Gene Literature Dashboard

Viewing November 2023 — 638 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← October 2023 December 2023 →
OLFM4
Also flagged:DeathGut Barrier Impairment After Strokestrokecerebral ischaemiafructosemetabolism
Journal Article 2023-11-30 ✓ 2 Snippets Prame Kumar K, McKay LD, Nguyen H, Kaur J, Wilson JL, Suthya AR, McKeown SJ, Abud HE, Wong CHY.
In-Text Gene Mentions

…(Fig. 3 a),Olfm4(Fig. 3 b),…

…of Bmi1 ,Olfm4, and Hes1…

Show Full Abstract

Tissue injury induced by stroke is traditionally thought to be localised to the brain. However, there is an accumulating body of evidence to demonstrate that stroke promotes pathophysiological consequences in peripheral tissues including the gastrointestinal system. In this study, we investigated the mechanisms underlying gut permeability after stroke. We utilised the clinically relevant experimental model of stroke called permanent intraluminal middle cerebral artery occlusion (pMCAO) to examine the effect of cerebral ischaemia on the gut. We detected stroke-induced gut permeability at 5 h after pMCAO. At this timepoint, we observed significantly elevated intestinal epithelial cell death in post-stroke mice compared to their sham-operated counterparts. At 24 h after stroke onset when the gut barrier integrity is restored, our findings indicated that post-stroke intestinal epithelium had higher expression of genes associated with fructose metabolism, and hyperplasia of intestinal crypts and goblet cells, conceivably as a host compensatory mechanism to adapt to the impaired gut barrier. Furthermore, we discovered that stroke-induced gut permeability was mediated by the activation of the sympathetic nervous system as pharmacological denervation decreased the stroke-induced intestinal epithelial cell death, goblet cell and crypt hyperplasia, and gut permeability to baseline levels. Our study identifies a previously unknown mechanism in the brain-gut axis by which stroke triggers intestinal cell death and gut permeability.

OLFM4
Also flagged:oral cancerpathogenesistumoursystemic diseasesPeriodontitisinflammatory disease
Journal Article 2023-11-30 ✓ 1 Snippet Ma Y, Yu Y, Yin Y, Wang L, Yang H, Luo S, Zheng Q, Pan Y, Zhang D.
In-Text Gene Mentions

OLFM4 is a potential biomarker for head and neck squamous cell carcinomas.

Show Full Abstract

With the increasing incidence of oral cancer in the world, it has become a hotspot to explore the pathogenesis and prevention of oral cancer. It has been proved there is a strong link between periodontal pathogens and oral cancer. However, the specific molecular and cellular pathogenic mechanisms remain to be further elucidated. Emerging evidence suggests that periodontal pathogens-induced epithelial-mesenchymal transition (EMT) is closely related to the progression of oral cancer. Cells undergoing EMT showed increased motility, aggressiveness and stemness, which provide a pro-tumour environment and promote malignant metastasis of oral cancer. Plenty of studies proposed periodontal pathogens promote carcinogenesis via EMT. In the current review, we discussed the association between the development of oral cancer and periodontal pathogens, and summarized various mechanisms of EMT caused by periodontal pathogens, which are supposed to play an important role in oral cancer, to provide targets for future research in the fight against oral cancer.

Also flagged:inflammatory diseasesNuclear factor kappa BNF-κBMitogen-activated protein kinaseMAPKJanus kinase
Journal Article 2023-11-30 No Snippets Ahsan T, Shoily SS, Ahmed T, Sajib AA.
Show Full Abstract

Persistent cellular stress induced perpetuation and uncontrolled amplification of inflammatory response results in a shift from tissue repair toward collateral damage, significant alterations of tissue functions, and derangements of homeostasis which in turn can lead to a large number of acute and chronic pathological conditions, such as chronic heart failure, atherosclerosis, myocardial infarction, neurodegenerative diseases, diabetes, rheumatoid arthritis, and cancer. Keeping the vital role of balanced inflammation in maintaining tissue integrity in mind, the way to combating inflammatory diseases may be through identification and characterization of mediators of inflammation that can be targeted without hampering normal body function. Pirin (PIR) is a non-heme iron containing protein having two different conformations depending on the oxidation state of the iron. Through exploration of the Pirin interactome and using molecular docking approaches, we identified that the Fe2+-bound Pirin directly interacts with BCL3, NFKBIA, NFIX and SMAD9 with more resemblance to the native binding pose and higher affinity than the Fe3+-bound form. In addition, Pirin appears to have a function in the regulation of inflammation, the transition between the canonical and non-canonical NF-κB pathways, and the remodeling of the actin cytoskeleton. Moreover, Pirin signaling appears to have a critical role in tumor invasion and metastasis, as well as metabolic and neuro-pathological complications. There are regulatory variants in PIR that can influence expression of not only PIR but also other genes, including VEGFD and ACE2. Disparity exists between South Asian and European populations in the frequencies of variant alleles at some of these regulatory loci that may lead to differential occurrence of Pirin-mediated pathogenic conditions.

Also flagged:TK1cell cycleBreast cancercancerThymidine Kinase 1tumor
Journal Article 2023-11-30 No Snippets Bitter EE, Skidmore J, Allen CI, Erickson RI, Morris RM, Mortimer T, Meade A, Brog R, Phares T, Townsend M, Pickett BE, O'Neill KL.
Show Full Abstract

Breast cancer is the most common cancer diagnosis worldwide accounting for 1 out of every 8 cancer diagnoses. The elevated expression of Thymidine Kinase 1 (TK1) is associated with more aggressive tumor grades, including breast cancer. Recent studies indicate that TK1 may be involved in cancer pathogenesis; however, its direct involvement in breast cancer has not been identified. Here, we evaluate potential pathogenic effects of elevated TK1 expression by comparing HCC 1806 to HCC 1806 TK1-knockdown cancer cells (L133). Transcriptomic profiles of HCC 1806 and L133 cells showed cell cycle progression, apoptosis, and invasion as potential pathogenic pathways affected by TK1 expression. Subsequent in-vitro studies confirmed differences between HCC 1806 and L133 cells in cell cycle phase progression, cell survival, and cell migration. Expression comparison of several factors involved in these pathogenic pathways between HCC 1806 and L133 cells identified p21 and AKT3 transcripts were significantly affected by TK1 expression. Creation of a protein-protein interaction map of TK1 and the pathogenic factors we evaluated predict that the majority of factors evaluated either directly or indirectly interact with TK1. Our findings argue that TK1 elevation directly increases HCC 1806 cell pathogenicity and is likely occurring by p21- and AKT3-mediated mechanisms to promote cell cycle arrest, cellular migration, and cellular survival.

PTGIS
Also flagged:membranemajor variant surface antigenerythrocyte membrane protein-1bindingIEhost cell
Journal Article 2023-11-30 ✓ 2 Snippets Othman B, Zeef L, Szestak T, Rchiad Z, Storm J, Askonas C, Satyam R, Madkhali A, Haley M, Wagstaff S, Couper K, Pain A, Craig A.
In-Text Gene Mentions

…prostacyclin (PLA2; PTGES;PTGIS; CYP1A1).…

…, procr ,ptgis, ptgs2 ,…

Show Full Abstract

The human malaria parasite Plasmodium falciparum is responsible for the majority of mortality and morbidity caused by malaria infection and differs from other human malaria species in the degree of accumulation of parasite-infected red blood cells in the microvasculature, known as cytoadherence or sequestration. In P. falciparum, cytoadherence is mediated by a protein called PfEMP1 which, due to its exposure to the host immune system, undergoes antigenic variation resulting in the expression of different PfEMP1 variants on the infected erythrocyte membrane. These PfEMP1s contain various combinations of adhesive domains, which allow for the differential engagement of a repertoire of endothelial receptors on the host microvasculature, with specific receptor usage associated with severe disease. We used a co-culture model of cytoadherence incubating human brain microvascular endothelial cells with erythrocytes infected with two parasite lines expressing different PfEMP1s that demonstrate different binding profiles to vascular endothelium. We determined the transcriptional profile of human brain microvascular endothelial cells (HBMEC) following different incubation periods with infected erythrocytes, identifying different transcriptional profiles of pathways previously found to be involved in the pathology of severe malaria, such as inflammation, apoptosis and barrier integrity, induced by the two PfEMP1 variants.

POU3F2
Also flagged:PHF3gene expressionRNA polymerase IIPol IIDeath-inducer obliterator 3PHD finger protein 3
Journal Article 2023-11-30 ✓ 2 Snippets Benedum J, Franke V, Appel LM, Walch L, Bruno M, Schneeweiss R, Gruber J, Oberndorfer H, Frank E, Strobl X, Polyansky A, Zagrovic B, Zagrovic B, Akalin A, Slade D.
In-Text Gene Mentions

…including Ascl1, Nestin,Pou3f2and Sox21 3…

…as Ascl1, Nestin,Pou3f2and Sox21 (Fig.…

Show Full Abstract

Transcription is regulated by a multitude of activators and repressors, which bind to the RNA polymerase II (Pol II) machinery and modulate its progression. Death-inducer obliterator 3 (DIDO3) and PHD finger protein 3 (PHF3) are paralogue proteins that regulate transcription elongation by docking onto phosphorylated serine-2 in the C-terminal domain (CTD) of Pol II through their SPOC domains. Here, we show that DIDO3 and PHF3 form a complex that bridges the Pol II elongation machinery with chromatin and RNA processing factors and tethers Pol II in a phase-separated microenvironment. Their SPOC domains and C-terminal intrinsically disordered regions are critical for transcription regulation. PHF3 and DIDO exert cooperative and antagonistic effects on the expression of neuronal genes and are both essential for neuronal differentiation. In the absence of PHF3, DIDO3 is upregulated as a compensatory mechanism. In addition to shared gene targets, DIDO specifically regulates genes required for lipid metabolism. Collectively, our work reveals multiple layers of gene expression regulation by the DIDO3 and PHF3 paralogues, which have specific, co-regulatory and redundant functions in transcription.

MLLT10
Also flagged:Dizzinessdeathvertigovertiginous syndromesvestibular disordershistone methyl transferase
Journal Article 2023-11-30 ✓ 4 Snippets Clifford R, Munro D, Dochtermann D, Devineni P, Pyarajan S, Million Veteran Program, Telese F, Palmer AA, Mohammadi P, Friedman R.
In-Text Gene Mentions

Fine mapping revealed credible sets of intronic single nucleotide polymorphisms (SNPs) in MLLT10 - a histone methyl transferase cofactor, BPTF - a subunit of a nucleosome remodeling complex implicated in neurodevelopment, and LINC01224 - a proto-oncogene receptor tyrosine kinase.<h4>Conclusion</h4>Despite the difficulties of phenotyping the nature of chronic imbalance, we replicated two loci from previous vertigo GWAS studies and identified three novel loci.

…polymorphisms (SNPs) inMLLT10- a histone…

…Identifies Loci ImplicatingMLLT10, BPTF, LINC01224 ,…

Mllt10

Show Full Abstract

<h4>Purpose</h4>Chronic age-related imbalance is a common cause of falls and subsequent death in the elderly and can arise from dysfunction of the vestibular system, an elegant neuroanatomical group of pathways that mediates human perception of acceleration, gravity, and angular head motion. Studies indicate that 27-46% of the risk of age-related chronic imbalance is genetic; nevertheless, the underlying genes remain unknown.<h4>Methods</h4>The cohort consisted of 50,339 cases and 366,900 controls in the Million Veteran Program. The phenotype comprised cases with two ICD diagnoses of vertigo or dizziness at least 6 months apart, excluding acute or recurrent vertiginous syndromes and other non-vestibular disorders. Genome-wide association studies were performed as individual logistic regressions on European, African American, and Hispanic ancestries followed by trans-ancestry meta-analysis. Downstream analysis included case-case-GWAS, fine mapping, probabilistic colocalization of significant variants and genes with eQTLs, and functional analysis of significant hits.<h4>Results</h4>Two significant loci were identified in Europeans, another in the Hispanic population, and two additional in trans-ancestry meta-analysis, including three novel loci. Fine mapping revealed credible sets of intronic single nucleotide polymorphisms (SNPs) in MLLT10 - a histone methyl transferase cofactor, BPTF - a subunit of a nucleosome remodeling complex implicated in neurodevelopment, and LINC01224 - a proto-oncogene receptor tyrosine kinase.<h4>Conclusion</h4>Despite the difficulties of phenotyping the nature of chronic imbalance, we replicated two loci from previous vertigo GWAS studies and identified three novel loci. Findings suggest candidates for further study and ultimate treatment of this common elderly disorder.

Also flagged:immune responseinfluenzaMyD88CD4interferon(IFN)-γ
Journal Article 2023-11-30 No Snippets Lee A, Floyd K, Wu S, Fang Z, Tan TK, Froggatt HM, Powers JM, Leist SR, Gully KL, Hubbard ML, Li C, Hui H, Scoville D, Ruggiero AD, Liang Y, Pavenko A, Lujan V, Baric RS, Nolan GP, Arunachalam PS, Suthar MS, Pulendran B.
Show Full Abstract

Bacille Calmette-Guérin (BCG) vaccination can confer nonspecific protection against heterologous pathogens. However, the underlying mechanisms remain mysterious. We show that mice vaccinated intravenously with BCG exhibited reduced weight loss and/or improved viral clearance when challenged with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2 B.1.351) or PR8 influenza. Protection was first evident between 14 and 21 d post-vaccination and lasted ∼3 months. Notably, BCG induced a biphasic innate response and robust antigen-specific type 1 helper T cell (T<sub>H</sub>1 cell) responses in the lungs. MyD88 signaling was essential for innate and T<sub>H</sub>1 cell responses, and protection against SARS-CoV-2. Depletion of CD4<sup>+</sup> T cells or interferon (IFN)-γ activity before infection obliterated innate activation and protection. Single-cell and spatial transcriptomics revealed CD4-dependent expression of IFN-stimulated genes in lung myeloid and epithelial cells. Notably, BCG also induced protection against weight loss after mouse-adapted SARS-CoV-2 BA.5, SARS-CoV and SHC014 coronavirus infections. Thus, BCG elicits integrated organ immunity, where CD4<sup>+</sup> T cells feed back on tissue myeloid and epithelial cells to imprint prolonged and broad innate antiviral resistance.

ZNF322
Also flagged:PSCAEFNA1DUpeptic ulcersHPALL
Journal Article 2023-11-30 ✓ 1 Snippet He Y, Koido M, Sutoh Y, Shi M, Otsuka-Yamasaki Y, Munter HM, BioBank Japan, Morisaki T, Nagai A, Murakami Y, Tanikawa C, Hachiya T, Matsuda K, Shimizu A, Kamatani Y.
In-Text Gene Mentions

…, PTGER4 ,ZNF322, HIATL1 ,…

Show Full Abstract

Peptic ulcer disease (PUD) refers to acid-induced injury of the digestive tract, occurring mainly in the stomach (gastric ulcer (GU)) or duodenum (duodenal ulcer (DU)). In the present study, we conducted a large-scale, cross-ancestry meta-analysis of PUD combining genome-wide association studies with Japanese and European studies (52,032 cases and 905,344 controls), and discovered 25 new loci highly concordant across ancestries. An examination of GU and DU genetic architecture demonstrated that GUs shared the same risk loci as DUs, although with smaller genetic effect sizes and higher polygenicity than DUs, indicating higher heterogeneity of GUs. Helicobacter pylori (HP)-stratified analysis found an HP-related host genetic locus. Integrative analyses using bulk and single-cell transcriptome profiles highlighted the genetic factors of PUD being enriched in the highly expressed genes in stomach tissues, especially in somatostatin-producing D cells. Our results provide genetic evidence that gastrointestinal cell differentiations and hormone regulations are critical in PUD etiology.

Also flagged:Extracellular vesiclesvenous thromboembolismpulmonary hypertensionPHright heart failuredeath
Journal Article 2023-11-30 No Snippets Zhang J, Hu X, Wang T, Xiao R, Zhu L, Ruiz M, Dupuis J, Hu Q.
Show Full Abstract

Venous thromboembolism (VTE) is a multifactorial disease, and pulmonary hypertension (PH) is a serious condition characterized by pulmonary vascular remodeling leading with increased pulmonary vascular resistance, ultimately leading to right heart failure and death. Although VTE and PH have distinct primary etiologies, they share some pathophysiologic similarities such as dysfunctional vasculature and thrombosis. In both conditions there is solid evidence that EVs derived from a variety of cell types including platelets, monocytes, endothelial cells and smooth muscle cells contribute to vascular endothelial dysfunction, inflammation, thrombosis, cellular activation and communications. However, the roles and importance of EVs substantially differ between studies depending on experimental conditions and parent cell origins of EVs that modify the nature of their cargo. Numerous studies have confirmed that EVs contribute to the pathophysiology of VTE and PH and increased levels of various EVs in relation with the severity of VTE and PH, confirming its potential pathophysiological role and its utility as a biomarker of disease severity and as potential therapeutic targets.

HFE
Also flagged:bindingcatalytic activitySTAT1Chronic mucocutaneous candidiasisCandida infectionmembranes
Journal Article 2023-11-30 ✓ 4 Snippets Stein D, Kars ME, Wu Y, Bayrak ÇS, Stenson PD, Cooper DN, Schlessinger A, Itan Y.
In-Text Gene Mentions

…LOF variants inHFE, namely, p.Cys282Tyr…

…neutral variants inHFE, p.Arg6Ser (rs149342416)…

…, p.Cys282Tyr inHFE, p.Trp620Arg in…

…Pathogenic variants inHFEare recognized as…

Show Full Abstract

Gain-of-function (GOF) variants give rise to increased/novel protein functions whereas loss-of-function (LOF) variants lead to diminished protein function. Experimental approaches for identifying GOF and LOF are generally slow and costly, whilst available computational methods have not been optimized to discriminate between GOF and LOF variants. We have developed LoGoFunc, a machine learning method for predicting pathogenic GOF, pathogenic LOF, and neutral genetic variants, trained on a broad range of gene-, protein-, and variant-level features describing diverse biological characteristics. LoGoFunc outperforms other tools trained solely to predict pathogenicity for identifying pathogenic GOF and LOF variants and is available at https://itanlab.shinyapps.io/goflof/ .

Also flagged:opioid use disordersubstance use disordersaddictionpsychiatric disordersimmune responsesopioid
Journal Article 2023-11-30 No Snippets Duffy EP, Bachtell RK, Ehringer MA.
Show Full Abstract

Opioid use disorder (OUD) is a worldwide public health crisis with few effective treatment options. Traditional genetics and neuroscience approaches have provided knowledge about biological mechanisms that contribute to OUD-related phenotypes, but the complexity and magnitude of effects in the brain and body remain poorly understood. The gut-brain axis has emerged as a promising target for future therapeutics for several psychiatric conditions, so characterizing the relationship between host genetics and the gut microbiome in the context of OUD will be essential for development of novel treatments. In this review, we describe evidence that interactions between host genetics, the gut microbiome, and immune signaling likely play a key role in mediating opioid-related phenotypes. Studies in humans and model organisms consistently demonstrated that genetic background is a major determinant of gut microbiome composition. Furthermore, the gut microbiome is susceptible to environmental influences such as opioid exposure. Additional work focused on gene by microbiome interactions will be necessary to gain improved understanding of their effects on OUD-related behaviors.

SERPINC1
Also flagged:Corticosteroid-binding globulinCBGcortisolproteolysisRCLglycans
Journal Article 2023-11-30 ✓ 2 Snippets Chernykh A, Abrahams JL, Grant OC, Kambanis L, Sumer-Bayraktar Z, Ugonotti J, Kawahara R, Corcilius L, Payne RJ, Woods RJ, Thaysen-Andersen M.
In-Text Gene Mentions

…(P08697, position P7),antithrombin-III(P01008, position P8),…

…, 50 ),antithrombin-III( 50 ),…

Show Full Abstract

Corticosteroid-binding globulin (CBG) delivers anti-inflammatory cortisol to inflamed tissues through proteolysis of an exposed reactive center loop (RCL) by neutrophil elastase (NE). We previously demonstrated that RCL-localized Asn347-linked N-glycans impact NE proteolysis, but a comprehensive structure-function characterization of the RCL glycosylation is still required to better understand CBG glycobiology. Herein, we first performed RCL-centric glycoprofiling of serum-derived CBG to elucidate the Asn347-glycans and then used molecular dynamics simulations to study their impact on NE proteolysis. Importantly, we also identified O-glycosylation (di/sialyl T) across four RCL sites (Thr338/Thr342/Thr345/Ser350) of serum CBG close to the NE-targeted Val344-Thr345 cleavage site. A restricted N- and O-glycan co-occurrence pattern on the RCL involving exclusively Asn347 and Thr338 glycosylation was experimentally observed and supported in silico by modeling of a CBG-GalNAc-transferase (GalNAc-T) complex with various RCL glycans. GalNAc-T2 and GalNAc-T3 abundantly expressed by liver and gall bladder, respectively, showed in vitro a capacity to transfer GalNAc (Tn) to multiple RCL sites suggesting their involvement in RCL O-glycosylation. Recombinant CBG was then used to determine roles of RCL O-glycosylation through longitudinal NE-centric proteolysis experiments, which demonstrated that both sialoglycans (disialyl T) and asialoglycans (T) decorating Thr345 inhibit NE proteolysis. Synthetic RCL O-glycopeptides expanded on these findings by showing that Thr345-Tn and Thr342-Tn confer strong and moderate protection against NE cleavage, respectively. Molecular dynamics substantiated that short Thr345-linked O-glycans abrogate NE interactions. In conclusion, we report on biologically relevant CBG RCL glycosylation events, which improve our understanding of mechanisms governing cortisol delivery to inflamed tissues.

HTT
Also flagged:XX-linked dystonia-parkinsonismneurodegenerative diseaseretrotransposonTATA-binding protein associated factor 1
Journal Article 2023-11-30 ✓ 2 Snippets Tshilenge KT, Bons J, Aguirre CG, Geronimo-Olvera C, Shah S, Rose J, Gerencser AA, Mak SK, Ehrlich ME, Bragg DC, Schilling B, Ellerby LM.
In-Text Gene Mentions

…Notably, theHTTprotein is part…

…green modules), includingHTT, SIN3A, CAPN2, CAPN1,…

Show Full Abstract

X-linked dystonia-parkinsonism (XDP) is a rare neurodegenerative disease endemic to the Philippines. The genetic cause for XDP is an insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32 of TATA-binding protein associated factor 1 (TAF1) that causes an alteration of TAF1 splicing, partial intron retention, and decreased transcription. Although TAF1 is expressed in all organs, medium spiny neurons (MSNs) within the striatum are one of the cell types most affected in XDP. To define how mutations in the TAF1 gene lead to MSN vulnerability, we carried out a proteomic analysis of human XDP patient-derived neural stem cells (NSCs) and MSNs derived from induced pluripotent stem cells. NSCs and MSNs were grown in parallel and subjected to quantitative proteomic analysis in data-independent acquisition mode on the Orbitrap Eclipse Tribrid mass spectrometer. Subsequent functional enrichment analysis demonstrated that neurodegenerative disease-related pathways, such as Huntington's disease, spinocerebellar ataxia, cellular senescence, mitochondrial function and RNA binding metabolism, were highly represented. We used weighted coexpression network analysis (WGCNA) of the NSC and MSN proteomic data set to uncover disease-driving network modules. Three of the modules significantly correlated with XDP genotype when compared to the non-affected control and were enriched for DNA helicase and nuclear chromatin assembly, mitochondrial disassembly, RNA location and mRNA processing. Consistent with aberrant mRNA processing, we found splicing and intron retention of TAF1 intron 32 in XDP MSN. We also identified TAF1 as one of the top enriched transcription factors, along with YY1, ATF2, USF1 and MYC. Notably, YY1 has been implicated in genetic forms of dystonia. Overall, our proteomic data set constitutes a valuable resource to understand mechanisms relevant to TAF1 dysregulation and to identify new therapeutic targets for XDP.

PCDH17
Also flagged:PBRM1WDR72NivolumabccRCCclear cell renal cell carcinomaGene Expression
Journal Article 2023-11-30 ✓ 2 Snippets Chang Q, Sun J, Zhao S, Li L, Zhang N, Yan L, Fan Y, Liu J.
In-Text Gene Mentions

It was also reported that hypermethylation in promoter region of several tumor suppression genes, such as PCDH17, NEFH, GREM1, GATA5, LAD1, NEFH, NEURL and SFRP1, was associated with poor survival of ccRCC patients [46–48].

…genes, such asPCDH17, NEFH, GREM1, GATA5,…

Show Full Abstract

<h4>Purpose</h4>Immune checkpoint therapy (ICT) provides a new idea for the treatment of advanced clear cell renal cell carcinoma (ccRCC), which can bring significant benefits to patients. However, the clinical application of ICT is limited because of the lack of predictive biomarkers to select potential responders. This study aims to propose a new biomarker to predict the response to Nivolumab in patients with ccRCC.<h4>Materials and methods</h4>The genes that significantly improve the prognosis of ccRCC were retrieved from The Cancer Genome Atlas (TCGA) database. The genomic and clinical data were from patients that had been registered in prospective clinical trials (CheckMate 009, CheckMate 010 and CheckMate 025). TCGA, Gene Expression Omnibus (GEO), and The Human Protein Atlas database were used to analyze the gene and protein expression of WD repeat-containing protein 72 (WDR72) in ccRCC. Gene Ontology (GO) & The Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Set Enrichment Analysis (GSEA) were performed to dig relevant mechanisms of WDR72. Single sample gene set enrichment analysis (ssGSEA) was conducted to evaluate the role of WDR72 in immune infiltration. Cell proliferation assay, FAO and ATP quantification were used to explore and verify the molecular mechanisms. The expression of WDR72, FOXP3, CD8, and CPT1A was examined by IHC in 20 advanced ccRCC tissue samples at the Urology Department of our hospital. The MethSurv was used to identify PBRM1 and WDR72 gene methylation and its effect on prognosis of ccRCC.<h4>Results</h4>WDR72 is the most significant gene for improving overall survival (OS) in ccRCC. In all three checkmates, OS and progression free survival (PFS) were found to be significantly higher in WDR72 high expression group than that in WDR72 low expression group (P=0.040 and P=0.012, respectively), and similar conclusions could be drawn from the PBRM1-mutation (MUT) compared with the PBRM1-wildtype (WT) (P=0.007 and P=0.006, respectively). What's more, high expression of WDR72 plus PBRM1-MUT as a combinatorial biomarker showed improved OS (HR=0.388, P=0.0026) and PFS (HR=0.39, P=0.0066) compared to low expression of WDR72 plus PBRM1-WT. Functional enrichment analysis showed that WDR72 was closely positively related to fatty acid degradation and fatty acid beta oxidation pathway in ccRCC. <i>In vitro</i> experiments showed that high expression of WDR72 can promote fatty acids oxidation and inhibit the proliferation of ccRCC cells. Immune analysis revealed that WDR72 high expression was associated with decreased infiltration of Treg cells and low ssGSEA score of check-point. IHC results showed that WDR72 was negatively correlated with FOXP3 expression (r=-0.506, P=0.023) and positively correlated with CPT1A expression (r=0.529, P=0.017).<h4>Conclusions</h4>The present study indicated that high expression of WDR72 may indicate a good prognosis of patients treated with Nivolumab and WDR72 expression combined with PBRM1 mutation could be more persuasive to predict the response for ICT in ccRCC patients.

DCC
Also flagged:Basosquamous carcinomabasal cell carcinomasquamous cell carcinomanonmelanoma skin cancersbasal cell carcinomascollision carcinoma
Journal Article 2023-11-30 ✓ 4 Snippets Murgia G, Denaro N, Boggio F, Nazzaro G, Benzecry V, Bortoluzzi P, Passoni E, Garrone O, Marzano A.
In-Text Gene Mentions

Additionally, these BSCs showed mutations commonly associated with BCC, including MYCN, PPP6C, GRIN2A, CSMD3, DCC, PREX2, APC, PTEN, and PIK3CA [38].

Various genetic drivers of BCC include PTEN, MYCN, PPP6C, GRIN2A, GLI1, CSMD3, DCC, PREX2, and APC [38,41,42].

…GRIN2A, GLI1, CSMD3,DCC, PREX2, and APC…

…PPP6C, GRIN2A, CSMD3,DCC, PREX2, APC, PTEN,…

Show Full Abstract

Basosquamous carcinoma (BSC), an uncommon and aggressive nonmelanoma skin cancer exhibiting characteristics ranging from basal cell carcinoma (BCC) to squamous cell carcinoma (SCC), is a subject of controversy in terms of its classification, pathogenesis, histologic morphology, biologic behavior, prognosis, and management. This narrative review is based on an electronic search of English-language articles in PubMed that included the terms "basosquamous carcinoma" and/or "metatypical carcinoma of the skin" in their titles. The review aims to succinctly present and assess current data on the epidemiology, clinical presentation, dermoscopic, LC-OCT, and histopathologic characteristics, as well as the genetics and management of BSC, providing insight into this intriguing entity. As a conclusion, dermoscopy, deep incisional biopsies, and immunohistologic techniques should be applied in clinically suspicious lesions to achieve an early diagnosis and better prognosis of this tumor. Surgical treatments, including wide excision and Mohs' micrographic surgery, remain the treatment of choice. Finally, Hedgehog pathway inhibitors and checkpoint inhibitors, must be thoroughly investigated with large controlled trials, since they may offer an alternative solution to irresectable or difficult-to-treat locally advanced cases of basosquamous carcinoma.

Also flagged:Krüppel-like Factor-13SPtranscriptional regulatorszinccarboxybinding
Journal Article 2023-11-30 No Snippets Simmen FA, Alhallak I, Simmen RCM.
Show Full Abstract

Specificity Proteins/Krüppel-like Factors (SP/KLF family) are a conserved family of transcriptional regulators. These proteins share three highly conserved, contiguous zinc fingers in their carboxy-terminus, requisite for binding to cis elements in DNA. Each SP/KLF protein has unique primary sequence within its amino-terminal and carboxy-terminal regions, and it is these regions which interact with co-activators, co-repressors, and chromatin-modifying proteins to support the transcriptional activation and repression of target genes. Krüppel-like Factor 9 (KLF9) and Krüppel-like Factor 13 (KLF13) are two of the smallest members of the SP/KLF family, are paralogous, emerged early in metazoan evolution, and are highly conserved. Paradoxically, while most similar in primary sequence, KLF9 and KLF13 display many distinct roles in target cells. In this article, we summarize the work that has identified the roles of KLF9 (and to a lesser degree KLF13) in tumor suppression or promotion via unique effects on differentiation, pro- and anti-inflammatory pathways, oxidative stress, and tumor immune cell infiltration. We also highlight the great diversity of miRNAs, lncRNAs, and circular RNAs which provide mechanisms for the ubiquitous tumor-specific suppression of KLF9 mRNA and protein. Elucidation of KLF9 and KLF13 in cancer biology is likely to provide new inroads to the understanding of oncogenesis and its prevention and treatments.

CACNA1E
Also flagged:Prostate Tumorprimary tumorphosphorylationprostate cancerprimary tumorstumor
Journal Article 2023-11-30 ✓ 3 Snippets Moreno CS, Winham CL, Alemozaffar M, Klein ER, Lawal IO, Abiodun-Ojo OA, Patil D, Barwick BG, Huang Y, Schuster DM, Sanda MG, Osunkoya AO.
In-Text Gene Mentions

We found that mutations were enriched in metastases over primary tumors for TP53 (q = 2 × 10−64), EYA1 (q = 2 × 10−9), CSMD3 (q = 6.1 × 10−6), MAP3K15 (q = 3.3 × 10−5), PIK3CD (q = 2.2 × 10−4), SLC16A14 (q = 1.4 × 10−3), FLT4 (q = 1.6 × 10−3), PCDH15 (q = 2.1 × 10−3), CACNA1E (q = 1.5 × 10−2), and NCOR2 (q = 1.9 × 10−2) by a Fisher exact test adjusted for false discovery (Figure 5A).

…SPOP, EYA1, NCOR2,CACNA1E, SOGA1, CSMD3, TP53,…

…10 −3 ),CACNA1E(q = 1.5…

Show Full Abstract

Prostate cancer is a highly heterogeneous disease and mortality is mainly due to metastases but the initial steps of metastasis have not been well characterized. We have performed integrative whole exome sequencing and transcriptome analysis of primary prostate tumor foci and corresponding lymph node metastases (LNM) from 43 patients enrolled in clinical trial. We present evidence that, while there are some cases of clonally independent primary tumor foci, 87% of primary tumor foci and metastases are descended from a common ancestor. We demonstrate that genes related to oxidative phosphorylation are upregulated in LNM and in African-American patients relative to White patients. We further show that mutations in <i>TP53</i>, <i>FLT4</i>, <i>EYA1</i>, <i>NCOR2</i>, <i>CSMD3</i>, and <i>PCDH15</i> are enriched in prostate cancer metastases. These findings were validated in a meta-analysis of 3929 primary tumors and 2721 metastases and reveal a pattern of molecular alterations underlying the pathology of metastatic prostate cancer. We show that LNM contain multiple subclones that are already present in primary tumor foci. We observed enrichment of mutations in several genes including understudied genes such as <i>EYA1</i>, <i>CSMD3</i>, <i>FLT4</i>, <i>NCOR2</i>, and <i>PCDH15</i> and found that mutations in <i>EYA1</i> and <i>CSMD3</i> are associated with a poor outcome in prostate cancer.

Also flagged:DiphyllinV-ATPasetumorarylnaphthalenelignan lactoneoxygen
Journal Article 2023-11-30 No Snippets Hou W, Huang LJ, Huang H, Liu SL, Dai W, Li ZM, Zhang ZY, Xin SY, Wang JY, Zhang ZY, Ouyang X, Lan JX.
Show Full Abstract

Natural products are treasure houses for modern drug discovery. Diphyllin is a natural arylnaphthalene lignan lactone isolated from the leaf of <i>Astilboides tabularis</i>. Studies have found that it possesses plenty of bioactivity characteristics. In this paper, we reviewed the structure, bioactivity, and mechanism of action of diphyllin and its derivatives. The references were obtained from PubMed, Web of Science, and Science Direct databases up to August 2023. Papers without a bio-evaluation were excluded. Diphyllin and its derivatives have demonstrated V-ATPase inhibition, anti-tumor, anti-virus, anti-biofilm, anti-inflammatory, and anti-oxidant activities. The most studied activities of diphyllin and its derivatives are V-ATPase inhibition, anti-tumor activities, and anti-virus activities. Furthermore, V-ATPase inhibition activity is the mechanism of many bioactivities, including anti-tumor, anti-virus, and anti-inflammatory activities. We also found that the galactosylated modification of diphyllin is a common phenomenon in plants, and therefore, galactosylated modification is applied by researchers in the laboratory to obtain more excellent diphyllin derivatives. This review will provide useful information for the development of diphyllin-based anti-tumor and anti-virus compounds.

Also flagged:SynthesisInfectious diseasesampicillinTriazolopyrazinetriazolo[4
Journal Article 2023-11-30 No Snippets Hu Z, Dong H, Si Z, Zhao Y, Liang Y.
Show Full Abstract

Infectious diseases pose a major challenge to human health, and there is an urgent need to develop new antimicrobial agents with excellent antibacterial activity. A series of novel triazolo[4,3-<i>a</i>]pyrazine derivatives were synthesized and their structures were characterized using various techniques, such as melting point, <sup>1</sup>H and <sup>13</sup>C nuclear magnetic resonance spectroscopy, mass spectrometry, and elemental analysis. All the synthesized compounds were evaluated for in vitro antibacterial activity using the microbroth dilution method. Among all the tested compounds, some showed moderate to good antibacterial activities against both Gram-positive <i>Staphylococcus aureus</i> and Gram-negative <i>Escherichia coli</i> strains. In particular, compound <b>2e</b> exhibited superior antibacterial activities (MICs: 32 μg/mL against <i>Staphylococcus aureus</i> and 16 μg/mL against <i>Escherichia coli</i>), which was comparable to the first-line antibacterial agent ampicillin. In addition, the structure-activity relationship of the triazolo[4,3-<i>a</i>]pyrazine derivatives was preliminarily investigated.

Also flagged:InstabilityGastric CancerTumorgastric cancerstumorsCIN
Journal Article 2023-11-30 No Snippets Nemtsova MV, Kuznetsova EB, Bure IV.
Show Full Abstract

According to the Cancer Genome Atlas (TCGA), gastric cancers are classified into four molecular subtypes: Epstein-Barr virus-positive (EBV+), tumors with microsatellite instability (MSI), tumors with chromosomal instability (CIN), and genomically stable (GS) tumors. However, the gastric cancer (GC) with chromosomal instability remains insufficiently described and does not have effective markers for molecular and histological verification and diagnosis. The CIN subtype of GC is characterized by chromosomal instability, which is manifested by an increased frequency of aneuploidies and/or structural chromosomal rearrangements in tumor cells. Structural rearrangements in the CIN subtype of GC are not accidental and are commonly detected in chromosomal loci, being abnormal because of specific structural organization. The causes of CIN are still being discussed; however, according to recent data, aberrations in the <i>TP53</i> gene may cause CIN development or worsen its phenotype. Clinically, patients with the CIN subtype of GC demonstrate poor survival, but receive the maximum benefit from adjuvant chemotherapy. In the review, we consider the molecular mechanisms and possible causes of chromosomal instability in GC, the common rearrangements of chromosomal loci and their impact on the development and clinical course of the disease, as well as the driver genes, their functions, and perspectives on their targeting in the CIN subtype of GC.

Also flagged:compoundspolycyclic aromatic hydrocarbonslung cancerregulation ofgene expressionResponse to
Journal Article 2023-11-30 No Snippets Letelier P, Saldías R, Loren P, Riquelme I, Guzmán N.
Show Full Abstract

Exposure to atmospheric air pollution containing volatile organic compounds such as polycyclic aromatic hydrocarbons (PAHs) has been shown to be a risk factor in the induction of lung inflammation and the initiation and progression of lung cancer. MicroRNAs (miRNAs) are small single-stranded non-coding RNA molecules of ~20-22 nucleotides that regulate different physiological processes, and their altered expression is implicated in various pathophysiological conditions. Recent studies have shown that the regulation of gene expression of miRNAs can be affected in diseases associated with outdoor air pollution, meaning they could also be useful as biomarkers of exposure to environmental pollution. In this article, we review the published evidence on miRNAs in relation to exposure to PAH pollution and discuss the possible mechanisms that may link these compounds with the expression of miRNAs.

SOX6
Also flagged:MYCIGFBP5IGFBP2MYH4FGF6IGFs
Journal Article 2023-11-30 ✓ 1 Snippet Wei Y, Guo D, Bai Y, Liu Z, Li J, Chen Z, Shi B, Zhao Z, Hu J, Han X, Wang J, Liu X, Li S, Zhao F.
In-Text Gene Mentions

…trans-regulation control overSOX6to suppress miR-29b…

Show Full Abstract

The production performance of Jeryak, resulting from the F1 generation of the cross between Gannan yak and Jersey cattle, exhibits a significantly superior outcome compared with that of Gannan yak. Therefore, we used an RNA-seq approach to identify differentially expressed mRNAs (DEMs) and differentially expressed lncRNAs (DELs) influencing muscle growth and development in Gannan yaks and Jeryaks. A total of 304 differentially expressed lncRNAs and 1819 differentially expressed mRNAs were identified based on the screening criteria of |log 2 FC| > 1 and FDR < 0.05. Among these, 132 lncRNAs and 1081 mRNAs were found to be down-regulated, while 172 lncRNAs and 738 mRNAs were up-regulated. GO and KEGG analyses showed that the identified DELs and DEMs were enriched in the entries of pathways associated with muscle growth and development. On this basis, we constructed an lncRNA-mRNA interaction network. Interestingly, two candidate DELs (MSTRG.16260.9 and MSTRG.22127.1) had targeting relationships with 16 (<i>MYC</i>, <i>IGFBP5</i>, <i>IGFBP2</i>, <i>MYH4</i>, <i>FGF6</i>, etc.) genes related to muscle growth and development. These results could provide a basis for further studies on the roles of lncRNAs and mRNAs in muscle growth in Gannan yaks and Jeryak breeds.

Also flagged:chronic heart failureCHFdeathHeart failureOverweightobesity
Journal Article 2023-11-30 No Snippets Nguyen HTT, Ha TTT, Tran HB, Nguyen DV, Pham HM, Tran PM, Pham TM, Allison TG, Reid CM, Kirkpatrick JN.
Show Full Abstract

<h4>Background</h4>Insufficient data exists regarding the relationship between body mass index (BMI) and the prognosis of chronic heart failure (CHF) specifically within low- and middle-income Asian countries. The objective of this study was to evaluate the impact of BMI on adverse outcomes of ambulatory patients with CHF in Vietnam.<h4>Methods</h4>Between 2018 and 2020, we prospectively enrolled consecutive outpatients with clinically stable CHF in an observational cohort, single-center study. The participants were stratified according to Asian-specific BMI thresholds. The relationships between BMI and adverse outcomes (all-cause death and all-cause hospitalization) were analyzed by Kaplan-Meier survival curves and Cox proportional-hazards model.<h4>Results</h4>Among 320 participants (age 63.5 ± 13.3 years, 57.9% male), the median BMI was 21.4 kg/m<sup>2</sup> (IQR 19.5-23.6), and 10.9% were underweight (BMI <18.50 kg/m<sup>2</sup>). Over a median follow-up time of 32 months, the cumulative incidence of all-cause mortality and hospitalization were 5.6% and 19.1%, respectively. After multivariable adjustment, underweight patients had a significantly higher risk of all-cause mortality than patients with normal BMI (adjusted hazard ratios = 3.03 [95% CI: 1.07-8.55]). Lower BMI remained significantly associated with a worse prognosis when analyzed as a continuous variable (adjusted hazard ratios = 1.27 [95% CI: 1.03-1.55] per 1 kg/m<sup>2</sup> decrease for all-cause mortality). However, BMI was not found to be significantly associated with the risk of all-cause hospitalization (<i>p</i> > 0.05).<h4>Conclusion</h4>In ambulatory patients with CHF in Vietnam, lower BMI, especially underweight status (BMI < 18.5 kg/m<sup>2</sup>), was associated with a higher risk of all-cause mortality. These findings suggest that BMI should be considered for use in risk classification, and underweight patients should be managed by a team consisting of cardiologists, nutritionists, and geriatricians.

Also flagged:thrombinserine proteasepeptideamino acidserine proteasesphenylmethylsulfonyl
Journal Article 2023-11-30 No Snippets Vilca-Quispe A, Alvarez-Risco A, Gomes Heleno MA, Ponce-Fuentes EA, Vera-Gonzales C, Zegarra-Aragon HFE, Aquino-Puma JL, Talavera-Núñez ME, Del-Aguila-Arcentales S, Yáñez JA, Ponce-Soto LA.
Show Full Abstract

<b>Objective:</b> The current study's objective is to characterize a new throm-bin-like enzyme called TLBro that was obtained from <i>Bothrops roedingeris</i> snake from a biochemical and hemostatic perspective. <b>Methodology:</b> One chromatographic step was used to purify it, producing the serine protease TLBro. Molecular mass was estimated by SDS-PAGE to be between reduced and unreduced by 35 kDa. Tryptic peptide sequencing using Swiss Prot provided the complete amino acid sequence. Expasy.org by conducting a search that is limited to Crotalinae snake serine proteases and displaying a high degree of amino acid sequence. <b>Results:</b> Ser (182) is inhibited by phenylmethylsulfonyl fluoride (PMSF), and TLBro demonstrated the presence of Asp (88) residues. It also deduced the positions of His (43) and Ser (182) in the set of three coordinated amino acids in serine proteases. It was discovered that this substrate had high specificity for BANA, Michaelis-Menten behavior with KM 0 point85 mM and Vmax 1 point89 nmoles -NA/L/min, and high stability between temperatures (15 to 70°C) and pHs (2 point0 to 10 point0). According to doses and incubation times, TLBro degraded fibrin preferentially on the B-chain; additionally, its activities were significantly diminished after preincubation with divalent ions (Zn<sub>2</sub> and Cd<sub>2</sub>). When incubated with PMSF, a particular serine protease inhibitor, enzymatic activities and platelet aggregation were inhibited. <b>Conclusion:</b> The findings revealed distinct structural and functional differences between the serine proteases, adding to the information and assisting in the improvement of the structure-function relationship.

Also flagged:protein expressiongene expressionmethylationchromatinhistonemodifications
Journal Article 2023-11-30 No Snippets Mavaie P, Holder L, Skinner M.
Show Full Abstract

Exposure to environmental toxicants can lead to epimutations in the genome and an increase in differential DNA methylated regions (DMRs) that have been linked to increased susceptibility to various diseases. However, the unique effect of particular toxicants on the genome in terms of leading to unique DMRs for the toxicants has been less studied. One hurdle to such studies is the low number of observed DMRs per toxicants. To address this hurdle, a previously validated hybrid deep-learning cross-exposure prediction model is trained per exposure and used to predict exposure-specific DMRs in the genome. Given these predicted exposure-specific DMRs, a set of unique DMRs per exposure can be identified. Analysis of these unique DMRs through visualization, DNA sequence motif matching, and gene association reveals known and unknown links between individual exposures and their unique effects on the genome. The results indicate the potential ability to define exposure-specific epigenetic markers in the genome and the potential relative impact of different exposures. Therefore, a computational approach to predict exposure-specific transgenerational epimutations was developed, which supported the exposure specificity of ancestral toxicant actions and provided epigenome information on the DMR sites predicted.

Also flagged:Sulfonic AcidSilicasynthesiscarbonylarenesarene
Journal Article 2023-11-30 No Snippets Singh S, Kumar A, Nebhani L, Hazra CK.
Show Full Abstract

The development of general and more sustainable heterogeneous catalytic processes for Friedel-Crafts (FC) alkylation reactions is a key objective of interest for the synthesis of pharmaceuticals and commodity chemicals. Sustainable heterogeneous catalysis for the typical FC alkylation of an easily accessible carbonyl electrophile and arenes or with two different arene nucleophiles in one-pot is a prime challenge. Herein, we present a resolution to these issues through the design and utilization of a mesoporous silica catalyst that has been functionalized with sulfonic acid. For the synthesis of sulfonic acid-functionalized mesoporous silica (MSN-SO<sub>3</sub>H), thiol-functionalized mesoporous silica was first synthesized by the co-condensation method, followed by oxidation of the thiol functionality to the sulfonic acid group. Sulfonation of mesoporous silica was confirmed by <sup>13</sup>C CP MAS NMR spectroscopy. Further, the devised heterogeneous catalysis using MSN-SO<sub>3</sub>H has been successfully employed in the construction of diverse polyalkanes including various bioactive molecules, viz arundine, tatarinoid-C, and late-stage functionalization of natural products like menthol and Eugenol. Further, we have utilized this sustainable technique to facilitate the formation of unsymmetrical C-S bonds in a one-pot fashion. In addition, the catalyst was successfully recovered and recycled for eight cycles, demonstrating the high sustainability and cost-effectiveness of this protocol for both academic and industrial applications.

HFE
Also flagged:Guillain-Barré Syndromeimmune-mediated disease of thenervousrespiratory infectionascending flaccid paralysisdisc herniation
Journal Article 2023-11-30 ✓ 1 Snippet Zaka A, Dehkordi O, Weir R, Oyawusi M, Millis RM.
In-Text Gene Mentions

…tis, medication-related (IVIG)hemochromatosis, and Wilson disease.…

Show Full Abstract

Guillain-Barré syndrome (GBS), an immune-mediated disease of the peripheral nervous system, is mainly characterized by rapidly progressive ascending weakness of the limbs with reduced or absent deep tendon reflexes. The exact cause of GBS is unknown, but it often occurs after a gastrointestinal or respiratory infection. The present study represents a case of GBS in which multiple antecedent antigenic stimuli may have contributed to the development of GBS. The patient, a 28-year-old immunocompetent man with no significant medical history, presented to the emergency department (ED) with acute ascending flaccid paralysis that persisted for a few days. His initial symptoms included tingling in his legs, which started at his shin and calf and developed into numbness, which extended to his upper limbs and arms. A CT scan of the lumbar and cervical spine indicated minor L4-L5 and L5-S1 disc herniation as well as slight bulging in C5-C6 and C7. The patient was discharged but returned to the ED for urgent treatment the next day after he weakened rapidly, losing the ability to walk or maintain balance. Based on his clinical presentation of ascending weakness and generalized hyporeflexia, he was diagnosed with GBS. Abnormal liver function and positive blood tests for anti-cytomegalovirus (anti-CMV) and anti-Epstein-Barr virus (anti-EBV) IgG and IgM antibodies diagnosed hepatitis, CMV, and EBV, respectively. The patient was treated with intravenous immunoglobulin therapy (IVIG; 27 g/day) and antiviral medicine (ganciclovir; 340 mg IV/day) for five days. His nonexistent deep tendon reflexes began to improve two to three days following treatment. He was able to ambulate longer distances with a walker, and his upper extremities regained full strength. This case highlights the importance of a multiple-treatment approach to the treatment of GBS, wherein multiple antigenic triggering factors may be involved.

OLFM4
Also flagged:solute carrier transporterstumorsolute carrier (SLC) transportersSLCSLC transporterscolon cancer
Journal Article 2023-11-30 ✓ 2 Snippets Zhou R, Li L, Zhang Y, Liu Z, Wu J, Zeng D, Sun H, Liao W.
In-Text Gene Mentions

…Fig. 3 G),OLFM4+ stem cells…

…cell subtype 2,OLFM4+ stem cells,…

Show Full Abstract

Recent findings have suggested that solute carrier (SLC) transporters play an important role in tumor development and progression, and alterations in the expression of individual SLC genes are critical for fulfilling the heightened metabolic requirements of cancerous cells. However, the global influence of the co-expression pattern of SLC transporters on the clinical stratification and characteristics of the tumor microenvironment (TME) remains unexplored. In this study, we identified five SLC gene subtypes based on transcriptome co-expression patterns of 187 SLC transporters by consensus clustering analysis. These subtypes, which were characterized by distinct TME and biological characteristics, were successfully employed for prognostic and chemotherapy response prediction in colon cancer patients, as well as demonstrated associations with immunotherapy benefits. Then, we generated an SLC score model comprising 113 genes to quantify SLC gene co-expression patterns and validated it as an independent prognostic factor and drug response predictor in several independent colon cancer cohorts. Patients with a high SLC score possessed distinct characteristics of copy number variation, genomic mutations, DNA methylation, and indicated an SLC-S2 subtype, which was characterized by strong stromal cell infiltration, stromal pathway activation, poor prognosis, and low predicted fluorouracil and immunotherapeutic responses. Furthermore, the analysis of the Cancer Therapeutics Response Portal database revealed that inhibitors targeting PI3K catalytic subunits could serve as promising chemosensitizing agents for individuals exhibiting high SLC scores. In conclusion, the co-expression patterns of SLC transporters aided the disease classification, and the SLC score proved to be a reliable tool for distinguishing SLC gene subtypes and guiding precise treatment in patients with colon cancer.

Also flagged:bindingorganizationglucosealbumininsulinglucagon
Journal Article 2023-11-30 No Snippets de Hoyos-Vega JM, Gonzalez-Suarez AM, Cedillo-Alcantar DF, Stybayeva G, Matveyenko A, Malhi H, Garcia-Cordero JL, Revzin A.
Show Full Abstract

A common challenge in microfluidic cell cultures has to do with analysis of cell function without replacing a significant fraction of the culture volume and disturbing local concentration gradients of signals. To address this challenge, we developed a microfluidic cell culture device with an integrated bioanalysis unit to enable on-chip analysis of picoliter volumes of cell-conditioned media. The culture module consisted of an array of 140 microwells with a diameter of 300 m which were made low-binding to promote organization of cells into 3D spheroids. The bioanalysis module contained a droplet generator unit, 15 micromechanical valves and reservoirs loaded with reagents. Each 0.8 nL droplet contained an aliquot of conditioned media mixed with assay reagents. The use of microvalves allowed us to load enzymatic assay and immunoassay into sequentially generated droplets for detection of glucose and albumin, respectively. As a biological application of the microfluidic device, we evaluated hormonal stimulation and glucose consumption of hepatic spheroids. To mimic physiological processes occurring during feeding and fasting, hepatic spheroids were exposed to pancreatic hormones, insulin or glucagon. The droplet-based bioanalysis module was used to measure uptake or release of glucose upon hormonal stimulation. In the future, we intend to use this microfluidic device to mimic and measure pathophysiological processes associated with hepatic insulin resistance and diabetes in the context of metabolic syndrome.

Also flagged:KMT2Aacute myeloid leukemia
Journal Article 2023-11-30 No Snippets Conneely SE, Rau RE.
Show Full Abstract

No abstract available.

Also flagged:gene expressionTGFB1deathcell divisionhematopoiesisNeu
Journal Article 2023-11-30 No Snippets Sha Y, Qiu Y, Zhou P, Nie Q.
Show Full Abstract

Time-series single-cell RNA sequencing (scRNA-seq) datasets provide unprecedented opportunities to learn dynamic processes of cellular systems. Due to the destructive nature of sequencing, it remains challenging to link the scRNA-seq snapshots sampled at different time points. Here we present TIGON, a dynamic, unbalanced optimal transport algorithm that reconstructs dynamic trajectories and population growth simultaneously as well as the underlying gene regulatory network from multiple snapshots. To tackle the high-dimensional optimal transport problem, we introduce a deep learning method using a dimensionless formulation based on the Wasserstein-Fisher-Rao (WFR) distance. TIGON is evaluated on simulated data and compared with existing methods for its robustness and accuracy in predicting cell state transition and cell population growth. Using three scRNA-seq datasets, we show the importance of growth in the temporal inference, TIGON's capability in reconstructing gene expression at unmeasured time points and its applications to temporal gene regulatory networks and cell-cell communication inference.

HTT
Also flagged:prostate canceroncological diseaseanxiety disordersdepressionanxietyurologic cancers
Journal Article 2023-11-30 ✓ 1 Snippet Severo M, Ventriglio A, Bhugra D, Petito A.
In-Text Gene Mentions

The S/S version may lead to a reduction of serotonin transporter expression in the brain and has been associated with changes in individual response to stress, increased risk of depressive disorders, and specific temperamental traits.[29, 30] Neuroticism is one of the most studied personality traits, and it has been correlated with the expression of 5-HTT polymorphisms.[31, 32] More specifically, Kim and colleagues have found a significant association between the short variant of the 5-HTTLPR genotype and depressive symptoms in patients suffering from breast cancer.[33] More recently, Iuso and colleagues suggested that the association between 5-HTTLPR polymorphism and neuroticism may identify cancer patients with a higher risk of mood disorders.[25]

Show Full Abstract

Prostate cancer is a common oncological disease of old age with the highest rates of incidence among males older than 65 years old. Diagnosis and treatment may be associated with the onset of adjustment, depressive, and anxiety disorders. The comorbidity with depression and anxiety may lead to a higher risk of suicide, and mortality as well as lower adherence to medical treatments and adverse functional outcomes in patients affected by urologic cancers. The role of genetic vulnerability and pre-morbid personality in predicting the development of mental disorders during cancer disease is debated. For instance, some genetic polymorphisms of the serotonin transporter-related promoter region (5-HTTLPR polymorphism) are associated with higher vulnerability for mental disorders as well as personality traits of neuroticism; both factors are potentially useful for identifying risk of depressive and anxious symptoms among cancer patients. This communication proposes the development of individualized psychobiological approaches to identify possible <i>'psychobiological'</i> markers associated with the risk of mental disorders in prostate cancer patients.

DCC
Also flagged:secretionTattype VIhost cellsmembranecytoplasmic
Journal Article 2023-11-29 ✓ 1 Snippet Ramamoorthy S, Pena M, Ghosh P, Liao Y-Y, Paret M, Jones JB, Potnis N.
In-Text Gene Mentions

…protein DsbA/DsbL andthiol-disulfide oxidoreductase DCCoxidoreductase DCC family…

Show Full Abstract

<h4>Importance</h4>T6SS has received attention due to its significance in mediating interorganismal competition through contact-dependent release of effector molecules into prokaryotic and eukaryotic cells. Reverse-genetic studies have indicated the role of T6SS in virulence in a variety of plant pathogenic bacteria, including the one studied here, <i>Xanthomonas</i>. However, it is not clear whether such effect on virulence is merely due to a shift in the microbiome-mediated protection or if T6SS is involved in a complex virulence regulatory network. In this study, we conducted in vitro transcriptome profiling in minimal medium to decipher the signaling pathways regulated by tssM-i3* in <i>X. perforans</i> AL65. We show that TssM-i3* regulates the expression of a suite of genes associated with virulence and metabolism either directly or indirectly by altering the transcription of several regulators. These findings further expand our knowledge on the intricate molecular circuits regulated by T6SS in phytopathogenic bacteria.

LRRC7
Also flagged:CENP-CchromosomecentromerekinetochoremitosisCENP-A
Journal Article 2023-11-29 ✓ 3 Snippets Fellmeth JE, Jang JK, Persaud M, Sturm H, Changela N, Parikh A, McKim KS.
In-Text Gene Mentions

…oocytes depleted ofCondensinsubunits.…

…and kinetochore together:Condensin/Top II maintains…

…also shown thatCondensin, along with Topoisomerase…

Show Full Abstract

The centromere is an epigenetic mark that is a loading site for the kinetochore during meiosis and mitosis. This mark is characterized by the H3 variant CENP-A, known as CID in Drosophila. In Drosophila, CENP-C is critical for maintaining CID at the centromeres and directly recruits outer kinetochore proteins after nuclear envelope break down. These two functions, however, happen at different times in the cell cycle. Furthermore, in Drosophila and many other metazoan oocytes, centromere maintenance and kinetochore assembly are separated by an extended prophase. We have investigated the dynamics of function of CENP-C during the extended meiotic prophase of Drosophila oocytes and found that maintaining high levels of CENP-C for metaphase I requires expression during prophase. In contrast, CID is relatively stable and does not need to be expressed during prophase to remain at high levels in metaphase I of meiosis. Expression of CID during prophase can even be deleterious, causing ectopic localization to non-centromeric chromatin, abnormal meiosis and sterility. CENP-C prophase loading is required for multiple meiotic functions. In early meiotic prophase, CENP-C loading is required for sister centromere cohesion and centromere clustering. In late meiotic prophase, CENP-C loading is required to recruit kinetochore proteins. CENP-C is one of the few proteins identified in which expression during prophase is required for meiotic chromosome segregation. An implication of these results is that the failure to maintain recruitment of CENP-C during the extended prophase in oocytes would result in chromosome segregation errors in oocytes.

CDK5RAP1
Also flagged:HIF-2αcancerleptin receptortranscription factorhypoxia-inducible factor-2αto radiation
Journal Article 2023-11-29 ✓ 1 Snippet Guo W, Hoque J, Garcia Garcia CJ, Spiller KV, Leinroth AP, Puviindran V, Potnis CK, Gunn KA, Newman H, Ishikawa K, Fujimoto TN, Neill DW, Delahoussaye AM, Williams NT, Kirsch DG, Hilton MJ, Varghese S, Taniguchi CM, Wu C.
In-Text Gene Mentions

Cdk5rap1

Show Full Abstract

Radiotherapy remains a common treatment modality for cancer despite skeletal complications. However, there are currently no effective treatments for radiation-induced bone loss, and the consequences of radiotherapy on skeletal progenitor cell (SPC) survival and function remain unclear. After radiation, leptin receptor-expressing cells, which include a population of SPCs, become localized to hypoxic regions of the bone and stabilize the transcription factor hypoxia-inducible factor-2α (HIF-2α), thus suggesting a role for HIF-2α in the skeletal response to radiation. Here, we conditionally knocked out HIF-2α in leptin receptor-expressing cells and their descendants in mice. Radiation therapy in littermate control mice reduced bone mass; however, HIF-2α conditional knockout mice maintained bone mass comparable to nonirradiated control animals. HIF-2α negatively regulated the number of SPCs, bone formation, and bone mineralization. To test whether blocking HIF-2α pharmacologically could reduce bone loss during radiation, we administered a selective HIF-2α inhibitor called PT2399 (a structural analog of which was recently FDA-approved) to wild-type mice before radiation exposure. Pharmacological inhibition of HIF-2α was sufficient to prevent radiation-induced bone loss in a single-limb irradiation mouse model. Given that ~90% of patients who receive a HIF-2α inhibitor develop anemia because of off-target effects, we developed a bone-targeting nanocarrier formulation to deliver the HIF-2α inhibitor to mouse bone, to increase on-target efficacy and reduce off-target toxicities. Nanocarrier-loaded PT2399 prevented radiation-induced bone loss in mice while reducing drug accumulation in the kidney. Targeted inhibition of HIF-2α may represent a therapeutic approach for protecting bone during radiation therapy.

Also flagged:cell adhesion moleculesynapsepsychiatric diseaseneuropsychiatric illnessautismschizophrenia
Journal Article 2023-11-29 No Snippets Clarin JD, Reddy N, Alexandropoulos C, Gao WJ.
Show Full Abstract

Understanding perturbations in synaptic function between health and disease states is crucial to the treatment of neuropsychiatric illness. While genome-wide association studies have identified several genetic loci implicated in synaptic dysfunction in disorders such as autism and schizophrenia, many have not been rigorously characterized. Here, we highlight immunoglobulin superfamily member 9b (IgSF9b), a cell adhesion molecule thought to localize exclusively to inhibitory synapses in the brain. While both pre-clinical and clinical studies suggest its association with psychiatric diseases, our understanding of IgSF9b in synaptic maintenance, neural circuits, and behavioral phenotypes remains rudimentary. Moreover, these functions wield undiscovered influences on neurodevelopment. This review evaluates current literature and publicly available gene expression databases to explore the implications of IgSF9b dysfunction in rodents and humans. Through a focused analysis of one high-risk gene locus, we identify areas requiring further investigation and unearth clues related to broader mechanisms contributing to the synaptic etiology of psychiatric disorders.

Also flagged:Diabetesalcohol dehydrogenase-4nogo receptorinterleukin-1 receptordeathobesity
Journal Article 2023-11-29 No Snippets Goudswaard LJ, Smith ML, Hughes DA, Taylor R, Lean M, Sattar N, Welsh P, McConnachie A, Blazeby JM, Rogers CA, Suhre K, Zaghlool SB, Hers I, Timpson NJ, Corbin LJ.
Show Full Abstract

Thousands of proteins circulate in the bloodstream; identifying those which associate with weight and intervention-induced weight loss may help explain mechanisms of diseases associated with adiposity. We aimed to identify consistent protein signatures of weight loss across independent studies capturing changes in body mass index (BMI). We analysed proteomic data from studies implementing caloric restriction (Diabetes Remission Clinical trial) and bariatric surgery (By-Band-Sleeve), using SomaLogic and Olink Explore1536 technologies, respectively. Linear mixed models were used to estimate the effect of the interventions on circulating proteins. Twenty-three proteins were altered in a consistent direction after both bariatric surgery and caloric restriction, suggesting that these proteins are modulated by weight change, independent of intervention type. We also integrated Mendelian randomisation (MR) estimates of the effect of BMI on proteins measured by SomaLogic from a UK blood donor cohort as a third line of causal evidence. These MR estimates provided further corroborative evidence for a role of BMI in regulating the levels of six proteins including alcohol dehydrogenase-4, nogo receptor and interleukin-1 receptor antagonist protein. These results indicate the importance of triangulation in interrogating causal relationships; further study into the role of proteins modulated by weight in disease is now warranted.

PTGIS
Also flagged:endocrine homeostasisestrogenprogesteroneOvarian dysfunctionprimary ovarian insufficiencymenopause
Journal Article 2023-11-29 ✓ 2 Snippets Birgersson M, Indukuri R, Lindquist L, Stepanauskaite L, Luo Q, Deng Q, Archer A, Williams C.
In-Text Gene Mentions

Their gene products, in addition to the enzymes that directly impact estrogen synthesis (Cyp11a1, Hsd17b1), also included proteins involved in cholesterol metabolism and steroidogenesis (e.g., Cyp27a1, Fdps, Fdxr, Hmgcs1, Lrp8, Lrp11), as well as in prostaglandin synthesis and fatty acid synthesis/elongation pathways (e.g., Ptgis, Fasn, Lep, Cds1, Hgpd, Acacb) which can impact steroidogenesis.

…sis/elongation pathways (e.g.,Ptgis, Fasn, Lep, Cds1,…

Show Full Abstract

<h4>Background</h4>Estrogen receptor beta (ERβ, Esr2) plays a pivotal role in folliculogenesis and ovulation, yet its exact mechanism of action is mainly uncharacterized.<h4>Results</h4>We here performed ERβ ChIP-sequencing of mouse ovaries followed by complementary RNA-sequencing of wild-type and ERβ knockout ovaries. By integrating the ERβ cistrome and transcriptome, we identified its direct target genes and enriched biological functions in the ovary. This demonstrated its strong impact on genes regulating organism development, cell migration, lipid metabolism, response to hypoxia, and response to estrogen. Cell-type deconvolution analysis of the bulk RNA-seq data revealed a decrease in luteal cells and an increased proportion of theca cells and a specific type of cumulus cells upon ERβ loss. Moreover, we identified a significant overlap with the gene regulatory network of liver receptor homolog 1 (LRH-1, Nr5a2) and showed that ERβ and LRH-1 extensively bound to the same chromatin locations in granulosa cells. Using ChIP-reChIP, we corroborated simultaneous ERβ and LRH-1 co-binding at the ERβ-repressed gene Greb1 but not at the ERβ-upregulated genes Cyp11a1 and Fkbp5. Transactivation assay experimentation further showed that ERβ and LRH-1 can inhibit their respective transcriptional activity at classical response elements.<h4>Conclusions</h4>By characterizing the genome-wide endogenous ERβ chromatin binding, gene regulations, and extensive crosstalk between ERβ and LRH-1, along with experimental corroborations, our data offer genome-wide mechanistic underpinnings of ovarian physiology and fertility.

Also flagged:acute liver failureHEV infectionHepatitisacute viral hepatitisHepatitis Eliver failure
Journal Article 2023-11-29 No Snippets Dong R, Chang D, Luo Z, Zhang M, Guan Q, Shen C, Chen Y, Huang P, Wang J.
Show Full Abstract

<h4>Background</h4>Hepatitis E can potentially progress to HEV-related acute liver failure (HEV-ALF). East and South Asia bear a substantial burden of HEV infection, with Bangladesh, China, and India facing the most severe threat in this region. Therefore, we conducted a systematic review and meta-analysis to evaluate the burden of HEV-ALF in these three high-risk countries.<h4>Methods</h4>A systematic literature search was performed utilizing PubMed, the Cochrane Library, Medline, Embase, and Web of Science databases. Studies in English or Chinese that reported data on the burden of HEV-ALF in Bangladesh, China and India were included. Outcomes were pooled with meta-analysis utilizing R software. Estimates were calculated with random-effects models, and subgroup analysis and sensitivity analysis were conducted to address heterogeneity. Egger's test and Begg's test were performed to assess publication bias.<h4>Results</h4>A total of 20 eligible studies were included in this study. The pooled HEV-attributable proportion of viral-related acute liver failure was estimated to be 40.0% (95% CI: 0.28-0.52), 30.0% (95% CI: 0.18-0.44), and 61.0% (95% CI: 0.49-0.72) among non-pregnant individuals in India, China and Bangladesh, while in Indian pregnant females, it was 71.0% (95% CI: 0.62-0.79). The combined prevalence among non-pregnant HEV-infected participants was 28.0% (95% CI: 0.20-0.37) and 10.0% (95% CI: 0.01-0.28) in India and China, and it was 34.0% (95% CI: 0.27-0.42) in Indian pregnant females with HEV infection. The overall mortality of HEV-ALF was estimated to be 32.0% (95% CI: 0.23-0.42) and 64.0% (95% CI: 0.50-0.77) among the non-pregnant and the pregnant participants in India, and it was 23.0% (95% CI: 0.14-0.34) in Chinese non-pregnant participants.<h4>Conclusions</h4>The burden of HEV-ALF in Bangladesh, China, and India is non-negligible despite geographic and population heterogeneity. The prevention of HEV infection and early recognition of HEV-ALF are of great significance, especially in high-risk countries and populations.<h4>Registration</h4>PROSPERO registration ID is CRD42022382101.

STAU1
Also flagged:TLR3Toll-like receptorsTLRspolyinosinic-polycytidylic acidsecretionIL-2
Journal Article 2023-11-29 ✓ 1 Snippet Tolstova T, Dotsenko E, Kozhin P, Novikova S, Zgoda V, Rusanov A, Luzgina N.
In-Text Gene Mentions

STAU1expression, which we…

Show Full Abstract

<h4>Background</h4>Mesenchymal stromal cells (MSCs) have regenerative and immunomodulatory properties, making them suitable for cell therapy. Toll-like receptors (TLRs) in MSCs respond to viral load by secreting immunosuppressive or proinflammatory molecules. The expression of anti-inflammatory molecules in MSCs can be altered by the concentration and duration of exposure to the TLR3 ligand polyinosinic-polycytidylic acid (poly(I:C)). This study aimed to optimize the preconditioning of MSCs with poly(I:C) to increase immunosuppressive effects and to identify MSCs with activated TLR3 (prMSCs).<h4>Methods</h4>Flow cytometry and histochemical staining were used to analyze MSCs for immunophenotype and differentiation potential. MSCs were exposed to poly(I:C) at 1 and 10 μg/mL for 1, 3, and 24 h, followed by determination of the expression of IDO1, WARS1, PD-L1, TSG-6, and PTGES2 and PGE2 secretion. MSCs and prMSCs were cocultured with intact (J<sup>-</sup>) and activated (J<sup>+</sup>) Jurkat T cells. The proportion of proliferating and apoptotic J<sup>+</sup> and J<sup>-</sup> cells, IL-10 secretion, and IL-2 production after cocultivation with MSCs and prMSCs were measured. Liquid chromatography-mass spectrometry and bioinformatics analysis identified proteins linked to TLR3 activation in MSCs.<h4>Results</h4>Poly(I:C) at 10 μg/mL during a 3-h incubation caused the highest expression of immunosuppression markers in MSCs. Activation of prMSCs caused a 18% decrease in proliferation and a one-third increase in apoptotic J<sup>+</sup> cells compared to intact MSCs. Cocultures of prMSCs and Jurkat cells had increased IL-10 and decreased IL-2 in the conditioned medium. A proteomic study of MSCs and prMSCs identified 53 proteins with altered expression. Filtering the dataset with Gene Ontology and Reactome Pathway revealed that poly(I:C)-induced proteins activate the antiviral response. Protein‒protein interactions by String in prMSCs revealed that the antiviral response and IFN I signaling circuits were more active than in native MSCs. prMSCs expressed more cell adhesion proteins (ICAM-I and Galectin-3), PARP14, PSMB8, USP18, and GBP4, which may explain their anti-inflammatory effects on Jurkat cells.<h4>Conclusions</h4>TLR3 activation in MSCs is dependent on exposure time and poly(I:C) concentration. The maximum expression of immunosuppressive molecules was observed with 10 µg/mL poly(I:C) for 3-h preconditioning. This priming protocol for MSCs enhances the immunosuppressive effects of prMSCs on T cells.

HTT
Also flagged:oligonucleotidecaspase-6Huntington diseasegene expression
Journal Article 2023-11-29 ✓ 4 Snippets Kuijper EC, Overzier M, Suidgeest E, Dzyubachyk O, Maguin C, Pérot JB, Flament J, Ariyurek Y, Mei H, Buijsen RAM, van der Weerd L, van Roon-Mom W.
In-Text Gene Mentions

In Huntington disease, cellular toxicity is particularly caused by toxic protein fragments generated from the mutant huntingtin (HTT) protein.

Antisense oligonucleotide-mediated disruption of HTT caspase-6 cleavage site ameliorates the phenotype of YAC128 Huntington disease mice.

…the mutant huntingtin (HTT) protein.…

…By modifying theHTTprotein, we aim…

Show Full Abstract

In Huntington disease, cellular toxicity is particularly caused by toxic protein fragments generated from the mutant huntingtin (HTT) protein. By modifying the HTT protein, we aim to reduce proteolytic cleavage and ameliorate the consequences of mutant HTT without lowering total HTT levels. To that end, we use an antisense oligonucleotide (AON) that targets HTT pre-mRNA and induces partial skipping of exon 12, which contains the critical caspase-6 cleavage site. Here, we show that AON-treatment can partially restore the phenotype of YAC128 mice, a mouse model expressing the full-length human HTT gene including 128 CAG-repeats. Wild-type and YAC128 mice were treated intracerebroventricularly with AON12.1, scrambled AON or vehicle starting at 6 months of age and followed up to 12 months of age, when MRI was performed and mice were sacrificed. AON12.1 treatment induced around 40% exon skip and protein modification. The phenotype on body weight and activity, but not rotarod, was restored by AON treatment. Genes differentially expressed in YAC128 striatum changed toward wild-type levels and striatal volume was preserved upon AON12.1 treatment. However, scrambled AON also showed a restorative effect on gene expression and appeared to generally increase brain volume.

STAU1
Also flagged:COPDcytokineimmune responsephagosomelysosomeCLEC5A
Journal Article 2023-11-29 ✓ 2 Snippets Zhang Z, Yu H, Wang Q, Ding Y, Wang Z, Zhao S, Bian T.
In-Text Gene Mentions

In recent years, increasing studies have proved the essential role of immune cell infiltration in the occurrence and development of various diseases.11,12 In the scope of COPD, Yang et al found that monocytes and M0 macrophages were up-regulated and CD8 T cells, activated NK cells, M2 macrophages, resting dendritic cells and resting mast cells were down-regulated in COPD lung tissues, while these differentially infiltrated immune cells were significantly associated with ferroptosis-related genes.13 Remarkably, even immune cells, such as monocytes, that have never been directly exposed to external stimuli, such as cigarette smoke or biomass smoke, have been observed to manifest defects in their function and regulation.14,15 The expressions of SLC27A3 and STAU1 which were identified as the diagnostic markers of COPD by Zhang et al were enhanced in COPD models, accompanied by the activation of immune infiltration.16 However, although many biomarkers have been developed to identify COPD, a novel diagnostic model that focused on the immune microenvironment associated with COPD has not been constructed.

…of SLC27A3 andSTAU1which were identified…

Show Full Abstract

<h4>Background</h4>This study aims to investigate the association between immune cells and the development of COPD, while providing a new method for the diagnosis of COPD according to the changes in immune microenvironment.<h4>Methods</h4>In this study, the "CIBERSORT" algorithm was used to estimate the tissue infiltration of 22 types of immune cells in GSE20257 and GSE10006. The "limma" package was used for differentially expressed analysis. The key modules associated with vital immune cells were identified using WGCNA. GO and KEGG enrichment analysis revealed the biological functions of the candidate genes. Ultimately, a novel diagnostic prediction model was constructed via machine learning methods and multivariate logistic regression analysis based on GSE20257. Furthermore, we examined the stability of the model on one internal test set (GSE10006), three external test sets (GSE8545, GSE57148 and GSE76925), one single-cell transcriptome dataset (GSE167295), macrophages (THP-M cells) and lung tissue from COPD patients.<h4>Results</h4>M0 macrophages (AUC > 0.7 in GSE20257 and GSE10006) were considered as the most important immune cells through exploring the immune microenvironment landscapes in COPD patients and healthy controls. The differentially expressed genes from GSE20257 and GSE10006 were divided into six and five modules via WGCNA, respectively. The green module in GSE20257 (cor = 0.41, P < 0.001) and the brown module in GSE10006 (cor = 0.67, P < 0.001) were highly correlated with M0 macrophages and were selected as key modules. Forty-one intersected genes obtained from two modules were primarily involved in regulation of cytokine production, regulation of innate immune response, specific granule, phagosome, lysosome, ferroptosis, and other biological processes. On the basis of the candidate genetic markers further characterized via the "Boruta" and "LASSO" algorithm for COPD, a diagnostic model comprising CLEC5A, FTL and SLC2A3 was constructed, which could accurately distinguish COPD patients from healthy controls in multiple datasets. GSE20257 as the training set has an AUC of 0.916. The AUCs of the internal test set and three external test sets were 0.873, 0.932, 0.675 and 0.688, respectively. Single-cell sequencing analysis suggested that CLEC5A, FTL and SLC2A3 were expressed in macrophages from COPD patients. The expressions of CLEC5A, FTL and SLC2A3 were up-regulated in THP-M cells and lung tissue from COPD patients.<h4>Conclusion</h4>According to the variations of immune microenvironment in COPD patients, we constructed and validated a novel macrophage M0-associated diagnostic model with satisfactory predictive value. CLEC5A, FTL and SLC2A3 are expected to be promising targets of immunotherapy in COPD.

Also flagged:addictionaffective disordersalcoholanxietydepressiondopamine
Journal Article 2023-11-29 No Snippets Bowirrat A, Elman I, Dennen CA, Gondré-Lewis MC, Cadet JL, Khalsa J, Baron D, Soni D, Gold MS, McLaughlin TJ, Bagchi D, Braverman ER, Ceccanti M, Thanos PK, Modestino EJ, Sunder K, Jafari N, Zeine F, Badgaiyan RD, Barh D, Makale M, Murphy KT, Blum K.
Show Full Abstract

Loneliness, an established risk factor for both, mental and physical morbidity, is a mounting public health concern. However, the neurobiological mechanisms underlying loneliness-related morbidity are not yet well defined. Here we examined the role of genes and associated DNA risk polymorphic variants that are implicated in loneliness via genetic and epigenetic mechanisms and may thus point to specific therapeutic targets. Searches were conducted on PubMed, Medline, and EMBASE databases using specific Medical Subject Headings terms such as loneliness and genes, neuro- and epigenetics, addiction, affective disorders, alcohol, anti-reward, anxiety, depression, dopamine, cancer, cardiovascular, cognitive, hypodopaminergia, medical, motivation, (neuro)psychopathology, social isolation, and reward deficiency. The narrative literature review yielded recursive collections of scientific and clinical evidence, which were subsequently condensed and summarized in the following key areas: (1) Genetic Antecedents: Exploration of multiple genes mediating reward, stress, immunity and other important vital functions; (2) Genes and Mental Health: Examination of genes linked to personality traits and mental illnesses providing insights into the intricate network of interaction converging on the experience of loneliness; (3) Epigenetic Effects: Inquiry into instances of loneliness and social isolation that are driven by epigenetic methylations associated with negative childhood experiences; and (4) Neural Correlates: Analysis of loneliness-related affective states and cognitions with a focus on hypodopaminergic reward deficiency arising in the context of early life stress, eg, maternal separation, underscoring the importance of parental support early in life. Identification of the individual contributions by various (epi)genetic factors presents opportunities for the creation of innovative preventive, diagnostic, and therapeutic approaches for individuals who cope with persistent feelings of loneliness. The clinical facets and therapeutic prospects associated with the current understanding of loneliness, are discussed emphasizing the relevance of genes and DNA risk polymorphic variants in the context of loneliness-related morbidity.

Also flagged:HydroxyapatitePhospholipidssynthesiswaterphospholipidosteogenesis
Journal Article 2023-11-29 No Snippets Rojewska M, Adamska K, Kurnatowska J, Miklaszewski A, Bartkowska A, Prochaska K.
Show Full Abstract

The main aims of thin biofilm synthesis are to either achieve a new form to promote the transport of drugs in oral delivery systems or as a coating to improve the biocompatibility of the implant's surface. In this study, the Langmuir monolayer technique was employed to obtain films containing Mg-doped hydroxyapatite with 0.5%, 1.0%, and 1.5% Mg(II). The obtained modified HA particles were analysed via the FT-IR, XRD, DLS, and SEM methods. It was shown that the modified hydroxyapatite particles were able to form thin films at the air/water interface. BAM microscopy was employed to characterized the morphology of these films. In the next step, the mixed films were prepared using phospholipid (DPPC) molecules and modified hydroxyapatite particles (HA-Mg(II)). We expected that the presence of phospholipids (DPPC) in thin films improved the biocompatibility of the preparing films, while adding HA-Mg(II) particles will promote antibacterial properties and enhance osteogenesis processes. The films were prepared in two ways: (1) by mixing DPPC and HA-Mg (II) and spreading this solution onto the subphase, or (2) by forming DPPC films, dropping the HA-Mg (II) dispersion onto the phospholipid monolayer. Based on the obtained π-A isotherms, the surface parameters of the achieved thin films were estimated. It was observed that the HA-Mg(II) films can be stabilized with phospholipid molecules, and a more stable structure was obtained from films synthesied via method (2).

ZNF644
Also flagged:MyopiaHigh myopiaretinal choroidal atrophyposterior scleral staphylomamacular degenerationchoroidal neovascularization
Journal Article 2023-11-29 ✓ 2 Snippets Zhou W, Jiang Z, Yi Z, Ouyang J, Li X, Zhang Q, Wang P.
In-Text Gene Mentions

To date, 27 loci (MYP1-MYP28, MYP4 was deprived) and ten genes (OPN1LW, OMIM 300822; SCO2, OMIM 604272; ZNF644, OMIM 614159; CCDC111, OMIM 615421; LRPAP1, OMIM 104225; SLC39A5, OMIM 608730; P4HA2, OMIM 600608; ARR3, OMIM 301770, CPSF1, OMIM 606027; LOXL3, OMIM 607163) are identified to be associated with myopia by linkage analysis combined with whole-exome sequencing (WES) or WES alone, which account for less than 15% patients with eoHM [5,6].

…, OMIM 604272;ZNF644, OMIM 614159;…

Show Full Abstract

Thinning of the sclera happens in myopia eyes owing to extracellular matrix (ECM) remodeling, but the initiators of the ECM remodeling in myopia are mainly unknown. The matrix metalloproteinase (MMPs) and tissue inhibitors of matrix metalloproteinase (TIMPs) regulate the homeostasis of the ECM. However, genetic studies of the MMPs and TIMPs in the occurrence of myopia are poor and limited. This study systematically investigated the association between twenty-nine genes of the TIMPs and MMPs families and early-onset high myopia (eoHM) based on whole exome sequencing data. Two <i>TIMP4</i> heterozygous loss-of-function (LoF) variants, c.528C>A in six patients and c.234_235insAA in one patient, were statistically enriched in 928 eoHM probands compared to that in 5469 non-high myopia control (<i>p</i> = 3.7 × 10<sup>-5</sup>) and that in the general population (<i>p</i> = 2.78 × 10<sup>-9</sup>). Consequently, the <i>Timp4</i> gene editing rat was further evaluated to explore the possible role of <i>Timp4</i> on ocular and myopia development. A series of ocular morphology abnormalities in a dose-dependent manner (<i>Timp4</i><sup>-/-</sup> < <i>Timp4</i><sup>+/-</sup> < <i>Timp4</i><sup>+/+</sup>) were observed in a rat model, including the decline in the retinal thickness, the elongation in the axial length, more vulnerable to the form deprivation model, morphology changes in sclera collagen bundles, and the decrease in collagen contents of the sclera and retina. Electroretinogram revealed that the b-wave amplitudes of <i>Timp4</i> defect rats were significantly reduced, consistent with the shorter length of the bipolar axons detected by HE and IF staining. Heterozygous LoF variants in the <i>TIMP4</i> are associated with early onset high myopia, and the <i>Timp4</i> defect disturbs ocular development by influencing the morphology and function of the ocular tissue.

OLFM4
Also flagged:Farnesoid X receptorFXRbile acidlipidcolitisnonalcoholic steatohepatitis
Journal Article 2023-11-29 ✓ 1 Snippet Liu HM, Chang ZY, Yang CW, Chang HH, Lee TY.
In-Text Gene Mentions

…the Lgr5 ,Olfm4, and cyclin…

Show Full Abstract

The farnesoid X receptor (FXR)/βKlotho/fibroblast growth factors (FGFs) pathway is crucial for maintaining the intestinal barrier and preventing colorectal cancer (CRC). We used an FXR agonist, GW4064, and FXR-knockout (FXR-KO) mice to investigate the role of FXR/Klothos/FGFs pathways in lipopolysaccharide (LPS)-induced intestinal barrier dysfunction and colon carcinogenesis. The results showed that upregulation of FXR in enterocytes effectively ameliorated intestinal tight-junction markers (claudin1 and zonula occludens-1), inflammation, and bile acid levels, thereby protecting mice from intestinal barrier dysfunction and colon carcinogenesis. GW4064 treatment increased FXR, αKlotho, βKlotho, FGF19, FGF21, and FGF23 in wild-type mice exposed to LPS, while FXR-KO mice had decreased levels. FXR-KO mice exhibited elevated colon cancer markers (β-catenin, LGR5, CD44, CD34, and cyclin D1) under LPS, underscoring the pivotal role of FXR in inhibiting the development of colon tumorigenesis. The varying gut microbiota responses in FXR-KO mice versus wild-type mice post LPS exposure emphasize the pivotal role of FXR in preserving intestinal microbial health, involving <i>Bacteroides thetaiotaomicron</i>, <i>Bacteroides acidifaciens</i>, and <i>Helicobacter hepaticus</i>. Our study validates the effectiveness of GW4064 in alleviating LPS-induced disruptions to the intestinal barrier and colon carcinogenesis, emphasizing the importance of the FXR/αKlotho/βKlotho/FGFs pathway and the interplay between bile acids and gut microbiota.

Also flagged:antibodieslaccasediazoniumcarboxylalbuminovalbumin
Journal Article 2023-11-29 No Snippets Wang W, Fu X, Li Y, Jing M, Yang Y, Xu D, Lai D, Wang M, Wang B, Zhou L.
Show Full Abstract

Ustilaginoidins are a class of bis-naphtho-γ-pyrone mycotoxins to threaten humans, animals and environment. Ustilaginoidins are produced by <i>Villosiclava virens</i>, the rice false smut pathogen. To prepare antibodies for quantitatively analyzing ustilaginoidins in rice samples, hemiustilaginoidins D and F from the laccase gene deficiency mutant of <i>V. virens</i> respectively reacted with diazonium 4-aminobenzoic acid to obtain haptens with a carboxyl group, which further reacted with bovine serum albumin or ovalbumin to get their complete antigens. Two monoclonal antibodies (mAbs) designated as 4A12C6 and 5F4F6 were developed by immunization. The relationships between mAb sensitivity and 20 ustilaginoidins were described. 4A12C6 was chosen for further analysis as it could recognize main ustilaginoidins and was more sensitive than 5F4F6. The achieved indirect competitive enzyme-linked immunosorbent assay (icELISA) based on 4A12C6 had a half maximal inhibitory concentration (IC<sub>50</sub>) of 0.76 ng/mL and working range of 0.2-2.8 ng/mL to ustilaginoidin A. The results of ustilaginoidins-contaminated rice samples by icELISA detection were consistent with those determined by HPLC‒DAD detection. Therefore, we developed a new strategy to get haptens from the biosynthetic precursors with half structures of ustilaginoidins. The achieved icELISA was demonstrated as a convenient method to monitor ustilaginoidin content in rice samples, and showed that the contents of total ustilaginoidins from the rice cultivars with low resistance to rice false smut were more than those of high resistance cultivars.

SERPINC1
Also flagged:gangrenedeathCOVID-19endothelial dysfunctionhypercoagulationmicrovascular thrombosis
Journal Article 2023-11-29 ✓ 1 Snippet Wang M, Sun T, Dong L, Huang S, Liu J.
In-Text Gene Mentions

…antithrombin III protein (ATIII) at 53% (normal…

Show Full Abstract

Symmetrical peripheral gangrene is a rare condition that is characterized by ischemic damage and tissue death (gangrene) in the extremities. Recent reports have shed light on SPG in patients with severe COVID-19. This condition presents with symmetrical cyanosis of the extremities and common COVID-19 symptoms and what the most frightening is within a few days, cutaneous necrosis occurred and patients died. Skin biopsy results have shown the presence of microthrombi in small vessels. The formation of SPG in COVID-19 patients results from immunothrombosis, endothelial dysfunction, and procoagulant platelets, leading to a hypercoagulation state and microvascular thrombosis. Thrombotic microangiopathy, shock, disseminated intravascular coagulation, and anticoagulant depletion promote the development of SPG in COVID-19. At the early stage, SPG patients with COVID-19 exhibit similar clinical manifestations. TMA causes early damage to microvasculature in SPG, and the shock state further exacerbates the ischemic injury due to local hypo-perfusion. The disturbed procoagulant-anticoagulant balance caused by DIC and anticoagulant depletion, combined with the pre-ischemic state brought on by TMA and shock, leads to the rapid formation of extensive microthrombi in the late stage of COVID-19 associated SPG. This review will delve into the clinical features, possible mechanisms, and potential therapeutic managements for COVID-19 associated SPG.

Also flagged:STATColorectal cancercancersJanus kinasesignal transducer and activator of transcriptiongene expression
Journal Article 2023-11-29 No Snippets Ghasemian A, Omear HA, Mansoori Y, Mansouri P, Deng X, Darbeheshti F, Zarenezhad E, Kohansal M, Pezeshki B, Wang Z, Tang H.
Show Full Abstract

Colorectal cancer (CRC) is one of the main fatal cancers. Cell signaling such as Janus kinase/signal transducer and activator of transcription (JAK/STAT) signaling substantially influences the process of gene expression and cell growth. Long non-coding RNAs (lncRNAs) play regulatory roles in cell signaling, cell proliferation, and cancer fate. Hence, lncRNAs can be considered biomarkers in cancers. The inhibitory or activating effects of different lncRNAs on the JAK/STAT pathway regulate cancer cell proliferation or tumor suppression. Additionally, lncRNAs regulate immune responses which play a role in immunotherapy. Mechanisms of lncRNAs in CRC via JAK/STAT regulation mainly include cell proliferation, invasion, metastasis, apoptosis, adhesion, and control of inflammation. More profound findings are warranted to specifically target the lncRNAs in terms of activation or suppression in hindering CRC cell proliferation. Here, to understand the lncRNA cross-talk in CRC through the JAK/STAT signaling pathway, we collected the related <i>in vitro</i> and <i>in vivo</i> data. Future insights may pave the way for the development of novel diagnostic tools, therapeutic interventions, and personalized treatment strategies for CRC patients.

DARS2
Also flagged:sepsislipopolysaccharidetransductionmitochondrialmetabolismsystemic inflammatory syndrome
Journal Article 2023-11-29 ✓ 3 Snippets Zhang TN, Wen R, Yang YH, Yang N, Liu CF.
In-Text Gene Mentions

The top correlated proteins were Gpat3, LOC100911055, Dars2, Spry4, and Kdm5a, and the top correlated metabolites were Val-Thr, 2-hydroxy-6-aminopurine, PS (16:1_22:6), glycolithocholic acid, 4-hydroxybenzaldehyde, Pro-Met, 4-deoxyuridine, PS (18:0_22:1), 2-O-methylguanosine, carnitine isoC4:0, 13-oxoODE, 9-oxoODE, and LPS (20:3/0:0).

…Pcyt1a, Aqp1, Ap2b1,Dars2, Cdc16, Atp2b4, Atp2a2,…

…were Gpat3, LOC100911055,Dars2, Spry4 , and…

Show Full Abstract

<b>Background:</b> Recent evidence has shown that the long non-coding RNA (lncRNA) rPvt1 is elevated in septic myocardial tissues and that its knockdown attenuates sepsis-induced myocardial injury. However, the mechanism underlying the role of rPvt1 in septic myocardial dysfunction has not been elucidated. <b>Methods:</b> In this study, we performed transcriptomic, proteomic, and metabolomic assays and conducted an integrated multi-omics analysis to explore the association between rPvt1 and lipopolysaccharide (Lipopolysaccharide)-induced H9C2 cardiomyocyte injury. LncRNA rPvt1 silencing was achieved using a lentiviral transduction system. <b>Results:</b> Compared to those with the negative control, rPvt1 knockdown led to large changes in the transcriptome, proteome, and metabolome. Specifically, 2,385 differentially expressed genes (DEGs), 272 differentially abundant proteins and 75 differentially expressed metabolites (DEMs) were identified through each omics analysis, respectively. Gene Ontology functional annotation, Kyoto Encyclopedia of Genes and Genomes, Nr, eukaryotic orthologous groups, and Clusters of Orthologous Groups of Proteins pathway analyses were performed on these differentially expressed/abundant factors. The results suggested that mitochondrial energy metabolism might be closely related to the mechanism through which Pvt1 functions. <b>Conclusion:</b> These genes, proteins, metabolites, and their related dysregulated pathways could thus be promising targets for studies investigating the rPvt1-regluatory mechanisms involved in septic myocardial dysfunction, which is important for formulating novel strategies for the prevention, diagnosis and treatment of septic myocardial injury.

Also flagged:Dibutyl PhthalateWaterDBPfluoresceinbindingantibodies
Journal Article 2023-11-29 No Snippets Mukhametova LI, Karimova MR, Zharikova OG, Pirogov AV, Levkina VV, Chichkanova ES, Liu L, Xu C, Eremin SA.
Show Full Abstract

Dibutyl phthalate (DBP) is widely used as a plasticizer in the production of polymeric materials to give them flexibility, strength and extensibility. However, due to its negative impact on human health, in particular reproductive functions and fetal development, the content of DBP must be controlled in food and the environment. The present study aims to develop a sensitive, fast and simple fluorescence polarization immunoassay (FPIA) using monoclonal antibodies derived against DBP (MAb-DBP) for its detection in open waters. New conjugates of DBP with various fluorescein derivatives were obtained and characterized: 5-aminomethylfluorescein (AMF) and dichlorotriazinylaminofluorescein (DTAF). The advantages of using the DBP-AMF conjugate in the FPIA method are shown, the kinetics of binding of this chemical with antibodies are studied, the analysis is optimized, and the concentration of monoclonal antibodies is selected for sensitivity analysis-16 nM. The calibration dependence of the fluorescence polarization signal for the detection of DBP was obtained. The observed IC50 (DBP concentration at which a 50% decrease in the fluorescence polarization signal occurs, 40 ng/mL) and the limit of detection (LOD, 7.5 ng/mL) values were improved by a factor of 45 over the previously described FPIA using polyclonal antibodies. This technique was tested by the recovery method, and the high percentage of DBP discovery in water ranged from 85 to 110%. Using the developed method, real water samples from Lake Onega were tested, and a good correlation was shown between the results of the determination of DBP by the FPIA method and GC-MS. Thus, the FPIA method developed in this work can be used to determine DBP in open-water reservoirs.

HTT
Also flagged:Sirtuin 2agingSIRT2neurodegenerative diseasesinsulin resistancecardiovascular diseases
Journal Article 2023-11-29 ✓ 3 Snippets Garmendia-Berges M, Sola-Sevilla N, Mera-Delgado M, Puerta E.
In-Text Gene Mentions

Moreover, Chopra and coworkers [91] observed that SIRT2 inhibition with AK-7 compound reduced HTT aggregates, improved motor function, reduced brain atrophy, and extended survival of two genetic mouse models of HD.

The genetic basis of HD is a CAG trinucleotide repeat (40 or more times) expansion within exon 1 of the huntingtin gene (HTT).

Bobrowska et al. [95] showed that genetic reduction or ablation of SIRT2 did not modify the disease progression or HTT levels in the HD genetic mouse model R6/2.

Show Full Abstract

Sirtuin 2 (SIRT2), one of the seven members of the sirtuin family, has emerged as a potential regulator of aging and age-related pathologies since several studies have demonstrated that it shows age-related changes in humans and different animal models. A detailed analysis of the relevant works published to date addressing this topic shows that the changes that occur in SIRT2 with aging seem to be opposite in the brain and in the periphery. On the one hand, aging induces an increase in SIRT2 levels in the brain, which supports the notion that its pharmacological inhibition is beneficial in different neurodegenerative diseases. However, on the other hand, in the periphery, SIRT2 levels are reduced with aging while keeping its expression is protective against age-related peripheral inflammation, insulin resistance, and cardiovascular diseases. Thus, systemic administration of any known modulator of this enzyme would have conflicting outcomes. This review summarizes the currently available information on changes in SIRT2 expression in aging and the underlying mechanisms affected, with the aim of providing evidence to determine whether its pharmacological modulation could be an effective and safe pharmacological strategy for the treatment of age-related diseases.

TNFSF4
Also flagged:deathdeoxyribonucleic acidtumormalignant tumorstranscription factorsamino acid
Journal Article 2023-11-29 ✓ 1 Snippet Liu T, Du J, Cheng X, Wei J.
In-Text Gene Mentions

…sites included HMGB1,TNFSF4, BTN3A1, TNF, ICAM1,…

Show Full Abstract

Tumor protein P53 (<i>TP53</i>) is an important tumor suppressor gene in humans. Under normal circumstances, <i>TP53</i> can help repair mutated genes, or promote the death of cells with severe gene mutations (specifically, <i>TP53</i> prevents cells from arrest in the G1/S phase when deoxyribonucleic acid (DNA) is damaged and promotes apoptosis if not repaired), and prevents normal cells from becoming malignant cells. <i>TP53</i> mutations affect its tumor suppressor function, leading to the development of malignant tumors. In this study, using a public database, we explored the pan-cancer expression of <i>TP53</i>, its impact on patient survival and prognosis, the types of gene mutations, its correlation with immunity, and its regulation of other transcription factors and micro RNA (miRNA). The docking sites of therapeutic drugs and key amino acid sites of action provide a basis for future targeted therapies. <i>TP53</i> has important biological functions in the human body. This study provides a theoretical basis for clinical <i>TP53</i> gene therapy.

Also flagged:mercury poisoningglutathioneGSTGPxATP-binding cassette transportersmetallothionein
Journal Article 2023-11-29 No Snippets Crespo-Lopez ME, Barthelemy JL, Lopes-Araújo A, Santos-Sacramento L, Leal-Nazaré CG, Soares-Silva I, Macchi BM, do Nascimento JLM, Arrifano GP, Augusto-Oliveira M.
Show Full Abstract

Human intoxication to mercury is a worldwide health problem. In addition to the type and length of exposure, the genetic background plays an important role in mercury poisoning. However, reviews on the genetic influence in mercury toxicity are scarce and not systematic. Therefore, this review aimed to systematically overview the most recent evidence on the genetic influence (using single nucleotide polymorphisms, SNPs) on human mercury poisoning. Three different databases (PubMed/Medline, Web of Science and Scopus) were searched, and 380 studies were found that were published from 2015 to 2022. After applying inclusion/exclusion criteria, 29 studies were selected and data on characteristics (year, country, profile of participants) and results (mercury biomarkers and quantitation, SNPs, main findings) were extracted and analyzed. The largest number of studies was performed in Brazil, mainly involving traditional populations of the Tapajós River basin. Most studies evaluated the influence of the SNPs related to genes of the glutathione system (GST, GPx, etc.), the ATP-binding cassette transporters and the metallothionein proteins. The recent findings regarding other SNPs, such as those of apolipoprotein E and brain-derived neurotrophic factor genes, are also highlighted. The importance of the exposure level is discussed considering the possible biphasic behavior of the genetic modulation phenomena that could explain some SNP associations. Overall, recommendations are provided for future studies based on the analysis obtained in this scoping review.

SOX6
Also flagged:canceractinic keratosesgene expressionoxygentoactinic keratosis
Journal Article 2023-11-29 ✓ 1 Snippet Razzaghi Z, Arjmand B, Hamzeloo-Moghadam M, Rezaei Tavirani M, Zamanian Azodi M.
In-Text Gene Mentions

SOX6

Show Full Abstract

<b>Introduction:</b> Photodynamic therapy (PDT) is a combined method of light and light-activated chemicals that are called photosensitizers (PSs). PDT is recommended as a high cure rate method with fewer side effects and a noninvasive tool to treat cancer. This study aimed to evaluate PDT efficacy as a therapeutic method against actinic keratoses in patients via protein-protein interaction (PPI) network analysis by using the gene expression profiles of Gene Expression Omnibus (GEO). <b>Methods:</b> Twenty-one gene expression profiles were extracted from GEO and analyzed by GEO2R to determine the significant differentially expressed genes (DEGs). The significant DEGs were included in PPI networks via Cytoscape software. The networks were analyzed by the "Network Analyzer", and the elements of the main connected components were assessed. <b>Results:</b> There were three main connected components for the compared sets of the gene expression profiles including the lesional region of skin before (Before set) and after (After set) PDT versus healthy (healthy set) skin and before versus after. The before-health comparison showed a partial similarity with the After-Healthy assessment. The before-after evaluation indicated that there were not considerable differences between the gene expression profile of the lesional region before and after PDT. <b>Conclusion:</b> In conclusion, PDT was unable to return the gene expression pattern of the actinic keratoses skin to a healthy condition completely.

HFE
Also flagged:Thrombotic MicroangiopathyAcute Tubular InjuryGlycoldiethylene glycolacute kidney injuryperipheral sensorimotor neuropathy
Journal Article 2023-11-29 ✓ 1 Snippet Malvar G, Gunasekaran D, Mehr NV, Ishibe S, Moeckel G.
In-Text Gene Mentions

…for hypertension andhemochromatosis.…

Show Full Abstract

We present a rare and unusual case of thrombotic microangiopathy (TMA) in a patient who ingested chafing fuel containing diethylene glycol. The patient showed a typical clinical course of initial gastrointestinal symptoms followed by acute kidney injury (AKI) and peripheral sensorimotor neuropathy. A kidney biopsy showed TMA and diffuse acute tubular injury. Diethylene glycol is widely used as a solvent in numerous consumer products, including brake fluid, antifreeze, chafing fuel, and artificial fog solutions. Diethylene glycol has been implemented in mass poisonings, and the incidence of AKI in diethylene glycol poisonings is linked to high-mortality rates. TMA, a pathologic lesion observed in a wide spectrum of diseases, is triggered by endothelial injury. Our case shows that TMA should be considered as a possible life-threatening complication in the setting of acute diethylene glycol poisoning. Direct toxic injury to endothelial cells by diethylene glycol is a possible mechanism. It is therefore plausible that patients with a genetic predisposition to endothelial injury may develop TMA following diethylene glycol exposure.

bioRxiv 2023-11-29 Preprint (No Snippets API) Banerjee S, Lu S, Jain A, Wang I, Tao H, Srinivasan S, Nemeth E, He P.
Show Full Abstract

Diabetes is one of the most prevalent chronic diseases worldwide. Iron overload increases the incidence of diabetes and aggravates diabetic complications that cause mortality. Reciprocally, diabetes potentially promotes body iron loading, but the mechanism remains not well understood. In this study, we demonstrated systemic iron excess and the upregulation of iron exporter ferroportin (Fpn) in the enterocytes and macrophages of multiple diabetic mouse models. Increased Fpn expression and iron efflux was also seen in the enterocytes of type 2 diabetic human patients. We further showed that protein kinase C (PKC), which is activated in hyperglycemia, was responsible for the sustained membrane expression of Fpn in physiological and in diabetic settings. For the first time, we identified that PKCs were novel binding proteins and positive regulators of Fpn. Mechanistically, hyperactive PKC promoted exocytotic membrane insertion while inhibited the endocytic trafficking of Fpn in the resting state. PKC also protected Fpn from internalization and degradation by its ligand hepcidin dependent on decreased ubiquitination and increased phosphorylation of Fpn. Importantly, the loss-of-function and pharmacological inhibition of PKC alleviated systemic iron overload in diabetes and hemochromatosis. Our study thus highlights PKC as a novel target in the control of systemic iron homeostasis.

TRIM38
Also flagged:spontaneous abortionendocrine disordersinfectious diseaseseclampsiaimmune responsestimulator of interferon genes
Journal Article 2023-11-28 ✓ 5 Snippets Liu J, Deng Y, Wang A, Liu B, Zhou X, Yin T, Wang Y, Tang T, Qiu Y, Chen J, Yang J.
In-Text Gene Mentions

…is mediated byTRIM38in M2 macrophages.…

…Knockdown ofTRIM38and MITA in…

…to knockdown theTRIM38and MITA genes…

…The particles targetingTRIM38were obtained from…

…after knockdown ofTRIM38or MITA and…

Show Full Abstract

The maternal-fetal interface shares similarities with tumor tissues in terms of the immune microenvironment. Normal pregnancy is maintained due to the immunosuppressed state, but pyroptosis induced by MITA can trigger the body's immune response and disrupt the immunosuppressed state of the maternal-fetal interface, leading to abortion. In this study, we explored the role of MITA and TRIM38 in regulating pyroptosis and maintaining the immune tolerance of the maternal-fetal interface during pregnancy. Our findings show that the interaction between MITA and TRIM38 plays a crucial role in maintaining the immunosuppressed state of the maternal-fetal interface. Specifically, we observed that TRIM38-mediated K48 ubiquitination of MITA was higher in M2 macrophages, leading to low expression levels of MITA and thus inhibiting pyroptosis. Conversely, in M1 macrophages, the ubiquitination of K48 was lower, resulting in higher expression levels of MITA and promoting pyroptosis. Our results also indicated that pyroptosis played an important role in hindering the transformation of M1 to M2 and maintaining the immunosuppressed state of the maternal-fetal interface. These discoveries help elucidate the mechanisms that support the preservation of the immune tolerance microenvironment at the maternal-fetal interface, playing a vital role in ensuring successful pregnancy.

GPR52
Also flagged:Hydroxycarboxylic acid receptor 2HCAR2class A G protein-coupled receptorslipolysisfatty acidmetabolic diseases
Journal Article 2023-11-28 ✓ 3 Snippets Pan X, Ye F, Ning P, Zhang Z, Li X, Zhang B, Wang Q, Chen G, Gao W, Qiu C, Wu Z, Li J, Zhu L, Xia J, Gong K, Du Y.
In-Text Gene Mentions

…ith self-activation, includingGPR52, GPR17, and BILF1…

…the N-terminus ofGPR52and BILF1 did…

…“agonist”, such asGPR52, GPR17, and BILF1…

Show Full Abstract

Hydroxycarboxylic acid receptor 2 (HCAR2) belongs to the family of class A G protein-coupled receptors with key roles in regulating lipolysis and free fatty acid formation in humans. It is deeply involved in many pathophysiological processes and serves as an attractive target for the treatment of cardiovascular, neoplastic, autoimmune, neurodegenerative, inflammatory, and metabolic diseases. Here, we report four cryo-EM structures of human HCAR2-Gi1 complexes with or without agonists, including the drugs niacin (2.69 Å) and acipimox (3.23 Å), the highly subtype-specific agonist MK-6892 (3.25 Å), and apo form (3.28 Å). Combined with molecular dynamics simulation and functional analysis, we have revealed the recognition mechanism of HCAR2 for different agonists and summarized the general pharmacophore features of HCAR2 agonists, which are based on three key residues R111<sup>3.36</sup>, S179<sup>45.52</sup>, and Y284<sup>7.43</sup>. Notably, the MK-6892-HCAR2 structure shows an extended binding pocket relative to other agonist-bound HCAR2 complexes. In addition, the key residues that determine the ligand selectivity between the HCAR2 and HCAR3 are also illuminated. Our findings provide structural insights into the ligand recognition, selectivity, activation, and G protein coupling mechanism of HCAR2, which shed light on the design of new HCAR2-targeting drugs for greater efficacy, higher selectivity, and fewer or no side effects.

RC3H1
Also flagged:Alzheimer's diseaseADdementiadeathtauamyloid-β
Journal Article 2023-11-28 ✓ 1 Snippet Wang X, Xie J, Tan L, Lu Y, Shen N, Li J, Hu H, Li H, Li X, Cheng L.
In-Text Gene Mentions

…we selected TRIM62,RC3H1, and ubiquitin conjugating…

Show Full Abstract

<h4>Background</h4>Synaptic degeneration occurs in the early stage of Alzheimer's disease (AD) before devastating symptoms, strongly correlated with cognitive decline. Circular RNAs (circRNAs) are abundantly enriched in neural tissues, and aberrant expression of circRNAs precedes AD symptoms, significantly correlated with clinical dementia severity. However, the direct relationship between circRNA dysregulation and synaptic impairment in the early stage of AD remains poorly understood.<h4>Methods</h4>Hippocampal whole-transcriptome sequencing was performed to identify dysregulated circRNAs and miRNAs in 4-month-old wild-type and APP/PS1 mice. RNA antisense purification and mass spectrometry were utilized to unveil interactions between circRIMS2 and methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit (METTL3). The roles of circRIMS2/miR-3968 in synaptic targeting of UBE2K-mediated ubiquitination of GluN2B subunit of NMDA receptor were evaluated via numerous lentiviruses followed by morphological staining, co-immunoprecipitation and behavioral testing. Further, a membrane-permeable peptide was used to block the ubiquitination of K1082 on GluN2B in AD mice.<h4>Results</h4>circRIMS2 was significantly upregulated in 4-month-old APP/PS1 mice, which was mediated by METTL3-dependent N6-methyladenosine (m6A) modification. Overexpression of circRIMS2 led to synaptic and memory impairments in 4-month-old C57BL/6 mice. MiR-3968/UBE2K was validated as the downstream of circRIMS2. Elevated UBE2K induced synaptic dysfunction of AD through ubiquitinating K1082 on GluN2B. Silencing METTL3 or blocking the ubiquitination of K1082 on GluN2B with a short membrane-permeable peptide remarkably rescued synaptic dysfunction in AD mice.<h4>Conclusions</h4>In conclusion, our study demonstrated that m6A-modified circRIMS2 mediates the synaptic and memory impairments in AD by activating the UBE2K-dependent ubiquitination and degradation of GluN2B via sponging miR-3968, providing novel therapeutic strategies for AD.

SERPINC1
Also flagged:Retinal VasculitisSystemic Lupus ErythematosusSLEautoimmune diseaseLupus retinopathyantiphospholipid syndrome
Journal Article 2023-11-28 ✓ 1 Snippet Aldhefeery N, Alhadhood N, Alkadi A.
In-Text Gene Mentions

…and antithrombin III (ATIII).…

Show Full Abstract

BACKGROUND Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease of undefined etiology with a relapsing and remitting course. Lupus retinopathy is reported in around 10% of patients with SLE; however, it is rarely the initial presenting feature of the disease. We report a unique case of bilateral retinal vasculitis as the initial presentation of SLE with secondary antiphospholipid syndrome (APS). CASE REPORT A 34-year-old man, previously healthy, presented to the eye clinic for the first time with painless reduced vision for 3 weeks. A review of systems revealed generalized fatigue, myalgia, arthralgias, and weight loss of around 10 kg in the last 3 months. On ophthalmic examination, his visual acuity was reduced bilaterally, more in the right eye. A fundus exam revealed bilateral diffuse multiple cotton-wool spots, dot and blot hemorrhage covering the posterior pole, and venous congestion and beading. In addition, there was cystoid macular edema (CME) in the fovea of both eyes, and fundus fluorescein angiography (FFA) showed bilateral areas of peripheral and macular hypo-fluorescence, multiple hyper-fluorescent knob-like aneurysmal dilatations, and vascular leaking and staining. He was diagnosed with SLE by the rheumatology team based on the clinical presentations and laboratory investigations. The patient was managed with intravenous methylprednisolone and discharged on oral prednisone with a tapering regimen. Eighteen months after, he reported significant improvement in his vision with regular follow-ups. CONCLUSIONS Ocular manifestations can be the initial presentation of SLE and can lead to serious ocular complications. Early diagnosis and proper management are essential and require cooperation between rheumatologists and ophthalmologists.

Also flagged:neurological disorderstranslationalneural tube formationbrain diseaseneurodegenerative diseasesautism spectrum disorder
Journal Article 2023-11-28 No Snippets Acharya P, Choi NY, Shrestha S, Jeong S, Lee MY.
Show Full Abstract

Brain organoids are self-organized, three-dimensional (3D) aggregates derived from pluripotent stem cells that have cell types and cellular architectures resembling those of the developing human brain. The current understanding of human brain developmental processes and neurological disorders has advanced significantly with the introduction of this in vitro model. Brain organoids serve as a translational link between two-dimensional (2D) cultures and in vivo models which imitate the neural tube formation at the early and late stages and the differentiation of neuroepithelium with whole-brain regionalization. In addition, the generation of region-specific brain organoids made it possible to investigate the pathogenic and etiological aspects of acquired and inherited brain disease along with drug discovery and drug toxicity testing. In this review article, we first summarize an overview of the existing methods and platforms used for generating brain organoids and their limitations and then discuss the recent advancement in brain organoid technology. In addition, we discuss how brain organoids have been used to model aspects of neurodevelopmental and neurodegenerative diseases, including autism spectrum disorder (ASD), Rett syndrome, Zika virus-related microcephaly, Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD).

CCPG1
Also flagged:LGR6lung cancerWntNSCLCCTNNB1Cell growth
Journal Article 2023-11-28 ✓ 1 Snippet Sunaga N, Kaira K, Shimizu K, Tanaka I, Miura Y, Nakazawa S, Ohtaki Y, Kawabata-Iwakawa R, Sato M, Girard L, Minna JD, Hisada T.
In-Text Gene Mentions

…significant DEGs being DYX1C1‐CCPG1, GATSL1 ,…

Show Full Abstract

<h4>Background</h4>Molecular abnormalities in the Wnt/β-catenin pathway confer malignant phenotypes in lung cancer. Previously, we identified the association of leucine-rich repeat-containing G protein-coupled receptor 6 (LGR6) with oncogenic Wnt signaling, and its downregulation upon β-catenin knockdown in non-small cell lung cancer (NSCLC) cells carrying CTNNB1 mutations. The aim of this study was to explore the mechanisms underlying this association and the accompanying phenotypes.<h4>Methods</h4>LGR6 expression in lung cancer cell lines and surgical specimens was analyzed using quantitative RT-PCR and immunohistochemistry. Cell growth was assessed using colony formation assay. Additionally, mRNA sequencing was performed to compare the expression profiles of cells subjected to different treatments.<h4>Results</h4>LGR6 was overexpressed in small cell lung cancer (SCLC) and NSCLC cell lines, including the CTNNB1-mutated NSCLC cell lines HCC15 and A427. In both cell lines, LGR6 knockdown inhibited cell growth. LGR6 expression was upregulated in spheroids compared to adherent cultures of A427 cells, suggesting that LGR6 participates in the acquisition of cancer stem cell properties. Immunohistochemical analysis of lung cancer specimens revealed that the LGR6 protein was predominantly overexpressed in SCLCs, large cell neuroendocrine carcinomas, and lung adenocarcinomas, wherein LGR6 overexpression was associated with vascular invasion, the wild-type EGFR genotype, and an unfavorable prognosis. Integrated mRNA sequencing analysis of HCC15 and A427 cells with or without LGR6 knockdown revealed LGR6-related pathways and genes associated with cancer development and stemness properties.<h4>Conclusions</h4>Our findings highlight the oncogenic roles of LGR6 overexpression induced by aberrant Wnt/β-catenin signaling in lung cancer.

Also flagged:maleimidecalcitriolCTLA-4immune responseautoimmune arthropathiesarthritis
Journal Article 2023-11-28 No Snippets Johnson WT, McBride D, Kerr M, Nguyen A, Zoccheddu M, Bollmann M, Wei X, Jones RM, Wang W, Svensson MND, Bottini N, Shah NJ.
Show Full Abstract

Disease-modifying drugs have improved the treatment for autoimmune joint disorders, such as rheumatoid arthritis, but inflammatory flares are a common experience. This work reports the development and application of flare-modulating poly(lactic-<i>co</i>-glycolic acid)-poly(ethylene glycol)-maleimide (PLGA-PEG-MAL)-based nanoparticles conjugated with joint-relevant peptide antigens, aggrecan<sub>70-84</sub> and type 2 bovine collagen<sub>256-270</sub>. Peptide-conjugated PLGA-PEG-MAL nanoparticles encapsulated calcitriol, which acted as an immunoregulatory agent, and were termed calcitriol-loaded nanoparticles (CLNP). CLNP had a ∼200 nm hydrodynamic diameter with a low polydispersity index. <i>In vitro</i>, CLNP induced phenotypic changes in bone marrow derived dendritic cells (DC), reducing the expression of costimulatory and major histocompatibility complex class II molecules, and proinflammatory cytokines. Bulk RNA sequencing of DC showed that CLNP enhanced expression of <i>Ctla4</i>, a gene associated with downregulation of immune responses. <i>In vivo</i>, CLNP accumulated in the proximal lymph nodes after intramuscular injection. Administration of CLNP was not associated with changes in peripheral blood cell numbers or cytokine levels. In the collagen-induced arthritis and SKG mouse models of autoimmune joint disorders, CLNP reduced clinical scores, prevented bone erosion, and preserved cartilage proteoglycan, as assessed by high-resolution microcomputed tomography and histomorphometry analysis. The disease protective effects were associated with increased CTLA-4 expression in joint-localized DC and CD4<sup>+</sup> T cells but without generalized suppression of T cell-dependent immune response. The results support the potential of CLNP as modulators of disease flares in autoimmune arthropathies.

HTT
Also flagged:pathogenesisneurodegenerative diseasesHuntingtinADPDHD
Journal Article 2023-11-28 ✓ 5 Snippets Ibrahim KA, Grußmayer KS, Riguet N, Feletti L, Lashuel HA, Radenovic A.
In-Text Gene Mentions

This discrepancy has been observed in several NDD-associated proteins, including alpha-synuclein18,19, tau20, amyloid beta21,22 (Aβ), and exon1 of the Huntingtin (Htt) protein14–17 (Httex1), one of the primary components of intracellular protein aggregates found in Huntington’s disease post-mortem brains23–25.

…of the Huntingtin (Htt) protein 14 –…

…human pathology, includingHttaggregation and inclusion…

…within which theHttfibrils colocalize with…

…and GFP-tagged mutantHttinclusions in mammalian…

Show Full Abstract

Protein misfolding and aggregation play central roles in the pathogenesis of various neurodegenerative diseases (NDDs), including Huntington's disease, which is caused by a genetic mutation in exon 1 of the Huntingtin protein (Httex1). The fluorescent labels commonly used to visualize and monitor the dynamics of protein expression have been shown to alter the biophysical properties of proteins and the final ultrastructure, composition, and toxic properties of the formed aggregates. To overcome this limitation, we present a method for label-free identification of NDD-associated aggregates (LINA). Our approach utilizes deep learning to detect unlabeled and unaltered Httex1 aggregates in living cells from transmitted-light images, without the need for fluorescent labeling. Our models are robust across imaging conditions and on aggregates formed by different constructs of Httex1. LINA enables the dynamic identification of label-free aggregates and measurement of their dry mass and area changes during their growth process, offering high speed, specificity, and simplicity to analyze protein aggregation dynamics and obtain high-fidelity information.

Also flagged:Dbhinnervationdopamine beta-hydroxylaseCatecholaminergicWolff-Parkinson-White syndromesick sinus syndrome
Journal Article 2023-11-28 No Snippets Sun T, Grassam-Rowe A, Pu Z, Li Y, Ren H, An Y, Guo X, Hu W, Liu Y, Zheng Y, Liu Z, Kou K, Ou X, Chen T, Fan X, Liu Y, Tu S, He Y, Ren Y, Chen A, Shang Z, Xia Z, Miquerol L, Smart N, Zhang H, Tan X, Shou W, Lei M.
Show Full Abstract

The heterogeneity of functional cardiomyocytes arises during heart development, which is essential to the complex and highly coordinated cardiac physiological function. Yet the biological and physiological identities and the origin of the specialized cardiomyocyte populations have not been fully comprehended. Here we report a previously unrecognised population of cardiomyocytes expressing Dbhgene encoding dopamine beta-hydroxylase in murine heart. We determined how these myocytes are distributed across the heart by utilising advanced single-cell and spatial transcriptomic analyses, genetic fate mapping and molecular imaging with computational reconstruction. We demonstrated that they form the key functional components of the cardiac conduction system by using optogenetic electrophysiology and conditional cardiomyocyte Dbh gene deletion models. We revealed their close relationship with sympathetic innervation during cardiac conduction system formation. Our study thus provides new insights into the development and heterogeneity of the mammalian cardiac conduction system by revealing a new cardiomyocyte population with potential catecholaminergic endocrine function.

Also flagged:gene expressionRTDMRT1transcription factortestosteronecollagenase type IV
Journal Article 2023-11-28 No Snippets Malolina EA, Galiakberova AA, Mun VV, Sabirov MS, Dashinimaev EB, Kulibin AY.
Show Full Abstract

The rete testis (RT) is a region of the mammalian testis that plays an important role in testicular physiology. The RT epithelium consists of cells sharing some well-known gene markers with supporting Sertoli cells (SCs). However, little is known about the differences in gene expression between these two cell populations. Here, we used fluorescence-activated cell sorting (FACS) to obtain pure cultures of neonatal RT cells and SCs and identified differentially expressed genes (DEGs) between these cell types using RNA sequencing (RNA-seq). We then compared our data with the RNA-seq data of other studies that examined RT cells and SCs of mice of different ages and generated a list of DEGs permanently upregulated in RT cells throughout testis development and in culture, which included 86 genes, and a list of 79 DEGs permanently upregulated in SCs. The analysis of studies on DMRT1 function revealed that nearly half of the permanent DEGs could be regulated by this SC upregulated transcription factor. We suggest that useful cell lineage markers and candidate genes for the specification of both RT cells and SCs may be present among these permanent DEGs.

Also flagged:insulintype 2 diabetessecretionglucagonadrenalineepinephrine
Journal Article 2023-11-28 No Snippets Castillo-Armengol J, Marzetta F, Rodriguez Sanchez-Archidona A, Fledelius C, Evans M, McNeilly A, McCrimmon RJ, Ibberson M, Thorens B.
Show Full Abstract

<h4>Aims/hypothesis</h4>Repeated exposures to insulin-induced hypoglycaemia in people with diabetes progressively impairs the counterregulatory response (CRR) that restores normoglycaemia. This defect is characterised by reduced secretion of glucagon and other counterregulatory hormones. Evidence indicates that glucose-responsive neurons located in the hypothalamus orchestrate the CRR. Here, we aimed to identify the changes in hypothalamic gene and protein expression that underlie impaired CRR in a mouse model of defective CRR.<h4>Methods</h4>High-fat-diet fed and low-dose streptozocin-treated C57BL/6N mice were exposed to one (acute hypoglycaemia [AH]) or multiple (recurrent hypoglycaemia [RH]) insulin-induced hypoglycaemic episodes and plasma glucagon levels were measured. Single-nuclei RNA-seq (snRNA-seq) data were obtained from the hypothalamus and cortex of mice exposed to AH and RH. Proteomic data were obtained from hypothalamic synaptosomal fractions.<h4>Results</h4>The final insulin injection resulted in similar plasma glucose levels in the RH group and AH groups, but glucagon secretion was significantly lower in the RH group (AH: 94.5±9.2 ng/l [n=33]; RH: 59.0±4.8 ng/l [n=37]; p<0.001). Analysis of snRNA-seq data revealed similar proportions of hypothalamic cell subpopulations in the AH- and RH-exposed mice. Changes in transcriptional profiles were found in all cell types analysed. In neurons from RH-exposed mice, we observed a significant decrease in expression of Avp, Pmch and Pcsk1n, and the most overexpressed gene was Kcnq1ot1, as compared with AH-exposed mice. Gene ontology analysis of differentially expressed genes (DEGs) indicated a coordinated decrease in many oxidative phosphorylation genes and reduced expression of vacuolar H<sup>+</sup>- and Na<sup>+</sup>/K<sup>+</sup>-ATPases; these observations were in large part confirmed in the proteomic analysis of synaptosomal fractions. Compared with AH-exposed mice, oligodendrocytes from RH-exposed mice had major changes in gene expression that suggested reduced myelin formation. In astrocytes from RH-exposed mice, DEGs indicated reduced capacity for neurotransmitters scavenging in tripartite synapses as compared with astrocytes from AH-exposed mice. In addition, in neurons and astrocytes, multiple changes in gene expression suggested increased amyloid beta (Aβ) production and stability. The snRNA-seq analysis of the cortex showed that the adaptation to RH involved different biological processes from those seen in the hypothalamus.<h4>Conclusions/interpretation</h4>The present study provides a model of defective counterregulation in a mouse model of type 2 diabetes. It shows that repeated hypoglycaemic episodes induce multiple defects affecting all hypothalamic cell types and their interactions, indicative of impaired neuronal network signalling and dysegulated hypoglycaemia sensing, and displaying features of neurodegenerative diseases. It also shows that repeated hypoglycaemia leads to specific molecular adaptation in the hypothalamus when compared with the cortex.<h4>Data availability</h4>The transcriptomic dataset is available via the GEO ( http://www.ncbi.nlm.nih.gov/geo/ ), using the accession no. GSE226277. The proteomic dataset is available via the ProteomeXchange data repository ( http://www.proteomexchange.org ), using the accession no. PXD040183.

Also flagged:ARID1AAT-rich interactive domain-containing protein 1Atumorsuppressorangiogenesiskidney cancer
Journal Article 2023-11-28 No Snippets Yoodee S, Peerapen P, Plumworasawat S, Malaitad T, Thongboonkerd V.
Show Full Abstract

<h4>Background</h4>Defects and deficiency of AT-rich interactive domain-containing protein 1A (ARID1A) encoded by a tumor suppressor gene ARID1A have recently been suggested to get involved in angiogenesis, a crucial process in carcinogenesis. However, molecular mechanisms of ARID1A deficiency to induce angiogenesis in kidney cancer remain underinvestigated.<h4>Methods</h4>We performed large-scale identification of ARID1A protein interactors in renal tubular epithelial cells (RTECs) using immunoprecipitation (IP) followed by nanoLC-ESI-LTQ-Orbitrap tandem mass spectrometry (MS/MS). Their roles in angiogenesis were investigated using various assays.<h4>Results</h4>A total of 74 ARID1A-interacting proteins were identified. Protein-protein interactions analysis revealed that these identified proteins interacted directly or indirectly with ARID1A. Among them, the direct interaction between ARID1A and β-actin was validated by IP and reciprocal IP followed by Western blotting. Small interfering RNA (siRNA) was used for single and double knockdowns of ARID1A and ACTB. Semi-quantitative RT-PCR demonstrated that deficiency of ARID1A, but not ACTB, significantly affected expression of angiogenesis-related genes in RTECs (VEGF and FGF2 were increased, whereas PDGF and EGF were decreased). However, the knockdowns did not affect TGFB1 and FGF1 levels. The quantitative mRNA expression data of VEGF and TGFB1 were consistent with the secreted levels of their protein products as measured by ELISA. Only secreted products derived from ARID1A-deficient RTECs significantly increased endothelial cells (ECs) migration and tube formation. Some of the other carcinogenic features could also be confirmed in the ARID1A-deficient RTECs, including increased cell migration and chemoresistance. Double knockdowns of both ARID1A and ACTB did not enhance the effects of single ARID1A knockdown in all assays.<h4>Conclusions</h4>We report herein a large dataset of the ARID1A-interacting proteins in RTECs using an IP-MS/MS approach and confirm the direct interaction between ARID1A and β-actin. However, the role of ARID1A deficiency in angiogenesis is independent of β-actin.

Also flagged:cancerantigen receptorhematological malignanciessolid cancersolid cancerssolid tumor
Journal Article 2023-11-28 No Snippets Hadiloo K, Taremi S, Heidari M, Esmaeilzadeh A.
Show Full Abstract

Today, adoptive cell therapy has many successes in cancer therapy, and this subject is brilliant in using chimeric antigen receptor T cells. The CAR T cell therapy, with its FDA-approved drugs, could treat several types of hematological malignancies and thus be very attractive for treating solid cancer. Unfortunately, the CAR T cell cannot be very functional in solid cancers due to its unique features. This treatment method has several harmful adverse effects that limit their applications, so novel treatments must use new cells like NK cells, NKT cells, and macrophage cells. Among these cells, the CAR macrophage cells, due to their brilliant innate features, are more attractive for solid tumor therapy and seem to be a better candidate for the prior treatment methods. The CAR macrophage cells have vital roles in the tumor microenvironment and, with their direct effect, can eliminate tumor cells efficiently. In addition, the CAR macrophage cells, due to being a part of the innate immune system, attended the tumor sites. With the high infiltration, their therapy modulations are more effective. This review investigates the last achievements in CAR-macrophage cells and the future of this immunotherapy treatment method.

HTT
Also flagged:ubiquitinTNFαIL-1NF-κBcancerslymphoma
Journal Article 2023-11-28 ✓ 2 Snippets Li J, Liu S, Li S.
In-Text Gene Mentions

…enic polyglutamine expansion (Htt-polyQ) through p97/VCP […

…linear polyubiquitin onHtt-polyQ aggregates.…

Show Full Abstract

Linear ubiquitination is a distinct type of ubiquitination that involves attaching a head-to-tail polyubiquitin chain to a substrate protein. Early studies found that linear ubiquitin chains are essential for the TNFα- and IL-1-mediated NF-κB signaling pathways. However, recent studies have discovered at least sixteen linear ubiquitination substrates, which exhibit a broader activity than expected and mediate many other signaling pathways beyond NF-κB signaling. Dysregulation of linear ubiquitination in these pathways has been linked to many types of cancers, such as lymphoma, liver cancer, and breast cancer. Since the discovery of linear ubiquitin, extensive effort has been made to delineate the molecular mechanisms of how dysregulation of linear ubiquitination causes tumorigenesis and cancer development. In this review, we highlight newly discovered linear ubiquitination-mediated signaling pathways, recent advances in the role of linear ubiquitin in different types of cancers, and the development of linear ubiquitin inhibitors. Video Abstract.

CACNA1E
Also flagged:axonamyotrophic lateral sclerosisALSTDP-43C9orf72ankyrin-G
Journal Article 2023-11-28 ✓ 1 Snippet Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I.
In-Text Gene Mentions

…plasticity such asCACNA1Eand CAMK2B .…

Show Full Abstract

Dysregulated neuronal excitability is a hallmark of amyotrophic lateral sclerosis (ALS). We sought to investigate how functional changes to the axon initial segment (AIS), the site of action potential generation, could impact neuronal excitability in ALS human induced pluripotent stem cell (hiPSC) motor neurons. We find that early TDP-43 and C9orf72 hiPSC motor neurons show an increase in the length of the AIS and impaired activity-dependent AIS plasticity that is linked to abnormal homeostatic regulation of neuronal activity and intrinsic hyperexcitability. In turn, these hyperactive neurons drive increased spontaneous myofiber contractions of in vitro hiPSC motor units. In contrast, late hiPSC and postmortem ALS motor neurons show AIS shortening, and hiPSC motor neurons progress to hypoexcitability. At a molecular level, aberrant expression of the AIS master scaffolding protein ankyrin-G and AIS-specific voltage-gated sodium channels mirror these dynamic changes in AIS function and excitability. Our results point toward the AIS as an important site of dysfunction in ALS motor neurons.

HTT
Also flagged:Huntington DiseaseHDbehavioralautosomal dominant neurodegenerative diseasechromosomeHuntington's Disease
Journal Article 2023-11-28 ✓ 3 Snippets Langbehn DR, Sathe SS, Loy C, Sampaio C, Mccusker EA.
In-Text Gene Mentions

Huntington disease (HD) is an inherited autosomal dominant neurodegenerative disease caused by an unstable expansion of CAG repeats in exon 1 of the huntingtin gene (HTT) on chromosome 4 that encodes the huntingtin protein (HTT).

…huntingtin gene (HTT) on chromosome…

…the huntingtin protein (HTT).…

Show Full Abstract

<h4>Background and objectives</h4>The variable CAG repeat expansion in the huntingtin gene and its inverse relationship to motor dysfunction onset are fundamental features of Huntington disease (HD). However, the wider phenotype (including non-motor features) at particular CAG lengths, ages, and functional levels is less well-characterized. The large number of participants in the Enroll-HD observational study enables the development of a phenotype atlas that summarizes the range and distribution of HD phenotypes, including outliers and possible clusters, with respect to various CAG repeat lengths, age ranges, and declining functional levels.<h4>Methods</h4>Enroll-HD is an ongoing prospective longitudinal observational study that collects natural history data, releasing periodic data sets, in people with HD (PwHD) and controls. Core assessments at annual visits focus on behavioral, cognitive, motor, and functional status. Periodic data set 5, used for the development of the first iteration of the Enroll-HD Phenotype Atlas (EHDPA), included all eligible data collected through October 31, 2020. The atlas is based on subsets (cells) of descriptive data for all motor, cognitive, psychiatric, and functional measures that are routinely collected at most Enroll-HD sites, analyzed by single CAG lengths and 5-year age blocks.<h4>Results</h4>Data from 42,840 visits from 15,982 unique PwHD were available for analysis. At baseline, participants had a mean ± SD age of 48.9 ± 13.9 years and CAG repeat length of 43.4 ± 3.6 and 54.1% were female. The EHDPA includes 223 age-by-CAG subsets for CAG repeats between 36 and 69 with five-year age brackets starting from 20-24 years up to 85-89 years. The atlas can be browsed at enroll-hd.org/for-researchers/atlas-of-hd-phenotype/.<h4>Discussion</h4>The EHDPA summarizes the spectrum and distribution of HD phenotypes, including outliers and possible clusters, in all domains of disease involvement for the range of CAG repeat lengths, ages, and functional levels. Its availability in an easy-to-use online format will assist clinicians in tracking disease progression in PwHD by identifying phenotypic features most associated with loss of function and enabling conversations related to prognosis. The observable patterns in the EHDPA should also catalyze more formal multidomain characterization of motor, cognitive, and psychiatric progression and their relationships to functional decline and disease modifiers.<h4>Trial registration information</h4>Enroll-HD is registered with clinicaltrials.gov: NCT01574053.

Also flagged:antibiotic
Journal Article 2023-11-28 No Snippets Oliver A, Kay M, Lemay DG.
Show Full Abstract

<h4>Motivation</h4>Biologists increasingly turn to machine learning models not just to predict, but to explain. Feature reduction is a common approach to improve both the performance and interpretability of models. However, some biological datasets, such as microbiome data, are inherently organized in a taxonomy, but these hierarchical relationships are not leveraged during feature reduction. We sought to design a feature engineering algorithm to exploit relationships in hierarchically organized biological data.<h4>Results</h4>We designed an algorithm, called TaxaHFE, to collapse information-poor features into their higher taxonomic levels. We applied TaxaHFE to six previously published datasets and found, on average, a 90% reduction in the number of features (SD = 5.1%) compared to using the most complete taxonomy. Using machine learning to compare the most resolved taxonomic level (i.e. species) against TaxaHFE-preprocessed features, models based on TaxaHFE features achieved an average increase of 3.47% in receiver operator curve area under the curve. Compared to other hierarchical feature engineering implementations, TaxaHFE introduces the novel ability to consider both categorical and continuous response variables to inform the feature set collapse. Importantly, we find TaxaHFE's ability to reduce hierarchically organized features to a more information-rich subset increases the interpretability of models.<h4>Availability and implementation</h4>TaxaHFE is available as a Docker image and as R code at https://github.com/aoliver44/taxaHFE.

HFE
Also flagged:Ironmetabolismiron deficiencymineraloxygencitric acid
Journal Article 2023-11-28 ✓ 1 Snippet Kardasis W, Naquin ER, Garg R, Arun T, Gopianand JS, Karmakar E, Gnana-Prakasam JP.
In-Text Gene Mentions

…were positive forHFEmutations for hereditary…

Show Full Abstract

Iron is an essential micronutrient for athletes, intricately linked to their performance, by regulating cellular respiration and metabolism. Impaired iron levels in the body can significantly hinder athletic performance. The increased demand for iron due to exercise, coupled with potential dietary iron insufficiencies, particularly among endurance athletes, amplifies the risk of iron deficiency. Moreover, prolonged exercise can impact iron absorption, utilization, storage, and overall iron concentrations in an athlete. On the contrary, iron overload may initially lead to enhanced performance; however, chronic excess iron intake or underlying genetic conditions can lead to detrimental health consequences and may negatively impact athletic performance. Excess iron induces oxidative damage, not only compromising muscle function and recovery, but also affecting various tissues and organs in the body. This narrative review delineates the complex relationship between exercise and iron metabolism, and its profound effects on athletic performance. The article also provides guidance on managing iron intake through dietary adjustments, oral iron supplementation for performance enhancement in cases of deficiency, and strategies for addressing iron overload in athletes. Current research is focused on augmenting iron absorption by standardizing the route of administration while minimizing side effects. Additionally, there is ongoing work to identify inhibitors and activators that affect iron absorption, aiming to optimize the body's iron levels from dietary sources, supplements, and chelators. In summary, by refining the athletic diet, considering the timing and dosage of iron supplements for deficiency, and implementing chelation therapies for iron overload, we can effectively enhance athletic performance and overall well-being.

Also flagged:AutophagySenescencelipidmetabolismdegradationbile acid
Journal Article 2023-11-28 No Snippets Li Q, Lin Y, Liang G, Xiao N, Zhang H, Yang X, Yang J, Liu A.
Show Full Abstract

The liver is the primary organ accountable for complex physiological functions, including lipid metabolism, toxic chemical degradation, bile acid synthesis, and glucose metabolism. Liver function homeostasis is essential for the stability of bodily functions and is involved in the complex regulation of the balance between cell proliferation and cell death. Cell proliferation-halting mechanisms, including autophagy and senescence, are implicated in the development of several liver diseases, such as cholestasis, viral hepatitis, nonalcoholic fatty liver disease, liver fibrosis, and hepatocellular carcinoma. Among various cell death mechanisms, autophagy is a highly conserved and self-degradative cellular process that recycles damaged organelles, cellular debris, and proteins. This process also provides the substrate for further metabolism. A defect in the autophagy machinery can lead to premature diseases, accelerated aging, inflammatory state, tumorigenesis, and cellular senescence. Senescence, another cell death type, is an active player in eliminating premalignant cells. At the same time, senescent cells can affect the function of neighboring cells by secreting the senescence-associated secretory phenotype and induce paracrine senescence. Autophagy can promote and delay cellular senescence under different contexts. This review decodes the roles of autophagy and senescence in multiple liver diseases to achieve a better understanding of the regulatory mechanisms and implications of autophagy and senescence in various liver diseases.

Also flagged:PDGF2peptidePDGF-BBRADA16-Ipeptideswound healing
Journal Article 2023-11-28 No Snippets Deptuła M, Sawicka J, Sass P, Sosnowski P, Karpowicz P, Zawrzykraj M, Wardowska A, Tymińska A, Dzierżyńska M, Pietralik-Molińska Z, Peplińska B, Zieliński J, Kondej K, Kozak M, Sachadyn P, Rodziewicz-Motowidło S, Pikuła M.
Show Full Abstract

<b>Background:</b> Wound healing complications affect numerous patients each year, creating significant economic and medical challenges. Currently, available methods are not fully effective in the treatment of chronic or complicated wounds; thus, new methods are constantly sought. Our previous studies showed that a peptide designated as PDGF2 derived from PDGF-BB could be a promising drug candidate for wound treatment and that RADA16-I can serve as a release system for bioactive peptides in wound healing. Based on that, in this work, we designed a new self-assembling hydrogel RADA-PDGF2, connecting both peptides by a sequence specific for neutrophil elastase, and evaluated its activity in wound healing. <b>Methods:</b> The physicochemical properties of the designed scaffold were analyzed using transmission electron microscopy, atomic force microscopy, cryoSEM microscopies, and circular dichroism spectroscopy. The enzymatic cleavage was performed using human neutrophil elastase and monitored using high-performance liquid chromatography and MS spectroscopic techniques. The aforementioned techniques (HPLC and MS) were also used to assess the stability of the peptide in water and human plasma. The biological activity was analyzed on human skin cells using a colorimetric XTT test, collagen synthesis evaluation, and a migration assay. The biocompatibility was analyzed with LDH cytotoxicity assay and flow cytometric analysis of activation of immune cells. Finally, RADA-PDGF2 activity in wound healing was checked in a mouse dorsal skin injury model. <b>Results:</b> The analysis showed that RADA-PDGF2 can self-assemble, form a hydrogel, and release a bioactive sequence when incubated with human elastase. It shows pro-proliferative and pro-migratory properties and accelerates wound closure in the mouse model compared to RADA16-I. In addition, it is not cytotoxic to human cells and does not show immunogenicity. RADA-PDGF2 seems to be a promising drug candidate for wound management.

Also flagged:antibodycell-mediated cytotoxicitycytokineCD16toactivation
Journal Article 2023-11-28 No Snippets Bennett-Boehm MMC, Mahr AR, Hartwell ST, Regan AK, Weber IS, Blackmon A, Bisson CR, Truong AN, Circo BA, Nienhueser J, Rogers DR, Booher N, Rajagopalan N, Martens JWS, Denton PW.
Show Full Abstract

Assays to quantify natural killer (NK) cell killing efficacy have traditionally focused on assessing either direct killing or antibody dependent cell-mediated cytotoxicity (ADCC) independently. Due to the probability that immunotherapeutic interventions affect NK cell-mediated direct killing and NK cell-mediated ADCC differently, we developed an assay with the capacity to measure NK cell-mediated direct killing and ADCC simultaneously with cells from the same human donor. Specifically, this design allows for a single NK cell population to be split into several experimental conditions (e.g., direct killing, ADCC), thus controlling for potential confounders associated with human-to-human variation when assessing immunotherapy impacts. Our Natural Killer cell Simultaneous ADCC and Direct Killing Assay (NK-SADKA) allows researchers to reproducibly quantify both direct killing and ADCC by human NK cells. Furthermore, this optimized experimental design allows for concurrent analysis of the NK cells via flow cytometric immunophenotyping of NK cell populations which will facilitate the identification of relationships between NK cell phenotype and the subsequent killing potential. This assay will be valuable for assessing the broader impact(s) of immunotherapy strategies on both modes of NK cell killing.

Also flagged:HydroxyapatitesynthesisMetaltumorinfectioncollagens
Journal Article 2023-11-28 No Snippets Wang X, Huang S, Peng Q.
Show Full Abstract

Hydroxyapatite (HA)-based materials are widely used in the bone defect restoration field due to their stable physical properties, good biocompatibility, and bone induction potential. To further improve their performance with extra functions such as antibacterial activity, various kinds of metal ion-doped HA-based materials have been proposed and synthesized. This paper offered a comprehensive review of metal ion-doped HA-based materials for bone defect restoration based on the introduction of the physicochemical characteristics of HA followed by the synthesis methods, properties, and applications of different kinds of metal ion (Ag<sup>+</sup>, Zn<sup>2+</sup>, Mg<sup>2+</sup>, Sr<sup>2+</sup>, Sm<sup>3+</sup>, and Ce<sup>3+</sup>)-doped HA-based materials. In addition, the underlying challenges for bone defect restoration using these materials and potential solutions were discussed.

HFE
Also flagged:psoriasisskin diseaseOral Psoriasisautoimmune inflammatory disordergenetic diseasesdermatological diseases
Journal Article 2023-11-28 ✓ 1 Snippet Garg A, Warrier S A, Subadra K.
In-Text Gene Mentions

Type 1 psoriasis1 psoriasis has…

Show Full Abstract

Congenital psoriasis is a rare skin disease that can clinically manifest in the oral cavity in many ways. Although manifestations over the skin are frequent, oral manifestations are rare, especially in pediatric patients. A clear family history, proper examination, and investigations are essential to diagnose this condition. This case report aims to highlight the oral and systemic manifestations of a case of psoriasis in a male pediatric patient.

HFE
Also flagged:Homeostatic iron regulatory proteinglioblastomatumorironGBMglioma
Journal Article 2023-11-28 ✓ 5 Snippets Troike KM, Wang SZ, Silver DJ, Lee J, Mulkearns-Hubert EE, Hajdari N, Ghosh PK, Kay KE, Beilis JL, Mitchell SE, Bishop CW, Hong ES, Artomov M, Hubert CG, Rajappa P, Connor JR, Fox PL, Kristensen BW, Lathia JD.
In-Text Gene Mentions

In isocitrate dehydrogenase 1 (IDH1) wild-type GBM patients, we found a statistically significant difference in survival, with high-HFE patients displaying a poorer prognosis (Figure 1C).

Previous work has described an association between increased HFE expression and truncated GBM patient survival.22 Accordingly, we find that HFE is upregulated in GBM tumors compared to nontumor brain tissue.

To determine the impact of Hfe knockdown on tumor cell growth in vitro, we first performed a trypan blue-exclusion assay and cell counts.

We utilized the GEPIA database29 and found significantly elevated HFE expression in GBM compared to nontumor brain tissue (Figure 1A).

In addition, our findings indicate that Hfe manipulation impacts both the tumor cells in a cell-intrinsic manner as well as the immune response in a sex-specific manner, suggesting that Hfe likely serves multiple roles in GBM.

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) displays alterations in iron that drive proliferation and tumor growth. Iron regulation is complex and involves many regulatory mechanisms, including the homeostatic iron regulator (<i>HFE</i>) gene, which encodes the homeostatic iron regulatory protein. While <i>HFE</i> is upregulated in GBM and correlates with poor survival outcomes, the function of HFE in GBM remains unclear.<h4>Methods</h4>We interrogated the impact of cell-intrinsic <i>Hfe</i> expression on proliferation and survival of intracranially implanted animals through genetic gain- and loss-of-function approaches in syngeneic mouse glioma models, along with in vivo immune assessments. We also determined the expression of iron-associated genes and their relationship to survival in GBM using public data sets and used transcriptional profiling to identify differentially expressed pathways in control compared to <i>Hfe</i>-knockdown cells.<h4>Results</h4>Overexpression of <i>Hfe</i> accelerated GBM proliferation and reduced animal survival, whereas suppression of <i>Hfe</i> induced apoptotic cell death and extended survival, which was more pronounced in females and associated with attenuation of natural killer cells and CD8+ T cell activity. Analysis of iron gene signatures in <i>Hfe</i>-knockdown cells revealed alterations in the expression of several iron-associated genes, suggesting global disruption of intracellular iron homeostasis. Further analysis of differentially expressed pathways revealed oxidative stress as the top pathway upregulated following <i>Hfe</i> loss. <i>Hfe</i> knockdown indeed resulted in enhanced <sup>55</sup>Fe uptake and generation of reactive oxygen species.<h4>Conclusions</h4>These findings reveal an essential function for HFE in GBM cell growth and survival, as well as a sex-specific interaction with the immune response.

Research Square 2023-11-28 Preprint (No Snippets API) Wang X, Gu Y, Liu X, Wang Q, Chen X, Chen J.
Show Full Abstract

<title>Abstract</title> <p>Neutrophil extracellular traps (NETs) provide key innate immune mechanisms, and studies have shown innate immunity and adaptive immunity are directly linked in Parkinson’s disease (PD) pathology. However, there are few studies on NETs in PD. Differential analysis was implemented to acquire differentially expressed genes (DEGs) between PD and Control, and between high- and low-score groups obtained by GSVA. Then, the DEGs between PD and Control groups, DEGs between the two score groups, and the genes in the critical module were overlapped to achieve the overlapping genes. Next, five kinds of algorithms in the PPI were performed to achieve biomarkers. Subsequently, a nomogram for forecasting PD probability was created. Enrichment analysis and immune infiltration analysis was conducted of biomarkers. qRT-PCR was performed to verify the expression trends of three biomarkers. Results shown there were 798 DEGs between PD and Control groups and 168 DEGs between high- and low-score groups obtained by differential analyses. The pink module containing 926 genes was identified as the critical module. According to the intersection, 43 overlapping genes were screened out. Furthermore, GPR78, CADM3, and CACNA1E were confirmed as biomarkers. Moreover, we found that biomarkers mainly participated in pathways, such as ‘hydrogen peroxide catabolic process’ and ‘cell cycle’. Five kinds of differential immune cells between PD and Control groups were identified. Finally, the qRT-PCR result showed that GPR78, CADM3, and CACNA1E all up-regulated in the PD group. Our study authenticated GPR78, CADM3, and CACNA1E as the biomarkers were associated with PD. It provides an original reference for the diagnosis and treatment of PD.</p>

Also flagged:Lung Cancercancervinyl carbamateadenocarcinomagene expressionadenoma
Journal Article 2023-11-27 No Snippets Blomberg R, Sompel K, Hauer C, Smith AJ, Peña B, Driscoll J, Hume PS, Merrick DT, Tennis MA, Magin CM.
Show Full Abstract

Lung cancer is the leading global cause of cancer-related deaths. Although smoking cessation is the best prevention, 50% of lung cancer diagnoses occur in people who have quit smoking. Research into treatment options for high-risk patients is constrained to rodent models, which are time-consuming, expensive, and require large cohorts. Embedding precision-cut lung slices (PCLS) within an engineered hydrogel and exposing this tissue to vinyl carbamate, a carcinogen from cigarette smoke, creates an in vitro model of lung cancer premalignancy. Hydrogel formulations are selected to promote early lung cancer cellular phenotypes and extend PCLS viability to six weeks. Hydrogel-embedded PCLS are exposed to vinyl carbamate, which induces adenocarcinoma in mice. Analysis of proliferation, gene expression, histology, tissue stiffness, and cellular content after six weeks reveals that vinyl carbamate induces premalignant lesions with a mixed adenoma/squamous phenotype. Putative chemoprevention agents diffuse through the hydrogel and induce tissue-level changes. The design parameters selected using murine tissue are validated with hydrogel-embedded human PCLS and results show increased proliferation and premalignant lesion gene expression patterns. This tissue-engineered model of human lung cancer premalignancy is the foundation for more sophisticated ex vivo models that enable the study of carcinogenesis and chemoprevention strategies.

HTT
Also flagged:Huntington diseasegenisteinFOXO3neurodegenerative disorderHDautophagy
Journal Article 2023-11-27 ✓ 5 Snippets Pierzynowska K, Podlacha M, Gaffke L, Rintz E, Wiśniewska K, Cyske Z, Węgrzyn G.
In-Text Gene Mentions

Abbreviations: CNS: central nervous system; EPM: elevated plus-maze; GOT1/ASPAT: glutamic-oxaloacetic transaminase 1, soluble; GPT/ALAT/ALT: glutamic pyruvic transaminase, soluble; HD: Huntington disease; HTT: huntingtin; IL: interleukin; mHTT: mutant huntingtin; NOR: novel object recognition; MWM: Morris water maze; OF: open field; ROS: reactive oxygen species; TNF: tumor necrosis factor

To test the hypothesis that FOXO3 is involved in the genistein-mediated stimulation of autophagy and subsequent elimination of mHTT aggregates, we have silenced the expression of the FOXO3-encoding gene in human fibroblasts derived from both HD patients and control individuals and monitored the effects of genistein on HTT levels.

However, silencing of expression of FOXO3 by specific siRNAs resulted in impairing the efficiency of the genistein-mediated decrease in HTT levels (Figure 15).

Interestingly, soluble HTT levels were drastically decreased in untreated and water-treated HD mice, while this form of the protein was as abundant in genistein-treated R6/1 mice as in genistein-treated wild-type animals (Figure 8).

…HD: Huntington disease;HTT: huntingtin; IL: interleukin;…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disorder caused by a mutation in the <i>HTT</i> gene. The expansion of CAG triplets leads to the appearance of misfolded HTT (huntingtin) forming aggregates and leading to impairment of neuronal functions. Here we demonstrate that stimulation of macroautophagy/autophagy by genistein (4',5,7-trihydroxyisoflavone or 5,7-dihydroxy-3-(4-hydroxyphenyl)-4 H-1-benzopyran-4-one) caused a reduction of levels of mutated HTT in brains of HD mice and correction of their behavior as assessed in a battery of cognitive, anxiety and motor tests, even if the compound was administered after symptoms had developed in the animals. Biochemical and immunological parameters were also improved in HD mice. Studies on molecular mechanisms of genistein-mediated stimulation of autophagy in HD cells indicated the involvement of the FOXO3-related pathway. In conclusion, treatment with genistein stimulates the autophagy process in the brains of HD mice, leading to correction of symptoms of HD, suggesting that it might be considered as a potential drug for this disease. Combined with a very recently published report indicating that impaired autophagy may be a major cause of neurodegenerative changes, these results may indicate the way to the development of effective therapeutic approaches for different neurodegenerative diseases by testing compounds (or possibly combinations of compounds) capable of stimulating autophagy and/or unblocking this process.<b>Abbreviations</b>: CNS: central nervous system; EPM: elevated plus-maze; GOT1/ASPAT: glutamic-oxaloacetic transaminase 1, soluble; GPT/ALAT/ALT: glutamic pyruvic transaminase, soluble; HD: Huntington disease; HTT: huntingtin; IL: interleukin; mHTT: mutant huntingtin; NOR: novel object recognition; MWM: Morris water maze; OF: open field; ROS: reactive oxygen species; TNF: tumor necrosis factor.

PTGIS
Also flagged:deltamethrinSODsteroid hormonebiosynthesisfatty acidmetabolism
Journal Article 2023-11-27 ✓ 2 Snippets Wu H, Gao J, Xie Z, Xie M, Song R, Yuan X, Wu Y, Ou D.
In-Text Gene Mentions

Transcriptomics analysis revealed that chronic Del exposure caused lipid metabolism disorder, endocrine disruption, and proinflammatory immune response by upregulating the pla2g4, cox2, log5, ptgis, lcn, and cbr expression.

…pla2g4, cox2, log5,ptgis, lcn, and cbr…

Show Full Abstract

Deltamethrin (Del), a widely administered pyrethroid insecticide, has been established as a common contaminant of the freshwater environment and detected in many freshwater ecosystems. In this study, we investigated the changes in brain transcriptome and metabolome of crucian carp after exposure to 0.6 μg/L Del for 28 days. Elevated MDA levels and inhibition of SOD activity indicate damage to the antioxidant system. Moreover, a total of 70 differential metabolites (DMs) were identified using the liquid chromatography-mass spectrometry, including 32 upregulated and 38 downregulated DMs in the Del-exposed group. The DMs associated with chronic Del exposure were enriched in steroid hormone biosynthesis, fatty acid metabolism, and glycerophospholipid metabolism for prostaglandin G2, 5-oxoeicosatetraenoic acid, progesterone, androsterone, etiocholanolone, and hydrocortisone. Transcriptomics analysis revealed that chronic Del exposure caused lipid metabolism disorder, endocrine disruption, and proinflammatory immune response by upregulating the pla2g4, cox2, log5, ptgis, lcn, and cbr expression. Importantly, the integrative analysis of transcriptomics and metabolomics indicated that the arachidonic acid metabolism pathway and steroid hormone biosynthesis were decisive processes in the brain tissue of crucian carp after Del exposure. Furthermore, Del exposure perturbed the tight junction, HIF-1 signaling pathway, and thyroid hormone signaling pathway. Overall, transcriptome and metabolome data of our study offer a new insight to assess the risk of chronic Del exposure in fish brains.

ARFGEF2
Also flagged:methylationinsulinmetabolisminsulin resistanceTETdemethylation
Journal Article 2023-11-27 ✓ 1 Snippet Konstantinidis I, Sætrom P, Brieuc SO, Jakobsen KS, Liedtke H, Pohlmann C, Tsoulia T, Fernandes JMO.
In-Text Gene Mentions

The differentially hydroxymethylated genes included several Rho and Rac/Cdc42 guanine nucleotide exchange factors (arhgef17, LOC100708472: arhgef12, arhgef37, arhgef10l, LOC100705949: arhgef25, arhgef4, and arhgef6), brefeldin A-inhibited guanine nucleotide exchange proteins (arfgef1 and LOC100708121: arfgef2), as well as the Rho GTPase-activating protein 7 (LOC100696392: dlc1) and the FYVE RhoGEF and PH domain containing proteins 1 and 3 (fgd1 and LOC100689713: fgd3), which are involved in cell growth, cell survival, and gene transcription.

Show Full Abstract

Phenotypic plasticity of metabolism and growth are essential for adaptation to new environmental conditions, such as those experienced during domestication. Epigenetic regulation plays a key role in this process but the underlying mechanisms are poorly understood, especially in the case of hydroxymethylation. Using reduced representation 5-hydroxymethylcytosine profiling, we compared the liver hydroxymethylomes in full-sib Nile tilapia with distinct growth rates (3.8-fold difference) and demonstrated that DNA hydroxymethylation is strongly associated with phenotypic divergence of somatic growth during the early stages of domestication. The 2677 differentially hydroxymethylated cytosines between fast- and slow-growing fish were enriched within gene bodies (79%), indicating a pertinent role in transcriptional regulation. Moreover, they were found in genes involved in biological processes related to skeletal system and muscle structure development, and there was a positive association between somatic growth and 5hmC levels in genes coding for growth factors, kinases and receptors linked to myogenesis. Single nucleotide polymorphism analysis revealed no genetic differentiation between fast- and slow-growing fish. In addition to unveiling a new link between DNA hydroxymethylation and epigenetic regulation of growth in fish during the initial stages of domestication, this study suggests that epimarkers may be applied in selective breeding programmes for superior phenotypes.

Also flagged:irondeathlipidferroptosismetabolismcysteine
Journal Article 2023-11-27 No Snippets Yadav VK, Choudhary N, Gacem A, Verma RK, Abul Hasan M, Tarique Imam M, Almalki ZS, Yadav KK, Park HK, Ghosh T, Kumar P, Patel A, Kalasariya H, Jeon BH, Ali AlMubarak H.
Show Full Abstract

Ferroptosis is an emerging and novel type of iron-dependent programmed cell death which is mainly caused by the excessive deposition of free intracellular iron in the brain cells. This deposited free iron exerts a ferroptosis pathway, resulting in lipid peroxidation (LiPr). There are mainly three ferroptosis pathways viz. iron metabolism-mediated cysteine/glutamate, and LiPr-mediated. Iron is required by the brain as a redox metal for several physiological activities. Due to the iron homeostasis balance disruption, the brain gets adversely affected which further causes neurodegenerative diseases (NDDs) like Parkinson's and Alzheimer's disease, strokes, and brain tumors like glioblastoma (GBS), and glioma. Nanotechnology has played an important role in the prevention and treatment of these NDDs. A synergistic effect of nanomaterials and ferroptosis could prove to be an effective and efficient approach in the field of nanomedicine. In the current review, the authors have highlighted all the latest research in the field of ferroptosis, specifically emphasizing on the role of major molecular key players and various mechanisms involved in the ferroptosis pathway. Moreover, here the authors have also addressed the correlation of ferroptosis with the pathophysiology of NDDs and theragnostic effect of ferroptosis and nanomaterials for the prevention and treatment of NDDs.

DCC
Also flagged:colorectal cancerprimary tumorsliver metastasesbrain metastaseschromosomecancers
Journal Article 2023-11-27 ✓ 1 Snippet Brandt VP, Holland H, Wallenborn M, Koschny R, Frydrychowicz C, Richter M, Holland L, Nestler U, Sander C.
In-Text Gene Mentions

…and 18q (DCC/SMAD4 ) were conserved…

Show Full Abstract

<h4>Purpose</h4>Brain metastasis formation is a rare and late event in colorectal cancer (CRC) patients and associated with poor survival. In contrast to other metastatic sites, the knowledge on chromosomal aberrations in brain metastases is very limited.<h4>Methods</h4>Therefore, we carried out single nucleotide polymorphism (SNP) array analyses on matched primary CRC and brain metastases of four patients as well as on liver metastases of three patients.<h4>Results</h4>Brain metastases showed more chromosomal aberrations than primary tumors or liver metastases. Commonly occurring aberrations were gain of 8q11.1-q24.3 (primary CRC), gain of 13q12.13-q12.3 (liver metastases), and gain of 20q11.1-q13.33 (brain metastases). Furthermore, we found one copy-neutral loss of heterozygosity (cn-LOH) region on chromosome 3 in primary CRC, three cn-LOH regions in liver metastases and 23 cn-LOH regions in brain metastases, comprising 26 previously undescribed sites.<h4>Conclusion</h4>The more frequent occurrence of cn-LOHs and subsequently affected genes in brain metastases shed light on the pathophysiology of brain metastasis formation. Further pairwise genetic analyses between primary tumors and their metastases will help to define the role of affected genes in cn-LOH regions.

DNAH10
Also flagged:tumorcancercancersnucleusgene expressiontumors
Journal Article 2023-11-27 ✓ 4 Snippets Chen H, Fang X, Shao J, Zhang Q, Xu L, Chen J, Mei Y, Jiang M, Wang Y, Li Z, Chen Z, Chen Y, Yu C, Ma L, Zhang P, Zhang T, Liao Y, Lv Y, Wang X, Yang L, Fu Y, Chen D, Jiang L, Yan F, Lu W, Chen G, Shen H, Wang J, Wang C, Liang T, Han X, Wang Y, Guo G.
In-Text Gene Mentions

The absence of DNAH10 expression may affect motile cilia assembly, as DNAH10 knockout mice display abnormal sperm flagella structures resembling asthenozoospermia‐like symptoms.[42] Additionally, the transcription factor RFX3, associated with lung ciliated cells, was expressed at low levels in ciliated‐like malignant cells (Figure S7c,e, Supporting Information).[43] Mutation profiles of ciliated‐like malignant cells and nonmalignant epithelial cells suggest that these expression differences may not be attributed to mutations (Figure S7f, Supporting Information).

…DNAH family gene,DNAH10(Figure S7d ,…

…The absence ofDNAH10expression may affect…

…cilia assembly, asDNAH10knockout mice display…

Show Full Abstract

Tumor heterogeneity and its drivers impair tumor progression and cancer therapy. Single-cell RNA sequencing is used to investigate the heterogeneity of tumor ecosystems. However, most methods of scRNA-seq amplify the termini of polyadenylated transcripts, making it challenging to perform total RNA analysis and somatic mutation analysis.Therefore, a high-throughput and high-sensitivity method called snHH-seq is developed, which combines random primers and a preindex strategy in the droplet microfluidic platform. This innovative method allows for the detection of total RNA in single nuclei from clinically frozen samples. A robust pipeline to facilitate the analysis of full-length RNA-seq data is also established. snHH-seq is applied to more than 730 000 single nuclei from 32 patients with various tumor types. The pan-cancer study enables it to comprehensively profile data on the tumor transcriptome, including expression levels, mutations, splicing patterns, clone dynamics, etc. New malignant cell subclusters and exploring their specific function across cancers are identified. Furthermore, the malignant status of epithelial cells is investigated among different cancer types with respect to mutation and splicing patterns. The ability to detect full-length RNA at the single-nucleus level provides a powerful tool for studying complex biological systems and has broad implications for understanding tumor pathology.

Also flagged:celldeathinflammatory responsecaspasemembranepore
Journal Article 2023-11-27 No Snippets Ekchariyawat P, Saengfak R, Sanongkiet S, Charoenwongpaiboon T, Khongpraphan S, Mala S, Luangjindarat C, Munyoo B, Chabang N, Charoensutthivarakul S, Borwornpinyo S, Tuchinda P, Ponpuak M, Pudla M, Utaisincharoen P.
Show Full Abstract

<h4>Background</h4>Cleistanthin A (CA), extracted from Phyllanthus taxodiifolius Beille, was previously reported as a potential V-ATPase inhibitor relevant to cancer cell survival. In the present study, ECDD-S16, a derivative of cleistanthin A, was investigated and found to interfere with pyroptosis induction via V-ATPase inhibition.<h4>Objective</h4>This study examined the ability of ECDD-S16 to inhibit endolysosome acidification leading to the attenuation of pyroptosis in Raw264.7 macrophages activated by both surface and endosomal TLR ligands.<h4>Methods</h4>To elucidate the activity of ECDD-S16 on pyroptosis-induced inflammation, Raw264.7 cells were pretreated with the compound before stimulation with surface and endosomal TLR ligands. The release of lactate dehydrogenase (LDH) was determined by LDH assay. Additionally, the production of cytokines and the expression of pyroptosis markers were examined by ELISA and immunoblotting. Moreover, molecular docking was performed to demonstrate the binding of ECDD-S16 to the vacuolar (V-)ATPase.<h4>Results</h4>This study showed that ECDD-S16 could inhibit pyroptosis in Raw264.7 cells activated with surface and endosomal TLR ligands. The attenuation of pyroptosis by ECDD-S16 was due to the impairment of endosome acidification, which also led to decreased Reactive Oxygen Species (ROS) production. Furthermore, molecular docking also showed the possibility of inhibiting endosome acidification by the binding of ECDD-S16 to the vacuolar (V-)ATPase in the region of V0.<h4>Conclusion</h4>Our findings indicate the potential of ECDD-S16 for inhibiting pyroptosis and prove that vacuolar H+ ATPase is essential for pyroptosis induced by TLR ligands.

Also flagged:host genomesporcine circovirus associated diseasesSynaptogyrin-2SYNGR2immune responseInfection
Journal Article 2023-11-27 No Snippets Walker LR, Vu HL, Montooth KL, Ciobanu DC.
Show Full Abstract

Mammalian evolution has been influenced by viruses for millions of years, leaving signatures of adaptive evolution within genes encoding for viral interacting proteins. Synaptogyrin-2 (SYNGR2) is a transmembrane protein implicated in promoting bacterial and viral infections. A genome-wide association study of pigs experimentally infected with porcine circovirus type 2b (PCV2b) uncovered a missense mutation (SYNGR2 p.Arg63Cys) associated with viral load. In this study, CRISPR/Cas9-mediated gene editing of the porcine kidney 15 (PK15, wtSYNGR2+p.63Arg) cell line generated clones homozygous for the favorable SYNGR2 p.63Cys allele (emSYNGR2+p.63Cys). Infection of edited clones resulted in decreased PCV2 replication compared to wildtype PK15 (P<0.05), with consistent effects across genetically distinct PCV2b and PCV2d isolates. Sequence analyses of wild and domestic pigs (n>700) revealed the favorable SYNGR2 p.63Cys allele is unique to domestic pigs and more predominant in European than Asian breeds. A haplotype defined by the SYNGR2 p.63Cys allele was likely derived from an ancestral haplotype nearly fixed within European (0.977) but absent from Asian wild boar. We hypothesize that the SYNGR2 p.63Cys allele arose post-domestication in ancestral European swine. Decreased genetic diversity in homozygotes for the SYNGR2 p.63Cys allele compared to SYNGR2 p.63Arg, corroborates a rapid increase in frequency of SYGNR2 p.63Cys via positive selection. Signatures of adaptive evolution across mammalian species were also identified within SYNGR2 intraluminal loop domains, coinciding with the location of SYNGR2 p.Arg63Cys. Therefore, SYNGR2 may reflect a novel component of the host-virus evolutionary arms race across mammals with SYNGR2 p.Arg63Cys representing a species-specific example of putative adaptive evolution.

HFE
Also flagged:tumorAFPHepatocellular carcinomaalpha-fetoproteinLiver cancercancers
Journal Article 2023-11-27 ✓ 1 Snippet Kocheise L, Schoenlein M, Behrends B, Joerg V, Casar C, Fruendt TW, Renné T, Heumann A, Li J, Huber S, Lohse AW, Pantel K, Riethdorf S, Wege H, Schulze K, von Felden J.
In-Text Gene Mentions

…(n = 2),hemochromatosis(n = 1),…

Show Full Abstract

Hepatocellular carcinoma (HCC) has high recurrence rates exceeding 50% despite curative resection. The serum biomarker alpha-fetoprotein (AFP) is a well-known prognostic marker for HCC. EpCAM-positive circulating tumor cells (CTC) have a high predictive value for early HCC recurrence after curatively intended resection, most likely indicating micro-metastases at the time of resection. However, sensitivity remains low. The objective of this study was to evaluate a composite test comprising both CTC and AFP to identify patients at high risk for early HCC recurrence. We prospectively enrolled 58 patients undergoing curative intended resection for HCC at a tertiary referral center. Blood specimens were obtained prior to resection and analyzed for EpCAM-positive CTC and serum AFP levels. A positive result was defined as either detection of CTC or AFP levels ≥ 400 ng/ml. Eight patients tested positive for CTC, seven for AFP, and two for both markers. A positive composite test was significantly associated with shorter early recurrence-free survival (5 vs. 16 months, p = 0.005), time to recurrence (5 vs. 16 months, p = 0.011), and overall survival (37 vs. not reached, p = 0.034). Combining CTC and AFP identified patients with poor outcome after surgical resection, for whom adjuvant or neoadjuvant therapies may be particularly desirable.

SLC9C2
Also flagged:RPL39RPL10RPL13AFTH1RPS2RPL18A
Journal Article 2023-11-27 ✓ 2 Snippets Salehi N, Totonchi M.
In-Text Gene Mentions

…their scores, were HLA-C-SLC9C2, CALM1-MIP, CALM2-ADCY8, CALM…

…TheSLC9C2gene product is…

Show Full Abstract

<h4>Background</h4>The testis is a complex organ that undergoes extensive developmental changes from the embryonic stage to adulthood. The development of germ cells, which give rise to spermatozoa, is tightly regulated by the surrounding somatic cells.<h4>Methods</h4>To better understand the dynamics of these changes, we constructed a transcriptional cell atlas of the testis, integrating single-cell RNA sequencing data from over 26,000 cells across five developmental stages: fetal germ cells, infants, childhood, peri-puberty, and adults. We employed various analytical techniques, including clustering, cell type assignments, identification of differentially expressed genes, pseudotime analysis, weighted gene co-expression network analysis, and evaluation of paracrine cell-cell communication, to comprehensively analyze this transcriptional cell atlas of the testis.<h4>Results</h4>Our analysis revealed remarkable heterogeneity in both somatic and germ cell populations, with the highest diversity observed in Sertoli and Myoid somatic cells, as well as in spermatogonia, spermatocyte, and spermatid germ cells. We also identified key somatic cell genes, including RPL39, RPL10, RPL13A, FTH1, RPS2, and RPL18A, which were highly influential in the weighted gene co-expression network of the testis transcriptional cell atlas and have been previously implicated in male infertility. Additionally, our analysis of paracrine cell-cell communication supported specific ligand-receptor interactions involved in neuroactive, cAMP, and estrogen signaling pathways, which support the crucial role of somatic cells in regulating germ cell development.<h4>Conclusions</h4>Overall, our transcriptional atlas provides a comprehensive view of the cell-to-cell heterogeneity in the testis and identifies key somatic cell genes and pathways that play a central role in male fertility across developmental stages.

SOX6
Also flagged:focal segmental glomerulosclerosisFSGSGene Expressiontranscription factorsPPARG coactivator 1 alphaFOXO4
Journal Article 2023-11-27 ✓ 2 Snippets Zhang YX, Bai JY, Pu X, Lv J, Dai EL.
In-Text Gene Mentions

Knockdown of XIST inhibited apoptosis and inflammation in renal fibrosis via miR-19b-mediated downregulation of SOX6 [62].

…19b-mediated downregulation ofSOX6[ 62 ].…

Show Full Abstract

<h4>Objective</h4>The purpose of this study was to identify potential biomarkers in the tubulointerstitium of focal segmental glomerulosclerosis (FSGS) and comprehensively analyze its mRNA-miRNA-lncRNA/circRNA network.<h4>Methods</h4>The expression data (GSE108112 and GSE200818) were downloaded from the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/). Identification and enrichment analysis of differentially expressed genes (DEGs) were performed. the PPI networks of the DEGs were constructed and classified using the Cytoscape molecular complex detection (MCODE) plugin. Weighted gene coexpression network analysis (WGCNA) was used to identify critical gene modules. Least absolute shrinkage and selection operator regression analysis were used to screen for key biomarkers of the tubulointerstitium in FSGS, and the receiver operating characteristic curve was used to determine their diagnostic accuracy. The screening results were verified by quantitative real-time-PCR (qRT-PCR) and Western blot. The transcription factors (TFs) affecting the hub genes were identified by Cytoscape iRegulon. The mRNA-miRNA-lncRNA/circRNA network for identifying potential biomarkers was based on the starBase database.<h4>Results</h4>A total of 535 DEGs were identified. MCODE obtained eight modules. The green module of WGCNA had the greatest association with the tubulointerstitium in FSGS. PPARG coactivator 1 alpha (<i>PPARGC1A</i>) was screened as a potential tubulointerstitial biomarker for FSGS and verified by qRT-PCR and Western blot. The TFs FOXO4 and FOXO1 had a regulatory effect on <i>PPARGC1A</i>. The ceRNA network yielded 17 miRNAs, 32 lncRNAs, and 50 circRNAs.<h4>Conclusions</h4><i>PPARGC1A</i> may be a potential biomarker in the tubulointerstitium of FSGS. The ceRNA network contributes to the comprehensive elucidation of the mechanisms of tubulointerstitial lesions in FSGS.

Also flagged:neuropsychiatric diseaseneuropsychiatric illnessesbrain developmentmental illnessesinfectious diseasepsychiatric disease
Journal Article 2023-11-27 No Snippets McClellan JM, Zoghbi AW, Buxbaum JD, Cappi C, Crowley JJ, Flint J, Grice DE, Gulsuner S, Iyegbe C, Jain S, Kuo PH, Lattig MC, Passos-Bueno MR, Purushottam M, Stein DJ, Sunshine AB, Susser ES, Walsh CA, Wootton O, King MC.
Show Full Abstract

The forces of evolution-mutation, selection, migration, and genetic drift-shape the genetic architecture of human traits, including the genetic architecture of complex neuropsychiatric illnesses. Studying these illnesses in populations that are diverse in genetic ancestry, historical demography, and cultural history can reveal how evolutionary forces have guided adaptation over time and place. A fundamental truth of shared human biology is that an allele responsible for a disease in anyone, anywhere, reveals a gene critical to the normal biology underlying that condition in everyone, everywhere. Understanding the genetic causes of neuropsychiatric disease in the widest possible range of human populations thus yields the greatest possible range of insight into genes critical to human brain development. In this perspective, we explore some of the relationships between genes, adaptation, and history that can be illuminated by an evolutionary perspective on studies of complex neuropsychiatric disease in diverse populations.

Also flagged:mismatch repairsolid tumorsPD-1antibodytumorscancer
Journal Article 2023-11-27 No Snippets Zhang B, Song Y, Luo S, Yin X, Li E, Wang H, He Y, Liu Z, Fan Q, Liang X, Shu Y, Liu Y, Xu N, Zhang S, Zhuang Z, Zhang J, Kou X, Wang F, Zhu X, Zeng S, Wang K, Zhong H, Li S, Bai Y, Yu J, Dou Y, Ma T, Liu Q, Huang J.
Show Full Abstract

We report a multicenter, phase 2 study evaluating the efficacy of pucotenlimab, an anti-PD-1 antibody, in patients with mismatch repair-deficient (dMMR) or microsatellite instability-high (MSI-H) tumors, and potential biomarkers for response. Overall, 100 patients with previously treated, advanced solid tumors centrally confirmed as dMMR or MSI-H received pucotenlimab at 200 mg every 3 weeks. The most common cancer type is colorectal cancer (n = 71). With a median follow-up of 22.5 months, the objective response rate is 49.0% (95% confidence interval 38.86%-59.20%) as assessed by the independent review committee, while the median progression-free survival and overall survival have not been reached. Grade ≥3 treatment-related adverse events were observed in 18 patients. For the biomarker analysis, responders are enriched in patients with mutations in the KMT2D gene. Pucotenlimab is an effective treatment option for previously treated advanced dMMR/MSI-H solid tumors, and the predictive value of KMT2D mutation warrants further research. This study is registered with ClinicalTrials.gov: NCT03704246.

CSE1L
Also flagged:IPO11colorectal cancerillnesscancerImportin-11cell proliferation
Journal Article 2023-11-27 ✓ 1 Snippet Aljahdali MO, Molla MHR.
In-Text Gene Mentions

CSE1L

Show Full Abstract

The most prevalent malignant illness of the gastrointestinal system, colorectal cancer, is the third most prevalent cancer in males and the second most prevalent cancer in women. Importin-11 is a protein that acts as a regulator of cancer cell proliferation in colorectal tumours by conveying β-catenin to the cell nucleus. However, the IPO11 gene was found to encode a protein called Importin-11, which functions as a nucleus importer for the cell. As a result, preventing β-catenin from entering the nucleus requires blocking Importin-11. As a result, we conducted a multi-omics investigation to assess IPO11 gene potential as a therapeutic biomarker for human colorectal cancer (CC). Oncomine, GEPIA2, immunohisto-chemistry, and UALCAN databases were used to analyses the mRNA expression profiles of IPO11 in CC. The investigation has yielded clear evidence of the increase of IPO11 expression in CC subtypes, as indicated by the data acquired. Analysing CC research from the cBioPortal database, the study discovered three new missense mutations in the importin-11 protein sequence at a frequency of 0.00-1.50% copy number changes. Additionally, the Kaplan-Meier plots demonstrated a strong connection concerning IPO11 downregulation and a poorer CC patient survival rate. The co-expressed gene profile of IPO11 was likewise associated with the onset of CC. IPO11 co-expressed gene profile was also linked to CC development. Moreover, the correlation analysis using bc-GenExMiner and the UCSC Xena server identified KIF2A as the most positively co-expressed gene. The study found that KIF2A and its co-expressed genes were involved in a wide variety of cancer progression pathways using the Enrichr database. Cumulatively, this result will not only provide new information about the expression of IPO11 associated with CC progression and patient survival, but could also serve as a therapeutic biomarker for treating CC in a significant and worthwhile manner.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s13755-023-00259-2.

HTT
Also flagged:Huntington diseaseHDdegenerative brain diseasecytosineadenineguanine
Journal Article 2023-11-27 ✓ 5 Snippets Meem TM, Khan U, Mredul MBR, Awal MA, Rahman MH, Khan MS.
In-Text Gene Mentions

In 1993, the faulty gene that triggers HD was first discovered and a genetic test for diagnosis is available now.20 The test can identify the malfunctioning gene for HTT protein as well as discover the genetic defect in individuals who already haven’t shown any symptoms but has the possibility to obtain the disease but this is a slow process and can only be diagnosed after mid-age.20,21 This condition is caused by a CAG triplet repeat amplification in the HTT gene.20,22 Due to prolonged CAG repeat, HTT protein with an enlarged polyglutamine tract is produced, resulting in pathogenic HTT protein residues that are immune to the protein cycle, leading to cellular toxicity.23,24 Most HD patients have motor-involved problems, a small percentage (15%) establish clinically relevant psychological disease first and hence have a mental diagnosis before the start of movement disorder.20,25 Huntington disease is associated with extremely selective deterioration of the corpus striatum which is a brain region with no noticeable abnormalities in peripheral tissues.

Huntington disease (HD) can be defined as a completely penetrant degenerative brain disease resulting from CAG (cytosine-adenine-guanine) repeat expansion that is inherited as a dominant trait in IT15 (“interesting transcript 15”) gene also defined as huntingtin (HTT) gene.1,2 Huntingtin is translated into such an excessively massive polyglutamine domain around the N-terminus of the Huntington protein.3 Mutant huntingtin (mHTT) becomes particularly unstable due to the enlargement of the CAG region and allows to a combination of proteins of the same type and/or other types resulting in clumps that may lead to discontinued neurotransmission.4,5

…as huntingtin (HTT) gene.…

…malfunctioning gene forHTTprotein as well…

…prolonged CAG repeat,HTTprotein with an…

Show Full Abstract

Huntington disease (HD) is a degenerative brain disease caused by the expansion of CAG (cytosine-adenine-guanine) repeats, which is inherited as a dominant trait and progressively worsens over time possessing threat. Although HD is monogenetic, the specific pathophysiology and biomarkers are yet unknown specifically, also, complex to diagnose at an early stage, and identification is restricted in accuracy and precision. This study combined bioinformatics analysis and network-based system biology approaches to discover the biomarker, pathways, and drug targets related to molecular mechanism of HD etiology. The gene expression profile data sets GSE64810 and GSE95343 were analyzed to predict the molecular markers in HD where 162 mutual differentially expressed genes (DEGs) were detected. Ten hub genes among them (<i>DUSP1, NKX2-5, GLI1, KLF4, SCNN1B, NPHS1, SGK2, PITX2, S100A4</i>, and <i>MSX1</i>) were identified from protein-protein interaction (PPI) network which were mostly expressed as down-regulated. Following that, transcription factors (TFs)-DEGs interactions (FOXC1, GATA2, etc), TF-microRNA (miRNA) interactions (hsa-miR-340, hsa-miR-34a, etc), protein-drug interactions, and disorders associated with DEGs were predicted. Furthermore, we used gene set enrichment analysis (GSEA) to emphasize relevant gene ontology terms (eg, TF activity, sequence-specific DNA binding) linked to DEGs in HD. Disease interactions revealed the diseases that are linked to HD, and the prospective small drug molecules like cytarabine and arsenite was predicted against HD. This study reveals molecular biomarkers at the RNA and protein levels that may be beneficial to improve the understanding of molecular mechanisms, early diagnosis, as well as prospective pharmacologic targets for designing beneficial HD treatment.

Also flagged:sulfhydrylseleniumredox homeostasiscysteinethiolspeptides
Journal Article 2023-11-27 No Snippets Jiang Z, Tang Y, Lu J, Xu C, Niu Y, Zhang G, Yang Y, Cheng X, Tong L, Chen Z, Tang B.
Show Full Abstract

Chemoproteomic profiling of sulfhydryl-containing proteins has consistently been an attractive research hotspot. However, there remains a dearth of probes that are specifically designed for sulfhydryl-containing proteins, possessing sufficient reactivity, specificity, distinctive isotopic signature, as well as efficient labeling and evaluation capabilities for proteins implicated in the regulation of redox homeostasis. Here, the specific selenium-containing probes (Se-probes) in this work displayed high specificity and reactivity toward cysteine thiols on small molecules, peptides and purified proteins and showed very good competitive effect of proteins labeling in gel-ABPP. We identified more than 6000 candidate proteins. In TOP-ABPP, we investigated the peptide labeled by Se-probes, which revealed a distinct isotopic envelope pattern of selenium in both the primary and secondary mass spectra. This unique pattern can provide compelling evidence for identifying redox regulatory proteins and other target peptides. Furthermore, our examiation of post-translational modification (PTMs) of the cysteine site residues showed that oxidation PTMs was predominantly observed. We anticipate that Se-probes will enable broader and deeper proteome-wide profiling of sulfhydryl-containing proteins, provide an ideal tool for focusing on proteins that regulate redox homeostasis and advance the development of innovative selenium-based pharmaceuticals.

Also flagged:Oral Squamous Cell CarcinomaOSCCoral cancergene expressionmethylationhistone modifications
Journal Article 2023-11-27 No Snippets Mesgari H, Esmaelian S, Nasiri K, Ghasemzadeh S, Doroudgar P, Payandeh Z.
Show Full Abstract

Oral squamous cell carcinoma (OSCC) is a prevalent and significant type of oral cancer that has far-reaching health implications worldwide. Epigenetics, a field focused on studying heritable changes in gene expression without modifying DNA sequence, plays a pivotal role in OSCC. Epigenetic changes, encompassing DNA methylation, histone modifications, and miRNAs, exert control over gene activity and cellular characteristics. In OSCC, aberrant DNA methylation of tumor suppressor genes (TSG) leads to their inactivation, subsequently facilitating tumor growth. As a result, distinct patterns of gene methylation hold promise as valuable biomarkers for the detection of OSCC. Oral cancer treatment typically involves surgery, radiation therapy, and chemotherapy, but even with these treatments, cancer cells cannot be effectively targeted and destroyed. Researchers are therefore exploring new methods to target and eliminate cancer cells. One promising approach is the use of epigenetic modifiers, such as DNA methyltransferase (DNMT) inhibitors and histone deacetylase (HDAC) inhibitors, which have been shown to modify abnormal epigenetic patterns in OSCC cells, leading to the reactivation of TSGs and the suppression of oncogenes. As a result, epigenetic-targeted therapies have the potential to directly alter gene expression and minimize side effects. Several studies have explored the efficacy of such therapies in the treatment of OSCC. Although studies have investigated the efficacy of epigenetic therapies, challenges in identifying reliable biomarkers and developing effective combination treatments are acknowledged. Of note, epigenetic mechanisms play a significant role in drug resistance in OSCC and other cancers. Aberrant DNA methylation can silence tumor suppressor genes, while alterations in histone modifications and chromatin remodeling affect gene expression related to drug metabolism and cell survival. Thus, understanding and targeting these epigenetic processes offer potential strategies to overcome drug resistance and improve the efficacy of cancer treatments in OSCC. This comprehensive review focuses on the complex interplay between epigenetic alterations and OSCC cells. This will involve a deep dive into the mechanisms underlying epigenetic modifications and their impact on OSCC, including its initiation, progression, and metastasis. Furthermore, this review will present the role of epigenetics in the treatment and diagnosis of OSCC.

Also flagged:osteogenesismetal ionsoral diseasesnoncommunicable diseasesgum diseasescaries
Journal Article 2023-11-27 No Snippets Sotova C, Yanushevich O, Kriheli N, Grigoriev S, Evdokimov V, Kramar O, Nozdrina M, Peretyagin N, Undritsova N, Popelyshkin E, Peretyagin P.
Show Full Abstract

The development of dental implantology is based on the detailed study of the interaction of implants with the surrounding tissues and methods of osteogenesis stimulation around implants, which has been confirmed by the increasing number of scientific publications presenting the results of studies related to both the influence of the chemical composition of dental implant material as well as the method of its surface modification on the key operational characteristics of implants. The main materials for dental implant manufacturing are Ti and its alloys, stainless steels, Zr alloys (including ceramics based on ZrO<sub>2</sub>), and Ta and its alloys, as well as other materials (ceramics based on Al<sub>2</sub>O<sub>3</sub>, Si<sub>3</sub>N<sub>4</sub>, etc.). The review presents alloy systems recommended for use in clinical practice and describes their physical-mechanical and biochemical properties. However, when getting into the body, the implants are subjected to various kinds of mechanical influences, which are aggravated by the action of an aggressive biological environment (electrolyte with a lot of Cl<sup>-</sup> and H<sup>+</sup>); it can lead to the loss of osteointegration and to the appearance of the symptoms of the general intoxication of the organism because of the metal ions released from the implant surface into the biological tissues of the organism. Since the osteointegration and biocompatibility of implants depend primarily on the properties of their surface layer (it is the implant surface that makes contact with the tissues of the body), the surface modification of dental implants plays an important role, and all methods of surface modification can be divided into mechanical, physical, chemical, and biochemical methods (according to the main effect on the surface). This review discusses several techniques for modifying dental implant surfaces and provides evidence for their usefulness.

TNFSF4
Also flagged:APOBEC3Gp53Restriction FactorRespiratory Syncytial Virus Infectiontumor suppressor p53APOBEC3
Journal Article 2023-11-27 ✓ 1 Snippet Gladwell W, Yost O, Li H, Bell WJ, Chen SH, Ward JM, Kleeberger SR, Resnick MA, Menendez D.
In-Text Gene Mentions

…and TNF (TNFSF4, TNFRSF10C ,…

Show Full Abstract

Identifying and understanding genetic factors that influence the propagation of the human respiratory syncytial virus (RSV) can lead to health benefits and possibly augment recent vaccine approaches. We previously identified a p53/immune axis in which the tumor suppressor p53 directly regulates the expression of immune system genes, including the seven members of the APOBEC3 family of DNA cytidine deaminases (A3), which are innate immune sentinels against viral infections. Here, we examined the potential p53 and A3 influence in RSV infection, as well as the overall p53-dependent cellular and p53/immune axis responses to infection. Using a paired p53 model system of p53+ and p53- human lung tumor cells, we found that RSV infection activates p53, leading to the altered p53-dependent expression of <i>A3D</i>, <i>A3F</i>, and <i>A3G,</i> along with p53 site-specific binding. Focusing on A3G because of its 10-fold-greater p53 responsiveness to RSV, the overexpression of <i>A3G</i> can reduce RSV viral replication and syncytial formation. We also observed that RSV-infected cells undergo p53-dependent apoptosis. The study was expanded to globally address at the transcriptional level the p53/immune axis response to RSV. Nearly 100 genes can be directly targeted by the p53/immune axis during RSV infection based on our p53BAER analysis (Binding And Expression Resource). Overall, we identify A3G as a potential p53-responsive restriction factor in RSV infection. These findings have significant implications for RSV clinical and therapeutic studies and other p53-influenced viral infections, including using p53 adjuvants to boost the response of <i>A3</i> genes.

HTT
Also flagged:Huntingtinneurodegenerative diseasesorphanHDpathogenesisCCT2
Journal Article 2023-11-27 ✓ 5 Snippets Makeeva VS, Dyrkheeva NS, Lavrik OI, Zakian SM, Malakhova AA.
In-Text Gene Mentions

The development of HD is associated with the expansion (multiplication) of trinucleotide CAG in the first exon of the huntingtin (HTT) gene [4].

For this purpose, we searched different sources related to HD studies and found 490 genes in the HTT-OMNI database [177], the PANTHER database [178], and mHTT interaction studies in human cells: 276 genes were discovered in the Podvin (2022) study [72], and six other genes—CCT2, PRMT6, KMO, JPH1, STIM1, and TFEB—came from later papers dealing with experimental and bioinformatic research of HD in years 2022–2023 [179,180,181,182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197,198,199,200,201,202,203,204,205,206,207,208,209,210,211,212,213,214,215,216,217,218,219,220,221,222,223,224,225].

Greco with the research group have analyzed PPIs of the HTT protein containing normal or expanded CAG repeats in a mouse HD model [71].

Owing to a positive effect of inhibitors INO-1001 [147] and Olaparib [176] on mice featuring the expression of HTT exon 1 with an expanded polyglutamine tract, efforts can be directed to further investigation into the impact of PARP inhibitors on the progression of HD in more relevant models such as cell lines derived from HD patients.

…mutation in theHTTgene, but having…

Show Full Abstract

The spectrum of neurodegenerative diseases known today is quite extensive. The complexities of their research and treatment lie not only in their diversity. Even many years of struggle and narrowly focused research on common pathologies such as Alzheimer's, Parkinson's, and other brain diseases have not brought cures for these illnesses. What can be said about orphan diseases? In particular, Huntington's disease (HD), despite affecting a smaller part of the human population, still attracts many researchers. This disorder is known to result from a mutation in the <i>HTT</i> gene, but having this information still does not simplify the task of drug development and studying the mechanisms of disease progression. Nonetheless, the data accumulated over the years and their analysis provide a good basis for further research. Here, we review studies devoted to understanding the mechanisms of HD. We analyze genes and molecular pathways involved in HD pathogenesis to describe the action of repurposed drugs and try to find new therapeutic targets.

SERPINC1
Also flagged:Intrauterine growth restrictionIUGRdeathpeptideGelsolinAlpha-2-macroglobulin
Journal Article 2023-11-27 ✓ 2 Snippets Starodubtseva NL, Tokareva AO, Volochaeva MV, Kononikhin AS, Brzhozovskiy AG, Bugrova AE, Timofeeva AV, Kukaev EN, Tyutyunnik VL, Kan NE, Frankevich VE, Nikolaev EN, Sukhikh GT.
In-Text Gene Mentions

…globulin, Apolipoprotein A-IV,Antithrombin-III, and Apolipoprotein C-I,…

…globulin, Apolipoprotein A-IV,Antithrombin-III, and Apolipoprotein C-I…

Show Full Abstract

Intrauterine growth restriction (IUGR) remains a significant concern in modern obstetrics, linked to high neonatal health problems and even death, as well as childhood disability, affecting adult quality of life. The role of maternal and fetus adaptation during adverse pregnancy is still not completely understood. This study aimed to investigate the disturbance in biological processes associated with isolated IUGR via blood plasma proteomics. The levels of 125 maternal plasma proteins were quantified by liquid chromatography-multiple reaction monitoring mass spectrometry (LC-MRM MS) with corresponding stable isotope-labeled peptide standards (SIS). Thirteen potential markers of IUGR (Gelsolin, Alpha-2-macroglobulin, Apolipoprotein A-IV, Apolipoprotein B-100, Apolipoprotein(a), Adiponectin, Complement C5, Apolipoprotein D, Alpha-1B-glycoprotein, Serum albumin, Fibronectin, Glutathione peroxidase 3, Lipopolysaccharide-binding protein) were found to be inter-connected in a protein-protein network. These proteins are involved in plasma lipoprotein assembly, remodeling, and clearance; lipid metabolism, especially cholesterol and phospholipids; hemostasis, including platelet degranulation; and immune system regulation. Additionally, 18 proteins were specific to a particular type of IUGR (early or late). Distinct patterns in the coagulation and fibrinolysis systems were observed between isolated early- and late-onset IUGR. Our findings highlight the complex interplay of immune and coagulation factors in IUGR and the differences between early- and late-onset IUGR and other placenta-related conditions like PE. Understanding these mechanisms is crucial for developing targeted interventions and improving outcomes for pregnancies affected by IUGR.

Also flagged:gelatinnorbornenepolytetrafluoroethylenepolydimethylsiloxanetissue regenerationcancer
Journal Article 2023-11-27 No Snippets Kim B, Lee B, Mandakhbayar N, Kim Y, Song Y, Doh J, Lee JH, Jeong B, Song KH.
Show Full Abstract

Molding processes with molds containing topographical structures have been used for fabrication of hydrogel and cryogel particles. However, they can involve difficulties in separation of fabricated particles with complex shape from the molds or repeated fabrication of the particles although the overall processes do not require much skill and equipment. In this study, molds with etched superhydrophobic patterns have been developed by etching polytetrafluoroethylene (PTFE) blocks in user-defined designs with a femtosecond (FS) laser-based etching system. Lyophilized cryogel particles with various designs and sizes were fabricated by molding precursors with these PTFE molds. Additionally, the clean and easy separation of particles from the molds allowed repeated fabrication of the particles. For an application, relatively 'big' gelatin-norbornene (GelNB) cryogel particles prepared via molding with polydimethylsiloxane (PDMS) molds, swelling in phosphate buffered saline (PBS) and slicing height in half and 'small' GelNB cryogel particles fabricated with the PTFE molds were fabricated. Then, they were used to study scaffold size effect on calvarial bone regeneration. The molds generated with the FS laser-based etching system can be useful for various applications that require the mass production of cryogel particles in various geometries.

SERPINC1
Also flagged:end-stage kidney diseasecardiovascular diseaseCVDchronic kidney diseasekidney diseasemembrane
Journal Article 2023-11-27 ✓ 3 Snippets Lin W, Mousavi F, Blum BC, Heckendorf CF, Moore J, Lampl N, McComb M, Kotelnikov S, Yin W, Rabhi N, Layne MD, Kozakov D, Chitalia VC, Emili A.
In-Text Gene Mentions

As shown in Figure 5C, creatinine, a key biomarker of CKD, showed direct physical interactions with the blood proteins CST3, MB, serum albumin (ALB), angiotensin-converting enzyme (ACE), complement factor H(CFH), and voltage-dependent calcium channel subunit alpha-2/delta-1 (CACNA2D1), while homocysteine was connected to CST3, serum paraoxonase/arylesterase 1 (PON1), and antithrombin-III (SERPINC1) (Figure 5C).

…1 (PON1), andantithrombin-III(SERPINC1) ( Figure…

…(PON1), and antithrombin-III (SERPINC1) ( Figure 5C…

Show Full Abstract

<b>Background:</b> We hypothesize that the poor survival outcomes of end-stage kidney disease (ESKD) patients undergoing hemodialysis are associated with a low filtering efficiency and selectivity. The current gold standard criteria using single or several markers show an inability to predict or disclose the treatment effect and disease progression accurately. <b>Methods:</b> We performed an integrated mass spectrometry-based metabolomic and proteomic workflow capable of detecting and quantifying circulating small molecules and proteins in the serum of ESKD patients. Markers linked to cardiovascular disease (CVD) were validated on human induced pluripotent stem cell (iPSC)-derived cardiomyocytes. <b>Results:</b> We identified dozens of elevated molecules in the serum of patients compared with healthy controls. Surprisingly, many metabolites, including lipids, remained at an elevated blood concentration despite dialysis. These molecules and their associated physical interaction networks are correlated with clinical complications in chronic kidney disease. This study confirmed two uremic toxins associated with CVD, a major risk for patients with ESKD. <b>Conclusion:</b> The retained molecules and metabolite-protein interaction network address a knowledge gap of candidate uremic toxins associated with clinical complications in patients undergoing dialysis, providing mechanistic insights and potential drug discovery strategies for ESKD.

Also flagged:AMPA receptorAMPA receptorsAMPARsynapsesextracellularsynapse
Journal Article 2023-11-27 No Snippets Rennich BJ, Luth ES, Moores S, Juo P.
Show Full Abstract

AMPA receptors (AMPARs) mediate the majority of fast excitatory transmission in the brain. Regulation of AMPAR levels at synapses controls synaptic strength and underlies information storage and processing. Many proteins interact with the intracellular domain of AMPARs to regulate their trafficking and synaptic clustering. However, a growing number of extracellular factors important for glutamatergic synapse development, maturation and function have emerged that can also regulate synaptic AMPAR levels. This mini-review highlights extracellular protein factors that regulate AMPAR trafficking to control synapse development and plasticity. Some of these factors regulate AMPAR clustering and mobility by interacting with the extracellular N-terminal domain of AMPARs whereas others regulate AMPAR trafficking indirectly via their respective signaling receptors. While several of these factors are secreted from neurons, others are released from non-neuronal cells such as glia and muscle. Although it is apparent that secreted factors can act locally on neurons near their sites of release to coordinate individual synapses, it is less clear if they can diffuse over longer ranges to coordinate related synapses within a circuit or region of the brain. Given that there are hundreds of factors that can be secreted from neuronal and non-neuronal cells, it will not be surprising if more extracellular factors that modulate AMPARs and glutamatergic synapses are discovered. Many open questions remain including where and when the factors are expressed, what regulates their secretion from different cell types, what controls their diffusion, stability, and range of action, and how their cognate receptors influence intracellular signaling to control AMPAR trafficking.

BTN2A1
Also flagged:Cervical cancerdeathsolid tumourscanceroncogenesE6
Journal Article 2023-11-27 ✓ 5 Snippets Dong J, Holthaus D, Peters C, Koster S, Ehsani M, Quevedo-Olmos A, Berger H, Zarobkiewicz M, Mangler M, Gurumurthy RK, Hedemann N, Chumduri C, Kabelitz D, Meyer TF.
In-Text Gene Mentions

However, our blocking studies using inhibitory antibodies against BTN2A1 and BTN3A1 clearly indicated the significance of these BTN molecules in triggering the cytotoxic activity of γδ T cells against HPV+ and cancer organoids., in line with previous reports (49).

Interestingly, the expression of BTN-family members including BTN2A1/3A1, crucial in pAg-mediated γδ T cell activation was largely down-regulated in the cancer isolates.

Taken together, our findings suggest that BTN2A1/3A1 and MSH2 are involved in triggering the cytotoxic activity in γδ T cells towards HPV+ and cancer organoids, but additional pathways might be involved.

While not directly measured in our study, it can be assumed that HPV+ and cancer organoids produce increased amounts of endogenous pAg isopentenyl pyrophosphate (IPP), leading to BTN2A1/3A1-dependent γδ T cell activation and subsequent tumour cell killing (8, 11, 60).

We also demonstrated the involvement of BTN3A1 and BTN2A1, crucial molecules for γδ T cell activation, as well as differential expression of PDL1/CD274 in cancer, E6/E7+ and healthy organoids.

Show Full Abstract

Cervical cancer is a leading cause of death among women globally, primarily driven by high-risk papillomaviruses. However, the effectiveness of chemotherapy is limited, underscoring the potential of personalized immunotherapies. Patient-derived organoids, which possess cellular heterogeneity, proper epithelial architecture and functionality, and long-term propagation capabilities offer a promising platform for developing viable strategies. In addition to αβ T cells and natural killer (NK) cells, γδ T cells represent an immune cell population with significant therapeutic potential against both hematologic and solid tumours. To evaluate the efficacy of γδ T cells in cervical cancer treatment, we generated patient-derived healthy and cancer ectocervical organoids. Furthermore, we examined transformed healthy organoids, expressing HPV16 oncogenes E6 and E7. We analysed the effector function of <i>in vitro</i> expanded γδ T cells upon co-culture with organoids. Our findings demonstrated that healthy cervical organoids were less susceptible to γδ T cell-mediated cytotoxicity compared to HPV-transformed organoids and cancerous organoids. To identify the underlying pathways involved in this observed cytotoxicity, we performed bulk-RNA sequencing on the organoid lines, revealing differences in DNA-damage and cell cycle checkpoint pathways, as well as transcription of potential γδ T cell ligands. We validated these results using immunoblotting and flow cytometry. We also demonstrated the involvement of BTN3A1 and BTN2A1, crucial molecules for γδ T cell activation, as well as differential expression of PDL1/CD274 in cancer, E6/E7+ and healthy organoids. Interestingly, we observed a significant reduction in cytotoxicity upon blocking MSH2, a protein involved in DNA mismatch-repair. In summary, we established a co-culture system of γδ T cells with cervical cancer organoids, providing a novel <i>in vitro</i> model to optimize innovative patient-specific immunotherapies for cervical cancer.

Also flagged:Gliomabrain tumorMalignant gliomasAnxietydepressionFerroptosis
Journal Article 2023-11-27 No Snippets Bo Y, Mu L, Yang Z, Li W, Jin M.
Show Full Abstract

Glioma is the most prevalent type of brain tumor characterized by a poor 5-year survival rate and a high mortality rate. Malignant gliomas are commonly treated by surgery, chemotherapy and radiotherapy. However, due to toxicity and resistance to chemoradiotherapy, these treatments can be ineffective. Anxiety and depression are highly prevalent in patients with glioma, adversely affecting disease prognosis and posing societal concerns. Ferroptosis is a type of non-apoptotic, iron-dependent cell death characterized by the accumulation of lethal reactive oxygen species produced by iron metabolism, and it serves a key role in numerous diseases. Regulation of iron phagocytosis may serve as a therapeutic strategy for the development of novel glioma treatments. The present review discusses the mechanisms underlying the occurrence and regulation of ferroptosis, its role in the genesis and evolution of gliomas, and its association with glioma-related anxiety and depression. By exploring potential targets for glioma treatment, the present review provides a theoretical basis for the development of novel therapeutic strategies against glioma.

PEBP1
Also flagged:ABSHydrogenDeuteriumpeptidedihydrofolate reductaseribosome
Journal Article 2023-11-27 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

PEBP1

Show Full Abstract

No abstract available.

SERPINC1
Also flagged:hemostasisandplatelet disordersThrombosisofvenous thromboembolism
Journal Article 2023-11-26 ✓ 1 Snippet Ross JE, Mohan S, Zhang J, Sullivan MJ, Bury L, Lee K, Futchi I, Frantz A, McDougal D, Perez Botero J, Cattaneo M, Cooper N, Downes K, Gresele P, Keenan C, Lee AI, Megy K, Morange PE, Morgan NV, Schulze H, Zimowski K, Freson K, Lambert MP.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

<h4>Background</h4>Inherited bleeding, thrombotic, and platelet disorders (BTPDs) are a heterogeneous set of diseases, many of which are very rare globally. Over the past 5 decades, the genetic basis of some of these disorders has been identified, and recently, high-throughput sequencing has become the primary means of identifying disease-causing genetic variants.<h4>Objectives</h4>Knowledge of the clinical validity of a gene-disease relationship is essential to provide an accurate diagnosis based on results of diagnostic gene panel tests and inform the construction of such panels. The Scientific and Standardization Committee for Genetics in Thrombosis and Hemostasis undertook a curation process for selecting 96 TIER1 genes for BTPDs. The purpose of the process was to evaluate the evidence supporting each gene-disease relationship and provide an expert-reviewed classification for the clinical validity of genes associated with BTPDs.<h4>Methods</h4>The Clinical Genome Resource (ClinGen) Hemostasis/Thrombosis Gene Curation Expert Panel assessed the strength of evidence for TIER1 genes using the semiquantitative ClinGen gene-disease clinical validity framework. ClinGen Lumping and Splitting guidelines were used to determine the appropriate disease entity or entities for each gene, and 101 gene-disease relationships were identified for curation.<h4>Results</h4>The final outcome included 68 Definitive (67%), 26 Moderate (26%), and 7 Limited (7%) classifications. The summary of each curation is available on the ClinGen website.<h4>Conclusion</h4>Expert-reviewed assignment of gene-disease relationships by the ClinGen Hemostasis/Thrombosis Gene Curation Expert Panel facilitates accurate molecular diagnoses of BTPDs by clinicians and diagnostic laboratories. These curation efforts can allow genetic testing to focus on genes with a validated role in disease.

ZNFX1
Also flagged:mycobacterial diseasesinfectionserrors of immunityMSMDIL12RB2IL23R
Journal Article 2023-11-26 ✓ 1 Snippet Errami A, Bousfiha AA.
In-Text Gene Mentions

…IL12B, ISG15, USP18,ZNFX1, TBX21, STAT1, TYK2,…

Show Full Abstract

The constant progress of genomics and the establishment of new functional tests have paved the way for identifying monogenic defects conferring a selective predisposition to infections by certain microbes as a new type of inborn errors of immunity (IEIs). Mendelian susceptibility to mycobacterial diseases (MSMD) is the most characterized of these IEIs, with 36 different disorders found in 20 distinct genes (<i>IFNGR1, IFNGR2, IFNG, IL12RB1, IL12RB2, IL23R, IL12B, ISG15, USP18, ZNFX1, TBX21, STAT1, TYK2, IRF8, IRF1, CYBB, JAK1, RORC, NEMO</i>, and <i>SPPL2A</i>) over the last 20 years. MSMD confers a selective susceptibility to infections with weakly virulent mycobacteria, including the <i>M</i>. bovis Bacille Calmette-Guerin (BCG) vaccines and various environmental mycobacteria in patients, primarily children, without classical immune defects. These patients may also present severe forms of tuberculosis, and about half of them might develop non-typhoidal salmonellosis. In some cases, patients also suffer from chronic mucocutaneous candidiasis (CMC), while in others, patients also present severe viral, parasitic, fungal, and/or bacterial diseases. Despite this clinical and genetic heterogeneity, almost all genetic etiologies of MSMD alter the interferon-gamma (IFN-γ)- mediated immunity by impairing or abolishing IFN-γ production or the response to this cytokine. It was proven that the human IFN-γ level is a quantitative trait that defines the outcome of mycobacterial infection. The study of these monogenic defects contributes to understanding the molecular mechanism of mycobacterial diseases in humans and to the development of new diagnostic and therapeutic approaches to improve care and prognosis. For example, MSMD patients with impaired production of IFN-γ may benefit from injections of human recombinant IFN-γ, while for patients with abolished response to this cytokine, hematopoietic stem cell transplantation (HSCT) and promising gene therapy are the only current therapeutic options. These discoveries also bridge the gap between simple Mendelian inheritance and complex human genetics.

OLFM4
Also flagged:Desmoglein-3DSG3oral canceroral squamous carcinomacancerMMP-13
Journal Article 2023-11-26 ✓ 5 Snippets Wan H, Teh MT, Mastroianni G, Ahmad US.
In-Text Gene Mentions

Other DSG3-associated cancer-related genes include upregulated OLFM4 (antiapoptotic factor), downregulated ADAMTS1 (antiangiogenic activity), downregulated KRT84 (cancer suppressor in oral SCC) [26] and FLNC [32].

Genes with known implications in cancer, such as MMP-13, KRT84, OLFM4, GJA1, AMOT and ADAMTS1, were strongly linked to DSG3 overexpression.

OLFM4, olfactomedin-4, is reported to be significantly increased in head and neck squamous cell carcinoma (75% tested), suggesting a potential biomarker in this type of cancer [33].

…as MMP-13, KRT84,OLFM4, GJA1, AMOT and…

…MMP-13, AMOT, CFH,OLFM4, IZUMO4, ANGPTL4, CALB1…

Show Full Abstract

The role of desmoglein-3 (DSG3) in oncogenesis is unclear. This study aimed to uncover molecular mechanisms through comparative transcriptome analysis in oral cancer cells, defining potential key genes and associated biological processes related to DSG3 expression. Four mRNA libraries of oral squamous carcinoma H413 cell lines were sequenced, and 599 candidate genes exhibited differential expression between DSG3-overexpressing and matched control lines, with 12 genes highly significantly differentially expressed, including 9 upregulated and 3 downregulated. Genes with known implications in cancer, such as MMP-13, KRT84, OLFM4, GJA1, AMOT and ADAMTS1, were strongly linked to DSG3 overexpression. Gene ontology analysis indicated that the DSG3-associated candidate gene products participate in crucial cellular processes such as junction assembly, focal adhesion, extracellular matrix formation, intermediate filament organisation and keratinocyte differentiation. Validation of RNA-Seq was performed through RT-qPCR, Western blotting and immunofluorescence analyses. Furthermore, using transmission electron microscopy, we meticulously examined desmosome morphology and revealed a slightly immature desmosome structure in DSG3-overexpressing cells compared to controls. No changes in desmosome frequency and diameter were observed between the two conditions. This study underscores intricate and multifaceted alterations associated with DSG3 in oral squamous carcinoma cells, implying a potential oncogenic role of this gene in biological processes that enable cell communication, motility and survival.

HFE
Also flagged:Hepatocellular carcinomacancerChronic hepatitisvirus infectionsalcoholaflatoxin
Journal Article 2023-11-26 ✓ 5 Snippets Lampimukhi M, Qassim T, Venu R, Pakhala N, Mylavarapu S, Perera T, Sathar BS, Nair A.
In-Text Gene Mentions

Hemochromatosisresults in an…

…absence of genetichemochromatosis, individuals of African…

…Early detection ofhemochromatosisby genetic screening…

…associated with hereditaryhemochromatosis.…

…smoking, aflatoxin exposure,hemochromatosis, obesity, type 2…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a primary liver malignancy, ranking as the seventh most common cancer globally and the second leading cause of deaths due to cancer. This review examines the incidence of HCC, its associated risk factors, and constantly changing global trends. Incidence has been noted to be varying worldwide, particularly due to environmental and infectious risk factors. Chronic hepatitis B (HBV) and C (HCV) virus infections, alcohol abuse, aflatoxin exposure, diabetes, obesity, and tobacco consumption are some of the leading risk factors noted. Eastern Asia and sub-Saharan Africa were noted to have the highest disease burden for HCC, with China representing a considerably large majority. On the contrary, the United States reports a lower HCC incidence overall due to improved vaccination programs against HBV; however, with a rising incidence of prominent risk factor in non-alcoholic fatty liver disease (NAFLD), the trend may very well change. Gender disparities were noted to be evident with men experiencing higher rates of HCC compared to women, which may be due to various environmental and biological factors, including alcohol intake, smoking, and androgen hormone levels. Currently, efforts to reduce the overall incidence of HCC include universal HBV vaccinations, antiviral therapies, aflatoxin prevention measures, genetic screening for hereditary hemochromatosis, and early ultrasound evaluation in patients with liver cirrhosis. Understanding these evolving trends and risk factors is essential in combating the rising HCC incidence, especially in Western countries, where risk factors, such as obesity, diabetes, and metabolic disorders, are on the rise.

SERPINC1
Also flagged:brain tumorstumorlung cancerHIF-1HIF-2metabolism
Journal Article 2023-11-25 ✓ 2 Snippets Fantin J, Toutain J, Pérès EA, Bernay B, Mehani SM, Helaine C, Bourgeois M, Brunaud C, Chazalviel L, Pontin J, Corroyer-Dulmont A, Valable S, Cherel M, Bernaudin M.
In-Text Gene Mentions

Besides increase in proteins involved in metabolic/oxidative pathways, the proteomic study revealed well-known protein expression changes in BM in cancer including lung cancers (CDK6, RAC2, integrin subunit alpha 3, FN1...), inflammation and immunity and in particular in the complement cascade (C1q A, C1q B, C1q C, C3, C4, C9, CfH and CfB), fibrinogens (FGA, FGB and FGG), plasminogen (PLG) and tissue-type plasminogen activator (tPA), serpins (SERPINA3K, SERPINA3N, SERPINA3C, SERPINA3L, SERPINA1; SERPING1; SERPINC1, SERPIND1), kininogen-1 (KNG1) and haptoglobin (HP) (Additional file 1: Table S1).

…SERPINA3L, SERPINA1; SERPING1;SERPINC1, SERPIND1), kininogen-1 (KNG1…

Show Full Abstract

<h4>Background</h4>Brain metastases (BM) are the most frequent malignant brain tumors. The aim of this study was to characterize the tumor microenvironment (TME) of BM and particularly hypoxia and redox state, known to play a role in tumor growth and treatment resistance with multimodal PET and MRI imaging, immunohistochemical and proteomic approaches in a human lung cancer (H2030-BrM3)-derived BM model in rats.<h4>Results</h4>First, in vitro studies confirmed that H2030-BrM3 cells respond to hypoxia with increasing expression of HIF-1, HIF-2 and their target genes. Proteomic analyses revealed, among expression changes, proteins associated with metabolism, oxidative stress, metal response and hypoxia signaling in particular in cortical BM. [<sup>64</sup>Cu][Cu(ATSM)] PET revealed a significant uptake by cortical BM (p < 0.01), while no uptake is observed in striatal BM 23 days after tumor implantation. Pimonidazole, HIF-1α, HIF-2α, CA-IX as well as GFAP, CTR1 and DMT1 immunostainings are positive in both BM.<h4>Conclusion</h4>Overall, [<sup>64</sup>Cu][Cu(ATSM)] imaging and proteomic results showed the presence of hypoxia and protein expression changes linked to hypoxia and oxidative stress in BM, which are more pronounced in cortical BM compared to striatal BM. Moreover, it emphasized the interest of [<sup>64</sup>Cu][Cu(ATSM)] PET to characterize TME of BM and depict inter-metastasis heterogeneity that could be useful to guide treatments.

BTN2A2BTN2A1
Also flagged:G protein-coupled receptorstumorskin cutaneous melanomaGPCRsGene ExpressionGPR19
Journal Article 2023-11-25 ✓ 2 Snippets Song B, Wang K, Peng Y, Zhu Y, Cui Z, Chen L, Yu Z, Song B.
In-Text Gene Mentions

BTN2A1

BTN2A2

Show Full Abstract

<h4>Background</h4>G protein-coupled receptors (GPCRs) have been shown to have an important role in tumor development and metastasis, and abnormal expression of GPCRs is significantly associated with poor prognosis of tumor patients. In this study, we analyzed the GPCRs-related gene (GPRGs) and tumor microenvironment (TME) in skin cutaneous melanoma (SKCM) to construct a prognostic model to help SKCM patients obtain accurate clinical treatment strategies.<h4>Methods</h4>SKCM expression data and clinical information were obtained from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. Differential expression analysis, LASSO algorithm, and univariate and multivariate cox regression analysis were used to screen prognosis-related genes (GPR19, GPR146, S1PR2, PTH1R, ADGRE5, CXCR3, GPR143, and OR2I1P) and multiple prognosis-good immune cells; the data set was analyzed according to above results and build up a GPR-TME classifier. The model was further subjected to immune infiltration, functional enrichment, tumor mutational load, immunotherapy prediction, and scRNA-seq data analysis. Finally, cellular experiments were conducted to validate the functionality of the key gene GPR19 in the model.<h4>Results</h4>The findings indicate that high expression of GPRGs is associated with a poor prognosis in patients with SKCM, highlighting the significant role of GPRGs and the tumor microenvironment (TME) in SKCM development. Notably, the group characterized by low GPR expression and a high TME exhibited the most favorable prognosis and immunotherapeutic efficacy. Furthermore, cellular assays demonstrated that knockdown of GPR19 significantly reduced the proliferation, migration, and invasive capabilities of melanoma cells in A375 and A2058 cell lines.<h4>Conclusion</h4>This study provides novel insights for the prognosis evaluation and treatment of melanoma, along with the identification of a new biomarker, GPR19.

Also flagged:sleepadenosineadenosine A 1 receptorscircadian rhythmalcoholwakefulness
Journal Article 2023-11-25 No Snippets Phillips AJK, St Hilaire MA, Barger LK, O'Brien CS, Rahman SA, Landrigan CP, Lockley SW, Czeisler CA, Klerman EB.
Show Full Abstract

<h4>Objectives</h4>Mathematical models of human neurobehavioral performance that include the effects of acute and chronic sleep restriction can be key tools in assessment and comparison of work schedules, allowing quantitative predictions of performance when empirical assessment is impractical.<h4>Methods</h4>Using such a model, we tested the hypothesis that resident physicians working an extended duration work roster, including 24-28 hours of continuous duty and up to 88 hours per week averaged over 4weeks, would have worse predicted performance than resident physicians working a rapidly cycling work roster intervention designed to reduce the duration of extended shifts. The performance metric used was attentional failures (ie, Psychomotor Vigilance Task lapses). Model input was 169 actual work and sleep schedules. Outcomes were predicted hours per week during work hours spent at moderate (equivalent to 16-20 hours of continuous wakefulness) or high (equivalent to ≥20 hours of continuous wakefulness) performance impairment.<h4>Results</h4>The model predicted that resident physicians working an extended duration work roster would spend significantly more time at moderate impairment (p = .02, effect size=0.2) than those working a rapidly cycling work roster; this difference was most pronounced during the circadian night (p < .001). On both schedules, performance was predicted to decline from weeks 1 + 2 to weeks 3 + 4 (p < .001), but the rate of decline was significantly greater on extended duration work roster (p < .01). Predicted performance impairment was inversely related to prior sleep duration (p < .001).<h4>Conclusions</h4>These findings demonstrate the utility of a mathematical model to evaluate the predicted performance profile of schedules for resident physicians and others who experience chronic sleep restriction and circadian misalignment.

TNFSF4
Also flagged:cancerTriple-negative breast CancerpathogenesistumorGPR34breast cancer
Journal Article 2023-11-25 ✓ 1 Snippet Wang G, Zhang H, Shen X, Jin W, Wang X, Zhou Z.
In-Text Gene Mentions

…TNFSF15, TNFSF18, andTNFSF4(Fig. 7 C).…

Show Full Abstract

Triple-negative breast Cancer (TNBC) is a highly malignant cancer with unclear pathogenesis. Within the tumor microenvironment (TME), cancer-associated fibroblasts (CAFs) vitally influence tumor onset and progression. Thus, this research aimed to identify distinct subgroups of CAF using single-cell and TNBC-related information from the GEO and TCGA databases, respectively. The primary aim was to establish a novel predictive model based on the CAF features and their clinical relevance. Moreover, the CAFs were analyzed for their immune characteristics, response to immunotherapy, and sensitivity to different drugs. The developed predictive model demonstrated significant effectiveness in determining the prognosis of patients with TNBC, TME, and the immune landscape of the tumor. Of note, the expression of GPR34 was significantly higher in TNBC tissues compared to that in other breast cancer (non-TNBC) tissues, indicating that GPR34 plays a crucial role in the onset and progression of TNBC. In summary, this research has yielded a novel predictive model for TNBC that holds promise for the accurate prediction of prognosis and response to immunotherapy in patients with TNBC.

OLFM4
Also flagged:iNOSInducible nitric oxide synthasetissue homeostasisgluconeogenesisimmune responseintestinal disorders
Journal Article 2023-11-25 ✓ 5 Snippets Huang L, Xu Z, Lei X, Huang Y, Tu S, Xu L, Xia J, Liu D.
In-Text Gene Mentions

…the number ofOlfm4+ ISCs but…

…primary antibodies againstOlfm4(39141S, CST, USA),…

…AISC markers, includingOlfm4and Lgr5.…

…active ISC marker “Olfm4” was upregulated in…

…an increase ofOlfm4+ cells might…

Show Full Abstract

<h4>Background</h4>Mammalian intestinal epithelium constantly undergoes rapid self-renewal and regeneration sustained by intestinal stem cells (ISCs) within crypts. Inducible nitric oxide synthase (iNOS) is an important regulator in tissue homeostasis and inflammation. However, the functions of iNOS on ISCs have not been clarified. Here, we aimed to investigate the expression pattern of inducible nitric oxide synthase (iNOS) within crypts and explore its function in the homeostatic maintenance of the ISC niche.<h4>Methods</h4>Expression of iNOS was determined by tissue staining and qPCR. iNOS<sup>-/-</sup> and Lgr5 transgenic mice were used to explore the influence of iNOS ablation on ISC proliferation and differentiation. Enteroids were cultured to study the effect of iNOS on ISCs in vitro. Ileum samples from wild-type and iNOS<sup>-/-</sup> mice were collected for RNA-Seq to explore the molecular mechanisms by which iNOS regulates ISCs.<h4>Results</h4>iNOS was physiologically expressed in Paneth cells. Knockout of iNOS led to apparent morphological changes in the intestine, including a decrease in the small intestine length and in the heights of both villi and crypts. Knockout of iNOS decreased the number of Ki67<sup>+</sup> or BrdU<sup>+</sup> proliferative cells in crypts. Loss of iNOS increased the number of Olfm4<sup>+</sup> ISCs but inhibited the differentiation and migration of Lgr5<sup>+</sup> ISCs in vivo. iNOS depletion also inhibited enteroid formation and the budding efficiency of crypts in vitro. Moreover, iNOS deficiency altered gluconeogenesis and the adaptive immune response in the ileum transcriptome.<h4>Conclusion</h4>Paneth cell-derived iNOS is required to maintain a healthy ISC niche, and Knockout of iNOS hinders ISC function in mice. Therefore, iNOS represents a potential target for the development of new drugs and other therapeutic interventions for intestinal disorders.

HFE
Also flagged:pancreatic cancercancerleucovorinoxaliplatinirinotecannab-paclitaxel
Journal Article 2023-11-25 ✓ 1 Snippet Wang S, Chen J, Li P, Chen Y.
In-Text Gene Mentions

…such as cancer,hemochromatosis, cardiomyopathy, liver fibros…

Show Full Abstract

Due to a lack of research on the critical non-coding RNAs in regulating ferroptosis, our study aimed to uncover the crucial ones involved in the process. We found that LINC01133 could make pancreatic cancer cells more resistant to ferroptosis. A higher expression of LINC01133 was associated with a higher IC50 of sorafenib in clinical samples. Furthermore, we discovered that LINC01133 induced this process through enhancing the mRNA stability of FSP1. CEBPB was the transcription factor to increase the expression of LINC01133. A higher CEBPB could also indicate a higher IC50 of sorafenib in patients with cancer. Moreover, we confirmed that LINC01133 could form a triple complex with FUS and FSP1 to increase the mRNA stability of FSP1.

Also flagged:ferroptosisLymphomacancerlymphomasdeathoxygen
Journal Article 2023-11-25 No Snippets Yu T, Xu-Monette ZY, Yu L, Li Y, Young KH.
Show Full Abstract

Lymphoma is the sixth most common type of cancer worldwide. Under the current treatment standards, patients with lymphoma often fail to respond to treatment or relapse early and require further therapy. Hence, novel therapeutic strategies need to be explored and our understanding of the molecular underpinnings of lymphomas should be expanded. Ferroptosis, a non-apoptotic regulated cell death, is characterized by increased reactive oxygen species and lipid peroxidation due to metabolic dysfunction. Excessive or lack of ferroptosis has been implicated in tumor development. Current preclinical evidences suggest that ferroptosis participates in tumorigenesis, progression, and drug resistance of lymphoma, identifying a potential biomarker and an attractive molecular target. Our review summarizes the core mechanisms and regulatory networks of ferroptosis and discusses existing evidences of ferroptosis induction for the treatment of lymphoma, with intent to provide a framework for understanding the role of ferroptosis in lymphomagenesis and a new perspective of lymphoma treatment.

ZNFX1
Also flagged:Mycobacterial DiseasesMSMDTYK2IFN-γR1IL-12β1NEMO
Journal Article 2023-11-25 ✓ 1 Snippet Yang Y, Xia L, Lu S.
In-Text Gene Mentions

…containing 1 (ZNFX1) [ 25…

Show Full Abstract

<h4>Objectives</h4>To help in diagnosis and treatment of adult-onset Mendelian Susceptibility to Mycobacterial Disease (MSMD).<h4>Methods</h4>We reported a 27-year-old man who had disease onset at 18 years. Then we reviewed previous reports of adult-onset MSMD patients, and summarized their clinical characteristics.<h4>Results</h4>The case was diagnosed as MSMD with tyrosine kinase 2 (TYK2) mutation and had dramatic improvement after treatment. In addition to our presented case and through a review of the literature, 12 cases in total were included in our study. Average age of disease onset was 29.4 years. Medium delay of diagnosis was 2.5 years. Four were with IFN-γR1 deficiency, four with IL-12β1 deficiency, two with NEMO deficiency, one with TYK2 deficiency and one with STAT1 deficiency. Common symptoms were lymphadenopathy (6/12, 50.0 %), weight loss (6/12, 50.0 %), bone/joint pain (5/12, 41.7 %), fever (4/12, 33.3 %) and gastrointestinal symptoms (4/12, 33.3 %). Mycobacteria caused infections in lymph nodes (7/12, 58.3 %), bone/joint (5/12, 41.7 %) and skin (5/12, 41.7 %). After treatment, eight (66.7 %) got favorable prognosis, two (16.7 %) died and one (16.7 %) was unknown.<h4>Conclusions</h4>Adult-onset MSMD have complex clinical presentations and are difficult to recognize, which results in delayed diagnosis. However, once identified, antibiotics and IFN-γ might have good efficacy. Therefore, when encountering adult patients with recurrent and refractory mycobacterial infections, especially in lymph nodes, bone/joints, and skin, MSMD should be considered.

Also flagged:KRASNSCLCsotorasibdocetaxelMetastatic Non-Small-Cell Lung CancersNon-small-cell lung cancers
Journal Article 2023-11-25 No Snippets O'Leary C, Murphy G, Yeung Y, Tang M, Jain V, O'Leary CG.
Show Full Abstract

Non-small-cell lung cancer (NSCLC) is a prevalent and often fatal malignancy. Advancements in targeted therapies have improved outcomes for NSCLC patients in the last decade. Kirsten rat sarcoma virus (KRAS) is a commonly mutated oncogene in NSCLC, contributing to tumorigenesis and proliferation. Though classically difficult to target, recently developed KRAS G12C inhibitors (sotorasib and adagrasib) have now overcome this therapeutic hurdle. We discuss the evidence for these medications, their pitfalls and adverse effects, as well as future directions in this space. Though these medications demonstrate substantial response rates in a heavily pre-treated advanced NSCLC cohort, as phase-3 evidence does not yet demonstrate an overall survival benefit versus standard-of-care chemotherapy, docetaxel. Additionally, these medications appear to have a negative interaction in combination with immunotherapies, with substantially greater hepatotoxicity rates observed. Despite this, it is undeniable that these medications represent an important advancement in targeted and personalised oncological treatment. Current and future trials assessing these medications in combination and through sequencing strategies will likely yield further clinically meaningful outcomes to guide treatment in this patient cohort.

Also flagged:Osteonecrosisosteonecrosis of the jawcytokinebisphosphonatesmTORbisphosphonate
Journal Article 2023-11-25 No Snippets Laputková G, Talian I, Schwartzová V.
Show Full Abstract

The objective was to evaluate the current evidence regarding the etiology of medication-related osteonecrosis of the jaw (MRONJ). This study systematically reviewed the literature by searching PubMed, Web of Science, and ProQuest databases for genes, proteins, and microRNAs associated with MRONJ from the earliest records through April 2023. Conference abstracts, letters, review articles, non-human studies, and non-English publications were excluded. Twelve studies meeting the inclusion criteria involving exposure of human oral mucosa, blood, serum, saliva, or adjacent bone or periodontium to anti-resorptive or anti-angiogenic agents were analyzed. The Cochrane Collaboration risk assessment tool was used to assess the quality of the studies. A total of 824 differentially expressed genes/proteins (DEGs) and 22 microRNAs were extracted for further bioinformatic analysis using Cytoscape, STRING, BiNGO, cytoHubba, MCODE, and ReactomeFI software packages and web-based platforms: DIANA mirPath, OmicsNet, and miRNet tools. The analysis yielded an interactome consisting of 17 hub genes and hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-145, hsa-mir-186, hsa-mir-221, and hsa-mir-424. A dominance of cytokine pathways was observed in both the cluster of hub DEGs and the interactome of hub genes with dysregulated miRNAs. In conclusion, a panel of genes, miRNAs, and related pathways were found, which is a step toward understanding the complexity of the disease.

HFE
Also flagged:Nicotinealkaloidspermatogenesismalemembranetubulin
Journal Article 2023-11-24 ✓ 1 Snippet Sa'adatzadeh M, Oroojan AA, Behmanesh MA, Mard-Soltani M.
In-Text Gene Mentions

…disease, liver failure,hemochromatosis, chronic obstructive pulmonar…

Show Full Abstract

<h4>Objective</h4>The protective effect of aqueous and methanolic extracts of corn silk on reproductive disorders induced by nicotine was investigated in the present study.<h4>Methods</h4>In this experimental study, 30 male NMRI mice (25-30gr) were divided into 5 groups: controls, sham, nicotine 2.5mg/kg, nicotine+aqueous extract of corn silk 400mg/kg, and nicotine+methanolic extract of corn silk 400mg/kg for 34 days. One day after the last nicotine and extracts administration, the serum samples were collected through cardiac puncture for hormonal measurements, and the testis and tail of the epididymis were isolated for the testis antioxidant, morphology, histopathology assessments, and sperm count.<h4>Results</h4>Luteinizing hormone (LH) and malondialdehyde (MDA) increased in the nicotine group. Testosterone, sperm count, and glutathione (GSH) decreased when compared to the control group. Both aqueous and methanolic extracts of corn silk led to the improvement of mentioned changes; Except for GSH, because only treatment with methanolic extract could lead to its increase (p<0.05). Nicotine decreased the thickness of the epithelium of seminiferous tubules and the separation between them, and the administration of corn silk extracts improved that.<h4>Conclusions</h4>Nicotine consumption increased oxidative stress, LH levels, and decreased testosterone and sperm count, which indicate the induction of primary hypogonadism in animals. Moreover, the use of corn silk extracts has recovered the amounts of sex hormones and sperm count to normal conditions by reducing lipid peroxidation.

HFE
Also flagged:Infertilityprimary infertilitysecondary infertilityAnti-Müllerian hormoneAMHfollicle stimulating hormone
Journal Article 2023-11-24 ✓ 1 Snippet Oliveira TFS, Barreiro M, Tomé A, Vale-Fernandes E.
In-Text Gene Mentions

…congenital metabolic disease,hemochromatosis, 21-hydroxylase deficiency, β…

Show Full Abstract

<h4>Objective</h4>Infertility is one of the most significant reproductive health issues addressed with medically assisted procreation. This study looked into a potential correlation between the number of mature oocytes harvested and donor biological characteristics in order to propose an anti-Müllerian hormone (AMH) cutoff level to optimize the selection of candidates for gamete donation.<h4>Methods</h4>The donors were healthy women included in the Public Gamete Bank between 2011 and 2021. Their results can be used as a national indicator of fertility.<h4>Results</h4>We found that women with higher AMH levels had more antral follicles and oocytes harvested. As age increased, the number of oocytes harvested decreased. The suggested AMH cutoff level for successful donation was 1.12 ng/mL.<h4>Conclusions</h4>The analysis of the reproductive health of Public Gamete Bank donors allows the standardization of AMH cutoff values at a national level, since the same laboratory techniques were employed consistently across medical centers. The study also allowed insight into the factors that compromise donation success. If adopted, a more rigorous selection of donor candidates would increase the success rate of egg donations.

CA10
Also flagged:chronic oral diseasemicrobial infectionsbiofilm formationsucroselactic acidlysozyme
Journal Article 2023-11-24 ✓ 1 Snippet Kim H, Han CY, Eun SH, Kim MG, Im AR, Lee B.
In-Text Gene Mentions

Lactic acid then triggers a neutralizing reaction with tooth enamel, which is primarily hydroxyapatite (Ca10(PO4)6(OH)2), dissolving calcium and phosphorus and forming dental caries.

Show Full Abstract

<h4>Background</h4>Dental caries is a chronic oral disease caused by microbial infections, which result in erosion of the dental enamel and cause irreversible damage. Therefore, proper disease management techniques and the creation of an environment that prevents intraoral growth and biofilm formation of Streptococcus mutans in the early stages, are crucial to prevent the potential progression of dental plaque to disease. Here, we aimed to investigate antimicrobial and antibiofilm effects of the Bacillus velezensis ID-A01 supernatant (ID23029) against S. mutans, and its inhibitory effects on acidogenesis.<h4>Results</h4>A killing kinetics assay showed a peak lethality percentage of 94.5% after 6 h of exposure to ID23029. In sucrose-exposed conditions, ID23029 inhibited lactic acid formation, preventing the pH from falling below the threshold for enamel demineralization, and inhibited up to 96.6% of biofilm formation. This effect was maintained in the presence of lysozyme. Furthermore, ID23029 retained up to 92% lethality, even at an intraoral concentration at which lysozyme is ineffective against S. mutans.<h4>Conclusions</h4>This study demonstrates the potential of the B. velezensis ID-A01 supernatant for the prevention and treatment of dental caries. Its eventual use in dental practice is encouraged, although further studies are required to confirm its beneficial effects.

SLC9C2
Also flagged:Solute-linked carrierstransportersmembranesSLCbicarbonatecarbonate
Journal Article 2023-11-24 ✓ 2 Snippets White B, Swietach P.
In-Text Gene Mentions

In fact, SLC9C2 mutations affected the highest proportion of tumour samples out of all SLCs, which is notable because, although it is currently an orphan transporter [59], its sequence is closely related to SLC9C1, the voltage-gated NHE [87].

…In fact,SLC9C2mutations affected the…

Show Full Abstract

Acidosis is a chemical signature of the tumour microenvironment that challenges intracellular pH homeostasis. The orchestrated activity of acid-base transporters of the solute-linked carrier (SLC) family is critical for removing the end-products of fermentative metabolism (lactate/H<sup>+</sup>) and maintaining a favourably alkaline cytoplasm. Given the critical role of pH homeostasis in enabling cellular activities, mutations in relevant SLC genes may impact the oncogenic process, emerging as negatively or positively selected, or as driver or passenger mutations. To address this, we performed a pan-cancer analysis of The Cancer Genome Atlas simple nucleotide variation data for acid/base-transporting SLCs (ABT-SLCs). Somatic mutation patterns of monocarboxylate transporters (MCTs) were consistent with their proposed essentiality in facilitating lactate/H<sup>+</sup> efflux. Among all cancers, tumours of uterine corpus endometrial cancer carried more ABT-SLC somatic mutations than expected from median tumour mutation burden. Among these, somatic mutations in SLC4A3 had features consistent with meaningful consequences on cellular fitness. Definitive evidence for ABT-SLCs as 'cancer essential' or 'driver genes' will have to consider microenvironmental context in genomic sequencing because bulk approaches are insensitive to pH heterogeneity within tumours. Moreover, genomic analyses must be validated with phenotypic outcomes (i.e. SLC-carried flux) to appreciate the opportunities for targeting acid-base transport in cancers.

OLFM4
Also flagged:stem cellWnt3WntDishevelled-associated activator of morphogenesis 1Daam1Daam2
Journal Article 2023-11-24 ✓ 1 Snippet Colozza G, Lee H, Merenda A, Wu SS, Català-Bordes A, Radaszkiewicz TW, Jordens I, Lee JH, Bamford AD, Farnhammer F, Low TY, Maurice MM, Bryja V, Kim J, Koo BK.
In-Text Gene Mentions

Olfm4and Axin2 expression…

Show Full Abstract

The mammalian intestine is one of the most rapidly self-renewing tissues, driven by stem cells residing at the crypt bottom. Paneth cells form a major element of the niche microenvironment providing various growth factors to orchestrate intestinal stem cell homeostasis, such as Wnt3. Different Wnt ligands can selectively activate β-catenin-dependent (canonical) or -independent (noncanonical) signaling. Here, we report that the Dishevelled-associated activator of morphogenesis 1 (Daam1) and its paralogue Daam2 asymmetrically regulate canonical and noncanonical Wnt (Wnt/PCP) signaling. Daam1/2 interacts with the Wnt inhibitor RNF43, and Daam1/2 double knockout stimulates canonical Wnt signaling by preventing RNF43-dependent degradation of the Wnt receptor, Frizzled (Fzd). Single-cell RNA sequencing analysis revealed that Paneth cell differentiation is impaired by Daam1/2 depletion because of defective Wnt/PCP signaling. Together, we identified Daam1/2 as an unexpected hub molecule coordinating both canonical and noncanonical Wnt, which is fundamental for specifying an adequate number of Paneth cells.

Also flagged:membranesinflammatory periodontal diseasesmembranebiomineralizationperiodontitisinflammatory responses
Journal Article 2023-11-24 No Snippets Choi W, Mangal U, Park JY, Kim JY, Jun T, Jung JW, Choi M, Jung S, Lee M, Na JY, Ryu DY, Kim JM, Kwon JS, Koh WG, Lee S, Hwang PTJ, Lee KJ, Jung UW, Cha JK, Choi SH, Hong J.
Show Full Abstract

Guided bone regeneration aided by the application of occlusive membranes is a promising therapy for diverse inflammatory periodontal diseases. Symbiosis, homeostasis between the host microbiome and cells, occurs in the oral environment under normal, but not pathologic, conditions. Here, we develop a symbiotically integrating occlusive membrane by mimicking the tooth enamel growth or multiple nucleation biomineralization processes. We perform human saliva and in vivo canine experiments to confirm that the symbiotically integrating occlusive membrane induces a symbiotic healing environment. Moreover, we show that the membrane exhibits tractability and enzymatic stability, maintaining the healing space during the entire guided bone regeneration therapy period. We apply the symbiotically integrating occlusive membrane to treat inflammatory-challenged cases in vivo, namely, the open and closed healing of canine premolars with severe periodontitis. We find that the membrane promotes symbiosis, prevents negative inflammatory responses, and improves cellular integration. Finally, we show that guided bone regeneration therapy with the symbiotically integrating occlusive membrane achieves fast healing of gingival soft tissue and alveolar bone.

MLLT10
Also flagged:acute myeloid leukemiaAMLto treatmentleukemiaAcute leukemiamalignant
Journal Article 2023-11-24 ✓ 2 Snippets Zaliova M, Zuna J, Winkowska L, Janotova I, Skorepova J, Lukes J, Meyer C, Marschalek R, Novak Z, Domansky J, Stary J, Sramkova L, Trka J.
In-Text Gene Mentions

…KMT2A -r ( KMT2A::MLLT10and KMT2A::MLLT3) while…

…D28 44% in KMT2A::MLLT10/ MLLT3 vs.…

Show Full Abstract

Measurable residual disease (MRD) monitoring in childhood acute myeloid leukemia (AML) is used to assess response to treatment and for early detection of imminent relapse. In childhood AML, MRD is typically evaluated using flow cytometry, or by quantitative detection of leukemia-specific aberrations at the mRNA level. Both methods, however, have significant limitations. Recently, we demonstrated the feasibility of MRD monitoring in selected subgroups of AML at the genomic DNA (gDNA) level. To evaluate the potential of gDNA-based MRD monitoring across all AML subtypes, we conducted a comprehensive analysis involving 133 consecutively diagnosed children. Integrating next-generation sequencing into the diagnostic process, we identified (presumed) primary genetic aberrations suitable as MRD targets in 97% of patients. We developed patient-specific quantification assays and monitored MRD in 122 children. The gDNA-based MRD monitoring via quantification of primary aberrations with a sensitivity of at least 10<sup>-4</sup> was possible in 86% of patients; via quantification with sensitivity of 5 × 10<sup>-4</sup>, of secondary aberrations, or at the mRNA level in an additional 8%. Importantly, gDNA-based MRD exhibited independent prognostic value at early time-points in patients stratified to intermediate-/high-risk treatment arms. Our study demonstrates the broad applicability, feasibility, and clinical significance of gDNA-based MRD monitoring in childhood AML.

Also flagged:honokiolneolignanbiphenolneurological diseasesanxietydepression
Journal Article 2023-11-24 No Snippets Faysal M, Khan J, Zehravi M, Nath N, Singh LP, Kakkar S, Perusomula R, Khan PA, Nainu F, Asiri M, Khan SL, Das R, Emran TB, Wilairatana P.
Show Full Abstract

Honokiol is a neolignan biphenol found in aerial parts of the Magnolia plant species. The Magnolia plant species traditionally belong to China and have been used for centuries to treat many pathological conditions. Honokiol mitigates the severity of several pathological conditions and has the potential to work as an anti-inflammatory, anti-angiogenic, anticancer, antioxidant, and neurotherapeutic agent. It has a long history of being employed in the healthcare practices of Southeast Asia, but in recent years, a greater scope of research has been conducted on it. Plenty of experimental evidence suggests it could be beneficial as a neuroprotective bioactive molecule. Honokiol has several pharmacological effects, leading to its exploration as a potential therapy for neurological diseases (NDs), including Alzheimer's disease (AD), Parkinson's disease (PD), cerebral ischemia, anxiety, depression, spinal cord injury, and so on. So, based on the previous experimentation reports, our goal is to discuss the neuroprotective properties of honokiol. Besides, honokiol derivatives have been highlighted recently as possible therapeutic options for NDs. So, this review focuses on honokiol's neurotherapeutic actions and toxicological profile to determine their safety and potential use in neurotherapeutics.

Also flagged:ALSAmyotrophic lateral sclerosisneurodegenerative disordermotor neurone diseasedeathgene expression
Journal Article 2023-11-24 No Snippets Fröhlich A, Pfaff AL, Bubb VJ, Quinn JP, Koks S.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder and the most common form of motor neurone disease (MND) which is characterized by the damage and death of motor neurons in the brain and spinal cord of affected individuals. Due to the heterogeneity of the disease, a better understanding of the interaction between genetics and biochemistry with the identification of biomarkers is crucial for therapy development. In this study, we used cerebrospinal fluid (CSF) RNA-sequencing data from the New York Genome Center (NYGC) ALS Consortium and analyzed differential gene expression between 47 MND individuals and 29 healthy controls. Pathway analysis showed that the affected genes are enriched in many pathways associated with ALS, including nucleocytoplasmic transport, autophagy, and apoptosis. Moreover, we assessed differential expression on both gene- and transcript-based levels and demonstrate that the expression of previously identified potential biomarkers, including <i>CAPG</i>, <i>CCL3</i>, and <i>MAP2</i>, was significantly higher in MND individuals. Ultimately, this study highlights the transcriptomic composition of CSF which enables insights into changes in the brain in ALS and therefore increases the confidence in the use of CSF for biomarker development.

SERPINC1
Also flagged:vimentinSARS-CoV-2 infectioninfectionviral infectionCOVID-19(Ig)A
Journal Article 2023-11-24 ✓ 5 Snippets Ellis S, Way R, Nel M, Burleigh A, Doykov I, Kembou-Ringert J, Woodall M, Masonou T, Case KM, Ortez AT, McHugh TD, Casal A, McCoy LE, Murdan S, Hynds RE, Gilmour KC, Grandjean L, Cortina-Borja M, Heywood WE, Mills K, Smith CM.
In-Text Gene Mentions

Although trends toward increased infection were also observed for SERPINC1 and S100A9, these did not reach statistical significance.

…UK), S100A9 andSERPINC1(Fisher Scientific).…

…and antithrombin III (SERPINC1) ( Fig. 5…

…BothSERPINC1and VIM were…

…with VIM andSERPINC1( Supplementary Fig.…

Show Full Abstract

SARS-CoV-2 initially infects cells in the nasopharynx and oral cavity. The immune system at these mucosal sites plays a crucial role in minimizing viral transmission and infection. To develop new strategies for preventing SARS-CoV-2 infection, this study aimed to identify proteins that protect against viral infection in saliva. We collected 551 saliva samples from 290 healthcare workers who had tested positive for COVID-19, before vaccination, between June and December 2020. The samples were categorized based on their ability to block or enhance infection using in vitro assays. Mass spectrometry and enzyme-linked immunosorbent assay experiments were used to identify and measure the abundance of proteins that specifically bind to SARS-CoV-2 antigens. Immunoglobulin (Ig)A specific to SARS-CoV-2 antigens was detectable in over 83% of the convalescent saliva samples. We found that concentrations of anti-receptor-binding domain IgA >500 pg/µg total protein in saliva correlate with reduced viral infectivity in vitro. However, there is a dissociation between the salivary IgA response to SARS-CoV-2, and systemic IgG titers in convalescent COVID-19 patients. Then, using an innovative technique known as spike-baited mass spectrometry, we identified novel spike-binding proteins in saliva, most notably vimentin, which correlated with increased viral infectivity in vitro and could serve as a therapeutic target against COVID-19.

Also flagged:Cas9PTCHD1genetic diseasesdevelopmental delayautism spectrum disorderintellectual disability
Journal Article 2023-11-24 No Snippets Farley KO, Forbes CA, Shaw NC, Kuzminski E, Ward M, Baynam G, Lassmann T, Fear VS.
Show Full Abstract

An estimated 3.5%-5.9% of the global population live with rare diseases, and approximately 80% of these diseases have a genetic cause. Rare genetic diseases are difficult to diagnose, with some affected individuals experiencing diagnostic delays of 5-30 years. Next-generation sequencing has improved clinical diagnostic rates to 33%-48%. In a majority of cases, novel variants potentially causing the disease are discovered. These variants require functional validation in specialist laboratories, resulting in a diagnostic delay. In the interim, the finding is classified as a genetic variant of uncertain significance (VUS) and the affected individual remains undiagnosed. A VUS (PTCHD1 c. 2489T>G) was identified in a child with autistic behavior, global developmental delay, and hypotonia. Loss of function mutations in PTCHD1 are associated with autism spectrum disorder and intellectual disability; however, the molecular function of PTCHD1 and its role in neurodevelopmental disease is unknown. Here, we apply CRISPR gene editing and induced pluripotent stem cell (iPSC) neural disease modeling to assess the variant. During differentiation from iPSCs to neural progenitors, we detect subtle but significant gene signatures in synaptic transmission and muscle contraction pathways. Our work supports the causal link between the genetic variant and the child's phenotype, providing evidence for the variant to be considered a pathogenic variant according to the American College of Medical Genetics and Genomics guidelines. In addition, our study provides molecular data on the role of PTCHD1 in the context of other neurodevelopmental disorders.

Also flagged:carbonatehydroxyapatitenanofiberscell adhesioncell proliferationglycolic acid
Journal Article 2023-11-24 No Snippets Patty DJ, Nugraheni AD, Ana ID, Aminatun, Sari YW, Gunawarman, Yusuf Y.
Show Full Abstract

Synthetic polymers, such as PCL and PLGA, are among the main material choices in tissue engineering because of their stable structures and strong mechanical properties. In this study, we designed polycaprolactone (PCL)/polylactic-<i>co</i>-glycolate acid (PLGA) nanofibers doped with carbonate hydroxyapatite (CHA) and egg white (EW) with enhanced properties. The addition of CHA and EW significantly influenced the properties and morphology of PCL/PLGA nanofibers; whereby the CHA substitution (PCL/PLGA/CHA) greatly increased the mechanical properties related to the Young's modulus and EW doping (PCL/PLGA/CHA/EW) increased the elongation at break. Bioactivity tests of PCL/PLGA/CHA/EW after immersion in the SBF for 3 to 9 days showed increased fiber diameters and a good swelling capacity that could improve cell adhesion, while biocompatibility tests with NIH-3T3 fibroblast cells showed good cell proliferation (85%) after 48 h and antibacterial properties against <i>S. aureus</i>.

Also flagged:Neurologic Diseasesneurodegenerative diseasespathogenesismetabolic syndromeneurologic disordersAD
Journal Article 2023-11-24 No Snippets Guo M, Wang X, Li Y, Luo A, Zhao Y, Luo X, Li S.
Show Full Abstract

As the global population ages, the prevalence of neurodegenerative diseases is surging. These disorders have a multifaceted pathogenesis, entwined with genetic and environmental factors. Emerging research underscores the profound influence of diet on the development and progression of health conditions. Intermittent fasting (IF), a dietary pattern that is increasingly embraced and recommended, has demonstrated potential in improving neurophysiological functions and mitigating pathological injuries with few adverse effects. Although the precise mechanisms of IF's beneficial impact are not yet completely understood, gut microbiota and their metabolites are believed to be pivotal in mediating these effects. This review endeavors to thoroughly examine current studies on the shifts in gut microbiota and metabolite profiles prompted by IF, and their possible consequences for neural health. It also highlights the significance of dietary strategies as a clinical consideration for those with neurological conditions.

Also flagged:Titaniummesenchymalcell adhesioncell proliferationcalcium phosphatecalcium
Journal Article 2023-11-24 No Snippets Campos-Bijit V, Inostroza NC, Orellana R, Rivera A, Von Marttens A, Cortez C, Covarrubias C.
Show Full Abstract

The topography and composition of dental implant surfaces directly impact mesenchymal cell adhesion, proliferation, and differentiation, crucial aspects of achieving osseointegration. However, cell adhesion to biomaterials is considered a key step that drives cell proliferation and differentiation. The aim of this study was to characterize characterize the topography and composition of commercial titanium dental implants manufactured with different surface treatments (two sandblasted/acid-etched (SLA) (INNO Implants, Busan, Republic of Korea; BioHorizons<sup>TM</sup>, Oceanside, CA, USA) and two calcium phosphate (CaP) treated (Biounite<sup>®</sup>, Berazategui, Argentina; Zimmer Biomet, Inc., Warsaw, IN, USA)) and to investigate their influence on the process of cell adhesion in vitro. A smooth surface implant (Zimmer Biomet, Inc.) was used as a control. For that, high-resolution methodologies such as scanning electron microscopy (SEM), X-ray dispersive spectroscopy (EDX), laser scanning confocal microscopy (LSCM), and atomic force microscopy (AFM) were employed. Protein adsorption and retromolar gingival mesenchymal stem cells (GMSCs) adhesion to the implant surfaces were evaluated after 48 h. The adherent cells were examined by SEM and LSCM for morphologic and quantitative analyses. ANOVA and Tukey tests (<i>α</i> = 0.05) were employed to determine statistical significance. SEM revealed that INNO, BioHorizons<sup>TM</sup>, and Zimmer implants have an irregular surface, whereas Biounite<sup>®</sup> has a regular topography consisting of an ordered pattern. EDX confirmed a calcium and phosphate layer on the Biounite<sup>®</sup> and Zimmer surfaces, and AFM exhibited different roughness parameters. Protein adsorption and cell adhesion were detected on all the implant surfaces studied. However, the Biounite<sup>®</sup> implant with CaP and regular topography showed the highest protein adsorption capacity and density of adherent GMSCs. Although the Zimmer implant also had a CaP treatment, protein and cell adhesion levels were lower than those observed with Biounite<sup>®</sup>. Our findings indicated that the surface regularity of the implants is a more determinant factor in the cell adhesion process than the CaP treatment. A regular, nanostructured, hydrophilic, and moderately rough topography generates a higher protein adsorption capacity and thus promotes more efficient cell adhesion.

HTT
Also flagged:psychiatric disorderscannabinoiddeathmental disordersmajor depressionschizophrenia
Journal Article 2023-11-24 ✓ 1 Snippet Navarro D, Marín-Mayor M, Gasparyan A, García-Gutiérrez MS, Rubio G, Manzanares J.
In-Text Gene Mentions

The serotonin transporter (5-HTT) is responsible for the sodium-dependent serotonin reuptake, and the 5-HTT gene is located at the 17q11.1-q12 locus.

Show Full Abstract

Suicide is a serious global public health problem, with a worrying recent increase in suicide rates in both adolescent and adult populations. However, it is essential to recognize that suicide is preventable. A myriad of factors contributes to an individual's vulnerability to suicide. These factors include various potential causes, from psychiatric disorders to genetic and epigenetic alterations. These changes can induce dysfunctions in crucial systems such as the serotonergic, cannabinoid, and hypothalamic-pituitary-adrenal axes. In addition, early life experiences of abuse can profoundly impact an individual's ability to cope with stress, ultimately leading to changes in the inflammatory system, which is a significant risk factor for suicidal behavior. Thus, it is clear that suicidal behavior may result from a confluence of multiple factors. This review examines the primary risk factors associated with suicidal behavior, including psychiatric disorders, early life adversities, and epigenetic modifications. Our goal is to elucidate the molecular changes at the genetic, epigenetic, and molecular levels in the brains of individuals who have taken their own lives and in the plasma and peripheral mononuclear cells of suicide attempters and how these changes may serve as predisposing factors for suicidal tendencies.

Also flagged:bone formationScarb1acetoacetyl-CoA synthetaseHIVEP3myristic acidpalmitic acid
Journal Article 2023-11-24 No Snippets Ren H, He X, Lu Y, Yue D, Liu X, Wu D, Zhu J, Gao Z, Xi D, Deng W.
Show Full Abstract

<b>Introduction:</b> Body measurement traits are integral in cattle production, serving as pivotal criteria for breeding selection. Wenshan cattle, a local breed in China's Yunnan province, exhibit remarkable genetic diversity. However, the molecular mechanisms regulating body measurement traits in Wenshan cattle remain unexplored. <b>Methods:</b> In this study, we performed a genome-wide association method to identify genetic architecture for body height body length hip height back height (BAH), waist height and ischial tuberosity height using the Bovine 50 K single nucleotide polymorphism Array in 1060 Wenshan cattles. <b>Results:</b> This analysis reveals 8 significant SNPs identified through the mixed linear model (MLM), with 6 SNPs are associated with multiple traits and 4 SNPs are associated with all 6 traits. Furthermore, we pinpoint 21 candidate genes located in proximity to or within these significant SNPs. Among them, <i>Scarb1</i>, <i>acetoacetyl-CoA synthetase</i> and <i>HIVEP3</i> were implicated in bone formation and rarely encountered in livestock body measurement traits, emerge as potential candidate genes regulating body measurement traits in Wenshan cattle. <b>Discussion:</b> This investigation provides valuable insights into the genetic mechanisms underpinning body measurement traits in this unique cattle breed, paving the way for further research in this domain.

TNFSF4
Also flagged:HistoneCUL4Blung adenocarcinomacisplatinLUADcell proliferation
Journal Article 2023-11-24 ✓ 1 Snippet Yin Y, Zhang L, Zeng Y, Chen D, Guan H, Ran G, Du K.
In-Text Gene Mentions

…PDCD1LG2, TGFB1, TLR4,TNFSF4, TNFSF9, VEGFA, VEGFB,…

Show Full Abstract

<b>Background:</b> The role of the histone ubiquitination-related gene in the cisplatin resistance of lung adenocarcinoma (LUAD) remains an intricate subject. <b>Methods:</b> We accessed transcriptome data of both wild type and cisplatin-resistant cells from the GSE108214 dataset, and garnered transcriptome and clinical data of LUAD patients from The Cancer Genome Atlas (TCGA) database. Utilizing the R software, we analyzed these public datasets in depth. Real-time Quantitative PCR (qPCR) was used to detect the RNA level of CUL4B. Effect of CUL4B on cell proliferation was evaluated using CCK8 and colony formation assay. Effect of CUL4B on cell invasion was evaluated using transwell assay. Cisplatin sensitivity was evaluated by calculating IC50. <b>Results:</b> Our analysis shed light on the significance of the histone ubiquitination-related gene, CUL4B, in relation to cisplatin resistance and the overall survival rates of LUAD patients. Notably, CUL4B was found to be overexpressed in both lung cancer tissues and cells. Meanwhile, <i>in vitro</i> experiments indicated can CUL4B significantly promote the proliferation, invasion and migration of lung cancer cells. Furthermore, suppressing CUL4B expression led to a noticeable reduction in the IC50 value of cisplatin in lung cancer cells. A deep dive into biological enrichment analysis revealed that among patients exhibiting high CUL4B expression, there was a pronounced activation of the G2M checkpoint and the PI3K/AKT/mTOR signaling pathways. Immune microenvironment analysis has revealed that patients with elevated CUL4B expression may exhibit increased infiltration of M2 macrophages, coupled with a reduced infiltration of CD8<sup>+</sup> T cells and activated NK cells. Notably, we observed higher CUL4B expression among those who responded positively to immunotherapy. <b>Conclusion:</b> These findings underscore the significance of CUL4B in the resistance to cisplatin in lung cancer, highlighting its potential as a therapeutic target.

OLFM4
Also flagged:hepatobiliary diseasesinfectionimmune responseliver fibrosisECM-receptorcell adhesion molecules
Journal Article 2023-11-24 ✓ 2 Snippets Zhan T, Wu Y, Deng X, Li Q, Chen Y, Lv J, Wang J, Li S, Wu Z, Liu D, Tang Z.
In-Text Gene Mentions

…Epcam, Col6a5, Col4a5,Olfm4, Agr2, Itga2, Cd34,…

…of Col6a3, Col6a5,Olfm4, Mrc2, Cd34, and…

Show Full Abstract

<h4>Introduction</h4>Clonorchiasis remains a serious global public health problem, causing various hepatobiliary diseases. However, there is still a lack of overall understanding regarding the molecular events triggered by <i>Clonorchis sinensis</i> (<i>C. sinensis</i>) in the liver.<h4>Methods</h4>BALB/c mouse models infected with <i>C. sinensis</i> for 5, 10, 15, and 20 weeks were constructed. Liver pathology staining and observation were conducted to evaluate histopathology. The levels of biochemical enzymes, blood routine indices, and cytokines in the blood were determined. Furthermore, alterations in the transcriptome, proteome, and metabolome of mouse livers infected for 5 weeks were analyzed using multi-omics techniques.<h4>Results</h4>The results of this study indicated that adult <i>C. sinensis</i> can cause hepatosplenomegaly and liver damage, with the most severe symptoms observed at 5 weeks post-infection. However, as the infection persisted, the Th2 immune response increased and symptoms were relieved. Multi-omics analysis of liver infected for 5 weeks identified 191, 402 and 232 differentially expressed genes (DEGs), proteins (DEPs) and metabolites (DEMs), respectively. Both DEGs and DEPs were significantly enriched in liver fibrosis-related pathways such as ECM-receptor interaction and cell adhesion molecules. Key molecules associated with liver fibrosis and inflammation (Cd34, Epcam, S100a6, Fhl2, Itgax, and Retnlg) were up-regulated at both the gene and protein levels. The top three metabolic pathways, namely purine metabolism, arachidonic acid metabolism, and ABC transporters, were associated with liver cirrhosis, fibrosis, and cholestasis, respectively. Furthermore, metabolites that can promote liver inflammation and fibrosis, such as LysoPC(P-16:0/0:0), 20-COOH-leukotriene E4, and 14,15-DiHETrE, were significantly up-regulated.<h4>Conclusion</h4>Our study revealed that the most severe symptoms in mice infected with <i>C. sinensis</i> occurred at 5 weeks post-infection. Moreover, multi-omics analysis uncovered predominant molecular events related to fibrosis changes in the liver. This study not only enhances our understanding of clonorchiasis progression but also provides valuable insights into the molecular-level interaction mechanism between <i>C. sinensis</i> and its host liver.

Also flagged:cancertumorHLAantigen presentationmalignant tumorscell receptor
Journal Article 2023-11-24 No Snippets Yan W, Dunmall LSC, Lemoine NR, Wang Y, Wang Y, Wang P.
Show Full Abstract

γδ T cells, a specialized subset of T lymphocytes, have garnered significant attention within the realm of cancer immunotherapy. Operating at the nexus between adaptive and innate immunological paradigms, these cells showcase a profound tumor discernment repertoire, hinting at novel immunotherapeutic strategies. Significantly, these cells possess the capability to directly identify and eliminate tumor cells without reliance on HLA-antigen presentation. Furthermore, γδ T cells have the faculty to present tumor antigens to αβ T cells, amplifying their anti-tumoral efficacy.Within the diverse and heterogeneous subpopulations of γδ T cells, distinct immune functionalities emerge, manifesting either anti-tumor or pro-tumor roles within the tumor microenvironment. Grasping and strategically harnessing these heterogeneous γδ T cell cohorts is pivotal to their integration in tumor-specific immunotherapeutic modalities. The aim of this review is to describe the heterogeneity of the γδ T cell lineage and the functional plasticity it generates in the treatment of malignant tumors. This review endeavors to elucidate the intricate heterogeneity inherent to the γδ T cell lineage, the consequential functional dynamics in combating malignancies, the latest advancements from clinical trials, and the evolving landscape of γδ T cell-based oncological interventions, while addressing the challenges impeding the field.

Also flagged:COPDRNA-binding proteinscell proliferationAsthmapathogenesiscell differentiation
Journal Article 2023-11-24 No Snippets Liu X, Ali MK, Dua K, Mao Y, Liu J.
Show Full Abstract

Circular RNAs (circRNAs) belong to a unique class of endogenously expressed non-protein-coding RNAs with a distinct circularized structure, characterized by the absence of 5'-cap and 3'-polyadenylate ends. They are generally formed through back-splicing from pre-mRNAs. They serve as regulators of transcription and splicing, and act as sponges for microRNAs (miRNAs) and RNA-binding proteins, thereby modulating the expression of target genes. As a result, they exert a substantial impact on a diverse array of cellular and biological processes, including cell proliferation, migration, inflammation, and oxidative stress. Asthma and COPD are chronic airway conditions that currently have no cure. In recent years, emerging evidence suggests that altered expression of circRNAs in airway, bronchial and immune cells is involved in asthma and COPD pathogenesis. Studies exploring circRNA dysregulation in asthma have showcased their involvement in regulating the proliferation, migration, and inflammation of airway smooth muscle and bronchial epithelial cells, as well as impacting goblet cell metaplasia, Th2 cell differentiation, and macrophage activation, primarily through interactions with miRNAs. Similarly, in COPD, circRNAs have shown altered expression patterns in the blood and lungs of patients, and these changes have been linked to modulating inflammation, oxidative stress, and airway remodeling in preclinical models. Furthermore, certain circRNAs have demonstrated promising potential as diagnostic and prognostic biomarkers for both asthma and COPD. This review delves into the current understanding of the function and molecular mechanisms of circRNAs in asthma and COPD, along with exploring their potential as biomarkers in these respiratory conditions.

Also flagged:degradationcervical intraepithelial neoplasiaCINcervical invasive carcinomacervical insufficiencymiscarriage
Journal Article 2023-11-24 No Snippets Chen L, Zhang Y, Liu L, Hayashi T, Cui N, Liu Y.
Show Full Abstract

<h4>Background</h4>Cervical intraepithelial neoplasia (CIN) is a collective term for pre-cancerous lesions associated with cervical invasive carcinoma. Treatment options depend on the development and progression of the disease. Especially for patients with CINII grade who are aged 25 years and older and have fertility requirements, it is a clinical challenge to determine whether to proceed with conservative or excisional treatment. Excisional treatment increases the risk of overtreatment outcomes, such as cervical insufficiency, preterm labor, miscarriage, and premature rupture of membranes, in young women with childbearing potential. P16 immunohistochemical staining has greatly improved the consistency of CINII patient's diagnosis. The aim of this study was to analyze the risk factors predicting pathological degradation after cervical excision in cervical intraepithelial neoplasia grade II P16-positive patients over 25 years old, and to provide information to help optimize clinical treatments patients with CINII disease.<h4>Methods</h4>Single-factor and logistic regression models were used to analyze the risk factors for pathological downgrading in the CINII/P16-positive (+) group. The predicted probability of pathological downgrading in the CINII/P16(+) group of patients was calculated according to the logistic regression model to generate a new variable multi-indicator association for receiver operating characteristic (ROC) curve plotting to determine the predictive ability.<h4>Results</h4>A total of 248 women who met the inclusion and exclusion criteria were included. Statistical analysis showed that the CINII/P16(+) group had a higher pathological downgrading rate compared with the CINIII group after cold knife conization (CKC) (χ<sup>2</sup>=6.26, P=0.012). Univariate factors showed that the differences were statistically significant when comparing age, number of biopsy-involved quadrants, menopausal status, and involvement of glands, respectively (P<0.05). In contrast, the differences were not statistically significant when comparing cytological findings, type of transformation zone, high-risk human papilloma virus (HR-HPV) testing, abortion status, pregnancy frequency, time from diagnosis to CKC and Ki67 percentage between the two groups. Multifactorial logistic regression showed that the extent of biopsy CINII involvement [odds ratio (OR), 1.589], menopausal status (OR, 4.031), and glandular involvement (OR, 5.549) were all independent risk factors for pathological downgrading in the CINII/P16(+) patient group (P<0.05). The order of significance of the areas under the ROC curve (AUCs) was as follows: combined multiple indicators (AUC 0.716) > gland involvement (AUC 0.625) > biopsy CINII involvement extent (AUC 0.614) > menopausal status (AUC 0.565).<h4>Conclusions</h4>A higher rate of pathological downgrading after CKC was found in CINII/P16-positive patients who were aged over 25 years. Overtreatment exists in patients with CINII/P16-positive diagnosis. Independent factors for pathological downgrading were identified by the factors including if the lesion involved the gland, the extent of CINII involvement on biopsy, and menopausal status.

SOX6
Also flagged:Head and Neck Squamous Cell CarcinomasHead and neck squamous cell carcinomaHNSCCcancerGene Expressionkeratinization
Journal Article 2023-11-24 ✓ 5 Snippets Kolenda T, Graczyk Z, Żarska B, Łosiewski W, Smolibowski M, Wartecki A, Kozłowska-Masłoń J, Guglas K, Florczak A, Kazimierczak U, Teresiak A, Lamperska K.
In-Text Gene Mentions

The TCGA expression and clinical data of SOX2-OT, SOX6, SOX8, SOX21, SOX30 and SRY were downloaded from cBioPortal and from the Santa Cruz University of California dataset (Head and Neck Squamous Cell Carcinoma, TCGA, dataset: gene expression RNAseq—IlluminaHiSeq pancan-normalized; RNA expression pan-cancer-normalized log2(norm_count + 1); accessed on 1 November 2021 from https://xenabrowser.net/) and from the UALCAN databases (http://ualcan.path.uab.edu; accessed on 1 November 2021) [29,30].

SOX6 can also be involved in tumorigenesis as an oncogene or tumor suppressor in different types of cancer [18].

SOX2-OT, SOX6, SOX8, SOX21 and SRY genes were connected with tobacco smoking; SOX2-OT, SOX6, SOX21 and SOX30- were connected with lymph node neck dissection and lymphovascular invasion; and SOX2-OT, SOX8 and SOX30 were connected with HPV in p16 test two with regard to gender (SOX21, SRY), cancer stage (SOX6, SOX21) and grade (SOX8, SOX30) and one gene with age (SRY), alcohol (SRY), T stage (SOX8) and N stage (SOX30).

The expression levels of SOX2-OT, SOX6, SOX8, SOX21, SOX30 and SRY genes were analyzed and correlated with clinicopathological parameters: age (<61 vs. >61), smoking category (No vs. Yes and Ex-smoker), gender (women vs. men), alcohol history (negative vs. positive), cancer stage (I + II vs. III + IV), T-stage (T1 + T2 vs. T3 + T4), N-stage (N0 + N1 vs. N2 + N3), grade (G1 + G2 vs. G3 + G4), perineural invasion (negative vs. positive), lymph node neck dissection (negative vs. positive), lymphovascular invasion (negative vs. positive) and HPV in p16 test (negative vs. positive) in all localizations of the HNSCC samples as described previously [31,32].

We observed statistically significant differences in the expression of SOX6, SOX8, SOX21 and SOX30 genes in healthy tissue vs. primary tumor samples.

Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) is the sixth leading cancer and the fifth cause of cancer-related deaths worldwide with a poor 5-year survival. <i>SOX</i> family genes play a role in the processes involved in cancer development such as epithelial-mesenchymal transition (EMT), the maintenance of cancer stem cells (CSCs) and the regulation of drug resistance. We analyzed the expression of <i>SOX2-OT</i>, <i>SOX6</i>, <i>SOX8</i>, <i>SOX21</i>, <i>SOX30</i> and <i>SRY</i> genes in HNSCC patients using the Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) datasets, to assess their biological role and their potential utility as biomarkers. We demonstrated statistically significant differences in expression between normal and primary tumor tissues for <i>SOX6</i>, <i>SOX8</i>, <i>SOX21</i> and <i>SOX30</i> genes and pointed to <i>SOX6</i> as the one that met the independent diagnostic markers criteria. <i>SOX21</i> or <i>SRY</i> alone, or the panel of six <i>SRY</i>-related genes, could be used to estimate patient survival. <i>SRY</i>-related genes are positively correlated with immunological processes, as well as with keratinization and formation of the cornified envelope, and negatively correlated with DNA repair and response to stress. Moreover, except <i>SRY</i>, all analyzed genes were associated with a different tumor composition and immunological profiles. Based on validation results, the expression of <i>SOX30</i> is higher in HPV(+) patients and is associated with patients' survival. <i>SRY</i>-related transcription factors have vast importance in HNSCC biology. <i>SOX30</i> seems to be a potential biomarker of HPV infection and could be used as a prognostic marker, but further research is required to fully understand the role of <i>SOX</i> family genes in HNSCC.

Also flagged:Huperzine AsynthesisADacetylcholinememory impairmentpathogenesis
Journal Article 2023-11-24 No Snippets Le TTM, Pham HT, Trinh HTT, Tran HT, Chu HH.
Show Full Abstract

Huperzine A (HupA) is an important drug for treating Alzheimer's disease (AD) and is primarily extracted from the <i>Huperzia serrata</i> (<i>Lycopodiaceae</i>). Failures in the chemical synthesis of Hup and in vitro culture have put <i>H. serrata</i> in danger of extinction, and there is a need for an extensive investigation of Hup from alternative perspectives. The aim of this study is to identify endophytic fungi that produce high Hup or simultaneously produce many types of Hup and have high genetic stability derived from other <i>Lycopodiaceae</i> species as a source of materials for natural Hup production. In this work, Hup-producing endophytic fungi were isolated from three species: <i>Lycopodium clavatum</i>, <i>Phlegmariurus squarrosus,</i> and <i>P. phlegmaria</i>. Of these, <i>L. clavatum</i> and <i>P. squarrosus</i> were confirmed as novel sources of Hup-producing fungi. Based on morphological characteristics and nuclear ribosomal DNA ITS sequences, four endophytic fungi <i>Colletotrichum siamense</i> THG1-17, <i>Epicoccum sorghinum</i> THG01-18, <i>Phoma</i> sp. TKH3-2, and <i>Phyllosticta</i> sp. THG2-27 were firstly isolated from these <i>Lycopodiaceae</i> plants, which were capable of simultaneously producing both HupA and HupB, as evidenced by high-performance liquid chromatography analysis. The four strains showed stability in Hup yield over 50 generations of culture with an in vitro storage period of 3 months. These isolated fungi will provide a new source of materials for further research to develop drugs containing HupA as well as HupB for AD treatment in the future.

Also flagged:bacterial infectionsubclinical mastitisPCCmastitisglycoproteinamino acids
Journal Article 2023-11-24 No Snippets Sala G, Orsetti C, Meucci V, De Marchi L, Sgorbini M, Bonelli F.
Show Full Abstract

Procalcitonin (PCT) and protein carbonylated content (PCC) are promising biomarkers for bacterial infection and inflammation in veterinary medicine. This study examined plasma PCT and PCC levels in healthy cows (H) and cows with subclinical mastitis (SCM). A total of 130 cows (65 H and 65 SCM) were included in this study. Blood samples were collected, and plasma was frozen at -80 °C. PCT levels were determined using a bovine procalcitonin ELISA kit, while PCC was measured following the methodology of Levine et al. Statistical analysis revealed a significant difference in PCT levels between H (75.4 pg/mL) and SCM (107.3 pg/mL) cows (<i>p</i> < 0.001) and significantly lower concentrations of PCC in the SCM group (H: 0.102 nmol/mL/mg, SCM: 0.046 nmol/mL/mg; <i>p</i> < 0.001). The PCT cut-off value for distinguishing healthy and subclinical mastitis animals was >89.8 pg/mL (AUC 0.695), with a sensitivity of 66.2% and specificity of 69.2%. PCT showed potential value as a diagnostic tool to help in decision making for subclinical mastitis cases, while PCC requires further studies to investigate the trend of this biomarker during localized pathology.

MLLT10
Also flagged:Acute myeloid leukemiaKMT2AMLLT3CD4plasmacytoid dendritic cell neoplasmAML
Journal Article 2023-11-24 ✓ 2 Snippets Wankel B, Afzal M, Loo EY, LeBlanc RE, Carter JB, Lansigan E, Yerrabothala S.
In-Text Gene Mentions

…confirmed AML with KMT2A::MLLT10fusion detected by…

…a KMT2A ::MLLT10fusion.…

Show Full Abstract

A 63-year-old woman presented with plaques covering 60 % body-surface-area and leonine facies. Blood work showed no diagnostic aberrancies. Skin biopsy contained a malignant CD4+/CD56+ mononuclear cell population concerning for blastic plasmacytoid dendritic cell neoplasm. A later bone marrow biopsy confirmed AML with <i>KMT2A::MLLT10</i> fusion detected by next-generation sequencing (NGS). This patient's LC preceded blood and marrow based symptoms of AML. NGS of the initial skin biopsy should be considered as part of diagnostic guidelines in cases with LC in the differential as this may have led to earlier diagnosis in this case and future cases.

OLFM4
Also flagged:Ptgs1Sox2Klf4c-MycPtgs2prostaglandin E2
Journal Article 2023-11-24 ✓ 5 Snippets Kim J, Kim S, Lee S, Jo B, Oh J, Kwon E, Kim K, Adpaikar A, Kim E, Jung H, Kim H, Roe J, Hong C, Kim J, Koo B, Cha H.
In-Text Gene Mentions

…611203, 1:500), rabbit anti-Olfm4(Cell Signaling Technology,…

…marked by olfactomedin-4 (Olfm4) ( 23 ),…

…clear depletion ofOlfm4and Ki67 signals…

…with re-expression ofOlfm4and Ki67 in…

…the level ofOlfm4+ cells in the…

Show Full Abstract

No abstract available.

Also flagged:Leprosydiabetesbodyerythrodermasarcoidosislupus erythematosus
Journal Article 2023-11-24 No Snippets Kumari S, Verma G, Negi A, Sharma A.
Show Full Abstract

No abstract available.

bioRxiv 2023-11-24 Preprint (No Snippets API) Cheng Y, Nocula-Lugowska G, Ramirez JA, Fan X, Jin F, Jiang Z, Bennett E, Li J, Hokanson D, Grandhi S, Chen M, Cheng C, Lin G, Lin L, Lepsy C, Chaparro-Riggers J, Bloom L, Morrissey D, Stewart M, Tadin-Strapps M, Chiang S.
Show Full Abstract

<h4>ABSTRACT</h4> Expansion of repeat sequences within the human genome can lead to disease pathogenesis, such as Huntington’s Disease, primarily affecting the nervous system. Genome-wide association studies (GWAS) of age-at-onset in Huntington’s disease (HD) patients demonstrated DNA mismatch repair (MMR) genes are modifiers of somatic expansion and may be potential therapeutic targets for repeat expansion (RE) disorders. FAN1, a Fanconi anemia-associated nuclease, has been reported as an influencer of repeat expansion in the RE mouse models. Here, we show the first demonstration that FAN1 knock-out in HD patient-derived fibroblasts and results in increased CAG repeat length. We also develop a robust novel cell-based platform using stem cell technology to produce the HD patients’ iPSC-derived astrocytes (iAstro). This platform is a disease-relevant system and has a significantly wider assay window, making it more suitable to assess the effect of gene modulation on CAG repeats. A substantial and exponential increase in repeat instability was exhibited in this HD patient’s iPSC-derived astrocytes platform. Over-expression of FAN1 protein via FAN1 plasmid transfection in this platform reduced CAG repeat instability, suggesting that upregulation of FAN1 protein may have a potential protective effect in CAG repeat expansion for a therapeutic setting. We leveraged the mRNA-LNP modality to enhance FAN1 protein expression and revealed that codon-optimized FAN1 mRNA-LNP robustly prevented increased CAG repeat in HD patients’ iPSC-derived astrocytes platform. The data from these cell-based platforms highlight that FAN1 plays a protective role in attenuating expanded somatic HTT CAG repeats and shed light on new therapeutic directions against repeat expansion disorders.

bioRxiv 2023-11-24 Preprint (No Snippets API) Sledzinski P, Nowaczyk M, Karwacka M, Olejniczak M.
Show Full Abstract

<h4>ABSTRACT</h4> Expansion of the CAG/CTG repeats in functionally unrelated genes is a causative factor in many inherited neurodegenerative disorders, including Huntington’s disease (HD), spinocerebellar ataxias (SCAs) and myotonic dystrophy type 1 (DM1). Despite many years of research, the mechanism responsible for repeat instability is unknown, and recent findings indicate the key role of DNA repair in this process. The repair of DSBs induced by genome editing tools results in the shortening of long CAG repeats in yeast models. Understanding this mechanism is the first step to developing a therapeutic strategy based on controlled shortening of repeats. The aim of this study was to characterize Cas9-induced DSB repair products in the endogenous HTT locus in human cells and to identify factors affecting the formation of specific types of sequences. The location of the cleavage site and the surrounding sequence influence the outcome of DNA repair. DSBs within CAG repeats result in shortening of the repeats in frame in ∼90% of products. The mechanism of this contraction involves MRE11-CTIP and RAD51 activity and extensive DNA end resection reaching ∼5000 bp. We demonstrated that a DSB located upstream of CAG repeats induces polymerase theta-mediated end joining, resulting in deletion of the entire CAG tract. Furthermore, using unbiased proteomic analysis, we identified novel factors that may be involved in CAG sequence repair. <h4>Graphical abstract</h4> DNA double-strand break repair in the CAG repeat locus engages numerous factors from various repair pathways and depends mainly on DNA end resection, leading to tract shortening.

Also flagged:tumoursNTRK2methylationextraventricular neurocytomasFGFR1MC EVN
Journal Article 2023-11-23 No Snippets Uro-Coste E, Tauziede-Espariat A, Dubucs C, Chiforeanu DC, Siegfried A, Nicaise Y, Bauchet L, Riffaud L, Bielle F, Vasiljevic A, Appay R, Evrard S, Varlet P, Rigau V, Biopathology RENOCLIP‐LOC network.
Show Full Abstract

We report here about two novel tumours classified as extraventricular neurocytomas (EVN) using DNA-methylation profiling, associated with NTRK2 fusions instead of the usual FGFR1 alterations so far attributed to this tumoural entity. We present the second detailed case of an intraventricular presentation in the MC EVN. Our findings broaden the spectrum of MC EVN and have implications in terms of diagnosis, therapy and terminology.

Also flagged:AGTPBP1intracerebral hemorrhageLuciferase
Journal Article 2023-11-23 No Snippets Zhu Z, Mo S, Wang X, Meng M, Qiao L.
Show Full Abstract

White matter injury (WMI) resulting from intracerebral hemorrhage (ICH) is closely associated with adverse prognoses in ICH patients. Although Circ-AGTPBP1 has been reported to exhibit high expression in the serum of premature infants with WMI, its effects and mechanisms in ICH-induced WMI remain unclear. This study aimed to investigate the role of circ-AGTPBP1 in white matter injury after intracerebral hemorrhage. An intracerebral hemorrhage rat model was established by injecting autologous blood into rat left ventricles and circ-AGTPBP1 was knocked down at the ICH site using recombinant adeno-associated virus, AAV2/9. Magnetic resonance imaging (MRI) and gait analysis were conducted to assess long-term neurobehavioral effects. Primary oligodendrocyte progenitor cells (OPCs) were isolated from rats and overexpressed with circ-AGTPBP1. Downstream targets of circ-AGTPBP1 in OPCs were investigated using CircInteractome, qPCR, FISH analysis, and miRDB network. Luciferase gene assay was utilized to explore the relationship between miR-140-3p and Pcdh17 in OPCs and HEK-293T cells. Finally, CCK-8 assay, EdU staining, and flow cytometry were employed to evaluate the effects of mi-RNA-140-3p inhibitor or silencing of sh-pcd17 on the viability, proliferation, and apoptosis of OPCs. Low expression of circ-AGTPBP1 alleviates white matter injury and improves neurological functions in rats after intracerebral hemorrhage. Conversely, overexpression of circ-AGTPBP1 reduces the proliferative and migrative potential of oligodendrocyte progenitor cells and promotes apoptosis. CircInteractome web tool and qPCR confirmed that circ-AGTPBP1 binds with miR-140-3p in OPCs. Additionally, miRDB network predicted Pcdh17 as a downstream target of miR-140-3p. Moreover, pcdh17 expression was increased in the brain tissue of rats with intracerebral-induced white matter injury. Furthermore, inhibiting miR-140-3p suppressed the proliferation and migration of OPCs and facilitated apoptosis through Pcdh17. Circ-AGTPBP1 promotes white matter injury through modulating the miR-140-3p/Pcdh17 axis. The study provides a new direction for developing therapeutic strategies for white matter injury.

Also flagged:antibodiesantibodyamyotrophic lateral sclerosisneurologic diseaseslocalizationAD
Journal Article 2023-11-23 No Snippets Ayoubi R, Ryan J, Biddle MS, Alshafie W, Fotouhi M, Bolivar SG, Ruiz Moleon V, Eckmann P, Worrall D, McDowell I, Southern K, Reintsch W, Durcan TM, Brown C, Bandrowski A, Virk H, Edwards AM, McPherson P, Laflamme C.
Show Full Abstract

Antibodies are critical reagents to detect and characterize proteins. It is commonly understood that many commercial antibodies do not recognize their intended targets, but information on the scope of the problem remains largely anecdotal, and as such, feasibility of the goal of at least one potent and specific antibody targeting each protein in a proteome cannot be assessed. Focusing on antibodies for human proteins, we have scaled a standardized characterization approach using parental and knockout cell lines (Laflamme et al., 2019) to assess the performance of 614 commercial antibodies for 65 neuroscience-related proteins. Side-by-side comparisons of all antibodies against each target, obtained from multiple commercial partners, have demonstrated that: (<i>i</i>) more than 50% of all antibodies failed in one or more applications, (<i>ii</i>) yet, ~50-75% of the protein set was covered by at least one high-performing antibody, depending on application, suggesting that coverage of human proteins by commercial antibodies is significant; and (<i>iii</i>) recombinant antibodies performed better than monoclonal or polyclonal antibodies. The hundreds of underperforming antibodies identified in this study were found to have been used in a large number of published articles, which should raise alarm. Encouragingly, more than half of the underperforming commercial antibodies were reassessed by the manufacturers, and many had alterations to their recommended usage or were removed from the market. This first study helps demonstrate the scale of the antibody specificity problem but also suggests an efficient strategy toward achieving coverage of the human proteome; mine the existing commercial antibody repertoire, and use the data to focus new renewable antibody generation efforts.

Also flagged:cell migrationhydroxyapatitecarbonatedapatitealuminaCAP
Journal Article 2023-11-23 No Snippets Kajander K, Sirkiä SV, Vallittu PK, Heino TJ, Määttä JA.
Show Full Abstract

Different biomaterials have been clinically used as bone filling materials, although the mechanisms behind the biological effects are incompletely understood. To address this, we compared the effects of five different biomaterials: two bioactive glasses (45S5 and S53P4), hydroxyapatite (HAP), carbonated apatite (CAP), and alumina on the in vitro migration and viability of pre-osteoblastic cells. In addition, we studied the effects of biomaterials' calcium release on cell migration, viability and differentiation. We found differences between the materials as the bioactive glasses promoted rapid pre-osteoblastic cell migration. In contrast, CAP decreased cell migration, which was also associated with lower activity of migration related kinases. Bioactive glasses released significant amounts of calcium into the media, while CAP decreased the calcium concentration. The response of cells to calcium was mechanistically studied by blocking calcium sensing receptor (CaSR) and ATP-gated ion channel P2X7, but this had no effect on cell migration. Surprisingly, HAP and CAP initially decreased cell viability. In summary, bioactive glasses 45S5 and S53P4 had significant and long-lasting effects on the pre-osteoblastic cell migration, which could be related to the observed calcium dissolution. Additionally, bioactive glasses had no negative effects on cell viability, which was observed with HAP and CAP.

Also flagged:syncytium formationspike proteinpeptidefurinangiotensin-converting enzyme 2endocytosis
Journal Article 2023-11-23 No Snippets Chan CWF, Wang B, Nan L, Huang X, Mao T, Chu HY, Luo C, Chu H, Choi GCG, Shum HC, Wong ASL.
Show Full Abstract

Mapping mutations and discovering cellular determinants that cause the spike protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to induce infected cells to form syncytia would facilitate the development of strategies for blocking the formation of such cell-cell fusion. Here we describe high-throughput screening methods based on droplet microfluidics and the size-exclusion selection of syncytia, coupled with large-scale mutagenesis and genome-wide knockout screening via clustered regularly interspaced short palindromic repeats (CRISPR), for the large-scale identification of determinants of cell-cell fusion. We used the methods to perform deep mutational scans in spike-presenting cells to pinpoint mutable syncytium-enhancing substitutions in two regions of the spike protein (the fusion peptide proximal region and the furin-cleavage site). We also used a genome-wide CRISPR screen in cells expressing the receptor angiotensin-converting enzyme 2 to identify inhibitors of clathrin-mediated endocytosis that impede syncytium formation, which we validated in hamsters infected with SARS-CoV-2. Finding genetic and cellular determinants of the formation of syncytia may reveal insights into the physiological and pathological consequences of cell-cell fusion.

Also flagged:peroxidasecytochrome cBarth syndromeBTHSgenetic disorderTAFAZZIN
Journal Article 2023-11-23 No Snippets Kagan VE, Tyurina YY, Mikulska-Ruminska K, Damschroder D, Vieira Neto E, Lasorsa A, Kapralov AA, Tyurin VA, Amoscato AA, Samovich SN, Souryavong AB, Dar HH, Ramim A, Liang Z, Lazcano P, Ji J, Schmidtke MW, Kiselyov K, Korkmaz A, Vladimirov GK, Artyukhova MA, Rampratap P, Cole LK, Niyatie A, Baker EK, Peterson J, Hatch GM, Atkinson J, Vockley J, Kühn B, Wessells R, van der Wel PCA, Bahar I, Bayir H, Greenberg ML.
Show Full Abstract

Barth syndrome (BTHS) is a life-threatening genetic disorder with unknown pathogenicity caused by mutations in TAFAZZIN (TAZ) that affect remodeling of mitochondrial cardiolipin (CL). TAZ deficiency leads to accumulation of mono-lyso-CL (MLCL), which forms a peroxidase complex with cytochrome c (cyt c) capable of oxidizing polyunsaturated fatty acid-containing lipids. We hypothesized that accumulation of MLCL facilitates formation of anomalous MLCL-cyt c peroxidase complexes and peroxidation of polyunsaturated fatty acid phospholipids as the primary BTHS pathogenic mechanism. Using genetic, biochemical/biophysical, redox lipidomic and computational approaches, we reveal mechanisms of peroxidase-competent MLCL-cyt c complexation and increased phospholipid peroxidation in different TAZ-deficient cells and animal models and in pre-transplant biopsies from hearts of patients with BTHS. A specific mitochondria-targeted anti-peroxidase agent inhibited MLCL-cyt c peroxidase activity, prevented phospholipid peroxidation, improved mitochondrial respiration of TAZ-deficient C2C12 myoblasts and restored exercise endurance in a BTHS Drosophila model. Targeting MLCL-cyt c peroxidase offers therapeutic approaches to BTHS treatment.

PRDX6
Also flagged:inflammatory arthritisgoutHyperuricemiamonosodiumuratejoint inflammation
Journal Article 2023-11-23 ✓ 1 Snippet Jiang H, Song D, Zhou X, Chen F, Yu Q, Ren L, Dai Q, Zeng M.
In-Text Gene Mentions

…PRDX2, PRDX4 andPRDX6after FAs +…

Show Full Abstract

<h4>Background</h4>Maresin1 (MaR1) is a potent lipid mediator that exhibits significant anti-inflammatory activity in the context of several inflammatory diseases. A previous study reported that MaR1 could suppress MSU crystal-induced peritonitis in mice. To date, the molecular mechanism by which MaR1 inhibits MSU crystal-induced inflammation remains poorly understood.<h4>Methods</h4>Mousebone marrow-derived macrophages (BMDMs) were pretreated with MaR1 and then stimulated with FAs (palmitic, C16:0 and stearic, C18:0) plus MSU crystals (FAs + MSUc). In vivo, the effects of MaR1 treatment or Prdx5 deficiency on MSUc induced peritonitis and arthritis mouse models were evaluated.<h4>Results</h4>The current study indicated that MaR1 effectively suppressed MSUc induced inflammation in vitro and in vivo. MaR1 reversed the decrease in Prdx5 mRNA and protein levels induced by FAs + MSUc. Further assays demonstrated that MaR1 acceleratedPrdx5 expression by regulating the Keap1-Nrf2 signaling axis. Activation of AMPK by Prdx5 improved homeostasis of the TXNIP and TRX proteins and alleviated mitochondrial fragmentation. In addition, Prdx5 overexpression inhibited the expression of CPT1A, a key enzyme for fatty acid oxidation (FAO). Prdx5 protected against defects in FA + MSUc induced FAO and the urea cycle.<h4>Conclusion</h4>MaR1 treatment effectively attenuated MSUc induced inflammation by upregulating Prdx5 expression. Our study provides a new strategy by which Prdx5 may help prevent acute gout attacks.

OLFM4
Also flagged:lumenantimicrobial peptidestissue homeostasisallergiesautoimmune diseasesinflammatory bowel diseases
Journal Article 2023-11-23 ✓ 5 Snippets Carlé C, Boucher D, Morelli L, Larue C, Ovtchinnikova E, Battut L, Boumessid K, Airaud M, Quaranta-Nicaise M, Ravanat JL, Dietrich G, Menard S, Eberl G, Barnich N, Mas E, Carriere M, Al Nabhani Z, Barreau F.
In-Text Gene Mentions

…Mylk ), CD44,Olfactomedin-4( Olfm4 ),…

…CD44, Olfactomedin-4 (Olfm4), Leucine-rich repeat-contain…

…Olfactome-din 4 (Olfm4), SPARC-related modular…

…S4D) but notOlfactomedin-4(Olfm4 ) (Additional…

…but not Olfactomedin-4 (Olfm4) (Additional file…

Show Full Abstract

<h4>Background</h4>Perinatal exposure to titanium dioxide (TiO<sub>2</sub>), as a foodborne particle, may influence the intestinal barrier function and the susceptibility to develop inflammatory bowel disease (IBD) later in life. Here, we investigate the impact of perinatal foodborne TiO<sub>2</sub> exposure on the intestinal mucosal function and the susceptibility to develop IBD-associated colitis. Pregnant and lactating mother mice were exposed to TiO<sub>2</sub> until pups weaning and the gut microbiota and intestinal barrier function of their offspring was assessed at day 30 post-birth (weaning) and at adult age (50 days). Epigenetic marks was studied by DNA methylation profile measuring the level of 5-methyl-2'-deoxycytosine (5-Me-dC) in DNA from colic epithelial cells. The susceptibility to develop IBD has been monitored using dextran-sulfate sodium (DSS)-induced colitis model. Germ-free mice were used to define whether microbial transfer influence the mucosal homeostasis and subsequent exacerbation of DSS-induced colitis.<h4>Results</h4>In pregnant and lactating mice, foodborne TiO<sub>2</sub> was able to translocate across the host barriers including gut, placenta and mammary gland to reach embryos and pups, respectively. This passage modified the chemical element composition of foetus, and spleen and liver of mothers and their offspring. We showed that perinatal exposure to TiO<sub>2</sub> early in life alters the gut microbiota composition, increases the intestinal epithelial permeability and enhances the colonic cytokines and myosin light chain kinase expression. Moreover, perinatal exposure to TiO<sub>2</sub> also modifies the abilities of intestinal stem cells to survive, grow and generate a functional epithelium. Maternal TiO<sub>2</sub> exposure increases the susceptibility of offspring mice to develop severe DSS-induced colitis later in life. Finally, transfer of TiO<sub>2</sub>-induced microbiota dysbiosis to pregnant germ-free mice affects the homeostasis of the intestinal mucosal barrier early in life and confers an increased susceptibility to develop colitis in adult offspring.<h4>Conclusions</h4>Our findings indicate that foodborne TiO<sub>2</sub> consumption during the perinatal period has negative long-lasting consequences on the development of the intestinal mucosal barrier toward higher colitis susceptibility. This demonstrates to which extent environmental factors influence the microbial-host interplay and impact the long-term mucosal homeostasis.

DCC
Also flagged:depressionMajor depressive disorderdeathalcoholinsomniapsychiatric disorders
Journal Article 2023-11-23 ✓ 4 Snippets Ma WR, Zhang LL, Ma JY, Yu F, Hou YQ, Feng XR, Yang L.
In-Text Gene Mentions

…netrin 1 receptor (DCC) gene as a…

…depressive episodes andDCC, and hypothesizes that…

…and hypothesizes thatDCCmay play a…

…the notion thatDCCis a key…

Show Full Abstract

<h4>Background</h4>Major depressive disorder (MDD) poses a significant social and economic burden worldwide. Identifying exposures, risk factors, and biological mechanisms that are causally connected to MDD can help build a scientific basis for disease prevention and development of novel therapeutic approaches.<h4>Methods</h4>In this systematic review, we assessed the evidence for causal relationships between putative causal risk factors and MDD from Mendelian randomization (MR) studies, following PRISMA. We assessed methodological quality based on key elements of the MR design: use of a full instrumental variable analysis and validation of the three key MR assumptions.<h4>Results</h4>We included methodological details and results from 52 articles. A causal link between lifestyle, metabolic, inflammatory biomarkers, particular pathological states and MDD is supported by MR investigations, although results for each category varied substantially.<h4>Conclusions</h4>While this review shows how MR can offer useful information for examining prospective treatment targets and better understanding the pathophysiology of MDD, some methodological flaws in the existing literature limit reliability of results and probably underlie their heterogeneity. We highlight perspectives and recommendations for future works on MR in psychiatry.

Also flagged:tissueperiodontal diseasesdegradationremineralizationmineralizationinfection
Journal Article 2023-11-23 No Snippets Luo X, Niu J, Su G, Zhou L, Zhang X, Liu Y, Wang Q, Sun N.
Show Full Abstract

Biomimetic materials are able to mimic the structure and functional properties of native tissues especially natural oral tissues. They have attracted growing attention for their potential to achieve configurable and functional reconstruction in oral medicine. Though tremendous progress has been made regarding biomimetic materials, significant challenges still remain in terms of controversy on the mechanism of tooth tissue regeneration, lack of options for manufacturing such materials and insufficiency of in vivo experimental tests in related fields. In this review, the biomimetic materials used in oral medicine are summarized systematically, including tooth defect, tooth loss, periodontal diseases and maxillofacial bone defect. Various theoretical foundations of biomimetic materials research are reviewed, introducing the current and pertinent results. The benefits and limitations of these materials are summed up at the same time. Finally, challenges and potential of this field are discussed. This review provides the framework and support for further research in addition to giving a generally novel and fundamental basis for the utilization of biomimetic materials in the future.

HTT
Also flagged:pathogenesisneurodegenerative disordersHDmicrogliaTLR4TLR2
Journal Article 2023-11-23 ✓ 5 Snippets Steinberg N, Galleguillos D, Zaidi A, Horkey M, Sipione S.
In-Text Gene Mentions

They reported that microglia-like cells with a polyQ expansion (81Q) that is usually linked to juvenile HD, expressed higher levels of IL-6 and TNF following LPS stimulation (1 μg/ml) compared to cells bearing HTT with a normal polyQ length (30Q).

HD is a genetic condition caused by a mutation that affects the folding and function of huntingtin (HTT).

In support of a higher inflammogenic potential of necrotic HD cells, N2a cells carrying mutant HTT were previously shown to produce higher levels of inflammatory molecules such as MCP-1 and IL-6 compared to wild-type N2a cells [33].

…codes for huntingtin (HTT) [ 2 –…

HTTis ubiquitously expressed…

Show Full Abstract

Chronic activation and dysfunction of microglia have been implicated in the pathogenesis and progression of many neurodegenerative disorders, including Huntington's disease (HD). HD is a genetic condition caused by a mutation that affects the folding and function of huntingtin (HTT). Signs of microglia activation have been observed in HD patients even before the onset of symptoms. It is unclear, however, whether pro-inflammatory microglia activation in HD results from cell-autonomous expression of mutant HTT, is the response of microglia to a diseased brain environment, or both. In this study, we used primary microglia isolated from HD knock-in (Q140) and wild-type (Q7) mice to investigate their response to inflammatory conditions in vitro in the absence of confounding effects arising from brain pathology. We show that naïve Q140 microglia do not undergo spontaneous pro-inflammatory activation and respond to inflammatory triggers, including stimulation of TLR4 and TLR2 and exposure to necrotic cells, with similar kinetics of pro-inflammatory gene expression as wild-type microglia. Upon termination of the inflammatory insult, the transcription of pro-inflammatory cytokines is tapered off in Q140 and wild-type microglia with similar kinetics. However, the ability of Q140 microglia to develop tolerance in response to repeated inflammatory stimulations is partially impaired in vitro and in vivo, potentially contributing to the establishment of chronic neuroinflammation in HD. We further show that ganglioside GM1, a glycosphingolipid with anti-inflammatory effects on wild-type microglia, not only decreases the production of pro-inflammatory cytokines and nitric oxide in activated Q140 microglia, but also dramatically dampen microglia response to re-stimulation with LPS in an experimental model of tolerance. These effects are independent from the expression of interleukin 1 receptor associated kinase 3 (Irak-3), a strong modulator of LPS signaling involved in the development of innate immune tolerance and previously shown to be upregulated by immune cell treatment with gangliosides. Altogether, our data suggest that external triggers are required for HD microglia activation, but a cell-autonomous dysfunction that affects the ability of HD microglia to acquire tolerance might contribute to the establishment of neuroinflammation in HD. Administration of GM1 might be beneficial to attenuate chronic microglia activation and neuroinflammation.

Also flagged:agingmetabolismgene expressionneurodegenerative diseasesmyelin sheathAlzheimer's disease
Journal Article 2023-11-23 No Snippets Ma YM, Zhao L.
Show Full Abstract

MicroRNAs (miRNAs) are the smallest class of noncoding RNAs, which widely exist in animals and plants. They can inhibit translation or overexpression by combining with mRNA and participate in posttranscriptional regulation of genes, resulting in reduced expression of target proteins, affecting the development, growth, aging, metabolism, and other physiological and pathological processes of animals and plants. It is a powerful negative regulator of gene expression. It mediates the information exchange between different cellular pathways in cellular homeostasis and stress response and regulates the differentiation, plasticity, and neurotransmission of neurons. In neurodegenerative diseases, in addition to the complex interactions between genetic susceptibility and environmental factors, miRNAs can serve as a promising diagnostic tool for diseases. They can also increase or reduce neuronal damage by regulating the body's signaling pathways, immune system, stem cells, gut microbiota, etc. They can not only affect the occurrence of diseases and exacerbate disease progression but also promote neuronal repair and reduce apoptosis, to prevent and slow down the development of diseases. This article reviews the research progress of miRNAs on the mechanism and treatment of neurodegenerative diseases in the nervous system. This trial is registered with NCT01819545, NCT02129452, NCT04120493, NCT04840823, NCT02253732, NCT02045056, NCT03388242, NCT01992029, NCT04961450, NCT03088839, NCT04137926, NCT02283073, NCT04509271, NCT02859428, and NCT05243017.

Also flagged:noradrenalineangiotensin IIacetylcholineserotonin-isoproterenol
Journal Article 2023-11-23 No Snippets Ootawa T, Wu S, Sekio R, Smith H, Islam MZ, Nguyen HTT, Uno Y, Shiraishi M, Miyamoto A.
Show Full Abstract

Vasoreactivity is relatively well documented in terrestrial snakes but has previously been investigated in only one semi-arboreal snake species. Consequently, the extent to which vasoreactivity is common across snake taxa or varies by habitat is unclear. The Tokara habu (<i>Protobothrops tokarensis</i>) is a semi-arboreal snake endemic to only two small adjacent Japanese islands, and hence a useful species for further investigation of vasoreactivity. We evaluated responses to known vasoactive substances in thoracic aortas isolated from Tokara habu. Under resting tension, noradrenaline and angiotensin II induced concentration-dependent contraction, but acetylcholine, serotonin (5-hydroxytriptamine; 5-HT), and isoproterenol induced relaxation followed by contraction. Histamine and rattlesnake bradykinin had no effect. Experiments with receptor-specific antagonists suggest that M<sub>1</sub> and M<sub>3</sub> receptors are involved in the acetylcholine-induced response; 5-HT<sub>1</sub>, 5-HT<sub>2</sub>, and 5-HT<sub>7</sub> receptors in the serotonin-induced response; and β<sub>1</sub> and β<sub>2</sub> adrenoceptors in isoproterenol-induced relaxation. This is the first report on such response patterns in snakes (including serotonin- and isoproterenol-induced relaxation). Nitric oxide may be involved in acetylcholine-induced relaxation but not in the responses to serotonin or isoproterenol. In contrast to the uniform vasoreactivity observed in terrestrial snakes, the vasoreactivity of semi-arboreal snakes may be governed by diverse regulatory mechanisms.

Also flagged:Tumoradaptative immune receptorscancersystemic diseaseshost cellstranscription factor
Journal Article 2023-11-23 No Snippets Otálora-Otálora BA, López-Rivera JJ, Aristizábal-Guzmán C, Isaza-Ruget MA, Álvarez-Moreno CA.
Show Full Abstract

The microbiome has shown a correlation with the diet and lifestyle of each population in health and disease, the ability to communicate at the cellular level with the host through innate and adaptative immune receptors, and therefore an important role in modulating inflammatory process related to the establishment and progression of cancer. The oral cavity is one of the most important interaction windows between the human body and the environment, allowing the entry of an important number of microorganisms and their passage across the gastrointestinal tract and lungs. In this review, the contribution of the microbiome network to the establishment of systemic diseases like cancer is analyzed through their synergistic interactions and bidirectional crosstalk in the oral-gut-lung axis as well as its communication with the host cells. Moreover, the impact of the characteristic microbiota of each population in the formation of the multiomics molecular metafirm of the oral-gut-lung axis is also analyzed through state-of-the-art sequencing techniques, which allow a global study of the molecular processes involved of the flow of the microbiota environmental signals through cancer-related cells and its relationship with the establishment of the transcription factor network responsible for the control of regulatory processes involved with tumorigenesis.

CACNA1E
Also flagged:gene expressioncell proliferationtoresponse to heat stressresponse tolipid
Journal Article 2023-11-23 ✓ 2 Snippets Reed KM, Mendoza KM, Kono T, Powell AA, Strasburg GM, Velleman SG.
In-Text Gene Mentions

…munoglobulin-like receptor 1),CACNA1E(calcium voltage-gated channel…

…C member 2),CACNA1E(calcium voltage-gated channel…

Show Full Abstract

Thermal stress alters the transcriptome and subsequent tissue physiology of poultry; thus, it can negatively impact poultry production through reduced meat quality, egg production, and health and wellbeing. The modulation of gene expression is critical to embryonic development and cell proliferation, and growing evidence suggests the role of non-coding RNAs (RNA:RNA interaction) in response to thermal stress in animals. MicroRNAs (miRNAs) comprise a class of small regulatory RNAs that modulate gene expression through posttranscriptional interactions and regulate mRNAs, potentially altering numerous cellular processes. This study was designed to identify and characterize the differential expression of miRNAs in satellite cells (SCs) from the turkey <i>pectoralis major</i> muscle and predict important miRNA:mRNA interactions in these developing SCs under a thermal challenge. Small RNA sequencing was performed on RNA libraries prepared from SCs cultured from 1-week-old male Nicholas commercial turkeys (NCTs) and non-selected Randombred Control Line 2 turkeys during proliferation and differentiation at the control temperature (38°C) or under a thermal challenge (33°C or 43°C). A total of 353 miRNAs (161 known and 192 novel) were detected across the sequenced libraries. Expression analysis found fewer differentially expressed miRNAs in the SCs of NCT birds, suggesting that the miRNA response to heat stress has been altered in birds selected for their modern commercial growth traits. Differentially expressed miRNAs, including those with described roles in muscle development, were detected both among temperature treatments and between genetic lines. A prominent differential expression of miR-206 was found in proliferating turkey SCs with a significant response to thermal challenges in both lines. In differentiating SCs, isoforms of miR-1 had significant differential responses, with the expression of miR-206 being mainly affected only by cold treatment. Target gene predictions and Gene Ontology analysis suggest that the differential expression of miRNAs during thermal stress could significantly affect cellular proliferation and differentiation.

DCC
Also flagged:exopolysaccharidebreast cancercancerinflammatory diseasescell migrationtumor
Journal Article 2023-11-23 ✓ 3 Snippets Nguyen MR, Ma E, Wyatt D, Knight KL, Osipo C.
In-Text Gene Mentions

On the contrary, B. subtilis is the primary producer of the serine protease subtilisin, which depletes tumor suppressor proteins Deleted in Colorectal Cancer (DCC) and Neogenin in breast cancer cells, leading to enhanced migration and cancer development (35, 36).

…in Colorectal Cancer (DCC) and Neogenin in…

…On the contrary, B. subtilis is the primary producer of the serine protease subtilisin, which depletes tumor suppressor proteins Deletedin Colorectal Cancer (DCC)and Neogenin in breast cancer cells, leading to enhanced migration and cancer development ( 35 , 36 ).…

Show Full Abstract

<h4>Introduction</h4>Many well-known risk factors for breast cancer are associated with dysbiosis (an aberrant microbiome). However, how bacterial products modulate cancer are poorly understood. In this study, we investigated the effect of an exopolysaccharide (EPS) produced by the commensal bacterium <i>Bacillus subtilis</i> on breast cancer phenotypes. Although <i>B. subtilis</i> is commonly included in probiotic preparations and its EPS protects against inflammatory diseases, it was virtually unknown whether <i>B. subtilis</i>-derived EPS affects cancer.<h4>Methods</h4>This work investigated effects of EPS on phenotypes of breast cancer cells as a cancer model. The phenotypes included proliferation, mammosphere formation, cell migration, and tumor growth in two immune compromised mouse models. RNA sequencing was performed on RNA from four breast cancer cells treated with PBS or EPS. IKKβ or STAT1 signaling was assessed using pharmacologic or RNAi-mediated knock down approaches.<h4>Results</h4>Short-term treatment with EPS inhibited proliferation of certain breast cancer cells (T47D, MDA-MB-468, HCC1428, MDA-MB-453) while having little effect on others (MCF-7, MDA-MB-231, BT549, ZR-75-30). EPS induced G1/G0 cell cycle arrest of T47D cells while increasing apoptosis of MDA-MB-468 cells. EPS also enhanced aggressive phenotypes in T47D cells including cell migration and cancer stem cell survival. Long-term treatment with EPS (months) led to resistance <i>in vitro</i> and promoted tumor growth in immunocompromised mice. RNA-sequence analysis showed that EPS increased expression of pro-inflammatory pathways including STAT1 and NF-κB. IKKβ and/or STAT1 signaling was necessary for EPS to modulate phenotypes of EPS sensitive breast cancer cells.<h4>Discussion</h4>These results demonstrate a multifaceted role for an EPS molecule secreted by the probiotic bacterium <i>B. subtilis</i> on breast cancer cell phenotypes. These results warrant future studies in immune competent mice and different cancer models to fully understand potential benefits and/or side effects of long-term use of probiotics.

Also flagged:tumorextracellularmembranecancercollagen Ibreast cancer
Journal Article 2023-11-23 No Snippets Jouybar M, Sleeboom JJF, Vaezzadeh E, Sahlgren CM, den Toonder JMJ.
Show Full Abstract

Metastasis is a multi-step process that is critically affected by cues from the tumor micro-environment (TME), such as from the extracellular matrix (ECM). The role of the ECM in the onset of metastasis, invasion, is not yet fully understood. A further complicating factor is that the ECM in the TME is mostly heterogeneous, in particular presenting a basement membrane (BM) directly enveloping the tumor, which acts as a barrier to invasion into the surrounding stromal ECM. To systematically investigate the role of ECM in invasion, appropriate <i>in vitro</i> models with control over such ECM heterogeneity are essential. We present a novel high-throughput microfluidic approach to build such a model, which enables to capture the invasion of cancer cells from the tumor, through the BM and into the stromal tissue. We used a droplet-maker device to encapsulate cells in beads of a primary hydrogel mimicking BM, Matrigel, which were then embedded in a secondary hydrogel mimicking stromal ECM, collagen I. Our technology ultimately provides control over parameters such as tissue size, cell count and type, and ECM composition and stiffness. As a proof-of-principle, we carried out a comparative study with two breast cancer cell types, and we observed typical behavior consistent with previous studies. Highly invasive MDA-MB-231 cells showed single cell invasion behavior, whereas poorly invasive MCF-7 cells physically penetrated the surrounding matrix collectively. A comparative analysis conducted between our heterogeneous model and previous models employing a single type of hydrogel, either collagen I or Matrigel, has unveiled a substantial difference in terms of cancer cell invasion distance. Our <i>in vitro</i> model resembles an <i>in vivo</i> heterogeneous cancer microenvironment and can potentially be used for high throughput studies of cancer invasion.

Also flagged:neurodegenerative disordertauADinflammatory responseimmune responsenuclear factor of activated T-cells
Journal Article 2023-11-23 No Snippets Mackiewicz J, Lisek M, Boczek T.
Show Full Abstract

Alzheimer's disease (AD) is a neurodegenerative disorder characterized by a progressive loss of cognitive functions. While the exact causes of this debilitating disorder remain elusive, numerous investigations have characterized its two core pathologies: the presence of β-amyloid plaques and tau tangles. Additionally, multiple studies of postmortem brain tissue, as well as results from AD preclinical models, have consistently demonstrated the presence of a sustained inflammatory response. As the persistent immune response is associated with neurodegeneration, it became clear that it may also exacerbate other AD pathologies, providing a link between the initial deposition of β-amyloid plaques and the later development of neurofibrillary tangles. Initially discovered in T cells, the nuclear factor of activated T-cells (NFAT) is one of the main transcription factors driving the expression of inflammatory genes and thus regulating immune responses. NFAT-dependent production of inflammatory mediators is controlled by Ca<sup>2+</sup>-dependent protein phosphatase calcineurin (CaN), which dephosphorylates NFAT and promotes its transcriptional activity. A substantial body of evidence has demonstrated that aberrant CaN/NFAT signaling is linked to several pathologies observed in AD, including neuronal apoptosis, synaptic deficits, and glia activation. In view of this, the role of NFAT isoforms in AD has been linked to disease progression at different stages, some of which are paralleled to diminished cognitive status. The use of classical inhibitors of CaN/NFAT signaling, such as tacrolimus or cyclosporine, or adeno-associated viruses to specifically inhibit astrocytic NFAT activation, has alleviated some symptoms of AD by diminishing β-amyloid neurotoxicity and neuroinflammation. In this article, we discuss the recent findings related to the contribution of CaN/NFAT signaling to the progression of AD and highlight the possible benefits of targeting this pathway in AD treatment.

BTN2A1
Also flagged:PD1pyroptosistumormesotheliomaPD-1antibody
Journal Article 2023-11-23 ✓ 5 Snippets Lui KS, Ye Z, Chan HC, Tanaka Y, Cheung AKL.
In-Text Gene Mentions

Therefore, our analysis reveals that the expression of BTN2A1/BTN3A1 is low on the tumor cells in mesothelioma, where a high percentage of cells express PD-L1/PD-L2, which could hinder the effectiveness of Vδ2 T cells for immunotherapy.

To further illustrate the characteristics of the tumor cells in the microenvironment, we quantified the cells expressing combinations of BTN2A1, PD-L1, and/or PD-L2 in the tile scan of the tumor section from the two-dose treatment (Supplementary 5B).

Flow cytometry was used to examine expression of BTN2A1, BTN3A1, PD-L1, PD-L2 on mesothelioma cell lines.

As the results suggest that Vδ2 T cells have certain effectiveness against mesothelioma, we next examined the expression of BTN2A1, BTN3A1, and PD-L1 in mesothelioma tumor tissue sections obtained from the mice experiments described earlier, at the time of death between 17-21 days.

Moreover, Vδ2-TCR+ cells seemed to be located in regions where tumor cells expressed BTN2A1 (Figure 3A) and were found to coincide with cells that co-expressed PD-L1 (Supplementary Figure 5A).

Show Full Abstract

<h4>Introduction</h4>Mesothelioma is an aggressive tumor in the pleural cavity that is difficult to treat. Diagnosis is usually late with minimal treatment options available for the patients and with unfavorable outcomes. However, recent advances in immunotherapy using γδ T cells may have potential against mesothelioma, given its ample tumoricidal and tumor-migratory properties could allow its infiltration to the widespread tumor mass. Thus, we hypothesize that Vδ2 T cells can perform cytotoxic activities against mesothelioma especially when combined with immune checkpoint blocker against PD-1.<h4>Methods</h4>Human Vδ2 T cells were expanded from peripheral blood mononuclear cells using Tetrakis-pivaloyloxymethyl 2-(thiazole-2-ylamino) ethylidene-1,1-bisphosphonate (PTA) plus IL-2 for 13 days, before used to test for cytotoxicity against mesothelioma cell lines. Mesothelioma-bearing mice was established by Intrapleural administration of mesothelioma cell lines to test for the efficacy of Vδ2 T cells plus anti-PD-1 antibody combination treatment. Pyroptosis was evaluated by cell morphology, western blot analysis, and ELISA experiments. Flow cytometry was used to examine expression of BTN2A1, BTN3A1, PD-L1, PD-L2 on mesothelioma cell lines. Immunofluorescence staining was performed to detect Vδ2 T cells post adoptive transfer and characteristics of pyroptosis in <i>ex vivo</i> mesothelioma tissue sections.<h4>Results</h4>Indeed, our data demonstrated that Vδ2 T cells killing mesothelioma can be enhanced by anti-PD-1 antibody <i>in vitro</i>, especially for high PD-1 expressing cells, and in vivo in the intrapleural mesothelioma mice model established by us. Adoptive transfer of Vδ2 T cells into these mice leads to tumor regression by 30-40% compared to control. Immunofluorescence of the tumor section confirmed infiltration of Vδ2 T cells into the tumor, especially to cells with BTN2A1 expression (a Vδ2 T cell activating molecule) despite PD-L1 co-localization. Interestingly, these cells co-expressed cleaved gasdermin D, suggesting that pyroptosis was induced by Vδ2 T cells. This was verified by Vδ2 T/mesothelioma co-culture experiments demonstrating membrane ballooning morphology, increased cleaved caspase-3 and gasdermin E, and upregulated IL-1β and IL-18.<h4>Discussion</h4>Vδ2 T cells plus anti-PD1 exhibited cytotoxicity against mesothelioma in vivo. However, we found no advantage for anti-PD-1 against PD-1 high expressing Vδ2 T cells in promoting pyroptosis. Taken together, our work demonstrated that Vδ2 T cells combined with anti-PD-1 antibody can be developed as a potential combination immunotherapy for mesothelioma.

OLFM4
Also flagged:HDACobesityshort-chain fatty acidsNotchHES1mucus
Journal Article 2023-11-23 ✓ 2 Snippets Farhadipour M, Arnauts K, Clarysse M, Thijs T, Liszt K, Van der Schueren B, Ceulemans LJ, Deleus E, Lannoo M, Ferrante M, Depoortere I.
In-Text Gene Mentions

No effect of obesity was found on the mRNA expression of OLFM4 and SOX9 positive crypt-based cells (Figure S3).

…mRNA expression ofOLFM4and SOX9 positive…

Show Full Abstract

Stem cells are a keystone of intestinal homeostasis, but their function could be shifted during energy imbalance or by crosstalk with microbial metabolites in the stem cell niche. This study reports the effect of obesity and microbiota-derived short-chain fatty acids (SCFAs) on intestinal stem cell (ISC) fate in human crypt-derived intestinal organoids (enteroids). ISC fate decision was impaired in obesity, resulting in smaller enteroids with less outward protruding crypts. Our key finding is that SCFAs switch ISC commitment to the absorptive enterocytes, resulting in reduced intestinal permeability in obese enteroids. Mechanistically, SCFAs act as HDAC inhibitors in stem cells to enhance Notch signaling, resulting in transcriptional activation of the Notch target gene HES1 to promote enterocyte differentiation. In summary, targeted reprogramming of ISC fate, using HDAC inhibitors, may represent a potential, robust therapeutic strategy to improve gut integrity in obesity.

Also flagged:Rheumatoid arthritisRAchronic autoimmune disorderautoantibodypathogenesishuman leukocyte antigen
Journal Article 2023-11-23 No Snippets Rajan JR, McDonald S, Bjourson AJ, Zhang SD, Gibson DS.
Show Full Abstract

Rheumatoid arthritis (RA) is a chronic autoimmune disorder that has a significant impact on quality of life and work capacity. Treatment of RA aims to control inflammation and alleviate pain; however, achieving remission with minimal toxicity is frequently not possible with the current suite of drugs. This review aims to summarise current treatment practices and highlight the urgent need for alternative pharmacogenomic approaches for novel drug discovery. These approaches can elucidate new relationships between drugs, genes, and diseases to identify additional effective and safe therapeutic options. This review discusses how computational approaches such as connectivity mapping offer the ability to repurpose FDA-approved drugs beyond their original treatment indication. This review also explores the concept of drug sensitisation to predict co-prescribed drugs with synergistic effects that produce enhanced anti-disease efficacy by involving multiple disease pathways. Challenges of this computational approach are discussed, including the availability of suitable high-quality datasets for comprehensive analysis and other data curation issues. The potential benefits include accelerated identification of novel drug combinations and the ability to trial and implement established treatments in a new index disease. This review underlines the huge opportunity to incorporate disease-related data and drug-related data to develop methods and algorithms that have strong potential to determine novel and effective treatment regimens.

HFE
Also flagged:Liver FibrosisDiabetesNoncommunicable Diseasesnonalcoholic fatty liver diseaseNAFLDCancer
Journal Article 2023-11-23 ✓ 1 Snippet Mondal A, Debnath A, Dhandapani G, Sharma A, Lukhmana S, Yadav G.
In-Text Gene Mentions

…patitis, autoimmune hepatitis,hemochromatosis, primary biliary cholangitis,…

Show Full Abstract

Background Diabetes is a known entity that contributes to increased incidence and progress of liver fibrosis. Despite the integration of nonalcoholic fatty liver disease (NAFLD) into the NP-NCD program (National Programme for Prevention and Control of Cancer, Diabetes, Cardiovascular Diseases, and Stroke [NPCDCS]), screening individuals in primary healthcare settings for liver fibrosis remains uncommon. The objective of this study was to determine the prevalence of the risk of liver fibrosis in individuals with diabetes. Methodology The secondary data analysis was conducted among patients with diabetes attending the noncommunicable diseases (NCD) clinic at the Primary Health Center (PHC) Najafgarh, Delhi, from January 2023 to June 2023. We used the Fibrosis-4 (FIB-4) score to assess the risk of liver fibrosis. The data analysis was carried out using Stata 17.0 software (StataCorp, College Station, TX). Results Out of 394 individuals screened, 158 (39.5%) were male and 236 (60.5%) were female. Among the study participants, 64.9% (95% confidence interval [CI] 60.0%-69.7%) were of low risk, 30.5% (95% CI 25.9%-35.3%) were of intermediate risk, and 4.6% (95% CI 2.7%-7.1%) were of high risk of developing liver fibrosis based on FIB-4 scoring. The increased risk was associated with increased age, duration of diabetes, and dyslipidemia. Conclusions The prevalence of high risk of liver fibrosis among patients with diabetes was 4.6% (95% CI 2.7%-7.1%), whereas an intermediate risk of developing liver fibrosis was observed in 30.5%. The study advocates integrating these screening tools into primary healthcare settings, alleviating the strain on larger healthcare facilities. It also underscores the importance of early detection and management of liver fibrosis in patients with diabetes.

bioRxiv 2023-11-23 Preprint (No Snippets API) Hernandez-Armendariz A, Sorichetti V, Hayashi Y, Brunner A, Ellenberg J, Šarić A, Cuylen-Haering S.
Show Full Abstract

<h4> <h4>Summary: </h4> </h4> The individualization of chromosomes during early mitosis and their clustering upon exit from cell division are two key transitions that ensure efficient segregation of eukaryotic chromosomes. Both processes are regulated by the surfactant-like protein Ki-67, but how Ki-67 achieves these diametric functions has remained unknown. Here, we report that Ki-67 radically switches from a chromosome repellent to a chromosome attractant during anaphase. We show that Ki-67 dephosphorylation during mitotic exit and the simultaneous exposure of a conserved basic patch induce the RNA-dependent formation of a liquid-like condensed phase on the chromosome surface. Experiments and coarse-grained simulations support a model in which the coalescence of chromosome surfaces driven by phase separation promote clustering of chromosomes. Our study reveals how the switch of Ki-67 from a surfactant to a liquid-like condensed phase can generate the mechanical forces during genome segregation that are required for re-establishing nuclear-cytoplasmic compartmentalization after mitosis.

DCC
Also flagged:Stromal netrin 1arteriogenesisnetrin 1Ntn1Klf4cell differentiation
Journal Article 2023-11-22 ✓ 1 Snippet Luo PM, Gu X, Chaney C, Carroll T, Cleaver O.
In-Text Gene Mentions

…family, Neo1 andDCC( Freitas et…

Show Full Abstract

The kidney vasculature has a complex architecture that is essential for renal function. The molecular mechanisms that direct development of kidney blood vessels are poorly characterized. We identified a regionally restricted, stroma-derived signaling molecule, netrin 1 (Ntn1), as a regulator of renal vascular patterning in mice. Stromal progenitor (SP)-specific ablation of Ntn1 (Ntn1SPKO) resulted in smaller kidneys with fewer glomeruli, as well as profound defects of the renal artery and transient blood flow disruption. Notably, Ntn1 ablation resulted in loss of arterial vascular smooth muscle cell (vSMC) coverage and in ectopic SMC deposition at the kidney surface. This was accompanied by dramatic reduction of arterial tree branching that perdured postnatally. Transcriptomic analysis of Ntn1SPKO kidneys revealed dysregulation of vSMC differentiation, including downregulation of Klf4, which we find expressed in a subset of SPs. Stromal Klf4 deletion similarly resulted in decreased smooth muscle coverage and arterial branching without, however, the disruption of renal artery patterning and perfusion seen in Ntn1SPKO. These data suggest a stromal Ntn1-Klf4 axis that regulates stromal differentiation and reinforces stromal-derived smooth muscle as a key regulator of renal blood vessel formation.

BTN2A1
Also flagged:solid tumorstuberculosisT cell receptortumorcytokineinfectious diseases
Journal Article 2023-11-22 ✓ 1 Snippet Hu Y, Hu Q, Li Y, Lu L, Xiang Z, Yin Z, Kabelitz D, Wu Y.
In-Text Gene Mentions

The ligand recognition by Vγ9Vδ2 T cells mainly falls into two groups, namely γδ TCR-mediated and NKR-mediated ones.8 Although γδ T cells were discovered almost four decades ago, knowledge of the exact molecular mechanism of antigen recognition by γδTCR is still rather limited, partly due to the low binding affinity to its ligands, which makes ligand identification difficult.271 Different from other γδ T subsets, Vδ2+ TCRs recognize phosphoantigens that accumulated in tumor cells due to their dysregulated mevalonate pathway.272–275 Notably, phosphoantigens do not directly bind to γδTCR, instead, they bind to the intracellular B30.2 domain of the butyrophilin family protein, BTN3A1.82,276 This binding then triggers a conformational change of BTN3A1, allowing its collaborator BTN2A1 to hinge onto the Vγ9 chain of the γδTCR, which then activates Vδ2 T cells.277–280 However, whether the Vδ2 chain of the Vγ9Vδ2 TCR is involved in the antigen recognition process is still elusive.

Show Full Abstract

The intricacy of diseases, shaped by intrinsic processes like immune system exhaustion and hyperactivation, highlights the potential of immune renormalization as a promising strategy in disease treatment. In recent years, our primary focus has centered on γδ T cell-based immunotherapy, particularly pioneering the use of allogeneic Vδ2<sup>+</sup> γδ T cells for treating late-stage solid tumors and tuberculosis patients. However, we recognize untapped potential and optimization opportunities to fully harness γδ T cell effector functions in immunotherapy. This review aims to thoroughly examine γδ T cell immunology and its role in diseases. Initially, we elucidate functional differences between γδ T cells and their αβ T cell counterparts. We also provide an overview of major milestones in γδ T cell research since their discovery in 1984. Furthermore, we delve into the intricate biological processes governing their origin, development, fate decisions, and T cell receptor (TCR) rearrangement within the thymus. By examining the mechanisms underlying the anti-tumor functions of distinct γδ T cell subtypes based on γδTCR structure or cytokine release, we emphasize the importance of accurate subtyping in understanding γδ T cell function. We also explore the microenvironment-dependent functions of γδ T cell subsets, particularly in infectious diseases, autoimmune conditions, hematological malignancies, and solid tumors. Finally, we propose future strategies for utilizing allogeneic γδ T cells in tumor immunotherapy. Through this comprehensive review, we aim to provide readers with a holistic understanding of the molecular fundamentals and translational research frontiers of γδ T cells, ultimately contributing to further advancements in harnessing the therapeutic potential of γδ T cells.

CA10
Also flagged:tumorCD25FOXP3tissue homeostasisallergiesmetabolic syndrome
Journal Article 2023-11-22 ✓ 5 Snippets Martín-Cruz L, Viñuela M, Kalograiaki I, Angelina A, Oquist-Phillips P, Real-Arévalo I, Cañada FJ, Tudela JI, Moltó L, Moreno-Sierra J, Subiza JL, Palomares O.
In-Text Gene Mentions

The inhibition of the mTOR pathway with rapamycin and glycolysis with 2-deoxyglucose (2-DG) in Ca10-activated DCs significantly suppressed the production of the proinflammatory cytokines TNF-α, IL-6 and IL-1β as well as IL-10, whereas a significant increase in the production of TNF-α was observed in the presence of 2-DG (Fig. 3G).

Ca10/hmoDCs also induce a higher proportion of Tregs and lower proportion of IFN-γ-producing T cells than conventional DCs, which might well represent a mechanism of tumor escape that also contributes to tumor progression [1, 4].

Ca10 did not directly affect the migration or proliferation capacity of other adherent tumor cells (Supplementary Fig. 5a–c).

To determine the potential molecular mechanisms by which Ca10 could promote Treg generation, we first studied the capacity of this tumor-associated carbohydrate to immunomodulate the phenotypic and functional features of human DCs.

Serum levels of Ca10 positively correlate with tumor size and splenic Treg numbers in ET-bearing mice

Show Full Abstract

Functional Tregs play a key role in tumor development and progression, representing a major barrier to anticancer immunity. The mechanisms by which Tregs are generated in cancer and the influence of the tumor microenvironment on these processes remain incompletely understood. Herein, by using NMR, chemoenzymatic structural assays and a plethora of in vitro and in vivo functional analyses, we demonstrate that the tumoral carbohydrate A10 (Ca10), a cell-surface carbohydrate derived from Ehrlich's tumor (ET) cells, is a heparan sulfate-related proteoglycan that enhances glycolysis and promotes the development of tolerogenic features in human DCs. Ca10-stimulated human DCs generate highly suppressive Tregs by mechanisms partially dependent on metabolic reprogramming, PD-L1, IL-10, and IDO. Ca10 also reprograms the differentiation of human monocytes into DCs with tolerogenic features. In solid ET-bearing mice, we found positive correlations between Ca10 serum levels, tumor size and splenic Treg numbers. Administration of isolated Ca10 also increases the proportion of splenic Tregs in tumor-free mice. Remarkably, we provide evidence supporting the presence of a circulating human Ca10 counterpart (Ca10H) and show, for the first time, that serum levels of Ca10H are increased in patients suffering from different cancer types compared to healthy individuals. Of note, these levels are higher in prostate cancer patients with bone metastases than in prostate cancer patients without metastases. Collectively, we reveal novel molecular mechanisms by which heparan sulfate-related structures associated with tumor cells promote the generation of functional Tregs in cancer. The discovery of this novel structural-functional relationship may open new avenues of research with important clinical implications in cancer treatment.

Also flagged:mineralbone formationdegradationhydroxyapatitephosphate transport-related proteinstype I collagen
Journal Article 2023-11-22 No Snippets Blair HC, Larrouture QC, Tourkova IL, Nelson DJ, Dobrowolski SF, Schlesinger PH.
Show Full Abstract

We review unique properties of bone formation including current understanding of mechanisms of bone mineral transport. We focus on formation only; mechanism of bone degradation is a separate topic not considered. Bone matrix is compared to other connective tissues composed mainly of the same proteins, but without the specialized mechanism for continuous transport and deposition of mineral. Indeed other connective tissues add mechanisms to prevent mineral formation. We start with the epithelial-like surfaces that mediate transport of phosphate to be incorporated into hydroxyapatite in bone, or in its ancestral tissue, the tooth. These include several phosphate producing or phosphate transport-related proteins with special expression in large quantities in bone, particularly in the bone-surface osteoblasts. In all connective tissues including bone, the proteins that constitute the protein matrix are mainly type I collagen and γ-carboxylate-containing small proteins in similar molar quantities to collagen. Specialized proteins that regulate connective tissue structure and formation are surprisingly similar in mineralized and non-mineralized tissues. While serum calcium and phosphate are adequate to precipitate mineral, specialized mechanisms normally prevent mineral formation except in bone, where continuous transport and deposition of mineral occurs.

Also flagged:autismchromatinKDM5Aautism spectrum disordernucleus-
Journal Article 2023-11-22 No Snippets El Hayek L, DeVries D, Gogate A, Aiken A, Kaur K, Chahrour MH.
Show Full Abstract

Chromatin regulation plays a pivotal role in establishing and maintaining cellular identity and is one of the top pathways disrupted in autism spectrum disorder (ASD). The hippocampus, composed of distinct cell types, is often affected in patients with ASD. However, the specific hippocampal cell types and their transcriptional programs that are dysregulated in ASD are unknown. Using single-nucleus RNA sequencing, we show that the ASD gene, lysine demethylase 5A (<i>KDM5A</i>), regulates the development of specific subtypes of excitatory and inhibitory neurons. We found that KDM5A is essential for establishing hippocampal cell identity by controlling a differentiation switch early in development. Our findings define a role for the chromatin regulator KDM5A in establishing hippocampal cell identity and contribute to the emerging convergent mechanisms across ASD.

BTN3A3BTN2A1
Also flagged:T cell receptortumorsbindingBTN3A1extracellularBTN3A2
Journal Article 2023-11-22 ✓ 5 Snippets Karunakaran MM, Subramanian H, Jin Y, Mohammed F, Kimmel B, Juraske C, Starick L, Nöhren A, Länder N, Willcox CR, Singh R, Schamel WW, Nikolaev VO, Kunzmann V, Wiemer AJ, Willcox BE, Herrmann T.
In-Text Gene Mentions

Relative to BTN3A1, BTN3A2 lacks the entire B30.2 domain and parts of the JM region, while BTN3A3 bears an H381R substitution which abrogates PAg binding to the pocket (numbering of amino acids as in Supplementary Fig. 1a)18.

Butyrophilin (BTN)–3A and BTN2A1 molecules control the activation of human Vγ9Vδ2 T cells during T cell receptor (TCR)-mediated sensing of phosphoantigens (PAg) derived from microbes and tumors.

Interestingly, BTN3A1-induced immunosuppression was reported for BTN3A1 overexpressing tumor cells, and it is abolished by BTN3A1-V domain-specific mAbs and by Zoledronate53 It will be interesting to learn whether V-domain interactions between constitutively expressed BTN2A1 and BTN3A13,57 or newly formed PAg-induced BTN3A-BTN2A1 complexes13,20,35,59 might affect such suppression.

…racellular V-domain of BTN3A2/BTN3A3.…

…interaction with theBTN2A1-B30.2 domain, is essential…

Show Full Abstract

Butyrophilin (BTN)-3A and BTN2A1 molecules control the activation of human Vγ9Vδ2 T cells during T cell receptor (TCR)-mediated sensing of phosphoantigens (PAg) derived from microbes and tumors. However, the molecular rules governing PAg sensing remain largely unknown. Here, we establish three mechanistic principles of PAg-mediated γδ T cell activation. First, in humans, following PAg binding to the intracellular BTN3A1-B30.2 domain, Vγ9Vδ2 TCR triggering involves the extracellular V-domain of BTN3A2/BTN3A3. Moreover, the localization of both protein domains on different chains of the BTN3A homo-or heteromers is essential for efficient PAg-mediated activation. Second, the formation of BTN3A homo-or heteromers, which differ in intracellular trafficking and conformation, is controlled by molecular interactions between the juxtamembrane regions of the BTN3A chains. Finally, the ability of PAg not simply to bind BTN3A-B30.2, but to promote its subsequent interaction with the BTN2A1-B30.2 domain, is essential for T-cell activation. Defining these determinants of cooperation and the division of labor in BTN proteins improves our understanding of PAg sensing and elucidates a mode of action that may apply to other BTN family members.

HTT
Also flagged:neurodegenerative disorderHDpro-inflammatory cytokinephagocytosisendocytosismicroglia
Journal Article 2023-11-22 ✓ 5 Snippets Stöberl N, Donaldson J, Binda CS, McAllister B, Hall-Roberts H, Jones L, Massey TH, Allen ND.
In-Text Gene Mentions

Huntington’s disease (HD) is a neurodegenerative disorder caused by a dominantly inherited CAG repeat expansion in the huntingtin gene (HTT).

Huntington’s disease (HD) is a severe neurodegenerative disorder caused by a dominantly inherited CAG trinucleotide repeat expansion in the huntingtin gene (HTT) on chromosome 4, resulting in progressive motor, psychiatric and cognitive problems that culminate in dementia and death1.

…huntingtin gene (HTT).…

…huntingtin gene (HTT) on chromosome…

…that interact withHTTare implicated in…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a dominantly inherited CAG repeat expansion in the huntingtin gene (HTT). Neuroinflammation and microglia have been implicated in HD pathology, however it has been unclear if mutant HTT (mHTT) expression has an adverse cell-autonomous effect on microglial function, or if they are only activated in response to the neurodegenerative brain environment in HD. To establish a human cell model of HD microglia function, we generated isogenic controls for HD patient-derived induced pluripotent stem cells (iPSC) with 109 CAG repeats (Q109). Q109 and isogenic Q22 iPSC, as well as non-isogenic Q60 and Q33 iPSC lines, were differentiated to iPSC-microglia. Our study supports a model of basal microglia dysfunction in HD leading to elevated pro-inflammatory cytokine production together with impaired phagocytosis and endocytosis capacity, in the absence of immune stimulation. These findings are consistent with early microglia activation observed in pre-manifest patients and indicate that mHTT gene expression affects microglia function in a cell-autonomous way.

MLLT10
Also flagged:germinal vesiclemetaphasetranscription factorlipidcholesterolmetabolism
Journal Article 2023-11-22 ✓ 1 Snippet Hu Y, Zhang R, Zhang S, Ji Y, Zhou Q, Leng L, Meng F, Gong F, Lu G, Lin G, Hu L.
In-Text Gene Mentions

…, TMF1 ,MLLT10, SSRP1 ,…

Show Full Abstract

<h4>Background</h4>The oocyte and its surrounding cumulus cells (CCs) exist as an inseparable entity. The maturation of the oocyte relies on communication between the oocyte and the surrounding CCs. However, oocyte evaluation is primarily based on morphological parameters currently, which offer limited insight into the quality and competence of the oocyte. Here, we conducted transcriptomic profiling of oocytes and their CCs from 47 patients undergoing preimplantation genetic testing for aneuploidy (PGT-A). We aimed to investigate the molecular events occurring between oocytes and CCs at different stages of oocyte maturation (germinal vesicle [GV], metaphase I [MI], and metaphase II [MII]). Our goal is to provide new insights into in vitro oocyte maturation (IVM).<h4>Results</h4>Our findings indicate that oocyte maturation is a complex and dynamic process and that MI oocytes can be further classified into two distinct subtypes: GV-like-MI oocytes and MII-like-MI oocytes. Human oocytes and cumulus cells at three different stages of maturation were analyzed using RNA-seq, which revealed unique transcriptional machinery, stage-specific genes and pathways, and transcription factor networks that displayed developmental stage-specific expression patterns. We have also identified that both lipid and cholesterol metabolism in cumulus cells is active during the late stage of oocyte maturation. Lipids may serve as a more efficient energy source for oocytes and even embryogenesis.<h4>Conclusions</h4>Overall, our study provides a relatively comprehensive overview of the transcriptional characteristics and potential interactions between human oocytes and cumulus cells at various stages of maturation before ovulation. This study may offer novel perspectives on IVM and provide a reliable reference data set for understanding the transcriptional regulation of follicular maturation.

PRDX6
Also flagged:hepatocellular carcinomatumorPrimaryliver cancerhepatitis virus infectionaflatoxin B1
Journal Article 2023-11-22 ✓ 5 Snippets Mu Y, Zheng D, Peng Q, Wang X, Zhang Y, Yin Y, Wang E, Ye F, Wang J.
In-Text Gene Mentions

Interestingly, we found that S100A9, CFH, PPP1R16A, POP4, PRDX6, UGT2B15, LDHA, TMEM106C, ALAS1, RTN3, and DNAJB4 were significantly upregulated in HCC tumor tissues compared to normal tissues (Figure 13).

S100A9, CFH, PPP1R16A, POP4, PRDX6, UGT2B15, LDHA, TMEM106C, ALAS1, RTN3, and DNAJB4 were significantly upregulated in HCC tumor tissues compared to normal tissues.

The phospholipase A2 activity of PRDX6 promotes tumor necrosis factor alpha‐induced cancer cell death in HCC.40

…CFH, PPP1R16A, POP4,PRDX6, UGT2B15, LDHA, TMEM106C,…

…TRGs (S100A9, PPP1R16A,PRDX6, GAGE2A, LDHA, TMEM106C,…

Show Full Abstract

<h4>Background</h4>The highly heterogeneous nature of hepatocellular carcinoma (HCC) results in different responses and prognoses to the same treatment in patients with similar clinical stages.<h4>Aims</h4>Thus, it is imperative to investigate the association between HCC tumor heterogeneity and treatment response and prognosis.<h4>Methods and results</h4>At first, we downloaded scRNA-seq, bulk RNA-seq, and clinical data from TCGA and GEO databases. We conducted quality control, normalization using SCTransform, dimensionality reduction using PCA, batch effect removal using Harmony, dimensionality reduction using UMAP, and cell annotation-based marker genes on the scRNA-seq data. We recognized tumor cells, identified tumor-related genes (TRGs), and performed cell communication analysis. Next, we developed a prognostic model using univariable Cox, LASSO, and multivariate Cox analyses. The signature was evaluated using survival analysis, ROC curves, C-index, and nomogram. Last, we studied the predictability of the signature in terms of prognosis and immunotherapeutic response for HCC, assessed a variety of drugs for clinical treatment, and used the qRT-PCR analysis to validate the mRNA expression levels of prognostic TRGs.<h4>Conclusion</h4>To conclude, this study expounded upon the influence of tumor cell heterogeneity on the prediction of treatment outcomes and prognosis in HCC. This, in turn, enhances the predictive ability of the TNM staging system and furnishes novel perspectives on the prognostic assessment and therapy of HCC.

TNFSF4
Also flagged:TNFcostimulatory receptorsantibodiestumorTNFSF receptorscolorectal cancers
Journal Article 2023-11-22 ✓ 5 Snippets Gui L, Wang Z, Lou W, Yekehfallah V, Basiri M, Gao WQ, Wang Y, Ma B.
In-Text Gene Mentions

Here we established an MSC-based system for tumor-targeted delivery of TNF superfamily ligands, including TNFSF4, 9 and 18.

TNFSF4 showed the least antitumor efficacy in both LLC1 and CT26 tumor models.

…superfamily ligands, includingTNFSF4, 9 and 18.…

TNFSF4showed the least…

…antitumor activities thanTNFSF4.…

Show Full Abstract

Stimulation of costimulatory receptors serves as an alternative immunotherapeutic strategy other than checkpoint inhibition. However, systemic administration of the agonistic antibodies is associated with severe toxicities, which is one of the major obstacles for their clinical application. This study aimed to develop a mesenchymal stem cell (MSC)-based system for tumor-targeted delivery of TNF superfamily ligands and assess their potential in enhancing antitumor immunity. Here we established an MSC-based system for tumor-targeted delivery of TNF superfamily ligands, including TNFSF4, 9 and 18. The TNFSF receptors (TNFRSFs) were evaluated in mouse models and patient samples for lung and colorectal cancers. TNFRSFs were all expressed at various levels on tumor-infiltrated lymphocytes, with TNFRSF18 being the most prevalent receptor. Human umbilical cord-derived MSCs expressing these costimulatory ligands (MSC-TNFSFs) effectively activated lymphocytes in vitro and elicited antitumor immunity in mice. TNFSF4 showed the least antitumor efficacy in both LLC1 and CT26 tumor models. MSC-TNFSF9 showed the most potent tumor-inhibiting effect in the LLC1 tumor model, while MSCs expressing TNFSF18 in combination with CXCL9 most significantly repressed CT26 tumor growth. Overall, TNFSF9 and TNFSF18 exhibited stronger lymphocyte-stimulating and antitumor activities than TNFSF4. Our study provides evidence that antitumor effects of agonism of different costimulatory receptors may vary in different tumor types and presents a promising approach for targeted delivery of TNF superfamily costimulatory ligands to avoid the systemic toxicities and side effects associated with immune agonist antibodies.

POU3F2
Also flagged:neuroendocrine small cell prostate canceradenocarcinomacancerneuroendocrine cancerASCL1ASCL2
Journal Article 2023-11-22 ✓ 1 Snippet Chen CC, Tran W, Song K, Sugimoto T, Obusan MB, Wang L, Sheu KM, Cheng D, Ta L, Varuzhanyan G, Huang A, Xu R, Zeng Y, Borujerdpur A, Bayley NA, Noguchi M, Mao Z, Morrissey C, Corey E, Nelson PS, Zhao Y, Huang J, Park JW, Witte ON, Graeber TG.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Trans-differentiation from an adenocarcinoma to a small cell neuroendocrine state is associated with therapy resistance in multiple cancer types. To gain insight into the underlying molecular events of the trans-differentiation, we perform a multi-omics time course analysis of a pan-small cell neuroendocrine cancer model (termed PARCB), a forward genetic transformation using human prostate basal cells and identify a shared developmental, arc-like, and entropy-high trajectory among all transformation model replicates. Further mapping with single cell resolution reveals two distinct lineages defined by mutually exclusive expression of ASCL1 or ASCL2. Temporal regulation by groups of transcription factors across developmental stages reveals that cellular reprogramming precedes the induction of neuronal programs. TFAP4 and ASCL1/2 feedback are identified as potential regulators of ASCL1 and ASCL2 expression. Our study provides temporal transcriptional patterns and uncovers pan-tissue parallels between prostate and lung cancers, as well as connections to normal neuroendocrine cell states.

MLLT10
Also flagged:DOT1LAF10methylationRNA polymerase IIgene bodiesgene expression
Journal Article 2023-11-22 ✓ 2 Snippets Wille CK, Neumann EN, Deshpande AJ, Sridharan R.
In-Text Gene Mentions

…with AF10 (Mllt10), which recognizes…

…these, AF10 (MLLT10) and AF17…

Show Full Abstract

Histone 3 lysine 79 methylation (H3K79me) is enriched on gene bodies proportional to gene expression levels and serves as a strong barrier for the reprogramming of somatic cells to induced pluripotent stem cells (iPSCs). DOT1L is the sole histone methyltransferase that deposits all three orders-mono (me1), di (me2), and tri (me3) methylation-at H3K79. Here, we leverage genetic and chemical approaches to parse the specific functions of orders of H3K79me in maintaining cell identity. DOT1L interacts with AF10 (Mllt10), which recognizes unmodified H3K27 and boosts H3K79me2/3 methylation. AF10 deletion evicts H3K79me2/3 and reorganizes H3K79me1 to the transcription start site to facilitate iPSC formation in the absence of steady-state transcriptional changes. Instead, AF10 loss redistributes RNA polymerase II to a uniquely pluripotent pattern at highly expressed, rapidly transcribed housekeeping genes. Taken together, we reveal a specific mechanism for H3K79me2/3 located at the gene body in reinforcing cell identity.

POU3F2
Also flagged:lumengenetic neurodevelopmental disorderbrain developmentvalproic acidPCDH19epilepsy
Journal Article 2023-11-22 ✓ 1 Snippet Tidball AM, Niu W, Ma Q, Takla TN, Walker JC, Margolis JL, Mojica-Perez SP, Sudyk R, Deng L, Moore SJ, Chopra R, Shakkottai VG, Murphy GG, Yuan Y, Isom LL, Li JZ, Parent JM.
In-Text Gene Mentions

…three neuronal markersPOU3F2(BRN2) and CUX2…

Show Full Abstract

Brain organoid methods are complicated by multiple rosette structures and morphological variability. We have developed a human brain organoid technique that generates self-organizing, single-rosette cortical organoids (SOSR-COs) with reproducible size and structure at early timepoints. Rather than patterning a 3-dimensional embryoid body, we initiate brain organoid formation from a 2-dimensional monolayer of human pluripotent stem cells patterned with small molecules into neuroepithelium and differentiated to cells of the developing dorsal cerebral cortex. This approach recapitulates the 2D to 3D developmental transition from neural plate to neural tube. Most monolayer fragments form spheres with a single central lumen. Over time, the SOSR-COs develop appropriate progenitor and cortical laminar cell types as shown by immunocytochemistry and single-cell RNA sequencing. At early time points, this method demonstrates robust structural phenotypes after chemical teratogen exposure or when modeling a genetic neurodevelopmental disorder, and should prove useful for studies of human brain development and disease modeling.

Also flagged:developmental disordersgene expressionchromatintumorTissuetranscription factors
Journal Article 2023-11-22 No Snippets Haug S, Muthusamy S, Li Y, Stewart G, Li X, Treppner M, Köttgen A, Akilesh S.
Show Full Abstract

The kidney medulla is a specialized region with important homeostatic functions. It has been implicated in genetic and developmental disorders along with ischemic and drug-induced injuries. Despite its role in kidney function and disease, the medulla's baseline gene expression and epigenomic signatures have not been well described in the adult human kidney. Here we generated and analyzed gene expression (RNA-seq), chromatin accessibility (ATAC-seq), chromatin conformation (Hi-C) and spatial transcriptomic data from the adult human kidney cortex and medulla. Tissue samples were obtained from macroscopically dissected cortex and medulla of tumor-adjacent normal material in nephrectomy specimens from five male patients. We used these carefully annotated specimens to reassign incorrectly labeled samples in the larger public Genotype-Tissue Expression (GTEx) Project, and to extract meaningful medullary gene expression signatures. Using integrated analysis of gene expression, chromatin accessibility and conformation profiles, we found insights into medulla development and function and then validated this by spatial transcriptomics and immunohistochemistry. Thus, our datasets provide a valuable resource for functional annotation of variants from genome-wide association studies and are freely accessible through an epigenome browser portal.

SERPINC1
Also flagged:Plasminhemostasisbindingcoagulationendothelial cell activationthrombin
Journal Article 2023-11-22 ✓ 1 Snippet Berger M, Rosa da Mata S, Pizzolatti NM, Parizi LF, Konnai S, da Silva Vaz I, Seixas A, Tirloni L.
In-Text Gene Mentions

ATIII

Show Full Abstract

The skin is the first host tissue that the tick mouthparts, tick saliva, and a tick-borne pathogen contact during feeding. Tick salivary glands have evolved a complex and sophisticated pharmacological arsenal, consisting of bioactive molecules, to assist blood feeding and pathogen transmission. In this work, persulcatin, a multifunctional molecule that targets keratinocyte function and hemostasis, was identified from Ixodes persulcatus female ticks. The recombinant persulcatin was expressed and purified and is a 25-kDa acidic protein with 2 Kunitz-type domains. Persulcatin is a classical tight-binding competitive inhibitor of proteases, targeting plasmin (K<sub>i</sub>: 28 nM) and thrombin (K<sub>i</sub>: 115 nM). It blocks plasmin generation on keratinocytes and inhibits their migration and matrix protein degradation; downregulates matrix metalloproteinase 2 and matrix metalloproteinase 9; and causes a delay in blood coagulation, endothelial cell activation, and thrombin-induced fibrinocoagulation. It interacts with exosite I of thrombin and reduces thrombin-induced endothelial cell permeability by inhibiting vascular endothelial-cadherin disruption. The multifaceted roles of persulcatin as an inhibitor and modulator within the plasminogen-plasmin system and thrombin not only unveil further insights into the intricate mechanisms governing wound healing but also provide a fresh perspective on the intricate interactions between ticks and their host organisms.

MLLT10
Also flagged:Acute Myeloid LeukemiaLysine methyltransferase 2Amyeloid neoplasmsgene expressioncell cyclephosphorylation
Journal Article 2023-11-22 ✓ 1 Snippet Li J, Zong S, Wan Y, Ruan M, Zhang L, Yang W, Chen X, Zou Y, Chen Y, Guo Y, Wu P, Zhang Y, Zhu X.
In-Text Gene Mentions

To date, at least 135 fusion partners of KMT2A have been described, with MLLT3, MLLT4, MLLT10, and MLLT1 being the commonest ones in KMT2A-r acute myeloid leukemia (AML), and they were also clinically and biologically heterogenous.2,3 Despite great advances in molecular biology in recent years, the prognosis of KMT2A-r AML did not improve much.

Show Full Abstract

Lysine methyltransferase 2A-rearranged acute myeloid leukemia (<i>KMT2A</i>-r AML) is a special entity in the 2022 World Health Organization classification of myeloid neoplasms, characterized by high relapse rate and adverse outcomes. Current risk stratification was established on the treatment response and translocation partner of <i>KMT2A</i>. To study the transcriptomic feature and refine the current stratification of pediatric <i>KMT2A</i>-r AML, we analyzed clinical and RNA sequencing data of 351 patients. By implementing least absolute shrinkage and selection operator algorithm, we identified 7 genes (<i>KIAA1522</i>, <i>SKAP2</i>, <i>EGFL7</i>, <i>GAB2</i>, <i>HEBP1</i>, <i>FAM174B</i>, and <i>STARD8</i>) of which the expression levels were strongly associated with outcomes. We then developed a transcriptome-based score, dividing patients into 2 groups with distinct gene expression patterns and prognosis, which was further validated in an independent cohort and outperformed the LSC17 score. We also found cell cycle, oxidative phosphorylation, and metabolism pathways were upregulated in patients with inferior outcomes. By integrating clinical characteristics, we proposed a simple-to-use prognostic scoring system with excellent discriminability, which allowed us to distinguish allogeneic hematopoietic stem cell transplantation candidates more precisely. In conclusion, pediatric <i>KMT2A</i>-r AML is heterogenous on transcriptomic level and the newly proposed scoring system combining clinical characteristics and transcriptomic features can be instructive in clinical routines.

Also flagged:myocardial infarctionMItissue healingIschemic Heart Diseasedeathoxygen
Journal Article 2023-11-22 No Snippets Yin X, Lin L, Fang F, Zhang B, Shen C.
Show Full Abstract

The morbidity and mortality of myocardial infarction (MI) are increasing worldwide. Mesenchymal stem cells (MSCs) are multipotent stem cells with self-renewal and differentiation capabilities that are essential in tissue healing and regenerative medicine. However, the low implantation and survival rates of transplanted cells hinder the widespread clinical use of stem cells. Exosomes are naturally occurring nanovesicles that are secreted by cells and promote the repair of cardiac function by transporting noncoding RNA and protein. In recent years, MSC-derived exosomes have been promising cell-free treatment tools for improving cardiac function and reversing cardiac remodeling. This review describes the biological properties and therapeutic potential of exosomes and summarizes some engineering approaches for exosomes optimization to enhance the targeting and therapeutic efficacy of exosomes in MI.

Also flagged:glutaredoxin 1atherosclerosisGrx1thiolthiol transferase glutaredoxin 1aging
Journal Article 2023-11-22 No Snippets Ahn YJ, Wang L, Kim S, Eber MR, Salerno AG, Asmis R.
Show Full Abstract

<h4>Background and aims</h4>Deficiency in the thiol transferase glutaredoxin 1 (Grx1) in aging mice promotes, in a sexually dimorphic manner, dysregulation of macrophages and atherogenesis. However, the underlying mechanisms are not known. Here we tested the hypothesis that macrophage-restricted overexpression of Grx1 protects atherosclerosis-prone mice against macrophage reprogramming and dysfunction induced by a high-calorie diet (HCD) and thereby reduces the severity of atherosclerosis.<h4>Methods</h4>We generated lentiviral vectors carrying cluster of differentiation 68 (CD68) promoter-driven enhanced green fluorescent protein (EGFP) or Grx1 constructs and conducted bone marrow (BM) transplantation studies to overexpress Grx1 in a macrophage-specific manner in male and female atherosclerosis-prone LDLR<sup>-/-</sup> mice, and fed these mice a HCD to induce atherogenesis. Atherosclerotic lesion size was determined in both the aortic root and the aorta. We isolated BM-derived macrophages (BMDM) to assess protein S-glutathionylation levels and loss of mitogen-activated protein kinase phosphatase 1 (MKP-1) activity as measures of HCD-induced thiol oxidative stress. We also conducted gene profiling on these BMDM to determine the impact of Grx1 activity on HCD-induced macrophage reprogramming.<h4>Results</h4>Overexpression of Grx1 protected macrophages against HCD-induced protein S-glutathionylation, reduced monocyte chemotaxis in vivo, limited macrophage recruitment into atherosclerotic lesions, and was sufficient to reduce the severity of atherogenesis in both male and female mice. Gene profiling revealed major sex differences in the transcriptional reprogramming of macrophages induced by HCD feeding, but Grx1 overexpression only partially reversed HCD-induced transcriptional reprogramming of macrophages.<h4>Conclusions</h4>Macrophage Grx1 plays a major role in protecting mice atherosclerosis mainly by maintaining the thiol redox state of the macrophage proteome and preventing macrophage dysfunction.

Also flagged:growth hormoneGHaromatasemetformininsulin-like growth factor-1IGF-1
Journal Article 2023-11-22 No Snippets Lim DW, Lee C.
Show Full Abstract

Approximately 80% of children with short stature are classified as having Idiopathic Short Stature (ISS). While growth hormone (GH) treatment received FDA approval in the United States in 2003, its long-term impact on final height remains debated. Other treatments, like aromatase inhibitors, metformin, and insulin-like growth factor-1 (IGF-1), have been explored, but there is no established standard treatment for ISS. In South Korea and other Asian countries, East Asian Traditional Medicine (EATM) is sometimes employed by parents to potentially enhance their children's height growth, often involving herbal medicines. One such product, <i>Astragalus membranaceus</i> extract mixture HT042, claims to promote height growth in children and has gained approval from the Korean Food and Drug Administration (KFDA). Research suggests that HT042 supplementation can increase height growth in children without skeletal maturation, possibly by elevating serum IGF-1 and IGF-binding protein-3 levels. Preclinical studies also indicate the potential benefits of natural products, including of EATM therapies for ISS. The purpose of this review is to offer an overview of bone growth factors related to ISS and to investigate the potential of natural products, including herbal preparations, as alternative treatments for managing ISS symptoms, based on their known efficacy in in vivo studies.

Also flagged:neurogenesiscognitionneurodegenerative diseasesneurological disorderspsychiatric disordersaging
Journal Article 2023-11-22 No Snippets Mattova S, Simko P, Urbanska N, Kiskova T.
Show Full Abstract

Since postnatal neurogenesis was revealed to have significant implications for cognition and neurological health, researchers have been increasingly exploring the impact of natural compounds on this process, aiming to uncover strategies for enhancing brain plasticity. This review provides an overview of postnatal neurogenesis, neurogenic zones, and disorders characterized by suppressed neurogenesis and neurogenesis-stimulating bioactive compounds. Examining recent studies, this review underscores the multifaceted effects of natural compounds on postnatal neurogenesis. In essence, understanding the interplay between postnatal neurogenesis and natural compounds could bring novel insights into brain health interventions. Exploiting the therapeutic abilities of these compounds may unlock innovative approaches to enhance cognitive function, mitigate neurodegenerative diseases, and promote overall brain well-being.

Also flagged:BenzamideAcetamideSulfonamideconjugationdiclofenacmefenamic acid
Journal Article 2023-11-22 No Snippets Ahmad S, Abdul Qadir M, Ahmed M, Imran M, Ahmad M, Yousaf N, Wani TA, Zargar S, Ali I, Muddassar M.
Show Full Abstract

The search for novel drug scaffolds that can improve effectiveness and safety through drug conjugates is a promising approach. Consequently, drug conjugates constitute a dynamic field of study and advancement within medicinal chemistry. This research demonstrates the conjugation of diclofenac and mefenamic acid with sulfa drugs and their screening for urease inhibition. These conjugates' structural confirmation was performed using elemental analysis and spectroscopic methods, including IR, <sup>1</sup>H NMR, and <sup>13</sup>C NMR. Diclofenac conjugated with sulfanilamide (4), sulfacetamide (10), and mefenamic acid conjugated with sulfanilamide (12), and sulfamethoxazole (17) was found potent and demonstrated urease inhibition competitively, with IC<sub>50</sub> (μM) values 3.59 ± 0.07, 5.49 ± 0.34, 7.92 ± 0.27, and 8.35 ± 0.26, respectively. Diclofenac conjugated with sulfathiazole (6), sulfamerazine (8), and sulfaguanidine (11), while mefenamic acid conjugated with sulfisoxazole (13), sulfathiazole (14), and sulfadiazine (15) exhibited a mixed mode of urease inhibition. The IC<sub>50</sub> (μM) values were 16.19 ± 0.21, 9.50 ± 0.28, 4.35 ± 0.23, 15.86 ± 0.25, 14.80 ± 0.27, and 7.92 ± 0.27, respectively. Furthermore, molecular docking studies were employed to predict the binding pose of competitive inhibitors at the urease active site. These conjugates generated stable complexes with the urease protein observed through molecular dynamics (MD) simulations, where no conformational changes occurred throughout the simulations. These results highlight the potential for approved therapeutic molecule conjugates to give rise to new categories of pharmacological agents for urease inhibition. The structural similarity of sulfonamides with urea allows them to compete with urea for binding to the active site of the urease enzyme. Sulfonamides and nonsteroidal anti-inflammatory drugs (NSAIDs) can interact hydrophobically with the active site of the urease enzyme, which may disturb its structure and catalytic activity. Therefore, these conjugates may be helpful in the development of novel pharmacological agents for the treatment of a variety of illnesses in which the urease enzyme is involved.

SERPINC1
Also flagged:EPCRvenous thromboembolismserineglycineendothelial protein C receptorFactor V Leiden
Journal Article 2023-11-22 ✓ 2 Snippets Pituk D, Miklós T, Schlammadinger Á, Rázsó K, Bereczky Z.
In-Text Gene Mentions

…(PS) genes (SERPINC1, PROC , and…

…PROS1 , andSERPINC1genes were analyzed…

Show Full Abstract

<h4>Background</h4>The rs867186 single-nucleotide polymorphism in the <i>PROCR</i> gene (g.6936A > G, c.4600A > G) results in a serine-to-glycine substitution at codon 219 of endothelial protein C receptor (EPCR). We performed a case-control study followed by an updated meta-analysis of the association between this polymorphism and the risk of venous thromboembolism (VTE).<h4>Objective and methods</h4>We enrolled 263 VTE patients and 320 unrelated healthy controls for the case-control study. The total number of cases and controls for the meta-analysis were 5,768 and 30,017, respectively. A new online MetaGenyo Statistical Analysis System software was used to perform the current meta-analysis. Furthermore, a reproducibility study was conducted to validate our results.<h4>Results</h4>Among well-defined thrombosis risk factors, Factor V Leiden was more frequent in the VTE group (<i>p</i> < 0.001), while there was no difference in mutation frequency of prothrombin 20210G>A polymorphism between the two groups. There was no difference in the mutation frequency of Factor V Leiden and prothrombin 20210G>A between cases with and without provoking factors and cases with and without VTE recurrence. The rs867186 "G" carriership did not influence the risk of VTE [odds ratio (OR) 1.339; 95% confidence interval (CI): 0.904-1.984] in our study. No significant differences could be demonstrated among the rs867186 genotype frequencies between VTE cases with and without provoking factors (<i>p</i> = 0.430). <i>PROCR</i> rs867186 was associated with an OR of 1.72 (95% CI: 0.95-3.13, <i>p</i> = 0.075) in terms of VTE recurrence. In the meta-analysis, a significant association was found between EPCR Ser219Gly polymorphism and VTE under the dominant model (OR = 1.27, 95% CI: 1.11-1.46, <i>p</i> = 0.0006), the recessive model (OR = 1.60, 95% CI: 1.26-2.04, <i>p</i> = 0.0001), the GG vs. AA contrast model (OR = 1.64, 95% CI: 1.28-2.09, <i>p</i> = 0.0001), and the GA vs. AA contrast model (OR = 1.24, 95% CI: 1.08-1.43, <i>p</i> = 0.002).<h4>Conclusion</h4>The rs867186 was not associated with the first VTE risk in our case-control study; however, a tendency to VTE recurrence was observed. Based on the results of our reproducibility study, MetaGenyo is acceptable for meta-analysis in case of genetic epidemiology studies. Although the risk conferred by the rs867186 is mild in all meta-analyses, including ours, identifying patients carrying the minor allele might have an impact on personalized VTE risk assessment, risk-score calculation, and patient management.

SOX6
Also flagged:myoblast proliferationwatermyoglobinmyogenesisMyogenic Regulatory FactorsMyostatin
Journal Article 2023-11-22 ✓ 1 Snippet Mo M, Zhang Z, Wang X, Shen W, Zhang L, Lin S.
In-Text Gene Mentions

…regulatory factor 4;Sox6, SRY-related high-mobility gr…

Show Full Abstract

In the past, the primary emphasis of livestock and poultry breeding was mainly on improving the growth rate, meat production efficiency and disease resistance. However, the improvement of meat quality has become a major industrial focus due to the ongoing advancements in livestock and poultry breeding. Skeletal muscles consist of multinucleated myofibers formed through the processes of myoblast proliferation, differentiation and fusion. Muscle fibers can be broadly classified into two main types: slow-twitch (Type I) and fast-twitch (Type II). Fast-twitch fibers can be further categorized into Type IIa, Type IIx, and Type IIb. The proportion of Type I and Type IIa muscle fibers is positively associated with meat quality, while the presence of Type IIb muscle fibers in skeletal muscle tissue is inversely related to meat quality. Consequently, muscle fiber composition directly influences meat quality. The distribution of these fiber types within skeletal muscle is governed by a complex network, which encompasses numerous pivotal regulators and intricate signaling pathways. This article aims to succinctly outline the parameters utilized for assessing meat quality, elucidate the relationship between muscle fiber composition and meat quality as well as elaborate on the relevant genetic factors and their molecular mechanisms that regulate muscle fiber types in livestock and poultry. This summary will enrich our comprehension of how to improve meat quality in livestock and poultry, providing valuable insights for future improvements.

Also flagged:chitinchitosancollagengelatinantimicrobial proteinsinsulin
Journal Article 2023-11-22 No Snippets Sarkar MSI, Hasan MM, Hossain MS, Khan M, Islam AA, Paul SK, Rasul MG, Rasul MG, Kamal M.
Show Full Abstract

From ancient times fish has always been considered as an important human food item. The purpose of this article is to introduce the perception that beside consumption, fish can also be used as a raw material for the industrial production of different products. In this article such 19 products have been described. Among them, the conventional fish products described herein include isinglass, pituitary gland, chitin, chitosan, pearl essence, fish skin leather, fish protein hydrolysates and concentrates, fish meal and scrap, fish oil, collagen, gelatin, glue, fish silage, pet food and wet feed from fish, fish fertilizer and compost. These products have important applications in aquaculture, agriculture, food, cosmetics and other industries. Different non-conventional hi-tech fish products has been reported such as novel antimicrobial proteins from skin mucus, enzymes, insulin, protamine, blood proteins, salcotonin, antifreeze proteins, hydroxyapatite, burn treatment bandage, albumins, fishbone calcium powder, biochar, biopolymer, bioplastics, fish industry derived rinse water recovery. These products have many significant applications in chemical, biomedical and pharmaceutical industries. Economical, logistic, environmental and technological considerations from fish waste valorization perspectives has also been presented to evaluate feasibility of industrial-scale production of these products.

VRK2
Also flagged:Nicotinamide adenine dinucleotideadenine nucleotide7-methylguanosinetriphosphatemethyladenosineantibody
Journal Article 2023-11-22 ✓ 1 Snippet Li D, Ge S, Liu Y, Pan M, Wang X, Han G, Zou S, Liu R, Niu K, Zhao C, Liu N, Qu L.
In-Text Gene Mentions

…(ZC3H12D), and apoptosis (VRK2).…

Show Full Abstract

Nicotinamide adenine dinucleotide (NAD) can be used as an initiating nucleotide in RNA transcription to produce NAD-capped RNA (NAD-RNA). RNA modification by NAD that links metabolite with expressed transcript is a poorly studied epitranscriptomic modification. Current NAD-RNA profiling methods involve multi-steps of chemo-enzymatic labeling and affinity-based enrichment, thus presenting a critical analytical challenge to remove unwanted variations, particularly batch effects. Here, we propose a computational framework, enONE, to remove unwanted variations. We demonstrate that designed spike-in RNA, together with modular normalization procedures and evaluation metrics, can mitigate technical noise, empowering quantitative and comparative assessment of NAD-RNA across different datasets. Using enONE and a human aging cohort, we reveal age-associated features of NAD-capping and further develop an accurate RNA-based aging clock that combines signatures from both transcriptome and NAD-modified epitranscriptome. enONE facilitates the discovery of NAD-RNA responsive to physiological changes, laying an important foundation for functional investigations into this modification.

HFE
Also flagged:ironbone morphogenetic protein(BMP)6transcription factorsNrf-2BMP6
Journal Article 2023-11-22 ✓ 4 Snippets Fisher AL, Wang CY, Xu Y, Phillips S, Paulo JA, Małachowska B, Xiao X, Fendler W, Mancias JD, Babitt JL.
In-Text Gene Mentions

,39 In addition to cellular oxidative stress, AP-1 is also suggested to function in regulation of the hemochromatosis gene HFE,40 and, via c-Jun, transcription of the plasma iron oxidase ceruloplasmin.41

…exogenous BMP6 ameliorateshemochromatosisin mice.…

…regulation of thehemochromatosisgene HFE ,…

…the hemochromatosis geneHFE, 40 and,…

Show Full Abstract

Hepcidin is the master hormone governing systemic iron homeostasis. Iron regulates hepcidin by activating bone morphogenetic protein (BMP)6 expression in liver endothelial cells (LECs), but the mechanisms are incompletely understood. To address this, we performed proteomics and RNA-sequencing on LECs from iron-adequate and iron-loaded mice. Gene set enrichment analysis identified transcription factors activated by high iron, including Nrf-2, which was previously reported to contribute to BMP6 regulation, and c-Jun. <i>Jun</i> (encoding c-Jun) knockdown blocked <i>Bmp6</i> but not Nrf-2 pathway induction by iron in LEC cultures. Chromatin immunoprecipitation of mouse livers showed iron-dependent c-Jun binding to predicted sites in <i>Bmp6</i> regulatory regions. Finally, c-Jun inhibitor blunted induction of <i>Bmp6</i> and hepcidin, but not Nrf-2 activity, in iron-loaded mice. However, <i>Bmp6</i> and iron parameters were unchanged in endothelial <i>Jun</i> knockout mice. Our data suggest that c-Jun participates in iron-mediated BMP6 regulation independent of Nrf-2, though the mechanisms may be redundant and/or multifactorial.

PRDX6
Also flagged:glucoseinsulin resistancemetabolismagingcarbohydrategluconeogenesis
Journal Article 2023-11-22 ✓ 5 Snippets Pacifici F, Andreadi A, Arriga R, Pastore D, Capuani B, Bonanni R, Della-Morte D, Bellia A, Lauro D, Donadel G.
In-Text Gene Mentions

…Metabolic Profile inPrdx6-Deficient Mice Exposed to…

…goal, we usedPrdx6−/− mice exposed…

…knockout mice (Prdx6−/− ) subjected…

…As previously demonstrated,Prdx6−/− mice develop…

…data showed thatPrdx6−/− mice subjected…

Show Full Abstract

<h4>Background</h4>Space travel has always been one of mankind's greatest dreams. Thanks to technological innovation, this dream is becoming more of a reality. Soon, humans (not only astronauts) will travel, live, and work in space. However, a microgravity environment can induce several pathological alterations that should be, at least in part, controlled and alleviated. Among those, glucose homeostasis impairment and insulin resistance occur, which can lead to reduced muscle mass and liver dysfunctions. Thus, it is relevant to shed light on the mechanism underlaying these pathological conditions, also considering a nutritional approach that can mitigate these effects.<h4>Methods</h4>To achieve this goal, we used <i>Prdx6</i><sup>-/-</sup> mice exposed to Hindlimb Unloading (HU), a well-established experimental protocol to simulate microgravity, fed with a chow diet or an omega-3-enriched diet.<h4>Results</h4>Our results innovatively demonstrated that HU-induced metabolic alterations, mainly related to glucose metabolism, may be mitigated by the administration of omega-3-enriched diet. Specifically, a significant improvement in insulin resistance has been reported.<h4>Conclusions</h4>Although preliminary, our results highlight the importance of specific nutritional approaches that can alleviate microgravity-induced harmful effects. These findings should be considered soon by those planning trips around the earth.

Also flagged:DendrimersBreast CancerGraphene oxidebiomacromoleculesPolypropylenimineGOX
Journal Article 2023-11-22 No Snippets Ribeiro BFM, Chaves JB, De Souza MM, Keppler AF, Do Carmo DR, Machado-Santelli GM.
Show Full Abstract

Graphene oxide (GOX) has become attractive due to its unique physicochemical properties. This nanomaterial can associate with other dendrimers, making them more soluble and allowing better interaction with biomacromolecules. The present study aimed to investigate, by real-time microscopy, the behavior of human breast cancer cells exposed to particles of materials based on graphene oxide. The MCF-7 cell line was exposed to GOX, GOX associated with Polypropylenimine hexadecaamine Dendrimer, Generation 3.0-DAB-AM-16 (GOXD) and GOX associated with polypropyleneimine-PAMAM (GOXP) in the presence or absence of fetal bovine serum (FBS). GOX, GOXD and GOXP were taken up by the cells in clusters and then the clusters were fragmented into smaller ones inside the cells. Real-time microscopy showed that the presence of FBS in the culture medium could allow a more efficient internalization of graphene materials. After internalizing the materials, cells can redistribute the clumps to their daughter cells. In conclusion, the present study showed that the particles can adhere to the cell surface, favoring their internalization. The presence of FBS contributed to the formation of smaller aggregates of particles, avoiding the formation of large ones, and thus transmitted a more efficient internalization of the materials through the interaction of the particles with the cell membrane.

Also flagged:zinchydroxyapatitedextranwatercervical adenocarcinomananomaterials
Journal Article 2023-11-22 No Snippets Ciobanu SC, Predoi D, Chifiriuc MC, Iconaru SL, Predoi MV, Popa M, Rokosz K, Raaen S, Marinas IC.
Show Full Abstract

In the present study, sage-coated zinc-doped hydroxyapatite was incorporated into a dextran matrix (7ZnHAp-SD), and its physico-chemical and antimicrobial activities were investigated. A 7ZnHAp-SD nanocomposite suspension was obtained using the co-precipitation method. The stability of the nanocomposite suspension was evaluated using ultrasound measurements. The stability parameter calculated relative to double-distilled water as a reference fluid highlights the very good stability of the 7ZnHAp-SD suspension. X-ray diffraction (XRD) experiments were performed to evaluate the characteristic diffraction peak of the hydroxyapatite phase. Valuable information regarding the morphology and chemical composition of 7ZnHAp-SD was obtained via scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), and X-ray photoelectron spectroscopy (XPS) studies. Fourier-transform infrared spectroscopy (FTIR) measurements were performed on the 7ZnHAp-SD suspensions in order to evaluate the functional groups present in the sample. Preliminary studies on the antimicrobial activity of 7ZnHAp-SD suspensions against the standard strains of <i>Staphylococcus aureus</i> 25923 ATCC, <i>Enterococcus faecalis</i> 29212 ATCC, <i>Escherichia coli</i> 25922 ATCC, and <i>Pseudomonas aeruginosa</i> 27853 ATCC were conducted. More than that, preliminary studies on the biocompatibility of 7ZnHAp-SD were conducted using human cervical adenocarcinoma (HeLa) cells, and their results emphasized that the 7ZnHAp-SD sample did not exhibit a toxic effect and did not induce any noticeable changes in the morphological characteristics of HeLa cells. These preliminary results showed that these nanoparticles could be possible candidates for biomedical/antimicrobial applications.

HTT
Also flagged:Foxp2innervationtranscription factorcell differentiationHDneurotransmitter
Journal Article 2023-11-21 ✓ 2 Snippets Rodríguez-Urgellés E, Casas-Torremocha D, Sancho-Balsells A, Ballasch I, García-García E, Miquel-Rio L, Manasanch A, Del Castillo I, Chen W, Pupak A, Brito V, Tornero D, Rodríguez MJ, Bortolozzi A, Sanchez-Vives MV, Giralt A, Alberch J.
In-Text Gene Mentions

Huntington's disease (HD) is an autosomal dominant inherited neurodegenerative disorder characterized by motor coordination alterations [1], and caused by a pathological CAG repeat expansions in the human huntingtin (htt) gene on chromosome 4p16.3 [2, 3].

…the human huntingtin (htt) gene on chromosome…

Show Full Abstract

<h4>Background</h4>Huntington's Disease (HD) is a disorder that affects body movements. Altered glutamatergic innervation of the striatum is a major hallmark of the disease. Approximately 30% of those glutamatergic inputs come from thalamic nuclei. Foxp2 is a transcription factor involved in cell differentiation and reported low in patients with HD. However, the role of the Foxp2 in the thalamus in HD remains unexplored.<h4>Methods</h4>We used two different mouse models of HD, the R6/1 and the HdhQ111 mice, to demonstrate a consistent thalamic Foxp2 reduction in the context of HD. We used in vivo electrophysiological recordings, microdialysis in behaving mice and rabies virus-based monosynaptic tracing to study thalamo-striatal and thalamo-cortical synaptic connectivity in R6/1 mice. Micro-structural synaptic plasticity was also evaluated in the striatum and cortex of R6/1 mice. We over-expressed Foxp2 in the thalamus of R6/1 mice or reduced Foxp2 in the thalamus of wild type mice to evaluate its role in sensory and motor skills deficiencies, as well as thalamo-striatal and thalamo-cortical connectivity in such mouse models.<h4>Results</h4>Here, we demonstrate in a HD mouse model a clear and early thalamo-striatal aberrant connectivity associated with a reduction of thalamic Foxp2 levels. Recovering thalamic Foxp2 levels in the mouse rescued motor coordination and sensory skills concomitant with an amelioration of neuropathological features and with a repair of the structural and functional connectivity through a restoration of neurotransmitter release. In addition, reduction of thalamic Foxp2 levels in wild type mice induced HD-like phenotypes.<h4>Conclusions</h4>In conclusion, we show that a novel identified thalamic Foxp2 dysregulation alters basal ganglia circuits implicated in the pathophysiology of HD.

HTT
Also flagged:RNA polymeraseSpt5elongation factorRNA polymerase IIPol IIneurodegenerative diseases
Journal Article 2023-11-21 ✓ 5 Snippets Gallardo A, Dutagaci B.
In-Text Gene Mentions

…the mutant huntingtin (Htt) gene, which has…

…of the mutantHttgene as well…

…inhibit the mutantHttgene transcription and…

…of the mutantHttgene from the…

…in the mutantHttgene transcription.…

Show Full Abstract

Spt5 is an elongation factor that associates with RNA polymerase II (Pol II) during transcription and has important functions in promoter-proximal pausing and elongation processivity. Spt5 was also recognized for its roles in the transcription of expanded-repeat genes that are related to neurodegenerative diseases. Recently, a set of Spt5-Pol II small molecule inhibitors (SPIs) were reported, which selectively inhibit mutant huntingtin gene transcription. Inhibition mechanisms as well as interaction sites of these SPIs with Pol II and Spt5 are not entirely known. In this study, we predicted the binding sites of three selected SPIs at the Pol II-Spt5 interface by docking and molecular dynamics simulations. Two molecules out of three demonstrated strong binding with Spt5 and Pol II, while the other molecule was more loosely bound and sampled multiple binding sites. Strongly bound SPIs indirectly affected RNA and DNA dynamics at the exit site as DNA became more flexible while RNA was stabilized by increased interactions with Spt5. Our results suggest that the transcription inhibition mechanism induced by SPIs can be related to Spt5-nucleic acid interactions, which were altered to some extent with strong binding of SPIs.

HFE
Also flagged:alcoholalcoholic liver diseasealcoholic hepatitisalcoholic cirrhosisNKp46NK cell-activating receptor
Journal Article 2023-11-21 ✓ 1 Snippet Eom JA, Jeong JJ, Han SH, Kwon GH, Lee KJ, Gupta H, Sharma SP, Won SM, Oh KK, Yoon SJ, Joung HC, Kim KH, Kim DJ, Suk KT.
In-Text Gene Mentions

…mmune hepatitis, pancreatitis,hemochromatosis, Wilson’s disease, cancer,…

Show Full Abstract

The liver is rich in innate immune cells, such as natural killer (NK) cells, natural killer T cells, and Kupffer cells associated with the gut microbiome. These immune cells are dysfunctional owing to alcohol consumption. However, there is insufficient data on the association between immune cells and gut microbiome in alcoholic liver disease (ALD). Therefore, the purpose of this study was to evaluate the effects of probiotic strains on NK cells in ALD patients. In total, 125 human blood samples [control (<i>n</i> = 22), alcoholic hepatitis (<i>n</i> = 43), and alcoholic cirrhosis (<i>n</i> = 60]) were collected for flow cytometric analysis. C57BL/6J mice were divided into four groups (normal, EtOH-fed, and 2 EtOH+strain groups [<i>Phocaeicola dorei</i> and <i>Lactobacillus helveticus</i>]). Lymphocytes isolated from mouse livers were analyzed using flow cytometry. The frequency of NK cells increased in patients with alcoholic hepatitis and decreased in patients with alcoholic cirrhosis. The expression of NKp46, an NK cell-activating receptor, was decreased in patients with alcoholic hepatitis and increased in patients with alcoholic cirrhosis compared to that in the control group. The number of cytotoxic CD56dimCD16<sup>+</sup> NK cells was significantly reduced in patients with alcoholic cirrhosis. We tested the effect of oral administration <i>P. dorei</i> and <i>L. helveticus</i> in EtOH-fed mice. <i>P. dorei</i> and <i>L. helveticus</i> improved liver inflammation and intestinal barrier damage caused by EtOH supply and increased NK cell activity. Therefore, these observations suggest that the gut microbiome may ameliorate ALD by regulating immune cells.

DCC
Also flagged:fatty acidcholesterolmetabolismbone resorptionosteoclast activationRANKL
Journal Article 2023-11-21 ✓ 1 Snippet Yu X, Hu J, Yang X, Xu Q, Chen H, Zhan P, Zhang B.
In-Text Gene Mentions

…healthy 8‐week‐old femaleC57BL/six micemice (Hunan SJA…

Show Full Abstract

Infection by bacterial products in the implant and endotoxin introduced by wear particles activate immune cells, enhance pro-inflammatory cytokines production, and ultimately promote osteoclast recruitment and activity. These factors are known to play an important role in osteolysis as well as potential targets for the treatment of osteolysis. Sesamin has been shown to have a variety of biological functions, such as inhibiting inflammation, anti-tumour and involvement in the regulation of fatty acid and cholesterol metabolism. However, the therapeutic effect of sesamin on osteolysis and its mechanism remain unclear. Present studies shown that in the condition of in vitro, sesamin could inhibit osteoclastogenesis and bone resorption, as well as suppressing the expression of osteoclast-specific genes. Further studies on the mechanism suggest that the effect of sesamin on human osteoclasts was mediated by blocking the ERK and NF-κB signalling pathways. Besides, sesamin was found to be effective in treating LPS-induced osteolysis by decreasing the production of pro-inflammatory cytokines and inhibiting osteoclastogenesis in vivo. Sesamin was non-toxic to heart, liver, kidney, lung and spleen. Therefore, sesamin is a promising phytochemical agent for the therapy of osteolysis-related diseases caused by inflammation and excessive osteoclast activation.

LRRC7
Also flagged:telomereslocalizationchromosomestelomerenucleosomeanaphase
Journal Article 2023-11-21 ✓ 5 Snippets Colin L, Reyes C, Berthezene J, Maestroni L, Modolo L, Toselli E, Chanard N, Schaak S, Cuvier O, Gachet Y, Coulon S, Bernard P, Tournier S.
In-Text Gene Mentions

Condensinpositioning at telomeres…

Condensinis enriched at…

Condensinis a ring-shaped…

Condensinis composed of…

Condensinis required for…

Show Full Abstract

The localization of condensin along chromosomes is crucial for their accurate segregation in anaphase. Condensin is enriched at telomeres but how and for what purpose had remained elusive. Here, we show that fission yeast condensin accumulates at telomere repeats through the balancing acts of Taz1, a core component of the shelterin complex that ensures telomeric functions, and Mit1, a nucleosome remodeler associated with shelterin. We further show that condensin takes part in sister-telomere separation in anaphase, and that this event can be uncoupled from the prior separation of chromosome arms, implying a telomere-specific separation mechanism. Consistent with a cis-acting process, increasing or decreasing condensin occupancy specifically at telomeres modifies accordingly the efficiency of their separation in anaphase. Genetic evidence suggests that condensin promotes sister-telomere separation by counteracting cohesin. Thus, our results reveal a shelterin-based mechanism that enriches condensin at telomeres to drive in cis their separation during mitosis.

RC3H1
Also flagged:waterCD4IgGCD3CD28antibodies
Journal Article 2023-11-21 ✓ 5 Snippets Schmidt H, Raj T, O'Neill TJ, Muschaweckh A, Giesert F, Negraschus A, Hoefig KP, Behrens G, Esser L, Baumann C, Feederle R, Plaza-Sirvent C, Geerlof A, Gewies A, Isay SE, Ruland J, Schmitz I, Wurst W, Korn T, Krappmann D, Heissmeyer V.
In-Text Gene Mentions

To induce EAE in a T cell conditional Mins/Mins setting, 1,500 CD4+, CD25− T cells from 2D2-TCR transgenic Rc3h1+/+ or Rc3hMins/Mins mice were injected into Rag1–/– recipients.

…SMARTA TCR-tg (SM(tg)),Rc3h1+/+ or SM(tg);…

…from 2D2-TCR transgenicRc3h1+/+ or Rc3h…

…signal-induced cleavage ofRoquin-1, we created a…

…cleavage sites ofRoquin-1( 4 ),…

Show Full Abstract

Constitutive activation of the MALT1 paracaspase in conventional T cells of <i>Malt1</i><sup>TBM/TBM</sup> (TRAF6 Binding Mutant = TBM) mice causes fatal inflammation and autoimmunity, but the involved targets and underlying molecular mechanisms are unknown. We genetically rendered a single MALT1 substrate, the RNA-binding protein (RBP) Roquin-1, insensitive to MALT1 cleavage. These <i>Rc3h1</i><sup>Mins/Mins</sup> mice showed normal immune homeostasis. Combining <i>Rc3h1</i><sup>Mins/Mins</sup> alleles with those encoding for constitutively active MALT1 (TBM) prevented spontaneous T cell activation and restored viability of <i>Malt1</i><sup>TBM/TBM</sup> mice. Mechanistically, we show how antigen/MHC recognition is translated by MALT1 into Roquin cleavage and derepression of Roquin targets. Increasing T cell receptor (TCR) signals inactivated Roquin more effectively, and only high TCR strength enabled derepression of high-affinity targets to promote Th17 differentiation. Induction of experimental autoimmune encephalomyelitis (EAE) revealed increased cleavage of Roquin-1 in disease-associated Th17 compared to Th1 cells in the CNS. T cells from <i>Rc3h1</i><sup>Mins/Mins</sup> mice did not efficiently induce the high-affinity Roquin-1 target IκB<sub>NS</sub> in response to TCR stimulation, showed reduced Th17 differentiation, and <i>Rc3h1</i><sup>Mins/Mins</sup> mice were protected from EAE. These data demonstrate how TCR signaling and MALT1 activation utilize graded cleavage of Roquin to differentially regulate target mRNAs that control T cell activation and differentiation as well as the development of autoimmunity.

OLFM4
Also flagged:prostate cancerbenign prostatic hyperplasiacancerdeathProstate-specific antigenPSA
Journal Article 2023-11-21 ✓ 3 Snippets Gabriele C, Aracri F, Prestagiacomo LE, Rota MA, Alba S, Tradigo G, Guzzi PH, Cuda G, Damiano R, Veltri P, Gaspari M.
In-Text Gene Mentions

An early pivotal study about PCa biomarker discovery identified a serum glycoprotein signature comprising ASPN, CTSD, HYOU1 and OLFM4, (from this point on, throughout the text, proteins will be indicated via their gene names to allow a more fluent reading) able to discriminate between BPH and PCa groups with an area under the ROC curve (AUC) of 0.726 [14].

…CTSD, HYOU1 andOLFM4, (from this point…

…ASPN, CTSD, HYOU1,OLFM4which, in combination…

Show Full Abstract

<h4>Background</h4>Prostate Cancer (PCa) represents the second leading cause of cancer-related death in men. Prostate-specific antigen (PSA) serum testing, currently used for PCa screening, lacks the necessary sensitivity and specificity. New non-invasive diagnostic tools able to discriminate tumoral from benign conditions and aggressive (AG-PCa) from indolent forms of PCa (NAG-PCa) are required to avoid unnecessary biopsies.<h4>Methods</h4>In this work, 32 formerly N-glycosylated peptides were quantified by PRM (parallel reaction monitoring) in 163 serum samples (79 from PCa patients and 84 from individuals affected by benign prostatic hyperplasia (BPH)) in two technical replicates. These potential biomarker candidates were prioritized through a multi-stage biomarker discovery pipeline articulated in: discovery, LC-PRM assay development and verification phases. Because of the well-established involvement of glycoproteins in cancer development and progression, the proteomic analysis was focused on glycoproteins enriched by TiO<sub>2</sub> (titanium dioxide) strategy.<h4>Results</h4>Machine learning algorithms have been applied to the combined matrix comprising proteomic and clinical variables, resulting in a predictive model based on six proteomic variables (RNASE1, LAMP2, LUM, MASP1, NCAM1, GPLD1) and five clinical variables (prostate dimension, proPSA, free-PSA, total-PSA, free/total-PSA) able to distinguish PCa from BPH with an area under the Receiver Operating Characteristic (ROC) curve of 0.93. This model outperformed PSA alone which, on the same sample set, was able to discriminate PCa from BPH with an AUC of 0.79. To improve the clinical managing of PCa patients, an explorative small-scale analysis (79 samples) aimed at distinguishing AG-PCa from NAG-PCa was conducted. A predictor of PCa aggressiveness based on the combination of 7 proteomic variables (FCN3, LGALS3BP, AZU1, C6, LAMB1, CHL1, POSTN) and proPSA was developed (AUC of 0.69).<h4>Conclusions</h4>To address the impelling need of more sensitive and specific serum diagnostic tests, a predictive model combining proteomic and clinical variables was developed. A preliminary evaluation to build a new tool able to discriminate aggressive presentations of PCa from tumors with benign behavior was exploited. This predictor displayed moderate performances, but no conclusions can be drawn due to the limited number of the sample cohort. Data are available via ProteomeXchange with identifier PXD035935.

HTT
Also flagged:Parkinson's diseasePDPINK1Parkinphosphoglycerate mutase 5PGAM5
Journal Article 2023-11-21 ✓ 2 Snippets Qian S, He H, Xiong X, Ai R, Wang W, Zhu H, Ye Q, Zhou S, Nilsen H, Xie C.
In-Text Gene Mentions

For HD issues, damaged mitochondrial and proteostasis alterations, especially in the autophagic/endosomal system, including the mutation of Autophagy Related Protein 7 (ATG7) and impairment of GAPDH‐mediated mitophagy by mutant Htt, are related to the pathogenesis of HD.39

…mitophagy by mutantHtt, are related to…

Show Full Abstract

<h4>Background</h4>Despite extensive work to identify diagnostic plasma markers for Parkinson's disease (PD), there are still no accepted and validated surrogate biomarkers. Mitophagy-associated proteins (MAPs), including PTEN-induced putative kinase 1 (PINK1), Parkin, phosphoglycerate mutase 5 (PGAM5), BCL2 interacting protein 3 (BNIP3), and phosphorylated-TBK1 (p-TBK1), are, to our best knowledge, not well studied as a panel of biomarkers of neurodegeneration in PD.<h4>Methods</h4>The study population comprised 116 age-matched controls (HC), 179 PD patients, alongside and 90 PD syndromes (PDs) divided between two cohorts: (i) the modeling cohort (cohort 1), including 150 PD, 97 HC, and 80 PDs; and (ii) the validated cohort (cohort 2), including 29 PD, 19 HC, and 10 PDs.<h4>Results</h4>MAPs are elevated in the plasma of PD patients. PINK1, Parkin, and PGAM5 displayed the top three measurable increase trends in amplitude compared to BNIP3 and p-TBK1. Moreover, the area under the curve (AUC) values of PINK1, PGAM5, and Parkin were ranked the top three MAP candidates in diagnosis accuracy for PD from HC, but the MAPs make it hard to differentiate PD from PDs. In addition, there are higher plasma PINK1-Parkin levels and prominent diagnostic accuracy in A-synuclein (+) subjects than in A-synuclein (-) subjects.<h4>Conclusions</h4>These results uncover that plasma MAPs (PINK1, Parkin, and PGAM5) may be potentially useful diagnostic biomarkers for PD diagnosis. Studies on larger cohorts would be required to test whether elevated plasma MAP levels are related to PD risk or prognosis.

HFE
Also flagged:HaemochromatosisHCgenetic disordersHJVHAMPTFR2
Journal Article 2023-11-21 ✓ 5 Snippets Corti P, Ferrari GM, Faraguna MC, Capitoli G, Longo F, Corradini E, Casini T, Boscarol G, Pinto VM, Ghilardi R, Russo G, Colombatti R, Mariani R, Piperno A.
In-Text Gene Mentions

HFE-HC is by far…

…in adults, while non-HFEtypes are rare…

…(10 cases ofHFE-, 5 TFR2-, 9…

…the adult population, non-HFE-HC constitutes 58% (14/24)…

…MostHFE-HC subjects had relatively…

Show Full Abstract

Haemochromatosis (HC) encompasses a range of genetic disorders. HFE-HC is by far the most common in adults, while non-HFE types are rare due to mutations of HJV, HAMP, TFR2 and gain-of-function mutations of SLC40A1. HC is often unknown to paediatricians as it is usually asymptomatic in childhood. We report clinical and biochemical data from 24 paediatric cases of HC (10 cases of HFE-, 5 TFR2-, 9 HJV-HC), with a median follow-up of 9.6 years. Unlike in the adult population, non-HFE-HC constitutes 58% (14/24) of the population in our series. Transferrin saturation was significantly higher in TFR2- and HJV-HC compared to HFE-HC, and serum ferritin and LIC were higher in HJV-HC compared to TFR2- and HFE-HC. Most HFE-HC subjects had relatively low ferritin and LIC at the time of diagnosis, so therapy could be postponed for most of them after the age of 18. Our results confirm that HJV-HC is a severe form already in childhood, emphasizing the importance of early diagnosis and treatment to avoid the development of organ damage and reduce morbidity and mortality. Although phlebotomies were tolerated by most patients, oral iron chelators could be a valid option in early-onset HC.

Also flagged:tumorCD36cancercolorectal cancerAlpha smooth muscle actinActin alpha 2
Journal Article 2023-11-21 No Snippets Wang J, Xi MJ, Lu Q, Xia BH, Liu YZ, Yang JL.
Show Full Abstract

No abstract available.

SERPINC1
Also flagged:prostate cancerAldehyde Dehydrogenase 1 Family Member A1Anaphase Promoting Complex Subunit 1Ataxia telangiectasia mutatedAxin2BRCA1 associated RING domain 1
Journal Article 2023-11-21 ✓ 1 Snippet Chica-Redecillas L, Cuenca-Lopez S, Andres-Leon E, Terron-Camero LC, Cano-Gutierrez B, Cozar JM, Lorente JA, Vazquez-Alonso F, Martinez-Gonzalez LJ, Alvarez-Cubero MJ.
In-Text Gene Mentions

Kinesin Family Member C1Family Member C1…

Show Full Abstract

No abstract available.

HTT
Also flagged:choreaHuntington's diseaseHDcytosineadenineguanine
Journal Article 2023-11-21 ✓ 3 Snippets Kim R, Seong MW, Oh B, Shin HS, Lee JS, Park S, Jang M, Jeon B, Kim HJ, Lee JY.
In-Text Gene Mentions

<h4>Background</h4>Although the epidemiology of Huntington's disease (HD) in Korea differs notably from that in Western countries, the genetic disparities between these regions remain unclear.<h4>Objective</h4>To investigate the characteristics and clinical significance of cytosine-adenine-guanine (CAG) repeat size associated with HD in the Korean population.<h4>Methods</h4>We analyzed the CAG repeat lengths of the HTT gene in 941 healthy individuals (1,882 alleles) and 954 patients with chorea (1,908 alleles) from two referral hospitals in Korea.

…lengths of theHTTgene in 941…

…lengths in theHTTgene in the…

Show Full Abstract

<h4>Background</h4>Although the epidemiology of Huntington's disease (HD) in Korea differs notably from that in Western countries, the genetic disparities between these regions remain unclear.<h4>Objective</h4>To investigate the characteristics and clinical significance of cytosine-adenine-guanine (CAG) repeat size associated with HD in the Korean population.<h4>Methods</h4>We analyzed the CAG repeat lengths of the HTT gene in 941 healthy individuals (1,882 alleles) and 954 patients with chorea (1,908 alleles) from two referral hospitals in Korea. We presented normative CAG repeat length data for the Korean population and computed the reduced penetrance (36-39 CAG) and intermediate allele (27-35 CAG) frequencies in the two groups. Furthermore, we investigated the relationship between intermediate alleles and chorea development using logistic regression models in individuals aged ≥55 years.<h4>Results</h4>The mean (±standard deviation) CAG repeat length in healthy individuals was 17.5 ± 2.0, with a reduced penetrance allele frequency of 0.05 % (1/1882) and intermediate allele frequency of 0.69 % (13/1882). We identified 213 patients with genetically confirmed HD whose CAG repeat length ranged from 39 to 140, with a mean of 45.2 ± 7.9 in the longer allele. Compared with normal CAG repeat alleles, intermediate CAG repeat alleles were significantly related to a higher risk of developing chorea (age of onset range, 63-84 years) in individuals aged ≥55 years.<h4>Conclusions</h4>This study provides insights into the specific characteristics of CAG repeat lengths in the HTT gene in the Korean population. The reduced penetrance and intermediate allele frequencies in the Korean general population seem to be lower than those reported in Western populations. The presence of intermediate alleles may increase the risk of chorea in the Korean elderly population, which requires further large-scale investigations.

Also flagged:tumornon-small-cell lung cancerNSCLCcolorectal cancerlung cancertumors
Journal Article 2023-11-21 No Snippets Tran HT, Heeke S, Sujit S, Vokes N, Zhang J, Aminu M, Lam VK, Vaporciyan A, Swisher SG, Godoy MCB, Cascone T, Sepesi B, Gibbons DL, Wu J, Heymach JV.
Show Full Abstract

<h4>Background</h4>Predicting relapse and overall survival (OS) in early-stage non-small-cell lung cancer (NSCLC) patients remains challenging. Therefore, we hypothesized that detection of circulating tumor DNA (ctDNA) can identify patients with increased risk of relapse and that integrating radiological tumor volume measurement along with ctDNA detectability improves prediction of outcome.<h4>Patients and methods</h4>We analyzed 366 serial plasma samples from 85 patients who underwent surgical resections and assessed ctDNA using a next-generation sequencing liquid biopsy assay, and measured tumor volume using a computed tomography-based three-dimensional annotation.<h4>Results</h4>Our results showed that patients with detectable ctDNA at baseline or after treatment and patients who did not clear ctDNA after treatment had a significantly worse clinical outcome. Integrating radiological analysis allowed the stratification in risk groups prognostic of clinical outcome as confirmed in an independent cohort of 32 patients.<h4>Conclusions</h4>Our findings suggest ctDNA and radiological monitoring could be valuable tools for guiding follow-up care and treatment decisions for early-stage NSCLC patients.

Also flagged:HNF4αinflammatory liver diseasecarbon tetrachloridechromatintranscription factorTF
Journal Article 2023-11-21 No Snippets Melis M, Marino R, Tian J, Johnson C, Sethi R, Oertel M, Fox IJ, Locker J.
Show Full Abstract

<h4>Background & aims</h4>HNF4α, a master regulator of liver development and the mature hepatocyte phenotype, is down-regulated in chronic and inflammatory liver disease. We used contemporary transcriptomics and epigenomics to study the cause and effects of this down-regulation and characterized a multicellular etiology.<h4>Methods</h4>Progressive changes in the rat carbon tetrachloride model were studied by deep RNA sequencing and genome-wide chromatin immunoprecipitation sequencing analysis of transcription factor (TF) binding and chromatin modification. Studies compared decompensated cirrhosis with liver failure after 26 weeks of treatment with earlier compensated cirrhosis and with additional rat models of chronic fibrosis. Finally, to resolve cell-specific responses and intercellular signaling, we compared transcriptomes of liver, nonparenchymal, and inflammatory cells.<h4>Results</h4>HNF4α was significantly lower in 26-week cirrhosis, part of a general reduction of TFs that regulate metabolism. Nevertheless, increased binding of HNF4α contributed to strong activation of major phenotypic genes, whereas reduced binding to other genes had a moderate phenotypic effect. Decreased Hnf4a expression was the combined effect of STAT3 and nuclear factor kappa B (NFκB) activation, which similarly reduced expression of other metabolic TFs. STAT/NFκB also induced de novo expression of Osmr by hepatocytes to complement induced expression of Osm by nonparenchymal cells.<h4>Conclusions</h4>Liver decompensation by inflammatory STAT3 and NFκB signaling was not a direct consequence of progressive cirrhosis. Despite significant reduction of Hnf4a expression, residual levels of this abundant TF still stimulated strong new gene expression. Reduction of HNF4α was part of a broad hepatocyte transcriptional response to inflammation.

B4GALT5
Also flagged:Hepatocellular carcinomacancerliver tumortumorextracellularECM proteins
Journal Article 2023-11-21 ✓ 1 Snippet Liu C, Jia Y, Zhao X, Wang Z, Zhu X, Zhang C, Li X, Zhao X, Gong T, Zhao H, Zhang D, Niu Y, Dong X, Li G, Li F, Zhang H, Zhang L, Xu J, Yu B.
In-Text Gene Mentions

…4-galactosyltransferase 1) andB4GALT5(beta-1,4-galactosyltransferas…

Show Full Abstract

<h4>Background</h4>As a three-dimensional network involving glycosaminoglycans (GAGs), proteoglycans (PGs) and other glycoproteins, the role of extracellular matrix (ECM) in tumorigenesis is well revealed. Abnormal glycosylation in liver cancer is correlated with tumorigenesis and chemoresistance. However, the role of galactosyltransferase in HCC (hepatocellular carcinoma) is largely unknown.<h4>Methods</h4>Here, the oncogenic functions of B4GALT7 (beta-1,4-galactosyltransferase 7) were identified in HCC by a panel of <i>in vitro</i> experiments, including MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), colony formation, transwell and flow cytometry assay. The expression of B4GALT7 in HCC cell lines and tissues were examined by qPCR (real-time quantitative polymerase chain reaction) and western blot assay. The binding between B4GALT7 and miR-338-3p was examined by dual-luciferase reporter assay.<h4>Results</h4>B4GALT7 encodes galactosyltransferase I and it is highly expressed in HCC cells and human HCC tissues compared with para-tumor specimens. MiR-338-3p was identified to bind the 3' UTR (untranslated region) of B4GALT7. Highly expressed miR-338-3p suppressed HCC cell invasive abilities and rescued the tumor-promoting effect of B4GALT7 in HCC. ShRNA (short hairpin RNA) mediated B4GALT7 suppression reduced HCC cell invasive abilities, and inhibited the expression of MMP-2 and Erk signaling.<h4>Conclusion</h4>These findings identified B4GALT7 as a potential prognostic biomarker and therapeutic target for HCC.

SOX6
Also flagged:SOX8tumorFZD6Wntcolorectal carcinomacell proliferation
Journal Article 2023-11-21 ✓ 2 Snippets Li C, Cheng B, Yang X, Tong G, Wang F, Li M, Wang X, Wang S.
In-Text Gene Mentions

Knockdown of SOX8 inhibits cell proliferation, migration, and invasion, suggesting the oncogenic roles of SOX6 in CRC development.

…oncogenic roles ofSOX6in CRC development.…

Show Full Abstract

SOX8 plays an important role in several physiological processes. Its expression is negatively associated with overall survival in patients with colorectal carcinoma (CRC), suggesting SOX8 is a potential prognostic factor for this disease. However, the role of SOX8 in CRC remains largely unknown. In this study, our data showed that <i>SOX8</i> expression was upregulated in CRC cell lines and tumor tissues. Stable knockdown of <i>SOX8</i> in CRC cell lines dramatically reduced cell proliferation, migration, and invasion. Furthermore, the knockdown of <i>SOX8</i> decreased the phospho-GSK3β level and suppressed Frizzled-6 (FZD6) transcription; restoration of <i>FZD6</i> expression partially abolished the effect of SOX8 on Wnt/β-catenin signaling and promote CRC cell proliferation. In conclusion, our findings suggested that SOX8 served as an oncogene in CRC through the activation of FZD6-dependent Wnt/β-catenin signaling.

Also flagged:deathsepsisinfectioninflammatory responseimmune responsefibrinolysis
Journal Article 2023-11-21 No Snippets Wang X, Li R, Qian S, Yu D.
Show Full Abstract

Severe sepsis causes organ dysfunction and continues to be the leading reason for pediatric death worldwide. Early recognition of sepsis could substantially promote precision treatment and reduce the risk of pediatric death. The host cellular response to infection during sepsis between adults and pediatrics could be significantly different. A growing body of studies focused on finding markers in pediatric sepsis in recent years using multi-omics approaches. This narrative review summarized the progress in studying pediatric sepsis biomarkers from genome, transcript, protein, and metabolite levels according to the omics technique that has been applied for biomarker screening. It is most likely not a single biomarker could work for precision diagnosis of sepsis, but a panel of markers and probably a combination of markers detected at multi-levels. Importantly, we emphasize the importance of group distinction of infectious agents in sepsis patients for biomarker identification, because the host response to infection of bacteria, virus, or fungus could be substantially different and thus the results of biomarker screening. Further studies on the investigation of sepsis biomarkers that were caused by a specific group of infectious agents should be encouraged in the future, which will better improve the clinical execution of personalized medicine for pediatric sepsis.

CCPG1
Also flagged:Gene ExpressionAge-related macular degenerationblindnessneovascular AMDNEOtranscription factors
Journal Article 2023-11-21 ✓ 1 Snippet Shwani T, Zhang C, Owen LA, Shakoor A, Vitale AT, Lillvis JH, Barr JL, Cromwell P, Finley R, Husami N, Au E, Zavala RA, Graves EC, Zhang SX, Farkas MH, Ammar DA, Allison KM, Tawfik A, Sherva RM, Li M, Stambolian D, Kim IK, Farrer LA, DeAngelis MM.
In-Text Gene Mentions

…genes, 8 genes,CCPG1, GALNT15 ,…

Show Full Abstract

Age-related macular degeneration (AMD) is a leading cause of blindness, and elucidating its underlying disease mechanisms is vital to the development of appropriate therapeutics. We identified differentially expressed genes (DEGs) and differentially spliced genes (DSGs) across the clinical stages of AMD in disease-affected tissue, the macular retina pigment epithelium (RPE)/choroid and the macular neural retina within the same eye. We utilized 27 deeply phenotyped donor eyes (recovered within a 6 h postmortem interval time) from Caucasian donors (60-94 years) using a standardized published protocol. Significant findings were then validated in an independent set of well-characterized donor eyes (<i>n</i> = 85). There was limited overlap between DEGs and DSGs, suggesting distinct mechanisms at play in AMD pathophysiology. A greater number of previously reported AMD loci overlapped with DSGs compared to DEGs between disease states, and no DEG overlap with previously reported loci was found in the macular retina between disease states. Additionally, we explored allele-specific expression (ASE) in coding regions of previously reported AMD risk loci, uncovering a significant imbalance in <i>C3</i> rs2230199 and <i>CFH</i> rs1061170 in the macular RPE/choroid for normal eyes and intermediate AMD (iAMD), and for <i>CFH</i> rs1061147 in the macular RPE/choroid for normal eyes and iAMD, and separately neovascular AMD (NEO). Only significant DEGs/DSGs from the macular RPE/choroid were found to overlap between disease states. <i>STAT1</i>, validated between the iAMD vs. normal comparison, and <i>AGTPBP1</i>, <i>BBS5</i>, <i>CERKL</i>, <i>FGFBP2</i>, <i>KIFC3</i>, <i>RORα</i>, and <i>ZNF292</i>, validated between the NEO vs. normal comparison, revealed an intricate regulatory network with transcription factors and miRNAs identifying potential upstream and downstream regulators. Findings regarding the complement genes <i>C3</i> and <i>CFH</i> suggest that coding variants at these loci may influence AMD development via an imbalance of gene expression in a tissue-specific manner. Our study provides crucial insights into the multifaceted genomic underpinnings of AMD (i.e., tissue-specific gene expression changes, potential splice variation, and allelic imbalance), which may open new avenues for AMD diagnostics and therapies specific to iAMD and NEO.

Also flagged:waterhydroxyapatiteimmune responsedrugtitanium nanotubessilicon
Journal Article 2023-11-21 No Snippets Zhumabayeva G, Turebayeva P, Ukhov A, Fedorishin D, Gubankov A, Luchsheva V, Kurzina I, Bakibaev A, Ryskaliyeva R, Abdullina G, Bolysbekova S, Yerkassov R.
Show Full Abstract

In this present investigation, a novel series of composite materials based on porous inorganic compounds-hydroxyapatite and diatomite-have been innovatively formulated for the first time through surface modification employing the promising macromolecular compound, bambus[6]uril. The process entailed the application of a bambus[6]uril dispersion in water onto the surfaces of hydroxyapatite and diatomite. Extensive characterization was carried out, involving IR spectroscopy and SEM. The materials underwent assessment for hemolytic effects and plasma protein adsorption. The results revealed that materials containing surface-bound bambus[6]uril did not demonstrate inherent hemolytic effects, laying a robust groundwork for their use as biocompatible materials. These findings hold significant promise as an alternative pathway for the development of durable and efficient bio-composites, potentially unveiling supramolecular strategies incorporating encapsulated bambus[6]urils in analogous processes.

Also flagged:bacterial infectionsphage infectioninfectionsimmune responsewatersecretions
Journal Article 2023-11-21 No Snippets Nikolic N, Anagnostidis V, Tiwari A, Chait R, Gielen F.
Show Full Abstract

An alarming rise in antimicrobial resistance worldwide has spurred efforts into the search for alternatives to antibiotic treatments. The use of bacteriophages, bacterial viruses harmless to humans, represents a promising approach with potential to treat bacterial infections (phage therapy). Recent advances in microscopy-based single-cell techniques have allowed researchers to develop new quantitative methodologies for assessing the interactions between bacteria and phages, especially the ability of phages to eradicate bacterial pathogen populations and to modulate growth of both commensal and pathogen populations. Here we combine droplet microfluidics with fluorescence time-lapse microscopy to characterize the growth and lysis dynamics of the bacterium <i>Escherichia coli</i> confined in droplets when challenged with phage. We investigated phages that promote lysis of infected <i>E. coli</i> cells, specifically, a phage species with DNA genome, T7 (<i>Escherichia virus T7</i>) and two phage species with RNA genomes, MS2 (<i>Emesvirus zinderi</i>) and Qβ (<i>Qubevirus durum</i>). Our microfluidic trapping device generated and immobilized picoliter-sized droplets, enabling stable imaging of bacterial growth and lysis in a temperature-controlled setup. Temporal information on bacterial population size was recorded for up to 25 h, allowing us to determine growth rates of bacterial populations and helping us uncover the extent and speed of phage infection. In the long-term, the development of novel microfluidic single-cell and population-level approaches will expedite research towards fundamental understanding of the genetic and molecular basis of rapid phage-induced lysis and eco-evolutionary aspects of bacteria-phage dynamics, and ultimately help identify key factors influencing the success of phage therapy.

HTT
Also flagged:flavonoidluteolinneurodegenerative disordercytoplasmnucleusneuroblastoma
Journal Article 2023-11-21 ✓ 5 Snippets Ramadan A, Mohammed A, Elnour AA, Sadeq A, Al Mazrouei N, Alkaabi M, Al-Kubaisi KA, Beshir SA, Menon V, AlAmoodi A, Sam KG, Saeed AAAM, Abdalla SF, Hussein SM.
In-Text Gene Mentions

luteolin-mediated reduction of brain cell death was also observed in HD transgenic fly lines that express the first coding exon of human htt encoding 96 glutamines.

Briefly, the cells were plated in 96-well plates and transfected with the plasmids encoding an N-terminal fragment of htt containing 20Q (htt20Q) or 160Q (htt160Q), followed by luteolin or vehicle treatment for 48 h.

Total RNA from the mutant and wild-type htt cells treated with luteolin or vehicle was prepared using TRIZOL reagent (Invitrogen) according to the manufacturer's instructions.

Accordingly, 48 h was used as a time point to examine the protective efficacy of luteolin treatment against mutant htt aggregates.

Our study aims to investigate the neuroprotective effects of luteolin and the mechanisms that underline its potential mediated protection in the mutant htt neuroblastoma cells.

Show Full Abstract

<h4>Background</h4>Huntington's disease is an inherited progressive neurodegenerative disorder caused by an expansion of the polyglutamine tract leading to malformation and aggregation of the mutant huntingtin protein in the cell cytoplasm and nucleus of affected brain regions. The development of neuroprotective agents from plants has received considerable research attention.<h4>Objective</h4>Our study aims to investigate the neuroprotective effects of luteolin and the mechanisms that underline its potential mediated protection in the mutant htt neuroblastoma cells.<h4>Methods</h4>The mutant htt neuroblastoma cells were transfected with 160Q, and the control wild-type neuroblastoma cells were transfected with 20Q htt for 24 h and later treated with luteolin. Cell viability was determined by MTT and PI staining in both groups, while western blotting was used to evaluate caspase 3 protein expression. Aggregation formation was assessed via immunofluorescence microscopy. Also, western blotting was utilized to measure the protein expression of mutant htt aggregated and soluble protein, Nrf2 and HO-1. The impact of Nrf2 on luteolin-treated neuroblastoma cells was assessed using small interfering RNAs.<h4>Results</h4>Our study reports that luteolin can protect cultured cells from mutant huntingtin cytotoxicity, evidenced by increased viability and decreased apoptosis. Also, luteolin reduced the accumulation of soluble and insoluble mutant huntingtin aggregates in mutant htt neuroblastoma cells transfected with 160Q compared to the control wild-type. The mutant htt aggregate reduction mediated by luteolin appeared to be independent of the Nrf2 -HO-1 antioxidant pathway.<h4>Conclusion</h4>Luteolin presents a new potential therapeutic and protective agent for the treatment and decreasing the cytotoxicity in neurodegenerative diseases such as Huntington's disease.

HFE
Also flagged:Ventricular TachycardiaSarcoidosisVTleft ventricular systolic dysfunctionnonischemicdilated cardiomyopathy
Journal Article 2023-11-21 ✓ 2 Snippets Puglla Sánchez LR, De Escalante Yangüela B, Escota-Villanueva J, Vallejo Grijalba J, Samaniego Pesántez DJ.
In-Text Gene Mentions

…as Fabry disease,hemochromatosis, or infections such…

…diseases such ashemochromatosis, Fabry disease, autoimmune…

Show Full Abstract

A 47-year-old male was referred for rapid palpitations and an electrocardiogram compatible with sustained monomorphic ventricular tachycardia (VT) that required synchronized electrical cardioversion due to hemodynamic instability. After the initial clinical certainty, an etiological search is carried out. The transthoracic echocardiogram (TTE) revealed moderate dilatation and left ventricular systolic dysfunction due to global hypokinesia. Coronary angiography did not show significant coronary stenosis. Cardiac magnetic resonance (CMR) guarantees a nonischemic dilated cardiomyopathy with moderate systolic dysfunction and a pattern of subepicardial and intramyocardial late gadolinium enhancement (LGE) in medial-lateral and median inferolateral segments. Lastly, a positron emission tomography-computed tomography (PET-CT) scan showed diffuse fixation of the radiotracer in the left ventricular (LV) walls, with greater uptake on the lateral and inferolateral surfaces of inflammatory origin. After ruling out other alternative pathologies and according to current diagnostic criteria, the clinical judgment of probable isolated cardiac sarcoidosis (ICS) is established. An implantable cardioverter-defibrillator was implanted as secondary prevention of the acute arrhythmic event. Specific treatment for systolic dysfunction was prescribed, as well as immunosuppressive therapy with corticosteroids and methotrexate, after which the patient remained in clinical remission, with disappearance of active inflammation on cardiac imaging tests and progressive ventricular systolic function. The initial diagnosis of isolated cardiac sarcoidosis can be complex and challenging, especially in those patients in whom the diagnosis of extracardiac sarcoidosis has not been previously established. The limitations of endomyocardial biopsy in this entity make it necessary to have a high index of clinical suspicion with the early use of new cardiac imaging techniques and to include this picture in the differential diagnosis of patients with sustained ventricular arrhythmias or left ventricular systolic dysfunction of nonspecific etiology clarified. Early initiation of aggressive immunosuppressive therapy has been shown to prevent disease progression and limit its potential cardiac complications.

Also flagged:Zinccell divisiontissue growthwound healingneurotransmissionimmune response
Journal Article 2023-11-21 No Snippets Dean MC, Garrevoet J, Van Malderen SJM, Santos F, Mirazón Lahr M, Foley R, Le Cabec A.
Show Full Abstract

Zinc is incorporated into enamel, dentine and cementum during tooth growth. This work aimed to distinguish between the processes underlying Zn incorporation and Zn distribution. These include different mineralisation processes, the physiological events around birth, Zn ingestion with diet, exposure to the oral environment during life and diagenetic changes to fossil teeth <i>post-mortem</i>. Synchrotron X-ray Fluorescence (SXRF) was used to map zinc distribution across longitudinal polished ground sections of both deciduous and permanent modern human, great ape and fossil hominoid teeth. Higher resolution fluorescence intensity maps were used to image Zn in surface enamel, secondary dentine and cementum, and at the neonatal line (NNL) and enamel-dentine-junction (EDJ) in deciduous teeth. Secondary dentine was consistently Zn-rich, but the highest concentrations of Zn (range 197-1743 ppm) were found in cuspal, mid-lateral and cervical surface enamel and were similar in unerupted teeth never exposed to the oral environment. Zinc was identified at the NNL and EDJ in both modern and fossil deciduous teeth. In fossil specimens, diagenetic changes were identified in various trace element distributions but only demineralisation appeared to markedly alter Zn distribution. Zinc appears to be tenacious and stable in fossil tooth tissues, especially in enamel, over millions of years.

OLFM4
Also flagged:Idiopathic Pulmonary Fibrosischroniclung diseasepathogenesisGene Expressiontranscription factors
Journal Article 2023-11-21 ✓ 5 Snippets Giriyappagoudar M, Vastrad B, Horakeri R, Vastrad C.
In-Text Gene Mentions

Involvement of highly significant DEGs including SLCO1A2 [52], OLFM4 [53], RTKN2 [54], CYP1A1 [55], and MUC5AC [56] plays a key role in rheumatoid arthritis development.Highly significant DEGs including OLFM4 [57], RTKN2 [58], CYP1A1 [59], MUC5AC [60], CYP2A6 [61], PCK1 [62], and PITX1 [63] have been reported to encourage the development of lung cancer.

…[ 52 ],OLFM4[ 53 ],…

…significant DEGs includingOLFM4[ 57 ],…

…demonstrated that theOLFM4[ 64 ]…

…significant DEGs includingOLFM4[ 65 ]…

Show Full Abstract

Idiopathic pulmonary fibrosis (IPF) is a chronic progressive lung disease with reduced quality of life and earlier mortality, but its pathogenesis and key genes are still unclear. In this investigation, bioinformatics was used to deeply analyze the pathogenesis of IPF and related key genes, so as to investigate the potential molecular pathogenesis of IPF and provide guidance for clinical treatment. Next-generation sequencing dataset GSE213001 was obtained from Gene Expression Omnibus (GEO), and the differentially expressed genes (DEGs) were identified between IPF and normal control group. The DEGs between IPF and normal control group were screened with the DESeq2 package of R language. The Gene Ontology (GO) and REACTOME pathway enrichment analyses of the DEGs were performed. Using the g:Profiler, the function and pathway enrichment analyses of DEGs were performed. Then, a protein-protein interaction (PPI) network was constructed via the Integrated Interactions Database (IID) database. Cytoscape with Network Analyzer was used to identify the hub genes. miRNet and NetworkAnalyst databaseswereused to construct the targeted microRNAs (miRNAs), transcription factors (TFs), and small drug molecules. Finally, receiver operating characteristic (ROC) curve analysis was used to validate the hub genes. A total of 958 DEGs were screened out in this study, including 479 up regulated genes and 479 down regulated genes. Most of the DEGs were significantly enriched in response to stimulus, GPCR ligand binding, microtubule-based process, and defective GALNT3 causes HFTC. In combination with the results of the PPI network, miRNA-hub gene regulatory network and TF-hub gene regulatory network, hub genes including LRRK2, BMI1, EBP, MNDA, KBTBD7, KRT15, OTX1, TEKT4, SPAG8, and EFHC2 were selected. Cyclothiazide and rotigotinethe are predicted small drug molecules for IPF treatment. Our findings will contribute to identification of potential biomarkers and novel strategies for the treatment of IPF, and provide a novel strategy for clinical therapy.

Also flagged:metal ionscardiovascular diseasecardiovascular diseasesangiogenesision channelsions
Journal Article 2023-11-21 No Snippets Hong X, Tian G, Zhu Y, Ren T.
Show Full Abstract

Metal ions participate in many metabolic processes in the human body, and their homeostasis is crucial for life. In cardiovascular diseases (CVDs), the equilibriums of metal ions are frequently interrupted, which are related to a variety of disturbances of physiological processes leading to abnormal cardiac functions. Exogenous supplement of metal ions has the potential to work as therapeutic strategies for the treatment of CVDs. Compared with other therapeutic drugs, metal ions possess broad availability, good stability and safety and diverse drug delivery strategies. The delivery strategies of metal ions are important to exert their therapeutic effects and reduce the potential toxic side effects for cardiovascular applications, which are also receiving increasing attention. Controllable local delivery strategies for metal ions based on various biomaterials are constantly being designed. In this review, we comprehensively summarized the positive roles of metal ions in the treatment of CVDs from three aspects: protecting cells from oxidative stress, inducing angiogenesis, and adjusting the functions of ion channels. In addition, we introduced the transferability of metal ions in vascular reconstruction and cardiac tissue repair, as well as the currently available engineered strategies for the precise delivery of metal ions, such as integrated with nanoparticles, hydrogels and scaffolds.

Also flagged:cytotoxic T-lymphocyte-associated protein 4programmed death 1programmed death ligand 1cancertumormelanoma
Journal Article 2023-11-21 No Snippets Liu Y, Altreuter J, Bodapati S, Cristea S, Wong CJ, Wu CJ, Michor F.
Show Full Abstract

Immune checkpoint blockade (ICB) therapy targeting cytotoxic T-lymphocyte-associated protein 4, programmed death 1, and programmed death ligand 1 has shown durable remission and clinical success across different cancer types. However, patient outcomes vary among disease indications. Studies have identified prognostic biomarkers associated with immunotherapy response and patient outcomes derived from diverse data types, including next-generation bulk and single-cell DNA, RNA, T cell and B cell receptor sequencing data, liquid biopsies, and clinical imaging. Owing to inter- and intra-tumor heterogeneity and the immune system's complexity, these biomarkers have diverse efficacy in clinical trials of ICB. Here, we review the genetic and genomic signatures and image features of ICB studies for pan-cancer applications and specific indications. We discuss the advantages and disadvantages of computational approaches for predicting immunotherapy effectiveness and patient outcomes. We also elucidate the challenges of immunotherapy prognostication and the discovery of novel immunotherapy targets.

bioRxiv 2023-11-21 Preprint (No Snippets API) Di Gioia M, Poli V, Tan PJ, Spreafico R, Chu A, Cuenca AG, Gordts PL, Pandolfi L, Meloni F, Witztum JL, Chou J, Springstead JR, Zanoni I.
Show Full Abstract

Macrophages detect invading microorganisms via pattern recognition receptors that recognize pathogen-associated molecular patterns, or via sensing the activity of virulence factors that initiates effector-triggered immunity (ETI). Tissue damage that follows pathogen encounter leads to the release of host-derived factors that participate to inflammation. How these self -derived molecules are sensed by macrophages and their impact on immunity remain poorly understood. Here we demonstrate that, in mice and humans, host-derived oxidized phospholipids (oxPLs) are formed upon microbial encounter. oxPL blockade restricts inflammation and prevents the death of the host, without affecting pathogen burden. Mechanistically, oxPLs bind and inhibit AKT, a master regulator of immunity and metabolism. AKT inhibition potentiates the methionine cycle, and epigenetically dampens Il10 , a pluripotent anti-inflammatory cytokine. Overall, we found that host-derived inflammatory cues act as “ self ” virulence factors that initiate ETI and that their activity can be targeted to protect the host against excessive inflammation upon microbial encounter.

bioRxiv 2023-11-21 Preprint (No Snippets API) Bahat A, Itzhaki E, Weiss B, Tolmasov M, Tsoory M, Kuperman Y, Brandis A, Shurrush KA, Dikstein R.
Show Full Abstract

Huntington’s disease (HD) is an incurable inherited disorder caused by repeat expansion in the huntingtin gene ( Htt ). The mutant protein causes neuronal degeneration leading to severe motor and psychological abnormalities. Selective downregulation of the mutant Htt expression is considered the leading therapeutic approach for HD. We report the identification of novel small molecule inhibitors of Spt5-Pol II, SPI-24 and SPI-77, which selectively lower mutant Htt mRNA and protein levels in HD cells. In the BACHD mouse model, their direct delivery to the striatum diminished mutant Htt levels, ameliorated mitochondrial dysfunction, restored BDNF expression and improved motor and anxious-like phenotypes. Pharmacokinetic studies revealed that these SPIs pass the blood-brain-barrier and prolonged subcutaneous injection or oral administration to early-stage mice significantly delayed disease deterioration. SPI-24 long-term treatment had no side effects or global changes in gene expression. Thus, lowering mutant Htt levels by small molecules can be an effective therapeutic strategy for HD.

Preprints.org 2023-11-21 Preprint (No Snippets API) Pfäffle SP, Herz C, Brombacher E, Proietti M, Gigl M, Hofstetter CK, Mittermeier-Kleßinger VK, Claßen S, Tran HTT, Dawid C, Kreutz C, Günther S, Lamy E.
Show Full Abstract

Despite substantial heterogeneity of studies, there is evidence that antibiotics commonly used in primary care influence the composition of the gastrointestinal microbiota in terms of changing the composition and/or diversity. Benzyl isothiocyanate (BITC) from the food and medicinal plant nasturtium (Tropaeolum majus) is known for its antimicrobial activity and is used for the treatment against infections of the draining urinary tract and upper respiratory tract. Against this background, we raised the question whether 14 d nasturtium intervention (3 g daily, N=30 healthy females) could also impact the normal gut microbiota composition. Spot urinary BITC excretion highly correlated with a weak, but significant antibacterial effect against Escherichia coli. A significant increase in human beta defensin 1 as parameter for host defense was seen in urine and exhaled breath condensate (EBC) upon verum intervention. Pre-to-post analysis revealed that mean gut microbiome composition did not significantly differ between groups, nor did circulating serum metabolome. On an individual level, partly large changes were observed between sampling points, though. Explorative Spearman rank correlation analysis in subgroups revealed associations between gut microbiota and the circulating metabolome, as well as between changes in blood markers and bacterial gut species.

SOX6
Also flagged:axonaltranscription factorsmechanistic target of rapamycin complex 1mTORC1axoninnervation
Journal Article 2023-11-20 ✓ 1 Snippet Gonda S, Riedel C, Reiner A, Köhler I, Wahle P.
In-Text Gene Mentions

Sox6is required for…

Show Full Abstract

Neuronal differentiation is regulated by neuronal activity. Here, we analyzed dendritic and axonal growth of Basket cells (BCs) and non-Basket cells (non-BCs) using sparse transfection of channelrhodopsin-YFP and repetitive optogenetic stimulation in slice cultures of rat visual cortex. Neocortical interneurons often display axon-carrying dendrites (AcDs). We found that the AcDs of BCs and non-BCs were, on average, the most complex dendrites. Further, the AcD configuration had an influence on BC axonal development. Axons originating from an AcD formed denser arborizations with more terminal endings within the dendritic field of the parent cell. Intriguingly, this occurred already in unstimulated BCs, and complexity was not increased further by optogenetic stimulation. However, optogenetic stimulation exerted a growth-promoting effect on axons emerging from BC somata. The axons of non-BCs neither responded to the AcD configuration nor to the optogenetic stimulation. The results suggest that the formation of locally dense BC plexuses is regulated by spontaneous activity. Moreover, in the AcD configuration, the AcD and the axon it carries mutually support each other's growth.

HTT
Also flagged:Neurodegenerative diseasescognitionAlzheimer's diseaseADParkinson's diseasePD
Journal Article 2023-11-20 ✓ 5 Snippets Na D, Lim DH, Hong JS, Lee HM, Cho D, Yu MS, Shaker B, Ren J, Lee B, Song JG, Oh Y, Lee K, Oh KS, Lee MY, Choi MS, Choi HS, Kim YH, Bui JM, Lee K, Kim HW, Lee YS, Gsponer J.
In-Text Gene Mentions

To establish fly eye models for AD, HD, SCA1, and SCA3, we expressed the respective disease‐causing genes in the developing eyes using the GMR‐GAL4 driver; Aβ1‐42 for AD, Htt‐Q128 for HD, Ataxin1‐Q82 for SCA1, and Ataxin3‐Q78 for SCA3.

To generate Drosophila eye models for AD, HD, SCA1, and SCA3 using the GAL4/UAS transactivation system (Brand & Perrimon, 1993), the GMR‐GAL4 driver line was crossed to the UAS‐transgene lines being analyzed: UAS‐Aβ42 (BL33769) for AD, UAS‐HTT‐128Q (BL33808) for HD, UAS‐ATX1‐82Q (BL39740) for SCA1 (Fernandez‐Funez et al, 2000), and UAS‐MJDtr‐78Q (BL8150) for SCA3 (Warrick et al, 1998).

In a first test, we constructed human cell‐based models for AD, HD, SCA1, and SCA3 by expressing ND‐causing genes (Aβ1–42, Htt‐Q74, Atx1‐Q52, and Atx3‐Q84) in HEK293 cells and evaluated the impact of Akt1 activation on cell phenotypes.

…1‐42 for AD,Htt‐Q128 for HD, Ataxin1‐Q82…

…(Aβ 1–42 ,Htt‐Q74, Atx1‐Q52, and Atx3‐Q84)…

Show Full Abstract

The accumulation of misfolded and aggregated proteins is a hallmark of neurodegenerative proteinopathies. Although multiple genetic loci have been associated with specific neurodegenerative diseases (NDs), molecular mechanisms that may have a broader relevance for most or all proteinopathies remain poorly resolved. In this study, we developed a multi-layered network expansion (MLnet) model to predict protein modifiers that are common to a group of diseases and, therefore, may have broader pathophysiological relevance for that group. When applied to the four NDs Alzheimer's disease (AD), Huntington's disease, and spinocerebellar ataxia types 1 and 3, we predicted multiple members of the insulin pathway, including PDK1, Akt1, InR, and sgg (GSK-3β), as common modifiers. We validated these modifiers with the help of four Drosophila ND models. Further evaluation of Akt1 in human cell-based ND models revealed that activation of Akt1 signaling by the small molecule SC79 increased cell viability in all models. Moreover, treatment of AD model mice with SC79 enhanced their long-term memory and ameliorated dysregulated anxiety levels, which are commonly affected in AD patients. These findings validate MLnet as a valuable tool to uncover molecular pathways and proteins involved in the pathophysiology of entire disease groups and identify potential therapeutic targets that have relevance across disease boundaries. MLnet can be used for any group of diseases and is available as a web tool at http://ssbio.cau.ac.kr/software/mlnet.

Also flagged:Lithiumcarbon dioxidegraphitesulfurhydrogenmanganese
Journal Article 2023-11-20 No Snippets Zhang Z, Han WQ.
Show Full Abstract

The widespread adoption of lithium-ion batteries has been driven by the proliferation of portable electronic devices and electric vehicles, which have increasingly stringent energy density requirements. Lithium metal batteries (LMBs), with their ultralow reduction potential and high theoretical capacity, are widely regarded as the most promising technical pathway for achieving high energy density batteries. In this review, we provide a comprehensive overview of fundamental issues related to high reactivity and migrated interfaces in LMBs. Furthermore, we propose improved strategies involving interface engineering, 3D current collector design, electrolyte optimization, separator modification, application of alloyed anodes, and external field regulation to address these challenges. The utilization of solid-state electrolytes can significantly enhance the safety of LMBs and represents the only viable approach for advancing them. This review also encompasses the variation in fundamental issues and design strategies for the transition from liquid to solid electrolytes. Particularly noteworthy is that the introduction of SSEs will exacerbate differences in electrochemical and mechanical properties at the interface, leading to increased interface inhomogeneity-a critical factor contributing to failure in all-solid-state lithium metal batteries. Based on recent research works, this perspective highlights the current status of research on developing high-performance LMBs.

SOX6
Also flagged:autism spectrum disorderbipolar disorderfocal cortical dysplasiaschizophreniaTourette syndromeneuropsychiatric diseases
Journal Article 2023-11-20 ✓ 4 Snippets Garrison MA, Jang Y, Bae T, Cherskov A, Emery SB, Fasching L, Jones A, Moldovan JB, Molitor C, Pochareddy S, Peters MA, Shin JH, Wang Y, Yang X, Akbarian S, Chess A, Gage FH, Gleeson JG, Kidd JM, McConnell M, Mills RE, Moran JV, Park PJ, Sestan N, Urban AE, Vaccarino FM, Walsh CA, Weinberger DR, Wheelan SJ, Abyzov A, BSMN Consortium.
In-Text Gene Mentions

…cortical interneurons expressSox6, anti-CTIP2 was replaced…

…was replaced with anti-Sox6conjugated to 647…

…of cortical nuclei, anti-Sox6was added to…

…performed for NeuN+Sox6+ interneurons, NeuN+ Sox6−…

Show Full Abstract

Somatic mosaicism is defined as an occurrence of two or more populations of cells having genomic sequences differing at given loci in an individual who is derived from a single zygote. It is a characteristic of multicellular organisms that plays a crucial role in normal development and disease. To study the nature and extent of somatic mosaicism in autism spectrum disorder, bipolar disorder, focal cortical dysplasia, schizophrenia, and Tourette syndrome, a multi-institutional consortium called the Brain Somatic Mosaicism Network (BSMN) was formed through the National Institute of Mental Health (NIMH). In addition to genomic data of affected and neurotypical brains, the BSMN also developed and validated a best practices somatic single nucleotide variant calling workflow through the analysis of reference brain tissue. These resources, which include >400 terabytes of data from 1087 subjects, are now available to the research community via the NIMH Data Archive (NDA) and are described here.

Also flagged:cardiac hypertrophyheart failuregene expressionregulation ofcardiac diseasenucleotides
Journal Article 2023-11-20 No Snippets Mably JD, Wang DZ.
Show Full Abstract

The surge in reports describing non-coding RNAs (ncRNAs) has focused attention on their possible biological roles and effects on development and disease. ncRNAs have been touted as previously uncharacterized regulators of gene expression and cellular processes, possibly working to fine-tune these functions. The sheer number of ncRNAs identified has outpaced the capacity to characterize each molecule thoroughly and to reliably establish its clinical relevance; it has, nonetheless, created excitement about their potential as molecular targets for novel therapeutic approaches to treat human disease. In this Review, we focus on one category of ncRNAs - long non-coding RNAs - and their expression, functions and molecular mechanisms in cardiac hypertrophy and heart failure. We further discuss the prospects for this specific class of ncRNAs as novel targets for the diagnosis and treatment of these conditions.

PEBP1
Also flagged:-deathclear cell renal cell carcinomaccRCCtumorProgrammed Cell Death
Journal Article 2023-11-20 ✓ 5 Snippets Zhang X, Zhang M, Song L, Wang S, Wei X, Shao W, Song N.
In-Text Gene Mentions

Conversely, the underexpression of genes like PEBP1, NAPSA, and FDX1 in ccRCC may indicate their roles as tumor suppressors or regulators of critical cellular processes.

Downregulation of PEBP1 has been observed in liver and pancreatic cancer, where it may contribute to aggressive tumor behavior and poor prognosis48,49.

In contrast, the remaining three genes (PEBP1, NAPSA, and FDX1) displayed noteworthy underexpression in ccRCC tumors, as depicted in Fig. 7F–H.

Serving as a physiological endogenous inhibitor of the RAF1/MEK/ERK pathway, PEBP1 may inhibit cancer cell migration, proliferation, and invasion.

…Specifically,PEBP1, NAPSA, and FDX1…

Show Full Abstract

Clear cell renal cell carcinoma (ccRCC) poses clinical challenges due to its varied prognosis, tumor microenvironment attributes, and responses to immunotherapy. We established a novel Programmed Cell Death-related Signature (PRS) for ccRCC assessment, derived through the Least Absolute Shrinkage and Selection Operator (LASSO) regression method. We validated PRS using the E-MTAB-1980 dataset and created PCD-related clusters via non-negative matrix factorization (NMF). Our investigation included an in-depth analysis of immune infiltration scores using various algorithms. Additionally, we integrated data from the Cancer Immunome Atlas (TCIA) for ccRCC immunotherapy insights and leveraged the Genomics of Drug Sensitivity in Cancer (GDSC) database to assess drug sensitivity models. We complemented our findings with single-cell sequencing data and employed the Clinical Proteomic Tumor Analysis Consortium (CPTAC) and qRT-PCR to compare gene expression profiles between cancerous and paracancerous tissues. PRS serves as a valuable tool for prognostication, immune characterization, tumor mutation burden estimation, immunotherapy response prediction, and drug sensitivity assessment in ccRCC. We identify five genes with significant roles in cancer promotion and three genes with cancer-suppressive properties, further validated by qRT-PCR and CPTAC analyses, showcasing gene expression differences in ccRCC tissues. Our study introduces an innovative PCD model that amalgamates diverse cell death patterns to provide accurate predictions for clinical outcomes, mutational profiles, and immune characteristics in ccRCC. Our findings hold promise for advancing personalized treatment strategies in ccRCC patients.

NEGR1
Also flagged:depressionLifetimeMDDanxietyneuroticismobesityaffective disorder
Journal Article 2023-11-20 ✓ 2 Snippets Dahl A, Thompson M, An U, Krebs M, Appadurai V, Border R, Bacanu SA, Werge T, Flint J, Schork AJ, Sankararaman S, Kendler KS, Cai N.
In-Text Gene Mentions

This hit overlaps NEGR1 (top SNP rs1194283, odds ratio (OR) = 1.05, SE = 0.0065, P = 6.71 × 10−13; Fig. 3g), which has been identified as an MDD risk locus in multiple GWASs with varying phenotyping approaches4,6,8,35–37.

…This hit overlapsNEGR1(top SNP rs1194283…

Show Full Abstract

Biobanks often contain several phenotypes relevant to diseases such as major depressive disorder (MDD), with partly distinct genetic architectures. Researchers face complex tradeoffs between shallow (large sample size, low specificity/sensitivity) and deep (small sample size, high specificity/sensitivity) phenotypes, and the optimal choices are often unclear. Here we propose to integrate these phenotypes to combine the benefits of each. We use phenotype imputation to integrate information across hundreds of MDD-relevant phenotypes, which significantly increases genome-wide association study (GWAS) power and polygenic risk score (PRS) prediction accuracy of the deepest available MDD phenotype in UK Biobank, LifetimeMDD. We demonstrate that imputation preserves specificity in its genetic architecture using a novel PRS-based pleiotropy metric. We further find that integration via summary statistics also enhances GWAS power and PRS predictions, but can introduce nonspecific genetic effects depending on input. Our work provides a simple and scalable approach to improve genetic studies in large biobanks by integrating shallow and deep phenotypes.

Also flagged:duodenal papilla carcinomaPDtumormalignant tumorduodenal malignant tumorspancreatic ductal adenocarcinoma
Journal Article 2023-11-20 No Snippets Yu G, Xu S, Kong J, He J, Liu J.
Show Full Abstract

<h4>Background</h4>Duodenal papilla carcinoma (DPC) is prone to relapse even after radical pancreaticoduodenectomy (PD) (including robotic, laparoscopic and open approach). This study aimed to develop web calculators to predict early recurrence (ER) (within two years after surgery) and long-term survival in patients with DPC after PD.<h4>Methods</h4>Patients with DPC after radical PD were included. Univariate and multivariate logistic regression analyses were used to identify independent risk factors. Two web calculators were developed based on independent risk factors in the training cohort and then tested in the validation cohort.<h4>Results</h4>Of the 251 patients who met the inclusion criteria, 180 and 71 patients were enrolled in the training and validation cohorts, respectively. Multivariate logistic regression analysis revealed that tumor size [Odds Ratio (OR) 1.386; 95% confidence interval (CI) 1070-1.797; P = 0.014]; number of lymph node metastasis (OR 2.535; 95% CI 1.114-5.769; P = 0.027), perineural invasion (OR 3.078; 95% CI 1.147-8.257; P = 0.026), and tumor differentiation (OR 3.552; 95% CI 1.132-11.152; P = 0.030) were independent risk factors for ER. Nomogram based on the above four factors achieved good C-statistics of 0.759 and 0.729 in predicting ER in the training and the validation cohorts, respectively. Time-dependent ROC analysis (timeROC) and decision curve analysis (DCA) revealed that the nomogram provided superior diagnostic capacity and net benefit compared with single variable.<h4>Conclusions</h4>This study developed and validated two web calculators that can predict ER and long-term survival in patients with DPC with high degree of stability and accuracy.

DDX27
Also flagged:KLRB1cancerbreast invasive carcinomaBRCAGene ExpressionHER2
Journal Article 2023-11-20 ✓ 4 Snippets He JR, Li D, Zhang QX, Liu T, Ding Y, Wu CY, Chen SS, Chen JL.
In-Text Gene Mentions

For instance, DEAD-box helicase 27 (DDX27) expression levels have been noted to be significantly elevated in BC tissues, with increased expression being associated with various adverse prognostic factors including tumor size, positive lymph nodes, high grade, Ki-67, pathological stage, and poor prognosis in BC patients.

DDX27 overexpression has also been shown to promote stem cell-like activity, proliferation, and migration in BC cells, as well as enhance the expression of stem cell biomarkers [9].

…DEAD-box helicase 27 (DDX27) expression levels have…

DDX27overexpression has also…

Show Full Abstract

<h4>Background</h4>The association between Killer cell lectin like receptor B1 (KLRB1) and cancer has been reported, but the roles of KLRB1 in breast invasive carcinoma (BRCA) has not been fully revealed.<h4>Methods</h4>Our study utilized the Cancer Genome Atlas (TCGA), Kaplan-Meier (K-M) Plotter, and TIMER databases to investigate the expression and clinical relevance of KLRB1 in BRCA and to explore its roles and mechanism in BRCA progression using gene set enrichment analysis, CCK-8, migration, apoptosis, and western blotting. We examined the relationship between KLRB1 expression and the BRCA immune microenvironment, using data from TCGA, and Gene Expression Profiling Interactive Analysis (GEPIA) databases and validated these findings in K-M Plotter databases.<h4>Results</h4>A significant decrease of KLRB1 expression was observed in BRCA patients. BRCA patients with low KLRB1 levels were associated with older age, advanced disease stage, HER2-positivity, poor prognosis, and a decreased survival probability compared to the high-expression group. Increased KLRB1 expression levels were correlated with inhibition of breast cancer cell proliferation, migration, and invasion, as well as promotion of cell apoptosis, possible through regulation of the NF-κB, PI3K/AKT, and TNF signaling pathways. Moreover, the study also indicated that decreased KLRB1 expression correlated with tumor purity, immune score, and immune cell infiltration (B cells, CD8<sup>+</sup> T cells, CD4<sup>+</sup> T cells, neutrophils, dendritic cells, among others), cell markers, and immunotherapy.<h4>Conclusion</h4>Decreased KLRB1 expression in BRCA is associated with poor prognosis and immune microenvironment. This study also highlights KLRB1 as a potential molecular marker for poor prognosis in BRCA patients, and therefore, it may provide clinical implications for the management of patients with BRCA.

Also flagged:EGFPAG1necroptosisdeathdiabetic nephropathyautophagy
Journal Article 2023-11-20 No Snippets Wang Y, Zhang L, Peng Z.
Show Full Abstract

The current study aims to understand the mechanisms behind regulated cell death (RCD) in diabetic nephropathy and identify related biomarkers through bioinformatics and experimental validation. Datasets of bulk and single-cell RNA sequencing were obtained from public databases and analyzed using gene set variation analysis (GSVA) with gene sets related to RCD, including autophagy, necroptosis, pyroptosis, apoptosis, and ferroptosis. RCD-related gene biomarkers were identified using weighted gene correlation network analysis (WGCNA). The results were verified through experiments with an independent cohort and <i>in vitro</i> experiments. The GSVA revealed higher necroptosis scores in diabetic nephropathy. Three necroptosis-related biomarkers, EGF, PAG1, and ZFP36, were identified and showed strong diagnostic ability for diabetic kidney disease. <i>In vitro</i> experiments showed high levels of necroptotic markers in HK-2 cells treated with high glucose. Bioinformatics and experimental validation have thus identified EGF and PAG1 as necroptosis-related biomarkers for diabetic nephropathy.

Also flagged:myelinaxonalnerve injuryadipokineleptinleptin receptors
Journal Article 2023-11-20 No Snippets Sundaram VK, Schütza V, Schröter NH, Backhaus A, Bilsing A, Joneck L, Seelbach A, Mutschler C, Gomez-Sanchez JA, Schäffner E, Sánchez EE, Akkermann D, Paul C, Schwagarus N, Müller S, Odle A, Childs G, Ewers D, Kungl T, Sitte M, Salinas G, Sereda MW, Nave KA, Schwab MH, Ost M, Arthur-Farraj P, Stassart RM, Fledrich R.
Show Full Abstract

The peripheral nervous system harbors a remarkable potential to regenerate after acute nerve trauma. Full functional recovery, however, is rare and critically depends on peripheral nerve Schwann cells that orchestrate breakdown and resynthesis of myelin and, at the same time, support axonal regrowth. How Schwann cells meet the high metabolic demand required for nerve repair remains poorly understood. We here report that nerve injury induces adipocyte to glial signaling and identify the adipokine leptin as an upstream regulator of glial metabolic adaptation in regeneration. Signal integration by leptin receptors in Schwann cells ensures efficient peripheral nerve repair by adjusting injury-specific catabolic processes in regenerating nerves, including myelin autophagy and mitochondrial respiration. Our findings propose a model according to which acute nerve injury triggers a therapeutically targetable intercellular crosstalk that modulates glial metabolism to provide sufficient energy for successful nerve repair.

POU3F2
Also flagged:pathogenesisImmune ResponseNEAT1MALAT1glioblastomaAS2
Journal Article 2023-11-20 ✓ 1 Snippet Poller W, Sahoo S, Hajjar R, Landmesser U, Krichevsky AM.
In-Text Gene Mentions

…like OLIG2, SOX2,POU3F2, and SALL2, along…

Show Full Abstract

While it is well known that 98-99% of the human genome does not encode proteins, but are nevertheless transcriptionally active and give rise to a broad spectrum of noncoding RNAs [ncRNAs] with complex regulatory and structural functions, specific functions have so far been assigned to only a tiny fraction of all known transcripts. On the other hand, the striking observation of an overwhelmingly growing fraction of ncRNAs, in contrast to an only modest increase in the number of protein-coding genes, during evolution from simple organisms to humans, strongly suggests critical but so far essentially unexplored roles of the noncoding genome for human health and disease pathogenesis. Research into the vast realm of the noncoding genome during the past decades thus lead to a profoundly enhanced appreciation of the multi-level complexity of the human genome. Here, we address a few of the many huge remaining knowledge gaps and consider some newly emerging questions and concepts of research. We attempt to provide an up-to-date assessment of recent insights obtained by molecular and cell biological methods, and by the application of systems biology approaches. Specifically, we discuss current data regarding two topics of high current interest: (1) By which mechanisms could evolutionary recent ncRNAs with critical regulatory functions in a broad spectrum of cell types (neural, immune, cardiovascular) constitute novel therapeutic targets in human diseases? (2) Since noncoding genome evolution is causally linked to brain evolution, and given the profound interactions between brain and immune system, could human-specific brain-expressed ncRNAs play a direct or indirect (immune-mediated) role in human diseases? Synergistic with remarkable recent progress regarding delivery, efficacy, and safety of nucleic acid-based therapies, the ongoing large-scale exploration of the noncoding genome for human-specific therapeutic targets is encouraging to proceed with the development and clinical evaluation of novel therapeutic pathways suggested by these research fields.

Also flagged:cancertumorfolic acidAFcatalaseoxygen
Journal Article 2023-11-20 No Snippets Tang H, Chen J, Qi LH, Lyu M, Quan H, Tan ZJ.
Show Full Abstract

<h4>Background</h4>Photothermal therapy (PTT) has gained considerable interest as an emerging modality for cancer treatment in recent years. Radiation therapy (RT) has been widely used in the clinic as a traditional treatment method. However, RT and PTT treatments are limited by side effects and penetration depth, respectively. In addition, hypoxia within the tumor can lead to increased resistance to treatment.<h4>Methods</h4>We synthesized multiple sizes of AuPt by modulating the reaction conditions. The smallest size of AuPt was selected and modified with folic acid (FA) for PTT and RT synergy therapy. Various methods including transmission electron microscope (TEM), X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FITR) are used to determine the structure and composition of AuPt-FA (AF). In addition, we researched the photothermal properties of AF with IR cameras and infrared lasers. Flow cytometry, colony formation assays, CCK8, and fluorescent staining for probing the treatment effect in vitro. Also, we explored the targeting of AF by TEM and In Vivo Imaging Systems (IVIS). In vivo experiments, we record changes in tumor volume and weight as well as staining of tumor sections (ROS, Ki67, and hematoxylin and eosin).<h4>Results</h4>The AuPt with particle size of 16 nm endows it with remarkably high photothermal conversion efficiency (46.84%) and catalase activity compared to other sizes of AuPt (30 nm and 100 nm). AF alleviates hypoxia in the tumor microenvironment, leading to the production of more reactive oxygen species (ROS) during the treatment. In addition, the therapeutic effect was significantly enhanced by combining RT and PTT, with an apoptosis rate of 81.1% in vitro and an in vivo tumor volume reduction rate of 94.0% in vivo.<h4>Conclusion</h4>These results demonstrate that AF potentiates the synergistic effect of PTT and RT and has the potential for clinical translation.

Also flagged:adrenocortical carcinomaACCpathogenesisGene Expressioncell cycleresponse to
Journal Article 2023-11-20 No Snippets Yin M, Wang Y, Ren X, Han M, Li S, Liang R, Wang G, Gang X.
Show Full Abstract

Adrenocortical carcinoma (ACC) is a rare endocrine malignancy with poor prognosis. The disease originates from the cortex of adrenal gland and lacks effective treatment. Efforts have been made to elucidate the pathogenesis of ACC, but the molecular mechanisms remain elusive. To identify key genes and pathways in ACC, the expression profiles of GSE12368, GSE90713 and GSE143383 were downloaded from the Gene Expression Omnibus (GEO) database. After screening differentially expressed genes (DEGs) in each microarray dataset on the basis of cut-off, we identified 206 DEGs, consisting of 72 up-regulated and 134 down-regulated genes in three datasets. Function enrichment analyses of DEGs were performed by DAVID online database and the results revealed that the DEGs were mainly enriched in cell cycle, cell cycle process, mitotic cell cycle, response to oxygen-containing compound, progesterone-mediated oocyte maturation, p53 signaling pathway. The STRING database was used to construct the protein-protein interaction (PPI) network, and modules analysis was performed using Cytoscape. Finally, we filtered out eight hub genes, including CDK1, CCNA2, CCNB1, TOP2A, MAD2L1, BIRC5, BUB1 and AURKA. Biological process analysis showed that these hub genes were significantly enriched in nuclear division, mitosis, M phase of mitotic cell cycle and cell cycle process. Violin plot, Kaplan-Meier curve and stage plot of these hub genes confirmed the reliability of the results. In conclusion, the results in this study provided reliable key genes and pathways for ACC, which will be useful for ACC mechanisms, diagnosis and candidate targeted treatment.

POU3F2
Also flagged:FEZ1brain developmentfasciculation and elongation protein zeta 1schizophreniaJacobsen syndromelocalization
Journal Article 2023-11-20 ✓ 1 Snippet Qu Y, Lim JJ, An O, Yang H, Toh YC, Chua JJE.
In-Text Gene Mentions

…layer neurons (POU3F2, BHLHE22 );…

Show Full Abstract

Mutations in the human fasciculation and elongation protein zeta 1 (<i>FEZ1)</i> gene are found in schizophrenia and Jacobsen syndrome patients. Here, using human cerebral organoids (hCOs), we show that <i>FEZ1</i> expression is turned on early during brain development and is detectable in both neuroprogenitor subtypes and immature neurons. FEZ1 deletion disrupts expression of neuronal and synaptic development genes. Using single-cell RNA sequencing, we detected abnormal expansion of homeodomain-only protein homeobox (HOPX)<sup>-</sup> outer radial glia (oRG), concurrent with a reduction of HOPX<sup>+</sup> oRG, in FEZ1-null hCOs. HOPX<sup>-</sup> oRGs show higher cell mobility as compared to HOPX<sup>+</sup> oRGs. Ectopic localization of neuroprogenitors to the outer layer is seen in FEZ1-null hCOs. Anomalous encroachment of TBR2<sup>+</sup> intermediate progenitors into CTIP2<sup>+</sup> deep layer neurons further indicated abnormalities in cortical layer formation these hCOs. Collectively, our findings highlight the involvement of FEZ1 in early cortical brain development and how it contributes to neurodevelopmental disorders.

Also flagged:Gelatinnucleasedegradationcell adhesiongene transfernucleus
Journal Article 2023-11-20 No Snippets Carvalho BG, Nakayama A, Miwa H, Han SW, de la Torre LG, Di Carlo D, Lee J, Kim HJ, Khademhosseini A, de Barros NR.
Show Full Abstract

mRNA therapy is the intracellular delivery of messenger RNA (mRNA) to produce desired therapeutic proteins. Developing strategies for local mRNA delivery is still required where direct intra-articular injections are inappropriate for targeting a specific tissue. The mRNA delivery efficiency depends on protecting nucleic acids against nuclease-mediated degradation and safe site-specific intracellular delivery. Herein, we report novel mRNA-releasing matrices based on RGD-moiety-rich gelatin methacryloyl (GelMA) microporous annealed particle (MAP) scaffolds. GelMA concentration in aerogel-based microgels (μgels) produced through a microfluidic process, MAP stiffnesses, and microporosity are crucial parameters for cell adhesion, spreading, and proliferation. After being loaded with mRNA complexes, MAP scaffolds composed of 10 % GelMA μgels display excellent cell viability with increasing cell infiltration, adhesion, proliferation, and gene transfer. The intracellular delivery is achieved by the sustained release of mRNA complexes from MAP scaffolds and cell adhesion on mRNA-releasing scaffolds. These findings highlight that hybrid systems can achieve efficient protein expression by delivering mRNA complexes, making them promising mRNA-releasing biomaterials for tissue engineering.

bioRxiv 2023-11-20 Preprint (No Snippets API) Xu Q, Halle L, Hediyeh-zadeh S, Kuijs M, Kilik U, Yu Q, Frum T, Adam L, Parikh S, Gander M, Kfuri-Rubens R, Klein D, He Z, Fleck JS, Oost K, Kahnwald M, Barbiero S, Mitrofanova O, Maciag G, Jensen KB, Lutolf M, Liberali P, Beumer J, Spence JR, Treutlein B, Theis FJ, Camp JG.
Show Full Abstract

Human stem cells can generate complex, multicellular epithelial tissues of endodermal origin in vitro that recapitulate aspects of developing and adult human physiology. These tissues, also called organoids, can be derived from pluripotent stem cells or tissue-resident fetal and adult stem cells. However, it has remained difficult to understand the precision and accuracy of organoid cell states through comparison with primary counterparts, and to comprehensively assess the similarity and differences between organoid protocols. Advances in computational single-cell biology now allow the integration of datasets with high technical variability. Here, we integrate single-cell transcriptomes from 218 samples covering organoids of diverse endoderm-derived tissues including lung, pancreas, intestine, liver, biliary system, stomach, and prostate to establish an initial version of a human endoderm organoid cell atlas (HEOCA). The integration includes nearly one million cells across diverse conditions, data sources and protocols. We align and compare cell types and states between organoid models, and harmonize cell type annotations by mapping the atlas to primary tissue counterparts. To demonstrate utility of the atlas, we focus on intestine and lung, and clarify ontogenic cell states that can be modeled in vitro . We further provide examples of mapping novel data from new organoid protocols to expand the atlas, and showcase how integrating organoid models of disease into the HEOCA identifies altered cell proportions and states between healthy and disease conditions. The atlas makes diverse datasets centrally available, and will be valuable to assess organoid fidelity, characterize perturbed and diseased states, and streamline protocol development.

Research Square 2023-11-20 Preprint (No Snippets API) Stoelinga A, Tushuizen ME, Hout WBvd, Girondo MDR, de Vries ES, Levens AD, Moes DA, Gevers TJ, Meer Sv, Brouwer JT, de Jonge HJ, de Boer YS, Beuers UH, Meer AJvd, Berg APvd, Guichelaar MM, Drenth JP, Hoek Bv.
Show Full Abstract

<title>Abstract</title> <p>• <bold>Background</bold>: Autoimmune hepatitis (AIH) is a rare, chronic inflammatory disease of the liver. Treatment goal is reaching complete biochemical response (CR), defined as normalization of aspartate and alanine aminotransferases and immunoglobulin gamma. Ongoing AIH activity can lead to fibrosis and (decompensated) cirrhosis. Incomplete biochemical response is the most important risk factor for liver transplantation or liver related mortality. First-line treatment consists of the combination of azathioprine and prednisolone. If CR is not reached, tacrolimus (TAC) or mycophenolate mofetil (MMF) can be used as second line therapy. Both products are registered for the prevention of graft rejection in solid organ transplant recipients. The aim of this study is to compare the effectiveness and safety of TAC and MMF as second line treatment for AIH. • <bold>Methods</bold>: The TAILOR study is a phase IIIB, multicentre, open-label, parallel-group, randomised (1:1) controlled trial performed in large teaching and university hospitals in the Netherlands. We will enrol 86 patients with AIH who have not reached CR after at least six months of treatment with first-line therapy. Patients are randomised to TAC (0.07mg/kg/day initially and adjusted by trough levels) or MMF (max 2000mg/day), stratified by the presence of cirrhosis at inclusion. The primary endpoint is the difference in proportion of patients reaching CR after 12 months. Secondary endpoints include the difference in proportion of patients reaching CR after six months, adverse effects, difference in fibrogenesis, quality of life and cost-effectiveness. • <bold>Discussion</bold>: This is the first randomised controlled trial comparing two second line therapies for AIH. Currently second line treatment is based on retrospective cohort studies. The rarity of AIH is the main issue in clinical research for alternative treatment options. The results of this trial can be implemented in existing international clinical guidelines. • <bold>Trial registration</bold>: ClinicalTrials.gov NCT05221411.– Retrospectively registered on: 3 February 2022; EudraCT number: 2021-003420-33, Prospectively registered on 16 June 2021.</p>

bioRxiv 2023-11-20 Preprint (No Snippets API) Ali H, Ahmad S.
Show Full Abstract

<h4>ABSTRACT</h4> This study aimed to investigate the genetic determinants of gestation length in Kari sheep, employing RNA-Seq technology. Employing a comprehensive whole transcriptome analysis, we sought to pinpoint differentially expressed genes (DEGs) while also delving into gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway assessments. The analysis revealed the identification of a total of 19,546 genes expressed in ovary. While comparing the transcriptomes of Kari sheep with Balkhi, yielding 976 DEGs (p < 0.05, Log2fc>1, <-1). Notably, among these DEGs, an upregulation of genes was observed associated with Ubiquitin-protein transferase activity, such as CNOT4, RC3H1 , and XIAP . Concurrently, DEGs like NFAT5, EPAS1, ZNF644, RBPJ , and FOXP2 exhibited associations with RNA polymerase II core promoter proximal region sequence-specific DNA binding. Conversely, downregulated genes, including EEA1, CNOT4, FGD4, MBNL1, ZRANB2, REV3L, XIAP, ATP13A3, RPAP2, FOXP2 , and ADAMTS6, were implicated in the mRNA surveillance pathway. In addition, several Gene Ontology terms, such as GO:0001228 (transcriptional activator activity) and GO:0004842, along with GO:0000978 (transcriptional activator activity), were linked to the DEGs. KEGG pathways, including “Glycosaminoglycan biosynthesis - chondroitin sulfate/dermatan sulfate” (KEGG:532) and “basal cell carcinoma” (KEGG:5217), were associated with our findings. Our principal component analysis (PCA) demonstrated a cohesive clustering of gene expression profiles among the four samples, with subtle distinctions. Protein-protein interaction (PPI) analysis indicated the functional relationships among the DEGs. Notably, genes such as ABHD16B and NPBWR2 exhibited strong co-expression among the down-regulated DEGs, while DNAH7/TBC1D31 and MBNL1/NOVA1 displayed prominent co-expression among the up-regulated DEGs. Consequently, our study offers a comprehensive understanding of Kari sheep genetics and the pivotal genes involved in gestation length determinants. These findings carry significant genetic implications, enhancing genetic resources, furthering reproductive biology comprehension, and contributing to the advancement of sustainable sheep farming practices.

Also flagged:agingN-methyl-D-aspartate type glutamate receptorNMDARglutamateionotropic Glu receptortraumatic brain injury
Journal Article 2023-11-19 No Snippets Chen C, Khanthiyong B, Thaweetee-Sukjai B, Charoenlappanit S, Roytrakul S, Thanoi S, Reynolds GP, Nudmamud-Thanoi S.
Show Full Abstract

Sex differences in cognitive function exist, but they are not stable and undergo dynamic change during the lifespan. However, our understanding of how sex-related neural information transmission evolves with age is still in its infancy. This study utilized the Wisconsin Card Sorting Test (WCST) and the label-free proteomics method with bioinformatic analysis to investigate the molecular mechanisms underlying age-related sex differences in cognitive performance in 199 healthy Thai subjects (aged 20-70 years), as well as explore the sex-dependent protein complexes for predicting cognitive aging. The results showed that males outperformed females in two of the five WCST sub-scores: %Corrects and %Errors. Sex differences in these scores were related to aging, becoming noticeable in those over 60. At the molecular level, differently expressed individual proteins and protein complexes between both sexes are associated with the potential N-methyl-D-aspartate type glutamate receptor (NMDAR)-mediated excitotoxicity, with the NMDAR complex being enriched exclusively in elderly female samples. These findings provided a preliminary indication that healthy Thai females might be more susceptible to such neurotoxicity, as evidenced by their cognitive performance. NMDAR protein complex enrichment in serum could be proposed as a potential indication for predicting cognitive aging in healthy Thai females.

DCC
Also flagged:intracranial hemorrhagedeathneurological disordersPeriventricular subependymal intraventricular hemorrhagebrain developmenttwin-twin transfusion syndrome
Journal Article 2023-11-19 ✓ 2 Snippets Wang H, Huang JL, Peng H.
In-Text Gene Mentions

…have confirmed thatDCCcan reduce the…

…have suggested thatDCCdoes not increase…

Show Full Abstract

<h4>Background</h4>Unstable cerebral hemodynamics is an important cause of intracranial hemorrhage in premature infants. The increased blood flow of delayed cord clamping (DCC) compared to immediate cord clamping (ICC) is equivalent to 1/3-1/4 of newborn blood volume. Our objective was to assess whether the increased blood flow causes fluctuations in cerebral blood flow and how.<h4>Methods</h4>This experiment was a prospective, observational study. Neonatologists selected preterm infants eligible for inclusion and exclusion, and divided them into DCC group and ICC group according to the way of umbilical cord ligation performed by obstetrics department, and matched them 1:1 according to gestational age. The peak systolic velocity (PSV) ,end diastolic velocity (EDV),and resistance index (RI) of middle cerebral artery was measured by Mindray M9 color ultrasonic diagnostic instrument within 1 h, 24±1 h, 48±1 h, 72±1 h, respectively.<h4>Results</h4>There was no significant difference in PSV, EDV and RI in middle cerebral artery between DCC group and ICC group (P > 0.05). There were no significant differences between groups and time (P > 0.05). The hemoglobin and hematocrit in DCC group were higher than those in ICC group within 2 h after birth (P < 0.05). (P > 0.05).<h4>Conclusion</h4>DCC can increase hemoglobin and hematocrit in preterm infants, but does not cause cerebral blood flow fluctuation within a certain range. DCC is a safe method of placental transfusion.

PRDX6
Also flagged:cuproptosisUterine corpus endometrial carcinomaUCECfemale reproductive system cancermitochondrialdeath
Journal Article 2023-11-19 ✓ 1 Snippet Li B, Li X, Ma M, Shi J, Wu C.
In-Text Gene Mentions

…39 lncRNAs: AC093382.1,PRDX6-AS1, LINC00662, LINC01585, KT…

Show Full Abstract

Uterine corpus endometrial carcinoma (UCEC) is a common female reproductive system cancer. Cuproptosis, a new type of mitochondrial respiration-regulated cell death, is associated with several cancer types. Here, we developed a cuproptosis-associated long non-coding RNA (lncRNA) model to predict the prognosis of patients with UCEC and their response to immune-based treatments. RNA sequencing (RNA-seq) and somatic mutation data for UCEC were obtained from The Cancer Genome Atlas (TCGA) database. LncRNAs co-expressed with cuproptosis-related genes were screened. Patients were randomly divided into two groups, one of which was used as training group to build the model, while the other group served as the validation group. A prognostic model comprising 13 cuproptosis-associated lncRNAs was constructed, and each lncRNA was individually related to patient prognosis. Our model clearly distinguished between risk variables in afflicted individuals. The risk score can provide a more accurate prognostic prediction compared with other clinical covariates. Patient groups at various risk groups were different according to tumor mutational burden and tumor immune dysfunction and exclusion analysis. We identified drugs for which patient populations at various risk groups showed higher sensitivity. Our model may contribute to immune related research and clinical decision-making for optimized treatment.

SUDS3
Also flagged:embryogenesiscancercell proliferationdevelopmental delayscancersgene expression
Journal Article 2023-11-19 ✓ 1 Snippet Zhang S, Wang R, Zhu X, Zhang L, Liu X, Sun L.
In-Text Gene Mentions

…complexes (such aspolycomb repressiverepressive complexes PRC1…

Show Full Abstract

Aneuploidy can globally affect the expression of the whole genome, which is detrimental to organisms. Dosage-sensitive regulators usually have multiple intermolecular interactions, and changes in their stoichiometry are responsible for the dysregulation of the regulatory network. Currently, studies on noncoding genes in aneuploidy are relatively rare. We studied the characteristics and expression profiles of long noncoding RNAs (lncRNAs) and transposable elements (TEs) in aneuploid <i>Drosophila</i>. It is found that lncRNAs and TEs are affected by genomic imbalance and appear to be more sensitive to an inverse dosage effect than mRNAs. Several dosage-sensitive lncRNAs and TEs were detected for their expression patterns during embryogenesis, and their biological functions in the ovary and testes were investigated using tissue-specific RNAi. This study advances our understanding of the noncoding sequences in imbalanced genomes and provides a novel perspective for the study of aneuploidy-related human diseases such as cancer.

POU3F2
Also flagged:gliomaGlioblastomaGBMcancersSUMO2 E3 ligaseTAF15
Journal Article 2023-11-18 ✓ 1 Snippet Liu L, Liu Z, Liu Q, Wu W, Lin P, Liu X, Zhang Y, Wang D, Prager BC, Gimple RC, Yu J, Zhao W, Wu Q, Zhang W, Wu E, Chen X, Luo J, Rich JN, Xie Q, Jiang T, Chen R.
In-Text Gene Mentions

…key transcription factorsPOU3F2, SOX2, SALL2, and…

Show Full Abstract

Glioblastoma (GBM) ranks among the most lethal of human cancers, containing glioma stem cells (GSCs) that display therapeutic resistance. Here, we report that the lncRNA INHEG is highly expressed in GSCs compared to differentiated glioma cells (DGCs) and promotes GSC self-renewal and tumorigenicity through control of rRNA 2'-O-methylation. INHEG induces the interaction between SUMO2 E3 ligase TAF15 and NOP58, a core component of snoRNP that guides rRNA methylation, to regulate NOP58 sumoylation and accelerate the C/D box snoRNP assembly. INHEG activation enhances rRNA 2<sup>'</sup>-O-methylation, thereby increasing the expression of oncogenic proteins including EGFR, IGF1R, CDK6 and PDGFRB in glioma cells. Taken together, this study identifies a lncRNA that connects snoRNP-guided rRNA 2'-O-methylation to upregulated protein translation in GSCs, supporting an axis for potential therapeutic targeting of gliomas.

SOX6
Also flagged:PDpathogenesismethylphenyl1,2,3,6-tetrahydropyridineparkinsonism
Journal Article 2023-11-18 ✓ 5 Snippets Tang L, Xu N, Huang M, Yi W, Sang X, Shao M, Li Y, Hao ZZ, Liu R, Shen Y, Yue F, Liu X, Xu C, Liu S.
In-Text Gene Mentions

…contrast to theSOX6+ PD-vulnerable DaNs,…

…demarcation between theSOX6+ and SOX6…

…SOX6 + andSOX6− groups of…

…part with theSOX6- CALB1 axis…

…enriched in theSOX6− DaNs in…

Show Full Abstract

The degenerative process in Parkinson's disease (PD) causes a progressive loss of dopaminergic neurons (DaNs) in the nigrostriatal system. Resolving the differences in neuronal susceptibility warrants an amenable PD model that, in comparison to post-mortem human specimens, controls for environmental and genetic differences in PD pathogenesis. Here we generated high-quality profiles for 250,173 cells from the substantia nigra (SN) and putamen (PT) of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced parkinsonian macaques and matched controls. Our primate model of parkinsonism recapitulates important pathologic features in nature PD and provides an unbiased view of the axis of neuronal vulnerability and resistance. We identified seven molecularly defined subtypes of nigral DaNs which manifested a gradient of vulnerability and were confirmed by fluorescence-activated nuclei sorting. Neuronal resilience was associated with a FOXP2-centered regulatory pathway shared between PD-resistant DaNs and glutamatergic excitatory neurons, as well as between humans and nonhuman primates. We also discovered activation of immune response common to glial cells of SN and PT, indicating concurrently activated pathways in the nigrostriatal system. Our study provides a unique resource to understand the mechanistic connections between neuronal susceptibility and PD pathophysiology, and to facilitate future biomarker discovery and targeted cell therapy.

PTGIS
Also flagged:cancermetastatic tumoursmammary tumourstranslationalbreast cancerarginase 1
Journal Article 2023-11-18 ✓ 1 Snippet Bokil AA, Le Boulvais Børkja M, Wolowczyk C, Lamsal A, Prestvik WS, Nonstad U, Pettersen K, Andersen SB, Bofin AM, Bjørkøy G, Hak S, Giambelluca MS.
In-Text Gene Mentions

…Scara5, Foxf1, F7,Ptgis, Thbs1, Il1a (inflammatory…

Show Full Abstract

<h4>Background</h4>Myeloid cells play an essential role in cancer metastasis. The phenotypic diversity of these cells during cancer development has attracted great interest; however, their functional heterogeneity and plasticity have limited their role as prognostic markers and therapeutic targets.<h4>Methods</h4>To identify markers associated with myeloid cells in metastatic tumours, we compared transcriptomic data from immune cells sorted from metastatic and non-metastatic mammary tumours grown in BALB/cJ mice. To assess the translational relevance of our in vivo findings, we assessed human breast cancer biopsies and evaluated the association between arginase 1 protein expression in breast cancer tissues with tumour characteristics and patient outcomes.<h4>Results</h4>Among the differentially expressed genes, arginase 1 (ARG1) showed a unique expression pattern in tumour-infiltrating myeloid cells that correlated with the metastatic capacity of the tumour. Even though ARG1-positive cells were found almost exclusively inside the metastatic tumour, ARG1 protein was also present in the plasma. In human breast cancer biopsies, the presence of ARG1-positive cells was strongly correlated with high-grade proliferating tumours, poor prognosis, and low survival.<h4>Conclusion</h4>Our findings highlight the potential use of ARG1-positive myeloid cells as an independent prognostic marker to evaluate the risk of metastasis in breast cancer patients.

ZNFX1
Also flagged:osteosarcomaFUSCircularcancerOS
Journal Article 2023-11-18 ✓ 2 Snippets Wang Z, She D, Liu L, Hua X, Zhu H, Yu L, Wang H, Zhu Y, Fan G, Wang Y, Xu M, Zhou G.
In-Text Gene Mentions

…miR-661/FUS-mediated mRNA ofZNFX1.…

…the mRNA ofZNFX1.…

Show Full Abstract

Circular RNAs (circRNAs) are a class of non-coding RNAs which take part in the regulation of the initiation and development of different types of cancer. Numerous studies have demonstrated that circRNAs are involved in the progression of osteosarcoma (OS) as well. Thus, we put our emphasis on the exploration of crucial circRNAs in the process of OS initiation and progression. Using RNA sequencing, we found that circSATB2 was highly expressed in OS tissues compared with adjacent normal tissues. Then, we confirmed the high expression of circSATB2 in OS cell lines and OS tissues and its high expression was related to poor prognosis of OS patients. Functional experiments exhibited that circSATB2 promoted OS proliferation and migration in vitro, primary OS model and OS lung metastasis model showed that circSATB2 aggravated OS progression in vivo. Mechanistically, circSATB2 was found to promote OS progression through sponging miR-661 and FUS regulating the mRNA of ZNFX1. Therefore, circSATB2 could act as a prognostic marker and a therapeutic target for osteosarcoma in the future.

PEBP1
Also flagged:pulmonary embolismPEHSPA5SFTPA2POF1BEPPK1
Journal Article 2023-11-17 ✓ 1 Snippet Gade IL, Riddersholm SJ, Stilling-Vinther T, Brøndum RF, Bennike TB, Honoré B.
In-Text Gene Mentions

…levels of HSPA5,PEBP1and SFTPA2 were…

Show Full Abstract

Pulmonary embolism (PE) can be a diagnostic challenge. Current diagnostic markers for PE are unspecific and new diagnostic tools are needed. The air we exhale is a possible new source for biomarkers which can be tapped into by analysing the exhaled breath condensate (EBC). We analysed the EBC from patients with PE and controls to investigate if the EBC is a useful source for new diagnostic biomarkers of PE. We collected and analysed EBC samples from patients with suspected PE and controls matched on age and sex. Patients in whom PE was ruled out after diagnostic work-up were included in the control group to increase the sensitivity and generalizability of the identified markers. EBC samples were collected using an RTube™. The protein composition of the EBCs were analysed using data dependent label-free quantitative nano liquid chromatography-tandem mass spectrometry. EBC samples from 28 patients with confirmed PE, and 49 controls were analysed. A total of 928 EBC proteins were identified in the 77 EBC samples. As expected, a low protein concentration was determined which resulted in many proteins with unmeasurable levels in several samples. The levels of HSPA5, PEBP1 and SFTPA2 were higher and levels of POF1B, EPPK1, PSMA4, ALDOA, and CFL1 were lower in PE compared with controls. In conclusion, the human EBC contained a variety of endogenous proteins and may be a source for new diagnostic markers of PE and other diseases.

Also flagged:thyroid nodulescancersthyroid cancercancerdifferentiated thyroid cancerspapillary thyroid carcinomas
Journal Article 2023-11-17 No Snippets Lebrun L, Salmon I.
Show Full Abstract

<h4>Purpose of review</h4>The assessment of thyroid nodules is a common clinical problem, linked to the high incidence of thyroid nodules in the population and the low incidence of aggressive thyroid carcinoma. The screening is therefore one of the strengths of our patient care. Recently, the 2023 Bethesda System for Reporting Thyroid Cytopathology (TBSRTC) and 2022 WHO classification of thyroid neoplasms have been released based on the definition of new entities and the growing impact of molecular testing. The aim of this review is to analyze how these upgrades can help us in the daily routine practice diagnosis of thyroid cancer.<h4>Recent findings</h4>Our review is focused on the most frequent thyroid tumors derived from thyroid follicular cell. Fine needle aspiration (FNA) is the gold standard for the screening of thyroid nodules with very high levels of sensitivity and specificity. These sensitivity and specificity are improved by molecular testing, which refines the risk of malignancy. The 2023 TBSRTC integrates molecular data and the upgrades integrated in the 2022 WHO classification such as the 'low-risk neoplasms' and the 'high-grade follicular-cells derived carcinoma'. The morphological examination remains crucial since the capsular and/or vascular invasion are key features of malignancy in the follicular thyroid neoplasms. Low-risk neoplasms represent a clinical challenge since no specific guidelines are available. Challenges remain regarding oncocytic thyroid lesions, which are not associated with specific diagnostic molecular biomarkers. Molecular testing can help not only in deciphering the prognosis but also in the targeted therapeutic strategy.<h4>Summary</h4>While molecular testing has succeeded to substantially improve the pre and postoperative diagnosis and risk stratification of thyroid tumors, the morphological examination is still central in the daily routine diagnosis of thyroid pathology. Future is the integrated diagnosis of clinical, morphological, molecular and epigenetic features with the help of artificial intelligence algorithms.

Also flagged:Prostaglandin-E1persistent pulmonary hypertensionoxygenprostglandin-E1right ventricular dysfunctionTachycardia
Journal Article 2023-11-17 No Snippets Tsoi SM, Nawaytou H, Almeneisi H, Steurer M, Zhao Y, Fineman JR, Keller RL.
Show Full Abstract

<h4>Background</h4>Neonates with persistent pulmonary hypertension of the newborn (PPHN) can present with hypoxia and right ventricular dysfunction with resultant inadequate oxygen delivery and end-organ damage. This study describes the use of prostaglandin-E1 (PGE) for ductal patency to preserve right ventricular systolic function and limit afterload in newborns with PPHN.<h4>Methods</h4>This is a retrospective cohort study that follows the hemodynamics, markers of end-organ perfusion, length of therapeutics, and echocardiographic variables of 57 newborns who used prostglandin-E1 in the setting of PPHN.<h4>Results</h4>Tachycardia, lactic acidosis, and supplemental oxygen use improved following PGE initiation. Fractional area change (FAC), to assess right ventricular systolic function, and pulmonary arterial acceleration time indexed to right ventricular ejection time (PAAT/RVET), to assess right ventricular afterload, also improved over three time points relative to PGE use (before, during, and after).<h4>Conclusions</h4>Overall, we described the safety and utility of PGE in newborns with severe PPHN for stabilization while allowing natural disease progression.

SUDS3
Also flagged:chromatindendritesaxonshistone H1.0histonehistone H1.2
Journal Article 2023-11-17 ✓ 2 Snippets Siqueira E, Kim BH, Reser L, Chow R, Delaney K, Esteller M, Ross MM, Shabanowitz J, Hunt DF, Guil S, Ausiö J.
In-Text Gene Mentions

…special emphasis onlinker histoneshistones.…

…core histones andlinker histoneshistones (histones of…

Show Full Abstract

An immortalized neural cell line derived from the human ventral mesencephalon, called ReNCell, and its MeCP2 knock out were used. With it, we characterized the chromatin compositional transitions undergone during differentiation, with special emphasis on linker histones. While the WT cells displayed the development of dendrites and axons the KO cells did not, despite undergoing differentiation as monitored by NeuN. ReNCell expressed minimal amounts of histone H1.0 and their linker histone complement consisted mainly of histone H1.2, H1.4 and H1.5. The overall level of histone H1 exhibited a trend to increase during the differentiation of MeCP2 KO cells. The phosphorylation levels of histone H1 proteins decreased dramatically during ReNCell's cell differentiation independently of the presence of MeCP2. Immunofluorescence analysis showed that MeCP2 exhibits an extensive co-localization with linker histones. Interestingly, the average size of the nucleus decreased during differentiation but in the MeCP2 KO cells, the smaller size of the nuclei at the start of differentiation increased by almost 40% after differentiation by 8 days (8 DIV). In summary, our data provide a compelling perspective on the dynamic changes of H1 histones during neural differentiation, coupled with the intricate interplay between H1 variants and MeCP2.<b>Abbreviations</b>: ACN, acetonitrile; A<sub>230</sub>, absorbance at 230 nm; bFGF, basic fibroblast growth factor; CM, chicken erythrocyte histone marker; CNS, central nervous system; CRISPR, clustered regulated interspaced short palindromic repeatsDAPI, 4,'6-diaminidino-2-phenylindole; DIV, days <i>in vitro</i> (days after differentiation is induced); DMEM, Dulbecco's modified Eagle medium; EGF, epidermal growth factor; ESC, embryonic stem cell; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFAP, glial fibrillary acidic proteinHPLC, high-performance liquid chromatography; IF, immunofluorescence; iPSCs, induced pluripotent stem cells; MAP2, microtubule-associated protein 2; MBD, methyl-binding domain; MeCP2, methyl-CpG binding protein 2; MS, mass spectrometry; NCP, nucleosome core particle; NeuN, neuron nuclear antigen; NPC, neural progenitor cellPAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline; PFA, paraformaldehyde; PTM, posttranslational modification; RP-HPLC, reversed phase HPLC; ReNCells, ReNCells VM; RPLP0, ribosomal protein lateral stalk subunit P0; RT-qPCR, reverse transcription quantitative polymerase-chain reaction; RTT, Rett Syndrome; SDS, sodium dodecyl sulphate; TAD, topologically associating domain; Triple KO, triple knockout.

Also flagged:α-synucleinfibrilsendocytosisdegradationdementiaswater
Journal Article 2023-11-17 No Snippets Liu Z, Sokratian A, Duda AM, Xu E, Stanhope C, Fu A, Strader S, Li H, Yuan Y, Bobay BG, Sipe J, Bai K, Lundgaard I, Liu N, Hernandez B, Bowes Rickman C, Miller SE, West AB.
Show Full Abstract

Recent studies have identified increasing levels of nanoplastic pollution in the environment. Here, we find that anionic nanoplastic contaminants potently precipitate the formation and propagation of α-synuclein protein fibrils through a high-affinity interaction with the amphipathic and non-amyloid component (NAC) domains in α-synuclein. Nanoplastics can internalize in neurons through clathrin-dependent endocytosis, causing a mild lysosomal impairment that slows the degradation of aggregated α-synuclein. In mice, nanoplastics combine with α-synuclein fibrils to exacerbate the spread of α-synuclein pathology across interconnected vulnerable brain regions, including the strong induction of α-synuclein inclusions in dopaminergic neurons in the substantia nigra. These results highlight a potential link for further exploration between nanoplastic pollution and α-synuclein aggregation associated with Parkinson's disease and related dementias.

HFE
Also flagged:Deferoxamineretinal ischemiaFerroptosisdeathglutathioneSLC7A11
Journal Article 2023-11-17 ✓ 1 Snippet Wang X, Li M, Diao K, Wang Y, Chen H, Zhao Z, Li Y, Jia X, Wang H, Zheng F, Xia Z, Han L, Zhang M.
In-Text Gene Mentions

…simultaneous inhibition ofhemochromatosis, the initiation of…

Show Full Abstract

Retinal ischemia‒reperfusion (I/R) injury can cause significant damage to human retinal neurons, greatly compromising their functions. Existing interventions have been proven to have little effect. Ferroptosis is a newly discovered type of programmed cell death that has been found to be involved in the process of ischemia‒reperfusion in multiple organs throughout the body. Studies have shown that it is also present in retinal ischemia‒reperfusion injury. A rat model of retinal ischemia‒reperfusion injury was constructed and treated with deferoxamine. In this study, we found the accumulation of Fe<sup>2+</sup>, reactive oxygen species (ROS), malondialdehyde (MDA), and the consumption of glutathione (GSH) via ELISA testing; increased expression of transferrin; and decreased expression of ferritin, SLC7A11, and GPX4 via Western blotting (WB) and real-time PCR testing. Structural signs of ferroptosis (mitochondrial shrinkage) were observed across multiple cell types, including retinal ganglion cells (RGCs), photoreceptor cells, and pigment epithelial cells. Changes in visual function were detected by F-VEP and ERG. The results showed that iron and oxidative stress were increased in the retinal ischemia‒reperfusion injury model, resulting in ferroptosis and tissue damage. Deferoxamine protects the structural and functional soundness of the retina by inhibiting ferroptosis through the simultaneous inhibition of hemochromatosis, the initiation of transferrin, and the degradation of ferritin and activating the antioxidant capacity of the System Xc-GSH-GPX4 pathway.

BTN2A2
Also flagged:viral capsidsviral genomeextracellularinfectionlipidVP4
Journal Article 2023-11-17 ✓ 1 Snippet Catching A, Te Yeh M, Bianco S, Capponi S, Andino R.
In-Text Gene Mentions

…the virus receptor,scavenger receptor B2 member 2receptor B2 member…

Show Full Abstract

A central role of viral capsids is to protect the viral genome from the harsh extracellular environment while facilitating initiation of infection when the virus encounters a target cell. Viruses are thought to have evolved an optimal equilibrium between particle stability and efficiency of cell entry. In this study, we genetically perturb this equilibrium in a non-enveloped virus, enterovirus A71 to determine its structural basis. We isolate a single-point mutation variant with increased particle thermotolerance and decreased efficiency of cell entry. Using cryo-electron microscopy and molecular dynamics simulations, we determine that the thermostable native particles have acquired an expanded conformation that results in a significant increase in protein dynamics. Examining the intermediate states of the thermostable variant reveals a potential pathway for uncoating. We propose a sequential release of the lipid pocket factor, followed by internal VP4 and ultimately the viral RNA.

CDK5RAP1
Also flagged:MetforminoxygenZEB1mitochondrialautophagyimmunosuppression
Journal Article 2023-11-17 ✓ 3 Snippets Cortés M, Brischetto A, Martinez-Campanario MC, Ninfali C, Domínguez V, Fernández S, Celis R, Esteve-Codina A, Lozano JJ, Sidorova J, Garrabou G, Siegert AM, Enrich C, Pintado B, Morales-Ruiz M, Castro P, Cañete JD, Postigo A.
In-Text Gene Mentions

…The methylthiotransferaseCdk5rap1catalyzes 2-methyl-2-thio (ms2…

…the downregulation ofCdk5rap1expression in Zeb1…

…the regulation ofCdk5rap1expression and ms2…

Show Full Abstract

Acute inflammation can either resolve through immunosuppression or persist, leading to chronic inflammation. These transitions are driven by distinct molecular and metabolic reprogramming of immune cells. The anti-diabetic drug Metformin inhibits acute and chronic inflammation through mechanisms still not fully understood. Here, we report that the anti-inflammatory and reactive-oxygen-species-inhibiting effects of Metformin depend on the expression of the plasticity factor ZEB1 in macrophages. Using mice lacking Zeb1 in their myeloid cells and human patient samples, we show that ZEB1 plays a dual role, being essential in both initiating and resolving inflammation by inducing macrophages to transition into an immunosuppressed state. ZEB1 mediates these diverging effects in inflammation and immunosuppression by modulating mitochondrial content through activation of autophagy and inhibition of mitochondrial protein translation. During the transition from inflammation to immunosuppression, Metformin mimics the metabolic reprogramming of myeloid cells induced by ZEB1. Mechanistically, in immunosuppression, ZEB1 inhibits amino acid uptake, leading to downregulation of mTORC1 signalling and a decrease in mitochondrial translation in macrophages. These results identify ZEB1 as a driver of myeloid cell metabolic plasticity, suggesting that targeting its expression and function could serve as a strategy to modulate dysregulated inflammation and immunosuppression.

Also flagged:type II cystatinCSTtumortype II CSTCST2CST4
Journal Article 2023-11-17 No Snippets Chen YY, Li BP, Wang JF, Wang Y, Luo SS, Lin RJ, Liao XW, Chen JQ.
Show Full Abstract

<h4>Background</h4>Accumulating evidence indicates that type II cystatin (CST) genes play a pivotal role in several tumor pathological processes, thereby affecting all stages of tumorigenesis and tumor development. However, the prognostic and predictive value of type II CST genes in GC has not yet been investigated.<h4>Methods</h4>The present study evaluated the expression and prognostic value of type II CST genes in GC by using The Cancer Genome Atlas (TCGA) database and the Kaplan-Meier plotter (KM plotter) online database. The type II CST genes related to the prognosis of GC were then screened out. We then validated the expression and prognostic value of these genes by immunohistochemistry. We also used Database for Annotation, Visualization, and Integrated Discovery (DAVID), Gene Multiple Association Network Integration Algorithm (GeneMANIA), Search Tool for the Retrieval of Interacting Genes/Proteins (STRING), nomogram, genome-wide co-expression analysis, and other bioinformatics tools to analyze the value of type II CST genes in GC and the underlying mechanism.<h4>Results</h4>The data from the TCGA database and the KM plotter online database showed that high expression of CST2 and CST4 was associated with the overall survival (OS) of patients with GC. The immunohistochemical expression analysis showed that patients with high expression of CST4 in GC tissues have a shorter OS than those with low expression of CST4 (HR = 1.85,95%CI: 1.13-3.03, P = 0.015). Multivariate Cox regression analysis confirmed that the high expression level of CST4 was an independent prognostic risk factor for OS.<h4>Conclusions</h4>Our findings suggest that CST4 could serve as a tumor marker that affects the prognosis of GC and could be considered as a potential therapeutic target for GC.

Also flagged:gene expressionfibrotic lung diseaseHIF1αendoplasmic reticulumATF4CHOP
Journal Article 2023-11-17 No Snippets Blumhagen RZ, Kurche JS, Cool CD, Walts AD, Heinz D, Fingerlin TE, Yang IV, Schwartz DA.
Show Full Abstract

<h4>Background</h4>Idiopathic pulmonary fibrosis (IPF) is a heterogeneous disease that is pathologically characterized by areas of normal-appearing lung parenchyma, active fibrosis (transition zones including fibroblastic foci) and dense fibrosis. Defining transcriptional differences between these pathologically heterogeneous regions of the IPF lung is critical to understanding the distribution and extent of fibrotic lung disease and identifying potential therapeutic targets. Application of a spatial transcriptomics platform would provide more detailed spatial resolution of transcriptional signals compared to previous single cell or bulk RNA-Seq studies.<h4>Methods</h4>We performed spatial transcriptomics using GeoMx Nanostring Digital Spatial Profiling on formalin-fixed paraffin-embedded (FFPE) tissue from 32 IPF and 12 control subjects and identified 231 regions of interest (ROIs). We compared normal-appearing lung parenchyma and airways between IPF and controls with histologically normal lung tissue, as well as histologically distinct regions within IPF (normal-appearing lung parenchyma, transition zones containing fibroblastic foci, areas of dense fibrosis, and honeycomb epithelium metaplasia).<h4>Results</h4>We identified 254 differentially expressed genes (DEGs) between IPF and controls in histologically normal-appearing regions of lung parenchyma; pathway analysis identified disease processes such as EIF2 signaling (important for cap-dependent mRNA translation), epithelial adherens junction signaling, HIF1α signaling, and integrin signaling. Within IPF, we identified 173 DEGs between transition and normal-appearing lung parenchyma and 198 DEGs between dense fibrosis and normal lung parenchyma; pathways dysregulated in both transition and dense fibrotic areas include EIF2 signaling pathway activation (upstream of endoplasmic reticulum (ER) stress proteins ATF4 and CHOP) and wound healing signaling pathway deactivation. Through cell deconvolution of transcriptome data and immunofluorescence staining, we confirmed loss of alveolar parenchymal signals (AGER, SFTPB, SFTPC), gain of secretory cell markers (SCGB3A2, MUC5B) as well as dysregulation of the upstream regulator ATF4, in histologically normal-appearing tissue in IPF.<h4>Conclusions</h4>Our findings demonstrate that histologically normal-appearing regions from the IPF lung are transcriptionally distinct when compared to similar lung tissue from controls with histologically normal lung tissue, and that transition zones and areas of dense fibrosis within the IPF lung demonstrate activation of ER stress and deactivation of wound healing pathways.

Also flagged:neurodegenerative diseaseHDorphanATP-binding cassette (ABC) transportersABCB1ABCC1
Journal Article 2023-11-17 No Snippets Stefan SM, Pahnke J, Namasivayam V.
Show Full Abstract

The discovery of both distinctive lead molecules and novel drug targets is a great challenge in drug discovery, which particularly accounts for orphan diseases. Huntington's disease (HD) is an orphan, neurodegenerative disease of which the pathology is well-described. However, its pathophysiological background and molecular mechanisms are poorly understood. To date, only 2 drugs have been approved on the US and European markets, both of which address symptomatic aspects of this disease only. Although several hundreds of agents were described with efficacy against the HD phenotype in in vitro and/or in vivo models, a successful translation into clinical use is rarely achieved. Two major impediments are, first, the lack of awareness and understanding of the interactome-the sum of key proteins, cascades, and mediators-that contributes to HD initiation and progression; and second, the translation of the little gained knowledge into useful model systems. To counteract this lack of data awareness, we manually compiled and curated the entire modulator landscape of successfully evaluated pre-clinical small-molecule HD-targeting agents which are annotated with substructural molecular patterns, physicochemical properties, as well as drug targets, and which were linked to benchmark databases such as PubChem, ChEMBL, or UniProt. Particularly, the annotation with substructural molecular patterns expressed as binary code allowed for the generation of target-specific and -unspecific fingerprints which could be used to determine the (poly)pharmacological profile of molecular-structurally distinct molecules.

SOX6
Also flagged:transcription factorsSRY-related box (SOX) subfamilySOX5SOX13spermatogenesistranslational modifications
Journal Article 2023-11-17 ✓ 1 Snippet Diawara M, Martin LJ.
In-Text Gene Mentions

…three members: SOX5,SOX6and SOX13.…

Show Full Abstract

Members of the SRY-related box (SOX) subfamily D (SoxD) of transcription factors are well conserved among vertebrate species and play important roles in different stages of male reproductive development. In mammals, the SoxD subfamily contains three members: SOX5, SOX6 and SOX13. Here, we describe their implications in testicular development and spermatogenesis, contributing to fertility. We also cover the mechanisms of action of SoxD transcription factors in gene regulation throughout male development. The specificity of activation of target genes by SoxD members depends, in part, on their post-translational modifications and interactions with other partners. Sperm production in adult males requires the coordination in the regulation of gene expression by different members of the SoxD subfamily of transcription factors in the testis. Specifically, the regulation of genes promoting adequate spermatogenesis by SoxD members is discussed in comparison between species.

Also flagged:UFM1cancercell proliferationoral squamous cell carcinomaOSCCUbiquitin fold modifier 1
Journal Article 2023-11-17 No Snippets Ke D, Guo HH, Jiang N, Shi RS, Fan TY.
Show Full Abstract

<h4>Background</h4>Ubiquitin fold modifier 1 (UFM1) overexpression is associated with cancer cell proliferation, migration and invasion. However, the roles and pathways of UFM1 in oral squamous cell carcinoma (OSCC) has remained undefined.<h4>Methods</h4>The expression of UFM1 and the relationship between UFM1 expression and prognosis were investigated using data of OSCC patients from The Cancer Genome Atlas (TCGA) database. The UFM1 co-expressed genes, and the association between the UFM1 expression and immune cells and ubiquitination were explored. The effects of UFM1 expression on the growth and migration of OSCC cells were investigated by siRNA interference, Cell Counting Kit-8 (CCK-8), Transwell, Western blotting, and wound healing experiments.<h4>Results</h4>UFM1 was highly expressed in OSCC. UFM1 overexpression was associated with short overall survival, disease-specific survival, and progression-free interval, and was an adverse factor for prognosis in OSCC. UFM1-related nomograms were significantly associated with poor prognosis in OSCC patients. Decreased UFM1 expression could inhibit the proliferation, migration, and invasion of OSCC cells. UFM1 was associated with the immune cells (such as the Th17 cells, T helper cells, and cytotoxic cells) and ubiquitination.<h4>Conclusion</h4>Elevated UFM1 expression was associated with poor prognosis, ubiquitination and immune infiltration in OSCC, and inhibition of UFM1 expression delayed OSCC progression, showing that UFM1 could be a biomarker for prognosis and treating OSCC patients.

Also flagged:AdolescentIdiopathic Scoliosisadolescent idiopathic scoliosisBICD2myosincalmodulin
Journal Article 2023-11-17 No Snippets Marie-Hardy L, Courtin T, Pascal-Moussellard H, Zakine S, Brice A.
Show Full Abstract

A significant genetic involvement has been known for decades to exist in adolescent idiopathic scoliosis (AIS), a spine deformity affecting 1-3% of the world population. However, though biomechanical and endocrinological theories have emerged, no clear pathophysiological explanation has been found. Data from the whole-exome sequencing performed on 113 individuals in 19 multi-generational families with AIS have been filtered and analyzed via interaction pathways and functional category analysis (Varaft, Bingo and Panther). The subsequent list of 2566 variants has been compared to the variants already described in the literature, with an 18% match rate. The familial analysis in two families reveals mutations in the BICD2 gene, supporting the involvement of the muscular system in AIS etiology. The cellular component analysis revealed significant enrichment in myosin-related and neuronal activity-related categories. All together, these results reinforce the suspected role of the neuronal and muscular systems, highlighting the calmodulin pathway and suggesting a role of DNA-binding activities in AIS physiopathology.

SOX6
Also flagged:immune responsetrichomonosisinfectionimmune-response-relatedT. gallinae infectionPRKCQ
Journal Article 2023-11-17 ✓ 1 Snippet Li X, Ni A, Zhang R, Li Y, Yuan J, Sun Y, Chen J, Ma H.
In-Text Gene Mentions

…inhibiting the geneSOX6expression [ 30…

Show Full Abstract

<i>Trichomonas gallinae</i> (<i>T. gallinae</i>) has a great influence on the pigeon industry. Pigeons display different resistance abilities to <i>T. gallinae</i>, so the study of the molecular mechanism of resistance is necessary in breeding disease resistant lines. MiRNA plays important roles in the immune response, but there are still no reports of miRNA regulating trichomonosis resistance. We used small RNA sequencing technology to characterize miRNA profiles in different groups. <i>T. gallinae</i> was nasally inoculated in one day old squabs, and according to the infection status, the groups were divided into control (C), susceptible (S) and tolerant (T) groups. We identified 2429 miRNAs in total, including 1162 known miRNAs and 1267 new miRNAs. In a comparison among the C, S and T groups, the target genes of differentially expressed miRNAs were analyzed via GO and KEGG annotation. The results showed that the target genes were enriched in immune-response-related pathways. This indicated that the differentially expressed miRNAs had a critical influence on <i>T. gallinae</i> infection. Novel_miR_741, which could inhibit the expression of <i>PRKCQ</i>, was down-regulated in the T group compared to the C group. It was proven that a decreased novel_miR_741 expression would increase the expression of <i>PRKCQ</i> and increase the immune response. This study brings new insights into understanding the mechanism of trichomonosis resistance.

Also flagged:synthesispolyvinylpyrrolidonehydroxyapatitenitrogendegradationmineral
Journal Article 2023-11-17 No Snippets Petrova A, Mamin G, Gnezdilov O, Fadeeva I, Antonova O, Forysenkova A, Antoniac IV, Rau JV, Gafurov M.
Show Full Abstract

The synthesis of biocompatible and bioresorbable composite materials, such as a "polymer matrix-mineral constituent," stimulating the natural growth of living tissues and the restoration of damaged parts of the body, is one of the challenging problems in regenerative medicine and materials science. Composite films of bioresorbable polymer of polyvinylpyrrolidone (PVP) and hydroxyapatite (HA) were obtained. HA was synthesized in situ in the polymer solution. We applied electron paramagnetic resonance (EPR) and nuclear magnetic resonance (NMR) approaches to study the composite films' properties. The application of EPR in two frequency ranges allowed us to derive spectroscopic parameters of the nitrogen-based light and radiation-induced paramagnetic centers in HA, PVP and PVP-HA with high accuracy. It was shown that PVP did not significantly affect the EPR spectral and relaxation parameters of the radiation-induced paramagnetic centers in HA, while light-induced centers were detected only in PVP. Magic angle spinning (MAS) <sup>1</sup>H NMR showed the presence of two signals at 4.7 ppm and -2.15 ppm, attributed to "free" water and hydroxyl groups, while the single line was attributed to <sup>31</sup>P. NMR relaxation measurements for <sup>1</sup>H and <sup>31</sup>P showed that the relaxation decays were multicomponent processes that can be described by three components of the transverse relaxation times. The obtained results demonstrated that the applied magnetic resonance methods can be used for the quality control of PVP-HA composites and, potentially, for the development of analytical tools to follow the processes of sample treatment, resorption, and degradation.

Also flagged:KeloidHypertrophic ScarTriamcinoloneacnevasodilationcollagen
Journal Article 2023-11-17 No Snippets Van Nguyen L, Ly HQ, Vo HT, Pham TT, Nguyen NK, Vo TV, Phan TQ, Tran PTN, Ly HHV, Mai HTT.
Show Full Abstract

<h4>Background</h4>Excessive scarring is a common problem that can have significant cosmetic and psychological consequences for patients. Intralesional injection therapy, such as the use of triamcinolone, has emerged as an effective treatment option for hypertrophic scars. The objective of this study was to describe the morphological features of hypertrophic scars, categorize them, and evaluate the efficacy of triamcinolone injection therapy in treating these scars.<h4>Materials and methods</h4>A cross-sectional descriptive study of 80 patients with hypertrophic scars treated with triamcinolone intralesional injection at Can Tho University of Medicine and Pharmacy Hospital from 5/2018 to 5/2021.<h4>Results</h4>There were 80 patients in all, with a male/female ratio of 1/1.05 and a median age of 15-35. There were 129 scars in all, with scar age >1 year accounting for 83%, keloid scars accounting for 64%, and hypertrophic scars accounting for the remaining 36%. Scars are most commonly seen on the trunk, accounting for 53.5% of all scars, particularly on the anterior chest wall. When the source of scars was discovered, trauma and acne accounted for 24% and 23%, respectively, while the rest were predominantly spontaneous scars, accounting for 49%. Scarring and discomfort of mild to moderate severity were common clinical symptoms; scars larger than 5cm in size had more symptoms than scars smaller than 5cm. Prior to the therapy, the mean Vancouver Score Scale-VSS was 6.55±2.13. After 24 weeks of the therapy, 96.7% of patients had entirely improved itching symptoms, 75% had completely improved pain, and 25% still had minimal pain. After therapy, the mean Vancouver Score Scale-VSS was 2.55±1.81 (p<0.05). At week 24, 3.75% of patients experienced skin shrinkage, 3.75% experienced depigmentation, and 13.75% experienced vasodilation.<h4>Conclusion</h4>Triamcinolone intralesional injection should be utilized as a first-line therapy for hypertrophic scarring.

Also flagged:oligonucleotidesnucleotidegenetic disordersconjugationantibodiesgene expression
Journal Article 2023-11-17 No Snippets Collotta D, Bertocchi I, Chiapello E, Collino M.
Show Full Abstract

Antisense oligonucleotides (ASOs) are short single stranded synthetic RNA or DNA molecules, whereas double-stranded RNA nucleotide sequences are called small interfering RNA (siRNA). ASOs bind to complementary nucleic acid sequences impacting the associated functions of the targeted nucleic acids. They represent an emerging class of drugs that, through a revolutionary mechanism of action, aim to directly regulate disease-causing genes and their variants, providing an alternative tool to traditional "protein-specific" therapies. The majority of the ASOs are designed to treat orphan genetic disorders that in most of the cases are seriously disabling and still lacking an adequate therapy. In order to translate ASOs into clinical success, constant technological advances have been instrumental in overcoming several pharmacological, toxicological and formulation limitations. Accordingly, chemical structures have been recently implemented and new bio-conjugation and nanocarriers formulation strategies explored. The aim of this work is to offer an overview of the antisense technology with a comparative analysis of the oligonucleotides approved by the Food and Drug Administration (FDA) and the European Medicines Agency (EMA).

DCC
Also flagged:chromosomeesophageal adenocarcinomaCD3tumorEsophageal cancercancer
Journal Article 2023-11-17 ✓ 2 Snippets Raters VM, Gebauer F, Löser H, Schröder W, Schlösser HA, Fuchs H, Bruns C, Quaas A, Zander T.
In-Text Gene Mentions

For the following analyses, the 44 markers for which > 30% (n ≥ 270) TMA samples could be evaluated were included: Programmed cell death 1 ligand 1 (PD-L1), T-cell immunoglobulin mucin receptor 3 (TIM-3), Lymphocyte activation gene 3 protein (LAG-3), Receptor tyrosine-protein kinase erbB-2 (HER2), cellular tumor antigen p53, Scavenger receptor class B member 1 (CD36), Carcinoembryonic antigen-related cell adhesion molecule 8 (CD66b), Proliferation marker protein Ki-67, E3 ubiquitin-protein ligase Mdm2, Antigen-presenting major histocompatibility complex class I (MHC-1), High mobility group protein B1 (HMGB1), DNA mismatch repair protein Mlh1, T-cell surface glycoprotein CD3 cell tumor infiltration, Mesothelin, AT-rich interactive domain-containing protein 1A (ARID domain-containing protein 1A), Pre-mRNA-splicing factor ini1, Probable global transcription activator SNF2L2 (BRM), Transcription activator BRG1, Aldo-keto reductase family 1 (AKR1), Claudin-18, Hepatocyte growth factor receptor (MET), Myc proto-oncogene protein, GTPase KRas, Transcription factor GATA-6, Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform (PIK3CA), preserved Y chromosome, Integrin alpha-5, Integrin beta-1, Integrin beta-4, Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase (PTEN), Fructose-1,6-bisphosphatase 1 (FBP1), Trimethylation of histone H3 lysine 27 (H3K27m3), Ubiquilin-4 (UBQLN4), Tumor-associated calcium signal transducer 2 (TROP-2), F-box/WD repeat-containing protein 7 (FBXW7), G1/S-specific cyclin-D1 (Cyclin D1), Cyclin-dependent kinase inhibitor 2A (CDKN2A/p16), U3 small nucleolar ribonucleoprotein protein IMP3, Cadherin-1 (E-cadherin), Carbonic anhydrase 9, E3 ubiquitin-protein ligase XIAP, Immunoglobulin superfamily DCC subclass member 4 (NOPE) on cancer cells, Hematopoietic progenitor cell antigen CD34 quantity and Gremlin-1 (GREM1) RNA.

…ubiquitin-protein ligase XIAP,Immunoglobulin superfamily DCC subclass member 4superfamily DCC subclass…

Show Full Abstract

<h4>Background</h4>Staging, especially clinical lymph node staging in esophageal adenocarcinoma has only moderate sensitivity and specificity. Therefore, we evaluated combined molecular markers to predict prognosis.<h4>Patients and methods</h4>890 tumor tissue samples were obtained from patients who underwent surgery for esophageal adenocarcinoma with curative intent. These were stained by tissue micro array for 48 markers which are associated with tumorigenesis and correlated with clinical data (TNM-staging, overall survival) by multivariate Cox regression.<h4>Results</h4>Two markers (preserved Y chromosome and high grade of (CD3+) T-cell infiltration) were found to be significantly and independently associated with better overall survival. We formed a score (called CY score) from the two markers. The more markers are positive and thus the higher the score (ranging from 0 to 2), the better the overall survival, independently of UICC. Moreover, we developed a combination score of the UICC and CY score based on cluster analysis. Patients with a UICC stage of III with the presence of both traits (CY=2) can be assigned to a better prognosis group (group II), whereas patients with a UICC stage of I without both traits (CY=0) must be assigned to a worse prognosis group (group II). Therefore, patients in stage I with adverse molecular signature might benefit of multimodal therapy.<h4>Conclusion</h4>In summary, the CY score adds prognostic information to the UICC stage based on tumor biology in esophageal adenocarcinoma and warrants further evaluations in independent clinical cohorts.

SUDS3
Also flagged:bacterial diseasePiscirickettsiosisbacterial infectionimmune responsespliceosomeSRSF7
Journal Article 2023-11-17 ✓ 1 Snippet Bravo S, Moya J, Leiva F, Guzman O, Vidal R.
In-Text Gene Mentions

…(e.g., lysosome C,AP-1 complexcomplex subunit sigma-3-like)…

Show Full Abstract

In the Chilean salmon farming industry, infection by <i>Piscirickettsia salmonis</i> is the primary cause of the main bacterial disease known as Piscirickettsiosis, which has an overwhelming economic impact. Although it has been demonstrated that Piscirickettsiosis modifies the expression of numerous salmonids genes, it is yet unknown how alternative splicing (AS) contributes to salmonids bacterial infection. AS, has the potential to create heterogeneity at the protein and RNA levels and has been associated as a relevant molecular mechanism in the immune response of eukaryotes to several diseases. In this study, we used RNA data to survey <i>P. salmonis</i>-induced modifications in the AS of Atlantic salmon and found that <i>P. salmonis</i> infection promoted a substantial number (158,668) of AS events. Differentially spliced genes (DSG) sensitive to Piscirickettsiosis were predominantly enriched in genes involved in RNA processing, splicing and spliceosome processes (e.g., hnRNPm, hnRPc, SRSF7, SRSF45), whereas among the DSG of resistant and susceptible to Piscirickettsiosis, several metabolic and immune processes were found, most notably associated to the regulation of GTPase, lysosome and telomere organization-maintenance. Furthermore, we found that DSG were mostly not differentially expressed (5-7 %) and were implicated in distinct biological pathways. Therefore, our results underpin AS achieving a significant regulatory performance in the response of salmonids to Piscirickettsiosis.

VRK2
Also flagged:C-RafcancerRasRafMEKERK
Journal Article 2023-11-17 ✓ 3 Snippets Ta L, Tsai BL, Deng W, Sha J, Varuzhanyan G, Tran W, Wohlschlegel JA, Carr-Ascher JR, Witte ON.
In-Text Gene Mentions

…VRK1 andVRK2, two serine/threonine kinases…

…regulate VRK1 andVRK2activity.…

…increased VRK1 andVRK2activity.…

Show Full Abstract

Mutated Ras and Raf kinases are well-known to promote cancer metastasis via flux through the Ras/Raf/MEK/ERK (mitogen-activated protein kinase [MAPK]) pathway. A role for non-mutated Raf in metastasis is also emerging, but the key mechanisms remain unclear. Elevated expression of any of the three wild-type Raf family members (C, A, or B) can drive metastasis. We utilized an <i>in vivo</i> model to show that wild-type C-Raf overexpression can promote metastasis of immortalized prostate cells in a gene dosage-dependent manner. Analysis of the transcriptomic and phosphoproteomic landscape indicated that C-Raf-driven metastasis is accompanied by upregulated MAPK signaling. Use of C-Raf mutants demonstrated that the dimerization domain, but not its kinase activity, is essential for metastasis. Endogenous Raf monomer knockouts revealed that C-Raf's ability to form dimers with endogenous Raf molecules is important for promoting metastasis. These data identify wild-type C-Raf heterodimer signaling as a potential target for treating metastatic disease.

HTT
Also flagged:oligonucleotidesalbuminbindinggene silencingcytokineinflammatory responses
Journal Article 2023-11-17 ✓ 5 Snippets Fakih HH, Tang Q, Summers A, Shin M, Buchwald JE, Gagnon R, Hariharan VN, Echeverria D, Cooper DA, Watts JK, Khvorova A, Sleiman HF.
In-Text Gene Mentions

…probe sets (mouseHtt, mouse Ppib…

…probe sets: mouseHtt(SB-14150) and mouse…

Httdata were normalized…

…target Huntingtin (Htt).…

…targeting positive controlHtt-DCA-siRNA, or albumin-binding…

Show Full Abstract

Although an increasing number of small interfering RNA (siRNA) therapies are reaching the market, the challenge of efficient extra-hepatic delivery continues to limit their full therapeutic potential. Drug delivery vehicles and hydrophobic conjugates are being used to overcome the delivery bottleneck. Previously, we reported a novel dendritic conjugate that can be appended efficiently to oligonucleotides, allowing them to bind albumin with nanomolar affinity. Here, we explore the ability of this novel albumin-binding conjugate to improve the delivery of siRNA <i>in vivo</i>. We demonstrate that the conjugate binds albumin exclusively in circulation and extravasates to various organs, enabling effective gene silencing. Notably, we show that the conjugate achieves a balance between hydrophobicity and safety, as it significantly reduces the side effects associated with siRNA interactions with blood components, which are commonly observed in some hydrophobically conjugated siRNAs. In addition, it reduces siRNA monocyte uptake, which may lead to cytokine/inflammatory responses. This work showcases the potential of using this dendritic conjugate as a selective albumin binding handle for the effective and safe delivery of nucleic acid therapeutics. We envision that these properties may pave the way for new opportunities to overcome delivery hurdles of oligonucleotides in future applications.

Also flagged:Intraventricular hemorrhageintrauterine infectionspreeclampsiaeclampsiaphenobarbitonecerebral palsy
Journal Article 2023-11-17 No Snippets Pande GS, Vagha JD.
Show Full Abstract

Intraventricular hemorrhage (IVH) is a type of bleeding that occurs through the germinal matrix and comes through the ependymal cells into the ventricular cavity. It is mostly seen in preterm neonates but can also be seen sometimes in term neonates. Various factors predispose to preterm delivery; it can be spontaneous or medically induced. Spontaneous IVH occurs in cases of intrauterine infections in the mother, and it can be induced in cases of medical emergencies such as preeclampsia and eclampsia. The brain of a preterm newborn is not fully developed as it does not have pericytes and proteins, so it can bleed very quickly, which can cause IVH. Also, the vessels supplying the germinal matrix are immature and highly vascularized. IVH has four grades based on findings detected on cranial ultrasound and MRI. Management includes medical and surgical management; medical management includes phenobarbitone used for seizures and prophylaxis. Surgical management includes drainage, irrigation, and fibrinolytic therapy (DRIFT), and neuro-endoscopic lavage. IVH causes various short-term and long-term neurodevelopmental consequences. Long-term complications include cerebral palsy and intellectual disability, which hamper the life of the child. It mainly presents with seizures, flaccidity, decerebrate posture, etc. Various preventive measures can be taken to tackle IVH in newborns. First of all, preterm delivery should be avoided, and intrauterine infections in mothers should be treated. The administration of corticosteroids should be done for all preterm deliveries as it helps in the maturation of organs. The administration of magnesium sulfate should be done as it is neuroprotective and reduces cerebral palsy in the future. Delayed cord clamping is to be done to reduce recurrent blood transfusions and decrease the risk of IVH. This article explains the pathogenesis, management, prevention, and future outcomes of IVH.

Also flagged:Thiolhyaluronic acidchitosancancerfolliclealginate
Journal Article 2023-11-17 No Snippets Khunmanee S, Yoo J, Lee JR, Lee J, Park H.
Show Full Abstract

There is a great deal of potential for <i>in vitro</i> follicle growth to provide an alternative approach to fertility preservation. This strategy reduces the possibility of cancer cells re-exposure after transplantation, and it does not require hormone stimulation. Adopting a three-dimensional (3D) culture method helps preserve the architecture of the follicle and promotes the maturity of oocytes. In order to maintain follicle morphology, enhance the quality of mature oocytes, and facilitate meiotic spindle assembly, the current work aimed to develop the 3D <i>in vitro</i> preantral mouse follicle culture method. Thiolated chitosan-co-thiolated hyaluronic (CSHS) hydrogel was designed to evaluate the effects of biomaterials on ovarian follicle development. Isolated follicles from mouse ovaries were randomly divided into alginate (Alg) as a 3D control, thiolated hyaluronic acid (HASH), and CSHS groups. Single follicle was encapsulated in each hydrogel, and performed for 10 days and subsequently ovulated to retrieve mature oocytes on day 11. CSHS hydrogel promoted follicle survival and oocyte viability with maintained spherical morphology of follicle. Matured oocytes with normal appearance of meiotic spindle and chromosome alignment were higher in the CSHS group compared with those in the Alg and HASH groups. Furthermore, CSHS increased expression level of folliculogenesis genes (TGFβ-1, GDF-9) and endocrine-related genes (LHCGR, and FSHR). With various experimental setups and clinical applications, this platform could be applied as an alternative method to <i>in vitro</i> follicle culture with different experimental designs and clinical applications in the long-term period.

TNFSF4
Also flagged:triple-negative breast cancerandrogen receptorBMS-754807cytochalasin blinifanibFZD10
Journal Article 2023-11-17 ✓ 1 Snippet Huang X, Huang J, Huang Q, Zhou S.
In-Text Gene Mentions

…unotherapy biomarkers (CX3CL1,TNFSF4, VEGFA) were higher…

Show Full Abstract

<h4>Background</h4>According to the Fudan University Shanghai Cancer Center (FUSCC) system, triple-negative breast cancer (TNBC) is divided into four stable subtypes: (I) luminal androgen receptor, (II) immunomodulatory, (III) basal-like immune-suppressed (BLIS), and (IV) mesenchymal-like. However, the treatment outcomes of the corresponding targeted therapies are unsatisfactory, especially for the BLIS subtype. Therefore, we aimed to identify the key long noncoding RNAs (lncRNAs) to construct a prognostic model for BLIS subtype and discover potential targets to explore potential therapeutic strategies in this study.<h4>Methods</h4>The FUSCC cohort was used to establish a prognostic risk model via least absolute shrinkage and selection operator (LASSO) and Cox regression analysis. The Cancer Genome Atlas (TCGA) cohort was then used to evaluate and verify the model. To understand the functional aspects of the model, functional, immune landscape, mutation, and drug sensitivity analyses were performed between high- and low-risk groups.<h4>Results</h4>Ten prognostic-related lncRNAs identified, including <i>C5ORF66-AS2</i>, <i>DIO3OS</i>, <i>FZD10-DT</i>, <i>LINC00393</i>, <i>LNC-ERI1-32</i>, <i>LNC-FOXO1-2</i>, <i>LNC-SPARCL1-1</i>, <i>HCG23</i>, <i>LNC-MMD-4</i> and <i>LNC-TMEM106C-6</i>, were selected for risk score system construction. The results showed that the model constructed could divide the patients with BLIS subtype into two groups of high and low risk, and patients with higher risk scores had shorter recurrence-free survival. In addition, drug sensitivity analysis identified 3 compounds, including BMS-754807, cytochalasin b, and linifanib, that could have a potential therapeutic effect on patients with the BLIS subtype.<h4>Conclusions</h4>The risk prognosis model showed good prognostic value for the BLIS subtype patients, and the ten lncRNAs may be potential therapeutic targets.

HFE
Also flagged:non-alcoholic fatty liver diseasemetabolic syndromeinsulin resistancenon-communicable diseasesobesitytype 2 diabetes
Journal Article 2023-11-17 ✓ 1 Snippet Grinshpan LS, Eilat-Adar S, Ivancovsky-Wajcman D, Kariv R, Gillon-Keren M, Zelber-Sagi S.
In-Text Gene Mentions

…(Wilson disease andhemochromatosis) liver diseases, alcohol-rela…

Show Full Abstract

<h4>Background</h4>High ultra-processed food (UPF) consumption is associated with the development of various diet-related non-communicable diseases, especially obesity and type 2 diabetes. The present study aimed to systematically review the association between UPF consumption and non-alcoholic fatty liver disease (NAFLD) and its leading risk factors; metabolic syndrome (MetS) and insulin resistance (IR).<h4>Methods</h4>A comprehensive search was conducted in PubMed, Scopus, Embase, Web of Science, CINAHL, and Cochrane (March 2023), and references of the identified articles were checked. The search keywords were defined through an exploratory investigation in addition to MeSH and similarly controlled vocabulary thesauruses. Observational and interventional studies were included. Studies that focused only on specific groups of processed foods or overlapping dietary patterns were excluded. The quality assessment was conducted using the Joanna Briggs Institute's critical appraisal tools for observational studies and Cochrane's risk of bias 2 tool for randomized-control trials. A narrative synthesis was employed to report the results.<h4>Results</h4>Fifteen studies were included, with a total of 52,885 participants, one randomized-controlled trial, and fourteen observational studies (nine cross-sectional and five prospective). The review has shown a significant association between UPF consumption and NAFLD in three studies out of six, MetS in five out of eight, and IR in one out of three. All large-scale prospective cohorts that studied NAFLD or MetS outcomes demonstrated a positive association. In contrast, studies that did not demonstrate significant associations were mostly cross-sectional and small. The evidence for an association with IR was insufficient and conflicting.<h4>Conclusion</h4>The included studies are few, observational, and based upon self-reported dietary assessment tools. However, current evidence indicates that UPF is not only associated with obesity and type 2 diabetes but may also be a risk factor for NAFLD and MetS. UPF is a worldwide concern deserving further longitudinal research.<h4>Impact and implications</h4>Overconsumption of ultra-processed food (UPF) may lead to the development of obesity and type 2 diabetes, but the association with non-alcoholic fatty liver disease (NAFLD) is not well established. The present systematic review shows that UPF may be associated with NAFLD, although more large prospective studies are needed. These findings emphasize the importance of minimizing the consumption of UPF to prevent NAFLD and other metabolic diseases among the general adult population. This systematic review and further prospective studies, epidemiological or interventional, can help physicians provide patients with evidence-based nutritional recommendations and will support policymakers in restricting the marketing of UPF as well as promoting affordable, healthy, and minimally processed foods.

PLCL1
Also flagged:telomerelung adenocarcinomaTelomereschromosomecancersLUAD
Journal Article 2023-11-17 ✓ 1 Snippet Zhang W.
In-Text Gene Mentions

…TRGs, followed byPLCL1, MYOM2, CENPF and…

Show Full Abstract

No abstract available.

Also flagged:diabetic nephropathyDNCASP3DHCR24CXCL1GYPC
Journal Article 2023-11-17 No Snippets Bi H, Ma L, Zhong X, Long G.
Show Full Abstract

No abstract available.

medRxiv 2023-11-17 Preprint (No Snippets API) Lucas MR, Atkins JL, Pilling LC, Shearman J, Melzer D.
Show Full Abstract

<h4>Objectives</h4> HFE haemochromatosis genetic variants have an uncertain clinical penetrance, especially to older ages and in undiagnosed groups. We estimated p.C282Y and p.H63D variant cumulative incidence of multiple clinical outcomes in a large community cohort. <h4>Design</h4> Prospective cohort study. <h4>Setting</h4> 22 assessment centres across England, Scotland, and Wales in the UK Biobank (2006-2010). <h4>Participants</h4> 451,270 participants genetically similar to the 1000-Genomes European reference population, with a mean 13.3-year follow-up through hospital inpatient, cancer registries and death certificate data. <h4>Main outcome measures</h4> Cox proportional hazard ratios of incident clinical outcomes and mortality in those with HFE p.C282Y-p.H63D mutations compared to those with no variants, stratified by sex and adjusted for age, assessment centre and genetic stratification. Cumulative incidences were estimated from age 40 to 80 years. <h4>Results</h4> 12.1% of p.C282Y+/+ males had baseline (mean age 57) haemochromatosis diagnoses, with age 80 cumulative incidence of 56.4%. 33.1% died vs. 25.4% without HFE variants (Hazard Ratio [HR] 1.29, 95% CI: 1.12-1.48, p=4.7*10 -4 ); 27.9% vs 17.1% had joint replacements, 20.3% vs 8.3% had liver disease, and there was excess delirium, dementia, and Parkinson’s disease, but not depression. Associations, including excess mortality, were similar in the group undiagnosed with haemochromatosis. 3.4% of p.C282Y+/+ females had baseline haemochromatosis diagnoses, with cumulative age 80 incidence of 40.5%. There was excess incident liver disease (8.9% vs 6.8%; HR 1.62, 95% CI: 1.27-2.05, p=7.8*10 -5 ), joint replacements and delirium, with similar results in the undiagnosed. p.C282Y/p.H63D and p.H63D+/+ men or women had no statistically significant excess fatigue or depression at baseline and no excess incident outcomes. <h4>Conclusions</h4> Male and female p.C282Y homozygotes experienced greater excess morbidity than previously documented, including those undiagnosed with haemochromatosis in the community. As haemochromatosis diagnosis rates were low at baseline despite treatment being considered effective, trials of screening to identify people with p.C282Y homozygosity early appear justified. <h4>Strengths and limitations of this study</h4> We analyzed largescale data on community volunteers from the UK Biobank, one of the world’s largest HFE genotyped cohorts. We have analyzed incident disease outcomes during an extended follow-up period of mean 13.3 years. We have provided the first clinical outcome data to age 80 years in those with haemochromatosis genotypes, including those undiagnosed with haemochromatosis at baseline, expanding the life-course evidence on HFE penetrance. UK Biobank participants were somewhat healthier than the general population, but HFE allele frequencies were similar to previous UK studies. Incident outcomes were from hospital inpatient and cancer registry follow-up, so did not rely on potentially biased patient self-reporting, but community diagnosed conditions may be underestimated.

DCC
Also flagged:Ginkgolide BMST1schizophreniaAlzheimer's diseaseADdepression
Journal Article 2023-11-16 ✓ 5 Snippets Yang T, Du X, Xu L.
In-Text Gene Mentions

Additionally, exogenous Netrin-1 alleviated X-ray-induced ROS production and apoptosis, whereas knockout of Netrin-1 receptor DCC abolished the protective effect of GB.<h4>Conclusion</h4>Oxidative stress and MST1-mediated neuronal apoptosis participated in radiation-induced cognitive impairment and depression-like behaviors, and modulation of DCC by GB was an effective intervention against RBI.

Immunofluorescence double staining, Dihydroethidium (DHE), western blot, and flow cytometry were used to explore the role of DCC/MST1 signaling in RBI.<h4>Results</h4>In this study, X-ray-treated mice exhibited cognitive impairment and depression-like behavior, which was ameliorated by GB treatment.

…mediating role ofDCC/MST1 signaling.…

…the role ofDCC/MST1 signaling in RBI.<h4>Res…

…of Netrin-1 receptorDCCabolished the protective…

Show Full Abstract

<h4>Purpose</h4>The risk of brain exposure to ionizing radiation increases gradually due to the extensive application of nuclear technology in medical, industrial, and aerospace fields. Radiation-induced brain injury (RBI) is highly likely to cause a wide range of neurological complications, including schizophrenia, Alzheimer's disease (AD), depression. Ginkgolide B (GB) is one of the effective active components extracted from ginkgo biloba leaves, exerts protective effects on CNS, which is involved in the regulation of the Hippo signaling pathway. MST1, as one of the core kinases of the Hippo pathway, participated in regulating cell proliferation, differentiation, and apoptosis. However, it remains unclear whether GB attenuates radiation brain injury (RBI) and whether the radioprotective effect of GB refers to MST1 signaling. Hence, our study aimed to explore the radiation protection effect and the potential mechanism of GB.<h4>Materials and methods</h4>C57BL/6 mice were stimulated with an X-ray (20 Gy) to establish an RBI model. Then, morris water maze test (MWM) and step-down passive avoidance test (SDPAT) were used to assess the learning and memory function of mice. The open field test (OFT), tail suspension test (TST), and forced swimming test (FST) were used to assess changes in locomotor activity and hopelessness. Besides, X-ray-stimulated SH-SY5Y cells were used to verify the radioprotective effect of GB. Immunofluorescence double staining, Dihydroethidium (DHE), western blot, and flow cytometry were used to explore the role of DCC/MST1 signaling in RBI.<h4>Results</h4>In this study, X-ray-treated mice exhibited cognitive impairment and depression-like behavior, which was ameliorated by GB treatment. GB also reduced the ROS production and the number of TUNEL-positive cells in the hippocampus. Moreover, GB increased the protein levels of p-AKT and Bcl2, while decreased the protein levels of MST1, p-p38, p-JNK, cleaved-caspase-3 and Bax both in vivo and in vitro. Additionally, exogenous Netrin-1 alleviated X-ray-induced ROS production and apoptosis, whereas knockout of Netrin-1 receptor DCC abolished the protective effect of GB.<h4>Conclusion</h4>Oxidative stress and MST1-mediated neuronal apoptosis participated in radiation-induced cognitive impairment and depression-like behaviors, and modulation of DCC by GB was an effective intervention against RBI.

PLCL1HTT
Also flagged:ovipositionegg-layingchromosomesNELL2SPTLC2SMYD3
Journal Article 2023-11-16 ✓ 5 Snippets Wang J, Liu Z, Cao D, Liu J, Li F, Han H, Han H, Lei Q, Liu W, Li D, Wang J, Zhou Y.
In-Text Gene Mentions

…, SMYD3 andPLCL1were the most…

…), huntingtin (HTT), pro-apoptotic WT1…

…like 1 (PLCL1), calcium voltage-gated…

…, PAWR ,PLCL1have been shown…

…phospholipase C-like proteinsPLCL1and PLCL2 are…

Show Full Abstract

<h4>Background</h4>Egg laying rate (LR) is associated with a clutch, which is defined as consecutive days of oviposition. The clutch trait can be used as a selection indicator to improve egg production in poultry breeding. However, little is known about the genetic basis of clutch traits. In this study, our aim was to estimate genetic parameters and identify quantitative trait single nucleotide polymorphisms for clutch traits in 399 purebred Laiwu Black chickens (a native Chinese breed) using a genome-wide association study (GWAS).<h4>Methods</h4>In this work, after estimating the genetic parameters of age at first egg, body weight at first egg, LR, longest clutch until 52 week of age, first week when the longest clutch starts, last week when the longest clutch ends, number of clutches, and longest number of days without egg-laying until 52 week of age, we identified single nucleotide polymorphisms (SNPs) and potential candidate genes associated with clutch traits in Laiwu Black chickens. The restricted maximum likelihood method was used to estimate genetic parameters of clutch pattern in 399 Laiwu Black hens, using the GCTA software.<h4>Results</h4>The results showed that SNP-based heritability estimates of clutch traits ranged from 0.06 to 0.59. Genotyping data were obtained from whole genome re-sequencing data. After quality control, a total of 10,810,544 SNPs remained to be analyzed. The GWAS revealed that 421 significant SNPs responsible for clutch traits were scattered on chicken chromosomes 1-14, 17-19, 21-25, 28 and Z. Among the annotated genes, NELL2, SMYD9, SPTLC2, SMYD3 and PLCL1 were the most promising candidates for clutch traits in Laiwu Black chickens.<h4>Conclusion</h4>The findings of this research provide critical insight into the genetic basis of clutch traits. These results contribute to the identification of candidate genes and variants. Genes and SNPs potentially provide new avenues for further research and would help to establish a framework for new methods of genomic prediction, and increase the accuracy of estimated genetic merit for egg production and clutch traits.

Also flagged:CacyBPPD-1cancerprogrammed cell death-1hepatocellular carcinomaSIP
Journal Article 2023-11-16 No Snippets Wang J, Zhang X, Ma X, Chen D, Cai M, Xiao L, Li J, Huang Z, Huang Y, Lian Y.
Show Full Abstract

<h4>Background</h4>Despite remarkable advancements in cancer immunotherapy, the overall response rate to anti-programmed cell death-1 (anti-PD-1) therapy in hepatocellular carcinoma (HCC) patients remains low. Our previous study has demonstrated the critical role of CacyBP/SIP (Calcyclin-Binding Protein and Siah-1 Interacting Protein) as a regulator of HCC development and progression. However, the possible impact of CacyBP on the tumor immune microenvironment has not yet been clarified.<h4>Methods</h4>The expressions of CacyBP and Myd88 in HCC cell lines and tissues was detected by bioinformatics analysis, real-time quantitative PCR, western blotting and immunohistochemistry. The interaction between CacyBP and Myd88 was measured using co-immunoprecipitation and immunofluorescence. In vitro and in vivo assays were used to investigate the regulation of CacyBP on tumor-associated macrophages (TAMs).<h4>Results</h4>We identified that CacyBP was positively correlated with Myd88, a master regulator of innate immunity, and Myd88 was a novel binding substrate downstream of CacyBP in HCC. Additionally, CacyBP protected Myd88 from Siah-1-mediated proteasome-dependent degradation by competitively binding to its Toll/interleukin-1 receptor (TIR) domain. Inhibition of CacyBP-Myd88 signaling subsequently diminished HDAC1-mediated H3K9ac and H3K27ac modifications on the CX3CL1 promoter and reduced its transcription and secretion in HCC cells. Moreover, by using in vitro and in vivo strategies, we demonstrated that depletion of CacyBP impaired the infiltration of TAMs and the immunosuppressive state of the tumor microenvironment, further sensitizing HCC-bearing anti-PD-1 therapy.<h4>Conclusions</h4>Our findings suggest that targeting CacyBP may be a novel treatment strategy for improving the efficacy of anti-PD-1 immunotherapy in HCC.

PEBP1
Also flagged:immune responsecariesdefense responsesynthesistumor necrosis factor-alphaT-cell receptor alpha variable 4
Journal Article 2023-11-16 ✓ 1 Snippet Aruna P, Patil SS, Muthu MS, Vettriselvi V, Arockiam S, Kirubakaran R, Sivakumar N.
In-Text Gene Mentions

…protein 1 (PEBP1), CCAAT enhancer…

Show Full Abstract

<h4>Background</h4>Early childhood caries is a significant public health concern affecting about 600 million children globally. The etiology of early childhood caries can be explained as an interplay between genetic and environmental factors. Single nucleotide polymorphisms are the most common variations in the human genome. Genetic variations of immune response genes can modify the defense response of the host, and alter the susceptibility to bacterial colonization of the oral cavity and early childhood caries. The aim of this systematic review is to identify genetic variants of immune response genes associated with early childhood caries.<h4>Results</h4>A total of 7124 articles were identified by conducting an elaborate search across various electronic databases and genome-wide association studies databases. Subsequent to exclusion at various stages, fifteen articles qualified to be included into the present review. Risk of bias assessment was done with the Q-genie tool. Quantitative synthesis revealed that the odds ratio for TT and CC genotypes of rs11362 was 1.07 (0.67-1.71) and 1.16 (0.84-1.60), respectively. Gene-based analysis revealed a statistically significant association between variants of tumor necrosis factor-alpha gene and T-cell receptor alpha variable 4 locus with early childhood caries. Gene clustering showed the presence of three functional clusters. To comprehend the protein-protein interaction, the bioinformatic tool of "Search Tools for the Retrieval of Interacting Genes and Proteins" was used. Among the biological processes and the reactome pathways, complement activation through the lectin pathway showed the highest strength of association with early childhood caries. To understand the interaction and functionality of the genes, "gene function prediction using Multiple Association Network Integration Algorithm" was used, which revealed that the genes were linked by physical interaction (39.34%) and through co-expression (34.88%).<h4>Conclusions</h4>Genotype TT of rs7217186 of arachidonate 15-lipoxygenase gene was a risk factor for early childhood caries. Multiple genetic variants of T-cell receptor alpha variable 4 locus and tumor necrosis factor-alpha gene were associated with increased susceptibility to early childhood caries. Polymorphisms of genes regulating the lectin pathway of complement activation can modify the susceptibility to early childhood caries.

HFE
Also flagged:liver fibrosisironliver diseasechronic liver diseasescirrhosiscongestive heart failure
Journal Article 2023-11-16 ✓ 5 Snippets Suresh D, Li A, Miller MJ, Wijarnpreecha K, Chen VL.
In-Text Gene Mentions

Furthermore, elevated ferritin was associated with carriage of cirrhosis-promoting alleles including PNPLA3-rs738409-G allele (p = .0068) and TM6SF2-rs58542926-T allele (p = 0.0083) but not with common HFE mutations.<h4>Conclusions</h4>In MASLD patients, metabolic hyperferritinaemia was associated with increased mortality and higher incidence of liver-related events, and cirrhosis-promoting alleles but not with iron overload-promoting HFE mutations.

…diseases other thanhemochromatosis.…

…with iron overload-promotingHFEmutations.…

…not with commonHFEmutations.…

hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>Ferritin has been investigated as a biomarker for liver fibrosis and iron in patients with metabolic dysfunction-associated steatotic liver disease (MASLD). However, whether metabolic hyperferritinaemia predicts progression of liver disease remains unknown. In this study, we sought to understand associations between hyperferritinaemia and (1) adverse clinical outcomes and (2) common genetic variants related to iron metabolism and liver fibrosis.<h4>Methods</h4>This was a retrospective analysis of adults with MASLD seen at the University of Michigan Health System, where MASLD was defined by hepatic steatosis on imaging, biopsy or vibration-controlled transient elastography, plus metabolic risk factors in the absence of chronic liver diseases other than hemochromatosis. The primary predictor was serum ferritin level, which was dichotomized based on a cut-off of 300 or 450 mcg/L for women or men. Primary outcomes included (1) incident cirrhosis, liver-related events, congestive heart failure (CHF), and mortality and (2) distribution of common genetic variants associated with hepatic fibrosis and hereditary hemochromatosis.<h4>Results</h4>Of 7333 patients with MASLD, 1468 (20%) had elevated ferritin. In multivariate analysis, ferritinaemia was associated with increased mortality (HR 1.68 [1.35-2.09], p < .001) and incident liver-related events (HR 1.92 [1.11-3.32], p = .019). Furthermore, elevated ferritin was associated with carriage of cirrhosis-promoting alleles including PNPLA3-rs738409-G allele (p = .0068) and TM6SF2-rs58542926-T allele (p = 0.0083) but not with common HFE mutations.<h4>Conclusions</h4>In MASLD patients, metabolic hyperferritinaemia was associated with increased mortality and higher incidence of liver-related events, and cirrhosis-promoting alleles but not with iron overload-promoting HFE mutations.

Also flagged:brain developmentattachment formationbehavioralcortisolnucleusgene expression
Journal Article 2023-11-16 No Snippets Barr GA, Opendak M, Perry RE, Sarro E, Sullivan RM.
Show Full Abstract

<h4>Background</h4>In the short term, parental presence while a human infant is in pain buffers the immediate pain responses, although emerging evidence suggests repeated social buffering of pain may have untoward long-term effects.<h4>Methods/finding</h4>To explore the short- and long-term impacts of social buffering of pain, we first measured the infant rat pup's [postnatal day (PN) 8, or 12] response to mild tail shock with the mother present compared to shock alone or no shock. Shock with the mother reduced pain-related behavioral activation and USVs of pups at both ages and reduced Fos expression in the periaqueductal gray, hypothalamic paraventricular nucleus, and the amygdala at PN12 only. At PN12, shock with the mother compared to shock alone differentially regulated expression of several hundred genes related to G-protein-coupled receptors (GPCRs) and neural development, whereas PN8 pups showed a less robust and less coherent expression pattern. In a second set of experiments, pups were exposed to daily repeated Shock-mother pairings (or controls) at PN5-9 or PN10-14 (during and after pain sensitive period, respectively) and long-term outcome assessed in adults. Shock+mother pairing at PN5-9 reduced adult carrageenan-induced thermal hyperalgesia and reduced Fos expression, but PN10-14 pairings had minimal impact. The effect of infant treatment on adult affective behavior showed a complex treatment by age dependent effect. Adult social behavior was decreased following Shock+mother pairings at both PN5-9 and PN10-14, whereas shock alone had no effect. Adult fear responses to a predator odor were decreased only by PN10-14 treatment and the infant Shock alone and Shock+mother did not differ.<h4>Conclusions/significance</h4>Overall, integrating these results into our understanding of long-term programming by repeated infant pain experiences, the data suggest that pain experienced within a social context impacts infant neurobehavioral responses and initiates an altered developmental trajectory of pain and affect processing that diverges from experiencing pain alone.

PCDH17
Also flagged:breast cancertumouradherensmetastatic diseaselung cancermelanoma
Journal Article 2023-11-16 ✓ 2 Snippets Fitzpatrick A, Iravani M, Mills A, Vicente D, Alaguthurai T, Roxanis I, Turner NC, Haider S, Tutt ANJ, Isacke CM.
In-Text Gene Mentions

Compared to primary tumours, CSF cfDNA more frequently lost 13q regions containing PCDH9 and PCDH17 (members of the cadherin superfamily) and KLHL1, an actin binding protein with a role in cytoskeleton reorganisation.

…containing PCDH9 andPCDH17(members of the…

Show Full Abstract

Breast cancer leptomeningeal metastasis (BCLM), where tumour cells grow along the lining of the brain and spinal cord, is a devastating development for patients. Investigating this metastatic site is hampered by difficulty in accessing tumour material. Here, we utilise cerebrospinal fluid (CSF) cell-free DNA (cfDNA) and CSF disseminated tumour cells (DTCs) to explore the clonal evolution of BCLM and heterogeneity between leptomeningeal and extracranial metastatic sites. Somatic alterations with potential therapeutic actionability were detected in 81% (17/21) of BCLM cases, with 19% detectable in CSF cfDNA only. BCLM was enriched in genomic aberrations in adherens junction and cytoskeletal genes, revealing a lobular-like breast cancer phenotype. CSF DTCs were cultured in 3D to establish BCLM patient-derived organoids, and used for the successful generation of BCLM in vivo models. These data reveal that BCLM possess a unique genomic aberration profile and highlight potential cellular dependencies in this hard-to-treat form of metastatic disease.

Also flagged:hepatitis delta virus infectionhepatitis Bviral hepatitisHDV infectionHBV infectioncirrhosis
Journal Article 2023-11-16 No Snippets Gish RG, Jacobson IM, Lim JK, Waters-Banker C, Kaushik A, Kim C, Cyhaniuk A, Wong RJ.
Show Full Abstract

<h4>Background and aims</h4>HDV leads to the most severe form of viral hepatitis; however, the prevalence of HDV is not well understood. Using real-world data from the All-Payer Claims Database, this study estimates the prevalence of HBV/HDV infection among the chronic HBV population and describes patient/clinical characteristics for adults with HBV/HDV infection in the United States.<h4>Approach and results</h4>Adults (≥18 years) with ≥1 inpatient claim or ≥2 outpatient claims for HDV infection or HBV in the All-Payer Claims Database from January 1, 2014, to December 31, 2020, were identified. HDV prevalence was calculated as the proportion of patients with HBV/HDV infection among total patients with HBV infection. Patient characteristics, socioeconomic status, advanced liver complications (eg, cirrhosis, HCC), and comorbidities were assessed. A total of 6719 patients were diagnosed with HBV/HDV among 144,975 with HBV and 12 months of continuous data, for a prevalence of 4.6%. At diagnosis, 31.7% of patients with HBV/HDV had advanced liver complications, including compensated cirrhosis (16.3%) and decompensated cirrhosis (10.4%). Diabetes (50.5%), hypertension (49.8%), and HIV infection (30.9%) were the top 3 comorbidities.<h4>Conclusions</h4>In a large database capturing approximately 80% of the US-insured population, HBV/HDV infection prevalence was 4.6% among adults infected with HBV. Patients infected with HDV had high rates of baseline liver complications and other comorbidities at the time of diagnosis, suggesting potentially delayed diagnosis and/or treatment. Earlier identification of HBV/HDV infection among the population with HBV may provide opportunities to improve linkage to care and treatment, thereby reducing the risk of liver-related morbidity and mortality.

Also flagged:small vessel diseaseCerebral small vessel diseasestrokedementiaextracellularmatrix metalloproteinases
Journal Article 2023-11-16 No Snippets Al-Thani M, Goodwin-Trotman M, Bell S, Patel K, Fleming LK, Vilain C, Abramowicz M, Allan SM, Wang T, Cader MZ, Horsburgh K, Van Agtmael T, Sinha S, Markus HS, Granata A.
Show Full Abstract

Cerebral small vessel disease (SVD) affects the small vessels in the brain and is a leading cause of stroke and dementia. Emerging evidence supports a role of the extracellular matrix (ECM), at the interface between blood and brain, in the progression of SVD pathology, but this remains poorly characterized. To address ECM role in SVD, we developed a co-culture model of mural and endothelial cells using human induced pluripotent stem cells from patients with COL4A1/A2 SVD-related mutations. This model revealed that these mutations induce apoptosis, migration defects, ECM remodeling, and transcriptome changes in mural cells. Importantly, these mural cell defects exert a detrimental effect on endothelial cell tight junctions through paracrine actions. COL4A1/A2 models also express high levels of matrix metalloproteinases (MMPs), and inhibiting MMP activity partially rescues the ECM abnormalities and mural cell phenotypic changes. These data provide a basis for targeting MMP as a therapeutic opportunity in SVD.

Also flagged:NanocrystallineHydroxyapatiteapatiteosteoblast proliferationchitosanpullulan
Journal Article 2023-11-16 No Snippets Pelin IM, Popescu I, Calin M, Rebleanu D, Voicu G, Ionita D, Zaharia MM, Constantin M, Fundueanu G.
Show Full Abstract

Composite hydrogels containing apatite-like particles can act as scaffolds for osteoblast proliferation, with applications in bone tissue engineering. In this respect, porous biocompatible hydrogels were obtained from chitosan, oxidized pullulan, and PVA in different ratios. The stability of the hydrogels was ensured both by covalent bonds between aldehyde groups of oxidized pullulan and free amino groups of chitosan, and by physical bonds formed during freeze-thaw cycles and lyophilization. The deposition of calcium phosphates was performed by alternate soaking of the porous hydrogels into solutions with calcium and phosphate ions, assuring a basic pH required for hydroxyapatite formation. The mineralized hydrogels were characterized using FTIR spectroscopy, scanning electron microscopy, X-ray diffraction, and thermogravimetric analysis, showing that inorganic particles containing between 80 and 92% hydroxyapatite were deposited in a high amount on the pore walls of the polymeric matrix. The composition of the organic matrix influenced the crystallization of calcium phosphates and the mechanical properties of the composite hydrogels. In vitro biological tests showed that mineralized hydrogels support the proliferation of MG-63 osteoblast-like cells to a greater extent compared to pristine hydrogels.

Also flagged:inflammatory disorderantigen presentationHLA-Iadaptive immunityCD8IL-17
Journal Article 2023-11-16 No Snippets Khoshbakht S, Başkurt D, Vural A, Vural S.
Show Full Abstract

Behçet's disease (BD) is a complex, recurring inflammatory disorder with autoinflammatory and autoimmune components. This comprehensive review aims to explore BD's pathogenesis, focusing on established genetic factors. Studies reveal that <i>HLA-B*51</i> is the primary genetic risk factor, but non-HLA genes (<i>ERAP1</i>, <i>IL-10</i>, <i>IL23R/IL-12RB2</i>), as well as innate immunity genes (<i>FUT2</i>, <i>MICA</i>, <i>TLRs</i>), also contribute. Genome-wide studies emphasize the significance of <i>ERAP1</i> and HLA-I epistasis. These variants influence antigen presentation, enzymatic activity, and HLA-I peptidomes, potentially leading to distinct autoimmune responses. We conducted a systematic review of the literature to identify studies exploring the association between <i>HLA-B*51</i> and BD and further highlighted the roles of innate and adaptive immunity in BD. Dysregulations in Th1/Th2 and Th17/Th1 ratios, heightened clonal cytotoxic (CD8+) T cells, and reduced T regulatory cells characterize BD's complex immune responses. Various immune cell types (neutrophils, γδ T cells, natural killer cells) further contribute by releasing cytokines (IL-17, IL-8, GM-CSF) that enhance neutrophil activation and mediate interactions between innate and adaptive immunity. In summary, this review advances our understanding of BD pathogenesis while acknowledging the research limitations. Further exploration of genetic interactions, immune dysregulation, and immune cell roles is crucial. Future studies may unveil novel diagnostic and therapeutic strategies, offering improved management for this complex disease.

Also flagged:ATP-Binding Cassette Subfamily C Member 6 TransporterATP-binding cassette (ABC) transporterstumorsABC transporterhepatocellular carcinomacancers
Journal Article 2023-11-16 No Snippets Matera I, Miglionico R, Abruzzese V, Marchese G, Ventola GM, Castiglione Morelli MA, Bisaccia F, Ostuni A.
Show Full Abstract

There is growing evidence that various ATP-binding cassette (ABC) transporters contribute to the growth and development of tumors, but relatively little is known about how the ABC transporter family behaves in hepatocellular carcinoma (HCC), one of the most common cancers worldwide. Cellular model studies have shown that ABCC6, which belongs to the ABC subfamily C (ABCC), plays a role in the cytoskeleton rearrangement and migration of HepG2 hepatocarcinoma cells, thus highlighting its role in cancer biology. Deep knowledge on the molecular mechanisms underlying the observed results could provide therapeutic insights into the tumors in which <i>ABCC6</i> is modulated. In this study, differential expression levels of mRNA transcripts between <i>ABCC6</i>-silenced HepG2 and control groups were measured, and subsequently, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed. Real-Time PCR and Western blot analyses confirmed bioinformatics; functional studies support the molecular mechanisms underlying the observed effects. The results provide valuable information on the dysregulation of fundamental cellular processes, such as the focal adhesion pathway, which allowed us to obtain detailed information on the active role that the down-regulation of ABCC6 could play in the biology of liver tumors, as it is involved not only in cell migration but also in cell adhesion and invasion.

HFE
Also flagged:Liver cancerviral infectionalcohol abusemetabolic diseaseshepatocellular carcinomametabolism
Journal Article 2023-11-16 ✓ 1 Snippet Liu TY, Liao CC, Chang YS, Chen YC, Chen HD, Lai IL, Peng CY, Chung CC, Chou YP, Tsai FJ, Jeng LB, Chang JG.
In-Text Gene Mentions

…obesity, metabolic diseases,hemochromatosis, and autoimmune hepatitis…

Show Full Abstract

Liver cancer is caused by complex interactions among genetic factors, viral infection, alcohol abuse, and metabolic diseases. We conducted a genome-wide association study and polygenic risk score (PRS) model in Taiwan, employing a nonspecific etiology approach, to identify genetic risk factors for hepatocellular carcinoma (HCC). Our analysis of 2836 HCC cases and 134,549 controls revealed 13 novel associated loci such as the <i>FAM66C</i> gene, noncoding genes, liver-fibrosis-related genes, metabolism-related genes, and HCC-related pathway genes. We incorporated the results from the UK Biobank and Japanese database into our study for meta-analysis to validate our findings. We also identified specific subtypes of the major histocompatibility complex that influence both viral infection and HCC progression. Using this data, we developed a PRS to predict HCC risk in the general population, patients with HCC, and HCC-affected families. The PRS demonstrated higher risk scores in families with multiple HCCs and other cancer cases. This study presents a novel approach to HCC risk analysis, identifies seven new genes associated with HCC development, and introduces a reproducible PRS model for risk assessment.

Also flagged:ADneurodegenerative diseaseneurofibrillaryoxygenmitochondrial
Journal Article 2023-11-16 No Snippets Hu Y, Guo H, Cheng S, Sun J, Du J, Liu X, Xiong Y, Chen L, Liu C, Wu C, Tian H.
Show Full Abstract

<h4>Background</h4>Oxidative stress induced reactive oxygen species (ROS) and aggregation of amyloid β (Aβ) in the nervous system are significant contributors to Alzheimer's disease (AD). Cerium dioxide and manganese oxide are known as to be effective and recyclable ROS scavengers with high efficiency in neuroprotection.<h4>Methods</h4>A hollow-structured manganese-doped cerium dioxide nanoparticle (LMC) was synthesized for loading Resveratrol (LMC-RES). The LMC-RES were characterized by TEM, DLS, Zeta potential, and X-ray energy spectrum analysis. We also tested the biocompatibility of LMC-RES and the ability of LMC-RES to cross the blood-brain barrier (BBB). The antioxidant effects of LMC-RES were detected by SH-SY5Y cells. Small animal live imaging was used to detect the distribution of LMC-RES in the brain tissue of AD mice. The cognitive abilities of mice were tested by water maze and nesting experiments. The effects of LMC-RES in reducing oxidative stress and protecting neurons was also explored by histological analysis.<h4>Results</h4>The results showed that LMC-RES had good sustained release effect and biocompatibility. The drug release rate of LMC-RES at 24 hours was 80.9 ± 2.25%. Meanwhile, LMC-RES could cross the BBB and enrich in neurons to exert antioxidant effects. In Aβ-induced SH-SY5Y cells, LMC-RES could inhibits oxidative stress through the Nrf-2/HO-1 signaling pathway. In AD model mice, LMC-RES was able to reduce ROS levels, inhibit Aβ-induced neurotoxicity, and protect neurons and significantly improve cognitive deficits of AD mice after drug administration.<h4>Conclusion</h4>LMC-RES can effectively across the BBB, reduce oxidative stress, inhibit Aβ aggregation, and promote the recovery of neurological function.

HFE
Also flagged:GinsenosidescarcinomasHepatocellular carcinomacell cycleG1 phaseautophagy
Journal Article 2023-11-16 ✓ 1 Snippet Zhou N, Mao F, Cheng S.
In-Text Gene Mentions

…disease (NAFLD), andhemochromatosisare well-recognized risk…

Show Full Abstract

Ginsenosides, the main active pharmacological ingredients of ginseng, have been widely used for the treatment of numerous carcinomas. Hepatocellular carcinoma (HCC) is 3<sup>rd</sup> leading malignant tumor in terms of mortality worldwide. Accumulating evidence indicates that ginsenosides play a vital role in the prevention and treatment of HCC. Ginsenosides can significantly improve the symptoms of HCC, and their anticancer activity is mainly involved in inhibiting proliferation and migration, inducing cell cycle arrest at the G0/G1 phase, promoting caspase-3 and 8-mediated apoptosis, regulating autophagy related to Atg5, Atg7, Atg12, LC3-II, and PI3K/Akt pathways, and lowering invasion and metastasis associated with decreased nuclear translocation of NF-<i>κ</i>B p65 and MMP-2/9, increasing IL-2 and IFN-<i>γ</i> levels to enhance immune function, as well as regulating the gut-liver axis. In addition, ginsenosides can be used as an adjuvant to conventional cancer therapies, enhancing sensitivity to chemotherapy drugs, and improving efficacy and/or reducing adverse reactions through synergistic effects. Therefore, the current manuscript discusses the mechanism and application of ginsenosides in HCC. It is hoped to provide theoretical basis for the treatment of HCC with ginsenosides.

Also flagged:thoughtsdeathanxietydepressionsleep disordersCOVID-19
Journal Article 2023-11-16 No Snippets McCarthy M, McIntyre JC, Nathan R, Ashworth EL, Saini P.
Show Full Abstract

<h4>Objective</h4>Crisis lines are the first mental health service contact point for many people, making them a vital community and public health intervention. Given the current and potential utility of crisis lines, better understanding the characteristics, socioeconomic factors and subsequent referral pathways of callers is critical to identifying targeted ways to improve such services.<h4>Study design</h4>The dataset captured calls to the Cheshire & Wirral Partnership NHS Foundation Trust (CWP) crisis line between August 2020 and August 2021. Calls were examined if self-harm, risk to self, or overdose were reported by the caller. Descriptive analyses were conducted to produce a clinical and demographic profile of the callers using the crisis line.<h4>Results</h4>Call handlers were significantly more likely to call 999, hand over to a practitioner and less likely to provide advice and guidance if self-harm, risk to self or overdose was reported. Social issues were found to be significantly associated with all 3 outcomes: self-harm, risk to self and overdose.<h4>Conclusion</h4>The current study provides the first exploratory analysis of the socioeconomic factors and resultant care pathways for those contacting a UK crisis line service. The findings have important implications for community early intervention efforts to reduce self-harm and suicidal behaviours.

SERPINC1
Also flagged:frontotemporal dementiaADACEfrontotemporal degenerationbehavioralpositron
Journal Article 2023-11-16 ✓ 5 Snippets Cabrera-Martín MN, Nespral P, Valles-Salgado M, Bascuñana P, Delgado-Alonso C, Delgado-Álvarez A, Fernández-Romero L, López-Carbonero JI, Díez-Cirarda M, Gil-Moreno MJ, Matías-Guiu J, Matias-Guiu JA.
In-Text Gene Mentions

…the performance ofACE-IIIin AD and…

…regions associated withACE-III, thereby facilitating its…

…further validation ofACE-IIIin the context…

…Importantly,ACE-IIIplays a dual…

…tests suggest thatACE-IIIcould offer valuable…

Show Full Abstract

<h4>Introduction</h4>The Addenbrooke's Cognitive Examination III (ACE-III) is a brief test useful for neuropsychological assessment. Several studies have validated the test for the diagnosis of Alzheimer's disease (AD) and frontotemporal dementia (FTD). In this study, we aimed to examine the metabolic correlates associated with the performance of ACE-III in AD and behavioral variant FTD.<h4>Methods</h4>We enrolled 300 participants in a cross-sectional study, including 180 patients with AD, 60 with behavioral FTD (bvFTD), and 60 controls. An <sup>18</sup>F-Fluorodeoxyglucose positron emission tomography study was performed in all cases. Correlation between the ACE-III and its domains (attention, memory, fluency, language, and visuospatial) with the brain metabolism was estimated.<h4>Results</h4>The ACE-III showed distinct neural correlates in bvFTD and AD, effectively capturing the most relevant regions involved in these disorders. Neural correlates differed for each domain, especially in the case of bvFTD. Lower ACE-III scores were associated with more advanced stages in both disorders. The ACE-III exhibited high discrimination between bvFTD vs. HC, and between AD vs. HC. Additionally, it was sensitive to detect hypometabolism in brain regions associated with bvFTD and AD.<h4>Conclusion</h4>Our study contributes to the knowledge of the brain regions associated with ACE-III, thereby facilitating its interpretation, and highlighting its suitability for screening and monitoring. This study provides further validation of ACE-III in the context of AD and FTD.

BTN3A3
Also flagged:TumorCancercell proliferationlymphangiogenesisepithelial-to-mesenchymal transitiontumors
Journal Article 2023-11-16 ✓ 1 Snippet Basak U, Sarkar T, Mukherjee S, Chakraborty S, Dutta A, Dutta S, Nayak D, Kaushik S, Das T, Sa G.
In-Text Gene Mentions

Another juxtacrine interaction of LSECtin on TAMs and BTN3A3 receptor on CSCs drives tumor stemness (197).

Show Full Abstract

Cancer progression is primarily caused by interactions between transformed cells and the components of the tumor microenvironment (TME). TAMs (tumor-associated macrophages) make up the majority of the invading immune components, which are further categorized as anti-tumor M1 and pro-tumor M2 subtypes. While M1 is known to have anti-cancer properties, M2 is recognized to extend a protective role to the tumor. As a result, the tumor manipulates the TME in such a way that it induces macrophage infiltration and M1 to M2 switching bias to secure its survival. This M2-TAM bias in the TME promotes cancer cell proliferation, neoangiogenesis, lymphangiogenesis, epithelial-to-mesenchymal transition, matrix remodeling for metastatic support, and TME manipulation to an immunosuppressive state. TAMs additionally promote the emergence of cancer stem cells (CSCs), which are known for their ability to originate, metastasize, and relapse into tumors. CSCs also help M2-TAM by revealing immune escape and survival strategies during the initiation and relapse phases. This review describes the reasons for immunotherapy failure and, thereby, devises better strategies to impair the tumor-TAM crosstalk. This study will shed light on the understudied TAM-mediated tumor progression and address the much-needed holistic approach to anti-cancer therapy, which encompasses targeting cancer cells, CSCs, and TAMs all at the same time.

NEGR1
Also flagged:obesityFTOMCM6HLAMC4RTCF7L2
Journal Article 2023-11-16 ✓ 1 Snippet Mera-Charria A, Nieto-Lopez F, Francès MP, Arbex PM, Vila-Vecilla L, Russo V, Silva CCV, De Souza GT.
In-Text Gene Mentions

…two SNPs nearNEGR1and PRKD1, as…

Show Full Abstract

<h4>Purpose</h4>Obesity is a multifactorial condition with a relevant genetic correlation. Recent advances in genomic research have identified several single nucleotide polymorphisms (SNPs) in genes such as FTO, MCM6, HLA, and MC4R, associated with obesity. This study aimed to evaluate the association of 102 SNPs with BMI and weight loss treatment response in a multi-ethnic population.<h4>Methods</h4>The study analyzed 9,372 patients for the correlation between SNPs and BMI (dataset A). The correlation between SNP and weight loss was accessed in 474 patients undergoing different treatments (dataset B). Patients in dataset B were further divided into 3 categories based on the type of intervention: dietary therapy, intragastric balloon procedures, or surgeries. SNP association analysis and multiple models of inheritance were performed.<h4>Results</h4>In dataset A, ten SNPs, including rs9939609 (FTO), rs4988235 (MCM6), and rs2395182 (HLA), were significantly associated with increased BMI. Additionally, other four SNPs, rs7903146 (TCF7L2), (rs6511720), rs5400 (SLC2A2), and rs7498665 (SH2B1), showed sex-specific correlation. For dataset B, SNPs rs2016520 (PPAR-Delta) and rs2419621 (ACSL5) demonstrated significant correlation with weight loss for all treatment types. In patients who adhered to dietary therapy, SNPs rs6544713 (ABCG8) and rs762551 (CYP1A2) were strongly correlated with weight loss. Patients undergoing surgical or endoscopic procedures exhibited differential correlations with several SNPs, including rs1801725 (CASR) and rs12970134 (MC4R), and weight loss.<h4>Conclusion</h4>This study provides valuable insights into the genetic factors influencing BMI and weight loss response to different treatments. The findings highlight the potential for personalized weight management approaches based on individual genetic profiles.

HFE
Also flagged:Lysinuric protein intolerancehyperferritinemiaaminoaciduriaamino acid transporterurea cycle disorderslysosomal storage diseases
Journal Article 2023-11-16 ✓ 5 Snippets Kalay I, Aykut H, Caliskan Z, Yigit G, Wollnik B.
In-Text Gene Mentions

…iseases, autoimmune disorders,hemochromatosis, and osteoporosis.…

…be caused byhemochromatosisLPI is a…

…was a virtualhemochromatosispanel.…

…lysosomal storage diseases,hemochromatosis, and osteoporosis.…

…the pre-diagnosis ofhemochromatosis.…

Show Full Abstract

Lysinuric protein intolerance (LPI) is a rare, inherited aminoaciduria caused by biallelic pathogenic variants in the amino acid transporter gene <i>SLC7A7</i> (OMIM *603593). Individuals with LPI show extreme variability in their clinical presentation, and LPI is included in the differential diagnosis of several disorders such as urea cycle disorders, lysosomal storage diseases, malabsorption diseases, autoimmune disorders, hemochromatosis, and osteoporosis. The phenotypic variability of LPI and the lack of a specific clinical presentation have caused various misdiagnoses. Here, we report two siblings diagnosed in their 4th decade of life with LPI, manifesting rare hyperferritinemia. Additionally, they presented with short stature, multiple bone fractures due to osteoporosis, and they showed an aversion to protein-rich food. Using a combination of exome sequencing, microarray analysis and qPCR, we identified a novel homozygous deletion in <i>SLC7A7</i> encompassing exons 3 to 10, which is predicted to lead to disruption of SLC7A7 function. This is the first report of lysinuric protein intolerance in a Turkish family associated with this so far unknown deletion in <i>SLC7A7</i>.

HTT
Also flagged:neurological diseasesHDspinocerebellar ataxiaSCA) types 1spinalbulbar muscular atrophy
Journal Article 2023-11-15 ✓ 5 Snippets Ikenoshita S, Matsuo K, Yabuki Y, Kawakubo K, Asamitsu S, Hori K, Usuki S, Hirose Y, Bando T, Araki K, Ueda M, Sugiyama H, Shioda N.
In-Text Gene Mentions

The levels of polyQ-expanded huntingtin (HTT) protein detected by an anti-polyQ tract antibody (clone 1C2) markedly decreased following CWG-cPIP treatment in HD patient–derived fibroblasts compared with their levels in vehicle-treated fibroblasts.

ASO and CRISPR/Cas13 have been evaluated in HD animal models over a wide range of treatment durations from 1 week to several months and have been reported to improve neurological symptoms by eliminating mutant HTT mRNA (59, 82, 83) but have not yet been clinically successful.

…for the humanHTTexon 1 transgene…

…and endogenous mouseHttin R6/2 mice…

…effect on endogenousHtttranscript levels (…

Show Full Abstract

Expansion of CAG and CTG (CWG) triplet repeats causes several inherited neurological diseases. The CWG repeat diseases are thought to involve complex pathogenic mechanisms through expanded CWG repeat-derived RNAs in a noncoding region and polypeptides in a coding region, respectively. However, an effective therapeutic approach has not been established for the CWG repeat diseases. Here, we show that a CWG repeat DNA-targeting compound, cyclic pyrrole-imidazole polyamide (CWG-cPIP), suppressed the pathogenesis of coding and noncoding CWG repeat diseases. CWG-cPIP bound to the hairpin form of mismatched CWG DNA, interfering with transcription elongation by RNA polymerase through a preferential activity toward repeat-expanded DNA. We found that CWG-cPIP selectively inhibited pathogenic mRNA transcripts from expanded CWG repeats, reducing CUG RNA foci and polyglutamine accumulation in cells from patients with myotonic dystrophy type 1 (DM1) and Huntington's disease (HD). Treatment with CWG-cPIP ameliorated behavioral deficits in adeno-associated virus-mediated CWG repeat-expressing mice and in a genetic mouse model of HD, without cytotoxicity or off-target effects. Together, we present a candidate compound that targets expanded CWG repeat DNA independently of its genomic location and reduces both pathogenic RNA and protein levels. CWG-cPIP may be used for the treatment of CWG repeat diseases and improvement of clinical outcomes.

PEBP1
Also flagged:RKIPBACH1Raf kinase-B inhibitor proteinBTB and CNC homology 1breast cancercancer
Journal Article 2023-11-15 ✓ 3 Snippets Shyam S, Ramu S, Sehgal M, Jolly MK.
In-Text Gene Mentions

Relevant cancer samples were split into two groups based on median: high PEBP1 (gene name for RKIP) versus low PEBP1, and high BACH1 versus low BACH1.

…on median: highPEBP1(gene name for…

…RKIP) versus lowPEBP1, and high BACH1…

Show Full Abstract

Epithelial-mesenchymal transition (EMT) is an important axis of phenotypic plasticity-a hallmark of cancer metastasis. Raf kinase-B inhibitor protein (RKIP) and BTB and CNC homology 1 (BACH1) are reported to influence EMT. In breast cancer, they act antagonistically, but the exact nature of their roles in mediating EMT and associated other axes of plasticity remains unclear. Here, analysing transcriptomic data, we reveal their antagonistic trends in a pan-cancer manner in terms of association with EMT, metabolic reprogramming and immune evasion via PD-L1. Next, we developed and simulated a mechanism-based gene regulatory network that captures how RKIP and BACH1 engage in feedback loops with drivers of EMT and stemness. We found that RKIP and BACH1 belong to two antagonistic 'teams' of players-while BACH1 belonged to the one driving pro-EMT, stem-like and therapy-resistant cell states, RKIP belonged to the one enabling pro-epithelial, less stem-like and therapy-sensitive phenotypes. Finally, we observed that low RKIP levels and upregulated BACH1 levels associated with worse clinical outcomes in many cancer types. Together, our systems-level analysis indicates that the emergent dynamics of underlying regulatory network enable the antagonistic patterns of RKIP and BACH1 with various axes of cancer cell plasticity, and with patient survival data.

SERPINC1
Also flagged:postherpetic neuralgiaCSFinfectioncoagulationlipidmetabolism
Journal Article 2023-11-15 ✓ 5 Snippets Chen K, Wang M, Long D, Zou D, Li X, Wang R, Wang Y, Yang L.
In-Text Gene Mentions

Next, SERPINC1, APOA1, CP, F2, ALB, KNG1, APOA2, PLG,ITIH2, and APOE were picked through the cross-comparison between thefirst cluster of MCODE and CytoHbba, and 7 out of them such as SERPINC1,F2, KNG1, PLG, APOA1, APOA2, and APOE were defined as the hub proteins,which were all enriched in the top pathways (including complementand coagulation cascades, cholesterol metabolism, PPAR signaling pathway,and African trypanosomiasis) based on the KEGG analysis (Figure 6D).

Meanwhile, the GSEA-KEGG analysis (Figure 5B–D) elucidated that DEPs includingPLG, F2, APOA1, APOA2, SERPINC1, etc., were mainly enriched in thetop 5 activated pathways of the estrogen signaling pathway, systemiclupus erythematosus, PPAR signaling pathway, complement and coagulationcascades, and salmonella infection (Figure 5B,C), while DEPs including FZD3, SEMA3G,SEMA3E, SLITRK5, NRXN2, and NRXN1 were enriched in the top 5 suppressedpathways including malaria, other glycan degradation, insulin secretion,axon guidance, and cell adhesion molecules (Figure 5B,D).

…F2, APOA1, APOA2,SERPINC1, and KNG1 and…

…F2, APOA1, APOA2,SERPINC1, etc.,…

…degree:80), APOA1 (degree:58),SERPINC1(degree:54), GC (degree:48), P…

Show Full Abstract

The intrinsic mechanism of postherpetic neuralgia (PHN) remains unclear. Herein, we aimed to seek the hub proteins in the cerebrospinal fluid (CSF), which display significant changes between the PHN and nonpainful patients (Control). First, the proteomic results showed that compared with the Control-CSF, there were 100 upregulated and 50 downregulated differentially expressed proteins (DEPs) in the PHN-CSF. Besides, functional analyses including gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and gene set enrichment analysis (GSEA) revealed that biological processes and pathways including complement activation, infection, coagulation, and lipid metabolism were activated, while synaptic organization was suppressed. Next, the protein-protein interaction (PPI) analysis indicated that increased PLG, F2, APOA1, APOA2, SERPINC1, and KNG1 and reduced APOE, which were all enriched in the top pathways according to the KEGG analysis, were defined as hub proteins. Finally, three of the hub proteins, such as PLG, APOA1, and APOE, were reconfirmed in a larger cohort using both enzyme-linked immunosorbent assay (ELISA) and Western blotting methods. Above all, the results indicated that PLG, APOA1, and APOE and their involved processes such as infection, inflammation, cholesterol metabolism, and coagulation shall be potential therapeutic approaches. (The raw mass spectrometry proteome data and search results have been deposited to the iProx-integrated Proteome Resources (http://www.iprox.cn) with the data set identifier IPX0007372000.).

CCDC92
Also flagged:transductionnuclearcapsidVP2VP3KIAA0319L
Journal Article 2023-11-15 ✓ 1 Snippet Hao S, Zhang X, Ning K, Ning K, Feng Z, Park SY, Aksu Kuz C, McFarlin S, Richart D, Cheng F, Zhang EY, Zhang-Chen A, Yan Z, Qiu J.
In-Text Gene Mentions

CCDC92

Show Full Abstract

<h4>Importance</h4>The essential steps of successful gene delivery by recombinant adeno-associated viruses (rAAVs) include vector internalization, intracellular trafficking, nuclear import, uncoating, double-stranded (ds)DNA conversion, and transgene expression. rAAV2.5T has a chimeric capsid of AAV2 VP1u and AAV5 VP2 and VP3 with the mutation A581T. Our investigation revealed that KIAA0319L, the multiple AAV serotype receptor, is not essential for vector internalization but remains critical for efficient vector transduction to human airway epithelia. Additionally, we identified that a novel gene <i>WDR63</i>, whose cellular function is not well understood, plays an important role in vector transduction of human airway epithelia but not vector internalization and nuclear entry. Our study also discovered the substantial transduction potential of rAAV2.5T in basal stem cells of human airway epithelia, underscoring its utility in gene editing of human airways. Thus, the knowledge derived from this study holds promise for the advancement of gene therapy in the treatment of pulmonary genetic diseases.

PRDX6
Also flagged:CurcuminSP1di-n-butyl phthalateferroptosisDBP
Journal Article 2023-11-15 ✓ 5 Snippets Bu H, Wang B, Wu Y, Li P, Cui Y, Jiang X, Yu X, Liu B, Tang M.
In-Text Gene Mentions

…self-protective mechanism-SP1/PRDX6pathway, against di-n-butyl…

…y transcriptionally upregulatePRDX6, a negative regulator…

…Overexpression ofPRDX6or adding SP1…

…the expression ofPRDX6was upregulated under…

…upregulating SP1 andPRDX6.…

Show Full Abstract

As one of the common plasticizers, di-n-butyl phthalate (DBP) has been using in various daily consumer products worldwide. Since it is easily released from products and exists in the environment for a long time, it has a lasting impact on human health, especially male reproductive health. However, the detailed mechanism of testicular damage from DBP and the protection strategy are still not clear enough. In this study, we found that DBP could induce dose-dependent ferroptosis in testicular tissue. Mechanism dissection indicates that DBP can upregulate SP1 expression, which could directly transcriptionally upregulate PRDX6, a negative regulator of ferroptosis. Overexpression of PRDX6 or adding SP1 agonist curcumin could suppress the DBP-induced ferroptosis on testicular cells. In vivo, rats were given 500 mg/kg/day DBP orally for 3 weeks; elevated levels of ferroptosis were detected in testicular tissue. When the above-mentioned doses of DBP and curcumin at a dose of 300 mg/kg/day were administered intragastrically simultaneously, the testicular ferroptosis induced by DBP was alleviated. Immunohistochemistry and quantitative real-time PCR of testis tissue showed that the expression of PRDX6 was upregulated under the action of DBP and curcumin. These findings suggest a spontaneous self-protection mechanism of testicular tissue from DBP damage by upregulating SP1 and PRDX6. However, it is not strong enough to resist the DBP-induced ferroptosis. Curcumin can strengthen this self-protection mechanism and weaken the level of ferroptosis induced by DBP. This study may help us to develop a novel therapeutic option with curcumin to protect the testicular tissue from ferroptosis and function impairment by DBP.

HTT
Also flagged:Schizophreniamental diseaseEYA3CNTN4HSPA8LRRK2
Journal Article 2023-11-15 ✓ 4 Snippets Yu S, Wang Z, Nan J, Li A, Yang X, Tang X.
In-Text Gene Mentions

Our framework identified 20 potential schizophrenia risk genes: EYA3, CNTN4, HSPA8, LRRK2, AFP, CTNNB1, CYP1A1, FGFR1, PRKAR2A, HTT, SLIT1, MEPCE, CENPC, NDUFA13, PDE4D, PIEZO1, PACSIN2, GSPT1, LOXL2, and CD2AP. Given these results, it is promising to examine what our framework produced.

…CYP1A1, FGFR1, PRKAR2A,HTT, SLIT1, MEPCE, CENPC,…

…the LRRK2 andHTTgenes, with a…

…the HSPA8 andHTTgenes with a…

Show Full Abstract

<h4>Background</h4>Schizophrenia is a serious mental disease. With increased research funding for this disease, schizophrenia has become one of the key areas of focus in the medical field. Searching for associations between diseases and genes is an effective approach to study complex diseases, which may enhance research on schizophrenia pathology and lead to the identification of new treatment targets.<h4>Objective</h4>The aim of this study was to identify potential schizophrenia risk genes by employing machine learning methods to extract topological characteristics of proteins and their functional roles in a protein-protein interaction (PPI)-keywords (PPIK) network and understand the complex disease-causing property. Consequently, a PPIK-based metagraph representation approach is proposed.<h4>Methods</h4>To enrich the PPI network, we integrated keywords describing protein properties and constructed a PPIK network. We extracted features that describe the topology of this network through metagraphs. We further transformed these metagraphs into vectors and represented proteins with a series of vectors. We then trained and optimized our model using random forest (RF), extreme gradient boosting, light gradient boosting machine, and logistic regression models.<h4>Results</h4>Comprehensive experiments demonstrated the good performance of our proposed method with an area under the receiver operating characteristic curve (AUC) value between 0.72 and 0.76. Our model also outperformed baseline methods for overall disease protein prediction, including the random walk with restart, average commute time, and Katz models. Compared with the PPI network constructed from the baseline models, complementation of keywords in the PPIK network improved the performance (AUC) by 0.08 on average, and the metagraph-based method improved the AUC by 0.30 on average compared with that of the baseline methods. According to the comprehensive performance of the four models, RF was selected as the best model for disease protein prediction, with precision, recall, F1-score, and AUC values of 0.76, 0.73, 0.72, and 0.76, respectively. We transformed these proteins to their encoding gene IDs and identified the top 20 genes as the most probable schizophrenia-risk genes, including the EYA3, CNTN4, HSPA8, LRRK2, and AFP genes. We further validated these outcomes against metagraph features and evidence from the literature, performed a features analysis, and exploited evidence from the literature to interpret the correlation between the predicted genes and diseases.<h4>Conclusions</h4>The metagraph representation based on the PPIK network framework was found to be effective for potential schizophrenia risk genes identification. The results are quite reliable as evidence can be found in the literature to support our prediction. Our approach can provide more biological insights into the pathogenesis of schizophrenia.

Also flagged:nitrogen fixationnitrogenNitrogenaseIronSulfurdinitrogen
Journal Article 2023-11-15 No Snippets Zhai H, Lee S, Cui ZH, Cao L, Ryde U, Chan GK.
Show Full Abstract

Characterizing the electronic structure of the iron-sulfur clusters in nitrogenase is necessary to understand their role in the nitrogen fixation process. One challenging task is to determine the protonation state of the intermediates in the nitrogen fixing cycle. Here, we use a dimeric iron-sulfur model to study relative energies of protonation at C, S, or Fe. Using a composite method based on coupled cluster and density matrix renormalization group energetics, we converge the relative energies of four protonated configurations with respect to basis set and correlation level. We find that accurate relative energies require large basis sets as well as a proper treatment of multireference and relativistic effects. We have also tested ten density functional approximations for these systems. Most of them give large errors in their relative energies. The best performing functional in this system is B3LYP, which gives mean absolute and maximum deviations of only 10 and 13 kJ/mol with respect to our correlated wave function estimates, respectively, comparable to the uncertainty in our correlated estimates. Our work provides benchmark results for the calibration of new approximate electronic structure methods and density functionals for these problems.

POU3F2
Also flagged:methylationRB1prostate cancerneuroendocrine prostate cancerDNA methyltransferasesDNMTs
Journal Article 2023-11-15 ✓ 1 Snippet Yamada Y, Venkadakrishnan VB, Mizuno K, Bakht M, Ku SY, Garcia MM, Beltran H.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Aberrant DNA methylation has been implicated as a key driver of prostate cancer lineage plasticity and histologic transformation to neuroendocrine prostate cancer (NEPC). DNA methyltransferases (DNMTs) are highly expressed, and global DNA methylation is dysregulated in NEPC. We identified that deletion of DNMT genes decreases expression of neuroendocrine lineage markers and substantially reduced NEPC tumor development and metastasis in vivo. Decitabine, a pan-DNMT inhibitor, attenuated tumor growth in NEPC patient-derived xenograft models, as well as retinoblastoma gene (<i>RB1</i>)-deficient castration-resistant prostate adenocarcinoma (CRPC) models compared with <i>RB1</i>-proficient CRPC. We further found that DNMT inhibition increased expression of B7 homolog 3 (B7-H3), an emerging druggable target, via demethylation of B7-H3. We tested DS-7300a (i-DXd), an antibody-drug conjugate targeting B7-H3, alone and in combination with decitabine in models of advanced prostate cancer. There was potent single-agent antitumor activity of DS-7300a in both CRPC and NEPC bearing high expression of B7-H3. In B7-H3-low models, combination therapy of decitabine plus DS-7300a resulted in enhanced response. DNMT inhibition may therefore be a promising therapeutic target for NEPC and RB1-deficient CRPC and may sensitize B7-H3-low prostate cancer to DS-7300a through increasing target expression. NEPC and RB1-deficient CRPC represent prostate cancer subgroups with poor prognosis, and the development of biomarker-driven therapeutic strategies for these populations may ultimately help improve patient outcomes.

Also flagged:multisystem disordersgene expressiondevelopmental disordersnitrogenBSAparaformaldehyde
Journal Article 2023-11-15 No Snippets Huang X, Henck J, Qiu C, Sreenivasan VKA, Balachandran S, Amarie OV, Hrabě de Angelis M, Behncke RY, Chan WL, Despang A, Dickel DE, Duran M, Feuchtinger A, Fuchs H, Gailus-Durner V, Haag N, Hägerling R, Hansmeier N, Hennig F, Marshall C, Rajderkar S, Ringel A, Robson M, Saunders LM, da Silva-Buttkus P, Spielmann N, Srivatsan SR, Ulferts S, Wittler L, Zhu Y, Kalscheuer VM, Ibrahim DM, Kurth I, Kornak U, Visel A, Pennacchio LA, Beier DR, Trapnell C, Cao J, Shendure J, Spielmann M.
Show Full Abstract

Mouse models are a critical tool for studying human diseases, particularly developmental disorders<sup>1</sup>. However, conventional approaches for phenotyping may fail to detect subtle defects throughout the developing mouse<sup>2</sup>. Here we set out to establish single-cell RNA sequencing of the whole embryo as a scalable platform for the systematic phenotyping of mouse genetic models. We applied combinatorial indexing-based single-cell RNA sequencing<sup>3</sup> to profile 101 embryos of 22 mutant and 4 wild-type genotypes at embryonic day 13.5, altogether profiling more than 1.6 million nuclei. The 22 mutants represent a range of anticipated phenotypic severities, from established multisystem disorders to deletions of individual regulatory regions<sup>4,5</sup>. We developed and applied several analytical frameworks for detecting differences in composition and/or gene expression across 52 cell types or trajectories. Some mutants exhibit changes in dozens of trajectories whereas others exhibit changes in only a few cell types. We also identify differences between widely used wild-type strains, compare phenotyping of gain- versus loss-of-function mutants and characterize deletions of topological associating domain boundaries. Notably, some changes are shared among mutants, suggesting that developmental pleiotropy might be 'decomposable' through further scaling of this approach. Overall, our findings show how single-cell profiling of whole embryos can enable the systematic molecular and cellular phenotypic characterization of mouse mutants with unprecedented breadth and resolution.

ZNFX1
Also flagged:Stress granulesorganelleendomembranesmembraneendomembraneendolysosomes
Journal Article 2023-11-15 ✓ 3 Snippets Bussi C, Mangiarotti A, Vanhille-Campos C, Aylan B, Pellegrino E, Athanasiadi N, Fearns A, Rodgers A, Franzmann TM, Šarić A, Dimova R, Gutierrez MG.
In-Text Gene Mentions

G3BP1-dependent stress granule formation seems to be critical for repairing Mtb phagosomes and the control of infection and provides a mechanistic explanation for clinical evidence showing that patients with inherited deficiency of the stress granule protein ZNFX1 exhibit impaired immunity to mycobacteria44.

Notably, ZNFX1—a gene associated with Mendelian susceptibility to mycobacterial disease or tuberculosis with intermittent monocytosis, and that has been previously identified in stress granules44—was also upregulated in a RD1-dependent manner (Fig. 4a).

…stress granule proteinZNFX1exhibit impaired immunity…

Show Full Abstract

Endomembrane damage represents a form of stress that is detrimental for eukaryotic cells<sup>1,2</sup>. To cope with this threat, cells possess mechanisms that repair the damage and restore cellular homeostasis<sup>3-7</sup>. Endomembrane damage also results in organelle instability and the mechanisms by which cells stabilize damaged endomembranes to enable membrane repair remains unknown. Here, by combining in vitro and in cellulo studies with computational modelling we uncover a biological function for stress granules whereby these biomolecular condensates form rapidly at endomembrane damage sites and act as a plug that stabilizes the ruptured membrane. Functionally, we demonstrate that stress granule formation and membrane stabilization enable efficient repair of damaged endolysosomes, through both ESCRT (endosomal sorting complex required for transport)-dependent and independent mechanisms. We also show that blocking stress granule formation in human macrophages creates a permissive environment for Mycobacterium tuberculosis, a human pathogen that exploits endomembrane damage to survive within the host.

TNFSF4
Also flagged:sialyltransferasesglycosyltransferasecancerstumorangiogenesiscancer
Journal Article 2023-11-15 ✓ 1 Snippet Cao P, Chen M, Zhang T, Zheng Q, Liu M.
In-Text Gene Mentions

…CTLA4, CD244, ICOS,TNFSF4, CD48, NRP1, CD276,…

Show Full Abstract

<h4>Background</h4>Aberrant glycosylation, catalyzed by the specific glycosyltransferase, is one of the dominant features of cancers. Among the glycosyltransferase subfamilies, sialyltransferases (SiaTs) are an essential part which has close linkages with tumor-associated events, such as tumor growth, metastasis and angiogenesis. Considering the relationship between SiaTs and cancer, the current study attempted to establish an effective prognostic model with SiaTs-related genes (SRGs) to predict patients' outcome and therapeutic responsiveness of bladder cancer.<h4>Methods</h4>RNA-seq data, clinical information and genomic mutation data were downloaded (TCGA-BLCA and GSE13507 datasets). The comprehensive landscape of the 20 SiaTs was analyzed, and the differentially expressed SiaTs-related genes were screened with "DESeq2" R package. ConsensusClusterPlus was applied for clustering, following with survival analysis with Kaplan-Meier curve. The overall survival related SRGs were determined with univariate Cox proportional hazards regression analysis, and the least absolute shrinkage and selection operator (LASSO) regression analysis was performed to generate a SRGs-related prognostic model. The predictive value was estimated with Kaplan-Meier plot and the receiver operating characteristic (ROC) curve, which was further validated with the constructed nomogram and decision curve.<h4>Results</h4>In bladder cancer tissues, 17 out of the 20 SiaTs were differentially expressed with CNV changes and somatic mutations. Two SiaTs_Clusters were determined based on the expression of the 20 SiaTs, and two gene_Clusters were identified based on the expression of differentially expressed genes between SiaTs_Clusters. The SRGs-related prognostic model was generated with 7 key genes (CD109, TEAD4, FN1, TM4SF1, CDCA7L, ATOH8 and GZMA), and the accuracy for outcome prediction was validated with ROC curve and a constructed nomogram. The SRGs-related prognostic signature could separate patients into high- and low-risk group, where the high-risk group showed poorer outcome, more abundant immune infiltration, and higher expression of immune checkpoint genes. In addition, the risk score derived from the SRGs-related prognostic model could be utilized as a predictor to evaluate the responsiveness of patients to the medical therapies.<h4>Conclusions</h4>The SRGs-related prognostic signature could potentially aid in the prediction of the survival outcome and therapy response for patients with bladder cancer, contributing to the development of personalized treatment and appropriate medical decisions.

PTGIS
Also flagged:necroptosislung squamous cell carcinomaLUSCmethylationCHMP4CIL1B
Journal Article 2023-11-15 ✓ 1 Snippet Song GQ, Wu HM, Ji KJ, He TL, Duan YM, Zhang JW, Hu GQ.
In-Text Gene Mentions

…genes (MYEOV, LCE3E,PTGIS, OR2W3 and RALGAPA2)…

Show Full Abstract

<h4>Background</h4>Given the poor prognosis of lung squamous cell carcinoma (LUSC), the aim of this study was to screen for new prognostic biomarkers.<h4>Methods</h4>The TGCA_LUSC dataset was used as the training set, and GSE73403 was used as the validation set. The genes involved in necroptosis-related pathways were acquired from the KEGG database, and the differential genes between the LUSC and normal samples were identified using the GSEA. A necroptosis signature was constructed by survival analysis, and its correlation with patient prognosis and clinical features was evaluated. The molecular characteristics and drug response associated with the necroptosis signature were also identified. The drug candidates were then validated at the cellular level.<h4>Results</h4>The TCGA_LUSC dataset included 51 normal samples and 502 LUSC samples. The GSE73403 dataset included 69 samples. 159 genes involved in necroptosis pathways were acquired from the KEGG database, of which most showed significant differences between two groups in terms of genomic, transcriptional and methylation alterations. In particular, CHMP4C, IL1B, JAK1, PYGB and TNFRSF10B were significantly associated with the survival (<i>p</i> < 0.05) and were used to construct the necroptosis signature, which showed significant correlation with patient prognosis and clinical features in univariate and multivariate analyses (<i>p</i> < 0.05). Furthermore, CHMP4C, IL1B, JAK1 and PYGB were identified as potential targets of trametinib, selumetinib, SCH772984, PD 325901 and dasatinib. Finally, knockdown of these genes in LUSC cells increased chemosensitivity to those drugs.<h4>Conclusion</h4>We identified a necroptosis signature in LUSC that can predict prognosis and identify patients who can benefit from targeted therapies.

HTT
Also flagged:Gene ExpressionOlfactionorganizationcellulosehydrocarbonsodorant receptors
Journal Article 2023-11-15 ✓ 1 Snippet Kaleem Ullah RM, Jia B, Liang S, Sikandar A, Gao F, Wu H.
In-Text Gene Mentions

…of Orco and5-HTTgenes were suggested…

Show Full Abstract

Termites are eusocial insects. Chemical signals between colony members are crucial to the smooth running of colony operations, but little is known about their olfactory system and the roles played by various chemosensory genes in this process. Chemosensory genes are involved in basic olfactory perception in insects. <i>Odontotermes formosanus</i> (Shiraki) is one of the most damaging pests to agricultural crops, forests, and human-made structures. To better understand the olfactory system and the genes involved in olfactory processing in <i>O. formosanus</i>, we produced a transcriptome of worker termites. In this study, we identified 13 <i>OforOBPs</i>, 1 <i>OforCSP</i>, 15 <i>OforORs</i>, 9 <i>OforGRs</i>, and 4 <i>OforSNMPs</i>. Multiple sequence alignments were used in the phylogenetic study, which included data from other termite species and a wide variety of insect species. Moreover, we also investigated the mRNA expression levels using qRT-PCR. The significantly high expression levels of <i>OforCSP1</i>, <i>OforOBP2</i>, <i>OforOR1</i>, and <i>OforSNMP1</i> suggest that these genes may play important roles in olfactory processing in termite social behavior, including caste differentiation, nestmate and non-nestmate discrimination, and the performance of colony operations among members. Our research establishes a foundation for future molecular-level functional studies of chemosensory genes in <i>O. formosanus</i>, which might lead to the identification of novel targets for termite integrated pest management.

OLFM4
Also flagged:Methylationagingchronic diseasestelomereTERTTERF2
Journal Article 2023-11-15 ✓ 1 Snippet Coltell O, Asensio EM, Sorlí JV, Ortega-Azorín C, Fernández-Carrión R, Pascual EC, Barragán R, González JI, Estruch R, Alzate JF, Pérez-Fidalgo A, Portolés O, Ordovas JM, Corella D.
In-Text Gene Mentions

…located between theOLFM4(Olfactomedin 4) and…

Show Full Abstract

Biological aging is a relevant risk factor for chronic diseases, and several indicators for measuring this factor have been proposed, with telomere length (TL) among the most studied. Oxidative stress may regulate telomere shortening, which is implicated in the increased risk. Using a novel estimator for TL, we examined whether adherence to the Mediterranean diet (MedDiet), a highly antioxidant-rich dietary pattern, is associated with longer TL. We determined TL using DNA methylation algorithms (DNAmTL) in 414 subjects at high cardiovascular risk from Spain. Adherence to the MedDiet was assessed by a validated score, and genetic variants in candidate genes and at the genome-wide level were analyzed. We observed several significant associations (<i>p</i> < 0.05) between DNAmTL and candidate genes (<i>TERT</i>, <i>TERF2</i>, <i>RTEL1</i>, and <i>DCAF4</i>), contributing to the validity of DNAmTL as a biomarker in this population. Higher adherence to the MedDiet was associated with lower odds of having a shorter TL in the whole sample (OR = 0.93; 95% CI: 0.85-0.99; <i>p</i> = 0.049 after fully multivariate adjustment). Nevertheless, this association was stronger in women than in men. Likewise, in women, we observed a direct association between adherence to the MedDiet score and DNAmTL as a continuous variable (beta = 0.015; SE: 0.005; <i>p</i> = 0.003), indicating that a one-point increase in adherence was related to an average increase of 0.015 ± 0.005 kb in TL. Upon examination of specific dietary items within the global score, we found that fruits, fish, "sofrito", and whole grains exhibited the strongest associations in women. The novel score combining these items was significantly associated in the whole population. In the genome-wide association study (GWAS), we identified ten polymorphisms at the suggestive level of significance (<i>p</i> < 1 × 10<sup>-5</sup>) for DNAmTL (intergenics, in the <i>IQSEC1</i>, <i>NCAPG2</i>, and <i>ABI3BP</i> genes) and detected some gene-MedDiet modulations on DNAmTL. As this is the first study analyzing the DNAmTL estimator, genetics, and modulation by the MedDiet, more studies are needed to confirm these findings.

Also flagged:energy homeostasisobesityMOmorbid obesityPKACREB
Journal Article 2023-11-15 No Snippets Mohammed I, Selvaraj S, Ahmed WS, Al-Barazenji T, Hammad AS, Dauleh H, Saraiva LR, Al-Shafai M, Hussain K.
Show Full Abstract

The leptin-melanocortin pathway is pivotal in appetite and energy homeostasis. Pathogenic variants in genes involved in this pathway lead to severe early-onset monogenic obesity (MO). The <i>MC4R</i> gene plays a central role in leptin-melanocortin signaling, and heterozygous variants in this gene are the most common cause of MO. A targeted gene panel consisting of 52 obesity-related genes was used to screen for variants associated with obesity. Variants were analyzed and filtered to identify potential disease-causing activity and validated using Sanger sequencing. We identified two novel heterozygous variants, c.253A>G p.Ser85Gly and c.802T>C p.Tyr268His, in the <i>MC4R</i> gene in two unrelated patients with morbid obesity and evaluated the functional impact of these variants. The impact of the variants on the <i>MC4R</i> gene was assessed using in silico prediction tools and molecular dynamics simulation. To further study the pathogenicity of the identified variants, GT1-7 cells were transfected with plasmid DNA encoding either wild-type or mutant <i>MC4R</i> variants. The effects of allelic variations in the <i>MC4R</i> gene on cAMP synthesis, <i>MC4R</i> protein level, and activation of PKA, ERB, and CREB signaling pathways in both stimulated and unstimulated ɑ-MSH paradigms were determined for their functional implications. In silico analysis suggested that the variants destabilized the <i>MC4R</i> structure and affected the overall dynamics of the <i>MC4R</i> protein, possibly leading to intracellular receptor retention. In vitro analysis of the functional impact of these variants showed a significant reduction in cell surface receptor expression and impaired extracellular ligand binding activity, leading to reduced cAMP production. Our analysis shows that the variants do not affect total protein expression; however, they are predicted to affect the post-translational localization of the <i>MC4R</i> protein to the cell surface and impair downstream signaling cascades such as PKA, ERK, and CREB signaling pathways. This finding might help our patients to benefit from the novel therapeutic advances for monogenic forms of obesity.

MLLT10
Also flagged:Acute Myeloid LeukemiaAMLacute lymphoblastic leukemiaALLcore-binding factor AMLacute promyelocytic leukemia
Journal Article 2023-11-15 ✓ 4 Snippets Tseng S, Lee ME, Lin PC.
In-Text Gene Mentions

Genetic elements MLLT3, ELL, MLLT10 (10p12), and ABI1 (10p11.2) are often linked to infant AML instances.

Furthermore, primary chemotherapy faces substantial resistance across various AML subtypes, including DNMT3A, TET2, IDH1/2 (more prevalent in adults), and UP98, WT1, RUNX1, MLLT10, SPECC1, and KMT2A [45].

In the 2022 WHO classification, AML with KMT2A rearrangement replaces “AML with t(9;11)(p22;q23); KMT2A-MLLT3”, because over 80 KMT2A fusion partners have been described, with MLLT3, AFDN, ELL, and MLLT10 being most common.

…UP98, WT1, RUNX1,MLLT10, SPECC1, and KMT2A…

Show Full Abstract

Acute myeloid leukemia (AML) is the second most common hematologic malignancy in children. The incidence of childhood AML is much lower than acute lymphoblastic leukemia (ALL), which makes childhood AML a rare disease in children. The role of genetic abnormalities in AML classification, management, and prognosis prediction is much more important than before. Disease classifications and risk group classifications, such as the WHO classification, the international consensus classification (ICC), and the European LeukemiaNet (ELN) classification, were revised in 2022. The application of the new information in childhood AML will be upcoming in the next few years. The frequency of each genetic abnormality in adult and childhood AML is different; therefore, in this review, we emphasize well-known genetic subtypes in childhood AML, including core-binding factor AML (CBF AML), <i>KMT2Ar</i> (<i>KMT2A</i>/11q23 rearrangement) AML, normal karyotype AML with somatic mutations, unbalanced cytogenetic abnormalities AML, <i>NUP98 11p15/NUP09</i> rearrangement AML, and acute promyelocytic leukemia (APL). Current risk group classification, the management algorithm in childhood AML, and novel treatment modalities such as targeted therapy, immune therapy, and chimeric antigen receptor (CAR) T-cell therapy are reviewed. Finally, the indications of hematopoietic stem cell transplantation (HSCT) in AML are discussed.

DCC
Also flagged:STINGcancersynthesishydroxylAntibodyConjugation
Journal Article 2023-11-15 ✓ 1 Snippet Lu Y, You L, Li L, Kilgore JA, Liu S, Wang X, Dai Y, Wei Q, Shi H, Han L, Sun L, Chen ZJ, Zhang X, Williams NS, Chen C.
In-Text Gene Mentions

To address this issue,we introduced to the linker a Val-Cit dipeptide unit that can be cleavedby cathepsin in a location- and carrier-independent manner.23,57,58 DCC coupling of 9 and cGAMP followed by reacting with ThioLinker-DBCO gave 10 that could also be loaded onto atezolizumab smoothly to give ADC 11/11′ (DAR 3.9) (Figure 6c).

Show Full Abstract

cGAMP is a signaling molecule produced by the cGAS-DNA complex to establish antimicrobial and antitumor immunity through STING. Whereas STING activation holds potential as a new strategy to treat cancer, cGAMP is generally considered unsuitable for in vivo use because of the rapid cleavage of its phosphodiester linkages and the limited cellular uptake under physiological conditions. Consequently, phosphorothioation and fluorination are commonly used to improve the metabolic stability and permeability of cGAMP and its synthetic analogues. We now show that methylation of the 3'-hydroxyl group of cGAMP also confers metabolic stability and that acylation of the 2'-hydroxyl group can be achieved directly and selectively to enable receptor-mediated intracellular delivery. Unlike phosphorothioation and fluorination, these modifications do not create a new stereogenic center and do not require laborious building block synthesis. As such, orthogonal hydroxyl functionalization is a simple solution to issues associated with the in vivo use of cGAMP.

Research Square 2023-11-15 Preprint (No Snippets API) Cen L, Hua H, Qin L, Li S, Chen W, Tian Z.
Show Full Abstract

<title>Abstract</title> <p>Liver hepatocellular carcinoma (LIHC) ranks among the most prevalent malignant tumors. This study investigated the pivotal role of platelet-type phosphofructokinase (PFKP) in LIHC. PFKP expression in LIHC tissues and adjacent normal tissues was assessed utilizing The Cancer Genome Atlas (TCGA) database. In addition, immunohistochemistry was conducted on clinical samples of LIHC tissues and adjacent normal tissues to evaluate PFKP expression. The TCGA database was further exploited to investigate PFKP expression and its correlation with LIHC prognosis and immune infiltration. Our findings unveiled upregulated PFKP expression in LIHC tissues, establishing an association with clinical pathological features (AJCC stage and T stage) and poor prognosis. Kaplan-Meier survival analysis and ROC curve analysis substantiated these observations by demonstrating that patients with high PFKP expression exhibited shorter median overall survival than those with low expression. Notably, PFKP expression displayed heightened predictive value for 1-year, 3-year, and 5-year survival predictions. Enrichment analysis disclosed the involvement of PFKP's biological functions in anti-tumor drug metabolism processes. Moreover, PFKP exhibited close associations with the tumor microenvironment and immune therapy. Consequently, our study identified several clinical drugs and inhibitors that exhibited increased sensitivity in LIHC patients with high PFKP expression. To conclude, PFKP assumes a critical role in the onset and progression of LIHC, thereby underscoring its significance in both research and treatment.</p>

Also flagged:type 2 diabetes mellitusobesitymorbid obesityinsulin resistanceleukocyte migrationmetabolic syndrome
Journal Article 2023-11-14 No Snippets Ruck L, Wiegand S, Kühnen P.
Show Full Abstract

<h4>Background</h4>Increasing prevalence of morbid obesity accompanied by comorbidities like type 2 diabetes mellitus (T2DM) led to a demand for improving therapeutic strategies and pharmacological intervention options. Apart from genetics, inflammation processes have been hypothesized to be of importance for the development of obesity and related aspects like insulin resistance.<h4>Main text</h4>Within this review, we provide an overview of the intricate interplay between chronic inflammation of the adipose tissue and the hypothalamus and the development of obesity. Further understanding of this relationship might improve the understanding of the underlying mechanism and may be of relevance for the establishment of new treatment strategies.

HFE
Also flagged:erythropoietic porphyriaGunther diseasehemebiosynthesisprotoporphyrinbullous skin lesions
Journal Article 2023-11-14 ✓ 1 Snippet Khan J, Hashmi MU, Noor N, Khan AJ, Shrateh ON, Tahir MJ.
In-Text Gene Mentions

…infection, alcoholism, andhemochromatosis[ 8 ].…

Show Full Abstract

<h4>Background</h4>Congenital erythropoietic porphyria (CEP), also known as pink tooth or Gunther disease, is a rare hereditary disorder caused by an enzyme mutation in the heme biosynthesis pathway, which leads to the accumulation of immature and non-physiological protoporphyrin rings in various tissues. CEP is characterized by sun-exposed bullous skin lesions, hemolytic anemia, red/brown urine, and teeth staining.<h4>Case presentation</h4>We present a unique case of a 10-year-old Asian boy with CEP who presented with recurrent epistaxis, an unusual presentation for this condition. Based on clinical presentation and laboratory findings, including elevated urine uroporphyrin and coproporphyrin I and III levels, microcytic anemia, a higher red cell distribution width (RDW), and a lower platelet count, a thorough assessment and detailed workup resulted in a diagnosis of CEP. The patient underwent a successful splenectomy and recovered without any complications.<h4>Conclusion</h4>This case report aims to raise awareness among healthcare professionals about the uncommon and atypical presentation of CEP and its management options.

PRDX6
Also flagged:GlycyrrhizinNrf2osteoarthritisredox homeostasistemporomandibular joint osteoarthritisnuclear factor-erythroid 2-related factor 2
Journal Article 2023-11-14 ✓ 2 Snippets Hu Z, Zhao J, Liu X, Li Y, Jiang H, Fang W, Long X.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6) were decreased, and…

…of antioxidants, especiallyPRDX6, as well as…

Show Full Abstract

<h4>Background</h4>Regulation of redox homeostasis could reduce osteoarthritis severity and limit disease progression, while glycyrrhizin (GL) shows great antioxidant and anti-inflammatory capacity.<h4>Objective</h4>The aim of this study was to investigate the role of GL on oxidative stress and the potential regulatory mechanism in rat temporomandibular joint (TMJ) chondrocytes under oxidative stress, and investigate the effect of GL in the rat temporomandibular joint osteoarthritis (TMJOA) model.<h4>Methods</h4>Rat TMJ chondrocytes were cultured in oxidative stress with different doses of GL. The effect of glycyrrhizin on the nuclear factor-erythroid 2-related factor 2 (Nrf2) in oxidative stress was evaluated by western blot and immunofluorescence staining. A rat model of TMJOA was treated with GL. Micro-computed tomography, histological and immunohistochemical analysis were used to assess the pathological change of TMJOA.<h4>Results</h4>The expression of superoxide dismutase 1 (SOD1), heme oxygenase-1 (HO-1), and peroxiredoxin 6 (PRDX6) were decreased, and intracellular Nrf2 signaling pathway was activated in chondrocytes in oxidative stress. GL upregulates the expression of antioxidants, especially PRDX6, as well as increases Nrf2 expression and nuclear translocation in rat condylar chondrocytes. Administration of GL attenuates condylar bone destruction, cartilage degeneration, and synovitis in rats TMJOA. Meanwhile, GL alleviated oxidative stress and enhanced the antioxidant capacity of TMJOA cartilage.<h4>Conclusion</h4>This study suggested that GL alleviates rat TMJOA by regulating oxidative stress in condylar cartilage.

OLFM4
Also flagged:autoimmune gastritischronic inflammatory diseasegene expressionGastric cancerATP4ACDX
Journal Article 2023-11-14 ✓ 1 Snippet Takeuchi C, Sato J, Yamamichi N, Kageyama-Yahara N, Sasaki A, Akahane T, Aoki R, Nakajima S, Ito M, Yamamichi M, Liu YY, Sakuma N, Takahashi Y, Sakaguchi Y, Tsuji Y, Sakurai K, Tomida S, Niimi K, Ushijima T, Fujishiro M.
In-Text Gene Mentions

…36 ], andOLFM4[ 37 ]…

Show Full Abstract

<h4>Background</h4>Autoimmune gastritis (AIG) is a prevalent chronic inflammatory disease with oncogenic potential that causes destruction of parietal cells and severe mucosal atrophy. We aimed to explore the distinctive gene expression profiles, activated signaling pathways, and their underlying mechanisms.<h4>Methods</h4>A comprehensive gene expression analysis was conducted using biopsy specimens from AIG, Helicobacter pylori-associated gastritis (HPG), and non-inflammatory normal stomachs. Gastric cancer cell lines were cultured under acidic (pH 6.5) conditions to evaluate changes in gene expression.<h4>Results</h4>Gastric mucosa with AIG had a unique gene expression profile compared with that with HPG and normal mucosa, such as extensively low expression of ATP4A and high expression of GAST and PAPPA2, which are involved in neuroendocrine tumorigenesis. Additionally, the mucosa with AIG and HPG showed the downregulation of stomach-specific genes and upregulation of small intestine-specific genes; however, intestinal trans-differentiation was much more prominent in AIG samples, likely in a CDX-dependent manner. Furthermore, AIG induced ectopic expression of pancreatic digestion-related genes, PNLIP, CEL, CTRB1, and CTRC; and a master regulator gene of the lung, NKX2-1/TTF1 with alveolar fluid secretion-related genes, SFTPB and SFTPC. Mechanistically, acidic conditions led to the downregulation of master regulator and stemness control genes of small intestine, suggesting that increased environmental pH may cause abnormal intestinal differentiation in the stomach.<h4>Conclusions</h4>AIG induces diverse trans-differentiation in the gastric mucosa, characterized by the transactivation of genes specific to the small intestine, pancreas, and lung. Increased environmental pH owing to AIG may cause abnormal differentiation of the gastric mucosa.

Also flagged:taxanepaclitaxelcorticosteroidsdexamethasonetumorcorticosteroid
Journal Article 2023-11-14 No Snippets Shalmani AA, Wang A, Ahmed Z, Sheybanifard M, Mihyar R, Buhl EM, Pohl M, Hennink WE, Kiessling F, Metselaar JM, Shi Y, Lammers T, Peña Q.
Show Full Abstract

Nanomedicine holds promise for potentiating drug combination therapies. Increasing (pre)clinical evidence is available exemplifying the value of co-formulating and co-delivering different drugs in modular nanocarriers. Taxanes like paclitaxel (PTX) are widely used anticancer agents, and commonly combined with corticosteroids like dexamethasone (DEX), which besides for suppressing inflammation and infusion reactions, are increasingly explored for modulating the tumor microenvironment towards enhanced nano-chemotherapy delivery and efficacy. We here set out to develop a size- and release rate-tunable polymeric micelle platform for co-delivery of taxanes and corticosteroids. We synthesized amphiphilic mPEG-b-p(HPMAm-Bz) block copolymers of various molecular weights and used them to prepare PTX and DEX single- and double-loaded micelles of different sizes. Both drugs could be efficiently co-encapsulated, and systematic comparison between single- and co-loaded formulations demonstrated comparable physicochemical properties, encapsulation efficiencies, and release profiles. Larger micelles showed slower drug release, and DEX release was always faster than PTX. The versatility of the platform was exemplified by co-encapsulating two additional taxane-corticosteroid combinations, demonstrating that drug hydrophobicity and molecular weight are key properties that strongly contribute to drug retention in micelles. Altogether, our work shows that mPEG-b-p(HPMAm-Bz) polymeric micelles serve as a tunable and versatile nanoparticle platform for controlled co-delivery of taxanes and corticosteroids, thereby paving the way for using these micelles as a modular carrier for multidrug nanomedicine.

STAU1
Also flagged:RNA-binding proteinslocalizationdegradationgene expressionRBPbiotin
Journal Article 2023-11-14 ✓ 1 Snippet Soueid DM, Garner AL.
In-Text Gene Mentions

Stau1

Show Full Abstract

RNA-binding proteins (RBPs) act as essential regulators of cell fate decisions, through their ability to bind and regulate the activity of cellular RNAs. For protein-coding mRNAs, RBPs control the localization, stability, degradation, and ultimately translation of mRNAs to impact gene expression. Disruption of the vast network of mRNA-protein interactions has been implicated in many human diseases, and accordingly, targeting these interactions has surfaced as a new frontier in RNA-targeted drug discovery. To catalyze this new field, methods are needed to enable the detection and subsequent screening of mRNA-RBP interactions, particularly in live cells. Using our laboratory's RNA-interaction with Protein-mediated Complementation Assay (RiPCA) technology, herein we describe its application to mRNA-protein interactions and present a guide for the development of future RiPCA assays for structurally diverse classes of mRNA-protein interactions.

Also flagged:glycoside 3-oxidasesdegradationflavo-oxidasesglucosemethanolmangiferin
Journal Article 2023-11-14 No Snippets Taborda A, Frazão T, Rodrigues MV, Fernández-Luengo X, Sancho F, Lucas MF, Frazão C, Melo EP, Ventura MR, Masgrau L, Borges PT, Martins LO.
Show Full Abstract

C-glycosides are natural products with important biological activities but are recalcitrant to degradation. Glycoside 3-oxidases (G3Oxs) are recently identified bacterial flavo-oxidases from the glucose-methanol-coline (GMC) superfamily that catalyze the oxidation of C-glycosides with the concomitant reduction of O<sub>2</sub> to H<sub>2</sub>O<sub>2</sub>. This oxidation is followed by C-C acid/base-assisted bond cleavage in two-step C-deglycosylation pathways. Soil and gut microorganisms have different oxidative enzymes, but the details of their catalytic mechanisms are largely unknown. Here, we report that PsG3Ox oxidizes at 50,000-fold higher specificity (k<sub>cat</sub>/K<sub>m</sub>) the glucose moiety of mangiferin to 3-keto-mangiferin than free D-glucose to 2-keto-glucose. Analysis of PsG3Ox X-ray crystal structures and PsG3Ox in complex with glucose and mangiferin, combined with mutagenesis and molecular dynamics simulations, reveal distinctive features in the topology surrounding the active site that favor catalytically competent conformational states suitable for recognition, stabilization, and oxidation of the glucose moiety of mangiferin. Furthermore, their distinction to pyranose 2-oxidases (P2Oxs) involved in wood decay and recycling is discussed from an evolutionary, structural, and functional viewpoint.

DCC
Also flagged:gene expressioncytoplasmdegenerative diseasestranscription factorsOLIG2HB9
Journal Article 2023-11-14 ✓ 4 Snippets Tollis P, Vitiello E, Migliaccio F, D'Ambra E, Rocchegiani A, Garone MG, Bozzoni I, Rosa A, Carissimo A, Laneve P, Caffarelli E.
In-Text Gene Mentions

…26 ] andDCC, associated with…

…, ROBO1 ,DCC, SEMA3E and…

…the expression ofDCC, encoding for…

…the SC (DCCand ROBO1 )…

Show Full Abstract

The mammalian nervous system is made up of an extraordinary array of diverse cells that form intricate functional connections. The programs underlying cell lineage specification, identity and function of the neuronal subtypes are managed by regulatory proteins and RNAs, which coordinate the succession of steps in a stereotyped temporal order. In the central nervous system (CNS), motor neurons (MNs) are responsible for controlling essential functions such as movement, breathing, and swallowing by integrating signal transmission from the cortex, brainstem, and spinal cord (SC) towards peripheral muscles. A prime role in guiding the progression of progenitor cells towards the MN fate has been largely attributed to protein factors. More recently, the relevance of a class of regulatory RNAs abundantly expressed in the CNS - the long noncoding RNAs (lncRNAs) - has emerged overwhelmingly. LncRNA-driven gene expression control is key to regulating any step of MN differentiation and function, and its derangement profoundly impacts neuronal pathophysiology. Here, we uncover a novel function for the neuronal isoform of HOTAIRM1 (nHOTAIRM1), a lncRNA specifically expressed in the SC. Using a model system that recapitulates spinal MN (spMN) differentiation, we show that nHOTAIRM1 intervenes in the binary cell fate decision between MNs and interneurons, acting as a pro-MN factor. Furthermore, human iPSC-derived spMNs without nHOTAIRM1 display altered neurite outgrowth, with a significant reduction of both branch and junction numbers. Finally, the expression of genes essential for synaptic connectivity and neurotransmission is also profoundly impaired when nHOTAIRM1 is absent in spMNs. Mechanistically, nHOTAIRM1 establishes both direct and indirect interactions with a number of target genes in the cytoplasm, being a novel post-transcriptional regulator of MN biology. Overall, our results indicate that the lncRNA nHOTAIRM1 is essential for the specification of MN identity and the acquisition of proper morphology and synaptic activity of post-mitotic MNs.

SHISA6
Also flagged:chromatintomitochondrialporphyrinchromosomeorganization
Journal Article 2023-11-14 ✓ 1 Snippet Lu Y, Lee J, Li J, Allu SR, Wang J, Kim H, Bullaughey KL, Fisher SA, Nordgren CE, Rosario JG, Anderson SA, Ulyanova AV, Brem S, Chen HI, Wolf JA, Grady MS, Vinogradov SA, Kim J, Eberwine J.
In-Text Gene Mentions

…LRR27 andSHISA6from ionotropic glutamate…

Show Full Abstract

Genomic DNA (gDNA) undergoes structural interconversion between single- and double-stranded states during transcription, DNA repair and replication, which is critical for cellular homeostasis. We describe "CHEX-seq" which identifies the single-stranded DNA (ssDNA) in situ in individual cells. CHEX-seq uses 3'-terminal blocked, light-activatable probes to prime the copying of ssDNA into complementary DNA that is sequenced, thereby reporting the genome-wide single-stranded chromatin landscape. CHEX-seq is benchmarked in human K562 cells, and its utilities are demonstrated in cultures of mouse and human brain cells as well as immunostained spatially localized neurons in brain sections. The amount of ssDNA is dynamically regulated in response to perturbation. CHEX-seq also identifies single-stranded regions of mitochondrial DNA in single cells. Surprisingly, CHEX-seq identifies single-stranded loci in mouse and human gDNA that catalyze porphyrin metalation in vitro, suggesting a catalytic activity for genomic ssDNA. We posit that endogenous DNA enzymatic activity is a function of genomic ssDNA.

Also flagged:cancersporadic early-onset colon cancertumorcolon cancertumorsfibroblast associated protein
Journal Article 2023-11-14 No Snippets Furuhashi S, Bustos MA, Mizuno S, Ryu S, Naeini Y, Bilchik AJ, Hoon DSB.
Show Full Abstract

The incidence of sporadic early-onset colon cancer (EOCC) has increased worldwide. The molecular mechanisms in the tumor and the tumor microenvironment (TME) in EOCC are not fully understood. The aim of this study is to unravel unique spatial transcriptomic and proteomic profiles in tumor epithelial cells and cancer-associated fibroblasts (CAFs). Here, we divide the sporadic colon cancer tissue samples with transcriptomic data into patients diagnosed with EOCC (<50 yrs) and late-onset colon cancer (LOCC, ≥50 yrs) and then, analyze the data using CIBERSORTx deconvolution software. EOCC tumors are more enriched in CAFs with fibroblast associated protein positive expression (FAP(+)) than LOCC tumors. EOCC patients with higher FAP mRNA levels in CAFs have shorter OS (Log-rank test, p < 0.029). Spatial transcriptomic analysis of 112 areas of interest, using NanoString GeoMx digital spatial profiling, demonstrate that FAP(+) CAFs at the EOCC tumor invasive margin show a significant upregulation of WNT signaling and higher mRNA/protein levels of fibroblast growth factor 20 (FGF20). Tumor epithelial cells at tumor invasive margin of EOCC tumors neighboring FAP(+) CAFs show significantly higher mRNA/protein levels of fibroblast growth factor receptor (FGFR2) and PI3K/Akt signaling activation. NichNET analysis show a potential interaction between FGF20 and FGFFR2. The role of FGF20 in activating FGFR2/pFGFR2 and AKT/pAKT was validated in-vitro. In conclusion, we identify a unique FAP(+) CAF population that showed WNT signaling upregulation and increased FGF20 levels; while neighbor tumor cells show the upregulation/activation of FGFR2-PI3K/Akt signaling at the tumor invasive margin of EOCC tumors.

Also flagged:FGFR2intrahepatic cholangiocarcinomascancerstumorsTP53cancer
Journal Article 2023-11-14 No Snippets Pu X, Qi L, Yan JW, Ai Z, Wu P, Yang F, Fu Y, Li X, Zhang M, Sun B, Yue S, Chen J.
Show Full Abstract

<h4>Background</h4>Except for gene fusions, FGFR2 genetic alterations in intrahepatic cholangiocarcinomas (ICCs) have received limited attention, leaving patients harboring activating FGFR2 gene mutations with inadequate access to targeted therapies.<h4>Experimental design</h4>We sought to survey FGFR2 genetic alterations in ICC and pan-cancers using fluorescence in situ hybridization and next-generation sequencing. We conducted an analysis of the clinical and pathological features of ICCs with different FGFR2 alterations, compared FGFR2 lesion spectrum through public databases and multicenter data, and performed cellular experiments to investigate the oncogenic potential of different FGFR2 mutants.<h4>Results</h4>FGFR2 gene fusions were identified in 30 out of 474 ICC samples, while five FGFR2 genetic alterations aside from fusion were present in 290 ICCs. The tumors containing FGFR2 translocations exhibited unique features, which we designated as the "FGFR2 fusion subtypes of ICC". Molecular analysis revealed that FGFR2 fusions were not mutually exclusive with other oncogenic driver genes/mutations, whereas FGFR2 in-frame deletions and site mutations often co-occurred with TP53 mutations. Multicenter and pan-cancer studies demonstrated that FGFR2 in-frame deletions were more prevalent in ICCs (0.62%) than in other cancers, and were not limited to the extracellular domain. We selected representative FGFR2 genetic alterations, including in-frame deletions, point mutations, and frameshift mutations, to analyze their oncogenic activity and responsiveness to targeted drugs. Cellular experiments revealed that different FGFR2 genetic alterations promoted ICC tumor growth, invasion, and metastasis but responded differently to FGFR-selective small molecule kinase inhibitors (SMKIs).<h4>Conclusions</h4>FGFR2 oncogenic alterations have different clinicopathological features and respond differently to SMKIs.

HFE
Also flagged:Systemic Lupus ErythematosusAutoimmune diseasesironmetabolisminflammatory cytokineimmune response
Journal Article 2023-11-14 ✓ 5 Snippets Carini M, Fredi M, Cavazzana I, Bresciani R, Ferrari F, Monti E, Franceschini F, Biasiotto G.
In-Text Gene Mentions

Although further investigation is needed, the examination of the frequencies of the -174G>C <i>IL-6</i> promoter polymorphism and <i>HFE</i> mutations may add some valuable information on the interplay linking iron metabolism, inflammation and immunity in autoimmune diseases such as SLE and RA.

Frequency Evaluation of the <i>Interleukin-6</i> -174G>C Polymorphism and <i>Homeostatic Iron Regulator (HFE)</i> Mutations as Disease Modifiers in Patients Affected by Systemic Lupus Erythematosus and Rheumatoid Arthritis.

…Homeostatic Iron Regulator (HFE) Mutations as Disease…

…of the threeHFEgene variations associated…

…p.Ser65Cys in theHFEgene did not…

Show Full Abstract

Autoimmune diseases are generally characterized by a multifactorial etiology and are often associated with a genetic predisposition. Both iron metabolism and the inflammatory cytokine system have been shown to play a pivotal role in the dysregulation of the immune response in many different autoimmune conditions, rheumatologic diseases included. The purpose of this work was to analyze the frequency of mutations altering the expression of IL-6 or influencing iron metabolism in patients affected by autoimmune diseases such as Rheumatoid Arthritis (RA) and Systemic Lupus Erythematosus (SLE). In this study, 144 patients were enrolled: 77 and 67 patients were affected by RA and SLE, respectively. In these cohorts, the frequency of the <i>IL-6</i> polymorphism -174G>C located in the <i>IL-6</i> gene promoter was tested. Moreover, the frequencies of the three <i>HFE</i> gene variations associated with iron overload were analyzed: p.His63Asp, p.Ser65Cys and p.Cys282Tyr. The two mutations p.His63Asp and p.Ser65Cys in the <i>HFE</i> gene did not reach statistical significance in any of the comparisons, regardless of the statistical model, cohorts of patients and control populations analyzed. The frequencies of the p.Cys282Tyr mutation and the <i>IL-6</i> polymorphism -174G>C were found to be overall significantly decreased in RA and SLE patients when the Dominant model and Allele contrast were adopted with both the Odds Ratio and Chi-square. Although further investigation is needed, the examination of the frequencies of the -174G>C <i>IL-6</i> promoter polymorphism and <i>HFE</i> mutations may add some valuable information on the interplay linking iron metabolism, inflammation and immunity in autoimmune diseases such as SLE and RA.

TAOK3
Also flagged:Polycystic Ovary Syndromesteroidpolycystic ovarian syndromePCOSfertilizationbinding
Journal Article 2023-11-14 ✓ 2 Snippets Pant P, Sircar R, Prasad R, Prasad HO, Chitme HR.
In-Text Gene Mentions

Only 6 common proteins were found in “Normal-MGCs,” “normal-MGCs + DHEAS,” “PCOS-MGCs,” and “PCOS-MGCs + DHEAS” (A2MG, ALBU, FETUA, ITIH2, SGO2, and SPT6H), a single protein, MAGT1_HUMAN, was found in “normal-MGCs + DHEAS” and “PCOS-MGCs + DHEAS,” and only 1 protein, CO3, was common in “normal-MGCs + DHEAS,” “PCOS-MGCs,” and “normal-MGCs + DHEAS.” A total of 32 proteins were exclusively included in “Normal-MGCs + DHEAS” (ACON, AL1A1, AL8A1, AP4E1, ASPP1, BRD8, CFA57, CIA2A, COMP, DHE3, ERIC3, ESPNL, FGD4, HS71A, IF122, ISM2, KAD2, MGAL, MTEF4, NDKA, NWD1, PLVAP, RAP2A, SIA8D, SORL, TAOK3, TDR15, TET5B, THUM2, TSH1, TTHY, and WLS).

…RAP2A, SIA8D, SORL,TAOK3, TDR15, TET5B, THUM2,…

Show Full Abstract

<h4>Background</h4>The reproductive system is heavily dependent on ovarian follicles, which are made up of germ cells (oocytes) and granulosa cells (GCs), including cumulus granulosa cells (CGCs) and mural granulosa cells (MGCs). Understanding their normal and steroid-induced functions is the key to understanding the pathophysiology of endocrinal diseases in women.<h4>Objective</h4>This study investigated the differentially expressed proteins by CGCs and MGCs of patients with polycystic ovarian syndrome (PCOS) and without subsequent exposure to dehydroepiandrosterone sulfate (DHEAS) and functional differentiation.<h4>Design</h4>The present study was observational and experimental study carried out in hospital involving 80 female patients undergoing IVF for infertility.<h4>Methods</h4>In this study, we isolated CGCs and MGCs from the follicular fluid of both PCOS and non-PCOS patients undergoing in vitro fertilization (IVF). The cells were cultured and treated with DHEAS for 48 hours, and these cells were extracted, digested, and analyzed by tandem mass spectrometry followed by processing of the results using open-source bioinformatics tools.<h4>Results</h4>The present investigation discovered 276 and 341 proteins in CGCs and MGCs, respectively. DHEAS reduced the number of proteins expressed by CGCs and MGCs to 34 and 57 from 91 and 94, respectively. Venn results of CGCs revealed 49, 53, 36, and 21 proteins in normal CGCs, PCOS-CGCs, post-DHEAS, and PCOS-CGCs, respectively. Venn analysis of MGCs showed 51 proteins specific to PCOS and 29 shared by normal and PCOS samples after DHEAS therapy. MGCs express the most binding and catalytic proteins, whereas CGCs express transporter-related proteins. A protein pathway study demonstrated considerable differences between normal and PCOS samples, while DHEAS-treated samples of both cell lines showed distinct pathways. String findings identified important network route components such as albumin, actin, apolipoprotein, complement component C3, and heat shock protein.<h4>Conclusion</h4>This is the first study to show how DHEAS-induced stress affects the expression of proteins by MGCs and CGCs isolated from normal and PCOS patients. Further studies are recommended to identify PCOS biomarkers from CGCs and MGCs expressed under the influence of DHEAS.

OLFM4
Also flagged:AHNAKAHNAK2calcium channelmembranetumorstumor
Journal Article 2023-11-14 ✓ 1 Snippet Zhang S, Cai Z, Li H.
In-Text Gene Mentions

Four candidate BLCA diagnostic proteins including AHNAK, EPPK1, MYH14 and OLFM4 were screened using public databases such as TCGA for joint comparisons.

Show Full Abstract

The AHNAK family currently consists of two members, namely AHNAK and AHNAK2, both of which have a molecular weight exceeding 600 kDa. Homologous sequences account for approximately 90% of their composition, indicating a certain degree of similarity in terms of molecular structure and biological functions. AHNAK family members are involved in the regulation of various biological functions, such as calcium channel modulation and membrane repair. Furthermore, with advancements in biological and bioinformatics technologies, research on the relationship between the AHNAK family and tumors has rapidly increased in recent years, and its regulatory role in tumor progression has gradually been discovered. This article briefly describes the physiological functions of the AHNAK family, and reviews and analyzes the expression and molecular regulatory mechanisms of the AHNAK family in malignant tumors using Pubmed and TCGA databases. In summary, AHNAK participates in various physiological and pathological processes in the human body. In multiple types of cancers, abnormal expression of AHNAK and AHNAK2 is associated with prognosis, and they play a key regulatory role in tumor progression by activating signaling pathways such as ERK, MAPK, Wnt, and MEK, as well as promoting epithelial-mesenchymal transition.

SERPINC1
Also flagged:Venous thromboembolismdeep venous thrombosisDVTpulmonary embolismPEobesity
Journal Article 2023-11-14 ✓ 1 Snippet Ding P, Zhou Y, Zhang KC, Li S, Long KL, Chen J, Chen YJ, Gao PY.
In-Text Gene Mentions

…(factor V Leiden),SERPINC1(antithrombin Ⅲ) and…

Show Full Abstract

<h4>Background</h4>Genetic and acquired risk factors are fundamental to developing venous thromboembolism. Autosomal dominant protein S deficiency caused by pathogenic mutations in the PROS1 gene is a well-known risk factor for thrombophilia.<h4>Case presentation</h4>We report a 30-year-old male patient who presented to the hospital with portal vein thrombosis. The patient had a history of abdominal pain for one month. Abdominal vascular CT showed venous thrombosis in the portal vein and superior mesenteric vein. He was diagnosed with "portal and superior mesenteric vein thrombosis, small bowel obstruction and necrosis, acute upper gastrointestinal bleeding (UGIB), hemorrhagic shock." Serum protein S levels were decreased, and gene sequencing revealed a heterozygous missense mutation in PROS1, c.1571T > G (p.Leu584Arg). The patient received anticoagulation therapy with Enoxaparin Sodium and rivaroxaban, transjugular intrahepatic portosystemic shunt (TIPS), and ICU treatments. Although the patient had a severe bleeding event during anticoagulation therapy, he recovered well after active treatment and dynamic monitoring of anti-Xa.<h4>Conclusion</h4>Hereditary protein S deficiency caused by a mutation in the PROS1 gene is the genetic basis of this patient, and Enoxaparin Sodium and rivaroxaban have been shown to be highly effective.

Also flagged:SCA2SCA3MJDATXN2ATXN3Spinocerebellar ataxia types 2
Journal Article 2023-11-14 No Snippets Sena LS, Lemes RB, Furtado GV, Saraiva-Pereira ML, Jardim LB.
Show Full Abstract

<b>Background:</b> Spinocerebellar ataxia types 2 (SCA2) and 3 (SCA3/MJD) are diseases due to dominant unstable expansions of CAG repeats (CAGexp). Age of onset of symptoms (AO) correlates with the CAGexp length. Repeat instability leads to increases in the expanded repeats, to important AO anticipations and to the eventual extinction of lineages. Because of that, compensatory forces are expected to act on the maintenance of expanded alleles, but they are poorly understood. <b>Objectives:</b> we described the CAGexp dynamics, adapting a classical equation and aiming to estimate for how many generations will the descendants of a <i>de novo</i> expansion last. <b>Methods:</b> A mathematical model was adapted to encompass anticipation, fitness, and allelic segregation; and empirical data fed the model. The arbitrated ancestral mutations included in the model had the lowest CAGexp and the highest AO described in the literature. One thousand generations were simulated until the alleles were eliminated, fixed, or 650 generations had passed. <b>Results</b>: All SCA2 lineages were eliminated in a median of 10 generations. In SCA3/MJD lineages, 593 were eliminated in a median of 29 generations. The other ones were eliminated due to anticipation after the 650th generation or remained indefinitely with CAG repeats transitioning between expanded and unexpanded ranges. <b>Discussion</b>: the model predicted outcomes compatible with empirical data - the very old ancestral SCA3/MJD haplotype, and the <i>de novo</i> SCA2 expansions -, which previously seemed to be contradictory. This model accommodates these data into understandable dynamics and might be useful for other CAGexp disorders.

Also flagged:tumorcancerangiogenesischemokinessynthesisoxygen
Journal Article 2023-11-14 No Snippets Shao S, Miao H, Ma W.
Show Full Abstract

Tumor-associated macrophages (TAMs) are integral to the tumor microenvironment (TME), influencing cancer progression significantly. Attracted by cancer cell signals, TAMs exhibit unparalleled adaptability, aligning with the dynamic tumor milieu. Their roles span from promoting tumor growth and angiogenesis to modulating metastasis. While substantial research has explored the fundamentals of TAMs, comprehending their adaptive behavior, and leveraging it for novel treatments remains challenging. This review delves into TAM polarization, metabolic shifts, and the complex orchestration of cytokines and chemokines determining their functions. We highlight the complexities of TAM-targeted research focusing on their adaptability and potential variability in therapeutic outcomes. Moreover, we discuss the synergy of integrating TAM-focused strategies with established cancer treatments, such as chemotherapy, and immunotherapy. Emphasis is laid on pioneering methods like TAM reprogramming for cancer immunotherapy and the adoption of single-cell technologies for precision intervention. This synthesis seeks to shed light on TAMs' multifaceted roles in cancer, pinpointing prospective pathways for transformative research and enhancing therapeutic modalities in oncology.

ZNFX1
Also flagged:infectioncoronavirus disease-2019COVID-19lung infectionCXCL10BEX2
Journal Article 2023-11-14 ✓ 1 Snippet Flynn J, Ahmadi MM, McFarland CT, Kubal MD, Taylor MA, Cheng Z, Torchia EC, Edwards MG.
In-Text Gene Mentions

…by Mdb1 andZnfx1( P =…

Show Full Abstract

The emergence of severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) reawakened the need to rapidly understand the molecular etiologies, pandemic potential, and prospective treatments of infectious agents. The lack of existing data on SARS-CoV-2 hampered early attempts to treat severe forms of coronavirus disease-2019 (COVID-19) during the pandemic. This study coupled existing transcriptomic data from severe acute respiratory syndrome-related coronavirus 1 (SARS-CoV-1) lung infection animal studies with crowdsourcing statistical approaches to derive temporal meta-signatures of host responses during early viral accumulation and subsequent clearance stages. Unsupervised and supervised machine learning approaches identified top dysregulated genes and potential biomarkers (e.g. CXCL10, BEX2, and ADM). Temporal meta-signatures revealed distinct gene expression programs with biological implications to a series of host responses underlying sustained Cxcl10 expression and Stat signaling. Cell cycle switched from G1/G0 phase genes, early in infection, to a G2/M gene signature during late infection that correlated with the enrichment of DNA damage response and repair genes. The SARS-CoV-1 meta-signatures were shown to closely emulate human SARS-CoV-2 host responses from emerging RNAseq, single cell, and proteomics data with early monocyte-macrophage activation followed by lymphocyte proliferation. The circulatory hormone adrenomedullin was observed as maximally elevated in elderly patients who died from COVID-19. Stage-specific correlations to compounds with potential to treat COVID-19 and future coronavirus infections were in part validated by a subset of twenty-four that are in clinical trials to treat COVID-19. This study represents a roadmap to leverage existing data in the public domain to derive novel molecular and biological insights and potential treatments to emerging human pathogens.

HTT
Also flagged:PeptideHuntingtinaminopeptidesThioflavin Tfibril formation
Journal Article 2023-11-14 ✓ 5 Snippets Khan A, Özçelik CE, Begli O, Oguz O, Kesici MS, Kasırga TS, Özçubukcu S, Yuca E, Seker UOS.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative disorder resulting from a significant amplification of CAG repeats in exon 1 of the Huntingtin (Htt) gene.

…of the Huntingtin (Htt) gene.…

…of a mutantHtt(mHtt) protein.…

…both wild type (Htt(Q25)) and mHtt fragments,…

…and mHtt fragments,Htt(Q46) and Htt(Q103).…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder resulting from a significant amplification of CAG repeats in exon 1 of the Huntingtin (Htt) gene. More than 36 CAG repeats result in the formation of a mutant Htt (mHtt) protein. These amino-terminal mHtt fragments lead to the formation of misfolded proteins, which then form aggregates in the relevant brain regions. Therapies that can delay the progression of the disease are imperative to halting the course of the disease. Peptide-based drug therapies provide such a platform. Inhibitory peptides were screened against monomeric units of both wild type (Htt(Q25)) and mHtt fragments, Htt(Q46) and Htt(Q103). Fibril kinetics was studied by utilizing the Thioflavin T (ThT) assay. Atomic force microscopy was also used to study the influence of the peptides on fibril formation. These experiments demonstrate that the chosen peptides suppress the formation of fibrils in mHtt proteins and can provide a therapeutic lead for further optimization and development.

NEGR1DCC
Also flagged:SH2B1ERKobesitymetabolismbehavioralextracellular signal-regulated kinase
Journal Article 2023-11-14 ✓ 3 Snippets Du X, Yan Y, Yu J, Zhu T, Huang CC, Zhang L, Shan X, Li R, Dai Y, Lv H, Zhang XY, Feng J, Li WG, Luo Q, Li F.
In-Text Gene Mentions
⭐ same-sentence co-mention

However, it is noteworthy that some of these genes, such as ATP2A1, COL16A1, DCC, FOXO3, NEGR1, SH2B1, SKAP1, TUFM, and YIPF7 [11–16], have also been linked to body mass index (BMI), obesity, or both.

…, COL16A1 ,DCC, FOXO3 ,…

…, FOXO3 ,NEGR1, SH2B1 ,…

Show Full Abstract

Fluid intelligence is a cognitive domain that encompasses general reasoning, pattern recognition, and problem-solving abilities independent of task-specific experience. Understanding its genetic and neural underpinnings is critical yet challenging for predicting human development, lifelong health, and well-being. One approach to address this challenge is to map the network of correlations between intelligence and other constructs. In the current study, we performed a genome-wide association study using fluid intelligence quotient scores from the UK Biobank to explore the genetic architecture of the associations between obesity risk and fluid intelligence. Our results revealed novel common genetic loci (<i>SH2B1</i>, <i>TUFM</i>, <i>ATP2A1</i>, and <i>FOXO3</i>) underlying the association between fluid intelligence and body metabolism. Surprisingly, we demonstrated that <i>SH2B1</i> variation influenced fluid intelligence independently of its effects on metabolism but partially mediated its association with bilateral hippocampal volume. Consistently, selective genetic ablation of <i>Sh2b1</i> in the mouse hippocampus, particularly in inhibitory neurons, but not in excitatory neurons, significantly impaired working memory, short-term novel object recognition memory, and behavioral flexibility, but not spatial learning and memory, mirroring the human intellectual performance. Single-cell genetic profiling of Sh2B1-regulated molecular pathways revealed that <i>Sh2b1</i> deletion resulted in aberrantly enhanced extracellular signal-regulated kinase (ERK) signaling, whereas pharmacological inhibition of ERK signaling reversed the associated behavioral impairment. Our cross-species study thus provides unprecedented insight into the role of <i>SH2B1</i> in fluid intelligence and has implications for understanding the genetic and neural underpinnings of lifelong mental health and well-being.

Research Square 2023-11-14 Preprint (No Snippets API) Li J, Zuo J.
Show Full Abstract

<h4>Background: </h4> Fibroblast growth factor18 (FGF18) is a synthetic growth factor that is associated with osteogenesis, chondrogenesis and articular cartilage repair. However, the exact mechanism is still unknown. In this work, we investigated the specific effects of FGF18 on chondrocyte differentiation and osteoarthritis (OA) development. Methods Recombinant FGF18 adenovirus (Ad-FGF18) was constructed to achieve instantaneous efficient expression. Chondrocyte progenitor cells were infected with Ad-FGF18 and subjected to chondrocyte differentiation. Alcian blue staining and chondrocyte differentiation markers’ qRT-PCR were used to evaluate the status of chondrocyte differentiation. Destabilization of the medial meniscus (DMM) surgery was used to construct the OA model. Ad-GFP or Ad-FGF18 was intra-articular injected once a week for 6 weeks. The knee joints were harvested for histological examination. Results FGF18 promoted chondrocyte differentiation by increasing the expression of Sox6 , Col2 (Collagen type Ⅱ) and Acan (Aggrecan). In the knee joint of Ad-FGF18 intra-articular injected, there was little cartilage degradation, increased protein levels of COL2 and ACAN, and decreased protein levels of ADAMTS5 (a disintegrin and metallopeptidase with thrombospondin type 1 motif 5) and MMP13 (matrix metalloproteinase 13). Conclusions Our findings reveal that FGF18 promotes the differentiation of chondrocytes and protects articular cartilage from degradation during OA development. This finding provides a potential novel therapeutic approach for cartilage regeneration and treatment of osteoarthritis.

HFE
Also flagged:Pulmonary Hypertensionβ-thalassemiaironmacitentanβ-thalassemiashemolytic anemias
Journal Article 2023-11-13 ✓ 2 Snippets Takagi K, Kasai H, Tani H, Sakao S, Sugiura T, Suzuki T.
In-Text Gene Mentions

…injury due tohemochromatosis.…

…injury due tohemochromatosisand low systemic…

Show Full Abstract

A 51-year-old Thai woman diagnosed with β-thalassemia underwent regular blood transfusion and iron-chelating therapy. However, after voluntarily discontinuing treatment, the patient developed progressive dyspnea and was diagnosed with pulmonary hypertension following right heart catheterization. Despite resuming blood transfusions, her condition did not improve. Because the patient had a history of multiple organ failure, curative treatment for β-thalassemia was not feasible, and macitentan was administered. Despite experiencing hypotension as an adverse event, her condition remained stable during macitentan treatment. Thus, macitentan may be well tolerated in patients with pulmonary hypertension caused by β-thalassemia with multiple organ dysfunction.

MLLT10DDX27
Also flagged:gene expressiontranscription factorsdevelopmental disordersmetabolic disorderscancerbinding
Journal Article 2023-11-13 ✓ 2 Snippets Talukdar PD, Chatterji U.
In-Text Gene Mentions

KMT2A (histone-lysine N-methyltransferase 2A, former MLL) is a transcriptional coactivator with histone H3 lysine 4 (H3K4) methyltransferase activity.414 KMT2A is popularly known to be associated with acute leukemias, especially in infants, where it mostly interacts with six partner genes (AFF1, MLLT3, MLLT10, MLLT1, ELL, AFDN).415 However, a recent study has highlighted that KMT2A is also prevalent in cervical cancer, where it promotes cancer cell growth by regulating VADC1 (Voltage-dependent anion-selective channel 1).

Thus, in the context of colorectal cancer, the functional interaction between DDX27-NPM1-NF-κB is essential for tumor progression and metastasis.468

Show Full Abstract

Specific cell states in metazoans are established by the symphony of gene expression programs that necessitate intricate synergic interactions between transcription factors and the co-activators. Deregulation of these regulatory molecules is associated with cell state transitions, which in turn is accountable for diverse maladies, including developmental disorders, metabolic disorders, and most significantly, cancer. A decade back most transcription factors, the key enablers of disease development, were historically viewed as 'undruggable'; however, in the intervening years, a wealth of literature validated that they can be targeted indirectly through transcriptional co-activators, their confederates in various physiological and molecular processes. These co-activators, along with transcription factors, have the ability to initiate and modulate transcription of diverse genes necessary for normal physiological functions, whereby, deregulation of such interactions may foster tissue-specific disease phenotype. Hence, it is essential to analyze how these co-activators modulate specific multilateral processes in coordination with other factors. The proposed review attempts to elaborate an in-depth account of the transcription co-activators, their involvement in transcription regulation, and context-specific contributions to pathophysiological conditions. This review also addresses an issue that has not been dealt with in a comprehensive manner and hopes to direct attention towards future research that will encompass patient-friendly therapeutic strategies, where drugs targeting co-activators will have enhanced benefits and reduced side effects. Additional insights into currently available therapeutic interventions and the associated constraints will eventually reveal multitudes of advanced therapeutic targets aiming for disease amelioration and good patient prognosis.

Also flagged:COVID-19RNA
Journal Article 2023-11-13 No Snippets Mainan A, Roy S.
Show Full Abstract

The programmed frameshifting stimulatory element, a promising drug target for COVID-19 treatment, involves a RNA pseudoknot (PK) structure. This RNA PK facilitates frameshifting, enabling RNA viruses to translate multiple proteins from a single mRNA, which is a key strategy for their rapid evolution. Overcoming the challenges of capturing large-scale structural changes of RNA under the influence of a dynamic counterion environment (K<sup>+</sup> and Mg<sup>2+</sup>), the study extended the applications of a newly developed dynamic counterion condensation (DCC) model. DCC simulations reveal potential folding pathways of this RNA PK, supported by the experimental findings obtained using optical tweezers. The study elucidates the pivotal role of Mg<sup>2+</sup> ions in crafting a lasso-like RNA topology, a novel RNA motif that governs dynamic transitions between the ring-opened and ring-closed states of the RNA. The pierced lasso component guided by Mg<sup>2+</sup>-mediated interactions orchestrates inward and outward motion fine-tuning tension on the slippery segment, a critical factor for optimizing frameshifting efficiency.

BTN2A2BTN2A1
Also flagged:lactylationtumorskin cutaneous melanomaskin tumorstranslational modificationhistones
Journal Article 2023-11-13 ✓ 2 Snippets Zhu Y, Song B, Yang Z, Peng Y, Cui Z, Chen L, Song B.
In-Text Gene Mentions

BTN2A1

BTN2A2

Show Full Abstract

<h4>Background</h4>The incidence of skin cutaneous melanoma (SKCM), one of the most aggressive and lethal skin tumors, is increasing worldwide. However, for advanced SKCM, we still lack an accurate and valid way to predict its prognosis, as well as novel theories to guide the planning of treatment options for SKCM patients. Lactylation (LAC), a novel post-translational modification of histones, has been shown to promote tumor growth and inhibit the antitumor response of the tumor microenvironment (TME) in a variety of ways. We hope that this study will provide new ideas for treatment options for SKCM patients, as well as research on the molecular mechanisms of SKCM pathogenesis and development.<h4>Methods</h4>At the level of the RNA sequencing set (TCGA, GTEx), we used differential expression analysis, LASSO regression analysis, and multifactor Cox regression analysis to screen for prognosis-related genes and calculate the corresponding LAC scores. The content of TME cells in the tumor tissue was calculated using the CIBERSORT algorithm, and the TME score was calculated based on its results. Finally, the LAC-TME classifier was established and further analyzed based on the two scores, including the construction of a prognostic model, analysis of clinicopathological characteristics, and correlation analysis of tumor mutation burden (TMB) and immunotherapy. Based on single-cell RNA sequencing data, this study analyzed the cellular composition in SKCM tissues and explored the role of LAC scores in intercellular communication. To validate the functionality of the pivotal gene CLPB in the model, cellular experiments were ultimately executed.<h4>Results</h4>We screened a total of six prognosis-related genes (NDUFA10, NDUFA13, CLPB, RRM2B, HPDL, NARS2) and 7 TME cells with good prognosis. According to Kaplan-Meier survival analysis, we found that the LAC<sup>low</sup>/TME<sup>high</sup> group had the highest overall survival (OS) and the LAC<sup>high</sup>/TME<sup>low</sup> group had the lowest OS (p value < 0.05). In further analysis of immune infiltration, tumor microenvironment (TME), functional enrichment, tumor mutational load and immunotherapy, we found that immunotherapy was more appropriate in the LAC<sup>low</sup>/TME<sup>high</sup> group. Moreover, the cellular assays exhibited substantial reductions in proliferation, migration, and invasive potentials of melanoma cells in both A375 and A2058 cell lines upon CLPB knockdown.<h4>Conclusions</h4>The prognostic model using the combined LAC score and TME score was able to predict the prognosis of SKCM patients more consistently, and the LAC-TME classifier was able to significantly differentiate the prognosis of SKCM patients across multiple clinicopathological features. The LAC-TME classifier has an important role in the development of immunotherapy regimens for SKCM patients.

Also flagged:colorectal carcinomatumorgene expressiontumorsTNF-αMYC
Journal Article 2023-11-13 No Snippets Budinská E, Hrivňáková M, Ivkovic TC, Madrzyk M, Nenutil R, Bencsiková B, Al Tukmachi D, Ručková M, Zdražilová Dubská L, Slabý O, Feit J, Dragomir MP, Borilova Linhartova P, Tejpar S, Popovici V.
Show Full Abstract

Heterogeneity of colorectal carcinoma (CRC) represents a major hurdle towards personalized medicine. Efforts based on whole tumor profiling demonstrated that the CRC molecular subtypes were associated with specific tumor morphological patterns representing tumor subregions. We hypothesize that whole-tumor molecular descriptors depend on the morphological heterogeneity with significant impact on current molecular predictors. We investigated intra-tumor heterogeneity by morphology-guided transcriptomics to better understand the links between gene expression and tumor morphology represented by six morphological patterns (morphotypes): complex tubular, desmoplastic, mucinous, papillary, serrated, and solid/trabecular. Whole-transcriptome profiling by microarrays of 202 tumor regions (morphotypes, tumor-adjacent normal tissue, supportive stroma, and matched whole tumors) from 111 stage II-IV CRCs identified morphotype-specific gene expression profiles and molecular programs and differences in their cellular buildup. The proportion of cell types (fibroblasts, epithelial and immune cells) and differentiation of epithelial cells were the main drivers of the observed disparities with activation of EMT and TNF-α signaling in contrast to MYC and E2F targets signaling, defining major gradients of changes at molecular level. Several gene expression-based (including single-cell) classifiers, prognostic and predictive signatures were examined to study their behavior across morphotypes. Most exhibited important morphotype-dependent variability within same tumor sections, with regional predictions often contradicting the whole-tumor classification. The results show that morphotype-based tumor sampling allows the detection of molecular features that would otherwise be distilled in whole tumor profile, while maintaining histopathology context for their interpretation. This represents a practical approach at improving the reproducibility of expression profiling and, by consequence, of gene-based classifiers.

CDK5RAP1
Also flagged:ironmetabolismgastric cancerDOHHP4HA3MMP1
Journal Article 2023-11-13 ✓ 1 Snippet Liu X, Ren J, Zhou R, Wen Z, Wen Z, Chen Z, He S, Zhang H.
In-Text Gene Mentions

…, ALKBH2 ,CDK5RAP1, CDO1 ,…

Show Full Abstract

<h4>Background</h4>Researches have manifested that the disorder of iron metabolism is participated in Gastric cancer (GC), but whether iron metabolism-relevant genes (IMRGs) is related to the survival outcome of GC remain unknown.<h4>Methods</h4>Eleven tumor as well as nine adjacent normal tissues from GC patients were underwent mRNA sequencing, and the The Cancer Genome Atlas Stomach Cancer (TCGA-STAD) datasets were acquired from the TCGA database. Cox analyses and least absolute shrinkage and selection operator (LASSO) regression were applied to build a IMRGs signature. The relationship between signature genes and the infiltration profiling of 24 immune cells were investigated using single-sample GSEA (ssGSEA). Meanwhile, the potential biological significance, genes that act synergistically with signature genes, and the upstream regulatory targets were predicted. Finally, the abundance of the signature genes were measured via the quantitative real-time PCR (qRT-PCR).<h4>Results</h4>A IMRGs signature was constructed according to the expression and corresponding coefficient of DOHH, P4HA3 and MMP1 (The Schoenfeld individual test showed risk score was not significant with P values = 0.83). The prognostic outcome of patients in the high-risk group was terrible (p < 0.05). Receiver operating characteristic (ROC) curves confirmed that the IMRGs signature presented good efficiency for predicting GC prognosis (AUC > 0.6). The nomogram was performed well for clinical utilize (C-index = 0.60), and the MMP1 expression significantly increased in the cohorts at age > 60 and Stage II-IV (p < 0.05). The positive correlation of P4HA3 and MMP1 expression as well as the negative correlation of DOHH expression with risk score (p < 0.0001) and worse prognosis (p < 0.05) were detected as well. Furthermore, 11 differential immune cells were associated with these signature genes (most p < 0.01). Finally, qRT-PCR revealed that the abundance of DOHH, P4HA3 and MMP1 were high in tumor cases, indicating the complex mechanism between the high expression of DOHH as a protective factor and the high expression of P4HA3 and MMP1 as the risk factors in the development of GC.<h4>Conclusion</h4>An iron metabolism-related signature was constructed and has significant values for foretelling the OS of GC.

TNFSF4
Also flagged:USP32cancerhepatocellular carcinomaUbiquitin-specific protease 32tumorposttranslational
Journal Article 2023-11-13 ✓ 3 Snippets Xiu M, Bao W, Wang J, Chen J, Li Y, Hai Y.
In-Text Gene Mentions

Subsequently, multivariate Cox regression analysis identified and produced an optimal 5-gene (CCR3, CXCL8, KDR, RAE1E and TNFSF4) prognostic signature of HCC patients (Fig. 8B).

…MICB, RAET1E, TGFB1,TNFSF4and ULBP1) were…

…KDR, RAE1E andTNFSF4) prognostic signature of…

Show Full Abstract

<h4>Background</h4>Ubiquitin-specific protease 32 (USP32) is a highly conserved gene that promotes cancer progression. However, its role in hepatocellular carcinoma (HCC) is not well understood. The aim of this project is to explore the clinical significance and functions of USP32 in HCC.<h4>Methods</h4>The expression of USP32 in HCC was evaluated using data from TCGA, GEO, TISCH, tissue microarray, and human HCC samples from our hospital. Survival analysis, PPI analysis and GSEA analysis were performed to evaluate USP32-related clinical significance, key molecules and enrichment pathways. Using the ssGSEA algorithm and TIMER, we investigated the relationships between USP32 and immune infiltrates in the TME. Univariate and multivariate Cox regression analyses were then used to identify key USP32-related immunomodulators and constructed a USP32-related immune prognostic model. Finally, CCK8, transwell and colony formation assays of HCC cells were performed and an HCC nude mouse model was established to verify the oncogenic role of USP32.<h4>Results</h4>USP32 is overexpressed in HCC and its expression is an independent predictive factor for outcomes of HCC patients. USP32 is associated with pathways related to cell behaviors and cancer signaling, and its expression is significantly correlated with the infiltration of immune cells in the TME. We also successfully constructed a USP32-related immune prognostic model using 5 genes. Wet experiments confirmed that knockdown of USP32 could repress the proliferation, colony formation and migration of HCC cells in vitro and inhibit tumor growth in vivo.<h4>Conclusion</h4>USP32 is highly expressed in HCC and closely correlates with the TME of HCC. It is a potential target for improving the efficacy of chemotherapy and developing new strategies for targeted therapy and immunotherapy in HCC.

SUDS3
Also flagged:agingcardiovascular diseasesstemsenescencetranslationalNrf2
Journal Article 2023-11-13 ✓ 1 Snippet Allemann MS, Lee P, Beer JH, Saeedi Saravi SS.
In-Text Gene Mentions

…the induction ofjumonji‐domain containing histone demethylasecontaining histone demethylase…

Show Full Abstract

Cardiovascular aging presents a formidable challenge, as the aging process can lead to reduced cardiac function and heightened susceptibility to cardiovascular diseases. Consequently, there is an escalating, unmet medical need for innovative and effective cardiovascular regeneration strategies aimed at restoring and rejuvenating aging cardiovascular tissues. Altered redox homeostasis and the accumulation of oxidative damage play a pivotal role in detrimental changes to stem cell function and cellular senescence, hampering regenerative capacity in aged cardiovascular system. A mounting body of evidence underscores the significance of targeting redox machinery to restore stem cell self-renewal and enhance their differentiation potential into youthful cardiovascular lineages. Hence, the redox machinery holds promise as a target for optimizing cardiovascular regenerative therapies. In this context, we delve into the current understanding of redox homeostasis in regulating stem cell function and reprogramming processes that impact the regenerative potential of the cardiovascular system. Furthermore, we offer insights into the recent translational and clinical implications of redox-targeting compounds aimed at enhancing current regenerative therapies for aging cardiovascular tissues.

HFE
Also flagged:polysaccharideiron deficiency anemiaFPN1IDAmicronutrient deficiencyASP
Journal Article 2023-11-13 ✓ 1 Snippet Zhang Y, Guo T, Huang L, He Z, Wang J, Mei H, Huang X, Wang K.
In-Text Gene Mentions

…P6/SMAD4, JAK2/STAT3 and TfR2/HFEsignaling pathways, which…

Show Full Abstract

Iron deficiency anemia (IDA) is a common micronutrient deficiency among pregnant women with deleterious maternal and fetal outcomes. Angelica sinensis polysaccharide (ASP) has been shown to reduce hepcidin expression in IDA rats. However, the role of ASP in the treatment of IDA during pregnancy and its potential mechanisms have not been investigated. Moreover, the effect of ASP on duodenal iron absorption is not clear. The aim of this study was to investigate the preventive efficacy of ASP against IDA during pregnancy and clarify the underlying mechanisms. Our results showed that ASP improved maternal hematological parameters, increased serum iron, maternal tissue iron, and fetal liver iron content, and improved pregnancy outcomes. Additionally, ASP combated oxidative stress caused by iron deficiency by improving the body's antioxidant capacity. Western blot results demonstrated that ASP downregulated hepcidin expression by blocking the BMP6/SMAD4, JAK2/STAT3 and TfR2/HFE signaling pathways, which in turn increased the expression of FPN1 in the liver, spleen, and duodenum and promoted iron cycling in the body. Furthermore, ASP increased the expression of DMT1 and Dcytb in the duodenum, thereby facilitating duodenal iron uptake. Our results suggest that ASP is a potential agent for the prevention and treatment of IDA during pregnancy.

HTT
Also flagged:Huntington's diseaseHDautosomal dominant diseaseinflammatory responseInterleukin 6IL-6
Journal Article 2023-11-13 ✓ 1 Snippet Soltani Khaboushan A, Moeinafshar A, Ersi MH, Teixeira AL, Majidi Zolbin M, Kajbafzadeh AM.
In-Text Gene Mentions

<h4>Background</h4>Huntington's disease (HD) is an autosomal dominant disease caused by an abnormally high number of CAG repeats at the huntingtin-encoding gene, HTT.

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is an autosomal dominant disease caused by an abnormally high number of CAG repeats at the huntingtin-encoding gene, HTT. This genetic alteration results in the expression of a mutant form of the protein (mHTT) and the formation of intracellular aggregates, inducing an inflammatory state within the affected areas. This dysfunction of inflammatory response leads to elevated levels of related inflammatory markers in both CNS tissue samples and body fluids. This study aims to investigate peripheral/blood concentrations of inflammatory molecules in HD.<h4>Methods</h4>A search was conducted in MEDLINE, Scopus, Web of Science, and Embase databases until March 30th, 2023. Random-effect meta-analysis was used for exploring concentrations of inflammatory molecules in HD. Subgroup and sensitivity analyses were used to assess heterogeneity among the included studies. The study protocol has been registered in PROSPERO with the ID number CRD42022296078.<h4>Results</h4>Ten studies were included in the meta-analysis. Plasma levels of Interleukin 6 (IL-6) and IL-10 were higher in HD compared to controls. Other biomarkers, namely, complement component C-reactive protein (CRP), C3, interferon-γ (IFN-γ), IL-1, IL-2, IL-8, and tumor necrosis factor-α (TNF-α), did not show any significant differences between the two groups. In addition, the subgroup analysis results established no significant differences in levels of these biomarkers in body fluids among premanifest and manifest HD patients.<h4>Conclusion</h4>The results of this study provide evidence for the presence of higher plasma levels of IL-6 and IL-10 in HD patients in comparison with healthy controls.

STAU1
Also flagged:OralLichen PlanusOral lichen planuschronic inflammatory diseaseextracellularinflammatory response
Journal Article 2023-11-13 ✓ 2 Snippets Kim TJ, Kim YG, Jung W, Jang S, Ko HG, Park CH, Byun JS, Kim DY.
In-Text Gene Mentions

…transactivates Staufen 1 (STAU1), which associates with…

…the abundance ofSTAU1-mediated mRNA decay targets…

Show Full Abstract

Oral lichen planus (OLP) is a chronic inflammatory disease that is characterized by the infiltration of T cells into the oral mucosa, causing the apoptosis of basal keratinocytes. OLP is a multifactorial disease of unknown etiology and is not solely caused by the malfunction of a single key gene but rather by various intracellular and extracellular factors. Non-coding RNAs play a critical role in immunological homeostasis and inflammatory response and are found in all cell types and bodily fluids, and their expression is closely regulated to preserve normal physiologies. The dysregulation of non-coding RNAs may be highly implicated in the onset and progression of diverse inflammatory disorders, including OLP. This narrative review summarizes the role of non-coding RNAs in molecular and cellular changes in the oral epithelium during OLP pathogenesis.

Also flagged:AutophagyHepatocellular Carcinomamitophagyliver diseasescancerdeath
Journal Article 2023-11-13 No Snippets Nguyen TH, Nguyen TM, Ngoc DTM, You T, Park MK, Lee CH.
Show Full Abstract

This review aims to provide a comprehensive understanding of the molecular mechanisms underlying autophagy and mitophagy in hepatocellular carcinoma (HCC). Autophagy is an essential cellular process in maintaining cell homeostasis. Still, its dysregulation is associated with the development of liver diseases, including HCC, which is one of leading causes of cancer-related death worldwide. We focus on elucidating the dual role of autophagy in HCC, both in tumor initiation and progression, and highlighting the complex nature involved in the disease. In addition, we present a detailed analysis of a small subset of autophagy- and mitophagy-related molecules, revealing their specific functions during tumorigenesis and the progression of HCC cells. By understanding these mechanisms, we aim to provide valuable insights into potential therapeutic strategies to manipulate autophagy effectively. The goal is to improve the therapeutic response of liver cancer cells and overcome drug resistance, providing new avenues for improved treatment options for HCC patients. Overall, this review serves as a valuable resource for researchers and clinicians interested in the complex role of autophagy in HCC and its potential as a target for innovative therapies aimed to combat this devastating disease.

PRDX6
Also flagged:Nlrp3InflammasomeInflammatory Responseagingage-related diseasesPeroxiredoxin
Journal Article 2023-11-13 ✓ 5 Snippets Chhunchha B, Kumar R, Kubo E, Thakur P, Singh DP.
In-Text Gene Mentions

Prdx6Regulates Nlrp3 Inflammasome…

…targeted inactivation ofPrdx6gene and aging…

…active cells whereinPrdx6availability offsets the…

…the delivery ofPrdx6or by silencing…

…biological significance ofPrdx6as an intrinsic…

Show Full Abstract

The continuum of antioxidant response dysregulation in aging/oxidative stress-driven Nlrp3 inflammasome activation-mediated inflammatory response is associated with age-related diseases. Peroxiredoxin (Prdx) 6 is a key antioxidant that provides cytoprotection by regulating redox homeostasis. Herein, using lens epithelial cells (LECs) derived from the targeted inactivation of Prdx6 gene and aging lenses, we present molecular evidence that <i>Prdx6</i>-deficiency causes oxidative-driven Nlrp3 inflammasome activation, resulting in pyroptosis in aging/redox active cells wherein Prdx6 availability offsets the inflammatory process. We observed that <i>Prdx6</i><sup>-/-</sup> and aging LECs harboring accumulated reactive oxygen species (ROS) showed augmented activation of Nlrp3 and bioactive inflammatory components, like Caspase-1, IL-1β, ASC and Gasdermin-D. Similar to lipopolysaccharide treatment, oxidative exposure led to further ROS amplification with increased activation of the Nlrp3 inflammasome pathway. Mechanistically, we found that oxidative stress enhanced Kruppel-like factor 9 (Klf9) expression in aging/<i>Prdx6</i><sup>-/-</sup> mLECs, leading to a Klf9-dependent increase in Nlrp3 transcription, while the elimination of ROS by the delivery of Prdx6 or by silencing Klf9 prevented the inflammatory response. Altogether, our data identify the biological significance of Prdx6 as an intrinsic checkpoint for regulating the cellular health of aging or redox active LECs and provide opportunities to develop antioxidant-based therapeutic(s) to prevent oxidative/aging-related diseases linked to aberrant Nlrp3 inflammasome activation.

Also flagged:cancersovarian cancerOCimmune response-Methylcytosinetumor
Journal Article 2023-11-13 No Snippets Liu Y, Liu S, Yan L, Zhang Q, Liu W, Huang X, Liu S.
Show Full Abstract

<h4>Background</h4>5-Methylcytosine (m5C) RNA modification is closely implicated in the occurrence of a variety of cancers. Here, we established a novel prognostic signature for ovarian cancer (OC) patients based on m5C RNA modification-related genes and explored the correlation between these genes with the tumor immune microenvironment.<h4>Methods</h4>Methylated-RNA immunoprecipitation sequencing helped us to identify candidate genes related to m5C RNA modification at first. Based on TCGA database, we screened the differentially expressed candidate genes related to the prognosis and constructed a prognostic model using LASSO Cox regression analyses. Notably, the accuracy of the model was evaluated by Kaplan-Meier analysis and receiver operator characteristic curves. Independent prognostic risk factors were investigated by Cox proportional hazard model. Furthermore, we also analyzed the biological functions and pathways involved in the signature. Finally, the immune response of the model was visualized in great detail.<h4>Results</h4>Totally, 2,493 candidate genes proved to be involved in m5C modification of RNA for OC. We developed a signature with prognostic value consisting of six m5C RNA modification-related genes. Specially, samples have been split into two cohorts with low- and high-risk scores according to the model, in which the low-risk OC patients exhibited dramatically better overall survival time than those with high-risk scores. Besides, not only was this model a prognostic factor independent of other clinical characteristics but it predicted the intensity of the immune response in OC. Significantly, the accuracy and availability of the signature were verified by ICGC database.<h4>Conclusions</h4>Our study bridged the gap between m5C RNA modification and the prognosis of OC and was expected to provide an effective breakthrough for immunotherapy in OC patients.

Also flagged:TDP-43 proteinopathyaxonalAmyotrophic lateral sclerosisALSneurodegenerative diseaseTDP-43
Journal Article 2023-11-13 No Snippets Pisciottani A, Croci L, Lauria F, Marullo C, Savino E, Ambrosi A, Podini P, Marchioretto M, Casoni F, Cremona O, Taverna S, Quattrini A, Cioni JM, Viero G, Codazzi F, Consalez GG.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a progressive, lethal neurodegenerative disease mostly affecting people around 50-60 years of age. TDP-43, an RNA-binding protein involved in pre-mRNA splicing and controlling mRNA stability and translation, forms neuronal cytoplasmic inclusions in an overwhelming majority of ALS patients, a phenomenon referred to as TDP-43 proteinopathy. These cytoplasmic aggregates disrupt mRNA transport and localization. The axon, like dendrites, is a site of mRNA translation, permitting the local synthesis of selected proteins. This is especially relevant in upper and lower motor neurons, whose axon spans long distances, likely accentuating their susceptibility to ALS-related noxae. In this work we have generated and characterized two cellular models, consisting of virtually pure populations of primary mouse cortical neurons expressing a human TDP-43 fusion protein, wt or carrying an ALS mutation. Both forms facilitate cytoplasmic aggregate formation, unlike the corresponding native proteins, giving rise to <i>bona fide</i> primary culture models of TDP-43 proteinopathy. Neurons expressing TDP-43 fusion proteins exhibit a global impairment in axonal protein synthesis, an increase in oxidative stress, and defects in presynaptic function and electrical activity. These changes correlate with deregulation of axonal levels of polysome-engaged mRNAs playing relevant roles in the same processes. Our data support the emerging notion that deregulation of mRNA metabolism and of axonal mRNA transport may trigger the dying-back neuropathy that initiates motor neuron degeneration in ALS.

SERPINC1
Also flagged:ATthrombinAT deficiencyacute kidney injurythromboembolismstroke
Journal Article 2023-11-13 ✓ 1 Snippet Li T, Bo F, Meng X, Wang D, Ma J, Dai Z.
In-Text Gene Mentions

…was divided intoATIIIand recombinant human…

Show Full Abstract

<h4>Study objective</h4>Antithrombin (AT) activity is reduced during cardiopulmonary bypass (CPB) surgery. Guidelines has demonstrated that perioperative AT supplementation contributed to blood conservation and prevent perioperative thrombotic complications and target organ injury owing to its role in reducing thrombin generation. But these recommends is lack of support of meta-analysis in the guidelines. This meta-analysis aims to include all the relevant randomized controlled trails (RCT) on patients who experienced cardiac surgeries with CPB and investigate the effect of perioperative AT on blood conservation and complications after cardiac surgery.<h4>Methods</h4>Standard published RCTs were searched from bibliographic databases to identify all evidence reporting perioperative AT supplementation for patients undergoing cardiovascular surgeries. The primary outcome was postoperative blood loss, the secondary outcomes were blood component transfusion (red blood cell (RBC), fresh frozen plasma (FFP), platelet and autologous blood), postoperative morbidity and in hospital mortality. The relative risk (RR) for dichotomous outcomes and the standardized mean difference (SMD) for continuous outcomes were estimated using a random-effects model. Trial sequential analysis (TSA) was performed using TSA software 0.9.5.10.<h4>Results</h4>13 RCTs with 996 participants undergoing different cardiovascular surgeries were included. Meta-analysis showed AT did not decrease postoperative blood loss (SMD -0.01, 95%CI -0.2 to 0.19). Subgroup analysis showed the effect of AT on postoperative blood loss was not associated with age, RCT type, surgery type, injection time of AT and AT deficiency. TSA further suggested that no additional studies were required for the stable result. Perioperative AT also did not reduce RBC ((SMD 0.10, 95%CI -0.66 to 0.85), (RR 0.99, 95%CI 0.83 to 1.19)), FFP ((SMD 0.11, 95%CI -0.19 to 0.41), (RR 1.30, 95%CI 0.90 to 1.87)), platelet (RR 1.10, 95%CI 0.83 to 1.46) and autologous blood (SMD 0.46, 95%CI -0.12 to 1.8504) transfusions. Perioperative AT significantly increased in hospital mortality (RR 2.53, 95%CI 1.02 to 6.28) and acute kidney injury (AKI) (RR 3.72, 95%CI 1.73 to 8.04) incidence. There was no significant difference in postoperative reexploration, thromboembolism, ECMO/IABP support, and stroke incidence between AT and non-AT group.<h4>Conclusions</h4>With the improvement of AT level and heparin sensitivity, perioperative AT has no significant effect on blood conservation. And it is noteworthy that the treatment increased in hospital mortality and the incidence of AKI after cardiac surgery.

Also flagged:flavonoidsmajor depressive disordertriterpenoidsliquiritinbrain-derived neurotrophic factorBDNF
Journal Article 2023-11-13 No Snippets Wang R, Chen Y, Wang Z, Cao B, Du J, Deng T, Yang M, Han J.
Show Full Abstract

With the development of society and changes in lifestyle, major depressive disorder (MDD) has become a significant disease that plagues many people. Licorice, an excellent natural medicine with a long history of cultivation and application, is found in classical antidepressant prescriptions such as Chaihu Shugan Powder, Ganmai Dazao Decoction, Suanzaoren Decoction, etc. Licorice mainly contains triterpenoids and flavonoids, among which licorice total flavonoids (LF) and liquiritin are the main active components with good antidepressant effects. The pharmacological effects of licorice have been extensively investigated in current studies. However, a review of the antidepressant effects of LF and liquiritin has not been conducted. This article reviews the antidepressant effects of LF and liquiritin, including the biological characteristics of licorice and the pharmacological mechanism of LF and liquiritin in treating MDD. Studies have shown that LF and liquiritin can exert their antidepressant effects by improving depressive behavior, regulating endocrine and hypothalamic-pituitary-adrenal (HPA) axis function, affecting the brain-derived neurotrophic factor (BDNF)/tyrosine kinase B (TrkB) signaling pathway, enhancing synaptic plasticity, increasing monoamine neurotransmitter levels, protecting nerve cells, reducing inflammation, preventing apoptosis, reducing oxidation and other ways. This lays a theoretical foundation for the development of antidepressant drugs.

Also flagged:cancergene expressioncancersimmune responseMethyladenosinemethylation
Journal Article 2023-11-13 No Snippets Hashemi M, Daneii P, Zandieh MA, Raesi R, Zahmatkesh N, Bayat M, Abuelrub A, Khazaei Koohpar Z, Aref AR, Zarrabi A, Rashidi M, Salimimoghadam S, Entezari M, Taheriazam A, Khorrami R.
Show Full Abstract

The emergence of RNA modifications has recently been considered as critical post-transcriptional regulations which governed gene expression. <i>N</i><sup>6</sup>-methyladenosine (m<sup>6</sup>A) modification is the most abundant type of RNA modification which is mediated by three distinct classes of proteins called m<sup>6</sup>A writers, readers, and erasers. Accumulating evidence has been made in understanding the role of m<sup>6</sup>A modification of non-coding RNAs (ncRNAs) in cancer. Importantly, aberrant expression of ncRNAs and m<sup>6</sup>A regulators has been elucidated in various cancers. As the key role of ncRNAs in regulation of cancer hallmarks is well accepted now, it could be accepted that m<sup>6</sup>A modification of ncRNAs could affect cancer progression. The present review intended to discuss the latest knowledge and importance of m<sup>6</sup>A epigenetic regulation of ncRNAs including mircoRNAs, long non-coding RNAs, and circular RNAs, and their interaction in the context of cancer. Moreover, the current insight into the underlying mechanisms of therapy resistance and also immune response and escape mediated by m<sup>6</sup>A regulators and ncRNAs are discussed.

medRxiv 2023-11-13 Preprint (No Snippets API) Schweizer L, Krishnan R, Shimizu A, Metousis A, Kenny H, Mendoza R, Nordmann TM, Rauch S, Kelliher L, Heide J, Rosenberger FA, Bilecz A, Borrego SN, Strauss MT, Thielert M, Rodriguez E, Müller-Reif JB, Chen M, Yamada SD, Mund A, Lastra RR, Mann M, Lengyel E.
Show Full Abstract

Serous borderline tumors (SBT) are epithelial neoplastic lesions of the ovaries that commonly have a good prognosis. In 10-15% of cases, however, SBT will recur as low-grade serous cancer (LGSC), which is deeply invasive and responds poorly to current standard chemotherapy 1,2,3 . While genetic alterations suggest a common origin, the transition from SBT to LGSC remains poorly understood 4 . Here, we integrate spatial proteomics 5 with spatial transcriptomics to elucidate the evolution from SBT to LGSC and its corresponding metastasis at the molecular level in both the stroma and the tumor. We show that the transition of SBT to LGSC occurs in the epithelial compartment through an intermediary stage with micropapillary features (SBT-MP), which involves a gradual increase in MAPK signaling. A distinct subset of proteins and transcripts was associated with the transition to invasive tumor growth, including the neuronal splicing factor NOVA2, which was limited to expression in LGSC and its corresponding metastasis. An integrative pathway analysis exposed aberrant molecular signaling of tumor cells supported by alterations in angiogenesis and inflammation in the tumor microenvironment. Integration of spatial transcriptomics and proteomics followed by knockdown of the most altered genes or pharmaceutical inhibition of the most relevant targets confirmed their functional significance in regulating key features of invasiveness. Combining cell-type resolved spatial proteomics and transcriptomics allowed us to elucidate the sequence of tumorigenesis from SBT to LGSC. The approach presented here is a blueprint to systematically elucidate mechanisms of tumorigenesis and find novel treatment strategies.

Also flagged:GliomaInfectioncancersolid tumorsLact infectionhistone
Journal Article 2023-11-12 No Snippets Semenov DV, Vasileva NS, Dymova MA, Mishinov SV, Savinovskaya YI, Ageenko AB, Dome AS, Zinchenko ND, Stepanov GA, Kochneva GV, Richter VA, Kuligina EV.
Show Full Abstract

Oncolytic virotherapy is a rapidly evolving approach that aims to selectively kill cancer cells. We designed a promising recombinant vaccinia virus, VV-GMCSF-Lact, for the treatment of solid tumors, including glioma. We assessed how VV-GMCSF-Lact affects human cells using immortalized and patient-derived glioma cultures and a non-malignant brain cell culture. Studying transcriptome changes in cells 12 h or 24 h after VV-GMCSF-Lact infection, we detected the common activation of histone genes. Additionally, genes associated with the interferon-gamma response, NF-kappa B signaling pathway, and inflammation mediated by chemokine and cytokine signaling pathways showed increased expression. By contrast, genes involved in cell cycle progression, including spindle organization, sister chromatid segregation, and the G2/M checkpoint, were downregulated following virus infection. The upregulation of genes responsible for Golgi vesicles, protein transport, and secretion correlated with reduced sensitivity to the cytotoxic effect of VV-GMCSF-Lact. Higher expression of genes encoding proteins, which participate in the maturation of pol II nuclear transcripts and mRNA splicing, was associated with an increased sensitivity to viral cytotoxicity. Genes whose expression correlates with the sensitivity of cells to the virus are important for increasing the effectiveness of cancer virotherapy. Overall, the results highlight molecular markers, biological pathways, and gene networks influencing the response of glioma cells to VV-GMCSF-Lact.

OLFM4
Also flagged:CFL2Intestinal gastric cancercancerdeathcell cycleimmune response
Journal Article 2023-11-12 ✓ 1 Snippet Dos Santos EC, Rohan P, Binato R, Abdelhay E.
In-Text Gene Mentions

…UBE2C, HSPE1, andOLFM4) ( Table 2…

Show Full Abstract

Intestinal gastric cancer (IGC) carcinogenesis results from a complex interplay between environmental and molecular factors, ultimately contributing to disease development. We used integrative bioinformatic analysis to investigate IGC high-throughput molecular data to uncover interactions among differentially expressed genes, microRNAs, and proteins and their roles in IGC. An integrated network was generated based on experimentally validated microRNA-gene/protein interaction data, with three regulatory circuits involved in a complex network contributing to IGC progression. Key regulators were determined, including 23 microRNA and 15 gene/protein hubs. The regulatory circuit networks were associated with hallmarks of cancer, e.g., cell death, apoptosis and the cell cycle, the immune response, and epithelial-to-mesenchymal transition, indicating that different mechanisms of gene regulation impact similar biological functions. Altered expression of hubs was related to the clinicopathological characteristics of IGC patients and showed good performance in discriminating tumors from adjacent nontumor tissues and in relation to T stage and overall survival (OS). Interestingly, expression of upregulated hub hsa-mir-200b and its downregulated target hub gene/protein CFL2 were related not only to pathological T staging and OS but also to changes during IGC carcinogenesis. Our study suggests that regulation of CFL2 by hsa-miR-200b is a dynamic process during tumor progression and that this control plays essential roles in IGC development. Overall, the results indicate that this regulatory interaction is an important component in IGC pathogenesis. Also, we identified a novel molecular interplay between microRNAs, proteins, and genes associated with IGC in a complex biological network and the hubs closely related to IGC carcinogenesis as potential biomarkers.

DARS2
Also flagged:lung adenocarcinomaLUADtumorERKCancerdeath
Journal Article 2023-11-11 ✓ 5 Snippets Fang T, Jiang J, Yu W, Li R, Tian H.
In-Text Gene Mentions

(h) IHC and HE staining were used to detect the expression of Ki‐67 and DARS2 in the subcutaneous tumors of nude mice.

After that, we further discussed the mechanism of DARS2 promoting proliferation, invasion and metastasis of the lung adenocarcinoma cells.

And EdU assay was also used to verify the effect of DARS2 on the proliferative capacity of LUAD cell lines.

We further analyzed the relationship between normal cases and LUAD cases at different stages through the ULCAN website, which showed that DARS2 expression was closely related to the stage of LUAD (Figure 1d).

Moreover, DARS2 targets ERK/c‐Myc signal pathway to promote the occurrence and development of LUAD.

Show Full Abstract

<h4>Background</h4>DARS2 expression is upregulated in lung adenocarcinoma (LUAD) which correlates with tumor patient stage and prognosis. The mechanism of DARS2 involvement in LUAD still needs to be further explored.<h4>Methods</h4>In this study, we found that DARS2 expression in LUAD tissue was significantly higher than that in normal tissue. At the same time, the Kaplan-Meier curve showed that the survival prognosis of LUAD patients with high expression of DARS2 was significantly worse than low expression of DARS2. The expression of DARS2 was detected in LUAD and adjacent normal tissues by IHC staining, histochemical scoring and a survival curve was generated. In addition, we demonstrated that the knockdown and overexpression of DARS2 significantly affected the proliferation, invasion, and migration of LUAD cells in vitro and in vivo. Finally, western blot and rescue assay were performed on LUAD cells to further explore and verify the signaling pathway.<h4>Results</h4>DARS2 expression was significantly upregulated in LUAD tissues and cell lines. What is more, the increased expression of DARS2 was closely related to proliferation, invasion and metastasis. The tumorigenic assay in nude mice further showed that the tumorigenic ability of nude mice was significantly improved with the increase in DARS2 expression. Finally, we determined that DARS2 plays its role in LUAD by targeting the ERK/c-Myc signaling pathway.<h4>Conclusion</h4>Our data revealed the oncogenic role of DARS2 in LUAD, indicating that DARS2 may be a predictive biomarker and novel therapeutic target for LUAD.

Also flagged:coagulationprothrombinfibrinogenhemoglobinhypertensiondiabetes
Journal Article 2023-11-11 No Snippets Pham HN, Huynh NX, Pham PNH, Dang DNY, Cao LT, Huynh DM, Thoi HTT, Le OH, Beaupha SMC.
Show Full Abstract

<h4>Background</h4>Pregnancy has major effects that make hematology parameters outside of normal reference ranges. Therefore, we conducted this study to establish reference intervals for Vietnamese pregnant women.<h4>Methods</h4>From June 2023 to Augst 2023, blood samples from 879 eligible pregnant women were run on DxH 900 hematology analyzer and ACL TOP 550 coagulation analyzer. The tested parameters are prothrombin time (PT), activated partial thromboplastin time (APTT), fibrinogen (FIB), white blood cell (WBC) and its differentials (neutrophils, lymphocytes, monocytes, eosinophils and basophils), red blood cell (RBC), hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), RBC distribution width (RDW), RBC distribution width standard deviation (RDW-SD), platelet count (PLT), mean platelet volume (MPV). A non-parametric method was used to establish the 2.5<sup>th</sup> and 97.5<sup>th</sup> percentile reference intervals.<h4>Results</h4>PT, APTT decrease but fibrinogen increases during pregnancy. Physiological adaptations of pregnancy result in a decrease in RBC count, but an increase in WBC count and no changes in platelet count. The reference intervals for PT (seconds), APTT (seconds), fibrinogen (mg/dL), in the first trimester were 10.30-12.88, 25.40-35.46, 280.28-559.00, in the second trimester were 9.80-11.66, 24.05-33.23, 347.75-593.35, in the third trimester were 9.60-11.40, 23.40-31.80, 330.28-628.56, respectively. The reference intervals for main hematology parameters which are WBC (× 10<sup>9</sup>/L), RBC (× 10<sup>12</sup>/L), HGB (g/dL), HCT (%), PLT (× 10<sup>9</sup>/L) in the first trimester were 6.33-15.24, 3.73-5.32, 10.33-13.95, 32.22-42.29, 169.66-413.88, in the second trimester were 6.99-15.55, 3.33-4.98, 9.71-13.17, 30.26-40.07, 172.34-372.19, in the third trimester were 6.22-14.14, 3.54-4.98, 9.80-13.97, 31.11-42.70, 151.30-417.14, respectively.<h4>Conclusions</h4>Most established referenced intervals from each trimester differ from other trimesters. These trimester-specific reference ranges for Vietnamese pregnant women will aid clinicians in entepreting parameters and help other laboratories adopt these ranges after validating.<h4>Trial registration</h4>This study is registered at www.<h4>Clinicaltrials</h4>gov as NCT05929326.

ECI2
Also flagged:tumorall-trans retinoic acidgastric-cancerneoplastic diseaseAll-Trans Retinoic-acidvitamin-A
Journal Article 2023-11-11 ✓ 1 Snippet Guarrera L, Kurosaki M, Garattini SK, Gianni' M, Fasola G, Rossit L, Prisciandaro M, Di Bartolomeo M, Bolis M, Rizzo P, Nastasi C, Foglia M, Zanetti A, Paroni G, Terao M, Garattini E.
In-Text Gene Mentions

The largest interactome (37 elements) contains proteins involved in lipid-metabolism (HADHB/HADH/ECH1/ECI2/ALDH1A3/ADH1C/DHRS3/CYP26B1/CYP2B6/UGT1A8/SRD5A3/GALC/BGALT5), with particular reference to the retinol metabolic pathway (ALDH1A3/ADH1C/DHRS3/CYP26B1/CYP2B6/UGT1A8).

Show Full Abstract

<h4>Background</h4>Gastric-cancer is a heterogeneous type of neoplastic disease and it lacks appropriate therapeutic options. There is an urgent need for the development of innovative pharmacological strategies, particularly in consideration of the potential stratified/personalized treatment of this tumor. All-Trans Retinoic-acid (ATRA) is one of the active metabolites of vitamin-A. This natural compound is the first example of clinically approved cyto-differentiating agent, being used in the treatment of acute promyelocytic leukemia. ATRA may have significant therapeutic potential also in the context of solid tumors, including gastric-cancer. The present study provides pre-clinical evidence supporting the use of ATRA in the treatment of gastric-cancer using high-throughput approaches.<h4>Methods</h4>We evaluated the anti-proliferative action of ATRA in 27 gastric-cancer cell-lines and tissue-slice cultures from 13 gastric-cancer patients. We performed RNA-sequencing studies in 13 cell-lines exposed to ATRA. We used these and the gastric-cancer RNA-sequencing data of the TCGA/CCLE datasets to conduct multiple computational analyses.<h4>Results</h4>Profiling of our large panel of gastric-cancer cell-lines for their quantitative response to the anti-proliferative effects of ATRA indicate that approximately half of the cell-lines are characterized by sensitivity to the retinoid. The constitutive transcriptomic profiles of these cell-lines permitted the construction of a model consisting of 42 genes, whose expression correlates with ATRA-sensitivity.  The model predicts that 45% of the TCGA gastric-cancers are sensitive to ATRA. RNA-sequencing studies performed in retinoid-treated gastric-cancer cell-lines provide insights into the gene-networks underlying ATRA anti-tumor activity. In addition, our data demonstrate that ATRA exerts significant immune-modulatory effects, which seem to be largely controlled by IRF1 up-regulation. Finally, we provide evidence of a feed-back loop between IRF1 and DHRS3, another gene which is up-regulated by ATRA.<h4>Conclusions</h4>ATRA is endowed with significant therapeutic potential in the stratified/personalized treatment gastric-cancer. Our data represent the fundaments for the design of clinical trials focusing on the use of ATRA in the personalized treatment of this heterogeneous tumor. Our gene-expression model will permit the development of a predictive tool for the selection of ATRA-sensitive gastric-cancer patients. The immune-regulatory responses activated by ATRA suggest that the retinoid and immune-checkpoint inhibitors constitute rational combinations for the management of gastric-cancer.

HTT
Also flagged:ammoniacarbonnitrogenmetabolismsulphuriron
Journal Article 2023-11-11 ✓ 1 Snippet Sheridan PO, Meng Y, Williams TA, Gubry-Rangin C.
In-Text Gene Mentions

HTTalso possess acid…

Show Full Abstract

Knowledge of deeply-rooted non-ammonia oxidising Thaumarchaeota lineages from terrestrial environments is scarce, despite their abundance in acidic soils. Here, 15 new deeply-rooted thaumarchaeotal genomes were assembled from acidic topsoils (0-15 cm) and subsoils (30-60 cm), corresponding to two genera of terrestrially prevalent Gagatemarchaeaceae (previously known as thaumarchaeotal Group I.1c) and to a novel genus of heterotrophic terrestrial Thaumarchaeota. Unlike previous predictions, metabolic annotations suggest Gagatemarchaeaceae perform aerobic respiration and use various organic carbon sources. Evolutionary divergence between topsoil and subsoil lineages happened early in Gagatemarchaeaceae history, with significant metabolic and genomic trait differences. Reconstruction of the evolutionary mechanisms showed that the genome expansion in topsoil Gagatemarchaeaceae resulted from extensive early lateral gene acquisition, followed by progressive gene duplication throughout evolutionary history. Ancestral trait reconstruction using the expanded genomic diversity also did not support the previous hypothesis of a thermophilic last common ancestor of the ammonia-oxidising archaea. Ultimately, this study provides a good model for studying mechanisms driving niche partitioning between spatially related ecosystems.

OLFM4
Also flagged:-CoV-2 infectionSpike proteinmembranestranslationallipidS-acyltransferases
Journal Article 2023-11-11 ✓ 3 Snippets S Mesquita F, Abrami L, Bracq L, Panyain N, Mercier V, Kunz B, Chuat A, Carlevaro-Fita J, Trono D, van der Goot FG.
In-Text Gene Mentions

OLFM4(Cell Signalling: 39141;…

…primary antibody: rabbit anti-Olfm4overnight at 4…

…After 30 min blocking with 1% BSA, tissues were incubated with the primary antibody: rabbit anti-Olfm4overnight at 4 °C.…

Show Full Abstract

SARS-CoV-2 infection requires Spike protein-mediated fusion between the viral and cellular membranes. The fusogenic activity of Spike depends on its post-translational lipid modification by host S-acyltransferases, predominantly ZDHHC20. Previous observations indicate that SARS-CoV-2 infection augments the S-acylation of Spike when compared to mere Spike transfection. Here, we find that SARS-CoV-2 infection triggers a change in the transcriptional start site of the zdhhc20 gene, both in cells and in an in vivo infection model, resulting in a 67-amino-acid-long N-terminally extended protein with approx. 40 times higher Spike acylating activity, resulting in enhanced fusion of viruses with host cells. Furthermore, we observed the same induced transcriptional change in response to other challenges, such as chemically induced colitis and pore-forming toxins, indicating that SARS-CoV-2 hijacks an existing cell damage response pathway to optimize it fusion glycoprotein.

Also flagged:organizationof theinnervationbehavioral disordersdystoniaschizophrenia
Journal Article 2023-11-11 No Snippets Roman KM, Dinasarapu AR, VanSchoiack A, Ross PM, Kroeppler D, Jinnah HA, Hess EJ.
Show Full Abstract

The dorsal striatum is organized into functional territories defined by corticostriatal inputs onto both direct and indirect spiny projection neurons (SPNs), the major cell types within the striatum. In addition to circuit connectivity, striatal domains are likely defined by the spatially determined transcriptomes of SPNs themselves. To identify cell-type-specific spatiomolecular signatures of direct and indirect SPNs within dorsomedial, dorsolateral, and ventrolateral dorsal striatum, we used RNA profiling in situ hybridization with probes to >98% of protein coding genes. We demonstrate that the molecular identity of SPNs is mediated by hundreds of differentially expressed genes across territories of the striatum, revealing extraordinary heterogeneity in the expression of genes that mediate synaptic function in both direct and indirect SPNs. This deep insight into the complex spatiomolecular organization of the striatum provides a foundation for understanding both normal striatal function and for dissecting region-specific dysfunction in disorders of the striatum.

CCDC92
Also flagged:diabetic kidney diseaselipidkidney diseasemetabolismcoronary heart diseasetype 2 diabetes
Journal Article 2023-11-11 ✓ 5 Snippets Zuo F, Wang Y, Xu X, Ding R, Tang W, Sun Y, Wang X, Zhang Y, Wu J, Xie Y, Liu M, Wang Z, Yi F.
In-Text Gene Mentions

Mechanically, CCDC92 promoted podocyte lipotoxicity, at least in part through ABCA1 signaling-mediated lipid homeostasis.<h4>Conclusion</h4>Our studies demonstrates that CCDC92 acts as a novel regulator of lipid homeostasis to promote podocyte injury in DKD, suggesting that CCDC92 might be a potential biomarker of podocyte injury in DKD, and targeting CCDC92 may be an effective innovative therapeutic strategy for patients with DKD.

CCDC92, a novel member of coiled-coil domain-containing protein family, was indicated relevant to lipid metabolism, coronary heart disease and type 2 diabetes.

Two types of diabetic mice model (db/db and HFD/STZ) in podocyte-specific Ccdc92 knockout background were generated to clarify the role of CCDC92 in podocyte lipotoxicity.<h4>Results</h4>The level of CCDC92 was increased in renal biopsies sections from patients with DKD, which was correlated with eGFR and lipid accumulation in glomeruli.

This study was designed to elucidate the contribution of CCDC92 in the pathogenesis of DKD.<h4>Methods</h4>Sections with a pathological diagnosis of different classes of DKD, including subjects with mild DKD (class II, n = 6), subjects with moderate DKD (class III, n = 6) or subjects with severe DKD (class IV, n = 6), and control samples (n = 12) were detected for the expression level of CCDC92 and lipid accumulation.

CCDC92 deficiency ameliorates podocyte lipotoxicity in diabetic kidney disease.

Show Full Abstract

<h4>Background and aims</h4>Podocyte injury is considered as the most important early event contributing to diabetic kidney disease (DKD). Recent findings provide new insights into the roles of lipids and lipid-modulating proteins as key determinants of podocyte function in health and kidney disease. CCDC92, a novel member of coiled-coil domain-containing protein family, was indicated relevant to lipid metabolism, coronary heart disease and type 2 diabetes. However, the expression pattern and role of CCDC92 in the kidney is not clear. This study was designed to elucidate the contribution of CCDC92 in the pathogenesis of DKD.<h4>Methods</h4>Sections with a pathological diagnosis of different classes of DKD, including subjects with mild DKD (class II, n = 6), subjects with moderate DKD (class III, n = 6) or subjects with severe DKD (class IV, n = 6), and control samples (n = 12) were detected for the expression level of CCDC92 and lipid accumulation. Two types of diabetic mice model (db/db and HFD/STZ) in podocyte-specific Ccdc92 knockout background were generated to clarify the role of CCDC92 in podocyte lipotoxicity.<h4>Results</h4>The level of CCDC92 was increased in renal biopsies sections from patients with DKD, which was correlated with eGFR and lipid accumulation in glomeruli. In animal studies, CCDC92 were also induced in the kidney from two independent diabetic models, especially in podocytes. Podocyte-specific deletion of Ccdc92 ameliorated podocyte injury and ectopic lipid deposition under diabetic condition. Mechanically, CCDC92 promoted podocyte lipotoxicity, at least in part through ABCA1 signaling-mediated lipid homeostasis.<h4>Conclusion</h4>Our studies demonstrates that CCDC92 acts as a novel regulator of lipid homeostasis to promote podocyte injury in DKD, suggesting that CCDC92 might be a potential biomarker of podocyte injury in DKD, and targeting CCDC92 may be an effective innovative therapeutic strategy for patients with DKD.

TNFSF4
Also flagged:Chemokine CCL19CCR7chemokineCCL21CCL19allergic asthma
Journal Article 2023-11-11 ✓ 1 Snippet Nakano K, Whitehead GS, Lyons-Cohen MR, Grimm SA, Wilkinson CL, Izumi G, Livraghi-Butrico A, Cook DN, Nakano H.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

<h4>Background</h4>Allergic asthma is driven largely by allergen-specific T<sub>H</sub>2 cells, which develop in regional lymph nodes on the interaction of naive CD4<sup>+</sup> T cells with allergen-bearing dendritic cells that migrate from the lung. This migration event is dependent on CCR7 and its chemokine ligand, CCL21. However, is has been unclear whether the other CCR7 ligand, CCL19, has a role in allergic airway disease.<h4>Objective</h4>This study sought to define the role of CCL19 in T<sub>H</sub>2 differentiation and allergic airway disease.<h4>Methods</h4>Ccl19-deficient mice were studied in an animal model of allergic asthma. Dendritic cells or fibroblastic reticular cells from wild-type and Ccl19-deficient mice were cultured with naive CD4<sup>+</sup> T cells, and cytokine production was measured by ELISA. Recombinant CCL19 was added to CD4<sup>+</sup> T-cell cultures, and gene expression was assessed by RNA-sequencing and quantitative PCR. Transcription factor activation was assessed by flow cytometry.<h4>Results</h4>Lungs of Ccl19-deficient mice had less allergic airway inflammation, reduced airway hyperresponsiveness, and less IL-4 and IL-13 production compared with lungs of Ccl19-sufficient animals. Naive CD4<sup>+</sup> T cells cocultured with Ccl19-deficient dendritic cells or fibroblastic reticular cells produced lower amounts of type 2 cytokines than did T cells cocultured with their wild-type counterparts. Recombinant CCL19 increased phosphorylation of STAT5 and induced expression of genes associated with T<sub>H</sub>2 cell and IL-2 signaling pathways.<h4>Conclusions</h4>These results reveal a novel, T<sub>H</sub>2 cell-inducing function of CCL19 in allergic airway disease and suggest that strategies to block this pathway might help to reduce the incidence or severity of allergic asthma.

Also flagged:Mitochondriamembraneorganellesmetabolismmitochondrialnuclear genomes
Journal Article 2023-11-11 No Snippets Nusir A, Sinclair P, Kabbani N.
Show Full Abstract

Mitochondria are ancient endosymbiotic double membrane organelles that support a wide range of eukaryotic cell functions through energy, metabolism, and cellular control. There are over 1000 known proteins that either reside within the mitochondria or are transiently associated with it. These mitochondrial proteins represent a functional subcellular protein network (mtProteome) that is encoded by mitochondrial and nuclear genomes and significantly varies between cell types and conditions. In neurons, the high metabolic demand and differential energy requirements at the synapses are met by specific modifications to the mtProteome, resulting in alterations in the expression and functional properties of the proteins involved in energy production and quality control, including fission and fusion. The composition of mtProteomes also impacts the localization of mitochondria in axons and dendrites with a growing number of neurodegenerative diseases associated with changes in mitochondrial proteins. This review summarizes the findings on the composition and properties of mtProteomes important for mitochondrial energy production, calcium and lipid signaling, and quality control in neural cells. We highlight strategies in mass spectrometry (MS) proteomic analysis of mtProteomes from cultured cells and tissue. The research into mtProteome composition and function provides opportunities in biomarker discovery and drug development for the treatment of metabolic and neurodegenerative disease.

OLFM4
Also flagged:endometriosisGene Expressioncell cycleimmune responsePIP5K1BCCNA1
Journal Article 2023-11-11 ✓ 5 Snippets Ding H, Xu H, Zhang T, Shi C.
In-Text Gene Mentions

Using machine learning algorithms, this study identified eight M2 macrophage-related genes (PGR, OLFM4, PIP5K1B, CCNA1, BRIP1, CADM1, PRAME, and GCNT1) that may be potential biomarkers of endometriosis.

Except for the OLFM4 and CADM1, the other 6 genes were all significant differences between the non-endometriosis and endometriosis groups (p < 0.05).

Following machine learning algorithms, eight key genes were selected in the endometriosis: PGR, OLFM4, PIP5K1B, CCNA1, BRIP1, CADM1, PRAME, and GCNT1. The eight key genes were confirmed to be negative with M2 macrophage infiltration levels.

These conclusions are consistent with the present study, as this study found that OLFM4 expression in endometriosis is menstrual cycle-dependent, with decreased expression in the midsecretory phase and relatively high expression in the proliferative phase (Fig. 6B).

OLFM4, olfactomedin-4, an extracellular matrix protein, is one of the top downregulated genes in patients with endometriosis compared with non-endometriosis controls [38].

Show Full Abstract

<h4>Aims</h4>M2 macrophage is believed to play an important role in the development of endometriosis. This study aimed to identify several key genes related to the M2 macrophage in endometriosis.<h4>Method</h4>Differential expressed genes between endometriosis and non-endometriosis were identified based on three microarray datasets from the Gene Expression Omnibus database. Gene modules significantly associated with M2 macrophage were identified from the weighted gene co-expression network analysis. Furthermore, by intersecting the differential expressed genes and M2 macrophage-associated module genes, M2 macrophage-related genes in endometriosis were identified. Functional analyses of the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes for these genes were then performed. Following, the least absolute shrinkage and selection operator, random forest, and receiver operating characteristic curves were further conducted to identify the key M2 macrophage-related genes in endometriosis. Finally, the expressions of key genes in endometriosis, as well as their correlations with M2 macrophages were verified in an independent validation cohort.<h4>Results</h4>Totally, 185 M2 macrophage-related genes were identified, and they were mainly enriched in functions associated with the cell cycle, oocyte maturation, and immune response. Following machine learning algorithms, eight key genes were selected in the endometriosis: <i>PGR</i>, <i>OLFM4</i>, <i>PIP5K1B</i>, <i>CCNA1</i>, <i>BRIP1</i>, <i>CADM1</i>, <i>PRAME</i>, and <i>GCNT1</i>. The eight key genes were confirmed to be negative with M2 macrophage infiltration levels. Furthermore, the expression levels of these genes were significantly lower in the middle secretory stage while relevantly higher in the proliferative stage. The validation analysis also showed similar outcomes with the above results.<h4>Conclusion</h4>Eight M2 macrophage-related genes were identified as potential biomarkers of endometriosis, providing novel understanding of immune cells in the endometriosis.

PRDX6
Also flagged:ferroptosisdeathdiabetesdiabetic complicationspathogenesiscell death
Journal Article 2023-11-11 ✓ 1 Snippet Liu C, Wang W, Gu J.
In-Text Gene Mentions

The specificity protein 1 (Sp1)-mediated upregulation of peroxiredoxin 6 (Prdx6) expression in vitro has been found to prevent podocyte injury in diabetic nephropathy by reducing oxidative stress and ferroptosis [35].

Show Full Abstract

Ferroptosis is a non-apoptotic mode of cell death. A large number of studies have confirmed that ferroptosis plays a vital role in the occurrence and development of diabetes and diabetic complications. Previous studies have found that Chinese herbal medicines have very promising results in the prevention and treatment of diabetes and diabetic complications, and some of these herbs or herbal natural compounds may act via the inhibition of ferroptosis. In this review, we summarized the relationship between ferroptosis and diabetes and diabetic complications, and discussed its molecular mechanisms. We also reviewed the published studies of herbal medicines or herbal natural compounds that improved diabetes or diabetic complications via the ferroptosis pathway. In addition, we are trying to provide new insights for better treatment of diabetes and diabetic complications with Chinese herbal medicine and its herbal compounds.

OLFM4
Also flagged:cholesterolNiemann-Pick C1 Like 1NPC1L1membranebrush borderhypercholesterolemia
Journal Article 2023-11-10 ✓ 1 Snippet Ferrari A, Whang E, Xiao X, Kennelly JP, Romartinez-Alonso B, Mack JJ, Weston T, Chen K, Kim Y, Tol MJ, Bideyan L, Nguyen A, Gao Y, Cui L, Bedard AH, Sandhu J, Lee SD, Fairall L, Williams KJ, Song W, Munguia P, Russell RA, Martin MG, Jung ME, Jiang H, Schwabe JWR, Young SG, Tontonoz P.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Intestinal absorption is an important contributor to systemic cholesterol homeostasis. Niemann-Pick C1 Like 1 (NPC1L1) assists in the initial step of dietary cholesterol uptake, but how cholesterol moves downstream of NPC1L1 is unknown. We show that Aster-B and Aster-C are critical for nonvesicular cholesterol movement in enterocytes. Loss of NPC1L1 diminishes accessible plasma membrane (PM) cholesterol and abolishes Aster recruitment to the intestinal brush border. Enterocytes lacking Asters accumulate PM cholesterol and show endoplasmic reticulum cholesterol depletion. Aster-deficient mice have impaired cholesterol absorption and are protected against diet-induced hypercholesterolemia. Finally, the Aster pathway can be targeted with a small-molecule inhibitor to manipulate cholesterol uptake. These findings identify the Aster pathway as a physiologically important and pharmacologically tractable node in dietary lipid absorption.

CSE1L
Also flagged:Nuclear transport proteinslocalizationbiomacromoleculescytoplasmicnuclear transportmembrane
Journal Article 2023-11-10 ✓ 1 Snippet Yang Y, Guo L, Chen L, Gong B, Jia D, Sun Q.
In-Text Gene Mentions

Exportin 2 (XPO2, cellular apoptosis susceptibility, CAS, or chromosome segregation 1-like, Cse1, Cse1L) is a dedicated nuclear export factor for the classical nuclear import adaptor Impα, which is unable to traverse NPCs alone.127 By wrapping around RanGTP and Impα and folding the IBB in the NLS binding sites of Impα, XPO2 ensures cargo dissociation from Impα before export.128 XPO2 depletion alters the localization of multiple silencing factors and reactivates many repressed genes, due to its indispensable role in classical nuclear import.129 As Impβ1, XPO2 is overexpressed in many cancers.130,131

Show Full Abstract

Proper subcellular localization is crucial for the functioning of biomacromolecules, including proteins and RNAs. Nuclear transport is a fundamental cellular process that regulates the localization of many macromolecules within the nuclear or cytoplasmic compartments. In humans, approximately 60 proteins are involved in nuclear transport, including nucleoporins that form membrane-embedded nuclear pore complexes, karyopherins that transport cargoes through these complexes, and Ran system proteins that ensure directed and rapid transport. Many of these nuclear transport proteins play additional and essential roles in mitosis, biomolecular condensation, and gene transcription. Dysregulation of nuclear transport is linked to major human diseases such as cancer, neurodegenerative diseases, and viral infections. Selinexor (KPT-330), an inhibitor targeting the nuclear export factor XPO1 (also known as CRM1), was approved in 2019 to treat two types of blood cancers, and dozens of clinical trials of are ongoing. This review summarizes approximately three decades of research data in this field but focuses on the structure and function of individual nuclear transport proteins from recent studies, providing a cutting-edge and holistic view on the role of nuclear transport proteins in health and disease. In-depth knowledge of this rapidly evolving field has the potential to bring new insights into fundamental biology, pathogenic mechanisms, and therapeutic approaches.

Also flagged:oxygensepsisnecrotizing soft tissue infectionnecrotizing soft tissue infectionsimmune responseNF-κB
Journal Article 2023-11-10 No Snippets Vinkel J, Rib L, Buil A, Hedetoft M, Hyldegaard O.
Show Full Abstract

<h4>Background</h4>For decades, the basic treatment strategies of necrotizing soft tissue infections (NSTI) have remained unchanged, primarily relying on aggressive surgical removal of infected tissue, broad-spectrum antibiotics, and supportive intensive care. One treatment strategy that has been proposed as an adjunctive measure to improve patient outcomes is hyperbaric oxygen (HBO<sub>2</sub>) treatment. HBO<sub>2</sub> treatment has been linked to several immune modulatory effects; however, investigating these effects is complicated due to the disease's acute life-threatening nature, metabolic and cell homeostasis dependent variability in treatment effects, and heterogeneity with respect to both patient characteristics and involved pathogens. To embrace this complexity, we aimed to explore the underlying biological mechanisms of HBO<sub>2</sub> treatment in patients with NSTI on the gene expression level.<h4>Methods</h4>We conducted an observational cohort study on prospective collected data, including 85 patients admitted to the intensive care unit (ICU) for NSTI. All patients were treated with one or two HBO<sub>2</sub> treatments and had one blood sample taken before and after the intervention. Total RNAs from blood samples were extracted and mRNA purified with rRNA depletion, followed by whole-transcriptome RNA sequencing with a targeted sequencing depth of 20 million reads. A model for differentially expressed genes (DEGs) was fitted, and the functional aspects of the obtained set of genes was predicted with GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of genes and Genomes) enrichment analyses. All analyses were corrected for multiple testing with FDR.<h4>Results</h4>After sequential steps of quality control, a final of 160 biological replicates were included in the present study. We found 394 protein coding genes that were significantly DEGs between the two conditions with FDR < 0.01, of which 205 were upregulated and 189 were downregulated. The enrichment analysis of these DEGs revealed 20 GO terms in biological processes and 12 KEGG pathways that were significantly overrepresented in the upregulated DEGs, of which the term; "adaptive immune response" (GO:0002250) (FDR = 9.88E-13) and "T cell receptor signaling pathway" (hsa04660) (FDR = 1.20E-07) were the most significant. Among the downregulated DEGs two biological processes were significantly enriched, of which the GO term "apoptotic process" (GO:0006915) was the most significant (FDR = 0.001), followed by "Positive regulation of T helper 1 cell cytokine production" (GO:2000556), and "NF-kappa B signaling pathway" (hsa04064) was the only KEGG pathway that was significantly overrepresented (FDR = 0.001).<h4>Conclusions</h4>When one or two sessions of HBO<sub>2</sub> treatment were administered to patients with a dysregulated immune response and systemic inflammation due to NSTI, the important genes that were regulated during the intervention were involved in activation of T helper cells and downregulation of the disease-induced highly inflammatory pathway NF-κB, which was associated with a decrease in the mRNA level of pro-inflammatory factors.<h4>Trial registration</h4>Biological material was collected during the INFECT study, registered at ClinicalTrials.gov (NCT01790698).

PLCL1
Also flagged:Rheumatoid Arthritiscardiovascular diseaseCVDRApathogenesisatherosclerosis
Journal Article 2023-11-10 ✓ 2 Snippets Guo Y, Chung W, Shan Z, Zhu Z, Costenbader KH, Liang L.
In-Text Gene Mentions

For example, Kasher et al identified shared causal genetic variants for RA, in genes including PLCL1, BOLL, NAT2/PSD,3 and FADS2/FADS1, by conducting colocalization analyses between RA and multiple RA related traits or diseases.43, 44

…in genes includingPLCL1, BOLL ,…

Show Full Abstract

<h4>Background</h4>Patients with rheumatoid arthritis (RA) have a 2- to 10-fold increased risk of cardiovascular disease (CVD), but the biological mechanisms and existence of causality underlying such associations remain to be investigated. We aimed to investigate the genetic associations and underlying mechanisms between RA and CVD by leveraging large-scale genomic data and genetic cross-trait analytic approaches.<h4>Methods and results</h4>Within UK Biobank data, we examined the genetic correlation, shared genetics, and potential causality between RA (N<sub>cases</sub>=6754, N<sub>controls</sub>=452 384) and cardiovascular diseases (CVD, N<sub>cases</sub>=44 238, N<sub>controls</sub>=414 900) using linkage disequilibrium score regression, cross-trait meta-analysis, and Mendelian randomization. We observed significant genetic correlations of RA with myocardial infarction (r<sub>g</sub>:0.40 [95% CI, 0.24-0.56), angina (r<sub>g</sub>:0.42 [95% CI, 0.28-0.56]), coronary heart diseases (r<sub>g</sub>:0.41 [95% CI, 0.27-0.55]), and CVD (r<sub>g</sub>:0.43 [95% CI, 0.29-0.57]) after correcting for multiple testing (<i>P</i><0.05/5). When stratified by frequent use of analgesics, we found increased genetic correlation between RA and CVD among participants without aspirin usage (r<sub>g</sub>:0.54 [95% CI, 0.30-0.78] for angina; <i>P</i><sub>value</sub>=6.69×10<sup>-6</sup>) and among participants with paracetamol usage (r<sub>g</sub>:0.75 [95% CI, 0.20-1.29] for myocardial infarction; <i>P</i><sub>value</sub>=8.90×10<sup>-3</sup>), whereas others remained similar. Cross-trait meta-analysis identified 9 independent shared loci between RA and CVD, including <i>PTPN22</i> at <i>chr1p13.2</i>, <i>BCL2L11</i> at <i>chr2q13</i>, and <i>CCR3</i> at <i>chr3p21.31</i> (<i>P</i><sub>single trait</sub><1×10<sup>-3</sup> and <i>P</i><sub>meta</sub><5×10<sup>-8</sup>), highlighting potential shared pathogenesis including accelerating atherosclerosis, upregulating oxidative stress, and vascular permeability. Finally, Mendelian randomization estimates showed limited evidence of causality between RA and CVD.<h4>Conclusions</h4>Our results supported shared genetic pathogenesis rather than causality in explaining the observed association between RA and CVD. The identified shared genetic factors provided insights into potential novel therapeutic target for RA-CVD comorbidities.

HTT
Also flagged:serotonincitalopramserotonin transporter5-HT1ARanxietyserotonin 1A receptor
Journal Article 2023-11-10 ✓ 5 Snippets Boucherie DE, Reneman L, Booij J, Martins D, Dipasquale O, Schrantee A.
In-Text Gene Mentions

Moreover, our study highlights the potential contribution of 5-HT1AR, in addition to 5-HTT, to dose-dependent changes in the functional response after acute citalopram administration.

For instance, one study found that 5-HTT availability following citalopram administration was associated with FC between the DMN and cortical regions (Schrantee et al., 2018), highlighting a prominent role of 5-HTT in modulating the effects of SSRIs on DMN connectivity.

Finally, as this study investigated only the effects of acute doses of citalopram, future studies should measure the functional response to citalopram at different time points to unravel its long-term effects on the 5-HTT and 5-HT1AR functional circuits.

While not investigating the 5-HTT itself, Lawn et al., (2022) showed that LSD significantly affected FC within serotonin 1A, 1B, 2A, and dopamine D1 and D2 receptor-related networks.

…the serotonin transporter (5-HTT), but the functional…

Show Full Abstract

<h4>Background</h4>Selective serotonin reuptake inhibitors (SSRIs) potentiate serotonergic neurotransmission by blocking the serotonin transporter (5-HTT), but the functional brain response to SSRIs involves neural circuits beyond regions with high 5-HTT expression. Currently, it is unclear whether and how changes in 5-HTT availability after SSRI administration modulate brain function of key serotoninergic circuits, including those characterized by high availability of the serotonin 1A receptor (5-HT1AR).<h4>Aim</h4>We investigated the association between 5-HTT availability and 5-HTT- and 5-HT1AR-enriched functional connectivity (FC) after an acute citalopram challenge.<h4>Methods</h4>We analyzed multimodal data from a dose-response, placebo-controlled, double-blind study, in which 45 healthy women were randomized into three groups receiving placebo, a low (4 mg), or high (16 mg) oral dose of citalopram. Receptor-Enhanced Analysis of functional Connectivity by Targets was used to estimate 5-HTT- and 5-HT1AR-enriched FC from resting-state and task-based fMRI. 5-HTT availability was determined using [<sup>123</sup>I]FP-CIT single-photon emission computerized tomography.<h4>Results</h4>5-HTT availability was negatively correlated with resting-state 5-HTT-enriched FC, and with task-dependent 5-HT1AR-enriched FC. Our exploratory analyses revealed lower 5-HT1AR-enriched FC in the low-dose group compared to the high-dose group at rest and the placebo group during the emotional face-matching task.<h4>Conclusions</h4>Taken together, our findings provide evidence for differential links between 5-HTT availability and brain function within 5-HTT and 5-HT1AR pathways and in context- and dose-dependent manner. As such, they support a potential pivotal role of the 5-HT1AR in the effects of citalopram on the brain and add to its potential as a therapeutic avenue for mood and anxiety disturbances.

SOX6
Also flagged:gastrulationgene expressionchromatinFgfembryogenesisinnervation
Journal Article 2023-11-10 ✓ 1 Snippet Kim YI, O'Rourke R, Sagerström CG.
In-Text Gene Mentions

…so do theSox6and Esrrg TFs…

Show Full Abstract

Rhombomeres serve to position neural progenitors in the embryonic hindbrain, thereby ensuring appropriate neural circuit formation, but the molecular identities of individual rhombomeres and the mechanism whereby they form has not been fully established. Here, we apply scMultiome analysis in zebrafish to molecularly resolve all rhombomeres for the first time. We find that rhombomeres become molecularly distinct between 10hpf (end of gastrulation) and 13hpf (early segmentation). While the embryonic hindbrain transiently contains alternating odd- versus even-type rhombomeres, our scMultiome analyses do not detect extensive odd versus even molecular characteristics in the early hindbrain. Instead, we find that each rhombomere displays a unique gene expression and chromatin profile. Prior to the appearance of distinct rhombomeres, we detect three hindbrain progenitor clusters (PHPDs) that correlate with the earliest visually observed segments in the hindbrain primordium that represent prospective rhombomere r2/r3 (possibly including r1), r4, and r5/r6, respectively. We further find that the PHPDs form in response to Fgf and RA morphogens and that individual PHPD cells co-express markers of multiple mature rhombomeres. We propose that the PHPDs contain mixed-identity progenitors and that their subdivision into individual rhombomeres requires the resolution of mixed transcription and chromatin states.

Also flagged:sulfurlithiumpolysulfidepolysulfideselectronsanions
Journal Article 2023-11-10 No Snippets Li J, Gao L, Pan F, Gong C, Sun L, Gao H, Zhang J, Zhao Y, Wang G, Liu H.
Show Full Abstract

Lithium-sulfur (Li-S) batteries are supposed to be one of the most potential next-generation batteries owing to their high theoretical capacity and low cost. Nevertheless, the shuttle effect of firm multi-step two-electron reaction between sulfur and lithium in liquid electrolyte makes the capacity much smaller than the theoretical value. Many methods were proposed for inhibiting the shuttle effect of polysulfide, improving corresponding redox kinetics and enhancing the integral performance of Li-S batteries. Here, we will comprehensively and systematically summarize the strategies for inhibiting the shuttle effect from all components of Li-S batteries. First, the electrochemical principles/mechanism and origin of the shuttle effect are described in detail. Moreover, the efficient strategies, including boosting the sulfur conversion rate of sulfur, confining sulfur or lithium polysulfides (LPS) within cathode host, confining LPS in the shield layer, and preventing LPS from contacting the anode, will be discussed to suppress the shuttle effect. Then, recent advances in inhibition of shuttle effect in cathode, electrolyte, separator, and anode with the aforementioned strategies have been summarized to direct the further design of efficient materials for Li-S batteries. Finally, we present prospects for inhibition of the LPS shuttle and potential development directions in Li-S batteries.

Also flagged:castration-resistant prostate cancerchloridesalttumorbone diseasesradium
Journal Article 2023-11-10 No Snippets Franchi S, Asti M, Di Marco V, Tosato M.
Show Full Abstract

<h4>Background</h4>The alpha-emitter radium-223 (<sup>223</sup>Ra) is presently used in nuclear medicine for the palliative treatment of bone metastases from castration-resistant prostate cancer. This application arises from its advantageous decay properties and its intrinsic ability to accumulate in regions of high bone turnover when injected as a simple chloride salt. The commercial availability of [<sup>223</sup>Ra]RaCl<sub>2</sub> as a registered drug (Xofigo<sup>®</sup>) is a further additional asset.<h4>Main body</h4>The prospect of extending the utility of <sup>223</sup>Ra to targeted α-therapy of non-osseous cancers has garnered significant interest. Different methods, such as the use of bifunctional chelators and nanoparticles, have been explored to incorporate <sup>223</sup>Ra in proper carriers designed to precisely target tumor sites. Nevertheless, the search for a suitable scaffold remains an ongoing challenge, impeding the diffusion of <sup>223</sup>Ra-based radiopharmaceuticals.<h4>Conclusion</h4>This review offers a comprehensive overview of the current role of radium radioisotopes in nuclear medicine, with a specific focus on <sup>223</sup>Ra. It also critically examines the endeavors conducted so far to develop constructs capable of incorporating <sup>223</sup>Ra into cancer-targeting drugs. Particular emphasis is given to the chemical aspects aimed at providing molecular scaffolds for the bifunctional chelator approach.

Also flagged:tumorisopropyl esteresteramidehexanoateglutamine
Journal Article 2023-11-10 No Snippets Novotná K, Tenora L, Prchalová E, Paule J, Alt J, Veeravalli V, Lam J, Wu Y, Šnajdr I, Gori S, Mettu VS, Tsukamoto T, Majer P, Slusher BS, Rais R.
Show Full Abstract

The glutamine antagonist 6-diazo-5-oxo-l-norleucine (DON) exhibits remarkable anticancer efficacy; however, its therapeutic potential is hindered by its toxicity to gastrointestinal (GI) tissues. We recently reported the discovery of DRP-104, a tumor-targeted DON prodrug with excellent efficacy and tolerability, which is currently in clinical trials. However, DRP-104 exhibits limited aqueous solubility, and the instability of its isopropyl ester promoiety leads to the formation of an inactive M1-metabolite, reducing overall systemic prodrug exposure. Herein, we aimed to synthesize DON prodrugs with various ester and amide promoieties with improved solubility, GI stability, and DON tumor delivery. Twenty-one prodrugs were synthesized and characterized in stability and pharmacokinetics studies. Of these, <b>P11</b>, <i>tert</i>-butyl-(<i>S</i>)-6-diazo-2-((<i>S</i>)-2-(2-(dimethylamino)acetamido)-3-phenylpropanamido)-5-oxo-hexanoate, showed excellent metabolic stability in plasma and intestinal homogenate, high aqueous solubility, and high tumor DON exposures and preserved the ideal tumor-targeting profile of DRP-104. In conclusion, we report a new generation of glutamine antagonist prodrugs with improved physicochemical and pharmacokinetic attributes.

HTT
Also flagged:depressionCognitionmental illnesspsychological problemsbehaviouralanxiety
Journal Article 2023-11-10 ✓ 1 Snippet Tu HF, Fransson E, Kunovac Kallak T, Elofsson U, Ramklint M, Skalkidou A.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT), catechol-O-methyl-transfera…

Show Full Abstract

<h4>Purpose</h4>The current U-BIRTH cohort (Uppsala Birth Cohort) extends our previous cohort Biology, Affect, Stress, Imaging and Cognition (BASIC), assessing the development of children up to 11 years after birth. The U-BIRTH study aims to (1) assess the impact of exposure to peripartum mental illness on the children's development taking into account biological and environmental factors during intrauterine life and childhood; (2) identify early predictors of child neurodevelopmental and psychological problems using biophysiological, psychosocial and environmental variables available during pregnancy and early post partum.<h4>Participants</h4>All mothers participating in the previous BASIC cohort are invited, and mother-child dyads recruited in the U-BIRTH study are consecutively invited to questionnaire assessments and biological sampling when the child is 18 months, 6 years and 11 years old. Data collection at 18 months (n=2882) has been completed. Consent for participation has been obtained from 1946 families of children having reached age 6 and from 698 families of children having reached age 11 years.<h4>Findings to date</h4>Based on the complete data from pregnancy to 18 months post partum, peripartum mental health was significantly associated with the development of attentional control and gaze-following behaviours, which are critical to cognitive and social learning later in life. Moreover, infants of depressed mothers had an elevated risk of difficult temperament and behavioural problems compared with infants of non-depressed mothers. Analyses of biological samples showed that peripartum depression and anxiety were related to DNA methylation differences in infants. However, there were no methylation differences in relation to infants' behavioural problems at 18 months of age.<h4>Future plans</h4>Given that the data collection at 18 months is complete, analyses are now being undertaken. Currently, assessments for children reaching 6 and 11 years are ongoing.

SOX6
Also flagged:DATtyrosine hydroxylaseTHdopamine transportercell bodiesaldehyde dehydrogenase 1A1
Journal Article 2023-11-10 ✓ 4 Snippets Burkert N, Roy S, Häusler M, Wuttke D, Müller S, Wiemer J, Hollmann H, Oldrati M, Ramirez-Franco J, Benkert J, Fauler M, Duda J, Goaillard JM, Pötschke C, Münchmeyer M, Parlato R, Liss B.
In-Text Gene Mentions

…the transcription factorSOX687 , 92…

…also Vglut2-positive, whileSOX6expression is at…

…sters preferentially expressedSOX6mRNA while other…

Sox6-negative SN DA neurons…

Show Full Abstract

Here we present a deep learning-based image analysis platform (DLAP), tailored to autonomously quantify cell numbers, and fluorescence signals within cellular compartments, derived from RNAscope or immunohistochemistry. We utilised DLAP to analyse subtypes of tyrosine hydroxylase (TH)-positive dopaminergic midbrain neurons in mouse and human brain-sections. These neurons modulate complex behaviour, and are differentially affected in Parkinson's and other diseases. DLAP allows the analysis of large cell numbers, and facilitates the identification of small cellular subpopulations. Using DLAP, we identified a small subpopulation of TH-positive neurons (~5%), mainly located in the very lateral Substantia nigra (SN), that was immunofluorescence-negative for the plasmalemmal dopamine transporter (DAT), with ~40% smaller cell bodies. These neurons were negative for aldehyde dehydrogenase 1A1, with a lower co-expression rate for dopamine-D2-autoreceptors, but a ~7-fold higher likelihood of calbindin-d28k co-expression (~70%). These results have important implications, as DAT is crucial for dopamine signalling, and is commonly used as a marker for dopaminergic SN neurons.

TNFSF4
Also flagged:tumorcancercolorectal cancergene expressionDNASE1L3HSPA1A
Journal Article 2023-11-10 ✓ 2 Snippets Li H, Pan L, Guo J, Lao J, Wei M, Huang F.
In-Text Gene Mentions

…A), whereas TNFRSF25,TNFSF4, and ICOSLG…

…increase in TNFRSF25,TNFSF4, and ICOSLG…

Show Full Abstract

Several studies have shown significant involvement of tumor-associated macrophages (TAMs) in the tumor microenvironment and cancer progression. However, no data on reliable TAM-related biomarkers are available for predicting the prognosis of patients with colorectal cancer (CRC). We analyzed the clinical data and gene expression profiles of patients with CRC from databases. The single-cell transcriptomic data was applied to identify M2-like TAM-related differentially expressed genes. Univariate Cox and least absolute shrinkage and selection operator regression analyses were used to determine the prognostic signature genes. Then, seven key genes were screened to develop the prognostic signature. In the training and external validation cohorts, the overall survival (OS) of patients in the high-risk group was significantly shorter compared to the low-risk group. Consequently, we created a nomogram that could accurately and reliably predict the prognosis of patient with CRC. A significant correlation was observed between the patient's prognosis, clinical features, sensitivity to anticancer drugs, TME, and risk scores. Moreover, risk score was strongly related to the response to immunotherapy in patients from GSE91061, GSE78220, and GSE60331 cohorts. Finally, high expression of HSPA1A, SERPINA1, CXCL1, and low expression of DNASE1L3 were found in human CRC tissue and normal tissue by using qRT-PCR. In conclusion, the M2-like TAM-related prognostic signature could predict the survival, prognosis, and response of patients with CRC to immunotherapy, which sheds light on the role of TAMs in CRCs and enhances our understanding of TAMs.

SERPINC1
Also flagged:Cygbimmune responseVibrio harveyi diseaseyellow drumCytoglobinheme
Journal Article 2023-11-10 ✓ 1 Snippet Zhou S, Tian O, Li W, Li J, Li W, Han F.
In-Text Gene Mentions

…ANPEP, CLDN5, ORM1/2,SERPINC1and HPN and…

Show Full Abstract

Cytoglobin (Cygb) is a 21-kDa heme-protein that belongs to the globin superfamily and is expressed in vertebrate tissues. It can participate in the oxidative stress response in organisms through the porphyrin ring. Previous studies have shown that this protein, also known as YdCygb, has potential immune abilities in the infection of Vibrio harveyi in yellow drum (Nibea albiflora). In this study, we report the role of Cygb in the immune response of teleost fish for the first time. Quantitative RT-PCR analysis indicated that YdCygb was highly expressed in the liver and intestine of yellow drum, and its expression can be upregulated by pathogenic attack. The cellular distribution of YdCygb-EGFP proteins was observed in cell membrane, cytoplasm, and nucleus in the kidney cells of N. albiflora. Furthermore, a comparative transcriptome analysis between the YdCygb overexpression group and control vector group identified 28 differentially expressed genes (DEGs). The analysis showed that ANPEP, CLDN5, ORM1/2, SERPINC1 and HPN and ITGAM might play important regulatory roles to Cygb in fish. Notably, using GST-pull down technology, we identified 3-phosphoglyceraldehyde dehydrogenase and intermediate filament protein as direct interactors with YdCygb, playing a role against V. harveyi. The molecular and functional characterization of YdCygb provides better understanding of the genetic basis of disease resistance traits in yellow drum and sheds new light on the functioning of Cygb and its potential regulatory signaling pathway as well.

HFE
Also flagged:Hepatocellular Carcinomatumoralpha-fetoproteinmetabolic diseasecancerchronic hepatitis viral infection
Journal Article 2023-11-10 ✓ 1 Snippet Naganuma H, Ishida H.
In-Text Gene Mentions

…exposure, tobacco smoking,hemochromatosis, alpha-antitrypsin deficiency…

Show Full Abstract

Hepatocellular carcinoma (HCC) in a non-fibrotic liver (F0) is considered to be rare, and there is a marked paucity of studies in the literature on this HCC type. A review of the literature shows some important clinical and tumor characteristics: (a) it occurs mainly in young female and elder male patients; (b) clinically, under normal hepatic function, alpha-fetoprotein level is often normal, and there are no risk factors; (c) associated with metabolic disease; (d) macroscopically, single large lesions are noted; and (e) microscopically, the lesions are well-differentiated and encapsulated. Radiological imaging results are straightforward, showing arterial hyperenhancement and later wash-out. The combined use of B-mode and contrast-enhanced (CE) ultrasound (US) is the most reliable and cost-effective diagnostic method. Few peri-and post-operative complications are noted and 5-year survival is not inferior to patients with HCC on fibrosis liver despite the lesion's large size. Most clinicians believe that HCC is unlikely to occur if patients have no symptoms and normal hepatic function. Although detailed clinical data are very limited, we expect that this review will help to improve the clinical management of HCC in non-fibrotic livers.

Also flagged:cancergangliosidessignal transductionglycosphingolipidsgrowth factor receptorsganglioside
Journal Article 2023-11-10 No Snippets Schengrund CL.
Show Full Abstract

The plethora of information about the expression of cancer cell-associated gangliosides, their role(s) in signal transduction, and their potential usefulness in the development of cancer treatments makes this an appropriate time to review these enigmatic glycosphingolipids. Evidence, reflecting the work of many, indicates that (1) expression of specific gangliosides, not generally found in high concentrations in most normal human cells, can be linked to certain types of cancer. (2) Gangliosides can affect the ability of cells to interact either directly or indirectly with growth factor receptors, thereby changing such things as a cell's mobility, rate of proliferation, and metastatic ability. (3) Anti-ganglioside antibodies have been tested, with some success, as potential treatments for certain cancers. (4) Cancer-associated gangliosides shed into the circulation can (a) affect immune cell responsiveness either positively or negatively, (b) be considered as diagnostic markers, and (c) be used to look for recurrence. (5) Cancer registries enable investigators to evaluate data from sufficient numbers of patients to obtain information about potential therapies. Despite advances that have been made, a discussion of possible approaches to identifying additional treatment strategies to inhibit metastasis, responsible for the majority of deaths of cancer patients, as well as for treating therapy-resistant tumors, is included.

DCC
Also flagged:Pancreatic ductal adenocarcinomaPDACsolid tumorsimmune responsestumorcolon diseases
Journal Article 2023-11-10 ✓ 2 Snippets Vietsch EE, Latifi D, Verheij M, van der Oost EWA, de Wilde RF, Haen R, van den Boom AL, Koerkamp BG, Doornebosch PG, van Verschuer VMT, Ooms AHAG, Mohammad F, Willemsen M, Aerts JGJV, Krog RT, de Miranda NFCC, van den Bosch TPP, Mueller YM, Katsikis PD, van Eijck CHJ.
In-Text Gene Mentions

…and detection withDCC(Ventana, 760-240) for…

…by visualization withDCCfor 8 min…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) remains one of the deadliest solid tumors and is resistant to immunotherapy. B cells play an essential role in PDAC progression and immune responses, both locally and systemically. Moreover, increasing evidence suggests that microbial compositions inside the tumor, as well as in the oral cavity and the gut, are important factors in shaping the PDAC immune landscape. However, the gut-associated lymphoid tissue (GALT) has not previously been explored in PDAC patients. In this study, we analyzed healthy vermiform appendix (VA) from 20 patients with PDAC and 32 patients with colon diseases by gene expression immune profiling, flow cytometry analysis, and microbiome sequencing. We show that the VA GALT of PDAC patients exhibits markers of increased inflammation and cytotoxic cell activity. In contrast, B cell function is decreased in PDAC VA GALT based on gene expression profiling; B cells express significantly fewer MHC class II surface receptors, whereas plasma cells express the immune checkpoint molecule HLA-G. Additionally, the vermiform appendix microbiome of PDAC patients is enriched with <i>Klebsiella pneumoniae</i>, <i>Bifidobacterium animalis</i>, and <i>Adlercreutzia equolifaciens</i>, while certain commensals are depleted. Our findings may suggest impaired B cell function within the GALT of PDAC patients, which could potentially be linked to microbial dysbiosis. Additional investigations are imperative to validate our observations and explore these potential targets of future therapies.

Also flagged:Synthesiscancercarbohydratesalkaloidsflavonoidsphenols
Journal Article 2023-11-10 No Snippets El-Sheekh MM, AlKafaas SS, Rady HA, Abdelmoaty BE, Bedair HM, Ahmed AA, El-Saadony MT, AbuQamar SF, El-Tarabily KA.
Show Full Abstract

The necessity to engineer sustainable nanomaterials for the environment and human health has recently increased. Due to their abundance, fast growth, easy cultivation, biocompatibility and richness of secondary metabolites, algae are valuable biological source for the green synthesis of nanoparticles (NPs). The aim of this review is to demonstrate the feasibility of using algal-based NPs for cancer treatment. Blue-green, brown, red and green micro- and macro-algae are the most commonly participating algae in the green synthesis of NPs. In this process, many algal bioactive compounds, such as proteins, carbohydrates, lipids, alkaloids, flavonoids and phenols, can catalyze the reduction of metal ions to NPs. In addition, many driving factors, including pH, temperature, duration, static conditions and substrate concentration, are involved to facilitate the green synthesis of algal-based NPs. Here, the biosynthesis, mechanisms and applications of algal-synthesized NPs in cancer therapy have been critically discussed. We also reviewed the effective role of algal synthesized NPs as anticancer treatment against human breast, colon and lung cancers and carcinoma.

Also flagged:vitamin Clung cancercancerdeathoxygenascorbic acid
Journal Article 2023-11-10 No Snippets Tran DV, Luu XQ, Tran HTT, Myung SK.
Show Full Abstract

Previous cohort studies reported inconsistent findings regarding the association between dietary or supplementary vitamin C intake and lung cancer risk. These associations were investigated by conducting a meta-analysis of cohort studies. The PubMed and EMBASE databases were utilized, using keywords related to the topic from inception to April 15, 2022. Pooled effect sizes, such as relative risk (RR) or hazard ratio (HR) with 95% confidence intervals (CIs), were calculated using a random-effects model. A total of 20 cohort studies from 13 articles were included in the final analysis. In a meta-analysis of all studies, there was no significant association between dietary or supplementary vitamin C intake and lung cancer risk (RR/HR, 0.90; 95% CI, 0.80-1.01; I<sup>2</sup>=56.4%; n=20). In the subgroup meta-analysis by the source of vitamin C, dietary vitamin C intake decreased the risk of lung cancer (RR/HR, 0.82; 95% CI, 0.73-0.92; I<sup>2</sup>=42.5%; n=14), whereas there was no association between supplementary vitamin C intake and lung cancer risk (RR/HR, 1.01; 95% CI, 0.84-1.22; n=4). The present meta-analysis of cohort studies found that dietary vitamin C intake is beneficial for preventing lung cancer, whereas its supplementary intake does not have a beneficial effect.

Also flagged:pyrrolhydroxypropenamideacidbindingalbumin
Journal Article 2023-11-10 No Snippets Zhang H, Yu S, Ni S, Gubu A, Ma Y, Zhang Y, Li H, Wang Y, Wang L, Zhang Z, Yu Y, Lyu A, Zhang B, Zhang G.
Show Full Abstract

The molecular weight of nucleic acid aptamers (20 kDa) is lower than the cutoff threshold of the renal filtration (30-50 kDa), resulting in a very short half-life, which dramatically limits their druggability. To address this, we utilized 3-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)-N-(4-hydroxy-2-oxo-2H-chromen-6-yl)propenamide (HC) and 12-((2,5-dioxopyrrolidin-1-yl)oxy)-12-oxododecanoic acid (DA), two newly designed coupling agents, for synergistic binding to human serum albumin (HSA). Both HC and DA are conjugated to a bone anabolic aptamer (Apc001) against sclerostin to form an Apc001OC conjugate with high binding affinity to HSA. Notably, HC and DA could synergistically facilitate prolonging the half-life of the conjugated Apc001 and promoting its bone anabolic potential. Using the designed blocking peptides, the mechanism studies indicate that the synergistic effect of HC-DA on pharmacokinetics and bone anabolic potential of the conjugated Apc001 is achieved via their synergistic binding to HSA. Moreover, biweekly Apc001OC at 50 mg/kg shows comparable bone anabolic potential to the marketed sclerostin antibody given weekly at 25 mg/kg. This proposed bimolecular modification strategy could help address the druggability challenge for aptamers with a short half-life.

HFE
Also flagged:Dyserythropoietic Anemia Type ICongenitaldyserythropoietic anemiaserythropoiesisanemiacongenital dyserythropoietic anemia type I
Journal Article 2023-11-10 ✓ 1 Snippet Nagar V, Patil NJ.
In-Text Gene Mentions

…subsequent development ofhemochromatosis.…

Show Full Abstract

Congenital dyserythropoietic anemias are a group of rare hereditary conditions affecting erythropoiesis. These disorders are characterized by anemia, primarily caused by inefficient erythropoiesis, as well as distinctive morphological abnormalities observed in most erythroblasts in the bone marrow. congenital dyserythropoietic anemia type I (CDA-I) is a hereditary condition characterized by inefficient production of red blood cells and excessive accumulation of iron. It follows an autosomal recessive pattern of inheritance. There have been approximately 300 recorded cases of CDA-I documented on a global scale. CDA-I is a rarely documented condition in the Indian subcontinent. Therefore, we will be examining a case of CDA-I in the present article. A male infant, aged four months, who had signs of vomiting, weight loss, and failure to thrive, was diagnosed with CDA-I following a bone marrow aspiration. Our experience provides further evidence supporting the notion that the accurate diagnosis of CDA-I can be achieved by doing a comprehensive assessment of bone marrow aspiration.

Also flagged:CTVTcancertumorstumormethylationcancers
Journal Article 2023-11-10 No Snippets Zhou BW, Wu QQ, Mauki DH, Wang X, Zhang SR, Yin TT, Chen FL, Li C, Liu YH, Wang GD, Zhang YP.
Show Full Abstract

The canine transmissible venereal tumor (CTVT) is a clonal cell-mediated cancer with a long evolutionary history and extensive karyotype rearrangements in its genome. However, little is known about its genetic similarity to human tumors. Here, using multi-omics data we identified 11 germline gene fusions (GGFs) in CTVT, which showed higher genetic susceptibility than others. Additionally, we illustrate a mechanism of a complex gene fusion of three gene segments (<i>HSD17B4</i>-<i>DMXL1</i>-<i>TNFAIP8</i>) that we refer to "greedy fusion". Our findings also provided evidence that expressions of GGFs are downregulated during the tumor regressive phase, which is associated with DNA methylation level. This study presents a comprehensive landscape of gene fusions (GFs) in CTVT, which offers a valuable genetic resource for exploring potential genetic mechanisms underlying the development of cancers in both dogs and humans.

bioRxiv 2023-11-10 Preprint (No Snippets API) Pupak A, Navarro IR, Sathasivam K, Essmann A, Singh A, del Toro D, Ginés S, Bates GP, Vang Ørom UA, Marti E, Brito V.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington’s disease (HD) is a dominantly inherited neurodegenerative disorder caused by an expanded, somatically unstable CAG repeat in the first exon of the huntingtin gene ( HTT) . In the presence of an expanded CAG repeat, huntingtin mRNA undergoes an aberrant processing that generates HTT1a transcripts with exon 1 and intron 1 sequences, which encodes the aggregation-prone and pathogenic HTTexon 1 protein. The regulatory mechanisms that contribute to the production of HTT1a are not fully understood. In a previous transcriptome-wide m6A landscape study performed in Hdh +/Q111 knock-in mice, we have found that the proximal region of intron 1 to exon1-intron 1 splice site in Htt RNA is highly modified by m6A. Several pieces of evidence have demonstrated that m6A is involved in RNA processing and splicing. Therefore, in this study we set out to explore the impact of m6A RNA modifications in the generation of Htt1a . We show in the striatum of Hdh +/Q111 mice that m6A is enriched in intronic sequences 5’ to the cryptic poly (A) sites (IpA1 and IpA2) at 680 and 1145 bp into intron 1 as well as in Htt1a polyadenylated mRNA. We also verified the presence of specific m6A-modified sites near the 5’ exon1-intron1 splice donor site. Intronic HTT m6A methylation was recapitulated in human samples showing a significantly increased methylation ratio in HD putamen post-mortem samples and in HD fibroblast cell lines from pre-symptomatic and symptomatic patients. In order to test the hypothesis that the m6A modification is involved in mutant Htt RNA processing, we performed a pharmacological inhibition of METTL3 and a targeted demethylation of Htt intron 1 in HD cells using a dCas13-ALKBH5 system. We found that Htt1a transcript levels in HD cells are regulated by METTL3 and by methylation status in Htt intron 1. Site-specific manipulation with an RNA editing system resulted in decreased expression levels of Htt1a , which was accompanied by a reduction in DNA damage, a major hallmark in HD. Finally, we propose that m6A methylation in intron 1 is likely dependent on the expanded CAG repeats. These findings provide insight into the role of m6A in the generation of the aberrantly spliced mutant Htt transcripts with important implications for therapeutic strategies.

Also flagged:peroxiredoxinsbreast cancer
Journal Article 2023-11-09 No Snippets Mei J, Hao L, Liu X, Sun G, Xu R, Wang H, Liu C.
Show Full Abstract

No abstract available.

Also flagged:Smyd3TAK1NF-κBIRF3degradationTransforming growth factor beta kinase 1
Journal Article 2023-11-09 No Snippets Qu Z, Sun Y, Zhou X, Yan X, Xu T.
Show Full Abstract

<h4>Importance</h4>In this study, we have found that the existence of Smyd3 promoted the replication of SCRV. Additionally, we report that Smyd3 negatively regulates the NF-κB and IRF3 signaling pathway by facilitating the degradation of TAK1 in fish. Our findings suggest that Smyd3 interacts with TAK1. Further investigations have revealed that Smyd3 specifically mediates K48-linked ubiquitination of TAK1 and enhances TAK1 degradation, resulting in a significant inhibition of the NF-κB and IRF3 signaling pathway. These results not only contribute to the advancement of fish anti-viral immunity but also provide new evidence for understanding the mechanism of TAK1 in mammals.

Also flagged:watercollagen type IIextracellularcollagencartilage formationchondrogenesis
Journal Article 2023-11-09 No Snippets Franz-Odendaal TA.
Show Full Abstract

The sclera of all vertebrate eyes is comprised of connective tissue, with some organisms developing cartilage within this tissue. A review of the cartilages that have been described in the vertebrate sclera and their anatomical relationships is discussed together with their potential homology. Incorrect terminology erroneously implies similarity in location, development, morphology, and evolution, which may lead some scientists to assume all cartilages in orbit are the same elements when reading the literature. Therefore, new terminology to distinguish the different types of cartilage associated with the vertebrate eye is proposed. The scleral cartilages that are likely homologous to one another and which are situated in the sclera, should be termed scleral cartilages sensu stricto, while other cartilages in the sclera should be termed ocular cartilages. Some of the cartilages also ossify, and these bones should be distinguished from the scleral ossicles. The plasticity of the scleral tissue layer and its range of morphologies from fibrous to cartilaginous connective tissue across different vertebrate lineages are also described. This review also highlights several gaps in our understanding of the vertebrate scleral cartilages, in particular.

Also flagged:Cardiac Failurebrain atrophysystolic heart failureidiopathic dilated cardiomyopathycerebral atrophyheart failure
Journal Article 2023-11-09 No Snippets Sekiguchi H, Kikuchi N, Ishida I, Sekiguchi N, Nishimura K, Shiga T, Kawana M, Hagiwara N, Takemura Y, Yamaguchi J.
Show Full Abstract

BACKGROUND Heart failure is associated with structural brain abnormalities, including atrophy of multiple brain regions. Previous studies have reported brain atrophy in middle-aged patients with systolic heart failure. In this report, we present the case of a 21-year-old woman with idiopathic dilated cardiomyopathy, cardiac failure, and global cerebral atrophy due to reduced cerebral artery blood flow. We also discuss the impact of brain atrophy in this young adult patient with severe heart failure and no risk factors for atherosclerosis. CASE REPORT A 21-year-old woman with dyspnea and leg edema was admitted to our hospital. After several examinations, an endomyocardial biopsy led to a diagnosis of idiopathic dilated cardiomyopathy, and transthoracic ultrasound cardiography revealed that her left ventricular ejection fraction was 36%. One year after the first hospitalization, her heart failure was classified as New York Heart Association Class III. Magnetic resonance imaging showed severe global brain atrophy, and single-photon emission computed tomography combined with brain computed tomography showed reduced blood flow to the entire brain. She had no risk factors for atherosclerosis and no atherosclerotic changes to her brain or carotid arteries, but her neuropsychological and neurological findings indicated more pronounced brain and cognitive dysfunction. CONCLUSIONS This young adult patient with idiopathic dilated cardiomyopathy, cardiac failure, and global cerebral atrophy showed reduced cerebral artery blood flow and cognitive impairment. The findings of this report indicate that low cardiac output may directly cause brain atrophy in patients with systolic heart failure.

Also flagged:cytotoxic T-lymphocyte-associated protein 4CTLA-4programmed death protein 1PD-1programmed death-ligand 1PD-L1
Journal Article 2023-11-09 No Snippets Wang Z, Li W, Jiang Y, Tran TB, Cordova LE, Chung J, Kim M, Wondrak G, Erdrich J, Lu J.
Show Full Abstract

Epacadostat (EPA), the most advanced IDO1 inhibitor, in combination with PD-1 checkpoint inhibitor, has failed in a recent Phase III clinical trial for treating metastatic melanoma. Here we report an EPA nanovesicle therapeutic platform (Epacasome) based on chemically attaching EPA to sphingomyelin via an oxime-ester bond highly responsive to hydrolase cleavage. Via clathrin-mediated endocytosis, Epacasome displays higher cellular uptake and enhances IDO1 inhibition and T cell proliferation compared to free EPA. Epacasome shows improved pharmacokinetics and tumour accumulation with efficient intratumoural drug release and deep tumour penetration. Additionally, it outperforms free EPA for anticancer efficacy, potentiating PD-1 blockade with boosted cytotoxic T lymphocytes (CTLs) and reduced regulatory T cells and myeloid-derived suppressor cells responses in a B16-F10 melanoma model in female mice. By co-encapsulating immunogenic dacarbazine, Epacasome further enhances anti-tumor effects and immune responses through the upregulation of NKG2D-mediated CTLs and natural killer cells responses particularly when combined with the PD-1 inhibitor in the late-stage metastatic B16-F10-Luc2 model in female mice. Furthermore, this combination prevents tumour recurrence and prolongs mouse survival in a clinically relevant, post-surgical melanoma model in female mice. Epacasome demonstrates potential to synergize with PD-1 blockade for improved response to melanoma immunotherapy.

Also flagged:prostate cancernon-skin cancerC9orf152ANO7CHEK2FAM111A
Journal Article 2023-11-09 No Snippets Wang A, Shen J, Rodriguez AA, Saunders EJ, Chen F, Janivara R, Darst BF, Sheng X, Xu Y, Chou AJ, Benlloch S, Dadaev T, Brook MN, Plym A, Sahimi A, Hoffman TJ, Takahashi A, Matsuda K, Momozawa Y, Fujita M, Laisk T, Figuerêdo J, Muir K, Ito S, Liu X, Biobank Japan Project, Uchio Y, Kubo M, Kamatani Y, Lophatananon A, Wan P, Andrews C, Lori A, Choudhury PP, Schleutker J, Tammela TLJ, Sipeky C, Auvinen A, Giles GG, Southey MC, MacInnis RJ, Cybulski C, Wokolorczyk D, Lubinski J, Rentsch CT, Cho K, Mcmahon BH, Neal DE, Donovan JL, Hamdy FC, Martin RM, Nordestgaard BG, Nielsen SF, Weischer M, Bojesen SE, Røder A, Stroomberg HV, Batra J, Chambers S, Horvath L, Clements JA, Tilly W, Risbridger GP, Gronberg H, Aly M, Szulkin R, Eklund M, Nordstrom T, Pashayan N, Dunning AM, Ghoussaini M, Travis RC, Key TJ, Riboli E, Park JY, Sellers TA, Lin HY, Albanes D, Weinstein S, Cook MB, Mucci LA, Giovannucci E, Lindstrom S, Kraft P, Hunter DJ, Penney KL, Turman C, Tangen CM, Goodman PJ, Thompson IM, Hamilton RJ, Fleshner NE, Finelli A, Parent MÉ, Stanford JL, Ostrander EA, Koutros S, Beane Freeman LE, Stampfer M, Wolk A, Håkansson N, Andriole GL, Hoover RN, Machiela MJ, Sørensen KD, Borre M, Blot WJ, Zheng W, Yeboah ED, Mensah JE, Lu YJ, Zhang HW, Feng N, Mao X, Wu Y, Zhao SC, Sun Z, Thibodeau SN, McDonnell SK, Schaid DJ, West CML, Barnett G, Maier C, Schnoeller T, Luedeke M, Kibel AS, Drake BF, Cussenot O, Cancel-Tassin G, Menegaux F, Truong T, Koudou YA, John EM, Grindedal EM, Maehle L, Khaw KT, Ingles SA, Stern MC, Vega A, Gómez-Caamaño A, Fachal L, Rosenstein BS, Kerns SL, Ostrer H, Teixeira MR, Paulo P, Brandão A, Watya S, Lubwama A, Bensen JT, Butler EN, Mohler JL, Taylor JA, Kogevinas M, Dierssen-Sotos T, Castaño-Vinyals G, Cannon-Albright L, Teerlink CC, Huff CD, Pilie P, Yu Y, Bohlender RJ, Gu J, Strom SS, Multigner L, Blanchet P, Brureau L, Kaneva R, Slavov C, Mitev V, Leach RJ, Brenner H, Chen X, Holleczek B, Schöttker B, Klein EA, Hsing AW, Kittles RA, Murphy AB, Logothetis CJ, Kim J, Neuhausen SL, Steele L, Ding YC, Isaacs WB, Nemesure B, Hennis AJM, Carpten J, Pandha H, Michael A, De Ruyck K, De Meerleer G, Ost P, Xu J, Razack A, Lim J, Teo SH, Newcomb LF, Lin DW, Fowke JH, Neslund-Dudas CM, Rybicki BA, Gamulin M, Lessel D, Kulis T, Usmani N, Abraham A, Singhal S, Parliament M, Claessens F, Joniau S, Van den Broeck T, Gago-Dominguez M, Castelao JE, Martinez ME, Larkin S, Townsend PA, Aukim-Hastie C, Bush WS, Aldrich MC, Crawford DC, Srivastava S, Cullen J, Petrovics G, Casey G, Wang Y, Tettey Y, Lachance J, Tang W, Biritwum RB, Adjei AA, Tay E, Truelove A, Niwa S, Yamoah K, Govindasami K, Chokkalingam AP, Keaton JM, Hellwege JN, Clark PE, Jalloh M, Gueye SM, Niang L, Ogunbiyi O, Shittu O, Amodu O, Adebiyi AO, Aisuodionoe-Shadrach OI, Ajibola HO, Jamda MA, Oluwole OP, Nwegbu M, Adusei B, Mante S, Darkwa-Abrahams A, Diop H, Gundell SM, Roobol MJ, Jenster G, van Schaik RHN, Hu JJ, Sanderson M, Kachuri L, Varma R, McKean-Cowdin R, Torres M, Preuss MH, Loos RJF, Zawistowski M, Zöllner S, Lu Z, Van Den Eeden SK, Easton DF, Ambs S, Edwards TL, Mägi R, Rebbeck TR, Fritsche L, Chanock SJ, Berndt SI, Wiklund F, Nakagawa H, Witte JS, Gaziano JM, Justice AC, Mancuso N, Terao C, Eeles RA, Kote-Jarai Z, Madduri RK, Conti DV, Haiman CA.
Show Full Abstract

The transferability and clinical value of genetic risk scores (GRSs) across populations remain limited due to an imbalance in genetic studies across ancestrally diverse populations. Here we conducted a multi-ancestry genome-wide association study of 156,319 prostate cancer cases and 788,443 controls of European, African, Asian and Hispanic men, reflecting a 57% increase in the number of non-European cases over previous prostate cancer genome-wide association studies. We identified 187 novel risk variants for prostate cancer, increasing the total number of risk variants to 451. An externally replicated multi-ancestry GRS was associated with risk that ranged from 1.8 (per standard deviation) in African ancestry men to 2.2 in European ancestry men. The GRS was associated with a greater risk of aggressive versus non-aggressive disease in men of African ancestry (P = 0.03). Our study presents novel prostate cancer susceptibility loci and a GRS with effective risk stratification across ancestry groups.

Also flagged:autism spectrum disorderneurogenesisSYNGAP1brain disorderssynaptogensisRas GTP-ase activating protein 1
Journal Article 2023-11-09 No Snippets Birtele M, Del Dosso A, Xu T, Nguyen T, Wilkinson B, Hosseini N, Nguyen S, Urenda JP, Knight G, Rojas C, Flores I, Atamian A, Moore R, Sharma R, Pirrotte P, Ashton RS, Huang EJ, Rumbaugh G, Coba MP, Quadrato G.
Show Full Abstract

Genes involved in synaptic function are enriched among those with autism spectrum disorder (ASD)-associated rare genetic variants. Dysregulated cortical neurogenesis has been implicated as a convergent mechanism in ASD pathophysiology, yet it remains unknown how 'synaptic' ASD risk genes contribute to these phenotypes, which arise before synaptogenesis. Here, we show that the synaptic Ras GTPase-activating (RASGAP) protein 1 (SYNGAP1, a top ASD risk gene) is expressed within the apical domain of human radial glia cells (hRGCs). In a human cortical organoid model of SYNGAP1 haploinsufficiency, we find dysregulated cytoskeletal dynamics that impair the scaffolding and division plane of hRGCs, resulting in disrupted lamination and accelerated maturation of cortical projection neurons. Additionally, we confirmed an imbalance in the ratio of progenitors to neurons in a mouse model of Syngap1 haploinsufficiency. Thus, SYNGAP1-related brain disorders may arise through non-synaptic mechanisms, highlighting the need to study genes associated with neurodevelopmental disorders (NDDs) in diverse human cell types and developmental stages.

DCC
Also flagged:distal cholangiocarcinomacancerCholangiocarcinomaperihilar cholangiocarcinomabiliary tract cancerscancers
Journal Article 2023-11-09 ✓ 5 Snippets Yoshii H, Izumi H, Fujino R, Kurata M, Inomoto C, Sugiyama T, Nakagohri T, Nomura E, Mukai M, Tajiri T.
In-Text Gene Mentions

…fibromuscular invasion ofDCCcontributes to recurrence…

…pathologically diagnosed withDCCwho underwent surgical…

…bile ducts, withDCCaccounting for 29–42%…

…Furthermore, inDCCcases with a…

…the prognosis ofDCC, despite the anatomical…

Show Full Abstract

The American Joint Committee on Cancer (AJCC) 8th edition T-staging system for distal cholangiocarcinoma (DCC) proposes classification according to the depth of invasion (DOI); nevertheless, DOI measurement is complex and irreproducible. This study focused on the fibromuscular layer and evaluated whether the presence or absence of penetrating fibromuscular invasion of DCC contributes to recurrence and prognosis. In total, 55 patients pathologically diagnosed with DCC who underwent surgical resection from 2002 to 2022 were clinicopathologically examined. Subserosal layer and/or pancreatic (SS/Panc) invasion, defined as penetration of the fibromuscular layer and invasion of the subserosal layer or pancreas by the cancer, was assessed with other clinicopathological prognostic factors to investigate recurrence and prognostic factors. According to the AJCC 8th edition, there were 11 T1, 28 T2, and 16 T3 cases, with 44 (80%) cases of SS/Panc invasion. The DOI was not significantly different for both recurrence and prognostic factors. In the multivariate analysis, only SS/Panc was identified as an independent factor for prognosis (hazard ratio: 16.1; 95% confidence interval: 2.1-118.8, <i>p</i> = 0.006). In conclusion, while the determination of DOI in DCC does not accurately reflect recurrence and prognosis, the presence of SS/Panc invasion may contribute to the T-staging system.

ZNF644
Also flagged:RPE65retinal degenerationsretinopathypathogenesisInherited Retinal Degenerationschromosomes
Journal Article 2023-11-09 ✓ 1 Snippet Stepanova A, Ogorodova N, Kadyshev V, Shchagina O, Kutsev S, Polyakov A.
In-Text Gene Mentions

…, USH2A ,ZNF644, ARMS2 ,…

Show Full Abstract

Pathogenic variants in the <i>RPE65</i> gene cause the only known form of inherited retinal degenerations (IRDs) that are prone to gene therapy. The current study is aimed at the evaluation of the prevalence of RPE65-associated retinopathy in the Russian Federation, the characterization of known variants in the <i>RPE65</i> gene, and the establishment of the specificities of the mutation spectrum in Russian patients.<h4>Methods</h4>The analysis was carried out on blood samples obtained from 1053 non-related IRDs patients. The analysis, which consisted of 211 genes, was carried out based on the method of massive parallel sequencing (MPS) for all probands. Variant validation, as well as biallelic status verification, were carried out using direct automated Sanger sequencing. The number of copies of <i>RPE65</i> exons 1-14 was analyzed with quantitative MLPA using an MRC-Holland SALSA MLPA probemix.<h4>Results</h4>Out of 1053 non-related patients, a molecular genetic diagnosis of IRDs has been confirmed in 474 cases, including 25 (5.3%) patients with RPE65-associated retinopathy. We detected 26 variants in the <i>RPE65</i> gene, nine of which have not been previously described in the literature. The most common mutations in the Russian population were c.304G>T/p.(Glu102*), c.370C>T/p.(Arg124*), and c.272G>A/p.(Arg91Gln), which comprised 41.8% of all affected chromosomes.<h4>Conclusions</h4>The current study shows that pathogenic variants in the <i>RPE65</i> gene contribute significantly to the pathogenesis of IRDs and comprise 5.3% of all patients with a confirmed molecular genetic diagnosis. This study allowed for the formation of a cohort for target therapy of the disorder; such therapy has already been carried out for some patients.

Also flagged:Cardiovascular diseasescoronary heart diseasevitamin Kstatincardiovascular diseasedyslipidemia
Journal Article 2023-11-09 No Snippets Mauriello A, Ascrizzi A, Molinari R, Falco L, Caturano A, D'Andrea A, Russo V.
Show Full Abstract

<h4>Purpose of review</h4>Advances in pharmacogenomics have paved the way for personalized medicine. Cardiovascular diseases still represent the leading cause of mortality in the world. The aim of this review is to summarize the background, rationale, and evidence of pharmacogenomics in cardiovascular medicine, in particular, the use of antiplatelet drugs, anticoagulants, and drugs used for the treatment of dyslipidemia.<h4>Recent findings</h4>Randomized clinical trials have supported the role of a genotype-guided approach for antiplatelet therapy in patients with coronary heart disease undergoing percutaneous coronary interventions. Numerous studies demonstrate how the risk of ineffectiveness of new oral anticoagulants and vitamin K anticoagulants is linked to various genetic polymorphisms. Furthermore, there is growing evidence to support the association of some genetic variants and poor adherence to statin therapy, for example, due to the appearance of muscular symptoms. There is evidence for resistance to some drugs for the treatment of dyslipidemia, such as anti-PCSK9.<h4>Summary</h4>Pharmacogenomics has the potential to improve patient care by providing the right drug to the right patient and could guide the identification of new drug therapies for cardiovascular disease. This is very important in cardiovascular diseases, which have high morbidity and mortality. The improvement in therapy could be reflected in the reduction of healthcare costs and patient mortality.

Also flagged:agingneurodegenerative diseasesamyotrophic lateral sclerosisALSADPD
Journal Article 2023-11-09 No Snippets Toader C, Dobrin N, Brehar FM, Popa C, Covache-Busuioc RA, Glavan LA, Costin HP, Bratu BG, Corlatescu AD, Popa AA, Ciurea AV.
Show Full Abstract

With the inexorable aging of the global populace, neurodegenerative diseases (NDs) like Alzheimer's disease (AD), Parkinson's disease (PD), and amyotrophic lateral sclerosis (ALS) pose escalating challenges, which are underscored by their socioeconomic repercussions. A pivotal aspect in addressing these challenges lies in the elucidation and application of biomarkers for timely diagnosis, vigilant monitoring, and effective treatment modalities. This review delineates the quintessence of biomarkers in the realm of NDs, elucidating various classifications and their indispensable roles. Particularly, the quest for novel biomarkers in AD, transcending traditional markers in PD, and the frontier of biomarker research in ALS are scrutinized. Emergent susceptibility and trait markers herald a new era of personalized medicine, promising enhanced treatment initiation especially in cases of SOD1-ALS. The discourse extends to diagnostic and state markers, revolutionizing early detection and monitoring, alongside progression markers that unveil the trajectory of NDs, propelling forward the potential for tailored interventions. The synergy between burgeoning technologies and innovative techniques like -omics, histologic assessments, and imaging is spotlighted, underscoring their pivotal roles in biomarker discovery. Reflecting on the progress hitherto, the review underscores the exigent need for multidisciplinary collaborations to surmount the challenges ahead, accelerate biomarker discovery, and herald a new epoch of understanding and managing NDs. Through a panoramic lens, this article endeavors to provide a comprehensive insight into the burgeoning field of biomarkers in NDs, spotlighting the promise they hold in transforming the diagnostic landscape, enhancing disease management, and illuminating the pathway toward efficacious therapeutic interventions.

HTT
Also flagged:neurodegenerative diseasesagingdeathpyroptosismembraneinflammatory response
Journal Article 2023-11-09 ✓ 2 Snippets Li Y, Li YJ, Zhu ZQ.
In-Text Gene Mentions

Furthermore, inhibiting NLRP3 inflammasome activation can delay neurodegeneration and disease progression in ALS mice, further confirming the role of pyroptosis in ALS pathogenesis (Johann et al., 2015).Huntington’s disease (HD) is a neurodegenerative disorder characterized by impaired motor control and cognitive function, which is associated with the mutation of the huntingtin (Htt) protein.

…HD research, mutatedHttprotein can induce…

Show Full Abstract

Neurodegenerative diseases (NDs), such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and motor neuron disease, are diseases characterized by neuronal damage and dysfunction. NDs are considered to be a multifactorial disease with diverse etiologies (immune, inflammatory, aging, genetic, etc.) and complex pathophysiological processes. Previous studies have found that neuroinflammation and typical microglial activation are important mechanisms of NDs, leading to neurological dysfunction and disease progression. Pyroptosis is a new mode involved in this process. As a form of programmed cell death, pyroptosis is characterized by the expansion of cells until the cell membrane bursts, resulting in the release of cell contents that activates a strong inflammatory response that promotes NDs by accelerating neuronal dysfunction and abnormal microglial activation. In this case, abnormally activated microglia release various pro-inflammatory factors, leading to the occurrence of neuroinflammation and exacerbating both microglial and neuronal pyroptosis, thus forming a vicious cycle. The recognition of the association between pyroptosis and microglia activation, as well as neuroinflammation, is of significant importance in understanding the pathogenesis of NDs and providing new targets and strategies for their prevention and treatment.

Also flagged:diabetes mellitusdiabetic kidney diseaseend-stage renal diseaseESRDtype 2 diabetes mellitustype 1 diabetes mellitus
Journal Article 2023-11-09 No Snippets Cai A, Shen J, Yang X, Shao X, Gu L, Mou S, Che X.
Show Full Abstract

<h4>Introduction</h4>Diabetic kidney disease (DKD) has become the leading cause of end-stage renal disease worldwide. Therefore, efforts to understand DKD pathophysiology and prevent its development at the early phase are highly warranted.<h4>Methods</h4>Here, we analyzed kidneys from healthy mice, diabetic mice, and diabetic mice treated with the sodium-glucose cotransporter 2 inhibitor dapagliflozin using ATAC and RNA sequencing. The findings were verified at the protein levels and in cultured cells.<h4>Results</h4>Our combined method of ATAC and RNA sequencing revealed <i>Csf2rb</i>, <i>Btla</i>, and <i>Isg15</i> as the key candidate genes associated with hyperglycemia, azotemia, and albuminuria. Their protein levels were altered together with multiple other inflammatory cytokines in the diabetic kidney, which was alleviated by dapagliflozin treatment. Cell culture of immortalized renal tubular cells and macrophages unraveled that dapagliflozin could directly effect on these cells <i>in vitro</i> as an anti-inflammatory agent independent of glucose concentrations. We further proved that dapagliflozin attenuated ischemia/reperfusion-induced chronic kidney injury and renal inflammation in mice.<h4>Discussion</h4>Overall, our data emphasize the importance of inflammatory factors to the pathogenesis of DKD, and provide valuable mechanistic insights into the renoprotective role of dapagliflozin.

HTT
Also flagged:CoV-2 infectionCOVID-19infectionsinfectionprostaglandin E2PGE receptor 3
Journal Article 2023-11-09 ✓ 3 Snippets Li D, Hu D, Ochi Y, Arakaki W, Mawatari A, Shigeta M, Wu Y, Hayashinaka E, Neyama H, Tahara T, Wada Y, Li F, Doi H, Watanabe Y, Cui Y.
In-Text Gene Mentions

Moreover, clinical studies have also demonstrated that the upregulation of 5-HTT and consequent reduction of extracellular 5-HT levels were observed in IFN-α and IFN-γ therapies to treat various forms of cancer and hepatitis C, in which patients often complain of serious tiredness (26, 27).

…the 5-HT transporter (5-HTT) promoter region was…

…pointing to elevated5-HTTexpression and low…

Show Full Abstract

<h4>Introduction</h4>A series of symptoms, including fever, widespread pain, fatigue, and even ageusia, have frequently been reported in the context of various infections, such as COVID-19. Although the pathogenic mechanisms underlying an infection causing fever and pain have been well established, the mechanisms of fatigue induced by infection in specific brain regions remain unclear.<h4>Methods</h4>To elucidate whether and how the peripheral infection cause fatigue via regional neuroinflammation, we performed a brain-wide investigation of neuroinflammation in a peripheral pseudoinfection rat model using [<sup>18</sup>F]DPA-714 positron emission tomography (PET) imaging analysis, in which the polyriboinosinic: polyribocytidylic acid (poly I:C) was intraperitoneally injected.<h4>Results</h4>Transient fever lasting for several hours and subsequent suppression of spontaneous activity lasting a few days were induced by poly I:C treatment. Significant increase in plasma interleukin (IL)-1β, IL-6 and tumour necrosis factor (TNF)-α were observed at 2 and 4 h following poly I:C treatment. PET imaging analysis revealed that the brain uptake of [<sup>18</sup>F]DPA-714 was significantly increased in several brain regions one day after poly I:C treatment, such as the dorsal raphe (DR), parvicellular part of red nucleus (RPC), A5 and A7 noradrenergic nucleus, compared with the control group. The accumulation of [<sup>18</sup>F]DPA-714 in the DR, RPC and A5 was positively correlated with subsequent fatigue-like behavior, and that in the A7 tended to positively correlate with fever.<h4>Discussion</h4>These findings suggest that peripheral infection may trigger regional neuroinflammation, which may cause specific symptoms such as fatigue. A similar mechanism might be involved in COVID-19.

Also flagged:maleic anhydridebenzoatesphenylesterfuranpyrrol
Journal Article 2023-11-09 No Snippets Ahmed HA, Abolibda TZ, Ismail YAM, Almohammedi A, Aly KA, Ibrahim MS, Gomha SM.
Show Full Abstract

A new class of liquid crystalline materials, 4-(2,5-dioxo-2,5-dihydro-1<i>H</i>-pyrrol-1-yl)phenyl 4-(alkoxy)benzoates (Mn), derived from maleic anhydride, was synthesized and studied for mesomorphic and optical properties. These materials consist of three derivatives with varying terminal flexible chain lengths (6-12 carbons) linked to the phenyl ring near the ester bond. The study employed differential scanning calorimetry and polarized optical microscopy (POM) to characterize the mesomorphic properties. Molecular structures were elucidated using elemental analysis, FT-IR, and NMR spectroscopy. The findings reveal that all the synthesized maleic anhydride derivatives exhibit enantiotropic nematic (N) mesophases. The insertion of the heterocyclic maleic anhydride moiety into the molecular structure influences the stability and range of the N phase. Additionally, entropy changes during N-isotropic transitions are of small magnitude and exhibit non-linear trends independent of the terminal alkoxy chain length (n). This suggests that the ester linkage group does not significantly promote molecular biaxiality, and the clearing temperature values are relatively high. By comparing the investigated materials with their furan derivatives found in existing literature, it was established that the substitution examined in this study induces the formation of nematic phases.

Also flagged:liver cancercancerdeathHepatocellular carcinomametabolismTumor
Journal Article 2023-11-09 No Snippets Ru B, Hu J, Zhang N, Wan Q.
Show Full Abstract

Hepatocellular carcinoma (HCC) remains a global challenge as it is the sixth most common neoplasm worldwide and the third leading cause of cancer-related death. A key feature of HCC is abnormal metabolism, which promotes cancer cell proliferation, survival, invasion, and metastasis. However, the significance of metabolism-related genes (MRGs) in HCC remains to be elucidated. Here, we aim to establish a novel metabolism-related prognostic signature for the prediction of patient outcomes and to investigate the value of MRG expression in the prognostic prediction of HCC. In our research, a Metabolism-Related Risk Score (MRRS) model was constructed using 14 MRGs (DLAT, SEPHS1, ACADS, UCK2, GOT2, ADH4, LDHA, ME1, TXNRD1, B4GALT2, AK2, PTDSS2, CSAD, and AMD1). The Kaplan-Meier curve confirmed that the MRRS has a high accuracy in predicting the prognosis of HCC patients (<i>p</i> < 0.001). According to the MRRS model, the area under the curve (AUC) values for predicting the prognosis of patients with hepatocellular carcinoma at 1, 3, and 5 years reached 0.829, 0.760, and 0.739, respectively. Functional analyses revealed that signaling pathways associated with the cell cycle were largely enriched by differential genes between high and low-risk groups. In addition, dendritic cells (DCs) (<i>p</i> < 0.001), CD4+ T cells (<i>p</i> < 0.01), CD8+ T cells (<i>p</i> < 0.001), B cells (<i>p</i> < 0.001), neutrophils (<i>p</i> < 0.001), macrophages (<i>p</i> < 0.001) had a higher proportion of infiltrates in high-risk populations. Low GOT2 expression is associated with poor prognosis in patients with hepatocellular carcinoma. Knockdown of GOT2 significantly increased the migration capacity of the Huh7 and MHCC97H hepatocellular carcinoma lines. Our research reveals that GOT2 is negatively related to the survival of patients with hepatocellular carcinoma and GOT2 may contribute to tumor progression by inhibiting the ability of tumor cells to migrate.

SUDS3
Also flagged:Tumormalignant tumorsnanomaterialstumorscancermalignant tumors
Journal Article 2023-11-09 ✓ 1 Snippet Wang W, Pang X, Dong M, Li R, Liu Z, Liang Y, Liu H, Ni N, Chen D, Sun X.
In-Text Gene Mentions

…complexes and recruitinghistone modifying coactivatorsmodifying coactivators such…

Show Full Abstract

Tumor metastasis is one of the most significant biological characteristics of malignant tumors. Advances in nanotechnology provide a new direction for tackling malignant tumors. Unlike previous studies that focused on the use of nanomaterials to eliminate tumors and avoid metastasis, this work focuses on summarizing the mechanisms by which some nanomaterials promote tumor metastasis in some cases. In this Review, we summarized recent research about various nanomaterials promoting tumor metastasis. The mechanisms of nanomaterials in this process have been highlighted, including the induction of epithelial-mesenchymal transition in tumor cells by nanomaterials, the interaction of nanomaterials with the vasculature, and the induction of inflammation by nanomaterials. Elucidating the mechanism of nanomaterials promoting tumor metastasis is beneficial to guide the development and application of safe and efficient nanomaterials, which can effectively reduce the incidence of tumor metastasis in the future.

SERPINC1
Also flagged:fetuin-Bessential hypertensionlipidmetabolismcardiovascular diseasescoronary heart disease
Journal Article 2023-11-08 ✓ 2 Snippets Gao T, Liu R, Li C, Chu X, Guo Q, Ke D.
In-Text Gene Mentions

…ulin/bicunin precursor (AMBP),antithrombin-III(SERPINC1), fibrinogen alpha…

…sor (AMBP), antithrombin-III (SERPINC1), fibrinogen alpha chain…

Show Full Abstract

<h4>Background</h4>Fetuin-B, a cytokine that regulates lipid metabolism, has recently been linked to cardiovascular diseases such as coronary heart disease. In this study, we discussed the relationship between fetuin-B and essential hypertension.<h4>Method</h4>A bioinformatics analysis of fetuin-B was performed. A total of 206 with essential hypertension and 180 age- and-sex-matched healthy subjects were enrolled. Plasma fetuin-B, endothelin 1 (ET-1), nitric oxide (NO), and adiponectin (ADI) levels were measured using ELISA kits.<h4>Results</h4>Bioinformatics analysis has revealed that fetuin-B plays an important role in pathways such as lipid metabolism. Compared with healthy subjects, serum fetuin-B levels in patients with essential hypertension were significantly increased. Correlation analysis showed that the serum fetuin-B level was positively correlated with systolic blood pressure (SBP), diastolic blood pressure, body mass index, fat percentage in vivo, waist-hip ratio, intima-media thickness, low-density lipoprotein cholesterol (LDL-C), glutamyltranspeptidase, alanine transaminase, albumin, fasting blood glucose (FBG), glycated hemoglobin, and ET-1 in the overall study subjects (all P < 0.05) and negatively correlated with HDL-C, ADI, and NO (all P < 0.05). Multivariate linear regression analysis showed that SBP, FBG, LDL-C, ADI, and ET-1 were independent factors affecting serum fetuin-B. A binary logistic regression analysis showed that fetuin-B was an independent risk factor for primary hypertension (odds ratio: 1.060, 95% CI: 1.034-1.086, P < 0.001). Receiver operating characteristic curve analysis was used to evaluate the predictive value of fetuin-B for primary hypertension, and the optimal cutoff point was 83.14 μg/mL (sensitivity 77.4%, specificity 63.3%) (area under the curve) = 0.7738, 95% CI 0.7276-0.8200, P < 0.001).<h4>Conclusion</h4>Elevated fetuin-B levels are associated with an increased risk of essential hypertension.

Also flagged:mesenchymal stem cell senescenceOsteoarthritisOAchronic joint diseaseextracellular matrixsynthesis
Journal Article 2023-11-08 No Snippets Tan D, Huang Z, Zhao Z, Chen X, Liu J, Wang D, Deng Z, Li W.
Show Full Abstract

Osteoarthritis (OA) is a chronic joint disease characterized by articular cartilage degeneration, secondary bone hyperplasia, inadequate extracellular matrix synthesis and degeneration of articular cartilage. Mesenchymal stem cells (MSCs) can self‑renew and undergo multidirectional differentiation; they can differentiate into chondrocytes. Aging MSCs have a weakened ability to differentiate, and release various pro‑inflammatory cytokines, which may contribute to OA progression; the other mechanism contributing to OA is epigenetic regulation (for instance, DNA methylation, histone modification and regulation of non‑coding RNA). Owing to the self‑renewal and differentiation ability of MSCs, various MSC‑based exogenous cell therapies have been developed to treat OA. The efficacy of MSC‑based therapy is mainly attributed to cytokines, growth factors and the paracrine effect of exosomes. Recently, extensive studies have been conducted on MSC‑derived exosomes. Exosomes from MSCs can deliver a variety of DNA, RNA, proteins and lipids, thereby facilitating MSC migration and cartilage repair. Therefore, MSC‑derived exosomes are considered a promising therapy for OA. The present review summarized the association between MSC aging and OA in terms of genetics and epigenetics, and characteristics of MSC‑derived exosomes, and the mechanism to alleviate OA cartilage damage.

Also flagged:Myxomatous mitral valve diseaseheart diseasemembranecollagencollagenslaminin
Journal Article 2023-11-08 No Snippets Reimann MJ, Cremer S, Christiansen L, Ibragimov E, Gao F, Cirera S, Fredholm M, Olsen LH, Karlskov-Mortensen P.
Show Full Abstract

We here report the results of a mitral valve transcriptome study designed to identify genes and molecular pathways involved in development of congestive heart failure (CHF) following myxomatous mitral valve disease (MMVD) in dogs. The study is focused on a cohort of elderly age-matched dogs (n = 34, age ~ 10 years) from a single breed-Cavalier King Charles Spaniels (CKCS)-with a high incidence of MMVD. The cohort comprises 19 dogs (10♀, 9♂) without MMVD-associated CHF, and 15 dogs (6♀, 9♂) with CHF caused by MMVD; i.e., we compare gene expression in breed and age-matched groups of dogs, which only differ with respect to CHF status. We identify 56 genes, which are differentially expressed between the two groups. In this list of genes, we confirm an enrichment of genes related to the TNFβ-signaling pathway, extracellular matrix organization, vascular development, and endothelium damage, which also have been identified in previous studies. However, the genes with the greatest difference in expression between the two groups are CNTN3 and MYH1. Both genes encode proteins, which are predicted to have an effect on the contractile activity of myocardial cells, which in turn may have an effect on valvular performance and hemodynamics across the mitral valve. This may result in shear forces with impact on MMVD progression.

Also flagged:polycaprolactonelactidedegradationgelatinwaterPolylactic acid
Journal Article 2023-11-08 No Snippets Jin B, Zhang C, Zhong Z, Liu Z, Zhang Z, Li D, Zhu M, Yu B.
Show Full Abstract

Early fracture fixation is the critical factor in fracture healing. Common internal fracture implants are made of metallic materials, which often affects the imaging quality of CT and MRI. Most patients will choose secondary surgery to remove the internal fixation implants, which causes secondary damage to them. The development of new degradable internal fracture implants has attracted more and more attention from orthopedic surgeons and researchers. Based on these problems, we improved the various properties of medical grade polycaprolactone (PCL) by adding poly(L-lactide) (PLLA). We produced PCL/PLLA strapping bands with different mass ratios by injection molding. We compared the mechanical properties, degradation properties, cell biocompatibility, bone marrow mesenchymal stem cells (BMSCs) adhesion, proliferation, osteogenic differentiation and fracture fixation effect of these strapping bands. The results showed that the tensile strength and yield force of the strapping bands increased with the increase of the content of PLLA. The addition of PLLA could significantly improve the mechanical strength in the early stage and accelerate the degradation rate of the strapping band. PCL/PLLA (80/20) strapping band had no significant cytotoxicity toward rBMSCs and could promote osteogenic differentiation of rBMSCs. The strapping band could ensure femoral fracture healing of beagles in 3 months and didn't cause damage to the surrounding tissues and main organs. This study will provide some new insights into the biodegradable products of PCL/PLLA blends for internal fixation of fracture. We produced novel degradable PCL/PLLA strapping bands with different mass ratios by injection molding. We tested the biological safety of the prepared internal fixation strapping bands for fracture, such as cell experiment in vitro and animal experiment, and studied the degradation behavior in vitro. The strapping bands could ensure femoral fracture healing of beagles. This study will provide some new insights into the biodegradable products of PCL/PLLA blends for internal fixation of fracture. A Immunofluorescence staining of rBMSCs (live cells: green; dead cells: red). B Young's modulus change curve during strapping bands degradation. C The implantation process of strapping bands. D Micro-CT images of the beagle's fracture recovery after the operation.

BTN2A1
Also flagged:ovarian cancerCD16cancertumorantibodycell-mediated cytotoxicity
Journal Article 2023-11-08 ✓ 1 Snippet Lee D, Dunn ZS, Guo W, Rosenthal CJ, Penn NE, Yu Y, Zhou K, Li Z, Ma F, Li M, Song TC, Cen X, Li YR, Zhou JJ, Pellegrini M, Wang P, Yang L.
In-Text Gene Mentions

…to interact withBTN2A1, forming a complex…

Show Full Abstract

Allogeneic Vγ9Vδ2 (Vδ2) T cells have emerged as attractive candidates for developing cancer therapy due to their established safety in allogeneic contexts and inherent tumor-fighting capabilities. Nonetheless, the limited clinical success of Vδ2 T cell-based treatments may be attributed to donor variability, short-lived persistence, and tumor immune evasion. To address these constraints, we engineer Vδ2 T cells with enhanced attributes. By employing CD16 as a donor selection biomarker, we harness Vδ2 T cells characterized by heightened cytotoxicity and potent antibody-dependent cell-mediated cytotoxicity (ADCC) functionality. RNA sequencing analysis supports the augmented effector potential of Vδ2 T cells derived from CD16 high (CD16<sup>Hi</sup>) donors. Substantial enhancements are further achieved through CAR and IL-15 engineering methodologies. Preclinical investigations in two ovarian cancer models substantiate the effectiveness and safety of engineered CD16<sup>Hi</sup> Vδ2 T cells. These cells target tumors through multiple mechanisms, exhibit sustained in vivo persistence, and do not elicit graft-versus-host disease. These findings underscore the promise of engineered CD16<sup>Hi</sup> Vδ2 T cells as a viable therapeutic option for cancer treatment.

HTT
Also flagged:penicillinstreptomycinTRMT61ATRMT61BTRMT10CEcoRI
Journal Article 2023-11-08 ✓ 2 Snippets Sun Y, Dai H, Dai X, Yin J, Cui Y, Liu X, Gonzalez G, Yuan J, Tang F, Wang N, Perlegos AE, Bonini NM, Yang XW, Gu W, Wang Y.
In-Text Gene Mentions

…one wild-type endogenousHttallele and a…

…and a secondHttallele with knock-in…

Show Full Abstract

Microsatellite repeat expansions within genes contribute to a number of neurological diseases<sup>1,2</sup>. The accumulation of toxic proteins and RNA molecules with repetitive sequences, and/or sequestration of RNA-binding proteins by RNA molecules containing expanded repeats are thought to be important contributors to disease aetiology<sup>3-9</sup>. Here we reveal that the adenosine in CAG repeat RNA can be methylated to N<sup>1</sup>-methyladenosine (m<sup>1</sup>A) by TRMT61A, and that m<sup>1</sup>A can be demethylated by ALKBH3. We also observed that the m<sup>1</sup>A/adenosine ratio in CAG repeat RNA increases with repeat length, which is attributed to diminished expression of ALKBH3 elicited by the repeat RNA. Additionally, TDP-43 binds directly and strongly with m<sup>1</sup>A in RNA, which stimulates the cytoplasmic mis-localization and formation of gel-like aggregates of TDP-43, resembling the observations made for the protein in neurological diseases. Moreover, m<sup>1</sup>A in CAG repeat RNA contributes to CAG repeat expansion-induced neurodegeneration in Caenorhabditis elegans and Drosophila. In sum, our study offers a new paradigm of the mechanism through which nucleotide repeat expansion contributes to neurological diseases and reveals a novel pathological function of m<sup>1</sup>A in RNA. These findings may provide an important mechanistic basis for therapeutic intervention in neurodegenerative diseases emanating from CAG repeat expansion.

Also flagged:nitrogenCarbonWatercalciumphosphorusmagnesium
Journal Article 2023-11-08 No Snippets Keenan SW, Beeler SR.
Show Full Abstract

Decomposing vertebrates impact ecosystems by stimulating animal, insect, and microbial scavengers, perturbing biogeochemical cycles, and transferring elements back to the environment. Most studies exploring the impacts of vertebrate decomposition focus on surface decay scenarios over timescales of days to years. Accordingly, our knowledge of ecosystem impacts of vertebrate decomposition in burial contexts and over longer time scales is limited. In 2000, six animal carcasses were buried in a shallow grave (<1.0 m) and allowed to decompose naturally until partial excavation in 2021, enabling evaluation of long-term soil biogeochemical responses to decomposing vertebrates. Soils were sampled along three vertical transects from the surface to the bone-bearing layer (~40 cm depth) and below. Comparison of the physical and chemical properties of the grave and control soils from equivalent depths indicate significant perturbations even 21 years after burial. Notably, soil pH was significantly more acidic in grave soils (p = 0.0296), and conductivity was significantly elevated (p = 0.0009). Grave soils were significantly enriched with respect to nitrogen stable isotopes, exhibiting δ15N values of 10.48 ± 3.6‰, which is ~5‰ greater than controls. Carbon and nitrogen content was also disrupted in the burial, with five times more nitrogen in the bone-bearing layer and almost double the carbon. Water and acid-based extractions of soils revealed significant differences between grave and control soils, driven largely by calcium, phosphorus (P), magnesium, and iron concentrations. P concentrations in acid extracts were significantly enriched at the bone-bearing layer, suggesting release of P from the bones. This study demonstrates that decomposition may result in long-lived impacts to burial environments and soil biogeochemistry, even after soft tissues decay. While not typically considered in ecosystem models, buried remains contribute to soils for decades or longer, and soil biogeochemistry serves a critical role in facilitating or preventing the long-term preservation of bone.

CCPG1
Also flagged:endoplasmic reticulummembraneorganelleintegral membrane proteinslipidsynthesis
Journal Article 2023-11-08 ✓ 1 Snippet Zou CX, Ma ZH, Jiang ZD, Pan ZQ, Xu DD, Suo F, Shao GC, Dong MQ, Du LL.
In-Text Gene Mentions

…FAM134C, SEC62, RTN3L,CCPG1, ATL3, TEX264, p62,…

Show Full Abstract

Selective macroautophagy of the endoplasmic reticulum (ER) and the nucleus, known as ER-phagy and nucleophagy, respectively, are processes whose mechanisms remain inadequately understood. Through an imaging-based screen, we find that in the fission yeast Schizosaccharomyces pombe, Yep1 (also known as Hva22 or Rop1), the ortholog of human REEP1-4, is essential for ER-phagy and nucleophagy but not for bulk autophagy. In the absence of Yep1, the initial phase of ER-phagy and nucleophagy proceeds normally, with the ER-phagy/nucleophagy receptor Epr1 coassembling with Atg8. However, ER-phagy/nucleophagy cargos fail to reach the vacuole. Instead, nucleus- and cortical-ER-derived membrane structures not enclosed within autophagosomes accumulate in the cytoplasm. Intriguingly, the outer membranes of nucleus-derived structures remain continuous with the nuclear envelope-ER network, suggesting a possible outer membrane fission defect during cargo separation from source compartments. We find that the ER-phagy role of Yep1 relies on its abilities to self-interact and shape membranes and requires its C-terminal amphipathic helices. Moreover, we show that human REEP1-4 and budding yeast Atg40 can functionally substitute for Yep1 in ER-phagy, and Atg40 is a divergent ortholog of Yep1 and REEP1-4. Our findings uncover an unexpected mechanism governing the autophagosomal enclosure of ER-phagy/nucleophagy cargos and shed new light on the functions and evolution of REEP family proteins.

POU3F2
Also flagged:gene expressiongestationcircadian rhythmssleepobesityanxiety
Journal Article 2023-11-08 ✓ 5 Snippets Herb BR, Glover HJ, Bhaduri A, Colantuoni C, Bale TL, Siletti K, Hodge R, Lein E, Kriegstein AR, Doege CA, Ament SA.
In-Text Gene Mentions

… representative markers: SIM1/POU3F2+ ), ventromedial…

…PVH marker genesPOU3F2, OTP ,…

…as PAX6 andPOU3F2in the cortex,…

…as SIM1 ,POU3F2, and NHLH2…

…mice, Sim1 orPou3f2knockouts are known…

Show Full Abstract

The development and diversity of neuronal subtypes in the human hypothalamus has been insufficiently characterized. To address this, we integrated transcriptomic data from 241,096 cells (126,840 newly generated) in the prenatal and adult human hypothalamus to reveal a temporal trajectory from proliferative stem cell populations to mature hypothalamic cell types. Iterative clustering of the adult neurons identified 108 robust transcriptionally distinct neuronal subtypes representing 10 hypothalamic nuclei. Pseudotime trajectories provided insights into the genes driving formation of these nuclei. Comparisons to single-cell transcriptomic data from the mouse hypothalamus suggested extensive conservation of neuronal subtypes despite certain differences in species-enriched gene expression. The uniqueness of hypothalamic neuronal lineages was examined developmentally by comparing excitatory lineages present in cortex and inhibitory lineages in ganglionic eminence, revealing both distinct and shared drivers of neuronal maturation across the human forebrain. These results provide a comprehensive transcriptomic view of human hypothalamus development through gestation and adulthood at cellular resolution.

OLFM4
Also flagged:Lgr5nucleotidespost-transcriptional gene silencingDGCR8DiGeorge syndrome critical region 8Numb
Journal Article 2023-11-08 ✓ 5 Snippets Wei X, Yu S, Zhang T, Liu L, Wang X, Wang X, Chan YS, Wang Y, Meng S, Chen YG.
In-Text Gene Mentions

…ab15580, 1:1000), rabbit anti-Olfm4(CST, 39141, 1:500),…

…the ISC markerOlfm4revealed loss of…

…the loss ofOlfm4+ ISCs shortly…

…as Lgr5 ,Olfm4, Ascl2 ,…

…stem cell markerOlfm4was downregulated (…

Show Full Abstract

Intestinal epithelium undergoes regeneration after injuries, and the disruption of this process can lead to inflammatory bowel disease and tumorigenesis. Intestinal stem cells (ISCs) residing in the crypts are crucial for maintaining the intestinal epithelium's homeostasis and promoting regeneration upon injury. However, the precise role of DGCR8, a critical component in microRNA (miRNA) biogenesis, in intestinal regeneration remains poorly understood. In this study, we provide compelling evidence demonstrating the indispensable role of epithelial miRNAs in the regeneration of the intestine in mice subjected to 5-FU or irradiation-induced injury. Through a comprehensive pooled screen of miRNA function in <i>Dgcr8</i>-deficient organoids, we observe that the loss of the miR-200 family leads to the hyperactivation of the p53 pathway, thereby reducing ISCs and impairing epithelial regeneration. Notably, downregulation of the miR-200 family and hyperactivation of the p53 pathway are verified in colonic tissues from patients with active ulcerative colitis (UC). Most importantly, the transient supply of miR-200 through the oral delivery of lipid nanoparticles (LNPs) carrying miR-200 restores ISCs and promotes intestinal regeneration in mice following acute injury. Our study implies the miR-200/p53 pathway as a promising therapeutic target for active UC patients with diminished levels of the miR-200 family. Furthermore, our findings suggest that the clinical application of LNP-miRNAs could enhance the efficacy, safety, and acceptability of existing therapeutic modalities for intestinal diseases.

HFE
Also flagged:Hepatocellular carcinomacytokeratin 19glypican-3Berlin blueironhepatocellular carcinoma
Journal Article 2023-11-08 ✓ 2 Snippets Kawaguchi N, Fuke N, Nueangphuet P, Pornthummawat A, Niazi AM, Izzati UZ, Hirai T, Yamaguchi R.
In-Text Gene Mentions

…lung metastasis showinghemochromatosisin an Egyptian…

…hepatocellular carcinoma withhemochromatosis.…

Show Full Abstract

After an Egyptian fruit bat (Rousettus aegyptiacus) in a zoo became emaciated and died, a necropsy revealed multiple nodules on the liver and lung surfaces. Microscopy revealed that the liver nodules consisted of neoplastic hepatocytes and showed metastasis in the lung lobes. Most of the neoplastic cells in the liver and lung showed positive labeling for HepPar-1, cytokeratin 19, glypican-3, and Ki-67. Hepatocellular degeneration and necrosis were diffuse in the liver parenchyma. Berlin blue staining revealed large amounts of iron in normal and neoplastic cells. Based on these pieces of evidence, this case was diagnosed as hepatocellular carcinoma with hemochromatosis. This is believed to be the first report of hepatocellular carcinoma in an Egyptian fruit bat that has been immunophenotypically examined in detail by pathological examination.

HFE
Also flagged:Runx1t1obesitygene expressionGlucagonmitochondrialendocrine disorders
Journal Article 2023-11-08 ✓ 5 Snippets Jiang N, Wang Z, Guo X, Peng Z, He Y, Wang Q, Wu H, Cui Y.
In-Text Gene Mentions

…significantly activated inHFEmice.…

…significantly increased inHFEmice than that…

…remarkably increased inHFEgroup.…

…significantly activated inHFEgroup, we analyzed…

…observably increased inHFEmice than that…

Show Full Abstract

Endurance exercise could attenuate obesity induced by high fat diet (HFD). Thus, the purpose of this study was to explore the crucial targets that play key roles in the improvement of body fat index (BFI) in obese mice by endurance exercise. Firstly, we constructed murine obesity models: High fat diet control (HFD) group, HFD exercise (HFE) group, normal chow diet control (NC) group, and normal chow diet exercise (NE) group. Next, we identified the BFI improvement related genes using differential gene analysis, and investigated these genes' functional pathways using functional enrichment analysis. The qRT-PCR and western blot assays were used to determine the gene expression and protein expression, respectively. Gene set enrichment analysis was used to explore the potential pathways associated with endurance exercise in obese mice and Mitochondrial respiratory control ratio (RCR) assay was applied to determine the RCR in the liver tissues of mice. We discovered that endurance exercise remarkably reduced the body weights and BFI of HFD-induced obese mice. Runx1t1 was related to the improvement of BFI by endurance exercise in HFD-induced obese mice. Runx1t1 mRNA and protein levels in liver tissues were observably decreased in HFD mice compared to mice in HFE, NC and NE groups. Moreover, Glucagon signaling pathway that was associated with mitochondrial function was significantly activated in HFE mice. The Runx1t1 expression exhibited an observable negative correlation with Acaca in HFD mice. Moreover, the mitochondrial RCR level was significantly increased in HFE mice than that in HFD mice. In HFD-induced obese mice, Runx1t1 was implicated in the improvement of BFI via endurance exercise. Endurance exercise could improve mitochondrial dysfunction in obese mice by activating the Runx1t1.

DCC
Also flagged:Pax2mitosiscell cyclesonic hedgehogShhglial cell-derived neurotrophic factor
Journal Article 2023-11-08 ✓ 1 Snippet Schilling K.
In-Text Gene Mentions

…Cdh13, Cntn3, andDcc) and three splicing-associate…

Show Full Abstract

The present review aims to provide a short update of our understanding of the inhibitory interneurons of the cerebellum. While these cells constitute but a minority of all cerebellar neurons, their functional significance is increasingly being recognized. For one, inhibitory interneurons of the cerebellar cortex are now known to constitute a clearly more diverse group than their traditional grouping as stellate, basket, and Golgi cells suggests, and this diversity is now substantiated by single-cell genetic data. The past decade or so has also provided important information about interneurons in cerebellar nuclei. Significantly, developmental studies have revealed that the specification and formation of cerebellar inhibitory interneurons fundamentally differ from, say, the cortical interneurons, and define a mode of diversification critically dependent on spatiotemporally patterned external signals. Last, but not least, in the past years, dysfunction of cerebellar inhibitory interneurons could also be linked with clinically defined deficits. I hope that this review, however fragmentary, may stimulate interest and help focus research towards understanding the cerebellum.

SLC2A14
Also flagged:optic nerve injuryPrimary open‑angle glaucomaPOAGpathogenesisnitric oxidevasopressin
Journal Article 2023-11-08 ✓ 1 Snippet Zhou X, Zhang F, Zhang X, Zhou D, Zhao Y, Chen B, Duan X.
In-Text Gene Mentions

…overlapping the genesSLC2A14and SLC2A3 as…

Show Full Abstract

<h4>Background</h4>Trabecular meshwork (TM) dysfunction-induced elevation of intraocular pressure has been identified as the main risk factor of irreversible optic nerve injury in Primary open‑angle glaucoma (POAG). Increasing evidences suggest that microRNA (miRNA) plays a vital role in the pathogenesis of POAG. This study aims to construct a miRNA-mRNA regulatory network and identify biomarkers for POAG.<h4>Methods</h4>miRNAs and mRNAs expression profiling of TM samples from controls and POAG patients were assessed through microarray analysis. Target genes of differentially expressed miRNAs (DEmiRNAs) were predicted by miEAA and miRNet. Then GO and KEGG pathway analysis of differentially expressed mRNAs (DEmRNAs) were performed. PPI of top 30 hub genes was identified and miRNA-mRNA network was established by STRING database and Cytoscape software. GSE27276 and GSE105269 datasets were used to verify the expression of hub genes and to predict potential biomarkers in TM and aqueous humor (AH) for POAG, respectively. Finally, GSEA analysis was conducted to estimate the main signaling pathway of POAG pathogenesis.<h4>Results</h4>A total of 29 up-regulated and 7 down-regulated miRNAs, 923 up-regulated and 887 down-regulated mRNAs were identified in TM of POAG compared with controls. Target genes and DEmRNAs were mainly enriched in nitric oxide biosynthetic process, vasopressin-regulated water reabsorption, and so on. Through miRNA-mRNA network construction, top 30 hub genes were regulated by 24 DEmiRNAs. 8 genes were aberrantly expressed in dataset GSE27276. 3 genes (CREB1, CAPZA2, SLC2A3) and 2 miRNAs (miR-106b-5p, miR-15a-5p) were identified as potential biomarkers for POAG in TM and AH, respectively. GSEA analysis revealed that these 3 genes modulated POAG through different pathways.<h4>Conclusion</h4>In this study, construction of miRNA-mRNA network and identification of biomarkers provide a novel insight into the pathogenesis, early diagnosis and treatment for POAG.

Also flagged:Synthesishydroxyapatitecalciumphosphorushydroxylmineral
Journal Article 2023-11-08 No Snippets Azzaoui K, Jodeh S, Mejdoubi E, Hammouti B, Taleb M, Ennabety G, Berisha A, Aaddouz M, Youssouf MH, Shityakov S, Sabbahi R, Algarra M.
Show Full Abstract

In this work, we presented a synthesis of a composite based on HAp and PEG 6000 using a new method of synthesis dissolution precipitation to be applied for application of wastewater purification from toxic metal ions. Multiple characterization methods were used to analyze the morphology and the structure of the well-prepared compounds including FT-IR, Raman, XRD, XPS, TGA and SEM were used to conduct a composite analysis. The adsorption effectiveness of this analysis towards Pb<sup>2+</sup> and various other hazardous metal ions found in sewage was assessed. Batch experiments were conducted to optimize the various operational parameters including adsorbent dose, temperature, pH, contact time, and initial concentration. The Langmuir isotherm was used to fit the data, and it predicted monolayer adsorption with a maximum capacity of 67 mg g<sup>-1</sup> for HAP PEG600 and 60 mg g<sup>-1</sup> for HAp. A pseudo-second-order equation fits the adsorption process well (0.961-0.971). The thermodynamic data support the spontaneous metal bonding to the composite receptor sites. Theoretical calculations showed that the interaction strength is very strong and gets stronger when the PEG6000 is deprotonated. The results presented here are supported by evidence acquired from experiments. Theoretical computation using Monte Carlo (MC) and Molecular Dynamic (MD) simulation models showed excellent affinity of prepared foams for the model ion Pb<sup>2+</sup> with highly negative adsorption energy values indicating vigorous interactions of Pb<sup>2+</sup> with the adsorbate surfaces.

HTT
Also flagged:pattern recognition receptorsToll-like receptor 9TLR9IFI16RNA polymerase IIIcyclic GMP-AMP synthase
Journal Article 2023-11-08 ✓ 3 Snippets Huang Y, Liu B, Sinha SC, Amin S, Gan L.
In-Text Gene Mentions

The mutant HTT protein (mHTT) is ubiquitously present and affects multiple cellular processes, including transcriptional regulation, microtubule-based transport, and proteostasis, leading to damage in the brain’s striatum and resulting in motor, psychiatric, and cognitive deficits [61].

HD is caused by a dominantly inherited CAG (cytosine-adenine-guanine) repeat expansion mutation of the huntingtin gene (HTT).

…MutantHTT

Show Full Abstract

DNA sensing is a pivotal component of the innate immune system that is responsible for detecting mislocalized DNA and triggering downstream inflammatory pathways. Among the DNA sensors, cyclic GMP-AMP synthase (cGAS) is a primary player in detecting cytosolic DNA, including foreign DNA from pathogens and self-DNA released during cellular damage, culminating in a type I interferon (IFN-I) response through stimulator of interferon genes (STING) activation. IFN-I cytokines are essential in mediating neuroinflammation, which is widely observed in CNS injury, neurodegeneration, and aging, suggesting an upstream role for the cGAS DNA sensing pathway. In this review, we summarize the latest developments on the cGAS-STING DNA-driven immune response in various neurological diseases and conditions. Our review covers the current understanding of the molecular mechanisms of cGAS activation and highlights cGAS-STING signaling in various cell types of central and peripheral nervous systems, such as resident brain immune cells, neurons, and glial cells. We then discuss the role of cGAS-STING signaling in different neurodegenerative conditions, including tauopathies, Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis, as well as aging and senescence. Finally, we lay out the current advancements in research and development of cGAS inhibitors and assess the prospects of targeting cGAS and STING as therapeutic strategies for a wide spectrum of neurological diseases.

Also flagged:STINGinfectionscancerneurological diseasesStimulator of interferon genestransmembrane
Journal Article 2023-11-08 No Snippets Yang K, Tang Z, Xing C, Yan N.
Show Full Abstract

Stimulator of interferon genes (STING) is an innate immune signaling protein critical to infections, autoimmunity, and cancer. STING signaling is also emerging as an exciting and integral part of many neurological diseases. Here, we discuss recent advances in STING signaling in the brain. We summarize how molecular threats activate STING signaling in the diseased brain and how STING signaling activities in glial and neuronal cells cause neuropathology. We also review human studies of STING neurobiology and consider therapeutic challenges in targeting STING to treat neurological diseases.

HFE
Also flagged:oleic acidironferroptosislipidpolyunsaturated fatty acylphospholipids
Journal Article 2023-11-08 ✓ 1 Snippet Mann J, Reznik E, Santer M, Fongheiser MA, Smith N, Hirschhorn T, Zandkarimi F, Soni RK, Dafré AL, Miranda-Vizuete A, Farina M, Stockwell BR.
In-Text Gene Mentions

HFE

Show Full Abstract

Iron overload, characterized by accumulation of iron in tissues, induces a multiorgan toxicity whose mechanisms are not fully understood. Using cultured cell lines, Caenorhabditis elegans, and mice, we found that ferroptosis occurs in the context of iron-overload-mediated damage. Exogenous oleic acid protected against iron-overload-toxicity in cell culture and Caenorhabditis elegans by suppressing ferroptosis. In mice, oleic acid protected against FAC-induced liver lipid peroxidation and damage. Oleic acid changed the cellular lipid composition, characterized by decreased levels of polyunsaturated fatty acyl phospholipids and decreased levels of ether-linked phospholipids. The protective effect of oleic acid in cells was attenuated by GW6471 (PPAR-α antagonist), as well as in Caenorhabditis elegans lacking the nuclear hormone receptor NHR-49 (a PPAR-α functional homologue). These results highlight ferroptosis as a driver of iron-overload-mediated damage, which is inhibited by oleic acid. This monounsaturated fatty acid represents a potential therapeutic approach to mitigating organ damage in iron overload individuals.

SERPINC1
Also flagged:KIFC1ESCCtransportationEsophageal squamous cell carcinomacancercarcinoma
Journal Article 2023-11-08 ✓ 1 Snippet Du B, Wei L, Wang J, Li Y, Huo J, Wang J, Wang P.
In-Text Gene Mentions

…KIFC1 (Kinesin Family Member C1Family Member C1)…

Show Full Abstract

Esophageal squamous cell carcinoma (ESCC) accounts for over 90% of total in China, and the five-year survival rate for patients is less than 30%. Accordingly, the identification of novel, effective early diagnosis markers and therapeutic targets for ESCC is of paramount importance. KIFC1 has been identified as highly expressed in several types of cancer, although its prognostic value is inconsistent, and no research has been conducted specifically on its effect on ESCC. To investigate the expression and function of KIFC1 in ESCC, we conducted immunohistochemical staining on 30 pairs of para-carcinoma tissue and cancerous tissues, revealing a significant increase in KIFC1 expression in ESCC tissues. Using siRNA to knock down KIFC1 significantly reduced the proliferation of EC109 ESCC cells both <i>in vitro</i> and <i>in vivo</i>. Bioinformatics analysis revealed a highly significant positive correlation between KIFC1 overexpression and signaling pathways associated with tumor proliferation pathways. In EC109 cells, overexpression of KIFC1 significantly increased the rate of centrosome amplification and the likelihood of pseudo-bipolar division. Furthermore, the expression of KIFC1 and the rate of centrosome amplification in ESCC tissues were also positively correlated. In order to explore the underline molecular mechanisms, we identified, through proteomics, that KIFC1 binds to the protein Aurora B. The knockdown of KIFC1 significantly reduced the distribution of Aurora B on the metaphase plate and substantially inhibited the phosphorylation of its classical substrate, Histone H3. In conclusion, these findings indicate the potential utility of KIFC1 as both a tumor marker and a promising target for therapeutic interventions.

Also flagged:hematopoiesisbonebone metastasesosteoporosisosteoarthritiswater
Journal Article 2023-11-08 No Snippets De Leon-Oliva D, Boaru DL, Perez-Exposito RE, Fraile-Martinez O, García-Montero C, Diaz R, Bujan J, García-Honduvilla N, Lopez-Gonzalez L, Álvarez-Mon M, Saz JV, de la Torre B, Ortega MA.
Show Full Abstract

Bone and cartilage tissue play multiple roles in the organism, including kinematic support, protection of organs, and hematopoiesis. Bone and, above all, cartilaginous tissues present an inherently limited capacity for self-regeneration. The increasing prevalence of disorders affecting these crucial tissues, such as bone fractures, bone metastases, osteoporosis, or osteoarthritis, underscores the urgent imperative to investigate therapeutic strategies capable of effectively addressing the challenges associated with their degeneration and damage. In this context, the emerging field of tissue engineering and regenerative medicine (TERM) has made important contributions through the development of advanced hydrogels. These crosslinked three-dimensional networks can retain substantial amounts of water, thus mimicking the natural extracellular matrix (ECM). Hydrogels exhibit exceptional biocompatibility, customizable mechanical properties, and the ability to encapsulate bioactive molecules and cells. In addition, they can be meticulously tailored to the specific needs of each patient, providing a promising alternative to conventional surgical procedures and reducing the risk of subsequent adverse reactions. However, some issues need to be addressed, such as lack of mechanical strength, inconsistent properties, and low-cell viability. This review describes the structure and regeneration of bone and cartilage tissue. Then, we present an overview of hydrogels, including their classification, synthesis, and biomedical applications. Following this, we review the most relevant and recent advanced hydrogels in TERM for bone and cartilage tissue regeneration.

Also flagged:Sebaceous gland carcinomasskin tumorseyelid tumorsbasal cell carcinomassebaceous carcinomassquamous cell carcinomas
Journal Article 2023-11-08 No Snippets Sangiorgi E, Giannuzzi F, Molinario C, Rapari G, Riccio M, Cuffaro G, Castri F, Benvenuto R, Genuardi M, Massi D, Savino G.
Show Full Abstract

Personalized medicine aims to develop tailored treatments for individual patients based on specific mutations present in the affected organ. This approach has proven paramount in cancer treatment, as each tumor carries distinct driver mutations that respond to targeted drugs and, in some cases, may confer resistance to other therapies. Particularly for rare conditions, personalized medicine has the potential to revolutionize treatment strategies. Rare cancers often lack extensive datasets of molecular and pathological information, large-scale trials for novel therapies, and established treatment guidelines. Consequently, surgery is frequently the only viable option for many rare tumors, when feasible, as traditional multimodal approaches employed for more common cancers often play a limited role. Sebaceous carcinoma of the eyelid is an exceptionally rare cancer affecting the eye's adnexal tissues, most frequently reported in Asia, but whose prevalence is significantly increasing even in Europe and the US. The sole established curative treatment is surgical excision, which can lead to significant disfigurement. In cases of metastatic sebaceous carcinoma, validated drug options are currently lacking. In this project, we set out to characterize the mutational landscape of two sebaceous carcinomas of the eyelid following surgical excision. Utilizing available bioinformatics tools, we demonstrated our ability to identify common features promptly and accurately in both tumors. These features included a Base-Excision Repair mutational signature, a notably high tumor mutational burden, and key driver mutations in somatic tissues. These findings had not been previously reported in similar studies. This report underscores how, in the case of rare tumors, it is possible to comprehensively characterize the mutational landscape of each individual case, potentially opening doors to targeted therapeutic options.

PTGIS
Also flagged:visionagingEEF1E1PAFAH1B1OGFRcell proliferation
Journal Article 2023-11-08 ✓ 1 Snippet Lu B.
In-Text Gene Mentions

…and lizards (PTGISand PTGS1 )…

Show Full Abstract

The extant amphibians have developed uncanny abilities to adapt to their environment. I compared the genes of amphibians to those of other vertebrates to investigate the genetic changes underlying their unique traits, especially salamanders' regeneration and longevity. Using the well-supported Batrachia tree, I found that salamander genomes have undergone accelerated adaptive evolution, especially for development-related genes. The group-based comparison showed that several genes are under positive selection, rapid evolution, and unexpected parallel evolution with traits shared by distantly related species, such as the tail-regenerative lizard and the longer-lived naked mole rat. The genes, such as <i>EEF1E1</i>, <i>PAFAH1B1</i>, and <i>OGFR</i>, may be involved in salamander regeneration, as they are involved in the apoptotic process, blastema formation, and cell proliferation, respectively. The genes <i>PCNA</i> and <i>SIRT1</i> may be involved in extending lifespan, as they are involved in DNA repair and histone modification, respectively. Some genes, such as <i>PCNA</i> and <i>OGFR</i>, have dual roles in regeneration and aging, which suggests that these two processes are interconnected. My experiment validated the time course differential expression pattern of <i>SERPINI1</i> and <i>OGFR</i>, two genes that have evolved in parallel in salamanders and lizards during the regeneration process of salamander limbs. In addition, I found several candidate genes responsible for frogs' frequent vocalization and caecilians' degenerative vision. This study provides much-needed insights into the processes of regeneration and aging, and the discovery of the critical genes paves the way for further functional analysis, which could open up new avenues for exploiting the genetic potential of humans and improving human well-being.

SERPINC1
Also flagged:KIFC1HSETAndrogen ReceptorBreast CancersQuadruple-negative breast cancerAR
Journal Article 2023-11-08 ✓ 1 Snippet Jinna N, Yuan YC, Rida P.
In-Text Gene Mentions

Kinesin Family Member C1Family Member C1…

Show Full Abstract

Quadruple-negative breast cancer (QNBC) lacks traditional actionable targets, including androgen receptor (AR). QNBC disproportionately afflicts and impacts patients of African genetic ancestry. Kinesin family member C1 (KIFC1/HSET), a centrosome clustering protein that prevents cancer cells from undergoing centrosome-amplification-induced apoptosis, has been reported to be upregulated in TNBCs and African-American (AA) TNBCs. Herein, we analyzed KIFC1 RNA levels and their associations with clinical features and outcomes among AR-low and AR-high TNBC tumors in three distinct publicly available gene expression datasets and in the breast cancer gene expression database (bc-GenExMiner). KIFC1 levels were significantly higher in AR-low and basal-like TNBCs than in AR-high and non-basal-like TNBCs, irrespective of the stage, grade, tumor size, and lymph node status. KIFC1 levels were also upregulated in AR-low tumors relative to AR-high tumors among Black and premenopausal women with TNBC. High KIFC1 levels conferred significantly shorter overall survival, disease-free survival, and distant metastasis-free survival among AR-low and basal-like TNBC patients in Kaplan-Meier analyses. In conclusion, KIFC1 levels may be upregulated in AR-low tumors and, specifically, in those of African descent, wherein it may promote poor outcomes. KIFC1 may be an actionable cancer-cell-specific target for the AR-low TNBC subpopulation and could aid in alleviating racial disparities in TNBC outcomes.

SOX6
Also flagged:S-Adenosylhomocysteine HydrolaseWnthypermethioninemiadevelopmental delayAHCYcolon cancer
Journal Article 2023-11-08 ✓ 2 Snippets Pavičić I, Rokić F, Vugrek O.
In-Text Gene Mentions

Furthermore, the presence of such connections in other cellular systems and the known involvement of SOX6 (a paralog of SOX2) in Wnt signaling, strengthens the importance of these findings within the broader context of cell regulation and signaling pathways in the tumor microenvironment.

…known involvement ofSOX6(a paralog of…

Show Full Abstract

S-adenosylhomocysteine hydrolase (AHCY) deficiency results mainly in hypermethioninemia, developmental delay, and is potentially fatal. In order to shed new light on molecular aspects of AHCY deficiency, in particular any changes at transcriptome level, we enabled knockdown of AHCY expression in the colon cancer cell line SW480 to simulate the environment occurring in AHCY deficient individuals. The SW480 cell line is well known for elevated AHCY expression, and thereby represents a suitable model system, in particular as AHCY expression is regulated by MYC, which, on the other hand, is involved in Wnt signaling and the regulation of Wnt-related genes, such as the β-catenin co-transcription factor LEF1 (lymphoid enhancer-binding factor 1). We selected LEF1 as a potential target to investigate its association with S-adenosylhomocysteine hydrolase deficiency. This decision was prompted by our analysis of RNA-Seq data, which revealed significant changes in the expression of genes related to the Wnt signaling pathway and genes involved in processes responsible for epithelial-mesenchymal transition (EMT) and cell proliferation. Notably, LEF1 emerged as a common factor in these processes, showing increased expression both on mRNA and protein levels. Additionally, we show alterations in interconnected signaling pathways linked to LEF1, causing gene expression changes with broad effects on cell cycle regulation, tumor microenvironment, and implications to cell invasion and metastasis. In summary, we provide a new link between AHCY deficiency and LEF1 serving as a mediator of changes to the Wnt signaling pathway, thereby indicating potential connections of AHCY expression and cancer cell phenotype, as Wnt signaling is frequently associated with cancer development, including colorectal cancer (CRC).

VRK2
Also flagged:sleepcircadian rhythmsobstructive sleep apneamethylationdepressionsleep-related diseases
Journal Article 2023-11-08 ✓ 2 Snippets Tao Y, Qin Y, Chen S, Xu T, Lin J, Su D, Yu W, Chen X.
In-Text Gene Mentions

Vaccinia-related kinase 2kinase 2 (…

…kinase 2 (VRK2), associated with…

Show Full Abstract

<h4>Background</h4>Sleep is an important biological process and has been linked to many diseases; however, very little is known about which and how genes control and regulate sleep. Although technology has seen significant development, this issue has still not been adequately resolved. Therefore, we conducted a bibliometric analysis to assess the progress in research on sleep quality and associated genes over the past 2 decades. Through our statistical data and discussions, we aimed to provide researchers with better research directions and ideas, thus promoting the advancement of this field.<h4>Methods</h4>On December 29, 2022, we utilized bibliometric techniques, such as co-cited and cluster analysis and keyword co-occurrence, using tools such as CiteSpace, VOSviewer, and the Online Analysis Platform of Literature Metrology (http://bibliometric.com/), to conduct a thorough examination of the relevant publications extracted from the Web of Science Core Collection (WoSCC). Our analysis aimed to identify the emerging trends and hot spots in this field while also predicting their potential development in future.<h4>Results</h4>Cluster analysis of the co-cited literature revealed the most popular terms relating to sleep quality and associated genes in the manner of cluster labels; these included genome-wide association studies (GWAS), circadian rhythms, obstructive sleep apnea (OSA), DNA methylation, and depression. Keyword burst detection suggested that obstructive sleep apnea, circadian clock, circadian genes, and polygenic risk score were newly emergent research hot spots.<h4>Conclusion</h4>Based on this bibliometric analysis of the publications in the last 20 years, a comprehensive analysis of the literature clarified the contributions, changes in research hot spots, and evolution of research techniques regarding sleep quality and associated genes. This research can provide medical staff and researchers with revelations into future directions of the study on the pathological mechanisms of sleep-related diseases.

PRDX6
Also flagged:peptidespolycystic ovary syndromePCOSpathogenesispeptidepolycystic ovarian syndrome
Journal Article 2023-11-08 ✓ 2 Snippets Sun N, Chen Y, Lu L, Yan H, Zhou J, Li K, Zhang W, Yuan L, Heng BC, Zeng W, Shi Y, Tong G, Yin P.
In-Text Gene Mentions

…HSPE1, HSP90B1, PKM,PRDX6, PRDX3 and EEF2.…

PRDX6and PRDX3 belong…

Show Full Abstract

<b>Objective:</b> The aim of this study was to analyze and compare the differential expression of peptides within the follicular fluid of polycystic ovary syndrome (PCOS) patients <i>versus</i> normal women by using peptidomics techniques. The underlying mechanisms involved in PCOS pathogenesis will be explored, together with screening and identification of potential functional peptides via bioinformatics analysis. <b>Materials and methods:</b> A total of 12 patients who underwent <i>in vitro</i> fertilization and embryo transfer (IVF-ET) at the Reproductive Medicine Center of Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine from 1 September 2022 to 1 November 2022 were included in this study. The follicular fluid of PCOS patients (<i>n</i> = 6) and normal women (<i>n</i> = 6) were collected. The presence and concentration differences of various peptides were detected by the LC-MS/MS method. GO and KEGG analysis were performed on the precursor proteins of the differentially-expressed peptides, and protein network interaction analysis was carried out to identify functionally-relevant peptides among the various peptides. <b>Results:</b> A variety of peptides within the follicular fluid of PCOS <i>versus</i> normal patients were detected by peptidomics techniques. Altogether, 843 upregulated peptides and 236 downregulated peptides were detected (absolute fold change ≥2 and <i>p</i> < 0.05). Of these, 718 (718 = 488 + 230) peptides were only detected in the PCOS group, while 205 (205 = 174 + 31) were only detected in the control group. Gene Ontology enrichment and pathway analysis were performed to characterize peptides through their precursor proteins. We identified 18 peptides from 7 precursor proteins associated with PCOS, and 4 peptide sequences were located in the functional domains of their corresponding precursor proteins. <b>Conclusion:</b> In this study, differences in the follicular development of PCOS <i>versus</i> normal patients were revealed from the polypeptidomics of follicular development, which thus provided new insights for future studies on the pathological mechanisms of PCOS development.

Also flagged:gold nanoparticlescyclodextrinssynthesisciprofloxacinosteomyelitisinfectious diseases
Journal Article 2023-11-08 No Snippets Bobrowska K, Sadowska K, Stolarczyk K, Prześniak-Welenc M, Golec P, Bilewicz R.
Show Full Abstract

<h4>Introduction</h4>Hybrid nanoflowers are structures consisting of organic (enzymes, proteins, nucleic acids) and inorganic components (mostly metal phosphates) with a flower-like hierarchical structure. Novel hybrid nanoflowers based on bovine serum albumin (BSA) and hydroxyapatite (HA) were obtained and characterized. Study on BSA-HA nanoflowers as potential drug delivery system is reported for the first time.<h4>Methods</h4>Embedding ciprofloxacin in the structure of hybrid nanoflowers was confirmed by ATR-FTIR and thermogravimetric analysis. The inorganic phase of the nanoflowers was determined by X-ray diffraction. UV‒Vis spectroscopy was used to evaluate the release profiles of ciprofloxacin from nanoflowers in buffer solutions at pH 7.4 and 5. The agar disk diffusion method was used to study the antibacterial activity of the synthesized nanoflowers against <i>Staphylococcus aureus</i> and <i>Pseudomonas aeruginosa</i>.<h4>Results</h4>Bovine serum albumin - hydroxyapatite nanoflowers were obtained with diameters of ca. 1-2 µm. The kinetics of ciprofloxacin release from nanoflowers were described by the Korsmeyer-Peppas model. The antibacterial activity of the synthesized nanoflowers was demonstrated against <i>S. aureus</i> and <i>P. aeruginosa</i>, two main pathogens found in osteomyelitis.<h4>Conclusion</h4>The formulated nanoflowers may act as an efficient local antibiotic delivery system. Due to the use of nonhazardous, biodegradable components and benign synthesis, hybrid nanoflowers are very promising drug delivery systems that could be applied in the treatment of skeletal system infections.

SHISA6DCC
Also flagged:Rett syndromegeneticneurodevelopmental disordergene expressionsF8A3CNTN6
Journal Article 2023-11-08 ✓ 3 Snippets Odabasi YC, Yanasik S, Saglam-Metiner P, Kaymaz Y, Yesil-Celiktas O.
In-Text Gene Mentions

…eurotransmitter interactions (SHISA6, SHH, FOXG1, CACNG4,…

…together with EPHA6,DCC, NTN1, FLRT1, and…

…nervous system, whereDCCand UNC5 receptors…

Show Full Abstract

Rett syndrome (RTT) is a rare genetic neurodevelopmental disorder that has no cure apart from symptomatic treatments. While intense research efforts are required to fulfill this unmet need, the fundamental challenge is to obtain sufficient patient data. In this study, we used human transcriptomic data of four different sample types from RTT patients including induced pluripotent stem cells, differentiated neural progenitor cells, differentiated neurons, and postmortem brain tissues with an increasing in vivo-like complexity to unveil specific trends in gene expressions across the samples. Based on DEG analysis, we identified F8A3, CNTN6, RPE65, and COL19A1 to have differential expression levels in three sample types and also observed previously reported genes such as MECP2, FOXG1, CACNA1G, SATB2, GABBR2, MEF2C, KCNJ10, and CUX2 in our study. Considering the significantly enriched pathways for each sample type, we observed a consistent increase in numbers from iPSCs to NEUs where MECP2 displayed profound effects. We also validated our GSEA results by using single-cell RNA-seq data. In WGCNA, we elicited a connection among MECP2, TNRC6A, and HOXA5. Our findings highlight the utility of transcriptomic analyses to determine genes that might lead to therapeutic strategies.

Also flagged:Alzheimer's diseaseADneurodegenerative disorderagingdementiaCognitive Impairment
Journal Article 2023-11-08 No Snippets Feng L, Sun J, Xia L, Shi Q, Hou Y, Zhang L, Li M, Fan C, Sun B.
Show Full Abstract

Regulated cell death is a genetically determined form of programmed cell death that commonly occurs during the development of living organisms. This process plays a crucial role in modulating homeostasis and is evolutionarily conserved across a diverse range of living organisms. Ferroptosis is a classic regulatory mode of cell death. Extensive studies of regulatory cell death in Alzheimer's disease have yielded increasing evidence that ferroptosis is closely related to the occurrence, development, and prognosis of Alzheimer's disease. This review summarizes the molecular mechanisms of ferroptosis and recent research advances in the role of ferroptosis in Alzheimer's disease. Our findings are expected to serve as a theoretical and experimental foundation for clinical research and targeted therapy for Alzheimer's disease.

medRxiv 2023-11-08 Preprint (No Snippets API) Nguyen TH, Nguyen TA, Tran NH, Nguyen Hoang V, Dao HTT, Tran V, Nguyen YN, Nguyen AT, Nguyen Thi CT, Do Thi TT, Nguyen DS, Nguyen H, Giang H, Tu LN.
Show Full Abstract

<h4>abstract</h4> <h4>Background</h4> Biomarker testing has gradually become standard of care in precision oncology to help physicians select optimal treatment for patients. Compared to single-gene or small gene panel testing, comprehensive genomic profiling (CGP) has emerged as a more time- and tissue-efficient method. This study demonstrated in-depth analytical validation of K-4CARE, a CGP assay that integrates circulating tumor DNA (ctDNA) tracking for residual cancer surveillance. <h4>Methods</h4> The assay utilized a panel of 473 cancer-relevant genes with a total length of 1.7 Mb. Reference standards were used to evaluate limit of detection (LOD), concordance, sensitivity, specificity and precision of the assay to detect single nucleotide variants (SNVs), small insertion/deletions (Indels), gene amplification and fusion, microsatellite instability (MSI) and tumor mutational burden (TMB). The assay was then benchmarked against orthogonal methods using 155 clinical samples from 10 cancer types. In selected cancers, top tumor-derived somatic mutations, as ranked by our proprietary algorithm, were used to detect ctDNA in the plasma. <h4>Results</h4> For detection of somatic SNVs and Indels, gene fusion and amplification, the assay had sensitivity of >99%, 94% and >99% respectively, and specificity of >99%. Detection of germline variants also achieved sensitivity and specificity of >99%. For TMB measurement, the correlation coefficient between whole-exome sequencing and our targeted panel was 97%. MSI analysis when benchmarked against polymerase chain reaction method showed sensitivity of 94% and specificity of >99%. The concordance between our assay and the TruSight Oncology 500 assay for detection of somatic variants, TMB and MSI measurement was 100%, 89% and 98% respectively. When CGP-informed mutations were used to personalize ctDNA tracking, the detection rate of ctDNA in liquid biopsy was 79%, and clinical utility in cancer surveillance was demonstrated in 2 case studies. <h4>Conclusions</h4> K-4CARE TM assay provides comprehensive and reliable genomic information that fulfills all guideline-based biomarker testing for both targeted therapy and immunotherapy. Integration of ctDNA tracking helps clinicians to further monitor treatment response and ultimately provide well-rounded care to cancer patients.

Also flagged:histiocytosispathogenesisSETBP1haematopoiesisErdheim Chester diseaseErdheim-Chester disease
Journal Article 2023-11-07 No Snippets Martínez-López J, Márquez A, Pegoraro F, Ortiz-Fernández L, Acosta-Herrera M, Kerick M, Gelain E, Diamond EL, Durham BH, Abdel-Wahab O, Go RS, Koster MJ, Dagna L, Campochiaro C, Collin M, Milne P, Estrada-Veras JI, O'Brien K, Papo M, Cohen-Aubar F, Amoura Z, Haroche J, Martín J, Vaglio A.
Show Full Abstract

<h4>Objective</h4>Erdheim-Chester disease (ECD) is rare histiocytosis with a wide range of clinical manifestations. Somatic mutations are key to the pathogenesis of the disease; however, the relationship between germline genetic variants and ECD has not been examined so far. The present study aims to explore the inherited genetic component of ECD by performing the first genome-wide association study.<h4>Methods</h4>After quality controls, a cohort of 255 patients with ECD and 7,471 healthy donors was included in this study. Afterward, a logistic regression followed by in silico functional annotation was performed.<h4>Results</h4>A signal at the 18q12.3 genomic region was identified as a new susceptibility locus for ECD (P = 2.75 × 10<sup>-11</sup> ; Odds Ratio = 2.09). This association was annotated to the SETBP1 gene, which is involved in clonal haematopoiesis. Functional annotation of this region and of the identified suggestive signals revealed additional genes that could be potentially involved in the pathogenesis of the disease.<h4>Conclusion</h4>Overall, this work demonstrates that germline genetic variants can impact on the development of ECD and suggests new pathways with a potential pathogenic role.

Also flagged:Artesunateartemisininmalariaesterchloroquineoxygen
Journal Article 2023-11-07 No Snippets Munnik BL, Kaschula CH, Harding CR, Chellan P.
Show Full Abstract

Artesunate (Ars) is a semisynthetic antimalarial drug and is a part of the artemisinin-based combination therapy arsenal employed for malaria treatment. The drug functions mainly by activation of its endoperoxide bridge leading to increased oxidative stress in malaria parasites. The purpose of this study was to ascertain the antiparasitic effects of combining ferrocene and Ars<i>via</i> short or long chain ester or amide linkages (C1-C4). The compounds were evaluated for growth inhibition activity on the apicomplexan parasites, <i>Plasmodium falciparum</i> (<i>P. falciparum</i>) and <i>Toxoplasma gondii</i> (<i>T. gondii</i>). All the complexes demonstrated good activity against <i>T. gondii</i> with IC<sub>50</sub> values in the low micromolar range (0.28-1.2 μM) and good to excellent antimalarial activity against a chloroquine sensitive strain of <i>P. falciparum</i> (NF54). Further investigations on <i>T. gondii</i> revealed that the likely mode of action (MoA) is through the generation of reactive oxygen species. Additionally, immunofluorescence microscopy suggested a novel change in the morphology of the parasite by complex C3, an artesunate-ferrocenyl ethyl amide complex. The complexes were not cytotoxic or showed low cytotoxicity to two normal cell lines tested.

ARFGEF2
Also flagged:ADP Ribosylation Factor 4Arf4N-CadherinArf5Arf small GTPasemembrane
Journal Article 2023-11-07 ✓ 5 Snippets Hara Y, Katsuyama T, Fukaya M, Sugawara T, Shiroshima T, Sadakata T, Osumi N, Sakagami H.
In-Text Gene Mentions

Lastly, mutations in the human genes for ARFGEF2 and ARF1 have been associated with cortical malformations, including periventricular nodular heterotopia and microcephaly, indicating that the ARFGEF2-Arf1 pathway is critical for cerebral cortical development (Sheen et al., 2004; Gana et al., 2022).

Concerning the roles of Arfs in cortical development, mutations in human genes for ARF1 and its GEF, ARFGEF2, have been linked to periventricular nodular heterotopia, suggesting the involvement of Arf1 in cortical radial migration (Sheen et al., 2004; Gana et al., 2022).

…and its GEF,ARFGEF2, have been linked…

…human genes forARFGEF2and ARF1 have…

…indicating that theARFGEF2-Arf1 pathway is critical…

Show Full Abstract

During the development of the cerebral cortex, N-cadherin plays a crucial role in facilitating radial migration by enabling cell-to-cell adhesion between migrating neurons and radial glial fibers or Cajar-Reztius cells. ADP ribosylation factor 4 (Arf4) and Arf5, which belong to the Class II Arf small GTPase subfamily, control membrane trafficking in the endocytic and secretory pathways. However, their specific contribution to cerebral cortex development remains unclear. In this study, we sought to investigate the functional involvement of Class II Arfs in radial migration during the layer formation of the cerebral cortex using mouse embryos and pups. Our findings indicate that knock-down of Arf4, but not Arf5, resulted in the stalling of transfected neurons with disorientation of the Golgi in the upper intermediate zone (IZ) and reduction in the migration speed in both the IZ and cortical plate (CP). Migrating neurons with Arf4 knock-down exhibited cytoplasmic accumulation of N-cadherin, along with disturbed organelle morphology and distribution. Furthermore, supplementation of exogenous N-cadherin partially rescued the migration defect caused by Arf4 knock-down. In conclusion, our results suggest that Arf4 plays a crucial role in regulating radial migration via N-cadherin trafficking during cerebral cortical development.

VRK2
Also flagged:immune responsemitochondrialmitochondriacytosolcGASSTING
Journal Article 2023-11-07 ✓ 2 Snippets Hu MM, Shu HB.
In-Text Gene Mentions

Deficiency of VRK2, which is a regulator of VDAC1 oligomerization and mtDNA release, renders mice more susceptible to infection with both the DNA virus HSV-1 and the RNA virus EMCV [121].

…8-oxoguanine DNA glycosylase,VRK2vaccinia related kinase…

Show Full Abstract

Various cellular stress conditions trigger mitochondrial DNA (mtDNA) release from mitochondria into the cytosol. The released mtDNA is sensed by the cGAS-MITA/STING pathway, resulting in the induced expression of type I interferon and other effector genes. These processes contribute to the innate immune response to viral infection and other stress factors. The deregulation of these processes causes autoimmune diseases, inflammatory metabolic disorders and cancer. Therefore, the cGAS-MITA/STING pathway is a potential target for intervention in infectious, inflammatory and autoimmune diseases as well as cancer. In this review, we focus on the mechanisms underlying the mtDNA-triggered activation of the cGAS-MITA/STING pathway, the effects of the pathway under various physiological and pathological conditions, and advances in the development of drugs that target cGAS and MITA/STING.

TNFSF4
Also flagged:OX40TRAF6CTLA-4degradationCD8cytotoxic T-lymphocyte associated protein 4
Journal Article 2023-11-07 ✓ 1 Snippet Yu J, Cui J, Zhang X, Xu H, Chen Z, Li Y, Niu Y, Wang S, Ran S, Zou Y, Ye W, Zhang D, Zhou C, Xia J, Wu J.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Immune checkpoint blockade (ICB), including anti-cytotoxic T-lymphocyte associated protein 4 (CTLA-4), benefits only a limited number of patients with cancer. Understanding the in-depth regulatory mechanism of CTLA-4 protein stability and its functional significance may help identify ICB resistance mechanisms and assist in the development of novel immunotherapeutic modalities to improve ICB efficacy. Here, we identified that TNF receptor-associated factor 6 (TRAF6) mediates Lys63-linked ubiquitination and subsequent lysosomal degradation of CTLA-4. Moreover, by using TRAF6-deficient mice and retroviral overexpression experiments, we demonstrated that TRAF6 promotes CTLA-4 degradation in a T-cell-intrinsic manner, which is dependent on the RING domain of TRAF6. This intrinsic regulatory mechanism contributes to CD8<sup>+</sup> T-cell-mediated antitumor immunity in vivo. Additionally, by using an OX40 agonist, we demonstrated that the OX40-TRAF6 axis is responsible for CTLA-4 degradation, thereby controlling antitumor immunity in both tumor-bearing mice and patients with cancer. Overall, our findings demonstrate that the OX40-TRAF6 axis promotes CTLA-4 degradation and is a potential therapeutic target for the improvement of T-cell-based immunotherapies.

Also flagged:alginateexopolysaccharidesextracellularBiopolymershydroxybutyratepolysaccharide
Journal Article 2023-11-07 No Snippets Saad MH, Sidkey NM, El-Fakharany EM.
Show Full Abstract

Cyanobacteria are a potential source of promising secondary metabolites with different biological activities, including antibacterial, antiviral, antifungal, antiprotozoal, and anticancer activities. To combat the emergence of antibiotic resistance, there is an urgent requirement for new drugs, and cyanobacteria metabolites can constitute alternative new antibacterial medication. The chemical complexity of their exopolysaccharides indicates that they have the potential to be bioactive molecules with many biological activities. The present study aimed to produce and optimise a novel alginate polymer from a newly isolated cyanobacterium, S. algini MNE ON864447, in addition to its promising antibacterial activity. We successfully isolated a new cyanobacterium strain, S. algini MNE ON864447 from the Nile River, which produces alginate as an extracellular polymeric substance. The isolated cyanobacterial alginate was identified using a set of tests, including FTIR, TLC, HPLC, GC-MS, and <sup>1</sup>H NMR. Plackett-Burman statistical design showed that working volume (X1), the incubation period (X2), and inoculum size (X3) are the most significant variables affecting the production of alginate. The highest alginate production (3.57 g/L) was obtained using 4% inoculum size in 400 mL medium/L conical flask after 20 days of the incubation period. The extracted alginate showed potent antibacterial activity against both Gram-negative and Gram-positive bacteria and Streptococcus mutants (NCTC10449) are the most sensitive tested pathogen for purified cyanobacterial alginate with inhibition zone diameters of 34 ± 0.1 mm at 10 mg/mL of purified alginate while Vibro cholera (NCTC 8021) the lowest sensitive one and showed inhibition zone diameters of 22.5 ± 0.05 mm at the same cyanobacterial alginate concentration. This antibacterial activity is a critical step in the development of antibacterial drugs and presents a new challenge to fight against multi-resistant bacteria.

Also flagged:extracellularperyleneantibodyFoodborne illnesseswaterpolymerase
Journal Article 2023-11-07 No Snippets Baryzewska AW, Roth C, Seeberger PH, Zeininger L.
Show Full Abstract

We demonstrate a novel, rapid, and cost-effective biosensing paradigm that is based on an in situ visualization of bacterial exoenzyme activity using biphasic Janus emulsion droplets. Sensitization of the droplets toward dominant extracellular enzymes of bacterial pathogens is realized via selective functionalization of one hemisphere of Janus droplets with enzyme-cleavable surfactants. Surfactant cleavage results in an interfacial tension increase at the respective droplet interface, which readily transduces into a microscopically detectable change of the internal droplet morphologies. A macroscopic fluorescence read-out of such morphological transitions is obtained via ratiometrically recording the angle-dependent anisotropic emission signatures of perylene-containing droplets from two different angles. The optical read-out method facilitates detection of marginal morphological responses of polydisperse droplet samples that can be easily produced in any environment. The performance of Janus droplets as powerful optical transducers and signal amplifiers is highlighted by rapid (<4 h) and cost-effective antibody and DNA-free identification of three major foodborne pathogens, with detection thresholds of below 10 CFU mL<sup>-1</sup> for <i>Salmonella</i> and <10<sup>2</sup> to 10<sup>3</sup> CFU mL<sup>-1</sup> for <i>Listeria</i> and <i>Escherichia coli</i>.

Also flagged:Starcholeatelipoic acidthioldegradationpolyethylene glycol
Journal Article 2023-11-07 No Snippets Boetje L, Lan X, van Dijken J, Kaastra G, Polhuis M, Loos K.
Show Full Abstract

Biobased films were synthesized from starch oleate (DS = 2.2) cross-linked with polyethylene glycol with <i>M</i><sub>n</sub> = 2000 and 1000 g · mol<sup>-1</sup>, and ethylene glycol, all of which were esterified with either lipoic acid (LA) or 3-mercaptopropionic acid (MPA). Cross-linking was achieved through a UV-initiated thiol-ene click, and confirmed by Fourier transform infrared spectroscopy and rheometry. The films exhibit higher degradation temperatures, and an increased degree of crystallinity as cross-linker length increased. The introduction of MPA-based cross-linkers resulted in hydrophilic films, while the contact angle was barely affected by the addition of LA-based cross-linkers. A reduction in maximum strength upon introducing the cross-linkers was observed, while an increase in elongation was observed for most of the LA-based cross-linkers. Our results demonstrate the potential for tuning the mechanical and thermal properties of starch-based films through the cross-linker choice, with some formulations exhibiting increased flexibility that may be well suited for packaging applications.

Also flagged:acute respiratory infectionpneumoniatract illnesseshemagglutinationupper respiratory infectionconjunctivitis
Journal Article 2023-11-07 No Snippets Nguyen DD, Phung LT, Thanh Tran HT, Ly HTT, Vo AHM, Dinh NP, Doan PM, Nguyen AT, Dang LD, Doan TT, Pham KT, Pham HL, Hoang DX, Pham TN, Tran BT, Tran TTT, Le HTM, Pham AN, Antoniou A, Ho NT.
Show Full Abstract

<h4>Background</h4>Under the pressure of Human Adenovirus (HAdV)-associated acute respiratory infection (ARI) outbreak in children in Northern Vietnam in the end of 2022, this study was initiated to identify the HAdV subtype(s) and examine the associated clinical features and risk factors of more severe cases.<h4>Methods</h4>This study evaluated pediatric patients with ARI which had tested positive for HAdV between October and November 2022 using a multiplex real-time PCR panel. Nasopharyngeal aspirates or nasal swab samples were used for sequencing to identify HAdV subtypes. Clinical data were collected retrospectively.<h4>Results</h4>Among 97 successfully sequenced samples, the predominant subtypes were HAdV-B3 (83%), HAdV-B7 (16%) and HAdV-C2 (1%). Lower respiratory manifestations were found in 25% of the patients of which 5% were diagnosed with severe pneumonia. There was no significant association between HAdV subtype and clinical features except higher white blood cell and neutrophil counts in those detected with HAdV-B3 (p<0.001). Co-detection of HAdV with ≥1 other respiratory viruses was found in 13/24(54%) of those with lower respiratory manifestations and 4/5(80%) of those with severe pneumonia (odds ratio (95% confidence interval) vs. those without = 10.74 (2.83, 48.17) and 19.44 (2.12, 492.73) respectively after adjusting for age, sex, birth delivery method, day of disease).<h4>Conclusion</h4>HAdV-B3 and HAdV-B7 were predominant in the outbreak. Co-detection of HAdV together with other respiratory viruses was a strong risk factor for lower respiratory tract illnesses and severe pneumonia. The findings advocate the advantages of multi-factor microbial panels for the diagnosis and prognosis of ARI in children.

Also flagged:COVID-19C-reactive proteinCRPD-dimerCoronavirus disease 2019respiratory infection
Journal Article 2023-11-07 No Snippets Wang X, White E, Giacona F, Khurana A, Li Y, Christiani DC, Alladina JW.
Show Full Abstract

<h4>Background</h4>Clinical utility of routinely measured serial biomarkers in predicting escalation of inpatient care intensity and mortality among hospitalized patients with COVID-19 remains unknown.<h4>Methods</h4>This retrospective cohort study included patients with COVID-19 who admitted to the Massachusetts General Hospital between March and June 2020 and January to March 2021. White blood cell (WBC) count, platelet count, C-reactive protein (CRP), and D-dimer values were measured on days 1, 3, and 7 of admission. Clinical outcomes include 30- and 60-day morality, ICU transfer, and overall survival (OS) over a follow-up period of 90 days. The association between serial biomarkers and outcomes were assessed using multivariable logistic regression and Cox proportional hazards models.<h4>Measurements and main results</h4>Of the 456 patients hospitalized with COVID-19, 199 (43.6%) were ICU, 179 (39.3%) were medical floor, and 78 (17.1%) were initially admitted to the medical floor and then transferred to the ICU. In adjusted analyses, each unit increase in the slope of CRP was associated with a 42% higher odds of ICU transfer after controlling for the initial admission level (OR = 1.42, 95% CI: 1.25-1.65, P < 0.001). Including serial change in CRP levels from initial level on admission achieved the greatest predictive accuracy for ICU transfer (AUC = 0.72, 95% CI: 0.64-0.79).<h4>Conclusions</h4>Serial change in CRP levels from admission is associated with escalations of inpatient care intensity and mortality among hospitalized patients with COVID-19.

BTN2A1
Also flagged:PhosphonateBTN3A1diphosphateimmune responsediestersaryl
Journal Article 2023-11-07 ✓ 1 Snippet Singh U, Pawge G, Rani S, Hsiao CC, Wiemer AJ, Wiemer DF.
In-Text Gene Mentions

…domain of aBTN2A1homodimer, 18 ,…

Show Full Abstract

Activation of Vγ9Vδ2 T cells with butyrophilin 3A1 (BTN3A1) agonists such as (<i>E</i>)-4-hydroxy-3-methyl-but-2-enyl diphosphate (HMBPP) has the potential to boost the immune response. Because HMBPP is highly charged and metabolically unstable, prodrugs may be needed to overcome these liabilities, but the prodrugs themselves may be limited by slow payload release or low plasma stability. To identify effective prodrug forms of a phosphonate agonist of BTN3A1, we have prepared a set of diesters bearing one aryl and one acyloxymethyl group. The compounds were evaluated for their ability to stimulate Vγ9Vδ2 T cell proliferation, increase production of interferon γ, resist plasma metabolism, and internalize into leukemia cells. These bioassays have revealed that varied aryl and acyloxymethyl groups can decouple plasma and cellular metabolism and have a significant impact on bioactivity (>200-fold range) and stability (>10 fold range), including some with subnanomolar potency. Our findings increase the understanding of the structure-activity relationships of mixed aryl/acyloxymethyl phosphonate prodrugs.

Also flagged:Antimicrobialpeptidesbacterial infectionsmembraneantimicrobial peptidesdeath
Journal Article 2023-11-07 No Snippets Sneideris T, Erkamp NA, Ausserwöger H, Saar KL, Welsh TJ, Qian D, Katsuya-Gaviria K, Johncock MLLY, Krainer G, Borodavka A, Knowles TPJ.
Show Full Abstract

Antimicrobial peptides (AMPs), which combat bacterial infections by disrupting the bacterial cell membrane or interacting with intracellular targets, are naturally produced by a number of different organisms, and are increasingly also explored as therapeutics. However, the mechanisms by which AMPs act on intracellular targets are not well understood. Using machine learning-based sequence analysis, we identified a significant number of AMPs that have a strong tendency to form liquid-like condensates in the presence of nucleic acids through phase separation. We demonstrate that this phase separation propensity is linked to the effectiveness of the AMPs in inhibiting transcription and translation in vitro, as well as their ability to compact nucleic acids and form clusters with bacterial nucleic acids in bacterial cells. These results suggest that the AMP-driven compaction of nucleic acids and modulation of their phase transitions constitute a previously unrecognised mechanism by which AMPs exert their antibacterial effects. The development of antimicrobials that target nucleic acid phase transitions may become an attractive route to finding effective and long-lasting antibiotics.

HTT
Also flagged:spike glycoproteinsvirion surfacereceptorbindingmembranelipid
Journal Article 2023-11-07 ✓ 2 Snippets Chmielewski D, Wilson EA, Pintilie G, Zhao P, Chen M, Schmid MF, Simmons G, Wells L, Jin J, Singharoy A, Chiu W.
In-Text Gene Mentions

…beta-, gamma- anddelta-coronaviruses, have been extensively…

…across alpha- anddelta-coronaviruses(Supplementary Fig. 5A…

Show Full Abstract

Coronavirus spike glycoproteins presented on the virion surface mediate receptor binding, and membrane fusion during virus entry and constitute the primary target for vaccine and drug development. How the structure dynamics of the full-length spikes incorporated in viral lipid envelope correlates with the virus infectivity remains poorly understood. Here we present structures and distributions of native spike conformations on vitrified human coronavirus NL63 (HCoV-NL63) virions without chemical fixation by cryogenic electron tomography (cryoET) and subtomogram averaging, along with site-specific glycan composition and occupancy determined by mass spectrometry. The higher oligomannose glycan shield on HCoV-NL63 spikes than on SARS-CoV-2 spikes correlates with stronger immune evasion of HCoV-NL63. Incorporation of cryoET-derived native spike conformations into all-atom molecular dynamic simulations elucidate the conformational landscape of the glycosylated, full-length spike that reveals a role of hinge glycans in modulating spike bending. We show that glycosylation at N1242 at the upper portion of the stalk is responsible for the extensive orientational freedom of the spike crown. Subsequent infectivity assays implicated involvement of N1242-glyan in virus entry. Our results suggest a potential therapeutic target site for HCoV-NL63.

DCC
Also flagged:hypertensionhigh blood pressurecardiovascular diseasesBPtumorcancerous
Journal Article 2023-11-07 ✓ 2 Snippets Rahman MA, Cai C, Bo N, McNamara DM, Ding Y, Cooper GF, Lu X, Liu J.
In-Text Gene Mentions

…across the 15-ExonDCClocus [ 44…

…enzyme activity ofDCCand result in…

Show Full Abstract

<h4>Background</h4>Genomic variants of the disease are often discovered nowadays through population-based genome-wide association studies (GWAS). Identifying genomic variations potentially underlying a phenotype, such as hypertension, in an individual is important for designing personalized treatment; however, population-level models, such as GWAS, may not capture all the important, individualized factors well. In addition, GWAS typically requires a large sample size to detect the association of low-frequency genomic variants with sufficient power. Here, we report an individualized Bayesian inference (IBI) algorithm for estimating the genomic variants that influence complex traits, such as hypertension, at the level of an individual (e.g., a patient). By modeling at the level of the individual, IBI seeks to find genomic variants observed in the individual's genome that provide a strong explanation of the phenotype observed in this individual.<h4>Results</h4>We applied the IBI algorithm to the data from the Framingham Heart Study to explore the genomic influences of hypertension. Among the top-ranking variants identified by IBI and GWAS, there is a significant number of shared variants (intersection); the unique variants identified only by IBI tend to have relatively lower minor allele frequency than those identified by GWAS. In addition, IBI discovered more individualized and diverse variants that explain hypertension patients better than GWAS. Furthermore, IBI found several well-known low-frequency variants as well as genes related to blood pressure that GWAS missed in the same cohort. Finally, IBI identified top-ranked variants that predicted hypertension better than GWAS, according to the area under the ROC curve.<h4>Conclusions</h4>The results support IBI as a promising approach for complementing GWAS, especially in detecting low-frequency genomic variants as well as learning personalized genomic variants of clinical traits and disease, such as the complex trait of hypertension, to help advance precision medicine.

DCC
Also flagged:inflammatory bowel diseasesinflammatory diseasecolorectal cancerVIMSEPT9GATA4
Journal Article 2023-11-07 ✓ 2 Snippets Deris Zayeri Z, Parsi A, Shahrabi S, Kargar M, Davari N, Saki N.
In-Text Gene Mentions

Tumor-suppressor genes, including KLF6, TP53, APC, K-RAS and DCC have been reported to be inactivated in patients with IBD-associated cancer, for instance.

…APC, K-RAS andDCChave been reported…

Show Full Abstract

<h4>Background and aim</h4>"Inflammatory bowel disease" (IBD) is a chronic, relapsing inflammatory disease of the intestinal tract that typically begins at a young age and might transit to colorectal cancer (CRC). In this manuscript, we discussed the epigenetic and metabolic change to present a extensive view of IBDs transition to CRC. This study discusses the possible biomarkers for evaluating the condition of IBDs patients, especially before the transition to CRC.<h4>Research approach</h4>We searched "PubMed" and "Google Scholar" using the keywords from 2000 to 2022.<h4>Discussion</h4>In this manuscript, interesting titles associated with IBD and CRC are discussed to present a broad view regarding the epigenetic and metabolic reprogramming and the biomarkers.<h4>Conclusion</h4>Epigenetics can be the main reason in IBD transition to CRC, and Hypermethylation of several genes, such as VIM, OSM4, SEPT9, GATA4 and GATA5, NDRG4, BMP3, ITGA4 and plus hypomethylation of LINE1 can be used in IBD and CRC management. Epigenetic, metabolisms and microbiome-derived biomarkers, such as Linoleic acid and 12 hydroxy 8,10-octadecadienoic acid, Serum M2-pyruvate kinase and Six metabolic genes (NAT2, XDH, GPX3, AKR1C4, SPHK and ADCY5) expression are valuable biomarkers for early detection and transition to CRC condition. Some miRs, such as miR-31, miR-139-5p, miR -155, miR-17, miR-223, miR-370-3p, miR-31, miR -106a, miR -135b and miR-320 can be used as biomarkers to estimate IBD transition to CRC condition.

Also flagged:Tropomyosin 3TPM3congenital myopathiesmyopathytropomyosinTPM1-4
Journal Article 2023-11-07 No Snippets Lambert MR, Gussoni E.
Show Full Abstract

The tropomyosin genes (TPM1-4) contribute to the functional diversity of skeletal muscle fibers. Since its discovery in 1988, the TPM3 gene has been recognized as an indispensable regulator of muscle contraction in slow muscle fibers. Recent advances suggest that TPM3 isoforms hold more extensive functions during skeletal muscle development and in postnatal muscle. Additionally, mutations in the TPM3 gene have been associated with the features of congenital myopathies. The use of different in vitro and in vivo model systems has leveraged the discovery of several disease mechanisms associated with TPM3-related myopathy. Yet, the precise mechanisms by which TPM3 mutations lead to muscle dysfunction remain unclear. This review consolidates over three decades of research about the role of TPM3 in skeletal muscle. Overall, the progress made has led to a better understanding of the phenotypic spectrum in patients affected by mutations in this gene. The comprehensive body of work generated over these decades has also laid robust groundwork for capturing the multiple functions this protein plays in muscle fibers.

TNFSF4
Also flagged:tumor-tumorscancerdeathHepatocellular carcinoma
Journal Article 2023-11-07 ✓ 1 Snippet Wang Y, Jin Q, Zhang S, Wang Y.
In-Text Gene Mentions

…NRP1, CD276, VTCN1,TNFSF4(Fig. 13 A,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a primary liver malignancy that is now relatively common worldwide. TMEM79 has been reported to play diagnostic and prognostic markers in a variety of cancers and was found to be closely associated with immune infiltration. SMG5 is associated with immune cell infiltration in HCC. Multiple nonsense-mediated mRNA processes require the involvement of SMG5. TMEM79 and SMG5 complexes may be prognostic markers for prostate cancer. However, the relationship between TMEM79 expression in HCC and prognosis, its role and mechanism of action, and its relationship with SMG5 have not been studied. This article focuses on not only the prognostic role of TMEM79 and its biological significance, including immuno-infiltration, tumor mutations and drug sensitivity, but also the interaction with SMG5 in HCC.<h4>Methods</h4>Differential expression analysis and the multiCox proportional hazards regression analyses of TMEM79 and SMG5 were performed by multiple databases. Then, use IHC to verify our results. Subsequently, we used R software to analyze the clinical phenotype of both: analysis of clinicopathological features, enrichment analysis, analysis of immune infiltration, analysis of immune checkpoints, analysis of drug sensitivity, and immunotherapy.<h4>Results</h4>Both the database studies and the results of our research group showed that TMEM79 and SMG5 were differentially expressed in HCC and normal tissues. Validation of immunohistochemistry showed that differential expression of TMEM79 and SMG5, which influenced the prognosis of patients with HCC, could be an independent prognostic factor. Results of the TCGA database study showed that TMEM79 and SMG5 were correlated with immune infiltration, immune checkpoints, drug sensitivity, and immunotherapy. We typed TMEM79-related molecules in HCC according to R software. Two types of TMEM79 correlated with clinical features, survival of patients with HCC, and immune infiltration.<h4>Conclusion</h4>TMEM79 are highly expressed in HCC and play an important role in the prognosis of patients with HCC. TMEM79 and SMG5 are positively correlated and may both associated with immune infiltration, and closely linked to immune checkpoints, drug sensitivity, and immunotherapy in HCC.

Also flagged:tumormalignant tumorsColorectal cancergene expressionpathogenesiscolon cancer
Journal Article 2023-11-07 No Snippets Shen J, Min Y, Luo J, Tang X, Han Z, Luo W, Xie F, Cao M, Zhou T, He J.
Show Full Abstract

<h4>Objectives</h4>To identify the most significantly differentially expressed circular RNAs (circRNAs) in colorectal cancer (CRC) tissues in terms of their expression levels and circularity, and to analyze the relationship between their expression levels and the clinical characteristics of patients.<h4>Methods</h4>circRNA RNA-seq technology was used to screen differentially expressed circRNAs in CRC. Sanger sequencing was used to identify circRNA back-splice junction sites. The relative expression levels of hsa_circ_0003761 (circMSH3) in CRC tissues and cell lines were detected by quantitative real-time fluorescence PCR technology. An RNA-protein pull-down assay was used to detect protein binding to circRNAs. Dual-luciferase reporter gene vectors were constructed to verify that circRNAs bind to microRNAs.<h4>Results</h4>Four hundred twenty circRNAs were found to be upregulated, and 616 circRNAs were downregulated. circMSH3 was derived from the MutS homolog 3 (MSH3) gene and was formed by a loop of exons 9, 10, 11, and 12. In 110 pairs of CRC and adjacent tissues, circMSH3 expression was 4.487-fold higher in CRC tissues. circMSH3 was also highly expressed in the HT-29 and LOVO CRC cell lines. The expression level of circMSH3 was associated with distant metastasis in CRC patients (<i>P</i> = 0.043); the area under the curve (AUC) of circMSH3 for CRC diagnosis was 0.75, with a sensitivity and specificity of 70.9% and 66.4%, respectively. circMSH3 could bind to a variety of proteins, mainly those involved in RNA transcription, splicing, cell cycle, and cell junctions. Furthermore, circMSH3 could bind to miR-1276, miR-942-5p, and miR-409-3p.<h4>Conclusion</h4>circMSH3 is a potential biomarker for the diagnosis of CRC and affects the distant metastasis of CRC. Multiple RNA-binding protein binds to circMSH3, and circMSH3 binds to miR-1276, miR-942-5p, and miR-409-3p, thereby affecting the expression of circMSH3.

Also flagged:Mineralocorticoid ReceptorType-2 Familial Partial LipodystrophyFPLD2MRcytoplasmiclocalization
Journal Article 2023-11-07 No Snippets Schena E, Mattioli E, Peres C, Zanotti L, Morselli P, Iozzo P, Guzzardi MA, Bernardini C, Forni M, Nesci S, Caprio M, Cecchetti C, Pagotto U, Gabusi E, Cattini L, Lisignoli G, Blalock W, Gambineri A, Lattanzi G.
Show Full Abstract

Type-2 Familial Partial Lipodystrophy (FPLD2), a rare lipodystrophy caused by <i>LMNA</i> mutations, is characterized by a loss of subcutaneous fat from the trunk and limbs and excess accumulation of adipose tissue in the neck and face. Several studies have reported that the mineralocorticoid receptor (MR) plays an essential role in adipose tissue differentiation and functionality. We previously showed that brown preadipocytes isolated from a FPLD2 patient's neck aberrantly differentiate towards the white lineage. As this condition may be related to MR activation, we suspected altered MR dynamics in FPLD2. Despite cytoplasmic MR localization in control brown adipocytes, retention of MR was observed in FPLD2 brown adipocyte nuclei. Moreover, overexpression of wild-type or mutated prelamin A caused GFP-MR recruitment to the nuclear envelope in HEK293 cells, while drug-induced prelamin A co-localized with endogenous MR in human preadipocytes. Based on in silico analysis and in situ protein ligation assays, we could suggest an interaction between prelamin A and MR, which appears to be inhibited by mineralocorticoid receptor antagonism. Importantly, the MR antagonist spironolactone redirected FPLD2 preadipocyte differentiation towards the brown lineage, avoiding the formation of enlarged and dysmorphic lipid droplets. Finally, beneficial effects on brown adipose tissue activity were observed in an FPLD2 patient undergoing spironolactone treatment. These findings identify MR as a new lamin A interactor and a new player in lamin A-linked lipodystrophies.

Also flagged:Nrf2pathogenesispulmonary hypertensionPHvasodilationNuclear factor erythroid 2-related factor 2
Journal Article 2023-11-07 No Snippets Fang Q, Bai Y, Hu S, Ding J, Liu L, Dai M, Qiu J, Wu L, Rao X, Wang Y.
Show Full Abstract

Pulmonary vascular remodeling, characterized by the thickening of all three layers of the blood vessel wall, plays a central role in the pathogenesis of pulmonary hypertension (PH). Despite the approval of several drugs for PH treatment, their long-term therapeutic effect remains unsatisfactory, as they mainly focus on vasodilation rather than addressing vascular remodeling. Therefore, there is an urgent need for novel therapeutic targets in the treatment of PH. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a vital transcription factor that regulates endogenous antioxidant defense and emerges as a novel regulator of pulmonary vascular remodeling. Growing evidence has suggested an involvement of Nrf2 and its downstream transcriptional target in the process of pulmonary vascular remodeling. Pharmacologically targeting Nrf2 has demonstrated beneficial effects in various diseases, and several Nrf2 inducers are currently undergoing clinical trials. However, the exact potential and mechanism of Nrf2 as a therapeutic target in PH remain unknown. Thus, this review article aims to comprehensively explore the role and mechanism of Nrf2 in pulmonary vascular remodeling associated with PH. Additionally, we provide a summary of Nrf2 inducers that have shown therapeutic potential in addressing the underlying vascular remodeling processes in PH. Although Nrf2-related therapies hold great promise, further research is necessary before their clinical implementation can be fully realized.

HFE
Also flagged:ErythrocytosisIronMetabolismchronic mountain sicknesshypoxia-inducible factor 2 alphaDmt1
Journal Article 2023-11-07 ✓ 1 Snippet Zhou S, Yan J, Song K, Ge RL.
In-Text Gene Mentions

…primary and secondaryhemochromatosis[ 23 ,…

Show Full Abstract

Excessive erythrocytosis (EE) is a preclinical form of chronic mountain sickness (CMS). The dysregulation of iron metabolism in high-altitude hypoxia may induce EE. The intestinal hypoxia-inducible factor 2 alpha (<i>HIF2a</i>) regulates the genes involved in iron metabolism. Considering these findings, we aimed to investigate the function and mechanism of intestinal <i>HIF2α</i> and the iron metabolism pathway in high-altitude EE mice. C57BL/6J mice were randomized into four groups: the low-altitude group, the high-altitude group, the high-altitude + <i>HIF2α</i> inhibitor group, and the high-altitude + vehicle group. In-vitro experiments were performed using the human intestinal cell line HCT116 cultured under hypoxic conditions for 24 h. Results showed that high-altitude hypoxia significantly increased the expression of intestinal <i>HIF2α</i> and iron metabolism-related genes, including <i>Dmt1</i>, <i>Dcytb</i>, <i>Fpn</i>, <i>Tfrc</i>, and <i>Fth</i> in EE mice. Genetic blockade of the intestinal <i>HIF2α</i>-iron metabolism pathway decreased iron availability in HCT116 cells during hypoxia. The <i>HIF2α</i> inhibitor PT2385 suppressed intestinal <i>HIF2α</i> expression, decreased iron hypermetabolism, and reduced excessive erythrocytosis in mice. These data support the hypothesis that exposure to high-altitude hypoxia can lead to iron hypermetabolism by activating intestinal <i>HIF2α</i> transcriptional regulation, and reduced iron availability improves EE by inhibiting intestinal <i>HIF2α</i> signaling.

HFE
Also flagged:liver fibrosiscirrhosisliver failureportal hypertensionhepatocellular carcinomachronic hepatitis
Journal Article 2023-11-07 ✓ 1 Snippet Mohammed OS, Attia HG, Mohamed BMSA, Elbaset MA, Fayed HM.
In-Text Gene Mentions

…biliary cholangitis andhemochromatosis[ 2 ].…

Show Full Abstract

Long-term liver injuries lead to hepatic fibrosis, often progressing into cirrhosis, liver failure, portal hypertension, and hepatocellular carcinoma. There is currently no effective therapy available for liver fibrosis. Thus, continuous investigations for anti-fibrotic therapy are ongoing. The main theme of anti-fibrotic investigation during recent years is the rationale-based selection of treatment molecules according to the current understanding of the pathology of the disease. The research efforts are mainly toward repurposing current FDA-approved drugs targeting etiological molecular factors involved in developing liver fibrosis. In parallel, investigations also focus on experimental small molecules with evidence to hinder or reverse the fibrosis. Natural compounds, immunological, and genetic approaches have shown significant encouraging effects. This review summarizes the efficacy and safety of current under-investigation antifibrosis medications targeting various molecular targets, as well as the properties of antifibrosis medications, mainly in phase II and III clinical trials.

Also flagged:ExtracellularMicrovesiclesvesiclesmusculoskeletal disordersNeurologic-Related DisordersPeripheral Nervous System Disorders
Journal Article 2023-11-07 No Snippets Caliani Carrera AL, Minto BW, Malard P, Brunel HDSS.
Show Full Abstract

The advances in regenerative medicine are very important for the development of medicine and the discovery of stem cells has shown a greater capacity to raise the level of therapeutic quality while their use becomes more accessible, especially in their mesenchymal form. In veterinary medicine, it is not different. The use of those cells, as well as recent advances related to the use of their extracellular vesicles, demonstrates a great opportunity to enhance therapeutic methods and ensure more life quality for patients, which can be in clinical or surgical treatments. Knowing the advances in these modalities and the growing clinical and surgery research and demands for innovations in orthopedic and neurology medicines, this paper aimed to review the literature about the methodologies of use and applications such as the pathways of action and the advances that were postulated for microvesicles and exosomes derived from mesenchymal stem cells in veterinary medicine, especially for musculoskeletal disorders and related injuries.

PRDX6
Also flagged:gene expressionbiomineralizationsynthesisWaterorganizationdegradation
Journal Article 2023-11-07 ✓ 1 Snippet Han T, Liao X, Guo Z, Chen JY, He C, Lu Z.
In-Text Gene Mentions

…particularly PRDX5 andPRDX6, were significantly upregulat…

Show Full Abstract

<b>Introduction:</b> Coral reefs, among the most invaluable ecosystems in the world, face escalating threats from climate change and anthropogenic activities. To decipher the genetic underpinnings of coral adaptation and resilience, we undertook comprehensive transcriptome profiling of two emblematic coral species, <i>Montipora foliosa</i> and <i>Montipora capricornis</i>, leveraging PacBio Iso-Seq technology. These species were strategically selected for their ecological significance and their taxonomic proximity within the Anthozoa class. <b>Methods:</b> Our study encompassed the generation of pristine transcriptomes, followed by thorough functional annotation via diverse databases. Subsequently, we quantified transcript abundance and scrutinized gene expression patterns, revealing notable distinctions between the two species. <b>Results:</b> Intriguingly, shared orthologous genes were identified across a spectrum of coral species, highlighting a substantial genetic conservation within scleractinian corals. Importantly, a subset of genes, integral to biomineralization processes, emerged as exclusive to scleractinian corals, shedding light on their intricate evolutionary history. Furthermore, we discerned pronounced upregulation of genes linked to immunity, stress response, and oxidative-reduction processes in <i>M. foliosa</i> relative to <i>M. capricornis</i>. These findings hint at the presence of more robust mechanisms in <i>M. foliosa</i> for maintaining internal equilibrium and effectively navigating external challenges, underpinning its potential ecological advantage. Beyond elucidating genetic adaptation in corals, our research underscores the urgency of preserving genetic diversity within coral populations. <b>Discussion:</b> These insights hold promise for informed conservation strategies aimed at safeguarding these imperiled ecosystems, bearing ecological and economic significance. In synthesis, our study seamlessly integrates genomic inquiry with ecological relevance, bridging the gap between molecular insights and the imperative to conserve coral reefs in the face of mounting threats.

bioRxiv 2023-11-07 Preprint (No Snippets API) Yong-Gonzalez V, Radu C, Calder PA, Shum D, Gin DY, Frattini MG, Djaballah H.
Show Full Abstract

Omacetaxine, a semisynthetic form of Homoharringtonine (HHT), was approved for the treatment of chronic myeloid leukemia (CML). Previously, we published the synthesis of this natural alkaloid and three of its derivatives: deoxyharringtonine (DHT), deoxyhomoharringtonine (DHHT), and bis(demethyl)-deoxyharringtonine (BDHT); and reported on its refractory activity against the HL-60/RV+ cells over-expressing P-glycoprotein 1 (MDR1). In this study, we explored the extent of this resistance by first expanding the panel of established cell lines and second, using a panel of 21 leukemia patient derived primary cells. Here, we report a consistent resistance to HTT in K562 derived cells and in MES-SA/MX2 derived cells resistant to mitoxanthrone; all of them over-express MDR1, while we found U87MG-ABCG2 and H69AR cells to be very sensitive to HTT. In contrast, DHT, DHHT, and BDHT seemingly overcome this resistance due to the changes made to the acyl chain of HTT rendering the derivatives less susceptible to efflux. Surprisingly, the leukemia primary cells were very sensitive to HHT and its derivatives with low nanomolar potencies, followed by a new class of CDC7 kinase inhibitors, the anthracycline class of topoisomerase inhibitors, the DNA intercalator actinomycin-D, and the vinca alkaloid class of microtubule inhibitors. The mechanism of cell death induced by HTT and DHHT was found to be mediated via Caspase 3 cleavage leading to apoptosis. Taken together, our results confirm that HHT is a substrate for MDR1. It opens the door to a new opportunity to clinically evaluate HHT and its derivatives for the treatment of AML and other cancers.

Research Square 2023-11-07 Preprint (No Snippets API) Shen Y, Zheng Q, Che G, Chen L.
Show Full Abstract

<h4>Background: </h4> The lymph node metastasis of LUAD is a pivotal factor leading to late TNM staging and poor prognosis. Ferroptosis plays a key role in promoting cancer cell death and immunotherapy. However, the roles of FRGs in lymph node metastasis and immunity of LUAD remain unclear. <h4>Methods: </h4> LUAD patients obtained from TCGA database were divided into lymph node metastasis group and non-lymph node metastasis group, and differential analysis was performed to screen lymph node metastasis-related FRGs. Univariate and multivariate Cox regression analyses were performed to construct a prediction model of FGRs. Kaplan-Meier survival curves and ROC curves were performed to verify the validity of model. The CIBERSOFT method was used to study the degree and prognostic value of immune cells in different groups. <h4>Results: </h4> The gene expression profiles of 301 LUAD samples without lymph node metastasis and 153 LUAD samples with lymph node metastasis obtained from the TCGA database were analyzed, 90 FRGs were obtained. Univariate analysis showed that 15 FRGs were significantly associated with OS in LUAD. Subsequently, we used multivariate Cox regression analysis to build a 9-FRGs model associated with LUAD survival, including CISD1, DDIT4, DECR1, IL33, PEBP1, PHKG2, PPP1R13L, SLC7A5 and VDAC2. The samples were divided into low-risk and high-risk subgroups. Kaplan-Meier survival curves showed better OS in the low-risk group. The ROC curve showed that this signature performed well in predicting OS. Finally, we systematically analyzed differences in immune infiltration profiles between high-risk and low-risk samples. We found that resting mast cells and resting memory CD4 T cells showed higher infiltration in low-risk group than in high-risk group, but M0 macrophages, activated mast cells and follicular helper T cells tended to infiltrate in high-risk group, and there were certain associations between above 5 TIICs with the risk scores and above 9 FGRs, and the high infiltration of activated mast cells was an adverse prognostic factor of LUAD. <h4>Conclusion: </h4> We constructed a novel 9-FRGs model that could serve as a potential therapeutic target for lymph node metastasis in LUAD. Targeting FRGs seems to be an alternative to clinical therapy for lymph node metastasis of LUAD.

TNFSF4
Also flagged:MYL9cancercolorectal cancertumorluciferasetumors
Journal Article 2023-11-06 ✓ 1 Snippet Deng S, Cheng D, Wang J, Gu J, Xue Y, Jiang Z, Qin L, Mao F, Cao Y, Cai K.
In-Text Gene Mentions

…CD86, CD40, andTNFSF4expression (Fig. 5…

Show Full Abstract

<h4>Background</h4>The tumor microenvironment (TME) is an important factor that regulates the progression of colorectal cancer (CRC). Cancer-associated fibroblasts (CAFs) are the main mesenchymal cells in the TME and play a vital role in tumor progression; however, the specific underlying mechanisms require further study.<h4>Methods</h4>Multiple single-cell and transcriptome data were analyzed and validated. Primary CAFs isolation, CCK8 assay, co-culture assay, western blotting, multiple immunofluorescence, qRT-PCR, ELISA, immunoprecipitation, ChIP, double luciferase, and animal experiments were used to explore the potential mechanism of MYL9 regulation in CRC.<h4>Results</h4>Our findings revealed that MYL9 was predominantly localized and expressed in CAFs rather than in CRC cells, and bioinformatics analysis revealed that high MYL9 expression was strongly associated with poor overall and disease-free survival in various tumors. In addition, high MYL9 expression is closely associated with M2 macrophage infiltration, which can lead to an immunosuppressive microenvironment in CRC, making it insensitive to immunotherapy. Mechanically, MYL9 can regulate the secretion of CAFs on CCL2 and TGF-β1, thus affecting the immune microenvironment and progression of CRC. In addition, MYL9 bounded with IQGAP1 to regulate CCL2 and TGF-β1 secretion through the ERK 1/2 pathway, and CCL2 and TGF-β1 synergistically promoted CRC cells progression through the PI3K-AKT pathway. Furthermore, MYL9 promotes epithelial-mesenchymal transition (EMT) in CRC. During the upstream regulation of MYL9 in CAFs, we found that the EMT transcription factor ZEB1 could bind to the MYL9 promoter in CAFs, enhancing the activity and function of MYL9. Therefore, MYL9 is predominantly expressed in CAFs and can indirectly influence tumor biology and EMT by affecting CAFs protein expression in CRC.<h4>Conclusions</h4>MYL9 regulates the secretion of cytokines and chemokines in CAFs, which can affect the immune microenvironment of CRC and promote CRC progression. The relationship between MYL9 expression and CRC clinical staging and immunotherapy is closer in CAFs than in tumor cells; therefore, studies using CAFs as a model deserve more attention when exploring tumor molecular targets in clinical research.

LRRC7
Also flagged:PIN1P1CREB1gastric cancercancersgastric carcinomaluciferase
Journal Article 2023-11-06 ✓ 2 Snippets Wang YW, Zhu WJ, Ma RR, Tian YR, Chen X, Gao P.
In-Text Gene Mentions

…the protein‐coding geneLRRC7, we also checked…

…positively correlated withLRRC7expression (Figure S2…

Show Full Abstract

Long noncoding RNAs (lncRNAs) play critical roles in the carcinogenesis and progression of cancers. However, the role and mechanism of the pseudogene lncRNA PIN1P1 in gastric carcinoma remain unclear. The expression and effects of lncRNA PIN1P1 in gastric cancer were investigated. The transcriptional regulation of CREB1 on PIN1P1 was determined by ChIP and luciferase assays. The mechanistic model of PIN1P1 in gastric cancer was further explored by RNA pull-down, RIP and western blot analysis. PIN1P1 was overexpressed in gastric cancer tissues, and upregulated PIN1P1 predicted poor prognosis in patients. CREB1 was directly combined with the promoter region of PIN1P1 to promote the transcription of PIN1P1. CREB1-mediated enhanced proliferation, migration and invasion could be partially reversed by downregulation of PIN1P1. Overexpressed PIN1P1 promoted the proliferation, migration and invasion of gastric cancer cells, whereas decreased PIN1P1 showed the opposite effects. PIN1P1 directly interacted with YBX1 and promoted YBX1 protein expression, leading to upregulation of PIN1, in which E2F1 may be involved. Silencing of YBX1 during PIN1P1 overexpression could partially rescue PIN1 upregulation. PIN1, the parental gene of PIN1P1, was elevated in gastric cancer tissues, and its upregulation was correlated with poor patient outcomes. PIN1 facilitated gastric cancer cell proliferation, migration and invasion. To sum up, CREB1-activated PIN1P1 could promote gastric cancer progression through YBX1 and upregulating PIN1, suggesting that it is a potential target for gastric cancer.

CCPG1
Also flagged:lysosomescytoplasmicorganellesautophagosomesmacroautophagyvesicles
Journal Article 2023-11-06 ✓ 5 Snippets Hayashi Y, Takatori S, Warsame WY, Tomita T, Fujisawa T, Ichijo H.
In-Text Gene Mentions

…Another ER‐phagy receptor,CCPG1, directly recognizes ER…

…c.234C > G),CCPG1(NM_020739 with c.940T…

… (5′‐CTACAGACAGCGGGCATCCC‐3′),CCPG1(5′‐CGTCGTCTAAAGGCAGGACT‐3′), …

…FAM134B, RTN3, andCCPG1), we found that…

…we found thatCCPG1(Smith et al…

Show Full Abstract

Endoplasmic reticulum (ER) proteostasis is maintained by various catabolic pathways. Lysosomes clear entire ER portions by ER-phagy, while proteasomes selectively clear misfolded or surplus aberrant proteins by ER-associated degradation (ERAD). Recently, lysosomes have also been implicated in the selective clearance of aberrant ER proteins, but the molecular basis remains unclear. Here, we show that the phosphatidylinositol-3-phosphate (PI3P)-binding protein TOLLIP promotes selective lysosomal degradation of aberrant membrane proteins, including an artificial substrate and motoneuron disease-causing mutants of VAPB and Seipin. These cargos are recognized by TOLLIP through its misfolding-sensing intrinsically disordered region (IDR) and ubiquitin-binding CUE domain. In contrast to ER-phagy receptors, which clear both native and aberrant proteins by ER-phagy, TOLLIP selectively clears aberrant cargos by coupling them with the PI3P-dependent lysosomal trafficking without promoting bulk ER turnover. Moreover, TOLLIP depletion augments ER stress after ERAD inhibition, indicating that TOLLIP and ERAD cooperatively safeguard ER proteostasis. Our study identifies TOLLIP as a unique type of cargo-specific adaptor dedicated to the clearance of aberrant ER cargos and provides insights into molecular mechanisms underlying lysosome-mediated quality control of membrane proteins.

HFE
Also flagged:systemic infectionsironlumenpathogenesisbiofilm formationhyphal
Journal Article 2023-11-06 ✓ 2 Snippets Sharma R, Gibb AA, Barnts K, Elrod JW, Puri S.
In-Text Gene Mentions

…iron overload fromhemochromatosisor from chemotherapy…

…iron overload disease (hemochromatosis) ( 56 ).…

Show Full Abstract

<h4>Importance</h4>The yeast <i>C. albicans</i> exhibits metabolic flexibility for adaptability to host niches with varying availability of nutrients including essential metals like iron. For example, blood is iron deplete, while the oral cavity and the intestinal lumen are considered iron replete. We show here that <i>C. albicans</i> can tolerate very high levels of environmental iron, despite an increase in high iron-induced reactive oxygen species (ROS) that it mitigates with the help of a unique oxidase, known as alternative oxidase (AOX). High iron induces <i>AOX1/2</i> that limits mitochondrial accumulation of ROS. Genetic elimination of <i>AOX1/2</i> resulted in diminished virulence during oropharyngeal candidiasis in high iron mice. Since human mitochondria lack AOX protein, it represents a unique target for treatment of fungal infections.

HFE
Also flagged:homeostatic iron regulatorironchromosomehuman leukocyte antigenclass I major histocompatibility complexarthropathy
Journal Article 2023-11-06 ✓ 5 Snippets Barton JC, Barton JC, Acton RT.
In-Text Gene Mentions

We studied the height of adults with hemochromatosis genotype HFE p.C282Y/p.C282Y and without common HFE mutations (wt/wt).

A strength of the present study is the availability of (1) data from a large primary care‐based screening study in which post‐screening examination participants were selected for HFE genotypes, age, sex, TS, and SF and in whom HFE genotypes were confirmed and post‐screening TS and SF were measured, and (2) data for confirmation from a large cohort of Alabama‐referred hemochromatosis probands with HFE p.C282Y/p.C282Y.

Hemochromatosis in whites of western European descent is associated with homozygosity for p.C282Y (rs1800562), a common missense allele of the HFE gene (homeostatic iron regulator, chromosome 6p22.2; OMIM accession *613609; NM_000410.4(HFE):c.845G>A (p.Cys282Tyr)) in linkage disequilibrium with human leukocyte antigen (HLA) A*03 (Barton et al., 2015; Feder et al., 1996).

…examination participants withHFEp.C282Y/p.…

…and (2) referredhemochromatosisprobands with p.C282Y/p.…

Show Full Abstract

<h4>Background</h4>We sought to evaluate height in white adults with hemochromatosis.<h4>Methods</h4>We analyzed the height of (1) post-screening examination participants with HFE p.C282Y/p.C282Y (rs1800562) and wt/wt (absence of p.C282Y and p.H63D (rs1799945)) and (2) referred hemochromatosis probands with p.C282Y/p.C282Y.<h4>Results</h4>There were 762 participants (270 p.C282Y/p.C282Y, 492 wt/wt; 343 men, 419 women) and 180 probands (104 men, 76 women). Median height of male participants with p.C282Y/p.C282Y or wt/wt was 177.8 cm. Median height of female participants was greater in those with p.C282Y/p.C282Y than wt/wt (165.1 cm vs 162.6 cm, respectively; p = 0.0298). Median height of p.C282Y/p.C282Y participants and probands was the same (men 177.8 cm; women 165.1 cm). Regressions on height of male and female participants revealed no associations with HFE genotype and inverse and positive associations with age and weight, respectively. Height of female participants was positively and inversely associated with transferrin saturation and serum ferritin, respectively. Regressions on height of male and female probands revealed positive associations with weight.<h4>Conclusions</h4>The height of men with HFE p.C282Y/p.C282Y and wt/wt does not differ significantly. The height of female participants was greater in those with p.C282Y/p.C282Y than wt/wt. We found no independent association of HFE genotype with the height of men or women.

DCC
Also flagged:Thy1GFPBRN3BchemokinesCXCR4membrane
Journal Article 2023-11-06 ✓ 3 Snippets Soucy JR, Todd L, Kriukov E, Phay M, Malechka VV, Rivera JD, Reh TA, Baranov P.
In-Text Gene Mentions

We screened all the receptors associated with neuron migration that had higher expression in the POU4F2+ RGC vs. RBMPS+ RGC subclusters and identified six candidates from this in silico analysis to investigate further: adhesion G protein-coupled receptor G1 (ADGRG1), C-X-C motif chemokine receptor type 4 (CXCR4), deleted in colorectal cancer/netrin receptor DCC (DCC), frizzled class receptor 3 (FZD3), nuclear receptor subfamily 2 group F member 1 (NR2F1), and roundabout guidance receptor 2 (ROBO2) (Fig. 2G).

…deleted in colorectal cancer/netrin receptor DCCreceptor DCC (DCC),…

…cancer/netrin receptor DCC (DCC), frizzled class receptor…

Show Full Abstract

Ongoing cell therapy trials have demonstrated the need for precision control of donor cell behavior within the recipient tissue. We present a methodology to guide stem cell-derived and endogenously regenerated neurons by engineering the microenvironment. Being an "approachable part of the brain," the eye provides a unique opportunity to study neuron fate and function within the central nervous system. Here, we focused on retinal ganglion cells (RGCs)-the neurons in the retina are irreversibly lost in glaucoma and other optic neuropathies but can potentially be replaced through transplantation or reprogramming. One of the significant barriers to successful RGC integration into the existing mature retinal circuitry is cell migration toward their natural position in the retina. Our in silico analysis of the single-cell transcriptome of the developing human retina identified six receptor-ligand candidates, which were tested in functional in vitro assays for their ability to guide human stem cell-derived RGCs. We used our lead molecule, SDF1, to engineer an artificial gradient in the retina, which led to a 2.7-fold increase in donor RGC migration into the ganglion cell layer (GCL) and a 3.3-fold increase in the displacement of newborn RGCs out of the inner nuclear layer. Only donor RGCs that migrated into the GCL were found to express mature RGC markers, indicating the importance of proper structure integration. Together, these results describe an "in silico-in vitro-in vivo" framework for identifying, selecting, and applying soluble ligands to control donor cell function after transplantation.

HFE
Also flagged:cancertumorlung cancerT-cell proliferationCD45ovarian carcinoma
Journal Article 2023-11-06 ✓ 1 Snippet Vanhaver C, Aboubakar Nana F, Delhez N, Luyckx M, Hirsch T, Bayard A, Houbion C, Dauguet N, Brochier A, van der Bruggen P, Bruger AM.
In-Text Gene Mentions

…from non-cancerous donors (hemochromatosispatients) was collected…

Show Full Abstract

The presence of human neutrophils in the tumor microenvironment is strongly correlated to poor overall survival. Most previous studies have focused on the immunosuppressive capacities of low-density neutrophils (LDN), also referred to as granulocytic myeloid-derived suppressor cells, which are elevated in number in the blood of many cancer patients. We observed two types of LDN in the blood of lung cancer and ovarian carcinoma patients: CD45<sup>high</sup> LDN, which suppressed T-cell proliferation and displayed mature morphology, and CD45<sup>low</sup> LDN, which were immature and non-suppressive. We simultaneously evaluated the classical normal-density neutrophils (NDN) and, when available, tumor-associated neutrophils. We observed that NDN from cancer patients suppressed T-cell proliferation, and NDN from healthy donors did not, despite few transcriptomic differences. Hence, the immunosuppression mediated by neutrophils in the blood of cancer patients is not dependent on the cells' density but rather on their maturity.

SOX6
Also flagged:gene expressionhistonesinflammatory diseasesspindleCD73CD14
Journal Article 2023-11-06 ✓ 2 Snippets Walewska A, Janucik A, Tynecka M, Moniuszko M, Eljaszewicz A.
In-Text Gene Mentions

…cofactors SOX5 andSOX6) represents a key…

…containing gene 6 (SOX6), control expression of…

Show Full Abstract

Mesenchymal stem cells (mesenchymal stromal cells, MSC) are multipotent stem cells that can differentiate into cells of at least three mesodermal lineages, namely adipocytes, osteoblasts, and chondrocytes, and have potent immunomodulatory properties. Epigenetic modifications are critical regulators of gene expression and cellular differentiation of mesenchymal stem cells (MSCs). Epigenetic machinery controls MSC differentiation through direct modifications to DNA and histones. Understanding the role of epigenetic machinery in MSC is crucial for the development of effective cell-based therapies for degenerative and inflammatory diseases. In this review, we summarize the current understanding of the role of epigenetic control of MSC differentiation and immunomodulatory properties.

HTT
Also flagged:sleepinsomnia disordersleep-wakefulnessinsomniaserotonin receptorsglutamate
Journal Article 2023-11-06 ✓ 2 Snippets Wang Y, Genon S, Dong D, Zhou F, Li C, Yu D, Yuan K, He Q, Qiu J, Feng T, Chen H, Lei X.
In-Text Gene Mentions

…rotonin reuptake transporter [5-HTT]), together with metabotropic…

…5-HT2a) and transporters (5-HTT), together with metabotropic…

Show Full Abstract

Sleep health is both conceptually and operationally a composite concept containing multiple domains of sleep. In line with this, high dependence and interaction across different domains of sleep health encourage a transition in sleep health research from categorical to dimensional approaches that integrate neuroscience and sleep health. Here, we seek to identify the covariance patterns between multiple sleep health domains and distributed intrinsic functional connectivity by applying a multivariate approach (partial least squares). This multivariate analysis reveals a composite sleep health dimension co-varying with connectivity patterns involving the attentional and thalamic networks and which appear relevant at the neuromolecular level. These findings are further replicated and generalized to several unseen independent datasets. Critically, the identified sleep-health related connectome shows diagnostic potential for insomnia disorder. These results together delineate a potential brain connectome biomarker for sleep health with high potential for clinical translation.

PRDX6
Also flagged:liver tumorstumorshepatoblastomahepatoblastomaspredispositionBeckwith-Wiedemann syndrome
Journal Article 2023-11-06 ✓ 1 Snippet Pilet J, Hirsch TZ, Gupta B, Roehrig A, Morcrette G, Pire A, Letouzé E, Fresneau B, Taque S, Brugières L, Branchereau S, Chardot C, Aerts I, Sarnacki S, Fabre M, Guettier C, Rebouissou S, Zucman-Rossi J.
In-Text Gene Mentions

…, IL6ST ,PRDX6, SLC27A2 )…

Show Full Abstract

Pediatric liver tumors are very rare tumors with the most common diagnosis being hepatoblastoma. While hepatoblastomas are predominantly sporadic, around 15% of cases develop as part of predisposition syndromes such as Beckwith-Wiedemann (11p15.5 locus altered). Here, we identify mosaic genetic alterations of 11p15.5 locus in the liver of hepatoblastoma patients without a clinical diagnosis of Beckwith-Wiedemann syndrome. We do not retrieve these alterations in children with other types of pediatric liver tumors. We show that mosaic 11p15.5 alterations in liver FFPE sections of hepatoblastoma patients display IGF2 overexpression and H19 downregulation together with an alteration of the liver zonation. Moreover, mosaic livers' microenvironment is enriched in extracellular matrix and angiogenesis. Spatial transcriptomics and single-nucleus RNAseq analyses identify a 60-gene signature in 11p15.5 altered hepatocytes. These data provide insights for 11p15.5 mosaicism detection and its functional consequences during the early steps of carcinogenesis.

Also flagged:Cxcl5chemokinemuscular dystrophytoIL-1βTNFα
Journal Article 2023-11-06 No Snippets Yaghi OK, Hanna BS, Langston PK, Michelson DA, Jayewickreme T, Marin-Rodero M, Benoist C, Mathis D.
Show Full Abstract

Following acute injury, stromal cells promote tissue regeneration by a diversity of mechanisms. Time-resolved single-cell RNA sequencing of muscle mesenchymal stromal cells (MmSCs) responding to acute injury identified an 'early-responder' subtype that spiked on day 1 and expressed a notable array of transcripts encoding immunomodulators. IL-1β, TNF-α and oncostatin M each strongly and rapidly induced MmSCs transcribing this immunomodulatory program. Macrophages amplified the program but were not strictly required for its induction. Transfer of the inflammatory MmSC subtype, tagged with a unique surface marker, into healthy hindlimb muscle induced inflammation primarily driven by neutrophils and macrophages. Among the abundant inflammatory transcripts produced by this subtype, Cxcl5 was stroma-specific and highly upregulated with injury. Depletion of this chemokine early after injury revealed a substantial impact on recruitment of neutrophils, a prolongation of inflammation to later times and an effect on tissue regeneration. Mesenchymal stromal cell subtypes expressing a comparable inflammatory program were found in a mouse model of muscular dystrophy and in several other tissues and pathologies in both mice and humans. These 'early-responder' mesenchymal stromal cells, already in place, permit rapid and coordinated mobilization and amplification of critical cell collaborators in response to injury.

HTT
Also flagged:atrial fibrillationarrhythmiastrokeheart failurecardiovascular diseaseAF
Journal Article 2023-11-06 ✓ 2 Snippets You Y, Wang W, Wang W, Zhu W, Xu J.
In-Text Gene Mentions

The expression of four key mRNAs and lncRNAs (CSMD1, OR3A2, HTT-AS and AC004990.1) in the network were selected to validate in 11 AF patients and 11 controls by qRT-PCR.

…( CSMD1, OR3A2,HTT-AS and AC004990.1 )…

Show Full Abstract

<h4>Background</h4>Atrial fibrillation (AF) is one of the most common arrhythmia contributing to serious conditions such as stroke and heart failure. Recent studies demonstrated that long noncoding RNAs (lncRNAs) were related to cardiovascular disease. However, the molecular mechanisms of AF are not fully clear. This study intended to discover lncRNAs that are differentially expressed in AF compared with controls and evaluate the potential functions of these lncRNAs.<h4>Methods</h4>Ninety-seven patients (49 patients with AF and 48 patients without AF) were included in this study. Among these patients, leucocyte suspensions of 3 AF patients and 3 controls were sent for RNA-seq analysis to select differentially expressed lncRNA and mRNA. Different lncRNA expressions were validated in another samples (46 AF patients and 45 controls). Gene ontology (GO) enrichment analysis was conducted to annotate the function of selected mRNAs. Alternative splicing (AS) analysis was performed and a lncRNA-mRNA network was also constructed. The receiver operating characteristics (ROC) curve was used to evaluate diagnostic values. Logistic regression analysis was utilized to assess the risk or protective factor of AF.<h4>Results</h4>A total of 223 mRNAs and 105 lncRNAs were detected in AF patients compared with controls. Total 4 lncRNAs (LINC01781, AC009509.2, AL662844.3, AL662844.4) associated with AF were picked out for validation in another samples by quantitative real-time PCR (qRT-PCR), detecting that upregulated AC009509.2 and downregulated LINC01781 in AF patients. Multivariate logistic regression analysis illustrated that left atrial diameter (OR 1.201; 95% CI 1.093-1.320; P=0.000) and AC009509.2 (OR 1.732; 95% CI 1.092-2.747; P=0.020) were related to AF respectively. ROC curve showed that AC009509.2, LINC01781 and left atrial diameter (LAD) were predictors of AF. For LINC01781, the area under the curve (AUC) was 0.654 (95% CI 0.541-0.767, P=0.0113). For AC009509.2, the AUC was 0.710 (95% CI 0.599-0.822, P=0.0005). Bioinformatic methods (GO enrichment, AS analysis and lncRNA-mRNA network construction) were performed to reveal the role of lncRNAs.<h4>Conclusions</h4>This study discussed differentially expressed lncRNA and their potential interaction with mRNA in AF. LncRNA AC009509.2 could be a new potential biomarker for AF prediction.

Also flagged:nasopharyngeal carcinomapathogenesisVirusEBV) infectionEBV infection-
Journal Article 2023-11-06 No Snippets Siak PY, Heng WS, Teoh SSH, Lwin YY, Cheah SC.
Show Full Abstract

Nasopharyngeal carcinoma (NPC) is an aggressive malignancy with high propensity for lymphatic spread and distant metastasis. It is prominent as an endemic malignancy in Southern China and Southeast Asia regions. Studies on NPC pathogenesis mechanism in the past decades such as through Epstein Barr Virus (EBV) infection and oncogenic molecular aberrations have explored several potential targets for therapy and diagnosis. The EBV infection introduces oncoviral proteins that consequently hyperactivate many promitotic pathways and block cell-death inducers. EBV infection is so prevalent in NPC patients such that EBV serological tests were used to diagnose and screen NPC patients. On the other hand, as the downstream effectors of oncogenic mechanisms, the promitotic pathways can potentially be exploited therapeutically. With the apparent heterogeneity and distinct molecular aberrations of NPC tumor, the focus has turned into a more personalized treatment in NPC. Herein in this comprehensive review, we depict the current status of screening, diagnosis, treatment, and prevention in NPC. Subsequently, based on the limitations on those aspects, we look at their potential improvements in moving towards the path of precision medicine. The importance of recent advances on the key molecular aberration involved in pathogenesis of NPC for precision medicine progression has also been reported in the present review. Besides, the challenge and future outlook of NPC management will also be highlighted.

PRDX6
Also flagged:CARD6autophagyPI3KAktage-related macular degenerationhereditary retinopathy diseases
Journal Article 2023-11-06 ✓ 5 Snippets Fan X, Yang Y, Wu G, Kong Y, Zhang Y, Zha X.
In-Text Gene Mentions

…cells via the miR-29b-3p/PRDX6/PI3K/Akt axis.…

…The expression ofPRDX6/PI3K/Akt axis genes and…

…between miR-29b-3p andPRDX6.<h4>Results</h4>In H<sub>2</s…

…of circ-CARD6 andPRDX6was decreased, while…

…miR-29b-3p, miR-29b-3p targetsPRDX6, and circ-CARD6 regulates…

Show Full Abstract

<h4>Background</h4>Oxidative stress-induced damage and dysfunction of retinal pigment epithelium (RPE) cells are important pathogenetic factors of age-related macular degeneration (AMD) and hereditary retinopathy diseases (HRDs). This study aimed to elucidate the roles and mechanisms of circ-CARD6 and miR-29b-3p in oxidative stress-induced RPE and provide new ideas for the diagnosis and treatment of retinopathy disease (RD).<h4>Methods</h4>A model of oxidative stress-induced RPE (ARPE-19) was established, and the level of malondialdehyde (MDA) and concentration of reactive oxygen species (ROS) were detected by a DCFH-DA fluorescent probe and MDA kit. The cell viability was measured by a CCK-8 assay. The expression of PRDX6/PI3K/Akt axis genes and proteins related to apoptosis and autophagy were determined by RT‒qPCR and Western blot analyses. The dual-luciferase reporter system confirmed the targeting relationship between miR-29b-3p and circ-CARD6 and between miR-29b-3p and PRDX6.<h4>Results</h4>In H<sub>2</sub>O<sub>2</sub>-treated ARPE-19 cells, the expression of circ-CARD6 and PRDX6 was decreased, while the expression of miR-29b-3p was increased. The overexpression of circ-CARD6 inhibits oxidative stress-induced increases in ROS, apoptosis and autophagy in ARPE-19 cells. circ-CARD6 targets miR-29b-3p, miR-29b-3p targets PRDX6, and circ-CARD6 regulates PRDX6 via miR-29b-3p. Further studies showed that circ-CARD6 acts as a competitive endogenous RNA of miR-29b-3p to affect the expression of PRDX6, thereby inhibiting autophagy and apoptosis in ARPE-19 cells.<h4>Conclusion</h4>circ-CARD6 can inhibit oxidative stress and apoptosis by regulating the miR-29b-3p/PRDX6/PI3K/Akt axis.

POU3F2
Also flagged:breast cancerCDH10SMR3AFABP7LHX1node
Journal Article 2023-11-06 ✓ 2 Snippets Pan Y, Zou Q, Yin W, Huang Z, Zhao Y, Mo Z, Li L, Yang J.
In-Text Gene Mentions

q-PCR and WB results showed that in BC, CDH10, SMR3A, POU3F2, and FABP7 were down-regulated, and LHX1 was up-regulated.<h4>Conclusions</h4>We built a prognostic model of BC based on LNM-related genes, proffering evaluation for prognosis and precise cure of BC.<h4>Significance</h4>At present, the genes related to lymph node metastasis in BC are still largely unknown and need to be further explored.

…BC, CDH10, SMR3A,POU3F2, and FABP7 were…

Show Full Abstract

<h4>Background</h4>Lymph node metastasis (LNM) from Breast cancer (BC) is commonly seen in BC progression. Currently, the identification of genes linked with LNM in BC remains in mystery.<h4>Methods</h4>Genes related to BC LNM were screened, and a risk model was constructed based on LASSO-Cox analysis. Combined with the Kaplan-Meier curve, the ability of riskscore to distinguish different baseline characteristics was evaluated, and model was verified by the receiver operating characteristic (ROC) curve. The expression levels of prognostic marker genes were analyzed by qRT-PCR and western blot (WB).<h4>Results</h4>A higher survival rate and longer survival time in low-risk BC patients. The 1, 3 and 5 year AUC values of the training set were 0.79, 0.74, and 0.73, respectively. Results for the validation set was similar to the training set. The differentially expressed genes between the high- and low-risk groups were significantly enriched in immune pathways. In addition, the low-risk group had higher levels of immune infiltration. qRT-PCR and WB results showed that in BC, CDH10, SMR3A, POU3F2, and FABP7 were down-regulated, and LHX1 was up-regulated.<h4>Conclusions</h4>We built a prognostic model of BC based on LNM-related genes, proffering evaluation for prognosis and precise cure of BC.<h4>Significance</h4>At present, the genes related to lymph node metastasis in BC are still largely unknown and need to be further explored. Searching for potential lymph node metastasis-related genes of BC will provide meaningful biomarkers for BC treatment. Based on TCGA-BRCA data, we established an effective 11-gene prognostic risk model that could predict patient outcomes independently. Our model could classify BC patients and distinguish patients with poor prognosis effectively. Besides, the feature genes we identified might exert a predictive function in immunotherapy. The results of this study provide a new reference for the prognosis and treatment of BC patients with lymph node metastasis.

Also flagged:visionneurofilament 200calretininaxonshearingphotoreception
Journal Article 2023-11-06 No Snippets De Boeck MWE, Cozzi B, Graïc JM.
Show Full Abstract

Throughout evolution, odontocete vision has had to readapt to the aquatic environment, which has had far-reaching effects on ocular anatomy and neurology. The most prominent features include the iris with an operculum, a well-developed choroid, the presence of giant ganglion cells in the retina, and the hemispherical shape of the thick eyecup. In the present study, the optic nerve and the retina were comparatively studied in Odontoceti (Cuvier's beaked whale, common bottlenose dolphin, false killer whale, long-finned pilot whale, Risso's dolphin, striped dolphin), the semi-aquatic common hippopotamus, and the fully terrestrial bovine. Cross-sections of the tissue were treated with histological and immunohistochemical techniques. Substantial differences were seen between the odontocetes and the reference species as well as within the cetaceans. The morphological structure of the optic nerve mainly appeared species specific, while the density of retinal ganglion cells was significantly higher in the terrestrial bovine than in the cetaceans. However, some typical characteristics of the cetacean retina were absent: the giant ganglion cells and the high retinal thickness. Immunohistochemical research showed varying degrees of neurofilament 200 expression in the retinal ganglion cells, while calretinin was only expressed in those of the common bottlenose dolphin and bovine.

Also flagged:hydroxymethylPropanoic Aciddendrimerdendrimerspolyestersynthesis
Journal Article 2023-11-06 No Snippets Alfei S.
Show Full Abstract

Gene therapy is extensively studied as a realistic and promising therapeutic approach for treating inherited and acquired diseases by repairing defective genes through introducing (transfection) the "healthy" genetic material in the diseased cells. To succeed, the proper DNA or RNA fragments need efficient vectors, and viruses are endowed with excellent transfection efficiency and have been extensively exploited. Due to several drawbacks related to their use, nonviral cationic materials, including lipidic, polymeric, and dendrimer vectors capable of electrostatically interacting with anionic phosphate groups of genetic material, represent appealing alternative options to viral carriers. Particularly, dendrimers are highly branched, nanosized synthetic polymers characterized by a globular structure, low polydispersity index, presence of internal cavities, and a large number of peripheral functional groups exploitable to bind cationic moieties. Dendrimers are successful in several biomedical applications and are currently extensively studied for nonviral gene delivery. Among dendrimers, those derived by 2,2-bis(hydroxymethyl)propanoic acid (b-HMPA), having, unlike PAMAMs, a neutral polyester-based scaffold, could be particularly good-looking due to their degradability in vivo. Here, an overview of gene therapy, its objectives and challenges, and the main cationic materials studied for transporting and delivering genetic materials have been reported. Subsequently, due to their high potential for application in vivo, we have focused on the biodegradable dendrimer scaffolds, telling the history of the birth and development of b-HMPA-derived dendrimers. Finally, thanks to a personal experience in the synthesis of b-HMPA-based dendrimers, our contribution to this field has been described. In particular, we have enriched this work by reporting about the b-HMPA-based derivatives peripherally functionalized with amino acids prepared by us in recent years, thus rendering this paper original and different from the existing reviews.

Also flagged:Fluorohydroxyapatitemineral trioxide aggregatemethyltricalcium silicatedicalcium silicatetricalcium aluminate
Journal Article 2023-11-06 No Snippets Bolhari B, Chitsaz N, Nazari S, Behroozibakhsh M, Sooratgar A, Hashemian A.
Show Full Abstract

<h4>Objectives</h4>This study aimed to assess the effect of addition of fluorohydroxyapatite (FHI) on biological and physical properties of mineral trioxide aggregate (MTA) Angelus.<h4>Materials and methods</h4>In this in vitro, experimental study, nano-FHI powder was first synthesized, and the morphology and chemical structure of particles were evaluated by scanning electron microscopy (SEM), Fourier-transform infrared spectroscopy (FTIR), and X-ray diffraction (XRD). Three groups were evaluated in this study: MTA Angelus, MTA modified with 10% FHA, and MTA modified with 15% FHA. After mixing, the materials were applied to ring molds (10 mm diameter, 1 mm height), and the setting time of the three groups was evaluated according to ISO6876 and ASTMC266-03 with a Gillmore needle. The pH was measured using a pH meter at 24 and 48 hours and 7 days after mixing. The cytotoxicity of the materials was assessed in freshly mixed form and after 1 and 7 days using the methyl thiazolyl tetrazolium (MTT) assay according to ISO10993-5. Data were analyzed by one-way and repeated measures ANOVA and Tukey's test (alpha = 0.05).<h4>Results</h4>The addition of FHA to MTA significantly decreased the initial setting time (<i>P</i> < 0.05) and had no significant effect on cell viability (compared with pure MTA Angelus) at 1 and 7 days. However, modified MTA groups in freshly mixed form showed significantly lower cell viability (<i>P</i> < 0.05). The pH remained alkaline at all time points.<h4>Conclusion</h4>Addition of 15% FHA to MTA Angelus decreased its setting time with no adverse effect on cell viability (except for fresh form) or pH.

POU3F2
Also flagged:PTNMDKcell migrationneuronal migrationcell proliferationdeath
Journal Article 2023-11-06 ✓ 2 Snippets Zhou Z, Pan Y, Zhou S, Wang S, Zhang D, Cao Y, Jiang X, Li J, Zhu L, Zhao L, Gu S, Lin G, Dong Z, Sun HX.
In-Text Gene Mentions

…( Tima2 ,Pou3f2and Ptn )…

…, Lhx2 andPou3f2) or DLNs…

Show Full Abstract

<b>Background:</b> Currently, the mechanism(s) underlying corticogenesis is still under characterization. <b>Methods:</b> We curated the most comprehensive single-cell RNA-seq (scRNA-seq) datasets from mouse and human fetal cortexes for data analysis and confirmed the findings with co-immunostaining experiments. <b>Results:</b> By analyzing the developmental trajectories with scRNA-seq datasets in mice, we identified a specific developmental sub-path contributed by a cell-population expressing both deep- and upper-layer neurons (DLNs and ULNs) specific markers, which occurred on E13.5 but was absent in adults. In this cell-population, the percentages of cells expressing DLN and ULN markers decreased and increased, respectively, during the development suggesting direct neuronal transition (namely D-T-U). Whilst genes significantly highly/uniquely expressed in D-T-U cell population were significantly enriched in PTN/MDK signaling pathways related to cell migration. Both findings were further confirmed by co-immunostaining with DLNs, ULNs and D-T-U specific markers across different timepoints. Furthermore, six genes (co-expressed with D-T-U specific markers in mice) showing a potential opposite temporal expression between human and mouse during fetal cortical development were associated with neuronal migration and cognitive functions. In adult prefrontal cortexes (PFC), D-T-U specific genes were expressed in neurons from different layers between humans and mice. <b>Conclusion:</b> Our study characterizes a specific cell population D-T-U showing direct DLNs to ULNs neuronal transition and migration during fetal cortical development in mice. It is potentially associated with the difference of cortical development in humans and mice.

DCC
Also flagged:Ibutilidepersistent atrial fibrillationatrial tachyarrhythmiaAFAtrial fibrillationcardiac arrhythmia
Journal Article 2023-11-06 ✓ 5 Snippets Liu X, He Y, Gui C, Wen W, Jiang Z, Zhong G, Wu M.
In-Text Gene Mentions

(A) Kaplan–Meier analysis of freedom from atrial tachyarrhythmia among Ibutilide conversion vs. AF/AFL vs. DCC subgroups at 12 months follow-up; (B) Kaplan–Meier analysis of freedom from atrial tachyarrhythmia among Ibutilide conversion vs. AF/AFL vs. DCC subgroups at median 17 months follow-up; (C) Kaplan–Meier analysis of freedom from atrial tachyarrhythmia in effective ibutilide vs. noneffective ibutilide subgroups at 12 months follow-up; (D) Kaplan–Meier analysis of freedom from atrial tachyarrhythmia in effective ibutilide vs. noneffective ibutilide subgroups at median 17 months follow-up.

After adjusting for risk factors of AF recurrence, the hazard ratio for AF recurrence of the DCC group with reference to the Ibutilide group was 4.10 [95% confidence interval (CI) (1.87–8.98), P < 0.001].

The patients, whose AF were not terminated by the index ablation strategy, were non-randomly assigned to receive DCC (DCC group) or Ibutilide intravenously (Ibutilide group) based on the operators' assessment for the patient's condition and intraoperative situation.

Moreover, DCC group had a substantially highrisk of AF recurrence compared to Ibutilide group.

In the crude model that was not adjusted for risk factors of AF recurrence, compared with the Ibutilide group (reference = 1), the DCC group (HR: 1.99, 95% CI: 1.01–3.92, P = 0.049, Table 4) was associated with increased risk of AF recurrence.

Show Full Abstract

<h4>Backgroup</h4>Ibutilide has already been used for cardioversion of persistent atrial fibrillation (PsAF) after radiofrequency catheter ablation (RFCA). The purpose of this study was to determine the effect of Ibutilide-guided cardioversion on clinical outcomes after individualized ablation of PsAF.<h4>Methods</h4>From October 2020 to September 2021, consecutive patients with PsAF accepted for RFCA were prospectively enrolled. After individualized ablation including pulmonary vein isolation plus left atrial roof line ablation and personalized linear ablation based on left atrial low-voltage zones, patients were divided into the spontaneous conversion (SCV) group, direct current synchronized cardioversion (DCC) group and Ibutilide group according to different cardioversion types during ablation. The rates of freedom from atrial tachyarrhythmia (ATT) among the three groups were evaluated after follow-up.<h4>Results</h4>In this study, 110 patients were enrolled, including 12 patients with SCV, 50 patients receiving DCC and 48 patients receiving Ibutilide cardioversion after individualized ablation. Among the three groups, the SCV group had shorter AF duration {12 months [interquartile range (IQR) 12-16], <i>P</i> = 0.042} and smaller left atrial diameter (LAD) [35 mm (IQR: 33-42), <i>P</i> = 0.023]. A 12-month freedom from ATT rate was 83.3% in SCV group, 69.4% in DCC group, and 79.2% in Ibutilide group, respectively (Log-rank, <i>P</i> = 0.745). During the follow-up [17 months (IQR: 15-19)], the rate of freedom from ATT of SCV group (83.3%), and Ibutilide group (72.9%) were both higher than that of DCC group (53.1%, <i>P</i> = 0.042). Moreover, Kaplan-Meier analysis showed a significantly higher sinus rhythm (SR) maintenance in Ibutilide group than in DCC group (Log-rank, <i>P</i> = 0.041). After adjusting for risk factors of AF recurrence, the hazard ratio for AF recurrence of the DCC group with reference to the Ibutilide group was 4.10 [95% confidence interval (CI) (1.87-8.98), <i>P</i> < 0.001]. Furthermore, subgroup analysis showed that freedom from ATT rate in effective Ibutilide subgroup was significantly higher than noneffective Ibutilide subgroup (Log-rank, <i>P</i> < 0.001).<h4>Conclusion</h4>For the treatment of the patients with PsAF, Ibutilide-guided cardioversion after individualized RFCA may be benefit for maintenance of SR compared to conventional DCC, especially for the patients who are effective for administration of Ibutilide.

bioRxiv 2023-11-06 Preprint (No Snippets API) DeGorter MK, Goddard PC, Karakoc E, Kundu S, Yan SM, Nachun D, Abell N, Aguirre M, Carstensen T, Chen Z, Durrant M, Dwaracherla VR, Feng K, Gloudemans MJ, Hunter N, Moorthy MPS, Pomilla C, Rodrigues KB, Smith CJ, Smith KS, Ungar RA, Balliu B, Fellay J, Flicek P, McLaren PJ, Henn B, McCoy RC, Sugden L, Kundaje A, Sandhu MS, Gurdasani D, Montgomery SB.
Show Full Abstract

Mapping the functional human genome and impact of genetic variants is often limited to European-descendent population samples. To aid in overcoming this limitation, we measured gene expression using RNA sequencing in lymphoblastoid cell lines (LCLs) from 599 individuals from six African populations to identify novel transcripts including those not represented in the hg38 reference genome. We used whole genomes from the 1000 Genomes Project and 164 Maasai individuals to identify 8,881 expression and 6,949 splicing quantitative trait loci (eQTLs/sQTLs), and 2,611 structural variants associated with gene expression (SV-eQTLs). We further profiled chromatin accessibility using ATAC-Seq in a subset of 100 representative individuals, to identity chromatin accessibility quantitative trait loci (caQTLs) and allele-specific chromatin accessibility, and provide predictions for the functional effect of 78.9 million variants on chromatin accessibility. Using this map of eQTLs and caQTLs we fine-mapped GWAS signals for a range of complex diseases. Combined, this work expands global functional genomic data to identify novel transcripts, functional elements and variants, understand population genetic history of molecular quantitative trait loci, and further resolve the genetic basis of multiple human traits and disease.

ZNFX1
Also flagged:cancertumortranslationalcancerscell motilitysecretion
Journal Article 2023-11-05 ✓ 2 Snippets Xiao Y, Hu Y, Liu S.
In-Text Gene Mentions

In HCC, lncRNA ZNFX1 antisense RNA 1 (ZFAS1) promotes the expression of MMP14 and MMP16 via inhibiting miR-150 and thus promotes intrahepatic and extrahepatic metastasis in HCC.[47] Wang et al[48] also found that the high expression level of lncRNA HOXD-AS1 was associated with poor prognosis and the high tumor node metastasis stage of HCC patients.

…In HCC, lncRNAZNFX1 antisense RNA 1antisense RNA 1…

Show Full Abstract

<h4>Abstract</h4>Metastases account for the overwhelming majority of cancer-associated deaths. The dissemination of cancer cells from the primary tumor to distant organs involves a complex process known as the invasion-metastasis cascade. The underlying biological mechanisms of metastasis, however, remain largely elusive. Recently, the discovery and characterization of non-coding RNAs (ncRNAs) have revealed the diversity of their regulatory roles, especially as key contributors throughout the metastatic cascade. Here, we review recent progress in how three major types of ncRNAs (microRNAs, long non-coding RNAs, and circular RNAs) are involved in the multistep procedure of metastasis. We further examine interactions among the three ncRNAs as well as current progress in their regulatory mechanisms. We also propose the prevention of metastasis in the early stages of cancer progression and discuss current translational studies using ncRNAs as targets for metastasis diagnosis and treatments. These studies provide insights into developing more effective strategies to target metastatic relapse.

SERPINC1
Also flagged:translationalgluconeogenesisureacoagulationtryptophanmetabolism
Journal Article 2023-11-05 ✓ 2 Snippets Maehara H, Kokaji T, Hatano A, Suzuki Y, Matsumoto M, Nakayama KI, Egami R, Tsuchiya T, Ozaki H, Morita K, Shirai M, Li D, Terakawa A, Uematsu S, Hironaka KI, Ohno S, Kubota H, Araki H, Miura F, Ito T, Kuroda S.
In-Text Gene Mentions

…Fgg, F2, andSerpinc1are reportedly hypomethylated…

…Fgg, F2, andSerpinc1, has been reported…

Show Full Abstract

Each tissue has a dominant set of functional proteins required to mediate tissue-specific functions. Epigenetic modifications, transcription, and translational efficiency control tissue-dominant protein production. However, the coordination of these regulatory mechanisms to achieve such tissue-specific protein production remains unclear. Here, we analyzed the DNA methylome, transcriptome, and proteome in mouse liver and skeletal muscle. We found that DNA hypomethylation at promoter regions is globally associated with liver-dominant or skeletal muscle-dominant functional protein production within each tissue, as well as with genes encoding proteins involved in ubiquitous functions in both tissues. Thus, genes encoding liver-dominant proteins, such as those involved in glycolysis or gluconeogenesis, the urea cycle, complement and coagulation systems, enzymes of tryptophan metabolism, and cytochrome P450-related metabolism, were hypomethylated in the liver, whereas those encoding-skeletal muscle-dominant proteins, such as those involved in sarcomere organization, were hypomethylated in the skeletal muscle. Thus, DNA hypomethylation characterizes genes encoding tissue-dominant functional proteins.

Also flagged:arsenicsulfatephosphorousPhosphatemineralsmineral
Journal Article 2023-11-05 No Snippets Alankarage D, Betts A, Scheckel KG, Herde C, Cavallaro M, Juhasz AL.
Show Full Abstract

In this study, smelter contaminated soil was treated with various soil amendments (ferric sulfate [Fe<sub>2</sub>(SO4)<sub>3</sub>], triple superphosphate [TSP] and biochar) to determine their efficacy in immobilizing soil lead (Pb) and arsenic (As). In soils incubated with ferric sulfate (0.6M), gastric phase Pb bioaccessibility was reduced from 1939 ± 17 mg kg<sup>-1</sup> to 245 ± 4.7 mg kg<sup>-1</sup>, while intestinal phase bioaccessibility was reduced from 194 ± 25 mg kg<sup>-1</sup> to 11.9 ± 3.5 mg kg<sup>-1</sup>, driven by the formation of plumbojarosite. In TSP treated soils, there were minor reductions in gastric phase Pb bioaccessibility (to 1631 ± 14 mg kg<sup>-1</sup>) at the highest TSP concentration (6000 mg kg<sup>-1</sup>) although greater reductions were observed in the intestinal phase, with bioaccessibility reduced to 9.3 ± 2.2 mg kg<sup>-1</sup>. Speciation analysis showed that this was primarily driven by the formation of chloropyromorphite in the intestinal phase following Pb and phosphate solubilization in the low pH gastric fluid. At the highest concentration (10% w/w), biochar treated soils showed negligible decreases in Pb bioaccessibility in both gastric and intestinal phases. Validation of bioaccessibility outcomes using an in vivo mouse assay led to similar results, with treatment effect ratios (TER) of 0.20 ± 0.01, 0.76 ± 0.11 and 1.03 ± 0.10 for ferric sulfate (0.6M), TSP (6000 mg kg<sup>-1</sup>) and biochar (10% w/w) treatments. Results of in vitro and in vivo assays showed that only ferric sulfate treatments were able to significantly reduce As bioaccessibility and bioavailability with TER at the highest application of 0.06 ± 0.00 and 0.14 ± 0.04 respectively. This study highlights the potential application of ferric sulfate treatment for the immobilization of Pb and As in co-contaminated soils.

Also flagged:bone formationbone resorptionsaltscollagenMineralcalcium
Journal Article 2023-11-05 No Snippets Šromová V, Sobola D, Kaspar P.
Show Full Abstract

This review focuses on understanding the macroscopic and microscopic characteristics of bone tissue and reviews current knowledge of its physiology. It explores how these features intricately collaborate to maintain the balance between osteoblast-mediated bone formation and osteoclast-mediated bone resorption, which plays a pivotal role in shaping not only our physical framework but also overall health. In this work, a comprehensive exploration of microscopic and macroscopic features of bone tissue is presented.

Also flagged:carbonnitrogendegradationhydrocarbonshaloalkanesnitrogen heterocycles
Journal Article 2023-11-05 No Snippets Ma Y, Wang J, Liu Y, Wang X, Zhang B, Zhang W, Chen T, Liu G, Xue L, Cui X.
Show Full Abstract

<i>Nocardioides</i>, a genus belonging to <i>Actinomycetes</i>, can endure various low-nutrient conditions. It can degrade pollutants using multiple organic materials such as carbon and nitrogen sources. The characteristics and applications of <i>Nocardioides</i> are described in detail in this review, with emphasis on the degradation of several hard-to-degrade pollutants by using <i>Nocardioides</i>, including aromatic compounds, hydrocarbons, haloalkanes, nitrogen heterocycles, and polymeric polyesters. <i>Nocardioides</i> has unique advantages when it comes to hard-to-degrade pollutants. Compared to other strains, <i>Nocardioides</i> has a significantly higher degradation rate and requires less time to break down substances. This review can be a theoretical basis for developing <i>Nocardioides</i> as a microbial agent with significant commercial and application potential.

Also flagged:boscalidcyprodiniliprodioneTamoxifen-estradiolcell proliferation
Journal Article 2023-11-05 No Snippets Jabłońska-Trypuć A, Wydro U, Wołejko E, Makuła M, Krętowski R, Naumowicz M, Sokołowska G, Serra-Majem L, Cechowska-Pasko M, Łozowicka B, Kaczyński P, Wiater J.
Show Full Abstract

An increasing level of pesticide exposition is being observed as a result of the consumption of large amounts of fruits, vegetables and grain products, which are key components of the vegetarian diet. Fungicides have been classified as endocrine-disrupting compounds, but their mechanisms of action have not yet been clarified. The effect of boscalid (B), cyprodinil (C) and iprodione (I) combined with Tamoxifen (T) and 17β-estradiol (E2) on cell viability, cell proliferation, reporter gene expression, ROS content, the cell membrane's function, cell morphology and antioxidant enzymes gene expression in MCF-7 and T47D-KBluc cell lines were investigated. The cell lines were chosen due to their response to 17β -estradiol. The selected fungicides are commonly used in Poland to protect crops against fungi. Our results revealed that the studied fungicides caused significant increases in cell viability and proliferation, and estrogenic activity was present in all studied compounds depending on their concentrations. Oxidative stress activated uncontrolled cancer cell proliferation by inducing ROS production and by inhibiting antioxidant defense. Our findings verify that the studied fungicides could possibly exhibit endocrine-disrupting properties and exposure should be avoided.

Also flagged:deathODOorganization
Journal Article 2023-11-05 No Snippets Lee LA, Martin DA, Mahoney M, James L, Avitzur Y, Carroll A, Piggott B, Tomlinson C, Urschel S, Hamiwka L.
Show Full Abstract

<h4>Objectives</h4>To understand contemporary pediatric organ donation programs in Canadian PICUs, including: policies and practices, data collection and reporting, and system and process barriers.<h4>Design</h4>A cross-sectional survey carried out 2021-2022.<h4>Setting</h4>Canadian PICUs affiliated with a donor physician network.<h4>Subjects</h4>Pediatric intensivists identified as the donation program lead, or most knowledgeable about donation for their institution.<h4>Measurements and main results</h4>A 19-item survey was developed through collaboration with stakeholders from the organ donation and transplantation community within Canada. Domains and items were generated and reduced iteratively during an in-person workshop. Pretesting and pilot testing were completed to ensure readability, flow, clinical sensibility, and construct validity. Fifteen of 16 (94%) invited Canadian PICUs from seven provinces completed the survey representing 88% (15/18) of all noncardiac Canadian PICUs. Surveys were completed between June 2021 and September 2022. All units support donation after death by neurologic criteria (DNC); 14 of 15 indicated donation policies were in place and 1 of 15 indicated no policy but the ability to facilitate donation. Thirteen of 15 units (87%) support donation after death by circulatory criteria (DCC) with policies in place, with 11 of 13 of these indicating routine support of donation opportunities. The majority (13/15) of units identified a donation champion. Of the 16 identified champions across these centers, 13 were physicians and were registered nurses or nurse practitioners. Eight of 13 units (62%) with donation champions had positions supported financially, of which 5 units came from the Organ Donation Organization and the other 3 came from the provincial health authority. Finally, only 3 of 15 PICU donation programs have a pediatric donation committee with family involvement. Variability exists in identification (including determination of death practices), referral, and approach for donation between units.<h4>Conclusions</h4>Although all Canadian PICUs support donation after DNC donation, and most support donation after DCC, variability exists in the identification, referral, and approach of potential donors. There is a notable lack of family involvement in pediatric donation programs. There are many opportunities for standardization of PICU donation programs which may result in improved rates of pediatric organ donation in Canada.

Also flagged:RPL5Anemiacongenital bone marrow failure syndromeribosomeerythropoiesismacrocytic anemia
Journal Article 2023-11-05 No Snippets Dorenkamp M, Porret N, Diepold M, Rovó A.
Show Full Abstract

Diamond-Blackfan anemia (DBA) is a congenital bone marrow failure syndrome associated with malformations. DBA is related to defective ribosome biogenesis, which impairs erythropoiesis, causing hyporegenerative macrocytic anemia. The disease has an autosomal dominant inheritance and is commonly diagnosed in the first year of life, requiring continuous treatment. We present the case of a young woman who, at the age of 21, developed severe symptomatic anemia. Although, due to malformations, a congenital syndrome had been suspected since birth, a confirmation diagnosis was not made until the patient was referred to our center for an evaluation of her anemia. In her neonatal medical history, she presented with anemia that required red blood cell transfusions, but afterwards remained with a stable, mild, asymptomatic anemia throughout her childhood and adolescence. Her family history was otherwise unremarkable. To explain the symptomatic anemia, vitamin deficiencies, autoimmune diseases, bleeding causes, and myeloid and lymphoid neoplasms were investigated and ruled out. A molecular investigation showed the RPL5 gene variant c.392dup, p.(Asn131Lysfs*6), confirming the diagnosis of DBA. All family members have normal blood values and none harbored the mutation. Here, we will discuss the unusual evolution of this case and revisit the literature.

SHISA6
Also flagged:VIPR2refractive errormyopiahighmyopic macular degenerationretinal detachment
Journal Article 2023-11-05 ✓ 1 Snippet He X, Lin C, Zhang F, Zhang S, Kang M, Wei S, Li H, Wang N, Li SM.
In-Text Gene Mentions

…of SNPs ofSHISA6-DNAH9, GJD2, and ZMAT4-SFRP…

Show Full Abstract

<h4>Clinical relevance</h4>Identification of individuals with a higher risk of developing refractive error under specific gene and environmental backgrounds, especially myopia, could enable more personalized myopic control advice for patients.<h4>Background</h4>Refractive error is a common disease that affects visual quality and ocular health worldwide. Its mechanisms have not been elaborated, although both genes and the environment are known to contribute to the process. Interactions between genes and the environment have been shown to exert effects on the onset of refractive error, especially myopia. Axial length elongation is the main characteristic of myopia development and could indicate the severity of myopia. Thus, the purpose of the study was to investigate the interaction between environmental factors and genetic markers of VIPR2 and their impact on spherical equivalence and axial length in a population of Han Chinese children.<h4>Methods</h4>A total of 1825 children aged 13~15 years in the Anyang Childhood Eye Study (ACES) were measured for cycloplegic autorefraction, axial length, and height. Saliva DNA was extracted for genotyping three single-nucleotide polymorphisms (SNPs) in the candidate gene (VIPR2). The median outdoor time (2 h/day) was used to categorize children into high and low exposure groups, respectively. Genetic quality control and linear and logistic regressions were performed. Generalized multifactor dimensional reduction (GMDR) was used to investigate gene-environment interactions.<h4>Results</h4>There were 1391 children who passed genetic quality control. Rs2071623 of VIPR2 was associated with axial length (T allele, β=-0.11 se=0.04 p=0.006), while SNP nominally interacted with outdoor time (T allele, β=-0.17 se=0.08 p=0.029). Rs2071623 in children with high outdoor exposure had a significant interaction effect on axial length (p=0.0007, β=-0.19 se=0.056) compared to children with low outdoor exposure. GMDR further suggested the existence of an interaction effect between outdoor time and rs2071623.<h4>Conclusions</h4>Rs2071623 within VIPR2 could interact with outdoor time in Han Chinese children. More outdoor exposure could enhance the protective effect of the T allele on axial elongation.

bioRxiv 2023-11-05 Preprint (No Snippets API) Marečková M, Garcia-Alonso L, Moullet M, Lorenzi V, Petryszak R, Sancho-Serra C, Oszlanczi A, Mazzeo CI, Hoffman S, Krassowski M, Garbutt K, Kelava I, Gaitskell K, Yancheva S, Woon EV, Male V, Granne I, Hellner K, Mahbubani KT, Saeb-Parsy K, Lotfollahi M, Prigmore E, Southcombe J, Dragovic RA, Becker CM, Zondervan KT, Vento-Tormo R.
Show Full Abstract

The human endometrium, the inner lining of the uterus, exhibits complex, dynamic changes throughout the menstrual cycle in response to ovarian hormones. Aberrant response of endometrial cells to hormones is associated with multiple disorders, including endometriosis. Previous single-cell studies of the endometrium profiled a limited number of donors and lacked consensus in defining cell types and states. Here, we introduce the Human Endometrial Cell Atlas (HECA), a high-resolution single-cell reference atlas, combining published and newly generated single-cell transcriptomics datasets of endometrial biopsies of women with and without endometriosis. The HECA assigned consensus cell types and states, and uncovered novel ones, which we mapped in situ using spatial transcriptomics. We quantified how coordinated interactions between cell states in space and time contribute to endometrial regeneration and differentiation. In the continuously changing functionalis layer, we identified an intricate coordination of TGFβ signalling between stromal and epithelial cells, likely crucial for cell differentiation. In the basalis layer, we defined signalling between fibroblasts and a new epithelial cell population expressing epithelial stem/progenitor markers, suggesting their role in endometrial regeneration. Additionally, integrating the HECA single-cell data with genome-wide association study data and comparing endometrial samples from women with and without endometriosis, we pinpointed subsets of decidualised stromal cells and macrophages as the most dysregulated cell states in endometriosis. Overall, the HECA is an invaluable resource for studying endometrial physiology, investigating endometrial disorders, and guiding the creation of endometrial microphysiological in vitro systems.

Also flagged:KRASNSCLCKRAS proto-oncogene, GTPasecolorectal cancerscell proliferationguanine nucleotide exchange factors
Journal Article 2023-11-04 No Snippets Batrash F, Kutmah M, Zhang J.
Show Full Abstract

Mutation in KRAS protooncogene represents one of the most common genetic alterations in NSCLC and has posed a great therapeutic challenge over the past ~ 40 years since its discovery. However, the pioneer work from Shokat's lab in 2013 has led to a recent wave of direct KRAS<sup>G12C</sup> inhibitors that utilize the switch II pocket identified. Notably, two of the inhibitors have recently received US FDA approval for their use in the treatment of KRAS<sup>G12C</sup> mutant NSCLC. Despite this success, there remains the challenge of combating the resistance that cell lines, xenografts, and patients have exhibited while treated with KRAS<sup>G12C</sup> inhibitors. This review discusses the varying mechanisms of resistance that limit long-lasting effective treatment of those direct inhibitors and highlights several novel therapeutic approaches including a new class of KRAS<sup>G12C</sup> (ON) inhibitors, combinational therapies across the same and different pathways, and combination with immunotherapy/chemotherapy as possible solutions to the pressing question of adaptive resistance.

LRRC7
Also flagged:LRRC8Aanion channelsBiosynthesisactivationvolume-regulated anion channelsleucine-rich repeat-containing protein 8A
Journal Article 2023-11-04 ✓ 1 Snippet Wang Y, Sun Z, Ping J, Tang J, He B, Chang T, Zhou Q, Yuan S, Tang Z, Li X, Lu Y, He R, He X, Liu Z, Yin L, Wu N.
In-Text Gene Mentions

…Recently, theleucine-rich repeat-containing protein 8repeat-containing protein 8…

Show Full Abstract

Biosynthesis drives the cell volume increase during T cell activation. However, the contribution of cell volume regulation in TCR signaling during T lymphoblast formation and its underlying mechanisms remain unclear. Here we show that cell volume regulation is required for optimal T cell activation. Inhibition of VRACs (volume-regulated anion channels) and deletion of leucine-rich repeat-containing protein 8A (LRRC8A) channel components impair T cell activation and function, particularly under weak TCR stimulation. Additionally, LRRC8A has distinct influences on mRNA transcriptional profiles, indicating the prominent effects of cell volume regulation for T cell functions. Moreover, cell volume regulation via LRRC8A controls T cell-mediated antiviral immunity and shapes the TCR repertoire in the thymus. Mechanistically, LRRC8A governs stringent cell volume increase via regulated volume decrease (RVD) during T cell blast formation to keep the TCR signaling molecules at an adequate density. Together, our results show a further layer of T cell activation regulation that LRRC8A functions as a cell volume controlling "valve" to facilitate T cell activation.

Also flagged:cancerscancerinfectionnucleotidechromosomeschromosome
Journal Article 2023-11-04 No Snippets Ruis C, Weimann A, Tonkin-Hill G, Pandurangan AP, Matuszewska M, Murray GGR, Lévesque RC, Blundell TL, Floto RA, Parkhill J.
Show Full Abstract

As observed in cancers, individual mutagens and defects in DNA repair create distinctive mutational signatures that combine to form context-specific spectra within cells. We reasoned that similar processes must occur in bacterial lineages, potentially allowing decomposition analysis to detect both disruption of DNA repair processes and exposure to niche-specific mutagens. Here we reconstruct mutational spectra for 84 clades from 31 diverse bacterial species and find distinct mutational patterns. We extract signatures driven by specific DNA repair defects using hypermutator lineages, and further deconvolute the spectra into multiple signatures operating within different clades. We show that these signatures are explained by both bacterial phylogeny and replication niche. By comparing mutational spectra of clades from different environmental and biological locations, we identify niche-associated mutational signatures, and then employ these signatures to infer the predominant replication niches for several clades where this was previously obscure. Our results show that mutational spectra may be associated with sites of bacterial replication when mutagen exposures differ, and can be used in these cases to infer transmission routes for established and emergent human bacterial pathogens.

NEGR1
Also flagged:innervationTAZS100BYapC/EBPβbinding
Journal Article 2023-11-04 ✓ 2 Snippets Huang X, Li X, Shen H, Zhao Y, Zhou Z, Wang Y, Yao J, Xue K, Wu D, Qiu Y.
In-Text Gene Mentions

…neurotrophin-4 (NTF4) andneuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1), have been implicated…

Show Full Abstract

Sympathetic innervation is essential for the development of functional beige fat that maintains body temperature and metabolic homeostasis, yet the molecular mechanisms controlling this innervation remain largely unknown. Here, we show that adipocyte YAP/TAZ inhibit sympathetic innervation of beige fat by transcriptional repression of neurotropic factor S100B. Adipocyte-specific loss of Yap/Taz induces S100b expression to stimulate sympathetic innervation and biogenesis of functional beige fat both in subcutaneous white adipose tissue (WAT) and browning-resistant visceral WAT. Mechanistically, YAP/TAZ compete with C/EBPβ for binding to the zinc finger-2 domain of PRDM16 to suppress S100b transcription, which is released by adrenergic-stimulated YAP/TAZ phosphorylation and inactivation. Importantly, Yap/Taz loss in adipocytes or AAV-S100B overexpression in visceral WAT restricts both age-associated and diet-induced obesity, and improves metabolic homeostasis by enhancing energy expenditure of mice. Together, our data reveal that YAP/TAZ act as a brake on the beige fat innervation by blocking PRDM16-C/EBPβ-mediated S100b expression.

Also flagged:migraineLRP1ACEESR1photophobiaHeadache Disorder
Journal Article 2023-11-04 No Snippets Sudershan A, Pushap AC, Bhagat M, Sharma I, Kumar H, Digra SK, Kumar P.
Show Full Abstract

Migraine is a complex disorder with multigenic inheritance and is characterized by the cardinal symptom of unilateral headache. Many genes are responsible for increasing the susceptibility of disease within different populations. Therefore, our primary aim in this review was to catalog the many genes that have been studied in India and after collecting the necessary information, we calculated a more precise risk relationship between an identified variation and migraine. The gene and its associated risk variant were discovered in the Indian population using a PRISMA-based systematic literature review guideline from online databases such as PubMed & Google Scholar. We constructed pooled odds ratios with 95% confidence intervals using multiple genetic models. Also, we looked for heterogeneity using Cochran's Q Test and the I2 statistic. Publication bias was analyzed using Begg's and Egger's tests. A p-value less than 0.05 was judged to be statistically significant for all tests. After a critical analysis, a total of 24 studies explored about 21 genes with 31 variants out of which only nine genes have been studied more than two times in the Indian population and thus were found eligible for the meta-analysis. It has been found, that the ACE-DD variant (allele model: OR: 1.37 [1.11-1.69], I<sup>2</sup> = 0%/ fixed model), ESR1-PvuII (allele model: OR: 1.47 [1.24-1.74], I<sup>2</sup> = 0%/ fixed model) significantly increases the risk of migraine in Indian population. Also, a protective role of the LRP1-rs11172113variant was observed for both migraine and its clinical subtype i.e., MA (allelic model: OR of 0.65 [0.50-0.83] I<sup>2</sup> = 44% and allele: OR: 0.54 [0.37-0.78], I<sup>2</sup> = 52%) respectively. Overall, the results of this meta-analysis indicated that the ACE-DD variant and the ESR1-PvuII were associated with an increased risk of migraine in the Indian community, while the LRP1-rs11172113 variant was associated with protection from migraine in this population.

HFE
Also flagged:nonalcoholic fatty liver diseaseNAFLDaminotransferaseslipoamino acidFatty Liver Diseaseadipocyte differentiation
Journal Article 2023-11-04 ✓ 1 Snippet Orkin S, Zhao X, Setchell KDR, Carr E, Arce-Clachar AC, Bramlage K, Huang R, Fei L, Beck AF, Fawaz R, Valentino PL, Xanthakos SA, Mouzaki M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>To determine the association between food insecurity and pediatric nonalcoholic fatty liver disease (NAFLD).<h4>Methods</h4>Cross-sectional study of patients < 21 years of age with histologically confirmed NAFLD. The Household Food Security Survey Module was administered to determine food insecurity status. Skin lipidomics were performed to explore pathophysiologic mechanisms.<h4>Results</h4>Seventy-three patients with histologically confirmed NAFLD completed the Household Food Security Survey Module. Of these, the majority were male (81%) and non-Hispanic (53%), with a mean age at biopsy of 13 ± 3 years. Food insecurity was seen in 42% (n = 31). Comparison of features between food insecure and food secure subgroups revealed no differences in sex, ethnicity, BMI z-score, aminotransferases, or histologic severity. However, children experiencing food insecurity presented on average 2 years before their food secure counterparts (12.3 ± 3.0 vs 14.4 ± 3.6 years, P = .015). A subset of 31 patients provided skin samples. Skin lipidomics revealed that food insecurity was associated with down-regulated features from the lipoamino acid class of lipids, previously linked to inflammation and adipocyte differentiation.<h4>Conclusions</h4>Food insecurity is highly prevalent in children with NAFLD and is associated with earlier presentation. Lipidomic analyses suggest a possible pathophysiologic link that warrants further exploration.

Also flagged:dimethyl fumaratedigestiontrypsinautophagyregenerative diseasesdegenerative diseases
Journal Article 2023-11-04 No Snippets Adelipour M, Hwang H, Kwon D, Kim KK, Moon JH, Lubman DM, Kim J.
Show Full Abstract

Mesenchymal stem cells (MSCs) have potential as a viable treatment option in the field of regenerative medicine, but MSC-based therapy needs to be more efficient. Preconditioning is a method to improve MSC-based therapy, and dimethyl fumarate (DMF) - an agent that can enhance the antioxidative capacity of cells - can be considered for preconditioning of MSCs. In this study, we treated bone marrow-derived MSCs with DMF and evaluated their proteome using bottom-up proteomics. The MSCs were exposed to 10 μM DMF for 24 h, followed by lysis with an SDS solution, digestion with trypsin using an s-trap column, and analysis using nanoLC-MS/MS, which identified 2262 proteins with confidence. Bioinformatic analysis of the identified proteins revealed 47 upregulated proteins and 81 downregulated proteins upon DMF treatment. Pathway enrichment analysis suggested a possible decrease in autophagy and a decrease in the activity of the TCA cycle, while indicating a potential increase in proliferation and antioxidant activity in DMF-treated MSCs compared to untreated MSCs. Our findings suggest that DMF can enhance the proliferation of MSCs and increase their stability, and that preconditioning could improve the therapeutic efficacy of MSCs for the treatment of regenerative diseases.

POU3F2
Also flagged:biosynthesisTRPV1capsaicincancerCAPMethyl
Journal Article 2023-11-04 ✓ 1 Snippet Luján-Méndez F, Roldán-Padrón O, Castro-Ruíz JE, López-Martínez J, García-Gasca T.
In-Text Gene Mentions

A growing body of evidence indicates that CAP exposure effectively abrogates the free and membrane-associated isoforms of tNOX [39,89,90,91,92,93,94,95], either in the serum of patients with active cancer through supramolecular interactions [89] or in cancer cell cultures, through the depletion of its transcriptional regulator [83] POU domain, class 3 transcription factor 2 (POU3F2).

Show Full Abstract

Capsaicinoids are a unique chemical species resulting from a particular biosynthesis pathway of hot chilies (<i>Capsicum</i> spp.) that gives rise to 22 analogous compounds, all of which are TRPV1 agonists and, therefore, responsible for the pungency of <i>Capsicum</i> fruits. In addition to their human consumption, numerous ethnopharmacological uses of chili have emerged throughout history. Today, more than 25 years of basic research accredit a multifaceted bioactivity mainly to capsaicin, highlighting its antitumor properties mediated by cytotoxicity and immunological adjuvancy against at least 74 varieties of cancer, while non-cancer cells tend to have greater tolerance. However, despite the progress regarding the understanding of its mechanisms of action, the benefit and safety of capsaicinoids' pharmacological use remain subjects of discussion, since CAP also promotes epithelial-mesenchymal transition, in an ambivalence that has been referred to as "the double-edge sword". Here, we update the comparative discussion of relevant reports about capsaicinoids' bioactivity in a plethora of experimental models of cancer in terms of selectivity, efficacy, and safety. Through an integration of the underlying mechanisms, as well as inherent aspects of cancer biology, we propose mechanistic models regarding the dichotomy of their effects. Finally, we discuss a selection of in vivo evidence concerning capsaicinoids' immunomodulatory properties against cancer.

HFE
Also flagged:iron overload cardiomyopathyacute myopericarditisirontransfusion-dependent thalassemiaanemiaheart failure
Journal Article 2023-11-04 ✓ 4 Snippets Kosum P, Theerasuwipakorn N, Wicheantawatchai A, Bunnag N, Wanlapakorn C, Tumkosit M, Uaprasert N, Satitthummanid S.
In-Text Gene Mentions

…(TDT) and secondaryhemochromatosiswith the latest…

…with TDT andhemochromatosis.…

Hemochromatosisin patients with…

…sion-dependent thalassemia andhemochromatosis.…

Show Full Abstract

Iron overload cardiomyopathy (IOC) is a condition in which iron deposition in the heart causes cardiac dysfunction. We described a 21-year-old woman who presented with acute chest pain, dyspnea, and fever. The patient had a history of transfusion-dependent thalassemia (TDT) and secondary hemochromatosis with the latest serum ferritin ranging from 8000 to 15,000. Physical examinations revealed signs of anemia and heart failure. Electrocardiography showed diffuse ST-segment elevation with reciprocal ST-segment depression in aVR and complete atrioventricular block. Cardiac markers were markedly elevated. Echocardiography demonstrated the dilated size, impaired systolic function, global wall hypokinesia, restrictive filling pattern of the left ventricle, and a small amount of pericardial effusion. Coronary angiography showed normal coronary arteries. A cardiac magnetic resonance imaging showed multifocal early and late gadolinium enhancement involving mid-wall and subepicardial areas of biventricular myocardium suggestive of diffuse myocardial injury from an inflammatory process. She was provisionally diagnosed with acute myopericarditis. Ibuprofen and loop diuretic were prescribed; however, cardiogenic shock occurred. Thus, an endomyocardial biopsy was done and revealed diffuse myocardial hemosiderin deposition without evidence of inflammatory cell infiltration. Severe IOC mimicking acute myopericarditis was considered based on an endomyocardial biopsy result. An intravenous iron chelating agent was immediately administered. Unfortunately, cardiogenic shock was refractory resulting in death. This case demonstrated a rare manifestation of IOC, which can masquerade as acute myopericarditis, and emphasized that IOC should be differentially diagnosed, particularly in patients with TDT and hemochromatosis.

medRxiv 2023-11-04 Preprint (No Snippets API) Mukhopadhyay S, Chauhan NK, Kathuria S, Mahajan B, Muheeb G, Mehta V, Agrawal RS, Mandal SK, Yusuf J.
Show Full Abstract

<h4>Background</h4> Patients of severe mitral stenosis (MS) in normal sinus rhythm (NSR) with left atrial appendage (LAA) inactivity and associated left atrial spontaneous echo contrast (LASEC) develop left atrial (LA) or LAA thrombus. But unlike atrial fibrillation (AF), oral anticoagulants (OAC) are not routinely prescribed in this subset of patients. <h4>Aim</h4> To assess local (LA) and systemic levels of procoagulants (PF1+2: prothrombin fragment 1+2; TAT-III: thrombin antithrombin III), PAI-1 (plasminogen activator inhibitor-1) and fibrinogen, in patients of severe MS in NSR with LAA inactivity and associated LASEC with healthy controls. <h4>Methods</h4> 35 patients of severe MS with valve suitable for balloon mitral valvuloplasty, along with 35 healthy volunteers were enrolled. All patients underwent transthoracic and transesophageal echocardiography to assess severity of MS, LAA activity, grade of LASEC, and exclude the presence of LA or LAA clot. Peripheral venous and LA blood samples were analysed for levels of procoagulants. <h4>Results</h4> Baseline characteristics like age and sex were comparable in both groups. Most of the patients in our study were either in NYHA II (n=13, 37.1%) or NYHA III functional class (n=21, 60%) and had grade 3+ (n=17;48.57%) or grade 4+ (n =15;42.86%) LASEC. Levels of PF1+2 {patient vs control, 9017(6228-10963.5) pg/mL vs 1790(842.3-2712) pg/mL, p<0.0001)}, TAT-III {patient vs control, 39(5.45-74.85) ng/ml vs 2.80(1.6-6.5) ng/mL, p<0.0001}, PAI-1 {patient vs control, 26.09±8.18 ng/ml vs 8.05 ± 3.53ng/ml. p<0.0001)}and fibrinogen (3.48± 0.89g/L vs 3.01± 0.53g/L, p=0.029) were significantly higher in LA of patients as compared to controls. Similarly, systemic levels of PF1+2, TAT-III, PAI-1 and fibrinogen were significantly higher in patients as compared to controls. However, systemic level of D-dimer was similar in both groups. <h4>Conclusion</h4> Both local and systemic levels of procoagulants were significantly raised in patients of severe MS in NSR with LAA inactivity and associated grade 3+ or 4+ LASEC, suggestive of a hypercoagulable state similar to that reported in patients of AF. Hence, we feel that OAC should be administered routinely in this subgroup of patients to prevent thrombus formation until there is improvement in LA and LAA function following valvuloplasty or mitral valve surgery. <h4>Clinical Perspective</h4> <h4>What’s new?</h4> Patients of severe MS in NSR with LAA inactivity and associated LASEC are prone to develop LA or LAA thrombus. However, the ACC/AHA 2020 guidelines on valvular heart disease still do not recommend oral anticoagulants in this subset of patients. We carried out an adequately powered study to assess the level of procoagulants in patients of severe MS in NSR with associated LASEC (LASEC being a marker of stasis). <h4>What are the clinical implications?</h4> Both local and systemic levels of procoagulants were significantly raised in patients of severe MS in NSR with LAA inactivity and associated grade 3+ or 4+ LASEC as compared to controls, suggestive of a hypercoagulable state similar to that reported in patients of AF. We feel that OAC should be administered routinely in this subgroup of patients of rheumatic MS in NSR to prevent thrombus formation until there is improvement in LA and LAA function following valvuloplasty or MV surgery.

Also flagged:chromiumsalicylic acidphotosynthesischlorophyllenzyme activitytransition
Journal Article 2023-11-03 No Snippets Ali HH, Ilyas M, Zaheer MS, Hameed A, Ikram K, Khan WUD, Iqbal R, Awan TH, Rizwan M, Mustafa AEMA, Elshikh MS.
Show Full Abstract

<h4>Background</h4>Chromium (Cr) contamination in soil poses a serious hazard because it hinders plant growth, which eventually reduces crop yield and raises the possibility of a food shortage. Cr's harmful effects interfere with crucial plant functions like photosynthesis and respiration, reducing energy output, causing oxidative stress, and interfering with nutrient intake. In this study, the negative effects of Cr on mung beans are examined, as well as investigate the effectiveness of Azospirillum brasilense and salicylic acid in reducing Cr-induced stress.<h4>Results</h4>We investigated how different Cr levels (200, 300, and 400 mg/kg soil) affected the growth of mung bean seedlings with the use of Azospirillum brasilense and salicylic acid. Experiment was conducted with randomized complete block design with 13 treatments having three replications. Significant growth retardation was caused by Cr, as were important factors like shoot and root length, plant height, dry weight, and chlorophyll content significantly reduced. 37.15% plant height, 71.85% root length, 57.09% chlorophyll contents, 82.34% crop growth rate was decreased when Cr toxicity was @ 50 µM but this decrease was remain 27.80%, 44.70%, 38.97% and 63.42%, respectively when applied A. brasilense and Salicylic acid in combine form. Use of Azospirillum brasilense and salicylic acid significantly increased mung bean seedling growth (49%) and contributed to reducing the toxic effect of Cr stress (34% and 14% in plant height, respectively) due to their beneficial properties in promoting plant growth.<h4>Conclusions</h4>Mung bean seedlings are severely damaged by Cr contamination, which limits their growth and physiological characteristics. Using Azospirillum brasilense and salicylic acid together appears to be a viable way to combat stress brought on by Cr and promote general plant growth. Greater nutrient intake, increased antioxidant enzyme activity, and greater root growth are examples of synergistic effects. This strategy has the ability to reduce oxidative stress brought on by chromium, enhancing plant resistance to adverse circumstances. The study offers new perspectives on sustainable practices that hold potential for increasing agricultural output and guaranteeing food security.

Also flagged:anxietySARS-CoV-2 infectionpolymeraseCoV-2 infectionCOVID-19substance use disorder
Journal Article 2023-11-03 No Snippets Engelmann P, Büchel C, Frommhold J, Klose HFE, Lohse AW, Maehder K, Nestoriuc Y, Scherer M, Suling A, Toussaint A, Weigel A, Zapf A, Löwe B.
Show Full Abstract

<h4>Background</h4>Growing evidence suggests that in addition to pathophysiological, there are psychological risk factors involved in the development of Long COVID. Illness-related anxiety and dysfunctional symptom expectations seem to contribute to symptom persistence.<h4>Aims</h4>With regard to the development of effective therapies, our primary aim is to investigate whether symptoms of Long COVID can be improved by a targeted modification of illness-related anxiety and dysfunctional symptom expectations. Second, we aim to identify additional psychosocial risk factors that contribute to the persistence of Long COVID, and compare them with risk factors for symptom persistence in other clinical conditions.<h4>Method</h4>We will conduct an observer-blinded, three-arm, randomised controlled trial. A total of 258 patients with Long COVID will be randomised into three groups of equal size: targeted expectation management in addition to treatment as usual (TAU), non-specific supportive treatment plus TAU, or TAU only. Both active intervention groups will comprise three individual online video consultation sessions and a booster session after 3 months. The primary outcome is baseline to post-interventional change in overall somatic symptom severity.<h4>Conclusions</h4>The study will shed light onto the action mechanisms of a targeted expectation management intervention for Long COVID, which, if proven effective, can be used stand-alone or in the context of broader therapeutic approaches. Further, the study will enable a better understanding of symptom persistence in Long COVID by identifying additional psychological risk factors.

CCPG1
Also flagged:Autophagylysosomedegradationendoplasmic reticulumlysosome-associated degradation-
Journal Article 2023-11-03 ✓ 1 Snippet Knupp J, Pletan ML, Arvan P, Tsai B.
In-Text Gene Mentions

CCPG1

Show Full Abstract

Lysosomal degradation of the endoplasmic reticulum (ER) and its components through the autophagy pathway has emerged as a major regulator of ER proteostasis. Commonly referred to as ER-phagy and ER-to-lysosome-associated degradation (ERLAD), how the ER is targeted to the lysosome has been recently clarified by a growing number of studies. Here, we summarize the discoveries of the molecular components required for lysosomal degradation of the ER and their proposed mechanisms of action. Additionally, we discuss how cells employ these machineries to create the different routes of ER-lysosome-associated degradation. Further, we review the role of ER-phagy in viral infection pathways, as well as the implication of ER-phagy in human disease. In sum, we provide a comprehensive overview of the current field of ER-phagy.

HTT
Also flagged:polyglutaminepolypeptideneurodegenerative diseasesnucleusglutaminepolypeptides
Journal Article 2023-11-03 ✓ 3 Snippets Kandola T, Venkatesan S, Zhang J, Lerbakken BT, Von Schulze A, Blanck JF, Wu J, Unruh JR, Berry P, Lange JJ, Box AC, Cook M, Sagui C, Halfmann R.
In-Text Gene Mentions

…Cav2.1; ATXN2, Ataxin-2;HTT, Huntingtin; AR, Androgen…

…lengthened polyQ and/orHttin vitro, in…

…of unlabeled mutantHttexon 1 in…

Show Full Abstract

A long-standing goal of amyloid research has been to characterize the structural basis of the rate-determining nucleating event. However, the ephemeral nature of nucleation has made this goal unachievable with existing biochemistry, structural biology, and computational approaches. Here, we addressed that limitation for polyglutamine (polyQ), a polypeptide sequence that causes Huntington's and other amyloid-associated neurodegenerative diseases when its length exceeds a characteristic threshold. To identify essential features of the polyQ amyloid nucleus, we used a direct intracellular reporter of self-association to quantify frequencies of amyloid appearance as a function of concentration, conformational templates, and rational polyQ sequence permutations. We found that nucleation of pathologically expanded polyQ involves segments of three glutamine (Q) residues at every other position. We demonstrate using molecular simulations that this pattern encodes a four-stranded steric zipper with interdigitated Q side chains. Once formed, the zipper poisoned its own growth by engaging naive polypeptides on orthogonal faces, in a fashion characteristic of polymer crystals with intramolecular nuclei. We further show that self-poisoning can be exploited to block amyloid formation, by genetically oligomerizing polyQ prior to nucleation. By uncovering the physical nature of the rate-limiting event for polyQ aggregation in cells, our findings elucidate the molecular etiology of polyQ diseases.

Also flagged:acute respiratory distress syndromeARDSbacteremiasepsisTMEM176BSLC2A5
Journal Article 2023-11-03 No Snippets Cao S, Li H, Xin J, Jin Z, Zhang Z, Li J, Zhu Y, Su L, Huang P, Jiang L, Du M, Christiani DC.
Show Full Abstract

<h4>Purpose</h4>The purpose of this study was to profile genetic causal factors of acute respiratory distress syndrome (ARDS) and early predict patients at high ARDS risk.<h4>Methods</h4>We performed a phenome-wide Mendelian Randomization analysis through summary statistics of an ARDS genome-wide association study (1250 cases and 1583 controls of European ancestry) and 33,150 traits. Transcriptomic data from human blood and lung tissues of a preclinical mouse model were used to validate biomarkers, which were further used to construct a prediction model and nomogram.<h4>Results</h4>A total of 1736 traits, including 1223 blood RNA, 159 plasma proteins, and 354 non-gene phenotypes (classified by Biochemistry, Anthropometry, Disease, Nutrition and Habit, Immunology, and Treatment), exhibited a potentially causal relationship with ARDS development, which were accessible through a user-friendly interface platform called CARDS (Causal traits for Acute Respiratory Distress Syndrome). Regarding candidate blood RNA, four genes were validated, namely TMEM176B, SLC2A5, CDC45, and VSIG8, showing differential expression in blood of ARDS patients compared to controls, as well as dynamic expression in mouse lung tissues. Importantly, the addition of four blood genes and five immune cell proportions significantly improved the prediction performance of ARDS development, with 0.791 of the area under the curve from receiver-operator characteristic, compared to 0.725 for the basic model consisting of Acute Physiology and Chronic Health Evaluation (APACHE) III Score, sex, body mass index, bacteremia, and sepsis. A model-based nomogram was also developed for the clinical practice.<h4>Conclusion</h4>This study identifies a wide range of ARDS relevant factors and develops a promising prediction model, enhancing early clinical management and intervention for ARDS development.

DCC
Also flagged:Netrin-1pancreatic cancerpancreatic ductal adenocarcinomaPDACprimary tumoraxon guidance
Journal Article 2023-11-03 ✓ 4 Snippets Dudgeon C, Casabianca A, Harris C, Ogier C, Bellina M, Fiore S, Bernet A, Ducarouge B, Goldschneider D, Su X, Pitarresi J, Hezel A, De S, Narrow W, Soliman F, Shields C, Vendramini-Costa DB, Prela O, Wang L, Astsaturov I, Mehlen P, Carpizo DR.
In-Text Gene Mentions

…The Netrin-1 receptorsDCC(deleted in colon…

…for Ntn1, Elf3,Dcc, Unc5a, Unc5b, Unc5c,…

…detectable levels ofDCCand minimal to…

…that also lackedDCCexpression ( Figure…

Show Full Abstract

The biology of metastatic pancreatic ductal adenocarcinoma (PDAC) is distinct from that of the primary tumor due to changes in cell plasticity governed by a distinct transcriptome. Therapeutic strategies that target this distinct biology are needed. We detect an upregulation of the neuronal axon guidance molecule Netrin-1 in PDAC liver metastases that signals through its dependence receptor (DR), uncoordinated-5b (Unc5b), to facilitate metastasis in vitro and in vivo. The mechanism of Netrin-1 induction involves a feedforward loop whereby Netrin-1 on the surface of PDAC-secreted extracellular vesicles prepares the metastatic niche by inducing hepatic stellate cell activation and retinoic acid secretion that in turn upregulates Netrin-1 in disseminated tumor cells via RAR/RXR and Elf3 signaling. While this mechanism promotes PDAC liver metastasis, it also identifies a therapeutic vulnerability, as it can be targeted using anti-Netrin-1 therapy to inhibit metastasis using the Unc5b DR cell death mechanism.

HTT
Also flagged:DNAJB6Molecular chaperoneschaperoneLGMDD1autosomal disorderHsp70
Journal Article 2023-11-03 ✓ 1 Snippet Abayev-Avraham M, Salzberg Y, Gliksberg D, Oren-Suissa M, Rosenzweig R.
In-Text Gene Mentions

…molar ratio of DNAJB6:HTTEx1 -Q48 and…

Show Full Abstract

Molecular chaperones are essential cellular components that aid in protein folding and preventing the abnormal aggregation of disease-associated proteins. Mutations in one such chaperone, DNAJB6, were identified in patients with LGMDD1, a dominant autosomal disorder characterized by myofibrillar degeneration and accumulations of aggregated protein within myocytes. The molecular mechanisms through which such mutations cause this dysfunction, however, are not well understood. Here we employ a combination of solution NMR and biochemical assays to investigate the structural and functional changes in LGMDD1 mutants of DNAJB6. Surprisingly, we find that DNAJB6 disease mutants show no reduction in their aggregation-prevention activity in vitro, and instead differ structurally from the WT protein, affecting their interaction with Hsp70 chaperones. While WT DNAJB6 contains a helical element regulating its ability to bind and activate Hsp70, in LGMDD1 disease mutants this regulation is disrupted. These variants can thus recruit and hyperactivate Hsp70 chaperones in an unregulated manner, depleting Hsp70 levels in myocytes, and resulting in the disruption of proteostasis. Interfering with DNAJB6-Hsp70 binding, however, reverses the disease phenotype, suggesting future therapeutic avenues for LGMDD1.

OLFM4
Also flagged:Wntlumenbasal laminaMMP21carcinomasNF-κB
Journal Article 2023-11-03 ✓ 3 Snippets Nakai K, Lin H, Yamano S, Tanaka S, Kitamoto S, Saitoh H, Sakuma K, Kurauchi J, Akter E, Konno M, Ishibashi K, Kamata R, Ohashi A, Koseki J, Takahashi H, Yokoyama H, Shiraki Y, Enomoto A, Abe S, Hayakawa Y, Ushiku T, Mutoh M, Fujita Y, Kon S.
In-Text Gene Mentions

While Villin-CreERT2 mice recombine Cre-responsive elements in both differentiated cells and Lgr5+ stem cells28, low-dose, tamoxifen-dependent, mosaic expression of transgenes was primarily restricted to terminally differentiated enterocytes, but not occur in Olfm4-positive stem cells, Wheat Germ Agglutinin (WGA)-positive paneth and goblet cells, or DCLK1-positive tuft cells (Supplementary Fig. 1b).

…from Clontech, rabbit anti-Olfm4(39141), rabbit anti-p-ERK…

…not occur inOlfm4-positive stem cells, Wheat…

Show Full Abstract

Normal epithelial cells exert their competitive advantage over RasV12-transformed cells and eliminate them into the apical lumen via cell competition. However, the internal or external factors that compromise cell competition and provoke carcinogenesis remain elusive. In this study, we examine the effect of sequential accumulation of gene mutations, mimicking multi-sequential carcinogenesis on RasV12-induced cell competition in intestinal epithelial tissues. Consequently, we find that the directionality of RasV12-cell extrusion in Wnt-activated epithelia is reversed, and transformed cells are delaminated into the basal lamina via non-cell autonomous MMP21 upregulation. Subsequently, diffusively infiltrating, transformed cells develop into highly invasive carcinomas. The elevated production of MMP21 is elicited partly through NF-κB signaling, blockage of which restores apical elimination of RasV12 cells. We further demonstrate that the NF-κB-MMP21 axis is significantly bolstered in early colorectal carcinoma in humans. Collectively, this study shows that cells with high mutational burdens exploit cell competition for their benefit by behaving as unfit cells, endowing them with an invasion advantage.

HTT
Also flagged:neurodegenerative diseasesLRRK1Alzheimer'sParkinson'sAlzheimerHuntington
Journal Article 2023-11-03 ✓ 2 Snippets Al-Ayari EA, Shehata MG, El-Hadidi M, Shaalan MG.
In-Text Gene Mentions

HD: HTT, DMBK, GRIK2, VCP, VPS13A, ATXN1, ALS, MJD, UBQLN2, and CACNA1A.

…mellifera has higherHTT, UBQLN2, and DMBK…

Show Full Abstract

Alzheimer's, Parkinson's, and Huntington's are the most common neurodegenerative diseases that are incurable and affect the elderly population. Discovery of effective treatments for these diseases is often difficult, expensive, and serendipitous. Previous comparative studies on different model organisms have revealed that most animals share similar cellular and molecular characteristics. The meta-SNP tool includes four different integrated tools (SIFT, PANTHER, SNAP, and PhD-SNP) was used to identify non synonymous single nucleotide polymorphism (nsSNPs). Prediction of nsSNPs was conducted on three representative proteins for Alzheimer's, Parkinson's, and Huntington's diseases; APPl in Drosophila melanogaster, LRRK1 in Aedes aegypti, and VCPl in Tribolium castaneum. With the possibility of using insect models to investigate neurodegenerative diseases. We conclude from the protein comparative analysis between different insect models and nsSNP analyses that D. melanogaster is the best model for Alzheimer's representing five nsSNPs of the 21 suggested mutations in the APPl protein. Aedes aegypti is the best model for Parkinson's representing three nsSNPs in the LRRK1 protein. Tribolium castaneum is the best model for Huntington's disease representing 13 SNPs of 37 suggested mutations in the VCPl protein. This study aimed to improve human neural health by identifying the best insect to model Alzheimer's, Parkinson's, and Huntington's.

HFE
Also flagged:cardiovascular diseaseCVDhypertensiongallstone diseasesgallstonesGallbladder
Journal Article 2023-11-03 ✓ 1 Snippet Joukar F, Ashoobi MT, Alizadeh A, Zeinali T, Faraji N, Tabatabaii M, Mansour-Ghanaei R, Naghipour M, Mansour-Ghanaei F.
In-Text Gene Mentions

…patients with provenhemochromatosis, were considered as…

Show Full Abstract

<h4>Background</h4>Ultrasound is an important method to determine the volume of the gallbladder and check its structure. Considering the variation in the size and volume of the gallbladder in disease and physiological conditions, determining the volume of the gallbladder is clinically valuable. This study was carried out to evaluate the gallbladder volume and its association with patients' demographic data in the Prospective Epidemiological Research Studies of Iranian Adults (PERSIAN) Guilan cohort study (PGCS) population.<h4>Methods</h4>In this cross-sectional study, 957 individuals aged 35-70 participated in determining the gallbladder volume by a radiologist based on the ultrasound method. The demographical data were collected using a questionnaire. After fasting for 12 h, the ultrasound was performed with an Ultrasonic device (Sonix SP series) with a 3.5 to 5 MHz probe.<h4>Results</h4>The total frequency of gallbladder lesions was 2.2%. The results showed a significant association between marriage and gender with the presence or absence of lesions in the studied participants (P < 0.05). Also, significant differences were reported between the volume of gallbladder and gender, body mass index (BMI), social and economic status (SES), metabolic equivalent of task (MET), history of cardiovascular disease (CVD), and hypertension (P < 0.05). The results of a linear regression represented a significant association between gender, BMI, MET, and CVD and the mean volume of the gallbladder (P < 0.05). However, there was no significant association between the presence or absence of a lesion and the individuals' average gallbladder volume (P > 0.05).<h4>Conclusion</h4>According to our results, gender, BMI, MET, and CVD were significantly associated with gallbladder volume.

TNFSF4
Also flagged:tumorPD-1PD-L1PD-L2IDOTIM3
Journal Article 2023-11-03 ✓ 1 Snippet Choi JE, Lee JS, Jin MS, Nikas IP, Kim K, Yang S, Park SY, Koh J, Yang S, Im SA, Ryu HS.
In-Text Gene Mentions

…Colorado, USA), OX40L (TNFSF4) (1:30; Millipore-Sigma, Mass…

Show Full Abstract

<h4>Background</h4>This study aimed to develop a novel combined immune score (CIS)-based model assessing prognosis in triple-negative breast cancer (TNBC).<h4>Methods</h4>The expression of eight immune markers (PD-1, PD-L1, PD-L2, IDO, TIM3, OX40, OX40L, and H7-H2) was assessed with immunohistochemistry on the tumor cells (TCs) and immune cells (ICs) of 227 TNBC cases, respectively, and subsequently associated with selected clinicopathological parameters and survival. Data retrieved from The Cancer Genome Atlas (TCGA) were further examined to validate our findings.<h4>Results</h4>All immune markers were often expressed in TCs and ICs, except for PD-1 which was not expressed in TCs. In ICs, the expression of all immune markers was positively correlated between one another, except between PD-L1 and OX40, also TIM3 and OX40. In ICs, PD-1, PD-L1, and OX40L positive expression was associated with a longer progression-free survival (PFS; p = 0.040, p = 0.020, and p = 0.020, respectively). In TCs, OX40 positive expression was associated with a shorter PFS (p = 0.025). Subsequently, the TNBC patients were classified into high and low combined immune score groups (CIS-H and CIS-L), based on the expression levels of a selection of biomarkers in TCs (TCIS-H or TCIS-L) and ICs (ICIS-H or ICIS-L). The TCIS-H group was significantly associated with a longer PFS (p < 0.001). Furthermore, the ICIS-H group was additionally associated with a longer PFS (p < 0.001) and overall survival (OS; p = 0.001), at significant levels. In the multivariate analysis, both TCIS-H and ICIS-H groups were identified as independent predictors of favorable PFS (p = 0.012 and p = 0.001, respectively). ICIS-H was also shown to be an independent predictor of favorable OS (p = 0.003). The analysis of the mRNA expression data from TCGA also validated our findings regarding TNBC.<h4>Conclusion</h4>Our novel TCIS and ICIS exhibited a significant prognostic value in TNBC. Additional research would be needed to strengthen our findings and identify the most efficient prognostic and predictive biomarkers for TNBC patients.

DCC
Also flagged:bone transcription factornode of Ranviertranscription factorstranscription factorSp7osteoblast maturation
Journal Article 2023-11-03 ✓ 1 Snippet Elbaz B, Darwish A, Vardy M, Isaac S, Tokars HM, Dzhashiashvili Y, Korshunov K, Prakriya M, Eden A, Popko B.
In-Text Gene Mentions

Dcc

Show Full Abstract

Oligodendrocytes are the primary producers of many extracellular matrix (ECM)-related proteins found in the CNS. Therefore, oligodendrocytes play a critical role in the determination of brain stiffness, node of Ranvier formation, perinodal ECM deposition, and perineuronal net formation, all of which depend on the ECM. Nevertheless, the transcription factors that control ECM-related gene expression in oligodendrocytes remain unknown. Here, we found that the transcription factor Osterix (also known as Sp7) binds in proximity to genes important for CNS ECM and node of Ranvier formation and mediates their expression. Oligodendrocyte-specific ablation of Sp7 changes ECM composition and brain stiffness and results in aberrant node of Ranvier formation. Sp7 is known to control osteoblast maturation and bone formation. Our comparative analyses suggest that Sp7 plays a conserved biological role in oligodendrocytes and in bone-forming cells, where it mediates brain and bone tissue stiffness by controlling expression of ECM components.

Also flagged:Soluble Epoxide HydrolaseAlcohol-Associated Liver Diseaselipidmetabolismethanolphenyl
Journal Article 2023-11-03 No Snippets Warner JB, Hardesty JE, Song YL, Floyd AT, Deng Z, Jebet A, He L, Zhang X, McClain CJ, Hammock BD, Warner DR, Kirpich IA.
Show Full Abstract

Alcohol-associated liver disease (ALD) is a serious public health problem with limited pharmacologic options. The goal of the current study was to investigate the efficacy of pharmacologic inhibition of soluble epoxide hydrolase (sEH), an enzyme involved in lipid metabolism, in experimental ALD, and to examine the underlying mechanisms. C57BL/6J male mice were subjected to acute-on-chronic ethanol (EtOH) feeding with or without the sEH inhibitor 4-[[trans-4-[[[[4-trifluoromethoxy phenyl]amino]carbonyl]-amino]cyclohexyl]oxy]-benzoic acid (TUCB). Liver injury was assessed by multiple end points. Liver epoxy fatty acids and dihydroxy fatty acids were measured by targeted metabolomics. Whole-liver RNA sequencing was performed, and free modified RNA bases were measured by mass spectrometry. EtOH-induced liver injury was ameliorated by TUCB treatment as evidenced by reduced plasma alanine aminotransferase levels and was associated with attenuated alcohol-induced endoplasmic reticulum stress, reduced neutrophil infiltration, and increased numbers of hepatic M2 macrophages. TUCB altered liver epoxy and dihydroxy fatty acids and led to a unique hepatic transcriptional profile characterized by decreased expression of genes involved in apoptosis, inflammation, fibrosis, and carcinogenesis. Several modified RNA bases were robustly changed by TUCB, including N<sup>6</sup>-methyladenosine and 2-methylthio-N<sup>6</sup>-threonylcarbamoyladenosine. These findings show the beneficial effects of sEH inhibition by TUCB in experimental EtOH-induced liver injury, warranting further mechanistic studies to explore the underlying mechanisms, and highlighting the translational potential of sEH as a drug target for this disease.

Also flagged:Neuroacanthocytosis SyndromesVPS13Achorea-acanthocytosisXK diseaseMcLeod syndromeXK
Journal Article 2023-11-03 No Snippets Kaestner L.
Show Full Abstract

The 11<sup>th</sup> International Meeting on Neuroacanthocytosis Syndromes was held on September 15<sup>th</sup>-17<sup>th</sup>, 2023 at the University Hospital Campus in Homburg/Saar, Germany. The meeting followed the previous ten international symposia, the last of which was held online due to restrictions due to COVID19, in March 2021. The setting of the meeting encouraged interactions, exchange of ideas, and networking opportunities among the participants from around the globe, including basic and clinical scientists, clinicians, and especially patients, their relatives and caregivers. A total of about 20 oral communications were presented in five scientific sessions accompanied by a keynote lecture, a "Poster-Blitz" session, the "Glenn Irvine Prize" lecture and a panel discussion about "Patient registries, international cooperation & future perspectives". In summary, attendees discussed recent advances and set the basis for the next steps, action points, and future studies in close collaboration with the patient associations, which were actively involved in the whole process.

Also flagged:multiple myelomadegradationtranslationaloncogenestumorgene expression
Journal Article 2023-11-03 No Snippets Ismail NH, Mussa A, Al-Khreisat MJ, Mohamed Yusoff S, Husin A, Al-Jamal HAN, Johan MF, Islam MA.
Show Full Abstract

The dysregulation of non-coding RNAs (ncRNAs), specifically microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), leads to the development and advancement of multiple myeloma (MM). miRNAs, in particular, are paramount in post-transcriptional gene regulation, promoting mRNA degradation and translational inhibition. As a result, miRNAs can serve as oncogenes or tumor suppressors depending on the target genes. In MM, miRNA disruption could result in abnormal gene expression responsible for cell growth, apoptosis, and other biological processes pertinent to cancer development. The dysregulated miRNAs inhibit the activity of tumor suppressor genes, contributing to disease progression. Nonetheless, several miRNAs are downregulated in MM and have been identified as gene regulators implicated in extracellular matrix remodeling and cell adhesion. miRNA depletion potentially facilitates the tumor advancement and resistance of therapeutic drugs. Additionally, lncRNAs are key regulators of numerous cellular processes, such as gene expression, chromatin remodeling, protein trafficking, and recently linked MM development. The lncRNAs are uniquely expressed and influence gene expression that supports MM growth, in addition to facilitating cellular proliferation and viability via multiple molecular pathways. miRNA and lncRNA alterations potentially result in anomalous gene expression and interfere with the regular functioning of MM. Thus, this review aims to highlight the dysregulation of these ncRNAs, which engender novel therapeutic modalities for the treatment of MM.

HFE
Also flagged:α1-AdrenoceptorPrazosinfructosemetabolic syndromemetabolic dysfunction-associated fatty liver diseasehypertension
Journal Article 2023-11-03 ✓ 1 Snippet Kubacka M, Nowak B, Zadrożna M, Szafarz M, Latacz G, Marona H, Sapa J, Mogilski S, Bednarski M, Kotańska M.
In-Text Gene Mentions

Hemochromatosiswas also rarely…

Show Full Abstract

Excessive fructose consumption may lead to metabolic syndrome, metabolic dysfunction-associated fatty liver disease (MAFLD) and hypertension. α1-adrenoceptors antagonists are antihypertensive agents that exert mild beneficial effects on the metabolic profile in hypertensive patients. However, they are no longer used as a first-line therapy for hypertension based on Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) outcomes. Later studies have shown that quinazoline-based α1-adrenolytics (prazosin, doxazosin) induce apoptosis; however, this effect was independent of α1-adrenoceptor blockade and was associated with the presence of quinazoline moiety. Recent studies showed that α1-adrenoceptors antagonists may reduce mortality in COVID-19 patients due to anti-inflammatory properties. MH-76 (1-[3-(2,6-dimethylphenoxy)propyl]-4-(2-methoxyphenyl)piperazine hydrochloride)) is a non-quinazoline α1-adrenoceptor antagonist which, in fructose-fed rats, exerted anti-inflammatory, antihypertensive properties and reduced insulin resistance and visceral adiposity. In this study, we aimed to evaluate the effect of fructose consumption and treatment with α1-adrenoceptor antagonists of different classes (MH-76 and prazosin) on liver tissue of fructose-fed rats. Livers were collected from four groups (Control, Fructose, Fructose + MH-76 and Fructose + Prazosin) and subjected to biochemical and histopathological studies. Both α1-adrenolytics reduced macrovesicular steatosis and triglycerides content of liver tissue and improved its antioxidant capacity. Treatment with MH-76, contrary to prazosin, reduced leucocytes infiltration as well as decreased elevated IL-6 and leptin concentrations. Moreover, the MH-76 hepatotoxicity in hepatoma HepG2 cells was less than that of prazosin. The use of α1-adrenolytics with anti-inflammatory properties may be an interesting option for treatment of hypertension with metabolic complications.

Also flagged:Cholesterolcolorectal canceralcoholcancermetabolismtumors
Journal Article 2023-11-03 No Snippets He X, Lan H, Jin K, Liu F.
Show Full Abstract

Colorectal cancer (CRC) is one of the most lethal human malignancies, and with the growth of societies and lifestyle changes, the rate of people suffering from it increases yearly. Important factors such as genetics, family history, nutrition, lifestyle, smoking, and alcohol can play a significant role in increasing susceptibility to this cancer. On the other hand, the metabolism of several macromolecules is also involved in the fate of tumors and immune cells. The evidence discloses that cholesterol and its metabolism can play a role in the pathogenesis of several cancers because there appears to be an association between cholesterol levels and CRC, and cholesterol-lowering drugs may reduce the risk. Furthermore, changes or mutations of some involved genes in cholesterol metabolism, such as CYP7A1 as well as signaling pathways, such as mitogen-activated protein kinase (MAPK), can play a role in CRC pathogenesis. This review summarized and discussed the role of cholesterol in the pathogenesis of CRC as well as available cholesterol-related therapeutic approaches in CRC.

HFE
Also flagged:Acute Coronary SyndromeThalassemiacongenital hemoglobinopathyerythropoiesisanemiairon
Journal Article 2023-11-03 ✓ 3 Snippets Ullah H, Salih N, Tavaratsyan A, Sandesara M, Syed S, Us Saher N, Fleihan T.
In-Text Gene Mentions

…SecondaryHemochromatosisLeading to Acute…

…(ACS) due tohemochromatosis.…

…induced by secondaryhemochromatosis.…

Show Full Abstract

Thalassemia, a congenital hemoglobinopathy, is characterized by impaired erythropoiesis and peripheral hemolysis, leading to anemia. Thalassemia major, in particular, necessitates regular blood transfusions, resulting in iron accumulation in the body. Iron overload primarily affects the heart and can induce cardiac disorder, including defects in the pump and conduction system, which is one of the leading causes of mortality among thalassemics. The existing literature has revealed limited support for the occurrence of acute coronary syndrome (ACS) due to hemochromatosis. However, it does show that elevated troponin levels can be observed even in cases not associated with ACS. Here, we offer a rare case study of acute coronary syndrome in a patient with thalassemia major who also had elevated ferritin levels and abnormal troponin I values. The difficulty of cardiac problems in thalassemia major is highlighted by this case, as well as the necessity for more clinical attention and study to better comprehend and handle such instances.

bioRxiv 2023-11-03 Preprint (No Snippets API) Negrey JD, Frye BM, Johnson CS, Kim J, Barcus RA, Lockhart SN, Whitlow CT, Sutphen C, Chiou KL, Snyder-Mackler N, Montine TJ, Craft S, Shively CA, Register TC.
Show Full Abstract

<h4>INTRODUCTION</h4> Mediterranean diets may be neuroprotective and prevent cognitive decline relative to Western diets, however the underlying biology is poorly understood. <h4>METHODS</h4> We assessed the effects of Western vs. Mediterranean-like diets on RNAseq generated transcriptional profiles in temporal cortex and their relationships with changes in MRI neuroimaging phenotypes, circulating monocyte gene expression, and observations of social isolation and anxiety in 38 socially-housed, middle-aged female cynomolgus macaques. <h4>RESULTS</h4> Diet resulted in differential expression of seven transcripts (FDR<0.05). Cyclin dependent kinase 14 ( CDK14 ), a proinflammatory regulator, was lower in the Mediterranean group. The remaining six transcripts [i.e., “lunatic fringe” ( LFNG ), mannose receptor C type 2 ( MRC2 ), solute carrier family 3 member 2 ( SLCA32 ), butyrophilin subfamily 2 member A1 ( BTN2A1 ), katanin regulatory subunit B1 ( KATNB1 ), and transmembrane protein 268 ( TMEM268 )] were higher in cortex of the Mediterranean group and generally associated with anti-inflammatory/neuroprotective pathways. KATNB1 encodes a subcomponent of katanin, important in maintaining microtubule homeostasis. BTN2A1 is involved in immunomodulation of γδ T-cells which have anti-neuroinflammatory and neuroprotective effects. CDK14 , LFNG , MRC2, and SLCA32 are associated with inflammatory pathways. The latter four differentially expressed cortex transcripts were associated with monocyte transcript levels, changes in AD-relevant brain volumes determined by MRI over the course of the study, and social isolation and anxiety. CDK14 was positively correlated with monocyte inflammatory transcripts, changes in total brain, gray matter, cortical gray matter volumes, and time alone and anxious behavior, and negatively correlated with changes in total white matter and cerebrospinal fluid (CSF) volumes. In contrast, LFNG , MRC2 , and SLCA32 were negatively correlated with monocyte inflammatory transcripts and changes in total gray matter volume, and positively correlated with CSF volume changes, and SLCA32 was negatively correlated with time alone. <h4>DISCUSSION</h4> Collectively, our results suggest that relative to Western diets, Mediterranean diets confer protection against peripheral and central inflammation which is reflected in preserved brain structure and behavior.

medRxiv 2023-11-03 Preprint (No Snippets API) Plassmeyer SP, Florian CP, Kasper MJ, Chase R, Mueller S, Liu Y, White KM, Jungers CF, Djuranovic SP, Djuranovic S, Dougherty JD.
Show Full Abstract

De novo mutations cause a variety of neurodevelopmental disorders including autism. Recent whole genome sequencing from individuals with autism has shown that many de novo mutations also occur in untranslated regions (UTRs) of genes, but it is difficult to predict from sequence alone which mutations are functional, let alone causal. Therefore, we developed a high throughput assay to screen the transcriptional and translational effects of 997 variants from 5′UTR patient mutations. This assay successfully enriched for elements that alter reporter translation, identifying over 100 potentially functional mutations from probands. Studies in patient-derived cell lines further confirmed that these mutations can alter protein production in individuals with autism, and some variants fall in genes known to cause syndromic forms of autism, suggesting a diagnosis for these individual patients. Since UTR function varies by cell type, we further optimized this high throughput assay to enable assessment of mutations in neurons in vivo . First, comparing in cellulo to in vivo results, we demonstrate neurons have different principles of regulation by 5′UTRs, consistent with a more robust mechanism for reducing the impact of RNA secondary structure. Finally, we discovered patient mutations specifically altering the translational activity of additional known syndromic genes LRRC4 and ZNF644 in neurons of the brain. Overall our results highlight a new approach for assessing the impact of 5′UTR mutations across cell types and suggest that some cases of neurodevelopmental disorder may be caused by such variants.

HFE
Also flagged:osteoarthritisjoint disordergene expressionferroptosisironFTH1
Journal Article 2023-11-02 ✓ 1 Snippet Li H, Jiang X, Xiao Y, Zhang Y, Zhang W, Doherty M, Nestor J, Li C, Ye J, Sha T, Lyu H, Wei J, Zeng C, Lei G.
In-Text Gene Mentions

…genetic variants ofHFE, which encodes…

Show Full Abstract

Hand osteoarthritis is a common heterogeneous joint disorder with unclear molecular mechanisms and no disease-modifying drugs. In this study, we performed single-cell RNA sequencing analysis to compare the cellular composition and subpopulation-specific gene expression between cartilage with macroscopically confirmed osteoarthritis (n = 5) and cartilage without osteoarthritis (n = 5) from the interphalangeal joints of five donors. Of 105 142 cells, we identified 13 subpopulations, including a novel subpopulation with inflammation-modulating potential annotated as inflammatory chondrocytes. Fibrocartilage chondrocytes exhibited extensive alteration of gene expression patterns in osteoarthritic cartilage compared with nonosteoarthritic cartilage. Both inflammatory chondrocytes and fibrocartilage chondrocytes showed a trend toward increased numbers in osteoarthritic cartilage. In these two subpopulations from osteoarthritic cartilage, the ferroptosis pathway was enriched, and expression of iron overload-related genes, e.g., FTH1, was elevated. To verify these findings, we conducted a Mendelian randomization study using UK Biobank and a population-based cross-sectional study using data collected from Xiangya Osteoarthritis Study. Genetic predisposition toward higher expression of FTH1 mRNA significantly increased the risk of hand osteoarthritis (odds ratio = 1.07, 95% confidence interval: 1.02-1.11) among participants (n = 332 668) in UK Biobank. High levels of serum ferritin (encoded by FTH1), a biomarker of body iron overload, were significantly associated with a high prevalence of hand osteoarthritis among participants (n = 1 241) of Xiangya Osteoarthritis Study (P-for-trend = 0.037). In conclusion, our findings indicate that inflammatory and fibrocartilage chondrocytes are key subpopulations and that ferroptosis may be a key pathway in hand osteoarthritis, providing new insights into the pathophysiology and potential therapeutic targets of hand osteoarthritis.

POU3F2
Also flagged:Gene Expressionschizophreniabrain disorderbrain developmentcognitive dysfunctionpathogenesis
Journal Article 2023-11-02 ✓ 1 Snippet Sawada T, Barbosa AR, Araujo B, McCord AE, D'Ignazio L, Benjamin KJM, Sheehan B, Zabolocki M, Feltrin A, Arora R, Brandtjen AC, Kleinman JE, Hyde TM, Bardy C, Weinberger DR, Paquola ACM, Erwin JA.
In-Text Gene Mentions

POU3F2

Show Full Abstract

<h4>Objective</h4>Schizophrenia is a brain disorder that originates during neurodevelopment and has complex genetic and environmental etiologies. Despite decades of clinical evidence of altered striatal function in affected patients, studies examining its cellular and molecular mechanisms in humans are limited. To explore neurodevelopmental alterations in the striatum associated with schizophrenia, the authors established a method for the differentiation of induced pluripotent stem cells (iPSCs) into ventral forebrain organoids (VFOs).<h4>Methods</h4>VFOs were generated from postmortem dural fibroblast-derived iPSCs of four individuals with schizophrenia and four neurotypical control individuals for whom postmortem caudate genotypes and transcriptomic data were profiled in the BrainSeq neurogenomics consortium. Individuals were selected such that the two groups had nonoverlapping schizophrenia polygenic risk scores (PRSs).<h4>Results</h4>Single-cell RNA sequencing analyses of VFOs revealed differences in developmental trajectory between schizophrenia and control individuals in which inhibitory neuronal cells from the patients exhibited accelerated maturation. Furthermore, upregulated genes in inhibitory neurons in schizophrenia VFOs showed a significant overlap with upregulated genes in postmortem caudate tissue of individuals with schizophrenia compared with control individuals, including the donors of the iPSC cohort.<h4>Conclusions</h4>The findings suggest that striatal neurons derived from high-PRS individuals with schizophrenia carry abnormalities that originated during early brain development and that the VFO model can recapitulate disease-relevant cell type-specific neurodevelopmental phenotypes in a dish.

Also flagged:neurogenic bladderspina bifidapeptidesdysraphismgestationneurogenic
Journal Article 2023-11-02 No Snippets Fazelinia H, Ding H, Taylor D, Spruce L, Roof J, Weiss D, Fesi J, Ischiropoulos H, Zderic S.
Show Full Abstract

Neurogenic bladder poses a major morbidity in children with spina bifida (SB), and videourodynamic studies (VUDS) are used to stratify this risk. This small-scale pilot study utilized current mass-spectrometry-based proteomic approaches to identify peptides or proteins in urine that may differentiate children at high risk of developing renal complications from a neurogenic bladder. Twenty-two urine samples of which nine had high bladder pressure storage that put the upper urinary tract at risk, while 13 with a lower risk for renal compromise were analyzed. More than 1,900 peptides across all 22 samples were quantified, and 115 peptides differed significantly (<i>P</i> < 0.05) between the two groups. Using machine learning approaches five peptides that showed the greatest differences between these two clinical categories were used to build a classifier. We tested this classifier by blind analysis of an additional six urine samples and showed that it correctly assigned the unknown samples in their proper risk category. These promising results indicate that a urinary screening test based on peptides could be performed on a regular basis to stratify the neurogenic bladder into low or high-risk categories. Expanding this work to larger cohorts as well as across a broad spectrum of urodynamics outcomes may provide a useful diagnostic test for neurogenic bladder.<b>NEW & NOTEWORTHY</b> This approach could help risk stratify the neurogenic bladder in patients with spina bifida and could allow us to safely defer on up to 1/3 of urodynamic studies. These pilot data justify a larger trial before this approach becomes a clinical tool.

Also flagged:brain developmentorganizationgene expressionnucleusmyelinationcell maturation
Journal Article 2023-11-02 No Snippets Heller DT, Kolson DR, Brandebura AN, Amick EM, Wan J, Ramadan J, Holcomb PS, Liu S, Deerinck TJ, Ellisman MH, Qian J, Mathers PH, Spirou GA.
Show Full Abstract

Early postnatal brain development involves complex interactions among maturing neurons and glial cells that drive tissue organization. We previously analyzed gene expression in tissue from the mouse medial nucleus of the trapezoid body (MNTB) during the first postnatal week to study changes that surround rapid growth of the large calyx of Held (CH) nerve terminal. Here, we present genes that show significant changes in gene expression level during the second postnatal week, a developmental timeframe that brackets the onset of airborne sound stimulation and the early stages of myelination. Gene Ontology analysis revealed that many of these genes are related to the myelination process. Further investigation of these genes using a previously published cell type-specific bulk RNA-Seq data set in cortex and our own single-cell RNA-Seq data set in the MNTB revealed enrichment of these genes in the oligodendrocyte lineage (OL) cells. Combining the postnatal day (P)6-P14 microarray gene expression data with the previously published P0-P6 data provided fine temporal resolution to investigate the initiation and subsequent waves of gene expression related to OL cell maturation and the process of myelination. Many genes showed increasing expression levels between P2 and P6 in patterns that reflect OL cell maturation. Correspondingly, the first myelin proteins were detected by P4. Using a complementary, developmental series of electron microscopy 3D image volumes, we analyzed the temporal progression of axon wrapping and myelination in the MNTB. By employing a combination of established ultrastructural criteria to classify reconstructed early postnatal glial cells in the 3D volumes, we demonstrated for the first time that astrocytes within the mouse MNTB extensively wrap the axons of the growing CH terminal prior to OL cell wrapping and compaction of myelin. Our data revealed significant expression of several myelin genes and enrichment of multiple genes associated with lipid metabolism in astrocytes, which may subserve axon wrapping in addition to myelin formation. The transition from axon wrapping by astrocytes to OL cells occurs rapidly between P4 and P9 and identifies a potential new role of astrocytes in priming calyceal axons for subsequent myelination.

TRIM38
Also flagged:MARCH5STINGStimulator of interferon genespost-translational modificationsphosphorylationmitochondrial ubiquitin ligase
Journal Article 2023-11-02 ✓ 1 Snippet Son K, Jeong S, Eom E, Kwon D, Kang SJ.
In-Text Gene Mentions

TRIM38

Show Full Abstract

Stimulator of interferon genes (STING) is a core DNA sensing adaptor in innate immune signaling. STING activity is regulated by a variety of post-translational modifications (PTMs), including phosphorylation, ubiquitination, sumoylation, palmitoylation, and oxidation, as well as the balance between active and inactive polymer formation. It remains unclear, though, how different PTMs and higher order structures cooperate to regulate STING activity. Here, we report that the mitochondrial ubiquitin ligase MARCH5 (Membrane Associated Ring-CH-type Finger 5, also known as MITOL) ubiquitinates STING and enhances its activation. A long-term MARCH5 deficiency, in contrast, leads to the production of reactive oxygen species, which then facilitate the formation of inactive STING polymers by oxidizing mouse STING cysteine 205. We show that MARCH5-mediated ubiquitination of STING prevents the oxidation-induced STING polymer formation. Our findings highlight that MARCH5 balances STING ubiquitination and polymer formation and its control of STING activation is contingent on oxidative conditions.

LRRC7SHISA6DCC
Also flagged:localizationpeptidepeptidesNucleusureatrypsin
Journal Article 2023-11-02 ✓ 3 Snippets Tüshaus J, Sakhteman A, Lechner S, The M, Mucha E, Krisp C, Schlegel J, Delbridge C, Kuster B.
In-Text Gene Mentions

…cerebral cortex areSHISA6and SHISA7, which…

…as SYNPO andLRRC7involved in spine…

…basal ganglia (ACE,DCC, CHAT) and midbrain…

Show Full Abstract

Substantial efforts are underway to deepen our understanding of human brain morphology, structure, and function using high-resolution imaging as well as high-content molecular profiling technologies. The current work adds to these approaches by providing a comprehensive and quantitative protein expression map of 13 anatomically distinct brain regions covering more than 11,000 proteins. This was enabled by the optimization, characterization, and implementation of a high-sensitivity and high-throughput microflow liquid chromatography timsTOF tandem mass spectrometry system (LC-MS/MS) capable of analyzing more than 2,000 consecutive samples prepared from formalin-fixed paraffin embedded (FFPE) material. Analysis of this proteomic resource highlighted brain region-enriched protein expression patterns and functional protein classes, protein localization differences between brain regions and individual markers for specific areas. To facilitate access to and ease further mining of the data by the scientific community, all data can be explored online in a purpose-built R Shiny app (https://brain-region-atlas.proteomics.ls.tum.de).

CCPG1
Also flagged:papillary thyroid carcinomacancerPTCZNF518BDTD2CCAR1
Journal Article 2023-11-02 ✓ 1 Snippet Hosseiniyan Khatibi SM, Zununi Vahed S, Homaei Rad H, Emdadi M, Akbarpour Z, Teshnehlab M, Pirmoradi S, Alizadeh E.
In-Text Gene Mentions

Cell cycle and apoptosis regulator 1cycle and apoptosis…

Show Full Abstract

<h4>Objective</h4>Thyroid Cancer (TC) is the most frequent endocrine malignancy neoplasm. It is the sixth cause of cancer in women worldwide. The treatment process could be expedited by identifying the controlling molecular mechanisms at the early and late stages, which can contribute to the acceleration of treatment schemes and the improvement of patient survival outcomes. In this work, we study the significant mRNAs through Machine Learning Algorithms in both the early and late stages of Papillary Thyroid Cancer (PTC).<h4>Method</h4>During the course of our study, we investigated various methods and techniques to obtain suitable results. The sequence of procedures we followed included organizing data, using nested cross-validation, data cleaning, and normalization at the initial stage. Next, to apply feature selection, a t-test and binary Non-Dominated Sorting Genetic Algorithm II (NSGAII) were chosen to be employed. Later on, during the analysis stage, the discriminative power of the selected features was evaluated using machine learning and deep learning algorithms. Finally, we considered the selected features and utilized Association Rule Mining algorithm to identify the most important ones for improving the decoding of dominant molecular mechanisms in PTC through its early and late stages.<h4>Result</h4>The SVM classifier was able to distinguish between early and late-stage categories with an accuracy of 83.5% and an AUC of 0.78 based on the identified mRNAs. The most significant genes associated with the early and late stages of PTC were identified as (e.g., ZNF518B, DTD2, CCAR1) and (e.g., lnc-DNAJB6-7:7, RP11-484D2.3, MSL3P1), respectively.<h4>Conclusion</h4>Current study reveals a clear picture of the potential candidate genes that could play a major role not only in the early stage, but also throughout the late one. Hence, the findings could be of help to identify therapeutic targets for more effective PTC drug developments.

Also flagged:formationtissue homeostasisActomyosincell-cell adhesionmembranetissue morphogenesis
Journal Article 2023-11-02 No Snippets Vian A, Pochitaloff M, Yen ST, Kim S, Pollock J, Liu Y, Sletten EM, Campàs O.
Show Full Abstract

Mechanics is known to play a fundamental role in many cellular and developmental processes. Beyond active forces and material properties, osmotic pressure is believed to control essential cell and tissue characteristics. However, it remains very challenging to perform in situ and in vivo measurements of osmotic pressure. Here we introduce double emulsion droplet sensors that enable local measurements of osmotic pressure intra- and extra-cellularly within 3D multicellular systems, including living tissues. After generating and calibrating the sensors, we measure the osmotic pressure in blastomeres of early zebrafish embryos as well as in the interstitial fluid between the cells of the blastula by monitoring the size of droplets previously inserted in the embryo. Our results show a balance between intracellular and interstitial osmotic pressures, with values of approximately 0.7 MPa, but a large pressure imbalance between the inside and outside of the embryo. The ability to measure osmotic pressure in 3D multicellular systems, including developing embryos and organoids, will help improve our understanding of its role in fundamental biological processes.

B4GALT5
Also flagged:glycansviral infectionsglycanglycosaminoglycansglycosphingolipidsvirion
Journal Article 2023-11-02 ✓ 5 Snippets Bagdonaite I, Marinova IN, Rudjord-Levann AM, Pallesen EMH, King-Smith SL, Karlsson R, Rømer TB, Chen YH, Miller RL, Olofsson S, Nordén R, Bergström T, Dabelsteen S, Wandall HH.
In-Text Gene Mentions

We have previously assessed transcriptomic profiles of MGAT1 KO, C1GALT1 KO, and B4GALT5 KO N/TERT keratinocytes6, where diverse transcriptomic changes affecting cell signaling, adhesion, and differentiation were identified, some of which may have bearings for the viral infection.

Ceramide and glucosylceramide, representing initial steps of GSL synthesis, were predominantly located intracellularly in WT cells, while some ceramide accumulation could be seen in B4GALT5 KO, devoid of elaborate GSLs (Fig. 3b).

…Through KO ofB4GALT5or ST3GAL5 ,…

…observed in bothB4GALT5and ST3GAL5 KOs,…

…was observed forB4GALT5KO cells, suggesting…

Show Full Abstract

Viral and host glycans represent an understudied aspect of host-pathogen interactions, despite potential implications for treatment of viral infections. This is due to lack of easily accessible tools for analyzing glycan function in a meaningful context. Here we generate a glycoengineered keratinocyte library delineating human glycosylation pathways to uncover roles of specific glycans at different stages of herpes simplex virus type 1 (HSV-1) infectious cycle. We show the importance of cellular glycosaminoglycans and glycosphingolipids for HSV-1 attachment, N-glycans for entry and spread, and O-glycans for propagation. While altered virion surface structures have minimal effects on the early interactions with wild type cells, mutation of specific O-glycosylation sites affects glycoprotein surface expression and function. In conclusion, the data demonstrates the importance of specific glycans in a clinically relevant human model of HSV-1 infection and highlights the utility of genetic engineering to elucidate the roles of specific viral and cellular carbohydrate structures.

Also flagged:extracellularvesiclessecretionangiogenesisnitric oxide synthaseNOS
Journal Article 2023-11-02 No Snippets Kargl CK, Jia Z, Shera DA, Sullivan BP, Burton LC, Kim KH, Nie Y, Hubal MJ, Shannahan JH, Kuang S, Gavin TP.
Show Full Abstract

Skeletal muscle fibers regulate surrounding endothelial cells (EC) via secretion of numerous angiogenic factors, including extracellular vesicles (SkM-EV). Muscle fibers are broadly classified as oxidative (OXI) or glycolytic (GLY) depending on their metabolic characteristics. OXI fibers secrete more pro-angiogenic factors and have greater capillary densities than GLY fibers. OXI muscle secretes more EV than GLY, however it is unknown whether muscle metabolic characteristics regulate EV contents and signaling potential. EVs were isolated from primarily oxidative or glycolytic muscle tissue from mice. MicroRNA (miR) contents were determined and endothelial cells were treated with OXI- and GLY-EV to investigate angiogenic signaling potential. There were considerable differences in miR contents between OXI- and GLY-EV and pathway analysis identified that OXI-EV miR were predicted to positively regulate multiple endothelial-specific pathways, compared to GLY-EV. OXI-EV improved in vitro angiogenesis, which may have been mediated through nitric oxide synthase (NOS) related pathways, as treatment of endothelial cells with a non-selective NOS inhibitor abolished the angiogenic benefits of OXI-EV. This is the first report to show widespread differences in miR contents between SkM-EV isolated from metabolically different muscle tissue and the first to demonstrate that oxidative muscle tissue secretes EV with greater angiogenic signaling potential than glycolytic muscle tissue.

HTT
Also flagged:formaldehydemyelinBSAChromiummitochondriamitochondrial
Journal Article 2023-11-02 ✓ 2 Snippets Jin P, Zhu B, Jia Y, Zhang Y, Wang W, Shen Y, Zhong Y, Zheng Y, Wang Y, Tong Y, Zhang W, Li S.
In-Text Gene Mentions

…Interestingly, huntingtin (htt), which is…

…were predicted ashtt-interacting proteins (for…

Show Full Abstract

Spiders are renowned for their efficient capture of flying insects using intricate aerial webs. How the spider nervous systems evolved to cope with this specialized hunting strategy and various environmental clues in an aerial space remains unknown. Here we report a brain-cell atlas of >30,000 single-cell transcriptomes from a web-building spider (Hylyphantes graminicola). Our analysis revealed the preservation of ancestral neuron types in spiders, including the potential coexistence of noradrenergic and octopaminergic neurons, and many peptidergic neuronal types that are lost in insects. By comparing the genome of two newly sequenced plesiomorphic burrowing spiders with three aerial web-building spiders, we found that the positively selected genes in the ancestral branch of web-building spiders were preferentially expressed (42%) in the brain, especially in the three mushroom body-like neuronal types. By gene enrichment analysis and RNAi experiments, these genes were suggested to be involved in the learning and memory pathway and may influence the spiders' web-building and hunting behaviour. Our results provide key sources for understanding the evolution of behaviour in spiders and reveal how molecular evolution drives neuron innovation and the diversification of associated complex behaviours.

Also flagged:rhythmorganizationGFPRFPchx10Shox2
Journal Article 2023-11-02 No Snippets Pallucchi I, Bertuzzi M, Madrid D, Fontanel P, Higashijima SI, El Manira A.
Show Full Abstract

The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules, yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Here we use adult zebrafish to link the molecular diversity of motoneurons (MNs) and the rhythm-generating V2a interneurons (INs) with the modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of MNs and V2a INs reflects their functional segregation into slow, intermediate or fast subtypes. Furthermore, we reveal shared molecular signatures between V2a INs and MNs of the three speed circuit modules. Overall, by characterizing how the molecular diversity of MNs and V2a INs relates to their function, connectivity and behavior, our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general.

Also flagged:mineralTAC4Osteoporosisfracturefracturesgene expression
Journal Article 2023-11-02 No Snippets Nethander M, Movérare-Skrtic S, Kämpe A, Coward E, Reimann E, Grahnemo L, Borbély É, Helyes Z, Funck-Brentano T, Cohen-Solal M, Tuukkanen J, Koskela A, Wu J, Li L, Lu T, Gabrielsen ME, Estonian Biobank Research Team, Mägi R, Hoff M, Lerner UH, Henning P, Ullum H, Erikstrup C, Brunak S, DBDS Genomic Consortium, Langhammer A, Tuomi T, Oddsson A, Stefansson K, Pettersson-Kymmer U, Ostrowski SR, Pedersen OBV, Styrkarsdottir U, Mäkitie O, Hveem K, Richards JB, Ohlsson C.
Show Full Abstract

Osteoporotic fracture is among the most common and costly of diseases. While reasonably heritable, its genetic determinants have remained elusive. Forearm fractures are the most common clinically recognized osteoporotic fractures with a relatively high heritability. To establish an atlas of the genetic determinants of forearm fractures, we performed genome-wide association analyses including 100,026 forearm fracture cases. We identified 43 loci, including 26 new fracture loci. Although most fracture loci associated with bone mineral density, we also identified loci that primarily regulate bone quality parameters. Functional studies of one such locus, at TAC4, revealed that Tac4<sup>-/-</sup> mice have reduced mechanical bone strength. The strongest forearm fracture signal, at WNT16, displayed remarkable bone-site-specificity with no association with hip fractures. Tall stature and low body mass index were identified as new causal risk factors for fractures. The insights from this atlas may improve fracture prediction and enable therapeutic development to prevent fractures.

TNFSF4
Also flagged:SLC7A11adrenocortical carcinomatumourACCchemokinesurological tumours
Journal Article 2023-11-02 ✓ 4 Snippets Liu T, Ren Y, Wang Q, Wang Y, Li Z, Sun W, Fan D, Luan Y, Gao Y, Yan Z.
In-Text Gene Mentions

SLC7A11 expression was positively associated with the expression of immune checkpoint genes (NRP1, TNFSF4, TNFRSF9, and CD276) and tumour mutation burden.

…checkpoint genes (NRP1,TNFSF4, TNFRSF9, and CD276)…

…P < 0.0001),TNFSF4(cor = 0.38,…

…genes, CD276, NRP1,TNFSF4, and TNFRSF9.…

Show Full Abstract

<h4>Background</h4>Disulfidptosis and the disulfidptosis-related gene SLC7A11 have recently attracted significant attention for their role in tumorigenesis and tumour management. However, its association with adrenocortical carcinoma (ACC) is rarely discussed.<h4>Methods</h4>Differential analysis, Cox regression analysis, and survival analysis were used to screen for the hub gene SLC7A11 in the TCGA and GTEx databases and disulfidptosis-related gene sets. Then, we performed an association analysis between SLC7A11 and clinically relevant factors in ACC patients. Univariate and multivariate Cox regression analyses were performed to evaluate the prognostic value of SLC7A11 and clinically relevant factors. Weighted gene coexpression analysis was used to find genes associated with SLC7A11. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses and the LinkedOmics database were used to analyse the functions of SLC7A11-associated genes. The CIBERSORT and Xcell algorithms were used to analyse the relationship between SLC7A11 and immune cell infiltration in ACC. The TISIDB database was applied to search for the correlation between SLC7A11 expression and immune chemokines. In addition, we performed a correlation analysis for SLC7A11 expression and tumour mutational burden and immune checkpoint-related genes and assessed drug sensitivity based on SLC7A11 expression. Immunohistochemistry and RT‒qPCR were used to validate the upregulation of SLC7A11 in the ACC.<h4>Results</h4>SLC7A11 is highly expressed in multiple urological tumours, including ACC. SLC7A11 expression is strongly associated with clinically relevant factors (M-stage and MYL6 expression) in ACC. SLC7A11 and the constructed nomogram can accurately predict ACC patient outcomes. The functions of SLC7A11 and its closely related genes are tightly associated with the occurrence of disulfidptosis in ACC. SLC7A11 expression was tightly associated with various immune cell infiltration disorders in the ACC tumour microenvironment (TME). It was positively correlated with the expression of immune chemokines (CXCL8, CXCL3, and CCL20) and negatively correlated with the expression of immune chemokines (CXCL17 and CCL14). SLC7A11 expression was positively associated with the expression of immune checkpoint genes (NRP1, TNFSF4, TNFRSF9, and CD276) and tumour mutation burden. The expression level of SLC7A11 in ACC patients is closely associated withcthe drug sensitivity.<h4>Conclusion</h4>In ACC, high expression of SLC7A11 is associated with migration, invasion, drug sensitivity, immune infiltration disorders, and poor prognosis, and its induction of disulfidptosis is a promising target for the treatment of ACC.

Also flagged:PARPbreast cancerbreast cancerstumourBRCAhomologous recombination
Journal Article 2023-11-02 No Snippets Jacobson DH, Pan S, Fisher J, Secrier M.
Show Full Abstract

<h4>Background</h4>Homologous recombination is a robust, broadly error-free mechanism of double-strand break repair, and deficiencies lead to PARP inhibitor sensitivity. Patients displaying homologous recombination deficiency can be identified using 'mutational signatures'. However, these patterns are difficult to reliably infer from exome sequencing. Additionally, as mutational signatures are a historical record of mutagenic processes, this limits their utility in describing the current status of a tumour.<h4>Methods</h4>We apply two methods for characterising homologous recombination deficiency in breast cancer to explore the features and heterogeneity associated with this phenotype. We develop a likelihood-based method which leverages small insertions and deletions for high-confidence classification of homologous recombination deficiency for exome-sequenced breast cancers. We then use multinomial elastic net regression modelling to develop a transcriptional signature of heterogeneous homologous recombination deficiency. This signature is then applied to single-cell RNA-sequenced breast cancer cohorts enabling analysis of homologous recombination deficiency heterogeneity and differential patterns of tumour microenvironment interactivity.<h4>Results</h4>We demonstrate that the inclusion of indel events, even at low levels, improves homologous recombination deficiency classification. Whilst BRCA-positive homologous recombination deficient samples display strong similarities to those harbouring BRCA1/2 defects, they appear to deviate in microenvironmental features such as hypoxic signalling. We then present a 228-gene transcriptional signature which simultaneously characterises homologous recombination deficiency and BRCA1/2-defect status, and is associated with PARP inhibitor response. Finally, we show that this signature is applicable to single-cell transcriptomics data and predict that these cells present a distinct milieu of interactions with their microenvironment compared to their homologous recombination proficient counterparts, typified by a decreased cancer cell response to TNFα signalling.<h4>Conclusions</h4>We apply multi-scale approaches to characterise homologous recombination deficiency in breast cancer through the development of mutational and transcriptional signatures. We demonstrate how indels can improve homologous recombination deficiency classification in exome-sequenced breast cancers. Additionally, we demonstrate the heterogeneity of homologous recombination deficiency, especially in relation to BRCA1/2-defect status, and show that indications of this feature can be captured at a single-cell level, enabling further investigations into interactions between DNA repair deficient cells and their tumour microenvironment.

SOX6
Also flagged:EGFRAKTmevalonatetemozolomideglioblastomaGBM
Journal Article 2023-11-02 ✓ 5 Snippets Cui X, Zhao J, Li G, Yang C, Yang S, Zhan Q, Zhou J, Wang Y, Xiao M, Hong B, Yi K, Tong F, Tan Y, Wang H, Wang Q, Jiang T, Fang C, Kang C.
In-Text Gene Mentions

(B) Expressions of GFAP, CHI3L1, OLIG2, SOX6, EGFR, and PDGFA in subcellular populations of tumor cells from GBM single‐cell data were stained.

The expression levels of glial fibrillary acidic protein (GFAP), chitinase 3 like 1 (CHI3L1), oligodendrocyte transcription factor 2 (OLIG2), SRY‐box transcription factor 6 (SOX6), EGFR, and platelet‐derived growth factor subunit A (PDGFA) in GBM patients from the CGGA, TCGA, and Rembrandt databases were selected.

(D) Kaplan‐Meier curve was generated to evaluate the overall survival time of GBM patients in distinct groups from the CGGA cohort, based on the expressions of GFAP, CHI3L1, OLIG2, SOX6, EGFR, and PDGFA.

Based on the expression features of the astrocyte marker gene GFAP, mesenchymal GBM marker gene CHI3L1, proneural GBM marker gene OLIG2 and SOX6 [32], tumor cells could easily be distinguished.

Abbreviations: GBM, glioblastoma; UMAP, uniform manifold approximation and projection; GFAP, glial fibrillary acidic protein; CHI3L1, chitinase 3 like 1; OLIG2, oligodendrocyte transcription factor 2; SOX6, SRY‐box transcription factor 6; EGFR, epidermal growth factor receptor; PDGFA, platelet‐derived growth factor subunit A; ACSS3, acyl‐CoA synthetase short‐chain family member 3; ACSL3, acyl‐CoA synthetase long‐chain family member 3; ELOVL2, long‐chain fatty acid elongation‐related gene ELOVL fatty acid elongase 2; CGGA, Chinese glioma genome atlas.

Show Full Abstract

<h4>Background</h4>Metabolism reprogramming plays a vital role in glioblastoma (GBM) progression and recurrence by producing enough energy for highly proliferating tumor cells. In addition, metabolic reprogramming is crucial for tumor growth and immune-escape mechanisms. Epidermal growth factor receptor (EGFR) amplification and EGFR-vIII mutation are often detected in GBM cells, contributing to the malignant behavior. This study aimed to investigate the functional role of the EGFR pathway on fatty acid metabolism remodeling and energy generation.<h4>Methods</h4>Clinical GBM specimens were selected for single-cell RNA sequencing and untargeted metabolomics analysis. A metabolism-associated RTK-fatty acid-gene signature was constructed and verified. MK-2206 and MK-803 were utilized to block the RTK pathway and mevalonate pathway induced abnormal metabolism. Energy metabolism in GBM with activated EGFR pathway was monitored. The antitumor effect of Osimertinib and Atorvastatin assisted by temozolomide (TMZ) was analyzed by an intracranial tumor model in vivo.<h4>Results</h4>GBM with high EGFR expression had characteristics of lipid remodeling and maintaining high cholesterol levels, supported by the single-cell RNA sequencing and metabolomics of clinical GBM samples. Inhibition of the EGFR/AKT and mevalonate pathways could remodel energy metabolism by repressing the tricarboxylic acid cycle and modulating ATP production. Mechanistically, the EGFR/AKT pathway upregulated the expressions of acyl-CoA synthetase short-chain family member 3 (ACSS3), acyl-CoA synthetase long-chain family member 3 (ACSL3), and long-chain fatty acid elongation-related gene ELOVL fatty acid elongase 2 (ELOVL2) in an NF-κB-dependent manner. Moreover, inhibition of the mevalonate pathway reduced the EGFR level on the cell membranes, thereby affecting the signal transduction of the EGFR/AKT pathway. Therefore, targeting the EGFR/AKT and mevalonate pathways enhanced the antitumor effect of TMZ in GBM cells and animal models.<h4>Conclusions</h4>Our findings not only uncovered the mechanism of metabolic reprogramming in EGFR-activated GBM but also provided a combinatorial therapeutic strategy for clinical GBM management.

Also flagged:Transcriptional elongationgene expressionelongationagingelongation factorsdevelopmental disorders
Journal Article 2023-11-02 No Snippets Aoi Y, Shilatifard A.
Show Full Abstract

The elongation stage of transcription by RNA polymerase II (RNA Pol II) is central to the regulation of gene expression in response to developmental and environmental cues in metazoan. Dysregulated transcriptional elongation has been associated with developmental defects as well as disease and aging processes. Decades of genetic and biochemical studies have painstakingly identified and characterized an ensemble of factors that regulate RNA Pol II elongation. This review summarizes recent findings taking advantage of genetic engineering techniques that probe functions of elongation factors in vivo. We propose a revised model of elongation control in this accelerating field by reconciling contradictory results from the earlier biochemical evidence and the recent in vivo studies. We discuss how elongation factors regulate promoter-proximal RNA Pol II pause release, transcriptional elongation rate and processivity, RNA Pol II stability and RNA processing, and how perturbation of these processes is associated with developmental disorders, neurodegenerative disease, cancer, and aging.

ZNF644
Also flagged:C2H2 Zinc Finger Transcription Factorsβ-globinsickle cell diseaseβ-thalassemiaCas9gene expression
Journal Article 2023-11-02 ✓ 5 Snippets Zhang X, Xia F, Zhang X, Blumenthal RM, Cheng X.
In-Text Gene Mentions

…IKZF1, WIZ andZNF644.…

ZNF644and WIZ…

ZNF644and WIZ are…

…ChIP-seq demonstratedZNF644and WIZ recognize…

…138 BothZNF644and WIZ are…

Show Full Abstract

In humans, specific aberrations in β-globin results in sickle cell disease and β-thalassemia, symptoms of which can be ameliorated by increased expression of fetal globin (HbF). Two recent CRISPR-Cas9 screens, centered on ∼1500 annotated sequence-specific DNA binding proteins and performed in a human erythroid cell line that expresses adult hemoglobin, uncovered four groups of candidate regulators of HbF gene expression. They are (1) members of the nucleosome remodeling and deacetylase (NuRD) complex proteins that are already known for HbF control; (2) seven C2H2 zinc finger (ZF) proteins, including some (ZBTB7A and BCL11A) already known for directly silencing the fetal γ-globin genes in adult human erythroid cells; (3) a few other transcription factors of different structural classes that might indirectly influence HbF gene expression; and (4) DNA methyltransferase 1 (DNMT1) that maintains the DNA methylation marks that attract the MBD2-associated NuRD complex to DNA as well as associated histone H3 lysine 9 methylation. Here we briefly discuss the effects of these regulators, particularly C2H2 ZFs, in inducing HbF expression for treating β-hemoglobin disorders, together with recent advances in developing safe and effective small-molecule therapeutics for the regulation of this well-conserved hemoglobin switch.

OLFM4
Also flagged:angiogenin-4Antimicrobial proteinsAng4ribonuclease Aregenerating islet-derived family member-4Reg4
Journal Article 2023-11-02 ✓ 5 Snippets Abo H, Sultana MF, Kawashima H.
In-Text Gene Mentions

…-GCC​ACA​CAC​CTG​GAC​ACA​T-3′)Olfm4(F, 5′-CTG​CTC​CTG​GAA​GCT​GTA…

…1:500 dilution) or anti-Olfm4antibody (39,141; Cell…

…(positive for Ki-67,Olfm4, Lysozyme, and β-catenin),…

…including Lgr5 ,Olfm4, Ascl2 ,…

…of ISCs expressingOlfm4, which is a…

Show Full Abstract

The intestinal epithelium is the first line of host defense, and its homeostasis is dependent on soluble factors that comprise the crypt niche. Antimicrobial proteins are one of the mediators to maintain gut homeostasis. Angiogenin-4 (Ang4) is a member of the ribonuclease A superfamily and plays a pivotal role in antimicrobial activity against gut microbiota. However, the functions of Ang4 within the intestinal crypt niche, particularly its involvement in the development of intestinal epithelial cells (IECs), remain unknown. Here, we demonstrate that Ang4 plays a significant role in maintaining Lgr5<sup>+</sup> intestinal stem cells (ISCs) and induces apoptosis of IECs in a concentration-dependent manner. We revealed that Ang4 is highly expressed by Paneth cells in the small intestine, as well as regenerating islet-derived family member-4 (Reg4) expressing goblet cells in the colon, and both cell subsets highly contribute to ISC maintenance. Functional analysis using intestinal organoids revealed that Ang4 induces Wnt and Notch signaling, increases Lgr5<sup>+</sup> stem cell expansion, and promotes organoid growth. Furthermore, high concentrations of Ang4 induced apoptosis in the IEC cell line and organoids. Collectively, we propose that Ang4 is a dual functional protein and is a novel member of the crypt niche factor that promotes the expansion of ISCs and induces apoptosis.

HTT
Also flagged:mitochondrialagingorganelleamino acidpolypeptidesmitochondria
Journal Article 2023-11-02 ✓ 5 Snippets Reed AL, Mitchell W, Alexandrescu AT, Alder NN.
In-Text Gene Mentions

First, the requirement of Nt17 for TIM23 interactions suggests that this sequence acts like a MTS, assuming an amphipathic α-helical structure to engage the TOM/TIM23 receptors and accumulate Htt/mHtt at mitochondria during HD progression.

These observations provide potential clues as to how Htt, specifically N-terminal segments of mHtt, may engage and disrupt the TIM23 machinery during HD-related proteostatic stress.

…Aβ/APP, α-syn, andHtt/mHtt that may facilitate…

…Aβ/APP, α-syn, andHtt/mHtt are shown in…

…1)Httmay engage the…

Show Full Abstract

Most mitochondrial proteins are targeted to the organelle by N-terminal mitochondrial targeting sequences (MTSs, or "presequences") that are recognized by the import machinery and subsequently cleaved to yield the mature protein. MTSs do not have conserved amino acid compositions, but share common physicochemical properties, including the ability to form amphipathic α-helical structures enriched with basic and hydrophobic residues on alternating faces. The lack of strict sequence conservation implies that some polypeptides can be mistargeted to mitochondria, especially under cellular stress. The pathogenic accumulation of proteins within mitochondria is implicated in many aging-related neurodegenerative diseases, including Alzheimer's, Parkinson's, and Huntington's diseases. Mechanistically, these diseases may originate in part from mitochondrial interactions with amyloid-β precursor protein (APP) or its cleavage product amyloid-β (Aβ), α-synuclein (α-syn), and mutant forms of huntingtin (mHtt), respectively, that are mediated in part through their associations with the mitochondrial protein import machinery. Emerging evidence suggests that these amyloidogenic proteins may present cryptic targeting signals that act as MTS mimetics and can be recognized by mitochondrial import receptors and transported into different mitochondrial compartments. Accumulation of these mistargeted proteins could overwhelm the import machinery and its associated quality control mechanisms, thereby contributing to neurological disease progression. Alternatively, the uptake of amyloidogenic proteins into mitochondria may be part of a protein quality control mechanism for clearance of cytotoxic proteins. Here we review the pathomechanisms of these diseases as they relate to mitochondrial protein import and effects on mitochondrial function, what features of APP/Aβ, α-syn and mHtt make them suitable substrates for the import machinery, and how this information can be leveraged for the development of therapeutic interventions.

Also flagged:Heart failuredeathtransforming growth factor(TGF)-β1isoproterenolfibroblast growth factor receptor 2
Journal Article 2023-11-02 No Snippets Jeong A, Lim Y, Kook T, Kwon DH, Cho YK, Ryu J, Lee YG, Shin S, Choe N, Kim YS, Cho HJ, Kim JC, Choi Y, Lee SJ, Kim HS, Kee HJ, Nam KI, Ahn Y, Jeong MH, Park WJ, Kim YK, Kook H.
Show Full Abstract

Heart failure is a leading cause of death and is often accompanied by activation of quiescent cardiac myofibroblasts, which results in cardiac fibrosis. In this study, we aimed to identify novel circular RNAs that regulate cardiac fibrosis. We applied transverse aortic constriction (TAC) for 1, 4, and 8 weeks in mice. RNA sequencing datasets were obtained from cardiac fibroblasts isolated by use of a Langendorff apparatus and then further processed by use of selection criteria such as differential expression and conservation in species. CircSMAD4 was upregulated by TAC in mice or by transforming growth factor (TGF)-β1 in primarily cultured human cardiac fibroblasts. Delivery of si-circSMAD4 attenuated myofibroblast activation and cardiac fibrosis in mice treated with isoproterenol (ISP). si-circSmad4 significantly reduced cardiac fibrosis and remodeling at 8 weeks. Mechanistically, circSMAD4 acted as a sponge against the microRNA miR-671-5p in a sequence-specific manner. miR-671-5p was downregulated during myofibroblast activation and its mimic form attenuated cardiac fibrosis. miR-671-5p mimic destabilized fibroblast growth factor receptor 2 (<i>FGFR2</i>) mRNA in a sequence-specific manner and interfered with the fibrotic action of <i>FGFR2</i>. The circSMAD4-miR-671-5p-<i>FGFR2</i> pathway is involved in the differentiation of cardiac myofibroblasts and thereby the development of cardiac fibrosis.

STAU1
Also flagged:extracellularvesiclescancerCCsquamous cell carcinomavesicle
Journal Article 2023-11-02 ✓ 1 Snippet Molika P, Leetanaporn K, Rungkamoltip P, Roytrakul S, Hanprasertpong J, Navakanitworakul R.
In-Text Gene Mentions

…COQ6, CXCR1, ACTN4,STAU1, LTV1, HDAC4, WDR19,…

Show Full Abstract

<h4>Background</h4>Cervical cancer (CC) is the fourth most common cancer in females worldwide. Existing biomarkers for CC, such as squamous cell carcinoma antigens, show low specificity. Hence, a novel biomarker for the diagnosis of CC is required. Through proteomic analysis, this study aimed to distinguish between the small extracellular vesicle (sEV) protein profiles of healthy controls (HC) and CC sera and to identify potential sEV proteins that can serve as biomarkers for CC diagnosis.<h4>Methods</h4>The number and size distribution of sEVs in HC and CC sera were measured using nanoparticle tracking analysis. Differential ultracentrifugation combined with size-exclusion chromatography was used to isolate and purify sEVs. Liquid chromatography-tandem mass spectrometry was used to identify and compare the protein profiles between patients with CC and HC. Differentially expressed extracellular vesicle (EV) proteins were validated using The Cancer Genome Atlas database.<h4>Results</h4>The EV particle concentration in patients with CC was marginally higher than that in HC. Proteomic and functional protein analyses revealed a difference in the EV protein profiles between HC and CC and identified proteins that can serve as biomarkers for CC.<h4>Conclusions</h4>This study provides insights into the potential of sEVs as less invasive biomarkers for CC diagnosis. Validation with a well-designed cohort should be performed to determine the clinical diagnostic value of specific protein markers for CC.

Also flagged:tumorCancergene expressionmetabolismcytochrome P450glutathione
Journal Article 2023-11-02 No Snippets Chen X, Shen R, Lv L, Zhu D, You G, Tian Z, Chen J, Lin S, Xu J, Hong G, Li H, Luo M, Cao L, Wu S, Huang K.
Show Full Abstract

Cancer can educate platelets by altering transcriptome profiles. However, the exact education mechanism remains unclear, and the variability of tumor-educated platelet (TEP) transcriptome has not been investigated. In this study, we aimed to build a stratification system for TEP based on machine learning (ML) data-driven patterns and platelet transcriptome profiles. This study included platelet samples from 1,628 cancer participants from European and United States populations, including 18 different and most prevalent types of cancer. Gaussian mixture model (GMM) was used to identify robust clusters and similar education pattern. While extreme gradient boosting (XGBoost) was used to precisely predict the clusters. Three clusters were eventually identified. The cluster results showed robustness and generality, reflected by comparable patterns of important gene expression, cancer type prevalence, and biological annotation across derivation, evaluation and validation cohorts. Cluster 1 (<i>n</i> = 346), mainly participated in drug metabolism cytochrome P450, metabolism of xenobiotics by cytochrome P450, and glutathione metabolism. Cluster 2 (<i>n</i> = 538) mainly participated in ribosome, spliceosome, and primary immunodeficiency. Cluster 3 (<i>n</i> = 744) mainly participated in gap junction and focal adhesion. Based on this novel cluster system, further observational study can investigate the association between these clusters and cancer progression, prognosis, cancer associated thrombosis, treatment resistance (both chemotherapy and immunotherapy), and immune cell infiltration. Overall, in this study, we built the first pan-cancer TEP stratification system based on data-driven patterns of ML and platelet transcriptional profiles. These clusters could help us better understand the variability of the pan-cancer education mechanism.

bioRxiv 2023-11-02 Preprint (No Snippets API) Deo A, Ghosh R, Ahire S, Majumdar A, Bose T.
Show Full Abstract

Huntington’s disease (HD) is a rare neurodegenerative disease. It is caused due to aggregation of Huntingtin (HTT) protein containing Q repeats more than 40. Similar protein aggregation is also a hallmark of several other neurodegenerative diseases related to loss of cognitive function. In search of modifiers of HTT aggregation, we have screened putative chaperone proteins from Drosophila in both fly and yeast model of HD. DnaJ chaperones were screened by evaluating HTT protein aggregation related phenotypes using growth assays for studying the growth rate of the cells, imaging studies, and gel-based approaches like semi-denaturing detergent agarose gel electrophoresis (SDD-AGE). Our screening led us to categorize several proteins as suppressors and enhancers of the HTT associated phenotypes. Out of the 40 chaperones and co-chaperones, two chaperones that came up strikingly were CG5001 and P58IPK. Protein aggregation was found to be reduced in both S2 cells and Drosophila transgenic lines with HTT103Q in presence of these class of chaperones. As these DnaJ chaperones have protein sequence similarity across species, these might be used as possible tools to combat the effects of neurodegenerative diseases, as evidenced specifically in Huntington’s disease and Amyotrophic Lateral Sclerosis (ALS).

bioRxiv 2023-11-02 Preprint (No Snippets API) Nguyen TB, Miramontes R, Chillon-Marinas C, Maimon R, Vazquez-Sanchez S, Lau AL, McClure NR, England WE, Singha M, Stocksdale JT, Jang K, Jung S, McKnight JI, Ho LN, Faull RL, Steffan JS, Reidling JC, Jang C, Lee G, Cleveland DW, Lagier-Tourenne C, Spitale RC, Thompson LM.
Show Full Abstract

Huntington’s disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the first exon of the HTT gene encoding huntingtin. Prior reports have established a correlation between CAG expanded HTT and altered gene expression. However, the mechanisms leading to disruption of RNA processing in HD remain unclear. Here, our analysis of the reported HTT protein interactome identifies interactions with known RNA-binding proteins (RBPs). Total, long-read sequencing and targeted RASL-seq of RNAs from cortex and striatum of the HD mouse model R6/2 reveals increased exon skipping which is confirmed in Q150 and Q175 knock-in mice and in HD human brain. We identify the RBP TDP-43 and the N6-methyladenosine (m6A) writer protein methyltransferase 3 (METTL3) to be upstream regulators of exon skipping in HD. Along with this novel mechanistic insight, we observe decreased nuclear localization of TDP-43 and cytoplasmic accumulation of phosphorylated TDP-43 in HD mice and human brain. In addition, TDP-43 co-localizes with HTT in human HD brain forming novel nuclear aggregate-like bodies distinct from mutant HTT inclusions or previously observed TDP-43 pathologies. Binding of TDP-43 onto RNAs encoding HD-associated differentially expressed and aberrantly spliced genes is decreased. Finally, m6A RNA modification is reduced on RNAs abnormally expressed in striatum from HD R6/2 mouse brain, including at clustered sites adjacent to TDP-43 binding sites. Our evidence supports TDP-43 loss of function coupled with altered m6A modification as a novel mechanism underlying alternative splicing/unannotated exon usage in HD and highlights the critical nature of TDP-43 function across multiple neurodegenerative diseases.

bioRxiv 2023-11-02 Preprint (No Snippets API) Iglesia MD, Jayasinghe RG, Chen S, Terekhanova NV, Herndon JM, Storrs E, Karpova A, Zhou DC, Al Deen NN, Shinkle AT, Lu RJ, Caravan W, Houston A, Zhao Y, Sato K, Lal P, Street C, Rodrigues FM, Southard-Smith AN, Targino da Costa ALN, Zhu H, Mo C, Crowson L, Fulton RS, Wyczalkowski MA, Fronick CC, Fulton LA, Sun H, Davies SR, Appelbaum EL, Chasnoff SE, Carmody M, Brooks C, Liu R, Wendl MC, Oh C, Bender D, Cruchaga C, Harari O, Bredemeyer A, Lavine K, Bose R, Margenthaler J, Held JM, Achilefu S, Ademuyiwa F, Aft R, Ma C, Colditz GA, Ju T, Oh ST, Fitzpatrick J, Hwang ES, Shoghi KI, Chheda MG, Veis DJ, Chen F, Fields RC, Gillanders WE, Ding L.
Show Full Abstract

<h4>ABSTRACT</h4> Breast cancer is a heterogeneous disease, and treatment is guided by biomarker profiles representing distinct molecular subtypes. Breast cancer arises from the breast ductal epithelium, and experimental data suggests breast cancer subtypes have different cells of origin within that lineage. The precise cells of origin for each subtype and the transcriptional networks that characterize these tumor-normal lineages are not established. In this work, we applied bulk, single-cell (sc), and single-nucleus (sn) multi-omic techniques as well as spatial transcriptomics and multiplex imaging on 61 samples from 37 breast cancer patients to show characteristic links in gene expression and chromatin accessibility between breast cancer subtypes and their putative cells of origin. We applied the PAM50 subtyping algorithm in tandem with bulk RNA-seq and snRNA-seq to reliably subtype even low-purity tumor samples and confirm promoter accessibility using snATAC. Trajectory analysis of chromatin accessibility and differentially accessible motifs clearly connected progenitor populations with breast cancer subtypes supporting the cell of origin for basal-like and luminal A and B tumors. Regulatory network analysis of transcription factors underscored the importance of BHLHE40 in luminal breast cancer and luminal mature cells, and KLF5 in basal-like tumors and luminal progenitor cells. Furthermore, we identify key genes defining the basal-like ( PRKCA , SOX6 , RGS6 , KCNQ3 ) and luminal A/B ( FAM155A , LRP1B ) lineages, with expression in both precursor and cancer cells and further upregulation in tumors. Exhausted CTLA4-expressing CD8+ T cells were enriched in basal-like breast cancer, suggesting altered means of immune dysfunction among breast cancer subtypes. We used spatial transcriptomics and multiplex imaging to provide spatial detail for key markers of benign and malignant cell types and immune cell colocation. These findings demonstrate analysis of paired transcription and chromatin accessibility at the single cell level is a powerful tool for investigating breast cancer lineage development and highlight transcriptional networks that define basal and luminal breast cancer lineages.

HFE
Also flagged:ironiron deficiency anaemiaTransferriniron deficiencycancerhematological disorders
Journal Article 2023-11-01 ✓ 1 Snippet Jacko G, Sivakaanthan A, Obeysekera M, Welvaert M, Viennet E, Hyland C, Tung JP, Perros AJ, Flower RL, Roulis E.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Young adults form the majority of first-time blood donors to Australian Red Cross Lifeblood. However, these donors pose unique challenges for donor safety. Young blood donors, who are still undergoing neurological and physical development, have been found to have lower iron stores, and have higher risks of iron deficiency anaemia when compared to older adults and non-donors. Identifying young donors with higher iron stores may improve donor health and experience, increase donor retention, and reduce the burden on product donation. In addition, these measures could be used to individualise donation frequency.<h4>Materials and methods</h4>Stored DNA samples from young male donors (18-25 years; No.=47) were sequenced using a custom panel of genes identified in the literature to be associated with iron homeostasis. The custom sequencing panel used in this study identified and reported variants to human genome version 19 (Hg19).<h4>Results</h4>82 gene variants were analysed. Only one of which, rs8177181, was found to have a statistically significant (p<0.05) association with plasma ferritin level. Heterozygous alleles of this Transferrin gene variant, rs8177181T>A, significantly predicted a positive effect on ferritin levels (p=0.03).<h4>Discussion</h4>This study identified gene variants involved in iron homeostasis using a custom sequencing panel and analysed their association with ferritin levels in a young male blood donor population. Additional studies of factors associated with iron deficiency in blood donors are required if a goal of personalised blood donation protocols is to be achieved.

Also flagged:SchizophreniaVitamin Dmental disorderpsychotic disorderpathogenesisbrain
Journal Article 2023-11-01 No Snippets Jaholkowski P, Hindley GFL, Shadrin AA, Tesfaye M, Bahrami S, Nerhus M, Rahman Z, O'Connell KS, Holen B, Parker N, Cheng W, Lin A, Rødevand L, Karadag N, Frei O, Djurovic S, Dale AM, Smeland OB, Andreassen OA.
Show Full Abstract

Low vitamin D (vitD) levels have been consistently reported in schizophrenia (SCZ) suggesting a role in the etiopathology. However, little is known about the role of underlying shared genetic mechanisms. We applied a conditional/conjunctional false discovery rate approach (FDR) on large, nonoverlapping genome-wide association studies for SCZ (N cases = 53 386, N controls = 77 258) and vitD serum concentration (N = 417 580) to evaluate shared common genetic variants. The identified genomic loci were characterized using functional analyses and biological repositories. We observed cross-trait SNP enrichment in SCZ conditioned on vitD and vice versa, demonstrating shared genetic architecture. Applying the conjunctional FDR approach, we identified 72 loci jointly associated with SCZ and vitD at conjunctional FDR < 0.05. Among the 72 shared loci, 40 loci have not previously been reported for vitD, and 9 were novel for SCZ. Further, 64% had discordant effects on SCZ-risk and vitD levels. A mixture of shared variants with concordant and discordant effects with a predominance of discordant effects was in line with weak negative genetic correlation (rg = -0.085). Our results displayed shared genetic architecture between SCZ and vitD with mixed effect directions, suggesting overlapping biological pathways. Shared genetic variants with complex overlapping mechanisms may contribute to the coexistence of SCZ and vitD deficiency and influence the clinical picture.

HTT
Also flagged:lysosomeneurodegenerative diseaseaggregate degradationorganellesTranscription factor EBautolysosome
Journal Article 2023-11-01 ✓ 1 Snippet Xue W, Zhang J, Li Y.
In-Text Gene Mentions

Huntington’s disease (HD) is a neurodegenerative disease characterized by striatal neurodegeneration resulting from mutation of the huntingtin (HTT) gene.

Show Full Abstract

Millions of people are suffering from Alzheimer's disease globally, but there is still no effective treatment for this neurodegenerative disease. Thus, novel therapeutic approaches for Alzheimer's disease are needed, which requires further evaluation of the regulatory mechanisms of protein aggregate degradation. Lysosomes are crucial degradative organelles that maintain cellular homeostasis. Transcription factor EB-mediated lysosome biogenesis enhances autolysosome-dependent degradation, which subsequently alleviates neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and Huntington's disease. In this review, we start by describing the key features of lysosomes, including their roles in nutrient sensing and degradation, and their functional impairments in different neurodegenerative diseases. We also explain the mechanisms - especially the post-translational modifications - which impact transcription factor EB and regulate lysosome biogenesis. Next, we discuss strategies for promoting the degradation of toxic protein aggregates. We describe Proteolysis-Targeting Chimera and related technologies for the targeted degradation of specific proteins. We also introduce a group of LYsosome-Enhancing Compounds, which promote transcription factor EB-mediated lysosome biogenesis and improve learning, memory, and cognitive function in APP-PSEN1 mice. In summary, this review highlights the key aspects of lysosome biology, the mechanisms of transcription factor EB activation and lysosome biogenesis, and the promising strategies which are emerging to alleviate the pathogenesis of neurodegenerative diseases.

HFE
Also flagged:obesitydiabetes mellitusdiabetestype 2 diabetes mellitusinsulin resistancemetabolic disorders
Journal Article 2023-11-01 ✓ 1 Snippet Yu H, Yu H, Zhang R, Peng D, Yan D, Gu Y, Bao Y, Jia W, Zhang H, Hu C.
In-Text Gene Mentions

…as Wolfram syndrome,hemochromatosis, and Alström syndrome…

Show Full Abstract

A small fraction of patients diagnosed with obesity or diabetes mellitus has an underlying monogenic cause. Here, we constructed a targeted gene panel consisting of 83 genes reported to be causative for monogenic obesity or diabetes. We performed this panel in 481 patients to detect causative variants and compared these results with whole-exome sequencing (WES) data available for 146 of these patients. The coverage of targeted gene panel sequencing was significantly higher than that of WES. The diagnostic yield in patients sequenced by the panel was 32.9% with subsequent WES leading to three additional diagnoses with two novel genes. In total, 178 variants in 83 genes were detected in 146 patients by targeted sequencing. Three of the 178 variants were missed by WES, although the WES-only approach had a similar diagnostic yield. For the 335 samples only receiving targeted sequencing, the diagnostic yield was 32.2%. In conclusion, taking into account the lower costs, shorter turnaround time, and higher quality of data, targeted sequencing is a more effective screening method for monogenic obesity and diabetes compared to WES. Therefore, this approach could be routinely established and used as a first-tier test in clinical practice for specific patients.

TNFSF4
Also flagged:atherosclerosisagingcholesterolcytokinecell differentiationantigen presentation
Journal Article 2023-11-01 ✓ 1 Snippet Smit V, de Mol J, Schaftenaar FH, Depuydt MAC, Postel RJ, Smeets D, Verheijen FWM, Bogers L, van Duijn J, Verwilligen RAF, Grievink HW, Bernabé Kleijn MNA, van Ingen E, de Jong MJM, Goncalves L, Peeters JAHM, Smeets HJ, Wezel A, Polansky JK, de Winther MPJ, Binder CJ, Tsiantoulas D, Bot I, Kuiper J, Foks AC.
In-Text Gene Mentions

…molecules, such asTnfsf4(OX40L), Tnfsf18 (GITRL),…

Show Full Abstract

<h4>Aims</h4>Aging is a dominant driver of atherosclerosis and induces a series of immunological alterations, called immunosenescence. Given the demographic shift towards elderly, elucidating the unknown impact of aging on the immunological landscape in atherosclerosis is highly relevant. While the young Western diet-fed Ldlr-deficient (Ldlr-/-) mouse is a widely used model to study atherosclerosis, it does not reflect the gradual plaque progression in the context of an aging immune system as occurs in humans.<h4>Methods and results</h4>Here, we show that aging promotes advanced atherosclerosis in chow diet-fed Ldlr-/- mice, with increased incidence of calcification and cholesterol crystals. We observed systemic immunosenescence, including myeloid skewing and T-cells with more extreme effector phenotypes. Using a combination of single-cell RNA-sequencing and flow cytometry on aortic leucocytes of young vs. aged Ldlr-/- mice, we show age-related shifts in expression of genes involved in atherogenic processes, such as cellular activation and cytokine production. We identified age-associated cells with pro-inflammatory features, including GzmK+CD8+ T-cells and previously in atherosclerosis undefined CD11b+CD11c+T-bet+ age-associated B-cells (ABCs). ABCs of Ldlr-/- mice showed high expression of genes involved in plasma cell differentiation, co-stimulation, and antigen presentation. In vitro studies supported that ABCs are highly potent antigen-presenting cells. In cardiovascular disease patients, we confirmed the presence of these age-associated T- and B-cells in atherosclerotic plaques and blood.<h4>Conclusions</h4>Collectively, we are the first to provide comprehensive profiling of aged immunity in atherosclerotic mice and reveal the emergence of age-associated T- and B-cells in the atherosclerotic aorta. Further research into age-associated immunity may contribute to novel diagnostic and therapeutic tools to combat cardiovascular disease.

HTT
Also flagged:Huntington's diseasegene expressionneurodegenerative disordersHDnucleusdeath
Journal Article 2023-11-01 ✓ 5 Snippets Estevez-Fraga C, Altmann A, Parker CS, Scahill RI, Costa B, Chen Z, Manzoni C, Zarkali A, Durr A, Roos RAC, Landwehrmeyer B, Leavitt BR, Rees G, Tabrizi SJ, McColgan P.
In-Text Gene Mentions

Huntington’s disease (HD) is an adult-onset autosomal dominant neurodegenerative disorder resulting in a triad of cognitive, motor and psychiatric symptoms.1 It is caused by cytosine-adenine-guanine (CAG) repeat expansions in the huntingtin (HTT) gene, encoding for the toxic mutant huntingtin (mHTT) protein.2 Longer CAG repeats are associated with earlier age at symptom onset, with clinical motor diagnosis being, on average, around the fourth decade.3 However, there are alterations in the brains of HD patients long before the emergence of symptoms, with imaging studies showing that striatal volumes differ between HD expansion carriers and controls since childhood, with initial striatal hypertrophy being followed by a rapid volume decline and atrophy.4,5 Recent evidence suggests that neurodevelopmental changes related to wild-type huntingtin (wtHTT) and mHTT, at the beginning of life, may also play a role.6–10

Most HD patients carry the HTT expansion in one allele, together with a single copy of the wild-type allele, resulting in reduced levels of wtHTT.61,62 This may explain the higher frequency of neurodevelopmental malformations compared to controls in post-mortem brains from HD patients.63 Similarly, although clinical manifestations of HD emerge on average, during mid-adulthood, there are numerous cellular abnormalities in the cortex of human HD fetuses, including changes in cell polarity and neuronal differentiation,7 and there is imaging evidence supporting the presence of structural brain changes in infants with the HTT mutation decades before expected clinical motor onset.4,64 Moreover, total intracranial volume (including tissue and CSF volume inside the calvarium), is also smaller in HTT gene expansion carriers compared with controls, not being associated with disease burden, and therefore suggesting abnormal development in the presence of the mutation.65 Single-nucleotide polymorphisms in HTT resulting in decreased transcription of the wild-type allele in HD patients, hasten age at onset.66 Also, a previous study investigating mRNA expression in the prefrontal cortex of HD brains showed that differentially expressed genes were involved in development both using functional clustering networks and GO enrichment analysis.67

Moreover, co-expression network analysis revealed that developmental genes are co-expressed with HTT in the occipital cortex, a region undergoing the greatest rate of cortical atrophy in HD during motor conversion.15 These findings suggest that lower wtHTT expression in HD expansion carriers during development, due to the presence of a single wild-type allele, may render specific areas vulnerable to neurodegeneration in adulthood.

HTTexpression was correlated…

…also revealed thatHTTexpression was associated…

Show Full Abstract

Cortical cell loss is a core feature of Huntington's disease (HD), beginning many years before clinical motor diagnosis, during the premanifest stage. However, it is unclear how genetic topography relates to cortical cell loss. Here, we explore the biological processes and cell types underlying this relationship and validate these using cell-specific post-mortem data. Eighty premanifest participants on average 15 years from disease onset and 71 controls were included. Using volumetric and diffusion MRI we extracted HD-specific whole brain maps where lower grey matter volume and higher grey matter mean diffusivity, relative to controls, were used as proxies of cortical cell loss. These maps were combined with gene expression data from the Allen Human Brain Atlas (AHBA) to investigate the biological processes relating genetic topography and cortical cell loss. Cortical cell loss was positively correlated with the expression of developmental genes (i.e. higher expression correlated with greater atrophy and increased diffusivity) and negatively correlated with the expression of synaptic and metabolic genes that have been implicated in neurodegeneration. These findings were consistent for diffusion MRI and volumetric HD-specific brain maps. As wild-type huntingtin is known to play a role in neurodevelopment, we explored the association between wild-type huntingtin (HTT) expression and developmental gene expression across the AHBA. Co-expression network analyses in 134 human brains free of neurodegenerative disorders were also performed. HTT expression was correlated with the expression of genes involved in neurodevelopment while co-expression network analyses also revealed that HTT expression was associated with developmental biological processes. Expression weighted cell-type enrichment (EWCE) analyses were used to explore which specific cell types were associated with HD cortical cell loss and these associations were validated using cell specific single nucleus RNAseq (snRNAseq) data from post-mortem HD brains. The developmental transcriptomic profile of cortical cell loss in preHD was enriched in astrocytes and endothelial cells, while the neurodegenerative transcriptomic profile was enriched for neuronal and microglial cells. Astrocyte-specific genes differentially expressed in HD post-mortem brains relative to controls using snRNAseq were enriched in the developmental transcriptomic profile, while neuronal and microglial-specific genes were enriched in the neurodegenerative transcriptomic profile. Our findings suggest that cortical cell loss in preHD may arise from dual pathological processes, emerging as a consequence of neurodevelopmental changes, at the beginning of life, followed by neurodegeneration in adulthood, targeting areas with reduced expression of synaptic and metabolic genes. These events result in age-related cell death across multiple brain cell types.

DCC
Also flagged:visionglaucomaaxon growthguidance receptorsaxonsresponse to chemorepulsion
Journal Article 2023-11-01 ✓ 4 Snippets Subramani M, Van Hook MJ, Qiu F, Ahmad I.
In-Text Gene Mentions

…raction, mediated by Netrin-1/DCCinteraction.…

…we demonstrate that Netrin-1/DCCinteraction, besides promoting…

…diverse influence of Netrin-1/DCCinteraction ranging from…

DCC

Show Full Abstract

Retinal ganglion cells (RGCs) connect the retina with the higher centers in the brain for visual perception. Their degeneration leads to irreversible vision loss in patients with glaucoma. The mechanism underlying human RGCs (hRGCs) axon growth and guidance remains poorly understood because hRGCs are born during development and connections with the central targets are established before birth. Here, using RGCs directly generated from human embryonic stem cells, we demonstrate that hRGCs express a battery of guidance receptors. These receptors allow hRGCs to read the spatially arrayed chemotropic cues in the developing rat retina for the centripetal orientation of axons toward the optic disc, suggesting that the mechanism of intraretinal guidance is conserved in hRGCs. The centripetal orientation of hRGCs axons is not only in response to chemorepulsion but also involves chemoattraction, mediated by Netrin-1/DCC interaction. The spatially arrayed chemotropic cues differentially influence hRGCs physiological responses, suggesting that neural activity of hRGCs and axon growth may be coupled during inter-retinal guidance. In addition, we demonstrate that Netrin-1/DCC interaction, besides promoting axon growth, facilitates hRGCs axon regeneration by recruiting the mTOR signaling pathway. The diverse influence of Netrin-1/DCC interaction ranging from axon growth to regeneration may involve recruitment of multiple intracellular signaling pathways as revealed by transcriptome analysis of hRGCs. From the perspective of ex vivo stem cell approach to glaucomatous degeneration, our findings posit that ex vivo generated hRGCs can read the intraretinal cues for guidance toward the optic disc, the first step required for connecting with the central target to restore vision.

HFE
Also flagged:iron chaperonepoly(rC)-binding protein 1ironiron efflux transporterPCBP1iron regulatory hormone
Journal Article 2023-11-01 ✓ 1 Snippet Wang Y, Protchenko O, Huber KD, Shakoury-Elizeh M, Ghosh MC, Philpott CC.
In-Text Gene Mentions

HFE hemochromatosis

Show Full Abstract

Iron is an essential nutrient required by all cells but used primarily for red blood cell production. Because humans have no effective mechanism for ridding the body of excess iron, the absorption of dietary iron must be precisely regulated. The critical site of regulation is the transfer of iron from the absorptive enterocyte to the portal circulation via the sole iron efflux transporter, ferroportin. Here, we report that poly(rC)-binding protein 1 (PCBP1), the major cytosolic iron chaperone, is necessary for the regulation of iron flux through ferroportin in the intestine of mice. Mice lacking PCBP1 in the intestinal epithelium exhibit low levels of enterocyte iron, poor retention of dietary iron in enterocyte ferritin, and excess efflux of iron through ferroportin. Excess iron efflux occurred despite lower levels of ferroportin protein in enterocytes and upregulation of the iron regulatory hormone hepcidin. PCBP1 deletion and the resulting unregulated dietary iron absorption led to poor growth, severe anemia on a low-iron diet, and liver oxidative stress with iron loading on a high-iron diet. Ex vivo culture of PCBP1-depleted enteroids demonstrated no defects in hepcidin-mediated ferroportin turnover. However, measurement of kinetically labile iron pools in enteroids competent or blocked for iron efflux indicated that PCBP1 functioned to bind and retain cytosolic iron and limit its availability for ferroportin-mediated efflux. Thus, PCBP1 coordinates enterocyte iron and reduces the concentration of unchaperoned "free" iron to a low level that is necessary for hepcidin-mediated regulation of ferroportin activity.

RABGAP1L
Also flagged:methylationgenetic disordersnucleotidecopperhepatopathyretinitis pigmentosa
Journal Article 2023-11-01 ✓ 1 Snippet Schall PZ, Winkler PA, Petersen-Jones SM, Yuzbasiyan-Gurkan V, Kidd JM.
In-Text Gene Mentions

…intron 14 ofRABGAP1L(XM_038542442.1), while the…

Show Full Abstract

Recent advances in long-read sequencing have enabled the creation of reference-quality genome assemblies for multiple individuals within a species. In particular, 8 long-read genome assemblies have recently been published for the canine model (dogs and wolves). These assemblies were created using a range of sequencing and computational approaches, with only limited comparisons described among subsets of the assemblies. Here we present 3 high-quality de novo reference assemblies based upon Oxford Nanopore long-read sequencing: 2 Bernese Mountain Dogs (BD & OD) and a Cairn terrier (CA611). These breeds are of particular interest due to the enrichment of unresolved genetic disorders. Leveraging advancement in software technologies, we utilized published data of Labrador Retriever (Yella) to generate a new assembly, resulting in a ∼280-fold increase in continuity (N50 size of 91 kbp vs 25.75 Mbp). In conjunction with these 4 new assemblies, we uniformly assessed 8 existing assemblies for generalized quality metrics, sequence divergence, and a detailed BUSCO assessment. We identified a set of ∼400 conserved genes during the BUSCO analysis missing in all assemblies. Genome-wide methylation profiles were generated from the nanopore sequencing, resulting in broad concordance with existing whole-genome and reduced-representation bisulfite sequencing, while highlighting superior overage of mobile elements. These analyses demonstrate the ability of Nanopore sequencing to resolve the sequence and epigenetic profile of canine genomes.

Also flagged:Transcription Factorsgene expressionchromatinbindingNANOGSOX2
Journal Article 2023-11-01 No Snippets Grillo G, Keshavarzian T, Linder S, Arlidge C, Mout L, Nand A, Teng M, Qamra A, Zhou S, Kron KJ, Murison A, Hawley JR, Fraser M, van der Kwast TH, Raj GV, He HH, Zwart W, Lupien M.
Show Full Abstract

Transposable elements hold regulatory functions that impact cell fate determination by controlling gene expression. However, little is known about the transcriptional machinery engaged at transposable elements in pluripotent and mature versus oncogenic cell states. Through positional analysis over repetitive DNA sequences of H3K27ac chromatin immunoprecipitation sequencing data from 32 normal cell states, we report pluripotent/stem and mature cell state-specific "regulatory transposable elements." Pluripotent/stem elements are binding sites for pluripotency factors (e.g., NANOG, SOX2, OCT4). Mature cell elements are docking sites for lineage-specific transcription factors, including AR and FOXA1 in prostate epithelium. Expanding the analysis to prostate tumors, we identify a subset of regulatory transposable elements shared with pluripotent/stem cells, including Tigger3a. Using chromatin editing technology, we show how such elements promote prostate cancer growth by regulating AR transcriptional activity. Collectively, our results suggest that oncogenesis arises from lineage-specific transcription factors hijacking pluripotent/stem cell regulatory transposable elements.<h4>Significance</h4>We show that oncogenesis relies on co-opting transposable elements from pluripotent stem cells as regulatory elements altering the recruitment of lineage-specific transcription factors. We further discover how co-option is dependent on active chromatin states with important implications for developing treatment options against drivers of oncogenesis across the repetitive DNA. This article is featured in Selected Articles from This Issue, p. 2293.

OLFM4
Also flagged:gastrointestinal acute radiation syndromeGIinsulin-like growth factor 1basic fibroblast growth factorcyclin-dependent kinase 4Toll-like receptor 5
Journal Article 2023-11-01 ✓ 2 Snippets Yan Z, Yin B, Wang Y, Ni Z, Feng J, Yang Q, Li X, Zhu H, Dou Y.
In-Text Gene Mentions

…010, Servicebio, China), anti-Olfm4(DF13440, Affinity Biosciences…

…of olfactomedin 4 (Olfm4), another protein involved…

Show Full Abstract

On the basis of the previous research, the Traditional Chinese Medicine theory was used to improve the drug composition for gastrointestinal acute radiation syndrome (GI-ARS). The purpose of this study was to study the therapeutic mechanism of Liangxue-Guyuan-Yishen decoction (LGYD) on GI-ARS and to provide a new scheme for the treatment of radiation injury. Here, we investigated the effects of LGYD on intestinal stem cells (ISCs) in a GI-ARS rat model. Rat health and survival and the protective efficacy of LGYD on the intestines were analyzed. The active principles in LGYD were detected using liquid chromatography-mass spectrometry (LC-MS). ISC proliferation, intestinal epithelial tight junction (TJ) protein expression and regulatory pathways were explored using immunohistochemistry, western blotting (WB) and reverse transcription quantitative polymerase chain reaction (RT-qPCR), respectively. Involvement of the WNT and MEK/ERK pathways in intestinal recovery was screened using network pharmacology analysis and validated by WB and RT-qPCR. LGYD administration significantly improved health and survival in GI-ARS rats. Pathological analysis showed that LGYD ameliorated radiation-induced intestinal injury and significantly promoted LGR5+ stem cell regeneration in the intestinal crypts, upregulated TJ protein, and accelerated crypt reconstruction in the irradiated rats. LC-MS revealed ≥13 constituents that might contribute to LGYD's protective effects. Collectively, LGYD can promote crypt cell proliferation and ISCs after radiation damage, the above effect may be related to WNT and MEK/ERK pathway.

Also flagged:PDGFRAAcute Lymphoblastic LeukemiaT-cell acute lymphoblastic leukemiaALLlymphoblastic lymphomaLeukemia
Journal Article 2023-11-01 No Snippets Paolino J, Dimitrov B, Apsel Winger B, Sandoval-Perez A, Rangarajan AV, Ocasio-Martinez N, Tsai HK, Li Y, Robichaud AL, Khalid D, Hatton C, Gillani R, Polonen P, Dilig A, Gotti G, Kavanagh J, Adhav AA, Gow S, Tsai J, Li Y, Ebert BL, Van Allen EM, Bledsoe J, Kim AS, Tasian SK, Cooper SL, Cooper TM, Hijiya N, Sulis ML, Shukla NN, Magee JA, Mullighan CG, Burke MJ, Luskin MR, Mar BG, Jacobson MP, Harris MH, Stegmaier K, Place AE, Pikman Y.
Show Full Abstract

<h4>Purpose</h4>Patients with relapsed or refractory T-cell acute lymphoblastic leukemia (T-ALL) or lymphoblastic lymphoma (T-LBL) have limited therapeutic options. Clinical use of genomic profiling provides an opportunity to identify targetable alterations to inform therapy.<h4>Experimental design</h4>We describe a cohort of 14 pediatric patients with relapsed or refractory T-ALL enrolled on the Leukemia Precision-based Therapy (LEAP) Consortium trial (NCT02670525) and a patient with T-LBL, discovering alterations in platelet-derived growth factor receptor-α (PDGFRA) in 3 of these patients. We identified a novel mutation in PDGFRA, p.D842N, and used an integrated structural modeling and molecular biology approach to characterize mutations at D842 to guide therapeutic targeting. We conducted a preclinical study of avapritinib in a mouse patient-derived xenograft (PDX) model of FIP1L1-PDGFRA and PDGFRA p.D842N leukemia.<h4>Results</h4>Two patients with T-ALL in the LEAP cohort (14%) had targetable genomic alterations affecting PDGFRA, a FIP1-like 1 protein/PDGFRA (FIP1L1-PDGFRA) fusion and a novel mutation in PDGFRA, p.D842N. The D842N mutation resulted in PDGFRA activation and sensitivity to tested PDGFRA inhibitors. In a T-ALL PDX model, avapritinib treatment led to decreased leukemia burden, significantly prolonged survival, and even cured a subset of mice. Avapritinib treatment was well tolerated and yielded clinical benefit in a patient with refractory T-ALL.<h4>Conclusions</h4>Refractory T-ALL has not been fully characterized. Alterations in PDGFRA or other targetable kinases may inform therapy for patients with refractory T-ALL who otherwise have limited treatment options. Clinical genomic profiling, in real time, is needed for fully informed therapeutic decision making.

Also flagged:Colorectal Adenocarcinomacolorectal carcinomastumorcolorectal carcinomapathogenesisCell Division Cycle
Journal Article 2023-11-01 No Snippets Osman S, Kahraman Çetin N, Erdoğdu İH, Meteoğlu İ.
Show Full Abstract

<h4>Background/aims</h4>Recent studies that reveal the molecular profiles of colorectal carcinomas have demonstrated tumor heterogeneity. Characterization of colorectal carcinoma-specific genomic alterations is essential for developing more successful and targeted treat- ment protocols. Moreover, it is vital in elucidating the pathogenesis and mechanisms of resistance against treatment and predicting prognosis.<h4>Materials and methods</h4>The study included 73 cases diagnosed with colorectal carcinomas and subjected to molecular analysis by the next-generation sequencing. The association between the clinicopathologic parameters and pathogenic mutations detected in 32 genes was evaluated.<h4>Results</h4>Pathogenic mutations were determined in a total of 24 genes. The Cell Division Cycle 27 (CDC27), Kirsten rat sarcoma viral proto-oncogene (KRAS), serine/threonine protein kinase B-raf (BRAF), phosphatase and tensin homolog, breast cancer 2 (BRCA2), and phosphotidylinositol-4,5-biphosphate 3-kinase (PIK3CA) mutations were determined at higher rates, with the adenomatous polypo- sis coli mutation determined at a lower rate than in the literature. There were significant positive correlations between CDC27 and phosphatase and tensin homolog (PTEN), PTEN and BRCA2, and PTEN and adenomatous polyposis coli (APC) concomitant muta- tions, whereas negative correlations were present between BRAF and KRAS. Statistically significant relationships were present between KRAS exon 2 and mucinous morphology, PIK3CA and absence of perineural invasion, BRAF and tumor differentiation/localization, MutS homolog 3 (MSH3) and tumor diameter, and BRCA2 and absence of lymph node metastasis.<h4>Conclusion</h4>It is necessary to have a comprehensive database of genomic alterations of colorectal carcinomas to interpret mutations more accurately clinically. There are no studies on the frequency of mutations in colorectal carcinomas in the Turkish population; thus, follow-up and treatment protocols are organized following the European and American databases and guidelines. A comprehensive study of the colorectal carcinoma patients' mutation profile in the Turkish patient cohort by the next-generation sequencing method will help to provide significant therapeutic, prognostic, and predictive data and design more successful treatment and follow-up strategies.

PEBP1
Also flagged:membrane associated proteinsmembranemembraneslecithinubiquitinmembrane proteins
Journal Article 2023-11-01 ✓ 5 Snippets Walters SH, Castillo AJ, Develin AM, Labrecque CL, Qu Y, Fuglestad B.
In-Text Gene Mentions

…hanolamine‐binding protein 1 (PEBP1), and fatty acid…

PEBP1, or raf‐1 kinase…

…Purification of GPx4,PEBP1, and FABP4 was…

…removed from GPx4,PEBP1, and FABP4.…

…ThePEBP1buffer was composed…

Show Full Abstract

Advancing the study of membrane associated proteins and their interactions is dependent on accurate membrane models. While a variety of membrane models for high-resolution membrane protein study exist, most do not reflect the diversity of lipids found within biological membranes. In this work, we have developed native reverse micelles (nRMs) formulated with lipids from multiple eukaryotic sources, which encapsulate proteins and enable them to interact as they would with a biological membrane. Diverse formulations of nRMs using soy lecithin, porcine brain lipids, or bovine heart lipids combined with n-dodecylphosphocholine were developed and characterized by dynamic light scattering and <sup>31</sup> P-NMR. To optimize protein encapsulation, ubiquitin was used as a standard and protein NMR verified minimal changes to its structure. Peripheral membrane proteins, which bind reversibly to membranes, were encapsulated and include glutathione peroxidase 4 (GPx4), phosphatidylethanolamine-binding protein 1 (PEBP1), and fatty acid binding protein 4 (FABP4). All three proteins showed anticipated interactions with the membrane-like inner surface of the nRMs as assessed by protein NMR. The nRM formulations developed here allow for efficient, high-resolution study of membrane interacting proteins up to and beyond ~21 kDa, in a more biologically relevant context compared to other non-native membrane models. The approach outlined here may be applied to a wide range of lipid extracts, allowing study of a variety of membrane associated proteins in their specific biological context.

Also flagged:androgen receptorsorganizationtestosteronenucleuschromatinAR
Journal Article 2023-11-01 No Snippets Yavuz S, Kabbech H, van Staalduinen J, Linder S, van Cappellen WA, Nigg AL, Abraham TE, Slotman JA, Quevedo M, Poot RA, Zwart W, van Royen ME, Grosveld FG, Smal I, Houtsmuller AB.
Show Full Abstract

A wide range of nuclear proteins are involved in the spatio-temporal organization of the genome through diverse biological processes such as gene transcription and DNA replication. Upon stimulation by testosterone and translocation to the nucleus, multiple androgen receptors (ARs) accumulate in microscopically discernable foci which are irregularly distributed in the nucleus. Here, we investigated the formation and physical nature of these foci, by combining novel fluorescent labeling techniques to visualize a defined chromatin locus of AR-regulated genes-PTPRN2 or BANP-simultaneously with either AR foci or individual AR molecules. Quantitative colocalization analysis showed evidence of AR foci formation induced by R1881 at both PTPRN2 and BANP loci. Furthermore, single-particle tracking (SPT) revealed three distinct subdiffusive fractional Brownian motion (fBm) states: immobilized ARs were observed near the labeled genes likely as a consequence of DNA-binding, while the intermediate confined state showed a similar spatial behavior but with larger displacements, suggesting compartmentalization by liquid-liquid phase separation (LLPS), while freely mobile ARs were diffusing in the nuclear environment. All together, we show for the first time in living cells the presence of AR-regulated genes in AR foci.

Also flagged:ferroptosisosteosarcomacancersdeathPRNPOS
Journal Article 2023-11-01 No Snippets Shao J, Zhang Y, Chang Z, Du S, Li W, Bai Y, Lu C, Xu T.
Show Full Abstract

The induction of ferroptosis is suggested to be a potential therapeutic strategy for cancers. MicroRNAs (miRNAs) are reported to play an important role in cell death processes. This study aims to construct and validate a risk model based on ferroptosis-related miRNAs (FR_miRNAs) to predict prognosis and identify novel therapeutic targets for osteosarcoma. Data from the Therapeutically Applicable Research to Generate Effective Treatments database are used as the training cohort. A prognostic signature based on two FR_miRNAs (miR-635 and miR-593) is developed using univariate Cox regression, least absolute shrinkage and selection operator regression, and multivariate Cox regression analyses. The area under the curve values of the prognostic signature to predict the 1-year, 2-year, 3-year, and 5-year overall survival rates in patients with osteosarcoma are 0.782, 0.781, 0.722, and 0.777, respectively, indicating a good predictive ability. Based on the risk score, patients are divided into low-risk and high-risk groups. Patients with high-risk scores are associated with poor survival. The risk level is determined to be an independent prognostic factor. A nomogram is established for predicting prognosis. The expression levels of <i>PRNP</i> (miR-635-related ferroptosis-related gene (FRG); <i>P</i>=0.024) and <i>HILPDA</i> (miR-593-related FRG; <i>P</i>=0.025) are significantly different between the low-risk and high-risk groups. All results are validated in an external cohort (GSE39040). The results of the functional assay reveal that miR-635 mimics inhibit osteosarcoma (OS) cell proliferation and migration, whereas miR-593 overexpression exerts the opposite effect. In conclusion, miR-635 and miR-593 exert contrasting regulatory effects on OS cell proliferation and migration.

HFE
Also flagged:agingcancersmethylationSglyoxalmethylglyoxal
Journal Article 2023-11-01 ✓ 1 Snippet Guilbaud A, Ghanegolmohammadi F, Wang Y, Leng J, Kreymerman A, Gamboa Varela J, Garbern J, Elwell H, Cao F, Ricci-Blair EM, Liang C, Balamkundu S, Vidoudez C, DeMott MS, Bedi K, Margulies KB, Bennett DA, Palmer AA, Barkley-Levenson A, Lee RT, Dedon PC.
In-Text Gene Mentions

…as Wilson's disease,hemochromatosisand cirrhosis (…

Show Full Abstract

DNA damage causes genomic instability underlying many diseases, with traditional analytical approaches providing minimal insight into the spectrum of DNA lesions in vivo. Here we used untargeted chromatography-coupled tandem mass spectrometry-based adductomics (LC-MS/MS) to begin to define the landscape of DNA modifications in rat and human tissues. A basis set of 114 putative DNA adducts was identified in heart, liver, brain, and kidney in 1-26-month-old rats and 111 in human heart and brain by 'stepped MRM' LC-MS/MS. Subsequent targeted analysis of these species revealed species-, tissue-, age- and sex-biases. Structural characterization of 10 selected adductomic signals as known DNA modifications validated the method and established confidence in the DNA origins of the signals. Along with strong tissue biases, we observed significant age-dependence for 36 adducts, including N2-CMdG, 5-HMdC and 8-Oxo-dG in rats and 1,N6-ϵdA in human heart, as well as sex biases for 67 adducts in rat tissues. These results demonstrate the potential of adductomics for discovering the true spectrum of disease-driving DNA adducts. Our dataset of 114 putative adducts serves as a resource for characterizing dozens of new forms of DNA damage, defining mechanisms of their formation and repair, and developing them as biomarkers of aging and disease.

HFE
Also flagged:ironosteoporosisgeneticiron overloadBmp6Gene expression
Journal Article 2023-11-01 ✓ 2 Snippets Robin F, Chappard D, Leroyer P, Latour C, Mabilleau G, Monbet V, Cavey T, Horeau M, Derbré F, Roth MP, Ropert M, Guggenbuhl P, Loréal O.
In-Text Gene Mentions

Cellular and molecular mechanisms involved in iron-related osteoporosis are not fully understood.<h4>Aim</h4>The aim of the study was to investigate the respective roles of iron excess and hepcidin, the systemic iron regulator, in the development of iron-related osteoporosis.<h4>Material and methods</h4>We used mice models with genetic iron overload (GIO) related to hepcidin deficiency (Hfe<sup>-/-</sup> and Bmp6<sup>-/-</sup> ) and secondary iron overload (SIO) exhibiting a hepcidin increase secondary to iron excess.

…to hepcidin deficiency (Hfe<sup>-/-</sup> and Bmp6<sup>-/…

Show Full Abstract

Iron overload is one of the secondary osteoporosis etiologies. Cellular and molecular mechanisms involved in iron-related osteoporosis are not fully understood.<h4>Aim</h4>The aim of the study was to investigate the respective roles of iron excess and hepcidin, the systemic iron regulator, in the development of iron-related osteoporosis.<h4>Material and methods</h4>We used mice models with genetic iron overload (GIO) related to hepcidin deficiency (Hfe<sup>-/-</sup> and Bmp6<sup>-/-</sup> ) and secondary iron overload (SIO) exhibiting a hepcidin increase secondary to iron excess. Iron concentration and transferrin saturation levels were evaluated in serum and hepatic, spleen, and bone iron concentrations were assessed by ICP-MS and Perl's staining. Gene expression was evaluated by quantitative RT-PCR. Bone micro-architecture was evaluated by micro-CT. The osteoblastic MC3T3 murine cells that are able to mineralize were exposed to iron and/or hepcidin.<h4>Results</h4>Despite an increase of bone iron concentration in all overloaded mice models, bone volume/total volume (BV/TV) and trabecular thickness (Tb.Th) only decreased significantly in GIO, at 12 months for Hfe<sup>-/-</sup> and from 6 months for Bmp6<sup>-/-</sup> . Alterations in bone microarchitecture in the Bmp6<sup>-/-</sup> model were positively correlated with hepcidin levels (BV/TV (ρ = +.481, p < .05) and Tb.Th (ρ = +.690, p < .05). Iron deposits were detected in the bone trabeculae of Hfe<sup>-/-</sup> and Bmp6<sup>-/-</sup> mice, while iron deposits were mainly visible in bone marrow macrophages in secondary iron overload. In cell cultures, ferric ammonium citrate exposure abolished the mineralization process for concentrations above 5 μM, with a parallel decrease in osteocalcin, collagen 1, and alkaline phosphatase mRNA levels. Hepcidin supplementation of cells had a rescue effect on the collagen 1 and alkaline phosphatase expression level decrease.<h4>Conclusion</h4>Together, these data suggest that iron in excess alone is not sufficient to induce osteoporosis and that low hepcidin levels also contribute to the development of osteoporosis.

SUDS3
Also flagged:human epidermal growth factor receptorHER2ERaromataseestrogenfulvestrant
Journal Article 2023-11-01 ✓ 1 Snippet Bahnassy S, Stires H, Jin L, Tam S, Mobin D, Balachandran M, Podar M, McCoy MD, Beckman RA, Riggins RB.
In-Text Gene Mentions

chromatin modifiers

Show Full Abstract

Breast tumors overexpressing human epidermal growth factor receptor (HER2) confer intrinsic resistance to endocrine therapy (ET), and patients with HER2/estrogen receptor-positive (HER2+/ER+) breast cancer (BCa) are less responsive to ET than HER2-/ER+. However, real-world evidence reveals that a large subset of patients with HER2+/ER+ receive ET as monotherapy, positioning this treatment pattern as a clinical challenge. In the present study, we developed and characterized 2 in vitro models of ET-resistant (ETR) HER2+/ER+ BCa to identify possible therapeutic vulnerabilities. To mimic ETR to aromatase inhibitors (AIs), we developed 2 long-term estrogen deprivation (LTED) cell lines from BT-474 (BT474) and MDA-MB-361 (MM361). Growth assays, PAM50 subtyping, and genomic and transcriptomic analyses, followed by validation and functional studies, were used to identify targetable differences between ET-responsive parental and ETR-LTED HER2+/ER+ cells. Compared to their parental cells, MM361 LTEDs grew faster, lost ER, and increased HER2 expression, whereas BT474 LTEDs grew slower and maintained ER and HER2 expression. Both LTED variants had reduced responsiveness to fulvestrant. Whole-genome sequencing of aggressive MM361 LTEDs identified mutations in genes encoding transcription factors and chromatin modifiers. Single-cell RNA sequencing demonstrated a shift towards non-luminal phenotypes, and revealed metabolic remodeling of MM361 LTEDs, with upregulated lipid metabolism and ferroptosis-associated antioxidant genes, including GPX4. Combining a GPX4 inhibitor with anti-HER2 agents induced significant cell death in both MM361 and BT474 LTEDs. The BT474 and MM361 AI-resistant models capture distinct phenotypes of HER2+/ER+ BCa and identify altered lipid metabolism and ferroptosis remodeling as vulnerabilities of this type of ETR BCa.

Also flagged:preeclampsiaVitamin DAsthmagestationIGF1Rvitamin D insufficiency
Journal Article 2023-11-01 No Snippets Mirzakhani H, Handy DE, Lu Z, Oppenheimer B, Litonjua AA, Loscalzo J, Weiss ST.
Show Full Abstract

<h4>Background</h4>MicroRNAs (miRNAs) have been implicated in the pathobiology of preeclampsia, a common hypertensive disorder of pregnancy. In a nested matched case-control cohort within the Vitamin D Antenatal Asthma Reduction Trial (VDAART), we previously identified peripheral blood mRNA signatures related to preeclampsia and vitamin D status (≤30 ng/mL) during gestation from 10 to 18 weeks, using differential expression analysis.<h4>Methods</h4>Using quantitative PCR arrays, we conducted profiling of circulating miRNAs at 10-18 weeks of gestation in the same VDAART cohort to identify differentially expressed (DE) miRNAs associated with preeclampsia and vitamin D status. For the validation of the expression of circulating miRNA signatures in the placenta, the HTR-8/SVneo trophoblast cell line was used. Targets of circulating miRNA signatures in the preeclampsia mRNA signatures were identified by consensus ranking of miRNA-target prediction scores from four sources. The connected component of target signatures was identified by mapping to the protein-protein interaction (PPI) network and hub targets were determined. As experimental validation, we examined the gene and protein expression of IGF1R, one of the key hub genes, as a target of the DE miRNA, miR-182-5p, in response to a miR-182-5p mimic in HTR-8/SVneo cells.<h4>Results</h4>Pregnant women with preeclampsia had 16 circulating DE miRNAs relative to normal pregnancy controls that were also DE under vitamin D insufficiency (9/16 = 56% upregulated, FDR < .05). Thirteen miRNAs (13/16 = 81.3%) were detected in HTR-8/SVneo cells. Overall, 16 DE miRNAs had 122 targets, of which 87 were unique. Network analysis demonstrated that the 32 targets of DE miRNA signatures created a connected subnetwork in the preeclampsia module with CXCL8, CXCL10, CD274, MMP9 and IGF1R having the highest connectivity and centrality degree. In an in vitro validation experiment, the introduction of an hsa-miR-182-5p mimic resulted in significant reduction of its target IGF1R gene and protein expression within HTR-8/SVneo cells.<h4>Conclusions</h4>The integration of the circulating DE miRNA and mRNA signatures associated preeclampsia added additional insights into the subclinical molecular signature of preeclampsia. Our systems and network biology approach revealed several biological pathways, including IGF-1, that may play a role in the early pathophysiology of preeclampsia. These pathways and signatures also denote potential biomarkers for the early stages of preeclampsia and suggest possible preventive measures.

HTT
Also flagged:mitochondrialoxygenproteostasishydrogenperoxidespinocerebellar ataxia type 3
Journal Article 2023-11-01 ✓ 2 Snippets Pohl F, Germann AL, Mao J, Hou S, Bakare B, Kong Thoo Lin P, Yates K, Nonet ML, Akk G, Kornfeld K, Held JM.
In-Text Gene Mentions

GABA signaling is also affected in models of Huntington’s disease (HD), which have polyQ expansions in the huntingtin (htt) protein (79).

…in the huntingtin (htt) protein ( 79…

Show Full Abstract

The γ-aminobutyric acid-mediated (GABAergic) system participates in many aspects of organismal physiology and disease, including proteostasis, neuronal dysfunction, and life-span extension. Many of these phenotypes are also regulated by reactive oxygen species (ROS), but the redox mechanisms linking the GABAergic system to these phenotypes are not well defined. Here, we report that GABAergic redox signaling cell nonautonomously activates many stress response pathways in <i>Caenorhabditis elegans</i> and enhances vulnerability to proteostasis disease in the absence of oxidative stress. Cell nonautonomous redox activation of the mitochondrial unfolded protein response (mitoUPR) proteostasis network requires UNC-49, a GABA<sub>A</sub> receptor that we show is activated by hydrogen peroxide. MitoUPR induction by a spinocerebellar ataxia type 3 (SCA3) <i>C. elegans</i> neurodegenerative disease model was similarly dependent on UNC-49 in <i>C. elegans</i>. These results demonstrate a multi-tissue paradigm for redox signaling in the GABAergic system that is transduced via a GABA<sub>A</sub> receptor to function in cell nonautonomous regulation of health, proteostasis, and disease.

SOX6
Also flagged:cell proliferationcell differentiationnucleusskeletal muscle diseasemyoblast proliferationmyoblast differentiation
Journal Article 2023-11-01 ✓ 1 Snippet Ma M, Chen M, Wu X, Sooranna SR, Liu Q, Shi D, Wang J, Li H.
In-Text Gene Mentions

…Pax7, MYOM3, MYOM1,SOX6, Myf5, PPARD, IGF2,…

Show Full Abstract

Cattle skeletal muscle development is a complex and highly coordinated biological process mediated by a series of myogenic regulators, which plays a critical role in beef yield and quality. Long non-coding RNAs (lncRNAs) have been shown to regulate skeletal muscle development. However, the molecular mechanism by which lncRNAs regulate skeletal muscle development is largely unknown. We performed transcriptome analysis of muscle tissues of adult and embryo Angus cattle to investigate the mechanism by which lncRNA regulates skeletal muscle development between adult and embryo cattle. A total of 37,115 candidate lncRNAs were detected, and a total of 1,998 lncRNAs were differentially expressed between the muscle tissue libraries of adult and embryo cattle, including 1,229 up-regulated lncRNAs and 769 down-regulated lncRNAs (adult cattle were the control group). We verified the expression of 7 differentially expressed lncRNAs by quantitative real-time PCR (RT-qPCR), and analysed the tissue expression profile of lnc000100, which is down-regulated in the longest dorsal muscle during foetal life and which is highly specifically expressed in muscle tissue. We found that the interference of lnc000100 significantly inhibited cell proliferation and promoted cell differentiation. Lnc000100 was located in the nucleus by RNA-FISH. Our research provides certain resources for the analysis of lncRNA regulating cattle skeletal muscle development, and may also provide new insights for improving beef production and breed selection.

DCC
Also flagged:axonneurologic disordersresponse toextracellular signalstoaxonal
Journal Article 2023-11-01 ✓ 1 Snippet Cagnetta R, Flanagan JG, Sonenberg N.
In-Text Gene Mentions

DCC

Show Full Abstract

In multiple cell types, mRNAs are transported to subcellular compartments, where local translation enables rapid, spatially localized, and specific responses to external stimuli. Mounting evidence has uncovered important roles played by local translation <i>in vivo</i> in axon survival, axon regeneration, and neural wiring, as well as strong links between dysregulation of local translation and neurologic disorders. Omic studies have revealed that >1000 mRNAs are present and can be selectively locally translated in the presynaptic and postsynaptic compartments from development to adulthood <i>in vivo</i> A large proportion of the locally translated mRNAs is specifically upregulated or downregulated in response to distinct extracellular signals. Given that the local translatome is large, selectively translated, and cue-specifically remodeled, a fundamental question concerns how selective translation is achieved locally. Here, we review the emerging regulatory mechanisms of local selective translation in neuronal subcellular compartments, their mRNA targets, and their orchestration. We discuss mechanisms of local selective translation that remain unexplored. Finally, we describe clinical implications and potential therapeutic strategies in light of the latest advances in gene therapy.

Also flagged:cancerChromatingene expressionnucleustransposasetranscription factor
Journal Article 2023-11-01 No Snippets Terekhanova NV, Karpova A, Liang WW, Strzalkowski A, Chen S, Li Y, Southard-Smith AN, Iglesia MD, Wendl MC, Jayasinghe RG, Liu J, Song Y, Cao S, Houston A, Liu X, Wyczalkowski MA, Lu RJ, Caravan W, Shinkle A, Naser Al Deen N, Herndon JM, Mudd J, Ma C, Sarkar H, Sato K, Ibrahim OM, Mo CK, Chasnoff SE, Porta-Pardo E, Held JM, Pachynski R, Schwarz JK, Gillanders WE, Kim AH, Vij R, DiPersio JF, Puram SV, Chheda MG, Fuh KC, DeNardo DG, Fields RC, Chen F, Raphael BJ, Ding L.
Show Full Abstract

Chromatin accessibility is essential in regulating gene expression and cellular identity, and alterations in accessibility have been implicated in driving cancer initiation, progression and metastasis<sup>1-4</sup>. Although the genetic contributions to oncogenic transitions have been investigated, epigenetic drivers remain less understood. Here we constructed a pan-cancer epigenetic and transcriptomic atlas using single-nucleus chromatin accessibility data (using single-nucleus assay for transposase-accessible chromatin) from 225 samples and matched single-cell or single-nucleus RNA-sequencing expression data from 206 samples. With over 1 million cells from each platform analysed through the enrichment of accessible chromatin regions, transcription factor motifs and regulons, we identified epigenetic drivers associated with cancer transitions. Some epigenetic drivers appeared in multiple cancers (for example, regulatory regions of ABCC1 and VEGFA; GATA6 and FOX-family motifs), whereas others were cancer specific (for example, regulatory regions of FGF19, ASAP2 and EN1, and the PBX3 motif). Among epigenetically altered pathways, TP53, hypoxia and TNF signalling were linked to cancer initiation, whereas oestrogen response, epithelial-mesenchymal transition and apical junction were tied to metastatic transition. Furthermore, we revealed a marked correlation between enhancer accessibility and gene expression and uncovered cooperation between epigenetic and genetic drivers. This atlas provides a foundation for further investigation of epigenetic dynamics in cancer transitions.

LRRC7
Also flagged:centromereorganizationchromosomechromosomesNCAPG2condensin II
Journal Article 2023-11-01 ✓ 2 Snippets El Yakoubi W, Akera T.
In-Text Gene Mentions

Condensindysfunction is a…

Condensins

Show Full Abstract

Reproductive isolation occurs when the genomes of two populations accumulate genetic incompatibilities that prevent interbreeding<sup>1,2</sup>. Understanding of hybrid incompatibility at the cell biology level is limited, particularly in the case of hybrid female sterility<sup>3</sup>. Here we find that species divergence in condensin regulation and centromere organization between two mouse species, Mus musculus domesticus and Mus spretus, drives chromosome decondensation and mis-segregation in their F<sub>1</sub> hybrid oocytes, reducing female fertility. The decondensation in hybrid oocytes was especially prominent at pericentromeric major satellites, which are highly abundant at M. m. domesticus centromeres<sup>4-6</sup>, leading to species-specific chromosome mis-segregation and egg aneuploidy. Consistent with the condensation defects, a chromosome structure protein complex, condensin II<sup>7,8</sup>, was reduced on hybrid oocyte chromosomes. We find that the condensin II subunit NCAPG2 was specifically reduced in the nucleus in prophase and that overexpressing NCAPG2 rescued both the decondensation and egg aneuploidy phenotypes. In addition to the overall reduction in condensin II on chromosomes, major satellites further reduced condensin II levels locally, explaining why this region is particularly prone to decondensation. Together, this study provides cell biological insights into hybrid incompatibility in female meiosis and demonstrates that condensin misregulation and pericentromeric satellite expansion can establish a reproductive isolating barrier in mammals.

LRRC7
Also flagged:synapsessynaptosomespresynaptic terminalssynaptosomesynapseorganization
Journal Article 2023-11-01 ✓ 1 Snippet van Oostrum M, Blok TM, Giandomenico SL, Tom Dieck S, Tushev G, Fürst N, Langer JD, Schuman EM.
In-Text Gene Mentions

…the Lrr family (Lrrc7/57/4) and protein phosphatase…

Show Full Abstract

Neurons build synaptic contacts using different protein combinations that define the specificity, function, and plasticity potential of synapses; however, the diversity of synaptic proteomes remains largely unexplored. We prepared synaptosomes from 7 different transgenic mouse lines with fluorescently labeled presynaptic terminals. Combining microdissection of 5 different brain regions with fluorescent-activated synaptosome sorting (FASS), we isolated and analyzed the proteomes of 18 different synapse types. We discovered ∼1,800 unique synapse-type-enriched proteins and allocated thousands of proteins to different types of synapses (https://syndive.org/). We identify shared synaptic protein modules and highlight the proteomic hotspots for synapse specialization. We reveal unique and common features of the striatal dopaminergic proteome and discover the proteome signatures that relate to the functional properties of different interneuron classes. This study provides a molecular systems-biology analysis of synapses and a framework to integrate proteomic information for synapse subtypes of interest with cellular or circuit-level experiments.

HFE
Also flagged:CDCP1non-alcoholic steatohepatitisNASHCUB domain-containing protein 1cytokeratin-18diabetes
Journal Article 2023-11-01 ✓ 1 Snippet Jia X, Song E, Liu Y, Chen J, Wan P, Hu Y, Ye D, Chakrabarti S, Mahajan H, George J, Yan S, Yu Y, Zhang G, Wang Y, Yang W, Wu L, Hua S, Lee CH, Li H, Jiang X, Lam KSL, Wang C, Xu A.
In-Text Gene Mentions

…drug-induced liver disease,hemochromatosis, α1-antitrypsin deficiency an…

Show Full Abstract

The definitive diagnosis of non-alcoholic steatohepatitis (NASH) currently relies on invasive and labor-intensive liver biopsy. Here, we identified soluble CUB domain-containing protein 1 (sCDCP1) as a top-ranked non-invasive biomarker for NASH using Olink-based proteomics in 238 obese individuals with liver biopsies. Both the circulating concentration and hepatic mRNA abundance of sCDCP1 were significantly elevated in patients with NASH and correlated closely with each histological feature of NASH. In the pooled multicenter validation cohort, sCDCP1 as a standalone biomarker achieved an area under the receiver operating characteristic (AUROC) of 0.838 (95% confidence interval [CI] 0.789-0.887) for diagnosing NASH, which is better than those achieved with cytokeratin-18 and other non-invasive tests. Furthermore, the C-DAG model established by the combination of sCDCP1 with diabetes, aspartate aminotransferase (AST), and gender accurately rules in and rules out both NASH and fibrotic NASH (gray zones <20%). Thus, sCDCP1-based non-invasive tests can be potentially implemented for screening and early diagnosis of NASH and for ruling out low-risk individuals to avoid unnecessary liver biopsies.

Also flagged:oxygenintraventricular hemorrhagedeathplacental abruptionplacenta previahemorrhage
Journal Article 2023-11-01 No Snippets Kuehne B, Grüttner B, Hellmich M, Hero B, Kribs A, Oberthuer A.
Show Full Abstract

<h4>Importance</h4>An extrauterine placental perfusion (EPP) approach for physiological-based cord clamping (PBCC) may support infants with very low birth weight (VLBW) during transition without delaying measures of support.<h4>Objective</h4>To test whether EPP in resuscitation of infants with VLBW results in higher hematocrit levels, better oxygenation, or improved infant outcomes compared with delayed cord clamping (DCC).<h4>Design, setting, and participants</h4>This nonblinded, single-center randomized clinical trial was conducted at a tertiary care neonatal intensive care unit. Infants with a gestational age greater than 23 weeks and birth weight less than 1500 g born by cesarean delivery between May 2019 and June 2021 were included. Data were analyzed from October through December 2021.<h4>Intervention</h4>Prior to cesarean delivery, participants were allocated to receive EPP or DCC. In the EPP group, infant and placenta, connected by an intact umbilical cord, were detached from the uterus and transferred to the resuscitation unit. Respiratory support was initiated while holding the placenta over the infant. The umbilical cord was clamped when infants showed regular spontaneous breathing, stable heart rates greater than 100 beats/min, and adequate oxygen saturations. In the DCC group, cords were clamped 30 to 60 seconds after birth before infants were transferred to the resuscitation unit, where respiratory support was started.<h4>Main outcomes and measure</h4>The primary outcome was the mean hematocrit level in the first 24 hours after birth. Secondary prespecified outcome parameters comprised oxygenation during transition and short-term neonatal outcome.<h4>Results</h4>Among 60 infants randomized and included, 1 infant was excluded after randomization; there were 29 infants in the EPP group (mean [SD] gestational age, 27 weeks 6 days [15.0 days]; 14 females [48.3%]) and 30 infants in the DCC group (mean [SD] gestational age, 28 weeks 1 day [17.1 days]; 17 females [56.7%]). The mean (SD) birth weight was 982.8 (276.6) g and 970.2 (323.0) g in the EPP and DCC group, respectively. Intention-to-treat analysis revealed no significant difference in mean hematocrit level (mean difference [MD], 2.1 percentage points; [95% CI, -2.2 to 6.4 percentage points]). During transition, infants in the EPP group had significantly higher peripheral oxygen saturation as measured by pulse oximetry (adjusted MD at 5 minutes, 15.3 percentage points [95% CI, 2.0 to 28.6 percentage points]) and regional cerebral oxygen saturation (adjusted MD at 5 minutes, 11.3 percentage points [95% CI, 2.0 to 20.6 percentage points]). Neonatal outcome parameters were similar in the 2 groups.<h4>Conclusions and relevance</h4>This study found that EPP resulted in similar hematocrit levels as DCC, with improved cerebral and peripheral oxygenation during transition. These findings suggest that EPP may be an alternative procedure for PBCC in infants with VLBW.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT03916159.

DDX27
Also flagged:Pancreatic cancercancerlocalized diseasebenzochalconeHydroxyquinolin
Journal Article 2023-11-01 ✓ 3 Snippets Guan X, Zhao B, Guan X, Dong J, Ying J.
In-Text Gene Mentions

…were as follows:DDX27(1:1000 dilution, #2251C2a;…

…studies showed thatDDX27regulated colony formation…

…KL-6 treatment decreasedDDX27expression in both…

Show Full Abstract

<h4>Background</h4>Pancreatic cancer is a highly aggressive and lethal disease with limited treatment options. In this study, we investigated the potential therapeutic effects of compound KL-6 on pancreatic cancer cells.<h4>Methods</h4>The study involved assessing the inhibitory effects of KL-6 on cell proliferation, clonogenic potential, cell cycle progression, apoptosis, migration, and invasion. Additionally, we examined the action mechanism of KL-6 by RNA-seq and bioinformatic analysis and validated by qRT-PCR and western blot in pancreatic cancer cells.<h4>Results</h4>Our results demonstrated that KL-6 effectively inhibited the growth of pancreatic cancer cells in a dose-dependent manner. It induced G2/M phase cell cycle arrest and apoptosis, disrupting the cell cycle progression and promoting cell death. KL-6 also exhibited inhibitory effects on cell migration and invasion, suggesting its potential to suppress the metastatic properties of pancreatic cancer cells. Furthermore, KL-6 modulated the expression of genes involved in various cancer-related pathways including apoptosis and ferroptosis.<h4>Conclusion</h4>These findings collectively support the potential of KL-6 as a promising therapeutic option for pancreatic cancer treatment. Further research is needed to fully understand the underlying mechanisms and evaluate the clinical efficacy of KL-6 in pancreatic cancer patients.

Also flagged:origins of replicationcell divisionchromatinsynthesiscellularhistone
Journal Article 2023-11-01 No Snippets Abbas Z, Rehman MU, Tayara H, Chong KT.
Show Full Abstract

<h4>Motivation</h4>The origins of replication sites (ORIs) are precise regions inside the DNA sequence where the replication process begins. These locations are critical for preserving the genome's integrity during cell division and guaranteeing the faithful transfer of genetic data from generation to generation. The advent of experimental techniques has aided in the discovery of ORIs in many species. Experimentation, on the other hand, is often more time-consuming and pricey than computational approaches, and it necessitates specific equipment and knowledge. Recently, ORI sites have been predicted using computational techniques like motif-based searches and artificial intelligence algorithms based on sequence characteristics and chromatin states.<h4>Results</h4>In this article, we developed ORI-Explorer, a unique artificial intelligence-based technique that combines multiple feature engineering techniques to train CatBoost Classifier for recognizing ORIs from four distinct eukaryotic species. ORI-Explorer was created by utilizing a unique combination of three traditional feature-encoding techniques and a feature set obtained from a deep-learning neural network model. The ORI-Explorer has significantly outperformed current predictors on the testing dataset. Furthermore, by employing the sophisticated SHapley Additive exPlanation method, we give crucial insights that aid in comprehending model success, highlighting the most relevant features vital for forecasting cell-specific ORIs. ORI-Explorer is also intended to aid community-wide attempts in discovering potential ORIs and developing innovative verifiable biological hypotheses.<h4>Availability and implementation</h4>The used datasets along with the source code are made available through https://github.com/Z-Abbas/ORI-Explorer and https://zenodo.org/record/8358679.

HTT
Also flagged:CALM3Leukemiaskin developmentchemokine receptorbindingcytokine receptors
Journal Article 2023-11-01 ✓ 2 Snippets He J, Ni Z, Li Z.
In-Text Gene Mentions

…FLNA, CALM3, andHTTgenes are commonly…

…that CALM3 andHTTare promising targets…

Show Full Abstract

Leukemia is an abnormal proliferation of white blood cells in the bone marrow, resulting in a large accumulation of abnormal leukemia cells in the blood and bone marrow. Hemorrhoids are dilated and swollen veins in the rectum or anal area. However, the relationship between CALM3 and leukemia and hemorrhoids remains unclear. The hemorrhoids dataset GSE154650 and leukemia dataset GSE26294 were downloaded from GEO databases generated by GPL20301 and GPL571.The R package limma was used to screen differentially expressed genes (DEDs). Weighted gene co-expression network analysis (WGCNA) was performed. The construction and analysis of protein-protein interaction (PPI) network, functional enrichment analysis, Gene Set Enrichment Analysis (GSEA) and comparative toxicogenomics database (CTD) analysis were performed. TargetScan was used to screen miRNAs regulating central DEGs. It was verified by western blot basic cell assay. A total of 125 DEGs were co-identified. According to the GO analysis, they are mainly enriched in small molecule catabolic processes, skin development, and chemokine receptor binding. The KEGG analysis results show that the target cells are mainly enriched in the interaction of cytokines and cytokine receptors, as well as butyric acid metabolism. The GSEA analysis results indicate enrichment in small molecule catabolic processes, skin development, and chemokine receptor binding. Six core genes (CALM3, ACE2, PPARGC1A, XCR1, CFTR, PRKCA) were identified. We found that the core gene CALM3 is highly expressed in hemorrhoid samples, low in leukemia samples, and has low expression in normal samples, which may play a regulatory role in hemorrhoids and leukemia. Immunoinfiltration results showed a higher proportion of T_cells_CD4_memory_resting and a correlation with T_cells_CD8. WB experiment verified the result. CALM3 expression is low in leukemia, and the lower the expression is, the worse the prognosis is. CALM3 is highly expressed in hemorrhoids, and the higher the expression, the worse the prognosis.

PTGIS
Also flagged:tumorpRCCnon-clear cell RCCclear cell RCCpapillary renal cell carcinomagene expression
Journal Article 2023-11-01 ✓ 1 Snippet de Vries-Brilland M, Rioux-Leclercq N, Meylan M, Dauvé J, Passot C, Spirina-Menand E, Flippot R, Fromont G, Gravis G, Geoffrois L, Chevreau C, Rolland F, Blanc E, Lefort F, Ravaud A, Gross-Goupil M, Escudier B, Negrier S, Albiges L.
In-Text Gene Mentions

…signature (PMCH, AHI,PTGIS, CXCR6, EVI5, IL-26,…

Show Full Abstract

<h4>Background</h4>Papillary renal cell carcinoma (pRCC) is the most common non-clear cell RCC, and associated with poor outcomes in the metastatic setting. In this study, we aimed to comprehensively evaluate the immune tumor microenvironment (TME), largely unknown, of patients with metastatic pRCC and identify potential therapeutic targets.<h4>Methods</h4>We performed quantitative gene expression analysis of TME using Microenvironment Cell Populations-counter (MCP-counter) methodology, on two independent cohorts of localized pRCC (n=271 and n=98). We then characterized the TME, using immunohistochemistry (n=38) and RNA-sequencing (RNA-seq) (n=30) on metastatic pRCC from the prospective AXIPAP trial cohort.<h4>Results</h4>Unsupervised clustering identified two "TME subtypes", in each of the cohorts: the "immune-enriched" and the "immune-low". Within AXIPAP trial cohort, the "immune-enriched" cluster was significantly associated with a worse prognosis according to the median overall survival to 8 months (95% CI, 6 to 29) versus 37 months (95% CI, 20 to NA, p=0.001). The two immune signatures, Teff and JAVELIN Renal 101 Immuno signature, predictive of response to immune checkpoint inhibitors (CPI) in clear cell RCC, were significantly higher in the "immune-enriched" group (adjusted p<0.05). Finally, five differentially overexpressed genes were identified, corresponding mainly to B lymphocyte populations.<h4>Conclusion</h4>For the first time, using RNA-seq and immunohistochemistry, we have highlighted a specific immune TME subtype of metastatic pRCC, significantly more infiltrated with T and B immune population. This "immune-enriched" group appears to have a worse prognosis and could have a potential predictive value for response to immunotherapy, justifying the confirmation of these results in a cohort of metastatic pRCC treated with CPI and in combination with targeted therapies.<h4>Trial registration number</h4>NCT02489695.

VRK2
Also flagged:Vaccinia-Related Kinase 2AB-cell lymphoma-extra LargeBcl-xLcancerSer/Thr kinasetransmembrane
Journal Article 2023-11-01 ✓ 4 Snippets Puja R, Dutta S, Bose K.
In-Text Gene Mentions

Vaccinia-Related Kinase 2 (VRK2) is an anti-apoptotic Ser/Thr kinase that enhances drug sensitivity in cancer cells.

Vaccinia-Related Kinase 2Kinase 2 (VRK2)…

…Vaccinia-Related Kinase 2 (VRK2) is an anti-apoptotic…

…therapeutic importance ofVRK2family proteins is…

Show Full Abstract

Vaccinia-Related Kinase 2 (VRK2) is an anti-apoptotic Ser/Thr kinase that enhances drug sensitivity in cancer cells. This protein exists in two isoforms: VRK2A, the longer variant, and VRK2B, which lacks the C-terminal region and transmembrane domain. While the therapeutic importance of VRK2 family proteins is known, the specific roles of VRK2A and its interplay with apoptotic regulator Bcl-xL (B-cell lymphoma-extra Large) remain elusive. Bcl-xL regulates cell death by interacting with BAX (B-cell lymphoma-2 Associated X-protein), controlling its cellular localization and influencing BAX-associated processes and signaling pathways. As VRK2A interacts with the Bcl-xL-BAX complex, comprehending its regulatory engagement with Bcl-xL presents potential avenues for intervening in diseases. Using a multi-disciplinary approach, this study provides information on the cellular localization of VRK2A and establishes its interaction with Bcl-xL in the cellular milieu, pinpointing the interacting site and elucidating its anti-apoptotic property within the complex. Furthermore, this study also put forth a model that highlights the importance of VRK2A in stabilizing the ternary complex, formed with Bcl-xL and BAX, thereby impeding BAX dissociation and hence apoptosis. Therefore, further investigations associated with this important revelation will provide cues for designing cancer therapeutics in the future.

B4GALT5
Also flagged:calvingRho GTPase activating protein 15trypanosomiasisARHGAP15catenin alpha 2CTNNA2
Journal Article 2023-11-01 ✓ 5 Snippets Laodim T, Koonawootrittriron S, Elzo MA, Suwanasopee T, Jattawa D, Sarakul M.
In-Text Gene Mentions

Further, B4GALT5 was found to be expressed in bovine mammary epithelial cells and involved in upregulating the immune system during bovine leukemia virus infection, resulting in a decrease in the incidence of mastitis [28].

Gene B4GALT5 was reported to be a candidate gene associated with mastitis resistance caused by Escherichia coli and Streptococcus uberis in dairy cows [26].

The involvement of B4GALT5 in immune response and mastitis resistance underscores its significance in maintaining mammary health and milk production.

…-1,4-galactosyltransferase 5 (B4GALT5), and protein…

…The FBXO36 ,B4GALT5, and PTPRE…

Show Full Abstract

<h4>Objective</h4>The objective of this study was to identify genes associated with 305-day milk yield (MY) and fat yield (FY) that also influence the adaptability of the Thai multibreed dairy cattle population to tropical conditions.<h4>Methods</h4>A total of 75,776 imputed and actual single nucleotide polymorphisms (SNPs) from 2,661 animals were used to identify genomic regions associated with MY and FY using the single-step genomic best linear unbiased predictions. Fixed effects included herd-yearseason, breed regression, heterosis regression and calving age regression effects. Random effects were animal additive genetic and residual. Individual SNPs with a p-value smaller than 0.05 were selected for gene mapping, function analysis, and quantitative trait loci (QTL) annotation analysis.<h4>Results</h4>A substantial number of QTLs associated with MY (9,334) and FY (8,977) were identified by integrating SNP genotypes and QTL annotations. Notably, we discovered 17 annotated QTLs within the health and exterior QTL classes, corresponding to nine unique genes. Among these genes, Rho GTPase activating protein 15 (ARHGAP15) and catenin alpha 2 (CTNNA2) have previously been linked to physiological traits associated with tropical adaptation in various cattle breeds. Interestingly, these two genes also showed signs of positive selection, indicating their potential role in conferring tolerance to trypanosomiasis, a prevalent tropical disease.<h4>Conclusion</h4>Our findings provide valuable insights into the genetic basis of MY and FY in the Thai multibreed dairy cattle population, shedding light on the underlying mechanisms of tropical adaptation. The identified genes represent promising targets for future breeding strategies aimed at improving milk and fat production while ensuring resilience to tropical challenges. This study significantly contributes to our understanding of the genetic factors influencing milk production and adaptability in dairy cattle, facilitating the development of sustainable genetic selection strategies and breeding programs in tropical environments.

HFE
Also flagged:Mineralsmineralmagnesiumzinccopperiron
Journal Article 2023-11-01 ✓ 5 Snippets Stefanache A, Lungu II, Butnariu IA, Calin G, Gutu C, Marcu C, Grierosu C, Bogdan Goroftei ER, Duceac LD, Dabija MG, Popa F, Damir D.
In-Text Gene Mentions

…the case ofHFE-associated HH, an autosomal-r…

…for the causativeHFEgene deficiency, which…

Hfe's ability to interact…

…a result, whenHfeis altered, TBI…

…the absence ofHfe.…

Show Full Abstract

Sufficient mineral supply is vital not only for the innate immune system but also for the components of the adaptive immune defense, which encompass defense mechanisms against pathogens and the delicate balance of pro- and anti-inflammatory regulation in the long term. Generally, a well-balanced diet is capable of providing the necessary minerals to support the immune system. Nevertheless, specific vulnerable populations should be cautious about obtaining adequate amounts of minerals such as magnesium, zinc, copper, iron, and selenium. Inadequate levels of these minerals can temporarily impair immune competence and disrupt the long-term regulation of systemic inflammation. Therefore, comprehending the mechanisms and sources of these minerals is crucial. In exceptional circumstances, mineral deficiencies may necessitate supplementation; however, excessive intake of supplements can have adverse effects on the immune system and should be avoided. Consequently, any supplementation should be approved by medical professionals and administered in recommended doses. This review emphasizes the crucial significance of minerals in promoting optimal functioning of the immune system. It investigates the indispensable minerals required for immune system function and the regulation of inflammation. Moreover, it delves into the significance of maintaining an optimized intake of minerals from a nutritional standpoint.

DCC
Also flagged:Aryl Hydrocarbon ReceptorObesityMultiple Myelomacell growthAhRcancers
Journal Article 2023-11-01 ✓ 3 Snippets Diedrich JD, Cole CE, Pianko MJ, Colacino JA, Bernard JJ.
In-Text Gene Mentions

…Direct Co-culture (AdipoDCC): Mouse bone marrow…

…with adipocytes (AdipoDCC) or on top…

…with BMAs (AdipoDCC) or in the…

Show Full Abstract

Obesity is not only a risk factor for multiple myeloma (MM) incidence, but it is also associated with an increased risk of progression from myeloma precursors-monoclonal gammopathy of undetermined significance-and smoldering myeloma. Adipocytes in the bone marrow (BMAs) microenvironment have been shown to facilitate MM cell growth via secreted factors, but the nature of these secreted factors and their mechanism of action have not been fully elucidated. The elevated expression of aryl hydrocarbon receptor (AhR) is associated with a variety of different cancers, including MM; however, the role of AhR activity in obesity-associated MM cell growth and survival has not been explored. Indeed, this is of particular interest as it has been recently shown that bone marrow adipocytes are a source of endogenous AhR ligands. Using multiple in vitro models of tumor-adipocyte crosstalk to mimic the bone microenvironment, we identified a novel, non-toxicological role of the adipocyte-secreted factors in the suppression of AhR activity in MM cells. A panel of six MM cell lines were cultured in the presence of bone marrow adipocytes in (1) a direct co-culture, (2) a transwell co-culture, or (3) an adipocyte-conditioned media to interrogate the effects of the secreted factors on MM cell AhR activity. Nuclear localization and the transcriptional activity of the AhR, as measured by <i>CYP1A1</i> and <i>CYP1B1</i> gene induction, were suppressed by exposure to BMA-derived factors. Additionally, decreased AhR target gene expression was associated with worse clinical outcomes. The knockdown of AhR resulted in reduced <i>CYP1B1</i> expression and increased cellular growth. This tumor-suppressing role of <i>CYP1A1</i> and <i>CYP1B1</i> was supported by patient data which demonstrated an association between reduced target gene expression and worse overall survival. These data demonstrated a novel mechanism by which bone marrow adipocytes promote MM progression.

PTGIS
Also flagged:tumourbreast cancerluminal breast cancermetabolismtumoursPIK3CA
Journal Article 2023-11-01 ✓ 1 Snippet Li X, Chen G, Wang F, Guo X, Zhang R, Liu P, Dong L, Yu W, Wang H, Wang H, Yu J.
In-Text Gene Mentions

…GGT6, ALOX15B, PTGDS,PTGIS, PLA2G5, ALOX5, LTC4S,…

Show Full Abstract

<h4>Background</h4>Oncogenic PIK3CA mutations (PIK3CA<sup>mut</sup> ) frequently occur in a higher proportion in luminal breast cancer (LBC), especially in refractory advanced cases, and are associated with changes in tumour cellular metabolism. Nevertheless, its effect on the progression of the immune microenvironment (TIME) within tumours and vital molecular events remains veiled.<h4>Methods</h4>Multiplex immunohistochemistry (mIHC) and single-cell mass cytometry (CyTOF) was used to describe the landscape of TIME in PIK3CA<sup>mut</sup> LBC. The PIK3CA mutant cell lines were established using CRISPER/Cas9 system. The gene expression levels, protein secretion and activity of signaling pathways were measured by real-time RT-PCR, ELISA, immunofluorescence staining or western blotting. GSEA analysis, transwell chemotaxis assay, live cell imaging, flow cytometry metabolite analysis targeting arachidonic acid, Dual-luciferase reporter assay, and Chromatin immunoprecipitation assay were used to investigate the underlying function and mechanism of the PI3K/5-LOX/LTB4 axis.<h4>Results</h4>PIK3CA<sup>mut</sup> LBC cells can induce an immunosuppressive TIME by recruiting myeloid-derived suppressor cells (MDSCs) and excluding cytotoxic T cells via the arachidonic acid (AA) metabolism pathway. Mechanistically, PIK3CA<sup>mut</sup> activates the transcription of 5-lipoxygenase (5-LOX) in a STAT3-dependent manner, which in turn directly results in high LTB4 production, binding to BLT2 on MDSCs and promoting their infiltration. Since a suppressive TIME is a critical barrier for the success of cancer immunotherapy, the strategies that can convert "cold" tumours into "hot" tumours were compared. Targeted therapy against the PI3K/5-LOX/LTB4 axis synergizing with immune checkpoint blockade (ICB) therapy achieved dramatic shrinkage in vivo.<h4>Conclusions</h4>The results emphasize that PIK3CA<sup>mut</sup> can induce immune evasion by recruiting MDSCs through the 5-LOX-dependent AA pathway, and combination targeted therapy with ICB may provide a promising treatment option for refractory advanced LBC patients.

RABGAP1L
Also flagged:Breast cancertransient receptor potential (TRP) channelstumorbreast carcinomaMalignant Tumorcheckpoint
Journal Article 2023-11-01 ✓ 2 Snippets Guo Q, Qiu P, Pan K, Chen J, Wang B, Lin J.
In-Text Gene Mentions

…NC02463, SIDT1-AS1, BTBD9-AS1,RABGAP1L-IT1, and ANKRD44-IT1.…

…expression level ofRABGAP1L-IT1) + (-0.288 ×…

Show Full Abstract

Breast cancer (BC) is the most commonly diagnosed malignancy in women around the world. Accumulating evidence suggests that transient receptor potential (TRP) channels play a significant role in tumor progression and immune cell infiltration. Hence, we conducted the study to investigate the correlation between TRP-associated lncRNAs and the prognosis of breast carcinoma. In the current study, 33 TRP-associated genes were selected from a review published by Amrita Samanta et al, and the TRP-related lncRNAs were identified by Pearson analysis. Based on the sum of the expression levels of 12 lncRNAs provided by the Cancer Genome Atlas (TCGA), a TRP-associated lncRNA signature was established by using Cox regression analysis. According to the median value of the risk score in the training set, BC patients were separated into high- and low-risk groups. Subsequently, functional enrichment analysis was conducted on the differential expression genes (DEGs) between different risk groups. The Estimation of Stromal and Immune Cells in Malignant Tumor Tissues Using Expression (ESTIMATE) Score was calculated by ESTIMATE, and the immune cell infiltration was evaluated by ssGSEA. Finally, the immune checkpoint gene expression levels, microsatellite instability (MSI), and immunophenoscore (IPS) were further assessed. The high-risk groups exhibited lower survival rates, while the low-risk groups showed higher survival rates. As a result, the DEGs between different risk groups were highly enriched in immune cell activation and immunoregulation. Besides, the ESTIMATE scores of patients in low-risk groups were higher than those in high-risk groups. The infiltration levels of several immune cells were remarkably elevated in low-risk groups, and various immune signatures were activated with a decreased risk score. Eventually, the TRP-associated lncRNA signature was confirmed with a highly potential ability to evaluate the immunotherapy response in breast carcinoma patients. The outcomes of the current study indicated that the 12-TRP-associated-lncRNA risk model was an independent prognostic risk factor for BC patients. This risk model could be closely related to the tumor immune microenvironment in BC. Our findings will provide new insights for future immunotherapy for BC treatment.

Also flagged:organizationchromatincohesinCTCFgene expressionIKAROS
Journal Article 2023-11-01 No Snippets Hu Y, Salgado Figueroa D, Zhang Z, Veselits M, Bhattacharyya S, Kashiwagi M, Clark MR, Morgan BA, Ay F, Georgopoulos K.
Show Full Abstract

A generic level of chromatin organization generated by the interplay between cohesin and CTCF suffices to limit promiscuous interactions between regulatory elements, but a lineage-specific chromatin assembly that supersedes these constraints is required to configure the genome to guide gene expression changes that drive faithful lineage progression. Loss-of-function approaches in B cell precursors show that IKAROS assembles interactions across megabase distances in preparation for lymphoid development. Interactions emanating from IKAROS-bound enhancers override CTCF-imposed boundaries to assemble lineage-specific regulatory units built on a backbone of smaller invariant topological domains. Gain of function in epithelial cells confirms IKAROS' ability to reconfigure chromatin architecture at multiple scales. Although the compaction of the Igκ locus required for genome editing represents a function of IKAROS unique to lymphocytes, the more general function to preconfigure the genome to support lineage-specific gene expression and suppress activation of extra-lineage genes provides a paradigm for lineage restriction.

Also flagged:Intramineral ProteinsCarbonateMembranesbiomineralizationcalcium phosphatesilica
Journal Article 2023-11-01 No Snippets Elejalde-Cadena NR, Hernández D, Capitelli F, Islas SR, Rosales-Hoz MJ, Zema M, Tarantino SC, Siliqi D, Moreno A.
Show Full Abstract

The lack of information on structural basis where proteins are involved, as well as the biomineralization processes of different systems such as bones, diatom frustules, and eggshells, have intrigued scientists from different fields for decades. This scientific curiosity has led to the use of methodologies that help understand the mechanism involved in the formation of these complex structures. Therefore, this work focuses on the use of eggshell membranes from different species of ratites (emu and ostrich) and reptiles (two species of crocodiles) as a model to differentiate biocalcification and biosilicification by introducing calcium phosphate or silica inside the membrane fiber mantles. We performed this to obtain information about the process of eggshell formation as well as the changes that occur in the membrane during crystal formation. In order to identify and understand the early processes leading to the formation of the microstructures present in the eggshell, we decided to carry out the synthesis of silica-carbonate of calcium, barium, and strontium called biomorph in the presence of intramineral proteins. This was carried out to evaluate the influence of these proteins on the formation of specific structures. We found that the proteins on untreated membranes, present a structural growth similar to those observed in the inner part of the eggshell, while in treated membranes, the structures formed present a high similarity with those observed in the outer and intermediate part of the eggshell. Finally, a topographic and molecular analysis of the biomorphs and membranes was performed by scanning electron microscopy (SEM), Raman and Fourier-transform Infrared (FTIR) spectroscopies.

DCC
Also flagged:anemiainfectionirondeathgestationhematological diseases
Journal Article 2023-11-01 ✓ 5 Snippets Zhang Y, Tao M, Wang S, Chen J, Hu Q, Luo S, Tang Z, Mu Y, Luo N, Wang Q, Wang M, Peng T.
In-Text Gene Mentions

Neonatal jaundice is the most common clinical problem during the neonatal period.[35] Premature infants are more prone to neonatal jaundice than term infants, with earlier, more severe, and longer jaundice.[36] Phototherapy is a simple and effective method to reduce unconjugated serum bilirubin, but phototherapy can also have some side effects, such as fever, diarrhea, rash, bronze baby syndrome, and DNA damage.[37,38] UCM and DCC allow preterm infants to receive more RBCs from the placental circulation, which may theoretically increase bilirubin levels and increase the incidence of neonatal jaundice and the duration of phototherapy.

…= .008), andDCCgroup ( P…

…= .006), andDCCgroup ( P…

…= .004), andDCCgroup ( P…

…= .001), andDCCgroup ( P…

Show Full Abstract

<h4>Introduction</h4>Both UCM and DCC are used to treat preterm infants, but there is no uniform standard for the length of UCM. The aim of this work was to explore the effectiveness and safety of different umbilical cord milking (UCM) lengths versus delayed cord clamping (DCC).<h4>Methods</h4>We enrolled premature infants from the Affiliated Hospital of Zunyi Medical University between September 2019 and October 2020 with random allocation (1:1:1:1) to the UCM 10 cm, UCM 20 cm, UCM 30 cm, and DCC groups. The primary outcome was hemoglobin at birth.<h4>Results</h4>Ultimately, 143 participants completed the trial (UCM 10 cm, n = 35; UCM 20 cm, n = 35; UCM 30 cm, n = 38; DCC, n = 35). The hemoglobin levels were significantly lower at birth in the UCM 10 cm group than in the UCM 20 and 30 cm and DCC groups (182.29 ± 22.15 vs 202.83 ± 21.46, 208.82 ± 20.72, and 198.46 ± 24.92, P = .001, .001, and .003, respectively). The systolic blood pressure and diastolic pressures in the UCM 30 cm group were higher than those in the UCM 10 and 20 cm and DCC groups at birth, postnatal day 3 and postnatal day 7 (P < .05). The occurrence rates of anemia were significantly higher in the UCM 10 cm group than in the UCM 20 and 30 cm and DCC groups (42.9% vs 14.3%, 10.5%, and 14.3%, all P < .0083). There were no significant differences in heart rate or complications among the 4 groups.<h4>Conclusions</h4>A UCM of 20 or 30 cm is a safe, effective operation for preterm infants and could improve blood pressure and hemoglobin levels and reduce anemia.

SERPINC1
Also flagged:Subchorionic hemorrhagehematomapathogenesisautoimmune dysfunctioncoagulationgestation
Journal Article 2023-11-01 ✓ 3 Snippets Xu T, Lun W, Wang P, He Y.
In-Text Gene Mentions

…S activity andantithrombin-IIIlevels, the increase…

…PS, PC, andAntiprothrombin-III(AT-III) were detected…

…nticardiolipin antibody AT-IIIantiprothrombin-IIIHCY homocysteine PC…

Show Full Abstract

Subchorionic hemorrhage (SCH) or hematoma is one of the abnormal ultrasonic manifestations. At present, there are few studies on the pathogenesis of SCH, and its underlying mechanism is still unclear. It may be related to abnormal placenta formation and implantation, autoimmune dysfunction, and coagulation dysfunction. As a unique complication of pregnancy, SCH has a controversial effect on pregnancy outcome. The aim of the present study was to explore the possible etiology of SCH, especially its association with autoimmune dysfunctions, as well as the pregnancy outcomes of SCH patients. This retrospective cohort study was conducted at the Third Affiliated Hospital of Zhengzhou University. Patients with a singleton pregnancy of ≤14 weeks gestation from June 2021 to June 2022 were included. Patients with SCH detected by ultrasound were selected as the study group, while patients without SCH during the same period were chosen as the control group. Immunological indicators and pregnancy outcomes were primarily compared between the 2 groups. The decrease in protein S activity and antithrombin-III levels, the increase in homocysteine levels, and the presence of autoantibodies (such as lupus anticoagulant, anticardiolipin antibody, and antinuclear antibody spectrum) were found to be risk factors for SCH. SCH in the first trimester was associated with higher rates of premature rupture of membranes (13.5% vs 3.8%) and miscarriage (14.4% vs 6.4%). However, there were no significant differences in the rates of placental abruption, fetal distress, cesarean section, neonatal birth weight, and gestational age. The incidence of miscarriage was also significantly higher in patients with subchorionic hematoma (SCH) who tested positive for autoantibodies (28.2% vs 7.6%). There were no significant differences in other clinical characteristics and pregnancy outcomes between patients with SCH who had positive autoantibodies and those who did not. The occurrence of SCH may be related to maternal immune abnormalities. SCH may increase the risk of premature rupture of membranes and abortion. However, there is no correlation between the presence or absence of SCH and neonatal outcomes.

Also flagged:Corticosteroid-Binding GlobulinSERPINA6CBGglucocorticoidsgrowth hormonesecretion
Journal Article 2023-11-01 No Snippets Toews JNC, Philippe TJ, Dordevic M, Hill LA, Hammond GL, Viau V.
Show Full Abstract

Produced by the liver, corticosteroid-binding globulin (CBG) regulates the plasma distribution and actions of glucocorticoids. A sex difference in pituitary growth hormone secretion patterns established during puberty in rats results in increased hepatic CBG production and 2-fold higher plasma corticosterone levels in females. Glucocorticoids control hepatic development and metabolic activities, and we have therefore examined how disrupting the SerpinA6 gene encoding CBG influences plasma corticosterone dynamics, as well as liver gene expression in male and female rats before and after puberty. Comparisons of corticosterone plasma clearance and hepatic uptake in adult rats, with or without CBG, indicated that CBG limits corticosterone clearance by reducing its hepatic uptake. Hepatic transcriptomic profiling revealed minor sex differences (207 differentially expressed genes) and minimal effect of CBG deficiency in 30-day-old rats before puberty. While liver transcriptomes in 60-day-old males lacking CBG remained essentially unchanged, 2710 genes were differentially expressed in wild-type female vs male livers at this age. Importantly, ∼10% of these genes lost their sexually dimorphic expression in adult females lacking CBG, including those related to cholesterol biosynthesis, inflammation, and lipid and amino acid catabolism. Another 203 genes were altered by the loss of CBG specifically in adult females, including those related to xenobiotic metabolism, circadian rhythm, and gluconeogenesis. Our findings reveal that CBG consolidates the sexual dimorphism of the rat liver initiated by sex differences in growth hormone secretion patterns and provide insight into how CBG deficiencies are linked to glucocorticoid-dependent diseases.

Also flagged:cancergastric cancerinfectiontumorGSTM1ACOT1
Journal Article 2023-11-01 No Snippets Yu Y.
Show Full Abstract

No abstract available.

DCC
Also flagged:KRASBRAFColorectal CancerMAPKMitogen-Activated Protein Kinasecancer
Journal Article 2023-11-01 ✓ 1 Snippet Hassani B, Alizadeh R, Akouchekian M, Safarnezhad Tameshkel F, Karbalaie Niya MH.
In-Text Gene Mentions

…in Colorectal Cancer (DCC) in 18q12.2, microsatellite…

Show Full Abstract

<h4>Background</h4>Mitogen-Activated Protein Kinase (MAPK) pathway and its downstream signaling pathways, play an important role in intracellular signaling. Mutations in KRAS (activating mutation) and BRAF proto-oncogenes are identified as key finding of colorectal cancer. The aim of this study was to examine mutation analysis of KRAS and BRAF in Iranian Colorectal cancer patients.<h4>Methods</h4>We used fifty archived formalin fixed paraffin-embedded (FFPE) blocks of Iranian colorectal cancer patients. DNA was extracted from FFPE blocks for PCR assay. The quality of PCR products was determined using horizontal electrophoresis. Then, sequencing and analysis of the sequencing results were performed to investigate variation status in the sequences.<h4>Results</h4>KRAS exons and BRAF genes exon 15 in 50 CRC patients were analyzed, among the 19 mutant KRAS samples, 18 (36%) patients had a single base substitution (synonymous mutation) in exon 5, p. Arg161Arg (c.483G>A) and 1 (2%) patient in exon 2 (codon 12), p. Gly12Cys (c.34G>T). Also, we observed two mutations p. Val600Glu (c.1799 T>A) and p. Ser616Thr (c.1846T>A) in exon 15 of BRAF gene.<h4>Conclusions</h4>We found a novel variant in BRAF gene. The p. Ser616Thr (c.1846T>A) mutation was not previously reported and we conclude that other new mutations can be identified in KRAS and BRAF which may lead to colorectal cancer.

Also flagged:hydroxyapatiteMethylene blueinfectionmineraltumorsmetals
Journal Article 2023-11-01 No Snippets Fontana CE, Dos Santos BA, Campos MC, de Lima SG, da Silva VC, Gonçalves AD, de Moura JD, Rocha DG, Pinheiro SL, Bueno CS.
Show Full Abstract

<h4>Background</h4>The success of endodontic treatment can be influenced by the type of endodontic sealer used, as certain sealers may be prone to apical microleakage, leading to treatment failure. The limitations of currently available sealers necessitate the development of new materials to improve the success rate of endodontic treatment. Therefore, the objective of this study was to assess the apical microleakage of newly developed hydroxyapatite-based endodontic sealers, including one derived from eggshells, and compare them with other commercially available sealers.<h4>Material and methods</h4>Eighty-five extracted human upper anterior teeth were selected for this study. The teeth were divided into 5 experimental groups and 2 control groups. The experimental groups were designated as follows: (1) HPSINT - obturated with gutta-percha cone and synthetic hydroxyapatite-based sealer, (2) BIOC - obturated with gutta-percha cone and Bio C-Sealer sealer, (3) AHPLUS-BC - obturated with gutta-percha cone and AHPLUS Bioceramic sealer, (4) AHP - obturated with gutta-percha cone and AHPLUS sealer, and (5) HPO - obturated with gutta-percha cone and sealer based on hydroxyapatite extracted from eggshells. Additionally, there were positive and negative control groups consisting of instrumented teeth filled with gutta-percha cones without any sealer and instrumented teeth without any filling, respectively. Methylene blue dye penetration was used to assess apical microleakage. Descriptive statistical analysis and Shapiro-Wilk normality test were applied to the observed results. As the samples followed a normal distribution, the ANOVA test was applied.<h4>Results</h4>The control groups confirmed the validity of the experimental method, while the experimental groups showed varying degrees of dye penetration. The group obturated with Bio C-Sealer exhibited the highest mean apical microleakage, while AHPLUS Bioceramic sealer demonstrated lower mean than AHPLUS sealer and sealer based on hydroxyapatite extracted from eggshells (<i>p</i><0.05). Finally, there was no difference between the synthetic hydroxyapatite-based sealer and AHPLUS Bioceramic sealer, AHPLUS sealer and sealer based on hydroxyapatite extracted from eggshells (<i>p</i>>0.05). No significant difference was observed between the hydroxyapatite-based sealers and the AHPLUS-BC sealer.<h4>Conclusions</h4>The results of this study suggest that the newly developed hydroxyapatite-based endodontic sealers, including the one derived from eggshells, may have a lower risk of apical microleakage compared to other commercially available sealers. These findings highlight the potential of hydroxyapatite-based sealers to improve the success rate of endodontic treatment. Further research and clinical studies are warranted to validate these results and explore the long-term effects of these novel sealers. <b>Key words:</b>Endodontic treatment, apical microleakage, endodontic sealer, hydroxyapatite, eggshell-derived sealer.

HTT
Also flagged:schizophrenianeurotransmitter receptorcaudatenucleusserotonin transporterCFH
Journal Article 2023-11-01 ✓ 3 Snippets He K, Hua Q, Li Q, Zhang Y, Yao X, Yang Y, Xu W, Sun J, Wang L, Wang A, Ji GJ, Wang K.
In-Text Gene Mentions

Density maps of the following molecules were selected based on known or hypothesized associations with schizophrenia pathology: dopamine receptors (D1R,27 D2R28), serotonin receptors (5-HT1AR,29 5-HT1BR,30 5-HT2AR,30 5-HT4R30), dopamine transporter (DAT),31 serotonin transporter (5-HTT),30 fluorodopa (F-DOPA; a reflection of presynaptic dopamine synthesis capacity),32 γ-aminobutyric acid type A receptor (GABAAR),31 norepinephrine transporter (NAT),33 vesicular acetylcholine transporter (VAChT)28 and metabotropic glutamate receptor (mGluR).28 Subsequently, density values were extracted from each PET atlas, and averaged within 360 regions based on the the HCP-MMP 1.0 atlas (https://cjneurolab.org/).34 We calculated the t values for CFH differences between the schizophrenia and control groups (independent sample t tests) and then extracted the t values and averaged them within 360 regions based on the HCP-MMP atlas.

Furthermore, changes in 5-HTT are associated with cognitive deficits in patients with schizophrenia.67 Associations of both serotonergic dysfunction and 5-HTT polymorphisms68 with schizophrenia pathophysiology have also been reported.66,69 Moreover, some newly developed antipsychotic medications preferentially target the serotonin system.70,71 The pathophysiology of schizophrenia and/or symptom expression may also involve altered cholinergic transmission.

However, it has long been appreciated that dopaminergic dysfunction alone cannot account for the full spectrum of psychopathology in schizophrenia.65,66 Consistent with contributions of serotonergic and cholinergic signalling dysfunctions in schizophrenia, we found significant positive correlations between the mean group difference in CFH and the densities of 5-HTT, GABAAR and VAChT.

Show Full Abstract

<h4>Background</h4>Interhemispheric cooperation is one of the most prominent functional architectures of the human brain. In patients with schizophrenia, interhemispheric cooperation deficits have been reported using increasingly powerful neurobehavioural and neuroimaging measures. However, these methods rely in part on the assumption of anatomic symmetry between hemispheres. In the present study, we explored interhemispheric cooperation deficits in schizophrenia using a newly developed index, connectivity between functionally homotopic voxels (CFH), which is unbiased by hemispheric asymmetry.<h4>Methods</h4>Patients with schizophrenia and age- and sexmatched healthy controls underwent multimodal MRI, and whole-brain CFH maps were constructed for comparison between groups. We examined the correlations of differing CFH values between the schizophrenia and control groups using various neurotransmitter receptor and transporter densities.<h4>Results</h4>We included 86 patients with schizophrenia and 86 matched controls in our analysis. Patients with schizophrenia showed significantly lower CFH values in the frontal lobes, left postcentral gyrus and right inferior temporal gyrus, and significantly greater CFH values in the right caudate nucleus than healthy controls. Moreover, the differing CFH values in patients with schizophrenia were significantly correlated with positive symptom score and illness duration. Functional connectivity within frontal lobes was significantly reduced at the voxel cluster level compared with healthy controls. Finally, the abnormal CFH map of patients with schizophrenia was spatially associated with the densities of the dopamine D<sub>1</sub> and D<sub>2</sub> receptors, fluorodopa, dopamine transporter, serotonin transporter and acetylcholine transporter.<h4>Conclusion</h4>Regional abnormalities in interhemispheric cooperation may contribute to the clinical symptoms of schizophrenia. These CFH abnormalities may be associated with dysfunction in neurotransmitter systems strongly implicated in schizophrenia.

Also flagged:bindingviral proteinTatpositive transcription elongation factor bP-TEFbCDK9
Journal Article 2023-11-01 No Snippets Liu H, Jian Y, Hou J, Zeng C, Zhao Y.
Show Full Abstract

Determining the RNA binding preferences remains challenging because of the bottleneck of the binding interactions accompanied by subtle RNA flexibility. Typically, designing RNA inhibitors involves screening thousands of potential candidates for binding. Accurate binding site information can increase the number of successful hits even with few candidates. There are two main issues regarding RNA binding preference: binding site prediction and binding dynamical behavior prediction. Here, we propose one interpretable network-based approach, RNet, to acquire precise binding site and binding dynamical behavior information. RNetsite employs a machine learning-based network decomposition algorithm to predict RNA binding sites by analyzing the local and global network properties. Our research focuses on large RNAs with 3D structures without considering smaller regulatory RNAs, which are too small and dynamic. Our study shows that RNetsite outperforms existing methods, achieving precision values as high as 0.701 on TE18 and 0.788 on RB9 tests. In addition, RNetsite demonstrates remarkable robustness regarding perturbations in RNA structures. We also developed RNetdyn, a distance-based dynamical graph algorithm, to characterize the interface dynamical behavior consequences upon inhibitor binding. The simulation testing of competitive inhibitors indicates that RNetdyn outperforms the traditional method by 30%. The benchmark testing results demonstrate that RNet is highly accurate and robust. Our interpretable network algorithms can assist in predicting RNA binding preferences and accelerating RNA inhibitor design, providing valuable insights to the RNA research community.

HFE
Also flagged:autoimmune hepatitisportal hypertensionliver fibrosisautoimmune hepatitischronic liver diseasechronic liver disease
Journal Article 2023-11-01 ✓ 1 Snippet Gomes NBN, Torres US, Silva GSE, Mamone POS, Ferraz MLCG, D'ippolito G.
In-Text Gene Mentions

…nts with concomitant diseases—hemochromatosis, primary biliary cholangitis,…

Show Full Abstract

<h4>Objective</h4>To determine the frequency and interobserver reproducibility of the magnetic resonance imaging (MRI) features considered diagnostic for autoimmune hepatitis.<h4>Materials and methods</h4>Two abdominal radiologists, blinded to pathology data, reviewed the MRI examinations of 20 patients with autoimmune hepatitis, looking for liver enhancement, lymphadenopathy, portal hypertension, and chronic liver disease. The pattern of liver fibrosis was categorized as reticular, confluent, or mixed. Interobserver agreement was assessed by calculating intraclass correlation coefficients and kappa statistics.<h4>Results</h4>The most common abnormal finding on MRI was surface nodularity (in 85%), followed by liver fibrosis with a reticular pattern (in 80%)-categorized as mild (in 25.0%), moderate (in 43.8%), or severe (in 31.2%)-; heterogeneous liver enhancement (in 65%); splenomegaly (in 60%); caudate lobe enlargement (in 50%); and lymphadenopathy (in 40%). The interobserver agreement was almost perfect for surface nodularity (0.83), ascites (0.89), and liver volume (0.95), whereas it was just slight and fair for the degree of fibrosis and for heterogeneous liver enhancement (0.12 and 0.25, respectively). It was also slight and fair for expanded gallbladder fossa and enlarged preportal space (0.14 and 0.36, respectively), both of which are indicative of chronic liver disease.<h4>Conclusion</h4>The interobserver agreement was satisfactory for surface nodularity (the most prevalent abnormal MRI finding), ascites, liver volume, and splenomegaly. Conversely, it was only slight or fair for common but less objective criteria.

RC3H1
Also flagged:Mucosa-associated lymphoid tissue protein-1paracaspasecaspase-like proteaseMALT1immunodeficiencycancers
Journal Article 2023-11-01 ✓ 1 Snippet Vérièpe-Salerno J, Podavini S, Long MJC, Kolotuev I, Cuendet M, Thome M.
In-Text Gene Mentions

…homolog of mammalianRoquin-1/2 [ 61 ]),…

Show Full Abstract

The caspase-like protease MALT1 promotes immune responses and oncogenesis in mammals by activating the transcription factor NF-κB. MALT1 is remarkably conserved from mammals to simple metazoans devoid of NF-κB homologs, like the nematode <i>C. elegans</i>. To discover more ancient, NF-κB -independent MALT1 functions, we analysed the phenotype of <i>C. elegans</i> upon silencing of MALT-1 expression systemically or in a tissue-specific manner. MALT-1 silencing in the intestine caused a significant increase in life span, whereas intestinal overexpression of MALT-1 shortened life expectancy. Interestingly, MALT-1-deficient animals showed higher constitutive levels of autophagy in the intestine, which were particularly evident in aged or starved nematodes. Silencing of the autophagy regulators ATG-13, BEC-1 or LGG-2, but not the TOR homolog LET-363, reversed lifespan extension caused by MALT-1 deficiency. These findings suggest that MALT-1 limits the lifespan of <i>C. elegans</i> by acting as an inhibitor of an early step of autophagy in the intestine.

Also flagged:NF2gene expressionschwannomasschwannomaTumortumors
Journal Article 2023-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Malignant peripheral nerve sheath tumorsplexiform neurofibromasneurofibromatosis type-1gene expressiontumorstumor
Journal Article 2023-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

POU3F2
Also flagged:glioblastomagene expressiongliomahistone methyltransferase EZH2transcription factorsoncogenes
Journal Article 2023-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…factors SOX2, OLIG2,POU3F2, and SALL2.…

Show Full Abstract

No abstract available.

Also flagged:GlioblastomaGBMtumorgene expressionphosphoproteinfibronectin
Journal Article 2023-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:lactationureafatty acidcholesterolglucosephenol
Journal Article 2023-11-01 No Snippets Monllor P, Zemzmi J, Muelas R, Roca A, Sendra E, Romero G, Díaz J.
Show Full Abstract

No abstract available.

HFE
Also flagged:NeuronAmyotrophic Lateral SclerosisALSneurodegenerative disorderdeathTAR DNA-binding protein 43
Journal Article 2023-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…homeostatic iron regulator (HFE) p.H63D polymorphism, a…

Show Full Abstract

No abstract available.

Also flagged:Esophageal Adenocarcinomaesophageal cancerchronic gastroesophageal reflux diseasetumormethylationchemokines
Journal Article 2023-11-01 No Snippets Li S, Hoefnagel S, Krishnadath K.
Show Full Abstract

No abstract available.

Also flagged:CarnosineZincCopperarthritic diseasesOsteoarthritisrheumatoid arthritis
Journal Article 2023-11-01 No Snippets Ciaffaglione V, Rizzarelli E.
Show Full Abstract

No abstract available.

Also flagged:dXNPATRXChromatinSNF2Alpha-Thalassemia with mental Retardation X-relatedgene expression
Journal Article 2023-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Extracellular VesiclesLung Infectionsdeathviralinfectionsinfection
Journal Article 2023-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

SERPINC1
Also flagged:KIFC1HSETAndrogen Receptor-Negative Breast CancersQuadruple-negative breast cancerAR
Journal Article 2023-11-01 ✓ 1 Snippet Jinna N, Yuan Y, Rida P.
In-Text Gene Mentions

Kinesin Family Member C1Family Member C1…

Show Full Abstract

No abstract available.

Also flagged:Heat IllnessMalignant Hyperthermiagene expressioninflammatory responsephosphorylationdeath
Journal Article 2023-11-01 No Snippets Chang L, Gardner L, House C, Daly C, Allsopp A, Roiz de Sa D, Shaw M, Hopkins P.
Show Full Abstract

No abstract available.

HFE
Also flagged:IronADneurodegenerative diseasetaumetabolism
Journal Article 2023-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…mouse models, includinghemochromatosis, high-iron diet-induced iron…

Show Full Abstract

No abstract available.

HTT
Also flagged:HDgenetic disorderautosomal dominant neurodegenerative disorderIT15interestingHuntingtin
Journal Article 2023-11-01 ✓ 4 Snippets Ahmad M, Ríos-Anillo M, Acosta-López J, Cervantes-Henríquez M, Martínez-Banfi M, Pineda-Alhucema W, Puentes-Rozo P, Sánchez-Barros C, Pinzón A, Patel H, Vélez J, Villarreal-Camacho J, Pineda D, Arcos-Burgos M, Sánchez-Rojas M.
In-Text Gene Mentions

…the huntingtin (HTT) gene.…

…transcript 15) (Huntingtin,HTT) gene, which…

…the huntingtin (HTT) gene, located…

…repeats in theHTTgene is 6…

Show Full Abstract

No abstract available.

Also flagged:Polycaprolactonehydroxyapatitetype I collagenchitosanossificationdegradation
Journal Article 2023-11-01 No Snippets Stafin K, Śliwa P, Piątkowski M.
Show Full Abstract

No abstract available.

OLFM4
Also flagged:Phospholipase AExperimental ColitisPhospholipase A 2PLA 2inflammatory bowel disease1B PLA 2
Journal Article 2023-11-01 ✓ 2 Snippets Haller A, Wolfkiel P, Jaeschke A, Hui D.
In-Text Gene Mentions

…which were rabbit anti-Olfm4(1:500 dilution; Cell…

…and olfactomedin 4 (Olfm4)-positive intestinal stem and…

Show Full Abstract

No abstract available.

Also flagged:COVID-19coronavirus disease 2019infectious diseasessevere acute respiratory syndromeMiddle East respiratory syndromeMERS
Journal Article 2023-11-01 No Snippets Terada M, Saito S, Kutsuna S, Kinoshita-Iwamoto N, Togano T, Hangaishi A, Shiratori K, Takamatsu Y, Maeda K, Ishizaka Y, Ohtsu H, Satake M, Mitsuya H, Ohmagari N.
Show Full Abstract

No abstract available.

HTT
Also flagged:Neurodegenerative DiseasesCalmodulin-Binding ProteinsADamyotrophic lateral sclerosisALSfrontotemporal lobar dementia
Journal Article 2023-11-01 ✓ 2 Snippets O’Day D.
In-Text Gene Mentions

…pTau); HD (huntingtin,HTT); PD (α-synuclein, αSyn).…

…of the biomarkersHTT, αSyn, and Tau,…

Show Full Abstract

No abstract available.

Also flagged:Insulationcarbonmineralfeldsparsaltsmetals
Journal Article 2023-11-01 No Snippets Zheng Y, Cui J, Gao P, Lv J, Chi L, Nan H, Huang Y, Yang F.
Show Full Abstract

No abstract available.

Also flagged:hereditary hemorrhagic telangiectasiadevelopmental vascular diseasearteriovenous malformationsangiogenesisHHTtelangiectasias
Journal Article 2023-11-01 No Snippets Ahmed H, Amos J, Gatchoff P, Garcia‐Ramiu J, Ortiz‐Garcia J.
Show Full Abstract

No abstract available.

Research Square 2023-11-01 Preprint (No Snippets API) Xu R, Zhao Y, Wang Y, An N, Wang B, Zhao M.
Show Full Abstract

<h4>Purpose: </h4> Nonsmall cell lung cancer (NSCLC) accounts for about 85% of lung cancer cases and is the leading cause of tumor-related death, of which Lung adenocarcinoma (LUAD) is the most prevalent histological subtype. At present, the prognosis of LUAD remains poor due to local recurrence and distant metastasis. This study aims to explore the key prognostic biomarkers and investigate the underlying mechanism. Methods GDC TCGA Lung adenocarcinoma (Data Release 18.0, July 8, 2019) was downloaded from the UCSC Xena browser. The dataset of GSE72094 and GSE13213 and the corresponding clinical information were downloaded from GEO database. By analyzing above datasets through DESeq2 R package and Limma R package, differentially expressed genes (DEGs) were found. GO and KEGG analysis were used to analyze the possible enrichment pathways of these DEGs. the protein-protein interaction network was constructed to explore the possible relationship among these DEGs using the STRING database. Survival analysis was performed to identify reliable prognostic genes using Kaplan-Meier method. Multi-omics analysis of the prognostic genes was performed using the GSCA. TIMER database was used to analyze the association of the prognostic genes with immune infiltration. Spearman correlation analysis was conducted to research the correlation between the prognostic genes and drug sensitivity. The multivariate Cox regression was used to identify the independent prognostic factor of LUAD. Finally, a nomogram was constructed using the rms R package . Results Firstly, we screened out 30 DEGs which may be associated with tumor progression. Functional enrichment analysis and PPI network were conducted to reveal the potential enrichment pathways and interactions of these DEGs. Secondly, survival analysis revealed that the expression of CENPL, DARS2 and PAICS was negatively correlated with prognosis of LUAD patients. Multi-omics analysis further disclosed that CENPL, DARS2 and PAICS expressions were significantly higher in LUAD. CENPL, DARS2 and PAICS were all high-expressed in the late groups and M1 stage of LUAD. The correlation analysis indicated that CENPL, DARS2 and PAICS may not be associated with activation or suppression of immune cells. Drug sensitivity analysis for CENPL, DARS2 and PAICS revealed many potentially effective drugs and small molecule compounds. Finally, we successfully constructed a robust and stable nomogram by combining the expression of DARS2 and PAICS with other clinicopathological variables. Conclusion CENPL, DARS2 and PAICS expressions were negatively correlated with LUAD prognosis. The prognostic model including DARS2 and PAICS with other clinicopathological variables could effectively predict prognosis.

Research Square 2023-11-01 Preprint (No Snippets API) Ochieng PJ, Dombi J, Kalmár T, Maróti Z, London A, Krész M.
Show Full Abstract

<title>Abstract</title> <p>Purpose: The identification of cancer-related genes with significant mutations is critical for deciphering the underlying mechanisms of tumor initiation and progression. Because of the infinite number of genes that are mutated at a low frequency, this is often a critical task in large-scale genomic analysis. To identify infrequently mutated genes, gene interaction networks have been combined with mutation data. Here, we introduce GBP-PR (Graph-Based Prioritization with PageRank), an efficient computational approach for prioritizing cancer-related genes. <h4>Methods:</h4> GBP-PR assigns a mutation score to each gene based on the type of mutation.Then the mutation neighbor influence of each gene received from their neighbors in the network is calculated via the asymmetric spreading strength computed from the consensus gene interaction network. To generate a set of the prioritized potential cancer genes, GBP-PR applies a PageRank algorithm with a gene-specific dynamic damping. <h4>Results:</h4> The experimental results with six types of cancer indicate the potential of GBP-PR to discover known and possible new significant cancer genes. Evaluation matrices with six types of cancer indicate that GBP-PR performs better when integrated with PageRank Algorithm compared with other rating algorithms (GBP-Keener, GBP-Colley, and GBP-Massey)</p>

medRxiv 2023-11-01 Preprint (No Snippets API) Lessard S, Chao M, Reis K, FinnGen, Estonian Biobank Research Team, Beauvais M, Rajpal DK, Shankara S, Sloane J, Palta P, Klinger K, de Rinaldis E, Khader S, Chatelain C.
Show Full Abstract

<h4>ABSTRACT</h4> BACKGROUND Therapeutic targets supported by genetic evidence from genome-wide association studies (GWAS) show higher probability of success in clinical trials. GWAS is a powerful approach to identify links between genetic variants and phenotypic variation; however, identifying the genes driving associations identified in GWAS remains challenging. Integration of molecular quantitative trait loci (molQTL) such as expression QTL (eQTL) using mendelian randomization (MR) and colocalization analyses can help with the identification of causal genes. Careful interpretation remains warranted because eQTL can affect the expression of multiple genes within the same locus. METHODS We used a combination of genomic features that include variant annotation, activity-by-contact maps, MR, and colocalization with molQTL to prioritize causal genes across 4,611 disease GWAS and meta-analyses from biobank studies, namely FinnGen, Estonian Biobank and UK Biobank. RESULTS Genes identified using this approach are enriched for gold standard causal genes and capture known biological links between disease genetics and biology. In addition, we find that eQTLs colocalizing with GWAS are statistically enriched for corresponding disease-relevant tissues. We show that predicted directionality from MR is generally consistent with matched drug mechanism of actions (>78% for approved drugs). Compared to the nearest gene mapping method our approach also shows a higher enrichment in approved therapeutic targets (risk ratio 1.38 vs 2.06). Finally, using this approach, we detected a novel association between the IL6 receptor signal transduction gene IL6ST and polymyalgia rheumatica, an indication for which sarilumab, a monoclonal antibody against IL-6, has been recently approved. CONCLUSIONS Combining variant annotation and activity-by-contact maps to molQTL increases performance to identify causal genes, while informing on directionality which can be translated to successful target identification and drug development.

bioRxiv 2023-11-01 Preprint (No Snippets API) Amossé Q, Tournier BB, Badina AM, Marchand-Maillet L, Abjean L, Lengacher S, Fancy N, Smith AM, Leung Y, Santer V, Garibotto V, Owen DR, Piguet C, Ceyzériat K, Tsartsalis S, Millet P.
Show Full Abstract

Multiple lines of evidence point to peripheral immune alterations in bipolar disorder (BD) although the activity of brain immune mechanisms remain largely unexplored. To identify the cell type-specific immune alterations in the BD brain, we performed a proteomic and single nuclear transcriptomic analysis of postmortem cingulate cortex samples from BD and control subjects. Our results showed that genes associated to the genetic risk for BD are enriched in microglia and astrocytes. Transcriptomic alterations in microglia point to a reduced proinflammatory phenotype, associated to reduced resistance to oxidative stress and apoptosis, which was confirmed with immunohistochemical quantification of IBA1 density. Astrocytes show transcriptomic evidence of an imbalance of multiple metabolic pathways, extracellular matrix composition and downregulated immune signalling. These alterations are associated to ADCY2 and NCAN, two GWAS genes upregulated in astrocytes. Finally, cell-cell communication analysis prioritized upregulated SPP1-CD44 signalling to astrocytes as a potential regulator of the transcriptomic alterations in BD. Our results indicate that microglia and astrocytes are characterized by downregulated immune responses associated to a dysfunction of core mechanisms via which these cells contribute to brain homeostasis.