Gene Literature Dashboard

Viewing August 2024 — 731 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← July 2024 September 2024 →
SOX6
Also flagged:cellular senescencecancersenescencecancersgene expressionmethylation
Journal Article 2024-08-31 ✓ 1 Snippet Qiu X, Guo R, Wang Y, Zheng S, Wang B, Gong Y.
In-Text Gene Mentions

SOX6suppresses cervical cell…

Show Full Abstract

Cellular senescence is widely acknowledged as having strong associations with cancer. However, the intricate relationships between cellular senescence-related (CSR) genes and cancer risk remain poorly explored, with insights on causality remaining elusive. In this study, Mendelian Randomization (MR) analyses were used to draw causal inferences from 866 CSR genes as exposures and summary statistics for 18 common cancers as outcomes. We focused on genetic variants affecting gene expression, DNA methylation, and protein expression quantitative trait loci (cis-eQTL, cis-mQTL, and cis-pQTL, respectively), which were strongly linked to CSR genes alterations. Variants were selected as instrumental variables (IVs) and analyzed for causality with cancer using both summary-data-based MR (SMR) and two-sample MR (TSMR) approaches. Bayesian colocalization was used to unravel potential regulatory mechanisms underpinning risk variants in cancer, and further validate the robustness of MR results. We identified five CSR genes (CNOT6, DNMT3B, MAP2K1, TBPL1, and SREBF1), 18 DNA methylation genes, and LAYN protein expression which were all causally associated with different cancer types. Beyond causality, a comprehensive analysis of gene function, pathways, and druggability values was also conducted. These findings provide a robust foundation for unravelling CSR genes molecular mechanisms and promoting clinical drug development for cancer.

POU3F2
Also flagged:prohibitin 2transcription factorsaxonsProhibitinsmitochondriamyelin
Journal Article 2024-08-31 ✓ 2 Snippets Wilson ER, Nunes GD, Shen S, Moore S, Gawron J, Maxwell J, Syed U, Hurley E, Lanka M, Qu J, Désaubry L, Wrabetz L, Poitelon Y, Feltri ML.
In-Text Gene Mentions

…POU3F1 (OCT6), andPOU3F2(BRN2), necessary for…

POU3F2

Show Full Abstract

Schwann cells are critical for the proper development and function of the peripheral nervous system (PNS), where they form a collaborative relationship with axons. Past studies highlighted that a pair of proteins called the prohibitins play major roles in Schwann cell biology. Prohibitins are ubiquitously expressed and versatile proteins. We have previously shown that while prohibitins play a crucial role in Schwann cell mitochondria for long-term myelin maintenance and axon health, they may also be present at the Schwann cell-axon interface during development. Here, we expand on this, showing that drug-mediated modulation of prohibitins in vitro disrupts myelination and confirming that Schwann cell-specific ablation of prohibitin 2 (Phb2) in vivo results in severe defects in radial sorting and myelination. We show in vivo that Phb2-null Schwann cells cannot effectively proliferate and the transcription factors EGR2 (KROX20), POU3F1 (OCT6), and POU3F2 (BRN2), necessary for proper Schwann cell maturation, are dysregulated. Schwann cell-specific deletion of Jun, a transcription factor associated with negative regulation of myelination, confers partial rescue of the developmental defect seen in mice lacking Schwann cell Phb2. Finally, we identify a pool of candidate PHB2 interactors that change their interaction with PHB2 depending on neuronal signals, and thus are potential mediators of PHB2-associated developmental defects. This work develops our understanding of Schwann cell biology, revealing that Phb2 may modulate the timely expression of transcription factors necessary for proper PNS development, and proposing candidates that may play a role in PHB2-mediated integration of axon signals in the Schwann cell.

Also flagged:lysinegene expressionmetabolismcell cycleagingneurological diseases
Journal Article 2024-08-31 No Snippets Fiorentino F, Fabbrizi E, Mai A, Rotili D.
Show Full Abstract

The sirtuin family comprises seven NAD<sup>+</sup>-dependent enzymes which catalyze protein lysine deacylation and mono ADP-ribosylation. Sirtuins act as central regulators of genomic stability and gene expression and control key processes, including energetic metabolism, cell cycle, differentiation, apoptosis, and aging. As a result, all sirtuins play critical roles in cellular homeostasis and organism wellness, and their dysregulation has been linked to metabolic, cardiovascular, and neurological diseases. Furthermore, sirtuins have shown dichotomous roles in cancer, acting as context-dependent tumor suppressors or promoters. Given their central role in different cellular processes, sirtuins have attracted increasing research interest aimed at developing both activators and inhibitors. Indeed, sirtuin modulation may have therapeutic effects in many age-related diseases, including diabetes, cardiovascular and neurodegenerative disorders, and cancer. Moreover, isoform selective modulators may increase our knowledge of sirtuin biology and aid to develop better therapies. Through this review, we provide critical insights into sirtuin pharmacology and illustrate their enzymatic activities and biological functions. Furthermore, we outline the most relevant sirtuin modulators in terms of their modes of action, structure-activity relationships, pharmacological effects, and clinical applications.

TNFSF4
Also flagged:lung cancerlung malignancycancerdeathlunglung adenocarcinomas
Journal Article 2024-08-31 ✓ 2 Snippets Xin M, Peng H, Zhang L.
In-Text Gene Mentions

…BTNL2, C10orf54, CD200R1,TNFSF4, CD200, and NRP1.…

…including CD200, CD276,TNFSF4, and TNFRSF4, and…

Show Full Abstract

<h4>Backgrounds</h4>Homeobox C6 (HOXC6) is a gene that encodes for a transcription factor involved in various cellular processes, including development and differentiation, and regulates cancer progression. However, the carcinogenesis and effect of HOXC6 in lung adenocarcinoma (LUAD) still need further investigation.<h4>Methods</h4>The differential HOXC6 expression levels at the mRNA and protein level were explored in multiple public datasets, including The Cancer Genome Atlas (TCGA) and Human Protein Atlas (HPA) dataset. Gene Expression Omnibus (GSE31210), International Cancer Genome Consortium (ICGC) datasets and the LUAD sample from Affiliated Hospital of Guangxi Medical University. We also investigated the relation between HOXC6 expression and clinicopathologic indexes. Furthermore, the correlation of immune infiltration, drug responsiveness and HOXC6 were explored.<h4>Results</h4>The upregulated HOXC6 expressions at mRNA and protein levels were found in LUAD tissues compared to the normal lung tissues. Besides, the relatively shorter overall survival time, worse T and N stages, and lower immune scores were found in the high-expression HOXC6 subgroup. Notably, T cells regulatory (Tregs), Macrophages M0, and Plasma cells had the higher infiltration levels in the high-HOXC6 expression subgroup, while NK cells activated, Monocytes, Dendritic cells resting, and Mast cells resting had the lower infiltration levels. In drug sensitivity analysis, we revealed that LUAD patients with high-HOXC6 expression may be more susceptible to Camptothecin, Cytarabine, Docetaxel, Elesclomol, Rapamycin, Sorafinib, Temsirolimus, and Vorinostat.<h4>Conclusions</h4>Taken together, there is a great potential for HOXC6 to become a prognosis biomarker and contribute to develop treatment strategies for LUAD patients. Further mechanism exploration and drug development for HOXC6 are needed.

SERPINC1
Also flagged:membranemetabolismHeparansulfateFGFRHs3st3b1
Journal Article 2024-08-31 ✓ 1 Snippet Patel VN, Aure MH, Choi SH, Ball JR, Lane ED, Wang Z, Xu Y, Zheng C, Liu X, Martin D, Pailin JY, Prochazkova M, Kulkarni AB, van Kuppevelt TH, Ambudkar IS, Liu J, Hoffman MP.
In-Text Gene Mentions

…HS domains includesantithrombin-III, glycoprotein D of…

Show Full Abstract

Heparan sulfate (HS) regulation of FGFR function, which is essential for salivary gland (SG) development, is determined by the immense structural diversity of sulfated HS domains. 3-O-sulfotransferases generate highly 3-O-sulfated HS domains (3-O-HS), and Hs3st3a1 and Hs3st3b1 are enriched in myoepithelial cells (MECs) that produce basement membrane (BM) and are a growth factor signaling hub. Hs3st3a1;Hs3st3b1 double-knockout (DKO) mice generated to investigate 3-O-HS regulation of MEC function and growth factor signaling show loss of specific highly 3-O-HS and increased FGF/FGFR complex binding to HS. During development, this increases FGFR-, BM- and MEC-related gene expression, while in adult, it reduces MECs, increases BM and disrupts acinar polarity, resulting in salivary hypofunction. Defined 3-O-HS added to FGFR pulldown assays and primary organ cultures modulates FGFR signaling to regulate MEC BM synthesis, which is critical for secretory unit homeostasis and acinar function. Understanding how sulfated HS regulates development will inform the use of HS mimetics in organ regeneration.

HFE
Also flagged:poreporeswatercell growthbenzeneethylbenzene
Journal Article 2024-08-31 ✓ 2 Snippets Batsch M, Guex I, Todorov H, Heiman CM, Vacheron J, Vorholt JA, Keel C, van der Meer JR.
In-Text Gene Mentions

…First, the extraHFE oilthat settled below the droplet emulsion was removed by pipetting.…

…To the remaining PBS and droplet emulsion layer, an approximate equivalent volume was added ofHFE oilcontaining 1H,1H,2H2H-perfluoro-1-octanol (5 g solution Sigma-Aldrich, further diluted 4 times in HFE 7500 oil).…

Show Full Abstract

Bacteria in nature often thrive in fragmented environments, like soil pores, plant roots or plant leaves, leading to smaller isolated habitats, shared with fewer species. This spatial fragmentation can significantly influence bacterial interactions, affecting overall community diversity. To investigate this, we contrast paired bacterial growth in tiny picoliter droplets (1-3 cells per 35 pL up to 3-8 cells per species in 268 pL) with larger, uniform liquid cultures (about 2 million cells per 140 µl). We test four interaction scenarios using different bacterial strains: substrate competition, substrate independence, growth inhibition, and cell killing. In fragmented environments, interaction outcomes are more variable and sometimes even reverse compared to larger uniform cultures. Both experiments and simulations show that these differences stem mostly from variation in initial cell population growth phenotypes and their sizes. These effects are most significant with the smallest starting cell populations and lessen as population size increases. Simulations suggest that slower-growing species might survive competition by increasing growth variability. Our findings reveal how microhabitat fragmentation promotes diverse bacterial interaction outcomes, contributing to greater species diversity under competitive conditions.

SOX6
Also flagged:myelinNPaxonalmyelinationchemokine ligandCADM1
Journal Article 2024-08-31 ✓ 2 Snippets Li D, Yang K, Li J, Xu X, Gong L, Yue S, Wei H, Yue Z, Wu Y, Yin S.
In-Text Gene Mentions

…, Rgs7 ,Sox6, Slc1a1 ,…

…the expression ofSox6was increased.…

Show Full Abstract

<h4>Background</h4>Neuropathic pain (NP), which results from injury or lesion of the somatosensory nervous system, is intimately associated with glial cells. The roles of microglia and astrocytes in NP have been broadly described, while studies on oligodendrocytes have largely focused on axonal myelination. The mechanisms of oligodendrocytes and their interactions with other glial cells in NP development remain uncertain.<h4>Methods</h4>To explore the function of the interaction of the three glial cells and their interactions on myelin development in NP, we evaluated changes in NP and myelin morphology after a chronic constriction injury (CCI) model in mice, and used single-cell sequencing to reveal the subpopulations characteristics of oligodendrocytes, microglia, and astrocytes in the spinal cord tissues, as well as their relationship with myelin lesions; the proliferation and differentiation trajectories of oligodendrocyte subpopulations were also revealed using pseudotime cell trajectory and RNA velocity analysis. In addition, we identified chemokine ligand-receptor pairs between glial cells by cellular communication and verified them using immunofluorescence.<h4>Results</h4>Our study showed that NP peaked on day 7 after CCI in mice, a time at which myelin lesions were present in both the spinal cord and sciatic nerve. Oligodendrocytes, microglia, and astrocytes subpopulations in spinal cord tissue were heterogeneous after CCI and all were involved in suppressing the process of immune defense and myelin production. In addition, the differentiation trajectory of oligodendrocytes involved a unidirectional lattice process of OPC-1-Oligo-9, which was arrested at the Oligo-2 stage under the influence of microglia and astrocytes. And the CADM1-CADM1, NRP1-VEGFA interactions between glial cells are enhanced after CCI and they had a key role in myelin lesions and demyelination.<h4>Conclusions</h4>Our study reveals the close relationship between the differentiation block of oligodendrocytes after CCI and their interaction with microglia and astrocytes-mediated myelin lesions and NP. CADM1/CADM1 and NRP-1/VEGFA may serve as potential therapeutic targets for use in the treatment of NP.

DCC
Also flagged:gene expressionlipidadaptive immunityaxonalmultiple sclerosisvascular endothelial growth factor C
Journal Article 2024-08-31 ✓ 1 Snippet das Neves SP, Delivanoglou N, Ren Y, Cucuzza CS, Makuch M, Almeida F, Sanchez G, Barber MJ, Rego S, Schrader R, Faroqi AH, Thomas JL, McLean PJ, Oliveira TG, Irani SR, Piehl F, Da Mesquita S.
In-Text Gene Mentions

Dcc

Show Full Abstract

The precise neurophysiological changes prompted by meningeal lymphatic dysfunction remain unclear. Here, we showed that inducing meningeal lymphatic vessel ablation in adult mice led to gene expression changes in glial cells, followed by reductions in mature oligodendrocyte numbers and specific lipid species in the brain. These phenomena were accompanied by altered meningeal adaptive immunity and brain myeloid cell activation. During brain remyelination, meningeal lymphatic dysfunction provoked a state of immunosuppression that contributed to delayed spontaneous oligodendrocyte replenishment and axonal loss. The deficiencies in mature oligodendrocytes and neuroinflammation due to impaired meningeal lymphatic function were solely recapitulated in immunocompetent mice. Patients diagnosed with multiple sclerosis presented reduced vascular endothelial growth factor C in the cerebrospinal fluid, particularly shortly after clinical relapses, possibly indicative of poor meningeal lymphatic function. These data demonstrate that meningeal lymphatics regulate oligodendrocyte function and brain myelination, which might have implications for human demyelinating diseases.

OLFM4
Also flagged:Benign prostatic hyperplasiacapsulefinasterideBMP5CXCL13androgen
Journal Article 2024-08-31 ✓ 1 Snippet Polasko AL, Zhang D, Ramraj A, Chiu CL, Garcia-Marques FJ, Bermudez A, Kapp K, Peterson E, Qiu Z, Pollack AS, Zhao H, Pollack JR, Pitteri SJ, Brooks JD.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Benign prostatic hyperplasia (BPH) is a common condition marked by the enlargement of the prostate gland, which often leads to significant urinary symptoms and a decreased quality of life. The development of clinically relevant animal models is crucial for understanding the pathophysiology of BPH and improving treatment options. This study aims to establish a patient-derived xenograft (PDX) model using benign prostatic tissues to explore the molecular and cellular mechanisms of BPH. PDXs were generated by implanting fresh BPH (transition zone) and paired normal (peripheral zone) prostate tissue from 8 patients under the renal capsule of immunodeficient male mice. Tissue weight, architecture, cellular proliferation, apoptosis, prostate-specific marker expression, and molecular profiles of PDXs were assessed after 1 week and 1, 2, or 3 months of implantation by immunohistochemistry, enzyme-linked immunosorbent assay, transcriptomics, and proteomics. Responses to finasteride, a standard-of-care therapy, were evaluated. PDXs maintained histologic and molecular characteristics of the parental human tissues. BPH, but not normal PDXs, demonstrated significant increases in weight and cellular proliferation, particularly at 1 month. Molecular profiling revealed specific gene and protein expression patterns correlating with BPH pathophysiology. Specifically, an increased immune and stress response was observed at 1 week, followed by increased expression of proliferation markers and BPH-specific stromal signaling molecules, such as BMP5 and CXCL13, at 1 month. Graft stabilization to preimplant characteristics was apparent between 2 and 3 months. Treatment with finasteride reduced proliferation, increased apoptosis, and induced morphologic changes consistent with therapeutic responses observed in human BPH. Our PDX model recapitulates the morphologic, histologic, and molecular features of human BPH, offering a significant advancement in modeling the complex interactions of cell types in BPH microenvironments. These PDXs respond to therapeutic intervention as expected, providing a valuable tool for preclinical testing of new therapeutics that will improve the well-being of BPH patients.

HFE
Also flagged:hepatocellular carcinomamethylationtumorperoxisomefocal adhesionmTOR
Journal Article 2024-08-31 ✓ 1 Snippet Akbulut S, Kucukakcali Z, Sahin TT, Colak C, Yilmaz S.
In-Text Gene Mentions

…in patients withhemochromatosis, and it is…

Show Full Abstract

<h4>Background</h4>The current study's objective is to evaluate the molecular genetic mechanisms influencing the biological behavior of hepatocellular carcinoma (HCC) by analyzing the transcriptomic and epigenetic signatures of the tumors.<h4>Methods</h4>Transcriptomic data were downloaded from the NCBI GEO database. We investigated the expression differences between the GSE46444 (48 cirrhotic tissues versus 88 HCC tissues) and GSE63898 (168 cirrhotic tissues versus 228 HCC tissues) data sets using GEO2R. Differentially expressed genes were evaluated using GO and KEGG metabolic pathway analysis websites. Whole genome bisulfite sequencing (WGBS) and Methylated DNA Immunoprecipitation Sequencing (MeDIP-Seq) data sets (26 HCC tissues versus 26 adjacent non-tumoral tissues) were also downloaded from the NCBI SRA database. These data sets were analyzed using Bismark and QSEA, respectively. The methylation differences between the groups were assessed using functional enrichment analysis.<h4>Results</h4>In the GSE46444 data set, 80 genes were upregulated, and 315 genes were downregulated in the tumor tissue (HCC tissue) compared to the non-tumor cirrhotic tissue. In the GSE63898 data set, 1261 genes were upregulated, and 458 genes were downregulated in the cirrhotic tissue compared to the tumor tissues. WGBS revealed that 20 protein-coding loci were hypermethylated. while the hypomethylated regions were non-protein-coding. The methylated residues of the tumor tissue, non-tumorous cirrhotic tissue, and healthy tissue were comparable. MeDIP-Seq, conducted on tumoral and non-tumoral tissues, identified hypermethylated or hypomethylated areas as protein-coding regions. The functional enrichment analysis indicated that these genes were related to pathways including peroxisome, focal adhesion, mTOR, RAP1, Phospholipase D, Ras, and PI3K/AKT signal transduction.<h4>Conclusions</h4>The investigation of transcriptomic and epigenetic mechanisms identified several genes significant in the biological behavior of HCC. These genes present potential targets for the development of targeted therapy.

Also flagged:Epidermolysis Bullosamechanobullousmembraneskeratin (K) 5cytoskeletonSkin lesions
Journal Article 2024-08-31 No Snippets Bchetnia M, Powell J, McCuaig C, Boucher-Lafleur AM, Morin C, Dupéré A, Laprise C.
Show Full Abstract

Epidermolysis bullosa (EB) is a clinically and genetically heterogeneous group of mechanobullous diseases characterized by non-scarring blisters and erosions on the skin and mucous membranes upon mechanical trauma. The simplex form (EBS) is characterized by recurrent blister formation within the basal layer of the epidermis. It most often results from dominant mutations in the genes coding for keratin (K) 5 or 14 proteins (<i>KRT5</i> and <i>KRT14</i>). A disruptive mutation in <i>KRT5</i> or <i>KRT14</i> will not only structurally impair the cytoskeleton, but it will also activate a cascade of biochemical mechanisms contributing to EBS. Skin lesions are painful and disfiguring and have a significant impact on life quality. Several gene expression studies were accomplished on mouse model and human keratinocytes to define the gene expression signature of EBS. Several key genes associated with EBS were identified as specific immunological mediators, keratins, and cell junction components. These data deepened the understanding of the EBS pathophysiology and revealed important functional biological processes, particularly inflammation. This review emphasizes the three EBS subtypes caused by dominant mutations on either <i>KRT5</i> or <i>KRT14</i> (localized, intermediate, and severe). It aims to summarize current knowledge about the EBS expression profiling pattern and predicted molecular mechanisms involved and to outline progress in therapy.

Also flagged:Maternal ObesityCell Migrationembryogenesishepatocyte growth factorfibroblast growth factorWnt
Journal Article 2024-08-31 No Snippets Gao Y, Hossain MN, Zhao L, Deavila JM, Law NC, Zhu MJ, Murdoch GK, Du M.
Show Full Abstract

Limb muscle is responsible for physical activities and myogenic cell migration during embryogenesis is indispensable for limb muscle formation. Maternal obesity (MO) impairs prenatal skeletal muscle development, but the effects of MO on myogenic cell migration remain to be examined. C57BL/6 mice embryos were collected at E13.5. The GeoMx DSP platform was used to customize five regions along myogenic cell migration routes (myotome, dorsal/ventral limb, limb stroma, limb tip), and data were analyzed by GeomxTools 3.6.0. A total of 2224 genes were down-regulated in the MO group. The GO enrichment analysis showed that MO inhibited migration-related biological processes. The signaling pathways guiding myogenic migration such as hepatocyte growth factor signaling, fibroblast growth factor signaling, Wnt signaling and GTPase signaling were down-regulated in the MO E13.5 limb tip. Correspondingly, the expression levels of genes involved in myogenic cell migration, such as <i>Pax3</i>, <i>Gab1</i>, <i>Pxn</i>, <i>Tln2</i> and <i>Arpc</i>, were decreased in the MO group, especially in the dorsal and ventral sides of the limb. Additionally, myogenic differentiation-related genes were down-regulated in the MO limb. MO impedes myogenic cell migration and differentiation in the embryonic limb, providing an explanation for the impairment of fetal muscle development and offspring muscle function due to MO.

Also flagged:vitamin Avitamin Evitamin Kvitamin Cseleniumfolic acid
Journal Article 2024-08-31 No Snippets Dewi WK, Aji BSP, Fikri F, Purnomo A, Maslamama ST, Çalışkan H, Purnama MTE.
Show Full Abstract

<h4>Background</h4>Due to their efficient insulation, lack of sweat glands, relatively quick metabolic rate, and heightened sensitivity to heat, the poultry industry faces a serious problem with heat stress. Combining vitamins has been demonstrated to be more effective than implementing a single vitamin in reducing the effects of heat stress.<h4>Aim</h4>This study aimed to investigate the efficacy of the multivitamin combination in feed on the growth performance, egg quality, and antioxidant enzymes in laying hens exposed to heat stress.<h4>Methods</h4>A total of 28 Isa Brown strains aged 18 weeks were randomly designated into seven groups with four replications, i.e., (C-) normal temperature group, (C+) heat stress group, and the others with the administration of vitamin A and E (AE), vitamin K and C (KC), vitamin C and E (CE), vitamin E and selenium (ESE), and vitamin C and folic acid (CAF). Feed intake, feed efficiency, eggshell thickness, shape index, haugh unit (HU), yolk, and albumen index were evaluated at 22, 23, 24, and 25 weeks. Meanwhile, antioxidant enzymes were quantified at 22 and 25 weeks.<h4>Results</h4>As a result, feed intake was reported a significant improvement in the AE and CE groups compared to the C+ group. Meanwhile, the feed efficiency was reported to be efficient in the CE and ESE groups. Based on egg quality evaluation, we reported significant shell thickness in the CE, ESE, and CAF groups compared to the C+; yolk index was reported slightly significant results in the AE and CAF groups; albumen index and HU were reported to increase significantly in the CAF group. Meanwhile, superoxide dismutase (SOD), malondialdehyde (MDA), and GPx activity were ameliorated significantly in the ESE and CAF groups.<h4>Conclusion</h4>Combinations of multivitamins can thereby enhance feed intake, feed efficiency, egg quality, and antioxidant activity. The CE, ESE, and CAF groups were found to have made equivalent improvements in the eggshell thickness, shape index, HU, yolk, and albumen index.

HFE
Also flagged:Hemolytic Anemiachronic hemolytic anemiaPK deficiencyanemiagallstonesiron
Journal Article 2024-08-31 ✓ 1 Snippet Tama-Shekan S, Moreno V, Saba L, Chaulagain CP.
In-Text Gene Mentions

…complicated by secondaryhemochromatosiswith cirrhosis of…

Show Full Abstract

<h4>Background</h4>Pyruvate kinase (PK) deficiency is an inherited red blood cell (RBC) enzyme disorder that results in non-immune chronic hemolytic anemia. Characteristic symptoms of PK deficiency include anemia, fatigue, splenomegaly, jaundice, gallstones, thrombosis, and transfusional iron overload. Previously, treatments aimed at symptomatic management with RBC transfusions, phototherapy, folic acid supplementation, splenectomy, and iron chelation therapy when iron overload was documented. Mitapivat, a recently approved medication for treatment of PK-deficiency hemolytic anemia, is an oral allosteric activator of wild-type and mutant RBC PK enzymes. In this paper, we describe three cases of PK-deficiency anemia treated with mitapivat and describe modern management of this rare hemolytic disorder.<h4>Methods</h4>A retrospective healthcare database analysis was conducted to extract relevant information. Both quantitative and qualitative methods were integrated to provide a more comprehensive understanding of the cases.<h4>Results</h4>Two patients responded well to treatment with mitapivat, noted by an increase in hemoglobin levels, improvements in hemolytic markers, less frequent or no RBC transfusion requirements, and improvements in fatigue. One patient carrying two non-missense mutations of the <i>PKLR</i> gene did not respond to treatment with mitapivat. As variations in patient-specific factors (including genotype) can lead to different clinical manifestations and responses to treatment, we recommend considering both the phenotype (clinical symptoms and signs) and the genotype of the <i>PKLR</i> gene when making therapeutic decisions about starting a patient on mitapivat.<h4>Conclusions</h4>While mitapivat addresses the previously unmet needs of most patients with PK deficiency as the first and only disease-modifying medication to receive approval for this condition, not all patients with PK deficiency are amenable to treatment with mitapivat.

SOX6
Also flagged:cancerscancerdeathproto-oncogenestumorexonucleases
Journal Article 2024-08-31 ✓ 1 Snippet Shahpari M, Hashemi M, Younesirad T, Hasanzadeh A, Mosanne MM, Ahmadifard M.
In-Text Gene Mentions

…The circ_PTN/miR-122/SOX6axis is considered…

Show Full Abstract

Circular RNAs are noncoding RNAs with circular conformation mainly due to backsplicing event. CircRNAs can potentially impact cell biological processes by interacting with cell signaling pathways. Numerous circRNAs have been found to be aberrantly expressed in a variety of cancers. These RNAs can act as ceRNA (competitive endogenous RNA) by sponging certain miRNAs to form circRNA/miRNA/mRNA networks. Dysregulation of ceRNA networks may lead to dysfunctions in various cell pathways, which modulate apoptosis-associated genes and ultimately result in cancer progression. Since disruption of apoptosis is one of the leading causes of cancer development, one approach for cancer treatment is to drive cells toward apoptosis. In this review, we present a summary of studies on the role of ceRNA networks in cellular signaling pathways that regulate apoptosis; these networks are suggested to be potential biomarkers for cancer treatment.

Also flagged:autophagy receptorsselective autophagy receptorsviral infectionsautophagypathogenesisMacroautophagy
Journal Article 2024-08-30 No Snippets Luo R, Wang T, Lan J, Lu Z, Chen S, Sun Y, Qiu H-J.
Show Full Abstract

Selective autophagy is a protein clearance mechanism mediated by evolutionarily conserved selective autophagy receptors (SARs), which specifically degrades misfolded, misassembled, or metabolically regulated proteins. SARs help the host to suppress viral infections by degrading viral proteins. However, viruses have evolved sophisticated mechanisms to counteract, evade, or co-opt autophagic processes, thereby facilitating viral replication. Therefore, this review aims to summarize the complex mechanisms of SARs involved in viral infections, specifically focusing on how viruses exploit strategies to regulate selective autophagy. We present an updated understanding of the various critical roles of SARs in viral pathogenesis. Furthermore, newly discovered evasion strategies employed by viruses are discussed and the ubiquitination-autophagy-innate immune regulatory axis is proposed to be a crucial pathway to control viral infections. This review highlights the remarkable flexibility and plasticity of SARs in viral infections.

HTT
Also flagged:autosomal dominant inherited diseaseHuntingtinbehavioralHDapathydepression
Journal Article 2024-08-30 ✓ 1 Snippet Mühlbäck A, Hoffmann R, Pozzi NG, Marziniak M, Brieger P, Dose M, Priller J.
In-Text Gene Mentions

…tingtin-Gens Huntingtin-Gens (HTT) zugrunde, die…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant inherited disease, which leads to motor, cognitive and psychiatric symptoms. The diagnosis can be confirmed by genetic testing for extended CAG repeats in the Huntingtin gene. Mental and behavioral symptoms are common in HD and can appear several years before the onset of motor symptoms. The psychiatric symptoms include apathy, depression, anxiety, obsessive-compulsive symptoms and, in some cases, psychoses and aggression. These are currently restricted to symptomatic treatment as disease-modifying treatment approaches are still under investigation. The current clinical practice is based on expert opinions as well as experience with the treatment of similar symptoms in other neurological and mental health diseases. This article provides an overview of the complex psychiatric manifestations of HD, the diagnostic options and the established pharmacological and nonpharmacological treatment approaches.

DCC
Also flagged:KRASnon-small cell lung cancerNSCLCULK1sotorasibtumor
Journal Article 2024-08-30 ✓ 1 Snippet Ghazi PC, O'Toole KT, Srinivas Boggaram S, Scherzer MT, Silvis MR, Zhang Y, Bogdan M, Smith BD, Lozano G, Flynn DL, Snyder EL, Kinsey CG, McMahon M.
In-Text Gene Mentions

…we noted thatDCC-3116 had substantial single-a…

Show Full Abstract

Mutational activation of <i>KRAS</i> occurs commonly in lung carcinogenesis and, with the recent U.S. Food and Drug Administration approval of covalent inhibitors of KRAS<sup>G12C</sup> such as sotorasib or adagrasib, KRAS oncoproteins are important pharmacological targets in non-small cell lung cancer (NSCLC). However, not all KRAS<sup>G12C</sup>-driven NSCLCs respond to these inhibitors, and the emergence of drug resistance in those patients who do respond can be rapid and pleiotropic. Hence, based on a backbone of covalent inhibition of KRAS<sup>G12C</sup>, efforts are underway to develop effective combination therapies. Here, we report that the inhibition of KRAS<sup>G12C</sup> signaling increases autophagy in KRAS<sup>G12C</sup>-expressing lung cancer cells. Moreover, the combination of DCC-3116, a selective ULK1/2 inhibitor, plus sotorasib displays cooperative/synergistic suppression of human KRAS<sup>G12C</sup>-driven lung cancer cell proliferation in vitro and superior tumor control in vivo. Additionally, in genetically engineered mouse models of KRAS<sup>G12C</sup>-driven NSCLC, inhibition of either KRAS<sup>G12C</sup> or ULK1/2 decreases tumor burden and increases mouse survival. Consequently, these data suggest that ULK1/2-mediated autophagy is a pharmacologically actionable cytoprotective stress response to inhibition of KRAS<sup>G12C</sup> in lung cancer.

Also flagged:Lat
Journal Article 2024-08-30 No Snippets Sevilmiş E, Atalag O, Baytaş E, Henselmans M, Balyan M, Binboğa E.
Show Full Abstract

Understanding muscle activation during exercises is crucial for devising effective training programs. We examined correlations between self-reported and electromyographic (EMG) muscle activity during upper-body exercises performed at loads corresponding to 4-6 repetition maximums (RMs). Thirteen male sub-elite soccer players who had previously engaged in resistance training participated in two testing sessions. In the initial session, the loads corresponding to 4-6 repetitions were determined for six exercises: Lat Pull Down (LPD), Barbell Bent Over Row (BBOR), Dumbbell Row (DR), Barbell Pull Over (BPO), Dumbbell Reverse Fly (DRF), and Dumbbell Concentration Curl (DCC). At post-exercise, participants rated their perceived muscle activation for three targeted muscles in each exercise on a 1-10 point Likert scale (LS). In the subsequent session, we used EMG to measure the activity of eight agonist and synergist muscles during these exercises. We found that one of two synergist muscles consistently demonstrated higher activity levels. Interestingly, we observed no difference in activity between primary and secondary (or synergist) muscles across all exercises. Most importantly, we found no significant correlation between the perceived muscle activation rate and the EMG measured activation level for any exercise. In conclusion, our findings suggest that, despite differential muscle activity during specific exercises, self-reported muscle activation may not accurately correspond to actual muscle activation, as measured via EMG, due to the participants' poor interoceptive awareness of muscles. These data highlight the potential limitations of relying on perceived muscle activation as a sole gauge of training intensity.

Also flagged:MYCNNBglycerolipidmetabolismpurinelysine
Journal Article 2024-08-30 No Snippets Du B, Zhang Y, Zhang P, Zhang M, Yu Z, Li L, Hou L, Wang Q, Zhang X, Zhang W.
Show Full Abstract

The limited understanding of the molecular mechanism underlying MYCN-amplified (MNA) neuroblastoma (NB) has hindered the identification of effective therapeutic targets for MNA NB, contributing to its higher mortality rate compared to MYCN non-amplified (non-MNA) NB. Therefore, a comprehensive analysis integrating metabolomics and transcriptomics was conducted to systematically investigate the MNA NB. Metabolomics analysis utilized plasma samples from 28 MNA NB patients and 68 non-MNA NB patients, while transcriptomics analysis employed tissue samples from 15 MNA NB patients and 37 non-MNA NB patients. Notably, joint metabolomics and transcriptomics analysis was performed. A total of 46 metabolites exhibited alterations, with 21 displaying elevated levels and 25 demonstrating reduced levels in MNA NB. In addition, 884 mRNAs in MNA NB showed significant changes, among which 766 mRNAs were higher and 118 mRNAs were lower. Joint-pathway analysis revealed three aberrant pathways involving glycerolipid metabolism, purine metabolism, and lysine degradation. This study highlights the substantial differences in metabolomics and transcriptomics between MNA NB and non-MNA NB, identifying three abnormal metabolic pathways that may serve as potential targets for understanding the molecular mechanisms underlying MNA NB.

SOX6
Also flagged:cancergene expressionmethyladenosine5-methylcytosine7-methylguanosinepseudouridine
Journal Article 2024-08-30 ✓ 1 Snippet Chen D, Gu X, Nurzat Y, Xu L, Li X, Wu L, Jiao H, Gao P, Zhu X, Yan D, Li S, Xue C.
In-Text Gene Mentions

…CENPK interacts withSOX6, enhancing Wnt signaling…

Show Full Abstract

Drug resistance in cancer cells significantly diminishes treatment efficacy, leading to recurrence and metastasis. A critical factor contributing to this resistance is the epigenetic alteration of gene expression via RNA modifications, such as N6-methyladenosine (m6A), N1-methyladenosine (m1A), 5-methylcytosine (m5C), 7-methylguanosine (m7G), pseudouridine (Ψ), and adenosine-to-inosine (A-to-I) editing. These modifications are pivotal in regulating RNA splicing, translation, transport, degradation, and stability. Governed by "writers," "readers," and "erasers," RNA modifications impact numerous biological processes and cancer progression, including cell proliferation, stemness, autophagy, invasion, and apoptosis. Aberrant RNA modifications can lead to drug resistance and adverse outcomes in various cancers. Thus, targeting RNA modification regulators offers a promising strategy for overcoming drug resistance and enhancing treatment efficacy. This review consolidates recent research on the role of prevalent RNA modifications in cancer drug resistance, with a focus on m6A, m1A, m5C, m7G, Ψ, and A-to-I editing. Additionally, it examines the regulatory mechanisms of RNA modifications linked to drug resistance in cancer and underscores the existing limitations in this field.

Also flagged:m7Gcolorectal cancercancerMETTL1degradationAKT
Journal Article 2024-08-30 No Snippets Sun Z, Xu Y, Si C, Wu X, Guo Y, Chen C, Wang C.
Show Full Abstract

Plenty of circRNAs have been reported to play an important role in colorectal cancer (CRC), while the reason of abnormal circRNA expression in cancer still keep elusive. Here, we found that m7G RNA modifications were enriched in some circRNAs, these m7G modifications in circRNAs were catalyzed by METTL1, and the GG motif was the main site preference for m7G modifications in circRNAs. We further confirmed that METTL1 played a cancer-promoting role in CRC. We then screened a highly expressed circRNA, called circKDM1A, and found that METTL1 prevented the degradation of circKDM1A by m7G modification. CircKDM1A was further verified to promote proliferation, invasion and migration of CRC in vivo and in vitro. Its cancer-promoting ability was weakened after the m7G site mutation. CircKDM1A was verified to activate AKT pathway by upregulating PDK1, consequently promoting CRC progression. These results suggest that m7G-modified circRNA promotes CRC progression via activating AKT pathway. Our study uncovers an essential physiological function and mechanism of METTL1-mediated m7G modification in the regulation of circRNA stability and cancer progression.

TNFSF4
Also flagged:cancerCircadian rhythmBLCAoxaliplatingemcitabinebladder cancer
Journal Article 2024-08-30 ✓ 1 Snippet Zhou L, He J, Hu Z, Li H, Li J.
In-Text Gene Mentions

…as HAVCR2, TNFSF9,TNFSF4, PDCD1LG2, CD86, PVR,…

Show Full Abstract

Circadian rhythm disruption impacts the efficiency of both chemotherapy and immunotherapy, yet identifying the key factors involved remains challenging. Circadian rhythm disruption can trigger aberrant fibroblasts activation, suggesting potential roles of cancer-associated fibroblasts (CAFs) in addressing this issue. In this paper, TCGA-BLCA patients were classified into two subgroups based on the expression of core circadian rhythm genes (CCRGs). The CCRG-based subgroups showed distinct fibroblast-related signals, from which a risk model composed of five fibroblast-related genes was finally established with excellent survival prognostic value in both TCGA and GEO datasets. The risk model was positively associated with the infiltration of CAFs and can efficiently predict the immunotherapy response in BLCA. Besides, high-risk score was associated with reduced sensitivity to a majority of traditional chemotherapeutic drugs such as oxaliplatin and gemcitabine. Further, the correlation between CCRGs and the risk genes was analyzed. Among the five risk genes, <i>FAM20C</i> displayed the most extensive correlation with the CCRGs and exhibited the strongest connection with CAFs infiltration. Moreover, <i>FAM20C</i> independently served as a predictor for the response to immunotherapy in BLCA. In conclusion, this study has identified a circadian-based signature for evaluating CAFs infiltration and predicting the efficacy of chemotherapy and immunotherapy. The central gene <i>FAM20C</i> has emerged as a promising candidate which merits further investigations.

HFE
Also flagged:1triazoleindirubintumorHGFc-MET
Journal Article 2024-08-30 ✓ 1 Snippet Gowda SV, Kim NY, Harsha KB, Gowda D, Suresh RN, Deivasigamani A, Mohan CD, Hui KM, Sethi G, Ahn KS, Rangappa KS.
In-Text Gene Mentions

…B/C viral infections,hemochromatosis, alcoholic hepatitis, nonalco…

Show Full Abstract

<h4>Introduction</h4>Hepatocellular carcinoma (HCC) is a fatal cancer that is often diagnosed at the advanced stages which limits the available therapeutic options. The interaction of HGF with c-MET (a receptor tyrosine kinase) results in the activation of c-MET which subsequently triggers the PI3K/Akt/mTOR axis. Overexpression of c-MET in HCC tissues has been demonstrated to contribute to tumor progression and metastasis.<h4>Objectives</h4>We aimed to synthesize triazole-indirubin conjugates, examine their growth suppressor efficacy in cell-based assays, and investigate the antitumor as well as antimetastatic activity of lead cytotoxic agent in the orthotopic mice model.<h4>Methods</h4>A series of triazole-indirubin hybrids were synthesized and cytotoxicity, apoptogenic, and antimigratory effect of the lead compound (CRI9) was evaluated using MTT assay, cell cycle analysis, annexin-V/PI assay, TUNEL assay, and wound healing assay. The effect of CRI9 on the operation of the HGF/c-MET/PI3K/Akt/mTOR axis was examined using western blotting and transfection experiments. Acute toxicity, antitumor, and antimetastatic activity of CRI9 were examined in NCr nude mice. The expression of c-MET/PI3K/Akt/mTOR, CD31, and Ki-67 was examined using immunohistochemistry and western blotting.<h4>Results</h4>Among the new compounds, CRI9 consistently displayed potent cytotoxicity against HGF-induced HCC cells. CRI9 induced apoptosis as evidenced by increased sub G1 cells, annexin-V<sup>+</sup>/PI<sup>+</sup> cells, TUNEL<sup>+</sup> cells, and cleavage of procaspase-3 and PARP. CRI9 inhibited HGF-induced phosphorylation of c-MET<sup>Y1234/1235</sup> and subsequently suppressed the PI3K/Akt/mTOR axis. Also, depletion of c-MET or inhibition of c-MET by CRI9 resulted in suppression of the PI3K/Akt/mTOR axis. CRI9 showed no toxic effects in NCr nude mice and displayed a potent antitumor and antimetastatic effect in the orthotopic HCC mice model. CRI9 also reduced the levels of phospho-c-MET, CD31, and Ki-67 and suppressed the activation of the PI3K/Akt/mTOR axis in tumor tissues.<h4>Conclusion</h4>CRI9 has been identified as a new inhibitor of the c-MET/PI3K/Akt/mTOR axis in HCC preclinical models.

Also flagged:Oxygenpost-translational modificationscysteinesulfenylationthrombotic disordersdiabetes
Journal Article 2024-08-30 No Snippets Mu B, Zeng Y, Luo L, Wang K.
Show Full Abstract

Reactive Oxygen Species (ROS) refer to a variety of derivatives of molecular oxygen that play crucial roles in regulating a wide range of physiological and pathological processes. Excessive ROS levels can cause oxidative stress, leading to cellular damage and even cell demise. However, moderately elevated levels of ROS can mediate the oxidative post-translational modifications (oxPTMs) of redox-sensitive proteins, thereby affecting protein functions and regulating various cellular signaling pathways. Among the oxPTMs, ROS-induced reversible protein sulfenylation represents the initial form of cysteine oxidation for sensing redox signaling. In this review, we will summarize the discovery, chemical formation, and detection approaches of protein sulfenylation. In addition, we will highlight recent findings for the roles of protein sulfenylation in various diseases, including thrombotic disorders, diabetes, cardiovascular diseases, neurodegenerative diseases, and cancer.

PRDX6
Also flagged:bindingauranofincancerferroptosisdeath
Journal Article 2024-08-30 ✓ 4 Snippets Inague A, Nakahata DH, Viviani LG, Alegria TGP, Lima RS, Iijima TS, Netto LES, Angeli JPF, Miyamoto S, de Paiva REF.
In-Text Gene Mentions

…of auranofin toPrdx6and its potential…

…potential role ofPrdx6in modulating the…

…evaluated here exhibitPrdx6-independent cytotoxicity.…

…Cys47 residue ofPrdx6in vitro under…

Show Full Abstract

In this study, we demonstrate that ferroptosis is a component of the cell death mechanism induced by auranofin in HT-1080 cells, in contrast to the gold(III) compounds [Au(phen)Cl<sub>2</sub>]PF<sub>6</sub> and [Au(bnpy)Cl<sub>2</sub>]. Additionally, we identify a potential role of Prdx6 in modulating the sensitivity of A-375 cells to auranofin treatment, whereas the gold(III) compounds evaluated here exhibit Prdx6-independent cytotoxicity. Finally, using mass spectrometry, we show that auranofin binds selectively to the catalytic Cys47 residue of Prdx6 in vitro under acidic conditions. No binding was observed with the C47S mutant or at neutral pH.

KLHL20
Also flagged:Ubiquitintumorcancercancersprotein degradationsignal transduction
Journal Article 2024-08-30 ✓ 2 Snippets Hong Z, Liu F, Zhang Z.
In-Text Gene Mentions

…for DAPK, theKLHL20–Cul3–ROC1 complex mediates DA…

…exposure to IFN,KLHL20accumulates within PML…

Show Full Abstract

Although immune checkpoint-based cancer immunotherapy has shown significant efficacy in various cancers, resistance still limits its therapeutic effects. Ubiquitination modification is a mechanism that adds different types of ubiquitin chains to proteins, mediating protein degradation or altering their function, thereby affecting cellular signal transduction. Increasing evidence suggests that ubiquitination modification plays a crucial role in regulating the mechanisms of resistance to cancer immunotherapy. Drugs targeting ubiquitination modification pathways have been shown to inhibit tumor progression or enhance the efficacy of cancer immunotherapy. This review elaborates on the mechanisms by which tumor cells, immune cells, and the tumor microenvironment mediate resistance to cancer immunotherapy and the details of how ubiquitination modification regulates these mechanisms, providing a foundation for enhancing the efficacy of cancer immunotherapy by intervening in ubiquitination modification.

Also flagged:resorcylic lactonesalternariolbiosynthesisaltenuenemethylether
Journal Article 2024-08-30 No Snippets Podlech J.
Show Full Abstract

In this overview, naturally occurring resorcylic lactones biosynthetically derived from alternariol and almost exclusively produced by fungi, are discussed with view on their isolation, structure, biological activities, biosynthesis, and total syntheses. This class of compounds consists until now of 127 naturally occurring compounds, with very divers structural motifs. Although only a handful of these toxins (i.e., alternariol and its 9-<i>O</i>-methyl ether, altenusin, dehydroaltenusin, altertenuol, and altenuene) were frequently found and isolated as fungal contaminants in food and feed and have been investigated in significant detail, further metabolites, which were much more rarely found as natural products, similarly show interesting biological activities.

Also flagged:pancreatic ductal adenocarcinomaPDACcancerstromagenesismechanotransductiontumor
Journal Article 2024-08-30 No Snippets Shah A, Ganguly K, Rauth S, Sheree SS, Khan I, Ganti AK, Ponnusamy MP, Kumar S, Jain M, Batra SK.
Show Full Abstract

Despite the ongoing advances in interventional strategies (surgery, chemotherapy, radiotherapy, and immunotherapy) for managing pancreatic ductal adenocarcinoma (PDAC), the development of therapy refractory phenotypes remains a significant challenge. Resistance to various therapeutic modalities in PDAC emanates from a combination of inherent and acquired factors and is attributable to cancer cell-intrinsic and -extrinsic mechanisms. The critical determinants of therapy resistance include oncogenic signaling and epigenetic modifications that drive cancer cell stemness and metabolic adaptations, CAF-mediated stromagenesis that results in ECM deposition altered mechanotransduction, and secretome and immune evasion. We reviewed the current understanding of these multifaceted mechanisms operating in the PDAC microenvironment, influencing the response to chemotherapy, radiotherapy, and immunotherapy regimens. We then describe how the lessons learned from these studies can guide us to discover novel therapeutic regimens to prevent, delay, or revert resistance and achieve durable clinical responses.

Also flagged:Obstructive Sleep Apneasleepserotoninpathogenesisdigestionobesity
Journal Article 2024-08-30 No Snippets Witkowska A, Jaromirska J, Gabryelska A, Sochal M.
Show Full Abstract

Obstructive Sleep Apnea (OSA) is a disorder characterized by repeated upper airway collapse during sleep, leading to apneas and/or hypopneas, with associated symptoms like intermittent hypoxia and sleep fragmentation. One of the agents contributing to OSA occurrence and development seems to be serotonin (5-HT). Currently, the research focuses on establishing and interlinking OSA pathogenesis and the severity of the disease on the molecular neurotransmitter omnipresent in the human body-serotonin, its pathway, products, receptors, drugs affecting the levels of serotonin, or genetic predisposition. The 5-HT system is associated with numerous physiological processes such as digestion, circulation, sleep, respiration, and muscle tone-all of which are considered factors promoting and influencing the course of OSA because of correlations with comorbid conditions. Comorbidities include obesity, physiological and behavioral disorders as well as cardiovascular diseases. Additionally, both serotonin imbalance and OSA are connected with psychiatric comorbidities, such as depression, anxiety, or cognitive dysfunction. Pharmacological agents that target 5-HT receptors have shown varying degrees of efficacy in reducing the Apnea-Hypopnea Index and improving OSA symptoms. The potential role of the 5-HT signaling pathway in modulating OSA provides a promising avenue for new therapeutic interventions that could accompany the primary treatment of OSA-continuous positive airway pressure. Thus, this review aims to elucidate the complex role of 5-HT and its regulatory mechanisms in OSA pathophysiology, evaluating its potential as a therapeutic target. We also summarize the relationship between 5-HT signaling and various physiological functions, as well as its correlations with comorbid conditions.

Also flagged:CancerColorectal CarcinogenesisColorectal cancerrectal cancerspathogenesistumor
Journal Article 2024-08-30 No Snippets Gharib E, Robichaud GA.
Show Full Abstract

Colorectal cancer (CRC) represents a significant global health burden, with high incidence and mortality rates worldwide. Recent progress in research highlights the distinct clinical and molecular characteristics of colon versus rectal cancers, underscoring tumor location's importance in treatment approaches. This article provides a comprehensive review of our current understanding of CRC epidemiology, risk factors, molecular pathogenesis, and management strategies. We also present the intricate cellular architecture of colonic crypts and their roles in intestinal homeostasis. Colorectal carcinogenesis multistep processes are also described, covering the conventional adenoma-carcinoma sequence, alternative serrated pathways, and the influential Vogelstein model, which proposes sequential <i>APC</i>, <i>KRAS</i>, and <i>TP53</i> alterations as drivers. The consensus molecular CRC subtypes (CMS1-CMS4) are examined, shedding light on disease heterogeneity and personalized therapy implications.

Also flagged:Synthesisnucleoside triphosphatesnucleoside triphosphatemetabolismpolymerasessulfur
Journal Article 2024-08-30 No Snippets Novgorodtseva AI, Lomzov AA, Vasilyeva SV.
Show Full Abstract

This review article is focused on the progress made in the synthesis of 5'-α-P-modified nucleoside triphosphates (α-phosphate mimetics). A variety of α-P-modified nucleoside triphosphates (NTPαXYs, Y = O, S; X = S, Se, BH<sub>3</sub>, alkyl, amine, N-alkyl, imido, or others) have been developed. There is a unique class of nucleoside triphosphate analogs with different properties. The main chemical approaches to the synthesis of NTPαXYs are analyzed and systematized here. Using the data presented here on the diversity of NTPαXYs and their synthesis protocols, it is possible to select an appropriate method for obtaining a desired α-phosphate mimetic. Triphosphates' substrate properties toward nucleic acid metabolism enzymes are highlighted too. We reviewed some of the most prominent applications of NTPαXYs including the use of modified dNTPs in studies on mechanisms of action of polymerases or in systematic evolution of ligands by exponential enrichment (SELEX). The presence of heteroatoms such as sulfur, selenium, or boron in α-phosphate makes modified triphosphates nuclease resistant. The most distinctive feature of NTPαXYs is that they can be recognized by polymerases. As a result, S-, Se-, or BH<sub>3</sub>-modified phosphate residues can be incorporated into DNA or RNA. This property has made NTPαXYs a multifunctional tool in molecular biology. This review will be of interest to synthetic chemists, biochemists, biotechnologists, or biologists engaged in basic or applied research.

DCC
Also flagged:vision
Journal Article 2024-08-30 ✓ 1 Snippet Cetinkaya A, Kaya MC, Danaci E, Oguztuzun H.
In-Text Gene Mentions

…generation of theDCC.…

Show Full Abstract

The calibration industry is renowned for its diverse and sophisticated equipment and complex processes, which necessitate innovative solutions to keep pace with rapidly advancing technology. This paper introduces an enhancement to an existing microservice-based cloud architecture, aimed at effectively managing the inherent complexity within this field. The enhanced architecture seamlessly integrates various equipment types and communication technologies, aligning diverse stakeholder expectations into a unified system that ensures efficient and accurate calibration processes. It highlights the integration of microservices to facilitate various methods of uncertainty calculation and the generation of digital calibration certificates (DCCs). A case study on RF power measurement illustrates the practical application and benefits of the enhanced architecture. Although initially focused on RF power measurement, the flexible architecture allows for future expansions to accommodate new standards and measurement techniques. The enhanced system offers a comprehensive approach to managing data flow from calibration equipment to the final generation of DCCs, utilizing cloud-based services for efficient data processing. As a future direction, this extension sets the groundwork for broader applicability across multiple measurement types, ensuring readiness for upcoming advancements in metrology.

Also flagged:FerroptosisironmetabolismdiabetesDiabetes mellituschronic disease
Journal Article 2024-08-30 No Snippets Jin EJ, Jo Y, Wei S, Rizzo M, Ryu D, Gariani K.
Show Full Abstract

Diabetes mellitus is a complex chronic disease, considered as one of the most common metabolic disorders worldwide, posing a major threat to global public health. Ferroptosis emerges as a novel mechanism of programmed cell death, distinct from apoptosis, necrosis, and autophagy, driven by iron-dependent lipid peroxidation accumulation and GPx4 downregulation. A mounting body of evidence highlights the interconnection between iron metabolism, ferroptosis, and diabetes pathogenesis, encompassing complications like diabetic nephropathy, cardiomyopathy, and neuropathy. Moreover, ferroptosis inhibitors hold promise as potential pharmacological targets for mitigating diabetes-related complications. A better understanding of the role of ferroptosis in diabetes may lead to an improvement in global diabetes management. In this review, we delve into the intricate relationship between ferroptosis and diabetes development, exploring associated complications and current pharmacological treatments.

Also flagged:autism spectrum disorderneurodevelopmental disorderspathogenesisautismCNTNAP2KCNQ3
Journal Article 2024-08-30 No Snippets Shiota Y, Nishiyama T, Yokoyama S, Yoshimura Y, Hasegawa C, Tanaka S, Iwasaki S, Kikuchi M.
Show Full Abstract

<h4>Introduction</h4>Autism spectrum disorders (ASD) represent a heterogeneous group of neurodevelopmental disorders with strong genetic predispositions. Although an increasing number of genetic variants have been implicated in the pathogenesis of ASD, little is known about the relationship between ASD-associated genetic variants and individual ASD traits. Therefore, we aimed to investigate these relationships.<h4>Methods</h4>Here, we report a case-control association study of 32 Japanese children with ASD (mainly with high-functioning autism [HFA]) and 36 with typical development (TD). We explored previously established ASD-associated genes using a next-generation sequencing panel and determined the association between Social Responsiveness Scale (SRS) T-scores and intelligence quotient (IQ) scores.<h4>Results</h4>In the genotype-phenotype analyses, 40 variants of five genes (<i>SCN1A</i>, <i>SHANK3, DYRK1A, CADPS,</i> and <i>SCN2A</i>) were associated with ASD/TD phenotypes. In particular, 10 <i>SCN1A</i> variants passed permutation filtering (false discovery rate <0.05). In the quantitative association analyses, 49 variants of 12 genes (<i>CHD8, SCN1A, SLC6A1, KMT5B, CNTNAP2, KCNQ3, SCN2A, ARID1B, SHANK3, DYRK1A, FOXP1, and GRIN2B</i>) and 50 variants of 10 genes (<i>DYRK1A, SCN2A, SLC6A1, ARID1B, CNTNAP2, SHANK3, FOXP1, PTEN, SCN1A, and CHD8</i>) were associated with SRS T- and IQ-scores, respectively.<h4>Conclusion</h4>Our data suggest that these identified variants are essential for the genetic architecture of HFA.

ZNFX1
Also flagged:AIFM2cancerFerroptosisirondeathlipid
Journal Article 2024-08-30 ✓ 1 Snippet Wang G, Yao Y, Xie J, Wen C.
In-Text Gene Mentions

ZNFX1 Antisense RNA 1Antisense RNA 1…

Show Full Abstract

ZNFX1 Antisense RNA 1 (ZFAS1) act as an oncogenic long noncoding RNA in multiple types of cancer. Ferroptosis is an iron-dependent cell death characterized by excessive iron accumulation and lipid peroxidation. However, to date, the functional role and mechanism of ZFAS1 in ferroptosis in hepatocellular carcinoma (HCC) remains largely unknown. The present study revealed that ZFAS1 was upregulated in HCC and upregulation of ZFAS1 indicated poor clinical outcome of HCC patients. Loss- and gain-of-function experiments demonstrated that knockdown of ZFAS1 inhibited HCC cell proliferation and induced ferroptosis, while overexpression of ZFAS1 exerted opposite effects. ZFAS1 enhanced cell proliferation via suppression of ferroptotic death. Mechanistically, ZFAS1 interacted with miR-150 and decreased its expression. AIFM2, the critical ferroptosis protector, was a direct target of ZFAS1/miR-150. ZFAS1 accelerated HCC proliferation and inhibited ferroptosis by the regulation of the miR-150/AIFM2 axis. These discoveries intimate an essential part of ZFAS1/miR-150/AIFM2 in governing HCC ferroptosis, which may provide a promising therapeutic strategy for HCC patients.

Also flagged:ureananoureananohydroxyapatitenitrogenmalnutritionCOVID-19
Journal Article 2024-08-30 No Snippets Asif MAA, Mahjabin F, Singha SK, Rahman Jahangir MM, Hoque SM.
Show Full Abstract

Bangladesh stands third in global rice production while complete modernization of rice production is not fully enforced. The boon of nano agriculture might circumvent the challenge of increasing the yield with minimal ecological damage. Nanofertilizer might be one of the solutions to address the problem of modern agriculture confronting environmental hazards owing to the excessive use of synthetic fertilizers by farmers in Bangladesh. We synthesized nanourea by chemical co-precipitation (CP) and hydrothermal (HT) methods in an attempt to develop environmentally friendly nanofertilizers. We characterized the nanourea and confirmed the functionalization of nanohydroxyapatite (nHAP) with urea by scanning transmission electron microscopy (STEM)/EDS mapping. The CP method produced particle dimensions of 45.62 nm for length and 14.16 nm for width. In comparison, the readings obtained through the HT method were around 74.69 nm and 20.44 nm for length and width, respectively. The field application of nanourea demonstrated impressive results, indicating a significant relationship between the particle size of nanourea and its impact on several agricultural factors. The grain yield using traditional synthetic fertilizer (urea) ranged from 6.47 to 6.52 t ha<sup>-1</sup> with a very low NUE of 35.8-36.34 %. Contrarily, the grain yield was found from 6.52 to 6.84 t ha<sup>-1</sup> and the obtained NUE ranged from 57.58 to 71.0 % using nanourea of the same concentration calibrated with traditional urea by two methods. Additionally, nanourea treatments having 25 % less nitrogen (N) provided higher total N (TN) in grain suggesting possible nutritional enrichment while checking the yield penalty and substantial increase in N use efficiency (NUE). However, further upscaling of this research on a field scale is necessary to confirm the findings.

TNFSF4
Also flagged:Smyd3head and neck squamous cell carcinomatype I IFNHNSCColigonucleotidesoral carcinoma
Journal Article 2024-08-30 ✓ 1 Snippet Tsai DE, Lovanov A, Abdelmaksoud A, Akhtar J, Dar MS, Luff M, McKinnon K, Kim S, Robbins Y, Huynh A, Murali M, Bernard B, Sinkoe A, Luo X, B K, Allen CT, Saloura V.
In-Text Gene Mentions

…checkpoints, such asTnfsf4, Cd27, Cd28, Cd40,…

Show Full Abstract

SET and MYND-domain containing protein 3 (SMYD3) mediates epigenetic repression of type I IFN response genes in human papillomavirus (HPV)-negative HNSCC cells, and Smyd3 depletion using anti-sense oligonucleotides (ASOs) increases the sensitivity of syngeneic mouse oral carcinoma (MOC1) models to anti-PD-1 therapy. In this study, we utilized single-cell RNA-seq of MOC1 tumors treated with Smyd3 ASOs and found enrichment of type I IFN response pathways in cancer cells, a shift of CD8<sup>+</sup> T-cells toward an activated/memory phenotype, and a shift of neutrophils toward an anti-tumorigenic phenotype. Mechanisms of resistance to the Smyd3 ASO and anti-PD-1 combination were derived from cancer cells, macrophages, and CD8<sup>+</sup> T-cells, including neutrophil enrichment through the upregulation of <i>Cxcl2</i>, repression of <i>Cxcl9,</i> and defective antigen presentation. This study sheds light on the immunomodulatory functions of Smyd3 <i>in vivo</i> and provides insight into actionable mechanisms of resistance to improve the efficacy of Smyd3 ASOs and anti-PD-1 combination.

Also flagged:NF-κBSOX9cell proliferationosteoarthritischondrocytecatabolism
Journal Article 2024-08-30 No Snippets Tian B, Zhang L, Zheng J, Kang X.
Show Full Abstract

The nuclear factor-κB (NF-κB) signalling pathway exists in a variety of cells and is involved in the gene regulation of various physiological and pathological processes such as inflammation, immunity, cell proliferation and apoptosis. It has been shown that this signaling pathway is also involved in numerous events associated with osteoarthritis, including chondrocyte catabolism, chondrocyte survival, and synovial inflammation. SRY-related high mobility group-box 9(SOX9) is the "master regulator" of chondrocytes and one of the key transcription factors that maintain chondrocyte phenotype and cartilage homeostasis. NF-κB can positively regulate the expression of SOX9 by directly binding to its promoter region, and play a role in the formation and development of chondrocytes. This article reviews the regulatory effect of the NF-κB-SOX9 signaling axis on osteoarthritis.

Also flagged:fluoridecalciumphosphorusmineraldental cariescaries
Journal Article 2024-08-30 No Snippets Cîrdei MV, Margan MM, Margan R, Ban-Cucerzan A, Petre I, Hulka I, Horhat RM, Todea DC.
Show Full Abstract

<h4>Objectives</h4>The purpose of this study is to evaluate the remineralization potential of primary teeth enamel after being exposed to different laser diode therapies.<h4>Methods</h4>Ninety-six vestibular primary teeth enamel samples were divided into eight groups (<i>n</i> = 12) with varying treatments: control (G1), CPP-ACP-fluoride varnish (G2), diode lasers at 980 nm (G3), 808 nm (G4), 450 nm (G5), 980 nm + CPP-ACP-fluoride varnish (G6), 808 nm + CPP-ACP-fluoride varnish (G7), and 450 nm + CPP-ACP-fluoride varnish (G8). Each sample was assessed using a DIAGNOdent<sup>®</sup> (KaVo Dental, Biberach, Germany), at baseline, post-treatment, and post-pH cycle remineralization. SEM imaging was performed before and after treatment and following the pH cycle.<h4>Results</h4>The results indicated that the 980 nm and 808 nm diode lasers, both alone and in combination with CPP-ACP-fluoride varnish, either maintained or increased the calcium (Ca) weight percentage (Wt%) in the enamel. The 980 nm diode laser combined with CPP-ACP-fluoride varnish (G6) showed a significant increase in Ca Wt%, suggesting a strong remineralization effect. Similarly, the 808 nm diode laser alone (G4) also promoted a substantial increase in Ca Wt%. In contrast, the 450 nm diode laser, whether applied alone or in combination with CPP-ACP-fluoride varnish, resulted in a lower Ca Wt% and an increase in phosphorus (P) Wt%. Most groups, except for the CPP-ACP-fluoride varnish alone (G2), demonstrated an increase in P Wt%, indicating a complex interaction between laser therapy and enamel remineralization.<h4>Conclusions</h4>The combined use of laser therapy with CPP-ACP-fluoride varnish significantly enhanced the remineralization of temporary teeth enamel. The 980 nm diode laser + CPP-ACP-fluoride varnish showed the most pronounced improvement in remineralization, while the 808 nm diode laser alone also effectively increased calcium solubility. These findings suggest that higher-wavelength diode lasers, particularly when combined with remineralizing agents, can effectively enhance the mineral content of primary teeth and promote enamel remineralization.

SERPINC1
Also flagged:Albuminuriaglomerular filtrationkidney diseasealbumincreatinineinsulin growth factor
Journal Article 2024-08-30 ✓ 5 Snippets Khoza S, George JA, Naicker P, Stoychev SH, Fabian J, Govender IS.
In-Text Gene Mentions

…proteins (SERPINA1, ALB,SERPINC1, AFM, PIGR, A1BG,…

…afamin, antithrombin III (SERPINC1), vitamin-D binding protein,…

…proteins, SERPINA1, albumin,SERPINC1, and afamin exhibited…

…glycoprotein, albumin, afamin,SERPINC1, myoglobin, and immunoglobuli…

…as SERPINA1, Alb,SERPINC1, AFM, PIGR, A1BG,…

Show Full Abstract

Albuminuria may precede decreases in the glomerular filtration rate (GFR) and both tests are insensitive predictors of early stages of kidney disease. Our aim was to characterise the urinary proteome in black African individuals with albuminuria and well-preserved GFR from South Africa. This case-controlled study compared the urinary proteomes of 52 normoalbuminuric (urine albumin: creatinine ratio (uACR) < 3 mg/mmol) and 56 albuminuric (uACR ≥ 3 mg/mmol) adults of black African ethnicity. Urine proteins were precipitated, reduced, alkylated, digested, and analysed using an Evosep One LC (Evosep Biosystems, Odense, Denmark) coupled to a Sciex 5600 Triple-TOF (Sciex, Framingham, MA, USA) in data-independent acquisition mode. The data were searched on Spectronaut<sup>TM</sup> 15. Differentially abundant proteins (DAPs) were filtered to include those with a ≥2.25-fold change and a false discovery rate ≤ 1%. Receiver-operating characteristic curves were used to assess the discriminating abilities of proteins of interest. Pathway analysis was performed using Enrichr software. As expected, the albuminuric group had higher uACR (7.9 vs. 0.55 mg/mmol, <i>p</i> < 0.001). The median eGFR (mL/min/1.73 m<sup>2</sup>) showed no difference between the groups (111 vs. 114, <i>p</i> = 0.707). We identified 80 DAPs in the albuminuria group compared to the normoalbuminuria group, of which 59 proteins were increased while 21 proteins were decreased in abundance. We found 12 urinary proteins with an AUC > 0.8 and a <i>p</i> < 0.001 in the multivariate analysis. Furthermore, an 80-protein model was developed that showed a high AUC ˃ 0.907 and a predictive accuracy of 91.3% between the two groups. Pathway analysis found that the DAPs were involved in insulin growth factor (IGF) functions, innate immunity, platelet degranulation, and extracellular matrix organization. In albuminuric individuals with a well-preserved eGFR, pathways involved in preventing the release and uptake of IGF by insulin growth factor binding protein were significantly enriched. These proteins are indicative of a homeostatic imbalance in a variety of cellular processes underlying renal dysfunction and are implicated in chronic kidney disease.

Also flagged:AnxietyCognitive ImpairmentReelinpost-traumatic stress disorderPTSDcognition
Journal Article 2024-08-30 No Snippets Park HR, Cai M, Yang EJ.
Show Full Abstract

We investigated the effects of epigenetic modifications on post-traumatic stress disorder (PTSD) using a novel combination of herbal medicines from <i>Panax ginseng</i>, <i>Astragalus membranaceus</i>, <i>Atractylodes macrocephala</i>, and <i>Glycyrrhiza uralensis</i>. The herbal formula extract (HFE) (250 mg/kg) was administered orally once daily for 14 days to determine its effects on PTSD in mice by combining prolonged stress and foot shock. The open field and Y-maze tests determined the effect of HFE on PTSD-induced anxiety and cognition. Hippocampal neuronal plastic changes and molecular mechanism were verified. Treatment with HFE decreased anxiety-like behavior and enhanced cognition. Moreover, it reduced the number of PTSD-related hilar ectopic granule cells in the dentate gyrus (DG). PTSD mice showed reduced neuronal plasticity of doublecortin<sup>+</sup> cells in the DG, which was restored by HFE treatment. HFE reversed PTSD-induced inhibition of the Reelin/Dab1 pathway, a critical signaling cascade involved in brain development, and regulated <i>Reelin</i> methylation. Furthermore, DNA methylation, methyl-CpG binding protein 2, and DNA methyltransferase 1, which were elevated in the hippocampus of PTSD mice, were restored following HFE treatment. HFE increased the expression of synaptic plasticity-related factors in the hippocampus of PTSD mice. Our findings suggest that HFE can facilitate PTSD treatment by alleviating behavioral abnormalities through the restoration of hippocampal dysfunction via regulation of the Reelin/Dab-1 pathway and DNA methylation in the hippocampus.

TRIM38
Also flagged:deathnecroptosissteatosissucroseMLKLButyric acid
Journal Article 2024-08-30 ✓ 5 Snippets Na S, Fan Y, Chen H, Li L, Li G, Zhang F, Wang R, Yang Y, Shen Z, Peng Z, Wu Y, Zhu Y, Yang Z, Dong G, Ye Q, Yue J.
In-Text Gene Mentions

…levels correlate withTRIM38and MLKL in…

…LPS stimuli viaTRIM38/TRIF and CREB3L3/MLKL pathway…

…necroptosis signals viaTRIM38/TRIF and CREB3L3/MLKL pathway…

…polyclonal rabbit anti-mouseTRIM38(1:100, #13405-1-AP, Proteinte…

…of the humanTRIM38promoter region (corresponding…

Show Full Abstract

Rapid turnover of the intestinal epithelium is a critical strategy to balance the uptake of nutrients and defend against environmental insults, whereas inappropriate death promotes the spread of inflammation. PPAR<i>α</i> is highly expressed in the small intestine and regulates the absorption of dietary lipids. However, as a key mediator of inflammation, the impact of intestinal PPAR<i>α</i> signaling on cell death pathways is unknown. Here, we show that <i>Pparα</i> deficiency of intestinal epithelium up-regulates necroptosis signals, disrupts the gut vascular barrier, and promotes LPS translocation into the liver. Intestinal <i>Pparα</i> deficiency drives age-related hepatic steatosis and aggravates hepatic fibrosis induced by a high-fat plus high-sucrose diet (HFHS). PPAR<i>α</i> levels correlate with TRIM38 and MLKL in the human ileum. Inhibition of PPAR<i>α</i> up-regulates necroptosis signals in the intestinal organoids triggered by TNF-<i>α</i> and LPS stimuli <i>via</i> TRIM38/TRIF and CREB3L3/MLKL pathways. Butyric acid ameliorates hepatic steatosis induced by intestinal <i>Pparα</i> deficiency through the inhibition of necroptosis. Our data suggest that intestinal PPAR<i>α</i> is essential for the maintenance of microenvironmental homeostasis and the spread of inflammation <i>via</i> the gut-liver axis.

HFE
Also flagged:Chronic PancreatitisPancreatic CancerCPpancreatic ductal adenocarcinomaPDAClipase
Journal Article 2024-08-30 ✓ 1 Snippet Ladna M, Madhok I, Bhat A, Ruiz N, Brown J, Wilson J, Jiang P, Taylor R, Radetic M, George J, Forsmark C.
In-Text Gene Mentions

…brush border proteins,hemochromatosis, and gastrointestinal surgeri…

Show Full Abstract

<h4>Background and aims</h4>Enzyme insufficiency (EPI) is common in chronic pancreatitis (CP), pancreatic ductal adenocarcinoma (PDAC), and after pancreatic resection. 40%-50% of CP patients and 70%-80% of PDAC patients develop EPI. 1/3rd of these patients are prescribed Pancreatic enzyme replacement therapy (PERT), often at an inadequate dose, with evidence that this leads to increased morbidity and mortality. This study aimed to develop and implement an EPIC-based best practice alert (BPA) and smart set to improve the management of EPI.<h4>Methods</h4>A retrospective analysis of all patients with International Classification of Diseases codes for EPI, CP, and PDAC or CPT code for pancreatic resection from Feb-2018 to Feb-2021. Appropriate use of PERT was defined as ≥ 40,000 units of lipase with each meal. The BPA and smart set were implemented into the electronic medical record in Feb-2020. The BPA fired if the patient was already on PERT or if an order for PERT was placed and directed the clinician to the smart set which provided PERT formulations each prefilled to the minimum therapeutic dose of 40,000 units of lipase.<h4>Results</h4>A significant increase in the proportion of patients on minimum therapeutic dose of PERT from 61.9% to 72.9% (<i>P</i> ≤ .001). Ordering of pancreatic elastase, A1c, vitamin D, and dual X-ray absorptiometry increased from 20.4% to 29.9% (<i>P</i> < .001), 54.7%-62.1% (<i>P</i> = .001), 30.9%-48.1% (<i>P</i> < .001) and 10%-18% (<i>P</i> < .001), respectively. The BPA triggered a total of 30,838 times resulting in the smart being opened a total of 624 (2.02%) times over 24 months.<h4>Conclusion</h4>The BPA and smart set were associated with an improvement in the diagnosis and management of EPI and related complications in CP, PDAC, and s/p pancreatic resection.

HFE
Also flagged:hyperbilirubinemiaGSUGT1A1nucleotidehypebilirubinemiacystic fibrosis
Journal Article 2024-08-30 ✓ 5 Snippets Ivanova AA, Apartseva NE, Kashirina AP, Nemtsova EG, Ivanova YV, Kruchinina MV, Kurilovich SA, Maksimov VN.
In-Text Gene Mentions

…alha-1-antitrypsin deficiency,hemochromatosis) affecting hepatic functions.…

…develops due toHFEgene mutations causing…

…(S65C) variants ofHFEgene (OMIM 235200).…

…gene variants withHFEgene mutations […

…rs1800730 (S65C) ofHFEgene, rs113993960 (ΔF508)…

Show Full Abstract

<b>The aim of the study</b> was to search for the associations of benign unconjugated hyperbilirubinemia phenotype with rs1799945 (H63D), rs1800562 (C282Y), rs1800730 (S65C) mutations of <i>HFE</i> gene, rs113993960 (ΔF508) of <i>CFTR</i> gene, rs28929474 (PIZ), rs17580 (PIS) mutations of <i>SERPINA1</i> gene.<h4>Material and methods</h4>The study design is case-control. The group with Gilbert's syndrome (GS) phenotype (n=414; mean age - 36.7±15.9 years; 49.8% men) was formed by gastroenterologists, and included the individuals with unconjugated hyperbilirubinemia who underwent a standard clinical examination. The individuals with known causes of unconjugated hyperbilirubinemia were excluded from the group. The control group (n=429; mean age - 38.5±14.3 years; 52.2% men) was a random sampling from DNA banks of MONICA project participants, the screening of young people aged 25-44 and a one-time study of schoolchildren in Novosibirsk (Russia). DNA was isolated by phenol-chloroform extraction or by the express method (PROBA-RAPID-GENETIKA; DNA-Technology, Moscow, Russia) from venous blood. Genotyping of groups by nucleotide sequence rs1799945 (H63D), rs1800562 (C282Y), rs1800730 (S65C) of <i>HFE</i> gene, rs113993960 (ΔF508) of <i>CFTR</i> gene, rs28929474 (PIZ), rs17580 (PIS) of <i>SERPINA1</i> gene was performed by polymerase chain reaction followed by the analysis of fragment length polymorphism on a polyacrylamide gel.<h4>Results</h4>According to the genotypes and alleles of the variants rs1799945 (H63D), rs1800562 (C282Y), rs1800730 (S65C) of <i>HFE</i> gene, rs113993960 (ΔF508) of <i>CFTR</i> gene, rs28929474 (PIZ), rs17580 (PIS) of <i>SERPINA1</i> gene, no statistically significant differences were found between the GS group and the control group (p>0.05).<h4>Conclusion</h4>Nucleotide sequence variants rs1799945 (H63D), rs1800562 (C282Y), rs1800730 (S65C) of <i>HFE</i> gene, rs113993960 (ΔF508) of <i>CFTR</i> gene, rs28929474 (PIZ), rs17580 (PIS) of <i>SERPINA1</i> gene, or their combinations with rs3064744 of <i>UGT1A1</i> gene were found to have no association with GS.

medRxiv 2024-08-30 Preprint (No Snippets API) Hupalo D, McCauley JL, Gomez L, Griswold AJ, Hoher G, Konidari I, Lorenzo J, Parker GS, Pascual J, Sandford AR, Whitehead PL, Davis DA, Garamszegi S, Gultekin SH, Sun X, Vontell RT, Chatigny M, Chernicky D, Constant MM, Darling IG, Ennulat DJ, Esposito JM, Morris K, Lawton ES, Morakabati NR, Oduor P, Rodgers AP, Sang LA, Sullivan KM, Tabit CJ, Turpin T, Zeabi A, Zheng T, Berretta S, Klengel T, Oakley DH, Ruzicka WB, Blanchard T, Ho E, Johnson R, LeFevre A, Bustamante M, Haroutunian V, Katsel P, Marino C, Panopoulos S, Purohit DP, Wysocki M, Glausier JR, Lewis D., Nagra RM, Alba C, Martin J, Rice E, Rosenberger J, Smith G, Sukumar G, Tompkins M, Wilkerson M, Dalgard CL, Scott WK.
Show Full Abstract

<h4>ABSTRACT</h4> Central nervous system diseases are a prevailing cause of morbidity and mortality worldwide, and are influenced by environmental and biological factors including genetic risk. Here we generated genome-wide genetic data on a large cohort of brain tissue donors with in-depth clinical and neuropathological phenotyping, allowing for broad investigations into the risk and mechanisms of these neurological, neurodevelopmental, and psychiatric conditions. This resource consists of 9,663 donors with array-based genotyping and 9,543 donors with whole-genome sequencing completed. The clinical diagnoses of these donors include 148 central nervous system diseases clustered in 15 broad categories by ICD-10 coding. These donors were collected by six repositories comprising the NIH NeuroBioBank, with an average participant age of 60 years. While primarily older individuals of European descent, the cohort also contains younger donors and individuals from non-European backgrounds. Variants detected by Whole-Genome Sequencing (WGS) were called genome-wide and annotated to describe their functional impact, resulting in 171,121,209 unique mutations and 1,078,774 non-silent mutations. This whole-genome resource has been made available in the NIMH Data Archive ( nda.nih.gov ) and accompanying deep demographic and phenotypic descriptions are available at the NeuroBioBank Portal ( neurobiobank.nih.gov ). To illustrate an application of this resource, we replicated the strong association observed in previous studies between pathogenic CAG repeat expansions in the HTT gene with the clinical diagnosis of Huntington’s disease.

Research Square 2024-08-30 Preprint (No Snippets API) Xie G, Chen H, Xie L, Wang K.
Show Full Abstract

<title>Abstract</title> <p>Multipath TCP (MPTCP) can aggregate the bandwidth of all connected paths, providing high data rate and transmission reliable service in wireless networks, especially for video streaming. To avoid network congestion and be fair to TCP users, extending the single-path congestion control to multipath has become a hot research issue in MPTCP. Because coupled multipath congestion control dominates existing MPTCP strategies, we analyze four classic coupled congestion control algorithms from the perspective of bandwidth competition, indicating that they can only achieve trade-off between the aggregate throughput and fairness on the shared bottleneck. Some shared bottleneck detection based MPTCP congestion control strategies fully utilize the available bandwidth on non-bottleneck links, but being unfair to legacy TCP compared to the coupled algorithms. This motives us to propose a new Shared bottleneck Detection based Decoupled Congestion Control (SD-DCC) scheme, which includes a more applicable shared bottleneck detection method and more suitable decoupled congestion control strategy in consideration of the wireless link conditions. The performance of our proposed SD-DCC scheme is evaluated through extensive simulations, which demonstrates that the SD-DCC scheme achieves better transmission performance to meet the requirements of video streaming services, while keeping fairness to legacy TCP users.</p>

SOX6
Also flagged:organophosphatewatermethylationmethylcytosinephosphoguanine
Journal Article 2024-08-29 ✓ 2 Snippets Negi CK, Bláhová L, Phan A, Bajard L, Blaha L.
In-Text Gene Mentions

…ACACA, PLIN2, CRLS1,SOX6, GSK3β, and TGFβ2,…

…TPHP exposure includedSOX6[SRY (sex determining…

Show Full Abstract

Emerging environmental contaminants, organophosphate flame retardants (OPFRs), pose significant threats to ecosystems and human health. Despite numerous studies reporting the toxic effects of OPFRs, research on their epigenetic alterations remains limited. In this study, we investigated the effects of exposure to 2-ethylhexyl diphenyl phosphate (EHDPP), tricresyl phosphate (TMPP), and triphenyl phosphate (TPHP) on DNA methylation patterns during zebrafish embryonic development. We assessed general toxicity and morphological changes, measured global DNA methylation and hydroxymethylation levels, and evaluated DNA methyltransferase (DNMT) enzyme activity, as well as mRNA expression of DNMTs and ten-eleven translocation (TET) methylcytosine dioxygenase genes. Additionally, we analyzed genome-wide methylation patterns in zebrafish larvae using reduced-representation bisulfite sequencing. Our morphological assessment revealed no general toxicity, but a statistically significant yet subtle decrease in body length following exposure to TMPP and EHDPP, along with a reduction in head height after TPHP exposure, was observed. Eye diameter and head width were unaffected by any of the OPFRs. There were no significant changes in global DNA methylation levels in any exposure group, and TMPP showed no clear effect on DNMT expression. However, EHDPP significantly decreased only DNMT1 expression, while TPHP exposure reduced the expression of several DNMT orthologues and TETs in zebrafish larvae, leading to genome-wide aberrant DNA methylation. Differential methylation occurred primarily in introns (43%) and intergenic regions (37%), with 9% and 10% occurring in exons and promoter regions, respectively. Pathway enrichment analysis of differentially methylated region-associated genes indicated that TPHP exposure enhanced several biological and molecular functions corresponding to metabolism and neurological development. KEGG enrichment analysis further revealed TPHP-mediated potential effects on several signaling pathways including TGFβ, cytokine, and insulin signaling. This study identifies specific changes in DNA methylation in zebrafish larvae after TPHP exposure and brings novel insights into the epigenetic mode of action of TPHP.

SERPINC1
Also flagged:extracellularvimentinsepsiscoagulopathyantibodiesinfection
Journal Article 2024-08-29 ✓ 1 Snippet Martinez-Vargas M, Saini A, Pradhan S, Gardea L, Stoll B, Didelija IC, Vijayan KV, Nguyen TC, Cruz MA.
In-Text Gene Mentions

…activities of FV,ATIII, Protein C and…

Show Full Abstract

<h4>Background</h4>Sepsis can lead to coagulopathy and microvascular thrombosis. Prior studies, including ours, reported an increased level of extracellular vimentin in blood derived from septic patients. Moreover, we identified the contribution of extracellular vimentin to fibrin formation and to the fibrin clot structure ex vivo in plasma from septic patients. Here, we tested the status of plasma vimentin and its impact on fibrin clots using our recently described swine model of methicillin-resistant Staphylococcus aureus (MRSA) sepsis-induced coagulopathy.<h4>Results</h4>We employed ELISA, size-exclusion chromatography, vimentin antibodies, confocal microscopy, and turbidity assays on piglet plasma obtained at pre- and post-MRSA inoculation. Plasma vimentin level at 70 h post-MRSA inoculation was on average twofold higher compared to pre-infection (0 h) level in the same animal. Anti-vimentin antibody effectively reduced fibrin formation ex vivo and increased porosity in the fibrin clot structure generated from septic piglet plasma. In contrast to plasma at 0 h, the size-exclusion chromatography revealed that phosphorylated vimentin was in-complex with fibrinogen in septic piglet plasma.<h4>Conclusions</h4>Thus, our swine model of sepsis-induced coagulopathy, reproduced increased extracellular circulating vimentin and subsequent potentiation of fibrin formation, often observed in septic patient. These outcomes validate the use of large animal models to investigate the dysregulated host immune response to infection leading to coagulopathy, and to develop new therapies for sepsis-induced disseminated microvascular thrombosis.

HFE
Also flagged:Tannic AcidFerroptosisIronKidney Dysfunctiondeathlipid
Journal Article 2024-08-29 ✓ 1 Snippet Taufani IP, Tasminatun S, Harimurti S, Yang LY, Huang CY, Situmorang JH.
In-Text Gene Mentions

…and conditions likehemochromatosis.…

Show Full Abstract

Iron toxicity intricately links with ferroptosis, a unique form of cell death, and is significantly influenced by lipid peroxidation. Despite its critical role in various diseases and drug development, the association between iron toxicity and ferroptosis remains relatively unexplored. Accidental iron ingestion has emerged as a growing concern, resulting in a spectrum of symptoms ranging from gastrointestinal discomfort to severe outcomes, including mortality. This research introduces tannic acid (TA), which contains numerous phenol groups, as a powerful antiferroptotic agent. In male Wistar rats, even a modest dose of TA (7.5 mg/kg) significantly curtailed thiobarbituric acid reactive substances (TBARS), a well-established indicator of lipid peroxidation, and mitigated iron accumulation induced by ferrous sulfate (FeSO<sub>4</sub>) in the liver and kidney. The evidence supporting TA's protective function against iron-triggered liver and kidney dysfunction was substantiated by assessing specifically the levels of blood urea nitrogen (BUN) and alanine aminotransferase (ALT). In cell models using ferroptosis inducers such as iron-salophene (FeSP) and RAS-selective lethal 3 (RSL3), tannic acid (TA) exhibited superior protective capabilities compared to the traditional iron chelator, deferoxamine (DFO). Nrf2 and HO-1, regulators of antioxidant defense genes, are implicated in controlling ferroptosis. The expression of Nrf2 and HO-1 increased with TA treatment in the presence of FeSP, indicating their role in reducing lipid ROS levels. Additionally, TA significantly reduced the heightened levels of COX2, a marker associated with ferroptosis. In summary, the remarkable antiferroptosis activity of TA is likely due to its combined iron-chelating and antioxidant properties. With its safety profile for oral consumption, TA may offer benefits in cases of accidental iron ingestion and conditions like hemochromatosis.

Also flagged:Amino Acidspeptideselenocysteinepyrrololysinepost-translational modificationsprotein synthesis
Journal Article 2024-08-29 No Snippets Niu W, Guo J.
Show Full Abstract

Over the past two decades, genetic code expansion (GCE)-enabled methods for incorporating noncanonical amino acids (ncAAs) into proteins have significantly advanced the field of synthetic biology while also reaping substantial benefits from it. On one hand, they provide synthetic biologists with a powerful toolkit to enhance and diversify biological designs beyond natural constraints. Conversely, synthetic biology has not only propelled the development of ncAA incorporation through sophisticated tools and innovative strategies but also broadened its potential applications across various fields. This Review delves into the methodological advancements and primary applications of site-specific cellular incorporation of ncAAs in synthetic biology. The topics encompass expanding the genetic code through noncanonical codon addition, creating semiautonomous and autonomous organisms, designing regulatory elements, and manipulating and extending peptide natural product biosynthetic pathways. The Review concludes by examining the ongoing challenges and future prospects of GCE-enabled ncAA incorporation in synthetic biology and highlighting opportunities for further advancements in this rapidly evolving field.

SUDS3
Also flagged:chromatinheterochromatintranscription factorbindingeuchromatinhistone
Journal Article 2024-08-29 ✓ 2 Snippets Bergwell M, Park J, Kirkland JG.
In-Text Gene Mentions

…loss of thepolycomb repressiverepressive-2 H3K27me3 histone…

…histone mark andpolycomb repressive-1repressive-1 and repressive-2…

Show Full Abstract

Chromatin regulators alter the physical properties of chromatin to make it more or less permissive to transcription by modulating another protein's access to a specific DNA sequence through changes in nucleosome occupancy or histone modifications at a particular locus. Mammalian SWI/SNF complexes are a group of ATPase-dependent chromatin remodelers. In mouse embryonic stem cells, there are three primary forms of mSWI/SNF: canonical BAF (cBAF), polybromo-associated BAF (pBAF), and GLTSCR-associated BAF (gBAF). <i>Nkx2-9</i> is bivalent, meaning nucleosomes at the locus have active and repressive modifications. In this study, we used unique BAF subunits to recruit each of the three complexes to <i>Nkx2-9</i> using dCas9-mediated inducible recruitment (FIRE-Cas9). We show that recruitment of cBAF complexes leads to a significant loss of the polycomb repressive-2 H3K27me3 histone mark and polycomb repressive-1 and repressive-2 complex proteins, whereas gBAF and pBAF do not. Moreover, nucleosome occupancy alone cannot explain the loss of these marks. Our results demonstrate that cBAF has a unique role in the direct opposition of polycomb-associated histone modifications that gBAF and pBAF do not share.

Also flagged:LRRC8Aanion channels
Journal Article 2024-08-29 No Snippets Carpanese V, Festa M, Prosdocimi E, Bachmann M, Sadeghi S, Bertelli S, Stein F, Velle A, Abdel-Salam MAL, Romualdi C, Pusch M, Checchetto V.
Show Full Abstract

No abstract available.

SOX6
Also flagged:chondrocyte proliferationPregestational diabetes mellitusbone formationhyperglycemiaAdamts5Col12a1
Journal Article 2024-08-29 ✓ 1 Snippet Qian F, Chen X, Wang S, Zhong Y, Liu M, Wang G, Yang X, Cheng X.
In-Text Gene Mentions

…and its co-factorSOX6, have been found…

Show Full Abstract

Pregestational diabetes mellitus (PGDM) has an impact on fetal bone formation, but the underlying mechanism is still obscure. Although miRNAs have been extensively investigated throughout bone formation, their effects on fetal bone development caused by PGDM still need clarification. This study intends to examine the mechanism by which hyperglycemia impairs the bone formation of offspring via miR-322-5p (miR-322). In this study, miR-322 was selected by systemically screening utilizing bioinformatics and subsequent validation experiments. Using streptozotocin (STZ)-induced diabetic mice and ATDC5 cell lines, we found that miR-322 was abundantly expressed in the proliferative and hypertrophic zones of the growth plate, and its expression pattern was disturbed in the presence of hyperglycemia, suggesting that miR-322 is involved in the chondrocyte proliferation and differentiation in absence/presence of hyperglycemia. This observation was proved by manipulating miR-322 expression in ATDC5 cells by transfecting mimic and inhibitor of miR-322. Furthermore, Adamts5, Col12a1, and Cbx6 were identified as the potential target genes of miR-322, verified by the co-transfection of miR-322 inhibitor and the siRNAs, respectively. The evaluation criteria are the chondrocyte proliferation and differentiation and their relevant key gene expressions (proliferation: Sox9 and PthIh; differentiation: Runx2 and Col10a1) after manipulating the gene expressions in ATDC5 cells. This study revealed the regulative role miR-322 on chondrocyte proliferation and differentiation of growth plate by targeting Adamts5, Col12a1, and Cbx6 in hyperglycemia during pregnancy. This translational potential represents a promising avenue for advancing our understanding of bone-related complications in diabetic pregnancy and mitigating bone deficiencies in diabetic pregnant individuals, improving maternal and fetal outcomes.

Also flagged:proteasomescytoplasmicAutophagyautophagosomeslysosomesdegradation
Journal Article 2024-08-29 No Snippets Park SJ, Son SM, Barbosa AD, Wrobel L, Stamatakou E, Squitieri F, Balmus G, Rubinsztein DC.
Show Full Abstract

Autophagy is a conserved pathway where cytoplasmic contents are engulfed by autophagosomes, which then fuse with lysosomes enabling their degradation. Mutations in core autophagy genes cause neurological conditions, and autophagy defects are seen in neurodegenerative diseases such as Parkinson's disease and Huntington's disease. Thus, we have sought to understand the cellular pathway perturbations that autophagy-perturbed cells are vulnerable to by seeking negative genetic interactions such as synthetic lethality in autophagy-null human cells using available data from yeast screens. These revealed that loss of proteasome and nuclear pore complex components cause synergistic viability changes akin to synthetic fitness loss in autophagy-null cells. This can be attributed to the cytoplasm-to-nuclear transport of proteins during autophagy deficiency and subsequent degradation of these erstwhile cytoplasmic proteins by nuclear proteasomes. As both autophagy and cytoplasm-to-nuclear transport are defective in Huntington's disease, such cells are more vulnerable to perturbations of proteostasis due to these synthetic interactions.

NEGR1HTT
Also flagged:Neurocognitive Disorderschromosomebrain disordersautism spectrum disorderschizophreniadevelopmental delay
Journal Article 2024-08-29 ✓ 2 Snippets Rahaie Z, Rabiee HR, Alinejad-Rokny H.
In-Text Gene Mentions

…45-kb deletion ofNEGR1with body mass…

…expansion occurs inHTTgene.…

Show Full Abstract

<h4>Background</h4>Copy number variants (CNVs) have become increasingly instrumental in understanding the etiology of all diseases and phenotypes, including Neurocognitive Disorders (NDs). Among the well-established regions associated with ND are small parts of chromosome 16 deletions (16p11.2) and chromosome 15 duplications (15q3). Various methods have been developed to identify associations between CNVs and diseases of interest. The majority of methods are based on statistical inference techniques. However, due to the multi-dimensional nature of the features of the CNVs, these methods are still immature. The other aspect is that regions discovered by different methods are large, while the causative regions may be much smaller.<h4>Results</h4>In this study, we propose a regularized deep learning model to select causal regions for the target disease. With the help of the proximal [20] gradient descent algorithm, the model utilizes the group LASSO concept and embraces a deep learning model in a sparsity framework. We perform the CNV analysis for 74,811 individuals with three types of brain disorders, autism spectrum disorder (ASD), schizophrenia (SCZ), and developmental delay (DD), and also perform cumulative analysis to discover the regions that are common among the NDs. The brain expression of genes associated with diseases has increased by an average of 20 percent, and genes with homologs in mice that cause nervous system phenotypes have increased by 18 percent (on average). The DECIPHER data source also seeks other phenotypes connected to the detected regions alongside gene ontology analysis. The target diseases are correlated with some unexplored regions, such as deletions on 1q21.1 and 1q21.2 (for ASD), deletions on 20q12 (for SCZ), and duplications on 8p23.3 (for DD). Furthermore, our method is compared with other machine learning algorithms.<h4>Conclusions</h4>Our model effectively identifies regions associated with phenotypic traits using regularized deep learning. Rather than attempting to analyze the whole genome, CNVDeep allows us to focus only on the causative regions of disease.

B4GALT5
Also flagged:sialylationtumorangiogenesisovarian cancerdeathOC
Journal Article 2024-08-29 ✓ 5 Snippets Wu D, Sun LY, Chang XY, Zhang GM.
In-Text Gene Mentions

B4GALT5a sialylation-related genes…

B4GALT5, a gene associated…

…The expression ofB4GALT5was test by…

…the impact ofB4GALT5on growth and…

B4GALT5significantly promoted the…

Show Full Abstract

<h4>Background</h4>Ovarian cancer (OC) is the predominant primary tumor in the human reproductive system. Abnormal sialylation has a significant impact on tumor development, metastasis, immune evasion, angiogenesis, and treatment resistance. B4GALT5, a gene associated with sialylation, plays a crucial role in ovarian cancer, and may potentially affect clinicopathological characteristics and prognosis.<h4>Methods</h4>We conducted a comprehensive search across TIMER, GEPIA2, GeneMANIA, and Metascape to obtain transcription profiling data of ovarian cancer from The Cancer Genome Atlas (TCGA). The expression of B4GALT5 was test by immunohistochemistry. To investigate the impact of B4GALT5 on growth and programmed cell death in OC cells, we performed transwell assays and western blots.<h4>Results</h4>The presence of B4GALT5 was strongly associated with an unfavorable outcome in OC. B4GALT5 significantly promoted the proliferation of OC cells. Upon analyzing gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), it was discovered that B4GALT5 played a crucial role in the extracellular matrix, particularly in collagen-containing structures, and exhibited correlations with ECM-receptor interactions, transcriptional dysregulation in cancer, as well as the interleukin-1 receptor signaling pathway. Furthermore, there is a clear link between B4GALT5 and the tumor immune microenvironment in OC. Moreover, B4GALT5 exhibits favorable expression levels across various types of cancers, including CHOL, KIRC, STAD and UCES.<h4>Conclusion</h4>In conclusion, it is widely believed that B4GALT5 plays a pivotal role in the growth and progression of OC, with its heightened expression serving as an indicator of unfavorable outcomes. Moreover, B4GALT5 actively participates in shaping the cancer immune microenvironment within OC. This investigation has the potential to contribute significantly to a deeper understanding of the substantial involvement of B4GALT5 in human malignancies, particularly OCs.

LRRC7
Also flagged:Cancerlung cancerLung adenocarcinomaLUADnon-small cell lung cancerAging
Journal Article 2024-08-29 ✓ 1 Snippet Ru K, Cui L, Wu C, Tan XX, An WT, Wu Q, Ma YT, Hao Y, Xiao X, Bai J, Liu X, Xia XF, Zhao MQ.
In-Text Gene Mentions

…, SI ,LRRC7, and PAPPA2…

Show Full Abstract

<h4>Introduction</h4>The connection between aging and cancer is complex. Previous research has highlighted the association between the aging process of lung adenocarcinoma (LUAD) cells and the immune response, yet there remains a gap in confirming this through single-cell data validation. Here, we aim to develop a novel aging-related prognostic model for LUAD, and verify the alterations in the genome and immune microenvironment linked to cellular senescence.<h4>Methods</h4>We integrated a comprehensive collection of senescence genes from the GenAge and CellAge databases and employed the least absolute shrinkage and selection operator (LASSO) Cox analysis to construct and validate a novel prognostic model for LUAD. This model was then utilized to examine the relationship between aging, tumor somatic mutations, and immune cell infiltration. Additionally, we explored the heterogeneity of senescence and intercellular communication within the LUAD tumor microenvironment (TME) through single-cell transcriptomic data analysis.<h4>Results</h4>By exploring the expression profiles of 586 cellular senescence-related genes in 428 LUAD patients, we constructed an aging-related genes (ARGs) risk model included 10 ARGs and validated it as an independent prognostic predictor for LUAD patients. Notably, patients with low aging scores (LAS group) exhibited better survival, lower tumor mutation burden (TMB), lower somatic mutation frequency, lower tumor proliferation rate, and an immune activated phenotype compared to patients with high aging scores (HAS group). While the HAS group was enriched in tumor cells and showed a lower infiltration of CD8-CCR7, CD8- CXCL13, CD8-GNLY, FCGR3A NK cells, XCL1 NK cells, plasma cell (PC) and other immune subsets. Furthermore, the SPP1 and TENASCIN pathways, associated with tumor immune escape and tumor progression, were also enriched in the HAS group. Additionally, our study also indicated that senescence levels were heterogeneous in the LUAD tumor microenvironment (TME), especially with tumor cells in the LAS group showing higher age scores compared to those in the HAS group.<h4>Conclusions</h4>Collectively, our findings underscore that ARRS through ARGs serves as a robust biomarker for the prognosis in LUAD.

Also flagged:titaniumhydroxyapatitegelatincell proliferationsecreted phosphoprotein 1SPP1
Journal Article 2024-08-29 No Snippets Di Matteo V, Di Filippo MF, Ballarin B, Bonvicini F, Iaquinta MR, Panzavolta S, Mazzoni E, Cassani MC.
Show Full Abstract

In this study, zeolitic imidazolate framework 8 (ZIF-8) was coated on porous Ti6Al4V scaffolds, either bare or previously modified using hydroxyapatite (HA) or HA and gelatin (HAgel), via a growing single-step method in aqueous media using two contact times at 6 h and 24 h. The coated scaffolds termed ZIF-8@Ti, ZIF-8@HA/Ti, and ZIF-8@HAgel/Ti were characterized via scanning electron microscopy (SEM), powder X-ray diffraction (PXRD), attenuated total reflectance-Fourier transform infrared (ATR-FTIR), and molecular plasma-atomic emission spectroscopy (MP-AES). In order to assess the cell proliferation rate, the cytocompatibility of the scaffolds was evaluated in primary osteoblasts (hOBs) using alamarBlue assay, while the osteoconductivity was analyzed in hOBs using a real-time approach, evaluating the expression of secreted phosphoprotein 1 (SPP1). Osteopontin, which is the protein encoded by this gene, represents the major non-collagenous bone protein that binds tightly to HA. The scaffolds were shown to be non-cytotoxic based on hOB proliferation at all time points of analysis (24 h and 72 h). In hOB cultures, the scaffolds induced the upregulation of SPP1 with different fold changes. Some selected scaffolds were assayed <i>in vitro</i> for their antibacterial potential against <i>Staphylococcus epidermidis</i>; the scaffolds coated with ZIF-8 crystals, regardless of the presence of HA and gelatin, strongly inhibited bacterial adhesion to the materials and reduced bacterial proliferation in the culture medium, demonstrating the suitable release of ZIF-8 in a bioactive form. These experiments suggest that the innovative scaffolds, tested herein, provide a good microenvironment for hOB adhesion, viability, and osteoconduction with effective prevention of <i>S. epidermidis</i> adhesion.

DCC
Also flagged:CalretininDhh-creDhhcarbon dioxideisofluranePhosphate
Journal Article 2024-08-29 ✓ 1 Snippet Lefèvre MA, Godefroid Z, Soret R, Pilon N.
In-Text Gene Mentions

…The Netrin/DCCpathway is a…

Show Full Abstract

Previously focused primarily on enteric neurons, studies of the enteric nervous system (ENS) in both health and disease are now broadening to recognize the equally significant role played by enteric glial cells (EGCs). Commensurate to the vast array of gastrointestinal functions they influence, EGCs exhibit considerable diversity in terms of location, morphology, molecular profiles, and functional attributes. However, the mechanisms underlying this diversification of EGCs remain largely unexplored. To begin unraveling the mechanistic complexities of EGC diversity, the current study aimed to examine its spatiotemporal aspects in greater detail, and to assess whether the various sources of enteric neural progenitors contribute differentially to this diversity. Based on established topo-morphological criteria for categorizing EGCs into four main subtypes, our detailed immunofluorescence analyses first revealed that these subtypes emerge sequentially during early postnatal development, in a coordinated manner with the structural changes that occur in the ENS. When combined with genetic cell lineage tracing experiments, our analyses then uncovered a strongly biased contribution by Schwann cell-derived enteric neural progenitors to particular topo-morphological subtypes of EGCs. Taken together, these findings provide a robust foundation for further investigations into the molecular and cellular mechanisms governing EGC diversity.

Also flagged:hypothalamic amenorrheaamenorrheachronic anovulationsecretiongonadotropin-releasing hormonehypoestrogenism
Journal Article 2024-08-29 No Snippets Barbagallo F, Bosoni D, Perone V, Cucinella L, Dealberti D, Cannarella R, Calogero AE, Nappi RE.
Show Full Abstract

Functional hypothalamic amenorrhea (FHA) is a common cause of amenorrhea and chronic anovulation in adolescent girls and young women, diagnosed after excluding other organic causes. It is commonly associated with calorie restriction, excessive physical exercise, and psychosocial stress. These stressors alter the pulsatile secretion of gonadotropin-releasing hormone, leading to a chronic condition of hypoestrogenism and significant health consequences. Recent evidence has highlighted a genetic predisposition to FHA that could explain interindividual variability in stress response. Indeed, not all women experience FHA in response to stress. Rare variants in genes associated with idiopathic hypogonadotropic hypogonadism have been identified in women with FHA, suggesting that these mutations may contribute to an increased susceptibility of women to the trigger of stress exposure. FHA appears today as a complex disease resulting from the combination of genetic predisposition, environmental factors, and epigenetic changes. Furthermore, the genetic background of FHA allows for the hypothesis of a male counterpart. Despite the paucity of data, preliminary findings indicate that an equivalent condition of FHA exists in men, warranting further investigation. This narrative review aims to summarize the recent genetic evidence contributing to the pathophysiology of FHA and to raise awareness on a possible male counterpart.

HTT
Also flagged:HER2breast cancerLapatinibcancerkinaseEGFR
Journal Article 2024-08-29 ✓ 1 Snippet Karcini A, Mercier NR, Lazar IM.
In-Text Gene Mentions

…(YBX3, HMGB2, CTNNA1,HTT, GCLM, HSPA1B, DNAJA1,…

Show Full Abstract

<h4>Introduction</h4>Modern cancer treatment strategies aim at achieving cancer remission by using targeted and personalized therapies, as well as harnessing the power of the immune system to recognize and eradicate the cancer cells. To overcome a relatively short-lived response due to resistance to the administered drugs, combination therapies have been pursued.<h4>Objective</h4>The objective of this study was to use high-throughput data generation technologies such as mass spectrometry and proteomics to investigate the broader implications, and to expand the outlook, of such therapeutic approaches. Specifically, we investigated the systems-level response of a breast cancer cell line model to a mixture of kinase inhibitors that has not been adopted yet as a standard therapeutic regime.<h4>Methods</h4>Two critical pathways that sustain the growth and survival of cancer cells, EGFR and PI3K/AKT, were inhibited in SKBR3/HER2+ breast cancer cells with Lapatinib (Tyr kinase inhibitor) and Ipatasertib (Ser/Thr kinase inhibitor), and the landscape of the affected biological processes was investigated with proteomic technologies.<h4>Results</h4>Over 800 proteins matched by three unique peptide sequences were affected by exposing the cells to the drugs. The work corroborated the anti-proliferative activity of Lapatinib and Ipatasertib and uncovered a range of impacted cancer-supportive hallmark processes, among which immune response, adhesion, and migration emerged as particularly relevant to the ability of drugs to effectively suppress the proliferation and dissemination of cancer cells. Changes in the expression of key cancer drivers such as oncogenes, tumor suppressors, EMT and angiogenesis regulators underscored the inhibitory effectiveness of drugs on cancer proliferation. The supplementation of Lapatinib with Ipatasertib further affected additional transcription factors and proteins involved in gene expression, trafficking, DNA repair, and development of multidrug resistance. Furthermore, over fifty of the impacted proteins represent approved or investigational targets in the DrugBank database, which through their protein-protein interaction networks can inform the selection of effective therapeutic partners.<h4>Conclusion</h4>Altogether, the exposure of SKBR3/HER2+ cells to Lapatinib and Ipatasertib kinase inhibitors uncovered a broad plethora of yet untapped opportunities that can be further explored for enhancing the anti-cancer effects of each drug as well as of many other multi-drug therapies that target the EGFR/ERBB2 and PI3K/AKT pathways.

HFE
Also flagged:IronMetabolismIschemic StrokeIStransferrin receptorsTfR
Journal Article 2024-08-29 ✓ 1 Snippet Boinska J, Słomka A, Sury M, Wiszniewska M, Pisarek E, Żekanowska E.
In-Text Gene Mentions

…the hemochromatosis gene (HFE) protein, neogenin, and…

Show Full Abstract

The hemojuvelin-hepcidin regulatory axis may play a key role in the iron metabolism both systemically and locally. There is a pressing need to evaluate this tightly regulated network of iron parameters and their potential impact on the development of ischemic stroke (IS). We aimed to assess iron metabolism biomarkers in patients after IS, evaluating changes over time and considering their clinical features. We studied 45 patients diagnosed with IS. We assessed major iron metabolism parameters, such as hepcidin, soluble hemojuvelin (sHJV), soluble transferrin receptor (sTfR), and ferritin, using immunoenzymathic methods at two time points: on admission and on the 7th day post IS. We found increased ferritin levels on the 7th day post IS compared to admission, and this was observed in the entire study group (<i>p</i> = 0.03) and in the subgroup treated with thrombolysis (<i>p</i> = 0.02). The hepcidin levels, on the other hand, showed a significant decrease on the 7th day, though this difference was only evident in the entire study group (<i>p</i> = 0.04). We also discovered significantly elevated sHJV levels in patients with PACI stroke compared to other stroke locations, both on admission and on the 7th day post IS (<i>p</i> < 0.05). Significantly higher sHJV levels were observed in patients treated with thrombolysis compared to those receiving conventional treatment, regardless of the time point (<i>p</i> < 0.0001 and <i>p</i> = 0.0002, respectively). Our study revealed changes in the iron metabolism parameters during stroke. The patients with anterior cerebral infarction and those treated with thrombolysis presented significantly elevated sHJV levels.

Also flagged:Hepatocellular CarcinomaPathogenesistumorgene expressioncancerliver cancers
Journal Article 2024-08-29 No Snippets Mahboobnia K, Beveridge DJ, Yeoh GC, Kabir TD, Leedman PJ.
Show Full Abstract

Hepatocellular carcinoma (HCC) presents a significant global health burden, with alarming statistics revealing its rising incidence and high mortality rates. Despite advances in medical care, HCC treatment remains challenging due to late-stage diagnosis, limited effective therapeutic options, tumor heterogeneity, and drug resistance. MicroRNAs (miRNAs) have attracted substantial attention as key regulators of HCC pathogenesis. These small non-coding RNA molecules play pivotal roles in modulating gene expression, implicated in various cellular processes relevant to cancer development. Understanding the intricate network of miRNA-mediated molecular pathways in HCC is essential for unraveling the complex mechanisms underlying hepatocarcinogenesis and developing novel therapeutic approaches. This manuscript aims to provide a comprehensive review of recent experimental and clinical discoveries regarding the complex role of miRNAs in influencing the key hallmarks of HCC, as well as their promising clinical utility as potential therapeutic targets.

TNFSF4
Also flagged:lung adenocarcinomaLUADtumorcancerLung cancertumors
Journal Article 2024-08-29 ✓ 1 Snippet Chen R, Liu Y, Xie J.
In-Text Gene Mentions

…upregulation of LAG3,TNFSF4, and CD80 in…

Show Full Abstract

<h4>Objective</h4>This study aimed to predict the level of stemness index (mRNAsi) and survival prognosis of lung adenocarcinoma (LUAD) using pathomics model.<h4>Methods</h4>From The Cancer Genome Atlas (TCGA) database, 327 LUAD patients were randomly assigned to a training set (n = 229) and a validation set (n = 98) for pathomics model development and evaluation. PyRadiomics was used to extract pathomics features, followed by feature selection using the mRMR-RFE algorithm. In the training set, Gradient Boosting Machine (GBM) was utilized to establish a model for predicting mRNAsi in LUAD. The model's predictive performance was evaluated using ROC curves, calibration curves, and decision curve analysis (DCA). Prognostic analysis was conducted using Kaplan-Meier curves and cox regression. Additionally, gene enrichment analysis, tumor microenvironment analysis, and tumor mutational burden (TMB) analysis were performed to explore the biological mechanisms underlying the pathomics prediction model.<h4>Results</h4>Multivariable cox analysis (HR = 1.488, 95 % CI 1.012-2.187, P = 0.043) identified mRNAsi as a prognostic risk factor for LUAD. A total of 465 pathomics features were extracted from TCGA-LUAD histopathological images, and ultimately, the most representative 8 features were selected to construct the predictive model. ROC curves demonstrated the significant predictive value of the model for mRNAsi in both the training set (AUC = 0.769) and the validation set (AUC = 0.757). Calibration curves and Hosmer-Lemeshow goodness-of-fit test showed good consistency between the model's prediction of mRNAsi levels and the actual values. DCA indicated a good net benefit of the model. The prediction of mRNAsi levels by the pathomics model is represented using the pathomics score (PS). PS was strongly associated with the prognosis of LUAD (HR = 1.496, 95 % CI 1.008-2.222, P = 0.046). Signaling pathways related to DNA replication and damage repair were significantly enriched in the high PS group. Prediction of immune therapy response indicated significantly reduced Dysfunction in the high PS group (P < 0.001). The high PS group exhibited higher TMB values (P < 0.001).<h4>Conclusions</h4>The predictive model constructed based on pathomics features can forecast the mRNAsi and survival risk of LUAD. This model holds promise to aid clinical practitioners in identifying high-risk patients and devising more optimized treatment plans for patients by jointly employing therapeutic strategies targeting cancer stem cells (CSCs).

Also flagged:binge-eating disorderBEDeating disorderpathogenesispsychiatric disordersobesity
Journal Article 2024-08-29 No Snippets Schneider E, Leigh SJ, Lynch CMK, Hilbert A, Clarke G, Higgs S, Cryan JF.
Show Full Abstract

Binge-eating disorder (BED) is the most common eating disorder, but the mechanisms that underlie this disorder are still largely unknown. There is tentative evidence to suggest that the gut microbiota, which communicates to the brain via the gut-brain axis, plays a role in the pathogenesis of BED. However, more mechanistic research is urgently required to gain greater clarity and inform the development of superior management strategies. In this review, we sought to develop a new conceptual model that incorporates the gut microbiota to provide valuable guidance for future research in this area. In BED, the large quantities of hyper-palatable, energy-dense foods rapidly consumed reduces microbial diversity and their associated metabolites alongside promotions in microbial volatility and inflammation. These dietary-induced effects on the microbiota alter pathways implicated in BED including satiety, reward, impulsivity, and mood. The biological mechanisms underpinning the psychological effects include actions of microbial components and metabolites, alongside effects on the hypothalamic-pituitary-adrenal axis and the dopaminergic and serotonergic systems. Importantly, individual baseline characteristics such as genetics and environmental stressors can moderate the relationship between one's diet, the gut microbiota, and BED. A growing body of evidence suggests that microbiota-targeted interventions, so called psychobiotics, may affect these pathways to modulate brain and behaviour. While further research is necessary to test this hypothesis, the gut microbiota represents a novel avenue for future BED therapeutics.

Research Square 2024-08-29 Preprint (No Snippets API) Rodgers G, Liu W, Li H, Kumkhaek C, Zhu J.
Show Full Abstract

<title>Abstract</title> <p>Olfactomedin 4 (OLFM4) is a member of the olfactomedin domain-containing olfactomedin glycoprotein family and plays important roles in innate immunity, inflammation, and cancer. It exhibits increased expression in gastric cancer patient tissues and has been shown to regulate proliferation and apoptosis in gastric cancer cells. However, the molecular mechanism(s) underlying OLFM4’s role in gastric cancer remain unknown. In this study, we found that OLFM4 knock-down significantly inhibited YCC3 gastric cancer cell proliferation and induced G2/M cell cycle arrest. Yeast two-hybridization screening revealed that OLFM4 directly interacts with cyclin B1 interacting protein 1 (CCNB1IP1), an E3 ubiquitin protein ligase. In YCC3 cells, OLFM4 co-immunoprecipitated and colocalized with CCNB1IP1, and underwent cell cycle phase-specific nucleo-cytoplasmic shuttling. OLFM4 knockdown decreased both cyclin B1 protein levels and CDK1 activity in YCC3 cells. Screening of a cohort of OLFM4-targeted microRNAs (miRNAs) for their impact on cell proliferation identified several that significantly downregulated OLFM4 protein levels and inhibited YCC3 cell proliferation in vitro. Rescue experiments demonstrated that these miRNAs’ inhibitory effect on cell proliferation was partially related to their downregulation of OLFM4. When three of these miRNAs were individually administered intratumorally to nude mice bearing YCC3 cell xenografts, tumor growth was significantly inhibited when compared with tumors treated with a negative control miRNA. These results suggest that OLFM4 promotes cell cycle progression and cell proliferation in gastric cancer cells and may have utility as a therapeutic target in gastric adenocarcinoma.</p>

Research Square 2024-08-29 Preprint (No Snippets API) Bocquet A, Pagnier A, Boccon-gibod I, defendi F, Hardy G, Bouillet L.
Show Full Abstract

<title>Abstract</title> <p><bold>Background </bold>: When the diagnosis of HAE is known in a family and a child is born, the question of early diagnosis at birth arises. Indeed, the first attacks may appear as early as birth. The importance of early diagnosis comes up against biological issues: C1 Inhibitor (C1 INH) and C4 levels can be low at birth, generally in the range of 60 to 100% of adult reference values, due to the immaturity of the complement system. As most of complement proteins, their levels normalize after one year of life. We report the opposite case, in two newborns. <bold>Case presentation:</bold> A women with well documented hereditary angioedema type II C1Inh deficiency gave birth to 2 children 4 years apart. The 2 children had a functional C1Inh assay at 8 and 7 months of age respectively: the results showed a normal functional C1Inh level. A genetic investigation was nevertheless carried out, which revealed the presence of the mother’s mutation in both children. Monitoring of C1Inh function at 3 and 4 years of age finally showed a pathological reduction in C1Inh function. <bold>Conclusion </bold>: These cases lead us to recommend, for the early detection of children, genetic research of the mutation of the index parent in the child rather than the C1Inh assay</p>

medRxiv 2024-08-29 Preprint (No Snippets API) Samocha KE, Kartik Chundru V, Fu JM, Gardner EJ, Danecek P, Wigdor EM, Malawsky DS, Lindsay SJ, Campbell P, Singh T, Eberhardt RY, Gallone G, Wright CF, Martin HC, Firth HV, Hurles ME.
Show Full Abstract

While the role of de novo and recessively-inherited coding variation in risk for rare developmental disorders (DDs) has been well established, the contribution of damaging variation dominantly-inherited from parents is less explored. Here, we investigated the contribution of rare coding variants to DDs by analyzing 13,452 individuals with DDs, 18,613 of their family members, and 3,943 controls using a combination of family-based and case/control analyses. In line with previous studies of other neuropsychiatric traits, we found a significant burden of rare (allele frequency < 1×10 -5 ) predicted loss-of-function (pLoF) and damaging missense variants, the vast majority of which are inherited from apparently unaffected parents. These predominantly inherited burdens are strongest in DD-associated genes or those intolerant of pLoF variation in the general population, however we estimate that ∼10% of the excess of these variants in DD cases is found within the DD-associated genes, implying many more risk loci are yet to be identified. We found similar, but attenuated, burdens when comparing the unaffected parents of individuals with DDs to controls, indicating that parents have elevated risk of DDs due to these rare variants, which are overtransmitted to their affected children. We estimate that 6-8.5% of the population attributable risk for DDs are due to rare pLoF variants in those genes intolerant of pLoF variation in the general population. Finally, we apply a Bayesian framework to combine evidence from these analyses of rare, mostly-inherited variants with prior de novo mutation burden analyses to highlight an additional 25 candidate DD- associated genes for further follow up.

Preprints.org 2024-08-29 Preprint (No Snippets API) Torres ACP, Brito RN, Araújo WNd, Pedrette P, Alves DCC, Teixeira AIP, Gontijo CC, Romero GAS, Gurgel-Gonçalves R, Ramalho WM.
Show Full Abstract

<h4>Introduction: </h4> Healthcare workers (HCW) are at higher risk of SARS-CoV-2 infection. Viral surveillance for early detection of COVID-19 is a critical strategy to understand the infection dynamics in this population and to prevent transmission. The study examines SARS-CoV-2 infection and reinfection among HCW vaccinated against COVID-19 who are employed at a primary health care unit serving a disenfranchised community of Brazil. <h4>Methods:</h4> The study was conducted in Cidade Estrutural, Federal District of Brazil, between February and October 2021. Participants were interviewed and provided samples. A prospective open cohort study was used to analyze the frequency of SARS-CoV-2 infection and reinfection. Nasopharyngeal and peripheral blood samples were collected from workers presenting with flu-like symptoms and subjected to RT-qPCR and serological testing (IgM and IgG chemiluminescence). The frequencies of infection and reinfection (RT-qPCR positive results 90 days after the infection) were calculated along with their respective confidence intervals (95%CI). <h4>Results:</h4> Of the 128 workers, 61 (47.65%; CI: 39.19-56.25) reported probable SARS-CoV-2 infection before vaccination. Of these, 50 (39.06%; CI: 31.04-47.71) had SARS-CoV-2 infection after vaccination, confirmed by molecular tests. Reinfection was identified in seven workers (14.00%; CI: 6.95-26.18), based on the 90-day interval between results. The serological data from the 128 workers during the cohort indicated that 68 had IgG antibodies (53.12%; CI: 44.5-61.5) and 46 had IgM antibodies (35.93%; CI: 28.14-44.54) against SARS-CoV-2. SARS-CoV-2 infection was common in community health workers (CHW, 56%), registered nurses (50%), and licensed practice nurses (33%). Following the COVID-19 vaccination, the percentage of infections among CHW decreased from 47.83% to 4.35%. <h4>Conclusion:</h4> These results demonstrate that (i) approximately 40% of the workers were infected with SARS-CoV-2 in 2021 and (ii) reinfections confirmed by RT-qPCR occurred in 14% of the HCW after vaccination. The results provide valuable insights into the circulation of SARS-CoV-2 among HCW in a primary care unit serving a minoritized community.

DCC
Also flagged:metamorphosisossificationTUBB3MYH3TBXTcorticosteroid stress hormones
Journal Article 2024-08-28 ✓ 1 Snippet Senevirathne G, Shubin NH.
In-Text Gene Mentions

…, POUF42 andDCC) that are…

Show Full Abstract

Evolutionary novelties entail the origin of morphologies that enable new functions. These features can arise through changes to gene function and regulation. One key novelty is the fused rod at the end of the vertebral column in anurans, the urostyle. This feature is composed of a coccyx and a hypochord, both of which ossify during metamorphosis. To elucidate the genetic basis of these features, we used laser capture microdissection of these tissues and did RNA-seq and ATAC-seq at three developmental stages in tadpoles of <i>Xenopus tropicalis</i>. RNA-seq reveals that the coccyx and hypochord have two different molecular signatures. Neuronal (<i>TUBB3</i>) and muscle markers (<i>MYH3</i>) are upregulated in coccygeal tissues, whereas T-box genes (<i>TBXT</i>, <i>TBXT.2</i>), corticosteroid stress hormones (<i>CRCH.1</i>) and matrix metallopeptidases (<i>MMP1</i>, <i>MMP8</i> and <i>MMP13</i>) are upregulated in the hypochord. ATAC-seq reveals potential regulatory regions that are observed in proximity to candidate genes that regulate ossification identified from RNA-seq. Even though an ossifying hypochord is only present in anurans, this ossification between the vertebral column and the notochord resembles a congenital vertebral anomaly seen prenatally in humans caused by an ectopic expression of the <i>TBXT</i>/<i>TBXT.2</i> gene. This work opens the way to functional studies that can elucidate anuran <i>bauplan</i> evolution.

Also flagged:rose bengalacanthamoeba keratitiscorneal ulcersInfectionInfectious keratitisinfectious corneal ulcers
Journal Article 2024-08-28 No Snippets Prajna NV, Lalitha P, Sharma S, de Freitas D, Höfling-Lima A, Varnado N, Abdelrahman S, Cavallino V, Arnold BF, Lietman TM, Rose-Nussbaumer J.
Show Full Abstract

<h4>Background</h4>Infectious keratitis secondary to fungus or acanthamoeba often has a poor outcome despite receiving the best available medical therapy. In vitro rose bengal photodynamic therapy (RB-PDT) appears to be effective against fungal and acanthamoeba isolates (Atalay HT et al., Curr Eye Res 43:1322-5, 2018, Arboleda A et al. Am J Ophthalmol 158:64-70, 2014). In one published series, RB-PDT reduced the need for therapeutic penetrating keratoplasty in severe bacterial, fungal, and acanthamoeba keratitis not responsive to medical therapy.<h4>Methods</h4>This international, randomized, sham and placebo controlled 2-arm clinical trial randomizes patients with smear positive fungal and acanthamoeba and smear negative corneal ulcers in a 1:1 fashion to one of two treatment arms: 1) topical antimicrobial plus sham RB-PDT or 2) topical antimicrobial plus RB-PDT.<h4>Discussion</h4>We anticipate that RB-PDT will improve best spectacle-corrected visual acuity and also reduce complications such as corneal perforation and the need for therapeutic penetrating keratoplasty. This study will comply with the NIH Data Sharing Policy and Policy on the Dissemination of NIH-Funded Clinical Trial Information and the Clinical Trials Registration and Results Information Submission rule. Our results will be disseminated via ClinicalTrials.gov website, meetings, and journal publications. Our data will also be available upon reasonable request.<h4>Trial registration</h4>NCT, NCT05110001 , Registered on November 5, 2021.

SHISA6
Also flagged:dementiamethylationcognitive impairmentsAlzheimer's diseaseParkinson's diseasecognitive impairment
Journal Article 2024-08-28 ✓ 2 Snippets Koetsier J, Cavill R, Reijnders R, Harvey J, Homann J, Kouhsar M, Deckers K, Köhler S, Eijssen LMT, van den Hove DLA, Demuth I, Düzel S, Alzheimer's Disease Neuroimaging Initiative, Smith RG, Smith AR, Burrage J, Walker EM, Shireby G, Hannon E, Dempster E, Frayling T, Mill J, Dobricic V, Johannsen P, Wittig M, Franke A, Vandenberghe R, Schaeverbeke J, Freund-Levi Y, Frölich L, Scheltens P, Teunissen CE, Frisoni G, Blin O, Richardson JC, Bordet R, Engelborghs S, de Roeck E, Martinez-Lage P, Tainta M, Lleó A, Sala I, Popp J, Peyratout G, Verhey F, Tsolaki M, Andreasson U, Blennow K, Zetterberg H, Streffer J, Vos SJB, Lovestone S, Visser PJ, Lill CM, Bertram L, Lunnon K, Pishva E.
In-Text Gene Mentions

…DLG, NLGN1, SHANK3,SHISA6, SHISA7, SLC7A11, and…

…57 SHANK3, 58SHISA6, 59 SHISA7, 60…

Show Full Abstract

<h4>Introduction</h4>The established link between DNA methylation and pathophysiology of dementia, along with its potential role as a molecular mediator of lifestyle and environmental influences, positions blood-derived DNA methylation as a promising tool for early dementia risk detection.<h4>Methods</h4>In conjunction with an extensive array of machine learning techniques, we employed whole blood genome-wide DNA methylation data as a surrogate for 14 modifiable and non-modifiable factors in the assessment of dementia risk in independent dementia cohorts.<h4>Results</h4>We established a multivariate methylation risk score (MMRS) for identifying mild cognitive impairment cross-sectionally, independent of age and sex (P = 2.0 × 10<sup>-3</sup>). This score significantly predicted the prospective development of cognitive impairments in independent studies of Alzheimer's disease (hazard ratio for Rey's Auditory Verbal Learning Test (RAVLT)-Learning = 2.47) and Parkinson's disease (hazard ratio for MCI/dementia<sub> </sub>= 2.59).<h4>Discussion</h4>Our work shows the potential of employing blood-derived DNA methylation data in the assessment of dementia risk.<h4>Highlights</h4>We used whole blood DNA methylation as a surrogate for 14 dementia risk factors. Created a multivariate methylation risk score for predicting cognitive impairment. Emphasized the role of machine learning and omics data in predicting dementia. The score predicts cognitive impairment development at the population level.

Also flagged:fluoroquinolonessulfonamidestylosinoligonucleotideantibodiesantibody
Journal Article 2024-08-28 No Snippets Guercetti J, Pascual N, Aviñó A, Eritja R, Salvador JP, Marco MP.
Show Full Abstract

The presence of antibiotic residues in cow's milk entails high risk for consumers, the dairy industry, and the environment. Therefore, the development of highly specific and sensitive screening tools for the rapid and cost-effective identification of traces of these compounds is urgently needed. A multiplexed screening platform utilizing DNA-directed immobilization (DDI) was developed aiming to detect three classes of antibiotic residues (fluoroquinolones, sulfonamides, and tylosin) prevalently found in milk. Throughout this work, each oligonucleotide sequence was conjugated to a different hapten molecule, while the three complementary strands were immobilized in 24 independent microarray chips on a single glass slide. First, the array was incubated with the pool of hapten-oligonucleotide conjugate site encoded the signal through DNA hybridization. Next, commercial milk samples were incubated with the cocktail of monoclonal antibodies following a secondary fluorophore-labeled antibody which was required for fluorescent readout. Direct sample detection was achieved in milk diluting 20 times in assay buffer. The limits of detection (LODs) reached were 1.43 µg kg<sup>-1</sup>, 1.67 µg kg<sup>-1</sup>, and 0.89 µg kg<sup>-1</sup> for TYLA, STZ, and CIP, respectively, which represented in raw milk 7.15 µg kg<sup>-1</sup>, 8.35 µg kg<sup>-1</sup>, and 4.45 µg kg<sup>-1</sup> for TYLA, STZ, and CIP, respectively, that are below the EU regulatory limits. Cross-reactivity profiles were evaluated against the family of structurally related antibiotics in order to demonstrate the capability to detect antibiotics from the same family of compounds. A pre-validation study was performed by spiking 20 blind samples above and below the maximum residue limits established by the EU guidelines. The system was successfully implemented towards randomized sample classification as compliant or non-compliant. The proposed DDI-based immunoarray provides a fast and cost-effective alternative to obtain semi-quantitative information about the presence of three veterinary residues simultaneously in milk samples.

Also flagged:Autoimmune diseasesmultiple sclerosisMSPR domain zinc finger protein 1PRDM1-Sserum and glucocorticoid-regulated kinase 1
Journal Article 2024-08-28 No Snippets Sumida TS, Lincoln MR, He L, Park Y, Ota M, Oguchi A, Son R, Yi A, Stillwell HA, Leissa GA, Fujio K, Murakawa Y, Kulminski AM, Epstein CB, Bernstein BE, Kellis M, Hafler DA.
Show Full Abstract

Autoimmune diseases, among the most common disorders of young adults, are mediated by genetic and environmental factors. Although CD4<sup>+</sup>FOXP3<sup>+</sup> regulatory T cells (T<sub>regs</sub>) play a central role in preventing autoimmunity, the molecular mechanism underlying their dysfunction is unknown. Here, we performed comprehensive transcriptomic and epigenomic profiling of T<sub>regs</sub> in the autoimmune disease multiple sclerosis (MS) to identify critical transcriptional programs regulating human autoimmunity. We found that up-regulation of a primate-specific short isoform of PR domain zinc finger protein 1 (PRDM1-S) induces expression of serum and glucocorticoid-regulated kinase 1 (SGK1) independent from the evolutionarily conserved long <i>PRDM1</i>, which led to destabilization of forkhead box P3 (FOXP3) and T<sub>reg</sub> dysfunction. This aberrant <i>PRDM1-S/SGK1</i> axis is shared among other autoimmune diseases. Furthermore, the chromatin landscape profiling in T<sub>regs</sub> from individuals with MS revealed enriched activating protein-1 (AP-1)/interferon regulatory factor (IRF) transcription factor binding as candidate upstream regulators of <i>PRDM1-S</i> expression and T<sub>reg</sub> dysfunction. Our study uncovers a mechanistic model where the evolutionary emergence of <i>PRDM1-S</i> and epigenetic priming of AP-1/IRF may be key drivers of dysfunctional T<sub>regs</sub> in autoimmune diseases.

OLFM4
Also flagged:tumorMYCprostate cancercanceroncogenetumour
Journal Article 2024-08-28 ✓ 1 Snippet Graham MK, Wang R, Chikarmane R, Abel B, Vaghasia A, Gupta A, Zheng Q, Hicks J, Sysa-Shah P, Pan X, Castagna N, Liu J, Meyers J, Skaist A, Zhang Y, Rubenstein M, Schuebel K, Simons BW, Bieberich CJ, Nelson WG, Lupold SE, DeWeese TL, De Marzo AM, Yegnasubramanian S.
In-Text Gene Mentions

…( PIGR, LCN2,OLFM4) to a…

Show Full Abstract

How prostate cancer cells and their precursors mediate changes in the tumor microenvironment (TME) to drive prostate cancer progression is unclear, in part due to the inability to longitudinally study the disease evolution in human tissues. To overcome this limitation, we perform extensive single-cell RNA-sequencing (scRNA-seq) and molecular pathology of the comparative biology between human prostate cancer and key stages in the disease evolution of a genetically engineered mouse model (GEMM) of prostate cancer. Our studies of human tissues reveal that cancer cell-intrinsic activation of MYC signaling is a common denominator across the well-known molecular and pathological heterogeneity of human prostate cancer. Cell communication network and pathway analyses in GEMMs show that MYC oncogene-expressing neoplastic cells, directly and indirectly, reprogram the TME during carcinogenesis, leading to a convergence of cell state alterations in neighboring epithelial, immune, and fibroblast cell types that parallel key findings in human prostate cancer.

Also flagged:TuberculosisIFNγpulmonary tuberculosisTNFinflammatory responsesrespiratory burst
Journal Article 2024-08-28 No Snippets Arias AA, Neehus AL, Ogishi M, Meynier V, Krebs A, Lazarov T, Lee AM, Arango-Franco CA, Yang R, Orrego J, Corcini Berndt M, Rojas J, Li H, Rinchai D, Erazo-Borrás L, Han JE, Pillay B, Ponsin K, Chaldebas M, Philippot Q, Bohlen J, Rosain J, Le Voyer T, Janotte T, Amarajeeva K, Soudée C, Brollo M, Wiegmann K, Marquant Q, Seeleuthner Y, Lee D, Lainé C, Kloos D, Bailey R, Bastard P, Keating N, Rapaport F, Khan T, Moncada-Vélez M, Carmona MC, Obando C, Alvarez J, Cataño JC, Martínez-Rosado LL, Sanchez JP, Tejada-Giraldo M, L'Honneur AS, Agudelo ML, Perez-Zapata LJ, Arboleda DM, Alzate JF, Cabarcas F, Zuluaga A, Pelham SJ, Ensser A, Schmidt M, Velásquez-Lopera MM, Jouanguy E, Puel A, Krönke M, Ghirardello S, Borghesi A, Pahari S, Boisson B, Pittaluga S, Ma CS, Emile JF, Notarangelo LD, Tangye SG, Marr N, Lachmann N, Salvator H, Schlesinger LS, Zhang P, Glickman MS, Nathan CF, Geissmann F, Abel L, Franco JL, Bustamante J, Casanova JL, Boisson-Dupuis S.
Show Full Abstract

Severe defects in human IFNγ immunity predispose individuals to both Bacillus Calmette-Guérin disease and tuberculosis, whereas milder defects predispose only to tuberculosis<sup>1</sup>. Here we report two adults with recurrent pulmonary tuberculosis who are homozygous for a private loss-of-function TNF variant. Neither has any other clinical phenotype and both mount normal clinical and biological inflammatory responses. Their leukocytes, including monocytes and monocyte-derived macrophages (MDMs) do not produce TNF, even after stimulation with IFNγ. Blood leukocyte subset development is normal in these patients. However, an impairment in the respiratory burst was observed in granulocyte-macrophage colony-stimulating factor (GM-CSF)-matured MDMs and alveolar macrophage-like (AML) cells<sup>2</sup> from both patients with TNF deficiency, TNF- or TNFR1-deficient induced pluripotent stem (iPS)-cell-derived GM-CSF-matured macrophages, and healthy control MDMs and AML cells differentiated with TNF blockers in vitro, and in lung macrophages treated with TNF blockers ex vivo. The stimulation of TNF-deficient iPS-cell-derived macrophages with TNF rescued the respiratory burst. These findings contrast with those for patients with inherited complete deficiency of the respiratory burst across all phagocytes, who are prone to multiple infections, including both Bacillus Calmette-Guérin disease and tuberculosis<sup>3</sup>. Human TNF is required for respiratory-burst-dependent immunity to Mycobacterium tuberculosis in macrophages but is surprisingly redundant otherwise, including for inflammation and immunity to weakly virulent mycobacteria and many other infectious agents.

Also flagged:obesitymetabolic syndromedyslipidemianonalcoholic fatty liver diseaseglucose homeostasisGene Expression
Journal Article 2024-08-28 No Snippets Mahjoubin-Tehran M, Atkin SL, Jamialahmadi T, Kroh M, Eid AH, Almahmeed W, Sahebkar A.
Show Full Abstract

Bariatric surgery is an approved treatment for obesity that consistently improves metabolic syndrome, with well-documented beneficial effects on dyslipidemia, cardiovascular risk, nonalcoholic fatty liver disease and glucose homeostasis. In this study, we determined the differential expression genes in three periods after bariatric surgery: short-term (4-months), medium-term (1- and 2-years), and long-term (5-years) periods. Two microarray profiles were downloaded from the Gene Expression Omnibus (GEO) database. Differentially expressed genes (DEGs) were identified by comparing the expression of adipose tissue genes before surgery compared to short, medium and long-term periods following surgery. Shared DEGs for the medium-term were evaluated by comparing the DEGs for both 1 and 2 years. 165, 65, and 59 DEGs were identified in short-medium-long periods. The protein-protein interactions were analyzed by STRING. A co-expression network was constructed by mapping the DEGs onto the GeneMANIA plugin of Cytoscape. Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) and wikipathway analysis were done for each group of DEGs. Interleukin-8 receptor activity, complement receptor activity and opsonin receptor activity/N-formyl peptide receptor activity in GO Function enrichment and cellular response to interleukin-8, positive regulation of hippocampal neuron apoptotic process, and positive regulation of hippocampal neuron apoptotic process in GO Process showed the best scores in short-, medium-, and long-term periods, respectively. Eight genes, including CCL2 (Chemokine ligand 2), CXCR4 (CXC motif chemokine receptor 4), EGR2 (Early Growth Response 2), FPR1 (Formyl Peptide Receptor 1), IL6 (interleukin-6), RGS2 (regulator of gene protein signaling2), SELPLG (Selectin P Ligand), and THBS1 (Thrombospondin 1) were identified as shared DEGs in the three periods after surgery. Importantly, results of DAVID database analysis showed 7, 6, 4, and 4 of these genes have roles in immune/ cancer/cardiovascular diseases, type 2 diabetes, myocardial infarct, and atherosclerosis, respectively.

PLCL1
Also flagged:endometriosistransforming growth factor betaTGFβHECAendometrial cancerfibroids
Journal Article 2024-08-28 ✓ 1 Snippet Marečková M, Garcia-Alonso L, Moullet M, Lorenzi V, Petryszak R, Sancho-Serra C, Oszlanczi A, Icoresi Mazzeo C, Wong FCK, Kelava I, Hoffman S, Krassowski M, Garbutt K, Gaitskell K, Yancheva S, Woon EV, Male V, Granne I, Hellner K, Mahbubani KT, Saeb-Parsy K, Lotfollahi M, Prigmore E, Southcombe J, Dragovic RA, Becker CM, Zondervan KT, Vento-Tormo R.
In-Text Gene Mentions

…the progesterone-induced genePLCL1(ref.…

Show Full Abstract

The complex and dynamic cellular composition of the human endometrium remains poorly understood. Previous endometrial single-cell atlases profiled few donors and lacked consensus in defining cell types. We introduce the Human Endometrial Cell Atlas (HECA), a high-resolution single-cell reference atlas (313,527 cells) combining published and new endometrial single-cell transcriptomics datasets of 63 women with and without endometriosis. HECA assigns consensus and identifies previously unreported cell types, mapped in situ using spatial transcriptomics and validated using a new independent single-nuclei dataset (312,246 nuclei, 63 donors). In the functionalis, we identify intricate stromal-epithelial cell coordination via transforming growth factor beta (TGFβ) signaling. In the basalis, we define signaling between fibroblasts and an epithelial population expressing progenitor markers. Integration of HECA with large-scale endometriosis genome-wide association study data pinpoints decidualized stromal cells and macrophages as most likely dysregulated in endometriosis. The HECA is a valuable resource for studying endometrial physiology and disorders, and for guiding microphysiological in vitro systems development.

Also flagged:Gold nanorodsAmphiphilic polymersalkylpolyethylene glycolfolic acidcancer
Journal Article 2024-08-28 No Snippets Kim K, Chejara MR, Yoon B, Park MH.
Show Full Abstract

Gold nanorods (GNRs) have received much attention as potential drug-delivery vehicles because of their various advantages such as good biocompatibility, passive targeting, responsiveness to stimuli, and easy post-functionalization by surface modification. However, the drug structure might be changed for loading into GNRs, making it difficult to load various drugs, and the space to contain drugs is small, making it difficult to deliver sufficient drugs required for treatment compared with other porous materials. Herein, we report an amphiphilic polymer-coated GNR platform for chemo- and photothermal combination therapy. Amphiphilic polymers comprise hydrophobic alkyl chains for drug encapsulation, polyethylene glycol for biocompatibility, and folic acid for cancer targeting. GNRs generate heat energy under near-infrared light irradiation, promoting controlled drug release, and inducing cellular uptake by deforming the cell membrane. On-demand release behavior was traced with Nile red, and targeting and delivery efficiency were confirmed with paclitaxel through cellular experiments. This GNR-based platform enables combination therapy with passive and active targeting to enhance the efficacy of cancer treatment.

HTT
Also flagged:Panic disorderPDanxiety disorderpanic attacksserotoninsignal transduction
Journal Article 2024-08-28 ✓ 4 Snippets Zhu W, Bu Y, Wu L, Li J, Song C, Hao Y.
In-Text Gene Mentions

…as serotonin transporter (5-HTT) and 5-HT1A receptor…

…otoninergic transporter gene (5-HTT) maps on chromosome…

…the HTR1A and5-HTTgenetic SNPs in…

…any association between5-HTTpolymorphism and PD.…

Show Full Abstract

HTR1A C-1019G polymorphism (rs6295) and serotonin transporter promoter polymorphism (5-HTTLPR) have been linked with panic disorder (PD) in different ethnic backgrounds. Both these polymorphisms are in the promoter regions. However, results are inconsistent and contrasting evidence makes reliable conclusions even more challenging. A meta-analysis was conducted to test whether C-1019G polymorphism and 5-HTTLPR were involved in the etiology of PD. Articles researching the link between C-1019G, 5-HTTLPR polymorphisms, and PD were retrieved by database searching and systematically selected on the basis of selected inclusion parameters. 21 studies were included that examined the relationship of rs6295,5-HTTLPR polymorphisms with PD risk susceptibility (rs62957 polymorphism - 7 articles, and 5-HTTLPR polymorphism - 14 articles). A significant association was seen between the rs6295 polymorphism and PD pathogenesis, especially in Caucasian PD patients. No significant genetic linkage was found between the 5-HTTLPR polymorphism and PD. C-1019G polymorphism was involved in the etiology of PD in Caucasian patients. The 5-HTTLPR polymorphism was not a susceptibility factor of PD.

CACNA1E
Also flagged:luminal breast cancertumorscancerbreast cancerTP53NF1
Journal Article 2024-08-28 ✓ 5 Snippets Serio PAMP, Saccaro DM, de Gouvêa ACRC, Encinas G, Maistro S, Pereira GFL, Rocha VM, de Souza LD, da Silva VJ, Katayama MLH, Folgueira MAAK.
In-Text Gene Mentions

CACNA1Ewas involved in…

…genes, such asCACNA1E, GRHL2 and SMURF2…

CACNA1Eis a candidate…

…identified, such asCACNA1E, GRHL2, MTHFD2, PIK3AP1,…

…other than CGC,CACNA1E( Fig. 1…

Show Full Abstract

<h4>Objectives</h4>To identify somatic mutations in tumors from young women with triple-negative or luminal breast cancer, through targeted sequencing and to explore the cancer driver potential of these gene variants.<h4>Methods</h4>A customized gene panel was assembled based on data from previous sequencing studies of breast cancer from young women. Triple-negative and luminal tumors and paired blood samples from young breast cancer patients were sequenced, and identified gene variants were searched for their driver potential, in databases and literature. Additionally, the authors performed an exploratory analysis using large, curated databases to evaluate the frequency of somatic mutations in this gene panel in tumors stratified by age groups (every 10 years).<h4>Results</h4>A total of 28 young women had their tumoral tissue and blood samples sequenced. Using a customized panel of 64 genes, the authors could detect cancer drivers in 11/12 (91.7 %) TNBC samples and 11/16 (68.7 %) luminal samples. Among TNBC patients, the most frequent cancer driver was TP53, followed by NF1, NOTCH1 and PTPN13. In luminal samples, PIK3CA and GATA3 were the main cancer drivers, and other drivers were GRHL2 and SMURF2. CACNA1E was involved in both TN and luminal BC. The exploratory analysis also indicated a role for SMURF2 in luminal BC development in young patients.<h4>Conclusions</h4>The data further indicates that some cancer drivers are more common in a specific breast cancer subtype from young patients, such as TP53 in TNBC and PIK3CA and GATA3 in luminal samples. These results also provide additional evidence that some genes not considered classical cancer-causing genes, such as CACNA1E, GRHL2 and SMURF2 might be cancer drivers in this age group.

SOX6
Also flagged:CSF1R-related disorder-RDdementing disorderleukodystrophyadult-onset leukoencephalopathy
Journal Article 2024-08-28 ✓ 2 Snippets Pan J, Fores-Martos J, Delpirou Nouh C, Jensen TD, Vallejo K, Cayrol R, Ahmadian S, Ashley EA, Greicius MD, Cobos I.
In-Text Gene Mentions

…LRP1, PDGFRA, SOX5,SOX6, NFIA ), downregulation…

…LRP1, PDGFRA, SOX5,SOX6, and NFIA ;…

Show Full Abstract

CSF1R-related disorder (CSF1R-RD) is a neurodegenerative condition that predominantly affects white matter due to genetic alterations in the CSF1R gene, which is expressed by microglia. We studied an elderly man with a hereditary, progressive dementing disorder of unclear etiology. Standard genetic testing for leukodystrophy and other neurodegenerative conditions was negative. Brain autopsy revealed classic features of adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP), including confluent white matter degeneration with axonal spheroids and pigmented glial cells in the affected white matter, consistent with CSF1R-RD. Subsequent long-read sequencing identified a novel deletion in CSF1R that was not detectable with short-read exome sequencing. To gain insight into potential mechanisms underlying white matter degeneration in CSF1R-RD, we studied multiple brain regions exhibiting varying degrees of white matter pathology. We found decreased CSF1R transcript and protein across brain regions, including intact white matter. Single nuclear RNA sequencing (snRNAseq) identified two disease-associated microglial cell states: lipid-laden microglia (expressing GPNMB, ATG7, LGALS1, LGALS3) and inflammatory microglia (expressing IL2RA, ATP2C1, FCGBP, VSIR, SESN3), along with a small population of CD44<sup>+</sup> peripheral monocyte-derived macrophages exhibiting migratory and phagocytic signatures. GPNMB<sup>+</sup> lipid-laden microglia with ameboid morphology represented the end-stage disease microglia state. Disease-associated oligodendrocytes exhibited cell stress signatures and dysregulated apoptosis-related genes. Disease-associated oligodendrocyte precursor cells (OPCs) displayed a failure in their differentiation into mature myelin-forming oligodendrocytes, as evidenced by upregulated LRP1, PDGFRA, SOX5, NFIA, and downregulated NKX2-2, NKX6.2, SOX4, SOX8, TCF7L2, YY1, ZNF488. Overall, our findings highlight microglia-oligodendroglia crosstalk in demyelination, with CSF1R dysfunction promoting phagocytic and inflammatory microglia states, an arrest in OPC differentiation, and oligodendrocyte depletion.

Also flagged:cervical cancerCCcancergene expressionpathogenesiscell cycle
Journal Article 2024-08-28 No Snippets Chauhan P, Pramodh S, Hussain A, Elsori D, Lakhanpal S, Kumar R, Alsaweed M, Iqbal D, Pandey P, Al Othaim A, Khan F.
Show Full Abstract

Cervical cancer (CC) is the most common cancer in women and poses a serious threat to health. Despite familiarity with the factors affecting its etiology, initiation, progression, treatment strategies, and even resistance to therapy, it is considered a significant problem for women. However, several factors have greatly affected the previous aspects of CC progression and treatment in recent decades. miRNAs are short non-coding RNA sequences that regulate gene expression by inhibiting translation of the target mRNA. miRNAs play a crucial role in CC pathogenesis by promoting cancer stem cell (CSC) proliferation, postponing apoptosis, continuing the cell cycle, and promoting invasion, angiogenesis, and metastasis. Similarly, miRNAs influence important CC-related molecular pathways, such as the PI3K/AKT/mTOR signaling pathway, Wnt/β-catenin system, JAK/STAT signaling pathway, and MAPK signaling pathway. Moreover, miRNAs affect the response of CC patients to chemotherapy and radiotherapy. Consequently, this review aims to provide an acquainted summary of onco miRNAs and tumor suppressor (TS) miRNAs and their potential role in CC pathogenesis and therapy responses by focusing on the molecular pathways that drive them.

HFE
Also flagged:SarcopeniaMalnutritionalcoholic liver diseasealcoholic hepatitisAHalcoholic cirrhosis
Journal Article 2024-08-28 ✓ 1 Snippet Enciu VT, Ologeanu PM, Fierbinteanu-Braticevici C.
In-Text Gene Mentions

…for viral hepatitis,hemochromatosisand Wilson’s disease,…

Show Full Abstract

Malnutrition frequently affects patients with alcoholic liver disease (ALD), with important impacts on disease prognosis. Sarcopenia, the clinical phenotype of malnutrition characterized by skeletal muscle loss, is the major component responsible for adverse events in this population. The aim of this study is to assess the use of ultrasound (US) skeletal muscle performance in stratifying ALD disease severity. We recruited 43 patients with ALD and divided them into two groups: alcoholic hepatitis (AH) and alcoholic cirrhosis (AC). We evaluated disease-specific clinical and biological parameters and their relation to US Rectus Femoris muscle (RFM) measurements, including RFM thickness, stiffness (RFMS) and echogenicity (RFE). A thirty-seconds chairs stand test (30sCST) was used as the sarcopenia surrogate test. RMF thickness correlated with platelet count and serum albumin (<i>p</i> < 0.001). Both RFM and RFMS correlated with disease severity (<i>p</i> < 0.001) and 30sCST (<i>p</i> < 0.001, <i>p</i> = 0.002). Patients with AH had more severe US muscle abnormalities compared to AC (RFMS 1.78 m/s vs. 1.35 m/s, <i>p</i> = 0.001) and the highest prevalence of RFE (χ<sup>2</sup> = 8.652, <i>p</i> = 0.003). Rectus Femoris US assessment could represent a reliable tool in the diagnosis and severity stratification of ALD-induced sarcopenia.

Also flagged:DiarrheaIrritable Bowel SyndromeIrritable bowel syndrome withIBSFunctional gastrointestinal disordersmixed bowel habit
Journal Article 2024-08-28 No Snippets Guido D, Maqoud F, Aloisio M, Mallardi D, Ura B, Gualandi N, Cocca M, Russo F.
Show Full Abstract

Irritable bowel syndrome with diarrhea (IBS-D) is the most prevalent subtype of IBS, characterized by chronic gastrointestinal symptoms in the absence of identifiable pathological findings. This study aims to investigate the molecular mechanisms underlying IBS-D using transcriptomic data. By employing causal network inference methods, we identify key transcriptomic modules associated with IBS-D. Utilizing data from public databases and applying advanced computational techniques, we uncover potential biomarkers and therapeutic targets. Our analysis reveals significant molecular alterations that affect cellular functions, offering new insights into the complex pathophysiology of IBS-D. These findings enhance our understanding of the disease and may foster the development of more effective treatments.

Also flagged:hereditary diseasesATP7BPAHNBNBRCA1SDHD
Journal Article 2024-08-28 No Snippets Yanus GA, Suspitsin EN, Imyanitov EN.
Show Full Abstract

There are more than 260 million people of Slavic descent worldwide, who reside mainly in Eastern Europe but also represent a noticeable share of the population in the USA and Canada. Slavic populations, particularly Eastern Slavs and some Western Slavs, demonstrate a surprisingly high degree of genetic homogeneity, and, consequently, remarkable contribution of recurrent alleles associated with hereditary diseases. Along with pan-European pathogenic variants with clearly elevated occurrence in Slavic people (e.g., <i>ATP7B</i> c.3207C>A and <i>PAH</i> c.1222C>T), there are at least 52 pan-Slavic germ-line mutations (e.g., <i>NBN</i> c.657_661del and <i>BRCA1</i> c.5266dupC) as well as several disease-predisposing alleles characteristic of the particular Slavic communities (e.g., Polish <i>SDHD</i> c.33C>A and Russian <i>ARSB</i> c.1562G>A variants). From a clinical standpoint, Slavs have some features of a huge founder population, thus providing a unique opportunity for efficient genetic studies.

OLFM4
Also flagged:oleatepalmitateglyceroltriacylglycerolfatty acidscalcium
Journal Article 2024-08-28 ✓ 1 Snippet Wu F, Liu Y, Zhang M, Yuan X, Ji T, Jin Y, Li Y, Wang R, Hao Y, Fang B, Fang B.
In-Text Gene Mentions

…stem cell markersOlfm4and Sox9 in…

Show Full Abstract

Recent studies have shown that 1-oleo-2-palmito-3-linoleyl glycerol (OPL) is the most abundant triacylglycerol in human breast milk in China. Epidemiologic studies have shown that sn-2 palmitate improves the absorption of fatty acids and calcium in infants. However, there have been few studies of the specific mechanism by which OPL affects intestinal function. In the present study, we have characterized the effects of various levels of OPL supplementation on the development of the intestinal epithelium and the intestinal microbiota of neonatal mice. OPL supplementation increased the body masses and intestinal lengths of weaned mice and promoted defecation. These positive effects were related to the effect of OPL to promote the development of intestinal villi and crypts. OPL increased the expression of the intestinal stem cell markers Olfm4 and Sox9 in the jejunum and ileum, which promoted their differentiation into goblet cells and Paneth cells. It also promoted the integrity of the epithelial barrier by increasing the secretion of mucin 2 and lysozyme 1 and the expression of the tight junction proteins occludin, ZO1, claudin 2, and claudin 3. More importantly, we found that low dose-OPL promotes the transformation of the intestinal microbiota of neonatal mice to the mature state in 3-month-old mice, increases the proportion of Firmicutes, and reduces the proportion of Bacteroidota. The proportions of anaerobic genera of bacteria, such as Lachnospiraceae_NK4A136_group, Lachnoclostridium, Ligilactobacillus, and Bifidobacterium were higher, as were the key producers of short-chain fatty acids, such as Bacteroides and Blautia. OPL also increased the butyric acid content of the feces, which significantly correlated with the abundance of Lactobacillus. High-dose OPL tended to be more effective at promoting defecation and the development of the villi and crypts, but these effects did not significantly differ from those achieved using the lower dose. A low dose of OPL was more effective at increasing the butyric acid content and causing the maturation of microbes. In summary, the OPL supplementation of newborn mice promotes the establishment of the intestinal epithelial layer structure and barrier function, and also promotes the transformation of the intestinal microbiota to a mature state. This study lays a theoretical foundation for the inclusion of OPL in infant formula and provides a scientific basis for the development of intestinal health products.

Also flagged:CMTM4tumorgastric cancerchronic superficial gastritisgastric adenocarcinomacell cycle
Journal Article 2024-08-28 No Snippets Han X, Fu W, Sun Q, Ning J, Zhang J, Matsas S, de Melo FF, Zhang H, Hao X, Meng Q, Gong Y, Zheng H, Zhang J, Ding S.
Show Full Abstract

<h4>Background</h4>CKLF-like MARVEL transmembrane domain-containing 4 (CMTM4) is involved in immune regulation and tumor progression; however, its role in gastric cancer (GC) remains unclear. This study explored the role and mechanism of CMTM4 in GC.<h4>Methods</h4>Immunohistochemistry was used to analyze CMTM4 expression in human gastric biopsied cells from patients with GC (N=23) or chronic superficial gastritis (N=23). To investigate the function of CMTM4 in GC cells, the gene <i>CMTM4</i> was knocked down and overexpressed in human gastric adenocarcinoma cell line AGS. The gene <i>CMTM4</i> was overexpressed in AGS cells and human gastric cell line SGC7901. Cell Counting Kit 8 (CCK-8) and cell clonogenic assays were used to analyze the proliferation of the GC cells. Flow cytometry was used to analyze the effects of CMTM4 on apoptosis and the cell cycle. Wound healing and transwell assays were used to analyze the migration and invasion of the gastric cells, respectively. The mechanism of CMTM4 in GC cells was explored using the tandem mass tags (TMTs) proteome and verified by western blot analysis.<h4>Results</h4>CMTM4 expression was more downregulated in the human GC tissues than the gastritis tissues. CMTM4 overexpression significantly inhibited the proliferation, migration, and invasion of the GC cells, whereas CMTM4 knockdown enhanced gastric cell proliferation (P>0.05), migration (P>0.05), and invasion (P>0.05). Flow cytometry showed that CMTM4 promoted apoptosis and resulted in G1/S arrest in the GC cells. In addition, the proteome and western blot results showed that STAT1 was significantly upregulated, and the STAT1 signaling pathways were enriched in the GC cells overexpressing CMTM4.<h4>Conclusions</h4>Our results suggest that CMTM4 plays a tumor-suppressive role in GC and may affect the growth, migration, and invasion of GC cells through the STAT1 signaling pathway. CMTM4 might have potential value as a prognosis marker and potential therapeutic target for GC therapy.

HTT
Also flagged:genetic disordercytosineadenineguanineHuntingtinbase-pairing
Journal Article 2024-08-28 ✓ 5 Snippets Gulumkar VN, Dowdy SF.
In-Text Gene Mentions

…se in selectivity for targeting mutant HTT

…wild type of the Huntingtin gene (WT-HTT). …

…6 CAG repeats in WT-HTT leads to the format…

…nterference with WT-HTT protein activity.2,…

…that reduce both WT-HTT and mHTT proteins a…

Show Full Abstract

No abstract available.

Also flagged:aginghyperpigmentationcollagensynthesisdegradationpigmentation
Journal Article 2024-08-28 No Snippets Dan X, Li S, Chen H, Xue P, Liu B, Ju Y, Lei L, Li Y, Fan X.
Show Full Abstract

Skin aging is the phenomenon of degenerative changes in the structure and function of skin tissues over time and is manifested by a gradual loss of skin elasticity and firmness, an increased number of wrinkles, and hyperpigmentation. Skin anti-aging refers to a reduction in the skin aging phenomenon through medical cosmetic technologies. In recent years, new biomaterials have been continuously developed for improving the appearance of the skin through mechanical tissue filling, regulating collagen synthesis and degradation, inhibiting pigmentation, and repairing the skin barrier. This review summarizes the mechanisms associated with skin aging, describes the biomaterials that are commonly used in medical aesthetics and their possible modes of action, and discusses the application strategies of biomaterials in this area. Moreover, the synergistic effects of such biomaterials and other active ingredients, such as stem cells, exosomes, growth factors, and antioxidants, on tissue regeneration and anti-aging are evaluated. Finally, the possible challenges and development prospects of biomaterials in the field of anti-aging are discussed, and novel ideas for future innovations in this area are summarized.

SUDS3
Also flagged:transcription factorszincglutaminetranscriptional repressorsSpalt-like proteinshistone deacetylase
Journal Article 2024-08-27 ✓ 1 Snippet Ostalé CM, Pulido D, Vega-Cuesta P, López-Varea A, de Celis JF.
In-Text Gene Mentions

…interactions with thehistone deacetylase complexdeacetylase complex NuRD…

Show Full Abstract

The Spalt transcriptional regulators participate in a variety of cell fate specification processes during development, regulating transcription through interactions with DNA AT-rich regions. Spalt proteins also bind to heterochromatic regions, and some of their effects require interactions with the NuRD chromatin remodeling and deacetylase complex. Most of the biological roles of Spalt proteins have been characterized in diploid cells engaged in cell proliferation. Here, we address the function of Drosophila Spalt genes in the development of a larval tissue formed by polyploid cells, the prothoracic gland, the cells of which undergo several rounds of DNA replication without mitosis during larval development. We show that prothoracic glands depleted of Spalt expression display severe changes in the size of the nucleolus, the morphology of the nuclear envelope and the disposition of the chromatin within the nucleus, leading to a failure in the synthesis of ecdysone. We propose that loss of ecdysone production in the prothoracic gland of Spalt mutants is primarily caused by defects in nuclear pore complex function that occur as a consequence of faulty interactions between heterochromatic regions and the nuclear envelope.

HFE
Also flagged:Crowned Dens Syndromemeningitispseudogoutcorticosteroidscalciumpyrophosphate
Journal Article 2024-08-27 ✓ 1 Snippet Xie L, Fang H, Dong C, Cui M, Zhao K, Yang C, Wu X.
In-Text Gene Mentions

…eudogout, hyperparathyroidism,hemochromatosis, and hypophosphatasia […

Show Full Abstract

BACKGROUND Crowned dens syndrome (CDS) is a rare condition characterized by deposition of calcium pyrophosphate crystals on the odontoid process of the second cervical vertebra, forming a calcified 'crown', with neck pain being a common symptom. The disorder exhibits unique clinical and radiological features, resembling manifestations of meningitis, such as acute headaches and cervical stiffness. There are few case reports and case series related to CDS. Patients generally respond well to treatment with nonsteroidal anti-inflammatory drugs (NSAIDs), although there is a certain rate of recurrence. Since there are few reports of CDS, we sought to publish this case report, aiming of increasing clinicians' awareness and reducing misdiagnosis rates. CASE REPORT A 62-year-old man presented to the Emergency Department with "cutting-like" headaches and neck pain for 2 days, and was subsequently diagnosed with CDS by cervical computed tomography (CT) scan, and hematological tests revealed inflammatory manifestations. He was advised to take oral nonsteroidal anti-inflammatory drugs and to rest; his symptoms improved after 3 days and his neck pain had almost resolved after 2 months. CONCLUSIONS In older patients experiencing new headaches and neck pain, along with increased inflammatory markers, particularly those with a history of pseudogout, the possibility of CDS should be considered. Case reports suggest that oral NSAIDs and short courses of corticosteroids can generally alleviate symptoms. Further research is needed on CDS diagnosis and treatment.

HTT
Also flagged:SOD1ALSJAK1HDoligonucleotidesArgonaute 2
Journal Article 2024-08-27 ✓ 2 Snippets Rivera Flores IV, Monopoli K, Jackson S, Echeverria D, O'Reilly D, Brown RH, Khvorova A.
In-Text Gene Mentions

We systematically altered potent siRNAs targeting human genes associated with diseases-<i>SOD1</i> (ALS), <i>JAK1</i> (inflammation), and <i>HTT</i> (HD)-to generate species-matching variants with full complementarity to their target in NHPs, mice, rats, sheep, and dogs.

Htt

Show Full Abstract

Small interfering RNAs (siRNAs) represent a novel class of drugs capable of potent and sustained modulation of genes across various tissues. Preclinical development of siRNAs necessitates assessing efficacy and toxicity in animal models. While identifying therapeutic leads with cross-species activity can expedite development, it may compromise efficacy and be infeasible for certain gene targets. Here, we investigate whether deriving species-active siRNAs from potent human-targeting leads-an approach termed mismatch conversion-can yield potent compounds. We systematically altered potent siRNAs targeting human genes associated with diseases-<i>SOD1</i> (ALS), <i>JAK1</i> (inflammation), and <i>HTT</i> (HD)-to generate species-matching variants with full complementarity to their target in NHPs, mice, rats, sheep, and dogs. Variants potency and efficacy were measured in corresponding cell lines. We demonstrate that sequence, position, and number of mismatches significantly influence the ability to generate potent species-active compounds via mismatch conversion. Across tested sequences, mismatch conversion strategy ability to identify a species-active lead varied from 0% to 70%. For <i>SOD1</i>, lead compounds identified from species-focus screening in mouse and dog cells were more potent than leads obtained from mismatch conversion. Thus, a focused screening of therapeutic lead and model compounds may represent a more reliable strategy for the clinical advancement of siRNAs.

Also flagged:Synthesis5-aminolevulinic acidgliomasbrain tumorfluorofluorine
Journal Article 2024-08-27 No Snippets Pashikanti G, Chavan LN, Liebeskind LS, Goodman MM.
Show Full Abstract

In 2017, the FDA authorized 5-aminolevulinic acid (5-ALA) for intraoperative optical imaging of suspected high-grade gliomas. This was the first authorized optical imaging agent for brain tumor surgery to enhance the visualization of malignant tissue. Herein we report the synthesis of a racemic and enantiopure fluorinated analog of 5-ALA, i.e., 3-fluoro-5-aminolevulinic acid (3F-5-ALA). We anticipate that these studies will provide the foundation for the future construction of a fluorine-18-labeled 5-ALA PET tracer to be used for functional and metabolic imaging of gliomas.

HFE
Also flagged:MomelotinibmyelofibrosisMFanemiabone marrow insufficiencyACVR1
Journal Article 2024-08-27 ✓ 1 Snippet Dadkhah PA, Karimi MA, Chahkand MSG, Moallem FE, Kazemabad MJE, Azarm E.
In-Text Gene Mentions

…iron regulator protein (HFE), the BMP co-receptor…

Show Full Abstract

Myelofibrosis (MF), a complex hematological malignancy, presents a diverse array of symptoms, including anemia, constitutional symptoms, bone marrow insufficiency, and splenomegaly. The latter, often necessitating blood transfusions, poses an essential obstacle to MF management. While conventional approaches predominantly involve the use of JAK inhibitors, the potential for exacerbating anemia introduces complexity to the treatment. Nonetheless, Momelotinib stands out as a promising pharmaceutical compound with the potential to revolutionize the field. Momelotinib is an ACVR1 antagonist and a dual inhibitor of the JAK1 and JAK2 enzymes. By targeting MF's hematological and fibrotic aspects, Momelotinib influences iron metabolism by regulating hepcidin. This results in reduced hepcidin expression and increased iron availability, ultimately leading to improved anemia and reduced dependency on blood transfusion. This study aims to provide a concise overview of the pathogenesis of MF and elucidate the mechanism of action of Momelotinib. Subsequently, our review offers a practical summary encompassing the effects of Momelotinib in monotherapy, combined comparative drug therapy, and its associated side effects. Additionally, we explore the application of Momelotinib in other cancer types and investigate predictors for treatment success. Furthermore, we examine the utilization of Momelotinib in patients with liver and kidney failure.

Also flagged:gangliosidesglycosphingolipidsmembranemetabolismGM2-gangliosidosislysosomal storage disorders
Journal Article 2024-08-27 No Snippets Kim J, Byeon SK, Oglesbee D, Schultz MJ, Matern D, Pandey A.
Show Full Abstract

The analysis of gangliosides and glycosphingolipids is crucial for understanding cellular membrane structure and function as well as to accurately diagnose certain inborn errors of metabolism. GM2-gangliosidosis represents a rare and fatal group of lysosomal storage disorders characterized by accumulation of GM2 gangliosides in various tissues and organs. These disorders arise due to deficiency or functional impairment of the β-hexosaminidase A or B enzymes, which are responsible for degradation of GM2 ganglioside. Deficient enzyme activity primarily leads to the accumulation of GM2 gangliosides within the lysosomes of cells. Accurate and rapid diagnostic methods that detect increased levels of GM2 gangliosides in patients with GM2-gangliosidosis can play a significant role in early diagnosis and appropriate treatment of this condition. To address this need, we developed a multiplexed liquid chromatography-tandem mass spectrometry method targeting 84 species of gangliosides and other glycosphingolipids involved in ganglioside metabolism. Reproducibility, linearity, extraction efficiency, and sample stability were evaluated and proof-of-concept data obtained from analysis of serum samples from confirmed cases of GM2-gangliosidosis. This method has the potential to simultaneously monitor the biosynthesis of gangliosides and the lysosomal catabolic pathway serving as a valuable tool for screening and diagnosing an important group of lysosomal storage disorders.

HTT
Also flagged:HDautosomal dominant neurodegenerative disorderpolyglutaminecognitive impairmentspositron-
Journal Article 2024-08-27 ✓ 1 Snippet Zajicek F, Verhaeghe J, De Lombaerde S, Van Eetveldt A, Miranda A, Munoz-Sanjuan I, Dominguez C, Khetarpal V, Bard J, Liu L, Staelens S, Bertoglio D.
In-Text Gene Mentions

…to the huntingtin (HTT) gene encoding for…

Show Full Abstract

<h4>Purpose</h4>Positron emission tomography (PET) imaging of mutant huntingtin (mHTT) aggregates is a potential tool to monitor disease progression as well as the efficacy of candidate therapeutic interventions for Huntington's disease (HD). To date, the focus has been mainly on the investigation of <sup>11</sup>C radioligands; however, favourable <sup>18</sup>F radiotracers will facilitate future clinical translation. This work aimed at characterising the novel [<sup>18</sup>F]CHDI-650 PET radiotracer using a combination of in vivo and in vitro approaches in a mouse model of HD.<h4>Methods</h4>After characterising [<sup>18</sup>F]CHDI-650 using in vitro autoradiography, we assessed in vivo plasma and brain radiotracer stability as well as kinetics through dynamic PET imaging in the heterozygous (HET) zQ175DN mouse model of HD and wild-type (WT) littermates at 9 months of age. Additionally, we performed a head-to-head comparison study at 3 months with the previously published [<sup>11</sup>C]CHDI-180R radioligand.<h4>Results</h4>Plasma and brain radiometabolite profiles indicated a suitable metabolic profile for in vivo imaging of [<sup>18</sup>F]CHDI-650. Both in vitro autoradiography and in vivo [<sup>18</sup>F]CHDI-650 PET imaging at 9 months of age demonstrated a significant genotype effect (p < 0.0001) despite the poor test-retest reliability. [<sup>18</sup>F]CHDI-650 PET imaging at 3 months of age displayed higher differentiation between genotypes when compared to [<sup>11</sup>C]CHDI-180R.<h4>Conclusion</h4>Overall, [<sup>18</sup>F]CHDI-650 allows for discrimination between HET and WT zQ175DN mice at 9 and 3 months of age. [<sup>18</sup>F]CHDI-650 represents the first suitable <sup>18</sup>F radioligand to image mHTT aggregates in mice and its clinical evaluation is underway.

DCC
Also flagged:prostate cancerExtracellular vesiclescancerExtracellularVesicleslipid
Journal Article 2024-08-27 ✓ 5 Snippets Erwied P, Gu Y, Simon L, Schneider M, Helm D, Michel MS, Nuhn P, Nitschke K, Worst TS.
In-Text Gene Mentions

…the combination ofDCC, SEC and concentration…

…EV enriched withDCC, SEC and concentration…

…the combination methodDCC, SEC and concentration,…

…EV enrichment withDCCand SEC but…

…after single stepDCC(Supplementary Fig. 2),…

Show Full Abstract

To improve the prognosis of bladder and prostate cancer, highly specific and sensitive biomarkers are needed for early detection, prognosis prediction, and therapeutic stratification. Extracellular vesicles (EV) from plasma could fill this gap due to their potential to serve as cancer biomarkers. However, the enrichment of EV is a major challenge, because the highly abundant plasma proteins are interfering with analytical downstream applications like mass spectrometry (MS). Therefore, the purity requirements of the EV samples must be carefully considered when selecting or developing a suitable EV enrichment method. The aim of this study was to compare a self-designed EV enrichment method based on density cushion centrifugation (DCC) combined with size exclusion chromatography (SEC) and concentration (method 1) with the exoRNeasy midi kit from Qiagen (method 2) and with unprocessed plasma. Furthermore, the single steps of method 1 were evaluated for their effectiveness to enrich EV from plasma. The results showed that the EV samples enriched with method 1 contained the highest levels of EV and exosome markers with simultaneously low levels of highly abundant plasma proteins. In summary, the combination of DCC, SEC and concentration proved to be a promising approach to discover EV-based biomarkers from plasma of cancer patients.

SOX6
Also flagged:gene expressionChromiumCell differentiationtranscription factorsSTAT1MYEF2
Journal Article 2024-08-27 ✓ 1 Snippet Yuan X, Long Q, Li W, Yan Q, Zhang P.
In-Text Gene Mentions

…STAT1, MYEF2, andSOX6transcription factors during…

Show Full Abstract

We employed single-cell transcriptome sequencing to reveal the dynamic gene expression changes during the differentiation of adipose-derived stromal cells (ADSCs) into astrocytes. Single-cell RNA sequencing was conducted on cells from the ADSCs group and the induced groups at 2, 7, 14, and 21 days using the 10 × Chromium platform. Data underwent quality control and dimensionality reduction. Cell differentiation trajectories were constructed using Monocle2, and differentially expressed genes (DEGs) in each cell cluster were identified using differential selection algorithms. DEGs at each time point were annotated using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), and regulatory intensities of transcription factors were analyzed using SCENIC. Integrating all groups, a total of five samples were divided into 13 cell clusters (0-12 clusters). DEGs between clusters and those compared with ADSCs at various induced time points showed distinct specificities. Monocle2 constructed cell differentiation trajectories; ADSCs can differentiate into mature astrocytes not only through the direct pathway from the 1 branch to the 3 branch but also through an indirect pathway, involving the 1 branch to the 2 branch before progressing to the 3 branch. SCENIC analysis highlighted the critical regulatory roles of STAT1, MYEF2, and SOX6 transcription factors during the differentiation of ADSCs into astrocytes. ADSCs can differentiate into mature astrocytes through two distinct pathways: direct and indirect. By the 14th day of induction, mature astrocytes have formed, characterized by a cell cycle arrest in mitosis. Further induction leads to degenerative senescence changes in differentiated cells.

HFE
Also flagged:Congenital hypogonadotropic hypogonadismreproductive disordersecretiongonadotropin-releasing hormoneGnRHmale infertility
Journal Article 2024-08-27 ✓ 1 Snippet Dwyer AA, McDonald IR, Quinton R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Congenital hypogonadotropic hypogonadism (CHH) is a rare reproductive disorder caused by deficient secretion or action of gonadotropin-releasing hormone (GnRH) and is a hormonally treatable form of male infertility. Both pulsatile GnRH treatment and combined gonadotropin therapy effectively induce spermatogenesis in 75%-80% of males with CHH, albeit the ejaculate does not usually approach normal semen parameters by WHO criteria. This is in some contrast to the cumulative fertility outcomes in females with CHH on gonadotropin treatment that are indistinguishable from those of reproductively normal females. Emerging data provide insights into early life determinants of male fertility (i.e., minipuberty), and research has identified key predictors of outcomes for fertility-inducing treatment in men with CHH. Such developments provide mounting evidence for tailoring approaches to maximize fertility potential in CHH, although there is no clear consensus to date on the optimal approach to fertility-inducing treatment. This review provides an up-to-date review on the current evidence underpinning therapeutic approaches for inducing spermatogenesis in males with CHH. In the absence of evidence-based clinical guidelines, this synthesis of current evidence provides guidance for clinicians working with males with CHH seeking fertility.

DCC
Also flagged:synapsessynaptic vesiclesacetylcholinegamma-aminobutyric acidglutamatesecretion
Journal Article 2024-08-27 ✓ 3 Snippets Correa E, Mialon M, Cizeron M, Bessereau JL, Pinan-Lucarre B, Kratsios P.
In-Text Gene Mentions

…rm (MADD-4B) activates UNC-40/DCC(deleted in colorectal…

…Adamtsl3 signals viaDCCat GABAergic synapses…

…and activation of UNC-40/DCCsignaling ( Zhou…

Show Full Abstract

Terminal selectors are transcription factors that control neuronal identity by regulating expression of key effector molecules, such as neurotransmitter biosynthesis proteins and ion channels. Whether and how terminal selectors control neuronal connectivity is poorly understood. Here, we report that UNC-30 (PITX2/3), the terminal selector of GABA nerve cord motor neurons in Caenorhabditis elegans, is required for neurotransmitter receptor clustering, a hallmark of postsynaptic differentiation. Animals lacking unc-30 or madd-4B, the short isoform of the motor neuron-secreted synapse organizer madd-4 (punctin/ADAMTSL), display severe GABA receptor type A (GABAAR) clustering defects in postsynaptic muscle cells. Mechanistically, UNC-30 acts directly to induce and maintain transcription of madd-4B and GABA biosynthesis genes (e.g. unc-25/GAD, unc-47/VGAT). Hence, UNC-30 controls GABAA receptor clustering in postsynaptic muscle cells and GABA biosynthesis in presynaptic cells, transcriptionally coordinating two crucial processes for GABA neurotransmission. Further, we uncover multiple target genes and a dual role for UNC-30 as both an activator and a repressor of gene transcription. Our findings on UNC-30 function may contribute to our molecular understanding of human conditions, such as Axenfeld-Rieger syndrome, caused by PITX2 and PITX3 gene variants.

Also flagged:Follicular lymphomaFLB-cell non-Hodgkin lymphomatumorCREBBPKMT2D
Journal Article 2024-08-27 No Snippets Bai B, Wise JF, Vodák D, Nakken S, Sharma A, Blaker YN, Brodtkorb M, Hilden V, Trøen G, Ren W, Lorenz S, Lawrence MS, Myklebost O, Kimby E, Pan-Hammarström Q, Steen CB, Meza-Zepeda LA, Beiske K, Smeland EB, Hovig E, Lingjærde OC, Holte H, Myklebust JH.
Show Full Abstract

Follicular lymphoma (FL) is the most common indolent type of B-cell non-Hodgkin lymphoma. Advances in treatment have improved overall survival, but early relapse or transformation to aggressive disease is associated with inferior outcome. To identify early genetic events and track tumor clonal evolution, we performed multi-omics analysis of 94 longitudinal biopsies from 44 FL patients; 22 with transformation (tFL) and 22 with relapse without transformation (nFL). Deep whole-exome sequencing confirmed recurrent mutations in genes encoding epigenetic regulators (CREBBP, KMT2D, EZH2, EP300), with similar mutational landscape in nFL and tFL patients. Calculation of genomic distances between longitudinal samples revealed complex evolutionary patterns in both subgroups. CREBBP and KMT2D mutations were identified as genetic events that occur early in the disease course, and cases with CREBBP KAT domain mutations had low risk of transformation. Gains in chromosomes 12 and 18 (TCF4), and loss in 6q were identified as early and stable copy number alterations. Identification of such early and stable genetic events may provide opportunities for early disease detection and disease monitoring. Integrative analysis revealed that tumors with EZH2 mutations exhibited reduced gene expression of numerous histone genes, including histone linker genes. This might contribute to the epigenetic dysregulation in FL.

SERPINC1
Also flagged:heparinCOVID-19coagulationoxygenviral pneumoniaCoronavirus 2019 disease
Journal Article 2024-08-27 ✓ 1 Snippet Ramos da Silva Grillo VT, Bertanha M, da Silva Rodrigues L, de Lima MA, Mellucci Filho PL, Rahal Guaragna Machado R, Durigon EL, Dias Sertorio N, de Assis Golim M, Moroz A, Marques Braz AM, de Moraes LN, Leite MA, Bonciani Nader H, de Campos GC, Rodrigues Guzzo Carvalho C, Florença Cardoso F, Magro AJ, Caputo Nunes H, Tommasini Grotto RM, de Cássia Alvarado R, de Moura Campos Pardini MI, Lima Sobreira M, da Costa EAPN, Naime Barbosa A, Fortaleza CMCB.
In-Text Gene Mentions

…the body, includingantithrombin-III(AT), which is…

Show Full Abstract

To evaluate the safety and the potential antiviral treatment of inhaled enriched heparin in patients with COVID-19. The specific objectives were to investigate the anticoagulation profile, antiviral and anti-inflammatory effects, and respiratory evolution of inhaled enriched heparin. We conducted a randomized, triple-blind, placebo-controlled Phase I/II clinical trial in hospitalized adults with COVID-19 receiving inhalation of enriched heparin or saline (placebo) every 4 h for 7 days. Among the 27 patients who completed the study, no changes in blood coagulation parameters were observed, indicating the safety of inhaled enriched heparin. The group receiving enriched heparin showed a significant reduction in the need for supplemental oxygen and improvement in respiratory parameters, such as the PaO<sub>2</sub>/FiO<sub>2</sub> ratio. Inhalation of enriched heparin is shown to be safe and has also demonstrated potential therapeutic benefits for patients with COVID-19. These promising results justify the continuation of the study to the next phase, Phase II/III, to further evaluate the therapeutic efficacy of inhaled enriched heparin in the treatment of COVID-19-associated viral pneumonia.Trial registration: ClinicalTrials.gov. 08/02/2021. Identifier: NCT04743011.

Also flagged:ionic liquidsricinoleic acidfatty acidethanoloxygenhydroxyl groups
Journal Article 2024-08-27 No Snippets El Nagy HA, Abd El-Aziz Mohamed M.
Show Full Abstract

Ecofriendly ionic liquids (ILs) were synthesized through amidation of ricinoleic acid, the main fatty acid in castor oil, followed by a quaternization reaction to solubilize ethanol in IL/diesel blends at different ratios. As a result, stable and highly renewable, low viscous microemulsion biofuels with high oxygen content were prepared. The prepared fuel samples combine the advantages of green ionic liquids and microemulsion properties. The chemical structures of ILs were confirmed with the aid of NMR and FTIR spectroscopy. DLS analysis revealed that the ethanol particles ranged in size from 8 to 18.1 nm in all samples. As ILs ratios decrease in microemulsion from 37 to 69%, the ethanol particle sizes increase from 10 to 25%. Ethanol shows good solubilization in diesel and IL-1 is more effective than IL-2 in ethanol solubilization at low percentages of ethanol due to more oxygen atoms besides three hydroxyl groups. The ternary phase diagram indicated that the microemulsion area in the case of using IL-1 is larger than that of IL-2. The fuel properties of the prepared microemulsions are nearly close to those of neat diesel and fall within the permitted range of ASTM D975. The viscosity and density values at low ratios of ILs are found to be very close to the values of the neat diesel at different temperatures. The prepared samples show a slight decrease in cetane number and heating value compared to diesel. However, they have improved flash points, cloud points, sulfur content, and acid value. The particle sizes were checked every week and the prepared samples showed high stability with the aid of the synthesized ILs. Moreover, the prepared microemulsions stayed in a transparent appearance for more than a year and no phase separation was observed.

HFE
Also flagged:ironcolorectal canceriron deficiencycancerTSanaemia
Journal Article 2024-08-27 ✓ 1 Snippet Gwenzi T, Schrotz-King P, Anker SC, Schöttker B, Hoffmeister M, Brenner H.
In-Text Gene Mentions

…of iron overload (hemochromatosis), liver disease, or…

Show Full Abstract

<h4>Background</h4>Post-operative anaemia is linked to iron deficiency. We investigated the prognostic value of post-operative iron biomarkers in colorectal cancer (CRC).<h4>Methods</h4>Ferritin, transferrin, iron, and transferrin saturation (TS%) were measured from blood collected at a single time-point post-surgery in 2769 CRC patients. Associations between iron biomarkers with cancer-specific survival (CSS) and overall survival (OS) were assessed using Cox regression with hazard ratios (HR), stratified by post-operative time of blood collection (<1-month/≥1-month).<h4>Results</h4>After a median follow-up of 9.5 years, 52.6% of patients had died. For iron biomarkers assessed <1-month post-surgery, higher compared to normal TS% was associated with shorter CSS (HR [95% CI] = 2.36 [1.25-4.46]), and higher iron levels with better OS (upper vs. median tertile: HR [95% CI] = 0.79 [0.65-0.97]). When assessed ≥1-month post-surgery, elevated ferritin was associated with poor CSS (high vs. normal: HR [95% CI] = 1.44 [1.10-1.87]), and low TS% with worse CSS (low vs. normal: HR [95% CI] = 1.60 [1.24-2.06]). Similar but weaker associations were observed for OS.<h4>Conclusion</h4>Monitoring of serum ferritin and TS% beyond 1-month post-surgery may be relevant for risk stratification of patients with operable CRC. Future studies should validate our findings.

Also flagged:major depressive disordergene expressionsynaptic transmissionneurogenesisanxietyneuroticism
Journal Article 2024-08-27 No Snippets Martone A, Possidente C, Fanelli G, Fabbri C, Serretti A.
Show Full Abstract

Treatment response and resistance in major depressive disorder (MDD) show a significant genetic component, but previous studies had limited power also due to MDD heterogeneity. This literature review focuses on the genetic factors associated with treatment outcomes in MDD, exploring their overlap with those associated with clinically relevant symptom dimensions. We searched PubMed for: (1) genome-wide association studies (GWASs) or whole exome sequencing studies (WESs) that investigated efficacy outcomes in MDD; (2) studies examining the association between MDD treatment outcomes and specific depressive symptom dimensions; and (3) GWASs of the identified symptom dimensions. We identified 13 GWASs and one WES of treatment outcomes in MDD, reporting several significant loci, genes, and gene sets involved in gene expression, immune system regulation, synaptic transmission and plasticity, neurogenesis and differentiation. Nine symptom dimensions were associated with poor treatment outcomes and studied by previous GWASs (anxiety, neuroticism, anhedonia, cognitive functioning, melancholia, suicide attempt, psychosis, sleep, sociability). Four genes were associated with both treatment outcomes and these symptom dimensions: CGREF1 (anxiety); MCHR1 (neuroticism); FTO and NRXN3 (sleep). Other overlapping signals were found when considering genes suggestively associated with treatment outcomes. Genetic studies of treatment outcomes showed convergence at the level of biological processes, despite no replication at gene or variant level. The genetic signals overlapping with symptom dimensions of interest may point to shared biological mechanisms and potential targets for new treatments tailored to the individual patient's clinical profile.

Also flagged:Neonatal hypoxic-ischemic encephalopathyHIEperinatal arterial ischemic strokePAISstrokeencephalopathy
Journal Article 2024-08-27 No Snippets Gonzalez FF, Monsell SE, Cornet MC, Glass H, Wisnowski J, Mathur A, McKinstry R, Li Y, Wu TW, Mayock DE, Heagerty PJ, Juul SE, Wu YW.
Show Full Abstract

<h4>Background</h4>Both perinatal arterial ischemic stroke (PAIS) and hypoxic-ischemic encephalopathy (HIE) can present with neonatal encephalopathy. We hypothesized that among infants undergoing therapeutic hypothermia, presence of PAIS is associated with a higher risk of seizures and a lower risk of persistent encephalopathy after rewarming.<h4>Methods</h4>We studied 473 infants with moderate or severe HIE enrolled in the HEAL Trial who received a brain MRI. We defined PAIS as focal ischemic infarct(s) within an arterial distribution, and HIE pattern of brain injury as central gray, peripheral watershed, or global injury. We compared the risk of seizures (clinically suspected or electrographic), and of an abnormal 5-day Sarnat exam, in infants with and without PAIS.<h4>Results</h4>PAIS was diagnosed in 21(4%) infants, most of whom (16/21, 76%) also had concurrent HIE pattern of brain injury. Infants with PAIS were more likely to have seizures (RR 2.4, CI 2.8-3.3) and persistent moderate or severe encephalopathy on 5-day Sarnat exam (RR 2.5, 95% CI 1.9-3.4).<h4>Conclusion</h4>Among infants undergoing therapeutic hypothermia, PAIS typically occurs with concurrent HIE pattern brain injury. The higher rate of encephalopathy after rewarming in infants with PAIS may be due to the frequent co-existence of PAIS and HIE patterns of injury.

SOX6
Also flagged:GPX4Gliomabrain tumorgliomasp53Notch
Journal Article 2024-08-27 ✓ 1 Snippet Banu MA, Dovas A, Argenziano MG, Zhao W, Sperring CP, Cuervo Grajal H, Liu Z, Higgins DM, Amini M, Pereira B, Ye LF, Mahajan A, Humala N, Furnari JL, Upadhyayula PS, Zandkarimi F, Nguyen TT, Teasley D, Wu PB, Hai L, Karan C, Dowdy T, Razavilar A, Siegelin MD, Kitajewski J, Larion M, Bruce JN, Stockwell BR, Sims PA, Canoll P.
In-Text Gene Mentions

…N1IC tumors, includingSox6, Olig1 , and…

Show Full Abstract

Glioma cells hijack developmental programs to control cell state. Here, we uncover a glioma cell state-specific metabolic liability that can be therapeutically targeted. To model cell conditions at brain tumor inception, we generated genetically engineered murine gliomas, with deletion of p53 alone (p53) or with constitutively active Notch signaling (N1IC), a pathway critical in controlling astrocyte differentiation during brain development. N1IC tumors harbored quiescent astrocyte-like transformed cell populations while p53 tumors were predominantly comprised of proliferating progenitor-like cell states. Further, N1IC transformed cells exhibited increased mitochondrial lipid peroxidation, high ROS production and depletion of reduced glutathione. This altered mitochondrial phenotype rendered the astrocyte-like, quiescent populations more sensitive to pharmacologic or genetic inhibition of the lipid hydroperoxidase GPX4 and induction of ferroptosis. Treatment of patient-derived early-passage cell lines and glioma slice cultures generated from surgical samples with a GPX4 inhibitor induced selective depletion of quiescent astrocyte-like glioma cell populations with similar metabolic profiles. Collectively, these findings reveal a specific therapeutic vulnerability to ferroptosis linked to mitochondrial redox imbalance in a subpopulation of quiescent astrocyte-like glioma cells resistant to standard forms of treatment.

DCC
Also flagged:acute lymphoblastic leukemiaALLacute leukemiasCD8CD5CD7
Journal Article 2024-08-27 ✓ 1 Snippet Pastorczak A, Urbanska Z, Styka B, Miarka-Walczyk K, Sedek L, Wypyszczak K, Wakulinska A, Nowicka Z, Szczepański T, Stańczak M, Fendler W, Kowalczyk J, Młynarski W, Lejman M.
In-Text Gene Mentions

…MMP14, CTCF, NF1,DCC, STIL, CDKN2A, CDKN2B,…

Show Full Abstract

Chromothripsis (cth) is a form of genomic instability leading to massive de novo structural chromosome rearrangements in a one-time catastrophic event. It can cause cancer-promoting alterations, such as loss of sequences for tumor-suppressor genes, formation of oncogenic fusions, and oncogene amplifications. We investigated the genetic background and clinical significance of cth in childhood T-cell acute lymphoblastic leukemia (T-ALL) patients. For this purpose, whole-genome copy number alterations were analyzed in 173 children with newly diagnosed T-ALL using high-density microarrays. Cth was identified in 10 T-ALL samples (5.78%). In six of them, cth occurred in a constitutional background of Nijmegen breakage syndrome (n = 5) or Li-Fraumeni syndrome (n = 1). Cth generated alterations, including deletions of CDKN2A/B (n = 4) and EZH2 (n = 4), amplifications of CDK6 (n = 2), and NUP214::ABL1 and TFG::GPR128 fusions. Cth-positive leukemias exhibited deletions involving the tumor-suppressor genes RB1 (n = 3), TP53 (n = 1) and MED12 (n = 2). Cth-positive T-ALL patients had a lower probability of 5-year overall survival (OS) [0.56 vs. 0.81; hazard ratio (HR) = 4.14 (1.42-12.02) p = 0.017] as did 5-year event-free survival [0.45 vs. 0.74; HR = 3.91 (1.52-10.08); p = 0.012]. Chromothripsis is an infrequent genomic phenomenon in pediatric T-ALL but is significantly associated with cancer-predisposing syndromes and may associate with inferior prognosis.

SERPINC1
Also flagged:psychiatric diseasespsychiatric disordersinflammatory responsebehavioraldepressionpsychiatric illnesses
Journal Article 2024-08-27 ✓ 5 Snippets Pedraz-Petrozzi B, Insan S, Spangemacher M, Reinwald J, Lamadé EK, Gilles M, Deuschle M, Sartorius A.
In-Text Gene Mentions

…nflammation-related proteins (ATIII, CRP, ITIH4, and…

…only changes inATIIIshowed significant positive…

…Moreover, changes inATIIIshowed a significant…

…Finally, baselineATIIIin both the…

…by changes inATIIIfollowing rTMS treatment.…

Show Full Abstract

<h4>Background</h4>Repetitive transcranial magnetic stimulation (rTMS) has recently gained relevance in treating different psychiatric disorders. Limited evidence suggests that the beneficial effects of rTMS on psychopathology could be at least partly mediated through changes in inflammatory response. This systematic review summarizes the literature on whether rTMS can modulate inflammatory markers and thus positively influence the course of psychiatric illnesses.<h4>Materials and methods</h4>A systematic review of rTMS and inflammatory markers in psychiatric diseases was conducted according to PRISMA guidelines. Information on the association between rTMS treatment response and changes of inflammatory markers was extracted. The quality of the studies was assessed using the National Heart, Lung, and Blood Institute for human studies and the Systematic Review Center for Laboratory Animal Experimentation for animal studies.<h4>Results</h4>This review includes 17 studies (2 animal and 15 human studies) on the relationship between rTMS treatment response and changes of inflammatory markers. Positive changes in microglial activity and anti-inflammatory effects were associated with behavioral improvement in animal models of depression. However, these findings have not been consistently replicated in human studies focusing on treatment-resistant depression. While several studies reported rTMS-induced alterations in peripheral inflammatory markers, only two could demonstrate their association to clinical treatment response. Notably, most studies showed poor or moderate quality in the bias assessment.<h4>Conclusions</h4>While certain human studies suggest an association between rTMS-induced anti-inflammatory effects and improvement in psychopathology, heterogeneity, and underpowered analyses constrain the generalizability of these results. The discrepancy between animal and human findings highlights the need for larger, standardized human studies.<h4>Trial registration</h4>(PROSPERO Registration: CRD42023492732).

Also flagged:SGLT-2acute kidney injuryheart failureexcretionwatersodium
Journal Article 2024-08-27 No Snippets Wang X, He M, Jin D, Sun C, Lu H.
Show Full Abstract

<h4>Background</h4>Sodium glucose cotransporter-2 (SGLT-2) inhibitors are known to reduce hospitalization and cardiovascular mortality in various heart failure (HF) populations, potentially through enhanced excretion of water and sodium. However, there are concerns regarding the risk of acute kidney injury (AKI) associated with their use. This meta-analysis aimed to unravel the effects of SGLT-2 inhibitors on risk of AKI in a variety of patients with HF.<h4>Methods</h4>This study conducted a comprehensive literature search using PubMed, EMBASE, Cochrane Library, and clinicaltrials.gov for studies published up to January 1, 2024. Data were analyzed using both random-effects or fixed-effects models to estimate the overall relative risk (RR) with a 95% confidence interval (CI).<h4>Results</h4>Our analysis included 25,172 patients with HF from 16 randomized controlled trials. Treatment with SGLT-2 inhibitors led to a 28% reduction in the risk of AKI progression compared to placebo (RR 0.72, 95% CI 0.61-0.85, p<0.0001), without an increased risk of hypotension (RR 1.21, 95% CI 0.87-1.70, p = 0.26) and hypovolemia (RR 2.26, 95% CI: 0.70-7.33, p = 0.17). Notably, SGLT-2 inhibitors significantly decreased AKI in specific subgroups, including patients with HF with reduced ejection fraction (RR 0.59, 95% CI 0.43-0.80, p = 0.0007), those treated with empagliflozin (RR 0.70, 95% CI 0.57-0.88, p = 0.002) or dapagliflozin (RR 0.74, 95% CI 0.57-0.98, p = 0.04), in studies with a follow-up of at least 1 year (RR 0.67, 95% CI 0.55-0.82, p = 0.0001), and in patients aged 65 years or older (RR 0.72, 95% CI 0.61-0.85, p < 0.0001).<h4>Conclusion</h4>Use of SGLT-2 inhibitors did not increase the incidence of AKI regardless of the ejection fraction environment (chronic and acute), type of SGLT-2 inhibitors, or patient age.

SERPINC1
Also flagged:thrombotic diseasescoagulationfibrinolysisThrombotic diseasevenous thrombosisarterial thrombosis
Journal Article 2024-08-27 ✓ 1 Snippet Wang R, Tang LV, Hu Y.
In-Text Gene Mentions

…S deficiencies, antithrombinSERPINC1, PAI-1 4G/5G polymorphism.…

Show Full Abstract

In thrombotic diseases, coagulation, anticoagulation, and fibrinolysis are three key physiological processes that interact to maintain blood in an appropriate state within blood vessels. When these processes become imbalanced, such as excessive coagulation or reduced anticoagulant function, it can lead to the formation of blood clots. Genetic factors play a significant role in the onset of thrombotic diseases and exhibit regional and ethnic variations. The decision of whether to initiate prophylactic anticoagulant therapy is a matter that clinicians must carefully consider, leading to the development of various thrombotic risk assessment scales in clinical practice. Given the considerable heterogeneity in clinical diagnosis and treatment, researchers are exploring the application of artificial intelligence in medicine, including disease prediction, diagnosis, treatment, prevention, and patient management. This paper reviews the research progress on various genetic factors involved in thrombotic diseases, analyzes the advantages and disadvantages of commonly used thrombotic risk assessment scales and the characteristics of ideal scoring scales, and explores the application of artificial intelligence in the medical field, along with its future prospects.

HFE
Also flagged:NAFLDNonalcoholic fatty liver diseaseabdominal obesityC-reactive proteinCRPmetabolic syndrome
Journal Article 2024-08-27 ✓ 1 Snippet Doustmohammadian A, Amirkalali B, de Courten B, Esfandyari S, Motamed N, Maadi M, Ajdarkosh H, Gholizadeh E, Chaibakhsh S, Zamani F.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, virus infection, alcoholic…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is expanding as a global health problem with approximately 25% of the world's population affected by it. Dietary modification is one of the most important strategies for preventing NAFLD. The association between nutrient density and the Healthy Eating Index 2015 (HEI2015) with NAFLD demonstrates that nutrient density is an independent predictor of NAFLD in Iranian adults [fully adjusted model: OR (95% CI)<sub>tertile3vs.1</sub>: 0.68 (0.54-0.85), P <sub>for trend</sub> = 0.001]. However, a favorable association between NAFDL and diet quality (HEI 2015) is more pronounced in participants with abdominal obesity [fully adjusted model: OR (95% CI)<sub>tertile3vs.1</sub>: 0.63 (0.41-0.98), P <sub>for trend</sub> = 0.03]. Based on the gender-stratified path analysis, diet quality indirectly through Waist-to-Height Ratio (WHtR), C-reactive protein (CRP), and metabolic syndrome in women, and men through WHtR, hemoglobin A1c (HBA1c), CRP, and metabolic syndrome affects NAFLD. Nutrient density directly and indirectly in women through WHtR, CRP, and metabolic syndrome, and in men indirectly through WHtR, hemoglobin A1c, and metabolic syndrome negatively affect NAFLD. Hence, in these subjects; we can provide early dietary intervention and education to prevent progression to NAFLD.

PLCL1
Also flagged:TrkBpeptideBDNF receptorAlzheimer's diseaseADbrain-derived neurotrophic factor
Journal Article 2024-08-27 ✓ 1 Snippet Fonseca-Gomes J, Costa-Coelho T, Ferreira-Manso M, Inteiro-Oliveira S, Vaz SH, Alemãn-Serrano N, Atalaia-Barbacena H, Ribeiro-Rodrigues L, Ramalho RM, Pinto R, Vicente Miranda H, Tanqueiro SR, de Almeida-Borlido C, Ramalho MJ, Miranda-Lourenço C, Belo RF, Ferreira CB, Neves V, Rombo DM, Viais R, Umemori J, Martins IC, Jerónimo-Santos A, Caetano A, Manso N, Mäkinen P, Marttinen M, Takalo M, Bremang M, Pike I, Haapasalo A, Loureiro JA, Pereira MC, Santos NC, Outeiro TF, Castanho MARB, Fernandes A, Hiltunen M, Duarte CB, Duarte CB, Castrén E, de Mendonça A, Sebastião AM, Rodrigues TM, Diógenes MJ.
In-Text Gene Mentions

…, Slc20a1 ,Plcl1, Got1 ).…

Show Full Abstract

In Alzheimer's disease (AD), amyloid β (Aβ)-triggered cleavage of TrkB-FL impairs brain-derived neurotrophic factor (BDNF) signaling, thereby compromising neuronal survival, differentiation, and synaptic transmission and plasticity. Using cerebrospinal fluid and postmortem human brain samples, we show that TrkB-FL cleavage occurs from the early stages of the disease and increases as a function of pathology severity. To explore the therapeutic potential of this disease mechanism, we designed small TAT-fused peptides and screened their ability to prevent TrkB-FL receptor cleavage. Among these, a TAT-TrkB peptide with a lysine-lysine linker prevented TrkB-FL cleavage both in vitro and in vivo and rescued synaptic deficits induced by oligomeric Aβ in hippocampal slices. Furthermore, this TAT-TrkB peptide improved the cognitive performance, ameliorated synaptic plasticity deficits and prevented Tau pathology progression in vivo in the 5XFAD mouse model of AD. No evidence of liver or kidney toxicity was found. We provide proof-of-concept evidence for the efficacy and safety of this therapeutic strategy and anticipate that this TAT-TrkB peptide has the potential to be a disease-modifying drug that can prevent and/or reverse cognitive deficits in patients with AD.

DCC
Also flagged:AR
Journal Article 2024-08-27 ✓ 1 Snippet Fadel A, Findlay BL, Ubl D, Warner JN, Viers BR, Anderson KT.
In-Text Gene Mentions

…P = .04),DCC(OR 2.76 [1.24-6.15],…

Show Full Abstract

<h4>Objective</h4>To study the impact of frailty on healthcare utilization in patients undergoing benign pelvic reconstructive surgery; specifically, bladder augmentation.<h4>Methods</h4>American College of Surgeons National Surgical Quality Improvement Program (ACS-NSQIP) was queried for adults undergoing bladder augmentation between 2005 and 2022. The Five-Item Frailty Index (FFI) was used to assign a score from 0 to 6. Healthcare resource utilization (HRU) was defined by 4 metrics: prolonged length of stay (PLOS), 30-day postoperative readmissions (AR), discharge to continued care (ie, non-home location) (DCC), overall HRU which is a composite of the other 3 outcomes, and complications. Multivariable risk-adjusted regression models were generated.<h4>Results</h4>Three hundred sixty-four patients were included, the majority being white (71%), female (52%), with a median age of 49 years. After controlling for baseline variables, higher FFI score (≥2) was independently associated with PLOS (OR 1.90 [1.02-3.53], P = .04), DCC (OR 2.76 [1.24-6.15], P = .01), and greater overall HRU (OR 2.64 [1.29-5.40], P = .008) but not AR (OR 2.27 [0.99-5.19], P = .05). Higher frailty (FFI ≥2) was independently associated with experiencing any complication (OR 2.32 [1.16-4.64], P = .02) as well as major complications (Clavien ≥3) (OR 2.56 [1.15-5.7] P = .02).<h4>Conclusion</h4>Frail adults undergoing bladder augmentation experience greater HRU and complications. This highlights the importance of frailty in benign pelvic reconstructive surgery and stresses the need for interventions to optimize frail patients.

HMGN4
Also flagged:Lactylationliver fibrosishistoneS100A6IFI16LDHB
Journal Article 2024-08-27 ✓ 5 Snippets Li LN, Li WW, Xiao LS, Lai WN.
In-Text Gene Mentions

…algorithms, namely S100A6,HMGN4, IFI16, LDHB, S100A4,…

…genes included S100A6,HMGN4, IFI16, LDHB, S100A4,…

…candidates, namely S100A6,HMGN4, IFI16, LDHB, S100A4,…

…0.773 (S100A6 andHMGN4).…

…immunocyte correlated withHMGN4, IFI16, and LDHB,…

Show Full Abstract

<h4>Introduction</h4>Precise staging and classification of liver fibrosis are crucial for the hierarchy management of patients. The roles of lactylation are newly found in the progression of liver fibrosis. This study is committed to investigating the signature genes with histone lactylation and their connection with immune infiltration among liver fibrosis with different phenotypes.<h4>Methods</h4>Firstly, a total of 629 upregulated and 261 downregulated genes were screened out of 3 datasets of patients with liver fibrosis from the GEO database and functional analysis confirmed that these differentially expressed genes (DEGs) participated profoundly in fibrosis-related processes. After intersecting with previously reported lactylation-related genes, 12 DEGs related to histone lactylation were found and narrowed down to 6 core genes using R algorithms, namely S100A6, HMGN4, IFI16, LDHB, S100A4, and VIM. The core DEGs were incorporated into the Least absolute shrinkage and selection operator (LASSO) model to test their power to distinguish the fibrotic stage.<h4>Results</h4>Advanced fibrosis presented a pattern of immune infiltration different from mild fibrosis, and the core DEGs were significantly correlated with immunocytes. Gene set and enrichment analysis (GSEA) results revealed that core DEGs were closely linked to immune response and chemokine signaling. Samples were classified into 3 clusters using the LASSO model, followed by gene set variation analysis (GSVA), which indicated that liver fibrosis can be divided into status featuring lipid metabolism reprogramming, immunity immersing, and intermediate of both. The regulatory networks of the core genes shared several transcription factors, and certain core DEGs also presented dysregulation in other liver fibrosis and idiopathic pulmonary fibrosis (IPF) cohorts, indicating that lactylation may exert comparable functions in various fibrotic pathology. Lastly, core DEGs also exhibited upregulation in HCC.<h4>Discussion</h4>Lactylation extensively participates in the pathological progression and immune infiltration of fibrosis. Lactylation and related immune infiltration could be a worthy focus for the investigation of HCC developed from liver fibrosis.

PEBP1
Also flagged:CDGSH iron-sulfur domain 2MYCdeathironlipidcancer
Journal Article 2024-08-27 ✓ 2 Snippets Zhao X, Li L, Li Y, Liu Y, Wang H, Tabrizi NS, Ye Z, Zhao Z.
In-Text Gene Mentions

…, CHMP5 ,PEBP1, IDH1 ,…

…, ISCU ,PEBP1, and TNFAIP3…

Show Full Abstract

<h4>Background</h4>Ferroptosis, a form of regulated cell death associated with iron-dependent lipid peroxidation, plays a role in cancer progression. However, the specific mechanisms of ferroptosis in lung adenocarcinoma (LUAD) bone metastasis (BM) remain unclear. Using bioinformatics analysis, this study sought to identify the ferroptosis-associated genes involved in BM in LUAD, thus providing potential novel targets for the treatment of BM in LUAD.<h4>Methods</h4>The RNA expression dataset GSE10799 was acquired from the Gene Expression Omnibus (GEO) database, and intersected with the ferroptosis dataset to identify ferroptosis-related differentially expressed genes (DEGs). The expression of candidate genes and their correlation with the prognosis of LUAD patients were validated in The Cancer Genome Atlas (TCGA) database. A protein gene interaction network was constructed using GeneMania and Retrieval of Interacting Genes/Proteins (STRING) databases. The association between the candidate genes and immune cells was assessed via TCGA and Tumor IMmune Estimation Resource (TIMER) databases. The potential mechanisms were elucidated by a gene set enrichment analysis (GSEA). The relevant microRNAs (miRNAs or miRs) that bind to the 3'untranslated region (3'UTR) end of candidate genes' mRNA was explored using the TargetScan database. The expression of these candidate miRNAs in LUAD was validated and the correlation between candidate miRNAs and candidate mRNAs was tested using the TCGA database. Finally, the clinical data of 40 LUAD patients were retrospectively analyzed to evaluate the clinical value of candidate gene expression for LUAD BM patients.<h4>Results</h4>In this research, 15 ferroptosis-related DEGs in LUAD BM were identified. TCGA database analysis indicated that patients with low levels of CDGSH iron-sulfur domain 2 (<i>CISD2</i>) in LUAD had better disease-specific survival (DSS), overall survival (OS), and a better progression-free interval (PFI) than those with high levels of <i>CISD2</i>. The TIMER database results show that the expression of <i>CISD2</i> is correlated with the infiltration levels of various immune cells. The GSEA indicated that <i>CISD2</i> might influence biological activity in LUAD by participating in cell-cycle regulation, mitochondrial translation, DNA damage repair, c-<i>Myc</i> (<i>MYC</i>) activation, and the P53 signaling pathway. Through the combined analysis of the TargetScan and TCGA databases, hsa-miR-320a was identified as the optimal upstream regulatory miRNA. The immunohistochemistry data indicated that the positive CISD2 expression rates and immunohistochemistry scores of the patients with BM were significantly higher than those of the patients without BM (P<0.05). The high expression of CISD2 is a significant risk factor for BM in LUAD.<h4>Conclusions</h4>The downregulation of <i>CISD2</i> expression may extend DSS, OS, and the PFI of LUAD patients. Thus, <i>CISD2</i> could serve as a novel predictive biomarker for LUAD patients. Further, miR-320a might negatively regulate <i>CISD2</i> and participate in LUAD BM by activating <i>MYC</i>. These data provide a potential perspective for developing anticancer therapies for LUAD-BM patients.

TNFSF4
Also flagged:deathendoplasmic reticulumcancersgastric cancertumorImmunogenic cell death
Journal Article 2024-08-27 ✓ 3 Snippets Li W, Ding F, Zhang J.
In-Text Gene Mentions

…, TNFRSF8 ,TNFSF4, CD200 ,…

…checkpoint genes (TNFSF4, TNFSF14 ,…

…receptor genes (TNFSF4, TNFSF14 ,…

Show Full Abstract

<h4>Background</h4>Immunogenic cell death (ICD) is a functionally specialized form of apoptosis induced by endoplasmic reticulum (ER) stress and is associated with a variety of cancers, including gastric cancer (GC). In recent years, long non-coding RNAs (lncRNAs) have been shown to be important mediators in the regulation of ICD. However, the specific role and prognostic value of ICD-related lncRNAs in GC remain unclear. This study aims to develop an ICD-related lncRNAs signature for prognostic risk assessment in GC.<h4>Methods</h4>The ICD-related lncRNAs signature (ICDlncSig) of GC was constructed by univariate Cox regression analysis, least absolute shrinkage, and selection operator (LASSO) regression model and multivariate Cox regression analysis, and the signature was correlated with immune infiltration. The potential response of GC patients to immunotherapy was predicted by the tumor immune dysfunction and rejection (TIDE) algorithm. <i>In vitro</i> functional experiments were conducted to assess the impact of lncRNAs on the proliferation, migration, and invasion capabilities of GC cells.<h4>Results</h4>We constructed a novel ICDlncSig and found that this signature could be used as a prognostic risk model to predict survival of GC patients by validating it in the training cohort, testing cohort and entire cohort. The robust predictive power of the signature was demonstrated by building a Nomogram based on ICDlncSig scores and clinical characteristics. Furthermore, immune cell subpopulations, expression of immune checkpoint genes, and response to chemotherapy and immunotherapy differed significantly between the high- and low-risk groups. The <i>in vitro</i> functional experiments revealed that AP002954.1 and AP000695.1 can promote the proliferation, migration, and invasion of GC cells.<h4>Conclusions</h4>In conclusion, our ICDlncSig model has significant predictive value for the prognosis of GC patients and may provide clinical guidance for individualized immunotherapy.

Also flagged:Gentisic Acid5-FluorouracilColorectal Cancercancermitochondriatransmembrane
Journal Article 2024-08-27 No Snippets Suárez-Rozas C, Jara JA, Cortés G, Rojas D, Araya-Valdés G, Molina-Berrios A, González-Herrera F, Fuentes-Retamal S, Aránguiz-Urroz P, Campodónico PR, Maya JD, Vivar R, Catalán M.
Show Full Abstract

Colorectal cancer (CRC) is the third leading cause of cancer deaths in the world. Standard drugs currently used for the treatment of advanced CRC-such as 5-fluorouracil (5FU)-remain unsatisfactory in their results due to their high toxicity, high resistance, and adverse effects. In recent years, mitochondria have become an attractive target for cancer therapy due to higher transmembrane mitochondrial potential. We synthesized gallic acid derivatives linked to a ten-carbon aliphatic chain associated with triphenylphosphonium (TPP<sup>+</sup>C<sub>10</sub>), a lipophilic cationic molecule that induces the uncoupling of the electron transport chain (ETC). Other derivatives, such as gentisic acid (GA-TPP<sup>+</sup>C<sub>10</sub>), have the same effects on colorectal cancer cells. Although part of our group had previously reported preparing these structures by a convergent synthesis route, including their application via flow chemistry, there was no precedent for a new methodology for preparing these compounds. In this scenario, this study aims to develop a new linear synthesis strategy involving an essential step of Steglich esterification under mild conditions (open flask) and a high degree of reproducibility. Moreover, the study seeks to associate GA-TPP<sup>+</sup>C<sub>10</sub> with 5FU to evaluate synergistic antineoplastic effects. In addition, we assess the antimigratory effect of GA-TPP<sup>+</sup>C<sub>10</sub> and TPP<sup>+</sup>C<sub>10</sub> using human and mouse metastatic CRC cell lines. The results show a new and efficient synthesis route of these compounds, having synergistic effects in combination with 5FU, increasing apoptosis and enhancing cytotoxic properties. Additionally, the results show a robust antimigratory effect of GATPP<sup>+</sup>C10 and TPP<sup>+</sup>C<sub>10</sub>, reducing the activation pathways linked to tumor progression and reducing the expression of VEGF and MMP-2 and MMP-9, common biomarkers of advanced CRC. Moreover, TPP<sup>+</sup>C<sub>10</sub> and GA-TPP<sup>+</sup>C<sub>10</sub> increase the activity of metabolic signaling pathways through AMPK activation. The data allow us to conclude that these compounds can be used for in vivo evaluations and are a promising alternative associated with conventional therapies for advanced colorectal cancer. Additionally, the reported intermediates of the new synthesis route could give rise to analog compounds with improved therapeutic activity.

OLFM4
Also flagged:peptidesdigestionantimicrobial peptideantimicrobial peptidesmucusOxygen
Journal Article 2024-08-27 ✓ 5 Snippets Timmermans S, Wallaeys C, Garcia-Gonzalez N, Pollaris L, Saeys Y, Libert C.
In-Text Gene Mentions

…high expression ofOlfm4( Figure 1…

…characterized by highOlfm4and some Lgr5…

…defined by theOlfm4marker, which is…

…The expression ofOlfm4was approximately two-fold…

…total number ofOlfm4+ cells is…

Show Full Abstract

The small intestinal crypts harbor secretory Paneth cells (PCs) which express bactericidal peptides that are crucial for maintaining intestinal homeostasis. Considering the diverse environmental conditions throughout the course of the small intestine, multiple subtypes of PCs are expected to exist. We applied single-cell RNA-sequencing of PCs combined with deep bulk RNA-sequencing on PC populations of different small intestinal locations and discovered several expression-based PC clusters. Some of these are discrete and resemble tuft cell-like PCs, goblet cell (GC)-like PCs, PCs expressing stem cell markers, and atypical PCs. Other clusters are less discrete but appear to be derived from different locations along the intestinal tract and have environment-dictated functions such as food digestion and antimicrobial peptide production. A comprehensive spatial analysis using Resolve Bioscience was conducted, leading to the identification of different PC's transcriptomic identities along the different compartments of the intestine, but not between PCs in the crypts themselves.

HTTPEBP1CCDC92
Also flagged:type 2 diabetes mellitusmetforminbindingobesityinsulin resistanceinsulin
Journal Article 2024-08-27 ✓ 4 Snippets Damarov IS, Korbolina EE, Rykova EY, Merkulova TI.
In-Text Gene Mentions

…, 47 ],CCDC92[ 48 ],…

…54 ], andCCDC92[ 48 ]);…

…, RXRA ,HTT, and ITGAM.…

…, AIF1 ,PEBP1, CDE3; in…

Show Full Abstract

The goal of our study was to identify and assess the functionally significant SNPs with potentially important roles in the development of type 2 diabetes mellitus (T2DM) and/or their effect on individual response to antihyperglycemic medication with metformin. We applied a bioinformatics approach to identify the regulatory SNPs (rSNPs) associated with allele-asymmetric binding and expression events in our paired ChIP-seq and RNA-seq data for peripheral blood mononuclear cells (PBMCs) of nine healthy individuals. The rSNP outcomes were analyzed using public data from the GWAS (Genome-Wide Association Studies) and Genotype-Tissue Expression (GTEx). The differentially expressed genes (DEGs) between healthy and T2DM individuals (GSE221521), including metformin responders and non-responders (GSE153315), were searched for in GEO RNA-seq data. The DEGs harboring rSNPs were analyzed using the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). We identified 14,796 rSNPs in the promoters of 5132 genes of human PBMCs. We found 4280 rSNPs to associate with both phenotypic traits (GWAS) and expression quantitative trait loci (eQTLs) from GTEx. Between T2DM patients and controls, 3810 rSNPs were detected in the promoters of 1284 DEGs. Based on the protein-protein interaction (PPI) network, we identified 31 upregulated hub genes, including the genes involved in inflammation, obesity, and insulin resistance. The top-ranked 10 enriched KEGG pathways for these hubs included insulin, AMPK, and FoxO signaling pathways. Between metformin responders and non-responders, 367 rSNPs were found in the promoters of 131 DEGs. Genes encoding transcription factors and transcription regulators were the most widely represented group and many were shown to be involved in the T2DM pathogenesis. We have formed a list of human rSNPs that add functional interpretation to the T2DM-association signals identified in GWAS. The results suggest candidate causal regulatory variants for T2DM, with strong enrichment in the pathways related to glucose metabolism, inflammation, and the effects of metformin.

LRRC7
Also flagged:nucleusmelaninsynthesispigmentationtranscription factorsRARB
Journal Article 2024-08-27 ✓ 5 Snippets Li P, Wei X, Zi Q, Qu X, He C, Xiao B, Guo S.
In-Text Gene Mentions

…revealed that STIMATE,LRRC7, ENSGALG00000049990 , and…

…TMSB4, GSTO2, P2RX6,LRRC7, and PCDH10…

…Notably, 4 genes—LRRC7, STIMATE, ENSGALG00000049990 …

…4 genes— STIMATE,LRRC7, ENSGALG00000049990 , and…

…Conversely,LRRC7, while not…

Show Full Abstract

The black-bone chicken, known for its high melanin content, holds significant economic value due to this unique trait. Particularly notable is the prominent melanin deposition observed in its breast muscle. However, the molecular mechanisms governing melanin synthesis and deposition in the breast muscle of black-bone chickens remain largely unknown. This study employed a single-nucleus transcriptome assay to identify genes associated with melanin deposition in the breast muscle of black-bone chickens, which are presumed to influence pigmentation levels. A comprehensive analysis of the nuclear transcriptome was conducted on the breast muscle of Xuefeng black-bone chickens, encompassing 18 distinct cell types, including melanocytes. Our findings revealed that STIMATE, LRRC7, ENSGALG00000049990, and GLDC play pivotal regulatory roles in melanin deposition within the breast muscle. Further exploration into the molecular mechanisms unveiled transcription factors and protein interactions suggesting that RARB, KLF15, and PRDM4 may be crucial regulators of melanin accumulation in the breast muscle. Additionally, HPGDS, GSTO1, and CYP1B1 may modulate melanin production and deposition in the breast muscle by influencing melanocyte metabolism. Our findings also suggest that melanocyte function in the breast muscle may be intertwined with intercellular signaling pathways such as PTPRK-WNT5A, NOTCH1-JAG1, IGF1R-IGF1, IDE-GCG, and ROR2-WNT5A. Leveraging advanced snRNA-seq technology, we generated a comprehensive single-cell nuclear transcriptome atlas of the breast muscle of Xuefeng black-bone chickens. This facilitated the identification of candidate genes, regulatory factors, and cellular signals potentially influencing melanin deposition and melanocyte function. Overall, our study provides crucial insights into the molecular basis of melanin deposition in chicken breast muscle, laying the groundwork for future breeding programs aimed at enhancing black-bone chicken cultivation.

Also flagged:Coronary Artery Diseasemenopausecardiovascular diseasedeathangina pectorismyocardial infarction
Journal Article 2024-08-27 No Snippets Methorst R, Jongbloed MRM, Noordam R, DeRuiter MC.
Show Full Abstract

Pain manifestation following coronary artery disease (CAD) disease differs between men and women. Here, we aimed to provide evidence favoring possible differences in pain manifestation between men and women following CAD using Mendelian randomization (MR). We used summary-level data from sex-stratified genome-wide association studies on CAD and self-reported and clinically diagnosed chest, neck and shoulder, back, and facial pain using data from the UK Biobank cohort (<i>N</i> > 450,000) followed by two-sample MR (sensitivity) analyses. We identified 32 and 19 independent genetic variants associated with CAD for men and women, respectively, as instrumental variables. Genetically influenced CAD was associated with a higher risk of self-reported chest pain in both men (OR: 1.27, CI: 1.2-1.33) and women (OR: 1.44, CI: 1.20-1.73), with similar results for clinically diagnosed chest pain (men OR: 1.22, CI: 1.17-1.26; women OR: 1.31, CI: 1.18-1.46). In addition, in women only, genetically influenced CAD was associated with a higher risk of back pain (OR: 1.35, CI: 1.03-1.66) and neck and shoulder pain (OR: 1.22, CI: 0.91-1.63) (<i>p</i>-values for interaction with men: 0.030 and 0.041, respectively). Sensitivity analysis did not indicate the results were biased by directional pleiotropy. We found evidence, based on genetic predisposition for CAD, for different pain manifestations of CAD in men and women. While CAD was associated with chest pain in both sexes, we only found evidence for a higher risk of back pain and neck and shoulder pain in women, supporting common notions that women may present more often with uncharacteristic anginal symptoms.

Also flagged:Autoimmune diseasesSTAT
Journal Article 2024-08-27 No Snippets Saadat I, Saadat M.
Show Full Abstract

No abstract available.

Also flagged:AutismbehavioralmetabolismCYP1A2CYP2C19CYP2D6
Journal Article 2024-08-27 No Snippets Alvarez A, Santamaria N, Bote V, Medina R, Sanchez B, Mendez I, Monreal J, Arranz M, Hervas A.
Show Full Abstract

No abstract available.

NEGR1
Also flagged:ObesitydepressionInfliximabpioglitazonepalmitoylethanolamidemetabolic disorders
Journal Article 2024-08-27 ✓ 2 Snippets Lopez J, Zaghi-Lara R.
In-Text Gene Mentions

…related to theNEGR1gene and its…

…Alterations in theNEGR1gene, inflammatory markers,…

Show Full Abstract

No abstract available.

bioRxiv 2024-08-27 Preprint (No Snippets API) Moffatt MF, Nishimura T, Cox MJ, McBrien C, Burke C, Cuthbertson L, Lewis K, Attanoos R, Davies G, Chung KF, Robertus JL, Ish-Horowicz J, O’Carroll O, Bozeman JM, McGowan A, Hopkin JM, Lathrop GM, Riazalhosseini Y, Cookson WO.
Show Full Abstract

Asthma is characterized by reduced bronchial bacterial diversity and airway mucosal disruption. We examined spatial distributions of microbial sequences and host mucosal transcripts in bronchial biopsies from healthy controls and adult asthmatics. Bacteria were discovered by 16S ribosomal RNA staining in the lamina propria of all biopsies, with counts positively associated to lumenal bacterial diversity. Weighted correlation network analysis identified fifteen co-expression networks, including distinct programs of adaptive and innate immunity in differing spatial distributions. Stromal bacterial counts correlated significantly with eight of the network eigenvectors in directions compatible with beneficial relationships. The results suggest that dysbiosis may affect mucosal immunity through impaired interactions beneath the epithelial border. Intra-mucosal companion bacteria may be a potential substrate for selective management of immunity in a wide range of diseases. <h4>One-Sentence Summary</h4> The lung microbiome extends within the airway mucosa and associates spatially and functionally with immune networks.

SERPINC1
Also flagged:thrombophiliaFactor Vprotein Cprotein Santithrombin IIIATIII) deficiency
Journal Article 2024-08-26 ✓ 4 Snippets Esmaeilzadeh S, Jazayeri O, Aghajani MMR, Amiri SS, GolsorkhtabarAmiri M, Delavar MA, Mirabi P.
In-Text Gene Mentions

…(APCR), antithrombin III (ATIII) , Protein S…

…TheATIIIactivity in plasma…

…the frequencies ofATIII, PS, and PC…

…of APCR andATIIIdeficiencies and combined…

Show Full Abstract

<h4>Objective</h4>Many pieces of literature have reported that inherited and acquired thrombophilia might be a risk factor for recurrent implantation failure (RIF), however, most studies have only focused on RIF patients and not their male partners. We studied the possible association of paternal thrombophilia with RIF risk.<h4>Methods</h4>Forty-two male partners aged 20-45 suffered from RIF compared with 42 males from couples with at least one successful pregnancy. All participants were investigated for thrombophilia markers.<h4>Results</h4>The prevalence of coagulation Factor V activity was significantly higher in the case group (42.9%) than in the control group (16.7%) (p=0.008) (OR=3.75; 95% CI, 1.38, 10.12). The prevalence of protein C and protein S deficiencies in RIF patients were 4.8% and 2.4%, respectively, and 0% in the controls. The prevalence of antithrombin III (ATIII) deficiency was significantly higher in the case group (19%) than in the control group (2.4%) (p=0.01). None of MTHFR C677T and MTHFR A1298C were statistically significant between the two groups. Combined thrombophilia was 45.2% in the men of the RIF group when compared with the control, 14.2% (p=0.001) (OR = 4.95; 95% CI, 1.75-13.86).<h4>Conclusions</h4>Paternal thrombophilia may be related to recurrent implantation failure, so evaluation of this factor in RIF patients could be used to identify relevant risk groups and may help in the proper management of these cases to enhance the chance of implantation.

Also flagged:synthesisenaminepolymerssiloxanesacrylatespolyethylene glycols
Journal Article 2024-08-26 No Snippets Jadhav T, Dhokale B, Saeed ZM, Hadjichristidis N, Mohamed S.
Show Full Abstract

Dynamic covalent chemistry (DCC) has revolutionized the field of polymer science by offering new opportunities for the synthesis, processability, and recyclability of polymers as well as in the development of new materials with interesting properties such as vitrimers and covalent organic frameworks (COFs). Many DCC linkages have been explored for this purpose, but recently, enamine-ones have proven to be promising dynamic linkages because of their facile reversible transamination reactions under thermodynamic control. Their high stability, stimuli-responsive properties, and tunable kinetics make them promising dynamic cross-linkers in network polymers. Given the rapid developments in the field in recent years, this review provides a critical and up-to-date overview of recent developments in enamine-one chemistry, including factors that control their dynamics. The focus of the review will be on the utility of enamine-ones in designing a variety of processable and self-healable polymers with important applications in vitrimers and recyclable closed-loop polymers. The use of enamine-one linkages in crystalline polymers, known as COFs and their applications are also summarized. Finally, we provide an outlook for future developments in this field.

Also flagged:cytokineimmune responseinterferon‐gammaIFN-γMycobacterial diseaseMycobacterial Infectious Diseases
Journal Article 2024-08-26 No Snippets Gemici Karaaslan B, Rosain J, Bustamante J, Kıykım A.
Show Full Abstract

In recent decades, the prevalence of inborn errors of immunity has increased, necessitating the development of more effective treatment and care options for these highly morbid conditions. Due to these “experiments of nature,” the complicated nature of the immune system is being revealed. Based on the functional and molecular tests, targeted therapies are now being developed which offer a more effective approach and reduce damage. This study aimed to investigate a key cytokine of the cellular immune response, interferon‐gamma (IFN-γ), which is linked to Mendelian susceptibility to Mycobacterial disease, and its potential as a therapeutic option for IFN-γ deficiency.

HTT
Also flagged:Huntington's diseasepolyglutaminepathogenesisHDnucleusgene expression
Journal Article 2024-08-26 ✓ 5 Snippets Bai D, Deng F, Jia Q, Ou K, Wang X, Hou J, Zhu L, Guo M, Yang S, Jiang G, Li S, Li XJ, Yin P.
In-Text Gene Mentions

Pathogenic TDP-43 accelerates the generation of toxic exon1 HTT in Huntington's disease knock-in mice.

…exon1 of theHTTgene that encodes…

…generation of exon1Htt.…

…of the mouseHttpre‐mRNA, promotes the…

…transport of exon1‐intron1Httonto ribosome, resulting…

Show Full Abstract

Huntington's disease (HD) is caused by a CAG repeat expansion in exon1 of the HTT gene that encodes a polyglutamine tract in huntingtin protein. The formation of HTT exon1 fragments with an expanded polyglutamine repeat has been implicated as a key step in the pathogenesis of HD. It was reported that the CAG repeat length-dependent aberrant splicing of exon1 HTT results in a short polyadenylated mRNA that is translated into an exon1 HTT protein. Under normal conditions, TDP-43 is predominantly found in the nucleus, where it regulates gene expression. However, in various pathological conditions, TDP-43 is mislocalized in the cytoplasm. By investigating HD knock-in mice, we explore whether the pathogenic TDP-43 in the cytoplasm contributes to HD pathogenesis, through expressing the cytoplasmic TDP-43 without nuclear localization signal. We found that the cytoplasmic TDP-43 is increased in the HD mouse brain and that its mislocalization could deteriorate the motor and gait behavior. Importantly, the cytoplasmic TDP-43, via its binding to the intron1 sequence (GU/UG)n of the mouse Htt pre-mRNA, promotes the transport of exon1-intron1 Htt onto ribosome, resulting in the aberrant generation of exon1 Htt. Our findings suggest that cytoplasmic TDP-43 contributes to HD pathogenesis via its binding to and transport of nuclear un-spliced mRNA to the ribosome for the generation of a toxic protein product.

CDK5RAP1
Also flagged:Esophageal CancerFAM136AtumorscuproptosisHNRNPCALYREF
Journal Article 2024-08-26 ✓ 2 Snippets Sun S, Huang C, Fan W, Wang Z, Li K, Liu X, Wang Z, Zhao T, Zhang G, Li X.
In-Text Gene Mentions

Bioinformatics analysis suggested that FAM136A may participate in the following processes to promote ESCA development and progression: 1) Promotion of mast cells infiltration to influence the ESCA immune microenvironment, 2) HNRNPC upregulation to regulate m6A modification, 3) ALYREF upregulation to increase the occurrence of retained intron (RI) events, 4) CDK5RAP1 upregulation to achieve inhibition of tumor cell apoptosis, and 5) promotion of ESCA progression through the lncRNA SNHG15/hsa-miR-29c-3p/FAM136A ceRNA network.

…(RI) events, 4)CDK5RAP1upregulation to achieve…

Show Full Abstract

FAM136A promotes the progression and metastasis of various tumors. However, there are few studies on the role of FAM136A in esophageal cancer (ESCA). The TCGA, GTEx, and GEO databases are employed to analyze the expression of FAM136A in ESCA, and qPCR and TMA experiments are performed for validation. Enrichment analyzes are performed to investigate the association of FAM136A expression with immune features, m6A modification, alternative splicing, cuproptosis, and the ceRNA network via bioinformatics analysis. FAM136A is highly expressed in ESCA and correlated with lymph node metastasis and overall survival (OS). Bioinformatics analysis suggested that FAM136A may participate in the following processes to promote ESCA development and progression: 1) Promotion of mast cells infiltration to influence the ESCA immune microenvironment, 2) HNRNPC upregulation to regulate m6A modification, 3) ALYREF upregulation to increase the occurrence of retained intron (RI) events, 4) CDK5RAP1 upregulation to achieve inhibition of tumor cell apoptosis, and 5) promotion of ESCA progression through the lncRNA SNHG15/hsa-miR-29c-3p/FAM136A ceRNA network. FAM136A is a potential biomarker for ESCA diagnosis and treatment response evaluation, and the underlying mechanisms may be associated with immune infiltration, m6A modification, alternative splicing, cuproptosis, and the ceRNA regulatory network.

UNC13C
Also flagged:threonylcarbamoyladenosineolfactory receptorchromosomeALPIchromosomestaurine
Journal Article 2024-08-26 ✓ 1 Snippet Ben-Jemaa S, Boussaha M, Mandonnet N, Bardou P, Naves M.
In-Text Gene Mentions

…, PIK3C2G ,UNC13C, DYSF ,…

Show Full Abstract

Structural variants play an important role in evolutionary processes. Besides, they constitute a large source of inter individual genetic variation that might represent a major factor in the aetiology of complex, multifactorial traits. Their importance in adaptation is becoming increasingly evident in literature. Yet, the characterization of the genomic landscape of structural variants in local breeds remains scarce to date. Herein, we investigate patterns and gene annotation of structural variants in the Creole cattle from Guadeloupe breed using whole genome sequences from 23 bulls representative of the population. In total, we detected 32821 ascertained SV defining 15258 regions, representing ~ 17% of the Creole cattle genome. Among these, 6639 regions have not been previously reported in the Database of Genomic Variants archive. Average number of structural variants detected per individual in the studied population is in the same order of magnitude of that observed in indicine populations and higher than that reported in taurine breeds. We observe an important within-individual variability where approximately half of the detected structural variants have low frequency (MAF < 0.25). Most of the detected structural variants (55%) occurred in intergenic regions. Genic structural variants overlapped with 7793 genes and the predicted effect of most of them is ranked as "modifier". Among the structural variants that were predicted to have a high functional impact on the protein, a 5.5 Kb in length, highly frequent deletion on chromosome 2, affects ALPI, a gene associated with the interaction between gut microbiota and host immune system. The 6639 newly identified structural variants regions include three deletions and three duplications shared by more than 80% of individuals that are significantly enriched for genes related to tRNA threonylcarbamoyladenosine metabolic process, important for temperature adaptation in thermophilic organisms, therefore suggesting a potential role in the thermotolerance of Creole cattle from Guadeloupe cattle to tropical climate. Overall, highly frequent structural variants that are specific to the Creole cattle population encompass olfactory receptor and immunity genes as well as genes involved in muscle tone, muscle development and contraction. Beyond mapping and characterizing structural variants in the Creole cattle from Guadeloupe breed, this study provides valuable information for a better understanding of the potential role of chromosomal rearrangements in adaptive traits in cattle.

Also flagged:ADneurological disordercognitive declineamyloid betataupathogenesis
Journal Article 2024-08-26 No Snippets Ramamurthy E, Agarwal S, Toong N, Sestili H, Kaplow IM, Chen Z, Phan B, Pfenning AR.
Show Full Abstract

Alzheimer's disease (AD) involves aggregation of amyloid β and tau, neuron loss, cognitive decline, and neuroinflammatory responses. Both resident microglia and peripheral immune cells have been associated with the immune component of AD. However, the relative contribution of resident and peripheral immune cell types to AD predisposition has not been thoroughly explored due to their similarity in gene expression and function. To study the effects of AD-associated variants on cis-regulatory elements, we train convolutional neural network (CNN) regression models that link genome sequence to cell type-specific levels of open chromatin, a proxy for regulatory element activity. We then use in silico mutagenesis of regulatory sequences to predict the relative impact of candidate variants across these cell types. We develop and apply criteria for evaluating our models and refine our models using massively parallel reporter assay (MPRA) data. Our models identify multiple AD-associated variants with a greater predicted impact in peripheral cells relative to microglia or neurons. Our results support their use as models to study the effects of AD-associated variants and even suggest that peripheral immune cells themselves may mediate a component of AD predisposition. We make our library of CNN models and predictions available as a resource for the community to study immune and neurological disorders.

DCC
Also flagged:colorectal cancercancertumorUNC5D6-Thioguanineoxaliplatin
Journal Article 2024-08-26 ✓ 1 Snippet Zhang M, Li W, Zhao Y, Qi L, Xiao Y, Liu D, Peng T.
In-Text Gene Mentions

…tumor suppressor geneDCC[ 25 ,…

Show Full Abstract

Colorectal cancer (CRC) ranks as the third most prevalent cancer globally and stands as the second principal contributor to cancer-related fatalities. Recently, emerging research has emphasized the role of pan apoptosis (PANoptosis) in tumor development and anti-tumor therapy. In the course of this investigation, we meticulously identified and conducted a correlation analysis between differentially expressed genes associated with PANoptosis in CRC (CPAN_DEGs) and the proportion of immune cells. Subsequently, we formulated a prognostic score based on the CPAN_DEGs. Further our analysis revealed a noteworthy reduction in UNC5D mRNA expression within HCT116, HT29 and SW480 cells, as validated by qRT-PCR assay. Furthermore, scrutinizing the TCGA database unveiled a distinctive trend wherein individuals with the low UNC5D expression exhibited significantly reduced overall survival compared to their counterparts with the high UNC5D levels. The drug susceptibility analysis of UNC5D was further performed, which showed that UNC5D was corassociated with the sensitivity of CRC to 6-Thioguanine. The outcomes of our investigation underscore the mechanisms by which PANoptosis influences immune dysregulation as well as prognostic outcome in CRC.

Also flagged:papillary thyroid cancerthyroid cancerPTCepithelial-to-mesenchymal transitioncancertumour
Journal Article 2024-08-26 No Snippets Zhang J, Xu S.
Show Full Abstract

The global incidence of thyroid cancer has increased over recent decades. Papillary thyroid cancer (PTC) is the most common type of thyroid cancer and accounts for nearly 90% of all cases. Typically, PTC has a good prognosis. However, some PTC variants exhibit more aggressive behaviour, which significantly increases the risk of postoperative recurrence. Over the past decade, the high metastatic potential of PTC has drawn the attention of many researchers and these studies have provided useful molecular markers for improved diagnosis, risk stratification and clinical approaches. The aim of this review is to discuss the progress in epidemiology, metastatic features, risk factors and molecular mechanisms associated with PTC aggressiveness. We present a detailed picture showing that epithelial-to-mesenchymal transition, cancer metabolic reprogramming, alterations in important signalling pathways, epigenetic aberrations and the tumour microenvironment are crucial drivers of PTC metastasis. Further research is needed to more fully elucidate the pathogenesis and biological behaviour underlying the aggressiveness of PTC.

HTT
Also flagged:neurodegenerative diseasesHuntington's diseaseHDautosomal dominant neurodegenerative disorderchromosomenucleus
Journal Article 2024-08-26 ✓ 5 Snippets Gouravani M, Fekrazad S, Mafhoumi A, Ashouri M, DeBuc DC.
In-Text Gene Mentions

…of the huntingtin (HTT) gene at the…

…chromosome encoding theHTTprotein [ 1…

…the retina containsHTTprotein.…

…presence of dysmorphicHTTprotein in the…

…of the huntingtinHTTgene is expressed…

Show Full Abstract

<h4>Background</h4>A connection has been established between ocular structural changes and various neurodegenerative diseases. Several studies utilizing optical coherence tomography (OCT) have detected signs of ocular structural alterations among individuals with Huntington's disease (HD). The inconsistent results reported in the literature regarding alterations in the retina and choroid encouraged us to conduct this systematic review and meta-analysis to accumulate the findings.<h4>Methods</h4>A systematic search was carried out in three electronic databases (PubMed, Embase, Scopus) to find studies reporting OCT measurements in HD cases compared with healthy controls (HC). A fixed-effects or random-effects meta-analysis was conducted according to the detected heterogeneity level. Furthermore, subgroup and sensitivity analyses, meta-regression, and quality assessment were performed.<h4>Results</h4>Eleven studies were included in the systematic review and 9 studies with a total population of 452 participants (241 cases, and 211 HC) underwent meta-analysis. Results of the analysis denoted that subfoveal choroid had a significantly reduced thickness in HD eyes compared to HC (p < 0.0001). Moreover, our analysis indicated that HD cases had a significantly thinner average (p = 0.0130) and temporal peripapillary retinal nerve fiber layer (pRNFL) (p = 0.0012) than HC. However, subjects with pre-HD had insignificant differences in average (p = 0.44) and temporal pRNFL thickness (p = 0.33) with the HC group.<h4>Conclusion</h4>Results of the current systematic review and meta-analysis revealed the significant thinning of average and temporal pRNFL and subfoveal choroid in HD compared to HC. However, OCT currently might be considered insensitive to be applied in the pre-HD population at least until further longitudinal investigations considering variables such as the duration between OCT measurement and disease onset validating OCT as a routine diagnostic tool in HD clinics.

Also flagged:APOL6bladder cancerBLCAFerroptosisdeathApolipoprotein L6
Journal Article 2024-08-26 No Snippets Fan Z, Liu Y, Wang X, Xu Y, Huang R, Shi W, Qu Y, Ruan J, Zhou C, Zhao X, Liu L.
Show Full Abstract

<h4>Background</h4>Immune checkpoint inhibitors (ICIs) are rapidly evolving in the management of bladder cancer (BLCA). Nevertheless, effective biomarkers for predicting immunotherapeutic outcomes in BLCA are still insufficient. Ferroptosis, a form of immunogenic cell death, has been found to enhance patient sensitivity to ICIs. However, the underlying mechanisms of ferroptosis in promoting immunotherapy efficacy in BLCA remain obscure.<h4>Methods</h4>Our analysis of The Cancer Genome Atlas (TCGA) mRNA data using single sample Gene Set Enrichment Analysis (ssGSEA) revealed two immunologically distinct subtypes. Based on these subtypes and various other public cohorts, we identified Apolipoprotein L6 (APOL6) as a biomarker predicting the efficacy of ICIs and explored its immunological correlation and predictive value for treatment. Furthermore, the role of APOL6 in promoting ferroptosis and its mechanism in regulating this process were experimentally validated.<h4>Results</h4>The results indicate that APOL6 has significant immunological relevance and is indicative of immunologically hot tumors in BLCA and many other cancers. APOL6, interacting with acyl-coenzyme A synthetase long-chain family member 4 (ACSL4), mediates immunotherapy efficacy by ferroptosis. Additionally, APOL6 is regulated by signal transducer and activator of transcription 1 (STAT1).<h4>Conclusions</h4>To conclude, our findings indicate APOL6 has potential as a predictive biomarker for immunotherapy treatment success estimation and reveal the STAT1/APOL6/GPX4 axis as a critical regulatory mechanism in BLCA.

Also flagged:Cardiovascular diseasesCVDalcoholsleepChronic Diseaselipid
Journal Article 2024-08-26 No Snippets Kamp M, Pain O, Lewis CM, Ramsay M.
Show Full Abstract

<h4>Background</h4>Cardiovascular diseases (CVD) are a major health concern in Africa. Improved identification and treatment of high-risk individuals can reduce adverse health outcomes. Current CVD risk calculators are largely unvalidated in African populations and overlook genetic factors. Polygenic scores (PGS) can enhance risk prediction by measuring genetic susceptibility to CVD, but their effectiveness in genetically diverse populations is limited by a European-ancestry bias. To address this, we developed models integrating genetic data and conventional risk factors to assess the risk of developing cardiometabolic outcomes in African populations.<h4>Methods</h4>We used summary statistics from a genome-wide association meta-analysis (n = 14,126) in African populations to derive novel genome-wide PGS for 14 cardiometabolic traits in an independent African target sample (Africa Wits-INDEPTH Partnership for Genomic Research (AWI-Gen), n = 10,603). Regression analyses assessed relationships between each PGS and corresponding cardiometabolic trait, and seven CVD outcomes (CVD, heart attack, stroke, diabetes mellitus, dyslipidaemia, hypertension, and obesity). The predictive utility of the genetic data was evaluated using elastic net models containing multiple PGS (MultiPGS) and reference-projected principal components of ancestry (PPCs). An integrated risk prediction model incorporating genetic and conventional risk factors was developed. Nested cross-validation was used when deriving elastic net models to enhance generalisability.<h4>Results</h4>Our African-specific PGS displayed significant but variable within- and cross- trait prediction (max.R<sup>2</sup> = 6.8%, p = 1.86 × 10<sup>-173</sup>). Significantly associated PGS with dyslipidaemia included the PGS for total cholesterol (logOR = 0.210, SE = 0.022, p = 2.18 × 10<sup>-21</sup>) and low-density lipoprotein (logOR =  - 0.141, SE = 0.022, p = 1.30 × 10<sup>-20</sup>); with hypertension, the systolic blood pressure PGS (logOR = 0.150, SE = 0.045, p = 8.34 × 10<sup>-4</sup>); and multiple PGS associated with obesity: body mass index (max. logOR = 0.131, SE = 0.031, p = 2.22 × 10<sup>-5</sup>), hip circumference (logOR = 0.122, SE = 0.029, p = 2.28 × 10<sup>-5</sup>), waist circumference (logOR = 0.013, SE = 0.098, p = 8.13 × 10<sup>-4</sup>) and weight (logOR = 0.103, SE = 0.029, p = 4.89 × 10<sup>-5</sup>). Elastic net models incorporating MultiPGS and PPCs significantly improved prediction over MultiPGS alone. Models including genetic data and conventional risk factors were more predictive than conventional risk models alone (dyslipidaemia: R<sup>2</sup> increase = 2.6%, p = 4.45 × 10<sup>-12</sup>; hypertension: R<sup>2</sup> increase = 2.6%, p = 2.37 × 10<sup>-13</sup>; obesity: R<sup>2</sup> increase = 5.5%, 1.33 × 10<sup>-34</sup>).<h4>Conclusions</h4>In African populations, CVD and associated cardiometabolic trait prediction models can be improved by incorporating ancestry-aligned PGS and accounting for ancestry. Combining PGS with conventional risk factors further enhances prediction over traditional models based on conventional factors. Incorporating data from target populations can improve the generalisability of international predictive models for CVD and associated traits in African populations.

DCC
Also flagged:behaviouralreproductionmatingwater
Journal Article 2024-08-26 ✓ 1 Snippet Linssen H, de Knegt HJ, Eikelboom JAJ.
In-Text Gene Mentions

…Thus,DCChad the following…

Show Full Abstract

<h4>Background</h4>Animal movement arises from complex interactions between animals and their heterogeneous environment. To better understand the movement process, it can be divided into behavioural, temporal and spatial components. Although methods exist to address those various components, it remains challenging to integrate them in a single movement analysis.<h4>Methods</h4>We present an analytic workflow that integrates the behavioural, temporal and spatial components of the movement process and their interactions, which also allows for the assessment of the relative importance of those components. We construct a daily cyclic covariate to represent temporally cyclic movement patterns, such as diel variation in activity, and combine the three components in a multi-modal Hidden Markov Model framework using existing methods and R functions. We compare the trends and statistical fits of models that include or exclude any of the behavioural, spatial and temporal components, and perform variance partitioning on the model predictions that included all components to assess their relative importance to the movement process, both in isolation and in interaction.<h4>Results</h4>We apply our workflow to a case study on the movements of plains zebra, blue wildebeest and eland antelope in a South African reserve. Behavioural modes impacted movement the most, followed by diel rhythms and then the spatial environment (viz. tree cover and terrain slope). Interactions between the components often explained more of the movement variation than the marginal effect of the spatial environment did on its own. Omitting components from the analysis led either to the inability to detect relationships between input and response variables, resulting in overgeneralisations when drawing conclusions about the movement process, or to detections of questionable relationships that appeared to be spurious.<h4>Conclusions</h4>Our analytic workflow can be used to integrate the behavioural, temporal and spatial components of the movement process and quantify their relative contributions, thereby preventing incomplete or overly generic ecological interpretations. We demonstrate that understanding the drivers of animal movement, and ultimately the ecological phenomena that emerge from it, critically depends on considering the various components of the movement process, and especially the interactions between them.

CA10
Also flagged:enterovirus infectionsencephalitismeningitismyocarditisconjunctivitisrespiratory diseases
Journal Article 2024-08-26 ✓ 1 Snippet Sun J, Guo Y, Li L, Li Y, Zhou H, Li W.
In-Text Gene Mentions

…and coxsackievirus A10 (CA10) are the major…

Show Full Abstract

Human enteroviruses are highly prevalent world-wide. Up to more than 100 subtypes of enteroviruses can cause several diseases, including encephalitis, meningitis, myocarditis, hand-foot-mouth disease, conjunctivitis, respiratory diseases, and gastrointestinal diseases, thus posing a great threat to human health. This study aimed to investigate the epidemiological characteristics of enterovirus in children in Hangzhou, China before and after the COVID-19 outbreak. Systematic monitoring of enterovirus infections was performed by collecting samples from the children admitted to the inpatient wards and outpatient departments in the Children's Hospital, Zhejiang University School of Medicine, between January 2019 and May 2023. A commercial real-time RT PCR kit was utilized to detect enteroviruses. Among the 34,152 samples collected, 1162 samples, accounting for 3.4% of the samples, were tested positive for enteroviruses. The annual positive rates of the enteroviruses were 5.46%, 1.15%, 4.43%, 1.62%, and 1.96% in 2019, 2020, 2021, 2022, and May 2023, respectively. The positivity rate of the enteroviruses was highest among children aged 3-5 years and 5-7 years. Moreover, the monthly positivity rate of enterovirus infection ranged from 0.32% to 10.38%, with a peak in June and July. Serotypes, especially EV71 and CA16, causing severe symptoms such as HFMD, were decreasing, while the proportion of unidentified serotypes was on the rise. The incidence of enteroviruses in Hangzhou was higher in children aged 1-3 years and 7-18 years.

Also flagged:infectious diseasesoncological ailmentsviral infectionsarthropod-borne diseasesviral diseasesDNase
Journal Article 2024-08-26 No Snippets Cruvinel VRN, Carvalho E, Alves DCC, Marques CP, Bezerra RDS, Giovanetti M, Sampaio SC, Elias MC, Araújo WN, Haddad R, Slavov SN.
Show Full Abstract

Waste pickers constitute a marginalized demographic engaged in the collection of refuse, facing considerable occupational hazards that heighten their susceptibility to contract infectious diseases. Moreover, waste pickers contend with societal stigmatization and encounter barriers to accessing healthcare services. To explore the viral profile of waste pickers potentially linked to their occupational environment, we conducted a metagenomic analysis on 120 plasma specimens sampled from individuals employed at the Cidade Estrutural dumpsite in Brasilia city, Brazil. In total, 60 blood donors served as a comparative control group. Specimens were pooled and subjected to Illumina NextSeq 2000 sequencing. Viral abundance among waste pickers revealed the presence of significant pathogens, including HIV, HCV, and Chikungunya, which were not detected in the control group. Additionally, elevated levels of anelloviruses and Human pegivirus-1 were noted, with a comparable incidence in the control group. These findings underscore the utility of metagenomics in identifying clinically relevant viral agents within underserved populations. The implications of this study extend to informing public health policies aimed at surveilling infectious diseases among individuals facing socioeconomic disparities and limited access to healthcare resources.

Also flagged:alcoholalcohol use disordernucleusMAPKp53alcohol abuse
Journal Article 2024-08-26 No Snippets Besong OTO, Koo JS, Zhang H.
Show Full Abstract

Prolonged alcohol consumption can disturb the expression of both coding and noncoding genes in the brain. These dysregulated genes may co-express in modules and interact within networks, consequently influencing the susceptibility to developing alcohol use disorder (AUD). In the present study, we performed an RNA-seq analysis of the expression of both long noncoding RNAs (lncRNAs) and messenger RNAs (mRNAs) in 192 postmortem tissue samples collected from eight brain regions (amygdala, caudate nucleus, cerebellum, hippocampus, nucleus accumbens, prefrontal cortex, putamen, and ventral tegmental area) of 12 AUD and 12 control subjects of European ancestry. Applying the limma-voom method, we detected a total of 57 lncRNAs and 51 mRNAs exhibiting significant differential expression (P<sub>adj</sub> < 0.05 and fold-change ≥2) across at least one of the eight brain regions investigated. Machine learning analysis further confirmed the potential of these top genes in predicting AUD. Through Weighted Gene Co-expression Network Analysis (WGCNA), we identified distinct lncRNA-mRNA co-expression modules associated with AUD in each of the eight brain regions. Additionally, lncRNA-mRNA co-expression networks were constructed for each brain region using Cytoscape to reveal gene regulatory interactions implicated in AUD. Hub genes within these networks were found to be enriched in several key KEGG pathways, including Axon Guidance, MAPK Signaling, p53 Signaling, Adherens Junction, and Neurodegeneration. Our results underscore the significance of networks involving AUD-associated lncRNAs and mRNAs in modulating neuroplasticity in response to alcohol exposure. Further elucidating these molecular mechanisms holds promise for the development of targeted therapeutic interventions for AUD.

SERPINC1
Also flagged:depressioncorticosteroneMAPKPI3KAKTAKT1
Journal Article 2024-08-26 ✓ 1 Snippet Wu M, Yan X, Huang H, Guo X, Bai M, Wang B, Su P, Li Y, Xu E.
In-Text Gene Mentions

…(SA), atractylenolide III (ATIII), and tokinolide B…

Show Full Abstract

<h4>Ethnopharmacological relevance</h4>Modified Danzhi Xiaoyao San (MDXS) is an effective clinical prescription for depression in China, which was deprived of Danzhi Xiaoyao San in the Ming Dynasty. MDSX has significant implications for the development of new antidepressants, but its pharmacological mechanism has been rarely studied.<h4>Aim of the study</h4>To reveal the active components and molecular mechanism of MDXS in treating depression through network pharmacology and experimental verification in vivo and in vitro.<h4>Materials and methods</h4>UPLC-Q-TOF-MS/MS was used to identify the chemical components in the MDXS freeze-dried powder, drug-containing serum, and cerebrospinal fluid (CSF). Based on the analysis of prototype components in the CSF, the major constituents, potential therapeutic targets and possible pharmacological mechanisms of MDXS in treating depression were investigated using network pharmacological and molecular docking. Then corticosterone (CORT)-induced mice model of depression was established to investigate the antidepressant effects of MDXS. HT22 cells were cultured to verify the neuroprotective effects and core targets of the active components.<h4>Results</h4>There were 81 compounds in MDXS freeze-dried powder, 36 prototype components in serum, and 13 prototype components in CSF were identified, respectively. Network pharmacology analysis showed that these 13 prototype components in the CSF shared 190 common targets with depression, which were mainly enriched in MAPK and PI3K/AKT signaling pathways. PPI analysis suggested that AKT1 and MAPK1 (ERK1/2) were the core targets. Molecular docking revealed that azelaic acid (AA), senkyunolide A (SA), atractylenolide III (ATIII), and tokinolide B (TB) had the highest binding energy with AKT1 and MAPK1. Animal experiments verified that MDXS could reverse CORT-induced depression-like behaviors, improve synaptic plasticity, alleviate neuronal injury in hippocampal CA3 regions, and up-regulate the protein expression of p-ERK1/2 and p-AKT. In HT22 cells, azelaic acid, senkyunolide A, and atractylenolide III significantly protected the cell injury caused by CORT, and up-regulated the protein levels of p-ERK1/2 and p-AKT.<h4>Conclusions</h4>These results suggested that MDXS may exert antidepressant effects partially through azelaic acid, senkyunolide A, and atractylenolide III targeting ERK1/2 and AKT.

Also flagged:AMPKAMP-activated protein kinaseprotein kinasetoglucosekinase
Journal Article 2024-08-26 No Snippets Penugurti V, Manne RK, Bai L, Kant R, Lin HK.
Show Full Abstract

AMP-activated protein kinase (AMPK) is a protein kinase that plays versatile roles in response to a variety of physiological stresses, including glucose deprivation, hypoxia, and ischemia. As a kinase with pleiotropic functions, it plays a complex role in tumor progression, exhibiting both tumor-promoting and tumor-suppressing activities. On one hand, AMPK enhances cancer cell proliferation and survival, promotes cancer metastasis, and impairs anti-tumor immunity. On the other hand, AMPK inhibits cancer cell growth and survival and stimulates immune responses in a context-dependent manner. Apart from these functions, AMPK plays a key role in orchestrating aging and aging-related disorders, including cardiovascular diseases (CVD), Osteoarthritis (OA), and Diabetes. In this review article, we summarized the functions of AMPK pathway based on its oncogenic and tumor-suppressive roles and highlighted the importance of AMPK pathway in regulating cellular aging. We also spotlighted the significant role of various signaling pathways, activators, and inhibitors of AMPK in serving as therapeutic strategies for anti-cancer and anti-aging therapy.

Also flagged:gene expressiontoll-like receptorpolymerasedefense responsesinflammatory bowel diseasesimmune response
Journal Article 2024-08-26 No Snippets Truong AD, Tran HTT, Chu NT, Phan L, Phan HT, Dang TH, Dang HV, Nguyen A.
Show Full Abstract

<h4>Objective</h4>Probiotics are living microorganisms that can provide health benefits when consumed. Here, we investigated the effects of probiotics on gene expression in the spleen of mice using RNA-sequencing analysis between negative control and probiotic groups (including 4 Lactobacillus strains: Lactobacillus fermentum, L. casei, L. plantarum, and L. brevis).<h4>Methods</h4>Mice exposed with probiotic in 4 weeks by intragastric administration. Then, spleen tissues of the control and probiotics groups were collected on days 14 and 28 for RNA sequencing.<h4>Results</h4>In total, 665, 186, and 81 differentially expressed genes (DEGs) were significantly expressed on day 14 vs control, day 28 vs control groups, and probiotics day 28 vs day 14 groups, respectively. On the other hand, 12 toll-like receptor genes underwent additional validation through quantitative real-time polymerase chain reaction (qRT-PCR), affirming the increased alignment between qRT-PCR and RNA-Seq findings. In addition, the Kyoto encyclopedia of genes and genomes and gene ontology analyses revealed that the DEGs were predominantly enriched in defense responses to pathogens, including inflammatory bowel diseases, malaria, leukaemia virus 1, and herpes virus, as well as immune processes related to immune response and signal transduction. This study represents the first investigation into mice's gene expression in the spleen exposed to probiotics using Lactobacillus spp. isolated from a field strain in Vietnam.<h4>Conclusion</h4>Our results provide valuable insights into the impacts and functions of probiotics on mammalian development, offering crucial information for the potential therapeutic use of probiotics in defending against pathogens in Vietnam. The findings from this study highlight the potential of probiotics in modulating gene expression in the spleen, which may have implications for immune function and overall health in mice.

HFE
Also flagged:HERC1NCOA4osteosarcomaoxygentumorferroptosis
Journal Article 2024-08-26 ✓ 1 Snippet Zhang Y, Chen Y, Mou H, Huang Q, Jian C, Tao Y, Tan F, Ou Y.
In-Text Gene Mentions

…urodegenerative disorders, andhemochromatosis.…

Show Full Abstract

Over the past 30 years, the survival rate for osteosarcoma (OS) has remained stagnant, indicating persistent challenges in diagnosis and treatment. Photodynamic therapy (PDT) has emerged as a novel and promising treatment modality for OS. Despite apoptosis being the primary mechanism attributed to PDT, it fails to overcome issues such as low efficacy and resistance. Ferroptosis, a Fe<sup>2+</sup>-dependent cell death process, has the potential to enhance PDT's efficacy by increasing reactive oxygen species (ROS) through the Fenton reaction. In this study, we investigated the anti-tumor mechanism of PDT and introduced an innovative therapeutic strategy that synergistically induces apoptosis and ferroptosis. Furthermore, we have identified HERC1 as a pivotal protein involved in the ubiquitination and degradation of NCOA4, while also uncovering a potential regulatory factor involving NRF2. Ultimately, by targeting the HERC1-NCOA4 axis during PDT, we successfully achieved full activation of ferroptosis, which significantly enhanced the anti-tumor efficacy of PDT. In conclusion, these findings provide new theoretical evidence for further characterizing mechanism of PDT and offer new molecular targets for the treatment of OS.

BTN2A1
Also flagged:tumorstumormajor histocompatibility complexMHCsolid tumorTNF receptor superfamily member 6
Journal Article 2024-08-26 ✓ 2 Snippets Zhu D, Ren X, Xie W, Chen J, Liang S, Jiang M, Wang J, Zheng Z.
In-Text Gene Mentions

…in 3A-butyrophilin 2A1 (BTN3A-BTN2A1) complexes, and interactions…

…as FAS/FASL pathways, BTN3A-BTN2A1complexes, and their…

Show Full Abstract

Gamma/delta T (γδ T)cells possess a unique mechanism for killing tumors, making them highly promising and distinguished among various cell therapies for tumor treatment. This review focuses on the major histocompatibility complex (MHC)-independent recognition of antigens and the interaction between γδ T cells and solid tumor cells. A comprehensive review is provided regarding the classification of human gamma-delta T cell subtypes, the characteristics and mechanisms underlying their functions, as well as their r545egulatory effects on tumor cells. The involvement of γδ T cells in tumorigenesis and migration was also investigated, encompassing potential therapeutic targets such as apoptosis-related molecules, the TNF receptor superfamily member 6(FAS)/FAS Ligand (FASL) pathways, butyrophilin 3A-butyrophilin 2A1 (BTN3A-BTN2A1) complexes, and interactions with CD4, CD8, and natural killer (NK) cells. Additionally, immune checkpoint inhibitors such as programmed cell death protein 1/Programmed cell death 1 ligand 1 (PD-1/PD-L1) have the potential to augment the cytotoxicity of γδ T cells. Moreover, a review on gamma-delta T cell therapy products and their corresponding clinical trials reveals that chimeric antigen receptor (CAR) gamma-delta T therapy holds promise as an approach with encouraging preclinical outcomes. However, practical issues pertaining to manufacturing and clinical aspects need resolution, and further research is required to investigate the long-term clinical side effects of CAR T cells. In conclusion, more comprehensive studies are necessary to establish standardized treatment protocols aimed at enhancing the quality of life and survival rates among tumor patients utilizing γδ T cell immunotherapy.

HFE
Also flagged:CD4CD8co-receptorscancerT cell antigen receptormajor histocompatibility complex class I
Journal Article 2024-08-26 ✓ 1 Snippet Srinivasan S, Zhu C, McShan AC.
In-Text Gene Mentions

…T22, M10.5, MILL,HFE, FcRn), is required…

Show Full Abstract

Expressed on the surface of CD8<sup>+</sup> T cells, the CD8 co-receptor is a key component of the T cells that contributes to antigen recognition, immune cell maturation, and immune cell signaling. While CD8 is widely recognized as a co-stimulatory molecule for conventional CD8<sup>+</sup> αβ T cells, recent reports highlight its multifaceted role in both adaptive and innate immune responses. In this review, we discuss the utility of CD8 in relation to its immunomodulatory properties. We outline the unique structure and function of different CD8 domains (ectodomain, hinge, transmembrane, cytoplasmic tail) in the context of the distinct properties of CD8αα homodimers and CD8αβ heterodimers. We discuss CD8 features commonly used to construct chimeric antigen receptors for immunotherapy. We describe the molecular interactions of CD8 with classical MHC-I, non-classical MHCs, and Lck partners involved in T cell signaling. Engineered and naturally occurring CD8 mutations that alter immune responses are discussed. The applications of anti-CD8 monoclonal antibodies (mABs) that target CD8 are summarized. Finally, we examine the unique structure and function of several CD8/mAB complexes. Collectively, these findings reveal the promising immunomodulatory properties of CD8 and CD8 binding partners, not only to uncover basic immune system function, but to advance efforts towards translational research for targeted immunotherapy.

ECI2
Also flagged:transposasechromatintranscription factorsFoxh1Mef2Mef2a
Journal Article 2024-08-26 ✓ 1 Snippet Lan Y, Yan D, Li X, Zhou C, Bai Y, Dong X.
In-Text Gene Mentions

…HABP2 from ATAC-seq,ECI2and SUSD4 from…

Show Full Abstract

As one of the largest tissues in the animal body, skeletal muscle plays a pivotal role in the production and quality of pork. Consequently, it is of paramount importance to investigate the growth and developmental processes of skeletal muscle. Lijiang pigs, which naturally have two subtypes, fast-growing and slow-growing, provide an ideal model for such studies by eliminating breed-related influences. In this study, we selected three fast-growing and three slow-growing 6-month-old Lijiang pigs as subjects. We utilized assay for transposase-accessible chromatin with sequencing (ATAC-seq) combined with genomics, RNA sequencing, and proteomics to screen for differentially expressed genes and transcription factors linked to increased longissimus dorsi muscle volume in Lijiang pigs. We identified 126 genes through ATAC-seq, including <i>PPARA</i>, <i>TNRC6B</i>, <i>NEDD1</i>, and <i>FKBP5</i>, that exhibited differential expression patterns during muscle growth. Additionally, we identified 59 transcription factors, including Foxh1, JunB, Mef2 family members (Mef2a/b/c/d), NeuroD1, and TEAD4. By examining open chromatin regions (OCRs) with significant genetic differentiation, genes such as <i>SAV1</i>, <i>CACNA1H</i>, <i>PRKCG</i>, and <i>FGFR4</i> were found. Integrating ATAC-seq with transcriptomics and transcriptomics with proteomics, we identified differences in open chromatin regions, transcription, and protein levels of <i>FKBP5</i> and <i>SCARB2</i> genes in fast-growing and slow-growing Lijiang pigs. Utilizing multi-omics analysis with R packages, we jointed ATAC-seq, transcriptome, and proteome datasets, identifying enriched pathways related to glycogen metabolism and skeletal muscle cell differentiation. We pinpointed genes such as MYF6 and HABP2 that exhibit strong correlations across these diverse data types. This study provides a multi-faceted understanding of the molecular mechanisms that lead to differences in pig muscle fiber growth.

Also flagged:voltage-gated ion channelTuberous Sclerosis Complexmammalian target of rapamycinmTORepilepsyvoltage-gated ion channels
Journal Article 2024-08-26 No Snippets Egido-Betancourt HX, Strowd Iii RE, Raab-Graham KF.
Show Full Abstract

Tuberous Sclerosis Complex (TSC) is a lynchpin disorder, as it results in overactive mammalian target of rapamycin (mTOR) signaling, which has been implicated in a multitude of disease states. TSC is an autosomal dominant disease where 90% of affected individuals develop epilepsy. Epilepsy results from aberrant neuronal excitability that leads to recurring seizures. Under neurotypical conditions, the coordinated activity of voltage-gated ion channels keep neurons operating in an optimal range, thus providing network stability. Interestingly, loss or gain of function mutations in voltage-gated potassium, sodium, or calcium channels leads to altered excitability and seizures. To date, little is known about voltage-gated ion channel expression and function in TSC. However, data is beginning to emerge on how mTOR signaling regulates voltage-gated ion channel expression in neurons. Herein, we provide a comprehensive review of the literature describing common seizure types in patients with TSC, and suggest possible parallels between acquired epilepsies with known voltage-gated ion channel dysfunction. Furthermore, we discuss possible links toward mTOR regulation of voltage-gated ion channels expression and channel kinetics and the underlying epileptic manifestations in patients with TSC.

DCC
Also flagged:cuticle collagentransmembrane receptorLARextracellularPerlecancollagens
Journal Article 2024-08-26 ✓ 1 Snippet Lundquist E.
In-Text Gene Mentions

…molecules including UNC-40 /DCCand PTP-3 /LAR…

Show Full Abstract

Nervous systems of bilaterally-symmetric animals display left-right asymmetries in development. In <i>Caenorhabditis elegans</i> , the Q neuroblasts display left-right asymmetry of migration, with QR on the right migrating anteriorly and QL on the left migrating posteriorly. Previous worked showed that a group of transmembrane receptor molecules including UNC-40 /DCC and PTP-3 /LAR control direction of initial Q migration. However, no classical secreted paracrine growth factor has been identified. Previous work showed that molecules in the extracellular matrix are involved, including UNC-52 /Perlecan and the cuticle collagens DPY-17 and SQT-3 . This report shows that the cuticle collagen DPY-14 is also involved, and genetically acts with DPY-17 and SQT-3 , possibly in a collagen trimer. DPY-14 might be a component of an inherent left-right chirality in the extracellular matrix that directs left-right asymmetric Q neuroblast migration.

PLCL1
Also flagged:kidney renal clear cell carcinomarenal cancerGene ExpressioncancerTumorpolymerase
Journal Article 2024-08-26 ✓ 5 Snippets Liu Q, Ding J.
In-Text Gene Mentions

…(i.e., BPHL ,PLCL1, CLIC5 ,…

…of BPHL ,PLCL1, CLIC5 ,…

…, BPHL ,PLCL1, CLIC5 and…

…HRs— BPHL ,PLCL1, CLIC5 ,…

…al. showed thatPLCL1inhibits tumor progression…

Show Full Abstract

<h4>Background</h4>Many factors affect the prognosis of kidney renal clear cell carcinoma (KIRC). Early diagnosis can significantly improve the prognosis of KIRC patients. Therefore, a method needs to be developed to diagnose KIRC early, predict patient prognosis, and improve personalized treatments. The objective of this study is to utilize bioinformatics tools and public database resources to identify differentially expressed genes (DEGs) between renal cancer tissues and adjacent normal tissues, and to further screen for prognostic-related genes (PRGs) of KIRC.<h4>Methods</h4>KIRC was studied using R language and FunRich software and several databases, including the Gene Expression Omnibus (GEO), The Cancer Genome Atlas (TCGA), the University of Alabama at Birmingham cancer data analysis Portal (UALCAN), and Tumor Immune Estimation Resource (TIMER) databases. Moreover, quantitative real-time polymerase chain reaction (qRT-PCR) was used to validate the expression of multiple genes in KIRC and adjacent normal tissues.<h4>Results</h4>There were substantial differences in immune cell infiltration between the KIRC and adjacent normal tissues in the GSE40435 and GSE46699 datasets. In addition, we screened multiple PRGs of KIRC by combining the GEO and TCGA data. The UALCAN database verified that some representative PRGs were differently expressed depending on the lymph node metastasis status, grade, and stage of KIRC. The qRT-PCR results confirmed the expression of the PRGs in KIRC and adjacent normal tissues. Through the GO and KEGG analyses, interaction analysis, and TIMER database, we found that the prognosis of KIRC was closely related to immune microenvironment and vascular endothelial growth factor (VEGF)/VEGF receptor (VEGFR) signaling.<h4>Conclusions</h4>Our findings could contribute to the prognosis prediction of KIRC, the selection of personalized treatments, and the early diagnosis of KIRC.

RABGAP1L
Also flagged:bladder cancertumorα1C-tubulinprogrammed cell death protein 1cytotoxic T-lymphocyte associated protein 4TUBA1C
Journal Article 2024-08-26 ✓ 3 Snippets Chen C, Zhang J, Liu X, Zhuang Q, Lu H, Hou J.
In-Text Gene Mentions

…, MFN2 ,RABGAP1L, ORM1 ,…

…+ (−0.0941) ×RABGAP1Lexp + 0.0006…

…GNB3, TUBA1C, MFN2,RABGAP1L, KIF1B.…

Show Full Abstract

<h4>Background</h4>Bladder cancer carries a large societal burden, with over 570,000 newly diagnosed cases and 210,000 deaths globally each year. Platelets play vital functions in tumor progression and therapy benefits. We aimed to construct a platelet-related signature (PRS) for the clinical outcome of bladder cancer cases.<h4>Methods</h4>Ten machine learning techniques were used in the integrative operations to build PRS using the datasets from The Cancer Genome Atlas (TCGA), gene series expression (GSE)13507, GSE31684, GSE32894 and GSE48276. A number of immunotherapy datasets and prediction scores, including GSE91061, GSE78220, and IMvigor210, were utilized to assess how well the PRS predicted the benefit of immunotherapy. Vitro experiment was performed to verify the role of α1C-tubulin (TUBA1C) in bladder cancer.<h4>Results</h4>Enet (alpha =0.4) algorithm-based PRS had the highest average C-index of 0.73 and it was suggested as the optimal PRS. PRS acted as an independent risk factor for bladder cancer and patients with high PRS score portended a worse overall survival rate, with the area under the curve of 1-, 3- and 5-year operating characteristic curve being 0.754, 0.779 and 0.806 in TCGA dataset. A higher level of immune-activated cells, cytolytic function and T cell co-stimulation was found in the low PRS score group. Low PRS score demonstrated a higher tumor mutation burden score and programmed cell death protein 1 & cytotoxic T-lymphocyte associated protein 4 immunophenoscore, lower tumor immune dysfunction and exclusion score, intratumor heterogeneity score and immune escape score in bladder cancer, suggesting the PRS as an indicator for predicting immunotherapy benefits. Vitro experiment showed that TUBA1C was upregulated in bladder cancer and knockdown of TUBA1C obviously suppressed tumor cell proliferation.<h4>Conclusions</h4>The present study developed an ideal PRS for bladder cancer, which may be used as a predictor of prognosis, a risk classification system, and a therapy guide.

HFE
Also flagged:Crohn's DiseaseHepatocellular CarcinomaLiver Cirrhosisiron-hereditary hemochromatosishepatic cirrhosis
Journal Article 2024-08-26 ✓ 5 Snippets Alrawashdeh D, Jibon N, Raheem A, Sankar S, Warrier V.
In-Text Gene Mentions

…Crohn's Disease,Hemochromatosis, Hepatocellular Carcinoma, an…

Hemochromatosis, an inherited disorder…

…rare coexistence ofhemochromatosisand Crohn's disease,…

Hemochromatosisis an iron…

…mutations of theHFEgene, with C282Y…

Show Full Abstract

Hemochromatosis, an inherited disorder characterized by excessive iron absorption and accumulation, can lead to organ damage and is a known contributor to liver cirrhosis. This case report discusses a 57-year-old man with a history of Crohn's disease, whose general practitioner identified elevated ferritin levels, cirrhotic liver features, and abnormal liver function tests. Further investigation revealed non-hereditary hemochromatosis, hepatic cirrhosis, and hepatocellular carcinoma (HCC). This case highlights the rare coexistence of hemochromatosis and Crohn's disease, underscoring the diagnostic and therapeutic challenges of managing these concurrent conditions. It also emphasizes the importance of prompt and effective treatment to prevent severe complications.

Also flagged:PolyketidesbenzoquinonePDE4esterembelin Aascorbic acid
Journal Article 2024-08-26 No Snippets Chen Y, Cai J, Xia Z, Chen C, Liu Y, Jayasinghe L, Wang X, Zhou X.
Show Full Abstract

Three new polyketides, including three ester derivatives (<b>1</b>, <b>3</b>, and <b>5</b>) and a new natural product, which was a benzoquinone derivative, embelin A (<b>4</b>), together with nine known ones (<b>2</b> and <b>6</b>-<b>13</b>), were isolated from the mangrove-derived fungus <i>Penicillium</i> sp. SCSIO 41411. Their structures were determined by detailed NMR and MS spectroscopic analyses. The X-ray single-crystal diffraction analysis of <b>4</b> was described for the first time. Compound <b>9</b> displayed obvious inhibition against PDE4 with an inhibitory ratio of 40.78% at 10 μM. Compound <b>12</b> showed DPPH radical scavenging activity, with an EC<sub>50</sub> of 16.21 µg/mL, compared to the positive control (ascorbic acid, EC<sub>50</sub>, 11.22 µg/mL). Furthermore, compound <b>4</b> exhibited cytotoxicity against PC-3 and LNCaP with IC<sub>50</sub> values of 18.69 and 31.62 µM, respectively.

BTN2A1
Also flagged:LipidMetabolismSterol Regulatory Element-Binding Protein 2PRRSV InfectionPorcine reproductive and respiratory syndromePRRS
Journal Article 2024-08-26 ✓ 1 Snippet Jiang D, Yang L, Meng X, Xu Q, Zhou X, Liu B.
In-Text Gene Mentions

…the mRNAs ofBTN2A1and PPARA were…

Show Full Abstract

Porcine reproductive and respiratory syndrome (PRRS) has caused substantial damage to the pig industry. MicroRNAs (miRNAs) were found to play crucial roles in modulating the pathogenesis of PRRS virus (PRRSV). In the present study, we revealed that PRRSV induced let-7f-5p to influence lipid metabolism to regulate PRRSV pathogenesis. A transcriptome analysis of PRRSV-infected PK15<sup>CD163</sup> cells transfected with let-7f-5p mimics or negative control (NC) generated 1718 differentially expressed genes, which were primarily associated with lipid metabolism processes. Furthermore, the master regulator of lipogenesis SREBP2 was found to be directly targeted by let-7f-5p using a dual-luciferase reporter system and Western blotting. The findings demonstrate that let-7f-5p modulates lipogenesis by targeting SREBP2, providing novel insights into miRNA-mediated PRRSV pathogenesis and offering a potential antiviral therapeutic target.

PRDX6
Also flagged:neurodegenerative diseasescalciumendoplasmic reticulumlipidintracellularinflammatory response
Journal Article 2024-08-26 ✓ 5 Snippets Jembrek MJ.
In-Text Gene Mentions

…Peroxiredoxin 6 (Prdx6) and clasmatodendrosis…

…of peroxiredoxin 6 (Prdx6), a multifunctional…

…uggest that the ROS-Prdx6-GPx1-GS axis is cru…

… aiPLA2 activity of Prdx6 abolishes the GPx1-…

…Altered Prdx6 activity has been associated wi…

Show Full Abstract

Oxidative stress, characterized by increased production of reactive oxygen species (ROS) and disturbed redox homeostasis, is one of the key mechanisms underlying synaptic loss and neuronal death in various neurodegenerative diseases [...].

HFE
Also flagged:Hepatocellular carcinomacancerdeathcirrhosisTrimethylaminecholine
Journal Article 2024-08-26 ✓ 2 Snippets Banerjee R, Wehrle CJ, Wang Z, Wilcox JD, Uppin V, Varadharajan V, Mrdjen M, Hershberger C, Reizes O, Yu JS, Lathia JD, Rotroff DM, Hazen SL, Tang WHW, Aucejo F, Brown JM.
In-Text Gene Mentions

…hepatitis C (34.1%),hemochromatosis(2.4%) and idiopathic…

…2, 8%) andhemochromatosis(n = 1,…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the third leading cause of cancer death worldwide. The gut microbiome has been implicated in outcomes for HCC, and gut microbe-derived products may serve as potential non-invasive indices for early HCC detection. This study evaluated differences in plasma concentrations of gut microbiota-derived metabolites.<h4>Methods</h4>Forty-one patients with HCC and 96 healthy controls were enrolled from surgical clinics at the Cleveland Clinic from 2016 to 2020. Gut microbiota-derived circulating metabolites detectable in plasma were compared between patients with HCC and healthy controls. Hierarchical clustering was performed for generating heatmaps based on circulating metabolite concentrations using ClustVis, with Euclidean and Ward settings and significant differences between metabolite concentrations were tested using a binary logistic regression model.<h4>Results</h4>In patients with HCC, 25 (61%) had histologically confirmed cirrhosis. Trimethylamine (TMA)-related metabolites were found at higher concentrations in those with HCC, including choline (<i>p</i> < 0.001), betaine (<i>p</i> < 0.001), carnitine (<i>p</i> = 0.007), TMA (<i>p</i> < 0.001) and trimethylamine N-oxide (TMAO, <i>p</i> < 0.001). Notably, concentrations of P-cresol glucuronide (<i>p</i> < 0.001), indole-lactic acid (<i>p</i> = 0.038), 5-hydroxyindoleacetic acid (<i>p</i> < 0.0001) and 4-hydroxyphenyllactic acid (<i>p</i> < 0.001) were also increased in those with HCC compared to healthy controls. Hierarchical clustering of the metabolite panel separated patients based on the presence of HCC (<i>p</i> < 0.001), but was not able to distinguish between patients with HCC based on the presence of cirrhosis (<i>p</i> = 0.42).<h4>Conclusions</h4>Gut microbiota-derived metabolites were differentially abundant in patients with HCC versus healthy controls. The observed perturbations of the TMAO pathway in HCC seem particularly promising as a target of future research and may have both diagnostic and therapeutic implications.

HTT
Also flagged:neurological diseasesglioblastoma multiformeneurological disorderscell proliferationimmune responsesinjuries
Journal Article 2024-08-26 ✓ 1 Snippet Li K, Zheng Y, Cai S, Fan Z, Yang J, Liu Y, Liang S, Song M, Du S, Qi L.
In-Text Gene Mentions

…the Huntington protein (HTT) gene.…

Show Full Abstract

The subventricular zone (SVZ) is a region surrounding the lateral ventricles that contains neural stem cells and neural progenitor cells, which can proliferate and differentiate into various neural and glial cells. SVZ cells play important roles in neurological diseases like neurodegeneration, neural injury, and glioblastoma multiforme. Investigating the anatomy, structure, composition, physiology, disease associations, and related mechanisms of SVZ is significant for neural stem cell therapy and treatment/prevention of neurological disorders. However, challenges remain regarding the mechanisms regulating SVZ cell proliferation, differentiation, and migration, delivering cells to damaged areas, and immune responses. In-depth studies of SVZ functions and related therapeutic developments may provide new insights and approaches for treating brain injuries and degenerative diseases, as well as a scientific basis for neural stem cell therapy. This review summarizes research findings on SVZ and neurological diseases to provide references for relevant therapies.

bioRxiv 2024-08-26 Preprint (No Snippets API) Zaidi Z, Dash DP, Sharma A, Kundu S, Bhatt S, Rao S, Padia K, Rai M, Chakraborty K.
Show Full Abstract

<h4>ABSTRACT</h4> Protein misfolding affects cellular fitness. This can be caused due to the toxic aggregation of one species of protein or global protein misfolding events. Since the fitness defect arises due to the multi-modal effect of misfolding, there is no consensus mechanism to alleviate this fitness defect. Here, we used adaptive laboratory evolution of thermotolerance to identify pathways contributing to proteotoxic stress resistance in S. cerevisiae . Our results suggest a link between thermotolerance and proteotoxicity resistance, majorly routed through the loss of mitochondrial DNA. Loss of mitochondrial DNA decreased the association of mistargeted misfolded proteins on the mitochondrial surface and altered the cellular response to proteostasis to enhance protein quality control associated degradation. We show that a decrease in the abundance of import channels is sufficient to mimic the loss of mtDNA and increase cellular proteostasis. Thus, we uncover a cryptic interorganellar cooperation in combating proteotoxicity in yeast.

HFE
Also flagged:Liver InjuryAcute Hepatitis Etransaminasesalanine transaminaseliver diseasesacute viral hepatitis
Journal Article 2024-08-25 ✓ 1 Snippet Müller SL, Kaumanns A, Adam KM, Osthoff M, Dräger S.
In-Text Gene Mentions

… nonalcoholic steatohepatitis,hemochromatosis, and alpha 1…

Show Full Abstract

BACKGROUND Common causes of severely elevated transaminases, especially alanine transaminase, due to liver diseases include drug-induced liver injury and acute viral hepatitis, especially hepatitis E, which can present similarly in clinical practice. Broad differential diagnostic workup in patients with elevated transaminases is required to not overlook the possibility of hepatitis E infection. CASE REPORT We report on a 65-year-old asymptomatic man who was referred to the Emergency Department from the rehabilitation center due to markedly elevated liver transaminases. Physical examination revealed no jaundice or abdominal pain. Laboratory findings included severely elevated aspartate transaminase, alanine transaminase, and bilirubin levels. He was previously treated with imipenem/cilastatin and clindamycin for a surgical site infection of his jaw after the removal of a squamous cell carcinoma 2 weeks earlier. An ultrasound of the liver was unremarkable. Drug-induced liver injury was suspected, and all potentially hepatotoxic drugs, including antibiotics, were stopped. Due to the rapid and marked increase in liver transaminases, further tests were performed, including testing for hepatitis E. Serum anti-hepatitis E virus immunoglobulin M, immunoglobulin G antibodies, and hepatitis E virus-ribonucleic acid-polymerase chain reaction turned positive, and the diagnosis of hepatitis E was confirmed. Supportive care was applied. Liver transaminases decreased spontaneously. CONCLUSIONS The diagnostic workup in patients with markedly elevated liver transaminases and suspected drug-induced liver injury should include the screening for hepatitis E. Making the correct diagnosis is crucial given the differing treatment approaches, the implications on further therapy, and the risk of contagion of hepatitis E.

HTTSTAU1
Also flagged:Extracellular vesicleExtracellular vesiclescell communicationdegenerative disordersneurological disordersneurological diseases
Journal Article 2024-08-25 ✓ 2 Snippets Putthanbut N, Lee JY, Borlongan CV.
In-Text Gene Mentions

…Staufen homolog 1 (STAU1), STAU2, Argonaute 2…

…the huntingtin gene (HTT) [ 284 ].…

Show Full Abstract

Extracellular vesicles (EVs) are vital for cell-to-cell communication, transferring proteins, lipids, and nucleic acids in various physiological and pathological processes. They play crucial roles in immune modulation and tissue regeneration but are also involved in pathogenic conditions like inflammation and degenerative disorders. EVs have heterogeneous populations and cargo, with numerous subpopulations currently under investigations. EV therapy shows promise in stimulating tissue repair and serving as a drug delivery vehicle, offering advantages over cell therapy, such as ease of engineering and minimal risk of tumorigenesis. However, challenges remain, including inconsistent nomenclature, complex characterization, and underdeveloped large-scale production protocols. This review highlights the recent advances and significance of EVs heterogeneity, emphasizing the need for a better understanding of their roles in disease pathologies to develop tailored EV therapies for clinical applications in neurological disorders.

POU3F2
Also flagged:Pax5docetaxelAndrogen Receptorneuroendocrine-like prostate cancertaxaneplatinum
Journal Article 2024-08-25 ✓ 1 Snippet Bhattacharya S, Harris HL, Islam R, Bodas S, Polavaram N, Mishra J, Das D, Seshacharyulu P, Kalluchi A, Pal A, Kohli M, Lele SM, Muders M, Batra SK, Ghosh PM, Datta K, Rowley MJ, Dutta S.
In-Text Gene Mentions

…as Sox2, NKX2.1,POU3F2, etc.) (…

Show Full Abstract

Resistance to the current Androgen Receptor Signaling Inhibitor (ARSI) therapies has led to higher incidences of therapy-induced neuroendocrine-like prostate cancer (t-NEPC). This highly aggressive subtype with predominant small-cell-like characteristics is resistant to taxane chemotherapies and has a dismal overall survival. t-NEPCs are mostly treated with platinum-based drugs with a combination of etoposide or taxane and have less selectivity and high systemic toxicity, which often limit their clinical potential. During t-NEPC transformation, adenocarcinomas lose their luminal features and adopt neuro-basal characteristics. Whether the adaptive neuronal characteristics of t-NEPC are responsible for such taxane resistance remains unknown. Pathway analysis from patient gene-expression databases indicates that t-NEPC upregulates various neuronal pathways associated with enhanced cellular networks. To identify transcription factor(s) (TF) that could be important for promoting the gene expression for neuronal characters in t-NEPC, we performed ATAC-Seq, acetylated-histone ChIP-seq, and RNA-seq in our NE-like cell line models and analyzed the promoters of transcriptionally active and significantly enriched neuroendocrine-like (NE-like) cancer-specific genes. Our results indicate that Pax5 could be an important transcription factor for neuronal gene expression and specific to t-NEPC. Pathway analysis revealed that Pax5 expression is involved in axonal guidance, neurotransmitter regulation, and neuronal adhesion, which are critical for strong cellular communications. Further results suggest that depletion of Pax5 disrupts neurite-mediated cellular communication in NE-like cells and reduces surface growth factor receptor activation, thereby, sensitizing them to docetaxel therapies. Moreover, t-NEPC-specific hydroxymethylation of Pax5 promoter CpG islands favors Pbx1 binding to induce Pax5 expression. Based on our study, we concluded that continuous exposure to ARSI therapies leads to epigenetic modifications and Pax5 activation in t-NEPC, which promotes the expression of genes necessary to adopt taxane-resistant NE-like cancer. Thus, targeting the Pax5 axis can be beneficial for reverting their taxane sensitivity.

Also flagged:calciumneurodegenerative diseasesglutamatergicvesicle transportersγ‐aminobutyric acidtyrosine hydroxylase
Journal Article 2024-08-25 No Snippets Saito A, Shiina T, Sekiba Y.
Show Full Abstract

High-intensity, low-frequency (1 Hz to 100 kHz) electric and magnetic fields (EF and MF) cause electrical excitation of the nervous system via an induced EF (iEF) in living tissue. However, the biological properties and thresholds of stimulus effects on synchronized activity in a three-dimensional (3D) neuronal network remain uncertain. In this study, we evaluated changes in neuronal network activity during extremely low-frequency EF (ELF-EF) exposure by measuring intracellular calcium ([Ca<sup>2+</sup>]<sub>i</sub>) oscillations, which reflect neuronal network activity. For ELF-EF exposure experiments, we used a human cortical spheroid (hCS), a 3D-cultured neuronal network generated from human induced pluripotent stem cell (hiPSC)-derived cortical neurons. A 50 Hz sinusoidal ELF-EF exposure modulated [Ca<sup>2+</sup>]<sub>i</sub> oscillations with dependencies on exposure intensity and duration. Based on the experimental setup and results, the iEF distribution inside the hCS was estimated using high-resolution numerical dosimetry. The numerical estimation revealed threshold values ranging between 255-510 V/m (peak) and 131-261 V/m (average). This indicates that thresholds of neuronal excitation in the hCS were equivalent to those of a thin nerve fiber.

HTT
Also flagged:autophagyCAPNS1melanomaSkin cutaneous melanomaskin cancercancer
Journal Article 2024-08-25 ✓ 1 Snippet Gao M, Liu J, Yang M, Zhang X, Zhang Y, Zhou Z, Deng J.
In-Text Gene Mentions

HTT

Show Full Abstract

Skin cutaneous melanoma (SKCM) is a highly fatal form of skin cancer that develops from the malignant transformation of epidermal melanocytes. There is substantial evidence linking autophagy to cancer etiology and immunotherapy efficacy. This study aimed to conduct a comprehensive analysis of autophagy-related genes (ARGs) using TCGA datasets and further explore the potential function of critical ARGs in SKCM progression. We performed comprehensive bioinformatics analysis uses the TCGA dataset. RT-PCR was applied to examine the expression of CAPNS1 in SKCM cells. Lost-of-function experiments were performed to detect the expression of the related proteins. In this search, we screed 70 differentially expressed autophagy-related genes (DE-ARGs), including 33 up-DE-ARGs and 37 down-DE-ARGs. Enrichment assays revealed that these 70 DE-ARGs may exert influence on critical cellular processes such as autophagy, protein kinase activity, and signaling pathways, impacting cell growth, differentiation, survival, and tumor development. Then, we further explore the prognostic value of 70 DE-ARGs and confirmed 18 survival-related DE-ARGs in SKCM patients. Nearly all the 18 DE-ARGs' methylation was negatively correlated with their corresponding expression in SKCM. The 12 survival-related DE-ARGs were used to develop a unique predictive model that effectively classified SKCM patients into high- and low-risk groups with regard to overall survival. Furthermore, tumor environment analysis indicated that the risk score was associated with several immune cells. Among the 12 survival-related DE-ARGs, our attention focused on CAPNS1 which was highly expressed in SKCM patients and predicted a poor prognosis. In addition, we confirmed that knockdown of CAPNS1 distinctly suppressed the proliferation, metastasis and EMT of SKCM cells, and promoted autophagy via regulating Notch signaling pathway. Overall, this study enhances our understanding of the intricate molecular landscape of SKCM progression and presents promising avenues for future research and clinical applications.

Also flagged:Thymic Epithelial Tumorsthymomasthymic carcinomasthymic neuroendocrine tumorsPD-L1thymic squamous cell carcinomas
Journal Article 2024-08-25 No Snippets Wang X, Jin H, Feng X, Liang Z, Jin R, Li X.
Show Full Abstract

Thymic epithelial tumors (TETs), consisting of thymomas, thymic carcinomas (TCs), and thymic neuroendocrine tumors, are rare diseases. Surgery remains the prime option in resectable and early-stage TETs, while chemotherapy, targeted therapy, and immunotherapy are also potential treatment modalities. However, the inadequate comprehension of the molecular landscape of TETs impedes the exploitation of such therapies. Hence, we conducted a meta-analysis which includes 21 studies reporting on genomic alterations in TETs and 14 studies reporting on PD-L1 expression levels, respectively. The pooled estimated rates of the most frequently mutated genes and PD-L1 expression levels were analyzed using the R software. We uncovered that the pooled estimated overall mutation rate is 0.65 ([0.49; 0.81]), and the top three genes with highest mutation frequency in thymomas and TCs are <i>GTF2I</i> (0.4263 [0.3590; 0.4936]), <i>TP53</i> (0.1101 [0.0000; 0.2586]), and <i>RAS</i> (0.0341 [0.0104; 0.0710]), and <i>TP53</i> (0.1797 [0.0732; 0.3203]), <i>CDKN2A</i> (0.0608 [0.0139; 0.1378]), and <i>TET2</i> (0.0318 [0.0087; 0.0639]), respectively. A uniform <i>GTF2I</i> mutational rate in thymomas and <i>TP53</i> mutational rate in thymic squamous cell carcinomas (TSCCs) are also observed. The pooled estimated expression level of PD-L1 is 0.71 ([0.59-0.81]). This systematic review provides an overview of the gene alteration landscape and PD-L1 expression levels in TETs, discovers several potential confounding factors that may contribute to the high heterogeneity, and facilitates deeper investigations into the elucidation of the molecular landscape of TETs.

Also flagged:hydroxyapatiteammoniumbicarbonatesynthesishydroxylapatiteapatite
Journal Article 2024-08-25 No Snippets Oladipupo OF, Adekola AH, Ofudje EA, Al-Ahmary KM, Al-Mhyawi SR, Alshdoukhi IF, Alrahili MR, Alsaiari AA.
Show Full Abstract

This work investigated the facile synthesis of porous scaffold eggshell derived hydroxylapatite (ESHAp) as a composite with ammonium bicarbonate <b>(</b>AMB<b>)</b> for potential biomaterial in tissue engineering application. The phase purity, composition, size, functional groups and morphology of the apatite were elucidated using high resolution transmission electron microscopy (HTEM), X-Ray Diffraction (XRD), Fourier Transform Infrared Spectroscopy (FT-IR) and scanning electron microscopy (SEM). The results showed that hydroxylapatite (HAp) nanoparticles have round morphologies with average diameters between 20 nm and 80 nm, FT-IR analysis confirmed significant hydroxylapatite functional groups like carbonate, phosphate, and hydroxyl groups, while XRD analysis revealed a well crystalline monophasic HAp powder. The scaffold samples containing 10, 20, 25 and 30 % of AMB withstood a compressive stress up to 5, 20, 30 and 42 N/mm<sup>2</sup> respectively which indicates that the compressive stress increased with the AMB content introduced as the pore forming agent. MTT assay performed using MG63 osteosarcoma cell lines showed that on comparing the sample of ESTHAp which contained 0 % AMB with other samples in the range of 0.01-1 mM, viability of above 85 % MG63 cells was achieved except for ESTHAp with 40 % AMB, which showed some level of toxicity. The cell adhesion studies of sintered ESTHAp porous scaffold with different weight percent of the pore forming agents using inverted microscopic images of MG 63 cells incubated with ESTHAp samples and treated with heat at 1000 °C appeared to be unstable in the media used with particle leaching observed, and no cells observed near to the samples.

Also flagged:cancerscancertumortyrosine kinaseandrogen receptorprostate cancer
Journal Article 2024-08-25 No Snippets Jamroze A, Liu X, Tang DG.
Show Full Abstract

Most human cancers are heterogeneous consisting of cancer cells at different epigenetic and transcriptional states and with distinct phenotypes, functions, and drug sensitivities. This inherent cancer cell heterogeneity contributes to tumor resistance to clinical treatment, especially the molecularly targeted therapies such as tyrosine kinase inhibitors (TKIs) and androgen receptor signaling inhibitors (ARSIs). Therapeutic interventions, in turn, induce lineage plasticity (also called lineage infidelity) in cancer cells that also drives therapy resistance. In this Perspective, we focus our discussions on cancer cell lineage plasticity manifested as treatment-induced switching of epithelial cancer cells to basal/stem-like, mesenchymal, and neural lineages. We employ prostate cancer (PCa) as the prime example to highlight ARSI-induced lineage plasticity during and towards development of castration-resistant PCa (CRPC). We further discuss how the tumor microenvironment (TME) influences therapy-induced lineage plasticity. Finally, we offer an updated summary on the regulators and mechanisms driving cancer cell lineage infidelity, which should be therapeutically targeted to extend the therapeutic window and improve patients' survival.

SERPINC1
Also flagged:cancervenous thromboembolismPLATC1Sglioblastomaimmune response
Journal Article 2024-08-24 ✓ 5 Snippets Zhang J, Zhao Q, Du Y, Wang W, Liu C.
In-Text Gene Mentions

…C member 1 (SERPINC1), F2, plasminogen (PLG),…

…F2, PLG, andSERPINC1(Fig. 2 a).…

…revealed that F3,SERPINC1, F2, PLG, and…

…observed in PLG,SERPINC1, and PLAT.…

…alteration type forSERPINC1and PLAT, with…

Show Full Abstract

Venous thromboembolism (VTE) is a prevalent complication among patients with cancer, contributing significantly to morbidity and mortality. However, the relationship between VTE-related genes (VRGs) and their potential impact on prognosis, immune response, and therapeutic targets in various cancer types remains unclear. Based on the coagulation and complement pathways, we identified hub VRGs that play a role in regulating the immune response in cancer. Specifically, coagulation factor III (F3), plasminogen activator (PLAT) and complement C1s (C1S) were identified as genes that exhibit high expression levels, positively correlating with tumor stemness and copy number variations, while inversely correlating with methylation levels, in particular cancer types. Pan-cancer survival analysis revealed detrimental effects of these VRGs in several cancer types, notably in glioblastoma and lower grade glioma (GMBLGG). Further analysis using receiver operating characteristic (ROC) curves demonstrated a high accuracy of F3, PLAT and C1S in predicting outcomes in GBMLGG, with area under the curve (AUC) values ranging from 0.78 to 0.9. Validation of the prognostic value of these three genes in GMBLGG was conducted using an independent Gene Expression Omnibus (GEO) dataset. Additionally, gene-drug association analysis identified ciclosporin, ouabain and 6- mercaptopurine, which all exhibit immunosuppressive properties, as potential therapeutic options for tumor patients exhibiting high F3, PLAT or C1S expression, respectively. In summary, our findings provide a bioinformatics perspective on VRGs in pan-cancer, highlighting the pivotal roles of F3, PLAT and C1S, which could potentially be therapeutically exploited and targeted in several cancers, especially in GBMLGG.

Also flagged:cancertumorantibodiessynapseactivating receptorstumors
Journal Article 2024-08-24 No Snippets Bottino C, Picant V, Vivier E, Castriconi R.
Show Full Abstract

Natural killer (NK) cells are innate immune effectors whose functions rely on receptors binding cytokines, recognizing self-molecules, or detecting danger signals expressed by virus-infected or tumor cells. The potent cytotoxic potential makes NK cells promising candidates for cancer immunotherapy. To enhance their activity strategies include cytokine administration, blocking of immune checkpoints, and designing of antibody-based NK cell engagers (NKCEs). NKCEs represent a cutting-edge approach to cancer therapy: they strengthen the NK-to-target cell interactions and optimize tumor killing, possibly overcoming the immunosuppressive tumor microenvironment. NK cells belong to the innate lymphoid cells (ILCs) and are categorized into different subsets also including cells with a memory-like phenotype: this complexity needs to be explored in the context of cancer immunotherapy, particularly when designing NKCEs. Two strategies to enhance NK cell activity in cancer patients can be adopted: activating patients' own NK cells versus the adoptive transfer of ex vivo activated NK cells. Furthermore, the capability of NKCEs to activate γδ T cells could have a significant synergistic effect in immunotherapy.

Also flagged:glucoseinsulin resistancesugarHyperglycaemiaC-peptideCDKAL1
Journal Article 2024-08-24 No Snippets Lowe WL, Kuang A, Hayes MG, Hivert MF, Scholtens DM.
Show Full Abstract

<h4>Aims/hypothesis</h4>Pregnancy is accompanied by maternal metabolic adaptations to ensure fetal growth and development, including insulin resistance, which occurs primarily during the second and third trimesters of pregnancy, and a decrease in fasting blood sugar levels over the course of pregnancy. Glucose-related traits are regulated by genetic and environmental factors and modulated by physiological variations throughout the life course. We addressed the hypothesis that there are both overlaps and differences between genetic variants associated with glycaemia-related traits during and outside of pregnancy.<h4>Methods</h4>Genome-wide SNP data were used to identify genetic variations associated with glycaemia-related traits measured during an OGTT performed at ~28 weeks' gestation in 8067 participants in the Hyperglycaemia and Adverse Pregnancy Outcome (HAPO) Study. Associations outside of pregnancy were determined in 3977 individuals who also participated in the HAPO Follow-Up Study at 11-14 years postpartum. A Bayesian classification algorithm was used to determine whether SNPs associated with fasting and 2 h glucose and fasting C-peptide during pregnancy had a pregnancy-predominant effect vs a similar effect during pregnancy and postpartum.<h4>Results</h4>SNPs in six loci (GCKR, G6PC2, GCK, PPP1R3B, PCSK1 and MTNR1B) were significantly associated with fasting glucose during pregnancy, while SNPs in CDKAL1 and MTNR1B were associated with 1 h glucose and SNPs in MTNR1B and HKDC1 were associated with 2 h glucose. Variants in CDKAL1 and MTNR1B were associated with insulin secretion during pregnancy. Variants in multiple loci were associated with fasting C-peptide during pregnancy, including GCKR, IQSEC1, PPP1R3B, IGF1 and BACE2. GCKR and BACE2 were associated with 1 h C-peptide and GCKR, IQSEC1 and BACE2 with insulin sensitivity during pregnancy. The associations of MTNR1B with 2 h glucose, BACE2 with fasting and 1 h C-peptide and insulin sensitivity, and IQSEC1 with fasting C-peptide and insulin sensitivity that we identified during pregnancy have not been previously reported in non-pregnancy cohorts. The Bayesian classification algorithm demonstrated that the magnitude of effect of the lead SNP was greater during pregnancy compared with 11-14 years postpartum in PCSK1 and PPP1R3B with fasting glucose, in three loci, including MTNR1B, with 2 h glucose, and in six loci, including IGF1, with fasting C-peptide.<h4>Conclusions/interpretation</h4>Our findings support the hypothesis that there are both overlaps and differences between the genetic architecture of glycaemia-related traits during and outside of pregnancy. Genetic variants at several loci, including PCSK1, PPP1R3B, MTNR1B and IGF1, appear to influence glycaemic regulation in a unique fashion during pregnancy. Future studies in larger cohorts will be needed to replicate the present findings, fully characterise the genetics of maternal glycaemia during pregnancy and determine similarities to and differences from the non-gravid state.

Also flagged:agingextracellularVCANTIMP1FOXO1nucleotide
Journal Article 2024-08-24 No Snippets Liu X, Hu F, Wang W, Chen X, Niu X, Huang S, Wang Z, Wang J, Ran X.
Show Full Abstract

Copy number variation (CNV) tends to occur in genetically enriched regions and is likely associated with a number of complex diseases such as skin aging. In this study, we investigated the genome-wide CNVs in 20 wrinkled skin cases (WSC) of Xiang pigs and 63 controls, and identified 7893 copy number variable regions (CNVRs). We estimated the F-statistic (Fst) at each locus and identified that 93 case-controls stratified CNVRs (Fst > = 0.15) overlapped with 87 known genes. Functional enrichment analysis showed that most of these genes were predominantly enriched in pathways and terms related to the extracellular matrix. Finally, we found that some CNVs were predicted to have high effects on genes such as VCAN, TIMP1 and FOXO1 through transcriptional amplification, transcript ablation and so on. Most of the genes overlapped with those CNVRs have been reported to be related to aging in human or animals. The copy numbers presented the positive correlations with the transcript level of the genes in skins between the cases and controls. Our results suggested that those 22 CNVRs, including 19 CNV losses and 3 CNV gains, were putatively associated with the skin wrinkle of Xiang pigs.

TNFSF4
Also flagged:Podoplaninodontogenic lesionstransmembrane glycoproteinpathogenesismembranecytoplasmic
Journal Article 2024-08-24 ✓ 3 Snippets Alarcón-Sánchez MA, Luna-Bonilla G, Romero-Servin S, Heboyan A.
In-Text Gene Mentions

…(0.673), LGALS8 (0.642),TNFSF4(0.567), CCL21(0.564), SYK…

…SYK, VEGF-C, SELP,TNFSF4, TNFRF10B and PODXL).…

…VEGF-C, CCL21, SELP,TNFSF4, PODXL, LGALS8 and…

Show Full Abstract

<h4>Background</h4>Podoplanin (PDPN) is a transmembrane glycoprotein implicated in the pathogenesis of odontogenic lesions (OL). It is localized at the membrane and cytoplasmic level, and its interaction with other proteins could trigger cell proliferation, invasion and migration. The main objective of this systematic review is to explore the immunoexpression pattern of podoplanin in OL. In addition, as secondary objectives, we aimed to compare the immunostaining intensity of PDPN in OL, to analyze its interaction networks by bioinformatic analysis and to highlight its importance as a potential diagnostic marker useful in the pathogenesis of OL.<h4>Methods</h4>The protocol was developed following PRISMA and Cochrane guidelines. The digital search was performed in the databases: PubMed/MEDLINE, ScienceDirect, Scopus, Web of Science and Google Schoolar from August 15, 2010 to June 15, 2023. We included cross-sectional and cohort studies that will analyze the pattern of PDPN immunoexpression in OL. Two investigators independently searched for eligible articles, selected titles and abstracts, analyzed full text, conducted data collection, and performed assessment of study quality and risk of bias. In addition, part of the results were summarized through a random-effects meta-analysis. STRING database was used for protein-protein interaction analysis.<h4>Results</h4>Twenty-nine relevant studies were included. The ages of the subjects ranged from 2 to 89 years, with a mean age of 33.41 years. Twenty-two point two percent were female, 21.4% were male, and in 56.4% the gender of the participants was not specified. A total of 1,337 OL samples were analyzed for PDPN immunoexpression pattern. Ninety-four (7.03%) were dental follicles and germs, 715 (53.47%) were odontogenic cysts, and 528 (39.49%) were odontogenic tumors. Meta-analysis indicated that the immunostaining intensity was significantly stronger in odontogenic keratocysts compared to dentigerous cysts (SMD=3.3(CI=1.85-4.82, p=0.000*). Furthermore, bioinformatic analysis revealed that PECAM-1, TNFRF10B, MSN, EZR and RDX interact directly with PDPN and their expression in OL was demonstrated.<h4>Conclusions</h4>The results of the present systematic review support the unique immunoexpression of PDPN as a potential useful diagnostic marker in the pathogenesis of OL.

Also flagged:gastrointestinal cancergastrointestinal tumorsmethylationhistonechromatincancer
Journal Article 2024-08-24 No Snippets Wang Y, Liu H, Zhang M, Xu J, Zheng L, Liu P, Chen J, Liu H, Chen C.
Show Full Abstract

Gastrointestinal tumors, the second leading cause of human mortality, are characterized by their association with inflammation. Currently, progress in the early diagnosis and effective treatment of gastrointestinal tumors is limited. Recent whole-genome analyses have underscored their profound heterogeneity and extensive genetic and epigenetic reprogramming. Epigenetic reprogramming pertains to dynamic and hereditable alterations in epigenetic patterns, devoid of concurrent modifications in the underlying DNA sequence. Common epigenetic modifications encompass DNA methylation, histone modifications, noncoding RNA, RNA modifications, and chromatin remodeling. These modifications possess the potential to invoke or suppress a multitude of genes associated with cancer, thereby governing the establishment of chromatin configurations characterized by diverse levels of accessibility. This intricate interplay assumes a pivotal and indispensable role in governing the commencement and advancement of gastrointestinal cancer. This article focuses on the impact of epigenetic reprogramming in the initiation and progression of gastric cancer, esophageal cancer, and colorectal cancer, as well as other uncommon gastrointestinal tumors. We elucidate the epigenetic landscape of gastrointestinal tumors, encompassing DNA methylation, histone modifications, chromatin remodeling, and their interrelationships. Besides, this review summarizes the potential diagnostic, therapeutic, and prognostic targets in epigenetic reprogramming, with the aim of assisting clinical treatment strategies.

PRDX6
Also flagged:Six-Transmembrane Enzyme GDE2Extracellular vesiclesGlycerophosphodiester Phosphodiesterase 2GDE2GDPD5six-transmembrane protein
Journal Article 2024-08-24 ✓ 4 Snippets Shuler KT, Llamas-Rodriguez J, Levy-Myers R, Sockanathan S.
In-Text Gene Mentions

…PRDX4, PRDX5, andPRDX6, as well as…

…PRDX2, PRDX4, andPRDX6, in addition to…

…PRDX4, PRDX5, andPRDX6, as either decreased…

…PRDX2, PRDX4, andPRDX6and the antioxidant…

Show Full Abstract

Extracellular vesicles (EVs) are implicated in a multitude of physiological and pathophysiological processes in the nervous system; however, their biogenesis and cargoes are not well defined. Glycerophosphodiester Phosphodiesterase 2 (GDE2 or GDPD5) is a six-transmembrane protein that cleaves the Glycosylphosphatidylinositol (GPI)-anchor that tethers some proteins to the membrane and has important roles in neurodevelopment and disease-relevant pathways of neuronal survival. We show here that GDE2 regulates the number of small EVs (sEVs) released from the cell surface of neurons via its GPI-anchor cleavage activity and contributes to the loading of protein cargo through enzymatic and non-enzymatic mechanisms. Proteomic profiling reveals that GDE2 releases at least two distinct EV populations, one containing GDE2 itself and the other harboring the putative ectosomal markers CD9 and BSG. sEVs released by GDE2 are enriched in cytoskeletal and actin-remodeling proteins, suggesting a potential mechanism for GDE2-dependent EV release. Further, sEV populations released by GDE2 are enriched in proteins responsible for modulating synaptic activity and proteins that are critical for cellular redox homeostasis. These studies identify GDE2 as a novel regulator of molecularly distinct sEV populations from neurons with potential roles in the synaptic and redox pathways required for neuronal function and survival.

CACNA1E
Also flagged:Type 2 diabetes mellituschronic diseaseinsulinsecretioninsulin resistanceion channels
Journal Article 2024-08-24 ✓ 5 Snippets Díaz-García JD, Leyva-Leyva M, Sánchez-Aguillón F, de León-Bautista MP, Fuentes-Venegas A, Torres-Viloria A, Tenorio-Aguirre EK, Morales-Lázaro SL, Olivo-Díaz A, González-Ramírez R.
In-Text Gene Mentions

…KCNQ1 , andCACNA1ESingle-Nucleotide Polymorphism…

…KCNJ11 , andCACNA1Egenes and the…

…and rs175338 inCACNA1E.…

…encoded by theCACNA1Egene located on…

…an association betweenCACNA1Evariants and the…

Show Full Abstract

Type 2 diabetes mellitus (T2DM) is a complex chronic disease characterized by decreased insulin secretion and the development of insulin resistance. Previous genome-wide association studies demonstrated that single-nucleotide polymorphisms (SNPs) present in genes coding for ion channels involved in insulin secretion increase the risk of developing this disease. We determined the association of 16 SNPs found in <i>CACNA1D</i>, <i>KCNQ1</i>, <i>KCNJ11</i>, and <i>CACNA1E</i> genes and the increased probability of developing T2DM. In this work, we performed a case-control study in 301 Mexican adults, including 201 cases with diabetes and 100 controls without diabetes. Our findings indicate a moderate association between T2DM and the C allele, and the C/C genotype of rs312480 within <i>CACNA1D</i>. The CAG haplotype surprisingly showed a protective effect, whereas the CAC and CGG haplotypes have a strong association with T2DM. The C allele and C/C genotype of rs5219 were significantly associated with diabetes. Also, an association was observed between diabetes and the A allele and the A/A genotype of rs3753737 and rs175338 in <i>CACNA1E</i>. The TGG and CGA haplotypes were also found to be significantly associated. The findings of this study indicate that the SNPs examined could serve as a potential diagnostic tool and contribute to the susceptibility of the Mexican population to this disease.

Also flagged:Hydroxyapatitemineralwound healingosteogenesiscell growthcell proliferation
Journal Article 2024-08-24 No Snippets Muñoz F, Haidar ZS, Puigdollers A, Guerra I, Padilla MC, Ortega N, Balcells M, García MJ.
Show Full Abstract

The demand for novel tissue grafting and regenerative wound care biomaterials is growing as traditional options often fall short in biocompatibility, functional integration with human tissue, associated cost(s), and sustainability. Salmon aquaculture generates significant volumes of waste, offering a sustainable opportunity for biomaterial production, particularly in osteo-conduction/-induction, and de novo clinical/surgical bone regeneration. Henceforth, this study explores re-purposing salmon waste through a standardized pre-treatment process that minimizes the biological <i>waste</i> content, followed by a treatment stage to remove proteins, lipids, and other compounds, resulting in a mineral-rich substrate. Herein, we examined various methods-alkaline hydrolysis, calcination, and NaOH hydrolysis-to better identify and determine the most efficient and effective process for producing bio-functional nano-sized hydroxyapatite. Through comprehensive chemical, physical, and biological assessments, including Raman spectroscopy and X-ray diffraction, we also optimized the extraction process. Our modified and innovative alkaline hydrolysis-calcination method yielded salmon-derived hydroxyapatite with a highly crystalline structure, an optimal Ca/P ratio, and excellent biocompatibility. The attractive nano-scale cellular/tissular properties and favorable molecular characteristics, particularly well-suited for bone repair, are comparable to or even surpass those of synthetic, human, bovine, and porcine hydroxyapatite, positioning it as a promising candidate for use in tissue engineering, wound healing, and regenerative medicine indications.

Also flagged:Calciumcalcium carbonatecalcium phosphatecalcium silicatenanostructurescell adhesion
Journal Article 2024-08-24 No Snippets Min KH, Kim DH, Kim KH, Seo JH, Pack SP.
Show Full Abstract

Calcium-based materials, such as calcium carbonate, calcium phosphate, and calcium silicate, have attracted significant attention in biomedical research, owing to their unique physicochemical properties and versatile applications. The distinctive characteristics of these materials, including their inherent biocompatibility and tunable structures, hold significant promise for applications in bone regeneration and tissue engineering. This review explores the biomedical applications of calcium-containing materials, particularly for bone regeneration. Their remarkable biocompatibility, tunable nanostructures, and multifaceted functionalities make them pivotal for advancing regenerative medicine, drug delivery system, and biomimetic scaffold applications. The evolving landscape of biomedical research continues to uncover new possibilities, positioning calcium-based materials as key contributors to the next generation of innovative biomaterial scaffolds.

Also flagged:Calcium PhosphatesosteogenesisangiogenesisCaPlocomotioncalcium
Journal Article 2024-08-23 No Snippets Pandit A, Indurkar A, Locs J, Haugen HJ, Loca D.
Show Full Abstract

The replication of bone physiology under laboratory conditions is a prime target behind the development of in vitro bone models. The model should be robust enough to elicit an unbiased response when stimulated experimentally, giving reproducible outcomes. In vitro bone tissue generation majorly requires the availability of cellular components, the presence of factors promoting cellular proliferation and differentiation, efficient nutrient supply, and a supporting matrix for the cells to anchor - gaining predefined topology. Calcium phosphates (CaP) are difficult to ignore while considering the above requirements of a bone model. Therefore, the current review focuses on the role of CaP in developing an in vitro bone model addressing the prerequisites of bone tissue generation. Special emphasis is given to the physico-chemical properties of CaP that promote osteogenesis, angiogenesis and provide sufficient mechanical strength for load-bearing applications. Finally, the future course of action is discussed to ensure efficient utilization of CaP in the in vitro bone model development field.

HFE
Also flagged:irongenetic disorderinsulin resistancehepatocellular carcinomaoverloadliver fibrosis
Journal Article 2024-08-23 ✓ 5 Snippets Lucas MR, Pilling LC, Atkins JL, Melzer D.
In-Text Gene Mentions

<h4>Background aims</h4>The HFE p.C282Y+/+ (homozygous) genotype and central adiposity both increase liver disease and diabetes risks, but combined effects are unclear.

…iron overload condition,hemochromatosis, is the most…

…1 , 2HFEgene mutations downregulate…

…Northern Europeans, theHFEp.C282Y homozygous (+/+)…

…predominant cause ofhemochromatosis.…

Show Full Abstract

<h4>Background and aims</h4>The HFE p.C282Y+/+ (homozygous) genotype and central adiposity both increase liver disease and diabetes risks, but the combined effects are unclear. We estimated waist-to-hip ratio (WHR) associations with incident clinical outcomes in routine care in p.C282Y+/+ participants in the UK Biobank community cohort.<h4>Approach and results</h4>Baseline WHR data available in 1297 male and 1602 female p.C282Y+/+ with 13.3-year mean follow-up for diagnoses. Spline regressions and Cox proportional hazard models were adjusted for age and genetic principal components. Cumulative incidence was from age 40 to 80 years. In p.C282Y+/+ males, there were positive linear WHR relationships for hospital inpatient-diagnosed liver fibrosis/cirrhosis ( p = 2.4 × 10 -5 ), liver cancer ( p = 0.007), non-alcoholic fatty liver disease ( p = 7.7 × 10 -11 ), and type 2 diabetes ( p = 5.1 × 10 -16 ). The hazard ratio for high WHR in p.C282Y+/+ males (≥0.96; 33.9%) was 4.13 for liver fibrosis/cirrhosis (95% CI: 2.04-8.39, p = 8.4 × 10 -5 vs. normal WHR); cumulative age 80 incidence 15.0% (95% CI: 9.8%-22.6%) versus 3.9% (95% CI: 1.9%-7.6%); for liver cancer, cumulative incidence was 9.2% (95% CI: 5.7%-14.6%) versus 3.6% (95% CI: 1.9%-6.6%). Hemochromatosis was diagnosed in 23 (96%) of the 24 high WHR p.C282Y+/+ males with incident fibrosis/cirrhosis. High WHR (≥0.85; 30.0%) p.C282Y+/+ females had raised hazards for liver fibrosis/cirrhosis (hazard ratio = 9.17, 95% CI: 2.51-33.50, p = 3.8 × 10 -7 ) and Non-alcoholic fatty liver disease (hazard ratio = 5.17, 95% CI: 2.48-10.78, p = 1.2 × 10 -5 ). Fibrosis/cirrhosis associations were similar in the subset with additional primary care diagnoses.<h4>Conclusions</h4>In p.C282Y+/+ males and females, increasing WHR is associated with substantially higher risks of liver complications. Interventions to reduce central adiposity to improve these outcomes should be tested.

Also flagged:CRISPR-CasSpCas9dCas9transcriptionalCRISPRCas
Journal Article 2024-08-23 No Snippets Guo J, Gong L, Yu H, Li M, An Q, Liu Z, Fan S, Yang C, Zhao D, Han J, Xiang H.
Show Full Abstract

Type I CRISPR-Cas systems are widespread and have exhibited high versatility and efficiency in genome editing and gene regulation in prokaryotes. However, due to the multi-subunit composition and large size, their application in eukaryotes has not been thoroughly investigated. Here, we demonstrate that the type I-F2 Cascade, the most compact among type I systems, with a total gene size smaller than that of SpCas9, can be developed for transcriptional activation in human cells. The efficiency of the engineered I-F2 tool can match or surpass that of dCas9. Additionally, we create a base editor using the I-F2 Cascade, which induces a considerably wide editing window (~30 nt) with a bimodal distribution. It can expand targetable sites, which is useful for disrupting functional sequences and genetic screening. This research underscores the application of compact type I systems in eukaryotes, particularly in the development of a base editor with a wide editing window.

Also flagged:cancerscancertranscription factorspathogenesispediatric cancersacute leukemia
Journal Article 2024-08-23 No Snippets Cuglievan B, Kantarjian H, Rubnitz JE, Cooper TM, Zwaan CM, Pollard JA, DiNardo CD, Kadia TM, Guest E, Short NJ, McCall D, Daver N, Nunez C, Haddad FG, Garcia M, Bhalla KN, Maiti A, Catueno S, Fiskus W, Carter BZ, Gibson A, Roth M, Khazal S, Tewari P, Abbas HA, Bourgeois W, Andreeff M, Shukla NN, Truong DD, Connors J, Ludwig JA, Stutterheim J, Salzer E, Juul-Dam KL, Sasaki K, Mahadeo KM, Tasian SK, Borthakur G, Dickson S, Jain N, Jabbour E, Meshinchi S, Garcia-Manero G, Ravandi F, Stein EM, Kolb EA, Issa GC.
Show Full Abstract

Aberrant expression of HOX and MEIS1 family genes, as seen in KMT2A-rearranged, NUP98-rearranged, or NPM1-mutated leukemias leads to arrested differentiation and leukemia development. HOX family genes are essential gatekeepers of physiologic hematopoiesis, and their expression is regulated by the interaction between KMT2A and menin. Menin inhibitors block this interaction, downregulate the abnormal expression of MEIS1 and other transcription factors and thereby release the differentiation block. Menin inhibitors show significant clinical efficacy against KMT2A-rearranged and NPM1-mutated acute leukemias, with promising potential to address unmet needs in various pediatric leukemia subtypes. In this collaborative initiative, pediatric and adult hematologists/oncologists, and stem cell transplant physicians have united their expertise to explore the potential of menin inhibitors in pediatric leukemia treatment internationally. Our efforts aim to provide a comprehensive clinical overview of menin inhibitors, integrating preclinical evidence and insights from ongoing global clinical trials. Additionally, we propose future international, inclusive, and efficient clinical trial designs, integrating pediatric populations in adult trials, to ensure broad access to this promising therapy for all children and adolescents with menin-dependent leukemias.

Also flagged:major depressive disorderdepressionneuropsychiatric diseasebehavioralanxietysubstance use disorders
Journal Article 2024-08-23 No Snippets Tian X, Hu N, Lu L, Tan L, Li P.
Show Full Abstract

<h4>Background</h4>Major depressive disorder (MDD) is a highly heterogeneous disease, with differences in clinical manifestations among depression patients based on onset ages and genders. The neural mechanisms underlying these differences remain unclear. In this study, we utilized resting state functional imaging data from a large sample database and adopted the ReHo method to investigate gender differences in local brain function in MDD patients across different onset age groups.<h4>Methods</h4>The study included 364 MDD patients and 695 healthy participants who were part of the REST-meta-MDD project. Regional homogeneity (ReHo) assessed gender disparities in MDD and healthy individuals within groups delineated by gender and onset age (young group: 18-29 years; middle-aged group: 30-45 years).<h4>Results</h4>Among the young MDD groups, there were significant gender differences in the right superior frontal gyrus, right inferior frontal gyrus, left superior temporal gyrus, and right superior parietal lobule, with male MDD patients having higher ReHo values compared to females. When compared to healthy males, male MDD patients exhibited elevated ReHo values in the right superior parietal lobule. In the middle-aged groups, a marked ReHo difference was observed in the bilateral cerebellum posterior lobe, with female MDD patients showing higher ReHo values.<h4>Conclusions</h4>The functional mechanisms of MDD differ between genders and show distinct variations across different onset age groups. These findings underscore the importance of developing personalized interventions that address the unique needs of MDD patients, tailored to their gender and age, and necessitate the development of antidepressant medications targeted at each gender-age subgroup.

Also flagged:diverticular diseasediverticulosisColonic diverticulosislumendiverticulitisdiverticular
Journal Article 2024-08-23 No Snippets Hua X, McGoldrick J, Nakrour N, Staller K, Chung DC, Xavier RJ, Khalili H.
Show Full Abstract

<h4>Background</h4>Colonic diverticulosis, the most common lesion found in routine colonoscopy, affects more than 50% of individuals aged ≥ 60 years. Emerging evidence suggest that dysbiosis of gut microbiota may play an important role in the pathophysiology of diverticular disease. However, specific changes in microbial species and metabolic functions in asymptomatic diverticulosis remain unknown.<h4>Methods</h4>In a cohort of US adults undergoing screening colonoscopy, we analyzed the gut microbiota using shotgun metagenomic sequencing. Demographic factors, lifestyle, and medication use were assessed using a baseline questionnaire administered prior to colonoscopy. Taxonomic structures and metabolic pathway abundances were determined using MetaPhlAn3 and HUMAnN3. We used multivariate association with linear models to identify microbial species and metabolic pathways that were significantly different between asymptomatic diverticulosis and controls, while adjusting for confounders selected a priori including age at colonoscopy, sex, body mass index (BMI), and dietary pattern.<h4>Results</h4>Among 684 individuals undergoing a screening colonoscopy, 284 (42%) had diverticulosis. Gut microbiome composition explained 1.9% variation in the disease status of asymptomatic diverticulosis. We observed no significant differences in the overall diversity of gut microbiome between asymptomatic diverticulosis and controls. However, microbial species Bifidobacterium pseudocatenulatum and Prevotella copri were significantly enriched in controls (q value = 0.19 and 0.14, respectively), whereas Roseburia intestinalis, Dorea sp. CAG:317, and Clostridium sp. CAG: 299 were more abundant in those with diverticulosis (q values = 0.17, 0.24, and 0.10, respectively). We observed that the relationship between BMI and diverticulosis appeared to be limited to carriers of Bifidobacterium pseudocatenulatum and Roseburia intestinalis (P<sub>interaction</sub> = 0.09).<h4>Conclusions</h4>Our study provides the first large-scale evidence supporting taxonomic and functional shifts of the gut microbiome in individuals with asymptomatic diverticulosis. The suggestive interaction between gut microbiota and BMI on prevalent diverticulosis deserves future investigations.

HTT
Also flagged:HSP110amyloid betachaperonenucleotidefactor
Journal Article 2024-08-23 ✓ 1 Snippet Montresor S, Pigazzini ML, Baskaran S, Sleiman M, Adhikari G, Basilicata L, Secker L, Jacob N, Ehlert Y, Kelkar A, Kalsi GK, Kulkarni N, Spellerberg P, Kirstein J.
In-Text Gene Mentions

…diseases (i.e., α‐synuclein,HTT, and tau).…

Show Full Abstract

Chaperones safeguard protein homeostasis by promoting folding and preventing aggregation. HSP110 is a cytosolic chaperone that functions as a nucleotide exchange factor for the HSP70 cycle. Together with HSP70 and a J-domain protein (JDP), HSP110 maintains protein folding and resolubilizes aggregates. Interestingly, HSP110 is vital for the HSP70/110/JDP-mediated disaggregation of amyloidogenic proteins implicated in neurodegenerative diseases (i.e., α-synuclein, HTT, and tau). However, despite its abundance, HSP110 remains still an enigmatic chaperone, and its functional spectrum is not very well understood. Of note, the disaggregation activity of neurodegenerative disease-associated amyloid fibrils showed both beneficial and detrimental outcomes in vivo. To gain a more comprehensive understanding of the chaperone HSP110 in vivo, we analyzed its role in neuronal proteostasis and neurodegeneration in C. elegans. Specifically, we investigated the role of HSP110 in the regulation of amyloid beta peptide (Aβ) aggregation using an established Aβ-C. elegans model that mimics Alzheimer's disease pathology. We generated a novel C. elegans model that over-expresses hsp-110 pan-neuronally, and we also depleted hsp-110 by RNAi-mediated knockdown. We assessed Aβ aggregation in vivo and in situ by fluorescence lifetime imaging. We found that hsp-110 over-expression exacerbated Aβ aggregation and appeared to reduce the conformational variability of the Aβ aggregates, whereas hsp-110 depletion reduced aggregation more significantly in the IL2 neurons, which marked the onset of Aβ aggregation. HSP-110 also plays a central role in growth and fertility as its over-expression compromises nematode physiology. In addition, we found that HSP-110 modulation affects the autophagy pathway. While hsp-110 over-expression impairs the autophagic flux, a depletion enhances it. Thus, HSP-110 regulates multiple nodes of the proteostasis network to control amyloid protein aggregation, disaggregation, and autophagic clearance.

TNFSF4
Also flagged:UBR1tumorsstomach adenocarcinomaSTADcancerGene Expression
Journal Article 2024-08-23 ✓ 1 Snippet Yuan W, Han J, Chen C, Qiu Y, Xu Y, Huang Y, Chen Z, Xu A, Sun M.
In-Text Gene Mentions

…CD28, CD40LG, CD200R1,TNFSF4, CD200, and NRP1…

Show Full Abstract

<h4>Background</h4>Ubiquitination is a targeted protein modification process mediated by intracellular molecules. UBR1 encodes a protein that binds to unstable N-terminal residues of substrate proteins and contributes to the formation of substrate-linked polyubiquitin chains. However, the function and cellular pathways of UBR1 in tumors have received inadequate attention. This study aimed to investigate the potential of UBR1 as a prognostic biomarker and immunotherapy target for stomach adenocarcinoma (STAD) as well as its biological function and molecular mechanism in relation to the disease.<h4>Methods</h4>Differential expression and pan-cancer gene set enrichment analysis (GSEA) were conducted using The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), and Genotype-Tissue Expression (GTEx) datasets. The Human Protein Atlas (HPA) database was utilized to identify UBR1-enriched pathways in AGS cells and to compare immunohistochemical differences between cancerous and adjacent non-cancerous tissues in gastric cancer. Quantitative Polymerase Chain Reaction (QPCR) and Western blot (WB) analyses were employed to validate these findings in both cancerous and adjacent non-cancerous tissues of gastric cancer. UBR1 expression in GES-1 and four gastric cancer cell lines was assessed using QPCR and WB. Kaplan-Meier curves, univariate and multivariate Cox regression analyses, and receiver operating characteristic (ROC) curve analyses were performed to evaluate the prognostic and diagnostic roles of UBR1. Additionally, the correlation between UBR1 expression and clinical parameters was analyzed using TCGA and GEO databases. UBR1 mutation data were obtained from the cBioPortal database. The mutation landscape, mutation-associated genes, protein structure, tumor mutation burden (TMB), and microsatellite instability (MSI) correlations were analyzed and illustrated. The biological functions of UBR1 were investigated using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. The correlation between UBR1 and immune infiltration was assessed using TIMER and EPIC computational methods. Protein expression levels of UBR1 in gastric cancer cell lines were determined by immunohistochemistry (IHC) and WB analysis. Quantitative real-time PCR (qRT-PCR) was employed to analyze mRNA expression. Immunoprecipitation (IP) assays were conducted to detect protein-protein interactions between UBR1 and PDL1, while cellular immunofluorescence was used to observe the co-localization of these proteins. Cell proliferation was evaluated using CCK8 and colony formation assays. Cell migration was assessed using Transwell and wound healing assays. Finally, apoptosis was analyzed using flow cytometry, and WB was used to detect changes in apoptotic proteins and NF-κB P65 pathway proteins.<h4>Results</h4>UBR1 was upregulated in 28 cancer types, including STAD, and its overexpression was validated in gastric cancer cell lines and tissues. UBR1 expression was associated with advanced pathological characteristics. High UBR1 expression was linked to poor prognostic outcomes, including overall survival (OS), progression-free interval (PFI), disease-specific survival (DSS), as well as responses to surgery, chemotherapy, and HER2 expression. UBR1 expression showed significant correlations with clinical parameters such as age, gender, TNM stage, pathological stage, tumor resection, and anti-reflux therapy. Amplifications and deletions were the most frequent genetic alterations associated with UBR1. According to KEGG and GSEA analyses, UBR1 was significantly associated with several cancer pathways, oxidative phosphorylation, and the TNF-NFκB pathway. UBR1 also exhibited a significant correlation with immune cell infiltration and immunotherapy, including a direct interaction with PDL1. Knockdown of UBR1 inhibited the proliferation, migration, and invasion of STAD cells and promoted apoptosis.<h4>Conclusions</h4>UBR1 is overexpressed in STAD, promoting its progression and positively correlating with immune cell infiltration and immunotherapeutic responses. Therefore, UBR1 could be a promising biomarker for the prognosis and immunotherapy of STAD.

HTT
Also flagged:Psychosis spectrum disorderscognitive impairmentschizophreniabipolar disordercognitive dysfunctionpsychosis
Journal Article 2024-08-23 ✓ 1 Snippet Hirsch F, Bumanglag Â, Zhang Y, Wohlschlaeger A.
In-Text Gene Mentions

…the serotonin transporter (5-HTT; r = 0.4,…

Show Full Abstract

<h4>Background</h4>Psychosis spectrum disorders (PSDs) are marked by cognitive impairments, the neurobiological correlates of which remain poorly understood. Here, we investigate the entropy of time-varying functional connectivity (TVFC) patterns from resting-state functional magnetic resonance imaging (rs-fMRI) as potential biomarker for cognitive performance in PSDs. By combining our results with multimodal reference data, we hope to generate new insights into the mechanisms underlying cognitive dysfunction in PSDs. We hypothesized that low-entropy TVFC patterns (LEN) would be more behaviorally informative than high-entropy TVFC patterns (HEN), especially for tasks that require extensive integration across diverse cognitive subdomains.<h4>Methods</h4>rs-fMRI and behavioral data from 97 patients in the early phases of psychosis and 53 controls were analyzed. Positron emission tomography (PET) and magnetoencephalography (MEG) data were taken from a public repository (Hansen et al., 2022). Multivariate analyses were conducted to examine relationships between TVFC patterns at multiple spatial scales and cognitive performance in patients.<h4>Results</h4>Compared to HEN, LEN explained significantly more cognitive variance on average in PSD patients, driven by superior encoding of information on psychometrically more integrated tasks. HEN better captured information in specific subdomains of executive functioning. Nodal HEN-LEN transitions were spatially aligned with neurobiological gradients reflecting monoaminergic transporter densities and MEG beta-power. Exploratory analyses revealed a close statistical relationship between LEN and positive symptom severity in patients.<h4>Conclusion</h4>Our entropy-based analysis of TVFC patterns dissociates distinct aspects of cognition in PSDs. By linking topographies of neurotransmission and oscillatory dynamics with cognitive performance, it enhances our understanding of the mechanisms underlying cognitive deficits in PSDs.

LRRC7
Also flagged:NCAPD2lung adenocarcinomacell proliferationtumorLUADcell division
Journal Article 2024-08-23 ✓ 1 Snippet Wu P, Zhao L, Zhang H, Lou Y, Chen D, Xue S, Liu X, Jiang H.
In-Text Gene Mentions

Condensin, a multisubunit protein…

Show Full Abstract

<h4>Objectives</h4>The pro-oncogenic effects of NCAPD2 have been extensively studied across various tumor types; however, its precise role within the context of lung adenocarcinoma (LUAD) remains elusive. This study aims to elucidate the biological functions of NCAPD2 in LUAD and unravel the underlying mechanistic pathways.<h4>Methods</h4>Utilizing bioinformatics methodologies, we explored the differential expression of NCAPD2 between normal and tumor samples, along with its correlations with clinical-pathological characteristics, survival prognosis, and immune infiltration.<h4>Results</h4>In the TCGA-LUAD dataset, tumor samples demonstrated significantly elevated levels of NCAPD2 expression compared to normal samples (<i>p</i> < 0.001). Clinically, higher NCAPD2 expression was notably associated with advanced T, N, and M stages, pathologic stage, gender, smoking status, and diminished overall survival (OS). Moreover, differentially expressed genes (DEGs) associated with NCAPD2 were predominantly enriched in pathways related to cell division. Immune infiltration analysis revealed that NCAPD2 expression levels were linked to the infiltration of memory B cells, naïve CD4+ T cells, activated memory CD4+ T cells, and M1 macrophages. <i>In vitro</i> experiments demonstrated that silencing NCAPD2 suppressed LUAD cell proliferation, migration, invasion, epithelial-mesenchymal transition (EMT), and cell cycle progression.<h4>Conclusions</h4>In summary, NCAPD2 may represent a promising prognostic biomarker and novel therapeutic target for LUAD.

HFE
Also flagged:Ironcancerhemeliver cancersmineraloxygen
Journal Article 2024-08-23 ✓ 1 Snippet Zeidan RS, Yoon HS, Yang JJ, Sobh A, Braithwaite D, Mankowski R, Leeuwenburgh C, Anton S.
In-Text Gene Mentions

…metabolism genes (e.g.,HFEmutations), can influence…

Show Full Abstract

Iron is an essential nutrient required for various physiological processes in the body. However, iron imbalance can potentially contribute to initiating and promoting cancer development. Epidemiological studies have investigated the relationship between dietary iron intake and the risk of different types of cancer, yet, not all studies have consistently shown a significant association between dietary iron and cancer risk. Also, studies have shown different effects of dietary heme and non-heme iron intake on cancer risk. While some epidemiological studies suggest a possible link between high dietary iron (mainly heme-iron) intake and increased cancer risk, the evidence remains inconsistent. Moreover, multiple iron biomarkers, which can mirror physiological iron status, have demonstrated varied correlations with the risk of cancer, contingent upon the specific biomarker analyzed and the type of cancer being investigated. Here, we have investigated the current evidence on the potential relationship between dietary iron intake on one hand, and iron biomarkers on the other hand, with the risk of developing different types of cancer, including breast, prostate, lung, pancreatic, colon, colorectal, and liver cancers. Further research is warranted to better understand the complex relationship between dietary iron, physiological iron and cancer development. Future research should account for factors that affect and interact with dietary iron and physiological iron levels, such as genetic susceptibility, overall diet quality, and lifestyle habits.

Also flagged:Synthesisridaifen-Baminoalkyldicyclohexylcarbodiimideamines
Journal Article 2024-08-23 No Snippets Murata T, Komukai K, Semba Y, Murata E, Sato F, Takano T, Tsuchiya K, Matsuda C, Sakai A, Yoneoka A, Takahashi S, Nagahara Y, Shiina I.
Show Full Abstract

We synthesized ridaifen-B boron dipyrromethene (<b>RID-B-BODIPY</b>) using 2-methyl-6-nitro benzoic anhydride (MNBA)-mediated dehydration condensation reaction between amino alkyl-tethered RID and BODIPY FL. Comparative experiments between dicyclohexylcarbodiimide (DCC) and MNBA for their coupling reactions demonstrated that MNBA is an effective condensation reagent for amines and BODIPY FL. A cell staining study with <b>RID-B-BODIPY</b> showed intracellular localization of BODIPY FL fluorescence, attributed to the <b>RID-B</b> structure, indicating the successful development of a tool for analyzing intracellular molecular behavior efficiently.

HFE
Also flagged:metabolismcoagulation factorsgenetic disordersCas9carbohydratesecretion
Journal Article 2024-08-23 ✓ 1 Snippet Simoni C, Barbon E, Muro AF, Cantore A.
In-Text Gene Mentions

…al., 2023 ),hemochromatosis( Rovai et…

Show Full Abstract

The liver is an essential organ of the body that performs several vital functions, including the metabolism of biomolecules, foreign substances, and toxins, and the production of plasma proteins, such as coagulation factors. There are hundreds of genetic disorders affecting liver functions and, for many of them, the only curative option is orthotopic liver transplantation, which nevertheless entails many risks and long-term complications. Some peculiar features of the liver, such as its large blood flow supply and the tolerogenic immune environment, make it an attractive target for <i>in vivo</i> gene therapy approaches. In recent years, several genome-editing tools mainly based on the clustered regularly interspaced short palindromic repeats associated protein 9 (CRISPR-Cas9) system have been successfully exploited in the context of liver-directed preclinical or clinical therapeutic applications. These include gene knock-out, knock-in, activation, interference, or base and prime editing approaches. Despite many achievements, important challenges still need to be addressed to broaden clinical applications, such as the optimization of the delivery methods, the improvement of the editing efficiency, and the risk of on-target or off-target unwanted effects and chromosomal rearrangements. In this review, we highlight the latest progress in the development of <i>in vivo</i> liver-targeted genome editing approaches for the treatment of genetic disorders. We describe the technological advancements that are currently under investigation, the challenges to overcome for clinical applicability, and the future perspectives of this technology.

HTT
Also flagged:infectionssaltSox10Krt5P63Sox2
Journal Article 2024-08-23 ✓ 1 Snippet Yu W, Kastriti ME, Ishan M, Choudhary SK, Rashid MM, Kramer N, Do HGT, Wang Z, Xu T, Schwabe RF, Ye K, Adameyko I, Liu HX.
In-Text Gene Mentions

…St3gal4 ), andMERS-CoV45( Dpp4 and…

Show Full Abstract

<h4>Introduction</h4>We have recently demonstrated that <i>Sox10</i>-expressing (<i>Sox10</i> <sup>+</sup>) cells give rise to mainly type-III neuronal taste bud cells that are responsible for sour and salt taste. The two tissue compartments containing <i>Sox10</i> <sup>+</sup> cells in the surrounding of taste buds include the connective tissue core of taste papillae and von Ebner's glands (vEGs) that are connected to the trench of circumvallate and foliate papillae.<h4>Methods</h4>In this study, we performed single cell RNA-sequencing of the epithelium of <i>Sox10-Cre/tdT</i> mouse circumvallate/vEG complex and used inducible Cre mouse models to map the cell lineages of vEGs and/or connective tissue (including stromal and Schwann cells).<h4>Results</h4>Transcriptomic analysis indicated that <i>Sox10</i> expression was enriched in the cell clusters of vEG ducts that contained abundant proliferating cells, while <i>Sox10-Cre/tdT</i> expression was enriched in type-III taste bud cells and vEG ductal cells. <i>In vivo</i> lineage mapping showed that the traced cells were distributed in circumvallate taste buds concurrently with those in the vEGs, but not in the connective tissue. Moreover, multiple genes encoding pathogen receptors were enriched in the vEG ducts hosting <i>Sox10</i> <sup>+</sup> cells.<h4>Discussion</h4>Our data supports that it is the vEGs, not connective tissue core, that serve as the niche of <i>Sox10</i> <sup>+</sup> taste bud progenitors. If this is also true in humans, our data indicates that vEG duct is a source of <i>Sox10</i> <sup>+</sup> taste bud progenitors and susceptible to pathogen infections.

MLLT10
Also flagged:Solid Tumortranslationalleukemiasarcomatumoracute myeloid leukemia
Journal Article 2024-08-23 ✓ 5 Snippets Schmitt AD, Sikkink K, Ahmed AA, Melnyk S, Reid D, Van Meter L, Guest EM, Lansdon LA, Pastinen T, Pushel I, Yoo B, Farooqi MS.
In-Text Gene Mentions

…fusions and one KMT2A::MLLT10fusion), as well…

…analysis detected a KMT2A::MLLT10gene fusion (…

…pattern at the KMT2A::MLLT10breakpoint ( Figure…

…3′ portion ofMLLT10, resulting in…

…in the expected KMT2A::MLLT10fusion gene orientation.…

Show Full Abstract

Hi-C sequencing is a DNA-based next-generation sequencing method that preserves the 3D genome conformation and has shown promise in detecting genomic rearrangements in translational research studies. To evaluate Hi-C as a potential clinical diagnostic platform, analytical concordance with routine laboratory testing was assessed using primary pediatric leukemia and sarcoma specimens. Archived viable and non-viable frozen leukemic cells and formalin-fixed paraffin-embedded (FFPE) tumor specimens were analyzed. Pediatric acute myeloid leukemia (AML) and alveolar rhabdomyosarcoma (A-RMS) specimens with known genomic rearrangements were subjected to Hi-C to assess analytical concordance. Subsequently, a discovery cohort consisting of AML and acute lymphoblastic leukemia (ALL) cases without known genomic rearrangements based on prior clinical diagnostic testing was evaluated to determine whether Hi-C could detect rearrangements. Using a standard sequencing depth of 50 million raw read-pairs per sample, or approximately 5X raw genomic coverage, we observed 100% concordance between Hi-C and previous clinical cytogenetic and molecular testing. In the discovery cohort, a clinically relevant gene fusion was detected in 45% of leukemia cases (5/11). This study provides an institutional proof of principle evaluation of Hi-C sequencing to medical diagnostic testing as it identified several clinically relevant rearrangements, including those that were missed by current clinical testing workflows.

HFE
Also flagged:TfR2IronMetabolismsynthesisTransferrin Receptor 2catabolism
Journal Article 2024-08-23 ✓ 5 Snippets Comità S, Falco P, Mezzanotte M, Vujić Spasić M, Roetto A.
In-Text Gene Mentions

…Lack ofHfeand TfR2 in…

…proteins, including thehemochromatosis-associated proteins Hfe and…

…hromatosis-associated proteinsHfeand Transferrin Receptor…

…The absence ofHfein macrophages causes…

…mice with macrophage-specificHfeand TfR2 silencing…

Show Full Abstract

Iron is a vital element involved in a plethora of metabolic activities. Mammalian systemic iron homeostasis is mainly modulated by hepcidin, the synthesis of which is regulated by a number of proteins, including the hemochromatosis-associated proteins Hfe and Transferrin Receptor 2 (TfR2). Macrophages play versatile functions in iron homeostasis by storing iron derived from the catabolism of erythrocytes and supplying iron required for erythropoiesis. The absence of Hfe in macrophages causes a mild iron deficiency in aged mice and leads to an overproduction of the iron exporter Ferroportin 1 (Fpn1). Conversely, <i>TfR2</i> gene silencing in macrophages does not influence systemic iron metabolism but decreases transcription of the macrophage Fpn1 in adult mice and modulates their immune response. This study investigated cellular and systemic iron metabolism in adult and aged male mice with macrophage-specific Hfe and TfR2 silencing (double knock-out, DKO). Serum iron parameters were significantly modified in aged animals, and significant differences were found in hepatic hepcidin transcription at both ages. Interestingly, splenic iron content was low in adult DKOs and splenic Fpn1 transcription was significantly increased in DKO animals at both ages, while the protein amount does not reflect the transcriptional trend. Additionally, DKO macrophages were isolated from mice bone marrow (BMDMs) and showed significant variations in the transcription of iron genes and protein amounts in targeted mice compared to controls. Specifically, Tranferrin Receptor 1 (TfR1) increased in DKO adult mice BMDMs, while the opposite is observed in the cells of aged DKO mice. <i>Fpn1</i> transcript was significantly decreased in the BMDMs of adult DKO mice, while the protein was reduced at both ages. Lastly, a significant increase in Erythropoietin production was evidenced in aged DKO mice. Overall, our study reveals that Hfe and TfR2 in macrophages regulate hepatic Hepc production and affect iron homeostasis in the spleen and BMDMs, leading to an iron deficiency in aged animals that impairs their erythropoiesis.

Also flagged:Tumordithiodipropionic aciddisulfidehyaluronic aciddoxorubicin hydrochloridedeath
Journal Article 2024-08-23 No Snippets Yang S, Liu J, Yuan H, Cheng Q, Shen W, Lv Y, Xiao Y, Zhang L, Li P.
Show Full Abstract

As a novel therapeutic approach, photothermal therapy (PTT) combined with chemotherapy can synergistically produce antitumor effects. Herein, dithiodipropionic acid (DTDP) was used as a donor of disulfide bonds sensitive to the tumor microenvironment for establishing chemical bonding between the photosensitizer indocyanine green amino (ICG-NH<sub>2</sub>) and acidified single-walled carbon nanotubes (CNTs). The CNT surface was then coated with conjugates (HD) formed by the targeted modifier hyaluronic acid (HA) and 1,2-tetragacylphosphatidyl ethanolamine (DMPE). After doxorubicin hydrochloride (DOX), used as the model drug, was loaded by CNT carriers, functional nano-delivery systems (HD/CNTs-SS-ICG@DOX) were developed. Nanosystems can effectively induce tumor cell (MCF-7) death in vitro by accelerating cell apoptosis, affecting cell cycle distribution and reactive oxygen species (ROS) production. The in vivo antitumor activity results in tumor-bearing model mice, further verifying that HD/CNTs-SS-ICG@DOX inhibited tumor growth most significantly by mediating a synergistic effect between chemotherapy and PTT, while various functional nanosystems have shown good biological tissue safety. In conclusion, the composite CNT delivery systems developed in this study possess the features of high biocompatibility, targeted delivery, and responsive drug release, and can achieve the efficient coordination of chemotherapy and PTT, with broad application prospects in cancer treatment.

Also flagged:AlcoholsligninwaterEthylene glycolpropylene glycol1,4-butanediol
Journal Article 2024-08-23 No Snippets Bujanovic BM, Hirth K, Ralph S, Reiner RS, Dongre P, Mickles C, Karlen SD, Baez C, Clemons C.
Show Full Abstract

This study aimed to investigate the intrinsic efficiency of renewable alcohols, applied under autocatalytic conditions, for removing lignin from aspen and hot-water-extracted aspen while substantially preserving the lignin structure so as to facilitate various valorization strategies. Ethylene glycol (EG), propylene glycol (PG), 1,4-butanediol (BDO), ethanol (EtOH), and tetrahydrofurfuryl alcohol (THFA) were evaluated based on their lignin solubilization ability, expressed as the relative energy difference (RED) following the principles of the Hansen solubility theory. The findings indicate that alcohols with a higher lignin solubilization potential lead to increased delignification, almost 90%, and produce a lignin with a higher content of β-O-4 bonds, up to 68% of those found in aspen milled wood lignin, thereby indicating their potential for valorization through depolymerization. However, these alcohols also produce lignin with a higher content of β-β and β-5 bonds, resulting in a higher molecular weight and polydispersity, due to readily occurring homolytic reactions. Hot-water extraction (HWE) conducted prior to alcohol treatment reduced the delignification efficiency and resulted in a lignin with a lower β-O-4 bond content. The lignins produced in these experiments exhibited a superior UV-A absorption capacity compared with synthetic benzophenone, as well as a greater radical quenching ability than synthetic butylated hydroxytoluene, indicating their potential for use in the protection of polymers against degradation.

Also flagged:CD117odontogenic keratocystscluster of differentiation (CD) 117receptor tyrosine kinasec-KITKIT
Journal Article 2024-08-23 No Snippets Varma S, Pm S, Viswanathan Deepthi P, G I.
Show Full Abstract

<h4>Background</h4>Odontogenic lesions contain mast cells (MCs), particularly those with a cystic appearance. Because of their high recurrence rates and aggressive clinical behaviour, odontogenic keratocysts (OKCs) require special treatment. A particular kind of protein called cluster of differentiation (CD) 117/ receptor tyrosine kinase (c-KIT) is present on the surface of many cells. Most hematopoietic cells lose their expression of KIT during the differentiation process, with the exception of MCs, which continue to express KIT throughout their lifetime.<h4>Aim</h4>Using the CD117 immunomarker, this immunohistochemical investigation sought to assess the presence and location of MCs in OKCs and examine the relationship between MC numbers in sporadic, syndromic, and recurrent OKCs.<h4>Methods</h4>The study comprised 30 paraffin-embedded tissue specimens, and a histopathological diagnosis was made from hematoxylin and eosin-stained sections with a thickness of 4-5 µ. Out of 30 specimens, 21 were sporadic, six were recurrent OKCs, and three were syndrome-associated OKCs. CD-117/c-kit rabbit polyclonal primary antibody was used to stain the sections for observing MCs, which were then viewed under a light microscope with a digital camera and a desktop computer with MICAPS software for viewing images.<h4>Result</h4>To compare the number of MCs among OKCs, a one-way ANOVA test was used. Our study revealed that a statistically significant increase in MCs has been observed in the subepithelial and deep connective tissue of recurrent OKC (p < 0.05). However, a comparison of the mean MC value among three OKC subtypes did not reveal any statistically significant differences. An increased mast count was observed in the deep connective tissue layer of syndromic OKC under multiple comparisons.<h4>Conclusion</h4>Our study concluded that MCs were present in increased numbers both in the superficial and deep connective tissue of recurrent OKCs, indicative of their aggressive clinical behaviour. Increased mean MC counts observed in some of the sporadic cases may be an indicator of their chances of recurrence in the future.

Also flagged:Hydroxyapatitesilver camphoriminecamphoriminecamphor sulfonimineiminecamphor
Journal Article 2024-08-23 No Snippets Costa JP, Sousa SA, Leitão JH, Marques F, Alves MM, Carvalho MFNN.
Show Full Abstract

Hydroxyapatite (HAp) is a widely used biocompatible material in orthopedic composite preparations. However, HAp composites that exhibit both anticancer and antibacterial activities through bioactive coordination complexes are relatively rare. To explore orthopedic applications, we blended several silver camphorimine compounds with HAp to create [Ag(I)] composites. All compounds [Ag(NO<sub>3</sub>)(L)<sub>n</sub>] (n = 1,2) based on camphorimine (L<sup>A</sup>), camphor sulfonimine (L<sup>B</sup>) or imine bi-camphor (L<sup>C</sup>) ligands demonstrated significant cytotoxic activity (IC<sub>50</sub> = 0.30-2.6 μg<sub>Ag</sub>/mL) against osteosarcoma cancer cells (HOS). Based on their structural and electronic characteristics, four complexes (<b>1</b>-<b>4</b>) were selected for antibacterial evaluation against <i>Escherichia coli</i>, <i>Burkholderia contaminans</i>, <i>Pseudomonas aeruginosa</i>, and <i>Staphylococcus aureus</i>. All complexes (<b>1</b>-<b>4</b>) revealed combined anticancer and antibacterial activities; therefore, they were used to prepare [Ag(I)]:HAp composites of 50:50% and 20:80% weight compositions and the activities of the composites were assessed. Results showed that they retain the dual anticancer and antibacterial characteristics of their precursor complexes. To replicate the clinical context of bone-filling applications, hand-pressed surfaces (pellets) were prepared. It is worth highlighting that no agglutination agent was necessary for the pellet's consistency. The biological properties of the so-prepared pellets were assessed, and the HOS cells and bacteria spreading on the pellet's surface were analyzed by SEM. Notably, composite <b>4B</b>, derived from the bicamphor (L<sup>C</sup>) complex [Ag(NO<sub>3</sub>)(OC<sub>10</sub>H<sub>14</sub>N(C<sub>6</sub>H<sub>4</sub>)<sub>2</sub>NC<sub>10</sub>H<sub>14</sub>O)], exhibited significant anticancer activity against HOS cells and antibacterial activity against <i>P. aeruginosa</i>, fostering potential clinical applications on post-surgical OS treatment.

HTT
Also flagged:CalciumOligonucleotidesbrain diseasesneurological diseasesoligonucleotidelipid
Journal Article 2024-08-23 ✓ 4 Snippets Buijsen RAM, van der Graaf LM, Kuijper EC, Pepers BA, Daoutsali E, Weel L, Raz V, Parfitt DA, van Roon-Mom WMC.
In-Text Gene Mentions

…in huntingtin (HTT) pre-mRNA, thereby…

…skip in humanHttpre-mRNA ([ 16…

…SinceHTTis only expressed…

…delivery methods ofHTT-AON12.1 in D35 cortical…

Show Full Abstract

Antisense technology demonstrates significant potential for addressing inherited brain diseases, with over a dozen products already available and numerous others in the development pipeline. The versatility of differentiating induced pluripotent stem cells (iPSCs) into nearly all neural cell types proves invaluable for comprehending the mechanisms behind neurological diseases, replicating cellular phenotypes, and advancing the testing and development of new therapies, including antisense oligonucleotide therapeutics. While delivering antisense oligonucleotides (ASOs) to human iPSC-based neuronal models has posed challenges, this study explores various delivery methods, including lipid-based transfection, gymnotic uptake, Ca<sup>(2+)</sup>-enhanced medium (CEM)-based delivery, and electroporation, in 2D and 3D hiPSC-derived neuronal models. This study reveals that CEM-based delivery exhibits efficiency and low toxicity in both 2D neuronal cultures and 3D brain organoids. Furthermore, the findings indicate that CEM is slightly more effective in neurons than in astrocytes, suggesting promising avenues for further exploration and optimization of preclinical ASO strategies in the treatment of neurological disorders.

CA10
Also flagged:immune responseinsulinsecretioncalciumdopaminesynapse
Journal Article 2024-08-23 ✓ 1 Snippet Cheng H, Lyu Y, Liu Z, Li C, Qu K, Li S, Ahmed Z, Ma W, Qi X, Chen N, Lei C.
In-Text Gene Mentions

…( ACAT1 ,CA10, GAB1 ,…

Show Full Abstract

(1) Background: Mengshan cattle from the Yimeng mountainous region in China stand out as a unique genetic resource, known for their adaptive traits and environmental resilience. However, these cattle are currently endangered and comprehensive genomic characterization remains largely unexplored. This study aims to address this gap by investigating the genomic features and selection signals in Mengshan cattle. (2) Methods: Utilizing whole-genome resequencing data from 122 cattle, including 37 newly sequenced Mengshan cattle, we investigated population structure, genetic diversity, and selection signals. (3) Results: Our analyses revealed that current Mengshan cattle primarily exhibit European taurine cattle ancestry, with distinct genetic characteristics indicative of adaptive traits. We identified candidate genes associated with immune response, growth traits, meat quality, and neurodevelopment, shedding light on the genomic features underlying the unique attributes of Mengshan cattle. Enrichment analysis highlighted pathways related to insulin secretion, calcium signaling, and dopamine synapse, further elucidating the genetic basis of their phenotypic traits. (4) Conclusions: Our results provide valuable insights for further research and conservation efforts aimed at preserving this endangered genetic resource. This study enhances the understanding of population genetics and underscores the importance of genomic research in informing genetic resources and conservation initiatives for indigenous cattle breeds.

Also flagged:clavulanic acidtazobactamdiazabicyclooctanecyclicboronatevaborbactam
Journal Article 2024-08-23 No Snippets Fatima N, Khalid S, Rasool N, Imran M, Parveen B, Kanwal A, Kanwal A, Irimie M, Ciurea CI.
Show Full Abstract

Some antibiotics that are frequently employed are <i>β</i>-lactams. In light of the hydrolytic process of <i>β</i>-lactamase, found in Gram-negative bacteria, inhibitors of <i>β</i>-lactamase (BLIs) have been produced. Examples of first-generation <i>β</i>-lactamase inhibitors include sulbactam, clavulanic acid, and tazobactam. Many kinds of bacteria immune to inhibitors have appeared, and none cover all the <i>β</i>-lactamase classes. Various methods have been utilized to develop second-generation <i>β</i>-lactamase inhibitors possessing new structures and facilitate the formation of diazabicyclooctane (DBO), cyclic boronate, metallo-, and dual-nature <i>β</i>-lactamase inhibitors. This review describes numerous promising second-generation <i>β</i>-lactamase inhibitors, including vaborbactam, avibactam, and cyclic boronate serine-<i>β</i>-lactamase inhibitors. Furthermore, it covers developments and methods for synthesizing M<i>β</i>L (metallo-<i>β</i>-lactamase inhibitors), which are clinically effective, as well as the various dual-nature-based inhibitors of <i>β</i>-lactamases that have been developed. Several combinations are still only used in preclinical or clinical research, although only a few are currently used in clinics. This review comprises materials on the research progress of BLIs over the last five years. It highlights the ongoing need to produce new and unique BLIs to counter the appearance of multidrug-resistant bacteria. At present, second-generation BLIs represent an efficient and successful strategy.

Preprints.org 2024-08-23 Preprint (No Snippets API) Choi MR, Chang HJ, Heo J, Yum SH, Jo E, Kim M, Lee S.
Show Full Abstract

The aim of this study was to identify differentially expressed lncRNAs (DElncRNAs) and mRNAs (DEmRNAs) in the endometrium of individuals with and without EMS during the proliferative (P) and secretory (S) phases of the menstrual cycle. Tissues were obtained from 18 control (CT; P-phase [pCT], n=8; S-phase [sCT], n=13) and 23 EMS patients (P-phase [pEMS], n=13; S-phase [sEMS], n=12). DElncRNAs and DEmRNAs were analyzed using total RNA-sequencing. In P-phase, expression of NONHSAG019742.2 and NONHSAT120701.2 was significantly higher in EMS than control patients, that of while NONHSAG048398.2 and NONHSAG016560.2 was lower in EMS patients. In S-phase, expression of NONHSAT000959.2, NONHSAT203423.1, and NONHSAG053769.2 was significantly increased in EMS patients, while that of NONHSAG012105.2 and NONHSAG020839.2 was lower. In addition, the expression of HSD11B2, THBS1, GPX3, and SHISA6 was similar to that of neighboring lncRNAs in both P- and S-phases. In contrast, ELP3 and NR4A1, respectively, were up- or downregulated in pEMS tissues. In sEMS, expression of LAMB3 and HIF1A was increased, while expression of PAM was reduced. Our findings on lncRNAs and mRNAs encourage not only to explore the potential clinical applications of lncRNAs and mRNAs as prognostic or diagnostic biomarkers for EMS but also to gain valuable insights into its pathogenesis.

Also flagged:tissue injuriessecretionmyelinaxoninnervationextracellular
Journal Article 2024-08-22 No Snippets Bordett R, Danazumi KB, Wijekoon S, Garcia CJ, Abdulmalik S, Kumbar SG.
Show Full Abstract

Soft-tissue injuries affecting muscles, nerves, vasculature, tendons, and ligaments often diminish the quality of life due to pain, loss of function, and financial burdens. Both natural healing and surgical interventions can result in scarring, which potentially may impede functional recovery and lead to persistent pain. Scar tissue, characterized by a highly disorganized fibrotic extracellular matrix, may serve as a physical barrier to regeneration and drug delivery. While approaches such as drugs, biomaterials, cells, external stimulation, and other physical forces show promise in mitigating scarring and promoting regenerative healing, their implementation remains limited and challenging. Ultrasound, laser, electrical, and magnetic forms of external stimulation have been utilized to promote soft tissue as well as neural tissue regeneration. After stimulation, neural tissues experience increased proliferation of Schwann cells, secretion of neurotropic factors, production of myelin, and growth of vasculature, all aimed at supporting axon regeneration and innervation. Yet, the outcomes of healing vary depending on the pathophysiology of the damaged nerve, the timing of stimulation following injury, and the specific parameters of stimulation employed. Increased treatment intensity and duration have been noted to hinder the healing process by inducing tissue damage. These stimulation modalities, either alone or in combination with nerve guidance conduits and scaffolds, have been demonstrated to promote healing. However, the literature currently lacks a detailed understanding of the stimulation parameters used for nerve healing applications. In this article, we aim to address this gap by summarizing existing reports and providing an overview of stimulation parameters alongside their associated healing outcomes.

Also flagged:Glycosphingolipidsmetabolismsynthesisbiosynthesisglycolipidssignal transduction
Journal Article 2024-08-22 No Snippets Bonab MKF, Guo Z, Li Q.
Show Full Abstract

GSLs are the major glycolipids in vertebrates and mediate many key biological processes from intercellular recognition to <i>cis</i> regulation of signal transduction. The fast-expanding field of glycobiology has led to a growing demand for diverse and structurally defined GSLs, and enzymatic GSL synthesis is developing rapidly in accordance. This article provides an overview of natural GSL biosynthetic pathways and surveys the bacterial enzymes applied to GSL synthesis and recent progress in synthesis strategies. By correlating these three areas, this article aims to define the gaps between GSL biosynthesis and chemoenzymatic synthesis and evaluate the opportunities for harnessing natural forces to access GSLs efficiently.

Also flagged:gene expressionZscan2Bag6Chronic obstructive pulmonary diseasechronic lung diseasepulmonary emphysema
Journal Article 2024-08-22 No Snippets Sánchez Carretero L, Cardeñosa Pérez ÀC, Peces-Barba G, Pérez-Rial S.
Show Full Abstract

Chronic obstructive pulmonary disease is a common chronic lung disease with an ever-increasing incidence. Despite years of drug research and approvals, we are still not able to halt progress or restore normal lung function. Our previous studies have demonstrated that liver growth factor-LGF has an effect on the repair of the affected tissue in a mouse model of cigarette smoke exposure, but by what pathways it achieves this is unknown. The present study aimed to identify differentially expressed genes between emphysematous mice treated with LGF to identify potential therapeutic targets for the treatment of pulmonary emphysema. The emphysema mouse model was induced by prolonged exposure to cigarette smoke. To determine the gene expression profile of the lung in smokers treated or not with LGF, lung messenger RNA gene expression was assessed with the Agilent Array platform. We carried out differentially expressed gene analysis, functional enrichment and validated in treated mouse lung samples. The treated group significantly improved lung function (~35%) and emphysema level (~20%), consistent with our previous published studies. Microarray analysis demonstrated 290 differentially expressed genes in total (2.0-fold over or lower expressed). Injury repair-associated genes and pathways were further enhanced in the lung of LGF treated mice. The expression trends of two genes (Zscan2 and Bag6) were different in emphysematous lungs treated with LGF compared to untreated lungs. Therefore, Zscan2 and Bag6 genes could play a role in regulating inflammation and the immune response in the lung that undergoes partial lung regeneration. However, further studies are necessary to demonstrate this causal relationship.

HTT
Also flagged:CHCHD2glutaminebrain developmentorganizationcoiled-coil--coiled-coil-helix domain containing 2
Journal Article 2024-08-22 ✓ 5 Snippets Lisowski P, Lickfett S, Rybak-Wolf A, Menacho C, Le S, Pentimalli TM, Notopoulou S, Dykstra W, Oehler D, López-Calcerrada S, Mlody B, Otto M, Wu H, Richter Y, Roth P, Anand R, Kulka LAM, Meierhofer D, Glazar P, Legnini I, Telugu NS, Hahn T, Neuendorf N, Miller DC, Böddrich A, Polzin A, Mayatepek E, Diecke S, Olzscha H, Kirstein J, Ugalde C, Petrakis S, Cambridge S, Rajewsky N, Kühn R, Wanker EE, Priller J, Metzger JJ, Prigione A.
In-Text Gene Mentions

…the protein huntingtin (HTT) causes the neurodegenerative…

…suggests that mutantHTT(mHTT) disrupts brain…

…gene Huntingtin (HTT) encoding for…

…for the proteinHTT.…

…although wild-type (WT)HTTis present in…

Show Full Abstract

Expansion of the glutamine tract (poly-Q) in the protein huntingtin (HTT) causes the neurodegenerative disorder Huntington's disease (HD). Emerging evidence suggests that mutant HTT (mHTT) disrupts brain development. To gain mechanistic insights into the neurodevelopmental impact of human mHTT, we engineered male induced pluripotent stem cells to introduce a biallelic or monoallelic mutant 70Q expansion or to remove the poly-Q tract of HTT. The introduction of a 70Q mutation caused aberrant development of cerebral organoids with loss of neural progenitor organization. The early neurodevelopmental signature of mHTT highlighted the dysregulation of the protein coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2), a transcription factor involved in mitochondrial integrated stress response. CHCHD2 repression was associated with abnormal mitochondrial morpho-dynamics that was reverted upon overexpression of CHCHD2. Removing the poly-Q tract from HTT normalized CHCHD2 levels and corrected key mitochondrial defects. Hence, mHTT-mediated disruption of human neurodevelopment is paralleled by aberrant neurometabolic programming mediated by dysregulation of CHCHD2, which could then serve as an early interventional target for HD.

POU3F2
Also flagged:AUTS2Autism Susceptibility Candidate 2intellectual disabilitymicrocephalyCas9WNT
Journal Article 2024-08-22 ✓ 1 Snippet Geng Z, Tai YT, Wang Q, Gao Z.
In-Text Gene Mentions

…as FOXG1 ,POU3F2, BCL11B ,…

Show Full Abstract

Individuals with the Autism Susceptibility Candidate 2 (AUTS2) gene disruptions exhibit symptoms such as intellectual disability, microcephaly, growth retardation, and distinct skeletal and facial differences. The role of AUTS2 in neurodevelopment has been investigated using animal and embryonic stem cell models. However, the precise molecular mechanisms of how AUTS2 influences neurodevelopment, particularly in humans, are not thoroughly understood. Our study employed a 3D human cerebral organoid culture system, in combination with genetic, genomic, cellular, and molecular approaches, to investigate how AUTS2 impacts neurodevelopment through cellular signaling pathways. We used CRISPR/Cas9 technology to create AUTS2-deficient human embryonic stem cells and then generated cerebral organoids with these cells. Our transcriptomic analyses revealed that the absence of AUTS2 in cerebral organoids reduces the populations of cells committed to the neuronal lineage, resulting in an overabundance of cells with a transcription profile resembling that of choroid plexus (ChP) cells. Intriguingly, we found that AUTS2 negatively regulates the WNT/β-catenin signaling pathway, evidenced by its overactivation in AUTS2-deficient cerebral organoids and in luciferase reporter cells lacking AUTS2. Importantly, treating the AUTS2-deficient cerebral organoids with a WNT inhibitor reversed the overexpression of ChP genes and increased the downregulated neuronal gene expression. This study offers new insights into the role of AUTS2 in neurodevelopment and suggests potential targeted therapies for neurodevelopmental disorders.

Also flagged:COVID-19coronavirus disease 2019pneumoniaCOVID-19 infectioncardiovascular diseaseprimary ciliary dyskinesia
Journal Article 2024-08-22 No Snippets Kamenarova K, Kachakova-Yordanova D, Baymakova M, Georgiev M, Mihova K, Petkova V, Beltcheva O, Argirova R, Atanasov P, Kunchev M, Andonova R, Zasheva A, Drenska R, Ivanov I, Pantileeva D, Koleva V, Penev A, Lekova-Nikova D, Georgiev D, Pencheva D, Bozhilova R, Ivanova N, Dimova I, Plochev K, Popov G, Popivanov I, Gabrovsky N, Leseva M, Mitev V, Kaneva R.
Show Full Abstract

Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) causes coronavirus disease 2019 (COVID-19), a pneumonia with extremely heterogeneous clinical presentation, ranging from asymptomatic to severely ill patients. Previous studies have reported links between the presence of host genetic variants and the outcome of the COVID-19 infection. In our study, we used whole exome sequencing in a cohort of 444 SARS-CoV-2 patients, admitted to hospital in the period October-2020-April-2022, to search for associations between rare pathogenic/potentially pathogenic variants and COVID-19 progression. We used gene prioritization-based analysis in genes that have been reported by host genetic studies. Although we did not identify correlation between the presence of rare pathogenic variants and COVID-19 outcome, in critically ill patients we detected known mutations in a number of genes associated with severe disease related to cardiovascular disease, primary ciliary dyskinesia, cystic fibrosis, DNA damage repair response, coagulation, primary immune disorder, hemoglobin subunit β, and others. Additionally, we report 93 novel pathogenic variants found in severely infected patients who required intubation or died. A network analysis showed main component, consisting of 13 highly interconnected genes related to epithelial cilium. In conclusion, we have detected rare pathogenic host variants that may have influenced the COVID-19 outcome in Bulgarian patients.

TNFSF4
Also flagged:CLDN7tight junctionstumorscancerscancerovarian cancers
Journal Article 2024-08-22 ✓ 1 Snippet Fan X, Qi A, Zhang M, Jia Y, Li S, Han D, Liu Y.
In-Text Gene Mentions

…NT5E, PVR, TMEM173,TNFSF4, TNFRSF8, TNFRSF14, TNFRSF9,…

Show Full Abstract

<h4>Background</h4>CLDN is a core component of tight junctions (TJs). Abnormal expressions of CLDNs are commonly detected in various types of tumors. CLDNs are of interest as a potential therapeutic target. CLDNs are closely associated with most cancers of epithelial origin, especially when CLDN7 promotes cancer cell metastasis, such as in gastric, cervical, and ovarian cancers.Its expression and prognosis in breast cancer (BC) remain unknown.The purpose of this study was to investigate the expression pattern of CLDN7 and related immune factors in BC and shed light on a better therapeutic avenue for BC patients.<h4>Method</h4>The cBioPortal, GEPIA, and TCGA databases were used to comprehensively assess the expression of CLDN7 in BC. The Kaplan-Meier Plotter (KMP) database was applied to examine the relationship among the CLDN7 overexpression (OE), prognosis, and overall survival (OS) of BC patients. Immunohistochemical staining was performed on 92 BC tissue samples and 20 benign breast tumors to verify the expression level of CLDN-7 protein and its correlation with clinicopathological features and prognosis. TIMER2.0 was used to analyze the correlation between the CLDN7 OE and immune gene activation using BC-related transcriptomic data. Enrichment analyses of CLDN7-related immune pathways were conducted using online databases. The risk of expression of CLDN7-related immune genes was assessed and differentially expressed (DE) genes were included in the construction of the risk prognosis nomogram.<h4>Results</h4>Both database analysis and clinical sample validation results showed that CLDN7 was significantly overexpressed (OE) in BC, and the OE was correlated with poor DFS in BC patients (p < 0.05). TIMER2.0 analysis indicated that CLDN7 OE was negatively associated with the activation of B-cells, CD4<sup>+</sup> T-cells, and CD8<sup>+</sup> T-cells but positively with the M<sub>0</sub> macrophages. Pathway enrichment analysis suggested that CLDN7-related immune factors were mostly involved in the NF-κB and T-cell receptor (TCR) signaling pathways. Univariate Cox regression was used to analyze the correlation between 52 CLDN7 related genes and OS, and 22 genes that are related to prognosis were identified. Prognostic genes were included in the prognostic nomogram of BC with a C-index of 0.76 to predict the 3-year and 5-year OS probabilities of BC individuals.<h4>Conclusions</h4>These findings provide evidence for the role of CLDN7-linked tumor immunity, suggesting that CLDN7 might be a potential immunotherapeutic target for BC, and its association with immune markers could shed light on the better prognosis of BC.

HFE
Also flagged:sickle cell diseasehydroxyureaanemiadeaththrombosisacute respiratory failure
Journal Article 2024-08-22 ✓ 1 Snippet Alan S, Sharma D, Pecker LH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Purpose of review</h4>Pregnancy for people with sickle cell disease (SCD) is high risk with persistently high rates of severe maternal and fetal mortality and morbidity. Transfusion therapy is the best-studied treatment for SCD in pregnancy; hydroxyurea is not usually used because of teratogenicity concerns. In high-resource settings, red cell transfusions are likely underutilized, while in low-resource settings, they may be altogether unavailable.<h4>Recent findings</h4>A randomized controlled trial and meta-analysis, two of the strongest forms of clinical research, show transfusion significantly reduces maternal and fetal death, painful crisis, thrombosis, and acute respiratory failure. Downstream benefits of treatment are less well measured and may include improving maternal anemia, reducing opioid exposure, and avoiding hospitalization, which presents risk for additional complications. Alloimmunization is a particular transfusion risk in SCD. However, many strategies can mitigate this risk. Accordingly, the American Society of Hematology classifies chronic transfusion in pregnancy as low risk.<h4>Summary</h4>Given the low risk classification, lack of alternative therapies, dismal, stagnant pregnancy outcomes and the potential for profound treatment benefit, wider use of chronic transfusion therapy for SCD pregnancy is likely indicated. This review discusses the benefits and potential risks of prophylactic transfusions for SCD pregnancy. Use of chronic transfusions during pregnancy is indicated to help urgently transform outcomes.

Also flagged:nitric oxidecancertumorhydrogen sulfidemembranescarbon monoxide
Journal Article 2024-08-22 No Snippets Dos Reis RA, Sarkar I, Rodrigues MG, Matson JB, Seabra AB, Kashfi K.
Show Full Abstract

The gasotransmitters nitric oxide (NO) and hydrogen sulfide (H<sub>2</sub>S) play important roles not only in maintaining physiological functions, but also in pathological conditions and events. Importantly, these molecules show a complex interplay in cancer biology, demonstrating both tumor-promoting and anti-tumor activities depending on their concentration, flux, and the environmental redox state. Additionally, various cell types respond differently to NO and H<sub>2</sub>S. These gasotransmitters can be synergistically combined with traditional anticancer treatments such as radiotherapy, immunotherapy, chemotherapy, and phototherapy. Notably, NO, and more recently H<sub>2</sub>S, have been shown to reverse multidrug resistance. Nanomaterials to deliver NO donors and, to a lesser extent, H<sub>2</sub>S donors, have emerged as a promising approach for targeted delivery of these gasotransmitters. Nanotechnology has advanced the delivery of anticancer drugs, enhancing efficiency and reducing side effects on non-cancerous cells. This review highlights recent progress in the design of NO and H<sub>2</sub>S-releasing nanomaterials for anticancer effects. It also explores the interactions between NO and H<sub>2</sub>S, which are crucial for developing combined therapies and nanomedicines with minimal side effects.

PRDX6
Also flagged:cell developmentimmunitytissue homeostasistumorsimmune responseoxygen
Journal Article 2024-08-22 ✓ 4 Snippets Kuehu DL, Fu Y, Nasu M, Yang H, Khadka VS, Deng Y.
In-Text Gene Mentions

…peroxiredoxin 6 (PRDX6) ( p…

…endoplasmic reticulum, andPRDX6is also found…

…, PRDX4 andPRDX6.…

…only marginally forPRDX6.…

Show Full Abstract

The thymus, a central lymphoid organ in animals, serves as the site for T cell development, differentiation and maturation, vital to adaptive immunity. The thymus is critical for maintaining tissue homeostasis to protect against tumors and tissue damage. An overactive or prolonged immune response can lead to oxidative stress from increased production of reactive oxygen species. Heat stress induces oxidative stress and overwhelms the natural antioxidant defense mechanisms. This study's objectives were to investigate the protective properties of astaxanthin against heat-induced oxidative stress and apoptosis in the chicken thymus, by comparing the growth performance and gene signaling pathways among three groups: thermal neutral, heat stress, and heat stress with astaxanthin. The thermal neutral temperature was 21-22 °C, and the heat stress temperature was 32-35 °C. Both heat stress groups experienced reduced growth performance, while the astaxanthin-treated group showed a slightly lesser decline. The inflammatory response and antioxidant defense system were activated by the upregulation of the <i>NF-kB</i>, <i>NFE2L2</i>, <i>PPARα</i>, cytoprotective capacity, and apoptotic gene pathways during heat stress compared to the thermal neutral group. However, expression levels showed no significant differences between the thermal neutral and heat stress with antioxidant groups, suggesting that astaxanthin may mitigate inflammation and oxidative stress damage.

Also flagged:MethylationTumorN6-methyladenosinegene expressioninfectionsimmune responses
Journal Article 2024-08-22 No Snippets Mu S, Zhao K, Zhong S, Wang Y.
Show Full Abstract

N6-methyladenosine (m6A) represents the most prevalent and significant internal modification in mRNA, with its critical role in gene expression regulation and cell fate determination increasingly recognized in recent research. The immune system, essential for defense against infections and maintaining internal stability through interactions with other bodily systems, is significantly influenced by m6A modification. This modification acts as a key post-transcriptional regulator of immune responses, though its effects on different immune cells vary across diseases. This review delineates the impact of m6A modification across major system-related cancers-including those of the respiratory, digestive, endocrine, nervous, urinary reproductive, musculoskeletal system malignancies, as well as acute myeloid leukemia and autoimmune diseases. We explore the pathogenic roles of m6A RNA modifications within the tumor immune microenvironment and the broader immune system, highlighting how RNA modification regulators interact with immune pathways during disease progression. Furthermore, we discuss how the expression patterns of these regulators can influence disease susceptibility to immunotherapy, facilitating the development of diagnostic and prognostic models and pioneering new therapeutic approaches. Overall, this review emphasizes the challenges and prospective directions of m6A-related immune regulation in various systemic diseases throughout the body.

Also flagged:Major Histocompatibility ComplexMHCHLApeptidesautoimmune diseasespeptide
Journal Article 2024-08-22 No Snippets Arnaiz-Villena A, Juarez I, Vaquero-Yuste C, Lledo T, Martin-Villa JM, Suarez-Trujillo F.
Show Full Abstract

The relationship between microbiota and the immune system is complex and characterized by the ways in which microbiota directs immune function interactions, both innate and acquired and also keeps activating the immune system throughout an individual's life. In this respect, the human Major Histocompatibility Complex (MHC, referred to as HLA in humans) plays a crucial role and is also established in self-defense against microbes by presenting microbial-derived peptides to the immune cells. However, this assumption has some unclear aspects that should be investigated. For example, how is the microbiota shaped by microbe species diversity, quantity and functions of the immune system, as well as the role and molecular mechanisms of the HLA complex during this process. There are autoimmune diseases related to both HLA and specific microbiota changes or alterations, many of which are mentioned in the present review. In addition, the HLA peptide presenting function should be put in a framework together with its linkage to diseases and also with HLA compatibility necessary for transplants to be successful. These are still quite an enigmatically statistical and phenomenological approach, but no firm pathogenic mechanisms have been described; thus, HLA's real functioning is still to be fully unveiled. After many years of HLA single-genes studies, firm pathogenesis mechanisms underlying disease linkage have been discovered. Finally, microbiota has been defined as conformed by bacteria, protozoa, archaea, fungi, and viruses; notwithstanding, endogenous viral sequences integrated into the human genome and other viral particles (obelisks) recently found in the digestive mucosa should be taken into account because they may influence both the microbiome and the immune system and their interactions. In this context, we propose to integrate these microbial-genetic particle components into the microbiome concept and designate it as "microgenobiota".

HFE
Also flagged:Liver DamageCeliac DiseaseOverlap Syndromeenteropathysystemic disorderautoimmune liver injury
Journal Article 2024-08-22 ✓ 1 Snippet Ghiga G, Boca LO, Cojocaru E, Stârcea IM, Țarcă E, Scurtu AM, Mocanu MA, Ioniuc I, Tîrnovanu MC, Trandafir LM.
In-Text Gene Mentions

…within normal limits—excludinghemochromatosis, alpha 1 antitrypsin…

Show Full Abstract

Celiac disease (CeD) is an enteropathy caused by the complex interaction between genetic, environmental, and individual immunological factors. Besides the hallmark of intestinal mucosal damage, CeD is a systemic disorder extending beyond the gastrointestinal tract and impacting various other organs, causing extraintestinal and atypical symptoms. The association between CeD and liver damage has been classified into three main categories: mild and asymptomatic liver injury, autoimmune liver injury, and liver failure. We present a case of severe liver damage with cirrhotic evolution in an obese 12-year-old boy who had been admitted due to generalized jaundice and localized abdominal pain in the right hypochondrium. In the course of investigating the etiology of severe liver disease, toxic, infectious, metabolic, obstructive, and genetic causes were excluded. Despite the patient's obesity, a diagnosis of CeD was established, and in accordance with autoimmune hepatitis (AIH) criteria, the patient was diagnosed with autoantibody-negative AIH associated to CeD.

ABT1
Also flagged:membranecytoplasmRING-H2 E3 subfamilystem rotStalk rotdeath
Journal Article 2024-08-22 ✓ 1 Snippet Ding H, Li X, Zhuge S, Du J, Wu M, Li W, Li Y, Ma H, Zhang P, Wang X, Lv G, Zhang Z, Qiu F.
In-Text Gene Mentions

…genes by regulatingABT1-mediated transcriptional acti…

Show Full Abstract

Maize is a significant food and feed product, and abiotic stress significantly impacts its growth and development. <i>Arabidopsis Toxicosa en Levadura</i> (<i>ATL</i>), a member of the RING-H2 E3 subfamily, modulates various physiological processes and stress responses in <i>Arabidopsis</i>. However, the role of <i>ATL</i> in maize remains unexplored. In this study, we systematically identified the genes encoding <i>ATL</i> in the maize genome. The results showed that the maize <i>ATL</i> family consists of 77 members, all predicted to be located in the cell membrane and cytoplasm, with a highly conserved RING domain. Tissue-specific expression analysis revealed that the expression levels of <i>ATL</i> family genes were significantly different in different tissues. Examination of the abiotic stress data revealed that the expression levels of <i>ATL</i> genes fluctuated significantly under different stress conditions. To further understand the biological functions of maize ATL family genes under high-temperature stress, we studied the high-temperature phenotypes of the maize ZmATL family gene <i>ZmATL10</i> and its homologous gene <i>AtATL27</i> in <i>Arabidopsis</i>. The results showed that overexpression of the <i>ZmATL10</i> and <i>AtATL27</i> genes enhanced resistance to high-temperature stress.

Also flagged:Interleukin-6hydrocarbonfluorocarbonIL-6affinityazide
Journal Article 2024-08-22 No Snippets Chen M, Corless EI, Engelward BP, Swager TM.
Show Full Abstract

When equal volumes of two immiscible liquids are mixed (e.g., a hydrocarbon and a fluorocarbon), Janus droplets can form in an aqueous solution. In a gravity-aligned Janus droplet, the boundary between the two phases is flat and thus optically transparent when viewed from above. When tipped due to interactions with an analyte (i.e., agglutination), the resulting change in refraction and reflection yields an optical signal that can be detected and quantified. This study reports the detection and quantitation of interleukin-6 (IL-6) using emulsions functionalized at the hydrocarbon:aqueous interface with engineered proteins that bind IL-6 at high affinity and specificity. Hyperthermophilic affinity proteins (rcSso7d) are derived from thermophiles, giving them excellent thermal stability. Two rcSso7d affinity protein variants were synthesized with a noncanonical azide-functionalized amino acid to enable click chemistry to novel polymeric anchors embedded in the hydrocarbon phase. The two binding proteins recognize different epitopes, enabling the detection of both monomeric and dimeric IL-6 via agglutination. It is noteworthy that the rsSso7d protein variants, in addition to having superior thermal stability and facile recombinant synthesis in <i>E. coli</i>, show superior performance when compared to commercial antibodies for IL-6.

Also flagged:pancreatic cancerPYGBACTR3CCNA2ITGB1ATP8A1
Journal Article 2024-08-22 No Snippets Li X, Yu R, Shi B, Chawla A, Feng X, Zhang K, Liang L.
Show Full Abstract

<h4>Background</h4>The growth and metastasis of pancreatic cancer (PC) has been found to be closely associated with liquid-liquid phase separation (LLPS). This study sought to identify LLPS-related biomarkers in PC to construct a robust prognostic model.<h4>Methods</h4>Transcriptomic data and clinical information related to PC were retrieved from publicly accessible databases. The PC-related data set was subjected to differential expression, Mendelian randomization (MR), univariate Cox, and least absolute selection and shrinkage operator analyses to identify biomarkers. Using the biomarkers, we subsequently constructed a risk model, identified the independent prognostic factors of PC, established a nomogram, and conducted an immune analysis.<h4>Results</h4>The study identified four genes linked with an increased risk of PC; that is, <i>PYGB, ACTR3, CCNA2</i>, and <i>ITGB1</i>. Conversely, <i>ATP8A1</i>, and <i>RAP1GAP2</i> were found to provide protection against PC. These findings contributed significantly to the development of a highly precise risk model in which risk, age, and pathology N stage were categorized as independent factors in predicting the prognosis of PC patients. Using these factors, a nomogram was established to predict survival outcomes accurately. An immune analysis revealed varying levels of eosinophils, gamma delta T cells, and other immune cells between the distinct risk groups. The high-risk patients exhibited increased potential for immune escape, while the low-risk patients showed a higher response to immunotherapy.<h4>Conclusions</h4>Six genes were identified as having potential causal relationships with PC. These genes were integrated into a prognostic risk model, thereby serving as unique prognostic signatures. Our findings provide novel insights into predicting the prognosis of PC patients.

HFE
Also flagged:Tumorphagocytosiscolorectal cancerwound healingTNF-αtumors
Journal Article 2024-08-22 ✓ 1 Snippet Leonard NA, Corry SM, Reidy E, Egan H, O'Malley G, Thompson K, McDermott E, O'Neill A, Zakaria N, Egan LJ, Ritter T, Loessner D, Redmond K, Sheehan M, Canney A, Hogan AM, Hynes SO, Treacy O, Dunne PD, Ryan AE.
In-Text Gene Mentions

…taken through thehemochromatosisclinic at University…

Show Full Abstract

CMS4 colorectal cancer (CRC), based on the consensus molecular subtype (CMS), stratifies patients with the poorest disease-free survival rates. It is characterized by a strong mesenchymal stromal cell (MSC) signature, wound healing-like inflammation and therapy resistance. We utilized 2D and 3D <i>in vitro, in vivo</i>, and <i>ex vivo</i> models to assess the impact of inflammation and stromal cells on immunosuppression in CMS4 CRC. RNA sequencing data from untreated stage II/III CRC patients showed enriched TNF-α signatures in CMS1 and CMS4 tumors. Secretome from TNF-α treated cancer cells induced an immunomodulatory and chemotactic phenotype in MSC and cancer-associated fibroblasts (CAFs). Macrophages in CRC tumours migrate and preferentially localise in stromal compartment. Inflammatory CRC secretome enhances expression of PD-L1 and CD47 on both human and murine stromal cells. We demonstrate that TNF-α-induced inflammation in CRC suppresses macrophage phagocytosis via stromal cells. We show that stromal cell-mediated suppression of macrophage phagocytosis is mediated in part through PD-1 signaling. These data suggest that re-stratification of CRC by CMS may reveal patient subsets with microsatellite stable tumors, particularly CMS4-like tumors, that may respond to immunotherapies.

Also flagged:Thalassemiaβ-globinanemiairongene expressionbinding
Journal Article 2024-08-22 No Snippets Rujito L, Wardana T, Siswandari W, Nainggolan IM, Sasongko TH.
Show Full Abstract

Thalassemia encompasses a group of inherited hemoglobin disorders characterized by reduced or absent production of the α- or β-globin chains, leading to anemia and other complications. Current management relies on lifelong blood transfusions and iron chelation, which is burdensome for patients. This review summarizes the emerging therapeutic potential of modulating microRNAs (miRNAs) to treat thalassemia. MiRNAs are small non-coding RNAs that regulate gene expression through sequence-specific binding to messenger RNAs (mRNAs). While they commonly repress gene expression by binding to the 3' untranslated regions (UTRs) of target mRNAs, miRNAs can also interact with 5'UTRs and gene promoters to activate gene expression. Many miRNAs are now recognized as critical regulators of erythropoiesis and are abnormally expressed in β-thalassemia. Therapeutically restoring levels of deficient miRNAs or inhibiting overexpression through miRNA mimics or inhibitors (antagomir), respectively, has shown preclinical efficacy in ameliorating thalassemic phenotypes. The miR-144/451 cluster is especially compelling for targeted upregulation to reactivate fetal hemoglobin synthesis. Advances in delivery systems are addressing previous challenges in stability and targeting of miRNA-based drugs. While still early, gene therapy studies suggest combinatorial approaches with miRNA modulation may provide synergistic benefits. Several key considerations remain including enhancing delivery, minimizing off-target effects, and demonstrating long-term safety and efficacy. While no miRNA therapies have yet progressed to clinical testing for thalassemia specifically, important lessons are being learned through clinical trials for other diseases and conditions, such as cancer, cardiovascular diseases, and viral. If limitations can be overcome through multi-disciplinary collaboration, miRNAs hold great promise to expand and transform treatment options for thalassemia in the future by precisely targeting pathogenic molecular networks. Ongoing innovations, such as advancements in miRNA delivery systems, improved targeting mechanisms, and enhanced understanding of miRNA biology, continue to drive progress in this emerging field towards realizing the clinical potential of miRNA-based medicines for thalassemia patients.

Also flagged:netrin G1SchizophreniaNetrin-G-Ligand-1NGL-1postsynaptic density protein 95cyclin-dependent kinase-like 5
Journal Article 2024-08-22 No Snippets Ibiayo AG, Yang LZ, Liu IY.
Show Full Abstract

Schizophrenia (SCZ) is a chronic psychotic disorder that profoundly alters an individual's perception of reality, resulting in abnormal behavior, cognitive deficits, thought distortions, and disorientation in emotions. Many complicated factors can lead to SCZ, and investigations are ongoing to understand the neurobiological underpinnings of this condition. Presynaptic Netrin G1 and its cognate partner postsynaptic Netrin-G-Ligand-1 (NGL-1) have been implicated in SCZ. This review article emphasized the structure and expression of Netrin G1/NGL-1 in the brain, its dysregulation in SCZ patients, and its role in synaptic plasticity, synaptic interaction, learning and memory, microglia neurotrophic activity, and possible signaling between Netrin G1/NGL-1, postsynaptic density protein 95, and cyclin-dependent kinase-like 5 in synaptic morphogenesis. Pharmaceutical targets and the potential use of Netrin G1/NGL-1 as treatment targets or biomarkers for SCZ were also discussed.

bioRxiv 2024-08-22 Preprint (No Snippets API) Riegman KLH, George C, Whittaker DE, Ahmed MU, Yun H, Huntly BJP, Sims D, Osborne CS, Basson MA.
Show Full Abstract

Neuronal specification, expansion and differentiation are tightly regulated by the concerted actions of transcription and chromatin modifying factors that are recruited to regulatory elements in the genome. Tissue-specific distal regulatory elements are typically located tens to hundreds of kilobases from the gene they regulate. Thus, to identify the distal enhancers that directly regulate a gene, information on the localisation of enhancers relative to the gene promoter in the nucleus is crucial. Cerebellar granule cell progenitors (GCps) are important transit amplifying neuronal progenitors, giving rise to the most abundant neuronal cell type in the brain. Many of the key factors that regulate fundamental developmental processes in GCps have been identified. For instance, the proneural transcription factor Atoh1 is essential for GCp specification, proliferation and differentiation and the ATP-dependent chromatin remodeller CHD7 is necessary for normal GCp proliferation and differentiation. However, both these factors are recruited to distal regulatory elements and the direct regulatory relationships between these factors, the enhancers they are recruited to, and the genes they regulate in GCps remain uncharacterised. To identify active, long-range gene regulatory interactions in GCps, we used promoter capture Hi-C (pcHi-C), and integrated pcHi-C data with ATAC-seq and ChIP-seq data. We present a rich dataset consisting of 46,428 interactions between 22,797 putative distal regulatory regions and 12,905 protein coding gene promoters in primary mouse GCps. Using VISTA-designated hindbrain enhancers as an example, we identify the genes most likely regulated directly by these enhancers and update their annotation accordingly. Motif enrichment analyses identified a significant enrichment of proneural transcription factor motifs in CHD7-regulated enhancers. Further analyses revealed co-localisation of Atoh1 and CHD7 at gene enhancers, suggesting a novel regulatory relationship between Atoh1 and CHD7 in controlling the expression of key genes in the GCp lineage. We used our data to identify >1,500 Atoh-regulated enhancers, contacting the promoters of 577 genes in GCps, and 197 enhancers of 22 genes that appear to be co-regulated by Atoh1 and CHD7. Co-immunoprecipitation experiments showed that Atoh1 and CHD7 proteins interact with each other. These findings support the emerging picture of CHD7 as an important gene regulatory co-factor for lineage-specific transcription factors. The pcHi-C data is presented as a useful resource to the community for investigating the function of long-range enhancers in the cerebellar GCp lineage.

Research Square 2024-08-22 Preprint (No Snippets API) Iuso A, Zhang F, Dorn T, Gnutti B, Anikster Y, Kuebler S, Ahrens-Nicklas R, Gosselin R, Rahman S, Durst R, Zanuttigh E, Güra M, Poch C, Meier A, Laugwitz K, Schüller H, Messias A, Sibon O, Finazzi D, Rippert A, Li D, Truxal K, Nandi D, Lampert B, Yeo M, Gardham A, Nissan B, Cederboim SH, Moretti A.
Show Full Abstract

<title>Abstract</title> <p>Background PPCS deficiency disorder (PPCS DD) is an ultra-rare, autosomal recessive form of dilated cardiomyopathy (DCM) caused by pathogenic variants in <italic>PPCS</italic>, which encodes the enzyme catalyzing the second step in the coenzyme A (CoA) biosynthesis pathway. To date, only six patients worldwide have been identified. In this study, we report on six additional patients. We shed light on the functional aspects of DCM in PPCS DD and evaluate therapeutic approaches to boost CoA levels both in vitro and in vivo. Methods and Results Whole-exome sequencing identified causative variants in PPCS in six additional individuals presenting with DCM and a spectrum of phenotypes, including neuromuscular signs and neurologic deterioration. Western blotting analyses demonstrated destabilizing effects of identified variants on the PPCS protein. Microplate-based assessment of CoA showed reduced levels of the coenzyme in patient-derived fibroblasts, cardiac progenitor cells, and cardiomyocytes. Functional investigation of DCM in cardiac cells and heart patches revealed defects in contractile function and arrhythmic events, which were partially rescued by pantethine. Long-term clinical assessment showed encouraging benefits in pantethine-treated patients. Conclusion Our study expands the genetic and clinical spectrum of PPCS deficiency disorder, identifying six new cases with diverse phenotypes. Functional investigations reveal reduced CoA levels and dysfunction in patient-derived cardiac cells. Pantethine treatment shows promise in partially rescuing DCM phenotypes, both in vitro and in patients. However, complete reversal may require early intervention. These findings underscore the importance of timely diagnosis and treatment in PPCS DD. Future research should focus on optimizing pantethine supplementation and exploring additional therapies to enhance CoA levels and cardiac function in affected individuals.</p>

SOX6
Also flagged:Lgr5Wnt6epithelial cell proliferationesophageal diseasescytokeratin 8Krt8
Journal Article 2024-08-21 ✓ 1 Snippet Kostic L, Leung C, Ahmad Murad K, Kancheva S, Perna S, Lee B, Barker N.
In-Text Gene Mentions

…(Trp63, Sox2, Sox4,Sox6) whilst downregulating differ…

Show Full Abstract

The existence and function of Lgr5<sup>+</sup> cells within the developing esophagus remains unknown. Here, we document multiple discrete Lgr5<sup>+</sup> populations in the developing mouse esophagus, predominantly within nascent epithelial and external muscle layers. Lgr5 expression initially emerges in the developing proximal embryonic epithelium, but progressively extends distally and persists within the distal epithelium of neonates. Fate mapping and ablation analyses reveal a long-term contribution of epithelial Lgr5<sup>+</sup> cells to esophageal organogenesis. Additionally, Lgr5-expressing cells are present in the developing external muscle layer, particularly during the development of the striated component. Fate mapping reveals a significant contribution of these embryonic Lgr5<sup>+</sup> cells to the adult muscle layer. Embryonic Lgr5<sup>+</sup> epithelial cells are also found to be important for regulating epithelial development, serving as a key source of Wnt6, among other ligands, to promote epithelial cell proliferation and formation of epithelial layers. These findings significantly enhance our understanding of esophageal development and shed light on the involvement of Lgr5<sup>+</sup> stem/progenitor cells during organogenesis. Importantly, this study lays the foundation for investigating esophageal diseases related to the Lgr5<sup>+</sup> stem/progenitor cell pool.

Also flagged:MYCKRASRASoncogenescancertumor
Journal Article 2024-08-21 No Snippets Casacuberta-Serra S, González-Larreategui Í, Capitán-Leo D, Soucek L.
Show Full Abstract

RAS and MYC rank amongst the most commonly altered oncogenes in cancer, with RAS being the most frequently mutated and MYC the most amplified. The cooperative interplay between RAS and MYC constitutes a complex and multifaceted phenomenon, profoundly influencing tumor development. Together and individually, these two oncogenes regulate most, if not all, hallmarks of cancer, including cell death escape, replicative immortality, tumor-associated angiogenesis, cell invasion and metastasis, metabolic adaptation, and immune evasion. Due to their frequent alteration and role in tumorigenesis, MYC and RAS emerge as highly appealing targets in cancer therapy. However, due to their complex nature, both oncogenes have been long considered "undruggable" and, until recently, no drugs directly targeting them had reached the clinic. This review aims to shed light on their complex partnership, with special attention to their active collaboration in fostering an immunosuppressive milieu and driving immunotherapeutic resistance in cancer. Within this review, we also present an update on the different inhibitors targeting RAS and MYC currently undergoing clinical trials, along with their clinical outcomes and the different combination strategies being explored to overcome drug resistance. This recent clinical development suggests a paradigm shift in the long-standing belief of RAS and MYC "undruggability", hinting at a new era in their therapeutic targeting.

PRDX6
Also flagged:saltresponse to saltporphyrinmetabolismribosomephotosynthesis
Journal Article 2024-08-21 ✓ 1 Snippet Feng L, Chen Y, Ma T, Zhou C, Sang S, Li J, Ji S.
In-Text Gene Mentions

…GST, GPX andPRDX6, and the key…

Show Full Abstract

<h4>Background</h4>Soil salinity is one of the major abiotic stresses that threatens crop growth. Cotton has some degree of salt tolerance, known as the "pioneer crop" of saline-alkali land. Cultivation of cotton is of great significance to the utilization of saline-alkali land and the development of cotton industry. Gossypium hirsutum and G. barbadense, as two major cotton species, are widely cultivated worldwide. However, until recently, the regulatory mechanisms and specific differences of their responses to salt stress have rarely been reported.<h4>Results</h4>In this study, we comprehensively compared the differences in the responses of G. hirsutum acc. TM-1 and G. barbadense cv. Hai7124 to salt stress. The results showed that Hai7124 exhibited better growth than did TM-1 under salt stress, with greater PRO content and antioxidant capability, whereas TM-1 only presented greater K<sup>+</sup> content. Transcriptome analysis revealed significant molecular differences between the two cotton species in response to salt stress. The key pathways of TM-1 induced by salt are mainly related to growth and development, such as porphyrin metabolism, DNA replication, ribosome and photosynthesis. Conversely, the key pathways of Hai7124, such as plant hormone signal transduction, MAPK signaling pathway-plant, and phenylpropanoid biosynthesis, are mainly related to plant defense. Further comparative analyses of differentially expressed genes (DEGs) revealed that antioxidant metabolism, abscisic acid (ABA) and jasmonic acid (JA) signalling pathways were more strongly activated in Hai7124, whereas TM-1 was more active in K<sup>+</sup> transporter-related genes and ethylene (ETH) signalling pathway. These differences underscore the various molecular strategies adopted by the two cotton species to navigate through salt stress, and Hai7124 responded more strongly to salt stress, which explains the potential reasons for the greater salt tolerance of Hai7124. Finally, we identified 217 potential salt tolerance-related genes, 167 of which overlapped with the confidence intervals of significant SNPs identified in previous genome-wide association studies (GWASs), indicating the high reliability of these genes.<h4>Conclusions</h4>These findings provide new insights into the differences in the regulatory mechanisms of salt tolerance between G. hirsutum and G. barbadense, and identify key candidate genes for salt tolerance molecular breeding in cotton.

HFE
Also flagged:liver injuryDILIliver disorderdeathliver diseasesinjury
Journal Article 2024-08-21 ✓ 1 Snippet García-Cortés M, Matilla-Cabello G, Lucena MI.
In-Text Gene Mentions

…diseases such ashemochromatosisor Wilson's disease,…

Show Full Abstract

The diagnosis of idiosyncratic drug-induced liver injury (DILI) is a challenging task due to the lack of specific features or definitive diagnostic tools. A minimum of clinical and pharmacological information is required, together with laboratory and imaging tests to exclude other causes of liver injury. Several standardized methods have been developed to support clinical judgement and establish causality assessment, the most widely used being the Roussel Uclaf Causality Assessment Method-RUCAM-and structured Expert Opinion. More recently, an evidence-based, revised RUCAM, Electronic Causality Assessment Method-RECAM-has been developed and, although still a work in progress, may replace RUCAM scoring in the future. International collaborative networks and ongoing research efforts are key to advancing biomarker qualification and validation and developing new in vitro patient-based methods that will help improve DILI diagnosis and move towards a personalized medicine approach.

Also flagged:Phenylglycinamidemature brain-derived neurotrophic factormBDNFnerve growth factorNGFglutamate
Journal Article 2024-08-21 No Snippets Jakubiec M, Abram M, Zagaja M, Socała K, Panic V, Latacz G, Mogilski S, Szafarz M, Szala-Rycaj J, Saunders J, West PJ, Nieoczym D, Przejczowska-Pomierny K, Szulczyk B, Krupa A, Wyska E, Wlaź P, Metcalf CS, Wilcox K, Andres-Mach M, Kamiński RM, Kamiński K.
Show Full Abstract

We developed a focused series of original phenyl-glycinamide derivatives which showed potent activity across <i>in vivo</i> mouse seizure models, namely, maximal electroshock (MES) and 6 Hz (using both 32 and 44 mA current intensities) seizure models. Following intraperitoneal (<i>i.p</i>.) administration, compound <b>(</b><b><i>R</i></b><b>)-32</b>, which was identified as a lead molecule, demonstrated potent protection against all seizure models with ED<sub>50</sub> values of 73.9 mg/kg (MES test), 18.8 mg/kg (6 Hz, 32 mA test), and 26.5 mg/kg (6 Hz, 44 mA test). Furthermore, <b>(</b><b><i>R</i></b><b>)-32</b> demonstrated efficacy in both the PTZ-induced kindling paradigm and the <i>iv</i>PTZ seizure threshold test. The expression of neurotrophic factors, such as mature brain-derived neurotrophic factor (mBDNF) and nerve growth factor (NGF), in the hippocampus and/or cortex of mice, and the levels of glutamate and GABA were normalized after PTZ-induced kindling by <b>(<i>R</i>)-32</b>. Importantly, besides antiseizure activity, (<b><i>R</i></b>)<b>-32</b> demonstrated potent antinociceptive efficacy in formalin-induced pain, capsaicin-induced pain, as well as oxaliplatin- and streptozotocin-induced peripheral neuropathy in mice (<i>i.p</i>.). No influence on muscular strength and body temperature in mice was observed. Pharmacokinetic studies and <i>in vitro</i> ADME-Tox data (<i>i.e.</i>, high metabolic stability in human liver microsomes, a weak influence on CYPs, no hepatotoxicity, satisfactory passive transport, <i>etc.</i>) proved favorable drug-like properties of (<b><i>R</i></b>)<b>-32</b>. Thermal stability of (<b><i>R</i></b>)-<b>32</b> shown in thermogravimetry and differential scanning calorimetry gives the opportunity to develop innovative oral solid dosage forms loaded with this compound. The <i>in vitro</i> binding and functional assays indicated its multimodal mechanism of action. (<b><i>R</i></b>)<b>-32</b>, beyond TRPV1 antagonism, inhibited calcium and sodium currents at a concentration of 10 μM. Therefore, the data obtained in the current studies justify a more detailed preclinical development of (<b><i>R</i></b>)<b>-32</b> for epilepsy and pain indications.

DCC
Also flagged:Alzheimer's diseaseADSPARCAmyloid betasigma‐2 receptor
Journal Article 2024-08-21 ✓ 1 Snippet Lizama BN, Williams C, North HA, Pandey K, Duong D, Di Caro V, Mecca AP, Blennow K, Zetterberg H, Levey AI, Grundman M, van Dyck CH, Caggiano AO, Seyfried NT, Hamby ME.
In-Text Gene Mentions

…levels: netrin receptorDCC(Uniprot P43146 ;…

Show Full Abstract

<h4>Introduction</h4>CT1812 is in clinical development for the treatment of Alzheimer's disease (AD). Cerebrospinal fluid (CSF) exploratory proteomics was employed to identify pharmacodynamic biomarkers of CT1812 in mild to moderate AD from two independent clinical trials.<h4>Methods</h4>Unbiased analysis of tandem-mass tag mass spectrometry (TMT-MS) quantitative proteomics, pathway analysis and correlation analyses with volumetric magnetic resonance imaging (vMRI) were performed for the SPARC cohort (NCT03493282). Comparative analyses and a meta-analysis with the interim SHINE cohort (NCT03507790; SHINE-A) followed by network analysis (weighted gene co-expression network analysis [WGCNA]) were used to understand the biological impact of CT1812.<h4>Results</h4>CT1812 pharmacodynamic biomarkers and biological pathways were identified that replicate across two clinical cohorts. The meta-analysis revealed novel candidate biomarkers linked to S2R biology and AD, and network analysis revealed treatment-associated networks driven by S2R.  DISCUSSION: Early clinical validation of CT1812 candidate biomarkers replicating in independent cohorts strengthens the understanding of the biological impact of CT1812 in patients with AD, and supports CT1812's synaptoprotective mechanism of action and its continued clinical development.<h4>Highlights</h4>This exploratory proteomics study identified candidate biomarkers of CT1812 in SPARC (NCT03493282) Comparative analyses identified biomarkers replicating across trials/cohorts Two independent Ph2 trial cohorts (SPARC and interim SHINE [NCT03507790; SHINE-A]) were used in a meta-analysis Amyloid beta (Aβ) & synaptic biology impacted by CT1812 and volumetric magnetic resonance imaging (vMRI) treatment-related correlates emerge Network analyses revealed sigma-2 receptor (S2R)-interacting proteins that may be "drivers" of changes.

DCC
Also flagged:NetrinHedgehogUveal colobomaeye defectaxonsHh
Journal Article 2024-08-21 ✓ 1 Snippet Lusk S, LaPotin S, Presnell JS, Kwan KM.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background</h4>Uveal coloboma, a developmental eye defect, is caused by failed development of the optic fissure, a ventral structure in the optic stalk and cup where axons exit the eye and vasculature enters. The Hedgehog (Hh) signaling pathway regulates optic fissure development: loss-of-function mutations in the Hh receptor ptch2 produce overactive Hh signaling and can result in coloboma. We previously proposed a model where overactive Hh signaling disrupts optic fissure formation by upregulating transcriptional targets acting both cell- and non-cell-autonomously. Here, we examine the Netrin family of secreted ligands as candidate Hh target genes.<h4>Results</h4>We find multiple Netrin ligands upregulated in the zebrafish ptch2 mutant during optic fissure development. Using a gain-of-function approach to overexpress Netrin in a spatiotemporally specific manner, we find that netrin1a or netrin1b overexpression is sufficient to cause coloboma and disrupt wild-type optic fissure formation. We used loss-of-function alleles, CRISPR/Cas9 mutagenesis, and morpholino knockdown to test if loss of Netrin can rescue coloboma in the ptch2 mutant: loss of netrin genes does not rescue the ptch2 mutant phenotype.<h4>Conclusion</h4>These results suggest that Netrin is sufficient but not required to disrupt optic fissure formation downstream of overactive Hh signaling in the ptch2 mutant.

DCC
Also flagged:PI3Korganellesextracellularciliopathy syndromesciliumcancer
Journal Article 2024-08-21 ✓ 5 Snippets Conduit SE, Pearce W, Bhamra A, Bilanges B, Bozal-Basterra L, Foukas LC, Cobbaut M, Castillo SD, Danesh MA, Adil M, Carracedo A, Graupera M, McDonald NQ, Parker PJ, Cutillas PR, Surinova S, Vanhaesebroeck B.
In-Text Gene Mentions

…considered as aDCC, a subset of…

…classified as aDCC, where the mutant…

…classified as aDCC.…

…be classed asDCCas defined by…

…the definition ofDCCfor the following…

Show Full Abstract

Primary cilia are antenna-like organelles which sense extracellular cues and act as signalling hubs. Cilia dysfunction causes a heterogeneous group of disorders known as ciliopathy syndromes affecting most organs. Cilia disassembly, the process by which cells lose their cilium, is poorly understood but frequently observed in disease and upon cell transformation. Here, we uncover a role for the PI3Kα signalling enzyme in cilia disassembly. Genetic PI3Kα-hyperactivation, as observed in PIK3CA-related overgrowth spectrum (PROS) and cancer, induced a ciliopathy-like phenotype during mouse development. Mechanistically, PI3Kα and PI3Kβ produce the PIP<sub>3</sub> lipid at the cilia transition zone upon disassembly stimulation. PI3Kα activation initiates cilia disassembly through a kinase signalling axis via the PDK1/PKCι kinases, the CEP170 centrosomal protein and the KIF2A microtubule-depolymerising kinesin. Our data suggest diseases caused by PI3Kα-activation may be considered 'Disorders with Ciliary Contributions', a recently-defined subset of ciliopathies in which some, but not all, of the clinical manifestations result from cilia dysfunction.

SOX6
Also flagged:Esco2cohesinopathyp53Roberts syndromepathogenesisembryogenesis
Journal Article 2024-08-21 ✓ 1 Snippet Strasser AS, Gonzalez-Reiche AS, Zhou X, Valdebenito-Maturana B, Ye X, Zhang B, Wu M, van Bakel H, Jabs EW.
In-Text Gene Mentions

…expressing Sox5 ,Sox6, and Sox9…

Show Full Abstract

Roberts syndrome (RBS) is an autosomal recessive disorder with profound growth deficiency and limb reduction caused by ESCO2 loss-of-function variants. Here, we elucidate the pathogenesis of limb reduction in an Esco2<sup>fl/fl</sup>;Prrx1-Cre<sup>Tg/0</sup> mouse model using bulk- and single-cell-RNA-seq and gene co-expression network analyses during embryogenesis. Our results reveal morphological and vascular defects culminating in hemorrhage of mutant limbs at E12.5. Underlying this abnormal developmental progression is a pre-apoptotic, mesenchymal cell population specific to mutant limb buds enriched for p53-related signaling beginning at E9.5. We then characterize these p53-related processes of cell cycle arrest, DNA damage, cell death, and the inflammatory leukotriene signaling pathway in vivo. In utero treatment with pifithrin-α, a p53 inhibitor, rescued the hemorrhage in mutant limbs. Lastly, significant enrichments were identified among genes associated with RBS, thalidomide embryopathy, and other genetic limb reduction disorders, suggesting a common vascular etiology among these conditions.

Also flagged:Major depressive disordermental disordersdepressive disordersrespiratory disordersdepressionchronic somatic diseases
Journal Article 2024-08-21 No Snippets Gezsi A, Van der Auwera S, Mäkinen H, Eszlari N, Hullam G, Nagy T, Bonk S, González-Colom R, Gonda X, Garvert L, Paajanen T, Gal Z, Kirchner K, Millinghoffer A, Schmidt CO, Bolgar B, Roca J, Cano I, Kuokkanen M, Antal P, Juhasz G.
Show Full Abstract

The heterogeneity and complexity of symptom presentation, comorbidities and genetic factors pose challenges to the identification of biological mechanisms underlying complex diseases. Current approaches used to identify biological subtypes of major depressive disorder (MDD) mainly focus on clinical characteristics that cannot be linked to specific biological models. Here, we examined multimorbidities to identify MDD subtypes with distinct genetic and non-genetic factors. We leveraged dynamic Bayesian network approaches to determine a minimal set of multimorbidities relevant to MDD and identified seven clusters of disease-burden trajectories throughout the lifespan among 1.2 million participants from cohorts in the UK, Finland, and Spain. The clusters had clear protective- and risk-factor profiles as well as age-specific clinical courses mainly driven by inflammatory processes, and a comprehensive map of heritability and genetic correlations among these clusters was revealed. Our results can guide the development of personalized treatments for MDD based on the unique genetic, clinical and non-genetic risk-factor profiles of patients.

ECI2
Also flagged:lipidmetabolismextracellular trapscolorectal canceretherInterleukin 8
Journal Article 2024-08-21 ✓ 5 Snippets Chen L, Dai P, Liu L, Chen Y, Lu Y, Zheng L, Wang H, Yuan Q, Li X.
In-Text Gene Mentions

Here we show that the lipid metabolism-related gene enoyl-CoA δ-isomerase 2 (ECI2) plays a tumor-suppressor role in CRC and is negatively associated with poor prognosis in CRC patients.

We mechanistically demonstrate that ECI2 reduces ether lipid-mediated Interleukin 8 (IL-8) expression leading to decreased neutrophil recruitment and neutrophil extracellular traps formation for colorectal cancer suppression.

…The lipid-metabolism enzymeECI2reduces neutrophil extracellul…

…chanistically demonstrate thatECI2reduces ether lipid-mediated…

…In particular,ECI2inhibits ether lipid…

Show Full Abstract

Abnormalities in ether lipid metabolism as well as the formation of neutrophil extracellular traps have recently been recognized as detrimental factors affecting tumorigenesis and progression. However, the role of abnormal ether lipid metabolism in colorectal cancer (CRC) evolution has not been reported. Here we show that the lipid metabolism-related gene enoyl-CoA δ-isomerase 2 (ECI2) plays a tumor-suppressor role in CRC and is negatively associated with poor prognosis in CRC patients. We mechanistically demonstrate that ECI2 reduces ether lipid-mediated Interleukin 8 (IL-8) expression leading to decreased neutrophil recruitment and neutrophil extracellular traps formation for colorectal cancer suppression. In particular, ECI2 inhibits ether lipid production in CRC cells by inhibiting the peroxisomal localization of alkylglycerone phosphate synthase (AGPS), the rate-limiting enzyme for ether lipid synthesis. These findings not only deepen our understanding of the role of metabolic reprogramming and neutrophil interactions in the progression of CRC, but also provide ideas for identifying potential diagnostic markers and therapeutic targets for CRC.

LRRC7
Also flagged:nucleosomechromatincell divisionchromosomeschromosomecondensins
Journal Article 2024-08-21 ✓ 4 Snippets Hibino K, Sakai Y, Tamura S, Takagi M, Minami K, Natsume T, Shimazoe MA, Kanemaki MT, Imamoto N, Maeshima K.
In-Text Gene Mentions

Condensinsact as molecular…

Condensinsare also found…

Condensinsare assumed to…

Condensinsact locally to…

Show Full Abstract

For accurate mitotic cell division, replicated chromatin must be assembled into chromosomes and faithfully segregated into daughter cells. While protein factors like condensin play key roles in this process, it is unclear how chromosome assembly proceeds as molecular events of nucleosomes in living cells and how condensins act on nucleosomes to organize chromosomes. To approach these questions, we investigate nucleosome behavior during mitosis of living human cells using single-nucleosome tracking, combined with rapid-protein depletion technology and computational modeling. Our results show that local nucleosome motion becomes increasingly constrained during mitotic chromosome assembly, which is functionally distinct from condensed apoptotic chromatin. Condensins act as molecular crosslinkers, locally constraining nucleosomes to organize chromosomes. Additionally, nucleosome-nucleosome interactions via histone tails constrain and compact whole chromosomes. Our findings elucidate the physical nature of the chromosome assembly process during mitosis.

OLFM4
Also flagged:tumourmTORC1protein synthesispolyaminemetabolismcancer
Journal Article 2024-08-21 ✓ 1 Snippet Imada S, Khawaled S, Shin H, Meckelmann SW, Whittaker CA, Corrêa RO, Alquati C, Lu Y, Tie G, Pradhan D, Calibasi-Kocal G, Nascentes Melo LM, Allies G, Rösler J, Wittenhofer P, Krystkiewicz J, Schmitz OJ, Roper J, Vinolo MAR, Ricciardiello L, Lien EC, Vander Heiden MG, Shivdasani RA, Cheng CW, Tasdogan A, Yilmaz ÖH.
In-Text Gene Mentions

OLFM4

Show Full Abstract

For over a century, fasting regimens have improved health, lifespan and tissue regeneration in diverse organisms, including humans<sup>1-6</sup>. However, how fasting and post-fast refeeding affect adult stem cells and tumour formation has yet to be explored in depth. Here we demonstrate that post-fast refeeding increases intestinal stem cell (ISC) proliferation and tumour formation; post-fast refeeding augments the regenerative capacity of Lgr5<sup>+</sup> ISCs, and loss of the tumour suppressor gene Apc in post-fast-refed ISCs leads to a higher tumour incidence in the small intestine and colon than in the fasted or ad libitum-fed states, demonstrating that post-fast refeeding is a distinct state. Mechanistically, we discovered that robust mTORC1 induction in post-fast-refed ISCs increases protein synthesis via polyamine metabolism to drive these changes, as inhibition of mTORC1, polyamine metabolite production or protein synthesis abrogates the regenerative or tumorigenic effects of post-fast refeeding. Given our findings, fast-refeeding cycles must be carefully considered and tested when planning diet-based strategies for regeneration without increasing cancer risk, as post-fast refeeding leads to a burst in stem-cell-driven regeneration and tumorigenicity.

PTGIS
Also flagged:endometriosismetabolismAMPKHIF-1glutathionephosphorylation
Journal Article 2024-08-21 ✓ 1 Snippet Sarsenova M, Lawarde A, Pathare ADS, Saare M, Modhukur V, Soplepmann P, Terasmaa A, Käämbre T, Gemzell-Danielsson K, Lalitkumar PGL, Salumets A, Peters M.
In-Text Gene Mentions

…, RERG ,PTGIS, GPC3 genes…

Show Full Abstract

Current therapeutics of endometriosis focus on hormonal disruption of endometriotic lesions (ectopic endometrium, EcE). Recent findings show higher glycolysis utilization in EcE, suggesting non-hormonal strategy for disease treatment that addresses cellular metabolism. Identifying metabolically altered cell types in EcE is important for targeted metabolic drug therapy without affecting eutopic endometrium (EuE). Here, using single-cell RNA-sequencing, we examine twelve metabolic pathways in paired samples of EuE and EcE from women with confirmed endometriosis. We detect nine major cell types in both EuE and EcE. Metabolic pathways are most differentially regulated in perivascular, stromal, and endothelial cells, with the highest changes in AMPK signaling, HIF-1 signaling, glutathione metabolism, oxidative phosphorylation, and glycolysis. We identify transcriptomic co-activation of glycolytic and oxidative metabolism in perivascular and stromal cells of EcE, indicating a critical role of metabolic reprogramming in maintaining endometriotic lesion growth. Perivascular cells, involved in endometrial stroma repair and angiogenesis, may be potential targets for non-hormonal treatment of endometriosis.

PEBP1
Also flagged:Nrf2PHKG2ferroptosiscancernon-small cell lung cancerNSCLC
Journal Article 2024-08-21 ✓ 1 Snippet Han F, Chen S, Zhang K, Zhang K, Wang M, Wang P.
In-Text Gene Mentions

…NFS1, NOX1, NQO1,PEBP1, PGD, PHKG2, PLA2G6,…

Show Full Abstract

While ferroptosis shows promise in anti-cancer strategy, the molecular mechanisms behind this process remain poorly understood. Our research aims to highlight the regulation of radiotherapy-induced ferroptosis in non-small cell lung cancer (NSCLC) via the NRF2/PHKG2 axis-mediated mechanism. To identify ferroptosis-associated genes associated with radioresistance in NSCLC, this study employed high-throughput transcriptome sequencing and Lasso risk regression analysis. Clinical samples were analyzed to confirm PHKG2 expression changes before and after radiotherapy. The study further examined ferritinophagy-related factors, intracellular iron levels, mitochondrial function, and ferroptosis in NSCLC cells undergoing radiation exposure to explore the effect of PHKG2 on radiosensitivity or radioresistance. The research also demonstrated the transcriptional inhibition of PHKG2 by NRF2 and created in situ transplantation tumor models of NSCLC to examine the role of NRF2/PHKG2 axis in NSCLC radiosensitivity and resistance in vivo. The Lasso risk regression model that incorporated ferroptosis-associated genes effectively predicted the prognosis of patients with NSCLC. Radiotherapy-sensitive tissues exhibited an increased expression of PHKG2. Overexpression of PHKG2 led to elevated intracellular iron levels by promoting ferritinophagy and increased mitochondrial stress-dependent ferroptosis induced by radiotherapy. PHKG2 transcription repression was achieved through NRF2. The FAGs-Lasso risk regression model can accurately predict the prognosis of NSCLC patients. Targeting Nrf2 upregulates the expression of PHKG2 and reverses radiotherapy resistance in NSCLC by promoting iron autophagy and inducing mitochondrial dysfunction, thereby increasing radiotherapy sensitivity.

TAOK3
Also flagged:breast cancercancerHER2breast cancerstumorCytokine
Journal Article 2024-08-21 ✓ 3 Snippets Ahuja S, Lazar IM.
In-Text Gene Mentions

…6 A), p38/MAPK (TAOK3), PI3K (PI3KR2), DNA…

…Ser/Thr protein kinaseTAOK3is a regulator…

…the previously discussedTAOK3are both included…

Show Full Abstract

The most devastating feature of cancer cells is their ability to metastasize to distant sites in the body. HER2 + and TN breast cancers frequently metastasize to the brain and stay potentially dormant for years until favorable conditions support their proliferation. The sheltered and delicate nature of the brain prevents, however, early disease detection and effective delivery of therapeutic drugs. Moreover, the challenges associated with the acquisition of brain biopsies add compounding difficulties to exploring the mechanistic aspects of tumor development. To provide insights into the determinants of cancer cell behavior at the brain metastatic site, this study was aimed at exploring the early response of HER2 + breast cancer cells (SKBR3) to factors present in the brain perivascular niche. The neural microenvironment was simulated by using the secretome of a set of brain cells that come first in contact with the cancer cells upon crossing the blood brain barrier, i.e., endothelial cells, astrocytes, and microglia. Cytokine microarrays were used to investigate the secretome mediators of intercellular communication, and proteomic technologies for assessing the changes in the behavior of cancer cells upon exposure to the brain cell-secreted factors. The cytokines detected in the brain secretomes were supportive of inflammatory conditions, while the SKBR3 cells secreted numerous cancer-promoting growth factors that were either absent or present in lower abundance in the brain cell cultures, indicating that upon exposure the SKBR3 cells may have been deprived of favorable conditions for optimal growth. Altogether, the results suggest that the exposure of SKBR3 cells to the brain cell-secreted factors altered their growth potential and drove them toward a state of quiescence, with broader overall outcomes that affected cellular metabolism, adhesion and immune response processes. The findings of this study underscore the key role played by the neural niche in shaping the behavior of metastasized cancer cells, provide insights into the cellular cross-talk that may lead cancer cells into dormancy, and highlight novel opportunities for the development of metastatic breast cancer therapeutic strategies.

SUDS3
Also flagged:TAF8transcription factorTFIIDRNA polymerase IIneurodevelopmental disorderbrain malformations
Journal Article 2024-08-21 ✓ 1 Snippet Nadav G, Odeh M, Mesika A, Abarbanel Har-Tal Y, Goldfeld M, Zalatkin T, Livoff A, Khoury RJ, Sgayer I, Ben-Sira L, Kalfon L, Falik-Zaccai TC.
In-Text Gene Mentions

…pre-natal diagnosis forTFIID complexcomplex-related disorders is…

Show Full Abstract

TAF8 is part of the transcription factor TFIID complex. TFIID is crucial for recruiting the transcription factor complex containing RNA polymerase II. TAF8 deficiency was recently reported as causing a severe neurodevelopmental disorder in eight patients. We have ascertained three Muslim Arab couples with fetal brain malformations. Clinical, imaging, pathological, biochemical, and molecular analyses were performed. Pre-natal ultrasound performed in four pregnancies revealed massive cerebellar atrophy, microcephaly, cerebral and corpus callosum (CC) anomalies. Pre-natal MRI studies of two of the affected fetuses confirmed microcephaly, small vermis, abnormal sulcation pattern with malformation, and shortening of CC. The fetuses were found to carry a novel likely pathogenic homozygous variant (c.45 + 5 G > A) of TAF8, predicted to affect splicing and presenting autosomal recessive inheritance. Post-mortem examinations confirmed the imaging studies in one fetus. Dysmorphic features including hypertelorism, wide nasal bridge, clinodactyly, and hirsutism were present. Western blotting analysis in fibroblasts of an affected fetus demonstrated a significant reduction of TAF8 protein. We determined high expression levels of TAF8 which progressively diminish in fetal brains of WT mice. We report for the first time the fetal presentation of TAF8 deficiency due to a novel genetic variant, and study TAF8 presence during fetal and neonatal periods in mouse brains. Our study may contribute to understanding the role of TAF8 in the developing human brain.

Also flagged:tumorsgene expressionsignal transductionmalignant tumorscancertumor
Journal Article 2024-08-21 No Snippets Zhang W, Xu C, Yang Z, Zhou J, Peng W, Zhang X, Li H, Qu S, Tao K.
Show Full Abstract

Circular RNAs (circRNAs) are unique noncoding RNAs that have a closed and stable loop structure generated through backsplicing. Due to their conservation, stability and tissue specificity, circRNAs can potentially be used as diagnostic indicators and therapeutic targets for certain tumors. Many studies have shown that circRNAs can act as microRNA (miRNA) sponges, and engage in interactions with proteins and translation templates to regulate gene expression and signal transduction, thereby participating in the occurrence and development of a variety of malignant tumors. Immunotherapy has revolutionized the treatment of cancer. Early researches have indicated that circRNAs are involved in regulating tumor immune microenvironment and antitumor immunity. CircRNAs may have the potential to be important targets for increasing sensitivity to immunotherapy and expanding the population of patients who benefit from cancer immunotherapy. However, few studies have investigated the correlation between circRNAs and tumor immunity. In this review, we summarize the current researches on circRNAs involved in antitumor immune regulation through different mechanisms and their potential value in increasing immunotherapy efficacy with the goal of providing new targets for cancer immunotherapy.

TNFSF4
Also flagged:Gliomasbrain tumorsglioblastomasGBMTumorglioblastoma
Journal Article 2024-08-21 ✓ 1 Snippet Song P, Deng H, Liu Y, Zhang M.
In-Text Gene Mentions

…PDCD1, HAVCR2, CD276,TNFSF4, CD80, ARHGEF5, and…

Show Full Abstract

<h4>Background</h4>Treatment of gliomas, the most prevalent primary malignant neoplasm of the central nervous system, is challenging. Arachidonate 5-lipoxygenase activating protein (ALOX5AP) is crucial for converting arachidonic acid into leukotrienes and is associated with poor prognosis in multiple cancers. Nevertheless, its relationship with the prognosis and the immune microenvironment of gliomas remains incompletely understood.<h4>Methods</h4>The differential expression of ALOX5AP was evaluated based on public Databases. Kaplan-Meier, multivariate Cox proportional hazards regression analysis, time-dependent receiver operating characteristic, and nomogram were used to estimate the prognostic value of ALOX5AP. The relationship between ALOX5AP and immune infiltration was calculated using ESTIMATE and CIBERSORT algorithms. Relationships between ALOX5AP and human leukocyte antigen molecules, immune checkpoints, tumor mutation burden, TIDE score, and immunophenoscore were calculated to evaluate glioma immunotherapy response. Single gene GSEA and co-expression network-based GO and KEGG enrichment analysis were performed to explore the potential function of ALOX5AP. ALOX5AP expression was verified using multiplex immunofluorescence staining and its prognostic effects were confirmed using a glioma tissue microarray.<h4>Result</h4>ALOX5AP was highly expressed in gliomas, and the expression level was related to World Health Organization (WHO) grade, age, sex, IDH mutation status, 1p19q co-deletion status, MGMTp methylation status, and poor prognosis. Single-cell RNA sequencing showed that ALOX5AP was expressed in macrophages, monocytes, and T cells but not in tumor cells. ALOX5AP expression positively correlated with M2 macrophage infiltration and poor immunotherapy response. Immunofluorescence staining demonstrated that ALOX5AP was upregulated in WHO higher-grade gliomas, localizing to M2 macrophages. Glioma tissue microarray confirmed the adverse effect of ALOX5AP in the prognosis of glioma.<h4>Conclusion</h4>ALOX5AP is highly expressed in M2 macrophages and may act as a potential biomarker for predicting prognosis and immunotherapy response in patients with glioma.

Also flagged:organizationBone defectsautoimmune diseasesgenetic disordersdegenerative diseasesbone cancer
Journal Article 2024-08-21 No Snippets Zhao X, Li N, Zhang Z, Hong J, Zhang X, Hao Y, Wang J, Xie Q, Zhang Y, Li H, Liu M, Zhang P, Ren X, Wang X.
Show Full Abstract

Bone defects pose significant challenges in healthcare, with over 2 million bone repair surgeries performed globally each year. As a burgeoning force in the field of bone tissue engineering, 3D printing offers novel solutions to traditional bone transplantation procedures. However, current 3D-printed bone scaffolds still face three critical challenges in material selection, printing methods, cellular self-organization and co-culture, significantly impeding their clinical application. In this comprehensive review, we delve into the performance criteria that ideal bone scaffolds should possess, with a particular focus on the three core challenges faced by 3D printing technology during clinical translation. We summarize the latest advancements in non-traditional materials and advanced printing techniques, emphasizing the importance of integrating organ-like technologies with bioprinting. This combined approach enables more precise simulation of natural tissue structure and function. Our aim in writing this review is to propose effective strategies to address these challenges and promote the clinical translation of 3D-printed scaffolds for bone defect treatment.

DDX27
Also flagged:Extracellularvesiclesdetoxificationageingamidelipid
Journal Article 2024-08-21 ✓ 1 Snippet Fernández-Rhodes M, Buchan E, Gagnon SD, Qian J, Gethings L, Lees R, Peacock B, Capel AJ, Martin NRW, Oppenheimer PG, Lewis MP, Davies OG.
In-Text Gene Mentions

…family such asDDX27, could indicate a…

Show Full Abstract

Skeletal muscle (SM) acts as a secretory organ, capable of releasing myokines and extracellular vesicles (SM-EVs) that impact myogenesis and homeostasis. While age-related changes have been previously reported in murine SM-EVs, no study has comprehensively profiled SM-EV in human models. To this end, we provide the first comprehensive comparison of SM-EVs from young and old human primary skeletal muscle cells (HPMCs) to map changes associated with SM ageing. HPMCs, isolated from young (24 ± 1.7 years old) and older (69 ± 2.6 years old) participants, were immunomagnetically sorted based on the presence of the myogenic marker CD56 (N-CAM) and cultured as pure (100% CD56<sup>+</sup>) or mixed populations (MP: 90% CD56<sup>+</sup>). SM-EVs were isolated using an optimised protocol combining ultrafiltration and size exclusion chromatography (UF + SEC) and their biological content was extensively characterised using Raman spectroscopy (RS) and liquid chromatography mass spectrometry (LC-MS). Minimal variations in basic EV parameters (particle number, size, protein markers) were observed between young and old populations. However, biochemical fingerprinting by RS highlighted increased protein (amide I), lipid (phospholipids and phosphatidylcholine) and hypoxanthine signatures for older SM-EVs. Through LC-MS, we identified 84 shared proteins with functions principally related to cell homeostasis, muscle maintenance and transcriptional regulation. Significantly, SM-EVs from older participants were comparatively enriched in proteins involved in oxidative stress and DNA/RNA mutagenesis, such as E3 ubiquitin-protein ligase TTC3 (TTC3), little elongation complex subunit 1 (ICE1) and Acetyl-CoA carboxylase 1 (ACACA). These data suggest SM-EVs could provide an alternative pathway for homeostasis and detoxification during SM ageing.

Also flagged:gene expressionchromatinmetabolismdetoxificationalanine transaminaseALT
Journal Article 2024-08-21 No Snippets Broadaway KA, Brotman SM, Rosen JD, Currin KW, Alkhawaja AA, Etheridge AS, Wright F, Gallins P, Jima D, Zhou YH, Love MI, Innocenti F, Mohlke KL.
Show Full Abstract

Understanding the molecular mechanisms of complex traits is essential for developing targeted interventions. We analyzed liver expression quantitative-trait locus (eQTL) meta-analysis data on 1,183 participants to identify conditionally distinct signals. We found 9,013 eQTL signals for 6,564 genes; 23% of eGenes had two signals, and 6% had three or more signals. We then integrated the eQTL results with data from 29 cardiometabolic genome-wide association study (GWAS) traits and identified 1,582 GWAS-eQTL colocalizations for 747 eGenes. Non-primary eQTL signals accounted for 17% of all colocalizations. Isolating signals by conditional analysis prior to coloc resulted in 37% more colocalizations than using marginal eQTL and GWAS data, highlighting the importance of signal isolation. Isolating signals also led to stronger evidence of colocalization: among 343 eQTL-GWAS signal pairs in multi-signal regions, analyses that isolated the signals of interest resulted in higher posterior probability of colocalization for 41% of tests. Leveraging allelic heterogeneity, we predicted causal effects of gene expression on liver traits for four genes. To predict functional variants and regulatory elements, we colocalized eQTL with liver chromatin accessibility QTL (caQTL) and found 391 colocalizations, including 73 with non-primary eQTL signals and 60 eQTL signals that colocalized with both a caQTL and a GWAS signal. Finally, we used publicly available massively parallel reporter assays in HepG2 to highlight 14 eQTL signals that include at least one expression-modulating variant. This multi-faceted approach to unraveling the genetic underpinnings of liver-related traits could lead to therapeutic development.

TRIM38
Also flagged:lipopolysaccharideIFNTinterferon-stimulated genesuterine infectionestrous cycleISG15
Journal Article 2024-08-21 ✓ 1 Snippet Talukder AK, McDonald M, Browne JA, Charpigny G, Rizos D, Lonergan P.
In-Text Gene Mentions

…ISGs (CMPK2, IFI35,TRIM38and TNFSF10) and…

Show Full Abstract

We recently demonstrated that conceptus-derived interferon tau (IFNT), responsible for maternal recognition in cattle, acts on the uterus in a dose- and time-dependent manner by upregulating key interferon-stimulated genes (ISGs) in the endometrium. In high producing dairy cows, postpartum uterine infection is a major factor influencing fertility and pregnancy outcome. Lipopolysaccharide (LPS), an endotoxin of Gram-negative bacteria such as Escherichia coli, generates an altered uterine environment by inducing excessive inflammation at the maternal-conceptus interface. Thus, we aimed to investigate whether the endometrial response to IFNT is altered in the presence of LPS. Endometrial explants were isolated from uteri collected at a local abattoir from Holstein Friesian cows (n = 8) during the mid-luteal stage of the estrous cycle, and cultured in RPMI medium for 24 h in 5 % CO<sub>2</sub> in humidified air without (control), or with IFNT (100 ng/mL), a single Day 15 conceptus, LPS (1 μg/mL), both IFNT and LPS, or both a Day 15 conceptus and LPS. Incubation with IFNT and a Day 15 conceptus up-regulated (P < 0.05) well-known classical ISGs (ISG15, OAS1, MX1 and MX2) as well as other candidate ISGs (CMPK2, IFI35, TRIM38 and TNFSF10) and down-regulated expression of IL1B in endometrial explants. Incubation with LPS increased (P < 0.05) abundance of NFKB1 (a key transcription factor involved in inflammatory and immune response), TNFA, IL1B and IL6 (pro-inflammatory cytokines), IL10 (anti-inflammatory cytokine), IL8, CXCL1, CXCL3 and CCL2 (chemokines), and, to a lesser extent, classical ISGs in endometrial explants. However, LPS did not alter endometrial response to IFNT, irrespective of IFNT concentration (1, 10 or 100 ng/mL). Results suggest that the expression of ISGs, up-regulated by conceptus-derived IFNT, is not altered in the endometrium in the presence of LPS; however, the increased expression of inflammation-related genes induced by LPS indicate an altered endometrial immune response that may be associated with compromised pregnancy establishment or pregnancy failure.

Also flagged:Extracellular Vesiclesimmune responsesTNF-αIL-1IL-6vasodilation
Journal Article 2024-08-21 No Snippets Zeng M, Liu M, Tao X, Yin X, Shen C, Wang X.
Show Full Abstract

Inflammation involves complex immune responses where cytokines such as TNF-α, IL-1, and IL-6 promote vasodilation and increased vascular permeability to facilitate immune cell migration to inflammation sites. Persistent inflammation is linked to diseases like cancer, arthritis, and neurodegenerative disorders. Although oral anti-inflammatory drugs are favored for their non-invasiveness and cost-effectiveness, their efficacy is often compromised due to gastrointestinal degradation and limited bioavailability. Recent advancements highlight the potential of extracellular vesicles (EVs) as nanocarriers that enhance drug delivery by encapsulating therapeutic agents, ensuring targeted release and reduced toxicity. These EVs, derived from dietary sources and cell cultures, exhibit excellent biocompatibility and stability, presenting a novel approach in anti-inflammatory therapies. This review discusses the classification and advantages of orally administered EVs (O-EVs), their mechanism of action, and their emerging role in treating inflammatory conditions, positioning them as promising vectors in the development of innovative anti-inflammatory drug delivery systems.

HTT
Also flagged:positronneurodegenerative diseaseproteinopathiesBACE1TDP-43OGA
Journal Article 2024-08-21 ✓ 1 Snippet Chassé M, Vasdev N.
In-Text Gene Mentions

…aggregates over normalHTT, monomeric soluble mHTT,…

Show Full Abstract

Positron emission tomography (PET) imaging of neurodegenerative disease has historically focused on a small number of established targets. The development of selective PET radiotracers for novel biological targets enables new ways to interrogate the neuropathology of proteinopathies and will advance our understanding of neurodegeneration. This perspective aims to highlight recent PET radiotracers developed for five emerging targets in proteinopathies (i.e., mHTT, BACE1, TDP-43, OGA, and CH24H).

Also flagged:Nrf2CarotenoidPolyphenolEstradiolRotenoneaging
Journal Article 2024-08-21 No Snippets Darawsha A, Trachtenberg A, Sharoni Y.
Show Full Abstract

Skin aging is associated with the increased production of mitochondrial reactive oxygen species (mtROS) due to mitochondrial dysfunction, and various phytonutrients and estrogens have been shown to improve skin health. Thus, the aim of the current study was to examine damage to dermal fibroblasts by chemically induced mitochondrial dysfunction and to study the mechanism of the protective effects of carotenoids, polyphenols, and estradiol. Rotenone, a Complex I inhibitor, caused mitochondrial dysfunction in human dermal fibroblasts, substantially reducing respiration and ATP levels, followed by increased mitochondrial and cytosolic ROS, which resulted in apoptotic cell death, an increased number of senescent cells, increased matrix metalloproteinase-1 (MMP1) secretion, and decreased collagen secretion. Pre-treatment with carotenoid-rich tomato extracts, rosemary extract, and estradiol reversed these effects. These protective effects can be partially explained by a cooperative activation of antioxidant response element (ARE/Nrf2) transcriptional activity by the protective compounds and rotenone, which led to the upregulation of antioxidant proteins such as NQO1. To determine if ARE/Nrf2 activity is crucial for cell protection, we inhibited it using the Nrf2 inhibitors ML385 and ochratoxin A. This inhibition markedly reduced the protective effects of the test compounds by diminishing their effect to reduce cytosolic ROS. Our study results indicate that phytonutrients and estradiol protect skin cells from damage caused by mtROS, and thus may delay skin cell senescence and improve skin health.

TRIM38
Also flagged:Chronic Liver Diseasesliver diseasesclotting factorshepatic cholestasischronic viral hepatitisalcoholic liver disease
Journal Article 2024-08-21 ✓ 2 Snippets Cao X, Chen Y, Chen Y, Jiang M.
In-Text Gene Mentions

TRIM38plays an antiviral…

…as TRIM28 andTRIM38in the progression…

Show Full Abstract

The worldwide impact of liver diseases is increasing steadily, with a consistent upswing evidenced in incidence and mortality rates. Chronic liver diseases (CLDs) refer to the liver function's progressive deterioration exceeding six months, which includes abnormal clotting factors, detoxification failure, and hepatic cholestasis. The most common etiologies of CLDs are mainly composed of chronic viral hepatitis, MAFLD/MASH, alcoholic liver disease, and genetic factors, which induce inflammation and harm to the liver, ultimately resulting in cirrhosis, the irreversible final stage of CLDs. The latest research has shown that tripartite motif family proteins (TRIMs) function as E3 ligases, which participate in the progression of CLDs by regulating gene and protein expression levels through post-translational modification. In this review, our objective is to clarify the molecular mechanisms and potential therapeutic targets of TRIMs in CLDs and provide insights for therapy guidelines and future research.

MLLT10
Also flagged:Transcription FactorsEMT-TFsAcute myeloid leukemiaAMLFLT3NPM1
Journal Article 2024-08-21 ✓ 1 Snippet Cuevas D, Amigo R, Agurto A, Heredia AA, Guzmán C, Recabal-Beyer A, González-Pecchi V, Caprile T, Haigh JJ, Farkas C.
In-Text Gene Mentions

…), AF10 (MLLT10), and the…

Show Full Abstract

Acute myeloid leukemia (AML) is a diverse malignancy originating from myeloid progenitor cells, with significant genetic and clinical variability. Modern classification systems like those from the World Health Organization (WHO) and European LeukemiaNet use immunophenotyping, molecular genetics, and clinical features to categorize AML subtypes. This classification highlights crucial genetic markers such as FLT3, NPM1 mutations, and MLL-AF9 fusion, which are essential for prognosis and directing targeted therapies. The MLL-AF9 fusion protein is often linked with therapy-resistant AML, highlighting the risk of relapse due to standard chemotherapeutic regimes. In this sense, factors like the ZEB, SNAI, and TWIST gene families, known for their roles in epithelial-mesenchymal transition (EMT) and cancer metastasis, also regulate hematopoiesis and may serve as effective therapeutic targets in AML. These genes contribute to cell proliferation, differentiation, and extramedullary hematopoiesis, suggesting new possibilities for treatment. Advancing our understanding of the molecular mechanisms that promote AML, especially how the bone marrow microenvironment affects invasion and drug resistance, is crucial. This comprehensive insight into the molecular and environmental interactions in AML emphasizes the need for ongoing research and more effective treatments.

Also flagged:Musculoskeletal sarcomastumorcancermembranetranslationalSarcomas
Journal Article 2024-08-21 No Snippets Giusti V, Miserocchi G, Sbanchi G, Pannella M, Hattinger CM, Cesari M, Fantoni L, Guerrieri AN, Bellotti C, De Vita A, Spadazzi C, Donati DM, Torsello M, Lucarelli E, Ibrahim T, Mercatali L.
Show Full Abstract

Musculoskeletal sarcomas pose major challenges to researchers and clinicians due to their rarity and heterogeneity. Xenografting human cells or tumor fragments in rodents is a mainstay for the generation of cancer models and for the preclinical trial of novel drugs. Lately, though, technical, intrinsic and ethical concerns together with stricter regulations have significantly curbed the employment of murine patient-derived xenografts (mPDX). In alternatives to murine PDXs, researchers have focused on embryonal systems such as chorioallantoic membrane (CAM) and zebrafish embryos. These systems are time- and cost-effective hosts for tumor fragments and near-patient cells. The CAM of the chick embryo represents a unique vascularized environment to host xenografts with high engraftment rates, allowing for ease of visualization and molecular detection of metastatic cells. Thanks to the transparency of the larvae, zebrafish allow for the tracking of tumor development and metastatization, enabling high-throughput drug screening. This review will focus on xenograft models of musculoskeletal sarcomas to highlight the intrinsic and technically distinctive features of the different hosts, and how they can be exploited to elucidate biological mechanisms beneath the different phases of the tumor's natural history and in drug development. Ultimately, the review suggests the combination of different models as an advantageous approach to boost basic and translational research.

Also flagged:disordered polyglutamine-binding protein 1PQBP1innate immunityRenpenning syndromeimmune responsetype 1 interferon
Journal Article 2024-08-21 No Snippets Wiench L, Rizzo D, Sinay Z, Nacsa Z, Fuchs NV, König R.
Show Full Abstract

The intrinsically disordered polyglutamine-binding protein 1 (PQBP1) has been linked to various cellular processes including transcription, alternative splicing, translation and innate immunity. Mutations in PQBP1 are causative for neurodevelopmental conditions collectively termed as the Renpenning syndrome spectrum. Intriguingly, cells of Renpenning syndrome patients exhibit a reduced innate immune response against human immunodeficiency virus 1 (HIV-1). PQBP1 is responsible for the initiation of a two-step recognition process of HIV-1 reverse-transcribed DNA products, ensuring a type 1 interferon response. Recent investigations revealed that PQBP1 also binds to the p17 protein of avian reovirus (ARV) and is affected by the ORF52 of Kaposi's sarcoma-associated herpesvirus (KSHV), possibly also playing a role in the innate immune response towards these RNA- and DNA-viruses. Moreover, PQBP1-mediated microglia activation in the context of tauopathies has been reported, highlighting the role of PQBP1 in sensing exogenous pathogenic species and innate immune response in the central nervous system. Its unstructured nature, the promiscuous binding of various proteins and its presence in various tissues indicate the versatile roles of PQBP1 in cellular regulation. Here, we systematically review the available data on the structure of PQBP1 and its cellular functions and interactome, as well as possible implications for innate immune responses and neurodegenerative disorders.

PRDX6
Also flagged:demyelinating disease of the central nervous systemimmune responsesmitochondrialironaxonalMS
Journal Article 2024-08-21 ✓ 3 Snippets Wilkins JM, Mangalaparthi KK, Netzel BC, Sherman WA, Guo Y, Kalinowska-Lyszczarz A, Pandey A, Lucchinetti CF.
In-Text Gene Mentions

…BCAN, ENO1, andPRDX6.…

…MAG, BCAN, andPRDX6had significant alterations…

…(HAPLN2, MAG, andPRDX6) were also found…

Show Full Abstract

<h4>Background</h4>Multiple sclerosis (MS) is a demyelinating disease of the central nervous system characterized by increased inflammation and immune responses, oxidative injury, mitochondrial dysfunction, and iron dyshomeostasis leading to demyelination and axonal damage. In MS, incomplete remyelination results in chronically demyelinated axons and degeneration coinciding with disability. This suggests a failure in the ability to remyelinate in MS, however, the precise underlying mechanisms remain unclear. We aimed to identify proteins whose expression was altered in chronic inactive white matter lesions and periplaque white matter in MS tissue to reveal potential pathophysiological mechanisms.<h4>Methods</h4>Laser capture microdissection coupled to proteomics was used to interrogate spatially altered changes in formalin-fixed paraffin-embedded brain tissue from three chronic MS individuals and three controls with no apparent neurological complications. Histopathological maps guided the capture of inactive lesions, periplaque white matter, and cortex from chronic MS individuals along with corresponding white matter and cortex from control tissue. Label free quantitation by liquid chromatography tandem mass spectrometry was used to discover differentially expressed proteins between the various brain regions.<h4>Results</h4>In addition to confirming loss of several myelin-associated proteins known to be affected in MS, proteomics analysis of chronic inactive MS lesions revealed alterations in myelin assembly, metabolism, and cytoskeletal organization. The top altered proteins in MS inactive lesions compared to control white matter consisted of PPP1R14A, ERMN, SIRT2, CARNS1, and MBLAC2.<h4>Conclusion</h4>Our findings highlight proteome changes in chronic inactive MS white matter lesions and periplaque white matter, which may be crucial for proper myelinogenesis, bioenergetics, focal adhesions, and cellular function. This study highlights the importance and feasibility of spatial approaches such as laser capture microdissection-based proteomics analysis of pathologically distinct regions of MS brain tissue. Identification of spatially resolved changes in the proteome of MS brain tissue should aid in the understanding of pathophysiological mechanisms and the development of novel therapies.

Also flagged:localizationdegradationprotein homeostasischaperonesmembrane-lesscytoplasm
Journal Article 2024-08-21 No Snippets Rolli S, Langridge CA, Sontag EM.
Show Full Abstract

Cellular protein homeostasis (proteostasis) plays an essential role in regulating the folding, sequestration, and turnover of misfolded proteins via a network of chaperones and clearance factors. Previous work has shown that misfolded proteins are spatially sequestered into membrane-less compartments in the cell as part of the proteostasis process. Soluble misfolded proteins in the cytoplasm are trafficked into the juxtanuclear quality control compartment (JUNQ), and nuclear proteins are sequestered into the intranuclear quality control compartment (INQ). However, the mechanisms that control the formation, localization, and degradation of these compartments are unknown. Previously, we showed that the JUNQ migrates to the nuclear membrane adjacent to the INQ at nucleus-vacuole junctions (NVJ), and the INQ moves through the NVJ into the vacuole for clearance in an ESCRT-mediated process. Here we have investigated what mechanisms are involved in the formation, migration, and clearance of the JUNQ. We find Hsp70s Ssa1 and Ssa2 are required for JUNQ localization to the NVJ and degradation of cytoplasmic misfolded proteins. We also confirm that sequestrases Btn2 and Hsp42 sort misfolded proteins to the JUNQ or IPOD, respectively. Interestingly, proteins required for piecemeal microautophagy of the nucleus (PMN) (i.e., Nvj1, Vac8, Atg1, and Atg8) drive the formation and clearance of the JUNQ. This suggests that the JUNQ migrates to the NVJ to be cleared via microautophagy.

HTT
Also flagged:protein degradationbindingubiquitinproteasomeproteolysislysosome
Journal Article 2024-08-21 ✓ 1 Snippet Tan X, Huang Z, Pei H, Jia Z, Zheng J.
In-Text Gene Mentions

…normal huntingtin protein (HTT), could serve as…

Show Full Abstract

Small-molecule drugs are effective and thus most widely used. However, their applications are limited by their reliance on active high-affinity binding sites, restricting their target options. A breakthrough approach involves molecular glues, a novel class of small-molecule compounds capable of inducing protein-protein interactions (PPIs). This opens avenues to target conventionally undruggable proteins, overcoming limitations seen in conventional small-molecule drugs. Molecular glues play a key role in targeted protein degradation (TPD) techniques, including ubiquitin-proteasome system-based approaches such as proteolysis targeting chimeras (PROTACs) and molecular glue degraders and recently emergent lysosome system-based techniques like molecular degraders of extracellular proteins through the asialoglycoprotein receptors (MoDE-As) and macroautophagy degradation targeting chimeras (MADTACs). These techniques enable an innovative targeted degradation strategy for prolonged inhibition of pathology-associated proteins. This review provides an overview of them, emphasizing the clinical potential of molecular glues and guiding the development of molecular-glue-mediated TPD techniques.

HTT
Also flagged:neurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseHuntington's diseaseamyotrophic lateral sclerosisALS
Journal Article 2024-08-21 ✓ 1 Snippet Albadawi EA.
In-Text Gene Mentions

…expansions in theHTTgene at the…

Show Full Abstract

The corpus callosum, the largest white matter structure in the brain, plays a crucial role in interhemispheric communication and cognitive function. This review examines the microstructural changes observed in the corpus callosum across various neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS). New neuroimaging studies, mainly those that use diffusion tensor imaging (DTI) and advanced tractography methods, were put together to show how changes have happened in the organization of white matter and the connections between them. Some of the most common ways the corpus callosum breaks down are discussed, including less fractional anisotropy, higher mean diffusivity, and atrophy in certain regions. The relationship between these microstructural changes and cognitive decline, motor dysfunction, and disease progression is explored. Additionally, we consider the potential of corpus callosum imaging as a biomarker for early disease detection and monitoring. Studies show that people with these disorders have lower fractional anisotropy and higher mean diffusivity in the corpus callosum, often in ways that are specific to the disease. These changes often happen before gray matter atrophy and are linked to symptoms, which suggests that the corpus callosum could be used as an early sign of neurodegeneration. The review also highlights the implications of these findings for understanding disease mechanisms and developing therapeutic strategies. Future directions, including the application of advanced imaging techniques and longitudinal studies, are discussed to elucidate the role of corpus callosum degeneration in neurodegenerative processes. This review underscores the importance of the corpus callosum in understanding the pathophysiology of neurodegenerative diseases and its potential as a target for therapeutic interventions.

Also flagged:LeukemiaCancerALLAMLCMLblood cancer
Journal Article 2024-08-21 No Snippets Algarni A.
Show Full Abstract

As per the Global Cancer Observatory, the WHO Eastern Mediterranean region (which includes the Arabic countries) ranks highest for age-standardized mortality rate at 4 per 100,000, thus indicating a probable role of genetic associations. Identifying the genes associated with leukemia in the Arab population is crucial for effective preventive and treatment strategies. This scoping review aimed to determine the nature and extent of research available on the genes associated with the major types of leukemia among the Arab population. As per the scoping review guidelines, a comprehensive search was conducted in PUBMED and Google Scholar for articles published before 01/10/2023 and focused on leukemia-related genes among the Arab population. In total 119 studies, focusing on genes associated with leukemia met the inclusion criteria. On reviewing these studies, 27 genes were found to be associated with ALL, 33 genes with AML, seven genes with CLL, and 14 genes with CML. The majority of these genes were associated with an increased risk for the disease. Notably, the 119 studies covered only nine out of the 22 Arab countries, with 56 studies carried out in Egypt, exhibiting an imbalance in the regional distribution of the research landscape. Thus, indicating the inadequacy of research on leukemia genetics in the Arab region in comparison to the Western studies. This finding highlights the need for extensive research in the Middle Eastern region to gain geographically heterogeneous genetic information about the Arab population. In conclusion, this scoping study highlights the genes associated with the major types of leukemia among the Arab population and also indicates the need for comprehensive and regionally balanced research on leukemia genetics in Middle Eastern countries. Addressing this gap is essential to provide robust genetic data that can be used for targeted interventions to improve leukemia outcomes in the Middle East. Increased research efforts in all Middle Eastern countries will contribute to a greater understanding of genetic predisposition and help develop effective prevention strategies and treatments tailored to this population.

NEGR1
Also flagged:cartilage intermediate layer protein-2high-temperature requirement A serine peptidase-1neuronal growth factor-1CVDCFcardiovascular disease
Journal Article 2024-08-21 ✓ 3 Snippets Dib MJ, Azzo JD, Zhao L, Salman O, Gan S, De Buyzere ML, De Meyer T, Ebert C, Gunawardhana K, Liu L, Gordon D, Seiffert D, Ching-Pin C, Zamani P, Cohen JB, Pourmussa B, Kun S, Gill D, Burgess S, van Empel V, Richards AM, Dennis J, Javaheri A, Mann DL, Cappola TP, Rietzschel E, Chirinos JA.
In-Text Gene Mentions

…neuronal growth regulator-1 (NEGR1); potassium voltage-gated cha…

…95% CI: 0.09-0.39),NEGR1(β = 0.14;…

…CGA, GHR, andNEGR1) without known roles…

Show Full Abstract

The molecular mechanisms contributing to large artery stiffness (LAS) are not fully understood. The aim of this study was to investigate the association between circulating plasma proteins and LAS using complementary proteomic and genomic analyses. A total of 106 proteins associated with carotid-femoral pulse-wave velocity, a noninvasive measure of LAS, were identified in 1,178 individuals from the Asklepios study cohort. Mendelian randomization analyses revealed causal effects of 13 genetically predicted plasma proteins on pulse pressure, including cartilage intermediate layer protein-2, high-temperature requirement A serine peptidase-1, and neuronal growth factor-1. These findings suggest potential novel therapeutic targets to reduce LAS and its related diseases.

Also flagged:Microcystin-LRserine/threonine kinaseshepatocellular carcinomaphosphorylationprotein phosphatases 1PP1
Journal Article 2024-08-20 No Snippets Ikumawoyi VO, Lynch KD, Iverson DT, Call MR, Yue GE, Prasad B, Clarke JD.
Show Full Abstract

Microcystin-LR (MCLR) exposure has been associated with development of hepatocellular carcinoma (HCC). Many of the carcinogenic mechanisms for MCLR have been attributed to the induction of cell survival and proliferation through altered protein phosphorylation pathways by inhibition of protein phosphatases 1 (PP1) and PP2A. The current study determined MCLR effects on the phosphoproteome in human HepaRG cells. Differentiated HepaRG cells were treated with either vehicle or MCLR followed by phosphoproteomic analysis and Western blotting of MAPK-activated proteins. MCLR decreased cell viability at 24 h at doses as low as 0.03 μM. MCLR also caused a dose-dependent increase in phosphorylation of signaling and stress kinases. The number of decreased phosphosites by 0.1 μM MCLR was similar between the 2 h (212) and 24 h (154) timepoints. In contrast, a greater number of phosphosites were increased at 24 h (567) versus the 2 h timepoint (136), indicating the hyperphosphorylation state caused by MCLR-mediated inhibition of PPs is time-dependent. A kinase perturbation analysis predicted that MCLR exposure at both 2 h and 24 h increased the function of aurora kinase B (AURKB), checkpoint kinase 1 (CHEK1), and serum and glucocorticoid-regulated kinase 1 (SGK1). STRING database analysis of the phosphosites altered by MCLR exposure revealed pathways associated with cell proliferation and survival, including ribosomal protein S6 kinase (RSK), and vascular endothelial growth factor receptor (VEGFR2)-mediated vascular permeability. In addition, several cancer-related KEGG pathways were enriched at both 2 h and 24 h timepoints, and multiple cancer-related disease-gene associations were identified at the 24 h timepoint. Many of the kinases and pathways described above play crucial roles in the development of HCC by affecting processes such as invasion and metastasis. Overall, our data indicate that MCLR-mediated changes in protein phosphorylation involve biological pathways related to carcinogenesis that may contribute to the development of HCC.

Also flagged:calciumphospholipidmitochondriamitochondrialorganelleGFP
Journal Article 2024-08-20 No Snippets Yang Z, Chan DC.
Show Full Abstract

Mitochondria-endoplasmic reticulum contact sites (MERCS) serve as hotspots for important cellular processes, including calcium homeostasis, phospholipid homeostasis, mitochondria dynamics, and mitochondrial quality control. MERCS reporters based on complementation of green fluorescent proteins (GFP) fragments have been designed to visualize MERCS in real-time, but we find that they do not accurately respond to changes in MERCS content. Here, we utilize split LacZ complementing fragments to develop the first MERCS reporter system (termed SpLacZ-MERCS) that continuously integrates the MERCS information within a cell and generates a fluorescent output. Our system exhibits good organelle targeting, no artifactual tethering, and effective, dynamic tracking of the MERCS level in single cells. The SpLacZ-MERCS reporter was validated by drug treatments and genetic perturbations known to affect mitochondria-ER contacts. The signal-integrating nature of SpLacZ-MERCS may enable systematic identification of genes and drugs that regulate mitochondria-ER interactions. Our successful application of the split LacZ complementation strategy to study MERCS may be extended to study other forms of interorganellar crosstalk.

PRDX6
Also flagged:extracellularvesicleslocally advanced rectal cancerS100A6ENO1MIF
Journal Article 2024-08-20 ✓ 2 Snippets Chen H, Fang Y, Dai S, Jiang K, Shen L, Zhao J, Huang K, Zhou X, Ding K.
In-Text Gene Mentions

…(S100A6, ENO1, MIF,PRDX6and MYL6) was…

PRDX6

Show Full Abstract

<h4>Background</h4>Neoadjuvant chemoradiotherapy (nCRT) stands as a pivotal therapeutic approach for locally advanced rectal cancer (LARC), yet the absence of a reliable biomarker to forecast its efficacy remains a challenge. Thus, this study aimed to assess whether the proteomic compositions of small extracellular vesicles (sEVs) might offer predictive insights into nCRT response among patients with LARC, while also delving into the proteomic alterations within sEVs post nCRT.<h4>Methods</h4>Plasma samples were obtained from LARC patients both pre- and post-nCRT. Plasma-derived sEVs were isolated utilizing the TIO<sub>2</sub>-based method, followed by LC-MS/MS-based proteomic analysis. Subsequently, pathway enrichment analysis was performed to the Differentially Expressed Proteins (DEPs). Additionally, ROC curves were generated to evaluate the predictive potential of sEV proteins in determining nCRT response. Public databases were interrogated to identify sEV protein-associated genes that are correlated with the response to nCRT in LARC.<h4>Results</h4>A total of 16 patients were enrolled. Among them, 8 patients achieved a pathological complete response (good responders, GR), while the remaining 8 did not achieve a complete response (poor responders, PR). Our analysis of pretreatment plasma-derived sEVs revealed 67 significantly up-regulated DEPs and 9 significantly down-regulated DEPs. Notably, PROC (AUC: 0.922), F7 (AUC: 0.953) and AZU1 (AUC: 0.906) demonstrated high AUC values and significant differences (P value < 0.05) in discriminating between GR and PR patients. Furthermore, a signature consisting of 5 sEV protein-associated genes (S100A6, ENO1, MIF, PRDX6 and MYL6) was capable of predicting the response to nCRT, yielding an AUC of 0.621(95% CI: 0.454-0.788). Besides, this 5-sEV protein-associated gene signature enabled stratification of patients into low- and high-risk group, with the low-risk group demonstrating a longer overall survival in the testing set (P = 0.048). Moreover, our investigation identified 11 significantly up-regulated DEPs and 31 significantly down-regulated DEPs when comparing pre- and post-nCRT proteomic profiles. GO analysis unveiled enrichment in the regulation of phospholipase A2 activity.<h4>Conclusions</h4>Differential expression of sEV proteins distinguishes between GR and PR patients and holds promise as predictive markers for nCRT response and prognosis in patients with LARC. Furthermore, our findings highlight substantial alterations in sEV protein composition following nCRT.

Also flagged:Collagenhydroxyapatitecell adhesioncollagen type Ifibrilshydroxyl
Journal Article 2024-08-20 No Snippets Han D, Wang W, Gong J, Ma Y, Li Y.
Show Full Abstract

Regenerative therapy, a key area of tissue engineering, holds promise for restoring damaged organs, especially in bone regeneration. Bone healing is natural to the body but becomes complex under stress and disease. Large bone deformities pose significant challenges in tissue engineering. Among various methods, scaffolds are attractive as they provide structural support and essential nutrients for cell adhesion and growth. Collagen and hydroxyapatite (HA) are widely used due to their biocompatibility and biodegradability. Collagen and nano-scale HA enhance cell adhesion and development. Thus, nano HA/collagen scaffolds offer potential solutions for bone regeneration. This review focuses on the use and production of nano-sized HA/collagen composites in bone regeneration.

Also flagged:photonepilepsysleepaction potentialsynapsesmembrane
Journal Article 2024-08-20 No Snippets Srinivasan K, Ribeiro TL, Kells P, Plenz D.
Show Full Abstract

Scaling relationships are key in characterizing complex systems at criticality. In the brain, they are evident in neuronal avalanches-scale-invariant cascades of neuronal activity quantified by power laws. Avalanches manifest at the cellular level as cascades of neuronal groups that fire action potentials simultaneously. Such spatiotemporal synchronization is vital to theories on brain function yet avalanche synchronization is often underestimated when only a fraction of neurons is observed. Here, we investigate biases from fractional sampling within a balanced network of excitatory and inhibitory neurons with all-to-all connectivity and critical branching process dynamics. We focus on how mean avalanche size scales with avalanche duration. For parabolic avalanches, this scaling is quadratic, quantified by the scaling exponent, χ = 2, reflecting rapid spatial expansion of simultaneous neuronal firing over short durations. However, in networks sampled fractionally, χ is significantly lower. We demonstrate that applying temporal coarse-graining and increasing a minimum threshold for coincident firing restores χ = 2, even when as few as 0.1% of neurons are sampled. This correction crucially depends on the network being critical and fails for near sub- and supercritical branching dynamics. Using cellular 2-photon imaging, our approach robustly identifies χ = 2 over a wide parameter regime in ongoing neuronal activity from frontal cortex of awake mice. In contrast, the common 'crackling noise' approach fails to determine χ under similar sampling conditions at criticality. Our findings overcome scaling bias from fractional sampling and demonstrate rapid, spatiotemporal synchronization of neuronal assemblies consistent with scale-invariant, parabolic avalanches at criticality.

OLFM4
Also flagged:CCKBRcancergastric cancerFOXOgastric adenocarcinomaGA
Journal Article 2024-08-20 ✓ 1 Snippet Tan Z, Pan K, Sun M, Pan X, Yang Z, Chang Z, Yang X, Zhu J, Zhan L, Liu Y, Li X, Lin K, Chen L, Mo H, Luo W, Kan C, Duan L, Zheng H.
In-Text Gene Mentions

OLFM4

Show Full Abstract

The existence of heterogeneity has plunged cancer treatment into a challenging dilemma. We profiled malignant epithelial cells from 5 gastric adenocarcinoma patients through single-cell sequencing (scRNA-seq) analysis, demonstrating the heterogeneity of gastric adenocarcinoma (GA), and identified the CCKBR+ stem cell-like cancer cells associated poorly differentiated and worse prognosis. We further conducted targeted analysis using single-cell transcriptome libraries, including 40 samples, to confirm these screening results. In addition, we revealed that FOXOs are involved in the progression and development of CCKBR+ gastric adenocarcinoma. Inhibited the expression of FOXOs and disrupting cancer cell stemness reduce the CCKBR+ GA organoid formation and impede tumor progression. Mechanically, CUT&Tag sequencing and Lectin pulldown revealed that FOXOs can activate ST3GAL3/4/5 as well as ST6GALNAC6, promoting elevated sialyation levels in CCKBR+ tumor cells. This FOXO-sialyltransferase axis contributes to the maintenance of homeostasis and the growth of CCKBR+ tumor cells. This insight provides novel perspectives for developing targeted therapeutic strategies aimed at the treating CCKBR associated gastric cancer.

Also flagged:Spinal scoliosisscoliosisneurological disordersprimary ciliary dyskinesiahydrocephalusantibodies
Journal Article 2024-08-20 No Snippets Yan C, Jin G, Li L.
Show Full Abstract

Spinal scoliosis, a prevalent spinal deformity impacting both physical and mental well-being, has a significant genetic component, though the exact pathogenic mechanisms remain elusive. This review offers a comprehensive exploration of current research on embryonic spinal development, focusing on the genetic and biological intricacies governing axial elongation and straightening. Zebrafish, a vital model in developmental biology, takes a prominent role in understanding spinal scoliosis. Insights from zebrafish studies illustrate genetic and physiological aspects, including notochord development and cerebrospinal fluid dynamics, revealing the anomalies contributing to scoliosis. In this review, we acknowledge existing challenges, such as deciphering the unique dynamics of human spinal development, variations in physiological curvature, and disparities in cerebrospinal fluid circulation. Further, we emphasize the need for caution when extrapolating findings to humans and for future research to bridge current knowledge gaps. We hope that this review will be a beneficial frame of reference for the guidance of future studies on animal models and genetic research for spinal scoliosis.

HFE
Also flagged:IronAceruloplasminemiagenetic disorderCPmicrocytic anemiadiabetes mellitus
Journal Article 2024-08-20 ✓ 2 Snippets Maarad N, Rahmani M, Taho A, Bnouhanna W, Benabdeljlil M, Aïdi S.
In-Text Gene Mentions

…microcytic anemias, and non-HFE(hereditary hemochromatosis pr…

…and non-HFE (hereditaryhemochromatosisprotein) iron overload…

Show Full Abstract

Aceruloplasminemia (ACP) is a rare genetic disorder that manifests in adulthood due to mutations in the CP (ceruloplasmin) gene, causing iron accumulation and neurodegeneration. Clinically, ACP presents with a range of symptoms, including mild microcytic anemia, diabetes mellitus, liver disease, retinopathy, progressive neurological symptoms such as cerebellar ataxia, involuntary movements, parkinsonism, mood and behavior disorders, and cognitive impairment. We present the case of a 53-year-old female with a history of first-degree consanguinity and a sister with anemia. At six years old, she developed asthenia, leading to multiple hospitalizations for acute hemolytic anemia requiring transfusions and iron therapy. She exhibited later memory disturbances, slowed comprehension, social withdrawal, and school discontinuation. At the age of 51, she developed gait disturbances, unexplained falls, and cognitive decline. One year later, cranial CT revealed a chronic bilateral subdural hematoma. On admission at 53, she had anarthria, right hemiparesis, diffuse rigidity, mouth dystonia, oculomotor paralysis, and intellectual deterioration. MRI showed superficial cortical and leptomeningeal hemosiderin deposits and bilateral signal anomalies in various deep brain regions. EEG revealed paroxysmal anomalies and abdominal MRI indicated hepatic iron overload. Laboratory tests confirmed ACP. This case highlights the rare and severe neurological and systemic manifestations of ACP, emphasizing the importance of early diagnosis and intervention in such degenerative diseases to prevent irreversible neurological complications.

POU3F2
Also flagged:schizophreniabrain developmentneurogenesisneuropsychiatric disordersgene expressionmodifications
Journal Article 2024-08-20 ✓ 1 Snippet Aygün N, Vuong C, Krupa O, Mory J, Le BD, Valone JM, Liang D, Shafie B, Zhang P, Salinda A, Wen C, Gandal MJ, Love MI, de la Torre-Ubieta L, Stein JL.
In-Text Gene Mentions

POU3F2

Show Full Abstract

The function of some genetic variants associated with brain-relevant traits has been explained through colocalization with expression quantitative trait loci (eQTL) conducted in bulk postmortem adult brain tissue. However, many brain-trait associated loci have unknown cellular or molecular function. These genetic variants may exert context-specific function on different molecular phenotypes including post-transcriptional changes. Here, we identified genetic regulation of RNA editing and alternative polyadenylation (APA) within a cell-type-specific population of human neural progenitors and neurons. More RNA editing and isoforms utilizing longer polyadenylation sequences were observed in neurons, likely due to higher expression of genes encoding the proteins mediating these post-transcriptional events. We also detected hundreds of cell-type-specific editing quantitative trait loci (edQTLs) and alternative polyadenylation QTLs (apaQTLs). We found colocalizations of a neuron edQTL in CCDC88A with educational attainment and a progenitor apaQTL in EP300 with schizophrenia, suggesting that genetically mediated post-transcriptional regulation during brain development leads to differences in brain function.

HFE
Also flagged:zincpotassiumammonianitrogen fixationhydrogen cyanidephytohormones
Journal Article 2024-08-20 ✓ 1 Snippet Fanai A, Bohia B, Lalremruati F, Lalhriatpuii N, Lalrokimi, Lalmuanpuii R, Singh PK, Zothanpuia.
In-Text Gene Mentions

…overload diseases likehemochromatosisand hemosiderosis, iron…

Show Full Abstract

Plants and bacteria are co-evolving and interact with one another in a continuous process. This interaction enables the plant to assimilate the nutrients and acquire protection with the help of beneficial bacteria known as plant growth-promoting bacteria (PGPB). These beneficial bacteria naturally produce bioactive compounds that can assist plants' stress tolerance. Moreover, they employ various direct and indirect processes to induce plant growth and protect plants against pathogens. The direct mechanisms involve phytohormone production, phosphate solubilization, zinc solubilization, potassium solubilization, ammonia production, and nitrogen fixation while, the production of siderophores, lytic enzymes, hydrogen cyanide, and antibiotics are included under indirect mechanisms. This property can be exploited to prepare bioformulants for biofertilizers, biopesticides, and biofungicides, which are convenient alternatives for chemical-based products to achieve sustainable agricultural practices. However, the application and importance of PGPB in sustainable agriculture are still debatable despite its immense diversity and plant growth-supporting activities. Moreover, the performance of PGPB varies greatly and is dictated by the environmental factors affecting plant growth and development. This review emphasizes the role of PGPB in plant growth-promoting activities (stress tolerance, production of bioactive compounds and phytohormones) and summarises new formulations and opportunities.

Also flagged:saltscalcium ionsphosphate estersapatitealkaline phosphataseALP
Journal Article 2024-08-20 No Snippets Yokoi T, Tomita S, Nakamura J, Sugawara-Narutaki A, Matsukawa Y, Kawashita M, Ohtsuki C.
Show Full Abstract

Bioresponsive ceramics, a new concept in ceramic biomaterials, respond to biological molecules or environments, as exemplified by salts composed of calcium ions and phosphate esters (SCPEs). SCPEs have been shown to form apatite in simulated body fluid (SBF) containing alkaline phosphatase (ALP). Thus, surface modification with SCPEs is expected to improve the apatite-forming ability of a material. In this study, we modified the surface of α-tricalcium phosphate (α-TCP) using methyl, butyl, or dodecyl phosphate to form SCPEs and investigated their apatite formation in SBF and SBF containing ALP. Although apatite did not form on the surface of the unmodified α-TCP in SBF, apatite formation was observed following surface modification with methyl or butyl phosphate. When ALP was present in SBF, apatite formation was especially remarkable on α-TCP modified with butyl phosphate. These SCPEs accelerated apatite formation by releasing calcium ions through dissolution and supplying inorganic phosphate ions, with the latter process only occurring in SBF containing ALP. Notably, no apatite formation occurred on α-TCP modified with dodecyl phosphate, likely because of the low solubility of the resulting calcium dodecyl phosphate/calcium phosphate composites. This new method of using SCPEs is anticipated to contribute to the development of novel ceramic biomaterials.

Also flagged:chitosanhydroxyapatitenanohydroxyapatiteapatitedegradationmineral
Journal Article 2024-08-20 No Snippets Piszko PJ, Piszko A, Kiryk S, Kiryk J, Horodniczy T, Struzik N, Wiśniewska K, Matys J, Dobrzyński M.
Show Full Abstract

In this systematic review, the authors aimed to investigate the state of knowledge on in vivo evaluations of chitosan and nanometric hydroxyapatite (nanohydroxyapatite, nHAp) scaffolds for bone-tissue regeneration. In March 2024, an electronic search was systematically conducted across the PubMed, Cochrane, and Web of Science databases using the keywords (hydroxyapatite) AND (chitosan) AND (scaffold) AND (biomimetic). Methodologically, the systematic review followed the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) protocol to the letter. Initially, a total of 375 studies were screened, and 164 duplicates were removed. A further 188 articles were excluded because they did not correspond to the predefined topics, and an additional 3 articles were eliminated due to the inability to obtain the full text. The final compilation included 20 studies. All publications indicated a potential beneficial effect of the scaffolds in in vivo bone defect repair. A beneficial effect of hydroxyapatite as a scaffold component was observed in 16 studies, including greater mechanical resistance, cellular differentiation, and enhanced bone damage regeneration. The addition of chitosan and apatite ceramics, which combined the strengths of both materials, had the potential to become a useful bone-tissue engineering material.

Also flagged:CholangiocarcinomaIntrahepatic cholangiocarcinomaiCCAliver cancersSimple Summary Intrahepatic cholangiocarcinomaliver cancer
Journal Article 2024-08-20 No Snippets Porreca V, Barbagallo C, Corbella E, Peres M, Stella M, Mignogna G, Maras B, Ragusa M, Mancone C.
Show Full Abstract

Intrahepatic cholangiocarcinoma (iCCA) is recognized worldwide as the second leading cause of morbidity and mortality among primary liver cancers, showing a continuously increasing incidence rate in recent years. iCCA aggressiveness is revealed through its rapid and silent intrahepatic expansion and spread through the lymphatic system leading to late diagnosis and poor prognoses. Multi-omics studies have aggregated information derived from single-omics data, providing a more comprehensive understanding of the phenomena being studied. These approaches are gradually becoming powerful tools for investigating the intricate pathobiology of iCCA, facilitating the correlation between molecular signature and phenotypic manifestation. Consequently, preliminary stratifications of iCCA patients have been proposed according to their "omics" features opening the possibility of identifying potential biomarkers for early diagnosis and developing new therapies based on personalized medicine (PM). The focus of this review is to provide new and advanced insight into the molecular pathobiology of the iCCA, starting from single- to the latest multi-omics approaches, paving the way for translating new basic research into therapeutic practices.

HTT
Also flagged:Hereditary neurodegenerative diseasessteroidorganizationplatelet-derived growth factorPDGFvascular endothelial growth factor
Journal Article 2024-08-20 ✓ 1 Snippet Issa S, Fayoud H, Shaimardanova A, Sufianov A, Sufianova G, Solovyeva V, Rizvanov A.
In-Text Gene Mentions

…hNDDs, examples includeHTTgene mutation in…

Show Full Abstract

Hereditary neurodegenerative diseases (hNDDs) such as Alzheimer's, Parkinson's, Huntington's disease, and others are primarily characterized by their progressive nature, severely compromising both the cognitive and motor abilities of patients. The underlying genetic component in hNDDs contributes to disease risk, creating a complex genetic landscape. Considering the fact that growth factors play crucial roles in regulating cellular processes, such as proliferation, differentiation, and survival, they could have therapeutic potential for hNDDs, provided appropriate dosing and safe delivery approaches are ensured. This article presents a detailed overview of growth factors, and explores their therapeutic potential in treating hNDDs, emphasizing their roles in neuronal survival, growth, and synaptic plasticity. However, challenges such as proper dosing, delivery methods, and patient variability can hinder their clinical application.

Also flagged:chromosomelysine-specific histone N-methyltransferase 2Achromatinhematologic disordersacute leukemiasKMT2A
Journal Article 2024-08-20 No Snippets Guarnera L, D'Addona M, Bravo-Perez C, Visconte V.
Show Full Abstract

<i>KMT2A</i> (alias: mixed-lineage leukemia [<i>MLL</i>]) gene mapping on chromosome 11q23 encodes the lysine-specific histone N-methyltransferase 2A and promotes transcription by inducing an open chromatin conformation. Numerous genomic breakpoints within the <i>KMT2A</i> gene have been reported in young children and adults with hematologic disorders and are present in up to 10% of acute leukemias. These rearrangements describe distinct features and worse prognosis depending on the fusion partner, characterized by chemotherapy resistance and high rates of relapse, with a progression-free survival of 30-40% and overall survival below 25%. Less intensive regimens are used in pediatric patients, while new combination therapies and targeted immunotherapeutic agents are being explored in adults. Beneficial therapeutic effects, and even cure, can be reached with hematopoietic stem cell transplantation, mainly in young children with dismal molecular lesions; however, delayed related toxicities represent a concern. Herein, we summarize the translocation partner genes and partial tandem duplications of the <i>KMT2A</i> gene, their molecular impact, clinical aspects, and novel targeted therapies.

Also flagged:DeathDiabetic Kidney Diseasediabetesautophagypyroptosisferroptosis
Journal Article 2024-08-20 No Snippets Zhong S, Wang N, Zhang C.
Show Full Abstract

Cell deaths maintain the normal function of tissues and organs. In pathological conditions, the abnormal activation or disruption of cell death often leads to pathophysiological effects. Diabetic kidney disease (DKD), a significant microvascular complication of diabetes, is linked to high mortality and morbidity rates, imposing a substantial burden on global healthcare systems and economies. Loss and detachment of podocytes are key pathological changes in the progression of DKD. This review explores the potential mechanisms of apoptosis, necrosis, autophagy, pyroptosis, ferroptosis, cuproptosis, and podoptosis in podocytes, focusing on how different cell death modes contribute to the progression of DKD. It recognizes the limitations of current research and presents the latest basic and clinical research studies targeting podocyte death pathways in DKD. Lastly, it focuses on the future of targeting podocyte cell death to treat DKD, with the intention of inspiring further research and the development of therapeutic strategies.

Also flagged:Cinnamic acidcinnamic acidsphenylGene transfercarboxylic acidacrylic acid
Journal Article 2024-08-20 No Snippets Annuur RM, Triana D, Ernawati T, Murai Y, Aswad M, Hashimoto M, Tachrim ZP.
Show Full Abstract

Antimicrobial resistance has emerged as a significant danger to global health, and the need for more effective antimicrobial resistance (AMR) control has been highlighted. Cinnamic acid is abundant in plant products and is a potential starting material for further modification, focusing on the development of new antimicrobial compounds. In the following review, we describe the classification of critical antibacterial-guided reactions applied to the main skeleton structure of cinnamic acid derivatives over the last decade. Of all of the main parts of cinnamic acids, the phenyl ring and the carboxylic group significantly affect antibacterial activity. The results presented in the following review can provide valuable insights into considerable features in the organic modification of cinnamic acids related to antibacterial medication development and the food industry.

Also flagged:HydroxyapatitesynthesiscalciumtitaniumBiopolymerschitosan
Journal Article 2024-08-20 No Snippets Alkaron W, Almansoori A, Balázsi K, Balázsi C.
Show Full Abstract

Hydroxyapatite (HAp) polymer composites have gained significant attention due to their applications in bone regeneration and tooth implants. This review examines the synthesis, properties, and applications of Hap, highlighting various manufacturing methods, including wet, dry, hydrothermal, and sol-gel processes. The properties of HAp are influenced by precursor materials and are commonly obtained from natural calcium-rich sources like eggshells, seashells, and fish scales. Composite materials, such as cellulose-hydroxyapatite and gelatin-hydroxyapatite, exhibit promising strength and biocompatibility for bone and tissue replacement. Metallic implants and scaffolds enhance stability, including well-known titanium-based and stainless steel-based implants and ceramic body implants. Biopolymers, like chitosan and alginate, combined with Hap, offer chemical stability and strength for tissue engineering. Collagen, fibrin, and gelatin play crucial roles in mimicking natural bone composition. Various synthesis methods like sol-gel, hydrothermal, and solution casting produce HAp crystals, with potential applications in bone repair and regeneration. Additionally, the use of biowaste materials, like eggshells and snails or seashells, not only supports sustainable HAp production but also reduces environmental impact. This review emphasizes the significance of understanding the properties of calcium-phosphate (Ca-P) compounds and processing methods for scaffold generation, highlighting novel characteristics and mechanisms of biomaterials in bone healing. Comparative studies of these methods in specific applications underscore the versatility and potential of HAp composites in biomedical engineering. Overall, HAp composites offer promising solutions for improving patient outcomes in bone replacement and tissue engineering and advancing medical practices.

Also flagged:TRIM ProteinsMicrotubule ReorganizationImmune ResponsesTRIMinnate immunityTRIM69
Journal Article 2024-08-20 No Snippets Vadon C, Magiera MM, Cimarelli A.
Show Full Abstract

TRIM proteins are a family of innate immune factors that play diverse roles in innate immunity and protect the cell against viral and bacterial aggression. As part of this special issue on TRIM proteins, we will take advantage of our findings on TRIM69, which acts by reorganizing the microtubules (MTs) in a manner that is fundamentally antiviral, to more generally discuss how host-pathogen interactions that take place for the control of the MT network represent a crucial facet of the struggle that opposes viruses to their cell environment. In this context, we will present several other TRIM proteins that are known to interact with microtubules in situations other than viral infection, and we will discuss evidence that may suggest a possible contribution to viral control. Overall, the present review will highlight the importance that the control of the microtubule network bears in host-pathogen interactions.

Also flagged:ion channelschannelopathies
Journal Article 2024-08-20 No Snippets Zhang J, Sabatier JM, Chahine M, Tricarico D.
Show Full Abstract

No abstract available.

Also flagged:hydroxideslayered double hydroxideshydrotalciteLDHsynthesishydroxyapatites
Journal Article 2024-08-20 No Snippets Velázquez-Herrera FD, Zarazua-Aguilar Y, Garzón-Pérez AS, Álvarez-Gómez KM, Fetter G.
Show Full Abstract

Nowadays, layered double hydroxides (LDH), sometimes referred as hydrotalcite-like compounds, have gained great attention since their composition and structure can be easily modified, so that they can be implemented in multiple fields. LDH-based composite materials based on LDH exhibit tremendously improved properties such as high specific surface area, which promotes the accessibility to a greater number of LDH active sites, considerably improving their catalytic, adsorbent and biological activities. Therefore, this review summarizes and discusses the synthesis methods of composites constituted by LDH with other inorganic compounds such as zeolites, cationic clays, hydroxyapatites, among many others, and describe the resulting characteristics of the resulting composites, emphasizing the morphology. Brief descriptions of their properties and applications are also included.

Also flagged:injuriesBone injuriesagingcongenital diseasesosteoporosispore
Journal Article 2024-08-20 No Snippets Mohammed A, Jiménez A, Bidare P, Elshaer A, Memic A, Hassanin H, Essa K.
Show Full Abstract

Bone is a complex connective tissue that serves as mechanical and structural support for the human body. Bones' fractures are common, and the healing process is physiologically complex and involves both mechanical and biological aspects. Tissue engineering of bone scaffolds holds great promise for the future treatment of bone injuries. However, conventional technologies to prepare bone scaffolds cannot provide the required properties of human bones. Over the past decade, three-dimensional (3D) printing or additive manufacturing technologies have enabled control over the creation of bone scaffolds with personalized geometries, appropriate materials, and tailored pores. This article aims to review recent advances in the fabrication of bone scaffolds for bone repair and regeneration. A detailed review of bone fracture repair and an in-depth discussion on conventional manufacturing and 3D printing techniques are introduced with an emphasis on novel studies concepts, potentials, and limitations.

medRxiv 2024-08-20 Preprint (No Snippets API) de Villiers CP, Downes DJ, Goel A, Pagnamenta AT, Ormondroyd E, Sparrow AJ, Nornes S, Giacopuzzi E, Rath P, Davies B, Schwessinger R, Gosden ME, Beagrie RA, Parkes D, Hastings R, Lise S, Salatino S, Roberts H, Lopopolo M, Weldon C, Trebes A, The WGS500 consortium, Buck D, Taylor JC, Redwood C, Rowland E, Tharmaratnam D, Stuart G, Lambiase PD, De Val S, Hughes JR, Watkins H.
Show Full Abstract

A substantial proportion of mutations underlying rare Mendelian diseases remain unknown, potentially because they lie in the non-coding genome. Here, we report the mapping of the causal mutation of an autosomal dominant cardiac arrhythmia syndrome, ST Depression Syndrome, which is associated with widespread ST-depression on the electrocardiogram together with risk of sudden death and heart failure, to the non-coding region of the KCNB1 locus. Using genetic linkage analysis, we narrowed the associated region to 1cM of the genome and then with a genome editing approach, we show that the mutation, a small complex insertion-deletion, generates a de novo gain-of-function enhancer that drives higher expression of KCNB1 in cardiomyocytes. This is the first report of a gain of de novo enhancer function causing Mendelian disease. Critically, the tissue-specific gain-of-function regulatory change could be predicted using a deep neural network. Application of a similar framework will enable identification of causal non-coding mutations and affected genes in other rare diseases.

bioRxiv 2024-08-20 Preprint (No Snippets API) Nicholson AS, Priestman DA, Antrobus R, Williamson JC, Bush R, Barrow HG, Smith E, Dobrenis K, Bright NA, Platt FM, Deane JE.
Show Full Abstract

<h4>ABSTRACT</h4> Glycosphingolipids (GSL) are important bioactive components of cellular membranes. Complex GSLs, containing sialic acid residues are known as gangliosides and are highly abundant in the brain. Diseases of ganglioside metabolism often result in severe, early-onset neurodegeneration. The ganglioside GM2 is the substrate of the hydrolytic lysosomal β- hexosaminidase A (HexA) enzyme and when subunits of this enzyme are non-functional, GM2 lipid accumulates in cells leading to the GM2 gangliosidoses, Tay-Sachs and Sandhoff diseases. We have developed high-quality i3Neuron-based models of Tay-Sachs and Sandhoff diseases, that demonstrate storage of GM2, formation of membrane whorls and accumulation of endolysosomal proteins consistent with disease phenotypes. Importantly, in addition to lysosomal dysfunction, the composition of the plasma membrane (PM) is significantly impacted in these diseases with changes in the abundance of both lipids and proteins. The changes to the PM proteome are driven in part by exocytosis of lysosomal material resulting in the aberrant accumulation of lysosomal proteins and lipids on the cell surface. The altered abundance of GM2 at the PM was striking, bringing the abundance of this precursor lipid up to that of the common neuronal gangliosides. Furthermore, the PM profiling identifies significant changes in synaptic protein abundances with direct functional impact on neuronal activity including rapid electrical firing consistent with neuronal hyperactivity. This work provides mechanistic insights into neuronal dysfunction in the GM2 gangliosidoses and highlights that these are also severe PM disorders. This work has broad implications for other lysosomal storage disorders and late-onset neurodegenerative diseases involving sphingolipid dysregulation.

SOX6
Also flagged:Degenerative spinal stenosisagingpathogenesisnitric oxideprostaglandinstendinopathy
Journal Article 2024-08-19 ✓ 1 Snippet Tang Y, Zhuo D, Yu Y, Pu W, Ma Y, Zhang Y, Huang Y, Zhang Q, Tang K, Meng C, Yang D, Bai L, He D, Jin L, Zou H, Xu H, Zhu Q, Wang J, Chen Y, Liu J.
In-Text Gene Mentions

…+ chondrocytes, includingSOX6, SOX10 ,…

Show Full Abstract

Degenerative spinal stenosis is a chronic disease that affects the spinal ligaments and associated bones, resulting in back pain and disorders of the limbs among the elderly population. There are few preventive strategies for such ligament degeneration. We here aimed to establish a comprehensive transcriptomic atlas of ligament tissues to identify high-priority targets for pharmaceutical treatment of ligament degeneration. Here, single-cell RNA sequencing was performed on six degenerative ligaments and three traumatic ligaments to understand tissue heterogeneity. After stringent quality control, high-quality data were obtained from 32,014 cells. Distinct cell clusters comprising stromal and immune cells were identified in ligament tissues. Among them, we noted that collagen degradation associated with CTHRC1<sup>+</sup> fibroblast-like cells and calcification linked to CRTAC1<sup>+</sup> chondrocyte-like cells were key features of ligament degeneration. SCENIC analysis and further experiments identified ATF3 as a key transcription factor regulating the pathogenesis of CRTAC1<sup>+</sup> chondrocyte-like cells. Typically, immune cells infiltrate localized organs, causing tissue damage. In our study, myeloid cells were found to be inflammatory-activated, and SPP1<sup>+</sup> macrophages were notably enriched in degenerative ligaments. Further exploration via CellChat analysis demonstrated a robust interaction between SPP1<sup>+</sup> macrophages and CRTAC1<sup>+</sup> chondrocyte-like cells. Activated by SPP1, ATF3 propels the CRTAC1/MGP/CLU axis, fostering ligament calcification. Our unique resource provides novel insights into possible mechanisms underlying ligament degeneration, the target cell types, and molecules that are expected to mitigate degenerative spinal ligament. We also highlight the role of immune regulation in ligament degeneration and calcification, enhancing our understanding of this disease.

SERPINC1
Also flagged:CYP1B1FOXC1childhood glaucomaCGMYOCCYP1B
Journal Article 2024-08-19 ✓ 1 Snippet Fuse N, Kimura M, Shimizu A, Koshiba S, Hamanaka T, Nakamura M, Ishida N, Sakai H, Ikeda Y, Mori K, Endo A, Nagasaki M, Katsuoka F, Yasuda J, Matsubara Y, Nakazawa T, Yamamoto M.
In-Text Gene Mentions

…mutation in theForkhead Box C1Box C1 (…

Show Full Abstract

<h4>Purpose</h4>To explore the frequency and positions of genetic mutations in CYP1B1 and FOXC1 in a Japanese population.<h4>Study design</h4>Molecular genetic analysis.<h4>Methods</h4>Genomic DNA was extracted from 31 Japanese patients with childhood glaucoma (CG) from 29 families. We examined the CYP1B, FOXC1, and MYOC genes using Sanger sequencing and whole-exome sequencing (WES).<h4>Results</h4>For CYP1B1, we identified 9 families that harbored novel mutations, p.A202T, p.D274E, p.Q340*, and p.V420G; the remaining mutations had been previously reported. When mapped to the CYP1B1 protein structure, all mutations appeared to influence the enzymatic activity of CYP1B1 by provoking structural deformity. Five patients were homozygotes or compound heterozygotes, supporting the recessive inheritance of the CYP1B1 mutations in CG. In contrast, four patients were heterozygous for the CYP1B1 mutation, suggesting the presence of regulatory region mutations or strong modifiers. For the FOXC1 gene, we identified 3 novel mutations, p.Q23fs, p.Q70R, and p.E163*, all of which were identified in a heterozygous state. No mutation was found in the MYOC gene in these CG patients. All individuals with CYP1B1 and FOXC1 mutations were severely affected by early-onset CG. In the CYP1B1-, FOXC1-, and MYOC-negative families, we also searched for variants in the other candidate genes reported for CG through WES, but could not find any mutations in these genes.<h4>Conclusions</h4>Our analyses of 29 CG families revealed 9 families with point mutations in the CYP1B1 gene, and four of those patients appeared to be heterozygotes, suggesting the presence of complex pathogenic mechanisms. FOXC1 appears to be another major causal gene of CG, indicating that panel sequencing of CYP1B1 and FOXC1 will be useful for diagnosis of CG in Japanese individuals.

DCC
Also flagged:axon growthaxonsextracellularNetrin-1Ntn1axon
Journal Article 2024-08-19 ✓ 5 Snippets Curran BM, Nickerson KR, Yung AR, Goodrich LV, Jaworski A, Tessier-Lavigne M, Ma L.
In-Text Gene Mentions

…for Ntn1 ,Dcc, Slit1 , Slit2…

…Robo1, Robo2 andDccwas done by…

…Role ofDCCand Robo receptors…

…the Ntn1 receptorDCC, which was previously…

DCCis expressed at…

Show Full Abstract

The dorsal funiculus in the spinal cord relays somatosensory information to the brain. It is made of T-shaped bifurcation of dorsal root ganglion (DRG) sensory axons. Our previous study has shown that Slit signaling is required for proper guidance during bifurcation, but loss of Slit does not affect all DRG axons. Here, we examined the role of the extracellular molecule Netrin-1 (Ntn1). Using wholemount staining with tissue clearing, we showed that mice lacking Ntn1 had axons escaping from the dorsal funiculus at the time of bifurcation. Genetic labeling confirmed that these misprojecting axons come from DRG neurons. Single axon analysis showed that loss of Ntn1 did not affect bifurcation but rather altered turning angles. To distinguish their guidance functions, we examined mice with triple deletion of Ntn1, Slit1, and Slit2 and found a completely disorganized dorsal funiculus. Comparing mice with different genotypes using immunolabeling and single axon tracing revealed additive guidance errors, demonstrating the independent roles of Ntn1 and Slit. Moreover, the same defects were observed in embryos lacking their cognate receptors. These in vivo studies thus demonstrate the presence of multi-factorial guidance mechanisms that ensure proper formation of a common branched axonal structure during spinal cord development.

HFE
Also flagged:Hemagglutinindeathlipidferroptosisautophagic receptors nuclear receptor coactivator 4mitochondrial antiviral signaling protein
Journal Article 2024-08-19 ✓ 1 Snippet Ouyang A, Chen T, Feng Y, Zou J, Tu S, Jiang M, Sun H, Zhou H.
In-Text Gene Mentions

…iron metabolism‐related geneHfemediates autophagic degradatio…

Show Full Abstract

Ferroptosis is a novel form of cell death caused by the accumulation of lipid peroxides in an iron-dependent manner. However, the precise mechanism underlying the exploitation of ferroptosis by influenza A viruses (IAV) remains unclear. The results demonstrate that IAV promotes its own replication through ferritinophagy by sensitizing cells to ferroptosis, with hemagglutinin identified as a key trigger in this process. Hemagglutinin interacts with autophagic receptors nuclear receptor coactivator 4 (NCOA4) and tax1-binding protein 1 (TAX1BP1), facilitating the formation of ferritin-NCOA4 condensates and inducing ferritinophagy. Further investigation shows that hemagglutinin-induced ferritinophagy causes cellular lipid peroxidation, inhibits aggregation of mitochondrial antiviral signaling protein (MAVS), and suppresses the type I interferon response, thereby contributing to viral replication. Collectively, a novel mechanism by which IAV hemagglutinin induces ferritinophagy resulting in cellular lipid peroxidation, consequently impairing MAVS-mediated antiviral immunity, is revealed.

LRRC7
Also flagged:Cohesininterphase genomechromosomesmitosisbindingstructural
Journal Article 2024-08-19 ✓ 1 Snippet Rhind N.
In-Text Gene Mentions

Condensin

Show Full Abstract

Cohesin is a ring-shaped complex that is loaded on DNA in two different conformations. In one conformation, it forms loops to organize the interphase genome; in the other, it topologically encircles sibling chromosomes to facilitate homologous recombination and to establish the cohesion that is required for orderly segregation during mitosis. How, and even if, these two loading conformation are related is unclear. Here, I propose that loop binding is a required first step for topological binding. This loop-binding-first model integrates the known information about the two loading mechanisms, explains genetic requirements for the two and explains how topological loading evolved from loop binding.

PCDH17
Also flagged:gene expressionfinasteridedoxazosinBenign prostatic hyperplasia5α-reductasefatty acid
Journal Article 2024-08-19 ✓ 1 Snippet Choi HY, Torkko KC, Lucia MS, Mozhui K, Choi WY, Clark PE, Fowke JH.
In-Text Gene Mentions

…genes ( PRKX,PCDH17, SPIB ) for…

Show Full Abstract

Benign prostatic hyperplasia (BPH) may decrease patient quality of life and often leads to acute urinary retention and surgical intervention. While effective treatments are available, many BPH patients do not respond or develop resistance to treatment. To understand molecular determinants of clinical symptom persistence after initiating BPH treatment, we investigated gene expression profiles before and after treatments in the prostate transitional zone of 108 participants in the Medical Therapy of Prostatic Symptoms (MTOPS) Trial. Unsupervised clustering revealed molecular subgroups characterized by expression changes in a large set of genes associated with resistance to finasteride, a 5α-reductase inhibitor. Pathway analyses within this gene cluster found finasteride administration induced changes in fatty acid metabolism, amino acid metabolism, immune response, steroid hormone metabolism, and kinase activity within the transitional zone. We found that patients without this transcriptional response were highly likely to develop clinical progression, which is expected in 13.2% of finasteride-treated patients. Importantly, a patient's transcriptional response to finasteride was associated with their pre-treatment kinase expression. Further, we identified novel expression signatures of finasteride resistance among the transcriptionally responded patients. These patients showed different gene expression profiles at baseline and increased prostate transitional zone volume compared to the patients who responded to the treatment. Our work suggests molecular mechanisms of clinical resistance to finasteride treatment that could be potentially helpful for personalized BPH treatment as well as new drug development to increase patient drug response.

HFE
Also flagged:hyperferritinemiachronic hepatitis C virus infectionvirusHCV) infectionmetabolic dysfunction-associated steatotic liver diseasealanine transaminase
Journal Article 2024-08-19 ✓ 3 Snippets Chang YP, Huang CB, Kao JH, Su TH, Huang SC, Tseng TC, Chen PJ, Liu CJ, Liu CH.
In-Text Gene Mentions

…hagocytic lymphohistiocytosis,hemochromatosis7 .…

…did not conductHFEC282Y and H63D…

…exclude participants withHFE hemochromatosishemochromatosis.…

Show Full Abstract

Pre-treatment host and viral factors may affect serum ferritin levels in patients with hepatitis C virus (HCV) infection. We delineated pre-treatment factors associated with hyperferritinemia in these patients. 1682 eligible patients underwent pre-treatment assessment for serum ferritin and various host/viral factors. Univariate and multivariate logistic regression analyses were conducted to evaluate factors associated with hyperferritinemia. Multivariate logistic regression analyses revealed that age > 50 years (adjusted odds ratio [OR]: 1.38 (95% confidence interval [CI] 1.09-1.74), p = 0.008), fibrosis stage ≥ F3 (adjusted OR: 1.36 (95% CI 1.04-1.77), p = 0.02), fibrosis index based on four parameters (FIB-4) > 3.25 (adjusted OR: 1.46 (95% CI 1.11-1.92), p = 0.01), presence of metabolic dysfunction-associated steatotic liver disease (MASLD) (adjusted OR: 1.43 (95% CI 1.21-1.76), p = 0.001), and alanine transaminase (ALT) > 2 folds upper limit of normal (ULN) (adjusted OR: 2.87 (95% CI 2.20-3.75), p < 0.001) were associated hyperferritinemia. The log<sub>10</sub> value of HBV or HCV viral load was not associated with the log<sub>10</sub> value of ferritin level (Spearman's rank correlation coefficient: - 0.025, p = 0.81 and 0.002, p = 0.92). In conclusion, host factors, rather than viral factors, are associated with hyperferritinemia in patients with HCV.

Also flagged:Tripartite motif-containing 24TRIM24TIF1cancerchromatingene expression
Journal Article 2024-08-19 No Snippets Yao Y, Zhou S, Yan Y, Fu K, Xiao S.
Show Full Abstract

Tripartite motif-containing 24 (TRIM24), also known as transcriptional intermediary factor 1α (TIF1α), is the founding member of TIF1 family. Recent evidence indicates that aberrant expression of TRIM24, functions as an oncogene, is associated with poor prognosis across various cancer types. TRIM24 exhibits a multifaceted structure comprising an N-terminal TRIM region with a RING domain, B-box type 1 and type 2 domains, and a coiled-coil region, as well as a C-terminal plant-homeodomain (PHD)-bromodomain. The bromodomain serves as a 'reader' of epigenetic histone marks, regulating chromatin structure and gene expression by linking associated proteins to acetylated nucleosomal targets, thereby controlling transcription of genes. Notably, bromodomains have emerged as compelling targets for cancer therapeutic development. In addition, TRIM24 plays specialized roles as a signal transduction molecule, orchestrating various cellular signaling cascades in cancer cells. Herein, we review the recent advancements in understanding the functions of TRIM24, and demonstrate the research progress in utilizing TRIM24 as a target for cancer therapy.

CACNA1E
Also flagged:CACNA2D2epileptic encephalopathymembraneneuropsychiatric disordersdevelopmental and epileptic encephalopathyDEE
Journal Article 2024-08-19 ✓ 1 Snippet Haddad S, Ablinger C, Stanika R, Hessenberger M, Campiglio M, Ortner NJ, Tuluc P, Obermair GJ.
In-Text Gene Mentions

…al., 2018 ),CACNA1E(Helbig et al.,…

Show Full Abstract

α<sub>2</sub>δ proteins serve as auxiliary subunits of voltage-gated calcium channels and regulate channel membrane expression and current properties. Besides their channel function, α<sub>2</sub>δ proteins regulate synapse formation, differentiation, and synaptic wiring. Considering these important functions, it is not surprising that CACNA2D1-4, the genes encoding for α<sub>2</sub>δ-1 to -4 isoforms, have been implicated in neurological, neurodevelopmental, and neuropsychiatric disorders. Mutations in CACNA2D2 have been associated with developmental and epileptic encephalopathy (DEE) and cerebellar atrophy. In our present study, we performed a detailed functional characterization of the p.R593P mutation in α<sub>2</sub>δ-2, a homozygous mutation previously identified in two siblings with DEE. Importantly, we analyzed both calcium channel-dependent as well as synaptic functions of α<sub>2</sub>δ-2. Our data show that the corresponding p.R596P mutation in mouse α<sub>2</sub>δ-2 drastically decreases membrane expression and synaptic targeting of α<sub>2</sub>δ-2. This defect correlates with altered biophysical properties of postsynaptic Ca<sub>V</sub>1.3 channel but has no effect on presynaptic Ca<sub>V</sub>2.1 channels upon heterologous expression in tsA201 cells. However, homologous expression of α<sub>2</sub>δ-2_R596P in primary cultures of hippocampal neurons affects the ability of α<sub>2</sub>δ-2 to induce a statistically significant increase in the presynaptic abundance of endogenous Ca<sub>V</sub>2.1 channels and presynaptic calcium transients. Moreover, our data demonstrate that in addition to lowering membrane expression, the p.R596P mutation reduces the trans-synaptic recruitment of GABA<sub>A</sub> receptors and presynaptic synapsin clustering in glutamatergic synapses. Lastly, the α<sub>2</sub>δ-2_R596P reduces the amplitudes of glutamatergic miniature postsynaptic currents in transduced hippocampal neurons. Taken together, our data strongly link the human biallelic p.R593P mutation to the underlying severe neurodevelopmental disorder and highlight the importance of studying α<sub>2</sub>δ mutations not only in the context of channelopathies but also synaptopathies.

Also flagged:Cognitive Impairmentgestationsteroidsintraventricular hemorrhageperiventricular leukomalaciameningitis
Journal Article 2024-08-19 No Snippets Salas AA, Carlo WA, Bann CM, Bell EF, Colaizy TT, Younge N, Peralta M, Ambalavanan N, Poindexter BB, Eunice Kennedy Shriver NICHD Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To assess the risk of cognitive impairment among infants born extremely preterm using the INTERGROWTH-21st standards.<h4>Study design</h4>We analyzed anthropometric data at birth and 36 weeks postmenstrual age (PMA) from infants born extremely preterm (24-26 weeks of gestation) admitted to US neonatal units between 2008 and 2018. To determine INTERGROWTH-21st z-score values that indicate an increased risk of cognitive impairment at 2 years of age (Bayley cognitive score <85), we employed classification and regression trees and redefined growth failure (weight, length, and head circumference z-scores at 36 weeks PMA) and growth faltering (weight, length, and head circumference z-score declines from birth to 36 weeks PMA).<h4>Results</h4>Among 5393 infants with a mean gestational age of 25 weeks, growth failure defined as a weight z-score of -1.8 or below at 36 weeks PMA and growth faltering defined as a weight z-score decline of 1.1 or greater from birth to 36 weeks PMA indicated a higher likelihood of cognitive impairment. A length z-score less than -1 at 36 weeks PMA had the highest sensitivity to detect cognitive impairment at 2 years (80%). A head circumference z-score decline of 2.43 or greater from birth to 36 weeks PMA had the highest specificity (86%). Standard definitions had fair to low sensitivity and specificity for risk detection of cognitive impairment.<h4>Conclusions</h4>Length and head circumference z-scores had the highest sensitivity and specificity for risk detection of cognitive impairment. Monitoring these growth parameters could guide earlier individualized interventions with potential to reduce cognitive impairment.<h4>Clinical trial registration</h4>ClinicalTrials.gov ID Generic Database: NCT00063063.

SERPINC1
Also flagged:Homologous RecombinationmedulloblastomasBrca1BccipmicrocephalyTrp53
Journal Article 2024-08-19 ✓ 1 Snippet Lu H, Wang Y, Chaudhary S, Balaga V, Ke H, Shi F, Liu J, Huo Y, Romanienko PJ, Xia B, De S, Chan CS, Shen Z.
In-Text Gene Mentions

ꞵ-III tubulin

Show Full Abstract

Germline mutations of homologous-recombination (HR) genes are among the top contributors to medulloblastomas. A significant portion of human medulloblastomas exhibit genomic signatures of HR defects. Whether ablation of Brca2 and Palb2, and their related Brca1 and Bccip genes, in the mouse brain can differentially initiate medulloblastomas was explored here. Conditional knockout mouse models of these HR genes and a conditional knockdown of Bccip (shBccip-KD) were established. Deletion of any of these genes led to microcephaly and neurologic defects, with Brca1<sup>-</sup> and Bccip<sup>-</sup> producing the worst defects. Trp53 co-deletion significantly rescued the microcephaly with Brca1, Palb2, and Brca2 deficiency but exhibited limited impact on Bccip<sup>-</sup> mice. For the first time, inactivation of either Brca1 or Palb2 with Trp53 was found to induce medulloblastomas. Despite shBccip-CKD being highly penetrative, Bccip/Trp53 deletions failed to induce medulloblastomas. The tumors displayed diverse immunohistochemical features and chromosome copy number variation. Although there were widespread up-regulations of cell proliferative pathways, most of the tumors expressed biomarkers of the sonic hedgehog subgroup. The medulloblastomas developed from Brca1<sup>-</sup>, Palb2<sup>-</sup>, and Brca2<sup>-</sup> mice were highly sensitive to a poly (ADP-ribose) polymerase inhibitor but not the ones from shBccip-CKD mice. These models recapitulate the spontaneous medulloblastoma development with high penetrance and a narrow time window, providing ideal platforms to test therapeutic agents with the ability to differentiate HR-defective and HR-proficient tumors.

CACNA1E
Also flagged:Hepatocellular carcinomadigestive tumorfludarabineoxaliplatinXIRP2zinc
Journal Article 2024-08-19 ✓ 1 Snippet Li D, Bao X, Lei S, Cao W, Zeng Z, Chen T.
In-Text Gene Mentions

…, HMCN1 ,CACNA1E, and RYR1…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a prevalent malignant digestive tumor. Numerous genetic mutations have been documented in HCC, yet the clinical significance of these mutations remains largely unexplored. The objective of this study is to ascertain the clinical value and biological effects of xin actin binding repeat containing 2 (<i>XIRP2</i>) mutation in HCC. The gene mutation landscape of HCC was examined using data from the Cancer Genome Atlas and the International Cancer Genome Consortium databases. The prognostic significance of the <i>XIRP2</i> mutation was assessed through KM plot analysis. The association between drug sensitivity and the <i>XIRP2</i> mutation was investigated using the TIDE algorithm and CCK-8 experiments. The biological effects of the <i>XIRP2</i> mutation were evaluated through qRT-PCR, protein stability experiments, and relevant biological experiments. The <i>XIRP2</i> mutation is one of the high-frequency mutations in HCC, and is associated with poor prognosis. A total of 72 differentially expressed genes (DEGs) were observed in HCC tissues with the <i>XIRP2</i> mutation as compared to those with the <i>XIRP2</i> wildtype, and these DEGs were closely related to ion metabolic processes. The <i>XIRP2</i> mutation was linked to alterations in the sensitivity of fludarabine, oxaliplatin, WEHI-539, and LCL-161. CCK-8 assays demonstrated that HCC cells carrying the <i>XIRP2</i> mutation exhibited increased resistance to fludarabine and oxaliplatin, but enhanced sensitivity to WEHI-539 and LCL-161 as compared with those HCC cells with the <i>XIRP2</i> wildtype. The <i>XIRP2</i> mutation was found to have no impact on the mRNA levels of XIRP2 in tissues and cells, but it did enhance the stability of the XIRP2 protein. Mechanically, the inhibition of <i>XIRP2</i> resulted in a significant increase in sensitivity to oxaliplatin through an elevation in zinc ions and a calcium ion overload. In conclusion, the <i>XIRP2</i> mutation holds potential as a biomarker for predicting the prognosis and drug sensitivity of HCC and serves as a therapeutic target to enhance the efficacy of oxaliplatin.

SERPINC1
Also flagged:lactationglycosyltransferasemacromolecule transmembrane transporterinflammatory responsecoagulationapolipoprotein B
Journal Article 2024-08-19 ✓ 1 Snippet Huang D, Wang Y, Ding H, Zhao H.
In-Text Gene Mentions

…SPP1, and upregulatedSERPINC1, LPO, ACAT2, LCP1,…

Show Full Abstract

Colostrum intake is a crucial determinant of survival in newborn rabbits. Neonates rely entirely on passive immunity transfer from their mothers while suckling colostrum. The goal of this study was to explore the protein differences of rabbit milk during different lactation periods. Our findings showed that the daily milk yield exhibited an increasing trend from the 2nd to the 21st day of lactation. A data-independent acquisition proteomics approach identified a total of 2011 proteins. Significantly, different abundances were found for 525 proteins in the colostrum and the mature milk samples. Eleven differentially abundant proteins (DAPs) were examined using parallel reaction monitoring, which verified the reliability of the proteomic data. Gene Ontology analysis revealed that these DAPs were primarily associated with glycosyltransferase activity, macromolecule transmembrane transporter activity, and regulation of acute inflammatory response. The dominant metabolic pathways of the DAPs involve the complement and coagulation cascades. A protein-protein interaction analysis identified apolipoprotein B, apolipoprotein A1, triose phosphate isomerase 1, and albumin as the hub proteins responsible for distinguishing differences between biological properties in rabbit colostrum and mature milk. These findings enhance our comprehension of the rabbit milk proteome, particularly in expanding our knowledge regarding the requirements of neonatal rabbits.

HFE
Also flagged:Liver cancercancerprimary liver cancerprimary hepatic cancerprimary hepatic malignancyliver cancers
Journal Article 2024-08-19 ✓ 1 Snippet Cristani M, Citarella A, Carnamucio F, Micale N.
In-Text Gene Mentions

…diseases (such ashemochromatosisand Wilson’s disease)…

Show Full Abstract

Oxidative stress is a key factor in the pathological processes that trigger various chronic liver diseases, and significantly contributes to the development of hepatocarcinogenesis. Natural antioxidants reduce oxidative stress by neutralizing free radicals and play a crucial role in the treatment of free-radical-induced liver diseases. However, their efficacy is often limited by poor bioavailability and metabolic stability. To address these limitations, recent advances have focused on developing nano-drug delivery systems that protect them from degradation and enhance their therapeutic potential. Among the several critical benefits, they showed to be able to improve bioavailability and targeted delivery, thereby reducing off-target effects by specifically directing the antioxidant to the liver tumor site. Moreover, these nanosystems led to sustained release, prolonging the therapeutic effect over time. Some of them also exhibited synergistic effects when combined with other therapeutic agents, allowing for improved overall efficacy. This review aims to discuss recent scientific advances in nano-formulations containing natural antioxidant molecules, highlighting their potential as promising therapeutic approaches for the treatment of liver cancer. The novelty of this review lies in its comprehensive focus on the latest developments in nano-formulations of natural antioxidants for the treatment of liver cancer.

Also flagged:waterdisease infectionsAfrican swine feverSwine feverrespiratory infectionsgenital infections
Journal Article 2024-08-19 No Snippets Pius L, Huang S, Wanjala G, Bagi Z, Kusza S.
Show Full Abstract

Africa is home to a wide diversity of locally adapted pig breeds whose genetic architecture offers important insights into livestock adaptation to climate change. However, the majority of these inherent traits have not been fully highlighted. This review presents an overview of the current state of African pig genetic resources, providing highlights on their population and production statistics, production system, population diversity indices, and genomic evidence underlying their evolutionary potential. The study results reveal an incomplete characterization of local pig genotypes across the continent. The characterized population, however, demonstrates moderate to high levels of genetic diversity, enough to support breeding and conservation programs. Owing to low genetic differentiation and limited evidence of distinct population structures, it appears that most local pig populations are strains within larger breeds. Genomic evidence has shown a higher number of selection signatures associated with various economically important traits, thus making them potential candidates for climate change adaptation. The reportedly early evidence of hybridization with wild suid groups further suggests untapped insights into disease resistance and resilience traits that need to be illuminated using higher-density markers. Nevertheless, gene introgression from commercial breeds is prevalent across Africa; thus, efforts to realize and utilize these traits must increase before they are permanently depleted.

LRRC7
Also flagged:Gene ExpressionNeurogenesisCerebral Infarctioncognitionstrokewater
Journal Article 2024-08-19 ✓ 1 Snippet Song MK, Jo HS, Kim EJ, Kim JK, Lee SG.
In-Text Gene Mentions

…to neurogenesis (Iqgap1,Lrrc7, Coq7, Myef2, Mapk3,…

Show Full Abstract

Regular exercise improves several functions, including cognition, in patients with stroke. However, the effect of regular exercise on neurogenesis related to cognition remains doubtful. We investigated the most effective exercise intensity for functional recovery after stroke using RNA sequencing following regular treadmill exercise. Photothrombotic cerebral infarction was conducted for 10-week-old male Sprague-Dawley rats (<i>n</i> = 36). A Morris water maze (MWM) test was performed before a regular treadmill exercise program (5 days/week, 4 weeks). Rats were randomly divided into four groups: group A (no exercise); group B (low intensity, maximal velocity 18 m/min); group C (moderate intensity, maximal velocity 24 m/min) and group D (high intensity, maximal velocity 30 m/min). After 4 weeks, another MWM test was performed, and all rats were sacrificed. RNA sequencing was performed with ipsilesional hippocampal tissue. On the day after cerebral infarction, no differences in escape latency and velocity were observed among the groups. At 4 weeks after cerebral infarction, the escape latencies in groups B, C, and D were shorter than in group A. The escape latencies in groups B and C were shorter than in group D. The velocity in groups A, B, and C was faster than in group D. Thirty gene symbols related to neurogenesis were detected (<i>p</i> < 0.05, fold change > 1.0, average normalized read count > four times). In the neurotrophin-signaling pathway, the <i>CHK</i> gene was upregulated, and the <i>NF-κB</i> gene was downregulated in the low-intensity group. The <i>CHK</i> and <i>NF-κB</i> genes were both downregulated in the moderate-intensity group. The <i>Raf</i> and <i>IRAK</i> genes were downregulated in the high-intensity group. Western blot analysis showed that <i>NF-κB</i> expression was lowest in the moderate-intensity group, whereas <i>CHK</i> and <i>Raf</i> were elevated, and <i>IRAK</i> was decreased in the high-intensity group. Moderate-intensity exercise may contribute to neuroplasticity. Variation in the expression of neurotrophins in neurogenesis according to exercise intensity may reveal the mechanism of neuroplasticity. Thus, <i>NF-κB</i> is the key neurotrophin for neurogenesis related to exercise intensity.

Also flagged:SynthesisChlorambucilsilicacancerCLBlung adenocarcinoma
Journal Article 2024-08-19 No Snippets Karnopp JCF, Jorge J, da Silva JR, Boldo D, Del Pino Santos KF, Duarte AP, de Castro GR, de Azevedo RB, Prada AL, Amado JRR, Martines MAU.
Show Full Abstract

This study describes the synthesis and characterization of chlorambucil (CLB)-functionalized mesoporous silica nanoparticles (MSNs) for potential application in cancer therapy. The nanoparticles were designed with a diameter between 20 and 50 nm to optimize cellular uptake and avoid rapid clearance from the bloodstream. The synthesis method involved modifying a previously reported technique to reduce particle size. Successful functionalization with CLB was confirmed through various techniques, including Fourier transform infrared spectroscopy (FTIR) and elemental analysis. The cytotoxicity of the CLB-functionalized nanoparticles (MSN@NH<sub>2</sub>-CLB) was evaluated against human lung adenocarcinoma cells (A549) and colon carcinoma cells (CT26WT). The results suggest significantly higher cytotoxicity of MSN@NH<sub>2</sub>-CLB compared to unbound CLB, with improved selectivity towards cancer cells over normal cells. This suggests that MSN@NH<sub>2</sub>-CLB holds promise as a drug delivery system for targeted cancer therapy.

Also flagged:African swine feverviral diseasehemadsorptionAfrican swine fever virusinfectionimmune responses
Journal Article 2024-08-19 No Snippets Truong QL, Wang L, Nguyen TA, Nguyen HT, Le AD, Nguyen GV, Vu AT, Hoang PT, Le TT, Nguyen HT, Nguyen HTT, Lai HLT, Bui DAT, Huynh LMT, Madera R, Li Y, Retallick J, Matias-Ferreyra F, Nguyen LT, Shi J.
Show Full Abstract

African swine fever (ASF) is a highly contagious and severe hemorrhagic transboundary swine viral disease with up to a 100% mortality rate, which leads to a tremendous socio-economic loss worldwide. The lack of safe and efficacious ASF vaccines is the greatest challenge in the prevention and control of ASF. In this study, we generated a safe and effective live-attenuated virus (LAV) vaccine candidate VNUA-ASFV-LAVL3 by serially passaging a virulent genotype II strain (VNUA-ASFV-L2) in an immortalized porcine alveolar macrophage cell line (3D4/21, 50 passages). VNUA-ASFV-LAVL3 lost its hemadsorption ability but maintained comparable growth kinetics in 3D4/21 cells to that of the parental strain. Notably, it exhibited significant attenuation of virulence in pigs across different doses (10<sup>3</sup>, 10<sup>4</sup>, and 10<sup>5</sup> TCID<sub>50</sub>). All vaccinated pigs remained healthy with no clinical signs of African swine fever virus (ASFV) infection throughout the 28-day observation period of immunization. VNUA-ASFV-LAVL3 was efficiently cleared from the blood at 14-17 days post-infection, even at the highest dose (10<sup>5</sup> TCID<sub>50</sub>). Importantly, the attenuation observed in vivo did not compromise the ability of VNUA-ASFV-LAVL3 to induce protective immunity. Vaccination with VNUA-ASFV-LAVL3 elicited robust humoral and cellular immune responses in pigs, achieving 100% protection against a lethal wild-type ASFV (genotype II) challenge at all tested doses (10<sup>3</sup>, 10<sup>4</sup>, and 10<sup>5</sup> TCID<sub>50</sub>). Furthermore, a single vaccination (10<sup>4</sup> TCID<sub>50</sub>) provided protection for up to 2 months. These findings suggest that VNUA-ASFV-LAVL3 can be utilized as a promising safe and efficacious LAV candidate against the contemporary pandemic genotype II ASFV.

HTT
Also flagged:Alzheimer's DiseaseADneurodegenerative disorderamyloid precursor proteinAPPamyloid-beta
Journal Article 2024-08-19 ✓ 1 Snippet Cai J, Ni YQ, Liu YS.
In-Text Gene Mentions

…targeting Huntington's gene (HTT) for Huntington's disease…

Show Full Abstract

Alzheimer's Disease (AD) is the most prevalent, costly, and fatal neurodegenerative disorder of this century. Two hallmark features of AD are the anomalous cleavage of amyloid precursor protein (APP), which leads to the accumulation of amyloid-beta (Aβ), and the hyperphosphorylation of tau protein. Despite extensive research efforts, the pathology and pathogenesis of AD remain elusive. Recent investigations have highlighted the close association between antisense long non-coding RNAs (AS-lncRNAs) and various biological and functional aspects of AD. However, many AS-lncRNAs implicated in AD have not yet been comprehensively compiled and discussed. This paper reviews the role of AS-lncRNAs in neurodegenerative diseases, outlines their association with AD, and offers novel insights into the potential applications of antisense RNAs in the diagnosis and treatment of AD.

Also flagged:epithelial cancersvascular endothelial growth factorVEGFtumourEBV infectionepithelial cancer
Journal Article 2024-08-19 No Snippets Xiang T, Sun F, Liu T, Zhao J, Yang J, Ouyang D, Chen H, Zhu Q, Wang Q, Li Y, He J, Yang C, Yang X, Chen Y, Tang Y, Weng D, Pan Q, Yang Q, Xia J.
Show Full Abstract

<b>Background:</b> Vasculogenic mimicry (VM) induced by Epstein-Barr virus (EBV) infection plays an important role in resistance to anti-vascular endothelial growth factor (VEGF) therapy in EBV-associated epithelial cancers; however, the interaction between VM and the immune microenvironment has not been systematically investigated. <b>Methods:</b> IHC and multiplex IHC analysis the relationships among tumour-associated macrophage (TAM), VM and EBV infection in EBV-associated epithelial cancer biopsies. <i>In vitro</i> and <i>in vivo</i> evidence using CRISPR-Cas9 system engineered EBV-infected epithelial cancer cells and mouse models support functional role and mechanism for M2c-like macrophages in the VM formation. The prediction of VM in the effectiveness of anti-angiogenic agent was analysed using clinical datasets. <b>Results:</b> EBV-associated epithelial cancer biopsies revealed that infiltration of the TAM surrounding the VM is closely associated with EBV infection. AKT/mTOR/HIF-1α pathway in EBV-infected epithelial cancer cells control the secretion of CCL5 and CSF-1, enabling the recruitment of monocytes and their differentiation into M2c macrophages which promote VM formation by MMP9. Combination of anti-angiogenesis agents and HIF-1α inhibitor caused marked decreases in CD31-positive micro-vessels, VM, and M2c-like macrophages. VM scores can be used as biomarkers to predict the efficacy of anti-angiogenic agent therapy in EBV-associated epithelial cancers. <b>Conclusions:</b> Our findings define a secretory cross-talk between tumour cells and the immune microenvironment in EBV-associated epithelial cancer, revealing an unexpected role of EBV in epithelial cancer cells, controlling VM formation via M2c-like macrophages.

bioRxiv 2024-08-19 Preprint (No Snippets API) Ding X, Lai X, Klæstrup IH, Jensen SRN, Nielsen MM, Thorsen K, Romero-Ramos M, Luo Y, Lin L, Reinert LS, Paludan SR.
Show Full Abstract

Herpes Simplex Virus 1 (HSV-1) is a common human neurotropic virus with the majority of adults harboring latent-recurrent infections. In rare cases, HSV-1 infection can access the central nervous system through the neuronal route and develop into life-threatening encephalitis. Here, we used a mouse model for HSV-1 infection to describe the transcriptomic profile of the infected brain stem at the single-cell level and with temporal resolution. Among resident brain cells, microglia increased in proportion during the course of infection, while astrocytes, pericytes, and endothelial cell levels decrease. At the levels of peripheral immune cells, we found notably monocytes to strongly influx the infected brain. Large dynamic changes were found in the abundance of subpopulations of the different cell types following virus infection. For instance, we identify one subpopulation of microglia exhibiting very high type I interferon and chemokine expression early during infection. This population was also enriched for viral transcripts, suggesting localization at foci of infection, and orchestrating recruitment of other immune cells. In contrast, for the infiltrating monocytes, we identified a larger panel of unique subpopulations with antiviral and inflammatory phenotypes, and found not all of these being highly positive for viral transcripts, thus indicating monocyte activities beyond the infected brain areas. Finally, investigation of endothelial cell cross-talk with other cell types revealed that cytokines derived from microglia and monocyte, but also T cells, contribute to disturbance of the blood brain barrier. Our work thus reveals for the first time the complex nature of the cellular response in the virus-infected brain, which seeks to eliminate infection but can also prime for pathological changes.

bioRxiv 2024-08-19 Preprint (No Snippets API) Wong TN, Mychalowych A, Feldpausch ER, Carson A, Karpova D, Link DC.
Show Full Abstract

Somatic mutations arising in hematopoietic stem cells (HSCs) may provide the latter with a fitness advantage, allowing the mutant HSC to clonally expand. Such mutations have been recurrently identified in the chromatin modifier, SRCAP , in both non-malignant and leukemic clones, suggesting that this gene plays a significant role in hematopoiesis. We generated a conditional Srcap loss of function murine model and determined the consequences of hematopoietic-specific loss of this gene. We show that Srcap is essential for normal fetal liver erythropoiesis and monocytopoiesis. In Srcap deficient fetal livers, the number of phenotypic HSCs is similar to that of controls, but these HSCs exhibit a profound repopulating defect. Likewise, conditional deletion of Srcap during adult hematopoiesis results in a rapid loss of HSCs. Loss of Srcap is associated with evidence of increased DNA damage in HSCs and lineage-restricted progenitors as assessed by y-H2AX expression. Consistent with this finding, we observed strong transcriptional upregulation of the p53 pathway in Srcap deficient erythroid precursors. Collectively our data highlight the importance of Srcap in maintaining HSC function and supporting hematopoietic differentiation and suggests that it plays an essential role in maintaining genomic integrity. <h4>Key Points</h4> (1) Srcap plays an essential role in supporting normal hematopoietic differentiation. and in maintaining HSC function. (2) Loss of Srcap is associated with evidence of increased DNA damage and transcriptional upregulation of the p53 pathway.

HTT
Also flagged:Huntington's diseaseHDPDneurodegenerative diseasedeathautosomal
Journal Article 2024-08-18 ✓ 5 Snippets Gao L, Bhattacharyya A, Beers B, Kaushik D, Bredlau AL, Kristensen A, Abd-Elaziz K, Grant R, Golden L, Kong R.
In-Text Gene Mentions

<h4>Aims</h4>PTC518 is an orally administered, centrally and peripherally distributed huntingtin (HTT) pre-mRNA splicing modifier being developed for the treatment of Huntington's disease (HD) for which there is a high unmet medical need as there are currently no approved disease-modifying treatments.

…distributed huntingtin (HTT) pre‐mRNA splicing…

…decrease in systemicHTTmRNA and HTT…

…HTT mRNA andHTTprotein levels.…

…huntingtin gene (HTT), which results…

Show Full Abstract

<h4>Aims</h4>PTC518 is an orally administered, centrally and peripherally distributed huntingtin (HTT) pre-mRNA splicing modifier being developed for the treatment of Huntington's disease (HD) for which there is a high unmet medical need as there are currently no approved disease-modifying treatments. This first-in-human study investigated the safety, tolerability, pharmacokinetics (PK), and pharmacodynamics (PD) of PTC518 in healthy volunteers.<h4>Methods</h4>This phase 1, single-centre, randomized study in 77 healthy male and female volunteers evaluated the safety and tolerability and PK of PTC518 following single ascending doses and multiple ascending doses, PD as assessed by HTT mRNA and HTT protein levels after single and multiple doses, and food effects.<h4>Results</h4>PTC518 demonstrated a favourable safety profile. The majority of treatment-emergent adverse events were mild and transient. PTC518 T<sub>max</sub> was reached at 6-7 h and the terminal T<sub>1/2</sub> was 54.0-75.3 h following a single oral dose. Exposure increased with dose though less than dose proportionally. The PTC518 concentrations in cerebrospinal fluid were approximately 2.6-fold higher than the unbound free-drug concentrations in plasma. A significant dose-dependent reduction of up to approximately 60% in HTT mRNA and a significant dose-dependent, time-dependent and sustained reduction in HTT protein levels of up to 35% were observed after PTC518 treatment.<h4>Conclusions</h4>PTC518 was well tolerated, and proof of mechanism of this novel splicing modifier was demonstrated by the dose-dependent decrease in systemic HTT mRNA and HTT protein levels. Results from this first-in-human study support further studies in patients with HD and demonstrate the potential for PTC518 as a breakthrough treatment for HD.

STAU1
Also flagged:SNX5Oral squamous cell carcinomaOSCCcancerpathogenesisADAM10
Journal Article 2024-08-18 ✓ 5 Snippets Chen YT, Tsai HJ, Kan CH, Ma CP, Chen HW, Chang IY, Liu H, Wu CC, Chu WY, Wu YC, Chang KP, Yu JS, Tan BC.
In-Text Gene Mentions

…the RNA-binding proteinSTAU1.…

STAU1protein delivers negatively…

…Previously, we identifiedSTAU1protein as a…

…assessed ADAR1 andSTAU1’s regulation on circSNX5.…

…However,STAU1knockdown markedly enhanced…

Show Full Abstract

Oral squamous cell carcinoma (OSCC) is a prevalent cancer worldwide, exhibiting unique regional prevalence. Despite advancements in diagnostics and therapy, the 5-year survival rate for patients has seen limited improvement. A deeper understanding of OSCC pathogenesis, especially its molecular underpinnings, is essential for improving detection, prevention, and treatment. In this context, noncoding RNAs, such as circular RNAs (circRNAs), have gained recognition as crucial regulators and potential biomarkers in OSCC progression. Our study highlights the discovery of previously uncharacterized circRNAs, including a SNX5 gene-derived circRNA, circSNX5, through deep sequencing of OSCC patient tissue transcriptomes. We established circSNX5's tumor-specific expression and its strong correlation with patient survival using structure-specific and quantitative PCR analyses. In vitro and in vivo experiments underscored circSNX5 RNA's regulatory role in cancer growth and metastasis. Further, our omics profiling and functional assays revealed that ADAM10 is a critical effector in circSNX5-mediated cancer progression, with circSNX5 maintaining ADAM10 expression by sponging miR-323. This novel circRNA-miRNA-mRNA regulatory axis significantly contributes to oral cancer progression and malignancy. Moreover, we discovered that circSNX5 RNA is produced via noncanonical sequential back-splicing of pre-mRNA, a process negatively regulated by the RNA-binding protein STAU1. This finding adds a new dimension to our understanding of exonic circRNA biogenesis in the eukaryotic transcriptome. Collectively, our findings offer a detailed mechanistic dissection and functional interpretation of a novel circRNA, shedding light on the role of the noncoding transcriptome in cancer biology and potentially paving the way for innovative therapeutic strategies.

HTT
Also flagged:deathglutamineaxonallysinesHDneurodegenerative diseases
Journal Article 2024-08-18 ✓ 5 Snippets Boulos A, Maroun D, Ciechanover A, Ziv NE.
In-Text Gene Mentions

…domain of Huntingtin (Htt), a very large…

…proteomic comparisons ofHttubiquitination profiles in…

…but not wild-typeHtt, is selectively ubiquitinated…

…segment encoded byHTTexon 1 35…

…observations that WTHttdegradation rates are…

Show Full Abstract

Huntington's disease (HD) is caused by a glutamine repeat expansion in the protein huntingtin. Mutated huntingtin (mHtt) forms aggregates whose impacts on neuronal survival are still debated. Using weeks-long, continual imaging of cortical neurons, we find that mHtt is gradually sequestrated into peripheral, mainly axonal aggregates, concomitant with dramatic reductions in cytosolic mHtt levels and enhanced neuronal survival. in-situ pulse-chase imaging reveals that aggregates continually gain and lose mHtt, in line with these acting as mHtt sinks at equilibrium with cytosolic pools. Mutating two N-terminal lysines found to be ubiquitinated in HD animal models suppresses peripheral aggregate formation and reductions in cytosolic mHtt, promotes nuclear aggregate formation, stabilizes aggregates and leads to pervasive neuronal death. These findings demonstrate the capacity of aggregates formed at peripheral locations to sequester away cytosolic, presumably toxic mHtt forms and support a crucial role for N-terminal ubiquitination in promoting these processes and delaying neuronal death.

OLFM4
Also flagged:regulation ofgene expressiontissue homeostasisH2A.Zlocalizationprogenitor cells proliferation
Journal Article 2024-08-18 ✓ 4 Snippets Rispal J, Rives C, Jouffret V, Leoni C, Dubois L, Chevillard-Briet M, Trouche D, Escaffit F.
In-Text Gene Mentions

…ogranin-A (#251190, Abbiotec),Olfm4(#39141, Cell Signaling…

…stem cell markerOlfm4.…

…a decrease ofOlfm4staining in double…

…markers Lgr5 andOlfm4mRNA ( Supplementary…

Show Full Abstract

The histone variant H2A.Z plays important functions in the regulation of gene expression. In mammals, it is encoded by two genes, giving rise to two highly related isoforms named H2A.Z.1 and H2A.Z.2, which can have similar or antagonistic functions depending on the promoter. Knowledge of the physiopathological consequences of such functions emerges, but how the balance between these isoforms regulates tissue homeostasis is not fully understood. Here, we investigated the relative role of H2A.Z isoforms in intestinal epithelial homeostasis. Through genome-wide analysis of H2A.Z genomic localization in differentiating Caco-2 cells, we uncovered an enrichment of H2A.Z isoforms on the bodies of genes which are induced during enterocyte differentiation, stressing the potential importance of H2A.Z isoforms dynamics in this process. Through a combination of in vitro and in vivo experiments, we further demonstrated the two isoforms cooperate for stem and progenitor cells proliferation, as well as for secretory lineage differentiation. However, we found that they antagonistically regulate enterocyte differentiation, with H2A.Z.1 preventing terminal differentiation and H2A.Z.2 favoring it. Altogether, these data indicate that H2A.Z isoforms are critical regulators of intestine homeostasis and may provide a paradigm of how the balance between two isoforms of the same chromatin structural protein can control physiopathological processes.

SUDS3
Also flagged:MethylationHistone3 lysine 4chromatinhistone methyltransferasescell differentiation
Journal Article 2024-08-18 ✓ 1 Snippet Yu H, Lesch BJ.
In-Text Gene Mentions

polycomb repressive

Show Full Abstract

Histone 3 lysine 4 methylation (H3K4me) is a highly evolutionary conserved chromatin modification associated with active transcription, and its three methylation states-mono, di, and trimethylation-mark distinct regulatory elements. However, whether H3K4me plays functional roles in transcriptional regulation or is merely a by-product of histone methyltransferases recruited to actively transcribed loci is still under debate. Here, we outline the studies that have addressed this question in yeast, <i>Drosophila</i>, and mammalian systems. We review evidence from histone residue mutation, histone modifier manipulation, and epigenetic editing, focusing on the relative roles of H3K4me1 and H3K4me3. We conclude that H3K4me1 and H3K4me3 may have convergent functions in establishing open chromatin and promoting transcriptional activation during cell differentiation.

SOX6
Also flagged:chromosomeTIMP3SYN3FBXO7BPIFCRTCB
Journal Article 2024-08-18 ✓ 1 Snippet Park J.
In-Text Gene Mentions

…TheSOX6gene on SSC2,…

Show Full Abstract

<h4>Objective</h4>The objective of this study was to identify genomic regions and candidate genes associated with the total number of piglets born (TNB), number of piglets born alive (NBA), and total number of stillbirths (TNS) in Berkshire pigs.<h4>Methods</h4>This study used a total of 11,228 records and 2,843 single-nucleotide polymorphism (SNP) data obtained from Illumina porcine 60 K and 80 K chips. The estimated genomic breeding values (GEBVs) and SNP effects were estimated using weighted single-step genomic BLUP (WssGBLUP).<h4>Results</h4>The heritabilities of the TNB, NBA, and TNS were determined using single-step genomic best linear unbiased prediction (ssGBLUP). The heritability estimates were 0.13, 0.12, and 0.015 for TNB, NBA, and TNS, respectively. When comparing the accuracy of breeding value estimates, the results using pedigree-based BLUP (PBLUP) were 0.58, 0.60, and 0.31 for TNB, NBA, and TNS, respectively. In contrast, the accuracy increased to 0.67, 0.66, and 0.42 for TNB, NBA, and TNS, respectively, when using WssGBLUP, specifically in the last three iterations. The results of weighted single-step genome-wide association studies (WssGWAS) showed that the highest variance explained for each trait was predominantly located in the Sus scrofa chromosome 5 (SSC5) region. Specifically, the variance exceeded 4% for TNB, 3% for NBA, and 6% for TNS. Within the SSC5 region (12.26 to 12.76 Mb), which exhibited the highest variance for TNB, 20 SNPs were identified, and five candidate genes were identified: TIMP3, SYN3, FBXO7, BPIFC, and RTCB.<h4>Conclusion</h4>The identified SNP markers for TNB, NBA, and TNS were expected to provide valuable information for genetic improvement as an understanding of their expression and genetic architecture in Berkshire pigs. With the accumulation of more phenotype and SNP data in the future, it is anticipated that more effective SNP markers will be identified.

TNFSF4
Also flagged:Cell DegranulationRituximabcancerantibodycytotoxicityantibodies
Journal Article 2024-08-18 ✓ 5 Snippets Wlodarczyk M, Torun A, Zerrouqi A, Pyrzynska B.
In-Text Gene Mentions

…the KIT andTNFSF4genes were strongly…

…S1PR5 , andTNFSF4.…

…KIT andTNFSF4Genes Are Down-Regulated…

…of KIT andTNFSF4mRNAs using qRT-PCR,…

…the KIT andTNFSF4genes.…

Show Full Abstract

A promising strategy in cancer immunotherapy is to restore or enhance the cytotoxicity of NK cells, among others, by activating the mechanism of antibody-dependent cellular cytotoxicity (ADCC). Monoclonal antibodies targeting tumor antigens, such as rituximab (targeting CD20), induce NK cell-mediated ADCC and have been used to treat B cell malignancies, such as non-Hodgkin lymphoma, but not always successfully. The aim of this study was to analyze the gene expression profile of the NK cells involved in the cytolytic response stimulated by rituximab. NK cells were co-cultured with rituximab-opsonized Raji cells. Sorting into responder and non-responder groups was based on the presence of CD107a, which is a degranulation marker. RNA-seq results showed that the <i>KIT</i> and <i>TNFSF4</i> genes were strongly down-regulated in the degranulating population of NK cells (responders); this was further confirmed by qRT-PCR. Both genes encode surface proteins with cellular signaling abilities, namely c-KIT and the OX40 ligand. Consistent with our findings, c-KIT was previously reported to correlate inversely with cytokine production by activated NK cells. The significance of these findings for cancer immunotherapy seems essential, as the pharmacological inhibition of c-KIT and OX40L, or gene ablation, could be further tested for the enhancement of the anti-tumor activity of NK cells in response to rituximab.

HTT
Also flagged:Dementiasystemic diseasesneurodegenerative diseaselate-onset dyskinesiaOral infectionscognitive decline
Journal Article 2024-08-18 ✓ 1 Snippet Minelli M, Anaclerio F, Calisi D, Onofrj M, Antonucci I, Gatta V, Stuppia L.
In-Text Gene Mentions

…repeats in theHTTgene.…

Show Full Abstract

(1) Background: The study of the microbiome is crucial for its role in major systemic diseases, in particular the oral and gut microbiota. In recent years, the study of microorganisms correlated, for example, with neurodegenerative disease has increased the prospect of a possible link between gut microbiota and the brain. Here, we report a new case concerning a patient who was initially evaluated genetically for dementia and late-onset dyskinesia, and later tested with 16S metagenomics sequencing. (2) Methods: Starting from a buccal swab, we extracted bacterial DNA and then we performed NGS metagenomics sequencing based on the amplification of the hypervariable regions of the 16S rRNA gene in bacteria. (3) Results: The sequencing revealed the presence of the <i>Spirochaetes</i> phylum, a pathogenic bacterium generally known to be capable of migrating to the Central Nervous System. (4) Conclusions: Oral infections, as our results suggest, could be possible contributing factors to various neurodegenerative conditions.

SERPINC1
Also flagged:COVID-19anosmiabehavioralSARS-CoV-2 infectioninfectionsacute infection
Journal Article 2024-08-17 ✓ 1 Snippet Kausel L, Figueroa-Vargas A, Zamorano F, Stecher X, Aspé-Sánchez M, Carvajal-Paredes P, Márquez-Rodríguez V, Martínez-Molina MP, Román C, Soto-Fernández P, Valdebenito-Oyarzo G, Manterola C, Uribe-San-Martín R, Silva C, Henríquez-Ch R, Aboitiz F, Polania R, Guevara P, Muñoz-Venturelli P, Soto-Icaza P, Billeke P.
In-Text Gene Mentions

ACE-IIIevaluation showed that…

Show Full Abstract

Patients recovering from COVID-19 commonly exhibit cognitive and brain alterations, yet the specific neuropathological mechanisms and risk factors underlying these alterations remain elusive. Given the significant global incidence of COVID-19, identifying factors that can distinguish individuals at risk of developing brain alterations is crucial for prioritizing follow-up care. Here, we report findings from a sample of patients consisting of 73 adults with a mild to moderate SARS-CoV-2 infection without signs of respiratory failure and 27 with infections attributed to other agents and no history of COVID-19. The participants underwent cognitive screening, a decision-making task, and MRI evaluations. We assessed for the presence of anosmia and the requirement for hospitalization. Groups did not differ in age or cognitive performance. Patients who presented with anosmia exhibited more impulsive alternative changes after a shift in probabilities (r =  - 0.26, p = 0.001), while patients who required hospitalization showed more perseverative choices (r = 0.25, p = 0.003). Anosmia correlated with brain measures, including decreased functional activity during the decision-making task, thinning of cortical thickness in parietal regions, and loss of white matter integrity. Hence, anosmia could be a factor to be considered when identifying at-risk populations for follow-up.

DCC
Also flagged:angiogenesiswound healingmenstruationmiscarriagepregnancy disorderspreeclampsia
Journal Article 2024-08-17 ✓ 1 Snippet Raja Xavier JP, Okumura T, Apweiler M, Chacko NA, Singh Y, Brucker SY, Takeda S, Lang F, Salker MS.
In-Text Gene Mentions

…cells/well with 10%DCC-FBS/DMEM and allowed to…

Show Full Abstract

After menstruation the uterine spiral arteries are repaired through angiogenesis. This process is tightly regulated by the paracrine communication between endometrial stromal cells (EnSCs) and endothelial cells. Any molecular aberration in these processes can lead to complications in pregnancy including miscarriage or preeclampsia (PE). Placental growth factor (PlGF) is a known contributing factor for pathological angiogenesis but the mechanisms remain poorly understood. In this study, we investigated whether PlGF contributes to pathological uterine angiogenesis by disrupting EnSCs and endothelial paracrine communication. We observed that PlGF mediates a tonicity-independent activation of nuclear factor of activated T cells 5 (NFAT5) in EnSCs. NFAT5 activated downstream targets including SGK1, HIF-1α and VEGF-A. In depth characterization of PlGF - conditioned medium (CM) from EnSCs using mass spectrometry and ELISA methods revealed low VEGF-A and an abundance of extracellular matrix organization associated proteins. Secreted factors in PlGF-CM impeded normal angiogenic cues in endothelial cells (HUVECs) by downregulating Notch-VEGF signaling. Interestingly, PlGF-CM failed to support human placental (BeWo) cell invasion through HUVEC monolayer. Inhibition of SGK1 in EnSCs improved angiogenic effects in HUVECs and promoted BeWo invasion, revealing SGK1 as a key intermediate player modulating PlGF mediated anti-angiogenic signaling. Taken together, perturbed PlGF-NFAT5-SGK1 signaling in the endometrium can contribute to pathological uterine angiogenesis by negatively regulating EnSCs-endothelial crosstalk resulting in poor quality vessels in the uterine microenvironment. Taken together the signaling may impact on normal trophoblast invasion and thus placentation and, may be associated with an increased risk of complications such as PE.

HFE
Also flagged:NeonatalHypoxic-Ischemic EncephalopathyNeonatal hypoxic-ischemic encephalopathyHIECatalaseCAT
Journal Article 2024-08-17 ✓ 1 Snippet Aycan N, Çay Demir D, Yürektürk E, Başaranoğlu M, Karaman S, Tuncer O.
In-Text Gene Mentions

…such as emphysema,hemochromatosis, acquired immunodeficiency sy…

Show Full Abstract

BACKGROUND Neonatal hypoxic-ischemic encephalopathy (HIE) is a significant cause of perinatal and postnatal morbidity and mortality worldwide. Catalase (CAT) activity detection is used to determine levels of inflammation and oxidative stress. Glutathione (GSH) is the most critical non-enzymatic endogenous antioxidant. Lipid peroxidation levels marked after hypoxia can be detected based on the level of malondialdehyde (MDA). Ischemia-modified albumin (IMA) is considered a biomarker for cardiac ischemia and is known to increase in the liver, brain, and kidney in states of insufficient oxygenation. We aimed to explain the results and relations between the oxidant and antioxidants to detail oxidant-antioxidant balance and cellular mechanisms. MATERIAL AND METHODS Serum levels of IMA and MDA, as an oxidative stress marker, and CAT and GSH, as antioxidant enzymes, were measured in first blood samples of 59 neonates diagnosed with HIE, with pH <7, base excess >12, and APGAR scores. RESULTS Neonates who were ≥37 weeks of gestation and had hypoxia were included. Compared with healthy newborns (n=32), CAT was statistically significantly lower in the hypoxia group (P=0.0001), while MDA serum levels were significantly higher in neonates with hypoxia (P=0.01). There was no difference between hypoxic and healthy neonates in GSH and IMA measurements (P=0.054, P=0.19 respectively). CONCLUSIONS HIE pathophysiology involves oxidative stress and mitochondrial energy production failure. Explaining the pathways between oxidant-antioxidant balance and cell death, which explains the pathophysiology of HIE, is essential to develop treatment strategies that will minimize the effects of oxygen deprivation on other body organs, especially the brain.

SOX6
Also flagged:NucleusAlzheimer's DiseaseADneurodegenerative diseaseGene ExpressionCapping Protein Regulator And Myosin 1 linker 1
Journal Article 2024-08-17 ✓ 1 Snippet Lu M, Li J, Huang Q, Mao D, Yang G, Lan Y, Zeng J, Pan M, Shi S, Zou D.
In-Text Gene Mentions

…Transcription Factor 6 (SOX6)<sup>+</sup> inhibitory neuro…

Show Full Abstract

Alzheimer's disease (AD) is a neurodegenerative disease with a projected significant increase in incidence. Therefore, this study analyzed single-nucleus AD data to provide a theoretical basis for the clinical development and treatment of AD. We downloaded AD-related monocyte data from the Gene Expression Omnibus database, annotated cells, compared cell abundance between groups, and investigated glial and neuronal cell biological processes and pathways through functional enrichment analysis. Furthermore, we constructed a global regulatory network for AD based on cell communication and ecological analyses. Our findings revealed increased abundance of Capping Protein Regulator And Myosin 1 linker 1 (CARMIL1)<sup>+</sup> astrocytes (AST), Immunoglobulin Superfamily Member 21 (IGSF21)<sup>+</sup> microglia (MIC), SRY-Box Transcription Factor 6 (SOX6)<sup>+</sup> inhibitory neurons (InNeu), and laminin alpha-2 chain (LAMA2)<sup>+</sup> oligodendrocytes (OLI) cell subgroups in tissues of patients with AD, while prostaglandin D2 synthase (PTGDS)<sup>+</sup> AST, Src Family Tyrosine Kinase (FYN)<sup>+</sup> MIC, and Proteolipid Protein 1 (PLP1)<sup>+</sup> InNeu subgroups specifically decreased. We found that the cell phenotype of patients with AD shifted from a simpler to a more complex state compared to the control group. Cell communication analysis revealed strong communication between MIC and NEU. Furthermore, AST, MIC, NEU, and OLI were involved in oxidative stress- and inflammation-related pathways, potentially contributing to disease development. This study provides a theoretical basis for further exploring the specific mechanisms underlying AD.

MLLT10
Also flagged:tooth agenesiscleft lipcleftcleft lip and palatecleft palatepalate
Journal Article 2024-08-17 ✓ 1 Snippet Aung WP, Pungchanchaikul P, Pisek A, Bloch-Zupan A, Morkmued S.
In-Text Gene Mentions

…, Inpp5e ,Mllt10, Ncor2 ,…

Show Full Abstract

<h4>Background</h4>Pattern of dental anomalies encountered in cleft patients shows subtle signs of genetic involvement. This study aimed to evaluate the prevalence and pattern of tooth agenesis and supernumerary teeth in Thai cleft population according to the cleft type.<h4>Methods</h4>Data collected from patients with cleft lip and palate, who had been treated at Tawanchai Cleft Center, Khon Kaen University, Thailand, available during year 2012-2022, were investigated. Records from 194 patients with non-syndromic clefts met the inclusion criteria. Standard dental records, and at least either orthopantomogram (OPG) or cone beam computed tomography (CBCT), were examined. Statistical analysis was performed using chi-square and binominal test (p ≤ 0.05).<h4>Results</h4>Prevalence of tooth agenesis was higher (77.3%) than that of supernumerary teeth (5.7%) and was more common in bilateral cleft lip and palate (BCLP) (88.1%) than in unilateral cleft lip and palate (UCLP) (72.6%) (p = 0.017). The upper lateral incisor was more frequently affected (46.4%), followed by the upper second premolar. The number of missing teeth observed on the left side was significantly higher. Patients with left UCLP (ULCLP) had the highest prevalence of tooth agenesis. A total of 41 tooth agenesis code (TAC) patterns was found. The prevalence of supernumerary teeth was comparable with 6.6% of ULCLP, 5.1% of BCLP, and 4.5% of URCLP. Tooth-number anomalies were observed more often in the BCLP and were most likely to occur on the left side of the maxilla. Both types of anomalies could be featured in a small proportion of cleft patients.<h4>Conclusions</h4>More than half of the patients with non-syndromic cleft lip and palate in this study, presented with tooth-number anomalies. Tooth agenesis was approximately 10-time more prevalent than supernumerary teeth. Tooth agenesis was likely to appear on the left-side of the maxilla regardless of the laterality of the cleft.

ZNFX1
Also flagged:reverse transcriptasetelomerescell proliferationprostate cancertumorZW10
Journal Article 2024-08-17 ✓ 1 Snippet Liu D, Qin Z, Yi B, Xie H, Liang Y, Zhu L, Yang K, Xu Y, Zhang H.
In-Text Gene Mentions

…1% for CDKN1B,ZNFX1, ABL1, AKT1, EGF,…

Show Full Abstract

<h4>Background</h4>Prostate cancer ranks among the six most lethal malignancies worldwide. Telomerase, a reverse transcriptase enzyme, plays a pivotal role in extending cellular telomeres and is intimately associated with cell proliferation and division. However, the interconnection between prostate cancer and telomerase-related genes (TEASEs) remains unclear.<h4>Methods</h4>Somatic mutations and copy number alterations of TEASEs were comprehensively analyzed. Subsequently, the transcripts of prostate cancer patients in TCGA and GEO databases were integrated to delineate new molecular subtypes. Followed by constructing a risk model containing nine characteristic genes through Lasso regression and Cox prognostic analysis among different subtypes. Various aspects including prognosis, tumor microenvironment (TME), landscape of immunity, tumor mutational burden (TMB), stem cell correlation, and median inhibitory concentration amongst different risk groups were compared. Finally, the expression, prognosis, and malignant biological behavior of ZW10 interactor (ZWINT) in vitro was explored.<h4>Results</h4>TEASEs exhibited a notably high mutation frequency. Three distinct molecular subtypes and two gene subclusters based on TEASEs were delineated, displaying significant associations with prognosis, immune function regulation, and clinical characteristics. Low-risk patients demonstrated superior prognosis and better response to immunotherapy. Conversely, high-risk patients exhibited higher TMB and stronger stem cell correlations. It was also found that the patients' sensitivity to chemotherapy agents was impacted by the risk score. Finally, ZWINT's potential as a novel diagnostic and prognostic biomarker for prostate cancer was validated.<h4>Conclusions</h4>TEASEs play a pivotal role in modulating immune regulation and immunotherapeutic responses, thereby significantly impacting the diagnosis, prognosis, and treatment strategies for affected patients.

BTN3A3
Also flagged:prostate cancerPCacancerdeathPPP1R3ATG
Journal Article 2024-08-17 ✓ 1 Snippet Feng BJ, Boyle JL, Wei J, Carroll C, Snyder NA, Shi Z, Zheng SL, Xu J, Isaacs WB, Cooney KA.
In-Text Gene Mentions

…TG, PPFIBP2, andBTN3A3) were selected as…

Show Full Abstract

<h4>Background</h4>Recent advances in the detection and treatment of prostate cancer (PCa) have reduced morbidity and mortality from this common cancer. Despite these improvements, PCa remains the second leading cause of cancer death in men in the United States. Further understanding of the genetic underpinnings of lethal PCa is required to drive risk detection and prevention and ultimately reduce mortality. We therefore set out to identify germline variants associated with cases of lethal prostate cancer (LPCa).<h4>Methods</h4>Using a two-stage study design, we compared whole-exome sequencing data of 550 LPCa patients to 488 healthy male controls. Men were classified as having LPCa based on medical record review. Candidate genes were identified using gene- and gene-set-based rare truncating variant association tests. Case-control burden testing through Firth's penalized logistic regression and case-gnomAD allelic burden testing through a one-sided mid-p Fisher's exact test were conducted. Each gene's p-values from these tests were combined into an omnibus p-value for candidate gene selection. In the subsequent validation stage, genes were assessed using the UK Biobank and Firth's penalized logistic regression for each ancestry, combined through meta-analysis.<h4>Results</h4>Gene-based rare variant association tests identified 12 genes nominally associated with LPCa. Rare-variant association tests identified a gene set with a significantly higher burden of truncating germline mutations in LPCa patients than controls. Combining gene- and gene-set test results, four nominally significant genes (PPP1R3A, TG, PPFIBP2, and BTN3A3) were selected as candidates. Subsequent validation using the UK Biobank found that PPP1R3A was significantly associated with LPCa risk (odds ratio 2.34, CI 1.20-4.59). Specifically, pGln662ArgfsTer7 was identified as the predominant variant in PPP1R3A among LPCa patients in our dataset.<h4>Conclusions</h4>Both individual gene and gene-set analyses identified candidates associated with LPCa. The novel association of PPP1R3A and LPCa risk merits further investigation.

HFE
Also flagged:type 2 diabetestype 2 diabetes mellitusmyocardial infarctionpermanent atrial fibrillationischemic strokehypertension
Journal Article 2024-08-17 ✓ 1 Snippet Mantovani A, Busti F, Borella N, Scoccia E, Pecoraro B, Sani E, Morandin R, Csermely A, Piasentin D, Grespan E, Castagna A, Bilson J, Byrne CD, Valenti L, Girelli D, Targher G.
In-Text Gene Mentions

…lasma ferritin concentrations,hemochromatosisand dilated cardiomyopathy…

Show Full Abstract

<h4>Background</h4>The effect of plasma hepcidin concentrations on the long-term risk of developing adverse cardiovascular outcomes in people with type 2 diabetes mellitus (T2DM) is unclear.<h4>Methods</h4>We followed for a median of 55.6 months 213 outpatients with established T2DM (45.5% women, mean age 69 ± 10 years; BMI 28.7 ± 4.7 kg/m<sup>2</sup>; median diabetes duration 11 years). Baseline plasma ferritin and hepcidin concentrations were measured with an electrochemiluminescence immunoassay and mass spectrometry-based assay, respectively. The primary study outcome was a composite of all-cause mortality or incident nonfatal cardiovascular events (inclusive of myocardial infarction, permanent atrial fibrillation, ischemic stroke, or new hospitalization for heart failure).<h4>Results</h4>42 patients developed the primary composite outcome over a median follow-up of 55.6 months. After stratifying patients by baseline hepcidin tertiles [1st tertile: median hepcidin 1.04 (IQR 0.50-1.95) nmol/L, 2nd tertile: 3.81 (IQR 3.01-4-42) nmol/L and 3rd tertile: 7.72 (IQR 6.37-10.4) nmol/L], the risk of developing the primary composite outcome in patients in the 3rd tertile was double that of patients in the 1st and 2nd tertile combined (unadjusted hazard ratio [HR] 2.32, 95%CI 1.27-4.26; p = 0.007). This risk was not attenuated after adjustment for age, sex, adiposity measures, smoking, hypertension, statin use, antiplatelet medication use, plasma hs-C-reactive protein and ferritin concentrations (adjusted HR 2.53, 95%CI 1.27-5.03; p = 0.008).<h4>Conclusions</h4>In outpatients with T2DM, higher baseline hepcidin concentrations were strongly associated with an increased long-term risk of overall mortality or nonfatal cardiovascular events, even after adjustment for established cardiovascular risk factors, plasma ferritin concentrations, medication use, and other potential confounders.

HFE
Also flagged:Ironiron disorderchronic metabolic diseasesenergy homeostasismitochondrialmitochondrial respiratory chain
Journal Article 2024-08-17 ✓ 5 Snippets Mai X, Liu Y, Fan J, Xiao L, Liao M, Huang Z, Chen Z, Huang S, Sun R, Jiang X, Huang L, Sun J, Xie L, Chen H.
In-Text Gene Mentions

…accumulation caused byHfedeficiency enhanced mitochondr…

…e.g., Tfr1 andHfe) are involved…

…Secondly, anHfe( Hfe −/−…

…an Hfe (Hfe−/− )-deficient mouse…

…Primary adipocyte fromHfe−/− mice exhibited…

Show Full Abstract

Iron homeostasis is essential for maintaining metabolic health and iron disorder has been linked to chronic metabolic diseases. Increasing thermogenic capacity in adipose tissue has been considered as a potential approach to regulate energy homeostasis. Both mitochondrial biogenesis and mitochondrial function are iron-dependent and essential for adipocyte thermogenic capacity, but the underlying relationships between iron accumulation and adipose thermogenesis is unclear. Firstly, we confirmed that iron homeostasis and the iron regulatory markers (e.g., Tfr1 and Hfe) are involved in cold-induced thermogenesis in subcutaneous adipose tissues using RNA-seq and bioinformatic analysis. Secondly, an Hfe (Hfe<sup>-/-</sup>)-deficient mouse model, in which tissues become overloaded with iron, was employed. We found iron accumulation caused by Hfe deficiency enhanced mitochondrial respiratory chain expression in subcutaneous white adipose in vivo and resulted in enhanced tissue thermogenesis with upregulation of PGC-1α and adipose triglyceride lipase, mitochondrial biogenesis and lipolysis. To investigate the thermogenic capacity in vitro, stromal vascular fraction from adipose tissues was isolated, followed with adipogenic differentiation. Primary adipocyte from Hfe<sup>-/-</sup> mice exhibited higher cellular oxygen consumption, associated with enhanced expression of mitochondrial oxidative respiratory chain protein, while primary adipocytes or stromal vascular fractions from WT mice supplemented with iron citrate) exhibited similar effect in thermogenic capacity. Taken together, these findings indicate iron supplementation and iron accumulation (Hfe deficiency) can regulate adipocyte thermogenic capacity, suggesting a potential role for iron homeostasis in adipose tissues.

Also flagged:colorectal cancersuperoxide dismutaseSODcatalaseCATglutathione peroxidase
Journal Article 2024-08-17 No Snippets Madej M, Kruszniewska-Rajs C, Kimsa-Dudek M, Synowiec-Wojtarowicz A, Chrobak E, Bębenek E, Boryczka S, Głuszek S, Adamska J, Kubica S, Matykiewicz J, Gola JM.
Show Full Abstract

Oxidative stress is considered one of the main reasons for the development of colorectal cancer (CRC). Depending on the stage of the disease, variable activity of the main antioxidant enzymes, i.e., superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx), is observed. Due to limited treatment methods for CRC, new substances with potential antitumor activity targeting pathways related to oxidative stress are currently being sought, with substances of natural origin, including betulin, leading the way. The betulin molecule is chemically modified to obtain new derivatives with improved pharmacokinetic properties and higher biological activity. The aim of this study was to evaluate the effects of betulin and its new derivatives on viability and major antioxidant systems in colorectal cancer cell lines. The study showed that betulin and its derivative EB5 affect the antioxidant enzyme activity to varying degrees at both the protein and mRNA levels. The SW1116 cell line is more resistant to the tested compounds than RKO, which may be due to differences in the genetic and epigenetic profiles of these lines.

Also flagged:CancersCancerCD47ciliumtumorpathogenesis
Journal Article 2024-08-17 No Snippets Dong K, Nihal R, Meyer TJ, Singh SP, Kaur S, Roberts DD.
Show Full Abstract

An association between high CD47 expression and poor cancer survival has been attributed to its function on malignant cells to inhibit phagocytic clearance. However, CD47 mRNA expression in some cancers lacks correlation or correlates with improved survival. <i>IFT57</i> encodes an essential primary cilium component and is colinear with <i>CD47</i> across amniote genomes, suggesting coregulation of these genes. Analysis of The Cancer Genome Atlas datasets identified <i>IFT57</i> as a top coexpressed gene with <i>CD47</i> among 1156 human cancer cell lines and in most tumor types. The primary cilium also regulates cancer pathogenesis, and correlations between IFT57 mRNA and survival paralleled those for CD47 in thyroid and lung carcinomas, melanoma, and glioma. CD47 ranked first for coexpression with IFT57 mRNA in papillary thyroid carcinomas, and higher expression of both genes correlated with significantly improved overall survival. CD47 and IFT57 mRNAs were coordinately regulated in thyroid carcinoma cell lines. Transcriptome analysis following knockdown of CD47 or IFT57 in thyroid carcinoma cells identified the cytoskeletal regulator CRACD as a specific target of IFT57. CRACD mRNA expression inversely correlated with IFT57 mRNA and with survival in low-grade gliomas, lung adenocarcinomas, and papillary thyroid carcinomas, suggesting that IFT57 rather than CD47 regulates survival in these cancers.

Also flagged:AlginateZinchydroxyapatitecarbonbiomineralizationcarbonate
Journal Article 2024-08-17 No Snippets Dornelas J, Dornelas G, Tude EMO, Mourão CF, Rossi ADM, Alves GG.
Show Full Abstract

The increasing demand for effective bone regeneration materials drives the exploration of biomaterials with enhanced bioactivity and biocompatibility, such as zinc-substituted compounds. This study investigates the in vitro cellular interactions with nanostructured spheres composed of alginate/carbonated hydroxyapatite (CHA), compared to zinc-substituted CHA (ZnCHA). This work aimed to compare the physicochemical properties and biological effects of ZnCHA and CHA on osteoblasts. ZnCHA was synthesized using a wet chemical method, followed by characterization through X-ray diffraction, Fourier transform infrared spectroscopy, total organic carbon analysis, Wavelength-dispersive X-ray spectroscopy, and BET surface area analysis to assess ion release and structural changes. Biological evaluation was conducted using cell viability, proliferation, and biomineralization assays on osteoblasts. Results showed successful incorporation of zinc and carbonate, leading to reduced crystallinity and increased surface area. Cell viability and proliferation assays indicated ZnCHA's cytocompatibility and enhanced osteoblastic activity, with increased mineralization nodules compared to CHA samples. The study concludes that ZnCHA composites are promising candidates for bone tissue engineering, demonstrating improved cytocompatibility and potential for further preclinical evaluations.

Also flagged:reverse transcriptionchromosomegermlineinfectionhost cellsinnate immunity
Journal Article 2024-08-17 No Snippets Jarosz AS, Halo JV.
Show Full Abstract

Endogenous retroviruses (ERVs) are the remnants of retroviral germline infections and are highly abundant in the genomes of vertebrates. At one time considered to be nothing more than inert 'junk' within genomes, ERVs have been tolerated within host genomes over vast timescales, and their study continues to reveal complex co-evolutionary histories within their respective host species. For example, multiple instances have been characterized of ERVs having been 'borrowed' for normal physiology, from single copies to ones involved in various regulatory networks such as innate immunity and during early development. Within the cell, the accessibility of ERVs is normally tightly controlled by epigenetic mechanisms such as DNA methylation or histone modifications. However, these silencing mechanisms of ERVs are reversible, and epigenetic alterations to the chromatin landscape can thus lead to their aberrant expression, as is observed in abnormal cellular environments such as in tumors. In this review, we focus on ERV transcriptional control and draw parallels and distinctions concerning the loss of regulation in disease, as well as their precise regulation in early development.

MMS22L
Also flagged:Cas9centriolePolo-like Kinase 4Plk4CRISPRCas9 endonuclease
Journal Article 2024-08-17 ✓ 1 Snippet Ryniawec JM, Amoiroglou A, Rogers GC.
In-Text Gene Mentions

…Asterless (Asl) andPericentrin-like ProteinProtein (Plp) (…

Show Full Abstract

CRISPR/Cas9 genome editing is a pervasive research tool due to its relative ease of use. However, some systems are not amenable to generating edited clones due to genomic complexity and/or difficulty in establishing clonal lines. For example, <i>Drosophila</i> Schneider 2 (S2) cells possess a segmental aneuploid genome and are challenging to single-cell select. Here, we describe a streamlined CRISPR/Cas9 methodology for knock-in and knock-out experiments in S2 cells, whereby an antibiotic resistance gene is inserted in-frame with the coding region of a gene-of-interest. By using selectable markers, we have improved the ease and efficiency for the positive selection of null cells using antibiotic selection in feeder layers followed by cell expansion to generate clonal lines. Using this method, we generated the first acentrosomal S2 cell lines by knocking-out centriole genes Polo-like Kinase 4/Plk4 or Ana2 as proof of concept. These strategies for generating gene-edited clonal lines will add to the collection of CRISPR tools available for cultured <i>Drosophila</i> cells by making CRISPR more practical and therefore improving gene function studies.

Also flagged:Sickle cell anemiahereditary diseaseHb Ftranscription factorsHbBCL11A
Journal Article 2024-08-17 No Snippets Santos GPD, Rabi LT, Bezerra AA, da Cunha MR, Iatecola A, Fernandes VAR.
Show Full Abstract

Sickle cell anemia is a hereditary disease caused by sickle-shaped red blood cells that can lead to vaso-occlusive crises. Treatment options are currently limited, highlighting the need to develop new clinical approaches. Studies demonstrated that elevated levels of fetal hemoglobin (Hb F) are associated with a reduction of mortality and morbidity in sickle cell anemia patients. In light of this, researchers have been trying to elucidate the transcriptional regulation of Hb F to develop new therapeutic interventions. The present study aimed to present the main transcription factors of Hb F and discuss the clinical feasibility of these molecular targets. Two search strategies were used in the PubMed, SciELO, and LILACS databases between July and August 2023 to conduct this review. Manual searches were also conducted by checking references of potentially eligible studies. Eligibility criteria consisted of clinical trials and cohort studies from the last five years that investigated transcription factors associated with Hb F. The transcription factors investigated in at least four eligible studies were included in this review. As a result, 56 eligible studies provided data on the BCL11A, LRF, NF-Y, GATA1, KLF1, HRI, ATF4, and MYB factors. The studies demonstrated that Hb F is cooperatively regulated by transcription factors with the BCL11A factor appearing to be the most specific target gene for γ-globin induction. Although these data are promising, there are still significant gaps and intervention limitations due to the adverse functions of the target genes. New studies that clarify the aspects and functionalities of Hb F regulators may enable new clinical approaches for sickle cell anemia patients.

DCC
Also flagged:cysticercosiscysticercidistal cholangiocarcinomaanemiasteroidscarbamazepine
Journal Article 2024-08-17 ✓ 2 Snippets Poudel B, Dahal A, Rayamajhi A, Ghimire P, Roy A, Paudel S, Luitel P.
In-Text Gene Mentions

…the syndrome ofDCC[ 2 ].…

…a case ofDCCinvolving the skin,…

Show Full Abstract

Cysticercosis, a major health issue in developing countries, is caused by the larval stage of <i>Taenia solium</i>. Disseminated cysticercosis (DCC), which is characterized by widespread cysticerci in various tissues, is rare and often asymptomatic. Here, we report the case of a 50-year-old man from rural Nepal with distal cholangiocarcinoma and DCC involving the skin, brain, orbit, tongue, soft palate, heart, and abdominal organs. Despite the presence of abdominal pain, obstructive jaundice, anemia, and significant weight loss-symptoms indicative of biliary malignancy-there were no symptoms typical of DCC. Diagnostic imaging confirmed DCC and stomach-preserving pancreaticoduodenectomy was performed. Histopathological examination of the periampullary mass revealed distal cholangiocarcinoma. Postsurgical treatment for DCC included steroids, carbamazepine, and antiparasitic therapy with albendazole. The coexistence of cysticercosis and neoplasia, though uncommon, necessitates thorough diagnostic evaluation. This case underscores the clinical complexity and highlights the need for comprehensive management of concurrent conditions.

TNFSF4
Also flagged:MMP13coppermetabolismBreast cancerUBE2D2SLC31A1
Journal Article 2024-08-17 ✓ 1 Snippet Han C, Feng Z, Wang Y, Hu M, Xu S, Jiang F, Han Y, Liu Z, Li Y.
In-Text Gene Mentions

…as MICA, CD276,TNFSF4, VEGFA, and EDNRB)…

Show Full Abstract

<h4>Objectives</h4>To comprehensively analyze the copper metabolism in Breast cancer, we established a prognostic signature for breast cancer (BC) related to copper metabolism.<h4>Methods</h4>Copper metabolism-related genes were sourced from previous literatures and were selected by the Univariate Cox regression. Cu-enrichment scores were calculated via ssGSEA. Differentially expressed genes were identified with limma between high and low Cu-enrichment scores group, then we used the Random Survival Forest and LASSO to build the CuScore for BC. Kaplan-Meier analysis, ROC curves, and Cox regression were used to evaluate CuScore. Genomic mutations were analyzed with GISTIC. Immune cells were examined using ESTIMATE, ssGSEA and TIMER. Enrichment analysis used clusterProfiler and GSVA. The GDSC database and oncoPredict package analyzed chemotherapeutic sensitivity. MMP13 was selected for in vitro assays.<h4>Results</h4>Four copper metabolism-related genes (UBE2D2, SLC31A1, ATP7A, and MAPK1) with prognostic value were identified. Higher expression levels of these genes were associated with higher Cu-enrichment scores, a factor of malignancy in breast cancer. Among 115 differentially expressed genes, 19 prognostic genes were identified, with three (CEACAM5, MMP13, and CRISP3) highlighted by Random Survival Forest and LASSO. Higher CuScores correlated with worse prognoses and were effective in predicting breast cancer outcomes. CuScore and metastasis were independent prognostic factors. Tumor-infiltrating immune cells were associated with lower CuScores. GO-GSEA analysis indicated six immune-related pathways might be regulated by CuScore. Patients with higher CuScores had lower TMB and were more sensitive to Sapitinib and LCL161, while those with lower CuScores might respond better to anti-PD1 therapy. High MMP13 expression in breast cancer was linked to malignancy, affecting cell proliferation and migration.<h4>Conclusion</h4>The identified copper metabolism-related gene signature has the potential to predict prognosis and guide clinical treatment for BC. Among these genes, MMP13 may act as a malignant factor in BC.

OLFM4
Also flagged:ARID3Atranscription factorcell proliferationTGF-βWNTbinding
Journal Article 2024-08-16 ✓ 3 Snippets Angelis N, Baulies A, Hubl F, Kucharska A, Kelly G, Llorian M, Boeing S, Li VSW.
In-Text Gene Mentions

…(REF 312171), andOlfm4(REF 311831).…

…stem cell-specific markerOlfm4was enriched at…

…the ISC-specific markerOlfm4between WT and…

Show Full Abstract

Intestinal stem cells at the crypt divide and give rise to progenitor cells that proliferate and differentiate into various mature cell types in the transit-amplifying (TA) zone. Here, we showed that the transcription factor ARID3A regulates intestinal epithelial cell proliferation and differentiation at the TA progenitors. ARID3A forms an expression gradient from the villus tip to the upper crypt mediated by TGF-β and WNT. Intestinal-specific deletion of Arid3a reduces crypt proliferation, predominantly in TA cells. Bulk and single-cell transcriptomic analysis shows increased enterocyte and reduced secretory differentiation in the Arid3a cKO intestine, accompanied by enriched upper-villus gene signatures of both cell lineages. We find that the enhanced epithelial differentiation in the Arid3a-deficient intestine is caused by increased binding and transcription of HNF1 and HNF4. Finally, we show that loss of Arid3a impairs irradiation-induced regeneration with sustained cell death and reprogramming. Our findings imply that Arid3a functions to fine-tune the proliferation-differentiation dynamics at the TA progenitors, which are essential for injury-induced regeneration.

PEBP1
Also flagged:renal cell carcinomapapillary renal cell carcinomaPRCCrenal cancersrenal clear cell carcinomaccRCC
Journal Article 2024-08-16 ✓ 1 Snippet Chen YB, Yang X, Lv D, Tang LY, Liu YW.
In-Text Gene Mentions

…FANCD2, GCLC, RPL8,PEBP1, ZEB1, SQLE, HSBP1,…

Show Full Abstract

<h4>Background</h4>This study aimed to identify the prognostic-related differentially expressed ferroptosis-associated genes (DEFAGs) in papillary renal cell carcinoma (PRCC).<h4>Methods</h4>Data encompassing simple nucleotide variation, transcriptome profiles, and relevant clinical information of PRCC patients were sourced from The Cancer Genome Atlas (TCGA) database. The expression matrix of ferroptosis-associated genes (FAGs) was analyzed using the "limma" package in R to identify differentially expressed DEFAGs. Lasso regression analysis, along with univariate and multivariate Cox proportional hazards regressions, was employed to identify independent prognostic-related DEFAGs and formulate a nomogram. Additionally, we examined potential independent survival-related clinical risk factors and compared immune cell infiltration and tumor mutation burden (TMB) differences between high- and low-risk patient groups.<h4>Results</h4>A cohort of 321 patients were analyzed, revealing twelve FAGs significantly influencing the overall survival (OS) of PRCC patients. Among them, two mRNAs (GCLC, HSBP1) emerged as independent prognostic-related DEFAGs. Smoking status, tumor stage, and risk score were identified as independent clinical risk factors for PRCC. Furthermore, notable disparities in immune cell infiltration and function were observed between high- and low-risk groups. GCLC and HSBP1 were associated with various immune cells and functions, TMB, and immune evasion.<h4>Conclusion</h4>This finding revealed two independent prognostic-related DEFAGs in PRCC and established a robust prognostic model, offering potential therapeutic targets and promising insights for the management of this disease.

ARFGEF2
Also flagged:cancergene expressionnucleotideoncogenesliposarcomaActinomycin D
Journal Article 2024-08-16 ✓ 2 Snippets Gong B, Li D, Łabaj PP, Pan B, Novoradovskaya N, Thierry-Mieg D, Thierry-Mieg J, Chen G, Bergstrom Lucas A, LoCoco JS, Richmond TA, Tseng E, Kusko R, Happe S, Mercer TR, Pabón-Peña C, Salmans M, Tilgner HU, Xiao W, Johann DJ, Jones W, Tong W, Mason CE, Kreil DP, Xu J.
In-Text Gene Mentions

…of fusion interest (ARFGEF2, NPEPPS, RASA3, SULF2,…

…Except forARFGEF2and RASA3, these…

Show Full Abstract

Next-generation sequencing (NGS) has revolutionized genomic research by enabling high-throughput, cost-effective genome and transcriptome sequencing accelerating personalized medicine for complex diseases, including cancer. Whole genome/transcriptome sequencing (WGS/WTS) provides comprehensive insights, while targeted sequencing is more cost-effective and sensitive. In comparison to short-read sequencing, which still dominates the field due to high speed and cost-effectiveness, long-read sequencing can overcome alignment limitations and better discriminate similar sequences from alternative transcripts or repetitive regions. Hybrid sequencing combines the best strengths of different technologies for a more comprehensive view of genomic/transcriptomic variations. Understanding each technology's strengths and limitations is critical for translating cutting-edge technologies into clinical applications. In this study, we sequenced DNA and RNA libraries of reference samples using various targeted DNA and RNA panels and the whole transcriptome on both short-read and long-read platforms. This study design enables a comprehensive analysis of sequencing technologies, targeting protocols, and library preparation methods. Our expanded profiling landscape establishes a reference point for assessing current sequencing technologies, facilitating informed decision-making in genomic research and precision medicine.

LRRC7
Also flagged:chromatincondensinsMksB-likechromosomeorganizationcell cycle
Journal Article 2024-08-16 ✓ 1 Snippet Bułacz H, Hołówka J, Wójcik W, Zakrzewska-Czerwińska J.
In-Text Gene Mentions

Condensinsplay important roles…

Show Full Abstract

Condensins play important roles in maintaining bacterial chromatin integrity. In mycobacteria, three types of condensins have been characterized: a homolog of SMC and two MksB-like proteins, the recently identified MksB and EptC. Previous studies suggest that EptC contributes to defending against foreign DNA, while SMC and MksB may play roles in chromosome organization. Here, we report for the first time that the condensins, SMC and MksB, are involved in various DNA transactions during the cell cycle of Mycobacterium smegmatis (currently named Mycolicibacterium smegmatis). SMC appears to be required during the last steps of the cell cycle, where it contributes to sister chromosome separation. Intriguingly, in contrast to other bacteria, mycobacterial MksB follows replication forks during chromosome replication and hence may be involved in organizing newly replicated DNA.

GPR52
Also flagged:tumortumorsthalidomidebleomycin A2pancreatic adenocarcinomasPLEC
Journal Article 2024-08-16 ✓ 1 Snippet Ge J, Ge J, Tang G, Xiong D, Zhu D, Ding X, Zhou X, Sang M.
In-Text Gene Mentions

…AHNAK2 , andGPR52expression levels were…

Show Full Abstract

<h4>Background</h4>Pancreatic adenocarcinomas (PAADs) often exhibit a "cold" or immunosuppressive tumor milieu, which is associated with resistance to immune checkpoint blockade therapy; however, the underlying mechanisms are incompletely understood. Here, we aimed to improve our understanding of the molecular mechanisms occurring in the tumor microenvironment and to identify biomarkers, therapeutic targets, and potential drugs to improve PAAD treatment.<h4>Methods</h4>Patients were categorized according to immunologically hot or cold PAAD subtypes with distinct disease outcomes. Cox regression and weighted correlation network analysis were performed to construct a novel gene signature, referred to as 'Downregulated in hot tumors, Prognostic, and Immune-Related Genes' (DPIRGs), which was used to develop prognostic models for PAAD via machine learning (ML). The role of DPIRGs in PAAD was comprehensively analyzed, and biomarker genes able to distinguish PAAD immune subtypes and predict prognosis were identified by ML. The expression of biomarkers was verified using public single-cell transcriptomic and proteomic resources. Drug candidates for turning cold tumors hot and corresponding target proteins were identified via molecular docking studies.<h4>Results</h4>Using the DPIRG signature as input data, a combination of survival random forest and partial least squares regression Cox was selected from 137 ML combinations to construct an optimized PAAD prognostic model. The effects and molecular mechanisms of DPIRGs were investigated by analysis of genetic/epigenetic alterations, immune infiltration, pathway enrichment, and miRNA regulation. Biomarkers and potential therapeutic targets, including PLEC, TRPV1, and ITGB4, among others, were identified, and the cell type-specific expression of the biomarkers was validated. Drug candidates, including thalidomide, SB-431542, and bleomycin A2, were identified based on their ability to modulate DPIRG expression favorably.<h4>Conclusions</h4>By combining multiple ML algorithms, we developed a novel prognostic model with excellent performance in PAAD cohorts. ML also proved to be powerful for identifying biomarkers and potential targets for improved PAAD patient stratification and immunotherapy.

ZNF311
Also flagged:hypertensive diseases of pregnancyofmembranesgestational diabetesgene expressionplacentation
Journal Article 2024-08-16 ✓ 5 Snippets Gonzalez TL, Willson BE, Wang ET, Taylor KD, Novoa A, Swarna A, Ortiz JC, Zeno GJ, Jefferies CA, Lawrenson K, Rotter JI, Chen YI, Williams J, Cui J, Goodarzi MO, Pisarska MD.
In-Text Gene Mentions

…was located inZNF311with 16 probes.…

…two DMRs (ZNF311and C6orf47/C6orf47-AS1 ),…

…expression: ZNF300 ,ZNF311, and CCDC178.…

…, transcription factorsZNF311(chr6) and GTF3C6…

…( ZNF300 ,ZNF311, ZNF175 ),…

Show Full Abstract

<h4>Background</h4>Fetal sex and placental development impact pregnancy outcomes and fetal-maternal health, but the critical timepoint of placenta establishment in first trimester is understudied in human pregnancies.<h4>Methods</h4>Pregnant subjects were recruited in late first trimester (weeks 10-14) at time of chorionic villus sampling, a prenatal diagnostic test. Leftover placenta tissue was collected and stored until birth outcomes were known, then DNA and RNA were isolated from singleton, normal karyotype pregnancies resulting in live births. DNA methylation was measured with the Illumina Infinium MethylationEPIC BeadChip array (n = 56). Differential methylation analysis compared 25 females versus 31 males using a generalized linear model on 743,461 autosomal probes. Gene expression sex differences were analyzed with RNA-sequencing (n = 74). An integrated analysis was performed using linear regression to correlate gene expression and DNA methylation in 51 overlapping placentas.<h4>Results</h4>Methylation analysis identified 151 differentially methylated probes (DMPs) significant at false discovery rate < 0.05, including 89 (59%) hypermethylated in females. Probe cg17612569 (GABPA, ATP5J) was the most significant CpG site, hypermethylated in males. There were 11 differentially methylated regions affected by fetal sex, with transcription factors ZNF300 and ZNF311 most significantly hypermethylated in males and females, respectively. RNA-sequencing identified 152 genes significantly sexually dimorphic at false discovery rate < 0.05. The 151 DMPs were associated with 18 genes with gene downregulation (P < 0.05) in the direction of hypermethylation, including 2 genes significant at false discovery rate < 0.05 (ZNF300 and CUB and Sushi multiple domains 1, CSMD1). Both genes, as well as Family With Sequence Similarity 228 Member A (FAM228A), showed significant correlation between DNA methylation and sexually dimorphic gene expression, though FAM228A DNA methylation was less sexually dimorphic. Comparison with other sex differences studies found that cg17612569 is male-hypermethylated across gestation in placenta and in human blood up to adulthood.<h4>Conclusions</h4>Overall, sex dimorphic differential methylation with associated differential gene expression in the first trimester placenta is small, but there remain significant genes that may be regulated through methylation leading to differences in the first trimester placenta.

SERPINC1
Also flagged:doxorubicincisplatinosteosarcomacathepsinCTSGextracellular
Journal Article 2024-08-16 ✓ 1 Snippet Ma Q, Sun J, Liu Q, Fu J, Wen Y, Zhang F, Wu Y, Zhang X, Gong L, Zhang W.
In-Text Gene Mentions

…FGG, EPB41L2, LAMA4,SERPINC1, EPB42, C4BPA, CPA3,…

Show Full Abstract

<h4>Background</h4>Doxorubicin and cisplatin are both first-line chemotherapeutics for osteosarcoma (OS) treatment. However, the efficacy of doxorubicin/cisplatin chemotherapy varies considerably. Thus, identifying an efficient diagnostic biomarker to distinguish patients with good and poor responses to doxorubicin/cisplatin chemotherapy is of paramount importance.<h4>Methods</h4>To predict the efficacy of doxorubicin/cisplatin chemotherapy, we analyzed the differentially expressed proteins in 37 resected OS samples, which were categorized into the primary group (PG), the recurrent group (RG) and the metastatic group (MG). The characteristics of the enriched differentially expressed proteins were assessed via GO and KEGG analyses. Protein‒protein interactions were identified to determine the relationships among the differentially expressed proteins. Receiver operating characteristic (ROC) curve analyses were performed to explore the clinical significance of the differentially expressed proteins. Parallel reaction monitoring (PRM) was used to validate the candidate proteins. Immunohistochemical (IHC) staining was performed to confirm the expression of cathepsin (CTSG) in patients with good and poor response to doxorubicin/cisplatin.<h4>Results</h4>A total of 9458 proteins were identified and quantified, among which 143 and 208 exhibited significant changes (|log2FC|>1, p < 0.05) in the RG and MG compared with the PG, respectively. GO and KEGG enrichment led to the identification of neutrophil extracellular traps (NETs). ROC curve analyses revealed 74 and 86 proteins with areas under the curve greater than 0.7 in the RG and MG, respectively. PRM validation revealed the statistical significance of CTSG, which is involved in NET formation, at the protein level in both the RG and MG. IHC staining of another cohort revealed that CTSG was prominently upregulated in the poor response group after treatment with doxorubicin/cisplatin.<h4>Conclusion</h4>CTSG and its associated NETs are potential biomarkers with which the efficacy of doxorubicin/cisplatin chemotherapy could be predicted in OS patients.

Also flagged:Octanoic AcidFatty acidfatty acidsmetabolismACADLACADM
Journal Article 2024-08-16 No Snippets Mizuno Y, Tamaru S, Tochigi H, Sato T, Kishi M, Ohtake A, Ishihara O, Kajihara T.
Show Full Abstract

Decidualization denotes the morphological and biological differentiating process of human endometrial stromal cells (HESCs). Fatty acid pathways are critical for endometrial decidualization. However, the participation of fatty acids as an energy source and their role in endometrial decidualization have received little attention. To identify fatty acids and clarify their role in decidualization, we comprehensively evaluated free fatty acid profiles using liquid chromatography/Fourier transform mass spectrometry (LC/FT-MS). LC/FT-MS analysis detected 26 kinds of fatty acids in the culture medium of decidualized or un-decidualized HESCs. Only the production of octanoic acid, which is an essential energy source for embryonic development, was increased upon decidualization. The expressions of genes related to octanoic acid metabolism including ACADL, ACADM, and ACADS; genes encoding proteins catalyzing the first step of mitochondrial fatty acid beta-oxidation; and ACSL5 and ACSM5; genes encoding fatty acid synthesis proteins were significantly altered upon decidualization. These results suggest that decidualization promotes lipid metabolism, implying that decidualized HESCs require energy metabolism of the mitochondria in embryo implantation.

HTT
Also flagged:neuropsychiatric disordersmental illnessemotional disturbancesaggressionbehavioralmental disorders
Journal Article 2024-08-16 ✓ 1 Snippet Fu Y, Cheng HW.
In-Text Gene Mentions

…5-HTRs: serotonin receptors;5-HTT: serotonin transporter; ASD:…

Show Full Abstract

Numerous studies have evidenced that neuropsychiatric disorders (mental illness and emotional disturbances) with aggression (or violence) pose a significant challenge to public health and contribute to a substantial economic burden worldwide. Especially, social disorganization (or social inequality) associated with childhood adversity has long-lasting effects on mental health, increasing the risk of developing neuropsychiatric disorders. Intestinal bacteria, functionally as an endocrine organ and a second brain, release various immunomodulators and bioactive compounds directly or indirectly regulating a host's physiological and behavioral homeostasis. Under various social challenges, stress-induced dysbiosis increases gut permeability causes serial reactions: releasing neurotoxic compounds, leading to neuroinflammation and neuronal injury, and eventually neuropsychiatric disorders associated with aggressive, violent, or impulsive behavior in humans and various animals via a complex bidirectional communication of the microbiota-gut-brain (MGB) axis. The dysregulation of the MGB axis has also been recognized as one of the reasons for the prevalence of social stress-induced injurious behaviors (feather pecking, aggression, and cannibalistic pecking) in chickens. However, existing knowledge of preventing and treating these disorders in both humans and chickens is not well understood. In previous studies, we developed a non-mammal model in an abnormal behavioral investigation by rationalizing the effects of gut microbiota on injurious behaviors in chickens. Based on our earlier success, the perspective article outlines the possibility of reducing stress-induced injurious behaviors in chickens through modifying gut microbiota via cecal microbiota transplantation, with the potential for providing a biotherapeutic rationale for preventing injurious behaviors among individuals with mental disorders via restoring gut microbiota diversity and function.

Also flagged:cardiovascular diseasescancerimmune system disorderspost-traumatic stress disorderPTSDmajor depressive disorder
Journal Article 2024-08-16 No Snippets Shchaslyvyi AY, Antonenko SV, Telegeev GD.
Show Full Abstract

The connection between chronic psychological stress and the onset of various diseases, including diabetes, HIV, cancer, and cardiovascular conditions, is well documented. This review synthesizes current research on the neurological, immune, hormonal, and genetic pathways through which stress influences disease progression, affecting multiple body systems: nervous, immune, cardiovascular, respiratory, reproductive, musculoskeletal, and integumentary. Central to this review is an evaluation of 16 Behavioral Stress Reduction Programs (BSRPs) across over 200 studies, assessing their effectiveness in mitigating stress-related health outcomes. While our findings suggest that BSRPs have the potential to enhance the effectiveness of medical therapies and reverse disease progression, the variability in study designs, sample sizes, and methodologies raises questions about the generalizability and robustness of these results. Future research should focus on long-term, large-scale studies with rigorous methodologies to validate the effectiveness of BSRPs.

DCC
Also flagged:depressionneurological disordersmental disorderscognitionneuroticismmajor depressive disorder
Journal Article 2024-08-16 ✓ 1 Snippet Huijsdens H, Leeftink D, Geerligs L, Hinne M.
In-Text Gene Mentions

…This makes theDCC-GARCH variant less likely…

Show Full Abstract

Several disciplines, such as econometrics, neuroscience, and computational psychology, study the dynamic interactions between variables over time. A Bayesian nonparametric model known as the Wishart process has been shown to be effective in this situation, but its inference remains highly challenging. In this work, we introduce a Sequential Monte Carlo (SMC) sampler for the Wishart process, and show how it compares to conventional inference approaches, namely MCMC and variational inference. Using simulations, we show that SMC sampling results in the most robust estimates and out-of-sample predictions of dynamic covariance. SMC especially outperforms the alternative approaches when using composite covariance functions with correlated parameters. We further demonstrate the practical applicability of our proposed approach on a dataset of clinical depression (n=1), and show how using an accurate representation of the posterior distribution can be used to test for dynamics in covariance.

HTT
Also flagged:Polyphenolic compoundsgene expressionpolyphenolsphenolic acidsflavonoidbiosynthesis
Journal Article 2024-08-16 ✓ 2 Snippets Zhao X, Li Y, Huang Y, Shen J, Xu H, Li K.
In-Text Gene Mentions

…PAL, C4H, 4CL, HCT/HQT/HTT(BAHD acyltransferase family)…

…eactions catalyzed by HCT/HQT/HTTfrom the BAHD…

Show Full Abstract

<h4>Introduction</h4>Dandelion is widely used in clinical practice due to its beneficial effects. Polyphenolic compounds are considered the main anti-inflammatory active ingredient of dandelion, but the gene expression patterns of polyphenolic compounds in different dandelion tissues are still unclear.<h4>Methods</h4>In this study, we combined a nontargeted metabolome, PacBio Iso-seq transcriptome, and Illumina RNA-seq transcriptome to investigate the relationship between polyphenols and gene expression in roots, flowers, and leaves of flowering dandelion plants.<h4>Results</h4>Eighty-eight flavonoids and twenty-five phenolic acids were identified, and 64 candidate genes involved in flavonoid biosynthesis and 63 candidate genes involved in chicoric acid biosynthesis were identified. Most flavonoid and chicoric acid-related genes demonstrated the highest content in flowers. RNA-seq analysis revealed that genes involved in polyphenol biosynthesis pathways, such as CHS, CHI, F3H, F3'H, FLS, HQT, and CAS, which are crucial for the accumulation of flavonoids and chicoric acid, were upregulated in flowers.<h4>Discussion</h4>The combination of transcriptomic and metabolomic data can help us better understand the biosynthetic pathways of polyphenols in dandelion. These results provide abundant genetic resources for further studying the regulatory mechanism of dandelion polyphenol biosynthesis.

SERPINC1
Also flagged:coagulationKawasaki disease shock syndromepericardial effusionvalve regurgitationarteryD-dimer
Journal Article 2024-08-16 ✓ 5 Snippets Li B, Liu X, Shao S, Wu P, Wu M, Liu L, Hua Y, Duan H, Zhou K, Wang C.
In-Text Gene Mentions

…and antithrombin III (ATIII) activity were significantly…

…APTT, D-dimer, andATIIIwere independent risk…

…D-dimer, FDP, andATIIIas 13.45 s,…

…d-dimer, FDP, andATIIIfor KDSS occurrence…

…KDSS group, whileATIIIactivity (68.97% [61.50%–78.50…

Show Full Abstract

<h4>Background</h4>Kawasaki disease (KD) is characterized as an acute febrile inflammatory disorder, which may potentially escalate into a more severe condition termed Kawasaki disease shock syndrome (KDSS). The objective of this research is to understand the clinical attributes of KDSS and to explore the predictive significance of coagulation profiles in the incidence of KDSS.<h4>Method</h4>Patients with Kawasaki disease (KD) were prospectively enrolled and divided into the KDSS group (<i>n</i> = 29) and the non-KDSS group (<i>n</i> = 494). Multivariate logistic regression analysis was used to ascertain the relationship between coagulation profiles and KDSS. Furthermore, ROC curve analysis was conducted to evaluate the predictive value of the coagulation profile for the occurrence of KDSS.<h4>Result</h4>Among the KDSS patients, the median age was higher and cervical lymph node involvement was greater compared to the non-KDSS group. Additionally pericardial effusion, valve regurgitation, cardiac enlargement, coronary artery lesions (CALs), and Intravenous immunoglobulin (IVIG) resistance were significantly more frequent in the KDSS group than in non-KDSS group. Notably, Prothrombin time (PT), activated partial thromboplastin time (APTT), D-dimer, and fibrin degradation products (FDP) were significantly elevated in the KDSS group compared to the non-KDSS group. Conversely, total thrombin time (TT), fibrinogen, and antithrombin III (ATIII) activity were significantly reduced. Multivariate logistic regression analysis revealed that PT, APTT, D-dimer, and ATIII were independent risk factors for predicting KDSS occurrence. ROC curve analysis established critical values for PT, D-dimer, FDP, and ATIII as 13.45 s, 2.03 mg/L, 7.45 μg/ml, and 77.5%, respectively. Sensitivity for predicting KDSS occurrence was 76%, 79%, 83%, and 76%, while specificity was 51%, 72%, 63%, and 80%, respectively. When we performed a combined ROC curve analysis of the four indicators, we found that its predictive sensitivity was much higher. Moreover, the Delong test results showed that the AUC of the combined analysis was significantly higher than that of the individual analyses.<h4>Conclusion</h4>Characteristic features of KDSS include older age, a greater likelihood of experiencing pericardial effusion, valve regurgitation, cardiac enlargement, CALs, and IVIG resistance. KD patients with a hypercoagulable state during the acute phase are at a higher risk of developing KDSS.

HFE
Also flagged:Inborn errors of immunitygenetic disordersautoinflammatory diseaseimmune dysregulationimmune responsesCD4
Journal Article 2024-08-16 ✓ 2 Snippets Hall G, Markle JG, Maiarana J, Martin PL, Rothman JA, Sleasman JW, Lederman H, Azar AE, Brodsky RA, Mousallem T.
In-Text Gene Mentions

…genetic testing forhemochromatosisdemonstrated a heterozygous…

…heterozygous variant inHFE(c.187C >G, p.His63Asp)…

Show Full Abstract

A 20-year-old male patient with a history of celiac disease came to medical attention after developing profound fatigue and pancytopenia. Evaluation demonstrated pan-hypogammaglobulinemia. There was no history of significant clinical infections. Bone marrow biopsy confirmed hypocellular marrow consistent with aplastic anemia. Oncologic and hematologic evaluations were unremarkable for iron deficiency, paroxysmal nocturnal hemoglobinuria, myelodysplastic syndromes, T-cell clonality, and leukemia. A next generation genetic sequencing immunodeficiency panel revealed a heterozygous variant of uncertain significance in <i>CTLA4</i> c.385T >A, p.Cys129Ser (C129S). Cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) is an inhibitory receptor important in maintaining immunologic homeostasis. To determine the functional significance of the C129S variant, additional testing was pursued to assess for diminished protein expression, as described in other pathogenic <i>CTLA4</i> variants. The results demonstrated severely impaired CTLA-4 expression and CD80 transendocytosis, consistent with other variants causing CTLA-4 haploinsufficiency. He was initially treated with IVIG and cyclosporine, and became transfusion independent for few months, but relapsed. Treatment with CTLA-4<i>-</i>Ig fusion protein (abatacept) was considered, however the patient opted for definitive therapy through reduced-intensity haploidentical hematopoietic stem cell transplant, which was curative.

Also flagged:ADCD34ELNATP5F1BVDAC1VDAC2
Journal Article 2024-08-16 No Snippets Zhiyan C, Min Z, Yida D, Chunying H, Xiaohua H, Yutong L, Huan W, Linjuan S.
Show Full Abstract

<h4>Background and aim</h4>Pathological changes in the central nervous system (CNS) begin before the clinical symptoms of Alzheimer's Disease (AD) manifest, with the hippocampus being one of the first affected structures. Current treatments fail to alter AD progression. Traditional Chinese medicine (TCM) has shown potential in improving AD pathology through multi-target mechanisms. This study investigates pathological changes in AD hippocampal tissue and explores TCM active components that may alleviate these changes.<h4>Methods</h4>GSE5281 and GSE173955 datasets were downloaded from GEO and normalized to identify differentially expressed genes (DEGs). Key functional modules and hub genes were analyzed using Cytoscape and R. Active TCM components were identified from literature and the Pharmacopoeia of the People's Republic of China. Enrichment analyses were performed on target genes overlapping with DEGs.<h4>Result</h4>From the datasets, 76 upregulated and 363 downregulated genes were identified. Hub genes included SLAMF, CD34, ELN (upregulated) and ATP5F1B, VDAC1, VDAC2, HSPA8, ATP5F1C, PDHA1, UBB, SNCA, YWHAZ, PGK1 (downregulated). Literature review identified 33 active components from 23 herbal medicines. Target gene enrichment and analysis were performed for six components: dihydroartemisinin, berberine, naringenin, calycosin, echinacoside, and icariside II.<h4>Conclusion</h4>Mitochondrial to synaptic vesicle dysfunction pathways were enriched in downregulated genes. Despite downregulation, UBB and SNCA proteins accumulate in AD brains. TCM studies suggest curcumin and echinacoside may improve hippocampal pathology and cognitive impairment in AD. Further investigation into their mechanisms is needed.

SOX6
Also flagged:chronic atrial fibrillationarrhythmiasheart failureembolic strokeAFGene Expression
Journal Article 2024-08-16 ✓ 1 Snippet Chen X, Zhang Y, Meng H, Chen G, Ma Y, Li J, Liu S, Liang Z, Xie Y, Liu Y, Guo H, Wang Y, Shan Z.
In-Text Gene Mentions

…AndSOX6is verified as…

Show Full Abstract

<h4>Background</h4>Atrial fibrillation (AF) is one of the most prevalent arrhythmias and is characterized by a high risk of heart failure and embolic stroke, yet its underlying mechanism is unclear. The primary goal of this study was to establish a miRNA-mRNA network and identify the miRNAs associated with chronic AF by bioinformatics and experimental validation.<h4>Methods</h4>The GSE79768 dataset was collected from the Gene Expression Omnibus(GEO) database to extract data from patients with or without persistent AF. Differentially expressed genes (DEGs) were identified in left atrial appendages (LAAs). The STRING platform was utilized for protein-protein interaction (PPI) network analysis. The target miRNAs for the top 20 hub genes were predicted by using the miRTarBase Web tool. The miRNA-mRNA network was established and visualized using Cytoscape software. The key miRNAs selected for verification in the animal experiment were confirmed by miRwalk Web tool. We used a classic animal model of rapid ventricular pacing for chronic AF. Two groups of animals were included in the experiment, namely, the ventricular pacing group (VP group), where ventricular pacing was maintained at 240-280 bpm for 2 weeks, and the control group was the sham-operated group (SO group). Finally, we performed reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to validate the expression of miR-1 and miR-499 in LAA tissues of the VP group and the SO group. Left atrial fibrosis and apoptosis were evaluated by Masson staining and caspase-3 activity assays, respectively.<h4>Results</h4>The networks showed 48 miRNAs in LAA tissues. MiR-1 and miR-499 were validated using an animal model of chronic AF. The expression level of miR-1 was increased, and miR-499 was decreased in VP group tissues compared to SO group tissues in LAAs (<i>P</i> < 0.05), which were correlated with left atrial fibrosis and apoptosis in AF.<h4>Conclusion</h4>This study provides a better understanding of the alterations in miRNA-1 and miR-499 in chronic AF from the perspective of the miRNA-mRNA network and corroborates findings through experimental validation. These findings may offer novel potential therapeutic targets for AF in the future.

PRDX6
Also flagged:retinopathy of prematuritydiabetic retinopathyage-related macular degenerationblindnesshemehemorrhage
Journal Article 2024-08-16 ✓ 2 Snippets Gáll T, Pethő D, Erdélyi K, Egri V, Balla JG, Nagy A, Nagy A, Póliska S, Gram M, Gábriel R, Nagy P, Balla J, Balla G.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6) were significantly downregul…

…GSTCD, TXN2, TXNRD3,PRDX6), while others genes…

Show Full Abstract

Neovascularization is implicated in the pathology of retinopathy of prematurity (ROP), diabetic retinopathy (DR), and age-related macular degeneration (AMD), which are the leading causes of blindness worldwide. In our work, we analyzed how heme released during hemorrhage affects hypoxic response and neovascularization. Our retrospective clinical analysis demonstrated, that hemorrhage was associated with more severe retinal neovascularization in ROP patients. Our heme-stimulated human retinal pigment epithelial (ARPE-19) cell studies demonstrated increased expression of positive regulators of angiogenesis, including vascular endothelial growth factor-A (VEGFA), a key player of ROP, DR and AMD, and highlighted the activation of the PI3K/AKT/mTOR/VEGFA pathway involved in angiogenesis in response to heme. Furthermore, heme decreased oxidative phosphorylation in the mitochondria, augmented glycolysis, facilitated HIF-1α nuclear translocation, and increased VEGFA/GLUT1/PDK1 expression suggesting HIF-1α-driven hypoxic response in ARPE-19 cells without effecting the metabolism of reactive oxygen species. Inhibitors of HIF-1α, PI3K and suppression of mTOR pathway by clinically promising drug, rapamycin, mitigated heme-provoked cellular response. Our data proved that oxidatively modified forms of hemoglobin can be sources of heme to induce VEGFA during retinal hemorrhage. We propose that hemorrhage is involved in the pathology of ROP, DR, and AMD.

Also flagged:gene expressiontrans -splicing-spliceosomeribonucleoproteinRNP
Journal Article 2024-08-16 No Snippets Doi A, Delaney C, Tanner D, Burkhart K, Bell RD.
Show Full Abstract

RNA exon editing is a therapeutic strategy for correcting disease-causing mutations by inducing <i>trans</i>-splicing between a synthetic RNA molecule and an endogenous pre-mRNA target, resulting in functionally restored mRNA and protein. This approach enables the replacement of exons at the kilobase scale, addresses multiple mutations with a single therapy, and maintains native gene expression without changes to DNA. For genes larger than 5 kb, RNA exon editors can be delivered in a single vector despite AAV capacity limitations because only mutated exons need to be replaced. While correcting mutations by <i>trans</i>-splicing has been previously demonstrated, prior attempts were hampered by low efficiency or lack of translation in preclinical models. Advances in synthetic biology, next-generation sequencing, and bioinformatics, with a deeper understanding of mechanisms controlling RNA splicing, have triggered a re-emergence of <i>trans</i>-splicing and the development of new RNA exon editing molecules for treating human disease, including the first application in a clinical trial (this study was registered at ClinicalTrials.gov [NCT06467344]). Here, we provide an overview of RNA splicing, the history of <i>trans</i>-splicing, previously reported therapeutic applications, and how modern advances are enabling the discovery of RNA exon editing molecules for genetic targets unable to be addressed by conventional gene therapy and gene editing approaches.

Also flagged:carbonate apatite-granulesbone formationcarbonateapatite
Journal Article 2024-08-16 No Snippets Nunn ME, Rudick C, Nikaido M, Miyamoto T.
Show Full Abstract

The objectives of this study are to provide a systematic review of a novel alloplastic hard-tissue grafting material, carbonate apatite granules (CO3Ap-granules), to provide a clinical case presentation of CO3Ap-granules in periodontal surgery. The following three electronic databases were searched independently by two of the authors (MN) and (CR): National Library of Medicine [MEDLINE (PubMed) and ClinicalTrials.gov], EMBASE (OVID) and the Cochrane Central Register of Controlled Trials (CENTRAL). After searching electronic databases, select journals in periodontics and implantology were also manually searched. Of the 43 studies identified from the systematic review, the following classifications were determined: (1) <i>in vitro</i> studies - 5 studies, (2) animal studies - 28 studies, (3) clinical studies - 7 studies, (4) reviews - 3 studies. Results from selected animal studies and all human studies were summarized. These results demonstrate that the novel alloplast CO3Ap-granules has the potential ability to stimulate new bone formation while CO3Ap-granules simultaneously resorb over time. Replacement of CO3Ap-granules with new bone formation has been shown to be comparable to autogenous bone grafting with one study showing superior results to a bovine-derived xenograft.

Research Square 2024-08-16 Preprint (No Snippets API) Teachey D, Newman H, Lee S, Pölönen P, Shraim R, Li Y, Liu H, Aplenc R, Bandyopadhyay S, Chen C, Chen Z, Devidas M, Diorio C, Dunsmore K, Elghawy O, Elhachimi A, Fuller T, Gupta S, Hall J, Hughes A, Hunger S, Loh M, Martinez Z, McCoy M, Mullen C, Pounds S, Raetz E, Ryan T, Seffernick A, Shi G, Sussman J, Tan K, Uppuluri L, Vincent TL, Wang'ondu R, Winestone L, Winter S, Wood B, Wu G, Xu J, Yang W, Mullighan C, Yang J, Bona K.
Show Full Abstract

<title>Abstract</title> <p>The influence of genetic ancestry on biology, survival outcomes, and risk stratification in T-cell Acute Lymphoblastic Leukemia (T-ALL) has not been explored. Genetic ancestry was genomically-derived from DNA-based single nucleotide polymorphisms in children and young adults with T-ALL treated on Children’s Oncology Group trial AALL0434. We determined associations of genetic ancestry, leukemia genomics and survival outcomes; co-primary outcomes were genomic subtype, pathway alteration, overall survival (OS), and event-free survival (EFS). Among 1309 patients, T-ALL molecular subtypes varied significantly by genetic ancestry, including increased frequency of genomically defined ETP-like, MLLT10, and BCL11B-activated subtypes in patients of African ancestry. In multivariable Cox models adjusting for high-risk subtype and pathways, patients of Admixed American ancestry had superior 5-year EFS/OS compared with European; EFS/OS for patients of African and European ancestry were similar. The prognostic value of five commonly altered T-ALL genes varied by ancestry – including <italic>NOTCH1</italic>, which was associated with superior OS for patients of European and Admixed American ancestry but non-prognostic among patients of African ancestry. Furthermore, a published five-gene risk classifier accurately risk stratified patients of European ancestry, but misclassified patients of African ancestry. We developed a penalized Cox model which successfully risk stratified patients across ancestries. Overall, 80% of patients had a genomic alteration in at least one gene with differential prognostic impact by genetic ancestry. T-ALL genomics and prognostic associations of genomic alterations vary by genetic ancestry. These data demonstrate the importance of incorporating genetic ancestry into analyses of tumor biology for risk classification algorithms.</p>

Research Square 2024-08-16 Preprint (No Snippets API) Zhang B, Xie H, Qian W, Wu J, Cui J, Zhu G, Yi Q, Pan F, Fang F, Ling Y, Zhang Y, Li Y, Liu Y.
Show Full Abstract

<title>Abstract</title> <p>Epigenetic regulation of gene transcription may play a critical role in the onset of puberty. Previous studies have confirmed that methylation regulates gene transcription in the hypothalamus-pituitary-gonadal axis during puberty initiation, but little is known about the regulation of DNA methylation on gene expression in the pineal gland. This study aims to screen pineal gland candidate genes related to the onset of goat puberty and regulated by genome methylation to clarify the initiation mechanism of goat puberty and lay the foundation for improving goat reproductive performance. Pineal glands were collected from three female Anhui white goats during prepuberty (2.5 to 3.0 mo) and three during puberty (4.0 to 4.5 mo). Genome-wide hydrogen sulfite sequencing determined the DNA methylation profile, while RNA sequencing determined the transcriptome. The relationship between gene transcription and DNA methylation was determined by joint analysis. We found that there was no significant change in the whole-genome methylation level of the goat pineal gland before and after puberty, but the methylation pattern changed significantly, indicating that genomic DNA methylation of the pineal gland may be involved in regulating goat puberty initiation. Changes in DNA methylation patterns affected some pineal gland transcriptomes, while the transcriptional level of most genes was not affected by DNA methylation differences. Genes regulated by DNA methylation were mainly involved in metabolic processes, oxidative phosphorylation (OXPHOS), and signaling pathways related to thermogenesis. The differentially expressed genes ATP5F1D, CACNB2, and PTEN were significantly regulated by methylation, and the fold changes in LIN28B, GIP, OPN1SW, and DCC were the most significant, possibly indicating involvement in puberty initiation.</p>

bioRxiv 2024-08-16 Preprint (No Snippets API) Theeuwes B, Harland LT, Bisia A, Costello I, Ton M, Lohoff T, Clark SJ, Argelaguet R, Wilson NK, Reik W, Bikoff E, Robertson EJ, Gottgens B.
Show Full Abstract

<h4>Summary</h4> During mouse gastrulation, extraembryonic mesoderm (ExEM) contributes to the extraembryonic yolk sac (YS) and allantois, both of which are essential for successful gestation. Although the genetic networks coordinating intra-embryonic mesodermal subtype specification are well-studied, the mechanisms driving ExEM diversification are poorly understood. Here, we reveal that embryoid body in vitro differentiation generates two distinct lineages of mesodermal cells matching YS and allantois respectively. Combining in vitro models with in vivo chimeric embryo analysis, we discover that Eomesodermin (Eomes) regulates the formation of a subset of YS-fated ExEM but is dispensable for allantois formation. Furthermore, simultaneous disruption of Eomes and T impedes the specification of any YS or allantois mesoderm, indicating compensatory roles for T during allantois formation when Eomes is disrupted. Our study highlights previously unrecognized functional and mechanistic diversity in ExEM diversification and endothelial development and introduces a tractable EB model to dissect the signaling pathways and transcriptional networks driving the formation of key extraembryonic tissues.

Also flagged:action potentialsnervous system diseasesepilepsypsychosisautismcardiac arrhythmia
Journal Article 2024-08-15 No Snippets Pei S, Wang N, Mei Z, Zhangsun D, Craik DJ, McIntosh JM, Zhu X, Luo S.
Show Full Abstract

Voltage-gated sodium (Na<sub>V</sub>) channels are intimately involved in the generation and transmission of action potentials, and dysfunction of these channels may contribute to nervous system diseases, such as epilepsy, neuropathic pain, psychosis, autism, and cardiac arrhythmia. Many venom peptides selectively act on Na<sub>V</sub> channels. These include conotoxins, which are neurotoxins secreted by cone snails for prey capture or self-defense but which are also valuable pharmacological tools for the identification and/or treatment of human diseases. Typically, conotoxins contain two or three disulfide bonds, and these internal crossbraces contribute to conotoxins having compact, well defined structures and high stability. Of the conotoxins containing three disulfide bonds, some selectively target mammalian Na<sub>V</sub> channels and can block, stimulate, or modulate these channels. Such conotoxins have great potential to serve as pharmacological tools for studying the functions and characteristics of Na<sub>V</sub> channels or as drug leads for neurologic diseases related to Na<sub>V</sub> channels. Accordingly, discovering or designing conotoxins targeting Na<sub>V</sub> channels with high potency and selectivity is important. The amino acid sequences, disulfide bond connectivity, and three-dimensional structures are key factors that affect the biological activity of conotoxins, and targeted synthetic modifications of conotoxins can greatly improve their activity and selectivity. This review examines Na<sub>V</sub> channel-targeted conotoxins, focusing on their structures, activities, and designed modifications, with a view toward expanding their applications. SIGNIFICANCE STATEMENT: Na<sub>V</sub> channels are crucial in various neurologic diseases. Some conotoxins selectively target Na<sub>V</sub> channels, causing either blockade or activation, thus enabling their use as pharmacological tools for studying the channels' characteristics and functions. Conotoxins also have promising potential to be developed as drug leads. The disulfide bonds in these peptides are important for stabilizing their structures, thus leading to enhanced specificity and potency. Together, conotoxins targeting Na<sub>V</sub> channels have both immediate research value and promising future application prospects.

HFE
Also flagged:ironcardiomyopathyheart failureanemiacalcium channel
Journal Article 2024-08-15 ✓ 4 Snippets Gera P, Oliveira V, Frishman WH, Aronow WS.
In-Text Gene Mentions

…Cardiac Manifestations ofHemochromatosis.…

…Cardiachemochromatosis, a consequence of…

…information on cardiachemochromatosis, elucidating its pathophysiol…

…Primary and secondaryhemochromatosis, genetic and acquired…

Show Full Abstract

Cardiac hemochromatosis, a consequence of primary or secondary iron-overload conditions, poses a threat to patient health, leading to cardiomyopathy and heart failure. This review aims to compile comprehensive information on cardiac hemochromatosis, elucidating its pathophysiology, clinical presentation, diagnosis, and management strategies. Primary and secondary hemochromatosis, genetic and acquired forms, can result in cardiotoxicity by means of iron dysregulation. Diagnostic tools, including biochemical markers, electrocardiography, echocardiography, and magnetic resonance imaging (MRI), are utilized for early detection as well as long-term monitoring post-treatment. For treatment options, phlebotomy is the standard, but for some patients (such as those with anemia), chelation therapy is an alternative option. Other potential therapies include erythrocytapheresis, calcium channel blockers, and hepcidin-targeted approaches, for which more research is needed to understand cardiac function benefits. With the onset of cardiac symptoms, patient health rapidly deteriorates. Thus, timely intervention to mitigate associated morbidity and mortality by means of screening can promote and prolong patient survival.

Also flagged:Lyme DiseaseLyme borreliosistick-borne illnessrelapsing feverborreliosisLyme
Journal Article 2024-08-15 No Snippets Akther S, Mongodin EF, Morgan RD, Di L, Yang X, Golovchenko M, Rudenko N, Margos G, Hepner S, Fingerle V, Kawabata H, Norte AC, de Carvalho IL, Núncio MS, Marques A, Schutzer SE, Fraser CM, Luft BJ, Casjens SR, Qiu W.
Show Full Abstract

Lyme disease, caused by spirochetes in the <i>Borrelia burgdorferi sensu lato</i> clade within the <i>Borrelia</i> genus, is transmitted by <i>Ixodes</i> ticks and is currently the most prevalent and rapidly expanding tick-borne disease in Europe and North America. We report complete genome sequences of 47 isolates that encompass all established species in this clade while highlighting the diversity of the widespread human pathogenic species <i>B. burgdorferi</i>. A similar set of plasmids has been maintained throughout <i>Borrelia</i> divergence, indicating that they are a key adaptive feature of this genus. Phylogenetic reconstruction of all sequenced <i>Borrelia</i> genomes revealed the original divergence of Eurasian and North American lineages and subsequent dispersals that introduced <i>B. garinii, B. bavariensis, B. lusitaniae, B. valaisiana,</i> and <i>B. afzelii</i> from East Asia to Europe and <i>B. burgdorferi</i> and <i>B. finlandensis</i> from North America to Europe. Molecular phylogenies of the universally present core replicons (chromosome and cp26 and lp54 plasmids) are highly consistent, revealing a strong clonal structure. Nonetheless, numerous inconsistencies between the genome and gene phylogenies indicate species dispersal, genetic exchanges, and rapid sequence evolution at plasmid-borne loci, including key host-interacting lipoprotein genes. While localized recombination occurs uniformly on the main chromosome at a rate comparable to mutation, lipoprotein-encoding loci are recombination hotspots on the plasmids, suggesting adaptive maintenance of recombinant alleles at loci directly interacting with the host. We conclude that within- and between-species recombination facilitates adaptive sequence evolution of host-interacting lipoprotein loci and contributes to human virulence despite a genome-wide clonal structure of its natural populations.<h4>Importance</h4>Lyme disease (also called Lyme borreliosis in Europe), a condition caused by spirochete bacteria of the genus <i>Borrelia</i>, transmitted by hard-bodied <i>Ixodes</i> ticks, is currently the most prevalent and rapidly expanding tick-borne disease in the United States and Europe. <i>Borrelia</i> interspecies and intraspecies genome comparisons of Lyme disease-related bacteria are essential to reconstruct their evolutionary origins, track epidemiological spread, identify molecular mechanisms of human pathogenicity, and design molecular and ecological approaches to disease prevention, diagnosis, and treatment. These Lyme disease-associated bacteria harbor complex genomes that encode many genes that do not have homologs in other organisms and are distributed across multiple linear and circular plasmids. The functional significance of most of the plasmid-borne genes and the multipartite genome organization itself remains unknown. Here we sequenced, assembled, and analyzed whole genomes of 47 <i>Borrelia</i> isolates from around the world, including multiple isolates of the human pathogenic species. Our analysis elucidates the evolutionary origins, historical migration, and sources of genomic variability of these clinically important pathogens. We have developed web-based software tools (BorreliaBase.org) to facilitate dissemination and continued comparative analysis of <i>Borrelia</i> genomes to identify determinants of human pathogenicity.

Also flagged:IL1βIL6Tumor Necrosis Factor-αTNF-αosteoblast differentiationprogrammed cell death
Journal Article 2024-08-15 No Snippets Li JX, Qu YD, Xia CL, Zhang W, Wang SS, Ou SJ, Yang Y, Qi Y, Xu CP.
Show Full Abstract

<h4>Background</h4>Inflammatory cytokines such as Interleukin 1β(IL1β), IL6,Tumor Necrosis Factor-α (TNF-α) can inhibit osteoblast differentiation and induce osteoblast apoptosis. PANoptosis, a newly identified type of programmed cell death (PCD), may be influenced by long noncoding RNA (lncRNAs) which play important roles in regulating inflammation. However, the potential role of lncRNAs in inflammation and PANoptosis during osteogenic differentiation remains unclear. This study aimed to investigate the regulatory functions of lncRNAs in inflammation and apoptosis during osteogenic differentiation.<h4>Methods and results</h4>High-throughput sequencing was used to identify differentially expressed genes involved in osteoblast differentiation under inflammatory conditions. Two lncRNAs associated with inflammation and PANoptosis during osteogenic differentiation were identified from sequencing data and Gene Expression Omnibus (GEO) databases. Their functionalities were analyzed using diverse bioinformatics methodologies, resulting in the construction of the lncRNA-miRNA-mRNA network. Among these, lncRNA (MIR17HG) showed a high correlation with PANoptosis. Bibliometric methods were employed to collect literature data on PANoptosis, and its components were inferred. PCR and Western Blotting experiments confirmed that lncRNA MIR17HG is related to PANoptosis in osteoblasts during inflammation.<h4>Conclusions</h4>Our data suggest that TNF-α-induced inhibition of osteogenic differentiation and PANoptosis in MC3T3-E1 osteoblasts is associated with MIR17HG. These findings highlight the critical role of MIR17HG in the interplay between inflammation, PANoptosis, and osteogenic differentiation, suggesting potential therapeutic targets for conditions involving impaired bone formation and inflammatory responses.

HTT
Also flagged:amino acidglutamineHuntingtindeathpolyglutamineendoplasmic reticulum
Journal Article 2024-08-15 ✓ 5 Snippets Dublin-Ryan LB, Bhadra AK, True HL.
In-Text Gene Mentions

…of Huntingtin protein (htt-103Q) have been conducted…

…of mutant huntingtin (htt-103Q) is a promising…

…expanded polyQ protein (htt-103Q) and reduces aggregation…

…NAC-deleted strains expressinghtt-103Q.…

… GAL1 promoter (p416Gal1-FLAG-htt-25QΔPro-CFP and p416Gal1-FLAG…

Show Full Abstract

The nascent polypeptide-associate complex (NAC) is a heterodimeric chaperone complex that binds near the ribosome exit tunnel and is the first point of chaperone contact for newly synthesized proteins. Deletion of the NAC induces embryonic lethality in many multi-cellular organisms. Previous work has shown that the deletion of the NAC rescues cells from prion-induced cytotoxicity. This counterintuitive result led us to hypothesize that NAC disruption would improve viability in cells expressing human misfolding proteins. Here, we show that NAC disruption improves viability in cells expressing expanded polyglutamine and also leads to delayed and reduced aggregation of expanded polyglutamine and changes in polyglutamine aggregate morphology. Moreover, we show that NAC disruption leads to changes in de novo yeast prion induction. These results indicate that the NAC plays a critical role in aggregate organization as a potential therapeutic target in neurodegenerative disorders.

DCC
Also flagged:embryogenesisxol-1chromosomesautosomescell divisiondosage compensation
Journal Article 2024-08-15 ✓ 5 Snippets Jash E, Azhar AA, Mendoza H, Tan ZM, Escher HN, Kaufman DS, Kaufman DS, Csankovszki G.
In-Text Gene Mentions

…dosage compensation complex (DCC) [ 5 ].…

…by activating theDCC[ 17 ].…

…TheDCCbinds to recruitment…

…TheDCCand the additional…

…dosage compensation complex (DCC) to determine when…

Show Full Abstract

Sex determination in the nematode C. elegans is controlled by the master regulator XOL-1 during embryogenesis. Expression of xol-1 is dependent on the ratio of X chromosomes and autosomes, which differs between XX hermaphrodites and XO males. In males, xol-1 is highly expressed and in hermaphrodites, xol-1 is expressed at very low levels. XOL-1 activity is known to be critical for the proper development of C. elegans males, but its low expression was considered to be of minimal importance in the development of hermaphrodite embryos. Our study reveals that XOL-1 plays an important role as a regulator of developmental timing during hermaphrodite embryogenesis. Using a combination of imaging and bioinformatics techniques, we found that hermaphrodite embryos have an accelerated rate of cell division, as well as a more developmentally advanced transcriptional program when xol-1 is lost. Further analyses reveal that XOL-1 is responsible for regulating the timing of initiation of dosage compensation on the X chromosomes, and the appropriate expression of sex-biased transcriptional programs in hermaphrodites. We found that xol-1 mutant embryos overexpress the H3K9 methyltransferase MET-2 and have an altered H3K9me landscape. Some of these effects of the loss of xol-1 gene were reversed by the loss of met-2. These findings demonstrate that XOL-1 plays an important role as a developmental regulator in embryos of both sexes, and that MET-2 acts as a downstream effector of XOL-1 activity in hermaphrodites.

TNFSF4
Also flagged:BUB1OSCCmalignant tumourcancertumourtranscription factors
Journal Article 2024-08-15 ✓ 1 Snippet Li X.
In-Text Gene Mentions

…CD200, CD40, CD276,TNFSF4, CD86, TNFRSF8, CD80,…

Show Full Abstract

<h4>Background</h4>Oral squamous cell carcinoma (OSCC) is the most common type of malignant tumour in the oral cavity, and it is known for its poor prognosis. Budding uninhibited by benzimidazoles 1 (BUB1) may be related to cancer prognosis; however, the specific relationship between BUB1 and OSCC prognosis remains largely unexplored.<h4>Methods</h4>The mRNA levels of BUB1 were analysed using data from the TCGA_OSCC and GSE23558 cohorts. OSCC samples from the TCGA_OSCC dataset were divided into low- and high-BUB1 expression groups based on the median BUB1 level. Furthermore, results of survival analysis, tumour mutation burden (TMB), gene set enrichment analysis (GSEA) pathways, and drug-sensitivity analysis were compared between the 2 groups.<h4>Results</h4>Based on the data from the TCGA_OSCC and GSE23558 cohorts, BUB1 mRNA levels were significantly upregulated in OSCC tissues compared to healthy controls. Moreover, high expression of BUB1 may serve as an independent indicator of poor prognosis in OSCC. Additionally, patients with high BUB1 expression also exhibited increased levels of immune checkpoints and TMB, suggesting that patients with high BUB1 expression may benefit from immunotherapy. Mechanistically, transcription factors ZFP64, TCF3, and ZNF281 were found to potentially bind to the promoter region of BUB1, thereby regulating its gene expression. Furthermore, GSEA results showed that BUB1 expression was closely related to cell cycle and tumour-related pathways in OSCC. Drug-sensitivity analysis showed that patients with high BUB1 expression may be more sensitive to gemcitabine, paclitaxel, or imatinib.<h4>Conclusions</h4>Collectively, results demonstrated that high BUB1 levels may be related to a poor prognosis of OSCC, highlighting its potential as a novel prognostic biomarker for OSCC.

HTT
Also flagged:L-asparaginasePAR2acute lymphoblastic leukemiaaLLhematologic cancerpediatric cancer
Journal Article 2024-08-15 ✓ 3 Snippets Lee JK, Kamran H, Lee KY.
In-Text Gene Mentions

…together with huntingtin (Htt) and the intracellular…

…form a ternary HAP1-Htt-IP3R complex that permits…

…of a functional HAP1-Htt-IP3R ternary complex and…

Show Full Abstract

L-asparaginase is a standard therapeutic option for acute lymphoblastic leukemia (aLL), a hematologic cancer that claims the most lives of pediatric cancer patients. Previously, we demonstrated that L-asparaginase kills aLL cells via a lethal rise in [Ca<sup>2+</sup>]<sub>i</sub> due to IP3R-mediated ER Ca<sup>2+</sup> release followed by calpain-1-Bid-caspase-3/12 activation (Blood, 133, 2222-2232). However, upstream targets of L-asparaginase that trigger IP3R-mediated ER Ca<sup>2+</sup> release remain elusive. Here, we show that L-asparaginase targets µ-OR1 and PAR2 and induces IP3R-mediated ER Ca<sup>2+</sup> release in aLL cells. In doing so, µ-OR1 plays a major role while PAR2 plays a minor role. Utilizing PAR2- and µ-OR1-knockdown cells, we demonstrate that L-asparaginase stimulation of µ-OR1 and PAR2 relays its signal via G<sub>αi</sub> and G<sub>αq</sub>, respectively. In PAR2-knockdown cells, stimulation of adenylate cyclase with forskolin or treatment with 8-CPT-cAMP reduces L-asparaginase-induced µ-OR1-mediated ER Ca<sup>2+</sup> release, suggesting that activation of µ-OR1 negatively regulates AC and cAMP. In addition, the PKA inhibitor 14-22 amide (myr) alone evokes ER Ca<sup>2+</sup> release, and subsequent L-asparaginase treatment does not induce further ER Ca<sup>2+</sup> release, indicating the involvement of PKA inhibition in L-asparaginase-induced µ-OR1-mediated ER Ca<sup>2+</sup> release, which can bypass the L-asparaginase-µ-OR1-AC-cAMP loop. This coincides with (a) the decreases in PKA-dependent inhibitory PLCβ3 Ser1105 phosphorylation, which prompts PLCβ3 activation and ER Ca<sup>2+</sup> release, and (b) BAD Ser118 phosphorylation, which leads to caspase activation and apoptosis. Thus, our findings offer new insights into the Ca<sup>2+</sup>-mediated mechanisms behind L-asparaginase-induced aLL cell apoptosis and suggest that PKA may be targeted for therapeutic intervention for aLL.

SERPINC1
Also flagged:C5aR1dementiaADnucleussynapseorganization
Journal Article 2024-08-15 ✓ 1 Snippet Schartz ND, Liang HY, Carvalho K, Chu SH, Mendoza-Arvilla A, Petrisko TJ, Gomez-Arboledas A, Mortazavi A, Tenner AJ.
In-Text Gene Mentions

…C3 and Serping1 (C1 InhibitorInhibitor) expressed predomina…

Show Full Abstract

Alzheimer's disease (AD) is the leading cause of dementia in older adults, and the need for effective, sustainable therapeutic targets is imperative. The complement pathway has been proposed as a therapeutic target. C5aR1 inhibition reduces plaque load, gliosis, and memory deficits in animal models, however, the cellular bases underlying this neuroprotection were unclear. Here, we show that the C5aR1 antagonist PMX205 improves outcomes in the Arctic48 mouse model of AD. A combination of single cell and single nucleus RNA-seq analysis of hippocampi derived from males and females identified neurotoxic disease-associated microglia clusters in Arctic mice that are C5aR1-dependent, while microglial genes associated with synapse organization and transmission and learning were overrepresented in PMX205-treated mice. PMX205 also reduced neurotoxic astrocyte gene expression, but clusters associated with protective responses to injury were unchanged. C5aR1 inhibition promoted mRNA-predicted signaling pathways between brain cell types associated with cell growth and repair, while suppressing inflammatory pathways. Finally, although hippocampal plaque load was unaffected, PMX205 prevented deficits in short-term memory in female Arctic mice. In conclusion, C5aR1 inhibition prevents cognitive loss, limits detrimental glial polarization while permitting neuroprotective responses, as well as leaving most protective functions of complement intact, making C5aR1 antagonism an attractive therapeutic strategy for AD.

Also flagged:FIGNL1FIRRMnucleoproteinstrand exchangeRAD51DMC1
Journal Article 2024-08-15 No Snippets Zainu A, Dupaigne P, Bouchouika S, Cau J, Clément JAJ, Auffret P, Ropars V, Charbonnier JB, de Massy B, Mercier R, Kumar R, Baudat F.
Show Full Abstract

During meiosis, nucleoprotein filaments of the strand exchange proteins RAD51 and DMC1 are crucial for repairing SPO11-generated DNA double-strand breaks (DSBs) by homologous recombination (HR). A balanced activity of positive and negative RAD51/DMC1 regulators ensures proper recombination. Fidgetin-like 1 (FIGNL1) was previously shown to negatively regulate RAD51 in human cells. However, FIGNL1's role during meiotic recombination in mammals remains unknown. Here, we decipher the meiotic functions of FIGNL1 and FIGNL1 Interacting Regulator of Recombination and Mitosis (FIRRM) using male germline-specific conditional knock-out (cKO) mouse models. Both FIGNL1 and FIRRM are required for completing meiotic prophase in mouse spermatocytes. Despite efficient recruitment of DMC1 on ssDNA at meiotic DSB hotspots, the formation of late recombination intermediates is defective in Firrm cKO and Fignl1 cKO spermatocytes. Moreover, the FIGNL1-FIRRM complex limits RAD51 and DMC1 accumulation on intact chromatin, independently from the formation of SPO11-catalyzed DSBs. Purified human FIGNL1ΔN alters the RAD51/DMC1 nucleoprotein filament structure and inhibits strand invasion in vitro. Thus, this complex might regulate RAD51 and DMC1 association at sites of meiotic DSBs to promote proficient strand invasion and processing of recombination intermediates.

POU3F2
Also flagged:cadmiumbrain developmentgestationbehavioralmetalsneurodevelopmental disorders
Journal Article 2024-08-15 ✓ 1 Snippet Ma Q, Yang Z, Yang C, Lin M, Gong M, Deng P, He M, Lu Y, Zhang K, Pi H, Qu M, Yu Z, Zhou Z, Chen C.
In-Text Gene Mentions

…Gria2, Gng5 andPou3f2in C16 (Supplementary…

Show Full Abstract

The effects of neurotoxicant cadmium (Cd) exposure on brain development have not been well elucidated. To investigate this, we have herein subjected pregnant mice to low-dose Cd throughout gestation. Using single-cell RNA sequencing (scRNA-seq), we explored the cellular responses in the embryonic brain to Cd exposure, and identified 18 distinct cell subpopulations that exhibited varied responses to Cd. Typically, Cd exposure impeded the development and maturation of cells in the brain, especially progenitor cells such as neural progenitor cells (NPCs) and oligodendrocyte progenitor cells (OPCs). It also caused significant cell subpopulation shifts in almost all the types of cells in the brain. Additionally, Cd exposure reduced the dendritic sophistication of cortical neurons in the offspring. Importantly, these changes led to aberrant Ca<sup>2+</sup> activity in the cortex and neural behavior changes in mature offspring. These data contribute to our understanding of the effects and mechanisms of Cd exposure on brain development and highlight the importance of controlling environmental neurotoxicant exposure at the population level.

HTT
Also flagged:AMPA receptorsdopamineserotoninnorepinephrine5-HTNE transporters
Journal Article 2024-08-15 ✓ 5 Snippets Daniels S, El Mansari M, Blier P.
In-Text Gene Mentions

…and 5-HT transporter (5-HTT), the RT50 values…

…of NET and5-HTT, respectively.…

…to blockade of5-HTTbecause the 5-HTT…

…5-HTT because the5-HTTblocker escitalopram did…

…previously reported for5-HTT[ 62 ,…

Show Full Abstract

Addition of dopamine (DA)/serotonin (5-HT) partial agonists to 5-HT/norepinephrine (NE) reuptake inhibitors are commonly used to enhance the antidepressant response. The simultaneous inhibition of 5-HT and NE transporters with venlafaxine and its combination of brexpiprazole, which blocks the α<sub>2</sub>-adrenergic autoreceptor on NE terminals, could constitute a superior strategy. Anesthetized rats received venlafaxine and brexpiprazole for 2 and 14 days, then the firing activity of dorsal raphe nucleus 5-HT, locus coeruleus NE, and ventral tegmental area DA neurons were assessed. Net 5-HT and NE neurotransmissions were evaluated by assessing the tonic activation of 5-HT<sub>1A</sub>, and α<sub>1</sub>- and α<sub>2</sub>-adrenergic receptors in the hippocampus. The combination of brexpiprazole with venlafaxine resulted in normalized 5-HT and NE neuron activity, which occurred earlier than that with venlafaxine alone. A significant enhancement of the tonic activation of 5-HT<sub>1A</sub> receptors and α<sub>2</sub>-adrenoceptors in the hippocampus was observed following administration of the combination for 14 days. The combination more than doubled the number of DA neurons per electrode descent, after both 2 and 14 days, while this increase was observed only after 14 days of venlafaxine administration. This increase in population activity was prevented by NBQX, an AMPA receptor antagonist. In conclusion, early during administration, the combination of venlafaxine with brexpiprazole normalized firing activity of 5-HT and NE neurons, and increased the population activity of DA neurons through AMPA receptors. In the hippocampus, there was an overall increase in both 5-HT and NE transmissions. These results imply that this strategy could be a rapid-acting approach to treat depression.

SLC2A14
Also flagged:Methylationhearingpathogenesistinnituscytosinescytosine
Journal Article 2024-08-15 ✓ 3 Snippets Bhatt IS, Garay JAR, Torkamani A, Dias R.
In-Text Gene Mentions

Genes within or in the proximity of hypomethylated DMRs associated with tinnitus included HLA-DPB2, PM20D1, TMEM18, SNTG2, MUC4, MIR886, MIR596, TXNRD1, EID3, SDHAP3, HLA-DPB2, LASS3 (CERS3), C10orf11 (LRMDA), HLA-DQB1, NADK, SZRD1, MFAP2, NUP210L, TPM3, INTS9, and SLC2A14.

…INTS9 , andSLC2A14.…

SLC2A14

Show Full Abstract

<h4>Purpose</h4>Tinnitus, the perception of sound without any external sound source, is a prevalent hearing health concern. Mounting evidence suggests that a confluence of genetic, environmental, and lifestyle factors can influence the pathogenesis of tinnitus. We hypothesized that alteration in DNA methylation, an epigenetic modification that occurs at cytosines of cytosine-phosphate-guanine (CpG) dinucleotide sites, where a methyl group from S-adenyl methionine gets transferred to the fifth carbon of the cytosine, could contribute to tinnitus. DNA methylation patterns are tissue-specific, but the tissues involved in tinnitus are not easily accessible in humans. This pilot study used saliva as a surrogate tissue to identify differentially methylated CpG regions (DMRs) associated with tinnitus. The study was conducted on healthy young adults reporting bilateral continuous chronic tinnitus to limit the influence of age-related confounding factors and health-related comorbidities.<h4>Methods</h4>The present study evaluated the genome-wide methylation levels from saliva-derived DNA samples from 24 healthy young adults with bilateral continuous chronic tinnitus (> 1 year) and 24 age, sex, and ethnicity-matched controls with no tinnitus. Genome-wide DNA methylation was evaluated for > 850,000 CpG sites using the Infinium Human Methylation EPIC BeadChip. The association analysis used the Bumphunter algorithm on 23 cases and 20 controls meeting the quality control standards. The methylation level was expressed as the area under the curve of CpG sites within DMRs.The FDR-adjusted p-value threshold of 0.05 was used to identify statistically significant DMRs associated with tinnitus.<h4>Results</h4>We obtained 25 differentially methylated regions (DMRs) associated with tinnitus. Genes within or in the proximity of the hypermethylated DMRs related to tinnitus included LCLAT1, RUNX1, RUFY1, NUDT12, TTC23, SLC43A2, C4orf27 (STPG2), and EFCAB4B. Genes within or in the proximity of hypomethylated DMRs associated with tinnitus included HLA-DPB2, PM20D1, TMEM18, SNTG2, MUC4, MIR886, MIR596, TXNRD1, EID3, SDHAP3, HLA-DPB2, LASS3 (CERS3), C10orf11 (LRMDA), HLA-DQB1, NADK, SZRD1, MFAP2, NUP210L, TPM3, INTS9, and SLC2A14. The burden of genetic variation could explain the differences in the methylation levels for DMRs involving HLA-DPB2, HLA-DQB1, and MUC4, indicating the need for replication in large independent cohorts.<h4>Conclusion</h4>Consistent with the literature on comorbidities associated with tinnitus, we identified genes within or close to DMRs involved in auditory functions, chemical dependency, cardiovascular diseases, psychiatric conditions, immune disorders, and metabolic syndromes. These results indicate that epigenetic mechanisms could influence tinnitus, and saliva can be a good surrogate for identifying the epigenetic underpinnings of tinnitus in humans. Further research with a larger sample size is needed to identify epigenetic biomarkers and investigate their influence on the phenotypic expression of tinnitus.

Also flagged:primary ciliary dyskinesiacystic fibrosisCFbronchiectasisorganizationDecompensated heart failure
Journal Article 2024-08-15 No Snippets Hoffmann AT, Mai A, Baum K, Schlegtendal A, Maier C, Stein J, Tokic M, Dillenhöfer S, Lücke T, Timmesfeld N, Brinkmann F.
Show Full Abstract

<h4>Background</h4>Primary ciliary dyskinesia (PCD) is a rare genetical disease with malfunction of the motile cilia leading to impaired muco-ciliary clearance in the respiratory tract. There is no cure for PCD, only supportive therapy aimed at minimizing the progression of the disease and improving the patient's quality of life (QoL). Physical activity (PA) is one of these recommended supportive therapies for people with PCD (pwPCD). However, there is no scientific evidence to support this recommendation. In addition, regular medical advice to increase PA remains largely ineffective in pwPCD.<h4>Methods</h4>To test the main hypothesis, that an individualized and supported PA program leads to a better QoL 6 months after randomization (QoL-PCD questionnaire) compared to usual recommendation in pwPCD, 158 pwPCD aged 7 to 55 years are to be included in this multi-center randomized controlled trial (RCT). After the screening visit, a 1:1 randomization stratified by age group and FEV1 will be performed. A QoL-PCD questionnaire, motor test, and lung function will be carried out at regular intervals in both groups. PA is recorded in both groups using activity trackers during the study period. The main aim of the trial is to estimate the difference in the change of QoL between the groups after 6 months. Therefore, our full analysis set consists of all randomized patients and analysis is performed using the intention-to-treat principle. Statistical software R ( http://www.r-project.org ) is used. Ethical approvement without any reservations: RUB Bochum Ethics Committee (No. 23-7938; December 4, 2023). Recruitment start: March 2024.<h4>Discussion</h4>Limitations result from the rarity of PCD with its broad disease spectrum and the large age range. These are reduced by stratified randomization and the measurement of the individual change in QoL as primary endpoint. In our view, only a PA program tailored to individual needs with close contact to trainers offers the chance to meet personal needs of pwPCD and to establish PA as a pillar of therapy in the long term. The study protocol explains all procedures and methods of recruitment, implementation of the study visits and intervention, measures for patient and data safety, and for minimizing risks and bias.<h4>Trial registration</h4>German Clinical Trials Register (DRKS) 00033030. Registered on December 7, 2023. Update 10 July 2024. STUDY PROTOCOL VERSION 10: Version 1.2; 12 June 2024.

BTN2A1
Also flagged:T-cell antigen receptorisoprenoidsynthesistumorsaminobisphosphonatesBTN
Journal Article 2024-08-15 ✓ 3 Snippets Herrmann T, Karunakaran MM.
In-Text Gene Mentions

…ch BTN3A1-A2/A3-heteromers andBTN2A1homodimers form a…

…B30.2 domains ofBTN2A1.…

…this results inBTN2A1-IgV binding to Vγ9-TCR…

Show Full Abstract

Vγ9Vδ2 T cells comprise 1-10% of human peripheral blood T cells. As multifunctional T cells with a strong antimicrobial and antitumor potential, they are of strong interest for immunotherapeutic development. Their hallmark is the eponymous Vγ9Vδ2 T-cell antigen receptor (TCR), which mediates activation by so-called "phosphoantigens" (PAg). PAg are small pyrophosphorylated intermediates of isoprenoid synthesis of microbial or host origin, with the latter elevated in some tumors and after administration of aminobisphosphonates. This review summarizes the progress in understanding PAg-recognition, with emphasis on the interaction between butyrophilins (BTN) and PAg and insights gained by phylogenetic studies on BTNs and Vγ9Vδ2 T cells, especially the comparison of human and alpaca. It proposes a composite ligand model in which BTN3A1-A2/A3-heteromers and BTN2A1 homodimers form a Vγ9Vδ2 TCR activating complex. An initiating step is the binding of PAg to the intracellular BTN3A1-B30.2 domain and formation of a complex with the B30.2 domains of BTN2A1. On the extracellular surface this results in BTN2A1-IgV binding to Vγ9-TCR framework determinants and BTN3A-IgV to additional complementarity determining regions of both TCR chains. Unresolved questions of this model are discussed, as well as questions on the structural basis and the physiological consequences of PAg-recognition.

Also flagged:brain tumourtumourglioblastomapathogenesistumours of theTP53
Journal Article 2024-08-15 No Snippets Lucchini S, Constantinou M, Marino S.
Show Full Abstract

Glioblastoma is the most common primary malignant brain tumour. Despite decades of intensive research in the disease, its prognosis remains poor, with an average survival of only 14 months after diagnosis. The remarkable level of intra- and interpatient heterogeneity is certainly contributing to the lack of progress in tackling this tumour. Epigenetic dysregulation plays an important role in glioblastoma biology and significantly contributes to intratumour heterogeneity. However, it is becoming increasingly clear that it also contributes to intertumour heterogeneity, which historically had mainly been linked to diverse genetic events occurring in different patients. In this review, we explore how DNA methylation, chromatin remodelling, microRNA (miRNA) dysregulation, and long noncoding RNA (lncRNA) alterations contribute to intertumour heterogeneity in glioblastoma, including its implications for advanced tumour stratification, which is the essential first step for developing more effective patient-specific therapeutic approaches.

Also flagged:Autism Spectrum DisorderAutistic spectrum disorderneurodevelopmental disabilitybrain developmentAutismAutistic
Journal Article 2024-08-15 No Snippets Chair SY, Chow KM, Chan CW, Chan JY, Law BM, Waye MM.
Show Full Abstract

Autistic spectrum disorder (ASD) is a neurodevelopmental disability characterised by the impairment of social interaction and communication ability. The alarming increase in its prevalence in children urged researchers to obtain a better understanding of the causes of this disease. Genetic factors are considered to be crucial, as ASD has a tendency to run in families. In recent years, with technological advances, the importance of structural variations (SVs) in ASD began to emerge. Most of these studies, however, focus on the Caucasian population. As a populated ethnicity, ASD shall be a significant health issue in China. This systematic review aims to summarise current case-control studies of SVs associated with ASD in the Chinese population. A list of genes identified in the nine included studies is provided. It also reveals that similar research focusing on other genetic backgrounds is demanded to manifest the disease etiology in different ethnic groups, and assist the development of accurate ethnic-oriented genetic diagnosis.

Also flagged:MicroorganismBiodegradation2,4-dichlorophenoxyacetic aciddegradationamino acidsalpha-ketoglutarate-dependent
Journal Article 2024-08-15 No Snippets Chen SF, Chen WJ, Song H, Liu M, Mishra S, Ghorab MA, Chen S, Chang C.
Show Full Abstract

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) has been widely used around the world in both agricultural and non-agricultural fields due to its high activity. However, the heavy use of 2,4-D has resulted in serious environmental contamination, posing a significant risk to non-target organisms, including human beings. This has raised substantial concerns regarding its impact. In addition to agricultural use, accidental spills of 2,4-D can pose serious threats to human health and the ecosystem, emphasizing the importance of prompt pollution remediation. A variety of technologies have been developed to remove 2,4-D residues from the environment, such as incineration, adsorption, ozonation, photodegradation, the photo-Fenton process, and microbial degradation. Compared with traditional physical and chemical remediation methods, microorganisms are the most effective way to remediate 2,4-D pollution because of their rich species, wide distribution, and diverse metabolic pathways. Numerous studies demonstrate that the degradation of 2,4-D in the environment is primarily driven by enzymatic processes carried out by soil microorganisms. To date, a number of bacterial and fungal strains associated with 2,4-D biodegradation have been isolated, such as <i>Sphingomonas</i>, <i>Pseudomonas</i>, <i>Cupriavidus</i>, <i>Achromobacter</i>, <i>Ochrobactrum</i>, <i>Mortierella</i>, and <i>Umbelopsis</i>. Moreover, several key enzymes and genes responsible for 2,4-D biodegradation are also being identified. However, further in-depth research based on multi-omics is needed to elaborate their role in the evolution of novel catabolic pathways and the microbial degradation of 2,4-D. Here, this review provides a comprehensive analysis of recent progress on elucidating the degradation mechanisms of the herbicide 2,4-D, including the microbial strains responsible for its degradation, the enzymes participating in its degradation, and the associated genetic components. Furthermore, it explores the complex biochemical pathways and molecular mechanisms involved in the biodegradation of 2,4-D. In addition, molecular docking techniques are employed to identify crucial amino acids within an alpha-ketoglutarate-dependent 2,4-D dioxygenase that interacts with 2,4-D, thereby offering valuable insights that can inform the development of effective strategies for the biological remediation of this herbicide.

BTN2A1
Also flagged:interleukin-12CXCR3infectioncell activationCCR7CD4
Journal Article 2024-08-15 ✓ 1 Snippet Ibraheem Y, Bayarsaikhan G, Macalinao ML, Kimura K, Yui K, Aoshi T, Inoue SI.
In-Text Gene Mentions

…butyrophilin family proteinsBTN2A1and BTN3A1.…

Show Full Abstract

γδ T cells facilitate the CD4<sup>+</sup> T helper 1 (Th1) cell response against <i>Plasmodium</i> infection by activating conventional dendritic cells (cDCs), although the underlying mechanism remains elusive. Our study revealed that γδ T cells promote the complete maturation and production of interleukin-12 and CXCR3-ligands specifically in type 1 cDCs (cDC1), with minimal impact on cDC2 and monocyte derived DCs (Mo-DCs). During the initial infection phase, γδ T cell activation and temporal accumulation in the splenic white pulp, alongside cDC1, occur via CCR7-signaling. Furthermore, cDC1/γδ T cell interactions in the white pulp are amplified through CXCR3 signaling in γδ T cells, optimizing Th1 cell priming by cDC1. We also demonstrated how transitional Th1 cells arise in the white pulp before establishing their presence in the red pulp as fully differentiated Th1 cells. Additionally, we elucidate the reciprocal activation between γδ T cells and cDC1s. These findings suggest that Th1 cell priming is orchestrated by this reciprocal activation in the splenic white pulp during the early phase of blood-stage <i>Plasmodium</i> infection.

Also flagged:gastrin-releasing peptide receptorGRPRbombesinpeptidecancerprostate cancer
Journal Article 2024-08-15 No Snippets Nagy Á, Abouzayed A, Kanellopoulos P, Landmark F, Bezverkhniaia E, Tolmachev V, Orlova A, Eriksson Karlström A.
Show Full Abstract

Targeting the gastrin-releasing peptide receptor (GRPR) with the bombesin analogue RM26, a 9 aa peptide, has been a promising strategy for cancer theranostics, with recent success in radionuclide imaging of prostate cancer. However, therapeutic application of the short peptide RM26 would require a longer half-life to prevent fast clearance from the circulation. Conjugation to an albumin-binding domain (ABD) is a viable strategy to extend the <i>in vivo</i> half-life of peptides and proteins. We previously reported an ABD-fused RM26 peptide targeting GRPR (ABD-RM26 Gen 1) that showed prolonged and stable tumor uptake over 144 h; however, the observed high kidney uptake indicated that the conjugate's binding to albumin was reduced and that this could be an obstacle for its use as a delivery system for targeted therapy, especially for radiotherapy. Here, we have designed, produced, and preclinically evaluated a series of novel ABD-RM26 conjugates with the aim of improving the conjugate's binding to albumin and decreasing the kidney uptake. We developed three second-generation constructs with varying formats, differing in the relative positions of the targeting moieties and the radionuclide chelator. The produced conjugates were radiolabeled with indium-111 and evaluated <i>in vitro</i> and <i>in vivo</i>. All constructs displayed improved biophysical characteristics, biodistribution, and lower kidney uptake compared to previously reported first-generation molecules. The ABD-RM26 Gen 2A conjugate showed the best biodistribution profile with a nearly 6-fold reduction in kidney uptake. However, the ABD-RM26 Gen 2A conjugate's binding to GRPR was compromised. This conjugate's assembly of albumin- and GRPR-binding moieties might be used for further development of drug conjugates for targeted therapy/radiotherapy of GRPR-expressing cancers.

HFE
Also flagged:type 2 diabetes mellitusnon-alcoholic fatty liver diseaseNAFLDFenofibrateglucoseinsulin resistance
Journal Article 2024-08-15 ✓ 1 Snippet Huang D, Bai F, Hu T, Li J, Wang G, Wu C.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>To elucidate the functional role and underlying mechanism of Salvia miltiorrhiza bge. f. alba (SMBFA) in patients with type 2 diabetes mellitus (T2DM) accompanied by non-alcoholic fatty liver disease (NAFLD).<h4>Methods</h4>A retrospective analysis was conducted on 90 patients with T2DM-NAFLD who met the inclusion criteria. The control group was comprised of 45 patients treated with Fenofibrate, while the observation group consisted of 45 patients who received SMBFA in addition to the control treatment. An in vivo mouse model of T2DM-NAFLD was established using a high-fat diet combined with streptozotocin. Serum levels of fasting plasma glucose (FPG), 2-hour postprandial glucose (2h PG), hemoglobin A1c (HbA1c), homeostasis model assessment of insulin resistance (HOMA-IR), total cholesterol (TC), and triglyceride (TG) were measured in both patients and mice using an automated biochemical analyzer. Liver indices and function were also evaluated. ELISA assays were performed to quantify inflammatory cytokine levels. Western blotting was utilized to assess the protein levels related to the stimulator of interferon genes (STING)-interferon regulatory factor 3 (IRF3) pathway.<h4>Results</h4>After treatment, significant reductions in blood glucose indices, HOMA-IR, lipid metabolism markers, liver function indices, and inflammatory cytokines were observed in both groups of T2DM-NAFLD patients. Notably, the decreases were more pronounced in the observation group compared to the control group. Similarly, in T2DM-NAFLD mouse models, the levels of these parameters were significantly lower in the observation group than in the normal control (NC) group. Additionally, SMBFA suppressed the elevated levels of STING, p-IRF3, and p-TANK-binding kinase 1 in the T2DM-NAFLD mice.<h4>Conclusion</h4>SMBFA exhibits the potential to regulate glucose and lipid metabolism, inhibit insulin resistance, and protect liver function by modulating the STING signaling pathway.

Also flagged:ADtauamyloid precursor proteinAPPamyloid-beta
Journal Article 2024-08-15 No Snippets Dey S, Thamaraikani T, Vellapandian C.
Show Full Abstract

Alzheimer's disease (AD) is a neurological condition that progressively impairs cognitive function and results in memory loss. Despite substantial research efforts, little is known about the specific processes driving AD, and there are few proven therapies. Because of their physiological and genetic resemblance to humans, zebrafish (<i>Danio rerio</i>) have become an important model organism for furthering research on AD. This abstract discusses the difficulties faced, looks at the insights currently garnered from zebrafish models, and suggests future research options. AD knowledge has greatly benefited from the use of zebrafish models. Transgenic zebrafish that express human AD-associated genes, such as tau and amyloid precursor protein (APP), display tau neurofibrillary tangles (NFTs) and amyloid-beta (Aβ) plaques, two of the disease's main clinical characteristics. These models have clarified the roles of oxidative stress, inflammation, and calcium homeostasis in the course of AD and allowed for the purpose of high-throughput screening of potential therapeutic agents. Understanding the growth and deterioration of neurons has been greatly aided by real-time zebrafish imaging. Fully using zebrafish models in AD research requires addressing a number of issues. The dissimilarities in zebrafish anatomy and physiology from humans, the difficulty of developing models that replicate progressive and late-onset AD (LOAD), and the requirement for standardized procedures to evaluate alterations in zebrafish cognition and behavior are a few issues. Furthermore, variations in the genetic makeup of zebrafish strains might affect the results of experiments. Future directions include developing standardized behavioral assays and cognitive tests, working together to create extensive databases of zebrafish genetic and phenotypic data, and using genetic engineering techniques like CRISPR/Cas9 to create more complex zebrafish models. Combining zebrafish models with other model species helps expedite the conversion of research results into therapeutic applications and offers a more thorough knowledge of AD. To sum up, zebrafish models have made a substantial contribution to Alzheimer's research by offering insightful information on the causes of the illness and possible therapies. By tackling present issues and formulating a planned future path, we can improve the use of zebrafish to decipher the mysteries of Alzheimer's and help create successful treatments.

Preprints.org 2024-08-15 Preprint (No Snippets API) Huiban L, Stanciu C, Muzica CM, Girleanu I, Avram RI, Damian IR, Nastasa R, Stratina E, Zenovia S, Minea H, Stafie R, Rotaru A, Singeap A, Chiriac S, Balmus IM, Trifan A.
Show Full Abstract

<h4>Background and Aims: </h4> Sustained virologic response (SVR) lead to the decrease of portal hypertension, the regression of fibrosis, the improvement of the hepatic synthesis of procoagulant and anticoagulant factors. We aimed to assess the influence of SVR on coagulation parameters in HCV cirrhotic patients treated with DAAs. <h4>Methods:</h4> We performed a prospective study in the Institute of Gastroenterology and Hepatology Iasi, Romania, between January 2022 and February 2024. We included patients diagnosed with compensated and decompensated HCV-related liver cirrhosis, treated with direct antivirals (PrOD &plusmn; RBV or SOF/LED &plusmn; RBV) for 12/24 weeks. Blood samples for biochemical, immunological and coagulation tests were collected at baseline, EOT and SVR12/24. <h4>Results:</h4> We analyzed a group of 52 patients with HCV-related liver cirrhosis, predominantly female (68.0%), the degree of severity of cirrhosis placed the patients mainly in Child-Pugh classes B (40%) and C (36%). All patients achieved SVR. The MELD score decrease at EOT (13.48 &plusmn; 4.273; p =0.001), and SVR (9.88 &plusmn; 2.774; p = 0.000), compared to baseline (14.92 &plusmn; 4.707). Fibroscan values decreased at SVR (17.596 &plusmn; 3.7276; p = 0.000) compared to baseline (26.068 &plusmn; 7.0954). For all common coagulation parameters (platelets, INR, PT, fibrinogen, aPTT) there was a trend towards improvement during treatment, changes that were statistically significant for the majority of patients. Factor II low at baseline (75.40 &plusmn; 7.506), increases at EOT (87.40 &plusmn; 9.587), and later at SVR (99.12 &plusmn; 11.695; p = 0.000). FVIII values increased at baseline (175.52 &plusmn; 16.414) decrease at EOT (151.48 &plusmn; 13.703) and SVR (143.40 &plusmn; 13.937). FvW values decreased during treatment (146.84 &plusmn; 9.428 &ndash; baseline, 141.32 &plusmn; 9.690; p =0.000 &ndash; EOT, 126.68 &plusmn; 17.960 &ndash; SVR). In regards to the anticoagulant factors (PC, PS, ATIII), a significant improvement was brought on by SVR. Advanced stages of liver disease showed the most diminished FII activity, while at baseline and in Child-Pugh C patients we recorded the highest values of FVIII and FvW. <h4>Conclusions:</h4> Our study proved that the &ldquo;reset&rdquo; of the coagulopathy might be due to the improving of the liver function due to viral eradication secondary to AAD therapy.

Also flagged:STIM1FAM134Bcell proliferationAutophagyEndoplasmic reticulumER-phagy receptor
Journal Article 2024-08-14 No Snippets Kajiho H, Sakisaka T.
Show Full Abstract

Autophagy is classified as nonselective or selective depending on the types of degrading substrates. Endoplasmic reticulum (ER)-phagy is a form of selective autophagy for transporting the ER-resident proteins to autolysosomes. FAM134B, a member of the family with sequence similarity 134, is a well-known ER-phagy receptor. Dysfunction of FAM134B results in several diseases including viral infection, inflammation, neurodegenerative disorder, and cancer, indicating that FAM134B has crucial roles in various kinds of intracellular functions. However, how FAM134B-mediated ER-phagy regulates intracellular functions is not well understood. In this study, we found that FAM134B knockdown in mammalian cells accelerated cell proliferation. FAM134B knockdown increased the protein amount of stromal interaction molecule 1 (STIM1), an ER Ca<sup>2+</sup> sensor protein mediating the store-operated Ca<sup>2+</sup> entry involved in G1 to S phase transition. FAM134B bound to STIM1 through its C-terminal cytosolic region. FAM134B knockdown reduced transport of STIM1 from the ER to autolysosomes. Finally, FAM134B knockdown accelerated G1 to S phase transition. These results suggest that FAM134B is involved in cell proliferation possibly through degradation of STIM1 via ER-phagy.

TAOK3
Also flagged:MASTLdesthiobiotinHSP90kinasesmicrotubule-associated serine/threonine kinase-likeNEDD4-1
Journal Article 2024-08-14 ✓ 1 Snippet Choi KM, Kim SJ, Ji MJ, Kim E, Kim JS, Park HM, Kim JY.
In-Text Gene Mentions

…MAP4K5, PKM, STK38,TAOK3, EIF2AK2, and DTYMK,…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) is a prevalent malignancy with limited therapeutic options for advanced stages. This study aimed to identify novel therapeutic targets for GC by profiling HSP90 client kinases.<h4>Methods</h4>We used mass spectrometry-based activity-based protein profiling (ABPP) with a desthiobiotin-ATP probe, combined with sensitivity analysis of HSP90 inhibitors, to profile kinases in a panel of GC cell lines. We identified kinases regulated by HSP90 in inhibitor-sensitive cells and investigated the impact of MASTL knockdown on GC cell behavior. Global proteomic analysis following MASTL knockdown was performed, and bioinformatics tools were used to analyze the resulting data.<h4>Results</h4>Four kinases-MASTL, STK11, CHEK1, and MET-were identified as HSP90-regulated in HSP90 inhibitor-sensitive cells. Among these, microtubule-associated serine/threonine kinase-like (MASTL) was upregulated in GC and associated with poor prognosis. MASTL knockdown decreased migration, invasion, and proliferation of GC cells. Global proteomic profiling following MASTL knockdown revealed NEDD4-1 as a potential downstream mediator of MASTL in GC progression. NEDD4-1 was also upregulated in GC and associated with poor prognosis. Similar to MASTL inhibition, NEDD4-1 knockdown suppressed migration, invasion, and proliferation of GC cells.<h4>Conclusions</h4>Our multi-proteomic analyses suggest that targeting MASTL could be a promising therapy for advanced gastric cancer, potentially through the reduction of tumor-promoting proteins including NEDD4-1. This study enhances our understanding of kinase signaling pathways in GC and provides new insights for potential treatment strategies.

LRRC7
Also flagged:secretionprotein secretionbioluminescenceamino acidextracellularluciferase
Journal Article 2024-08-14 ✓ 3 Snippets Yang Y, Scott AA, Kneuper H, Alcock F, Palmer T.
In-Text Gene Mentions

…belonging to theLap1(DUF3130) and Lap2…

…for secretion, withLap1being a DUF3130…

…each case, theLap1and Lap2 proteins…

Show Full Abstract

Successful colonization by the opportunistic pathogen <i>Staphylococcus aureus</i> depends on its ability to interact with other microorganisms. <i>Staphylococcus aureus</i> strains harbour a T7b subtype of type VII secretion system (T7SSb), a protein secretion system found in a wide variety of Bacillota, which functions in bacterial antagonism and virulence. Assessment of T7SSb activity in <i>S. aureus</i> has been hampered by low secretion activity under laboratory conditions and the lack of a sensitive assay to measure secretion. Here, we have utilized NanoLuc binary technology to develop a simple assay to monitor protein secretion via detection of bioluminescence. Fusion of the 11 amino acid NanoLuc fragment to the conserved substrate EsxA permits its extracellular detection upon supplementation with the large NanoLuc fragment and luciferase substrate. Following miniaturization of the assay to 384-well format, we use high-throughput analysis to demonstrate that T7SSb-dependent protein secretion differs across strains and growth temperature. We further show that the same assay can be used to monitor secretion of the surface-associated toxin substrate TspA. Using this approach, we identify three conserved accessory proteins required to mediate TspA secretion. Co-purification experiments confirm that all three proteins form a complex with TspA.

UNC13C
Also flagged:malignant tumorpediatric cancersdefectscancercancerstumor
Journal Article 2024-08-14 ✓ 1 Snippet Liu Y, Glessner J, Qu HQ, Chang X, Qiu H, Wang T, Mentch FD, Hakonarson H.
In-Text Gene Mentions

…, VTI1A ,UNC13C, CACNA1H ,…

Show Full Abstract

There are two key signatures of pediatric cancers: (a) higher prevalence of germline alterations and (b) heterogeneity in alteration types. Recent population-based assessments have demonstrated that children with birth defects (BDs) are more likely to develop cancer even without chromosomal anomalies; therefore, explorations of genetic alterations in children with BDs and cancers could provide new insights into the underlying mechanisms for pediatric tumor development. We performed whole-genome sequencing (WGS) on blood-derived DNA for 1556 individuals without chromosomal anomalies, including 454 BD probands with at least one type of malignant tumor, 757 cancer-free children with BDs, and 345 healthy individuals, focusing on copy number variation (CNV) analysis. Roughly half of the children with BD-cancer have CNVs that are not identified in BD-only/healthy individuals, and CNVs are not evenly distributed among these patients. Strong heterogeneity was observed, with a limited number of cancer predisposition genes containing CNVs in more than three patients. Moreover, functional enrichments of genes with CNVs showed that dozens of patients have variations related to the same biological pathways, such as deletions of genes with neurological functions and duplications of immune response genes. Phenotype clustering uncovered recurrences of patients with sarcoma: A notable enrichment was observed involving non-coding RNA regulators, showing strong signals related to growth and cancer regulations in functional analysis. In conclusion, we conducted one of the first genomic studies exploring the impact of CNVs on cancer development in children with BDs, unveiling new insights into the underlying biological processes.

CA10
Also flagged:skin traumainfectionhemostasisalginatehyaluronic acidextracellular
Journal Article 2024-08-14 ✓ 1 Snippet Yang Y, Suo D, Xu T, Zhao S, Xu X, Bei HP, Wong KK, Li Q, Zheng Z, Li B, Zhao X.
In-Text Gene Mentions

…the G/Ca5-PLD and G/Ca10-PLD groups presented distinct…

Show Full Abstract

Current sprayable hydrogel masks lack the stepwise protection, cleansing, and nourishment of extensive wounds, leading to delayed healing with scarring. Here, we develop a sprayable biomimetic double wound mask (BDM) with rapid autophasing and hierarchical programming for scarless wound healing. The BDMs comprise hydrophobic poly (lactide-<i>co</i>-propylene glycol-<i>co</i>-lactide) dimethacrylate (PLD) as top layer and hydrophilic gelatin methacrylate (GelMA) hydrogel as bottom layer, enabling swift autophasing into bilayered structure. After photocrosslinking, BDMs rapidly solidify with strong interfacial bonding, robust tissue adhesion, and excellent joint adaptiveness. Upon implementation, the bottom GelMA layer could immediately release calcium ion for rapid hemostasis, while the top PLD layer could maintain a moist, breathable, and sterile environment. These traits synergistically suppress the inflammatory tumor necrosis factor-α pathway while coordinating the cyclic guanosine monophosphate/protein kinase G-Wnt/calcium ion signaling pathways to nourish angiogenesis. Collectively, our BDMs with self-regulated construction of bilayered structure could hierarchically program the healing progression with transformative potential for scarless wound healing.

MLLT10
Also flagged:chronic hydrocephalusidiopathicHydrocephalusnormal pressure hydrocephalusSLCO1A2AMZ1
Journal Article 2024-08-14 ✓ 5 Snippets Räsänen J, Heikkinen S, Mäklin K, Lipponen A, Kuulasmaa T, Mehtonen J, Korhonen VE, Junkkari A, Grenier-Boley B, Bellenguez C, Oinas M, Avellan C, Frantzén J, Kotkansalo A, Rinne J, Ronkainen A, Kauppinen M, von Und Zu Fraunberg M, Lönnrot K, Satopää J, Perola M, Koivisto AM, Julkunen V, Portaankorva AM, Mannermaa A, Soininen H, Helisalmi S, Jääskeläinen JE, Lambert JC, Eide PK, for FinnGen, Palotie A, Kurki MI, Hiltunen M, Leinonen V.
In-Text Gene Mentions

In the sensitivity analysis comparing only patients with iNPH (n = 1,055) with the controls (n = 451,091), 4 top loci near the following genes remained significant: rs7962263, <i>SLCO1A2</i> (OR 0.70, 95% CI 0.63-0.78, <i>p</i> = 2.1e-11); rs10828247, <i>MLLT10</i> (OR 0.74, 95% CI 0.62-0.82, <i>p</i> = 4.6e-10); rs798511, <i>AMZ1</i>/<i>GNA12</i> (OR 1.28, 95% CI 1.17-1.39, <i>p</i> = 1.7e-8); and rs56023709, <i>C16orf95</i> (OR 1.28, 95% CI 1.17-1.39, <i>p</i> = 1.7e-8).<h4>Discussion</h4>We identified 6 loci significantly associated with NPH in the thus far largest GWAS in chronic hydrocephalus.

…= 2.9e-12); rs10828247,MLLT10(OR 0.77, 95%…

…= 2.1e-11); rs10828247,MLLT10(OR 0.74, 95%…

…= 1.5e-11) nearMLLT10, rs561699566 and…

…= 4.6e-10) nearMLLT10, rs798511 (OR…

Show Full Abstract

<h4>Background and objectives</h4>Large-scale genome-wide studies of chronic hydrocephalus have been lacking. We conducted a genome-wide association study (GWAS) in normal pressure hydrocephalus (NPH).<h4>Methods</h4>We used a case-control study design implementing FinnGen data containing 473,691 Finns with genotypes and nationwide health records. Patients with NPH were selected based on <i>ICD-10</i> G91.2 diagnosis. To select patients with idiopathic NPH (iNPH) for sensitivity analysis, we excluded patients with a potentially known etiology of the condition using an algorithm on their disease history. The controls were the remaining non-hydrocephalic participants. For a replication analysis, the NPH cohort from UK Biobank (UKBB) was used.<h4>Results</h4>We included 1,522 patients with NPH (mean age 72.2 years, 53% women) and 451,091 controls (mean age 60.5 years, 44% women). In the GWAS comparing patients with NPH with the controls, we identified 6 gene regions significantly (<i>p</i> < 5.0e-8) associated with NPH that replicated in a meta-analysis with UKBB (NPH n = 173). The top loci near the following genes were rs7962263, <i>SLCO1A2</i> (odds ratio [OR] 0.71, 95% CI 0.65-0.78, <i>p</i> = 1.0e-14); rs798495, <i>AMZ1</i>/<i>GNA12</i> (OR 1.29, 95% CI 1.20-1.39, <i>p</i> = 2.9e-12); rs10828247, <i>MLLT10</i> (OR 0.77, 95% CI 0.71-0.83, <i>p</i> = 1.5e-11); rs561699566 and rs371919113, <i>CDCA2</i> (OR 0.76, 95% CI 0.70-0.82, <i>p</i> = 1.5e-11); rs56023709, <i>C16orf95</i> (OR 1.24, 95% CI 1.16-1.33, <i>p</i> = 3.0e-9); and rs62434144, <i>PLEKHG1</i> (OR 1.23, 95% CI 1.14-1.32, <i>p</i> = 1.4e-8). In the sensitivity analysis comparing only patients with iNPH (n = 1,055) with the controls (n = 451,091), 4 top loci near the following genes remained significant: rs7962263, <i>SLCO1A2</i> (OR 0.70, 95% CI 0.63-0.78, <i>p</i> = 2.1e-11); rs10828247, <i>MLLT10</i> (OR 0.74, 95% CI 0.62-0.82, <i>p</i> = 4.6e-10); rs798511, <i>AMZ1</i>/<i>GNA12</i> (OR 1.28, 95% CI 1.17-1.39, <i>p</i> = 1.7e-8); and rs56023709, <i>C16orf95</i> (OR 1.28, 95% CI 1.17-1.39, <i>p</i> = 1.7e-8).<h4>Discussion</h4>We identified 6 loci significantly associated with NPH in the thus far largest GWAS in chronic hydrocephalus. The genes near the top loci have previously been associated with blood-brain barrier and blood-CSF barrier function and with increased lateral brain ventricle volume. The effect sizes and allele frequencies remained similar in NPH and iNPH cohorts, indicating the identified loci are risk determinants for iNPH and likely not explained by associations with other etiologies. However, the exact role of these loci is still unknown, warranting further studies.

Also flagged:ExtracellularVesiclevesiclescancermetastatic lung adenocarcinomaLUAD
Journal Article 2024-08-14 No Snippets Sharma N, Angori S, Sandberg A, Mermelekas G, Lehtiö J, Wiklander OPB, Görgens A, Andaloussi SE, Eriksson H, Pernemalm M.
Show Full Abstract

Plasma-derived extracellular vesicles (pEVs) are a potential source of diseased biomarker proteins. However, characterizing the pEV proteome is challenging due to its relatively low abundance and difficulties in enrichment. This study presents a streamlined workflow to identify EV proteins from cancer patient plasma using minimal sample input. Starting with 400 μL of plasma, we generated a comprehensive pEV proteome using size exclusion chromatography (SEC) combined with HiRIEF prefractionation-based mass spectrometry (MS). First, we compared the performance of HiRIEF and long gradient MS workflows using control pEVs, quantifying 2076 proteins with HiRIEF. In a proof-of-concept study, we applied SEC-HiRIEF-MS to a small cohort (12) of metastatic lung adenocarcinoma (LUAD) and malignant melanoma (MM) patients. We also analyzed plasma samples from the same patients to study the relationship between plasma and pEV proteomes. We identified and quantified 1583 proteins in cancer pEVs and 1468 proteins in plasma across all samples. While there was substantial overlap, the pEV proteome included several unique EV markers and cancer-related proteins. Differential analysis revealed 30 DEPs in LUAD vs the MM group, highlighting the potential of pEVs as biomarkers. This work demonstrates the utility of a prefractionation-based MS for comprehensive pEV proteomics and EV biomarker discovery. Data are available via ProteomeXchange with the identifiers PXD039338 and PXD038528.

MLLT10
Also flagged:acute lymphoblastic leukaemiaALLtumourgene expressionchromatinleukaemia
Journal Article 2024-08-14 ✓ 1 Snippet Pölönen P, Di Giacomo D, Seffernick AE, Elsayed A, Kimura S, Benini F, Montefiori LE, Wood BL, Xu J, Chen C, Cheng Z, Newman H, Myers J, Iacobucci I, Li E, Sussman J, Hedges D, Hui Y, Diorio C, Uppuluri L, Frank D, Fan Y, Chang Y, Meshinchi S, Ries R, Shraim R, Li A, Bernt KM, Devidas M, Winter SS, Dunsmore KP, Inaba H, Carroll WL, Ramirez NC, Phillips AH, Kriwacki RW, Yang JJ, Vincent TL, Zhao Y, Ghate PS, Wang J, Reilly C, Zhou X, Sanders MA, Takita J, Kato M, Takasugi N, Chang BH, Press RD, Press RD, Loh M, Rampersaud E, Raetz E, Hunger SP, Tan K, Chang TC, Wu G, Pounds SB, Mullighan CG, Teachey DT.
In-Text Gene Mentions

MLLT10

Show Full Abstract

T-lineage acute lymphoblastic leukaemia (T-ALL) is a high-risk tumour<sup>1</sup> that has eluded comprehensive genomic characterization, which is partly due to the high frequency of noncoding genomic alterations that result in oncogene deregulation<sup>2,3</sup>. Here we report an integrated analysis of genome and transcriptome sequencing of tumour and remission samples from more than 1,300 uniformly treated children with T-ALL, coupled with epigenomic and single-cell analyses of malignant and normal T cell precursors. This approach identified 15 subtypes with distinct genomic drivers, gene expression patterns, developmental states and outcomes. Analyses of chromatin topology revealed multiple mechanisms of enhancer deregulation that involve enhancers and genes in a subtype-specific manner, thereby demonstrating widespread involvement of the noncoding genome. We show that the immunophenotypically described, high-risk entity of early T cell precursor ALL is superseded by a broader category of 'early T cell precursor-like' leukaemia. This category has a variable immunophenotype and diverse genomic alterations of a core set of genes that encode regulators of hematopoietic stem cell development. Using multivariable outcome models, we show that genetic subtypes, driver and concomitant genetic alterations independently predict treatment failure and survival. These findings provide a roadmap for the classification, risk stratification and mechanistic understanding of this disease.

Also flagged:mitochondrialgene expressioncancermetabolismMitochondriamitochondrion
Journal Article 2024-08-14 No Snippets Berner MJ, Wall SW, Echeverria GV.
Show Full Abstract

"Reprogramming of energy metabolism" was first considered an emerging hallmark of cancer in 2011 by Hanahan & Weinberg and is now considered a core hallmark of cancer. Mitochondria are the hubs of metabolism, crucial for energetic functions and cellular homeostasis. The mitochondrion's bacterial origin and preservation of their own genome, which encodes proteins and RNAs essential to their function, make them unique organelles. Successful generation of mitochondrial gene products requires coordinated functioning of the mitochondrial 'central dogma,' encompassing all steps necessary for mtDNA to yield mitochondrial proteins. Each of these processes has several levels of regulation, including mtDNA accessibility and protection through mtDNA packaging and epigenetic modifications, mtDNA copy number through mitochondrial replication, mitochondrial transcription through mitochondrial transcription factors, and mitochondrial translation through mitoribosome formation. Deregulation of these mitochondrial processes in the context of cancers has only recently been appreciated, with most studies being correlative in nature. Nonetheless, numerous significant associations of the mitochondrial central dogma with pro-tumor phenotypes have been documented. Several studies have even provided mechanistic insights and further demonstrated successful pharmacologic targeting strategies. Based on the emergent importance of mitochondria for cancer biology and therapeutics, it is becoming increasingly important that we gain an understanding of the underpinning mechanisms so they can be successfully therapeutically targeted. It is expected that this mechanistic understanding will result in mitochondria-targeting approaches that balance anticancer potency with normal cell toxicity. This review will focus on current evidence for the dysregulation of mitochondrial gene expression in cancers, as well as therapeutic opportunities on the horizon.

Also flagged:Polydimethylsiloxanetrichlorosilaneformationamino acidantibodies
Journal Article 2024-08-14 No Snippets Fischer K, Lulla A, So TY, Pereyra-Gerber P, Raybould MIJ, Kohler TN, Yam-Puc JC, Kaminski TS, Hughes R, Pyeatt GL, Leiss-Maier F, Brear P, Matheson NJ, Deane CM, Hyvönen M, Thaventhiran JED, Hollfelder F.
Show Full Abstract

Monoclonal antibodies are increasingly used to prevent and treat viral infections and are pivotal in pandemic response efforts. Antibody-secreting cells (ASCs; plasma cells and plasmablasts) are an excellent source of high-affinity antibodies with therapeutic potential. Current methods to study antigen-specific ASCs either have low throughput, require expensive and labor-intensive screening or are technically demanding and therefore not widely accessible. Here we present a straightforward technology for the rapid discovery of monoclonal antibodies from ASCs. Our approach combines microfluidic encapsulation of single cells into an antibody capture hydrogel with antigen bait sorting by conventional flow cytometry. With our technology, we screened millions of mouse and human ASCs and obtained monoclonal antibodies against severe acute respiratory syndrome coronavirus 2 with high affinity (<1 pM) and neutralizing capacity (<100 ng ml<sup>-1</sup>) in 2 weeks with a high hit rate (>85% of characterized antibodies bound the target). By facilitating access to the underexplored ASC compartment, the approach enables efficient antibody discovery and immunological studies into the generation of protective antibodies.

Also flagged:polymyxincarbapenemcarbapenemasemgrBpmrBpolymyxins
Journal Article 2024-08-14 No Snippets Wang X, Meng T, Dai Y, Ou HY, Wang M, Tang B, Sun J, Cheng D, Pan T, Tan R, Qu H.
Show Full Abstract

<h4>Purpose</h4>We aimed to explore the prevalence and within-host evolution of resistance in polymyxin-heteroresistant carbapenem-resistant Klebsiella pneumoniae (PHR-CRKP) in critically ill patients.<h4>Methods</h4>We performed an epidemiological analysis of consecutive patients with PHR-CRKP from clinical cases. Our study investigated the within-host resistance evolution and its clinical significance during polymyxin exposure. Furthermore, we explored the mechanisms underlying the dynamic evolution of polymyxin resistance at both subpopulation and genetic levels, involved population analysis profile test, time-killing assays, competition experiments, and sanger sequencing. Additionally, comparative genomic analysis was performed on 713 carbapenemase-producing K. pneumoniae strains.<h4>Results</h4>We enrolled 109 consecutive patients, and PHR-CRKP was found in 69.7% of patients without previous polymyxin exposure. 38.1% of PHR-CRKP isolates exhibited polymyxin resistance and led to therapeutic failure in critically ill scenarios. An increased frequency of resistant subpopulations was detected during PHR-CRKP evolution, with rapid regrowth of resistant subpopulations under high polymyxin concentrations, and a fitness cost in an antibiotic-free environment. Mechanistic analysis revealed that diverse mgrB insertions and pmrB hypermutations contributed to the dynamic changes in polymyxin susceptibility in dominant resistant subpopulations during PHR evolution, which were validated by comparative genomic analysis. Several deleterious mutations (e.g. pmrB<sup>Leu82Arg</sup>, pmrB<sup>Ser85Arg</sup>) were firstly detected during PHR-CRKP evolution. Indeed, specific sequence types of K. pneumoniae demonstrated unique deletions and deleterious mutations.<h4>Conclusions</h4>Our study emphasizes the high prevalence of pre-existing heteroresistance in CRKP, which can lead to polymyxin resistance and fatal outcomes. Hence, it is essential to continuously monitor and observe the treatment response to polymyxins in appropriate critically ill scenarios.

DCC
Also flagged:periventricularintraventricular hemorrhage
Journal Article 2024-08-14 ✓ 1 Snippet Rumalla KC, Hansen-Lindner L, Walsh CM, Makary MA.
In-Text Gene Mentions

…established benefits toDCC[ 1 ].…

Show Full Abstract

Deferred umbilical cord clamping (DCC) has been employed with wide variation in the United States over the last few decades. This practice has the potential to improve infant health and outcomes at the population health level. Education campaigns and policy interventions can promote DCC use in a safe manner.

HFE
Also flagged:acute myeloid leukemiaAMLRare diseasesRDchromosomesDuchenne muscular dystrophy
Journal Article 2024-08-14 ✓ 3 Snippets Ahmadi N, Zoch M, Guengoeze O, Facchinello C, Mondorf A, Stratmann K, Musleh K, Erasmus HP, Tchertov J, Gebler R, Schaaf J, Frischen LS, Nasirian A, Dai J, Henke E, Tremblay D, Srisuwananukorn A, Bornhäuser M, Röllig C, Eckardt JN, Middeke JM, Wolfien M, Sedlmayr M.
In-Text Gene Mentions

…imaging data inhemochromatosisor with sonography…

…the context ofhemochromatosis, it allows subgroup…

…mutations, e.g. inhemochromatosis, the CDM is…

Show Full Abstract

<h4>Background</h4>Given the geographical sparsity of Rare Diseases (RDs), assembling a cohort is often a challenging task. Common data models (CDM) can harmonize disparate sources of data that can be the basis of decision support systems and artificial intelligence-based studies, leading to new insights in the field. This work is sought to support the design of large-scale multi-center studies for rare diseases.<h4>Methods</h4>In an interdisciplinary group, we derived a list of elements of RDs in three medical domains (endocrinology, gastroenterology, and pneumonology) according to specialist knowledge and clinical guidelines in an iterative process. We then defined a RDs data structure that matched all our data elements and built Extract, Transform, Load (ETL) processes to transfer the structure to a joint CDM. To ensure interoperability of our developed CDM and its subsequent usage for further RDs domains, we ultimately mapped it to Observational Medical Outcomes Partnership (OMOP) CDM. We then included a fourth domain, hematology, as a proof-of-concept and mapped an acute myeloid leukemia (AML) dataset to the developed CDM.<h4>Results</h4>We have developed an OMOP-based rare diseases common data model (RD-CDM) using data elements from the three domains (endocrinology, gastroenterology, and pneumonology) and tested the CDM using data from the hematology domain. The total study cohort included 61,697 patients. After aligning our modules with those of Medical Informatics Initiative (MII) Core Dataset (CDS) modules, we leveraged its ETL process. This facilitated the seamless transfer of demographic information, diagnoses, procedures, laboratory results, and medication modules from our RD-CDM to the OMOP. For the phenotypes and genotypes, we developed a second ETL process. We finally derived lessons learned for customizing our RD-CDM for different RDs.<h4>Discussion</h4>This work can serve as a blueprint for other domains as its modularized structure could be extended towards novel data types. An interdisciplinary group of stakeholders that are actively supporting the project's progress is necessary to reach a comprehensive CDM.<h4>Conclusion</h4>The customized data structure related to our RD-CDM can be used to perform multi-center studies to test data-driven hypotheses on a larger scale and take advantage of the analytical tools offered by the OHDSI community.

PRDX6
Also flagged:CMDLDL receptorsucrosecholesterolmetabolismtranscription factors
Journal Article 2024-08-14 ✓ 1 Snippet Amor M, Diaz M, Bianco V, Svecla M, Schwarz B, Rainer S, Pirchheim A, Schooltink L, Mukherjee S, Grabner GF, Beretta G, Lamina C, Norata GD, Hackl H, Kratky D.
In-Text Gene Mentions

…were downregulated, whereasPRDX6, GMPR, TMEM65, MLYCD,…

Show Full Abstract

<h4>Background</h4>Activation of brown adipose tissue (BAT) has gained attention due to its ability to dissipate energy and counteract cardiometabolic diseases (CMDs).<h4>Methods</h4>This study investigated the consequences of cold exposure on the BAT and liver proteomes of an established CMD mouse model based on LDL receptor-deficient (LdlrKO) mice fed a high-fat, high-sucrose, high-cholesterol diet for 16 weeks. We analyzed energy metabolism in vivo and performed untargeted proteomics on BAT and liver of LdlrKO mice maintained at 22 °C or 5 °C for 7 days.<h4>Results</h4>We identified several dysregulated pathways, miRNAs, and transcription factors in BAT and liver of cold-exposed Ldlrko mice that have not been previously described in this context. Networks of regulatory interactions based on shared downstream targets and analysis of ligand-receptor pairs identified fibrinogen alpha chain (FGA) and fibronectin 1 (FN1) as potential crosstalk factors between BAT and liver in response to cold exposure. Importantly, genetic variations in the genes encoding FGA and FN1 have been associated with cardiometabolic-related phenotypes and traits in humans.<h4>Discussion</h4>This study describes the key factors, pathways, and regulatory networks involved in the crosstalk between BAT and the liver in a cold-exposed CMD mouse model. These findings may provide a basis for future studies aimed at testing whether molecular mediators, as well as regulatory and signaling mechanisms involved in tissue adaption upon cold exposure, could represent a target in cardiometabolic disorders.

HTT
Also flagged:cholinemetabolismHuntington's diseaseHDglycerophosphocholine phosphodiesterase 1GPCPD1
Journal Article 2024-08-14 ✓ 1 Snippet Chang KH, Cheng ML, Tang HY, Lin CY, Chen CM.
In-Text Gene Mentions

…the huntingtin (HTT) gene (MacDonald…

Show Full Abstract

Huntington's disease (HD) is associated with dysregulated choline metabolism, but the underlying mechanisms remain unclear. This study investigated the expression of key enzymes in this pathway in R6/2 HD mice and human HD postmortem brain tissues. We further explored the therapeutic potential of modulating choline metabolism for HD. Both R6/2 mice and HD patients exhibited reduced expression of glycerophosphocholine phosphodiesterase 1 (GPCPD1), a key enzyme in choline metabolism, in the striatum and cortex. The striatum of R6/2 mice also showed decreased choline and phosphorylcholine, and increased glycerophosphocholine, suggesting disruption in choline metabolism due to GPCPD1 deficiency. Treatment with citicoline significantly improved motor performance, upregulated anti-apoptotic Bcl2 expression, and reduced oxidative stress marker malondialdehyde in both brain regions. Metabolomic analysis revealed partial restoration of disrupted metabolic patterns in the striatum and cortex following citicoline treatment. These findings strongly suggest the role of GPCPD1 deficiency in choline metabolism dysregulation in HD. The therapeutic potential of citicoline in R6/2 mice highlights the choline metabolic pathway as a promising target for future HD therapies.

SLC2A14
Also flagged:Chronic Obstructive Pulmonary DiseaseCOPDpeptidesimmune responsehemostasisdeath
Journal Article 2024-08-14 ✓ 1 Snippet Enríquez-Rodríguez CJ, Casadevall C, Faner R, Pascual-Guardia S, Castro-Acosta A, López-Campos JL, Peces-Barba G, Seijo L, Caguana-Vélez OA, Monsó E, Rodríguez-Chiaradia D, Barreiro E, Cosío BG, Agustí A, Gea J, On Behalf Of The Biomepoc Group.
In-Text Gene Mentions

…including SLC2A3 andSLC2A14members) and the…

Show Full Abstract

Chronic Obstructive Pulmonary Disease (COPD) is the third leading cause of global mortality. Despite clinical predictors (age, severity, comorbidities, etc.) being established, proteomics offers comprehensive biological profiling to obtain deeper insights into COPD pathophysiology and survival prognoses. This pilot study aimed to identify proteomic footprints that could be potentially useful in predicting mortality in stable COPD patients. Plasma samples from 40 patients were subjected to both blind (liquid chromatography-mass spectrometry) and hypothesis-driven (multiplex immunoassays) proteomic analyses supported by artificial intelligence (AI) before a 4-year clinical follow-up. Among the 34 patients whose survival status was confirmed (mean age 69 ± 9 years, 29.5% women, FEV<sub>1</sub> 42 ± 15.3% ref.), 32% were dead in the fourth year. The analysis identified 363 proteins/peptides, with 31 showing significant differences between the survivors and non-survivors. These proteins predominantly belonged to different aspects of the immune response (12 proteins), hemostasis (9), and proinflammatory cytokines (5). The predictive modeling achieved excellent accuracy for mortality (90%) but a weaker performance for days of survival (Q<sup>2</sup> 0.18), improving mildly with AI-mediated blind selection of proteins (accuracy of 95%, Q<sup>2</sup> of 0.52). Further stratification by protein groups highlighted the predictive value for mortality of either hemostasis or pro-inflammatory markers alone (accuracies of 95 and 89%, respectively). Therefore, stable COPD patients' proteomic footprints can effectively forecast 4-year mortality, emphasizing the role of inflammatory, immune, and cardiovascular events. Future applications may enhance the prognostic precision and guide preventive interventions.

DCC
Also flagged:Homeostasiswatersignal transductionmetabolismamino acidresponse to
Journal Article 2024-08-14 ✓ 2 Snippets Wang M, Zhou J, Xu G, Tang Y.
In-Text Gene Mentions

…egulatory molecules, includingDCC-interacting protein 13-alphaprotein 13-alpha (APPL1),…

…ltifunctional adapter protein,DCC-interacting protein 13-alphaprotein 13-alpha can…

Show Full Abstract

(1) The development and utilization of the vast saline-alkali land worldwide is an important way to solve the worsening food crisis. <i>Eriocheir sinensis</i>, due to its strong osmotic regulation capability and its characteristics of being suitable for culturing in alkaline water, has become a potential aquaculture species in saline-alkali water. The brain and heart are the key tissues for signal transduction and energy supply under environmental stress. (2) This study is the first to explore the synergistic regulatory molecular mechanism by integrated analysis on cerebral ganglion proteomics and heart metabolomics of <i>Eriocheir sinensis</i> under alkalinity stress. (3) The results indicate that the cerebral ganglion and heart of <i>E. sinensis</i> were closely related in response to acute alkalinity stress. The differential regulatory pathways mainly involved regulation of energy metabolism, amino acid metabolism, and homeostasis maintenance. Importantly, alkalinity stress induced the regulation of antioxidants and further adjusted longevity and rhythm in the cerebral ganglion and heart, reflecting that the cerebral ganglion and heart may be the key tissues for the survival of <i>Eriocheir sinensis</i> under an alkalinity environment. (4) This study provides a theoretical reference for research on the regulation mechanism of <i>E. sinensis</i> under alkalinity condition and contributes to the development of aquaculture in saline-alkali water.

Also flagged:LL-37Peptidesbacterial infectionsorthopedic infections
Journal Article 2024-08-14 No Snippets Pennone V, Angelini E, Sarlah D, Lovati AB.
Show Full Abstract

Open fractures and prosthetic joints are prone to bacterial infections, especially those involving biofilms, and are worsened by antibiotic inefficacy and resistance. This highlights the need for targeted treatments against orthopedic infections. LL-37, a human cathelicidin, is known for its antimicrobial properties. This study aimed to synthesize and evaluate LL-37-derived antimicrobial peptides (AMPs) for antibacterial efficacy and toxicity. Several truncated LL-37 analogues were created and tested against 18 bacterial strains, both ATCC and orthopedic clinical isolates, using MIC and MBC assays. Synergy with antibiotics and resistance development were also analyzed, alongside cytotoxicity on NIH-3T3 fibroblasts and hemolytic activity assessments. Six AMPs were synthesized, with FK-16 and GF-17 emerging as the most effective. The MIC values ranged from 4.69 to 18.75 µg/mL and 2.34 to 18.75 µg/mL, respectively, against <i>S. epidermidis</i> and <i>S. aureus</i>, with the MBC values matching the MIC values. Cytotoxicity tests showed no toxicity at concentrations below 75 µg/mL for GF-17 and 150 µg/mL for FK-16. Hemolytic activity was below 1% at 18.75 µg/mL for GF-17 and 75 µg/mL for FK-16. These AMPs showed no synergistic effects with antibiotics and no resistance development. FK-16 and GF-17 effectively removed biofilms, particularly against <i>S. epidermidis</i>. Incorporating these AMPs into surgical materials (hydrogels, cements, etc.) could enhance infection control in orthopedic procedures, warranting further in vivo studies.

Also flagged:Postpartum Depressionanxietysleepmajor depression disorderinsomniaof
Journal Article 2024-08-14 No Snippets Zhang K, He L, Li Z, Ding R, Han X, Chen B, Cao G, Ye JH, Li T, Fu R.
Show Full Abstract

Postpartum depression (PPD) affects 174 million women worldwide and is characterized by profound sadness, anxiety, irritability, and debilitating fatigue, which disrupt maternal caregiving and the mother-infant relationship. Limited pharmacological interventions are currently available. Our understanding of the neurobiological pathophysiology of PPD remains incomplete, potentially hindering the development of novel treatment strategies. Recent hypotheses suggest that PPD is driven by a complex interplay of hormonal changes, neurotransmitter imbalances, inflammation, genetic factors, psychosocial stressors, and hypothalamic-pituitary-adrenal (HPA) axis dysregulation. This narrative review examines recent clinical studies on PPD within the past 15 years, emphasizing advancements in neuroimaging findings and blood biomarker detection. Additionally, we summarize recent laboratory work using animal models to mimic PPD, focusing on hormone withdrawal, HPA axis dysfunction, and perinatal stress theories. We also revisit neurobiological results from several brain regions associated with negative emotions, such as the amygdala, prefrontal cortex, hippocampus, and striatum. These insights aim to improve our understanding of PPD's neurobiological mechanisms, guiding future research for better early detection, prevention, and personalized treatment strategies for women affected by PPD and their families.

Also flagged:Type 2 diabeteschronic diseasesdopaminePDmitochondrialferroptosis
Journal Article 2024-08-14 No Snippets Duță C, Muscurel C, Dogaru CB, Stoian I.
Show Full Abstract

Type 2 diabetes (T2D) and Parkinson's disease (PD) are the two most frequent age-related chronic diseases. There are many similarities between the two diseases: both are chronic diseases; both are the result of a decrease in a specific substance-insulin in T2D and dopamine in PD; and both are caused by the destruction of specific cells-beta pancreatic cells in T2D and dopaminergic neurons in PD. Recent epidemiological and experimental studies have found that there are common underlying mechanisms in the pathophysiology of T2D and PD: chronic inflammation, mitochondrial dysfunction, impaired protein handling and ferroptosis. Epidemiological research has indicated that there is a higher risk of PD in individuals with T2D. Moreover, clinical studies have observed that the symptoms of Parkinson's disease worsen significantly after the onset of T2D. This article provides an up-to-date review on the intricate interplay between oxidative stress, reactive oxygen species (ROS) and ferroptosis in PD and T2D. By understanding the shared molecular pathways and how they can be modulated, we can develop more effective therapies, or we can repurpose existing drugs to improve patient outcomes in both disorders.

Also flagged:SynthesisHydroxyapatitePhosphoric Aciddigestionsulfuric acidgypsum
Journal Article 2024-08-14 No Snippets Benataya K, Lakrat M, Hammani O, Aaddouz M, Ait Yassine Y, Abuelizz HA, Zarrouk A, Zarrouk A, Karrouchi K, Mejdoubi E.
Show Full Abstract

This study investigates, in the first part, the synthesis and purification of a poorly crystalline hydroxyapatite (HAp) using natural Moroccan phosphate (Boucraa region) as a raw material. Despite its successful preparation, the obtained HAp was contaminated by several metallic cations (mostly Cd, Pb, Sn, Ti, Mn, Mg, Fe, and Al) migrated from the natural rocks during the digestion process, inhibiting HAp application in several sectors. To minimize the existence of these elements, the dissolution-precipitation technique (DP) was investigated as a non-selective purification process. Following the initial DP cycle conducted on the precipitated HAp, the removal efficiency was approximately 60% for Al, Fe, Mg, Mn, and Ti and 90% for Cd and Pb. After three consecutive DP cycles, notable improvement in the removal efficiency was observed, reaching 66% for Fe, 69% for Mg, 73% for Mn, and 74% for Al, while Cd, Pb, and Ti were totally removed. In the second part of this study, the purified HAp was digested using sulfuric acid to produce high-quality phosphoric acid (PA) and gypsum (GP). The elemental analysis of the PA indicates a removal efficiency of approximately 89% for Fe and over 94% for all the examined cations. In addition, the generated GP was dominated by SO<sub>3</sub> and CaO accompanied with minor impurities. Overall, this simple process proves to be practically useful, to reduce a broad spectrum of cationic impurities, and to be flexible to prepare valuable products such hydroxyapatite, phosphoric acid, and gypsum.

SERPINC1
Also flagged:cognitive impairmentdementiaCOVID-19depressionanxietysleep
Journal Article 2024-08-14 ✓ 3 Snippets Chakrabarty M, Chatterjee P, Mukherjee A, Das G, Mollah RI, Mondal B, Sardar S, Basu A, Ghosh M, Sengupta A, Pal SK, Biswas A.
In-Text Gene Mentions

…significantly worse inACE-III(p =.009) and…

…were tested withACE-III, patients were found…

…dementia assessment, theACE-III.…

Show Full Abstract

<h4>Background</h4>COVID-19 survivors around the globe are suffering from mental health issues. While mental health problems can be an early warning sign of dementia, they may also increase the chances of developing the disease. In this study, we examined the mental health of COVID-19 survivors and mapped its associations with cognitive and demographic variables.<h4>Method</h4>COVID-19 survivors listed in the databases of three tertiary care hospitals in Kolkata were contacted sequentially. 376 willing patients were interviewed over the telephone. 99 COVID-19 patients and 31 matched controls participated in the in-person interviews that were arranged for a more detailed investigation. The participants were administered standardized tests that are widely used for the assessment of cognitive functioning and mental health status.<h4>Result</h4>64.89% of COVID-19 survivors reported a deterioration in physical functioning. 44.95% reported a decline in mental health, whereas 41.49% reported a drop in cognitive performance. Detailed investigations revealed that they had an increased risk of having depression, anxiety, and poor sleep quality by 91%, 68%, and 140%, respectively. 6.1% of the patients had mild cognitive impairment, and 4% had dementia. COVID-19 patients who had depression and anxiety were 8.6 and 19.4 times more likely to have cognitive decline, respectively. Compared to the matched controls, COVID-19 patients had greater depression (p<.001), anxiety (p<.001), stress (p =.003), and insomnia (p <.001). They also scored significantly lower on Addenbrooke's Cognitive Examination-III (p =.009) and Picture Naming Test (p =.005) and took significantly longer to complete Trail Making Test-A (p =.002).<h4>Conclusion</h4>COVID-19 survivors in this study had major mental health issues even one year after contracting the virus. They had significant cognitive deficits that might progress into dementia. Strict monitoring and systematic treatment plans should be implemented as soon as possible.

CACNA1E
Also flagged:immune responseantibodyantigenbindingimmunoglobulin(Ig)G
Journal Article 2024-08-14 ✓ 1 Snippet Tasdighian S, Bechtold V, Essaghir A, Saeys Y, Burny W.
In-Text Gene Mentions

…antibody response, withCACNA1E, NUP50-AS1 and RNF213…

Show Full Abstract

<h4>Background</h4>Antibody-mediated protection can depend on mechanisms varying from neutralization to Fc-dependent innate immune-cell recruitment. Adjuvanted vaccine development relies on a holistic understanding of how adjuvants modulate the quantity/titer and quality of the antibody response.<h4>Methods</h4>A Phase 2 trial (ClinicalTrials.gov: NCT00805389) evaluated hepatitis B vaccines formulated with licensed adjuvants (AS01<sub>B</sub>, AS01<sub>E</sub>, AS03, AS04 or Alum) in antigen-naïve adults. The trial investigated the role of adjuvants in shaping antibody-effector functions, and identified an innate transcriptional response shared by AS01<sub>B</sub>, AS01<sub>E</sub> and AS03. We integrated previously reported data on the innate response (gene expression, cytokine/C-reactive protein levels) and on quantitative/qualitative features of the mature antibody response (Fc-related parameters, immunoglobulin titers, avidity). Associations between the innate and humoral parameters were explored using systems vaccinology and a machine-learning framework.<h4>Results</h4>A dichotomy in responses between AS01/AS03 and AS04/Alum (with the former two contributing most to the association with the humoral response) was observed across all timepoints of this longitudinal study. The consistent patterns over time suggested a similarity in the impacts of the two-dose immunization regimen, year-long interval, and non-adjuvanted antigenic challenge given one year later. An innate signature characterized by interferon pathway-related gene expression and secreted interferon-γ-induced protein 10 and C-reactive protein, which was shared by AS01 and AS03, consistently predicted both the qualitative antibody response features and the titers. The signature also predicted from the antibody response quality, the group of adjuvants from which the administered vaccine was derived.<h4>Conclusion</h4>An innate signature induced by AS01- or AS03-adjuvanted vaccines predicts the antibody response magnitude and quality consistently over time.

Also flagged:macrophage activationlung diseasesasthmachronic obstructive pulmonary diseaseCOPDpulmonary fibrosis
Journal Article 2024-08-14 No Snippets Zhang F, Cui Y, Zhang T, Yin W.
Show Full Abstract

Macrophages in the innate immune system play a vital role in various lung diseases such as asthma, chronic obstructive pulmonary disease (COPD), acute lung injury and pulmonary fibrosis. Macrophages involved in the process of immunity need to go through a process of activation, including changes in gene expression and cell metabolism. Epigenetic modifications are key factors of macrophage activation including DNA methylation, histone modification and non-coding RNA regulation. Understanding the role and mechanisms of epigenetic regulation of macrophage activation can provide insights into the function of macrophages in lung diseases and help identification of potential therapeutic targets. This review summarizes the latest progress in the epigenetic changes and regulation of macrophages in their development process and in normal physiological states, and the epigenetic regulation of macrophages in COPD as well as the influence of macrophage activation on COPD development.

SUDS3
Also flagged:extracellularhistonesinflammatory diseasessepsispancreatitistrauma
Journal Article 2024-08-14 ✓ 1 Snippet Yang T, Peng J, Zhang Z, Chen Y, Liu Z, Jiang L, Jin L, Han M, Su B, Li Y.
In-Text Gene Mentions

…H3, H4) andlinker histoneshistones (H1) according…

Show Full Abstract

Extracellular histones are crucial damage-associated molecular patterns involved in the development and progression of multiple critical and inflammatory diseases, such as sepsis, pancreatitis, trauma, acute liver failure, acute respiratory distress syndrome, vasculitis and arthritis. During the past decade, the physiopathologic mechanisms of histone-mediated hyperinflammation, endothelial dysfunction, coagulation activation, neuroimmune injury and organ dysfunction in diseases have been systematically elucidated. Emerging preclinical evidence further shows that anti-histone strategies with either their neutralizers (heparin, heparinoids, nature plasma proteins, small anion molecules and nanomedicines, etc.) or extracorporeal blood purification techniques can significantly alleviate histone-induced deleterious effects, and thus improve the outcomes of histone-related critical and inflammatory animal models. However, a systemic evaluation of the efficacy and safety of these histone-targeting therapeutic strategies is currently lacking. In this review, we first update our latest understanding of the underlying molecular mechanisms of histone-induced hyperinflammation, endothelial dysfunction, coagulopathy, and organ dysfunction. Then, we summarize the latest advances in histone-targeting therapy strategies with heparin, anti-histone antibodies, histone-binding proteins or molecules, and histone-affinity hemoadsorption in pre-clinical studies. Finally, challenges and future perspectives for improving the clinical translation of histone-targeting therapeutic strategies are also discussed to promote better management of patients with histone-related diseases.

HFE
Also flagged:β-thalassemiaironhereditary blood disorderanemiaHbβ-globin
Journal Article 2024-08-14 ✓ 1 Snippet Adhikari P.
In-Text Gene Mentions

…iron regulator protein (HFE)-associated hereditary hemoch…

Show Full Abstract

<h4>Introduction and importance</h4>β-thalassemia is a hereditary blood disorder with a global prevalence, presenting diagnostic and management challenges, particularly in regions with high consanguinity rates. Diagnostic methods include clinical assessments, genetic testing, and hemoglobin electrophoresis. Treatment typically involves transfusions and chelation therapy, with gene therapy showing promise. This case series emphasizes the need for tailored care strategies and global health initiatives to improve outcomes for β-thalassemia patients worldwide.<h4>Methods</h4>This case series involves five patients from rural Nepal presenting various β-thalassemia manifestations. The cases highlight the challenges in diagnosis and management in resource-limited settings. Data were collected through clinical assessments, laboratory investigations, and follow-ups. Each patient's medical history, presentation, and treatment regimen were documented.<h4>Outcomes</h4>The cases underscore the importance of regular follow-ups, community engagement, and personalized treatment strategies tailored to genetic profiles. Key findings include the necessity for consistent transfusion schedules, iron overload monitoring, and managing complications associated with β-thalassemia. Enhanced education and healthcare collaboration were noted as critical for optimizing care and outcomes in resource-limited settings.<h4>Conclusions</h4>Managing β-thalassemia in resource-limited settings demands timely intervention, regular monitoring, and community involvement. Enhanced healthcare collaboration, access to advanced diagnostic tools, and tailored treatment strategies are paramount in addressing the unique challenges of β-thalassemia. These measures are essential for ensuring an improved quality of life for affected individuals in such regions.

Also flagged:hyaluronancatecholwound healinglocalizationVEGFthrombin
Journal Article 2024-08-14 No Snippets Song W, Choi YH, Moon YG, Lee C, Sundaram MN, Hwang NS.
Show Full Abstract

Wounds, characterized by the disruption of the continuity of body tissues resulting from external trauma, manifest in diverse types and locations. Although numerous wound dressings are available for various wound scenarios, it remains challenging to find an integrative wound dressing capable of addressing diverse wound situations. We focused on utilizing sulfated hyaluronan (sHA), known for its anti-inflammatory properties and capacity to load cationic drugs. By conjugating catechol groups to sHA (sHA-CA), we achieved several advantages in wound healing: 1) Fabrication of patches through crosslinking with catechol-modified high-molecular-weight hyaluronan (HA(HMW)-CA), 2) Adhesiveness that enabled stable localization, 3) Radical scavenging that could synergize with the immunomodulation of sHA. The sHA-CA patches demonstrated therapeutic efficacy in three distinct murine wound models: diabetic wound, hepatic hemorrhage, and post-surgical adhesion. Collectively, these findings underscore the potential of the sHA-CA patch as a promising candidate for the next-generation wound dressing.

HFE
Also flagged:B12 hypervitaminosisvitamin B12cobalaminmegaloblastic anemianeuropsychiatric disorderswater
Journal Article 2024-08-14 ✓ 1 Snippet Fernández-Landázuri S, Baeza-Trinidad R, Bernardo González I.
In-Text Gene Mentions

…disease, autoimmune diseases,hemochromatosis; cancer (hepatic, breast,…

Show Full Abstract

<h4>Objectives</h4>Unexplained B12 hypervitaminosis (HB12) in asymptomatic patients leads to a cascade of medical consultations and diagnostic tests aimed at determining its etiology. The objective of this study was to assess the efficacy of the laboratory getting involved in the detection and elimination of immune complexes with vitamin B12 in clinical practice and its economic impact.<h4>Methods</h4>A retrospective longitudinal study was undertaken to assess the laboratory strategy of detecting B12 macrovitamin (macro-B12) in patients with HB12 >1,000 pg/mL. The clinical characteristics of patients with HB12 referred to Internal Medicine (IM) in the pre- and post-implantation period of the new strategy were compared. Additionally, the healthcare costs of one-year follow-up were estimated.<h4>Results</h4>The prevalences of HB12 in the pre- and post-implantation period were 3.9 % and 3 %, respectively. Macro-B12 explained 25 % of the HB12 cases initially detected. A 41 % reduction was observed in the number of patients with HB12 after the implantation of the new strategy, thereby resulting in a cost reduction of 5,000 €.<h4>Conclusions</h4>The laboratory intervention for the detection of macro-B12 provides clear economic and clinical benefits in clinical practice.

HFE
Also flagged:Cervical Spine MyelopathyCalcium pyrophosphatedihydrate depositionaspseudogoutinflammatory arthropathy
Journal Article 2024-08-14 ✓ 1 Snippet Avetisian H, Ton A, Dowling TJ, Hah R.
In-Text Gene Mentions

…osteoarthritis, advanced age,hemochromatosis, hypomagnesemia, hypophosphat…

Show Full Abstract

Calcium pyrophosphate dihydrate deposition (CPPD), commonly known as pseudogout, is an inflammatory arthropathy primarily affecting the knee, wrist, hip, and shoulder joints. However, it can occasionally deposit in various structures surrounding the spinal column, including the facet joints, ligamentum flavum, bursae, and intervertebral discs. Such occurrences are typically asymptomatic or associated with mild neck pain. Nonetheless, severe cases may lead to myeloradiculopathy, characterized by severe neck pain and upper extremity weakness. Conservative management with nonsteroidal anti-inflammatory drugs is often sufficient for mild cases, while surgical decompression remains the gold standard for severe cases with significant spinal cord compression. Herein, we present a rare case of pseudogout, manifesting as cervical spine myelopathy due to calcium pyrophosphate dihydrate deposition in the ligamentum flavum and facet joints at C1-2. This was found incidentally during cervical spine decompression and fusion and subsequentially confirmed through pathological examination. Following the removal of the compressive pathology, the patient reported significant improvements in neck pain and neurological symptoms. This case underscores the importance of considering pseudogout in the differential diagnosis of acute neck pain presenting with myelopathy or radiculopathy.

Also flagged:metabolismpathogenesislipidamino aciddry eyedry eye diseases
Journal Article 2024-08-14 No Snippets Wan X, Zhang Y, Zhang K, Mou Y, Jin X, Huang X.
Show Full Abstract

<h4>Background</h4>Dry eye disease (DED) stands as a prominent ocular condition of global prevalence, emerging as a growing concern within public health. However, the underlying mechanisms involved in its pathogenesis remain largely unknown. In recent years, with the development of metabolomics, numerous studies have reported alterations in ocular surface metabolism in DED and offered fresh perspectives on the development of DED.<h4>Main text</h4>The metabolic changes of the ocular surface of DED patients are closely intertwined with the cellular metabolism process and immune inflammation changes. This article expounds upon the correlation between ocular surface metabolism and immune inflammation alterations in DED in terms of glycolysis, lipid metabolism, amino acid metabolism, cellular signaling pathways, and immune inflammation regulation.<h4>Conclusions</h4>The alterations in ocular surface metabolism of patients with dry eye are closely associated with their inflammatory status. Our work contributes novel insights into the pathogenesis of dry eye diseases and offers innovative molecular targets for diagnosing, detecting, and managing DED patients.

bioRxiv 2024-08-14 Preprint (No Snippets API) Johnson OD, Paul S, Gutierrez JA, Russell WK, Ward MC.
Show Full Abstract

<h4>Summary</h4> Cardiovascular disease (CVD) is associated with both genetic variants and environmental factors. One unifying consequence of the molecular risk factors in CVD is DNA damage, which must be repaired by DNA damage response proteins. However, the impact of DNA damage on global cardiomyocyte protein abundance, and its relationship to CVD risk remains unclear. We therefore treated induced pluripotent stem cell-derived cardiomyocytes with the DNA-damaging agent Doxorubicin (DOX) and a vehicle control, and identified 4,178 proteins that contribute to a network comprising 12 co-expressed modules and 403 hub proteins with high intramodular connectivity. Five modules correlate with DOX and represent distinct biological processes including RNA processing, chromatin regulation and metabolism. DOX-correlated hub proteins are depleted for proteins that vary in expression across individuals due to genetic variation but are enriched for proteins encoded by loss-of-function intolerant genes. While proteins associated with genetic risk for CVD, such as arrhythmia are enriched in specific DOX-correlated modules, DOX-correlated hub proteins are not enriched for known CVD risk proteins. Instead, they are enriched among proteins that physically interact with CVD risk proteins. Our data demonstrate that DNA damage in cardiomyocytes induces diverse effects on biological processes through protein co-expression modules that are relevant for CVD, and that the level of protein connectivity in DNA damage-associated modules influences the tolerance to genetic variation.

Also flagged:TDP43fibril formationneurodegenerative diseasesALSfibrilsthioredoxin
Journal Article 2024-08-13 No Snippets George G, Ajayan A, Varkey J, Pandey NK, Chen J, Langen R.
Show Full Abstract

Protein aggregation is a common feature of many neurodegenerative diseases. In Huntington's disease, mutant huntingtin is the primary aggregating protein, but the aggregation of other proteins, such as TDP43, is likely to further contribute to toxicity. Moreover, mutant huntingtin is also a risk factor for TDP pathology in ALS. Despite this co-pathology of huntingtin and TDP43, it remains unknown whether these amyloidogenic proteins directly interact with each other. Using a combination of biophysical methods, we show that the aggregation-prone regions of both proteins, huntingtin exon-1 (Httex1) and the TDP43 low complexity domain (TDP43-LCD), interact in a conformationally specific manner. This interaction significantly slows Httex1 aggregation, while it accelerates TDP43-LCD aggregation. A key intermediate responsible for both effects is a complex formed by liquid TDP43-LCD condensates and Httex1 fibrils. This complex shields seeding competent surfaces of Httex1 fibrils from Httex1 monomers, which are excluded from the condensates. In contrast, TDP43-LCD condensates undergo an accelerated liquid-to-solid transition upon exposure to Httex1 fibrils. Cellular studies show co-aggregation of untagged Httex1 with TDP43. This interaction causes mislocalization of TDP43, which has been linked to TDP43 toxicity. The protection from Httex1 aggregation in lieu of TDP43-LCD aggregation is interesting, as it mirrors what has been found in disease models, namely that TDP43 can protect from huntingtin toxicity, while mutant huntingtin can promote TDP43 pathology. These results suggest that direct protein interaction could, at least in part, be responsible for the linked pathologies of both proteins.

Also flagged:Trop2breast cancertrophoblastic cell surface antigen 2glycoproteincalciumtumors
Journal Article 2024-08-13 No Snippets Hu Y, Zhu Y, Qi D, Tang C, Zhang W.
Show Full Abstract

Human trophoblastic cell surface antigen 2 (Trop2) is a glycoprotein, a cellular marker of trophoblastic and stem cells, and a calcium signaling transducer involved in several signaling pathways, leading to the proliferation, invasion, and metastasis of tumors. It is expressed at a low level in normal epithelial cells, but at a high level in many tumors, making it an ideal target for cancer therapy. According to previous literature, Trop2 is broadly expressed in all breast cancer subtypes, especially in triple negative breast cancer (TNBC). Several clinical trials have demonstrated the effectiveness of Trop2-targeted therapy in breast cancer. Sacituzumab govitecan (SG) is a Trop2-targeted antibody-drug conjugate (ADC) that has been approved for the treatment of metastatic TNBC and hormone receptor-positive (HR+) and human epidermal growth factor receptor 2-negative (HER2-) breast cancer. This article reviews the structure and function of Trop2, several major Trop2-targeted ADCs, other appealing novel Trop2-targeted agents and relevant clinical trials to provide a landscape of how Trop2-targeted treatments will develop in the future.

NEGR1
Also flagged:Fibrotic diseaseextracellularRenal fibrosischronic progressive kidney diseasespathogenesisepithelial‐mesenchymal transition
Journal Article 2024-08-13 ✓ 4 Snippets Xiao PT, Hao JH, Kuang YJ, Dai CX, Rong XL, Jiang LL, Xie ZS, Zhang L, Chen QQ, Liu EH.
In-Text Gene Mentions

…, Luc‐CYR61 , Luc‐NEGR1, Luc‐ANKRD1 and…

…, Ctgf andNegr1).…

…on CTGF ,NEGR1, CYR61 and…

…and its targetsNegr1and matrix metalloproteinase…

Show Full Abstract

Despite significant progress in therapy, there remains a lack of substantial evidence regarding the molecular factors that lead to renal fibrosis. Neuraminidase 4 (NEU4), an enzyme that removes sialic acids from glycoconjugates, has an unclear role in chronic progressive fibrosis. Here, this study finds that NEU4 expression is markedly upregulated in mouse fibrotic kidneys induced by folic acid or unilateral ureter obstruction, and this elevation is observed in patients with renal fibrosis. NEU4 knockdown specifically in the kidney attenuates the epithelial-to-mesenchymal transition, reduces the production of pro-fibrotic cytokines, and decreases cellular senescence in male mice. Conversely, NEU4 overexpression exacerbates the progression of renal fibrosis. Mechanistically, NEU4<sub>254-388aa</sub> interacts with Yes-associated protein (YAP) at WW2 domain (231-263aa), promoting its nucleus translocation and activation of target genes, thereby contributing to renal fibrosis. 3,5,6,7,8,3',4'-Heptamethoxyflavone, a natural compound, is identified as a novel NEU4 inhibitor, effectively protecting mice from renal fibrosis in a NEU4-dependent manner. Collectively, the findings suggest that NEU4 may represent a promising therapeutic target for kidney fibrosis.

HTT
Also flagged:sexual dysfunctionFluoxetinesertralineserotoninreuptakemitochondrial
Journal Article 2024-08-13 ✓ 2 Snippets Santos RA, Sousa AP, Almeida-Santos T, Ramalho-Santos J, Tavares RS.
In-Text Gene Mentions

…blocking its transporter (5-HTT) and consequently increase…

…as 5-HT receptors,5-HTTand tryptophan hydroxylase…

Show Full Abstract

<h4>Abstract</h4>Depression currently affects about 280 million people worldwide and its prevalence has been increasing dramatically, especially among the young and people of reproductive age, which consequently leads to an increase in antidepressant consumption. Antidepressants are associated with sexual dysfunction in both men and women; however, their role in male fertility has been scarcely studied. Fluoxetine and sertraline, two serotonin reuptake inhibitors (SSRIs), are among the most prescribed antidepressants worldwide. To determine their possible effects, human sperm cells were exposed to either sertraline or fluoxetine at concentrations previously found in blood and seminal fluid of patients undergoing treatment. Spermatozoa were incubated for up to 24 h at 37°C and 5% CO 2 , and important functional parameters such as sperm motility, viability, mitochondrial membrane potential, cellular reactive oxygen species (ROS) production, chromatin/DNA integrity, acrosome status, and tyrosine phosphorylation were assessed. At low levels, fluoxetine consistently decreased progressive motility throughout time while promoting fluctuations in ROS levels and sperm capacitation. Nevertheless, it did not affect viability, mitochondrial membrane potential, acrosome reaction nor chromatin/DNA integrity. Sertraline, on the other hand, had little to nonsignificant impact at low doses, but affected almost all tested parameters at supratherapeutic concentrations. Altogether, our results suggest that both antidepressants may impair sperm function, possibly through different mechanisms of action, but fluoxetine is the only exhibiting mild negative effects at doses found in vivo .

Also flagged:corticosteronesteroidhormoneadrenocortical insufficiencynuclear receptor subfamily 5 group A member 1NR5A1
Journal Article 2024-08-13 No Snippets Niimi T, Tanaka T, Aoyagi C, Onda Y, Nagamitsu S, Kodama S.
Show Full Abstract

Cell therapy for adrenocortical insufficiency can potentially provide steroid replacement in response to physiological stimuli. Previously, we reported that adipose tissue-derived stromal cells (ADSCs) are transformed into steroid-producing cells by overexpression of nuclear receptor subfamily 5 group A member 1 (NR5A1). The steroidogenic cells are characterized by the production of both adrenal and gonadal steroids. Cytotherapy for adrenocortical insufficiency requires cells with more adrenocortical characteristics. Considering the highly developed vascular network within the adrenal cortex, all adrenocortical cells are adjacent to and interact with vascular endothelial cells (VECs). In this study, NR5A1-induced steroidogenic cells derived from mouse ADSCs (NR5A1-ADSCs) were co-cultured with mouse VECs. Testosterone secretion in NR5A1-ADSCs was not altered; however, corticosterone secretion significantly increased while levels of steroidogenic enzymes significantly increased in the corticosterone synthesis pathway. Co-culture with lymphatic endothelial cells (LECs) or ADSCs, or transwell culture with NR5A1-ADSCs and VECs did not alter corticosterone production. VECs expressed higher levels of collagen and laminin than LECs. Culture in type-IV collagen and laminin-coated dishes increased corticosterone secretion in NR5A1-ADSCs. These results suggest that VECs may characterize ADSC-derived steroidogenic cells into a more corticosterone-producing phenotype, and VECs may be useful for generating adrenal steroidogenic cells from stem cells.

Also flagged:pneumoniainterferonNF-κBnucleocapsidORF1ab2
Journal Article 2024-08-13 No Snippets Markov NS, Ren Z, Senkow KJ, Grant RA, Gao CA, Malsin ES, Sichizya L, Kihshen H, Helmin KA, Jovisic M, Arnold JM, Pérez-Leonor XG, Abdala-Valencia H, Swaminathan S, Nwaezeapu J, Kang M, Rasmussen L, Ozer EA, Lorenzo-Redondo R, Hultquist JF, Simons LM, Rios-Guzman E, Misharin AV, Wunderink RG, Budinger GRS, Singer BD, Morales-Nebreda L, NU SCRIPT Study Investigators.
Show Full Abstract

The evolution of T cell molecular signatures in the distal lung of patients with severe pneumonia is understudied. Here, we analyzed T cell subsets in longitudinal bronchoalveolar lavage fluid samples from 273 patients with severe pneumonia, including unvaccinated patients infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or with respiratory failure not linked to pneumonia. In patients with SARS-CoV-2 pneumonia, activation of interferon signaling pathways, low activation of the NF-κB pathway and preferential targeting of spike and nucleocapsid proteins early after intubation were associated with favorable outcomes, whereas loss of interferon signaling, activation of NF-κB-driven programs and specificity for the ORF1ab complex late in disease were associated with mortality. These results suggest that in patients with severe SARS-CoV-2 pneumonia, alveolar T cell interferon responses targeting structural SARS-CoV-2 proteins characterize individuals who recover, whereas responses against nonstructural proteins and activation of NF-κB are associated with poor outcomes.

STAU1
Also flagged:Insulin resistanceIRinsulinglucosemetabolic disordersmetabolic syndrome
Journal Article 2024-08-13 ✓ 5 Snippets Lv Z, Ren Y, Li Y, Niu F, Li Z, Li M, Li X, Li Q, Huang D, Yu Y, Xiong Y, Qian L.
In-Text Gene Mentions

In the in vivo mice model, GIGYF2 knockdown and tocopherol administration alleviate high-fat diet (HFD)-induced glucose intolerance and IR, along with the suppression of STAU1/PTEN and restoration of PI3K/AKT signaling.<h4>Conclusions</h4>Our study discloses that GIGYF2 mediates obesity-related IR by disrupting the PI3K/AKT signaling axis through the up-regulation of STAU1/PTEN.

Notably, silencing STAU1 prevented GIGYF2-induced PTEN upregulation, PI3K/AKT pathway inactivation, and IR.

RNA-binding protein GIGYF2 orchestrates hepatic insulin resistance through STAU1/PTEN-mediated disruption of the PI3K/AKT signaling cascade.

Additionally, PA-induced hepatic IR caused a notable increase in STAU1, which was prevented by depleting GIGYF2.

…To construct theSTAU1overexpression vector, the…

Show Full Abstract

<h4>Background</h4>Obesity is well-established as a significant contributor to the development of insulin resistance (IR) and diabetes, partially due to elevated plasma saturated free fatty acids like palmitic acid (PA). Grb10-interacting GYF Protein 2 (GIGYF2), an RNA-binding protein, is widely expressed in various tissues including the liver, and has been implicated in diabetes-induced cognitive impairment. Whereas, its role in obesity-related IR remains uninvestigated.<h4>Methods</h4>In this study, we employed palmitic acid (PA) exposure to establish an in vitro IR model in the human liver cancer cell line HepG2 with high-dose chronic PA treatment. The cells were stained with fluorescent dye 2-NBDG to evaluate cell glucose uptake. The mRNA expression levels of genes were determined by real-time qRT-PCR (RT-qPCR). Western blotting was employed to examine the protein expression levels. The RNA immunoprecipitation (RIP) was used to investigate the binding between protein and mRNA. Lentivirus-mediated gene knockdown and overexpression were employed for gene manipulation. In mice, an IR model induced by a high-fat diet (HFD) was established to validate the role and action mechanisms of GIGYF2 in the modulation of HFD-induced IR in vivo.<h4>Results</h4>In hepatocytes, high levels of PA exposure strongly trigger the occurrence of hepatic IR evidenced by reduced glucose uptake and elevated extracellular glucose content, which is remarkably accompanied by up-regulation of GIGYF2. Silencing GIGYF2 ameliorated PA-induced IR and enhanced glucose uptake. Conversely, GIGYF2 overexpression promoted IR, PTEN upregulation, and AKT inactivation. Additionally, PA-induced hepatic IR caused a notable increase in STAU1, which was prevented by depleting GIGYF2. Notably, silencing STAU1 prevented GIGYF2-induced PTEN upregulation, PI3K/AKT pathway inactivation, and IR. STAU1 was found to stabilize PTEN mRNA by binding to its 3'UTR. In liver cells, tocopherol treatment inhibits GIGYF2 expression and mitigates PA-induced IR. In the in vivo mice model, GIGYF2 knockdown and tocopherol administration alleviate high-fat diet (HFD)-induced glucose intolerance and IR, along with the suppression of STAU1/PTEN and restoration of PI3K/AKT signaling.<h4>Conclusions</h4>Our study discloses that GIGYF2 mediates obesity-related IR by disrupting the PI3K/AKT signaling axis through the up-regulation of STAU1/PTEN. Targeting GIGYF2 may offer a potential strategy for treating obesity-related metabolic diseases, including type 2 diabetes.

SOX6
Also flagged:PDtauprotein kinaseinclusion bodymitochondriaDepression
Journal Article 2024-08-13 ✓ 2 Snippets Dehestani M, Kozareva V, Blauwendraat C, Fraenkel E, Gasser T, Bansal V, Bansal V.
In-Text Gene Mentions

…from DEGs inSOX6_AGTR1, were significantly ass…

…Intriguingly, besidesSOX6_AGTR1, we found an…

Show Full Abstract

Several prior studies have proposed the involvement of various brain regions and cell types in Parkinson's disease (PD) pathology. Here, we performed snRNA-seq on the prefrontal cortex and anterior cingulate regions from a small cohort of post-mortem control and PD brain tissue. We found a significant association of oligodendrocytes (ODCs) and oligodendrocyte precursor cells (OPCs) with PD-linked risk loci and report several dysregulated genes and pathways, including regulation of tau-protein kinase activity, regulation of inclusion body assembly and protein processing involved in protein targeting to mitochondria. In an independent PD cohort with clinical measures (681 cases and 549 controls), polygenic risk scores derived from the dysregulated genes significantly predicted Montreal Cognitive Assessment (MoCA)-, and Beck Depression Inventory-II (BDI-II)-scores but not motor impairment (UPDRS-III). We extended our analysis of clinical outcome prediction by incorporating differentially expressed genes from three separate datasets that were previously published by different laboratories. In the first dataset from the anterior cingulate cortex, we identified an association between ODCs and BDI-II. In the second dataset obtained from the substantia nigra (SN), OPCs displayed an association with UPDRS-III. In the third dataset from the SN region, a distinct subtype of OPCs, labeled OPC_ADM, exhibited an association with UPDRS-III. Intriguingly, the OPC_ADM cluster also demonstrated a significant increase in PD samples. These results suggest that by expanding our focus to glial cells, we can uncover region-specific molecular pathways associated with PD symptoms.

Also flagged:oral squamous cell carcinomaGBOSCCtumorslocalizationgene expression
Journal Article 2024-08-13 No Snippets Shaikh S, Dhar H, Moorthy M, Bhat V, Basu S, Banerjee D, Mishra DK, Datta S, Mukherjee G.
Show Full Abstract

<h4>Background</h4>Oral cancer poses a significant health challenge due to limited treatment protocols and therapeutic targets. We aimed to investigate the invasive margins of gingivo-buccal oral squamous cell carcinoma (GB-OSCC) tumors in terms of the localization of genes and cell types within the margins at various distances that could lead to nodal metastasis.<h4>Methods</h4>We collected tumor tissues from 23 resected GB-OSCC samples for gene expression profiling using digital spatial transcriptomics. We monitored differential gene expression at varying distances between the tumor and its microenvironvent (TME), and performed a deconvulation study and immunohistochemistry to identify the cells and genes regulating the TME.<h4>Results</h4>We found that the tumor-stromal interface (a distance up to 200 µm between tumor and immune cells) is the most active region for disease progression in GB-OSCC. The most differentially expressed apex genes, such as FN1 and COL5A1, were located at the stromal ends of the margins, and together with enrichment of the extracellular matrix (ECM) and an immune-suppressed microenvironment, were associated with lymph node metastasis. Intermediate fibroblasts, myocytes, and neutrophils were enriched at the tumor ends, while cancer-associated fibroblasts (CAFs) were enriched at the stromal ends. The intermediate fibroblasts transformed into CAFs and relocated to the adjacent stromal ends where they participated in FN1-mediated ECM modulation.<h4>Conclusion</h4>We have generated a functional organization of the tumor-stromal interface in GB-OSCC and identified spatially located genes that contribute to nodal metastasis and disease progression. Our dataset might now be mined to discover suitable molecular targets in oral cancer.

SERPINC1
Also flagged:tumorcolorectal cancertumorsgene expressionBRAFKRAS
Journal Article 2024-08-13 ✓ 2 Snippets Rhead B, Hein DM, Pouliot Y, Guinney J, De La Vega FM, Sanford NN.
In-Text Gene Mentions

…antithrombin III (SERPINC1) (Additional file…

…while antithrombin IIISERPINC1was overexpressed in…

Show Full Abstract

<h4>Background</h4>There are known disparities in incidence and outcomes of colorectal cancer (CRC) by race and ethnicity. Some of these disparities may be mediated by molecular changes in tumors that occur at different rates across populations. Genetic ancestry is a measure complementary to race and ethnicity that can overcome missing data issues and better capture genetic similarity in admixed populations. We aimed to identify somatic mutations and tumor gene expression differences associated with both genetic ancestry and imputed race and ethnicity.<h4>Methods</h4>Sequencing was performed with the Tempus xT NGS 648-gene panel and whole exome capture RNA-Seq for 8454 primarily late-stage CRC patients. Genetic ancestry proportions for five continental groups-Africa (AFR), American indigenous (AMR), East Asia (EAS), Europe (EUR), and South Asia (SAS)-were estimated using ancestry informative markers. To address data gaps, race and ethnicity categories were imputed, resulting in assignments for 952 Hispanic/Latino, 420 non-Hispanic (NH) Asian, 1061 NH Black, and 5763 NH White individuals. We assessed association of genetic ancestry proportions and imputed race and ethnicity categories with somatic mutations in relevant CRC genes and in 2608 expression profiles, as well as 1957 consensus molecular subtypes (CMS).<h4>Results</h4>Increased AFR ancestry was associated with higher odds of somatic mutations in APC, KRAS, and PIK3CA and lower odds of BRAF mutations. Additionally, increased EAS ancestry was associated with lower odds of mutations in KRAS, EUR with higher odds in BRAF, and the Hispanic/Latino category with lower odds in BRAF. Greater AFR ancestry and the NH Black category were associated with higher rates of CMS3, while a higher proportion of Hispanic/Latino patients exhibited indeterminate CMS classifications.<h4>Conclusions</h4>Molecular differences in CRC tumor mutation frequencies and gene expression that may underlie observed differences by race and ethnicity were identified. The association of AFR ancestry with increased KRAS mutations aligns with higher CMS3 subtype rates in NH Black patients. The increase of indeterminate CMS in Hispanic/Latino patients suggests that subtype classification methods could benefit from enhanced patient diversity.

Also flagged:genetic disordersgenetic diseasesinborn errors of metabolismGaucher diseaseTay-Sachs diseasemucopolysaccharidosis IVA diseases
Journal Article 2024-08-13 No Snippets Sheth J, Nair A, Sheth F, Ajagekar M, Dhondekar T, Panigrahi I, Bavdekar A, Nampoothiri S, Datar C, Gandhi A, Muranjan M, Kaur A, Desai M, Mistri M, Patel C, Naik P, Shah M, Godbole K, Kapoor S, Gupta N, Bijarnia-Mahay S, Kadam S, Solanki D, Desai S, Iyer A, Patel K, Patel H, Shah RC, Mehta S, Shah R, Bhavsar R, Shah J, Pandya M, Patel B, Shah S, Shah H, Shah S, Bajaj S, Shah S, Thaker N, Kalane U, Kamate M, Kn VR, Tayade N, Jagadeesan S, Jain D, Chandarana M, Singh J, Mehta S, Suresh B, Sheth H.
Show Full Abstract

<h4>Background</h4>Rare disorders comprise of ~ 7500 different conditions affecting multiple systems. Diagnosis of rare diseases is complex due to dearth of specialized medical professionals, testing labs and limited therapeutic options. There is scarcity of data on the prevalence of rare diseases in different populations. India being home to a large population comprising of 4600 population groups, of which several thousand are endogamous, is likely to have a high burden of rare diseases. The present study provides a retrospective overview of a cohort of patients with rare genetic diseases identified at a tertiary genetic test centre in India.<h4>Results</h4>Overall, 3294 patients with 305 rare diseases were identified in the present study cohort. These were categorized into 14 disease groups based on the major organ/ organ system affected. Highest number of rare diseases (D = 149/305, 48.9%) were identified in the neuromuscular and neurodevelopmental (NMND) group followed by inborn errors of metabolism (IEM) (D = 47/305; 15.4%). Majority patients in the present cohort (N = 1992, 61%) were diagnosed under IEM group, of which Gaucher disease constituted maximum cases (N = 224, 11.2%). Under the NMND group, Duchenne muscular dystrophy (N = 291/885, 32.9%), trinucleotide repeat expansion disorders (N = 242/885; 27.3%) and spinal muscular atrophy (N = 141/885, 15.9%) were the most common. Majority cases of β-thalassemia (N = 120/149, 80.5%) and cystic fibrosis (N = 74/75, 98.7%) under the haematological and pulmonary groups were observed, respectively. Founder variants were identified for Tay-Sachs disease and mucopolysaccharidosis IVA diseases. Recurrent variants for Gaucher disease (GBA:c.1448T > C), β-thalassemia (HBB:c.92.+5G > C), non-syndromic hearing loss (GJB2:c.71G > A), albinism (TYR:c.832 C > T), congenital adrenal hyperplasia (CYP21A2:c.29-13 C > G) and progressive pseudo rheumatoid dysplasia (CCN6:c.298T > A) were observed in the present study.<h4>Conclusion</h4>The present retrospective study of rare disease patients diagnosed at a tertiary genetic test centre provides first insight into the distribution of rare genetic diseases across the country. This information will likely aid in drafting future health policies, including newborn screening programs, development of target specific panel for affordable diagnosis of rare diseases and eventually build a platform for devising novel treatment strategies for rare diseases.

Also flagged:autoimmune diseasesrheumatoid arthritisRAasthmaCOVID-19 infectionosteoarthritis
Journal Article 2024-08-13 No Snippets McMullon GT, Ezdoglian A, Booth AC, Jimenez-Royo P, Murphy PS, Jansen G, van der Laken CJ, Faulkner S.
Show Full Abstract

Several conjugates between folic acid and a series of kinetically stable lanthanide complexes have been synthesized, using amide coupling and azide-alkyne cycloaddition methodologies to link the metal-binding domain to folate through a variety of spacer groups. While all these complexes exhibit affinity for the folate receptor, it is clear that the point of attachment to folate is essential, with linkage through the γ-carboxylic acid giving rise to significantly enhanced receptor affinity. All the conjugates studied show affinities consistent with displacing biological circulating folate derivatives, 5-methyltetrahydrofolate, from folate receptors. All the complexes exhibit luminescence with a short-lived component arising from ligand fluorescence overlaid on a much longer lived terbium-centered component. These can be separated using time-gating methods. From the results obtained, the most promising approach to achieve sensitized luminescence in these systems requires incorporating a sensitizing chromophore close to the lanthanide.

BTN3A3
Also flagged:BTN3A2SARS-CoV-2 infectionimmune-related disorderpathogenesishost cellsbutyrophilin subfamily 3 member A2
Journal Article 2024-08-13 ✓ 5 Snippets Xu L, Yu D, Xu M, Liu Y, Yang LX, Zou QC, Feng XL, Li MH, Sheng N, Yao YG.
In-Text Gene Mentions

…BTN3A1, BTN3A2, andBTN3A3, share similar extracellular…

…BTN3A1 andBTN3A3contain an intracellular…

…studies have identifiedBTN3A3as a restriction…

…of BTN3A2 andBTN3A3, along with…

…BTN3A2-S, BTN3A1 andBTN3A3bind to Spike…

Show Full Abstract

<h4>Background</h4>Coronavirus disease 2019 (COVID-19) is an immune-related disorder caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The complete pathogenesis of the virus remains to be determined. Unraveling the molecular mechanisms governing SARS-CoV-2 interactions with host cells is crucial for the formulation of effective prophylactic measures and the advancement of COVID-19 therapeutics.<h4>Methods</h4>We analyzed human lung single-cell RNA sequencing dataset to discern the association of butyrophilin subfamily 3 member A2 (BTN3A2) expression with COVID-19. The BTN3A2 gene edited cell lines and transgenic mice were infected by live SARS-CoV-2 in a biosafety level 3 (BSL-3) laboratory. Immunoprecipitation, flow cytometry, biolayer interferometry and competition ELISA assays were performed in BTN3A2 gene edited cells. We performed quantitative real-time PCR, histological and/or immunohistochemical analyses for tissue samples from mice with or without SARS-CoV-2 infection.<h4>Findings</h4>The BTN3A2 mRNA level was correlated with COVID-19 severity. BTN3A2 expression was predominantly identified in epithelial cells, elevated in pathological epithelial cells from COVID-19 patients and co-occurred with ACE2 expression in the same lung cell subtypes. BTN3A2 targeted the early stage of the viral life cycle by inhibiting SARS-CoV-2 attachment through interactions with the receptor-binding domain (RBD) of the Spike protein and ACE2. BTN3A2 inhibited ACE2-mediated SARS-CoV-2 infection by reducing ACE2 in vitro and in vivo.<h4>Interpretation</h4>These results reveal a key role of BTN3A2 in the fight against COVID-19. Identifying potential monoclonal antibodies which mimic BTN3A2 may facilitate disruption of SARS-CoV-2 infection, providing a therapeutic avenue for COVID-19.<h4>Funding</h4>This study was supported by the National Natural Science Foundation of China (32070569, U1902215, and 32371017), the CAS "Light of West China" Program, and Yunnan Province (202305AH340006).

Also flagged:gene expressionsevofluranepropofolCardiovascular diseaseshemodynamicPyruvate Dehydrogenase Kinase 4
Journal Article 2024-08-13 No Snippets Bao M, Wu A.
Show Full Abstract

<h4>Background</h4>This study leverages the GSE4386 dataset, obtained from atrial tissue samples post-coronary artery bypass graft (CABG) surgery, to investigate the impact of anesthetic agents (sevoflurane and propofol) on gene expression and immune cell infiltration.<h4>Methods</h4>Hierarchical clustering and box plots were employed for dataset preprocessing, highlighting a significant outlier (sample GSM99282), subsequently removed to ensure data integrity. Differentially expressed genes (DEGs) were identified using volcano plots based on specific log-fold-change and <i>P</i>-value thresholds. Additional analyses included the Friends approach, Spearman's correlation, and gene set enrichment analysis (GSEA), exploring functional annotations and pathways.<h4>Results</h4>Heatmaps and bubble plots depicted DEGs, revealing distinct expression patterns between the sevoflurane and propofol groups. Friends analysis identified top genes based on log fold changes, further correlated using Spearman's method. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses illustrated functional annotations of DEGs, while GSEA highlighted enriched biological categories. Immune cell infiltration analysis showcased varied cellular presence post-CABG. ESTIMATE algorithm scores demonstrated differences in immune, stroma, and estimate scores. Microenvironment Cell Populations-counter (MCPcounter) revealed an increased abundance of cytotoxic lymphocytes in the sevoflurane group, confirmed by a single sample GSEA. CIBERSORT algorithm identified distinct immune cell compositions, highlighting differences in macrophage M0 prevalence between sevoflurane and propofol groups.<h4>Conclusions</h4>This comprehensive analysis provides insights into anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-CABG surgery. The identified DEGs and immune cell compositions offer potential biomarkers and therapeutic targets for refining anesthetic strategies in cardiac surgeries.

Also flagged:influenza infectionsinfluenzaInfluenza virus infectionsimmune responseSARS-CoV-2 infectionspulmonary infection
Journal Article 2024-08-13 No Snippets Schughart K, Smith AM, Tsalik EL, Threlkeld SC, Sellers S, Fischer WA, Schreiber J, Lücke E, Cornberg M, Debarry J, Woods CW, McClain MT, Heise M.
Show Full Abstract

<h4>Introduction</h4>Influenza virus infections are a major global health problem. Influenza can result in mild/moderate disease or progress to more severe disease, leading to high morbidity and mortality. Severity is thought to be primarily driven by immunopathology, but predicting which individuals are at a higher risk of being hospitalized warrants investigation into host genetics and the molecular signatures of the host response during influenza infections.<h4>Methods</h4>Here, we performed transcriptome and genotype analysis in healthy controls and patients exhibiting mild/moderate or severe influenza (ICU patients). A unique aspect of our study was the genotyping of all participants, which allowed us to assign ethnicities based on genetic variation and assess whether the variation was correlated with expression levels.<h4>Results</h4>We identified 169 differentially expressed genes and related molecular pathways between patients in the ICU and those who were not in the ICU. The transcriptome/genotype association analysis identified 871 genes associated to a genetic variant and 39 genes distinct between African-Americans and Caucasians. We also investigated the effects of age and sex and found only a few discernible gene effects in our cohort.<h4>Discussion</h4>Together, our results highlight select risk factors that may contribute to an increased risk of ICU admission for influenza-infected patients. This should help to develop better diagnostic tools based on molecular signatures, in addition to a better understanding of the biological processes in the host response to influenza.

CACNA1E
Also flagged:Maturity-onset diabetes of the youngMODYdiabetes mellitusautoimmune diabetesRFX6NKX2.2
Journal Article 2024-08-13 ✓ 1 Snippet Hasballa I, Maggi D.
In-Text Gene Mentions

…, TBC1D4 ,CACNA1E, MNX1 ,…

Show Full Abstract

Maturity-onset diabetes of the young (MODY) represents the most frequent form of monogenic diabetes mellitus (DM), currently classified in 14 distinct subtypes according to single gene mutations involved in the differentiation and function of pancreatic β-cells. A significant proportion of MODY has unknown etiology, suggesting that the genetic landscape is still to be explored. Recently, <i>novel</i> potentially MODY-causal genes, involved in the differentiation and function of β-cells, have been identified, such as <i>RFX6</i>, <i>NKX2.2</i>, <i>NKX6.1</i>, <i>WFS1</i>, <i>PCBD1</i>, <i>MTOR</i>, <i>TBC1D4</i>, <i>CACNA1E</i>, <i>MNX1</i>, <i>AKT2</i>, <i>NEUROG3</i>, <i>EIF2AK3</i>, <i>GLIS3</i>, <i>HADH</i>, and <i>PTF1A</i>. Genetic and clinical features of MODY variants remain highly heterogeneous, with no direct genotype-phenotype correlation, especially in the low-penetrant subtypes. This is a narrative review of the literature aimed at describing the current state-of-the-art of the <i>novel</i> likely MODY-associated variants. For a deeper understanding of MODY complexity, we also report some related controversies concerning the etiological role of some of the well-known pathological genes and MODY inheritance pattern, as well as the rare association of MODY with autoimmune diabetes. Due to the limited data available, the assessment of MODY-related genes pathogenicity remains challenging, especially in the setting of rare and low-penetrant subtypes. In consideration of the crucial importance of an accurate diagnosis, prognosis and management of MODY, more studies are warranted to further investigate its genetic landscape and the genotype-phenotype correlation, as well as the pathogenetic contribution of the nongenetic modifiers in this cohort of patients.

Also flagged:UbiquitinationSpinal muscular atrophydeathSMNmotor neuron degenerationmuscle atrophy
Journal Article 2024-08-13 No Snippets Bolado-Carrancio A, Tapia O, Rodríguez-Rey JC.
Show Full Abstract

Spinal muscular atrophy (SMA) is one of the most frequent causes of death in childhood. The disease's molecular basis is deletion or mutations in the <i>SMN1</i> gene, which produces reduced survival motor neuron protein (SMN) levels. As a result, there is spinal motor neuron degeneration and a large increase in muscle atrophy, in which the ubiquitin-proteasome system (UPS) plays a significant role. In humans, a paralogue of <i>SMN1</i>, <i>SMN2</i> encodes the truncated protein SMNΔ7. Structural differences between SMN and SMNΔ7 affect the interaction of the proteins with UPS and decrease the stability of the truncated protein. SMN loss affects the general ubiquitination process by lowering the levels of UBA1, one of the main enzymes in the ubiquitination process. We discuss how SMN loss affects both SMN stability and the general ubiquitination process, and how the proteins involved in ubiquitination could be used as future targets for SMA treatment.

Also flagged:COVID-19AMH
Journal Article 2024-08-13 No Snippets Nkrumah-Boadu B, Tweneboah G, Frimpong S.
Show Full Abstract

We investigate the degree of interconnectedness between stock returns and exchange rate returns, and the influence of some selected global uncertainty indices on such a relationship within a time-frequency domain in West Africa through the bi and partial wavelet approaches. The analysis was based on monthly observations from February 2013 to June 2023. The results highlight a negative correlation between stock return and exchange rates. The partial wavelet analysis evidence a significant effect of the global economic policy uncertainty, the implied oil market volatility, and the United States volatility index in driving the co-movements observed in the currency and stock markets. We also find a significant impact of the stock market on the currency market, underscoring the need for robust stock market policies. It is recommended that policymakers prioritize strategies aimed at boosting stock market stability and depth which can positively affect the currency markets. The significant influence of global uncertainties or shocks should not be disregarded in the formulation of policies regarding exchange rates and stock return integration at various investment horizons.

DCC
Also flagged:KRAScancersbindinghydrogennucleotidesRAS
Journal Article 2024-08-13 ✓ 1 Snippet Jani V, Sonavane U, Joshi R.
In-Text Gene Mentions

…(E–H) shows theDCCmotion for the…

Show Full Abstract

KRAS protein is known to be frequently mutated in various cancers. The most common mutations being at position 12, 13 and 61. The positions 12 and 13 form part of the phosphate binding region (P-loop) of KRAS. Owing to mutation, the protein remains in continuous active state and affects the normal cellular process. Understanding the structural changes owing to mutations in GDP-bound (inactive state) and GTP-bound (active state) may help in the design of better therapeutics. To understand the structural flexibility due to the mutations specifically located at P-loop regions (G12D, G12V and G13D), extensive molecular dynamics simulations (24 μs) have been carried for both inactive (GDP-bound) and active (GTP-bound) structures for the wild type and these mutants. The study revealed that the local structural changes at the site of mutations allosterically guide changes in distant regions of the protein through hydrogen bond and hydrophobic signalling network. The dynamic cross correlation analysis and the comparison of the correlated motions among different systems manifested that changes in SW-I, SW-II, α3 and the loop preceding α3 affects the interactions of GDP/GTP with different regions of the protein thereby affecting its hydrolysis. Further, the Markov state modelling analysis confirmed that the mutations, especially G13D imparts rigidity to structure compared to wild type and thus limiting its conformational state in either intermediate state or active state. The study suggests that along with SW-I and SW-II regions, the loop region preceding the α3 helix and α3 helix are also involved in affecting the hydrolysis of nucleotides and may be considered while designing therapeutics against KRAS.

HFE
Also flagged:postmenopausal osteoporosisosteoporosismineralTNF-α-C-reactive protein
Journal Article 2024-08-13 ✓ 1 Snippet Sarrafi S, Vahedi L, Pourzainali S, Ranjbar M, Farshbaf-Khalili A, Babaie S.
In-Text Gene Mentions

…disorders (such ashemochromatosis, hemophilia, and thalassemia)…

Show Full Abstract

The purpose of this study was to compare the inflammatory biomarkers in postmenopausal women with osteoporosis and those with normal bone mineral density (BMD). A total of 850 postmenopausal women aged 50 to 65 were randomly selected for participation in this cross-sectional investigation. 100 women displayed normal BMD, while 101 were diagnosed with osteoporosis, as determined by dual-energy X-ray absorptiometry. Biochemical techniques were used to quantify tumor necrosis factor α (TNF-α) levels, high-sensitivity C-reactive protein (hs-CRP), and interleukin-6. The area under the curve (AUC) for the diagnosis of osteoporosis was calculated using receiver-operator characteristic (ROC) curves. A significant difference was observed between the two groups in terms of age, menopause age, education level, and BMI (p < 0.005). Moreover, TNF-α (<i>p</i> = 0.026) and hs-CRP (<i>p</i> < 0.001) levels were significant differences between two groups. The logistic regression analysis adjusted for the confounders showed that only the elevation of hs-CRP had a significant effect on the risk of osteoporosis (OR (95 % CI):42.41 (12.66-142.3), <i>p</i> < 0.001). ROC analysis demonstrated that at the cut-off point of 0.415, the sensitivity and specificity values of 83.2 % and 82.2 % were obtained, respectively, for hs-CRP. hs-CRP is a valuable test for screening osteoporosis in postmenopausal women due to its accuracy and cost-effectiveness.

Also flagged:IronHepcidinSMURF1SMAD
Journal Article 2024-08-13 No Snippets Yazal T, Li CY.
Show Full Abstract

No abstract available.

Also flagged:extracellularPrimary Sjögren syndromechronic autoimmune diseaseautoantibodiespathogenesisimmune responses
Journal Article 2024-08-13 No Snippets Shahsavari A, Liu F.
Show Full Abstract

Primary Sjögren syndrome (pSS) is a chronic autoimmune disease mainly affecting salivary and lacrimal glands. The current pSS biomarkers, serum autoantibodies, are negative in many pSS patients diagnosed with histopathology changes, indicating the need of novel biomarkers. The current therapies of pSS are merely short-term symptomatic relief and can't provide effective long-term remedy. Extracellular vehicles (EVs) are nano-sized lipid bilayer-delimited particles spontaneously released by almost all types of cells and carrying various bioactive molecules to mediate inter-cellular communications. Recent studies found that EVs from salivary gland epithelial cells and immune cells play essential roles in pSS pathogenesis. Correspondingly, EVs and their cargos in plasma and saliva are promising candidate biomarkers for pSS diagnosis. Moreover, EVs from mesenchymal stem cells have shown promises to improve pSS treatment by modulating immune responses. This review summarizes recent findings in roles of EVs in pSS pathogenesis, diagnosis, and treatment of pSS, as well as related challenges and future research directions.

PRDX6
Also flagged:peroxiredoxin-6fertilizationcytoplasmpolyunsaturated fatty acidmembraneoxygen
Journal Article 2024-08-13 ✓ 5 Snippets Xu J, Zhang J, Song Y, Hasi G, Luan Z, Du W, Zhang J.
In-Text Gene Mentions

…Peroxiredoxin-6 (PRDX6) is an important…

…study, we investigatedPRDX6expression in the…

…We found thatPRDX6mRNA and protein…

PRDX6protein expression in…

…Similarly,PRDX6protein expression was…

Show Full Abstract

Sperm complete their maturation in the epididymis. Mature sperm are highly sensitive to oxidative damage. Peroxiredoxin-6 (PRDX6) is an important antioxidant enzyme. In this study, we investigated PRDX6 expression in the epididymal microenvironment and its distribution in the sperm of sheep. We found that PRDX6 mRNA and protein had the highest expression in the caput epididymis, followed by the corpus epididymis and cauda epididymis ( p<0.01 ). PRDX6 protein expression in epididymal fluid was higher in the caput epididymis than in the corpus epididymis and cauda epididymis ( p<0.01 ). Similarly, PRDX6 protein expression was higher in sperm derived from the caput epididymis and corpus epididymis than in sperm derived from the cauda epididymis ( p<0.01 ). Immunofluorescence revealed that PRDX6 was present only in the head of sperm derived from the caput epididymis and corpus epididymis but was distributed within the principal and middle regions of sperm derived from the cauda epididymis. Furthermore, PRDX6 was present in all parts of ejaculated sperm. In conclusion, PRDX6 showed a wider distribution in sperm cells during transport through the epididymis, and PRDX6 expression levels in epididymal tissue, epididymal fluid, and epididymal sperm decreased from the caput epididymis to the cauda epididymis. These results suggest that PRDX6 has an important role during sperm maturation in the epididymis.

HFE
Also flagged:β2-microglobulinβ2Mmajor histocompatibility complexMHC) class Icell surfaceMHC class I
Journal Article 2024-08-12 ✓ 5 Snippets Li K, Chai D, Ren S, Lian X, Shi X, Xu Y, Bao L, Yang S, Liang Y, Li X, Du H.
In-Text Gene Mentions

β2-microglobulin induced apoptosis of tumor cells via the ERK signaling pathway by directly interacting with HFE in HER2-overexpressing breast cancer.

The expression of HFE and p-ERK1/2 showed significantly high levels in HER2-overexpressing breast cancer tumor tissue compared with adjacent normal tissue, consistent with the results obtained from the cell experiments.<h4>Conclusions</h4>β2M induced apoptosis of tumor cells via activation of the ERK signal pathway by directly interacting with HFE in HER2-overexpressing breast cancer.

β2M, HFE, and p-ERK1/2 were examined in tumor and paired adjacent tissues via immunohistochemistry.<h4>Results</h4>HFE was found to be an interacting protein of β2M in ER<sup>-</sup>/HER2<sup>+</sup> breast cancer cells MDA-MB-453 by co-immunoprecipitation and mass spectrometry.

…and that thehemochromatosis(HFE) protein interacted…

…that the hemochromatosis (HFE) protein interacted with…

Show Full Abstract

<h4>Background</h4>Our previous study demonstrated that β2-microglobulin (β2M) promoted ER<sup>+</sup>/HER2<sup>-</sup> breast cancer survival via the SGK1/Bcl-2 signaling pathway. However, the role of β2M has not been investigated in ER<sup>-</sup>/HER2<sup>+</sup> breast cancer. Here, we aimed to determine the role of β2M in ER<sup>-</sup>/HER2<sup>+</sup> breast cancer.<h4>Methods</h4>The interaction between β2M and HFE was confirmed by co-immunoprecipitation, mass spectrometry, yeast two-hybrid screening, and His pull-down. The knockdown and overexpression of β2M or HFE were performed in MDA-MB-453 cells, and ERK signaling pathway was subsequently analyzed via western blotting. Apoptotic cells were detected using flow cytometer. β2M, HFE, and p-ERK1/2 were examined in tumor and paired adjacent tissues via immunohistochemistry.<h4>Results</h4>HFE was found to be an interacting protein of β2M in ER<sup>-</sup>/HER2<sup>+</sup> breast cancer cells MDA-MB-453 by co-immunoprecipitation and mass spectrometry. A yeast two-hybrid system and His-pull down experiments verified that β2M directly interacted with HFE. β2M and HFE as a complex were mainly located in the cytoplasm, with some on the cytomembrane of MDA-MB-453 cells. In addition to breast cancer cells BT474, endogenous β2M directly interacted with HFE in breast cancer cells MDA-MB-453, MDA-MB-231, and MCF-7. β2M activated the ERK signaling pathway by interacting with HFE and induced apoptosis of MDA-MB-453 cells. The expression of HFE and p-ERK1/2 showed significantly high levels in HER2-overexpressing breast cancer tumor tissue compared with adjacent normal tissue, consistent with the results obtained from the cell experiments.<h4>Conclusions</h4>β2M induced apoptosis of tumor cells via activation of the ERK signal pathway by directly interacting with HFE in HER2-overexpressing breast cancer.

SERPINC1
Also flagged:thrombophiliaATAtresia ofantithrombin(AT) deficiencyatresia of the
Journal Article 2024-08-12 ✓ 5 Snippets Iversen N, Henriksson CE, Sletten M, Le MS, Lindberg BR, Andersen R, Paus B.
In-Text Gene Mentions

Heterozygosity for the Budapest 3 mutation in SERPINC1 in a family with thrombophilia and structural anomalies of the inferior vena cava.

While all were heterozygous for c.391C > T, the father was also heterozygous for a variant of uncertain significance in SERPINC1.<h4>Conclusions</h4>The findings support the association between c.391C > T in SERPINC1, thrombophilia, and atresia of the IVC system and indicate that even heterozygosity for c.391C > T may contribute to such anomalies.

<h4>Background</h4>Atresia of the infrarenal inferior vena cava (IVC) is associated with thrombophilia and antithrombin (AT) deficiency (ATD) due to homozygosity for the so-called Budapest 3 variant, c.391C > T, in the gene, SERPINC1.<h4>Case presentation</h4>We report on a father and his two sons that had severe thrombosis at a young age.

…3 mutation inSERPINC1in a family…

…in the gene,SERPINC1.…

Show Full Abstract

<h4>Background</h4>Atresia of the infrarenal inferior vena cava (IVC) is associated with thrombophilia and antithrombin (AT) deficiency (ATD) due to homozygosity for the so-called Budapest 3 variant, c.391C > T, in the gene, SERPINC1.<h4>Case presentation</h4>We report on a father and his two sons that had severe thrombosis at a young age. One son had absence of, and the other had very gracile infrarenal IVC. The father had gracile vena iliaca. All had significant collateral building. AT activity was determined with four different methods and varied between moderately reduced and borderline normal values, depending on the method. While all were heterozygous for c.391C > T, the father was also heterozygous for a variant of uncertain significance in SERPINC1.<h4>Conclusions</h4>The findings support the association between c.391C > T in SERPINC1, thrombophilia, and atresia of the IVC system and indicate that even heterozygosity for c.391C > T may contribute to such anomalies. ATD detection was hampered by the varying sensitivity of methods used for AT activity measurement.

Also flagged:COVID-19COVID-19 infectionCOVID syndromecognitive declineskin rashvision
Journal Article 2024-08-12 No Snippets Xu Z, Wang W, Zhang D, Tam KW, Li Y, Chan DCC, Yang Z, Wong SYS.
Show Full Abstract

<h4>Background</h4>It is important to understand the excess risks of symptoms of long COVID when compared to the same symptoms in the general population. We aimed to evaluate the association between coronavirus disease 2019 (COVID-19) infection and various long-term symptoms.<h4>Methods</h4>We conducted a systematic review and meta-analysis of studies measuring long COVID symptoms lasting for at least three months after severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection in comparison to non-COVID-19 control groups. We searched MEDLINE and Embase (via Ovid), CINAHL (via EBSCOhost), the ProQuest Coronavirus Research Database, and the World Health Organization COVID-19 Research Database for relevant literature on 14 February 2023. The symptom list had 10 categories with 29 symptoms, including general, neurologic, respiratory, cardiac, dermatologic, eye, ear, musculoskeletal, psychiatric, and gastrointestinal symptoms. We performed random-effects meta-analysis and summarised the results using odds ratios (OR) and 95% confidence intervals (CI), after which we conducted subgroup analyses.<h4>Results</h4>We included 51 studies with 17 901 204 participants (range of mean age: 5.9-65.4 years; range of proportion of women: 11.2-96.0%). In the primary analysis, participants with COVID-19 had a significantly higher risk of having at least one long COVID symptom (OR = 2.032; 95% CI = 1.787-2.310). Specifically, they had higher risks of 25 symptoms, the highest of which were for smell (OR = 8.474; 95% CI = 6.357-11.295), taste (OR = 5.881; 95% CI = 3.818-9.059), post-exertional malaise (OR = 3.187; 95% CI = 2.602-3.904), shortness of breath (OR = 2.497; 95% CI = 2.125-2.935), brain fog (OR = 2.093; 95% CI = 1.362-3.218), hair loss (OR = 2.082; 95% CI = 1.291-3.358), chest pain (OR = 2.056; 95% CI = 1.692-2.498), cognitive decline (OR = 1.992; 95% CI = 1.560-2.544), palpitations (OR = 1.986; 95% CI = 1.647-2.395), and fatigue (OR = 1.971; 95% CI = 1.781-2.182). We found significant differences between studies with different follow-up times in cognitive decline, dizziness, palpitations, and sleep problems (P < 0.05). Adults had significantly higher risks of cognitive decline, hair loss, and joint pain than children (P < 0.05).<h4>Conclusions</h4>We found that COVID-19 can significantly increase the risk of many long COVID symptoms, without differences due to gender, age, or decrease over time after three months post-infection. This highlights that services and interventions for long COVID symptoms are needed.<h4>Registration</h4>PROSPERO (CRD42023409847).

Also flagged:protein secretioncell surfacelysosomesorganellesmembraneexocytosis
Journal Article 2024-08-12 No Snippets Néel E, Chiritoiu-Butnaru M, Fargues W, Denus M, Colladant M, Filaquier A, Stewart SE, Lehmann S, Zurzolo C, Rubinsztein DC, Marin P, Parmentier ML, Villeneuve J.
Show Full Abstract

Most secreted proteins are transported through the "conventional" endoplasmic reticulum-Golgi apparatus exocytic route for their delivery to the cell surface and release into the extracellular space. Nonetheless, formative discoveries have underscored the existence of alternative or "unconventional" secretory routes, which play a crucial role in exporting a diverse array of cytosolic proteins outside the cell in response to intrinsic demands, external cues, and environmental changes. In this context, lysosomes emerge as dynamic organelles positioned at the crossroads of multiple intracellular trafficking pathways, endowed with the capacity to fuse with the plasma membrane and recognized for their key role in both conventional and unconventional protein secretion. The recent recognition of lysosomal transport and exocytosis in the unconventional secretion of cargo proteins provides new and promising insights into our understanding of numerous physiological processes.

DCC
Also flagged:gastric intraepithelial foveolar type neoplasiagastric tumorsintraepithelial foveolar neoplasiaIFNstumorIFN
Journal Article 2024-08-12 ✓ 1 Snippet Sugai T, Uesugi N, Osakabe M, Yamamoto R, Hamada K, Honda M, Yanagawa N, Suzuki H.
In-Text Gene Mentions

…, BAX ,DCC, MSH2 ,…

Show Full Abstract

<h4>Background</h4>Gastric foveolar type neoplasia is a rare histological variant of gastric tumors. It is very difficult to differentiate between benign and malignant intraepithelial foveolar neoplasia (IFN). Although limited molecular alterations have been identified in IFNs, somatic copy number alterations (SCNAs), which are linked to tumor progression, have not been systematically evaluated in IFN.<h4>Methods</h4>The aim of the present study was to comprehensively examine SCNAs using a SNP array in 37 cases of IFN, compared with intestinal type dysplasia, including 39 low grade (LGD) and 32 high grade dysplasia (HGD) cases. In addition, gene mutations were evaluated using a gene panel. Finally, we attempted to determine molecular profiles using a hierarchical clustering analysis.<h4>Results</h4>Two patterns could be categorized according to the SCNAs in 108 tumors examined: high (subgroup 1) and low (subgroup 2) frequencies of SCNAs. Although IFN and LGD were associated with subgroup 2, HGD was found in both subgroups. The median numbers of total SCNAs and copy number gains were higher in IFN or HGD than in LGD. In addition, the IFN genotype was characterized by altered genes located at 4p13-4q35.2, including RAP1GDS1 and LEF1, which may be associated with IFN development. Finally, no significant mutations were found in IFNs using a gene panel.<h4>Conclusions</h4>The current molecular profiles of IFN may help elucidate the mechanisms of IFN development.

Also flagged:signal transductioncancerbrainageinggene expressionCOVID-19
Journal Article 2024-08-12 No Snippets Tokuhara Y, Akutsu T, Schwartz JM, Nacher JC.
Show Full Abstract

Network controllability is unifying the traditional control theory with the structural network information rooted in many large-scale biological systems of interest, from intracellular networks in molecular biology to brain neuronal networks. In controllability approaches, the set of minimum driver nodes is not unique, and critical nodes are the most important control elements because they appear in all possible solution sets. On the other hand, a common but largely unexplored feature in network control approaches is the probabilistic failure of edges or the uncertainty in the determination of interactions between molecules. This is particularly true when directed probabilistic interactions are considered. Until now, no efficient algorithm existed to determine critical nodes in probabilistic directed networks. Here we present a probabilistic control model based on a minimum dominating set framework that integrates the probabilistic nature of directed edges between molecules and determines the critical control nodes that drive the entire network functionality. The proposed algorithm, combined with the developed mathematical tools, offers practical efficiency in determining critical control nodes in large probabilistic networks. The method is then applied to the human intracellular signal transduction network revealing that critical control nodes are associated with important biological features and perturbed sets of genes in human diseases, including SARS-CoV-2 target proteins and rare disorders. We believe that the proposed methodology can be useful to investigate multiple biological systems in which directed edges are probabilistic in nature, both in natural systems or when determined with large uncertainties in-silico.

DNAH10
Also flagged:breast cancerTTNTP53MUC16SYNE1OBSCN
Journal Article 2024-08-12 ✓ 2 Snippets Kumar R, Awasthi S, Pradhan D, Kumar R, Goel H, Singh J, Haider I, Deo SVS, Kumar C, Srivastava A, Bhatnagar A, Kumar R, Lakshmi S, Augustine P, Ranjan A, Chopra A, Gogia A, Batra A, Mathur S, Rath GK, Kaur T, Dhaliwal RS, Mathew A, Agrawal U, Hussain S, Tanwar P.
In-Text Gene Mentions

…observed co-occurrence ofDNAH10and MUC16 (OR…

…P value: 6.68E−06),DNAH10and MUC16 (OR…

Show Full Abstract

Breast cancer (BC) has emerged as the most common malignancy among females. The genomic profile of BC is diverse in nature and complex due to heterogeneity among various geographically different ethnic groups. The primary objective of this study was to carry out a comprehensive mutational analysis of Indian BC cases by performing whole exome sequencing. The cohort included patients with a median age of 48 years. TTN, TP53, MUC16, SYNE1, and OBSCN were the frequently altered genes found in our cohort. The PIK3CA and KLC3 genes are driver genes implicated in various cellular functions and cargo transportation through microtubules, respectively. Except for CCDC168 and PIK3CA, several gene pairings were found to be significantly linked with co-occurrence. Irrespective of their hormonal receptor status, RTK/RAS was observed with frequently altered signaling pathways. Further analysis of the mutational signature revealed that SBS13, SBS6, and SBS29 were mainly observed in our cohort. This study supplements the discovery of diagnostic biomarkers and provides new therapeutic options for the improved management of BC.

SLC2A14
Also flagged:CTHRC1cell proliferationhepatocellular carcinomaextracellular matrix proteinmethylationangiogenesis
Journal Article 2024-08-12 ✓ 1 Snippet Sun X, Liu Y, Cheng C, Sun H, Tian L.
In-Text Gene Mentions

…SLC22A20P, MEGF10, andSLC2A14, were negatively correlated…

Show Full Abstract

<h4>Background</h4>Collagen triple helix repeat containing-1 (CTHRC1), an extracellular matrix protein, is highly expressed in hepatocellular carcinoma (HCC) and linked to poor prognosis. Nevertheless, the precise mechanism of CTHRC1 in HCC is unclear.<h4>Methods</h4>Agena MassARRAY® Methylation Analysis assessed the methylation level of CTHRC1 in the promoter region. Functional assays were conducted to investigate the effects of CTHRC1 knockdown in Hep3B2.1 cells. RNA sequencing identified differentially expressed genes and lncRNAs associated with angiogenesis after CTHRC1 knockdown. Furthermore, differential alternative splicing (AS) and gene fusion events were analyzed using rMATS and Arriba.<h4>Results</h4>In HCC cell lines, CTHRC1 was highly expressed and associated with hypomethylation. Downregulation of CTHRC1 inhibited Hep3B2.1 cell proliferation, migration, and invasion, blocked cells in the G1/S phase, and promoted apoptosis. We obtained 34 mRNAs and 7 lncRNAs differentially expressed between the NC and CTHRC1 inhibitor groups. Additionally, we found 4 angiogenesis-related mRNAs and lncRNAs significantly correlated with CTHRC1. RT-qPCR results showed that knockdown of CTHRC1 in Hep3B2.1 cells resulted in significantly aberrant expression of CXCL6, LINC02127, and AC020978.8. Moreover, the role of CTHRC1 in HCC development may be associated with events, like 12 AS events and 5 pairs of fusion genes.<h4>Conclusions</h4>High expressed CTHRC1 is associated with hypomethylation and may promote HCC development, involving events like angiogenesis, alternative splicing, and gene fusion.

Also flagged:metal ionsgliomametalmetabolismangiogenesisIron
Journal Article 2024-08-12 No Snippets Li JW, Mao YM, Chen SL, Ye R, Fei YR, Li Y, Tong SY, Yang HW, He YB.
Show Full Abstract

This review explores the intricate roles of metal ions-iron, copper, zinc, and selenium-in glioma pathogenesis and immune evasion. Dysregulated metal ion metabolism significantly contributes to glioma progression by inducing oxidative stress, promoting angiogenesis, and modulating immune cell functions. Iron accumulation enhances oxidative DNA damage, copper activates hypoxia-inducible factors to stimulate angiogenesis, zinc influences cell proliferation and apoptosis, and selenium modulates the tumor microenvironment through its antioxidant properties. These metal ions also facilitate immune escape by upregulating immune checkpoints and secreting immunosuppressive cytokines. Targeting metal ion pathways with therapeutic strategies such as chelating agents and metalloproteinase inhibitors, particularly in combination with conventional treatments like chemotherapy and immunotherapy, shows promise in improving treatment efficacy and overcoming resistance. Future research should leverage advanced bioinformatics and integrative methodologies to deepen the understanding of metal ion-immune interactions, ultimately identifying novel biomarkers and therapeutic targets to enhance glioma management and patient outcomes.

CACNA1E
Also flagged:Congenital heart diseasedeathMKL2MYH7NKX2-5left
Journal Article 2024-08-12 ✓ 4 Snippets Luo X, Liu L, Rong H, Liu X, Yang L, Li N, Shi H.
In-Text Gene Mentions

…cardiac relaxation, andCacna1eand Cacna1s ,…

…R-type calcium channelCacna1eis expressed in…

…Ablation ofCacna1ehas been shown…

…and mutations inCACNA1Ehave been associated…

Show Full Abstract

<h4>Background</h4>Congenital heart disease (CHD) is the most prevalent congenital anomaly, but its underlying causes are still not fully understood. It is believed that multiple rare genetic mutations may contribute to the development of CHD.<h4>Methods</h4>In this study, we aimed to identify novel genetic risk factors for CHD using an ENU-based dominant genetic screen in mice. We analyzed fetuses with malformed hearts and compared them to control littermates by whole exome or whole genome sequencing (WES/WGS). The differences in mutation rates between observed and expected values were tested using the Poisson and Binomial distribution. Additionally, we compared WES data from human CHD probands obtained from the Pediatric Cardiac Genomics Consortium with control subjects from the 1000 Genomes Project using Fisher's exact test to evaluate the burden of rare inherited damaging mutations in patients.<h4>Results</h4>By screening 10,285 fetuses, we identified 1109 cases with various heart defects, with ventricular septal defects and bicuspid aortic valves being the most common types. WES/WGS analysis of 598 cases and 532 control littermates revealed a higher number of ENU-induced damaging mutations in cases compared to controls. GO term and KEGG pathway enrichment analysis showed that pathways related to cardiac contraction and neuronal development and functions were enriched in cases. Further analysis of 1457 human CHD probands and 2675 control subjects also revealed an enrichment of genes associated with muscle and nervous system development in patients. By combining the mice and human data, we identified a list of 101 candidate digenic genesets, from which each geneset was co-mutated in at least one mouse and two human probands with CHD but not in control mouse and control human subjects.<h4>Conclusions</h4>Our findings suggest that gene mutations affecting early hemodynamic perturbations in the developing heart may play a significant role as a genetic risk factor for CHD. Further validation of the candidate gene set identified in this study could enhance our understanding of the complex genetics underlying CHD and potentially lead to the development of new diagnostic and therapeutic approaches.

Also flagged:nucleoporinnuclear poreenvelopecytoplasmicorganizationNucleoporins
Journal Article 2024-08-12 No Snippets Lin J, Sumara I.
Show Full Abstract

Nucleoporins, essential proteins building the nuclear pore, are pivotal for ensuring nucleocytoplasmic transport. While traditionally confined to the nuclear envelope, emerging evidence indicates their presence in various cytoplasmic structures, suggesting potential non-transport-related roles. This review consolidates findings on cytoplasmic nucleoporin assemblies across different states, including normal physiological conditions, stress, and pathology, exploring their structural organization, formation dynamics, and functional implications. We summarize the current knowledge and the latest concepts on the regulation of nucleoporin homeostasis, aiming to enhance our understanding of their unexpected roles in physiological and pathological processes.

Also flagged:poredegradationhydroxyapatitepolycaprolactonegelatinnanofiber
Journal Article 2024-08-12 No Snippets Aminatun, Sujak M K A, Izak R D, Hadi S, Sari YW, Gunawarman, Cahyati N, Yusuf Y, Che Abdullah CA.
Show Full Abstract

One approach to addressing bone defects involves the field of bone tissue engineering, with scaffolds playing an important role. The properties of the scaffold must be similar to those of natural bone, including pore size, porosity, interconnectivity, mechanical attributes, degradation rate, non-toxicity, non-immunogenicity, and biocompatibility. The primary goals of this study are as follows: first, to evaluate hydroxyapatite (HA)/polycaprolactone (PCL)/gelatin nanofiber scaffolds based on functional groups, fibre diameter, porosity, and degradation rate; second, to investigate the interaction between HA/PCL/gelatin scaffolds and osteoblast cells (specifically, the ATCC 7F2 cell line) using <i>in vitro</i> assays, including cell viability and adhesion levels. The fibre samples were fabricated using an electrospinning technique with a 15 kV voltage, a spinneret-collector distance of 10 cm, and a flow rate of 0.3 mL hour<sup>-1</sup>. The process was applied to five different HA/PCL/gelatin concentration ratios: 50 : 40 : 10; 50 : 30 : 20; 50 : 25 : 25; 50 : 20 : 30; 50 : 35 : 15 (in %wt). Fourier Transform Infrared (FTIR) spectrum analysis and tests revealed no differences in functional groups across the five compositions. The identified functional groups include PO<sub>4</sub> <sup>3-</sup>, OH<sup>-</sup>, CO<sub>3</sub> <sup>2-</sup> and C[double bond, length as m-dash]O stretching. Notably, an increase in PCL concentrations resulted in larger fiber diameters, ranging from 369-1403 nm with an average value of 929 ± 175 nm. The highest porosity percentage was (77.27 ± 11.57) %, and a sufficient degradation rate of up to 3.5 months facilitated the proliferation process of osteoblast cells. Tensile strength assessments revealed a significant increase in tensile strength with the addition of PCL, reaching a peak of 1.93 MPa. The MTT assay demonstrated a discernible increase in cell proliferation, as evidenced by increased cell viability percentages on days 1, 3, and 5. Concurrently, the fluorescence microscopy examination indicated an increase in cell numbers, which was especially noticeable on days 1 and 5. The SEM analysis confirmed the biocompatibility of the HA/PCL/gelatin nanofiber scaffold, as osteoblast cells attached and dispersed successfully five days after seeding. Based on these findings, the HA/PCL/gelatin nanofiber scaffold emerges as a very promising candidate for treating bone damage.

MMS22L
Also flagged:chromatinsister-chromatidcohesinreplication forkreplisomesG1 phase
Journal Article 2024-08-12 ✓ 1 Snippet Branzei D, Bene S, Gangwani L, Szakal B.
In-Text Gene Mentions

MMS22L

Show Full Abstract

At the core of cellular life lies a carefully orchestrated interplay of DNA replication, recombination, chromatin assembly, sister-chromatid cohesion and transcription. These fundamental processes, while seemingly discrete, are inextricably linked during genome replication. A set of replisome factors integrate various DNA transactions and contribute to the transient formation of sister chromatid junctions involving either the cohesin complex or DNA four-way junctions. The latter structures serve DNA damage bypass and may have additional roles in replication fork stabilization or in marking regions of replication fork blockage. Here, we will discuss these concepts based on the ability of one replisome component, Ctf4, to act as a hub and functionally link these processes during DNA replication to ensure genome maintenance.

Also flagged:polyethylene glycolreverse transcriptionpolymeraseviral hepatitis
Journal Article 2024-08-12 No Snippets Raya S, Tandukar S, Kattel HP, Sharma S, Sangsanont J, Sirikanchana K, Ngo HTT, Inson JGM, Enriquez MLD, Alam ZF, Setiyawan AS, Setiadi T, Haramoto E.
Show Full Abstract

Hepatitis A and E viruses (HAV and HEV, respectively) remain a significant global health concern despite advancements in healthcare and vaccination programs. Regular monitoring and vaccine efficacy of HAV are still lacking in different countries. This study aimed to investigate HAV and HEV prevalence in developed, developing, and least-developed Asian countries using wastewater as a surveillance tool. A total of 232 untreated wastewater samples were collected from six wastewater treatment plants, a sewage treatment plant, or an open drainage in six countries [Nepal (n = 51), Indonesia (n = 37), Thailand (n = 30), Vietnam (n = 27), the Philippines (n = 17), and Japan (n = 70)] between April and October 2022. Viruses in wastewater were concentrated by simple centrifugation or polyethylene glycol precipitation method, followed by viral RNA extraction and reverse transcription-quantitative polymerase chain reaction. HAV and HEV RNA were detected in the samples from Nepal (51 % for HAV and 2 % for HEV), Thailand (3 % for both viruses), and Japan (1 % for HAV and 24 % for HEV). Only HAV RNA was found in 11 % of the samples in Indonesia, whereas only HEV RNA was detected in Vietnam and the Philippines, with a positive ratio of 15 % and 12 %, respectively. These results highlighted the geographic variability in HAV and HEV prevalence, underscoring the need for localized public health strategies to address specific viral hepatitis challenges in each country.

Also flagged:synthesisnanomaterialsnanostructuresphotonPeptidespeptide
Journal Article 2024-08-12 No Snippets Bera S, Umesh, Bhattacharya S.
Show Full Abstract

Circularly polarized luminescence (CPL) is gaining interest across various disciplines, including materials science, pharmaceuticals, and sensing technologies. Organic molecules, due to their ease of synthesis and reduced toxicity, are a focus for achieving high dissymmetry values (<i>g</i> <sub>lum</sub>) in CPL. Here, we present a low molecular weight molecule (1), a dipeptide (Ala-Phe) covalently linked with tetraphenyl-ethylene (TPE), an Aggregation-Induced Emission luminophore (AIE-gen). Varying the stereochemistry of amino acid chiral centers, we synthesized homochiral 1-(l, l) & 1-(d, d) and heterochiral 1-(l, d) and 1-(d, l). In aqueous media, these molecules exhibit aggregation-induced chirality at the TPE chromophore. Heterochiral systems form sheet-like structures, displaying a bisignate induced circular dichroism signal and a good <i>g</i> <sub>lum</sub> value for CPL [7.5 (±0.04) × 10<sup>-3</sup>]. Conversely, homochiral systems adopt fibrillar morphology, exhibiting a monosignate induced circular dichroism signal with a lower dissymmetry value for CPL [1.3 (±0.05) × 10<sup>-3</sup>]. This study introduces the concept of chiroptical amplification, emphasizing enhanced CPL through heterochiral peptide-induced CPL compared to its homochiral counterpart, with an ON and OFF CPL signal at low and high temperature respectively.

HFE
Also flagged:Gadoliniumnephrogenic systemic fibrosisencephalopathymetalslanthanumSystemic fibrosis
Journal Article 2024-08-12 ✓ 1 Snippet Cunningham A, Kirk M, Hong E, Yang J, Howard T, Brearley A, Sáenz-Trevizo A, Krawchuck J, Watt J, Henderson I, Dokladny K, DeAguero J, Escobar GP, Wagner B.
In-Text Gene Mentions

…in patients withhemochromatosis.…

Show Full Abstract

Gadolinium-based contrast agents are increasingly used in clinical practice. While these pharmaceuticals are verified causal agents in nephrogenic systemic fibrosis, there is a growing body of literature supporting their role as causal agents in symptoms associated with gadolinium exposure after intravenous use and encephalopathy following intrathecal administration. Gadolinium-based contrast agents are multidentate organic ligands that strongly bind the metal ion to reduce the toxicity of the metal. The notion that cationic gadolinium dissociates from these chelates and causes the disease is prevalent among patients and providers. We hypothesize that non-ligand-bound (soluble) gadolinium will be exceedingly low in patients. Soluble, ionic gadolinium is not likely to be the initial step in mediating any disease. The Kidney Institute of New Mexico was the first to identify gadolinium-rich nanoparticles in skin and kidney tissues from magnetic resonance imaging contrast agents in rodents. In 2023, they found similar nanoparticles in the kidney cells of humans with normal renal function, likely from contrast agents. We suspect these nanoparticles are the mediators of chronic toxicity from magnetic resonance imaging contrast agents. This article explores associations between gadolinium contrast and adverse health outcomes supported by clinical reports and rodent models.

HTT
Also flagged:depressionbrain-derived neurotrophic factorBDNFTNF-αGABAergic receptorMajor depressive disorder
Journal Article 2024-08-12 ✓ 1 Snippet Dib M, Lewine JD, Abbott CC, Deng ZD.
In-Text Gene Mentions

…and negatively with5-HTTthroughout the temporal…

Show Full Abstract

<h4>Introduction</h4>Electroconvulsive therapy (ECT) remains a critical intervention for treatment-resistant depression (MDD), yet its neurobiological underpinnings are not fully understood. This pilot study aims to investigate changes in loudness dependence of auditory evoked potentials (LDAEP), a proposed biomarker of serotonergic activity, in patients undergoing ECT.<h4>Methods</h4>High-resolution magnetoencephalography (MEG) was utilized to measure LDAEP in nine depressed patients receiving right unilateral ECT. We hypothesized that ECT would reduce the LDAEP slope, reflecting enhanced serotonergic neurotransmission. Depression severity and cognitive performance were assessed using the 24-item Hamilton Depression Rating Scale (HDRS<sub>24</sub>) and the Repeatable Battery for the Assessment of Neuropsychological Status (RBANS), respectively.<h4>Results</h4>Contrary to our hypothesis, findings indicated a significant increase in LDAEP post-ECT (<i>t</i> <sub>8</sub> = 3.17, <i>p</i> = .013). The increase in LDAEP was not associated with changes in depression severity or cognitive performance.<h4>Discussion</h4>The observed increase in LDAEP suggests a more complex interaction between ECT and neurobiological systems, rather than a direct reflection of serotonergic neurotransmission. Potential mechanisms for this increase include ECT's impact on serotonergic, dopaminergic, glutamatergic, and GABAergic receptor activity, neuroplasticity involving brain-derived neurotrophic factor (BDNF), and inflammatory modulators such as TNF-α. Our results highlight the multifaceted effects of ECT on brain function, necessitating further research to elucidate these interactions.

Also flagged:endoplasmic reticulumdoxorubicincancerpathogenesisprotein synthesiscalcium
Journal Article 2024-08-12 No Snippets Sun M, Zhang X, Tan B, Zhang Q, Zhao X, Dong D.
Show Full Abstract

As a chemotherapy agent, doxorubicin is used to combat cancer. However, cardiotoxicity has limited its use. The existing strategies fail to eliminate doxorubicin-induced cardiotoxicity, and an in-depth exploration of its pathogenesis is in urgent need to address the issue. Endoplasmic reticulum stress (ERS) occurs when Endoplasmic Reticulum (ER) dysfunction results in the accumulation of unfolded or misfolded proteins. Adaptive ERS helps regulate protein synthesis to maintain cellular homeostasis, while prolonged ERS stimulation may induce cell apoptosis, leading to dysfunction and damage to tissue and organs. Numerous studies on doxorubicin-induced cardiotoxicity strongly link excessive activation of the ERS to mechanisms including oxidative stress, calcium imbalance, autophagy, ubiquitination, and apoptosis. The researchers also found several clinical drugs, chemical compounds, phytochemicals, and miRNAs inhibited doxorubicin-induced cardiotoxicity by targeting ERS. The present review aims to outline the interactions between ERS and other mechanisms in doxorubicin-induced cardiotoxicity and summarize ERS's role in this type of cardiotoxicity. Additionally, the review enumerates several clinical drugs, phytochemicals, chemical compounds, and miRNAs targeting ERS for considering therapeutic regimens that address doxorubicin-induced cardiotoxicity.

Also flagged:HydroxyapatitePolyvinyl Alcoholporenitrogensynthesispolyvinylpyrrolidone
Journal Article 2024-08-12 No Snippets Antonova OS, Goldberg MA, Fomin AS, Kucheryaev KA, Konovalov AA, Sadovnikova MA, Murzakhanov FF, Sitnikov AI, Leonov AV, Andreeva NA, Khayrutdinova DR, Gafurov MR, Barinov SM, Komlev VS.
Show Full Abstract

Mesoporous hydroxyapatite (HA) is widely used in various applications, such as the biomedical field, as a catalytic, as a sensor, and many others. The aim of this work was to obtain HA powders by means of chemical precipitation in a medium containing a polymer-polyvinyl alcohol or polyvinylpyrrolidone (PVP)-with concentrations ranging from 0 to 10%. The HA powders were characterized by X-ray diffraction, Fourier transform infrared spectroscopy, atomic emission spectroscopy with inductively coupled plasma, electron paramagnetic resonance, scanning electron microscopy (SEM), and transmission electron microscopy (TEM). The specific surface area (SSA), pore volume, and pore size distributions were determined by low-temperature nitrogen adsorption measurements, and the zeta potential was established. The formation of macropores in powder agglomerates was determined using SEM and TEM. The synthesis in 10% PVP increased the SSA from 101.3 to 158.0 m<sup>2</sup>/g, while the ripening for 7 days led to an increase from 112.3 to 195.8 m<sup>2</sup>/g, with the total pore volume rising from 0.37 to 0.71 cm<sup>3</sup>/g. These materials could be classified as meso-macroporous HA. Such materials can serve as the basis for various applications requiring improved textural properties and may lay the foundation for the creation of bulk 3D materials using a technique that allows for the preservation of their unique pore structure.

Also flagged:metalsdeathrespiratory diseasesasthmasynthesissphingolipid
Journal Article 2024-08-12 No Snippets Ahmad S, Single S, Liu Y, Hough KP, Wang Y, Thannickal VJ, Athar M, Goliwas KF, Deshane JS.
Show Full Abstract

Exposure to heavy metals (HMs) is often associated with inflammation and cell death, exacerbating respiratory diseases including asthma. Most inhaled particulate HM exposures result in the deposition of HM-bound fine particulate matter, PM<sub>2.5</sub>, in pulmonary cell populations. While localized high concentrations of HMs may be a causative factor, existing studies have mostly evaluated the effects of systemic or low-dose chronic HM exposures. This report investigates the impact of local high concentrations of specific HMs (NaAsO<sub>2</sub>, MnCl<sub>2</sub>, and CdCl<sub>2</sub>) on sphingolipid homeostasis and oxidative stress, as both play a role in mediating responses to HM exposure and have been implicated in asthma. Utilizing an in vitro model system and three-dimensional ex vivo human tissue models, we evaluated the expression of enzymatic regulators of the salvage, recycling, and de novo synthesis pathways of sphingolipid metabolism, and observed differential modulation in these enzymes between HM exposures. Sphingolipidomic analyses of specific HM-exposed cells showed increased levels of anti-apoptotic sphingolipids and reduced pro-apoptotic sphingolipids, suggesting activation of the salvage and de novo synthesis pathways. Differential sphingolipid regulation was observed within HM-exposed lung tissues, with CdCl<sub>2</sub> exposure and NaAsO<sub>2</sub> exposure activating the salvage and de novo synthesis pathway, respectively. Additionally, using spatial transcriptomics and quantitative real-time PCR, we identified HM exposure-induced transcriptomic signatures of oxidative stress in epithelial cells and human lung tissues.

OLFM4
Also flagged:Ginsenoside Rb1cell proliferationWntRb1cell homeostasisNotch
Journal Article 2024-08-12 ✓ 5 Snippets Zong B, Wang J, Wang K, Hao J, Han JY, Jin R, Ge Q.
In-Text Gene Mentions

…AGT, R, GCATTGGGGTGAATGATAGCA;Olfm4, F, AAAGTGACCTTGTGCCTGCC,…

…of Lgr5 andOlfm4in the ileum…

…decreased number ofOlfm4+ cells per…

…Rb1 showed elevatedOlfm4and Lgr5 expression…

…increased number ofOlfm4+ cells, reaching…

Show Full Abstract

Exposure to the space microenvironment has been found to disrupt the homeostasis of intestinal epithelial cells and alter the composition of the microbiota. To investigate this in more detail and to examine the impact of ginsenoside Rb1, we utilized a mouse model of hindlimb unloading (HU) for four weeks to simulate the effects of microgravity. Our findings revealed that HU mice had ileum epithelial injury with a decrease in the number of intestinal stem cells (ISCs) and the level of cell proliferation. The niche functions for ISCs were also impaired in HU mice, including a reduction in Paneth cells and Wnt signaling, along with an increase in oxidative stress. The administration of Rb1 during the entire duration of HU alleviated the observed intestinal defects, suggesting its beneficial influence on epithelial cell homeostasis. Hindlimb unloading also resulted in gut dysbiosis. The supplementation of Rb1 in the HU mice or the addition of Rb1 derivative compound K in bacterial culture in vitro promoted the growth of beneficial probiotic species such as <i>Akkermansia</i>. The co-housing experiment further showed that Rb1 treatment in ground control mice alone could alleviate the defects in HU mice that were co-housed with Rb1-treated ground mice. Together, these results underscore a close relationship between dysbiosis and impaired ISC functions in the HU mouse model. It also highlights the beneficial effects of Rb1 in mitigating HU-induced epithelial injury by promoting the expansion of intestinal probiotics. These animal-based insights provide valuable knowledge for the development of improved approaches to maintaining ISC homeostasis in astronauts.

Also flagged:Costimulatory ReceptorsICOS4-1BBTumorCervical cancerCC
Journal Article 2024-08-12 No Snippets Rojas-Diaz JM, Solorzano-Ibarra F, Garcia-Barrientos NT, Klimov-Kravtchenko K, Guitron-Aviña MS, Cruz-Ramos JA, Ortiz-Lazareno PC, Urciaga-Gutierrez PI, Bueno-Topete MR, Garcia-Chagollan M, Haramati J, Del Toro-Arreola S.
Show Full Abstract

Cervical cancer (CC) poses a significant health burden, particularly in low- and middle-income countries. NK cells play a crucial role against CC; however, they can become exhausted and lose their cytotoxic capacity. This work explores the expression of costimulatory receptors (ICOS, 4-1BB, OX-40) in exhausted NK cells from CC patients. Peripheral blood and tumor biopsies were collected, and flow cytometry was used to evaluate the expression of costimulatory receptors in exhausted NK cells. There is an increase of peripheral exhausted NK cells (PD-1<sup>+</sup>TIGIT<sup>+</sup>) in CC patients; this subpopulation has a selectively increased expression of the costimulatory receptors ICOS and 4-1BB. An exhausted population is also highly increased in tumor-infiltrating NK cells, and it shows a dramatically increased expression of the costimulatory receptors ICOS (>15×) and 4-1BB (>10×) compared to peripheral NK cells. The exhausted cells, both in the periphery and in the tumor infiltrating lymphocytes (TILs), are also more likely than non-exhausted NK cell populations (PD-1<sup>-</sup>TIGIT<sup>-</sup>) to express these costimulatory receptors; increases ranging from 2.0× ICOS, 2.4× 4-1BB, and 2.6× OX-40 in CD56<sup>dim</sup> PBMCs to 1.5× ICOS, 5× 4-1BB, and 10× OX-40 in TILs were found. Our study demonstrates for the first time the increased expression of the costimulatory receptors ICOS, 4-1BB, and OX-40 in peripheral CD56<sup>dim</sup>, CD56<sup>bright</sup>, and tumor-infiltrating NK cells in CC. Targeting these receptors for stimulation could reverse exhaustion and be a promising immunotherapy strategy.

STAU1
Also flagged:COVID-19glialcytoplasmic inclusionsadult-onset neurodegenerative disordersamyotrophic lateral sclerosisALS
Journal Article 2024-08-12 ✓ 1 Snippet Strong MJ, McLellan C, Kaplanis B, Droppelmann CA, Junop M.
In-Text Gene Mentions

…several (e.g., G3BP1/2,Stau1and Caprin1) that…

Show Full Abstract

The SARS-CoV-2 nucleocapsid protein (N protein) is critical in viral replication by undergoing liquid-liquid phase separation to seed the formation of a ribonucleoprotein (RNP) complex to drive viral genomic RNA (gRNA) translation and in suppressing both stress granules and processing bodies, which is postulated to increase uncoated gRNA availability. The N protein can also form biomolecular condensates with a broad range of host endogenous proteins including RNA binding proteins (RBPs). Amongst these RBPs are proteins that are associated with pathological, neuronal, and glial cytoplasmic inclusions across several adult-onset neurodegenerative disorders, including TAR DNA binding protein 43 kDa (TDP-43) which forms pathological inclusions in over 95% of amyotrophic lateral sclerosis cases. In this study, we demonstrate that the N protein can form biomolecular condensates with TDP-43 and that this is dependent on the N protein C-terminus domain (N-CTD) and the intrinsically disordered C-terminus domain of TDP-43. This process is markedly accelerated in the presence of RNA. In silico modeling suggests that the biomolecular condensate that forms in the presence of RNA is composed of an N protein quadriplex in which the intrinsically disordered TDP-43 C terminus domain is incorporated.

HFE
Also flagged:MyocarditisCardiomyopathiesCOVID-19antibodylymphocytic myocarditisnucleocapsid
Journal Article 2024-08-12 ✓ 5 Snippets Blagova O, Lutokhina Y, Kogan E, Savina P, Aleksandrova S, Zaklyazminskaya E.
In-Text Gene Mentions

…heterozygous form ofhemochromatosis(n = 1,…

…(n = 1,HFE), restrictive CMP…

…(Danon’s disease andhemochromatosis) capillary Sanger sequencing…

…( LAMP2 andHFE) was performed…

…mutation in theHFEgene was revealed,…

Show Full Abstract

The aim of this study was to evaluate the clinical course and outcomes of post-COVID myocarditis in patients with cardiomyopathies (CMP). This case series includes 10 patients with different CMPs who had COVID-19 (seven men; 48.4 ± 11.4 yr.): left ventricular non-compaction (n = 2), arrhythmogenic right ventricular CMP in combination with a heterozygous form of hemochromatosis (n = 1, <i>HFE</i>), restrictive CMP (n = 1, <i>MyBPC3</i>), laminopathy (n = 1, <i>LMNA</i>), dilated cardiomyopathy (n = 1, <i>MYH7 + MyBPC3</i>), Danon's disease (n = 1, <i>LAMP2</i>) and AL cardiac amyloidosis (n = 3). Myocardial morphological examination with immunohistochemical staining and PCR for SARS-CoV-2 and cardiotropic viruses was performed in six patients, while cardiac MRI and anti-cardiac antibody titres were evaluated in all patients. Post-COVID lymphocytic myocarditis was confirmed morphologically in six patients (with LVNC, RCM, ARCV, Danon's disease, and AL amyloidosis). Spike and nucleocapsid coronavirus proteins were detected in cell infiltrates, endothelium and cardiomyocytes in all biopsies; SARS-CoV-2 RNA was found in five out of six. In four patients, the diagnosis of myocarditis was based on MRI, high titres of anti-cardiac antibodies and clinical data. The mean time from COVID-19 to the diagnosis of myocarditis was 7 (5; 10.5) months. Myocarditis manifested with the onset/increase of arrhythmias and heart failure. Immunosuppressive therapy with corticosteroids was administered to six patients and led to an increase in ejection fraction and improvement of heart failure symptoms in five of them. CMPs are a favourable background for the development of post-COVID myocarditis. The onset or deterioration of heart failure and/or arrhythmias in patients with CMPs after COVID-19 requires the exclusion of myocarditis and, if present, the administration of immunosuppressive therapy.

Also flagged:ketamineGAD67synthesisneurotransmitter receptorsN-methyl-D-aspartate (NMDA) receptorcannabinoid receptor 1
Journal Article 2024-08-12 No Snippets Gu SM, Hong E, Seo S, Kim S, Yoon SS, Cha HJ, Yun J.
Show Full Abstract

<h4>Importance</h4>Glutamic acid decarboxylase 67 (GAD67) is a gamma-aminobutyric acid (GABA) synthesis enzyme associated with the function of other neurotransmitter receptors, such as the N-methyl-D-aspartate (NMDA) receptor and cannabinoid receptor 1. However, the role of GAD67 in the development of different abused drug-induced reward behaviors remains unknown. In order to elucidate the mechanisms of substance use disorder, it is crucial to study changes in biomarkers within the brain's reward circuit induced by drug use.<h4>Objective</h4>The study was designed to examine the effects of the downregulation of GAD67 expression in the dorsal striatum on reward behavior development.<h4>Methods</h4>We evaluated the effects of GAD67 knockdown on depression-like behavior and anxiety using the forced swim test and elevated plus maze test in a mouse model. We further determined the effects of GAD67 knockdown on ketamine- and JWH-018-induced conditioned place preference (CPP).<h4>Results</h4>Knockdown of GAD67 in the dorsal striatum of mice increased depression-like behavior, but it decreased anxiety. Moreover, the CPP score on the NMDA receptor antagonist ketamine was increased by GAD67 knockdown, whereas the administration of JWH-018, a cannabinoid receptor agonist, did not affect the CPP score in the GAD67 knockdown mice group compared with the control group.<h4>Conclusions and relevance</h4>These results suggest that striatal GAD67 reduces GABAergic neuronal activity and may cause ketamine-induced NMDA receptor inhibition. Consequently, GAD67 downregulation induces vulnerability to the drug reward behavior of ketamine.

CCPG1
Also flagged:RUNX1PDIA5Glioblastomadisulfideglioblastoma multiformeGBM
Journal Article 2024-08-12 ✓ 1 Snippet Ji Q, Tu Z, Liu J, Zhou Z, Li F, Zhu X, Huang K.
In-Text Gene Mentions

Cell cycle and apoptosis regulator 1cycle and apoptosis…

Show Full Abstract

PDIA5 is responsible for modification of disulfide bonds of proteins. However, its impact on the malignant progression of glioblastoma multiforme (GBM) remains unknown. We analyzed the expression and prognostic significance of PDIA5 in cohorts of GBM and clinical samples. The PDIA5 protein was significantly overexpressed in GBM tissues, and higher expression of PDIA5 was statistically associated with a worse prognosis in patients with GBM. Transcriptional data from PDIA5 knockdown GBM cells revealed that downstream regulatory genes of PDIA5 were enriched in malignant regulatory pathways and PDIA5 enhanced the proliferative and invasive abilities of GBM cells. By constructing a PDIA5 CXXC motif mutant plasmid, we found CCAR1 was the vital downstream factor of PDIA5 in regulating GBM malignancy <i>in vitro</i> and <i>in vivo</i>. Additionally, RUNX1 bound to the promoter region of PDIA5 and regulated gene transcription, leading to activation of the PDIA5/CCAR1 regulatory axis in GBM. The RUNX1/PDIA5/CCAR1 axis significantly influenced the malignant behavior of GBM cells. In conclusion, this study comprehensively elucidates the crucial role of PDIA5 in the malignant progression of GBM. Downregulating PDIA5 can mitigate the malignant biological behavior of GBM both <i>in vitro</i> and <i>in vivo</i>, potentially improving the efficacy of treatment for clinical patients with GBM.

PLCL1
Also flagged:autoimmune diseaseantibodiesHLASTAT1STAT4HLA-DRA
Journal Article 2024-08-11 ✓ 1 Snippet Casares-Marfil D, Martínez-Bueno M, Borghi MO, Pons-Estel G, PRECISESADS Clinical Consortium, Reales G, Zuo Y, Espinosa G, Radstake T, van den Hoogen LL, Wallace C, Guthridge J, James JA, Cervera R, Meroni PL, Martin J, Knight JS, Alarcón-Riquelme ME, Sawalha AH.
In-Text Gene Mentions

PLCL1

Show Full Abstract

<h4>Objective</h4>Primary antiphospholipid syndrome (PAPS) is a rare autoimmune disease characterized by the presence of antiphospholipid antibodies and the occurrence of thrombotic events and pregnancy complications. Our study aimed to identify novel genetic susceptibility loci associated with PAPS.<h4>Methods</h4>We performed a genome-wide association study comprising 5,485 individuals (482 affected individuals) of European ancestry. Significant and suggestive independent variants from a meta-analysis of approximately 7 million variants were evaluated for functional and biological process enrichment. The genetic risk variability for PAPS in different populations was also assessed. Hierarchical clustering, Mahalanobis distance, and Dirichlet Process Mixtures with uncertainty clustering methods were used to assess genetic similarities between PAPS and other immune-mediated diseases.<h4>Results</h4>We revealed genetic associations with PAPS in a regulatory locus within the HLA class II region near HLA-DRA and in STAT1-STAT4 with a genome-wide level of significance; 34 additional suggestive genetic susceptibility loci for PAPS were also identified. The disease risk allele near HLA-DRA is associated with overexpression of HLA-DRB6, HLA-DRB9, HLA-DQA2, and HLA-DQB2 in immune cells, vascular tissue, and nervous tissue. This association is independent of the association between PAPS and HLA-DRB1*1302. Functional analyses highlighted immune-related pathways in PAPS-associated loci. The comparison with other immune-mediated diseases revealed a close genetic relatedness to neuromyelitis optica, systemic sclerosis, and Sjögren syndrome, suggesting co-localized causal variations close to STAT1-STAT4, TNPO3, and BLK.<h4>Conclusion</h4>This study represents a comprehensive large-scale genetic analysis for PAPS and provides new insights into the genetic basis and pathophysiology of this rare disease.

DNAJC1
Also flagged:bindingNucleic acid binding proteinsgene expressiongerm cellNBPmembrane
Journal Article 2024-08-11 ✓ 1 Snippet Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R.
In-Text Gene Mentions

…19/RFX, LET-607/CREB, F54F2.9/DNAJC1, ZK546.5, XND-1, ZTF-23,…

Show Full Abstract

Fertility requires the faithful proliferation of germ cells and their differentiation into gametes. Controlling these cellular states demands precise timing and expression of gene networks. Nucleic acid binding proteins (NBPs) play critical roles in gene expression networks that influence germ cell development. There has, however, been no functional analysis of the entire NBP repertoire in controlling in vivo germ cell development. Here, we analyzed germ cell states and germline architecture to systematically investigate the function of 364 germline-expressed NBPs in the Caenorhabditis elegans germ line. Using germline-specific knockdown, automated germ cell counting, and high-content analysis of germ cell nuclei and plasma membrane organization, we identify 156 NBPs with discrete autonomous germline functions. By identifying NBPs that control the germ cell cycle, proliferation, differentiation, germline structure and fertility, we have created an atlas for mechanistic dissection of germ cell behavior and gamete production.

Also flagged:lysophospholipidsoxygenmembranelipidmembraneshydroxyl
Journal Article 2024-08-11 No Snippets Fedoruk A, Shadyro O, Edimecheva I, Fedoruk D, Khrutskin V, Kirkovsky L, Sorokin V, Talkachova H.
Show Full Abstract

The interaction of reactive oxygen species with cell membrane lipids is usually considered in the context of lipid peroxidation in the nonpolar component of the membrane. In this work, for the first time, data were obtained indicating that damage to human cell membranes can occur in the polar part of lysophospholipids at the interface with the aqueous environment due to free radical fragmentation (FRF) processes. FRF products, namely 1-hexadecanoyloxyacetone (PAc) and 1-octadecanoyloxyacetone (SAc), were identified in human serum, and a GC-MS method was developed to quantify PAc and SAc. The content of FRF products in serum samples of 52 healthy donors was found to be in the range of 1.98-4.75 μmol/L. A linear regression equation, C<sub>PAc&SAc</sub> (μmol/L) = 0.51 + 0.064 × years, was derived to describe the relationship between age and content of FRF products. In 70 patients with acute surgical pathology in comparison with the control group of healthy donors, two distinct clusters with different concentration levels of FRF products were revealed. The first cluster: groups of 43 patients with various localized inflammatory-destructive lesions of hollow organ walls and bacterial translocation (septic inflammation) of abdominal cavity organs. These patients showed a 1.5-1.9-fold (p = 0.012) decrease in the total concentration of PAc and SAc in serum. In the second cluster: groups of 27 patients with ischemia-reperfusion tissue damage (aseptic inflammation), - a statistically significant increase in the concentration of FRF products was observed: in 2.2-4.0 times (p = 0.0001). The obtained data allow us to further understand the role of free-radical processes in the damage of lipid molecules. FRF products can potentially be used as markers of the degree of free-radical damage of hydroxyl containing phospholipids.

SOX6
Also flagged:Transcription FactorsSox8Sox10transcription factoroligodendrocytemyelin
Journal Article 2024-08-11 ✓ 2 Snippets Jörg LM, Schlötzer-Schrehardt U, Lefebvre V, Sock E, Wegner M.
In-Text Gene Mentions

…]; guinea pig anti-Sox6(made in house,…

…by staining forSox6( Figure 2…

Show Full Abstract

Myelin-forming oligodendrocytes in the vertebrate nervous system co-express the transcription factor Sox10 and its paralog Sox8. While Sox10 plays crucial roles throughout all stages of oligodendrocyte development, including terminal differentiation, the loss of Sox8 results in only mild and transient perturbations. Here, we aimed to elucidate the roles and interrelationships of these transcription factors in fully differentiated oligodendrocytes and myelin maintenance in adults. For that purpose, we conducted targeted deletions of Sox10, Sox8, or both in the brains of two-month-old mice. Three weeks post-deletion, none of the resulting mouse mutants exhibited significant alterations in oligodendrocyte numbers, myelin sheath counts, myelin ultrastructure, or myelin protein levels in the corpus callosum, despite efficient gene inactivation. However, differences were observed in the myelin gene expression in mice with Sox10 or combined Sox8/Sox10 deletion. RNA-sequencing analysis on dissected corpus callosum confirmed substantial alterations in the oligodendrocyte expression profile in mice with combined deletion and more subtle changes in mice with Sox10 deletion alone. Notably, Sox8 deletion did not affect any aspects of the expression profile related to the differentiated state of oligodendrocytes or myelin integrity. These findings extend our understanding of the roles of Sox8 and Sox10 in oligodendrocytes into adulthood and have important implications for the functional relationship between the paralogs and the underlying molecular mechanisms.

Also flagged:PalmitoylationlipidPalmitoyl acyltransferasesneurodegenerative diseasessynapticsynaptic vesicle
Journal Article 2024-08-10 No Snippets Peng J, Liang D, Zhang Z.
Show Full Abstract

Palmitoylation is a type of lipid modification that plays an important role in various aspects of neuronal function. Over the past few decades, several studies have shown that the palmitoylation of synaptic proteins is involved in neurotransmission and synaptic functions. Palmitoyl acyltransferases (PATs), which belong to the DHHC family, are major players in the regulation of palmitoylation. Dysregulated palmitoylation of synaptic proteins and mutated/dysregulated DHHC proteins are associated with several neurodegenerative diseases, such as Alzheimer's disease (AD), Huntington's disease (HD), and Parkinson's disease (PD). In this review, we summarize the recent discoveries on the subcellular distribution of DHHC proteins and analyze their expression patterns in different brain cells. In particular, this review discusses how palmitoylation of synaptic proteins regulates synaptic vesicle exocytotic fusion and the localization, clustering, and transport of several postsynaptic receptors, as well as the role of palmitoylation of other proteins in regulating synaptic proteins. Additionally, some of the specific known associations of these factors with neurodegenerative disorders are explored, with a few suggestions for the development of therapeutic strategies. Finally, this review provides possible directions for future research to reveal detailed and specific mechanisms underlying the roles of synaptic protein palmitoylation.

RABGAP1LBTN3A3PTGIS
Also flagged:intrahepatic cholestasisstillbirthIntrahepatic cholestasis of pregnancybile acidmetabolismbiosynthesis
Journal Article 2024-08-10 ✓ 5 Snippets Fang Y, Kang Z, Zhang W, Xiang Y, Cheng X, Gui M, Fang D.
In-Text Gene Mentions

…by PSAT1, KRT72,RABGAP1Land ACAT2 etc.…

…DCD, TMEM258, KRT72,RABGAP1L, PPP3CC, MYH7, BLOC1S1,…

…1:100; Proteintech, USA),RABGAP1L(13894-1-AP; 1:100; Proteintec…

…PKLR, SIGLEC6, SH3BP4,BTN3A3, BIN2, HMBS, CASKIN2,…

…CASKIN2, SMIM1, SLC2A3,PTGIS, ERVFRD-1, NOP10, PADI3,…

Show Full Abstract

<h4>Background</h4>The pregnant women with intrahepatic cholestasis were at high risk of fetal distress, preterm birth and unexpected stillbirth. Intrahepatic cholestasis of pregnancy (ICP) was mainly caused by disorder of bile acid metabolism, whereas the specific mechanism was obscure.<h4>Methods</h4>We performed proteomics analysis of 10 ICP specimens and 10 placenta specimens from patients without ICP through data-independent acquisition (DIA) technique to disclose differentially expressed proteins. We executed metabolomic analysis of 30 ICP specimens and 30 placenta specimens from patients without ICP through UPLC-MS/MS to identify differentially expressed metabolites. Enrichment and correlation analysis was used to obtain the direct molecular insights of ICP development. The ICP rat models were constructed to validate pathological features.<h4>Results</h4>The heatmap of proteomics analysis showed the top 30 up-regulated and 30 down-regulated proteins. The metabolomic analysis revealed 20 richer and 4 less abundant metabolites in ICP samples compared with placenta specimens from patients without ICP, and enrichment pathways by these metabolites included primary bile acid biosynthesis, cholesterol metabolism, bile secretion, nicotinate and nicotinamide metabolism, purine metabolism and metabolic pathways. Combined analysis of multiple omics results demonstrated that bile acids such as Glycohyocholic acid, Glycine deoxycholic acid, beta-Muricholic acid, Noncholic acid, cholic acid, Gamma-Mercholic Acid, alpha-Muricholic acid and Glycochenodeoxycholic Aicd were significantly associated with the expression of GLRX3, MYL1, MYH7, PGGT1B, ACTG1, SP3, LACTB2, C2CD5, APBB2, IPO9, MYH2, PPP3CC, PIN1, BLOC1S1, DNAJC7, RASAL2 and ATCN3 etc. The core protein ACAT2 was involved in lipid metabolic process and animal model showed that ACAT2 was up-regulated in placenta and liver of pregnant rats and fetal rats. The neonates had low birth weight and Safranin O-Fast green FCF staining of animal models showed that poor osteogenic and chondrogenic differentiation of fetal rats.<h4>Conclusion</h4>Multiple metabolites-alpha-Muricholic acid, beta-Muricholic acid, Glycine deoxycholic acid and Glycochenodeoxycholic Acid etc. were perfect biomarkers to predict occurrence of ICP. Bile acids were significantly associated with varieties of protein expression and these proteins were differentially expressed in ICP samples. Our study provided several biomarkers for ICP detection and potential therapeutic targets for ICP development.

Also flagged:skin infectiondermatophytosisInfectionsinfectionfungal infectiondermatophytoses
Journal Article 2024-08-10 No Snippets Kizerwetter-Świda M, Bąk I, Biegańska MJ, Dembele K, Chrobak-Chmiel D.
Show Full Abstract

<h4>Background</h4>Dermatophytosis is a common skin infection of cats and many other animals. A reliable diagnosis is crucial because of the zoonotic potential of dermatophytes. The routine mycological diagnostic procedures for dermatophytosis are widely known, but in the case of some isolates, identification based on phenotypic characteristics may be incorrect. Infections caused by Chrysosporium spp. are usually described in reptiles, but in other animals they are uncommon.<h4>Case presentation</h4>This study presents a description of a cat with dermatological lesions, that was mistakenly diagnosed with Trichophyton spp. dermatophytosis. Clinical material for mycological examination was collected from alopecic areas on the back of the neck, the ventral abdomen, and the hindlimbs. The initial identification based on phenotypic properties indicated Trichophyton spp. The result of the MALDI-ToF MS allowed the exclusion of the Trichophyton genus. Ultimately, the correct identification as Chrysosporium articulatum was obtained based on the sequencing of ribosomal genes.<h4>Conclusions</h4>Interpretation of the results of the mycological examination of samples collected from animals' skin or hair shafts is always challenging. Thus, careful consideration of the primary cause of the clinical lesions observed on the skin is mandatory, and the culture results are worth supporting by molecular methods.

OLFM4
Also flagged:Cas9PLAGL2DigestiveERT2RNA polymerase IIIPol III
Journal Article 2024-08-10 ✓ 1 Snippet Kashima H, Fischer A, Veronese-Paniagua DA, Gazit VA, Ma C, Yan Y, Levin MS, Madison BB, Rubin DC.
In-Text Gene Mentions

…Sox9 , andOlfm4showed no change…

Show Full Abstract

<h4>Background & aims</h4>Human sporadic colorectal cancer (CRC) results from a multistep pathway with sequential acquisition of specific genetic mutations in the colorectal epithelium. Modeling CRC in vivo is critical for understanding the tumor microenvironment. To accurately recapitulate human CRC pathogenesis, mouse models must include these multi-step genetic abnormalities. The aim of this study was to generate a sporadic CRC model that more closely mimics this multi-step process and to use this model to study the role of a novel Let7 target PLAGL2 in CRC pathogenesis.<h4>Methods</h4>We generated a CRISPR/Cas9 somatic mutagenesis mouse model that is inducible and multiplexed for simultaneous inactivation of multiple genes involved in CRC pathogenesis. We used both a doxycycline-inducible transcriptional activator and a doxycycline-inactivated transcriptional repressor to achieve tight, non-leaky expression of the Cas9 nickase. This mouse has transgenic expression of multiple guide RNAs to induce sporadic inactivation in the gut epithelium of 4 tumor suppressor genes commonly mutated in CRC, Apc, Pten, Smad4, and Trp53. These were crossed to Vil-LCL-PLAGL2 mice, which have Cre-inducible overexpression of PLAGL2 in the gut epithelium.<h4>Results</h4>These mice exhibited random somatic mutations in all 4 targeted tumor suppressor genes, resulting in multiple adenomas and adenocarcinomas in the small bowel and colon. Crosses with Vil-LCL-PLAGL2 mice demonstrated that gut-specific PLAGL2 overexpression increased colon tumor growth.<h4>Conclusions</h4>This conditional model represents a new CRISPR/Cas9-mediated mouse model of colorectal carcinogenesis. These mice can be used to investigate the role of novel, previously uncharacterized genes in CRC, in the context of multiple commonly mutated tumor suppressor genes and thus more closely mimic human CRC pathogenesis.

Also flagged:gene expressionpathogenesisnicotinecarbonyl compoundsmetalsbinding
Journal Article 2024-08-10 No Snippets Besaratinia A, Tommasi S.
Show Full Abstract

Despite the popularity of electronic cigarettes (e-cigs) among adolescent never-smokers and adult smokers seeking a less pernicious substitute for tobacco cigarettes, the long-term health impact of vaping is largely unknown. Like cigarette smoke, e-cig vapor contains harmful and potentially harmful compounds, although in fewer numbers and at substantially lower concentrations. Many of the same constituents of e-cig vapor and cigarette smoke induce epigenetic changes that can lead to the dysregulation of disease-related genes. MicroRNAs (MiRNAs) are key regulators of gene expression in health and disease states. Extensive research has shown that miRNAs play a prominent role in the regulation of genes involved in the pathogenesis of smoking-related diseases. However, the use of miRNAs for investigating the disease-causing potential of vaping has not been fully explored. This review article provides an overview of e-cigs as a highly consequential electronic nicotine delivery system, describes trends in e-cig use among adolescents and adults, and discusses the ongoing debate on the public health impact of vaping. Highlighting the significance of miRNAs in cell biology and disease, it summarizes the published and ongoing research on miRNAs in relation to gene regulation and disease pathogenesis in e-cig users and in vitro experimental settings. It identifies gaps in knowledge and priorities for future research while underscoring the need for empirical evidence that can inform the regulation of tobacco products to protect youth and promote public health.

Also flagged:tumorPancreatic ductal adenocarcinomaPDACpeptidegemcitabinepaclitaxel
Journal Article 2024-08-10 No Snippets Nakka NMR, Rachamala HK, Angom RS, Indla NR, Dutta SK, Wang E, Bhattacharya S, Sesha Sainath AV, Babiker H, Pal K, Mukhopadhyay D.
Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is a lethal disease where standard-of-care chemotherapeutic drugs have limited efficacy due to the development of drug resistance and poor drug delivery caused by a highly desmoplastic tumor microenvironment. Combining multiple drugs in a tumor-targeting carrier would be a favorable approach to overcome these limitations. Hence, a tumor-targeted peptide (TTP) conjugated amphiphilic tri-block copolymer was developed to make targeted polymer nanoparticles (TTP-PNPs) serving as a vehicle for carrying gemcitabine (Gem), paclitaxel (PTX), and their combination (Gem + PTX). The TTP-PNPs in the form of empty polymer (P), single drug-loaded [P(Gem) and P(PTX)], and dual drug-loaded [P(Gem + PTX)] polymer nanoformulations exhibited stable and homogenous spherical shapes with 110-160 nm size. These nanoformulations demonstrated excellent stability under <i>in vitro</i> physiological conditions and led to an efficient release of the drugs in the presence of reduced glutathione (GSH). The efficacy of these nanoparticles was thoroughly evaluated <i>in vitro</i> and <i>in vivo</i>, demonstrating a notable capacity to selectively target and restrict PDAC cells (PANC-1 and KPC) growth. The cellular uptake and biodistribution study showed a significantly higher tumor-targeting ability of TTP-PNPs than PNPs without TTP. Notably, P(Gem + PTX) exhibited the lowest IC<sub>50</sub> compared to all other controls and showed heightened synergistic effects in both cell lines. Furthermore, P(Gem + PTX) showed a significantly better tumor reduction and median overall survival in mouse models than single drug-loaded TTP-PNPs or a combination of free drugs (Gem + PTX). In summary, our TTP-PNP system shows great promise as a novel platform for delivering Gem + PTX specifically to pancreatic cancer (PC), maximizing the therapeutic benefits with lower concentrations of the drugs and potentially reducing toxic side effects.

HFE
Also flagged:Central ObesityFibrosisliver diseasenonalcoholic fatty liver diseaseNAFLDsteatosis
Journal Article 2024-08-10 ✓ 1 Snippet De A, Bhagat N, Mehta M, Singh P, Rathi S, Verma N, Taneja S, Premkumar M, Duseja A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>The current definition of lean is based on body mass index (BMI). However, BMI is an imperfect surrogate for adiposity and provides no information on central obesity (CO). Hence, we explored the differences in clinical profile and liver disease severity in lean patients with nonalcoholic fatty liver disease (NAFLD) with and without CO.<h4>Methods</h4>One hundred seventy lean patients with NAFLD (BMI <23 kg/m<sup>2</sup>) were divided into two groups depending upon the presence or absence of CO (waist circumference ≥80 cm in females and ≥90 cm in males). Noninvasive assessment of steatosis was done by ultrasound and controlled attenuation parameter (CAP), while fibrosis was assessed with FIB-4 and liver stiffness measurement (LSM). FibroScan-AST (FAST) score was used for non-invasive prediction of NASH with significant fibrosis.<h4>Results</h4>Of 170 patients with lean NAFLD, 96 (56.5%) had CO. Female gender (40.6% vs. 17.6%, <i>P</i> = 0.001), hypertriglyceridemia (58.3% vs. 39.2%, <i>P</i> = 0.01) and metabolic syndrome (23.9% vs. 4.1%, <i>P</i> < 0.001) were more common in the CO group. There was a poor correlation between BMI and waist circumference (r = 0.24, 95% CI: 0.09-0.38). Grade 2-3 steatosis on ultrasound was significantly more common in CO patients (30% vs. 12.3%, <i>P</i> = 0.007). CAP [312.5 (289.8-341) dB/m vs. 275 (248-305.1) dB/m, <i>P</i> = 0.002], FAST score [0.42 (0.15-0.66) vs. 0.26 (0.11-0.39), <i>P</i> = 0.04], FIB-4 and LSM were higher in those with CO. Advanced fibrosis was more prevalent among CO patients using FIB-4 (19.8% vs 8.1%, <i>P</i> = 0.03) and LSM (9.5% vs. 0, <i>P</i> = 0.04). CO was independently associated with advanced fibrosis after adjusting for BMI and metabolic risk factors (aOR: 3.11 (1.10-8.96), <i>P</i> = 0.03). Among these 170 patients, 142 fulfilled metabolic dysfunction associated steatotic liver disease (MASLD) criteria. CO was also an independent risk factor for advanced fibrosis in MASLD (3.32 (1.23-8.5), <i>P</i> = 0.02).<h4>Conclusion</h4>Lean patients with NAFLD or MASLD and CO have more severe liver disease compared to those without CO.

Research Square 2024-08-10 Preprint (No Snippets API) Fan J, Guo Q, Liang J, Huo J, Wu S, Wang T, Wu W, Bai X.
Show Full Abstract

<title>Abstract</title> <p> <bold>Background</bold> Acute respiratory distress syndrome (ARDS) is a major lung injury disease, and the most common cause is sepsis. Angiogenesis is vital in the process of diseaseoccurrence. Several angiogenesis related pathways have been identified to play an important role in ARDS. Hence, it was vital to screen the angiogenesis-related biomarkers for the treatment of sepsis-induced ARDS (SI-ARDS). <bold>Methods</bold> We introduced transcriptome data to filter differentially expressed genes (DEGs) in SI-ARDS. Venn diagram was executed to identify angiogenesis-related differentially expressed genes (AR-DEGs). Pearson correlation was utilised to obtain AR-DEGs highly correlated with SI-ARDS. PPI network was executed to gain core genes. Further, least absolute shrinkage and selection operator (LASSO) regression was implemented to retain biomarkers. Receiver operating characteristic (ROC) curves were conducted to estimate diagnostic model. The immune infltration circumstance was analyzed by ssGSEA algorithms. The miRNAs-transcription factor (TFs) and ceRNA network were predicted via miRTarBase, miRNet and AnimalTFDB database, respectively. <bold>Results</bold> We identified 108 DEGs associated with SI-ARDS. Then, 22 AR-DEGs highly correlated with SI-ARDS were obtainedpearson correlation. Subsequently, 6 angiogenesis-related biomarkers were identified, including <italic>LTF</italic> , <italic>OLFM4</italic> , <italic>CEACAM8</italic> , <italic>MME</italic> , <italic>BPI</italic> , and <italic>TFPI</italic> . Moreover, we got six significantly differential immune cells in ARDS samples induced by sepsis, among which neutrophils and MDSC infiltration had the highest correlation with <italic>TFPI</italic> , <italic>MME</italic> . Finally, the constructed ceRNA regulatory network was composed of 87 nodes and 192 edges. Some potential TFs targeting angiogenesis-related biomarkers were identified, including CEBPE and DCH1. <bold>Conclusion</bold> Overall, we obtained six angiogenesis-related biomarkers ( <italic>LTF</italic> , <italic>OLFM4</italic> , <italic>CEACAM8</italic> , <italic>MME</italic> , <italic>BPI</italic> , <italic>TFPI</italic> ) associated with SI-ARDS, which laid a theoretical foundation for the treatment of SI-ARDS. </p>

Also flagged:transcription factorschromatincell-cycle associatedproneural transcription factorscell cycleRLBP1
Journal Article 2024-08-09 No Snippets Zuo Z, Cheng X, Ferdous S, Shao J, Li J, Bao Y, Li J, Lu J, Jacobo Lopez A, Wohlschlegel J, Prieve A, Thomas MG, Reh TA, Li Y, Moshiri A, Chen R.
Show Full Abstract

The development of the retina is under tight temporal and spatial control. To gain insights into the molecular basis of this process, we generate a single-nuclei dual-omic atlas of the human developing retina with approximately 220,000 nuclei from 14 human embryos and fetuses aged between 8 and 23-weeks post-conception with matched macular and peripheral tissues. This atlas captures all major cell classes in the retina, along with a large proportion of progenitors and cell-type-specific precursors. Cell trajectory analysis reveals a transition from continuous progression in early progenitors to a hierarchical development during the later stages of cell type specification. Both known and unrecorded candidate transcription factors, along with gene regulatory networks that drive the transitions of various cell fates, are identified. Comparisons between the macular and peripheral retinae indicate a largely consistent yet distinct developmental pattern. This atlas offers unparalleled resolution into the transcriptional and chromatin accessibility landscapes during development, providing an invaluable resource for deeper insights into retinal development and associated diseases.

SUDS3
Also flagged:AP-1ORF2capsid proteinhost cellORF2 capsid proteinORF2g
Journal Article 2024-08-09 ✓ 2 Snippets Ferrié M, Alexandre V, Montpellier C, Bouquet P, Tubiana T, Mézière L, Ankavay M, Bentaleb C, Dubuisson J, Bressanelli S, Aliouat-Denis CM, Rouillé Y, Cocquerel L.
In-Text Gene Mentions

…σ1), sp|P56377 (humanAP-1 complexcomplex subunit σ1B,…

…and sp|Q96PC3 (humanAP-1 complexcomplex subunit σ1C,…

Show Full Abstract

Although the Hepatitis E virus (HEV) is an emerging global health burden, little is known about its interaction with the host cell. HEV genome encodes three proteins including the ORF2 capsid protein that is produced in different forms, the ORF2i protein which is the structural component of viral particles, and the ORF2g/c proteins which are massively secreted but are not associated with infectious material. We recently demonstrated that the endocytic recycling compartment (ERC) is hijacked by HEV to serve as a viral factory. However, host determinants involved in the subcellular shuttling of viral proteins to viral factories are unknown. Here, we demonstrate that the AP-1 adaptor complex plays a pivotal role in the targeting of ORF2i protein to viral factories. This complex belongs to the family of adaptor proteins that are involved in vesicular transport between the trans-Golgi network and early/recycling endosomes. An interplay between the AP-1 complex and viral protein(s) has been described for several viral lifecycles. In the present study, we demonstrated that the ORF2i protein colocalizes and interacts with the AP-1 adaptor complex in HEV-producing or infected cells. We showed that silencing or drug-inhibition of the AP-1 complex prevents ORF2i protein localization in viral factories and reduces viral production in hepatocytes. Modeling of the ORF2i/AP-1 complex also revealed that the S domain of ORF2i likely interacts with the σ1 subunit of AP-1 complex. Hence, our study identified for the first time a host factor involved in addressing HEV proteins (i.e. ORF2i protein) to viral factories.

Also flagged:acute kidney injurychronic kidney diseaseischemiareperfusion injuryextracellularinsulin‐like growth factors
Journal Article 2024-08-09 No Snippets Zhang YL, Tang TT, Wang B, Wen Y, Feng Y, Yin Q, Jiang W, Zhang Y, Li ZL, Wu M, Wu QL, Song J, Crowley SD, Lan HY, Lv LL, Liu BC.
Show Full Abstract

The transition from acute kidney injury (AKI) to chronic kidney disease (CKD) is a critical clinical issue. Although previous studies have suggested macrophages as a key player in promoting inflammation and fibrosis during this transition, the heterogeneity and dynamic characterization of macrophages are still poorly understood. Here, we used integrated single-cell RNA sequencing and spatial transcriptomic to characterize the spatiotemporal heterogeneity of macrophages in murine AKI-to-CKD model of unilateral ischemia-reperfusion injury. A marked increase in macrophage infiltration at day 1 was followed by a second peak at day 14 post AKI. Spatiotemporal profiling revealed that injured tubules and macrophages co-localized early after AKI, whereas in late chronic stages had spatial proximity to fibroblasts. Further pseudotime analysis revealed two distinct lineages of macrophages in this transition: renal resident macrophages differentiated into the pro-repair subsets, whereas infiltrating monocyte-derived macrophages contributed to chronic inflammation and fibrosis. A novel macrophage subset, extracellular matrix remodeling-associated macrophages (EAMs) originating from monocytes, linked to renal fibrogenesis and communicated with fibroblasts via insulin-like growth factors (IGF) signalling. In sum, our study identified the spatiotemporal dynamics of macrophage heterogeneity with a unique subset of EAMs in AKI-to-CKD transition, which could be a potential therapeutic target for preventing CKD development.

Also flagged:infertilitypsychological distresscancerinfertileMale infertilityprimary ciliary dyskinesia
Journal Article 2024-08-09 No Snippets Stallmeyer B, Dicke AK, Tüttelmann F.
Show Full Abstract

Male infertility affects approximately 17% of all men and represents a complex disorder in which not only semen parameters such as sperm motility, morphology, and number of sperm are highly variable, but also testicular phenotypes range from normal spermatogenesis to complete absence of germ cells. Genetic factors significantly contribute to the disease but chromosomal aberrations, mostly Klinefelter syndrome, and microdeletions of the Y-chromosome have remained the only diagnostically and clinically considered genetic causes. Monogenic causes remain understudied and, thus, often unidentified, leaving the majority of the male factor couple infertility pathomechanistically unexplained. This has been changing mostly because of the introduction of exome sequencing that allows the analysis of multiple genes in large patient cohorts. As a result, pathogenic variants in single genes have been associated with non-syndromic forms of all aetiologic sub-categories in the last decade. This review highlights the contribution of exome sequencing to the identification of novel disease genes for isolated (non-syndromic) male infertility by presenting the results of a comprehensive literature search. Both, reduced sperm count in azoospermic and oligozoospermic patients, and impaired sperm motility and/or morphology, in asthenozoospermic and/or teratozoospermic patients are highly heterogeneous diseases with well over 100 different candidate genes described for each entity. Applying the standardized evaluation criteria of the ClinGen gene curation working group, 70 genes with at least moderate evidence to contribute to the disease are highlighted. The implementation of these valid disease genes in clinical exome sequencing is important to increase the diagnostic yield in male infertility and, thus, improve clinical decision-making and appropriate genetic counseling. Future advances in androgenetics will continue to depend on large-scale exome and genome sequencing studies of comprehensive international patient cohorts, which are the most promising approaches to identify additional disease genes and provide reliable data on the gene-disease relationship.

Also flagged:extracellular vesiclecolorectal cancermetastatic carcinomaadenomaAAextracellular
Journal Article 2024-08-09 No Snippets Min L, Bu F, Meng J, Liu X, Guo Q, Zhao L, Li Z, Li X, Zhu S, Zhang S.
Show Full Abstract

It takes more than 20 years for normal colorectal mucosa to develop into metastatic carcinoma. The long time window provides a golden opportunity for early detection to terminate the malignant progression. Here, we aim to enable liquid biopsy of T1a stage colorectal cancer (CRC) and precancerous advanced adenoma (AA) by profiling circulating small extracellular vesicle (sEV)-derived RNAs. We exhibited a full RNA landscape for the circulating sEVs isolated from 60 participants. A total of 58,333 annotated RNAs were detected from plasma sEVs, among which 1,615 and 888 sEV-RNAs were found differentially expressed in plasma from T1a stage CRC and AA compared to normal controls (NC). Then we further categorized these sEV-RNAs into six modules by a weighted gene coexpression network analysis and constructed a 60-gene t-SNE model consisting of the top 10 RNAs of each module that could well distinguish T1a stage CRC/AA from NC samples. Some sEV-RNAs were also identified as indicators of specific endoscopic and morphological features of different colorectal lesions. The top-ranked biomarkers were further verified by RT-qPCR, proving that these candidate sEV-RNAs successfully identified T1a stage CRC/AA from NC in another cohort of 124 participants. Finally, we adopted different algorithms to improve the performance of RT-qPCR-based models and successfully constructed an optimized classifier with 79.3% specificity and 99.0% sensitivity. In conclusion, circulating sEVs of T1a stage CRC and AA patients have distinct RNA profiles, which successfully enable the detection of both T1a stage CRC and AA via liquid biopsy.

Also flagged:oligonucleotideKIF1Abehavioralneurological disorderarrestdegradation
Journal Article 2024-08-09 No Snippets Ziegler A, Carroll J, Bain JM, Sands TT, Fee RJ, Uher D, Kanner CH, Montes J, Glass S, Douville J, Mignon L, Gleeson JG, Crooke ST, Chung WK.
Show Full Abstract

KIF1A-associated neurological disorder (KAND) is a neurodegenerative and often lethal ultrarare disease with a wide phenotypic spectrum associated with largely heterozygous de novo missense variants in KIF1A. Antisense oligonucleotide treatments represent a promising approach for personalized treatments in ultrarare diseases. Here we report the case of one patient with a severe form of KAND characterized by refractory spells of behavioral arrest and carrying a p.Pro305Leu variant in KIF1A, who was treated with intrathecal injections of an allele-specific antisense oligonucleotide specifically designed to degrade the mRNA from the pathogenic allele. The first intrathecal administration was complicated by an epidural cerebrospinal fluid collection, which resolved spontaneously. Otherwise, the antisense oligonucleotide was safe and well tolerated over the 9-month treatment. Most outcome measures, including severity of the spells of behavioral arrest, number of falls and quality of life, improved. There was little change in the 6-min Walk Test distance, but qualitative changes in gait resulting in meaningful reductions in falls and increasing independence were observed. Cognitive performance was stable and did not degenerate over time. Our findings provide preliminary insights on the safety and efficacy of an allele-specific antisense oligonucleotide as a possible treatment for KAND.

PCDH17
Also flagged:Dachsous cadherin related 1DCHS1epithelial-mesenchymal transitionendometrial cancercancerstumor
Journal Article 2024-08-09 ✓ 1 Snippet Meijuan C, Fang M, Qian W.
In-Text Gene Mentions

…[ 27 ],PCDH17[ 28 ]…

Show Full Abstract

<h4>Background</h4>Dachsous cadherin related 1 (DCHS1) is one of calcium-dependent adhesion membrane proteins and is mainly involved in the development of mammalian tissues. There is a lack of more detailed research on the biological function of DCHS1 in pan-cancer.<h4>Materials and methods</h4>We evaluated the expression, the prognostic value, the diagnostic value and genomic alterations of DCHS1 by using the databases, including TCGA, UALCAN, HPA, GEPIA2.0 and GSCA. We employed the databases of UCSC, TIMER2.0, TISIDB, GSCA to analyze the association between DCHS1 expression and the immune microenvironment, stemness, TMB, MSI and anticancer drug sensitivity. BioGRID, STRING and GEPIA2.0 were used to perform protein interaction and functional enrichment analysis. Real-time quantitative PCR, CCK8, Transwell assay and Western blot were performed to determine the function of DCHS1 in UCEC.<h4>Results</h4>DCHS1 is differentially expressed in many cancers and its expression is significantly associated with tumor prognosis and diagnosis. DCHS1 expression was significantly correlated with the infiltration of cancer-associated fibroblasts (CAFs), Endothelial cell (ECs), and Hematopoietic stem cell in most cancers. In addition, DCHS1 was significantly associated with sensitivity to many antitumor drugs. Functional enrichment analysis revealed that DCHS1-related proteins were involved in Focal adhesion, Endometrial cancer and Wnt signaling pathway. GSEA results showed that DCHS1 was related to epithelial-mesenchymal transition (EMT) in many cancers. In vitro experiments in UCEC showed that DCHS1 regulated cell proliferation, migration and EMT.<h4>Conclusions</h4>Our findings indicated that DCHS1 might be a novel prognostic and diagnostic biomarker and immunotherapy target, and plays an important role in the proliferation, migration and EMT in UCEC.

Also flagged:renal diseaseglomerular filtrationcreatininecystatin CKIM-1MCP-1
Journal Article 2024-08-09 No Snippets Kilbo Edlund K, Xu Y, Andersson EM, Christensson A, Dehlin M, Forsblad-d'Elia H, Harari F, Ljunggren S, Molnár P, Oudin A, Svartengren M, Ljungman P, Stockfelt L.
Show Full Abstract

<h4>Background</h4>Despite accumulating evidence of an association between air pollution and renal disease, studies on the association between long-term exposure to air pollution and renal function are still contradictory. This study aimed to investigate this association in a large population with relatively low exposure and with improved estimation of renal function as well as renal injury biomarkers.<h4>Methods</h4>We performed a cross-sectional analysis in the middle-aged general population participating in the Swedish CardioPulmonary bioImaging Study (SCAPIS; n = 30 154). Individual 10-year exposure to total and locally emitted fine particulate matter (PM<sub>2.5</sub>), inhalable particulate matter (PM<sub>10</sub>), and nitrogen oxides (NO<sub>x</sub>) were modelled using high-resolution dispersion models. Linear regression models were used to estimate associations between exposures and estimated glomerular filtration rate (eGFR, combined creatinine and cystatin C) and serum levels of renal injury biomarkers (KIM-1, MCP-1, IL-6, IL-18, MMP-2, MMP-7, MMP-9, FGF-23, and uric acid), with consideration of potential confounders.<h4>Results</h4>Median long-term PM<sub>2.5</sub> exposure was 6.2 µg/m<sup>3</sup>. Almost all participants had a normal renal function and median eGFR was 99.2 mL/min/1.73 m<sup>2</sup>. PM<sub>2.5</sub> exposure was associated with 1.3% (95% CI 0.6, 2.0) higher eGFR per 2.03 µg/m<sup>3</sup> (interquartile range, IQR). PM<sub>2.5</sub> exposure was also associated with elevated serum matrix metalloproteinase 2 (MMP-2) concentration, with 7.2% (95% CI 1.9, 12.8) higher MMP-2 per 2.03 µg/m<sup>3</sup>. There was a tendency towards an association between PM<sub>10</sub> and higher levels of uric acid, but no associations were found with the other biomarkers. Associations with other air pollutants were null or inconsistent.<h4>Conclusion</h4>In this large general population sample at low exposure levels, we found a surprising association between PM<sub>2.5</sub> exposure and a higher renal filtration. It seems unlikely that particle function would improve renal function. However, increased filtration is an early sign of renal injury and may be related to the relatively healthy population at comparatively low exposure levels. Furthermore, PM<sub>2.5</sub> exposure was associated with higher serum concentrations of MMP-2, an early indicator of renal and cardiovascular pathology.

GPR52
Also flagged:cancertumorgene expressiontranscription factorTFkinase
Journal Article 2024-08-09 ✓ 1 Snippet Deng EZ, Marino GB, Clarke DJB, Diamant I, Resnick AC, Ma W, Wang P, Ma'ayan A.
In-Text Gene Mentions

…the gene level,GPR52, TAS2R13 ,…

Show Full Abstract

The availability of data from profiling of cancer patients with multiomics is rapidly increasing. However, integrative analysis of such data for personalized target identification is not trivial. Multiomics2Targets is a platform that enables users to upload transcriptomics, proteomics, and phosphoproteomics data matrices collected from the same cohort of cancer patients. After uploading the data, Multiomics2Targets produces a report that resembles a research publication. The uploaded matrices are processed, analyzed, and visualized using the tools Enrichr, KEA3, ChEA3, Expression2Kinases, and TargetRanger to identify and prioritize proteins, genes, and transcripts as potential targets. Figures and tables, as well as descriptions of the methods and results, are automatically generated. Reports include an abstract, introduction, methods, results, discussion, conclusions, and references and are exportable as citable PDFs and Jupyter Notebooks. Multiomics2Targets is applied to analyze version 3 of the Clinical Proteomic Tumor Analysis Consortium (CPTAC3) pan-cancer cohort, identifying potential targets for each CPTAC3 cancer subtype. Multiomics2Targets is available from https://multiomics2targets.maayanlab.cloud/.

Also flagged:nucleuspsychiatric disordersaddictiondepressionmonoaminescalcium
Journal Article 2024-08-09 No Snippets Xu Y, Lin Y, Yu M, Zhou K.
Show Full Abstract

The nucleus accumbens (NAc), a central component of the brain's reward circuitry, has been implicated in a wide range of behaviors and emotional states. Emerging evidence, primarily drawing from recent rodent studies, suggests that the function of the NAc in reward and aversion processing is multifaceted. Prolonged stress or drug use induces maladaptive neuronal function in the NAc circuitry, which results in pathological conditions. This review aims to provide comprehensive and up-to-date insights on the role of the NAc in motivated behavior regulation and highlights areas that demand further in-depth analysis. It synthesizes the latest findings on how distinct NAc neuronal populations and pathways contribute to the processing of opposite valences. The review examines how a range of neuromodulators, especially monoamines, influence the NAc's control over various motivational states. Furthermore, it delves into the complex underlying mechanisms of psychiatric disorders such as addiction and depression and evaluates prospective interventions to restore NAc functionality.

Also flagged:tuberculosisTBmultidrug-resistant TBTB infectioninfectionimmune response
Journal Article 2024-08-09 No Snippets Li Z, Hu Y, Wang W, Zou F, Yang J, Gao W, Feng S, Chen G, Shi C, Cai Y, Deng G, Chen X.
Show Full Abstract

This review explores the evolving landscape of blood biomarkers in the diagnosis of tuberculosis (TB), focusing on biomarkers derived both from the pathogen and the host. These biomarkers provide critical insights that can improve diagnostic accuracy and timeliness, essential for effective TB management. The document highlights recent advancements in molecular techniques that have enhanced the detection and characterization of specific biomarkers. It also discusses the integration of these biomarkers into clinical practice, emphasizing their potential to revolutionize TB diagnostics by enabling more precise detection and monitoring of the disease progression. Challenges such as variability in biomarker expression and the need for standardized validation processes are addressed to ensure reliability across different populations and settings. The review calls for further research to refine these biomarkers and fully harness their potential in the fight against TB, suggesting a multidisciplinary approach to overcome existing barriers and optimize diagnostic strategies. This comprehensive analysis underscores the significance of blood biomarkers as invaluable tools in the global effort to control and eliminate TB.

Also flagged:Calcium phosphateapatitehydroxyapatitemagnesiumsodiumcarbonate
Journal Article 2024-08-09 No Snippets Montesissa M, Sassoni E, Boi M, Borciani G, Boanini E, Graziani G.
Show Full Abstract

Calcium phosphate (CaP)-based materials are largely explored in orthopedics, to increase osseointegration of the prostheses and specifically in spine surgery, to permit better fusion. To address these aims, nanostructured biogenic apatite coatings are emerging, since they better mimic the characteristics of the host tissue, thus potentially being better candidates compared to their synthetic counterpart. Here, we compare hydroxyapatite (HA) nanostructured coatings, obtained by ionized jet deposition, starting from synthetic and natural sources. The starting materials and the corresponding films are characterized and compared from a compositional and morphological point of view, then their stability is studied after post-treatment annealing. Although all the films are formed by globular aggregates and show morphological features at different scales (from nano to micro), significant differences are found in composition between the synthetic and naturally derived HA in terms of magnesium and sodium content, carbonate substitution and Ca/P ratio, while differences between the coatings obtained by the different natural HA sources are minor. In addition, the shape of the aggregates is also target-dependent. All coatings have a good stability after over 14 days of immersion in medium, with natural apatite coatings showing a better behavior, as no cracking and detachments are observed during immersion. Based on these results, both synthetic and naturally derived apatitic materials appear promising for applications in spine surgery, with coatings from natural sources possessing physiochemical properties more similar to the mineral phase of the human bone tissue.

TNFSF4
Also flagged:hematologic malignancieshuman leukocyte antigenHLAHCP5NOTCH4HLA-DOA
Journal Article 2024-08-09 ✓ 5 Snippets Tseng CP, Lin TL, Tsai SH, Lin WT, Hsu FP, Wang WT, Chen DP.
In-Text Gene Mentions

…-stimulatory signaling (CTLA4,TNFSF4, CD28, and PDCD1)…

…rs1234314 of theTNFSF4gene, were significantly…

…as CTLA4, CD28,TNFSF4, and PDCD1) are…

…cells (CTLA4, CD28,TNFSF4, and PDCD1) located…

…CTLA4, rs1234314 inTNFSF4, rs2523676 in HCP5,…

Show Full Abstract

<b>Background</b>: Hematopoietic stem cell transplantation (HSCT) is one of the mainstream treatments for patients with hematologic malignancies. The matching status of human leukocyte antigen (HLA) between the donor and recipient is highly related to the outcomes of HSCT. Haploidentical HSCT (haplo-HSCT) has emerged as a type of HSCT for patients who cannot find a fully HLA-matched donor. In this study, we investigated whether the single nucleotide polymorphisms (SNPs) of the HLA-related genes and the genes encoding co-stimulatory molecules located on the non-HLA region are related to the outcomes of haplo-HSCT. <b>Methods</b>: The genomic DNAs of 24 patients and their respective donors were isolated from the peripheral blood obtained before performing haplo-HSCT. A total of 75 SNPs of the HLA-related genes (HCP5, NOTCH4, HLA-DOA, LTA, HSPA1L, BAG6, RING1, TRIM27, and HLA-DOB) and the genes located in the non-HLA genes involved in co-stimulatory signaling (CTLA4, TNFSF4, CD28, and PDCD1) were selected to explore their relationship with the outcomes after haplo-HSCT, including graft-versus-host disease, survival status, and relapse. <b>Results</b>: Our data revealed that specific donor or patient SNPs, including rs79327197 of the HLA-DOA gene, rs107822 and rs213210 of the RING1 gene, rs2523676 of the HCP5 gene, rs5742909 of the CTLA4 gene, rs5839828 and rs36084323 of the PDCD1 gene, and rs1234314 of the TNFSF4 gene, were significantly related to the development of adverse outcomes post-haplo-HSCT. <b>Conclusions</b>: These SNPs may play important roles in post-transplant immune response that can be considered during the selection of suitable donors.

Also flagged:Myotonic Dystrophy Type 1genetic disordermyotoniaproprioceptionspindlesmuscular dystrophies
Journal Article 2024-08-09 No Snippets Scarano S, Caronni A, Carraro E, Ferrari Aggradi CR, Rota V, Malloggi C, Tesio L, Sansone VA.
Show Full Abstract

<b>Background:</b> Myotonic dystrophy type 1 (DM1) is a rare multisystemic genetic disorder with motor hallmarks of myotonia, muscle weakness and wasting. DM1 patients have an increased risk of falling of multifactorial origin, and proprioceptive and vestibular deficits can contribute to this risk. Abnormalities of muscle spindles in DM1 have been known for years. This observational cross-sectional study was based on the hypothesis of impaired cervical proprioception caused by alterations in the neck spindles. <b>Methods:</b> Head position sense was measured in 16 DM1 patients and 16 age- and gender-matched controls. A head-to-target repositioning test was requested from blindfolded participants. Their head was passively rotated approximately 30° leftward or rightward and flexed or extended approximately 25°. Participants had to replicate the imposed positions. An optoelectronic system was adopted to measure the angular differences between the reproduced and the imposed positions (joint position error, JPE, °) concerning the intended (sagittal, horizontal) and unintended (including the frontal) planar projections. In DM1 patients, JPEs were correlated with clinical and balance measures. Static balance in DM1 patients was assessed through dynamic posturography. <b>Results:</b> The accuracy and precision of head repositioning in the intended sagittal and horizontal error components did not differ between DM1 and controls. On the contrary, DM1 patients showed unintended side-bending to the left and the right: the mean [95%CI] of frontal JPE was -1.29° [-1.99°, -0.60°] for left rotation and 0.98° [0.28°, 1.67°] for right rotation. The frontal JPE of controls did not differ significantly from 0° (left rotation: 0.17° [-0.53°, 0.87°]; right rotation: -0.22° [-0.91°, 0.48°]). Frontal JPE differed between left and right rotation trials (<i>p</i> < 0.001) only in DM1 patients. No correlation was found between JPEs and measures from dynamic posturography and clinical scales. <b>Conclusions:</b> Lateral head bending associated with head rotation may reflect a latent impairment of neck proprioception in DM1 patients.

SERPINC1
Also flagged:Cognitive Impairmentmild cognitive impairmentDementiaACEMemory LossNeurodegenerative diseases
Journal Article 2024-08-09 ✓ 3 Snippets Valles-Salgado M, Matias-Guiu JA, Delgado-Álvarez A, Delgado-Alonso C, Gil-Moreno MJ, Valiente-Gordillo E, López-Carbonero JI, Fernández-Romero L, Peña-DeDiego L, Oliver-Mas S, Matías-Guiu J, Diez-Cirarda M.
In-Text Gene Mentions

…was 0.827 forACE-III, 0.505 for MMSE,…

…0.869 (0.812–0.927) forACE-III, 0.717 (0.630–0.803) for…

…0.875 (0.816–0.934) forACE-III, 0.822 (0.751–0.893) for…

Show Full Abstract

<b>Objectives</b>: We aimed to evaluate and compare the diagnostic capacity of five cognitive screening tests for the diagnosis of mild cognitive impairment (MCI) in patients consulting by memory loss. <b>Methods</b>: A cross-sectional study involving 140 participants with a mean age of 74.42 ± 7.60 years, 87 (62.14%) women. Patients were classified as MCI or cognitively unimpaired according to a comprehensive neuropsychological battery. The diagnostic properties of the following screening tests were compared: Mini-Mental State Examination (MMSE), Addenbrooke's Cognitive Examination III (ACE-III) and Mini-Addenbrooke (M-ACE), Memory Impairment Screen (MIS), Montreal Cognitive Assessment (MoCA), and Rowland Universal Dementia Assessment Scale (RUDAS). <b>Results</b>: The area under the curve (AUC) was 0.861 for the ACE-III, 0.867 for M-ACE, 0.791 for MoCA, 0.795 for MMSE, 0.731 for RUDAS, and 0.672 for MIS. For the memory components, the AUC was 0.869 for ACE-III, 0.717 for MMSE, 0.755 for MoCA, and 0.720 for RUDAS. Cronbach's alpha was 0.827 for ACE-III, 0.505 for MMSE, 0.896 for MoCA, and 0.721 for RUDAS. Correlations with Free and Cued Selective Reminding Test were moderate with M-ACE, ACE-III, and MoCA, and moderate for the other tests. The M-ACE showed the best balance between diagnostic capacity and time of administration. <b>Conclusions</b>: ACE-III and its brief version M-ACE showed better diagnostic properties for the diagnosis of MCI than the other screening tests. MoCA and MMSE showed adequate properties, while the diagnostic capacity of MIS and RUDAS was limited.

HFE
Also flagged:Turner SyndromeTShypogonadotropic hypogonadismmeningiomashearingloss
Journal Article 2024-08-09 ✓ 1 Snippet Saideekshit T, S N MS, Govindan S, Prakash S, Radhika M.
In-Text Gene Mentions

…had thalassemia major,hemochromatosis[ 9 ],…

Show Full Abstract

Isochromosome mosaic Turner syndrome (IMTS) is a rare genetic variant of Turner syndrome (TS). The diagnosis of TS can be missed until adolescence or early adulthood in females with minimal symptoms. The clinical features of mosaic TS can be atypical and should be evaluated thoroughly to detect potential complications. Here, we describe a unique report of a 47-year-old woman diagnosed with IMTS, hypogonadotropic hypogonadism, and multiple meningiomas. She presented with decreased responsiveness and decreased appetite. She had primary amenorrhea, hearing loss, and visual impairment for which focused medical care was not sought. Physical examination revealed short stature, short neck, Tanner stage 3 breast, Tanner stage 1 vaginal development, and absent axillary and pubic hair, which led us to a clinical diagnosis of TS. A transabdominal ultrasound revealed a hypoplastic uterus with no visualized ovaries. A slit lamp examination revealed bilateral immature cataracts and optic atrophy. An audiogram confirmed sensorineural hearing loss. The intelligence quotient was below average. Hormonal assays showed hypogonadotropic hypogonadism and secondary adrenal insufficiency, which is not a feature of TS. This abnormal hormonal assay prompted us to do magnetic resonance imaging of the brain, which showed meningiomas in the suprasellar region and left cerebellopontine angle. Karyotyping revealed 46,X,i(X)(q10)(37)/45,X(3), which was suggestive of IMTS. The patient required a multidisciplinary approach in the evaluation, diagnosis, and management, which included hormone replacement therapy and supportive and psychological care.

OLFM4
Also flagged:olfactomedin 4gallbladder cancerbenign gallbladder diseasescancercholecystitisgallbladder polyps
Journal Article 2024-08-08 ✓ 5 Snippets He H, Chen S, Yu Y, Fan Z, Qian Y, Dong Y, Song Y, Zhong C, Sun X, Cao Q, Li S, Huang W, Li W, Zhuang M, Yang J, Wang X, Wang J, Wu D, Wang H, Wen W.
In-Text Gene Mentions

Further investigations revealed that OLFM4 upregulated programmed death-ligand 1 (PD-L1) expression through the MAPK-AP1 axis, facilitating tumour cell immune evasion.<h4>Conclusion</h4>These findings offer a valuable resource for understanding the pathogenesis of gallbladder diseases and indicate OLFM4 as a potential biomarker and therapeutic target for GBC.

OLFM4 was related to T-cell malfunction and tumour-associated macrophage infiltration, leading to a worse prognosis in GBC.

…elevated olfactomedin 4 (OLFM4) in epithelial cells…

OLFM4was related to…

…investigations revealed thatOLFM4upregulated programmed death-l…

Show Full Abstract

<h4>Objective</h4>Elucidating complex ecosystems and molecular features of gallbladder cancer (GBC) and benign gallbladder diseases is pivotal to proactive cancer prevention and optimal therapeutic intervention.<h4>Design</h4>We performed single-cell transcriptome analysis on 230 737 cells from 15 GBCs, 4 cholecystitis samples, 3 gallbladder polyps, 5 gallbladder adenomas and 16 adjacent normal tissues. Findings were validated through large-scale histological assays, digital spatial profiler multiplexed immunofluorescence (GeoMx), etc. Further molecular mechanism was demonstrated with <i>in vitro</i> and <i>in vivo</i> studies.<h4>Results</h4>The cell atlas unveiled an altered immune landscape across different pathological states of gallbladder diseases. GBC featured a more suppressive immune microenvironment with distinct T-cell proliferation patterns and macrophage attributions in different GBC subtypes. Notably, mutual exclusivity between stromal and immune cells was identified and remarkable stromal ecosystem (SC) heterogeneity during GBC progression was unveiled. Specifically, SC1 demonstrated active interaction between Fibro-iCAF and Endo-Tip cells, correlating with poor prognosis. Moreover, epithelium genetic variations within adenocarcinoma (AC) indicated an evolutionary similarity between adenoma and AC. Importantly, our study identified elevated olfactomedin 4 (OLFM4) in epithelial cells as a central player in GBC progression. OLFM4 was related to T-cell malfunction and tumour-associated macrophage infiltration, leading to a worse prognosis in GBC. Further investigations revealed that OLFM4 upregulated programmed death-ligand 1 (PD-L1) expression through the MAPK-AP1 axis, facilitating tumour cell immune evasion.<h4>Conclusion</h4>These findings offer a valuable resource for understanding the pathogenesis of gallbladder diseases and indicate OLFM4 as a potential biomarker and therapeutic target for GBC.

HTT
Also flagged:nucleusHDpoly-unsaturated fatty acidsdeathlipidmetabolism
Journal Article 2024-08-08 ✓ 4 Snippets Paryani F, Kwon JS, Ng CW, Jakubiak K, Madden N, Ofori K, Tang A, Lu H, Xia S, Li J, Mahajan A, Davidson SM, Basile AO, McHugh C, Vonsattel JP, Hickman R, Zody MC, Housman DE, Goldman JE, Yoo AS, Menon V, Al-Dalahmah O.
In-Text Gene Mentions

…Huntingtin gene (HTT) can expand…

…research implicates mutantHTT(mHTT) expression in…

…In contrast, downregulatingHTTin astrocytes can…

…length in theHTTgene.…

Show Full Abstract

The mechanisms underlying the selective regional vulnerability to neurodegeneration in Huntington's disease (HD) have not been fully defined. To explore the role of astrocytes in this phenomenon, we used single-nucleus and bulk RNAseq, lipidomics, HTT gene CAG repeat-length measurements, and multiplexed immunofluorescence on HD and control post-mortem brains. We identified genes that correlated with CAG repeat length, which were enriched in astrocyte genes, and lipidomic signatures that implicated poly-unsaturated fatty acids in sensitizing neurons to cell death. Because astrocytes play essential roles in lipid metabolism, we explored the heterogeneity of astrocytic states in both protoplasmic and fibrous-like (CD44+) astrocytes. Significantly, one protoplasmic astrocyte state showed high levels of metallothioneins and was correlated with the selective vulnerability of distinct striatal neuronal populations. When modeled in vitro, this state improved the viability of HD-patient-derived spiny projection neurons. Our findings uncover key roles of astrocytic states in protecting against neurodegeneration in HD.

SUDS3
Also flagged:organizationimmune responsesneuroticismROBO1CIB3LYPD4
Journal Article 2024-08-08 ✓ 1 Snippet Herrera-Rivero M, Garvert L, Horn K, Löbner M, Weitzel EC, Stoll M, Lichtner P, Teismann H, Teumer A, Van der Auwera S, Völzke H, Völker U, Andlauer TFM, Meinert S, Heilmann-Heimbach S, Forstner AJ, Streit F, Witt SH, Kircher T, Dannlowski U, Scholz M, Riedel-Heller SG, Grabe HJ, Baune BT, Berger K.
In-Text Gene Mentions

…immune cells; andSUDS3, associated with…

Show Full Abstract

Resilience is the capacity to adapt to stressful life events. As such, this trait is associated with physical and mental functions and conditions. Here, we aimed to identify the genetic factors contributing to shape resilience. We performed variant- and gene-based meta-analyses of genome-wide association studies from six German cohorts (N = 15822) using the 11-item version of the Resilience Scale (RS-11) as outcome measure. Variant- and gene-level results were combined to explore the biological context using network analysis. In addition, we conducted tests of correlation between RS-11 and the polygenic scores (PGSs) for 12 personality and mental health traits in one of these cohorts (PROCAM-2, N = 3879). The variant-based analysis found no signals associated with resilience at the genome-wide level (p < 5 × 10<sup>-8</sup>), but suggested five genomic loci (p < 1 × 10<sup>-5</sup>). The gene-based analysis identified three genes (ROBO1, CIB3 and LYPD4) associated with resilience at genome-wide level (p < 2.48 × 10<sup>-6</sup>) and 32 potential candidates (p < 1 × 10<sup>-4</sup>). Network analysis revealed enrichment of biological pathways related to neuronal proliferation and differentiation, synaptic organization, immune responses and vascular homeostasis. We also found significant correlations (FDR < 0.05) between RS-11 and the PGSs for neuroticism and general happiness. Overall, our observations suggest low heritability of resilience. Large, international efforts will be required to uncover the genetic factors that contribute to shape trait resilience. Nevertheless, as the largest investigation of the genetics of resilience in general population to date, our study already offers valuable insights into the biology potentially underlying resilience and resilience's relationship with other personality traits and mental health.

HTT
Also flagged:Huntingtinneurodegenerative diseaseagingHDbehavioralbrain development
Journal Article 2024-08-08 ✓ 5 Snippets Neema M, Schultz JL, Langbehn DR, Conrad AL, Epping EA, Magnotta VA, Nopoulos PC.
In-Text Gene Mentions

<h4>Objective</h4>Huntington's disease (HD) is a neurodegenerative disease caused by a triplet repeat expansion within the gene huntingtin (HTT).

…gene huntingtin (HTT).…

…mutant huntingtin (HTT) gene using…

…young adult mutantHTTcarriers exhibit superior…

HTT

Show Full Abstract

<h4>Objective</h4>Huntington's disease (HD) is a neurodegenerative disease caused by a triplet repeat expansion within the gene huntingtin (HTT). Antagonistic pleiotropy is a theory of aging that posits that some genes, facilitating individual fitness early in life through adaptive evolutionary changes, also augment detrimental aging-related processes. Antagonistic pleiotropy theory may explain a positive evolutionary pressure toward functionally advantageous brain development that is vulnerable to rapid degeneration. The current study investigated antagonistic pleiotropy in HD using a years-to-onset paradigm in a unique sample of children and young adults at risk for HD.<h4>Methods</h4>Cognitive, behavioral, motor, and brain structural measures from premanifest gene-expanded (n = 79) and gene nonexpanded (n = 112) participants (6-21 years) in the Kids-HD study were examined. All measures in the gene-expanded group were modeled using a mixed-effects regression approach to assess years-to-onset-based changes while controlling for normal growth. Simultaneously, structure-function associations were also examined.<h4>Results</h4>Decades from motor onset, gene-expanded participants showed significantly better cognitive, behavioral, and motor scores versus gene nonexpanded controls, along with larger cerebral volumes and cortical features. After this initial peak, a prolonged deterioration was observed in both functional and structural measures. Far from onset, brain measures were positively correlated with functional measures, supporting the view that functional advantages were mediated by structural differences.<h4>Interpretation</h4>Mutant HTT may drive the development of a larger than normal brain that subserves superior early-life function. These findings support the antagonistic pleiotropy theory of HTT in HD, where this gene drives early advantage followed by accelerated aging processes. ANN NEUROL 2024;96:1006-1019.

PEBP1
Also flagged:COVID-19 infectioninfectionmembraneglycoproteincellfurin
Journal Article 2024-08-08 ✓ 2 Snippets Singh P, Pahari P, Mukherjee S, Karmakar S, Hoffmann M, Mandal T, Das DK.
In-Text Gene Mentions

…the PE-binding protein,PEBP1.…

…the presence ofPEBP1protein, and for…

Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike is the fusion machine for host cell entry. Still, the mechanism by which spike protein interacts with the target lipid membrane to facilitate membrane fusion during entry is not fully understood. Here, using steady-state membrane fusion and single-molecule fluorescence resonance energy transfer imaging of spike trimers on the surface of SARS-CoV-2 pseudovirion, we directly show that spike protein interacts with phosphatidylserine (PS) lipid in the target membrane for mediating fusion. We observed that the fusion peptide of the spike S2 domain interacts with the PS lipid of the target membrane. Low pH and Ca<sup>2+</sup> trigger the spike conformational change and bring fusion peptide in close proximity to the PS lipid of the membrane. The binding of the spike with PS lipid of its viral membrane (<i>cis</i> interaction) impedes the fusion activation. PS on the target membrane promotes spike binding via <i>trans</i> interaction, prevents the <i>cis</i> interaction, and accelerates fusion. Sequestering or absence of PS lipid abrogates the spike-mediated fusion process and restricts SARS-CoV-2 infectivity. We found that PS-dependent interaction for fusion is conserved across all the SARS-CoV-2 spike variants of concern (D614G, Alpha, Beta, Delta, and Omicron). Our study suggests that PS lipid is indispensable for SARS-CoV-2 spike-mediated virus and target membrane fusion for entry, and restricting PS interaction with spike inhibits the SARS-CoV-2 spike-mediated entry. Therefore, PS is an important cofactor and acts as a molecular beacon in the target membrane for SARS-CoV-2 entry.<h4>Importance</h4>The role of lipids in the host cell target membrane for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) entry is not clear. We do not know whether SARS-CoV-2 spike protein has any specificity in terms of lipid for membrane fusion reaction. Here, using <i>in vitro</i> reconstitution of membrane fusion assay and single-molecule fluorescence resonance energy transfer imaging of SARS-CoV-2 spike trimers on the surface of the virion, we have demonstrated that phosphatidylserine (PS) lipid plays a key role in SARS-CoV-2 spike-mediated membrane fusion reaction for entry. Membrane-externalized PS lipid strongly promotes spike-mediated membrane fusion and COVID-19 infection. Blocking externalized PS lipid with PS-binding protein or in the absence of PS, SARS-CoV-2 spike-mediated fusion is strongly inhibited. Therefore, PS is an important target for restricting viral entry and intervening spike, and PS interaction presents new targets for COVID-19 interventions.

Also flagged:cardiac diseaseorganizationadenosine monophosphateadenylyl cyclasesA kinase anchoring proteinsphosphodiesterases
Journal Article 2024-08-08 No Snippets Zaccolo M, Kovanich D.
Show Full Abstract

The 3',5'-cyclic adenosine monophosphate (cAMP) mediates the effects of sympathetic stimulation on the rate and strength of cardiac contraction. Beyond this pivotal role, in cardiac myocytes cAMP also orchestrates a diverse array of reactions to various stimuli. To ensure specificity of response, the cAMP signaling pathway is intricately organized into multiple, spatially confined, subcellular domains, each governing a distinct cellular function. In this review, we describe the molecular components of the cAMP signaling pathway with a specific focus on adenylyl cyclases, A-kinase anchoring proteins, and phosphodiesterases. We discuss how they are organized inside the intracellular space and how they achieve exquisite regulation of signaling within nanometer-size domains. We delineate the key experimental findings that lead to the current model of compartmentalized cAMP signaling, and we offer an overview of our present understanding of how cAMP nanodomains are structured and regulated within cardiac myocytes. Furthermore, we discuss how compartmentalized cAMP signaling is affected in cardiac disease and consider the potential therapeutic opportunities arising from understanding such organization. By exploiting the nuances of compartmentalized cAMP signaling, novel and more effective therapeutic strategies for managing cardiac conditions may emerge. Finally, we highlight the unresolved questions and hurdles that must be addressed to translate these insights into interventions that may benefit patients.

HTT
Also flagged:Nesprin-2microtubuleNuclear migrationnucleusdyneinbinding
Journal Article 2024-08-08 ✓ 1 Snippet Zhou C, Wu YK, Ishidate F, Fujiwara TK, Kengaku M.
In-Text Gene Mentions

…2014 ); Huntingtin (Htt) switches between kinesin-…

Show Full Abstract

Nuclear migration is critical for the proper positioning of neurons in the developing brain. It is known that bidirectional microtubule motors are required for nuclear transport, yet the mechanism of the coordination of opposing motors is still under debate. Using mouse cerebellar granule cells, we demonstrate that Nesprin-2 serves as a nucleus-motor adaptor, coordinating the interplay of kinesin-1 and dynein. Nesprin-2 recruits dynein-dynactin-BicD2 independently of the nearby kinesin-binding LEWD motif. Both motor binding sites are required to rescue nuclear migration defects caused by the loss of function of Nesprin-2. In an intracellular cargo transport assay, the Nesprin-2 fragment encompassing the motor binding sites generates persistent movements toward both microtubule minus and plus ends. Nesprin-2 drives bidirectional cargo movements over a prolonged period along perinuclear microtubules, which advance during the migration of neurons. We propose that Nesprin-2 keeps the nucleus mobile by coordinating opposing motors, enabling continuous nuclear transport along advancing microtubules in migrating cells.

ARFGEF2
Also flagged:IER3IP1microcephalyImmediate Early Response-3 Interacting Protein 1EpilepsyPermanent Neonatal Diabetes Syndrome-1endoplasmic reticulum
Journal Article 2024-08-08 ✓ 1 Snippet Anitei M, Bruno F, Valkova C, Dau T, Cirri E, Mestres I, Calegari F, Kaether C.
In-Text Gene Mentions

…, 112 ],ARFGEF2[ 113 ],…

Show Full Abstract

Mutations in the IER3IP1 (Immediate Early Response-3 Interacting Protein 1) gene can give rise to MEDS1 (Microcephaly with Simplified Gyral Pattern, Epilepsy, and Permanent Neonatal Diabetes Syndrome-1), a severe condition leading to early childhood mortality. The small endoplasmic reticulum (ER)-membrane protein IER3IP1 plays a non-essential role in ER-Golgi transport. Here, we employed secretome and cell-surface proteomics to demonstrate that the absence of IER3IP1 results in the mistrafficking of proteins crucial for neuronal development and survival, including FGFR3, UNC5B and SEMA4D. This phenomenon correlates with the distension of ER membranes and increased lysosomal activity. Notably, the trafficking of cargo receptor ERGIC53 and KDEL-receptor 2 are compromised, with the latter leading to the anomalous secretion of ER-localized chaperones. Our investigation extended to in-utero knock-down of Ier3ip1 in mouse embryo brains, revealing a morphological phenotype in newborn neurons. In summary, our findings provide insights into how the loss or mutation of a 10 kDa small ER-membrane protein can cause a fatal syndrome.

Also flagged:Nonreceptor tyrosine phosphatasesphosphorylationcancermetabolic diseasesHydroxySTAT
Journal Article 2024-08-08 No Snippets Howard JN, Zaikos TD, Levinger C, Rivera E, McMahon EK, Holmberg CS, Terao J, Sanz M, Copertino DC, Wang W, Soriano-Sarabia N, Jones RB, Bosque A.
Show Full Abstract

Nonreceptor tyrosine phosphatases (NTPs) play an important role in regulating protein phosphorylation and have been proposed as attractive therapeutic targets for cancer and metabolic diseases. We have previously identified that 3-Hydroxy-1,2,3-benzotriazin-4(3H)-one (HODHBt) enhanced STAT activation upon cytokine stimulation, leading to increased reactivation of latent HIV and effector functions of NK and CD8 T cells. Here, we demonstrate that HODHBt interacted with and inhibited the NTPs PTPN1 and PTPN2 through a mixed inhibition mechanism. We also confirm that PTPN1 and PTPN2 specifically controlled the phosphorylation of different STATs. The small molecule ABBV-CLS-484 (AC-484) is an active site inhibitor of PTPN1 and PTPN2 currently in clinical trials for advanced solid tumors. We compared AC-484 and HODHBt and found similar effects on STAT5 and immune activation, albeit with different mechanisms of action leading to varying effects on latency reversal. Our studies provide the first specific evidence to our knowledge that enhancing STAT phosphorylation via inhibition of PTPN1 and PTPN2 is an effective tool against HIV.

Also flagged:osteogenesisangiogenesisosteoblast proliferationcalmodulinNFATcell migration
Journal Article 2024-08-08 No Snippets Sun J, Xie W, Wu Y, Li Z, Li Y.
Show Full Abstract

Piezoelectric effect produces an electrical signal when stress is applied to the bone. When the integrity of the bone is destroyed, the biopotential within the defect site is reduced and several physiological responses are initiated to facilitate healing. During the healing of the bone defect, the bioelectric potential returns to normal levels. Treatment of fractures that exceed innate regenerative capacity or exhibit delayed healing requires surgical intervention for bone reconstruction. For bone defects that cannot heal on their own, exogenous electric fields are used to assist in treatment. This paper reviews the effects of exogenous electrical stimulation on bone healing, including osteogenesis, angiogenesis, reduction in inflammation and effects on the peripheral nervous system. This paper also reviews novel electrical stimulation methods, such as small power supplies and nanogenerators, that have emerged in recent years. Finally, the challenges and future trends of using electrical stimulation therapy for accelerating bone healing are discussed.

SUDS3
Also flagged:synthesisCH1PAsaltprotamineOligonucleotides
Journal Article 2024-08-08 ✓ 1 Snippet Watson M, Sabirova D, Hardy MC, Pan Y, Carpentier DCJ, Yates H, Wright CJ, Chan WH, Destan E, Stott K.
In-Text Gene Mentions

…condensing properties oflinker histoneshistones.…

Show Full Abstract

Linker histones play an essential role in chromatin packaging by facilitating compaction of the 11-nm fiber of nucleosomal "beads on a string." The result is a heterogeneous condensed state with local properties that range from dynamic, irregular, and liquid-like to stable and regular structures (the 30-nm fiber), which in turn impact chromatin-dependent activities at a fundamental level. The properties of the condensed state depend on the type of linker histone, particularly on the highly disordered C-terminal tail, which is the most variable region of the protein, both between species, and within the various subtypes and cell-type specific variants of a given organism. We have developed an in vitro model system comprising linker histone tail and linker DNA, which although very minimal, displays surprisingly complex behavior, and is sufficient to model the known states of linker histone-condensed chromatin: disordered "fuzzy" complexes ("open" chromatin), dense liquid-like assemblies (dynamic condensates), and higher-order structures (organized 30-nm fibers). A crucial advantage of such a simple model is that it allows the study of the various condensed states by NMR, circular dichroism, and scattering methods. Moreover, it allows capture of the thermodynamics underpinning the transitions between states through calorimetry. We have leveraged this to rationalize the distinct condensing properties of linker histone subtypes and variants across species that are encoded by the amino acid content of their C-terminal tails. Three properties emerge as key to defining the condensed state: charge density, lysine/arginine ratio, and proline-free regions, and we evaluate each separately using a strategic mutagenesis approach.

Also flagged:PonicidinHepatocellular CarcinomaditerpenoidKeap1PGAM5mitochondrial
Journal Article 2024-08-08 No Snippets Zhao B, Liang Z, Zhang L, Jiang L, Xu Y, Zhang Y, Zhang R, Wang C, Liu Z.
Show Full Abstract

Ponicidin is a diterpenoid with demonstrated antitumor activity in clinical trials. However, the specific function and mechanism of action against hepatocellular carcinoma (HCC) remain unknown. In this study, it is found that ponicidin significantly inhibited the proliferation and migration of HCC cells. It is shown that ponicidin targets Keap1 and promotes the formation of the Keap1-PGAM5 complex, leading to the ubiquitination of PGAM5, using biotin-labeled ponicidin for target fishing and the HuProt<sup>TM</sup> Human Proteome Microarray V4.0. Ponicidin is found to activate the cysteine-dependent mitochondrial pathway via PGAM5, resulting in mitochondrial damage and ROS production, thereby promoting mitochondrial apoptosis in HepG2 cells. The first in vitro cocrystal structure of the PGAM5 IE 12-mer peptide and the Keap1 Kelch domain is obtained. Using molecular dynamics simulations to confirm the binding of ponicidin to the Keap1-PGAM5 complex. Based on the depth-based dynamic simulation, it is found that ponicidin can induce the tightening of the Keap1-PGAM5 interaction pocket, thereby stabilizing the formation of the protein complex. Finally, it is observed that ponicidin effectively inhibited tumor growth and promoted tumor cell apoptosis in a BALB/c nude mouse xenograft tumor model. The results provide insight into the anti-HCC properties of ponicidin based on a mechanism involving the Keap1-PGAM5 complex.

DCC
Also flagged:agenesis of the corpus callosumACCSMARCB1PPP2R1AARID1BUSP34
Journal Article 2024-08-08 ✓ 2 Snippets Wei X, Cai L, Zhang L, Chen J, Zhang Y, Meng M, Yang Y, Zhou X, Zou G, Sun L.
In-Text Gene Mentions

…CDC42, NFIA andDCCgenes.…

…identified variants ofDCCand USP34 gene…

Show Full Abstract

<h4>Objective</h4>To assess the genetic etiologies underlying agenesis of the corpus callosum (ACC) and its pregnancy outcomes in the era of next-generation sequencing.<h4>Methods</h4>A retrospective analysis was conducted on prospectively collected prenatal ACC cases in which amniocentesis was performed between January 2016 and December 2022. ACC was divided into non-isolated and isolated according to the presence or absence of ultrasound abnormalities. Chromosomal microarray analysis (CMA), karyotyping and exome sequencing (ES) were performed after genetic counseling. Pregnancy outcomes were assessed by pediatric neurosurgeons and were followed up by telephone through their parents.<h4>Results</h4>Sixty-eight fetuses with ACC were enrolled in this study. CMA detected eight cases with pathogenic copy number variants (CNVs) and all were non-isolated ACC, with a detection rate of 11.8% (8/68). Among the CMA abnormalities, the majority (6/8) were detectable by karyotyping. ES was performed in 26 cases with normal CMA, revealing pathogenic or likely pathogenic gene variations in 12 cases (46.2%, 12/26), involving L1CMA, SMARCB1, PPP2R1A, ARID1B, USP34, CDC42, NFIA and DCC genes. The detection rates of ES in isolated and non-isolated ACC were 40% (6/15) and 54.5% (6/11), respectively. After excluding cases where pregnancy was terminated (56 cases), there were 12 live births, ranging in age from 15 months to 7 years. Of these, 91.7% (11 out of 12) demonstrated normal neurodevelopmental outcomes. Specifically, all five cases with isolated ACC and negative ES results exhibited normal neurodevelopment. The remaining six cases with favorable outcomes were all isolated ACC, among which ES identified variants of DCC and USP34 gene in one each case. The other four cases were CMA-negative and declined ES.<h4>Conclusions</h4>We highlight the efficacy of prenatal ES in determining the genetic etiology of ACC, whether isolated or not. Favorable neurodevelopmental outcomes were observed when ACC was isolated and with normal ES results.

PRDX6
Also flagged:malignant tumorsliver cancercancerchronic infectionsalcoholic liver diseasenon-alcoholic fatty liver disease
Journal Article 2024-08-08 ✓ 1 Snippet Wang G, Shen X, Jin W, Song C, Dong M, Zhou Z, Wang X.
In-Text Gene Mentions

…key genes: S100A10,PRDX6, APEX1, SMS, ACSL3,…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a common malignant tumor with a complex immune evasion mechanism posing a challenge to treatment. The role of the S100A10 gene in various cancers has garnered significant attention. This study aims to elucidate the impact of S100A10 on CD8<sup>+</sup> T cell exhaustion via the cPLA2 and 5-LOX axis, thereby elucidating its role in immune evasion in HCC. By analyzing the HCC-related data from the GEO and TCGA databases, we identified differentially expressed genes associated with lipid metabolism and developed a prognostic risk model. Subsequently, through RNA-seq and PPI analyses, we determined vital lipid metabolism genes and downstream factors S100A10, ACOT7, and SMS, which were significantly correlated with CD8<sup>+</sup> T cell infiltration. Given the most significant expression differences, we selected S100A10 for further investigation. Both in vitro and in vivo experiments were conducted, including co-culture experiments of CD8<sup>+</sup> T cells with MHCC97-L cells, Co-IP experiments, and validation in an HCC mouse model. S100A10 was significantly overexpressed in HCC tissues and potentially regulates CD8<sup>+</sup> T cell exhaustion and lipid metabolism reprogramming through the cPLA2 and 5-LOX axis. Silencing S100A10 could inhibit CD8<sup>+</sup> T cell exhaustion, further suppressing immune evasion in HCC. S100A10 may activate the cPLA2 and 5-LOX axis, initiating lipid metabolism reprogramming and upregulating LTB4 levels, thus promoting CD8<sup>+</sup> T cell exhaustion in HCC tissues, facilitating immune evasion by HCC cells, ultimately impacting the growth and migration of HCC cells. This research highlights the critical role of S100A10 via the cPLA2 and 5-LOX axis in immune evasion in HCC, providing new theoretical foundations and potential targets for diagnosing and treating HCC.

PEBP1
Also flagged:Programmed cell deathhepatocellular carcinomaliver cancercancerdeathnecroptosis
Journal Article 2024-08-08 ✓ 1 Snippet Wu X, Cao J, Wan X, Du S.
In-Text Gene Mentions

…hanolamine-binding protein 1 (Pebp1) pathway, indicating that…

Show Full Abstract

Hepatocellular Carcinoma (HCC), the most common primary liver cancer, ranks as the third most common cause of cancer-related deaths globally. A deeper understanding of the cell death mechanisms in HCC is essential for developing more effective treatment strategies. This review explores programmed cell death (PCD) pathways involved in HCC, including apoptosis, necroptosis, pyroptosis, ferroptosis, and immunogenic cell death (ICD). These mechanisms trigger specific cell death cascades that influence the development and progression of HCC. Although multiple PCD pathways are involved in HCC, shared cellular factors suggest a possible interplay between the different forms of cell death. However, the exact roles of different cell death pathways in HCC and which cell death pathway plays a major role remain unclear. This review also highlights how disruptions in cell death pathways are related to drug resistance in cancer therapy, promoting a combined approach of cell death induction and anti-tumor treatment to enhance therapeutic efficacy. Further research is required to unravel the complex interplay between cell death modalities in HCC, which may lead to innovative therapeutic breakthroughs.

POU3F2
Also flagged:EZH2Enhancer of zeste homolog 2histone methyltransferaseprostate cancersprostate adenocarcinomaneuroendocrine prostate cancer
Journal Article 2024-08-08 ✓ 1 Snippet Venkadakrishnan VB, Presser AG, Singh R, Booker MA, Traphagen NA, Weng K, Voss NCE, Mahadevan NR, Mizuno K, Puca L, Idahor O, Ku SY, Bakht MK, Borah AA, Herbert ZT, Tolstorukov MY, Barbie DA, Rickman DS, Brown M, Beltran H.
In-Text Gene Mentions

…NEUROD1, LHX2, FOXA2,POU3F2, and INSM1…

Show Full Abstract

Enhancer of zeste homolog 2 (EZH2) is a histone methyltransferase and emerging therapeutic target that is overexpressed in most castration-resistant prostate cancers and implicated as a driver of disease progression and resistance to hormonal therapies. Here we define the lineage-specific action and differential activity of EZH2 in both prostate adenocarcinoma and neuroendocrine prostate cancer (NEPC) subtypes of advanced prostate cancer to better understand the role of EZH2 in modulating differentiation, lineage plasticity, and to identify mediators of response and resistance to EZH2 inhibitor therapy. Mechanistically, EZH2 modulates bivalent genes that results in upregulation of NEPC-associated transcriptional drivers (e.g., ASCL1) and neuronal gene programs in NEPC, and leads to forward differentiation after targeting EZH2 in NEPC. Subtype-specific downstream effects of EZH2 inhibition on cell cycle genes support the potential rationale for co-targeting cyclin/CDK to overcome resistance to EZH2 inhibition.

DCC
Also flagged:dopaminebrain disordersneuron developmentpost-transcriptional silencingaddictionschizophrenia
Journal Article 2024-08-08 ✓ 1 Snippet Rybiczka-Tešulov M, Garritsen O, Venø MT, Wieg L, Dijk RV, Rahimi K, Gomes-Duarte A, Wit M, van de Haar LL, Michels L, van Kronenburg NCH, van der Meer C, Kjems J, Vangoor VR, Pasterkamp RJ.
In-Text Gene Mentions

…in colorectal cancer (DCC)/NETRIN-1 7 , 8…

Show Full Abstract

Midbrain dopamine (mDA) neurons play an essential role in cognitive and motor behaviours and are linked to different brain disorders. However, the molecular mechanisms underlying their development, and in particular the role of non-coding RNAs (ncRNAs), remain incompletely understood. Here, we establish the transcriptomic landscape and alternative splicing patterns of circular RNAs (circRNAs) at key developmental timepoints in mouse mDA neurons in vivo using fluorescence-activated cell sorting followed by short- and long-read RNA sequencing. In situ hybridisation shows expression of several circRNAs during early mDA neuron development and post-transcriptional silencing unveils roles for different circRNAs in regulating mDA neuron morphology. Finally, in utero electroporation and time-lapse imaging implicate circRmst, a circRNA with widespread morphological effects, in the migration of developing mDA neurons in vivo. Together, these data for the first time suggest a functional role for circRNAs in developing mDA neurons and characterise poorly defined aspects of mDA neuron development.

OLFM4
Also flagged:gastric cancerOlfactomedin 4intestinal metaplasialocalizationalcoholIM
Journal Article 2024-08-08 ✓ 5 Snippets Zhang T, Tang X.
In-Text Gene Mentions

This commentary offers a thoughtful discussion of the study by Wei et al. published in the journal on the role of Olfactomedin 4 (OLFM4) in incomplete intestinal metaplasia, a gastric precancerous condition.

…diagnostic utility ofOLFM4in gastric cancer…

…of Olfactomedin 4 (OLFM4) in incomplete intestinal…

…original paper introducesOLFM4as a novel…

…cellular localization ofOLFM4.…

Show Full Abstract

This commentary offers a thoughtful discussion of the study by Wei et al. published in the journal on the role of Olfactomedin 4 (OLFM4) in incomplete intestinal metaplasia, a gastric precancerous condition. The original paper introduces OLFM4 as a novel biomarker with potential enhanced diagnostic efficacy compared to established markers. However, several methodological and interpretive considerations are noted. The histopathological findings could be refined by using higher magnification to better elucidate the cellular localization of OLFM4. Including high-resolution images for key stainings would enhance the study's robustness in expression profiling. The statistical approach could be strengthened by employing more rigorous, quantitative methodologies. Additionally, integrating immunofluorescence double-staining may improve the reliability of the results. Discrepancies in immunohistochemical signals across datasets suggest a need for further investigation into tissue section representativeness. Clarifying the term "precancerous lesions of gastric carcinoma cells" to align with widely accepted definitions would enhance clarity. The choice of the GES-1 cell model treated with MNNG could be reconsidered in favor of more established models such as organoids, air-liquid interface models, and gastric cancer-specific cell lines. The in vivo MNNG-alcohol combination model might require additional empirical support, given the limited and conflicting literature on this approach, to ensure an accurate portrayal of IM pathogenesis. The commentary concludes with a call for stringent and standardized methodologies in biomarker research to ensure the clinical applicability and reliability of biomarker studies, particularly in the context of gastric cancer detection and intervention.

HFE
Also flagged:PARP1Poly (ADP-ribose) polymerase 1chromatintranscription factorsmethylationcancer
Journal Article 2024-08-08 ✓ 4 Snippets Lu Y, Fu W, Xing W, Wu H, Zhang C, Xu D.
In-Text Gene Mentions

…hemochromatosis gene (HFE) [ 51…

…sequence of theHFEpromoter to inhibit…

…the expression ofHFE, providing a…

…[ 46 ]HFE[ 47 ]…

Show Full Abstract

Poly (ADP-ribose) polymerase 1 (PARP1) is a multifunctional nuclear enzyme that catalyzes poly-ADP ribosylation in eukaryotic cells. In addition to maintaining genomic integrity, this nuclear enzyme is also involved in transcriptional regulation. PARP1 can trigger and maintain changes in the chromatin structure and directly recruit transcription factors. PARP1 also prevents DNA methylation. However, most previous reviews on PARP1 have focused on its involvement in maintaining genome integrity, with less focus on its transcriptional regulatory function. This article comprehensively reviews the transcriptional regulatory function of PARP1 and its application in disease treatment, providing new ideas for targeting PARP1 for the treatment of diseases other than cancer.

SOX6
Also flagged:multiple sclerosisMSoligodendrocyte differentiationCSFdeathtranscription factor
Journal Article 2024-08-08 ✓ 1 Snippet Fagiani F, Pedrini E, Taverna S, Brambilla E, Murtaj V, Podini P, Ruffini F, Butti E, Braccia C, Andolfo A, Magliozzi R, Smirnova L, Kuhlmann T, Quattrini A, Calabresi PA, Reich DS, Martino G, Panina-Bordignon P, Absinta M.
In-Text Gene Mentions

…, SOX10 ,SOX6, NKX2-2 ,…

Show Full Abstract

The role of central nervous system (CNS) glia in sustaining self-autonomous inflammation and driving clinical progression in multiple sclerosis (MS) is gaining scientific interest. We applied a single transcription factor (SOX10)-based protocol to accelerate oligodendrocyte differentiation from human induced pluripotent stem cell (hiPSC)-derived neural precursor cells, generating self-organizing forebrain organoids. These organoids include neurons, astrocytes, oligodendroglia, and hiPSC-derived microglia to achieve immunocompetence. Over 8 weeks, organoids reproducibly generated mature CNS cell types, exhibiting single-cell transcriptional profiles similar to the adult human brain. Exposed to inflamed cerebrospinal fluid (CSF) from patients with MS, organoids properly mimic macroglia-microglia neurodegenerative phenotypes and intercellular communication seen in chronic active MS. Oligodendrocyte vulnerability emerged by day 6 post-MS-CSF exposure, with nearly 50% reduction. Temporally resolved organoid data support and expand on the role of soluble CSF mediators in sustaining downstream events leading to oligodendrocyte death and inflammatory neurodegeneration. Such findings support the implementation of this organoid model for drug screening to halt inflammatory neurodegeneration.

PTGIS
Also flagged:cancerneurodegenerative disordersvesiclesresponses to stressmembranesmelanoma
Journal Article 2024-08-08 ✓ 1 Snippet Shen C, Li X, Qin J, Duan L.
In-Text Gene Mentions

…prostaglandin I2 synthase (PTGIS), mitogen-activated protein k…

Show Full Abstract

Plant-derived exosome-like nanoparticles (ELNs) have demonstrated cross-kingdom capabilities in regulating intercellular communication, facilitating drug delivery, and providing therapeutic interventions in humans. However, the functional attributes of konjac-derived ELNs (K-ELNs) remain largely unexplored. This study investigates the isolation, characterization, and functional analysis of K-ELNs, along with the profiling and differential expression analysis of associated miRNAs in both K-ELNs and Konjac tissues. K-ELNs were successfully isolated and characterized from two konjac species using ultracentrifugation, followed by Transmission Electron Microscopy (TEM) and Nanoparticle Tracking Analysis (NTA). Small RNA sequencing identified a total of 3,259 miRNAs across all samples. Differential expression analysis revealed significant differences in miRNA profiles between K-ELNs and tissue samples. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analysis of target genes provided insights into their roles in modulating pathways associated with diseases such as cancer and neurodegenerative disorders. Additionally, six miRNAs were selected for validation of sequencing results via RT-qPCR. The 5'RLM-RACE method was employed to validate the cleavage sites between differentially expressed miRNAs (DEMs) and their predicted target genes, further substantiating the regulatory roles of miRNAs in konjac. The findings of this study enhance our understanding of the molecular mechanisms underlying the biological functions and applications of K-ELNs, laying the groundwork for future research into their potential therapeutic roles in human health.

Also flagged:autophagyNon-alcoholic fatty liver diseaseNAFLDliver diseasecytoplasmicorganelles
Journal Article 2024-08-08 No Snippets Shen Q, Yang M, Wang S, Chen X, Chen S, Zhang R, Xiong Z, Leng Y.
Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) is a clinicopathologic syndrome characterized by excessive fat deposition in hepatocytes and a major cause of end-stage liver disease. Autophagy is a metabolic pathway responsible for degrading cytoplasmic products and damaged organelles, playing a pivotal role in maintaining the homeostasis and functionality of hepatocytes. Recent studies have shown that pharmacological intervention to activate or restore autophagy provides benefits for liver function recovery by promoting the clearance of lipid droplets (LDs) in hepatocytes, decreasing the production of pro-inflammatory factors, and inhibiting activated hepatic stellate cells (HSCs), thus improving liver fibrosis and slowing down the progression of NAFLD. This article summarizes the physiological process of autophagy, elucidates the close relationship between NAFLD and autophagy, and discusses the effects of drugs on autophagy and signaling pathways from the perspectives of hepatocytes, kupffer cells (KCs), and HSCs to provide assistance in the clinical management of NAFLD.

RC3H1
Also flagged:NeuroblastomaNBsolid tumorchildhood cancersMYCNpediatric cancer
Journal Article 2024-08-08 ✓ 1 Snippet Zhang L, Mo J, Shi H, Xiong J, Aierken Y, Chen F, Tang Y, Zhao K, Lv Z, Tan K.
In-Text Gene Mentions

…(e.g., ARID4B, FEM1B,RC3H1) with HRs…

Show Full Abstract

<b>Objectives:</b> Neuroblastoma (NB), a pediatric malignancy of the peripheral nervous system, is characterized by epigenetic and transcriptional (EP-TF) anomalies. This study aimed to develop an EP-TF clinical prognostic model for NB using CRISPR-Cas9 knockout screening. <b>Results:</b> An integrative analysis was conducted using CRISPR-Cas9 screening <i>in vitro</i> and <i>in vivo</i> with public NB datasets to identify 35 EP-TF genes that exhibited the highest expression in NB and were highly dependent on cancer viability. After univariate analysis, 27 of these 35 genes were included in the least absolute shrinkage and selection operator screen. We established and biologically validated a prognostic EP-TF model encompassing <i>RUVBL1, LARP7, GTF3C4, THAP10, SUPT16H, TIGD1, SUV39H2, TAF1A, SMAD9,</i> and <i>FEM1B</i> across diverse NB cohorts. MYCN serves a potential upstream regulator of EP-TF genes. The high-risk subtype exhibited traits associated with the malignant cell cycle, MYCN-linked signaling and chromatin remodeling, all of which are correlated with poor prognosis and immunosuppression. MEK inhibitors have emerged as promising therapeutic agents for targeting most EP-TF risk genes in NB. <b>Conclusion:</b> Our novel prognostic model shows significant potential for predicting and evaluating the overall survival of NB patients, offering insights into therapeutic targets.

PEBP1
Also flagged:Peptidesmetabolismacrosomespermatid developmentSPACA1PEBP4
Journal Article 2024-08-08 ✓ 5 Snippets Satrio FA, Karja NWK, Setiadi MA, Kaiin EM, Pardede BP, Purwantara B.
In-Text Gene Mentions

…sperm decapacitation factor (PEBP1).…

…related to decapacitation (PEBP1), antioxidants (QSOX1), capac…

…protein expressions, includingPEBP1(21 kDa; pI…

PEBP1located in the…

…Abundant expression ofPEBP1has been associated…

Show Full Abstract

Increasing the age of bulls results in a decrease in reproductive function, including a reduction in sperm quality, which plays a vital role in determining the fertility of bulls. Through a proteomic approach, this research aims to analyze the influence of age factors on various proteomes contained in bull sperm. Frozen semen samples from Simmental Bulls were categorized into three age groups: two, four, and ≥10 years old. Subsequently, the post-thaw sperm cells obtained were separated based on molecular weight using 1D-SDS-PAGE. Peptides extracted from the bands produced in each age group were subjected to LC-MS/MS analysis. A total of 72 protein types were identified, with 45 being detected in the 4-year-old group and 41 expressed in both the 2 and ≥10-year-old groups. The results provided insights into proteins' role in sperm metabolism across all age groups. Specifically, the 2-year-old group exhibited the expression of proteins associated with acrosome assembly and spermatid development (SPACA1). In contrast, those in the 4-year-old group were linked to motility (PEBP4) and sperm decapacitation factor (PEBP1). Proteins expressed in the 2 and -year-old groups were discovered to be involved in fertilization processes (TEX101). In contrast, the ≥10-year-old age group was associated with hyperactive movement related to capacitation (Tubulin). In conclusion, age influenced the differences observed in the proteomic profile of post-thaw Simmental bull sperm using the 1D-SDS-PAGE tandem LC-MS/MS approach.

Also flagged:collagenmembranesHIF1αoxygendevelopmental disordersProser2
Journal Article 2024-08-08 No Snippets Li Z, Han D, Li Z, Luo L.
Show Full Abstract

Animal embryonic development occurs under hypoxia, which can promote various developmental processes. Embryonic fibroblasts, which can differentiate into bone and cartilage and secrete various members of the collagen protein family, play essential roles in the formation of embryonic connective tissues and basement membranes. However, the adaptations of embryonic fibroblasts under hypoxia remain poorly understood. In this study, we investigated the effects of hypoxia on mouse embryonic fibroblasts (MEFs). We found that hypoxia can induce migration, promote metabolic reprogramming, induce the production of ROS and apoptosis, and trigger the activation of multiple signaling pathways of MEFs. Additionally, we identified several hypoxia-inducible genes, including <i>Proser2</i>, <i>Bean1</i>, <i>Dpf1</i>, <i>Rnf128</i>, and <i>Fam71f1</i>, which are regulated by HIF1α. Furthermore, we demonstrated that CoCl<sub>2</sub> partially mimics the effects of low oxygen on MEFs. However, we found that the mechanisms underlying the production of ROS and apoptosis differ between hypoxia and CoCl<sub>2</sub> treatment. These findings provide insights into the complex interplay between hypoxia, fibroblasts, and embryonic developmental processes.

BTN2A1
Also flagged:Cholangiocarcinomatumormajor histocompatibility complexIFN-γthiazole1
Journal Article 2024-08-08 ✓ 1 Snippet Kulma I, Na-Bangchang K, Carvallo Herrera A, Ndubuisi IT, Iwasaki M, Tomono H, Morita CT, Okamura H, Mukae H, Tanaka Y.
In-Text Gene Mentions

…a TCR- andBTN2A1/3A1-dependent manner [ 23…

Show Full Abstract

Cholangiocarcinoma (CCA) is a rare disease characterized by malignant cells derived from the epithelial cells of the biliary duct system. Despite extensive treatments, the prognosis for CCA remains poor, emphasizing the critical need for the development of novel treatments. Considerable attention has been directed towards innate immune effector cells, which can recognize tumor cells independently of the major histocompatibility complex, laying the foundation for the development of off-the-shelf drugs. In this study, we cultured innate immune cells obtained from the peripheral blood of healthy adults and conducted a comparative analysis of the effector functions against CCA cell lines by Vδ2 γδ T cells and NK cells. This analysis was performed using standard short- and long-term cytotoxicity assays, as well as ELISA for IFN-γ. Vδ2 γδ T cells demonstrated cytotoxicity and IFN-γ production in response to CCA cells in a TCR-dependent manner, particularly in the presence of tetrakis-pivaloyloxymethyl 2-(thiazole-2-ylamino)ethylidene-1,1-bisphosphonate, a bisphosphonate prodrug. In contrast, direct killing and antibody-dependent cellular cytotoxicity were relatively slow and weak. Conversely, NK cells displayed potent, direct cytotoxicity against CCA cells. In summary, both Vδ2 γδ T cells and NK cells show promise as innate immune effector cells for adoptive transfer therapy in the context of CCA.

Also flagged:oxygencardiovascular diseasesstrokeatherosclerosisglucoseangiogenesis
Journal Article 2024-08-08 No Snippets Zhang Y, Shen X, Deng S, Chen Q, Xu B.
Show Full Abstract

As a critical part of the circulatory system, blood vessels transport oxygen and nutrients to every corner of the body, nourishing each cell, and also remove waste and toxins. Defects in vascular development and function are closely associated with many diseases, such as heart disease, stroke, and atherosclerosis. In the nervous system, the nervous and vascular systems are intricately connected in both development and function. First, peripheral blood vessels and nerves exhibit parallel distribution patterns. In the central nervous system (CNS), nerves and blood vessels form a complex interface known as the neurovascular unit. Second, the vascular system employs similar cellular and molecular mechanisms as the nervous system for its development. Third, the development and function of CNS vasculature are tightly regulated by CNS-specific signaling pathways and neural activity. Additionally, vascular endothelial cells within the CNS are tightly connected and interact with pericytes, astrocytes, neurons, and microglia to form the blood-brain barrier (BBB). The BBB strictly controls material exchanges between the blood and brain, maintaining the brain's microenvironmental homeostasis, which is crucial for the normal development and function of the CNS. Here, we comprehensively summarize research on neural regulation of vascular and BBB development and propose directions for future research.

Also flagged:Pancreatic cancermalignant tumortumorPancreatic ductal adenocarcinomapancreatic endocrine tumorspancreatic cancers
Journal Article 2024-08-08 No Snippets Wei C, Zhang C, Zhou Y, Wang J, Jin Y.
Show Full Abstract

Pancreatic cancer is a prevalent malignant tumor with rising medication resistance and mortality. Due to a dearth of specific and trustworthy biomarkers and therapeutic targets, pancreatic cancer early detection and treatment are still not at their best. Exosomal LncRNAs have been found to be plentiful and persistent within exosomes, and they are capable of functioning whether the exosomes are traveling to close or distant cells. Furthermore, increasing evidence suggests that exosomal LncRNA, identified as an oncogene or tumor suppressor-control the growth, metastasis, and susceptibility of pancreatic cancer to chemotherapy and radiation therapy. Promising prospects for both antitumor targets and diagnostic biomarkers are exosomal LncRNAs. The primary features of exosomal LncRNAs, their biological roles in the onset and progression of pancreatic cancer, and their potential as therapeutic targets and diagnostic molecular markers are outlined in this review.

Also flagged:TroloxFerulic,Sinapic,Cinnamic AcidProlinecardiovascular diseases
Journal Article 2024-08-08 No Snippets Papagiouvannis G, Theodosis-Nobelos P, Rekka EA.
Show Full Abstract

Degenerative conditions, such as neurodegenerative disorders (Alzheimer's disease (AD), Parkinson's disease (PD)) and cardiovascular diseases, are complex, multifactorial disorders whose pathophysiology has not been fully elucidated yet. As a result, the available treatment options cannot eliminate these diseases radically, but only alleviate the symptoms. Both inflammatory processes and oxidation are key factors in the development and evolution of neurodegeneration, while acetylcholinesterase inhibitors are the most used therapeutic options against AD. In this work, following the multi-targeting compound approach, we designed and synthesized a series of proline and gamma-aminobutyric acid (GABA) amides with various acidic moieties that possess an antioxidant and/or anti-inflammatory potency. Proline is the pharmacophore of nootropic drugs (e.g., piracetam) used for memory improvement, while GABA is the main inhibitory neurotransmitter in the central nervous system. The designed molecules were subjected to a preliminary screening of their bioactivity in antioxidant and anti-inflammatory assays, as well as against acetylcholinesterase. Most of the synthesized compounds could inhibit lipid peroxidation (IC<sub>50</sub> as low as 8 μΜ) and oxidative protein glycation (inhibition of up to 48%) and reduce the 2,2-diphenyl-1-picrylhydrazyl free radical (DPPH). In addition, all of the compounds were moderate inhibitors of lipoxygenase (LOX) (up to 46% at 100 μΜ) and could decrease carrageenan-induced paw edema in rats by up to 55%. Finally, some of the compounds were moderate acetylcholinesterase inhibitors (IC<sub>50</sub> as low as 219 μΜ). The results confirmed the design rationale, indicating that the compounds could be further optimized as multi-targeting molecules directed against degenerative conditions.

Also flagged:Brain-Derived Neurotrophic FactorBDNFAnorexia Nervosabrain developmentANpsychiatric disorder
Journal Article 2024-08-08 No Snippets Cao J, Gorwood P, Ramoz N, Viltart O.
Show Full Abstract

Neurotrophic factors play pivotal roles in shaping brain development and function, with brain-derived neurotrophic factor (BDNF) emerging as a key regulator in various physiological processes. This review explores the intricate relationship between BDNF and anorexia nervosa (AN), a complex psychiatric disorder characterized by disordered eating behaviors and severe medical consequences. Beginning with an overview of BDNF's fundamental functions in neurodevelopment and synaptic plasticity, the review delves into recent clinical and preclinical evidence implicating BDNF in the pathophysiology of AN. Specifically, it examines the impact of BDNF polymorphisms, such as the Val66Met variant, on AN susceptibility, prognosis, and treatment response. Furthermore, the review discusses the interplay between BDNF and stress-related mood disorders, shedding light on the mechanisms underlying AN vulnerability to stress events. Additionally, it explores the involvement of BDNF in metabolic regulation, highlighting its potential implications for understanding the metabolic disturbances observed in AN. Through a comprehensive analysis of clinical data and animal studies, the review elucidates the nuanced role of BDNF in AN etiology and prognosis, emphasizing its potential as a diagnostic and prognostic biomarker. Finally, the review discusses limitations and future directions in BDNF research, underscoring the need for further investigations to elucidate the complex interplay between BDNF signaling and AN pathology.

Also flagged:agingGATA binding protein 6GATA6cell proliferationSOCS3interleukin 6
Journal Article 2024-08-08 No Snippets Lin EC, Davis MP, Lee MS, Ma G, Xu W, Chang YI, Li WJ.
Show Full Abstract

<h4>Background aims</h4>The immunomodulatory capacity of mesenchymal stem/stromal cells (MSCs) is a key feature that makes them particularly valuable for regenerative medicine. However, this potential is affected by the chronological aging of the donors and the cell expansion procedures in culture. We have demonstrated that GATA binding protein 6 (GATA6) plays a pivotal role in the aging of MSCs and inhibiting GATA6 rejuvenates the characteristics of MSCs.<h4>Methods</h4>In this study, we compared the immunomodulatory capabilities of young and old MSC models, using induced pluripotent stem cells-derived rejuvenated MSCs (rMSCs) and their parental MSCs (pMSCs), respectively, to identify a key mechanism involved in the differential regulation of these capabilities. Additionally, we explored the role of GATA6 in mediating the mechanism.<h4>Results</h4>Our results demonstrated that rMSCs exhibited downregulated aging-associated regulators, including p53, p21 and GATA6, and showed enhanced suppression of T cell proliferation compared to pMSCs. Through analyzing our previous RNA-seq data and employing target gene knockdown, we determined both suppressors of cytokine signaling 3 (SOCS3) and interleukin 6 were involved in GATA6-induced regulation, collectively affecting the expression of programmed death ligand 1 (PDL1) in both pMSCs and rMSCs.<h4>Conclusions</h4>Our findings underline the significance of the GATA6/SOCS3/PDL1 pathway in regulating aging-associated changes in MSC immunomodulatory activity, providing valuable insights into the potential use of rMSCs in the treatment of immune diseases and regenerative medicine.

Also flagged:Acyl SulfamidesGlioblastomaGBMbrain tumormalignant tumorstumor
Journal Article 2024-08-08 No Snippets Wang Z, Thakare RP, Chitale S, Mishra AK, Goldstein SI, Fan AC, Li R, Zhu LJ, Brown LE, Cencic R, Huang S, Green MR, Pelletier J, Malonia SK, Porco JA.
Show Full Abstract

Glioblastoma (GBM) is the most aggressive and frequently occurring type of malignant brain tumor in adults. The initiation, progression, and recurrence of malignant tumors are known to be driven by a small subpopulation of cells known as tumor-initiating cells or cancer stem cells (CSCs). GBM CSCs play a pivotal role in orchestrating drug resistance and tumor relapse. As a prospective avenue for GBM intervention, the targeted suppression of GBM CSCs holds considerable promise. In this study, we found that rocaglates, compounds which are known to inhibit translation <i>via</i> targeting of the DEAD-box helicase eIF4A, exert a robust, dose-dependent cytotoxic impact on GBM CSCs with minimal killing of nonstem GBM cells. Subsequent optimization identified novel rocaglate derivatives (rocaglate acyl sulfamides or Roc ASFs) that selectively inhibit GBM CSCs with nanomolar EC<sub>50</sub> values. Furthermore, comparative evaluation of a lead CSC-optimized Roc ASF across diverse mechanistic and target profiling assays revealed suppressed translation inhibition relative to that of other CSC-selective rocaglates, with enhanced targeting of the DEAD-box helicase DDX3X, a recently identified secondary target of rocaglates. Overall, these findings suggest a promising therapeutic strategy for targeting GBM CSCs.

Also flagged:nanohydroxyapatiteZn2+calcium+collagen type Imineral
Journal Article 2024-08-08 No Snippets Alashi S, Alkhouri I, Alghoraibi I, Kochaji N, Houri A, Karkoutly M.
Show Full Abstract

<h4>Background</h4>This study aimed to evaluate morphological, chemical and biocompatible properties of nanohydroxyapatite (N-HA) synthesized from eggshells and dual-doped with Si4+ and Zn2+.<h4>Methods</h4>In the current study, N-HA was synthesized from chicken eggshells using the wet chemical precipitation method and doped with Si4+ and Zn2+. The physical assessment was carried out using field emission scanning electron microscopy (FE-SEM), energy dispersive X-ray (EDX) analysis, and X-ray diffraction (XRD) analysis. Crystal size was calculated using the Scherrer equation. Cytotoxicity was studied in vitro using the MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) cytotoxicity assay. The optical density (OD) of each well was obtained and recorded at 570 nm for 24 h (t1), 48 h (t2), 72 h (t3), and 5 days (t4) using a microplate reader.<h4>Results</h4>The results of Si-Zn-doped HA showed a high specific surface area with an irregular nano-sized spherical particle structure. The atomic percentage provided the ratio of calcium to phosphate; for non-doped HA, the atomic Ca/P ratio was 1.6, but for Si-Zn-doped HA, where Zn+2 Ca and Si + replaced 4 substituted P, the atomic ratio (Ca + Zn)/(P + Si) was 1.76. The average crystal size of Si-Zn-doped HA was 46 nm, while for non-doped HA it was 61 nm. both samples were non-toxic and statistically significantly less viable than the control group After 5 days, the mean cell viability of Si-Zn-doped HA (79.17 ± 2.18) was higher than that of non-doped HA (76.26 ± 1.71) (P = 0.091).<h4>Conclusions</h4>The MTT assay results showed that Si-Zn-doped HA is biocompatible. In addition, it showed characteristic physiochemical properties of a large surface area with interconnected porosity.

DCC
Also flagged:Post-traumatic stress disorderPTSDstress-psychiatric disorderin colorectal cancerlong-term potentiation
Journal Article 2024-08-08 ✓ 5 Snippets Yang S, Hu J, Chen Y, Zhang Z, Wang J, Zhu G.
In-Text Gene Mentions

DCC, a potential target…

…in colorectal cancer (DCC) was highly upregulated.…

…Specific overexpression ofDCCin the hippocampus…

…function of hippocampalDCCusing a neutralizing…

…hippocampal neurons increasedDCCexpression and induced…

Show Full Abstract

Post-traumatic stress disorder (PTSD) is a severe stress-dependent psychiatric disorder characterized by impairment of fear memory extinction; however, biological markers to determine impaired fear memory extinction in PTSD remain unclear. In male mice with PTSD-like behaviors elicited by single prolonged stress (SPS), 19 differentially expressed proteins in the hippocampus were identified compared with controls. Among them, a biological macromolecular protein named deleted in colorectal cancer (DCC) was highly upregulated. Specific overexpression of DCC in the hippocampus induced similar impairment of long-term potentiation (LTP) and fear memory extinction as observed in SPS mice. The impairment of fear memory extinction in SPS mice was improved by inhibiting the function of hippocampal DCC using a neutralizing antibody. Mechanistic studies have shown that knocking down or inhibiting μ-calpain in hippocampal neurons increased DCC expression and induced impairment of fear memory extinction. Additionally, SPS-triggered impairment of hippocampal LTP and fear memory extinction could be rescued through activation of the Rac1-Pak1 signaling pathway. Our study provides evidence that calpain-mediated regulation of DCC controls hippocampal LTP and fear memory extinction in SPS mice, which likely through activation of the Rac1-Pak1 signaling pathway.

OLFM4
Also flagged:Rheumatoid ArthritisInterstitial Lung DiseaseRALung DiseasesKL-6RF
Journal Article 2024-08-08 ✓ 2 Snippets Lira ST, Costa MR, Gonçalves Barros WR, Gonçalves Junior J.
In-Text Gene Mentions

…(MKI67), olfactomedin 4 (OLFM4), baculoviral inhibitor of…

…TYMS, SORT1, MKI67,OLFM4, BIRC5, MS4A4A, CLEC12A,…

Show Full Abstract

Despite advances in the study of rheumatoid arthritis-associated interstitial lung disease (RA-ILD), the pulmonary manifestation remains an important cause of morbidity and mortality. However, there is a lack of biochemical markers for this manifestation in the literature. Therefore, the objective of this study was to carry out a qualitative systematic review on biochemical markers associated with RA-ILD in the PubMed, Web of Science, Embase, Cochrane Library, and Virtual Health Library (VHL) between January 2015 and July 2024, using the following descriptors: #1 "biomarkers" (MeSH) AND #2 "rheumatoid arthritis" (MeSH) AND #3 "Lung Diseases, Interstitial" (MeSH). Of the 1497 articles found, 27 presented eligibility criteria. The findings were divided into three sessions: "Main biomarkers for RA-ILD," "Other biomarkers for RA-ILD activity," and "Other biomarkers for RA-ILD prognosis." Among the evaluated markers, KL-6, RF, ACPA, ESR, and CRP appear to have prognostic value and association with damage in patients with RA-ILD. The association of some molecules such as sPD-1, sCD25, VCAM-1, MCP-1, and ADMA with tissue damage is intriguing. Longitudinal and randomized studies are imperative to comprehensively delineate the history of RA-ILD and evaluate potential serum biomarkers.

PRDX6
Also flagged:fatty acidslinoleic acidα-linolenic acid polyunsaturated fatty acidobesitytype 2 diabetesfatty acid
Journal Article 2024-08-08 ✓ 5 Snippets Liput KP, Lepczyński A, Poławska E, Ogłuszka M, Starzyński R, Urbański P, Nawrocka A, Jończy A, Pierzchała D, Pareek CS, Gołyński M, Woźniakowski G, Czarnik U, Pierzchała M.
In-Text Gene Mentions

…EIF2S1; peroxiredoxin-6 –PRDX6; aldehyde dehydrogenase 1A1…

… oxidation-reduction process (PRDX6; ALDH1A1; PRDX4; cytosolic…

…expression of thePrdx6gene was similar…

…potential inducer ofPrdx6expression.…

…The level ofPRDX6protein was increased…

Show Full Abstract

<h4>Introduction</h4>Some health disorders, such as obesity and type 2 diabetes, are associated with a poor diet and low quality of the fat in it. The type and duration of the diet have an impact on the liver. This investigation uses the proteomic approach to identify changes in the mouse liver protein profile in adaptation to high-fat diets with different saturated fatty acid contents and linoleic acid (18:2<i>n</i>-6) to α-linolenic acid (18:3<i>n</i>-3) fatty acid ratios.<h4>Material and methods</h4>Four groups of male mice were fed different diets: one standard diet and three high-fat diets were investigated. After six months on these diets, the animals were sacrificed for liver dissection. Two-dimensional electrophoresis was used to separate the complex liver protein mixture, which enabled the separation of proteins against a wide, 3-10 range of pH and molecular weights of 15-250 kDa. Protein profiles were analysed in the PDQuest Advanced 8.0.1 program. Differentially expressed spots were identified using matrix-assisted laser desorption/ionisation-time-of-flight tandem mass spectrometry and peptide mass fingerprinting. The levels of identified proteins were validated using Western blotting. Transcript levels were evaluated using a real-time quantitative PCR.<h4>Results</h4>The analysis of mouse liver protein profiles enabled the identification of 32 protein spots differing between nutritional groups.<h4>Conclusion</h4>A diet high in polyunsaturated fatty acids modulated the levels of liver proteins involved in critical metabolic pathways, including amino acid metabolism, carbohydrate metabolism and cellular response to oxidative stress.

OLFM4
Also flagged:AlbuminADcirrhosisinfectionsAD cirrhosisphagocytosis
Journal Article 2024-08-08 ✓ 1 Snippet Clària J, Aguilar F, Lozano JJ, Jiménez-Gracia L, Nieto JC, Romero-Grimaldo B, Marcos-Fa X, Giarracco E, Weiss E, Trebicka J, Hernàndez I, Fernandez J, Casulleras M, López-Vicario C, Muldur S, Hopke A, Vlagea A, Aransay AM, Marchese D, Bernardi M, Jalan R, Angeli P, Magri G, Cerutti A, Irimia D, Heyn H, Arroyo V, Moreau R.
In-Text Gene Mentions

…genes ( CD177,OLFM4, PRG2, MPO, BPI,…

Show Full Abstract

<h4>Background & aims</h4>Patients with acutely decompensated (AD) cirrhosis are immunocompromised and particularly susceptible to infections. This study investigated the immunomodulatory actions of albumin by which this protein may lower the incidence of infections.<h4>Methods</h4>Blood immunophenotyping was performed in 11 patients with AD cirrhosis and 10 healthy volunteers (HV). Bulk and single-cell RNA sequencing (scRNA-seq) and flow cytometry were performed in peripheral blood mononuclear cells (PBMCs) from 20 patients with AD cirrhosis and 34 HV exposed to albumin. Albumin's effects on degranulation, phagocytosis, chemotaxis, and swarming of neutrophils from six patients with AD cirrhosis and nine HV were assessed by measuring myeloperoxidase enzymatic activity, the engulfment of fluorescent-labeled <i>Escherichia coli</i> and zymosan, and interactions of neutrophils with <i>Candida albicans</i> at single-cell resolution in microfluidic chambers, respectively. Whole blood RNA sequencing (RNA-seq) analyses were performed in 49 patients admitted for severe AD cirrhosis, of whom 30 received albumin during hospitalization.<h4>Results</h4>Compared with HV, patients with AD cirrhosis showed severe lymphopenia and defective neutrophil antimicrobial function. Bulk and scRNA-seq analyses revealed significantly (false discovery rate [FDR] <0.05) increased signatures related to B cells, myeloid cells, and CD4<sup>+</sup> T cells in PBMCs incubated with albumin. Changes in the B cell population were confirmed by flow cytometry. Neutrophils exposed to albumin also exhibited augmented chemotactic and degranulation responses, enhanced phagocytosis, and increased pathogen-restrictive swarming. RNA-seq data analysis in patients who had received albumin revealed specific upregulation of signatures related to B cells and neutrophils together with transcriptional changes in CD4<sup>+</sup> T cells (FDR <0.05).<h4>Conclusions</h4>The finding that albumin promotes the transcriptional reprogramming and expansion of the B cell compartment and improves neutrophil antimicrobial functions indicates mechanisms that may lower the incidence of infections in patients with severe AD cirrhosis receiving albumin therapy.<h4>Impact and implications</h4>Patients with acutely decompensated cirrhosis receiving albumin as treatment have a lower incidence of infections. The reason for this protection is currently unknown, but the present study provides data that support the ability of albumin to boost the antimicrobial functions of immune cells in these patients. Moreover, these findings encourage the design of controlled clinical studies specifically aimed at investigating the effects of albumin administration on the immune system.

NEGR1DCC
Also flagged:Subarachnoid hemorrhagebrain aneurysmbrainCerebral edemapathogenesisbrain edema
Journal Article 2024-08-07 ✓ 3 Snippets Wei B, Liu W, Jin L, Huang Y, Cheng W, Fan H, Su S, Jin F, Zhang X, Yang Z, Liang S, Li L, Wu Y, Liu Y, Duan C, Li X.
In-Text Gene Mentions
⭐ same-sentence co-mention

…revealed NEO1, CLSTN1,DCC, and NEGR1 as…

⭐ same-sentence co-mention

…CLSTN1, DCC, andNEGR1as significantly altered…

…belonging to theDCCfamily of netrin…

Show Full Abstract

Subarachnoid hemorrhage (SAH) significantly compromises the blood-brain barrier (BBB) and impairs patient recovery. This study elucidates the critical role of astrocytic Neogenin-1 (NEO1) in BBB integrity post-SAH and examines the regulatory effects of hepcidin on endothelial cell (EC) function amid NEO1-mediated disruptions in iron homeostasis. Proteomic analyses of cerebrospinal fluid (CSF) from SAH patients revealed a substantial decrease in NEO1 expression, identifying it as a key factor in BBB integrity. 111 CSF proteins were significantly reduced in early SAH stages (days 1-3), with NEO1 among the most significantly altered. This dysregulation was linked to poorer patient outcomes, as indicated by a negative correlation between NEO1 levels and Modified Rankin Scale scores six months post-SAH (R = -0.4743, P < 0.0001). Experimental models further highlighted the importance of NEO1: SAH model and NEO1<sup>GFAP-Cre</sup> mice exhibited exacerbated EC dysfunction and increased BBB permeability, evidenced by significant Evans Blue retention and dextran leakage in the parietal cortex, effects that were mitigated by hepcidin administration. Our findings highlight the complex interplay between astrocytic signaling and endothelial function in SAH pathophysiology. The loss of astrocytic NEO1 led to increased EC proliferation and altered BBB structure, as confirmed by transmission electron microscopy and immunostaining for PECAM-1, indicating heightened blood vessel density in the affected cortex. Hepcidin treatment effectively reversed the EC dysfunction and BBB disruption in both NEO1-cKO mice and the SAH model, highlighting its potential as a therapeutic agent to enhance recovery and improve prognosis following SAH.

Also flagged:acute kidney diseasegene expressionkidney diseasechronic kidney diseaserenal diseaseschronic renal disease
Journal Article 2024-08-07 No Snippets Li S, Hu W, Qian L, Sun D.
Show Full Abstract

Noncoding RNAs (ncRNAs) have emerged as pivotal regulators of gene expression, and have attracted significant attention because of their various roles in biological processes. These molecules have transcriptional activity despite their inability to encode proteins. Moreover, research has revealed that ncRNAs, especially microRNAs (miRNAs), long noncoding RNAs (lncRNAs), and circular RNAs (circRNAs), are linked to pervasive regulators of kidney disease, including anti-inflammatory, antiapoptotic, antifibrotic, and proangiogenic actions in acute and chronic kidney disease. Although the exact therapeutic mechanism of ncRNAs remains uncertain, their value in treatment has been studied in clinical trials. The numerous renal diseases and the beneficial or harmful effects of NcRNAs on the kidney will be discussed in this article. Afterward, exploring the biological characteristics of ncRNAs, as well as their purpose and potential contributions to acute and chronic renal disease, were explored. This may offer guidance for treating both acute and long-term kidney illnesses, as well as insights into the potential use of these indicators as kidney disease biomarkers.

SERPINC1
Also flagged:thyroidcoagulationvenous thromboembolismFibrinogenThrombomodulinPlasminogen activator inhibitor-1
Journal Article 2024-08-07 ✓ 3 Snippets Li X, Lin P, Qi M, Zhou H, Liang Z.
In-Text Gene Mentions

…F XI, Fibrinogen,Antithrombin-III, Thrombomodulin, Plasminogen …

…related to decreasedAntithrombin-III(β: -0.04 [95%…

…nticoagulant factors includingAntithrombin-IIIand Protein C.…

Show Full Abstract

<h4>Objective</h4>The association between thyroid function, coagulation and venous thromboembolism (VTE) has been reported in observational studies with conflicting findings. This study aimed to elucidate the causal effects of thyroid function on coagulation and VTE from a genetic perspective.<h4>Methods</h4>Two sample Mendelian randomization analysis was conducted using summary statistics from genome-wide association studies in a European population. Coagulation status was associated with nine coagulation-related factors (F VIII, F IX, F XI, Fibrinogen, Antithrombin-III, Thrombomodulin, Plasminogen activator inhibitor-1, Protein C and Protein S). Inverse variance weighting with random effect method was used as the main analytic approach with MR-Egger, weighted median, simple mode and weighted mode methods serving as complements. Sensitivity analyses including heterogeneity test, horizontal pleiotropy test and leave-one-out analysis were conducted to further assess the reliability of results.<h4>Results</h4>No genetic causal effects of thyroid function on VTE (including pulmonary embolism and deep venous thrombosis) were found. Genetically, hyperthyroidism was suggestively related to decreased Antithrombin-III (β: -0.04 [95% CI: -0.06 to - 0.01], p = 0.010) and Protein C (β: -0.03 [95% CI: -0.06 to 0.00], p = 0.045). No notable associations were observed between other thyroid function parameters and coagulation-related factors.<h4>Conclusion</h4>We provide suggestive genetic evidence supporting the causal effect of hyperthyroidism on decreased level of anticoagulant factors including Antithrombin-III and Protein C. However, whether this genetic causality could lead to clinically significant hypercoagulable state and increased risk of VTE in hyperthyroid population needs to be further addressed.

PRDX6
Also flagged:tumoursteroidTXNRD1thioredoxin reductase 1cytochrome P450electrons
Journal Article 2024-08-07 ✓ 4 Snippets Tang F, Hummitzsch K, Rodgers RJ.
In-Text Gene Mentions

…6B ), whereasPRDX6significantly decreased with…

…10C ) andPRDX6( Fig 10F…

…, SOD2 andPRDX6were significantly increased…

…The increase inPRDX6in TXNRD1 -deficient…

Show Full Abstract

The ovarian KGN granulosa-like tumour cell line is commonly used as a model for human granulosa cells, especially since it produces steroid hormones. To explore this further, we identified genes that were differentially expressed by KGN cells compared to primary human granulosa cells using three public RNA sequence datasets. Of significance, we identified that the expression of the antioxidant gene TXNRD1 (thioredoxin reductase 1) was extremely high in KGN cells. This is ominous since cytochrome P450 enzymes leak electrons and produce reactive oxygen species during the biosynthesis of steroid hormones. Gene Ontology (GO) analysis identified steroid biosynthetic and cholesterol metabolic processes were more active in primary granulosa cells, whilst in KGN cells, DNA processing, chromosome segregation and kinetochore pathways were more prominent. Expression of cytochrome P450 cholesterol side-chain cleavage (CYP11A1) and cytochrome P450 aromatase (CYP19A1), which are important for the biosynthesis of the steroid hormones progesterone and oestrogen, plus their electron transport chain members (FDXR, FDX1, POR) were measured in cultured KGN cells. KGN cells were treated with 1 mM dibutyryl cAMP (dbcAMP) or 10 μM forskolin, with or without siRNA knockdown of TXNRD1. We also examined expression of antioxidant genes, H2O2 production by Amplex Red assay and DNA damage by γH2Ax staining. Significant increases in CYP11A1 and CYP19A1 were observed by either dbcAMP or forskolin treatments. However, no significant changes in H2O2 levels or DNA damage were found. Knockdown of expression of TXNRD1 by siRNA blocked the stimulation of expression of CYP11A1 and CYP19A1 by dbcAMP. Thus, with TXNRD1 playing such a pivotal role in steroidogenesis in the KGN cells and it being so highly overexpressed, we conclude that KGN cells might not be the most appropriate model of primary granulosa cells for studying the interplay between ovarian steroidogenesis, reactive oxygen species and antioxidants.

DCC
Also flagged:Acute kidney injurychronic kidney diseasenucleus-nuclear factor κBbinding
Journal Article 2024-08-07 ✓ 2 Snippets Muto Y, Dixon EE, Yoshimura Y, Ledru N, Kirita Y, Wu H, Humphreys BD.
In-Text Gene Mentions

…in injured PTCs),DCC, FKBP5 ,…

…( VCAM1 +/DCC+), proliferating (…

Show Full Abstract

Acute kidney injury (AKI) causes epithelial damage followed by subsequent repair. While successful repair restores kidney function, this process is often incomplete and can lead to chronic kidney disease (CKD) in a process called failed repair. To better understand the epigenetic reprogramming driving this AKI-to-CKD transition, we generated a single-nucleus multiomic atlas for the full mouse AKI time course, consisting of ~280,000 single-nucleus transcriptomes and epigenomes. We reveal cell-specific dynamic alterations in gene regulatory landscapes reflecting, especially, activation of proinflammatory pathways. We further generated single-nucleus multiomic data from four human AKI samples including validation by genome-wide identification of nuclear factor κB binding sites. A regularized regression analysis identifies key regulators involved in both successful and failed repair cell fate, identifying the transcription factor CREB5 as a regulator of both successful and failed tubular repair that also drives proximal tubular cell proliferation after injury. Our interspecies multiomic approach provides a foundation to comprehensively understand cell states in AKI.

OLFM4
Also flagged:KAT2AKAT2BinterferonAcetylmitochondriamitochondrial
Journal Article 2024-08-07 ✓ 3 Snippets Nguyen MU, Iqbal J, Potgieter S, Huang W, Pfeffer J, Woo S, Zhao C, Lawlor M, Yang R, Rizly R, Halstead A, Dent S, Sáenz JB, Zheng H, Yuan ZF, Sidoli S, Ellison CE, P Verzi M.
In-Text Gene Mentions

…marker olfactomedin 4 (OLFM4) and proliferation marker…

…stem cell markerOLFM4in Kat2 DKO…

…transcript levels forOlfm4and Mki67 decreased…

Show Full Abstract

Histone acetyltransferases <i>KAT2A</i> and <i>KAT2B</i> are paralogs highly expressed in the intestinal epithelium, but their functions are not well understood. In this study, double knockout of murine <i>Kat2</i> genes in the intestinal epithelium was lethal, resulting in robust activation of interferon signaling and interferon-associated phenotypes including the loss of intestinal stem cells. Use of pharmacological agents and sterile organoid cultures indicated a cell-intrinsic double-stranded RNA trigger for interferon signaling. Acetyl-proteomics and sequencing of immunoprecipitated double-stranded RNA were used to interrogate the mechanism behind this response, which identified mitochondria-encoded double-stranded RNA as the source of intrinsic interferon signaling. <i>Kat2a</i> and <i>Kat2b</i> therefore play an essential role in regulating mitochondrial functions and maintaining intestinal health.

Also flagged:neoplastic diseaseKillerCD4inflammatory responseinfectionautoimmune diseases
Journal Article 2024-08-07 No Snippets Poisner H, Faucon A, Cox N, Bick AG.
Show Full Abstract

T-cells play a critical role in multiple aspects of human health and disease. However, to date the genetic determinants of human T-cell abundance have not been studied at scale because assays quantifying T-cell abundance are not widely used in clinical or research settings. The complete blood count clinical assay quantifies lymphocyte abundance which includes T-cells, B-cells, and NK-cells. To address this gap, we directly estimate T-cell fractions from whole genome sequencing data in over 200,000 individuals from the multi-ethnic TOPMed and All of Us studies. We identified 27 loci associated with T-cell fraction. Interrogating electronic health records identified clinical phenotypes associated with T-cell fraction, including notable changes in T-cell proportions that were highly dynamic over the course of pregnancy. In summary, by estimating T-cell fraction, we obtained new insights into the genetic regulation of T-cells and identified disease consequences of T-cell fractions across the human phenome.

HFE
Also flagged:copperIronradiocarbonADX-chromosomemitochondrial
Journal Article 2024-08-07 ✓ 3 Snippets Alves I, Giemza J, Blum MGB, Bernhardsson C, Chatel S, Karakachoff M, Saint Pierre A, Herzig AF, Olaso R, Monteil M, Gallien V, Cabot E, Svensson E, Bacq D, Baron E, Berthelier C, Besse C, Blanché H, Bocher O, Boland A, Bonnaud S, Charpentier E, Dandine-Roulland C, Férec C, Fruchet C, Lecointe S, Le Floch E, Ludwig TE, Marenne G, Meyer V, Quellery E, Racimo F, Rouault K, Sandron F, Schott JJ, Velo-Suarez L, Violleau J, Willerslev E, Coativy Y, Jézéquel M, Le Bris D, Nicolas C, Pailler Y, Goldberg M, Zins M, Le Marec H, Jakobsson M, Darlu P, Génin E, Deleuze JF, Redon R, Dina C.
In-Text Gene Mentions

…with cystic fibrosis,hemochromatosisand lactase persistence…

…presence of thehemochromatosismutation 57 .…

…those associated withhemochromatosis, cystic fibrosis and…

Show Full Abstract

The demographical history of France remains largely understudied despite its central role toward understanding modern population structure across Western Europe. Here, by exploring publicly available Europe-wide genotype datasets together with the genomes of 3234 present-day and six newly sequenced medieval individuals from Northern France, we found extensive fine-scale population structure across Brittany and the downstream Loire basin and increased population differentiation between the northern and southern sides of the river Loire, associated with higher proportions of steppe vs. Neolithic-related ancestry. We also found increased allele sharing between individuals from Western Brittany and those associated with the Bell Beaker complex. Our results emphasise the need for investigating local populations to better understand the distribution of rare (putatively deleterious) variants across space and the importance of common genetic legacy in understanding the sharing of disease-related alleles between Brittany and people from western Britain and Ireland.

HTT
Also flagged:ADAM10TrkBHDproteolysissynaptic cell adhesion proteinN-Cadherin
Journal Article 2024-08-07 ✓ 5 Snippets Scolz A, Vezzoli E, Villa M, Talpo F, Cazzola J, Raffin F, Cordiglieri C, Falqui A, Pepe G, Maglione V, Besusso D, Biella G, Zuccato C.
In-Text Gene Mentions

…the huntingtin (HTT) gene experience…

…binding partner ofHTTat the synapse…

…reported that wild-typeHTTbinds to active…

…of the humanHTTpromoter, as described…

…zQ175 heterozygous mutantHTTknock-in mice (F…

Show Full Abstract

Synaptic dysfunction is an early pathogenic event leading to cognitive decline in Huntington's disease (HD). We previously reported that the active ADAM10 level is increased in the HD cortex and striatum, causing excessive proteolysis of the synaptic cell adhesion protein N-Cadherin. Conversely, ADAM10 inhibition is neuroprotective and prevents cognitive decline in HD mice. Although the breakdown of cortico-striatal connection has been historically linked to cognitive deterioration in HD, dendritic spine loss and long-term potentiation (LTP) defects identified in the HD hippocampus are also thought to contribute to the cognitive symptoms of the disease. The aim of this study is to investigate the contribution of ADAM10 to spine pathology and LTP defects of the HD hippocampus. We provide evidence that active ADAM10 is increased in the hippocampus of two mouse models of HD, leading to extensive proteolysis of N-Cadherin, which has a widely recognized role in spine morphology and synaptic plasticity. Importantly, the conditional heterozygous deletion of ADAM10 in the forebrain of HD mice resulted in the recovery of spine loss and ultrastructural synaptic defects in CA1 pyramidal neurons. Meanwhile, normalization of the active ADAM10 level increased the pool of synaptic BDNF protein and activated ERK neuroprotective signaling in the HD hippocampus. We also show that the ADAM10 inhibitor GI254023X restored LTP defects and increased the density of mushroom spines enriched with GluA1-AMPA receptors in HD hippocampal neurons. Notably, we report that administration of the TrkB antagonist ANA12 to HD hippocampal neurons reduced the beneficial effect of GI254023X, indicating that the BDNF receptor TrkB contributes to mediate the neuroprotective activity exerted by ADAM10 inhibition in HD. Collectively, these findings indicate that ADAM10 inhibition coupled with TrkB signaling represents an efficacious strategy to prevent hippocampal synaptic plasticity defects and cognitive dysfunction in HD.

CACNA1E
Also flagged:Colorectal carcinomacancercancerstumoursHLAcolorectal cancers
Journal Article 2024-08-07 ✓ 1 Snippet Cornish AJ, Gruber AJ, Kinnersley B, Chubb D, Frangou A, Caravagna G, Noyvert B, Lakatos E, Wood HM, Thorn S, Culliford R, Arnedo-Pac C, Househam J, Cross W, Sud A, Law P, Leathlobhair MN, Hawari A, Woolley C, Sherwood K, Feeley N, Gül G, Fernandez-Tajes J, Zapata L, Alexandrov LB, Murugaesu N, Sosinsky A, Mitchell J, Lopez-Bigas N, Quirke P, Church DN, Tomlinson IPM, Sottoriva A, Graham TA, Wedge DC, Houlston RS.
In-Text Gene Mentions

…missense change inCACNA1E(p.Ile95Leu); these exhibited…

Show Full Abstract

Colorectal carcinoma (CRC) is a common cause of mortality<sup>1</sup>, but a comprehensive description of its genomic landscape is lacking<sup>2-9</sup>. Here we perform whole-genome sequencing of 2,023 CRC samples from participants in the UK 100,000 Genomes Project, thereby providing a highly detailed somatic mutational landscape of this cancer. Integrated analyses identify more than 250 putative CRC driver genes, many not previously implicated in CRC or other cancers, including several recurrent changes outside the coding genome. We extend the molecular pathways involved in CRC development, define four new common subgroups of microsatellite-stable CRC based on genomic features and show that these groups have independent prognostic associations. We also characterize several rare molecular CRC subgroups, some with potential clinical relevance, including cancers with both microsatellite and chromosomal instability. We demonstrate a spectrum of mutational profiles across the colorectum, which reflect aetiological differences. These include the role of Escherichia coli<sup>pks+</sup> colibactin in rectal cancers<sup>10</sup> and the importance of the SBS93 signature<sup>11-13</sup>, which suggests that diet or smoking is a risk factor. Immune-escape driver mutations<sup>14</sup> are near-ubiquitous in hypermutant tumours and occur in about half of microsatellite-stable CRCs, often in the form of HLA copy number changes. Many driver mutations are actionable, including those associated with rare subgroups (for example, BRCA1 and IDH1), highlighting the role of whole-genome sequencing in optimizing patient care.

Also flagged:esophageal adenocarcinomaBEgene expressionkeratinkeratin 14KRT14
Journal Article 2024-08-07 No Snippets Fu Y, Agrawal S, Snyder DR, Yin S, Zhong N, Grunkemeyer JA, Dietz N, Corlett R, Hansen LA, Waddah AR, Nandipati KC, Xia J.
Show Full Abstract

The incidence of esophageal adenocarcinoma (EAC) has surged by 600% in recent decades, with a dismal 5-year survival rate of just 15%. Barrett's esophagus (BE), affecting about 2% of the population, raises the risk of EAC by 40-fold. Despite this, the transcriptomic changes during the BE to EAC progression remain unclear. Our study addresses this gap through comprehensive transcriptomic profiling to identify key mRNA signatures and genomic alterations, such as gene fusions. We performed RNA-sequencing on BE and EAC tissues from 8 individuals, followed by differential gene expression, pathway and network analysis, and gene fusion prediction. We identified mRNA changes during the BE-to-EAC transition and validated our results with single-cell RNA-seq datasets. We observed upregulation of keratin family members in EAC and confirmed increased levels of keratin 14 (KRT14) using immunofluorescence. More differentiated BE marker genes are downregulated during progression to EAC, suggesting undifferentiated BE subpopulations contribute to EAC. We also identified several gene fusions absent in paired BE and normal esophagus but present in EAC. Our findings are critical for the BE-to-EAC transition and have the potential to promote early diagnosis, prevention, and improved treatment strategies for EAC.

HTT
Also flagged:HuntingtinHDBDNFCreb1pathogenesisneurodegenerative disorder
Journal Article 2024-08-07 ✓ 5 Snippets Nateghi B, Keraudren R, Boulay G, Bazin M, Goupil C, Canet G, Loiselle A, St-Amour I, Planel E, Soulet D, Hébert SS.
In-Text Gene Mentions

Huntington's disease (HD) is a rare genetic neurodegenerative disorder caused by an expansion of CAG repeats in the Huntingtin (HTT) gene.

One hypothesis suggests that the mutant HTT gene contributes to HD neuropathology through transcriptional dysregulation involving microRNAs (miRNAs).

Surprisingly, miR-132/212 loss seemed to alleviate, in part, the effects on endogenous Htt expression, HTT inclusions, and neuronal integrity in HD zQ175 mice.

…in the Huntingtin (HTT) gene.…

…that the mutantHTTgene contributes to…

Show Full Abstract

Huntington's disease (HD) is a rare genetic neurodegenerative disorder caused by an expansion of CAG repeats in the Huntingtin (HTT) gene. One hypothesis suggests that the mutant HTT gene contributes to HD neuropathology through transcriptional dysregulation involving microRNAs (miRNAs). In particular, the miR-132/212 cluster is strongly diminished in the HD brain. This study explores the effects of miR-132/212 deficiency specifically in adult HD zQ175 mice. The absence of miR-132/212 did not impact body weight, body temperature, or survival rates. Surprisingly, miR-132/212 loss seemed to alleviate, in part, the effects on endogenous Htt expression, HTT inclusions, and neuronal integrity in HD zQ175 mice. Additionally, miR-132/212 depletion led to age-dependent improvements in certain motor functions. Transcriptomic analysis revealed alterations in HD-related networks in WT- and HD zQ175-miR-132/212-deficient mice, including significant overlap in BDNF and Creb1 signaling pathways. Interestingly, however, a higher number of miR-132/212 gene targets was observed in HD zQ175 mice lacking the miR-132/212 cluster, especially in the striatum. These findings suggest a nuanced interplay between miR-132/212 expression and HD pathogenesis, providing potential insights into therapeutic interventions. Further investigation is needed to fully understand the underlying mechanisms and therapeutic potential of modulating miR-132/212 expression during HD progression.

HFE
Also flagged:irongastrointestinal diseasesiron deficiency anemialiver cancerceliac diseasenon-alcoholic fatty liver disease
Journal Article 2024-08-07 ✓ 4 Snippets Su T, Peng X, Gan Y, Wu H, Ma S, Zhi M, Lu Y, Dai S, Yao J.
In-Text Gene Mentions

…rs1800562 in theHFEgene, commonly referred…

…severe manifestation ofHemochromatosis.…

…that individuals withHFEC282Y polymorphisms may…

…A 2016 meta-analysis conducted by Qing et al. found evidence suggesting that individuals withHFEC282Y polymorphisms may have a higher genetic predisposition to developing NAFLD and liver cancer, while the risk of cirrhosis does not appear to be affected ( Ye et al., 2016 ).…

Show Full Abstract

<h4>Background</h4>Iron status has been implicated in gastrointestinal diseases and gut microbiota, however, confounding factors may influence these associations.<h4>Objective</h4>We performed Mendelian randomization (MR) to investigate the associations of iron status, including blood iron content, visceral iron content, and iron deficiency anemia with the incidence of 24 gastrointestinal diseases and alterations in gut microbiota.<h4>Methods</h4>Independent genetic instruments linked with iron status were selected using a genome-wide threshold of <i>p</i> = 5 × 10-6 from corresponding genome-wide association studies. Genetic associations related to gastrointestinal diseases and gut microbiota were derived from the UK Biobank, the FinnGen study, and other consortia.<h4>Results</h4>Genetically predicted higher levels of iron and ferritin were associated with a higher risk of liver cancer. Higher levels of transferrin saturation were linked to a decreased risk of celiac disease, but a higher risk of non-alcoholic fatty liver disease (NAFLD) and liver cancer. Higher spleen iron content was linked to a lower risk of pancreatic cancer. Additionally, higher levels of liver iron content were linked to a higher risk of NAFLD and liver cancer. However, certain associations lost their statistical significance upon accounting for the genetically predicted usage of cigarettes and alcohol. Then, higher levels of iron and ferritin were associated with 11 gut microbiota abundance, respectively. In a secondary analysis, higher iron levels were associated with lower diverticular disease risk and higher ferritin levels with increased liver cancer risk. Higher levels of transferrin saturation were proven to increase the risk of NAFLD, alcoholic liver disease, and liver cancer, but decrease the risk of esophageal cancer. MR analysis showed no mediating relationship among iron status, gut microbiota, and gastrointestinal diseases.<h4>Conclusion</h4>This study provides evidence suggesting potential causal associations of iron status with gastrointestinal diseases and gut microbiota, especially liver disease.

Also flagged:breast cancercancerdeathBRCA1infectionsHPV infection
Journal Article 2024-08-07 No Snippets Bumrungthai S, Duangjit S, Passorn S, Pongpakdeesakul S, Butsri S, Janyakhantikul S.
Show Full Abstract

Breast cancer is the most prevalent cancer and also the leading cause of cancer death in women worldwide. A comprehensive understanding of breast cancer risk factors and their incidences is useful information for breast cancer prevention and control planning. The present study aimed to provide information on single nucleotide polymorphisms (SNPs) and copy number variations (CNVs) in breast cancer, the allele frequency of two SNPs in breast cancer-related genes BRCA1 DNA repair associated (<i>BRCA1;</i> rs799917) and ATP binding cassette subfamily G member 2 (<i>ABCG2;</i> rs2231142), and the prevalence of human papillomavirus (HPV) infections in a normal population living in Phayao Province, Northern Thailand. One breast cancer and 10 healthy samples were investigated by whole exome sequencing (WES) and compared for genetic variation. The WES data contained SNPs in genes previously implicated in breast cancer and provided data on CNVs. The allele frequencies for SNPs rs799917 and rs2231142 were also examined. The SNP genotype frequencies were 35.88% CC, 46.54% CT, and 17.58% TT for rs799917 and 33.20% CC, 46.88% CA, and 19.92% AA for rs2231142. A total of 825 human whole blood samples were examined for HPV infection by PCR, and the pooled DNA was tested for HPV infection using metagenomic sequencing. No HPV infections were detected among all 825 samples or the pooled blood samples. The incidence of breast cancer among the tested samples was estimated based on acceptable breast cancer risk factors and demographic data and was 1.47%. The present study provided data on SNPs and CNVs in breast cancer-related genes. The associations between SNPs rs2231142 and rs799917 and breast cancer should be further investigated in a case-control study since heterozygous and homozygous variants are more common. Based on the detection of HPV infection in the blood samples, HPV may not be associated with breast cancer, at least in the Northern Thai population.

HFE
Also flagged:Liver Cancermetabolismhemebiosynthesisprotoporphyrintumor
Journal Article 2024-08-07 ✓ 1 Snippet Adapa SR, Meshram P, Sami A, Jiang RHY.
In-Text Gene Mentions

…Wilson’s disease andhemochromatosiscan disrupt heme…

Show Full Abstract

The liver, a pivotal organ in human metabolism, serves as a primary site for heme biosynthesis, alongside bone marrow. Maintaining precise control over heme production is paramount in healthy livers to meet high metabolic demands while averting potential toxicity from intermediate metabolites, notably protoporphyrin IX. Intriguingly, our recent research uncovers a disrupted heme biosynthesis process termed 'porphyrin overdrive' in cancers that fosters the accumulation of heme intermediates, potentially bolstering tumor survival. Here, we investigate heme and porphyrin metabolism in both healthy and oncogenic human livers, utilizing primary human liver transcriptomics and single-cell RNA sequencing (scRNAseq). Our investigations unveil robust gene expression patterns in heme biosynthesis in healthy livers, supporting electron transport chain (ETC) and cytochrome P450 function without intermediate accumulation. Conversely, liver cancers exhibit rewired heme biosynthesis and a massive downregulation of cytochrome P450 gene expression. Notably, despite diminished drug metabolism, gene expression analysis shows that heme supply to the ETC remains largely unaltered or even elevated with patient cancer progression, suggesting a metabolic priority shift. Liver cancers selectively accumulate intermediates, which are absent in normal tissues, implicating their role in disease advancement as inferred by expression analysis. Furthermore, our findings in genomics establish a link between the aberrant gene expression of porphyrin metabolism and inferior overall survival in aggressive cancers, indicating potential targets for clinical therapy development. We provide in vitro proof-of-concept data on targeting porphyrin overdrive with a drug synergy strategy.

Also flagged:toECM proteinsLOXL1locomotionmetabolismangiogenesis
Journal Article 2024-08-07 No Snippets Pattamaprapanont P, Cooney EM, MacDonald TL, Paulo JA, Pan H, Dreyfuss JM, Lessard SJ.
Show Full Abstract

Skeletal muscle has a unique ability to remodel in response to stimuli such as contraction and aerobic exercise training. Phenotypic changes in muscle that occur with training such as a switch to a more oxidative fiber type, and increased capillary density contribute to the well-known health benefits of aerobic exercise. The muscle matrisome likely plays an important role in muscle remodeling with exercise. However, due to technical limitations in studying muscle ECM proteins, which are highly insoluble, little is known about the muscle matrisome and how it contributes to muscle remodeling. Here, we utilized two-fraction methodology to extract muscle proteins, combined with multiplexed tandem mass tag proteomic technology to identify 161 unique ECM proteins in mouse skeletal muscle. In addition, we demonstrate that aerobic exercise training induces remodeling of a significant proportion of the muscle matrisome. We performed follow-up experiments to validate exercise-regulated ECM targets in a separate cohort of mice using Western blotting and immunofluorescence imaging. Our data demonstrate that changes in several key ECM targets are strongly associated with muscle remodeling processes such as increased capillary density in mice. We also identify LOXL1 as a novel muscle ECM target associated with aerobic capacity in humans. In addition, publically available data and databases were used for in silico modeling to determine the likely cellular sources of exercise-induced ECM remodeling targets and identify ECM interaction networks. This work greatly enhances our understanding of ECM content and function in skeletal muscle and demonstrates an important role for ECM remodeling in the adaptive response to exercise. The raw MS data have been deposited to the ProteomeXchange with identifier PXD053003.

Also flagged:5-FluorouracilColorectal CancerNEAT1Gene Expressioncancercell growth
Journal Article 2024-08-07 No Snippets Sahebnasagh R, Azizi Z, Komeili-Movahhed T, Zendehdel K, Ghahremani MH.
Show Full Abstract

Background Acquired resistance to 5-fluorouracil (5-FU) frequently results in chemotherapy failure and disease recurrence in advanced colorectal cancer (CRC) patients. Research has demonstrated that dysregulation of long non-coding RNAs (lncRNAs) mediates the development of chemotherapy resistance in cancerous cells. The present study aims to identify key lncRNAs associated with 5-FU resistance in CRC using bioinformatic and experimental validation approaches. Methods The Gene Expression Omnibus (GEO) dataset GSE119481, which contains miRNA expression profiles of the parental CRC HCT116 cell line (HCT116/P) and its in-vitro established 5-FU-resistant sub-cell line (HCT116/FUR), was downloaded. Firstly, differentially expressed microRNAs (DEmiRNAs) between the parental and 5-FU resistance cells were identified. LncRNAs and mRNAs were then predicted using online databases. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed to uncover relevant biological mechanisms and pathways. Networks integrating lncRNAs, miRNAs, and mRNAs interactions were constructed, and topological analyses were used to identify key lncRNAs associated with 5-FU resistance. An in-vitro model of the HCT116/FUR sub-cell line was developed by exposing the HCT116/P cell line to increasing concentrations of 5-FU. Finally, real-time quantitative PCR (RT-qPCR) was performed on total RNA extracted from the HCT116/P cell line and the HCT116/FUR sub-cell line to validate the in-silico predictions of key lncRNAs. Results A total of 32 DEmiRNAs were identified. Enrichment analysis demonstrated that these DEmiRNAs were mainly enriched in several cancer hallmark pathways that regulate cell growth, cell cycle, cell survival, inflammation, immune response, and apoptosis. The predictive analysis identified 237 unique lncRNAs and 123 mRNAs interacting with these DEmiRNAs. The pathway analysis indicated that most of these predicted genes were enriched in the cellular response to starvation, protein polyubiquitination, chromatin remodeling, and negative regulation of gene expression. Topological analyses of the lncRNA-miRNA-mRNA network highlighted the nuclear enriched abundant transcript 1 (NEAT1), metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), and Opa interacting protein 5 antisense RNA 1 (OIP5-AS1) as central lncRNAs. Experimental analysis by RT-qPCR confirmed that the expression levels of NEAT1 and MALAT1 were significantly increased in HCT116/FUR cells compared to HCT116/P cells. However, no significant difference was observed in the OIP5-AS1 expression level between the two cells. Conclusion Our findings specifically highlight MALAT1 and NEAT1 as significant contributors to 5-FU resistance in CRC. These lncRNAs are promising biomarkers for diagnosing and predicting outcomes in CRC.

OLFM4
Also flagged:agingGene expressionmitochondrialCCR2cell proliferationembryogenesis
Journal Article 2024-08-07 ✓ 1 Snippet O'Sell J, Cirulli V, Pardike S, Aare-Bentsen M, Sdek P, Anderson J, Hailey DW, Regier MC, Gharib SA, Crisa L.
In-Text Gene Mentions

…on mitochondrial (e.g.,Olfm4) 29 and…

Show Full Abstract

Perinatal expansion of pancreatic β cells is critical to metabolic adaptation. Yet, mechanisms surveying the fidelity by which proliferative events generate functional β cell pools remain unknown. We have previously identified a CCR2<sup>+</sup> myeloid niche required for peri-natal β cell replication, with β cells dynamically responding to loss and repopulation of these myeloid cells with growth arrest and rebound expansion, respectively. Here, using a timed single-cell RNA-sequencing approach, we show that transient disruption of perinatal CCR2<sup>+</sup> macrophages change islet β cell repertoires in young mice to resemble those of aged mice. Gene expression profiling and functional assays disclose prominent mitochondrial defects in β cells coupled to impaired redox states, NAD depletion, and DNA damage, leading to accelerated islets' dysfunction with age. These findings reveal an unexpected vulnerability of mitochondrial β cells' bioenergetics to the disruption of perinatal CCR2<sup>+</sup> macrophages, implicating these cells in surveying early in life both the size and energy homeostasis of β cells populations.

MLLT10
Also flagged:Childhood canceracute myeloid leukemiacancerAMLmarrowfebrile neutropenia
Journal Article 2024-08-07 ✓ 1 Snippet Wijnen N, Klootwijk L, Gichemi A, Apadet L, Njuguna F, Klein K, Huibers M, Goemans BF, Mostert S, Kaspers G.
In-Text Gene Mentions

…A KMT2A-MLLT10fusion was detected…

Show Full Abstract

Annually, over 400,000 children develop cancer, with the majority living in low- and middle-income countries (LMICs). Survival rates in high-income countries (HICs; ≥ 75%-80%) significantly exceed those in LMICs (< 30%). Acute myeloid leukemia (AML) is a childhood cancer with high mortality rates in LMICs and is not included in the World Health Organization (WHO)'s 'six common and curable types of cancer'. This case report explores two pediatric AML cases in Kenya (LMIC) and the Netherlands (HIC), highlighting differences and similarities in both patient journeys. The first case is a 15-year-old Kenyan boy who initially experienced dizziness and fatigue. After repeated blood transfusions without a definitive diagnosis, AML was confirmed via bone marrow aspiration (BMA) 63 days later, and treatment followed the SIOP PODC AML guidelines for LMICs. The second case is a 6-year-old Dutch boy with fatigue and malaise. Initially diagnosed with post-viral bone marrow failure, a BMA performed 61 days after symptom onset revealed AML, and treatment followed the NOPHO-DBH AML-2012 protocol. Both patients faced frequent febrile neutropenia, managed per local guidelines, illustrating the balance between anti-cancer treatment and supportive care. Despite challenges, both boys completed treatment and are in complete remission. This case series highlights the potential for effective AML treatment in resource-constrained settings and underscores the need to address cancers beyond the 'six common and curable types'.

DCC
Also flagged:chromosomechromosomespolymerasenucleotidesagarosewater
Journal Article 2024-08-07 ✓ 5 Snippets Herbert AL, Lee D, McCoy MJ, Behrens VC, Wucherpfennig JI, Kingsley DM.
In-Text Gene Mentions

…Colorectal Cancer (DCC), which is…

…the Netrin-1 receptorDCC.…

…In humans, theDCCgene is known…

…or loss ofDCCexpression found in…

…Importantly,DCCcan regulate apoptosis…

Show Full Abstract

The genetic mechanisms underlying striking axial patterning changes in wild species are still largely unknown. Previous studies have shown that <i>Apeltes quadracus</i> fish, commonly known as fourspine sticklebacks, have evolved multiple different axial patterns in wild populations. Here, we revisit classic locations in Nova Scotia, Canada, where both high-spined and low-spined morphs are particularly common. Using genetic crosses and quantitative trait locus (QTL) mapping, we examine the genetic architecture of wild differences in several axial patterning traits, including the number and length of prominent dorsal spines, the number of underlying median support bones (pterygiophores), and the number and ratio of abdominal and caudal vertebrae along the anterior-posterior body axis. Our studies identify a highly significant QTL on chromosome 6 that controls a substantial fraction of phenotypic variation in multiple dorsal spine and pterygiophore traits (~15%-30% variance explained). An additional smaller-effect QTL on chromosome 14 contributes to the lengths of both the last dorsal spine and anal spine (~9% variance explained). 1 or no QTL were detected for differences in the numbers of abdominal and caudal vertebrae. The major-effect patterning QTL on chromosome 6 is centered on the <i>HOXDB</i> gene cluster, where sequence changes in a noncoding axial regulatory enhancer have previously been associated with prominent dorsal spine differences in <i>Apeltes</i>. The QTL that have the largest effects on dorsal spine number and length traits map to different chromosomes in <i>Apeltes</i> and <i>Gasterosteus</i>, 2 distantly related stickleback genera. However, in both genera, the major-effect QTL for prominent skeletal changes in wild populations maps to linked clusters of powerful developmental control genes. This study, therefore, bolsters the body of evidence that regulatory changes in developmental gene clusters provide a common genetic mechanism for evolving major morphological changes in natural species.

Also flagged:oxygencarbon dioxideK + channelmembranedepolarizationvesicle
Journal Article 2024-08-06 No Snippets Prange-Barczynska M, Jones HA, Sugimoto Y, Cheng X, Lima JD, Ratnayaka I, Douglas G, Buckler KJ, Ratcliffe PJ, Keeley TP, Bishop T.
Show Full Abstract

The study of transcription factors that determine specialized neuronal functions has provided invaluable insights into the physiology of the nervous system. Peripheral chemoreceptors are neurone-like electrophysiologically excitable cells that link the oxygen concentration of arterial blood to the neuronal control of breathing. In the adult, this oxygen chemosensitivity is exemplified by type I cells of the carotid body, and recent work has revealed one isoform of the hypoxia-inducible transcription factor (HIF), HIF-2α, as having a nonredundant role in the development and function of that organ. Here, we show that activation of HIF-2α, including isolated overexpression of HIF-2α but not HIF-1α, is sufficient to induce oxygen chemosensitivity in adult adrenal medulla. This phenotypic change in the adrenal medulla was associated with retention of extra-adrenal paraganglioma-like tissues resembling the fetal organ of Zuckerkandl, which also manifests oxygen chemosensitivity. Acquisition of chemosensitivity was associated with changes in the adrenal medullary expression of gene classes that are ordinarily characteristic of the carotid body, including G protein regulators and atypical subunits of mitochondrial cytochrome oxidase. Overall, the findings suggest that, at least in certain tissues, HIF-2α acts as a phenotypic driver for cells that display oxygen chemosensitivity, thus linking 2 major oxygen-sensing systems.

Also flagged:type 2 diabetesnon-alcoholic fatty liver diseaseNAFLDmetabolic disordersGene Expressionsignal transduction
Journal Article 2024-08-06 No Snippets Chen C, Yang K, Zhang Y, Lu M, Zhao X, Wan Z.
Show Full Abstract

<h4>Background</h4>Type 2 diabetes (T2D) and non-alcoholic fatty liver disease (NAFLD) are prevalent metabolic disorders with overlapping pathophysiological mechanisms. A comprehensive understanding of the shared molecular pathways involved in these conditions can advance the development of effective therapeutic interventions.<h4>Methods</h4>We used two datasets sourced from the Gene Expression Omnibus (GEO) database to identify common differentially expressed genes (DEGs) between T2D and NAFLD. Subsequently, we conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses to identify the enriched biological processes and signaling pathways. In addition, we performed a protein-protein interaction (PPI) network analysis to identify hub genes with pivotal roles. To validate our findings, we established a type 2 diabetic mouse model with NAFLD.<h4>Results</h4>Our analysis identified 53 DEGs shared between T2D and NAFLD. Enrichment analysis revealed their involvement in signal transduction, transcriptional regulation, and cell proliferation as well as in the ferroptosis signaling pathways. PPI network analysis identified ten hub genes, namely CD44, CASP3, FYN, KLF4, HNRNPM, HNRNPU, FUBP1, RUNX1, NOTCH3, and ANXA2. We validated the differential expression of FYN, HNRNPU, and FUBP1 in liver tissues of a type 2 diabetic mouse model with NAFLD.<h4>Conclusions</h4>Our study offers valuable insights into the shared molecular mechanisms underlying T2D and NAFLD. The identified hub genes and pathways present promising prospects as therapeutic targets to address these prevalent metabolic disorders.

Also flagged:Autophagylysosomeorganellesneurodegenerative diseaseslysosomesAlzheimer disease
Journal Article 2024-08-06 No Snippets Nixon RA, Rubinsztein DC.
Show Full Abstract

Autophagy is a lysosome-based degradative process used to recycle obsolete cellular constituents and eliminate damaged organelles and aggregate-prone proteins. Their postmitotic nature and extremely polarized morphologies make neurons particularly vulnerable to disruptions caused by autophagy-lysosomal defects, especially as the brain ages. Consequently, mutations in genes regulating autophagy and lysosomal functions cause a wide range of neurodegenerative diseases. Here, we review the role of autophagy and lysosomes in neurodegenerative diseases such as Alzheimer disease, Parkinson disease and frontotemporal dementia. We also consider the strong impact of cellular ageing on lysosomes and autophagy as a tipping point for the late-age emergence of related neurodegenerative disorders. Many of these diseases have primary defects in autophagy, for example affecting autophagosome formation, and in lysosomal functions, especially pH regulation and calcium homeostasis. We have aimed to provide an integrative framework for understanding the central importance of autophagic-lysosomal function in neuronal health and disease.

Also flagged:Hydroxyapatitetitaniumcrystal violetcell proliferationZirconiumzirconium oxide
Journal Article 2024-08-06 No Snippets Ji MK, Chun Y, Jeong G, Kim HS, Kim WJ, Ryu JH, Cho H, Lim HP.
Show Full Abstract

<h4>Purpose</h4>This study aimed to confirm the synergy effect of these two materials by evaluating osteoblast and antibacterial activity by applying a double-layered hydroxyapatite(HA) zirconium oxide(ZrO<sub>2</sub>) coating to titanium.<h4>Methods</h4>The specimens used in this study were divided into four groups: a control group (polished titanium; group T) and three experimental groups: Group TH (RF magnetron sputtered HA deposited titanium), Group Z (ZrO<sub>2</sub> ALD deposited titanium), and Group ZH (RF magnetron sputtered HA and ZrO<sub>2</sub> ALD deposited titanium). The adhesion of <i>Streptococcus mutans</i> (<i>S.mutans</i>) to the surface was assessed using a crystal violet assay. The adhesion, proliferation, and differentiation of MC3T3-E1 cells, a mouse osteoblastic cell line, were assessed through a WST-8 assay and ALP assay.<h4>Results</h4>Group Z showed a decrease in the adhesion of <i>S. mutans</i> (<i>p</i> < 0.05) and an improvement in osteoblastic viability (<i>p</i> < 0.0083). Group TH and ZH showed a decrease in adhesion of <i>S. mutans</i> (<i>p</i> < 0.05) and an increase in osteoblastic cell proliferation and cell differentiation (<i>p</i> < 0.0083). Group ZH exhibited the highest antibacterial and osteoblastic differentiation.<h4>Conclusion</h4>In conclusion double-layered HA and ZrO<sub>2</sub> deposited on titanium were shown to be more effective in inhibiting the adhesion of <i>S. mutans</i>, which induced biofilm formation, and increasing osteoblastic differentiation involved in osseointegration by the synergistic effect of the two materials.

TNFSF4
Also flagged:Gastric cancercancersolid tumorstumorcell proliferationangiogenesis
Journal Article 2024-08-06 ✓ 2 Snippets Li Y, Cui Y, Wang Z, Wang L, Yu Y, Xiong Y.
In-Text Gene Mentions

…TNSF14, TNFSF18, andTNFSF4were significantly elevated…

…TNSF14, TNFSF18, andTNFSF4) were significantly elevated…

Show Full Abstract

<h4>Introduction</h4>Gastric cancer (GC) remains a major global health threat ranking as the fifth most prevalent cancer. Hypoxia, a characteristic feature of solid tumors, significantly contributes to the malignant progression of GC. Mitochondria are the major target of hypoxic injury that promotes mitochondrial dysfunction during the development of cancers including GC. However, the gene signature and prognostic model based on hypoxia- and mitochondrial dysfunction-related genes (HMDRGs) in the prediction of GC prognosis have not yet been established.<h4>Methods</h4>The gene expression profile datasets of stomach cancer patients were retrieved from The Cancer Genome Atlas and the Gene Expression Omnibus databases. Prognostic genes were selected using Least Absolute Shrinkage and Selection Operator Cox (LASSO-Cox) regression analysis to construct a prognostic model. Immune infiltration was evaluated through ESTIMATE, CIBERSORT, and ssGSEA analyses. Tumor immune dysfunction and exclusion (TIDE) and immunophenoscore (IPS) were utilized to explore implications for immunotherapy. Furthermore, in vitro experiments were conducted to validate the functional roles of HMDRGs in GC cell malignancy.<h4>Results</h4>In this study, five HMDRGs (ZFP36, SERPINE1, DUSP1, CAV1, and AKAP12) were identified for developing a prognostic model in GC. This model stratifies GC patients into high- and low-risk groups based on median risk scores. A nomogram predicting overall survival (OS) was constructed and showed consistent results with observed OS. Immune infiltration analysis indicated that individuals in the high-risk group tend to exhibit increased immune cell infiltration. Additionally, analysis of cancer immunotherapy responses revealed that high-risk group patients exhibit poorer responses to cancer immunotherapy compared to the low-risk group. Immunohistochemistry (IHC) staining indicated that the expression levels of HMDRGs were remarkably correlated with GC, of which, SERPINE1 displayed the most pronounced up-regulation, while ZFP36 exhibited the most notable down-regulation in GC patients. Furthermore, <i>in vitro</i> investigation validated that SERPINE1 and ZFP36 contribute to the malignant processes of GC cells correlated with mitochondrial dysfunction.<h4>Conclusions</h4>This study presents a novel and efficient approach to evaluate GC prognosis and immunotherapy efficacy, and also provides insights into understanding the pathogenesis of GC.

DCC
Also flagged:ADHDanxiety disordersanxiety disorderAttention Deficit Hyperactivity Disorderneurodevelopmental disorderbehavioral
Journal Article 2024-08-06 ✓ 1 Snippet Deng X, Ren H, Wu S, Jie H, Gu C.
In-Text Gene Mentions

…FOXP2, SORCS3, FOXP1,DCC, CDH8, and a…

Show Full Abstract

<h4>Background</h4>ADHD and anxiety disorders often co-occur, sharing symptoms and dysfunctions, yet the underlying mechanisms remain elusive.<h4>Methods</h4>To explore the shared and distinct genetic variations between ADHD and anxiety disorders, we applied Mendelian randomization (MR) analysis to ADHD, anxiety disorders, and three socioeconomic factors: income, educational attainment (EA), and intelligence. MR analysis utilized genome-wide association study summary datasets (anxiety disorder: 7,016 cases and 14,745 controls; ADHD: 38,691 cases and 275,986 controls; EA: 766,345 participants; intelligence: 146,808 participants; household income: 392,422 participants), with inverse-variance weighting as the primary method.<h4>Results</h4>Our MR analysis revealed no discernible genetic-level causal effect between ADHD and anxiety disorders (p > 0.77). Additionally, the independent variables for ADHD (25 SNPs) and anxiety disorders (18 SNPs) did not overlap, highlighting the genetic distinction between the two conditions. Higher income (p < 0.002) and EA (p < 0.005) were found to serve as protective factors for both ADHD and anxiety disorders. Genetic predisposition to higher income (86 SNPs) and EA (457 SNPs) were identified as a potential common protective factors for both conditions. Lastly, genetic predisposition to higher intelligence was found to potentially guard against ADHD (p < 0.001) but not against anxiety disorders (p > 0.55).<h4>Conclusion</h4>Our findings indicate that the shared symptoms observed between ADHD and anxiety disorders are more likely influenced by genetic predispositions related to socioeconomic factors rather than by the genetic predispositions specific to the disorders themselves.

PTGIS
Also flagged:endoplasmic reticulumnon-small cell lung cancercancermetabolismCAV1Lung cancer
Journal Article 2024-08-06 ✓ 1 Snippet Li S, Chen J, Zhou B.
In-Text Gene Mentions

…HighPTGISis associated with…

Show Full Abstract

In recent years, protein homeostasis imbalance caused by endoplasmic reticulum stress has become a major hallmark of cancer. Studies have shown that endoplasmic reticulum stress is closely related to the occurrence, development, and drug resistance of non-small cell lung cancer, however, the role of various endoplasmic reticulum stress-related genes in non-small cell lung cancer is still unclear. In this study, we established an endoplasmic reticulum stress scores based on the Cancer Genome Atlas for non-small cell lung cancer to reflect patient features and predict prognosis. Survival analysis showed significant differences in overall survival among non-small cell lung cancer patients with different endoplasmic reticulum stress scores. In addition, endoplasmic reticulum stress scores was significantly correlated with the clinical features of non-small cell lung cancer patients, and can be served as an independent prognostic indicator. A nomogram based on endoplasmic reticulum stress scores indicated a certain clinical net benefit, while ssGSEA analysis demonstrated that there was a certain immunosuppressive microenvironment in high endoplasmic reticulum stress scores. Gene Set Enrichment Analysis showed that scores was associated with cancer pathways and metabolism. Finally, weighted gene co-expression network analysis displayed that CAV1 was closely related to the occurrence of non-small cell lung cancer. Therefore, in order to further analyze the role of this gene, Chinese non-smoking females were selected as the research subjects to investigate the relationship between CAV1 rs3779514 and susceptibility and prognosis of non-small cell lung cancer. The results showed that the mutation of rs3779514 significantly reduced the risk of non-small cell lung cancer in Chinese non-smoking females, but no prognostic effect was found. In summary, we proposed an endoplasmic reticulum stress scores, which was an independent prognostic factor and indicated immune characteristics in the microenvironment of non-small cell lung cancer. We also validated the relationship between single nucleotide polymorphism locus of core genes and susceptibility to non-small cell lung cancer.

SERPINC1
Also flagged:neurological diseasestransportationcell proliferationnitric oxideinducible NO synthaseiNOS
Journal Article 2024-08-06 ✓ 1 Snippet Salikhova DI, Shedenkova MO, Sudina AK, Belousova EV, Krasilnikova IA, Nekrasova AA, Nefedova ZA, Frolov DA, Fatkhudinov TK, Makarov AV, Surin AM, Savostyanov KV, Goldshtein DV, Bakaeva ZV.
In-Text Gene Mentions

…response: antithrombin III (SERPINC1), galectin-1 (LGALS1), cathep…

Show Full Abstract

Currently, stem cells technology is an effective tool in regenerative medicine. Cell therapy is based on the use of stem/progenitor cells to repair or replace damaged tissues or organs. This approach can be used to treat various diseases, such as cardiovascular, neurological diseases, and injuries of various origins. The mechanisms of cell therapy therapeutic action are based on the integration of the graft into the damaged tissue (replacement effect) and the ability of cells to secrete biologically active molecules such as cytokines, growth factors and other signaling molecules that promote regeneration (paracrine effect). However, cell transplantation has a number of limitations due to cell transportation complexity and immune rejection. A potentially more effective therapy is using only paracrine factors released by stem cells. Secreted factors can positively affect the damaged tissue: promote forming new blood vessels, stimulate cell proliferation, and reduce inflammation and apoptosis. In this work, we have studied the anti-inflammatory and neuroprotective effects of proteins with a molecular weight below 100 kDa secreted by glial progenitor cells obtained from human induced pluripotent stem cells. Proteins secreted by glial progenitor cells exerted anti-inflammatory effects in a primary glial culture model of LPS-induced inflammation by reducing nitric oxide (NO) production through inhibition of inducible NO synthase (iNOS). At the same time, added secreted proteins neutralized the effect of glutamate, increasing the number of viable neurons to control values. This effect is a result of decreased level of intracellular calcium, which, at elevated concentrations, triggers apoptotic death of neurons. In addition, secreted proteins reduce mitochondrial depolarization caused by glutamate excitotoxicity and help maintain higher NADH levels. This therapy can be successfully introduced into clinical practice after additional preclinical studies, increasing the effectiveness of rehabilitation of patients with neurological diseases.

HTT
Also flagged:Circadianneurodegenerative disorderHDsleepcircadian rhythmsdeath
Journal Article 2024-08-06 ✓ 1 Snippet Dell'Angelica D, Singh K, Colwell CS, Ghiani CA.
In-Text Gene Mentions

…region of theHTT(huntingtin) gene providing…

Show Full Abstract

Huntington's Disease (HD) is a neurodegenerative disorder caused by an autosomal-dominant mutation in the huntingtin gene, which manifests with a triad of motor, cognitive and psychiatric declines. Individuals with HD often present with disturbed sleep/wake cycles, but it is still debated whether altered circadian rhythms are intrinsic to its aetiopathology or a consequence. Conversely, it is well established that sleep/wake disturbances, perhaps acting in concert with other pathophysiological mechanisms, worsen the impact of the disease on cognitive and motor functions and are a burden to the patients and their caretakers. Currently, there is no cure to stop the progression of HD, however, preclinical research is providing cementing evidence that restoring the fluctuation of the circadian rhythms can assist in delaying the onset and slowing progression of HD. Here we highlight the application of circadian-based interventions in preclinical models and provide insights into their potential translation in clinical practice. Interventions aimed at improving sleep/wake cycles' synchronization have shown to improve motor and cognitive deficits in HD models. Therefore, a strong support for their suitability to ameliorate HD symptoms in humans emerges from the literature, albeit with gaps in our knowledge on the underlying mechanisms and possible risks associated with their implementation.

Also flagged:ferroptosisrenal diseasesKidney diseasesdeathironlipid
Journal Article 2024-08-06 No Snippets Jiang M, Wu S, Xie K, Zhou G, Zhou W, Bao P.
Show Full Abstract

Kidney diseases are significant global public health concern, with increasing prevalence and substantial economic impact. Developing novel therapeutic approaches are essential for delaying disease progression and improving patient quality of life. Cell death signifying the termination of cellular life, could facilitate appropriate bodily development and internal homeostasis. Recently, regulated cell death (RCD) forms such as ferroptosis, characterized by iron-dependent lipid peroxidation, has garnered attention in diverse renal diseases and other pathological conditions. This review offers a comprehensive examination of ferroptosis, encompassing an analysis of the involvement of iron and lipid metabolism, the System Xc <sup><b>-</b></sup> /glutathione/glutathione peroxidase 4 signaling, and additional associated pathways. Meanwhile, the review delves into the potential of targeting ferroptosis as a therapeutic approach in the management of acute kidney injury (AKI), chronic kidney disease (CKD), diabetic nephropathy, and renal tumors. Furthermore, it emphasizes the significance of ferroptosis in the transition from AKI to CKD and further accentuates the potential for repurposing drug and utilizing traditional medicine in targeting ferroptosis-related pathways for clinical applications. The integrated review provides valuable insights into the role of ferroptosis in kidney diseases and highlights the potential for targeting ferroptosis as a therapeutic strategy.

Also flagged:ferroptosisischemic strokeneurological disordersischemiadeathcuproptosis
Journal Article 2024-08-06 No Snippets Wang J, Lv C, Wei X, Li F.
Show Full Abstract

Ischemic stroke, as one of the most severe and prevalent neurological disorders, poses a significant threat to the health and quality of life of affected individuals. Stemming from the obstruction of blood flow, ischemic stroke, leads to cerebral tissue hypoxia and ischemia, instigating a cascade of pathophysiological changes that markedly exacerbate neuronal damage and may even culminate in cell death. In recent years, emerging research has increasingly focused on novel cell death mechanisms such as ferroptosis and cuproptosis. Mounting evidence underscores the independent roles of ferroptosis and cuproptosis in ischemic stroke. This review aims to elucidate potential cross-regulatory mechanisms between ferroptosis and cuproptosis, exploring their regulatory roles in ischemic stroke. The objective is to provide targeted therapeutic intervention strategies.

SOX6
Also flagged:Extracellular VesiclesInsulin resistanceglucosemetabolic diseasesinsulinsecretion
Journal Article 2024-08-06 ✓ 1 Snippet Xu F, Dou L, Yu D, Wu X, Liu L, Man Y, Huang X.
In-Text Gene Mentions

Sox6 SRYSRY…

Show Full Abstract

Insulin resistance is the primary contributor to the disruption in glucose homeostasis in the body, playing a significant causative role in many metabolic diseases. Insulin resistance is characterized by compensatory insulin secretion and reduced insulin responsiveness in target organs. Dysregulation of the interaction between insulin-secreting cells and insulin-responsive target organs is an important factor driving the progression of insulin resistance. Circulating endocrine hormones are important mediators mediating the interaction between insulin-secreting cells and insulin-responsive target organs. In addition to the classical hormones secreted by endocrine glands and organ-specific hormones secreted by metabolism-related organs (adipose tissue, muscle, liver, etc.), extracellular vesicles have been recognized as a novel class of endocrine hormones with a complex composition. Extracellular vesicles can transport signaling molecules, such as miRNAs and LncRNAs, to vital organs related to insulin resistance, in a manner akin to conventional hormones. The significant role in regulating the development of insulin resistance underscores the increasing interest in extracellular vesicles as essential contributors to this process. In this review, we summarize the three types of hormones (classical hormones, organokines and extracellular vesicles) that play a regulatory role in insulin resistance, and focus on the novel endocrine hormones, extracellular vesicles, to elaborate the mechanism of extracellular vesicles' regulation of insulin resistance progress from two aspects: the impact on insulin-secreting cells and the influence on insulin-responsive target organs. In addition, this paper outlines the clinical applications of extracellular vesicles in insulin resistance. A comprehensive understanding of the regulatory mechanisms and diagnostic status of the inter-organ network in insulin resistance has great potential to advance targeted therapeutic interventions and diagnostic markers, thereby benefiting both the prevention and treatment of insulin resistance.

HFE
Also flagged:Natural Killer Cell Leukemiaacute fatty liversepsisdisseminated intravascular coagulopathyNK cell leukemiaCAEBV
Journal Article 2024-08-06 ✓ 1 Snippet Hamdan A, Chou C, Rust D, Strand A.
In-Text Gene Mentions

…not suggestive ofhemochromatosis.…

Show Full Abstract

A 24-year-old Ecuadorian female, previously diagnosed with acute fatty liver (AFL) during pregnancy, developed constitutional symptoms, jaundice, and abdominal pain in a subsequent pregnancy, prompting investigations that suggested a recurrence of AFL. She underwent an elective abortion, which resulted in the resolution of her abdominal pain, and a liver biopsy, which showed granulomatous inflammation and lymphocytic infiltration. She later presented with abdominal distention, productive cough, and persistent constitutional symptoms and jaundice. Extensive laboratory and imaging studies indicated sepsis, acute liver injury, and disseminated intravascular coagulopathy. Her serum Epstein-Barr virus (EBV) level was elevated. Special staining of her previous liver biopsy revealed EBV-positive natural killer (NK) cells. A bone marrow biopsy also revealed EBV-positive NK cells. She was diagnosed with aggressive NK cell leukemia (ANKL) with or without chronic active EBV (CAEBV). Treatment included dexamethasone, atovaquone, bortezomib, and ganciclovir, with plans for a stem cell transplant. However, her course was complicated by infections and multi-organ failure, resulting in her passing. This case highlights the rarity and challenges in managing EBV-associated ANKL, emphasizing the need for early detection and improved treatment options, with stem cell transplantation offering the best prognosis.

HFE
Also flagged:Pyruvate KinaseDeficiencyPKLRHemoglobinalanine aminotransferasePyruvate
Journal Article 2024-08-06 ✓ 1 Snippet Mohammed HE, Bady Z, Farhat YZ, Haseeb ME, Nasser M, Eshun F, Abdelgawad HAH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Pyruvate kinase deficiency (PKD), a rare autosomal recessive disease, often leads to chronic hemolytic complications stemming from mutations in the PKLR gene. Mitapivat, an innovative, allosteric activator of the pyruvate kinase enzyme in red blood cells, has emerged as a potential therapeutic agent. This systematic review aims to meticulously evaluate the efficacy and safety of Mitapivat in treating PKD patients.<h4>Methods</h4>We conducted a comprehensive search across three major databases-PubMed, Web of Science, and Scopus-up to November 2023, utilizing a single-arm meta-analysis methodology.<h4>Results</h4>Our analysis included three clinical trials comprising 94 PKD patients. Hemoglobin (HB) levels improved, with an average increase of 1.05 g/dl (95% Confidence Interval [CI]: -0.22 to 2.33). In terms of hemolysis indicators, there was a notable decrease in indirect bilirubin (mean change: -1.36 mg/dl, 95% CI: -3.67 to 0.95) and an increase in haptoglobin (mean change: 0.26 g/L). Patient-reported outcomes (PROs), assessed via the Pyruvate Kinase Deficiency Diary and Pyruvate Kinase Impact Assessment, showed significant improvements, with mean changes of -4.95 (95% CI: -6.711 to -3.19) and - 5.97 (95% CI: -9.87 to -2.06), respectively. Adverse effects were generally mild, with the most common being headache, nausea, elevated alanine aminotransferase, and nasopharyngitis.<h4>Conclusion</h4>Mitapivat substantially improves hemoglobin levels, hemolysis markers, and PROs, maintaining an acceptable safety profile. Nevertheless, additional, larger-scale randomized controlled trials across diverse age groups remain necessary to further corroborate these findings.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s12288-024-01830-x.

DARS2
Also flagged:DnaAmaster replication initiator proteinATPasecell-cycleinitiator proteinthiamine
Journal Article 2024-08-06 ✓ 4 Snippets Boesen TO, Charbon G, Fu H, Jensen C, Sandler M, Jun S, Løbner-Olesen A.
In-Text Gene Mentions

…DnaA-ATP, DARS1 andDARS2at different loci…

…conversion elements (DARS1,DARS2, hda , and…

…by DARS1 +DARS2and DnaA-ATP →…

…DnaA-ADP conversion (DARS1,DARS2, hda , and…

Show Full Abstract

Investigating a long-standing conceptual question in bacterial physiology, we examine why DnaA, the bacterial master replication initiator protein, exists in both ATP and ADP forms, despite only the ATP form being essential for initiation. We engineered the Δ4 <i>Escherichia coli</i> strain, devoid of all known external elements facilitating the DnaA-ATP/ADP conversion and found that these cells display nearly wild-type behaviors under nonoverlapping replication cycles. However, during rapid growth with overlapping cycles, Δ4 cells exhibit initiation instability. This aligns with our model predictions, suggesting that the intrinsic ATPase activity of DnaA alone is sufficient for robust initiation control in <i>E. coli</i> and the DnaA-ATP/ADP conversion regulatory elements extend the robustness to multifork replication, indicating an evolutionary adaptation. Moreover, our experiments revealed constant DnaA concentrations during steady-state cell elongation in both wild-type and Δ4 cells. These insights not only advance our understanding of bacterial cell-cycle regulation and DnaA but also highlight a fundamental divergence from eukaryotic cell-cycle controls, emphasizing protein copy-number sensing in bacteria versus programmed protein concentration oscillations in eukaryotes.

HTT
Also flagged:Noradrenergicnorepinephrine (NE) transporteralpha-2a receptormethylphenidateADRA2AADRA2B
Journal Article 2024-08-06 ✓ 2 Snippets van Hooijdonk CFM, Voulgaropoulou S, Podrzaj L, Wolvekamp D, van Amelsvoort TAMJ, Leibold NK.
In-Text Gene Mentions

…COMT and the5-HTT) were associated with…

…the gene encoding5-HTT(rs25531, 5-HTTLPR, serotonin-…

Show Full Abstract

Mental health problems are highly prevalent worldwide. Stress can precipitate both the onset and recurrence of mental health problems. While many individuals are exposed to similar stressors, there is a large heterogeneity in sensitivity to stress and the extent to which someone subsequently develops mental health issues. A key factor that contributes to an individual's capacity to cope with adversity, referred to as resilience, is genetic variation. Here, we systematically reviewed the effects of genetic variation in the genes encoding the norepinephrine (NE) transporter and receptors on resilience- and mental health-related features in a transdiagnostic approach (i.e., without restrictions regarding factors such as diagnosis or age). Our search yielded 49 studies for inclusion. The current evidence highlights that 1) genetic variations in the NE system (particularly in the <i>ADRA2A</i> and <i>ADRA2B</i> genes) exert influence on some cognitive processes, especially attention and emotional memory; 2) genetic variants in the alpha-2a receptor might play a role in some personality traits; 3) deletion in the <i>ADRA2B</i> and <i>ADRA2C</i> genes seems to be related with altered activity of the amygdala during emotional memory tasks; 4) the link between NE variants and response to methylphenidate are inconclusive. Altogether, these studies provide evidence for a genetic effect of the noradrenergic system in specific resilience- and mental health-related individual characteristics. However, the number of available studies specifically investigating noradrenergic genes were limited, emphasizing the need to perform more research on the noradrenergic system, while taking into account factors such as age, sex, environment, and the potential interactions with other genes.

Research Square 2024-08-06 Preprint (No Snippets API) LI J, SHENG J, HUANG Y.
Show Full Abstract

<title>Abstract</title> <p>Measuring and preventing systemic risk have always been core issues in finance. To accurately capture systemic risk, this is the first introduction of the Quantile Regression Dilated Causal Convolution Neural Network (QRDCCNN) model for assessing systemic risk. This model focuses on the causal consistency of financial time series and effectively expands the model's receptive field by increasing the dilation rate layer by layer. The study selects the daily closing prices of the S\&P 500 index and 38 US financial institutions as subjects. The QRDCCNN model is employed to measure the VaR of each financial institution and the CoVaR of the financial system when these institutions are in extreme risk conditions. This paper compares the results of the QRDCCNN model with those from the DCC-GARCH, quantile regression, QRNN, and QRCNN models using the Kupiec test. The research results show that the QRDCCNN model has the highest accuracy, followed by QRNN and QRCNN models, while the DCC-GARCH model has the lowest accuracy.</p>

Also flagged:post-translational modificationpolysaccharidesamino acidglycosyltransferasescell adhesioncancer
Journal Article 2024-08-05 No Snippets He M, Zhou X, Wang X.
Show Full Abstract

Protein post-translational modification (PTM) is a covalent process that occurs in proteins during or after translation through the addition or removal of one or more functional groups, and has a profound effect on protein function. Glycosylation is one of the most common PTMs, in which polysaccharides are transferred to specific amino acid residues in proteins by glycosyltransferases. A growing body of evidence suggests that glycosylation is essential for the unfolding of various functional activities in organisms, such as playing a key role in the regulation of protein function, cell adhesion and immune escape. Aberrant glycosylation is also closely associated with the development of various diseases. Abnormal glycosylation patterns are closely linked to the emergence of various health conditions, including cancer, inflammation, autoimmune disorders, and several other diseases. However, the underlying composition and structure of the glycosylated residues have not been determined. It is imperative to fully understand the internal structure and differential expression of glycosylation, and to incorporate advanced detection technologies to keep the knowledge advancing. Investigations on the clinical applications of glycosylation focused on sensitive and promising biomarkers, development of more effective small molecule targeted drugs and emerging vaccines. These studies provide a new area for novel therapeutic strategies based on glycosylation.

Also flagged:Tumoroxygensolid tumorscancervascular endothelial growth factorVEGF
Journal Article 2024-08-05 No Snippets Zhao L, Li Q, Zhou T, Liu X, Guo J, Fang Q, Cao X, Geng Q, Yu Y, Zhang S, Deng T, Wang X, Jiao Y, Zhang M, Liu H, Tan H, Xiao C.
Show Full Abstract

Tumor neovascularization is essential for the growth, invasion, and metastasis of tumors. Recent studies have highlighted the significant role of N6-methyladenosine (m<sup>6</sup>A) modification in regulating these processes. This review explores the mechanisms by which m<sup>6</sup>A influences tumor neovascularization, focusing on its impact on angiogenesis and vasculogenic mimicry (VM). We discuss the roles of m<sup>6</sup>A writers, erasers, and readers in modulating the stability and translation of angiogenic factors like vascular endothelial growth factor (VEGF), and their involvement in key signaling pathways such as PI3K/AKT, MAPK, and Hippo. Additionally, we outline the role of m<sup>6</sup>A in vascular-immune crosstalk. Finally, we discuss the current development of m<sup>6</sup>A inhibitors and their potential applications, along with the contribution of m<sup>6</sup>A to anti-angiogenic therapy resistance. Highlighting the therapeutic potential of targeting m<sup>6</sup>A regulators, this review provides novel insights into anti-angiogenic strategies and underscores the need for further research to fully exploit m<sup>6</sup>A modulation in cancer treatment. By understanding the intricate role of m<sup>6</sup>A in tumor neovascularization, we can develop more effective therapeutic approaches to inhibit tumor growth and overcome treatment resistance. Targeting m<sup>6</sup>A offers a novel approach to interfere with the tumor's ability to manipulate its microenvironment, enhancing the efficacy of existing treatments and providing new avenues for combating cancer progression.

Also flagged:taubeta-amyloidADcognitive declineautophagy
Journal Article 2024-08-05 No Snippets Jury-Garfe N, Redding-Ochoa J, You Y, Martínez P, Karahan H, Chimal-Juárez E, Johnson TS, Zhang J, Resnick S, Kim J, Troncoso JC, Lasagna-Reeves CA.
Show Full Abstract

Asymptomatic Alzheimer's disease (AsymAD) describes the status of individuals with preserved cognition but identifiable Alzheimer's disease (AD) brain pathology (i.e., beta-amyloid (Aβ) deposits, neuritic plaques, and neurofibrillary tangles) at autopsy. In this study, we investigated the postmortem brains of a cohort of AsymAD subjects to gain insight into the mechanisms underlying resilience to AD pathology and cognitive decline. Our results showed that AsymAD cases exhibit enrichment in core plaques, decreased filamentous plaque accumulation, and increased plaque-surrounding microglia. Less pathological tau aggregation in dystrophic neurites was found in AsymAD brains than in AD brains, and tau seeding activity was comparable to that in healthy brains. We used spatial transcriptomics to characterize the plaque niche further and revealed autophagy, endocytosis, and phagocytosis as the pathways associated with the genes upregulated in the AsymAD plaque niche. Furthermore, the levels of ARP2 and CAP1, which are actin-based motility proteins that participate in the dynamics of actin filaments to allow cell motility, were increased in the microglia surrounding amyloid plaques in AsymAD cases. Our findings suggest that the amyloid-plaque microenvironment in AsymAD cases is characterized by the presence of microglia with highly efficient actin-based cell motility mechanisms and decreased tau seeding compared with that in AD brains. These two mechanisms can potentially protect against the toxic cascade initiated by Aβ, preserving brain health, and slowing AD pathology progression.

HMGN4
Also flagged:marrowhypercalcemiamonoclonal gammopathy of unknown significanceMGUSB-cell malignanciessolid tumors
Journal Article 2024-08-05 ✓ 1 Snippet Went M, Duran-Lozano L, Halldorsson GH, Gunnell A, Ugidos-Damboriena N, Law P, Ekdahl L, Sud A, Thorleifsson G, Thodberg M, Olafsdottir T, Lamarca-Arrizabalaga A, Cafaro C, Niroula A, Ajore R, Lopez de Lapuente Portilla A, Ali Z, Pertesi M, Goldschmidt H, Stefansdottir L, Kristinsson SY, Stacey SN, Love TJ, Rognvaldsson S, Hajek R, Vodicka P, Pettersson-Kymmer U, Späth F, Schinke C, Van Rhee F, Sulem P, Ferkingstad E, Hjorleifsson Eldjarn G, Mellqvist UH, Jonsdottir I, Morgan G, Sonneveld P, Waage A, Weinhold N, Thomsen H, Försti A, Hansson M, Juul-Vangsted A, Thorsteinsdottir U, Hemminki K, Kaiser M, Rafnar T, Stefansson K, Houlston R, Nilsson B.
In-Text Gene Mentions

…SMARCD3 11 ,HMGN438 , and…

Show Full Abstract

Multiple myeloma (MM) is an incurable malignancy of plasma cells. Epidemiological studies indicate a substantial heritable component, but the underlying mechanisms remain unclear. Here, in a genome-wide association study totaling 10,906 cases and 366,221 controls, we identify 35 MM risk loci, 12 of which are novel. Through functional fine-mapping and Mendelian randomization, we uncover two causal mechanisms for inherited MM risk: longer telomeres; and elevated levels of B-cell maturation antigen (BCMA) and interleukin-5 receptor alpha (IL5RA) in plasma. The largest increase in BCMA and IL5RA levels is mediated by the risk variant rs34562254-A at TNFRSF13B. While individuals with loss-of-function variants in TNFRSF13B develop B-cell immunodeficiency, rs34562254-A exerts a gain-of-function effect, increasing MM risk through amplified B-cell responses. Our results represent an analysis of genetic MM predisposition, highlighting causal mechanisms contributing to MM development.

Also flagged:breast cancerpolymerssilicaphosphotungstateelectron transfernanocapsules
Journal Article 2024-08-05 No Snippets Jalilian S, Bahremand K, Arkan E, Jaymand M, Aghaz F.
Show Full Abstract

With breast cancer emerging as a pressing global health challenge, characterized by escalating incidence rates and geographical disparities, there is a critical need for innovative therapeutic strategies. This comprehensive research navigates the landscape of nanomedicine, specifically focusing on the potential of magnetic nanoparticles (MNPs), with magnetite (Fe<sub>3</sub>O<sub>4</sub>) taking center stage. MNPs, encapsulated in biocompatible polymers like silica known as magnetic silica nanoparticles (MSN), are augmented with phosphotungstate (PTA) for enhanced chemodynamic therapy (CDT). PTA is recognized for its dual role as a natural chelator and electron shuttle, expediting electron transfer from ferric (Fe<sup>3+</sup>) to ferrous (Fe<sup>2+</sup>) ions within nanoparticles. Additionally, protein-based charge-reversal nanocarriers like silk sericin and gluten are introduced to encapsulate (MSN-PTA) nanoparticles, offering a dynamic facet to drug delivery systems for potential revolutionization of breast cancer therapy. This study successfully formulates and characterizes protein-coated nanocapsules, specifically MSN-PTA-SER, and MSN-PTA-GLU, with optimal physicochemical attributes for drug delivery applications. The careful optimization of sericin and gluten concentrations results in finely tuned nanoparticles, showcasing uniform size, enhanced negative zeta potential, and remarkable stability. Various analyses, from Dynamic Light Scattering (DLS) and scanning electron microscopy (SEM) to transmission electron microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), X-Ray diffraction analysis (XRD), and Thermogravimetric analysis (TGA), provide insights into structural integrity and surface modifications. Vibrating Sample Magnetometer (VSM) analysis underscores superparamagnetic behavior, positioning these nanocapsules as promising candidates for targeted drug delivery. In vitro evaluations demonstrate dose-dependent inhibition of cell viability in MCF-7 and Zr-75-1 breast cancer cells, emphasizing the therapeutic potential of MSN-PTA-SER and MSN-PTA-GLU. The interplay of surface charge and pH-dependent cellular uptake highlights the robust stability and versatility of these nanocarriers in tumor microenvironment, paving the way for advancements in targeted drug delivery and personalized nanomedicine. This comparative analysis explores the suitability of silk sericin and gluten, unraveling a promising avenue for the development of advanced, targeted, and efficient breast cancer treatments.

HTT
Also flagged:PSME3neurodegenerative diseasesneuronal senescencenucleolar polyglutamine binding protein 3NOL7cytoplasmic
Journal Article 2024-08-05 ✓ 3 Snippets Yoshioka Y, Huang Y, Jin X, Ngo KX, Kumaki T, Jin M, Toyoda S, Takayama S, Inotsume M, Fujita K, Homma H, Ando T, Tanaka H, Okazawa H.
In-Text Gene Mentions

…type-7, SCA7), huntingtin (Htt, the causative gene…

…coexpressed with Atxn1,Htt, and AR, these…

…effects of Atxn1,Htt, and AR, and…

Show Full Abstract

Senescence of nondividing neurons remains an immature concept, with especially the regulatory molecular mechanisms of senescence-like phenotypes and the role of proteins associated with neurodegenerative diseases in triggering neuronal senescence remaining poorly explored. In this study, we reveal that the nucleolar polyglutamine binding protein 3 (PQBP3; also termed NOL7), which has been linked to polyQ neurodegenerative diseases, regulates senescence as a gatekeeper of cytoplasmic DNA leakage. PQBP3 directly binds PSME3 (proteasome activator complex subunit 3), a subunit of the 11S proteasome regulator complex, decreasing PSME3 interaction with Lamin B1 and thereby preventing Lamin B1 degradation and senescence. Depletion of endogenous PQBP3 causes nuclear membrane instability and release of genomic DNA from the nucleus to the cytosol. Among multiple tested polyQ proteins, ataxin-1 (ATXN1) partially sequesters PQBP3 to inclusion bodies, reducing nucleolar PQBP3 levels. Consistently, knock-in mice expressing mutant Atxn1 exhibit decreased nuclear PQBP3 and a senescence phenotype in Purkinje cells of the cerebellum. Collectively, these results suggest homologous roles of the nucleolar protein PQBP3 in cellular senescence and neurodegeneration.

Also flagged:positronneurotransmitterreceptortransportersorganizationwater
Journal Article 2024-08-05 No Snippets Luppi AI, Singleton SP, Hansen JY, Jamison KW, Bzdok D, Kuceyeski A, Betzel RF, Misic B.
Show Full Abstract

The mechanisms linking the brain's network structure to cognitively relevant activation patterns remain largely unknown. Here, by leveraging principles of network control, we show how the architecture of the human connectome shapes transitions between 123 experimentally defined cognitive activation maps (cognitive topographies) from the NeuroSynth meta-analytic database. Specifically, we systematically integrated large-scale multimodal neuroimaging data from functional magnetic resonance imaging, diffusion tractography, cortical morphometry and positron emission tomography to simulate how anatomically guided transitions between cognitive states can be reshaped by neurotransmitter engagement or by changes in cortical thickness. Our model incorporates neurotransmitter-receptor density maps (18 receptors and transporters) and maps of cortical thickness pertaining to a wide range of mental health, neurodegenerative, psychiatric and neurodevelopmental diagnostic categories (17,000 patients and 22,000 controls). The results provide a comprehensive look-up table charting how brain network organization and chemoarchitecture interact to manifest different cognitive topographies, and establish a principled foundation for the systematic identification of ways to promote selective transitions between cognitive topographies.

SUDS3
Also flagged:chromatinorganizationnucleusregulation ofgene expressionnucleosome
Journal Article 2024-08-05 ✓ 1 Snippet Li W, Hu J, Song F, Yu J, Peng X, Zhang S, Wang L, Hu M, Liu JC, Wei Y, Xiao X, Li Y, Li D, Wang H, Zhou BR, Dai L, Mou Z, Zhou M, Zhang H, Zhou Z, Zhang H, Bai Y, Zhou JQ, Li W, Li G, Zhu P.
In-Text Gene Mentions

…but also thelinker histoneshistones (H5), can…

Show Full Abstract

The hierarchical packaging of chromatin fibers plays a critical role in gene regulation. The 30-nm chromatin fibers, a central-level structure bridging nucleosomal arrays to higher-order organizations, function as the first level of transcriptional dormant chromatin. The dynamics of 30-nm chromatin fiber play a crucial role in biological processes related to DNA. Here, we report a 3.6-angstrom resolution cryogenic electron microscopy structure of H5-bound dodecanucleosome, i.e., the chromatin fiber reconstituted in the presence of linker histone H5, which shows a two-start left-handed double helical structure twisted by tetranucleosomal units. An atomic structural model of the H5-bound chromatin fiber, including an intact chromatosome, is built, which provides structural details of the full-length linker histone H5, including its N-terminal domain and an HMG-motif-like C-terminal domain. The chromatosome structure shows that H5 binds the nucleosome off-dyad through a three-contact mode in the chromatin fiber. More importantly, the H5-chromatin structure provides a fine molecular basis for the intra-tetranucleosomal and inter-tetranucleosomal interactions. In addition, we systematically validated the physiological functions and structural characteristics of the tetranucleosomal unit through a series of genetic and genomic studies in Saccharomyces cerevisiae and in vitro biophysical experiments. Furthermore, our structure reveals that multiple structural asymmetries of histone tails confer a polarity to the chromatin fiber. These findings provide structural and mechanistic insights into how a nucleosomal array folds into a higher-order chromatin fiber with a polarity in vitro and in vivo.

NEGR1
Also flagged:ADTREM2Triggering receptor expressed on myeloid cell 2LOADcellsurface receptor
Journal Article 2024-08-05 ✓ 1 Snippet Johnston KG, Berackey BT, Tran KM, Gelber A, Yu Z, MacGregor GR, Mukamel EA, Tan Z, Green KN, Xu X.
In-Text Gene Mentions

…Syp , Bdnf,Negr1, and Gsto1…

Show Full Abstract

The R47H missense mutation of the TREM2 gene is a known risk factor for development of Alzheimer's Disease. In this study, we analyze the impact of the Trem2<sup>R47H</sup> mutation on specific cell types in multiple cortical and subcortical brain regions in the context of wild-type and 5xFAD mouse background. We profile 19 mouse brain sections consisting of wild-type, Trem2<sup>R47H</sup>, 5xFAD and Trem2<sup>R47H</sup>; 5xFAD genotypes using MERFISH spatial transcriptomics, a technique that enables subcellular profiling of spatial gene expression. Spatial transcriptomics and neuropathology data are analyzed using our custom pipeline to identify plaque and Trem2<sup>R47H</sup>-induced transcriptomic dysregulation. We initially analyze cell type-specific transcriptomic alterations induced by plaque proximity. Next, we analyze spatial distributions of disease associated microglia and astrocytes, and how they vary between 5xFAD and Trem2<sup>R47H</sup>; 5xFAD mouse models. Finally, we analyze the impact of the Trem2<sup>R47H</sup> mutation on neuronal transcriptomes. The Trem2<sup>R47H</sup> mutation induces consistent upregulation of Bdnf and Ntrk2 across many cortical excitatory neuron types, independent of amyloid pathology. Spatial investigation of genotype enriched subclusters identified spatially localized neuronal subpopulations reduced in 5xFAD and Trem2<sup>R47H</sup>; 5xFAD mice. Overall, our MERFISH spatial transcriptomics analysis identifies glial and neuronal transcriptomic alterations induced independently by 5xFAD and Trem2<sup>R47H</sup> mutations, impacting inflammatory responses in microglia and astrocytes, and activity and BDNF signaling in neurons.

PEBP1
Also flagged:tumorFerroptosiscancerphospholipidToll-like receptor 2TLR2
Journal Article 2024-08-05 ✓ 1 Snippet Luo X, Gong HB, Li ZC, Li DD, Li ZX, Sun J, Yan CY, Huang RT, Feng Y, Chen SR, Cao YF, Liu M, Wang R, Huang F, Sun WY, Kurihara H, Duan WJ, Liang L, Jin W, Wu YP, He RR, Li YF.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Ferroptosis holds significant potential for application in cancer therapy. However, ferroptosis inducers are not cell-specific and can cause phospholipid peroxidation in both tumor and non-tumor cells. This limitation greatly restricts the use of ferroptosis therapy as a safe and effective anticancer strategy. Our previous study demonstrated that macrophages can engulf ferroptotic cells through Toll-like receptor 2 (TLR2). Despite this advancement, the precise mechanism by which phospholipid peroxidation in macrophages affects their phagocytotic capability during treatment of tumors with ferroptotic agents is still unknown. Here, we utilized flow sorting combined with redox phospholipidomics to determine that phospholipid peroxidation in tumor microenvironment (TME) macrophages impaired the macrophages ability to eliminate ferroptotic tumor cells by phagocytosis, ultimately fostering tumor resistance to ferroptosis therapy. Mechanistically, the accumulation of phospholipid peroxidation in the macrophage endoplasmic reticulum (ER) repressed TLR2 trafficking to the plasma membrane and caused its retention in the ER by disrupting the interaction between TLR2 and its chaperone CNPY3. Subsequently, this ER-retained TLR2 recruited E3 ligase MARCH6 and initiated the proteasome-dependent degradation. Using redox phospholipidomics, we identified 1-steaoryl-2-15-HpETE-sn-glycero-3-phosphatidylethanolamine (SAPE-OOH) as the crucial mediator of these effects. Conclusively, our discovery elucidates a novel molecular mechanism underlying macrophage phospholipid peroxidation-induced tumor resistance to ferroptosis therapy and highlights the TLR2-MARCH6 axis as a potential therapeutic target for cancer therapy.

CCPG1
Also flagged:organelleTRIPcongenital hypothyroidismhypothyroidismHsp70disulfide
Journal Article 2024-08-05 ✓ 5 Snippets Wright MT, Timalsina B, Garcia Lopez V, Hermanson JN, Garcia S, Plate L.
In-Text Gene Mentions

…receptors, ATL3 (Atlastin-3),CCPG1(Cpr8), and RTN3…

CCPG1and RTN3 were…

…then decreasing, whileCCPG1interactions peaked later…

…the ER-phagy receptorCCPG1was identified in…

…siRNA silencing ofCCPG1did not significantly…

Show Full Abstract

Many cellular processes are governed by protein-protein interactions that require tight spatial and temporal regulation. Accordingly, it is necessary to understand the dynamics of these interactions to fully comprehend and elucidate cellular processes and pathological disease states. To map de novo protein-protein interactions with time resolution at an organelle-wide scale, we developed a quantitative mass spectrometry method, time-resolved interactome profiling (TRIP). We apply TRIP to elucidate aberrant protein interaction dynamics that lead to the protein misfolding disease congenital hypothyroidism. We deconvolute altered temporal interactions of the thyroid hormone precursor thyroglobulin with pathways implicated in hypothyroidism pathophysiology, such as Hsp70-/90-assisted folding, disulfide/redox processing, and N-glycosylation. Functional siRNA screening identified VCP and TEX264 as key protein degradation components whose inhibition selectively rescues mutant prohormone secretion. Ultimately, our results provide novel insight into the temporal coordination of protein homeostasis, and our TRIP method should find broad applications in investigating protein-folding diseases and cellular processes.

HTT
Also flagged:HuntingtinHuntington's diseaseHD
Journal Article 2024-08-05 ✓ 4 Snippets Louçã M, El Akrouti D, Lemesle A, Louessard M, Dufour N, Baroin C, de la Fouchardière A, Cotter L, Jean-Jacques H, Redeker V, Perrier AL.
In-Text Gene Mentions

It also emphasizes the potential risks of excessive wt-HTT loss associated with non-selective therapeutic approaches targeting both wt- and mut-HTT isoforms in HD patients.

Despite growing descriptions of wild-type Huntingtin (wt-HTT) roles in both adult brain function and, more recently, development, several clinical trials are exploring HTT-lowering approaches that target both wt-HTT and the mutant isoform (mut-HTT) responsible for Huntington's disease (HD).

…trials are exploringHTT-lowering approaches that targ…

…two-thirds of the wt-HTTprotein was depleted.…

Show Full Abstract

Despite growing descriptions of wild-type Huntingtin (wt-HTT) roles in both adult brain function and, more recently, development, several clinical trials are exploring HTT-lowering approaches that target both wt-HTT and the mutant isoform (mut-HTT) responsible for Huntington's disease (HD). This non-selective targeting is based on the autosomal dominant inheritance of HD, supporting the idea that mut-HTT exerts its harmful effects through a toxic gain-of-function or a dominant-negative mechanism. However, the precise amount of wt-HTT needed for healthy neurons in adults and during development remains unclear. In this study, we address this question by examining how wt-HTT loss affects human neuronal network formation, synaptic maturation, and homeostasis in vitro. Our findings establish a role of wt-HTT in the maturation of dendritic arborization and the acquisition of network-wide synchronized activity by human cortical neuronal networks modeled in vitro. Interestingly, the network synchronization defects only became apparent when more than two-thirds of the wt-HTT protein was depleted. Our study underscores the critical need to precisely understand wt-HTT role in neuronal health. It also emphasizes the potential risks of excessive wt-HTT loss associated with non-selective therapeutic approaches targeting both wt- and mut-HTT isoforms in HD patients.

Also flagged:mismatch repairimmune responsesPD-1solid tumorsdiffuse large B-cell lymphomaDLBCL
Journal Article 2024-08-05 No Snippets Xu-Monette ZY, Luo C, Yu L, Li Y, Bhagat G, Tzankov A, Visco C, Fan X, Dybkaer K, Sakhdari A, Wang NT, Yuan AF, Chiu A, Tam W, Zu Y, Hsi ED, Perry AM, Song W, O'Malley D, Au Q, Nunns H, Go H, Møller MB, Parsons BM, Montes-Moreno S, Ponzoni M, Ferreri AJM, Sohani AR, Abramson JS, Xu B, Young KH.
Show Full Abstract

Deficient (d) DNA mismatch repair (MMR) is a biomarker predictive of better response to PD-1 blockade immunotherapy in solid tumors. dMMR can be caused by mutations in MMR genes or by protein inactivation, which can be detected by sequencing and immunohistochemistry, respectively. To investigate the role of dMMR in diffuse large B-cell lymphoma (DLBCL), MMR gene mutations and expression of MSH6, MSH2, MLH1, and PMS2 proteins were evaluated by targeted next-generation sequencing and immunohistochemistry in a large cohort of DLBCL patients treated with standard chemoimmunotherapy, and correlated with the tumor immune microenvironment characteristics quantified by fluorescent multiplex immunohistochemistry and gene-expression profiling. The results showed that genetic dMMR was infrequent in DLBCL and was significantly associated with increased cancer gene mutations and favorable immune microenvironment, but not prognostic impact. Phenotypic dMMR was also infrequent, and MMR proteins were commonly expressed in DLBCL. However, intratumor heterogeneity existed, and increased DLBCL cells with phenotypic dMMR correlated with significantly increased T cells and PD-1<sup>+</sup> T cells, higher average nearest neighbor distance between T cells and PAX5<sup>+</sup> cells, upregulated immune gene signatures, LE4 and LE7 ecotypes and their underlying Ecotyper-defined cell states, suggesting the possibility that increased T cells targeted only tumor cell subsets with dMMR. Only in patients with MYC¯ DLBCL, high MSH6/PMS2 expression showed significant adverse prognostic effects. This study shows the immunologic and prognostic effects of genetic/phenotypic dMMR in DLBCL, and raises a question on whether DLBCL-infiltrating PD-1<sup>+</sup> T cells target only tumor subclones, relevant for the efficacy of PD-1 blockade immunotherapy in DLBCL.

Also flagged:GI diseasestem cell homeostasismetabolismIBSmucusmechanosensation
Journal Article 2024-08-05 No Snippets Nwako JG, McCauley HA.
Show Full Abstract

Enteroendocrine cells (EECs) are well-known for their systemic hormonal effects, especially in the regulation of appetite and glycemia. Much less is known about how the products made by EECs regulate their local environment within the intestine. Here, we focus on paracrine interactions between EECs and other intestinal cells as they regulate three essential aspects of intestinal homeostasis and physiology: 1) intestinal stem cell function and proliferation; 2) nutrient absorption; and 3) mucosal barrier function. We also discuss the ability of EECs to express multiple hormones, describe in vitro and in vivo models to study EECs, and consider how EECs are altered in GI disease.

BTN2A2
Also flagged:breast cancerBRCAGene ExpressionPSCAcell proliferationwound-healing
Journal Article 2024-08-05 ✓ 1 Snippet Feng S, Ning L, Zhang H, Wang Z, Lu Y.
In-Text Gene Mentions

…as the PDCD1,BTN2A2, VTCN1, ADORA2A, CTLA4…

Show Full Abstract

<h4>Background</h4>As a heterogeneous malignancy, breast cancer (BRCA) shows high incidence and mortality. Discovering novel molecular markers and developing reliable prognostic models may improve the survival of BCRA.<h4>Methods</h4>The RNA-seq data of BRCA patients were collected from the training set The Cancer Genome Atlas (TCGA)-BRCA and validation set GSE20685 in the Gene Expression Omnibus (GEO) databases. The "GSVA" R package was used to calculate the glycolysis score for each patient, based on which all the patients were divided into different glycolysis groups. The "limma" package was employed to perform differentially expression genes (DEGs) analysis. Key signature genes were selected by performing un/multivariate and least absolute shrinkage and selection operator (LASSO) C regression and used to develop a RiskScore model. The ESTIMATE and MCP-Counter algorithms were used for quantifying immune infiltration level. The functions of the genes were validated using Western blot, colony formation, transwell and wound-healing assay.<h4>Results</h4>The glycolysis score and prognostic analysis showed that high glycolysis score was related to tumorigenesis pathway and a poor prognosis in BRCA as overactive glycolysis inhibited the normal functions of immune cells. Subsequently, we screened five key prognostic genes using the LASSO Cox regression analysis and used them to establish a RiskScore with a high classification efficiency. Based on the results of the RiskScore, it was found that patients in the high-risk group had significantly unfavorable immune infiltration and prognostic outcomes. A nomogram integrating the RiskScore could well predict the prognosis for BRCA patients. Knockdown of PSCA suppressed cell proliferation, invasion and migration of BRCA cells.<h4>Conclusion</h4>This study developed a glycolysis-related signature with five genes to distinguish between high-risk and low-risk BRCA patients. A nomogram developed on the basis of the RiskScore was reliable to predict BRCA survival. Our model provided clinical guidance for the treatment of BRCA patients.

PCDH17
Also flagged:Lung CancerBenign Lung Diseasesmethylationnon-small cell lung cancerNSCLCsmall cell lung cancer
Journal Article 2024-08-05 ✓ 3 Snippets Batochir C, Kim IA, Jo EJ, Kim EB, Kim HJ, Hur JY, Kim DW, Park HK, Lee KY.
In-Text Gene Mentions

…, 0.33 forPCDH17, 1.89 for…

…, HOXD3 ,PCDH17, NID2 ,…

PCDH17downregulation and hypermethyl…

Show Full Abstract

Benign lung diseases are common and often do not require specific treatment, but they pose challenges in the distinguishing of them from lung cancer during low-dose computed tomography (LDCT). This study presents a comprehensive methylation analysis using real-time PCR for minimally invasive diagnoses of lung cancer via employing BALF exosome DNA. A panel of seven epigenetic biomarkers was identified, exhibiting specific methylation patterns in lung cancer BALF exosome DNA. This panel achieved an area under the curve (AUC) of 0.97, with sensitivity and specificity rates of 88.24% and 97.14%, respectively. Each biomarker showed significantly higher mean methylation levels (MMLs) in both non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) compared to non-cancer groups, with fold changes from 1.7 to 13.36. The MMLs of the biomarkers were found to be moderately elevated with increasing patient age and smoking history, regardless of sex. A strong correlation was found between the MMLs and NSCLC stage progression, with detection sensitivities of 79% for early stages and 92% for advanced stages. In the validation cohort, the model demonstrated an AUC of 0.95, with 94% sensitivity and specificity. Sensitivity for early-stage NSCLC detection improved from 88.00% to 92.00% when smoking history was included as an additional risk factor.

Also flagged:CalciumCalcium CarbonateCalcium Acetateacetic acidcalcium oxideacetate monohydrate
Journal Article 2024-08-05 No Snippets Seesanong S, Seangarun C, Boonchom B, Laohavisuti N, Boonmee W, Thompho S, Rungrojchaipon P.
Show Full Abstract

Waste oyster shells were utilized to produce calcium carbonate (CaCO<sub>3</sub>) by grinding. This CaCO<sub>3</sub> was then reacted with acetic acid to yield calcium acetate monohydrate (Ca(CH<sub>3</sub>COO)<sub>2</sub>·H<sub>2</sub>O). Both CaCO<sub>3</sub> and Ca(CH<sub>3</sub>COO)<sub>2</sub>·H<sub>2</sub>O were used as precursors for synthesizing calcium oxide (CaO) through thermal decomposition at 900 °C and 750 °C, respectively. The yields of CaO from both precursors, determined through calcination experiments and thermogravimetric analysis (TGA), exceeded 100% due to the high purity of the raw agents and the formation of calcium hydroxide (Ca(OH)<sub>2</sub>). X-ray fluorescence (XRF) analysis revealed a CaO content of 87.8% for CaO-CC and 91.5% for CaO-CA, indicating the purity and contamination levels. X-ray diffraction (XRD) patterns confirmed the presence of CaO and minor peaks of Ca(OH)<sub>2</sub>, attributed to moisture adsorption. Fourier-transform infrared (FTIR) spectroscopy identified the vibrational characteristics of the Ca-O bond. Scanning electron microscopy (SEM) showed similar morphologies for both CaO-CC and CaO-CA, with CaO-CA displaying a significant amount of rod-like crystals. Based on these results, calcium acetate monohydrate (CA) is recommended as the superior precursor for synthesizing high-purity CaO, offering advantages for various applications.

Also flagged:SilicaBiopolymerscancersilymarinporetumor
Journal Article 2024-08-05 No Snippets Curcio F, Sanguedolce M, Filice L, Testa F, Catapano G, Giordano F, Trombino S, Cassano R.
Show Full Abstract

Mesoporous silica nanoparticles (MSNs) are promising drug carriers for cancer therapy. Their functionalization with ligands for specific tissue/cell targeting and stimuli-responsive cap materials for sealing drugs within the pores of MSNs is extensively studied for biomedical and pharmaceutical applications. The objective of the present work was to establish MSNs as ideal nanocarriers of anticancer drugs such as 5-FU and silymarin by exploiting characteristics such as their large surface area, pore size, and biocompatibility. Furthermore, coating with various biopolymeric materials such as carboxymethyl chitosan-dopamine and hyaluronic acid-folic acid on their surface would allow them to play the role of ligands in the process of active targeting to tumor cells in which there is an overexpression of specific receptors for them. From the results obtained, it emerged, in fact, that these hybrid nanoparticles not only inhibit the growth of glioblastoma and breast cancer cells, but also act as pH-responsive release systems potentially useful as release vectors in tumor environments.

Also flagged:NanocelluloseWaterCellulosemembranesmetalssalts
Journal Article 2024-08-05 No Snippets Abdelhamid HN.
Show Full Abstract

Cellulose in the nano regime, defined as nanocellulose, has been intensively used for water treatment. Nanocellulose can be produced in various forms, including colloidal, water redispersible powders, films, membranes, papers, hydrogels/aerogels, and three-dimensional (3D) objects. They were reported for the removal of water contaminants, e.g., heavy metals, dyes, drugs, pesticides, pharmaceuticals, microbial cells, and other pollutants from water systems. This review summarized the recent technologies for water treatment using nanocellulose-based materials. A scientometric analysis of the topic was also included. Cellulose-based materials enable the removal of water contaminants, and salts offer advanced technologies for water desalination. They are widely used as substrates, adsorbents, and catalysts. They were applied for pollutant removal via several methods such as adsorption, filtration, disinfection, coagulation/flocculation, chemical precipitation, sedimentation, filtration (e.g., ultrafiltration (UF), nanofiltration (NF)), electrofiltration (electrodialysis), ion-exchange, chelation, catalysis, and photocatalysis. Processing cellulose into commercial products enables the wide use of nanocellulose-based materials as adsorbents and catalysts.

Also flagged:Leukocyte AntigenMild Cognitive ImpairmentHLAADcognitive declinehuman leukocyte antigen
Journal Article 2024-08-05 No Snippets Cătană CS, Marta MM, Văleanu M, Dican L, Crișan CA.
Show Full Abstract

The expression of inflamma-miRs and human leukocyte antigen (<i>HLA</i>) haplotypes could indicate mild cognitive impairment (MCI) and Alzheimer's disease (AD). We used international databases to conduct a systematic review of studies on <i>HLA</i> variants and a meta-analysis of research on microRNAs (miRNAs). We aimed to analyze the discriminative value of HLA variants and miRNAs in MCI, AD and controls to evaluate the protective or causative effect of HLA in cognitive decline, establish the role of miRNAs as biomarkers for the early detection of AD, and find a possible link between miRNAs and <i>HLA</i>. Statistical analysis was conducted using Comprehensive Meta-analysis software, version 2.2.050 (Biostat Inc., Englewood, NJ, USA). The effect sizes were estimated by the logarithm base 2 of the fold change. The systematic review revealed that some <i>HLA</i> variants, such as <i>HLA-B*4402</i>, <i>HLA-A*33:01</i>, <i>HLA-A*33:01</i>, <i>HLA-DPB1</i>, <i>HLA-DR15</i>, <i>HLA-DQB1*03:03</i>, <i>HLA-DQB1*06:01</i>, <i>HLA-DQB1*03:01</i>, SNPs on <i>HLA-DRB1/DQB1</i>, and <i>HLA-DQA1,</i> predisposed to cognitive decline before the occurrence of AD, while <i>HLA-A1*01</i>, <i>HLA-DRB1∗13:02</i>, <i>HLA-DRB1*04:04,</i> and <i>HLA-DRB1*04:01</i> demonstrated a protective role. The meta-analysis identified let-7 and miR-15/16 as biomarkers for the early detection of AD. The association between these two miRNA families and the <i>HLA</i> variants that predispose to AD could be used for the early screening and prevention of MCI.

BTN3A3
Also flagged:virus receptorsHAinfluenzapolymerasepolymerase basic 1PB1
Journal Article 2024-08-05 ✓ 2 Snippets Focosi D, Maggi F.
In-Text Gene Mentions

…to evade humanBTN3A3, a recently discovered…

…A viruses wereBTN3A3-resistant thanks to either…

Show Full Abstract

Avian influenza virus has been long considered the main threat for a future pandemic. Among the possible avian influenza virus subtypes, A(H<sub>5</sub>N<sub>1</sub>) clade 2.3.4.4b is becoming enzootic in mammals, representing an alarming step towards a pandemic. In particular, genotype B3.13 has recently caused an outbreak in US dairy cattle. Since pandemic preparedness is largely based on the availability of prepandemic candidate vaccine viruses, in this review we will summarize the current status of the enzootics, and challenges for H<sub>5</sub> vaccine manufacturing and delivery.

Also flagged:Chromosome Region Maintenance 1CRM1Exportin 1XPO1cytoplasmnuclear
Journal Article 2024-08-05 No Snippets Aumann WK, Kazi R, Harrington AM, Wechsler DS.
Show Full Abstract

Chromosome Region Maintenance 1 (CRM1), also known as Exportin 1 (XPO1), is a protein that is critical for transport of proteins and RNA to the cytoplasm through the nuclear pore complex. CRM1 inhibition with small molecule inhibitors is currently being studied in many cancers, including leukemias, solid organ malignancies and brain tumors. We review the structure of CRM1, its role in nuclear export, the current availability of CRM1 inhibitors, and the role of CRM1 in a number of distinct cellular processes. A deeper understanding of how CRM1 functions in nuclear export as well as other cellular processes may allow for the development of additional novel CRM1 inhibitors.

HTT
Also flagged:sleepneurodegenerative disordersneurodegenerative diseaseHDchromosomeneurodegenerative diseases
Journal Article 2024-08-05 ✓ 3 Snippets Chiem E, Zhao K, Dell'Angelica D, Ghiani CA, Paul KN, Colwell CS.
In-Text Gene Mentions

…the huntingtin (Htt) gene, which…

…a human mutantHttgene encoding 97…

…full-length human mutantHtt(mHtt) with 97…

Show Full Abstract

Sleep disturbances are common features of neurodegenerative disorders including Huntington's disease (HD). Sleep and circadian disruptions are recapitulated in animal models, providing the opportunity to evaluate the effectiveness of circadian interventions as countermeasures for neurodegenerative disease. For instance, time restricted feeding (TRF) successfully improved activity rhythms, sleep behavior and motor performance in mouse models of HD. Seeking to determine if these benefits extend to physiological measures of sleep, electroencephalography (EEG) was used to measure sleep/wake states and polysomnographic patterns in male and female wild-type (WT) and bacterial artificial chromosome transgenic (BACHD) adult mice, under TRF and <i>ad lib</i> feeding (ALF). Our findings show that male, but not female, BACHD mice exhibited significant changes in the temporal patterning of wake and non-rapid eye movement (NREM) sleep. The TRF intervention reduced the inappropriate early morning activity by increasing NREM sleep in the male BACHD mice. In addition, the scheduled feeding reduced sleep fragmentation (# bouts) in the male BACHD mice. The phase of the rhythm in rapid-eye movement (REM) sleep was significantly altered by the scheduled feeding in a sex-dependent manner. The treatment did impact the power spectral curves during the day in male but not female mice regardless of the genotype. Sleep homeostasis, as measured by the response to six hours of gentle handling, was not altered by the diet. Thus, TRF improves the temporal patterning and fragmentation of NREM sleep without impacting sleep homeostasis. This work adds critical support to the view that sleep is a modifiable risk factor in neurodegenerative diseases.

HTT
Also flagged:extracellularneurodegenerative disordersfibrilsα-synucleinamyloid-βtau
Journal Article 2024-08-05 ✓ 1 Snippet Zampar S, Di Gregorio SE, Grimmer G, Watts JC, Ingelsson M.
In-Text Gene Mentions

…of abnormal huntingtin (Htt) protein with N-terminal…

Show Full Abstract

Intra- or extracellular aggregates of proteins are central pathogenic features in most neurodegenerative disorders. The accumulation of such proteins in diseased brains is believed to be the end-stage of a stepwise aggregation of misfolded monomers to insoluble cross-β fibrils via a series of differently sized soluble oligomers/protofibrils. Several studies have shown how α-synuclein, amyloid-β, tau and other amyloidogenic proteins can act as nucleating particles and thereby share properties with misfolded forms, or strains, of the prion protein. Although the roles of different protein assemblies in the respective aggregation cascades remain unclear, oligomers/protofibrils are considered key pathogenic species. Numerous observations have demonstrated their neurotoxic effects and a growing number of studies have indicated that they also possess seeding properties, enabling their propagation within cellular networks in the nervous system. The seeding behavior of oligomers differs between the proteins and is also affected by various factors, such as size, shape and epitope presentation. Here, we are providing an overview of the current state of knowledge with respect to the "prion-like" behavior of soluble oligomers for several of the amyloidogenic proteins involved in neurodegenerative diseases. In addition to providing new insight into pathogenic mechanisms, research in this field is leading to novel diagnostic and therapeutic opportunities for neurodegenerative diseases.

Also flagged:wound healingsynthesiscalcium carbonatesilvertitaniummineral
Journal Article 2024-08-05 No Snippets Al-Rawe RA, Al-Rammahi HM, Cahyanto A, Ma'amor A, Liew YM, Sukumaran P, Wan Hassan WN.
Show Full Abstract

<h4>Background</h4>Marine ecosystems, covering 70% of Earth's surface, hold immense biodiversity and potential for biomaterials. Cuttlefish bone (CB) and marine resources have gained attention as eco-friendly biomaterials.<h4>Objectives</h4>We aim to comprehensively study biomedical applications of CB-derived materials. By evaluating both in vivo and in vitro investigations, the review seeks to uncover the diverse potential of CB in the biomedical field.<h4>Methods</h4>A comprehensive search of electronic databases yielded 51 articles from 2408 studies. These studies encompassed in vivo animal studies and in vitro investigations.<h4>Results</h4>In vivo studies employed for bone repair, dorsal subcutaneous defects, thermal wound healing, muscle injections, and avian blood testing. In vitro studies focused on HAp synthesis, scaffold development, dental material enhancement, and antimicrobial properties. Risk of bias assessments revealed varying degrees of methodological quality in both animal and in vitro studies, underscoring the need for standardised reporting and rigorous study design in future research.<h4>Conclusions</h4>This review fills a gap in the literature by providing a comprehensive overview of the applications of CB-derived materials in the biomedical field. Additionally, it offers valuable insights for researchers, clinicians, and policymakers interested in sustainable and effective biomaterials for diverse medical purposes, advancing the fields of regenerative medicine and dentistry.

SOX6
Also flagged:tissue developmentcartilageSOX9collagen type IIextracellulardegradation
Journal Article 2024-08-05 ✓ 1 Snippet Jeyaraman M, Ramasubramanian S, Yadav S, Jeyaraman N.
In-Text Gene Mentions

…trio genes (SOX5,SOX6, and SOX9) are…

Show Full Abstract

Novel investigations of how microgravity affects cellular and tissue development have recently been made possible by the multidisciplinary fusion of tissue engineering and space science. This review examines the intersection of cartilage tissue engineering (CTE) and space science, focusing on how microgravity affects cartilage development. Space microgravity induces distinct physiological changes in chondrocytes, including a 20-30% increase in cell diameter, a 1.5- to 2-fold increase in proliferation rates, and up to 3-fold increases in chondrogenic markers such as SOX9 and collagen type II. These cellular alterations impact extracellular matrix composition and tissue structure. Space-optimized bioreactors using dynamic culture methods replicate physiological conditions and enhance tissue growth, but the absence of gravity raises concerns about the mechanical properties of engineered cartilage. Key research areas include the role of growth factors in cartilage development under microgravity, biocompatibility and degradation of scaffold materials in space, and in situ experiments on space stations. This review highlights the opportunities and challenges in leveraging microgravity for CTE advancements, emphasizing the need for continued research to harness space environments for therapeutic applications in cartilage regeneration. The multidisciplinary fusion of tissue engineering and space science opens novel avenues for understanding and improving cartilage tissue engineering, with significant implications for the future of biomedical applications in space and on Earth.

Also flagged:small nucleolartumortumorstranslationaloncogenestumor suppressor genes
Journal Article 2024-08-05 No Snippets Hu X, Cui W, Liu M, Zhang F, Zhao Y, Zhang M, Yin Y, Li Y, Che Y, Zhu X, Fan Y, Deng X, Wei M, Wu H.
Show Full Abstract

Recently, small nucleolar RNAs (snoRNAs) have transcended the genomic "noise" to emerge as pivotal molecular markers due to their essential roles in tumor progression. Substantial evidence indicates a strong association between snoRNAs and critical clinical features such as tumor pathology and drug resistance. Historically, snoRNA research has concentrated on two classical mechanisms: 2'-<i>O</i>-ribose methylation and pseudouridylation. This review specifically summarizes the novel regulatory mechanisms and functional patterns of snoRNAs in tumors, encompassing transcriptional, post-transcriptional, and post-translational regulation. We further discuss the synergistic effect between snoRNA host genes (SNHGs) and snoRNAs in tumor progression. More importantly, snoRNAs extensively contribute to the development of tumor cell resistance as oncogenes or tumor suppressor genes. Accordingly, we provide a comprehensive review of the clinical diagnosis and treatment associated with snoRNAs and explore their significant potential as novel drug targets.

Also flagged:Brucellosis Spondylodiscitisantibodiescyclic citrulline peptiderheumatoid arthritisRArheumatoid factor
Journal Article 2024-08-05 No Snippets Khaidarova Y, Kurmanova G, Nurgaliyeva G, Omarova M.
Show Full Abstract

<h4>Background</h4>High titers of specific antibodies to cyclic citrulline peptide (ACCP) are often present in the serum of patients with rheumatoid arthritis (RA) and, together with rheumatoid factor (RF), are a diagnostic marker of RA. Brucellosis is a zoonotic infection in which osteoarticular involvement occurs in 10-85% of patients. RF in brucellosis patients is significantly higher than in healthy people.<h4>Methods</h4>We presented 2 cases of brucellosis spondylodiscitis with positive results for RF and ACCP, which aroused great interest among the rheumatologists of our center.<h4>Results</h4>Both patients described were men (27 and 60 years old) with arthritis, back pain, and high levels of rheumatoid arthritis-specific antibodies. These patients were suspected of having tuberculous spondylitis, but the tuberculous process was excluded using specific tests. During antibacterial therapy, there is a dynamic decrease in antirheumatoid antibodies. X-rays of the hand joints revealed no signs of erosive arthritis.<h4>Conclusion</h4>All cases of arthritis, spondylitis, and spondylodiscitis in endemic areas require careful analysis and comparison of patients' clinical and laboratory-instrumental data to prevent misdiagnosis. With brucellosis infection, against the background of adequate antibacterial therapy, inflammation of the joints and spine is reversible.

Research Square 2024-08-05 Preprint (No Snippets API) Singh K, Jayaram M, Hanumantharaju A, Tõnissoo T, Jagomäe T, Mikheim K, Muthuraman S, Gilbert SF, Plaas M, Schäfer MK, Innos J, Lilleväli K, Philips M, Vasar E.
Show Full Abstract

<title>Abstract</title> <p>Deletions and malfunctions of the IgLON family of cell adhesion molecules are associated with anatomical, behavioral, and metabolic manifestations of neuropsychiatric disorders. We have previously shown that IgLON genes are expressed in sensory nuclei/pathways and that IgLON proteins modulate sensory processing. Here, we examined the expression of IgLON alternative promoter-specific isoforms during embryonic development and studied the sensory consequences of the anatomical changes when one of the IgLON genes, Negr1, is knocked out. At the embryonal age of E12.5 and E13.5, various IgLONs were distributed differentially and dynamically in the developing sensory areas within the central and peripheral nervous system, as well as in limbs and mammary glands. Sensory tests showed that Negr1 deficiency causes differences in vestibular function and temperature sensitivity in the knockout mice. Sex-specific differences were noted across olfaction, vestibular functioning, temperature regulation, and mechanical sensitivity. Our findings highlight the involvement of IgLON molecules during sensory circuit formation and suggest Negr1's critical role in somatosensory processing.</p>

bioRxiv 2024-08-05 Preprint (No Snippets API) Kaulich E, Waselenchuk Q, Fürst N, Desch K, Mosbacher J, Ciirdaeva E, Juengling M, Tushev G, Langer J, Schuman EM.
Show Full Abstract

<h4>ABSTRACT</h4> The molecular diversity of neurons and their synapses underlies the different responses and plasticity profiles that drive all neural circuits and behavior. While the extent of this diversity has been partially revealed by transcriptomic and proteomic profiling, combined studies of neuronal transcripts and proteins are limited. Here, we used microdissection of mouse hippocampal subregions and CA1 strata and fluorescence-activated synaptosome sorting (FASS) to characterize the transcripts and proteins from different hippocampal neurons and their compartments with synaptic resolution. Parallel RNA-seq and LC-MS/MS of microdissections identified over 15,000 mRNA transcripts and 10,000 proteins, revealing thousands with local enrichment such as classes of glutamate receptors and voltage-gated potassium channels, myelin-associated molecules, and adhesion molecules. Synaptosome analysis further identified specific enrichment of molecules from collagen, ribosome, solute carrier, and receptor families at different synapses formed along CA1 neurons. By integrating mRNA and protein data, we defined clusters of co-regulated molecules such as adhesion and neurofilament proteins and transporter mRNAs, and found subsets of mRNA-protein pairs with strong correlation and anti-correlation in their abundance variation. Our findings comprise a rich resource on the molecular landscape of the hippocampus and its synapses that is accessible at syndive.org , and highlight the coordinated organization of transcripts and proteins between regions, neuronal compartments, and synapses.

medRxiv 2024-08-05 Preprint (No Snippets API) Cuyàs B, Alvarado-Tapias E, Tan EH, Golozar A, Duarte-Salles T, Delmestri A, Ballbé JMA, Man WY, Burn E, Guarner-Argente C, Prieto Alhambra D, Newby D.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Background</h4> Primary liver cancer (PLC) remains a global health challenge. Understanding trends in the disease burden and survival is crucial to inform decisions regarding screening, prevention and treatment. <h4>Methods</h4> Population-based cohort study using UK primary care data from the Clinical Practice Research Datalink (CPRD) GOLD (2000 to 2021), replicated in CPRD Aurum. PLC incidence rates (IR), period prevalence (PP) and survival at one, five and ten years over the study period were calculated, and stratified by age, sex and diagnosis year. <h4>Results</h4> The crude IR of PLC was 4.56 (95%CI 4.42-4.70) per 100,000 person-years between 2000 and 2021, with an increase over time across age and sex strata. Sex-specific IR for males was higher than females, 6.60 (95%CI 6.36-6.85) vs. 2.58 (95%CI 2.44-2.74) per 100,000 person-years. Crude PP showed a 7-fold increase over the study period, with PP 0.02% (95%CI 0.019%-0.022%) in 2021, and a 2.8-fold higher PP in males. Survival at one, five and ten years after diagnosis was 41.7%, 13.2% and 7.1%, respectively, for both sexes. One-year survival increased only in men, from 33.2% in 2005-2009 to 49.3% in 2015-2019. <h4>Conclusion</h4> Over the past two decades, there has been a significant increase in the number of patients diagnosed with PLC. Despite a slight improvement in median and one-year survival in men, prognosis remains poor. To improve the survival of PLC patients, it is necessary to understand the epidemiological changes and address the preventable risk factors associated with liver disease and promote early detection and access to care. <h4>LAY SUMMARY</h4> This population-based cohort study shows that the incidence and prevalence of primary liver cancer in the UK has increased in the last 20 years across both sexes and age groups, with a 7-fold increase in crude period prevalence over the study period. One-year survival has improved only in males over the study period and, regrettably, no increases in long-term survival were observed. Our findings are a call for awareness to stimulate further research and public health actions on liver cancer.

Also flagged:AxonopathyAmyotrophic Lateral SclerosisALSneurodegenerative disordermitochondrialmicrotubules
Journal Article 2024-08-04 No Snippets Luan T, Li Q, Huang Z, Feng Y, Xu D, Zhou Y, Hu Y, Wang T.
Show Full Abstract

Amyotrophic Lateral Sclerosis (ALS) is a complex neurodegenerative disorder characterized by progressive axonopathy, jointly leading to the dying back of the motor neuron, disrupting both nerve signaling and motor control. In this review, we highlight the roles of axonopathy in ALS progression, driven by the interplay of multiple factors including defective trafficking machinery, protein aggregation, and mitochondrial dysfunction. Dysfunctional intracellular transport, caused by disruptions in microtubules, molecular motors, and adaptors, has been identified as a key contributor to disease progression. Aberrant protein aggregation involving TDP-43, FUS, SOD1, and dipeptide repeat proteins further amplifies neuronal toxicity. Mitochondrial defects lead to ATP depletion, oxidative stress, and Ca<sup>2+</sup> imbalance, which are regarded as key factors underlying the loss of neuromuscular junctions and axonopathy. Mitigating these defects through interventions including neurotrophic treatments offers therapeutic potential. Collaborative research efforts aim to unravel ALS complexities, opening avenues for holistic interventions that target diverse pathological mechanisms.

HTT
Also flagged:posttranslational modificationsneurodegenerative diseasesAlzheimer diseaseParkinson diseaseHuntington diseaseneurodegenerative disease
Journal Article 2024-08-04 ✓ 5 Snippets Ramazi S, Dadzadi M, Darvazi M, Seddigh N, Allahverdi A.
In-Text Gene Mentions

…Notably, theHttprotein, which is…

…expansion in theHttprotein triggers its…

…region of theHttprotein has revealed…

…residues in theHttprotein can be…

…negative modifications inHttfunction.…

Show Full Abstract

Posttranslational modifications play a crucial role in governing cellular functions and protein behavior. Researchers have implicated dysregulated posttranslational modifications in protein misfolding, which results in cytotoxicity, particularly in neurodegenerative diseases such as Alzheimer disease, Parkinson disease, and Huntington disease. These aberrant posttranslational modifications cause proteins to gather in certain parts of the brain that are linked to the development of the diseases. This leads to neuronal dysfunction and the start of neurodegenerative disease symptoms. Cognitive decline and neurological impairments commonly manifest in neurodegenerative disease patients, underscoring the urgency of comprehending the posttranslational modifications' impact on protein function for targeted therapeutic interventions. This review elucidates the critical link between neurodegenerative diseases and specific posttranslational modifications, focusing on Tau, APP, α-synuclein, Huntingtin protein, Parkin, DJ-1, and Drp1. By delineating the prominent aberrant posttranslational modifications within Alzheimer disease, Parkinson disease, and Huntington disease, the review underscores the significance of understanding the interplay among these modifications. Emphasizing 10 key abnormal posttranslational modifications, this study aims to provide a comprehensive framework for investigating neurodegenerative diseases holistically. The insights presented herein shed light on potential therapeutic avenues aimed at modulating posttranslational modifications to mitigate protein aggregation and retard neurodegenerative disease progression.

Also flagged:Cannabidiolacute liver injurypullulanpolysaccharidedeoxycholic acidα-lipoic acid
Journal Article 2024-08-04 No Snippets Zhang X, Yi X, Gao X, Li Y, Shen X.
Show Full Abstract

The purpose of this work was to construct liver-targeted nanoparticles based on the redox response to effectively deliver cannabidiol (CBD) for the prevention of acute liver injury (ALI). CBD-loaded nanoparticles (CBD NPs) with a particle size of 126.5 ± 1.56 nm were prepared using the polymer DA-PP-LA obtained by grafting pullulan polysaccharide with deoxycholic acid (DA) and α-lipoic acid (α-LA). CBD NPs showed typical redox-response release behavior. Interestingly, CBD NPs exhibited admirable liver targeting ability, significantly accumulated in the liver, and effectively promoted the internalization of CBD in liver cells, thus effectively reducing the H<sub>2</sub>O<sub>2</sub>-induced oxidative damage of HepG2 cells and avoiding apoptosis. More importantly, CBD NPs effectively prevented CCl<sub>4</sub>-induced ALI by protecting liver function, ameliorating oxidative stress levels, inhibiting the production of inflammatory factors, and protecting the liver from histological damage. This study provides a promising strategy for achieving targeted delivery of CBD NPs in the liver, thereby effectively preventing ALI.

HTT
Also flagged:alexithymiasolute carrier family 6 member 4metabolismpathogenesisSLC6A4serotonin 1A receptor
Journal Article 2024-08-04 ✓ 1 Snippet Hernández-Díaz Y, Genis-Mendoza AD, González-Castro TB, Fresán A, Tovilla-Zárate CA, López-Narváez ML, Juárez-Rojop IE, Nicolini H.
In-Text Gene Mentions

…droxy Tryptamine Transporter (5-HTT), is encoded in…

Show Full Abstract

<h4>Background</h4>Alexithymia is a trait involving difficulties in processing emotions. Genetic association studies have investigated candidate genes involved in alexithymia's pathogenesis. Therefore, the aim of the present study was to perform a systematic review of the genetic background associated with alexithymia.<h4>Methods</h4>A systematic review of genetic studies of people with alexithymia was conducted. Electronic databases including PubMed, Scopus, and Web of Science were searched for the study purpose. We used the words "Alexithymia", "gene", "genetics", "variants", and "biomarkers". The present systematic review was performed following the Preferred Reporting Items for Systematic reviews and Meta-Analyses statement. We found only candidate gene studies. A total of seventeen studies met the eligibility criteria, which comprised 22,361 individuals. The candidate genes associated with alexithymia were the serotoninergic pathway genes solute carrier family 6 member 4 (<i>SLC6A4</i>), serotonin 1A receptor (<i>HTR1A</i>), and serotonin 1A receptor (<i>HTR2A</i>); the neurotransmitter metabolism genes dopamine receptor D2 (<i>DRD2</i>), ankyrin repeat and kinase domain containing 1 (<i>ANKK1</i>), catechol-o-methyltransferase (<i>COMT</i>), brain-derived neurotrophic factor (<i>BDNF</i>), and oxytocin receptor (<i>OXTR</i>); and other pathway genes, vitamin D-binding protein (<i>VDBP</i>), tumor protein P53 regulated apoptosis inducing protein 1 (<i>TP53AIP1</i>), Rho GTPase Activating Protein 32 (<i>ARHGAP32</i>), and transmembrane protein 88B (<i>TMEM88B</i>).<h4>Conclusion</h4>The results of this study showed that only case-control gene studies have been performed in alexithymia. On the basis of our findings, the majority of alexithymia genes and polymorphisms in this study belong to the serotoninergic pathway and neurotransmitter metabolism genes. These data suggest a role of serotoninergic neurotransmission in alexithymia. Nevertheless, more and future research is required to learn about the role of these genes in alexithymia.

Also flagged:PeroxidasePeroxiredoxinsperoxidehydrogenhydroperoxidescysteine
Journal Article 2024-08-04 No Snippets Qausain S, Basheeruddin M.
Show Full Abstract

Peroxiredoxins (Prxs) are members of the antioxidant enzymes necessary for every living object in the three domains of life and play critical roles in controlling peroxide levels in cells. This comprehensive literature review aims to elucidate the peroxidase activity of Prxs, examining their roles and significance for organisms across various taxa. Ironically, the primary role of the Prxs is the peroxidase activity, which comprises the reduction of hydrogen peroxide and other organic hydroperoxides and decreases the risk of oxidative damage in the cells. The above enzymatic activity occurs through the reversible oxidation-reduction catalyzed by cysteine residues in the active site by forming sulfenic acid and reduction by intracellular reductants. Structurally and functionally, Prxs function as dimers or decamers and show different catalytic patterns according to their subfamilies or cellular compartments. Compared to the mechanisms of the other two subgroups of Prxs, including 2-Cys Prxs and atypical Prxs, the 1-Cys Prxs have monomer-dimer switch folding coupled with catalytic activity. In addition to their peroxidase activity, which is widely known, Prxs are becoming acknowledged to be involved in other signaling processes, including redox signaling and apoptosis. This aversion to oxidative stress and regulation by the cellular redox state places them at the heart of adaptive cellular responses to changes in the environment or manifestations of diseases. In conclusion, based on the data obtained and on furthering the knowledge of Prxs' structure and function, these enzymes may be classified as a diverse yet essential family of proteins that can effectively protect cells from the adverse effects of oxidative stress due to peroxidase activity. This indicates secondary interactions, summarized as peroxide detoxification or regulatory signaling, and identifies their applicability in multiple biological pathways. Such knowledge is valuable for enhancing the general comprehension of essential cellular functions and disclosing further therapeutic approaches to the diseases caused by the increased production of reactive oxygen species.

Also flagged:deathBronchopulmonary dysplasiaoxygenRAgestationcerebral palsy
Journal Article 2024-08-03 No Snippets Aleem S, Do BT, Gantz MG, Hibbs AM, Jensen EA, Cotten CM, Malcolm WF, Jobe AH, Greenberg RG, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>Evaluate the association between results of the room air (RA) challenge and death, respiratory morbidity, and neurodevelopmental impairment (NDI) at 2 years' corrected age.<h4>Study design</h4>Cohort study of infants born <27 weeks' gestational age who underwent a RA challenge to determine BPD diagnosis at 36 weeks postmenstrual age.<h4>Results</h4>Of 1022 infants eligible for the RA challenge, 554 underwent testing and 223 passed. Test result was not associated with death or serious respiratory morbidities [adjusted relative risk (aRR) 1.01, 95% confidence interval (CI) 0.65-1.56] or death or moderate/severe NDI (aRR 1.06, 95% CI 0.81-1.39) at 2 years.<h4>Conclusion</h4>Results of the RA challenge were not associated with differences in respiratory or neurodevelopmental morbidity at 2 years, suggesting the RA challenge does not add prognostic value in contemporary extremely preterm infants.<h4>Clinicaltrials</h4><h4>Gov id</h4>Generic Database: NCT00063063.

STAU1
Also flagged:MDM2testicular germ cell tumorApoptosis of germ cellscancerLINC03074testicular germ cell tumors
Journal Article 2024-08-03 ✓ 5 Snippets Ito S, Ueno A, Ueda T, Ogura R, Sako S, Gabata Y, Murashita J, Takahashi H, Ukimura O.
In-Text Gene Mentions

…LINC03074 stimulatesSTAU1-mediated nuclear export of…

…mRNA by increasingSTAU1binding to MDM2…

…such as Staufen1 (STAU1) and adenosine deaminase…

STAU1binds to IR…

…enzyme, competes withSTAU1for the occupancy…

Show Full Abstract

Germ cells preferentially induce apoptosis in response to DNA damage to avoid genomic mutations. Apoptosis of germ cells is closely related to cancer development and chemotherapy resistance; however, its regulatory mechanism is unclear. Here, we suggest that testis-specific lncRNA LINC03074 is involved in male germ cell apoptosis by regulating the expression of the proto-oncogene MDM2. LINC03074 is highly expressed in the sperm of healthy adult testes and cancer cells of testes with testicular germ cell tumors (TGCTs). LINC03074 binds to MDM2 mRNA via an Alu element, thereby reducing MDM2 protein levels. LINC03074 stimulates STAU1-mediated nuclear export of MDM2 mRNA by increasing STAU1 binding to MDM2 mRNA in the cell nucleus, thereby promoting PKR-mediated translational repression in the cytoplasm. The induction of apoptosis in TGCT cells and their responsiveness to the anticancer drug cisplatin is enhanced by LINC03074. Notably, LINC03074 increased E2F1 expression without increasing p53, the primary target of MDM2, and upregulated the apoptotic gene p73, the target gene of E2F1. LINC03074-mediated regulation of apoptosis contributes to the responsiveness of TGCTs to anticancer drug-induced DNA damage.

Also flagged:extracellularvesiclesacidificationlactationtranslationalsignal transduction
Journal Article 2024-08-03 No Snippets Mecocci S, Pietrucci D, Milanesi M, Capomaccio S, Pascucci L, Evangelista C, Basiricò L, Bernabucci U, Chillemi G, Cappelli K.
Show Full Abstract

Recently, much interest has been raised for the characterization of signaling molecules carried by extracellular vesicles (EVs), which are particularly enriched in milk (mEVs). Such interest is linked to the capability of EVs to cross biological barriers, resist acidification in the gastric environment, and exert modulation of the immune system, mainly through their microRNA (miRNA) content. We characterized the small-RNA cargo of colostrum EVs (colosEVs) and mEVs from Italian Mediterranean buffalo through next generation sequencing. Colostrum (first milking after birth) and milk (day 50 of lactation) were sampled from seven subjects from five farms. ColosEVs and mEVs were subjected to morphological characterization, followed by high-depth sequencing of small RNA libraries produced from total RNA. The main difference was the amount of EV in the two samples, with colostrum showing 10 to 100-fold higher content than milk. For both matrices, miRNA was the most abundant RNA species (95% for colosEVs and 96% for mEVs) and three lists were identified: colosEV-specific, mEV-specific and shared most expressed. Gene ontology (GO) enrichment analysis on miRNA targets highlighted many terms related to the epigenetic, transcriptional and translational regulations across the three lists, with a higher number of enriched terms for colosEV-specific miRNAs. Terms specific to colosEVs were related to "cell differentiation" and "microvillus assembly", while for mEV "cardiac and blood vessel development" and "mitochondria" emergerd. Immune modulation terms were found for both sample-specific miRNAs. Overall, both matrices carry a similar molecular message in terms of biological processes potentially modulated into receiving cells, but there is significant difference in the abundance, with colostrum containing much more EVs than milk. Moreover, colosEVs carry molecules involved in signal transduction, cell cycle and immune response, as for mEVs and EVs of other previously characterized species, but with a special enrichment for miRNAs with epigenetic regulation capacities. These beneficial characteristics of colosEVs and mEVs are essential for the calf and could also be exploited for the therapeutic purposes in humans, although further studies are necessary to measure the sanitization treatment impact on EV conservation, especially in buffalo where milk is consumed almost exclusively after processing.

Also flagged:PTIPcell cyclechromatintranscription factorstrimethylationhistone H3
Journal Article 2024-08-03 No Snippets Nakata Y, Nagasawa S, Sera Y, Yamasaki N, Kanai A, Kobatake K, Ueda T, Koizumi M, Manabe I, Kaminuma O, Honda H.
Show Full Abstract

The genome is constantly exposed to DNA damage from endogenous and exogenous sources. Fine modulation of DNA repair, chromatin remodeling, and transcription factors is necessary for protecting genome integrity, but the precise mechanisms are still largely unclear. We found that after ionizing radiation (IR), global trimethylation of histone H3 at lysine 4 (H3K4me3) was decreased at an early (5 min) post-IR phase but increased at an intermediate (180 min) post-IR phase in both human and mouse hematopoietic cells. We demonstrated that PTIP, a component of the MLL histone methyltransferase complex, is required for H3K4me3 upregulation in the intermediate post-IR phase and promotes cell cycle arrest by epigenetically inducing a cell cycle inhibitor, PRDM1. In addition, we found that PTIP expression is specifically downregulated in acute myeloid leukemia patients. These findings collectively suggest that the PTIP-PRDM1 axis plays an essential role in proper DNA damage response and its deregulation contributes to leukemogenesis.

B4GALT5
Also flagged:α1,4-galactosyltransferaseA4galtGolgi apparatusGTglycoproteinsShiga toxin types 1
Journal Article 2024-08-03 ✓ 3 Snippets Mikołajczyk K, Wróblewski K, Kmiecik S.
In-Text Gene Mentions

…5 and 6 (B4galt5and B4galt6).…

…with B4galt1 andB4galt5in two cell…

…highlighted that the A4galt-B4galt5heterodimer exhibited the…

Show Full Abstract

Human α1,4-galactosyltransferase (A4galt), a Golgi apparatus-resident GT, synthesizes Gb3 glycosphingolipid (GSL) and P1 glycotope on glycoproteins (GPs), which are receptors for Shiga toxin types 1 and 2. Despite the significant role of A4galt in glycosylation processes, the molecular mechanisms underlying its varied acceptor specificities remain poorly understood. Here, we attempted to elucidate A4galt specificity towards GSLs and GPs by exploring its interaction with GTs with various acceptor specificities, GP-specific β1,4-galactosyltransferase 1 (B4galt1) and GSL-specific β1,4-galactosyltransferase isoenzymes 5 and 6 (B4galt5 and B4galt6). Using a novel NanoBiT assay, we found that A4galt can form homodimers and heterodimers with B4galt1 and B4galt5 in two cell lines, human embryonic kidney cells (HEK293T) and Chinese hamster ovary cells (CHO-Lec2). We found that A4galt-B4galts heterodimers preferred N-terminally tagged interactions, while in A4galt homodimers, the favored localization of the fused tag depended on the cell line used. Furthermore, by employing AlphaFold for state-of-the-art structural prediction, we analyzed the interactions and structures of these enzyme complexes. Our analysis highlighted that the A4galt-B4galt5 heterodimer exhibited the highest prediction confidence, indicating a significant role of A4galt heterodimerization in determining enzyme specificity toward GSLs and GPs. These findings enhance our knowledge of A4galt acceptor specificity and may contribute to a better comprehension of pathomechanisms of the Shiga toxin-related diseases.

BTN2A2BTN2A1
Also flagged:Poliovirus Receptor-like 3Triple-negative breast cancerbreast cancerestrogen receptorsprogesterone receptorsHER2
Journal Article 2024-08-03 ✓ 2 Snippets Leone GM, Mangano K, Caponnetto S, Fagone P, Nicoletti F.
In-Text Gene Mentions
⭐ same-sentence co-mention

…follows: co-stimulator genes (BTN2A1, BTN2A2, BTN3A1, BTNL2,…

⭐ same-sentence co-mention

…co-stimulator genes (BTN2A1,BTN2A2, BTN3A1, BTNL2, BTNL3,…

Show Full Abstract

Triple-negative breast cancer (TNBC) represents an aggressive subtype of breast cancer, with a bad prognosis and lack of targeted therapeutic options. Characterized by the absence of estrogen receptors, progesterone receptors, and HER2 expression, TNBC is often associated with a significantly lower survival rate compared to other breast cancer subtypes. Our study aimed to explore the prognostic significance of 83 immune-related genes, by using transcriptomic data from the TCGA database. Our analysis identified the Poliovirus Receptor-Like 3 protein (PVRL3) as a critical negative prognostic marker in TNBC patients. Furthermore, we found that the Enhancer of Zeste Homolog 2 (EZH2), a well-known epigenetic regulator, plays a pivotal role in modulating PVRL3 levels in TNBC cancer cell lines expressing EZH2 along with high levels of PVRL3. The elucidation of the EZH2-PVRL3 regulatory axis provides valuable insights into the molecular mechanisms underlying TNBC aggressiveness and opens up potential pathways for personalized therapeutic intervention.

Also flagged:Yes-Associated ProteinTAZTranscriptional Coactivator withcancerskidney cancerRenal cell carcinoma
Journal Article 2024-08-03 No Snippets Mondal V, Higgins PJ, Samarakoon R.
Show Full Abstract

Although Hippo-YAP/TAZ pathway involvement has been extensively studied in the development of certain cancers, the involvement of this cascade in kidney cancer progression is not well-established and, therefore, will be the focus of this review. Renal cell carcinoma (RCC), the most prevalent kidney tumor subtype, has a poor prognosis and a high mortality rate. Core Hippo signaling inactivation (e.g., LATS kinases) leads to the nuclear translocation of YAP/TAZ where they bind to co-transcriptional factors such as TEAD promoting transcription of genes which initiates various fibrotic and neoplastic diseases. Loss of expression of LATS1/2 kinase and activation of YAP/TAZ correlates with poor survival in RCC patients. Renal-specific ablation of LATS1 in mice leads to the spontaneous development of several subtypes of RCC in a YAP/TAZ-dependent manner. Genetic and pharmacological inactivation of YAP/TAZ reverses the oncogenic potential in LATS1-deficient mice, highlighting the therapeutic benefit of network targeting in RCC. Here, we explore the unique upstream controls and downstream consequences of the Hippo-YAP/TAZ pathway deregulation in renal cancer. This review critically evaluates the current literature on the role of the Hippo pathway in RCC progression and highlights the recent scientific evidence designating YAP/TAZ as novel therapeutic targets against kidney cancer.

Also flagged:mineralhematoxylinbone formationinfectionCytokineOsteogenesis
Journal Article 2024-08-03 No Snippets Fekrazad S, Farzad-Mohajeri S, Mashhadiabbas F, Daghighi H, Arany PR, Fekrazad R.
Show Full Abstract

<b>Introduction:</b> This study explored the synergistic effects of low-level laser therapy (LLLT) and adipose-derived stem cells (ADSCs) on cranial bone regeneration in rats, addressing the limitations of autogenous grafts and advancing bone tissue engineering with innovative photobiomodulation (PBM) applications. <b>Methods:</b> Sixty Wistar rats were allocated to 5 separate groups randomly; (1) natural bovine bone mineral (NBBM); (2) NBBM+LLLT; (3) NBBM+allogenic ADSCs; (4) NBBM+allogenic ADSCs+LLLT; (5) Only defects. 8-mm calvarial defects were made in each rat in the surgical procedure. A diode laser was applied with the following parameters (continuous mode, power of 100mW, wavelength of 808nm, and 4 J/cm2 energy density) immediately after the procedure and every other day. Bone samples were obtained and assessed histomorphometrically and histologically after staining with hematoxylin and eosin (H&E). <b>Results:</b> Different volumes of bony material were observed in two weeks; 2.94%±1.00 in group 1, 5.1%±1.92 in group 2, 7.11%±2.82 in group 3, 7.34%±2.31 in group 4, and 2.01%±0.83 in group 5 (P<0.05). On the other hand, foreign body residuals were up by 23% in the groups with scaffolding by the end of 2 weeks. Four weeks of observation led to 6.74 %±1.95, 13.24%±1.98, 15.76%±1.19, 15.92%±3.4, and 3.11%±1.00 bone formation in groups 1 to 5, respectively (<i>P</i><0.05). Generally, the difference between groups 2-4 was not statistically significant based on different types of bone and the extent of inflammation. <b>Conclusion:</b> Bearing in mind the limitations of our research, it was demonstrated that ADSCs in combination with PBM have promising effects on bone tissue regeneration in sizeable bony defects. Furthermore, this study also showed that PBM usage improved the newly regenerated bone quality.

Also flagged:ionsmetalmetalspersistent infectionhypersensitivity reactionsoxygen
Journal Article 2024-08-03 No Snippets Safin Kaosar Saad K, Saba T, Bin Rashid A.
Show Full Abstract

Physical vapor deposition (PVD) coating is a versatile and well-liked method for depositing thin films of materials onto surfaces in a range of industries. Due to their numerous functional and aesthetic benefits, PVD coatings are beneficial in several applications, from electronics and optics to automotive and medical equipment. PVD coating technology dramatically improves the effectiveness and quality of medical implants. PVD-coated medical implants improve osseointegration, lower wear and friction, increase corrosion resistance, and have antibacterial properties, which lead to better patient outcomes, fewer complications, and overall higher quality of life for people who need implantable medical devices. The essential concepts of PVD coating and the numerous deposition techniques and materials used are covered at the study's outset. The specific uses of PVD-coated medical implants are then highlighted, including those for orthopedic and dental implants and cardiovascular and neurosurgical devices. The review also emphasizes the critical contribution of PVD coatings to reducing wear and friction, improving corrosion resistance, augmenting biocompatibility, enhancing osseointegration, and aesthetic appeal. The challenges and prospects of PVD coating technologies were further addressed in this article. This review is invaluable for academics, doctors, and businesspeople interested in the beneficial combination of PVD coating and medical implantology.

HFE
Also flagged:HyperferritinemiaType 2 Diabetes MellitusMetabolic dysfunction-associated steatotic liver diseasemetabolic dysfunction-associated steatohepatitisliver cirrhosishepatocellular carcinoma
Journal Article 2024-08-03 ✓ 3 Snippets Elmakki EE.
In-Text Gene Mentions

…this case includedhemochromatosis.…

…clinical features ofhemochromatosis, normal transferrin saturatio…

…cases from classicalhemochromatosis.…

Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a common complication in patients with type 2 diabetes mellitus (T2DM), potentially progressing to more severe conditions such as metabolic dysfunction-associated steatohepatitis (MASH), liver cirrhosis, and hepatocellular carcinoma. This case study presents a 55-year-old man with long-standing T2DM who was found to have deranged liver function tests, elevated serum iron, and hyperferritinemia during a routine follow-up visit. The patient's clinical presentation, laboratory findings, and imaging results led to a diagnosis of MASH, complicated by dysregulated iron metabolism. This case highlights the importance of vigilant monitoring of liver function and iron studies in T2DM patients. Furthermore, it illustrates the challenges in managing the complex interplay between metabolic syndrome, liver dysfunction, and cardiovascular risk.

bioRxiv 2024-08-03 Preprint (No Snippets API) Chopra H, Cao C, Alice H, Kak S, Maska B, Tagett R, Sugai J, Garmire L, Kaigler D.
Show Full Abstract

<h4>Background</h4> Mesenchymal stem cells (MSCs) offer clinical promise for use in cell therapy approaches for regenerative medicine. A therapeutic challenge is that MSCs from different tissues are phenotypically and functionally distinct. Therefore, this study aims to molecularly characterize oral-derived MSCs by defining one of the three hallmarks of MSCs, differentiation potential, to discern their true molecular identities. <h4>Methods</h4> Three different populations of oral tissue MSCs (from alveolar bone-aBMSCs; from dental pulp-DPSCs; and from gingiva-GMSCs) from three different patients were isolated and cultured. These MSCs were characterized for their stemness by flow cytometry and multi-differentiation potential, and their RNA was also isolated and analyzed quantitatively with RNA sequencing. Total mRNA-seq was performed and differentially expressed genes (DEGs) were identified in pairwise (DPSCs vs. aBMSCs, GMSCs vs. aBMSCs, and GMSCs vs. DPSCs) and tissue-specific comparisons (aBMSCs vs. Others, DPSCs vs. Others, GMSCs vs. Others) (FDR, p<0.05 ). Further, these DEGs, either common between MSC populations or unique to a specific MSC population, were evaluated for pathways and biological processes <h4>Results</h4> aBMSCs, DPSCs, and GMSCs were successfully isolated and characterized. The tissue-specific comparison revealed that DEGs were most numerous in DPSCs (693 genes) as compared to aBMSCs (103 genes) or DPSCs (232 genes). Statistically significant DEGs through pairwise comparisons present higher numbers in GMSCs vs. DPSCs (627) as compared to either DPSCs vs aBMSCs (286) or GMSCs vs. aBMSCs (82). Further analysis found that RUNX2, IBSP, SOX6, ACAN, and VCAM1 were significantly upregulated in aBMSCs. In DPSCs, BMP4 and IL6 were significantly downregulated, whereas AXL and NES were significantly upregulated. In GMSCs, AGPT1, SEMA4D, and PGDFA were significantly downregulated. Additionally, MAPK, PI3-AKT, and RAS signaling pathways were significantly regulated in GMSCs. Interestingly, aBMSCs and DPSCs revealed positive regulation of osteoblast differentiation, whereas GMSCs revealed negative regulation of osteoblast differentiation. DPSCs also revealed negative regulation of angiogenesis. <h4>Conclusions</h4> Oral-derived MSCs have an inherent “landscape” of differentiation defined by their tissue of origin; yet this differentiation potential can be modulated by their microenvironment. <h4>Graphical Abstract</h4>

Also flagged:dienessynthesisLGOdiolcarboxylic acidsdegradation
Journal Article 2024-08-02 No Snippets Pezzana L, Fadlallah S, Giri G, Archimbaud C, Roppolo I, Allais F, Sangermano M.
Show Full Abstract

Additive manufacturing (AM) is a well-established technique that allows for the development of complex geometries and structures with multiple applications. While considered a more environmentally-friendly method than traditional manufacturing, a significant challenge lies in the availability and ease of synthesis of bio-based alternative resins. In our endeavor to valorize biomass, this work proposes the synthesis of new α,ω-dienes derived from cellulose-derived levoglucosenone (LGO). These dienes are not only straightforward to synthesize but also offer a tunable synthesis approach. Specifically, LGO is first converted into diol precursor, which is subsequently esterified using various carboxylic acids (in this case, 3-butenoic, and 4-pentenoic acids) through a straightforward chemical pathway. The resulting monomers were then employed in UV-activated thiol-ene chemistry for digital light process (DLP). A comprehensive study of the UV-curing process was carried out by Design of Experiment (DoE) to evaluate the influence of light intensity and photoinitiator to find the optimal curing conditions. Subsequently, a thorough thermo-mechanical characterization highlighted the influence of the chemical structure on material properties. 3D printing was performed, enabling the fabrication of complex and self-stain structures with remarkable accuracy and precision. Lastly, a chemical degradation study revealed the potential for end-of-use recycling of the bio-based thermosets.

Also flagged:tauautosomal dominant ADLOADADγ-secretase
Journal Article 2024-08-02 No Snippets Sun Z, Kwon JS, Ren Y, Chen S, Walker CK, Lu X, Cates K, Karahan H, Sviben S, Fitzpatrick JAJ, Valdez C, Houlden H, Karch CM, Bateman RJ, Sato C, Mennerick SJ, Diamond MI, Kim J, Tanzi RE, Holtzman DM, Yoo AS.
Show Full Abstract

Late-onset Alzheimer's disease (LOAD) is the most common form of Alzheimer's disease (AD). However, modeling sporadic LOAD that endogenously captures hallmark neuronal pathologies such as amyloid-β (Aβ) deposition, tau tangles, and neuronal loss remains an unmet need. We demonstrate that neurons generated by microRNA (miRNA)-based direct reprogramming of fibroblasts from individuals affected by autosomal dominant AD (ADAD) and LOAD in a three-dimensional environment effectively recapitulate key neuropathological features of AD. Reprogrammed LOAD neurons exhibit Aβ-dependent neurodegeneration, and treatment with β- or γ-secretase inhibitors before (but not subsequent to) Aβ deposit formation mitigated neuronal death. Moreover inhibiting age-associated retrotransposable elements in LOAD neurons reduced both Aβ deposition and neurodegeneration. Our study underscores the efficacy of modeling late-onset neuropathology of LOAD through high-efficiency miRNA-based neuronal reprogramming.

HTT
Also flagged:Premature ejaculationPESerotonin5-hydroxytryptaminecoagulationejaculation
Journal Article 2024-08-02 ✓ 1 Snippet Huang YY, Ye N, Peng DW, Li GY, Zhang XS.
In-Text Gene Mentions

…the 5-HT transporter (5-HTT), which transports 5-HT…

Show Full Abstract

<h4>Abstract</h4>Parameters of peripheral blood cell have been shown as the potential predictors of erectile dysfunction (ED). To investigate the clinical significance of hematological parameters for predicting the risk of rapid ejaculation, we established a rat copulatory model on the basis of ejaculation distribution theory. Blood samples from different ejaculatory groups were collected for peripheral blood cell counts and serum serotonin (5-HT) tests. Meanwhile, the relationship between hematological parameters and ejaculatory behaviors was assessed. Final analysis included 11 rapid ejaculators, 10 normal ejaculators, and 10 sluggish ejaculators whose complete data were available. The platelet (PLT) count in rapid ejaculators was significantly lower than that in normal and sluggish ejaculators, whereas the platelet distribution width (PDW) and mean platelet volume (MPV) were significantly greater in rapid ejaculators. Multivariate logistic regression analysis and receiver operating characteristic (ROC) curve analysis showed that the PLT was an independent protective factor for rapid ejaculation. Meanwhile, rapid ejaculators were found to have the lowest serum 5-HT compared to normal and sluggish ejaculators ( P < 0.001). Furthermore, there was a positive correlation between the PLT and serum 5-HT ( r = 0.662, P < 0.001), indicating that the PLT could indirectly reflect the serum 5-HT concentration. In addition, we assessed the association between the PLT and ejaculatory parameters. There was a negative correlation between ejaculation frequency (EF) and the PLT ( r = -0.595, P < 0.001), whereas there was a positive correlation between ejaculation latency (EL) and the PLT ( r = 0.740, P < 0.001). This study indicated that the PLT might be a useful and convenient diagnostic marker for predicting the risk of rapid ejaculation.

Also flagged:Diabetesinsulin
Journal Article 2024-08-02 No Snippets Eichinger V, de Klepper M, Silbermann S, Roux H, Heinemann L.
Show Full Abstract

No abstract available.

SERPINC1
Also flagged:Proton pumpeosinophilic esophagitisantigen presentationinflammatory diseasetissuetype 2 cytokines
Journal Article 2024-08-02 ✓ 1 Snippet Molina-Jiménez F, Ugalde-Triviño L, Arias-González L, Armenteros E, Relaño-Rupérez C, Casabona S, Moreno-Monteagudo JA, Pérez-Fernández MT, Martín-Domínguez V, Fernández-Pacheco J, Laserna-Mendieta EJ, Muñoz-Hernández P, García-Martínez J, Muñoz J, Lucendo AJ, Santander C, Majano P.
In-Text Gene Mentions

…C member 1 (SERPINC1), and microsomal triglyceride…

Show Full Abstract

<h4>Background</h4>Recently, we have identified a dysregulated protein signature in the esophageal epithelium of eosinophilic esophagitis (EoE) patients including proteins associated with inflammation and epithelial barrier function; however, the effect of proton pump inhibitor (PPI) treatment on this signature is unknown. Herein, we used a proteomic approach to investigate: (1) whether PPI treatment alters the esophageal epithelium protein profile observed in EoE patients and (2) whether the protein signature at baseline predicts PPI response.<h4>Methods</h4>We evaluated the protein signature of esophageal biopsies using a cohort of adult EoE (n = 25) patients and healthy controls (C) (n = 10). In EoE patients, esophageal biopsies were taken before (pre) and after (post) an 8-week PPI treatment, determining the histologic response. Eosinophil count PostPPI was used to classify the patients: ≥15 eosinophils/hpf as non-responders (non-responder) and < 15 eosinophils/hpf as responders (R). Protein signature was determined and differentially accumulated proteins were characterized to identify altered biological processes and signaling pathways.<h4>Results</h4>Comparative analysis of differentially accumulated proteins between groups revealed common signatures between three groups of patients with inflammation (responder-PrePPI, non-responder-PrePPI, and non-responder-PostPPI) and without inflammation (controls and responder-PostPPI). PPI therapy almost reversed the EoE specific esophageal protein signature, which is enriched in pathways associated with inflammation and epithelial barrier function, in responder-PostPPI. Furthermore, we identified a set of candidate proteins to differentiate responder-PrePPI and non-responder-PrePPI EoE patients before treatment.<h4>Conclusion</h4>These findings provide evidence that PPI therapy reverses the alterations in esophageal inflammatory and epithelial proteins characterizing EoE, thereby providing new insights into the mechanism of PPI clinical response. Interestingly, our results also suggest that PPI response could be predicted at baseline in EoE.

Also flagged:gastric cancercancerHER2VEGFgene expressiontumor
Journal Article 2024-08-02 No Snippets Ma Y, Jiang Z, Pan L, Zhou Y, Xia R, Liu Z, Yuan L.
Show Full Abstract

Gastric cancer (GC) is a complex and heterogeneous disease with significant phenotypic and genetic variation. Traditional classification systems rely mainly on the evaluation of clinical pathological features and conventional biomarkers and might not capture the diverse clinical processes of individual GCs. The latest discoveries in omics technologies such as next‑generation sequencing, proteomics and metabolomics have provided crucial insights into potential genetic alterations and biological events in GC. Clustering strategies for identifying subtypes of GC might offer new tools for improving GC treatment and clinical trial outcomes by enabling the development of therapies tailored to specific subtypes. However, the feasibility and therapeutic significance of implementing molecular classifications of GC in clinical practice need to addressed. The present review examines the current molecular classifications, delineates the prevailing landscape of clinically relevant molecular features, analyzes their correlations with traditional GC classifications, and discusses potential clinical applications.

LRRC7
Also flagged:NCAPD2liver canceroncogenetumorwound healingcell cycle
Journal Article 2024-08-02 ✓ 1 Snippet Gu JX, Huang K, Zhao WL, Zheng XM, Wu YQ, Yan SR, Huang YG, Hu P.
In-Text Gene Mentions

Condensincomplexes exert an…

Show Full Abstract

Non‑SMC condensin I complex subunit D2 (<i>NCAPD2</i>) is a newly identified oncogene; however, the specific biological function and molecular mechanism of NCAPD2 in liver cancer progression remain unknown. In the present study, the aberrant expression of <i>NCAPD2</i> in liver cancer was investigated using public tumor databases, including TNMplot, The Cancer Genome Atlas and the International Cancer Genome Consortium based on bioinformatics analyses, and it was validated using a clinical cohort. It was revealed that NCAPD2 was significantly upregulated in liver cancer tissues compared with in control liver tissues, and <i>NCAPD2</i> served as an independent prognostic factor and predicted poor prognosis in liver cancer. In addition, the expression of NCAPD2 was positively correlated with the percentage of Ki67<sup>+</sup> cells. Finally, single‑cell sequencing data, gene‑set enrichment analyses and <i>in</i> <i>vitro</i> investigations, including cell proliferation assay, Transwell assay, wound healing assay, cell cycle experiments, cell apoptosis assay and western blotting, were carried out in human liver cancer cell lines to assess the biological mechanisms of NCAPD2 in patients with liver cancer. The results revealed that the upregulation of NCAPD2 enhanced tumor cell proliferation, invasion and cell cycle progression at the G<sub>2</sub>/M‑phase transition, and inhibited apoptosis in liver cancer cells. Furthermore, NCAPD2 overexpression was closely associated with the phosphatidylinositol 3‑kinase (PI3K)‑Akt‑mammalian target of rapamycin (mTOR)/c‑Myc signaling pathway and epithelial‑mesenchymal transition (EMT) progression in HepG2 and Huh7 cells. In addition, upregulated <i>NCAPD2</i> was shown to have adverse effects on overall survival and disease‑specific survival in liver cancer. In conclusion, the overexpression of NCAPD2 was shown to lead to cell cycle progression at the G<sub>2</sub>/M‑phase transition, activation of the PI3K‑Akt‑mTOR/c‑Myc signaling pathway and EMT progression in human liver cancer cells.

HTT
Also flagged:HuntingtinHuntington's diseaseHDneurodegenerative disorderpolyglutaminepathogenesis
Journal Article 2024-08-02 ✓ 5 Snippets Nanajkar N, Sahoo A, Matysiak S.
In-Text Gene Mentions

The polyQ tract within htt is flanked by two regions: an N-terminal domain (N17) and a short C-terminal proline-rich segment.

These early oligomeric assemblies of htt, exhibiting diverse characteristics during aggregation, are implicated as potential toxic entities in HD.

Research in mouse models suggests that HD pathogenesis involves the aggregation of N-terminal fragments of the huntingtin protein (htt).

…the huntingtin protein (htt).…

…oligomeric assemblies ofhtt, exhibiting diverse character…

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disorder resulting from an abnormal expansion of polyglutamine (polyQ) repeats in the N-terminus of the huntingtin protein. When the polyQ tract surpasses 35 repeats, the mutated protein undergoes misfolding, culminating in the formation of intracellular aggregates. Research in mouse models suggests that HD pathogenesis involves the aggregation of N-terminal fragments of the huntingtin protein (htt). These early oligomeric assemblies of htt, exhibiting diverse characteristics during aggregation, are implicated as potential toxic entities in HD. However, a consensus on their specific structures remains elusive. Understanding the heterogeneous nature of htt oligomers provides crucial insights into disease mechanisms, emphasizing the need to identify various oligomeric conformations as potential therapeutic targets. Employing coarse-grained molecular dynamics, our study aims to elucidate the mechanisms governing the aggregation process and resultant aggregate architectures of htt. The polyQ tract within htt is flanked by two regions: an N-terminal domain (N17) and a short C-terminal proline-rich segment. We conducted self-assembly simulations involving five distinct N17 + polyQ systems with polyQ lengths ranging from 7 to 45, utilizing the ProMPT force field. Prolongation of the polyQ domain correlates with an increase in β-sheet-rich structures. Longer polyQ lengths favor intramolecular β-sheets over intermolecular interactions due to the folding of the elongated polyQ domain into hairpin-rich conformations. Importantly, variations in polyQ length significantly influence resulting oligomeric structures. Shorter polyQ domains lead to N17 domain aggregation, forming a hydrophobic core, while longer polyQ lengths introduce a competition between N17 hydrophobic interactions and polyQ polar interactions, resulting in densely packed polyQ cores with outwardly distributed N17 domains. Additionally, at extended polyQ lengths, we observe distinct oligomeric conformations with varying degrees of N17 bundling. These findings can help explain the toxic gain-of-function that htt with expanded polyQ acquires.

Also flagged:deathdevelopmental neurotoxicity-programmed cell deathsnecroptosispyroptosis
Journal Article 2024-08-02 No Snippets Sun H, Yisi Shan, Cao L, Wu X, Chen J, Yuan R, Qian M.
Show Full Abstract

Anesthetic-induced developmental neurotoxicity (AIDN) can arise due to various factors, among which aberrant nerve cell death is a prominent risk factor. Animal studies have reported that repeated or prolonged anesthetic exposure can cause significant neuroapoptosis in the developing brain. Lately, non-apoptotic programmed cell deaths (PCDs), characterized by inflammation and oxidative stress, have gained increasing attention. Substantial evidence suggests that non-apoptotic PCDs are essential for neuronal cell death in AIDN compared to apoptosis. This article examines relevant publications in the PubMed database until April 2024. Only original articles in English that investigated the potential manifestations of non-apoptotic PCD in AIDN were analysed. Specifically, it investigates necroptosis, pyroptosis, ferroptosis, and parthanatos, elucidating the signaling mechanisms associated with each form. Furthermore, this study explores the potential relevance of these non-apoptotic PCDs pathways to the pathological mechanisms underlying AIDN, drawing upon their distinctive characteristics. Despite the considerable challenges involved in translating fundamental scientific knowledge into clinical therapeutic interventions, this comprehensive review offers a theoretical foundation for developing innovative preventive and treatment strategies targeting non-apoptotic PCDs in the context of AIDN.

Also flagged:CCStranscription factorsTbx3Irx3blocksventricular fibrillation
Journal Article 2024-08-02 No Snippets Oh Y, Abid R, Dababneh S, Bakr M, Aslani T, Cook DP, Vanderhyden BC, Park JG, Munshi NV, Hui CC, Kim KH.
Show Full Abstract

The cardiac conduction system (CCS) is a network of specialized cardiomyocytes that coordinates electrical impulse generation and propagation for synchronized heart contractions. Although the components of the CCS, including the sinoatrial node, atrioventricular node, His bundle, bundle branches, and Purkinje fibers, were anatomically discovered more than 100 years ago, their molecular constituents and regulatory mechanisms remain incompletely understood. Here, we demonstrate the transcriptomic landscape of the postnatal mouse CCS at a single-cell resolution with spatial information. Integration of single-cell and spatial transcriptomics uncover region-specific markers and zonation patterns of expression. Network inference shows heterogeneous gene regulatory networks across the CCS. Notably, region-specific gene regulation is recapitulated in vitro using neonatal mouse atrial and ventricular myocytes overexpressing CCS-specific transcription factors, Tbx3 and/or Irx3. This finding is supported by ATAC-seq of different CCS regions, Tbx3 ChIP-seq, and Irx motifs. Overall, this study provides comprehensive molecular profiles of the postnatal CCS and elucidates gene regulatory mechanisms contributing to its heterogeneity.

HTT
Also flagged:HDneurodegenerative disorderbrain developmentsynaptic contactscell-cell communicationgene silencing
Journal Article 2024-08-02 ✓ 2 Snippets Galimberti M, Nucera MR, Bocchi VD, Conforti P, Vezzoli E, Cereda M, Maffezzini C, Iennaco R, Scolz A, Falqui A, Cordiglieri C, Cremona M, Espuny-Camacho I, Faedo A, Felsenfeld DP, Vogt TF, Ranzani V, Zuccato C, Besusso D, Cattaneo E.
In-Text Gene Mentions

…region in theHTTgene leading to…

…known to bindHTTand already described…

Show Full Abstract

Huntington's disease (HD) causes selective degeneration of striatal and cortical neurons, resulting in cell mosaicism of coexisting still functional and dysfunctional cells. The impact of non-cell autonomous mechanisms between these cellular states is poorly understood. Here we generated telencephalic organoids with healthy or HD cells, grown separately or as mosaics of the two genotypes. Single-cell RNA sequencing revealed neurodevelopmental abnormalities in the ventral fate acquisition of HD organoids, confirmed by cytoarchitectural and transcriptional defects leading to fewer GABAergic neurons, while dorsal populations showed milder phenotypes mainly in maturation trajectory. Healthy cells in mosaic organoids restored HD cell identity, trajectories, synaptic density, and communication pathways upon cell-cell contact, while showing no significant alterations when grown with HD cells. These findings highlight cell-type-specific alterations in HD and beneficial non-cell autonomous effects of healthy cells, emphasizing the therapeutic potential of modulating cell-cell communication in disease progression and treatment.

ZNF644
Also flagged:keratin 12pathogenesishigh myopiamyopiahighkeratoconus
Journal Article 2024-08-02 ✓ 1 Snippet Lin Q, Wang X, Han T, Peng X, Zhou X.
In-Text Gene Mentions

ZNF644

Show Full Abstract

<h4>Background</h4>High myopia is a major cause of visual impairment, and genetic factors play crucial roles in the pathogenesis. We performed this study to identify candidate genes for the development of high myopia in a four-generation Chinese family with myopia.<h4>Methods</h4>All family members with myopia and 100 healthy participants were included in this study. Data were obtained on demographics, disease history, and ocular examination results. We performed whole exome sequencing of the genomic DNA and Sanger sequencing to verify the variants. Functional analyses of the variant were performed using software programmes.<h4>Results</h4>Nine of thirteen family members were found to have high myopia, amongst which two members were also diagnosed keratoconus. A missense variant in the keratin 12 gene (KRT12, p.Val410Gly) was detected in all high myopia cases but not in other family members without high myopia or the controls. The variant was predicted to be benign by online software programmes. However, modelling of the three-dimensional structure of the protein clearly revealed conformational changes caused by the mutation.<h4>Conclusions</h4>A missense mutation in the KRT12 gene was identified in this Chinese family, which may be associated with the pathogenesis of high myopia.

Also flagged:cancerbrain tumorsbrain tumourspilocytic astrocytomamedulloblastomaependymoma
Journal Article 2024-08-02 No Snippets Gruszka R, Zakrzewski J, Nowosławska E, Grajkowska W, Zakrzewska M.
Show Full Abstract

Alterations in miRNA levels have been observed in various types of cancer, impacting numerous cellular processes and increasing their potential usefulness in combination therapies also in brain tumors. Recent advances in understanding the genetics and epigenetics of brain tumours point to new aberrations and associations, making it essential to continually update knowledge and classification. Here we conducted molecular analysis of 123 samples of childhood brain tumors (pilocytic astrocytoma, medulloblastoma, ependymoma), focusing on identification of genes that could potentially be regulated by crucial representatives of OncomiR-1: miR-17-5p and miR-20a-5p. On the basis of microarray gene expression analysis and qRTPCR profiling, we selected six (WEE1, CCND1, VEGFA, PTPRO, TP53INP1, BCL2L11) the most promising target genes for further experiments. The WEE1, CCND1, PTPRO, TP53INP1 genes showed increased expression levels in all tested entities with the lowest increase in the pilocytic astrocytoma compared to the ependymoma and medulloblastoma. The obtained results indicate a correlation between gene expression and the WHO grade and subtype. Furthermore, our analysis showed that the integration between genomic and epigenetic pathways should now point the way to further molecular research.

SERPINC1
Also flagged:clottingHeparinantithrombin IIIAT-IIIfibrinogendegradation
Journal Article 2024-08-02 ✓ 1 Snippet Yamashiro T, Takami Y, Takagi Y.
In-Text Gene Mentions

…Relation betweenantithrombin-IIIactivity and activated…

Show Full Abstract

Heparin resistance (HR) is observed before cardiopulmonary bypass (CPB), despite with normal antithrombin III (AT-III) levels. The relationships between preoperative AT-III activity and activated clotting time (ACT) after the first heparin dose should be clarified. We retrospectively analyzed the data of 818 patients who underwent CPB surgery, with the initial heparin of 300, 400, and 500 IU/kg, between 2017 and 2021. We defined HR as the failure to achieve ACT after the initial heparin dose (Post ACT) of > 480 s.There were no significant correlations between the AT-III activity and Post ACT in all patients, including 143 patients with AT-III activity < 80% and 675 patients with AT-III activity of ≥ 80%. Also, there were no significant correlations between the AT-III activity and Post ACT in 74 patients who received heparin of 300 IU/kg, in 186 patients with 400 IU/kg, and in 339 patients with 500 IU/kg. After identifying smoking, HR, activated partial thromboplastin time, fibrinogen degradation products (FDP), and ACT as influencing factors, multiple comparisons using the Steel-Dwass test showed significant difference in FDP and HR among the patients who received heparin of 300 IU/kg, 400 IU/kg, and 500 IU/kg. There is no association between preoperative AT-III activity and ACT after the first heparin administration for CPB, even in different dose of heparin. Rather, the higher the initial UFH dose is, the higher ACT may be, regardless of the AT-III activity.

CACNA1E
Also flagged:growth hormoneGnRHHPOsynthesissecretionreproduction
Journal Article 2024-08-02 ✓ 5 Snippets Keogh K, Kelly AK, Kenny DA.
In-Text Gene Mentions

…hormone processing includingCACNA1E, DIO3 ,…

…CASR , theCACNA1Egene is also…

CACNA1Eencodes a voltage-dependent…

…ferentially expressed includedCACNA1E, CACNA1I ,…

…these genes/proteins (CACNA1E, PRKCB and…

Show Full Abstract

<h4>Background</h4>Enhanced nutrition during the early calfhood period has been shown to lead to earlier pubertal development in heifer calves. This is of interest as earlier pubertal onset can subsequently facilitate earlier calving which can economically benefit production systems. Reproductive development in heifers is regulated by the hypothalamic-pituitary-ovarian signalling pathway. In particular the anterior pituitary gland is central to reproductive development, through the dynamics of gonadotropic pulsatility. However, despite clear knowledge of the influence of enhanced dietary intake on subsequent reproductive development, the molecular control governing this response in the pituitary gland within the hypothalamic-pituitary-ovarian signalling axis in heifer calves is not fully understood. The objective of this study was to examine the effect of an enhanced plane of nutrition during early life on the anterior pituitary gland of heifer calves through both transcriptomic and proteomic analyses. Between 3 and 21 weeks of age, heifer calves were offered either a high (HI, n = 14) or moderate (MOD, n = 14) plane of nutrition, designed to elicit target growth rates of 1.2 and 0.5 kg/d for HI and MOD groups, respectively. All calves were euthanised at 21 weeks of age and anterior pituitary tissue harvested for subsequent use in global transcriptomic and proteomic analyses.<h4>Results</h4>Average daily gain was affected by diet (P < 0.001) and was 1.18 and 0.50 kg/day, for HI and MOD calves, respectively. RNAseq analysis resulted in the identification of 195 differentially expressed genes (P<sub>adj</sub><0.05; fold change > 1.5), with 277 proteins identified as differentially abundant (P<sub>adj</sub><0.05; fold change > 1.5) between contrasting dietary treatment groups. Biochemical pathway analysis of differentially affected genes and proteins revealed an enrichment for both growth hormone and GnRH signalling pathways (P<sub>adj</sub>.<0.05). Additionally, pathway analysis predicted an effect of enhanced dietary intake on endocrine function within the anterior pituitary gland as well as on reproductive system development and function (P<sub>adj</sub>.<0.05).<h4>Conclusions</h4>Results from this study show that an enhanced dietary intake during early calfhood affected the molecular control of the anterior pituitary gland in heifer calves in early life.

Also flagged:tumorovarian cancerhigh grade serous ovarian cancergene expressionOvarian Tumorfocal-adhesion
Journal Article 2024-08-02 No Snippets Sarkar S, Saha SA, Swarnakar A, Chakrabarty A, Dey A, Sarkar P, Banerjee S, Mitra P.
Show Full Abstract

<h4>Background</h4>The clinicopathological parameters such as residual tumor, grade, the International Federation of Gynecology and Obstetrics (FIGO) score are often used to predict the survival of ovarian cancer patients, but the 5-year survival of high grade serous ovarian cancer (HGSOC) still remains around 30%. Hence, the relentless pursuit of enhanced prognostic tools for HGSOC, this study introduces an unprecedented gene expression-based molecular prognostic score (mPS). Derived from a novel 20-gene signature through Least Absolute Shrinkage and Selection Operator (LASSO)-Cox regression, the mPS stands out for its predictive prowess.<h4>Results</h4>Validation across diverse datasets, including training and test sets (n = 491 each) and a large HGSOC patient cohort from the Ovarian Tumor Tissue Analysis (OTTA) consortium (n = 7542), consistently shows an area-under-curve (AUC) around 0.7 for predicting 5-year overall survival. The mPS's impact on prognosis resonates profoundly, yielding an adjusted hazard-ratio (HR) of 6.1 (95% CI: 3.65-10.3; p < 0.001), overshadowing conventional parameters-FIGO score, residual disease, and age. Molecular insights gleaned from mPS stratification uncover intriguing pathways, with focal-adhesion, Wnt, and Notch signaling upregulated, and antigen processing and presentation downregulated (p < 0.001) in high-risk HGSOC cohorts.<h4>Conclusion</h4>Positioned as a robust prognostic marker, the 20-gene signature-derived mPS emerges as a potential game-changer in clinical settings. Beyond its role in predicting overall survival, its implications extend to guiding alternative therapies, especially targeting Wnt/Notch signaling pathways and immune evasion-a promising avenue for improving outcomes in high-risk HGSOC patients.

NEGR1
Also flagged:cervical cancerCCCCNE1CCNE2ANLNRACGAP1
Journal Article 2024-08-02 ✓ 1 Snippet Karunakara SH, Eswaran S, Mallya S, Suresh PS, Chakrabarty S, Kabekkodu SP.
In-Text Gene Mentions

…TPM1, MYB, AXIN2,NEGR1, TMEM100, and SLC229A2)…

Show Full Abstract

<h4>Objective</h4>miR-497/195, located at 17p13.1, is a highly conserved miRNA cluster whose abnormal expression is a key regulator of carcinogenesis. We performed a comprehensive analysis of the miR-497/195 cluster to determine its prognostic utility and role in cervical cancer (CC) using publicly available datasets.<h4>Results</h4>In silico analysis and validation revealed that this cluster is downregulated in CC. A total of 60 target genes of miR-497/195 cluster were identified as differentially expressed between normal and CC samples. ShinyGO, STRING, CytoHubba, Timer 2.0, HPA, and HCMBD were used for functional enrichment, PPIN network construction, hub gene identification, immune infiltration correlation, histopathological expression, and determination of the metastatic potential of miR-497/195 cluster and their target genes. PPIN analysis identified CCNE1, CCNE2, ANLN, RACGAP1, KIF23, CHEK1, CDC25A, E2F7, CDK1, and CEP55 as the top 10 hub genes (HGs). Furthermore, the upregulation of RECK, ATD5, and BCL2, downregulation of OSBPL3, RCAN3, and HIST1H3H effected overall survival of CC patients. We identified 6 targets (TFAP2A, CLSPN, RASEF, HIST1H3H, AKT3, and ITPR1) of miR-497/195 cluster to influence metastasis. In addition, 8 druggable genes and 38 potential drugs were also identified. Our study identified miR-497/195 cluster target genes and pathways that could be used for prognostic and therapeutic applications in CC.

PRDX6
Also flagged:metabolismGFPanemiaChromiumredox homeostasislipid
Journal Article 2024-08-02 ✓ 1 Snippet Zimring JC, Hay AM, Dzieciatkowska M, D'Alessandro A.
In-Text Gene Mentions

PRDX6

Show Full Abstract

<h4>Background</h4>The cellular and molecular changes during red blood cell (RBC) storage that affect posttransfusion recovery (PTR) remain incompletely understood. We have previously reported that RBCs of different storage biology cross-regulate each other when stored together (co-storage cross-regulation [CSCR]). However, the mechanism of CSCR is unclear. In the current study, we tested the hypothesis that CSCR involves acquisition of molecular signatures associated with PTR.<h4>Study design and methods</h4>The whole blood compartment of either B6 or FVB mice was biotinylated in vivo prior to blood collection and storage. Bio-B6 or Bio.FVB were stored with RBCs from B6 mice transgenic for green florescent protein (GFP) (B6.GFP). After storage, avidin-magnetic beads were used to simultaneous purify Bio-RBCs (positive selection) and B6.GFPs (negative selection). Isolated populations were analyzed by transfusion to establish PTR, and subjected to metabolomic and proteomic analysis.<h4>Results</h4>B6 RBCs acquired molecular signatures associated with stored FVB RBCs at both the metabolomic and proteomic level including metabolites associated with energy metabolism, oxidative stress regulation, and oxidative damage. Mitochondrial signatures were also acquired by B6 RBCs. Protein signatures acquired by B6 RBCs include proteins associated with vesiculation.<h4>Conclusion</h4>The data presented herein demonstrate the appearance of multiple molecular changes from poor-storing RBCs in good-storing RBCs during co-storage. Whether this is a result of damage causing intrinsic molecular changes in B6 RBCs or if molecules of FVB RBC origin are transferred to B6 RBCs remains unclear. These studies broaden our mechanistic understanding of RBC storage (in particular) and potentially RBC biology (in general).

LRRIQ3
Also flagged:Pde6brdretinal degenerationbehavioralcircadian rhythmsretinal melanopsin
Journal Article 2024-08-02 ✓ 1 Snippet Cox OH, Giannoni-Guzmán MA, Cartailler JP, Cottam MA, McMahon DG.
In-Text Gene Mentions

…containing 3 (Lrriq3), and Ras…

Show Full Abstract

Seasonal daylength, or circadian photoperiod, is a pervasive environmental signal that profoundly influences physiology and behavior. In mammals, the central circadian clock resides in the suprachiasmatic nuclei (SCN) of the hypothalamus where it receives retinal input and synchronizes, or entrains, organismal physiology and behavior to the prevailing light cycle. The process of entrainment induces sustained plasticity in the SCN, but the molecular mechanisms underlying SCN plasticity are incompletely understood. Entrainment to different photoperiods persistently alters the timing, waveform, period, and light resetting properties of the SCN clock and its driven rhythms. To elucidate novel candidate genes for molecular mechanisms of photoperiod plasticity, we performed RNA sequencing on whole SCN dissected from mice raised in long (light:dark [LD] 16:8) and short (LD 8:16) photoperiods. Fewer rhythmic genes were detected in mice subjected to long photoperiod, and in general, the timing of gene expression rhythms was advanced 4-6 h. However, a few genes showed significant delays, including <i>Gem</i>. There were significant changes in the expression of the clock-associated gene <i>Timeless</i> and in SCN genes related to light responses, neuropeptides, gamma aminobutyric acid (GABA), ion channels, and serotonin. Particularly striking were differences in the expression of the neuropeptide signaling genes <i>Prokr2</i> and <i>Cck</i>, as well as convergent regulation of the expression of 3 SCN light response genes, <i>Dusp4</i>, <i>Rasd1</i>, and <i>Gem</i>. Transcriptional modulation of <i>Dusp4</i> and <i>Rasd1</i> and phase regulation of <i>Gem</i> are compelling candidate molecular mechanisms for plasticity in the SCN light response through their modulation of the critical NMDAR-MAPK/ERK-CREB/CRE light signaling pathway in SCN neurons. Modulation of <i>Prokr2</i> and <i>Cck</i> may critically support SCN neural network reconfiguration during photoperiodic entrainment. Our findings identify the SCN light response and neuropeptide signaling gene sets as rich substrates for elucidating novel mechanisms of photoperiod plasticity. Data are also available at http://circadianphotoperiodseq.com/, where users can view the expression and rhythmic properties of genes across these photoperiod conditions.

Also flagged:acetylgalactosaminepolypeptide:N-acetylgalactosaminyltransferaseGalNAc-Tsugar
Journal Article 2024-08-02 No Snippets Dalal K, Yang W, Tian E, Chernish A, McCluggage P, Lara AJ, Ten Hagen KG, Tabak LA.
Show Full Abstract

The UDP-N-acetylgalactosamine polypeptide:N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes initiates O-linked glycosylation by catalyzing the addition of the first GalNAc sugar to serine or threonine on proteins destined to be membrane-bound or secreted. Defects in individual isoforms of the GalNAc-T family can lead to certain congenital disorders of glycosylation (CDG). The polypeptide N-acetylgalactosaminyltransferase 3 (GALNT)3-CDG, is caused by mutations in GALNT3, resulting in hyperphosphatemic familial tumoral calcinosis due to impaired glycosylation of the phosphate-regulating hormone fibroblast growth factor 23 (FGF23) within osteocytes of the bone. Patients with hyperphosphatemia present altered bone density, abnormal tooth structure, and calcified masses throughout the body. It is therefore important to identify all potential substrates of GalNAc-T3 throughout the body to understand the complex disease phenotypes. Here, we compared the Galnt3<sup>-/-</sup> mouse model, which partially phenocopies GALNT3-CDG, with WT mice and used a multicomponent approach using chemoenzymatic conditions, a product-dependent method constructed using EThcD triggered scans in a mass spectrometry workflow, quantitative O-glycoproteomics, and global proteomics to identify 663 Galnt3-specific O-glycosites from 269 glycoproteins across multiple tissues. Consistent with the mouse and human phenotypes, functional networks of glycoproteins that contain GalNAc-T3-specific O-glycosites involved in skeletal morphology, mineral level maintenance, and hemostasis were identified. This library of in vivo GalNAc-T3-specific substrate proteins and O-glycosites will serve as a valuable resource to understand the functional implications of O-glycosylation and to unravel the underlying causes of complex human GALNT3-CDG phenotypes.

Also flagged:extracellularvesiclesvesicleocular toxoplasmosisCD63TSG101
Journal Article 2024-08-02 No Snippets Costa DF, Pessuti CL, Tsering T, Abdouh M, Ribeiro K, Nascimento H, Commodaro AG, Burnier JV, Belfort R, Burnier MN.
Show Full Abstract

<h4>Purpose</h4>To characterize the extracellular vesicle protein cargo in the aqueous humor and plasma of patients with ocular toxoplasmosis.<h4>Methods</h4>Aqueous humor and plasma were collected from six patients with active ocular toxoplasmosis and six patients with cataract. Extracellular vesicles were isolated, and western blotting and mass spectrometry were performed for protein analysis.<h4>Results</h4>All plasma samples from patients with ocular toxoplasmosis and cataract were positive for the tetraspanins CD63 and TSG101. However, the aqueous humor from patients with ocular toxoplasmosis was positive only for CD63. Sixty-seven new unreported proteins were identified in the aqueous humor and plasma of patients with the ocular toxoplasmosis and cataract. Of the 67 proteins, 10 and 7 were found only in the cataract and ocular toxoplasmosis groups, respectively. In general, these proteins were involved in immune system activation and retina homeostasis and were related to infections and retina-associated diseases.<h4>Conclusion</h4>The distinct protein signatures between ocular toxoplasmosis and cataract may be helpful in the differential diagnosis of ocular toxoplasmosis. However, more studies are needed to better understand the role of these proteins in the pathogenesis of ocular toxoplasmosis.

Also flagged:Graphenesynthesiscarbonbindingelectronsgraphite
Journal Article 2024-08-02 No Snippets Cardoso AT, Martins RO, Lanças FM.
Show Full Abstract

The advancement of traditional sample preparation techniques has brought about miniaturization systems designed to scale down conventional methods and advocate for environmentally friendly analytical approaches. Although often referred to as green analytical strategies, the effectiveness of these methods is intricately linked to the properties of the sorbent utilized. Moreover, to fully embrace implementing these methods, it is crucial to innovate and develop new sorbent or solid phases that enhance the adaptability of miniaturized techniques across various matrices and analytes. Graphene-based materials exhibit remarkable versatility and modification potential, making them ideal sorbents for miniaturized strategies due to their high surface area and functional groups. Their notable adsorption capability and alignment with green synthesis approaches, such as bio-based graphene materials, enable the use of less sorbent and the creation of biodegradable materials, enhancing their eco-friendly aspects towards green analytical practices. Therefore, this study provides an overview of different types of hybrid graphene-based materials as well as their applications in crucial miniaturized techniques, focusing on offline methodologies such as stir bar sorptive extraction (SBSE), microextraction by packed sorbent (MEPS), pipette-tip solid-phase extraction (PT-SPE), disposable pipette extraction (DPX), dispersive micro-solid-phase extraction (d-µ-SPE), and magnetic solid-phase extraction (MSPE).

HFE
Also flagged:Liver Cirrhosisgadoliniumacidhepatocellular carcinomaliver cancercirrhosis
Journal Article 2024-08-02 ✓ 1 Snippet Goetz A, Verloh N, Utpatel K, Fellner C, Rennert J, Einspieler I, Doppler M, Luerken L, Alizadeh LS, Uller W, Stroszczynski C, Haimerl M.
In-Text Gene Mentions

…fatty liver disease,hemochromatosis, or alpha-1 antitrypsin…

Show Full Abstract

This study uses magnetic resonance imaging (MRI) to investigate the potential of the hepatospecific contrast agent gadolinium ethoxybenzyl-diethylenetriaminepentaacetic acid (Gd-EOB-DTPA) in distinguishing G1- from G2/G3-differentiated hepatocellular carcinoma (HCC). Our approach involved analyzing the dynamic behavior of the contrast agent in different phases of imaging by signal intensity (SI) and lesion contrast (C), to surrounding liver parenchyma, and comparing it across distinct groups of patients differentiated based on the histopathological grading of their HCC lesions and the presence of liver cirrhosis. Our results highlighted a significant contrast between well- and poorly-differentiated lesions regarding the lesion contrast in the arterial and late arterial phases. Furthermore, the hepatobiliary phase showed limited diagnostic value in cirrhotic liver parenchyma due to altered pharmacokinetics. Ultimately, our findings underscore the potential of Gd-EOB-DTPA-enhanced MRI as a tool for improving preoperative diagnosis and treatment selection for HCC while emphasizing the need for continued research to overcome the diagnostic complexities posed by the disease.

Also flagged:OxygenPhotosynthesispoly-unsaturated fatty acidsmembraneslipidperoxides
Journal Article 2024-08-02 No Snippets Pancheri T, Baur T, Roach T.
Show Full Abstract

During photosynthesis, reactive oxygen species (ROS) are formed, including hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) and singlet oxygen (<sup>1</sup>O<sub>2</sub>), which have putative roles in signalling, but their involvement in photosynthetic acclimation is unclear. Due to extreme reactivity and a short lifetime, <sup>1</sup>O<sub>2</sub> signalling occurs via its reaction products, such as oxidised poly-unsaturated fatty acids in thylakoid membranes. The resulting lipid peroxides decay to various aldehydes and reactive electrophile species (RES). Here, we investigated the role of ROS in the signal transduction of high light (HL), focusing on GreenCut2 genes unique to photosynthetic organisms. Using RNA seq. data, the transcriptional responses of <i>Chlamydomonas reinhardtii</i> to 2 h HL were compared with responses under low light to exogenous RES (acrolein; 4-hydroxynonenal), β-cyclocitral, a β-carotene oxidation product, as well as Rose Bengal, a <sup>1</sup>O<sub>2</sub>-producing photosensitiser, and H<sub>2</sub>O<sub>2</sub>. HL induced significant (<i>p</i> < 0.05) up- and down-regulation of 108 and 23 GreenCut2 genes, respectively. Of all HL up-regulated genes, over half were also up-regulated by RES, including <i>RBCS1</i> (ribulose bisphosphate carboxylase small subunit), NPQ-related <i>PSBS1</i> and <i>LHCSR1</i>. Furthermore, 96% of the genes down-regulated by HL were also down-regulated by <sup>1</sup>O<sub>2</sub> or RES, including <i>CAO1</i> (chlorophyllide-<i>a</i> oxygnease), <i>MDH2</i> (NADP-malate dehydrogenase) and <i>PGM4</i> (phosphoglycerate mutase) for glycolysis. In comparison, only 0-4% of HL-affected GreenCut2 genes were similarly affected by H<sub>2</sub>O<sub>2</sub> or β-cyclocitral. Overall, <sup>1</sup>O<sub>2</sub> plays a significant role in signalling during the initial acclimation of <i>C. reinhardtii</i> to HL by up-regulating photo-protection and carbon assimilation and down-regulating specific primary metabolic pathways. Our data support that this pathway involves RES.

Also flagged:NAFLDNASHNonalcoholic fatty liver diseasemetabolic dysfunction-associated steatotic liver diseaseobesitydiabetes mellitus
Journal Article 2024-08-02 No Snippets Sergi CM.
Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD), or metabolic dysfunction-associated steatotic liver disease (MASLD), is a liver condition that is linked to overweight, obesity, diabetes mellitus, and metabolic syndrome. Nonalcoholic steatohepatitis (NASH), or metabolic dysfunction-associated steatohepatitis (MASH), is a form of NAFLD/MASLD that progresses over time. While steatosis is a prominent histological characteristic and recognizable grossly and microscopically, liver biopsies of individuals with NASH/MASH may exhibit several other abnormalities, such as mononuclear inflammation in the portal and lobular regions, hepatocellular damage characterized by ballooning and programmed cell death (apoptosis), misfolded hepatocytic protein inclusions (Mallory-Denk bodies, MDBs), megamitochondria as hyaline inclusions, and fibrosis. Ballooning hepatocellular damage remains the defining feature of NASH/MASH. The fibrosis pattern is characterized by the initial expression of perisinusoidal fibrosis ("chicken wire") and fibrosis surrounding the central veins. Children may have an alternative form of progressive NAFLD/MASLD characterized by steatosis, inflammation, and fibrosis, mainly in Rappaport zone 1 of the liver acinus. To identify, synthesize, and analyze the scientific knowledge produced regarding the implications of using a score for evaluating NAFLD/MASLD in a comprehensive narrative review. The search for articles was conducted between 1 January 2000 and 31 December 2023, on the PubMed/MEDLINE, Scopus, Web of Science, and Cochrane databases. This search was complemented by a gray search, including internet browsers (e.g., Google) and textbooks. The following research question guided the study: "What are the basic data on using a score for evaluating NAFLD/MASLD?" All stages of the selection process were carried out by the single author. Of the 1783 articles found, 75 were included in the sample for analysis, which was implemented with an additional 25 articles from references and gray literature. The studies analyzed indicated the beneficial effects of scoring liver biopsies. Although similarity between alcoholic steatohepatitis (ASH) and NASH/MASH occurs, some patterns of hepatocellular damage seen in alcoholic disease of the liver do not happen in NASH/MASH, including cholestatic featuring steatohepatitis, alcoholic foamy degeneration, and sclerosing predominant hyaline necrosis. Generally, neutrophilic-rich cellular infiltrates, prominent hyaline inclusions and MDBs, cholestasis, and obvious pericellular sinusoidal fibrosis should favor the diagnosis of alcohol-induced hepatocellular injury over NASH/MASH. Multiple grading and staging methods are available for implementation in investigations and clinical trials, each possessing merits and drawbacks. The systems primarily used are the Brunt, the NASH CRN (NASH Clinical Research Network), and the SAF (steatosis, activity, and fibrosis) systems. Clinical investigations have utilized several approaches to link laboratory and demographic observations with histology findings with optimal platforms for clinical trials of rapidly commercialized drugs. It is promising that machine learning procedures (artificial intelligence) may be critical for developing new platforms to evaluate the benefits of current and future drug formulations.

Also flagged:LipidMetabolismcancerendocrine system diseasesdiseases of the cardiovascular systemneurodegenerative diseases
Journal Article 2024-08-02 No Snippets Xu L, Yang Q, Zhou J.
Show Full Abstract

Lipid metabolism is a critical component in preserving homeostasis and health, and lipids are significant chemicals involved in energy metabolism in living things. With the growing interest in lipid metabolism in recent years, an increasing number of studies have demonstrated the close relationship between abnormalities in lipid metabolism and the development of numerous human diseases, including cancer, cardiovascular, neurological, and endocrine system diseases. Thus, understanding how aberrant lipid metabolism contributes to the development of related diseases and how it works offers a theoretical foundation for treating and preventing related human diseases as well as new avenues for the targeted treatment of related diseases. Therefore, we discuss the processes of aberrant lipid metabolism in various human diseases in this review, including diseases of the cardiovascular system, neurodegenerative diseases, endocrine system diseases (such as obesity and type 2 diabetes mellitus), and other diseases including cancer.

CCPG1
Also flagged:Glioblastomatumorcancertumorstranslationaldiffuse glioma
Journal Article 2024-08-02 ✓ 1 Snippet Arbatskiy M, Balandin D, Churov A, Varachev V, Nikolaeva E, Mitrofanov A, Bekyashev A, Tkacheva O, Susova O, Nasedkina T.
In-Text Gene Mentions

…and cell proliferation (CCPG1, CDKN1A) ( Supplementary…

Show Full Abstract

Glioblastoma cell lines derived from different patients are widely used in tumor biology research and drug screening. A key feature of glioblastoma is the high level of inter- and intratumor heterogeneity that accounts for treatment resistance. Our aim was to investigate whether intratumor heterogeneity is maintained in cell models. Single-cell RNA sequencing was used to investigate the cellular composition of a tumor sample and six patient-derived glioblastoma cell lines. Three cell lines preserved the mutational profile of the original tumor, whereas three others differed from their precursors. Copy-number variation analysis showed significantly rearranged genomes in all the cell lines and in the tumor sample. The tumor had the most complex cell composition, including cancer cells and microenvironmental cells. Cell lines with a conserved genome had less diverse cellularity, and during cultivation, a relative increase in the stem-cell-derived progenitors was noticed. Cell lines with genomes different from those of the primary tumors mainly contained neural progenitor cells and microenvironmental cells. The establishment of cell lines without the driver mutations that are intrinsic to the original tumors may be related to the selection of clones or cell populations during cultivation. Thus, patient-derived glioblastoma cell lines differ substantially in their cellular profile, which should be taken into account in translational studies.

Also flagged:chromosomeschromosomecholesterolmetabolismlipidsynthesis
Journal Article 2024-08-02 No Snippets Nawaz MY, Savegnago RP, Lim D, Lee SH, Gondro C.
Show Full Abstract

In this study, we detected signatures of selection in Hanwoo and Angus beef cattle using allele frequency and haplotype-based methods based on imputed whole genome sequence variants. Our dataset included 13,202 Angus animals with 10,057,633 imputed SNPs and 10,437 Hanwoo animals with 13,241,550 imputed SNPs. The dataset was subset down to 6,873,624 SNPs in common between the two populations to identify within population (runs of homozygosity, extended haplotype homozygosity) and between population signals of selection (allele fixation index, extended haplotype homozygosity). Assuming these selection signals were complementary to each other, they were combined into a decorrelated composite of multiple signals to identify regions under selection for each of the breeds. 27 genomic regions spanning 25.15 Mb and harboring 360 genes were identified in Angus on chromosomes 1,3, 4, 5, 6, 7, 8, 12, 13, 14, 16, 20, 21 and 28. Similarly, in Hanwoo, 59 genes and 17 genomic regions spanning 5.21 Mb on chromosomes 2, 4, 5, 6, 7, 8, 9, 10, 13, 17, 20 and 24 were identified. Apart from a small region on chromosome 13, there was no major overlap of selection signals between the two breeds reflecting their largely different selection histories, environmental challenges, breeding objectives and breed characteristics. Positional candidate genes identified in selected genomic regions in Angus have been previously associated with growth, immunity, reproductive development, feed efficiency and adaptation to environment while the candidate genes identified in Hanwoo included important genes regulating meat quality, fat deposition, cholesterol metabolism, lipid synthesis, neuronal development, and olfactory reception.

TNFSF4
Also flagged:cancerTumorubiquitinationbreast cancerATG5FBXL20
Journal Article 2024-08-02 ✓ 5 Snippets Feng K, He X, Qin L, Ma Z, Liu S, Jia Z, Ren F, Cao H, Wu J, Ma D, Wang X, Xing Z.
In-Text Gene Mentions

…, TNFRSF4 ,TNFSF4, and in…

…Conversely,TNFSF4and TNFRSF4 were…

…Together,TNFSF4and TNFRSF4 promote…

TNFSF4overexpression has been…

…survival and highTNFSF4expression [ 43…

Show Full Abstract

<h4>Background</h4>Breast cancer (BC) is a highly common form of cancer that occurs in many parts of the world. However, early -stage BC is curable. Many patients with BC have poor prognostic outcomes owing to ineffective diagnostic and therapeutic tools. The ubiquitination system and associated proteins were found influencing the outcome of individuals with cancer. Therefore, developing a biomarker associated with ubiquitination genes to forecast BC patient outcomes is a feasible strategy.<h4>Objective</h4>The primary goal of this work was to develop a novel risk score signature capable of accurately estimate the future outcome of patients with BC by targeting ubiquitinated genes.<h4>Methods</h4>Univariate Cox regression analysis was conducted utilizing the E1, E2, and E3 ubiquitination-related genes in the GSE20685 dataset. Genes with p < 0.01 were screened again using the Non-negative Matrix Factorization (NMF) algorithm, and the resulting hub genes were composed of a risk score signature. Patients were categorized into two risk groups, and the predictive effect was tested using Kaplan-Meier (KM) and Receiver Operating Characteristic (ROC) curves. This risk score signature was later validated using multiple external datasets, namely TCGA-BRAC, GSE1456, GSE16446, GSE20711, GSE58812 and GSE96058. Immuno-microenvironmental, single-cell, and microbial analyses were also performed.<h4>Results</h4>The selected gene signature comprising six ubiquitination-related genes (<i>ATG5</i>, <i>FBXL20</i>, <i>DTX4</i>, <i>BIRC3</i>, <i>TRIM45</i>, and <i>WDR78</i>) showed good prognostic power in patients with BC. It was validated using multiple externally validated datasets, with KM curves showing significant differences in survival (p < 0.05). The KM curves also demonstrated superior predictive ability compared to traditional clinical indicators. Single-cell analysis revealed that Vd2 gd T cells were less abundantin the low-risk group, whereas patients in the high-risk group lacked myeloid dendritic cells. Tumor microbiological analysis revealed a notable variation in microorganism diversity between the high- and low-risk groups.<h4>Conclusion</h4>This study established an risk score signature consisting of six ubiquitination genes, that can accurately forecast the outcome of patients with BC using multiple datasets. It can provide personalized and targeted assistance to provide the evaluation and therapy of individuals having BC.

Also flagged:Liver cancercancerdeathviral infectionslung cancerwound healing
Journal Article 2024-08-02 No Snippets Tran CV, Tran TTP, Nguyen AT, Tran LV, Pham NT, Nguyen LT, Nguyen DT, Garrett MD, Nguyen NT, Do TT, Serpell CJ, Tran SV.
Show Full Abstract

A series of 14 conjugates of 2α,3β,23-triacetyl-madecassic acid and silybin were designed and synthesized. The madecassic acid unit was linked to silybin either directly at position C-7 or C-3; or through an amino acid linker (glycine, β-alanine, or 11-aminoundecanoic acid) at position C-3. The conjugates were tested <i>in vitro</i> for their cytotoxic effect on HepG2 cells using the MTT assay. The results confirmed that the conjugated compounds demonstrated a stronger cytotoxic effect compared to the parent compounds. Of these compounds, the most promising conjugate, compound 8, was evaluated for cytotoxic activity in the additional Hep3B, Huh7, and Huh7R human hepatocellular carcinoma cell lines and also for cell cycle changes and induction of apoptosis in HepG2 cells. This compound caused a rapid and significant induction of caspase 3 activity and induced cell cycle arrest in the S phase - effects distinct from the activity of madecassic acid. This is the first study on the synthesis and cytotoxicity of madecassic acid-silybin conjugates, and of their testing against liver cancer cell lines and provides evidence for a distinct biological profile <i>versus</i> madecassic acid alone.

HFE
Also flagged:response toPsychological stresscreatinesynthesisneuroticismaggression
Journal Article 2024-08-02 ✓ 3 Snippets Anastasiou K, Morris M, Akam L, Mastana S.
In-Text Gene Mentions

…allele: three studies);HFErs1799945 (endurance G…

…rs1815739, EPAS1 rs1867785,HFErs1799945, and HIF1A…

…( UCP2 ,HFE, and HIF1A…

Show Full Abstract

This systematic review aims to assess the genetic determinants influencing combat sports performance and address potential gaps in previous reviews. Twenty-four selected studies were analysed, investigating genetic influences on physiological performance, psychological traits, psychophysiological factors like pain perception, and injury susceptibility in combat sport athletes. The systematic literature search, using keywords, encompassed PubMed, Scopus, SportDiscus, Medline, and Google Scholar. The Covidence systematic review management software facilitated the screening process and the creation of the PRISMA flow diagram. The quality assessment complied with the PRISMA guidelines, featuring a custom 10-point scale and the STREGA criteria for more reliable study inclusion. Collectively, the 24 studies incorporated 18,989 participants, of which 3323 were combat athletes of majority European ancestry (71.7%) from various combat sports disciplines. Twenty-five unique genetic variants were significantly associated with combat sports performance across diverse domains. These included physiological performance (nine genetic variants), psychological traits (ten genetic variants), psychophysiological factors (one genetic variant), and injury susceptibility (four genetic variants). In conclusion, this systematic review lays the foundation for a more comprehensive exploration of the association between genetics and athletic performance in the demanding arena of combat sports, offering valuable insights for talent identification, training optimisation, and injury prevention.

Also flagged:metabolismreproductionangiogenesisobesitylactationmetabolic disorders
Journal Article 2024-08-02 No Snippets Dowker-Key PD, Jadi PK, Gill NB, Hubbard KN, Elshaarrawi A, Alfatlawy ND, Bettaieb A.
Show Full Abstract

White adipose tissue (WAT) makes up about 20-25% of total body mass in healthy individuals and is crucial for regulating various metabolic processes, including energy metabolism, endocrine function, immunity, and reproduction. In adipose tissue research, "adipogenesis" is commonly used to refer to the process of adipocyte formation, spanning from stem cell commitment to the development of mature, functional adipocytes. Although, this term should encompass a wide range of processes beyond commitment and differentiation, to also include other stages of adipose tissue development such as hypertrophy, hyperplasia, angiogenesis, macrophage infiltration, polarization, etc.… collectively, referred to herein as the adipogenic cycle. The term "differentiation", conversely, should only be used to refer to the process by which committed stem cells progress through distinct phases of subsequent differentiation. Recognizing this distinction is essential for accurately interpreting research findings on the mechanisms and stages of adipose tissue development and function. In this review, we focus on the molecular regulation of white adipose tissue development, from commitment to terminal differentiation, and examine key functional aspects of WAT that are crucial for normal physiology and systemic metabolic homeostasis.

Also flagged:PARPicastration resistant prostate cancerTumorspoly (ADP-ribose) polymerasePARPcancer
Journal Article 2024-08-02 No Snippets Panebianco M, Cereda V, D'Andrea MR.
Show Full Abstract

Tumors with an impaired ability to repair DNA double-strand breaks by homologous recombination, including those with alterations in breast cancer 1 and 2 (<i>BRCA1</i> and <i>BRCA2</i>) genes, are very sensitive to blocking DNA single-strand repair by inhibition of the poly (ADP-ribose) polymerase (PARP) enzyme. This provides the basis for a synthetic deadly strategy in the treatment of different types of cancer, such as prostate cancer (PCa). The phase 3 PROfound study was the first to lead to olaparib approval in patients with metastatic castration resistant PCa (mCRPC) and <i>BRCA</i> genes mutations. In recent years, the benefit of combination therapy consisted of a PARP inhibitor (PARPi) plus an androgen receptor signalling inhibitor (ARSi), was evaluated as first-line treatment of mCRPC, regardless of the mutational state of genes, participating in the homologous recombination repair (HRR). This review explores the role of PARPi in PCa and analyses the data of latest clinical trials exploring the PARPi-ARSi combinations, and how these results could change our clinical practice.

Also flagged:HDHuntington Diseaseautosomal-dominant neurodegenerative disorderpolyglutaminepolyprolinepolymerase
Journal Article 2024-08-02 No Snippets Findlay Black H, Kay C, Dawson J, Bortnick S, Javier K, Xia Q, Chau CH, Leavitt T, Arning L, Nguyen HP, Hayden MR.
Show Full Abstract

<h4>Purpose</h4>In Huntington disease (HD), synonymous variants causing loss or duplication of the interrupting CAA codon in the <i>HTT</i> CAG repeat modify disease onset. These variants are undetectable during HD genetic testing, resulting in inaccurate diagnostic reporting of uninterrupted CAG repeat length. Inaccurate reporting of CAG repeat length results in misdiagnosis of individuals with alleles near diagnostic cut-offs. We present a method to identify variant alleles during CAG repeat genotyping, allowing accurate diagnostic reporting of uninterrupted CAG repeat length.<h4>Methods</h4>We used triplet-primed PCR (TP-PCR) to amplify <i>HTT</i> CAG repeat alleles with canonical or noncanonical repeat interruptions and leveraged differences in peak amplification patterns to develop a screening method based on peak height ratio (PHR). We used PHR to screen blood DNA from a cohort of symptomatic individuals with diagnostic CAG repeat lengths of 40 to 41.<h4>Results</h4>TP-PCR enables accurate reporting of uninterrupted CAG repeat length in diagnostic testing by detecting HD alleles with loss or duplication of the CAG repeat interruption.<h4>Conclusion</h4>PHR screening of TP-PCR traces is a cost-effective screening method for detection, ascertainment of uninterrupted <i>HTT</i> CAG repeat length, and accurate diagnostic reporting for individuals with disease-modifying noncanonical CAG repeat interruptions.

DCC
Also flagged:psychiatric disordersmethylationbrain developmentagingpsychiatric diseasesautism spectrum disorder
Journal Article 2024-08-02 ✓ 1 Snippet Mao Q, Luo Z, Wang X, Wang K, Wang Z, Zhang Y, Luo X.
In-Text Gene Mentions

DCC

Show Full Abstract

Neuroepigenetics underscores the significance of the methylome in both normal and pathological brain function, influencing neurobiological processes and psychiatric well-being. This study systematically examines methylome-wide association studies (MWAS) across various psychiatric disorders that utilize array-based and sequencing approaches on blood or brain tissue samples. The findings provide valuable insights into the early stages of neuropathogenesis in psychiatric disorders, revealing altered epigenetic mechanisms. The methylome emerges as a pivotal factor in the development and treatment of psychiatric conditions, potentially offering avenues for identifying therapeutic targets and informing treatment strategies.

HFE
Also flagged:Inflammatory Bowel Diseaseobesityliver fibrosissteroidinsulin resistanceSteatotic Liver Disease
Journal Article 2024-08-01 ✓ 1 Snippet Martínez-Domínguez SJ, García-Mateo S, Gargallo-Puyuelo CJ, Gallego-Llera B, Callau P, Mendi C, Arroyo-Villarino MT, Simón-Marco MÁ, Ampuero J, Gomollón F.
In-Text Gene Mentions

…lpha-1 antitrypsin deficiency,hemochromatosis, or storage diseases),…

Show Full Abstract

<h4>Background</h4>Despite classical association between metabolic dysfunction-associated steatotic liver disease (MASLD) and obesity, there is increasing evidence on the development of MASLD in lean individuals. The aim of the study was to assess the prevalence and risk factors of MASLD and significant liver fibrosis in lean participants with inflammatory bowel disease (IBD).<h4>Methods</h4>This was a cross-sectional, case-control study including 300 lean cases with IBD and 80 lean controls without IBD, matched by sex and age. All participants underwent a liver ultrasound, transient elastography, and laboratory tests.<h4>Results</h4>The lean IBD group showed a significantly higher prevalence of MASLD compared with lean non-IBD group (21.3% vs 10%; P = .022), but no differences were observed in the prevalence of significant liver fibrosis (4.7% vs 0.0%; P = 1.000). No differences were found between the prevalence of MASLD in IBD and non-IBD participants who were overweight/obese (66.8% vs 70.8%; P = .442). In addition, the prevalence of MASLD was significantly higher in the overweight/obese IBD group compared with the lean IBD group (P < .001). IBD was an independent risk factor for MASLD in lean participants (odds ratio [OR], 2.71; 95% confidence interval [CI], 1.05-7.01; P = .04), after adjusting for classic metabolic risk factors and prior history of systemic steroid use. Nevertheless, no association between IBD related factors and MASLD was identified in lean IBD participants. When the overweight/obese and lean IBD groups with MASLD were compared, the overweight/obese IBD group with MASLD showed higher levels of the homeostatic model assessment of insulin resistance (OR, 1.49; 95% CI, 1.11-1.98; P = .007) and history of smoking (OR, 4.66; 95% CI, 1.17-18.49; P = .029).<h4>Conclusions</h4>MASLD prevalence was higher in the lean IBD group compared with lean non-IBD group, independent of classic metabolic risk factors.

HFE
Also flagged:Liver CancerPrimary liver cancerhepatocellular carcinomacholangiocarcinomacancerliver disease
Journal Article 2024-08-01 ✓ 1 Snippet Lee DU, Adonizio EA, Hastie DJ, Ponder R, Lee KJ, Jung D, Fan GH, Malik R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Primary liver cancer (PLC) has placed an increasing economic and resource burden on the health care system of the United States. We attempted to quantify its epidemiology and associated costs using a national inpatient database.<h4>Methods</h4>Hospital discharge and insurance claims data from the National Inpatient Sample were used to conduct this analysis. Patients diagnosed with PLC (hepatocellular carcinoma or cholangiocarcinoma) were included in the study population, which was then stratified using patient demographics, comorbidities, degree of cancer spread, liver disease complications, and other descriptors. Trends were analyzed via regression curves for each of these strata from the years 2016 to 2019, with special attention to patterns in hospitalization incidence, inpatient mortality rate, total costs, and average per-capita costs. The resulting curves were evaluated using goodness-of-fit statistics and P -values.<h4>Results</h4>Aggregate hospitalization incidence, inpatient mortality rates, and total costs were found to significantly increase throughout the study period ( P =0.002, 0.002, and 0.02, respectively). Relative to their demographic counterparts, males, White Americans, and those older than 65 years of age contributed the largest proportions of total costs. These population segments also experienced significant increases in total expenditure ( P =0.04, 0.03, and 0.02, respectively). Admissions deemed to have multiple comorbidities were associated with progressively higher total costs throughout the study period ( P =0.01). Of the categorized underlying liver diseases, only admissions diagnosed with alcoholic liver disease or nonalcoholic fatty liver disease saw significantly increasing total costs ( P =0.006 and 0.01), although hepatitis C was found to be the largest contributor to total expenses.<h4>Conclusions</h4>From 2016 to 2019, total costs, admission incidence, and inpatient mortality rates associated with PLC hospitalization increased. Strata-specific findings may be reflective of demographic shifts in the PLC patient populations, as well as changes in underlying chronic liver disease etiologies.

PCDH17
Also flagged:myeloid neoplasmsCHNeoplasmhematopoiesismyeloid neoplasmaging
Journal Article 2024-08-01 ✓ 1 Snippet Tran D, Beeler JS, Liu J, Wiley B, Chan ICC, Xin Z, Kramer MH, Batchi-Bouyou AL, Zong X, Walter MJ, Petrone GEM, Chlamydas S, Ferraro F, Oh ST, Link DC, Busby B, Cao Y, Bolton KL.
In-Text Gene Mentions

…AMIGO2, GALNT3, KAZALD1,PCDH17, and SLITRK2 that…

Show Full Abstract

<h4>Purpose</h4>Clonal hematopoiesis (CH) is thought to be the origin of myeloid neoplasms (MN). Yet, our understanding of the mechanisms driving CH progression to MN and clinical risk prediction of MN remains limited. The human proteome reflects complex interactions between genetic and epigenetic regulation of biological systems. We hypothesized that the plasma proteome might predict MN risk and inform our understanding of the mechanisms promoting MN development.<h4>Experimental design</h4>We jointly characterized CH and plasma proteomic profiles of 46,237 individuals in the UK Biobank at baseline study entry. During 500,036 person-years of follow-up, 115 individuals developed MN. Cox proportional hazard regression was used to test for an association between plasma protein levels and MN risk.<h4>Results</h4>We identified 115 proteins associated with MN risk, of which 30% (N = 34) were also associated with CH. These were enriched for known regulators of the innate and adaptive immune system. Plasma proteomics improved the prediction of MN risk (AUC = 0.85; P = 5×10-9) beyond clinical factors and CH (AUC = 0.80). In an independent group (N = 381,485), we used inherited polygenic risk scores (PRS) for plasma protein levels to validate the relevance of these proteins toMNdevelopment. PRS analyses suggest that most MN-associated proteins we identified are not directly causally linked toMN risk, but rather represent downstream markers of pathways regulating the progression of CH to MN.<h4>Conclusions</h4>These data highlight the role of immune cell regulation in the progression of CH to MN and the promise of leveraging multi-omic characterization of CH to improveMN risk stratification. See related commentary by Bhalgat and Taylor, p. 3095.

HFE
Also flagged:anxietyironbindingiron deficiency anemiaRCATransferrin
Journal Article 2024-08-01 ✓ 1 Snippet Jittapranerat J, Chinswangwatanakul W.
In-Text Gene Mentions

…of overordering werehemochromatosisdiagnosis, pretransfusion prot…

Show Full Abstract

<h4>Objectives</h4>This study aimed to develop a root cause analysis (RCA) model for test overutilization, applying it to transferrin overordering at our institution.<h4>Methods</h4>A comprehensive review was undertaken to establish a systematic RCA model. Upon implementation, the questionnaire identifying the root causes of transferrin overordering with infographic intervention was distributed to clinicians and nurses.<h4>Results</h4>The RCA model comprises 5 steps: (1) problem identification, (2) causal factor determination, (3) data collection, (4) significant factor identification, and (5) corrective action development and outcome measurement. The major causes of transferrin overutilization were confusion between transferrin and transferrin saturation, as well as unfamiliarity with the laboratory handbook. An infographic reduced postintervention transferrin ordering among clinicians (84.9%, P < .001) and nurses (46.8%, P < .001).<h4>Conclusions</h4>This study presents a 5-step RCA model that offers a customized method to identify the causes of test overutilization. Applying this model to transferrin at our institution revealed 22 leading root causes. Laboratories are encouraged to adopt this RCA model as it can contribute to optimized patient care and more efficient resource allocation.

HFE
Also flagged:HJV
Journal Article 2024-08-01 ✓ 1 Snippet Vadivelan A, Zhang S, Srole DN, Marcus EA, Neto GC, Nemeth E, Ganz T, De Oliveira S.
In-Text Gene Mentions

…HJV mutations causinghemochromatosis: variable phenotypic expressi…

Show Full Abstract

No abstract available.

POU3F2
Also flagged:ZNF397TET2ARProstate CancerCancerzinc finger protein 397
Journal Article 2024-08-01 ✓ 1 Snippet Xu Y, Yang Y, Wang Z, Sjöström M, Jiang Y, Tang Y, Cheng S, Deng S, Wang C, Gonzalez J, Johnson NA, Li X, Li X, Metang LA, Mukherji A, Xu Q, Tirado CR, Wainwright G, Yu X, Barnes S, Hofstad M, Chen Y, Zhu H, Hanker AB, Raj GV, Zhu G, He HH, Wang Z, Arteaga CL, Liang H, Feng FY, Wang Y, Wang T, Mu P.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Cancer cells exhibit phenotypical plasticity and epigenetic reprogramming that allows them to evade lineage-dependent targeted treatments by adopting lineage plasticity. The underlying mechanisms by which cancer cells exploit the epigenetic regulatory machinery to acquire lineage plasticity and therapy resistance remain poorly understood. We identified zinc finger protein 397 (ZNF397) as a bona fide coactivator of the androgen receptor (AR), essential for the transcriptional program governing AR-driven luminal lineage. ZNF397 deficiency facilitates the transition of cancer cell from an AR-driven luminal lineage to a ten-eleven translocation 2 (TET2)-driven lineage plastic state, ultimately promoting resistance to therapies inhibiting AR signaling. Intriguingly, our findings indicate that a TET2 inhibitor can eliminate the resistance to AR-targeted therapies in ZNF397-deficient tumors. These insights uncover a novel mechanism through which prostate cancer acquires lineage plasticity via epigenetic rewiring and offer promising implications for clinical interventions designed to overcome therapy resistance dictated by lineage plasticity. Significance: This study reveals a bifurcated role of ZNF397, and a TET2-driven epigenetic mechanism regulating tumor lineage plasticity and therapy response in prostate cancer, enhances the understanding of drug resistance, and unveils a new therapeutic strategy for overcoming androgen receptor-targeted therapy resistance.

Also flagged:IRF4BLOC1S5TEMPI syndrome
Journal Article 2024-08-01 No Snippets Zhao M, Liu J, Yu Q, Xu W, Zhang Z, Fu Z, Jia M, Zeng X, Wu C, Ye C, Wu C, Wu Y, Ren R, Li J, Wang K, Yan H.
Show Full Abstract

No abstract available.

Also flagged:LAIR1lung cancercollagencollagen-binding inhibitory receptorleukocyte-associated immunoglobulin-like receptor 1tumor
Journal Article 2024-08-01 No Snippets Rodriguez BL, Huang J, Gibson L, Fradette JJ, Chen HH, Koyano K, Cortez C, Li B, Ho C, Ashique AM, Lin VY, Crawley S, Roda JM, Chen P, Fan B, Kim J, Sissons J, Sitrin J, Kaplan DD, Gibbons DL, Rivera LB.
Show Full Abstract

We recently reported that resistance to PD-1 blockade in a refractory lung cancer-derived model involved increased collagen deposition and the collagen-binding inhibitory receptor leukocyte-associated immunoglobulin-like receptor 1 (LAIR1). Thus, we hypothesized that LAIR1 and collagen cooperated to suppress therapeutic response. In this study, we report that LAIR1 is associated with tumor stroma and is highly expressed by intratumoral myeloid cells in both human tumors and mouse models of cancer. Stroma-associated myeloid cells exhibit a suppressive phenotype and correlate with LAIR1 expression in human cancer. NGM438, a novel humanized LAIR1 antagonist mAb, elicits myeloid inflammation and allogeneic T-cell responses by binding to LAIR1 and blocking collagen engagement. Furthermore, a mouse-reactive NGM438 surrogate antibody sensitized refractory KP mouse lung tumors to anti-PD-1 therapy and resulted in increased intratumoral CD8+ T-cell content and inflammatory gene expression. These data place LAIR1 at the intersection of stroma and suppressive myeloid cells and support the notion that blockade of the LAIR1/collagen axis can potentially address resistance to checkpoint inhibitor therapy in the clinic.

POU3F2
Also flagged:ASCL1PDAchaete-scute family bHLH transcription factor 1neurogenesistranscription factorsNURR1
Journal Article 2024-08-01 ✓ 1 Snippet Yong SH, Kim SM, Kong GW, Ko SH, Lee EH, Oh Y, Park CH.
In-Text Gene Mentions

…factors, BRN2 (Pou3f2), achaete-scute family…

Show Full Abstract

Parkinson's disease (PD), characterized by dopaminergic neuron degeneration in the substantia nigra, is caused by various genetic and environmental factors. Current treatment methods are medication and surgery; however, a primary therapy has not yet been proposed. In this study, we aimed to develop a new treatment for PD that induces direct reprogramming of dopaminergic neurons (iDAN). Achaete-scute family bHLH transcription factor 1 (ASCL1) is a primary factor that initiates and regulates central nervous system development and induces neurogenesis. In addition, it interacts with BRN2 and MYT1L, which are crucial transcription factors for the direct conversion of fibroblasts into neurons. Overexpression of ASCL1 along with the transcription factors NURR1 and LMX1A can directly reprogram iDANs. Using a retrovirus, GFP-tagged ASCL1 was overexpressed in astrocytes. One week of culture in iDAN convertsion medium reprogrammed the astrocytes into iDANs. After 7 days of differentiation, TH+/TUJ1+ cells emerged. After 2 weeks, the number of mature TH+/TUJ1+ dopaminergic neurons increased. Only ventral midbrain (VM) astrocytes exhibited these results, not cortical astrocytes. Thus, VM astrocytes can undergo direct iDAN reprogramming with ASCL1 alone, in the absence of transcription factors that stimulate dopaminergic neurons development. [BMB Reports 2024; 57(8): 363-368].

HTT
Also flagged:UBR5Ubiquitinasesubiquitincell proliferationautophagycell cycle
Journal Article 2024-08-01 ✓ 3 Snippets Wang Y, Niu K, Shi Y, Zhou F, Li X, Li Y, Chen T, Zhang Y.
In-Text Gene Mentions

…in the huntingtin (HTT) gene results in…

…production of mutantHTTprotein (mHTT) 171…

…UBR5 degradesHTTproteins, whether normal…

Show Full Abstract

Ubiquitinases are known to catalyze ubiquitin chains on target proteins to regulate various physiological functions like cell proliferation, autophagy, apoptosis, and cell cycle progression. As a member of E3 ligase, ubiquitin protein ligase E3 component n-recognin 5 (UBR5) belongs to the HECT E3 ligase and has been reported to be correlated with various pathophysiological processes. In this review, the authors give a comprehensive insight into the structure and function of UBR5. The authors discuss the specific domains of UBR5 and explore their biological functions separately. Furthermore, the authors describe the involvement of UBR5 in different pathophysiological conditions, including immune response, virus infection, DNA damage response, and protein quality control. Moreover, the authors provide a thorough summary of the important roles and regulatory mechanisms of UBR5 in cancers and other diseases. On the whole, investigating the domains and functions of UBR5, elucidating the underlying mechanisms of UBR5 with various substrates in detail may provide new theoretical basis for the treatment of diseases, including cancers, which could improve future studies to construct novel UBR5-targeted therapy strategies.

HTT
Also flagged:FMRPFragile X syndromeneurodevelopmental disorderautism spectrum disordersFragile X mental retardation proteinRNA binding protein
Journal Article 2024-08-01 ✓ 1 Snippet Rani R, Sri NS, Medishetti R, Chatti K, Sevilimedu A.
In-Text Gene Mentions

htt

Show Full Abstract

Fragile X syndrome (FXS) is an inherited neurodevelopmental disorder and the leading genetic cause of autism spectrum disorders. FXS is caused by loss of function mutations in Fragile X mental retardation protein (FMRP), an RNA binding protein that is known to regulate translation of its target mRNAs, predominantly in the brain and gonads. The molecular mechanisms connecting FMRP function to neurodevelopmental phenotypes are well understood. However, neither the full extent of reproductive phenotypes, nor the underlying molecular mechanisms have been as yet determined. Here, we developed new fmr1 knockout zebrafish lines and show that they mimic key aspects of FXS neuronal phenotypes across both larval and adult stages. Results from the fmr1 knockout females also showed that altered gene expression in the brain, via the neuroendocrine pathway contribute to distinct abnormal phenotypes during ovarian development and oocyte maturation. We identified at least three mechanisms underpinning these defects, including altered neuroendocrine signaling in sexually mature females resulting in accelerated ovarian development, altered expression of germ cell and meiosis promoting genes at various stages during oocyte maturation, and finally a strong mitochondrial impairment in late stage oocytes from knockout females. Our findings have implications beyond FXS in the study of reproductive function and female infertility. Dissection of the translation control pathways during ovarian development using models like the knockout lines reported here may reveal novel approaches and targets for fertility treatments.

HFE
Also flagged:Ironinfectionsinfectionhereditary hemochromatosissepsisdeath
Journal Article 2024-08-01 ✓ 4 Snippets Mottelson M, Glenthøj A, Nordestgaard BG, Ellervik C, Petersen J, Bojesen SE, Helby J.
In-Text Gene Mentions

Therefore, we tested whether high and low iron, transferrin saturation, and ferritin are associated with risk of infections observationally and genetically through HFE genotypes.

…Iron,hemochromatosisgenotypes, and risk…

…and genetically throughHFEgenotypes.…

HFEwas genotyped for…

Show Full Abstract

<h4>Abstract</h4>It is unclear whether risk of infection is increased in individuals with hereditary hemochromatosis and in individuals with low or high plasma iron, transferrin saturation, or ferritin. Therefore, we tested whether high and low iron, transferrin saturation, and ferritin are associated with risk of infections observationally and genetically through HFE genotypes. We studied 142 188 Danish general population individuals. Iron, transferrin saturation, and ferritin were measured in 136 656, 136 599, and 38 020 individuals, respectively. HFE was genotyped for C282Y and H63D in 132 542 individuals. Median follow-up after study enrollment was 8 years (range, 0-38) for hospital and emergency room admissions with infections (n = 20 394) using the National Patient Register, covering all Danish hospitals. Hazard ratios for any infection were 1.20 (95% confidence interval [CI], 1.12-1.28) and 1.14 (95% CI, 1.07-1.22) in individuals with plasma iron ≤5th or ≥95th percentile compared with individuals with iron from 26th to 74th percentiles. Findings for transferrin saturation were similar, whereas infection risk was not increased in individuals with ferritin ≤5th or ≥95th percentile. Hazard ratios in C282Y homozygotes vs noncarriers were 1.40 (95% CI, 1.16-1.68) for any infection, 1.69 (95% CI, 1.05-2.73) for sepsis, and 2.34 (95% CI, 1.41-3.90) for death from infectious disease. Risk of infection was increased in C282Y homozygotes with normal plasma iron, transferrin saturation, or ferritin, and in C282Y homozygotes without liver disease, diabetes, and/or heart failure. In summary, low and high plasma iron and transferrin saturation were independently associated with increased infection risk. C282Y homozygotes had increased risk of any infection, sepsis, and death from infections. Even C282Y homozygotes with normal iron, transferrin saturation, or ferritin, not currently recommended for genotyping, had increased infection risk.

Also flagged:fetal hemoglobinerythropoiesisβ-globinsickle cell diseaseβ-thalassemiatranscriptional regulators
Journal Article 2024-08-01 No Snippets Khandros E, Blobel GA, Blobel GA.
Show Full Abstract

<h4>Abstract</h4>It has been known for over half a century that throughout ontogeny, humans produce different forms of hemoglobin, a tetramer of α- and β-like hemoglobin chains. The switch from fetal to adult hemoglobin occurs around the time of birth when erythropoiesis shifts from the fetal liver to the bone marrow. Naturally, diseases caused by defective adult β-globin genes, such as sickle cell disease and β-thalassemia, manifest themselves as the production of fetal hemoglobin fades. Reversal of this developmental switch has been a major goal to treat these diseases and has been a driving force to understand its underlying molecular biology. Several review articles have illustrated the long and at times arduous paths that led to the discovery of the first transcriptional regulators involved in this process. Here, we survey recent developments spurred by the discovery of CRISPR tools that enabled for the first time high-throughput genetic screens for new molecules that impact the fetal-to-adult hemoglobin switch. Numerous opportunities for therapeutic intervention have thus come to light, offering hope for effective pharmacologic intervention for patients for whom gene therapy is out of reach.

Also flagged:Chimeric Antigen Receptorscancerchimeric antigen receptortumorsolid tumorsB-cell lymphomas
Journal Article 2024-08-01 No Snippets Thomas P, Paris P, Pecqueur C.
Show Full Abstract

Immunotherapy has emerged as a promising approach in the field of cancer treatment, with chimeric antigen receptor (CAR) T-cell therapy demonstrating remarkable success. However, challenges such as tumor antigen heterogeneity, immune evasion, and the limited persistence of CAR-T cells have prompted the exploration of alternative cell types for CAR-based strategies. Gamma delta T cells, a unique subset of lymphocytes with inherent tumor recognition capabilities and versatile immune functions, have garnered increasing attention in recent years. In this review, we present how arming Vδ2-T cells might be the basis for next-generation immunotherapies against solid tumors. Following a comprehensive overview of γδ T-cell biology and innovative CAR engineering strategies, we discuss the clinical potential of Vδ2 CAR-T cells in overcoming the current limitations of immunotherapy in solid tumors. Although the applications of Vδ2 CAR-T cells in cancer research are relatively in their infancy and many challenges are yet to be identified, Vδ2 CAR-T cells represent a promising breakthrough in cancer immunotherapy.

SOX6
Also flagged:tumorOsteosarcomaosteosarcomasOStumorssarcomas
Journal Article 2024-08-01 ✓ 1 Snippet Truong DD, Weistuch C, Murgas KA, Admane P, King BL, Chauviere Lee J, Lamhamedi-Cherradi SE, Swaminathan J, Daw NC, Gordon N, Gopalakrishnan V, Gorlick RG, Somaiah N, Deasy JO, Mikos AG, Tannenbaum A, Ludwig J.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Purpose</h4>The genetic intratumoral heterogeneity observed in human osteosarcomas poses challenges for drug development and the study of cell fate, plasticity, and differentiation, which are processes linked to tumor grade, cell metastasis, and survival.<h4>Experimental design</h4>To pinpoint errors in osteosarcoma differentiation, we transcriptionally profiled 31,527 cells from a tissue-engineered model that directs mesenchymal stem cells toward adipogenic and osteoblastic fates. Incorporating preexisting chondrocyte data, we applied trajectory analysis and non-negative matrix factorization to generate the first human mesenchymal differentiation atlas.<h4>Results</h4>This "roadmap" served as a reference to delineate the cellular composition of morphologically complex osteosarcoma tumors and quantify each cell's lineage commitment. Projecting a bulk RNA-sequencing osteosarcoma dataset onto this roadmap unveiled a correlation between a stem-like transcriptomic phenotype and poorer survival outcomes.<h4>Conclusions</h4>Our study quantifies osteosarcoma differentiation and lineage, a prerequisite to better understanding lineage-specific differentiation bottlenecks that might someday be targeted therapeutically.

HTT
Also flagged:glutamatedeathneurodegenerative genetic disorderbehaviouralpathogenesisHD
Journal Article 2024-08-01 ✓ 5 Snippets Jiang A, You L, Handley RR, Hawkins V, Reid SJ, Jacobsen JC, Patassini S, Rudiger SR, Mclaughlan CJ, Kelly JM, Verma PJ, Bawden CS, Gusella JF, MacDonald ME, Waldvogel HJ, Faull RLM, Lehnert K, Snell RG.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative genetic disorder caused by an expansion in the CAG repeat tract of the huntingtin (HTT) gene resulting in behavioural, cognitive, and motor defects.

…the huntingtin (HTT) gene resulting…

…huntingtin gene (HTT) [ 1…

…human huntingtin (HTT) cDNA with…

…TheHTTcDNA is under…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative genetic disorder caused by an expansion in the CAG repeat tract of the huntingtin (HTT) gene resulting in behavioural, cognitive, and motor defects. Current knowledge of disease pathogenesis remains incomplete, and no disease course-modifying interventions are in clinical use. We have previously reported the development and characterisation of the OVT73 transgenic sheep model of HD. The 73 polyglutamine repeat is somatically stable and therefore likely captures a prodromal phase of the disease with an absence of motor symptomatology even at 5-years of age and no detectable striatal cell loss. To better understand the disease-initiating events we have undertaken a single nuclei transcriptome study of the striatum of an extensively studied cohort of 5-year-old OVT73 HD sheep and age matched wild-type controls. We have identified transcriptional upregulation of genes encoding N-methyl-D-aspartate (NMDA), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate receptors in medium spiny neurons, the cell type preferentially lost early in HD. Further, we observed an upregulation of astrocytic glutamate uptake transporters and medium spiny neuron GABAA receptors, which may maintain glutamate homeostasis. Taken together, these observations support the glutamate excitotoxicity hypothesis as an early neurodegeneration cascade-initiating process but the threshold of toxicity may be regulated by several protective mechanisms. Addressing this biochemical defect early may prevent neuronal loss and avoid the more complex secondary consequences precipitated by cell death.

BTN2A1
Also flagged:acute myeloid leukemiaAMLleukocytosisbutyrophilin 3Atumorimmune checkpoint receptors
Journal Article 2024-08-01 ✓ 1 Snippet Le Floch AC, Orlanducci F, Béné MC, Ben Amara A, Rouviere MS, Salem N, Le Roy A, Cordier C, Demerlé C, Granjeaud S, Hamel JF, Ifrah N, Cornillet-Lefebvre P, Delaunay J, Récher C, Delabesse E, Pigneux A, Vey N, Chretien AS, Olive D.
In-Text Gene Mentions

…soluble BTN3A andBTN2A1have been associated…

Show Full Abstract

<h4>Abstract</h4>In several tumor subtypes, an increased infiltration of Vγ9Vδ2 T cells has been shown to have the highest prognostic value compared with other immune subsets. In acute myeloid leukemia (AML), similar findings have been based solely on the inference of transcriptomic data and have not been assessed with respect to confounding factors. This study aimed at determining, by immunophenotypic analysis (flow or mass cytometry) of peripheral blood from patients with AML at diagnosis, the prognostic impact of Vγ9Vδ2 T-cell frequency. This was adjusted for potential confounders (age at diagnosis, disease status, European LeukemiaNet classification, leukocytosis, and allogeneic hematopoietic stem cell transplantation as a time-dependent covariate). The cohort was composed of 198 patients with newly diagnosed (ND) AML. By univariate analysis, patients with lower Vγ9Vδ2 T cells at diagnosis had significantly lower 5-year overall and relapse-free survivals. These results were confirmed in multivariate analysis (hazard ratio [HR], 1.55 [95% confidence interval (CI), 1.04-2.30]; P = .030 and HR, 1.64 [95% CI, 1.06-2.53]; P = .025). Immunophenotypic alterations observed in patients with lower Vγ9Vδ2 T cells included a loss of some cytotoxic Vγ9Vδ2 T-cell subsets and a decreased expression of butyrophilin 3A on the surface of blasts. Samples expanded regardless of their Vγ9Vδ2 T-cell levels and displayed similar effector functions in vitro. This study confirms the prognostic value of elevated Vγ9Vδ2 T cells among lymphocytes in patients with ND AML. These results provide a strong rationale to consider consolidation protocols aiming at enhancing Vγ9Vδ2 T-cell responses.

SOX6
Also flagged:mechanotransductionsignal transductionreceptorshearinginformation transductionmembrane
Journal Article 2024-08-01 ✓ 1 Snippet Nakamichi R, Asahara H.
In-Text Gene Mentions

Sox6

Show Full Abstract

Tendons play an important role in the maintenance of motor function by connecting muscles and bones and transmitting forces. Particularly, the role of mechanical stress has primarily focused on the key mechanism of tendon homeostasis, with much research on this topic. With the recent development of molecular biological techniques, the mechanisms of mechanical stress sensing and signal transduction have been gradually elucidated with the identification of mechanosensor in tendon cells and the master regulator in tendon development. This review provides a comprehensive overview of the structure and function of tendon tissue, including the role for physical performance and the detailed mechanism of mechanotransduction in its regulation. An important lesson is that the role of mechanotransduction in tendon tissue is only partially clarified, indicating the complexity of the mechanisms of motor function and fueling increasing interest in uncovering these mechanisms.

LRRC7
Also flagged:type 2 diabetesdepressionneuroticismasthmatype 1 diabetes mellitusAging
Journal Article 2024-08-01 ✓ 2 Snippets Gong T, Karlsson R, Yao S, Magnusson PKE, Ajnakina O, Steptoe A, Bhatta L, Brumpton B, Kumar A, Mélen E, 23andMe research team, Lin KH, Tian C, Fall T, Almqvist C.
In-Text Gene Mentions

…GWAS Catalog wereLRRC7, NCS1 ,…

…nearest genes (i.e.LRRC7, NCS1 ,…

Show Full Abstract

Dog ownership has been associated with several complex traits, and there is evidence of genetic influence. We performed a genome-wide association study of dog ownership through a meta-analysis of 31,566 Swedish twins in 5 discovery cohorts and an additional 65,986 European-ancestry individuals in 3 replication cohorts from Sweden, Norway, and the United Kingdom. Association tests with >7.4 million single-nucleotide polymorphisms were meta-analyzed using a fixed effect model after controlling for population structure and relatedness. We identified 2 suggestive loci using discovery cohorts, which did not reach genome-wide significance after meta-analysis with replication cohorts. Single-nucleotide polymorphism-based heritability of dog ownership using linkage disequilibrium score regression was estimated at 0.123 (CI 0.038-0.207) using the discovery cohorts and 0.018 (CI -0.002 to 0.039) when adding in replication cohorts. Negative genetic correlation with complex traits including type 2 diabetes, depression, neuroticism, and asthma was only found using discovery summary data. Furthermore, we did not identify any genes/gene-sets reaching even a suggestive level of significance. This genome-wide association study does not, by itself, provide clear evidence on common genetic variants that influence dog ownership among European-ancestry individuals.

Also flagged:Breast Cancertriple-negative breast cancerTNFSF10NACAP1GRHL2LINC00536
Journal Article 2024-08-01 No Snippets Sun X, Verma SP, Jia G, Wang X, Ping J, Guo X, Shu XO, Chen J, Derkach A, Cai Q, Liang X, Long J, Offit K, Oh JH, Reiner AS, Watt GP, Woods M, Yang Y, Ambrosone CB, Ambs S, Chen Y, Concannon P, Garcia-Closas M, Gu J, Haiman CA, Hu JJ, Huo D, John EM, Knight JA, Li CI, Lynch CF, Mellemkjær L, Nathanson KL, Nemesure B, Olopade OI, Olshan AF, Pal T, Palmer JR, Press MF, Sanderson M, Sandler DP, Troester MA, Zheng W, Bernstein JL, Buas MF, Shu X.
Show Full Abstract

Breast cancer includes several subtypes with distinct characteristic biological, pathologic, and clinical features. Elucidating subtype-specific genetic etiology could provide insights into the heterogeneity of breast cancer to facilitate the development of improved prevention and treatment approaches. In this study, we conducted pairwise case-case comparisons among five breast cancer subtypes by applying a case-case genome-wide association study (CC-GWAS) approach to summary statistics data of the Breast Cancer Association Consortium. The approach identified 13 statistically significant loci and eight suggestive loci, the majority of which were identified from comparisons between triple-negative breast cancer (TNBC) and luminal A breast cancer. Associations of lead variants in 12 loci remained statistically significant after accounting for previously reported breast cancer susceptibility variants, among which, two were genome-wide significant. Fine mapping implicated putative functional/causal variants and risk genes at several loci, e.g., 3q26.31/TNFSF10, 8q22.3/NACAP1/GRHL2, and 8q23.3/LINC00536/TRPS1, for TNBC as compared with luminal cancer. Functional investigation further identified rs16867605 at 8q22.3 as a SNP that modulates the enhancer activity of GRHL2. Subtype-informative polygenic risk scores (PRS) were derived, and patients with a high subtype-informative PRS had an up to two-fold increased risk of being diagnosed with TNBC instead of luminal cancers. The CC-GWAS PRS remained statistically significant after adjusting for TNBC PRS derived from traditional case-control GWAS in The Cancer Genome Atlas and the African Ancestry Breast Cancer Genetic Consortium. The CC-GWAS PRS was also associated with overall survival and disease-specific survival among patients with breast cancer. Overall, these findings have advanced our understanding of the genetic etiology of breast cancer subtypes, particularly for TNBC. Significance: The discovery of subtype-informative genetic risk variants for breast cancer advances our understanding of the etiologic heterogeneity of breast cancer, which could accelerate the identification of targets and personalized strategies for prevention and treatment.

Also flagged:S100Btumormelanomatumorsgene expressionCD68
Journal Article 2024-08-01 No Snippets Aung TN, Warrell J, Martinez-Morilla S, Gavrielatou N, Vathiotis I, Yaghoobi V, Kluger HM, Gerstein M, Rimm DL.
Show Full Abstract

<h4>Purpose</h4>We aim to improve the prediction of response or resistance to immunotherapies in patients with melanoma. This goal is based on the hypothesis that current gene signatures predicting immunotherapy outcomes show only modest accuracy due to the lack of spatial information about cellular functions and molecular processes within tumors and their microenvironment.<h4>Experimental design</h4>We collected gene expression data spatially from three cellular compartments defined by CD68+ macrophages, CD45+ leukocytes, and S100B+ tumor cells in 55 immunotherapy-treated melanoma specimens using Digital Spatial Profiling-Whole Transcriptome Atlas. We developed a computational pipeline to discover compartment-specific gene signatures and determine if adding spatial information can improve patient stratification.<h4>Results</h4>We achieved robust performance of compartment-specific signatures in predicting the outcome of immune checkpoint inhibitors in the discovery cohort. Of the three signatures, the S100B signature showed the best performance in the validation cohort (N = 45). We also compared our compartment-specific signatures with published bulk signatures and found the S100B tumor spatial signature outperformed previous signatures. Within the eight-gene S100B signature, five genes (PSMB8, TAX1BP3, NOTCH3, LCP2, and NQO1) with positive coefficients predict the response, and three genes (KMT2C, OVCA2, and MGRN1) with negative coefficients predict the resistance to treatment.<h4>Conclusions</h4>We conclude that the spatially defined compartment signatures utilize tumor and tumor microenvironment-specific information, leading to more accurate prediction of treatment outcome, and thus merit prospective clinical assessment.

SOX6
Also flagged:osteoporosismineralMAP1LC3BRERE 8Nicotine useTissue
Journal Article 2024-08-01 ✓ 1 Snippet Qin C, Zhang W, Xiao C, Qu Y, Xiao J, Wu X, Zhang L, Wang Y, He L, Zhu J, Wang W, Li Y, Sun L, Jiang X.
In-Text Gene Mentions

SOX6

Show Full Abstract

Although the negative association of tobacco smoking with osteoporosis is well-documented, little is known regarding the shared genetic basis underlying these conditions. In this study, we aim to investigate a shared genetic architecture between smoking and heel estimated bone mineral density (eBMD), a reliable proxy for osteoporosis. We conducted a comprehensive genome-wide cross-trait analysis to identify genetic correlation, pleiotropic loci and causal relationship of smoking with eBMD, leveraging summary statistics of the hitherto largest genome-wide association studies conducted in European ancestry for smoking initiation (Nsmoker = 1 175 108, Nnonsmoker = 1 493 921), heaviness (cigarettes per day, N = 618 489), cessation (Ncurrent smoker = 304 244, Nformer smoker = 843 028), and eBMD (N = 426 824). A significant negative global genetic correlation was found for smoking cessation and eBMD (${r}_g$ = -0.051, P = 0.01), while we failed to identify a significant global genetic correlation of smoking initiation or heaviness with eBMD. Partitioning the whole genome into independent blocks, we observed 6 significant shared local signals for smoking and eBMD, with 22q13.1 showing the strongest regional genetic correlation. Such a genetic overlap was further supported by 71 pleiotropic loci identified in the cross-trait meta-analysis. Mendelian randomization identified no causal effect of smoking initiation (beta = -0.003 g/cm2, 95% CI = -0.033 to 0.027) or heaviness (beta = -0.017 g/cm2, 95% CI = -0.072 to 0.038) on eBMD, but a putative causal effect of genetic predisposition to being a current smoker was associated with a lower eBMD compared to former smokers (beta = -0.100 g/cm2, 95% CI = -0.181 to -0.018). Our study demonstrates a pronounced biological pleiotropy as well as a putative causal link between current smoking status and eBMD, providing novel insights into the primary prevention and modifiable intervention of osteoporosis by advocating individuals to avoid, reduce or quit smoking as early as possible.

NEGR1
Also flagged:Schizophreniapsychiatric disorderhallucinationsdelusionscognitive impairmentAnorexia nervosa
Journal Article 2024-08-01 ✓ 2 Snippets Lu ZA, Ploner A, Birgegård A, Eating Disorders Working Group of the Psychiatric Genomics Consortium, Bulik CM, Bergen SE.
In-Text Gene Mentions

NEGR1was observed to…

…27 BlockingNEGR1expression in the…

Show Full Abstract

<h4>Background and hypothesis</h4>Schizophrenia (SCZ) and anorexia nervosa (AN) are 2 severe and highly heterogeneous disorders showing substantial familial co-aggregation. Genetic factors play a significant role in both disorders, but the shared genetic etiology between them is yet to be investigated.<h4>Study design</h4>Using summary statistics from recent large genome-wide association studies on SCZ (Ncases = 53 386) and AN (Ncases = 16 992), a 2-sample Mendelian randomization analysis was conducted to explore the causal relationship between SCZ and AN. MiXeR was employed to quantify their polygenic overlap. A conditional/conjunctional false discovery rate (condFDR/conjFDR) framework was adopted to identify loci jointly associated with both disorders. Functional annotation and enrichment analyses were performed on the shared loci.<h4>Study results</h4>We observed a cross-trait genetic enrichment, a suggestive bidirectional causal relationship, and a considerable polygenic overlap (Dice coefficient = 62.2%) between SCZ and AN. The proportion of variants with concordant effect directions among all shared variants was 69.9%. Leveraging overlapping genetic associations, we identified 6 novel loci for AN and 33 novel loci for SCZ at condFDR <0.01. At conjFDR <0.05, we identified 10 loci jointly associated with both disorders, implicating multiple genes highly expressed in the cerebellum and pituitary and involved in synapse organization. Particularly, high expression of the shared genes was observed in the hippocampus in adolescence and orbitofrontal cortex during infancy.<h4>Conclusions</h4>This study provides novel insights into the relationship between SCZ and AN by revealing a shared genetic component and offers a window into their complex etiology.

DARS2
Also flagged:NEK4SchizophreniaBipolar I DisorderaxonHARS2SUGP1
Journal Article 2024-08-01 ✓ 1 Snippet Zhang C, Yang Z, Li X, Zhao L, Guo W, Deng W, Wang Q, Hu X, Li M, Sham PC, Xiao X, Li T.
In-Text Gene Mentions

DARS2

Show Full Abstract

<h4>Background and hypothesis</h4>Investigating the shared brain protein and genetic components of schizophrenia (SCZ) and bipolar I disorder (BD-I) presents a unique opportunity to understand the underlying pathophysiological processes and pinpoint potential drug targets.<h4>Study design</h4>To identify overlapping susceptibility brain proteins in SCZ and BD-I, we carried out proteome-wide association studies (PWAS) and Mendelian Randomization (MR) by integrating human brain protein quantitative trait loci with large-scale genome-wide association studies for both disorders. We utilized transcriptome-wide association studies (TWAS) to determine the consistency of mRNA-protein dysregulation in both disorders. We applied pleiotropy-informed conditional false discovery rate (pleioFDR) analysis to identify common risk genetic loci for SCZ and BD-I. Additionally, we performed a cell-type-specific analysis in the human brain to detect risk genes notably enriched in distinct brain cell types. The impact of risk gene overexpression on dendritic arborization and axon length in neurons was also examined.<h4>Study results</h4>Our PWAS identified 42 proteins associated with SCZ and 14 with BD-I, among which NEK4, HARS2, SUGP1, and DUS2 were common to both conditions. TWAS and MR analysis verified the significant risk gene NEK4 for both SCZ and BD-I. PleioFDR analysis further supported genetic risk loci associated with NEK4 for both conditions. The cell-type specificity analysis revealed that NEK4 is expressed on the surface of glutamatergic neurons, and its overexpression enhances dendritic arborization and axon length in cultured primary neurons.<h4>Conclusions</h4>These findings underscore a shared genetic origin for SCZ and BD-I, offering novel insights for potential therapeutic target identification.

Also flagged:BPphototransductionchromosomessnpRchromosomebinding
Journal Article 2024-08-01 No Snippets Campbell MA, Hale MC.
Show Full Abstract

Advancements in genome sequencing and assembly techniques have increased the documentation of structural variants in wild organisms. Of these variants, chromosomal inversions are especially prominent due to their large size and active recombination suppression between alternative homokaryotypes. This suppression enables the 2 forms of the inversion to be maintained and allows the preservation of locally adapted alleles. The Barramundi Perch (BP; Lates calcarifer) is a widespread species complex with 3 main genetic lineages located in the biogeographic regions of Australia and New Guinea (AUS + NG), Southeast Asia (SEA), and the Indian Subcontinent (IND). BP are typically considered to be a protandrous sequential hermaphrodite species that exhibits catadromy. Freshwater occupancy and intraspecific variation in life history (e.g. partially migratory populations) exist and provide opportunities for strongly divergent selection associated with, for example, salinity tolerance, swimming ability, and marine dispersal. Herein, we utilize genomic data generated from all 3 genetic lineages to identify and describe 3 polymorphic candidate chromosomal inversions. These candidate chromosomal inversions appear to be fixed for ancestral variants in the IND lineage and for inverted versions in the AUS + NG lineage and exhibit variation in all 3 inversions in the SEA lineage. BP have a diverse portfolio of life history options that includes migratory strategy as well as sexual system (i.e. hermaphroditism and gonochorism). We propose that the some of the life history variabilities observed in BP may be linked to inversions and, in doing so, we present genetic data that might be useful in enhancing aquaculture production and population management.

Also flagged:BRCA2tumor suppressornucleuslocalizationchromatinorganization
Journal Article 2024-08-01 No Snippets Paul MW, Aaron J, Wait E, Van Genderen RM, Tyagi A, Kabbech H, Smal I, Chew TL, Kanaar R, Wyman C.
Show Full Abstract

BRCA2 is an essential tumor suppressor protein involved in promoting faithful repair of DNA lesions. The activity of BRCA2 needs to be tuned precisely to be active when and where it is needed. Here, we quantified the spatio-temporal dynamics of BRCA2 in living cells using aberration-corrected multifocal microscopy (acMFM). Using multicolor imaging to identify DNA damage sites, we were able to quantify its dynamic motion patterns in the nucleus and at DNA damage sites. While a large fraction of BRCA2 molecules localized near DNA damage sites appear immobile, an additional fraction of molecules exhibits subdiffusive motion, providing a potential mechanism to retain an increased number of molecules at DNA lesions. Super-resolution microscopy revealed inhomogeneous localization of BRCA2 relative to other DNA repair factors at sites of DNA damage. This suggests the presence of multiple nanoscale compartments in the chromatin surrounding the DNA lesion, which could play an important role in the contribution of BRCA2 to the regulation of the repair process.

ZNFX1
Also flagged:exocytosiscytotoxicitypathogenesishyperinflammatory syndromes-cell-cell differentiation
Journal Article 2024-08-01 ✓ 1 Snippet Chiang SCC, Covill LE, Tesi B, Campbell TM, Schlums H, Nejati-Zendegani J, Mördrup K, Wood S, Theorell J, Sekine T, Al-Herz W, Akar HH, Belen FB, Chan MY, Devecioglu O, Aksu T, Ifversen M, Malinowska I, Sabel M, Unal E, Unal S, Introne WJ, Krzewski K, Gilmour KC, Ehl S, Ljunggren HG, Nordenskjöld M, Horne A, Henter JI, Meeths M, Bryceson YT.
In-Text Gene Mentions

…, MAGT1 ,ZNFX1, CYBA ,…

Show Full Abstract

<h4>Abstract</h4>Primary hemophagocytic lymphohistiocytosis (HLH) is a life-threatening disorder associated with autosomal recessive variants in genes required for perforin-mediated lymphocyte cytotoxicity. A rapid diagnosis is crucial for successful treatment. Although defective cytotoxic T lymphocyte (CTL) function causes pathogenesis, quantification of natural killer (NK)-cell exocytosis triggered by K562 target cells currently represents a standard diagnostic procedure for primary HLH. We have prospectively evaluated different lymphocyte exocytosis assays in 213 patients referred for evaluation for suspected HLH and related hyperinflammatory syndromes. A total of 138 patients received a molecular diagnosis consistent with primary HLH. Assessment of Fc receptor-triggered NK-cell and T-cell receptor (TCR)-triggered CTL exocytosis displayed higher sensitivity and improved specificity for the diagnosis of primary HLH than routine K562 cell-based assays, with these assays combined providing a sensitivity of 100% and specificity of 98.3%. By comparison, NK-cell exocytosis after K562 target cell stimulation displayed a higher interindividual variability, in part explained by differences in NK-cell differentiation or large functional reductions after shipment. We thus recommend combined analysis of TCR-triggered CTL and Fc receptor-triggered NK-cell exocytosis for the diagnosis of patients with suspected familial HLH or atypical manifestations of congenital defects in lymphocyte exocytosis.

LRRIQ3ANKRD45
Also flagged:ciliopathiestranscription factorTForganellesorganizationmicrotubule
Journal Article 2024-08-01 ✓ 2 Snippets Pir MS, Begar E, Yenisert F, Demirci HC, Korkmaz ME, Karaman A, Tsiropoulou S, Firat-Karalar EN, Blacque OE, Oner SS, Doluca O, Cevik S, Kaplan OI.
In-Text Gene Mentions

…genes, including BASP1,ANKRD45, DNAH12, IQUB, DYDC2,…

…IQUB, DYDC2, TEX9,LRRIQ3, BAIAP3, C1orf87, KIF9,…

Show Full Abstract

Uncovering the full list of human ciliary genes holds enormous promise for the diagnosis of cilia-related human diseases, collectively known as ciliopathies. Currently, genetic diagnoses of many ciliopathies remain incomplete (1-3). While various independent approaches theoretically have the potential to reveal the entire list of ciliary genes, approximately 30% of the genes on the ciliary gene list still stand as ciliary candidates (4,5). These methods, however, have mainly relied on a single strategy to uncover ciliary candidate genes, making the categorization challenging due to variations in quality and distinct capabilities demonstrated by different methodologies. Here, we develop a method called CilioGenics that combines several methodologies (single-cell RNA sequencing, protein-protein interactions (PPIs), comparative genomics, transcription factor (TF) network analysis, and text mining) to predict the ciliary capacity of each human gene. Our combined approach provides a CilioGenics score for every human gene that represents the probability that it will become a ciliary gene. Compared to methods that rely on a single method, CilioGenics performs better in its capacity to predict ciliary genes. Our top 500 gene list includes 258 new ciliary candidates, with 31 validated experimentally by us and others. Users may explore the whole list of human genes and CilioGenics scores on the CilioGenics database (https://ciliogenics.com/).

Also flagged:Acetaminophenpatent ductus arteriosusibuprofenindomethacinCOXdeath
Journal Article 2024-08-01 No Snippets Jensen EA, DeMauro SB, Rysavy MA, Patel RM, Laughon MM, Eichenwald EC, Do BT, Das A, Wright CJ, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>Emerging data indicate that acetaminophen may adversely affect lung health. We examined whether acetaminophen compared with cyclooxygenase (COX) inhibitor alone for patent ductus arteriosus (PDA) is associated with mortality or respiratory morbidity in extremely preterm infants.<h4>Methods</h4>This is a retrospective cohort study using data from the National Institute of Child Health and Human Development Neonatal Research Network. Infants were born at 22 to 28 weeks' gestation or weighing 401 to 1000 g between 2016 and 2020 and received acetaminophen, ibuprofen, and/or indomethacin for PDA closure. The primary outcome was death or grade 2 to 3 bronchopulmonary dysplasia (BPD) at 36 weeks' postmenstrual age. Secondary outcomes included predischarge mortality and respiratory morbidities. Risk ratios were adjusted for baseline and early postnatal factors. Additional exploratory analyses were adjusted for later postnatal covariates.<h4>Results</h4>Of 1921 infants, 627 (32.6%) received acetaminophen and 1294 (67.3%) received COX inhibitor only. Multidrug therapy (42.9% vs 4.7%) and surgical or catheter PDA closure (26.5% vs 19.9%) were more common among acetaminophen-exposed infants. Death or grade 2 to 3 BPD at 36 weeks' postmenstrual age was similar between infants treated with acetaminophen versus COX inhibitor only (57.1% vs 58.3%; adjusted relative risk [aRR] 0.96, 95% confidence interval [CI] 0.87-1.06). Acetaminophen was associated with increased risk of predischarge mortality (13.3% vs 10.0%) when adjusting for perinatal and early postnatal factors (aRR 1.42, 95% CI 1.02-1.93), but not in exploratory analyses that included later postnatal factors (aRR 1.28, 95% CI 0.91-1.82).<h4>Conclusions</h4>Treatment with acetaminophen versus COX inhibitor alone for PDA was not associated with the composite outcome of death or BPD in extremely preterm infants. Our results support further evaluation of whether acetaminophen for PDA increases mortality.

Also flagged:Ribosomal protein RPL39Lribosomeprotein synthesisribosomal proteinRPL39Lcancer
Journal Article 2024-08-01 No Snippets Banerjee A, Ataman M, Smialek MJ, Mookherjee D, Rabl J, Mironov A, Mues L, Enkler L, Coto-Llerena M, Schmidt A, Boehringer D, Piscuoglio S, Spang A, Mittal N, Zavolan M.
Show Full Abstract

Increasingly many studies reveal how ribosome composition can be tuned to optimally translate the transcriptome of individual cell types. In this study, we investigated the expression pattern, structure within the ribosome and effect on protein synthesis of the ribosomal protein paralog 39L (RPL39L). With a novel mass spectrometric approach we revealed the expression of RPL39L protein beyond mouse germ cells, in human pluripotent cells, cancer cell lines and tissue samples. We generated RPL39L knock-out mouse embryonic stem cell (mESC) lines and demonstrated that RPL39L impacts the dynamics of translation, to support the pluripotency and differentiation, spontaneous and along the germ cell lineage. Most differences in protein abundance between WT and RPL39L KO lines were explained by widespread autophagy. By CryoEM analysis of purified RPL39 and RPL39L-containing ribosomes we found that, unlike RPL39, RPL39L has two distinct conformations in the exposed segment of the nascent peptide exit tunnel, creating a distinct hydrophobic patch that has been predicted to support the efficient co-translational folding of alpha helices. Our study shows that ribosomal protein paralogs provide switchable modular components that can tune translation to the protein production needs of individual cell types.

HTT
Also flagged:gene expressionmetabolismmyelinationglucosetransporter(
Journal Article 2024-08-01 ✓ 1 Snippet Ruffle JK, Watkins H, Gray RJ, Hyare H, Thiebaut de Schotten M, Nachev P.
In-Text Gene Mentions

We evaluated positron emission tomography (PET) maps of receptor and transporter distributions across 18 neurotransmitter systems: serotonin (5‐HT)1A, 5‐HT2A, 5‐HT4, 5‐HT6, serotonin transporter (5‐HTT), alpha‐4 beta‐2 nicotinic receptor (α4β2), cannabinoid (CB)1, dopamine (D)1, D2, 18F‐fluorodopa (FDOPA), γ‐Aminobutyric acid type A (GABAA), histamine (H)3, muscarinic acetylcholine receptor (M)1, metabotropic glutamate receptor 5 (mGluR5), mu‐opioid receptor (MOR)1, noradrenaline transporter (NAT), N‐methyl‐D‐aspartate (NMDA) receptor, and vesicular acetylcholine transporter (VAChT) (Hansen et al., 2022).

Show Full Abstract

The architecture of the brain is too complex to be intuitively surveyable without the use of compressed representations that project its variation into a compact, navigable space. The task is especially challenging with high-dimensional data, such as gene expression, where the joint complexity of anatomical and transcriptional patterns demands maximum compression. The established practice is to use standard principal component analysis (PCA), whose computational felicity is offset by limited expressivity, especially at great compression ratios. Employing whole-brain, voxel-wise Allen Brain Atlas transcription data, here we systematically compare compressed representations based on the most widely supported linear and non-linear methods-PCA, kernel PCA, non-negative matrix factorisation (NMF), t-stochastic neighbour embedding (t-SNE), uniform manifold approximation and projection (UMAP), and deep auto-encoding-quantifying reconstruction fidelity, anatomical coherence, and predictive utility across signalling, microstructural, and metabolic targets, drawn from large-scale open-source MRI and PET data. We show that deep auto-encoders yield superior representations across all metrics of performance and target domains, supporting their use as the reference standard for representing transcription patterns in the human brain.

Also flagged:diabetic retinopathyfluoresceinCFDiabetes Mellitusblindnessproliferative diabetic retinopathy
Journal Article 2024-08-01 No Snippets Castellanos-Canales D, Decker NL, Fukuyama H, Duffy BV, Fawzi AA.
Show Full Abstract

<h4>Purpose</h4>To evaluate the reliability of clinical grading of diabetic retinopathy (DR) severity compared with grading on ultra-widefield pseudocolor fundus (UWF-CF) and ultra-widefield fluorescein angiography (UWF-FA) images and their relative detection of sight-threatening DR and referable DR.<h4>Methods</h4>A total of 184 diabetic eyes were analyzed. UWF-CF and UWF-FA images were graded based on the International Clinical Diabetic Retinopathy severity scale. Agreement between clinical and UWF-based severity grading was evaluated using Cohen's kappa coefficient. The rate of sight-threatening DR and referable DR was evaluated for each grading method.<h4>Results</h4>Moderate agreement was found between clinical grading and UWF-CF (k = 0.456, P < 0.001) and between UWF-CF and UWF-FA (k = 0.443, P < 0.001). The agreement between clinical grading and UWF-FA was fair (k = 0.397, P < 0.001). UWF-based grading identified a higher DR grade in 56 eyes (30%) on UWF-CF and 85 eyes (46.2%) on UWF-FA. Compared with clinical grading, UWF-FA detected a higher rate of sight-threatening DR (44%; 81/184 vs. 22.3%; 41/184), while UWF-CF detected more referable eyes (58.1%; 107/184 vs. 45.65%; 84/184).<h4>Conclusion</h4>Ultra-widefield pseudocolor fundus is a valuable tool for identifying referable eyes and can be a useful, noninvasive adjunct to clinical grading. The results suggest that UWF-FA is particularly useful for detecting unsuspected sight-threatening DR in eyes with clinically referable DR.

SUDS3
Also flagged:nucleuschromatinRNA-binding proteinsbindingmembranesalt
Journal Article 2024-08-01 ✓ 1 Snippet Stocks J, Gilbert N.
In-Text Gene Mentions

…ng transcriptional regulators,chromatin modifiersmodifiers, DNA methyltransfera…

Show Full Abstract

Although the majority of RNAs are retained in the nucleus, their significance is often overlooked. However, it is now becoming clear that nuclear RNA forms a dynamic structure through interacting with various proteins that can influence the three-dimensional structure of chromatin. We review the emerging evidence for a nuclear RNA mesh or gel, highlighting the interplay between DNA, RNA and RNA-binding proteins (RBPs), and assessing the critical role of protein and RNA in governing chromatin architecture. We also discuss a proposed role for the formation and regulation of the nuclear gel in transcriptional control. We suggest that it may concentrate the transcriptional machinery either by direct binding or inducing RBPs to form microphase condensates, nanometre sized membraneless structures with distinct properties to the surrounding medium and an enrichment of particular macromolecules.

HTT
Also flagged:parkinspinocerebellar ataxiaATXN3pathogenesisMJDPRKN
Journal Article 2024-08-01 ✓ 1 Snippet Weber JJ, Czisch L, Pereira Sena P, Fath F, Huridou C, Schwarz N, Incebacak Eltemur RD, Würth A, Weishäupl D, Döcker M, Blumenstock G, Martins S, Sequeiros J, Rouleau GA, Jardim LB, Saraiva-Pereira ML, França MC, Gordon CR, Zaltzman R, Cornejo-Olivas MR, van de Warrenburg BPC, Durr A, Brice A, Bauer P, Klockgether T, Schöls L, Riess O, EUROSCA Network, Schmidt T.
In-Text Gene Mentions

…, ATN1 andHTThave already been…

Show Full Abstract

Machado-Joseph disease (MJD) is an autosomal dominant neurodegenerative spinocerebellar ataxia caused by a polyglutamine-coding CAG repeat expansion in the ATXN3 gene. While the CAG length correlates negatively with the age at onset, it accounts for approximately 50% of its variability only. Despite larger efforts in identifying contributing genetic factors, candidate genes with a robust and plausible impact on the molecular pathogenesis of MJD are scarce. Therefore, we analysed missense single nucleotide polymorphism variants in the PRKN gene encoding the Parkinson's disease-associated E3 ubiquitin ligase parkin, which is a well-described interaction partner of the MJD protein ataxin-3, a deubiquitinase. By performing a correlation analysis in the to-date largest MJD cohort of more than 900 individuals, we identified the V380L variant as a relevant factor, decreasing the age at onset by 3 years in homozygous carriers. Functional analysis in an MJD cell model demonstrated that parkin V380L did not modulate soluble or aggregate levels of ataxin-3 but reduced the interaction of the two proteins. Moreover, the presence of parkin V380L interfered with the execution of mitophagy-the autophagic removal of surplus or damaged mitochondria-thereby compromising cell viability. In summary, we identified the V380L variant in parkin as a genetic modifier of MJD, with negative repercussions on its molecular pathogenesis and disease age at onset.

Also flagged:gene expressionDNasehistonenucleotidebindingchromatin
Journal Article 2024-08-01 No Snippets Ali A, Liang P.
Show Full Abstract

<h4>Background</h4>Transposable elements (TEs) contribute to approximately half of the human genome, and along with many other functions, they have been known to play a role in gene regulation in the genome. With TEs' active/repressed states varying across tissue and cell types, they have the potential to regulate gene expression in a tissue-specific manner.<h4>Objective and methods</h4>To provide a systematic analysis of TEs' contribution in tissue-specific gene regulation, we examined the regulatory elements and genes in association with TE-derived regulatory sequences in 14 human cell lines belonging to 10 different tissue types using the functional genomics data from the ENCODE project. Specifically, we separately analyzed regulatory regions identified by three different approaches (DNase hypersensitive sites (DHS), histone active sites (HA), and histone repressive sites (HR)).<h4>Results</h4>These regulatory regions showed to be distinct from each other by sharing less than 2.5% among all three types and more than 95% showed to be cell line-specific. Despite a lower total TE content overall than the genome average, each regulatory sequence type showed enrichment for one or two specific TE type(s): DHS for long terminal repeats (LTRs) and DNA transposons, HA for short interspersed nucleotide elements (SINEs), and HR for LTRs. In contrast, SINE was shown to be overrepresented in all three types of regulatory sequences located in gene-neighboring regions. TE-regulated genes were mostly shown to have cell line specific pattern, and tissue-specific genes (TSGs) showed higher usage of TE regulatory sequences in the tissue of their expression. While TEs in the regulatory sequences showed to be older than their genome-wide counterparts, younger TEs were shown to be more likely used in cell line specific regulatory sequences.<h4>Conclusions</h4>Collectively, our study provided further evidence enforcing an important contribution of TEs to tissue-specific gene regulation in humans.

Also flagged:inclusion body myositisSporadic inclusion body myositismuscle diseasevacuolesprimaryautoimmune disease
Journal Article 2024-08-01 No Snippets Suzuki N, Kanzaki M, Koide M, Izumi R, Fujita R, Takahashi T, Ogawa K, Yabe Y, Tsuchiya M, Suzuki M, Harada R, Ohno A, Ono H, Nakamura N, Ikeda K, Warita H, Osana S, Oikawa Y, Toyohara T, Abe T, Rui M, Ebihara S, Nagatomi R, Hagiwara Y, Aoki M.
Show Full Abstract

Sporadic inclusion body myositis (sIBM) is a muscle disease in older people and is characterized by inflammatory cell invasion into intact muscle fibers and rimmed vacuoles. The pathomechanism of sIBM is not fully elucidated yet, and controversy exists as to whether sIBM is a primary autoimmune disease or a degenerative muscle disease with secondary inflammation. Previously, we established a method of collecting CD56-positive myoblasts from human skeletal muscle biopsy samples. We hypothesized that the myoblasts derived from these patients are useful to see the cell-autonomous pathomechanism of sIBM. With these resources, myoblasts were differentiated into myotubes, and the expression profiles of cell-autonomous pathology of sIBM were analyzed. Myoblasts from three sIBM cases and six controls were differentiated into myotubes. In the RNA-sequencing analysis of these "myotube" samples, 104 differentially expressed genes (DEGs) were found to be significantly upregulated by more than twofold in sIBM, and 13 DEGs were downregulated by less than twofold. For muscle biopsy samples, a comparative analysis was conducted to determine the extent to which "biopsy" and "myotube" samples differed. Fifty-three DEGs were extracted of which 32 (60%) had opposite directions of expression change (e.g., increased in biopsy vs decreased in myotube). Apolipoprotein E (apoE) and transmembrane protein 8C (TMEM8C or MYMK) were commonly upregulated in muscle biopsies and myotubes from sIBM. ApoE and myogenin protein levels were upregulated in sIBM. Given that enrichment analysis also captured changes in muscle contraction and development, the triggering of muscle atrophy signaling and abnormal muscle differentiation via MYMK or myogenin may be involved in the pathogenesis of sIBM. The presence of DEGs in sIBM suggests that the myotubes formed from sIBM-derived myoblasts revealed the existence of muscle cell-autonomous degeneration in sIBM. The catalog of DEGs will be an important resource for future studies on the pathogenesis of sIBM focusing on primary muscle degeneration.

LRRIQ3
Also flagged:Opioid use disorderCYP3A4DRD3opioid overdosefentanyloverdose
Journal Article 2024-08-01 ✓ 1 Snippet Sprague JE, Freiermuth CE, Lambert J, Braun R, Frey JA, Bachmann DJ, Bischof JJ, Beaumont L, Lyons MS, Pantalon MV, Punches BE, Ancona R, Kisor DF.
In-Text Gene Mentions

…KDM4A (rs3791033) andLRRIQ3(rs640561) in the…

Show Full Abstract

The influence of genetic variants related to opioid use disorder (OUD) was evaluated using multiple logistic regression analysis in self-reported assigned African American/Afro-Caribbean and European biogeographical ancestry groups (BGAGs) and by sex. From a sample size of 1301 adult patients (>18 years of age) seen in emergency departments of three medical centers in Ohio, six variants were found to be associated with OUD. Two of the variants, rs2740574 (CYP3A4) and rs324029 (DRD3), were included in the analysis having met criteria of at least five subjects for each BGAG, variant carrier status, and OUD status combinations. Variant carriers in the African/Afro-Caribbean BGAG had slightly lower predicted probabilities of OUD. Variant carriers in the European BGAG had slightly higher predicted probabilities of OUD. Relative to sex, all the six variants met evaluation criteria (five subjects for all sex, variant, and OUD status combinations). No statistically significant interactions were found between a given variant, BGAGs and sex. Findings suggest variant testing relative to OUD risk can be applied across BGAGs and sex, however, studies in larger populations are needed.

Also flagged:cyclin-dependent kinase 12DNA damage-binding protein 1CDK12DDB1cyclin Kdegradation
Journal Article 2024-08-01 No Snippets Zhang Z, Li Y, Yang J, Li J, Lin X, Liu T, Yang S, Lin J, Xue S, Yu J, Tang C, Li Z, Liu L, Ye Z, Deng Y, Li Z, Chen K, Ding H, Luo C, Lin H.
Show Full Abstract

Protein-protein interactions (PPIs) stabilization with molecular glues plays a crucial role in drug discovery, albeit with significant challenges. In this study, we propose a dual-site approach, targeting the PPI region and its dynamic surroundings. We conduct molecular dynamics simulations to identify critical sites on the PPI that stabilize the cyclin-dependent kinase 12 - DNA damage-binding protein 1 (CDK12-DDB1) complex, resulting in further cyclin K degradation. This exploration leads to the creation of LL-K12-18, a dual-site molecular glue, which enhances the glue properties to augment degradation kinetics and efficiency. Notably, LL-K12-18 demonstrates strong inhibition of gene transcription and anti-proliferative effects in tumor cells, showing significant potency improvements in MDA-MB-231 (88-fold) and MDA-MB-468 cells (307-fold) when compared to its precursor compound SR-4835. These findings underscore the potential of dual-site approaches in disrupting CDK12 function and offer a structural insight-based framework for the design of cyclin K molecular glues.

CA10
Also flagged:enterovirus infectionshand, foot, and mouth diseaserespiratory diseaseacute flaccid myelitisinfectionsVP1
Journal Article 2024-08-01 ✓ 1 Snippet Zhong Z, Su X, Yang K, Huang W, Wang J, Zhuo Z, Xiang J, Lin L, He S, Li T, Zhang J, Ge S, Zhang S, Xia N.
In-Text Gene Mentions

…illnesses, including CA6,CA10, CA16, and EV71,…

Show Full Abstract

Human enteroviruses (HEV) can cause a range of diseases from mild to potentially life-threatening. Identification and genotyping of HEV are crucial for disease management. Existing typing methods, however, have inherent limitations. Developing alternative methods to detect HEV with more virus types, high accuracy, and sensitivity in an accessible manner presents a technological and analytical challenge. Here, a sequence-specific nanoparticle barcode (SSNB) method is presented for simultaneous detection of 10 HEV types. This method significantly increases sensitivity, enhancing detection by 10-10<sup>6</sup> times over the traditional multiplex hybrid genotyping (MHG) method, by resolving cross-interference between the multiple primer sets. Furthermore, the SSNB method demonstrates a 100% specificity in accurately distinguishing between 10 different HEV types and other prevalent clinical viruses. In an analysis of 70 clinical throat swab samples, the SSNB method shows slightly higher detection rate for positive samples (50%) compared to the RT-PCR method (48.6%). Additionally, further assessment of the typing accuracy for samples identified as positive by SSNB using sequencing method reveals a concordance rate of 100%. The combined high sensitivity and specificity level of the methodology, together with the capability for multiple type analysis and compatibility with clinical workflow, make this approach a promising tool for clinical settings.

PRDX6
Also flagged:extracellularvesiclesinsulinsilvergene expressionglucose
Journal Article 2024-08-01 ✓ 1 Snippet Gabr MM, El-Halawani SM, Refaie AF, Khater SM, Ismail AM, Karras MS, Magar RW, Sayed SE, Kloc M, Uosef A, Sabek OM, Ghoneim MA.
In-Text Gene Mentions

…(Sigma-Aldrich), 10 µg/lPRDX6protein (BioVision, CA,…

Show Full Abstract

This study was to determine whether extracellular vesicles (EVs) derived from insulin-producing cells (IPCs) can modulate naïve mesenchymal stromal cells (MSCs) to become insulin-secreting. MSCs were isolated from human adipose tissue. The cells were then differentiated to generate IPCs by achemical-based induction protocol. EVs were retrieved from the conditioned media of undifferentiated (naïve) MSCs (uneducated EVs) and from that of MSC-derived IPCs (educated EVs) by sequential ultracentrifugation. The obtained EVs were co-cultured with naïve MSCs.The cocultured cells were evaluated by immunofluorescence, flow cytometry, C-peptide nanogold silver-enhanced immunostaining, relative gene expression and their response to a glucose challenge.Immunostaining for naïve MSCs cocultured with educated EVs was positive for insulin, C-peptide, and GAD65. By flow cytometry, the median percentages of insulin-andC-peptide-positive cells were 16.1% and 14.2% respectively. C-peptide nanogoldimmunostaining providedevidence for the intrinsic synthesis of C-peptide. These cells released increasing amounts of insulin and C-peptide in response to increasing glucose concentrations. Gene expression of relevant pancreatic endocrine genes, except for insulin, was modest. In contrast, the results of naïve MSCs co-cultured with uneducated exosomes were negative for insulin, C-peptide, and GAD65. These findings suggest that this approach may overcome the limitations of cell therapy.

SUDS3
Also flagged:lipidsynthesismetabolismHepatomahousekeeping genesCDC40
Journal Article 2024-08-01 ✓ 5 Snippets Chen Z, Hua G, Shu X, Zhuang W, Zhang J, Zhu R, Zheng X, Chen J.
In-Text Gene Mentions

…reference genes wereSUDS3, TRIM33 ,…

…male liver tissues,SUDS3, ERAL1 ,…

…, ALB ,SUDS3, 18s RNA…

…, HPRT ,SUDS3, 18s RNA…

…, RPL13 ,SUDS3, ALB ,…

Show Full Abstract

The liver plays a vital role in lipid synthesis and metabolism in poultry. To study the functional genes more effectively, it is essential to screen of reliable reference genes in the chicken liver, including females, males, embryos, as well as the Leghorn Male Hepatoma (LMH) cell line. Traditional reference gene screening involves selecting commonly used housekeeping genes (HKGs) for RT-qPCR experiments and using different algorithms to identify the most stable ones. However, this approach is limited in selecting the best reference gene from a small pool of HKGs. High-throughput sequencing technology may offer a solution to this limitation. This study aimed to identify the most consistently expressed genes by utilizing multiple published RNA-seq data of chicken liver and LMH cells. Subsequently, the stability of the newly identified reference genes was assessed in comparison to previously validated stable poultry liver expressed reference genes and the commonly employed HKGs using RT-qPCR. The findings indicated that there is a higher degree of similarity in stable expression genes between female and male liver (such as LSM14A and CDC40). In embryonic liver, the optimal new reference genes were SUDS3, TRIM33, and ERAL1. For LMH cells, the optimal new reference genes were ALDH9A1, UGGT1, and C21H1orf174. However, it is noteworthy that most HKGs did not exhibit stable expression across multiple samples, indicating potential instability under diverse conditions. Furthermore, RT-qPCR experiments proved that the stable expression genes identified from RNA-seq data outperformed commonly used HKGs and certain validated reference genes specific to poultry liver. Over all, this study successfully identified new stable reference genes in chicken liver and LMH cells using RNA-seq data, offering researchers a wider range of reference gene options for RT-qPCR in diverse situations.

Also flagged:autophagynon-communicable diseasescardiovascular diseasescancerdiabetesaging
Journal Article 2024-08-01 No Snippets Xu TT, Deng YY, Yu XY, Li M, Fu YY.
Show Full Abstract

Non-communicable diseases (NCDs) are defined as a kind of diseases closely related to bad behaviors and lifestyles, e.g., cardiovascular diseases, cancer, and diabetes. Driven by population growth and aging, NCDs have become the biggest disease burden in the world, and it is urgent to prevent and control these chronic diseases. Autophagy is an evolutionarily conserved process that degrade cellular senescent or malfunctioning organelles in lysosomes. Mounting evidence has demonstrated a major role of autophagy in the pathogenesis of cardiovascular diseases, cancer, and other major human diseases, suggesting that autophagy could be a candidate therapeutic target for NCDs. Natural products/phytochemicals are important resources for drugs against a wide variety of diseases. Recently, compounds from natural plants, such as resveratrol, curcumin, and ursolic acid, have been recognized as promising autophagy modulators. In this review, we address recent advances and the current status of the development of natural autophagy modulators in NCDs and provide an update of the latest in vitro and in vivo experiments that pave the way to clinical studies. Specifically, we focus on the relationship between natural autophagy modulators and NCDs, with an intent to identify natural autophagy modulators with therapeutic potential.

Also flagged:alcoholinsomniachronic disorderobesitytransportationanxiety
Journal Article 2024-08-01 No Snippets Guan J, Liu T, Gao G, Yang K, Liang H.
Show Full Abstract

<h4>Background</h4>Mendelian randomization (MR) studies have an advantage over conventional observational studies when studying the causal effect of lifestyle-related risk factors on back pain. However, given the heterogeneous design of existing MR studies on back pain, the reported causal estimates of these effects remain equivocal, thus obscuring the true extent of the biological effects of back pain lifestyle-risk factors.<h4>Purpose</h4>The purpose of this study was to conduct a systematic review with multiple meta-analyses on the associations between various lifestyle factors and low back pain.<h4>Methods</h4>We conducted a PRISMA systematic review and specifically included MR studies to investigate the associations between lifestyle factors-specifically, BMI, insomnia, smoking, alcohol consumption, and leisure sedentary behavior-and various back pain outcomes. Each meta-analysis synthesized data from three or more studies to assess the causal impact of these exposures on distinct back pain outcomes, including chronic pain, disability, and pain severity. Quality of studies was assessed according to STROBE-MR guidelines.<h4>Results</h4>A total of 1576 studies were evaluated and 20 were included. Overall, the studies included were of high quality and had a low risk of bias. Our meta-analysis demonstrates the positive causal effect of BMI (OR <sub>IVW-random effects models</sub>: 1.18 [1.08-1.30]), insomnia(OR <sub>IVW-random effects models</sub>: 1.38 [1.10-1.74]), smoking(OR <sub>IVW-fixed effects models</sub>: 1.30 [1.23-1.36]), alcohol consumption(OR <sub>IVW-fixed effects models</sub>: 1.31 [1.21-1.42]) and leisure sedentary behaviors(OR <sub>IVW-random effects models</sub>: 1.52 [1.02-2.25]) on back pain.<h4>Conclusion</h4>In light of the disparate designs and causal effect estimates presented in numerous MR studies, our meta-analysis establishes a compelling argument that lifestyle-related risk factors such as BMI, insomnia, smoking, alcohol consumption, and leisure sedentary behaviors genuinely contribute to the biological development of back pain.

Also flagged:methylationinfectionhepatitis B surface antigenDNMT1HBV infectionCUL7
Journal Article 2024-08-01 No Snippets Wu B, Sheng Y, Yu W, Ruan L, Geng H, Xu C, Wang C, Tang D, Lv M, Hua R, Li K.
Show Full Abstract

<h4>Background</h4>Hepatitis B virus (HBV) infection poses a substantial threat to human health, impacting not only infected individuals but also potentially exerting adverse effects on the health of their offspring. The underlying mechanisms driving this phenomenon remain elusive. This study aims to shed light on this issue by examining alterations in paternally imprinted genes within sperm.<h4>Methods</h4>A cohort of 35 individuals with normal semen analysis, comprising 17 hepatitis B surface antigen (HBsAg)-positive and 18 negative individuals, was recruited. Based on the previous research and the Online Mendelian Inheritance in Man database (OMIM, https://www.omim.org/ ), targeted promoter methylation sequencing was employed to investigate 28 paternally imprinted genes associated with various diseases.<h4>Results</h4>Bioinformatic analyses revealed 42 differentially methylated sites across 29 CpG islands within 19 genes and four differentially methylated CpG islands within four genes. At the gene level, an increase in methylation of DNMT1 and a decrease in methylation of CUL7, PRKAG2, and TP53 were observed. DNA methylation haplotype analysis identified 51 differentially methylated haplotypes within 36 CpG islands across 22 genes.<h4>Conclusions</h4>This is the first study to explore the effects of HBV infection on sperm DNA methylation and the potential underlying mechanisms of intergenerational influence of paternal HBV infection.

OLFM4
Also flagged:gene expressionCD4CD14KRT19SOX9TFF1
Journal Article 2024-08-01 ✓ 2 Snippets Li J, Shyr Y, Liu Q.
In-Text Gene Mentions

…specifically positive forOLFM4, and cluster…

…ductal cells, whereOLFM4+ ductal was…

Show Full Abstract

Typical clustering methods for single-cell and spatial transcriptomics struggle to identify rare cell types, while approaches tailored to detect rare cell types gain this ability at the cost of poorer performance for grouping abundant ones. Here, we develop aKNNO to simultaneously identify abundant and rare cell types based on an adaptive k-nearest neighbor graph with optimization. Benchmarking on 38 simulated and 20 single-cell and spatial transcriptomics datasets demonstrates that aKNNO identifies both abundant and rare cell types more accurately than general and specialized methods. Using only gene expression aKNNO maps abundant and rare cells more precisely compared to integrative approaches.

Also flagged:piperazinepeptideGlutamatemalignant tumorcolorectal cancerchitosan
Journal Article 2024-08-01 No Snippets Piri-Gharaghie T, Ghourchian H, Rezaeizadeh G, Kabiri H, Rajaei N, Dhiaa AM, Ghajari G, Bahari R.
Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC), now the second most prevalent malignant tumor worldwide, is more prevalent in young adults. In recent decades, there has been progress in creating anti-colorectal cancer medications, including cytotoxic compounds.<h4>Objectives</h4>Novel anticancer drugs are needed to surmount existing obstacles. A recent study investigated the effectiveness of novel formulations in preventing colorectal cancer.<h4>Methods</h4>During this study, we assessed a new kind of niosome called cyclo-Gly-L-DOPA (CG-Nio-CGLD) made from chitosan glutamate. We evaluated the anti-colorectal cancer properties of CG-Nio-CGLD utilizing CCK-8, invasion assay, MTT assay, flow cytometry, and cell cycle analysis. The transcription of genes associated with apoptosis was analyzed using quantitative real-time PCR. At the same time, the cytotoxicity of nanomaterials on both cancer and normal cell lines was assessed using MTT assays. Novel anticancer drugs are needed to surmount existing obstacles. A recent study investigated the effectiveness of newly developed formulations in preventing colorectal cancer.<h4>Results</h4>The Nio-CGLD and CG-Nio-CGLD were spherical mean diameters of 169.12 ± 1.87 and 179.26 ± 2.17 nm, respectively. Entrapment efficiency (EE%) measurements of the Nio-CGLD and CG-Nio-CGLD were 63.12 ± 0.51 and 76.43 ± 0.34%, respectively. In the CG-Nio-CGLD group, the percentages of early, late, necrotic, and viable CL40 cells were 341.93%, 23.27%, 9.32%, and 25.48%. The transcription of the genes PP53, cas3, and cas8 was noticeably higher in the treatment group compared to the control group (P > 0.001). Additionally, the treatment group had lower BCL2 and survivin gene expression levels than the control group (P < 0.01). Additionally, CG-Nio-CGLD formulations demonstrated a biocompatible nanoscale delivery mechanism and displayed little cytotoxicity toward the CCD 841 CoN reference cell line.<h4>Conclusion</h4>These findings indicate that chitosan-based noisome encapsulation may enhance the effectiveness of CG-Nio-CGLD formulations in fighting cancer.

Also flagged:COVID-19pancreatic cancermalignant tumorinfectiondeathgene expression
Journal Article 2024-08-01 No Snippets Fang C, Sun H, Wen J, Wu X, Wu Q, Zhai D.
Show Full Abstract

<h4>Background</h4>The coronavirus disease 2019 (COVID-19) pandemic, caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus, poses a huge threat to human health. Pancreatic cancer (PC) is a malignant tumor with high mortality. Research suggests that infection with SARS-CoV-2 may increase disease severity and risk of death in patients with pancreatic cancer, while pancreatic cancer may also increase the likelihood of contracting SARS-CoV-2, but the link is unclear.<h4>Methods</h4>This study investigated the transcriptional profiles of COVID-19 and PC patients, along with their respective healthy controls, using bioinformatics and systems biology approaches to uncover the molecular mechanisms linking the 2 diseases. Specifically, gene expression data for COVID-19 and PC patients were obtained from the Gene Expression Omnibus datasets, and common differentially expressed genes (DEGs) were identified. Gene ontology and pathway enrichment analyses were performed on the common DEGs to elucidate the regulatory relationships between the diseases. Additionally, hub genes were identified by constructing a protein-protein interaction network from the shared DEGs. Using these hub genes, we conducted regulatory network analyses of microRNA/transcription factors-genes relationships, and predicted potential drugs for treating COVID-19 and PC.<h4>Results</h4>A total of 1722 and 2979 DEGs were identified from the transcriptome data of PC (GSE119794) and COVID-19 (GSE196822), respectively. Among these, 236 common DEGs were found between COVID-19 and PC based on protein-protein interaction analysis. Functional enrichment analysis indicated that these shared DEGs were involved in pathways related to viral genome replication and tumorigenesis. Additionally, 10 hub genes, including extra spindle pole bodies like 1, holliday junction recognition protein, marker of proliferation Ki-67, kinesin family member 4A, cyclin-dependent kinase 1, topoisomerase II alpha, cyclin B2, ubiquitin-conjugating enzyme E2 C, aurora kinase B, and targeting protein for Xklp2, were identified. Regulatory network analysis revealed 42 transcription factors and 23 microRNAs as transcriptional regulatory signals. Importantly, lucanthone, etoposide, troglitazone, resveratrol, calcitriol, ciclopirox, dasatinib, enterolactone, methotrexate, and irinotecan emerged as potential therapeutic agents against both COVID-19 and PC.<h4>Conclusion</h4>This study unveils potential shared pathogenic mechanisms between PC and COVID-19, offering novel insights for future research and therapeutic strategies for the treatment of PC and SARS-CoV-2 infection.

SERPINC1
Also flagged:pulmonary thromboembolismantithrombin IIIvenous thromboembolismserpin family C member 1amino acidsdisulfide
Journal Article 2024-08-01 ✓ 5 Snippets Lin M, Sun X, Wu J.
In-Text Gene Mentions

<h4>Background</h4>Deficiency of natural anticoagulant antithrombin was first reported as a genetic risk factor for venous thromboembolism, antithrombin III (AT III) is encoded by the serpin family C member 1 (SERPINC1) gene, consisting of 432 amino acids, including 3 disulfide bonds and 4 possible glycosylation sites.

Atypical pulmonary thromboembolism caused by the mutation site SERPINC1 of the antithrombin III gene: A case report.

…the mutation siteSERPINC1of the antithrombin…

…mutation in geneSERPINC1of c.1154-14G>A was…

…mutation in theSERPINC1gene (c.1154-14G>A).…

Show Full Abstract

<h4>Background</h4>Deficiency of natural anticoagulant antithrombin was first reported as a genetic risk factor for venous thromboembolism, antithrombin III (AT III) is encoded by the serpin family C member 1 (SERPINC1) gene, consisting of 432 amino acids, including 3 disulfide bonds and 4 possible glycosylation sites. Studies have shown that hereditary AT deficiency increases the incidence of venous thromboembolism by up to 20 times.<h4>Case presentation</h4>The case presented a 27-year-old young man with no acquired risk factors and a sudden onset of right lower extremity venous thrombosis and pulmonary embolism. A heterozygous mutation in gene SERPINC1 of c.1154-14G>A was detected in the patient, which is a deleterious mutation resulting in reduced AT III activity and increased risk of thrombotic events. The patient received anticoagulant therapy for approximately 5 months, and the thrombus gradually dissolved and no recurrent thrombotic events occurred during follow-up.<h4>Discussion</h4>AT deficiency is a rare autosomal dominant genetic disease, they are mainly divided into 2 types according to the different effects on the structure or function of the encoded protein. The patient had a mutation in the SERPINC1 gene (c.1154-14G>A). Several cases of this type of mutation have been reported since 1991, and it is classified as AT deficiency type I.<h4>Conclusion</h4>Thrombosis in patients with antithrombin deficiency is often unpredictable and can lead to fatal pulmonary embolism. Early genetic testing for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors is critical. Long-term anticoagulation treatment is an effective treatment, for this type of type I AT III deficiency combined with pulmonary embolism patients, warfarin is an effective anticoagulant drug.

HFE
Also flagged:ATP7BWilson diseaseATPase copper transporting betachromosomecirrhosiscopper transport P-type ATPase
Journal Article 2024-08-01 ✓ 1 Snippet Zhou Z, Zhang S, Bi Y, Duan W, Gao H.
In-Text Gene Mentions

…liver diseases, includinghemochromatosis.…

Show Full Abstract

<h4>Introduction</h4>Hepatolenticular degeneration (Wilson disease) is an autosomal recessive monogenic disorder caused by mutations in the ATPase copper transporting beta (ATP7B) gene located on human chromosome 13. This gene encodes a copper-transporting P-type ATPase (ATP7B). Recent studies have revealed that the ATP7B gene is predominantly affected by a few hotspot mutations, with the His1069Gln mutation in exon 14 accounting for 50 to 80% of cases. In China, the Arg778Leu mutation in exon 8 is the most prevalent. However, the discovery of novel mutant genes persists.<h4>Case presentation</h4>A 56-year-old Chinese female was referred to our hospital with a liver injury and cirrhosis. Her parents, 2 younger brothers, and children exhibited no signs of liver function impairment. Whole-exome sequencing was conducted on the proband's genomic DNA, and Sanger sequencing was performed on 6 family members for first-generation verification.<h4>Conclusions</h4>We identified a novel c.3715G > T (p.Val1239Phe) variant mutation in the ATP7B gene in the patient. The ATP7B c.3715G > T (p.Val1239Phe) variant is predicted to impact the copper transport P-type ATPase. When combined with another mutant gene to form a compound heterozygous mutation, it can lead to hepatolenticular degeneration. This discovery broadens the range of pathogenic genes in the ATP7B gene.

CCPG1
Also flagged:-endoplasmic reticulum-associated protein degradationdegradationmTORC1transcription factors
Journal Article 2024-08-01 ✓ 5 Snippets De Leonibus C, Maddaluno M, Ferriero R, Besio R, Cinque L, Lim PJ, Palma A, De Cegli R, Gagliotta S, Montefusco S, Iavazzo M, Rohrbach M, Giunta C, Polishchuk E, Medina DL, Di Bernardo D, Forlino A, Piccolo P, Settembre C.
In-Text Gene Mentions

…13 FAM134C, 12CCPG1, 14 RTN3, 15…

…, 8 TheCCPG1receptor interacts directly…

CCPG1: Fw 5′-TCTTGTGGCTGGACTGTCAT-3…

CCPG1: Rev 5′-TTTGCACTGCTTTCTCCACC-…

CCPG1: Fw 5’- TTCTGTGACCCCCACTGACA-…

Show Full Abstract

Protein biogenesis within the endoplasmic reticulum (ER) is crucial for organismal function. Errors during protein folding necessitate the removal of faulty products. ER-associated protein degradation and ER-phagy target misfolded proteins for proteasomal and lysosomal degradation. The mechanisms initiating ER-phagy in response to ER proteostasis defects are not well understood. By studying mouse primary cells and patient samples as a model of ER storage disorders (ERSDs), we show that accumulation of faulty products within the ER triggers a response involving SESTRIN2, a nutrient sensor controlling mTORC1 signaling. SESTRIN2 induction by XBP1 inhibits mTORC1's phosphorylation of TFEB/TFE3, allowing these transcription factors to enter the nucleus and upregulate the ER-phagy receptor FAM134B along with lysosomal genes. This response promotes ER-phagy of misfolded proteins via FAM134B-Calnexin complex. Pharmacological induction of FAM134B improves clearance of misfolded proteins in ERSDs. Our study identifies the interplay between nutrient signaling and ER quality control, suggesting therapeutic strategies for ERSDs.

SOX6
Also flagged:tumorcancerangiogenesisNSCLCLung CancerERRFI1
Journal Article 2024-08-01 ✓ 2 Snippets Wang H, Liu H, Lu G, Tang X, Luo S, Du M, Christiani DC, Wei Q.
In-Text Gene Mentions

…of CEBPA (HM03470),SOX6(HM06519), MEF2A (HM03380),…

…(HM06519), MEF2A (HM03380),SOX6(HM06559), TBP (HM01158),…

Show Full Abstract

<h4>Background</h4>Hypoxia is often involved in tumor microenvironment, and the hypoxia-induced signaling pathways play a key role in aggressive cancer phenotypes, including angiogenesis, immune evasion, and therapy resistance. However, it is unknown what role genetic variants in the hypoxia-related genes play in survival of patients with non-small cell lung cancer (NSCLC).<h4>Methods</h4>We evaluated the associations between 16,092 single-nucleotide polymorphisms (SNPs) in 182 hypoxia-related genes and survival outcomes of NSCLC patients. Data from the Prostate, Lung, Colorectal, and Ovarian (PLCO) Cancer Screening Trial were used as the discovery dataset, and the Harvard Lung Cancer Susceptibility (HLCS) Study served as the replication dataset. We also performed additional linkage disequilibrium analysis and a stepwise multivariable Cox proportional hazards regression analysis in the PLCO dataset.<h4>Results</h4>An independent SNP, ERRFI1 rs28624 A > C, was identified with an adjusted hazards ratio (HR) of 1.31 (95% CI = 1.14-1.51, p = 0.0001) for overall survival (OS). In further analyses, unfavorable genotypes AC and CC, compared with the AA genotype, were associated a worse OS (HR = 1.20, 95% CI = 1.03-1.39, p = 0.014) and disease-specific survival (HR = 1.21, 95% CI = 1.04-1.42, p = 0.016). Further expression quantitative trait loci analysis indicated that ERRFI1 rs28624C genotypes were significantly associated with higher ERRFI1 mRNA expression levels in the whole blood. Additional analysis showed that high ERRFI1 mRNA expression levels were associated with a worse OS in patients with lung adenocarcinoma.<h4>Conclusion</h4>Our findings suggest that genetic variants in the hypoxia-related gene ERRFI1 may modulate NSCLC survival, potentially through their effect on the gene expression.

UNC13C
Also flagged:oral cavity canceroral squamous cell carcinomatumortumorsICOP
Journal Article 2024-08-01 ✓ 1 Snippet Hsu CL, Wen YW, Wang HM, Hsieh CH, Liao CT, Lee LY, Ng SH, Lin CY, Chen WC, Lin JC, Tsai YT, Lee SR, Chien CY, Hua CH, Wang CP, Chen TM, Terng SD, Tsai CY, Fan KH, Yeh CH, Lin CH, Tsao CK, Cheng NM, Fang TJ, Huang SF, Kang CJ, Lee LA, Fang KH, Wang YC, Lin WN, Hsin LJ, Yen TC, Liao CT.
In-Text Gene Mentions

…, ARID2 ,UNC13C, and TRPM3…

Show Full Abstract

<h4>Background</h4>While surgery remains the primary treatment for oral squamous cell carcinoma (OCSCC), induction chemotherapy (IC) can be used as a bridging or neoadjuvant therapy. This nationwide study in Taiwan examines the survival outcomes of OCSCC patients who received IC before surgery.<h4>Methods</h4>We analyzed data from 29,891 patients with OCSCC. Of these, 29,058 initially underwent surgery (OP group), whereas 833 received IC before surgery (IC + OP group). A propensity score (PS)-matched analysis (4, 1 ratio, 3260 vs. 815 patients) was performed considering tumor subsite, sex, age, Charlson comorbidity index, clinical T1-T4b tumors, clinical N0-3 disease, and clinical stage I-IV.<h4>Results</h4>In the PS-matched cohort, the 5-year disease-specific survival (DSS) and overall survival (OS) rates were 65% and 57%, respectively. When comparing the OP and IC + OP groups, the 5-year DSS rates were 66% and 62%, respectively (p = 0.1162). Additionally, the 5-year OS rates were 57% and 56%, respectively (p = 0.9917). No significant intergroup differences in survival were observed for specific subgroups with cT4a tumors, cT4b tumors, cN3 disease, pT4b tumors, and pN3 disease. However, for patients with pT4a tumors, the OP group demonstrated superior 5-year outcomes compared to the IC + OP group, with a DSS of 62% versus 52% (p = 0.0006) and an OS of 53% versus 44% (p = 0.0060). Notably, patients with cT2-3, cN1, and c-Stage II disease in the IC + OP group were significantly more likely to achieve pT0-1 status (p < 0.05).<h4>Conclusions</h4>Following PS matching, the IC + OP group generally exhibited similar prognosis to the OP group. However, for pT4a tumors, the OP group showed superior 5-year outcomes. While IC may not universally improve survival, it could be advantageous for patients who respond positively to the treatment.

Also flagged:gene expressionoxygenwaternucleotidelidocaineSynthesis
Journal Article 2024-08-01 No Snippets Christodoulides N, Urgiles VL, Guayasamin JM, Savage AE.
Show Full Abstract

The genus Pristimantis diversified in the tropical Andes mountains and is the most speciose genus of terrestrial vertebrates. Pristimantis are notable among frogs in that they thrive at high elevations (>2,000 m) and are direct developers without a tadpole stage. Despite their ecological significance, little is known about the genetic and physiological traits enabling their success. We conducted transcriptomic analysis on seven Pristimantis species sampled across elevations in the Ecuadorean Andes to explore three hypotheses for their success: (i) unique genes are under selection relative to all other frogs, (ii) common selection occurs across all direct developers, or (iii) common selection occurs across all high-elevation frog clades. Comparative analysis with 34 frog species revealed unique positive selection in Pristimantis genes related to aerobic respiration, hemostasis, signaling, cellular transportation of proteins and ions, and immunity. Additionally, we detected positive selection across all direct developers for genes associated with oxygenase activity and metal ion binding. While many genes under selection in Pristimantis were not positively selected in other high-elevation frog species, we identified some shared genes and pathways linked to lipid metabolism, innate immunity, and cellular redox processes. We observed more positive selection in duplicated- versus single-copy genes, while relaxed purifying selection was prevalent in single-copy genes. Notably, copy number of an innate immunity complement gene was positively correlated with Pristimantis species elevation. Our findings contribute novel insights into the genetic basis of adaptation in Pristimantis and provide a foundation for future studies on the evolutionary mechanisms leading to direct development and coping with high elevations.

BTN2A2
Also flagged:nucleotidechromosomeethanolwaterphenolchloroform
Journal Article 2024-08-01 ✓ 1 Snippet Hashiguchi Y, Mishina T, Takeshima H, Nakayama K, Tanoue H, Takeshita N, Takahashi H.
In-Text Gene Mentions

…member A2-like (BTN2A2) in LG14,…

Show Full Abstract

It is known that some endangered species have persisted for thousands of years despite their very small effective population sizes and low levels of genetic polymorphisms. To understand the genetic mechanisms of long-term persistence in threatened species, we determined the whole genome sequences of akame (Lates japonicus), which has survived for a long time with extremely low genetic variations. Genome-wide heterozygosity in akame was estimated to be 3.3 to 3.4 × 10-4/bp, one of the smallest values in teleost fishes. Analysis of demographic history revealed that the effective population size in akame was around 1,000 from 30,000 years ago to the recent past. The relatively high ratio of nonsynonymous to synonymous heterozygosity in akame indicated an increased genetic load. However, a detailed analysis of genetic diversity in the akame genome revealed that multiple genomic regions, including genes involved in immunity, synaptic development, and olfactory sensory systems, have retained relatively high nucleotide polymorphisms. This implies that the akame genome has preserved the functional genetic variations by balancing selection, to avoid a reduction in viability and loss of adaptive potential. Analysis of synonymous and nonsynonymous nucleotide substitution rates has detected signs of positive selection in many akame genes, suggesting adaptive evolution to temperate waters after the speciation of akame and its close relative, barramundi (Lates calcarifer). Our results indicate that the functional genetic diversity likely contributed to the long-term persistence of this species by avoiding the harmful effects of the population size reduction.

SUDS3
Also flagged:bindingTranscription Termination Factor 1TTF1Pol IchromatinMyb
Journal Article 2024-08-01 ✓ 1 Snippet Singh G, Bhopale AJ, Khatri S, Prakash P, Kumar R, Singh SM, Singh SK.
In-Text Gene Mentions

…Nucleosome remodelling andhistone deacetylase complexdeacetylase complex (NuRD),…

Show Full Abstract

Transcription Termination Factor 1 (TTF1) is a multifunctional mammalian protein with vital roles in various cellular processes, including Pol I-mediated transcription initiation and termination, pre-rRNA processing, chromatin remodelling, DNA damage repair, and polar replication fork arrest. It comprises two distinct functional regions; the N-terminal regulatory region (1-445 aa), and the C-terminal catalytic region (445-859 aa). The Myb domain located at the C-terminal region is a conserved DNA binding domain spanning from 550 to 732 aa (183 residues). Despite its critical role in various cellular processes, the physical structure of TTF1 remains unsolved. Attempts to purify the functional TTF1 protein have been unsuccessful till date. Therefore, we focused on characterizing the Myb domain of this essential protein. We started with predicting a 3-D model of the Myb domain using homology modelling, and ab-initio method. We then determined its stability through MD simulation in an explicit solvent. The model predicted is highly stable, which stabilizes at 200ns. To experimentally validate the computational model, we cloned and expressed the codon optimized Myb domain into a bacterial expression vector and purified the protein to homogeneity. Further, characterization of the protein shows that, Myb domain is predominantly helical (65%) and is alone sufficient to bind the Sal Box DNA. This is the first-ever study to report a complete in silico model of the Myb domain, which is physically characterized. The above study will pave the way towards solving the atomic structure of this essential mammalian protein.

Also flagged:Hepatocellular Carcinomaliver tumorpathogenesisGene ExpressionP53pyrimidine
Journal Article 2024-08-01 No Snippets Moghimi A, Bani Hosseinian N, Mahdipour M, Ahmadpour E, Miranda-Bedate A, Ghorbian S.
Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) represents a primary liver tumor characterized by a bleak prognosis and elevated mortality rates, yet its precise molecular mechanisms have not been fully elucidated. This study uses advanced bioinformatics techniques to discern differentially expressed genes (DEGs) implicated in the pathogenesis of HCC. The primary objective is to discover novel biomarkers and potential therapeutic targets that can contribute to the advancement of HCC research.<h4>Methods</h4>The bioinformatics analysis in this study primarily utilized the Gene Expression Omnibus (GEO) database as data source. Initially, the Transcriptome analysis console (TAC) screened for DEGs. Subsequently, we constructed a protein-protein interaction (PPI) network of the proteins associated to the identified DEGs with the STRING database. We obtained our hub genes using Cytoscape and confirmed the results through the GEPIA database. Furthermore, we assessed the prognostic significance of the identified hub genes using the GEPIA database. To explore the regulatory interactions, a miRNA-gene interaction network was also constructed, incorporating information from the miRDB database. For predicting the impact of gene overexpression on drug effects, we utilized CANCER DP.<h4>Results</h4>A comprehensive analysis of HCC gene expression profiles revealed a total of 4716 DEGs, consisting of 2430 upregulated genes and 2313 downregulated genes in HCC sample compared to healthy control group. These DEGs exhibited significant enrichment in key pathways such as the PI3K-Akt signaling pathway, nuclear receptors meta-pathway, and various metabolism-related pathways. Further exploration of the PPI network unveiled the P53 signaling pathway and pyrimidine metabolism as the most prominent pathways. We identified 10 hub genes (ASPM, RRM2, CCNB1, KIF14, MKI67, SHCBP1, CENPF, ANLN, HMMR, and EZH2) that exhibited significant upregulation in HCC samples compared to healthy control group. Survival analysis indicated that elevated expression levels of these genes were strongly associated with changes in overall survival in HCC patients. Lastly, we identified specific miRNAs that were found to influence the expression of these genes, providing valuable insights into potential regulatory mechanisms underlying HCC progression.<h4>Conclusion</h4>The findings of this study have successfully identified pivotal genes and pathways implicated in the pathogenesis of HCC. These novel discoveries have the potential to significantly enhance our understanding of HCC at the molecular level, opening new ways for the development of targeted therapies and improved prognosis evaluation.

Also flagged:TumorCD3CD20NLRgene expressionLAG3
Journal Article 2024-08-01 No Snippets Mendoza-Valderrey A, Choe J, Kessler DM, Jimenez G, Li X, Kolker S, Allen W, Linehan JA, Twardowski PW, Ascierto ML.
Show Full Abstract

<h4>Background</h4>Neoadjuvant cisplatin-based chemotherapy (NAC) followed by cystectomy is the standard of care for patients with muscle-invasive bladder cancer (MIBC). Pathologic complete response (pCR) is associated with favorable outcomes, but only 30%-40% of patients achieve that response. The aim of this study is to investigate the role played by the Tumor and Immune Microenvironment (TIME) in association with the clinical outcome of patients with MIBC undergoing NAC.<h4>Methods</h4>Nineteen patients received NAC and were classified as pCR (n = 10) or non-pCR (n = 9). Bulk RNA-seq and immune protein evaluations using Digital Spatial Profiling (DSP) were performed on formalin-fixed paraffin-embedded (FFPE) tumor biopsies collected before NAC (baseline). Immunohistochemistry (IHC) evaluation focused on CD3 and CD20 expression was performed on baseline and end-of-treatment (EOT) FFPEs. Baseline peripheral blood was assessed for lymphocyte and neutrophil counts. Kaplan-Meier analyses and Cox PH regression models were used for survival analyses (OS).<h4>Results</h4>In the periphery, pCR patients showed lower neutrophil counts, and neutrophil/ lymphocyte ratio (NLR) when compared to non-pCR patients. In the tumor microenvironment (TME), gene expression analysis and protein evaluations highlighted an abundance of B cells and CD3<sup>+</sup> T cells in pCR versus non-pCR patients. On the contrary, increased protein expression of ARG1<sup>+</sup> cells, and cells expressing immune checkpoints such as LAG3, ICOS, and STING were observed in the TME of patients with non-pCR.<h4>Conclusions</h4>In the current study, we demonstrated that lower NLR levels and increased CD3<sup>+</sup> T cells and B cell infiltration are associated with improved response and long-term outcomes in patients with MIBC receiving NAC. These findings suggest that the impact of immune environment should be considered in determining the clinical outcome of MIBC patients treated with NAC.

CDK5RAP1
Also flagged:LAG-3TOXCD94NKG2-Qa-1bNK receptorcancer
Journal Article 2024-08-01 ✓ 1 Snippet Ngiow SF, Manne S, Huang YJ, Azar T, Chen Z, Mathew D, Chen Q, Khan O, Wu JE, Alcalde V, Flowers AJ, McClain S, Baxter AE, Kurachi M, Shi J, Huang AC, Giles JR, Sharpe AH, Vignali DAA, Wherry EJ.
In-Text Gene Mentions

Cdk5rap1

Show Full Abstract

Exhausted CD8 T (T<sub>ex</sub>) cells in chronic viral infection and cancer have sustained co-expression of inhibitory receptors (IRs). T<sub>ex</sub> cells can be reinvigorated by blocking IRs, such as PD-1, but synergistic reinvigoration and enhanced disease control can be achieved by co-targeting multiple IRs including PD-1 and LAG-3. To dissect the molecular changes intrinsic when these IR pathways are disrupted, we investigated the impact of loss of PD-1 and/or LAG-3 on T<sub>ex</sub> cells during chronic infection. These analyses revealed distinct roles of PD-1 and LAG-3 in regulating T<sub>ex</sub> cell proliferation and effector functions, respectively. Moreover, these studies identified an essential role for LAG-3 in sustaining TOX and T<sub>ex</sub> cell durability as well as a LAG-3-dependent circuit that generated a CD94/NKG2<sup>+</sup> subset of T<sub>ex</sub> cells with enhanced cytotoxicity mediated by recognition of the stress ligand Qa-1b, with similar observations in humans. These analyses disentangle the non-redundant mechanisms of PD-1 and LAG-3 and their synergy in regulating T<sub>ex</sub> cells.

NEGR1
Also flagged:CD133CancerGliomacentral nervous system cancerglioblastomaGBM
Journal Article 2024-08-01 ✓ 2 Snippets Joyce T, Tasci E, Jagasia S, Shephard J, Chappidi S, Zhuge Y, Zhang L, Cooley Zgela T, Sproull M, Mackey M, Camphausen K, Krauze AV.
In-Text Gene Mentions

…TRPA2, AMPD2, DLK2,NEGR1, POLI, ITGA6, CLN5,…

…, 63 ],NEGR1(involved in synaptogenesis…

Show Full Abstract

Glioma is the most prevalent type of primary central nervous system cancer, while glioblastoma (GBM) is its most aggressive variant, with a median survival of only 15 months when treated with maximal surgical resection followed by chemoradiation therapy (CRT). CD133 is a potentially significant GBM biomarker. However, current clinical biomarker studies rely on invasive tissue samples. These make prolonged data acquisition impossible, resulting in increased interest in the use of liquid biopsies. Our study, analyzed 7289 serum proteins from 109 patients with pathology-proven GBM obtained prior to CRT using the aptamer-based SOMAScan<sup>®</sup> proteomic assay technology. We developed a novel methodology that identified 24 proteins linked to both serum CD133 and 12-month overall survival (OS) through a multi-step machine learning (ML) analysis. These identified proteins were subsequently subjected to survival and clustering evaluations, categorizing patients into five risk groups that accurately predicted 12-month OS based on their protein profiles. Most of these proteins are involved in brain function, neural development, and/or cancer biology signaling, highlighting their significance and potential predictive value. Identifying these proteins provides a valuable foundation for future serum investigations as validation of clinically applicable GBM biomarkers can unlock immense potential for diagnostics and treatment monitoring.

HTT
Also flagged:Serotonin transporterSERTbehavioralserotoninextracellularc-fos
Journal Article 2024-08-01 ✓ 1 Snippet Boillot M, Ter Horst J, López JR, Di Fazio I, Steens ILM, Cohen MX, Homberg JR.
In-Text Gene Mentions

…transporter (SERT or5-HTT) regulates the synaptic…

Show Full Abstract

The orbitofrontal cortex and amygdala collaborate in outcome-guided decision-making through reciprocal projections. While serotonin transporter knockout (SERT-/-) rodents show changes in outcome-guided decision-making, and in orbitofrontal cortex and amygdala neuronal activity, it remains unclear whether SERT genotype modulates orbitofrontal cortex-amygdala synchronization. We trained SERT-/- and SERT+/+ male rats to execute a task requiring to discriminate between two auditory stimuli, one predictive of a reward (CS+) and the other not (CS-), by responding through nose pokes in opposite-side ports. Overall, task acquisition was not influenced by genotype. Next, we simultaneously recorded local field potentials in the orbitofrontal cortex and amygdala of both hemispheres while the rats performed the task. Behaviorally, SERT-/- rats showed a nonsignificant trend for more accurate responses to the CS-. Electrophysiologically, orbitofrontal cortex-amygdala synchronization in the beta and gamma frequency bands during response selection was significantly reduced and associated with decreased hubness and clustering coefficient in both regions in SERT-/- rats compared to SERT+/+ rats. Conversely, theta synchronization at the time of behavioral response in the port associated with reward was similar in both genotypes. Together, our findings reveal the modulation by SERT genotype of the orbitofrontal cortex-amygdala functional connectivity during an auditory discrimination task.

PRDX6
Also flagged:Punicalaginsuperoxide dismutase 1catalaseglutathione peroxidase 1oxygencollagen
Journal Article 2024-08-01 ✓ 1 Snippet Bezerra VS, Costa FC, Caetano Filho FF, Costa JJN, de Lima Neto MF, Furtado CLM, Ceccatto VM, Araújo VR, Silva JRV.
In-Text Gene Mentions

…and perirredoxin 6 (PRDX6), and activity…

Show Full Abstract

Context The overproduction of reactive oxygen species (ROS) during in vitro culture of ovarian tissues impairs follicular development and survival. Aims To evaluate the effects of punicalagin on the development and survival of primordial follicles, stromal cell and collagen fibres, as well as on the levels of mRNA for nuclear factor erythroid 2-related factor 2 (NRF2 ), superoxide dismutase 1 (SOD1 ), catalase (CAT ), glutathione peroxidase 1 (GPX1 ) and perirredoxin 6 (PRDX6 ), and activity of antioxidant enzymes in cultured bovine ovarian tissues. Methods Bovine ovarian cortical tissues were cultured for 6days in α-MEM+ alone or with 1.0, 10.0, or 100.0μM punicalagin at 38.5°C with 5% CO2 . Follicle morphology and growth, stromal cell density, and collagen fibres were evaluated by classical histology, while the expression of mRNA was evaluated by real-time PCR. The activity of enzymes was analysed by the Bradford method. Key results Punicalagin improved follicle survival and development, reduced mRNA expression for SOD1 and CAT , but did not influence stromal cells or collagen fibres. Punicalagin (10.0μM) increased the levels of thiol and activity of SOD1, CAT , and GPX1 enzymes. Conclusions Punicalagin (10.0μM) promotes follicle survival and development and activates SOD1, CAT , and GPX1 enzymes in bovine ovarian tissues. Implications Punicalagin improves follicle development and survival in cultured ovarian tissues.

SOX6
Also flagged:NFIXgliomaNSCLCbindingluciferaseCell proliferation
Journal Article 2024-08-01 ✓ 1 Snippet Liu G, Shi H, Zheng H, Kong W, Cheng X, Deng L.
In-Text Gene Mentions

…in NSCLC throughSOX6[ 39 ].…

Show Full Abstract

<h4>Background</h4>circRNA NFIX has been shown to exist as an oncogene in glioma. But its expression and role in NSCLC (non-small cell lung cancer) are still unclear. This research aimed to discover the expression and function of circRNA NFIX in NSCLC.<h4>Methods</h4>In this research, qRT-PCR was utilized to investigate the expression levels of circRNA NFIX, miRNA-214-3p, and TRIAP1 in NSCLC tissues and cell lines. The binding sites between circRNA NFIX/TRIAP1 and miRNA-214-3p were predicted using the Starbase. These interactions were further validated using a double luciferase reporter assay. Cell proliferation and apoptosis were assessed through MTT and flow cytometry, respectively. The expression of apoptosis-related proteins was measured by western blot assay.<h4>Results</h4>miRNA-214-3p could link with circRNA NFIX. circRNA NFIX was upregulated, while miRNA-214-3p was downregulated in NSCLC cell lines and clinical samples. Besides, suppression of circRNA NFIX repressed cell proliferation and induced apoptosis in NSCLC cells by upregulating miRNA-214-3p expression. Besides, the data indicated that TRIAP1 was a target of miRNA-214-3p, and it was negatively regulated by miRNA-214-3p in NSCLC cells. The excessive expression of miRNA-214-3p suppressed NSCLC cell proliferation and increased apoptosis. In addition, overexpression of TRIAP1 significantly reversed the effects on NSCLC cells caused by miRNA-214-3p mimic.<h4>Conclusion</h4>circRNA NFIX silencing repressed the proliferation of NSCLC cells and induced cell apoptosis by regulating the miR-214-3p/TRIAP1 axis, which was a potential diagnostic and therapeutic target for NSCLC.

CACNA1E
Also flagged:MAPKPI3KAktmigrainepathogenesisgene expression
Journal Article 2024-08-01 ✓ 2 Snippets Wang M, Gu Y, Meng S, Kang L, Yang J, Sun D, Liu Y, Wan Z, Shan Y, Xue D, Su C, Li S, RanYan, Liu Y, Pan Y, Zhao Y.
In-Text Gene Mentions

…shown that theCACNA1E‐rs35737760 polymorphism is…

…Both CACNA1H andCACNA1Eare important genes…

Show Full Abstract

<h4>Background</h4>The causes of migraine remain unclear. Evidence suggests that the MAPK and PI3K/Akt signaling pathways play a role in migraine pathogenesis. However, studies on genetic polymorphisms in the two pathways associated with migraine are still limited.<h4>Methods</h4>This study included 226 migraineurs and 452 age- and sex-matched nonmigraine control individuals. Genotyping of 31 Single Nucleotide Polymorphisms (SNPs) in 21 genes was performed. The relationship between migraine and gene polymorphisms was analyzed by using logistic regression. SNP-SNP interactions were examined by a generalized multifactor dimension reduction (GMDR) approach. The possible role of SNPs was evaluated with gene expression data from the GTEx database.<h4>Results</h4>The RASGRP2-rs2230414 GT genotype was associated with decreased migraine risk compared with the wild-type GG genotype [OR<sub>adj</sub> (95% CI): 0.674(0.458-0.989)]. PIK3R1-rs3730089 was associated with migraine in the recessive model [OR<sub>adj</sub> (95% CI): 1.446(1.004-2.083)]. The CACNA1H-rs61734410 CT genotype was associated with migraine risk [OR<sub>adj</sub> (95% CI): 1.561(1.068-2.281)]. One significant two-way SNP-SNP interaction was found (PRKCA rs2228945-BDNF rs6265) (p = 0.0107). Significant eQTL and sQTL signals were observed for the SNP rs2230414.<h4>Conclusions</h4>This is the first study to systematically reveal significant associations between MAPK and PI3K/Akt signaling pathway-related gene polymorphisms and migraine risk.

SERPINC1
Also flagged:tumorbrain tumorsbrain tumorextracellularfocal adhesionPI3K
Journal Article 2024-08-01 ✓ 1 Snippet Ma J, Lin Z, Zhang Y, Ding Y, Tang Q, Qian Y, Jin B, Luo RY, Liao WL, Thyparambil S, Han Z, Chou CJ, Schilling J, Li Q, Zhang M, Lin Y, Ma Y, Sylvester KG, Nagpal S, McElhinney DB, Ling XB, Chen B.
In-Text Gene Mentions

…C Member 1 (SERPINC1), Transthyretin (TTR), Fibrin…

Show Full Abstract

<h4>Introduction</h4>Primary central nervous system lymphoma (PCNSL) is a rare type of non-Hodgkin's lymphoma that affects brain parenchyma, eyes, cerebrospinal fluid, and spinal cord. Diagnosing PCNSL can be challenging because imaging studies often show similar patterns as other brain tumors, and stereotactic brain lesion biopsy conformation is invasive and not always possible. This study aimed to validate a previous proteomic profiling (PMID: 32610669) of cerebrospinal fluid (CSF) and develop a CSF-based proteomic panel for accurate PCNSL diagnosis and differentiation.<h4>Methods</h4>CSF samples were collected from patients of 30 PCNSL, 30 other brain tumors, and 31 tumor-free/benign controls. Liquid chromatography tandem-mass spectrometry targeted proteomics analysis was used to establish CSF-based proteomic panels.<h4>Results</h4>Final proteomic panels were selected and optimized to diagnose PCNSL from tumor-free controls or other brain tumor lesions with an area under the curve (AUC) of 0.873 (95%CI: 0.723-0.948) and 0.937 (95%CI: 0.807- 0.985), respectively. Pathways analysis showed diagnosis panel features were significantly enriched in pathways related to extracellular matrices-receptor interaction, focal adhesion, and PI3K-Akt signaling, while prion disease, mineral absorption and HIF-1 signaling were significantly enriched with differentiation panel features.<h4>Discussion</h4>This study suggests an accurate clinical test panel for PCNSL diagnosis and differentiation with CSF-based proteomic signatures, which may help overcome the challenges of current diagnostic methods and improve patient outcomes.

SERPINC1
Also flagged:glycosylationthrombophilia
Journal Article 2024-08-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…et al. TwoSERPINC1variants affecting N-glycosyla…

Show Full Abstract

No abstract available.

Also flagged:polylysinepaclitaxeltriple-negative breast cancerAXLtumortumors
Journal Article 2024-08-01 No Snippets Wan X, Chen C, Zhan J, Ye S, Li R, Shen M.
Show Full Abstract

<b>Background:</b> Drug resistance is common in triple-negative breast cancer (TNBC) therapy. To identify a method to overcome chemotherapy resistance in TNBC cells, an siRNA targeting the AXL gene (siAXL), which can overcome drug resistance, was used in this study. A nanodelivery system was constructed to co-deliver siAXL and paclitaxel (PTX). <b>Methods:</b> A biodegradable and tumor microenvironment (TME)-sensitive mPEG-coated dendritic polylysine material (PDPLL) was synthesized. This material was used to construct single-molecule nanoparticles to co-deliver PTX and siAXL. The drug encapsulation and morphological properties of the nanoparticles (NPs) were characterized. The sensitivity of the NPs to the TME was evaluated <i>in vitro</i> with a dialysis method. The tumor-targeting effect of the PDPLL NPs was evaluated by fluorescence imaging and drug distribution evaluation <i>in vivo</i>. The ability to overcome drug resistance was evaluated using PTX-resistant 4T1 cells (4T1/PTX cells) in both <i>in vitro</i> and <i>in vivo</i> models. <b>Results:</b> PDPLL NPs had a particle size of 49.6 ± 5.9 nm and a zeta potential of 7.87 ± 0.68 mV. The PTX drug loading (DL)% was 2.59%. The siAXL DL was 2.5 mg PDPLL: 10 nmol siAXL. The release of PTX showed sustained release performance. The release of siAXL showed sensitivity for the TME. The NPs were stable in the plasma. The NPs promoted cell uptake by PTX-resistant 4T1 cells (4T1/PTX) and promoted tumor targeting and permeability <i>in vivo</i>. siAXL enhanced the toxicity and apoptosis efficiency of PTX in 4T1/PTX cells, as well as the cycle arrest efficiency caused by PTX. The NPs improved the above effects. In mouse 4T1/PTX orthotopic tumors, the NPs enhanced the sensitization of PTX to siAXL. <b>Conclusion:</b> The PDPLL NP co-delivery system possesses good encapsulating potential not only for PTX but also for siRNA. It can enhance the tumor-targeting effect and overcome the drug resistance of 4T1/PTX both <i>in vitro</i> and <i>in vivo</i>. This system is a potential delivery system for RNAs.

Also flagged:RNA helicasesribonucleoproteinshelicaseSF1metabolismSF3
Journal Article 2024-08-01 No Snippets Lederbauer J, Das S, Piton A, Lessel D, Kreienkamp HJ.
Show Full Abstract

Neurodevelopmental disorders (NDDs) represent a large group of disorders with an onset in the neonatal or early childhood period; NDDs include intellectual disability (ID), autism spectrum disorders (ASD), attention deficit hyperactivity disorders (ADHD), seizures, various motor disabilities and abnormal muscle tone. Among the many underlying Mendelian genetic causes for these conditions, genes coding for proteins involved in all aspects of the gene expression pathway, ranging from transcription, splicing, translation to the eventual RNA decay, feature rather prominently. Here we focus on two large families of RNA helicases (DEAD- and DExH-box helicases). Genetic variants in the coding genes for several helicases have recently been shown to be associated with NDD. We address genetic constraints for helicases, types of pathological variants which have been discovered and discuss the biological pathways in which the affected helicase proteins are involved.

Also flagged:waterbindingelectron transferamino acidsmembrane proteins
Journal Article 2024-08-01 No Snippets Krieger JM, Doljanin F, Bogetti AT, Zhang F, Manivarma T, Bahar I, Mikulska-Ruminska K.
Show Full Abstract

<h4>Summary</h4>We introduce WatFinder, a tool designed to identify and visualize protein-water interactions (water bridges, water-mediated associations, or water channels, fluxes, and clusters) relevant to protein stability, dynamics, and function. WatFinder is integrated into ProDy, a Python API broadly used for structure-based prediction of protein dynamics. WatFinder provides a suite of functions for generating raw data as well as outputs from statistical analyses. The ProDy framework facilitates comprehensive automation and efficient analysis of the ensembles of structures resolved for a given protein or the time-evolved conformations from simulations in explicit water, as illustrated in five case studies presented in the Supplementary Material.<h4>Availability and implementation</h4>ProDy is open-source and freely available under MIT License from https://github.com/ProDy/ProDy.

HTT
Also flagged:HDcytosineadenineguanineIT15Huntingtin
Journal Article 2024-08-01 ✓ 2 Snippets Hossain MR, Tareq MMI, Biswas P, Tauhida SJ, Bibi S, Zilani MNH, Albadrani GM, Al-Ghadi MQ, Abdel-Daim MM, Hasan MN.
In-Text Gene Mentions

…as the huntingtin (HTT) gene.…

…identify the faultyHTTprotein gene, exposing…

Show Full Abstract

Huntington's disease (HD) is a gradually severe neurodegenerative ailment characterised by an increase of a specific trinucleotide repeat sequence (cytosine-adenine-guanine, CAG). It is passed down as a dominant characteristic that worsens over time, creating a significant risk. Despite being monogenetic, the underlying mechanisms as well as biomarkers remain poorly understood. Furthermore, early detection of HD is challenging, and the available diagnostic procedures have low precision and accuracy. The research was conducted to provide knowledge of the biomarkers, pathways and therapeutic targets involved in the molecular processes of HD using informatic based analysis and applying network-based systems biology approaches. The gene expression profile datasets GSE97100 and GSE74201 relevant to HD were studied. As a consequence, 46 differentially expressed genes (DEGs) were identified. 10 hub genes (TPM1, EIF2S3, CCN2, ACTN1, ACTG2, CCN1, CSRP1, EIF1AX, BEX2 and TCEAL5) were further differentiated in the protein-protein interaction (PPI) network. These hub genes were typically down-regulated. Additionally, DEGs-transcription factors (TFs) connections (e.g. GATA2, YY1 and FOXC1), DEG-microRNA (miRNA) interactions (e.g. hsa-miR-124-3p and has-miR-26b-5p) were also comprehensively forecast. Additionally, related gene ontology concepts (e.g. sequence-specific DNA binding and TF activity) connected to DEGs in HD were identified using gene set enrichment analysis (GSEA). Finally, in silico drug design was employed to find candidate drugs for the treatment HD, and while the possible modest therapeutic compounds (e.g. cortistatin A, 13,16-Epoxy-25-hydroxy-17-cheilanthen-19,25-olide, Hecogenin) against HD were expected. Consequently, the results from this study may give researchers useful resources for the experimental validation of Huntington's diagnosis and therapeutic approaches.

HFE
Also flagged:hematological disordersHHHereditary Hemochromatosisnecrosistypeavascular necrosis
Journal Article 2024-08-01 ✓ 3 Snippets Top ACR, Vanmierlo B, Decramer A.
In-Text Gene Mentions

…mutation of theHFEgene is found…

…mutation of theHFEgene presented with…

…mutation in theHFEgene is presented.…

Show Full Abstract

<h4>Introduction</h4>Avascular necrosis of the lunate bone has been extensively researched, although the etiology of the condition remains controversial. Even though many treatments for the disease exist, a better understanding of the pathophysiology can improve our decision-making between preventive and therapeutic measures. Various hematological disorders have been found to predispose for Kienböck's disease. On the other hand, there has not yet been any reference in literature to a relationship between this condition and hereditary hemochromatosis (HH).<h4>Case report</h4>We present two cases of Kienböck's disease in two patients who are third-degree relatives and diagnosed with HH. A 61-year-old Caucasian female patient with type 1 HH presented with symptomatic Kienböck's disease on the left side. The patient is a third-degree relative of a 51-year-old male Caucasian patient with Kienbock's disease on the right side, known as having the same hereditary hematological condition.<h4>Conclusion</h4>Our findings suggest a potential correlation between the aforementioned conditions. The prevalence of these coexisting pathologies should be studied further.

DARS2
Also flagged:hereditary cardiac disorderpathogenesisGATMMGST1SDSLARG2
Journal Article 2024-08-01 ✓ 4 Snippets Dai H, Liu Y, Zhu M, Tao S, Hu C, Luo P, Jiang A, Zhang G.
In-Text Gene Mentions

Five novel biomarkers (DARS2, GATM, MGST1, SDSL and ARG2) associated with HCM were identified.

…Five novel biomarkers (DARS2, GATM, MGST1, SDSL…

…, which includedDARS2, GATM, MGST1, SDSL…

…tissues (AUC ofDARS2, GATM, MGST1, SDSL…

Show Full Abstract

Hypertrophic cardiomyopathy (HCM) is a hereditary cardiac disorder marked by anomalous thickening of the myocardium, representing a significant contributor to mortality. While the involvement of immune inflammation in the development of cardiac ailments is well-documented, its specific impact on HCM pathogenesis remains uncertain. Five distinct machine learning algorithms, namely LASSO, SVM, RF, Boruta and XGBoost, were utilized to discover new biomarkers associated with HCM. A unique nomogram was developed using two newly identified biomarkers and subsequently validated. Furthermore, samples of HCM and normal heart tissues were gathered from our institution to confirm the variance in expression levels and prognostic significance of GATM and MGST1. Five novel biomarkers (DARS2, GATM, MGST1, SDSL and ARG2) associated with HCM were identified. Subsequent validation revealed that GATM and MGST1 exhibited significant diagnostic utility for HCM in both the training and test cohorts, with all AUC values exceeding 0.8. Furthermore, a novel risk assessment model for HCM patients based on the expression levels of GATM and MGST1 demonstrated favourable performance in both the training (AUC = 0.88) and test cohorts (AUC = 0.9). Furthermore, our study revealed that GATM and MGST1 exhibited elevated expression levels in HCM tissues, demonstrating strong discriminatory ability between HCM and normal cardiac tissues (AUC of GATM = 0.79; MGST1 = 0.86). Our findings suggest that two specific cell types, monocytes and multipotent progenitors (MPP), may play crucial roles in the pathogenesis of HCM. Notably, GATM and MGST1 were found to be highly expressed in various tumours and showed significant prognostic implications. Functionally, GATM and MGST1 are likely involved in xenobiotic metabolism and epithelial mesenchymal transition in a wide range of cancer types. GATM and MGST1 have been identified as novel biomarkers implicated in the progression of both HCM and cancer. Additionally, monocytes and MPP may also play a role in facilitating the progression of HCM.

SERPINC1
Also flagged:Traumatic Brain Injurybrain injuryinjurystrokemetacognitionGAS
Journal Article 2024-08-01 ✓ 1 Snippet Richardson JD, Hubbard HI, Dalton SG, Davidson S, Maple T, Smith TB, Chen M, Hiltner R, Jones T, Mayer AR, Myers O, Nelson C, Pirio-Richardson S, Robertson-Benta C, Sponheim S, Upston J, Worth L, Davenport N, Quinn DK.
In-Text Gene Mentions

APT-III

Show Full Abstract

<h4>Introduction</h4>The Control Network Neuromodulation to Enhance Cognitive Training in Complex Traumatic Brain Injury (CONNECT-TBI) study is an ongoing randomized, double-blinded, sham-controlled multisite clinical trial to determine the enhancing effects of noninvasive neuromodulation when paired with cognitive training in military participants (Veterans and active duty) with mild TBI. Attention Process Training-III (APT-III) was selected for its strong evidence base, manualized procedures, and computerized program. However, many aspects of APT-III that make it ideal for personalization make it less ideal for reliable implementation across participants, clinicians/technicians, and sites. The purpose of this feature article is to highlight APT-III procedures that require additional standardization for reliable administration across participants and sites.<h4>Materials and methods</h4>Ten studies using APT-III were reviewed for methodology of APT-III administration. The manual was also scrutinized; aspects of administration that involved clinical decision-making, subjectivity, flexibility, and/or that were identified by the APT-III developers as areas in need of "empirical evaluation" were flagged by clinicians. Literature and manual review findings were presented to the team for discussion and solution-finding. The authors created and refined a standardized process that would allow participants to move through APT-III training, including task movement algorithms and new materials drafts. Refining of algorithms and drafts continued until there was a consensus from team members.<h4>Results</h4>Many gray areas were identified, but we will limit our reporting to focus on (1) dosage, (2) adaptation, (3) metacognitive strategy instruction, and (4) goal attainment scaling. We present APT-III manual details, literature review findings, and CONNECT-TBI decisions and materials for each of these areas of focus.<h4>Conclusions</h4>We have highlighted some of the major gray areas of APT-III administration so that fellow researchers can understand the need to take similar steps in clinical trials using APT-III. We provide examples of our standardization process and resultant rules and materials. Our algorithm, based on prior studies using the APT-III and our own iterative adjustments, allows for adjustment of the difficulty and speed of the training tasks (but within certain parameters) in order to achieve the best balance between individualization and consistency across participants and sites. We provide an example of a workflow and reporting process for future studies.

CACNA1E
Also flagged:malignant glioblastomatumorNeosynaptogenesisglutamatemembraneepilepsy
Journal Article 2024-08-01 ✓ 1 Snippet Soeung V, Puchalski RB, Noebels JL.
In-Text Gene Mentions

…CACNA1B , andCACNA1E, respectively) mediate…

Show Full Abstract

The cortical microenvironment surrounding malignant glioblastoma is a source of depolarizing crosstalk favoring hyperexcitability, tumor expansion, and immune evasion. Neosynaptogenesis, excess glutamate, and altered intrinsic membrane currents contribute to excitability dyshomeostasis, yet only half of the cases develop seizures, suggesting that tumor and host genomics, along with location, rather than mass effect, play a critical role. We analyzed the spatial contours and expression of 358 clinically validated human epilepsy genes in the human glioblastoma transcriptome compared to non-tumor adult and developing cortex datasets. Nearly half, including dosage-sensitive genes whose expression levels are securely linked to monogenic epilepsy, are strikingly enriched and aberrantly regulated at the leading edge, supporting a complex epistatic basis for peritumoral epileptogenesis. Surround hyperexcitability induced by complex patterns of proepileptic gene expression may explain the limited efficacy of narrowly targeted antiseizure medicines and the persistence of epilepsy following tumor resection and clarify why not all brain tumors provoke seizures.

HFE
Also flagged:colorectal cancerFerritiniron deficiencydeathobesitydiabetes
Journal Article 2024-08-01 ✓ 1 Snippet Urback AL, Martens K, McMurry HS, Chen EY, Citti C, Sharma A, Kardosh A, Shatzel JJ.
In-Text Gene Mentions

…disorder such ashemochromatosis, patients currently undergoin…

Show Full Abstract

<h4>Background</h4>The incidence of early-onset colorectal cancer (EO-CRC) is rising in the United States, and is often diagnosed at advanced stages. Low serum ferritin is often incidentally discovered in young adults, however, the indication for endoscopy in EO-CRC is unclear.<h4>Aim</h4>To compare serum ferritin between patients with EO-CRC and healthy controls (HCs), and examine the association of serum ferritin in EO-CRC with patient- and disease-specific characteristics.<h4>Methods</h4>A retrospective study of patients < 50 years with newly-diagnosed EO-CRC was conducted from 1/2013-12/2023. Patients were included if serum ferritin was measured within 2 years prior to 1 year following CRC histologic diagnosis. To supplement the analysis, a cohort of HCs meeting similar inclusion and exclusion criteria were identified for comparison. A sensitivity analysis including only patients with serum ferritin obtained at or before diagnosis was separately performed to minimize risk of confounding.<h4>Results</h4>Among 85 patients identified with EO-CRC (48 females), the median serum ferritin level was 26 ng/mL (range < 1-2759 ng/mL). Compared to HCs (<i>n</i> = 80211), there were a higher proportion of individuals with EO-CRC with serum ferritin < 20 ng/mL (female 65%, male 40%) versus HCs (female 32.1%, male 7.2%) age 29-39 years (<i>P</i> = 0.002 and <i>P</i> < 0.00001, respectively). Stage IV disease was associated with significantly higher serum ferritin compared to less advanced stages (<i>P</i> < 0.001). Serum ferritin obtained before or at the time of diagnosis was lower than levels obtained after diagnosis. Similar findings were confirmed in the sensitivity analysis.<h4>Conclusion</h4>Severe iron deficiency may indicate an increased risk of EO-CRC, particularly at earlier stages. Further studies defining the optimal serum ferritin threshold and routine incorporation of serum ferritin in screening algorithms is essential to develop more effective screening strategies for EO-CRC.

ZNF311
Also flagged:malariainfectious diseasestuberculosisTBchronic mountain sicknessangiogenesis
Journal Article 2024-08-01 ✓ 1 Snippet González-Buenfil R, Vieyra-Sánchez S, Quinto-Cortés CD, Oppenheimer SJ, Pomat W, Laman M, Cervantes-Hernández MC, Barberena-Jonas C, Auckland K, Allen A, Allen S, Phipps ME, Huerta-Sanchez E, Ioannidis AG, Mentzer AJ, Moreno-Estrada A.
In-Text Gene Mentions

…( KAT6B, ZBED9,ZNF311, ZSCAN12, ZSCAN23 ),…

Show Full Abstract

Papua New Guinea (PNG) hosts distinct environments mainly represented by the ecoregions of the Highlands and Lowlands that display increased altitude and a predominance of pathogens, respectively. Since its initial peopling approximately 50,000 years ago, inhabitants of these ecoregions might have differentially adapted to the environmental pressures exerted by each of them. However, the genetic basis of adaptation in populations from these areas remains understudied. Here, we investigated signals of positive selection in 62 highlanders and 43 lowlanders across 14 locations in the main island of PNG using whole-genome genotype data from the Oceanian Genome Variation Project (OGVP) and searched for signals of positive selection through population differentiation and haplotype-based selection scans. Additionally, we performed archaic ancestry estimation to detect selection signals in highlanders within introgressed regions of the genome. Among highland populations we identified candidate genes representing known biomarkers for mountain sickness (SAA4, SAA1, PRDX1, LDHA) as well as candidate genes of the Notch signaling pathway (PSEN1, NUMB, RBPJ, MAML3), a novel proposed pathway for high altitude adaptation in multiple organisms. We also identified candidate genes involved in oxidative stress, inflammation, and angiogenesis, processes inducible by hypoxia, as well as in components of the eye lens and the immune response. In contrast, candidate genes in the lowlands are mainly related to the immune response (HLA-DQB1, HLA-DQA2, TAAR6, TAAR9, TAAR8, RNASE4, RNASE6, ANG). Moreover, we find two candidate regions to be also enriched with archaic introgressed segments, suggesting that archaic admixture has played a role in the local adaptation of PNG populations.

HTT
Also flagged:Alzheimer diseaseADParkinson diseasePDneurodegenerative diseasesHuntington disease
Journal Article 2024-08-01 ✓ 2 Snippets Hou M, Zhang Z, Fan Z, Huang L, Wang L.
In-Text Gene Mentions

…(α-syn), ahd Huntingtin (Htt) protein.…

…HD Huntington diseaseHttHuntingtin IP3R inositol…

Show Full Abstract

Neurodegenerative diseases are complex disorders that significantly challenge human health, with their incidence increasing with age. A key pathological feature of these diseases is the accumulation of misfolded proteins. The underlying mechanisms involve an imbalance in calcium homeostasis and disturbances in autophagy, indicating a likely correlation between them. As the most important second messenger, Ca2+ plays a vital role in regulating various cell activities, including autophagy. Different organelles within cells serve as Ca2+ storage chambers and regulate Ca2+ levels under different conditions. Ca2+ in these compartments can affect autophagy via Ca2+ channels or other related signaling proteins. Researchers propose that Ca2+ regulates autophagy through distinct signal transduction mechanisms, under normal or stressful conditions, and thereby contributing to the occurrence and development of neurodegenerative diseases. This review provides a systematic examination of the regulatory mechanisms of Ca2+ in cell membranes and different organelles, as well as its downstream pathways that influence autophagy and its implications for neurodegenerative diseases. This comprehensive analysis may facilitate the development of new drugs and provide more precise treatments for neurodegenerative diseases.

Also flagged:ripretinibgastrointestinal stromal tumorgastrointestinal stromal tumorsGISTkinasetyrosine kinase
Journal Article 2024-08-01 No Snippets Li J, Zhang H, Chen XD.
Show Full Abstract

<h4>Background</h4>Imatinib (IMA) has received approval as the primary treatment for gastrointestinal stromal tumors (GIST). Nonetheless, approximately half of the patients with advanced GIST show disease advancement following IMA treatment. Presently, the efficacy of secondary and tertiary medications in addressing various GIST secondary mutations is somewhat restricted. Consequently, there is a significant medical demand for the creation of kinase inhibitors that extensively block secondary drug-resistant mutations in advanced GIST. Ripretinib (RPT) is a new, switch-control tyrosine kinase inhibitors that can suppress different mutations of KIT and PDGFRA <i>via</i> a dual mechanism of action.<h4>Aim</h4>To investigate the literature on RPT to assess an effective, safe, and successful treatment strategy against advanced GIST.<h4>Methods</h4>The present systematic review and meta-analysis was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. PubMed, Embase, Cochrane, Web of Science and ClinicalTrials.gov databases were screened from January 1, 2003 to May 1, 2024.<h4>Results</h4>A total of 4 studies were included, with a total of 507 patients enrolled. The objective response rate (ORR) of the RPT-treated advanced GIST was 17% (95%CI: 0.11-0.27), while the disease control rate (DCR) was 66% (95%CI: 0.59-0.73). The overall occurrence of adverse events with varying degrees was 97% (95%CI: 0.93-1), whereas that of grade ≥ 3 adverse reactions was 42% (95%CI: 0.28-0.63). The sensitivity analysis revealed that omitting some studies did not yield statistically notable variances in the aggregate data regarding the ORR, DCR, and the occurrence of adverse events of grade 3 or higher. The publication bias was absent because no significant asymmetry was observed in Begg's funnel plot in all studies.<h4>Conclusion</h4>RPT has favorable efficacy profiles in GIST patients, but the adverse reactions are obvious, and patient management needs to be strengthened to achieve better safety and tolerability.

SERPINC1CSE1L
Also flagged:Endometrial CancerEGFRPGRMC1MYDGFSTMN1CASP3
Journal Article 2024-08-01 ✓ 5 Snippets Serambeque B, Mestre C, Hundarova K, Marto CM, Oliveiros B, Gomes AR, Teixo R, Carvalho AS, Botelho MF, Matthiesen R, Carvalho MJ, Laranjo M.
In-Text Gene Mentions

…studies: EGFR, PGRMC1,CSE1L, MYDGF, STMN1, CASP3…

…and Antithrombin III (ATR/SERPINC1).…

SERPINC1is an important…

…these, EGFR, PGRMC1,CSE1L, MYDGF, STMN1 and…

…The exportin-2 (CSE1L) protein is highly…

Show Full Abstract

Proteomics can be a robust tool in protein identification and regulation, allowing the discovery of potential biomarkers. In clinical practice, the management of endometrial cancer can be challenging. Thus, identifying promising markers could be beneficial, helping both in diagnosis and prognostic stratification, even predicting the response to therapy. Therefore, this manuscript systematically reviews the existing evidence of the proteomic profile of human endometrial cancer. The literature search was conducted via Medline (through PubMed) and the Web of Science. The inclusion criteria were clinical, in vitro, and in vivo original studies reporting proteomic analysis using all types of samples to map the human endometrial cancer proteome. A total of 55 publications were included in this review. Most of the articles carried out a proteomic analysis on endometrial tissue, serum and plasma samples, which enabled the identification of several potential diagnostic and prognostic biomarkers. In addition, eight articles were analyzed regarding the identified proteins, where three studies showed a strong correlation, sharing forty-five proteins. This analysis also allowed the identification of the 10 most frequently reported proteins in these studies: EGFR, PGRMC1, CSE1L, MYDGF, STMN1, CASP3 ANXA2, YBX1, ANXA1, and MYH11. Proteomics-based approaches pointed out potential diagnostic and prognostic candidates for endometrial cancer. However, there is a lack of studies exploring novel therapeutic targets.

Also flagged:waterT. gondii infectionhydrocephalycongenital toxoplasmosisautismpsychiatric disorders
Journal Article 2024-08-01 No Snippets Meza-Sosa KF, Valle-Garcia D, González-Conchillos H, Blanco-Ayala T, Salazar A, Flores I, Gómez-Manzo S, González Esquivel DF, Pérez de la Cruz G, Pineda B, Pérez de la Cruz V.
Show Full Abstract

Epidemiological studies and meta-analyses have shown a strong association between high seroprevalence of <i>Toxoplasma gondii</i> (<i>T. gondii</i>) and schizophrenia. Schizophrenic patients showed higher levels of anti-Toxoplasma immunoglobulins M and G (IgM and IgG) when compared to healthy controls. Previously, in a rat model, we demonstrated that the progeny of mothers immunized with <i>T. gondii</i> lysates before gestation had behavioral and social impairments during adulthood. Therefore, we suggested that <i>T. gondii</i> infection can trigger autoreactivity by molecularly mimicking host brain proteins. Here, we aimed to identify the occurrence of antigenic mimicry between <i>T. gondii</i> epitopes and host brain proteins. Using a bioinformatic approach, we predicted <i>T. gondii RH-88 B</i> cell epitopes and compared them to human cell-surface proteins involved in brain development and differentiation (BrainS). Five different algorithms for B-cell-epitope prediction were used and compared, resulting in 8584 <i>T. gondii</i> epitopes. We then compared <i>T. gondii</i> predicted epitopes to BrainS proteins by local sequence alignments using BLASTP. <i>T. gondii</i> immunogenic epitopes significantly overlapped with 42 BrainS proteins. Among these overlapping proteins essential for brain development and differentiation, we identified HSP90 and NOTCH receptors as the proteins most likely to be targeted by the maternally generated pathogenic antibodies due to their topological overlap at the extracellular region of their sequence. This analysis highlights the relevance of pregestational clinical surveillance and screening for potential pathogenic anti-<i>T. gondii</i> antibodies. It also identifies potential targets for the design of vaccines that could prevent behavioral and cognitive impairments associated with pre-gestational <i>T. gondii</i> exposure.

PRDX6
Also flagged:metabolismmitochondrialdesmoglein-2Right Ventricular DysplasiaCardiomyopathycomplexes I
Journal Article 2024-08-01 ✓ 2 Snippets Heywood WE, Searle J, Collis R, Doykov I, Ashworth M, Sebire N, Bamber A, Gautel M, Eaton S, Coats CJ, Elliott PM, Mills K.
In-Text Gene Mentions

PRDX6has a much…

PRDX6also acts to…

Show Full Abstract

Proteomics studies often explore phenotypic differences between whole organs and systems. Within the heart, more subtle variation exists. To date, differences in the underlying proteome are only described between whole cardiac chambers. This study, using the bovine heart as a model, investigates inter-regional differences and assesses the feasibility of measuring detailed, cross-tissue variance in the cardiac proteome. Using a bovine heart, we created a two-dimensional section through a plane going through two chambers. This plane was further sectioned into 4 × 4 mm cubes and analysed using label-free proteomics. We identified three distinct proteomes. When mapped to the extracted sections, the proteomes corresponded largely to the outer wall of the right ventricle and secondly to the outer wall of the left ventricle, right atrial appendage, tricuspid and mitral valves, modulator band, and parts of the left atrium. The third separate proteome corresponded to the inner walls of the left and right ventricles, septum, and left atrial appendage. Differential protein abundancies indicated differences in energy metabolism between regions. Data analyses of the mitochondrial proteins revealed a variable pattern of abundances of complexes I-V between the proteomes, indicating differences in the bioenergetics of the different cardiac sub-proteomes. Mapping of disease-associated proteins interestingly showed desmoglein-2, for which defects in this protein are known to cause Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy, which was present predominantly in the outer wall of the left ventricle. This study highlights that organs can have variable proteomes that do not necessarily correspond to anatomical features.

Also flagged:indolenitrogenRNA-dependent RNA polymeraseRdRpnitroNS5B
Journal Article 2024-08-01 No Snippets Giannakopoulou E, Akrani I, Mpekoulis G, Frakolaki E, Dimitriou M, Myrianthopoulos V, Vassilaki N, Zoidis G.
Show Full Abstract

Infections with <i>Flaviviridae</i> viruses, such as hepatitis C (HCV), dengue (DENV), and yellow fever (YFV) viruses, are major public health problems worldwide. In the case of HCV, treatment is associated with drug resistance and high costs, while there is no clinically approved therapy for DENV and YFV. Consequently, there is still a need for new chemotherapies with alternative modes of action. We have previously identified novel 2-hydroxypyrazino[1,2-<i>a</i>]indole-1,3(2<i>H</i>,4<i>H</i>)-diones as metal-chelating inhibitors targeting HCV RNA replication. Here, by utilizing a structure-based approach, we rationally designed a second series of compounds by introducing various substituents at the indole core structure and at the imidic nitrogen, to improve specificity against the RNA-dependent RNA polymerase (RdRp). The resulting derivatives were evaluated for their potency against HCV genotype 1b, DENV2, and YFV-17D using stable replicon cell lines. The most favorable substitution was nitro at position 6 of the indole ring (compound <b>36</b>), conferring EC<sub>50</sub> 1.6 μM against HCV 1b and 2.57 μΜ against HCV 1a, with a high selectivity index. Compound <b>52</b>, carrying the acetohydroxamic acid functionality (-CH<sub>2</sub>CONHOH) on the imidic nitrogen, and compound <b>78</b>, the methyl-substituted molecule at the position 4 indolediketopiperazine counterpart, were the most effective against DENV and YFV, respectively. Interestingly, compound <b>36</b> had a high genetic barrier to resistance and only one resistance mutation was detected, T181I in NS5B, suggesting that the compound target HCV RdRp is in accordance with our predicted model.

SUDS3
Also flagged:histonechromatinlocalizationsChromatin remodelerreverse transcriptasepolymerase
Journal Article 2024-08-01 ✓ 5 Snippets Vlasova O, Antonova I, Zenkov R, Naberezhnov D, Belitsky G, Borunova A, Zabotina T, García-Gomis D, Safina A, Gurova K, Gudkov A, Kirsanov K, Jordan A, Yakubovskaya M.
In-Text Gene Mentions

…of the studiedlinker histoneshistones showing some…

…the cell nuclei,linker histoneshistones localization in…

…content of thelinker histoneshistones H1.2 and…

…relative contents oflinker histoneshistones H1.2 and…

…Noteworthy, thatlinker histoneshistones H1.2-H1.3-H1.5 deplet…

Show Full Abstract

<h4>Background</h4>Many plant secondary metabolites (PSMs) were shown to intercalate into DNA helix or interact with DNA grooves. This may influence histone-DNA interactions changeing chromatin structure and genome functioning.<h4>Methods</h4>Nucleosome stability and linker histone H1.2, H1.4 and H1.5 localizations were studied in HeLa cells after the treatment with 15 PSMs, which are DNA-binders and possess anticancer activity according to published data. Chromatin remodeler CBL0137 was used as a control. Effects of PSMs were studied using fluorescent microscopy, flowcytometry, quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), western-blotting.<h4>Results</h4>We showed that 1-hour treatment with CBL0137 strongly inhibited DNA synthesis and caused intensive linker histone depletion consistent with nucleosome destabilization. None of PSMs caused nucleosome destabilization, while most of them demonstrated significant influence on linker histone localizations. In particular, cell treatment with 11 PSMs at non-toxic concentrations induced significant translocation of the histone H1.5 to nucleoli and most of PSMs caused depletion of the histones H1.2 and H1.4 from chromatin fraction. Curcumin, resveratrol, berberine, naringenin, and quercetin caused significant redistribution of all three variants of the studied linker histones showing some overlap of PSM effects on linker histone DNA-binding. We demonstrated that PSMs, which induced the most significant redistribution of the histone H1.5 (berberine, curcumin and naringenin), influence the proportion of cells synthesizing DNA, expressing or non-expressing cyclin B and influence cell cycle distribution. Berberine induction of H1.5 translocations to nucleoli was shown to occur independently on the phases of cell cycle (metaphase was not analyzed).<h4>Conclusions</h4>For the first time we revealed PSM influence on linker histone location in cell nuclei that opens a new direction of PSM research as anticancer agents.

HFE
Also flagged:Portal hypertensionliver cirrhosisanemiahematocheziaGastrointestinal Bleedingchronic liver diseases
Journal Article 2024-08-01 ✓ 1 Snippet Abosheaishaa H, Abdelhalim O, Hegazy Y, Abdelwahed A, Ahmed N, Nassar M.
In-Text Gene Mentions

…Wilson's disease, andhemochromatosis), and hereditary abnormalitie…

Show Full Abstract

Portal hypertension is a major complication of liver cirrhosis, leading to various life-threatening conditions. The most common of these is the formation and bleeding of varices at the portosystemic anastomosis. Varices are most commonly esophageal or gastric and less commonly ectopic. Although ectopic varices are rare, they should be considered as a cause of obscure gastrointestinal bleeding in cirrhotic patients. We present a case of ruptured ectopic varices in the small intestine of a known cirrhotic patient who presented with anemia and melena, alternated with hematochezia. The case was managed with Histoacryl<sup>®</sup> injection using push enteroscopy, resulting in adequate hemostasis.

Also flagged:Met1methioninelysineubiquitinHOIPSHARPIN
Journal Article 2024-08-01 No Snippets Guo Y, Zhao Y, Cong YS.
Show Full Abstract

Met1-linked ubiquitination (Met1-Ub), also known as linear ubiquitination, is a newly identified atypical type of polyubiquitination that is assembled via the N-terminal methionine (Met1) rather than an internal lysine (Lys) residue of ubiquitin. The linear ubiquitin chain assembly complex (LUBAC) composed of HOIP, HOIL-1L and SHARPIN is the sole E3 ubiquitin ligase that specifically generates Met1-linked ubiquitin chains. The physiological role of LUBAC-mediated Met1-Ub has been first described as activating NF-κB signaling through the Met1-Ub modification of NEMO. However, accumulating evidence shows that Met1-Ub is broadly involved in other cellular pathways including MAPK, Wnt/β-Catenin, PI3K/AKT and interferon signaling, and participates in various cellular processes including angiogenesis, protein quality control and autophagy, suggesting that Met1-Ub harbors a potent signaling capacity. Here, we review the formation and cellular functions of Met1-linked ubiquitin chains, with an emphasis on the recent advances in the cellular mechanisms by which Met1-Ub controls signaling transduction.

Also flagged:erythropoiesissodiumoxygenacetylcholineironwater
Journal Article 2024-08-01 No Snippets Cubel C, Fischer M, Stampe D, Klaris MB, Bruun TR, Lundby C, Nordsborg NB, Nybo L.
Show Full Abstract

Short-term heat acclimation (HA) appears adequate for maximizing sudomotor adaptations and enhancing thermal resilience in trained athletes. However, for enhanced erythropoiesis and transfer effects to exercise capacity in cooler environments, prolonged HA appears necessary. To establish the time-course for physiological adaptations and performance effects, 20 male elite cyclists were divided into an intervention group (HEAT; <i>n</i> = 10) completing 5 weeks of HA (six one-hour HA-training sessions per week) and control (<i>n</i> = 10) tested pre and post in hot (40°C) and cool conditions (20°C). HEAT completed tests at 40°C every week during HA with measures of sweat rate and [Na<sup>+</sup>] and a decay test 2 weeks after termination of HA. HEAT improved time for exhaustion by 15 min (<i>p</i> < 0.001) in the 40°C test, increased sweat rate by 0.44 L/hour (<i>p</i> < 0.001), and lowered sweat sodium concentration [Na<sup>+</sup>] by 14.1 mmol/L (<i>p</i> = 0.006) from pre- to post-HA, with performance returning to pre-HA levels in the 2-week decay test. Total hemoglobin mass (tHb<sub>mass</sub>) was increased by 30 grams (+3%, <i>p</i> = 0.048) after 3 weeks and 40 grams (+4%, <i>p</i> = 0.038) after 5 weeks in HEAT but returned to pre-HA levels at the 2-week decay test. HEAT improved incremental peak power output (+12 W, <i>p</i> = 0.001) without significant changes in maximal oxygen uptake (<i>p</i> = 0.094). In conclusion, improvements in heat exercise tolerance and sudomotor adaptations materialized during the first ~3 weeks and the entire 5 weeks of HA augmented both cool exercise capacity and tHb<sub>mass</sub>. However, the 2-week post-HA evaluation demonstrated a rapid decay of physiological adaptations and exercise capacity in the heat.

Also flagged:DoxorubicinanthracyclinewaterCreatine KinaseCK-MBLactate Dehydrogenase
Journal Article 2024-08-01 No Snippets Nimbal SK, Nagashettikoppa K, Jeedi NM, Patil SB, Mali N.
Show Full Abstract

The doxorubicin, an anthracycline derivative, is a cytotoxic agent with proven efficacy in various malignancies. The clinical utility has been limited due to its dose -dependent cardiac toxicity. To evaluate the role of <i>Chlorophytum Borivilianum</i> L. on doxorubicin-induced cardiotoxicity in rats and to predict the role of <i>Chlorophytum Borivilianum</i> L. by <i>Insilico</i> and in vivo methods. Invitro studies were conducted on <i>Chlorophytum Borivilianum</i> L. Cardiotoxicity was produced by administration of doxorubicin (Dox-15 mg/kg ip. for two weeks). Ethanolic extract and fractions of <i>Chlorophytum Borivilianum</i> L. (250 and 500 mg/kg, p.o.) were administered as pretreatment for 15 days followed by Doxorubicin 2.5 mg/kg i.p. on alternate day for two weeks. The parameters like body weight, food and water consumption, cardiac specific markers like Creatine Kinase (CK-MB), Lactate Dehydrogenase (LDH) and Cardiac Troponin-I (cTnl), ECG changes, antioxidant parameters like superoxide dismutase (SOD), glutathione (GSH), catalase (CAT) and lipid peroxidation (MDA) were monitored. Histopathological studies of the heart were also performed to evaluate myocardial toxicity. Dox treatment results in cardiomyopathy characterised by elevated cardiac biomarkers and deficiency of antioxidant enzymes. By reducing the elevated levels of biomarker enzymes like LDH and CK-MB and the absence of cTnI, pretreatment with the EECB (500mg/kg) significantly protected the myocardium from the toxic effects of Dox. In addition, the EECB increased the reduced levels of GSH, SOD, and CAT while decreasing the elevated levels of malondialdehyde (MDA) in cardiac tissue.

Also flagged:BuprenorphineOpioid Use DisordermethadoneNaltrexoneu-opioid receptorMAT
Journal Article 2024-08-01 No Snippets Tolba H, Foad W, Ameri A, Abdullah S, El Hayek S.
Show Full Abstract

No abstract available.

Also flagged:Hyperprolactinaemiamineralintellectual disabilityIDosteoporosisprolactin
Journal Article 2024-08-01 No Snippets Healy S, Patel R.
Show Full Abstract

No abstract available.

HTT
Also flagged:Huntington's DiseaseHDautosomal dominant neurodegenerative disordernucleotideaggressiondepression
Journal Article 2024-08-01 ✓ 1 Snippet Gupta-Jessop T, Caldwell-Dunn E.
In-Text Gene Mentions

…the huntingtin gene (HTT).…

Show Full Abstract

No abstract available.

bioRxiv 2024-08-01 Preprint (No Snippets API) Zhao H, Shu L, Liu F, Lin E, Xia S, Wang B, Wang M, Shan F, Lin Y, Zhang L, Gu Y, Blobel GA, Zhang H.
Show Full Abstract

Mammalian genomes are folded by the distinct actions of SMC complexes which include the chromatin loop-extruding cohesin, the sister-chromatid cohesive cohesin, and the mitotic chromosome-associated condensins. While these complexes function at different stages of the cell cycle, they co-exist on chromatin during the G2/M-phase transition, when genome structure undergoes a dramatic reorganization. Yet, how distinct SMC complexes affect each other and how their mutual interplay orchestrates the dynamic folding of 3D genome remains elusive. Here, we engineered all possible cohesin/condensin configurations on mitotic chromosomes to delineate the concerted, mutual influential action of SMC complexes. We find that: (i) The mitotic SMC complex condensin disrupts the focal accumulation of extrusive-cohesin at CTCF binding sites, thereby promoting the disassembly of interphase TADs and chromatin loops during mitotic progression. Conversely, extrusive-cohesin can impair condensin activity and alter mitotic chromosome helicity. (ii) Condensin diminishes cohesive-cohesin focal enrichment and, conversely, cohesive-cohesin can counteract condensin function and impede mitotic chromosome longitudinal shortening. (iii) The co-presence of extrusive- and cohesive-cohesin synergistically antagonizes condensin function and dramatically delays mitotic chromosome condensation. (iv) Extrusive-cohesin positions cohesive-cohesin at CTCF binding sites. However, cohesive-cohesin by itself is insufficient to mediate the formation of TADs or chromatin loop, implying non-overlapping function with extrusive-cohesin. Instead, cohesive-cohesin restricts chromatin loop expansion, potentially by limiting extrusive-cohesin movement. Collectively, our data describe a comprehensive three-way interplay among major SMC complexes that dynamically sculpts chromatin architecture during cell cycle progression.