Gene Literature Dashboard

Viewing November 2024 — 743 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← October 2024 December 2024 →
Also flagged:mineralizationcollagenhyperphosphatemiaextracellularhydroxyapatitecalcium
Journal Article 2024-11-30 No Snippets Poorhemati H, Komarova SV.
Show Full Abstract

Bone mineralization is a complex process tightly regulated by both biological factors such as collagen maturation as well as physicochemical factors such as pH. A previous model of biological mineralization captured the biological regulation of bone mineralization dynamics, but not the impact of bone microenvironment such as ion availabilities which may be altered in hypo or hyperphosphatemia. To build an integrated model of bone mineralization, we utilized two previously developed models which addressed a distinct aspect of bone mineralization. The first model described the processes of the extracellular matrix formation and maturation, inhibitor and nucleator formation and removal and their combined action in regulating bone mineralization. The second model simulated the bone interstitial fluid (BIF) permissive to precipitation of hydroxyapatite and described the physicochemical process of hydroxyapatite precipitation. The resulting bone mineralization model accounts for biological and physicochemical aspects of the process. The integrated model was analyzed for the impact of physicochemical factors (pH, levels of calcium and phosphate) on the mineralization dynamics. Model predictions were compared to experimental findings using two outcomes characterizing mineralization dynamics: mineralization delay that corresponds to histomorphometry measures of osteoid volume or thickness, and mineralization degree that corresponds to bone mineral density distribution. We identified the limitation of the previously developed model in predicting the mineralization delay observed in the situations of hypophosphatemia and hypocalcemia and proposed a model adaptation that predicts these outcomes. The resulting mathematical model can be used for in silico testing of hypotheses regarding the role of different physicochemical, molecular, or cellular factors in causing a specific disruption in mineralization dynamics.

Also flagged:tryptophanmetabolismnicotinamide adenine dinucleotideADCognitionDementia
Journal Article 2024-11-30 No Snippets Choe K, Ali M, Lardenoije R, Riemens RJM, Pishva E, Bickel H, Weyerer S, Hoffmann P, Pentzek M, Riedel-Heller S, Wiese B, Scherer M, Wagner M, Mastroeni D, Coleman PD, Ramirez A, Ramakers IHGB, Verhey FRJ, Rutten BPF, Kenis G, van den Hove DLA.
Show Full Abstract

<h4>Background</h4>Neurodegenerative disorders, including Alzheimer's disease (AD), have been linked to alterations in tryptophan (TRP) metabolism. However, no studies to date have systematically explored changes in the TRP pathway at both transcriptional and epigenetic levels. This study aimed to investigate transcriptomic, DNA methylomic (5mC) and hydroxymethylomic (5hmC) changes within genes involved in the TRP and nicotinamide adenine dinucleotide (NAD) pathways in AD, using three independent cohorts.<h4>Methods</h4>DNA derived from post-mortem middle temporal gyrus (MTG) tissue from AD patients (n = 45) and age-matched controls (n = 35) was analyzed, along with DNA derived from blood samples from two independent cohorts: the German Study on Ageing, Cognition, and Dementia in Primary Care Patients (AgeCoDe) cohort (n = 96) and the Dutch BioBank Alzheimer Center Limburg (BBACL) cohort (n = 262). Molecular profiling, including assessing mRNA expression and DNA (hydroxy)methylation levels, was conducted using HumanHT-12 v4 Expression BeadChip and HM 450 K BeadChip arrays, respectively. Functional interactions between genes and identification of common phenotype-specific positive and negative elementary circuits were conducted using computational modeling, i.e. gene regulatory network (GRN) and network perturbational analysis. DNA methylation of IDO2 (cg11251498) was analyzed using pyrosequencing.<h4>Results</h4>Twelve TRP- and twenty NAD-associated genes were found to be differentially expressed in the MTG of AD patients. Gene sets associated in the kynurenine pathway, the most common TRP pathway, and NAD pathway, showed enrichment at the mRNA expression level. Downstream analyses integrating data on gene expression, DNA (hydroxy)methylation, and AD pathology, as well as GRN and network perturbation analyses, identified IDO2, an immune regulatory gene, as a key candidate in AD. Notably, one CpG site in IDO2 (cg11251498) exhibited significant methylation differences between AD converters and non-converters in the AgeCoDe cohort.<h4>Conclusion</h4>These findings reveal substantial transcriptional and epigenetic alterations in TRP- and NAD-pathway-associated genes in AD, highlighting IDO2 as a key candidate gene for further investigation. These genes and their encoded proteins hold potential as novel biomarkers and therapeutic targets for AD.

Also flagged:5-Fluorouracilpathogenesismucositistranscription factorsinsulin-like growth factor 1insulin receptor substrate 1
Journal Article 2024-11-30 No Snippets Ivanov SM, Zgoda VG, Isakova VA, Trukhanova LS, Poroikov VV, Shtil AA.
Show Full Abstract

<b>Background/Objectives.</b> Damage of the gastrointestinal mucosa is a major side effect of the anticancer drug 5-fluorouracil (5-FU). Insight into the molecular pathogenesis of 5-FU-induced gut mucositis is expected to justify the strategies of prophylaxis. <b>Methods.</b> We analyzed intestinal specimens obtained from Balb/c mice treated with 70 mg/kg 5-FU daily for up to 6 days. <b>Results.</b> Manifestations of mucositis in the ileum and the colon included diarrhea, weight loss, and morphological lesions. The proteomic analysis revealed dozens of differentially expressed proteins governed by a set of master regulator proteins that regulated downstream pathways culminating in the complexes of specific transcription factors. Among the most important mechanisms of 5-FU-induced gut damage predicted by bioinformatics tools was stimulation of insulin-like growth factor 1 concomitant with inhibition of insulin receptor substrate 1, suggesting an involvement of the insulin pathway. Furthermore, the levels of 14-3-3γ protein and epinephrin B2 tyrosine kinase were interpreted as key inhibitory effects of 5-FU. These changes were detectable in the ileum as well as in the colon, pointing to the commonality of 5-FU responses across the gut. <b>Conclusion.</b> These results demonstrated a hierarchical network of gut injury mechanisms differentially regulated in the course of the emergence of 5-FU-induced mucositis.

HFE
Also flagged:Steatotic Liver DiseaseAMPKNAFLDchronic liver diseasemetabolic dysfunction-chlorogenic acid
Journal Article 2024-11-30 ✓ 1 Snippet Gu MJ, Ahn Y, Lee YR, Yoo G, Kim Y, Choi I, Ha SK, Kim D.
In-Text Gene Mentions

…type 2 diabetes,hemochromatosis, and heart disease…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease. In recent times, the term NAFLD has been modified to metabolic dysfunction-associated steatotic liver disease (MASLD), reflecting its comprehensive scope encompassing a range of metabolic abnormalities. <i>Coriandrum sativum</i> L. (CS) is a traditional medicine, although the preventive mechanism of CS extracts remains unclear.<h4>Objective</h4>This study evaluated the preventive effects of CS in high-fat diet (HFD)-induced MASLD mice by oral administration of 100 or 200 mg/kg/day of CS extracts for 12 weeks.<h4>Results</h4>The major CS extract compounds were chlorogenic acid, caffeic acid, rutin, and isoquercetin. The administration of CS extract suppressed HFD-induced weight gain, liver weight, and the liver/body weight ratio. It improved the mice's serum biological profiles and suppressed HFD-induced lipid droplet and lipid accumulation by inhibiting lipid accumulation-related gene expression in the liver. It modulated HFD-induced Ampk-Srebp1c pathways and suppressed HFD-induced NF-κB pathway activation in the liver. It regulated inflammation and the AMPK alpha signaling pathway in HFD-fed mice by reducing the accumulation of specific amino acids, leading to the amelioration of fatty liver.<h4>Conclusions</h4>The CS extract prevents HFD-induced MASLD and may help prevent or treat MASLD.

Also flagged:cytoplasmicHCN1HCN2hyperpolarizationcationHCN 1
Journal Article 2024-11-30 No Snippets Song Y, Gao L.
Show Full Abstract

In vitro experiments performed on dissociated dorsal root ganglion (DRG) neurons suggest the involvement of the hyperpolarization-activated cation current (I<sub>h</sub>) in enhancing neuronal excitability, potentially contributing to neuropathic pain. However, the more confirmative in vivo information about how nerve injury interacts with I<sub>h</sub> is lacking. In this study, I<sub>h</sub> was recorded in vivo using the dynamic single-electrode voltage clamp (dSEVC) technique on L5 DRG neurons of normal rats and those seven days after spinal nerve axotomy (SNA). Compared to normal rats, SNA unexpectedly inhibited the activity of I<sub>h</sub> channels on A-fiber DRG neurons: (a) the I<sub>h</sub> current magnitude, density, and conductance were consistently diminished; and (b) the I<sub>h</sub> activation velocity was slowed and the voltage for I<sub>h</sub> activation was hyperpolarized. The half-activation voltage (V<sub>0.5</sub>) exhibited a negative shift, and the time constant for I<sub>h</sub> activation was prolonged across all test potentials, indicating the reduced availability of I<sub>h</sub> after SNA. To further investigate the mechanisms of SNA on I<sub>h</sub>, the underlying HCN channels and the correlated mRNA were quantified and compared. The mRNA expression level of <i>HCN</i>1-4 was uniformly enhanced after SNA, which might have contributed to the increased cytoplasmic HCN1 intensity observed in both medium- and large-sized DRG neurons. This finding contradicted the functional reduction of I<sub>h</sub> after SNA. Surprisingly, the HCN labeling pattern was altered after SNA: the labeling area of HCN1 and HCN2 at the membranous ring region of the axotomized large neurons became significantly thinner or absent. We concluded that the diminished ring immunoreactivity for HCN1 and HCN2 correlated with a reduced availability of I<sub>h</sub> channels, elucidating the observed decrease in I<sub>h</sub> in axotomized A-fiber neurons.

Also flagged:cancerdiabetescardiovascular diseaseschronic diseasesBRCABRCA1
Journal Article 2024-11-30 No Snippets Molla G, Bitew M.
Show Full Abstract

The field of personalized medicine is undergoing a transformative shift through the integration of multi-omics data, which mainly encompasses genomics, transcriptomics, proteomics, and metabolomics. This synergy allows for a comprehensive understanding of individual health by analyzing genetic, molecular, and biochemical profiles. The generation and integration of multi-omics data enable more precise and tailored therapeutic strategies, improving the efficacy of treatments and reducing adverse effects. However, several challenges hinder the full realization of personalized medicine. Key hurdles include the complexity of data integration across different omics layers, the need for advanced computational tools, and the high cost of comprehensive data generation. Additionally, issues related to data privacy, standardization, and the need for robust validation in diverse populations remain significant obstacles. Looking ahead, the future of personalized medicine promises advancements in technology and methodologies that will address these challenges. Emerging innovations in data analytics, machine learning, and high-throughput sequencing are expected to enhance the integration of multi-omics data, making personalized medicine more accessible and effective. Collaborative efforts among researchers, clinicians, and industry stakeholders are crucial to overcoming these hurdles and fully harnessing the potential of multi-omics for individualized healthcare.

DCC
Also flagged:transposonsmetalschromosomechromatintranscriptional factorbinding
Journal Article 2024-11-30 ✓ 1 Snippet Gan Y, Wang L, Liu G, Guo X, Zhou Y, Chang K, Zhang Z, Yan F, Liu Q, Chen B.
In-Text Gene Mentions

…Dosage Compensation Complex (DCC) in Drosophila […

Show Full Abstract

<b>Background</b>: Transposable elements (TEs) and noncoding sequences are major components of the genome, yet their functional contributions to long noncoding RNAs (lncRNAs) are not well understood. Although many lncRNAs originating from TEs (TE-lncRNAs) have been identified across various organisms, their characteristics and regulatory roles, particularly in insects, remain largely unexplored. This study integrated multi-omics data to investigate TE-lncRNAs in <i>D. melanogaster</i>, focusing on the influence of transposons across different omics levels. <b>Results</b>: We identified 16,118 transposons overlapping with lncRNA sequences that constitute 2119 TE-lncRNAs (40.4% of all lncRNAs) using 256 public RNA-seq samples and 15 lncRNA-seq samples of <i>Drosophila</i> S2 cells treated with heavy metals. Of these, 67.2% of TE-lncRNAs contain more than one TE. The LTR/Gypsy family was the most common transposon insertion. Transposons preferred to insert into promoters, transcription starting sites, and intronic regions, especially in chromosome ends. Compared with lncRNAs, TE-lncRNAs showed longer lengths, a lower conservation, and lower levels but a higher specificity of expression. Multi-omics data analysis revealed positive correlations between transposon insertions and chromatin openness at the pre-transcriptional level. Notably, a total of 516 TE-lncRNAs provided transcriptional factor binding sites through transposon insertions. The regulatory network of a key transcription factor was rewired by transposons, potentially recruiting other transcription factors to exert regulatory functions under heavy metal stress. Additionally, 99 TE-lncRNAs were associated with m<sup>6</sup>A methylation modification sites, and 115 TE-lncRNAs potentially provided candidate small open reading frames through transposon insertions. <b>Conclusions</b>: Our data analysis demonstrated that TEs contribute to the regulation of lncRNAs. TEs not only promote the transcriptional regulation of lncRNAs, but also facilitate their post-transcriptional and epigenetic regulation.

HFE
Also flagged:inflammatory bowel diseasedeathgastrointestinal diseaserespiratory diseasesPrimary sclerosing cholangitisdisease of the bile ducts
Journal Article 2024-11-30 ✓ 1 Snippet Leung KK, Li W, Hansen B, Gulamhusein A, Lapointe-Shaw L, Shaheen AA, Ricciuto A, Benchimol EI, Flemming JA, Hirschfield GM.
In-Text Gene Mentions

…were used forhemochromatosis, alpha-1-antitrypsin deficien…

Show Full Abstract

<h4>Background & aims</h4>Primary sclerosing cholangitis (PSC) carries significant morbidity and mortality compared with inflammatory bowel disease (IBD). We characterized epidemiology trends and outcomes in those with PSC-IBD and IBD, paying particular attention to the impact of PSC-IBD diagnostic sequence on outcomes.<h4>Methods</h4>Incidence and prevalence of PSC-IBD and IBD (2002-2018) were evaluated using validated health administrative data-derived cohorts from Ontario, Canada (population ∼15 million). Transplant and death outcomes were assessed, with PSC-IBD diagnostic sequence as the exposure of interest.<h4>Results</h4>Incidence of PSC-IBD and IBD was 0.46 and 24.6/100,000 person-years (PYs) respectively, whereas prevalence was 5.53 and 588/100,000 PY respectively. Incidence/prevalence of PSC-IBD increased over time, unlike for IBD. Age at IBD diagnosis was earlier among those with PSC-IBD compared with those with IBD alone. Higher socioeconomic status associated with high PSC-IBD incidence rates and fastest incidence rise. Those diagnosed with IBD before PSC had higher risk of transplant/death compared with PSC before IBD (hazard ratio [HR] 1.34, 95% CI 1.02-1.75), driven by an increased risk of death (HR 2.73, 95% CI 1.68-4.45). PSC-IBD had a 4.5-fold greater risk of transplant/death compared with IBD alone. Liver-related and luminal gastrointestinal disease, particularly hepatopancreatobiliary malignancy, were predominant causes of death among those with PSC-IBD, while cardiovascular and respiratory diseases were predominant among those with IBD.<h4>Conclusions</h4>Population-level data support distinct epidemiological patterns among people living with PSC-IBD compared with IBD, including a higher socioeconomic status and worse outcomes in those found to have IBD before PSC.<h4>Impact and implications</h4>Individuals with primary sclerosing cholangitis (PSC) face increased morbidity and mortality compared with the general population and those with inflammatory bowel disease (IBD); yet, most individuals with PSC are found to have concomitant IBD during their lifetime. This study describes the distinctive epidemiological differences and mortality trends at the population level between PSC-IBD and IBD. While PSC-IBD remains a rare condition, diagnoses are on the rise (particularly among higher socioeconomic status populations), with most patients being diagnosed with IBD before PSC; this group also experienced higher mortality post-PSC diagnosis compared with those diagnosed with PSC first, with a large proportion of deaths caused by liver- and gut-related causes. Practical applications of these findings include further studies to evaluate whether earlier identification of PSC-IBD affects disease outcomes, as well as educating patients, clinicians, and policymakers on the importance of recognizing PSC-IBD as a distinct entity from IBD alone.

HFE
Also flagged:Hepatic FibrosisHBeAgChronic Hepatitis B Virus Infectionhepatitis B e antigenfibrosischronic
Journal Article 2024-11-30 ✓ 1 Snippet Al-Shuaili HH, Al Mashikhi B, Al Sinani A, Alwassief A, Al-Busafi SA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objectives</h4>Hepatic fibrosis remains a potential complication for hepatitis B e antigen (HBeAg)-negative chronic hepatitis B virus (HBV) infection. The affected individuals, known as inactive HBV carriers, tend to have a favorable prognosis. This study aimed to determine the prevalence of significant fibrosis and associated risk factors among Omani patients diagnosed as inactive HBV carriers.<h4>Methods</h4>A retrospective study was conducted on Omani inactive HBV carriers visiting a tertiary hospital in Muscat, Oman, between January 2017 and December 2018. Significant hepatic fibrosis (stage F2 or higher) was identified using two-dimensional shear-wave elastography, with baseline clinical, laboratory, and radiological data analyzed for associations.<h4>Results</h4>Among the selected 200 participants (mean age = 44.6 ± 9.3 years), 53.0% were male. Significant fibrosis was present in 40 (20.0%) patients, with a preponderance of male (<i>p =</i>0.007) and those aged ≥ 60 years (<i>p =</i>0.024). Fatty changes, as detected by liver ultrasound, were independent risk factors (<i>p =</i>0.044).<h4>Conclusions</h4>The findings underscore the importance of periodic assessment and monitoring of inactive HBV carriers in Oman, particularly those with risk factors for fibrosis progression, such as male sex, older age, and fatty liver. Non-invasive tests can aid in early detection and management of fibrosis, thereby improving patient outcomes.

Also flagged:tumororganizationdiffuse large B-cell lymphomastesticular diffuse large B-cell lymphomastesticular tumorsDLBCL
Journal Article 2024-11-30 No Snippets Wu X, Shi J, Lu M, Yun D, Gao S, Hu L, Sun F.
Show Full Abstract

Primary testicular diffuse large B-cell lymphomas (PT-DLBCL) are a collection of 1%-9% of testicular tumors. However, the characterization of the tumor microenvironment and spatial organization of PT-DLBCL is poorly understood. We profiled the transcriptomes of 19,559 single cells derived from a PT-DLBCL patient via single-cell RNA sequencing. We found that the tumor microenvironment was majorly composed of three exhausted CD8<sup>+</sup> T cell subpopulations and two B cell subpopulations, and the genetic heterogeneity was further analyzed. Then, transcription factors related to PT-DLBCL cell proliferation and development were identified. Our results demonstrated that inhibiting E2F and CREB could decrease cell proliferation, induce apoptosis in human B-lymphoma cells, and inhibit tumor growth in xenograft testicular DLBCL models. Subsequently, chromatin immunoprecipitation sequencing was performed to identify the enriched loci of E2F and CREB that regulate human B-lymphoma cell proliferation and apoptosis. To annotate the precise spatial cellular composition of testicular DLBCL, we performed spatial transcriptomics. The spatial organization of PT-DLBCL, especially the spatial location of exhausted CD8<sup>+</sup> T and B cells, was identified. Concurrently, we delineated the expression patterns of key genes, including MALAT1, RPS3A, RPS7, RPS23, RPS27A, IGHM, HINT1, and HSPA8, across various regions. In this study, we unveiled the spatial architecture of the tumor microenvironment in DLBCL, where exhausted T cells were strategically positioned around tumor B cells, and macrophages, in turn, encircled the exhausted T cells. Inhibition of E2F and CREB in the tumor microenvironment may be a novel therapeutic option for testicular DLBCL patients.

Also flagged:wound healingClustered regularly interspaced shortdegenerative diseasestissue developmentclustered regularly interspaced short palindromic repeatsCRISPR-associated (Cas)
Journal Article 2024-11-30 No Snippets Farag VE, Devey EA, Leong KW.
Show Full Abstract

The potential of regenerative medicine in the clinical space is vast, given its ability to repair and replace damaged tissues, restore lost functions due to age or disease, and transform personalized therapy. Traditional regenerative medicine and tissue engineering strategies have created specialized tissues using progenitor cells and various biological stimuli. To date, there are many US Food and Drug Administration (FDA)-approved regenerative medicine therapies, such as those for wound healing and orthopedic injuries. Nonetheless, these therapies face challenges, including off-target effects, a lack of precision, and failure to target the disease or injury at its origin. In search of novel, precise, and efficient alternatives, the regenerative medicine landscape is shifting towards genome engineering technologies, particularly gene editing. Clustered regularly interspaced short palindromic repeats (CRISPR)-based gene editing systems enable precise knock-ins, knockouts, transcriptional activation and repression, as well as specific base conversions. This advancement has allowed researchers to treat genetic and degenerative diseases, control cell fate for highly regulated tissue repair, and enhance tissue functions. In this review, we explore the progress and future prospects of CRISPR technologies in regenerative medicine, focusing on how gene editing has led to advanced therapeutic applications and served as a versatile research tool for understanding tissue development and disease progression.

OLFM4
Also flagged:Lgr5doxorubicinLy6aCluWNTanthracycline
Journal Article 2024-11-29 ✓ 1 Snippet Lee J, Gleizes A, Janto NV, Appell LL, Sun S, Takaesu F, Webster SF, Hailstock T, Barker N, Gracz AD.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Progenitors and mature cells can maintain the intestinal epithelium by dedifferentiation and facultative intestinal stem cell (fISC) function when active ISCs (aISCs) are lost to damage. Here, we modeled fISC activation in mouse intestinal organoids with doxorubicin (DXR) treatment, a chemotherapeutic known to ablate Lgr5+ aISCs in vivo. Similar fISC gene activation was observed between organoids treated with low versus high DXR, despite significantly decreased survival at the higher dose. aISCs exhibited dose-dependent loss after DXR treatment but survived at doses compatible with organoid survival. We ablated residual aISCs after DXR treatment using a Lgr52A-DTR allele and observed that aISC survival of the initial genotoxic insult is required for organoid survival following DXR treatment. These results suggest that although typical fISC genes are activated by DXR-induced injury in organoids, functional stemness remains dependent on the aISC pool. Finally, we show that human intestinal organoids require higher doses of DXR to induce loss of survival and downregulation of LGR5. Our data establish a reproducible model of DXR-induced injury in intestinal organoids and reveal differences in in vitro responses to an established in vivo damage modality.

Also flagged:solute carrier transportersSolute carrier (SLC) transporterscancerovarian cancerOCtumor
Journal Article 2024-11-29 No Snippets Quaresima B, Scicchitano S, Faniello MC, Mesuraca M.
Show Full Abstract

Solute carrier (SLC) transporters are involved in various biological processes associated with metabolic reprogramming and cancer, supporting the increased requirement of nutrients and energy. Over the past decade, there have been significant advancements in understanding the expression and function of SLCs in ovarian cancer (OC). This gynecological condition has a high mortality rate and limited treatment options; thus, early diagnosis remains a target clinically. OC exhibits complexity and heterogeneity, resulting in different clinical characteristics, resistance to chemotherapy drugs and poor prognosis. Additionally, SLCs have a different expression pattern between healthy and tumor tissue, and consequently, their inhibition or activation could modify signaling pathways involved in the tumor growth process, such as cell proliferation, apoptosis and drug accumulation. The present review aims to consolidate current data to provide a comprehensive understanding of the potential importance of SLCs in OC. Additionally, it seeks to offer guidance for further research on utilizing SLCs as prognostic biomarkers and therapeutic targets.

CA10
Also flagged:histoneIL-1RAIL-8CXCL8IL-18IL-27
Journal Article 2024-11-29 ✓ 1 Snippet Jung YS, Aguilera J, Kaushik A, Ha JW, Cansdale S, Yang E, Ahmed R, Lurmann F, Lutzker L, Hammond SK, Balmes J, Noth E, Burt TD, Aghaeepour N, Waldrop AR, Khatri P, Utz PJ, Rosenburg-Hasson Y, DeKruyff R, Maecker HT, Johnson MM, Nadeau KC.
In-Text Gene Mentions

…d Applications Center (SEDAC) (2024); 10.7927/G2N9-CA10. …

Show Full Abstract

Fine particulate matter (PM<sub>2.5</sub>) exposure can induce immune system pathology via epigenetic modification, affecting pregnancy outcomes. Our study investigated the association between PM<sub>2.5</sub> exposure and immune response, as well as epigenetic changes using high-dimensional epigenetic landscape profiling using cytometry by time-of-flight (EpiTOF) at the single cell. We found statistically significant associations between PM<sub>2.5</sub> exposure and levels of certain cytokines [interleukin-1RA (IL-1RA), IL-8/CXCL8, IL-18, and IL-27)] and histone posttranslational modifications (HPTMs) in immune cells (HPTMs: H3K9ac, H3K23ac, H3K27ac, H2BK120ub, H4K20me1/3, and H3K9me1/2) among pregnant and nonpregnant women. The cord blood of neonates with high maternal PM<sub>2.5</sub> exposure showed lower IL-27 than those with low exposure. Furthermore, PM<sub>2.5</sub> exposure affects the co-modification profiles of cytokines between pregnant women and their neonates, along with HPTMs in each immune cell type between pregnant and nonpregnant women. These modifications in specific histones and cytokines could indicate the toxicological mechanism of PM<sub>2.5</sub> exposure in inflammation, inflammasome pathway, and pregnancy complications.

PRDX6
Also flagged:obesitychromatinhistonemethylationmetabolic diseasehistone H3
Journal Article 2024-11-29 ✓ 1 Snippet Pepin AS, Jazwiec PA, Dumeaux V, Sloboda DM, Kimmins S.
In-Text Gene Mentions

…Hox gene family),Prdx6(peroxiredoxin 6, an…

Show Full Abstract

Paternal obesity has been implicated in adult-onset metabolic disease in offspring. However, the molecular mechanisms driving these paternal effects and the developmental processes involved remain poorly understood. One underexplored possibility is the role of paternally induced effects on placenta development and function. To address this, we investigated paternal high-fat diet-induced obesity in relation to sperm histone H3 lysine 4 tri-methylation signatures, the placenta transcriptome, and cellular composition. C57BL6/J male mice were fed either a control or high-fat diet for 10 weeks beginning at 6 weeks of age. Males were timed-mated with control-fed C57BL6/J females to generate pregnancies, followed by collection of sperm, and placentas at embryonic day (E)14.5. Chromatin immunoprecipitation targeting histone H3 lysine 4 tri-methylation (H3K4me3) followed by sequencing (ChIP-seq) was performed on sperm to define obesity-associated changes in enrichment. Paternal obesity corresponded with altered sperm H3K4me3 at promoters of genes involved in metabolism and development. Notably, altered sperm H3K4me3 was also localized at placental enhancers. Bulk RNA-sequencing on placentas revealed paternal obesity-associated sex-specific changes in expression of genes involved in hypoxic processes such as angiogenesis, nutrient transport, and imprinted genes, with a subset of de-regulated genes showing changes in H3K4me3 in sperm at corresponding promoters. Paternal obesity was also linked to impaired placenta development; specifically, a deconvolution analysis revealed altered trophoblast cell lineage specification. These findings implicate paternal obesity effects on placenta development and function as one potential developmental route to offspring metabolic disease.

Also flagged:squamous cell carcinomasHead and neck squamous cell carcinomaHNSCCcancerTP53CDKN2A
Journal Article 2024-11-29 No Snippets Nadal A, Cardesa A, Agaimy A, Almangush A, Franchi A, Hellquist H, Leivo I, Zidar N, Ferlito A.
Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and is a cause of significant mortality and morbidity. The epidemiology of this cancer varies worldwide due to either genetic differences in populations or differences in carcinogen exposure. The application of massive parallel sequencing-based techniques in HNSCC should provide a helpful understanding of the genetic alterations that eventually lead to HNSCC development and progression, and ideally, could be used for personalized therapy. In this review, the reader will find an overview of the mutational profile of conventional HNSCC according to published results on massive parallel sequencing data that confirm the pivotal role of TP53 and the frequent involvement of CDKN2A and PIK3CA. The reader will also find a more detailed description of the genes, such as NOTCH1 and FBXW7, that were not identified in HNSCCs before the development of these techniques, the differences that can be site-specific, such as the different mutational signatures that indicate specific carcinogens for various subsites of the head and neck, and finally, the actionability of these findings that should allow more personalized therapy for patients.

PLCL1
Also flagged:sleepmental health disordersmental disorderanxietydepressionbehavioral
Journal Article 2024-11-29 ✓ 1 Snippet Grigsby-Toussaint DS, Shin JC, Acevedo AR, Kemball-Cook W, Story D, Katz A, Nwanaji-Enwerem U, Evans G, Johnson A, Ury B, Romero-Ramos YM, Yang J, Barker DM, McGeary JE, Dunsiger SI.
In-Text Gene Mentions

…include PDE4D ,PLCL1, GNG12 ,…

Show Full Abstract

<h4>Background</h4>The prevention of pediatric mental health disorders is a growing health priority in the United States. While exposure to green space, such as outdoor vegetation, has been linked with improved mental health outcomes in children, little is known about the impact of green space on children's sleep. Sleep has many benefits, but the factors affecting both sleep and mental health as they relate to green space exposure are not well understood in children. This study aims to investigate how green space can affect sleep in children and contribute to the promotion of mental health and wellbeing.<h4>Methods</h4>Project Green Space, Sleep, and Mental Health (G-SPACE) aims to recruit 250 elementary school-children from first, second, and third grade in Rhode Island to examine the influence of green space exposure on sleep, physical activity, and mental health over a five-year period. Objective measures of sleep, physical activity, and daily activity space will be assessed using an actigraph and a GPS (Global Positioning System) unit. Subjective measures of sleep duration, sleep quality, and mental health will be assessed using daily sleep diaries from parents, in addition to a range of survey items, including PROMIS<sup>®</sup> (Patient Reported Outcome Measurement Information System) pediatric scales, and the Children's Sleep Habits questionnaire, among others. Green space exposure will be based on measures of green space from the normalized difference vegetation index (NDVI) aligned with the daily activity trajectory of children. Additionally, saliva and DNA samples will be collected to examine epigenetic mechanisms linking green space to sleep and mental health. A subset of participants (n = 50) will be followed longitudinally to evaluate the long-term impact of green space on sleep and mental health among children. Multi-level models will be used to assess the association between green space exposure, sleep behaviors, and mental health.<h4>Discussion</h4>Project G-SPACE will evaluate whether green space utilization influences sleep and mental health in early elementary school children, and the possible mechanistic pathways through which these associations emerge.

HTT
Also flagged:HDcognitionasautosomal dominant neurodegenerative disease-19health
Journal Article 2024-11-29 ✓ 1 Snippet van Lonkhuizen PJC, Heemskerk AW, Slutter L, van Duijn E, de Bot ST, Chavannes NH, Meijer E, HEALTHE-RND consortium.
In-Text Gene Mentions

…in the huntingtin (HTT) gene [ 11…

Show Full Abstract

<h4>Background</h4>Understanding quality of life (QoL) is important in diseases for which there is no cure to date, such as Huntington's disease (HD). A deeper level of understanding is, however, compromised by the lack of studies examining QoL from the perspectives of HD gene expansion carriers (HDGECs). Only a few qualitative studies on QoL in HD have been performed, yet none investigated how QoL is defined by HDGECs themselves.<h4>Objective</h4>This qualitative study explores how premanifest and manifest HDGECs define their QoL.<h4>Methods</h4>Online semi-structured interviews were conducted with 6 premanifest and 6 manifest HDGECs in the Netherlands. Qualitative content analysis was used to explore participants' QoL definitions via inductive coding and the subsequent formulation of (sub)categories and (sub)themes.<h4>Results</h4>Premanifest and manifest HDGECs had a different focus when defining QoL. Two subthemes were identified for premanifest HDGECs: Thoughts about a meaningful life regardless of HD and Concerns about the future progression and impact of HD. For manifest HDGECs, two other subthemes were identified: Coming to terms with HD and Shifting perspectives due to the impact of HD. One overall theme was generated, reflecting the difference and adaptive shift in focus between premanifest and manifest HDGECs: Shifting focus from ideality to reality.<h4>Conclusions</h4>In providing optimal care, HDGECs should be considered as part of a complex, continuously changing environment, thereby taking into account their individual QoL experiences and tailoring care accordingly. HDGECs might benefit from forming helpful beliefs about future adaptability and resilience and developing adaptive coping strategies.

SUDS3
Also flagged:Bohring-Opitz syndromeacute myeloid leukemiaAMLneurodevelopmental disorderadditional sex combs-like 1ASXL1
Journal Article 2024-11-29 ✓ 1 Snippet Lin I, Awamleh Z, Sinvhal M, Wan A, Bondhus L, Wei A, Russell BE, Weksberg R, Arboleda VA.
In-Text Gene Mentions

chromatin modifiersmodifiers), a class…

Show Full Abstract

<h4>Background</h4>Rare variants in epigenes (a.k.a. chromatin modifiers), a class of genes that control epigenetic regulation, are commonly identified in both pediatric neurodevelopmental syndromes and as somatic variants in cancer. However, little is known about the extent of the shared disruption of signaling pathways by the same epigene across different diseases. To address this, we study an epigene, Additional Sex Combs-like 1 (ASXL1), where truncating heterozygous variants cause Bohring-Opitz syndrome (BOS, OMIM #605039), a germline neurodevelopmental disorder, while somatic variants are driver events in acute myeloid leukemia (AML). No BOS patients have been reported to have AML.<h4>Methods</h4>This study explores common pathways dysregulated by ASXL1 variants in patients with BOS and AML. We analyzed whole blood transcriptomic and DNA methylation data from patients with BOS and AML with ASXL1-variant (AML-ASXL1) and examined differential exon usage and cell proportions.<h4>Results</h4>Our analyses identified common molecular signatures between BOS and AML-ASXL1 and highlighted key biomarkers, including VANGL2, GRIK5 and GREM2, that are dysregulated across samples with ASXL1 variants, regardless of disease type. Notably, our data revealed significant de-repression of posterior homeobox A (HOXA) genes and upregulation of Wnt-signaling and hematopoietic regulator HOXB4. While we discovered many shared epigenetic and transcriptomic features, we also identified differential splice isoforms in RUNX3 where the long isoform, p46, is preferentially expressed in BOS, while the shorter p44 isoform is expressed in AML-ASXL1.<h4>Conclusion</h4>Our findings highlight the strong effects of ASXL1 variants that supersede cell-type and even disease states. This is the first direct comparison of transcriptomic and methylation profiles driven by pathogenic variants in a chromatin modifier gene in distinct diseases. Similar to RASopathies, in which pathogenic variants in many genes lead to overlapping phenotypes that can be treated by inhibiting a common pathway, our data identifies common pathways for ASXL1 variants that can be targeted for both disease states. Comparative approaches of high-penetrance genetic variants across cell types and disease states can identify targetable pathways to treat multiple diseases. Finally, our work highlights the connections of epigenes, such as ASXL1, to an underlying stem-cell state in both early development and in malignancy.

Also flagged:AR
Journal Article 2024-11-29 No Snippets Schmitz MJ, Bashar A, Soman V, Nkrumah EAF, Al Mulla H, Darabi H, Wang J, Kiehl P, Sethi R, Dungan J, Gregg AR, Rajkovic A, Yatsenko SA, Chandran U, Aarabi M.
Show Full Abstract

Analysis of exome data from the latest release of the Genome Aggregation Database (gnomAD v.4.1.0) revealed a significant carrier burden of pathogenic/likely pathogenic (P/LP) variants in genes associated with autosomal-recessive conditions across diverse ancestral populations. Carrier screening panels are routinely offered to reproductive partners to inform their risk of having an affected child. Current guidelines from the American College of Medical Genetics and Genomics (ACMG) recommend screening for genes with a carrier frequency of at least 1/200 and associated with moderate/severe conditions. Here, we systematically analyzed >700,000 gnomAD v.4.1.0 exomes spanning eight ancestries to estimate the carrier frequency of P/LP variants in 2,987 genes associated with autosomal-recessive conditions. After expert curation for clinical severity, we identified 286 genes meeting the criteria for carrier screening. The number of genes exceeding the 1/200 threshold varied across populations, with 40 in the South Asian ancestry and up to 119 in the Ashkenazi Jewish population. Simulations showed that pan-ethnic screening panels offer advantages for individuals of diverse or admixed ancestry, while ancestry-specific panels may be preferable for genetically homogeneous populations. This study leveraged the most comprehensive genomic dataset to date to provide an updated candidate gene list for equitable carrier screening across diverse populations. Our findings highlight the need for continued expansion of genomic resources to better understand rare disease risk and inform screening efforts in underrepresented groups.

HTT
Also flagged:HDCOVID-19breast cancer
Journal Article 2024-11-29 ✓ 2 Snippets Cruickshank H, Miedzybrodzka Z.
In-Text Gene Mentions

…living with theHTTgene expansion for…

…with a knownHTTgene expansion, which…

Show Full Abstract

<h4>Introduction</h4>Previous work demonstrated a prevalence of 14.6 per 100,000 manifest Huntington's disease (HD) patients and 8.3 per 100,000 identified pre-symptomatic gene expansion carriers (IPGEC) in Northern Scotland. Many of those at high risk of having a huntingtin (HTT) gene expansion remain untested with the exact number being unknown.<h4>Objectives</h4>The objective of this study was to estimate how many people in Northern Scotland are at 50% risk of having a HTT gene expansion to help with HD clinic service planning and to calculate how many people could access an effective treatment if available.<h4>Methods</h4>Clinical and pedigree records from the North of Scotland Genetic Clinic were examined to estimate numbers of manifest HD patients, IPGEC, and individuals at 50% risk.<h4>Results</h4>The prevalence of those at 50% risk living in Northern Scotland was 45.2 per 100,000 people. Every manifest HD patient in Northern Scotland has 4.4 relatives at 50% risk and every patient with a HTT gene expansion has 2.9 relatives at 50% risk. There are up to 415 (46.2 per 100,000) adults who could access an effective treatment if available, but this number is likely to be an underestimate as not all manifesting individuals seek diagnosis.<h4>Conclusions</h4>Despite high predictive testing rates, at least 2.2 adults are living with the HTT gene expansion for every one of the 14.5 per 100,000 manifest HD patients in Northern Scotland. Regional variation in rates and ascertainment need to be factored into future service planning, including genetic counselling and testing, management, and treatment delivery.

HFE
Also flagged:post-translational modificationslocalizationferroptosisirondeathto
Journal Article 2024-11-29 ✓ 5 Snippets Christopher JA, Breckels LM, Crook OM, Vazquez-Chantada M, Barratt D, Lilley KS.
In-Text Gene Mentions

…tary hemochromatosis protein (HFE), which was found…

HFEis known to…

…Generally,HFEhas been studied…

…the context ofhemochromatosis, where its most…

…concurrent localization ofHFEto the PM…

Show Full Abstract

Cells have many protective mechanisms against background levels of ionizing radiation orchestrated by molecular changes in expression, post-translational modifications, and subcellular localization. Radiotherapeutic treatment in oncology attempts to overwhelm such mechanisms, but radioresistance is an ongoing challenge. Here, global subcellular proteomics combined with Bayesian modeling identified 544 differentially localized proteins in A549 cells upon 6 Gy X-ray exposure, revealing subcellular-specific changes of proteins involved in ferroptosis, an iron-dependent cell death, suggestive of potential radioresistance mechanisms. These observations were independent of expression changes, emphasizing the utility of global subcellular proteomics and the promising prospect of ferroptosis-inducing therapies for combating radioresistance.

HFE
Also flagged:ironhereditary hemochromatosisHHgenetic disorderALT
Journal Article 2024-11-29 ✓ 1 Snippet Lou A, Elnenaei MO, Zhu J, Peltekian K, Liu E, Jamieson JA, Said H, Nassar BA.
In-Text Gene Mentions

…mutations in theHFEgene, is the…

Show Full Abstract

<h4>Introduction</h4>Hereditary hemochromatosis (HH), associated with C282Y or H63D mutations in the HFE gene, is the commonest genetic disorder in Canada. The majority of HH cases are attributable to C282Y homozygosity which can precipitate iron overload and organ damage, but with low penetrance. Elevated transferrin saturation (TSat) and ferritin levels are key biochemical indicators of iron overload in C282Y homozygotes. This retrospective study examined TSat and ferritin levels as predictors of C282Y homozygosity in genotyped patients.<h4>Methods</h4>This study included 23,432 individuals from Maritime provinces who underwent HFE genotyping from 2009 to 2022. Those with available biomarkers (TSat, ferritin, ALT) were included in the study sample. C282Y and H63D variants were identified based on HFE genotying. Median values for each biomarker were compared across genotypes and their diagnostic performance in predicting C282Y homozygosity evaluated using ROC analysis.<h4>Results</h4>1241 individuals (5.3 %) showed C282Y homozygosity, marking the largest North American study cohort. C282Y homozygotes showed significantly higher median TSat and ferritin levels than wildtypes. TSat showed the best diagnostic performance in detecting C282Y homozygosity (AUC = 0.82, 95 % CI: 0.78-0.85), outperforming ferritin (AUC = 0.54, 95 % CI: 0.50-0.58) and ALT (AUC = 0.59, 95 % CI: 0.56-0.63). TSat thresholds of 32 % (females) and 35 % (males) had a 90 % sensitivity for C282Y homozygosity. Using thresholds of TSat ≤46 % and ferritin ≤370 µg/L (females), and TSat ≤49 % and ferritin ≤703 µg/L (males) reduced the need for genotyping by up to 50 % without missing significant biochemical iron overload cases. Implementing this strategy across 23,432 tests could save $1,701,163 and potentially reduce unnecessary downstream management.<h4>Conclusion</h4>Our study suggests significant efficiency savings by implementing an algorithm to reduce unnecessary HFE genotyping and alleviate unwarranted genetic testing anxiety.

OLFM4
Also flagged:steatotic fatty liver diseasecirrhosisliver failurecardiovascular diseasecancerchronic kidney disease
Journal Article 2024-11-29 ✓ 1 Snippet Lai M, Dillon ST, Gu X, Morhardt TL, Xu Y, Chan NY, Xiong B, Can H, Ngo LH, Jin L, Zhang X, Moreira CC, Leite NC, Villela-Nogueira CA, Otu HH, Schattenberg JM, Schuppan D, Afdhal NH, Libermann TA.
In-Text Gene Mentions

…model (APCS, SHBG,OLFM4, and FGA/FGB/FGG), differenti…

Show Full Abstract

<h4>Background</h4>Reliable, noninvasive tools to diagnose at-risk metabolic dysfunction-associated steatohepatitis (MASH) are urgently needed to improve management. We developed a risk stratification score incorporating proteomics-derived serum markers with clinical variables to identify high-risk patients with MASH (NAFLD activity score >4 and fibrosis score >2).<h4>Methods</h4>In this 3-phase proteomic study of biopsy-proven metabolic dysfunction-associated steatotic fatty liver disease, we first developed a multi-protein predictor for discriminating NAFLD activity score >4 based on SOMAscan proteomics quantifying 1305 serum proteins from 57 US patients. Four key predictor proteins were verified by ELISA in the expanded US cohort (N = 168) and enhanced by adding clinical variables to create the 9-feature MASH Dx score, which predicted MASH and also high-risk MASH (F2+). The MASH Dx score was validated in 2 independent, external cohorts from Germany (N = 139) and Brazil (N = 177).<h4>Results</h4>The discovery phase identified a 6-protein classifier that achieved an AUC of 0.93 for identifying MASH. Significant elevation of 4 proteins (THBS2, GDF15, SELE, and IGFBP7) was verified by ELISA in the expanded discovery and independently in the 2 external cohorts. MASH Dx score incorporated these proteins with established MASH risk factors (age, body mass index, ALT, diabetes, and hypertension) to achieve good discrimination between MASH and metabolic dysfunction-associated steatotic fatty liver disease without MASH (AUC: 0.87-discovery; 0.83-pooled external validation cohorts), with similar performance when evaluating high-risk MASH F2-4 (vs. MASH F0-1 and metabolic dysfunction-associated steatotic fatty liver disease without MASH).<h4>Conclusions</h4>The MASH Dx score offers the first reliable noninvasive approach combining novel, biologically plausible ELISA-based fibrosis markers and clinical parameters to detect high-risk MASH in patient cohorts from the United States, Brazil, and Europe.

Also flagged:methylationagingretinal diseasesdiabetic retinopathyage-related macular degenerationglaucoma
Journal Article 2024-11-29 No Snippets Xu C, Fu X, Qin H, Yao K.
Show Full Abstract

DNA methylation plays a crucial role in development, aging, degeneration of various tissues and dedifferentiated cells. This review explores the multifaceted impact of DNA methylation on the retina and brain during development and pathological processes. First, we investigate the role of DNA methylation in retinal development, and then focus on retinal diseases, detailing the changes in DNA methylation patterns in diseases such as diabetic retinopathy (DR), age-related macular degeneration (AMD), and glaucoma. Since the retina is considered an extension of the brain, its unique structure allows it to exhibit similar immune response mechanisms to the brain. We further extend our exploration from the retina to the brain, examining the role of DNA methylation in brain development and its associated diseases, such as Alzheimer's disease (AD) and Huntington's disease (HD) to better understand the mechanistic links between retinal and brain diseases, and explore the possibility of communication between the visual system and the central nervous system (CNS) from an epigenetic perspective. Additionally, we discuss neurodevelopmental brain diseases, including schizophrenia (SZ), autism spectrum disorder (ASD), and intellectual disability (ID), focus on how DNA methylation affects neuronal development, synaptic plasticity, and cognitive function, providing insights into the molecular mechanisms underlying neurodevelopmental disorders.

Also flagged:ovarian cancergynecologic malignanciescancerPost-translational modificationspathogenesiscell cycle
Journal Article 2024-11-29 No Snippets Zhu Q, Zhou H, Xie F.
Show Full Abstract

Ovarian cancer is one of the predominant gynecologic malignancies worldwide, ranking as the fifth leading cause of cancer-induced mortality among women globally. Post-translational modifications (PTMs) refer to the enzyme-catalyzed attachment of functional groups to proteins, thereby inducing structural and functional alterations. Recent evidence suggests that PTMs play multifaceted roles in the pathogenesis of ovarian cancer, influencing processes such as cell cycle, metabolism reprogramming, chemoresistance, and immune responses against cancer. Accordingly, a comprehensive understanding of the diverse PTMs in ovarian cancer is imperative for decoding the complex molecular mechanisms that drive cancer progression. This review discusses the latest developments in the study of protein PTMs in ovarian cancer and introduces pharmacological approaches that target these modifications as therapeutic strategies.

Also flagged:Synthesistransitiontransition-ionicwatertransition-metal complexes
Journal Article 2024-11-29 No Snippets Xu D, Wang XN, Wang L, Dai L, Yang C.
Show Full Abstract

Ionic liquids have been utilized in numerous significant applications within the field of chemistry, particularly in organic chemistry, due to their unique physical and chemical properties. In the realm of asymmetric transition-metal-catalyzed transformations, chiral ionic-liquid-supported ligands and their corresponding transition-metal complexes have facilitated these processes in unconventional solvents, especially ionic liquids and water. These innovative reaction systems enable the recycling of transition-metal catalysts while producing optically active organic molecules with comparable or even higher levels of chemo-, regio-, and stereoselectivity compared to their parent catalysts. In this short review, we aim to provide an overview of the structures of chiral ionic-liquid-supported ligands and the synthetic pathways for these ligands and catalysts. Various synthetic methodologies are demonstrated based on the conceptual frameworks of diverse chiral ionic-liquid-supported ligands. We systematically present the structures and comprehensive synthetic pathways of the chiral ionic-liquid-supported ligands and the typical corresponding transition-metal complexes that have been readily applied to asymmetric processes, categorized by their parent ligand framework. Notably, the crucial experimental procedures are delineated in exhaustive detail, with the objective of enhancing comprehension of the pivotal aspects involved in constructing chiral ionic-liquid-tagged ligands and compounds for both scholars and readers. Considering the current limitations of such ligands and catalysts, we conclude with remarks on several potential research directions for future breakthroughs in the synthesis and application of these intriguing ligands.

Also flagged:Atopic DermatitisAzalomycin FtumorADskin lesionsinflammatory cytokine
Journal Article 2024-11-29 No Snippets Zhao W, Zhu J, Luo X, Lian F, Yang Y, He S, Zhu J, Yuan G.
Show Full Abstract

Azalomycin F (AZF) is a kind of antibiotic with antifungal and antibacterial activities, as well as anti-inflammatory and anti-tumor activities. In this study, we evaluated the effects of AZF on atopic dermatitis (AD) and its possible molecular mechanisms. Mice with 2,4-dinitrofluorobenzene-induced AD-like skin lesions were topically treated with 10-30 mg/kg AZF on their dorsal skin for 12 days. Observations focused on skin lesion scores, the frequency of scratching, and histopathological alterations in the skin. In addition, IgE and inflammatory cytokine levels in serum were assessed. The results indicated that topical application of 10-20 mg/kg AZF could reduce skin lesion scores and scratching frequencies in AD mice, while 15-20 mg/kg AZF decreased epidermal thickness and mast cell infiltration. Additionally, the serum levels of IgE, IFN-γ, IL-4, TSLP and IL-1β were reduced with 10-20 mg/kg AZF treatment. Moreover, RNA-Seq was employed to reveal the potential molecular mechanisms underlying anti-AD effects of AZF. KEGG enrichment analysis revealed that the most significantly differentially expressed genes are predominantly enriched in signaling pathways such as NF-κB and TNF. Protein-protein interaction network analysis identifies the key genes including Il1b, Tnf, and Cxcl1. In summary, 15 mg/kg AZF effectively alleviates the inflammatory response in AD mice, and the potential mechanism may involve the regulation of key signaling pathways like NF-κB and TNF, thereby reducing inflammatory factor levels and eliciting an anti-inflammatory effect. These findings provide valuable scientific evidence for the development of novel natural drugs for the treatment of AD.

Also flagged:Calcium Phosphatesynthesiscalciumpeptideenalaprilatsuperoxide dismutase 1
Journal Article 2024-11-29 No Snippets Popova E, Tikhomirova V, Akhmetova A, Ilina I, Kalinina N, Taliansky M, Kost O.
Show Full Abstract

Nanoparticles could improve the bioavailability of active agents of various natures to human, animal, and plant tissues. In this work, we compared two methods on the synthesis of calcium phosphate nanoparticles (CaPs), differed by the synthesis temperature, pH, and concentration of the stabilizing agent, and explored the possibilities of incorporation of a low-molecular-weight peptide analogue enalaprilat, the enzyme superoxide dismutase 1 (SOD1), as well as DNA and dsRNA into these particles, by coprecipitation and sorption. CaPs obtained with and without cooling demonstrated the highest inclusion efficiency for enalaprilat upon coprecipitation: 250 ± 10 μg/mg of CaPs and 340 ± 30 μg/mg of CaPs, respectively. Enalaprilat sorption on the preliminarily formed CaPs was much less effective. SOD1 was only able to coprecipitate with CaPs upon cooling, with SOD1 loading 6.6 ± 2 μg/mg of CaPs. For the incorporation of DNA, the superiority of the sorption method was demonstrated, allowing loading of up to 88 μg/mg of CaPs. The ability of CaPs to incorporate dsRNa by sorption was also demonstrated by electrophoresis and atomic force microscopy. These results could have important implications for the development of the roots for incorporating substances of different natures into CaPs for agricultural and medical applications.

HFE
Also flagged:Heart failureironhaemochromatosisdilated cardiomyopathymitral regurgitationtricuspid regurgitation
Journal Article 2024-11-29 ✓ 3 Snippets Montvilaitė-Laurinavičienė A, Dirsienė R, Neverauskaitė-Piliponienė G, Banišauskaitė A, Šukys M, Šakalytė G, Ereminienė E.
In-Text Gene Mentions

…detected in theHFEgene, which is…

…those with undetectableHFEmutations who already…

…variants for theHFEgene [(NM_000410.3) c.845G…

Show Full Abstract

<h4>Background</h4>Haemochromatosis is a pathological condition characterized by the accumulation of iron in parenchymal organs, leading to toxic damage and dysfunction. Cardiac haemochromatosis represents one of the rare causes of severe heart failure (HF) that can be potentially prevented with targeted treatment.<h4>Case summary</h4>We present the case of a 41-year-old female who was hospitalized for decompensated HF. Echocardiography revealed severe systolic dysfunction with a phenotype of dilated cardiomyopathy, accompanied by secondary moderate mitral regurgitation and severe tricuspid regurgitation (TR). To differentiate potential causes of HF, coronary angiography, cardiac magnetic resonance imaging (MRI), and endomyocardial biopsy were performed. Based on clinical findings, laboratory results, cardiac MRI, and endomyocardial biopsy data, a diagnosis of haemochromatosis was confirmed, and mutations in the <i>TFR2</i> gene, responsible for haemochromatosis Type 3, were identified. The patient was treated in accordance with the latest European Society of Cardiology HF guidelines, and specific treatment for haemochromatosis, including therapeutic phlebotomy and iron chelation therapy, was initiated, resulting in a significant positive outcome.<h4>Discussion</h4>Investigating the aetiology of HF is essential, as even rare causes can be identified, and specific treatments are available that significantly improve prognosis and survival.

B4GALT5
Also flagged:Sphingomyelinsphingolipidmembranesmetabolismphospholipidssphingosine
Journal Article 2024-11-29 ✓ 1 Snippet Wang S, Jiang H, Hu M, Gong Y, Zhou H.
In-Text Gene Mentions

…such as NEU,B4GALT5, B4GALT6, GLAC, GLA,…

Show Full Abstract

Sphingomyelin is an important member of the sphingolipid family and was first reported more than a century ago. It has been demonstrated that sphingomyelin plays a crucial role in compositing cell membranes and signaling pathways. Despite extensive functional studies on the sphingolipid metabolism pathway genes, one intriguing question remains: how does the emergence of these genes during evolution correlate with the acquisition of new functions in different species? By employing an evolutionary conservation analysis, the sequence of occurrence of biological processes during evolutionary history can be elucidated. Here we summarize and analyze the conservation status of the genes involved in sphingomyelin metabolism.

CACNA1E
Also flagged:psychiatric disordersanxietydepressionposttraumatic stress disorderbehavioralto fear
Journal Article 2024-11-29 ✓ 1 Snippet Biltz RG, Yin W, Goodman EJ, Wangler LM, Davis AC, Oliver BT, Godbout JP, Sheridan JF.
In-Text Gene Mentions

…27 DEGs (e.g.,Cacna1e, Adcy3 ) increased…

Show Full Abstract

Chronic stress increases the incidence of psychiatric disorders including anxiety, depression, and posttraumatic stress disorder. Repeated Social Defeat (RSD) in mice recapitulates several key physiological, immune, and behavioral changes evident after chronic stress in humans. For instance, neurons in the prefrontal cortex, amygdala, and hippocampus are involved in the interpretation of and response to fear and threatful stimuli after RSD. Therefore, the purpose of this study was to determine how stress influenced the RNA profile of hippocampal neurons and neurons that project into the hippocampus from threat appraisal centers. Here, RSD increased anxiety-like behavior in the elevated plus maze and reduced hippocampal-dependent novel object location memory in male mice. Next, pan-neuronal (Baf53 b-Cre) RiboTag mice were generated to capture ribosomal bound mRNA (i.e., active translation) activated by RSD in the hippocampus. RNAseq revealed that there were 1694 differentially expressed genes (DEGs) in hippocampal neurons after RSD. These DEGs were associated with an increase in oxidative stress, synaptic long-term potentiation, and neuroinflammatory signaling. To further examine region-specific neural circuitry associated with fear and anxiety, a retrograde-adeno-associated-virus (AAV2rg) expressing Cre-recombinase was injected into the hippocampus of male RiboTag mice. This induced expression of a hemagglutinin epitope in neurons that project into the hippocampus. These AAV2rg-RiboTag mice were subjected to RSD and ribosomal-bound mRNA was collected from the amygdala for RNA-sequencing. RSD induced 677 DEGs from amygdala projections. Amygdala neurons that project into the hippocampus had RNA profiles associated with increased synaptogenesis, interleukin-1 signaling, nitric oxide, and reactive oxygen species production. Using a similar approach, there were 1132 DEGs in neurons that project from the prefrontal cortex. These prefrontal cortex neurons had RNA profiles associated with increased synaptogenesis, integrin signaling, and dopamine feedback signaling after RSD. Collectively, there were unique RNA profiles of stress-influenced projection neurons and these profiles were associated with hippocampal-dependent behavioral and cognitive deficits.

PRDX6
Also flagged:Neurological DisordersAutism Spectrum DisorderSchizophreniaBipolar DisorderMajor Depressive Disorderautism
Journal Article 2024-11-29 ✓ 5 Snippets Castro-Martínez JA, Vargas E, Díaz-Beltrán L, Esteban FJ.
In-Text Gene Mentions

…shared two DEGs:PRDX6(Peroxiredoxin 6) and…

…Peroxiredoxin 6 (Prdx6) is an enzyme…

…encoded by thePRDX6gene, which was…

…well known thatPrdx6possesses antioxidant activity…

…the role ofPrdx6in ASD and…

Show Full Abstract

Neurological disorders such as Autism Spectrum Disorder (ASD), Schizophrenia (SCH), Bipolar Disorder (BD), and Major Depressive Disorder (MDD) affect millions of people worldwide, yet their molecular mechanisms remain poorly understood. This study describes the application of the Comparative Analysis of Shapley values (CASh) to transcriptomic data from nine datasets associated with these complex disorders, demonstrating its effectiveness in identifying differentially expressed genes (DEGs). CASh, which combines Game Theory with Bootstrap resampling, offers a robust alternative to traditional statistical methods by assessing the contribution of each gene in the broader context of the complete dataset. Unlike conventional approaches, CASh is highly effective at detecting subtle but meaningful molecular patterns that are often missed. These findings highlight the potential of CASh to enhance the precision of transcriptomic analysis, providing a deeper understanding of the molecular mechanisms underlying these disorders and establishing a solid basis to improve diagnostic techniques and developing more targeted therapeutic interventions.

Also flagged:Congenital HypothyroidismCHcongenital thyroid dysfunctionhyperthyrotropinemiahypothyroidismDUOX2
Journal Article 2024-11-29 No Snippets Ye L, Zhang Y, Feng J, Huang C, Wang X, Han L, Huang Y, Zou H, Zhu B, Miao J.
Show Full Abstract

Newborn congenital hypothyroidism (CH) screening has been widely used worldwide. The objective of this study was to evaluate the effectiveness of applying biochemical and gene panel sequencing as screening tests for CH and to analyze the mutation spectrum of CH in China. Newborns were prospectively recruited from eight hospitals in China between February and December 2021. Clinical characteristics were collected. Second-generation sequencing was used to detect four CH-related genes, and the genetic patterns of the pathogenic genes were analyzed. We analyzed the relationship between genotype and biochemical phenotype. A total of 29,601 newborns were screened for CH. Gene panel sequencing identified 18 patients, including 10 patients affected by biochemically and genetically screened disorders and 8 patients affected by solely genetically screened disorders. The predictive positive value of genetic screening was 34.62%, which was much greater than that of biochemical screening alone (17.99%). A total of 94 cases of congenital thyroid dysfunction were confirmed by biochemical and genetic screening, including 30 CHs and 64 isolated hyperthyrotropinemia (HTT), with an incidence of 1/987 for CH and 1/463 for HTT, and a total incidence of 1/315 for hypothyroidism. The incidence rate and number of patients in Jinan were the highest, and the incidence rates in Shijiazhuang and Shanghai were the lowest. The gene mutation rate in this study was 19.1%, mainly <i>DUOX2</i> mutation. The most common variant of <i>DUOX2</i> was c.1588A>T(p.Lys530*). There was only a difference in sFT4 between groups with gene mutations and those without mutations. Genetic screening is a supplement to biochemical screening. Combining biochemical screening with genetic screening is useful for improving screening efficiency. The incidence of CH in China according to a multicenter study of nearly 30,000 NBS surveys was 1/315. <i>DUOX2</i> gene mutations are commonly detected in these patients.

DCC
Also flagged:peptideCD4heat shock protein 60HSP60autoantigenpathogenesis
Journal Article 2024-11-29 ✓ 1 Snippet Hernández-Cedeño M, Rodríguez-Ulloa A, Ramos Y, González LJ, Serrano-Díaz A, Zettl K, Wiśniewski JR, Martinez-Donato G, Guillen-Nieto G, Besada V, Domínguez-Horta MDC.
In-Text Gene Mentions

…signaling were up-regulated:DCC-interacting protein 13-betaprotein 13-beta (APPL2)…

Show Full Abstract

Jusvinza is an immunomodulatory drug composed of an altered peptide ligand (APL) designed from a novel CD4+ T cell epitope of human heat shock protein 60 (HSP60), an autoantigen involved in the pathogenesis of rheumatoid arthritis (RA). The peptide induces regulatory T cells and decreases levels of TNF-α and IL-17; pre-clinical and phase I clinical studies support its use for the treatment of RA. This peptide was repositioned for the treatment of COVID-19 patients with signs of hyperinflammation. Neutrophils play a pathogenic role in both RA and severe forms of COVID-19. To add novel evidence about the mechanism of action of Jusvinza, the proteomic profile regulated by this peptide of neutrophils isolated from four RA patients was investigated using LC-MS/MS and bioinformatics analysis. A total of 149 proteins were found to be differentially modulated in neutrophils treated with Jusvinza. The proteomic profile regulated by Jusvinza is characterized by the presence of proteins related to RNA splicing, phagocytosis, endocytosis, and immune functions. In response to Jusvinza treatment, several proteins that regulate the NF-κB signaling pathway were differentially modulated, supporting the peptide's anti-inflammatory effect. Proteins related to metabolic pathways that supply ATP for cellular functions or lipid metabolites with immunoregulatory properties were also identified. Additionally, several structural components of neutrophil extracellular traps (NETs) were decreased in Jusvinza-treated cells, supporting its impairment of this biological process. Of note, these findings were validated by in vitro experiments which confirmed that Jusvinza decreased NET formation. Such results provide evidence of the molecular mechanism of action and support the therapeutic potentialities of Jusvinza to treat other diseases characterized by hyperinflammation besides RA and COVID-19.

Also flagged:depressionmonoamine oxidaseserotoninnoradrenalineneurogenesisbehavioral
Journal Article 2024-11-29 No Snippets Rosas-Sánchez GU, Germán-Ponciano LJ, Guillen-Ruiz G, Cueto-Escobedo J, Limón-Vázquez AK, Rodríguez-Landa JF, Soria-Fregozo C.
Show Full Abstract

Pharmacotherapy for depression includes drugs such as monoamine oxidase inhibitors (MAOIs), tricyclic antidepressants (TCAs), selective serotonin reuptake inhibitors (SSRIs), noradrenaline (NA) and serotonin (5-HT) reuptake inhibitors (NaSSAs), and atypical antidepressants; these drugs exert differentially beneficial effects on symptoms of depression after acute and chronic treatment in animal models. Said effects are established through neuroplastic mechanisms involving changes in neurogenesis and synaptogenesis as result of the activation of intracellular signaling pathways associated with neurochemical and behavioral changes. Antidepressants increase the synaptic availability of monoamines (monoaminergic hypothesis) such as 5-HT, NA, and gamma-aminobutyric acid (GABA) by inhibiting their reuptake or degradation and activating intracellular signaling pathways such as the responsive element binding protein (cAMP-CREB) cascade, which regulates the expression of genes related to neuroplasticity and neurogenesis, such as brain-derived neurotrophic factor (BDNF), in various brain structures implicated in depression. The aim of this review is to analyze the mechanisms of action of different antidepressants and to compare the effects of acute and chronic treatment on neuroplasticity in animal models of depression. A thorough search was conducted in PubMed, Scopus, and Web of Science, focusing on studies since 1996 with keywords like antidepressants, acute and chronic treatment, neuroplasticity, and experimental depression. Studies included had to investigate antidepressant effects experimentally, with full-text access, while excluding those that did not. Data extraction focused on study design, findings, and relevance to understanding treatment differences. Only high-quality, peer-reviewed studies were considered to ensure a comprehensive synthesis of current knowledge.

HFE
Also flagged:Aspartate Aminotransferasemetabolic dysfunction-associated steatotic liver diseaseprimary biliary cholangitisautoimmune hepatitisoverlap syndromeOS
Journal Article 2024-11-29 ✓ 1 Snippet Danis N, Gunsar F, Yilmaz F, Nart D, Turan I, Karasu Z, Ersoz G, Akarca US, Ozutemiz O.
In-Text Gene Mentions

…included Wilson’s disease,hemochromatosis, granulomatous hepatitis, gra…

Show Full Abstract

<h4>Background and aim</h4>The primary aim of this study was to investigate the concordance of Transient Elastography FibroScan<sup>®</sup> (FS) measurements, Fibrosis-4 (FIB-4), and the Aspartate Aminotransferase to Platelet Ratio Index (APRI) scores with each other and with liver biopsies in predicting histological fibrosis.<h4>Materials and methods</h4>In this single-center, cross-sectional, retrospective collected data cohort study spanning seven consecutive years, simultaneous FS measurements, FIB-4, and APRI scores of 778 patients with different diagnoses who had undergone liver biopsy were evaluated.<h4>Results</h4>A total of 417 (53.6%) of the patients were female. The median age was 51 years. The diagnoses were HBV (n=228), metabolic dysfunction-associated steatotic liver disease (MASLD) (n=185), HCV (n=58), cryptogenic (n=53), primary biliary cholangitis (n=40), autoimmune hepatitis (AIH) (n=28), overlap syndrome (OS) (n=23), multiple diagnoses (n=42), and other diagnoses (n=83). All three methods showed a strong correlation with histological fibrosis, and FS demonstrated a statistically significantly superior relationship compared to FIB-4 and APRI. In AIH and OS, FIB-4 and APRI scores do not show a consistent increase with histological stage; however, FS does. In MASLD, all three methods correlate with histologic stage, but FS measurements appear significantly superior.<h4>Conclusion</h4>Although FIB-4, APRI, and FS correlate well with histological fibrosis, especially in MASLD, evaluation with FS, if available, should be preferred. In the evaluation of fibrosis in AIH and OS, laboratory-based indicators should be avoided.

Also flagged:cordycepinadenosineergothioneinecarotenoidspolysaccharidesmating-type
Journal Article 2024-11-29 No Snippets Trinh MT, Bui KT, Thai HD, Nguyen TD, Nguyen GTH, Ha KT, Nguyen HT, Le DA, Pham HTT, Nguyen SV, Vu TX, Tran VT.
Show Full Abstract

<i>Cordyceps militaris</i> is a well-known medicinal mushroom widely exploited in traditional medicine and nutraceuticals. In this study, we aim to establish a new platform for improving the production of beneficial ingredients in this fungus. We successfully generated uridine/uracil auxotrophic mutants (Δ<i>pyrG</i>) in five homokaryotic <i>C. militaris</i> strains. The efficiency of the <i>pyrG</i> deletion by homologous recombination reached 100% in all the <i>C. militaris</i> strains. Genetic transformation of the <i>C. militaris</i> Δ<i>pyrG</i> strains mediated by <i>Agrobacterium tumefaciens</i> using the native <i>pyrG</i> auxotrophic marker resulted in high transformation yields of 109-810 transformants per 10<sup>5</sup> conidia. Additionally, the <i>pyrG</i> marker from <i>Aspergillus oryzae</i> was also functional for the genetic transformation of <i>C. militaris</i> Δ<i>pyrG.</i> We further showed that the <i>gpd1</i> and <i>tef1</i> genes were strongly expressed during the mycelial growth of <i>C. militaris</i>, and their promoter sequences were integrated into binary vectors for enhancing recombinant expression. With the constructed platform, the strong heterologous expression of the DsRed protein was proven, and the genomic integration of the endogenous <i>CmFE</i> gene encoding a serine protease under the regulation of the <i>tef1</i> promoter significantly increased the activity of this enzyme in <i>C. militaris</i>. Our work provides a promising platform for food-grade recombinant expression in <i>C. militaris</i>.

Also flagged:immune responsesT‐cell activationautoimmune diseasesinflammatory disordersmultiple sclerosisinflammatory bowel disease
Journal Article 2024-11-28 No Snippets Haap-Hoff A, Freeley M, Dempsey E, Dunican D, Bennett E, Triglia D, Skubis-Zegadlo J, Mitchell Davies A, Kelleher D, Long A.
Show Full Abstract

The α<sub>L</sub>β<sub>2</sub> integrin LFA-1 plays a key role in T-cell adhesion to the endothelial vasculature and migration into both secondary lymphoid organs and peripheral tissues via interactions with its target protein ICAM-1, but the pathways that regulate LFA-1-mediated T-cell polarity and migration are not fully understood. In this study we screened two RNAi libraries targeting G protein-coupled receptors (GPCR)/GPCR-associated proteins and kinases in a HuT 78 T cell line model of LFA-1-stimulated T-cell migration. Based on staining of the actin cytoskeleton, multiple parameters to measure cell morphology were used to assess the contribution of 1109 genes to LFA-1-mediated T-cell polarity and migration. These RNAi screens identified a number of both novel and previously identified genes that either increased or decreased the polarity and migratory capacity of these cells. Following multiparametric analysis, hierarchical clustering and pathway analysis, three of these genes were characterized in further detail using primary human T cells, revealing novel roles for the heterotrimeric G protein subunit Gβ1 and Casein Kinase 2 in LFA-1-mediated T-cell polarity and migration in vitro. Our studies also highlighted a new role for ICAP-1, an adaptor protein previously described to be associated with β1 integrins, in β2 integrin LFA-1-directed migration in T cells. Knockdown of ICAP-1 expression in primary T cells revealed a role in cell polarity, cell velocity and transmigration towards SDF-1 for this adaptor protein. This study therefore uncovers new roles for GPCR/GPCR-associated proteins and kinases in T-cell migration and provides potential novel targets for modulation of the T-cell immune response.

Also flagged:DAVIDadrenocorticotropic hormone deficiencyhypogammaglobulinemiaCas9NFKB2Variable Immune Deficiency
Journal Article 2024-11-28 No Snippets Mac TT, Fauquier T, Jullien N, Romanet P, Etchevers H, Barlier A, Castinetti F, Brue T.
Show Full Abstract

Deficient Anterior pituitary with common Variable Immune Deficiency (DAVID) syndrome results from <i>NFKB2</i> heterozygous mutations, causing adrenocorticotropic hormone deficiency (ACTHD) and primary hypogammaglobulinemia. While NFKB signaling plays a crucial role in the immune system, its connection to endocrine symptoms is unclear. We established a human disease model to investigate the role of <i>NFKB2</i> in pituitary development by creating pituitary organoids from CRISPR/Cas9-edited human induced pluripotent stem cells (hiPSCs). Introducing homozygous <i>TBX19<sup>K146R/K146R</sup></i> missense pathogenic variant in hiPSC, an allele found in congenital isolated ACTHD, led to a strong reduction of corticotrophs number in pituitary organoids. Then, we characterized the development of organoids harboring <i>NFKB2<sup>D865G/D865G</sup></i> mutations found in DAVID patients. <i>NFKB2<sup>D865G/D865G</sup></i> mutation acted at different levels of development with mutant organoids displaying changes in the expression of genes involved on pituitary progenitor generation (<i>HESX1</i>, <i>PITX1</i>, <i>LHX3</i>), hypothalamic secreted factors (<i>BMP4, FGF8, FGF10</i>), epithelial-to-mesenchymal transition, lineage precursors development (<i>TBX19</i>, <i>POU1F1</i>) and corticotrophs terminal differentiation (<i>PCSK1, POMC</i>), and showed drastic reduction in the number of corticotrophs. Our results provide strong evidence for the direct role of <i>NFKB2</i> mutations in the endocrine phenotype observed in patients leading to a new classification of a <i>NFKB2</i> variant of previously unknown clinical significance as pathogenic in pituitary development.

Also flagged:atrial fibrillationaspirinsteatotic liver diseaseNAFLDcoronary heart diseaseheart failure
Journal Article 2024-11-28 No Snippets Clayton-Chubb D, Roberts SK, Majeed A, Woods RL, Tonkin AM, Nelson MR, Chan AT, Ryan J, Tran C, Hodge A, Lubel JS, Schneider HG, Brodtmann A, Fitzgerald SM, Orchard SG, McNeil JJ, Kemp WW.
Show Full Abstract

The impact of metabolic dysfunction-associated steatotic liver disease (MASLD), the preferred nomenclature for NAFLD, on cardiovascular health and mortality among older adults is uncertain. As such, we aimed to identify whether MASLD increases the risk of Major Adverse Cardiovascular Events (MACE) (a composite of fatal coronary heart disease [excluding heart failure], nonfatal myocardial infarction, or fatal or nonfatal ischemic stroke), Atrial Fibrillation (AF), or all-cause mortality in older adults, and whether aspirin attenuates these risks in individuals with MASLD. This is a non-prespecified post-hoc analysis of the ASPREE (ASPirin in Reducing Events in the Elderly) randomized trial. Participants were community dwelling well adults aged ≥ 70 years without a history of atherosclerotic cardiovascular disease or AF. Fatty Liver Index (FLI) was used to identify MASLD at baseline. FLI is a composite of anthropometric and biochemical markers used in epidemiologic studies to rule in and rule out hepatic steatosis. MACE and cause of death were adjudicated by clinical experts; AF was assessed by previously defined algorithm in ASPREE. 9,097 participants were stratified into groups according to FLI. In univariate analysis, prevalent MASLD (FLI ≥ 60 with evidence of metabolic dysfunction; n = 2,998 [33.0%]) was associated with an increased risk of MACE (HR 1.47 [95% CI 1.22-1.78]) and AF (HR 1.50 [95% CI 1.19-1.88] but not all-cause mortality (HR 1.04 [95% CI 0.91-1.19]). After adjusting for cardiovascular disease risk factors, only the association between MASLD and AF remained significant (HR 1.46 [95% CI 1.11-1.93]). Aspirin did not reduce the risk of MACE, death, or AF in the MASLD group. MASLD was associated with an increased hazard of incident AF, but not of MACE or all-cause mortality, in community dwelling older adults. Primary prevention with aspirin does not ameliorate these risks in older adults with MASLD.

Also flagged:beta-lactamswound infectionNontuberculous mycobacteriumNTM) infectionsNTM infectionsbeta-lactam
Journal Article 2024-11-28 No Snippets Cristinziano M, Shashkina E, Chen L, Xiao J, Miller MB, Doligalski C, Coakley R, Lobo LJ, Footer B, Bartelt L, Abad L, Russell DA, Garlena R, Lauer MJ, Viland M, Kaganovsky A, Mowry E, Jacobs-Sera D, van Duin D, Kreiswirth BN, Hatfull GF, Friedland A.
Show Full Abstract

Nontuberculous mycobacterium (NTM) infections are challenging to manage and are frequently non-responsive to aggressive but poorly-tolerated antibiotic therapies. Immunosuppressed lung transplant patients are susceptible to NTM infections and poor patient outcomes are common. Bacteriophages present an alternative treatment option and are associated with favorable clinical outcomes. Similarly, dual beta-lactam combinations show promise in vitro, but clinical use is sparse. We report here a patient with an uncontrolled Mycobacterium abscessus infection following a bilateral lung transplant and failed antibiotic therapy. Both smooth and rough colony morphotype strains were initially present, but treatment with two phages that kill the rough strain - including epigenetic-modification to overcome restriction - resulted in isolation of only the smooth strain. The rough and smooth strains have similar antibiotic susceptibilities suggesting that the phages specifically eliminated the rough strain. Dual beta-lactam therapy with meropenem and ceftazidime-avibactam provided further clinical improvement, and the phages act synergistically with meropenem in vitro.

SERPINC1
Also flagged:Cas9infectious diseasenucleotidespinocerebellar ataxiaATXN7ATXN8
Journal Article 2024-11-28 ✓ 1 Snippet Ahn JH, Yoon JG, Cho J, Lee S, Kim S, Kim MJ, Kim SY, Lee ST, Chu K, Lee SK, Kim HJ, Youn J, Jang JH, Chae JH, Moon J, Cho JW.
In-Text Gene Mentions

…involving the entireSERPINC1gene was identified…

Show Full Abstract

The global burden of undiagnosed diseases, particularly in adults, is rising due to their significant socioeconomic impact. To address this, we enrolled 232 adult probands with undiagnosed conditions, utilizing bioinformatics tools for genetic analysis. Alongside exome and genome sequencing, repeat-primed PCR and Cas9-mediated nanopore sequencing were applied to suspected short tandem repeat disorders. Probands were classified into probable genetic (n = 128) or uncertain (n = 104) origins. The study found genetic causes in 66 individuals (28.4%) and non-genetic causes in 12 (5.2%), with a longer diagnostic journey for those in the probable genetic group or with pediatric symptom onset, emphasizing the need for increased efforts in these populations. Genetic diagnoses facilitated effective surveillance, cascade screening, drug repurposing, and pregnancy planning. This study demonstrates that integrating sequencing technologies improves diagnostic accuracy, may shorten the time to diagnosis, and enhances personalized management for adults with undiagnosed diseases.

GPR52
Also flagged:GPR180GOLD domain seven-transmembrane helixmembraneextracellularGolgi-dynamicslocalization
Journal Article 2024-11-28 ✓ 5 Snippets Mitrovic SA, Demalgiriya-Gamage C, Winter LM, Kiechle T, Ebenhoch R, Neubauer H, Stierstorfer B, Frego L, Wolfrum C, Reindl S, Nar H.
In-Text Gene Mentions

…0.250 mg/mL, andGPR52at 0.250 mg/mL.…

…( Q86V85 ),GPR52GFP ( Q9Y2T5…

…( Q86V85 ),GPR52-MYC ( Q9Y2T5 ),…

…TMEM87A, Rhodopsin, andGPR52with C-terminal GFP-fusions.…

GPR52GFP (unrelated GPCR…

Show Full Abstract

GOLD domain seven-transmembrane helix (GOST) proteins form a new protein family involved in trafficking of membrane-associated cargo. They share a characteristic extracellular/luminal Golgi-dynamics (GOLD) domain, possibly responsible for ligand recognition. Based on structural homology, GPR180 is a new member of this protein family, but little is known about the cellular role of GPR180. Here we show the X-ray structure of the N-terminal domain of GPR180 (1.9 Å) and can confirm the homology to GOLD domains. Using cellular imaging we show the localization of GPR180 in intracellular vesicular structures implying its exposure to acidic pH environments. With Hydrogen/Deuterium Exchange-Mass Spectrometry (HDX-MS) we identify pH-dependent conformational changes, which can be mapped to a putative ligand binding site in the transmembrane region. The results reveal GPR180's role in intracellular vesicles and offer insights into the pH-dependent function of this conserved GOST protein.

HTT
Also flagged:WDR47Brain developmentaxonsaxonassyndromic corpus callosum dysgenesis
Journal Article 2024-11-28 ✓ 2 Snippets Bayam E, Tilly P, Collins SC, Rivera Alvarez J, Kannan M, Tonneau L, Brivio E, Rinaldi B, Lecat R, Schwaller N, Cotellessa L, Maddirevula S, Monteiro F, Guardia CM, Kitajima JP, Kok F, Kato M, Hamed AAA, Salih MA, Al Tala S, Hashem MO, Tada H, Saitsu H, Stabile M, Giacobini P, Friant S, Yüksel Z, Nakashima M, Alkuraya FS, Yalcin B, Godin JD.
In-Text Gene Mentions

…similarities with Huntingtin (Htt) and Tau, the…

…AlikeHttand Tau (Cheng…

Show Full Abstract

Brain development requires the coordinated growth of structures and cues that are essential for forming neural circuits and cognitive functions. The corpus callosum, the largest interhemispheric connection, is formed by the axons of callosal projection neurons through a series of tightly regulated cellular events, including neuronal specification, migration, axon extension and branching. Defects in any of those steps can lead to a range of disorders known as syndromic corpus callosum dysgenesis (CCD). We report five unrelated families carrying bi-allelic variants in WDR47 presenting with CCD together with other neuroanatomical phenotypes such as microcephaly and enlarged ventricles. Using in vitro and in vivo mouse models and complementation assays, we show that WDR47 is required for survival of callosal neurons by contributing to the maintenance of mitochondrial and microtubule homeostasis. We further propose that severity of the CCD phenotype is determined by the degree of the loss of function caused by the human variants. Taken together, we identify WDR47 as a causative gene of a new neurodevelopmental syndrome characterized by corpus callosum abnormalities and other neuroanatomical malformations.

PTGIS
Also flagged:tumorGene ExpressionNSCLCnon-small cell lung cancernon-small-cell lung cancerLung cancer
Journal Article 2024-11-28 ✓ 1 Snippet Li Z, Meng Z, Xiao L, Du J, Jiang D, Liu B.
In-Text Gene Mentions

…CD69, EPHB2, andPTGIS, was validated across…

Show Full Abstract

<h4>Background</h4>The tumor microenvironment (TME) plays a crucial role in tumorigenesis and tumor progression. This study aimed to identify novel TME-related biomarkers and develop a prognostic model for patients with non-small-cell lung cancer (NSCLC).<h4>Methods</h4>After downloading and preprocessing data from The Cancer Genome Atlas (TCGA) data portal and Gene Expression Omnibus (GEO) datasets, we classified the molecular subtypes using the "NMF" R package. We performed survival analysis and quantified immune scores between clusters. A Cox proportional hazards model was then constructed, and its formula was produced. We assessed model performance and clinical utility. A prediction nomogram was also constructed and validated. Additionally, we explored the potential regulatory mechanisms of our TME gene signature using Gene Set Enrichment Analysis (GSEA).<h4>Results</h4>From data processing and univariate Cox regression analysis, 57 TME-related prognostic genes were identified, and two significantly distinct clusters were established. Using Cox regression and Lasso regression, an 18-gene TME-related prognostic model was developed. Patients were stratified into high- and low-risk groups based on the risk score, with survival analysis showing that the low-risk group had significantly better outcomes than the high-risk group (P < 0.01). ROC curve analysis demonstrated strong predictive performance, with 1-year, 3-year, and 5-year AUC values ranging from 0.654 to 0.702 across different cohorts. The model accurately predicted survival outcomes across subgroups with varying clinical features, and its predictive accuracy was validated through a nomogram.<h4>Conclusions</h4>We developed a prognostic model based on TME-related genes in NSCLC. Our 18-gene TME signature can effectively predict the prognosis of NSCLC with high accuracy.

OLFM4
Also flagged:obesitychildhood obesityantimicrobial peptidesdegranulationlauric acidBPIFA1
Journal Article 2024-11-28 ✓ 3 Snippets Ren Y, Huang P, Zhang L, Tang Y, He S, Li H, Huang X, Ding Y, Liu L, Liu L, He X.
In-Text Gene Mentions

…Lithocholic acid, CRISP3,OLFM4, p_Firmicutes , DL-Glutamine,…

…ELANE, SAA1, LCN2,OLFM4, CCL2, OAS3, BPI,…

…with immune-related DEGsOLFM4and CRISP3.…

Show Full Abstract

<h4>Background</h4>The increasing incidence of childhood obesity annually has led to a surge in physical and mental health risks, making it a significant global public health concern. This study aimed to discover novel biomarkers of childhood simple obesity through integrative multi-omics analysis, uncovering their potential connections and providing fresh research directions for the complex pathogenesis and treatment strategies.<h4>Methods</h4>Transcriptome, untargeted metabolome, and 16 S rDNA sequencing were conducted on subjects to examine transcripts, metabolites in blood, and gut microflora in stool.<h4>Results</h4>Transcriptomic analysis identified 599 differentially expressed genes (DEGs), of which 25 were immune-related genes, and participated in immune pathways such as antimicrobial peptides, neutrophil degranulation, and interferons. The optimal random forest model based on these genes exhibited an AUC of 0.844. The metabolomic analysis examined 71 differentially expressed metabolites (DEMs), including 12 immune-related metabolites. Notably, lauric acid showed an extremely strong positive correlation with BMI and showed a good discriminative power for obesity (AUC = 0.82). DEMs were found to be significantly enriched in four metabolic pathways, namely "Aminoacyl-tRNA biosynthesis", "Valine leucine and isoleucine biosynthesis, and Glycine", "Serine and threonine metabolism", and "Biosynthesis of unsaturated fatty acids". Microbiome analysis revealed 12 differential gut microbiotas (DGMs) at the phylum and genus levels, with p_Firmicutes dominating in the obese group and g_Escherichia-Shigella in the normal group. Subsequently, a Random Forest model was developed based on the DEMs, immune-related DEGs, and metabolites with an AUC value of 0.912. The 14 indicators identified by this model could potentially serve as a set of biomarkers for obesity. The analysis of the inter-omics correlation network found 233 pairs of significant correlations. DEGs BPIFA1, BPI, and SAA1, DEMs Dimethy(tetradecyl)amine, Deoxycholic acid, Pathalic anhydride, and DL-Alanine, and DGMs g_Intestinimonas and g_Turicibacter showed strong connectivity within the network, constituting a large proportion of interactions.<h4>Conclusion</h4>This study presents the first comprehensive description of the multi-omics characteristics of childhood simple obesity, recognizing promising biomarkers. Immune-related markers offer a new perspective for researching the immunological mechanisms underlying obesity and its associated complications. The revealed interactions among these biomarkers contribute to a deeper understanding the intricate biological regulatory networks associated with obesity.

HMGN4
Also flagged:complexobesitylipidlipoproteincholesteroltriglycerides
Journal Article 2024-11-28 ✓ 1 Snippet Winkler TW, Wiegrebe S, Herold JM, Stark KJ, Küchenhoff H, Heid IM.
In-Text Gene Mentions

…, and additionally,HMGN4for weight) except…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies (GWAS) have identified thousands of loci for disease-related human traits in cross-sectional data. However, the impact of age on genetic effects is underacknowledged. Also, identifying genetic effects on longitudinal trait change has been hampered by small sample sizes for longitudinal data. Such effects on deteriorating trait levels over time or disease progression can be clinically relevant.<h4>Results</h4>Under certain assumptions, we demonstrate analytically that genetic-by-age interaction observed in cross-sectional data can be indicative of genetic association on longitudinal trait change. We propose a 2-stage approach with genome-wide pre-screening for genetic-by-age interaction in cross-sectional data and testing identified variants for longitudinal change in independent longitudinal data. Within UK Biobank cross-sectional data, we analyze 8 complex traits (up to 370,000 individuals). We identify 44 genetic-by-age interactions (7 loci for obesity traits, 26 for pulse pressure, few to none for lipids). Our cross-trait view reveals trait-specificity regarding the proportion of loci with age-modulated effects, which is particularly high for pulse pressure. Testing the 44 variants in longitudinal data (up to 50,000 individuals), we observe significant effects on change for obesity traits (near APOE, TMEM18, TFAP2B) and pulse pressure (near FBN1, IGFBP3; known for implication in arterial stiffness processes).<h4>Conclusions</h4>We provide analytical and empirical evidence that cross-sectional genetic-by-age interaction can help pinpoint longitudinal-change effects, when cross-sectional data surpasses longitudinal sample size. Our findings shed light on the distinction between traits that are impacted by age-dependent genetic effects and those that are not.

Also flagged:Fibrillin-1extracellularFBN1Marfan syndromesclerodermacollagen
Journal Article 2024-11-28 No Snippets Hossain AS, Clarin MTRDC, Kimura K, Biggin G, Taga Y, Uto K, Yamagishi A, Motoyama E, Narenmandula, Mizuno K, Nakamura C, Asano K, Ohtsuki S, Nakamura T, Kanki S, Baldock C, Raja E, Yanagisawa H.
Show Full Abstract

Fibrillin-1, an extracellular matrix (ECM) protein encoded by the FBN1 gene, serves as a microfibril scaffold crucial for elastic fiber formation and homeostasis in pliable tissue such as the skin. Aside from causing Marfan syndrome, some mutations in FBN1 result in scleroderma, marked by hardened and thicker skin which limits joint mobility. Here, we describe a tight skin phenotype in the Fbn1<sup>G234D/G234D</sup> mice carrying a corresponding variant of FBN1 in the hybrid1 domain that was identified in a patient with familial aortic dissection. Unlike scleroderma, skin thickness and collagen fiber abundance do not change in the Fbn1<sup>G234D/G234D</sup> mutant skin. Instead, increased collagen cross-links were observed. In addition, short elastic fibers were sparsely located underneath the panniculus muscle layer, and an abundance of thin, aberrant elastic fibers was increased within the subcutaneous fascia, which may have tightened skin attachment to the underlying skeletal muscle. Structurally, Fbn1<sup>G234D/G234D</sup> microfibrils have a disrupted shoulder region that shares similarities with hybrid1 deletion mutant microfibrils. We then demonstrate the consequence of fibrillin-1 G234D mutation on dermal fibroblast functions. Mutant primary fibroblasts produce fewer elastic fibers, exhibit slower migration and increased cell stiffness. Moreover, secretome from mutant fibroblasts are marked by enhanced secretion of ECM, ECM-modifying enzymes, proteoglycans and cytokines, which are pro-tissue repair/fibrogenic. The transcriptome of mutant fibroblasts displays an increased expression of myogenic developmental and immune-related genes. Our study proposes that imbalanced ECM homeostasis due to a fibrillin-1 G234D mutation impacts fibroblast properties with potential ramifications on skin function.

HFE
Also flagged:ironchronic diseasesanemiaHeparinBMPSMAD
Journal Article 2024-11-28 ✓ 2 Snippets Asperti M, Denardo A, Gryzik M, Persson KEM, Westerberg G, Öhd J, Poli M.
In-Text Gene Mentions

…editary Hemochromatosis Gene (HFE), and Transferrin receptor…

…such as inhemochromatosisto iron deficiency…

Show Full Abstract

Hepcidin is an essential regulator of systemic iron availability mediating both iron uptake from the diet and its release from body stores. Abnormally high hepcidin levels resulting from inflammation in chronic diseases cause iron restriction with the onset of anemia. Restoring physiological levels of hepcidin could contribute to ameliorating anemia in these patients. Heparin derivatives are known to suppress hepcidin expression acting on the BMP/SMAD pathway. The novel heparin derivative sevuparin, modified to markedly reduce its anticoagulant activity, is proposed as a promising hepcidin antagonizing strategy. Sevuparin was tested for its anti-hepcidin properties <i>in vitro</i> in HepG2 cells, <i>in vivo</i> in mice, and in healthy volunteers. Sevuparin strongly suppressed basal, BMP6-, and IL6-dependent hepcidin expression in HepG2 cells in a dose- and time-dependent manner, modulating the essential BMP6/SMAD cascade. These effects were evident in C57BL/6J mice after intravenous injection of a single dose of sevuparin (20 mg/kg) with a 70% reduction of hepcidin mRNA. Remarkably, similar effects were observed in healthy volunteers following single subcutaneous doses at 3, 6, and 9 mg/kg with 40%-50% suppression at 3 and 6 mg/kg and 72% at 9 mg/kg. Moreover, sevuparin was able to reduce hepcidin upregulation in a mouse model of acute inflammation induced by LPS, also showing an amelioration of the inflammatory markers. Combined with its excellent safety profile, these data suggest a role for sevuparin in treating high-hepcidin disorders.

Also flagged:MyostatinMSTNGrowth hormone receptorGHRtissue development
Journal Article 2024-11-28 No Snippets You G, Long H, Shen X, Yin H, Zhang S.
Show Full Abstract

Chickens are vital agricultural animals that supply a significant portion of the protein consumed by humans. In society today, enhancing the productive performance of chickens in a safe and efficient manner has become a central focus of research. This performance is determined by various production traits that are primarily influenced by multiple factors, including epigenetics-a critical aspect of gene regulation. Circular RNAs (circRNAs), a unique class of non-coding RNAs, have emerged as key epigenetic regulators. Recent studies have demonstrated that circRNAs are extensively engaged in numerous production traits, which include skeletal muscle formation, fat deposition, ovarian follicle development, liver function, bone development, immunity, and resistance to environmental stress. These processes play crucial roles in determining the overall productivity of chickens. Given the significance of circRNAs in these various traits, this article provides a comprehensive review of the functional circRNAs associated with different traits in chickens, serving as a valuable theoretical reference for future research. Further investigation into the role of circRNAs may reveal novel insights into the molecular mechanisms underlying key economic traits in chickens and pave the way for innovative strategies in molecular breeding aimed at enhancing chicken productive performance.

DDX27
Also flagged:pancreatic ductal adenocarcinomaPDACtumorspancreatic cancerpeptidescancer
Journal Article 2024-11-28 ✓ 1 Snippet Guillon C, Pichereaux C, Lazar I, Chaoui K, Mouton-Barbosa E, Liauzun M, Gourbeyre E, Altiner P, Bouyssié D, Stella A, Burlet-Schiltz O, Plaza S, Martineau Y, Fabre B.
In-Text Gene Mentions

…proteins BOP1, DDX21,DDX27, EMG1, ISG20, MPHOSPH10,…

Show Full Abstract

The identification of small proteins and proteins produced from unannotated open reading frames (called alternative proteins or AltProts) has changed our vision of the proteome and has attracted more and more attention from the scientific community. Despite several studies investigating particular AltProts in diseases and demonstrating their importance in such context, we are still missing data on their expression and functions in many pathologies. Among these, pancreatic ductal adenocarcinoma (PDAC) is a particularly relevant case to study alternative proteins. Indeed, late detection of this disease, notably due to the lack of reliable biomarkers of early-stage PDAC, and the fact that tumors rapidly develop resistance to most of the treatments used in the clinics warrant the exploration of new repertoires of molecules. In the present article, we aim to investigate the alternative proteome of pancreatic cancer cell lines as a first attempt to decipher the expression of AltProts in PDAC. Thanks to a combined data-dependent and data-independent acquisition mass spectrometry workflow, we were able to identify tryptic peptides matching 113 AltProts in a panel of 6 cell lines. In addition, we identified AltProts differentially expressed between pancreatic cancer cell lines and other cells (HeLa and HEK293T). Finally, mining the TCGA and Gtex databases showed that the corresponding transcripts encoding several AltProts we identified are differentially expressed between PDAC tumors and normal tissues and are correlated with the patient's survival.

Also flagged:polyphenolflavonoidrutinquercetinmethanolinternal hemorrhoids
Journal Article 2024-11-28 No Snippets Nguyen HC, Hoang HTT, Miyamoto A, Nguyen TD, Nguyen HTT.
Show Full Abstract

Roasting is the most common thermal processing method established for <i>Sophora japonica</i> (SJ) buds applied as traditional medicines, and it has also been reported to alter several of their therapeutic functions. However, there have been no studies investigating the influences of roasting on the effects of these materials against bacteria. Therefore our study was performed to examine the alterations that this process would induce in SJ buds' antibacterial properties. Fresh buds were subjected to hot air drying or different roasting methods, as described in Materia Medica, including yellow-, dark yellow-, scorched-, and charred-roasting conditions. Antibacterial effects, total polyphenol and flavonoid contents, antioxidant activities, as well as rutin and quercetin concentrations in methanol extracts obtained from those materials, were then measured and compared. The results showed that dark yellow-roasted SJ buds exerted the strongest antibacterial and antioxidant activities and were also the richest in polyphenol contents. Analysis of rutin and quercetin revealed that, following the increment in heating temperatures up to 240 °C, the reduction in rutin content occurred in a parallel manner to the increment in quercetin content. However, overheating at 300 °C reduced both concentrations. Among the five tested samples, dark yellow-roasted SJ had the highest amounts of quercetin. Furthermore, the comparison of rutin and quercetin in antibacterial effects and antioxidant activities showed that the latter was significantly stronger in both of these functions, suggesting that the increment in quercetin content as a result of heat treatment was responsible, at least in part, for the potentiation of the two therapeutic effects.

Also flagged:nanohydroxyapatitehydroxyapatiteapatitecationsanionsions
Journal Article 2024-11-28 No Snippets Lubojański A, Zakrzewski W, Samól K, Bieszczad-Czaja M, Świtała M, Wiglusz R, Watras A, Mielan B, Dobrzyński M.
Show Full Abstract

This review is an extensive collection of the latest literature describing the current knowledge about nanohydroxyapatite in a comprehensive way. These are hydroxyapatite particles with a size below 100 nm. Due to their size, the surface area to mass ratio of the particles increases. They are widely used in medicine due to their high potential in regenerative medicine, as a carrier of various substances, e.g., in targeted therapy. The aim of this article is to present the biological and physicochemical properties as well as the use of nanohydroxyapatite in modern medicine. Due to the potential of nanohydroxyapatite in medicine, further research is needed.

Also flagged:Resveratrolinsulinfemale infertilityFertility3,5,4-trihydroxystilbeneresponse to ultraviolet radiation
Journal Article 2024-11-28 No Snippets Bertoldo A, Pizzol D, Yon DK, Callegari M, Gobbo V, Cuccurese P, Butler L, Caminada S, Stebbing J, Richardson F, Gawronska J, Smith L.
Show Full Abstract

Resveratrol is a natural polyphenolic compound that may have multiple influences on human health, including antiaging, anti-inflammatory, anti-neoplastic, antioxidant, insulin-sensitizing, cardioprotective and vasodilating activities. Growing evidence also suggests a potential positive effect of resveratrol on female fertility. The aim of the present study was to collate and appraise the scientific literature on the relationship between resveratrol and female fertility. We systematically searched Medline, PubMed, Web of Science and Embase from the databases' inception (1951, 1951, 1947 and 1900, respectively) until 9th May 2024. All in vivo or in vitro retrospective or prospective studies reporting the effects of resveratrol interventions on women's fertility were included. We ultimately incorporated twenty-four studies into a systematic review with a narrative summary of the results; of those studies, nine were performed on women seeking natural or assisted fertility, and fifteen were in vitro studies performed on human cells and tissues in different stages of the reproductive cascade. The current literature, though limited, suggests that resveratrol may play a role in female infertility. Specifically, it may significantly and positively impact reproductive outcomes, owing to its potential therapeutic effects improving ovarian function. Further studies are now needed to better understand resveratrol's effects and define the optimal dosage and periods of intake to maximize beneficial effects, as well as to prevent adverse outcomes on implantation, subsequent pregnancy and the fetus.

HFE
Also flagged:CitrateEnd-Stage Liver Diseasemitochondrialglomerular filtrationliver failurepathogenesis
Journal Article 2024-11-28 ✓ 1 Snippet Li Y, Chvatal-Medina M, Trillos-Almanza MC, Bourgonje AR, Connelly MA, Moshage H, Bakker SJL, de Meijer VE, Blokzijl H, Dullaart RPF, TransplantLines Investigators.
In-Text Gene Mentions

…(e.g., Wilson’s disease,hemochromatosisand alpha-1 antitrypsin…

Show Full Abstract

Circulating citrate may serve as a proxy for mitochondrial dysfunction which plays a role in the progression of end-stage liver disease (ESLD). This study aimed to determine the extent of alterations in circulating citrate in patients with ESLD, and examined its association with all-cause mortality among ESLD patients while on the waiting list for liver transplantation. Plasma citrate levels were measured using nuclear magnetic resonance spectroscopy in 129 ESLD patients (TransplantLines cohort study; NCT03272841) and compared to levels in 4837 participants of the community-dwelling PREVEND cohort. Plasma citrate levels were 40% higher in ESLD patients compared to PREVEND participants (<i>p</i> < 0.001). In a subset of 30 ESLD patients, citrate decreased following liver transplantation (<i>p</i> < 0.001), resulting in levels that were slightly lower than those observed in PREVEND participants. In multivariable analysis, plasma citrate levels were positively associated with Child-Turcotte-Pugh classification and inversely associated with estimated glomerular filtration rate (both <i>p</i> < 0.05). Survival was significantly reduced in ESLD patients in the highest citrate tertile (log-rank <i>p</i> = 0.037). Elevated citrate levels were associated with an increased risk of all-cause mortality in ESLD patients (HR per 1 Ln SD increment: 1.65 [95% CI: 1.03-2.63], <i>p</i> = 0.037). This association was suggested to be particularly present in men (HR: 2.04 [95% CI: 1.08-3.85], <i>p</i> = 0.027). In conclusion, plasma citrate levels are elevated in ESLD patients and decrease following liver transplantation. Moreover, elevated plasma citrate levels may be associated with increased all-cause mortality in ESLD patients, likely more pronounced in men.

Also flagged:Infectionstitaniumzirconiumzinc oxideswateroxides
Journal Article 2024-11-28 No Snippets Straumal BB, Kurkin EN, Balihin IL, Klyatskina E, Straumal PB, Anisimova NY, Kiselevskiy MV.
Show Full Abstract

The simple oxides like titania, zirconia, and ZnO are famous with their antibacterial (or even antimicrobial) properties as well as their biocompatibility. They are broadly used for air and water filtering, in food packaging, in medicine (for implants, prostheses, and scaffolds), etc. However, these application fields can be broadened by switching to the composite multicomponent compounds (for example, titanates) containing in their unit cell, together with oxygen, several different metallic ions. This review begins with a description of the synthesis methods, starting from wet chemical conversion through the manufacturing of oxide (nano)powders toward mechanosynthesis methods. The morphology of these multicomponent oxides can also be very different (like thin films, complicated multilayers, or porous scaffolds). Further, we discuss in vitro tests. The antimicrobial properties are investigated with Gram-positive or Gram-negative bacteria (like <i>Escherichia coli</i> or <i>Staphylococcus aureus</i>) or fungi. The cytotoxicity can be studied, for example, using mouse mesenchymal stem cells, MSCs (C3H10T1/2), or human osteoblast-like cells (MG63). Other human osteoblast-like cells (SaOS-2) can be used to characterize the cell adhesion, proliferation, and differentiation in vitro. The in vitro tests with individual microbial or cell cultures are rather far away from the real conditions in the human or animal body. Therefore, they have to be followed by in vivo tests, which permit the estimation of the real applicability of novel materials. Further, we discuss the physical, chemical, and biological mechanisms determining the antimicrobial properties and biocompatibility. The possible directions of future developments and novel application areas are described in the concluding section of the review.

HTT
Also flagged:Transactive response DNA-binding protein of 43 kDaTDP-43neurodegenerative disordersamyotrophic lateral sclerosisfrontotemporal lobar degenerationproteinopathies
Journal Article 2024-11-28 ✓ 1 Snippet An J, Gopalakrishnan L, Ortega V, Saul J, Kadali R, Bowser R.
In-Text Gene Mentions

…to quantify huntingtin (HTT) protein levels, helping…

Show Full Abstract

Transactive response DNA-binding protein of 43 kDa (TDP-43) is a major component of pathological inclusions in various neurodegenerative disorders, including amyotrophic lateral sclerosis and frontotemporal lobar degeneration. The detection of TDP-43 in biofluids is crucial for the development of diagnostic and prognostic indicators of disease and therapeutic development for TDP-43-related proteinopathies. Despite its potential as a biomarker for numerous neurological disorders, the lack of a sensitive and reproducible TDP-43 assay hinders progress in TDP-43-based therapy development, underscoring the need for an effective and standardized method for accurate quantification. Addressing the limitations of sensitivity and reproducibility in existing assays, in this study, we developed and validated a highly sensitive electrochemiluminescence immunoassay on the Meso Scale Discovery platform. The assay demonstrated the detection of full-length TDP-43 in human biofluids with a limit of detection of 4pg/mL, a working range of 4-20,000 pg/mL, and a total assay time of 16 h. In this study, we developed and validated a sensitive immunoassay for the detection of full-length TDP-43 in human biofluids using the Meso Scale Discovery platform. We used this immunoassay to quantify TDP-43 levels in the plasma and serum of healthy controls and ALS patients. Our results indicate a reduction in full-length TDP-43 in the blood of ALS patients compared to healthy controls.

Also flagged:Prostate CancercancerLymph Node Carcinoma of the Prostatepolystyrenemicrospherespolyethylene terephthalate
Journal Article 2024-11-28 No Snippets Jia H, Meng W, Gao R, Wang Y, Zhan C, Yu Y, Cong H, Yu L.
Show Full Abstract

The detection and analysis of cancer cell exosomes with high sensitivity and precision are pivotal for the early diagnosis and treatment strategies of prostate cancer. To this end, a microfluidic chip, equipped with a cactus-like array substrate (CAS) based on surface-enhanced Raman spectroscopy (SERS) was designed and fabricated for the detection of exosome concentrations in Lymph Node Carcinoma of the Prostate (LNCaP). Double layers of polystyrene (PS) microspheres were self-assembled onto a polyethylene terephthalate (PET) film to form an ordered cactus-like nanoarray for detection and analysis. By combining EpCAM aptamer-labeled SERS nanoprobes and a CD63 aptamer-labeled CAS, a 'sandwich' structure was formed and applied to the microfluidic chips, further enhancing the Raman scattering signal of Raman reporter molecules. The results indicate that the integrated microfluidic sensor exhibits a good linear response within the detection concentration range of 10<sup>5</sup> particles μL<sup>-1</sup> to 1 particle μL<sup>-1</sup>. The detection limit of exosomes in cancer cells can reach 1 particle μL<sup>-1</sup>. Therefore, we believed that the CAS integrated microfluidic sensor offers a superior solution for the early diagnosis and therapeutic intervention of prostate cancer.

BTN2A1
Also flagged:Nuclear transmembrane protein 199transmembrane protein 199TMEM199cancerlocalizationPD-L1
Journal Article 2024-11-28 ✓ 1 Snippet You W, Luu H, Li M, Chen Z, Li F, Zhang Y, Cai M, He TC, Li J.
In-Text Gene Mentions

…contrast, CD70, IDO1,BTN2A1, and other immune…

Show Full Abstract

The function of transmembrane protein 199 (TMEM199) in cancer development has rarely been studied thus far. We report the nuclear localization of the TMEM199 protein and further analyzed the truncated fractions that mediate its nuclear localization. Cut&Tag assay globally explores the nuclear-located TMEM199 functions and tests its influence on the immune checkpoint PD-L1 <i>in vitro</i> and <i>in vivo</i>. Nuclear-located TMEM199 regulates PD-L1 mRNA levels by binding to transcription factors such as IFNGR1, IRF1, MTMR9, and Trim28, which all promote PD-L1 mRNA expression. Our study demonstrates the nuclear localization of TMEM199 and its immune regulation functions in cancer development. We uncovered the nuclear localization of TMEM199. TMEM199 is involved in CD274 mRNA gene expression by the transcriptional regulation of the upstream transcription factors or cofactors of CD274, such as IFNGR1, IRF1, MTMR9, KAT8, and Trim28. The nuclear-located TMEM199 is reported to address the tumor immune microenvironment commanding function.

DCC
Also flagged:gene expressionaxonaltranscription factorsaxoncorticogenesisdendritic spine
Journal Article 2024-11-28 ✓ 2 Snippets Iyer A, Vaasjo LO, Siththanandan VB, K C R, Thurmon A, Akumuo M, Lu V, Nnebe C, Nair R, Galazo MJ, Tharin S.
In-Text Gene Mentions

…netrin-1 signaling throughDCC(DCC Netrin 1…

…signaling through DCC (DCC Netrin 1 receptorNetrin 1 receptor),…

Show Full Abstract

Different neuron types develop characteristic axonal and dendritic arborizations that determine their inputs, outputs, and functions. Expression of fate-determinant transcription factors is essential for specification of their distinct identities. However, the mechanisms downstream of fate-determinant factors coordinating different aspects of neuron identity are not understood. Specifically, how distinct projection neurons develop appropriate dendritic arbors that determine their inputs is unknown. Here, we investigate this question in corticospinal and callosal projection neurons. We identified a mechanism linking the corticospinal/corticofugal identity gene <i>Fezf2</i> with the regulation of dendritic development. We show that miR-193b∼365 microRNA cluster is regulated by <i>Fezf2</i> and enriched in corticospinal neurons. miR-193b∼365 represses mitogen-activated protein kinase 8 (MAPK8) to regulate corticospinal dendritic development. miR-193b∼365 overexpression in callosal neurons abnormally reduces MAPK8 signal and dendritic complexity. Our findings show that regulation of MAPK8 via miR-193b∼365 cluster regulates dendritic development, providing a mechanism that coordinates projection neuron identity, specified by <i>Fezf2</i>, and neuron-specific dendritic morphology.

Also flagged:Bladder cancerneoplasm of the urinarycancertumorbladder tumorneoplasm
Journal Article 2024-11-28 No Snippets Rico-Méndez MA, Ayala-Madrigal ML, González-Mercado A, Gutiérrez-Angulo M, Ramírez de Arellano Sánchez JA, Beltrán-Ontiveros SA, Contreras-Haro B, Gutiérrez-Hurtado IA, Moreno-Ortiz JM.
Show Full Abstract

Bladder cancer (BC) is the most common neoplasm of the urinary system and ranks tenth in global cancer incidence. Due to its high recurrence rate and the need for continuous monitoring, it is the cancer with the highest cost per patient. Cystoscopy is the traditional method for its detection and surveillance; however, this is an invasive technique, while non-invasive methods, such as cytology, have a limited sensitivity. For this reason, new non-invasive strategies have emerged, analyzing useful markers for BC detection from urine samples. The identification of tumor markers is essential for early cancer detection and treatment. Urine analysis offers a non-invasive method to identify these markers. Microsatellite instability (MSI) has been proposed as a promising marker for tumor cell detection and guided targeted therapies. Therefore, this review aims to explore the evidence supporting the identification of MSI in exfoliated bladder tumor cells (EBTCs) in the urine, emphasizing its potential as a non-invasive and clinically effective alternative for tumor identification. Furthermore, establishing clinical guidelines is crucial for standardizing its application in oncological screening and validating its clinical utility.

bioRxiv 2024-11-28 Preprint (No Snippets API) Oberegger S, Misslinger M, Haas H.
Show Full Abstract

<h4>ABSTRACT</h4> Accurate sensing of cellular iron levels is vital, as this metal is essential but toxic in excess. The iron-sensing transcription factor HapX is crucial for virulence of Aspergillus fumigatus, the predominant human mold pathogen. Its absence impairs growth under iron limitation and excess, but not under moderate iron availability, suggesting that HapX switches between three states to adapt to varying iron availability. This study suggests that the HapX state transitions are regulated by the different propensities of four phylogenetically conserved cysteine-rich regions (CRRs) to coordinate [2Fe-2S] clusters resulting in cumulative occupancies that depend on iron availability. In the iron starvation state, CRR-B and -C lack [2Fe-2S] clusters, the iron sufficiency/”neutral” state features clusters in CRR-B and/or -C and the iron excess state has clusters in all CRR-A, B, and -C, while CRR-D plays a minor role. Combinatorial mutation of CRR-B and -C blocked growth by locking HapX in the iron starvation state, leading to uncontrolled iron uptake, iron accumulation, repression of iron-consuming pathways and impaired iron detoxification. Loss of the C-terminal 27 amino acid region of HapX, which is crucial for the iron starvation state and was found to contain a degron, rescued the severe growth defect. Noteworthy, the - Fe state of HapX induced several gene clusters encoding secondary metabolites.

Also flagged:UBAC2reticulophagyendoplasmic reticulummacroautophagyautophagyunfolded
Journal Article 2024-11-27 No Snippets He X, Jin S.
Show Full Abstract

Reticulophagy selectively degrades fragments of the endoplasmic reticulum (ER) through macroautophagy/autophagy to maintain ER homeostasis. The deficiency of reticulophagy results in the unfolded protein response (UPR), which is a crucial clue to the pathogenesis of inflammatory diseases. However, the detailed mechanism underlying the cross-regulation between reticulophagy and inflammatory diseases remains largely unclear. Recently, we have revealed that UBAC2 (UBA domain containing 2) is essential for controlling ER homeostasis as a novel reticulophagy receptor. MARK2 catalyzes the phosphorylation of UBAC2 at serine (S) 223, hence facilitating the progression of reticulophagy and inhibiting ER stress-induced inflammatory responses.

SOX6
Also flagged:gliomaCancercancersgliomasglioblastomasGBM
Journal Article 2024-11-27 ✓ 5 Snippets Mikolajewicz N, Tatari N, Wei J, Savage N, Granda Farias A, Dimitrov V, Chen D, Zador Z, Dasgupta K, Aguilera-Uribe M, Xiao YX, Lee SY, Mero P, McKenna D, Venugopal C, Brown KR, Han H, Singh S, Moffat J.
In-Text Gene Mentions

…hits, Kras andSox6were top differential…

…GL261 oncogene andSox6being a transcriptional…

…(87 genes, e.g.,Sox6and Ptprz1 )…

…Finally,Sox6, although not…

…, 115 ],SOX6[ 109 ],…

Show Full Abstract

Cancer-intrinsic immune evasion mechanisms and pleiotropy are a barrier to cancer immunotherapy. This is apparent in certain highly fatal cancers, including high-grade gliomas and glioblastomas (GBM). In this study, we evaluated two murine syngeneic glioma models (GL261 and CT2A) as preclinical models for human GBM using functional genetic screens, single-cell transcriptomics and machine learning approaches. Through CRISPR genome-wide co-culture killing screens with various immune cells (cytotoxic T cells, natural killer cells, and macrophages), we identified three key cancer-intrinsic evasion mechanisms: NFκB signaling, autophagy/endosome machinery, and chromatin remodeling. Additional fitness screens identified dependencies in murine gliomas that partially recapitulated those seen in human GBM (e.g., UFMylation). Our single-cell analyses showed that different glioma models exhibited distinct immune infiltration patterns and recapitulated key immune gene programs observed in human GBM, including hypoxia, interferon, and TNF signaling. Moreover, in vivo orthotopic tumor engraftment was associated with phenotypic shifts and changes in proliferative capacity, with murine tumors recapitulating the intratumoral heterogeneity observed in human GBM, exhibiting propensities for developmental- and mesenchymal-like phenotypes. Notably, we observed common transcription factors and cofactors shared with human GBM, including developmental (Nfia and Tcf4), mesenchymal (Prrx1 and Wwtr1), as well as cycling-associated genes (Bub3, Cenpa, Bard1, Brca1, and Mis18bp1). Perturbation of these genes led to reciprocal phenotypic shifts suggesting intrinsic feedback mechanisms that balance in vivo cellular states. Finally, we used a machine-learning approach to identify two distinct immune evasion gene programs, one of which represents a clinically-relevant phenotype and delineates a subpopulation of stem-like glioma cells that predict response to immune checkpoint inhibition in human patients. This comprehensive characterization helps bridge the gap between murine glioma models and human GBM, providing valuable insights for future therapeutic development.

Also flagged:myocardial infarctionmyocarditiscardiovascular diseasescardiovascular diseaseinflammatory responsedeath
Journal Article 2024-11-27 No Snippets Zhang Z, Du H, Gao W, Zhang D.
Show Full Abstract

Macrophages are crucial in the heart's development, function, and injury. As part of the innate immune system, they act as the first line of defense during cardiac injury and repair. After events such as myocardial infarction or myocarditis, numerous macrophages are recruited to the affected areas of the heart to clear dead cells and facilitate tissue repair. This review summarizes the roles of resident and recruited macrophages in developing cardiovascular diseases. We also describe how macrophage phenotypes dynamically change within the cardiovascular disease microenvironment, exhibiting distinct pro-inflammatory and anti-inflammatory functions. Recent studies reveal the values of targeting macrophages in cardiovascular diseases treatment and the novel bioengineering technologies facilitate engineered macrophages as a promising therapeutic strategy. Engineered macrophages have strong natural tropism and infiltration for cardiovascular diseases aiming to reduce inflammatory response, inhibit excessive fibrosis, restore heart function and promote heart regeneration. We also discuss recent studies highlighting therapeutic strategies and new approaches targeting engineered macrophages, which can aid in heart injury recovery.

SERPINC1
Also flagged:PGPprophageBitter rotleaf spotappleplant diseases
Journal Article 2024-11-27 ✓ 1 Snippet Das VA, Gautam B, Yadav PK, Varadwaj PK, Wadhwa G, Singh S.
In-Text Gene Mentions

…genomic island GIAK-III, only a single…

Show Full Abstract

A comparative genomic analysis approach provides valuable information about genetic variations and evolutionary relationships among microorganisms, aiding not only in the identification of functional genes responsible for traits such as pathogenicity, antibiotic resistance, and metabolic capabilities but also in enhancing our understanding of microbial genomic diversity and their ecological roles, such as supporting plant growth promotion, thereby enabling the development of sustainable strategies for agriculture. We used two strains from different Bacillus species, Bacillus velezensis AK-0 and Bacillus atrophaeus CNY01, which have previously been reported to have PGP activity in apple, and performed comparative genomic analysis to understand their evolutionary process and obtain a mechanistic understanding of their plant growth-promoting activity. We identified genomic features such as mobile genetic elements (MGEs) that encode key proteins involved in the survival, adaptation and growth of these bacterial strains. The presence of genomic islands and intact prophage DNA in Bacillus atrophaeus CNY01 and Bacillus velezensis AK-0 suggests that horizontal gene transfer has contributed to their diversification and acquisition of adaptive traits, enhancing their evolutionary advantage. We also identified novel DNA motifs that are associated with key physiological processes and metabolic pathways.

Also flagged:neurofibromatosisSchwannomatosispathogenesisNFgenetic disordertumors
Journal Article 2024-11-27 No Snippets Hussain MS, Sharma S, Kumari A, Kamran A, Bahl G, Bisht AS, Sultana A, Ashique S, Ramalingam PS, Arumugam S.
Show Full Abstract

Neurofibromatosis (NF) is identified as genetic disorder characterized by multiple tumors on nerve tissues. NF1 is the most prevalent form, identified by neurofibromas and skin changes. NF1 is the most prevalent neurofibromatosis disorder, distinct from the rarer NF2 and schwannomatosis (SWN) conditions. NF2, including NF2-related SWN (NF2-SWN), predominantly involves schwannoma formation and differs from <i>NF1</i> in its genetic basis and clinical presentation. Despite the established genetic basis of NF, effective treatments remain scarce. Long non-coding RNAs (lncRNAs) have emerged as important regulators of gene expression, impacting pathways vital to tumor biology. This review explores the lncRNAs role in NF pathogenesis along with their potential as therapeutic targets. LncRNAs such as <i>ANRIL</i> and <i>H19</i> show dysregulated expression in NF, influencing signaling pathways like Ras/MAPK and JAK/STAT, thereby contributing to tumor development. Understanding these interactions sheds light on the molecular mechanisms underlying NF and highlights lncRNAs as potential biomarkers of diagnosis and prognosis of NF. Additionally, therapeutic strategies targeting lncRNAs with antisense oligonucleotides (ASOs) or CRISPR-Cas9 offer promising treatment options. The present review emphasizes crucial role of lncRNAs in NF pathogenesis and their promise to create innovative treatments, aiming to improve patient outcomes and meet the urgent need for effective NF therapies.

CSE1L
Also flagged:CaMKIIRIG-Ihost-cellpeptideM3kinase
Journal Article 2024-11-27 ✓ 1 Snippet Hama S, Watanabe-Takahashi M, Nishimura H, Omi J, Tamada M, Saitoh T, Maenaka K, Okuda Y, Ikegami A, Kitagawa A, Furuta K, Izumi K, Shimizu E, Nishizono T, Fujiwara M, Miyasaka T, Takamori S, Takayanagi H, Nishikawa K, Kobayashi T, Toyama-Sorimachi N, Yamashita M, Senda T, Hirokawa T, Bito H, Nishikawa K.
In-Text Gene Mentions

…nuclear trafficking proteinCSE1Land Ca 2+…

Show Full Abstract

Ca<sup>2+</sup>/calmodulin-dependent protein kinase II (CaMKII) is one of hundreds of host-cell factors involved in the propagation of type A influenza virus (IAV), although its mechanism of action is unknown. Here, we identified CaMKII inhibitory peptide M3 by targeting its kinase domain using affinity-based screening of a tailored random peptide library. M3 inhibited IAV cytopathicity and propagation in cells by specifically inhibiting the acute-phase activation of retinoic acid-inducible gene I (RIG-I), which is uniquely regulated by CaMKII. Downstream of the RIG-I pathway activated TBK1 and then IRF3, which induced small but sufficient amounts of transcripts of the genes for IFN α/β to provide the capped 5'-ends that were used preferentially as primers to synthesize viral mRNAs by the cap-snatching mechanism. Importantly, knockout of <i>RIG-I</i> in cells almost completely inhibited the expression of IFN mRNAs and subsequent viral NP mRNA early in infection (up to 6 h after infection), which then protected cells from cytopathicity 24 h after infection. Thus, CaMKII-dependent acute-phase activation of RIG-I promoted IAV propagation, whereas the canonical RIG-I pathway stimulated antiviral activity by inducing large amounts of mRNA for IFNs and then for antiviral proteins later in infection. Co-administration of M3 with IAV infection rescued mice from the lethality and greatly reduced proinflammatory cytokine mRNA expression in the lung, indicating that M3 is highly effective against IAV <i>in vivo</i>. Thus, regulation of the CaMKII-dependent non-canonical RIG-I pathway may provide a novel host-factor-directed antiviral therapy.IMPORTANCEThe recent emergence of IAV strains resistant to commonly used therapeutic agents that target viral proteins has exacerbated the need for innovative strategies. Here, we originally identified CaMKII-inhibitory peptide M3, which efficiently inhibits IAV-lethality <i>in vitro</i> and <i>in vivo</i>. M3 specifically inhibited the acute-phase activation of RIG-I, which is a novel pathway to promote IAV propagation. Thus, this pathway acts in an opposite manner compared with the canonical RIG-I pathway, which plays essential roles in antiviral innate immune response later in infection. The CaMKII-dependent non-canonical RIG-I pathway can be a promising and novel drug target for the treatment of infections.

ZNFX1
Also flagged:IFNαIL1ACSF1RC1QAC1RC1S
Journal Article 2024-11-27 ✓ 5 Snippets Topper MJ, Guarnieri JW, Haltom JA, Chadburn A, Cope H, Frere J, An J, Borczuk A, Sinha S, Kim J, Park J, Butler D, Meydan C, Foox J, Bram Y, Richard SA, Epsi NJ, Agan B, Chenoweth JG, Simons MP, Tribble D, Burgess T, Dalgard C, Heise MT, Moorman NJ, Baxter VK, Madden EA, Taft-Benz SA, Anderson EJ, Sanders WA, Dickmander RJ, Beigel K, Widjaja GA, Janssen KA, Lie T, Murdock DG, Angelin A, Soto Albrecht YE, Olali AZ, Cen Z, Dybas J, Priebe W, Emmett MR, Best SM, Kelsey Johnson M, Trovao NS, Clark KB, Zaksas V, Meller R, Grabham P, Schisler JC, Moraes-Vieira PM, Pollett S, Mason CE, Syrkin Wurtele E, Taylor D, Schwartz RE, Beheshti A, Wallace DC, Baylin SB.
In-Text Gene Mentions

…This linkage between mitochondrial dysfunction and the innate immune system links to these dynamics and SARS-CoV-2 induction ofZNFX1and ZBP1.…

…noncanonical genes, encodingZNFX1, ZBP1, GSDMB, XAF1,…

…the top one,ZNFX1, encodes a zinc…

…genes and alsoZNFX1, SERPING1 ,…

…germline mutations inZNFX1, our top upregulated…

Show Full Abstract

Lethal COVID-19 outcomes are attributed to classic cytokine storm. We revisit this using RNA sequencing of nasopharyngeal and 40 autopsy samples from patients dying of SARS-CoV-2. Subsets of the 100 top-upregulated genes in nasal swabs are upregulated in the heart, lung, kidney, and liver, but not mediastinal lymph nodes. Twenty-two of these are "noncanonical" immune genes, which we link to components of the renin-angiotensin-activation-system that manifest as increased fibrin deposition, leaky vessels, thrombotic tendency, PANoptosis, and mitochondrial dysfunction. Immunohistochemistry of mediastinal lymph nodes reveals altered architecture, excess collagen deposition, and pathogenic fibroblast infiltration. Many of the above findings are paralleled in animal models of SARS-CoV-2 infection and human peripheral blood mononuclear and whole blood samples from individuals with early and later SARS-CoV-2 variants. We then redefine cytokine storm in lethal COVID-19 as driven by upstream immune gene and mitochondrial signaling producing downstream RAAS (renin-angiotensin-aldosterone system) overactivation and organ damage, including compromised mediastinal lymph node function.

PEBP1
Also flagged:posttranslational modificationsproteolysislysineBUPproteasedigestion
Journal Article 2024-11-27 ✓ 1 Snippet Zou Y, Huang CF, Sturrock GR, Kelleher NL, Fitzgerald MC.
In-Text Gene Mentions

PEBP1

Show Full Abstract

The crucial roles of proteoforms in biological processes and disease mechanisms have been increasingly recognized. However, the rate at which new proteoforms are being discovered using top-down proteomics has far outpaced the rate at which the functional significance of different proteoforms can be determined. Because of the close connection between protein folding and protein function, protein folding stability measurements on proteoforms have the potential to identify functionally significant proteoforms of a given protein. While a number of mass spectrometry-based proteomics methods for making protein folding stability measurements on the proteomic scale have been reported over the past decade, none have been interfaced with top-down proteomics. Described here is a top-down (TD) stability of proteins from the rates of oxidation (SPROX) approach for making proteoform specific folding stability measurements. This approach is validated using a mixture of three model proteins with well-characterized protein folding behavior by conventional SPROX as well as other more conventional biophysical techniques. The method is also used to evaluate the relative folding stabilities of the <30 kDa protein fraction isolated from an MCF-7 cell lysate. The relative folding stabilities of 150 proteoforms from 83 proteins were successfully characterized in the cell lysate analysis using the TD-SPROX approach.

Also flagged:alcoholchromosomechromosomeschromosomal regionshuman leukocyte antigentHLA
Journal Article 2024-11-27 No Snippets Schaid DJ, McDonnell SK, Akhtari FS, Sinnwell JP, Batzler A, Cobran EK, Motsinger-Reif A.
Show Full Abstract

The use of polygenic scores (PGS) for personalized medicine has gained momentum, along with caution to avoid accentuating health disparities. Greater ancestral diversity in genetic studies is needed, as well as close attention to the social determinants of health (SDoH).We measured the correlations between 3,030 PGS from the PGS Catalog and SDoH among participants in the Personalized Environment and Genes Study (PEGS). Correlations mainly ranged from -0.05 to 0.05, yet there was a heterogeneity of correlations across SDoH themes, with the largest amount of heterogeneity for PGS predicting body measures and smoking, as well as some common diseases. We also quantify the expected bias of PGS effect size on disease risk when strong predictors, such as SDoH, are omitted from models, emphasizing the importance of including SDoH with PGS to avoid biased estimates of PGS risk and to achieve equitable precision medicine.

SERPINC1
Also flagged:enoxaparinargatrobanhemostaticclottingcoagulationthrombin
Journal Article 2024-11-27 ✓ 1 Snippet Gratz J, Ulbing S, Schäfer F, Koch S, Dibiasi C, Wiegele M, Quehenberger P, Schaden E.
In-Text Gene Mentions

…ombin inhibition (STA-STACHROMATIII; Diagnostica Stago, Asnieres,…

Show Full Abstract

Owing to the simultaneous increase in the risk of thrombosis and bleeding in critically ill patients, point-of-care-available diagnostic tests to guide parenteral anticoagulation are warranted. We evaluated the detection of enoxaparin and argatroban, two commonly used parenteral anticoagulants, using the novel ClotPro viscoelastic coagulometer. For this experimental in vitro study at a tertiary care academic center, blood samples were drawn from twelve (six female, six male) healthy volunteers without intake of antithrombotic medication and no history of hemostatic disorders. Blood samples were spiked with enoxaparin (IU.ml<sup>- 1</sup>) and argatroban (µg.ml<sup>- 1</sup>) at increasing concentrations ranging from 0 to 1. The ClotPro Russell's viper venom (RVV)-test and the ClotPro ecarin (ECA)-test clotting time were performed in parallel with conventional coagulation tests (anti-Xa activity, activated partial thromboplastin time, and diluted thrombin time). We observed a strong correlation between anti-Xa activity and the RVV-test clotting time (r = 0.88 (95% confidence interval (CI) 0.8-0.92; p < 0.001)). Although clotting time cutoff values of 71 and 145 s provided high sensitivity and specificity for detecting anti-Xa activity of ≤ 0.1 and ≥0.6 IU.ml<sup>- 1</sup>, we found a poor performance at both high and low concentrations. The ECA-test clotting time revealed a very strong correlation with activated partial thromboplastin time (r = 0.96 (95% CI 0.93-0.97; p < 0.001)) and diluted thrombin time (r = 0.97 (95% CI 0.96-0.98; p < 0.001)). The clotting time cutoff values of 86 and 298-431 s provided high sensitivity and specificity for detecting diluted thrombin time values ≤ 0.1 and 0.5-1 µg.ml<sup>- 1</sup>. Our results suggest that the RVV test is an unreliable method for monitoring enoxaparin treatment, whereas the ECA-test might be an accurate point-of-care alternative for detecting argatroban concentration with potential advantages over standard coagulation tests in terms of point-of-care applicability and turnaround time.

FBXL4
Also flagged:methylationaging5-methylcytosinelong interspersed nuclearchromatindemethylation
Journal Article 2024-11-27 ✓ 1 Snippet Morandini F, Lu JY, Rechsteiner C, Shadyab AH, Casanova R, Snively BM, Seluanov A, Gorbunova V.
In-Text Gene Mentions

…an intron ofFBXL4, a gene…

Show Full Abstract

Transposable elements (TEs) are DNA sequences that expand selfishly in the genome, possibly causing severe cellular damage. While normally silenced, TEs have been shown to activate during aging. DNA 5-methylcytosine (5mC) is one of the main epigenetic modifications by which TEs are silenced and has been used to train highly accurate age predictors. Yet, one common criticism of such predictors is that they lack interpretability. In this study, we investigate the changes in TE 5mC methylation that occur during aging in human blood using published methylation array data. We find that evolutionarily young long interspersed nuclear elements 1 (L1s), the only known TEs capable of autonomous transposition in humans, undergo the fastest loss of 5mC methylation, suggesting an active mechanism of de-repression. The same young L1s also showed preferential gain in chromatin accessibility but not expression. The long terminal repeat retrotransposons THE1A and THE1C also showed very rapid 5mC loss. We then show that accurate age predictors can be trained on both 5mC methylation of individual TE copies and average methylation of TE families genome wide. Lastly, we show that while old L1s gradually lose 5mC during the entire lifespan, demethylation of young L1s only happens late in life and is associated with cancer.

MRPL39
Also flagged:Down syndromeADchromosomepathogenesisintellectual disabilitycognitive decline
Journal Article 2024-11-27 ✓ 1 Snippet Alldred MJ, Ibrahim KW, Pidikiti H, Chiosis G, Mufson EJ, Stutzmann GE, Ginsberg SD.
In-Text Gene Mentions

…itochondrial ribosomal proteinMRPL39is involved in…

Show Full Abstract

Selective vulnerability of neuronal populations occurs in both Down syndrome (DS) and Alzheimer's disease (AD), resulting in disproportional degeneration of pyramidal neurons (PNs) affecting memory and executive function. Elucidating the cellular mechanisms underlying the selective vulnerability of these populations will provide pivotal insights for disease progression in DS and AD. Single population RNA-sequencing analysis was performed on neurons critical for executive function, prefrontal cortex Brodmann area 9 (BA9) layer III (L3) and layer V (L5) excitatory PNs in postmortem human DS and age- and sex-matched control (CTR) brains. Data mining was performed on differentially expressed genes (DEGs) from PNs in each lamina with DEGs divergent between lamina identified and interrogated. Bioinformatic inquiry of L3 PNs revealed more unique/differentially expressed DEGs (uDEGs) than in L5 PNs in DS compared to CTR subjects, indicating gene dysregulation shows both spatial and cortical laminar projection neuron dependent dysregulation. DS triplicated human chromosome 21 (HSA21) comprised a subset of DEGs only dysregulated in L3 or L5 neurons, demonstrating partial cellular specificity in HSA21 expression. These HSA21 uDEGs had a disproportionally high number of noncoding RNAs, suggesting lamina specific dysfunctional gene regulation. L3 uDEGs revealed overall more dysregulation of cellular pathways and processes, many relevant to early AD pathogenesis, while L5 revealed processes suggestive of frank AD pathology. These findings indicate that trisomy differentially affects a subpopulation of uDEGs in L3 and L5 BA9 projection neurons in aged individuals with DS, which may inform circuit specific pathogenesis underlying DS and AD.

HTT
Also flagged:affective disordersgene expressiondepressionanxiety disordersresponse toserotonin transporter
Journal Article 2024-11-27 ✓ 5 Snippets Kuznetsova M, Wilson C, Cheng L, Pang T, Li S, Roberts BR, Lago LC, Tran H, Hill AF, Hannan AJ, Renoir T.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) knockout (KO) mouse…

…67 proteins in 5-HTTKO mice compared…

…DE proteins in 5-HTTKO mice.…

…(due to the5-HTTKO gene mutation)…

…found altered in5-HTTKO mice, while…

Show Full Abstract

Environmental changes may alter gene expression in depression and anxiety disorders through epigenetic regulation, including via small non-coding RNAs (sncRNAs) and their major subclass, microRNAs (miRNAs). However, underlying mechanisms mediating miRNA regulation in response to changing environmental stimuli are unclear. Using the serotonin transporter (5-HTT) knockout (KO) mouse model of depression/anxiety, this study aimed to compare the effects of voluntary exercise (EX) versus chronic treatment with the stress hormone corticosterone (CT), on hippocampal miRNA transcriptome and proteome in five comparison groups: WT-SH vs. KO-SH; WT-SH vs. WT-EX; KO-SH vs. KO-EX; WT-SH vs. WT-CT; KO-SH vs. KO-CT. We hypothesized that treatment with stress hormone will result in miRNA and proteomics changes observed in genetic model of depression, while exercise will have beneficial effects similar to antidepressant treatment. Using high-throughput sequencing of miRNAs and mass spectrometry (MS)-based approaches for protein expression, we revealed 337 differentially expressed (DE) miRNAs and 67 proteins in 5-HTT KO mice compared to wild-type (WT) control mice in standard-housing conditions. After exercise, there were 200 DE miRNAs and 3 DE proteins in WT mice, and 20 DE miRNAs and 95 DE proteins in 5-HTT KO mice, while corticosterone treatment led to 168 DE miRNAs and 1 DE protein in WT, and 21 DE miRNAs and 21 DE proteins in 5-HTT KO mice. Serotonergic dysfunction (due to the 5-HTT KO gene mutation) induced altered expression of miRNAs and proteins involved in regulation of neurodevelopment, neurogenesis and neuroinflammatory responses. Treatment with the stress hormone corticosterone in WT mice activated pathways which were also found altered in 5-HTT KO mice, while exercise caused antidepressant-like effects. These findings suggest that functional 5-HTT might be required for the beneficial effects of exercise on miRNA expression. Our study is the first to explore how gene-environment interactions affect miRNA/proteomic composition in a mouse model of depression/anxiety, and extends our understanding of gene-environmental interactions underlying these affective disorders.

Also flagged:Indomethacincancerlipidphospholipidphosphatidylcholineoleic acid
Journal Article 2024-11-27 No Snippets Thiruchenthooran V, Świtalska M, Maciejewska G, Palko-Łabuz A, Bonilla-Vidal L, Wietrzyk J, Souto EB, Sánchez-López E, Gliszczyńska A.
Show Full Abstract

<h4>Purpose</h4>It is well known that the nonsteroidal anti-inflammatory drug (NSAID) indomethacin (IND) exhibits significant anticancer potential reported not only by in vitro and in vivo studies, but also in clinical trials. Despite promising results, IND is not widely used as an adjunctive agent in cancer therapy due to the occurrence of several gastrointestinal side effects, primarily after oral administration. Therefore, this study aimed to develop a nanosystem with reduced toxicity and risk of side effects for the delivery of IND for cancer treatment.<h4>Methods</h4>IND was encapsulated in nanostructured lipid carriers (NLC) in the form of a phospholipid conjugate, where a covalent bond exists between the drug and phosphatidylcholine skeleton. For this purpose, seven new hybrid molecules were synthesized, and subsequently evaluated as anticancer agents in an in vitro model against selected cancer cell lines.<h4>Results</h4>Biological studies demonstrated that the synthesized conjugates possessed excellent antiproliferative effects, exhibiting a 2.7-fold to even 100-fold higher activity against selected cancer cells, while remaining non-toxic to healthy cells. Based on biological studies and molecular calculations, heterosubstituted phosphatidylcholine containing IND and oleic acid (IND-OA-PC) in the <i>sn</i>-1 and <i>sn</i>-2 positions, respectively, was identified as the most potent molecule. Subsequently, IND-OA-PC was encapsulated in nanostructured lipid carriers (IND-OA-PC-NLC). The results revealed that IND-OA-PC-NLC has a spherical shape with an average diameter of 155 nm and a negatively charged surface (-17.4 ± 0.49 mV). In this study, it was proven that the encapsulated conjugate of indomethacin with PC exhibits high activity against triple-negative (TNBC, Her2-, PR-, and ER-) breast cancer cells MDA-MB-468. While free IND was active at a concentration of 270.5 μM, in the form of the phospholipid conjugate (IND-OA-PC), it inhibited the growth of cancer cells at 67.5 μM and after conjugate encapsulation (IND-OA-PC-NLC) it was effective at only 10.3 μM.<h4>Conclusion</h4>Our study revealed that the conjugation of NSAID with phosphatidylcholine and its combination with nanotechnology techniques create opportunities to repurpose well-known drugs from this group for new therapeutic applications.

OLFM4
Also flagged:Gastric cancertumourmicroribonucleic acidsangiogenesisSASH1luciferase
Journal Article 2024-11-27 ✓ 1 Snippet Yan H, Cai X, Zhang J, Zhao H, Wu H, Zhang J, Xu L, Liu S, Zang Y, Fu S.
In-Text Gene Mentions

…MTAP, MXI1, PRKAA2,OLFM4, WIF1, TRIM32, DDX58,…

Show Full Abstract

Exosomes, key components of the tumour microenvironment, can mediate intercellular communication through the delivery of various signalling molecules, including microribonucleic acids (miRNAs), and ultimately participate in regulating the process of tumour development. In this study, we aimed to investigate the reason and mechanism by which exosomal miRNAs derived from gastric cancer cells affect carcinogenesis and metastasis. Among these miRNAs, microRNA-128-3p (miR-128-3p) was highly expressed in serum exosomes isolated from gastric cancer patients, as confirmed by high-throughput sequencing and subsequent experiments. Coculture of gastric cancer-derived exosomes overexpressing miR-128-3p with human umbilical vein endothelial cells (HUVECs) significantly enhanced HUVEC proliferation, migratio n and angiogenesis. Bioinformatics analysis suggested SASH1 as the target gene of miR-128-3p. The dual luciferase assay and Western blot analysis results confirmed that miR-128-3p directly targeted SASH1 to inhibit its expression in HUVECs. Therefore, this study provides preliminary evidence that gastric cancer-derived exosomal miR-128-3p promotes tumour angiogenesis by targeting SASH1, reveals the potential diagnostic and therapeutic value of cancer-derived exosomal miR-128-3p, and provides new insights into the novel molecular mechanisms regulating metastasis. This study provides further information for understanding the role of gastric cancer-derived exosomal miR-128-3p in cancer progression and to discover new therapeutic targets.

HFE
Also flagged:FAPfibroblast activation proteinlocalizationcholangiocarcinomahepatocellular carcinomahepatocellular adenoma
Journal Article 2024-11-27 ✓ 1 Snippet Jorgenson LC, Torbenson MS, Halfdanarson TR, Kankeu Fonkoua LA, Tran NH, Roberts LR, Smoot RL, Goenka AH, Thompson SM.
In-Text Gene Mentions

…hepatitis C virus,hemochromatosis, inflammatory bowel disease,…

Show Full Abstract

<h4>Purpose</h4>The aims of this study were to evaluate and compare fibroblast activation protein (FAP) expression and localization in surgically resected cholangiocarcinoma (CCA), primary and metastatic hepatocellular carcinoma (HCC), hepatocellular adenoma (HCA), and focal nodular hyperplasia (FNH), and to identify any association between CCA clinical or pathologic features and FAP expression.<h4>Materials and methods</h4>FAP immunostaining from surgically resected CCA (<i>N</i> = 58), primary intrahepatic and extrahepatic metastatic HCC (<i>N</i> = 148), HCA (N26), and FNH (<i>N</i> = 19) was scored (negative, weak positive, moderate positive or strong positive) from tissue microarrays. FAP expression was compared between groups. CCA FAP expression was compared to clinical and tumor pathology features.<h4>Results</h4>Moderate-strong FAP expression in the tumor stroma was present in 93.1% of CCA, 60.7% of extrahepatic metastatic HCC, 29.6% of primary HCC, 21.1% of FNH, and 11.6% of HCA. Moderate-strong FAP expression in tumor stroma was significantly more prevalent in CCA than HCC (<i>p</i> < 0.001), metastatic HCC (<i>p</i> = 0.005), HCA (<i>p</i> < 0.001) and FNH (<i>p</i> < 0.001). FAP was expressed in the stroma of all but one CCA (1.7%), and FAP expression in CCA tumor stroma was not associated with any clinical or tumor pathology features (<i>p</i> > 0.05, all).<h4>Conclusion</h4>FAP is expressed in the stroma of a high proportion (93%) of primary CCA independent of patient clinical or tumor pathology features. As such, these data provide the tissue basis for systematically evaluating FAP as a theranostic target across a broad range of CCA subtypes.

HFE
Also flagged:metabolic liver diseasesLiver diseasesliver diseasealpha-1-antitrypsin deficiencychronic liver diseases
Journal Article 2024-11-27 ✓ 1 Snippet Wang M, Zheng S, Li X.
In-Text Gene Mentions

…on Wilson’s disease,hemochromatosisand alpha-1-antitrypsin defici…

Show Full Abstract

No abstract available.

Also flagged:GentamicinCalcium Phosphateironmetalsdegradationinfections
Journal Article 2024-11-27 No Snippets Petráková M, Gorejová R, Shepa J, Macko J, Kupková M, Petruš O, Baláž M, Sopčák T, Mičušík M, Kožár M, Hajdučková V, Oriňaková R.
Show Full Abstract

In the past decades, iron has been one of the intensively studied biodegradable metals due to its suitable mechanical properties, but it suffers from slow degradation in a physiological environment and low bioactivity. In this work, the beneficial properties of ceramic and polymer coatings were merged to enhance the corrosion properties and biological compatibility of Fe-based biomaterials. A new bilayer coating for Fe-based biomaterials that speeds up degradation while offering controlled, localized drug release to prevent infections was prepared. In addition, bioactive coatings with an incorporated antibiotic (gentamicin, Ge) were produced to introduce antibacterial properties into the prepared biomaterials and thus increase their bioactivity. The calcium phosphate (CaP) coating layer as well as a bioactive coating layer of CaP doped with gentamicin was electrochemically deposited onto an iron substrate. A layer of poly(ethylene glycol) was subsequently applied to the selection of prepared specimens to create a bilayer ceramic/polymer coating. Electrochemical and immersion corrosion tests revealed that the application of a bilayer coating allowed achieving the desired acceleration of degradation, while the application of only a ceramic coating led to a reduction in the corrosion rate. A slight increase in the corrosion rate was observed for samples with bioactive drug-containing coatings compared to samples with drug-free coatings. Higher viability of human fibroblastic cells cultured in the extracts of the tested samples was noted for samples with a bilayer coating compared to a ceramic coating. The addition of gentamicin in the bioactive coatings had no significant effect on the viability value. Antibacterial tests proved the antibacterial activity of samples with a gentamicin-loaded coating layer against <i>Escherichia coli</i> and <i>Staphylococcus aureus</i> strains. A detailed study of the release of gentamicin from the prepared coatings revealed a different mechanism of drug release from the ceramic and the ceramic/polymer coating. Furthermore, it was found that the drug was released more slowly and uniformly from the bilayer coating. It is therefore possible to adjust the amount and duration of drug release from the bioactive coating by the thickness of the upper polymer layer. Incorporation of an antibiotic in a combined ceramic/polymer coating enabled the creation of a high-performance bioactive coating for Fe bone implants with the possibility to release a drug in the vicinity of the implant in a controlled manner to address the needs of the patient.

SUDS3
Also flagged:gene expressionlong interspersed elements-1methylationfactorsOCT4SOX2
Journal Article 2024-11-27 ✓ 1 Snippet Sakaloglou P, Lazaros L, Bouba I, Markoula S, Zikopoulos A, Drakaki E, Anagnostaki I, Potiris A, Stavros S, Gerede A, Domali E, Drakakis P, Tzavaras T, Georgiou I.
In-Text Gene Mentions

…factors, such aspolycomb repressiverepressive complexes (PRCs),…

Show Full Abstract

Retrotransposable elements are implicated in genome rearrangements and gene expression alterations that result in various human disorders. In the current study, we sought to investigate the potential effects of long interspersed elements-1 (LINE-1) overexpression on the integrity and methylation of DNA and on the expression of three major pluripotency factors (OCT4, SOX2, NANOG) during the preimplantation stages of human embryo development. Human MI oocytes were matured in vitro to MII and transfected through intracytoplasmic sperm injection (ICSI) either with an EGFP vector carrying a cloned active human LINE-1 retroelement or with the same EGFP vector without insert as control. The occurrence of retrotransposition events was screened by fluorescent microscopy. The in vitro preimplantation development as well as the methylation, pluripotency, and DNA double-strand breaks (DSBs) of the transfected embryos were examined. LINE-1 retrotransposons gave rise to new retrotransposition events in the transfected embryos. LINE-1 injected embryos were characterized by accelerated asymmetrical cell division, multiple cellular fragments, cleavage arrest, and degeneration. Early OCT4 expression remained unaltered, but cleavage arrest and a high fragmentation rate hindered the expression of SOX2/NANOG at the morula stage. Increased DNA DSBs were observed in cleavage-stage blastomeres, while no methylation changes were detected before the cleavage arrest. Our data provide evidence that LINE-1 retrotransposition in human preimplantation embryos may induce DNA DSBs, while at the same time, it appears to interfere with the expression patterns of pluripotency factors. The morphological, structural, and cleavage abnormalities of the transfected embryos show that aberrant retroelement expression may negatively affect human embryo development.

MLLT10
Also flagged:Polo-like Kinase 1PLK-1cell cycleAurora kinase AMLLRearranged Leukemia
Journal Article 2024-11-27 ✓ 1 Snippet Fischer J, Erkner E, Radszuweit P, Hentrich T, Keppeler H, Korkmaz F, Schulze-Hentrich J, Fitzel R, Lengerke C, Schneidawind D, Schneidawind C.
In-Text Gene Mentions

…thyltransferase DOT1L CofactorMLLT10( AF10 ),…

Show Full Abstract

<i>MLL</i>-rearranged (<i>MLL</i>r) leukemia is characterized by a poor prognosis. Depending on the cell of origin, it differs in the aggressiveness and therapy response. For instance, in adults, volasertib blocking Polo-like kinase 1 (PLK-1) exhibited limited success. Otherwise, PLK-1 characterizes an infant <i>MLL</i>r signature, indicating potential sensitivity. By using our CRISPR/Cas9 <i>MLL</i>r model in CD34+ cells from human cord blood (huCB) and bone marrow (huBM) mimicking the infant and adult patient diseases, we were able to shed light on this phenomenon. The <i>PLK-1</i> mRNA level was significantly increased in our huCB compared to the huBM model, which was underpinned by analyzing infant and adult <i>MLL</i>r leukemia patients. Importantly, the expression levels correlated with a functional response. Volasertib induced a significant dose-dependent decrease in proliferation and cell cycle arrest, most pronounced in the infant model. Mechanistically, upon volasertib treatment, we uncovered negative feedback only in the huBM model by compensatory upregulation of <i>PLK-1</i> and related genes like <i>AURKA</i> involved in mitosis. Importantly, the poor response could be overcome by a combinatorial strategy with alisertib, an Aurora kinase A inhibitor. Our study emphasizes the importance of considering the cell of origin in therapeutic decision-making and provides the rationale for evaluating volasertib and alisertib in <i>MLL</i>r leukemia.

Also flagged:Phosphorusdegradationwaterorganic acidscitric,gluconic,
Journal Article 2024-11-27 No Snippets García-Berumen JA, Flores de la Torre JA, de Los Santos-Villalobos S, Espinoza-Canales A, Echavarría-Cháirez FG, Gutiérrez-Bañuelos H.
Show Full Abstract

Phosphorus (P) is an essential element for plant growth, playing a crucial role in various metabolic processes. Despite its importance, phosphorus availability in soils is often restricted due to its tendency to form insoluble complexes, limiting plant uptake. The increasing demand for phosphorus in agriculture, combined with limited global reserves of phosphate rock, has created challenges for sustainable plant production. Additionally, the overuse of chemical phosphorus fertilizers has resulted in environmental degradation, such as eutrophication of water bodies. Increasing agronomic phosphorus (P) efficiency is crucial because of population growth and increased food demand. Hence, microorganisms involved in the P cycle are a promising biotechnological strategy that has gained global interest in recent decades. Microorganisms' solubilization of phosphate rock (PR) is an environmentally sustainable alternative to chemical processing for producing phosphate fertilizers. Phosphorus-solubilizing microorganisms (PSMs), including bacteria and fungi, and their enzymatic processes offer an eco-friendly and sustainable alternative to chemical inputs by converting insoluble phosphorus into forms readily available for plant uptake. Integrating PSMs into agricultural systems presents a promising strategy to reduce dependence on chemical fertilizers, enhance soil health, and contribute to the transition toward more sustainable and resilient agricultural practices. It can be an alternative that reduces the loss of phosphorus in the environment, especially the eutrophication of aquatic systems. This paper explores the challenges of phosphorus availability in agriculture and the potential of microbial phosphorus solubilization as a sustainable alternative to conventional practices.

PEBP1
Also flagged:caspase 3-cell activationviremiaCD4cell proliferation
Journal Article 2024-11-27 ✓ 1 Snippet Jain J, Pham TNQ, Begum S, Romero-Medina MC, Bellini N, Li Y, Dallaire F, Béland K, Patey N, Guimond JV, Haddad É, Zhai Y, Cohen ÉA.
In-Text Gene Mentions

…binding protein 1 (PEBP1) agonists reactivate HIV…

Show Full Abstract

Latent viral reservoirs (VRs) represent a main barrier to HIV cure. Thus, developing new approaches that can purge and eliminate VRs paves the path toward achieving an HIV-1 cure. APG-1387, a bivalent SMAC mimetic (SM), efficiently reactivates latent HIV expression in T cell line models and enhances active caspase 3 expression, a condition that typically leads to apoptosis. In primary CD4<sup>+</sup> T cells infected with a dual reporter-encoded HIV, APG-1387 decreases latently infected cells without a notable effect on productively infected cells. In virally suppressed humanized (hu)-BLT mice, APG-1387 augments cell-associated viral RNA and potently reduces HIV DNA-containing cells without modulating T cell activation or proliferation. Upon antiretroviral therapy (ART) interruption, HIV rebound was decreased in APG-1387-treated humanized mice (hu-mice), and the viremia maintained at levels below that of pre-ART. Thus, the ability of APG-1387 to affect VRs and decrease viral rebound highlights the potential of bivalent SMs in HIV cure strategies.

Also flagged:lipidvesiclescommunicationCNS diseasescerebrovascular diseasesneurodegenerative disorders
Journal Article 2024-11-27 No Snippets Li J, Song J, Jia L, Wang M, Ji X, Meng R, Zhou D.
Show Full Abstract

Exosomes, nano-sized lipid bilayer vesicles, have garnered significant attention as mediators of cell communication, particularly within the central nervous system (CNS). Their unique properties, including high stability, low immunogenicity, and the ability to traverse the blood-brain barrier (BBB), position them as promising tools for understanding and addressing CNS diseases. This comprehensive review delves into the biogenesis, properties, composition, functions, and isolation of exosomes, with a particular focus on their roles in cerebrovascular diseases, neurodegenerative disorders, and CNS tumors. Exosomes are involved in key pathophysiological processes in the CNS, including angiogenesis, inflammation, apoptosis, and cellular microenvironment modification. They demonstrate promise in mitigating ischemic injury, regulating inflammatory responses, and providing neuroprotection across various CNS conditions. Furthermore, exosomes carry distinct biomolecules, offering a novel method for the early diagnosis and monitoring of CNS diseases. Despite their potential, challenges such as complex extraction processes, the heterogeneity of exosomal contents, and targeted delivery limitations hinder their clinical application. Nevertheless, exosomes hold significant promise for advancing our understanding of CNS diseases and developing novel therapeutic strategies. This manuscript significantly contributes to the field by highlighting exosomes' potential in advancing our understanding of CNS diseases, underscoring their unique value in developing novel therapeutic strategies and mediating cellular communication.

HFE
Also flagged:HemopexinNephrotoxinKidney InjuryRenal IschemiaDestabilizationheme
Journal Article 2024-11-27 ✓ 1 Snippet Jeon YH, Oh EJ, Oh SH, Lim JH, Jung HY, Choi JY, Cho JH, Park SH, Kim YL, Kim CD.
In-Text Gene Mentions

…β-thalassemia major andhemochromatosisby chelating excess…

Show Full Abstract

Destabilization of heme proteins is recognized to play a role in acute kidney injury (AKI). Hemopexin (Hpx), known for its role in binding heme, mitigates free heme toxicity. Despite this, the potential adverse effects of Hpx deposition in kidney tissues and its impact on kidney function are not fully understood. Deferoxamine (DFO) chelates iron released from heme and mitigates associated kidney damage. Therefore, this study aimed to evaluate whether Hpx contributes to kidney injury in an ischemia-reperfusion injury (IRI) induced AKI model and to investigate if DFO could alleviate this damage. Mice were categorized into five groups: Sham-Vehicle, Sham-Hpx, IRI-Vehicle, IRI-Hpx, and IRI-Hpx-DFO. Decline in kidney function was observed exclusively in the IRI group, independent of Hpx injection. Serum Hpx levels remained comparable across all groups, and administration of Hpx did not alter serum Hpx levels or kidney function after 24 hours. Although increased Hpx deposition in kidneys was noted in both the IRI and Hpx groups, this accumulation did not correlate with impaired kidney function. Additionally, DFO did not exhibit a protective effect against kidney injury. In summary, Hpx does not directly induce kidney injury and cannot be considered a biomarker for kidney damage caused by IRI.

LRRC7
Also flagged:Papillary thyroid cancerPTCcancerscancerthyroid cancerHERV-L
Journal Article 2024-11-27 ✓ 1 Snippet Stricker E, Peckham-Gregory EC, Lai SY, Sandulache VC, Scheurer ME.
In-Text Gene Mentions

…, RADIL ,LRRC7, PCDH11X ,…

Show Full Abstract

Papillary thyroid cancer (PTC) is one of the fastest-growing cancers worldwide, lacking established causal factors or validated early diagnostics. Human endogenous retroviruses (HERVs), comprising 8% of human genomes, have potential as PTC biomarkers due to their comparably high baseline expression in healthy thyroid tissues, indicating homeostatic roles. However, HERV regions are often overlooked in genome-wide association studies because of their highly repetitive nature, low sequence coverage, and decreased sequencing quality. Using targeted whole-genome sequence analysis in conjunction with high sequencing depth to overcome methodological limitations, we identified associations of specific HERV variants with PTC. Analyzing WGS data from 138 patients with PTC generated through The Cancer Genome Atlas project and 2015 control samples from the 1000 Genomes Project, we examined the mutational variation in HERVs within a 20 kb radius of known cancer predisposition genes (CPGs) differentially expressed in PTC. We discovered 15 common and 13 rare germline HERV variants near or within 20 CPGs that distinguish patients with PTC from healthy controls. We identified intragenic-intronic HERV variants within <i>RYR2</i>, <i>LRP1B</i>, <i>FN1</i>, <i>MET</i>, <i>TCRVB</i>, <i>UNC5D</i>, <i>TRPM3</i>, <i>CNTN5</i>, <i>CD70</i>, <i>RYR1</i>, <i>RUNX1</i>, <i>CRLF2</i>, and <i>PCDH1X</i>, and three variants downstream of <i>SERPINA1</i> and <i>RUNX1T1</i>. Sanger sequencing analyses of 20 thyroid and 5 non-thyroid cancer cell lines confirmed associations with PTC, particularly for MSTA HERV-L variant rs200077102 within the <i>FN1</i> gene and HERV-L MLT1A LTR variant rs78588384 within the <i>CNTN5</i> gene. Variant rs78588384, in particular, was shown in our analyses to be located within a POL2 binding site regulating an alternative transcript of <i>CNTN5</i>. In addition, we identified 16 variants that modified the poly(A) region in <i>Alu</i> elements, potentially altering the potential to retrotranspose. In conclusion, this study serves as a proof-of-concept for targeted variant analysis of HERV regions and establishes a basis for further exploration of HERVs in thyroid cancer development.

Also flagged:ParacetamolEthanolacute liver failurewaterALTAST
Journal Article 2024-11-27 No Snippets Gonçalves AC, Coelho AM, da Cruz Castro ML, Pereira RR, da Silva Araújo NP, Ferreira FM, Machado Júnior PA, Pio S, Vital CE, Bezerra FS, Talvani A, de Castro Borges W, de Oliveira EC, Costa DC.
Show Full Abstract

Paracetamol (APAP) overdose is the leading cause of drug-induced liver injury, leading to acute liver failure. However, the role of concurrent acute or chronic ethanol ingestion in this context requires further clarification. In this study, we investigated the effects of acute and chronic ethanol ingestion on APAP-induced hepatotoxicity. Male C57BL/6 mice were randomly allocated into four groups: control (C; water 2×/day for 7 days); APAP (single dose of APAP, 500 mg/kg); acute ethanol (AE; a single ethanol dose-10 mL/kg, and one hour later an overdose of APAP-500 mg/kg); chronic ethanol (CE; ethanol-10 mL/kg, 2×/day for 7 days; and on the last day, an overdose of APAP-500 mg/kg). The results showed that AE induced heightened liver damage, increased necrotic area, and elevated levels of ALT, AST, TBARS, and oxidized glutathione compared to the control group. The AE group exhibited diminished glutathione availability and elevated CYP2E1 levels compared to the other groups. CE maintained a hepatic profile similar to that of the control group in terms of necrosis index, ALT and AST levels, GSH/GSSG ratio, and CYP2E1 activity, along with the upregulation of gene expression of the glucuronidation enzyme compared to the APAP group. Proteomic analysis revealed that the AE protein profile closely resembled that of the APAP group, whereas the C and CE groups were clustered together. In conclusion, ethanol consumption differentially modulated APAP overdose-induced liver damage. Acute consumption exacerbated hepatotoxicity, similar to an APAP overdose alone, whereas chronic consumption appeared to mitigate this injury, at least within the parameters assessed in this study.

Also flagged:cirrhosishepatocellular carcinomaantibodymethylationchromosomesHBV infections
Journal Article 2024-11-27 No Snippets Ferraresi F, Anticoli S, Salvioli S, Pirazzini C, Calzari L, Gentilini D, Albano C, Di Prinzio RR, Zaffina S, Carsetti R, Garagnani P, Ruggieri A, Kwiatkowska KM.
Show Full Abstract

<b>Background/Objectives</b>: HBV infections can lead to serious liver complications that can have fatal consequences. In 2022, around 1.1 million individuals died from HBV-related cirrhosis and hepatocellular carcinoma. Vaccines allow us to save more than 2.5 million lives each year; however, up to 10% of vaccinated individuals may not develop sufficient protective antibody levels. The aim of this study was to investigate the epigenetic drift in the response to HBV vaccine in isolated B cells. <b>Methods</b>: Epigenetic drift was measured by counting rare DNA methylation variants. These epivariants were detected in epigenome-wide data collected from isolated B cell samples from 41 responders and 30 non-responders (age range 22-62 years) to vaccination against HBV. <b>Results</b>: We found an accumulation of epivariants in the NR group, with a significant increase in hyper-methylated aberrations. We identified the chromosomes (1, 3, 11, 12, and 14) and genes (e.g., <i>RUSC1_AS1</i> or <i>TROVE2</i>) particularly enriched in epivariants in NRs. The literature search and pathway analysis indicate that such genes are involved in the correct functioning of the immune system. Moreover, we observed a correlation between epigenetic drift and DNA methylation entropy in the male population of the cohort. Finally, we confirmed the correlation between epivariant loads and age-related epigenetic clocks. <b>Conclusions</b>: Our findings support the idea that an age-related derangement of the epigenetic architecture is involved in unresponsiveness to the HBV vaccine. Furthermore, the overall results highlight the interconnection between various epigenetic dynamics (such as drift, clocks, and entropy), although these interconnections seem not to be involved in the altered immunological activity.

Also flagged:EIF4A3cellsCircularagingrenalJAK2
Journal Article 2024-11-26 No Snippets Chen Y, Zhu X, Sun D, Yao L, Yang S, Wang L.
Show Full Abstract

Circular RNAs (circRNAs) have garnered attention for their potential involvement in the regulation of cellular aging processes. Exploring the role and mechanism of circRNAs in cellular senescence may help to identify new anti-aging therapeutic targets. In the present study, we investigated the role and regulatory mechanism of hsa_circ_0127071 in renal aging. We employed high-throughput sequencing to assess circRNA expression differences in kidney tissues from young and old groups. qRT-PCR confirmed that the expression of hsa_circ_0127071 in kidney tissue of the old group was significantly higher than that of the young group. Cellular senescence was evaluated using SA-β-Gal staining and Masson's trichrome staining. Using RNA Immunoprecipitation (RIP), RNA Pull-Down Assay (RNA pull down), and Western Blot (WB) to study the interaction between hsa_circ_0127071 and aging related pathway proteins. In this study, we found that the expression of hsa_circ_0127071 in kidney tissue of the old group was significantly higher than that of the young group. Silencing of EIF4A3, a protein involved in the JAK2/STAT5 signaling pathway, was found to delay the aging process. On the basis of silencing EIF4A3 expression, the JAK2/STAT5 signaling pathway was activated by Erythropoietin (EPO) processing, and the senescence of Human glomerular mesangial cells (HGMCs) increased. After treatment with Losartan (LOS), the activity of JAK2/STAT5 pathway was decreased and the aging process of HGMCs was delayed. Our findings demonstrate that hsa_circ_0127071 promotes renal aging through the EIF4A3/JAK2/STAT5 signaling axis, highlighting a novel potential therapeutic target for the management of renal aging and associated disorders.

PCDH17
Also flagged:enhancer of zeste drosophila homolog 2Ezh2CD34CD133CD45imprinting
Journal Article 2024-11-26 ✓ 1 Snippet Jarczak J, Bujko K, Ratajczak MZ, Kucia M.
In-Text Gene Mentions

…DLL4, LRFN5, POTEF,PCDH17, GRIK2, and ZNF280A…

Show Full Abstract

A population of CD133<sup>+</sup>lin<sup>-</sup>CD45<sup>-</sup> and CD34<sup>+</sup>lin<sup>-</sup>CD45<sup>-</sup> very small embryonic-like stem cells (VSELs) has been identified in postnatal human tissues, including bone marrow (BM), mobilized peripheral blood (mPB) and umbilical cord blood (UCB). Under appropriate conditions, VSELs in vitro and in vivo differentiate into tissue-committed stem cells for all three germ layers. Molecular analysis of adult murine BM-purified VSELs revealed that these rare cells deposited during development in adult tissues (i) express a similar transcriptome as embryonic stem cells, (ii) share several markers characteristic for epiblast and migratory primordial germ cells (PGCs), (iii) highly express a polycomb group protein enhancer of zeste drosophila homolog 2 (Ezh2) and finally (iv) display a unique pattern of imprinting at crucial paternally inherited genes that promotes their quiescence. Here, by employing single-cell RNA sequencing we demonstrate for the first time that purified from UCB human VSELs defined by expression of CD34 or CD133 antigens and lack of lineage markers, including CD45 antigen express similar molecular signature as murine BM-derived VSELs. Specifically, unsupervised clustering revealed numerous subpopulations of VSELs including ones i) annotated to germline compartments, ii) regulated by parental imprinting, iii) responding to early developmental fate decisions, iv) transcription factors involved in differentiation and development, including homeobox family of genes, and v) expressing innate immunity and purinergic signaling genes.

TNFSF4
Also flagged:CD30LOX40Latopic dermatitisADOX40TNFSF8
Journal Article 2024-11-26 ✓ 2 Snippets Gupta RK, Figueroa DS, Ay F, Causton B, Abdollahi S, Croft M.
In-Text Gene Mentions

…OX40 and OX40L (TNFSF4) holds promise for…

TNFSF4

Show Full Abstract

<h4>Background</h4>Blocking IL-13 is highly efficacious in patients with Th2-biased atopic dermatitis (AD), and recent clinical data have highlighted that targeting the T cell costimulatory molecules OX40 and OX40L (TNFSF4) holds promise for future treatment of AD.<h4>Aim</h4>We asked whether targeting another T cell costimulatory molecule, CD30L (TNFSF8), might also be a possible treatment option in AD.<h4>Methods</h4>Single-cell RNA-seq data from human AD skin lesions was analyzed to identify pathogenic IL-13- or IL-22-producing T cells and assess expression of CD30 and its ligand in comparison to OX40 and its ligand. Additionally, a murine model of AD with repetitive exposure to house dust mite allergen was used to compare neutralizing antibodies against CD30L with those against IL-13 or OX40L.<h4>Results</h4>Analysis of several scRNA-seq datasets from skin lesions of AD patients showed that transcripts for CD30 or CD30L were found expressed with OX40 or OX40L in the primary T cell populations that also expressed mRNA for IL13 and/or IL22. Suggesting that this could be therapeutically relevant, mice treated prophylactically with a blocking CD30L antibody were protected from developing maximal allergen-induced AD features, including epidermal and dermal thickening, immune cell infiltration, and expression of AD-related genes, similar to mice treated with a blocking IL-13 antibody. Moreover, therapeutic neutralization of CD30L in mice with experimental AD also reduced all of the pathological skin lesion features to a comparable extent as blocking OX40L.<h4>Conclusion</h4>These data suggest that targeting the CD30-CD30L axis might hold promise as a future therapeutic intervention in human AD, similar to targeting the OX40-OX40L axis.

RC3H1TNFSF4
Also flagged:antigen receptorchimeric antigen receptorcancersleukemiacancerITK
Journal Article 2024-11-26 ✓ 2 Snippets Fu Z, Huang Z, Xu H, Liu Q, Li J, Song K, Deng Y, Tao Y, Zhang H, Wang P, Li H, Sheng Y, Zhou A, Han L, Fu Y, Wang C, Choudhary SK, Ye K, Veggiani G, Li Z, August A, Huang W, Shan Q, Peng H.
In-Text Gene Mentions

…proteins, Ragnase-1, andRoquin-1has been shown…

…activation, such asTNFSF4, TNFSF14 ,…

Show Full Abstract

Despite the revolutionary achievements of chimeric antigen receptor (CAR) T cell therapy in treating cancers, especially leukemia, several key challenges still limit its therapeutic efficacy. Of particular relevance is the relapse of cancer in large part as a result of exhaustion and short persistence of CAR-T cells in vivo. IL-2-inducible T cell kinase (ITK) is a critical modulator of the strength of T cell receptor signaling, while its role in CAR signaling is unknown. By electroporation of CRISPR-associated protein 9 (Cas9) ribonucleoprotein (RNP) complex into CAR-T cells, we successfully deleted ITK in CD19-CAR-T cells with high efficiency. Bulk and single-cell RNA sequencing analyses revealed downregulation of exhaustion and upregulation of memory gene signatures in ITK-deficient CD19-CAR-T cells. Our results further demonstrated a significant reduction of T cell exhaustion and enhancement of T cell memory, with significant improvement of CAR-T cell expansion and persistence both in vitro and in vivo. Moreover, ITK-deficient CD19-CAR-T cells showed better control of tumor relapse. Our work provides a promising strategy of targeting ITK to develop sustainable CAR-T cell products for clinical use.

HMGN4
Also flagged:Liver cancercancerpathogenesisVEGFvascular endothelial growth factorPD-1
Journal Article 2024-11-26 ✓ 5 Snippets Zhong Q, Zhao B, She X, Liu X.
In-Text Gene Mentions

…HMGN1, HMGN2, HMGN3,HMGN4, and HMGN5, which…

…Currently, research onHMGN4is relatively limited,…

…the exception ofHMGN4due to lack…

…expression pattern ofHMGN4differed from other…

…HMGB2, HMGN1, andHMGN4with the prognoses…

Show Full Abstract

The molecular mechanisms underlying hepatocellular carcinoma (HCC) are complex and not fully understood. This study aims to explore the expression and clinical significance of High Mobility Group (HMG) proteins in HCC to identify potential prognostic biomarkers and therapeutic targets. Bioinformatic analyses were performed using data from The Cancer Genome Atlas (TCGA) and other databases. Expression levels of HMGs were validated in HCC cell lines using qRT-PCR, and functional studies were conducted by knocking down HMGA2.HMG family members, particularly HMGA1, HMGA2, HMGB2, and HMGN1, were significantly upregulated in HCC tissues compared to normal tissues. High expression levels of these proteins were associated with poor overall survival and disease-specific survival in HCC patients. Knockdown of HMGA2 in HCC cell lines led to reduced cell proliferation, migration, and invasion. HMGA2, along with other HMG family members, emerges as a potential prognostic biomarker and therapeutic target in HCC. This study provides new insights into the role of HMG proteins in HCC progression.

Also flagged:Amyloid-βtauAT8antibodyviral infections
Journal Article 2024-11-26 No Snippets Orekhova K, Testori C, Giorda F, Grattarola C, Mattioda V, Di Guardo G, Corona C, Castagnaro M, Sierra E, Casalone C, Favole A, Centelleghe C, Mazzariol S.
Show Full Abstract

Cetacean brains are uniquely adapted to diving, but can be affected by diseases and exposure to toxins, triggering neurodegenerative processes that may cause stranding. Some species exhibit a significant post-reproductive lifespan (PRLS), increasing the likelihood of observing cumulative and age-related pathology. Immunohistochemistry against amyloid-β and hyperphosphorylated tau proteins is increasingly implemented to assess Alzheimer's Disease-like neuropathology in cetaceans, but comparisons between geographically distinct populations, animals of different age groups, sex, and with concomitant pathologies are lacking. We tested 43 cetaceans' (30 Tursiops truncatus; 13 Stenella coeruleoalba) parietal cortex, our most consistently archived cerebral tissue, in immunohistochemical analyses with amyloid-β oligomer 42 (Aβ-42) and hyperphosphorylated tau (pTau AT180 and AT8) antibodies. Aβ-42 antibody cross-reacted with plaques in three aged bottlenose and two aged striped dolphins, but was more often detected within neurons, glia, and blood vessels of all the dolphins. Histoscore comparisons between dolphins of different ages, sexes, and pathologies revealed significant correlations between older age, viral infections, and plaque presence. Protozoan cysts cross-reacted with Aβ-42 antibody. pTau signal was observed as single foci in neurons and neuropil in two young and two aged bottlenose dolphins. To our knowledge, this study is the first of its kind for the Mediterranean region and will help establish baseline understanding of physiological and pathological expression of proteins associated with human neurodegenerative disease in cetacean brains.

HTT
Also flagged:Huntington's diseaseHDneurodegenerative disorderautophagybehavioralneuroblastoma
Journal Article 2024-11-26 ✓ 5 Snippets Simmons DA, Alexander N, Cao G, Rippin I, Lugassy Y, Eldar-Finkelman H, Longo FM.
In-Text Gene Mentions

…expansion in theHTTgene encoding a…

…levels by reducingHttproduction or enhancing…

…Wild-type (WT)Httpositively modulates selective…

…WTHttis present in…

…Cambridge, UK) or GFP-Htt(23Q), which has…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the HTT gene encoding a mutant huntingtin (mHtt) protein. mHtt aggregates within neurons causing degeneration primarily in the striatum. There is currently a need for disease-modifying treatments for HD. Many therapeutic studies have focused on lowering mHtt levels by reducing its production or enhancing its clearance. One way to clear mHtt aggregates is to promote autophagy, which is disrupted in HD. Our previous studies showed that the small molecule p75 neurotrophin receptor (p75<sup>NTR</sup>) ligand, LM11A-31, prevented HD-related neuropathologies and behavioral deficits in multiple HD mouse models. This study investigated whether modulating p75<sup>NTR</sup> with LM11A-31, would reduce mHtt aggregates via autophagic/lysosomal mechanisms in HD models. LM11A-31 decreased mHtt aggregates in human neuroblastoma SH-SY5Y cells expressing mHtt (exon 1 with 74 CAG repeats) and in the striatum of R6/2 and zQ175dn mouse models of HD. The LM11A-31 associated decrease in mHtt aggregates in vitro was accompanied by increased autophagic/lysosomal activity as indicated by altered levels of relevant markers including p62/SQSTM1 and the lysosomal protease, mature cathepsin D, and increased autophagy flux. In R6/2 and/or zQ175dn striatum, LM11A-31 increased AMPK activation, normalized p62/SQSTM1 and LC3II levels, and enhanced LAMP1 and decreased LC3B association with mHtt. Thus, LM11A-31 reduces mHtt aggregates and may do so via engaging autophagy/lysosomal systems. LM11A-31 has successfully completed a Phase 2a clinical trial for mild-to-moderate Alzheimer's disease and our results here strengthen its potential as a candidate for HD clinical testing.

CCPG1
Also flagged:Acid-sensing ion channel 1aalcoholliver diseaseendoplasmic reticulumautophagyAlcohol-associated liver disease
Journal Article 2024-11-26 ✓ 1 Snippet Zhu YQ, Wang LL, Li ZH, Qian SS, Xu Z, Zhang J, Song YH, Pan XS, Du N, Abou-Elnour A, Tay LJ, Zhang JR, Li MX, Shen YX, Huang Y.
In-Text Gene Mentions

CCPG1

Show Full Abstract

Alcohol-associated liver disease (ALD) is a hepatocyte dysfunction disease caused by chronic or excessive alcohol consumption, which can lead to extensive hepatocyte necrosis and even liver failure. Currently, the pathogenesis of ALD and the anti-ALD mechanisms have not been fully elucidated yet. In this study, we investigated the effects of endoplasmic reticulum autophagy (ER-phagy) in ALD and the role of acid-sensing ion channel 1a (ASIC1a) in ER stress-mediated ER-phagy. A mouse model of ALD was established using the Gao-Binge method and the AML12 cell line treated with alcohol was used as an in vitro model. We showed that ASIC1a expression was significantly increased and ER-phagy was activated in both the in vivo and in vitro models. In alcohol-treated AML12 cells, we showed that blockade of ASIC1a with PcTx-1 or knockdown of ASIC1a reduced alcohol-induced intracellular Ca<sup>2+</sup> accumulation and ER stress. In addition, inhibition of ER stress with 4-PBA reduced the level of ER-phagy. Furthermore, knockdown of the ER-phagy receptor family with sequence similarity 134 member B (FAM134B) alleviated alcohol-triggered hepatocyte injury and apoptosis. In conclusion, this study demonstrates that alcohol activates ER stress-induced ER-phagy and liver injury by increasing ASIC1a expression and ASIC1a-mediated Ca<sup>2+</sup> influx, providing a novel strategy for the treatment of ALD.

SOX6
Also flagged:RNA polymerase IIRNAPIISOX2bindingchromatinneurodevelopmental syndromes
Journal Article 2024-11-26 ✓ 1 Snippet Zhang Y, Hill CM, Leach KA, Grillini L, Deliard S, Offley SR, Gatto M, Picone F, Zucco A, Gardini A.
In-Text Gene Mentions

SOX6

Show Full Abstract

Lineage-specific transcription factors operate as master orchestrators of developmental processes by activating select cis-regulatory enhancers and proximal promoters. Direct DNA binding of transcription factors ultimately drives context-specific recruitment of the basal transcriptional machinery that comprises RNA polymerase II (RNAPII) and a host of polymerase-associated multiprotein complexes, including the metazoan-specific Integrator complex. Integrator is primarily known to modulate RNAPII processivity and to surveil RNA integrity across coding genes. Here we describe an enhancer module of Integrator that directs cell fate specification by promoting epigenetic changes and transcription factor binding at neural enhancers. Depletion of Integrator's INTS10 subunit upends neural traits and derails cells towards mesenchymal identity. Commissioning of neural enhancers relies on Integrator's enhancer module, which stabilizes SOX2 binding at chromatin upon exit from pluripotency. We propose that Integrator is a functional bridge between enhancers and promoters and a main driver of early development, providing new insight into a growing family of neurodevelopmental syndromes.

TNFSF4
Also flagged:vesiclesglycerolcholesterolIL-6dicetyl phosphateNF-κB
Journal Article 2024-11-26 ✓ 1 Snippet McGahon J, Woods S, D'Elia R, Roberts CW.
In-Text Gene Mentions

…and superfamily membersTnfsf4, Tnfsf9 and Tnfsf15…

Show Full Abstract

Inflammation can be an unwanted consequence or cause of debilitating diseases of infectious and non-infectious aetiologies. Current anti-inflammatory medications have several deficiencies including lack of specificity and undesirable side effects. Herein, the potential of non-ionic surfactant vesicles (NISV) comprised of monopalmityol glycerol, dicetyl phosphate and cholesterol) as an anti-inflammatory drug and their mode of action is investigated. NISV were able to inhibit LPS-induced IL-6 from BMD macrophages. The individual components of NISV, monopalmityol glycerol, dicetyl phosphate and cholesterol did not affect LPS induced IL-6 levels, proving that formulation of NISV is essential for their anti-inflammatory effects. Transcriptomic analyses showed NISV mediated down-regulation of transcripts for inflammatory mediators in LPS stimulated macrophages. Notably, NISV downregulate NF-κB transcripts in LPS stimulated macrophages. Measurement of inflammatory mediators by cytometric bead array validated a number of transcriptomic findings as NISV were found to inhibit LPS induced IL-6, IL-12, and multiple chemokines. Further investigation demonstrated that NISV inhibited Poly(I:C) or Pam3csk4 induced inflammatory mediators. This indicates that the effects of NISV are distal to both MyD88 and TRIF signalling. Overall, the data generated highlights the potential of NISV as an anti-inflammatory therapeutic.

Also flagged:viral infectionpathogenesisgene expressionToll-like receptor-8TLR8binding
Journal Article 2024-11-26 No Snippets Yang JY.
Show Full Abstract

miR-574-5p is an unusual microRNA (miRNA) that is often upregulated or downregulated following exposure to irradiation or toxic chemicals; bacterial, parasitic or viral infection; and a variety of other disease conditions. Canonically, miR-574-5p epigenetically regulates the expression of many messenger RNAs (mRNAs) through miRNA-mediated posttranscriptional regulation, thereby affecting cellular physiology or pathophysiology and contributing to the pathogenesis or progression of a variety of diseases. However, recent studies have established that in addition to serving as a fine-tuning repressor of gene expression, miR-574-5p also stimulates gene expression as an endogenous ligand for Toll-like receptor-8/7 (TLR8/7). Indeed, the binding of miR-574-5p to TLR8/7 triggers the TLR signaling pathway, leading to the induction of interferons, inflammatory cytokines and autoimmune signaling. These findings suggest that miR-574-5p is not only an important epigenetic regulator of gene expression, but also an important regulator of immune and inflammatory responses. Abnormal miR-574-5p-TLR8/7 signaling has been shown to be tightly associated with inflammation-related cancers and a number of autoimmune disorders. miR-574-5p can serve as a potential biomarker for many diseases. Most importantly, miR-574-5p is a promising therapeutic target for the treatment or prevention of human disorders, especially infectious diseases, cancers and autoimmune diseases.

Also flagged:Breast cancerestrogen receptorERprogesterone receptorPRhuman epidermal growth factor receptor 2
Journal Article 2024-11-26 No Snippets Chernosky NM, Tamagno I, Polak KL, Chan ER, Yuan X, Jackson MW.
Show Full Abstract

<h4>Background</h4>Patients with Triple Negative Breast Cancer (TNBC) currently lack targeted therapies, and consequently face higher mortality rates when compared to patients with other breast cancer subtypes. The tumor microenvironment (TME) cytokine Oncostatin M (OSM) reprograms TNBC cells to a more stem-like/mesenchymal state, conferring aggressive cancer cell properties such as enhanced migration and invasion, increased tumor-initiating capacity, and intrinsic resistance to the current standards of care. In contrast to OSM, Interferon-β (IFN-β) promotes a more differentiated, epithelial cell phenotype in addition to its role as an activator of anti-tumor immunity. Importantly, OSM suppresses the production of IFN-β, although the mechanism of IFN-β suppression has not yet been elucidated.<h4>Methods</h4>IFN-β production and downstream autocrine signaling were assessed via quantitative real-time PCR (qRT-PCR) and Western blotting in TNBC cells following exposure to OSM. RNA-sequencing (RNA-seq) was used to assess an IFN-β metagene signature, and to assess the expression of innate immune sensors, which are upstream activators of IFN-β. Cell migration was assessed using an in vitro chemotaxis assay. Additionally, TNBC cells were exposed to TGF-β1, Snail, and Zeb1, and IFN-β production and downstream autocrine signaling were assessed via RNA-seq, qRT-PCR, and Western blotting.<h4>Results</h4>Here, we identify the repression of Toll-like Receptor 3 (TLR3), an innate immune sensor, as the key molecular event linking OSM signaling and the repression of IFN-β transcription, production, and autocrine IFN signaling. Moreover, we demonstrate that additional epithelial-mesenchymal transition-inducing factors, such as TGF-β1, Snail, and Zeb1, similarly suppress TLR3-mediated IFN-β production and signaling.<h4>Conclusions</h4>Our findings provide a novel insight into the regulation of TLR3 and IFN-β production in TNBC cells, which are known indicators of treatment responses to DNA-damaging therapies. Furthermore, strategies to stimulate TLR3 in order to increase IFN-β within the TME may be ineffective in stem-like/mesenchymal cells, as TLR3 is strongly repressed. Rather, we propose that therapies targeting OSM or OSM receptor would reverse the stem-like/mesenchymal program and restore TLR3-mediated IFN-β production within the TME, facilitating improved responses to current therapies.

Also flagged:uraniumplutoniumoxideamericiumcuriumneptunium
Journal Article 2024-11-26 No Snippets Zaytsev AV, Distler P, John J, Wilden A, Modolo G, Sims M, Lewis FW.
Show Full Abstract

Bis-1,2,4-triazine ligands are amongst the most promising soft N-donor ligands for the partitioning of trivalent actinides from trivalent lanthanides; a key separation proposed in the future reprocessing of spent nuclear fuels. In an effort to improve the extraction properties of these benchmark ligands, we propose herein a general ligand design approach that is inspired by the field of drug discovery, and we apply it to a new class of ligands in which the bidentate 3-(2-pyridyl)-1,2,4-triazine unit of the benchmark ligands is replaced by a bidentate 1,2,4-triazine-3-carboxamide unit. A series of nine novel ligands were synthesized by reactions of readily available ethyl 1,2,4-triazine-3-carboxylate building blocks with different polyamine cores and evaluated for their ability to extract and separate Am(III) and Cm(III) from Eu(III). One of the reported ligands can co-extract Am(III) and Eu(III) from nitric acid into cyclohexanone, albeit with no selectivity between the metal ions. NMR titration experiments suggested that ligand 23 b formed a chiral 1 : 1 complex species with La(III) but not Lu(III) or Y(III), suggesting the coordination cavity of the ligand is sensitive to the size of the metal ion. The structures and thermodynamic parameters for the proposed complexes were further supported by DFT calculations.

HFE
Also flagged:AmyloidosisRestrictive Cardiomyopathiescardiac amyloidosisstrokeventricular tachycardiaatrial fibrillation
Journal Article 2024-11-26 ✓ 5 Snippets Sagalov A, Ullah W, Brailovsky Y, Buhnerkempe M, Scaife S, Kulkarni A, Labedi M, Hegde S.
In-Text Gene Mentions

…(RCM), such ashemochromatosisand cardiac sarcoid,…

…not limited tohemochromatosis, scleroderma, carcinoid syndr…

…sarcoid, carcinoid, andhemochromatosis.…

…common pathologies, includinghemochromatosis, carcinoid, and scarring…

Hemochromatosisrefers to systemic…

Show Full Abstract

<h4>Background</h4>The arrhythmic burden and cardiovascular risks of cardiac amyloidosis compared with other types of restrictive cardiomyopathies (RCM), such as hemochromatosis and cardiac sarcoid, have not been well characterized in the literature. An increase in emphasis on screening has resulted in more diagnoses of cardiac amyloidosis and a larger data pool to analyze the cardiovascular outcomes of this cardiomyopathy.<h4>Methods and results</h4>We queried the National Inpatient Sample (NIS) database to identify all adult patients diagnosed with cardiac amyloidosis or other RCM between the years 2016 and 2019. Discharge-weighted analysis using survey regressions accounts for discharge weights and characteristics found to be significantly different between groups. A total sample size of 13 345 patients was obtained, including cardiac amyloidosis (N = 8365; 62.7%) and other RCM (N = 4980; 37.3%). Cardiac amyloidosis was associated with a significantly increased risk of stroke (Odds ratio = 3.91: 95% confidence interval = [2.15, 7.11], <i>P</i> < .001) and ventricular tachycardia (1.98 [1.35-2.91], <i>P</i> < .001). Cardiac amyloidosis had a decreased risk of atrial fibrillation (0.56 [0.47-0.68], <i>P</i> < .001). Significant differences in risk were not observed among the different types of heart block and supraventricular arrhythmias. In-hospital mortality was similar between the 2 groups (<i>P</i> = .72).<h4>Conclusions</h4>Cardiac amyloidosis was associated with an increased risk of stroke and ventricular tachycardia compared to other types of RCM. Significant differences in in-hospital mortality, bundle branch blocks, and supraventricular arrhythmias were not appreciated. A subgroup analysis comparing light chain (AL) and wild-type transthyretin (ATTR) amyloidosis outcomes would further delineate the cardiovascular risks of cardiac amyloidosis.

BTN2A2H4C8
Also flagged:Gene expressionamoxicillinatenololinfliximabcolchicinepropionyl
Journal Article 2024-11-26 ✓ 5 Snippets Xi L, Cheng R, Zhang M, Pei Z, Ye J, Zhao Z.
In-Text Gene Mentions

…previous evidence (BTN2A2and RBMS1P1 ).…

…Data B. Similarly,BTN2A2, CEP250 ,…

…, H4C3 ,H4C8, H4C5 ,…

…genes, such asBTN2A2and RBMS1P1 ,…

BTN2A2and RBMS1P1 have…

Show Full Abstract

<h4>Background</h4>Mendelian randomization (MR) has been used to identify drug targets in many conditions. Height is a classic complex trait affected by genetic and early-life environmental factors. No systematic screening has been conducted to identify drugs that interact with height. We investigated the causal relationship between genes and height, and systematically screened for interactive drugs that may promote or delay growth.<h4>Methods</h4>We performed MR using summary statistics from the Genetic Investigation of ANthropometric Traits consortium (N=253,288), the UK Biobank (N=461,950), and the BioBank Japan Project (N=159,095). Gene expression-single-nucleotide polymorphism associations represented by cis-expression quantitative trait loci data were obtained from the Genotype-Tissue Expression study and were used as genetic instruments. We performed annotation and enrichment analyses of the genes. Interactive drugs were identified through drug-gene interactions.<h4>Results</h4>Of the 27,094 genes screened, 209 had causal associations with height, including genes associated with height and short stature phenotypes (<i>AMZ1</i>, <i>GNA12</i>, <i>NPPC</i>, <i>UQCC1</i>, and <i>ZBTB38</i>), genes associated with height in a few studies (<i>ANKIB1</i>, <i>CEP250</i>, <i>DCAF16</i>, <i>HIST1H4E</i>, and <i>HLA-C</i>), and genes without previous evidence (<i>BTN2A2</i> and <i>RBMS1P1</i>). Enrichment analysis showed that transcriptional regulation by <i>RUNX1</i> was the most enriched pathway. Interactive drugs were identified, including amoxicillin, atenolol, infliximab, colchicine, propionyl-L-carnitine, BMN-111, and tamoxifen, which were known to have a positive effect on height. We also identified drugs that had a negative effect on height, including antineoplastic drugs, corticosteroids, and antiepileptic drugs. Moreover, many interactive drugs have not been previously reported to be associated with height.<h4>Conclusions</h4>Our results suggest that many genes have causal effects on height. By interrogating drug-gene interactions, interactive drugs have been identified as having both positive and negative effects on growth, which would help make clinical decisions.

DCC
Also flagged:hydroxyapatitearagoniteossificationbone formationzoledronatebisphosphonate
Journal Article 2024-11-26 ✓ 1 Snippet Steijvers E, Shi Y, Lu H, Zhang W, Zhang Y, Zhao F, Wang B, Hughes L, Barralet JE, Degli-Alessandrini G, Kraev I, Johnston R, Shao Z, Ebetino FH, Triffitt JT, Russell RGG, Deganello D, Cao X, Xia Z.
In-Text Gene Mentions

…(Netrin1, CGRP, PGP9.5,DCC), and (4) angiogenesis…

Show Full Abstract

Biomaterials are widely used as orthopaedic implants and bone graft substitutes. We aimed to develop a rapid osteogenic assessment method using a murine tibial periosteal ossification model to evaluate the bone formation/remodelling potential of a biomaterial within 2-4 weeks. A novel hydroxyapatite/aragonite (HAA) biomaterial was implanted into C57BL/6 mice juxtaskeletally between the tibia and tibialis anterior muscle. Rapid intramembranous bone formation was observed at 14 days, with 4- to 8-fold increases in bone thickness and callus volume in comparison with sham-operated animals (<i>p</i> < 0.0001), followed by bone remodelling and a new layer of cortical bone formation by 28 days after implantation. The addition of zoledronate, a clinically-utilised bisphosphonate, to HAA, promoted significantly more new bone formation than HAA alone over 28 days (<i>p</i> < 0.01). The osteogenic potential of HAA was further confirmed by implanting into a 3.5 mm diameter femoral cancellous bone defect in rats and a 5 mm diameter femoral cortical bone defect in minipigs. To understand the biodegradation and the cellular activity at the cell/biomaterial interfaces, non-decalcified specimens were resin embedded and sections subjected to combined scanning electron microscopy (SEM)/electron backscatter diffraction (EBSD)/energy dispersive X-ray spectrometry (EDS) analysis. We conclude that murine tibial periosteal ossification is a novel method for rapid assessment of the interaction of bioactive materials with osteogenic tissues. This study also highlights that combining calcium carbonate with hydroxyapatite enhances biodegradation and osteogenesis.

Also flagged:Wilms tumorWTtumorWT1tumor suppressorpathogenesis
Journal Article 2024-11-26 No Snippets Zeng Q, Tao J, Qin L, Zeng Y, Liu Z, Xu M, Zeng L.
Show Full Abstract

<h4>Background</h4>Wilms tumor (WT) is the most common pediatric kidney cancer, with survival rates exceeding 90% in localized cases. However, advanced or recurrent WT remains difficult to treat due to poor prognosis and limited knowledge of its molecular mechanisms. Gene expression profiling has shown promise in identifying prognostic markers and therapeutic targets. This study aimed to identify key prognostic genes and pathways in WT, construct risk prediction models, and validate their role in tumor progression.<h4>Methods</h4>RNA sequencing and clinical data from 136 WT patients were obtained from the TARGET database. Differential gene expression analysis was conducted using GEO datasets GSE11024 and GSE66405 to compare WT and normal kidney tissues. Identified differentially expressed genes (DEGs) underwent Gene Ontology (GO) and KEGG pathway enrichment analysis to explore biological functions and pathways associated with WT progression. Univariate Cox regression was used to assess the association between DEGs and overall survival (OS) and progression-free survival (PFS). LASSO regression models were developed for risk stratification, and model accuracy was evaluated using time-dependent ROC curves. External validation confirmed key hub genes, while functional assays in WT cell lines (WiT-49) assessed the role of GRAMD1A in tumor behavior.<h4>Results</h4>A total of 3,395 DEGs were identified, with 1,564 upregulated and 1,831 downregulated genes. Enrichment analyses revealed significant pathways involved in cell cycle regulation and metabolic reprogramming. Six key genes (GRAMD1A, PLXNA3, SPR, EBAG9, RBM47, and RIDA) were associated with both OS and PFS. LASSO models demonstrated strong predictive performance, with GRAMD1A identified as a major risk factor. External validation confirmed differential expression, and functional assays showed that GRAMD1A silencing significantly inhibited WT cell viability, proliferation, migration, and invasion.<h4>Conclusions</h4>This study identifies novel prognostic genes and potential therapeutic targets in WT. GRAMD1A, SPR, EBAG9, RBM47, and RIDA play critical roles in WT progression, with GRAMD1A as a key oncogenic factor, offering potential for risk stratification and future therapeutic intervention.

Also flagged:LEDGFCancerlens epithelium derived growth factor of 75 kDLEDGF/p75transcription co-activatoroncoprotein
Journal Article 2024-11-26 No Snippets Ortiz-Hernandez GL, Sanchez-Hernandez ES, Ochoa PT, Casiano CA.
Show Full Abstract

The lens epithelium derived growth factor of 75 kD (LEDGF/p75) is a transcription co-activator and epigenetic reader that has emerged as a stress oncoprotein in multiple human cancers. Growing evidence indicates that it promotes tumor cell survival against certain therapeutic drugs. The amino (N)-terminal region of LEDGF/p75 contains a PWWP domain that reads methylated histone marks, critical for recognizing transcriptionally active chromatin sites. Its carboxyl (C)-terminus has an integrase binding domain (IBD) that serves as the binding site for the HIV-1 integrase and multiple oncogenic transcription factors. Acting as hubs for protein-protein interactions, both domains facilitate the tethering of oncogenic transcription factors and regulators to active chromatin to regulate mRNA splicing, promote DNA repair, and enhance the expression of stress and cancer-related genes that contribute to tumor cell aggressiveness and chemoresistance. This review summarizes our current knowledge of the emerging roles of LEDGF/p75 in cancer biology and therapy resistance and discusses its potential as a novel oncotherapeutic target in combinatorial treatments.

MLLT10
Also flagged:Acute Lymphoblastic LeukemiaALLhematological neoplasmcell differentiationcanceracute leukemias
Journal Article 2024-11-26 ✓ 1 Snippet Ramírez Maldonado V, Navas Acosta J, Maldonado Marcos I, Villaverde Ramiro Á, Hernández-Sánchez A, Hernández Rivas JM, Benito Sánchez R.
In-Text Gene Mentions

…d SP1 rearrangements; PICALM::MLLT10or SET::NUMP214 fusion;…

Show Full Abstract

Acute lymphoblastic leukemia (ALL) is a hematological neoplasm characterized by the clonal expansion of abnormal lymphoid precursors in bone marrow, which leads to alterations in the processes of cell differentiation and maturation as a consequence of genetic alterations. The integration of conventional methods, such as cytogenetics and immunophenotyping, and next-generation sequencing (NGS) has led to significant improvements at diagnosis and patient stratification; this has also allowed the discovery of several novel molecular entities with specific genetic variants that may drive the processes of leukemogenesis. Nevertheless, the understanding of the process of leukemogenesis remains a challenge since this disease persists as the most frequent cancer in children; it accounts for approximately one-quarter of adult acute leukemias, and the patient management may take into consideration the high intra- and inter-tumor heterogeneity and the relapse risk due to the various molecular events that can occur during clonal evolution. Some germline variants have been identified as risk factors or have been found to be related to the response to treatment. Therefore, better knowledge of the genetic alterations in B-ALL will have a prognostic impact from the perspective of personalized medicine. This review aims to compare, synthesize, and highlight recent findings concerning ALL obtained through NGS that have led to a better understanding of new molecular subtypes based on immunophenotypic characteristics, mutational profiles, and expression profiles.

Also flagged:Uremic ToxinsCardiovascular diseaseCVDchronic kidney diseasepathogenesisendothelial dysfunction
Journal Article 2024-11-26 No Snippets Chermiti R, Burtey S, Dou L.
Show Full Abstract

Cardiovascular disease (CVD) is a major complication of chronic kidney disease (CKD), despite improvements in patient care. Vascular inflammation is a crucial process in the pathogenesis of CVD and a critical factor in the cardiovascular complications in CKD patients. CKD promotes a pro-inflammatory environment that impacts the vascular wall, leading to endothelial dysfunction, increased oxidative stress, and vascular remodeling. The uremic toxins that accumulate as kidney function declines are key contributors to vascular inflammatory processes. Our review will examine how CKD leads to vascular inflammation, paving the way to CVD. We will provide an overview of the mechanisms of vascular inflammation induced by uremic toxins, with a particular focus on those derived from tryptophan metabolism. These toxins, along with their receptor, the aryl hydrocarbon receptor (AHR), have emerged as key players linking inflammation and thrombosis. A deeper understanding of the mechanisms underlying inflammation in CKD, particularly those driven by uremic toxins, could reveal valuable therapeutic targets to alleviate the burden of CVD in CKD patients.

PCDH17
Also flagged:Bladder cancercancerNMIBCmethylationaluminiumarsenic
Journal Article 2024-11-26 ✓ 2 Snippets Jaszek N, Bogdanowicz A, Siwiec J, Starownik R, Kwaśniewski W, Mlak R.
In-Text Gene Mentions

…et al., includingPCDH17, POU4F2 ,…

…, HOXA9 ,PCDH17, and POU4F2…

Show Full Abstract

Bladder cancer (BC) currently ranks as the 9th most common cancer worldwide. It is characterised by very high rates of recurrence and metastasis. Most cases of BC are of urothelial origin, and due to its ability to penetrate muscle tissue, BC is divided into non-muscle-invasive BC (NMIBC) and muscle-invasive BC (MIBC). The current diagnosis of BC is still based primarily on invasive cystoscopy, which is an expensive and invasive method that carries a risk of various complications. Urine sediment cytology is often used as a complementary test, the biggest drawback of which is its very low sensitivity concerning the detection of BC at early stages, which is crucial for prompt implementation of appropriate treatment. Therefore, there is a great need to develop innovative diagnostic techniques that would enable early detection and accurate prognosis of BC. Great potential in this regard is shown by epigenetic changes, which are often possible to observe long before the onset of clinical symptoms of the disease. In addition, these changes can be detected in readily available biological material, such as urine or blood, indicating the possibility of constructing non-invasive diagnostic tests. Over the past few years, many studies have emerged using epigenetic alterations as novel diagnostic and prognostic biomarkers of BC. This review provides an update on promising diagnostic biomarkers for the detection and prognosis of BC based on epigenetic changes such as DNA methylation and expression levels of selected non-coding RNAs (ncRNAs), taking into account the latest literature data.

LRRC7
Also flagged:ALSgene expressionAmyotrophic Lateral Sclerosistranscriptional regulatorsTP53SOD1
Journal Article 2024-11-26 ✓ 1 Snippet Pappalardo XG, Jansen G, Amaradio M, Costanza J, Umeton R, Guarino F, De Pinto V, Oliver SG, Messina A, Nicosia G.
In-Text Gene Mentions

…R N ,LRRC7, MAGEA2B, MRPS18A, PPP3CA,…

Show Full Abstract

One of the most robust approaches to the prediction of causal driver genes of complex diseases is to apply reverse engineering methods to infer a gene regulatory network (GRN) from gene expression profiles (GEPs). In this work, we analysed 794 GEPs of 1117 human whole-blood samples from Amyotrophic Lateral Sclerosis (ALS) patients and healthy subjects reported in the GSE112681 dataset. GRNs for ALS and healthy individuals were reconstructed by ARACNe-AP (Algorithm for the Reconstruction of Accurate Cellular Networks - Adaptive Partitioning). In order to examine phenotypic differences in the ALS population surveyed, several datasets were built by arranging GEPs according to sex, spinal or bulbar onset, and survival time. The designed reverse engineering methodology identified a significant number of potential ALS-promoting mechanisms and putative transcriptional biomarkers that were previously unknown. In particular, the characterization of ALS phenotypic networks by pathway enrichment analysis has identified a gender-specific disease signature, namely network activation related to the radiation damage response, reported in the networks of bulbar and female ALS patients. Also, focusing on a smaller interaction network, we selected some hub genes to investigate their inferred pathological and healthy subnetworks. The inferred GRNs revealed the interconnection of the four selected hub genes (<i>TP53, SOD1, ALS2, VDAC3</i>) with p53-mediated pathways, suggesting the potential neurovascular response to ALS neuroinflammation. In addition to being well consistent with literature data, our results provide a novel integrated view of ALS transcriptional regulators, expanding information on the possible mechanisms underlying ALS and also offering important insights for diagnostic purposes and for developing possible therapies for a disease yet incurable.

Also flagged:bindingM6PIGF2TGF-βIGFcell growth
Journal Article 2024-11-26 No Snippets Huseynova F, Ionescu C, Cuisinier F, Huseynova I, Mammadov A, Barragan-Montero V.
Show Full Abstract

<b>Background</b>: CI-RM6P has different binding sites with affinities for both M6P and IGF2, plays a role in the regulation of the TGF-β and IGF pathways that is important for controlling cell growth and differentiation. We hypothesize that previously synthesised derivative of M6P could be an alternative candidate for bone tissue regeneration in terms of higher binding affinity, stability in human serum, low cost and temporal delivery. <b>Methods</b>: CH<sub>3</sub>-M6P is synthesised based on previously described protocol; mesenchymal origin of isolated DPSCs was assessed by flow cytometry and AR staining prior to alkaline phosphatase (ALP) activity test, qPCR to evaluate differentiation specific marker expression, immunofluoresence, and SEM/EDS to evaluate organic and inorganic matrix formation; and rat aortic ring model to evaluate angiogenic effect of molecule. <b>Results</b>: CH<sub>3</sub>-M6P upregulated ALP activity, the expression of the <i>ALP</i>, <i>Col1</i>, <i>RunX2</i>, <i>Mef2C</i>, <i>TGFβ1</i>, <i>TGFβ1R</i>, <i>TGFβ2</i>, and <i>Smad3</i> genes under osteogenic conditions. The results of immunofluorescence and SEM/EDS studies did not show enhancing effect on matrix formation. As we observed, the induction effect of CH<sub>3</sub>-M6P on the expression of angiogenic genes such as <i>SMAD3</i> and <i>TGFβ1R</i>, even under osteogenic conditions, within the scope of research, we checked the angiogenic effect of the molecule and compared it to VEGF, showing that the CH<sub>3</sub>-M6P is really angiogenic. <b>Conclusions</b>: Our findings provide an important clue for the further exploration of the molecule, which can be necessary to enhance the capability of the commonly used osteomedium, possibly leading to the development of bone-forming drugs and has the potential to be a dual-functioning molecule for bone tissue engineering.

HFE
Also flagged:Heart Failureliverdiabeteshypertensiondeathtype 2 diabetes mellitus
Journal Article 2024-11-26 ✓ 2 Snippets Buzas R, Ciubotaru P, Faur AC, Preda M, Ardelean M, Georgescu D, Dumitrescu P, Lighezan DF, Popa MD.
In-Text Gene Mentions

…liver disease, andhemochromatosis, among others […

…onsumption, storage diseases (hemochromatosis) or autoimmune liver…

Show Full Abstract

<i>Background and Objectives</i>: Heart failure is associated with high morbidity and mortality and linked with several pre-existing health conditions and risk factors. Early detection and prompt management in heart failure improves patient outcomes. Liver involvement is associated with heart failure disease progression, and hence liver biomarkers and liver fibrosis may have a prognostic impact. Several blood test based markers and scoring systems estimate liver fibrosis and hence can be useful prognostic tools. <i>Materials and Methods</i>: We retrospectively analyzed a series of 303 patients with decompensated heart failure in a city in western Romania over a period of 6 months. Several biochemical parameters were measured, the FIB-4 score was estimated and echocardiography was performed. Results for targeted variables are presented using descriptive statistics. Patients were analyzed based on their LVEF categories. Statistical analysis was based on ANOVA one-way tests for continuous variables and Chi-square tests for categorical variables. Pairwise comparisons were performed based on Bonferroni adjusted significance tests. The correlations between FIB-4 score, LVEF and NT-pro BNP in patients with and without diabetes and hypertension were explored using Spearman's correlation coefficient. <i>Result</i>: Age, gender, NYHA class, death, history of (h/o) type 2 diabetes mellitus (T2DM), h/o coronary artery disease (CAD), h/o arrhythmias, sodium, potassium, creatinine, eGFR, uric acid, NT-pro BNP, left atrial volume, LDL, HDL, and TG were analyzed by LVEF categories using ANOVA one-way tests, Chi-square tests, and Bonferroni correction comparisons. We found a strong statistically significant correlation between each of NT-pro BNP, left atrial volume, LDL, and HDL with the LVEF categories. <i>Discussion</i>: Early detection of cardiac dysfunction leads to better management in patients with cardiovascular risk factors including diabetes and hypertension. High LDL and low HDL levels contribute to a reduction in left ventricular (LV) function. Available literature suggests the FIB-4 score as superior to other non-invasive markers of fibrosis. It utilizes the patient's age, platelet count, AST, and ALT, which can be available retrospectively, making it an easy and inexpensive tool. FIB-4 score has a few limitations. <i>Conclusions</i>: Our study has shown a statistically significant positive correlation between severity categories of LVEF and FIB-4 score for heart failure patients with and without diabetes, and for heart failure patients with or without hypertension. We propose the implementation of FIB-4 score as a prognostic tool for heart failure.

Also flagged:Cas9Prostate cancerPCacancerdeathprimary tumor
Journal Article 2024-11-26 No Snippets Park J, Kim J.
Show Full Abstract

Prostate cancer (PCa) is the most prevalent malignancy and the second leading cause of cancer-related death in men. Although current therapies can effectively manage the primary tumor, most patients with late-stage disease manifest with metastasis in different organs. From surgery to treatment intensification (TI), several combinations of therapies are administered to improve the prognosis of patients with metastatic PCa. Due to the high frequency of the mutation during the metastatic phase, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) genetic engineering tool can accelerate the effects of TI by enhancing targeted gene therapy or immunotherapy. This review describes the genetic background of metastatic PCa and how CRISPR/Cas9 technology can contribute to the field of PCa treatment development. It also discusses the current limitations of conventional PCa therapy and the potential of CRISPR-based PCa therapy.

SERPINC1
Also flagged:Macrophage-inducible C-type lectinMinclepattern-recognition receptortrehalose dimycolatetrehalose dibehenatecancer
Journal Article 2024-11-26 ✓ 1 Snippet Weth AF, Dangerfield EM, Timmer MSM, Stocker BL.
In-Text Gene Mentions

…potent Mincle-signalling ofPGL-III, although mostly, Mincle-clus…

Show Full Abstract

The Macrophage-inducible C-type lectin (Mincle) is a pattern-recognition receptor (PRR), which has shown much promise as a molecular target for the development of T<sub>H</sub>1/T<sub>H</sub>17-skewing vaccine adjuvants. In 2009, the first non-proteinaceous Mincle ligands, trehalose dimycolate (TDM) and trehalose dibehenate (TDB), were identified. This prompted a search for other Mincle agonists and the exploration of Mincle agonists as vaccine adjuvants for both preventative and therapeutic (anti-cancer) vaccines. In this review, we discuss those classes of Mincle agonists that have been explored for their adjuvant potential. These Mincle agonists have been used as stand-alone adjuvants or in combination with other pathogen-associated molecular patterns (PAMPs) or immunomodulatory agents. We will also highlight recently identified Mincle ligands with hitherto unknown adjuvanticity. Conjugate vaccines that contain covalently linked adjuvants and/or adjuvant-antigen combinations are also presented, as well as the different formulations (e.g., oil-in-water emulsions, liposomes, and particulate delivery systems) that have been used for the codelivery of antigens and adjuvants. Insofar the reader is presented with a thorough review of the potential of Mincle-mediated vaccine adjuvants, including historical context, present-day research and clinical trials, and outstanding research questions, such as the role of ligand presentation and Mincle clustering, which, if better understood, will aid in the development of the much-needed T<sub>H</sub>1/T<sub>H</sub>17-skewing vaccine adjuvants.

Also flagged:cardiovascular diseasesCVDcerebrovascular diseasesCTLA-4CD86CD80
Journal Article 2024-11-26 No Snippets Shao Y, Yang WY, Nanayakkara G, Saaoud F, Ben Issa M, Xu K, Lu Y, Jiang X, Mohsin S, Wang H, Yang X.
Show Full Abstract

Although previous reviews explored the roles of selected immune checkpoints (ICPs) in cardiovascular diseases (CVD) and cerebrovascular diseases from various perspectives, many related aspects have yet to be thoroughly reviewed and analyzed. Our comprehensive review addresses this gap by discussing the cellular functions of ICPs, focusing on the tissue-specific and microenvironment-localized transcriptomic and posttranslational regulation of ICP expressions, as well as their functional interactions with metabolic reprogramming. We also analyze how 14 pairs of ICPs, including CTLA-4/CD86-CD80, PD1-PDL-1, and TIGIT-CD155, regulate CVD pathogenesis. Additionally, the review covers the roles of ICPs in modulating CD4<sup>+</sup>Foxp3<sup>+</sup> regulatory T cells (Tregs), T cells, and innate immune cells in various CVDs and cerebrovascular diseases. Furthermore, we outline seven immunological principles to guide the development of new ICP-based therapies for CVDs. This timely and thorough analysis of recent advancements and challenges provide new insights into the role of ICPs in CVDs, cerebrovascular diseases and Tregs, and will support the development of novel therapeutics strategies for these diseases.

bioRxiv 2024-11-26 Preprint (No Snippets API) Hujoel ML, Handsaker RE, Kamitaki N, Mukamel RE, Rubinacci S, Palamara PF, McCarroll SA, Loh P.
Show Full Abstract

Expansions and contractions of tandem DNA repeats are a source of genetic variation in human populations and in human tissues: some expanded repeats cause inherited disorders, and some are also somatically unstable. We analyzed DNA sequence data, derived from the blood cells of >700,000 participants in UK Biobank and the All of Us Research Program, and developed new computational approaches to recognize, measure and learn from DNA-repeat instability at 15 highly polymorphic CAG-repeat loci. We found that expansion and contraction rates varied widely across these 15 loci, even for alleles of the same length; repeats at different loci also exhibited widely variable relative propensities to mutate in the germline versus the blood. The high somatic instability of TCF4 repeats enabled a genome-wide association analysis that identified seven loci at which inherited variants modulate TCF4 repeat instability in blood cells. Three of the implicated loci contained genes ( MSH3 , FAN1 , and PMS2 ) that also modulate Huntington’s disease age-at-onset as well as somatic instability of the HTT repeat in blood; however, the specific genetic variants and their effects (instability-increasing or-decreasing) appeared to be tissue-specific and repeat-specific, suggesting that somatic mutation in different tissues—or of different repeats in the same tissue—proceeds independently and under the control of substantially different genetic variation. Additional modifier loci included DNA damage response genes ATAD5 and GADD45A . Analyzing DNA repeat expansions together with clinical data showed that inherited repeats in the 5’ UTR of the glutaminase ( GLS) gene are associated with stage 5 chronic kidney disease (OR=14.0 [5.7–34.3]) and liver diseases (OR=3.0 [1.5–5.9]). These and other results point to the dynamics of DNA repeats in human populations and across the human lifespan.

Preprints.org 2024-11-26 Preprint (No Snippets API) Maharana N, Panigrahi C(AK, Chaudhury SK, Uprety M, Barik P, Kulkarni P.
Show Full Abstract

This study explores the resilience of the Indian stock market in the face of global shocks in the post-pandemic era, focusing on its volatility dynamics and interconnections with international indices. Through a combination of Vector Autoregression (VAR), DCC-GARCH, and Wavelet analysis, we analysed the time-varying relationships between the National Stock Exchange (NSE) of India and major global indices, including those from the U.S., Europe, Asia-Pacific, Hong Kong and Japan. Time series data of the selected indices has been collected from January 1, 2021, to September 30, 2024. Results reveal that while the NSE demonstrates resilience through rapid adjustments following shocks, it remains vulnerable to substantial spillover effects from markets such as the S&amp;P 500 and European indices. Wavelet coherence analysis identifies periods of high correlation, particularly during major economic events, indicating that regional and global factors can periodically compromise market stability. Moreover, the DCC-GARCH results show a persistent but fluctuating correlation with specific markets, reflecting a connected and adaptive nature of the Indian market that is influenced by regional dynamics. This study emphasises the importance of strategic risk management. It highlights critical periods and indices that policymakers and investors should monitor closely to understand the economic resilience of the Indian financial market better. Further research could explore sector-specific impacts and the role of macroeconomic factors in shaping market responses.

Also flagged:cyclic dinucleotideguanosineadenosinecytosolcGASadaptor protein stimulator of interferon genes
Journal Article 2024-11-25 No Snippets Halbritter AJ, Gärtner YV, Nabiev J, Hernichel F, Ganazzoli G, Özdemir D, Pappa A, Veth S, Stazzoni S, Müller M, Hornung V, Carell T.
Show Full Abstract

2',3'-Cyclic GMP-AMP (cGAMP) is a cyclic dinucleotide second messenger in which guanosine and adenosine are connected by one 3'-5' and one 2'-5' phosphodiester linkage. It is formed in the cytosol upon detection of pathogenic DNA by the enzyme guanosine-monophosphate-adenosine monophosphate synthase (cGAS). cGAMP subsequently binds to the adaptor protein stimulator of interferon genes (STING) to elicit an innate immune response leading to the production of type I interferons and cytokines. STING agonists are a highly promising avenue for an immuno-oncological anticancer therapy. A particular challenge with cyclic dinucleotide STING agonists are the two negative charges of the phosphodiester linkages, which strongly reduce the ability of such compounds to penetrate cell membranes. The development of cell-permeable STING agonists that can stimulate the immune system enhancing their anticancer potency is currently of utmost importance in the field. Herein, we report the development of a dideoxy derivative of cGAMP as a phosphotriester prodrug, where the negative charge of the phosphate backbone has been masked with a thioester. We found that this thioester-protected compound features a dramatic increase in its cellular potency that rises from EC<sub>50</sub>=5 μM to 25 nM. The new compound is envisioned to enable an efficient STING-agonist-based anticancer therapy.

SERPINC1
Also flagged:BivalirudinHeparinMembranecongenital diaphragmatic herniaheparin-induced thrombocytopeniahepatic insufficiency
Journal Article 2024-11-25 ✓ 1 Snippet McMichael A, Weller J, Li X, Hatton L, Zia A, Raman L.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Objectives</h4>To test feasibility of a randomized controlled trial (RCT) with an endpoint of time at goal anticoagulation in children on extracorporeal membrane oxygenation (ECMO) randomized to receive bivalirudin vs. unfractionated heparin.<h4>Design</h4>Open-label pilot RCT (NCT03318393) carried out 2018-2021.<h4>Setting</h4>Single-center quaternary U.S. pediatric hospital.<h4>Patients</h4>Children 0 days to younger than 18 years old supported with ECMO in the PICU or cardiovascular ICU.<h4>Interventions</h4>Randomization to bivalirudin vs. unfractionated heparin while on ECMO.<h4>Measurements and main results</h4>Sixteen patients were randomized to bivalirudin, and 14 patients were randomized to heparin. There was no difference in the primary outcome, time spent at goal anticoagulation, for patients randomized to bivalirudin compared with those randomized to heparin. While hemorrhagic complications were similar between study groups, thrombotic complications were higher with six of 16 patients in the bivalirudin group having one or more circuit changes compared with 0 of 14 patients in heparin group (mean difference, 37.5% [95% CI, 8.7-61.4%]; p = 0.02). Patients in the bivalirudin group received less packed RBC transfusions vs. those receiving heparin (median [interquartile range], 6.3 mL/kg/d [2.5-8.4 mL/kg/d] vs. 12.2 mL/kg/d [5.5-14.5 mL/kg/d]; p = 0.02).<h4>Conclusions</h4>In this single-center pilot RCT carried out 2018-2021, we found that the test of anticoagulation therapy of bivalirudin vs. heparin during ECMO was feasible. Larger multicenter studies are required to further assess the safety and efficacy of bivalirudin for pediatric ECMO.

SERPINC1
Also flagged:membranelecithinphosphatidylserinephosphatidylethanolaminecholesterolvitamin C
Journal Article 2024-11-25 ✓ 2 Snippets Dcunha R, Aravind A, Bhaskar S, Mutalik S, Mutalik S, Kalthur SG, Kumar A, Hegde P, Adiga SK, Zhao Y, Kannan N, Prasad TSK, Kalthur G.
In-Text Gene Mentions

…Car3, ltih2, C3,Serpinc1, and tpm1 were…

…high level ofSERPINC1protein in the…

Show Full Abstract

The present study explores the advantages of enriching the freezing medium with membrane lipids and antioxidants in improving the outcome of prepubertal testicular tissue cryopreservation. For the study, testicular tissue from Swiss albino mice of prepubertal age group (2 weeks) was cryopreserved by slow freezing method either in control freezing medium (CFM; containing DMSO and FBS in DMEM/F12) or test freezing medium (TFM; containing soy lecithin, phosphatidylserine, phosphatidylethanolamine, cholesterol, vitamin C, sodium selenite, DMSO and FBS in DMEM/F12 medium) and stored in liquid nitrogen for at least one week. The tissues were thawed and enzymatically digested to assess viability, DNA damage, and oxidative stress in the testicular cells. The results indicate that TFM significantly mitigated freeze-thaw-induced cell death, DNA damage, and lipid peroxidation compared to tissue cryopreserved in CFM. Further, a decrease in Cyt C, Caspase-3, and an increase in Gpx4 mRNA transcripts were observed in tissues frozen with TFM. Spermatogonial germ cells (SGCs) collected from tissues frozen with TFM exhibited higher cell survival and superior DNA integrity compared to those frozen in CFM. Proteomic analysis revealed that SGCs experienced a lower degree of freeze-thaw-induced damage when cryopreserved in TFM, as evident from an increase in the level of proteins involved in mitigating the heat stress response, transcriptional and translational machinery. These results emphasize the beneficial role of membrane lipids and antioxidants in enhancing the cryosurvival of prepubertal testicular tissue offering a significant stride towards improving the clinical outcome of prepubertal testicular tissue cryopreservation.

Also flagged:metalsorganochlorinepolychlorinated biphenylsarsenicmineralwater
Journal Article 2024-11-25 No Snippets Moriarity RJ, Wilton MJ, Tsuji LJS, Sarkar A, Liberda EN.
Show Full Abstract

Globally, soil contamination threatens ecosystems and food security. This study examines the contamination of soils intended for agri-food initiatives by Indigenous communities across New South Wales and Queensland, Australia, and Newfoundland and subarctic Ontario, Canada. Soils from 47 sites were tested for metals, metalloids, organochlorine (OC) pesticides, and polychlorinated biphenyls (PCBs) to assess ecological risks and compare against national guidelines. Australian soils were primarily contaminated with lead (Pb) and to a lesser extent with other metals and metalloids, whereas subarctic Ontario soils were heavily contaminated with OC pesticides, and to a lesser extent metals and metalloids. Newfoundland soils contained arsenic (As) concentrations exceeding agricultural soil guidelines with limited OC levels. The contaminants from these sites stem from both anthropogenic activities and natural geological sources; however, their precise origins-whether from the historical use of banned substances or mineral extraction-are not fully elucidated for all sites. This article specifically highlights the need to assess soil to be used in agri-food initiatives for contaminants in rural and remote landscapes in Indigenous homelands worldwide and, in general, for all soil to be used in any agri-food initiative.

Also flagged:UveitisJIAArthritisCorticosteroidinflammatory ocular diseaseJuvenile Idiopathic Arthritis
Journal Article 2024-11-25 No Snippets Maccora I, Altaye M, Greis KD, Brunner HI, Duell A, Haffey WD, Nguyen T, Quinlan-Waters M, Schulert GS, Sproles A, Utz VM, Thornton S, Angeles-Han ST.
Show Full Abstract

<h4>Background</h4>Uveitis is an inflammatory ocular disease secondary to disruption of the retinal pigmented epithelium (RPE) and blood retinal barrier (BRB). Known clinical factors do not accurately predict uveitis risk in Juvenile Idiopathic Arthritis (JIA). Tear fluid is easily obtained for biomarker study. We aim to identify tear-based markers associated with the presence of uveitis in children with JIA.<h4>Methods</h4>In a cross-sectional comparative cohort study, tears were collected by Schirmer strips from children with oligoarticular JIA-associated uveitis (JIA-U) and JIA without uveitis (JIA-no-U). A tandem isotope tagging (iTRAQ and TMT) strategy was used for relative quantitation via nanoLC-MS/MS to quantify proteins in the affected eye. Log transformed relative protein abundance of protein levels was compared between groups using Wilcoxon exact test. We explored the influence of arthritis activity and topical corticosteroids (CS) use on protein levels. STRING analysis was performed.<h4>Results</h4>Tear samples of 14 JIA-U and 14 JIA-no-U patients were analyzed. Thirteen proteins were differentially expressed between both groups. Stratified analysis based on arthritis activity (inactive arthritis) and topical CS (off CS) showed that alpha-2-macroglobulin (<i>p</i> = 0.012), apolipoprotein A1 (<i>p</i> = 0.036), S100A9 (<i>p</i> = 0.05), haptoglobin (<i>p</i> = 0.066), and transthyretin (<i>p</i> = 0.066) consistently differentiated between both groups. On STRING analysis, these proteins were associated with the RPE, BRB, and inflammation.<h4>Conclusion</h4>Importantly, we identified proteins involved in the RPE, BRB, and immune response that were differentially abundant in the tears of children with JIA-U compared to JIA-no-U, regardless of arthritis activity or topical CS. Candidate tear-based biomarkers may represent a non-invasive means to detect uveitis.

Also flagged:WntneurogenesisNodalbehavioraldepressiondrug addiction
Journal Article 2024-11-25 No Snippets Lanoizelet M, Michel L, Lagadec R, Mayeur H, Guichard L, Logeux V, Séverac D, Martin K, Klopp C, Marcellini S, Castillo H, Pollet N, Candal E, Debiais-Thibaud M, Boisvert C, Billoud B, Schubert M, Blader P, Mazan S.
Show Full Abstract

The mode of evolution of left-right asymmetries in the vertebrate habenulae remains largely unknown. Using a transcriptomic approach, we show that in a cartilaginous fish, the catshark Scyliorhinus canicula, habenulae exhibit marked asymmetries, in both their medial and lateral components. Comparisons across vertebrates suggest that those identified in lateral habenulae reflect an ancestral gnathostome trait, partially conserved in lampreys, and independently lost in tetrapods and neopterygians. Asymmetry formation involves distinct mechanisms in the catshark lateral and medial habenulae. Medial habenulae are submitted to a marked, asymmetric temporal regulation of neurogenesis, undetectable in their lateral counterparts. Conversely, asymmetry formation in lateral habenulae results from asymmetric choices of neuronal identity in post-mitotic progenitors, a regulation dependent on the repression of Wnt signaling by Nodal on the left. Based on comparisons with the mouse and the zebrafish, we propose that habenular asymmetry formation involves a recurrent developmental logic across vertebrates, which relies on conserved, temporally regulated genetic programs sequentially shaping choices of neuronal identity on both sides and asymmetrically modified by Wnt activity.

MLLT10
Also flagged:T cell acute lymphoblastic leukemiaALLtumorhematopoiesisBMPleukemia
Journal Article 2024-11-25 ✓ 2 Snippets Xu J, Chen C, Sussman JH, Yoshimura S, Vincent T, Pölönen P, Hu J, Bandyopadhyay S, Elghawy O, Yu W, Tumulty J, Chen CH, Li EY, Diorio C, Shraim R, Newman H, Uppuluri L, Li A, Chen GM, Wu DW, Ding YY, Xu JA, Karanfilovski D, Lim T, Hsu M, Thadi A, Ahn KJ, Wu CY, Peng J, Sun Y, Wang A, Mehta R, Frank D, Meyer L, Loh ML, Raetz EA, Chen Z, Wood BL, Devidas M, Dunsmore KP, Winter SS, Chang TC, Wu G, Pounds SB, Zhang NR, Carroll W, Hunger SP, Bernt K, Yang JJ, Mullighan CG, Tan K, Teachey DT.
In-Text Gene Mentions

…cluster expression, includingMLLT10, KMT2A ,…

…( KMT2A andMLLT10fusions), two of…

Show Full Abstract

Refractoriness to initial chemotherapy and relapse after remission are the main obstacles to curing T cell acute lymphoblastic leukemia (T-ALL). While tumor heterogeneity has been implicated in treatment failure, the cellular and genetic factors contributing to resistance and relapse remain unknown. Here we linked tumor subpopulations with clinical outcome, created an atlas of healthy pediatric hematopoiesis and applied single-cell multiomic analysis to a diverse cohort of 40 T-ALL cases. We identified a bone marrow progenitor (BMP)-like leukemia subpopulation associated with treatment failure and poor overall survival. The single-cell-derived molecular signature of BMP-like blasts predicted poor outcome across multiple subtypes of T-ALL and revealed that NOTCH1 mutations additively drive T-ALL blasts away from the BMP-like state. Through in silico and in vitro drug screenings, we identified a therapeutic vulnerability of BMP-like blasts to apoptosis-inducing agents including venetoclax. Collectively, our study establishes multiomic signatures for rapid risk stratification and targeted treatment of high-risk T-ALL.

B4GALT5
Also flagged:GOLPH3GOLPH3LlocalizationLYSETSPPL3TMEM251
Journal Article 2024-11-25 ✓ 5 Snippets Brauer BK, Chen Z, Beirow F, Li J, Meisinger D, Capriotti E, Schweizer M, Wagner L, Wienberg J, Hobohm L, Blume L, Qiao W, Narimatsu Y, Carette JE, Clausen H, Winter D, Braulke T, Jabs S, Voss M.
In-Text Gene Mentions

…Golgi membrane proteinB4GALT5.…

…in wild-type cellsB4GALT5is tagged with…

…Hence, M6P-tagging ofB4GALT5may represent a…

…We also observedB4GALT5hypersecretion and prominent…

…lysosomal enzymes andB4GALT5, an M6P-modified Golgi…

Show Full Abstract

Glycosylation, which plays an important role in modifying lipids and sorting of proteins, is regulated by asymmetric intra-Golgi distribution and SPPL3-mediated cleavage of Golgi enzymes. We found that cells lacking LYSET/TMEM251, a retention factor for Golgi N-acetylglucosamine-1-phosphotransferase (GNPT), display SPPL3-dependent hypersecretion of the Golgi membrane protein B4GALT5. We demonstrate that in wild-type cells B4GALT5 is tagged with mannose 6-phosphate (M6P), a sorting tag typical of soluble lysosomal hydrolases. Hence, M6P-tagging of B4GALT5 may represent a novel degradative lysosomal pathway. We also observed B4GALT5 hypersecretion and prominent destabilization of LYSET-GNPT complexes, impaired M6P-tagging, and disturbed maturation and trafficking of lysosomal enzymes in multiple human cell lines lacking the COPI adaptors GOLPH3 and GOLPH3L. Mechanistically, we identified LYSET as a novel, atypical client of GOLPH3/GOLPH3L. Thus, by ensuring the cis-Golgi localization of the LYSET-GNPT complex and maintaining its Golgi polarity, GOLPH3/GOLPH3L is essential for the integrity of the M6P-tagging machinery and homeostasis of lysosomes.

NEGR1
Also flagged:colorectal cancerPI3KAKTmalignant tumorColorectal cancer liver metastasisdeath
Journal Article 2024-11-25 ✓ 5 Snippets Dai S, Zhuang H, Li Z, Chen Z, Chai Y, Zhou Q.
In-Text Gene Mentions

…miR-122/NEGR1axis contributes colorectal…

…NA-pulldown confirmed miR-122/NEGR1interaction.…

…miR-122 and decreasedNEGR1in liver metastases…

…The miR-122/NEGR1axis enhanced CRC…

…Furthermore, reducedNEGR1promoted M2 macrophage…

Show Full Abstract

Colorectal cancer (CRC) is a prevalent malignant tumor in the gastrointestinal tract, with around 50% of patients experiencing distant metastases, predominantly to the liver. Colorectal cancer liver metastasis (CRLM) is a leading cause of CRC-related death, and effective treatments remain limited. This study aims to identify new targets for predicting and treating CRLM. Bioinformatics analysis highlighted the miR-122/NEGR1 axis as crucial in CRLM. In vitro assays (Colony formation, Wound healing, Transwell) explored the impact of this axis on CRC cell proliferation, invasion, and migration. Dual-Luciferase Reporter Gene Assay and RNA-pulldown confirmed miR-122/NEGR1 interaction. In vivo, CRLM model mice were used to investigate the axis's effects on tumor metastasis and macrophage polarization. Immunofluorescence (IF), Quantitative Real-time PCR (qRT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), and Western Blot (WB) analyzed macrophage polarization markers and cytokine/protein/RNA expression. Results showed increased miR-122 and decreased NEGR1 in liver metastases compared to primary tumors. The miR-122/NEGR1 axis enhanced CRC cell proliferation, migration, invasion, and affected the PI3K/AKT pathway. Furthermore, reduced NEGR1 promoted M2 macrophage polarization and accelerated liver metastasis in CRLM model mice. In conclusion, the miR-122/NEGR1 axis drives CRC progression and liver metastasis through the PI3K/AKT pathway and M2 macrophage polarization, representing a potential target for the therapy of CRLM.

MLLT10DNAJC1
Also flagged:polycystic ovary syndromebreast cancerPCOSFTOSER1RALB
Journal Article 2024-11-25 ✓ 5 Snippets Bi K, Chen M, Zhao Q, Yang T, Xie W, Ma W, Jia H.
In-Text Gene Mentions
⭐ same-sentence co-mention

…positional: CASC10, SKIDA1,MLLT10and DNAJC1) (Fig.…

⭐ same-sentence co-mention

…SKIDA1, MLLT10 andDNAJC1) (Fig. 4 ,…

…ESR1, FGFR2, SNRPD2,MLLT10, ZMIZ1, SKIDA1 and…

…Thirteen genes (SKIDA1,MLLT10, ZMIZ1, FTO, SNRPD2,…

…FTO, RALB, SKIDA1,MLLT10, FTO, SNRPD2 and…

Show Full Abstract

<h4>Background</h4>The clinically high comorbidity between polycystic ovary syndrome (PCOS) and breast cancer (BC) has been extensively reported. However, limited knowledge exists regarding their shared genetic basis and underlying mechanisms.<h4>Method</h4>Leveraging summary statistics from the largest genome-wide association studies (GWASs) to date, we conducted a comprehensive genome-wide cross-trait analysis of PCOS and BC. A variety of genetic statistical methods were employed to uncover potential shared genetic causes.<h4>Results</h4>Our analysis revealed genetic overlap between the three trait pairs. After partitioning the genome into 2,495 independent regions, we identified two loci, chr8: 75,011,700-76,295,483 and chr17: 6,305,079-7,264,458, with significant localized genetic correlations. Pleiotropic analysis under a composite null hypothesis identified 1,183 significant pleiotropic single nucleotide polymorphisms (SNPs) across three trait pairs. FUMA mapped 26 pleiotropic loci, with regions 16q12.2 and 6q25.1 duplicated across all three trait pairs, while COLOC detected three loci with colocalization evidence. Gene-based analysis identified 23 unique candidate pleiotropic genes, including the FTO shared by all trait pairs, as well as SER1, RALB, and others in two trait pairs. Pathway enrichment analysis further highlighted key biological pathways, primarily involving the significant biological pathways were the metabolism of regulation of autophagy, regulation of cellular catabolic process, and positive regulation of catabolic process. Latent Heritable Confounder Mendelian randomization (LHC-MR) supported a positive causal relationship between PCOS and both BCALL and ERPBC but not with ERNBC.<h4>Conclusion</h4>In conclusion, our genome-wide cross-trait analysis identified a shared genetic basis between PCOS and BC, specific identical genetic mechanisms and causality between PCOS and various BC subtypes, which could better explains the genetics of the co-morbidity of PCOS and ERPBC rather than PCOS and ERNBC. These findings provide new insights into the biological mechanisms underlying the co-morbidity of these two complex diseases, which have important implications for clinical disease intervention, treatment, and improved prognosis.

Also flagged:Spinal Cord InjuryMitophagyFKBP52AKTmitochondrialTacrolimus
Journal Article 2024-11-25 No Snippets Tian Z, Hu HJ, Chan CC, Hu T, Cai C, Li H, Rong L, Jiang GB, Liu B.
Show Full Abstract

In the realm of neural regeneration post-spinal cord injury, hydrogel scaffolds carrying induced neural stem cells (iNSCs) have demonstrated significant potential. However, challenges such as graft rejection and dysfunction caused by mitochondrial damage persist after transplantation, presenting formidable barriers. Tacrolimus, known for its dual role as an immunosuppressant and promoter of neural regeneration, holds the potential for enhancing iNSC transplantation. However, systemic administration of tacrolimus often comes with severe side effects. This study pioneers the development of a self-healing hydrogel with sustained-release tacrolimus (COCu-Tac), tailored specifically for iNSC transplantation after spinal cord injury. This research reveals that the sustained release of tacrolimus enhances axonal growth and improves mitochondrial quality control in iNSCs and neurons. Further analysis shows that tacrolimus targets FKBP52 rather than FKBP51, enhancing mitophagy via the FKBP52/AKT pathway. This advanced system demonstrates significant efficacy in promoting neural regeneration and restoring motor function following spinal cord injury.

HTT
Also flagged:Postpartum Depressionemotional disorderestrogenestrogen receptorbehavioralESR2
Journal Article 2024-11-25 ✓ 1 Snippet Luo F, Luo F, Liu L, Guo M, Liang J, Chen L, Shi X, Liu H, Cheng Y, Du Y.
In-Text Gene Mentions

…to neurotransmission (e.g.,5-HTT[ 16 ]…

Show Full Abstract

Postpartum depression (PPD) represents a important emotional disorder emerging after childbirth, characterized by its complex etiology and challenging management. Despite extensive preclinical and clinical investigations underscoring the role of estrogen fluctuations and estrogen receptor genes in PPD, the precise mechanisms underpinning this condition have remained elusive. In our present study, animal behavioral studies have elucidated a tight link between the aberrant expression of ESR2, miR-10a-5p, and BDNF in the prefrontal cortex of mice exhibiting postpartum depressive-like behavior, shedding light on the potential molecular pathways involved. Integrating bioinformatics, in vivo, and cell transfection methodologies has unraveled the intricate molecular interplay between ESR2, miR-10a-5p, and BDNF. We identified ESR2 as a negative transcription factor that down-regulates miR-10a transcription, while miR-10a-5p serves as a negative regulator that suppresses BDNF expression. This molecular triad contributes to the pathogenesis of PPD by affecting synaptic plasticity, as evidenced by alterations in synapse-related proteins (e.g., SYP, SYN, and PSD95) and glutamate receptor expression. Additionally, primary neuron culture studies have confirmed the critical roles of ESR2 and miR-10a-5p in maintaining neuronal growth and morphology. Therapeutic interventions, including stereotactic and intranasal administration of antagomir or BDNF, have demonstrated significant potential in treating PPD, highlighting the therapeutic implications of targeting the negative transcriptional and regulatory interactions between ESR2, miR-10a-5p, and BDNF. Our findings endorse the hypothesis that estrogen fluctuations and estrogen receptor gene activity are pivotal stressors and risk factors for PPD, affecting central nervous system functionality and precipitating depressive behaviors postpartum.

HTT
Also flagged:lysine methyltransferaseSETD2cancerhistone methyltransferaselysinehistone
Journal Article 2024-11-25 ✓ 3 Snippets Michail C, Rodrigues Lima F, Viguier M, Deshayes F.
In-Text Gene Mentions

…the Huntingtin protein (HTT).…

…with Huntingtin protein (HTT) via the WW…

…disruption of the SETD2-HTT-HIP1R axis inhibits actin…

Show Full Abstract

SETD2 is known to be the unique histone methyltransferase responsible for the trimethylation of the lysine 36 of histone H3 thus generating H3K36me3. This epigenetic mark is critical for transcriptional activation and elongation, DNA repair, mRNA splicing, and DNA methylation. Recurrent SETD2-inactivating mutations and altered H3K36me3 levels are found in cancer at high frequency and numerous studies indicate that SETD2 acts as a tumor suppressor. Recently, SETD2 was further shown to methylate non-histone proteins particularly the cytoskeletal proteins tubulin and actin with subsequent impacts on cytoskeleton structure, mitosis and cell migration. Herein, we provide a review of the role of SETD2 in different cancers with special emphasis on the structural basis of the functions of this key lysine methyltransferase. Moreover, beyond the role of this enzyme in epigenetics and H3K36me3-dependent processes, we highlight the putative role of "non-epigenetic/H3K36me3" functions of SETD2 in cancer, particularly those involving the cytoskeleton.

Also flagged:hereditary hemochromatosisHAMP
Journal Article 2024-11-25 No Snippets Wang Z, Hou W, Zheng H.
Show Full Abstract

The incidence of juvenile Hereditary Hemochromatosis caused by HAMP gene mutation is low, which is rarely reported in China. This patient took abnormal liver function as the first symptom, and was finally diagnosed by genetic testing and hepatic histopathology, and treated by venous bloodletting.

HFE
Also flagged:Strokedeathstrokesischemic strokeacute ischemic strokeacute myocardial infarction
Journal Article 2024-11-25 ✓ 2 Snippets Ke L, Zhang H, Long K, Peng Z, Huang Y, Ma X, Wu W.
In-Text Gene Mentions

…variations in thehemochromatosisgene (HFE) are…

…the hemochromatosis gene (HFE) are associated with…

Show Full Abstract

<h4>Background</h4>Ischemic stroke is one of the leading causes of disability and death worldwide, with a high risk of recurrence that severely impacts the quality of life of patients. Therefore, identifying and analyzing the risk factors for recurrent ischemic stroke is crucial for the prevention and management of this disease.<h4>Methods</h4>A total of 114 cases of recurrent acute ischemic stroke patients admitted from July 2017 to March 2021 were selected as the observation group, and another 409 cases of initial ischemic stroke patients from the same period as the control group. The clinical data of the observation group and the control group were compared to analyze the risk factors associated with the readmission of ischemic stroke. A single-factor analysis (Model 1), Least Absolute Shrinkage and Selection Operator (LASSO) regression, and machine learning methods (Model 2) were used to screen important variables, and a multi-factor COX Proportional Hazards Model regression stroke recurrence risk prediction model was constructed. The predictive performance of the model was evaluated by the consistency index (C-index).<h4>Results</h4>Multivariate COX regression analysis revealed that history of hypertension (Hazard Ratio [HR] = 2.549; 95% Confidence Interval (CI) [1.503-4.321]; <i>P</i> = 0.001), history of cerebral infarction (HR = 1.709; 95% CI [1.066-2.738]; <i>P</i> = 0.026), cerebral artery stenosis (HR = 0.534; 95% CI [0.306-0.931]; <i>P</i> = 0.027), carotid arteriosclerosis (HR = 1.823; 95% CI [1.137-2.924]; <i>P</i> = 0.013), systolic blood pressure (HR = 0.981; 95% CI [0.971-0.991]; <i>P</i> < 0.0001), red cell distribution width-coefficient of variation (RDW-CV) (HR = 1.251; 95% CI [1.019-1.536]; <i>P</i> = 0.033), mean platelet volume (MPV) (HR = 1.506; 95% CI [1.148-1.976]; <i>P</i> = 0.003), uric acid (UA) (HR = 0.995; 95% CI [0.991-1.000]; <i>P</i> = 0.049) were found significantly associated with acute ischemic stroke. The C-index of the full COX model was 0.777 (0.732~0.821), showing a good discrimination between Model 1 and Model 2.<h4>Conclusions</h4>History of hypertension, history of cerebral infarction, cerebral artery stenosis, carotid atherosclerosis, systolic blood pressure, UA, RDW-CV, and MPV were identified as risk factors for acute ischemic stroke recurrence. The model can be used to predict the recurrence of acute ischemic stroke.

HFE
Also flagged:Wilson's DiseaseWDATP7Bcopperhypertransaminasemiachronic hepatitis
Journal Article 2024-11-25 ✓ 5 Snippets La Rosa A, Covone AE, Coviello D, Arrigo S, Ferro J, Gandullia P, Madeo A.
In-Text Gene Mentions

…the WD phenotype;HFEvariants may act…

…HADHA, HADHB, HAMP,HFE, HNF1B, HSD3B7, JAG1,…

…1, due toHFEgene mutations, is…

HFEencodes for a…

…most common pathogenicHFEvariant is the…

Show Full Abstract

Wilson's disease (WD) is a rare autosomal recessive disorder caused by mutations in the ATP7B gene, resulting in copper accumulation. Symptoms rarely appear before the age of 5, almost never before 3. The phenotypic variability of WD suggests the presence of modifying factors, making early diagnosis challenging. We present a case of symptomatic WD in a toddler, emphasizing the importance of considering WD in differential diagnoses and exploring genetic modifiers influencing disease onset. Clinical and laboratory assessments, including liver biopsy, were performed on a 4.2-year-old boy presenting with hypertransaminasemia and mild hepatomegaly. Histological evaluation revealed chronic hepatitis with fibrosis and severe steatosis, indicating long-standing active disease. Genetic analysis identified a missense variant and a 15-nucleotide deletion in the 5' UTR promoter region of the ATP7B gene, confirming the WD diagnosis. Additionally, homozygosity for the HFE H63D variant was detected, with transferrin saturations at the upper limit of normal. The patient's clinical management included a trial of D-penicillamine, discontinued due to side effects, followed by successful zinc acetate therapy. This case underscores the consideration of WD in the differential diagnosis of toddlers. The Ferenci-Leipzig score remains a valid diagnostic tool for WD even in the presence of a single ATP7B variant, although extended genetic analysis should still be considered. Normal ceruloplasmin levels do not rule out WD. Environmental, epigenetic, and genetic factors appear to influence the WD phenotype; HFE variants may act as modifiers given the link between iron and copper homeostasis, possibly explaining the early symptomatic onset in our patient.

Also flagged:functional dyspepsiamitochondrialMitochondriaautophagysignal transductionpathogenesis
Journal Article 2024-11-25 No Snippets Zhong K, Du X, Niu Y, Li Z, Tao Y, Wu Y, Zhang R, Guo L, Bi Y, Tang L, Dou T, Wang L.
Show Full Abstract

Mitochondria are the main source of energy for cellular activity. Their functional damage or deficiency leads to cellular deterioration, which in turn triggers autophagic reactions. Taking mitochondrial autophagy as a starting point, the present review explored the mechanisms of duodenal abnormalities in detail, including mucosal barrier damage, release of inflammatory factors, and disruption of intracellular signal transduction. We summarized the key roles of mitochondrial autophagy in the abnormal development of the duodenum and examined the in-depth physiological and pathological mechanisms involved, providing a comprehensive theoretical basis for understanding the pathogenesis of functional dyspepsia. At present, it has been confirmed that an increase in the eosinophil count and mast cell degranulation in the duodenum can trigger visceral hypersensitive reactions and cause gastrointestinal motility disorders. In the future, it is necessary to continue exploring the molecular mechanisms and signaling pathways of mitochondrial autophagy in duodenal abnormalities. A deeper understanding of mitochondrial autophagy provides important references for developing treatment strategies for functional dyspepsia, thereby improving clinical efficacy and patient quality of life.

PRDX6
Also flagged:Cancers of thetumorscognitioncognitive deficitsMicrogliasynapses
Journal Article 2024-11-25 ✓ 3 Snippets Strohm AO, Oldfield S, Hernady E, Johnston CJ, Marples B, O'Banion MK, Majewska AK.
In-Text Gene Mentions

…Hsp90aa1, Ddx3x, Eif2s3x,Prdx6, which were also…

…Hsp90aa1, Ddx3x, Eif2s3x,Prdx6( Weis et…

…two of which (Prdx6and Fam81a) have…

Show Full Abstract

Patients receiving cranial radiation therapy experience tissue damage and cognitive deficits that severely decrease their quality of life. Experiments in rodent models show that these adverse neurological effects are in part due to functional changes in microglia, the resident immune cells of the central nervous system. Increasing evidence suggests that experimental manipulation of microglial signaling can regulate radiation-induced changes in the brain and behavior. Furthermore, many studies show sex-dependent neurological effects of radiation exposure. Despite this, few studies have used both males and females to explore how sex and microglial function interact to influence radiation effects on the brain. Here, we used a system levels approach to examine how deficiencies in purinergic and fractalkine signaling, two important microglial signaling pathways, impact brain proteomic and behavioral profiles in irradiated and control male and female mice. We performed a comprehensive analysis of the cortical proteomes from irradiated and control C57BL/6J, P2Y12-/-, and CX3CR1-/- mice of both sexes using multiple bioinformatics methods. We identified distinct proteins and biological processes, as well as behavioral profiles, regulated by sex, genotype, radiation exposure, and their interactions. Disrupting microglial signaling, had the greatest impact on proteomic expression, with CX3CR1-/- mice showing the most distinct proteomic profile characterized by upregulation of CX3CL1. Surprisingly, radiation exposure caused relatively smaller proteomic changes in glial and synaptic proteins, including Rgs10, Crybb1, C1qa, and Hexb. While we observed some radiation effects on locomotor behavior, biological sex as well as loss of P2Y12 and CX3CR1 signaling had a stronger influence on locomotor outcomes in our model. Lastly, loss of P2Y12 and CX3CR1 strongly regulated exploratory behaviors. Overall, our findings provide novel insights into the molecular pathways and proteins that are linked to P2Y12 and CX3CR1 signaling, biological sex, radiation exposure, and their interactions.

ZNFX1
Also flagged:Tyrosine KinaseHepatocellular Carcinomacancerliver cancerliver cancerstumor
Journal Article 2024-11-25 ✓ 1 Snippet Gawi Ermi A, Sarkar D.
In-Text Gene Mentions

…identified lncRNA ZFAS1 (ZNFX1antisense RNA 1)…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a leading cause of cancer-related deaths worldwide, and the development of effective treatment strategies remains a significant challenge in the management of advanced HCC patients. The emergence of tyrosine kinase inhibitors (TKIs) has been a significant advancement in the treatment of HCC, as these targeted therapies have shown promise in prolonging the survival of patients with advanced disease. Although immunotherapy is currently considered as the first line of treatment for advanced HCC patients, many such patients do not meet the clinical criteria to be eligible for immunotherapy, and in many parts of the world there is still lack of accessibility to immunotherapy. As such, TKIs still serve as the first line of treatment and play a major role in the treatment repertoire for advanced HCC patients. However, the development of resistance to these agents is a major obstacle that must be overcome. In this review, we explore the underlying mechanisms of resistance to TKIs in HCC, the clinical implications of this resistance, and the potential strategies to overcome or prevent the emergence of resistance.

Also flagged:COVID-19proteaseneuraminidasenucleosidereverse transcriptasenuclear import
Journal Article 2024-11-25 No Snippets Barghash RF, Gemmati D, Awad AM, Elbakry MMM, Tisato V, Awad K, Singh AV.
Show Full Abstract

Amidst the ongoing global challenge of the SARS-CoV-2 pandemic, the quest for effective antiviral medications remains paramount. This comprehensive review delves into the dynamic landscape of FDA-approved medications repurposed for COVID-19, categorized as antiviral and non-antiviral agents. Our focus extends beyond conventional narratives, encompassing vaccination targets, repurposing efficacy, clinical studies, innovative treatment modalities, and future outlooks. Unveiling the genomic intricacies of SARS-CoV-2 variants, including the WHO-designated Omicron variant, we explore diverse antiviral categories such as fusion inhibitors, protease inhibitors, transcription inhibitors, neuraminidase inhibitors, nucleoside reverse transcriptase, and non-antiviral interventions like importin α/β1-mediated nuclear import inhibitors, neutralizing antibodies, and convalescent plasma. Notably, Molnupiravir emerges as a pivotal player, now licensed in the UK. This review offers a fresh perspective on the historical evolution of COVID-19 therapeutics, from repurposing endeavors to the latest developments in oral anti-SARS-CoV-2 treatments, ushering in a new era of hope in the battle against the pandemic.

Also flagged:Recurrent Pregnancy LossRecurrent Spontaneous Abortionmetabolic disordersOGAFNDC3BRAB11FIP1
Journal Article 2024-11-25 No Snippets Varela-Martínez E, Colau O, van der Molen RG, Jugo BM.
Show Full Abstract

Recurrent Pregnancy Loss (RPL), also named Recurrent Spontaneous Abortion (RSA), is a common fertility problem that refers to at least two consecutive pregnancy losses and affects 1-2% of couples all over the world. Despite common causes such as genetic abnormalities, uterine anomalies or hormonal and metabolic disorders, there is still a huge challenge in identifying the causes of about 40-60% of RPL patients. Circular RNAs (circRNAs) are endogenous ncRNAs with a unique closed-loop and single-stranded structure. Accumulated evidence indicates the role of circRNAs in embryonic development and implantation, which may help decipher the mechanisms and causes underlying RSA. Four works were selected in the SRA public repository that used RNAseq analysis in control and RPL samples in four tissues: endometrium, chorionic villus tissue, decidua and decidua immune cells. Two programs were selected for circRNA detection: DCC and CIRI2. A total of 1715 candidate circRNAs were detected after filtering the results. In the differential expression analysis, decidual tissue showed the highest percentage of circRNA with differential expression between cases and controls. CircRNAs originating from genes <i>OGA</i>, <i>FNDC3B</i>, <i>RAB11FIP1</i>, <i>SIPA1L2</i> and <i>GREB1L</i> showed the highest expression in women suffering from pregnancy losses, in decidual tissue or endometrium. In the GO term enrichment analysis, multiple terms related to embryonic development and immunological response were consistently enriched in villus and decidual tissues. Although some differentially expressed circRNAs were shared between tissues, decidua seems the tissue of choice for analyzing the role of circRNAs in RPL.

OLFM4
Also flagged:Gene Expressioninnate immune responsesClostridioides difficile InfectionC. difficile infectioninflammatory bowel diseaseadaptive immunity
Journal Article 2024-11-25 ✓ 3 Snippets Tsakiroglou M, Evans A, Doce-Carracedo A, Little M, Hornby R, Roberts P, Zhang E, Miyajima F, Pirmohamed M.
In-Text Gene Mentions

…, MMP8 ,OLFM4, and SLC26A8…

…our searches wereOLFM4, CEACAM8 ,…

…Wnt/β-catenin pathway (OLFM4, STING1 ),…

Show Full Abstract

<i>Clostridioides difficile</i> (<i>C. difficile</i>) is a global threat and has significant implications for individuals and health care systems. Little is known about host molecular mechanisms and transcriptional changes in peripheral immune cells. This is the first gene expression study in whole blood from patients with <i>C. difficile</i> infection. We took blood and stool samples from patients with toxigenic <i>C. difficile</i> infection (CDI), non-toxigenic <i>C. difficile</i> infection (GDH), inflammatory bowel disease (IBD), diarrhea from other causes (DC), and healthy controls (HC). We performed transcriptome-wide RNA profiling on peripheral blood to identify diarrhea common and CDI unique gene sets. Diarrhea groups upregulated innate immune responses with neutrophils at the epicenter. The common signature associated with diarrhea was non-specific and shared by various other inflammatory conditions. CDI had a unique 45 gene set reflecting the downregulation of humoral and T cell memory functions. Dysregulation of immunometabolic genes was also abundant and linked to immune cell fate during differentiation. Whole transcriptome analysis of white cells in blood from patients with toxigenic <i>C. difficile</i> infection showed that there is an impairment of adaptive immunity and immunometabolism.

HFE
Also flagged:β-ThalassemiaThalassemiaironmetabolismmicrocytic anemiaanemia
Journal Article 2024-11-25 ✓ 5 Snippets Jensen K, Hammer A, Khatib A, Hazin M.
In-Text Gene Mentions

…Non-HFEHemochromatosis in the…

…Non-HFEHemochromatosisin the Context…

…Thalassemia andhemochromatosisare two distinct…

…secondary causes ofhemochromatosis.…

…trait and non-HFEhemochromatosis.…

Show Full Abstract

Thalassemia and hemochromatosis are two distinct conditions that involve dysregulation of iron metabolism, though their origin, clinical presentations, and treatments differ. This case represents a patient with incidentally discovered microcytic anemia due to β-thalassemia trait and non-<i>HFE</i> hemochromatosis. It discusses the potential synergistic effect of these two diseases on iron overload and highlights the need for further testing to determine hereditary versus secondary causes of hemochromatosis. In addition, this case study also offers insight into the management of these conditions with somewhat conflicting treatments. In this case, the patient was advised to avoid phlebotomies so as not to worsen the anemia and was referred to hepatology.

HTT
Also flagged:neurodegenerative diseasesgene expressionneural degenerationneurodegenerative disordersAPPPSEN1
Journal Article 2024-11-25 ✓ 2 Snippets Rallis E, Grech VS, Lotsaris K, Tertipi N, Sfyri E, Kefala V.
In-Text Gene Mentions

…the huntingtin protein (Htt), which leads to…

…expansion in theHTTgene.…

Show Full Abstract

As the global population ages, the rising prevalence of neurodegenerative diseases, characterized by abnormal protein aggregates, presents significant challenges for early diagnosis and disease monitoring. Identifying accessible tissue biomarkers is crucial for advancing our ability to detect and track the progression of these diseases. Among the most promising biomarkers is the skin, which shares a common embryological origin with the brain and central nervous system (CNS). This biological connection positions the skin as a potential reflection of CNS pathology. Over the past decades, gene expression studies have demonstrated that key genes involved in neurodegenerative diseases are also expressed in skin tissues. Genes such as <i>APP</i>, <i>PSEN1</i>, <i>PPA2</i>, <i>PINK1</i>, <i>LRRK2</i>, <i>PLCB4</i>, <i>MAPT</i>, <i>SPAST</i>, and <i>SPG7</i> are prominent in this regard. Beyond gene expression, proteins related to neurodegenerative diseases-such as α-synuclein, TAU, PARKIN, and prion protein (PrP)-have been isolated from the skin of affected individuals, underscoring the skin's capacity to mirror neural degeneration. This non-invasive window into neurodegenerative processes is further enhanced by advances in stem cell technology, which have allowed for the generation of human-induced pluripotent stem cells (iPSCs) from patient-derived fibroblasts. These iPSCs offer a valuable model for studying disease mechanisms and developing therapeutic approaches. This review conducts a comprehensive analysis of the literature from databases such as PubMed, Google Scholar, and ResearchGate, emphasizing the unique potential of the skin as a non-invasive biomarker for neurodegenerative diseases. It explores how the skin serves as a bridge between gene expression and disease pathology in both the skin and the CNS. By leveraging this biological connection, the skin emerges as a promising model for enhancing our understanding of neurodegenerative disorders and developing innovative strategies for early detection and treatment. However, significant limitations remain, requiring further validation to establish the specificity and sensitivity of these biomarkers.

DCC
Also flagged:Cardiovascular diseasesdeathischemic heart diseasestrokeheart failureaging
Journal Article 2024-11-25 ✓ 1 Snippet Moore A, Ritchie MD.
In-Text Gene Mentions

…netrin protein receptorDCC, which has also…

Show Full Abstract

<h4>Background/objectives</h4>Cardiovascular disease (CVD) and Alzheimer's disease (AD) are two diseases highly prevalent in the aging population and often co-occur. The exact relationship between the two diseases is uncertain, though epidemiological studies have demonstrated that CVDs appear to increase the risk of AD and vice versa. This scoping review aims to examine the current identified overlapping genetics between CVDs and AD at the individual gene level and at the shared pathway level.<h4>Methods</h4>Following PRISMA-ScR guidelines for a scoping review, we searched the PubMed and Scopus databases from 1990 to October 2024 for articles that involved (1) CVDs, (2) AD, and (3) used statistical methods to parse genetic relationships.<h4>Results</h4>Our search yielded 2918 articles, of which 274 articles passed screening and were organized into two main sections: (1) evidence of shared genetic risk; and (2) shared mechanisms. The genes <i>APOE</i>, <i>PSEN1</i>, and <i>PSEN2</i> reportedly have wide effects across the AD and CVD spectrum, affecting both cardiac and brain tissues. Mechanistically, changes in three main pathways (lipid metabolism, blood pressure regulation, and the breakdown of the blood-brain barrier (BBB)) contribute to subclinical and etiological changes that promote both AD and CVD progression. However, genetic studies continue to be limited by the availability of longitudinal data and lack of cohorts that are representative of diverse populations.<h4>Conclusions</h4>Highly penetrant familial genes simultaneously increase the risk of CVDs and AD. However, in most cases, sets of dysregulated genes within larger-scale mechanisms, like changes in lipid metabolism, blood pressure regulation, and BBB breakdown, increase the risk of both AD and CVDs and contribute to disease progression.

bioRxiv 2024-11-25 Preprint (No Snippets API) Lee YJ, Stolze SC, Saridis G, Ebert MK, Nakagami H, Doehlemann G.
Show Full Abstract

<h4>Summary</h4> Ustilago maydis is a biotrophic fungus infecting maize, secreting effector proteins to manipulate host cellular processes and create nutrient-rich environments for its growth. Three effectors, Hap1-3 (hypertrophy-associated proteins), were identified as virulence factors promoting hypertrophic mesophyll tumor cells (HTT). Immunoprecipitation and mass spectrometry revealed interactions among Hap effectors, suggesting potential effector complex formation. CRISPR-Cas9 triple knockout of hap1-3 demonstrated Hap1’s role in HTT formation. Infection assays identified Hap1 as a key virulence factor interacting with maize Snf1-related kinase 1 (SnRK1), a central energy regulator. RNA-seq analysis showed that Hap1 promotes cell cycle and starch biosynthesis genes, while CR- hap1 induced defense-related WRKY transcription factors. Phosphoproteomics revealed increased phosphorylation of SnRK1 and metabolic enzymes during SG200 infection. Our findings support a model where U. maydis induces hypertrophy through Hap1, targeting the SnRK1α subunit to prevent SnRK1 inhibition by high trehalose-6-phosphate (T6P), disrupting the antagonistic relationship between T6P and SnRK1. This reprograms host transcription to enhance starch metabolism and induce endoreduplication, leading to hypertrophy induction, while suppressing sugar-induced immune signaling.

Also flagged:Colorectal Cancercancercancerstumorcell growthPRRC2A
Journal Article 2024-11-24 No Snippets Wu X, Wang S, Pan Y, Li M, Song M, Zhang H, Deng M, Yang X, Xu J, Zhang S, Zhang J, Wang F, Plikus MV, Lv C, Yu L, Yu Z.
Show Full Abstract

Colorectal cancer (CRC) is the third most common cancer type and the second highest mortality rate among cancers. However, the mechanisms underlying CRC progression remain to be fully understood. In this work, a recently identified m<sup>6</sup>A-modified RNA reader protein Proline-rich Coiled-coil 2a (PRRC2A) is markedly upregulated in CRC, and intestinal epithelium-specific deletion of Prrc2a significantly suppressed tumor cell growth, stemness, and migratory capacity, while its overexpression promoted these behaviors. Through multiomics analysis, PRRC2A directly targeted CSNK1E (encoding CK1ε), maintaining its RNA stability in an m<sup>6</sup>A-dependent manner, and that elevated CK1ε can concomitantly result in activation of the WNT and YAP signaling pathways. Interestingly, PRRC2A is directly regulated by the transcription factor ATF1 in its promoter. In summary, the work reveals a novel mechanism by which m<sup>6</sup>A reader PRRC2A promotes colorectal cancer progression via CK1ε and aberrant upregulation of WNT and YAP signaling. Therefore, PRRC2A and CK1ε can be potential therapeutic targets for treating CRC.

HTT
Also flagged:NeurodegenerationNeurodegenerative diseasesmitochondrialALSHuntingtonAD
Journal Article 2024-11-24 ✓ 1 Snippet Toader C, Tataru CP, Munteanu O, Serban M, Covache-Busuioc RA, Ciurea AV, Enyedi M.
In-Text Gene Mentions

…repeats in theHTTgene, leading to…

Show Full Abstract

Neurodegenerative diseases, such as Alzheimer's, Parkinson's, ALS, and Huntington's, remain formidable challenges in medicine, with their relentless progression and limited therapeutic options. These diseases arise from a web of molecular disturbances-misfolded proteins, chronic neuroinflammation, mitochondrial dysfunction, and genetic mutations-that slowly dismantle neuronal integrity. Yet, recent scientific breakthroughs are opening new paths to intervene in these once-intractable conditions. This review synthesizes the latest insights into the underlying molecular dynamics of neurodegeneration, revealing how intertwined pathways drive the course of these diseases. With an eye on the most promising advances, we explore innovative therapies emerging from cutting-edge research: nanotechnology-based drug delivery systems capable of navigating the blood-brain barrier, gene-editing tools like CRISPR designed to correct harmful genetic variants, and stem cell strategies that not only replace lost neurons but foster neuroprotective environments. Pharmacogenomics is reshaping treatment personalization, enabling tailored therapies that align with individual genetic profiles, while molecular diagnostics and biomarkers are ushering in an era of early, precise disease detection. Furthermore, novel perspectives on the gut-brain axis are sparking interest as mounting evidence suggests that microbiome modulation may play a role in reducing neuroinflammatory responses linked to neurodegenerative progression. Taken together, these advances signal a shift toward a comprehensive, personalized approach that could transform neurodegenerative care. By integrating molecular insights and innovative therapeutic techniques, this review offers a forward-looking perspective on a future where treatments aim not just to manage symptoms but to fundamentally alter disease progression, presenting renewed hope for improved patient outcomes.

PRDX6
Also flagged:oxygenNacetylcysteinecell proliferationcaspaseage-related macular degeneration
Journal Article 2024-11-24 ✓ 1 Snippet Abdouh M, Chen Y, Goyeneche A, Burnier MN.
In-Text Gene Mentions

…GSS, PXDN, andPRDX6; 5.3-fold decrease).…

Show Full Abstract

Reactive oxygen species (ROS) play a pivotal role in apoptosis. We reported that Blue Light (BL) induced oxidative stress in human retinal pigment epithelial (RPE) cells in vitro and increased drusen deposition and RPE cell apoptosis in human eyes. Here, we investigated the mechanisms underlying BL-induced damage to RPE cells. Cells were exposed to BL with or without the antioxidant N-acetylcysteine. Cells were analyzed for levels of ROS, proliferation, viability, and mitochondria membrane potential (ΔΨ<sub>M</sub>) fluctuation. We performed proteomic analyses to search for differentially expressed proteins. ROS levels increased following RPE cell exposure to BL. While ROS production did not affect RPE cell proliferation, it was accompanied by decreased ΔΨ<sub>M</sub> and increased cell apoptosis due to the caspase cascade activation in a ROS-dependent manner. Proteomic analyses revealed that BL decreased the levels of ROS detoxifying enzymes in exposed cells. We conclude that BL-induced oxidative stress is cytotoxic to RPE cells. These findings bring new insights into the involvement of BL on RPE cell damage and its role in the progression of age-related macular degeneration. The use of antioxidants is an avenue to block or delay BL-mediated RPE cell apoptosis to counteract the disease progression.

Also flagged:compartmentalizationnucleuslipidmembranesenvelopeof
Journal Article 2024-11-23 No Snippets Riaz Z, Richardson GS, Jin H, Zenitsky G, Anantharam V, Kanthasamy A, Kanthasamy AG.
Show Full Abstract

Nuclear pore complexes (NPCs) are embedded in the nuclear envelope and facilitate the exchange of macromolecules between the nucleus and cytoplasm in eukaryotic cells. The dysfunction of the NPC and nuclear transport plays a significant role in aging and the pathogenesis of various neurodegenerative diseases. Common features among these neurodegenerative diseases, including Parkinson's disease (PD), encompass mitochondrial dysfunction, oxidative stress and the accumulation of insoluble protein aggregates in specific brain regions. The susceptibility of dopaminergic neurons to mitochondrial stress underscores the pivotal role of mitochondria in PD progression. Disruptions in mitochondrial-nuclear communication are exacerbated by aging and α-synuclein-induced oxidative stress in PD. The precise mechanisms underlying mitochondrial impairment-induced neurodegeneration in PD are still unclear. Evidence suggests that perturbations in dopaminergic neuronal nuclei are linked to PD-related neurodegeneration. These perturbations involve structural damage to the nuclear envelope and mislocalization of pivotal transcription factors, potentially driven by oxidative stress or α-synuclein pathology. The presence of protein aggregates, pathogenic mutations, and ongoing oxidative stress can exacerbate the dysfunction of NPCs, yet this mechanism remains understudied in the context of oxidative stress-induced PD. This review summarizes the link between mitochondrial dysfunction and dopaminergic neurodegeneration and outlines the current evidence for nuclear envelope and nuclear transport abnormalities in PD, particularly in oxidative stress. We highlight the potential role of nuclear pore and nucleocytoplasmic transport dysfunction in PD and stress the importance of systematically investigating NPC components in PD.

DCC
Also flagged:Calcium sensing receptorneuroendocrine tumoursgastrinomascancerstumourCASR
Journal Article 2024-11-23 ✓ 4 Snippets English KA, Goldsworthy M, Willis B, Kooblall KG, Birla S, Selberherr A, Stevenson M, Shariq OA, Oberg AL, Wang T, Carmichael J, Mavrommatis K, Escoubet L, Thakker RV, Howles SA, Lines KE.
In-Text Gene Mentions

…Scientific) and rabbit anti‐DCC(Abcam, ab273570), or…

…colorectal cancer (DCC) that encodes…

…29 As expected,DCCtransfected QGP‐1 cells…

…Expression ofDCCin QGP‐1 cells…

Show Full Abstract

Gastroenteropancreatic neuroendocrine tumours (GEP-NETs), which may be hormone secreting (e.g., gastrinomas and insulinomas) or non-secreting (also known as non-functioning NETs) are associated with severe morbidity and have a median overall survival of 75-124 months. Studies have highlighted the importance of epigenetic mechanisms in GEP-NETs pathogenesis, with the most frequently mutated genes being the epigenetic regulators, MEN1, DAXX, and ATRX. However, the consequences of these aberrant epigenetic mechanisms are poorly understood. The calcium sensing receptor (CASR), a G protein coupled-receptor, is epigenetically silenced in cancers, and therefore we examined its role in GEP-NET subtypes. Using RNA-Scope and quantitative PCR analyses in two independent tumour cohorts from Europe (n = 18 patients) and the USA (n = 46 patients) we showed that CASR mRNA is almost completely absent in gastrinomas, insulinomas and non-functioning pancreatic NETs. Furthermore, immunohistochemical staining confirmed a significant reduction in CaSR protein expression in all GEP-NET subtypes, compared to normal islets. DNA methylationEPIC and ATAC-seq analyses in the pancreatic NET cell line QGP-1 showed the CaSR promoter was both hypermethylated and in a region of closed chromatin. Furthermore, transfection of wild type CaSR into QGP-1 cells decreased cell viability, in keeping with the CaSR having a role in cellular proliferation. In summary, our study reveals that CaSR expression is decreased in GEP-NETs and that this reduced expression is likely due to DNA methylation and chromatin changes. Moreover, we demonstrate that transfection of the CaSR into a PNET cell line reduces cell viability, thereby indicating that the CaSR acts as a tumour suppressor in this tumour type.

HFE
Also flagged:ferroptosisosteoporosispathogenesishematoxylinTXNTMSB4X
Journal Article 2024-11-23 ✓ 1 Snippet Su H, Tan G, Guo W, Yu JS, Xu Z, Zhuang R, Xue H.
In-Text Gene Mentions

…steoclast differentiation, theHFE-transferrin receptor complex,…

Show Full Abstract

<h4>Background</h4>Primary osteoporosis has increasingly emerged as a major issue affecting human health, with a complex specific pathogenic mechanism. As a research hotspot, ferroptosis plays a vital role in the pathogenesis of primary osteoporosis, aiming to explore the link and specific target genes between ferroptosis and primary osteoporosis.<h4>Methods</h4>By utilizing TMT proteomics and bioinformatics analyses, we elucidated the linkages and key targets of the ferroptosis pathway in an ovariectomized osteoporotic rat model. Forty 12-week-old SD female rats were employed in the study, of which 20 female SD rats were ovariectomized as the OVX group and 20 female SD rats were employed as the SHAM group. At the end of the experiments, the femurs of the rats were excised for computed tomography tests and used for hematoxylin and eosin staining. Finally, we extracted bone tissue proteins for TMT proteomics analysis and protein blotting verification.<h4>Results</h4>The proteomics results of the VX and SHAM groups showed that 133 proteins were significantly changed, of which 91 proteins were upregulated and 42 proteins were downregulated, including TXN, TMSB4X, TFRC, TF, RELA, PARP14, CP, CAPG, and ADIPOQ. The expression of key proteins in the bone tissues was detected by protein blotting. The expression of TFR1, TFRC and TF was upregulated, whereas the expression of Cp, TXN and BMP-2 was downregulated.<h4>Conclusions</h4>TMT proteomics and functional enrichment analyses in our study substantiated that in osteoporosis, disturbances in lipid metabolism lead to the emergence of oxidative stress with iron homeostasis imbalance.

PLCL1
Also flagged:medulloblastomachromosometumourp53chromothripsiscancer
Journal Article 2024-11-23 ✓ 1 Snippet Smirnov P, Przybilla MJ, Simovic-Lorenz M, Parra RG, Susak H, Ratnaparkhe M, Wong JK, Körber V, Mallm JP, Philippos G, Sill M, Kolb T, Kumar R, Casiraghi N, Okonechnikov K, Ghasemi DR, Maaß KK, Pajtler KW, Jauch A, Korshunov A, Höfer T, Zapatka M, Pfister SM, Huber W, Stegle O, Ernst A.
In-Text Gene Mentions

…PTPRD, MARCH1, NCAM2,PLCL1, NEUROD1 (malignant neuronal…

Show Full Abstract

Chromothripsis is a frequent form of genome instability, whereby a presumably single catastrophic event generates extensive genomic rearrangements of one or multiple chromosome(s). However, little is known about the heterogeneity of chromothripsis across different clones from the same tumour, as well as changes in response to treatment. Here we analyse single-cell genomic and transcriptomic alterations linked with chromothripsis in human p53-deficient medulloblastoma and neural stem cells (n = 9). We reconstruct the order of somatic events, identify early alterations likely linked to chromothripsis and depict the contribution of chromothripsis to malignancy. We characterise subclonal variation of chromothripsis and its effects on extrachromosomal circular DNA, cancer drivers and putatively druggable targets. Furthermore, we highlight the causative role and the fitness consequences of specific rearrangements in neural progenitors.

OLFM4
Also flagged:IFN-γCD1dinterferon-γinterleukin-4secretionactivation
Journal Article 2024-11-23 ✓ 2 Snippets Lebrusant-Fernandez M, Ap Rees T, Jimeno R, Angelis N, Ng JC, Fraternali F, Li VSW, Barral P.
In-Text Gene Mentions

…antibodies at 4C:OLFM4(D6Y5A, Cell Signaling),…

…the numbers ofOLFM4+ ISCs are…

Show Full Abstract

Intestinal homeostasis is maintained through the combined functions of epithelial and immune cells that collaborate to preserve the integrity of the intestinal barrier. However, the mechanisms by which immune cell populations regulate intestinal epithelial cell (IEC) homeostasis remain unclear. Here, we use a multi-omics approach to study the immune-epithelial crosstalk and identify CD1d-restricted natural killer T (NKT) cells as key regulators of IEC biology. We find that NKT cells are abundant in the proximal small intestine and show hallmarks of activation at steady state. Subsequently, NKT cells regulate the survival and the transcriptional and cellular composition landscapes of IECs in intestinal organoids, through interferon-γ (IFN-γ) and interleukin-4 secretion. In vivo, lack of NKT cells results in an increase in IEC turnover, while NKT cell activation leads to IFN-γ-dependent epithelial apoptosis. Our findings propose NKT cells as potent producers of cytokines that contribute to the regulation of IEC homeostasis.

OLFM4
Also flagged:metabolismcancercell growthcell cyclemethylationhistone modifications
Journal Article 2024-11-23 ✓ 1 Snippet Balamurli G, Liew AQX, Tee WW, Pervaiz S.
In-Text Gene Mentions

…of HES1 andOLFM4, which are genes…

Show Full Abstract

There is accumulating evidence indicating a close crosstalk between key molecular events regulating cell growth and proliferation, which could profoundly impact carcinogenesis and its progression. Here we focus on reviewing observations highlighting the interplay between epigenetic modifications, irreversible cell cycle arrest or senescence, and cellular redox metabolism. Epigenetic alterations, such as DNA methylation and histone modifications, dynamically influence tumour transcriptome, thereby impacting tumour phenotype, survival, growth and spread. Interestingly, the acquisition of senescent phenotype can be triggered by epigenetic changes, acting as a double-edged sword via its ability to suppress tumorigenesis or by facilitating an inflammatory milieu conducive for cancer progression. Concurrently, an aberrant redox metabolism, which is a function of the balance between reactive oxygen species (ROS) generation and intracellular anti-oxidant defences, influences signalling cascades and genomic stability in cancer cells by serving as a critical link between epigenetics and senescence. Recognizing this intricate interconnection offers a nuanced perspective for therapeutic intervention by simultaneously targeting specific epigenetic modifications, modulating senescence dynamics, and restoring redox homeostasis.

CCDC92
Also flagged:WDPCPchronic inflammatory diseaseCASMRlipidmetabolism
Journal Article 2024-11-23 ✓ 1 Snippet Hu X, Chen G, Yang X, Cui J, Zhang N.
In-Text Gene Mentions

…HERC6, RTF2, ABITRAM,CCDC92, PAAF1, ZNF354B, PTGDS,…

Show Full Abstract

<h4>Background</h4>Coronary atherosclerosis (CAS) is a complex chronic inflammatory disease with significant genetic and environmental contributions. While genome-wide association studies (GWAS) have pinpointed many risk loci, over 75 % are in non-coding regions, complicating functional analysis and understanding gene-disease mechanisms.<h4>Methods</h4>We conducted a cross-tissue transcriptome-wide association study (TWAS) using data from the GWAS Catalog (16,041 cases, 440,307 controls) and the Genotype-Tissue Expression (GTEx) v8 eQTL dataset. Initially, we used the Unified Test for Molecular Signatures (UTMOST) for analysis, followed by validation with Functional Summary-based Imputation (FUSION) and conditional and joint (COJO) analyses. Candidate genes were further refined using Multi-marker Analysis of Genomic Annotation (MAGMA). Causal relationships were assessed through Summary Data-Based Mendelian Randomization (SMR), colocalization analysis (COLOC), and Mendelian Randomization (MR). GeneMANIA was used to identify interacting genes, and Phenome-Wide Association Study (PheWAS) was employed to enhance the results.<h4>Results</h4>UTMOST identified 33 susceptibility genes for CAS. Out of these, 17 met stringent criteria in both UTMOST and FUSION analyses. Combining results from UTMOST, FUSION, and MAGMA, we identified four critical candidate genes. WDPCP was the only gene to pass SMR, COLOC, and MR analyses, confirming its causal role in CAS. GeneMANIA revealed additional interacting genes, and PheWAS validated WDPCP's role as a susceptibility gene.<h4>Conclusion</h4>WDPCP is a potential novel susceptibility gene for CAS, influencing endothelial function, lipid metabolism, and coronary artery development. This study extends GWAS findings, highlighting WDPCP's potential as a therapeutic target and its consistent expression across different tissues. Further validation studies are warranted.

Also flagged:cancertumorchimeric antigen receptorCytokineslipoproteinsretinoic acids
Journal Article 2024-11-23 No Snippets Kuźnicki J, Janicka N, Białynicka-Birula B, Kuźnicki W, Chorążyczewska H, Deszcz I, Kulbacka J.
Show Full Abstract

Numerous studies have demonstrated the significant influence of immune cells on cancer development and treatment. This study specifically examines tumor-associated macrophages (TAMs), detailing their characteristics and roles in tumorigenesis and analyzing the impact of the ratio of TAM subtypes on patient survival and prognosis. It is established that TAMs interact with immunotherapy, radiotherapy, and chemotherapy, thereby influencing the efficacy of these treatments. Emerging therapies are explored, such as the use of nanoparticles (NPs) for drug delivery to target TAMs and modify the tumor microenvironment (TME). Additionally, novel anticancer strategies like the use of chimeric antigen receptor macrophages (CAR-Ms) show promising results. Investigations into the training of macrophages using magnetic fields, plasma stimulation, and electroporation are also discussed. Finally, this study presents prospects for the combination of TAM-based therapies for enhanced cancer treatment outcomes.

HTT
Also flagged:Docosahexaenoic AcidTriglycerideneurodegenerative diseasespolypeptideLong-chain polyunsaturated fatty acidsglutamine
Journal Article 2024-11-23 ✓ 3 Snippets Mora I, Teixidó A, Vázquez-Manrique RP, Puiggròs F, Arola L.
In-Text Gene Mentions

…encoding the Huntingtin (Htt) protein.…

…generation of mutantHtt(mHtt) with an…

…physiological role ofHttis not completely…

Show Full Abstract

A common hallmark of neurodegenerative diseases is the accumulation of polypeptide aggregates in neurons. Despite the primary cause of these diseases being inherently genetic, their development can be delayed with proper preventive treatments. Long-chain polyunsaturated fatty acids (ω-3 LCPUFA) are promising bioactive nutrients that are beneficial for brain health. In this study, the impact of an oil rich in a structured form of docosahexaenoic acid (DHA) triglyceride (TG) was assessed in a <i>Caenorhabditis elegans</i> model expressing long poly-glutamine (polyQ) chains, which mimics the symptomatology of polyQ-related neurodegenerative diseases such as Huntington's disease (HD), among others. The lifespan, the motility, the number of polyQ aggregates, the oxidative stress resistance, and the cognitive performance associated with sensitive stimuli was measured in mutant nematodes with polyQ aggregates. Overall, DHA-TG at 0.5 µM improved the lifespan, the motility, the oxidative stress resistance, and the cognitive performance of the nematodes, emphasizing the protection against serotonergic synapse dysfunction. Furthermore, the treatment reduced the polyQ aggregates in the nematodes. The data described herein shed light on the connection between DHA and the cognitive performance in neurodegenerative diseases and demonstrated the potential of DHA-TG as nutritional co-adjuvant to prevent the development of polyQ-associated dysfunctions.

Also flagged:hypoxic pulmonary hypertensionPHCD26dipeptidyl peptidase-4DPP4lung diseases
Journal Article 2024-11-23 No Snippets Suzuki Y, Kawasaki T, Tatsumi K, Okaya T, Sato S, Shimada A, Misawa T, Hatano R, Morimoto C, Kasuya Y, Hasegawa Y, Ohara O, Suzuki T.
Show Full Abstract

In hypoxic pulmonary hypertension (PH), pulmonary vascular remodeling is characterized by the emergence of activated adventitial fibroblasts, leading to medial smooth muscle hyperplasia. Previous studies have suggested that CD26/dipeptidyl peptidase-4 (DPP4) plays a crucial role in the pathobiological processes in lung diseases. However, its role in pulmonary fibroblasts in hypoxic PH remains unknown. Therefore, we aimed to clarify the mechanistic role of CD26/DPP4 in lung fibroblasts in hypoxic PH. <i>Dpp4</i> knockout (<i>Dpp4</i> KO) and wild-type (WT) mice were exposed to hypoxia for 4 weeks. The degree of PH severity and medial wall thickness was augmented in <i>Dpp4</i> KO mice compared with that in WT mice, suggesting that CD26/DPP4 plays a suppressive role in the development of hypoxic PH. Transcriptome analysis of human lung fibroblasts cultured under hypoxic conditions revealed that <i>TGFB2</i>, <i>TGFB3</i>, and <i>TGFA</i> were all upregulated as differentially expressed genes after <i>DPP4</i> knockdown with small interfering RNA treatment. These results suggest that CD26/DPP4 plays a suppressive role in TGFβ signal-regulated fibroblast activation under hypoxic conditions. Therefore, CD26/DPP4 may be a potential therapeutic target in patients with PH associated with chronic hypoxia.

HFE
Also flagged:IronMetabolismTriglycerideGlucosechronic diseasesobesity
Journal Article 2024-11-23 ✓ 1 Snippet Hao Z, Guo X, Wang Y, Yang G.
In-Text Gene Mentions

…mutations in theHFEgene, have a…

Show Full Abstract

<b>Purpose:</b> Studies suggest that the triglyceride-glucose index (TyG) is a novel and comprehensive marker of metabolic health. While most research indicates that increased physical activity (PA) is linked to improved metabolic health, some studies argue that the previous markers may not fully capture this relationship. This study uses TyG as a marker of metabolic health to examine the association between PA and TyG. <b>Methods:</b> Data are from cross-sectional surveys in three large population studies in China and the United States: CHARLS, CHNS, and NHANES. Regression models were applied to analyze the relationship between PA and TyG, with covariates adjusted in a stepwise manner. Stratified analysis was used to explore this relationship among different population groups, and, since it has been suggested that iron metabolism plays an important role in metabolic health, it was used as a mediating variable to construct a mediation model for analysis and discussion. <b>Results:</b> Higher PA was significantly associated with lower TyG levels across all three databases (<i>p</i> < 0.001), and this relationship remained robust after full adjustment for covariates. This negative association was more pronounced in older males (over 45 years). Iron metabolism also mediated this relationship, with mediation proportions ranging from 10% to 12.5%. <b>Conclusions:</b> There is a significant inverse association between PA and TyG, suggesting a link between increased PA and metabolic health, with iron metabolism moderating this relationship, especially among older males.

Also flagged:Cytochrome P450 3Arenal diseasehypoalbuminemiahyperlipidemiaNSsteroid
Journal Article 2024-11-23 No Snippets Kochuthakidiyel Suresh P, Venkatachalapathy Y, Ekambaram S, Sangeetha, Manoj M, C D M.
Show Full Abstract

<h4>Background</h4>Nephrotic syndrome (NS) is a renal disease characterized by excessive proteinuria (greater than 3.5 g/dl per 24 h), which results in hypoalbuminemia and leads to hyperlipidemia, edema, and various complications. NS patients typically respond to standard steroid treatment (prednisolone) and are classified as having steroid-sensitive nephrotic syndrome (SSNS). However, patients who do not respond to steroid therapy after 4 weeks are referred to as having steroid-resistant nephrotic syndrome (SRNS). The unequal response to steroid treatment in nephrotic syndrome involved many factors, including genetic, medication, and kidney diseases. The <i>CYP3A</i> gene family is predominantly involved in the metabolism of medications used in the treatment of NS.<h4>Methodology</h4>A systematic literature review was conducted from January 2014 to June 2024 using an extensive electronic search of data related to pediatric nephrotic syndrome and the CYP gene family, including associated polymorphisms. Through this review, we systematically analyze factors that affect the metabolism of medications targeting the <i>CYP3A</i> gene family (including steroidal and non-steroidal drugs) commonly used in the treatment of NS and its comorbidities.<h4>Conclusion</h4>Studies have correlated the relationship between polymorphisms in the <i>CYP3A</i> gene family and medication in NS, with 90 % of the research focusing primarily on post-kidney transplant NS patients. Many studies have reported a correlation between CYP3A gene family polymorphisms and increased tacrolimus (TAC) dosage.

HTT
Also flagged:LipidNeurodegenerative Diseasesenergy homeostasismetabolismagingaxons
Journal Article 2024-11-22 ✓ 1 Snippet Xu Z, He S, Begum MM, Han X.
In-Text Gene Mentions

HTT

Show Full Abstract

<b><i>Significance:</i></b> Lipids, which constitute the highest portion (over 50%) of brain dry mass, are crucial for brain integrity, energy homeostasis, and signaling regulation. Emerging evidence revealed that lipid profile alterations and abnormal lipid metabolism occur during normal aging and in different forms of neurodegenerative diseases. Moreover, increasing genome-wide association studies have validated new targets on lipid-associated pathways involved in disease development. Myelin, the protective sheath surrounding axons, is crucial for efficient neural signaling transduction. As the primary site enriched with lipids, impairments of myelin are increasingly recognized as playing significant and complex roles in various neurodegenerative diseases, beyond simply being secondary effects of neuronal loss. <b><i>Recent Advances:</i></b> With advances in the lipidomics field, myelin lipid alterations and their roles in contributing to or reflecting the progression of diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, and others, have recently caught great attention. <b><i>Critical Issues:</i></b> This review summarizes recent findings of myelin lipid alterations in the five most common neurodegenerative diseases and discusses their implications in disease pathogenesis. <b><i>Future Directions:</i></b> By highlighting myelin lipid abnormalities in neurodegenerative diseases, this review aims to encourage further research focused on lipids and the development of new lipid-oriented therapeutic approaches in this area. <i>Antioxid. Redox Signal.</i> 00, 000-000.

HFEDCC
Also flagged:nonalcoholic steatohepatitisNASHmetabolic dysfunction-associated steatohepatitisnon-alcoholic fatty liver diseaseNAFLDmetabolic dysfunction-associated liver disease
Journal Article 2024-11-22 ✓ 5 Snippets Kim Y, Medicis J, Davis M, Nunag D, Gish R.
In-Text Gene Mentions

…non-cirrhotic NASH, CC,DCC, HCC and LT,…

…non-cirrhotic NASH, CC,DCC, HCC and LT…

…primary biliary cholangitis,hemochromatosis, primary sclerosing cholangit…

…diagnoses/procedures for CC,DCC, HCC and LT…

…used to determineDCCindex date.…

Show Full Abstract

<b>Aim:</b> Non-alcoholic steatohepatitis (NASH), or metabolic dysfunction-associated steatohepatitis (MASH), is a severe form of non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-associated liver disease (MASLD), that may progress to advanced liver disease. Costs associated with progression are not well characterized. This study sought to quantify costs and healthcare resource utilization (HRU) associated with NASH progression. <b>Methods:</b> Patients were included if diagnosed with NASH (ICD-10: K75.81) in 100% Medicare claims data (2015-2021) who were ≥66 years at index (diagnosis), continuously enrolled in Parts A, B and D for ≥12 months prior to and 6 months following index (unless death) and who had no evidence of other causes of liver disease. Patient-time was categorized into five severity states: non-cirrhotic NASH, compensated cirrhosis (CC), decompensated cirrhosis (DCC), hepatocellular carcinoma (HCC) and liver transplant (LT). Annualized HRU and costs were calculated during the study periods overall and stratified by occurrence and timing of progression. <b>Results:</b> In 14,806 unique patients (n = 12,990 non-cirrhotic NASH; 1899 CC; 997 DCC; 209 HCC; 140 LT), mean age and follow-up were 72.2 and 2.8 years, respectively. Average annualized costs increased from baseline following diagnosis, generally scaling with severity: $16,231 to $27,044; $25,122 to $57,705; $40,613 to $181,036; $36,549 to $165,121 and $35,626 to $108,918 in NASH; CC; DCC; HCC; and LT; respectively. Non-cirrhotic NASH and CC patients with progression had higher follow-up spending (1.6x for NASH; 1.7x for CC) than non-progressors (both p < 0.001), 2.8 and 6.1-times higher odds of an inpatient stay and 2.6 and 3.6-times higher odds to be in the top 20% of spenders, respectively, relative to non-progressors (both p < 0.001). Patients progressing within a year had costs 1.4, 1.6, 1.7 and 2.2-times more than year 2, 3, 4 and 5 progressors' costs, respectively, for non-cirrhotic NASH and 1.3, 1.8, 2.0 and 2.2-times more than year 2, 3, 4 and 5 progressors' costs, respectively, for CC. <b>Conclusion:</b> NASH progression is associated with high costs that increase in more severe disease states. Slower progression is associated with lower costs, suggesting a potential benefit of therapies that may delay or prevent progression.

Also flagged:immune responsepeptidespeptideviral infectionspolymeraseapolipoprotein A1
Journal Article 2024-11-22 No Snippets Ploypetch S, Pornthummawat A, Roytrakul S, Jaresitthikunchai J, Phaonakrop N, Wardhani SW, Lacharoje S, Techangamsuwan S.
Show Full Abstract

<h4>Background</h4>Chronic gingivostomatitis in cats (FCGS) is a moderately to severely painful condition, potentially caused by inadequate immune response to oral antigenic stimulation. Salivary peptidome analysis can identify inflammatory protein mediators and pathways involved in oral mucosal immune activation and may indicate potential therapeutic options for FCGS.<h4>Objective</h4>Evaluate the diversity and abundance of salivary peptides in cats with FCGS using matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) and nanoscale liquid chromatography-tandem mass spectrometry (nano LC-MS/MS).<h4>Animals</h4>Thirty-two cats with FCGS and 18 healthy controls.<h4>Methods</h4>Case-control cross-sectional study. We compared the salivary peptide profiles of diseased and healthy cats. The diagnosis of FCGS was confirmed by histopathology. Saliva samples were analyzed for viral infections using polymerase chain reaction (PCR), peptide mass fingerprint (PMF) using MALDI-TOF MS, and peptide identification using nano LC-MS/MS.<h4>Results</h4>Distinct clusters of peptide profiles were observed between groups. In FCGS, 26 salivary peptides were altered, including apolipoprotein A1, nuclear receptor subfamily 1 group I member 3, fibrinogen alpha chain, interleukin 2 receptor gamma, interleukin 23 receptor, hemoglobin subunit alpha, and serpin peptidase inhibitor clade A (alpha-1 antiproteinase, antitrypsin) member 12, protein-tyrosine-phosphatase, and cholinergic receptor nicotinic alpha 10 subunit. Protein-anti-inflammatory drug interaction networks were observed.<h4>Conclusions and clinical importance</h4>Peptide mass fingerprint and peptide profiles identified distinct clusters between FCGS and healthy cats. The 9 novel salivary peptide markers were associated with the JAK/STAT and PI3K/Akt pathways and immune responses. These potentially noninvasive biomarkers may facilitate understanding of FCGS pathophysiology and guide future therapeutic research.

HFE
Also flagged:cholatechronic liver diseasevaricesesophageal varicesdeathCirrhosis
Journal Article 2024-11-22 ✓ 1 Snippet Chavan S, McRae MP, Pitts KR, Everson GT.
In-Text Gene Mentions

…B (1.3%), andhemochromatosis(0.4%).…

Show Full Abstract

<h4>Aims</h4>The dual oral cholate challenge test (DuO) quantifies liver function and portal-systemic shunting. Herein we report the economic impact of the use of the DuO Disease Severity Index (DSI) in the clinical management of patients with chronic liver disease suspected of having large esophageal varices.<h4>Methods</h4>A Markov health state transition model of 100,000 patients with chronic liver disease suspected of having varices was populated with previously reported epidemiological, utility, and price data to assess the cost-effectiveness of employing the DuO test against the standard of care. The model examined the clinical and economic impact of healthcare management decisions all centered around the DSI score and given fixed prices of the DuO test.<h4>Results</h4>In the target population, the combined strategy of healthcare management decisions based on DSI results would be highly cost-effective within two years for a price of $3,250 per DuO test. These same management decisions would save 2,740 lives over five years. For a price of ≤$3,213 per test, this intervention would be cost-saving within two years, and for ≤$4,100 per test it would be cost-saving within five years.<h4>Conclusions</h4>Clinical decisions based on DSI from DuO are cost-effective in the management of patients with chronic liver disease suspected of having large esophageal varices. Future studies of direct comparison of DuO with other noninvasive tests are warranted. The DuO test offers a simplified approach that could enhance the clinical and research utility of liver function testing.

HTT
Also flagged:guanine nucleotide exchange factorLRRK2GTPasekinaseCalDAG-GEFIPD
Journal Article 2024-11-22 ✓ 1 Snippet Liu Q, Huang B, Guiberson NGL, Chen S, Zhu D, Ma G, Ma XM, Crittenden JR, Yu J, Graybiel AM, Dawson TM, Dawson VL, Xiong Y.
In-Text Gene Mentions

…effects of mutantHtt, while the knockdown…

Show Full Abstract

Mutations in <i>LRRK2</i> are the most common genetic cause of Parkinson's disease (PD). LRRK2 protein contains two enzymatic domains: a GTPase (Roc-COR) and a kinase domain. Disease-causing mutations are found in both domains. Now, studies have focused largely on LRRK2 kinase activity, while attention to its GTPase function is limited. LRRK2 is a guanine nucleotide-binding protein, but the mechanism of direct regulation of its GTPase activity remains unclear and its physiological GEF is not known. Here, we identified CalDAG-GEFI (CDGI) as a physiological GEF for LRRK2. CDGI interacts with LRRK2 and increases its GDP to GTP exchange activity. CDGI modulates LRRK2 cellular functions and LRRK2-induced neurodegeneration in both LRRK2 <i>Drosophila</i> and mouse models. Together, this study identified the physiological GEF for LRRK2 and provides strong evidence that LRRK2 GTPase is regulated by GAPs and GEFs. The LRRK2 GTPase, GAP, or GEF activities have the potential to serve as therapeutic targets, which is distinct from the direct LRRK2 kinase inhibition.

HFE
Also flagged:ironPDmovement disordersmyelinationsynthesisdopamine
Journal Article 2024-11-22 ✓ 5 Snippets Loughnan R, Ahern J, Boyle M, Jernigan TL, Hagler DJ, Iversen JR, Frei O, Smith DM, Andreassen O, Zaitlen N, Sugrue L, Thompson WK, Dale A, Schork AJ, Fan CC.
In-Text Gene Mentions

Hemochromatosisneural archetype reveals…

…iron absorption andhemochromatosisrisk.…

…misfolding of theHFE(human homeostatic iron…

…to as the “HemochromatosisBrain,” we trained…

…resemble the archetypalHemochromatosisBrain.…

Show Full Abstract

Our understanding of brain iron regulation and its disruption in disease is limited. Excess iron affects motor circuitry, contributing to Parkinson's disease (PD) risk. The molecular mechanisms regulating central iron levels, beyond a few well-known genes controlling peripheral iron, remain unclear. We generated scores based on the archetypal brain iron accumulation observed in magnetic resonance imaging scans of individuals with excessive dietary iron absorption and hemochromatosis risk. Genome-wide analysis revealed that this score is highly heritable, identifying loci associated with iron homeostasis, and driven by peripheral iron levels. Our score predicted gait abnormalities and showed a U-shaped relationship with PD risk, identifying individuals with threefold increased risk. These results establish a hormetic relationship between brain iron and PD risk, where central iron levels are strongly determined by genetics via peripheral iron. This framework combining forward and reverse genetics is a powerful study design to understand genomic drivers underlying high dimensional phenotypes.

Also flagged:coppericariinalkaline phosphatasemineralizationBiomoleculeglass nanoparticles
Journal Article 2024-11-22 No Snippets Khodaei A, Nawaz Q, Zhu Z, Amin Yavari S, Weinans H, Boccaccini AR.
Show Full Abstract

Immune-involved cell communications have recently been introduced as key role players in the fate of mesenchymal stem cells in making bone tissue. In this study, a drug delivery system for bone (re)generation based on copper-doped mesoporous bioactive glass nanoparticles (BGNPs) was developed to codeliver copper as a biologically active ion and icariin as an anti-inflammatory agent. This design was based on temporal inflammation fluctuations from proinflammatory to anti-inflammatory during bone generation. Three <i>in vitro</i> models were performed with human mesenchymal stem cells (hMSCs) to verify the osteo-immunomodulatory effects of released copper ions and icariin: nonstimulated, co-conditioned with macrophage medium and co-cultured with macrophages. Both icariin and copper showed increased levels of alkaline phosphatase activation, indicating a direct osteogenic effect. Copper-doped BGNPs showed the highest increase of osteo-immunogenic properties in a mineralization assay and also induced short-term inflammation. However, the mineralization dropped in copper doped BGNPs after loading with icariin due to copper-icariin chelate formation and inhibition of the early inflammatory phase in the immune-stimulated <i>in vitro</i> models. In the absence of copper, the direct osteogenic properties of icariin overtook its osteo-immunogenic inhibition and increased calcification. Overall, BGNPs doped with 5 mol % copper and no icariin showed the highest bone-forming capacity.

FBXL4
Also flagged:Drp1mitochondrialSERCA2a
Journal Article 2024-11-22 ✓ 1 Snippet Abudureyimu M, Luo X, Jiang L, Jin X, Pan C, Yu W, Ge J, Zhang Y, Ren J.
In-Text Gene Mentions

…Corrigendum to “FBXL4protects against HFpEF…

Show Full Abstract

No abstract available.

HFE
Also flagged:ironSCFFerritinTFhereditary hemochromatosisHH
Journal Article 2024-11-22 ✓ 5 Snippets Pušeljić M, Stadlbauer V, Ahmadova N, Pohl M, Kopetzky M, Kaufmann-Bühler AK, Watzinger N, Igrec J, Fuchsjäger M, Talakić E.
In-Text Gene Mentions

…overload severity inhemochromatosis: a retrospective MRI…

…iron overload inhemochromatosispatients.…

…in patients withhemochromatosis.…

Hemochromatosisis a group…

…be divided intohemochromatosisgene (HFE) related…

Show Full Abstract

<h4>Purpose</h4>To evaluate the correlation between ectopic adipose tissue and iron overload severity in patients with hemochromatosis.<h4>Material and methods</h4>A retrospective cohort of 52 patients who underwent liver iron concentration quantification from January 2015 to October 2023 using a 3.0T MRI scanner. R2* relaxation times and proton density fat fraction (PDFF) were assessed for the entire liver volume and a specific region of interest (ROI) placed in the right lobe. Total body fat (TF), subcutaneous fat (SCF), intermuscular fat (IMF), and visceral fat (VSF) percentages were calculated from a single axial slice at the level of the third lumbar vertebra. Additionally, ratios of IMF-to-VSF, IMF-to-SCF, and SCF-to-VSF were calculated. Standard iron laboratory parameters were collected at least one month prior to MRI. Pearson correlation coefficient was used for correlation analysis.<h4>Results</h4>The mean age of participants was 53.9 ± 19.6 years. IMF positively correlated with R2* values in the ROI (p = 0.005, r<sub>s</sub> = 0.382) and entire liver (p = 0.016, r<sub>s</sub> = 0.332). Conversely, VSF negatively correlated with R2* values from the ROI (p = < 0.001, r<sub>s</sub> = - 0.488) and entire liver (p = < 0.001, r<sub>s</sub> = - 0.459). Positive correlations were also found between IMF-to-VSF and R2* of the ROI (p = 0.003, r<sub>s</sub> = 0.400) and whole liver (p = 0.008, r<sub>s</sub> = 0.364). Ferritin levels positively correlated with R2* values calculated from ROI (p = 0.002, r<sub>s</sub> = 0.417) and whole liver volume (p = 0.004, r<sub>s</sub> = 0.397). A positive correlation was noted between PDFF of the entire liver and TF (p = 0.024, rs = 0.313).<h4>Conclusion</h4>The percentage of Intermuscular and visceral adipose tissues correlates with the severity of liver iron overload in hemochromatosis patients.

VRK2
Also flagged:cervical cancerCCCC tumorspathogenesisEP300FOSL2
Journal Article 2024-11-22 ✓ 2 Snippets Yu J, Gui X, Zou Y, Liu Q, Yang Z, An J, Guo X, Wang K, Guo J, Huang M, Zhou S, Zuo J, Chen Y, Deng L, Yuan G, Li N, Song Y, Jia J, Zeng J, Zhao Y, Liu X, Du X, Liu Y, Wang P, Zhang B, Ding L, Robles AI, Rodriguez H, Zhou H, Shao Z, Wu L, Gao D.
In-Text Gene Mentions

VRK2and MTDH showed…

VRK2has been identified…

Show Full Abstract

Although the incidence of cervical cancer (CC) has been reduced in high-income countries due to human papillomavirus (HPV) vaccination and screening strategies, it remains a significant public health issue that poses a threat to women's health in low-income countries. Here, we perform a comprehensive proteogenomic profiling of CC tumors obtained from 139 Chinese women. Integrated proteogenomic analysis links genetic aberrations to downstream pathogenesis-related pathways and reveals the landscape of HPV-associated multi-omic changes. EP300 is found to enhance the acetylation of FOSL2-K222, consequently accelerating the malignant proliferation of CC cells. Proteomic stratification identifies three patient subgroups with distinct features in prognosis, genetic alterations, immune infiltration, and post-translational modification regulations. PRKCB is further identified as a potential radioresponse-related biomarker of CC patients. This study provides a valuable public resource for researchers and clinicians to delve into the molecular basis of CC, to identify potential treatments and to ultimately advance clinical practice.

HFE
Also flagged:cardiovascular diseasesNOTCH1Cerebral cavernous malformationsligaseglucoselipid
Journal Article 2024-11-22 ✓ 2 Snippets Ou X, Xiao C, Jiang J, Liu X, Liu L, Lu Y, Zhang W, He Y, Zhao Z.
In-Text Gene Mentions

…They recently foundhemochromatosis( HFE ) polymorphism…

…ecently found hemochromatosis(HFE) polymorphism might…

Show Full Abstract

An increasing number of studies have shown that lead is an important cardiovascular risk factor, but the impact of cardiovascular related gene polymorphisms on lead induced cardiovascular diseases is still unclear. To assess the interaction of lead exposure and related key cardiovascular regulating gene polymorphisms on blood pressure traits, three single-nucleotide polymorphisms including NOTCH1 rs3124591, Cerebral cavernous malformations 3 (CCM3) rs3804610 and Vascular endothelial growth factor receptor type 2 (VEGFR2) rs2305948 were selected and genotyped using improved multiplex ligase detection reaction method in 568 lead exposure workers in South China. General characteristics, blood lead and biochemical parameters including glucose, lipid profile and creatinine were also collected according to standard protocols. Regression analysis was used to evaluate the association of blood pressure with lead exposure, polymorphisms and their interaction. This study displayed that CCM3 rs3804610 had a positive interaction with lead and VEGFR2 rs2305948 had a negative interaction with lead. Specifcally, compared with the wild-type population, the blood lead of the genotype population carrying the risk allele increased by 1 µg/dL, systolic blood pressure increased by 0.53 mmHg (p < 0.01) and diastolic blood pressure increased by 0.34 mmHg (p < 0.05) for CCM3 rs3804610, and systolic blood pressure decreased by 0.28 mmHg (p < 0.05) and diastolic blood pressure decreased by 0.22 mmHg (p < 0.05) for VEGFR2 rs2305948. Thus our findings showed that the interaction between CCM3 rs3804610 and VEGFR2 rs2305948 and lead exposure were associated with blood pressure and may provide guidance for future research on hypertension prevention and personalized clinical treatment in lead exposed populations.

Also flagged:bindingpoly adenosine diphosphate-ribose polymerase 1cancerPARP1DDR1tyrosine kinase
Journal Article 2024-11-22 No Snippets Wang M, Li S, Wang J, Zhang O, Du H, Jiang D, Wu Z, Deng Y, Kang Y, Pan P, Li D, Wang X, Yao X, Hou T, Hsieh CY.
Show Full Abstract

Despite the significant potential of generative models, low synthesizability of many generated molecules limits their real-world applications. In response to this issue, we develop ClickGen, a deep learning model that utilizes modular reactions like click chemistry to assemble molecules and incorporates reinforcement learning along with inpainting technique to ensure that the proposed molecules display high diversity, novelty and strong binding tendency. ClickGen demonstrates superior performance over the other reaction-based generative models in terms of novelty, synthesizability, and docking conformation similarity for existing binders targeting the three proteins. We then proceeded to conduct wet-lab validation on the ClickGen's proposed molecules for poly adenosine diphosphate-ribose polymerase 1. Due to the guaranteed high synthesizability and model-generated synthetic routes for reference, we successfully produced and tested the bioactivity of these novel compounds in just 20 days, much faster than typically expected time frame when handling sufficiently novel molecules. In bioactivity assays, two lead compounds demonstrated superior anti-proliferative efficacy against cancer cell lines, low toxicity, and nanomolar-level inhibitory activity to PARP1. We demonstrate that ClickGen and related models may represent a new paradigm in molecular generation, bringing AI-driven, automated experimentation and closed-loop molecular design closer to realization.

DCC
Also flagged:pancreatic fistulaabdominal infectionobesityhypertensiondiabetesmalignant tumors
Journal Article 2024-11-22 ✓ 1 Snippet Li D, Wang S, Zhang H, Cao Y, Chu Q.
In-Text Gene Mentions

…of PDAC andDCCpatients in this…

Show Full Abstract

<h4>Background</h4>The feasibility and safety of laparoscopic pancreaticoduodenectomy (LPD) in overweight patients is still controversial. This study was designed to analyze the impact of overweight on surgical outcomes in patients undergoing LPD.<h4>Methods</h4>Data from patients who underwent LPD between January 2018 and July 2022 were analyzed retrospectively. A 1:1 propensity score-matching (PSM) analysis was performed to minimize bias between groups.<h4>Results</h4>A total of 432 patients were enrolled, with a normal weight group (n = 241) and an overweight group (n = 191). After matching, 144 patients were enrolled in each group. The results showed that the incidence of clinically relevant postoperative pancreatic fistula (CR-POPF) and delayed gastric emptying (DGE) was significantly higher in the overweight group compared to the normal weight group (P = 0.036). However, there were no significant differences in perioperative mortality (1.4% vs. 2.1%, P = 0.652) and long-term survival outcomes between malignancy patients with different body mass index (BMI) before and after PSM (all P > 0.05).<h4>Conclusions</h4>It is safe and feasible for overweight patients to undergo LPD with mortality and long-term survival outcomes comparable to the normal weight group. High-quality prospective randomized controlled trials are still needed.

HTT
Also flagged:genetic neurological disorderHDgene expressioncalciumquinolinic acidbehavioural
Journal Article 2024-11-22 ✓ 2 Snippets McCaughey-Chapman A, Burgers AL, Combrinck C, Marriott L, Gordon D, Connor B.
In-Text Gene Mentions

…1 of theHTT(IT15) gene, encoding…

…protein termed Huntingtin (HTT).…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a genetic neurological disorder predominantly characterised by the progressive loss of GABAergic medium spiny neurons in the striatum resulting in motor dysfunction. One potential strategy for the treatment of HD is the development of cell replacement therapies to restore neuronal circuitry and function by the replacement of lost neurons. We propose the generation of lineage-specific human lateral ganglionic eminence precursors (hiLGEP) using direct reprogramming technology provides a novel and clinically viable cell source for cell replacement therapy for HD.<h4>Methods</h4>hiLGEPs were derived by direct reprogramming of adult human dermal fibroblasts (aHDFs) using chemically modified mRNA (cmRNA) and a defined reprogramming medium. hiLGEPs were differentiated in vitro using an optimised striatal differentiation medium. Acquisition of a striatal precursor and neural cell fate was assessed through gene expression and immunocytochemical analysis of key markers. hiLGEP-derived striatal neuron functionality in vitro was demonstrated by calcium imaging using Cal-520. To investigate the ability for hiLGEP to survive, differentiate and functionally integrate in vivo, we transplanted hiLGEPs into the striatum of quinolinic acid (QA)-lesioned rats and performed behavioural assessment using the cylinder test over the course of 14 weeks. Survival and differentiation of hiLGEPs was assessed at 8 and 14-weeks post-transplant by immunohistochemical analysis.<h4>Results</h4>We demonstrate the capability to generate hiLGEPs from aHDFs using cmRNA encoding the pro-neural genes SOX2 and PAX6, combined with a reprogramming medium containing Gö6983, Y-27,632, N-2 and Activin A. hiLGEPs generated functional DARPP32 + neurons following 14 days of culture in BrainPhys™ media supplemented with dorsomorphin and Activin A. We investigated the ability for hiLGEPs to survive transplantation, differentiate to medium spiny-like striatal neurons and improve motor function in the QA lesion rat model of HD. Fourteen weeks after transplantation, we observed STEM121 + neurons co-expressing MAP2, DARPP32, GAD<sub>65/67</sub>, or GABA. Rats transplanted with hiLGEPs also demonstrated reduction in motor function impairment as determined by spontaneous exploratory forelimb use when compared to saline transplanted animals.<h4>Conclusion</h4>This study provides proof-of-concept and demonstrates for the first time that aHDFs can be directly reprogrammed to hiLGEPs which survive transplantation, undergo neuronal differentiation to generate medium spiny-like striatal neurons, and reduce functional impairment in the QA lesion rat model of HD.

DARS2
Also flagged:tumourcancertumour suppressorsuppressor geneKMT2Dhistone
Journal Article 2024-11-22 ✓ 1 Snippet Takemon Y, Pleasance ED, Gagliardi A, Hughes CS, Csizmok V, Wee K, Trinh DL, Huff RD, Mungall AJ, Moore RA, Chuah E, Mungall KL, Lewis E, Nelson J, Lim HJ, Renouf DJ, Jones SJ, Laskin J, Marra MA.
In-Text Gene Mentions

…[ 130 ],DARS2[ 131 ],…

Show Full Abstract

<h4>Background</h4>Loss-of-function (LOF) alterations in tumour suppressor genes cannot be directly targeted. Approaches characterising gene function and vulnerabilities conferred by such mutations are required.<h4>Methods</h4>Here, we computationally map genetic networks of KMT2D, a tumour suppressor gene frequently mutated in several cancer types. Using KMT2D loss-of-function (KMT2D<sup>LOF</sup>) mutations as a model, we illustrate the utility of in silico genetic networks in uncovering novel functional associations and vulnerabilities in cancer cells with LOF alterations affecting tumour suppressor genes.<h4>Results</h4>We revealed genetic interactors with functions in histone modification, metabolism, and immune response and synthetic lethal (SL) candidates, including some encoding existing therapeutic targets. Notably, we predicted WRN as a novel SL interactor and, using recently available WRN inhibitor (HRO761 and VVD-133214) treatment response data, we observed that KMT2D mutational status significantly distinguishes treatment-sensitive MSI cell lines from treatment-insensitive MSI cell lines.<h4>Conclusions</h4>Our study thus illustrates how tumour suppressor gene LOF alterations can be exploited to reveal potentially targetable cancer cell vulnerabilities.

Also flagged:dementiacognitive impairmentdeliriumcognitionmental illnessdepression
Journal Article 2024-11-22 No Snippets Campbell NL, Holden RJ, Gao S, Unverzagt FW, Lane KA, Carter A, Harrington AB, Manoharan S, Manoharan N, Rosenthal DL, Pitts C, Pelkey K, Papineau E, Lauck DM, Keshk N, Alamer K, Khalil H, Boustani MA.
Show Full Abstract

<h4>Background</h4>Older adults commonly experience chronic medical conditions and are at risk of cognitive impairment as a result of age, chronic comorbidity, and medications prescribed to manage multiple chronic conditions. Anticholinergic medications are common treatments for chronic conditions and have been repeatedly associated with poor cognitive outcomes, including delirium and dementia, in epidemiologic studies. However, no study has definitively evaluated the causal relationship between anticholinergics and cognition in a randomized controlled trial design. Utilizing our prior experience in deprescribing anticholinergic medications in various clinical environments, we designed an outpatient deprescribing intervention to prospectively test the potential causal relationship between anticholinergics and cognition in primary care older adults.<h4>Methods</h4>This cluster randomized clinical trial will be conducted to evaluate the impact of an anticholinergic deprescribing intervention compared to usual care on outcomes of cognition and safety in primary care older adults. Participants will include those aged 65 years and over, receiving primary care in the greater Indianapolis area, using a strong anticholinergic within the last 2 weeks or with evidence of high-risk exposure in the past year. Those excluded will have a diagnosis of Alzheimer's disease or related dementia, or serious mental illness. The trial plans to enroll 344 participants who will be cluster-randomized at the level of primary care physician to avoid contamination. Participants will complete outcome assessments every 6 months up to 2 years by blinded outcome assessors. The primary outcome of the study is a composite measure of cognition that includes domains assessing executive cognitive function, language, and memory. Secondary outcomes include patient-reported measures of pain intensity, depression, anxiety, sleep disturbance, and health-related quality of life.<h4>Discussion</h4>The R2D2 trial will be the largest and longest prospective randomized trial testing the impact of an anticholinergic-specific deprescribing intervention on cognition in primary care older adults. Results could influence deprescribing methodology and provide new insight on the relationship between anticholinergics and cognition.<h4>Trial registration</h4>ClinicalTrials.gov NCT04270474. Registered on February 17, 2020.

SOX6
Also flagged:Osteoarthritisdegenerative joint disordertranslationaldegenerationtype 2 diabetesRFX6
Journal Article 2024-11-22 ✓ 1 Snippet Katsoula G, Lawrence JEG, Arruda AL, Tutino M, Balogh P, Southam L, Swift D, Behjati S, Teichmann SA, Wilkinson JM, Zeggini E.
In-Text Gene Mentions

…SOX genes (SOX6, SOX7 ,…

Show Full Abstract

Translational efforts in osteoarthritis are hampered by a gap in our understanding of disease processes at the molecular level. Here, we present evidence of pronounced transcriptional changes in high- and low-disease-grade cartilage tissue, pointing to embryonic processes involved in disease progression. We identify shared transcriptional programs between osteoarthritis cartilage and cell populations in the human embryonic and fetal limb, pointing to increases in pre-hypertrophic chondrocytes' transcriptional programs in low-grade cartilage and increases in osteoblastic signatures in high-grade disease tissue. We find that osteoarthritis genetic risk signals are enriched in six gene co-expression modules and show that these transcriptional signatures reflect cell-type-specific expression along the endochondral ossification developmental trajectory. Using this network approach in combination with causal inference analysis, we present evidence of a causal effect on osteoarthritis risk for variants associated with the expression of ten genes that have not been previously reported as effector genes in genome-wide association studies in osteoarthritis. Our findings point to key molecular pathways as drivers of cartilage degeneration and identify high-value drug targets and repurposing opportunities.

Also flagged:musculoskeletal diseasesosteoarthritisOAmethylationSOX9chondrogenesis
Journal Article 2024-11-22 No Snippets McDonnell E, Orr SE, Barter MJ, Rux D, Brumwell A, Wrobel N, Murphy L, Overman LM, Sorial AK, Young DA, Soul J, Rice SJ.
Show Full Abstract

Increasing evidence is emerging to link age-associated complex musculoskeletal diseases, including osteoarthritis (OA), to developmental factors. Multiple studies have shown a functional role for DNA methylation in the genetic mechanisms of OA risk using articular cartilage samples taken from aged individuals, yet knowledge of temporal changes to the methylome during human cartilage development is limited. We quantified DNA methylation at ∼700,000 individual CpGs across the epigenome of developing human chondrocytes in 72 samples ranging from 7 to 21 post-conception weeks. We identified significant changes in 3% of all CpGs and >8,200 developmental differentially methylated regions. We further identified 24 loci at which OA genetic variants colocalize with methylation quantitative trait loci. Through integrating developmental and mature human chondrocyte datasets, we find evidence for functional effects exerted solely in development or throughout the life course. This will have profound impacts on future approaches to translating genetic pathways for therapeutic intervention.

OLFM4
Also flagged:FZD5WntLgr5Frizzled receptorsFZD1binding
Journal Article 2024-11-22 ✓ 1 Snippet Mu Q, Ha A, Santos AJM, Lo YH, van Unen V, Miao Y, Tomaske M, Guzman VK, Alwahabi S, Yuan JJ, Deng L, Li L, Garcia KC, Kuo CJ.
In-Text Gene Mentions

OLFM4

Show Full Abstract

The rapidly regenerating intestinal epithelium requires crypt intestinal stem cells (ISCs). Wnt/β-catenin signaling maintains crypt homeostasis and Lgr5+ ISCs, and WNT ligands bind Frizzled receptors (FZD1-10). Identifying specific FZD(s) essential for intestinal homeostasis has been elusive; however, bioengineered antagonists blocking Wnt binding to FZD5 and FZD8 deplete the gut epithelium in vivo, highlighting potential roles. Here, an epithelial-specific Fzd5 knockout (KO) elicited lethal pan-intestinal crypt and villus loss, whereas an Lgr5+ ISC-specific Fzd5 KO depleted Lgr5+ ISCs via premature differentiation and repressed Wnt target genes. Fzd5-null phenotypes were rescued by constitutive β-catenin activation in vivo and in both mouse and human enteroids. KO of Fzd5, not Fzd8, in enteroids ablated responsiveness to dual-specificity FZD5/FZD8-selective Wnt surrogate agonists, which ameliorated DSS-induced colitis in wild-type and Fzd8 KO mice. Overall, FZD5 is a dominant and essential regulator of crypt homeostasis, Lgr5+ ISCs, and intestinal response to Wnt surrogate agonists, with implications for therapeutic mucosal repair.

OLFM4
Also flagged:Frizzled5Fzd5WntchromatinLgr5Krt19
Journal Article 2024-11-22 ✓ 1 Snippet Deng L, He XC, Chen S, Zhang N, Deng F, Scott A, He Y, Tsuchiya D, Smith SE, Epp M, Malloy S, Liu F, Hembree M, Mu Q, Haug JS, Malagola E, Hassan H, Petentler K, Egidy R, Maddera L, Russell J, Wang Y, Li H, Zhao C, Perera A, Wang TC, Kuo CJ, Li L.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The homeostasis of the intestinal epithelium relies on intricate yet insufficiently understood mechanisms of intestinal epithelial plasticity. Here, we elucidate the pivotal role of Frizzled5 (Fzd5), a Wnt pathway receptor, as a determinant of murine intestinal epithelial cell fate. Deletion of Fzd5 in Lgr5<sup>+</sup> intestinal stem cells (ISCs) impairs their self-renewal, whereas its deletion in Krt19<sup>+</sup> cells disrupts lineage generation, without affecting crypt integrity in either case. However, a broader deletion of Fzd5 across the epithelium leads to substantial crypt deterioration. Integrated analysis of single-cell RNA sequencing (scRNA-seq) and single-cell ATAC-seq (scATAC-seq) identifies that Fzd5 governs chromatin accessibility, orchestrating the regulation of stem- and lineage-related gene expression mainly in ISCs and progenitor cells. In summary, our findings provide insights into the regulatory role of Fzd5 in governing intestinal epithelial plasticity.

VRK2
Also flagged:RACK1Infectious bursal diseaseavian diseasemitochondria-associated proteinvoltage-dependent anion channel 2VDAC2
Journal Article 2024-11-22 ✓ 5 Snippets Ma YH, Liang ZS, Shao HC, Ren H, Pan XY, Zi MH, Shi LF, Zhang Y, Han S, Wan B, Yuan J, Lin W, He WR.
In-Text Gene Mentions

VRK2inhibits the replication…

…itochondria-associated proteinvaccinia virus-related kinase 2virus-related kinase 2…

…virus-related kinase 2 (VRK2) as an inhibitor…

…Overexpression ofVRK2significantly reduced IBDV…

…the absence ofVRK2resulted in higher…

Show Full Abstract

Infectious bursal disease (IBD) is an acute, highly contagious, and immunosuppressive avian disease caused by the infectious bursal disease virus (IBDV). Despite significant efforts, the lack of knowledge about host proteins that counteract IBDV replication has hindered progress in preventing and controlling IBD in chickens. This study identifies the mitochondria-associated protein vaccinia virus-related kinase 2 (VRK2) as an inhibitor of IBDV. Overexpression of VRK2 significantly reduced IBDV proliferation in DF-1 cells and chicken embryo fibroblasts (CEFs). Conversely, the absence of VRK2 resulted in higher viral loads in these cells. Additionally, we found that VRK2 interacts with voltage-dependent anion channel 2 (VDAC2) and Receptor for Activated C Kinase 1 (RACK1). Mechanistic studies revealed that VRK2 inhibits IBDV-induced apoptosis by targeting RACK1 phosphorylation, leading to reduced viral growth. This study enhances our understanding of VRK2's role in host anti-apoptotic mechanisms and offers novel insights into IBDV pathogenesis and vaccine development.

Also flagged:bone formationbone resorptionbone morphogenetic protein type 2rhBMP-2calcium phosphatehydroxyapatite
Journal Article 2024-11-22 No Snippets Soylu E, Kilavuz MS, Duman F, Ekeer H, Gönen ZB, Kahraman B, Yay AH, Bolat D.
Show Full Abstract

<h4>Objective</h4>Although autogenous grafting is accepted as the gold standard in intraoral grafting, xenogenous grafts are frequently used in sinus lift surgeries due to their osteoinductive and osteoconductive properties. This study aimed to investigate the efficacy of fish spine-derived xenogenic grafts in sinus augmentation surgery.<h4>Material and methods</h4>In this study, a fish spine-derived xenogenic graft was produced for comparison with autogenous graft and bovine derived xenogenic grafts. Twenty-one New Zealand rabbits were used. Autogenous grafts (AG- Group 1), as well as bovine-derived (bHAP - Group 2) and fish spine-derived (fHAP - Group 3) xenogenic grafts were placed in the right and left sinuses of rabbits. The animals were sacrificed at the 4th and 8th weeks. New bone formation (NBF) was evaluated through histological examination, while bone volume (BV), new bone surface/bone volume (BS-BV), new bone surface/tissue volume (BS-TV), and trabecular separation (Tb-Sp) were assessed via Micro-CT. Statistical significance was considered at p<0.05.<h4>Results</h4>Histological examination revealed a significant difference in NBF between AG-bHAP (p<0.001), as well as between fHAP-bHAP (p<0.001) in the fourth-week group. No significant difference was found in the eighth-week group (p=0.130). In the eighth-week group, a statistically significant difference was found between fHAP and bHAP in terms of BV. (p=0.007).<h4>Conclusion</h4>Although both graft materials used in this study showed positive effects on bone regeneration, fHAP and AG presented similar effects on bone regeneration and were superior to bHAP.

Also flagged:synthesisneurodegenerative diseasesCentral nervous system disordersagingneurological disordersNanoparticles
Journal Article 2024-11-22 No Snippets Izadi R, Bahramikia S, Akbari V.
Show Full Abstract

Central nervous system disorders impact over 1.5 billion individuals globally, with neurodegenerative diseases such as Alzheimer's, Parkinson's, and Huntington's diseases being particularly prominent. These conditions, often associated with aging, present debilitating symptoms including memory loss and movement difficulties. The growing incidence of neurological disorders, alongside a scarcity of effective anti-amyloidogenic therapies, highlights an urgent need for innovative treatment methodologies. Nanoparticles (NPs), derived from medicinal plants and characterized by their favorable pharmacological properties and minimal side effects, offer a promising solution. Their inherent attributes allow for successful traversal of the blood-brain barrier (BBB), enabling targeted delivery to the brain and the modulation of specific molecular pathways involved in neurodegeneration. NPs are crucial in managing oxidative stress, apoptosis, and neuroinflammation in ND. This study reviews the efficacy of green-synthesized nanoparticles in conjunction with various medicinal plants for treating neurodegenerative diseases, advocating for further research to refine these formulations for enhanced clinical applicability and improved patient outcomes.

PTGIS
Also flagged:endoplasmic reticulumchronic obstructive pulmonary diseaseCOPDGene ExpressionERSAGR3
Journal Article 2024-11-22 ✓ 1 Snippet Zhang S, Duan H, Yan J.
In-Text Gene Mentions

…MPO, MTTP, PIK3CA,PTGIS, PURA, and TMCC1.…

Show Full Abstract

<h4>Background</h4>Endoplasmic reticulum stress (ERS) is a crucial factor in the progression of chronic obstructive pulmonary disease (COPD). However, the key genes associated with COPD and immune cell infiltration remain to be elucidated. Therefore, this study aimed to identify biomarkers pertinent to the diagnosis of ERS in COPD and delve deeper into the association between pivotal genes and their possible interactions with immune cells.<h4>Methods</h4>We selected the genetic data of 189 samples from the Gene Expression Omnibus database, including 91 control and 98 COPD samples. First, we identified the differentially expressed genes between patients with COPD and controls and then screened the ERS genes associated with COPD. Second, 22 core ERS genes associated with COPD were screened using the Least Absolute Shrinkage and Selection Operator (LASSO) regression model and Support Vector Machine Recursive Feature Elimination (SVM-RFE), and the predictive effects of the screened core genes in COPD were evaluated. Third, we explored immune cell infiltration associated with COPD and conducted an in-depth analysis to explore the possible connections between the identified key genes and their related immune cells.<h4>Results</h4>A total of 66 differentially expressed endoplasmic reticulum stress-related genes (DE-ERGs) were identified in this study, among which 12 were upregulated and 54 were downregulated. The 22 key genes screened were as follows: AGR3, BCHE, CBY1, CHRM3, CYP1B1, DCSTAMP, DDHD1, DMPK, EDEM3, EDN1, FKBP10, HSPA2, KPNA2, LGALS3, MAOB, MMP9, MPO, MTTP, PIK3CA, PTGIS, PURA, and TMCC1. Their expression was significantly different between COPD and healthy samples, and the difference between the groups was significant. Receiver operating characteristic curve analysis revealed that CBY1 (area under the curve [AUC] = 0.800), BCHE (AUC = 0.773), EDEM3 (AUC = 0.768), FKBP10 (AUC = 0.760), MAOB (AUC = 0.736), and MMP9 (AUC = 0.729) showed a strong ability to distinguish COPD samples from normal samples. Immune cell infiltration results associated with the three key genes were also obtained.<h4>Conclusion</h4>The insights of our study have the potential to present new evidence for exploring emerging diagnostic signs of COPD while also contributing to a better understanding of its developmental mechanisms.

Also flagged:Beclin-1autophagytumorscancerAMPKmTOR
Journal Article 2024-11-22 No Snippets Cao Z, Tian K, Ran Y, Zhou H, Zhou L, Ding Y, Tang X.
Show Full Abstract

The significant identification of Beclin-1's function in regulating autophagy flow signified a significant progression in our understanding of cellular operations. Beclin-1 acts as a scaffold for forming the PI3KC3 complex, controlling autophagy and cellular trafficking processes in a complicated way. This intricate protein has garnered considerable attention due to its substantial impact on the development of tumors. Strong evidence indicates Beclin-1 plays a critical role in controlling autophagy in various human cancer types and its intricate connection with apoptosis and ferroptosis. The potential of Beclin-1 as a viable target for cancer therapy is highlighted by its associations with key autophagy regulators such as AMPK, mTOR, and ATGs. Beclin-1 controls the growth and dissemination of tumors by autophagy. It also affects how tumors react to therapies such as chemotherapy and radiation therapy. The role of Beclin-1 in autophagy can influence apoptosis, depending on whether it supports cell survival or leads to cell death. Beclin-1 plays a crucial role in ferroptosis by increasing ATG5 levels, which in turn promotes autophagy-triggered ferroptosis. Finally, we analyzed the possible function of Beclin-1 in tumor immunology and drug sensitivity in cancers. In general, Beclin-1 has a significant impact on regulating autophagy, offering various potentials for medical intervention and altering our understanding of cancer biology.

Also flagged:Myelinaxonsmyelin-associatedlipidspinal cord injurycholesterol
Journal Article 2024-11-22 No Snippets Zhou Y, Xu T, Zhou Y, Han W, Wu Z, Yang C, Chen X.
Show Full Abstract

Myelin sheath, as the multilayer dense structure enclosing axons in humans and other higher organisms, may rupture due to various injury factors after spinal cord injury, thus producing myelin debris. The myelin debris contains a variety of myelin-associated inhibitors (MAIs) and lipid, all inhibiting the repair after spinal cord injury. Through summary and analysis, the present authors found that the inhibition of myelin debris can be mainly divided into two categories: firstly, the direct inhibition mediated by MAIs; secondly, the indirect inhibition mediated by lipid such as cholesterol. It is worth noting that phagocytes are required in the latter indirect inhibition, such as professional phagocytes (macrophages et al.) and non-professional phagocytes (astrocytes et al.). Moreover, complement and the immune system also participate in the phagocytosis of myelin debris, working together with phagocytes to aggravate spinal cord injury. In conclusion, this paper focuses on the direct and indirect effects of myelin debris on spinal cord injury, aiming to provide new inspiration and reflection for the basic research of spinal cord injury and the conception of related treatment.

Also flagged:hepatocellular carcinomamalignant tumoralpha-fetoproteinAFPLiver cancercancers
Journal Article 2024-11-22 No Snippets Zhao J, Hu Z, Zheng X, Lin Y, Liu X, Zhang J, Peng J, Gao H.
Show Full Abstract

Hepatocellular Carcinoma (HCC) is a malignant tumor with high morbidity and mortality worldwide, which represents a serious threat to human life, health and quality of life. Blood-based detection is essential for HCC screening, early diagnosis, prognosis evaluation, and surveillance. Current non-invasive detection strategy including serum alpha-fetoprotein (AFP), ultrasound, computerized tomography, and magnetic resonance imaging. The limited specificity of an AFP and the dependence on operator experience and diagnostic personnel for ultrasound have constrained their utility in early HCC diagnosis. In recent years, with the development of various detection technologies, there has been an increasing focus on exploring blood-based detection markers for HCC. The types of markers include protein markers, DNA mutation, DNA epigenetic modification, mRNA, miRNA, and so on. However, numerous methodological and biological factors limit the clinical sensitivity and generalization performance of these new biomarkers. In this review, we describe the state-of-the-art technologies for cfDNA analysis, and discuss outstanding biological and technical challenges that, if addressed, would substantially improve HCC diagnostics and patient care.

Also flagged:DisulfiramcanceralcoholismtumorTumor diseasesTumors
Journal Article 2024-11-22 No Snippets Huang D, Yao Y, Lou Y, Kou L, Yao Q, Chen R.
Show Full Abstract

The initial focus of the clinical application of disulfiram was its efficacy in treating alcoholism. However, recent research has revealed its potential as an anti-tumor agent and even as an enhancer of cancer immunotherapy. Disulfiram has received safety approval from the FDA, indicating its safety advantages over other substances used for disease treatment. Although clinical trials have been conducted on strategies involving disulfiram or its combination with other anti-tumor drugs, the treatment outcomes have not yielded satisfactory results, thereby emphasizing the significance of addressing drug delivery as a crucial challenge to be resolved. The need to explore advanced nano-delivery systems and the potential immunotherapy enhancement effect of disulfiram in cancer treatment has increased. This review highlights various ways in which disulfiram can combat cancer and importantly, activate immune-related mechanisms. It also discusses obstacles related to delivering disulfiram and provides existing solutions in terms of drug delivery. These drug delivery strategies offer solutions to address various challenges encountered in diverse delivery methods and aim to achieve enhanced therapeutic effects. The focus is on recent advancements in disulfiram delivery strategies and the future potential of disulfiram in immune regulation.

SOX6
Also flagged:MALAT1Sox-6cardiac arrhythmiaAFpathogenesismetastasis-associated lung adenocarcinoma transcript 1
Journal Article 2024-11-22 ✓ 5 Snippets Chuang CY, Wang BW, Yu YJ, Fang WJ, Lin CM, Shyu KG, Chua SK.
In-Text Gene Mentions

…MALAT1, miR-499a-5p, andSOX6in human cardiac…

…Transcription Factor 6 (SOX6) were measured using…

…499a-5p mimics/inhibitors, andSOX6overexpression on gene…

SOX6mRNA and protein…

…confirmed MALAT1 andSOX6as miR-499a-5p targets.…

Show Full Abstract

<h4>Background</h4>Atrial fibrillation (AF) is a common cardiac arrhythmia associated with significant morbidity and mortality. Rapid electrical stimulation (RES) of atrial fibroblasts plays a crucial role in AF pathogenesis, but the underlying molecular mechanisms remain unclear. This study investigates the regulatory axis involving MALAT1, miR-499a-5p, and SOX6 in human cardiac fibroblasts from adult atria (HCF-aa) under RES conditions.<h4>Methods</h4>HCF-aa were subjected to RES at 0.5 V/cm and 10 Hz. The expression levels of metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), miR-499a-5p, and SRY-Box Transcription Factor 6 (SOX6) were measured using qPCR and Western blot analyses. Luciferase reporter assays were performed to confirm target relationships. The effects of MALAT1 siRNA, miR-499a-5p mimics/inhibitors, and SOX6 overexpression on gene expression and apoptosis were assessed.<h4>Results</h4>RES increased exosomal MALAT1 expression, peaking at 2 h. MiR-499a-5p levels initially increased, then decreased at 2 h, coinciding with peak MALAT1 expression. SOX6 mRNA and protein levels increased, peaking at 4 and 6 h, respectively. Luciferase assays confirmed MALAT1 and SOX6 as miR-499a-5p targets. MALAT1 knockdown increased miR-499a-5p levels and reduced SOX6 expression. MiR-499a-5p overexpression decreased SOX6 levels and inhibited RES-induced apoptosis.<h4>Conclusion</h4>In HCF-aa under RES, increased exosomal MALAT1 expression counteracts miR-499-5p's suppression of SOX6, suggesting that MALAT1-containing exsosomes derived from HCF-aa may offer a novel cell-free therapeutic approach for AF.

HTT
Also flagged:Multiple sclerosisMSneurodegenerative diseasechronic demyelinating diseasecognitive disabilitiesmyelin sheath
Journal Article 2024-11-22 ✓ 1 Snippet Kapel-Reguła A, Duś-Ilnicka I, Radwan-Oczko M.
In-Text Gene Mentions

…tau, α-syn, andHTT, as well as…

Show Full Abstract

Multiple sclerosis (MS) is a demyelinating, progressive, and neurodegenerative disease. The cause of this condition remains unknown. Diagnosing and monitoring the course of this disease requires the use of time-consuming, costly, and invasive methods such as magnetic resonance imaging and cerebrospinal fluid analysis. To date, no specific diagnostic tests for MS are available. The purpose of this publication is to answer the question of whether saliva, as a mirror of oral and general health and easily obtainable test material, can be a significant source of information on etiological factors, biomarkers, and indicators of disease progression and whether analysis of substances in saliva is sensitive enough to replace plasma, urine, or cerebrospinal fluid. For this purpose, a systematic search of databases was conducted: PubMed, Google Scholar, and Embase.

RC3H1
Also flagged:cancersoral squamous cell carcinomaOSCCEBV infectioncell proliferationwound healing
Journal Article 2024-11-22 ✓ 1 Snippet Srisathaporn S, Pientong C, Heawchaiyaphum C, Nukpook T, Aromseree S, Ekalaksananan T.
In-Text Gene Mentions

…IGF2BP2, KHDRBS3, SNRNP70,RC3H1, SRSF1, SRSF9, and…

Show Full Abstract

Dysregulated long non-coding RNA (lncRNA) expression is linked to various cancers and may be influenced by oncogenic Epstein-Barr virus (EBV) infection, a known and detectable risk factor in oral squamous cell carcinoma (OSCC) patients. However, research on the oncogenic role of EBV-induced lncRNAs in OSCC is limited. To identify lncRNA-associated EBV infection and OSCC carcinogenesis, the differential expression of RNA-seq datasets from paired normal adjacent and OSCC tissues, and microarray data from EBV-negative and EBV-positive SCC25 cells, were identified and selected, respectively, for interaction, functional analysis, and CCK-8 cell proliferation, wound healing, and invasion Transwell assays. In OSCC tissues, 6731 differentially expressed lncRNAs were identified when compared to normal tissues from RNA-seq datasets, with 295 linked to EBV-induced OSCC carcinogenesis from microarray datasets. The EBV-induced lncRNA <i>VWA8-AS1</i> showed significant upregulation in EBV-positive SCC25 cells and EBV-infected adjacent and OSCC tissue samples. <i>VWA8-AS1</i> potentially promotes OSCC via the lncRNA-miRNA-mRNA axis or direct protein interactions, affecting various cellular processes. Studies in OSCC cell lines revealed that elevated <i>VWA8-AS1</i> levels enhanced cell migration and invasion. This study demonstrates <i>VWA8-AS1</i>'s contribution to tumor progression and possible interactions with its targets in OSCC, offering insights for future research on functional mechanisms and therapeutic targets in EBV-associated OSCC.

Also flagged:gestationinseminationabortionfertilizationparturitionmembranes
Journal Article 2024-11-22 No Snippets Suarez EM, Kelson VC, Kiser JN, Davenport KM, Murdoch BM, Neibergs HL.
Show Full Abstract

<b>Background/Objectives:</b> The dairy industry relies on reproductive efficiency to maintain efficient milk production. Spontaneous abortion (SA), defined as pregnancy loss between gestation days 42 and 260, occurred in 4.5% of the artificially inseminated (AI) Holstein heifers and 31.6% of the embryo transfer (ET) recipient Holstein heifers that received in vitro-produced frozen embryos on a single dairy farm in Idaho. <b>Methods:</b> A genome-wide association analysis (GWAA) was performed to identify the associations (FDR <i>p</i> < 0.05) with SA in heifers that were bred by AI (1351 controls that delivered at term and 63 cases that aborted) that conceived following the first insemination, as well as in 59 controls and 273 cases of ET recipient heifers pregnant from the first ET. <b>Results:</b> There were 216 loci and 413 positional candidate genes associated (FDR <i>p</i> < 0.05) with SA in the heifers bred by AI in a recessive model and no loci associated with SA in the ET recipients. <b>Conclusions:</b> The identification of loci associated with SA in the heifers bred by AI may be used to reduce fetal loss through genomic selection.

DCC
Also flagged:heart failureesmololreproductionaortic valve insufficiency
Journal Article 2024-11-22 ✓ 3 Snippets Perez EC, Bolch CM, Tompkins RM, Burkhoff D, Letsou GV, Criscione JC, Criscione JC.
In-Text Gene Mentions

…HF states, beforeDCCactivation.…

…effects of CorInnovaDCCbeyond what has…

…silico effects ofDCCon hemodynamics.…

Show Full Abstract

Despite advancements in mechanical circulatory support (MCS) technology, persistent critical complications related to blood contact remain unresolved. To provide a safer alternative therapy, CorInnova is developing a non-blood contacting direct cardiac compression (DCC) device for MCS. To support product development toward clinical trials, a simulation platform has been developed to predict clinical outcomes under patient-specific conditions, guiding patient selection for clinical trials. The Harvi simulation was validated using preclinical in vivo data from experimental studies with the CorInnova device, with n = 28 hemodynamic samples simulated from animal data (n = 4 ovine). After confirming validation, further simulation was performed to predict additional hemodynamic outcomes not captured in animal studies. The simulated effects of CorInnova device therapy were not significantly different from animal data for cardiac output, systemic arterial blood pressure, mean pulmonary artery pressure, central venous pressure, or left ventricular pressure ( p > 0.050). Harvi accurately predicts the effects of the CorInnova device in heart failure conditions and can be used in preparation for future clinical trials.

SERPINC1
Also flagged:ureanitrogensuperoxide dismutaseribosomefatty acidbiosynthesis
Journal Article 2024-11-22 ✓ 2 Snippets Liao J, Ke W, Wang B, Du M, Lu Q, Zhang Y, Zhang G.
In-Text Gene Mentions

…III encoded bySERPINC1exhibits anti-inflammatory eff…

…, C9 ,SERPINC1, ITGB2 ,…

Show Full Abstract

This study investigated the effects of <i>Lycium barbarum</i> residues (LBR) and fermented <i>L. barbarum</i> residues (FLBR) on the growth performance and meat quality of lambs. Eighteen lambs were randomly assigned into three groups and fed either a basal diet (CON) or the same diet supplemented with 5.0% LBR or FLBR for a period of 90 days. The underlying mechanisms responsible for the beneficial effect of LBR and FLBR on the longissimus thoracis (LT) and intramuscular fat (IMF) tissues of lambs were examined using multiomics techniques. Our findings showed that FLBR supplementation significantly enhanced the average daily gain, feed efficiency, and nutrient digestibility (<i>P</i> < 0.05 or <i>P</i> < 0.01). Serum total protein (<i>P</i> = 0.007) and glucose (<i>P</i> = 0.002) levels were higher in the FLBR-fed lambs, while urea nitrogen level was lower (<i>P</i> = 0.001). Additionally, the levels of rumen acetate (<i>P</i> = 0.002) and propionate (<i>P</i> = 0.011) were significantly elevated, while ammonia-nitrogen (NH<sub>3</sub>-N), isobutyrate and isovalerate decreased (<i>P</i> < 0.05 or <i>P</i> < 0.01) following FLBR supplementation. Post-mortem meat quality was also improved by FLBR, as evidenced by enhanced total antioxidant capacity, superoxide dismutase activity, pH, redness (a∗), tenderness and water holding capacity (<i>P</i> < 0.05 or <i>P</i> < 0.01), alongside a reduction in the malonaldehyde content (<i>P</i> < 0.001). Transcriptomic analysis identified 962 differentially expressed genes (DEGs, FLBR vs CON) and 782 DEGs (FLBR vs LBR) in LT, and 1313 DEGs (FLBR vs CON) and 1221 DEGs (FLBR vs LBR) in IMF. The ribosome signaling pathway related genes in LT tissue were activated by the FLBR diet (<i>P</i> < 0.05), showing a higher anabolism of protein. The genes involved in fatty acid biosynthesis in IMF tissue were upregulated by the FLBR diet (<i>P</i> < 0.05), showing a higher anabolism of lipids. Metabolomics analysis identified the 1732 differential metabolites in LT tissue following FLBR supplementation, with significant alterations in metabolites such as carnosine, L-arginine and L-proline, which may serve as potential biomarkers for meat quality betterment. In conclusion, FLBR supplementation might have modified anabolism of proteins and fatty acid, as well as muscle metabolomic profiles, leading to improvements in both growth performance and meat quality in fattening lambs.

HFE
Also flagged:Amiodaroneatrial fibrillationrefractory arrhythmiasliver failurehepatic encephalopathythyroid dysfunction
Journal Article 2024-11-21 ✓ 2 Snippets Kishimoto K, Tobita H, Kataoka M, Yazaki T, Oka A, Ishimura N, Tanabe K, Ishihara S.
In-Text Gene Mentions

…diseases such ashemochromatosis, hemosiderosis, Wilson's dise…

Hemochromatosisand hemosiderosis were…

Show Full Abstract

Amiodarone is an antiarrhythmic drug that is widely used for atrial fibrillation and other refractory arrhythmias. Although beneficial, its long-term administration is associated with adverse effects on various organs. One patient presented with amiodarone-induced liver injury, which led to liver failure. Computed tomography revealed a gradual increase in hepatic density over a long period following the initiation of amiodarone. Despite the discontinuation of the drug, the patient developed hepatic encephalopathy and subsequently died. This outcome highlights the drug's extended half-life, which caused persistent end-organ damage even after its withdrawal. Drug titration to the lowest effective dose and careful monitoring of annual liver function tests are important.

SERPINC1
Also flagged:HeparinthrombincoagulationATAT deficiencyclotting
Journal Article 2024-11-21 ✓ 1 Snippet Chabata CV, Yu H, Ke L, Frederiksen JW, Patel PA, Sullenger BA, Thalji NK.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Background</h4>Andexanet alfa (andexanet) is the only Food and Drug Administration-approved antidote for direct FXa (factor Xa) inhibitors but has been reported to cause resistance to unfractionated heparin (UFH). This has delayed anticoagulation for procedures requiring cardiopulmonary bypass. The mechanism, andexanet and UFH dose dependence, and thrombotic risk of andexanet-associated heparin resistance are unknown.<h4>Methods</h4>The effect of andexanet in vitro was determined using activated clotting times and thromboelastography. Ex vivo cardiopulmonary bypass circuits were used to determine whether andexanet impaired anticoagulation for extracorporeal circulation. Kinetics of AT (antithrombin) inhibition of FXa and thrombin were measured in the presence of andexanet. Equilibrium modeling and thrombin generation assay validation were used to predict the role of andexanet, AT, and UFH concentrations in andexanet-associated heparin resistance.<h4>Results</h4>Andexanet prevented UFH-mediated prolongation of activated clotting times and thromboelastography times. At lower concentrations of andexanet, heparin resistance could be overcome with suprapharmacologic doses of UFH, but not at higher andexanet concentrations. Andexanet rendered standard doses of UFH inadequate to prevent circuit thrombosis, and suprapharmacologic UFH doses were only partially able to overcome this. Scanning electron microscopy demonstrated coagulation activation in circuits. Andexanet prevented UFH enhancement of AT-mediated inhibition of FXa and thrombin. Equilibrium modeling and thrombin generation assay validation demonstrated that andexanet creates a triphasic equilibrium with UFH and AT: initial UFH unresponsiveness, normal UFH responsiveness when andexanet is depleted, and finally AT depletion. Sufficient cardiopulmonary bypass heparinization can only occur at low therapeutic andexanet doses and normal AT levels. Higher andexanet doses or AT deficiency may require high UFH doses and potentially AT supplementation.<h4>Conclusions</h4>Andexanet causes heparin resistance due to redistribution of UFH-bound AT. If andexanet cannot be avoided before heparinization and direct thrombin inhibitors are undesirable, our in vitro study suggests excess UFH should be considered as a potential strategy before AT supplementation.

Also flagged:triacylglycerolslipiddegradationsynthesisunsaturatedacyl
Journal Article 2024-11-21 No Snippets Handke M, Beierlein F, Imhof P, Schiedel M, Hammann S.
Show Full Abstract

Lipids are major constituents of food but are also highly relevant substructures of drugs and are increasingly applied for the development of lipid-based drug delivery systems. Lipids are prone to oxidative degradation, thus affecting the quality of food or medicines. Therefore, analytical methods or tools that enable the degree of lipid oxidation to be assessed are of utmost importance to guarantee food and drug safety. Herein, we report the design, synthesis and application of the first-in-class fluorogenic triacylglycerols that enable dynamic monitoring of lipid oxidation via straightforward fluorescence readout. Our fluorogenic triacylglycerols can be used in both aqueous and lipid-based environments. Furthermore, we showed that the sensitivity of our fluorescent tracers towards oxidation could be tuned by incorporating either saturated or unsaturated acyl chains in their triacylglycerol core structure. With this, we provide a first proof of principle for the applicability of fluorescently labelled triacylglycerols as tracers to monitor the dynamics of lipid oxidation, thus paving the way for novel discoveries in the area of lipid analytics.

Also flagged:CentromereschromosomechromatincentromerechromosomesCell division
Journal Article 2024-11-21 No Snippets Courret C, Hemmer LW, Wei X, Patel PD, Chabot BJ, Fuda NJ, Geng X, Chang CH, Mellone BG, Larracuente AM.
Show Full Abstract

Centromeres reside in rapidly evolving, repeat-rich genomic regions, despite their essential function in chromosome segregation. Across organisms, centromeres are rich in selfish genetic elements such as transposable elements and satellite DNAs that can bias their transmission through meiosis. However, these elements still need to cooperate at some level and contribute to, or avoid interfering with, centromere function. To gain insight into the balance between conflict and cooperation at centromeric DNA, we take advantage of the close evolutionary relationships within the Drosophila simulans clade-D. simulans, D. sechellia, and D. mauritiana-and their relative, D. melanogaster. Using chromatin profiling combined with high-resolution fluorescence in situ hybridization on stretched chromatin fibers, we characterize all centromeres across these species. We discovered dramatic centromere reorganization involving recurrent shifts between retroelements and satellite DNAs over short evolutionary timescales. We also reveal the recent origin (<240 Kya) of telocentric chromosomes in D. sechellia, where the X and fourth centromeres now sit on telomere-specific retroelements. Finally, the Y chromosome centromeres, which are the only chromosomes that do not experience female meiosis, do not show dynamic cycling between satDNA and TEs. The patterns of rapid centromere turnover in these species are consistent with genetic conflicts in the female germline and have implications for centromeric DNA function and karyotype evolution. Regardless of the evolutionary forces driving this turnover, the rapid reorganization of centromeric sequences over short evolutionary timescales highlights their potential as hotspots for evolutionary innovation.

HTT
Also flagged:HuntingtindepressionanxietyHDmajor depressive disordernucleus
Journal Article 2024-11-21 ✓ 2 Snippets Vater M, Rost N, Eckstein G, Sauer S, Tontsch A, Erhardt A, Lucae S, Brückl T, Klopstock T, Sämann PG, Binder EB.
In-Text Gene Mentions

…huntingtin gene (HTT) CAG repeat…

…TheHTTgene represents the…

Show Full Abstract

Huntington's disease (HD) is strongly associated with psychiatric symptoms, yet, associations between huntingtin gene (HTT) CAG repeat size variations and psychiatric phenotypes outside the HD complex are still under-investigated. In this genetic case-control study we compared the distribution of HTT CAG repeat sizes in predefined ranges between patients with major depressive disorder (MDD) (n = 2136) and anxiety disorders (ANX) (n = 493), and healthy controls (CON) (n = 1566). We used regression models to study interactions between the alleles and associations with fine-granular clinical phenotypes and basal ganglia structure. HD mutations in the range of incomplete penetrance (36-39 repeats) were not overrepresented in patients. In participants older than 48 years, 13-20 repeats on both HTT alleles were associated with a reduced ANX risk whereas a 13-20 | 21-26 combination was associated with an increased ANX risk. Post-hoc analyses confirmed a turning point around 21 repeats and trends in the same direction were detected for MDD. The joint patient | CON analysis of the full spectrum of allele combinations confirmed interaction effects and age-dependent allele | risk profiles. A short-by-long interaction effect and an age-dependent negative correlation of the short allele on the nucleus accumbens volume was detected, independently of the diagnostic group. In conclusion, we revealed that HTT CAG repeat sizes of both alleles in the non-HD range are associated with a risk modulation for common psychiatric disorders as well as basal ganglia structure differences in an age-dependent way, possibly implying that normal variation of the functionally diverse wildtype huntingtin protein may impact brain function.

RABGAP1LGPR52
Also flagged:chromosomesBMP2mitochondrialPDGFDGlutathione S ‐transferaseBEST4
Journal Article 2024-11-21 ✓ 2 Snippets Ben-Jemaa S, Yahyaoui G, Kdidi S, Najjari A, Lenstra JA, Mastrangelo S, Gaouar SBS, Mwacharo JM, Khorchani T, Yahyaoui MH.
In-Text Gene Mentions
⭐ same-sentence co-mention

…627 bp (RABGAP1Land GPR52 );…

⭐ same-sentence co-mention

…( RABGAP1L andGPR52); and OAR24,…

Show Full Abstract

North Africa counts several sheep breeds that can be categorized as fat- and thin-tailed. The former are well adapted to dryland environments. In this study, we used 50K genome-wide single nucleotide polymorphism profiles from 462 animals representing nine fat-tailed and 13 thin-tailed sheep breeds across North Africa to localize genomic regions putatively under differential selective pressures between the two types of breeds. We observed genetic clines from east to west and from north to south. The east-west cline separates the fat- and thin-tailed breeds, with the exception of the fat-tailed Algerian Barbarine, which is closely related to a genetically homogeneous cluster of Moroccan and Algerian thin-tailed breeds. Using a combination of three extended haplotype homozygosity tests, we detected seven candidate regions under divergent selection between fat- and thin-tailed sheep. The strongest selection signals reside on chromosomes 1 and 13, with the latter spanning the BMP2 gene, known to be associated with the fat-tail phenotype. Overall, the candidate regions under selection in fat-tailed sheep overlap with genes associated with adaptation to desert-like environments including adipogenesis, as well as heat and drought tolerance. Our results confirm previously reported candidate genes known to be a target of fat-tail selection in sheep but also reveal novel candidate genes specifically under selection in North African populations.

SOX6
Also flagged:ALDH1A1Asparagine EndopeptidaseParkinson's diseasePDLegumainAEP
Journal Article 2024-11-21 ✓ 5 Snippets Nie S, Li B, Wang M, Chen Z, Ren J, Li Z, Xu X, Qian Z, Xie Z, Han J, Zhang Z, Zhang Z, Zhu Y, Chen Z, Yang X, Ye K.
In-Text Gene Mentions

Sox6and ALDH1A1 Truncation…

…SNpc and cleavesSox6and ALDH1A1, leading…

…AEP cutsSox6and ALDH1A1 in…

…coeruleus (LC), abolishingSox6's transcriptive and ALDH1A1's…

…family member A1, (Sox6+ /ALDH1A1 +…

Show Full Abstract

Dopaminergic neurons in the substantia nigra pars compacta (SNpc) demonstrate regionally selective susceptibility in Parkinson's disease (PD) compared to those in the ventral tegmental area (VTA). However, the molecular mechanism for this distinct vulnerability remains unclear. Here, it is shown that Legumain, also known as asparagine endopeptidase (AEP), is activated in a subgroup of SRY-box transcription factor 6 /Aldehyde dehydrogenase 1 family member A1, (Sox6<sup>+</sup>/ALDH1A1<sup>+</sup>) neurons in the ventral tier of the SNpc and cleaves Sox6 and ALDH1A1, leading to repression of Special AT-rich sequence binding protein 1 (Satb1) that is a dimeric/tetrameric transcription factor specifically binding to AT-rich DNA sequences, and toxic dopamine metabolite accumulation. AEP cuts Sox6 and ALDH1A1 in dopaminergic neurons that project to the locus coeruleus (LC), abolishing Sox6's transcriptive and ALDH1A1's enzymatic activities. Co-expressing AEP-truncated Sox6 and ALDH1A1 fragments in 3-month-old A53T SNCA transgenic mice accelerates dopamine degeneration, whereas expressing AEP-resistant Sox6 N336A/N446A and ALDH1A1 N220A mutants alleviates rotenone-induced PD pathologies. Hence, different circuitries and intrinsic properties of dopaminergic neurons in the SNpc and VTA render differential predispositions in PD.

Also flagged:tumorhead and neck squamous cell carcinomahead and neck squamous cell carcinomascancerHNSCCmethylation
Journal Article 2024-11-21 No Snippets Yang R, Li T, Zhang S, Shui C, Ma H, Li C.
Show Full Abstract

<h4>Background</h4>Circulating tumour DNA (ctDNA) has emerged as a valuable liquid biopsy biomarker in the field of oncology, including head and neck squamous cell carcinomas (HNSCCs), offering potential insights into cancer diagnosis, progression, and prognosis. This review aims to comprehensively evaluate the utility of ctDNA as a prognostic biomarker in HNSCC.<h4>Methods</h4>PubMed and Ovid were searched as part of our review. Studies that investigated the relationship between ctDNA and prognosis in HNSCC patients were included. Outcomes extracted included basic characteristics, ctDNA details and survival data. Meta-analysis was performed on eligible studies to determine pooled progression-free/recurrence-free survival (RFS/PFS) and overall survival (OS).<h4>Results</h4>Twenty-two studies were included, involving 5062 HNSCC patients from 11 countries. The meta-analysis demonstrated that the positive ctDNA/methylation detection was associated with worse OS (HR = 2.00, 95% CI 1.35-2.96) and worse PFS/RFS (HR = 3.54, 95% CI 1.05-11.85). Positive ctEBV DNA was associated with poorer OS (HR = 2.86, 95% CI 1.84-4.45) and poorer PFS/RFS (HR = 1.93, 95% CI 1.74-2.13). Positive ctHPV DNA was associated with poorer OS (HR = 1.38, 95% CI 1.07-1.38) but not PFS/PFS (HR = 1.33, 95% CI 0.96-1.85).<h4>Conclusion</h4>Meta-analysis indicates that the status of ctDNA is significantly associated with the prognosis of HNSCC patients, with ctDNA/methylation-negative patients demonstrating better PFS/RFS and OS.

CA10
Also flagged:gene expressionTSretinal diseasesMEGF11SLIT2RUNX1
Journal Article 2024-11-21 ✓ 5 Snippets Xiong LL, Sun YF, Niu RZ, Xue LL, Chen L, Huangfu LR, Li J, Wang YY, Liu X, Wang WY, Zuo ZF, Wang TH.
In-Text Gene Mentions

…+ ; BCs,CA10+ , NETO1…

…and BCs (CA10) (Fig. 1…

…Interestingly,CA10was presented as…

…immunofluorescent staining ofCA10+ / NETO1…

…− (OFF_BCs) andCA10+ / ISL1…

Show Full Abstract

Tree shrews (TSs) possess a highly developed visual system. Here, we establish an age-related single-cell RNA sequencing atlas of retina cells from 15 TSs, covering 6 major retina cell classes and 3 glial cell types. An age effect is observed on the cell subset composition and gene expression pattern. We then verify the cell subtypes and identify specific markers in the TS retina including <i>CA10</i> for bipolar cells, <i>MEGF11</i> for H1 horizontal cells, and <i>SLIT2</i>, <i>RUNX1</i>, <i>FOXP2</i>, and <i>SPP1</i> for retinal ganglion cell subpopulations. The cross-species analysis elucidates the cell type-specific transcriptional programs, different cell compositions, and cell communications. The comparisons also reveal that TS cones and subclasses of bipolar and amacrine cells exhibit the closest relationship with humans and macaques. Our results suggests that TS could be used as a better disease model to understand age-dependent cellular and genetic mechanisms of the retina, particularly for the retinal diseases associated with cones.

Also flagged:Chromosomechromosomesnucleusnucleotidemitochondrialrhodopsin
Journal Article 2024-11-21 No Snippets Cardoso DC, Cristiano MP.
Show Full Abstract

Trait evolution has become a central focus in evolutionary biology, with phylogenetic comparative methods offering a framework to study how and why traits vary among species. Identifying variations in trait evolution rates within phylogenies is important for uncovering the mechanisms behind these differences. Karyotype variation, which is substantial across eukaryotic organisms, plays an essential role in species diversification. This study investigates karyotype variation within the leafcutting ant clade, focusing on chromosome number and morphology. We aim to determine whether karyotypic traits are phylogenetically dependent and how different evolutionary models explain karyotype diversity. Previous models have been insufficient in explaining these variations. To address these gaps, we employ modern phylogenetic methods to assess the impact of chromosomal fissions and fusions on karyotype evolution. By evaluating various evolutionary models-particularly the Brownian motion model, which suggests neutral chromosomal changes-we pursue for the further understanding the mode and tempo of karyotype evolution in ants. Our research examines how shifts in chromosomal change rates contribute to divergence among leafcutting ant species and assesses the role of chromosomal changes in the clade's evolutionary trajectory. Comparative analysis of leafcutting ant ideograms suggests that shared karyotype traits are strongly related to species relationships. This implies that karyotype diversification in leafcutting ants follows a phylogenetic trajectory at varying rates, with differences in karyotype traits reflecting the evolutionary distance between lineages. Particularly, the increase in the chromosome number of <i>Acromyrmex</i> is likely due to fission rearrangements rather than demi or polyploidization. We discuss and provide insights into the mechanisms driving karyotype variation and its implications for leafcutting ant diversification.

PRDX6
Also flagged:mitochondrial peroxiredoxinPrdx3intermembrane spacePeroxiredoxin 3mitochondriamitochondrial
Journal Article 2024-11-21 ✓ 1 Snippet Gomes F, Turano H, Haddad LA, Netto LES.
In-Text Gene Mentions

…(Prdx1, Prdx2 andPrdx6) were absent in…

Show Full Abstract

Peroxiredoxin 3 (Prdx3) is the major sink for H<sub>2</sub>O<sub>2</sub> and other hydroperoxides within mitochondria, yet the mechanisms guiding the import of its cytosolic precursor into mitochondrial sub-compartments remain elusive. Prdx3 is synthesized in the cytosol as a precursor with an N-terminal cleavable presequence, which is frequently proposed to target the protein exclusively to the mitochondrial matrix. Here, we present a comprehensive analysis of the human Prdx3 biogenesis, using highly purified mitochondria from HEK293T cells. Subfractionation and probing for specific mitochondrial markers confirmed Prdx3 localization in the matrix, while unexpectedly revealed its presence in the mitochondrial intermembrane space (IMS). Both matrix and IMS isoforms were found to be soluble proteins, as demonstrated by alkaline carbonate extraction. By combining in silico analysis, in organello import assays and heterologous expression in yeast, we found that Prdx3 undergoes sequential proteolytic processing steps by mitochondrial processing peptidase (MPP) and mitochondrial intermediate peptidase (MIP) during its import into the matrix. Additionally, heterologous expression of Prdx3 in yeast revealed that its sorting to the IMS is dependent on the inner membrane peptidase (IMP) complex. Collectively, these findings uncover a complex submitochondrial distribution of Prdx3, supporting its multifaceted role in mitochondrial H<sub>2</sub>O<sub>2</sub> metabolism.

SOX6
Also flagged:Baicalinflavonoidacute lung injuryCell growthcaspase 3methyltransferase-like 14
Journal Article 2024-11-21 ✓ 5 Snippets Chen Y, Gu Y, Gao Z.
In-Text Gene Mentions

…URY THROUGH MEDIATING METTL14/SOX6AXIS.…

…transcription factor 6 (SOX6) was studied using…

…Downregulation ofSOX6weakened LPS-induced cytotoxic…

…injury via reducingSOX6expression.…

SOX6expression was stabilized…

Show Full Abstract

<h4>Abstract</h4>Background : Baicalin (C 21 H 18 O 11 ) is a flavonoid component extracted from Scutellaria baicalensis with biological activity in various types of diseases, including acute lung injury (ALI). The relevant mechanism behind baicalin in ALI needs further investigation. Methods : ALI model in vitro was established by LPS in WI-38 cells (lung fibroblast). Cell growth was determined via MTT assay and EdU assay. Apoptosis was assessed using flow cytometry, caspase 3 assay, and TUNEL assay. Oxidative indicators and inflammatory cytokines were detected by commercial kits. Interaction between methyltransferase-like 14 (METTL14) and SRY-box transcription factor 6 (SOX6) was studied using methylated RNA immunoprecipitation and dual-luciferase reporter assay. Reverse transcription-quantitative polymerase chain reaction and Western blot were applied for examining gene levels. Results : Baicalin enhanced cell growth and reduced apoptosis and oxidative stress; inflammation after ALI was induced by LPS. Downregulation of SOX6 weakened LPS-induced cytotoxicity in WI-38 cells. Baicalin prevented from LPS-induced lung cell injury via reducing SOX6 expression. SOX6 expression was stabilized by METTL14 through its methylation modification. METTL14/SOX6 axis was related to the regulation of baicalin in LPS-treated WI-38 cells. Conclusion : Therefore, baicalin played an important role to inhibit LPS-induced cytotoxicity in vitro via METTL14-mediated methylation of SOX6.

Also flagged:diphenylmethylpentalenediazapentalenedibenzopentalenesacenenitrogen
Journal Article 2024-11-21 No Snippets Santiago R, Carvajal MÀ, Poater J, Moreira IPR, Bromley ST, Deumal M, Ribas-Ariño J.
Show Full Abstract

Fully-organic molecules with high-spin ground states are promising building blocks for new lightweight flexible magnetic materials for emerging technological applications (<i>e.g.</i> spintronics). In this study, we explore the potential of diradicals made of two diphenylmethyl-based open-shell cores covalently linked <i>via</i> different types of pentalene and diazapentalene-based antiaromatic couplers (including dibenzopentalenes and acene-inserted derivatives). Accurate electronic structure calculations have been employed to target non-bonding and non-disjoint frontier molecular orbitals that favor high-spin configurations, leading to the identification of diradicals displaying robust triplet ground states. These candidates exhibit singlet-triplet energy gaps that are up to ten times the thermal energy at room temperature. These substantial gaps emerge from strong interactions between the π-systems of the open-shell centers and the antiaromatic coupler. These interactions not only result in high spin states but are also found to lead to an enhanced stability of the diradicals by drastically dampening their inherent antiaromatic character as compared to the bare couplers, and promoting a high degree of spin density delocalization. These findings highlight the potential of pentalene-based diradicals as building blocks for developing new advanced fully organic magnetic materials.

HFE
Also flagged:lipidinfectiontissue homeostasispoly-unsaturated fatty acidsalcoholAH
Journal Article 2024-11-21 ✓ 1 Snippet Li W, Xia Y, Yang J, Sanyal AJ, Shah VH, Chalasani NP, Yu Q.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, and Wilson’s disease,…

Show Full Abstract

<h4>Background</h4>Alcoholic hepatitis (AH) is characterized by intense systemic and liver inflammation, posing significant risks of health complications and mortality. While inflammation is a crucial defense mechanism against injury and infection, its timely resolution is essential to prevent tissue damage and restore tissue homeostasis. The resolution of inflammation is primarily governed by specialized pro-resolving mediators (SPMs), lipid metabolites derived from w-6 and w-3 poly-unsaturated fatty acids (PUFAs). Currently, the balance between pro-inflammatory lipid mediators (PLMs) and SPMs in the w-6 and w-3 PUFA metabolic pathways and the impact of alcohol abstinence on profiles of PLMs and SPMs in AH patients are not well studied.<h4>Methods</h4>In this study, we used LC-MS/MS and ELISA to quantify levels of lipid mediators (LMs) and their precursors in the plasma samples from 58 AH patients, 29 heavy drinkers without overt liver diseases (HDCs), and 35 healthy controls (HCs). Subsequently, we assessed correlations of altered LMs with clinical parameters and inflammatory mediators. Furthermore, we conducted a longitudinal study to analyze the effects of alcohol abstinence on LMs over 6- and 12-month follow-ups.<h4>Results</h4>AH patients exhibited significantly higher plasma levels of w-6 PLMs (PGD2 and LTB4) and SPM RvE1 compared to HDCs or HCs. Conversely, the SPM LXA4 was significantly downregulated in AH patients. Some of these altered LMs were found to correlate with AH disease severity and various inflammatory cytokines. Particularly, the LTB4/LXA4 ratio was substantially elevated in AH patients relative to HDCs and HCs. This altered ratio displayed a positive correlation with the MELD score. Importantly, the majority of dysregulated LMs, particularly PLMs, were normalized following alcohol abstinence.

Also flagged:Cas9shortCRISPR-associated genesCRISPRCaszinc finger nucleases
Journal Article 2024-11-21 No Snippets Hu S, Gan M, Wei Z, Shang P, Song L, Feng J, Chen L, Niu L, Wang Y, Zhang S, Shen L, Zhu L, Zhao Y.
Show Full Abstract

Genome-wide CRISPR library screening technology is a gene function research tool developed based on the CRISPR/Cas9 gene-editing system. The clustered regularly interspaced short palindromic repeats/CRISPR-associated genes (CRISPR/Cas) system, considered the third generation of gene editing after zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN), is widely used for screening various viral host factors. CRISPR libraries are classified into three main categories based on the different functions of Cas9 enzymes: CRISPR knockout (CRISPR KO) library screening, CRISPR transcriptional activation (CRISPRa) library screening, and CRISPR transcriptional interference (CRISPRi) library screening. Recently, genome-wide CRISPR library screening technology has been used to identify host factors that interact with viruses at various stages, including adsorption, endocytosis, and replication. By specifically modulating the expression of these host factors, it becomes possible to cultivate disease-resistant varieties, establish disease models, and design and develop vaccines, among other applications. This review provides an overview of the development and technical processes of genome-wide CRISPR library screening, as well as its applications in identifying viral host factors in livestock and poultry.

PRDX6
Also flagged:uterine leiomyomapathogenesisGene ExpressionchemokineANXA1CD36
Journal Article 2024-11-21 ✓ 5 Snippets Li Y, Chen H, Zhang H, Lin Z, Song L, Zhao C.
In-Text Gene Mentions

…CD36, MICB, andPRDX6) in ULM through…

…MICB , andPRDX6.…

…= 1.032), andPRDX6( p =…

…MICB , andPRDX6, indicating consistency…

…MICB , andPRDX6were confirmed as…

Show Full Abstract

<h4>Background</h4>Oxidative stress has been implicated in the pathogenesis of uterine leiomyoma (ULM) with an increasing incidence. This study aimed to identify potential oxidative stress-related biomarkers in ULM using transcriptome data integrated with Mendelian randomization (MR) analysis.<h4>Methods</h4>Data from GSE64763 and GSE31699 in the Gene Expression Omnibus (GEO) were included in the analysis. Oxidative stress-related genes (OSRGs) were identified, and the intersection of differentially expressed genes (DEGs), Weighted Gene Co-expression Network Analysis (WGCNA) genes, and OSRGs was used to derive differentially expressed oxidative stress-related genes (DE-OSRGs). Biomarkers were subsequently identified <i>via</i> MR analysis, followed by Gene Set Enrichment Analysis (GSEA) and immune infiltration analysis. Nomograms, regulatory networks, and gene-drug interaction networks were constructed based on the identified biomarkers.<h4>Results</h4>A total of 883 DEGs were identified between ULM and control samples, from which 42 DE-OSRGs were screened. MR analysis revealed four biomarkers: <i>ANXA1</i>, <i>CD36</i>, <i>MICB</i>, and <i>PRDX6</i>. Predictive nomograms were generated based on these biomarkers. <i>ANXA1</i>, <i>CD36</i>, and <i>MICB</i> were significantly enriched in chemokine signaling and other pathways. Notably, <i>ANXA1</i> showed strong associations with follicular helper T cells, resting mast cells, and M0 macrophages. <i>CD36</i> was positively correlated with resting mast cells, while <i>MICB</i> was negatively correlated with macrophages. Additionally, <i>ANXA1</i> displayed strong binding energy with amcinonide, and <i>MICB</i> with ribavirin.<h4>Conclusion</h4>This study identified oxidative stress-related biomarkers (ANXA1, CD36, MICB, and PRDX6) in ULM through transcriptomic and MR analysis, providing valuable insights for ULM therapeutic research.

HFE
Also flagged:liver tumorhepatocellular carcinomatumorcirrhosisChronic liver diseaseLiver cancer
Journal Article 2024-11-21 ✓ 1 Snippet Hernandez L, Parent L, Molinier V, Suc B, Izar F, Moyal E, Peron JM, Otal P, Lusque A, Modesto A.
In-Text Gene Mentions

…cirrhosis associated withhemochromatosis.…

Show Full Abstract

<h4>Objective</h4>Stereotactic body radiation therapy (SBRT) is a therapeutic option in the guidelines for liver primaries after standard strategies like surgery or thermoablation have failed. To assess its efficacy and safety, we reviewed all patients treated by SBRT for a hepatocellular carcinoma (HCC) over a six-year period.<h4>Methods and materials</h4>The study included all patients treated by SBRT for HCC between April 2015 and November 2021 in the University Cancer Institute at Toulouse-Oncopole. All patients were inoperable and not eligible for thermoablation, or after a failure. All tumor sizes were included and cirrhosis up to Child-Pugh B was accepted. Local control (LC), overall survival (OS) and progression-free survival (PFS) were estimated by the Kaplan-Meier method. Treatment response was assessed using mRECIST criteria. Toxicity was graded using CTCAE (v4.0).<h4>Results</h4>One hundred and nine patients with 118 lesions were treated. Half underwent prior standard treatment. Median dose was 50 Grays in five fractions for most patients. Chronic liver disease represented 90.8 % of cases with a median age of 69 years. Median tumor size was 4.0 cm. Median follow-up was 22.2 months [95 %CI: 15.1-30.4]. LC, OS and PFS at two years were 82.4 % [95 %CI: 71.3; 89.5], 73.2 % [95 %CI: 61.5; 81.8] and 35.8 % [95 %CI: 25.1; 46.7], respectively. Acute toxicities occurred in 20.2 % of patients, including 10.1 % grade 3-4 and 1.8 % grade 5. Late toxicities occurred in 5.5 % of patients including 4.6 % grade 3-4. Grade ≥ 3 toxicity was related to digestive perforation or liver failure.<h4>Conclusion</h4>SBRT provides good LC with an acceptable safety profile. It can be used in several settings such as salvage therapy or in combination with validated treatment. Prospective randomized trials are needed to validate SBRT as a standard alternative.

ECI2
Also flagged:synthesisspermatogenesiscell proliferationmetabolismBLVRASTK17A
Journal Article 2024-11-21 ✓ 3 Snippets Zhang H, Bao S, Zhao X, Bai Y, Lv Y, Gao P, Li F, Zhang W.
In-Text Gene Mentions

…SERPINB9 , andECI2genes were significantly…

…the RPP40 ,ECI2, SLC15A1 ,…

…literature that theECI2gene is involved…

Show Full Abstract

In a study involving 385 Large White pigs, a genome-wide association study (GWAS) was conducted to investigate reproductive traits, specifically the number of healthy litters (NHs) and the number of weaned litters (NWs). Several SNP loci, including ALGA0098819, ALGA0037969, and H3GA0032302, were significantly associated with these traits. In the combined-parity analysis, candidate genes, such as <i>BLVRA</i>, <i>STK17A</i>, <i>PSMA2</i>, and <i>C7orf25</i>, were identified. GO and KEGG pathway enrichment analyses revealed that these genes are involved in key biological processes, including organic synthesis, the regulation of sperm activity, spermatogenesis, and meiosis. In the by-parity analysis, the <i>PLCXD3</i> gene was significantly associated with the NW trait in the second and fourth parities, while <i>RNASEH1</i>, <i>PYM1</i>, and <i>SEPTIN9</i> were linked to cell proliferation, DNA repair, and metabolism, suggesting their potential role in regulating reproductive traits. These findings provide new molecular markers for the genetic study of reproductive traits in Large White pigs. For the phenotypic prediction of NH and NW traits, several machine learning models (GBDT, RF, LightGBM, and Adaboost.R2), as well as traditional models (GBLUP, BRR, and BL), were evaluated using SNP data in varying proportions. After PCA processing, the GBDT model achieved the highest PCC for NH (0.141), while LightGBM reached the highest PCC for NW (0.146). The MAE, MSE, and RMSE results showed that the traditional models exhibited stable error rates, while the machine learning models performed comparatively better across the different SNP ratios. Overall, PCA processing provided some improvement in the predictive performance of all of the models, though the overall increase in accuracy was limited.

HFE
Also flagged:RNA-Binding ProteinHepatobiliary Cancershepatocellular carcinomacholangiocarcinomacancercancers
Journal Article 2024-11-21 ✓ 1 Snippet Fagoonee S, Weiskirchen R.
In-Text Gene Mentions

…biliary cholangitis, andhemochromatosis, with the molecular…

Show Full Abstract

Hepatobiliary cancers, such as hepatocellular carcinoma (HCC) and cholangiocarcinoma (CCA), are among the deadliest malignancies worldwide, leading to a significant number of cancer-related deaths. While bone metastases from these cancers are rare, they are highly aggressive and linked to poor prognosis. This review focuses on RNA-based molecular mechanisms that contribute to bone metastasis from hepatobiliary cancers. Specifically, the role of two key factors, microRNAs (miRNAs) and RNA-binding proteins (RBPs), which have not been extensively studied in the context of HCC and CCA, is discussed. These molecules often exhibit abnormal expression in hepatobiliary tumors, influencing cancer cell spread and metastasis by disrupting bone homeostasis, thereby aiding tumor cell migration and survival in the bone microenvironment. This review also discusses potential therapeutic strategies targeting these RNA-based pathways to reduce bone metastasis and improve patient outcomes. Further research is crucial for developing effective miRNA- and RBP-based diagnostic and prognostic biomarkers and treatments to prevent bone metastases in hepatobiliary cancers.

Also flagged:synthesisalkaloidsflavonoid glycosidestriterpene estersphenolic glucosideskinase
Journal Article 2024-11-21 No Snippets Chen L, Lv C, Meng Y, Yang Z, Xin W, Zhu Y, Wang X, Wang B, Ding X, Wang Z, Wei X, Zhang X, Fu X, Meng X, Zhang M, Huo M, Li Y, Yu H, Wei Y, Geng L.
Show Full Abstract

<i>Daphniphyllum</i> alkaloids (DAs) are interesting molecules with rich molecular skeletons and diverse biological activities. Since their discovery, phytochemists have isolated, purified, and identified more than 350 DAs. Synthetic chemists, attracted by the structure and activity of DAs, have accomplished many elegant synthetic jobs. Herein, we summarize work on the isolation, structural identification, bioactivity testing, and synthesis of DAs from 2018 to 2023, with the aim of providing a reference for future studies.

Also flagged:SynthesisDecanolidespinolidoxinbellidisin CL -riboseL -malic acid
Journal Article 2024-11-21 No Snippets Bi J, Chen M, Nie P, Liu Y, Liu J, Du Y.
Show Full Abstract

A divergent total synthesis of bioactive, naturally occurring decanolides, pinolidoxin and bellidisin C, was accomplished by taking advantage of chiral templates <i>L</i>-ribose and <i>L</i>-malic acid. In particular, bellidisin C, which is the first total synthesis so far, was achieved through a cascade reaction of reductive elimination and nucleophilic addition in a one-pot process and a sodium-alkoxide-promoted intramolecular lactonization as the key steps.

HTT
Also flagged:Neurodegenerative Diseasesspinal muscular atrophyamyotrophic lateral sclerosisHDhereditary degenerative disorderchromosome
Journal Article 2024-11-21 ✓ 3 Snippets García-González N, Gonçalves-Sánchez J, Gómez-Nieto R, Gonçalves-Estella JM, López DE.
In-Text Gene Mentions

…exon of theHTTgene located on…

…include targeting theHTTgene in Huntington’s…

…presented in theHTTgene mutation […

Show Full Abstract

This review explores recent advancements in gene therapy as a potential treatment for neurodegenerative diseases, focusing on intervention mechanisms, administration routes, and associated limitations. Following the PRISMA procedure guidelines, we systematically analyzed studies published since 2020 using the PICO framework to derive reliable conclusions. The efficacy of various gene therapies was evaluated for Parkinson's disease (n = 12), spinal muscular atrophy (n = 8), Huntington's disease (n = 3), Alzheimer's disease (n = 3), and amyotrophic lateral sclerosis (n = 6). For each condition, we assessed the therapeutic approach, curative or disease-modifying potential, delivery methods, advantages, drawbacks, and side effects. Results indicate that gene therapies targeting specific genes are particularly effective in monogenic disorders, with promising clinical outcomes expected in the near future. In contrast, in polygenic diseases, therapies primarily aim to promote cell survival. A major challenge remains: the translation of animal model success to human clinical application. Additionally, while intracerebral delivery methods enhance therapeutic efficacy, they are highly invasive. Despite these hurdles, gene therapy represents a promising frontier in the treatment of neurodegenerative diseases, underscoring the need for continued research to refine and personalize treatments for each condition.

Also flagged:Head and neck cancerscancersquamous cell carcinomadeoxyribonucleic acidcell cycleMAD1L1
Journal Article 2024-11-21 No Snippets Zebene ED, Lombardi R, Pucci B, Medhin HT, Seife E, Di Gennaro E, Budillon A, Woldemichael GB.
Show Full Abstract

Head and neck cancers (HNCs) are the sixth most commonly diagnosed cancer and the eighth leading cause of cancer-related mortality worldwide, with squamous cell carcinoma being the most prevalent type. The global incidence of HNCs is steadily increasing, projected to rise by approximately 30% per year by 2030, a trend observed in both developed and undeveloped countries. This study involved serum proteomic profiling to identify predictive clinical biomarkers in cancer patients undergoing chemoradiotherapy (CRT). Fifteen HNC patients at Tikur Anbessa Specialized Hospital, Radiotherapy (RT) center in Addis Ababa were enrolled. Serum samples were collected before and after RT, and patients were classified as responders (R) or non-responders (NR). Protein concentrations in the serum were determined using the Bradford assay, followed by nano-HPLC-MS/MS for protein profiling. Progenesis QI for proteomics identified 55 differentially expressed proteins (DEPs) between R and NR, with a significance of <i>p</i> < 0.05 and a fold-change (FC) ≥ 1.5. The top five-up-regulated proteins included <i>MAD1L1</i>, <i>PSMC2</i>, <i>TRIM29</i>, <i>C5</i>, and <i>SERPING1</i>, while the top five-down-regulated proteins were <i>RYR1</i>, <i>HEY2</i>, <i>HIF1A</i>, <i>TF</i>, and <i>CNN3</i>. Notably, about 16.4% of the DEPs were involved in cellular responses to DNA damage from cancer treatments, encompassing proteins related to deoxyribonucleic acid (DNA) damage sensing, checkpoint activation, DNA repair, and apoptosis/cell cycle regulation. The analysis of the relative abundance of ten proteins with high confidence scores identified three DEPs: <i>ADIPOQ</i>, <i>HEY2</i>, and <i>FUT10</i> as potential predictive biomarkers for treatment response. This study highlighted the identification of three potential predictive biomarkers-<i>ADIPOQ</i>, <i>HEY2</i>, and <i>FUT10</i>-through serum proteomic profiling in HNC patients undergoing RT, emphasizing their significance in predicting treatment response.

Also flagged:AntibodyAge-Related Macular Degenerationpathogenesisneovascular AMDantibodiesautoantibodies
Journal Article 2024-11-21 No Snippets Korb CA, Gerstenberger E, Lorenz K, Bell K, Beck A, Scheller Y, Beutgen VM, Wolters D, Grus FH.
Show Full Abstract

<b>Background:</b> Age-related macular degeneration (AMD) is a multifactorial disorder, and there is growing evidence of immunological involvement in its pathogenesis. To address this, we aimed to identify biomarker candidates related to retinal antigens in patients with neovascular AMD treated with ranibizumab and healthy subjects. <b>Materials and Methods:</b> This study was designed as a prospective, open, parallel-group, interventional, single-center phase IV trial. Fifty subjects with neovascular AMD and twenty healthy volunteers were enrolled. The primary objective was to assess the efficacy of intravitreally (IVT) administered ranibizumab in terms of the change in best-corrected visual acuity in subjects with all subtypes of neovascular AMD and in a subgroup of pretreated AMD subjects. A secondary objective was to assess the efficacy of the same in terms of the change in central retinal thickness (CRT) in the same subjects. Another secondary objective was to identify antibodies against retinal antigens in patients with neovascular AMD treated with ranibizumab and healthy subjects. The last secondary objective was to correlate functional and structural parameters with the identified biomarker candidates to differentiate between initial and deferred responders to IVT administered ranibizumab. Serum was analyzed using customized antigen microarrays containing 58 antigens. <b>Results:</b> After 12 weeks of ranibizumab treatment, treated patients gained 4.02 letters on average. The central retinal thickness (CRT) measured in the complete AMD study population was significantly (<i>p</i> < 0.001) decreased at Week 24 compared to the baseline measurement, and the mean CRT dropped from 393.4 to 296.8 µm. A significant increase in the following autoantibodies was detected between the control group and AMD group at Week 24, as well as in the AMD group between baseline and Week 24: antibodies targeting the proteins serotransferrin, opioid growth factor receptor, 60 kDa chaperonin 2, neurotrophin-4, dermcidin, clusterin and vascular endothelial growth factor. <b>Conclusions:</b> The present trial was able to confirm the efficacy of ranibizumab treatment in neovascular AMD, and treatment-naïve patients benefitted the most. Up- and downregulations of antibodies were observed over the course of treatment with ranibizumab. Some antibodies seemed to have a fair correlation with the classification of initial and deferred responders.

TNFSF4
Also flagged:TWIST1methylationBLCAcancersepithelial-mesenchymal transitionGene Expression
Journal Article 2024-11-21 ✓ 1 Snippet Wan M, Meng H, Li H.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4)], and immunosuppressants [in…

Show Full Abstract

<h4>Background</h4>Bladder urothelial carcinoma (BLCA), like other cancers, is strongly associated with genetic and epigenetic changes. TWIST1 is an epithelial-mesenchymal transition (EMT) promoter that has been linked to the development of many malignancies. It is still unclear, however, what role TWIST1 plays in BLCA, and the relationship between TWIST1 transcript levels and its promoter methylation and immune infiltration has been reported even less. This study aimed to reveal the potential role of TWIST1 promoter methylation-related changes in BLCA.<h4>Methods</h4>Transcriptional expression data of TWIST1 in BLCA were acquired from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), and University of Alabama at Birmingham (UALCAN) databases. TWIST1 methylation levels and prognosis were sourced from Gene Expression Profiling Interactive Analysis 2 (GEPIA2), LinkedOmics, cBio Cancer Genomics Portal (c-BioPortal), MethSurv, and DNA Methylation Information Visualization Database (DNMIVD) databases. The methylation status of the BLCA-associated TWIST1 in preoperative and postoperative urinary exfoliated cells was subsequently analyzed using methylation-specific real-time fluorescence polymerase chain reaction, with validation of accuracy through pyrophosphate sequencing. Finally, from the Gene Set Cancer Analysis (GSCA) and Tumor-Immune System Interaction Database (TISIDB) databases, we obtained the association between TWIST1 transcript expression and DNA methylation and cancer immune infiltration and immunolabelling.<h4>Results</h4>Our study demonstrated that TWIST1 expression was down-regulated in BLCA, which was negatively correlated with DNA methylation. The association between TWIST1 promoter hypermethylation and the progression, staging, grading, and recurrence of BLCA is highly significant. Furthermore, we revealed that hypermethylation of both the preoperative and postoperative TWIST1 promoters is useful as a biomarker for monitoring BLCA recurrence, particularly when considering the methylation status of specific CpG sites. Additionally, we observed that TWIST1 expression, promoter methylation, and immune infiltration immunoreactive markers correlated significantly in BLCA.<h4>Conclusions</h4>We propose that TWIST1 holds great promise as a diagnostic and therapeutic target for BLCA, with the potential to influence tumor progression and patient prognosis through the regulation of immune cell infiltration. We hope these findings contribute valuable insights to the field of BLCA research.

Also flagged:Calcium Phosphatecell adhesionmineraldiabetesliver damageosteoporosis
Journal Article 2024-11-21 No Snippets Aspera-Werz RH, Chen G, Schilonka L, Bouakaz I, Bronne C, Cobraiville E, Nolens G, Nussler A.
Show Full Abstract

Due to the chemical composition and structure of the target tissue, autologous bone grafting remains the gold standard for orthopedic applications worldwide. However, ongoing advancements in alternative grafting materials show that 3D-printed synthetic biomaterials offer many advantages. For instance, they provide high availability, have low clinical limitations, and can be designed with a chemical composition and structure comparable to the target tissue. This study aimed to compare the influences of particle size and sintering temperature on the mechanical properties and biocompatibility of calcium phosphate (CaP) gyroid scaffolds. CaP gyroid scaffolds were fabricated by 3D printing using powders with the same chemical composition but different particle sizes and sintering temperatures. The physicochemical characterization of the scaffolds was performed using X-ray diffractometry, scanning electron microscopy, and microtomography analyses. The immortalized human mesenchymal stem cell line SCP-1 (osteoblast-like cells) and osteoclast-like cells (THP-1 cells) were seeded on the scaffolds as mono- or co-cultures. Bone cell attachment, number of live cells, and functionality were assessed at different time points over a period of 21 days. Improvements in mechanical properties were observed for scaffolds fabricated with narrow-particle-size-distribution powder. The physicochemical analysis showed that the microstructure varied with sintering temperature and that narrow particle size distribution resulted in smaller micropores and a smoother surface. Viable osteoblast- and osteoclast-like cells were observed for all scaffolds tested, but scaffolds produced with a smaller particle size distribution showed less attachment of osteoblast-like cells. Interestingly, low attachment of osteoclast-like cells was observed for all scaffolds regardless of surface roughness. Although bone cell adhesion was lower in scaffolds made with powder containing smaller particle sizes, the long-term function of osteoblast-like and osteoclast-like cells was superior in scaffolds with improved mechanical properties.

Also flagged:azoospermiaInfertilitymale infertilityalcoholobesitysleep
Journal Article 2024-11-21 No Snippets Jamalirad H, Jajroudi M, Khajehpour B, Sadighi Gilani MA, Eslami S, Sabbaghian M, Vakili Arki H.
Show Full Abstract

<h4>Study question</h4>How accurately can artificial intelligence (AI) models predict sperm retrieval in non-obstructive azoospermia (NOA) patients undergoing micro-testicular sperm extraction (m-TESE) surgery?<h4>Summary answer</h4>AI predictive models hold significant promise in predicting successful sperm retrieval in NOA patients undergoing m-TESE, although limitations regarding variability of study designs, small sample sizes, and a lack of validation studies restrict the overall generalizability of studies in this area.<h4>What is known already</h4>Previous studies have explored various predictors of successful sperm retrieval in m-TESE, including clinical and hormonal factors. However, no consistent predictive model has yet been established.<h4>Study design size duration</h4>A comprehensive literature search was conducted following PRISMA-ScR guidelines, covering PubMed and Scopus databases from 2013 to 15 May 2024. Relevant English-language studies were identified using Medical Subject Headings (MeSH) terms. We also used PubMed's 'similar articles' and 'cited by' features for thorough bibliographic screening to ensure comprehensive coverage of relevant literature.<h4>Participants/materials setting methods</h4>The review included studies on patients with NOA where AI-based models were used for predicting m-TESE outcomes, by incorporating clinical data, hormonal levels, histopathological evaluations, and genetic parameters. Various machine learning and deep learning techniques, including logistic regression, were employed. The Prediction Model Risk of Bias Assessment Tool (PROBAST) evaluated the bias in the studies, and their quality was assessed using the Transparent Reporting of a Multivariable Prediction Model for Individual Prognosis or Diagnosis (TRIPOD) guidelines, ensuring robust reporting standards and methodological rigor.<h4>Main results and the role of chance</h4>Out of 427 screened articles, 45 met the inclusion criteria, with most using logistic regression and machine learning to predict m-TESE outcomes. AI-based models demonstrated strong potential by integrating clinical, hormonal, and biological factors. However, limitations of the studies included small sample sizes, legal barriers, and challenges in generalizability and validation. While some studies featured larger, multicenter designs, many were constrained by sample size. Most studies had a low risk of bias in participant selection and outcome determination, and two-thirds were rated as low risk for predictor assessment, but the analysis methods varied.<h4>Limitations reasons for caution</h4>The limitations of this review include the heterogeneity of the included research, potential publication bias and reliance on only two databases (PubMed and Scopus), which may limit the scope of the findings. Additionally, the absence of a meta-analysis prevents quantitative assessment of the consistency of models. Despite this, the review offers valuable insights into AI predictive models for m-TESE in NOA.<h4>Wider implications of the findings</h4>The review highlights the potential of advanced AI techniques in predicting successful sperm retrieval for NOA patients undergoing m-TESE. By integrating clinical, hormonal, histopathological, and genetic factors, AI models can enhance decision-making and improve patient outcomes, reducing the number of unsuccessful procedures. However, to further enhance the precision and reliability of AI predictions in reproductive medicine, future studies should address current limitations by incorporating larger sample sizes and conducting prospective validation trials. This continued research and development is crucial for strengthening the applicability of AI models and ensuring broader clinical adoption.<h4>Study funding/competing interests</h4>The authors would like to acknowledge Mashhad University of Medical Sciences, Mashhad, Iran, for financial support (Grant ID: 4020802). The authors declare no competing interests.<h4>Registration number</h4>N/A.

Also flagged:ossificationmineralgrowth disordersgenetic disorderssystemic diseasesmalnutrition
Journal Article 2024-11-21 No Snippets Hernández-García F, Fernández-Iglesias Á, Rodríguez Suárez J, Gil Peña H, López JM, Pérez RF.
Show Full Abstract

While the flat bones of the face, most of the cranial bones, and the clavicles are formed directly from sheets of undifferentiated mesenchymal cells, most bones in the human body are first formed as cartilage templates. Cartilage is subsequently replaced by bone via a very tightly regulated process termed endochondral ossification, which is led by chondrocytes of the growth plate (GP). This process requires continuous communication between chondrocytes and invading cell populations, including osteoblasts, osteoclasts, and vascular cells. A deeper understanding of these signaling pathways is crucial not only for normal skeletal growth and maturation but also for their potential relevance to pathophysiological processes in bones and joints. Due to limited information on the communication between chondrocytes and other cell types in developing bones, this review examines the current knowledge of how interactions between chondrocytes and bone-forming cells modulate bone growth.

bioRxiv 2024-11-21 Preprint (No Snippets API) Cleven A, Meringa AD, Brazda P, Fasci D, Koorman T, Aarts T, Johanna I, Beringer DX, Hernandez-Lopez P, Heijhuurs S, Mizutani T, Lim S, Huismans M, Bernink J, Diaz DV, Wu W, Jose ES, Schipper J, Tsakirakis N, Hoorens van Heyningen L, Nouwens A, Gatti L, Straetemans T, Snippert H, Roodhart J, Derksen PW, Drost J, Altelaar M, Heck AJ, Clevers H, Kuball J, Sebestyen Z.
Show Full Abstract

<h4>ABSTRACT</h4> Vγ9Vδ2T cells have the unique ability to recognize a broad range of malignant transformed cells. The tumor targeting event involving BTN2A1 and BTN3A1 dimers on the tumor cell surface is critical, leading to full activation of the TCR. Although the molecular mechanisms governing TCR engagement and T cell activation are well-characterized, the role of Vγ9Vδ2 T cells in cancer immune surveillance remains to be fully elucidated, particularly the mechanisms that enable these cells to discriminate between healthy and malignant cells at an early stage of malignant transformation. We employed two independent, genetically engineered step-wise mutagenesis models of human colorectal and breast cancer that mimic the transformation steps leading to tumor formation. We demonstrate that various single oncogenic mutations introduced into healthy organoids or cells, are sufficient to upregulate surface expressed BTN2A1 and enable Vγ9Vδ2 TCR binding to tumor cells. However, full activation of T cells through a Vγ9Vδ2TCR required additional subsequent phosphorylation of juxtamembrane (JTM) amino acids of BTN3A1, leading to the activating heterodimerization of BTN2A1 and 3A1. Using a protein interactome mapping pipeline, we identified PHLDB2, SYNJ2 and CARMIL1 as key players in controlling these delicate dual surface dynamics of BTN2A1 and 3A1 during early transformation. This mode of action allowed Vγ9Vδ2TCR T cells to control tumors in vitro and in vivo, emphasizing the crucial role of these molecules from early mutagenesis, to advanced cancer stages, and highlighting the therapeutic potential of a Vγ9Vδ2TCR.

Also flagged:myotonic dystrophy type 1craminochromosomesex chromosomesbindingsCas9
Journal Article 2024-11-20 No Snippets De Coster W, Höijer I, Bruggeman I, D'Hert S, Melin M, Ameur A, Rademakers R.
Show Full Abstract

The lack of population-scale databases hampers research and diagnostics for medically relevant tandem repeats and repeat expansions. We attempt to fill this gap using our pathSTR web tool, which leverages long-read sequencing of large cohorts to determine repeat length and sequence composition in a healthy population. The current version includes 1040 individuals of The 1000 Genomes Project cohort sequenced on the Oxford Nanopore Technologies PromethION. A comprehensive set of medically relevant tandem repeats has been genotyped using STRdust and LongTR to determine the tandem repeat length and sequence composition. PathSTR provides rich visualizations of this data set and the feature to upload one's data for comparison along the control cohort. We demonstrate the implementation of this application using data from targeted nanopore sequencing of a patient with myotonic dystrophy type 1. This resource will empower the genetics community to get a more complete overview of normal variation in tandem repeat length and sequence composition and, as such, enable a better assessment of rare tandem repeat alleles observed in patients.

PRDX6
Also flagged:Necrotizing enterocolitisNEChemenitrogenpurine nucleotidebiosynthesis
Journal Article 2024-11-20 ✓ 1 Snippet Chen F, Tan K, Lv Z, Chen F, Xu W, Gong X, Lu L, Sun H, Fu Q, Zhuang W.
In-Text Gene Mentions

…in GAPDH andPRDX6between non-NEC and…

Show Full Abstract

Necrotizing enterocolitis (NEC) is a life-threatening condition affecting preterm infants, sometimes necessitating surgical treatment. This study aimed to analyze differentially expressed proteins (DEPs) and access their biological and clinical significance in the plasma of neonates with NEC. Peripheral blood samples were collected from NEC infants at various time points, and plasma was separated. Data-independent acquisition (DIA) technology was utilized to identify DEPs among NEC patients at different stages. Bioinformatic analyses, including Gene Ontology and Kyoto Encyclopedia of Genes and Genomes, and protein-to-protein interaction analyses were performed on the DEPs. External datasets, along with receiver operating characteristic curves and gene set enrichment analysis, were used to clinically and biologically validate the findings. DEPs between the NEC and pre-NEC groups indicated reduced protein, heme, nitrogen, and purine nucleotide biosynthesis during NEC formation. In addition, enriched DEPs among the NEC groups at different time points suggested reconstructed extracellular matrix, aberrant B-lymphocyte immune responses, and decreased glycosaminoglycan levels during NEC progression. These findings were both clinically and biologically validated using external datasets. Our study highlights the clinical and biological relevance of proteomics in NEC patients. This study demonstrates key pathways involved in NEC pathogenesis and establishes DIA mass spectrometry as a powerful and noninvasive tool for evaluating and predicting NEC formation and progression.

HTT
Also flagged:neurodegenerative disorderphosphorylationmicrotubule-associated protein Tauubiquitinproteasome
Journal Article 2024-11-20 ✓ 1 Snippet Qin B, Chen X, Wang F, Wang Y.
In-Text Gene Mentions

…clusion bodies (polyQ-expandedHtt) [ 5 ],…

Show Full Abstract

Alzheimer's disease (AD) is a prevalent neurodegenerative disorder characterized by the accumulation of amyloid β protein (Aβ) and the hyper-phosphorylation of the microtubule-associated protein Tau. The ubiquitin-proteasome system (UPS) plays a pivotal role in determining the fate of proteins, and its dysregulation can contribute to the buildup of Aβ and Tau. Deubiquitinating enzymes (DUBs), working in conjunction with activating enzymes (E1), ubiquitin-conjugating enzymes (E2), and ubiquitin ligases (E3), actively maintain the delicate balance of protein homeostasis. DUBs specifically remove ubiquitin tags from proteins marked for degradation, thereby averting their proteasomal breakdown. Several DUBs have demonstrated their capacity to regulate the levels of Aβ and Tau by modulating their degree of ubiquitination, underscoring their potential as therapeutic targets for AD. In this context, we present a comprehensive review of AD-associated DUBs and elucidate their physiological roles. Moreover, we delve into the current advancements in developing inhibitors targeting these DUBs, including the determination of cocrystal structures with their respective targets. Additionally, we assess the therapeutic efficacy of these inhibitors in AD, aiming to establish a theoretical foundation for future AD treatments.

Also flagged:metalsgadoliniummembranelanthanideslanthanumreceptor
Journal Article 2024-11-20 No Snippets Valdés JJ, Petrash DA, Konhauser KO.
Show Full Abstract

Investigating microorganisms in metal-enriched environments holds the potential to revolutionize the sustainable recovery of critical metals such as lanthanides (Ln<sup>3+</sup>). We observe Hyphomicrobium spp. as part of a Fe<sup>2+</sup>/Mn<sup>2+</sup>-oxidizing consortia native to the ferruginous bottom waters of a Ln<sup>3+</sup>-enriched lake in Czechia. Notably, one species shows similarities to recently discovered bacteria expressing proteins with picomolar Ln<sup>3+</sup> affinity. This finding was substantiated by developing an in-silico ionic competition model and recombinant expression of a homolog protein (Hm-LanM) from Hyphomicrobium methylovorum. Biochemical assays validate Hm-LanM preference for lighter Ln<sup>3+</sup> ions (from lanthanum to gadolinium). This is comparable to established prototypes. Bioinformatics analyses further uncover additional H. methylovorum metabolic biomolecules in genomic proximity to Hm-LanM analogously dependent on Ln<sup>3+</sup>, including an outer membrane receptor that binds Ln<sup>3+</sup>-chelating siderophores. These combined observations underscore the remarkable strategy of Hyphomicrobium spp. for thriving in relatively Ln<sup>3+</sup> enriched zones of metal-polluted environments.

DNAH10
Also flagged:localizationorganellesspermatogenesisacrosome reactioncapacitationbinding
Journal Article 2024-11-20 ✓ 1 Snippet Bhushan V, Ali SA, Parashar A, Kumar S, Mohanty AK.
In-Text Gene Mentions

…family proteins (DNAH17,DNAH10, DNAH11), 60 SUN5,…

Show Full Abstract

Proteomic analysis of sperm cells offers significant insights into proteins' structural, functional, and localization aspects within biological systems. Sahiwal, a native Indian cattle breed, is well known for its disease resistance, calving ease, and resilience to drought. This study addressed the gap in Sahiwal's comprehensive sperm proteome profiling data. The research involved the global in-silico quantitative high-resolution mass spectrometry-based protein profiling of Indian Zebu sperm, identifying 4651 sperm proteins. Beyond mere identification, the study characterized these proteins at a sub-organellar level to facilitate a better understanding of their functional attributes. Gene Ontology analysis of sperm proteins facilitated the segregation of proteins based on their function, localization, and mode of action. The study revealed that despite the limited number of organelles, sperm cells encapsulate a wide array of crucial proteins, compensating for the deficiency of organelles through the presence of multifunctional proteins. Most identified sperm proteins actively participate in spermatogenesis, motility, acrosome reaction, capacitation, and seminal plasma binding, directly or indirectly. Notably, the results not only present the highest number of identified bovine sperm proteins but also hold the potential to pave the way for empirical research on sperm functionality, egg-sperm interaction, sperm-sex sorting biomarkers, sperm quality, and bull fertility.

HFE
Also flagged:heart failuremyocardial infarctionMIsotagliflozintype 2 diabetes mellituscardiovascular
Journal Article 2024-11-20 ✓ 3 Snippets Liao J, Chen Y, Ling Z, Pürerfellner H, Martinek M, Derndorfer M, Niel J, Ebrahimi R, Heukäufer M, Janschel S, Di Vece D, Empen K, Hummel A, Chamling B, Futyma P, Ebrahimi F, Kiuchi MG, Liu S, Yin Y, Schratter A, Acou WJ, Sommer P, Schmidt B, Chun JKR, Meyer C, Dörr M, Templin C, Chen S.
In-Text Gene Mentions

…2 = 0%),HFE(RR: 0.72, 95%…

…of SGLTi onHFEwas more pronounced…

…of diabetes onHFEis shown in…

Show Full Abstract

<h4>Aims</h4>Sodium-glucose co-transporter inhibitors (SGLTis) have cardiovascular protective effects. We aimed to assess the effects of SGLTis on individual hard clinical endpoints and quality of life (QoL) in patients with cardiovascular risk factors.<h4>Methods and results</h4>Data was searched in PubMed, Embase, Cochrane Library and clinicaltrials.gov databases up to February 2024. Randomized controlled trials (RCTs) comparing SGLTis with placebo were included. The primary outcomes were individual hard clinical endpoints (Subset A) and QoL (Subset B). For Subset A, 13 RCTs including 90 413 patients were enrolled (age 66 ± 10.1 years, 35.7% female, follow-up 2.4 ± 0.3 years); as compared with placebo, SGLTis were associated with significantly lower risk of all-cause mortality [risk ratio (RR): 0.90, 95% confidence interval (CI): 0.86-0.94, P < 0.01], cardiovascular mortality (RR: 0.87, 95% CI: 0.82-0.92, P < 0.01), hospitalization for heart failure (HF) (RR: 0.72, 95% CI: 0.68-0.76, P < 0.01), HF events (RR: 0.72, 95% CI: 0.68-0.75, P < 0.01), hospitalization for any cause (RR: 0.91, 95% CI: 0.88-0.93, P < 0.01) and myocardial infarction (MI) (RR: 0.92, 95% CI: 0.85-0.99, P = 0.03). Notably, the favourable effect of SGLTis on all-cause mortality was more pronounced in younger (<65 years) patients (RR: 0.86, 95% CI: 0.81-0.92) and in studies with less female (RR: 0.84, 95% CI: 0.79-0.90). The favourable effect of SGLTis on MI was only observed in patients who received sotagliflozin (RR: 0.47, 95% CI: 0.31-0.73). For Subset B, nine RCTs including 2552 HF patients were enrolled (age 67.8 ± 12.4 years, 36.4% female, follow-up 3.4 ± 1.9 months); SGLTis were associated with significant improvement in QoL as compared with placebo.<h4>Conclusions</h4>In patients with a broad spectrum of cardiovascular risk factors, SGLTis substantially improve individual hard clinical outcomes and QoL.

Also flagged:reflexgaze stabilization reflextranscription factorsneuron-nucleus
Journal Article 2024-11-20 No Snippets Goldblatt D, Rosti B, Hamling KR, Leary P, Panchal H, Li M, Gelnaw H, Huang S, Quainoo C, Schoppik D.
Show Full Abstract

Sensorimotor reflex circuits engage distinct neuronal subtypes, defined by precise connectivity, to transform sensation into compensatory behavior. Whether and how motor neuron populations specify the subtype fate and/or sensory connectivity of their pre-motor partners remains controversial. Here, we discovered that motor neurons are dispensable for proper connectivity in the vestibular reflex circuit that stabilizes gaze. We first measured activity following vestibular sensation in pre-motor projection neurons after constitutive loss of their extraocular motor neuron partners. We observed normal responses and topography indicative of unchanged functional connectivity between sensory neurons and projection neurons. Next, we show that projection neurons remain anatomically and molecularly poised to connect appropriately with their downstream partners. Lastly, we show that the transcriptional signatures that typify projection neurons develop independently of motor partners. Our findings comprehensively overturn a long-standing model: that connectivity in the circuit for gaze stabilization is retrogradely determined by motor partner-derived signals. By defining the contribution of motor neurons to specification of an archetypal sensorimotor circuit, our work speaks to comparable processes in the spinal cord and advances our understanding of principles of neural development.

TNFSF4BTN2A1
Also flagged:cancerCNC-bZIPstranscription factortumortumorsgene expression
Journal Article 2024-11-20 ✓ 5 Snippets Ning H, Yang Q, Ren Y, Qiu L.
In-Text Gene Mentions

…cells are largelyBTN2A1, CD40, CD48, CD70,…

…CD48, CD70, ICOSLG,TNFSF4, TNFSF9, TNFSF15, TNFSF18,…

…ICMs (such asBTN2A1, CD40, CD48, CD70,…

…CD48, CD70, ICOSLG,TNFSF4/OX40L, TNFSF9/41BBL, TNFSF15,…

…generally correlated withBTN2A1and TNFSF15, NFE2L2…

Show Full Abstract

<h4>Background</h4>Although oxidative stress is strongly connected to the initiation and progression of cancer, the underlying molecular pathways remain unknown. The redox regulator CNC-bZIPs are important transcription factor groups that mediate the interplay of environmental cues and intercellular homeostasis. Immune checkpoint molecules (ICMs) are key molecules that mediate the communication between immune cells and tumor cells. This research sought to explore the transcriptional regulatory effects of CNC-bZIPs on ICMs.<h4>Methods</h4>The potential role of CNC-bZIPs in tumors and the correlation between CNC-bZIPs and ICMs were analyzed by the gene expression characteristics, survival analysis, and correlation analysis in TCGA data. And the transcriptional regulatory effects of CNC-bZIPs on ICMs were verified through cis acting element analysis and promoter activity reporter experiments.<h4>Results</h4>In this study, we found that high expression of CNC-bZIPs predicted poor prognosis, and we determined that CNC-bZIPs are universally connected to ICMs by analyzing gene expression correlation in TCGA tumor data. Specifically, CD47 and CD274 exhibit universally positive correlation with CNC-bZIPs in various tumor tissues. Promoter analysis revealed that there are several ARE elements, which are specifically recognized by CNC-bZIPs, in the promoter regions of CD47 and CD274 genes. Overexpression of NFE2L1 and NFE2L2 was used to explore the regulation of common ICM genes, such as CD47 and CD274, and the transcriptional regulatory effect of CNC-bZIPs on ICMs was confirmed using promoter activity reporter experiments.<h4>Conclusion</h4>In this study, the universal and systematic transcriptional regulatory role of the CNC-bZIP transcription factor family on ICMs was discovered. According to this study, the results and conclusions drawn are based on gene expression correlation and promoter activity assays, the CNC-bZIPs/ICMs transcriptional regulatory axis was revealed to be a potential regulatory axis that may drive redox signaling and anti-tumor immune responses.

Also flagged:OX40OX40LAtopic DermatitisADchronic inflammatory skin diseaseantibodies
Journal Article 2024-11-20 No Snippets Abdelhalim A, Yilmaz O, Elshaikh Berair M, Torres T.
Show Full Abstract

Atopic dermatitis (AD) is a common chronic inflammatory skin disease involving complex immune dysregulation, including the OX40-OX40L pathway. Rocatinlimab and amlitelimab, monoclonal antibodies targeting OX40 and OX40L, respectively, have shown promise in treating moderate-to-severe AD. Both therapies have demonstrated significant efficacy in reducing disease severity, with favorable safety profiles and no serious treatment-related adverse events. Both treatments outperformed placebo across key clinical endpoints, including skin clearance and symptom reduction, highlighting their potential as effective AD therapies. Although initial results are promising, further research is needed to evaluate the long-term effects, durability of response, and safety of these treatments. These findings support the therapeutic potential of targeting the OX40-OX40L pathway in AD, providing new options for patients with moderate-to-severe disease, with ongoing trials necessary to confirm their sustained benefits.

B4GALT5
Also flagged:parathyroid neoplasmsglycosylationsglycoproteinslectincancersparathyroid adenoma
Journal Article 2024-11-20 ✓ 4 Snippets Zheng Q, Cui M, Xiao J, Yang S, Chen T, Shi Y, Hu Y, Liao Q.
In-Text Gene Mentions

…1 (XYLT1) andBeta-1,4-Galactosyltransferase 55 (B4GALT5) were…

…-1,4-Galactosyltransferase 5 (B4GALT5) were upregulated in…

…Notably, XYLT1 andB4GALT5were the most…

B4GALT5is primarily responsible…

Show Full Abstract

<h4>Purpose</h4>Parathyroid carcinoma (PC) is a rare malignancy with a poor prognosis. Diagnosis of PC is often difficult in clinical practice and efficient diagnostic markers are still needed for differential diagnosis. Aberrant glycosylations of glycoproteins were identified with lectin microarray in various cancers, while relevant information is lacking in PC.<h4>Methods</h4>In this study, 8 PC and 6 parathyroid adenoma (PA) tissues were assessed using a microarray consisting of 70 lectins. Overall lectin-specific glycosylation patterns were compared between PA and PC tissues. Lectins with significant differential response between PC and PA were further validated by lectin histochemistry.<h4>Results</h4>The difference in signal intensities was found in 71.4% (50/70) of the lectins between the two groups (P < 0.05). The vast majority of PCs had higher intensity signals than PAs (PCs vs. PAs, ratio >1) and amaranthus caudatus (ACL) showed the most significantly different response between them (ratio = 2.45). Lectin histochemistry further confirmed higher ACL intensity in PCs than in PAs. The differentially expressed glycans in PC tissues were primarily glucose, mannose, and galactose-based.<h4>Conclusion</h4>PC presented unique glycomic features and ACL may serve as a candidate diagnostic marker for PC.

Also flagged:Cdk8 kinasegene expressionRNA polymerase IIRNA Pol IIMediatorCKM
Journal Article 2024-11-20 No Snippets Friedson B, Willis SD, Shcherbik N, Campbell AN, Cooper KF.
Show Full Abstract

Survival following stress is dependent upon reprogramming transcription and translation. Communication between these programs following stress is critical for adaptation but is not clearly understood. The Cdk8 kinase module (CKM) of the Mediator complex modulates the transcriptional response to various stresses. Its involvement in regulating translational machinery has yet to be elucidated, highlighting an existing gap in knowledge. Here, we report that the CKM positively regulates a subset of ribosomal protein (RP) and translation initiation factor (TIF)-encoding genes under physiological conditions in Saccharomyces cerevisiae. In mouse embryonic fibroblasts and HCT116 cells, the CKM regulates unique sets of RP and TIF genes, demonstrating some conservation of function across species. In yeast, this is mediated by Cdk8 phosphorylation of one or more transcription factors which control RP and TIF expression. Conversely, the CKM is disassembled following nutrition stress, permitting repression of RP and TIF genes. The CKM also plays a transcriptional role important for promoting cell survival, particularly during translational machinery stress triggered by ribosome-targeting antibiotics. Furthermore, in mammalian cells, the activity of CDK8 and its paralogue, CDK19, promotes cell survival following ribosome inhibition. These results provide mechanistic insights into the CKM's role in regulating expression of a subset of genes associated with translation.

Also flagged:Cas9genetic disordersHLACYP2D6pore
Journal Article 2024-11-20 No Snippets Iyer SV, Goodwin S, McCombie WR.
Show Full Abstract

Long-read sequencing technologies have improved the contiguity and, as a result, the quality of genome assemblies by generating reads long enough to span and resolve complex or repetitive regions of the genome. Several groups have shown the power of long reads in detecting thousands of genomic and epigenomic features that were previously missed by short-read sequencing approaches. While these studies demonstrate how long reads can help resolve repetitive and complex regions of the genome, they also highlight the throughput and coverage requirements needed to accurately resolve variant alleles across large populations using these platforms. At the time of this review, whole-genome long-read sequencing is more expensive than short-read sequencing on the highest throughput short-read instruments; thus, achieving sufficient coverage to detect low-frequency variants (such as somatic variation) in heterogenous samples remains challenging. Targeted sequencing, on the other hand, provides the depth necessary to detect these low-frequency variants in heterogeneous populations. Here, we review currently used and recently developed targeted sequencing strategies that leverage existing long-read technologies to increase the resolution with which we can look at nucleic acids in a variety of biological contexts.

STAU1
Also flagged:nucleotidegene expressionchromatinchromosomesdegradationreverse transcription
Journal Article 2024-11-20 ✓ 1 Snippet Wu H, Yu H, Zhang Y, Yang B, Sun W, Ren L, Li Y, Li Q, Liu B, Ding Y, Zhang H.
In-Text Gene Mentions

…factors, such asSTAU1in humans, often…

Show Full Abstract

Despite the critical role of mRNA stability in post-transcriptional gene regulation, research on this topic in wheat, a vital agricultural crop, remains unclear. Our study investigated the mRNA decay landscape of durum wheat (Triticum turgidum L. ssp. durum, BBAA), revealing subgenomic asymmetry in mRNA stability and its impact on steady-state mRNA abundance. Our findings indicate that the 3' UTR structure and homoeolog preference for RNA structural motifs can influence mRNA stability, leading to subgenomic RNA decay imbalance. Furthermore, single-nucleotide variations (SNVs) selected for RNA structural motifs during domestication can cause variations in subgenomic mRNA stability and subsequent changes in steady-state expression levels. Our research on the transcriptome stability of polyploid wheat highlights the regulatory role of non-coding region structures in mRNA stability, and how domestication shaped RNA structure, altering subgenomic mRNA stability. These results illustrate the importance of RNA structure-mediated post-transcriptional gene regulation in wheat and pave the way for its potential use in crop improvement.

NEGR1
Also flagged:HOXgene expressiontranscription factorsbindingchromosomesCTCF
Journal Article 2024-11-20 ✓ 1 Snippet Lawrence JEG, Roberts K, Tuck E, Li T, Mamanova L, Balogh P, Usher I, Piapi A, Mazin P, Anderson ND, Bolt L, Richardson L, Prigmore E, He X, Barker RA, Flanagan A, Young MD, Teichmann SA, Bayraktar O, Behjati S.
In-Text Gene Mentions

…cell adhesion moleculeNEGR139 – 41…

Show Full Abstract

Positional coding along the anterior-posterior axis is regulated by HOX genes, whose 3' to 5' expression correlates with location along this axis. The precise utilisation of HOX genes in different human cell types is not fully understood. Here, we use single-cell and spatial-transcriptomics, along with in-situ sequencing, to create a developmental atlas of the human fetal spine. We analyse HOX gene expression across cell types during development, finding that neural-crest derivatives unexpectedly retain the anatomical HOX code of their origin while also adopting the code of their destination. This trend is confirmed across multiple organs. In the axial plane of the spinal cord, we find distinct patterns in the ventral and dorsal domains, providing insights into motor pool organisation and loss of collinearity in HOXB genes. Our findings shed new light on HOX gene expression in the developing spine, highlighting a HOX gene 'source code' in neural-crest cell derivatives.

OLFM4
Also flagged:DAOAobesitySEC16BchromosomeARADCY3
Journal Article 2024-11-20 ✓ 1 Snippet Burrows K, Heiskala A, Bradfield JP, Balkhiyarova Z, Ning L, Boissel M, Chan YM, Froguel P, Bonnefond A, Hakonarson H, Alves AC, Lawlor DA, Kaakinen M, Järvelin MR, Grant SFA, Tilling K, Prokopenko I, Sebert S, Canouil M, Warrington NM.
In-Text Gene Mentions

…the SEC16B, ADCY3,OLFM4and FTO loci…

Show Full Abstract

Genetic effects on changes in human traits over time are understudied and may have important pathophysiological impact. We propose a framework that enables data quality control, implements mixed models to evaluate trajectories of change in traits, and estimates phenotypes to identify age-varying genetic effects in GWAS. Using childhood BMI as an example trait, we included 71,336 participants from six cohorts and estimated the slope and area under the BMI curve within four time periods (infancy, early childhood, late childhood and adolescence) for each participant, in addition to the age and BMI at the adiposity peak and the adiposity rebound. GWAS of the 12 estimated phenotypes identified 28 genome-wide significant variants at 13 loci, one of which (in DAOA) has not been previously associated with childhood or adult BMI. Genetic studies of changes in human traits over time could uncover unique biological mechanisms influencing quantitative traits.

SUDS3
Also flagged:EZH2castration-resistant prostate cancerCRPCprotein kinasephosphorylationenhancer of zeste homolog 2
Journal Article 2024-11-20 ✓ 1 Snippet Chatterjee SS, Linares JF, Cid-Diaz T, Duran A, Khan MIK, Osrodek M, Brady NJ, Reina-Campos M, Marzio A, Venkadakrishnan VB, Bakht MK, Khani F, Mosquera JM, Robinson BD, Moyer J, Elemento O, Hsieh AC, Goodrich DW, Rickman DS, Beltran H, Moscat J, Diaz-Meco MT.
In-Text Gene Mentions

…of the canonicalpolycomb repressiverepressive complex (PRC2).…

Show Full Abstract

Overcoming resistance to therapy is a major challenge in castration-resistant prostate cancer (CRPC). Lineage plasticity towards a neuroendocrine phenotype enables CRPC to adapt and survive targeted therapies. However, the molecular mechanisms of epigenetic reprogramming during this process are still poorly understood. Here we show that the protein kinase PKCλ/ι-mediated phosphorylation of enhancer of zeste homolog 2 (EZH2) regulates its proteasomal degradation and maintains EZH2 as part of the canonical polycomb repressive complex (PRC2). Loss of PKCλ/ι promotes a switch during enzalutamide treatment to a non-canonical EZH2 cistrome that triggers the transcriptional activation of the translational machinery to induce a transforming growth factor β (TGFβ) resistance program. The increased reliance on protein synthesis creates a synthetic vulnerability in PKCλ/ι-deficient CRPC.

DCC
Also flagged:surgical site infectioninfectionpancreatic fistulaappendicitisperitonitisPD
Journal Article 2024-11-20 ✓ 1 Snippet Yang Y, Sheng J, Lu C, Cheng H, Li G, Mao L, Chen C, Qiu Y, Liu C, Fu X.
In-Text Gene Mentions

…There were 32(30.5%) patients diagnosed with pancreatic ductal adenocarcinoma (PDAC), 41(39.0%) with Vater’s ampullary carcinoma (VAC), and 8(7.6%) withdistal cholangiocarcinoma(DCC).…

Show Full Abstract

Organ/space surgical site infection (SSI) are common after pancreaticoduodenectomy (PD). There is limited research on the clinical impact of intraoperative lavage fluid contamination in patients undergoing PD. One hundred five patients who underwent PD between August 2022 and July 2023 were retrospectively enrolled. The intraoperative bile and peritoneal lavage were collected for bacterial culture. Postoperative drainage bacterial cultures were performed every 2-3 days thereafter until drains were all removed. The bacteria isolated from intraoperative lavage fluid, intraoperative bile, and postoperative drainage fluid were examined in detail. The risk factors associated with positive intraoperative lavage fluid culture were analyzed through both univariate and multivariate analyses. Organ/space SSI occurred in 59(56.2%) of the 105 patients. The positivity rates of cultures in intraoperative lavage fluid, intraoperative bile, and postoperative drainage fluid were found to be 41.0%, 67.6%, and 84.8%, respectively. Patients with positive intraoperative lavage fluid culture had a significantly higher occurrence of organ/space SSI compared to the negative group (69.0% vs. 29.4%, P < 0.001). Preoperative biliary drainage (PBD) was identified as the only independent risk factor for the contamination of intraoperative lavage fluid (OR = 7.687, 95% CI: 2.164-27.300, P = 0.002). K. pneumoniae was the most common isolates both in the intraoperative lavage fluid and postoperative drainage fluid. Intraoperative lavage fluid contamination closely correlated with organ/space SSI after PD. Meanwhile, PBD was the only risk factor for the contamination of intraoperative lavage fluid.

Also flagged:collagenmineralbone formationbioapatiteType I collagenacetic acid
Journal Article 2024-11-20 No Snippets Robin M, Mouloungui E, Castillo Dali G, Wang Y, Saffar JL, Pavon-Djavid G, Divoux T, Manneville S, Behr L, Cardi D, Choudat L, Giraud-Guille MM, Meddahi-Pellé A, Baudimont F, Colombier ML, Nassif N.
Show Full Abstract

Autologous bone (AB) is the gold standard for bone-replacement surgeries<sup>1</sup>, despite its limited availability and the need for an extra surgical site. Traditionally, competitive biomaterials for bone repair have focused on mimicking the mineral aspect of bone, as evidenced by the widespread clinical use of bioactive ceramics<sup>2</sup>. However, AB also exhibits hierarchical organic structures that might substantially affect bone regeneration. Here, using a range of cell-free biomimetic-collagen-based materials in murine and ovine bone-defect models, we demonstrate that a hierarchical hybrid microstructure-specifically, the twisted plywood pattern of collagen and its association with poorly crystallized bioapatite-favourably influences bone regeneration. Our study shows that the most structurally biomimetic material has the potential to stimulate bone growth, highlighting the pivotal role of physicochemical properties in supporting bone formation and offering promising prospects as a competitive bone-graft material.

OLFM4
Also flagged:Liver X receptortumourLXRCYP27A1colorectal cancerCD8
Journal Article 2024-11-20 ✓ 4 Snippets Das S, Parigi SM, Luo X, Fransson J, Kern BC, Okhovat A, Diaz OE, Sorini C, Czarnewski P, Webb AT, Morales RA, Lebon S, Monasterio G, Castillo F, Tripathi KP, He N, Pelczar P, Schaltenberg N, De la Fuente M, López-Köstner F, Nylén S, Larsen HL, Kuiper R, Antonson P, Hermoso MA, Huber S, Biton M, Scharaw S, Gustafsson JÅ, Katajisto P, Villablanca EJ.
In-Text Gene Mentions

…PBS with rabbit anti-OLFM4(1:300, Cell Signalling),…

…of BrdU +Olfm4+ and Olfm4…

…Olfm4 + andOlfm4+ cells from…

…ATGGTCA, AAGAACATGACAGGCGGGTT;Olfm4, TGCTCCTGGAAGCTGTAGTCA, TGTAT…

Show Full Abstract

Uncontrolled regeneration leads to neoplastic transformation<sup>1-3</sup>. The intestinal epithelium requires precise regulation during continuous homeostatic and damage-induced tissue renewal to prevent neoplastic transformation, suggesting that pathways unlinking tumour growth from regenerative processes must exist. Here, by mining RNA-sequencing datasets from two intestinal damage models<sup>4,5</sup> and using pharmacological, transcriptomics and genetic tools, we identified liver X receptor (LXR) pathway activation as a tissue adaptation to damage that reciprocally regulates intestinal regeneration and tumorigenesis. Using single-cell RNA sequencing, intestinal organoids, and gain- and loss-of-function experiments, we demonstrate that LXR activation in intestinal epithelial cells induces amphiregulin (Areg), enhancing regenerative responses. This response is coordinated by the LXR-ligand-producing enzyme CYP27A1, which was upregulated in damaged intestinal crypt niches. Deletion of Cyp27a1 impaired intestinal regeneration, which was rescued by exogenous LXR agonists. Notably, in tumour models, Cyp27a1 deficiency led to increased tumour growth, whereas LXR activation elicited anti-tumour responses dependent on adaptive immunity. Consistently, human colorectal cancer specimens exhibited reduced levels of CYP27A1, LXR target genes, and B and CD8 T cell gene signatures. We therefore identify an epithelial adaptation mechanism to damage, whereby LXR functions as a rheostat, promoting tissue repair while limiting tumorigenesis.

PRDX6
Also flagged:lysine-specific demethylase 1dysfunction steatotic liver diseasenon-alcoholic fatty liver diseaseNAFLDCHSsaponin
Journal Article 2024-11-20 ✓ 1 Snippet Liu YW, Luo RY, Liu AQ, Wang JW, Hu NP, Li WT, Li JK, Wang JW, Duan JL.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Diet-induced metabolic dysfunction steatotic liver disease (MASLD) is also called as non-alcoholic fatty liver disease (NAFLD) with limited effective strategies available. We previously have shown that chikusetsusaponin IVa (CHS), a dietary saponin from herbs in South American known for their metabolic benefits, mitigates diet-induced diabetes. In this study we investigated the beneficial effects of CHS on MASLD and the underlying mechanisms. MAFLD mouse model was established by the high-fat diet (HFD) for 6 weeks and then were treated with CHS (50 mg·kg<sup>-1</sup>·d<sup>-1</sup>, i.g.) for another 8 weeks. By conducting transcriptomic analysis in palmitic acid-treated HepG2 cells and primary hepatocytes as well as lipidomic analysis in liver tissues, we demonstrated that HFD activated the intestinal farnesoid X receptor (FXR) pathway, leading to the release of FGF15/19, which in turn promoted hepatic FXR-SHP binding with cAMP-responsive element-binding protein H (CREBH), thereby inhibiting CREBH-mediated fatty acid oxidation (FAO) and ketogenesis. Intriguingly, we found that CHS improved lipid metabolism in HFD mice by suppressing the enterohepatic crosstalk of FXR-SHP to enhance CREBH transactivation. Among these, lysine-specific demethylase 1 (LSD1)-mediated histone demethylation played a crucial role in lipid metabolic reprogramming. Moreover, we identified LSD1 as a critical cellular target of CHS, directly binding to Lys661 and Tyr761 of LSD1 to inhibit its histone demethylation activity. Our results suggest that targeting intestinal LSD1 with CHS could be a promising strategy for MAFLD treatment, offering new insights into the bioavailability and efficacy of natural products.

OLFM4
Also flagged:gastrointestinal diseasegastrointestinal cancerscoeliac diseaseintestinal inflammatory diseasesinflammatory gut diseasesgastrointestinal diseases
Journal Article 2024-11-20 ✓ 1 Snippet Oliver AJ, Huang N, Bartolome-Casado R, Li R, Koplev S, Nilsen HR, Moy M, Cakir B, Polanski K, Gudiño V, Melón-Ardanaz E, Sumanaweera D, Dimitrov D, Milchsack LM, FitzPatrick MEB, Provine NM, Boccacino JM, Dann E, Predeus AV, To K, Prete M, Chapman JA, Masi AC, Stephenson E, Engelbert J, Lobentanzer S, Perera S, Richardson L, Kapuge R, Wilbrey-Clark A, Semprich CI, Ellams S, Tudor C, Joseph P, Garrido-Trigo A, Corraliza AM, Oliver TRW, Hook CE, James KR, Mahbubani KT, Saeb-Parsy K, Zilbauer M, Saez-Rodriguez J, Høivik ML, Bækkevold ES, Stewart CJ, Berrington JE, Meyer KB, Klenerman P, Salas A, Haniffa M, Jahnsen FL, Elmentaite R, Teichmann SA.
In-Text Gene Mentions

…, RGMB andOLFM4.…

Show Full Abstract

The gastrointestinal tract is a multi-organ system crucial for efficient nutrient uptake and barrier immunity. Advances in genomics and a surge in gastrointestinal diseases<sup>1,2</sup> has fuelled efforts to catalogue cells constituting gastrointestinal tissues in health and disease<sup>3</sup>. Here we present systematic integration of 25 single-cell RNA sequencing datasets spanning the entire healthy gastrointestinal tract in development and in adulthood. We uniformly processed 385 samples from 189 healthy controls using a newly developed automated quality control approach (scAutoQC), leading to a healthy reference atlas with approximately 1.1 million cells and 136 fine-grained cell states. We anchor 12 gastrointestinal disease datasets spanning gastrointestinal cancers, coeliac disease, ulcerative colitis and Crohn's disease to this reference. Utilizing this 1.6 million cell resource (gutcellatlas.org), we discover epithelial cell metaplasia originating from stem cells in intestinal inflammatory diseases with transcriptional similarity to cells found in pyloric and Brunner's glands. Although previously linked to mucosal healing<sup>4</sup>, we now implicate pyloric gland metaplastic cells in inflammation through recruitment of immune cells including T cells and neutrophils. Overall, we describe inflammation-induced changes in stem cells that alter mucosal tissue architecture and promote further inflammation, a concept applicable to other tissues and diseases.

Also flagged:joint formationnucleusossificationlocalizationosteoarthritiscraniosynostosis
Journal Article 2024-11-20 No Snippets To K, Fei L, Pett JP, Roberts K, Blain R, Polański K, Li T, Yayon N, He P, Xu C, Cranley J, Moy M, Li R, Kanemaru K, Huang N, Megas S, Richardson L, Kapuge R, Perera S, Tuck E, Wilbrey-Clark A, Mulas I, Memi F, Cakir B, Predeus AV, Horsfall D, Murray S, Prete M, Mazin P, He X, Meyer KB, Haniffa M, Barker RA, Bayraktar O, Chédotal A, Buckley CD, Teichmann SA.
Show Full Abstract

Human embryonic bone and joint formation is determined by coordinated differentiation of progenitors in the nascent skeleton. The cell states, epigenetic processes and key regulatory factors that underlie lineage commitment of these cells remain elusive. Here we applied paired transcriptional and epigenetic profiling of approximately 336,000 nucleus droplets and spatial transcriptomics to establish a multi-omic atlas of human embryonic joint and cranium development between 5 and 11 weeks after conception. Using combined modelling of transcriptional and epigenetic data, we characterized regionally distinct limb and cranial osteoprogenitor trajectories across the embryonic skeleton and further described regulatory networks that govern intramembranous and endochondral ossification. Spatial localization of cell clusters in our in situ sequencing data using a new tool, ISS-Patcher, revealed mechanisms of progenitor zonation during bone and joint formation. Through trajectory analysis, we predicted potential non-canonical cellular origins for human chondrocytes from Schwann cells. We also introduce SNP2Cell, a tool to link cell-type-specific regulatory networks to polygenic traits such as osteoarthritis. Using osteolineage trajectories characterized here, we simulated in silico perturbations of genes that cause monogenic craniosynostosis and implicate potential cell states and disease mechanisms. This work forms a detailed and dynamic regulatory atlas of bone and cartilage maturation and advances our fundamental understanding of cell-fate determination in human skeletal development.

Also flagged:digestionsleepchronic diseasesepsispneumoniafailure
Journal Article 2024-11-20 No Snippets Maximino P, van Lee L, Meijer-Krommenhoek YN, van der Zee L, da Costa Ribeiro Junior H.
Show Full Abstract

<h4>Objective</h4>To assess common gastrointestinal symptoms in healthy Brazilian infants receiving goat milk-based formula (GMF) compared to cow's milk-based formula (CMF).<h4>Methods</h4>We performed a 24-weeks double-blind, randomized, controlled study in Brazil, enrolling healthy infants from 3 to 12 months of age. Primary outcome were the gastrointestinal (GI) symptoms stool consistency, regurgitation frequency and crying duration. Secondary outcomes were growth trajectories and hemoglobin levels. Repeated mixed models were used to compare outcomes variables between GMF and CMF groups, while adjusting for age at baseline.<h4>Results</h4>Fifty-six infants were recruited and randomly allocated in the GMF (n = 26) and the CMF (n = 30) group. Scores on all measured GI symptoms were low and similar among the groups throughout intervention period and improved over time. Average age- and sex-adjusted WHO z-scores of weight, length, head circumference, and weight-for-length were all within +/-1 SD and similar between groups, indicating adequate growth. Serum hemoglobin was 11.1 (SD 0.7) g/dL in infants fed GMF and 11.0 (SD 0.8) g/dL in infants fed CMF after the intervention and was similar between groups.<h4>Conclusion</h4>GMF was well tolerated, safe and supported adequate growth in infants. This was shown by the low occurrence of GI symptoms, adequate blood hemoglobin levels and adequate growth within WHO standards.<h4>Trial registration</h4>The clinical trial was approved by the ethics committee of the Federal University of Bahia under number CAAE06923319.5.0000.5577. The study was retrospectively registered in clinicaltrials.gov on 02/05/2024 under identifier NCT06395571.

Also flagged:co-infectionpolyproteinsnsP4capsidE2E3
Journal Article 2024-11-20 No Snippets de Jesus ACP, Fonseca PLC, Alves HJ, Bonfim DM, Dutra JVR, Moreira FRR, de Brito Mendonça CPT, Rios JSH, do Prado Silva J, Malta FSV, Braga-Paz I, de Araújo JLF, de Oliveira JS, de Souza CSA, da Silva SEB, Chaves DCC, da Silva Carvalho R, de Oliveira ES, de Oliveira Ribeiro M, Arruda MB, Alvarez P, Moreira RG, de Souza RP, Zauli DAG, Aguiar RS.
Show Full Abstract

<h4>Background</h4>The rapid spread and increase of chikungunya (CHIKV) and dengue (DENV) cases in Brazilian regions in 2023 has raised concerns about the impact of arboviruses on public health. Epidemiological and genomic surveillance was performed to estimate the introduction and spread of CHIKV and DENV in Brazil.<h4>Methods</h4>This study obtained results from the Hermes Pardini (HP), a private medical laboratory, and the Health Department of Minas Gerais state (SES-MG). We investigated the positivity rates of CHIKV and DENV by analyzing the results of 139,457 samples tested for CHIKV (44,029 in 2022 and 95,428 in 2023) and 491,528 samples tested for DENV (163,674 in 2022 and 327,854 in 2023) across the five representative geographical regions of Brazil. Genome sequencing was performed on 80 CHIKV and 153 DENV samples that had been positive for RT-PCR tests.<h4>Results</h4>In our sampling, the data from CHIKV tests indicated that the Northeast region had the highest regional positivity rate in 2022 (58.1%). However, in 2023, the Southeast region recorded the highest positivity rate (40.5%). With regard to DENV, the South region exhibited the highest regional positivity rate in both 2022 (40.8%) and 2023 (22.7%), followed by the Southeast region in both years (34.8% in 2022; 21.4% in 2023). During the first 30 epidemiological weeks of 2023 in the state of Minas Gerais (MG), there was a 5.8-fold increase in CHIKV cases and a 3.5-fold increase in DENV compared to the same period in 2022. Analysis of 151 new DENV-1 and 80 CHIKV genomes revealed the presence of three main clusters of CHIKV and circulation of several DENV lineages in MG. All CHIKV clades are closely related to genomes from previous Brazilian outbreaks in the Northeast, suggesting importation events from this region to MG. We detected the RNA of both viruses in approximately 12.75% of the confirmed positive cases, suggesting an increase of co-infection with DENV and CHIKV during the period of analysis.<h4>Conclusions</h4>These high rates of re-emergence and co-infection with both arboviruses provide useful data for implementing control measures of Aedes vectors and the urgent implementation of public health politics to reduce the numbers of CHIKV and DENV cases in the country.

Also flagged:biliary atresiaalbuminalanine aminotransferaseaspartate aminotransferasegamma-glutamyl transferaseprothrombin
Journal Article 2024-11-20 No Snippets Thanh LN, Nguyen HP, Kieu TPT, Duy MN, Ha HTT, Thi HB, Nguyen TQ, Pham HD, Tran TD.
Show Full Abstract

<h4>Aim</h4>To evaluate the safety and outcomes of modified Kasai operation combined with autologous bone marrow mononuclear cell (BMMNC) infusion for biliary atresia (BA).<h4>Methods</h4>A matched control study was conducted between January 2015 and December 2021. Ten consecutive children with biliary atresia (BA) who underwent the modified Kasai operation combined with autologous BMMNC infusion (cell therapy group) and ten children who had only the modified Kasai operation (control group) were included in the study. The Kasai operation was performed with two modifications: partial exteriorization of the liver, and encirclement with lateral retraction of two hepatic pedicles to facilitate the removal of fibrotic tissue. Bone marrow was harvested through anterior iliac crest under general anesthesia then a modified Kasai operation was performed. After processing, bone marrow mononuclear cells were infused through the umbilical vein at the end of the operation. Serum bilirubin, albumin, alanine aminotransferase, aspartate aminotransferase, gamma-glutamyl transferase, and prothrombin time were monitored at baseline, six months, twelve months, and the last follow-up (4.5 years) after the operation. In addition, esophagoscopy and liver biopsies were performed on patients whose parents agreed. Mixed-effects analysis was used to evaluate the changes in Pediatric End-Stage Liver Disease (PELD) scores.<h4>Results</h4>There were no intraoperative or postoperative complications related to the operation or cell infusion. The average infused BMMNC and CD34 + cell counts per kg bodyweight were 85.5 ± 56.0 × 10<sup>6</sup>/kg and 10.0 ± 3.6 × 10<sup>6</sup> for the injection, respectively. Following the intervention, all ten patients in the cell therapy group survived, with a mean follow-up duration of 4.5 ± 0.9 years. Meanwhile, three patients in the control group died due to end-stage liver failure, with a mean follow-up time of 4.3 ± 0.9 years. Liver function of the cell therapy group was maintained or improved after the operation and cell infusion, as assessed by biochemical tests. The disease severity reduced markedly in the CT group compared to the control group, with a significant reduction in PELD scores (p < 0.05).<h4>Conclusion</h4>Autologous BMMNC administration combined with Kasai operation for BA is safe and may maintain or improve liver function in the studied patients.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT05517317 on August 26th, 2022.

SOX6
Also flagged:Serinc5Chondrocyte DifferentiationSerine incorporator 5Ihhcell proliferationCol2a1
Journal Article 2024-11-20 ✓ 1 Snippet Hata K, Wakamori K, Hirakawa-Yamamura A, Ichiyama-Kobayashi S, Yamaguchi M, Okuzaki D, Takahata Y, Murakami T, Uzawa N, Yamashiro T, Nishimura R.
In-Text Gene Mentions

…partners Sox5 andSox6directly regulate Col2a1…

Show Full Abstract

The growth plate is the primary site of longitudinal bone growth with chondrocytes playing a pivotal role in endochondral bone development. Chondrocytes undergo a series of differentiation steps, resulting in the formation of a unique hierarchical columnar structure comprising round, proliferating, pre-hypertrophic, and hypertrophic chondrocytes. Pre-hypertrophic chondrocytes, which exist in the transitional stage between proliferating and hypertrophic stages, are a critical cell population in the growth plate. However, the molecular basis of pre-hypertrophic chondrocytes remains largely undefined. Here, we employed scRNA-seq analysis on fluorescently labeled growth plate chondrocytes for their molecular characterization. Serine incorporator 5 (Serinc5) was identified as a marker gene for pre-hypertrophic chondrocytes. Histological analysis revealed that Serinc5 is specifically expressed in pre-hypertrophic chondrocytes, overlapping with Indian hedgehog (Ihh). Serinc5 represses cell proliferation and Col2a1 and Acan expression by inhibiting the transcriptional activity of Sox9 in primary chondrocytes. Chromatin profiling using ChIP-seq and ATAC-seq revealed an active enhancer of Serinc5 located in intron 1, with its chromatin status progressively activated during chondrocyte differentiation. Collectively, our findings suggest that Serinc5 regulates sequential chondrocyte differentiation from proliferation to hypertrophy by inhibiting Sox9 function in pre-hypertrophic chondrocytes, providing novel insights into the mechanisms underlying chondrocyte differentiation in growth plates.

HFE
Also flagged:PorphyriaHereditary Hemochromatosisskin lesionsporphyria cutanea tardaHHiron
Journal Article 2024-11-20 ✓ 5 Snippets DeMaria BL, Franke AJ.
In-Text Gene Mentions

…a homozygous C282YHFEmutation.…

…mutations in theHFEgene, causing excessive…

…consideration of co-existingHFEmutations and the…

HFEgene mutations causing…

HFEencodes a crucial…

Show Full Abstract

We present a case of a 34-year-old woman with a 12-week history of blistering skin lesions, ultimately diagnosed with co-existing porphyria cutanea tarda (PCT) and hereditary hemochromatosis (HH) due to a homozygous C282Y <i>HFE</i> mutation. The patient's discovered genetic predisposition to iron overload played a key role in the development of clinically symptomatic PCT. Treatment with serial therapeutic phlebotomy was started, dramatically improving her symptomatic cutaneous disease, iron indices, and liver function tests. The case brings to the fore the need for thorough diagnostics including genetic testing and the early identification and treatment of iron overload in patients with PCT. This case emphasizes the clinical effectiveness of reducing plasma iron by phlebotomy and underscores the importance of intervention to prevent the long-term complications of pathologic iron overload in PCT. This case report serves to supplement the paucity of existing literature detailing the complex association between PCT and HH and the diagnostic challenges of identifying these commonly co-existing conditions.

DCC
Also flagged:QuercetinDiabetic Peripheral NeuropathyRhoROCKglucoseaxonal growth factors
Journal Article 2024-11-20 ✓ 4 Snippets Song W, Li Y, Jia Y, Xu L, Kang L, Yang Y, Wang S, Zhang Q, Wu Q.
In-Text Gene Mentions

…Netrin-1 binding toDCCand UNC5A receptors…

…whereas its receptorsDCCand UNC5A showed…

…Notably,DCC, another receptor of…

…to its receptorsDCCand UNC5A.…

Show Full Abstract

<h4>Purpose</h4>The axon guidance factors and Rho/ROCK pathway play crucial roles in axon protection and nerve repair and has been implicated in the development of diabetic peripheral neuropathy (DPN). This study investigates the protective effects of quercetin against DPN, focusing on axon guidance factors and Rho/ROCK pathway.<h4>Methods</h4>DPN was induced by intraperitoneal injection of streptozotocin (STZ) to Sprague-Dawley rats. The DPN model rats were allocated into three groups and administered quercetin at two different doses (30 mg/kg/day and 60 mg/kg/day) or a placebo. Concurrently, healthy rats were divided into two groups and administered either a placebo or quercetin (60 mg/kg/day). Administration was initiated 8 weeks post-STZ injection and continued for a duration of six weeks. To assess quercetin's neuroprotective effects, biochemical analyses, neurological function tests (mechanical threshold, thermal response latency, motor nerve conduction velocity), and morphological assessments via transmission electron microscopy were conducted. Immunofluorescence and immunohistochemical assays were performed on sciatic nerve tissue and high glucose-induced RSC96 rat Schwann cells to explore quercetin's pharmacological effects on DPN.<h4>Results</h4>Quercetin exhibited neuroprotective effects on both DPN rats and RSC96 cells exposed to high-glucose. A six-week administration of quercetin at both doses significantly improved the peripheral neurological functions and alleviated the pathological changes in sciatic nerve of DPN rats (<i>P</i><0.05). Mechanistically, quercetin markedly upregulated the expressions of axonal growth factors, Slit-2 and Netrin-1 in vivo and in vitro (<i>P</i><0.05), while inhibiting the aberrant activation of Rho/ROCK signaling pathway in the sciatic nerve of DPN rats.<h4>Conclusion</h4>Our findings suggest that quercetin improves DPN through a novel mechanism, indicating its potential as a therapeutic agent for DPN therapy.

Also flagged:choreadystoniacognitive declineperipheral neuropathyacanthocytosisChAc
Journal Article 2024-11-20 No Snippets Hoe RHM, Zhao Y, Ong HL, Tay KSS, Tan NCK, Khor MJY, Fan BE, Peikert K, Hermann A, Neo S, Chen Z.
Show Full Abstract

<h4>Objectives</h4>Chorea-acanthocytosis is an autosomal recessively inherited condition caused by loss-of-function pathogenic variants in <i>VPS13A</i>. We identified a novel synonymous exonic variant leading to abnormal mRNA splicing in a patient with chorea-acanthocytosis.<h4>Methods</h4>A patient with focal epilepsy developed generalized chorea with orolingual dystonia, cognitive decline, and peripheral neuropathy, consistent with chorea-acanthocytosis. Her parents were first cousins, but there was otherwise no family history. Targeted gene sequencing for variants in <i>VPS13A</i>, mRNA splicing analysis, and Western blot for chorein were performed.<h4>Results</h4>A homozygous synonymous variant in exon 41 of <i>VPS13A</i> (NM_033305.3): c.5157C>T; p.Gly1719 = was identified; this was previously classified as a variant of uncertain significance. SpliceAI predicted a splice donor gain with a score of 0.75 2 base pairs upstream of the reported variant. RNA splicing analysis revealed the creation of a type III splice variant, resulting in a frameshift and a premature termination codon. Western blot showed absent chorein/VPS13A protein.<h4>Discussion</h4>The variant is reclassified as likely pathogenic based on the American College of Medical Genetics criteria. This is the first reported case of ChAc caused by a synonymous variant in <i>VPS13A</i> proven to affect splicing. Our report further expands the spectrum of variants known to cause ChAc.

Also flagged:StrontiumCopperagingobesitytricalciumbiomineralization
Journal Article 2024-11-20 No Snippets Safarova Yantsen Y, Nessipbekova A, Syzdykova A, Olzhayev F, Umbayev B, Kassenova A, Fadeeva IV, Askarova S, Rau JV.
Show Full Abstract

<h4>Background</h4>Pathological bone fracturing is an escalating problem driven by increasing aging and obesity. Bioceramics, particularly tricalcium-phosphate-based materials (TCP), are renowned for their exceptional biocompatibility, osteoconductivity, and ability to promote biomineralization. In the present study, we designed and characterized TCP porous granules doped with strontium (Sr) and copper (Cu) (CuSr TCP). Sr<sup>2+</sup> ions were selected as Sr plays a crucial role in early bone formation, osteogenesis, and angiogenesis; Cu<sup>2+</sup> ions possess antibacterial properties.<h4>Materials</h4>The synthesized CuSr TCP granules were characterized by X-ray diffraction. Cytotoxicity and cell proliferation analyses' assays were performed through the lactate dehydrogenase (LDH) activity and CCK-8 viability tests in rat bone marrow-derived mesenchymal stem cells (BM-MSCs). Hemolytic activity was carried out with human red blood cells (RBCs). Early and late osteogenesis were assessed with alkaline phosphatase (ALP) and Alizarin Red S activity in human osteoblast progenitor cells and rat BM-MSCs. The influence of CuSr TCP on angiogenesis was investigated in human umbilical vein endothelial cells (HUVECs).<h4>Results</h4>We have demonstrated that media enriched with CuSr TCP in concentrations ranging from 0.1 mg/mL to 1 mg/mL were not cytotoxic and did not significantly affect cell proliferation rate motility. Moreover, a concentration of 0.5 mg/mL showed a 2.5-fold increase in the migration potential of BM-MSCs. We also found that CuSr TCP-enriched media slightly increased early osteogenesis. We also found that Sr and Cu substitutions in TCP particles significantly enhanced the measured angiogenic parameters compared to control and unsubstituted TCP granules.<h4>Conclusion</h4>Our results demonstrate that TCP porous granules doped with Sr and Cu are biocompatible, promote osteodifferentiation and angiogenesis, and could be recommended for further in vivo studies.

PRDX6
Also flagged:Wound HealingFibrinmembranehemostasistumorautoimmune diseases
Journal Article 2024-11-20 ✓ 1 Snippet Stiller HL, Perumal N, Manicam C, Trzeciak ER, Todt J, Jurk K, Tuettenberg A, Schumann S, Schiegnitz E, Blatt S.
In-Text Gene Mentions

…1C (Rab-1B), peroxiredoxin-6 (PRDX6), and glutathione S-transfera…

Show Full Abstract

Differences in cell count and growth factor expression between first- and second-generation autologous platelet concentrates (APCs) have been well described. The debate over which formula best supports wound healing in various surgical procedures is still ongoing. This study aims to assess the whole proteome assembly, cell content, immunological potential and pro-angiogenic potential of second-generation APC, Platelet-Rich Fibrin (PRF) vs. first-generation APC, Platelet-Rich Plasma (PRP). The global proteome of the APCs was analyzed using nano-liquid chromatography mass spectrometry. Blood cell concentrations were determined by an automated cell counter. The effect of APCs on macrophage polarization was analyzed by flow cytometry. A yolk sac membrane (YSM) assay was used to monitor the neo-vessel formation and capillary branching in vivo. Cell count analysis revealed a higher number/concentration of leukocytes in PRF vs. PRP. Incubation of macrophages with PRP or platelet-free plasma (PFP) did not induce a significant pro-inflammatory state but led to a shift to the M0/M2 phenotype as seen in wound healing for all tested formulas. Label-free proteomics analysis identified a total of 387 proteins from three biological replicates of the respective designated groups. PRF induced increased formation of neo-vessels and branching points in vivo in comparison to PRP and PFP (each <i>p</i> < 0.001), indicating the enhanced pro-angiogenic potential of PRF. Overall, PRF seems superior to PRP, an important representative of first-generation formulas. Inclusion of leucocytes in PRF compared to PRP suggested rather an anti-inflammatory effect on macrophages. These results are important to support the versatile clinical applications in regenerative medicine for second-generation autologous platelet concentrates to optimize wound healing.

HFE
Also flagged:25-HydroxycholecalciferolMitochondrialBiogeneticsobesitypathogenesisdeath
Journal Article 2024-11-20 ✓ 1 Snippet Chiang SK, Sin MY, Lin JW, Siregar M, Valdez G, Chen YH, Chung TK, Walzem RL, Chang LC, Chen SE.
In-Text Gene Mentions

…mouse model ofhemochromatosis, iron load upregulated…

Show Full Abstract

Broiler breeder hens allowed ad libitum (Ad) feed intake developed obesity and cardiac pathogenesis and thereby were susceptible to sudden death. A supplement of 69 µg 25-hydroxycholecalciferol (25-OH-D3)/kg feed rescued the livability of feed-restricted (R) and Ad-hens (mortality; 6.7% vs. 8.9% and 31.1% vs. 48.9%). Necropsy with the surviving counterparts along the time course confirmed alleviation of myocardial remodeling and functional failure by 25-OH-D3, as shown by BNP and MHC-β expressions, pathological hypertrophy, and cardiorespiratory responses (<i>p</i> < 0.05). 25-OH-D3 mitigated cardiac deficient bioenergetics in Ad-hens by rescuing PGC-1α activation, mitochondrial biogenesis, dynamics, and electron transport chain complex activities, and metabolic adaptions in glucose oxidation, pyruvate/lactate interconversion, TCA cycle, and β-oxidation, as well as in TG and ceramide accumulation to limit lipotoxic development (<i>p</i> < 0.05). Supplemental 25-OH-D3 also sustained Nrf2 activation and relieved MDA accumulation, protein carbonylation, and GSH depletion to potentiate cell survival in the failing heart (<i>p</i> < 0.05). Parts of the redox amendments were mediated via lessened blood hematocrit and heme metabolism, and improved iron status and related gene regulations (<i>p</i> < 0.05). In conclusion, 25-OH-D3 ameliorates cardiac pathological remodeling and functional compromise to rescue the livability of obese hens through metabolic flexibility and mitochondrial bioenergetics, and by operating at antioxidant defense, and heme and iron metabolism, to maintain redox homeostasis and sustain cell viability.

PRDX6
Also flagged:pathogenesisequine asthmahypersensitivityimmune responseasthmasecretions
Journal Article 2024-11-20 ✓ 1 Snippet Karagianni AE, Richard EA, Toquet MP, Hue ES, Courouce-Malblanc A, McGorum B, Kurian D, Aguilar J, Mazeri S, Wishart TM, Pirie RS.
In-Text Gene Mentions

…homeostasis (GCLC, PRDX3,PRDX6), and oxidative phosphorylati…

Show Full Abstract

A state-of-the-art multi-omics approach was applied to improve our understanding of the aetio-pathogenesis of a highly prevalent, performance-limiting disorder of racehorses: mild-to-moderate equine asthma (MMEA). This is a prerequisite to improving prophylactic, management, and therapeutic options for this condition. Although a number of risk factors have been identified, options for intervention are limited. This study applied a multi-omic approach to reveal key inflammatory pathways involved in inflammatory cell recruitment to the lower airways and highlight distinct MMEA inflammatory profiles. We compared bronchoalveolar lavage fluid (BALF) cell gene and protein expression data from horses with non-inflammatory BALF cytology with those isolated from horses with neutrophilic, mastocytic, mixed neutrophilic/mastocytic, and eosinophilic/mastocytic inflammation. The analyses on transcriptomic/proteomic data derived from BALF from horses with neutrophilic cytology showed enrichment in classical inflammatory pathways, and horses with mastocytic inflammation showed enrichment in pathways involved in hypersensitivity reactions related to nonclassical inflammation potentially mimicking a Th2-immune response. The mixed eosinophilic/mastocytic group also presented with a nonclassical inflammatory profile, whereas the mixed neutrophilic/mastocytic group revealed profiles consistent with both neutrophilic inflammation and hypersensitivity. Our adopted multi-omics approach provided a holistic assessment of the immunological status of the lower airways associated with the different cytological profiles of equine asthma.

Also flagged:metabolismgene expressionFbsextracellularcollagenimmune responses
Journal Article 2024-11-20 No Snippets Li X, Li N, Wang Y, Han Q, Sun B.
Show Full Abstract

Fibroblasts, which originate from embryonic mesenchymal cells, are the predominant cell type seen in loose connective tissue. As the main components of the internal environment that cells depend on for survival, fibroblasts play an essential role in tissue development, wound healing, and the maintenance of tissue homeostasis. Furthermore, fibroblasts are also involved in several pathological processes, such as fibrosis, cancers, and some inflammatory diseases. In this review, we analyze the latest research progress on fibroblasts, summarize the biological characteristics and physiological functions of fibroblasts, and delve into the role of fibroblasts in disease pathogenesis and explore treatment approaches for fibroblast-related diseases.

Also flagged:WaterPolyglycidolSynthesiscalixareneResorcinarene Oligomersresorcinol
Journal Article 2024-11-20 No Snippets Penchev H, Dimitrov E, Novakov C, Haladjova E, Veleva R, Moskova-Doumanova V, Topouzova-Hristova T, Rangelov S.
Show Full Abstract

Ladder oligomers containing calixarene skeletons in the main chain-calix[4]resorcinarene (CRA) ladder macromolecules with open chain and cyclic macromolecules with double ring-like (Noria-type) topologies-bring particular research attention as functional materials with various applications. However, there is still a remarkable lack of studies into the synthesis of fully water-soluble derivatives of these interesting macromolecules. Research on this topic would allow their bio-based research and application niche to be at least revealed. In the present study, a strategy for the synthesis of water-soluble polyglycidol-derivatized calix resorcinarene ladder oligomers with open chain and cyclic structures is introduced. A <i>grafting from</i> approach was used to build branched or linear polyglycidol chains from the ladder scaffolds. The novel structures were synthesized in quantitative yields and fully characterized by NMR, FTIR and UV-vis spectroscopy, gel permeation chromatography, MALDI-TOF mass spectrometry, analytical ultracentrifugation, and static light scattering to obtain the molar mass characteristics and composition. The biocompatibility and toxicity of the two polyglycidol-derivatized oligomers were investigated and the concentration dependence of the survival of three cell lines of human origin determined. The selective apoptosis effect at relatively low dissolve concentrations toward two kinds of cancerous cell lines was found.

Also flagged:Chagas diseasetransposonsPIWIgenes expressionembryogenesisRTE-X
Journal Article 2024-11-20 No Snippets de Brito TF, Arruda Cardoso M, Atinbayeva N, Alexandre de Abreu Brito I, Amaro da Costa L, Iovino N, Pane A.
Show Full Abstract

<h4>Introduction</h4>Piwi proteins and the associated Piwi-interacting RNAs (piRNAs) coordinate a surveillance system that protects the animal genome from DNA damage induced by transposable element (TE) mobilization. While the pathway has been described in detail in the fruit fly <i>Drosophila melanogaster</i>, much less is known in more basal insects. <i>Rhodnius prolixus</i> is an hemipteran insect and one of the major vectors of Chagas disease. <i>Rhodnius</i> acquired specific classes of horizontally transferred transposons (HTTs) by feeding on bats, opossums and squirrel monkeys, thus providing the opportunity to investigate the piRNA-base response against HTTs in this species.<h4>Methods</h4>SmallRNA-Seq reads mapping to HTTs and resident transposable elements were quantified and checked for piRNA features like 1U a 10A biases, ping-pong and phasing signatures. Uniquely mapped piRNAs were used to identify piRNA clusters in <i>Rhodnius</i>' genome. RNA-Seq data was used to quantify transposon and Rp-PIWI genes expression levels and were validated by qRT-PCR.<h4>Results</h4>By analyzing the temporal dynamics of piRNA cluster expression and piRNA production during critical stages of Rhodnius development, we show that peak levels of ∼28 nt long piRNAs correlate with reduced HTT and resident TE expression primarily during embryogenesis. Strikingly, while resident TEs piRNAs seem to engage in a typical ping-pong amplification mechanism, sense and antisense HTT piRNAs instead overlap by ∼20 nt or do not display ping-pong signatures.<h4>Discussion</h4>Our data shed light on the biogenesis and functions of the piRNAs in Rhodnius prolixus and reveal that piRNAs, but not the siRNA pathway, responded to HTTs that were recently transferred from vertebrate tetrapods to a hematophagous insect of medical relevance.

DNAJC1
Also flagged:germinal vesicleprophase IMetaphasefolliclechromatinorganization
Journal Article 2024-11-20 ✓ 1 Snippet Mao R, Cai Z, Wang T, Li Y, Tian S, Li D, Li P.
In-Text Gene Mentions

…, PPP1R12C ,DNAJC1, RPL28 ,…

Show Full Abstract

<h4>Introduction</h4>Follicle development is a critical process in the female reproductive system, with significant implications for fertility and reproductive health. Germinal vesicle (GV) oocytes are primary oocytes that are arrested in the dictyate stage, also known as the diplotene stage of meiotic prophase I. Metaphase II (MII) is the stage at which the oocyte is typically retrieved for assisted reproductive technologies such as <i>in vitro</i> fertilization (IVF). The granulosa cells play a pivotal role in follicle development processes. 3D chromatin organization is a fundamental aspect of cellular biology that has significant implications for gene regulation and cellular function.<h4>Methods</h4>In this study, we investigated 3D chromatin organization in granulosacells from GV and MII follicles, which is essential for understanding the regulatory mechanisms governing oocyte development.<h4>Results</h4>The results revealed distinct compartmentalization patterns,including stable genomic regions and transitions during oocyte maturation. Notably, there was a significant shift in functional gene activation, particularly in processes related to hormone metabolic pathways. Furthermore, alterations in topologically associating domains (TADs) were observed, with differential expression observed in genes that are involved in crucial biological processes. The analysis also identified a subset of genes with altered promoter-enhancer interactions (PEIs), reflecting a regulatory shift in gene expression related to reproductive processes.<h4>Discussion</h4>These findings provide valuable insights into 3D genome organization in granulosa cells with implications for reproductive health and the development of assisted reproductive technologies. Understanding spatial genome organization at different stages of follicular development may help realize novel strategies for enhancing success rates in assisted reproductive technologies.

HFE
Also flagged:Pyruvatekinase deficiencyfetal anemiachronic hemolytic anemiahemolytic anemiapyruvate kinase
Journal Article 2024-11-20 ✓ 1 Snippet Pang Y, Qi X, Qin J, Zhai X, Wang R, Cao J, Zhang N, Liu J, Li J, Wu W, Wei S, Zhang J, Zhang S, Zhang Y, Yue Y.
In-Text Gene Mentions

…or coinheritance ofhemochromatosisgenes.…

Show Full Abstract

Pyruvate kinase deficiency (PKD) is an autosomal recessive genetic disease caused by mutations in the <i>PKLR</i> gene. To date, the clinical manifestations of PKD are heterogeneous, ranging from fetal anemia, neonatal jaundice, and severe chronic hemolytic anemia to fully compensated hemolytic anemia. Successful cases of allogeneic hematopoietic stem cell transplantation (allo-HSCT) for PKD have been reported, however, the number of cases is very small, and experiences are very limited. Here, we report two successful cases involving our modified conditioning regimen. This approach is suitable for patients with severe transfusion dependence. In conclusion, for PKD patients with severe transfusion dependence, allo-HSCT is an option and is currently a safe and effective way to completely eliminate the need for transfusions of drugs, such as Mitapivat, or genetic therapies and allow the patient to return to normal life.

TNFSF4
Also flagged:Coppermetabolismhepatocellular carcinomacancertumorchromosome
Journal Article 2024-11-20 ✓ 1 Snippet Luo R, Huang S, Shi X, Xu H, Peng J, Lei W, Li S, Zhang W, Shi L, Peng Y, Tang X.
In-Text Gene Mentions

…including LGALS9 ,TNFSF4, IDO1 ,…

Show Full Abstract

<h4>Background</h4>Characterized by its high mortality and easy recurrence, hepatocellular carcinoma (HCC) poses significant clinical challenges. The association between copper metabolism and development of cancer has been identified. However, the underlying mechanisms of copper metabolism-related long non-coding RNAs (CMRLs) in HCC remain elusive. To address the gap, our study analyzed the prognostic and immuno-therapeutic value of CMRLs in HCC.<h4>Methods</h4>This research utilized The Cancer Genome Atlas-Liver Hepatocellular Carcinoma (TCGA-LIHC) data (n=424) for analysis, applying the "limma" package in R software for differential gene analysis and construction of a prognostic signature. We validated the signature using training and validation groups stochastically divided at a ratio of 1:1 and assessed prognostic value via Kaplan-Meier, C-index, and receiver operating characteristic (ROC) curves. By multivariate Cox regression, independent prognostic indicators were identified, and a nomogram was formulated for survival forecasting. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses elucidated biological pathways, and the immune landscape was examined through multiple algorithms. Finally, drug sensitivity was determined from Genomics of Drug Sensitivity in Cancer (GDSC), with mutation analysis conducted via maftools.<h4>Results</h4>In this study, a predictive model based on four pivotal CMRLs (<i>PRRT3-AS1</i>, <i>AC108752.1</i>, <i>AC092115.3</i>, <i>AL031985.3</i>) significantly associated with HCC progression and prognosis was constructed and validated with the overall survival (OS) prediction area under the curve (AUC) values for 1, 3, and 5 years of 0.718, 0.688, and 0.669, respectively. The calibration curves and C-index values showed a solid prognostic ability of the nomogram. The high-risk group was notably higher than the low-risk group both in OS and tumor mutational burdens (TMBs). Moreover, functional annotation enrichment analysis of CMRLs revealed that the signature was mainly associated with mitotic function, chromosome, kinetochore, cell cycle, and oocyte meiosis. Furthermore, therapeutic drugs, including fluorouracil, afatinib, alpelisib, cedranib, crizotinib, erlotinib, gefitinib, and ipatasertib, were found to induce higher sensitivity in high-risk group.<h4>Conclusions</h4>The prognostic signature consisting of four CMRLs displays an outstanding predictive performance and improves the precision of immuno-oncology.

HFE
Also flagged:chronic hepatitis BinfectionCOVID-19antibodieshepatitisglobulin
Journal Article 2024-11-20 ✓ 1 Snippet Wang P, Chen J, Chen D, Lei Z, Mo Z, Zhang Y.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosis.…

Show Full Abstract

<h4>Background and aims</h4>Clinical data regarding patients with chronic hepatitis B (CHB) after Omicron BA.5 infection are currently limited. This study aimed to assess the clinical characteristics of patients with CHB and Omicron BA.5 infection in South China.<h4>Methods</h4>This retrospective study was conducted from January to March 2023 in a cohort of 485 healthy individuals and 553 patients with CHB. Clinical features, encompassing COVID-19-related symptoms, levels of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) antibodies, vaccination status, liver functions, and virological markers of hepatitis B virus (HBV) infection were measured.<h4>Results</h4>COVID-19-related symptom patterns were similar in both groups, except for fever, which was notably less prevalent (85.4% <i>vs.</i> 90.4%, <i>P</i> = 0.047) among patients with CHB who experienced a significantly shorter duration of fever (median 2.2 (25th-75th percentile, 1.0-3.0) days <i>vs.</i> 2.3 (1.0-3.0) days, <i>P</i> = 0.048) and a shorter time for symptom relief (9.2 (5.0-14.0) <i>vs.</i> 11.1 (5.0-14.0) days, <i>P</i> = 0.015). The levels of SARS-CoV-2 antibodies were comparable between the two groups but increased after booster vaccinations. In patients with CHB, globulin (GLB) and hepatitis B envelope antibody levels were significantly increased after Omicron BA.5 infection, regardless of nucleos(t)ide analog regimens comparing entecavir (ETV) with tenofovir (TFV). Patients with CHB treated with TFV had significantly higher levels of SARS-CoV-2 antibodies than those treated with ETV (1065.1 (346.9-1188.5) COI <i>vs.</i> 765.5 (24.5-1119.1) COI, <i>P</i> = 0.025).<h4>Conclusions</h4>No significant exacerbation of COVID-19 symptoms was observed in conjunction with the efficacy of COVID-19 booster vaccinations. There were no notable alterations in liver functions except for GLB. HBV reactivation, as evidenced by increased HBV DNA, was observed among patients with CHB after Omicron BA.5 infection. These changes were not affected by ETV versus TFV administration; however, TFV resulted in a significant increase in SARS-CoV-2 antibody levels. Further studies are required to improve care and therapeutics for patients with CHB who contracted COVID-19.

Also flagged:hemagglutininHApolymerase acidicPAneuraminidaseNA
Journal Article 2024-11-20 No Snippets Jeong CG, Lee CY, Chae SB, Kwon JH, Na EJ, Park JS, Kim YS, Kim SC, Kim HJ, Sung YS, Kim SY, Kim WI, Oem JK.
Show Full Abstract

The emergence and evolution of avian influenza A viruses (AIVs) pose significant challenges to both public health and animal husbandry worldwide. Here, we characterized a novel reassortant highly pathogenic avian influenza virus (HPAIV), clade 2.3.4.4b H5N6, that was isolated from a mandarin duck in South Korea in December 2023. Phylogenetic and molecular analyses show that the hemagglutinin (HA) gene of the 23-JBN-F12-36/H5N6 virus clustered with HPAIV clade 2.3.4.4b H5N1 viruses, which were circulating in South Korea and Japan in 2022-2023. The M and polymerase acidic (PA) genes also revealed a close association with the HPAIV clade 2.3.4.4b H5N1 AIV that was identified previously in South Korea during November 2022. Notably, the neuraminidase (NA) gene of the 23-JBN-F12-36/H5N6 virus was estimated to have its origins in the HPAIV clade 2.3.4.4h H5N6 prevalent in poultry in China, and it is clustered with the AIVs that are associated with human infection cases. Taken together, these results show that the virus has been produced by reassortment with H5N1 HPAIV, which is prevalent in wild birds; H5N6 HPAIV, which is circulated in poultry in China; and the internal genes of low pathogenic avian influenza viruses (LPAIVs). In light of the reassortment of HPAIVs circulating in existing wild birds and HPAIVs circulating in poultry in China within the 2.3.4.4b H5Nx clade, it is imperative to strengthen active surveillance across wild bird populations, poultry farms, and live poultry markets, and to inform for the effective design of improved prevention and control strategies.

HTT
Also flagged:citalopramserotoninreuptakealprazolamGABA type A receptor5-HT1A receptor
Journal Article 2024-11-20 ✓ 1 Snippet Munsch F, Taso M, Wolf DH, Press D, Buss S, Detre JA, Alsop DC.
In-Text Gene Mentions

…of citalopram, (the5-HTTserotonergic transporter and…

Show Full Abstract

Functional MRI methods can assess aspects of drug-induced brain response. Resting blood oxygenation level dependent (BOLD) fMRI and arterial spin labeling (ASL) perfusion MRI indirectly measure brain function through the coupling of activity to cerebral blood flow (CBF) and oxygenation but their relative sensitivity has not been directly compared. We assessed changes in resting measures of BOLD and ASL MRI in response to two neurotransmitter modulators: citalopram, a selective serotonin reuptake inhibitor, and alprazolam, a positive allosteric modulator of GABA type A receptor. Thirty healthy subjects were imaged in a placebo-controlled study, with N = 20 subjects receiving each treatment as part of an incomplete block design. Time-averaged CBF images from ASL and measures of resting-state fluctuations of BOLD and ASL images were assessed for significant effects. Following acute citalopram administration, analysis of the ASL data showed a reduction in time-averaged regional CBF in regions associated with high levels of 5-HT1A receptor density. In contrast, following alprazolam administration, BOLD amplitude of low-frequency fluctuations showed a highly significant and cortically widespread increase, consistent with the distribution of GABA-A receptors. Only a marginal decrease in ASL CBF was detected after alprazolam intake. BOLD and ASL are each sensitive to drugs targeting neurotransmitter systems, but appear to reflect different aspects of neural metabolism and the balance between excitatory and inhibitory activity. Accordingly, their combination may best capture the effects of neurotransmitter modulations, and thus be advantageous for pharmacological MRI studies.

Also flagged:constipationHematoxylinperiodic acidwateracetylcholinegastrin
Journal Article 2024-11-20 No Snippets Wen Y, Zhan Y, Du LJ, Li J, Shen XL, He B, Chen TY, Tang XG.
Show Full Abstract

<i>Aurantii fructus immaturus</i> flavonoid (AFIF) is the main constituent of <i>Aurantii fructus immaturus</i> (Rutaceae) (AFI), and is effective against constipation. This study explores the mechanism of AFIF against antibiotics-induced constipation (AC) in mice. Forty six-week-old female C57BL/6 mice were randomly divided into 4 groups (<i>n</i> = 10): control, control + AFIF, model, and model + AFIF groups. The AC model was established by antibiotics mixture for 8 days. Mice were gavaged daily with AFIF (0.1 mL/10 g, 3 g/mL) for 2 weeks. Hematoxylin and eosin (H&E) staining and periodic acid-Schiff (PAS) staining were used for histological analysis. The colonic microbiota was analyzed by 16sRNA sequencing. Transcriptome sequencing was used to detect miRNA and mRNA expression profiles. The results showed that AFIF treatment improved constipation in AC mice: increased fecal number, fecal wet weight, fecal water content, and intestinal propulsion rate; decreased average weight of individual feces. AFIF improved the colonic pathological injury and increased acetylcholine (ACH), gastrin (GAS), motilin (MTL), substance P (SP), and vasoactive intestinal peptide (VIP) levels. Moreover, AFIF might improve AC by regulating colonic microbiota and a "miRNA-mRNA" regulatory network related to cell junction and neuroactive function. This study also found the colonic microbiota at the genus level was connected to the expressions and target mRNA expressions (including Ccdc85b, Dlgap2, Elavl4, and Shisa6) of mmu-miR-5100 and mmu-miR-18b-5p. In conclusions, AFIF could improve AC via regulating colonic microbiota and a "miRNA-mRNA" regulatory network, which provide a theoretical basis for expanding its clinical application.

bioRxiv 2024-11-20 Preprint (No Snippets API) Kakui Y, Kusano Y, Clarence T, Lopez M, Hirota T, Khatri BS, Uhlmann F.
Show Full Abstract

Mitotic chromosomes give genome portions the required compaction and mechanical stability for faithful inheritance during cell divisions. Here, we record human chromosome dimensions from their appearance in prophase over successive times in a mitotic arrest. Chromosomes first appear long and uniformly thin. Then, individual chromosome arms become discernible, which continuously shorten and thicken - the longer a chromosome arm, the thicker it becomes. The observed chromosome arm length to width relationship can be described by a power law with progressively increasing exponent. In the search for a molecular explanation of this behavior, the popular loop extrusion model provides no obvious means by which longer arms become thicker. Instead, we find that simulations of an alternative loop capture model recapitulate key features of our observations, including the gradually developing arm length to width relationship. Our analyses portray chromosomes as out-of-equilibrium structures in the process of transitioning towards, but on biologically relevant time scales not typically reaching, steady state.

Also flagged:EsteraseSynthesishydrolaseacyltransferaseamidesacyl
Journal Article 2024-11-19 No Snippets Goulding E, Ward LC, Allan FE, Dittman D, Salcedo-Sora JE, Carnell AJ.
Show Full Abstract

A growing number of hydrolase enzymes show promiscuous acyltransferase activity, even under aqueous conditions. Here we report, for the first time, the ability of Pyrobaculum calidifontis VA1 esterase (PestE) to catalyse the formation of a wide range of amides in buffer, where the acyl donor forms a significant structural component in the amide product. The reactions occur under mild conditions and can achieve conversions up to 97 % in 6 h for formation of N-benzylfuranamide as the model reaction. We demonstrate PestE's potential in enzyme cascades to make amides from waste PET plastic and the conversion of the terephthalic acid product to tamibarotene, a drug with activity against acute leukemia. Rational mutagenesis led to identification of PestE variants F33L F289A and F33L. F33L F289A increased conversion of N-benzylfuranamide by 1.2-fold, and F33L gave a 4-fold increase in conversion to tamibarotene.

Also flagged:KetoneHeart FailureSodiumGlucose Co-Transporter-2Sodium-glucose co-transporter 2SGLT2i
Journal Article 2024-11-19 No Snippets Tan JY, Ephraums LA, Inglis JM, Nguyen HTT, Umapathysivam MM, Simpson NJ, Harris JH, Burdeniuk CM, De Pasquale CG, Thynne TRJ.
Show Full Abstract

<h4>Background</h4>Sodium-glucose co-transporter 2 inhibitors (SGLT2i) are standard-of-care treatment in heart failure (HF). The risk of ketosis in patients with HF is unclear, especially during hospitalisation.<h4>Aim</h4>We aimed to evaluate the normal ketone concentration range in HF patients.<h4>Method</h4>We performed a cross-sectional study of inpatients with acutely decompensated HF and outpatients with stable HF. Ketone concentrations were measured and analysed based on SGLT2i use. Baseline demographic data (age, gender, body mass index [BMI]), time since last meal, HF type, type 2 diabetes status, insulin use, and blood parameters (creatinine, glycosylated haemoglobin A1c [HbA1c] and N-terminal pro-B-type natriuretic peptide) were collected from patients or medical records. The primary outcome was capillary blood ketone concentration in patients with acute decompensated HF and stable chronic HF stratified by SGLT2i use. Multivariate regression was also performed using ketones as the outcome variable, with age, gender, BMI, glucose levels, HbA1c, time since last meal and presence of insulin therapy as predictor variables.<h4>Results</h4>A total of 20 individuals with decompensated HF (n=5 SGLT2i treated) and 47 with stable chronic HF (n=22 SGLT2i treated) were recruited. Median ketone concentrations were similar in all groups irrespective of SGLT2i use and the presence of acute decompensation (0.1 mmol/L, biggest interquartile range 0.2 mmol/L, p=0.49). Apart from time from last meal, multivariate regression analysis showed no association of ketone concentration with SGLT2i use, age, gender, BMI, type 2 diabetes status, insulin use and blood glucose level.<h4>Conclusions</h4>Ketone concentrations were low in individuals with HF regardless of SGLT2i use or the presence of acute decompensation.

HFE
Also flagged:ironferric carboxymaltoseiron deficiencyinflammatory bowel diseaseIDanaemia
Journal Article 2024-11-19 ✓ 1 Snippet Piechnik SK, Polzella P, Shah A, Vera-Aviles M, Kabir SN, Desborough M, Ferreira VM, Lakhal-Littleton S.
In-Text Gene Mentions

…tested for haemochromatosisHFEmutations.…

Show Full Abstract

In clinical practice, intravenous (IV) iron therapy is used for the correction of iron deficiency. Patients with chronic causes of iron deficiency, for example, women with abnormal uterine bleeding, patients with inflammatory bowel disease often require repeated dosing with IV iron therapy. After a single standard dose of IV iron therapy (1000 mg) with ferric carboxymaltose, there is a rapid intake of iron into the myocardium, resulting in a sustained increase in myocardial iron content. The increase in myocardial iron content is independent of changes in plasma ferritin levels, and the recurrence of iron deficiency is not accompanied by a normalisation of myocardial iron. The most important implication is that repeated dosing with IV iron (ferric carboxymaltose) can result in cumulative build-up of iron in the myocardium.

TRIM38
Also flagged:Osteoporosisbone disorderagingestrogendeficiencyglucocorticoid
Journal Article 2024-11-19 ✓ 3 Snippets Zhang Y, Bai J, Xiao B, Li C.
In-Text Gene Mentions

…, 5′-TCTCACATCATCCAGTGCTCT—3′;TRIM38, forward, 5′—GAGCCTGATGACGAAC…

…of TRIM16, TRIM21,TRIM38, and TRIM62 showed…

…Additionally,TRIM38has been found…

Show Full Abstract

Osteoporosis is characterized by reduced bone mass due to imbalanced bone metabolism. Exosomes derived from bone mesenchymal stem cells (BMSCs) have been shown to play roles in various diseases. This study aimed to clarify the regulatory function and molecular mechanism of BMSCs-derived exosomes in osteogenic differentiation and their potential therapeutic effects on osteoporosis. Exosomes were extracted from BMSCs. Bone marrow-derived macrophages (BMDMs) were cultured and internalized with BMSCs-derived exosomes. Real-time quantitative PCR was used to detect the expression of macrophage surface markers and tripartite motif (TRIM) family genes. BMDMs were co-cultured with human osteoblasts to assess osteogenic differentiation. Western blot was performed to analyze the ubiquitination of triggering receptor expressed on myeloid cell 1 (TREM1) mediated by TRIM25. An ovariectomized mice model was established to evaluate the role of TRIM25 and exosomes in osteoporosis. Exosomes were successfully isolated from BMSCs. BMSCs-derived exosomes upregulated TRIM25 expression, promoting M2 macrophage polarization and osteogenic differentiation. TRIM25 facilitated the ubiquitination and degradation of TREM1. Overexpression of TREM1 reversed the enhanced M2 macrophage polarization and osteogenic differentiation caused by TRIM25 overexpression. TRIM25 enhanced the protective effect of BMSCs-derived exosomes against bone loss in mice. These findings suggested that BMSCs-derived exosomes promoted osteogenic differentiation by regulating M2 macrophage polarization through TRIM25-mediated ubiquitination and degradation of TREM1. This mechanism might provide a novel approach for treating osteoporosis.

HFE
Also flagged:IL6 receptorsignal transductionIL6STpolymyalgia rheumaticasarilumabantibody
Journal Article 2024-11-19 ✓ 1 Snippet Lessard S, Chao M, Reis K, FinnGen, Estonian Biobank Research Team, Beauvais M, Rajpal DK, Sloane J, Palta P, Klinger K, de Rinaldis E, Shameer K, Chatelain C.
In-Text Gene Mentions

…−11 ), andHFEand disorders of…

Show Full Abstract

<h4>Background</h4>Therapeutic targets supported by genetic evidence from genome-wide association studies (GWAS) show higher probability of success in clinical trials. GWAS is a powerful approach to identify links between genetic variants and phenotypic variation; however, identifying the genes driving associations identified in GWAS remains challenging. Integration of molecular quantitative trait loci (molQTL) such as expression QTL (eQTL) using mendelian randomization (MR) and colocalization analyses can help with the identification of causal genes. Careful interpretation remains warranted because eQTL can affect the expression of multiple genes within the same locus.<h4>Methods</h4>We used a combination of genomic features that include variant annotation, activity-by-contact maps, MR, and colocalization with molQTL to prioritize causal genes across 4,611 disease GWAS and meta-analyses from biobank studies, namely FinnGen, Estonian Biobank and UK Biobank.<h4>Results</h4>Genes identified using this approach are enriched for gold standard causal genes and capture known biological links between disease genetics and biology. In addition, we find that eQTL colocalizing with GWAS are statistically enriched for corresponding disease-relevant tissues. We show that predicted directionality from MR is generally consistent with matched drug mechanism of actions (> 85% for approved drugs). Compared to the nearest gene mapping method, genes supported by multi-omics evidences displayed higher enrichment in approved therapeutic targets (risk ratio 1.75 vs. 2.58 for genes with the highest level of support). Finally, using this approach, we detected anassociation between the IL6 receptor signal transduction gene IL6ST and polymyalgia rheumatica, an indication for which sarilumab, a monoclonal antibody against IL-6, has been recently approved.<h4>Conclusions</h4>Combining variant annotation, activity-by-contact maps, and molQTL increases performance to identify causal genes, while informing on directionality which can be translated to successful target identification and drug development.

POU3F2
Also flagged:POU3F4Gli1neurodegenerative diseasesgene expressionBrn4Cell cycle
Journal Article 2024-11-19 ✓ 2 Snippets Zhang L, Wang J, Xu N, Guo J, Lin Y, Zhang X, Ji R, Ji Y, Li H, Han X, Li W, Cheng X, Qin J, Tian M, Xu M, Zhang X.
In-Text Gene Mentions

…have shown thatPOU3F2, POU3F3, and POU3F4…

POU3F2, POU3F3, and POU3F4…

Show Full Abstract

<h4>Background</h4>Neural stem cells (NSCs) are considered to be the most promising cell type for cell replacement therapy in neurodegenerative diseases. However, their low neuronal differentiation ratio impedes their application in such conditions. Elucidating the molecular mechanism of NSC differentiation may provide the necessary experimental basis for expanding their application. Previous studies have indicated that POU3F4 can induce neuronal differentiation of NSCs, this study aims to underly the possible exact mechanism of POU3F4 on the NSC differentiation and development.<h4>Methods</h4>NSCs were isolated and cultured from the hippocampus of neonatal mice. The frozen hippocampal sections were prepared for immunohistochemical staining. Synaptic development was assessed using electron microscopy. High-throughput sequencing was employed to analyze the gene expression profile following the overexpression of Brn4. Gene expression levels were determined through Western blotting and qRT-PCR. Cell cycle and differentiation were evaluated using flow cytometry and immunofluorescent staining.<h4>Results</h4>It was found that POU3F4 promoted the neuronal differentiation of hippocampal NSCs and synapse development, and inhibited NSC proliferation. POU3F4-deficient mice exhibited impairments in learning and memory. RNA sequencing and ChIP assays confirmed that Gli1 was downstream of POU3F4. Loss and gain function experiments indicated that Gli1 mediated POU3F4 promoting neuronal differentiation and synapse development. Forced expression of Gli1 in hippocampus improved learning and memory function of animal models.<h4>Conclusions</h4>The results suggest that POU3F4 and Gli1 promote neuronal differentiation and synaptic development of NSCs, and that Gli1 partially mediates the effects of POU3F4.

HFE
Also flagged:BMP4iron overload disorderironBone morphogenetic protein 4BMPSMAD
Journal Article 2024-11-19 ✓ 5 Snippets Ouyang Q, Li Y, Xu A, Zhang N, Chen S, Zhou D, Zhang B, Ou X, Jia J, Huang J, Zhang W.
In-Text Gene Mentions

…exon 4 cause non-HFE-associated hemochromatosis vi…

…4 cause non-HFE-associatedhemochromatosisvia the BMP/SMAD…

…(0.68%) with secondaryhemochromatosisharbored the BMP4…

…variants in non-HFEgenes in Chinese…

…iron regulator (HFE), hemojuvelin (…

Show Full Abstract

<h4>Background</h4>Hereditary hemochromatosis (HH) is an iron overload disorder and can be caused by variants in non-HFE genes in Chinese patients. However, there is still a considerable proportion of patients suffering from unexplained iron overload. In our previous study, we had identified the p.R269Q variant in exon 4 of the Bone morphogenetic protein 4 (BMP4) gene in Chinese patients with unexplained primary iron overload by Whole Exome sequencing, and then the BMP4 p.H251Y variant was identified by Sanger sequencing in a Chinese patient with secondary iron overload. Our study aimed to explore the pathogenicity and underlying mechanism of BMP4 p.H251Y and BMP4 p.R269Q variants in patients with iron overload.<h4>Methods</h4>Sanger sequencing was conducted to identify the novel variants in the BMP4 gene of patients with unexplained iron overload. MRI and liver biopsy were used to display iron overload in the liver of the patient harboring the BMP4 p.H251Y variant. The BMP4 and hepcidin levels in BMP4 knockdown and BMP4 variant cells were examined by enzyme-linked immunosorbent assay. The effects of BMP4 p.H251Y and BMP4 p.R269Q variants on the hepcidin-regulation pathway were studied.<h4>Results</h4>One of 54 HH patients (1.85%) harbored the BMP4 p.R269Q variant. One of 148 patients (0.68%) with secondary hemochromatosis harbored the BMP4 p.H251Y variant, and these two variants were not found in 100 Chinese general population. For the patient harboring the BMP4 p.H251Y variant, abdominal MRI and Perl's staining of liver tissue displayed iron overload in the liver. Cells transfected with the BMP4 p.H251Y and p.R269Q variants showed down-regulation of hepcidin level and BMP/SMAD pathway compared with cells transfected with the wild-type BMP4 vector.<h4>Conclusion</h4>The BMP4 p.H251Y and p.R269Q variants can downregulate hepcidin levels by inhibiting the BMP/SMAD axis, suggesting they may play pathogenic roles in iron overload.

Also flagged:Fatty acidssynthesismembranessignal transductionprotein modificationsphospholipids
Journal Article 2024-11-19 No Snippets Loix M, Vanherle S, Turri M, Kemp S, Fernandes KJL, Hendriks JJA, Bogie JFJ.
Show Full Abstract

Disturbances in the fatty acid lipidome are increasingly recognized as key drivers in the progression of various brain disorders. In this review article, we delve into the impact of Δ9 fatty acid desaturases, with a particular focus on stearoyl-CoA desaturase-1 (SCD1), within the setting of neuroinflammation, neurodegeneration, and brain repair. Over the past years, it was established that inhibition or deficiency of SCD1 not only suppresses neuroinflammation but also protects against neurodegeneration in conditions such as multiple sclerosis, Alzheimer's disease, and Parkinson's disease. This protective effect is achieved through different mechanisms including enhanced remyelination, reversal of synaptic and cognitive impairments, and mitigation of α-synuclein toxicity. Intriguingly, metabolic rerouting of fatty acids via SCD1 improves the pathology associated with X-linked adrenoleukodystrophy, suggesting context-dependent benign and harmful effects of SCD1 inhibition in the brain. Here, we summarize and discuss the cellular and molecular mechanisms underlying both the beneficial and detrimental effects of SCD1 in these neurological disorders. We explore commonalities and distinctions, shedding light on potential therapeutic challenges. Additionally, we touch upon future research directions that promise to deepen our understanding of SCD1 biology in brain disorders and potentially enhance the clinical utility of SCD1 inhibitors.

PRDX6
Also flagged:Arachidonic acidpolyunsaturated fatty acidovarian carcinomaOCSTAT1phosphorylation
Journal Article 2024-11-19 ✓ 1 Snippet Hammoud MK, Meena C, Dietze R, Hoffmann N, Szymanski W, Finkernagel F, Nist A, Stiewe T, Graumann J, von Strandmann EP, Müller R.
In-Text Gene Mentions

…ase), PRDX1 (peroxiredoxin-1),PRDX6(peroxiredoxin-6), SOD1 (super…

Show Full Abstract

<h4>Background</h4>High levels of the polyunsaturated fatty acid arachidonic acid (AA) within the ovarian carcinoma (OC) microenvironment correlate with reduced relapse-free survival. Furthermore, OC progression is tied to compromised immunosurveillance, partially attributed to the impairment of natural killer (NK) cells. However, potential connections between AA and NK cell dysfunction in OC have not been studied.<h4>Methods</h4>We employed a combination of phosphoproteomics, transcriptional profiling and biological assays to investigate AA's impact on NK cell functions.<h4>Results</h4>AA (i) disrupts interleukin-2/15-mediated expression of pro-inflammatory genes by inhibiting STAT1-dependent signaling, (ii) hampers signaling by cytotoxicity receptors through disruption of their surface expression, (iii) diminishes phosphorylation of NKG2D-induced protein kinases, including ERK1/2, LYN, MSK1/2 and STAT1, and (iv) alters reactive oxygen species production by transcriptionally upregulating detoxification. These modifications lead to a cessation of NK cell proliferation and a reduction in cytotoxicity.<h4>Conclusion</h4>Our findings highlight significant AA-induced alterations in the signaling network that regulates NK cell activity. As low expression of several NK cell receptors correlates with shorter OC patient survival, these findings suggest a functional linkage between AA, NK cell dysfunction and OC progression.

Also flagged:WaterphotonLanthanidebiotoxicityhyaluronic acidpolycaprolactone
Journal Article 2024-11-19 No Snippets Choi HE, Park JM, Jeong WY, Lee SB, Kim JH, Kim KS.
Show Full Abstract

Photomedicine, which utilizes light for therapeutic purposes, has several hurdles such as limited tissue penetration for short-wavelength light and inadequate deep tissue efficacy for long-wavelength light. Photon energy upconversion (UC) reveals promise in photomedicine because it enables the conversion of lower-energy photons into higher-energy photon. Lanthanide (Ln)-based inorganic UC system has been extensively studied but faces challenges, including high excitation laser power density, intrinsically subpar UC quantum efficiency, and potential biotoxicity. Recently, an organic-based triplet-triplet annihilation UC (TTA-UC) system has emerged as a novel UC system due to its prolonged emission lifetime upon low power laser excitation and exceptional UC quantum yield. In this study, we developed water-dispersible hyaluronic acid (HA)-conjugated polycaprolactone (PCL) nanoparticles loaded with TTA-UC chromophores (HA-PCL/UC NPs), which allow deeper tissue penetration by converting red light (635 nm) into blue light (470 nm) for noninvasive transdermal delivery. HA-PCL/UC NPs demonstrated a 1.6% high quantum yield in distilled water, improved cellular imaging in HeLa cells, and effectively penetrated the deep tissue of porcine skin, showing upconverted blue light. Our strategy holds significant potential as a next-generation noninvasive photomedicine platform for bioimaging, photo-triggered drug delivery, and photodynamic therapy, ultimately advancing targeted and effective therapeutic interventions.

SERPINC1
Also flagged:bindingoxidizedphospholipidsdetoxificationantibodiesimmunoglobulin
Journal Article 2024-11-19 ✓ 5 Snippets Jokesch P, Holzer L, Jantscher L, Guttzeit S, Übelhart R, Oskolkova O, Bochkov V, Gesslbauer B.
In-Text Gene Mentions

…protein B, andantithrombin-III.…

Antithrombin-III(ATIII), which is…

…Antithrombin-III (ATIII), which is well…

…-known heparin-binding proteinAntithrombin-IIIwas enriched with…

…allows hypothesizing thatATIIIand other proteins…

Show Full Abstract

Oxidized phospholipids (OxPLs) are increasingly recognized as toxic and proinflammatory mediators, which raises interest in the mechanisms of their detoxification. Circulating OxPLs are bound and neutralized by plasma proteins, including both antibodies and non-immunoglobulin proteins. The latter group of proteins is essentially not investigated because only three OxPC-binding plasma proteins are currently known. The goal of this work was to characterize a broad spectrum of plasma proteins selectively binding OxPLs. Using pull-down-proteomic analysis, we found about 150 non-immunoglobulin proteins preferentially binding oxidized 1-palmitoyl-2-arachidonoyl-sn-glycero-phosphatidylcholine (OxPAPC) as compared to non-oxidized PAPC. To test if candidate proteins indeed can form a barrier isolating OxPLs from recognition by other proteins, we applied an immune masking assay. Oxidized LDL (OxLDL) immobilized in multiwell plates was used as a carrier of OxPLs, while mAbs recognizing OxPC or OxPE were used as "detectors" showing if OxPLs on the surface of OxLDL are physically accessible to external binding partners. Using an orthogonal combination of pull-down and masking assays we confirmed that previously described OxPL-binding proteins (non-fractionated IgM, CFH, and Apo-M) indeed can bind to and mask OxPC and OxPE on liposomes and OxLDL. Furthermore, we identified additional plasma proteins selectively binding and masking OxPC including Apo-D, Apo-H, pulmonary surfactant-associated protein B, and antithrombin-III. We hypothesize that in addition to circulating antibodies, multiple non-immunoglobulin plasma proteins can also bind OxPLs and modulate their recognition by innate and adaptive immunity.

Also flagged:Endoplasmic reticulumautophagyosteoarthritisOAcollagendegradation
Journal Article 2024-11-19 No Snippets Lu Y, Zhou J, Wang H, Gao H, Ning E, Shao Z, Hao Y, Yang X.
Show Full Abstract

Osteoarthritis (OA) is characterized primarily by the degeneration of articular cartilage, with a high prevalence and disability rate. The functional phenotype of chondrocytes, as the sole cell type within cartilage, is vital for OA progression. Due to the avascular nature of cartilage and its limited regenerative capacity, repair following injury poses significant challenges. Various cellular stressors, including hypoxia, nutrient deprivation, oxidative stress, and collagen mutations, can lead to the accumulation of misfolded proteins in the endoplasmic reticulum (ER), resulting in ER stress (ERS). In response to restore ER homeostasis as well as cellular vitality and function, a series of adaptive mechanisms are triggered, including the unfolded protein response, ER-associated degradation, and ER-phagy. Prolonged or severe ERS may exceed the adaptive capacity of cells, leading to dysregulation in apoptosis and autophagy-key pathogenic factors contributing to chondrocyte damage and OA progression. This review examines the relationship between ERS in OA chondrocytes and both apoptosis and autophagy in order to identify potential therapeutic targets and strategies for prevention and treatment of OA.

Also flagged:OxygenNanospheresHydrogelschronic limb-threatening ischemialower limb ischemiamembrane
Journal Article 2024-11-19 No Snippets Zhao M, Zhou Z, Sherchan A, Yuan W, Xie X, Li M.
Show Full Abstract

<h4>Purpose</h4>Bone marrow mesenchymal stem cells (BMSCs) have emerged as promising candidate for postoperative therapeutics in chronic limb-threatening ischemia (CLTI). Nevertheless, their effectiveness is limited by their low survival rate and impaired functionality in the ischemic microenvironment. To overcome these challenges, we have devised an innovative delivery approach to support the utilization of BMSCs in CLTI therapy.<h4>Methods</h4>We synthesized oxygen-releasing nanospheres and self-healing hydrogels. The in vivo functionality of the hydrogel-nanosphere delivery system was evaluated via a multimodality animal live imaging system. A unilateral lower limb ischemia model was established in mice, and a delivery system loaded with BMSCs was administered. The experimental groups included normal mice, ischemic mice, ischemic mice treated with BMSCs in PBS, and ischemic mice treated with BMSCs in the delivery system. Blood perfusion was quantitatively measured via a laser doppler flowmeter (LDF). Immunofluorescence, Masson's trichrome staining, immunohistochemistry and enzyme-linked immunosorbent assay (ELISA) were also used.<h4>Results</h4>For cell viability analysis 80 μg.mL<sup>-1</sup> was considered the optimal concentration for cell survival. In vivo, 18 days after injection, the cell membrane fluorescence signal in the delivery system was significantly greater (5.655<sup>10</sup>±8.226<sup>8</sup>) p/s/cm²/sr than that in the other groups (p=0.043). Ischemic mice treated with BMSCs in the delivery system presented an improved limb salvage rate (0.926±0.12)% compared with that of ischemic mice treated with BMSCs in PBS (0.841±0.029)% at the 5th week after ischemia establishment (p=0.0033).<h4>Conclusion</h4>Our findings suggest that the survival time of BMSCs is prolonged in this innovative delivery system. The combination of nanospheres and hydrogels effectively restored vascular blood perfusion while exerting minimal toxicity on BMSCs. This novel approach combining oxygen-releasing nanospheres and self-healing hydrogels as a delivery system represents an advancement in enhancing the functionality of BMSCs to treat CLTI.

Also flagged:organizationdegradationosteoarthritiscorticosteroidextracellularmeniscus injuries
Journal Article 2024-11-19 No Snippets Ahmadpoor X, Sun J, Douglas N, Zhu W, Lin H.
Show Full Abstract

Autologous chondrocyte implantation (ACI) and matrix-induced ACI (MACI) have demonstrated improved clinical outcomes and reduced revision rates for treating osteochondral and chondral defects. However, their ability to achieve lasting, fully functional repair remains limited. To overcome these challenges, scaffold-enhanced ACI, particularly utilizing hydrogel-based biomaterials, has emerged as an innovative strategy. These biomaterials are intended to mimic the biological composition, structural organization, and biomechanical properties of native articular cartilage. This review aims to provide comprehensive and up-to-date information on advancements in hydrogel-enhanced ACI from the past decade. We begin with a brief introduction to cartilage biology, mechanisms of cartilage injury, and the evolution of surgical techniques, particularly looking at ACI. Subsequently, we review the diversity of hydrogel scaffolds currently undergoing development and evaluation in preclinical studies for articular cartilage regeneration, emphasizing chondrocyte-laden hydrogels applicable to ACI. Finally, we address the key challenges impeding effective clinical translation, with particular attention to issues surrounding fixation and integration, aiming to inform and guide the future progression of tissue engineering strategies.

Also flagged:GRPExtracellularVascular calcificationvesicleGla rich proteinbone-related proteins
Journal Article 2024-11-19 No Snippets Viegas C, Carreira J, Maia TM, Macedo AL, Matos AP, Neves J, Simes D.
Show Full Abstract

Vascular calcification (VC) is a complex process involving vascular smooth muscle cell (VSMC) osteogenic differentiation, inflammation, and extracellular vesicle (EV) calcification and communication networks. Gla rich protein (GRP) is a calcification inhibitor involved in most of these processes. However, the molecular mechanism of GRP in VC and the specific characteristics, cargo, and functionality of calcifying EVs require further elucidation. Here, we use a combination of human ex vivo aortic fragments and primary vascular smooth muscle cell (VSMC) models to obtain new information on GRP function in VC and EVs released by VSMCs. We demonstrate that GRP inhibits VSMC osteogenic differentiation through downregulation of bone-related proteins and upregulation of mineralization inhibitors, with decreased mineral crystallinity in EVs deposited into the tissue extracellular matrix (ECM). EVs isolated by ultracentrifugation at 30K and 100K from the cell media (CM) and deposited in the ECM from control (CTR) and mineralizing (MM) VSMCs were biochemically, physically, and proteomically characterized. Four different EV populations were identified with shared markers commonly present in all EVs but with unique protein cargo and specific molecular profiles. Comparative proteomics identified several regulated proteins specifically loaded into MM EV populations associated with multiple processes involved in VC. Functional analysis demonstrated that 30K and 100K ECM-MM EVs with higher calcium and lower GRP levels induced macrophage inflammation. Our findings reinforce the functional relevance of GRP in multiple VC processes and suggest that ECM EVs released under calcification stress function as a new signaling axis on the calcification-inflammation cycle.

HFE
Also flagged:AmpicillinDeathListeriosismeningitisbacteremiameningoencephalitis
Journal Article 2024-11-19 ✓ 1 Snippet Liau SK, Hung CC, Chen CY, Liu YC, Lu YA, Lin YJ, Chen YC, Tian YC, Tseng FG, Hsu HH.
In-Text Gene Mentions

…or liver disease,hemochromatosis, taking antacids or…

Show Full Abstract

<i>Listeria monocytogenes</i> causes listeriosis, a serious foodborne illness with a high mortality rate, especially in vulnerable populations. It accounts for 19% of foodborne deaths, with invasive cases having a mortality rate of up to 44%, leading to conditions like meningitis, bacteremia, and meningoencephalitis. However, the prognostic factors remain unclear. This study examines the hospital outcomes of invasive listeriosis and identifies risk factors for in-hospital and one-year mortality. We analyzed the electronic medical records of 118 hospitalized patients with non-perinatal, culture-proven invasive listeriosis collected over a 21-year period. The in-hospital mortality rate was 36.4%, with only 33.1% surviving one year and 22.0% surviving two years. The key findings indicate that a quick Sequential Organ Failure Assessment (qSOFA) score of ≥2 (OR 106.59, <i>p</i> < 0.001), respiratory failure (OR 7.58, <i>p</i> = 0.031), and shorter ampicillin duration (OR 0.53, <i>p</i> = 0.012) independently predicted poorer in-hospital outcomes. Additionally, a qSOFA score of ≥2 (OR 8.46, <i>p</i> < 0.001) and shorter ampicillin duration (OR 0.65, <i>p</i> < 0.001) were linked to higher one-year mortality. This study is the first to identify a qSOFA score of ≥2 as a significant marker for high-risk invasive listeriosis patients, with poorer outcomes linked to a qSOFA score of ≥2, respiratory failure, and shorter ampicillin use.

Also flagged:Myeloproliferative neoplasmspolycythemia veraessential thrombocytosisprimary myelofibrosishematopoietic stem cell neoplasmshematopoiesis
Journal Article 2024-11-19 No Snippets Spivak JL.
Show Full Abstract

Myeloproliferative neoplasms, polycythemia vera, essential thrombocytosis, and primary myelofibrosis are a unique group of clonal hematopoietic stem cell neoplasms that share somatic, gain-in-function driver mutations in <i>JAK</i>2, <i>CALR</i>, and <i>MPL</i>. As a consequence, these disorders exhibit similar phenotypic features, the most common of which are the ceaseless production of normal erythrocytes, myeloid cells, platelets alone or in combination, extramedullary hematopoiesis, myelofibrosis, and a potential for leukemic transformation. In the case of polycythemia vera and essential thrombocytosis, however, prolonged survival is possible. With an incidence value in the range of 0.5-2.0/100,000, myeloproliferative neoplasms are rare disorders, but they are not new disorders, and after a century of scrutiny, their clinical features and natural histories are well-defined, though their individual management continues to be controversial. With respect to polycythemia vera, there has been a long-standing dispute between those who believe that the suppression of red blood cell production by chemotherapy is superior to phlebotomy to prevent thrombosis, and those who do not. With respect to essential thrombocytosis, there is a similar dispute about the role of platelets in veinous thrombosis, and the role of chemotherapy in preventing thrombosis by suppressing platelet production. Linked to these disputes is another: whether therapy with hydroxyurea promotes acute leukemia in disorders with a substantial possibility of longevity. The 21st century revealed new insights into myeloproliferative neoplasms with the discovery of their three somatic, gain-of-function driver mutations. Almost immediately, this triggered changes in the diagnostic criteria for myeloproliferative neoplasms and their therapy. Most of these changes, however, conflicted with prior well-validated, phenotypically driven diagnostic criteria and the management of these disorders. The aim of this review is to examine these conflicts and demonstrate how genomic discoveries in myeloproliferative neoplasms can be used to effectively complement the known phenotypic features of these disorders for their diagnosis and management.

TNFSF4
Also flagged:ferroptosisKawasaki diseasesystemic vasculitisheart diseasedeathinfectious diseases
Journal Article 2024-11-19 ✓ 3 Snippets Yan R, Chen S, Lang X, Liu J, Zhou T.
In-Text Gene Mentions

…BTLA, LAG3, TIGIT,TNFSF4and TNFRSF4 genes…

…the CD274 andTNFSF4genes were highly…

…with CD274 andTNFSF4, but negatively correlated…

Show Full Abstract

Kawasaki disease (KD) is an acute febrile rash that is primarily characterized by systemic vasculitis and is the leading cause of childhood-acquired heart disease. At present, a KD diagnosis is solely dependent on clinical symptoms and effective diagnostic markers are unavailable. Ferroptosis, a novel form of programmed cell death, contributes to the pathophysiology of infectious diseases. The present study aimed to identify key ferroptosis-related genes (FRGs) involved in the pathological process of KD and thus potential diagnostic biomarkers for this disease. For this purpose, differentially expressed-FRGs (DE-FRGs) between patients with KD and healthy controls were screened. The least absolute shrinkage and selection operator (LASSO) algorithm and a logistic regression model combined with receiver operating characteristic analysis were then used to identify and assess ferroptosis-related markers. Additionally, immune cell infiltration landscapes in the KD and control groups were evaluated using CIBERSORT. Moreover, the predictive value of the identified markers was validated in the clinical samples as well as vascular endothelial cells. A total of 10 DE-FRGs were screened from the KD and control samples. These 10 DE-FRGs were then applied to the LASSO model and 6 key ferroptosis-related markers were obtained. The subsequent Gene Set Variation Analysis results suggested that high expression levels of these markers were closely associated with innate immune activation and metabolism, while low expression was mainly linked to adaptive immune-related pathways. In addition to validating each gene in the training and validation sets, the diagnostic potential of these markers was assessed utilizing KD samples obtained from Shenzhen Baoan Women's and Children's Hospital. As a result, MAPK14, SLC2A3 and PGD were selected as potential diagnostic markers for KD. Additionally, changes in the expression of marker genes during inflammatory activation of vascular endothelial cells were measured by reverse transcription-quantitative PCR. The results of the present study will help to understand the role of FRGs in the pathogenesis of KD. Moreover, the identified FRGs may serve as diagnostic biomarkers, providing new strategies for KD prediction and treatment.

HTT
Also flagged:neuropsychiatric disordersgeneralized anxiety disorderpost-traumatic stress disorderPTSDpsychiatric disorderspostsynaptic density proteins
Journal Article 2024-11-19 ✓ 2 Snippets Iqbal J, Huang GD, Shen D, Xue YX, Yang M, Jia XJ.
In-Text Gene Mentions

…Rtn3, Gria1, andHttgenes.…

…SPS reducedHtt(huntingtin) gene expression,…

Show Full Abstract

<h4>Introduction</h4>Transcriptomic studies offer valuable insights into the pathophysiology of traumatic stress-induced neuropsychiatric disorders, including generalized anxiety disorder and post-traumatic stress disorder (PTSD). The medial prefrontal cortex (mPFC) has been implicated in emotion, cognitive function, and psychiatric disorders. Alterations in the function of mPFC have been observed in PTSD patients. However, the specific transcriptomic mechanisms governed by genes within the mPFC under traumatic stress remain elusive.<h4>Methods</h4>In this study, we conducted transcriptome-wide RNA-seq analysis in the prelimbic (PL) and infralimbic (IL) cortices. We employed the single prolonged stress (SPS) animal model to simulate anxiety-like behavior, which was assessed using the open field and elevated plus maze tests.<h4>Results</h4>We identified sixty-two differentially expressed genes (DEGs) (FDR adjusted <i>p</i> < 0.05) with significant expression changes in the PL and IL mPFC. In the PL cortex, DEGs in the susceptible group exhibited reduced enrichment for cellular, biological, and molecular functions such as postsynaptic density proteins, glutamatergic synapses, synapse formation, transmembrane transport proteins, and actin cytoskeleton reorganization. In contrast, the IL-susceptible group displayed diminished enrichment for synapse formation, neuronal activity, dendrite development, axon regeneration, learning processes, and glucocorticoid receptor binding compared to control and insusceptible groups. DEGs in the PL-susceptible group were enriched for Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways related to Parkinson's disease, Huntington's disease, Alzheimer's disease, and neurodegeneration processes. In the IL cortex, the susceptible group demonstrated enrichment for KEGG pathways involved in regulating stress signaling pathways and addiction-like behaviors, compared to control and insusceptible groups.<h4>Conclusion</h4>Our findings suggest that SPS activates distinct transcriptional and molecular pathways in PL and IL cortices of mPFC, enabling differential coping mechanisms in response to the effects of traumatic stress. The enhanced enrichment of identified KEGG pathways in the PL and IL mPFC may underlie the anxiety-like behavior observed in susceptible rats.

Also flagged:Rho-associated kinasesNeurodegenerative diseasespathogenesisagingROCKsserine/threonine protein kinases
Journal Article 2024-11-19 No Snippets Ye Q, Li X, Gao W, Gao J, Zheng L, Zhang M, Yang F, Li H.
Show Full Abstract

Neurodegenerative diseases (NDDs) are prevalent in the elderly. The pathogenesis of NDDs is complex, and currently, there is no cure available. With the increase in aging population, over 20 million people are affected by common NDDs alone (Alzheimer's disease and Parkinson's disease). Therefore, NDDs have profound negative impacts on patients, their families, and society, making them a major global health concern. Rho-associated kinases (ROCKs) belong to the serine/threonine protein kinases family, which modulate diverse cellular processes (e.g., apoptosis). ROCKs may elevate the risk of various NDDs (including Huntington's disease, Parkinson's disease, and Alzheimer's disease) by disrupting synaptic plasticity and promoting inflammatory responses. Therefore, ROCK inhibitors have been regarded as ideal therapies for NDDs in recent years. Fasudil, one of the classic ROCK inhibitor, is a potential drug for treating NDDs, as it repairs nerve damage and promotes axonal regeneration. Thus, the current review summarizes the relationship between ROCKs and NDDs and the mechanism by which fasudil inhibits ROCKs to provide new ideas for the treatment of NDDs.

Also flagged:synthesisphenol redgelatincopperascorbic aciddegradation
Journal Article 2024-11-19 No Snippets Nguyen TD, Ngo ST, Hoang YH, Thai NTT, Nguyen HTT, Trinh GTN.
Show Full Abstract

This study presents a synthesis method for environmentally friendly copper nanoparticles using ascorbic acid and gelatin as key components. The influence of precursor concentration, reductant amount, and stabilizer on the process was systematically investigated to obtain optimal results for the synthesis. The optimal parameters for forming copper nanoparticles, including 20 g per L gelatin, 19.3 mM (AcO)<sub>2</sub>Cu, and 41.5 mM ascorbic acid, were determined using a central composite design of the response surface methodology. Successful generation of pure copper nanoparticles with both spherical and cylindrical shapes, whose sizes were 43.1 and 105.2 nm, respectively, was confirmed by X-ray diffraction analysis and transmission electron microscopy. The synthesized nanomaterial was stable for a two-week storage time after which they gradually oxidized into Cu<sup>2+</sup> ions. During antimicrobial activity testing, the synthesized nanoparticles displayed distinctive ability to inhibit the growth of Gram-positive bacteria (<i>Lactobacillus fermentum</i>, <i>Bacillus subtilis</i>, and <i>Staphylococcus aureus</i>), Gram-negative bacteria (<i>Escherichia coli</i>), and cancer cells (A549, Hep-G2, KB, and MCF7). Copper nanoparticles synthesized by chemical reduction demonstrated notable inhibitory activity against various pathogenic fungi that affect plants, including <i>Fusarium solani</i>, <i>Rhizoctonia solani</i>, and <i>Colletotrichum gloeosporioides</i>. Additionally, the catalytic activity of the produced nanomaterial with a bandgap energy of 2.14 eV and a specific surface area of 40.6 m<sup>2</sup> g<sup>-1</sup> was explored in the degradation of phenol, a common dye used in laboratories and industries. An optimized phenol red removal of 94.4% was achieved after a 540 second reaction time using response surface methodology, specifically a central composite design with an optimal dosage of copper nanoparticles at 31.5 ppm, a NaBH<sub>4</sub> concentration of 53.1 mM, and a pH of 7.5.

DCC
Also flagged:lung adenocarcinomacelltumorLUADgene expressionERG
Journal Article 2024-11-19 ✓ 1 Snippet Zhang Y, Cheng J, Jin P, Lv L, Yu H, Yang C, Zhang S.
In-Text Gene Mentions

… <i>BTK</i>, <i>IKZF3</i>, <i>DCC</i>, <i>EML4</i>, <i>MET</i>,…

Show Full Abstract

BackgroundT-cell exhaustion (TEX) in the tumor microenvironment causes immunotherapy resistance and poor prognosis.ObjectiveWe used bioinformatics to identify crucial TEX genes associated with the molecular classification and risk stratification of lung adenocarcinoma (LUAD).MethodsBulk RNA sequencing data of patients with LUAD were acquired from open sources. LUAD samples exhibited abnormal TEX gene expression, compared with normal samples. TEX gene-based prognostic signature was established and validated in both TCGA and GSE50081 datasets. Immune correlation and risk group-related functional analyses were also performed.ResultsEight optimized TEX genes were identified using the LASSO algorithm: <i>ERG</i>, <i>BTK</i>, <i>IKZF3</i>, <i>DCC</i>, <i>EML4</i>, <i>MET</i>, <i>LATS2</i>, and <i>LOX</i>. Several crucial Kyoto encyclopedia of genes and genomes (KEGG) pathways were identified, such as T-cell receptor signaling, toll-like receptor signaling, leukocytes trans-endothelial migration, Fcγ R-mediated phagocytosis, and GnRH signaling. Eight TEX gene-based risk score models were established and validated. Patients with high-risk scores had worse prognosis (P < 0.001). A nomogram model comprising three independent clinical factors showed good predictive efficacy for survival rate in patients with LUAD. Correlation analysis revealed that the TEX signature significantly correlated with immune cell infiltration, tumor purity, stromal cells, estimate, and immunophenotype score.ConclusionTEX-derived risk score is a promising and effective prognostic factor that is closely correlated with the immune microenvironment and estimated score. TEX signature may be a useful clinical diagnostic tool for evaluating pre-immune efficacy in patients with LUAD.

bioRxiv 2024-11-19 Preprint (No Snippets API) Korell F, Knudsen NH, Kienka T, Escobar G, Nobrega C, Anderson S, Cheng AY, Zschummel M, Bouffard A, Kann MC, Goncalves S, Pope HW, Pezeshki M, Rojas A, Suermondt JSMT, Phillips M, Berger TR, Park S, Salas-Benito D, Darnell EP, Birocchi F, Leick MB, Larson RC, Doench JG, Sen D, Yates KB, Manguso RT, Maus MV.
Show Full Abstract

Chimeric antigen receptor (CAR) T cells are highly effective in hematologic malignancies. However, loss of CAR T cells can contribute to relapse in a significant number of patients. These limitations could potentially be overcome by targeted gene editing to increase CAR T cell persistence. Here, we performed in vivo loss-of-function CRISPR screens in BCMA-targeting CAR T cells to investigate genes that influence CAR T cell persistence, function and efficacy in a human multiple myeloma model. We tracked the expansion and persistence of CRISPR-library edited T cells in vitro and then at early and late timepoints in vivo to track the performance of gene modified CAR T cells from manufacturing to survival in tumors. The screens revealed several context-specific regulators of CAR T cell expansion and persistence. Ablation of RASA2 and SOCS1 enhanced T cell expansion in vitro , while loss of PTPN2 , ZC3H12A , and RC3H1 conferred early selective growth advantages to CAR T cells in vivo . Strikingly, we identified cyclin-dependent kinase inhibitor 1B ( CDKN1B ), a cell cycle regulator, as the most important factor limiting CAR T cell fitness at late timepoints in vivo . CDKN1B ablation increased BCMA CAR T cell proliferation and effector function in response to antigen, significantly enhancing tumor clearance and overall survival. Thus, our findings reveal differing effects of gene-perturbation on CAR T cells over time and in different selective environments, highlight CDKN1B as a promising target to generate highly effective CAR T cells for multiple myeloma, and underscore the importance of in vivo screening as a tool for identifying genes to enhance CAR T cell function and efficacy.

ZNFX1
Also flagged:ZFP36Zinc finger proteinsZinc finger protein 36ZFP36L1ZFP36L2Senecavirus A infection
Journal Article 2024-11-18 ✓ 2 Snippets Yin M, Guan L, Zhang M, Li X, Qian P.
In-Text Gene Mentions

…During virus infection,ZNFX1expression is upregulated…

…is upregulated andZNFX1bind to viral…

Show Full Abstract

Zinc finger proteins (ZFPs) play an important role in the host-virus interplay. Zinc finger protein 36 is a member of the zinc finger protein 36 family, which includes two other paralogs, namely ZFP36L1 and ZFP36L2. Studies have demonstrated that ZFP36L1 acts as a host defender against influenza A virus and flaviviruses. However, the role of ZFP36 in host-virus interactions has not been thoroughly investigated. Here, we demonstrated that human zinc finger protein 36 (hZFP36) exhibited potent pro-viral activity during Senecavirus A infection. Overexpression of ZFP36 facilitated Senecavirus A infection, while hZFP36 knockdown inhibited viral replication. The ZF motifs of hZFP36 are key for promoting viral proliferation. hZFP36 stabilized Senecavirus A VP1 by binding to it. Furthermore, hZFP36 inhibited SeV-mediated IFN-β production through inducing caspase-dependent cleavage for MAVS. These findings provide insights into the mechanism of action of ZFP36 in host-virus interactions.

Also flagged:organellesmembranelessneurodegenerative disorderscardiovascular diseasesagingmetabolism
Journal Article 2024-11-18 No Snippets Li Y, Liu Y, Yu XY, Xu Y, Pan X, Sun Y, Wang Y, Song YH, Shen Z.
Show Full Abstract

Once considered unconventional cellular structures, membraneless organelles (MLOs), cellular substructures involved in biological processes or pathways under physiological conditions, have emerged as central players in cellular dynamics and function. MLOs can be formed through liquid-liquid phase separation (LLPS), resulting in the creation of condensates. From neurodegenerative disorders, cardiovascular diseases, aging, and metabolism to cancer, the influence of MLOs on human health and disease extends widely. This review discusses the underlying mechanisms of LLPS, the biophysical properties that drive MLO formation, and their implications for cellular function. We highlight recent advances in understanding how the physicochemical environment, molecular interactions, and post-translational modifications regulate LLPS and MLO dynamics. This review offers an overview of the discovery and current understanding of MLOs and biomolecular condensate in physiological conditions and diseases. This article aims to deliver the latest insights on MLOs and LLPS by analyzing current research, highlighting their critical role in cellular organization. The discussion also covers the role of membrane-associated condensates in cell signaling, including those involving T-cell receptors, stress granules linked to lysosomes, and biomolecular condensates within the Golgi apparatus. Additionally, the potential of targeting LLPS in clinical settings is explored, highlighting promising avenues for future research and therapeutic interventions.

HFE
Also flagged:IronIron overload diseasesbone resorptionbone formationclodronateOsteoporosis
Journal Article 2024-11-18 ✓ 1 Snippet Passin V, Ledesma-Colunga MG, Altamura S, Muckenthaler MU, Baschant U, Hofbauer LC, Rauner M, Rauner M.
In-Text Gene Mentions

…mouse models ofhemochromatosisobserved an increased…

Show Full Abstract

Iron is an essential element for physiological cellular processes, but is toxic in excess. Iron overload diseases are commonly associated with low bone mass. Increased bone resorption by osteoclasts as well as decreased bone formation by osteoblasts have been implicated in bone loss under iron overload conditions. However, the exact contribution of individual cell types has not yet been formally tested. In this study, we aimed to investigate the role of osteoclast precursors in iron overload-induced bone loss. To that end, we used clodronate liposomes to deplete phagocytic cells (including macrophages and osteoclast precursors) in male C57BL/6J mice that were exposed to ferric derisomaltose. Bone microarchitecture and bone turnover were assessed after 4 weeks. The application of clodronate resulted in the efficient depletion of circulating myeloid-lineage cells by about 70%. Depletion of osteoclast precursors mitigated iron overload-induced trabecular bone loss at the lumbar vertebrae and distal femur. While clodronate treatment led to a profound inhibition of bone turnover in control mice, it significantly reduced osteoclast numbers in iron-treated mice without further impacting the bone formation rate or serum PINP levels. Our observations suggest that even though bone formation is markedly suppressed by iron overload, osteoclasts also play a key role in iron overload-induced bone loss and highlight them as potential therapeutic targets.

CCPG1
Also flagged:-translationallumenRFPGFPendoplasmic reticulum
Journal Article 2024-11-18 ✓ 1 Snippet Sang Y, Li B, Su T, Zhan H, Xiong Y, Huang Z, Wang C, Cong X, Du M, Wu Y, Yu H, Yang X, Ding K, Wang X, Miao X, Gong W, Wang L, Zhao J, Zhou Y, Liu W, Hu X, Sun Q.
In-Text Gene Mentions

…of FAM134B-Flag, ATL3-Flag,CCPG1-Flag, RTN3L-Flag, SEC62-Flag,…

Show Full Abstract

ER-phagy is an evolutionarily conserved mechanism crucial for maintaining cellular homeostasis. However, significant gaps persist in our understanding of how ER-phagy and the ER network vary across cell subtypes, tissues, and organs. Furthermore, the pathophysiological relevance of ER-phagy remains poorly elucidated. Addressing these questions requires developing quantifiable methods to visualize ER-phagy and ER architecture in vivo. We generated two transgenic mouse lines expressing an ER lumen-targeting tandem RFP-GFP (ER-TRG) tag, either constitutively or conditionally. This approach enables precise spatiotemporal measurements of ER-phagy and ER structure at single-cell resolution in vivo. Systemic analysis across diverse organs, tissues, and primary cultures derived from these ER-phagy reporter mice unveiled significant variations in basal ER-phagy, both in vivo and ex vivo. Furthermore, our investigation uncovered substantial remodeling of ER-phagy and the ER network in different tissues under stressed conditions such as starvation, oncogenic transformation, and tissue injury. In summary, both reporter models represent valuable resources with broad applications in fundamental research and translational studies.

MLLT10
Also flagged:chromosomepigmentationchromosomesWCP 1organizationmicrochromosomes
Journal Article 2024-11-18 ✓ 2 Snippets Silva M, Mazzoni Zerbinato Andrade Silva D, Castro JP, Makunin AI, Barby FF, de Oliveira EHC, Liehr T, Cioffi MB, Porto-Foresti F, Foresti F, Artoni RF.
In-Text Gene Mentions

…them: Nyap1 ,Mllt10, and Pcdb…

…the Nyap1 ,Mllt10and Pcdb genes…

Show Full Abstract

Natural selection in the cave habitat has resulted in unique phenotypic traits (including pigmentation loss and ocular degeneration) in the Mexican tetra Astyanax mexicanus, considered a model species for evolutionary research. A. mexicanus has a karyotype of 2n = 50 chromosomes, and long-read sequencing and quantitative trait linkage maps (QTLs) have completely reconstructed the reference genome at the chromosomal level. In the current work, we performed whole chromosome isolation by microdissection and total amplification using DOP-PCR and Whole Chromosome Painting (WCP), followed by sequencing on the Illumina NextSeq platform, to investigate the microstructure of the large and conserved metacentric chromosome 1 of A. mexicanus. The sequences aligned to linkage block 3 of the reference genome, as determined by processing the reads with the DOPseq pipeline and characterizing the satellites with the TAREAN program. In addition, part of the sequences was anchored in linkage blocks that have not yet been assigned to the chromosomes. Furthermore, fluorescence in situ hybridization using WCP 1 carried out in other nearby species revealed a high degree of chromosome conservation, which allows us to hypothesize a common origin of this element. The physical mapping of the repetitive marker sequences provided a micro- and macrostructural overview and confirmed their position in chromosome pair 1. These sequences can serve as comparative tools for understanding the evolution and organization of this chromosome in other species of the family in future studies.

POU3F2
Also flagged:FABP7Fatty acid binding protein 7MEK1MEKautismAutism spectrum disorder
Journal Article 2024-11-18 ✓ 2 Snippets Han X, He Y, Wang Y, Hu W, Chu C, Huang L, Hong Y, Han L, Zhang X, Gao Y, Lin Y, Ma H, Shen H, Ke X, Liu Y, Hu Z.
In-Text Gene Mentions

…BCL11B, SATB2 andPOU3F2, were expressed…

…expression of CUX1,POU3F2, and SATB2…

Show Full Abstract

Autism spectrum disorder (ASD), which is caused by heterogeneous genetic and environmental factors, is characterized by diverse clinical phenotypes linked to distinct pathological mechanisms. ASD individuals with a shared clinical phenotype might contribute to revealing the molecular mechanism underlying ASD progression. Here, it is generated induced pluripotent stem cell (iPSC)-derived cerebral organoids from normocephalic individuals with ASD in a prospective birth cohort with a shared clinical diagnosis. Multiple cell lines and time series scRNA-seq combined with a histomorphological analysis revealed premature neural differentiation of neural stem cells (NSCs) and decreased expression of Fatty acid binding protein 7 (FABP7) in ASD organoids. It is subsequently revealed alterations in the phosphorylation levels of Mitogen-Activated Protein Kinase Kinase 1/2 (MEK1/2), which are downstream of FABP7, and the regulation of the FABP7/MEK pathway reversed improper neural differentiation in the ASD organoids. Moreover, both Fabp7-knockdown and MEK2-overexpressing mice exhibited repetitive stereotyped behaviors and social defects relevant to autism. This study reveals the role of the FABP7/MEK pathway in abnormal NSC differentiation in normocephalic individuals with ASD, which might provide a promising therapeutic target for ASD treatment.

OLFM4
Also flagged:TET3cell differentiationTETphosphorylationATP synthasemitochondrial
Journal Article 2024-11-18 ✓ 3 Snippets Mulet I, Grueso-Cortina C, Cortés-Cano M, Gerovska D, Wu G, Iakab SA, Jimenez-Blasco D, Curtabbi A, Hernansanz-Agustín P, Ketchum H, Manjarrés-Raza I, Wunderlich FT, Bolaños JP, Dawlaty MM, Hopf C, Enríquez JA, Araúzo-Bravo MJ, Tapia N.
In-Text Gene Mentions

…cell-type specific probes:OLFM4(311838-C2), MUC2 (315458-C2),…

…detected together withOlfm4, Vil1 , Muc2…

…inversely correlates toOlfm4, Muc2 and…

Show Full Abstract

TET-family members play a critical role in cell fate commitment. Indeed, TET3 is essential to postnatal development due to yet unknown reasons. To define TET3 function in cell differentiation, we have profiled the intestinal epithelium at single-cell level from wild-type and Tet3 knockout mice. We have found that Tet3 is mostly expressed in differentiated enterocytes. In the absence of TET3, enterocytes exhibit an aberrant differentiation trajectory and do not acquire a physiological cell identity due to an impairment in oxidative phosphorylation, specifically due to an ATP synthase assembly deficiency. Moreover, spatial metabolomics analysis has revealed that Tet3 knockout enterocytes exhibit an unphysiological metabolic profile when compared with their wild-type counterparts. In contrast, no metabolic differences have been observed between both genotypes in the stem cell compartment where Tet3 is mainly not expressed. Collectively, our findings suggest a mechanism by which TET3 regulates mitochondrial function and, thus, terminal cell differentiation at the metabolic level.

CSE1L
Also flagged:PDneurodegenerative diseasepostural instabilityLewy bodiesalpha-synucleinα-Syn
Journal Article 2024-11-18 ✓ 1 Snippet Beric A, Sun Y, Sanchez S, Martin C, Powell T, Kumar R, Pardo JA, Darekar G, Sanford J, Dikec D, Phillips B, Botia JA, Cruchaga C, Ibanez L.
In-Text Gene Mentions

…in brain (circCSE1L, circ RNF13…

Show Full Abstract

To identify circRNAs associated with Parkinson's disease (PD) we leveraged two of the largest publicly available studies with longitudinal clinical and blood transcriptomic data. We performed a cross-sectional study utilizing the last visit of each participant (N = 1848), and a longitudinal analysis that included 1166 participants with at least two time points. We identified 192 differentially expressed circRNAs, with effects that were sustained during disease, in mutation carriers, and diverse ancestry. The 192 circRNAs were leveraged to distinguish between PD and healthy participants with a ROC AUC of 0.797. Further, 71 circRNAs were sufficient to distinguish between genetic PD (AUC<sub>71</sub> = 0.954) and, at-risk participants (AUC<sub>71</sub> = 0.929) and healthy controls, supporting that circRNAs have the potential to aid the diagnosis of PD. Finally, we identified five circRNAs highly correlated with symptom severity. Overall, we demonstrated that circRNAs play an important role in PD and can be clinically relevant to improve diagnostic and monitoring.

HTT
Also flagged:GRK4COPDChronic obstructive pulmonary diseaserespiratory disorderG protein-coupled receptor kinase 4MR
Journal Article 2024-11-18 ✓ 5 Snippets Chen G, Jin Y, Chu C, Zheng Y, Yang C, Chen Y, Zhu X.
In-Text Gene Mentions

…XPNPEP3 , andHTT) and one…

…, XPNPEP3 ,HTT, and NOP14-AS1…

…TET2 , andHTTexhibited significance in…

…TET2 , andHTT(Fig. 3 ).…

…TET2 , andHTT—for SMR and…

Show Full Abstract

Chronic obstructive pulmonary disease (COPD) is a prevalent respiratory disorder with environmental factors being the primary risk determinants. However, genetic factors also substantially contribute to the susceptibility and progression of COPD. Although genome-wide association studies (GWAS) have identified several loci associated with COPD susceptibility, the specific pathogenic genes underlying these loci, along with their biological functions and roles within regulatory networks, remain unclear. This lack of clarity constrains our ability to achieve a deeper understanding of the genetic basis of COPD. This study leveraged the FinnGen R11 genetic dataset, comprising 21,617 cases and 372,627 controls, along with GTEx V8 eQTLs data to conduct a cross-tissue transcriptome-wide association study (TWAS). Initially, we performed a cross-tissue TWAS analysis using the Unified Test for Molecular Signatures (UTMOST), followed by validation of the UTMOST findings in single tissues using the Functional Summary-based Imputation (FUSION) method and conditional and joint (COJO) analyses of the identified genes. Subsequently, candidate susceptibility genes were screened using Multi-marker Analysis of Genomic Annotation (MAGMA). The causal relationship between these candidate genes and COPD was further evaluated through summary data-based Mendelian randomization (SMR), colocalization analysis, and Mendelian randomization (MR). Additionally, the identified results were validated against the COPD dataset in the GWAS Catalog (GCST90399694). GeneMANIA was employed to further explore the functional significance of these susceptibility genes. In the cross-tissue TWAS analysis (UTMOST), we identified 17 susceptibility genes associated with COPD. Among these, a novel susceptibility gene, G protein-coupled receptor kinase 4 (GRK4), was validated through single-tissue TWAS (FUSION) and MAGMA analyses, with further confirmation via SMR, MR, and colocalization analyses. Moreover, GRK4 was validated in an independent dataset. This study identifies GRK4 as a potential novel susceptibility gene for COPD, which may influence disease risk by exacerbating inflammatory responses. The findings address gaps in previous single-tissue GWAS studies, revealing consistent expression and potential function of GRK4 across different tissues. However, considering the study's limitations, further investigation and validation of GRK4's role in COPD are warranted.

UNC13C
Also flagged:Triple-negative inflammatory breast cancerIBCbreast cancertumorstumorInflammatory breast cancer
Journal Article 2024-11-18 ✓ 1 Snippet Wang X, Zhao L, Song X, Wu X, Krishnamurthy S, Semba T, Shao S, Knafl M, Coffer LW, Alexander A, Vines A, Bopparaju S, Woodward WA, Chu R, Zhang J, Yam C, Loo LWM, Nasrazadani A, Huong LP, Woodman SE, Futreal A, Rare Tumor Initiative Team, Tripathy D, Ueno NT.
In-Text Gene Mentions

…p < 0.0001),UNC13C(Log2FC = −8.22,…

Show Full Abstract

Triple-negative inflammatory breast cancer (TN-IBC) is the most aggressive type of breast cancer, yet its defining genomic, molecular, and immunological features remain largely unknown. In this study, we performed the largest and most comprehensive genomic and transcriptomic analyses of prospectively collected TN-IBC patient samples from a phase II clinical trial (ClinicalTrials.gov, NCT02876107, registered on August 22, 2016) and compared them to similarly analyzed stage III TN-non-IBC patient samples (ClinicalTrials.gov, NCT02276443, registered on October 21, 2014). We found that TN-IBC tumors have distinctive genomic, molecular, and immunological characteristics, including a lower tumor mutation load than TN-non-IBC, and an association of immunosuppressive tumor-infiltrating immune components with an unfavorable response to neoadjuvant chemotherapy. To our knowledge, this is the only study in which TN-IBC and TN-non-IBC samples were collected prospectively. Our analysis improves the understanding of the molecular landscape of the most aggressive subtype of breast cancer. Further studies are needed to discover novel prognostic biomarkers and druggable targets for TN-IBC.

OLFM4
Also flagged:EGFSPP1cell-cell communicationtranslationalbicarbonatemucin 2
Journal Article 2024-11-18 ✓ 1 Snippet Cherubini A, Rusconi F, Piras R, Wächtershäuser KN, Dossena M, Barilani M, Mei C, Hof L, Sordi V, Pampaloni F, Dolo V, Piemonti L, Lazzari L.
In-Text Gene Mentions

…cluster 4 (OLFM4+ transitional to…

Show Full Abstract

Human organoids have been proposed to be powerful tools mimicking the physiopathological processes of the organs of origin. Recently, human pancreatic organoids (hPOs) have gained increasing attention due to potential theragnostic and regenerative medicine applications. However, the cellular components of hPOs have not been defined precisely. In this work, we finely characterized these structures, focusing first on morphology and identity-defining molecular features under long-term culture conditions. Next, we focused our attention on hPOs cell type composition using single-cell RNA sequencing founding a complex heterogeneity in ductal components, ranging from progenitor components to terminally differentiated ducts. Furthermore, an extensive comparison of human pancreatic organoids with previously reported transcriptomics signature of human and mouse pancreatic ductal populations, confirmed the functional pancreatic duct subpopulation heterogeneity. Finally, we showed that pancreatic organoid cells follow a precise developmental trajectory and utilize diverse signalling mechanisms, including EGF and SPP1, to facilitate cell-cell communication and maturation. Together our results offer an in-depth description of human pancreatic organoids providing a strong foundation for future in vitro diagnostic and translational studies of pancreatic health and disease.

SERPINC1
Also flagged:extracellular vesiclesBST2papillary thyroid microcarcinomanodeextracellularvesicles
Journal Article 2024-11-18 ✓ 4 Snippets Cao Z, Wang Y, Wu J, Tang X, Qian Z, Zhang Z, Liu R, Liu P, Li Z, Xu X, Liu Z.
In-Text Gene Mentions

…BST2,SERPINC1, RNH1, and DEFA1…

…AUCs of BST2,SERPINC1, RNH1, and DEFA1…

…analysis revealed thatSERPINC1, RNH1, DEFA1, and…

…reported that upregulatedSERPINC1could be beneficial…

Show Full Abstract

Papillary thyroid microcarcinoma (PTMC), although frequently indolent, could be aggressive in a few patients, leading to lymph node metastasis (LNM) and worsened prognosis. To explore the role of protein profiling of small extracellular vesicles (sEVs) in the auxiliary diagnosis and risk stratification of PTMC, proteins in serum sEVs isolated from PTMC patients with (N = 10) and without (N = 10) LNM and benign thyroid nodule (BN) patients (N = 9) were profiled via a bioinformatics-integrated data-independent acquisition proteomic technique. The performance of candidate proteins as diagnostic and prognostic biomarkers in PTMC was assessed via receiver operating characteristic analysis. We found that serum sEVs from PTMC patients promoted the proliferation and migration of human papillary thyroid cancer (PTC) cells and tube formation in human lymphatic endothelial cells (HLECs). SEV proteins from PTMC patients with and without LNM have differential expression profiles, with bone marrow stromal cell antigen 2 (BST2) being best associated with PTMC progression. Through knockdown and overexpression, we proved that the high expression of sEV-derived BST2 was bound up with higher proliferation and migration ability of PTC cells as well as stronger lymphangiogenesis in HLECs. This study brought insight into the differential sEV-protein profile with or without LNM in PTMC. The serum sEV-BST2 may contribute to PTMC progression and LNM and may have diagnostic, prognostic, and therapeutic implications.

OLFM4
Also flagged:Fanconi AnemiaoxygenanemiaFAAP20cholesterolmetabolism
Journal Article 2024-11-18 ✓ 3 Snippets Shin SC, Kim S, Kim HW, Lee JH, Kim JH.
In-Text Gene Mentions

…FAAP20, SOAT1, OLFM,OLFM4, and MBP-like isoform,…

…SOAT1( XP_034094487.1 ),OLFM4( XP_034051626.1 and…

…the SOAT1, OLFM,OLFM4, and MBP-like isoform…

Show Full Abstract

<h4>Background</h4>The white-blooded Antarctic icefishes is a representative organism that survive under the stenothermal conditions of the Southern Ocean without the hemoglobin genes. To compensate for inefficient oxygen transport, distinct features such as increased heart size, greater blood volume, and reduced hematocrit density enhance the amount of dissolved oxygen and the velocity of blood flow.<h4>Results</h4>Here, we investigated these unique characteristics by comparing high-quality genomic data between white-blooded and red-blooded fishes and identified the loss of FAAP20, which is implicated in anemia. Although the gene region containing FAAP20 is conserved in notothenioids as shown through collinear analysis, only remnants of FAAP20 persist in several icefish species. Additionally, we observed the loss of SOAT1, which plays a pivotal role in cholesterol metabolism, providing a clue for further investigations into the unique mitochondrial form of the icefish.<h4>Conclusions</h4>The loss of FAAP20, which is known to reduce erythrocyte counts under stress conditions in mice and humans, may provide a clue to understanding the genomic characteristics related to oxygen supply, such as low hematocrit, in Antarctic icefishes.

NEGR1
Also flagged:bipolar disorderAP1ARanxietysynaptic transmissionpolygenicdepression
Journal Article 2024-11-18 ✓ 5 Snippets Li S, Ni H, Wang Y, Wu X, Bi J, Ou H, Li Z, Ping J, Wang Z, Chen R, Yang Q, Jiang M, Cao L, Jiang T, Ren S, Zhao C.
In-Text Gene Mentions

…behaviors by reducingNegr1-mediated excitatory synaptic …

…overexpression of recombinantNegr1in the mPFC…

…that AP1AR-DT reducesNEGR1expression by competing…

…disorder revealed thatNEGR1, which encodes…

…, which encodesneuronal growth regulator 1growth regulator 1,…

Show Full Abstract

<h4>Background</h4>Bipolar disorder is a complex polygenic disorder that is characterized by recurrent episodes of depression and mania, the heterogeneity of which is likely complicated by epigenetic modifications that remain to be elucidated.<h4>Methods</h4>We performed transcriptomic analysis of peripheral blood RNA from monozygotic (MZ) twins discordant for bipolar disorder to identify disease-associated differentially expressed long noncoding RNAs (DE-lncRNAs), which were further validated in the PsychENCODE brain RNA-seq dataset. We then performed behavioral tests, electrophysiological assays, chromatin immunoprecipitation, and PCR to investigate the function of DE-lncRNAs in the mouse and cell models. Statistical analyses were performed using GraphPad Prism 9.0 or SPSS.<h4>Results</h4>We identified a bipolar disorder-associated upregulated long non-coding RNA (lncRNA), AP1AR-DT. We observed that overexpression of AP1AR-DT in the mouse medial prefrontal cortex (mPFC) resulted in a reduction of both the total spine density and the spontaneous excitatory postsynaptic current (sEPSC) frequency of mPFC neurons as well as depressive and anxiety-like behaviors. A combination of the results of brain transcriptome analysis of AP1AR-DT overexpressing mice brains with the known genes associated with bipolar disorder revealed that NEGR1, which encodes neuronal growth regulator 1, is one of the AP1AR-DT targets and is reduced in vivo upon gain of AP1AR-DT in mice. We further demonstrated that overexpression of recombinant Negr1 in the mPFC neurons of AP1AR-DT<sub>OE</sub> mice ameliorates depressive and anxiety-like behaviors and normalizes the reduced excitatory synaptic transmission induced by the gain of AP1AR-DT. We finally identified that AP1AR-DT reduces NEGR1 expression by competing for the transcriptional activator NRF1 in the overlapping binding site of the NEGR1 promoter region.<h4>Conclusions</h4>The epigenetic and pathophysiological mechanism linking AP1AR-DT to the modulation of depressive and anxiety-like behaviors and excitatory synaptic function provides etiological implications for bipolar disorder.

Also flagged:Meninacute myeloid leukemiaAMLFLT3IDH1venetoclax
Journal Article 2024-11-18 No Snippets Nadiminti KVG, Sahasrabudhe KD, Liu H.
Show Full Abstract

The AML treatment landscape has significantly changed in recent years with the approval of targeted therapies in the front-line and relapsed/refractory settings, including inhibitors of FLT3 and IDH1/2 mutations. More importantly, approval of the combination of the BCl-2 inhibitor, venetoclax, and hypomethylating agents or low dose cytarabine provided unprecedented breakthrough for the frontline treatment of older, unfit AML patients. Even with all this exciting progress, more targeted therapies for AML treatment are needed. Recent development of menin inhibitors targeting AML with KMT2A rearrangements or NPM1 mutations could represent a promising new horizon of treatment for patients within these subsets of AML. Our current review will focus on a summary and updates of recent developments of menin inhibitors in the treatment of AML, on the challenges ahead arising from drug resistance, as well as on the opportunities of novel combinations with menin inhibitors.

TRIM38
Also flagged:Skeletal Dysplasiagrowth disorderheart diseaseinfertilitytumorsFibrous
Journal Article 2024-11-18 ✓ 1 Snippet Karlberg S, Toiviainen-Salo S, Lipsanen-Nyman M, Mäkitie O.
In-Text Gene Mentions

…TRIM21, TRIM33 andTRIM38, mediate osteogenesis or…

Show Full Abstract

Mulibrey nanism (MUL) is a monogenic growth disorder caused by mutations in TRIM37, with pre-and postnatal growth failure, typical craniofacial features, perimyocardial heart disease, infertility and predisposition to tumors. Clinically, patients are gracile with relative macrocephaly, thin extremities, and narrow shoulders, but the full spectrum of skeletal features remains unknown. We conducted a cross-sectional study in order to further clarify the skeletal phenotype. We assessed radiographs of the long bones and spine in 33 MUL patients, aged 4.5-48 years (14 females and 19 males, median age 16.7 years) for skeletal features. Hospital records were reviewed for clinical characteristics and fractures. Results confirmed significant skeletal abnormalities related to MUL. Skeletal changes were present in all patients; long bones were slender and bowed with broad metaphyses and narrow diaphysis, the cortices were thick, and medullary cavities were narrow. The vertebral bodies were tall. Fibrous dysplasia was found in 19/33 patients (58%); changes were monostotic in 58% and polyostotic in 42%. Altogether 17/33 patients (52%) had a history of fractures. This study confirms that in addition to short stature, patients with MUL have a specific skeletal dysplasia. Our findings suggest an important role for TRIM37 in cellular functions governing skeletal modelling and remodelling.

ZNFX1
Also flagged:obesitymyopiarefractive errorsrefractive errorvisionpathogenesis
Journal Article 2024-11-18 ✓ 1 Snippet Lu Y, Zhang CC, Ma RT, Li YJ, Li WP, Hu DW, Zhou LH.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

<h4>Aim</h4>To study the causal relationship between obesity-related anthropometric traits and myopia and the mediating role of educational attainment (EA).<h4>Methods</h4>Univariable Mendelian randomization (UVMR) was performed to evaluate the causal association between body mass index (BMI), height, waist-hip ratio (WHR, adjusted for BMI), and mean spherical equivalent (MSE). BMI was divided into fat and fat-free mass and included in multivariable Mendelian randomization (MVMR) to explore the roles of different BMI components in the causal relationship between BMI and MSE. A mediation analysis based on two-step Mendelian randomization (MR) was carried out. Specifically, UVMR was conducted to estimate the causal effect of BMI on EA. The direct effect of EA on MSE was estimated from MVMR. The mediation effect of EA in the BMI-EA-MSE model was calculated by the product of coefficients method. Expression quantitative trait loci (eQTL)-MR, reverse MR, and Linkage Disequilibrium Score Regression (LDSC) were performed to assess the robustness.<h4>Results</h4>Genetically predicted higher BMI had a positive total effect on MSE (<i>β</i>IVW=0.26 D, 95%CI=0.14 to 0.37 D, <i>P</i><0.001), whereas there was no significant association between height, WHR, and MSE. Fat mass was found to play a significant role in the effect of body mass on MSE (<i>β</i>IVW=0.50 D, 95%CI=0.21 to 0.78 D, <i>P</i>=0.001), but there was no significant association between fat-free mass and MSE. The causal effect of BMI on EA was -0.14 (95%CI=-0.16 to -0.11, <i>P</i><0.001), and the direct effect of EA on MSE was -0.63 D (95%CI=-0.81 to -0.44 D, <i>P</i><0.001). The mediating effect of EA in the BMI-EA-MSE model was 0.09 D (95%CI=0.06 to 0.12 D), with a mediation proportion of 33% (95%CI=22.1% to 44.6%). No reverse causal associations were detected except for BMI on EA. The results of eQTL-MR and LDSC were consistent with each MR analysis.<h4>Conclusion</h4>Genetically predicted higher BMI decreases the degree of myopia with a 33% mediation proportion by EA, and fat mass provides a dominant protective role in body mass-myopia. As a supplement to previous observational studies, it provides strong evidence for the relationship between anthropometric traits and refractive errors and offers a theoretical basis for future measures to prevent and control myopia.

Also flagged:zoonosesreceptorbindinginfectionCD4CD8
Journal Article 2024-11-18 No Snippets Case JB, Sanapala S, Dillen C, Rhodes V, Zmasek C, Chicz TM, Switzer CE, Scheaffer SM, Georgiev G, Jacob-Dolan C, Hauser BM, Dos Anjos DCC, Adams LJ, Soudani N, Liang CY, Ying B, McNamara RP, Scheuermann RH, Boon ACM, Fremont DH, Whelan SPJ, Schmidt AG, Sette A, Grifoni A, Frieman MB, Diamond MS.
Show Full Abstract

The continued emergence of SARS-CoV-2 variants and the threat of future Sarbecovirus zoonoses have spurred the design of vaccines that can induce broad immunity against multiple coronaviruses. Here, we use computational methods to infer ancestral phylogenetic reconstructions of receptor binding domain (RBD) sequences across multiple Sarbecovirus clades and incorporate them into a multivalent adenoviral-vectored vaccine. Mice immunized with this pan-Sarbecovirus vaccine are protected in the upper and lower respiratory tracts against infection by historical and contemporary SARS-CoV-2 variants, SARS-CoV, and pre-emergent SHC014 and Pangolin/GD coronavirus strains. Using genetic and immunological approaches, we demonstrate that vaccine-induced protection unexpectedly is conferred principally by CD4<sup>+</sup> and CD8<sup>+</sup> T cell-mediated anamnestic responses. Importantly, prior mRNA vaccination or SARS-CoV-2 respiratory infection does not alter the efficacy of the mucosally delivered pan-Sarbecovirus vaccine. These data highlight the promise of a phylogenetic approach for antigen and vaccine design against existing and pre-emergent Sarbecoviruses with pandemic potential.

Also flagged:MethylCyclodextrinBone Morphogenetic Protein 2agingbone morphogenetic proteinBMP
Journal Article 2024-11-18 No Snippets Halloran D, Pandit V, Chukwuocha K, Nohe A.
Show Full Abstract

During aging, disruptions in various signaling pathways become more common. Some older patients will exhibit irregular bone morphogenetic protein (BMP) signaling, which can lead to osteoporosis (OP)-a debilitating bone disease resulting from an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved recombinant human BMP-2 (rhBMP-2) for use in spinal fusion surgeries as it is required for bone formation. However, complications with rhBMP-2 arose and primary osteoblasts from OP patients often fail to respond to BMP-2. Although patient samples are available for study, previous medical histories can impact results. Consequently, the C57BL/6 mouse line serves as a valuable model for studying OP and aging. We find that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month-old mice, consistent with prior data. Furthermore, conjugating BMP-2 with Quantum Dots (QDot<sup>®</sup>s) allows effective binding to BMPRIa, creating a fluorescent tag for BMP-2. Furthermore, after treating BMSCs with methyl-β-cyclodextrin (MβCD), a disruptor of cellular endocytosis, BMP signaling is restored in 15-month-old mice, as shown by von Kossa assays. MβCD has the potential to restore BMPRIa function, and the BMP signaling pathway offers a promising avenue for future OP therapies.

Also flagged:Atopic dermatitisADchronic inflammatory skin diseasepathogenesispolyunsaturated fatty acidsSPM
Journal Article 2024-11-18 No Snippets Livshits G, Kalinkovich A.
Show Full Abstract

Atopic dermatitis (AD) is a chronic inflammatory skin disease with multifactorial and unclear pathogenesis. Its development is characterized by two key elements: epigenetic dysregulation of molecular pathways involved in AD pathogenesis and disrupted skin and gut microbiota (dysbiosis) that jointly trigger and maintain chronic inflammation, a core AD characteristic. Current data suggest that failed inflammation resolution is the main pathogenic mechanism underlying AD development. Inflammation resolution is provided by specialized pro-resolving mediators (SPMs) derived from dietary polyunsaturated fatty acids acting through cognate receptors. SPM levels are reduced in AD patients. Administration of SPMs or their stable, small-molecule mimetics and receptor agonists, as well as supplementation with probiotics/prebiotics, demonstrate beneficial effects in AD animal models. Epidrugs, compounds capable of restoring disrupted epigenetic mechanisms associated with the disease, improve impaired skin barrier function in AD models. Based on these findings, we propose a novel, multilevel AD treatment strategy aimed at resolving chronic inflammation by application of SPM mimetics and receptor agonists, probiotics/prebiotics, and epi-drugs. This approach can be used in conjunction with current AD therapy, resulting in AD alleviation.

Also flagged:Thrombospondin 1AutophagyAge-related macular degenerationdegenerative eye diseasevisionrho-associated protein kinase
Journal Article 2024-11-18 No Snippets Catral KPC, Tse CY, Yang WY, Ling CY, Kwok OL, Choy KY, Lu DQ, Bian JF, Lam TC, Tse DY, Shan SS.
Show Full Abstract

Age-related macular degeneration (AMD) is a degenerative eye disease leading to central vision loss and is characterized by dysregulated autophagy of the retinal pigment epithelium (RPE) layer. Recent studies have suggested that rho-associated protein kinase (ROCK) inhibitors may enhance autophagy in neurodegenerative diseases and promote the survival of RPE cells. This study investigated the effect of ROCK inhibitors on autophagy gene expression and autophagic vacuole formation in a human RPE (ARPE-19) cell line. The highly selective and potent ROCK inhibitor Y-39983 enhanced the expression of autophagy genes in ARPE-19 cells and increased autophagic vacuole formation. A proteomic analysis using mass spectrometry was performed to further characterize the effects of ROCK inhibition at the protein level. Y-39983 downregulated thrombospondin-1 (THBS1), and suppression of THBS1 in ARPE-19 cells resulted in an increase in autophagic vacuole formation. Our data showed that ROCK inhibitor-induced autophagy was mediated by THBS1 downregulation. We identified ROCK and THBS1 as potential novel therapeutic targets in AMD.

Also flagged:Polyunsaturated fatty acidsarachidonic acidglycerophospholipidsvinyletherglycerol
Journal Article 2024-11-18 No Snippets Balsinde J, Balboa MA.
Show Full Abstract

Polyunsaturated fatty acids such as arachidonic acid are indispensable components of innate immune signaling. Plasmalogens are glycerophospholipids with a vinyl ether bond in the sn-1 position of the glycerol backbone instead of the more common sn-1 ester bond present in "classical" glycerophospholipids. This kind of phospholipid is particularly rich in polyunsaturated fatty acids, especially arachidonic acid. In addition to or independently of the role of plasmalogens as major providers of free arachidonic acid for eicosanoid synthesis, plasmalogens also perform a varied number of functions. Membrane plasmalogen levels may determine parameters of the plasma membrane, such as fluidity and the formation of microdomains that are necessary for efficient signal transduction leading to optimal phagocytosis by macrophages. Also, plasmalogens may be instrumental for the execution of ferroptosis. This is a nonapoptotic form of cell death that is associated with oxidative stress. This review discusses recent data suggesting that, beyond their involvement in the cellular metabolism of arachidonic acid, the cells maintain stable pools of plasmalogens rich in polyunsaturated fatty acids for executing specific responses.

NEGR1
Also flagged:neurological diseaseneurological disordersα-synucleinglial fibrillary acidic proteinGFAPPD
Journal Article 2024-11-18 ✓ 1 Snippet Arya R, Haque AKMA, Shakya H, Billah MM, Parvin A, Rahman MM, Sakib KM, Faruquee HM, Kumar V, Kim JJ.
In-Text Gene Mentions

…1, CD36, DUS3,NEGR1, Notch1, TrkB, and…

Show Full Abstract

Parkinson's disease (PD) is a progressive neurological disease that causes both motor and nonmotor symptoms. While our understanding of putative mechanisms has advanced significantly, it remains challenging to verify biomarkers with sufficient evidence for regular clinical use. Clinical symptoms are the primary basis for diagnosing the disease, which can be mild in the early stages and overlap with other neurological disorders. As a result, clinical testing and medical records are mostly relied upon for diagnosis, posing substantial challenges during both the initial diagnosis and the continuous disease monitoring. Recent biochemical, neuroimaging, and genetic biomarkers have helped us understand the pathophysiology of Parkinson's disease. This comprehensive study focuses on these biomarkers, which were chosen based on their relevance, methodological excellence, and contribution to the field. Biochemical biomarkers, including α-synuclein and glial fibrillary acidic protein (GFAP), can predict disease severity and progression. The dopaminergic system is widely used as a neuroimaging biomarker to diagnose PD. Numerous genes and genome wide association study (GWAS) sites have been related to the development of PD. Recent research on the SNCA gene and leucine-rich repeat protein kinase 2 (LRRK2) has shown promising results. By evaluating current studies, this review intends to uncover gaps in biomarker validation and use, while also highlighting promising improvements. It emphasizes the need for dependable and reproducible indicators in improving PD diagnosis and prognosis. These biomarkers may open up new avenues for early diagnosis, disease progression tracking, and the development of personalized treatment programs.

HTT
Also flagged:TDP-43neurodegenerative diseasesamyotrophic lateral sclerosisALSfrontotemporal lobar degenerationFTLD
Journal Article 2024-11-18 ✓ 3 Snippets Jiang LL, Zhang XL, Hu HY.
In-Text Gene Mentions

…12 ], huntingtin (Htt) for HD […

…Further, mutantHtt(mHtt) can co-aggregate…

…HD, Huntington’s disease;Htt, huntingtin; iPSC, induced…

Show Full Abstract

Pathological aggregation of a specific protein into insoluble aggregates is a common hallmark of various neurodegenerative diseases (NDDs). In the earlier literature, each NDD is characterized by the aggregation of one or two pathogenic proteins, which can serve as disease-specific biomarkers. The aggregation of these specific proteins is thought to be a major cause of or deleterious result in most NDDs. However, accumulating evidence shows that a pathogenic protein can interact and co-aggregate with other pathogenic proteins in different NDDs, thereby contributing to disease onset and progression synergistically. During the past years, more than one type of NDD has been found to co-exist in some individuals, which may increase the complexity and pathogenicity of these diseases. This article reviews and discusses the biochemical characteristics and molecular mechanisms underlying the co-aggregation and co-pathologies associated with TDP-43 pathology. The TDP-43 aggregates, as a hallmark of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD), can often be detected in other NDDs, such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and spinocerebellar ataxia type 2 (SCA2). In many cases, TDP-43 is shown to interact and co-aggregate with multiple pathogenic proteins in vitro and in vivo. Furthermore, the co-occurrence and co-aggregation of TDP-43 with other pathogenic proteins have important consequences that may aggravate the diseases. Thus, the current viewpoint that the co-aggregation of TDP-43 with other pathogenic proteins in NDDs and their relevance to disease progression may gain insights into the patho-mechanisms and therapeutic potential of various NDDs.

Also flagged:Canceroxygencell proliferationdeathNRF2NF-κB
Journal Article 2024-11-18 No Snippets Ju S, Singh MK, Han S, Ranbhise J, Ha J, Choe W, Yoon KS, Yeo SG, Kim SS, Kang I.
Show Full Abstract

Cancer is a multifaceted disease influenced by various mechanisms, including the generation of reactive oxygen species (ROS), which have a paradoxical role in both promoting cancer progression and serving as targets for therapeutic interventions. At low concentrations, ROS serve as signaling agents that enhance cancer cell proliferation, migration, and resistance to drugs. However, at elevated levels, ROS induce oxidative stress, causing damage to biomolecules and leading to cell death. Cancer cells have developed mechanisms to manage ROS levels, including activating pathways such as NRF2, NF-κB, and PI3K/Akt. This review explores the relationship between ROS and cancer, focusing on cell death mechanisms like apoptosis, ferroptosis, and autophagy, highlighting the potential therapeutic strategies that exploit ROS to target cancer cells.

SERPINC1
Also flagged:cholesterollactosealbuminbehavioralmethanedigestion
Journal Article 2024-11-18 ✓ 1 Snippet Pérez Núñez I, Díaz R, Quiñones J, Martínez A, Velázquez L, Huaiquipán R, Tapia D, Muñoz A, Valdés M, Sepúlveda N, Paz E.
In-Text Gene Mentions

…inhibitor, plasminogen, andantithrombin-III, which decrease between…

Show Full Abstract

Non-bovine dairy animals, commonly referred to as non-traditional dairy species, include goats, sheep, yaks, buffalo, donkeys, alpacas, llamas, and other less commonly farmed species. These animals have been integral to livestock systems since ancient times, providing milk and other essential products. Despite their historical significance, dairy production from many of these species remains predominantly confined to rural areas in developing countries, where scientific advancements and technical improvements are often limited. As a consequence of this, the scientific literature and technological developments in the processing and characterization of dairy products from these species have lagged behind those for cow's milk. This review aims to compile and analyze existing research on dairy products derived from non-traditional animals, focusing on their molecular characteristics, including proteins (alpha, beta, kappa, and total casein), fats (cholesterol and total fat), lactose, albumin, ash, total solids, and somatic cell count, among others, for each of these species. Additionally, we discuss emerging technologies employed in their processing, encompassing both non-thermal methods (such as high-pressure processing, pulsed electric fields, ultrasound processing, UV-C irradiation, gamma radiation, microfiltration, and cold plasma processing) and thermal methods (such as ohmic heating). This review also explores the specific potential applications and challenges of implementing these technologies. By synthesizing recent findings, we aim to stimulate further research into innovative technologies and strategies that can enhance the quality and yield of non-bovine dairy products. Understanding the unique properties of milk from these species may lead to new opportunities for product development, improved processing methods, and increased commercialization in both developing and developed markets.

Also flagged:Cajaninstilbene Acidstilbenemetabolismtumorsynthesiswound healing
Journal Article 2024-11-18 No Snippets Hou W, Huang L, Wang J, Luyten W, Lai J, Zhou Z, Kang S, Dai P, Wang Y, Huang H, Lan J.
Show Full Abstract

Pigeon pea (<i>Cajanus cajan</i> (L.) Millsp.) is a traditional Chinese medicinal plant widely utilized in folk medicine due to its significant pharmacological and nutritional properties. Cajaninstilbene acid (CSA), a stilbene compound derived from pigeon pea leaves, has been extensively investigated since the 1980s. A thorough understanding of CSA's mechanisms of action and its therapeutic effects on various diseases is crucial for developing novel therapeutic approaches. This paper presents an overview of recent research advancements concerning the biological activities and mechanisms of CSA and its derivatives up to February 2024. The review encompasses discussions on the in vivo metabolism of CSA and its derivatives, including antipathogenic micro-organisms activity, anti-tumor activity, systematic and organ protection activity (such as bone protection, cardiovascular protection, neuroprotection), anti-inflammatory activity, antioxidant activity, immune regulation as well as action mechanism of CSA and its derivatives. The most studied activities are antipathogenic micro-organisms activities. Additionally, the structure-activity relationships of CSA and its derivatives as well as the total synthesis of CSA are explored, highlighting the potential for developing new pharmaceutical agents. This review aims to provide a foundation for future clinical applications of CSA and its derivatives.

KLHL20
Also flagged:Pin1cancertumoroncogenesnever-in-mitosis kinase-1threonine
Journal Article 2024-11-18 ✓ 1 Snippet Liu C, Dan L, Li Q, Bajinka O, Yuan X.
In-Text Gene Mentions

…stimulate E3 ligaseKLHL20-mediated PML deprivation, whi…

Show Full Abstract

Targeted therapy has considerable promise for the effective eradication of cancer at the primary tumor site prior to subsequent metastasis. Using this therapeutic approach, gaining an understanding of mechanistic cancer models is essential for facilitating the inhibition or suppression of tumor growth. Among different oncogenes and proteins, the protein interacting with never-in-mitosis kinase-1 (Pin1) is particularly important. The interaction between Pin1 and phosphorylated threonine-proline motifs results in significant alterations in protein structure and function. In this review, we provide a comprehensive summary of the processes involving Pin1 and its mechanisms in the context of cancer therapy. Pin1 enhances signaling pathways in a number of different human cancers and plays a pivotal role in the suppressive mechanisms relevant to cancer treatment. It is essential for the regulation of proline-directed phosphorylation and for modulating tumor suppressors. Inhibitors of Pin1, particularly naturally occurring substances, have been found to inhibit the carcinogenic activity of Pin1, and consequently this protein could represent an excellent candidate for novel cancer treatment strategies, offering a valuable therapeutic target in carcinogenesis and treatment resistance.

HFE
Also flagged:Energy homeostasisinsulinmetabolismAT 1 receptortelmisartanAT 1
Journal Article 2024-11-18 ✓ 1 Snippet Freschi ML, Künstner A, Huber G, Stölting I, Busch H, Hirose M, Raasch W.
In-Text Gene Mentions

…We did not analyze the microbiota of the donor mice in the present study; however, we still assume that it differed from healthy chow-fed controls, as we recently demonstrated, at least in rats, that network plots and random forest classifier differentiated between the taxonomic classification of chow-fed controls andHFE-fed/TEL-treated animals, although body weight and glucose homeostasis were similar in the two groups ( Beckmann et al., 2021 ).…

Show Full Abstract

<h4>Introduction</h4>Treatment of rodents with the AT<sub>1</sub> blocker (ARB) telmisartan (TEL) has an anti-adipose effect. Among other mechanisms, we also have attributed the anti-adipose action to diet-independent alterations in gut microbiota. Thus, we aimed here to confirm this mechanism by using the fecal microbiota transfer (FMT) approach.<h4>Methods</h4>Seven weeks after initiating a high-fat diet (HFD), C57BL/6N mice received fecal microbiota for 8 weeks from donor mice by oral gavage, continuing HFD feeding. Stool samples came from mice that were treated with TEL (8 mg/kg/d by gavage, 12 weeks), thus remaining lean despite HFD feeding (BL/6>f<sup>TEL</sup>), while controls received feces samples from vehicle/HFD-treated obese mice (BL/6>f<sup>VEH</sup>). Microbiota of the stool samples from these acceptor mice was analyzed by 16S rRNA gene amplicon sequencing.<h4>Results</h4>Weight gain was lower in BL6>f<sup>TEL</sup> than in BL6>f<sup>VEH</sup> mice after 3 but not 8 weeks. Energy homeostasis, insulin sensitivity, and body composition did not differ between the two groups. β-diversity indicated group differences (F = 2.27, p = 0.005). Although the Firmicutes/Bacteroides ratio did not differ, abundances of distinct phyla, families, and genera varied. Among others, Ruminococcaceae and Desulfovibrionaceae, Desulfovibrionia uncl., and Lachnospiraceae uncl. were lower in BL/6>f<sup>TEL</sup> than in BL/6>f<sup>VEH</sup> mice. Moreover, the correlation between body weight and Lachnospiraceae, Desulfovibrionaceae, Desulfovibrionia uncl., or Desulfovibrio was positive in BL/6>f<sup>VEH</sup> and negative in BL/6>f<sup>TEL</sup> mice.<h4>Discussion</h4>As FMT from TEL-pretreated mice influences the microbiota in acceptor mice with slight weight-reducing effects, we confirm the relevance of TEL-related microbiota changes for weight reduction, most likely independent of the transferred stool-residual TEL effect on the host metabolism.

CCPG1
Also flagged:myocardial ischemiaautophagyendoplasmic reticulumFAM134Bacute myocardial infarctionPI3K
Journal Article 2024-11-18 ✓ 1 Snippet Li R, Zhang J, Ji S, Fang J, Ji X, Zeng Y, Liu N, Wu W, Liu S.
In-Text Gene Mentions

…SEC62, RTN3, andCCPG1( Liang et…

Show Full Abstract

<h4>Background</h4>Autophagy‒endoplasmic reticulum (ER) stress axis dysregulation is linked to myocardial ischemia‒reperfusion injury (MIRI), which counteracts the benefits of acute myocardial infarction (AMI) reperfusion therapy. Qingre Huoxue decoction (QRHX) improves the short- and long-term prognosis of AMI after percutaneous coronary intervention and alleviates myocardial injury in AMI rats by stimulating autophagy via the PI3K/Akt pathway. We aimed to further explore the efficacy of QRHX in treating MIRI and its regulatory relationship with FAM134B-mediated ER-phagy.<h4>Materials and methods</h4>Rats were administered different concentrations of QRHX for 2 weeks, and then MIRI was induced. Ultra-performance liquid chromatography‒tandem mass spectrometry (UPLC‒MS) was used to examine the levels of the main pharmacological metabolites of the serum of rats treated with QRHX. H9c2 cells were pretreated with QRHX-mediating serum (QRHX-MS) for 24 h before being exposed to hypoxia/reoxygenation (H/R). The mechanisms underlying the effects of QRHX-MS were further studied via rescue experiments involving FAM134B knockdown. The myocardial infarct size, cardiac function, morphology and the expression of apoptosis-, autophagy-, and ER stress-related proteins and genes were assessed. The colocalization of autophagosomes with lysosomes and the localization of proteins involved in ER-phagy or autophagic flux was examined.<h4>Results</h4>QRHX decreased the myocardial infarct size and oxidative stress, improved cardiac function and alleviated morphological changes in a dose-dependent manner in MIRI rats by promoting autophagic flux to inhibit ER stress and ER stress-related apoptosis, which was related to FAM134B-mediated ER-phagy, as revealed by autophagy analysis. UPLC‒MS analysis of QRHX-MS revealed 20 major active metabolites of QRHX-MS, including baicalin, cryptotanshinone, 3,4-dihydroxybenzaldehyde and caffeic acid. QRHX-MS attenuated H/R-induced cardiomyocyte injury and apoptosis by increasing autophagic flux to suppress ER stress and ER stress-related apoptotic protein and gene expression. When autophagic flux was inhibited or FAM134B was knocked down in H9c2 cells followed by QRHX-MS pretreatment, the protective effect of QRHX was partially reversed.<h4>Conclusion</h4>QRHX alleviates myocardial injury, apoptosis and infarct size expansion in MIRI by regulating the autophagy‒ER stress axis via FAM134B-mediated ER-phagy.

PTGIS
Also flagged:cell cyclenucleosomeGolgiendoplasmic reticulumorganizationDNA-binding proteins
Journal Article 2024-11-18 ✓ 1 Snippet Tworig J, Grafton F, Fisher K, Hörer M, Reid CA, Mandegar MA.
In-Text Gene Mentions

…( CDK5, MFAP2,PTGIS, RAB3B, TNFRSF12A ),…

Show Full Abstract

Recombinant adeno-associated virus (rAAV) is a widely used viral vector for gene therapy. However, these vectors have limited availability due to manufacturing challenges with productivity and quality. These challenges can be addressed by better understanding the mechanisms that influence cellular responses during rAAV production. In this study, we aimed to identify targets that may enhance rAAV production using transcriptomic analyses of five cell lines with variable capacities for rAAV production. Using an intersectional approach, we measured the transcriptional responses of these cells during rAAV production and compared transcriptional profiles between high and base producers to identify possible targets for enhancing production. During rAAV production, we found transcriptional differences in cell cycle and nucleosome components contributed to proliferative capacity and DNA replication. We also saw upregulation of several core functions, including transcription, stress response, and Golgi and endoplasmic reticulum organization. Conversely, we saw consistent downregulation of other factors, including inhibitors of DNA-binding proteins and mitochondrial components. With a drug-connectivity analysis, we identified five classes of drugs that were predicted to enhance rAAV production. We also validated the efficacy of histone deacetylase and microtubule inhibitors. Our data uncover novel and previously identified pathways that may enhance rAAV production and quality to expand availability of rAAV for gene therapies.

Also flagged:Hepatitis CinfectionsHCV infectionHCV infectionsopioidopioid use disorder
Journal Article 2024-11-18 No Snippets Stopka TJ, Whitney BM, de Gijsel D, Brook DL, Friedmann PD, Taylor LE, Feinberg J, Young AM, Evon DM, Herink M, Westergaard R, Koepke R, Havens JR, Zule WA, Delaney JA, Pho MT.
Show Full Abstract

<h4>Background</h4>Restrictive Medicaid policies regarding hepatitis C virus (HCV) treatment may exacerbate rural health care disparities for people who use drugs (PWUD). We assessed associations between Medicaid restrictions and HCV treatment among rural PWUD.<h4>Methods</h4>We compiled state-specific Medicaid treatment policies across 8 US rural sites in 10 states and merged these with participant survey data. We hypothesized that local restrictions regarding prescriber type, sobriety, and fibrosis estimates were associated with HCV treatment outcomes. We conducted a cross-sectional, ecological analysis of treatment restrictions and HCV treatment outcomes using bivariate analyses to characterize differences between PWUD who initiated HCV treatment and unadjusted logistic regressions to assess associations between restrictions and treatment.<h4>Results</h4>Among 944 participants, 111 (12%) reported receiving HCV treatment. Participants receiving treatment were older [median age (interquartile range): 42 (34-53) vs. 35 (29-42), P<0.001], more likely to receive disability support (32% vs. 20%, P=0.002), and less likely to be Medicaid-insured (57% vs. 71%, P < 0.001). More PWUD in states without any restrictions reported receiving treatment (17% vs. 11%, P=0.08) and achieving HCV cure/clearance (42% vs. 30%, P=0.01) than in states with restrictions. Restrictions were associated with lower odds of receiving HCV treatment (odds ratio=0.61, 95% CI: 0.35-1.06, P=0.08). Sensitivity analyses showed a similar association with HCV cure/clearance (odds ratio=0.60, 95% CI: 0.40-0.91, P=0.02).<h4>Conclusions</h4>We identified significant unadjusted associations between Medicaid restrictions and receipt of HCV treatment and cure, which has substantial implications for health outcomes among rural PWUD. Lifting remaining Medicaid restrictions will be critical to achieving HCV elimination.

Also flagged:Metabolic dysfunctionsteatotic liver diseasemetabolic syndromesteatotic liver diseasesobesitydiabetes
Journal Article 2024-11-18 No Snippets Wade H, Pan K, Zhang B, Zheng W, Su Q.
Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD), previously referred to as non-alcoholic fatty liver disease, encompasses a broad range of hepatic metabolic disorders primarily characterised by the disruption of hepatic lipid metabolism, hepatic lipid accumulation and steatosis. Severe cases of MASLD might progress to metabolic dysfunction-associated steatohepatitis, characterised by hepatic inflammation, hepatocyte ballooning degeneration, activation of hepatic stellate cells (HSCs) and fibrogenesis. It may further progress to hepatocellular carcinoma. In the liver, long non-coding RNAs (lncRNAs) target multiple metabolic pathways in hepatocytes, HSCs, and Kupffer cells at different stages of MASLD and liver fibrosis. In this study, we overview recent findings on the potential role of lncRNAs in the pathogenesis of MASLD and liver fibrosis via modulation of de novo lipid synthesis, fatty acid β-oxidation, lipotoxicity, oxidative stress, metabolic inflammation, mammalian target of rapamycin signalling, apoptosis, ubiquitination and fibrogenesis. We critically assess the literature reports that investigate the complex interplay between lncRNA, microRNA and key mediators in liver injury, in both human participants and animal models of MASLD and liver fibrosis. We also highlight the therapeutic potential of lncRNAs in chronic liver diseases.

bioRxiv 2024-11-18 Preprint (No Snippets API) Rigter PM, Bezstarosti K, Koc OC, Perfitt TL, Demmers JA, Colbran RJ, Stratton M, Elgersma Y, van Woerden GM.
Show Full Abstract

Ca 2+ /calmodulin-dependent protein kinase 2 (CAMK2) plays a critical role in calcium signaling. Recent gene knockout studies show that CAMK2A and CAMK2B can have distinct roles yet also partially compensate for each other in yet unknown brain functions. In order to provide insight into potential novel CAMK2 functions, we performed parallel phosphoproteomic analyses on non-stimulated cortex tissue from inducible Camk2a and Camk2b double knockout ( Camk2a f/f ;Camk2b f/f ;CAG-Cre ESR ) mice and from wild type mice. A total of 5622 phosphorylated peptides derived from 2080 proteins were identified. Phosphorylation at serine/threonine residues in 130 proteins were downregulated in the double knockout mice, including residues in 113 proteins that have not previously been identified as potential CAMK2 substrates. Comparison of amino acid sequences surrounding the downregulated phosphorylation residues provided new insights into the CAMK2-substrate consensus sequences in vivo . This dataset provides an important resource for future studies examining novel roles for CAMK2 in the brain.

medRxiv 2024-11-18 Preprint (No Snippets API) Chen L, Deng O, Fang T, Chen M, Zhang X, Cong R, Lu D, Zhang R, Jin Q, Wang X.
Show Full Abstract

<h4>Objective</h4> Systemic lupus erythematosus (SLE) is a complex autoimmune disease characterized by unpredictable flares. This study aimed to develop a novel proteomics-based risk prediction model specifically for Asian SLE populations to enhance personalized disease management and early intervention. <h4>Methods</h4> A longitudinal cohort study was conducted over 48 weeks, including 139 SLE patients monitored every 12 weeks. Patients were classified into flare (n = 53) and non-flare (n = 86) groups. Baseline plasma samples underwent data-independent acquisition (DIA) proteomics analysis, and phenome-wide Mendelian randomization (PheWAS) was performed to evaluate causal relationships between proteins and clinical predictors. Logistic regression (LR) and random forest (RF) models were used to integrate proteomic and clinical data for flare risk prediction. <h4>Results</h4> Five proteins (SAA1, B4GALT5, GIT2, NAA15, and RPIA) were significantly associated with SLE Disease Activity Index-2K (SLEDAI-2K) scores and 1-year flare risk, implicating key pathways such as B-cell receptor signaling and platelet degranulation. SAA1 demonstrated causal effects on flare-related clinical markers, including hemoglobin and red blood cell counts. A combined model integrating clinical and proteomic data achieved the highest predictive accuracy (AUC = 0.769), surpassing individual models. SAA1 was highlighted as a priority biomarker for rapid flare discrimination. <h4>Conclusion</h4> The integration of proteomic and clinical data significantly improves flare prediction in Asian SLE patients. The identification of key proteins and their causal relationships with flare-related clinical markers provides valuable insights for proactive SLE management and personalized therapeutic approaches. <h4>Graphical Abstract</h4>

Research Square 2024-11-18 Preprint (No Snippets API) Li H, Liu P, Li R, Hu H, Shen A, Xing Y, Zhu W, Liu H.
Show Full Abstract

<title>Abstract</title> <p>Background Aquaporin-4 immunoglobulin G antibody (AQP4-IgG) product by B cells is essential in Neuromyelitis optica (NMO). However, some patients with immunosuppressive drugs persistently high AQP4-IgG titers, possibly owing to Follicular helper T (Tfh) cells can assist B cells in antibody production. Roquin-1 has been linked to the regulation of immune balance and plays an important role in the peripheral homeostasis of T cells. However, whether Roquin-1 can target Tfh cells differentiation in NMO mechanism remain unclear. Hence, in this study, we aim to explore the relationship between Roquin-1 and clinical characteristic in NMO, and whether Roquin-1 can target AMPK to regulates the CXCR5 + PD-1 + Tfh differentiation aggravate NMO progression. Methods We enrolled 71 NMO patients in this study, Clinical characteristics, MRI lesion counts in the spinal cord or brain, Expanded Disability Status Scale (EDSS) scores, Roquin-1 expression levels, and the proportion of Tfh cells were recorded and analyzed in each group using cell flow assay and other studies. Then, to validate Roquin-1 ability, we knockout or overexpression the Roquin-1 along Tfh cell differentiation. Results In the acute phase, Roquin-1 mRNA expression was reduced, while in remission phase, it was increased compared to healthy controls. The proportion of CXCR5 + PD-1 + Tfh cells was higher in NMO patients than in controls, and there was a negative correlation between Tfh cells proportions and Roquin-1 expression. Roquin-1 expression was negatively correlated with the EDSS score and positive correlation between the percentage of Tfh cells and the EDSS score and MRI lesions. We found that Roquin-1 could affect Tfh cell function and ratio during Tfh cell differentiation, promoted the expression of glycolysis-related proteins by influencing the interaction between AMPK and mTOR, and improved the antibody secretion ability of B cells. Conclusions Our study elucidated the effect of Roquin-1 on Tfh cells in NMO and the corresponding protective mechanism in autoimmunity, explore the possible causes of immune imbalance in NMO mechanisms, thus aiming to provide novel insights into NMO pathogenesis.</p>

Also flagged:spindle assembly checkpointSACchromosomemitosismitotic arrest deficiency 2MAD2
Journal Article 2024-11-17 No Snippets Xi Y, Xu R, Chen S, Fang J, Duan X, Zhang Y, Zhong G, He Z, Guo Y, Li X, Tao W, Li Y, Li Y, Fang L, Niikura Y.
Show Full Abstract

Overexpression of mitotic arrest deficiency 2 (MAD2/MAD2L1), a pivotal component of the spindle assembly checkpoint (SAC), resulted in many types of cancer. Here we show that the depletion of tumor susceptibility gene 101 (TSG101), causes synthetic dosage lethality (SDL) in MAD2-overexpressing cells, and we term this cell death MAD2-overexpressing interphase cell death (MOID). The induction of MOID depends on PML and DAXX mediating mitochondrial AIFM1-release. MAD2, TSG101, and AIF-PML-DAXX axis regulate mitochondria, PML nuclear bodies (NBs), and autophagy with close inter-dependent protein stability in survival cells. Loss of C-terminal phosphorylation(s) of TSG101 and closed (C-)MAD2-overexpression contribute to induce MOID. In survival cells, both MAD2 and TSG101 localize at PML NBs in interphase, and TSG101 Y390 phosphorylation is required for localization of TSG101 to PML NBs. PML release from PML NBs through PML deSUMOylation contributes to induce MOID. The post-transcriptional/translational cell death machinery and the non-canonical transcriptional regulation are intricately linked to MOID, and ER-MAM, may serve as a crucial intersection for MOID signaling.

SOX6
Also flagged:HydroxycarbamideSickle Cell Diseasehememetabolisminterferon alphainterferon gamma
Journal Article 2024-11-17 ✓ 1 Snippet Bhat V, Potdar AA, Yu GK, Gibson G, Sheehan VA.
In-Text Gene Mentions

SOX6

Show Full Abstract

Hydroxycarbamide (HC) is the most widely used therapeutic for individuals with sickle cell disease (SCD, including sickle cell anemia and other forms of the disease). HC's clinical benefits are primarily associated with its ability to induce foetal haemoglobin (HbF); this limited view of HC's therapeutic potential may lead to its discontinuation when a modest amount of HbF is induced. A better understanding of the HbF-independent effects of HC on genes and pathways relevant to SCD pathophysiology is therefore needed. In this study, we performed bulk RNA-Seq on whole blood samples collected from a cohort of 25 paediatric patients with SCD to identify genes and pathways that are affected by treatment with HC. At the maximum tolerated dose (MTD) of HC, patients showed altered expression levels of several genes and biological pathways. Pathways related to haeme metabolism, interferon-alpha response, and interferon-gamma response were significantly downregulated at HC MTD relative to the matched pre-HC samples. Pathways linked with IL2-STAT5 signalling and TNFα signalling via NF-Kβ were observed to be up-regulated at HC MTD. These results illustrate the range of effects exerted by HC during therapy for SCD and pave the way for an improved understanding of the HbF induction-independent benefits of HC.

Also flagged:titaniumhydroxyapatitebiomineralizationextracellularchronicmineral
Journal Article 2024-11-17 No Snippets Cotrut CM, Blidisel A, Vranceanu DM, Vladescu Dragomir A, Ungureanu E, Pana I, Dinu M, Vitelaru C, Parau AC, Pruna V, Magurean MS, Titorencu I.
Show Full Abstract

The purpose of coatings is to protect or enhance the functionality of the substrate material, irrespective of the field in which the material was designed. The use of coatings in medicine is rapidly expanding with the objective of enhancing the osseointegration ability of metallic materials such as titanium. The aim of this study was to obtain biomimetic hydroxyapatite (HAp)-based coatings on titanium by using the pulsed galvanostatic method. The morphology of the HAp-based coatings revealed the presence of very thin and wide plate-like crystals, grown perpendicular to the Ti substrate, while the chemical composition highlighted a Ca/P ratio of 1.66, which is close to that of stoichiometric HAp (1.67). The main phases and chemical bonds identified confirmed the presence of the HAp phase in the developed coatings. A roughness of 228 nm and a contact angle of approx. 17° were obtained for the HAp coatings, highlighting a hydrophilic character. In terms of biomineralization and electrochemical behavior, it was shown that the HAp coatings have significantly enhanced the titanium properties. Finally, the in vitro cell tests carried out with human mesenchymal stem cells showed that the Ti samples coated with HAp have increased cell viability, extracellular matrix, and Ca intracellular deposition when compared with the uncoated Ti, indicating the beneficial effect.

Also flagged:COVID-19SARS-CoV-2 infectionIgGinfectioninfectionsantibodies
Journal Article 2024-11-17 No Snippets Torres ACP, de Brito RN, de Araújo WN, Pedrette P, Alves DCC, Teixeira AIP, Gontijo CC, Romero GAS, Gurgel-Gonçalves R, Ramalho WM.
Show Full Abstract

<h4>Introduction</h4>Healthcare workers (HCWs) are at higher risk of SARS-CoV-2 infection. Viral surveillance for early detection of COVID-19 is a critical strategy to understand this population's infection dynamics and prevent transmission. The study examines SARS-CoV-2 infection and reinfection among HCWs vaccinated against COVID-19 working at a primary healthcare unit serving a disenfranchised community in Brazil.<h4>Methods</h4>The study was conducted in Cidade Estrutural, Federal District, Brazil, between February and October 2021. Participants were interviewed and provided samples. A prospective open cohort study was used to analyze the frequency of SARS-CoV-2 infection and reinfection, and the vaccine-induced seroconversion. Nasopharyngeal swab specimen was collected from workers presenting with flu-like symptoms and subjected to RT-qPCR. Peripheral blood samples were also collected every 30 ± 2 days for eight months, starting from the day participants received their first dose of COVID-19 vaccine, and submitted to serological testing (IgM and IgG chemiluminescence). The frequencies of infection and reinfection (RT-qPCR positive results 90 days after the infection) were calculated along with their respective confidence intervals (95% CI).<h4>Results</h4>Of the 128 workers, 61 (47.65%; CI: 39.19-56.25) reported probable SARS-CoV-2 infection before vaccination and 50 (39.06%; CI: 31.04-47.71) had SARS-CoV-2 infection after vaccination, confirmed by molecular test. Reinfection was identified in seven workers (7/50, 14%; CI: 6.95-26.18) based on the 90-day interval between results. The serological data from the 128 workers during the cohort indicated that 68 (53.12%; CI: 44.5-61.5) had IgG antibodies and 46 had IgM antibodies (35.93%; CI: 28.14-44.54) against SARS-CoV-2. SARS-CoV-2 infection was common in 56% of the community health workers (CHWs), 50% of registered nurses, and licensed vocational nurses (33%). Following the COVID-19 vaccination, the percentage of infections among HCWs decreased from 47.83% to 4.35%.<h4>Conclusion</h4>These results demonstrate that (i) approximately 40% of the workers were infected with SARS-CoV-2 in 2021 and (ii) reinfections confirmed by RT-qPCR occurred in 14% of the HCWs after vaccination. The results provide valuable insights into the circulation of SARS-CoV-2 among HCWs in a primary care unit serving a minoritized community.

Also flagged:neuroimmune diseasesendothelial cell surfaceautoantibodiescellsMultiple sclerosisinflammatory diseases
Journal Article 2024-11-17 No Snippets Nagata S, Yamasaki R.
Show Full Abstract

The blood-brain barrier and glial cells, particularly astrocytes, interact with each other in neuroimmune diseases. In the inflammatory environment typical of these diseases, alterations in vascular endothelial cell surface molecules and weakened cell connections allow immune cells and autoantibodies to enter the central nervous system. Glial cells influence the adhesion of endothelial cells by changing their morphology and releasing various signaling molecules. Multiple sclerosis has been the most studied disease in relation to vascular endothelial and glial cell interactions, but these cells also significantly affect the onset and severity of other neuroimmune conditions, including demyelinating and inflammatory diseases. In this context, we present an overview of these interactions and highlight how they vary across different neuroimmune diseases.

TNFSF4
Also flagged:TNF Receptor-Associated Factor 5TNF receptor-associated factorsadaptor proteinsTNF receptorCD40TRAF
Journal Article 2024-11-17 ✓ 3 Snippets Hikosaka-Kuniishi M, Iwata C, Ozawa Y, Ogawara S, Wakaizumi T, Itaya R, Sunakawa R, Sato A, Nagai H, Morita M, So T.
In-Text Gene Mentions

…genes Tnfaip3 ,Tnfsf4, and Cd80…

…, 5′-TTGTTCAGCCATGGTCCTCG-3′),Tnfsf4(forward primer, 5′-AATCTGGAAA…

…genes, Cd80 ,Tnfsf4, and Tnfaip3…

Show Full Abstract

TNF receptor-associated factors (TRAFs) function as intracellular adaptor proteins utilized by members of the TNF receptor superfamily, such as CD40. Among the TRAF family proteins, TRAF5 has been identified as a potential regulator of CD40. However, it remains unclear whether TRAF5 regulates the generation of germinal center (GC) B cells and antigen-specific antibody production in the T-dependent (TD) immune response. TRAF5-deficient (<i>Traf5<sup>-/-</sup></i>) and TRAF5-sufficient (<i>Traf5<sup>+/+</sup></i>) mice were immunized in the footpad with 2,4,6-trinitrophenol-conjugated keyhole limpet hemocyanin (TNP-KLH) and complete Freund's adjuvant (CFA). We found that GC B cell generation and antigen-specific IgM and IgG1 production were significantly impaired in <i>Traf5<sup>-/-</sup></i> mice compared to <i>Traf5<sup>+/+</sup></i> mice. The expression levels of CD40-target genes <i>Fas</i> and <i>Lta</i>, which are involved in GC formation, were significantly decreased in B220<sup>+</sup> cells isolated from immunized <i>Traf5<sup>-/-</sup></i> mice. <i>Traf5<sup>-/-</sup></i> B cells showed decreased antibody production, proliferation, and induction of CD40-target genes <i>Tnfaip3</i>, <i>Tnfsf4</i>, and <i>Cd80</i> in response to agonistic Fc-CD40L protein in vitro. Furthermore, administration of TNP-KLH and Fc-CD40L to <i>Traf5<sup>-/-</sup></i> mice resulted in a severe loss of GC B cell development. These results highlight the crucial role of TRAF5 in driving CD40-mediated TD immune response in vivo.

MLLT10
Also flagged:breast cancerPolyunsaturated Fatty Acidn -3 polyunsaturated fatty acidscancersynthesisestrogen
Journal Article 2024-11-17 ✓ 2 Snippets Buchanan CDC, Ashraf R, Hillyer LM, Tu W, Kang JX, Subedi S, Ma DWL.
In-Text Gene Mentions

…of mixed-lineage leukemia (Mllt10/AF10) and a gene…

…PUFA exposure decreasesMllt10/AF10 , a cofactor…

Show Full Abstract

<h4>Background</h4>The early exposure of nutrients during pubertal mammary gland development may reduce the risk of developing breast cancer later in life. Anticancer <i>n</i>-3 polyunsaturated fatty acids (<i>n</i>-3 PUFA) are shown to modulate pubertal mammary gland development; however, the mechanisms of action remain unclear. Prior work focused on effects at the whole tissue level, and little is known at the cellular level, such as at the level of mammary epithelial cells (MECs), which are implicated in cancer development.<h4>Methods</h4>This pilot study examined the effects of lifelong <i>n</i>-3 PUFA exposure on the transcriptome by RNA-Seq in the isolated MECs of pubertal (6-8-week-old) female <i>fat-1</i> transgenic mice capable of de novo <i>n</i>-3 PUFA synthesis. <i>edgeR</i> and <i>DESeq2</i> were used separately for the differential expression analysis of RNA sequencing data followed by the Benjamani-Hochberg procedure for multiple testing correction.<h4>Results</h4>Nine genes were found concordant and significantly different (<i>p</i> ≤ 0.05) by both the DESeq2 and edgeR methods. These genes were associated with multiple pathways, suggesting that <i>n</i>-3 PUFA stimulates estrogen-related signaling (<i>Mlltl0</i>, <i>Galr3</i>, and <i>Nrip1</i>) and a glycolytic profile (<i>Soga1</i>, <i>Pdpr</i>, and <i>Uso1</i>) while offering protective effects for immune and DNA damage responses (<i>Glpd1</i>, <i>Garre1</i>, and <i>Rpa1</i>) in MECs during puberty.<h4>Conclusions</h4>This pilot study highlights the utility of RNA-Seq to better understanding the mechanistic effects of specific nutrients such as <i>n</i>-3 PUFA in a cell-specific manner. Thus, further studies are warranted to investigate the cell-specific mechanisms by which <i>n</i>-3 PUFA influences pubertal mammary gland development and breast cancer risk later in life.

bioRxiv 2024-11-17 Preprint (No Snippets API) Erickson AG, Isaev S, Artemov A, He J, Semsch B, Murtazina A, Sun J, Mangold K, Chalou A, Frisen J, Ratz M, Andersson ER, Kharchenko PV, Adameyko I.
Show Full Abstract

The proportion of cell types varies systematically across the body, but it remains unclear how individual progenitor cells integrate positional information to establish patterns of cellular composition. In this study we profile the clonal landscape of the embryo, using single-cell lineage tracing of mouse embryos from neurulation until mid-gestation. To analyze the complex clonal patterns derived from highly multipotent progenitors, we developed clone2vec , which uses unsupervised learning to categorize individual clones into lineages based on shared transcriptional context. This revealed a body-wide gradient of clonal fate biases, in which anatomical position and clonal composition are mutually predictive. Comparison of clonal lineages revealed spatial transcription factor programs associated with dynamic cell biasing towards skeletal versus non-skeletal fates. Mosaic combinatorial perturbations targeting the Hedgehog pathway generated clones in which positional identity was mismatched with clonal composition, suggesting a potential signaling influence on somite patterning. We explore the effects of position and heterochrony on fate biases in cranial, trunk, and caudal neural crest clones. Altogether, our work demonstrates an effective practical approach for dissecting mechanisms of lineage specification.

OLFM4
Also flagged:Oral cancercancertumouroral squamous cell carcinomaOSCCbinding
Journal Article 2024-11-16 ✓ 1 Snippet Prasad M, Sekar R, Priya MDL, Varma SR, Karobari MI.
In-Text Gene Mentions

…targets the geneOLFM4, which is involved…

Show Full Abstract

Oral cancer, the most prevalent cancer worldwide, is far more likely to occur after the age of forty-five, according to the World Health Organization. Although many biomarkers have been discovered over the years using non-invasive saliva samples, biopsies, and human blood, these biomarkers have not been incorporated into standard clinical practice. Investigating the function of microRNAs (miRNAs) in the diagnosis, aetiology, prognosis, and treatment of oral cancer has drawn more attention in recent years. Though salivary microRNA can act as a window into the molecular environment of the tumour, there are challenges due to the heterogeneity of oral squamous cell carcinoma (OSCC), diversity in sample collection, processing techniques, and storage conditions. The up and downregulation of miRNAs has been found to have a profound role in OSCC as it regulates tumour stages by targeting many genes. As a result, the regulatory functions of miRNAs in OSCC underscore their significance in the field of cancer biology. Salivary miRNAs are useful diagnostic and prognostic indicators because their abnormal expression profiles shed light on tumour behaviour and patient prognosis. In addition to their diagnostic and prognostic value, miRNAs hold promise as therapeutic targets for oral cancer intervention. The current review sheds light on the challenges and potentials of microRNA studies that could lead to a better understanding of oral cancer prognosis, diagnosis, and therapeutic intervention. Furthermore, the clinical translation of OSCC biomarkers requires cooperation between investigators, physicians, regulatory bodies, and business partners. There is much potential for improving early identification, tracking therapy response, and forecasting outcomes in OSCC patients by including saliva-based miRNAs as biomarkers.

Also flagged:chromatingene expressionhistonetranscription factorbindingDNase
Journal Article 2024-11-16 No Snippets Murphy AE, Beardall W, Rei M, Phuycharoen M, Skene NG.
Show Full Abstract

Understanding how genetic variants affect the epigenome is key to interpreting GWAS, yet profiling these effects across the non-coding genome remains challenging due to experimental scalability. This necessitates accurate computational models. Existing machine learning approaches, while progressively improving, are confined to the cell types they were trained on, limiting their applicability. Here, we introduce Enformer Celltyping, a deep learning model which incorporates distal effects of DNA interactions, up to 100,000 base-pairs away, to predict epigenetic signals in previously unseen cell types. Using DNA and chromatin accessibility data for epigenetic imputation, Enformer Celltyping outperforms current best-in-class approaches and generalises across cell types and biological regions. Moreover, we propose a framework for evaluating models on genetic variant effect prediction using regulatory quantitative trait loci mapping studies, highlighting current limitations in genomic deep learning models. Despite this, Enformer Celltyping can also be used to study cell type-specific genetic enrichment of complex traits.

PRDX6
Also flagged:peroxiredoxin 2diabetic kidney diseasediabetes mellitusinflammatory responsePRDX2amino acid
Journal Article 2024-11-16 ✓ 2 Snippets Li X, Long H, Peng R, Zou X, Zuo S, Yang Y, Chen M, Yuan H, Liu Z, Wang T, Zhao Q, Guo B, Liu L.
In-Text Gene Mentions

…namely PRDX1 toPRDX6.…

…and cytoplasm, andPRDX6is present in…

Show Full Abstract

Diabetic kidney disease (DKD) is the main cause of deaths due to diabetes mellitus (DM). Due to the complexity of its onset, it is difficult to achieve accurate prevention and treatment. The classically activated macrophage (M1) polarization is a crucial proinflammatory mechanism of DKD, while the interaction and cascade effects of oxidative stress and inflammatory response remain to be elucidated. A urine proteomic analysis of patients with DM indicated that peroxiredoxin 2 (PRDX2) had the higher abundance in DKD. We recently found that PRDX of parasitic protozoa Entamoeba histolytica, which was similar to human PRDX2 in amino acid sequence and spatial structure, could activate the inflammatory response of macrophages through toll-like receptor 4 (TLR4). Hence, our study was designed to explore the role of PRDX2 in chronic inflammation during DKD. Combined with in vivo and in vitro experiments, results showed that the PRDX2 was positively correlated with DKD progression and upregulated by high glucose or recombinant tumor necrosis factor-α in renal tubular epithelial cells; Besides, recombinant PRDX2 could promote M1 polarization of macrophages, and enhance the migration as well as phagocytic ability of macrophages through TLR4. In summary, our study has explored the novel role of PRDX2 in DKD to provide a basis for further research on the diagnosis and treatment of DKD.

PRDX6
Also flagged:Facioscapulohumeral DystrophyFacioscapulohumeral muscular dystrophyFSHDdouble homeobox 4DUX4pentose phosphate
Journal Article 2024-11-16 ✓ 3 Snippets Moriggi M, Ruggiero L, Torretta E, Zoppi D, Arosio B, Ferri E, Castegna A, Fiorillo C, Gelfi C, Capitanio D.
In-Text Gene Mentions

…(PRDX2), peroxiredoxin 6 (PRDX6), thioredoxin (TXN), and…

…NNT, PPIA, PRDX2,PRDX6, SOD1, and ST13.…

…GLRX, GSTP1, PRDX2,PRDX6, and SOD1—ineffective for…

Show Full Abstract

Facioscapulohumeral muscular dystrophy (FSHD) is caused by the epigenetic de-repression of the double homeobox 4 (DUX4) gene, leading to asymmetric muscle weakness and atrophy that begins in the facial and scapular muscles and progresses to the lower limbs. This incurable condition can severely impair muscle function, ultimately resulting in a loss of ambulation. A thorough analysis of molecular factors associated with the varying degrees of muscle impairment in FSHD is still lacking. This study investigates the molecular mechanisms and biomarkers in the biceps brachii of FSHD patients, classified according to the FSHD clinical score, the A-B-C-D classification scheme, and global proteomic variation. Our findings reveal distinct metabolic signatures and compensatory responses in patients. In severe cases, we observe pronounced metabolic dysfunction, marked by dysregulated glycolysis, activation of the reductive pentose phosphate pathway (PPP), a shift toward a reductive TCA cycle, suppression of oxidative phosphorylation, and an overproduction of antioxidants that is not matched by an increase in the redox cofactors needed for their function. This imbalance culminates in reductive stress, exacerbating muscle wasting and inflammation. In contrast, mild cases show metabolic adaptations that mitigate stress by activating polyols and the oxidative PPP, preserving partial energy flow through the oxidative TCA cycle, which supports mitochondrial function and energy balance. Furthermore, activation of the hexosamine biosynthetic pathway promotes autophagy, protecting muscle cells from apoptosis. In conclusion, our proteomic data indicate that specific metabolic alterations characterize both mild and severe FSHD patients. Molecules identified in mild cases may represent potential diagnostic and therapeutic targets for FSHD.

Also flagged:Hypertensive nephropathychronic kidney diseaseend-stage renal diseaseESRDmethylationhistone
Journal Article 2024-11-16 No Snippets Zhang Y, Arzaghi H, Ma Z, Roye Y, Musah S.
Show Full Abstract

Hypertensive nephropathy (HN) is a leading cause of chronic kidney disease (CKD) and end-stage renal disease (ESRD), contributing to significant morbidity, mortality, and rising healthcare costs. In this review article, we explore the role of epigenetic mechanisms in HN progression and their potential therapeutic implications. We begin by examining key epigenetic modifications-DNA methylation, histone modifications, and non-coding RNAs-observed in kidney disease. Next, we discuss the underlying pathophysiology of HN and highlight current in vitro and in vivo models used to study the condition. Finally, we compare various types of HN-induced renal injury and their associated epigenetic mechanisms with those observed in other kidney injury models, drawing inferences on potential epigenetic therapies for HN. The information gathered in this work indicate that epigenetic mechanisms can drive the progression of HN by regulating key molecular signaling pathways involved in renal damage and fibrosis. The limitations of Renin-Angiotensin-Aldosterone System (RAAS) inhibitors underscore the need for alternative treatments targeting epigenetic pathways. This review emphasizes the importance of further research into the epigenetic regulation of HN to develop more effective therapies and preventive strategies. Identifying novel epigenetic markers could provide new therapeutic opportunities for managing CKD and reducing the burden of ESRD.

HTT
Also flagged:CDKPhosphorylationneurodegenerative diseaseHD-translational modification
Journal Article 2024-11-16 ✓ 5 Snippets Liu H, McCollum A, Krishnaprakash A, Ouyang Y, Shi T, Ratovitski T, Jiang M, Duan W, Ross CA, Jin J.
In-Text Gene Mentions

…mHTT by TargetingHTTPhosphorylation at S1181…

…the huntingtin gene (HTT).…

…will encode mutantHTTprotein (mHTT), which…

HTTis a large…

…huntingtin gene (HTT), with CAG…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by a single mutation in the huntingtin gene (HTT). Normal HTT has a CAG trinucleotide repeat at its N-terminal within the range of 36. However, once the CAG repeats exceed 37, the mutant gene (mHTT) will encode mutant HTT protein (mHTT), which results in neurodegeneration in the brain, specifically in the striatum and other brain regions. Since the mutation was discovered, there have been many research efforts to understand the mechanism and develop therapeutic strategies to treat HD. HTT is a large protein with many post-translational modification sites (PTMs) and can be modified by phosphorylation, acetylation, methylation, sumoylation, etc. Some modifications reduced mHTT toxicity both in cell and animal models of HD. We aimed to find the known kinase inhibitors that can modulate the toxicity of mHTT. We performed an in vitro kinase assay using HTT peptides, which bear different PTM sites identified by us previously. A total of 368 kinases were screened. Among those kinases, cyclin-dependent kinases (CDKs) affected the serine phosphorylation on the peptides that contain S1181 and S1201 of HTT. We explored the effect of CDK1 and CDK5 on the phosphorylation of these PTMs of HTT and found that CDK5 modified these two serine sites, while CDK5 knockdown reduced the phosphorylation of S1181 and S1201. Modifying these two serine sites altered the neuronal toxicity induced by mHTT. Roscovitine, a CDK inhibitor, reduced the p-S1181 and p-S1201 and had a protective effect against mHTT toxicity. We further investigated the feasibility of the use of roscovitine in HD mice. We confirmed that roscovitine penetrated the mouse brain by IP injection and inhibited CDK5 activity in the brains of HD mice. It is promising to move this study to in vivo for pre-clinical HD treatment.

Also flagged:hyperglycemiadiabetes mellitusmuscle atrophyatrophyinsulin resistancemitochondrial
Journal Article 2024-11-16 No Snippets Gaur K, Mohapatra L, Wal P, Parveen A, Kumar S, Gupta V.
Show Full Abstract

Hyperglycemia, a hallmark of diabetes mellitus, significantly contributes to skeletal muscle atrophy, characterized by progressive muscle mass and strength loss. This review summarizes the mechanisms of hyperglycemia-induced muscle atrophy, examines clinical evidence, and discusses preventive and therapeutic strategies. A systematic search of electronic databases, including PubMed, Scopus, and Web of Science, was conducted to identify relevant papers on hyperglycemic skeletal muscle atrophy. Key mechanisms include insulin resistance, chronic inflammation, oxidative stress, and mitochondrial dysfunction. Crucial molecular pathways involved are Phosphoinositide 3-kinase/Protein kinase B signaling, Forkhead box O transcription factors, the ubiquitin-proteasome system, and myostatin-mediated degradation. Hyperglycemia disrupts normal glucose and lipid metabolism, exacerbating muscle protein degradation and impairing synthesis. Clinical studies support the association between hyperglycemia and muscle atrophy, emphasizing the need for early diagnosis and intervention. Biomarkers, imaging techniques, and functional tests are vital for detecting and monitoring muscle atrophy in hyperglycemic patients. Management strategies focus on glycemic control, pharmacological interventions targeting specific molecular pathways, nutritional support, and tailored exercise regimens. Despite these advances, research gaps remain in understanding the long-term impact of hyperglycemia on muscle health and identifying novel therapeutic targets. The review aims to provide a comprehensive understanding of the mechanisms, clinical implications, and potential therapeutic strategies for addressing hyperglycemia-induced skeletal muscle atrophy.

PRDX6
Also flagged:knee osteoarthritisplatelet activationextracellulararthritisOAcoagulation
Journal Article 2024-11-16 ✓ 1 Snippet Naili JE, Ahmed AS, Hedström M, Simonsen MB, Broström EW, Harris HE, Végvári Á, Aulin C.
In-Text Gene Mentions

…HSP7C, KPYM, PECA1,PRDX6, TERA and VINC)…

Show Full Abstract

<h4>Objective</h4>This study aimed to identify proteins associated with clinical manifestations of knee osteoarthritis (KOA), including performance-based joint function and patient-reported outcome measures (PROM).<h4>Methods</h4>This cross-sectional exploratory study included thirteen individuals with KOA and eleven age-matched controls. All participants performed the 30s Single Leg Mini Squat test and 30s Sit-to-Stand test with simultaneous recording of joint kinematics. Individuals with KOA completed the Knee Injury and Osteoarthritis Outcome Score and Forgotten Joint Score-12. Proteins were determined by quantitative mass spectrometry (MS) in plasma. Principal component analysis (PCA), hierarchical cluster analysis (HCA), and Reactome enrichment analysis of the proteome were conducted to identify activated pathways and groups.<h4>Results</h4>Performance-based function was worse in individuals with KOA compared to controls, and they reported higher levels of pain. MS analysis identified 82 differentially expressed proteins (DEPs) in KOA (28 upregulated, 54 downregulated of 321 detected proteins). PCA displayed distinct features between KOA and controls, similar to HCA, which distinguished two major clusters. Enrichment analysis displayed platelet activation and degranulation, neutrophil, and extracellular matrix (ECM)-related pathways. From the proteome, 23 DEPs were associated with different aspects of joint function, and 25 DEPs with PROM.<h4>Conclusions</h4>Individuals with KOA differed from controls across all three assessment modalities; they presented worse joint function, higher levels of pain, and an altered plasma protein profile. Multiple associations were observed between up- and downregulated DEPs and clinical manifestations. The described study protocol shows promise for performing multivariate analyses for future subgrouping of individuals with KOA.

Also flagged:tumortriple negative breast cancerhematoxylinbreast cancerestrogen receptorsprogesterone receptors
Journal Article 2024-11-16 No Snippets Garcia V, Gardecki E, Jou S, Li X, Shroyer KR, Saltz J, Acs B, Elfer K, Lennerz J, Salgado R, Gallas BD.
Show Full Abstract

<h4>Objective</h4>With the increasing energy surrounding the development of artificial intelligence and machine learning (AI/ML) models, the use of the same external validation dataset by various developers allows for a direct comparison of model performance. Through our High Throughput Truthing project, we are creating a validation dataset for AI/ML models trained in the assessment of stromal tumor-infiltrating lymphocytes (sTILs) in triple negative breast cancer (TNBC).<h4>Materials and methods</h4>We obtained clinical metadata for hematoxylin and eosin-stained glass slides and corresponding scanned whole slide images (WSIs) of TNBC core biopsies from two US academic medical centers. We selected regions of interest (ROIs) from the WSIs to target regions with various tissue morphologies and sTILs densities. Given the selected ROIs, we implemented a hierarchical rank-sort method for case prioritization.<h4>Results</h4>We received 122 glass slides and clinical metadata on 105 unique patients with TNBC. All received cases were female, and the mean age was 63.44 years. 60% of all cases were White patients, and 38.1% were Black or African American. After case prioritization, the skewness of the sTILs density distribution improved from 0.60 to 0.46 with a corresponding increase in the entropy of the sTILs density bins from 1.20 to 1.24. We retained cases with less prevalent metadata elements.<h4>Conclusion</h4>This method allows us to prioritize underrepresented subgroups based on important clinical factors. In this manuscript, we discuss how we sourced the clinical metadata, selected ROIs, and developed our approach to prioritizing cases for inclusion in our pivotal study.

PRDX6
Also flagged:ginsenoside Rb1peroxiredoxin 6cardiovascular diseasesisoproterenolCKLDH
Journal Article 2024-11-16 ✓ 5 Snippets Mu R, Li Y, Cui Y, Feng C, Li T, Liu T, Chang M, Guo X, Yi X.
In-Text Gene Mentions

…with Peroxiredoxin 6 (PRDX6) in myocardial injury…

…Rb1 (Gs-Rb1) andPRDX6, aiming to provide…

…with Gs-Rb1 andPRDX6significantly inhibited cardia…

…how Gs-Rb1 andPRDX6work together to…

PRDX6, as an important…

Show Full Abstract

<h4>Aim</h4>Ginsenosides have notable bioactivity in treating cardiovascular diseases, but the mechanisms of their combined use with Peroxiredoxin 6 (PRDX6) in myocardial injury remain unclear. This study explores the synergistic effects of Ginsenoside Rb1 (Gs-Rb1) and PRDX6, aiming to provide a theoretical foundation for their therapeutic potential.<h4>Methods</h4>We established a rat model of isoproterenol (ISO)-induced myocardial injury and observed that combination therapy was more effective than single-drug treatments, as shown by ECG monitoring and Masson staining. We performed RNA sequencing (RNA-Seq) on the combination therapy group and the ISO group. The results indicated that, compared to the ISO group, the combination therapy alleviated myocardial injury by reducing inflammation, oxidative stress, and apoptosis. Further analyses, including cell morphology, apoptosis rates, HE staining, ROS fluorescence intensity, and inflammation-related proteins, confirmed that the combination therapy successfully inhibited apoptosis, managed oxidative stress, and lessened inflammation.<h4>Results</h4>Combined treatment with Gs-Rb1 and PRDX6 significantly inhibited cardiac tissue fibrosis in rats, leading to a marked decrease in serum CK and LDH levels. RNA-seq analysis revealed upregulated genes related to lipid metabolism and small molecule biosynthesis, while downregulated genes were associated with oxidative stress, inflammation, and apoptosis. Validation experiments confirmed the combined treatment's significant inhibition of apoptosis, ROS activity, and inflammation. These results support the effectiveness of the two-drug combination in suppressing key biological processes in cardiac tissue, suggesting potential mechanisms for combating cardiac fibrosis.<h4>Conclusion</h4>This study clarifies how Gs-Rb1 and PRDX6 work together to protect against myocardial damage, demonstrating that their combined therapy reduces inflammation, apoptosis, and oxidative stress. This highlights a new avenue for developing ginseng-based treatments.

HFE
Also flagged:alcoholvisionhearingdeathAPOECHRM2
Journal Article 2024-11-15 ✓ 1 Snippet Qasim M, Månsson K, Balakrishnan N.
In-Text Gene Mentions

…DISCI, CYP11A1, BDNF,HFEand DRD2), along…

Show Full Abstract

Valid instrumental variables (IVs) must not directly impact the outcome variable and must also be uncorrelated with nonmeasured variables. However, in practice, IVs are likely to be invalid. The existing methods can lead to large bias relative to standard errors in situations with many weak and invalid instruments. In this paper, we derive a LASSO procedure for the <i>k</i>-class IV estimation methods in the linear IV model. In addition, we propose the jackknife IV method by using LASSO to address the problem of many weak invalid instruments in the case of heteroscedastic data. The proposed methods are robust for estimating causal effects in the presence of many invalid and valid instruments, with theoretical assurances of their execution. In addition, two-step numerical algorithms are developed for the estimation of causal effects. The performance of the proposed estimators is demonstrated via Monte Carlo simulations as well as an empirical application. We use Mendelian randomization as an application, wherein we estimate the causal effect of body mass index on the health-related quality of life index using single nucleotide polymorphisms as instruments for body mass index.

HTT
Also flagged:Neurofilament light chainneurodegenerative diseasesAlzheimer's diseaseamyotrophic lateral sclerosismultiple sclerosisHuntington's disease
Journal Article 2024-11-15 ✓ 1 Snippet A Virata MC, Catahay JA, Lippi G, Henry BM.
In-Text Gene Mentions

HTT

Show Full Abstract

Neurofilament light chain (NfL) is a promising biomarker for neurodegenerative diseases, measurable in both CSF and blood upon neuroaxonal damage. While CSF analysis was traditionally used, blood-based assays now offer a less invasive alternative. NfL levels correlate with disease severity and progression in conditions like Alzheimer's disease, amyotrophic lateral sclerosis, multiple sclerosis and Huntington's disease. Clinical trials demonstrate its utility as a pharmacodynamic biomarker in MS and ALS. The FDA's approval of Tofersen for SOD1-ALS based on NfL reduction underscores its growing acceptance as surrogate marker. However, challenges remain in standardizing assays, interpreting clinical correlations, low specificity and understanding the dynamics between CSF and blood NfL levels. Addressing these issues is crucial for maximizing NfL's potential in neurodegenerative disease management.

Also flagged:HypertensionDiabetesBPcardiovascular diseasenon‐communicable diseasescardio‐metabolic diseases
Journal Article 2024-11-15 No Snippets Wong WJ, Nguyen TV, Ahmad F, Vu HTT, Koh AS, Tan KM, Zhang Y, Harrison C, Woodward M, Nguyen TN.
Show Full Abstract

Diabetes is one of the most pressing health issues in the Southeast Asian region, and hypertension has been commonly reported as a comorbidity in adults with diabetes. This systematic review aimed to synthesize evidence on the prevalence and management of hypertension in adults with diabetes in Southeast Asian countries. A literature search was conducted in Ovid MEDLINE and Embase Classic + Embase from database inception until March 15, 2024. Studies were included if (1) they were conducted in Southeast Asian countries, (2) the study populations were adults with diabetes, and (3) there was information related to hypertension or blood pressure (BP) in the study results. Of the 7486 abstracts found, 90 studies qualified for this review. Most studies reported a hypertension prevalence of 70% or higher (ranging from 29.4% to 93.4%). Despite this high prevalence, a substantial proportion of these populations did not receive adequate BP control, with most studies indicating a control rate of less than 40%. There was limited evidence on the prescription of antihypertensive therapies and medication adherence. There was a lack of studies from 4 of the 11 countries in the region. This review highlights that BP control in adults with diabetes remains a significant challenge in Southeast Asia. Given the ongoing epidemiological transition, and the increasing older population in this region who are likely to accumulate multiple chronic conditions complicating medication strategies, this review highlights the urgent need to improve BP management in those with diabetes.

Also flagged:tumourColorectal cancerpathogenesisangiogenesisphagocytosiscancer
Journal Article 2024-11-15 No Snippets Yuan W, Zhang J, Chen H, Zhuang Y, Zhou H, Li W, Qiu W, Zhou H.
Show Full Abstract

Colorectal cancer (CRC) exhibits a substantial morbidity and mortality rate, with its aetiology and pathogenesis remain elusive. It holds significant importance within the tumour microenvironment (TME) and exerts a crucial regulatory influence on tumorigenesis, progression, and metastasis. TAMs possess the capability to foster CRC pathogenesis, proliferation, invasion, and metastasis, as well as angiogenesis, immune evasion, and tumour resistance. Furthermore, TAMs can mediate the prognosis of CRC. In this paper, we review the mechanisms by which natural compounds target TAMs to exert anti-CRC effects from the perspective of the promotional effects of TAMs on CRC, mainly regulating the polarization of TAMs, reducing the infiltration and recruitment of TAMs, enhancing the phagocytosis of macrophages, and regulating the signalling pathways and cytokines, and discuss the potential value and therapeutic strategies of natural compounds-targeting the TAMs pathway in CRC clinical treatment.

HFE
Also flagged:Hepcidinhormoneironpeptidepolycythemia verachronic myeloproliferative neoplasm
Journal Article 2024-11-15 ✓ 3 Snippets Modi NB, Khanna S, Rudraraju S, Valone F.
In-Text Gene Mentions

…in patients withHFE-related hemochromatosis [ 25…

…patients with HFE-relatedhemochromatosis[ 25 ].…

…with PV orhemochromatosisused rusfertide as…

Show Full Abstract

<h4>Background and objective</h4>Hepcidin, an endogenous peptide hormone, binds to ferroportin and is the master regulator of iron trafficking. Rusfertide, a synthetic peptide, is a potent hepcidin mimetic. Clinical studies suggest rusfertide may be effective in the treatment of polycythemia vera. This study investigated the dose-ranging pharmacokinetics, pharmacodynamics, and safety of a lyophilized formulation of rusfertide.<h4>Methods</h4>A randomized open-label crossover study was conducted in two groups of healthy adult subjects to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics of subcutaneous rusfertide doses that ranged from 10 to 60 mg of a lyophilized formulation and 20 mg of an aqueous prefilled syringe formulation that were used in clinical trials.<h4>Results</h4>Rusfertide showed a rapid initial absorption. Median time to peak plasma concentrations for the lyophilized formulation was 24 h for doses of 10-30 mg and 2-4 h for doses of 45 and 60 mg. Mean terminal half-life ranged from 19.6 to 57.1 h. Rusfertide peak concentration and area under the concentration-time curve increased with an increasing dose, but in a less than dose-proportional manner. Metabolites M4 and M9 were identified as major metabolites. At the rusfertide 20-mg dose, the lyophilized formulation had an area under the concentration-time curve from time zero to infinity approximately 1.5-fold higher than the aqueous formulation. The elimination half-life was comparable for the two formulations. Dose-related decreases in serum iron and transferrin-iron saturation were seen following rusfertide treatment. The majority of treatment-emergent adverse events were mild; treatment-related treatment-emergent adverse events seen in ≥10% of subjects were injection-site erythema and injection-site pruritus.<h4>Conclusions</h4>Rusfertide was well tolerated; the pharmacokinetic and pharmacodynamic results indicate that lyophilized rusfertide is suitable for once-weekly or twice-weekly administration.

OLFM4
Also flagged:phototoxicitygene expressionresponse tooxygenmetabolismmitosis
Journal Article 2024-11-15 ✓ 5 Snippets Yokoi Y, Nakamura R, Ohira S, Takemi S, Ayabe T, Nakamura K.
In-Text Gene Mentions

…protein expression ofOlfm4, a marker…

…the aISC markerOlfm4was markedly decreased…

…light illumination decreasesOlfm4expression without the…

…impairs not onlyOlfm4expression but also…

…the aISCs markerOlfm4is already markedly…

Show Full Abstract

Live imaging visualizes the structure, dynamics, and function of cells and tissues to reveal the molecular mechanisms, and has contributed to the advancement of life science. In live imaging, it has been well known that there is a trade-off between higher-resolution analysis and cell damage caused by light illumination, i.e., phototoxicity. However, despite the risk of unknowingly distorting experimental results, phototoxicity is an unresolved issue in live imaging because overall consequences occurring inside cells due to phototoxicity remains unknown. Here, we determined the molecular process of phototoxicity-induced cell damage systematically under low- and high-dose light illumination conditions by analyzing differential gene expression using RNA-sequencing in a three-dimensional organoid of small intestinal epithelial cells, enteroid. The low-dose light illumination already induced various abnormalities in functional molecules involved in the response to reactive oxygen species generated by the excitation of fluorescent dyes, intracellular metabolism, mitosis, immune responses, etc., at mRNA expression level. Together with the behavior toward apoptosis caused by high-dose light illumination, the light dose-dependent progression of intracellular damage was revealed. About visible impairment of intestinal epithelial function, failures in both the structure-forming ability of enteroids and Paneth cell granule secretion were observed under high-dose light illumination, while the drug efflux was not disturbed despite abnormal drug efflux transporter mRNA expression. Based on the gene expression profiles, we comprehensively clarified phenomena in the cells at mRNA level that cannot be recognized both morphologically and functionally during live imaging, further providing a new insight into the risk of phototoxicity. This study warns from the aspect of mRNA expression that awareness of phototoxic artifacts is needed when analyzing cellular function and the mechanism in live imaging.

Also flagged:chaperoneautophagyneurodegenerative diseasesParkinson's diseaseAlzheimer's diseasedegradation
Journal Article 2024-11-15 No Snippets Wu J, Xu W, Su Y, Wang GH, Ma JJ.
Show Full Abstract

The pathological hallmarks of various neurodegenerative diseases including Parkinson's disease and Alzheimer's disease prominently feature the accumulation of misfolded proteins and neuroinflammation. Chaperone-mediated autophagy (CMA) has emerged as a distinct autophagic process that coordinates the lysosomal degradation of specific proteins bearing the pentapeptide motif Lys-Phe-Glu-Arg-Gln (KFERQ), a recognition target for the cytosolic chaperone HSC70. Beyond its role in protein quality control, recent research underscores the intimate interplay between CMA and immune regulation in neurodegeneration. In this review, we illuminate the molecular mechanisms and regulatory pathways governing CMA. We further discuss the potential roles of CMA in maintaining neuronal proteostasis and modulating neuroinflammation mediated by glial cells. Finally, we summarize the recent advancements in CMA modulators, emphasizing the significance of activating CMA for the therapeutic intervention in neurodegenerative diseases.

Also flagged:CancerdeathCholangiocarcinomamalignant tumorsintrahepatic cholangiocarcinomaperihilar cholangiocarcinoma
Journal Article 2024-11-15 No Snippets Ma D, Wei P, Liu H, Hao J, Chen Z, Chu Y, Li Z, Shi W, Yuan Z, Cheng Q, Gao J, Zhu J, Li Z.
Show Full Abstract

<h4>Background</h4>Intrahepatic cholangiocarcinoma (ICC) is a malignant tumor with a poor prognosis, predominantly CA19-9 positive. High CA19-9 levels correlate with increased aggressiveness and worse outcomes. This study employs multi-omics analysis to reveal molecular features and identify therapeutic targets of CA19-9 positive ICC, aiming to support individualized treatment.<h4>Methods</h4>Data from seven clinical cohorts, two whole-exome sequencing cohorts, six RNA sequencing/microarray cohorts, one proteomic cohort, 20 single-cell RNA sequencing samples, and one spatial transcriptome sample were analyzed. Key findings were validated on tissue microarrays from 52 ICC samples.<h4>Results</h4>CA19-9 positive ICC exhibited poorer OS (median 24.1 v.s. 51.5 months) and RFS (median 11.7 v.s. 28.2 months) compared to negative group (all P < 0.05). Genomic analysis revealed a higher KRAS mutation frequency in the positive group and a greater prevalence of IDH1/2 mutations in the negative group (all P < 0.05). Transcriptomic analysis indicated upregulated glycolysis pathways in CA19-9 positive ICC. Single-cell analysis identified specific glycolysis-related cell subclusters associated with poor prognosis, including Epi_SLC2A1, CAF_VEGFA, and Mph_SPP1. Higher hypoxia in the CA19-9 positive group led to metabolic reprogramming and promoted these cells' formation. These cells formed interactive communities promoting epithelial-mesenchymal transition (EMT) and angiogenesis. Drug sensitivity analysis identified six potential therapeutic drugs.<h4>Conclusions</h4>This study systematically elucidated the clinical, genomic, transcriptomic, and immune features of CA19-9 positive ICC. It reveals glycolysis-associated cellular communities and their cancer-promoting mechanisms, enhancing our understanding of ICC and laying the groundwork for individualized therapeutic strategies.

Also flagged:Lipidtriacylglycerolsfatty acidsacyl-carnitinesdiacylglycerolslactate
Journal Article 2024-11-15 No Snippets Estevao IL, Kazman JB, Bramer LM, Nicora C, Ren MQ, Sambuughin N, Munoz N, Kim YM, Bloodsworth K, Richert M, Teeguarden J, Burnum-Johnson K, Deuster PA, Nakayasu ES, Many G.
Show Full Abstract

<h4>Background</h4>The year of 2023 displayed the highest average global temperatures since it has been recorded-the duration and severity of extreme heat are projected to increase. Rising global temperatures represent a major public health threat, especially to occupations exposed to hot environments, such as construction and agricultural workers, and first responders. Despite efforts of the scientific community, there is still a need to characterize the pathophysiological processes leading to heat related illness and develop biomarkers that can predict its onset.<h4>Methods</h4>Liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based lipidomics analysis was performed on plasma from male and female subjects who underwent exertional heat tolerance testing (HTT), consisting of a 2-h treadmill walk at 5 km/h with 2.0% incline at a controlled temperature of 40ºC. From HTT, heat tolerance was calculated using the physiological strain index (PSI).<h4>Results</h4>Nearly half of all 995 detected lipids from 27 classes were responsive to HTT. Lipid classes related to substrate utilization were predominantly affected by HTT, with a downregulation of triacylglycerols and upregulation of free fatty acids and acyl-carnitines (CARs). Even chain CAR 4:0, 14:0 and 16:1, suggested by-products of incomplete beta oxidation, and diacylglycerols displayed the highest correlation to PSI. PSI did not correlate with plasma lactate levels, suggesting that correlations between even chain CARs and PSI are related to metabolic efficiency versus physical exertion.<h4>Conclusions</h4>Overall, HTT displays a strong impact on the human plasma lipidome and lipid metabolic inefficiencies may underlie reduced heat tolerance.

Also flagged:Cholangiocarcinomasarcopeniamalnutritioncancertumorliver cancer
Journal Article 2024-11-15 No Snippets Zhang L, Wang K, Liu R, Kuang T, Chen C, Yao F, Wang W.
Show Full Abstract

This investigation seeks to scrutinize the relationships between body composition metrics and the clinical outcomes observed in patients with cholangiocarcinoma (CCA). A comprehensive exploration was conducted across three prominent online databases: Embase, PubMed, and the Cochrane Library. This endeavor spanned the entirety of each database up to the cutoff date of September 29, 2023. To evaluate the quality of the included studies, the Newcastle-Ottawa scale was employed. This comprehensive analysis included a total of 26 articles with a combined patient cohort of 4398 individuals. The results demonstrated that CCA patients with low skeletal muscle index (SMI) had significantly inferior OS (HR: 1.93, p < 0.001) and RFS (HR: 2.02, p < 0.001), as well as a higher incidence of postoperative complications (OR: 1.69, 95% CI: 1.20-2.38, p < 0.001) compared to those with high SMI. The presence of sarcopenia in CCA patients was significantly related to poorer OS (HR: 1.96, p < 0.001) and RFS (HR: 2.05, p < 0.001), and a higher rate of postoperative complications (OR: 1.39, p = 0.049) in comparison to those without sarcopenia. Moreover, lower psoas muscle index (PMI) and myosteatosis were associated with shorter OS (PMI, HR: 1.56, p < 0.001; myosteatosis, HR: 1.49, p = 0.001) and RFS (PMI, HR: 2.16, p < 0.001; myosteatosis, HR: 1.35, p = 0.023). Our findings highlight incorporating body composition screening into clinical practice can help develop treatment strategies and optimize perioperative care, potentially improving patient outcomes.

CCPG1
Also flagged:Astragaloside IVDUSP1Prohibitin 2mitochondrialseptic cardiomyopathyPHB2
Journal Article 2024-11-15 ✓ 1 Snippet Wang J, Pu X, Zhuang H, Guo Z, Wang M, Yang H, Li C, Chang X.
In-Text Gene Mentions

…as FAM134B, RTN3L,CCPG1, SEC62, TEX264, and…

Show Full Abstract

<h4>Introduction</h4>Septic cardiomyopathy (SCM) is a complication of myocardial injury in patients with severe sepsis.<h4>Objectives</h4>This study highlights the potential of Astragaloside IV(AS) in the treatment of septic cardiomyopathy and provides a reference for developing cardioprotective drugs targeting DUSP1-PHB2-related mitochondria-ER interaction.<h4>Methods</h4>Dual specificity phosphatase-1 (DUSP1)/Prohibitin 2 cardiomyocyte-specific knockout mice (DUSP1/PHB2<sup>CKO</sup>) /DUSP1 transgenic mice (DUSP1/PHB2<sup>TG</sup>) were used to generate LPS-induced sepsis models. The pathological mechanism by which AS-IV improves heart injury was detected using cardiac ultrasound, fluorescence staining, transmission electron microscopy, and western blotting. After siRNA treatment of cardiomyocytes with DUSP-1/PHB2, changes in mitochondrial function and morphology were determined using qPCR, western blotting, ELISA, and laser confocal microscopy, and the targeted therapeutic effects of AS-IV were further examined.<h4>Results</h4>SCM treatment leads to severe mitochondrial dysfunction. However, Astragaloside IV (AS) treatment normalizes mitochondrial homeostasis and ER function. Notably, the protective effect was blocked in DUSP1/Prohibitin 2 cardiomyocyte-specific knockout mice (DUSP1/PHB2<sup>CKO</sup>) but remained unaffected in DUSP1 transgenic mice (DUSP1/PHB2<sup>TG</sup>).<h4>Conclusion</h4>This study highlights the potential of AS in the treatment of septic cardiomyopathy and provides a reference for developing cardioprotective drugs targeting DUSP1-PHB2 related mitochondria-ER interaction.

Also flagged:Hydroxyapatitemolybdenum oxidecyclohexanecyclohexenesynthesiscyclohexanol
Journal Article 2024-11-15 No Snippets Zheng M, Zhou F, Ma H, Song X, Wu G.
Show Full Abstract

The selective oxidative dehydrogenation of cyclohexane to cyclohexene was conducted using molybdenum oxide (MoO <sub><i>x</i></sub> ) as a catalyst and hydroxyapatite (HAP) and Ca<sub>5</sub>(OH)(PO<sub>4</sub>)<sub>3</sub> as carriers. Two series of MO <sub><i>x</i></sub> /HAP catalysts with varying MoO <sub><i>x</i></sub> loading capacity and calcination temperature were prepared <i>via</i> the co-impregnation method. The impact of dispersibility and chemical environment on the catalytic performance of MoO <sub><i>x</i></sub> was investigated. The catalysts were characterized using XRD, XPS, H<sub>2</sub>-TPR, and UV-Vis spectra. These MoO <sub><i>x</i></sub> /HAP catalysts were employed for the oxidative dehydrogenation (ODH) of cyclohexane to cyclohexene. MoO <sub><i>x</i></sub> /HAP catalysts with lower loading capacity exhibited higher dispersion of MoO <sub><i>x</i></sub> and selectivity towards cyclohexane. The calcination temperature directly influenced the chemical environment of MoO <sub><i>x</i></sub> , thereby affecting its catalytic performance. Samples calcinated at lower temperatures (500 °C and 600 °C) demonstrated higher conversion rates for cyclohexane, while samples calcinated at higher temperatures (above 700 °C) displayed greater selectivity towards cyclohexane. At 430 °C, when the conversion rate of cyclohexane reached 13.1%, the selectivity of cyclohexene over MHAP-0.05-800 catalyst reached 58.2%.

Also flagged:Extracellular Vesiclesextracellularvesiclesmacrophage differentiationcytokinecancer
Journal Article 2024-11-15 No Snippets Barathan M, Ng SL, Lokanathan Y, Ng MH, Law JX.
Show Full Abstract

Milk-derived extracellular vesicles (mEVs) are emerging as promising therapeutic candidates due to their unique properties and versatile functions. These vesicles play a crucial role in immunomodulation by influencing macrophage differentiation and cytokine production, potentially aiding in the treatment of conditions such as bone loss, fibrosis, and cancer. mEVs also have the capacity to modulate gut microbiota composition, which may alleviate the symptoms of inflammatory bowel diseases and promote intestinal barrier integrity. Their potential as drug delivery vehicles is significant, enhancing the stability, solubility, and bioavailability of anticancer agents while supporting wound healing and reducing inflammation. Additionally, bovine mEVs exhibit anti-aging properties and protect skin cells from UV damage. As vaccine platforms, mEVs offer advantages including biocompatibility, antigen protection, and the ability to elicit robust immune responses through targeted delivery to specific immune cells. Despite these promising applications, challenges persist, including their complex roles in cancer, effective antigen loading, regulatory hurdles, and the need for standardized production methods. Achieving high targeting specificity and understanding the long-term effects of mEV-based therapies are essential for clinical translation. Ongoing research aims to optimize mEV production methods, enhance targeting capabilities, and conduct rigorous preclinical and clinical studies. By addressing these challenges, mEVs hold the potential to revolutionize vaccine development and targeted drug delivery, ultimately improving therapeutic outcomes across various medical fields.

HFE
Also flagged:Liver cirrhosischronic liver diseasecirrhosisalcoholic liver diseaseobesityinsulin resistance
Journal Article 2024-11-15 ✓ 1 Snippet Reshetova M, Markin P, Appolonova S, Yunusov I, Zolnikova O, Bueverova E, Dzhakhaya N, Zharkova M, Poluektova E, Maslennikov R, Ivashkin V.
In-Text Gene Mentions

…as well ashemochromatosis(ferritin level, transferrin…

Show Full Abstract

The aim of this study was to investigate the levels of various tryptophan metabolites in patients with alcoholic liver disease (ALD) and metabolic-associated fatty liver disease (MAFLD) at different stages of the disease. The present study included 44 patients diagnosed with MAFLD, 40 patients diagnosed with ALD, and 14 healthy individuals in the control group. The levels of tryptophan and its 16 metabolites (3-OH anthranilic acid, 5-hydroxytryptophan, 5-methoxytryptamine, 6-hydroxymelatonin, indole-3-acetic acid, indole-3-butyric, indole-3-carboxaldehyde, indole-3-lactic acid, indole-3-propionic acid, kynurenic acid, kynurenine, melatonin, quinolinic acid, serotonin, tryptamine, and xanthurenic acid) in the serum were determined via high-performance liquid chromatography and tandem mass spectrometry. In patients with cirrhosis resulting from MAFLD and ALD, there are significant divergent changes in the serotonin and kynurenine pathways of tryptophan catabolism as the disease progresses. All patients with cirrhosis showed a decrease in serotonin levels (<sup>MAFLD</sup><i>p</i> = 0.038; <sup>ALD</sup><i>p</i> < 0.001) and an increase in kynurenine levels (<sup>MAFLD</sup><i>p</i> = 0.032; <sup>ALD</sup><i>p</i> = 0.010). A negative correlation has been established between serotonin levels and the FIB-4 index (<i>p</i> < 0.001). The decrease in serotonin pathway metabolites was associated with manifestations of portal hypertension (<i>p</i> = 0.026), the development of hepatocellular insufficiency (<i>p</i> = 0.008) (hypoalbuminemia; hypocoagulation), and jaundice (<i>p</i> < 0.001), while changes in the kynurenine pathway metabolite xanthurenic acid were associated with the development of hepatic encephalopathy (<i>p</i> = 0.044). Depending on the etiological factors of cirrhosis, disturbances in the metabolic profile may be involved in various pathogenetic pathways.

HTT
Also flagged:degradationoxygenorganellesmitochondriaautophagyneurodegenerative disease
Journal Article 2024-11-15 ✓ 3 Snippets Nanda SS, Yi DK.
In-Text Gene Mentions

…extension in theHTTgene, leading to…

HTThas a crucial…

HTTalso interacts with…

Show Full Abstract

Drug delivery, tissue engineering, and cell promotion in biomedical fields heavily rely on the use of nanomaterials (NMs). When they penetrate cells, NPs undergo degradation and initiate the generation of reactive oxygen species (ROS) by causing changes in the structures of organelles linked to mitochondria. Inside the cell, the excess production of ROS can initiate a chain reaction, along with the autophagy process that helps maintain ROS balance by discarding unnecessary materials. At present, there is no effective treatment for Alzheimer's disease (AD), a progressive neurodegenerative disease. The use of NMs for siRNA delivery could become a promising treatment for AD and other CNS disorders. Recent research demonstrates that the use of combined NPs can induce autophagy in cells. This article emphasizes the importance of the shape of siRNA-encapsulated NMs in determining their efficiency in delivering and suppressing gene activity in the central nervous system. Because of its strict selectivity against foreign substances, the blood-brain barrier (BBB) significantly hinders the delivery of therapeutic agents to the brain. Conventional chemotherapeutic drugs are significantly less effective against brain cancers due to this limitation. As a result, NMs have become a promising approach for targeted drug delivery, as they can be modified to carry specific ligands that direct them to their intended targets. This review thoroughly examines the latest breakthroughs in using NMs to deliver bioactive compounds across the BBB, focusing on their use in cancer treatments. The review starts by examining the structure and functions of the BBB and BBTB, and then emphasizes the benefits that NMs offer.

BTN2A2
Also flagged:Hunner interstitial cystitischronic inflammatory bladder diseaseHunner ulcersinterstitial cystitisICbladder pain syndrome
Journal Article 2024-11-15 ✓ 1 Snippet Lyu X, Peng L, Xu X, Fan Y, Yang Y, Chen J, Liu M, Chen Y, Zhang C, Yang S, Shen S, Zhang J, Zeng X, Shen H, Luo D, Lin Y.
In-Text Gene Mentions

…the symbol genesBTN2A2, BTN3A1, FLOT1, DDR1,…

Show Full Abstract

<h4>Purpose</h4>Epidemiological studies have demonstrated the clinical link between Hunner interstitial cystitis (HIC) and autoimmune diseases (ADs), suggesting potential shared genetic bases for their comorbidity. We aimed to investigate the shared genetic architecture and causal relationships between HIC and ADs.<h4>Methods</h4>We conducted a genome-wide cross-trait study with ~170000 individuals of East Asian ancestry to investigate the shared architecture between HIC and ADs. Bidirectional Mendelian randomization (MR) was used to assess potential causal relationships and a multi-trait analysis of GWAS (MTAG) was conducted to identify their associated pleiotropic loci. Fine-mapping analysis narrowed candidate gene susceptibility loci and colocalization analysis was performed to identify shared variants at specific locus. Lastly, transcriptome-wide association (TWAS) and functional analysis were utilized to explore potential shared gene-tissue associations.<h4>Results</h4>Through bidirectional MR analysis, we observed a positive causal effect of AIH(OR<sub>IVW</sub>=1.09, P<sub>IVW</sub>=1.00×10<sup>-3</sup>) and RA (OR<sub>IVW</sub>=1.47, P<sub>IVW</sub><1.00×10<sup>-4</sup>) on HIC and a negative causal effect of UC on HIC (OR<sub>IVW</sub>=0.89, P<sub>IVW</sub>< 1.00×10<sup>-4</sup>). Furthermore, we unveiled a robust positive causal effect of HIC on T1D(OR<sub>ConMix</sub>=1.05, P<sub>ConMix</sub>=1.77×10<sup>-3</sup>). Cross-trait meta-analysis identified a total of 64 independent SNPs associated with HIC and ADs. Functional analysis revealed that the identified variants regulated gene expression in major tissues belonging to the autoimmune system.<h4>Conclusions</h4>Our findings might offer insights into the shared underlying etiology of HIC and ADs.

Also flagged:histonepost-translational modificationscancerHistonesgene expressionamino acid
Journal Article 2024-11-15 No Snippets Duan X, Xing Z, Qiao L, Qin S, Zhao X, Gong Y, Li X.
Show Full Abstract

Histones play crucial roles in both promoting and repressing gene expression, primarily regulated through post-translational modifications (PTMs) at specific amino acid residues. Histone PTMs, including methylation, acetylation, ubiquitination, phosphorylation, lactylation, butyrylation, and propionylation, act as important epigenetic markers. These modifications influence not only chromatin compaction but also gene expression. Their importance extends to the treatment and prevention of various human diseases, particularly cancer, due to their involvement in key cellular processes. Abnormal histone modifications and the enzymes responsible for these alterations often serve as critical drivers in tumor cell proliferation, invasion, apoptosis, and stemness. This review introduces key histone PTMs and the enzymes responsible for these modifications, examining their impact on tumorigenesis and cancer progression. Furthermore, it explores therapeutic strategies targeting histone PTMs and offers recommendations for identifying new potential therapeutic targets.

DCC
Also flagged:colorectal cancertumorcancerplatelet activationcancerslung cancers
Journal Article 2024-11-15 ✓ 1 Snippet Bonfitto PHL, Rodrigues BAG, Siqueira NSN, Genaro LM, Rodrigues BL, Oliveira PSP, Martinez CAR, Ayrizono MLS, Leal RF.
In-Text Gene Mentions

DCC

Show Full Abstract

Colorectal cancer (CRC) is one of the most widespread tumor types, and it stands as the second leading cause of disease-related mortality globally. Due to its adverse effects, which lead to low patient adherence, new alternatives to conventional chemotherapy and radiotherapy treatments are being studied. Since, in most cases, platelets are positively involved in the persistence and progression of CRC, several elements of the platelet signaling pathway have been considered possible therapeutic targets. The present study assembles the main treatments for CRC and investigates the cellular mechanisms involved in the interaction between blood platelets and cancer cells. Additionally, this review cites other articles that propose possible therapeutic targets in the platelet activation pathways to be explored. Despite the reported benefits of antithrombotic therapy on CRC progression, some studies have warned about an increased bleeding risk and CRC incidence and highlight the importance of controlling this therapy through diagnostic tests. However, their high cost is still a significant obstacle to the population's access from low Human Development Index (HDI) countries. Many research groups have studied platelet signaling pathways in depth to develop a safer, more effective, and affordable therapy for the population.

HFE
Also flagged:Systemic Lupus ErythematosusSLEautoantibodiestick-borne diseaseantibodybabesiosis
Journal Article 2024-11-15 ✓ 5 Snippets Laskova A, Syritsa B, Han B, Fu JJ.
In-Text Gene Mentions

…suggestive of early-stagehemochromatosisdue to periportal…

…patient lacked theHFEgene.…

…Such secondaryhemochromatosiscould be due…

…suggestive of early-stagehemochromatosis(HFE) (Figure 3…

… early-stage hemochromatosis (HFE) (Figure 3 ).…

Show Full Abstract

False positive serologic results are common in systemic lupus erythematosus (SLE) due to the presence of autoantibodies. We present a case of a young patient initially suspected of having a tick-borne disease with a false positive Babesia microti antibody result, and later diagnosed with SLE. Acute babesiosis was excluded after additional laboratory tests such as Babesia polymerase chain reaction (PCR) and blood smear for parasites. The patient's symptoms were then thought to be a new manifestation of SLE and prompted the initiation of systemic steroids with subsequent improvement. False positive serologic Babesia microti test result was attributed to SLE autoantibodies.

VRK2
Also flagged:CFTRPDX1cystic fibrosisCFcystic fibrosis conductance regulatorglucose intolerance
Journal Article 2024-11-15 ✓ 1 Snippet Rotti PG, Yi Y, Gasser G, Yuan F, Sun X, Apak-Evans I, Wu P, Liu G, Choi S, Reeves R, Scioneaux AE, Zhang Y, Winter M, Liang B, Cunicelli N, Uc A, Norris AW, Sussel L, Wells KL, Engelhardt JF.
In-Text Gene Mentions

…in pancreatic cancerVRK2(Log2FC = 2.25,…

Show Full Abstract

Inflammation, acinar atrophy, and ductal hyperplasia drive pancreatic remodeling in newborn cystic fibrosis (CF) ferrets lacking a functional cystic fibrosis conductance regulator (CFTR) channel. These changes are associated with a transient phase of glucose intolerance that involves islet destruction and subsequent regeneration near hyperplastic ducts. The phenotypic changes in CF ductal epithelium and their impact on islet function are unknown. Using bulk RNA sequencing (RNA-seq), single-cell RNA sequencing (scRNA-seq), and assay for transposase-accessible chromatin using sequencing (ATAC-seq) on CF ferret models, we demonstrate that ductal CFTR protein constrains PDX1 expression by maintaining PTEN and GSK3β activation. In the absence of CFTR protein, centroacinar cells adopted a bipotent progenitor-like state associated with enhanced WNT/β-Catenin, transforming growth factor β (TGF-β), and AKT signaling. We show that the level of CFTR protein, not its channel function, regulates PDX1 expression. Thus, this study has discovered a cell-autonomous CFTR-dependent mechanism by which <i>CFTR</i> mutations that produced little to no protein could impact pancreatic exocrine/endocrine remodeling in people with CF.

HTT
Also flagged:neurodegenerative disordermismatch repairpolyglutamineantibodiesHdhpsychiatric
Journal Article 2024-11-15 ✓ 5 Snippets Landles C, Osborne GF, Phillips J, Canibano-Pico M, Nita IM, Ali N, Bobkov K, Greene JR, Sathasivam K, Bates GP.
In-Text Gene Mentions

…in the huntingtin (HTT) protein.…

…detecting the full-lengthHTTand HTT1a isoforms,…

…the full-length mutantHTTprotein decreases, whereas…

…the huntingtin (HTT) gene that…

…the levels ofHTTprotein isoforms can…

Show Full Abstract

Huntington's disease is an inherited neurodegenerative disorder caused by a CAG repeat expansion that encodes a polyglutamine tract in the huntingtin (HTT) protein. The mutant CAG repeat is unstable and expands in specific brain cells and peripheral tissues throughout life. Genes involved in the DNA mismatch repair pathways, known to act on expansion, have been identified as genetic modifiers; therefore, it is the rate of somatic CAG repeat expansion that drives the age of onset and rate of disease progression. In the context of an expanded CAG repeat, the <i>HTT</i> pre-mRNA can be alternatively processed to generate the <i>HTT1a</i> transcript that encodes the aggregation prone and highly pathogenic HTT1a protein. This may be a mechanism through which somatic CAG repeat expansion exerts its pathogenic effects, as the longer the CAG repeat, the more <i>HTT1a</i> and HTT1a is produced. The allelic series of knock-in mouse models, <i>Hdh</i>Q20, <i>Hdh</i>Q50, <i>Hdh</i>Q80, <i>Hdh</i>Q111, CAG140 and zQ175 with polyglutamine expansions of 20, 50, 80, 111, 140 and ∼190, can be used to model the molecular and cellular consequences of CAG repeat expansion within a single neuron. By western blot of cortical lysates, we found that mutant HTT levels decreased with increasing CAG repeat length; mutant HTT was only 23 and 10% of wild-type levels in CAG140 and zQ175 cortices, respectively. To identify the optimal bioassays for detecting the full-length HTT and HTT1a isoforms, we interrogated the pairwise combinations of seven well-characterized antibodies on both the 'homogeneous time-resolved fluorescence' and 'Meso Scale Discovery' platforms. We tested 32 assays on each platform to detect 'full-length mutant HTT', HTT1a, 'total mutant HTT' (full-length HTT and HTT1a) and 'total full-length HTT' (mutant and wild type). None of these assays recapitulated the full-length mutant HTT levels as measured by western blot. We recommend using isoform- and species-specific assays that detect full-length mutant HTT, HTT1a or wild-type HTT as opposed to those that detect more than one isoform simultaneously. Our finding that as the CAG repeat expands, full-length mutant HTT levels decrease, while <i>HTT1a</i> and HTT1a levels increase has implications for therapeutic strategies. If mutant HTT levels in cells containing (CAG)<sub>200</sub> are only 10% of wild-type, HTT-lowering strategies targeting full-length <i>HTT</i> at sequences 3' to Intron 1 <i>HTT</i> will predominantly lower wild-type HTT, as mutant HTT levels in these cells are already depleted. These data support a therapeutic strategy that lowers <i>HTT1a</i> and depletes levels of the HTT1a protein.

STAU1
Also flagged:gene expressionRNA-binding proteinsbindingYTHDF2U2AF2methyladenosine
Journal Article 2024-11-15 ✓ 1 Snippet Vandelli A, Broglia L, Armaos A, Delli Ponti R, Tartaglia GG.
In-Text Gene Mentions

…WDR33, U2AF2, SRSF1,STAU1, and CPSF1.…

Show Full Abstract

RNA modifications play a crucial role in regulating gene expression by altering RNA structure and modulating interactions with RNA-binding proteins (RBPs). In this study, we explore the impact of specific RNA chemical modifications-N<sup>6</sup>-methyladenosine (m⁶A), A-to-I editing, and pseudouridine (Ψ)-on RNA secondary structure and protein-RNA interactions. Utilizing genome-wide data, including RNA secondary structure predictions and protein-RNA interaction datasets, we classify proteins into distinct categories based on their binding behaviors: modification specific and structure independent, or modification unspecific and structure dependent. For instance, m⁶A readers such as YTHDF2 exhibit modification-specific and structure-independent binding, consistently recognizing m⁶A regardless of structural changes. Conversely, proteins such as U2AF2 display modification-unspecific and structure-dependent behavior, altering their binding preferences in response to structural changes induced by different modifications. A-to-I editing, which causes significant structural changes, typically reduces protein interactions, while Ψ enhances RNA structural stability, albeit with variable effects on protein binding. To predict these interactions, we developed the <i>cat</i>RAPID 2.2 <i>RNA modifications</i> algorithm, which computes the effects of RNA modifications on protein-RNA binding propensities. This algorithm enables the prediction and analysis of RNA modifications' impact on protein interactions, offering new insights into RNA biology and engineering.

HFE
Also flagged:viral cirrhosiscirrhosisalcoholobesityalanine aminotransferasediabetes
Journal Article 2024-11-15 ✓ 1 Snippet Byun J, Kim HS, Han Y, Thrift AP, Lin SM, Xiao X, Lim H, Jun G, Desantis SM, El-Serag HB, Kanwal F, Amos CI.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>Cirrhosis is a leading cause of liver-related mortality and a multifactorial disease. To date, the complex genetic architecture of non-viral cirrhosis has not been fully explored. Cross-trait genetic correlations can elucidate the common genetic etiology of genetically correlated phenotypes. This study aims to identify polygenic and pleiotropic traits associated with cirrhosis using the linkage disequilibrium score regression analysis.<h4>Methods</h4>We conducted genome-wide association analysis of 9,622,842 imputed SNPs on 3,368 non-viral cirrhosis cases and 258,258 controls, and cross-trait analysis between non-viral cirrhosis and various polygenic and pleiotropic traits using the UK Biobank cohort study. We further performed sensitivity analyses by removing genomic regions of alcohol intake, smoking behaviors, and obesity. We observed multiple traits showing robust genetic correlations (rg) with non-viral cirrhosis.<h4>Results</h4>We found strong genetic correlations between the genetic architectures of non-viral cirrhosis and clinical/physiologic factors, including BMI (rg=0.82), alanine aminotransferase (0.71), diabetes (0.70), number of cigarettes currently smoked daily (0.67), amount of alcohol drunk on a typical drinking day (0.60), insomnia (0.59), gout (0.57), depression (0.50), apoliprotein-A (-0.33), HDL cholesterol (-0.49). Exclusion of genomic regions associated with alcohol intake, smoking behaviors, and obesity demonstrated consistent directions and persistent associations in genetic patterns. The inheritability of cirrhosis on the observed scale showed 0.56%.<h4>Conclusions</h4>This study provides a comprehensive assessment of the shared genetic architecture of non-viral cirrhosis predisposition and numerous polygenic and pleiotropic traits, most notably BMI, alanine aminotransferase, and diabetes. These findings provide new information on underlying comorbid conditions that can increase the non-viral cirrhosis risk.

Also flagged:Kawasaki Diseaseacute febrile vasculitishand, foot, and mouth diseasenucleotideCVA6 infectionmucocutaneous lymph node syndrome
Journal Article 2024-11-15 No Snippets Puenpa J, Saelim N, Wanlapakorn N, Korkong S, Yorsaeng R, Poovorawan Y.
Show Full Abstract

<b>Background and Clinical Significance:</b> Kawasaki disease (KD) is an acute febrile vasculitis that primarily affects children and is associated with systemic inflammation, particularly in the coronary arteries. Coxsackievirus A6 (CVA6) has emerged as a significant agent in atypical presentations of hand, foot, and mouth disease (HFMD), raising the possibility of its involvement in KD. <b>Case Presentation:</b> This report presents the case of an 18-month-old Thai boy admitted with symptoms of high fever, sore throat, and ulcerative lesions, initially diagnosed with herpangina. As his condition progressed, additional KD symptoms developed, including conjunctival injection, rash, and elevated inflammatory markers, fulfilling the diagnostic criteria for KD. Notably, throat swab analysis confirmed CVA6 as the causative agent. Phylogenetic analysis revealed that the CVA6 strain closely aligned with Chinese strains from 2023, showing a high nucleotide sequence homology of 98.4%. <b>Conclusions:</b> In conclusion, this case highlights a possible association between CVA6-associated herpangina and KD, suggesting that CVA6 infection may act as a trigger for KD in genetically susceptible children. These findings highlight the need for increased awareness among healthcare providers to promptly identify and manage Kawasaki Disease during peak enterovirus seasons, reducing its impact on children.

medRxiv 2024-11-15 Preprint (No Snippets API) Thakur R, Xu M, Sowards H, Yon J, Jessop L, Myers T, Zhang T, Chari R, Long E, Rehling T, Hennessey R, Funderburk K, Yin J, Machiela MJ, Johnson ME, Wells AD, Chesi A, Grant SF, Iles MM, Landi MT, Law MH, Melanoma Meta-Analysis Consortium, Choi J, Brown KM.
Show Full Abstract

<h4>ABSTRACT</h4> Genome-wide association studies (GWAS) of melanoma risk have identified 68 independent signals at 54 loci. For most loci, specific functional variants and their respective target genes remain to be established. Capture-HiC is an assay that links fine-mapped risk variants to candidate target genes by comprehensively mapping cell-type specific chromatin interactions. We performed a melanoma GWAS region-focused capture-HiC assay in human primary melanocytes to identify physical interactions between fine-mapped risk variants and potential causal melanoma susceptibility genes. Overall, chromatin interaction data alone nominated potential causal genes for 61 of the 68 melanoma risk signals, identifying many candidates beyond those reported by previous studies. We further integrated these data with cell-type specific epigenomic (chromatin state, accessibility), gene expression (eQTL/TWAS), DNA methylation (meQTL/MWAS), and massively parallel reporter assay (MPRA) data to prioritize potentially cis -regulatory variants and their respective candidate gene targets. From the set of fine-mapped variants across these loci, we identified 140 prioritized candidate causal variants linked to 195 candidate genes at 42 risk signals. In addition, we developed an integrative scoring system to facilitate candidate gene prioritization, integrating melanocyte and melanoma datasets. Notably, at several GWAS risk signals we observed long-range chromatin connections (500 kb to >1 Mb) with distant candidate target genes. We validated several such cis -regulatory interactions using CRISPR inhibition, providing evidence for known cancer driver genes MDM4 and CBL , as well as the SRY-box transcription factor SOX4 , as likely melanoma risk genes.

bioRxiv 2024-11-15 Preprint (No Snippets API) Rasteh AM, Liu H, Wang P.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>BACKGROUND</h4> The mitotic DNA integrity checkpoint signaling pathway is potentially involved in cancers that regulate genomic stability where protein kinases play a pivotal role. 16 total protein kinase genes are involved in this pathway: ATM, BRSK1, CDK1, CDK2, CHEK1, CHEK2, MAP3K20, NEK11, PLK1, PLK2, PLK3, PRKDC, STK33, TAOK1, TAOK2, and TAOK3. This study aims to provide pan-cancer profiles of the protein kinases in mitotic DNA integrity checkpoint signaling gene set for potential prognostic and diagnostic purposes, as well as future potential therapeutic targets for cancer in a clinical setting. <h4>METHODS</h4> Multi-omic data was acquired for the 16 genes; over 9000 samples of 33 types of cancer were analyzed to create pan-cancer profiles of SNV, CNV, methylation, mRNA expression, pathway crosstalk, and microRNA regulation networks. <h4>RESULTS</h4> The SNV profile showed that most of these genes have a high SNV mutation frequency across some cancer types, such as UCEC and SKCM. The CNVs of some of these genes are associated with the survival of UCEC, KIRP, and LGG. BRCA, KIRC, LUAD, and STAD might be affected by the mRNA expression of these genes which might involve regulation of copy number, methylation, and miRNA. In addition, these genes also cross-talk with some known cancer pathways. <h4>CONCLUSION</h4> The protein kinases in mitotic DNA integrity checkpoint signaling may play a role in cancer development and, with adequate research, could potentially be developed as biomarkers for cancer diagnosis and prognosis. However, further efforts are necessary to validate their clinical value for diagnosis and prognosis and to develop practical applications in clinical settings. Nevertheless, these pan-cancer profiles offer a better overall understanding as well as useful information for future reference regarding mitotic DNA integrity checkpoint signaling in cancer.

bioRxiv 2024-11-15 Preprint (No Snippets API) Ali S, Berg AH, Yamashita M, Covarrubias AE, Zhang R, Dupont V, Shin B, Yang S, Murali R, Katiki M, Pisarska MD, Thadhani R, Heeger PS, Jordan SC, Karumanchi SA.
Show Full Abstract

<h4>ABSTRACT</h4> B7 costimulatory family member Butyrophilin 2A2 ( BTN2A2) is predominantly expressed by antigen presenting cells and regulates T cell immunity, but molecular mechanisms are unclear. Using immunoblots analyzing TCR-initiated signaling intermediaries, co-immunoprecipitation studies, confocal microscopy, structural modeling-guided mutational analyses, and microscale thermophoresis, we demonstrate that BTN2A2 directly interacts with CD45RO, resulting in CD45 retention within the immune synapse during TCR activation. Recombinant BTN2A2 increased murine CD4+Foxp3+ regulatory T cells (Treg) and reduced T helper 17 (Th17) cells in vitro through mechanisms dependent on CD45 phosphatase activity. BTN2A2 treatment reduced clinical expression of two murine autoimmune disease models and increased Treg/Th17 ratios. Analyses of BTN2A2-deficient animals showed exacerbated disease associated with reduced Treg/Th17 ratios. Addition of BTN2A2 to human mixed lymphocyte responses similarly enhanced human Treg and suppressed Th17 cells and was CD45 phosphatase dependent. Together, our studies identify BTN2A2 as a physiological CD45RO ligand that enhances CD45 phosphatase activity in murine and human T cells, providing mechanisms for BTN2A2-mediated amelioration of autoimmunity. <h4>Summary</h4> Butyrophilin 2A2 ameliorates autoimmunity by binding to CD45RO on activated T cell surfaces leading to dampened TCR signaling which in turn leads to expansion of T regulatory cells and reduction of Th17 differentiation.

bioRxiv 2024-11-15 Preprint (No Snippets API) Soenksen J, Chen J, Varshney A, Martin S, MAGIC, Parker SCJ, Morris AP, Asimit JL, Barroso I.
Show Full Abstract

The Meta-Analysis of Glucose and Insulin-related traits Consortium (MAGIC) identified 242 loci associated with glycaemic traits fasting insulin (FI), fasting glucose (FG), 2h-Glucose (2hGlu), and glycated haemoglobin (HbA1c). However, for the majority, the causal variant(s) remain(s) unknown. Modelling multiple traits and integrating functional annotations have each been shown to improve fine-mapping resolution. Here, we aimed to determine whether combining these techniques would further improve fine-mapping resolution. Using single-trait fine-mapping results from FINEMAP as input, we performed multi-trait fine-mapping with flashfm at 50 loci significantly associated with more than one glycaemic trait. We used fGWAS to build models of enriched annotations by considering 32 cell-type specific and 28 static annotations. We used the prior probabilities from these models to perform annotation informed fine-mapping with both FINEMAP (single-trait) and flashfm (multi-trait). Multi-trait fine-mapping of 106 locus-trait associations significantly (p=1.23 x 10 -17 ) reduced the median size of the credible sets accounting for 99% of the posterior probability of being causal (99CS) to 21.5 variants compared to the 60.5 variants in single-trait fine-mapping. Annotation informed single-trait fine-mapping of 211 locus-trait associations reduced (p=4.24x10 -12 ) the median 99CS size from 72 in agnostic single-trait fine-mapping to 52 variants. Annotation informed multi-trait fine-mapping of 110 locus-trait associations led to a further significant (p=2.69x10 -18 ) decrease in median 99CS size to 14.5 variants compared to 51.0 in annotation informed single-trait fine-mapping. In conclusion, we found that multi-trait and annotation informed fine-mapping can help to further narrow down likely causal variants at glycaemic trait loci, both separately and when combined. <h4>Author Summary</h4> Large-scale studies such as the Meta-analysis of glucose and insulin-related traits consortium (MAGIC) identified regions in our DNA which affect glycaemic measures related to type 2 diabetes, such as glucose and insulin levels measured after fasting overnight. However, these regions contain many DNA changes within them that are close to each other and that are inherited together. This makes identifying the DNA change responsible for the effect on glycaemic measures challenging. Fine-mapping is a statistical approach that helps to narrow down the list of DNA changes that are likely to be responsible for the association with glycaemic measures, referred to as causal DNA changes. Here we used multiple types of fine-mapping approaches together to combine their advantages. We showed that both combining data from multiple related glycaemic measures as well as including information about the likely function of DNA changes helps to narrow down the number of likely causal DNA changes. Combining both approaches led to the biggest improvement in the list of likely causal DNA changes. While this study focuses on glycaemic measures, the approaches can be applied to other measures used to monitor human health, for example blood pressure or cholesterol levels. This study highlights the benefits of combining multiple approaches to find likely causal DNA changes.

POU3F2
Also flagged:organizationstem cell differentiationgene expressionchromatinCCCTC-binding factorCTCF
Journal Article 2024-11-14 ✓ 4 Snippets Zhang R, Sun J, Liu S, Ding J, Xiang M.
In-Text Gene Mentions

…including SOX2 ,POU3F2and ID3 during…

…, FOXG1 ,POU3F2and GBX2 ,…

…like SOX2 andPOU3F2, known to…

…, ID3 andPOU3F2, as well…

Show Full Abstract

The genome is intricately folded into chromatin compartments, topologically associating domains (TADs) and loops unique to each cell type. How this higher-order genome organization regulates cell fate transition remains elusive. Here we show how a single non-neural progenitor transcription factor, PTF1A, reorchestrates the 3D genome during fibroblast transdifferentiation into neural stem cells (NSCs). Multiomics analyses integrating Hi-C data, PTF1A and CTCF DNA-binding profiles, H3K27ac modification, and gene expression, demonstrate that PTF1A binds to subTAD boundaries subsequently associated with elevated CTCF binding and enhanced boundary insulation, and reorganizes chromatin loops, leading to gene expression changes that drive transdifferentiation into NSCs. Moreover, PTF1A activates enhancers and super-enhancers near low-insulation boundaries and modulates H3K27ac deposition, promoting cell fate transitions. Together, our data implicate an involvement of 3D genome in transcriptional and cell fate alterations, and highlight an essential role for PTF1A in gene expression control and multiscale 3D genome remodeling during cell reprogramming.

DCC
Also flagged:Mef2cGata4Tbx5transductionhistonemitochondrial
Journal Article 2024-11-14 ✓ 5 Snippets Santos F, Correia M, Dias R, Bola B, Noberini R, Ferreira RS, Trigo D, Domingues P, Teixeira J, Bonaldi T, Oliveira PJ, Bär C, de Jesus BB, Nóbrega-Pereira S.
In-Text Gene Mentions

…epigenetic landscape ofDCC.…

…Moreover,DCCis accompanied by…

…in vivo improveDCCefficiency and are…

…fate transitions drivingDCC, highlighting the potential…

DCCis accompanied by…

Show Full Abstract

Heart disease is the leading cause of mortality in developed countries, and novel regenerative procedures are warranted. Direct cardiac conversion (DCC) of adult fibroblasts can create induced cardiomyocytes (iCMs) for gene and cell-based heart therapy, and in addition to holding great promise, still lacks effectiveness as metabolic and age-associated barriers remain elusive. Here, by employing MGT (Mef2c, Gata4, Tbx5) transduction of mouse embryonic fibroblasts (MEFs) and adult (dermal and cardiac) fibroblasts from animals of different ages, we provide evidence that the direct reprogramming of fibroblasts into iCMs decreases with age. Analyses of histone posttranslational modifications and ChIP-qPCR revealed age-dependent alterations in the epigenetic landscape of DCC. Moreover, DCC is accompanied by profound mitochondrial metabolic adaptations, including a lower abundance of anabolic metabolites, network remodeling, and reliance on mitochondrial respiration. In vitro metabolic modulation and dietary manipulation in vivo improve DCC efficiency and are accompanied by significant alterations in histone marks and mitochondrial homeostasis. Importantly, adult-derived iCMs exhibit increased accumulation of oxidative stress in the mitochondria and activation of mitophagy or dietary lipids; they improve DCC and revert mitochondrial oxidative damage. Our study provides evidence that metaboloepigenetics plays a direct role in cell fate transitions driving DCC, highlighting the potential use of metabolic modulation to improve cardiac regenerative strategies.

ABT1
Also flagged:transcription factorsbindingMAK16Glutathione S-transferaseGSTlocalization
Journal Article 2024-11-14 ✓ 1 Snippet Lozano-Amado D, Singh U.
In-Text Gene Mentions

…In mice, theactivator of basal transcription 1of basal transcription…

Show Full Abstract

The protozoan parasite <i>Entamoeba</i> has a life cycle that switches between infective cysts and invasive trophozoites. Encystation, a crucial process in parasite biology, is controlled by different mechanisms including transcriptional control. We identified two nuclear proteins in <i>Entamoeba invadens</i>, EIN_066100 and EIN_085620, that regulate parasite development by binding to a DNA motif (TCACTTTC) in the promoter regions of genes upregulated in the first 8 h of stage conversion. Overexpression of EIN_066100, a homolog of MAK16 protein, resulted in reduced amoebic proliferation without affecting encystation efficiency. Overexpression of EIN_085620, a protein with an RNA-recognition motif (RRM), led to increased encystation efficiency. Glutathione S-transferase (GST) pull down assays revealed that EIN_066100 interacts with EIN_085620 both <i>in vivo</i> and <i>in vitro,</i> and this interaction is mediated by the EIN_085620 RRM domain. By evaluating truncated proteins with deletions at either the N-terminal or C-terminal regions of EIN_066100, we elucidated the importance of its N-terminal region in proper protein localization, proliferation, encystation, and interaction with EIN_085620. Taken together, these results indicate a coordinated role of EIN_066100 and EIN_085620 in regulating <i>Entamoeba</i> development. This work sheds light on the molecular mechanisms in the earliest stages of <i>Entamoeba</i> encystation.IMPORTANCEAn important biological process in the biology of <i>Entamoeba</i> is stage conversion, which plays a crucial role in disease propagation, facilitating parasite survival outside the host and spreading to new hosts. Multiple mechanisms contribute to controlling the expression of amebic stage-specific genes such as epigenetic and transcriptional control. Identification of early transcriptional control regulators is crucial to understanding the initiation of the encystation cascade. We identified two nuclear proteins, EIN_066100 and EIN_085620, involved in the proliferation and developmental regulation of <i>E. invadens</i>. These proteins work by direct binding to each other and mediating encystation efficiency. Study of new regulators involved in <i>Entamoeba</i> development represents an important advance in a critical aspect of parasite biology.

Also flagged:ChemokineGranulomasinfectionchemokinesgranulomaCXC chemokines
Journal Article 2024-11-14 No Snippets Amason ME, Beatty CJ, Harvest CK, Saban DR, Miao EA.
Show Full Abstract

Granulomas are defined by the presence of organized layers of immune cells that include macrophages. Granulomas are often characterized as a way for the immune system to contain an infection and prevent its dissemination. We recently established a mouse infection model where <i>Chromobacterium violaceum</i> induces the innate immune system to form granulomas in the liver. This response successfully eradicates the bacteria and returns the liver to homeostasis. Here, we sought to characterize the chemokines involved in directing immune cells to form the distinct layers of a granuloma. We use spatial transcriptomics to investigate the spatial and temporal expression of all CC and CXC chemokines and their receptors within this granuloma response. The expression profiles change dynamically over space and time as the granuloma matures and then resolves. To investigate the importance of monocyte-derived macrophages in this immune response, we studied the role of CCR2 during <i>C. violaceum</i> infection. <i>Ccr2</i><sup>-/-</sup> mice had negligible numbers of macrophages, but large numbers of neutrophils, in the <i>C. violaceum</i>-infected lesions. In addition, lesions had abnormal architecture resulting in loss of bacterial containment. Without CCR2, bacteria disseminated and the mice succumbed to the infection. This indicates that macrophages are critical to form a successful innate granuloma in response to <i>C. violaceum</i>.

SOX6DCC
Also flagged:axonalgene expressioninnervationtranscription factorsinnervationsPD
Journal Article 2024-11-14 ✓ 2 Snippets Fiorenzano A, Storm P, Sozzi E, Bruzelius A, Corsi S, Kajtez J, Mudannayake J, Nelander J, Mattsson B, Åkerblom M, Björklund T, Björklund A, Parmar M.
In-Text Gene Mentions

…neuron markers, includingDCC, DLK1, and long…

SOX6was also detected…

Show Full Abstract

Dopaminergic (DA) neurons exhibit significant diversity characterized by differences in morphology, anatomical location, axonal projection pattern, and selective vulnerability to disease. More recently, scRNAseq has been used to map DA neuron diversity at the level of gene expression. These studies have revealed a higher than expected molecular diversity in both mouse and human DA neurons. However, whether different molecular expression profiles correlate with specific functions of different DA neurons or with their classical division into mesolimbic (A10) and nigrostriatal (A9) neurons, remains to be determined. To address this, we have developed an approach termed TARGET-seq (Tagging projections by AAV-mediated RetroGrade Enrichment of Transcriptomes) that links the transcriptional profile of the DA neurons with their innervation of specific target structures in the forebrain. Leveraging this technology, we identify molecularly distinct subclusters of human DA neurons with a clear link between transcriptome and axonal target-specificity, offering the possibility to infer neuroanatomical-based classification to molecular identity and target-specific connectivity. We subsequently used this dataset to identify candidate transcription factors along DA developmental trajectories that may control subtype identity, thus providing broad avenues that can be further explored in the design of next-generation A9 and A10 enriched DA-neurons for drug screening or A9 enriched DA cells for clinical stem cell-based therapies.

VRK2
Also flagged:gene expressionCancertumortumorsinflammatory responsecell cycles
Journal Article 2024-11-14 ✓ 1 Snippet Pizurica M, Zheng Y, Carrillo-Perez F, Noor H, Yao W, Wohlfart C, Vladimirova A, Marchal K, Gevaert O.
In-Text Gene Mentions

…, PRDX1 ,VRK2) (Fig. 3…

Show Full Abstract

Cancer is a heterogeneous disease requiring costly genetic profiling for better understanding and management. Recent advances in deep learning have enabled cost-effective predictions of genetic alterations from whole slide images (WSIs). While transformers have driven significant progress in non-medical domains, their application to WSIs lags behind due to high model complexity and limited dataset sizes. Here, we introduce SEQUOIA, a linearized transformer model that predicts cancer transcriptomic profiles from WSIs. SEQUOIA is developed using 7584 tumor samples across 16 cancer types, with its generalization capacity validated on two independent cohorts comprising 1368 tumors. Accurately predicted genes are associated with key cancer processes, including inflammatory response, cell cycles and metabolism. Further, we demonstrate the value of SEQUOIA in stratifying the risk of breast cancer recurrence and in resolving spatial gene expression at loco-regional levels. SEQUOIA hence deciphers clinically relevant information from WSIs, opening avenues for personalized cancer management.

MLLT10
Also flagged:acute myeloid leukemiaAMLNPM1acute myeloid leukaemialeukemiaRUNX1
Journal Article 2024-11-14 ✓ 1 Snippet Wu Y, Zhang S, Feng R, Xiao K, Wang T, Bai J, Zhou X, Wang Y, Dai P, Liu H, Wu LR.
In-Text Gene Mentions

…1P), MLL-MLLT6(MLL-AF17), MLL-MLLT10(MLL-AF10), MLL-PTD, TCF3-PBX1…

Show Full Abstract

Relapse is one of the major challenges in clinical treatment of acute myeloid leukemia (AML). Though minimal residual disease (MRD) monitoring plays a crucial role in quantitative assessment of the disease, molecular MRD analysis has been mainly limited to patients diagnosed with gene fusions and NPM1 mutations. Here, we report a longitudinal ultra-sensitive mutation burden (UMB) monitoring strategy for accurate MRD analysis in AML patients regardless of genetic abnormality types. Using a Quantitative Blocker Displacement Amplification (QBDA) sequencing panel with limit of detection below 0.01% variant allele frequency (VAF), a hazard ratio of 14.8 (p < 0.001) is observed in cumulative incidence of relapse analysis of 20 patients with ≥ 2 samples during complete remission (CR). The ROC area under curve (AUC) is 0.98 when predicting relapse within 30 weeks of CR timepoint 2 (N = 20). Furthermore, we demonstrate quantitating VAF below 0.01% is essential for accurate relapse prediction.

Also flagged:bindingestermyeloid leukemiaIononecarotenoids-inducing
Journal Article 2024-11-14 No Snippets Jahanbakhsh K, Ansari-Ahl R, Mashhadi B, Zare M, Samarkhazan NS, Kazemzadeh H, Dehghan G, Dehkordi MF, Gharaghani S, Mahdavi M.
Show Full Abstract

β-Ionone is the end-ring counterpart of β-carotenoids, which are widely found in fruits and vegetables. Recent studies have illustrated the antimetastatic, anti-proliferative, and apoptosis-inducing activities of β-ionone both in vitro and in vivo. We aimed to explore the anti-cancer potency of β-Ionone-derived ester, (E)-4-(2,6,6-trimethylcyclohex-1-enyl) but-3-en-2-ylpyrazine-2-carboxylate (4-TM.P). The cytotoxic effects of the compound on K562 cells were evaluated by MTT assay. The mechanisms of apoptosis induction were investigated by acridine orange/ethidium bromide (AO/EtBr) double staining, cell cycle analysis, and Annexin V/PI staining. Furthermore, the 4-TM.P-DNA interactions have been thoroughly elucidated by various methods, such as ultraviolet-visible spectroscopy, fluorescence assays, viscosity measurements, molecular docking, and dynamic simulation. The MTT cytotoxicity assay revealed that the growth of K562 cells was inhibited by treatment with β-ionone-derived ester, with an IC50 of 25 ± 5.0 µM at 72 h. Morphological studies revealed the occurrence of apoptosis in treated cells, and G0/G1 cell cycle arrest was observed after treatment of the cells with the IC50 value of the compound. Analyses of multi-spectroscopy and viscosity assays revealed that 4-TM.P binds to DNA in the minor groove mode, which was supported by molecular docking studies. The dynamic stability of the complex was also confirmed using molecular dynamic simulation analyses.

Also flagged:lipoproteincholesterolEnvbehaviouralDiabeteschromosome
Journal Article 2024-11-14 No Snippets Wang S, Ojewunmi OO, Kamiza A, Ramsay M, Morris AP, Chikowore T, Fatumo S, Asimit JL.
Show Full Abstract

Meta-analysis of genome-wide association studies (GWAS) across diverse populations offers power gains to identify loci associated with complex traits and diseases. Often heterogeneity in effect sizes across populations will be correlated with genetic ancestry and environmental exposures (e.g. lifestyle factors). We present an environment-adjusted meta-regression model (env-MR-MEGA) to detect genetic associations by adjusting for and quantifying environmental and ancestral heterogeneity between populations. In simulations, env-MR-MEGA has similar or greater association power than MR-MEGA, with notable gains when the environmental factor has a greater correlation with the trait than ancestry. In our analysis of low-density lipoprotein cholesterol in ~19,000 individuals across twelve sex-stratified GWAS from Africa, adjusting for sex, BMI, and urban status, we identify additional heterogeneity beyond ancestral effects for seven variants. Env-MR-MEGA provides an approach to account for environmental effects using summary-level data, making it a useful tool for meta-analyses without the need to share individual-level data.

PEBP1
Also flagged:infectioncoronavirus disease 2019COVID-19gene expressionantiviral responseSARS-CoV2 infection
Journal Article 2024-11-14 ✓ 1 Snippet Zhang T, Li Y, Pan L, Sha J, Bailey M, Faure-Kumar E, Williams CK, Wohlschlegel J, Magaki S, Niu C, Lee Y, Su YC, Li X, Vinters HV, Geschwind DH.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Understanding the pathophysiology of neurological symptoms observed after severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) infection is essential to optimizing outcomes and therapeutics. To date, small sample sizes and narrow molecular profiling have limited the generalizability of findings. In this study, we profiled multiple cortical and subcortical regions in postmortem brains of patients with coronavirus disease 2019 (COVID-19) and controls with matched pulmonary pathology (total n = 42) using spatial transcriptomics, bulk gene expression and proteomics. We observed a multi-regional antiviral response without direct active SARS-CoV2 infection. We identified dysregulation of mitochondrial and synaptic pathways in deep-layer excitatory neurons and upregulation of neuroinflammation in glia, consistent across both mRNA and protein. Remarkably, these alterations overlapped substantially with changes in age-related neurodegenerative diseases, including Parkinson's disease and Alzheimer's disease. Our work, combining multiple experimental and analytical methods, demonstrates the brain-wide impact of severe acute/subacute COVID-19, involving both cortical and subcortical regions, shedding light on potential therapeutic targets within pathways typically associated with pathological aging and neurodegeneration.

Also flagged:genetic diseasespeptidebindingcolorectal cancercancergenetic disorders
Journal Article 2024-11-14 No Snippets Lee KH, Assassi S, Mohan C, Pedroza C.
Show Full Abstract

<h4>Background</h4>One of the most promising approaches for early and more precise disease prediction and diagnosis is through the inclusion of proteomics data augmented with clinical data. Clinical proteomics data is often characterized by its high dimensionality and extremely limited sample size, posing a significant challenge when employing machine learning techniques for extracting only the most relevant information. Although there is a wide array of statistical techniques and numerous analysis pipelines employed in proteomics data analysis, it is unclear which of these methods produce the most efficient, reproducible, and clinically meaningful results.<h4>Results</h4>In this study, we compared 9 unique analysis schemes comprised of different machine learning and dimensionality reduction methods for the analysis of simulated proteomics data consisting of 1317 proteins measured in 26 subjects (i.e., 13 controls and 13 cases). In scenarios where the sample size is extremely small (i.e., n < 30), all schemes resulted in an exceptionally high level of performance metrics, indicating potential overfitting. While performance metrics did not exhibit significant differences across schemes, the set of proteins selected to be discriminatory between groups demonstrated a substantial level of heterogeneity. However, despite heterogeneity in the selected proteins, their biological pathways and genetic diseases exhibited similarities. A sensitivity analysis conducted using varying sample sizes indicated that the stability of a set of selected biomarkers improves with larger sample sizes within a scheme.<h4>Conclusions</h4>When the aim of the study is to identify a statistical model that best distinguishes between cohort groups using proteomics data and to uncover the biological pathways and disorders common among the selected proteins, the majority of widely used analysis pipelines perform similarly. However, if the main objective is to pinpoint a set of selected proteins that wield significant influence in discriminating cohort groups and utilize them for subsequent investigations, meticulous consideration is necessary when opting for statistical models, due to the possibility of heterogeneity in the sets of selected proteins.

Also flagged:HYdrocortisoneBronchopulmonary Dysplasiarespiratory failureneonatal lung diseaselung diseaseand
Journal Article 2024-11-14 No Snippets DeMauro SB, Kirpalani H, Ziolkowski K, Hintz S, Watterberg K, Lowe J, Shankaran S, Chawla S, Vohr B, Msall M, D'Angio C, Yoder BA, Lai K, Winter S, Colaizy T, Merhar S, Bann CM, Trotta M, Newman J, Natarajan A, Das A.
Show Full Abstract

<h4>Background</h4>Bronchopulmonary dysplasia (BPD) affects up to half of extremely preterm infants, and is associated with adverse long-term respiratory, neurodevelopmental, and educational sequelae and costly health service and family economic outcomes. The NICHD Neonatal Research Network Hydrocortisone for Bronchopulmonary Dysplasia (BPD) Trial evaluated the efficacy and safety of hydrocortisone treatment to prevent BPD in high-risk infants. The trial enrolled 800 very preterm infants with respiratory failure and followed the participants until 2 years corrected age to assess safety of the trial intervention. Longer-term impacts of hydrocortisone exposure and severity of BPD on functional outcomes of high-risk infants remain unknown. The HYdrocortisone for BPD Respiratory and Developmental (HYBRiD) Outcomes Study extends follow-up of all surviving children enrolled in the Hydrocortisone for BPD Trial until early school age. It aims to characterize the childhood functional motor, cognitive, academic, and pulmonary outcomes of this large, well-phenotyped trial cohort.<h4>Methods</h4>Parents of surviving trial participants complete telephone questionnaires when their children are 3 and 4 years corrected age. A single in-person study visit takes place at early school age (5 years, 0 months to 7 years, 11 months corrected age). Children undergo a multidimensional assessment of functional outcomes and parents complete a battery of questionnaires. In 5 of 19 participating centers, respiratory mechanics are evaluated with impulse oscillometry.<h4>Discussion</h4>The HYBRiD Outcomes Study will be the largest and most comprehensive evaluation to date of the functional early school age outcomes of children with a history of severe neonatal lung disease and of children exposed to HC during infancy. This will substantially improve understanding of the longer-term implications of severe neonatal lung disease; provide data to facilitate the development of future randomized intervention trials in this population; and inform public policy by enhancing knowledge about school age resource requirements in children with a history of prematurity and lung disease.<h4>Trial registration</h4>clinicaltrials.gov ID NCT01353313. Primary trial registration 5/11/11 modified to include followup through school age 12/13/17. This manuscript reflects version 3 of the trial manuscript, dated 10/12/2020.

Also flagged:IgA nephropathyprimary glomerulonephritischronic kidney diseaserenal failuregalactosecomplement C3
Journal Article 2024-11-14 No Snippets Gomes AM, Schau B, Farinha A.
Show Full Abstract

IgA nephropathy (IgAN) is the most prevalent form of primary glomerulonephritis worldwide and a leading cause of chronic kidney disease and renal failure. This disorder is characterized by the deposition of immune complexes containing galactose-deficient forms of IgA and complement C3 in the glomeruli. Until now, disease management relied mainly on optimized supportive care. Systemic corticosteroid therapy is proposed for patients at high risk of disease progression, but the effectiveness and safety of this approach are under debate. A significant proportion of patients do not respond to current therapies and require kidney replacement therapy at a young age, with substantial costs and impact on quality of life. Recently, there have been multiple joint efforts to improve the understanding of IgAN pathophysiology. International collaborations resulted in multiple ongoing clinical trials that are providing new insights toward innovative therapeutic options such as SGLT2 inhibitors, dual endothelin and angiotensin receptor blockers, targeted-release budesonide, B-cell proliferation and differentiation inhibitors, and complement system blockers. Based on this new evidence, revision of the guidelines to manage IgAN is expected to occur in the near future. In addition to the novelty in therapeutic agents, there is also a growing interest in new noninvasive biomarkers for IgAN screening, risk stratification to monitor the course of the disease, and the response to treatment. In this review, we discuss current knowledge on the pathophysiology of IgAN, disease management, and emerging advances in clinical translation of IgAN research.

PRDX6
Also flagged:seleniumSelenium-dependent glutathione peroxidase 4GPX4lipidphospholipidhydroperoxides
Journal Article 2024-11-14 ✓ 5 Snippets Ito J, Nakamura T, Toyama T, Chen D, Berndt C, Poschmann G, Mourão ASD, Doll S, Suzuki M, Zhang W, Zheng J, Trümbach D, Yamada N, Ono K, Yazaki M, Kawai Y, Arisawa M, Ohsaki Y, Shirakawa H, Wahida A, Proneth B, Saito Y, Nakagawa K, Mishima E, Conrad M.
In-Text Gene Mentions

PRDX6dictates ferroptosis sensitivi…

…of peroxiredoxin 6 (PRDX6), a thiol-specific antioxidan…

…we uncover thatPRDX6, beyond its known…

…GPX4 expression inPrdx6-deficient mouse brains and…

…to ferroptosis inPRDX6-deficient tumor xenografts in…

Show Full Abstract

Selenium-dependent glutathione peroxidase 4 (GPX4) is the guardian of ferroptosis, preventing unrestrained (phospho)lipid peroxidation by reducing phospholipid hydroperoxides (PLOOH). However, the contribution of other phospholipid peroxidases in ferroptosis protection remains unclear. We show that cells lacking GPX4 still exhibit substantial PLOOH-reducing capacity, suggesting a contribution of alternative PLOOH peroxidases. By scrutinizing potential candidates, we found that although overexpression of peroxiredoxin 6 (PRDX6), a thiol-specific antioxidant enzyme with reported PLOOH-reducing activity, failed to prevent ferroptosis, its genetic loss sensitizes cancer cells to ferroptosis. Mechanistically, we uncover that PRDX6, beyond its known peroxidase activity, acts as a selenium-acceptor protein, facilitating intracellular selenium utilization and efficient selenium incorporation into selenoproteins, including GPX4. Its physiological significance was demonstrated by reduced GPX4 expression in Prdx6-deficient mouse brains and increased sensitivity to ferroptosis in PRDX6-deficient tumor xenografts in mice. Our study highlights PRDX6 as a critical player in directing cellular selenium utilization and dictating ferroptosis sensitivity.

PRDX6
Also flagged:selenocysteinemetabolismSecselenoprotein PSELENOPselenocysteine lyase
Journal Article 2024-11-14 ✓ 4 Snippets Chen Z, Inague A, Kaushal K, Fazeli G, Schilling D, Xavier da Silva TN, Dos Santos AF, Cheytan T, Freitas FP, Yildiz U, Viviani LG, Lima RS, Pinz MP, Medeiros I, Iijima TS, Alegria TGP, Pereira da Silva R, Diniz LR, Weinzweig S, Klein-Seetharaman J, Trumpp A, Mañas A, Hondal R, Bartenhagen C, Fischer M, Shimada BK, Seale LA, Chillon TS, Fabiano M, Schomburg L, Schweizer U, Netto LE, Meotti FC, Dick TP, Alborzinia H, Miyamoto S, Friedmann Angeli JP.
In-Text Gene Mentions

PRDX6contributes to selenocysteine…

…by peroxiredoxin 6 (PRDX6), independent of SCLY.…

…we demonstrate thatPRDX6can readily react…

…elevated expression ofPRDX6and human MYCN-amplified…

Show Full Abstract

Selenocysteine (Sec) metabolism is crucial for cellular function and ferroptosis prevention and begins with the uptake of the Sec carrier, selenoprotein P (SELENOP). Following uptake, Sec released from SELENOP is metabolized via selenocysteine lyase (SCLY), producing selenide, a substrate for selenophosphate synthetase 2 (SEPHS2), which provides the essential selenium donor, selenophosphate (H<sub>2</sub>SePO<sub>3</sub><sup>-</sup>), for the biosynthesis of the Sec-tRNA. Here, we discovered an alternative pathway in Sec metabolism mediated by peroxiredoxin 6 (PRDX6), independent of SCLY. Mechanistically, we demonstrate that PRDX6 can readily react with selenide and interact with SEPHS2, potentially acting as a selenium delivery system. Moreover, we demonstrate the functional significance of this alternative route in human cancer cells, revealing a notable association between elevated expression of PRDX6 and human MYCN-amplified neuroblastoma subtype. Our study sheds light on a previously unrecognized aspect of Sec metabolism and its implications in ferroptosis, offering further possibilities for therapeutic exploitation.

DCC
Also flagged:axonalbone morphogenetic proteinIdaxonlaminin-likeaxon guidance
Journal Article 2024-11-14 ✓ 5 Snippets Alvarez S, Gupta S, Mercado-Ayon Y, Honeychurch K, Rodriguez C, Kawaguchi R, Butler SJ.
In-Text Gene Mentions

…different receptors, includingDcc, neogenin1, and members…

…have shown thatDccis consistently expressed…

…) shows thatDcc, neogenin1, Unc5c, and…

…However, onlyDcchas the profile…

…the expression ofDccis upregulated immediately…

Show Full Abstract

We have identified an unexpected role for netrin1, a canonical axonal guidance cue, as a suppressor of bone morphogenetic protein (Bmp) signaling in the developing dorsal spinal cord. Using a combination of gain- and loss-of-function approaches in chicken and mouse embryonic models, as well as mouse embryonic stem cells (mESCs), we have observed that manipulating the level of netrin1 specifically alters the patterning of the Bmp-dependent dorsal interneurons (dIs), dI1-dI3. Altered netrin1 levels also change Bmp signaling activity, as assessed using bioinformatic approaches, as well as monitoring phosophoSmad1/5/8 activation, the canonical intermediate of Bmp signaling, and Id levels, a known Bmp target. Together, these studies support the hypothesis that netrin1 acts from the intermediate spinal cord to regionally confine Bmp signaling to the dorsal spinal cord. Thus, netrin1 has reiterative activities shaping dorsal spinal circuits, first by regulating cell fate decisions and then acting as a guidance cue to direct axon extension.

Also flagged:Pancreatic Ductal AdenocarcinomaPtf1acre-recombinasetranscription factorElastasegene expression
Journal Article 2024-11-14 No Snippets Mousavi F, Thompson J, Lau J, Renollet N, Martin MB, McGue J, Hassan O, Frankel T, Shooshtari P, Pin CL, Bednar F.
Show Full Abstract

<h4>Background & aims</h4>The fundamental biology of pancreatic ductal adenocarcinoma has been greatly impacted by the characterization of genetically engineered mouse models that allow temporal and spatial activation of oncogenic KRAS (KRAS<sup>G12D</sup>). One of the most commonly used models involves targeted insertion of a cre-recombinase into the Ptf1a gene. However, this approach disrupts the Ptf1a gene, resulting in haploinsufficiency that likely affects sensitivity to oncogenic KRAS (KRAS<sup>G12D</sup>). This study aims to determine if Ptf1a haploinsufficiency affected the acinar cell response to KRAS<sup>G12D</sup> before and after induction of pancreatic injury.<h4>Methods</h4>We performed morphological and molecular analysis of 3 genetically engineered mouse models that express a tamoxifen-inducible cre-recombinase to activate Kras<sup>G12D</sup> in acinar cells of the pancreas. The cre-recombinase was targeted to the acinar-specific transcription factor genes, Ptf1a or Mist1/Bhlha15, or expressed within a BAC-derived Elastase transgene. Histological and RNA-seq analyses were used to delineate differences between the models.<h4>Results</h4>Up to 2 months after tamoxifen induction of KRAS<sup>G12D</sup>, morphological changes were negligible. However, induction of pancreatic injury by cerulein resulted in widespread PanIN lesions in Ptf1a<sup>creERT</sup> pancreata within 7 days and maintained for at least 5 weeks post-injury, which was not seen in the models with 2 functional Ptf1a alleles. RNA-sequencing analysis prior to injury induction suggested Ptf1a<sup>creERT</sup> and Mist1<sup>creERT</sup> mice have unique profiles of gene expression that predict a differential response to injury. Multiplex analysis of pancreatic tissue confirmed different inflammatory responses between the models.<h4>Conclusions</h4>These findings suggest Ptf1a haploinsufficiency in Ptf1a<sup>creERT</sup> mouse models promotes KRAS<sup>G12D</sup> priming of genes for promotion of pancreatic ductal adenocarcinoma.

Also flagged:chromatinhistonemodificationsmethylationinfectionsvision
Journal Article 2024-11-14 No Snippets Sood S, Tiwari A, Sangwan J, Vohra M, Sinha NR, Tripathi R, Sangwan VS, Mohan RR.
Show Full Abstract

Epigenetics plays a vital role in corneal health and diseases. Epigenetic changes regulate the expression of genes by altering the accessibility of chromatin via histone modifications, DNA methylation and miRNAs without altering DNA sequence. Ocular trauma and infections are common causes of corneal damage, vision impairment, and mono/bilateral blindness worldwide. Mounting literature shows that epigenetic modifications can modulate corneal clarity, function, and pathogenesis including inflammation, wound healing, fibrosis, and neovascularization. Additionally, epigenetic modifications can be targeted to reverse corneal pathologies and develop interventional therapies. However, current understanding on how epigenetic modifications lead to corneal abnormalities and diseases is limited. This review provides in-depth knowledge and mechanistic understanding of epigenetics alterations in corneal pathogenesis, and information on potential epigenetic targets for treatment of corneal diseases.

PLCL1
Also flagged:colorectal cancercarcinomapolymeraseColorectal adenomasAPCKRAS
Journal Article 2024-11-14 ✓ 1 Snippet Chen Q, Xu YH, Kang S, Lin W, Luo L, Yang L, Zhang QH, Yang P, Huang JQ, Zhang X, Zhang J, Zhao Q, Xu RH, Luo HY.
In-Text Gene Mentions

…TAS2R43 (14%), andPLCL1(12%) (Figure 3D…

Show Full Abstract

Colorectal adenomas (CRAs) represent precancerous lesions that precede the development of colorectal cancer (CRC). Regular monitoring of CRAs can hinder the progression into carcinoma. To explore the utility of tissue DNA and circulating cell-free DNA (cfDNA) in early diagnosis of CRC, we retrospectively sequenced paired tissue and plasma samples from 85 patients with conventional CRAs. The genetic alterations identified were compared with those from 78 stage-I CRC patients (CRC-I) in the ChangKang project. Within the CRA cohort, we pinpointed 12 genes, notably <i>APC</i>, <i>KRAS</i>, and <i>SOX9</i>, that exhibited significant mutated rates in tissue. Patients harboring <i>KMT2C</i> and <i>KMT2D</i> mutations displayed persistent polyps. By comparing with the mutational profiles of metastatic CRC plasma samples, we found that <i>ZNF717</i> was exclusively mutated in CRAs, while <i>KMT2C</i> and <i>KMT2D</i> mutations were detected in both CRA and CRC. The presence of cfDNA mutations in plasma was validated through polymerase chain reaction, enhancing the feasibility of using cfDNA mutations for early CRC screening. Compared with CRC-I, CRAs exhibited a reduced frequency of <i>TP53</i> and <i>PIK3CA</i> somatic mutations and underwent non-neutral evolution more often. We established a random forest model based on 15 characteristic genes to distinguish CRA and CRC, achieving an area under the curve of 0.89. Through this endeavor, we identified two novel genes, <i>CNTNAP5</i> and <i>GATA6</i>, implicated in CRC carcinogenesis. Overall, our findings reveal convincing biomarkers markers for detecting CRAs with a propensity for CRC development, highlighting the importance of early genetic screening in CRC prevention.

Also flagged:Mineralscarbohydratespolyphenolsmineralpotassiumcalcium
Journal Article 2024-11-14 No Snippets Zhao S, Zhong L, Li X, Qin L, Zhou Y, Lei X, Zheng X, Jin K, Pu Z, Hou X, Song J, Lang T, Zhang C, Feng J.
Show Full Abstract

Sweet potato (<i>Ipomoea batatas</i> (L.) is regarded among the most crucial crops globally because it is abundant in essential nutrients vital for human health. However, limited comprehensive information is available regarding the nutritional composition of sweet potato, which hinders its optimal utilization. This study investigated the nutritional and chemical composition of sweet potato roots and explored their interrelationships. In total, 86 sweet potato accessions, comprising white, yellow, orange, and purple flesh-colored varieties, were used. A total of 34 components, including nutrients, phytochemicals, and minerals, were identified. Multivariate analysis was performed to assess the relationships among these components. The sweet potato roots were rich in carbohydrates, polyphenols, and minerals. Carbohydrates were primarily composed of total starch (22.6-69.7 g/100 g DW), total soluble sugar (TSS) (10.3-40.0 g/100 g DW), and total dietary fiber (TDF) (7.99-26.0 g/100 g DW). Polyphenols included total caffeoylquinic acids (CQAs) (0.478-14.2 g/kg DW), total anthocyanins (0-2003 mg/kg DW), and β-carotene (0-133 mg/kg DW). The mineral content followed the order: potassium > calcium > phosphorus > sodium > magnesium > iron > manganese > zinc > copper > selenium. White-fleshed sweet potato exhibited high total starch levels (50.4 g/100 g DW) but low TSS levels (21.1 g/100 g DW). Orange-fleshed sweet potato contained high levels of TSS (26.5 g/100 g DW), TDF (17.9 g/100 g DW), and β-carotene (61.4 mg/100 g DW) but low levels of protein (2.99 g/100 g DW) and total starch (43.0 g/100 g DW). Purple-fleshed sweet potato had high levels of phytochemicals, particularly total CQAs (8.17 g/kg DW) and anthocyanins (904 mg/kg DW). Cluster analysis categorized sweet potato accessions into six clusters with unique characteristics. Furthermore, principal component analysis identified accessions with exceptionally high nutritional content. The correlation analysis indicated that starch was negatively correlated with soluble sugar and TDF, whereas CQAs and anthocyanins were highly positively correlated. These findings offer a solid theoretical foundation for sweet potato breeding and utilization.

HFE
Also flagged:Heart failurediabeteshypertensionhyperlipidemiaobesityalcohol
Journal Article 2024-11-14 ✓ 1 Snippet Macrì R, Mollace R, Serra M, Scarano F, Ritorto G, Ussia S, Cardamone A, Coppoletta AR, Carresi C, Gliozzi M, Musolino V, Maiuolo J, Palma E, Volterrani M, Mollace V, Muscoli C.
In-Text Gene Mentions

…trophic erectile dysfunction (HFE) was examined in…

Show Full Abstract

Heart failure (HF) is a complex condition that affects 1-2% of the global population. The presence of comorbidities like diabetes, hypertension, hyperlipidemia, or obesity has been shown in various studies to elevate mortality and hospitalization rates in HF patients. Insufficient outcomes persist in HF, necessitating additional research to address unmet needs in disease management. Lifestyle modifications, including smoking cessation, decreased alcohol consumption, regular exercise, cardiac rehabilitation, and a balanced diet, can prevent and treat a wide range of HF cases. In this review, we aimed to examine how lifestyle changes, nutrition, and nutraceutical supplements can play a role in preventing heart failure and supporting its treatment. A detailed and comprehensive analysis of the most recent data present in the literature could help identify potential candidates for future clinical trials in HF management. There is a growing body of evidence supporting the importance of closely monitoring nutritional balance, including micronutrients and nutraceuticals, in HF patients for better symptom management and outcomes. Despite promising results from initial approaches, the lack of conclusive evidence from recent studies and meta-analyses questions the widespread use of nutraceutical supplementation in HF patients. Further studies are necessary to determine the most effective way to use nutraceutical supplementation in the treatment of myocardial dysfunction in HF patients.

Also flagged:Sulfuric AcidDemineralizationcollagenmineralhydroxyapatitephosphorous
Journal Article 2024-11-14 No Snippets Marković M, Kuzmanović M, Ranković D, Bajuk-Bogdanović D, Šajić A, Dimić D.
Show Full Abstract

The present research aimed to investigate the demineralizing effects of sulfuric acid on pig bone. Alterations in collagen and phosphate contents and changes in the elemental composition of the bone during the 14-day-long immersion in sulfuric acid solutions of different concentrations were estimated using ATR-FTIR, LIBS, and AAS. FTIR spectra at amide I (1800-1600 cm<sup>-1</sup>) and phosphate ν<sub>1</sub>/ν<sub>3</sub> (PO<sub>4</sub><sup>3-</sup>) (1300-900 cm<sup>-1</sup>) domains were scrutinized using the deconvolution method for monitoring changes in the protein secondary structure and mineral content. The results implicated sulfuric acid as a powerful demineralization agent and effective in targeting mineral components, such as hydroxyapatite, while leaving the collagen matrix relatively preserved with a complex secondary structure. Collagen maturity marker values gave valuable insights into the structural integrity of the bone. LIBS and AAS indicated changes in bone hardness; phosphorous-to-carbon ratio; and calcium, phosphorous, and magnesium content in the solutions left after the immersion period. The changes in the ratio of ionic-to-atomic calcium lines in the LIBS spectra indicated hardening of the bone, with increasing acid concentration and prolonged action, due to the deposition of calcium sulfate on the surface. The calcium concentration in the solutions decreased with increased acid concentration, while the change in phosphorus and magnesium concentrations was reversed.

PRDX6
Also flagged:reproductionphloroglucinolroot development6-benzyladenineα-naphthaleneacetic acidindole-3-butyric acid
Journal Article 2024-11-14 ✓ 3 Snippets Zheng K, Yao L, Xie Y, Yu S, Hu Y, Zhu M.
In-Text Gene Mentions

…encoding Peroxidase 6 (PRDX6), Hydroxycinnamoyl-COA Shikim…

…to COMT andPRDX6, which encode the…

…for COMT andPRDX6, enhancing the final…

Show Full Abstract

<i>Paeonia ostii</i>, a plant of substantial economic significance, continues to face constraints in achieving large-scale propagation. In vitro propagation offers a promising avenue for the production of disease-free plants and the genetic transformation of peonies to instill novel traits. However, significant challenges persist in tissue culture, particularly with regards to the reproduction coefficient of shoots and the rooting process. This study reports an efficacious protocol for <i>P. ostii</i> micropropagation, focusing on in vitro root development facilitated through the application of phloroglucinol (PG). Furthermore, the study unveils the molecular signature of <i>P. ostii</i> during in vitro root development. The results indicate that the modified Y3 medium (Y3M), supplemented with 1 mg/L 6-benzyladenine (BA) and 0.1 mg/L α-naphthaleneacetic acid (NAA), is optimal for adventitious bud induction, achieving a 96.67% induction rate and an average of 16.03 adventitious shoots per sample. The highest elongation percentage (92.15%) and the longest average shoot length (3.87 cm) were obtained with Y3M containing 0.3 mg/L BA and 0.03 mg/L NAA. Additionally, the optimal medium for inducing root formation in <i>P. ostii</i> was identified as WPM supplemented with 3 mg/L indole-3-butyric acid (IBA) and 100 mg/L phloroglucinol (PG). Lignin content detection, microscope inspection, and molecular signature results demonstrated that PG enhanced lignin biosynthesis, thereby promoting in vitro rooting of <i>P. ostii</i>.

Also flagged:cancerGBMBreast Invasive CarcinomaGlioblastomapathogenesisgene expression
Journal Article 2024-11-14 No Snippets Liu J, Xue X, Wen P, Song Q, Yao J, Ge S.
Show Full Abstract

<h4>Introduction</h4>The combination of next-generation sequencing technology and Cancer Genome Atlas (TCGA) data provides unprecedented opportunities for the discovery of cancer subtypes. Through comprehensive analysis and in-depth analysis of the genomic data of a large number of cancer patients, researchers can more accurately identify different cancer subtypes and reveal their molecular heterogeneity.<h4>Methods</h4>In this paper, we propose the SMMSN (Self-supervised Multi-fusion Strategy Network) model for the discovery of cancer subtypes. SMMSN can not only fuse multi-level data representations of single omics data by Graph Convolutional Network (GCN) and Stacked Autoencoder Network (SAE), but also achieve the organic fusion of multi- -omics data through multiple fusion strategies. In response to the problem of lack label information in multi-omics data, SMMSN propose to use dual self-supervise method to cluster cancer subtypes from the integrated data.<h4>Results</h4>We conducted experiments on three labeled and five unlabeled multi-omics datasets to distinguish potential cancer subtypes. Kaplan Meier survival curves and other results showed that SMMSN can obtain cancer subtypes with significant differences.<h4>Discussion</h4>In the case analysis of Glioblastoma Multiforme (GBM) and Breast Invasive Carcinoma (BIC), we conducted survival time and age distribution analysis, drug response analysis, differential expression analysis, functional enrichment analysis on the predicted cancer subtypes. The research results showed that SMMSN can discover clinically meaningful cancer subtypes.

TNFSF4
Also flagged:gynecological tumorpregnancy lossRPLpathogenesistumorovarian cancer
Journal Article 2024-11-14 ✓ 1 Snippet Wang Y, Cai Y, Chen J, Shen W, Zhu J, Wang Q.
In-Text Gene Mentions

…NRP1, TNFRSF8, andTNFSF4were greatly higher…

Show Full Abstract

<h4>Background</h4>Ovarian cancer (OV) is the second most prevalent gynecological tumor. Recurrent pregnancy loss (RPL) refers to two or more spontaneous abortions. However, the molecular mechanisms underlying both OV and RPL remain poorly understood. This article focuses on the exploration of the common genetic characteristics of OV and RPL and their molecular mechanisms.<h4>Methods</h4>The 71 differentially expressed genes associated with RPL and 1427 genes associated with OV survival were analyzed, among which 7 common genes were both important in the pathogenesis of RPL and OV. Then stepAIC analysis was performed to simplify the model and decrease the number of genes, which yielded a final set of 5 prognostic genes with coefficients to construct a prognostic risk scoring system. Univariate and multivariate Cox analyses were conducted to verify the independent prognostic factor for OV patients. GSEA and GO analysis results showed enriched biological pathways in the high/low risk groups, thereby revealing their biological characteristics. The effect of immunotherapy is better in LR patients. There was a significantly higher enrichment score of stemness and higher tumor aneuploidy score in the HR group.<h4>Results</h4>A five-gene prognostic risk model provided a more accurate prognosis for OV, and this prognostic score system was validated using two external cohorts. The risk score was an independent prognostic index for OV patients. Based on levels of ICs, immune cell infiltration, and predicted response, low risk OV patients were more likely to benefit from immunotherapies.<h4>Conclusions</h4>The 5-gene risk model can predict the prognosis of OV patients, which can draw the attention of clinicians and help stratify patients into high and low risk groups for management.

RC3H1
Also flagged:systemic autoinflammatory diseasesSAIDsAOSDskin rashhyperferritinemiaglucocorticoids
Journal Article 2024-11-14 ✓ 1 Snippet Prieto-Peña D, Labrador-Sánchez E, Melero-González RB, Antón-Pagés F, Palmou-Fontana N, Alvarez-Reguera C, Paz-Gandiaga N, Blanco R.
In-Text Gene Mentions

…PSMG2, PSTPIP1, RBCK1,RC3H1, RIPK1, SLC29A3, TMEM173,…

Show Full Abstract

<h4>Objective</h4>Next-generation sequencing (NGS) panels are increasingly used for the diagnosis of monogenic systemic autoinflammatory diseases (SAIDs). However, their role in patients with adult-onset Still's disease (AOSD) remains unknown. This study aims to assess the usefulness of NGS panels in AOSD patients to improve diagnosis and management of the disease.<h4>Methods</h4>This observational, multicenter study included all patients with AOSD diagnosis who underwent NGS panel testing in northern Spain. Clinical manifestations, laboratory parameters, complications, and therapeutic responses were recorded.<h4>Results</h4>A total of 24 patients (16 men, 8 women) with an average age of 42.2 ± 17.9 (mean ± SD) years, in whom NGS was performed, fulfilled the Yamaguchi and/or Fautrel criteria for AOSD. The most common symptoms, apart from fever, were skin rash (75%), asthenia (91.7%), and articular manifestations (91.7%). All patients had elevated acute-phase reactant levels and hyperferritinemia. Almost all patients received oral glucocorticoids as initial therapy. Conventional disease-modifying antirheumatic drugs (cDMARDs) were used in 17 (70.8%) patients and biologic therapy in 13 (54.1%) patients. Genetic variants were observed in 5 (20.8%) patients. None of them were classified as pathogenic. Variants of uncertain significance (VUS) were identified in <i>NOD2</i> (c.2104C>T and c.2251G>A), <i>TNFRSF1A</i> (c.224C>T), <i>TNFAIP3</i> (c.1939A>C), and <i>SCN9A</i> (c.2617G>A). Atypical manifestations and/or therapeutic refractoriness were observed in patients carrying genetic variants, except for one patient with the <i>TNFAIP3</i> VUS. Four out of five patients with VUS had a severe and refractory course of the disease and required biologic therapy.<h4>Conclusion</h4>NGS was useful to rule out the presence of pathogenic genetic variants related to other SAIDs and to detect VUS that may help identify patients at risk for atypical and severe manifestations and poor response to conventional therapy.

Also flagged:-19anxietyCOVID-19Goldmetalssilver
Journal Article 2024-11-14 No Snippets Dammak W, Fakhfekh M, Alnafisah H, Jeribi A.
Show Full Abstract

The financial industry evolves rapidly, offering numerous opportunities but also introducing inherent risks that require careful navigation by institutions. This paper explores the performance of traditional and digital assets as tools for hedging, diversification, and safe-haven strategies during the Russian-Ukrainian crisis and the Silicon Valley Bank (SVB) collapse. Utilizing daily data from April 30, 2021, to September 15, 2023, and employing the Asymmetric Dynamic Conditional Correlation (ADCC) model, which combines four Generalized Autoregressive Conditional Heteroskedasticity (GARCH) family models and two residual distributions, we conduct a comprehensive analysis. The results indicate that Bitcoin's role as a safe haven is limited during the geopolitical crisis, impacting specific stocks, while gold's effectiveness varies. Digix Gold (DGX) demonstrates robust safe-haven properties, and Paxos Gold (PAXG) proves notably effective for certain stocks. Before the SVB crisis, gold primarily acts as a diversifier but later emerges as a significant safe haven during the banking crisis. These findings provide valuable insights to portfolio managers, emphasizing the importance of adaptive asset allocation in addressing financial uncertainties.

HFE
Also flagged:irondextranthalassemiabindingtransfusion-dependent thalassemiacirrhosis
Journal Article 2024-11-14 ✓ 5 Snippets Khristian E, Ghozali M, Bashari MH, Purnama JN, Irianto G, Panigoro R, Safitri R.
In-Text Gene Mentions

…potential inducer forhemochromatosis: Development of an…

…a model forhemochromatosis.…

…rapid and accuratehemochromatosismodel that better…

…to produce ahemochromatosismodel in rats.…

…rat models ofhemochromatosisare lacking, existing…

Show Full Abstract

Iron overload in transfusion-dependent thalassemia patients represents a significant public health challenge due to its high mortality rate and risks of severe complications. Therefore, developing safe and effective therapeutic modalities for managing iron overload is critical, as current animal models inadequately replicate human conditions. The aim of this study was to investigate the effects of intravenous iron dextran on hepatocyte morphology, liver iron concentration, and serum iron profile changes as a model for hemochromatosis. An experimental design with a post-test-only control group method was conducted using animal models. Fifty rats were used and divided into ten groups, nine received different intravenous doses of iron dextran: 10, 20, 30, 40, 50, 60, 80, 100, and 120 mg/kg body weight (BW) and a control group received no treatment. The results showed that intravenous iron dextran starting at a dose of 10 mg/kg BW caused significant changes in liver iron concentration while starting at 20 mg/kg BW significantly affected hepatocyte morphology, transferrin levels, unsaturated iron binding capacity, serum iron levels, and transferrin saturation. Intravenous iron dextran starting at 40 mg/kg BW resulted significant changes in the level of total iron binding capacity compared to control group. In conclusion, intravenous iron dextran significantly altered hepatocyte morphology, increased liver iron concentration, and modified the serum iron profile, reflecting changes that might be observed in patients with transfusion-dependent thalassemia.

Also flagged:neurodegenerative disordersmitochondrialmitochondriapathogenesisAlzheimer's diseaseAD
Journal Article 2024-11-14 No Snippets Xu L, Zhang T, Zhu B, Tao H, Liu Y, Liu X, Zhang Y, Meng X.
Show Full Abstract

Neurodegenerative disorders (NDDs) are prevalent chronic conditions characterized by progressive synaptic loss and pathological protein alterations. Increasing evidence suggested that mitochondrial quality control (MQC) serves as the key cellular process responsible for clearing misfolded proteins and impaired mitochondria. Herein, we provided a comprehensive analysis of the mechanisms through which MQC mediates the onset and progression of NDDs, emphasizing mitochondrial dynamic stability, the clearance of damaged mitochondria, and the generation of new mitochondria. In addition, traditional Chinese medicines (TCMs) and their active monomers targeting MQC in NDD treatment have been demonstrated. Consequently, we compiled the TCMs that show great potential in the treatment of NDDs by targeting MQC, aiming to offer novel insights and a scientific foundation for the use of MQC stabilizers in NDD prevention and treatment.

Also flagged:Synthesislipid Alipopolysaccharidesglucosaminedisaccharideamine
Journal Article 2024-11-13 No Snippets Verpalen ECJM, Ehlers AM, van Wingaarden ACA, Brouwer AJ, Boons GJ.
Show Full Abstract

The inflammation-inducing properties of lipopolysaccharides (LPS) of Gram-negative bacteria reside in their lipid A moiety. <i>Bacillus fragilis</i>, which is a commensal Gram-negative bacterium, biosynthesises lipid A that is structurally distinct from that of <i>E. coli</i> and other enteric bacteria. It is composed of a β1,6-linked glucosamine (GlcN) disaccharide that is only phosphorylated at the anomeric center. The major species of <i>B. fragilis</i> has five fatty acids and the amine of the distal GlcN moiety carries the unusual (<i>R</i>)-3-(13-methyltetradecanoyloxy)-1.5-methylhexadecanoic acid. A recent study indicates that the LPS of <i>B. fragilis</i> has anti-viral activity by selective induction of interferon (IFN)-β and is protective in mouse models of vesicular stomatitis virus (VSV) and influenza A. Heterogeneity in the structures of LPS and lipid A and possible contamination with other inflammatory components make it difficult to unambiguously define the immune-modulatory properties of LPS or lipid A. Therefore, we developed a synthetic approach for the preparation of the unusual major lipid A species derived from <i>B. fragilis</i>, which includes a synthetic approach for (<i>R</i>)-3-(13-methyltetradecanoyloxy)-1.5-methylhexadecanoic acid by the Wittig olefination to install the terminal isopropyl moiety. The proinflammatory and antiviral responses of synthetic <i>B. fragilis</i> lipid A were investigated in several cell lines and primary human monocytes by examining the production of interleukin (IL)-6 and IFN-β. It was found that <i>B. fragilis</i> does not induce the production of IL-6 and IFN-β but can partially antagonize the production of pro-inflammatory cytokines induced by <i>E. coli</i> LPS and lipid A.

Also flagged:gastric cancergastric cancersH. pylori infectionsH. pylori infectioninfectioncancer
Journal Article 2024-11-13 No Snippets Yin X, Lai Y, Zhang X, Zhang T, Tian J, Du Y, Li Z, Gao J.
Show Full Abstract

Helicobacter pylori (H. pylori) is a primary pathogen associated with gastrointestinal diseases, including gastric cancer. The increase in resistance to antibiotics, along with the adverse effects caused by complicated medication protocols, has made the eradication of H. pylori a more formidable challenge, necessitating alternative therapeutics. Herein, a targeted nanoplatform is reported based on sonodynamic therapy, the chitosan-conjugated fucose loaded with indocyanine green (ICG@FCS). It penetrates the gastric mucosa and homes in on H. pylori through dual targeting mechanisms: molecular via fucose and physical via ultrasound. Upon ultrasound activation, it generates singlet oxygen, effectively attacking planktonic bacteria, disrupting biofilms, and facilitating the clearance of intracellular bacteria by promoting autophagy, including multidrug-resistant strains. The ICG@FCS nanoplatform minimally affects the gut microbiota and aids in gastric mucosa repair. a holistic integrative H. pylori therapy strategy is proposed that targets eradication while preserving gastrointestinal health. This strategy emphasizes the importance of maintaining patient health while eradicating the pathogen. This advancement is set to refine the comprehensive antibacterial approach, offering a promising horizon in the ongoing battle against antibiotic resistance and more effective gastric cancer prevention strategies.

HFE
Also flagged:Macroautophagyautophagycytoplasmicantigen presentationAtg5Atg7
Journal Article 2024-11-13 ✓ 1 Snippet Arbogast F, Sal-Carro R, Boufenghour W, Frenger Q, Bouis D, Filippi De La Palavesa L, Fauny JD, Griso O, Puccio H, Fima R, Huby T, Gautier EL, Molitor A, Carapito R, Bahram S, Romani N, Clausen BE, Voisin B, Mueller CG, Gros F, Flacher V.
In-Text Gene Mentions

…genes such asHfe(Homeostatic iron regulator),…

Show Full Abstract

Macroautophagy (often-named autophagy), a catabolic process involving autophagy-related (Atg) genes, prevents the accumulation of harmful cytoplasmic components and mobilizes energy reserves in long-lived and self-renewing cells. Autophagy deficiency affects antigen presentation in conventional dendritic cells (DCs) without impacting their survival. However, previous studies did not address epidermal Langerhans cells (LCs). Here, we demonstrate that deletion of either Atg5 or Atg7 in LCs leads to their gradual depletion. ATG5-deficient LCs showed metabolic dysregulation and accumulated neutral lipids. Despite increased mitochondrial respiratory capacity, they were unable to process lipids, eventually leading them to ferroptosis. Finally, metabolically impaired LCs upregulated proinflammatory transcripts and showed decreased expression of neuronal interaction receptors. Altogether, autophagy represents a critical regulator of lipid storage and metabolism in LCs, allowing their maintenance in the epidermis.

DNAJC1SOX6
Also flagged:transcription factorsbindingTFHOTgene expressionhistone
Journal Article 2024-11-13 ✓ 4 Snippets Hudaiberdiev S, Ovcharenko I.
In-Text Gene Mentions

…MED1, TFAP4, andSOX6.…

…as TCF7L2, FOXA3,SOX6, FOSL2, etc.,…

…For example,DNAJC1( Michailidou et…

…genes, ARID1A, AUTS2,DNAJC1, OLA1, SOX5, and…

Show Full Abstract

Enhancers and promoters are classically considered to be bound by a small set of transcription factors (TFs) in a sequence-specific manner. This assumption has come under increasing skepticism as the datasets of ChIP-seq assays of TFs have expanded. In particular, high-occupancy target (HOT) loci attract hundreds of TFs with often no detectable correlation between ChIP-seq peaks and DNA-binding motif presence. Here, we used a set of 1003 TF ChIP-seq datasets (HepG2, K562, H1) to analyze the patterns of ChIP-seq peak co-occurrence in combination with functional genomics datasets. We identified 43,891 HOT loci forming at the promoter (53%) and enhancer (47%) regions. HOT promoters regulate housekeeping genes, whereas HOT enhancers are involved in tissue-specific process regulation. HOT loci form the foundation of human super-enhancers and evolve under strong negative selection, with some of these loci being located in ultraconserved regions. Sequence-based classification analysis of HOT loci suggested that their formation is driven by the sequence features, and the density of mapped ChIP-seq peaks across TF-bound loci correlates with sequence features and the expression level of flanking genes. Based on the affinities to bind to promoters and enhancers we detected five distinct clusters of TFs that form the core of the HOT loci. We report an abundance of HOT loci in the human genome and a commitment of 51% of all TF ChIP-seq binding events to HOT locus formation thus challenging the classical model of enhancer activity and propose a model of HOT locus formation based on the existence of large transcriptional condensates.

TAOK3
Also flagged:PIWILmethylationwaterTAO Kinase 3gene expressionhistone
Journal Article 2024-11-13 ✓ 5 Snippets Perera BPU, Wang K, Wang D, Chen K, Dewald A, Sriram S, Goodrich JM, Svoboda LK, Sartor MA, Dolinoy DC.
In-Text Gene Mentions

…brain exhibited increasedTaok3expression ( p…

…Kinase 3 (Taok3), along with…

Taok3expression differences between…

…with mRNA targetsTaok3and Zona pellucida…

…The piRNA targetTaok3is sensitive to…

Show Full Abstract

Lead (Pb) is a neurotoxicant with early life exposure linked to long-term health effects. Piwi-interacting RNAs (piRNAs) are small non-coding RNAs that associate with PIWIL proteins to induce DNA methylation. It remains unknown whether Pb exposure influences piRNA expression. This study evaluated how perinatal Pb exposure (32 ppm in drinking water) impacts piRNA expression in adult mice and assessed piRNA dysregulation as a potential mechanism for Pb-induced toxicity. Pb exposure effects on piRNA expression and associated gene repression in the germline (testis/ovary) and soma (liver and brain) were evaluated. Small RNA sequencing was used to determine differentially expressed piRNAs, RT-qPCR to examine piRNA target expression, and whole genome bisulfite sequencing to evaluate target DNA methylation status. Three piRNAs (mmpiR-1500602, mmpiR-0201406, and mmpiR-0200026) were significant after multiple testing correction (all downregulated in the male Pb-exposed brain in comparison to control; FDR < 0.05). Within piOxiDB, TAO Kinase 3 was identified as a downstream mRNA target for one of the three Pb-sensitive piRNA. The Pb-exposed male brain exhibited increased <i>Taok3</i> expression (<i>p</i> < 0.05) and decreased DNA methylation (FDR < 0.01). The results demonstrate that perinatal Pb exposure stably influences longitudinal piRNA expression in a tissue- and sex-specific manner, potentially via DNA methylation-directed mechanisms.

TNFSF4
Also flagged:TET2cancerchronic infectionschimeric antigen receptorinfectiontumor
Journal Article 2024-11-13 ✓ 1 Snippet Dimitri AJ, Baxter AE, Chen GM, Hopkins CR, Rouin GT, Huang H, Kong W, Holliday CH, Wiebking V, Bartoszek R, Drury S, Dalton K, Koucky OM, Chen Z, Giles JR, Dils AT, Jung IY, O'Connor R, Collins S, Everett JK, Amses K, Sherrill-Mix S, Chandra A, Goldman N, Vahedi G, Jadlowsky JK, Young RM, Melenhorst JJ, Maude SL, Levine BL, Frey NV, Berger SL, Grupp SA, Porter DL, Herbst F, Porteus MH, Carty SA, Bushman FD, Weber EW, Wherry EJ, Jordan MS, Fraietta JA.
In-Text Gene Mentions

…Slamf6 (LY108) andTnfsf4(OX40L) were up-regulated…

Show Full Abstract

CD8<sup>+</sup> T cell exhaustion hampers control of cancer and chronic infections and limits chimeric antigen receptor (CAR) T cell efficacy. Targeting <i>TET2</i> in CAR T cells provides therapeutic benefit; however, TET2's role in exhausted T cell (T<sub>EX</sub>) development is unclear. In chronic lymphocytic choriomeningitis virus (LCMV) infection, TET2 drove conversion from stem cell-like T<sub>EX</sub> progenitors toward terminally differentiated and effector (T<sub>EFF</sub>)-like T<sub>EX</sub>. TET2 also enforced a terminally differentiated state in the early bifurcation between T<sub>EFF</sub> and T<sub>EX</sub>, indicating broad roles for TET2 in acquisition of effector biology. To exploit the therapeutic potential of TET2, we developed clinically actionable <i>TET2-</i>targeted CAR T cells by disrupting <i>TET2</i> via knock-in of a safety switch alongside CAR knock-in at the <i>TRAC</i> locus. <i>TET2</i>-targeted CAR T cells exhibited restrained terminal exhaustion in vitro and enhanced antitumor responses in vivo. Thus, TET2 regulates fate transitions in T<sub>EX</sub> differentiation and can be targeted with a safety mechanism in CAR T cells for improved tumor control.

SOX6
Also flagged:KAT6Bhistone 3lysinegene expressionhistone lysine acetyltransferasecell proliferation
Journal Article 2024-11-13 ✓ 1 Snippet Bergamasco MI, Abeysekera W, Garnham AL, Hu Y, Li-Wai-Suen CS, Sheikh BN, Smyth GK, Thomas T, Voss AK.
In-Text Gene Mentions

…differentiation (SOX2 andSOX6[ Lee et…

Show Full Abstract

Heterozygous mutations in the histone lysine acetyltransferase gene <i>KAT6B</i> (<i>MYST4/MORF/QKF</i>) underlie neurodevelopmental disorders, but the mechanistic roles of KAT6B remain poorly understood. Here, we show that loss of KAT6B in embryonic neural stem and progenitor cells (NSPCs) impaired cell proliferation, neuronal differentiation, and neurite outgrowth. Mechanistically, loss of KAT6B resulted in reduced acetylation at histone H3 lysine 9 and reduced expression of key nervous system development genes in NSPCs and the developing cortex, including the SOX gene family, in particular <i>Sox2</i>, which is a key driver of neural progenitor proliferation, multipotency and brain development. In the fetal cortex, KAT6B occupied the <i>Sox2</i> locus. Loss of KAT6B caused a reduction in <i>Sox2</i> promoter activity in NSPCs. <i>Sox2</i> overexpression partially rescued the proliferative defect of <i>Kat6b</i> <sup>-/-</sup> NSPCs. Collectively, these results elucidate molecular requirements for KAT6B in brain development and identify key KAT6B targets in neural precursor cells and the developing brain.

Also flagged:ethylene glycolmethoxyesteralbuminBSAsynthesis
Journal Article 2024-11-13 No Snippets Burggraef MJ, Oxley A, Zaidi NA, Cutillas PR, Gaffney PRJ, Livingston AG.
Show Full Abstract

PEGylation (the covalent attachment of one or more poly(ethylene glycol) (PEG) units to a therapeutic) is a well-established technique in the pharmaceutical industry to increase blood-residence time and decrease immunogenicity. A challenging aspect of PEGylation is the dispersity of PEGylation agents, which results in batch-to-batch variations and analytical limitations. Herein, we present an approach to overcome these limitations by manufacturing a defined molecular weight (dispersity-free) PEGylation agent. We synthesise a defined molecular weight (M<sub>w</sub>), linear 5 kDa methoxy-PEG (mPEG) active ester in an efficient and scalable manner using an iterative liquid-phase approach based on Nanostar Sieving. We then perform a comparative study on the random PEGylation and subsequent characterisation of the protein bovine serum albumin (BSA), using both the defined M<sub>w</sub>, dispersity-free mPEG active ester, and a commercially available disperse 5 kDa mPEG active ester. We demonstrate that the defined M<sub>w</sub> PEG both allows for facile monitoring of chemical modification reactions during the synthesis of the PEGylation agents, and facilitates straightforward identification of the PEGylated fragments within a PEGylated protein via a simple peptide mapping approach using UPLC-MS.

HTT
Also flagged:methylationdepressionanxietyBDNFACEPRDM8
Journal Article 2024-11-13 ✓ 2 Snippets Rivera LM, Uwizeye G, Stolrow H, Christensen B, Rutherford J, Thayer Z.
In-Text Gene Mentions

…SLC6A4 encodes5 HTTHTT, responsible for…

…Greater peripheral5 HTTHTT expression has…

Show Full Abstract

We investigated associations between prenatal genocidal trauma, including maternal rape, and postnatal adverse childhood experiences (ACEs) on DNA methylation of genes associated with the stress response. In a comparative cross-sectional study of 91 Rwandan young adults, categorized by prenatal exposure to genocide and maternal rape, genocide without rape, and unexposed controls, we analyzed DNA methylation from dried blood spots and assessed ACEs and depression and anxiety symptoms at age 24. Prenatal exposure to maternal rape was associated with DNA methylation changes in BDNF and SLC6A4, with the association in BDNF attenuated after including ACE exposure in the model. Genocide exposure without rape was associated with methylation changes in PRDM8 after adjusting for early adversity. Methylation in BDNF and SLC6A4 correlated with depression and anxiety symptoms. These findings underscore the impact of prenatal and postnatal trauma on DNA methylation and mental wellbeing, emphasizing the need for continued support for survivors in the decades after conflict.

Also flagged:cancertumorT Cell ReceptorChimeric Antigen Receptorhematologic malignanciessolid tumors
Journal Article 2024-11-13 No Snippets Zhang Y, Xu Q, Gao Z, Zhang H, Xie X, Li M.
Show Full Abstract

Adoptive T cell therapy is a pivotal strategy in cancer immunotherapy, demonstrating potent clinical efficacy. However, its limited durability often results in primary resistance. High-throughput screening technologies, which include both genetic and non-genetic approaches, facilitate the optimization of adoptive T cell therapies by enabling the selection of biologically significant targets or substances from extensive libraries. In this review, we examine advancements in high-throughput screening technologies and their applications in adoptive T cell therapies. We highlight the use of genetic screening for T cells, tumor cells, and other promising combination strategies, and elucidate the role of non-genetic screening in identifying small molecules and targeted delivery systems relevant to adoptive T cell therapies, providing guidance for future research and clinical applications.

Also flagged:neoplasmsneuroendocrine neoplasmsgastrointestinal cancercancersolid tumorstumors
Journal Article 2024-11-13 No Snippets Padwal MK, Parghane RV, Chakraborty A, Ujaoney AK, Anaganti N, Basu S, Basu B.
Show Full Abstract

Neuroendocrine tumors (NETs) are presented with metastases due to delayed diagnosis. We aimed to identify NET-related biomarkers from peripheral blood. The development and validation of a multi-gene NETseq ensemble classifier using peripheral blood RNA-Seq is reported. RNA-Seq was performed on peripheral blood samples from 178 NET patients and 73 healthy donors. Distinguishing gene features were identified from a learning cohort (59 PRRT-naïve GEP-NET patients and 38 healthy donors). Ensemble classifier combining the output of five machine learning algorithms viz. Random Forest (RF), Extreme Gradient Boosting (XGBOOST), Gradient Boosting Machine (GBM), Support Vector Machine (SVM), and Logistic Regression (LR) were trained and independently validated in the evaluation cohort (n = 106). The response to PRRT was evaluated in the PRRT cohort (n = 46) and the PRRT response monitoring cohort (n = 16). The response to <sup>177</sup>Lu-DOTATATE PRRT was assessed using RECIST 1.1 criteria. The Ensemble classifier trained on 61 gene features, distinguished NET from healthy samples with 100% accuracy in the learning cohort. In an evaluation cohort, the classifier achieved 93% sensitivity (95% CI: 87.8%-98.03%) and 91.4% specificity (95% CI: 82.1%-100%) for PRRT-naïve GEP-NETs (AUROC = 95.4%). The classifier returned >87.5% sensitivity across different tumor characteristics and outperformed serum Chromogranin A sensitivity (χ<sup>2</sup> = 21.89, p = 4.161e-6). In the PRRT cohort, RECIST 1.1 responders showed significantly lower NETseq prediction scores after <sup>177</sup>Lu-DOTATATE PRRT, in comparison to the non-responders. In an independent response monitoring cohort, paired samples (before PRRT and after 2nd or 3rd cycle of PRRT) were analyzed. The NETseq prediction score significantly decreased in partial responders (p = .002) and marginally reduced in stable disease (p = .068). The NETseq ensemble classifier identified PRRT-naïve GEP-NETs with high accuracy (≥92%) and demonstrated a potential role in early treatment response monitoring in the PRRT setting. This blood-based, non-invasive, multi-analyte molecular method could be developed as a valuable adjunct to conventional methods in the detection and treatment response assessment in NET patients.

POU3F2
Also flagged:chromatintranscription factorshistoneorgan developmenthistone modificationsorganization
Journal Article 2024-11-13 ✓ 1 Snippet Cao X, Ma T, Fan R, Yuan GC.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

Chromatin states play important roles in the maintenance of cell identities, yet their spatial patterns remain poorly characterized at the organism scale. We developed a systematic approach to analyzing spatial epigenomic data and then applied it to a recently published spatial-CUT&Tag dataset that was obtained from a mouse embryo. We identified a set of spatial genes whose H3K4me3 patterns delineate tissue boundaries. These genes are enriched with tissue-specific transcription factors, and their corresponding genomic loci are marked by broad H3K4me3 domains. Integrative analysis with H3K27me3 profiles showed coordinated spatial transitions across tissue boundaries, which is marked by the continuous shortening of H3K4me3 domains and expansion of H3K27me3 domains. Motif-based analysis identified transcription factors whose activities change significantly during such transitions. Taken together, our systematic analyses reveal a strong connection between the genomic and spatial variations of chromatin states. A record of this paper's transparent peer review process is included in the supplemental information.

MMS22L
Also flagged:vimentincancerstype-III intermediate filament-to-mesenchymal transitioncancervimentin intermediate filaments
Journal Article 2024-11-13 ✓ 3 Snippets Pan KW, Chen HC.
In-Text Gene Mentions

…expression of theMMS22Lgene was decreased.…

MMS22Lis the abbreviation…

…the abbreviation formethyl methanesulfonate-sensitivity protein 22-likemethanesulfonate-sensitivity p…

Show Full Abstract

Nuclear dysmorphia, characterized by crumpled or lobulated polymorphic nuclear shapes, has been used as an index for the malignant grades of certain cancers. The expression of vimentin, a type-III intermediate filament protein, is a hallmark of the epithelial-to-mesenchymal transition. However, it remains unclear whether vimentin is involved in cancer cell nuclear dysmorphia. In this study, we found that vimentin intermediate filaments (VIFs) frequently accumulated at the concave of dysmorphic nucleus in breast cancer MDA-MB-231 cells. Depletion of vimentin apparently restored the nuclear shape of the cells, which was devastated by re-expression of vimentin, but not its assembly-defective Y117D mutant. Depletion of plectin, a cytoskeletal linker, partially prevented the perinuclear accumulation of VIFs and concomitantly restored the nuclear shape of the cells. In addition, depletion of vimentin in lung cancer A549 cells largely prevented nuclear dysmorphia during the epithelial-to-mesenchymal transition induced by TGFβ. Moreover, we found that VIF-mediated nuclear dysmorphia led to defects in DNA repair. Together, our results unveil a novel role of VIFs in cancer cell nuclear dysmorphia, which is associated with genome instability.

Also flagged:Coppertransition metalshomeostasiscopper-dependent proteinscopper transportersCTR1
Journal Article 2024-11-13 No Snippets Wang Y, Li D, Xu K, Wang G, Zhang F.
Show Full Abstract

Copper, one of the most prolific transition metals in the body, is required for normal brain physiological activity and allows various functions to work normally through its range of concentrations. Copper homeostasis is meticulously maintained through a complex network of copper-dependent proteins, including copper transporters (CTR1 and CTR2), the two copper ion transporters the Cu -transporting ATPase 1 (ATP7A) and Cu-transporting beta (ATP7B), and the three copper chaperones ATOX1, CCS, and COX17. Disruptions in copper homeostasis can lead to either the deficiency or accumulation of copper in brain tissue. Emerging evidence suggests that abnormal copper metabolism or copper binding to various proteins, including ceruloplasmin and metallothionein, is involved in the pathogenesis of neurodegenerative disorders. However, the exact mechanisms underlying these processes are not known. Copper is a potent oxidant that increases reactive oxygen species production and promotes oxidative stress. Elevated reactive oxygen species levels may further compromise mitochondrial integrity and cause mitochondrial dysfunction. Reactive oxygen species serve as key signaling molecules in copper-induced neuroinflammation, with elevated levels activating several critical inflammatory pathways. Additionally, copper can bind aberrantly to several neuronal proteins, including alpha-synuclein, tau, superoxide dismutase 1, and huntingtin, thereby inducing neurotoxicity and ultimately cell death. This study focuses on the latest literature evaluating the role of copper in neurodegenerative diseases, with a particular focus on copper-containing metalloenzymes and copper-binding proteins in the regulation of copper homeostasis and their involvement in neurodegenerative disease pathogenesis. By synthesizing the current findings on the functions of copper in oxidative stress, neuroinflammation, mitochondrial dysfunction, and protein misfolding, we aim to elucidate the mechanisms by which copper contributes to a wide range of hereditary and neuronal disorders, such as Wilson's disease, Menkes' disease, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, and multiple sclerosis. Potential clinically significant therapeutic targets, including superoxide dismutase 1, D-penicillamine, and 5,7-dichloro-2-[(dimethylamino)methyl]-8-hydroxyquinoline, along with their associated therapeutic agents, are further discussed. Ultimately, we collate evidence that copper homeostasis may function in the underlying etiology of several neurodegenerative diseases and offer novel insights into the potential prevention and treatment of these diseases based on copper homeostasis.

Also flagged:cyclic adenosine monophosphateprotein kinase APKAneurological diseasesbehavioralamyloid-β
Journal Article 2024-11-13 No Snippets Deng F, Yang D, Qing L, Chen Y, Zou J, Jia M, Wang Q, Jiang R, Huang L.
Show Full Abstract

The interaction between the gut microbiota and cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) signaling pathway in the host's central nervous system plays a crucial role in neurological diseases and enhances communication along the gut-brain axis. The gut microbiota influences the cAMP-PKA signaling pathway through its metabolites, which activates the vagus nerve and modulates the immune and neuroendocrine systems. Conversely, alterations in the cAMP-PKA signaling pathway can affect the composition of the gut microbiota, creating a dynamic network of microbial-host interactions. This reciprocal regulation affects neurodevelopment, neurotransmitter control, and behavioral traits, thus playing a role in the modulation of neurological diseases. The coordinated activity of the gut microbiota and the cAMP-PKA signaling pathway regulates processes such as amyloid-β protein aggregation, mitochondrial dysfunction, abnormal energy metabolism, microglial activation, oxidative stress, and neurotransmitter release, which collectively influence the onset and progression of neurological diseases. This study explores the complex interplay between the gut microbiota and cAMP-PKA signaling pathway, along with its implications for potential therapeutic interventions in neurological diseases. Recent pharmacological research has shown that restoring the balance between gut flora and cAMP-PKA signaling pathway may improve outcomes in neurodegenerative diseases and emotional disorders. This can be achieved through various methods such as dietary modifications, probiotic supplements, Chinese herbal extracts, combinations of Chinese herbs, and innovative dosage forms. These findings suggest that regulating the gut microbiota and cAMP-PKA signaling pathway may provide valuable evidence for developing novel therapeutic approaches for neurodegenerative diseases.

Also flagged:Calciummitochondriaendoplasmic reticulummembranesorganellesmembrane
Journal Article 2024-11-13 No Snippets Peng Y, Zhou L, Jin Y, Wu D, Chen N, Zhang C, Liu H, Li C, Ning R, Yang X, Mao Q, Liu J, Zhang P.
Show Full Abstract

The exchange of information and materials between organelles plays a crucial role in regulating cellular physiological functions and metabolic levels. Mitochondria-associated endoplasmic reticulum membranes serve as physical contact channels between the endoplasmic reticulum membrane and the mitochondrial outer membrane, formed by various proteins and protein complexes. This microstructural domain mediates several specialized functions, including calcium (Ca 2+ ) signaling, autophagy, mitochondrial morphology, oxidative stress response, and apoptosis. Notably, the dysregulation of Ca 2+ signaling mediated by mitochondria-associated endoplasmic reticulum membranes is a critical factor in the pathogenesis of neurological diseases. Certain proteins or protein complexes within these membranes directly or indirectly regulate the distance between the endoplasmic reticulum and mitochondria, as well as the transduction of Ca 2+ signaling. Conversely, Ca 2+ signaling mediated by mitochondria-associated endoplasmic reticulum membranes influences other mitochondria-associated endoplasmic reticulum membrane-associated functions. These functions can vary significantly across different neurological diseases-such as ischemic stroke, traumatic brain injury, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease-and their respective stages of progression. Targeted modulation of these disease-related pathways and functional proteins can enhance neurological function and promote the regeneration and repair of damaged neurons. Therefore, mitochondria-associated endoplasmic reticulum membranes-mediated Ca 2+ signaling plays a pivotal role in the pathological progression of neurological diseases and represents a significant potential therapeutic target. This review focuses on the effects of protein complexes in mitochondria-associated endoplasmic reticulum membranes and the distinct roles of mitochondria-associated endoplasmic reticulum membranes-mediated Ca 2+ signaling in neurological diseases, specifically highlighting the early protective effects and neuronal damage that can result from prolonged mitochondrial Ca 2+ overload or deficiency. This article provides a comprehensive analysis of the various mechanisms of Ca 2+ signaling mediated by mitochondria-associated endoplasmic reticulum membranes in neurological diseases, contributing to the exploration of potential therapeutic targets for promoting neuroprotection and nerve repair.

Also flagged:ACEAGTACTN3lactateMCT1nitric oxide
Journal Article 2024-11-13 No Snippets Hall ECR, John G, Ahmetov II.
Show Full Abstract

Football clubs regularly test and monitor players, with different approaches reflecting player age and competitive level. This narrative review aims to summarise justifications for testing and commonly used testing protocols. We also aim to discuss the validity and reliability of specific tests used to assess football players and provide a holistic overview of protocols currently used in football or those demonstrating potential utility. The PubMed, SportDiscus, and Google Scholar databases were screened for relevant articles from inception to September 2024. Articles that met our inclusion criteria documented tests for several purposes, including talent identification or the assessment of growth/maturation, physiological capacity, sport-specific skill, health status, monitoring fatigue/recovery, training adaptation, and injury risk factors. We provide information on specific tests of anthropometry, physical capacity, biochemical markers, psychological indices, injury risk screening, sport-specific skills, and genetic profile and highlight where certain tests may require further evidence to support their use. The available evidence suggests that test selection and implementation are influenced by financial resources, coach perceptions, and playing schedules. The ability to conduct field-based testing at low cost and to test multiple players simultaneously appear to be key drivers of test development and implementation among practitioners working in elite football environments.

DCC
Also flagged:EndocannabinoidsBrain Developmentendocannabinoidembryogenesisneurogenesisneuronal migration
Journal Article 2024-11-13 ✓ 1 Snippet Rodrigues RJ, Marques JM, Köfalvi A.
In-Text Gene Mentions

…Diacylglycerol Lipase beta;DCC, Deleted in Colorectal…

Show Full Abstract

The endocannabinoid signalling system (ECS) plays a critical role from the very beginning of embryogenesis. Accordingly, the ECS is engaged early on in nervous system development, starting from neurulation, supported by the identification of ECS components-both receptors and enzymes controlling endocannabinoid metabolism-at these early stages. In particular, regarding the brain, the ECS is involved in the tightly regulated sequence of events that comprise brain development, from neurogenesis to neuronal migration, morphological guidance for neuronal connectivity, and synaptic circuitry refinement. The importance of this broad role of the ECS across various brain development processes is further underscored by the growing understanding of the consequences of cannabis exposure at different developmental stages. Despite the considerable knowledge we have on the role of the ECS in brain development, significant gaps in our understanding remain, particularly regarding the long-term impact and underlying mechanisms of cannabis exposure at different developmental stages. This review provides an overview of the current state of knowledge on the role of the ECS throughout brain development, from embryogenesis to adulthood, and discusses the impact of cannabis exposure, especially during adolescence-a critical period of circuitry maturation and refinement coinciding with an increased risk of cannabis use.

Also flagged:Limbic System-Associated Membrane ProteinLSAMPclear cell renal cell carcinomaprostatic adenocarcinomalung adenocarcinomaosteosarcoma
Journal Article 2024-11-13 No Snippets Sinopole KW, Babcock K, Dobi A, Petrovics G.
Show Full Abstract

<h4>Purpose of review</h4>This review aims to describe the role of limbic system-associated membrane protein (LSAMP) in normal- and pathophysiology, and its potential implications in oncogenesis. We have summarized research articles reporting the role of LSAMP in the development of a variety of malignancies, such as clear cell renal cell carcinoma, prostatic adenocarcinoma, lung adenocarcinoma, osteosarcoma, neuroblastoma, acute myeloid leukemia, and epithelial ovarian cancer. We also examine the current understanding of how defects in LSAMP gene function may contribute to oncogenesis. Finally, this review discusses the implications of future LSAMP research and clinical applications.<h4>Recent findings</h4>LSAMP has been originally described as a surface adhesion glycoprotein expressed on cortical and subcortical neuronal somas and dendrites during the development of the limbic system. It is categorized as part of the IgLON immunoglobulin superfamily of cell-adhesion molecules and is involved in regulating neurite outgrowth and neural synapse generation. LSAMP is both aberrantly expressed and implicated in the development of neuropsychiatric disorders due to its role in the formation of specific neuronal connections within the brain. Additionally, LSAMP has been shown to support brain plasticity via the formation of neuronal synapses and is involved in modulating the hypothalamus in anxiogenic environments. In murine studies, the loss of LSAMP expression was associated with decreased sensitivity to amphetamine, increased sensitivity to benzodiazepines, increased hyperactivity in new environments, abnormal social behavior, decreased aggressive behavior, and decreased anxiety. Findings have suggested that LSAMP plays a role in attuning serotonergic activity as well as GABA activity. Given its importance to limbic system development, LSAMP has also been studied in the context of suicide. In malignancies, LSAMP may play a significant role as a putative tumor suppressor, the loss of which leads to more aggressive phenotypes and mortality from metastatic disease. Loss of the LSAMP gene facilitates epithelial-mesenchymal transition, or EMT, where epithelial cells lose adhesion and gain the motile properties associated with mesenchymal cells. Additionally, LSAMP and the function of the RTK pathway have been implicated in tumorigenesis through the modulation of RTK expression in cell membranes and the activation of second messenger pathways and β-catenin.<h4>Summary</h4>Beyond its many roles in the limbic system, LSAMP functions as a putative tumor suppressor protein. Loss of the LSAMP gene is thought to facilitate epithelial-mesenchymal transition, or EMT, where cells lose adhesion and migrate to distant organs. LSAMP's role in modulating RTK activity and downstream ERK and Akt pathways adds to a large body of data investigating RTK expression in oncogenesis. The characteristics of LSAMP defects and their association with aggressive and metastatic disease are evident in reports on clear cell renal cell carcinoma, prostatic adenocarcinoma, lung adenocarcinoma, osteosarcoma, neuroblastoma, acute myeloid leukemia, and epithelial ovarian cancer.

SOX6
Also flagged:steroidhormonebiosynthesisMAPKTGF-betadetermination
Journal Article 2024-11-13 ✓ 2 Snippets Wang H, Wen Z, Amenyogbe E, Jin J, Lu Y, Wang Z, Huang J.
In-Text Gene Mentions

…which sox9b ,sox6, sox11 ,…

…, sox5 ,sox6, and sox8…

Show Full Abstract

The Nao-zhou stock large yellow croaker (<i>Larimichthys crocea</i>) is a unique economic seawater fish species in China and exhibits significant dimorphism in both male and female phenotypes. Cultivating all-female seedlings can significantly improve breeding efficiency. To accelerate the cultivation process of all female seedlings of this species, it is necessary to deeply understand the regulatory mechanisms of sexual differentiation and gonadal development. This study used Illumina high-throughput sequencing to sequence the transcriptome of the testes and ovaries of Nao-zhou stock large yellow croaker to identify genes and molecular functions related to sex determination. A total of 10,536 differentially expressed genes were identified between males and females, including 5682 upregulated and 4854 downregulated genes. Functional annotation screened out 70 important candidate genes related to sex, including 34 genes highly expressed in the testis (including <i>dmrt1</i>, <i>foxm1</i>, and <i>amh</i>) and 36 genes highly expressed in the ovary (including <i>gdf9</i>, <i>hsd3b1</i>, and <i>sox19b</i>). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis found that differentially expressed genes were significantly enriched in nine signaling pathways related to sex determination and gonadal development, including steroid hormone biosynthesis, MAPK signaling pathway, and the TGF-beta signaling pathway. By screening sex-related differentially expressed genes and mapping protein-protein interaction networks, hub genes such as <i>dmrt1</i>, <i>amh</i>, and <i>cyp19a1a</i> were found to be highly connected. The expression levels of 15 sex-related genes, including <i>amh</i>, <i>dmrt1</i>, <i>dmrt2a</i>, <i>foxl1</i>, and <i>zp3b</i>, were determined by qRT-PCR and RNA sequencing. This study screened for differentially expressed genes related to sex determination and differentiation of Nao-zhou stock large yellow croaker and revealed the signaling pathways involved in gonad development of male and female individuals. The results provide important data for future research on sex determination and differentiation mechanisms, thereby providing a scientific basis for the cultivation of all-female seedlings.

SUDS3
Also flagged:CarotenoidcarotenoidsmineralsPSYCRTISOCCD
Journal Article 2024-11-13 ✓ 1 Snippet Cholin SS, Kulkarni CC, Grzebelus D, Jakaraddi R, Hundekar A, Chandan BM, Archana TS, Krishnaja NR, Prabhuling G, Ondrasek G, Simon P.
In-Text Gene Mentions

…activated VRN1 withpolycomb repressorsrepressors (PcG N-terminal)…

Show Full Abstract

<h4>Background/objectives</h4>Carrot is a major root vegetable in the <i>Apiaceae</i> owing to its abundant carotenoids, antioxidants, vitamins, and minerals. The modern dark orange western carrot was derived from sequential domestication events from the white-rooted wild form to the pale orange-, purple-, or yellow-rooted eastern carrot. Genetic and molecular studies between eastern and western carrots are meager despite their evolutionary relatedness.<h4>Methods</h4>Twelve RNA seq libraries obtained from distinct eastern and western cultivars at vegetative and reproductive developmental stages were utilized to identify differentially expressed genes (DEGs) to decode the key molecular genetic changes in carotenoid and flowering pathways.<h4>Results</h4>In the carotenoid pathway, an upregulation of the PSY, CRTISO, and LCYE genes was observed in the western cultivar, while the eastern cultivar exhibited a higher abundance of downstream enzymes, particularly CCD and NCED1. These later enzymes are crucial in linking apocarotenoids and xanthin-mediated ABA signaling. In the flowering pathway, we noted a greater expression of DEGs associated with the photoperiod and vernalization pathways in the western cultivar. In contrast, the eastern cultivar displayed a dominance of genes from the autonomous pathway (FLD, LD, FLK, and PEBP) that function to repress FLC. The experimental validation of 12 key genes through quantitative real-time PCR further confirms their functional role in carrots.<h4>Conclusions</h4>The identified key regulatory genes in these major pathways are valuable for designing breeding strategies for manipulating carotenoid content and flowering time while developing climate-specific carrots. The knowledge of carotenoid and flowering pathways is advantageous in producing nutritionally improved roots and seeds in carrots across diverse climates.

HTT
Also flagged:c-Fosanxietyolanzapineclozapinefluoxetinenucleus
Journal Article 2024-11-13 ✓ 1 Snippet Stanisavljević Ilić A, Filipović D.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT), which is responsible…

Show Full Abstract

The c-Fos as a marker of cell activation is used to identify brain regions involved in stimuli processing. This review summarizes a pattern of c-Fos immunoreactivity and the overlapping brain sub/regions which may provide hints for the identification of neural circuits that underlie depressive- and anxiety-like behaviors of adult male rats following three and six weeks of chronic social isolation (CSIS), relative to controls, as well as the antipsychotic-like effects of olanzapine (Olz), and clozapine (Clz), and the antidepressant-like effect of fluoxetine (Flx) in CSIS relative to CSIS alone. Additionally, drug-treated controls relative to control rats were also characterized. The overlapping rat brain sub/regions with increased expression of c-Fos immunoreactivity following three or six weeks of CSIS were the retrosplenial granular cortex, c subregion, retrosplenial dysgranular cortex, dorsal dentate gyrus, paraventricular nucleus of the thalamus (posterior part, PVP), lateral/basolateral (LA/BL) complex of the amygdala, caudate putamen, and nucleus accumbens shell. Increased activity of the nucleus accumbens core following exposure of CSIS rats either to Olz, Clz, and Flx treatments was found, whereas these treatments in controls activated the LA/BL complex of the amygdala and PVP. We also outline sub/regions that might represent potential neuroanatomical targets for the aforementioned antipsychotics or antidepressant treatments.

DCC
Also flagged:CytokinemyeloperoxidaseMPOoxygennitrogenousIL-10
Journal Article 2024-11-13 ✓ 1 Snippet Ciliberti MG, Santillo A, Caroprese M, Albenzio M.
In-Text Gene Mentions

…the cytokine profile,DCCdistribution, MPO activity…

Show Full Abstract

In the context of climate change, there has been an increased interest in improving management practices for animals genetically adapted to extreme environmental conditions, such as buffaloes. The temperature-humidity index (THI) is used to determine the severity of heat stress in livestock. This study aimed to evaluate the cytokine profile, oxidative staus, differential somatic cell count (DCC), and the surface expression and activity of myeloperoxidase (MPO) in the somatic cells (SCs) of buffalo. Milk samples (<i>n</i> = 216) were collected from the spring to summer season under three different THI classes (THI < 72; ≤72 THI < 76, and THI ≥ 76). The cytokine profile was determined using ELISA, and the expression of DSCC and MPO was determined by flow cytometry. MPO activity was performed on SC extracts using a specific ELISA kit. Oxidative status was determined by the antioxidant/oxidant balance combining the free radical scavenging activity levels, and reactive oxygen and nitrogenous species. The results on the cytokine profile showed that at the THI ≥ 76 the levels of both IL-10 and IFN-γ were highest. IL-1β secretion was lower at the THI < 72 than at the THI values ranging from ≤72 THI < 76. Higher levels of both TNF-α and IL-12 were registered in both THI < 72 and THI ≥ 76 classes. The level of IL-4 was higher in the THI ≥ 76 class than in the ≤72 to <76 range. Data on DCC showed a decrease in the percentage of macrophages and lymphocytes as the THI increased from the ≤72 to <76 range to THI ≥ 76. Furthermore, the highest percentage of polymorphonuclear leukocyte (PMNLs) was registered in both ≤72 to <76 and THI ≥ 76 classes. The MPO activity and surface expression on SC were lower at a THI above 76, which could be associated with an absence of inflammation. A condition of oxidative imbalance was registered as demonstrated by the lower levels of antioxidant/oxidant balance along with increasing THI. Present data demonstrated that buffaloes were able to modulate the alteration of immune response activated by heat stress throughout a series of cross-linked mechanisms involving cytokine networks, different somatic cell distribution, and oxidative status.

Also flagged:gastric cancergastric cancersexonucleasesRNA-binding proteinsgene expressionRNaseR
Journal Article 2024-11-13 No Snippets Guha D, Mondal J, Nandy A, Biswas S, Bagchi A.
Show Full Abstract

Circular RNAs (circRNAs) have gained prominence as important players in various biological processes such as gastric cancer (GC). Identification of several dysregulated circRNAs may serve as biomarkers for early diagnosis or as novel therapeutic targets. Predictive models can suggest potential new interactions and regulatory roles of circRNAs in GCs. Experimental validations of key interactions are being performed using <i>in vitro</i> models, confirming the significance of identified circRNA networks. The aim of this review is to highlight the important circRNAs associated with GC. On top of that an overview of the mechanistic details of the biogenesis and functionalities of the circRNAs are also presented. Furthermore, the potentialities of the circRNAs in the field of new drug discovery are deciphered.

Also flagged:dextranpolyethylene glycoloxanorbornadienethiolesterdegradation
Journal Article 2024-11-13 No Snippets Shi W, Xi Y, Sheng X, Das S, He D, Collins K, Hu Y, Finn MG.
Show Full Abstract

Injectable hydrogels represent a promising strategy for the extended release of biological molecules, thereby reducing the frequency of injections. This study introduces a novel system based on Michael addition of dextran and polyethylene glycol (PEG) polymers functionalized with oxanorbornadiene (OND) and thiol groups, respectively. Reliable control over gelation speed allows administration by injection using a simple syringe-to-syringe mixing protocol that entrains more than 95% of virus-like particle (VLP) cargo. A combination of retro-Diels-Alder and hydrolytic ester bond cleavage gives rise to programmable release of the VLPs. Different release profiles, including burst, linear, and delayed release over a two-week period, are engineered using different OND linkages, and rheological characterization shows the hydrogels to be well within the desired range of stiffness for subcutaneous use. The modular nature of this system offers a generalizable platform for developing degradable materials aimed at sustained release biomedical applications.

HTT
Also flagged:menopausesuicidal thoughtsprimary ovarian insufficiencydeathsleepdepression
Journal Article 2024-11-13 ✓ 1 Snippet Martin-Key NA, Funnell EL, Barker EJ, Bahn S.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) gene in menopausal…

Show Full Abstract

Suicide is one of the leading causes of deaths worldwide, with an estimated 1 in 100 deaths being attributable to suicide. Whilst rates of suicide are higher in men, evidence suggests that suicide attempts are more frequent in women. Suicidality data indicates that deaths by suicide in women are highest in those in midlife, warranting investigation into the relationship between the menopause and suicidality. The current study aimed to review the existing literature examining the relationship between suicidality and the menopause using a systematic review approach. A systematic literature search of MEDLINE, Cochrane Library, Scopus Web of Science, PsycINFO, and Embase databases was conducted in October 2023. Two authors independently screened the titles and abstracts of identified articles against the eligibility criteria. Any inconsistencies were discussed and resolved. This process was subsequently repeated with the articles' full-text. Risk of bias was assessed using the Quality Assessment Tool for Studies with Diverse Designs (QATSDD). Relevant data were extracted and summarised in both a tabulated and narrative form. A total of 28 studies met the inclusion criteria, with the findings revealing a complex relationship between the menopause and suicidality. Several studies highlighted that the perimenopause period shows a higher prevalence of suicidal thoughts compared to pre-menopausal and post-menopausal stages. Conversely, some studies indicated increased suicidality during the post-menopausal phase, while others noted elevated suicidality in pre-menopausal individuals and those with primary ovarian insufficiency. Critically, several studies found no link between hormonal status and suicidality. The quality of the studies also varied, with a lack of involvement from individuals with relevant lived experience being a consistent methodological flaw across all the included studies. Overall, the current evidence on menopause and suicidality is mixed. Further research is needed to unravel the relationship between menopause and suicidality.

TNFSF4
Also flagged:Colorectal cancercancerdeathliverPD-1PD-L1
Journal Article 2024-11-12 ✓ 1 Snippet Xie Q, Liu X, Liu R, Pan J, Liang J.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4), promoted anti-tumor efficac…

Show Full Abstract

PD-1/PD-L1 blockade therapies have displayed extraordinary clinical efficacy for melanoma, renal, bladder and lung cancer; however, only a minority of colorectal cancer (CRC) patients benefit from these treatments. The efficacy of PD-1/PD-L1 blockade in CRC is limited by the complexities of tumor microenvironment. PD-1/PD-L1 blockade immunotherapy is based on T cell-centered view of tumor immunity. However, the onset and maintenance of T cell responses and the development of long-lasting memory T cells depend on innate immune responses. Acknowledging the pivotal role of innate immunity in anti-tumor immune response, this review encapsulates the employment of combinational therapies those involve PD-1/PD-L1 blockade alongside the activation of innate immunity and explores the underlying cellular mechanisms, aiming to harnessing innate immune responses to induce long-lasting tumor control for CRC patients who received PD-1/PD-L1 blockade therapy.

Also flagged:spinal muscular atrophyneuromuscular disordersurvival motor neuron 1SMNgene expressionMetallothionein
Journal Article 2024-11-12 No Snippets Kumar SH, Brandt K, Claus P, Jung K.
Show Full Abstract

<h4>Background</h4>Spinal Muscular Atrophy (SMA), a neuromuscular disorder that leads to weakness in the muscles due to degeneration of motor neurons. Mutations in the survival motor neuron 1 (SMN1) gene leads to the deficiency of SMN protein that causes SMA. The molecular alterations associated with SMA extends across the transcriptome and proteome. Although several studies have examined the transcriptomic profile of SMA, the difference in experimental settings across these studies highlight the need for a comparative meta-analysis to better understand these differences.<h4>Methods and data</h4>We conducted a systematic comparative meta-analysis of publicly available gene expression data from six selected studies to elucidate variations in the transcriptomic landscape across different experimental conditions, including tissue types and mouse models. We used both microarray and RNA-seq datasets, retrieved from Gene Expression Omnibus (GEO) and ArrayExpress (AE). Methods included normalization, differential expression analysis, gene-set enrichment analysis (GSEA), network reconstruction and co-expression analysis.<h4>Results</h4>Differential expression analysis revealed varying numbers of differentially expressed genes ranging between zero and 1,655 across the selected studies. Notably, the Metallothionein gene Mt2 was common in several of the eight comparisons. This highlights its role in oxidative stress and detoxification. Additionally, genes such as Hspb1, St14 and Sult1a1 were among the top ten differentially expressed genes in more than one comparison. The Snrpa1 gene, involved in pre-mRNA splicing, was upregulated in the spinal cord and has a strong correlation with other differentially expressed genes from other comparisons in our network reconstruction analysis. Gene-set enrichment analysis identified significant GO terms such as contractile fibers and myosin complexes in more than one comparison which highlights its significant role in SMA.<h4>Conclusions</h4>Our comparative meta-analysis identified only few genes and pathways that were consistently dysregulated in SMA across different tissues and experimental settings. Conversely, many genes and pathways appeared to play a tissue-specific role in SMA. In comparison with the original studies, reproducibility was rather weak.

Also flagged:steroidosteonecrosis of the femoral headorthopedic diseasesteroidsosteogenesislipid
Journal Article 2024-11-12 No Snippets Li L, Zhao S, Leng Z, Chen S, Shi Y, Shi L, Li J, Mao K, Tang H, Meng B, Wang Y, Shang G, Liu H.
Show Full Abstract

<h4>Background</h4>Osteonecrosis of the femoral head (ONFH) is a refractory orthopedic disease with a high disability rate. Long-term administration of steroids is the most common pathogenic factor for non-traumatic ONFH. Early diagnosis of steroid-induced osteonecrosis of the femoral head (SONFH) is difficult and mainly depends on imaging.<h4>Objectives</h4>The objectives of this review were to examine the pathological mechanisms of SONFH, summarize related markers of SONFH, and identify areas for future studies.<h4>Methods</h4>We reviewed studies on pathological mechanisms and related markers of SONFH and discussed the relationship between them, as well as clinical applications and the outlook of potential markers.<h4>Results</h4>The pathological mechanisms of SONFH included decreased osteogenesis, lipid accumulation, increased intraosseous pressure, and microcirculation disruption. Differential proteomics and genomics play crucial roles in the occurrence, progression, and outcome of SONFH, providing novel insights into SONFH. Additionally, the biological functions of mesenchymal stem cells (MSCs) and exosomes (Exos) in SONFH have attracted increasing attention.<h4>Conclusions</h4>The pathological mechanisms of SONFH are complex. The related markers mentioned in the current review can predict the occurrence and progression of SONFH, which will help provide effective early clinical prevention and treatment strategies for SONFH.

HFE
Also flagged:cataractsadenosine deaminase 2steroidautosomal recessive autoinflammatory disordersystemic vasculitismarrow
Journal Article 2024-11-12 ✓ 1 Snippet Abe-Ridgway K, Puente MA.
In-Text Gene Mentions

…the setting ofhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Deficiency of adenosine deaminase 2 (DADA2) is a rare autosomal recessive autoinflammatory disorder associated with systemic vasculitis and bone marrow failure. Reported ophthalmic findings in DADA2 include optic neuritis, retinal artery occlusion, uveitis, and optic atrophy. We report the case of a child found to have bilateral cataracts.<h4>Case report</h4>A three-year-old recent immigrant from Mexico with a diagnosis of DADA2 and transfusion-dependent anemia was referred to ophthalmology to screen for deferasirox-associated retinopathy in the setting of hemochromatosis. He was incidentally found to have bilateral posterior subcapsular cataracts with no other ophthalmic abnormalities. The child's lab findings were significant for chronic hyperferritinemia, and his history was significant for over a year of oral prednisone use in Mexico.<h4>Conclusions</h4>This is the first reported case of cataracts in a child with DADA2. While DADA2 is an autoinflammatory disorder, this child's lack of uveitis suggests a non-inflammatory etiology. Hyperferritinemia is a known cause of cataracts and is common in DADA2, but the child's history of oral steroid use in Mexico could also explain his cataracts. As pediatric cataracts have not otherwise been reported in DADA2, ophthalmologists should be aware of this possibility, especially in children with hyperferritinemia or a history of steroid use.

Also flagged:ironOsteoarthritisOAdegenerative joint diseaseammoniumcitrate
Journal Article 2024-11-12 No Snippets Prasadam I, Schrobback K, Kranz-Rudolph B, Fischer N, Sonar Y, Sun AR, Secondes E, Klein T, Crawford R, Subramaniam VN, Rishi G.
Show Full Abstract

Osteoarthritis (OA) is a prevalent degenerative joint disease affecting over 530 million individuals worldwide. Recent studies suggest a potential link between iron overload, a condition characterised by the excessive accumulation of iron in the body, and the onset of OA. Iron is essential for various biological processes, and any disruption in its homeostasis can trigger significant health effects, including OA. This study aimed to elucidate the effects of excess iron on joint tissue and the underlying mechanisms associated with excess iron and OA development. Human articular cartilage (n = 6) and synovium (n = 4) were collected from patients who underwent total knee arthroplasty. Cartilage and synovium explants were incubated with a gradually increasing concentration of ferric ammonium citrate for 3 days respectively. The effects of iron homeostasis in tissue explants were analysed using a Laser Ablation Inductively Coupled Plasma Mass Spectrometry (LA-ICP-MS). To further study the effects of iron excess on OA initiation and development, male 3-week-old Hfe<sup>-/-</sup> and 5-week-old Tfr2<sup>-/-</sup> mice, animal models of hereditary haemochromatosis were established. Littermate wild-type mice were fed a high-iron diet to induce dietary overload. All animals were sacrificed at 8 weeks of age, and knee joints were harvested for histological analysis. The LA-ICP-MS analysis unveiled changes in the elemental composition related to iron metabolism, which included alterations in FTH1, FPN1, and HAMP within iron(III)-treated cartilage explants. While chondrocyte viability remained stable under different iron concentrations, ex vivo treatment with a high concentration of Fe<sup>3+</sup> increased the catabolic gene expression of MMP13. Similar alterations were observed in the synovium, with added increases in GAG content and inflammation markers. In vivo studies further supported the role of iron overload in OA development as evidenced by spontaneous OA symptoms, proteoglycan loss, increased Mankin scores, synovial thickening, and enhanced immunohistochemical expression of MMP13, ADAMTS5, and P21 in Hfe<sup>-/-</sup>, Tfr2<sup>-/-</sup>, and diet-induced iron overload mouse models. Our findings elucidate the specific pathways through which excess iron accelerates OA progression and highlights potential targets for therapeutic intervention aimed at modulating iron levels to mitigate OA symptoms. KEY MESSAGES: Iron overload alters joint iron metabolism, increasing OA markers in cartilage and synovium. High iron levels in mice accelerate OA, highlighting genetic and dietary impacts. Excess iron prompts chondrocyte iron storage response, signalling potential OA pathways. Iron dysregulation linked to increased cartilage degradation and synovial inflammation. Our findings support targeted therapies for OA based on iron modulation strategies.

Also flagged:Macrophage-Specific Lactate DehydrogenaseLactate dehydrogenase A+fermentationpyruvatelactate
Journal Article 2024-11-12 No Snippets Lu Y, Osis G, Osis G, Zmijewska AA, Traylor A, Thukral S, Wilson L, Barnes S, George JF, Agarwal A.
Show Full Abstract

No abstract available.

DCC
Also flagged:membranecell adhesioncadherinscytoskeletoncell nucleustranscriptional regulator
Journal Article 2024-11-12 ✓ 3 Snippets Lhomond G, Schubert M, Croce J.
In-Text Gene Mentions

…In thesea urchin L .urchin L .…

…In thesea urchins L .urchins L .…

…reported in thesea urchins L .urchins L .…

Show Full Abstract

Establishment of the 3 primordial germ layers (ectoderm, endoderm, and mesoderm) during early animal development represents an essential prerequisite for the emergence of properly patterned embryos. β-catenin is an ancient protein that is known to play essential roles in this process. However, these roles have chiefly been established through inhibition of β-catenin translation or function at the time of fertilization. Comprehensive analyses reporting the totality of functions played by nuclear β-catenin during early embryogenesis of a given animal, i.e., at different developmental stages and in different germ layers, are thus still lacking. In this study, we used an inducible, conditional knockdown system in the sea urchin to characterize all possible requirements of β-catenin for germ layer establishment and patterning. By blocking β-catenin protein production starting at 7 different time points of early development, between fertilization and 12 h post fertilization, we established a clear correlation between the position of a germ layer along the primary embryonic axis (the animal-vegetal axis) and its dependence on nuclear β-catenin activity. For example, in the vegetal hemisphere, we determined that the 3 germ layers (skeletogenic mesoderm, non-skeletogenic mesoderm, and endoderm) require distinct and highly specific durations of β-catenin production for their respective specification, with the most vegetal germ layer, the skeletogenic mesoderm, requiring the shortest duration. Likewise, for the 2 animal territories (ectoderm and anterior neuroectoderm), we established that their restriction, along the animal-vegetal axis, relies on different durations of β-catenin production and that the longest duration is required for the most animal territory, the anterior neuroectoderm. Moreover, we found that 2 of the vegetal germ layers, the non-skeletogenic mesoderm and the endoderm, further require a prolonged period of nuclear β-catenin activity after their specification to maintain their respective germ layer identities through time. Finally, we determined that restriction of the anterior neuroectoderm territory depends on at least 2 nuclear β-catenin-dependent inputs and a nuclear β-catenin-independent mechanism. Taken together, this work is the first to comprehensively define the spatiotemporal requirements of β-catenin during the early embryogenesis of a single animal, the sea urchin Paracentrotus lividus, thereby providing new experimental evidence for a better understanding of the roles played by this evolutionary conserved protein during animal development.

OLFM4
Also flagged:cancerluciferaseHematoxylinGene expressionFXRobesity
Journal Article 2024-11-12 ✓ 2 Snippets Dong X, Sun F, Secaira-Morocho H, Hui A, Wang K, Cai C, Udgata S, Low B, Wei S, Chen X, Qi M, Pasch CA, Xu W, Jiang J, Zhu Q, Huan T, Deming DA, Fu T.
In-Text Gene Mentions

…and ISCs markerOlfm4in BAs-treated WT…

…Increased Ki67 andOlfm4staining was evident…

Show Full Abstract

The gut microbiota has a significant impact on the development and function of intestinal epithelial cells (IECs) by modifying bile acid (BA) metabolites. Recently, specific gut microbiome-derived BAs, such as 7-oxo-deoxycholic acid (7-oxo-DCA) and isodeoxycholic acid (isoDCA), have been identified to be shifted inversely in colitis and hepatic liver diseases. Although the responsible gut microbes have been identified, metabolites' effects on IECs remain largely unclear. We found that although high-fat diet treatment in mice elevated both 7-oxo-DCA and isoDCA levels, during intestinal tumorigenesis, 7-oxo-DCA levels rise while isoDCA levels decrease. Interestingly, 7-oxo-DCA promotes cancer cell growth, while isoDCA suppresses it. Moreover, 7-oxo-DCA promotes whereas isoDCA inhibits the proliferation of intestinal stem cells in organoids derived from WT and <i>APC<sup>Min/+</sup></i> mice, as well as in patient-derived colon cancer organoids. The <i>APC<sup>Min/+</sup></i> mice administered with 7-oxo-DCA heightened gut permeability and increased tumor burden, whereas isoDCA protected gut barrier and reduced tumor loads. Both BAs reshape the BA pool and shifted gut microbiome. Mechanistically, we identified 7-oxo-DCA as a natural antagonist of Farnesoid X Receptor (FXR) to downregulate FXR signaling, as opposed to isoDCA, which is a potent FXR agonist to upregulate FXR signaling. In conclusion, we unveiled the opposing roles of 7-oxo-DCA and isoDCA to promote or inhibit intestinal tumorigenesis, respectively. Manipulating the BA-FXR axis during tumor initiation and progression holds great promise for developing innovative diagnostic and therapeutic approaches for the treatment of colorectal cancer.

Also flagged:cancertumortumorsadvancedepidermal growth factor receptorEGFR
Journal Article 2024-11-12 No Snippets Dowdell AK, Meng RC, Vita A, Bapat B, Hanes D, Chang SC, Harold L, Wong C, Poon H, Schroeder B, Weerasinghe R, Leidner R, Urba WJ, Bifulco CB, Piening BD.
Show Full Abstract

<h4>Purpose</h4>Precision therapies and immunotherapies have revolutionized cancer care, with novel genomic biomarker-associated therapies being introduced into clinical practice rapidly, resulting in notable gains in patient survival. Despite this, there is significant variability in the utilization of tumor molecular profiling that spans the timing of test ordering, comprehensiveness of gene panels, and clinical decision support through therapy and trial recommendations.<h4>Methods</h4>To standardize testing, we designed a pathologist-directed test ordering system at the time of diagnosis using a 523-gene DNA/RNA hybrid comprehensive genomic profiling (CGP) panel and extensive clinical decision support tools. To comprehensively characterize the clinical impact of this protocol, we developed a novel natural language processing (NLP)-based approach to extract clinical features from physician chart notes. We assessed test actionability rates, therapy choice, and outcomes across a set of 3,216 patients with advanced cancer.<h4>Results</h4>We observed 49% of patients had at least one actionable genomic biomarker-driven-approved and/or guideline-recommended targeted or immunotherapy (IO) and 53% of patients would have been eligible for a precision therapy clinical trial from three large basket trials. When assessing CGP versus an in silico 50-gene panel, 67% of tumors compared with 33% harbored actionable alterations including clinical trials. Among patients with 6 months or more of follow-up, over 52% received a targeted therapy (TT) or IO, versus 32% who received conventional chemotherapy alone. Furthermore, patients receiving TT had significantly improved overall survival compared with patients receiving chemotherapy alone (<i>P</i> < .001).<h4>Conclusion</h4>Overall, these data represent a major shift in standard clinical practice toward molecularly guided treatments (targeted and immunotherapies) over conventional systemic chemotherapy. As guidelines continue to evolve and more precision therapeutics gain approval, we expect this gap to continue to widen.

DCC
Also flagged:anemiahyperthermiaalloimmunizationDvitamin Kvitamin K deficiency
Journal Article 2024-11-12 ✓ 1 Snippet Jiang L, Dominguez G, Cummins A, Muralidharan O, Harrison L, Vaivada T, Bhutta ZA.
In-Text Gene Mentions

…cell mass ofDCCmay be greater…

Show Full Abstract

<h4>Background</h4>Several interventions provided to newborns at birth or within 24 h after birth have been proven critical in improving neonatal survival and other birth outcomes. We aimed to provide an update on the effectiveness and safety of these interventions in low- and middle-income countries (LMICs).<h4>Summary</h4>Following a comprehensive scoping of the literature, we updated or re-analyzed the LMIC-specific evidence for included topics. Ninety-four LMIC studies were identified. Delayed cord clamping with immediate neonatal care after cord clamping resulted in a lower risk of blood transfusion in newborns <32-34 gestational weeks and a lower occurrence of anemia in term newborns but did not have significant effect on neonatal mortality or other common morbidities both in preterm and term newborns. Immediate thermal care using plastic wrap/bag led to a 38% lower risk of hypothermia and a higher axillary temperature in preterm newborns without increasing the risk of hyperthermia. Kangaroo mother care initiated immediately (iKMC) or early after birth (eKMC, within 24 h) significantly reduced neonatal mortality and the occurrence of hypothermia in preterm or low-birth-weight neonates. For delayed first bath in newborns, no pooled estimate was generated due to high heterogeneity of included studies. Trials from high-income countries demonstrated anti-D's effectiveness in lowering the incidence of Rhesus D alloimmunization in subsequent pregnancy if given within 72 h postpartum.<h4>Key messages</h4>We generated the most updated LMIC evidence for several immediate newborn care interventions. Despite their effectiveness and safety in improving some of the neonatal outcomes, further high-quality trials are necessary.<h4>Background</h4>Several interventions provided to newborns at birth or within 24 h after birth have been proven critical in improving neonatal survival and other birth outcomes. We aimed to provide an update on the effectiveness and safety of these interventions in low- and middle-income countries (LMICs).<h4>Summary</h4>Following a comprehensive scoping of the literature, we updated or re-analyzed the LMIC-specific evidence for included topics. Ninety-four LMIC studies were identified. Delayed cord clamping with immediate neonatal care after cord clamping resulted in a lower risk of blood transfusion in newborns <32-34 gestational weeks and a lower occurrence of anemia in term newborns but did not have significant effect on neonatal mortality or other common morbidities both in preterm and term newborns. Immediate thermal care using plastic wrap/bag led to a 38% lower risk of hypothermia and a higher axillary temperature in preterm newborns without increasing the risk of hyperthermia. Kangaroo mother care initiated immediately (iKMC) or early after birth (eKMC, within 24 h) significantly reduced neonatal mortality and the occurrence of hypothermia in preterm or low-birth-weight neonates. For delayed first bath in newborns, no pooled estimate was generated due to high heterogeneity of included studies. Trials from high-income countries demonstrated anti-D's effectiveness in lowering the incidence of Rhesus D alloimmunization in subsequent pregnancy if given within 72 h postpartum.<h4>Key messages</h4>We generated the most updated LMIC evidence for several immediate newborn care interventions. Despite their effectiveness and safety in improving some of the neonatal outcomes, further high-quality trials are necessary.

Also flagged:testicular cancersolid organ tumourtumourscancerplatinumcisplatin
Journal Article 2024-11-12 No Snippets Khan MR, Sheehan PK, Bazin A, Leonard C, Aleem U, Corrigan L, McDermott R.
Show Full Abstract

Testicular cancer is a rare solid organ tumour associated with high cure rates and young age at diagnosis, hence it has a sizeable cohort of survivors worldwide. As it is one of the earliest tumours to be cured, a lot of studies have highlighted the late side effects of cancer and its different treatment modalities including surgery, radiotherapy and chemotherapy. While we are trying to identify the population at higher risk of platinum based chemotherapy and reduce its exposure, cisplatin based regimes remain an important tool to cure testicular cancer. The list of late side effects include a number of fatal and morbid conditions including but not limited to the second malignant neoplasms, cardiovascular disease, hypogonadism, infertility, metabolic syndrome, chronic respiratory disease, renal insufficiency, hearing loss, peripheral neuropathy, infertility and psychological illnesses like stress and anxiety. These complications eventually result in compromised social and economic health as well as lower life expectancy compared to the normal population. This article provides a comprehensive review of the latest data regarding the late side effects in testicular cancer survivors. A review of these conditions can help us develop recommendations and guidelines to improve the morbidity and mortality in survivors of testicular cancer.

Also flagged:oligonucleotidesgenetic diseasesgenetic diseaseOligonucleotide-Threatening DiseasesDuchenne Muscular Dystrophy
Journal Article 2024-11-12 No Snippets Kim-McManus O, Gleeson JG, Mignon L, Smith Fine A, Yan W, Nolen N, Demarest S, Berry-Kravis E, Finkel R, Leonard S, Finlayson S, Augustine E, Lyon GJ, Schule R, Yu T.
Show Full Abstract

Individualized genetic therapies-medicines that precisely target a genetic variant that may only be found in a small number of individuals, as few as only one-offer promise for addressing unmet needs in genetic disease, but present unique challenges for trial design. By nature these new individualized medicines require testing in individualized N-of-1 trials. Here, we provide a framework for maintaining scientific rigor in N-of-1 trials. Building upon best practices from traditional clinical trial design, recent guidance from the United States Food and Drug Administration, and our own clinical research experience, we suggest key considerations including comprehensive baseline natural history, selection of appropriate clinical outcome assessments (COAs) individualized to the patient genotype-phenotype for safety and efficacy assessment over time, and specific statistical considerations. Standardization of N-of-1 trial designs in this fashion will maximize efficient learning from this next generation of targeted individualized therapeutics.

ZNF311
Also flagged:mineralmetabolismaminoacylbiosynthesisgluconeogenesisPPAR
Journal Article 2024-11-12 ✓ 1 Snippet Polizel GHG, Fanalli SL, Diniz WJS, Cesar ASM, Cônsolo NRB, Fukumasu H, Cánovas A, Fernandes AC, Prati BCT, Furlan É, Pombo GDV, Santana MHA.
In-Text Gene Mentions

…; tan =ZNF311; plum3 =…

Show Full Abstract

We investigated the long-term effects of prenatal nutrition on pre-slaughter Nelore bulls using integrative transcriptome and metabolome analyses of liver tissue. Three prenatal nutritional treatments were administered to 126 cows: NP (control, mineral supplementation only), PP (protein-energy supplementation in the third trimester), and FP (protein-energy supplementation throughout pregnancy). Liver samples from 22.5 ± 1-month-old bulls underwent RNA-Seq and targeted metabolomics. Weighted correlation network analysis (WGCNA) identified treatment-associated gene and metabolite co-expression modules, further analyzed using MetaboAnalyst 6.0 (metabolite over-representation analysis and transcriptome-metabolome integrative analysis) and Enrichr (gene over-representation analysis). We identified several significant gene and metabolite modules, as well as hub components associated with energy, protein and oxidative metabolism, regulatory mechanisms, epigenetics, and immune function. The NP transcriptome-metabolome analysis identified key pathways (aminoacyl t-RNA biosynthesis, gluconeogenesis, and PPAR signaling) and hub components (glutamic acid, SLC6A14). PP highlighted pathways (arginine and proline metabolism, TGF-beta signaling, glyoxylate and dicarboxylate metabolism) with arginine and ODC1 as hub components. This study highlights the significant impact of prenatal nutrition on the liver tissue of Nelore bulls, shedding light on critical metabolic pathways and hub components related to energy and protein metabolism, as well as immune system and epigenetics.

DCC
Also flagged:CNTN6NIPA1dopamineSHANK2ISCA1mitochondrial protein assembly
Journal Article 2024-11-12 ✓ 5 Snippets Wang C, Zeng Y, Wang J, Wang T, Li X, Shen Z, Meng J, Yao X.
In-Text Gene Mentions

…(neuronal development), andDCC(dopamine pathway maturation)…

…located within theDCCgene, near the…

…The product ofDCCgene expression is…

…acid sequence ofDCCshares homology with…

…that loss ofDCCfunction may lead…

Show Full Abstract

Racing performance traits are the main indicators for evaluating the performance and value of sport horses. The aim of this study was to identify the key genes for racing performance traits in Yili horses by performing a genome-wide association study (GWAS). Breeding values for racing performance traits were calculated for Yili horses (n = 827) using an animal model. Genome-wide association analysis of racing performance traits in horses (n = 236) was carried out using the Blink, and FarmCPU models in GAPIT software, and genes within the significant regions were functionally annotated. The results of GWAS showed that a total of 24 significant SNP markers (P < 6.05 × 10<sup>- 9</sup>) and 22 suggestive SNP markers (P < 1.21 × 10<sup>- 7</sup>) were identified. Among them, the Blink associated 16 significant SNP loci and FarmCPU associated 12 significant SNP loci. A total of 127 candidate genes (50 significant) were annotated. Among these, CNTN6 (motor coordination), NIPA1 (neuronal development), and DCC (dopamine pathway maturation) may be the main candidate genes affecting speed traits. SHANK2 (neuronal synaptic regulation), ISCA1 (mitochondrial protein assembly), and KCNIP4 (neuronal excitability) may be the main candidate genes affecting ranking score traits. A common locus (ECA1: 22698579) was significantly associated with racing performance traits, and the function of the genes at this locus needs to be studied in depth. These findings will provide new insights into the detection and selection of genetic variants for racing performance and will help to accelerate the genetic improvement of Yili horses.

PRDX6
Also flagged:Head and neck squamous cell carcinomaHNSCCadeninemodificationsmethylationnitrogen
Journal Article 2024-11-12 ✓ 3 Snippets Li W, Chen Y, Zhang Y, Wen W, Lu Y.
In-Text Gene Mentions

…STING1, WDR41, RDH10,PRDX6, NEAT1, SLC20A1, VPS33B,…

…Peroxiredoxin 6 (PRDX6), a member of…

…41 ]found thatPRDX6was downregulated in…

Show Full Abstract

<h4>Objectives</h4>Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide. Four types of RNA modification writers (m6A, m1A, A-I editing, and APA) are widely involved in tumorigenesis and the TME. We aimed to comprehensively explore the role of the four RNA modification writers in the progression and immune microenvironment of HNSCC.<h4>Materials and methods</h4>We first obtained transcription profile data and transcriptional variation of the four types of RNA modification writers from The Cancer Genome Atlas (TCGA) database. HNSCC patients in TCGA dataset were divided into different clusters based on the four types of RNA modification writers. Univariate Cox and Least absolute shrinkage and selection operator (LASSO) analyses were performed to conduct a Writer-score scoring system, which was successfully verified in the GSE65858 dataset and our clinical sample dataset. Finally, we evaluated the relationship between different RNA modification clusters (Writer-score) and immunological characteristics of HNSCC.<h4>Results</h4>Two different RNA modification clusters (A and B) were obtained. These RNA modification clusters (Writer-score) were strongly associated with immunological characteristics (immunomodulators, cancer immunity cycles, infiltrating immune cells (TIICs), inhibitory immune checkpoints, and T cell inflamed score (TIS)) of HNSCC.<h4>Conclusions</h4>This study identified two different RNA modification clusters and explored the potential relationship between RNA modification clusters (Writer-score) and immunological characteristics, offering a new theoretical basis for precision immunotherapy in patients with HNSCC.

DCC
Also flagged:sensory neuronNTRK3transcriptional regulatorstranscription factorTF
Journal Article 2024-11-12 ✓ 1 Snippet Lu T, Wang M, Zhou W, Ni Q, Yue Y, Wang W, Shi Y, Liu Z, Li C, Hong B, Zhou X, Zhong S, Wang K, Zeng B, Zhang J, Wang W, Zhang X, Wu Q, Wang X.
In-Text Gene Mentions

…an-enriched NTRK3<sup>+</sup>/DCC<sup>+</sup> nociceptor subtyp…

Show Full Abstract

Dorsal root ganglia (DRGs) play a crucial role in processing sensory information, making it essential to understand their development. Here, we construct a single-cell spatiotemporal transcriptomic atlas of human embryonic DRG. This atlas reveals the diversity of cell types and highlights the extrinsic signaling cascades and intrinsic regulatory hierarchies that guide cell fate decisions, including neuronal/glial lineage restriction, sensory neuron differentiation and specification, and the formation of neuron-satellite glial cell (SGC) units. Additionally, we identify a human-enriched NTRK3<sup>+</sup>/DCC<sup>+</sup> nociceptor subtype, which is involved in multimodal nociceptive processing. Mimicking the programmed activation of signaling pathways in vivo, we successfully establish functional human DRG organoids and underscore the critical roles of transcriptional regulators in the fate commitment of unspecialized sensory neurons (uSNs). Overall, our research elucidates the multilevel signaling pathways and transcription factor (TF) regulatory hierarchies that underpin the diversity of somatosensory neurons, emphasizing the phenotypic distinctions in human nociceptor subtypes.

PLCL1
Also flagged:GlaucomablindnesspathogenesisCDKN2BCAV1CAV2
Journal Article 2024-11-12 ✓ 1 Snippet Li M, Liu S, Ma S, Shang X, Zhang X, Jason H, Huang Y, Kiburg K, Zhao K, Hu G, Zhang L, Yu H, He M, Zhang X.
In-Text Gene Mentions

…overlapping genes (DERA,PLCL1and GLIS3) for…

Show Full Abstract

<h4>Objective</h4>Glaucoma is an optic neuropathy and the leading cause of irreversible blindness worldwide. However, the early detection of glaucoma remains challenging, as chronic forms of glaucoma remain largely asymptomatic until considerable irreversible visual field deficits have ensued. Thus, biomarkers that facilitate early diagnosis and treatment for glaucoma patients with a high risk of progression are pressing.<h4>Methods and analysis</h4>Human disease-biomarker interactions network and human disease-target-drug interactions network were first constructed based on multiomics data. The greedy search algorithm was used to search for the hub biomarkers and drug targets for glaucoma. Genome-wide association studies and epidemiological data from the UK Biobank were used to verify our results. Biological network and functional analysis was conducted to find common network features and pathways.<h4>Results</h4>We identified 10 hub biomarkers/drug targets for the diagnosis, treatment and prognosis for glaucoma. These results were verified by text mining and genomic/epidemiology data. We also predicted the new application of BMP1 and MMP9 to diagnose glaucoma and confirm the theory of hub biomarkers with multiple clinical applications. Further, relevant pivotal pathways for these hub biomolecules were discovered, which may serve as foundations for future biomarker and drug target prediction for glaucoma.<h4>Conclusion</h4>We have used a network-based approach to identify hub diagnostic and therapeutic biomarkers for glaucoma and detected relationships between glaucoma and associated diseases. Several hub biomarkers were identified and verified, which may play more important roles in the diagnosis and treatment of glaucoma.

HTT
Also flagged:neurodegenerative disorderpolyglutamine (polyQ) diseasesHDcognitive declinenucleuscytoplasm
Journal Article 2024-11-12 ✓ 5 Snippets Hana TA, Mousa VG, Lin A, Haj-Hussein RN, Michael AH, Aziz MN, Kamaridinova SU, Basnet S, Ormerod KG.
In-Text Gene Mentions

…the huntingtin protein (htt) that tend to…

…associated with mutanthtt, two constructs of…

…polyQ lengths, non-pathogenic-htt(NP-htt) and pathogenic-htt…

…ngths, non-pathogenic-htt (NP-htt) and pathogenic-htt (P-htt),…

…c-htt (NP-htt) and pathogenic-htt(P-htt), with an…

Show Full Abstract

Huntington's Disease (HD) is a neurodegenerative disorder, part of the nine identified inherited polyglutamine (polyQ) diseases. Most commonly, HD pathophysiology manifests in middle-aged adults with symptoms including progressive loss of motor control, cognitive decline, and psychiatric disturbances. Associated with the pathophysiology of HD is the formation of insoluble fragments of the huntingtin protein (htt) that tend to aggregate in the nucleus and cytoplasm of neurons. To track both the intracellular progression of the aggregation phenotype as well as the physiological deficits associated with mutant htt, two constructs of human HTT were expressed in the Drosophila melanogaster nervous system with varying polyQ lengths, non-pathogenic-htt (NP-htt) and pathogenic-htt (P-htt), with an N-terminal RFP tag for in vivo visualization. P-htt aggregates accumulate in the ventral nerve cord cell bodies as early as 24 h post hatching and significant aggregates form in the segmental nerve branches at 48 h post hatching. Organelle trafficking up- and downstream of aggregates formed in motor neurons showed severe deficits in trafficking dynamics. To explore putative downstream deficits of htt aggregation, ultrastructural changes of presynaptic motor neurons and muscles were assessed, but no significant effects were observed. However, the force and kinetics of muscle contractions were severely affected in P-htt animals, reminiscent of human chorea. Reduced muscle force production translated to altered locomotory behavior. A novel HD aggregation model was established to track htt aggregation throughout adulthood in the wing, showing similar aggregation patterns with larvae. Expressing P-htt in the adult nervous system resulted in significantly reduced lifespan, which could be partially rescued by feeding flies the mTOR inhibitor rapamycin. These findings advance our understanding of htt aggregate progression as well the downstream physiological impacts on the nervous system and peripheral tissues.

HFE
Also flagged:Cluster headacheprimary headache diseaseautonomic dysfunctiontrigeminal-autonomic cephalalgiasHeadacheptosis
Journal Article 2024-11-12 ✓ 2 Snippets Isayeva U, Paribello P, Ginelli E, Pisanu C, Comai S, Carpiniello B, Squassina A, Manchia M.
In-Text Gene Mentions

…well as theHFEH63D variant and…

…earlier study analyzingHFEgene polymorphisms C282Y…

Show Full Abstract

The role of genetic factors in cluster headache etiology, suggested by familial and twin studies, remains ill-defined, with the exact pathophysiological mechanisms still largely elusive. This systematic review aims to synthesize current knowledge on cluster headache genetics and explore its implications for personalized treatment and prediction of treatment response. Thus, we searched PubMed, Scopus, and the Cochrane Library databases and reference lists of identified research articles, meta-analyses, and reviews to identify relevant studies up to 10 July 2024. The quality of the evidence was assessed using Newcastle-Ottawa Scale for case control studies and NIH Quality Assessment tool for Observational Cohort and Cross-Sectional Studies. The protocol of this study was registered via the Open Science Framework ( https://osf.io/cd4s3 ). Fifty-one studies were selected for the qualitative synthesis: 34 candidate gene studies, 5 GWAS, 7 gene expression studies, 4 pharmacogenetic association studies, and 1 whole genome sequencing study. The bulk of genetic evidence in cluster headache underscores the involvement of genes associated with chronobiological regulation. The most studied gene in cluster headache is the HCRTR2 , which is expressed in the hypothalamus; however, findings across studies continue to be inconclusive. Recent GWAS have uncovered novel risk loci for cluster headache, marking a significant advancement for the field. Nevertheless, there remains a need to investigate various genes involved in specific mechanisms and pathways.

Also flagged:chromosomesGNAQCOL5A2COL3A1HECW1FBN1
Journal Article 2024-11-12 No Snippets Mohammadi H, Khaltabadi Farahani AH, Moradi MH, Moradi-Shahrbabak H, Gholizadeh M, Najafi A, Tolone M, D'Alessandro E.
Show Full Abstract

Domestication and selection significantly changed phenotypic traits in modern domestic animals. To identify the genomic regions associated with prolificacy in this study, 837 ewes from three Iranian indigenous sheep breeds, consisting of Baluchi, Lori-Bakhtiari, and Zandi uniparous breeds, and one Greek highly prolific dairy sheep, namely Chios, were genotyped using OvineSNP50K arrays. Statistical tests were then performed using different and complementary methods based on either site frequency (F<sub>ST</sub>) and haplotype (hapFLK) between populations, followed by a pathway analysis of the genes contained in the selected regions. The results revealed that for the top 0.01 percentile of the obtained F<sub>ST</sub> values, 16 genomic regions on chromosomes 2, 3, 4, 7, 8, 9, 13, 14, 16, 18, 19, and 20, and for hapFLK values, 3 regions located on chromosomes 3, 7, and 13, were under selection. A bioinformatic analysis of these genomic regions showed that these loci overlapped with potential candidate genes associated with prolificacy in sheep including <i>GNAQ</i>, <i>COL5A2</i>, <i>COL3A1</i>, <i>HECW1</i>, <i>FBN1</i>, <i>COMMD3</i>, <i>RYR1</i>, <i>CCL28</i>, <i>SERPINA14</i>, and <i>HSPA2</i>. These regions also overlapped with some quantitative trait loci (QTLs) linked to prolificacy traits, milk yield, and body weight. These findings suggest that future research could further link these genomic regions to prolificacy traits in sheep.

Also flagged:TitaniumHydroxyapatitebone diseasecalcium phosphatemetalscell growth
Journal Article 2024-11-12 No Snippets Sadlik J, Kosińska E, Bańkosz M, Tomala A, Bruzda G, Jampilek J, Sobczak-Kupiec A.
Show Full Abstract

Hard bone disease is a clinical problem affecting more than 20 million people annually worldwide, with significant health, social, and economic consequences. For successful integration of any implant, the key aspects are bone regeneration, osseointegration at the bone-implant interface, and the mitigation of inflammation. The purpose of this research work is to demonstrate an innovative material system and method of biomaterial preparation for regenerative medicine. A number of studies were carried out for both hydroxyapatite powder and composites. Wet-precipitated synthesized hydroxyapatite was compared to commercial products through accurate physicochemical studies that confirmed the high purity of the obtained calcium phosphate without any impurities. Ti/HAp composites before and after sintering were compared by XRF, XRD, SEM, EDS, PSA, and roughness measurements, and the Vickers microhardness was analyzed. The fabrication of the biomaterial was based on a bottom-up approach, which involved fabricating HAp particles with specific morphologies using powder metallurgy (PM) to sinter Ti composites. The resulting gradient structures consisting of two compositions (5%HAp%5CMC and 10%HAp10%CMC) mimic the structure of bone tissue. The created pores of 10-100 µm in size will allow bone cells to penetrate the implant and regenerate bone. In turn, the introduction of hydroxyapatite into the material reduces the microhardness of the composite and introduces properties such as bioactivity. The developed composite material contains a combination of Ti alloy and hydroxyapatite (HAp), creating an excellent biomaterial that promotes bone growth and eliminates the problem of implant loosening by integrating it into the bone. This material requires further research, especially biological research. However, it shows promising potential for further experiments.

HTT
Also flagged:PeptidePeptidesorganellestransmissible spongiform encephalopathiesprion diseasescancer
Journal Article 2024-11-12 ✓ 1 Snippet Kalmouni M, Oh Y, Alata W, Magzoub M.
In-Text Gene Mentions

…tau protein, huntingtin (HTT), α-synuclein (α-syn), prion…

Show Full Abstract

Peptides possess a number of pharmacologically desirable properties, including greater chemical diversity than other biomolecule classes and the ability to selectively bind to specific targets with high potency, as well as biocompatibility, biodegradability, and ease and low cost of production. Consequently, there has been considerable interest in developing peptide-based therapeutics, including amyloid inhibitors. However, a major hindrance to the successful therapeutic application of peptides is their poor delivery to target tissues, cells or subcellular organelles. To overcome these issues, recent efforts have focused on engineering cell-penetrating peptide (CPP) antagonists of amyloidogenesis, which combine the attractive intrinsic properties of peptides with potent therapeutic effects (i.e., inhibition of amyloid formation and the associated cytotoxicity) and highly efficient delivery (to target tissue, cells, and organelles). This review highlights some promising CPP constructs designed to target amyloid aggregation associated with a diverse range of disorders, including Alzheimer's disease, transmissible spongiform encephalopathies (or prion diseases), Parkinson's disease, and cancer.

Also flagged:ICRDaconitase 2ACO2aconitasemitochondrialbinding
Journal Article 2024-11-12 No Snippets Yang W, Wang S, Yang K, Li Y, Guo Z, Huang J, Wang J, Liao S.
Show Full Abstract

<h4>Background and purpose</h4>Infantile cerebellar retinal degeneration (ICRD) (OMIM #614559) is a rare autosomal recessive inherited disease associated with mutations in the aconitase 2 (ACO2) gene. We report a Chinese girl with novel compound heterozygous variants in <i>ACO2</i>, who presented at 7 months of age with psychomotor retardation, truncal hypotonia, and ophthalmologic abnormalities. This study aims to investigate the potential molecular mechanisms underlying <i>ACO2</i> deficiency-induced neuropathy.<h4>Methods</h4>Whole exome sequencing was performed on family members to screen for potential pathogenic mutations, followed by Sanger sequencing for validation. Mitochondrial aconitase activity and mitochondrial DNA (mtDNA) copy number were measured using an aconitase activity detection kit and quantitative PCR, respectively. Transcriptome expression profiles from patient cells, and cerebellar and retinal organoids retrieved from the GEO database were integrated. Functional enrichment analysis and protein-protein interaction networks were used to identify key molecules, and their expression levels were validated using Western blot analysis.<h4>Results</h4>Genetic testing revealed novel compound heterozygous variations in the proband's <i>ACO2</i> gene (NM:001098), including c.854A>G (p.Asn285Ser) and c.1183C>T (p.Arg395Cys). Predictive analysis of the tertiary structure of the ACO2 protein suggests that both p.Asn285Ser and p.Arg395Cys affect the binding ability of ACO2 to ligands. The mitochondrial aconitase activity and mtDNA copy number in the proband's leukocytes were significantly reduced. Transcriptomic data analysis identified 80 key candidate genes involved in ACO2-related neuropathy. Among these, <i>LRP8</i> and <i>ANK3</i>, whose gene expression levels were significantly positively correlated with <i>ACO2</i>, were further validated by Western blot analysis.<h4>Conclusions</h4>This study expands the spectrum of pathogenic <i>ACO2</i> variants, elucidates the potential molecular mechanisms underlying ACO2-related neuropathy, provides in-depth support for the pathogenicity of <i>ACO2</i> genetic variations, and offers new insights into the pathogenesis of ICRD.

Also flagged:pathogenesishepatic diseasesFerroptosisapoptotic celldeathiron
Journal Article 2024-11-12 No Snippets You Y, Qian Z, Jiang Y, Chen L, Wu D, Liu L, Zhang F, Ning X, Zhang Y, Xiao J.
Show Full Abstract

Ferroptosis, a distinct form of non-apoptotic cell death characterized by iron dependency and lipid peroxidation, is increasingly linked to various pathological conditions in pregnancy and liver diseases. It plays a critical role throughout pregnancy, influencing processes such as embryogenesis, implantation, and the maintenance of gestation. A growing body of evidence indicates that disruptions in these processes can precipitate pregnancy-related disorders, including pre-eclampsia (PE), gestational diabetes mellitus (GDM), and intrahepatic cholestasis of pregnancy (ICP). Notably, while ICP is primarily associated with elevated maternal serum bile acid levels, its precise etiology remains elusive. Oxidative stress induced by bile acid accumulation is believed to be a significant factor in ICP pathogenesis. Similarly, the liver's susceptibility to oxidative damage underscores the importance of lipid metabolism dysregulation and impaired iron homeostasis in the progression of liver diseases such as alcoholic liver disease (ALD), non-alcoholic fatty liver disease (NAFLD), cholestatic liver injury, autoimmune hepatitis (AIH), acute liver injury, viral hepatitis, liver fibrosis, and hepatocellular carcinoma (HCC). This review discusses the shared signaling mechanisms of ferroptosis in gestational and hepatic diseases, and explores recent advances in understanding the mechanisms of ferroptosis and its potential role in the pathogenesis of gestational and hepatic disorders, with the aim of identifying viable therapeutic targets.

SOX6
Also flagged:degenerative joint diseaseendoplasmic reticulumpathogenesisOAosteogenesisPamrevlumab
Journal Article 2024-11-12 ✓ 1 Snippet Gao Y, Wei H, Peng X, Wang C, Zhu H, Yin J.
In-Text Gene Mentions

…direct upregulation ofSox6but inhibits subsequent…

Show Full Abstract

<h4>Background</h4>Osteoarthritis (OA) is a common degenerative joint disease, leading to pain and restricted mobility. Age-related endoplasmic reticulum (ER) stress has been implicated in the pathogenesis of OA, but the underlying mechanisms remain unclear. This study aims to explore the relationship between age-related ER stress, YAP overexpression, and chondrocyte phenotype loss in the development of OA.<h4>Methods</h4>Cartilage samples were collected from patients undergoing amputation, and age-related ER stress markers and YAP expression were assessed using immunohistochemical staining and qPCR. Transgenic mice with cartilage-specific YAP overexpression (YAP<sup>OE</sup>) were created, and Pamrevlumab was administered to evaluate its therapeutic effects.<h4>Results</h4>Higher expression of ER stress markers and YAP were showed in aged tissues compared to younger tissues. YAP overexpression led to decreased levels of cartilage phenotype markers and increased osteogenesis-related proteins. <i>In vivo</i>, YAP<sup>OE</sup> mice exhibited OA-like cartilage degeneration, which was mitigated by Pamrevlumab treatment.<h4>Conclusion</h4>Age-related ER stress induces YAP overexpression, contributing to OA pathogenesis. Pamrevlumab effectively prevents this phenotype loss in YAP<sup>OE</sup> mice, suggesting its potential as a therapeutic agent for OA. These findings provide new insights into the molecular mechanisms of OA and highlight the importance of targeting the ER stress-YAP-CTGF signaling pathway in OA treatment and prevention.

TNFSF4
Also flagged:cancerCD73tumorcancersesophageal carcinomaESCA
Journal Article 2024-11-12 ✓ 1 Snippet Chen C, Liu S, Ma Y.
In-Text Gene Mentions

…CD80, CD44, NRP1,TNFSF4, TNFSF8, TNFRSF9 and…

Show Full Abstract

<h4>Background</h4>CD73 is adenosine generation molecule, which is involved in the immune regulation. However, the roles of CD73 in the tumor microenvironment remain unknown.<h4>Methods</h4>CD73 expression levels in pan-cancers were analyzed, based on The Cancer Genome Atlas (TCGA), Genotype-Tissue Expression (GTEx) and Human Protein ALTAS (HPA) databases. Kaplan-Meier (KM) plotter was used to analyze the prognostic values of CD73. Immune scores in pan-cancers was evaluated by ESTIMATE. TIMER2.0 and UCSCXena were used to explore the correlation between CD73 and immune infiltration/immune checkpoints/tumor mutation burden (TMB)/microsatellite instability (MSI). CD73 expression correlated genes in tumor tissues were screened by using LinkedOmics tool.<h4>Results</h4>Firstly, CD73 was significant increased in following cancer types: esophageal carcinoma (ESCA), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), brain lower grade glioma (LGG), lung adenocarcinoma (LUAD), pancreatic adenocarcinoma (PAAD) and stomach adenocarcinoma (STAD). Secondly, high CD73 expression was associated with poor overall survival in patients with breast invasive carcinoma (BRCA), CESC, HNSC, liver hepatocellular carcinoma (LIHC), LUAD, lung squamous cell carcinoma (LUSC), PAAD and STAD. However, in KIRC and UCEC, patients high CD73 expression showed a favorable prognosis. Thirdly, the immune scores of the high CD73 expression in bladder urothelial carcinoma (BLCA), BRCA, kidney chromophobe (KICH), LUAD, LUSC, ovarian serous cystadenocarcinoma (OV), pheochromocytoma and paraganglioma (PCPG), prostate adenocarcinoma (PRAD), and skin cutaneous melanoma (SKCM) were significant higher than that of patients with low CD73 expression. Furthermore, we observed a positive correlation between CD73 and the multiple immune cells infiltration, including CD4<sup>+</sup> memory T cells, CD8<sup>+</sup> T cells, Treg cells, myeloid DC and macrophage, particularly in BRCA and LUAD. There was no strong correlation between CD73 and TMB/MSI. In LUAD, CD73 expression correlated genes were mainly enrichment in positive regulation of cell proliferation, cell adhesion, positive regulation of kinase activity, cellular response to LPS. However, in UCEC, CD73 correlated genes were mainly associated with fatty acid omega-oxidation, protein localization to endoplasmic reticulum exit site, endoplasmic reticulum to Golgi vesicle-mediated transport.<h4>Conclusion</h4>CD73 could be used to predict the prognosis of patients with several cancers. The potential functional mechanism of CD73 involved in cancer progress may not only dependent on its immunomodulatory effects.

HTT
Also flagged:major depressive disorderdepressionAnxietyMajor DepressionBDNFSLC6A4
Journal Article 2024-11-12 ✓ 3 Snippets Mert A, Yucens B, Karagur ER, Akca H, Tumkaya S, Atesci FC.
In-Text Gene Mentions

…the BDNF , SLC6A4/SERT/5-HTT, HTR1a , and…

…events and low5-HTT(serotonin transporter) could…

…finding of lower5-HTTand widespread higher…

Show Full Abstract

<h4>Objective</h4>Psychosocial and genetic factors are considered to play roles in the etiological mechanisms of major depressive disorder (MDD). The involvement of miRNAs in the etiopathogenesis of depression and childhood traumas is still unclear. This study aims to reveal potential differences in miRNA levels between patients with depression and healthy individuals and assess their connection to childhood traumas.<h4>Methods</h4>This study included fifty patients with MDD and 33 healthy controls. The targeting of the 3'UTR regions of the <i>BDNF, SLC6A4/SERT/5-HTT, HTR1a</i>, and <i>HTR2a</i> genes by 8 miRNAs was analyzed to explore their potential involvement in depression and childhood traumas. The Hamilton Depression Rating Scale, the Hamilton Anxiety Rating Scale, and the Childhood Trauma Questionnaire-28 were administered to the participants.<h4>Results</h4>Patients with MDD exhibited significantly lower expression levels of miR-335 and miR-4775, as well as significantly higher expression levels of miR-15, miR-16, miR-17, miR-92, miR-182, and miR-206, when compared to healthy controls using the 2<sup>-(ΔΔCt)</sup> method. Only miR-17 and miR-92 were associated with childhood traumas in the patients with depression.<h4>Conclusion</h4>Our research reveals a possible involvement of miRNAs in the pathophysiology of depression and highlights a potential relationship between childhood traumas and specific miRNAs in depressed patients.

DNAH10
Also flagged:DNAH9asthenospermiamovement disordersmale infertilitydyneinprimary ciliary dyskinesia
Journal Article 2024-11-11 ✓ 1 Snippet Yan F, Zhi W, Wei Y, Dai L, Xu W, Zheng R.
In-Text Gene Mentions

…DNAI1, DNAH1 andDNAH10.…

Show Full Abstract

Asthenospermia is a type of sperm that has malformed sperm with movement disorders that lead to male infertility. DNAH9 is a member of the dynein family and a central part of the outer dynein arm of cilia and flagella. DNAH9 gene defects are associated with primary ciliary dyskinesia and ultrastructural abnormalities in ciliary axial ultrastructure. However, the role of DNAH9 in sperm motility remains unclear, prompting us to investigate its function in spermatozoa. Familial Sanger sequencing showed that sterile males carried homozygous DNAH9 variants (c. 12218A>C, p. N4073T) and compound heterozygous variants (c.8617G>A, p.V2873M; c.11742A>T, p.E3914D), respectively. Transmission electron microscopy revealed these variants resulted in a significant lack of outer dynein arms in the cross-sectional view of the axoneme in both patients. Immunofluorescence results showed that these variants can lead to decline in DNAH9 protein expression, which led to the dysfunction of flagellar ultrastructure-related proteins, including DNAI1, DNAH1 and DNAH10. In conclusion, we identified novel biallelic variants in DNAH9 that likely bring about sharply decreased motility of spermatozoa in the two patients with asthenospermia. Our findings will widen the variant spectrum of known DNAH9 variants involving asthenospermia and further offer more proofs for genetic counseling and diagnosis.

HFE
Also flagged:Hepatitis EAcuteinfectionchronic liver diseaseacute-on-chronic liver failureviral hepatitis
Journal Article 2024-11-11 ✓ 1 Snippet Buti M, Ruiz-Cobo JC, Esteban R, Riveiro-Barciela M.
In-Text Gene Mentions

…sorders, Budd-Chiari syndrome,hemochromatosis, and cryptogenic origins.…

Show Full Abstract

Acute hepatitis E virus (HEV) infection is typically self-limiting and has a favourable prognosis. However, certain populations such as patients with pre-existing chronic liver disease may experience severe manifestations, including progression to acute-on-chronic liver failure (ACLF). Among viral hepatitis types, hepatitis A, E, and B are major causes of ACLF. Active screening and early diagnosis of HEV infection in patients with cirrhosis, especially those who develop ACLF, can improve management and enable timely antiviral therapy. Preventive measures, including HEV vaccination for high-risk groups, could reduce the morbidity and mortality associated with hepatitis E.

HTT
Also flagged:exocytosisHuntington's diseaseneurodegenerative disorderextracellularglutamateHD
Journal Article 2024-11-11 ✓ 5 Snippets King AC, Payne E, Stephens E, Fowler JA, Wood TE, Rodriguez E, Gray M.
In-Text Gene Mentions

…the huntingtin (HTT) gene leading…

…expressed huntingtin protein (HTT) ( MacDonald et…

…TheHTTprotein can influence…

…previous study, silencingHTTin fibroblasts blocked…

…membrane, suggesting thatHTTinteracts with ACTN2…

Show Full Abstract

Huntington's disease (HD) is a fatal, progressive neurodegenerative disorder. Prior studies revealed an increase in extracellular glutamate levels after evoking astrocytic SNARE-dependent exocytosis from cultured primary astrocytes from mutant huntingtin (mHTT)-expressing BACHD mice compared to control astrocytes, suggesting alterations in astrocytic SNARE-dependent exocytosis in HD. We used BACHD and dominant-negative (dn)SNARE mice to decrease SNARE-dependent exocytosis from astrocytes to determine whether reducing SNARE-dependent exocytosis from astrocytes could rescue neuropathological changes in vivo. We observed significant protection against striatal atrophy and no significant rescue of cortical atrophy in BACHD/dnSNARE mice compared to BACHD mice. Amino acid transporters are important for modulating the levels of extracellular neurotransmitters. BACHD mice had no change in GLT1 expression, decreased striatal GAT1 expression and increased levels of GAT3. There was no change in GAT1 after reducing astrocytic SNARE-dependent exocytosis, and increased GAT3 expression in BACHD mice was normalized in BACHD/dnSNARE mice. Thus, modulation of astrocytic SNARE-dependent exocytosis in BACHD mice is protective against striatal atrophy and modulates GABA transporter expression.

Also flagged:orthostatic hypotensionorthostatic hypertensioncardiovascular diseaseanginamyocardial infarctionhypertension
Journal Article 2024-11-11 No Snippets Owen CM, Bacardit J, Tan MP, Saedon NI, Goh CH, Newton JL, Frith J.
Show Full Abstract

Gravity, an invisible but constant force , challenges the regulation of blood pressure when transitioning between postures. As physiological reserve diminishes with age, individuals grow more susceptible to such stressors over time, risking inadequate haemodynamic control observed in orthostatic hypotension. This prevalent condition is characterized by drops in blood pressure upon standing; however, the contrary phenomenon of blood pressure rises has recently piqued interest. Expanding on the currently undefined orthostatic hypertension, our study uses continuous non-invasive cardiovascular data to explore the full spectrum of blood pressure profiles and their associated frailty outcomes in community-dwelling older adults. Given the richness of non-invasive beat-to-beat data, artificial intelligence (AI) offers a solution to detect the subtle patterns within it. Applying machine learning to an existing dataset of community-based adults undergoing postural assessment, we identified three distinct clusters (iOHYPO, OHYPO and OHYPER) akin to initial and classic orthostatic hypotension and orthostatic hypertension, respectively. Notably, individuals in our OHYPER cluster exhibited indicators of frailty and sarcopenia, including slower gait speed and impaired balance. In contrast, the iOHYPO cluster, despite transient drops in blood pressure, reported fewer fallers and superior cognitive performance. Surprisingly, those with sustained blood pressure deficits outperformed those with sustained rises, showing greater independence and higher Fried frailty scores. Working towards more refined definitions, our research indicates that AI approaches can yield meaningful blood pressure morphologies from beat-to-beat data. Furthermore, our findings support orthostatic hypertension as a distinct clinical entity, with frailty implications suggesting that it is worthy of further investigation.

TNFSF4
Also flagged:VEGFvascular endothelial growth factorcancercolon adenocarcinomaCOADGene Expression
Journal Article 2024-11-11 ✓ 1 Snippet Yang J, Li C, Wang Z, Jiang K.
In-Text Gene Mentions

…TNFSF14, TNFSF15, TNFSF18,TNFSF4, TNFSF9, and VTCN1.…

Show Full Abstract

The vascular endothelial growth factor (VEGF) family plays a crucial role in cancer progression, but the prognostic significance and biological functions of VEGF family members in colon adenocarcinoma (COAD) remain unclear. Using data from The Cancer Genome Atlas, Gene Expression Omnibus, Gene Set Cancer Analysis, cBioPortal, GeneMANIA, String, MethSurv and starBase database, we identified vascular endothelial growth factor B (VEGFB) as a key gene associated with COAD prognosis, with its abnormal expression linked to methylation dysregulation. In vitro experiments confirmed VEGFB expression was significantly higher in colon cancer tissues compared to normal tissues, as shown by Real-time quantitative PCR and immunohistochemistry. Cell Counting Kit-8 and colony formation assay showed that decreased VEGFB expression in SW480 cells resulted in decreased cell viability and proliferation ability. Scratch assay showed that VEGFB downregulation impaired SW480 cell migration. In addition, our research suggests that VEGFB not only promotes angiogenesis but is also involved in the tumor microenvironment and immune regulation. The SHNG17-miR-375-VEGFB regulatory axis provides a potential therapeutic target for COAD, highlighting VEGFB's role in immune activation during anti-angiogenic therapy and potential reversal of drug resistance.

Also flagged:p16agingcellular senescencep21 Cip1p16 Ink4avascular dementia
Journal Article 2024-11-11 No Snippets Lyons CE, Pallais JP, McGonigle S, Mansk RP, Collinge CW, Yousefzadeh MJ, Baker DJ, Schrank PR, Williams JW, Niedernhofer LJ, van Deursen JM, Razzoli M, Bartolomucci A.
Show Full Abstract

Life stress can shorten lifespan and increase risk for aging-related diseases, but the biology underlying this phenomenon remains unclear. Here we assessed the effect of chronic stress on cellular senescence-a hallmark of aging. Exposure to restraint stress, a psychological non-social stress model, increased p21<sup>Cip1</sup> exclusively in the brains of male, but not female mice, and in a p16<sup>Ink4a</sup>-independent manner. Conversely, exposure to chronic subordination stress (only males were tested) increased key senescent cell markers in peripheral blood mononuclear cells, adipose tissue and brain, in a p16<sup>Ink4a</sup>-dependent manner. p16<sup>Ink4a</sup>-positive cells in the brain of chronic subordination stress-exposed mice were primarily hippocampal and cortical neurons with evidence of DNA damage that could be reduced by p16<sup>Ink4a</sup> cell clearance. Clearance of p16<sup>Ink4a</sup>-positive cells was not sufficient to ameliorate the adverse effects of social stress on measured metrics of healthspan. Overall, our findings indicate that social stress induces an organ-specific and p16<sup>Ink4a</sup>-dependent accumulation of senescent cells, illuminating a fundamental way by which the social environment can contribute to aging.

PLCL1
Also flagged:nucleusADaginggene expressionsucroseTriton
Journal Article 2024-11-11 ✓ 1 Snippet Serrano-Pozo A, Li H, Li Z, Muñoz-Castro C, Jaisa-Aad M, Healey MA, Welikovitch LA, Jayakumar R, Bryant AG, Noori A, Connors TR, Hu M, Zhao K, Liao F, Lin G, Pastika T, Tamm J, Abdourahman A, Kwon T, Bennett RE, Woodbury ME, Wachter A, Talanian RV, Biber K, Karran EH, Hyman BT, Das S.
In-Text Gene Mentions

…, PLA2G4C ,PLCL1, PLPP3 and…

Show Full Abstract

Astrocytes are crucial to brain homeostasis, yet their changes along the spatiotemporal progression of Alzheimer's disease (AD) neuropathology remain unexplored. Here we performed single-nucleus RNA sequencing of 628,943 astrocytes from five brain regions representing the stereotypical progression of AD pathology across 32 donors spanning the entire normal aging to severe AD continuum. We mapped out several unique astrocyte subclusters that exhibited varying responses to neuropathology across the AD-vulnerable neural network (spatial axis) or AD pathology stage (temporal axis). The proportion of homeostatic, intermediate and reactive astrocytes changed only along the spatial axis, whereas two other subclusters changed along the temporal axis. One of these, a trophic factor-rich subcluster, declined along pathology stages, whereas the other increased in the late stage but returned to baseline levels in the end stage, suggesting an exhausted response with chronic exposure to neuropathology. Our study underscores the complex dynamics of astrocytic responses in AD.

Also flagged:bindingamino acidamino acidsligandguanosinetriphosphate
Journal Article 2024-11-11 No Snippets Utgés JS, Barton GJ.
Show Full Abstract

The accurate identification of protein-ligand binding sites is of critical importance in understanding and modulating protein function. Accordingly, ligand binding site prediction has remained a research focus for over three decades with over 50 methods developed and a change of paradigm from geometry-based to machine learning. In this work, we collate 13 ligand binding site predictors, spanning 30 years, focusing on the latest machine learning-based methods such as VN-EGNN, IF-SitePred, GrASP, PUResNet, and DeepPocket and compare them to the established P2Rank, PRANK and fpocket and earlier methods like PocketFinder, Ligsite and Surfnet. We benchmark the methods against the human subset of our new curated reference dataset, LIGYSIS. LIGYSIS is a comprehensive protein-ligand complex dataset comprising 30,000 proteins with bound ligands which aggregates biologically relevant unique protein-ligand interfaces across biological units of multiple structures from the same protein. LIGYSIS is an improvement for testing methods over earlier datasets like sc-PDB, PDBbind, binding MOAD, COACH420 and HOLO4K which either include 1:1 protein-ligand complexes or consider asymmetric units. Re-scoring of fpocket predictions by PRANK and DeepPocket display the highest recall (60%) whilst IF-SitePred presents the lowest recall (39%). We demonstrate the detrimental effect that redundant prediction of binding sites has on performance as well as the beneficial impact of stronger pocket scoring schemes, with improvements up to 14% in recall (IF-SitePred) and 30% in precision (Surfnet). Finally, we propose top-N+2 recall as the universal benchmark metric for ligand binding site prediction and urge authors to share not only the source code of their methods, but also of their benchmark.Scientific contributionsThis study conducts the largest benchmark of ligand binding site prediction methods to date, comparing 13 original methods and 15 variants using 10 informative metrics. The LIGYSIS dataset is introduced, which aggregates biologically relevant protein-ligand interfaces across multiple structures of the same protein. The study highlights the detrimental effect of redundant binding site prediction and demonstrates significant improvement in recall and precision through stronger scoring schemes. Finally, top-N+2 recall is proposed as a universal benchmark metric for ligand binding site prediction, with a recommendation for open-source sharing of both methods and benchmarks.

Also flagged:chromatingene expressioncancertumorcancersTRIM28
Journal Article 2024-11-11 No Snippets Maghsoudloo M, Mokhtari K, Jamali B, Gholamzad A, Entezari M, Hashemi M, Fu J.
Show Full Abstract

The <i>TRIM</i> (tripartite motif) family, with <i>TRIM28</i> as a key member, plays a vital role in regulating health and disease. <i>TRIM28</i> contains various functional domains essential for transcriptional regulation, primarily through its interaction with <i>KRAB-ZNF</i> proteins, which influence chromatin remodeling and gene expression. Despite extensive research, the precise mechanisms by which <i>TRIM28</i> impacts health and disease remain elusive. This review delves into <i>TRIM28</i>'s multifaceted roles in maintaining health, contributing to a variety of diseases, and influencing cancer progression. In cancers, <i>TRIM28</i> exhibits a dual nature, functioning as both a tumor promoter and suppressor depending on the cellular context and cancer type. The review also explores its critical involvement in processes such as DNA repair, cell cycle regulation, epithelial-to-mesenchymal transition, and the maintenance of stem cell properties. By uncovering <i>TRIM28</i>'s complex roles across different cancers and other diseases, this review underscores its potential as a therapeutic target. The significance of <i>TRIM28</i> as a versatile regulator opens the door to innovative therapeutic strategies, particularly in cancer treatment and the management of other diseases. Ongoing research into <i>TRIM28</i> may yield key insights into disease progression and novel treatment options.

Also flagged:glucosemetabolismcancercell proliferationtumourfermentation
Journal Article 2024-11-11 No Snippets Ronghe R, Tavares AAS.
Show Full Abstract

Recent discoveries demonstrated the skeleton's role as an endocrine organ regulating whole-body glucose homeostasis. Glucose metabolism is critical for rapid cell proliferation and tumour growth through increasing glucose uptake and fermentation of glucose to lactate despite being in an aerobic environment. This hypothesis paper discusses emerging evidence on how bones can regulate whole-body glucose homeostasis with potential to impact on tumour growth and proliferation. Moreover, it proposes a clinical link between bone glucose metabolism and prognosis of cancer based on recent clinical trial data. Targeting metabolic pathways related with classic glucose metabolism and also bone metabolism, novel methods of cancer therapy and treatment could be developed. This paper objective is to highlight the need for future research on this altered metabolism with potential to change future management of cancer patients.

Also flagged:Endometrial cancertumorprogestinmalignant tumorscervical cancermalignant tumor
Journal Article 2024-11-11 No Snippets Qin Z, Zhang D, Cao G, Li H.
Show Full Abstract

Endometrial cancer is a common tumor of the female reproductive system. In recent years, as the age of onset of the disease has gradually become younger, this has caused distress to some young patients with reproductive needs, and the active search for methods of preserving reproductive function has gradually attracted attention. In this paper, we will systematize the current status of progestin-based pharmacotherapy in combination with other drug therapies in the conservative management of early-stage endometrial cancer. With the expectation of providing a reference for the treatment of early stage endometrial cancer patients in China and for the in-depth development of related research in this field.

DNAJC1
Also flagged:Endoplasmic ReticulumEndoplasmiclumenpathogenesiscancerERGs
Journal Article 2024-11-11 ✓ 5 Snippets Wu M, Yan J, Qin S, Fu L, Sun S, Li W, Lv J, Chen L.
In-Text Gene Mentions

…PDIA6, EIF2S1, andDNAJC1.…

…0.0151 × ExpDNAJC1+ 0.0003 ×…

…for TRIM25 andDNAJC1( Supplementary Figure…

…UBE2J2-UBE2D2-TRIM25,DNAJC1-HSPA8-BAG2, and PDIA6-SEC61A1…

…PDIA6, EIF2S1, andDNAJC1) that were further…

Show Full Abstract

Endoplasmic reticulum (ER) stress is a state in which misfolded or unfolded proteins accumulate in the lumen of the ER as a result of some exogenous or endogenous factors. It plays a crucial role in the pathogenesis of malignancies, affecting cell survival, proliferation, and metastasis in cancer. ER stress genes could provide new ideas for potential therapeutic targets in cancer. In our study, we aimed to construct an ER stress-related genes (ERGs) model for hepatocellular carcinoma (HCC). ERGs with differential expression and significant survival were screened to construct a prognostic model. The effectiveness of the model was successfully validated by external datasets. High and low-risk groups were classified based on risk scores. Functional analysis showed risk groups involved in the unfolded protein response, DNA repair, and other differential pathways. When compared to patients with low risk, the prognosis for HCC patients in the high-risk group might be worsened by disruptions in these pathways. Importantly, we considered genomic druggability and predicted drugs. Sorafenib-induced autophagy in HCC cells through an ES stress mechanism. Sorafenib was more sensitive for high-risk patients. In brief, our model predicted the prognosis of HCC and provided novel treatment strategies for the study of other cancers.

Also flagged:Flavonolquercetinflavonoidbiosynthesisflavonoidscarbon
Journal Article 2024-11-11 No Snippets Frenț OD, Stefan L, Morgovan CM, Duteanu N, Dejeu IL, Marian E, Vicaș L, Manole F.
Show Full Abstract

The main goal of this systematic review on the flavonol class secondary metabolite quercetin is to evaluate and summarize the existing research on quercetin's potential health benefits, therapeutic properties, and effectiveness in disease prevention and treatment. In addition to evaluating quercetin's potential for drug development with fewer side effects and lower toxicity, this type of review attempts to collect scientific evidence addressing quercetin's roles as an antioxidant, anti-inflammatory, antibacterial, and anticancer agent. In the first part, we analyze various flavonoid compounds, focusing on their chemical structure, classification, and natural sources. We highlight their most recent biological activities as reported in the literature. Among these compounds, we pay special attention to quercetin, detailing its chemical structure, physicochemical properties, and process of biosynthesis in plants. We also present natural sources of quercetin and emphasize its health benefits, such as its antioxidant and anti-inflammatory effects. Additionally, we discuss methods to enhance its bioavailability, analyzing the latest and most effective delivery systems based on quercetin.

HFE
Also flagged:cancerchronic liver diseasehepatitisaflatoxinsHepatocellular Carcinomaalcohol
Journal Article 2024-11-11 ✓ 1 Snippet Polpichai N, Saowapa S, Danpanichkul P, Chan SY, Sierra L, Blagoie J, Rattananukrom C, Sripongpun P, Kaewdech A.
In-Text Gene Mentions

…including phlebotomy forhemochromatosis, can prevent disease…

Show Full Abstract

<h4>Background/objectives</h4>Hepatocellular carcinoma (HCC) is a leading cause of cancer-related mortality worldwide, primarily developing in the context of chronic liver disease. Traditional prevention has focused on liver-specific interventions like antiviral therapies and surveillance. However, extrahepatic factors also significantly contribute to HCC risk. This review explores comprehensive strategies for HCC prevention, including both hepatic and extrahepatic factors.<h4>Methods</h4>An extensive literature search of peer-reviewed articles up to October 2024 was conducted, focusing on studies addressing HCC prevention strategies. Studies that focused on both hepatic and extrahepatic factors were included. Data were extracted and synthesized to provide an overview of current prevention strategies and their effectiveness in reducing HCC incidence.<h4>Results</h4>Hepatitis B vaccination and antiviral treatments for hepatitis B and C significantly reduce HCC incidence. Lifestyle modifications-such as reducing alcohol consumption, maintaining a healthy weight through diet and exercise, and smoking cessation-are crucial in lowering HCC risk. Environmental measures to limit exposure to aflatoxins and other hazards also contribute to prevention. Regular surveillance of high-risk groups enables early detection and improves survival rates. Emerging strategies like immunotherapy and gene therapy show potential for further reducing HCC risk.<h4>Conclusions</h4>A comprehensive approach combining medical interventions, lifestyle changes, and environmental controls is essential for effectively decreasing HCC incidence globally. Implementing these combined measures could significantly reduce the global burden of HCC.

Also flagged:mental illnessorganizationphysical diseasesobesitypsychological problemsAutism
Journal Article 2024-11-11 No Snippets Roy P, Chowdhury KUA.
Show Full Abstract

This study investigates the stigma against people with mental illness in Bangladesh through in-depth interviews with 14 patients and 9 healthcare professionals, and 33 focus group discussions with people without mental illness. The research has delved into the understanding of different types of stigma against mental illness in the context of Bangladesh. The findings revealed four types of stigma which were categorized into four themes namely self-stigma, public stigma, professional, and institutional stigma. Patients had internalized negative attitudes, thereby discriminated toward themselves. The public discriminated against patients because of believing in prejudices against them. Other health professionals had negative conceptions toward patients, and they devalued mental health professionals (MHPs). A culture of negative attitude and belief had emerged in institutional settings which encouraged discrimination. Policymakers and healthcare professionals can use the findings to develop a mental health service by addressing the stigma. Mental health practitioners can assess the impact of stigma to improve the mental well-being of their patients. Students and workplace staff will benefit from intentional or unintentional discrimination in educational institutions and workplace settings by addressing the effects of stigma. Importantly, other health care providers will be aware of their thoughts against patients and MHPs.

HFE
Also flagged:Cholateoesophageal varicesportal hypertensionPHcirrhosischolates
Journal Article 2024-11-10 ✓ 1 Snippet Shiffman M, Reddy KR, Leise MD, Qureshi K, Smith AD, Helmke S, Kittelson J, McRae MP, Imperial JC, Everson GT, SHUNT‐V Investigators.
In-Text Gene Mentions

…B (2.5%) andhemochromatosis(0.8%).…

Show Full Abstract

<h4>Background</h4>The accuracy of current criteria for ruling out large oesophageal varices (LEV) and other endoscopic lesions of portal hypertension (PH) may be compromised by obesity and MASLD/MASH.<h4>Aims</h4>In the US multicentre SHUNT-V study, we evaluated the disease severity index (DSI) for detecting LEV and other lesions of PH at endoscopy.<h4>Methods</h4>Subjects were adults with compensated cirrhosis scheduled for endoscopy to screen for varices. DSI was calculated from clearances of labelled cholates after oral and intravenous administration. DSI ≤ 18.3 was evaluated as a cut-off for ruling out LEV with acceptance criteria of negative likelihood ratio < 0.52 and sensitivity > 85%.<h4>Results</h4>SHUNT-V enrolled 306 subjects; 275 had both DSI and endoscopy, and 238 had Child-Pugh A cirrhosis (52.1% MASLD/MASH, 25.2% chronic hepatitis C and 15.6% alcoholic liver disease; 87% were overweight, 64% were obese and 54% had diabetes). AUROCs for DSI ranged from 0.81 to 0.82 for LEV and 0.79 to 0.80 for all significant PH lesions. DSI 18.3 had sensitivity 96.3%-100% for LEV and 97.3%-100% for all significant PH lesions. If DSI ≤ 18.3 were used as the sole determinant to defer EGD, 27%-35% of EGDs could have been avoided with 0%-3.7% of LEV and 0%-2.7% of all significant PH lesions missed.<h4>Conclusions</h4>HepQuant DSI predicts the likelihood of LEV and significant PH lesions across a spectrum of patient characteristics and disease aetiologies. DSI, based on liver function and portal-systemic shunting, can aid in the decision to defer endoscopy for varices in patients with Child-Pugh A cirrhosis.<h4>Trial registration</h4>The SHUNT-V study was registered at ClinicalTrials.gov (NCT03583996).

PRDX6
Also flagged:Lipidmetabolic disordersheme oxygenase-1thioredoxininflammatory responsecaspase-1
Journal Article 2024-11-10 ✓ 1 Snippet Atalay Ekiner S, Gęgotek A, Domingues P, Domingues MR, Skrzydlewska E.
In-Text Gene Mentions

…; Peroxiredoxin 6,PRDX6; Principal component…

Show Full Abstract

Lipid extracts from the microalgae <i>Nannochloropsis oceanica</i> and <i>Chlorococcum amblystomatis</i> have great potential to prevent ultraviolet A (UVA)-induced metabolic disorders. Therefore, the aim of this study has been to analyze their cytoprotective effect, focused on maintaining intracellular redox balance and inflammation in UVA-irradiated skin fibroblasts, at the proteome level. The above lipid extracts reversed the suppression of the antioxidant response caused by UVA radiation, which was more visible in the case of <i>C. amblystomatis</i>. Modulations of interactions between heme oxygenase-1 and matrix metalloproteinase 1/Parkinson's disease protein 7/transcript1-α/β, as well as thioredoxin and migration inhibitory factor/Parkinson's disease protein 7/calnexin/ATPase p97, created key molecular signaling underlying their cytoprotective actions. Moreover, they reduced pro-inflammatory processes in the control group but they also showed the potential to regulate the cellular inflammatory response by changing inflammasome signaling associated with the changes in the caspase-1 interaction area, including heat shock proteins HSP90, HSPA8, and vimentin. Therefore, lipid extracts from <i>N. oceanica</i> and <i>C. amblystomatis</i> protect skin fibroblast metabolism from UVA-induced damage by restoring the redox balance and regulating inflammatory signaling pathways. Thus, those extracts have proven to have great potential to be used in cosmetic or cosmeceutical products to protect the skin against the effects of solar radiation. However, the possibility of their use requires the evaluation of their effects at the skin level in in vivo and clinical studies.

SOX6
Also flagged:ASIPKITGRIK2reproductionKCNIP4IFNAR1
Journal Article 2024-11-10 ✓ 1 Snippet Bian C, Luo Y, Li J, Cheng H, He F, Duan H, Ahmed Z, Lei C, Yi K.
In-Text Gene Mentions

…II, which containsSOX6, SOX30 ,…

Show Full Abstract

(1) Background: Buffaloes are crucial livestock species for food and service in tropical and subtropical regions. Buffalo genetics, particularly in indigenous Chinese breeds such as the Xiangxi white buffalo (XWB), remains an intriguing area of study due to its unique traits and regional significance. (2) Methods: This investigation utilized the whole-genome sequences of twenty XWBs (newly sequenced), along with eighty published whole-genome sequences of other buffalo breeds (including Guizhou white buffalo, river buffalo, and Chinese buffalo in the Yangtze River). Using whole-genome sequencing analysis technology, the population structure, genomic diversity, and selection signatures of XWB were determined. (3) Results: This study revealed that the XWB, being phylogenetically positioned in the middle and lower reaches of the Yangtze River, exhibited substantial genomic diversity. Employing four selection sweep detection methods (CLR, iHS, π-ratio, and <i>F</i><sub>ST</sub>), several genes were positively identified for adaptive traits in the XWB, including coat color phenotypes (<i>ASIP</i>, <i>KIT</i>), the nervous system (<i>GRIK2</i>), reproduction (<i>KCNIP4</i>), growth and development (<i>IFNAR1</i>, <i>BMP6</i>, <i>HDAC9</i>, <i>MGAT4C</i>, and <i>SLC30A9</i>), the body (<i>LINGO2</i>, <i>LYN</i>, and <i>FLI1</i>), immunity (<i>IRAK3</i> and <i>MZB1</i>), and lactation (<i>TP63</i>, <i>LPIN1</i>, <i>SAE1</i>). (4) Conclusions: In conclusion, this study enhances our understanding of the genetic distinctiveness and adaptive traits of XWB, highlighting selection signatures crucial for future breeding and conservation and ensuring sustainable use of this vital livestock resource.

Also flagged:localizationHAP40aminopolyglutaminepolyglutamine diseaseataxin-1
Journal Article 2024-11-10 No Snippets Truant R, Harding RJ, Neuman K, Maiuri T.
Show Full Abstract

Protein localization signals and activity motifs have been defined within huntingtin since 2003. Advances in technology in protein structure determination by cryo-electron microscopy (EM) have led to 2.6 Å resolution structures of huntingtin and HAP40 for the majority of the protein, although structure of the amino terminus with the polyglutamine expansion remains elusive in the context of full-length huntingtin. Recent advances in protein modeling using neural network algorithms trained on a database of known protein structures has resulted in structure predictions that are useful for researchers but need experimental validation. Here, we use both structures solved by cryo-EM as well as modeling centered around experimental structural data to retrospectively revisit huntingtin protein localization signals identified prior to the cryo-EM and AI-enabled structural revolutions. We interrogate these models as well as put forward testable hypotheses of allosteric changes in huntingtin and how they could be affected by polyglutamine expansion. We also extended this methodology to another polyglutamine disease protein, ataxin-1, expanded in Spinocerebellar Ataxia Type 1 (SCA1).

Also flagged:fluorocarbonpolyethylene glycolperfluoropolyethersynthesiswaterperfluorocarbon
Journal Article 2024-11-09 No Snippets van de Wouw HL, Yen ST, Valet M, Garcia JA, Gomez CO, Vian A, Liu Y, Pollock J, Pospíšil P, Campàs O, Sletten EM.
Show Full Abstract

Fluorocarbon oils are uniquely suited for many biomedical applications due to their inert, bioorthogonal properties. In order to interface fluorocarbon oils with biological systems, non-ionic fluorosurfactants are necessary. However, there is a paucity of non-ionic fluorosurfactants with low interfacial tension (IFT) to stabilize fluorocarbon phases in aqueous environments (such as oil-in-water emulsions). We developed non-ionic fluorosurfactants composed of a polyethylene glycol (PEG) segment covalently bonded to a flexible perfluoropolyether (PFPE) segment that confer low IFTs between a fluorocarbon oil (HFE-7700) and water. The synthesis of a panel of surfactants spanning a molecular weight range of 0.64-66 kDa with various hydrophilic-lipophilic balances allowed for identification of minimal IFTs, ranging from 1.4 to 17.8 mN m<sup>-1</sup>. The majority of these custom fluorosurfactants display poor solubility in water, allowing their co-introduction with fluorocarbon oils and minimal leaching. We applied the PEG<sub>5</sub>PFPE<sub>1</sub> surfactant for mechanical force measurements in zebrafish, enabling exceptional sensitivity.

SOX6
Also flagged:Nervous system cancerstumorstranscription factorskinasesbrain cancerstemozolomide
Journal Article 2024-11-09 ✓ 5 Snippets Larsson I, Held F, Popova G, Koc A, Kundu S, Jörnsten R, Nelander S.
In-Text Gene Mentions

…chose DDR1 andSOX6.…

…TF regulators wereSOX6(positive regulation) and…

SOX6belongs to the…

…ERBB3 , orSOX6, or increasing…

…of DDR1 orSOX6in U3065MG cells…

Show Full Abstract

Nervous system cancers exhibit diverse transcriptional cell states influenced by normal development, injury response, and growth. However, the understanding of these states' regulation and pharmacological relevance remains limited. Here we present "single-cell regulatory-driven clustering" (scregclust), a method that reconstructs cellular regulatory programs from extensive collections of single-cell RNA sequencing (scRNA-seq) data from both tumors and developing tissues. The algorithm efficiently divides target genes into modules, predicting key transcription factors and kinases with minimal computational time. Applying this method to adult and childhood brain cancers, we identify critical regulators and suggest interventions that could improve temozolomide treatment in glioblastoma. Additionally, our integrative analysis reveals a meta-module regulated by SPI1 and IRF8 linked to an immune-mediated mesenchymal-like state. Finally, scregclust's flexibility is demonstrated across 15 tumor types, uncovering both pan-cancer and specific regulators. The algorithm is provided as an easy-to-use R package that facilitates the exploration of regulatory programs underlying cell plasticity.

Also flagged:retrotranspositioncognitionL1DNA binding proteinshost cellretrotransposons
Journal Article 2024-11-09 No Snippets Mangoni D, Mazzetti A, Ansaloni F, Simi A, Tartaglia GG, Pandolfini L, Gustincich S, Sanges R.
Show Full Abstract

Transposable elements (TEs) are mobile genomic elements constituting a big fraction of eukaryotic genomes. They ignite an evolutionary arms race with host genomes, which in turn evolve strategies to restrict their activity. Despite being tightly repressed, TEs display precisely regulated expression patterns during specific stages of mammalian development, suggesting potential benefits for the host. Among TEs, the long interspersed nuclear element (LINE-1 or L1) has been found to be active in neurons. This activity prompted extensive research into its possible role in cognition. So far, no specific cause-effect relationship between L1 retrotransposition and brain functions has been conclusively identified. Nevertheless, accumulating evidence suggests that interactions between L1 RNAs and RNA/DNA binding proteins encode specific messages that cells utilize to activate or repress entire transcriptional programs. We summarize recent findings highlighting the activity of L1 RNAs at the non-coding level during early embryonic and brain development. We propose a hypothesis suggesting a mutualistic relationship between L1 mRNAs and the host cell. In this scenario, cells tolerate a certain rate of retrotransposition to leverage the regulatory effects of L1s as non-coding RNAs on potentiating their mitotic potential. In turn, L1s benefit from the cell's proliferative state to increase their chance to mobilize.

PCDH17
Also flagged:Glycosylphosphatidylinositoltranslationalbiosynthesisneurodevelopmental disordersPIGKintellectual disability
Journal Article 2024-11-09 ✓ 4 Snippets Chen S, You J, Zhou X, Li Y, Liu F, Teng Y, Teng H, Li Y, Liang D, Li Z, Wu L.
In-Text Gene Mentions

…downregulated genes, whilePCDH17and COMT were…

PCDH17and COMT are…

PCDH17, belonging to the…

PCDH17overexpression promotes the…

Show Full Abstract

Biallelic mutations in PIGK cause GPI biosynthesis defect 22 (GPIBD22), characterized with developmental delay, hypotonia, and cerebellar atrophy. The understanding of the underlying causes is limited due to the lack of suitable disease models. To address this gap, we generated a mouse model with PIGK deficits, specifically in Purkinje cells (Pcp2-cko) and an induced pluripotent stem cell (iPSC) model using the c.87dupT mutant (KI) found in GPIBD22 patients. Pcp2-cko mice demonstrated cerebellar atrophy, ataxia and progressive Purkinje cells loss which were accompanied by increased apoptosis and neuroinflammation. Similarly, KI iPSCs exhibited increased apoptosis and accelerated neural rosette formation, indicating that PIGK defects could impact early neural differentiation that confirmed by the RNA-Seq results of neural progenitor cells (NPCs). The increased apoptosis and accelerated NPC differentiation in KI iPSCs are associated with excessive unfolded protein response (UPR) pathway activation, and can be rescued by UPR pathway inhibitor. Our study reveals potential pathogenic mechanism of GPIBD22 and providing new insights into the therapeutic strategy for GPIBD.

PEBP1
Also flagged:cystinecystine/glutamate antiportererastinglutamateirondeath
Journal Article 2024-11-09 ✓ 2 Snippets Yang X, Liu Y, Wang Z, Jin Y, Gu W.
In-Text Gene Mentions

…binding protein 1 (PEBP1) to generate a…

…NO• interfered with 15LOX/PEBP1activity by competing…

Show Full Abstract

As a newly defined type of programmed cell death, ferroptosis is considered a potent weapon against tumors due to its distinct mechanism from other types of programmed cell death. Ferroptosis is triggered by the uncontrolled accumulation of hydroperoxyl polyunsaturated fatty acid-containing phospholipids, also called lipid peroxidation. The lipid peroxidation, generated through enzymatic and non-enzymatic mechanisms, drives changes in cell morphology and the destruction of membrane integrity. Here, we dissect the mechanisms of ferroptosis induced enzymatically or non-enzymatically, summarize the major metabolism pathways in modulating lipid peroxidation, and provide insights into the relationship between ferroptosis and tumor suppression. In this review, we discuss the recent advances of ferroptosis in tumor microenvironments and the prospect of potential therapeutic application.

OLFM4
Also flagged:NPpathogenesisoxygenchronic rhinosinusitisChronic rhinosinusitis with nasal polypsnasal polyps
Journal Article 2024-11-09 ✓ 1 Snippet Iwasaki N, Poposki JA, Kidoguchi M, Oka A, Klingler AI, Stevens WW, Suh LA, Bai J, Peters AT, Grammer LC, Welch KC, Smith SS, Conley DB, Bochner BS, Schleimer RP, Kern RC, Tan BK, Kato A.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Background</h4>Chronic rhinosinusitis with nasal polyps (CRSwNP) is characterized by type 2 (T2) inflammation. Recent studies, including our own, suggest that neutrophils are also elevated in T2 nasal polyps (NP) and that elevated neutrophils display an activated phenotype. However, the actual roles of neutrophils in NP pathogenesis in T2 CRSwNP are still largely unclear.<h4>Objective</h4>To reveal the roles and heterogeneity of neutrophils in NP tissue by single-cell RNA sequencing analysis.<h4>Methods</h4>We developed a novel microwell-based single-cell RNA sequencing assay using granulocyte-enriched samples from 5 control sinus tissues, 5 NP tissues and patient-matched peripheral blood (PB) samples. This approach allowed for examination of differential expression of genes in NP neutrophils by the Benjamini-Hochberg algorithm and predicted the overall function of NP neutrophils by pathway and Gene Ontology enrichment analyses.<h4>Results</h4>After performing all quality control steps, we successfully detected neutrophils. We identified 333 downregulated and 128 upregulated genes in NP neutrophils (1,151 cells) compared with all PB neutrophils (13,591 cells) (>1.5-fold, q < 0.05) and found commonly dysregulated genes in NP neutrophils compared with both all PB and control sinus tissue neutrophils (3,136 cells). Commonly downregulated genes in NP neutrophils were associated with the innate immune system, and upregulated genes were associated with nuclear factor-κB signaling, cytokine activity, and cellular response to oxygen-containing compounds. NP neutrophils displayed 4 clusters revealing potential heterogeneity of neutrophils in NP tissue.<h4>Conclusions</h4>Elevated neutrophils in NP tissue appear to exist in several subphenotypes that may play important pathogenic roles in CRSwNP.

HFE
Also flagged:complex diseasecancerhereditary cancer syndromehereditary cancer syndromesmetastatic cancerneurodegenerative disease
Journal Article 2024-11-09 ✓ 2 Snippets Mighton C, Kodida R, Shickh S, Clausen M, Reble E, Sam J, Grewal S, Hirjikaka D, Panchal S, Piccinin C, Aronson M, Ward T, Armel SR, Hofstedter R, Graham T, Mancuso T, Forster N, Capo-Chichi JM, Greenfeld E, Noor A, Cohn I, Morel CF, Elser C, Eisen A, Carroll JC, Glogowksi E, Schrader KA, Chan KKW, Thorpe KE, Lerner-Ellis J, Kim RH, Bombard Y, Incidental Genomics Study Team.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

<h4>Purpose</h4>Practice is shifting toward genome-first approaches, such as opportunistic screening for secondary findings (SFs). Analysis of SFs could be extended beyond medically actionable results to include non-medically actionable monogenic disease risks, carrier status, pharmacogenomic variants, and risk variants for common complex disease. However, evidence on the clinical utility of returning these results is lacking. We assessed the outcomes of opportunistic screening for a broad spectrum of SFs by evaluating the yield, impact on clinical management, and consistency between SFs and participants' clinical features and family history.<h4>Methods</h4>Adult cancer patients had exome sequencing with the option to learn multiple categories of SFs. Outcomes data were collected through chart review and participant-reported measures up to one year after return of results.<h4>Results</h4>All participants (n = 139, 85.6% female, average 54.6 years old) who elected to learn SFs had ≥1 variant reported (100% [139/139]). The yield of reportable findings was highest for pharmacogenomic variants (97.8% [135/138] of participants), followed by common disease risk variants (89.4% [118/132]), carrier status (89.3% [117/131]), and variants related to Mendelian (27.2% [34/125]), medically actionable (15.2% [21/138]), and early-onset neurodegenerative (2.6% [3/117]) disease risks. SFs from the American College of Medical Genetics and Genomics list (v3.2, noncancer genes) were reported in 1.4% (2/138) of participants. SFs across all categories demonstrated clinical utility by prompting management changes in 28.1% (39/139) of participants. Moreover, a considerable proportion of participants had suggestive clinical features (49.0% (24/49)]) or family history (21.8% (27/124)) potentially related to their SFs.<h4>Conclusion</h4>Our findings indicate there are potential benefits from opportunistic screening for a broad range of SFs.

Also flagged:Glucosamine-6-Phosphate DeaminaseshexosamineglucosamineFructoseglucosamine-6-phosphate deaminases 1GNPDA1
Journal Article 2024-11-09 No Snippets Lara-Lemus R, Castillejos-López M, Aquino-Gálvez A.
Show Full Abstract

Nearly 5% of the glucose-6-phosphate (Glc6P) in cells is diverted into the hexosamine biosynthetic pathway (HBP) to synthesize glucosamine-6-phosphate (GlcN6P) and uridine diphosphate <i>N</i>-acetyl-glucosamine-6-phosphate (UDP-GlcN6P). Fructose-6-phosphate (Fru6P) is a common intermediary between glycolysis and the HBP. Changes in HBP regulation cause abnormal protein N-glycosylation and <i>O</i>-linked-N-acetylglucosamine modification (O-GlcNAcylation), affecting protein function and modifying cellular responses to signals. The HBP enzymes glucosamine-6-phosphate deaminases 1 and 2 (GNPDA1 and 2) turn GlcN6P back into Fru6P and ammonium, and have been implicated in cancer and metabolic diseases. Despite the plentiful literature on this topic, the mechanisms involved are just beginning to be studied. In this review, we summarize, for the first time, the current knowledge regarding the possible roles of the isoenzymes of both GNPDAs in the pathogenesis and development of metabolic diseases and cancer from a molecular point of view, highlighting their importance not only in supplying carbon from glycolysis, but also in ammonia metabolism.

Also flagged:thiohydronidonelipidHydrogensulfidelysosomal hydrolase
Journal Article 2024-11-09 No Snippets Jin H, Ma J, Xu B, Xu S, Hu T, Jin X, Wang J, Wang G, Zhen L.
Show Full Abstract

Hydrogen sulfide (H<sub>2</sub>S) is a gas signaling molecule with versatile bioactivities; however, its exploitation for disease treatment appears challenging. This study describes the design and characterization of a novel type of H<sub>2</sub>S donor-drug conjugate (DDC) based on the thio-ProTide scaffold, an evolution of the ProTide strategy successfully used in drug discovery. The new H<sub>2</sub>S DDCs achieved hepatic co-delivery of H<sub>2</sub>S and an anti-fibrotic drug candidate named hydronidone, which synergistically attenuated liver injury and resulted in more sufficient intracellular drug exposure. The potent hepatoprotective effects were also attributed to the H<sub>2</sub>S-mediated multipronged intervention in lipid peroxidation both at the whole cellular and lysosomal levels. Lysosomal H<sub>2</sub>S accumulation and H<sub>2</sub>S DDC activation were facilitated by the hydrolysis through the specific lysosomal hydrolase, representing a distinct mechanism for lysosomal targeting independent of the classical basic moieties. These findings provided a novel pattern for the design of optimally therapeutic H<sub>2</sub>S DDC and organelle-targeting functional molecules.

PRDX6
Also flagged:Chronic obstructive pulmonary diseaseCOPDpathogenesisemphysemaproteasecytoskeletal remodeling
Journal Article 2024-11-08 ✓ 2 Snippets Sui J, Xiao H, Mbaekwe U, Ting NC, Murday K, Hu Q, Gregory AD, Kapellos TS, Yildirim AÖ, Königshoff M, Zhang Y, Sciurba F, Das J, Kliment CR.
In-Text Gene Mentions

…( Cyp2b10 andPrdx6), fatty acid metabolism…

…in the literature:Prdx6( 30 ,…

Show Full Abstract

Transcriptomic analyses have advanced the understanding of complex disease pathophysiology including chronic obstructive pulmonary disease (COPD). However, identifying relevant biologic causative factors has been limited by the integration of high dimensionality data. COPD is characterized by lung destruction and inflammation, with smoke exposure being a major risk factor. To define previously unknown biological mechanisms in COPD, we utilized unsupervised and supervised interpretable machine learning analyses of single-cell RNA-Seq data from the mouse smoke-exposure model to identify significant latent factors (context-specific coexpression modules) impacting pathophysiology. The machine learning transcriptomic signatures coupled to protein networks uncovered a reduction in network complexity and new biological alterations in actin-associated gelsolin (GSN), which was transcriptionally linked to disease state. GSN was altered in airway epithelial cells in the mouse model and in human COPD. GSN was increased in plasma from patients with COPD, and smoke exposure resulted in enhanced GSN release from airway cells from patients with COPD. This method provides insights into rewiring of transcriptional networks that are associated with COPD pathogenesis and provides a translational analytical platform for other diseases.

OLFM4
Also flagged:indole-3-aldehydelipopolysaccharideD-lactatetryptophanmetabolismdigestion
Journal Article 2024-11-08 ✓ 4 Snippets Zhang J, Chen Y, Guo X, Li X, Zhang R, Wang M, Zhu W, Yu K.
In-Text Gene Mentions

…staining, antibodies againstOlfm4, Keratin 20 (KRT20),…

…Staining forOlfm4, KRT20, Villin, and…

…the number ofOlfm4+ ISCs (…

…of ISCs (Olfm4and Lgr5 ),…

Show Full Abstract

<h4>Background</h4>Weaning stress-induced diarrhea is widely recognized as being associated with gut microbiota dysbiosis. However, it has been challenging to clarify which specific intestinal microbiota and their metabolites play a crucial role in the antidiarrhea process of weaned piglets.<h4>Results</h4>In this study, we first observed that piglets with diarrhea exhibited a lower average daily gain and higher diarrhea score, and elevated levels of lipopolysaccharide (LPS) and D-lactate (D-LA) compared to healthy piglets. Subsequently, we analyzed the differences in intestinal microbial composition and metabolite levels between healthy and diarrheal weaned piglets. Diarrheal piglets demonstrated intestinal microbiota dysbiosis, characterized primarily by a higher Firmicutes to Bacteroidota ratio, a deficiency of Lactobacillus amylovorus and Lactobacillus reuteri, and an increased abundance of Bacteroides sp.HF-5287 and Bacteroides thetaiotaomicron. Functional profiling of the gut microbiota based on Kyoto Encyclopedia of Genes and Genomes (KEGG) data was performed, and the results showed that tryptophan metabolism was the most significantly inhibited pathway in piglets with diarrhea. Most tryptophan metabolites were detected at lower concentrations in diarrheal piglets than in healthy piglets. Furthermore, we explored the effects of dietary indole-3-aldehyde (IAld), a key tryptophan metabolite, on intestinal development and gut barrier function in weaned piglets. Supplementation with 100 mg/kg IAld in the diet increased the small intestine index and improved intestinal barrier function by promoting intestinal stem cell (ISC) expansion in piglets. The promotion of ISC expansion by IAld was also confirmed in porcine intestinal organoids.<h4>Conclusions</h4>These findings revealed that intestinal microbial tryptophan metabolite IAld alleviates impaired intestinal development by promoting ISC expansion in weaned piglets.

FBXL4
Also flagged:lipidmembranemethyld-aspartateKCC2nucleus
Journal Article 2024-11-08 ✓ 2 Snippets Song X, Hu J.
In-Text Gene Mentions

…ich is driven by the ubiquitin ligase Fbxl4. …

…otes the interaction between KCC2 and Fbxl4. …

Show Full Abstract

No abstract available.

Also flagged:HDAC3Histone deacetylase 3gene expressionneuropsychiatric disordersneurodegenerative diseasesbrain injury
Journal Article 2024-11-08 No Snippets Rosete C, Ciernia AV.
Show Full Abstract

Histone deacetylase 3 (HDAC3) is a critical regulator of gene expression, influencing a variety of cellular processes in the central nervous system. As such, dysfunction of this enzyme may serve as a key driver in the pathophysiology of various neuropsychiatric disorders and neurodegenerative diseases. HDAC3 plays a crucial role in regulating neuroinflammation, and is now widely recognized as a major contributor to neurological conditions, as well as in promoting neuroprotective recovery following brain injury, hemorrhage and stroke. Emerging evidence suggests that pharmacological inhibition of HDAC3 can mitigate behavioral and neuroimmune deficits in various brain diseases and disorders, offering a promising therapeutic strategy. Understanding HDAC3 in the healthy brain lays the necessary foundation to define and resolve its dysfunction in a disease state. This review explores the mechanisms of HDAC3 in various cell types and its involvement in disease pathology, emphasizing the potential of HDAC3 inhibition to address neuroimmune, gene expression and behavioral deficits in a range of neurodegenerative and neuropsychiatric conditions.

SERPINC1
Also flagged:heart failureperipartum cardiomyopathyPPCMSBSPONsomatomedin B andthrombospondin type 1 domain-containing protein precursor
Journal Article 2024-11-08 ✓ 2 Snippets Li A, Fang B, Li M, Koay YC, Malecki C, Hunter B, Harney D, Dos Remedios CG, Larance M, O'Sullivan JF, Lal S.
In-Text Gene Mentions

…=4.7×10 –5 ),SERPINC1(antithrombin III; FC=3.1,…

…ATPase SERPINA4 kallistatinSERPINC1antithrombin III SOD3…

Show Full Abstract

<h4>Background</h4>Pregnancy imposes significant cardiovascular adaptations, including progressive increases in plasma volume and cardiac output. For most women, this physiological adaptation resolves at the end of pregnancy, but some women develop pathological dilatation and ultimately heart failure late in pregnancy or in the postpartum period, manifesting as peripartum cardiomyopathy (PPCM). Despite the mortality risk of this form of heart failure, the molecular mechanisms underlying PPCM have not been extensively examined in human hearts.<h4>Methods</h4>Protein and metabolite profiles from left ventricular tissue of end-stage PPCM patients (N=6-7) were compared with dilated cardiomyopathy (DCM; N=5-6) and nonfailing donors (N=7-18) using unbiased quantitative mass spectrometry. All samples were derived from the Sydney Heart Bank. Data are available via ProteomeXchange with identifier PXD055986. Differential protein expression and metabolite abundance and Kyoto Encyclopedia of Genes and Genomes pathway analyses were performed.<h4>Results</h4>Proteomic analysis identified 2 proteins, SBSPON (somatomedin B and thrombospondin type 1 domain-containing protein precursor) and TNS3 (tensin 3), that were uniquely downregulated in PPCM. SBSPON, an extracellular matrix protein, and TNS3, involved in actin remodeling and cell signaling, may contribute to impaired tissue remodeling and fibrosis in PPCM. Metabolomic analysis revealed elevated levels of homogentisate and deoxycholate and reduced levels of lactate and alanine in PPCM, indicating disrupted metabolic pathways and glucose utilization. Both PPCM and DCM shared pathways related to inflammation, immune responses, and signal transduction. However, thyroid hormone signaling was notably reduced in PPCM, affecting contractility and calcium handling through altered expression of PLN (phospholamban) and Sarcoendoplasmic Reticulum Calcium ATPase (SERCA). Enhanced endoplasmic reticulum stress and altered endocytosis pathways in PPCM suggested additional mechanisms of energy metabolism disruption.<h4>Conclusions</h4>The present study reveals unique posttranslational molecular features of the PPCM myocardium, which mediates cellular and metabolic remodeling, and holds promise as potential targets for therapeutic intervention.

Also flagged:organizationgastric cancergastric adenocarcinomacancermalignant diseaseskidney insufficiency
Journal Article 2024-11-08 No Snippets Jia Z, Cao S, Wang D, Tang C, Tan X, Liu S, Liu X, Li Z, Tian Y, Niu Z, Tang B, Zhou Y.
Show Full Abstract

<h4>Objective</h4>The current research aimed to conduct a detailed analysis of intraoperative surgical performance, short-term outcomes, identify and categorize technical errors, and hazard zones enacted during total gastrectomy performed robotically and laparoscopically by surgeons. Prospective research is needed to determine whether the technical advantages of robotic surgery translate to patient outcomes.<h4>Background</h4>At present, a growing number of clinical studies have demonstrated that the quality of intraoperative surgical performance has a direct impact on the clinical outcomes of the patient. The current research aimed to conduct a detailed analysis of intraoperative surgical performance and short-term outcomes, and identify and categorize technical errors, and hazard zones enacted during total gastrectomy performed robotically and laparoscopically by surgeons.<h4>Methods</h4>Eighty-two patients were recruited and participated in this study, with 40 cases undergoing RTG and 42 cases for LTG. Patients undergoing RTG and LTG were recruited and randomized into the study. Six consultant/attending surgeons participated in this study and all surgical procedures were recorded. The unedited surgical video recordings were handed over to third-party experts for granular analysis of the procedures using objective clinical human reliability analysis for the quality of intraoperative performance, technical errors, and intraoperative complications.<h4>Results</h4>The technical errors enacted and identified in the RTG and the LTG were 46.11 ± 5.63 versus 58.79 ± 8.45 ( P < 0.001), respectively. The highest number of technical errors was identified during the dissection of the supra-pancreatic lymph nodes (task zone 3), including No. 5, 7, 8a, 9, 11p, and 12a to complete the nodal clearance around the celiac artery and its trifurcation (7.29 ± 1.88 vs 9.43 ± 2.24, P < 0.001) in both RTG and LTG. The number of lymph nodes harvested with RTG was higher than LTG (35.36 ± 7.51 vs 30.54 ± 6.95, P = 0.016), especially in the upper margin of the pancreas (13.32 ± 4.17 vs 9.36 ± 3.81, P < 0.001). The total cost of hospitalization in the RTG group is 3% more than the LTG group ($15953.41±3533.91 vs $12198.26±2761.27, P < 0.001).<h4>Conclusions</h4>This study offers compelling objective clinical human reliability analysis evidence demonstrating that RTG facilitates significantly superior technical performance compared with LTG. Whether examining short-term clinical outcomes or intraoperative operations, the robotic surgery system consistently outperforms laparoscopic surgery. Lymph node dissection in the supra-pancreatic region emerged as a major hazard zone in both procedures.

Also flagged:protein degradationchaperoneautophagydegradationorganellessignal transduction
Journal Article 2024-11-08 No Snippets Huang J, Wang J.
Show Full Abstract

Cells rely on autophagy for the degradation and recycling of damaged proteins and organelles. Chaperone-mediated autophagy (CMA) is a selective process targeting proteins for degradation through the coordinated function of molecular chaperones and the lysosome‑associated membrane protein‑2A receptor (LAMP2A), pivotal in various cellular processes from signal transduction to the modulation of cellular responses under stress. In the present review, the intricate regulatory mechanisms of CMA were elucidated through multiple signaling pathways such as retinoic acid receptor (RAR)α, AMP‑activated protein kinase (AMPK), p38‑TEEB‑NLRP3, calcium signaling‑NFAT and PI3K/AKT, thereby expanding the current understanding of CMA regulation. A comprehensive exploration of CMA's versatile roles in cellular physiology were further provided, including its involvement in maintaining protein homeostasis, regulating ferroptosis, modulating metabolic diversity and influencing cell cycle and proliferation. Additionally, the impact of CMA on disease progression and therapeutic outcomes were highlighted, encompassing neurodegenerative disorders, cancer and various organ‑specific diseases. Therapeutic strategies targeting CMA, such as drug development and gene therapy were also proposed, providing valuable directions for future clinical research. By integrating recent research findings, the present review aimed to enhance the current understanding of cellular homeostasis processes and emphasize the potential of targeting CMA in therapeutic strategies for diseases marked by CMA dysfunction.

PRDX6HTT
Also flagged:infectionmitochondrialproximal tubulopathytubularantigen presentationinnate immunity
Journal Article 2024-11-08 ✓ 2 Snippets Weissbach FH, Follonier OM, Schmid S, Leuzinger K, Schmid M, Hirsch HH.
In-Text Gene Mentions

…peroxidases GSTP1 ,PRDX6, MGST3 ,…

HTT(huntingtin) was identified…

Show Full Abstract

BK polyomavirus (BKPyV) contributes to premature renal failure in 10%-20% of kidney transplant recipients. Current treatment relies on reducing immunosuppression to regain BKPyV-specific immune control. Subsequently, declining allograft function may result from persisting viral cytopathology, BKPyV-specific immune reconstitution, or alloimmunity/rejection, all being poorly distinguishable by current histological or molecular approaches. To reduce the complexity encountered in BKPyV-replicating kidneys, we analyzed differentially expressed genes (DEGs) in primary human renal proximal tubular epithelial cells at 24 and 48 h post-infection (hpi) using single-cell RNA-sequencing (10x-Genomics-3´ kit). At 24 hpi, viral transcript reads predominantly mapped to the early viral gene region (<i>EVGR</i>) and shifted to >100-fold higher late viral gene region (<i>LVGR</i>) levels at 48 hpi, matching the sequential bi-directional viral protein expression from the circular double-stranded BKPyV-DNA genome. Besides expected coverage "hills" at viral 3´-poly-A sites, unexpected "spike" and "pulse" reads resulted from off-target TSO priming. "Spike" and "pulse" patterns were rare for the mostly unidirectional reads mapping to the circular mitochondrial genome. Bioinformatic curation removed "spikes" and "pulses" and reclassified 10% of DEGs in renal proximal tubular epithelial cells (RPTECs). Up-regulated gene ontologies included S and G2/M phase, double-stranded DNA repair, proximal tubulopathy, and renal tubular dysfunction, whereas allograft rejection, antigen presentation, innate immunity, translation, and autophagy were down-regulated. BKPyV-<i>LVGR</i> expression induced a novel mitochondrial cell stress pattern consisting of discordant up-regulation and down-regulation of mitochondria-encoded and nucleus-encoded mitochondrial genes, respectively. We explored which top-scoring gene sets of late-phase BKPyV-replicating RPTECs can identify BKPyV-associated nephropathy in kidney transplant biopsies. The results should facilitate distinguishing BKPyV-associated pathology from other entities in kidney transplant biopsies.IMPORTANCEBK polyomavirus (BKPyV) infects more than 90% of the general population and then persists in the reno-urinary tract. Subsequently, low-level urinary shedding is seen in 10% of healthy BKPyV-seropositive persons, indicating that BKPyV replication occurs despite the presence of virus-specific cellular and humoral immunity. Notably, transplantation of donor kidneys with low-level BKPyV replication is a risk factor for progression to high-level BKPyV viruria, new-onset BKPyV-DNAemia and biopsy-proven BKPyV nephropathy. Here, we identify a short list of robust up- and down-regulated nucleus-encoded differentially expressed genes potentially allowing to discriminate viral from allograft immune damage. By carefully curating viral and mitochondrial transcriptomes, we identify a novel virus-associated mitochondrial stress pattern of up-regulated mitochondria-encoded and down-regulated nucleus-encoded mitochondrial transcripts which heralds the BKPyV-agnoprotein-mediated immune escape by breakdown of the mitochondrial membrane potential and network and mitophagy. The results may prove useful when assessing the role of BKPyV replication in kidney transplant patients with suspected acute rejection and/or BKPyV nephropathy.

Also flagged:Cancerdeathagingobesitysolid tumorsinnate immunity
Journal Article 2024-11-08 No Snippets Kzhyshkowska J, Shen J, Larionova I.
Show Full Abstract

АBSTRACT: With increasing incidence and geography, cancer is one of the leading causes of death, reduced quality of life and disability worldwide. Principal progress in the development of new anticancer therapies, in improving the efficiency of immunotherapeutic tools, and in the personification of conventional therapies needs to consider cancer-specific and patient-specific programming of innate immunity. Intratumoral TAMs and their precursors, resident macrophages and monocytes, are principal regulators of tumor progression and therapy resistance. Our review summarizes the accumulated evidence for the subpopulations of TAMs and their increasing number of biomarkers, indicating their predictive value for the clinical parameters of carcinogenesis and therapy resistance, with a focus on solid cancers of non-infectious etiology. We present the state-of-the-art knowledge about the tumor-supporting functions of TAMs at all stages of tumor progression and highlight biomarkers, recently identified by single-cell and spatial analytical methods, that discriminate between tumor-promoting and tumor-inhibiting TAMs, where both subtypes express a combination of prototype M1 and M2 genes. Our review focuses on novel mechanisms involved in the crosstalk among epigenetic, signaling, transcriptional and metabolic pathways in TAMs. Particular attention has been given to the recently identified link between cancer cell metabolism and the epigenetic programming of TAMs by histone lactylation, which can be responsible for the unlimited protumoral programming of TAMs. Finally, we explain how TAMs interfere with currently used anticancer therapeutics and summarize the most advanced data from clinical trials, which we divide into four categories: inhibition of TAM survival and differentiation, inhibition of monocyte/TAM recruitment into tumors, functional reprogramming of TAMs, and genetic enhancement of macrophages.

PRDX6
Also flagged:brain tumorglioblastoma multiformeGBMglioblastomaoxygencancer
Journal Article 2024-11-08 ✓ 1 Snippet Liu X, Liu X, Dong W, Wang P, Liu L, Liu L, E T, Wang D, Lin Y, Lin H, Ruan X, Xue Y.
In-Text Gene Mentions

…that G6PD andPRDX6could be regulated…

Show Full Abstract

Glioblastoma is one of the most common and aggressive primary brain tumors. The aberration of metabolism is the important character of GBM cells and is tightly related to the malignancy of GBM. We mainly verified the regulatory effects of KHDRBS1, SNORD51 and ZBED6 on pentose phosphate pathway and malignant biological behavior in glioblastoma cells, such as proliferation, migration and invasion. KHDRBS1 and SNORD51 were upregulated in GBM tissues and cells. But ZBED6 had opposite tendency in GBM tissues and cells. KHDRBS1 may improve the stability of SNORD51 by binding to SNORD51, thus elevating the expression of SNORD51. More importantly, SNORD51 can competitively bind to WDR33 with 3'UTR of ZBED6 pre-mRNA which can inhibit the 3' end processing of ZBED6 pre-mRNA, thereby inhibiting the expression of ZBED6 mRNA. ZBED6 inhibited the transcription of G6PD by binding to the promoter region of G6PD. Therefore, the KHDRBS1/SNORD51/ZBED6 pathway performs an important part in regulating the pentose phosphate pathway to influence malignant biological behavior of GBM cells, providing new insights and potential targets for the treatment of GBM.

Also flagged:gestationneurogenesisgenetic disordersaxonaltranscription factorsBirth Defects
Journal Article 2024-11-08 No Snippets Ball G, Oldham S, Kyriakopoulou V, Williams LZJ, Karolis V, Price A, Hutter J, Seal ML, Alexander-Bloch A, Hajnal JV, Edwards AD, Robinson EC, Seidlitz J.
Show Full Abstract

The third trimester of human gestation is characterised by rapid increases in brain volume and cortical surface area. Recent studies have revealed a remarkable molecular diversity across the prenatal cortex but little is known about how this diversity translates into the differential rates of cortical expansion observed during gestation. We present a digital resource, μBrain, to facilitate knowledge translation between molecular and anatomical descriptions of the prenatal brain. Using μBrain, we evaluate the molecular signatures of preferentially-expanded cortical regions, quantified in utero using magnetic resonance imaging. Our findings demonstrate a spatial coupling between areal differences in the timing of neurogenesis and rates of neocortical expansion during gestation. We identify genes, upregulated from mid-gestation, that are highly expressed in rapidly expanding neocortex and implicated in genetic disorders with cognitive sequelae. The μBrain atlas provides a tool to comprehensively map early brain development across domains, model systems and resolution scales.

SERPINC1
Also flagged:Deep vein thrombosisDVThypertensionheart diseasecoagulationpulmonary thromboembolism
Journal Article 2024-11-08 ✓ 1 Snippet Furukawa Y, Kobayashi T, Narumi S, Koba M, Koami H, Sakamoto Y.
In-Text Gene Mentions

…– 33 ,SERPINC129 – 33…

Show Full Abstract

The principal goal of this study was to assess factors associated with deep vein thrombosis (DVT) in the aftermath of earthquakes in Japan. We searched PubMed, Google Scholar, Web of Science, and Cochrane Library for articles published in English or Japanese regarding indicators for DVT associated with Japanese earthquakes. We calculated pooled odds ratios (OR) or mean differences (MD) with 95% confidence intervals (CIs) for patients with DVT (the DVT group) as compared with the non-DVT group for potential predictors. Ultimately, 7 articles were included in the analysis, comprising 6,637 subjects (DVT, 895; and non-DVT, 5,742). The following factors proved statistically significant: female gender (OR = 1.48, 95% CI; 1.20-1.81, p = 0.0002), greater age (MD = 4.44, 95% CI; 1.62-7.25, p = 0.002), hypertension (OR = 1.44, 95% CI; 1.18-1.75, p = 0.0003), heart disease (OR = 1.45, 95% CI; 1.07-1.97, p = 0.02), previous history of DVT (OR = 9.23, 95% CI; 2.94-28.91, p = 0.0001), sleeping pill use (OR = 1.81, 95% CI; 1.37-2.38, p = 0.0001), lower leg varix (OR = 1.63, 95% CI; 1.17-2.28, p = 0.004), and soleal vein dilatation ≥ 8 mm (OR = 2.13, 95% CI; 1.32-3.42, p = 0.002). Our findings furnish insights that can aid in making informed choices about healthcare and policy in the context of earthquake-induced stress.

BTN2A2
Also flagged:CDCA8lung cancersCell division cycle-associated 8cell cyclecancersLUAD
Journal Article 2024-11-08 ✓ 1 Snippet Gu H, Gao X, Han W, Wang F, Zhang H, Yao L, Chen W, Liu Q.
In-Text Gene Mentions

…, CD48 ,BTN2A2, BTNL9 ,…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) accounts for the highest proportion of lung cancers; however, specific biomarkers are lacking for diagnosis, treatment, and prognostic assessment. Cell division cycle-associated 8 (CDCA8) is a cell cycle regulator with elevated expression in various cancers. However, the association between CDCA8 expression and LUAD prognosis remains unclear.<h4>Methods</h4>The association between CDCA8 and LUAD prognosis was evaluated based on the The Cancer Genome Atlas (TCGA) dataset, and CDCA8 related functions were determined using gene enrichment and gene ontology analyses. We also analyzed the association between CDCA8 expression and immune cell infiltration. Immunohistochemistry was used to determine the differential expression of CDCA8 in tumors and controls. Finally, we evaluated the differences in the sensitivity of different levels of CDCA8 to different anticancer drugs in LUAD.<h4>Results</h4>CDCA8 expression was significantly higher in primary LUAD tumors than in normal tissues (P < 0.001). Moreover, Kaplan-Meier survival analysis demonstrated that high CDCA8 expression predicted poor survival in patients with LUAD (P = 0.006). The receiver operating characteristic (ROC) curves indicated that CDCA8 was an effective guide for the diagnosis of LUAD. Functional annotation indicated that CDCA8 might be involved in functions such as p53 stabilization, nucleotide metabolism, RNA-mediated gene silencing, and the G2/M phase checkpoint. Immune infiltration results suggested that CDCA8 was positively correlated with Th2 cells and Tgd and negatively correlated with Eosinophils and Mast cells (P < 0.01). In addition, elevated expression of CDCA8 may increase the sensitivity of patients to certain anticancer drugs.<h4>Conclusions</h4>CDCA8 upregulation is significantly associated with poor survival and immune infiltration in patients with LUAD. Our study suggests that CDCA8 can be used as a biomarker for LUAD prognosis and a reference for personalized medication.

BTN2A1
Also flagged:IgA nephropathymembranous nephropathyIgANlocalizationPLA2R1FCGR3B
Journal Article 2024-11-08 ✓ 1 Snippet Xu X, Miao C, Yang S, Xiao L, Gao Y, Wu F, Xu J.
In-Text Gene Mentions

…between BTN3A1 andBTN2A1may selectively inhibit…

Show Full Abstract

<h4>Background</h4>Membranous nephropathy (MN) and IgA nephropathy (IgAN) pose challenges in clinical treatment with existing therapies primarily focusing on symptom relief and often yielding unsatisfactory outcomes. The search for novel drug targets remains crucial to address the shortcomings in managing both kidney diseases.<h4>Methods</h4>Utilizing GWAS data for MN (ncase = 2150, ncontrol = 5829) and IgAN (ncase = 15587, ncontrol = 462197), instrumental variables for plasma proteins were derived from recent GWAS. Sensitivity analysis involved bidirectional Mendelian randomization analysis, MR Steiger, Bayesian co-localization, and Phenotype scanning. The SMR analysis using eQTL data from the eQTLGen Consortium was conducted to assess the availability of selected protein targets. The PPI network was constructed to reveal potential associations with existing drug treatment targets.<h4>Results</h4>The study, subjected to the stringent Bonferroni correction, revealed significant associations: four proteins with MN and three proteins with IgAN. In plasma protein cis-pQTL data from two cohorts, an increase in one standard deviation in PLA2R1 (OR = 2.01, 95%CI = 1.83-2.21), AIF1 (OR = 9.04, 95%CI = 4.69-17.41), MLN (OR = 3.79, 95%CI = 2.12-6.78), and NFKB1 (OR = 29.43, 95%CI = 7.73-112.0) was associated with an increased risk of MN. Additionally, in plasma protein cis-pQTL data, a standard deviation increase in FCGR3B (OR = 1.15, 95%CI = 1.09-1.22) and BTN3A1 (OR = 4.05, 95%CI = 2.65-6.19) correlated with elevated IgAN risk, while AIF1 (OR = 0.58, 95%CI = 0.46-0.73) exhibited IgAN protection. Bayesian co-localization indicated that PLA2R1 (coloc.abf-PPH4 = 0.695), NFKB1 (coloc.abf-PPH4 = 0.949), FCGR3B (coloc.abf-PPH4 = 0.909), and BTN3A1 (coloc.abf-PPH4 = 0.685) share the same variants associated with MN and IgAN. The SMR analysis indicated a causal link between NFKB1 and BTN3A1 plasma protein eQTL in both conditions, and BTN3A1 was validated externally.<h4>Conclusion</h4>Genetically influenced plasma levels of PLA2R1 and NFKB1 impact MN risk, while FCGR3B and BTN3A1 levels are causally linked to IgAN risk, suggesting potential drug targets for further clinical exploration, notably BTN3A1 for IgAN.

Also flagged:Enterocolitisnecrotizing enterocolitisdeathNECbronchopulmonary dysplasiaoxygen
Journal Article 2024-11-08 No Snippets DeMauro SB, Jensen EA, McDonald SA, Hintz S, Tyson J, Stevenson DK, Blakely ML, NICHD Neonatal Research Network.
Show Full Abstract

The multicenter Necrotizing Enterocolitis Surgery Trial compared initial peritoneal drainage with laparotomy among infants with extremely low birth weight and surgical necrotizing enterocolitis or intestinal perforation. In this post hoc analysis of trial data, initial drainage was associated with adverse respiratory outcomes, both in hospital and through 2 years corrected age.

POU3F2
Also flagged:glioblastomastemozolomideCNStumorGBMATM
Journal Article 2024-11-08 ✓ 1 Snippet Modestov A, Zolotovskaia M, Suntsova M, Zakharova G, Seryakov A, Jovcevska I, Mlakar J, Poddubskaya E, Moisseev A, Vykhodtsev G, Roumiantsev S, Sorokin M, Tkachev V, Simonov A, Buzdin A.
In-Text Gene Mentions

…blocks transcriptional factorsPOU3F2and SMARCA5, 60…

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) is the most aggressive and lethal central nervous system (CNS) tumor. The treatment strategy is mainly surgery and/or radiation therapy, both combined with adjuvant temozolomide (TMZ) chemotherapy. Historically, methylation of <i>MGMT</i> gene promoter is used as the major biomarker predicting individual tumor response to TMZ.<h4>Objectives</h4>This research aimed to analyze genes and molecular pathways of DNA repair as biomarkers for sensitivity to TMZ treatment in GBM using updated The Cancer Genome Atlas (TCGA) data and validate the results on experimental datasets.<h4>Methods</h4>Survival analysis of GBM patients under TMZ therapy and hazard ratio (HR) calculation were used to assess all putative biomarkers on World Health Organization CNS5 reclassified TCGA project collection of molecular profiles and experimental multicenter GBM patient cohort. Pathway activation levels were calculated for 38 DNA repair pathways. TMZ sensitivity pathway was reconstructed using a human interactome model built using pairwise interactions extracted from 51,672 human molecular pathways.<h4>Results</h4>We found that expression/activation levels of seven and six emerging gene/pathway biomarkers served as high-quality positive (HR < 0.61) and negative (HR > 1.63), respectively, patient survival biomarkers performing better than <i>MGMT</i> methylation. Positive survival biomarkers were enriched in the processes of ATM-dependent checkpoint activation and cell cycle arrest whereas negative-in excision DNA repair. We also built and characterized gene pathways which were informative for GBM patient survival following TMZ administration (HR 0.18-0.44, <i>p</i> < 0.0009; area under the curve 0.68-0.9).<h4>Conclusion</h4>In this study, a comprehensive analysis of the expression of 361 DNA repair genes and activation levels of 38 DNA repair pathways revealed 13 potential survival biomarkers with increased prognostic potential compared to <i>MGMT</i> methylation. We algorithmically reconstructed the TMZ sensitivity pathway with strong predictive capacity in GBM.

NEGR1
Also flagged:Lipedemaextracellularpathogenesislipidextracellular matrixPRKG2
Journal Article 2024-11-08 ✓ 4 Snippets Streubel MK, Baumgartner A, Meier-Vollrath I, Frambach Y, Brandenburger M, Kisch T.
In-Text Gene Mentions

…MEDAG , andNEGR1are differentially expressed…

…gender-specific alteration ofNEGR1expression with an…

…37NEGR1is inducing FGF2,…

…BothNEGR1and MEDAG are…

Show Full Abstract

<h4>Background</h4>Lipedema is a disease typically affecting women with a symmetrical, painful fat distribution disorder, which is hypothesized to be caused by impaired adipogenesis, inflammation, and extracellular matrix remodeling, leading to fibrosis and the development of edema in lipedema subcutaneous adipose tissue. The pathogenesis and molecular processes leading to lipedema have not yet been clarified.<h4>Methods</h4>A whole transcriptome analysis of subcutaneous tissue of lipedema stages I (n = 12), II (n = 9), and III (n = 8) compared with hypertrophied subcutaneous tissue (n = 4) was performed. Further data about hormonal substitution and body morphology were collected. The study is registered at ClinicalTrials.gov (NCT05861583).<h4>Results</h4>We identified several differentially expressed genes involved in mechanisms leading to the development of lipedema. Some genes, such as <i>PRKG2</i>, <i>MEDAG</i>, <i>CSF1R</i>, <i>BICC1</i>, <i>ERBB4</i>, and <i>ACP5</i>, are involved in adipogenesis, regulating the development of mature adipocytes from mesenchymal stem cells. Other genes, such as <i>MAFB</i>, <i>C1Q</i>, <i>C2</i>, <i>CD68</i>, <i>CD209</i>, <i>CD163</i>, <i>CD84</i>, <i>BCAT1</i>, and <i>TREM2</i>, are predicted to be involved in lipid accumulation, hypertrophy, and the inflammation process. Further genes such as <i>SHTN1</i>, <i>SCN7A</i>, and <i>SCL12A2</i> are predicted to be involved in the regulation and transmission of pain.<h4>Conclusions</h4>In summary, the pathogenesis and development of lipedema might be caused by alterations in adipogenesis, inflammation, and extracellular matrix remodeling, leading to fibrosis and the formation of edema resulting in this painful disease. These processes differ from hypertrophied adipose tissue and may therefore play a main role in the formation of lipedema.

OLFM4
Also flagged:immune responsehumoral responsehost cellsneutrophilleukocyte migrationantigen receptor
Journal Article 2024-11-08 ✓ 5 Snippets Chao Y, Jin X, Guo R, Zhang H, Cui X, Qi Y.
In-Text Gene Mentions

…, AGPAT2, SLC7A9,OLFM4, EPCAM, ANXA2, PRSS3,…

…mRNAs (AGPAT2, SLC7A9,OLFM4, EPCAM, ANXA2, PRSS3,…

…that knocking downOLFM4may slow the…

…gradual increase ofOLFM4with further intestinalization…

…57 Other studies showed gradual increaseof OLFM4with further intestinalization of gastric mucosa.…

Show Full Abstract

<h4>Background</h4>Chronic atrophic gastritis (CAG) is a severe condition characterized by inflammation and loss of appropriate mucosal glands in the stomach. The underlying mechanisms of CAG development remain unclear. Exploring immune-related circular RNAs (circRNAs) could provide insights for potential diagnostic and therapeutic strategies.<h4>Methods</h4>Samples from 40 patients with CAG and non-CAG (CNAG) underwent high-throughput sequencing, and EdgeR analysis identified differentially expressed circRNAs and mRNAs. Gene Ontology (GO) analysis elucidated biological functions, while Immune Cell Abundance Identifier (ImmuCellAI) estimated immune cell abundance. Flow cytometry analyzed immune cell infiltration. Weighted gene co-expression network analysis (WGCNA) identified hub genes related to the immune response in CAG. CircRNA-mRNA networks were constructed, and qRT-PCR validated findings.<h4>Results</h4>A total of 163 differentially expressed immune-related genes (DEIRGs) were identified between CAG and CNAG. The upregulated immune-related mRNAs in CAG were significantly enriched in antimicrobial humoral response, viral entry into host cells, neutrophil activation, and leukocyte migration. Conversely, downregulated immune-related mRNAs were linked to regulation of natural killer cell-mediated cytotoxicity, positive regulation of adaptive immune response, antigen receptor-mediated signaling pathway, and B cell activation. Immune Cell Abundance Identifier (ImmuCellAI) and flow cytometry confirmed increased neutrophil infiltration in CAG compared to CNAG. WGCNA identified 56 hub immune-related genes. Additionally, circRNA expression profiles in CNAG and CAG were explored, with 19 upregulated and 23 downregulated circRNAs identified in CAG. The upregulated circRNAs were associated with biological processes like carnitine metabolic process and regulation of B cell receptor signaling pathway. A circRNA-mRNA co-expression network was constructed based on five circRNAs highly related to hub immune-related genes. Furthermore, the expression of eight immune-related mRNAs and five circRNAs were validated in CAG.<h4>Conclusion</h4>This study is the first systematic analysis of circRNA profiles in CAG and provide important insights for potential immunotherapeutic strategies and early diagnostic biomarkers in CAG treatment.

MLLT10
Also flagged:acute myeloid leukemiaAMLcancerleukemiaRUNX1RUNX1T1
Journal Article 2024-11-08 ✓ 4 Snippets Singh H, Sahajpal NS, Gupta V, Farmaha J, Vashisht A, Mondal AK, Kolhe R.
In-Text Gene Mentions

…the fusion partnersMLLT10(10p12.31) has been…

…resulted in the KMT2A::MLLT10fusion as shown…

…resulting in the KMT2A::MLLT10fusion.…

…addition to the KMT2A::MLLT10rearrangement, an unbalanced…

Show Full Abstract

No abstract available.

Also flagged:autophagyNeurodegenerative diseasesagingorganellesoligonucleotidesdegradation
Journal Article 2024-11-08 No Snippets Mohseni M, Behzad G, Farhadi A, Behroozi J, Mohseni H, Valipour B.
Show Full Abstract

Neurodegenerative diseases (NDs) are increasingly prevalent in our aging population, imposing significant social and economic burdens. Currently, most ND patients receive only symptomatic treatment due to limited understanding of their underlying causes. Consequently, there is a pressing need for comprehensive research into the pathological mechanisms of NDs by both researchers and clinicians. Autophagy, a cellular mechanism responsible for maintaining cellular equilibrium by removing dysfunctional organelles and misfolded proteins, plays a vital role in cell health and is implicated in various diseases. MicroRNAs (miRNAs) exert influence on autophagy and hold promise for treating these diseases. These small oligonucleotides bind to the 3'-untranslated region (UTR) of target mRNAs, leading to mRNA silencing, degradation, or translation blockade. This review explores recent findings on the regulation of autophagy and autophagy-related genes by different miRNAs in various pathological conditions, including neurodegeneration and inflammation-related diseases. The recognition of miRNAs as key regulators of autophagy in human diseases has spurred investigations into pharmacological compounds and traditional medicines targeting these miRNAs in disease models. This has catalyzed a new wave of therapeutic interventions aimed at modulating autophagy.

HFE
Also flagged:Pituitary hemochromatosissecondary amenorrhealuteinizing hormoneLHfollicle stimulating hormoneDiamond-Blackfan anemia
Journal Article 2024-11-08 ✓ 5 Snippets Chandrapal J, Fetzer D, Kukkar V, Feltrin F.
In-Text Gene Mentions

…dysfunction from secondaryhemochromatosis, presumably due to…

…nsequently developed secondaryhemochromatosis.…

…ng/mL. This secondaryhemochromatosisresulted in iron…

…setting of secondaryhemochromatosis.…

…sequela of secondaryhemochromatosiswithin the spleen…

Show Full Abstract

Secondary amenorrhea is the absence of menses for more than 3 months in women who previously had regular menstrual cycles or 6 months for those with irregular cycles. Workup of secondary amenorrhea includes laboratory analysis to assess pituitary function, specifically luteinizing hormone (LH) and follicle stimulating hormone (FSH). If low, structural evaluation of the pituitary gland with MRI is recommended. We report a case of a 31-year-old female with history of transfusion-dependent Diamond-Blackfan anemia and type 2 diabetes that reported amenorrhea for 1 year following intrauterine device (IUD) removal. Due to low LH and FSH, the patient underwent an MRI of the pituitary gland. Imaging demonstrated complete absence of MRI signal within the pituitary parenchyma, which confirmed pituitary dysfunction from secondary hemochromatosis, presumably due to iron overload from multiple transfusions. As a result of her imaging and laboratory assessment, she was placed on an iron chelator and oral contraception.

Also flagged:silicaorganizationgold nanoparticleplatinumcatalasenanoparticle
Journal Article 2024-11-08 No Snippets Nidhi V, Allaire A, Ait Athmane Z, Guenoun P, Testard F, Renault JP, Malloggi F.
Show Full Abstract

This study compares the mobility behaviour, in a H<sub>2</sub>O<sub>2</sub> environment, of three different geometries of hybrid particle made of silica core functionalized by gold (nanoparticles or layer). It is known that the decomposition of H<sub>2</sub>O<sub>2</sub> on gold surfaces drives mobility; however, the link between mobility orientation and the organization of gold on silica surfaces is still questionable. While conventional wisdom posits that asymmetric designs are crucial for generating phoretic forces or localized bubble propulsion, recent research suggests that symmetrical particles may also exhibit motility. To address this debate, we developed a robust workflow for synthesizing gold grafted silica nanoparticles with precise control over size and shape, enabling the direct comparison of their motile behaviour by dynamic light scattering and particle tracking velocimetry. Our results indicate, first, that a combination of techniques is necessary to overcome their intrinsic limitation and, second, that the inherent asymmetry generated by isotropic gold nanoparticle deposition onto silica surfaces may enable particle motility.

Also flagged:systemic infectiondeathorganochlorine compoundsorganochlorinesmalnutritioninfectious diseases
Journal Article 2024-11-08 No Snippets Mattioda V, Giorda F, Consales G, Testori C, Zoppi S, Goria M, Crescio MI, Serracca L, Varello K, Carta V, Marsili L, Baini M, Galli M, Fossi CC, Fontanesi E, Garibaldi F, Pietroluongo G, Mazzariol S, Brunelli F, Casalone C, Grattarola C.
Show Full Abstract

Data collected by C. Re. Di. Ma over a 3-year period (2020-2022) were considered to assess anthropic pressure on cetaceans living in the Ligurian sea. Out of a total of 37 stranded cetaceans, a complete <i>post mortem</i> examination was performed on 23 cases. Of these, 14 were further selected considering at least one of these conditions: (i) confirmed, probable, or suspected interaction with fishing activities through the application of a standardized diagnostic framework (7/14; 50%), (ii) toxicological stress through the evaluation of OCs hazardous levels (14/14; 100%), and (iii) terrestrial pathogen-associated disease (systemic infection and/or associated lesions) (7/14; 50%). For 9 animals out of a total of 14 selected, the cause of death was classified as natural (6/14; 42,8%), anthropic (3/14; 21,4%), or not determined (5/14; 35,7%) based on gross and histological pathology and ancillary testing. These findings extend our knowledge of the anthropic pressure to which cetaceans stranded along the Ligurian coastline are subjected from a multidisciplinary point of view.

SOX6
Also flagged:nuclear factor INFINfixMSTNmyostatintranscription factor
Journal Article 2024-11-08 ✓ 3 Snippets Qiu M, Zhang X, Liao L, Zhang N, Liu M.
In-Text Gene Mentions

…zebrafish, Nfix counteractsSox6, facilitating proper…

…that knocking downSOX6upregulated slow skeletal…

…direct targets ofSOX6affecting the muscle…

Show Full Abstract

Skeletal muscle development is crucial for livestock production, and understanding the molecular mechanisms involved is essential for enhancing muscle growth in sheep. This study aimed to investigate the role of <i>Nfix</i>, a member of the nuclear factor I (NFI) family, in regulating muscle development in sheep, filling a significant gap in the current understanding of <i>Nfix</i> deficiency and its impact on skeletal muscle growth, as no similar studies have been reported in this species. Bioinformatic analysis, including temporal analysis of transcriptome data, identified <i>Nfix</i> as a potential target gene for muscle growth regulation. The effects of <i>Nfix</i> overexpression and knockout on the proliferation and differentiation of sheep skeletal muscle cells were investigated. Changes in the expression of associated marker genes were assessed to explore the regulatory link between <i>Nfix</i> and the myostatin (<i>MSTN</i>) gene. Additionally, target miRNAs for <i>Nfix</i> and <i>MSTN</i> were predicted using online databases such as miRWalk, resulting in the construction of an <i>Nfix</i>-miRNA-<i>MSTN</i> interactive regulatory network. The findings revealed that <i>Nfix</i> promotes the proliferation and differentiation of sheep skeletal muscle cells, with further analysis indicating that <i>Nfix</i> may regulate muscle cell development by modulating <i>MSTN</i> expression. This study provides preliminary insights into the function of <i>Nfix</i> in sheep skeletal muscle development and its regulatory interactions, addressing a critical knowledge gap regarding <i>Nfix</i> deficiency and its implications for muscle growth. These findings contribute to a better understanding of muscle biology in sheep and provide a theoretical foundation for future research into the regulatory mechanisms governing muscle development.

Also flagged:OsteosarcomaOSbone tumordoxorubicincisplatinmethotrexate
Journal Article 2024-11-08 No Snippets Guerrieri AN, Hattinger CM, Marchesini F, Melloni M, Serra M, Ibrahim T, Penzo M.
Show Full Abstract

High-grade osteosarcoma (OS) is the most common primary bone tumor mainly affecting children and young adults. First-line treatment consists of neo-adjuvant chemotherapy with doxorubicin, cisplatin, and methotrexate and surgery. The mean long-term survival rate for localized disease at diagnosis is 65-70%, dropping down to 20% when metastases are present at diagnosis. Therefore, curing OS is a clinical challenge, particularly for patients that do not respond to standard treatments. <i>MYC</i> has frequently been reported to be involved in the pathogenesis of OS and its high expression may be associated with drug resistance and patients' worse prognosis. Moreover, <i>MYC</i> is a master regulator of ribosomal proteins (RPs) synthesis and ribosome biogenesis (RiBi), which is often up-regulated in human tumors. In recent years, RPs have been recognized not only for their traditional role in ribosome assembly but also for their extra-ribosomal functions, many of which are linked to the onset and progression of cancer. In this review we focus on the role and possible interplay of <i>MYC</i> and RPs expression in association with drug resistance and worse prognosis in OS and discuss therapeutic options that target de-regulated <i>MYC</i>, RiBi, or RPs, which are already clinically available or under evaluation in clinical trials.

ECI2
Also flagged:liver diseasescirrhosisNOD-like receptorp53lipidmetabolism
Journal Article 2024-11-08 ✓ 1 Snippet Yang S, Luo T, Liu H, Chen L, Wang J, Zhao Y, Li X, Li H, Li M, Lu L.
In-Text Gene Mentions

…the upregulated genesEci2, Cnbd2 ,…

Show Full Abstract

<b>Background/Objectives:</b> CD161, encoded by the <i>KLRB1</i> gene, is an inhibitory receptor expresses on various immune cell and has gained attention in immune checkpoint research. In recent studies, <i>KLRB1</i> has been found to be one of the potential markers of liver diseases such as cirrhosis. Therefore, it will be important to understand what process <i>KLRB1</i> involved in the liver for the prevention of liver diseases. <b>Methods:</b> We compared <i>KO</i> mice with wild-type controls by routine blood analysis and RNA-seq, and additionally performed H&E staining and qPCR to validate the differentially expressed genes (DEGs). <b>Results:</b><i>KO</i> mice had fewer lymphocytes compared to the wild-type mice. A transcriptomic analysis showed that <i>Klrb1</i> loss causes the upregulation of immune-related genes and pathways like NOD-like receptor and p53 signaling, while causing the downregulation of lipid metabolism-related genes. A protein interaction analysis indicated a potential cancer risk under chronic inflammation. Histological examination with H&E staining reveals an inflammatory response around the central venous vessels in the liver tissue of the <i>KO</i> mice. <b>Conclusions</b>: We conclude that <i>Klrb1</i> knockout disrupts the immune and metabolic functions in the liver, which may possibly lead to chronic inflammation and malignancy risks. These findings highlight the role of <i>Klrb1</i> in hepatic health.

Also flagged:InfectionautophagyHCV infectionsnonstructural (NS) 5Aacidic hydrolasesHCV infection
Journal Article 2024-11-08 No Snippets Ke PY, Yeh CT.
Show Full Abstract

Many types of RNA viruses, including the hepatitis C virus (HCV), activate autophagy in infected cells to promote viral growth and counteract the host defense response. Autophagy acts as a catabolic pathway in which unnecessary materials are removed via the lysosome, thus maintaining cellular homeostasis. The HCV non-structural 5A (NS5A) protein is a phosphoprotein required for viral RNA replication, virion assembly, and the determination of interferon (IFN) sensitivity. Recently, increasing evidence has shown that HCV NS5A can induce autophagy to promote mitochondrial turnover and the degradation of hepatocyte nuclear factor 1 alpha (HNF-1α) and diacylglycerol acyltransferase 1 (DGAT1). In this review, we summarize recent progress in understanding the detailed mechanism by which HCV NS5A triggers autophagy, and outline the physiological significance of the balance between host-virus interactions.

HTT
Also flagged:aminoN-acetyltransferaseNAA10genetic disorders-translational modification
Journal Article 2024-11-08 ✓ 1 Snippet Saha S, Jain BP, Ghosh DK, Ranjan A.
In-Text Gene Mentions

…-α-acetylation of Huntingtin (HTT) exon1 by the…

Show Full Abstract

The acetylation of proteins' N-terminal amino groups by the N-acetyltransferase complexes plays a crucial role in modulating the spatial stability and functional activities of diverse human proteins. Mutations disrupting the stability and function of NAA10 result in X-linked rare genetic disorders. In this study, we conducted a global analysis of the impact of fifteen disease-associated missense mutations in <i>NAA10</i>. The analyses revealed that mutations in specific residues, such as Y43, V107, V111, and F128, predictably disrupted interactions essential for NAA10 stability, while most mutations (except R79C, A111W, Q129P, and N178K) expectedly led to structural destabilization. Mutations in many conserved residues within short linear motifs and post-translational modification sites were predicted to affect NAA10 functionality and regulation. All mutations were classified as pathogenic, with F128I and F128L identified as the most destabilizing mutations. The findings show that the F128L and F128I mutations employ different mechanisms for the loss of catalytic activities of NAA10<sup>F128L</sup> and NAA10<sup>F128I</sup> due to their structural instability. These two mutations induce distinct folding energy states that differentially modulate the structures of different regions of NAA10<sup>F128L</sup> and NAA10<sup>F128I</sup>. Specifically, the predicted instability caused by the F128I mutation results in decreased flexibility within the substrate-binding region, impairing the substrate peptide binding ability of NAA10<sup>F128I</sup>. Conversely, F128L is predicted to reduce the flexibility of the region containing the acetyl-CoA binding residues in NAA10<sup>F128L</sup>. Our study provides insights into the mechanism of catalytic inactivation of mutants of NAA10, particularly elucidating the mechanistic features of the structural and functional pathogenicity of the F128L and F128I mutations.

medRxiv 2024-11-08 Preprint (No Snippets API) Gezegen H, Alaylıoğlu M, Şahin E, Swann O, Veleva E, Güven G, Yaman U, Salih DA, Bilgiç B, Hanağası H, Gürvit H, Emre M, Gezen-Ak D, Dursun E, Zetterberg H, Hardy J, Heslegrave A, Shoai M, Samancı B.
Show Full Abstract

Alzheimer’s disease (AD) diagnosis is challenging due to overlapping symptoms with other dementias. Current diagnostic methods are invasive and costly, highlighting the need for accessible biomarkers. This study investigates the diagnostic performance and pathophysiological implications of a novel plasma biomarker panel in a mixed dementia cohort, aiming to enhance diagnosis and elucidate underlying pathogenic mechanisms. 120 plasma biomarkers were analyzed using the NULISA™ platform in a well-characterized mixt dementia. CSF biomarkers were measured via ELISA. Statistical analyses employed ANOVA, and Kruskal-Wallis tests for group comparisons. Spearman correlations assessed relationships between CSF and plasma biomarkers. Diagnostic accuracy was evaluated using regression models and ROC curves. Feature importance and selection were performed using random forest analysis. Protein interactions assessed with GO enrichment analysis. We evaluated 248 subjects (130 females, 118 males) with 117 AD, 50 MCI, 39 FTD, 25 DLB, and 17 other dementias. Plasma pTau were significantly elevated in AD compared to other groups, and in DLB compared to MCI. Plasma Aβ42 was highest in DLB, while NfL was highest in FTD. Plasma GFAP was highest in AD and elevated in DLB compared to MCI and FTD. Plasma pTau levels showed a negative correlation with CSF Aβ42 and a positive correlation with CSF pTau in the entire cohort. CSF and plasma NfL levels were also highly correlated. These correlations were stronger in DLB and amyloid-positive MCI groups but weaker or absent in the AD group. Plasma pTau, GFAP, and NfL were negatively correlated with MMSE in AD, while GFAP showed a negative correlation with MMSE in FTD and DLB. Plasma pTau217 demonstrated the best diagnostic accuracy for AD, DLB, FTD diagnosis and CSF amyloid positivity (AUCs 0.9, 0.84, 0.79, and 0.87, respectively). pTau181, pTau217, pTau231, total-tau and GFAP had lower odds in DLB and FTD compared to AD. AGRN, CXCL1, SCNB, TEK, and UCHL1 had higher odds in DLB compared to AD. SNAP25 had lower odds ratio in FTD compared to AD and DLB. pTau181, pTau217, pTau231, GFAP, MAPT, SNAP25 and PGF is related to AD progression. Random forest analysis incorporating all plasma biomarkers, age, and gender yielded an AUCs of 0.85 for AD, 0.84 for FTD, and 0.75 for DLB. Refining the model by including biomarkers identified as significant in regression model improved performance, resulting in AUCs of 0.88 for AD, 0.87 for FTD, and 0.81 for DLB. This demonstrates potential for enhancing diagnostic accuracy through targeted biomarker panel refinement.

Also flagged:Protein CfurinpeptideCas9coagulationPS
Journal Article 2024-11-07 No Snippets Togashi T, Baatartsogt N, Nagao Y, Kashiwakura Y, Hayakawa M, Hiramoto T, Fujiwara T, Morishita E, Nureki O, Ohmori T.
Show Full Abstract

<h4>Background</h4>PC (protein C) is a plasma anticoagulant encoded by <i>PROC</i>; mutation in both <i>PROC</i> alleles results in neonatal purpura fulminans-a fatal systemic thrombotic disorder. In the present study, we aimed to develop a genome editing treatment to cure congenital PC deficiency.<h4>Methods</h4>We generated an engineered APC (activated PC) to insert a furin-cleaving peptide sequence between light and heavy chains. The engineered PC was expressed in the liver of mice using an adeno-associated virus vector or CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat-associated 9)-mediated genome editing using an adeno-associated virus vector in vivo.<h4>Results</h4>The engineered PC could be released in its activated form and significantly prolonged the plasma coagulation time independent of the cofactor activity of PS (protein S) in vitro. The adeno-associated virus vector-mediated expression of the engineered PC, but not wild-type PC, prolonged coagulation time owing to the inhibition of activated coagulation FV (factor V) in a dose-dependent manner and abolished pathological thrombus formation in vivo in C57BL/6J mice. The insertion of <i>EGFP</i> (enhanced green fluorescent protein) sequence conjugated with self-cleaving peptide sequence at <i>Alb</i> locus via neonatal in vivo genome editing using adeno-associated virus vector resulted in the expression of EGFP in 7% of liver cells, mainly via homology-directed repair, in mice. Finally, we succeeded in improving the survival of PC-deficient mice by expressing the engineered PC via neonatal genome editing in vivo.<h4>Conclusions</h4>These results suggest that the expression of engineered PC via neonatal genome editing is a potential cure for severe congenital PC deficiency.

RC3H1
Also flagged:cell cycletranslationalpurinemetabolismadenosine deaminaseADA
Journal Article 2024-11-07 ✓ 1 Snippet DeLuca S, Strash N, Chen Y, Patsy M, Myers A, Tejeda L, Broders S, Miranda A, Jiang X, Bursac N.
In-Text Gene Mentions

RC3H1

Show Full Abstract

Improved understanding of cardiomyocyte (CM) cell cycle regulation may allow researchers to stimulate pro-regenerative effects in injured hearts or promote maturation of human stem cell-derived CMs. Gene therapies, in particular, hold promise to induce controlled proliferation of endogenous or transplanted CMs via transient activation of mitogenic processes. Methods to identify and characterize candidate cardiac mitogens in vitro can accelerate translational efforts and contribute to the understanding of the complex regulatory landscape of CM proliferation and postnatal maturation. In this study, A CRISPR knockout-based screening strategy using in vitro neonatal rat ventricular myocyte (NRVM) monolayers is established, followed by candidate mitogen validation in mature 3-D engineered cardiac tissues (ECTs). This screen identified knockout of the purine metabolism enzyme adenosine deaminase (ADA-KO) as an effective pro-mitogenic stimulus. RNA-sequencing of ECTs further reveals increased pentose phosphate pathway (PPP) activity as the primary driver of ADA-KO-induced CM cycling. Inhibition of the pathway's rate limiting enzyme, glucose-6-phosphate dehydrogenase (G6PD), prevented ADA-KO induced CM cycling, while increasing PPP activity via G6PD overexpression increased CM cycling. Together, this study demonstrates the development and application of a genetic/tissue engineering platform for in vitro discovery and validation of new candidate mitogens affecting regenerative or maturation states of cardiomyocytes.

Also flagged:vacuolemacropinocytosisextracellulardeathcancerF-actin
Journal Article 2024-11-07 No Snippets Kim J, Kim D, Kim DK, Lee SH, Jang W, Lim DS.
Show Full Abstract

Cell survival in metazoans depends on cell attachment to the extracellular matrix (ECM) or to neighboring cells. Loss of such attachment triggers a type of programmed cell death known as anoikis, the acquisition of resistance to which is a key step in cancer development. The mechanisms underlying anoikis resistance remain unclear, however. The intracellular F-actin cytoskeleton plays a key role in sensing the loss of cell-ECM attachment, but how its disruption affects cell fate during such stress is not well understood. Here, we reveal a cell survival strategy characterized by the formation of a giant unilocular vacuole (GUVac) in the cytoplasm of the cells whose actin cytoskeleton is disrupted during loss of matrix attachment. Time-lapse imaging and electron microscopy showed that large vacuoles with a diameter of >500 nm accumulated early after inhibition of actin polymerization in cells in suspension culture, and that these vacuoles subsequently coalesced to form a GUVac. GUVac formation was found to result from a variation of a macropinocytosis-like process, characterized by the presence of inwardly curved membrane invaginations. This phenomenon relies on both F-actin depolymerization and the recruitment of septin proteins for micron-sized plasma membrane invagination. The vacuole fusion step during GUVac formation requires PI(3)P produced by VPS34 and PI3K-C2α on the surface of vacuoles. Furthermore, its induction after loss of matrix attachment conferred anoikis resistance. Our results thus show that the formation of a previously unrecognized organelle promotes cell survival in the face of altered actin and matrix environments.

HTT
Also flagged:eIF5Amitoproteinribosomemitochondriamitochondrialtranslation factor
Journal Article 2024-11-07 ✓ 1 Snippet Barba-Aliaga M, Bernal V, Rong C, Volfbeyn ME, Zhang K, Zid BM, Alepuz P.
In-Text Gene Mentions

…replace huntingtin (htt) gene by…

Show Full Abstract

Efficient import of nuclear-encoded proteins into mitochondria is crucial for proper mitochondrial function. The conserved translation factor eIF5A binds ribosomes, alleviating stalling at polyproline-encoding sequences. eIF5A impacts mitochondrial function across species, though the precise molecular mechanism is unclear. We found that eIF5A depletion in yeast reduces the translation and levels of the TCA cycle and oxidative phosphorylation proteins. Loss of eIF5A causes mitoprotein precursors to accumulate in the cytosol and triggers a mitochondrial import stress response. We identify an essential polyproline protein as a direct target of eIF5A: the mitochondrial inner membrane protein and translocase component Tim50. Thus, eIF5A controls mitochondrial protein import by alleviating ribosome stalling along Tim50 mRNA at the mitochondrial surface. Removal of polyprolines from Tim50 partially rescues the mitochondrial import stress response and translation of oxidative phosphorylation genes. Overall, our findings elucidate how eIF5A impacts the mitochondrial function by promoting efficient translation and reducing ribosome stalling of co-translationally imported proteins, thereby positively impacting the mitochondrial import process.

HFE
Also flagged:Type 1 diabetestype 2 diabetesdiabetesdiabetes mellitusislet autoimmunityautoantibodies
Journal Article 2024-11-07 ✓ 1 Snippet Astudillo MF, Winter WE, Billings LK, Kreienkamp R, Balasubramanyam A, Redondo MJ, Tosur M, RADIANT Study Group.
In-Text Gene Mentions

…or HIV medications,hemochromatosis, Cushing syndrome, acromegaly…

Show Full Abstract

<h4>Introduction</h4>There are no established methods to identify children with atypical diabetes for further study. We aimed to develop strategies to systematically ascertain cases of atypical pediatric diabetes using electronic medical records (EMR).<h4>Research design and methods</h4>We tested two strategies in a large pediatric hospital in the USA. Strategy 1: we designed a questionnaire to rule out typical diabetes and applied it to the EMR of 100 youth with diabetes. Strategy 2: we built three electronic queries to generate reports of three atypical pediatric diabetes phenotypes: unknown type, type 2 diabetes (T2D) diagnosed <10 years old and autoantibody-negative type 1 diabetes (AbNegT1D).<h4>Results</h4>Strategy 1 identified six cases (6%) of atypical diabetes (mean diagnosis age=11±2.6 years, 16.6% men, 33% non-Hispanic white (NHW) and 66.6% Hispanic). Strategy 2: unknown diabetes type: n=68 (1%) out of 6676 patients with diabetes; mean diagnosis age=12.6±3.3 years, 32.8% men, 23.8% NHW, 47.6% Hispanic, 25.4% African American (AA), 3.2% other. T2D <10 years old: n=64 (6.6%) out of 1142 patients with T2D; mean diagnosis age=8.6±1.6 years, 20.3% men, 4.7% NHW, 65.6% Hispanic, 28.1% AA, 1.6% other. AbNegT1D: n=38 (5.6%) out of 680 patients with new onset T1D; mean diagnosis age=11.3±3.8 years; 57.9% men, 50% NHW, 19.4% Hispanic, 22.3% AA, 8.3% other.<h4>Conclusions</h4>In sum, we identified 1%-6.6% of atypical diabetes cases in a pediatric diabetes population with high racial and ethnic diversity using systematic review of the EMR. Better identification of these cases using unbiased approaches may advance precision diabetes.

Also flagged:Cancermetabolismprimary tumortumorcell proliferationdeath
Journal Article 2024-11-07 No Snippets Drapela S, Garcia BM, Gomes AP, Correia AL.
Show Full Abstract

Cancer dormancy is a phenomenon defined by the entry of cancer cells into a reversible quiescent, nonproliferative state, and represents an essential part of the metastatic cascade responsible for cancer recurrence and mortality. Emerging evidence suggests that metabolic reprogramming plays a pivotal role in enabling entry, maintenance, and exit from dormancy in the face of the different environments of the metastatic cascade. Here, we review the current literature to understand the dynamics of metabolism during dormancy, highlighting its fine-tuning by the host micro- and macroenvironment, and put forward the importance of identifying metabolic vulnerabilities of the dormant state as therapeutic targets to eradicate recurrent disease.

SOX6DCC
Also flagged:lumbar disc herniationLDHsynaptic transmissionlumbar disc herniationsDisc herniationradiculopathy
Journal Article 2024-11-07 ✓ 3 Snippets Salo V, Määttä J, Sliz E, FinnGen, Reimann E, Mägi R, Estonian Biobank Research Team, Reis K, Elhanas AG, Reigo A, Palta P, Esko T, Karppinen J, Kettunen J.
In-Text Gene Mentions

…growth factor ),DCC( DCC netrin-1…

…), DCC (DCC netrin-1 receptornetrin-1 receptor ),…

…3C ) andSOX6( SRY-box transcription…

Show Full Abstract

Given that lumbar disc herniation (LDH) is a prevalent spinal condition that causes significant individual suffering and societal costs, the genetic basis of LDH has received relatively little research. Our aim is to increase understanding of the genetic factors influencing LDH. We perform a genome-wide association analysis (GWAS) of LDH in the FinnGen project and in Estonian and UK biobanks, followed by a genome-wide meta-analysis to combine the results. In the meta-analysis, we identify 41 loci that have not been associated with LDH in prior studies on top of the 23 known risk loci. We detect LDH-associated loci in the vicinity of genes related to inflammation, disc-related structures, and synaptic transmission. Overall, our research contributes to a deeper understanding of the genetic factors behind LDH, potentially paving the way for the development of new therapeutics, prevention methods, and treatments for symptomatic LDH in the future.

SERPINC1
Also flagged:polystyrenephosphatidylcholinealbuminwaterPeptidesimmunoglobulins
Journal Article 2024-11-07 ✓ 1 Snippet Ashkarran AA, Gharibi H, Sadeghi SA, Modaresi SM, Wang Q, Lin TJ, Yerima G, Tamadon A, Sayadi M, Jafari M, Lin Z, Ritz D, Kakhniashvili D, Guha A, Mofrad MRK, Sun L, Landry MP, Saei AA, Mahmoudi M.
In-Text Gene Mentions

…For example,antithrombin-IIIin coagulation factors…

Show Full Abstract

The protein corona formed on nanoparticles (NPs) has potential as a valuable diagnostic tool for improving plasma proteome coverage. Here, we show that spiking small molecules, including metabolites, lipids, vitamins, and nutrients into plasma can induce diverse protein corona patterns on otherwise identical NPs, significantly enhancing the depth of plasma proteome profiling. The protein coronas on polystyrene NPs when exposed to plasma treated with an array of small molecules allows for the detection of 1793 proteins marking an 8.25-fold increase in the number of quantified proteins compared to plasma alone (218 proteins) and a 2.63-fold increase relative to the untreated protein corona (681 proteins). Furthermore, we discovered that adding 1000 µg/ml phosphatidylcholine could singularly enable the detection of 897 proteins. At this specific concentration, phosphatidylcholine selectively depletes the four most abundant plasma proteins, including albumin, thus reducing the dynamic range of plasma proteome and enabling the detection of proteins with lower abundance. Employing an optimized data-independent acquisition approach, the inclusion of phosphatidylcholine leads to the detection of 1436 proteins in a single plasma sample. Our molecular dynamics results reveal that phosphatidylcholine interacts with albumin via hydrophobic interactions, H-bonds, and water bridges. The addition of phosphatidylcholine also enables the detection of 337 additional proteoforms compared to untreated protein corona using a top-down proteomics approach. Given the critical role of plasma proteomics in biomarker discovery and disease monitoring, we anticipate the widespread adoption of this methodology for the identification and clinical translation of biomarkers.

B4GALT5
Also flagged:glycosyltransferaseGb3/CD77 synthaseglycosphingolipidsglycoproteinsglycansGlobotriaosylceramide
Journal Article 2024-11-07 ✓ 3 Snippets Szymczak-Kulus K, Czerwinski M, Kaczmarek R.
In-Text Gene Mentions

…B4GALT1 ) andβ1,4-galactosyltransferase 55 ( B4GALT5…

…β1,4-galactosyltransferase 5 (B4GALT5) [ 114…

…for interactions withβ1,4-galactosyltransferase 55, which is…

Show Full Abstract

Human Gb3/CD77 synthase (α1,4-galactosyltransferase, P1/P<sup>k</sup> synthase, UDP-galactose: β-D-galactosyl-β1-R 4-α-D-galactosyltransferase, EC 2.4.1.228) forms Galα1 → 4Gal structures on glycosphingolipids and glycoproteins. These glycans are recognized by bacterial adhesins and toxins. Globotriaosylceramide (Gb3), the major product of Gb3/CD77 synthase, is a glycosphingolipid located predominantly in plasma membrane lipid rafts, where it serves as a main receptor for Shiga toxins released by enterohemorrhagic Escherichia coli and Shigella dysenteriae of serotype 1. On the other hand, accumulation of glycans formed by Gb3/CD77 synthase contributes to the symptoms of Anderson-Fabry disease caused by α-galactosidase A deficiency. Moreover, variation in Gb3/CD77 synthase expression and activity underlies the P1PK histo-blood group system. Glycosphingolipids synthesized by the enzyme are overproduced in colorectal, gastric, pancreatic, and ovarian cancer, and elevated Gb3 biosynthesis is associated with cancer cell chemo- and radioresistance. Furthermore, Gb3/CD77 synthase acts as a key glycosyltransferase modulating ovarian cancer cell plasticity. Here, we describe the role of human Gb3/CD77 synthase and its products in the P1PK histo-blood group system, Anderson-Fabry disease, and bacterial infections. Additionally, we provide an overview of emerging evidence that Gb3/CD77 synthase and its glycosphingolipid products are involved in cancer metastasis and chemoresistance.

Also flagged:Hemophagocytic lymphohistiocytosiscytokineimmune responsecytokine stormemapalumabinterferon-γ
Journal Article 2024-11-07 No Snippets Wu Y, Sun X, Kang K, Yang Y, Li H, Zhao A, Niu T.
Show Full Abstract

Hemophagocytic lymphohistiocytosis (HLH) is a rapidly progressing, life-threatening syndrome characterized by excessive immune activation, often presenting as a complex cytokine storm. This hyperactive immune response can lead to multi-organ failure and systemic damage, resulting in an extremely short survival period if left untreated. Over the past decades, although HLH has garnered increasing attention from researchers, there have been few advancements in its treatment. The cytokine storm plays a crucial role in the treatment of HLH. Investigating the detailed mechanisms behind cytokine storms offers insights into targeted therapeutic approaches, potentially aiding in early intervention and improving the clinical outcome of HLH patients. To date, there is only one targeted therapy, emapalumab targeting interferon-γ, that has gained approval for primary HLH. This review aims to summarize the current treatment advances, emerging targeted therapeutics and underlying mechanisms of HLH, highlighting its newly discovered targets potentially involved in cytokine storms, which are expected to drive the development of novel treatments and offer fresh perspectives for future studies. Besides, multi-targeted combination therapy may be essential for disease control, but further trials are required to determine the optimal treatment mode for HLH.

HTT
Also flagged:corticosteroneanxietydepressionglucocorticoidsmajor depressionmetabolism
Journal Article 2024-11-07 ✓ 1 Snippet Shoji H, Maeda Y, Miyakawa T.
In-Text Gene Mentions

…The behavioral characteristics, i.e., reduced duration of active contacts, increased mean duration per contact, and decreased distance traveled, were seen in5-HTT−/−mice, which are considered as an animal model for depression [ 60 ].…

Show Full Abstract

Chronic exposure to glucocorticoids in response to long-term stress is thought to be a risk factor for major depression. Depression is associated with disturbances in the gut microbiota composition and peripheral and central energy metabolism. However, the relationship between chronic glucocorticoid exposure, the gut microbiota, and brain metabolism remains largely unknown. In this study, we first investigated the effects of chronic corticosterone exposure on various domains of behavior in adult male C57BL/6J mice treated with the glucocorticoid corticosterone to evaluate them as an animal model of depression. We then examined the gut microbial composition and brain and plasma metabolome in corticosterone-treated mice. Chronic corticosterone treatment resulted in reduced locomotor activity, increased anxiety-like and depression-related behaviors, decreased rotarod latency, reduced acoustic startle response, decreased social behavior, working memory deficits, impaired contextual fear memory, and enhanced cued fear memory. Chronic corticosterone treatment also altered the composition of gut microbiota, which has been reported to be associated with depression, such as increased abundance of Bifidobacterium, Turicibacter, and Corynebacterium and decreased abundance of Barnesiella. Metabolomic data revealed that long-term exposure to corticosterone led to a decrease in brain neurotransmitter metabolites, such as serotonin, 5-hydroxyindoleacetic acid, acetylcholine, and gamma-aminobutyric acid, as well as changes in betaine and methionine metabolism, as indicated by decreased levels of adenosine, dimethylglycine, choline, and methionine in the brain. These results indicate that mice treated with corticosterone have good face and construct validity as an animal model for studying anxiety and depression with altered gut microbial composition and brain metabolism, offering new insights into the neurobiological basis of depression arising from gut-brain axis dysfunction caused by prolonged exposure to excessive glucocorticoids.

TNFSF4
Also flagged:N6-methyladenosinehepatocellular carcinomamethylationsorafenibgemcitabineCTLA4
Journal Article 2024-11-07 ✓ 1 Snippet Yan X, Qi Y, Yao X, Yin L, Wang H, Fu J, Wan G, Gao Y, Zhou N, Ye X, Liu X, Chen X.
In-Text Gene Mentions

…with immune checkpointsTNFSF4and CTLA4, and…

Show Full Abstract

<h4>Background</h4>Accurately identifying effective biomarkers and translating them into clinical practice have significant implications for improving clinical outcomes in hepatocellular carcinoma (HCC). In this study, our objective is to explore appropriate methods to improve the accuracy of biomarker identification and investigate their clinical value.<h4>Methods</h4>Concentrating on the N6-methyladenosine (m6A) modification regulators, we utilized dozens of multi-omics HCC datasets to analyze the expression patterns and genetic features of m6A regulators. Through the integration of big data analysis with function experiments, we have redefined the biological roles of m6A regulators in HCC. Based on the key regulators, we constructed m6A risk models and explored their clinical value in estimating prognosis and guiding personalized therapy for HCC.<h4>Results</h4>Most m6A regulators exhibit abnormal expression in HCC, and their expression is influenced by copy number variations (CNV) and DNA methylation. Large-scale data analysis has revealed the biological roles of many key m6A regulators, and these findings are well consistent with experimental results. The m6A risk models offer significant prognostic value. Moreover, they assist in reassessing the therapeutic potential of drugs such as sorafenib, gemcitabine, CTLA4 and PD1 blockers in HCC.<h4>Conclusions</h4>Our findings suggest that the mutual validation of big data analysis and functional experiments may facilitate the precise identification and definition of biomarkers, and our m6A risk models may have the potential to guide personalized chemotherapy, targeted treatment, and immunotherapy decisions in HCC.

Also flagged:VisionOptic NeuritisFlashTRIM46CSFNystagmus
Journal Article 2024-11-07 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

HFE
Also flagged:Semaglutidetype 2 diabetes mellitustestosteronehypogonadismFHtype 2 diabetes
Journal Article 2024-11-07 ✓ 1 Snippet Gregorič N, Šikonja J, Janež A, Jensterle M.
In-Text Gene Mentions

…or secondary hypogonadism,hemochromatosis, active malignant disease,…

Show Full Abstract

<h4>Aims</h4>To compare the effects of semaglutide and testosterone replacement therapy (TRT) on semen quality and parameters of functional hypogonadism (FH) in men with type 2 diabetes mellitus and obesity.<h4>Materials and methods</h4>We designed a randomised open-label trial in 25 men with type 2 diabetes (aged 50 [46-60] years, BMI 35.9 [32.8-38.7] kg/m<sup>2</sup>) and FH randomised to semaglutide (SEMA) 1 mg/week or intramuscular testosterone undecanoate (TRT) 1000 mg/10-12 weeks for 24 weeks. Semen analysis and parameters of FH were measured at baseline and after 24 weeks of treatment. Participants completed questionnaires of the International Index of Erectile Function-15 (IIEF-15) and the Aging Symptoms in Men (AMS).<h4>Results</h4>The quality of baseline sperm parameters of our study cohort was poor, below the 5th percentile of reference values. In the SEMA group, there was a significant increase in morphologically normal sperm from baseline to the end of the study (2% [2; 3.5] vs. 4% [2; 5.5]; p = 0.012), whereas sperm concentration and total number decreased significantly in the TRT group. Compared to TRT, the SEMA group had a significantly higher number of morphologically normal sperm, sperm concentration and total number. Both groups experienced an increase in total testosterone and improvement in the AMS score, whereas the IIEF-15 score significantly improved only in the TRT group.<h4>Conclusion</h4>Semaglutide markedly improved sperm morphology, total testosterone levels and symptoms of hypogonadism. These findings highlight semaglutide's potential as a therapeutic approach for men with obesity-related FH who desire fertility.<h4>Clinical trial registration number</h4>NCT06489457, www.<h4>Clinicaltrials</h4>gov.

OLFM4
Also flagged:Stem Cell Differentiationirritable bowel syndromeIBSpathogenesisvirus infectioneIF3
Journal Article 2024-11-07 ✓ 2 Snippets Zhao B, Ye J, Zhao W, Liu X, Lan H, Sun J, Chen J, Cai X, Wei Q, Zhou Q, Zhang Z, Wu Y, Yang Y, Cao P.
In-Text Gene Mentions

…of olfactomedin 4 (Olfm4)-positive stem cells in…

…Additionally, immunofluorescence analysis revealed that ginger intake markedly reduced the number of Ki67 proliferating cells (transit-amplifying zone-Ki67 + ) in the intestinal recess but did not affect the number ofolfactomedin 4 (Olfm4)-positive stem cellsin the intestinal recess (Fig. 1 L and M and Figs. S3 C and S4 G and H).…

Show Full Abstract

Dietary factors play a crucial role in irritable bowel syndrome (IBS) pathogenesis. Therefore, the dietary contraindications for patients with IBS require further supplementation. Recent investigations have revealed that ginger consumption may pose a risk of aggravating the symptoms and incidence of IBS; however, the specific mechanism remains unknown. In this study, we developed experimental IBS and intestinal organoid differentiation screening models to elucidate the mechanisms underlying the ginger-mediated exacerbation of IBS symptoms. Subsequently, we used a knockout approach combined with click chemistry as well as virus infection to identify the toxic components of ginger and the target mechanism. Our results showed that a daily intake of 90 to 300 mg/kg ginger (equivalent to a human daily dose of 0.6 to 2 g per person) may pose a risk of exacerbating IBS symptoms. Furthermore, a component derived from 6-gingerol (ginger's main ingredient) through in vivo gastric acid and heat processing inhibited the formation of the eIF3 transcription initiation complex by covalently binding to the Cys<sup>58</sup> site of eIF3A, a key factor regulating intestinal crypt stem cell differentiation, further reducing the goblet cell number and related mucus layer thickness and increasing lipopolysaccharide infiltration and low-grade inflammation in the ileum crypts, thereby exacerbating the symptoms of IBS in mice. Our study suggests that dietary ginger aggravates IBS and provides safety evaluation methods for the proper use of foods in specific populations.

Also flagged:SynthesisTricalciumPhosphatecalciumtricalcium phosphatewound healing
Journal Article 2024-11-07 No Snippets Oladele IO, Adekola SA, Agbeboh NI, Isola-Makinde BA, Adewuyi BO.
Show Full Abstract

Trends in health care delivery systems have shifted as a result of the modern uses of biomaterials in medicine. Contrary to traditional medicine, modern healthcare are now useful in solving problems that were considered impossible some years back. One of the most significant factors to the most recent advancements in implant development has been the use of calcium based materials in the creation of necessary implants in the form of soft and hard tissues. With the advent of naturally sourced materials in the manufacturing of biomaterials, lots of attention are now focused on the different sources of agro-based resources that can be used for the product developments. These agro-based materials are now been considered for sustainable and ecological purposes in several areas of applications globally in the recent times. Hence, the review was carried out with focus on the sources, relevance, processing techniques and applications of tricalcium phosphate based biomaterials in modern day healthcare delivery. This review provides a historical and prospective picture of the crucial functions that materials based on tricalcium phosphate will play in fulfilling human requirements for medication.

HFE
Also flagged:pernicious anemiaautoimmune hepatitisanemiaviral hepatitisantibodyantibodies
Journal Article 2024-11-07 ✓ 1 Snippet Ibrahim Siddiqui A, Luqman M, Mustafa Siddiqui A, Bin Aijaz A, Zuberi MAW, Abdul Rauf S, Shah HH.
In-Text Gene Mentions

…conditions such ashemochromatosisor Wilson disease.…

Show Full Abstract

This is a case of probable pernicious anemia in the setting of autoimmune hepatitis. A 55-year-old male patient presented to the Emergency Room at Dr. Ruth K.M. Pfau Civil Hospital, Karachi with complaints of diarrhea and fever and was subsequently transferred to the medicine ward. The patient also had signs of unexplained anemia. We performed laboratory tests and were able to rule out the common causes of liver pathology, including viral hepatitis. For blood, the values showed decreased hemoglobin levels and an elevated Mean corpuscular hemoglobin (MCH) and mean corpuscular volume (MCV) (114 fL), indicating macrocytosis. Finally, we were able to conclude autoimmune pathology after the results of antibody testing demonstrated positive lab values for anti-smooth muscle antibodies, antinuclear antibodies, and anti-gastric parietal cell antibodies. The patient had developed pernicious anemia in the setting of autoimmune hepatitis, which is an extremely rare case and documented instances are scarce in the available literature regarding such cases.

PEBP1
Also flagged:FerroptosisOsteoarthritisOAdegenerative diseasechondrocyte senescencemetabolism
Journal Article 2024-11-07 ✓ 1 Snippet Liu Y, Zhang Z, Fang Y, Liu C, Zhang H.
In-Text Gene Mentions

…holipid; ALOXs, lipoxygenases;PEBP1, phosphatidylethanolamine bin…

Show Full Abstract

Osteoarthritis (OA) is a prevalent degenerative disease in elderly people that is characterized by cartilage loss and abrasion, leading to joint pain and dysfunction. The aetiology of OA is complicated and includes abnormal mechanical stress, a mild inflammatory environment, chondrocyte senescence and apoptosis, and changes in chondrocyte metabolism. Ferroptosis is a regulated cell death modality characterized by the excessive accumulation of lipid peroxidation and mitochondrial dysfunction. The role of ferroptosis in OA pathogenesis has aroused researchers' attention in the past two years, and there is mounting evidence indicating that ferroptosis is destructive. However, the impact of ferroptosis on OA and how the regulators of ferroptosis affect OA development are unclear. Here, we reviewed the current understanding of ferroptosis in OA pathogenesis and summarized several drugs and compounds targeting ferroptosis in OA treatment. The accumulation of intracellular iron, the trigger of Fenton reaction, the excessive production of ROS, the peroxidation of PUFA-PLs, and mitochondrial and membrane damage are involved in chondrocyte ferroptosis. System X<sub>c</sub> <sup>-</sup> and GPX4 are the most important regulators that control ferroptosis. Several compounds, such as DFO and Fer-1, have been proven effective in preventing ferroptosis and slowing OA progression on animal models. Collectively, targeting ferroptosis shows great potential in treating OA.

TNFSF4
Also flagged:Feveracute viral infectioninfectioncytokineinflammatory responsecoagulation
Journal Article 2024-11-07 ✓ 1 Snippet Zhang Y, Sun Q, Liu T, Chang C, Chen X, Duan Q, Wen Z, Zhang X, Pang B, Jiang X.
In-Text Gene Mentions

…JUNB, SOCS1, IFNG,TNFSF4, NFKBIZ , and…

Show Full Abstract

<h4>Purpose</h4>Severe fever with thrombocytopenia syndrome (SFTS) is an acute viral infection disease with a high mortality, but there are no specific effective drugs or vaccines available for use. To develop effective treatment methods, more basic researches are urgently needed to elucidate the response mechanisms of patients.<h4>Patients and methods</h4>Here, we conducted the transcriptomic analysis of peripheral immunity in 14 SFTS patients, ranging from moderate infection to severe and fatal disease.<h4>Results</h4>The results showed orderly cytokine signaling pathway modulation in moderate patients, cellular immunosuppression in severe patients, and significant dysregulation of the inflammatory response and coagulation dysfunction characteristic of deceased patients. In addition, WGCNA further showed a significant positive correlation between fatal outcomes and B cell and immunoglobulin mediated immune function modules, as well as a significant negative correlation with coagulation function modules.<h4>Conclusion</h4>Overall, our research findings systematically observed potential immune mechanisms underlying clinical symptom heterogeneity and noteworthily revealed multiple signaling pathways leading to coagulation dysfunction in fatal outcomes, not just related to decreased platelet count, which can further elucidate the interaction between viruses and hosts and contribute to clinical treatment.

Also flagged:hematological diseasesleukemialymphomamyelodysplastic syndromemultiple myelomamyeloproliferative neoplasms
Journal Article 2024-11-07 No Snippets Wang SX, Huang ZF, Li J, Wu Y, Du J, Li T.
Show Full Abstract

<h4>Background</h4>Optimizing the diagnosis and treatment of hematological diseases is a challenging yet crucial research area. Effective treatment plans typically require the comprehensive integration of cell morphology, immunology, cytogenetics, and molecular biology. These plans also consider patient-specific factors such as disease stage, age, and genetic mutation status. With the advancement of artificial intelligence (AI), more "AI + medical" application models are emerging. In clinical practice, many AI-assisted systems have been successfully applied to the diagnosis and treatment of hematological diseases, enhancing precision and efficiency and offering valuable solutions for clinical practice.<h4>Objective</h4>This study summarizes the research progress of various AI-assisted systems applied in the clinical diagnosis and treatment of hematological diseases, with a focus on their application in morphology, immunology, cytogenetics, and molecular biology diagnosis, as well as prognosis prediction and treatment.<h4>Methods</h4>Using PubMed, Web of Science, and other network search engines, we conducted a literature search on studies from the past 5 years using the main keywords "artificial intelligence" and "hematological diseases." We classified the clinical applications of AI systems according to the diagnosis and treatment. We outline and summarize the current advancements in AI for optimizing the diagnosis and treatment of hematological diseases, as well as the difficulties and challenges in promoting the standardization of clinical diagnosis and treatment in this field.<h4>Results</h4>AI can significantly shorten turnaround times, reduce diagnostic costs, and accurately predict disease outcomes through applications in image-recognition technology, genomic data analysis, data mining, pattern recognition, and personalized medicine. However, several challenges remain, including the lack of AI product standards, standardized data, medical-industrial collaboration, and the complexity and non-interpretability of AI systems. In addition, regulatory gaps can lead to data privacy issues. Therefore, more research and improvements are needed to fully leverage the potential of AI to promote standardization of the clinical diagnosis and treatment of hematological diseases.<h4>Conclusion</h4>Our results serve as a reference point for the clinical diagnosis and treatment of hematological diseases and the development of AI-assisted clinical diagnosis and treatment systems. We offer suggestions for further development of AI in hematology and standardization of clinical diagnosis and treatment.

Also flagged:Amyotrophic lateral sclerosisALS-onsetDeathmetabolismgene expression
Journal Article 2024-11-07 No Snippets Dash BP, Freischmidt A, Helferich AM, Ludolph AC, Andersen PM, Weishaupt JH, Hermann A.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a fatal, adult-onset disease marked by a progressive degeneration of motor neurons (MNs) present in the spinal cord, brain stem and motor cortex. Death in most patients usually occurs within 2-4 years after symptoms onset. Despite promising progress in delineating underlying mechanisms, such as disturbed proteostasis, DNA/RNA metabolism, splicing or proper nucleocytoplasmic shuttling, there are no effective therapies for the vast majority of cases. A reason for this might be the disease heterogeneity and lack of substantial clinical and molecular biomarkers. The identification and validation of such pathophysiology driven biomarkers could be useful for early diagnosis and treatment stratification. Recent advances in next generation RNA-sequencing approaches have provided important insights to identify key changes of non-coding RNAs (ncRNAs) implicated with ALS disease. Especially, microRNAs (miRNAs) have emerged as key post-transcriptional regulators of gene expression to target several genes/pathways by degrading messenger RNAs (mRNAs) or repressing levels of gene expression. In this study, we expand our previous work to identify top-regulated differentially expressed (DE)-miRNAs by combining different normalizations to search for important and generalisable pathomechanistic dysregulations in ALS as putative novel biomarkers of the disease. For this we performed a consensus pipeline of existing datasets to investigate the transcriptomic profile (mRNAs and miRNAs) of MN cell lines from iPSC-derived <i>SOD1</i>- and <i>TARDBP</i> (TDP-43 protein)-mutant-ALS patients and healthy controls to identify potential signatures and their related pathways associated with neurodegeneration. Transcriptional profiling of miRNA-mRNA interactions from MN cell lines in ALS patients revealed differential expression of genes showed greater vulnerability to KEAP1-NRF2 stress response pathway, sharing a common molecular denominator linked to both disease conditions. We also reported that mutations in above genes led to significant upregulation of the top candidate miR-10b-5p, which we could validate in immortalized lymphoblast cell lines (LCLs) derived from sporadic and familial ALS patients and postmortem tissues of familial ALS patients. Collectively, our findings suggest that miRNA analysis simultaneously performed in various human biological samples may reveal shared miRNA profiles potentially useful as a biomarker of the disease.

MRPL39
Also flagged:chromosomeneurocognitive impairmentsdevelopmental delayscongenital heart defectsagingmitochondrial
Journal Article 2024-11-07 ✓ 1 Snippet Mouli K, Liopo AV, Suva LJ, Olson KR, McHugh EA, Tour JM, Derry PJ, Kent TA.
In-Text Gene Mentions

…peptide synthesis (MRPL39, MRPS6 ),…

Show Full Abstract

Down syndrome (DS) is a multisystemic disorder that includes accelerated aging caused by trisomy 21. In particular, overexpression of cystathionine-β-synthase (CBS) is linked to excess intracellular hydrogen sulfide (H<sub>2</sub>S), a mitochondrial toxin at higher concentrations, which impairs cellular viability. Concurrent overexpression of superoxide dismutase 1 (SOD1) may increase oxidative stress by generating excess hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) while also mitigating the toxic H<sub>2</sub>S burden via a non-canonical sulfide-oxidizing mechanism. We investigated the phenotypic variability in basal H<sub>2</sub>S levels in relation to DS B lymphocyte cell health and SOD1 in H<sub>2</sub>S detoxification. The H<sub>2</sub>S levels were negatively correlated with the DS B lymphocyte growth rates but not with CBS protein. Pharmacological inhibition of SOD1 using LCS-1 significantly increased the H<sub>2</sub>S levels to a greater extent in DS cells while also decreasing the polysulfide products of H<sub>2</sub>S oxidation. However, DS cells exhibited elevated H<sub>2</sub>O<sub>2</sub> and lipid peroxidation, representing potential toxic consequences of SOD1 overexpression. Treatment of DS cells with a pleiotropic carbon nanozyme (pleozymes) decreased the total oxidative stress and reduced the levels of the H<sub>2</sub>S-generating enzymes CBS and 3-mercaptopyruvate sulfurtransferase (MPST). Our results indicate that pleozymes may bridge the protective and deleterious effects of DS SOD1 overexpression on H<sub>2</sub>S metabolism and oxidative stress, respectively, with cytoprotective benefits.

Also flagged:LipidGlycanglycoproteinsglycolipidsglycocalyxsugar
Journal Article 2024-11-07 No Snippets Zhong X, D'Antona AM, Rouse JC.
Show Full Abstract

Glycan structures of glycoproteins and glycolipids on the surface glycocalyx and luminal sugar layers of intracellular membrane compartments in human cells constitute a key interface between intracellular biological processes and external environments. Sialic acids, a class of alpha-keto acid sugars with a nine-carbon backbone, are frequently found as the terminal residues of these glycoconjugates, forming the critical components of these sugar layers. Changes in the status and content of cellular sialic acids are closely linked to many human diseases such as cancer, cardiovascular, neurological, inflammatory, infectious, and lysosomal storage diseases. The molecular machineries responsible for the biosynthesis of the sialylated glycans, along with their biological interacting partners, are important therapeutic strategies and targets for drug development. The purpose of this article is to comprehensively review the recent literature and provide new scientific insights into the mechanisms and therapeutic implications of sialylation in glycoproteins and glycolipids across various human diseases. Recent advances in the clinical developments of sialic acid-related therapies are also summarized and discussed.

CA10
Also flagged:gene expressionviral infectionNewcastle diseaseinfectionpoultryinflammatory response
Journal Article 2024-11-07 ✓ 1 Snippet Mears MC, Bakre A.
In-Text Gene Mentions

…carbonic anhydrase X (CA10) [ 83 ],…

Show Full Abstract

Post-transcriptional gene regulation mediated by microRNAs (miRNAs) relies on sequence complementarity between the miRNA seed site and the target gene transcript(s). This complementarity can completely inhibit or reduce translation into protein. We hypothesized that viruses employ sequence complementarity/similarity with host miRNAs to inhibit or increase the miRNA-mediated regulation of host gene expression specifically during viral infection(s). In this study, we focus on <i>Orthoavulavirus javaense</i> (OAVJ), the causative of Newcastle disease, a poultry disease with significant economic impact. A computational analysis of OAVJ genomes from low-virulence (lentogenic) versus virulent (velogenic) viruses was carried out to identify viral signature motifs that potentially either mimic or complement host miRNA seed sequences. Data show that OAVJ genomes harbor viral seed mimics (vSMs) or viral seed sponges (vSSs) and can mimic host miRNAs or inhibit their regulation of host genes, disrupting cellular pathways. Our analyses showed that velogens encode a statistically significant higher number of vSMs and a lower number of vSSs relative to lentogens. The number of vSMs or vSSs did not correlate with gene length. The analysis of the secondary structures flanking these vSMs and vSSs showed structural features common to miRNA precursors. The inhibition or upregulation of vSS-miR-27b-5p altered P gene expression in a sequence-dependent manner. These data demonstrate that viral transcripts can interact with host miRNAs to alter the outcomes of infection.

CACNA1E
Also flagged:NUP214Fetal Hydropsnuclear pore complexnucleoporincytoplasmacute infection-induced encephalopathy type 9
Journal Article 2024-11-07 ✓ 1 Snippet Tamhankar V, Patel SJ, Kachhadiya T, Vaniawala S, Patel J, Bhammar R, Patel S, Vaniawala S, Menon P, Tamhankar PM.
In-Text Gene Mentions

…ADGRG6, AGRN, BIN1,CACNA1E, CASK, CFL2, CHAT,…

Show Full Abstract

The <i>NUP214</i> gene encodes a nuclear pore complex protein (nucleoporin, 214 kilodaltons) which plays a critical role in messenger RNA export to the cytoplasm and import of substrates from the cytoplasm. Biallelic mutations in the <i>NUP214</i> gene have been associated with susceptibility to acute infection-induced encephalopathy type 9 (ILAE9) (Online Mendelian Inheritance in Man (OMIM), 114350), an autosomal recessive disorder. Herein, we describe for the first time, a fetus with hydrops and arthrogryposis multiplex with a homozygous novel consensus splice site variant in the NUP214 gene, chr9:g.131127522A>G or c.46-2A>G (transcript ID NM_005085.4). Parents were heterozygous for the same variant. Mutations in either of 83 genes have been previously published to cause fetal arthrogryposis multiplex but mutations in <i>NUP214</i> have not been previously reported as per our search in the available medical literature (PubMed/MEDLINE (Medical Literature Analysis and Retrieval System Online) and Google Scholar). STRING (Search Tool for Retrieval of Interacting Genes/Proteins) analysis showed close interactions between <i>NUP214</i> and the other proteins GLE1, NUP88, NEK9, and THOC2. Thus, this case report expands the phenotype of <i>NUP214</i> gene-related human disease.

CDK5RAP1
Also flagged:CPT1fatty acidcarnitine palmitoyltransferase 1myocardial infarctionpoly(ADP-ribose) polymerase 1ADP-ribosylation
Journal Article 2024-11-07 ✓ 1 Snippet Tang L, Shi Y, Liao Q, Wang F, Wu H, Ren H, Wang X, Fu W, Shou J, Wang WE, Jose PA, Yang Y, Zeng C.
In-Text Gene Mentions

…Cdkn1b andCdk5rap1( Fig. 6…

Show Full Abstract

The neonatal mammalian heart has a remarkable regenerative capacity, while the adult heart has difficulty to regenerate. A metabolic reprogramming from glycolysis to fatty acid oxidation occurs along with the loss of cardiomyocyte proliferative capacity shortly after birth. In this study, we sought to determine if and how metabolic reprogramming regulates cardiomyocyte proliferation. Reversing metabolic reprogramming by carnitine palmitoyltransferase 1 (CPT1) inhibition, using cardiac-specific <i>Cpt1a</i> and <i>Cpt1b</i> knockout mice promoted cardiomyocyte proliferation and improved cardiac function post-myocardial infarction. The inhibition of CPT1 is of pharmacological significance because those protective effects were replicated by etomoxir, a CPT1 inhibitor. CPT1 inhibition, by decreasing poly(ADP-ribose) polymerase 1 expression, reduced ADP-ribosylation of dual-specificity phosphatase 1 in cardiomyocytes, leading to decreased p38 MAPK phosphorylation, and stimulation of cardiomyocyte proliferation. Our present study indicates that reversing metabolic reprogramming is an effective strategy to stimulate adult cardiomyocyte proliferation. CPT1 is a potential therapeutic target for promoting heart regeneration and myocardial infarction treatment.

bioRxiv 2024-11-07 Preprint (No Snippets API) Lozano-Muñoz D, Elorza A, Mayor L, Santos-Galindo M, Lucas-Santamaría M, Parras A, Lucas JJ.
Show Full Abstract

RNA mis-splicing correction therapies have been developed for neurological disorders like spinal muscular atrophy and neuronal ceroid lipofuscinosis. In Huntington’s disease (HD), pathogenic mis-splicing was initially observed in genes linked to neurodegeneration, such as HTT itself, MAPT , and TAF1 . Later, genome-wide analyses identified a broader mis-splicing signature in HD brains, involving additional neurodegeneration-related genes. Correcting each mis-spliced gene individually would be unfeasible, highlighting the need to target upstream splicing factors altered in HD. Our previous motif-enrichment analyses of intronic sequences flanking the exons mis-spliced in HD identified RBFOX and U2AF2 as candidate splicing factors, both of which are reduced in HD brains. In this study, we tested their pathogenic relevance generating conditional transgenic mouse models that overexpress RBFOX1 or U2AF2 in forebrain neurons and combining them with HD mice. Our results show that moderate overexpression of RBFOX1, but not U2AF2, corrects multiple HD-associated mis-splicing events and alleviates HD mice neuropathology and motor symptoms. These findings demonstrate that RBFOX1 downregulation contributes to HD pathology and underscore the therapeutic potential of strategies aimed at increasing RBFOX1 levels.

DCC
Also flagged:Polyketideleinamycinpolyketidesbiosynthesissulfurpolyketide synthase
Journal Article 2024-11-06 ✓ 5 Snippets Phillips AP, Winter AJ, Hooper CM, Williams C, Crosby J, Willis CL, Crump MP.
In-Text Gene Mentions

…prime it forDCC.…

…by malonyl-WsmR ACP8,DCCdid not occur…

…gave no observableDCCproduct ( Figure…

…the lack ofDCCin the presence…

…time, showing thatDCCand β-branching in…

Show Full Abstract

The leinamycin family of polyketides are promising antitumor antibiotics, yet several aspects of their biosynthesis remain elusive. All leinamycin family members bear a sulfur-containing moiety which is essential for the anticancer activity exhibited by leinamycin. The key building blocks required for the incorporation of these functionalities are introduced in the final module of the polyketide synthase (PKS), which elegantly combines β-branching and thiocysteine incorporation to generate a diverse library of sulfur-based molecular scaffolds. Two acyl carrier proteins (ACPs) form a key didomain component of this module, but their amino acid sequence divergence has brought into question the common notion of functional equivalence. Here, we provide unprecedented functional evidence that these tandem ACPs play distinct roles in the final module of polyketide assembly. Using the weishanmycin biosynthetic pathway as a template, the in vitro reconstitution of key polyketide chain extension and β-branching steps in this module has revealed strict functional selectivity for a single ACP. Furthermore, we propose a cryptic transacylation step must occur prior to polyketide off-loading and cyclization. Altogether, these mechanistic investigations suggest that an atypical in-series mechanism underpins sulfur incorporation in the leinamycin family, and provides significant progress towards delineating their late-stage assembly.

BTN2A2HFE
Also flagged:G-ProteinAlzheimer's DiseaseADGNAI1GNB1KNG1
Journal Article 2024-11-06 ✓ 2 Snippets Zhang DF, Penwell T, Chen YH, Koehler A, Wu R, Nik Akhtar S, Lu Q.
In-Text Gene Mentions

HFE

BTN2A2

Show Full Abstract

Systemic study of pathogenic pathways and interrelationships underlying genes associated with Alzheimer's disease (AD) facilitates the identification of new targets for effective treatments. Recently available large-scale multiomics datasets provide opportunities to use computational approaches for such studies. Here, we devised a novel <u>di</u>sease <u>g</u>ene <u>id</u>entification (digID) computational framework that consists of a semi-supervised deep learning classifier to predict AD-associated genes and a protein-protein interaction (PPI) network-based analysis to prioritize the importance of these predicted genes in AD. digID predicted 1,529 AD-associated genes and revealed potentially new AD molecular mechanisms and therapeutic targets including GNAI1 and GNB1, two G-protein subunits that regulate cell signaling, and KNG1, an upstream modulator of CDC42 small G-protein signaling and mediator of inflammation and candidate coregulator of amyloid precursor protein (APP). Analysis of mRNA expression validated their dysregulation in AD brains but further revealed the significant spatial patterns in different brain regions as well as among different subregions of the frontal cortex and hippocampi. Super-resolution STochastic Optical Reconstruction Microscopy (STORM) further demonstrated their subcellular colocalization and molecular interactions with APP in a transgenic mouse model of both sexes with AD-like mutations. These studies support the predictions made by digID while highlighting the importance of concurrent biological validation of computationally identified gene clusters as potential new AD therapeutic targets.

RC3H1
Also flagged:degradationbindingnucleotideRoquinRNA‐binding proteinstrinucleotide
Journal Article 2024-11-06 ✓ 1 Snippet Oberstrass L, Tants JN, Lichtenthaeler C, Ali SE, Koch L, Mathews DH, Schlundt A, Weigand JE.
In-Text Gene Mentions

…proteins (encoded byRC3H1and RC3H2 )…

Show Full Abstract

The cellular levels of mRNAs are controlled post-transcriptionally by cis-regulatory elements located in the 3'-untranslated region. These linear or structured elements are recognized by RNA-binding proteins (RBPs) to modulate mRNA stability. The Roquin-1 and -2 proteins specifically recognize RNA stem-loop motifs, the trinucleotide loop-containing constitutive decay elements (CDEs) and the hexanucleotide loop-containing alternative decay elements (ADEs), with their unique ROQ domain to initiate mRNA degradation. However, the RNA-binding capacity of Roquin towards different classes of stem-loops has not been rigorously characterized, leaving its exact binding preferences unclear. Here, we map the RNA-binding preference of the ROQ domain at nucleotide resolution introducing sRBNS (structured RNA Bind-n-Seq), a customized RBNS workflow with pre-structured RNA libraries. We found a clear preference of Roquin towards specific loop sizes and extended the consensus motifs for CDEs and ADEs. The newly identified motifs are recognized with nanomolar affinity through the canonical RNA-ROQ interface. Using these new stem-loop variants as blueprints, we predicted novel Roquin target mRNAs and verified the expanded target space in cells. The study demonstrates the power of high-throughput assays including RNA structure formation for the systematic investigation of (structural) RNA-binding preferences to comprehensively identify mRNA targets and elucidate the biological function of RBPs.

Also flagged:protein degradationproteasomeproteolysiscancerchronic myeloid leukemiaCML
Journal Article 2024-11-06 No Snippets Zhong G, Chang X, Xie W, Zhou X.
Show Full Abstract

Targeted protein degradation (TPD) represents a revolutionary therapeutic strategy in disease management, providing a stark contrast to traditional therapeutic approaches like small molecule inhibitors that primarily focus on inhibiting protein function. This advanced technology capitalizes on the cell's intrinsic proteolytic systems, including the proteasome and lysosomal pathways, to selectively eliminate disease-causing proteins. TPD not only enhances the efficacy of treatments but also expands the scope of protein degradation applications. Despite its considerable potential, TPD faces challenges related to the properties of the drugs and their rational design. This review thoroughly explores the mechanisms and clinical advancements of TPD, from its initial conceptualization to practical implementation, with a particular focus on proteolysis-targeting chimeras and molecular glues. In addition, the review delves into emerging technologies and methodologies aimed at addressing these challenges and enhancing therapeutic efficacy. We also discuss the significant clinical trials and highlight the promising therapeutic outcomes associated with TPD drugs, illustrating their potential to transform the treatment landscape. Furthermore, the review considers the benefits of combining TPD with other therapies to enhance overall treatment effectiveness and overcome drug resistance. The future directions of TPD applications are also explored, presenting an optimistic perspective on further innovations. By offering a comprehensive overview of the current innovations and the challenges faced, this review assesses the transformative potential of TPD in revolutionizing drug development and disease management, setting the stage for a new era in medical therapy.

Also flagged:Cancercell growthtumorstumortranslationalextracellular
Journal Article 2024-11-06 No Snippets Singh P, Pandit S, Balusamy SR, Madhusudanan M, Singh H, Amsath Haseef HM, Mijakovic I.
Show Full Abstract

Cancer remains one of the most challenging health issues globally, demanding innovative therapeutic approaches for effective treatment. Nanoparticles, particularly those composed of gold, silver, and iron oxide, have emerged as promising candidates for changing cancer therapy. This comprehensive review demonstrates the landscape of nanoparticle-based oncological interventions, focusing on the remarkable advancements and therapeutic potentials of gold, silver, and iron oxide nanoparticles. Gold nanoparticles have garnered significant attention for their exceptional biocompatibility, tunable surface chemistry, and distinctive optical properties, rendering them ideal candidates for various cancer diagnostic and therapeutic strategies. Silver nanoparticles, renowned for their antimicrobial properties, exhibit remarkable potential in cancer therapy through multiple mechanisms, including apoptosis induction, angiogenesis inhibition, and drug delivery enhancement. With their magnetic properties and biocompatibility, iron oxide nanoparticles offer unique cancer diagnosis and targeted therapy opportunities. This review critically examines the recent advancements in the synthesis, functionalization, and biomedical applications of these nanoparticles in cancer therapy. Moreover, the challenges are discussed, including toxicity concerns, immunogenicity, and translational barriers, and ongoing efforts to overcome these hurdles are highlighted. Finally, insights into the future directions of nanoparticle-based cancer therapy and regulatory considerations, are provided aiming to accelerate the translation of these promising technologies from bench to bedside.

ZNFX1
Also flagged:Nitric OxideNO synthaseNOS2cytokine stormmitochondrialinflammatory response
Journal Article 2024-11-06 ✓ 1 Snippet Sánchez-García S, Povo-Retana A, Marin S, Madurga S, Fariñas M, Aleixandre N, Castrillo A, de la Rosa JV, Alvarez-Lucena C, Landauro-Vera R, Prieto P, Cascante M, Boscá L.
In-Text Gene Mentions

…IFNγ response (ZNFX1and GBP2 )…

Show Full Abstract

The cytokine storm associated with SARS-CoV-2 infection is one of the most distinctive pathological signatures in COVID-19 patients. Macrophages respond to this pro-inflammatory challenge by reprogramming their functional and metabolic phenotypes. Interestingly, human macrophages fail to express the inducible form of the NO synthase (NOS2) in response to pro-inflammatory activation and, therefore, NO is not synthesized by these cells. The contribution of exogenously added NO, via a chemical NO-donor, on the immunometabolic changes associated with the cytokine storm is investigated. By using metabolic, transcriptomic, and functional assays the effect of NO in human macrophages is evaluated and found specific responses. Moreover, through integrative fluxomic analysis, pathways modified by NO that contribute to the expression of a particular phenotype in human macrophages are identified, which includes a decrease in mitochondrial respiration and TCA with a slight increase in the glycolytic flux. A significant ROS increase and preserved cell viability are observed in the presence of NO, which may ease the inflammatory response and host defense. Also, NO reverses the cytokine storm-induced itaconate accumulation. These changes offer additional clues to understanding the potential crosstalk between NO and the COVID-19 cytokine storm-dependent signaling pathways.

Also flagged:severe combined immunodeficiencyinfectionantibodiesLyme disease
Journal Article 2024-11-06 No Snippets Koloski CW, Adam H, Hurry G, Foley-Eby A, Zinck CB, Wei H, Hansra S, Wachter J, Voordouw MJ.
Show Full Abstract

The Lyme disease spirochete <i>Borrelia burgdorferi</i> cycles between immature black-legged ticks (<i>Ixodes scapularis</i>) and vertebrate reservoir hosts, such as rodents. Larval ticks acquire spirochetes from infected hosts, and the resultant nymphs transmit the spirochetes to naïve hosts. This study investigated the impact of immunocompetence and host tissue spirochete load on host-to-tick transmission (HTT) of <i>B. burgdorferi</i> and the spirochete load inside immature <i>I. scapularis</i> ticks. Wild-type (WT) C57BL/6J mice and mice with severe combined immunodeficiency (SCID) were experimentally infected with <i>B. burgdorferi</i>. To measure HTT, WT and SCID mice were repeatedly infested with <i>I. scapularis</i> larvae, and ticks were sacrificed at three different developmental stages: engorged larvae, 1-month-old, and 12-month-old nymphs. The spirochete loads in immature ticks and mouse tissues were estimated using qPCR. In WT mice, HTT decreased from 90% to 65% over the course of the infection, whereas in the SCID mice, HTT was always 100%. Larvae that fed on SCID mice acquired a much larger dose of spirochetes compared to larvae that fed on WT mice. This difference in spirochete load persisted over tick development where nymphs that fed as larvae on SCID mice had significantly higher spirochete loads compared to their WT counterparts. HTT and the tick spirochete loads were strongly correlated with the mouse tissue spirochete loads. Our study shows that the host immune system (e.g., the presence of antibodies) influences HTT of <i>B. burgdorferi</i> and the spirochete load in immature <i>I. scapularis</i> ticks.IMPORTANCEThe tick-borne spirochete <i>Borrelia burgdorferi</i> causes Lyme disease in humans. This pathogen is maintained in nature by cycles involving black-legged ticks and wildlife hosts. The present study investigated the host factors that influence the transmission of <i>B. burgdorferi</i> from infected hosts to feeding ticks. We infected immunocompetent mice and immunocompromised mice (that cannot develop antibodies) with <i>B. burgdorferi</i> and repeatedly infested these mice with ticks. We determined the percentage of infected ticks and their spirochete loads. This percentage was 100% for immunocompromised mice but decreased from 90% to 65% over time (8 weeks) for immunocompetent mice. The tick spirochete load was much higher in ticks fed on immunocompromised mice compared to ticks fed on immunocompetent mice. In summary, the host immune system influences the transmission of <i>B. burgdorferi</i> from infected hosts to ticks and the spirochete loads in those ticks, which, in turn, determines the risk of Lyme disease for people.

DNAH10
Also flagged:DNAH3dyneinmale infertilityasthenozoospermiaasthenoteratozoospermiaDynein axonemal heavy chain 3
Journal Article 2024-11-06 ✓ 2 Snippets Wang X, Shen G, Yang Y, Jiang C, Ruan T, Yang X, Zhuo L, Zhang Y, Ou Y, Zhao X, Long S, Tang X, Lin T, Shen Y.
In-Text Gene Mentions

…DNAH6, DNAH7, DNAH8,DNAH10, DNAH12, and DNAH17…

…, DNAH8 ,DNAH10, DNAH12, and…

Show Full Abstract

Axonemal protein complexes, including the outer and inner dynein arms (ODA/IDA), are highly ordered structures of the sperm flagella that drive sperm motility. Deficiencies in several axonemal proteins have been associated with male infertility, which is characterized by asthenozoospermia or asthenoteratozoospermia. Dynein axonemal heavy chain 3 (DNAH3) resides in the IDA and is highly expressed in the testis. However, the relationship between DNAH3 and male infertility is still unclear. Herein, we identified biallelic variants of <i>DNAH3</i> in four unrelated Han Chinese infertile men with asthenoteratozoospermia through whole-exome sequencing (WES). These variants contributed to deficient DNAH3 expression in the patients' sperm flagella. Importantly, the patients represented the anomalous sperm flagellar morphology, and the flagellar ultrastructure was severely disrupted. Intriguingly, <i>Dnah3</i> knockout (KO) male mice were also infertile, especially showing the severe reduction in sperm movement with the abnormal IDA and mitochondrion structure. Mechanically, nonfunctional DNAH3 expression resulted in decreased expression of IDA-associated proteins in the spermatozoa flagella of patients and KO mice, including DNAH1, DNAH6, and DNALI1, the deletion of which has been involved in disruption of sperm motility. Moreover, the infertility of patients with <i>DNAH3</i> variants and <i>Dnah3</i> KO mice could be rescued by intracytoplasmic sperm injection (ICSI) treatment. Our findings indicated that <i>DNAH3</i> is a novel pathogenic gene for asthenoteratozoospermia and may further contribute to the diagnosis, genetic counseling, and prognosis of male infertility.

TNFSF4
Also flagged:tumorProlyl-4-hydroxylase subunit alpha3P4HA3procollagensynthesiscancer
Journal Article 2024-11-06 ✓ 3 Snippets Huang HY, Zhang FW, Yu J, Xiao YH, Zhu D, Yi X, Lin X, Jin M, Jin HY, Huang YS, Ren SW.
In-Text Gene Mentions

…CD200, NRP1, LAIR1,TNFSF4, HAVCR2, CD276, VSIR…

…CD200, NRP1, LAIR1,TNFSF4, ICOS, CTLA-4, CD48,…

…TNFRSF14, NRP1, LAIR1,TNFSF4, CD244, ICOS, CD40LG,…

Show Full Abstract

Prolyl-4-hydroxylase subunit alpha3 (P4HA3) is a triple helical procollagen synthesis protein. The role of P4HA3 in cancer development is not well known and lacks comprehensive analyses among human cancers. This study aimed to investigate the relationship between P4HA3 expression and anti-tumor immunity and its prognostic value in pan-cancer. P4HA3 expression was analyzed from TIMER2.0, GTEx, GEPIA2.0 and TCGA databases. Genetic and DNA methylation alterations, survival analysis and proteins co-expression analysis of P4HA3 in cBio Cancer Genomics Portal, TCGA, GSCA and TIMER2.0. The correlation between P4HA3 expression and immune infiltration was analyzed by TIDE, XCELL, MCPCOUNTER, and EPIC. We performed EdU and transwell experiments to evaluate the influence of P4HA3 on the proliferation, migration and invasion abilities of different tumors. Patients derived xenograft (PDX) and subcutaneous transplantation models were utilized to explore the correlation between P4HA3 and immunotherapy response in triple-negative breast cancer (TNBC). Among 33 types of cancers, P4HA3 had generally different expression between different tumors, further analysis showed that the expression of P4HA3 was correlated with the cells infiltration of the tumor microenvironment (TME). The expression of P4HA3 was positively with the cell proliferation markers and epithelial-mesenchymal transition (EMT) markers. Moreover, P4HA3 deficiency inhibited the proliferation, migration and invasion abilities of tumor cells, and promoted anti-tumor immunotherapy of PD-1/PD-L1 inhibitor. This pan-cancer analysis of P4HA3 provides a comprehensive understanding of its oncogenic and prognosis role in different cancers, P4HA3 abnormal expression could be a useful biomarker for predicting the effectiveness of immunotherapy in cancer patients.

DCC
Also flagged:Solid cancerscancerlocalizationLIM domain 2FHL2p21
Journal Article 2024-11-06 ✓ 2 Snippets Bakhshandeh S, Heras U, Taïeb HM, Varadarajan AR, Lissek SM, Hücker SM, Lu X, Garske DS, Young SAE, Abaurrea A, Caffarel MM, Riestra A, Bragado P, Contzen J, Gossen M, Kirsch S, Warfsmann J, Honarnejad K, Klein CA, Cipitria A.
In-Text Gene Mentions

…for future diagnosticDCCdetection and targeting…

…identification of promisingDCC-selective drugs and drug…

Show Full Abstract

Solid cancers frequently relapse with distant metastasis, despite local and systemic treatment. Cellular dormancy has been identified as an important mechanism underlying drug resistance enabling late relapse. Therefore, relapse from invisible, minimal residual cancer of seemingly disease-free patients call for in vitro models of dormant cells suited for drug discovery. Here, we explore dormancy-inducing 3D engineered matrices, which generate mechanical confinement and induce growth arrest and survival against chemotherapy in cancer cells. We characterized the dormant phenotype of solitary cells by P-ERK<sup>low</sup>:P-p38<sup>high</sup> dormancy signaling ratio, along with Ki67<sup>-</sup> expression. As underlying mechanism, we identified stiffness-dependent nuclear localization of the four-and-a-half LIM domain 2 (FHL2) protein, leading to p53-independent high p21<sup>Cip1/Waf1</sup> nuclear expression, validated in murine and human tissue. Suggestive of a resistance-causing role, cells in the dormancy-inducing matrix became sensitive against chemotherapy upon FHL2 down-regulation. Thus, our biomaterial-based approach will enable systematic screens for previously unidentified compounds suited to eradicate potentially relapsing dormant cancer cells.

Also flagged:addictionAIDSopioidcytochrome P450 2D6CYP2D6nicotine
Journal Article 2024-11-06 No Snippets Sharafshah A, Motovali-Bashi M, Keshavarz P, Blum K.
Show Full Abstract

The global public health addiction crisis has been stark, with over 932,400 deaths in the USA and Canada from opioid overdose since 1999-2020, surpassing the mortality rates at the top of the HIV/AIDS epidemic. Both nations exhibit opioid consumption rates significantly above the norm for developed countries. Analgesic type of opioids present both therapeutic benefits and substantial health risks, necessitating balanced drug regulation, careful prescribing, and dedicated opioid stewardship. The role of the cytochrome P450 2D6 (CYP2D6) system (Enzymatic functions) in metabolizing opioids highlights the potential of genotype-guided analgesia. By integrating Pharmacogenomics (PGx), this approach aims to optimize pain management, enhance safety, and reduce addiction risks. This understanding prompted the utilization of multifactor dimensionality reduction (MDR) to explore a range of phenotypes including PGx and gene-gene interactions (GGI) in a healthy cohort, thereby personalizing pain management strategies. The study sampled 100 unrelated healthy Western Iranians and 100 individuals from the 1000 Genome Project. Pre-testing involved searching for PGx annotations (variants associated with drug-gene-diseases) related to pain sensitivity and inflammation using the PharmGKB database, which identified 128 relevant genes. A questionnaire helped select 100 participants who had never used potent opioids but also other psychoactive agents (e.g., nicotine, amphetamines, etc.) and disease-related drugs. Whole-exome sequencing (WES) was then employed to analyze these genes in an Iranian cohort. Further analyses included MDR for identifying synergistic gene annotations and GGI for exploring complex gene interactions through the Visualization of Statistical Epistasis Networks (ViSEN). The study identified a Pain, Anti-Inflammatory, and Immunomodulating agents (PAIma) panel from the 128 genes, resulting in 55,590 annotations across 21 curated pathways. After filtering, 54 significant structural or regulatory variants were identified. This research also highlighted novel gene relationships involving the CYP3A5 gene, hsa-miR-355-5p, Paliperidone, and CYP2D6, which warrant further investigation. This study offers a novel pharmacogenetic framework that could potentially transform opioid prescribing practices to mitigate misuse and enhance personalized pain management. Further validation of these findings from multi countries and ethnic groups could guide clinicians in implementing DNA-based opioid prescribing, aligning treatment more closely with individual genetic profiles.

Also flagged:Viral nervous necrosisnervousRNA-directed RNA polymerasesimmune responseToll-like receptorsTLRs
Journal Article 2024-11-06 No Snippets Moin AT, Rani NA, Sharker YA, Ahammed T, Rahman US, Yasmin S, Ratul IH, Joyoti SA, Musa MS, Rahaman MU, Biswas D, Ali MH, Alam SMMU, Patil RB, Nabi RU, Uddin MH.
Show Full Abstract

Viral nervous necrosis (VNN) poses a significant threat to the aquaculture industry, causing substantial losses and economic burdens. The disease, attributed to nervous necrosis viruses within the Betanodavirus genus, is particularly pervasive in the Mediterranean region, affecting various fish species across all production stages with mortality rates reaching 100%. Developing effective preventive measures against VNN is imperative. In this study, we employed rigorous immunoinformatics techniques to design a novel multi-epitope vaccine targeting VNN. Five RNA-directed RNA polymerases, crucial to the lifecycle of Betanodavirus, were selected as vaccine targets. The antigenicity and favorable physicochemical properties of these proteins were confirmed, and epitope mapping identified cytotoxic T lymphocyte, helper T lymphocyte, and linear B lymphocyte epitopes essential for eliciting a robust immune response. The selected epitopes, characterized by high antigenicity, non-allergenicity, and non-toxicity, were further enhanced by adding PADRE sequences and hBD adjuvants to increase immunogenicity. Two vaccine constructs were developed by linking epitopes using appropriate linkers, demonstrating high antigenicity, solubility, and stability. Molecular dynamics simulations revealed stable interactions between the vaccine constructs and Toll-like receptors (TLRs), essential for pathogen recognition and immune response activation in fish. Notably, vaccine construct V2 exhibited superior stability and binding affinity with TLR8, suggesting its potential as a promising candidate for VNN prevention. Overall, our study presents a comprehensive approach to VNN vaccine design utilizing immunoinformatics, offering safe, immunogenic, and effective solutions across multiple Betanodavirus species. Further experimental validation in model animals is recommended to fully assess the vaccine's efficacy. This research contributes to improved vaccine development against diverse fish pathogens by addressing emerging challenges and individualized immunization requirements in aquaculture.

POU3F2
Also flagged:prostate cancerPCaENO2SYPCHGAandrogen receptor
Journal Article 2024-11-06 ✓ 1 Snippet Zhou Q, Yang M, Fu J, Sun X, Wang J, Zhang H, Hu J, Han B.
In-Text Gene Mentions

…genes (ENO2, SYP,POU3F2, SRRM4, etc.),…

Show Full Abstract

Neuroendocrine prostate cancer (NEPC) arises from prostate adenocarcinoma after endocrine treatment failure and implies lethality and limited therapeutic options. Deciphering the molecular mechanisms underlying transdifferentiation from adenocarcinoma to NEPC may provide valuable therapeutic strategies. We performed a pan-cancer differential mRNA abundance analysis and identified that Kinesin-like protein (KIF1A) was highly expressed in NEPC. KIF1A knockdown impaired neuroendocrine(NE) features, including NE marker gene expression, stemness, and epithelial-mesenchymal transition (EMT), whereas KIF1A overexpression promoted these processes. Targeting KIF1A inhibited the growth of NE differentiated prostate cancer (PCa) cells in vitro and in vivo. Mechanistically, KIF1A bound with O-linked N-acetylglucosamine transferase (OGT) and regulated its protein expression and activity. Nuclear accumulation of OGT induced by KIF1A overexpression promoted intranuclear O-GlcNAcylation of β-catenin and OCT4 in nucleus. More importantly, our data revealed that OGT was critical for KIF1A induced NE differentiation and aggressive tumor growth. An OGT inhibitor, OSMI-1, can significantly inhibited NE differentiated PCa cell proliferation in vitro and tumor growth in vivo. Our findings showed that KIF1A promotes NE differentiation to NEPC by regulating the OGT-mediated O-GlcNAcylation. Targeting O-GlcNAcylation may impede the development of NEPC for a group of PCa patients with elevated KIF1A expression.

NEGR1
Also flagged:aphidicolinsynthesisDNA polymerase thetaend-joiningmitosisgenomic
Journal Article 2024-11-06 ✓ 2 Snippets Wilson TE, Ahmed S, Winningham A, Glover TW.
In-Text Gene Mentions

…genes PRKG1 ,NEGR1, and MAGI2…

…PRKG1 ,NEGR1, and MAGI2…

Show Full Abstract

Genomic structural variants (SVs) greatly impact human health, but much is unknown about the mechanisms that generate the largest class of nonrecurrent alterations. Common fragile sites (CFSs) are unstable loci that provide a model for SV formation, especially large deletions, under replication stress. We study SV junction formation as it occurs in human cell lines by applying error-minimized capture sequencing to CFS DNA harvested after low-dose aphidicolin treatment. SV junctions form throughout CFS genes at a 5-fold higher rate after cells pass from G2 into M-phase. Neither SV formation nor CFS expression depend on mitotic DNA synthesis (MiDAS), an error-prone form of replication active at CFSs. Instead, analysis of tens of thousands of de novo SV junctions combined with DNA repair pathway inhibition reveal a primary role for DNA polymerase theta (POLQ)-mediated end-joining (TMEJ). We propose an important role for mitotic TMEJ in nonrecurrent SV formation genome wide.

TNFSF4
Also flagged:cancertumorcancersADAM9phosphorylationmethylation
Journal Article 2024-11-06 ✓ 1 Snippet AmeliMojarad M, AmeliMojarad M, Wang J, Tavakolpour V, Shariati P.
In-Text Gene Mentions

…and (IL1B, HMGB1,TNFSF4) as stimulatory effectors…

Show Full Abstract

A pan-cancer analysis summarizing the overall changes in mRNA and protein stability of ADM9, as well as its oncogenic function on immune cell line modulation and checkpoints within the tumor microenvironment (TME), is lacking, despite the fact that ADM9 up-regulation is correlated with the progression of many cancers. Therefore, in this study, we comprehensively analyzed the role of ADAM9 expression and its prognostic value in different cancers to fill this gap. Multiple bioinformatics databases such as Cancer Genome Atlas (TCGA), Genotype-Tissue Expression (GTEx), and Clinical Proteomic Tumor Analysis Consortium (CPTAC) were used to evaluate the ADAM9 genetic alternation, phosphorylation, and methylation, and indicated highly positive correlated genes that might play a critical interaction with ADAM9 and their molecular function with GO analysis. We also evaluate the effect of higher ADAM9 with prominent immune modulatory genes and immune infiltration especially in liver cancer pathogenesis stimulates lower NK cell effector functions based on its role in MICA shedding and increasing the Tregs infiltration. Immunohistochemistry (IHC) staining from 90 pathologically verified samples proved the positive correlation between ADAM9 and tumor stages and proved the higher expression of ADAM9 correlated genes (SNX9, APP, TNF, CDH1, ITGAV, MAD2L2) in HCC pathogenesis. In conclusion, this pan-cancer study provides a comprehensive understanding of the prognostic value of ADAM9 in various tumors emphasizing its importance to be considered as an innovative treatment approach, especially in tumor immunity shortly.

CCPG1
Also flagged:AMFRNS2Aendoplasmic reticulumautophagyinfectiondegradation
Journal Article 2024-11-06 ✓ 5 Snippets Zhang L, Wang H, Han C, Dong Q, Yan J, Guo W, Shan C, Zhao W, Chen P, Huang R, Wu Y, Chen Y, Qin Y, Chen M.
In-Text Gene Mentions

…SEC62, ATL3, RTN3,CCPG1, and TEX264 25…

…1-AP), rabbit polyclonal anti-CCPG1(cat.…

…HA-AMFR, HA-CCPG1, HA-FAM134B, HA-RTN3, HA-TEX2…

…period, except thatCCPG1at 48 h…

…ATL3, SEC62, andCCPG1(Fig. 2c and…

Show Full Abstract

Flaviviruses strategically utilize the endoplasmic reticulum (ER) in their replication cycles. However, the role of ER autophagy (ER-phagy) in viral replication process remains poorly understood. Here, we reveal that prolonged Zika virus (ZIKV) infection results from the degradation of ER-phagy receptor FAM134B, facilitated by viral NS2A protein. Mechanistically, ER-localized NS2A undergoes K48-linked polyubiquitination at lysine (K) 56 by E3 ligase AMFR. Ubiquitinated NS2A binds to FAM134B and AMFR orchestrates the degradation of NS2A-FAM134B complexes. AMFR-catalyzed NS2A ubiquitination not only targets FAM134B degradation but also hinders the FAM134B-AMFR axis. Notably, a recombinant ZIKV mutant (ZIKV-NS2A<sub>K56R</sub>), lacking ubiquitination and ER-phagy inhibition, exhibits attenuation in ZIKV-induced microcephalic phenotypes in human brain organoids and replicates less efficiently, resulting in weakened pathogenesis in mouse models. In this work, our mechanistic insights propose that flaviviruses manipulate ER-phagy to modulate ER turnover, driving viral infection. Furthermore, AMFR-mediated flavivirus NS2A ubiquitination emerges as a potential determinant of viral pathogenecity.

Also flagged:sodium chloridewatergypsumapatitemineralizationcalcium sulfate
Journal Article 2024-11-06 No Snippets Jaita P, Randorn C, Watcharapasorn A, Jarupoom P.
Show Full Abstract

In this research, sodium chloride-added calcium sulfate-hydroxyapatite composite bone cements (0.70CaS-0.30HAP)/<i>x</i>NaCl were studied. Different wt% of NaCl (0, 1.5, and 2.5) were added to 0.70CaS-0.30HAP bone cement to investigate the setting time, injectability, washout resistance, phase evolution, physical properties, water absorption, microstructural, chemical analysis, mechanical strength, statistical analysis, <i>in vitro</i> apatite-forming ability, and <i>in vitro</i> cytotoxicity. With increasing NaCl, the initial setting time decreased to around 3.18 min. X-ray pattern revealed that all composite bone cement samples had mixed phases of CaS, HAP, brushite, gypsum, and NaCl. Water absorption and average grain size increased with increasing NaCl content. The densification and mechanical performances, including <i>σ</i> <sub>c</sub>, <i>σ</i> <sub>f</sub>, and <i>E</i> values, slightly decreased with increasing NaCl content, correlated with the increasing porosity value. This resulted in the production of a porous structure, which caused an excellent <i>in vitro</i> apatite-forming ability. The <i>x</i> = 2.5 sample showed good bioactivity, inducing the highest apatite mineralization ability in the SBF solution. Additionally, <i>in vitro</i> cell culture analysis showed above 94.12% cell viability against a high concentration (@ 200 μg mL<sup>-1</sup>) for the <i>x</i> = 2.5 sample, revealing cytocompatibility. The obtained results indicated that the (0.70CaS-0.30HAP)/2.5NaCl composite bone cement, with good injectability, bioactivity, and cytocompatibility, are promising candidates for biomedical applications.

CACNA1E
Also flagged:autism spectrum disorderneurobehavioral disordermosXYY syndromesex chromosome
Journal Article 2024-11-06 ✓ 3 Snippets Kalayci A, Agirbasli D, Serdengecti N, Alay MT, Tarakcioglu MC, Seven M.
In-Text Gene Mentions

…mosaic 48,XYYY/47,XYY, andCACNA1Evariant in autism…

…c.3545G>A in theCACNA1Egene.…

…48,XYYY/47,XYY karyotype andCACNA1Evariant together may…

Show Full Abstract

Autism spectrum disorder (ASD) is a genetically heterogeneous neurobehavioral disorder. The etiology and the inheritance pattern are usually multifactorial. The index case is a 3-year-old male, whose family applied to the child psychiatry outpatient clinic due to failure to speak at 30 months. He had mild dysmorphic features. He is diagnosed with ASD according to DSM-V criteria. Chromosomal analysis revealed mos 48,XYYY[28]/47,XYY[72] karyotype. In FISH analysis, nuc ish (DXZ1x1, DYZ1x3)[44]/(DXZ1x1, DYZ1x2)[156] was detected. WES results displayed a heterozygous missense variant of uncertain significance c.3545G>A in the CACNA1E gene. XYY syndrome is one of the most common sex chromosome aneuploidies, and ASD is detected 20 times more likely than males in general population. To the best of our knowledge, the first case with the coexistence of mosaic 48,XYYY/47,XYY karyotype and CACNA1E variant together may contribute to phenotypic heterogeneity. Further investigation into the functionality of the variant in CACNA1E is needed.

Also flagged:AMPA) receptorGlutamateAMPARneurotransmissionaminohydroxy
Journal Article 2024-11-06 No Snippets Yatomi T, Tomasi D, Tani H, Nakajima S, Tsugawa S, Nagai N, Koizumi T, Nakajima W, Hatano M, Uchida H, Takahashi T.
Show Full Abstract

Local and global functional connectivity densities (lFCD and gFCD, respectively), derived from functional magnetic resonance imaging (fMRI) data, represent the degree of functional centrality within local and global brain networks. While these methods are well-established for mapping brain connectivity, the molecular and synaptic foundations of these connectivity patterns remain unclear. Glutamate, the principal excitatory neurotransmitter in the brain, plays a key role in these processes. Among its receptors, the <i>α</i>-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor (AMPAR) is crucial for neurotransmission, particularly in cognitive functions such as learning and memory. This study aimed to examine the association of the AMPAR density and FCD metrics of intraregional and interregional functional centrality. Using [<sup>11</sup>C]K-2, a positron emission tomography (PET) tracer specific for AMPARs, we measured AMPAR density in the brains of 35 healthy participants. Our findings revealed a strong positive correlation between AMPAR density and both lFCD and gFCD-lFCD across the entire brain. This correlation was especially notable in key regions such as the anterior cingulate cortex, posterior cingulate cortex, pre-subgenual frontal cortex, Default Mode Network, and Visual Network. These results highlight that postsynaptic AMPARs significantly contribute to both local and global functional connectivity in the brain, particularly in network hub regions. This study provides valuable insights into the molecular and synaptic underpinnings of brain functional connectomes.

TNFSF4BTN2A2
Also flagged:lactatemetabolismcancerosteosarcomatumorMHC
Journal Article 2024-11-06 ✓ 2 Snippets Wang Y, Wang X, Liu Y, Xu J, Zhu J, Zheng Y, Qi Q.
In-Text Gene Mentions
⭐ same-sentence co-mention

…, CD209 ,TNFSF4, BTN2A2 ,…

⭐ same-sentence co-mention

…, TNFSF4 ,BTN2A2, CD70 ,…

Show Full Abstract

<h4>Background</h4>Immunotherapy has shown considerable promise in cancer treatment, yet only a minority of osteosarcoma patients derive benefits from this approach. Hypoxia and lactate metabolism are two predominant characteristics of the tumor microenvironment. These features are crucial for molding the immune landscape and thus have the potential to act as predictive indicators for immunotherapy response.<h4>Methods</h4>Prognostic modeled genes were identified through univariate and multivariate Cox regression as well as LASSO regression analyses. The tumor microenvironment was evaluated using ESTIMATE, CIBERSORT, and ImmuCellAI analyses. Tide prediction and expression of immune checkpoints, MHC molecules, chemokines, interleukins, interferons, receptors, and other cytokines were utilized to estimate immunotherapy efficacy. Single-cell analysis was performed to demonstrate the expression of modeled genes among various immune cell types. Experimental validation was carried out to verify the expression and functions of <i>SFXN4</i> and <i>SQOR</i>.<h4>Results</h4>A potent signature was constructed with 8 genes related to hypoxia and lactate metabolism, including <i>MAFF</i>, <i>COL5A2</i>, <i>FAM162A</i>, <i>SQOR</i>, <i>UQCRB</i>, <i>SFXN4</i>, <i>PFKFB2</i> and <i>COX6A2</i>. A nomogram incorporating risk scores and other clinical features demonstrated excellent predictive capacity. Osteosarcoma patients with high-risk scores exhibited poor prognosis and more "cold" tumor characteristics. According to the ESTIMATE algorithm, these patients displayed lower immune, stromal, and ESTIMATE scores, partially attributed to inadequate infiltration of key immunocytes. The Ciborsort analysis similarly indicated that high-risk individuals had diminished infiltration of critical anti-tumor immune cells such as Cytotoxic T cells, CD4+ T cells, and NK cells. The low expression levels of certain immune checkpoints, MHC molecules, chemokines, interleukins, interferons, receptors, and other cytokines in high-risk cases suggested their unsatisfactory responses to immune treatment. Tide prediction further demonstrated that fewer individuals classified as high risk may exhibit sensitivity to immune checkpoint inhibitor therapy. Notably, <i>SFXN4</i> was found to be highly expressed in osteosarcoma tissues and cells; it promoted the growth, migration, and invasion of osteosarcoma cells, while <i>SQOR</i> had the opposite effect.<h4>Conclusion</h4>Our research has developed a robust hypoxia- and lactate metabolism-related gene signature, providing a solid theoretical foundation for prognosis prediction, classification of "cold" and "hot" tumors, accessing immunotherapy response, and directing personalized treatment for osteosarcoma.

HTT
Also flagged:pathogenesisgenetic disordersneurodegenerative disorderscancermuscular dystrophiesconditions
Journal Article 2024-11-06 ✓ 1 Snippet Casas-Tintó S.
In-Text Gene Mentions

…the huntingtin (HTT) gene, which…

Show Full Abstract

Rare and ultra-rare diseases constitute a significant medical challenge due to their low prevalence and the limited understanding of their origin and underlying mechanisms. These disorders often exhibit phenotypic diversity and molecular complexity that represent a challenge to biomedical research. There are more than 6000 different rare diseases that affect nearly 300 million people worldwide. However, the prevalence of each rare disease is low, and in consequence, the biomedical resources dedicated to each rare disease are limited and insufficient to effectively achieve progress in the research. The use of animal models to investigate the mechanisms underlying pathogenesis has become an invaluable tool. Among the animal models commonly used in research, <i>Drosophila melanogaster</i> has emerged as an efficient and reliable experimental model for investigating a wide range of genetic disorders, and to develop therapeutic strategies for rare and ultra-rare diseases. It offers several advantages as a research model including short life cycle, ease of laboratory maintenance, rapid life cycle, and fully sequenced genome that make it highly suitable for studying genetic disorders. Additionally, there is a high degree of genetic conservation from <i>Drosophila melanogaster</i> to humans, which allows the extrapolation of findings at the molecular and cellular levels. Here, I examine the role of <i>Drosophila melanogaster</i> as a model for studying rare and ultra-rare diseases and highlight its significant contributions and potential to biomedical research. High-throughput next-generation sequencing (NGS) technologies, such as whole-exome sequencing and whole-genome sequencing (WGS), are providing massive amounts of information on the genomic modifications present in rare diseases and common complex traits. The sequencing of exomes or genomes of individuals affected by rare diseases has enabled human geneticists to identify rare variants and identify potential loci associated with novel gene-disease relationships. Despite these advances, the average rare disease patient still experiences significant delay until receiving a diagnosis. Furthermore, the vast majority (95%) of patients with rare conditions lack effective treatment or a cure. This scenario is enhanced by frequent misdiagnoses leading to inadequate support. In consequence, there is an urgent need to develop model organisms to explore the molecular mechanisms underlying these diseases and to establish the genetic origin of these maladies. The aim of this review is to discuss the advantages and limitations of <i>Drosophila melanogaster</i>, hereafter referred as <i>Drosophila</i>, as an experimental model for biomedical research, and the applications to study human disease. The main question to address is whether <i>Drosophila</i> is a valid research model to study human disease, and in particular, rare and ultra-rare diseases.

HTT
Also flagged:MembranespeptidesfibrilsPMDsphospholipidmembrane
Journal Article 2024-11-06 ✓ 1 Snippet Seychell RM, El Saghir A, Vassallo N.
In-Text Gene Mentions

…, 35 ],htt[ 36 ],…

Show Full Abstract

The transition of peptides or proteins along a misfolding continuum from soluble functional states to pathological aggregates, to ultimately deposit as amyloid fibrils, is a process that underlies an expanding group of human diseases-collectively known as protein-misfolding disorders (PMDs). These include common and debilitating conditions, such as Alzheimer's disease, Parkinson's disease, and type-2 diabetes. Compelling evidence has emerged that the complex interplay between the misfolded proteins and biological membranes is a key determinant of the pathogenic mechanisms by which harmful amyloid entities are formed and exert their cytotoxicity. Most efforts thus far to develop disease-modifying treatments for PMDs have largely focused on anti-aggregation strategies: to neutralise, or prevent the formation of, toxic amyloid species. Herein, we review the critical role of the phospholipid membrane in mediating and enabling amyloid pathogenicity. We consequently propose that the development of small molecules, which have the potential to uniquely modify the physicochemical properties of the membrane and make it more resilient against damage by misfolded proteins, could provide a novel therapeutic approach in PMDs. By way of an example, natural compounds shown to intercalate into lipid bilayers and inhibit amyloid-lipid interactions, such as the aminosterols, squalamine and trodusquamine, cholesterol, ubiquinone, and select polyphenols, are discussed. Such a strategy would provide a novel approach to counter a wide range of toxic biomolecules implicit in numerous human amyloid pathologies.

SOX6
Also flagged:LipidMetabolismobesitymyopathycarbohydrateslipoprotein
Journal Article 2024-11-06 ✓ 1 Snippet Gao G, Jiao Y, Kwok LY, Zhong Z.
In-Text Gene Mentions

…(such as theSOX6-MYH1s axis) involved in…

Show Full Abstract

Optimizing fat deposition is crucial for improving chicken production and meat quality. This study investigated the interactive roles of host genetics and gut microbiome in regulating abdominal fat deposition in selectively bred broiler chicken lines. We compared the gut microbiome composition and host whole-genome profiles between fat-line and lean-line broiler chickens that had been selectively bred for divergent abdominal fat levels over 15 generations. Despite identical dietary and environmental conditions, the two chicken lines exhibited significant differences in their gut microbiota. Lean-line broiler chickens exhibited an increased abundance of intestinal <i>Lactobacillus</i> and a decreased presence of potentially pathogenic species, such as <i>Campylobacter coli</i>, <i>Corynebacterium casei</i>, and <i>Enterococcus faecalis</i>. These microbial alterations were accompanied by shifts in the functional metagenome, with enrichment in pathways involved in energy metabolism and nutrient utilization in the lean-line chickens. Notably, the selective breeding process also led to genomic variations in the lean broilers, with single nucleotide polymorphisms predominantly observed in genes related to energy and lipid metabolism. Our findings suggest that the host-microbiome interactions play a key role in the divergent abdominal fat deposition phenotypes observed in these selectively bred chicken lines. The co-evolution of the gut microbiome and host genetics highlights the importance of considering both factors to optimize poultry production efficiency and meat quality. This study offers new insights into the intricate gut-genome interactions in chicken fat metabolism, paving the way for more effective breeding and microbiome-based strategies to manage adiposity in poultry.

Also flagged:Cancergene expressioncell cyclecardiovascular diseasesheart failurenatriuretic peptides
Journal Article 2024-11-06 No Snippets Moscoso I, Rodríguez-Mañero M, Cebro-Márquez M, Vilar-Sánchez ME, Serrano-Cruz V, Vidal-Abeijón I, Martínez-Monzonís MA, Mazón-Ramos P, Pedreira M, González-Juanatey JR, Lage R.
Show Full Abstract

Cardiotoxicity (CDTX) is a critical side effect of many cancer therapies, leading to increased morbidity and mortality if not addressed. Early detection of CDTX is essential, and while echocardiographic measures like global longitudinal strain offer promise in identifying early myocardial dysfunction, the search for reliable biomarkers continues. MicroRNAs (miRNAs) are emerging as important non-coding RNA molecules that regulate gene expression post-transcriptionally, influencing key biological processes such as the cell cycle, apoptosis, and stress responses. In cardiovascular diseases, miRNAs have demonstrated potential as biomarkers due to their stability in circulation and specific expression patterns that reflect pathological changes. Certain miRNAs have been linked to CDTX and hold promise for early detection, prognosis, and therapeutic targeting. These miRNAs not only assist in identifying early cardiac injury, but also offer opportunities for personalized interventions by modulating their expression to influence disease progression. As research advances, integrating miRNA profiling with traditional diagnostic methods could enhance the management of CDTX in cancer patients, paving the way for improved patient outcomes and more tailored therapeutic strategies. Further clinical studies are essential to validate the clinical utility of miRNAs in managing CDTX.

Also flagged:PathogenesisNarcolepsy Type 1sleep disordercataplexysleepNT1
Journal Article 2024-11-06 No Snippets Xu W, Ding W, Zhang Y, Wang S, Yan X, Xu Y, Zhi X, Liu R.
Show Full Abstract

Narcolepsy type 1 (NT1) is an uncommon, persistent sleep disorder distinguished by significant daytime sleepiness, episodes of cataplexy, and irregularities in rapid eye movement sleep. The etiology of NT1 is linked to the destruction of hypothalamic neurons responsible for the synthesis of the wake-promoting neuropeptide known as hypothalamic orexin. The pathophysiological mechanisms underlying NT1 remain inadequately elucidated; however, a model that incorporates the interplay of genetic predisposition, environmental influences, immune system factors, and a deficiency in hypocretin (HCRT) provides a framework for elucidating the pathogenesis of NT1. The prevalence of NT1 has been observed to rise following influenza A (H1N1) pdm09 and the administration of the Pandemrix influenza vaccine. The strong association between narcolepsy and the <i>HLA-DQB1*06:02</i> allele strongly indicates an autoimmune etiology for this condition. Increasing evidence suggests that T cells play a critical role in this autoimmune-mediated HCRT neuronal loss. Studies have identified specific T cell subsets, including CD4<sup>+</sup> and CD8<sup>+</sup> T cells, that target HCRT neurons, contributing to their destruction. Clarifying the pathogenesis of NT1 driven by autoimmune T cells is crucial for the development of effective therapeutic interventions for this disorder. This review examines the risk factors associated with the pathogenesis of NT1, explores the role of T cells within the immune system in the progression of NT1, and evaluates immune-mediated animal models alongside prospective immunotherapeutic strategies.

PRDX6
Also flagged:USP2OxygenUbiquitin-specific protease 2mitochondrialmitochondriamembrane
Journal Article 2024-11-06 ✓ 1 Snippet Kitamura H, Fujimoto M, Hashimoto M, Yasui H, Inanami O.
In-Text Gene Mentions

…Nfe2l2 , andPrdx6) were significantly…

Show Full Abstract

Ubiquitin-specific protease 2 (USP2) maintains mitochondrial integrity in culture myoblasts. In this study, we investigated the molecular mechanisms underlying the protective role of USP2 in mitochondria. The knockout (KO) of the <i>Usp2</i> gene or the chemical inhibition of USP2 induced a robust accumulation of mitochondrial reactive oxygen species (ROS), accompanied by defects in mitochondrial membrane potential, in C2C12 myoblasts. ROS removal by N-acetyl-L-cysteine restored the mitochondrial dysfunction induced by USP2 deficiency. Comprehensive RT-qPCR screening and following protein analysis indicated that both the genetic and chemical inhibition of USP2 elicited a decrease in uncoupling protein 2 (UCP2) at mRNA and protein levels. Accordingly, the introduction of a <i>Ucp2</i>-expressing construct effectively recovered the mitochondrial membrane potential, entailing an increment in the intracellular ATP level in <i>Usp2</i>KO C2C12 cells. In contrast, USP2 deficiency also decreased peroxisome proliferator-activated receptor γ coactivator 1α (PGC1α) protein in C2C12 cells, while it upregulated <i>Ppargc1a</i> mRNA. Overexpression studies indicated that USP2 potentially stabilizes PGC1α in an isopeptidase-dependent manner. Given that PGC1α is an inducer of UCP2 in C2C12 cells, USP2 might ameliorate mitochondrial ROS by maintaining the PGC1α-UCP2 axis in myoblasts.

Also flagged:Ischemic CholecystitisHereditary Hemorrhagic TelangiectasiaHHTarteriovenous malformationshigh-output heart failureportal hypertension
Journal Article 2024-11-06 No Snippets L'Huillier R, Garnaud A, Monneuse O.
Show Full Abstract

<b>Background/Objectives:</b> Hereditary hemorrhagic telangiectasia (HHT) is an autosomal dominant disorder characterized by abnormal blood vessel formation, leading to recurrent epistaxis, cutaneous and mucosal telangiectases, and visceral arteriovenous malformations (AVMs). Hepatic involvement may result in complications such as high-output heart failure, portal hypertension, and biliary ischemia. We report an uncommon case of ischemic cholecystitis in a patient with HHT. <b>Methods:</b> A 57-year-old male with HHT type 1, including gastric telangiectases and hepatic AVMs, presented with anemia, melena, epigastric pain, and a history of recurrent epistaxis. Imaging revealed gastric telangiectases and liver AVMs, consistent with HHT. Following an episode of severe epistaxis and aspiration pneumonia, the patient developed right upper quadrant pain. <b>Results:</b> Abdominal CT and ultrasound identified thickening of the gallbladder wall, segmental enhancement defects, and a perivesicular fluid effusion, suggestive of acalculous cholecystitis. A laparoscopic cholecystectomy was performed, revealing ischemic cholecystitis with necrotic gallbladder walls. <b>Conclusions:</b> This case underscores the potential for ischemic cholecystitis in patients with HHT and liver involvement, particularly under conditions of acute hemodynamic instability. Clinicians should be vigilant in recognizing this rare complication, especially in patients with established HHT and associated hepatic vascular anomalies.

Also flagged:TRIM ProteinsinfectionE3 ligaseherpesvirus infectioncGASSTING
Journal Article 2024-11-06 No Snippets Sayyad Z, Acharya D, Gack MU.
Show Full Abstract

Herpesviruses are ubiquitous DNA viruses that can establish latency and cause a range of mild to life-threatening diseases in humans. Upon infection, herpesviruses trigger the activation of several host antiviral defense programs that play critical roles in curbing virus replication and dissemination. Recent work from many groups has integrated our understanding of TRIM (<i>tripartite motif</i>) proteins, a specific group of E3 ligase enzymes, as pivotal orchestrators of mammalian antiviral immunity. In this review, we summarize recent advances in the modulation of innate immune signaling by TRIM proteins during herpesvirus infection, with a focus on the detection of herpes simplex virus type 1 (HSV-1, a prototype herpesvirus) by cGAS-STING, RIG-I-like receptors, and Toll-like receptors. We also review the latest progress in understanding the intricate relationship between herpesvirus replication and TRIM protein-regulated autophagy and apoptosis. Finally, we discuss the maneuvers used by HSV-1 and other herpesviruses to overcome TRIM protein-mediated virus restriction.

Also flagged:enzyme activitytopoisomerase ITOP1restriction endonuclease EcoRIEcoRIpolyacrylamide
Journal Article 2024-11-06 No Snippets Borg KN, Shetty A, Cheng G, Zhu S, Wang T, Yuan W, Ho HP, Knudsen BR, Tesauro C, Ho YP.
Show Full Abstract

DNA-modifying enzymes are crucial in biological processes and have significant clinical implications. Traditional quantification methods often overlook enzymatic activity, the true determinants of enzymes' functions. We present hydrogel Bead-based Isothermal Detection (BEAD-ID), utilizing uniform hydrogel bead-based microreactors to evaluate DNA-modifying enzyme activity on-bead. We fabricated homogeneous oligo-conjugated polyacrylamide (oligo-PAA) beads <i>via</i> droplet microfluidics, optimized for capturing and amplifying enzyme-modified nanosensors. By incorporating DNA oligos within the hydrogel network, BEAD-ID retains isothermally amplified products, facilitating <i>in situ</i> detection of enzyme activities on-bead. We validate BEAD-ID by quantifying human topoisomerase I (TOP1) and restriction endonuclease EcoRI, showing a direct correlation between enzyme concentration and fluorescence intensity, demonstrating the platform's sensitivity (6.25 nM TOP1, 6.25 U/μL EcoRI) and reliability in food matrix (25 U/μL EcoRI). Additionally, a customized flow cytometry-mimicking setup allows high-throughput detection at 352 Hz with objective assessment. BEAD-ID, offering flexibility and scalability, is a promising tool for studying DNA-modifying enzymes.

DCC
Also flagged:BocShhaxonaxonsgrowth conesRac1
Journal Article 2024-11-06 ✓ 3 Snippets Balekoglu N, Michaud JF, Sauvé R, Ayinde KS, Lin S, Liu Y, Kramer DA, Zhang K, Steffen A, Stradal T, Angers S, Chen B, Yam PT, Charron F.
In-Text Gene Mentions

…guidance receptors, includingDCC, UNC5D, neogenin, Robo1,…

…act downstream ofDCCin netrin-mediated axon…

…The netrin-1 receptorsDCC, neogenin, and UNC5D…

Show Full Abstract

During development, Shh attracts axons of spinal cord commissural neurons to the floor plate. Shh-mediated attraction of commissural axons requires the receptor Boc. How Boc regulates cytoskeletal changes in growth cones in response to Shh is not fully understood. To identify effectors of Boc in Shh-mediated axon guidance, we used BioID to screen for proteins in proximity to Boc. Top hits included members of the WAVE regulatory complex (WRC), which acts downstream of Rac1 to promote actin cytoskeleton assembly. Therefore, we hypothesized that the WRC is important for Shh-mediated growth cone turning. Using biochemical and cellular assays, we found that Boc directly interacts with the WRC and that this interaction can occur in live cells. Moreover, we found that knockdown of <i>Nckap1</i> and <i>Cyfip1/2,</i> two subunits of the WRC, in commissural neurons, impairs axon attraction toward a Shh gradient. Our results demonstrate that the WRC is required for Shh-mediated axon attraction.

HFE
Also flagged:hepatocellular carcinomaprimary biliary cholangitisdiabetesalcoholcirrhosischronic liver disease
Journal Article 2024-11-06 ✓ 1 Snippet Lim J, Kim YJ, Kim S, Choi J.
In-Text Gene Mentions

…antitrypsin deficiency, orhemochromatosis(n = 1,222);…

Show Full Abstract

<h4>Background & aims</h4>Large-scale studies on the association between primary biliary cholangitis (PBC) and hepatocellular carcinoma (HCC) in Asians are scarce. This study aimed to evaluate the incidence of HCC and its risk factors in a nationwide cohort.<h4>Methods</h4>The data of 4,882 patients with PBC and 38,603 matched controls were extracted from the Korean National Health Insurance Service (2007-2020) and analyzed. The incidence of HCC and its risk factors in patients with PBC were assessed and compared with those in the matched controls. The results were validated in a multicenter hospital cohort of 862 patients with PBC, recruited from Asan Medical Center (n = 815) and Yeouido St. Mary's Hospital (n = 47) in Korea.<h4>Results</h4>In total, 105 patients with PBC developed HCC over the median follow-up period of 5.42 years, yielding an incidence rate of 3.7/1,000 person-years (PYs), which was significantly higher than that in the controls (0.5/1,000 PYs; adjusted hazard ratio: 9.07; 95% CI: 6.71-12.27). PBC, older age, male sex, diabetes, and smoking were identified as significant risk factors for HCC. Twenty-three of the 862 patients with PBC developed HCC in the multicenter hospital cohort, yielding an incidence of 4.0/1,000 PYs (95% CI: 2.4-5.7). Older age (subdistribution hazard ratio [SHR]: 1.05, 95% CI: 1.00-1.10), male sex (SHR: 3.00, 95% CI: 1.11-8.13), current alcohol consumption (SHR: 3.70, 95% CI: 1.08-12.59), and cirrhosis (SHR: 5.17, 95% CI: 2.07-12.93) were identified as risk factors in the hospital cohort.<h4>Conclusions</h4>Patients with PBC were at a significantly higher risk of developing HCC. Older age and male sex were consistent risk factors in both cohorts.<h4>Impact and implications</h4>Notable heterogeneity has been observed among different studies in terms of the incidence of hepatocellular carcinoma (HCC) in patients with primary biliary cholangitis (PBC). Large-scale studies on the association between PBC and HCC in Asians are scarce. In our nationwide cohort study, patients with PBC exhibited a significantly heightened risk of developing HCC and mortality than the age- and sex-matched controls. Individuals with PBC had a 9.1-fold higher risk of developing HCC than their matched counterparts, with an incidence rate of 3.7/1,000 person-years. Older age, male sex, smoking, and diabetes were identified as prominent risk factors for HCC in patients with PBC in the nationwide cohort. Older age, male sex, and alcohol consumption were identified as the factors significantly contributing to the elevated risk of HCC in patients with PBC in validation multicenter hospital cohort.

bioRxiv 2024-11-06 Preprint (No Snippets API) Pulver C, Forey R, Lederer AR, Begnis M, Rosspopoff O, Carlevaro-Fita J, Martins F, Planet E, Duc J, Raclot C, Offner S, Coudray A, Dorschel A, Trono D.
Show Full Abstract

The cell cycle is a fundamental process in eukaryotic biology and is accordingly controlled by a highly conserved core signaling cascade. However, whether recently evolved proteins also influence this process is unclear. Here, we systematically map the influence of evolutionarily recent transcription factors (TFs) on human cell cycle progression. We find that the genomic targets of select young TFs, many of which belong to the rapidly evolving Krüppel-associated box (KRAB) zinc-finger proteins (KZFP) family, exhibit synchronized cell cycle expression. Systematic perturbation studies reveal that silencing recent TFs disrupts normal cell cycle progression, which we experimentally confirm for ZNF519, a simian-restricted KZFP. Further, we show that the therian-specific KZFP ZNF274 sets the cell cycle expression and replication timing of hundreds of clustered genes. These findings highlight an underappreciated level of lineage specificity in cell cycle regulation.

Research Square 2024-11-06 Preprint (No Snippets API) Sun J, Zeng Y.
Show Full Abstract

<title>Abstract</title> <p>Introduction: Celiac disease (CeD) is an autoimmune condition characterized by a reversible inflammatory reaction in the mucous membrane of the small intestine. Nevertheless, there is a limited availability of efficient control approaches. Prior research has demonstrated that pharmacological targets supported by genetic evidence can greatly enhance the efficacy of drug development. Hence, the study aims to integrate transcriptomic and proteomic information to identify candidate targets for CeD. Methods The study employed proteome-wide Mendelian randomization (MR) analysis of circulating plasma proteins to investigate their causal association with CeD. The candidate targets for CeD were further assessed employing colocalization analysis, transcriptome-wide summary-data-based Mendelian randomization (SMR) analysis, multimarker analysis of genomic annotation (MAGMA) gene-based analysis, and bulk RNAseq-based differential expression analysis. For the proteins that were identified, extended Phenome-wide association studies (PheWAS) were conducted to assess their side-effect profiles, while the DGIdb database provided information on the approved or investigated drugs for candidate targets. Results Systematic MR analysis identified 22 candidate targets for CeD. Among the proteins analyzed, BTN2A1 passed all subsequent verification analyses. Additionally, three proteins, including CatH, IL-18R1, and PTPRC, passed the majority of the subsequent verification analyses. The other 18 proteins were also candidate targets (Trehalase, CD226, SH2B3, ICOSLG, ULK3, Park7, ALDH2, RABEP1, TNFRSF9, COL11A2, GNPDA1, IL-1RL1, B3galt6, TNFSF11, CCL21, BTN3A3, OLFM2 and Colipase). Conclusions The study employed a combination of human transcriptomic and proteomic information, employing several analytical methods. As a result, 22 proteins, divided into four tiers, were identified as prospective therapeutic targets for CeD.</p>

Also flagged:RAGEpathogenesisagingSynthesisPyrazolineage‐related disorders
Journal Article 2024-11-05 No Snippets Dascălu AE, Furman C, Lancel S, Lipka E, Liberelle M, Boulanger E, Ghinet A.
Show Full Abstract

In the context of age-related disorders, the receptor of advanced glycation end products (RAGE), plays a pivotal role in the pathogenesis of these conditions by triggering downstream signaling pathways associated with chronic inflammation and oxidative stress. Targeting this inflammaging phenomenon with RAGE antagonists holds promise for interventions with broad implications in healthy aging and the management of age-related conditions. This study explores the structure-activity relationship (SAR) of pyrazoline-based RAGE antagonists synthesized using an ultrasound-assisted green one-pot two-steps methodology. Our investigation identifies phenylurenyl-pyrazoline 2 g as a promising candidate, demonstrating superior efficiency compared to the reference antagonist Azeliragon (IC<sub>50</sub>=13 μM). Compound 2 g exhibits potent inhibition of the AGE2-BSA/sRAGE interaction (IC<sub>50</sub>=22 μM) and favorable affinity in Microscale Thermophoresis (MST) assays (K<sub>d</sub>=17.1 μM), along with a favorable safety profile, with no apparent cytotoxicity observed in vitro in the MTS assay. These findings underscore the potential of pyrazoline-derived RAGE antagonists as therapeutic agents for addressing age-related disorders.

Also flagged:autoimmune thyroiditisthyroid nodulesthyroid tumorsthyroidRETneoplasms
Journal Article 2024-11-05 No Snippets Kujdowicz M, Januś D, Radliński J, Kiszka-Wiłkojć A, Taczanowska-Niemczuk A, Młynarski D, Górecki W, Starzyk JB, Adamek D.
Show Full Abstract

The management of thyroid nodules is guided by the cytological classification provided by The Bethesda System for Reporting Thyroid Cytology. Notably, the biology of thyroid tumors in pediatric patients differs from that in adults, and there is limited research focused on pediatric cases. This study aimed to assess the effectiveness of the Bethesda system in pediatric patients treated at the largest tertiary pediatric thyroid center in Poland between 2015 and 2023. A retrospective analysis was conducted on 566 patients with thyroid nodules, of whom 555 underwent fine-needle aspiration biopsy (FNAB). A total of 217 patients underwent thyroid surgery. Of these, 206 had previously undergone FNAB with cytological evaluation at our center, while 11 patients underwent thyroid surgery due to a RET mutation or the need for an extended procedure. The initial FNAB results showed distribution across Bethesda categories as follows: 7.6% for category I, 54.6% for category II, 20.9% for category III, 4.1% for category IV, 7.6% for category V, and 5.6% for category VI. Among patients who underwent surgery, the distribution of Bethesda categories I through VI was 2.9%, 25.2%, 29.1%, 8.3%, 19.4%, and 15%, respectively. The risk of malignancy (ROM) from the initial FNAB was estimated at 33.3%, 11.5%, 22.2%, 4.8%, 84.4%, and 96.8% for Bethesda categories I through VI, respectively. In patients with autoimmune thyroiditis (AIT), the ROM was higher than in non-AIT patients for Bethesda categories I through IV, while it was lower in category VI. The sensitivity for detecting non-benign neoplasms across Bethesda categories III through VI was approximately 86% in both AIT and non-AIT patients. However, for papillary thyroid carcinoma, sensitivity in Bethesda categories V and VI was 86% in non-AIT patients but decreased to 61.5% in AIT patients. These findings emphasize the importance of considering surgical intervention in pediatric patients with Bethesda III-VI cytology, particularly in those with AIT.

MLLT10
Also flagged:hematological neoplasmsCALMAF10hematological malignanciesacute myeloid leukemiaAML
Journal Article 2024-11-05 ✓ 2 Snippets Wang JN, Ye B, Cheng F, Yang L, Hu Y, Zheng G, Cai Z, Yu J, Wu W.
In-Text Gene Mentions

…<i>PICALM-MLLT10</i> fusion gene in…

…oduction</h4><i>PICALM</i>-<i>MLLT10</i>, formerly <i>CALM-AF10</i…

Show Full Abstract

<h4>Introduction</h4><i>PICALM</i>-<i>MLLT10</i>, formerly <i>CALM-AF10</i>, is a rarely reported fusion gene in hematological malignancies, especially in Asian people.<h4>Case presentations</h4>Six patients with <i>PICALM-MALLT10</i> fusion gene were identified at the First Affiliated Hospital, Zhejiang University School of Medicine, China between October 2019 and October 2023, with a median age of 25 years. Clinical diagnoses included acute myeloid leukemia (AML) in 2 patients, acute lymphoblastic leukemia (ALL) in 3, and mixed phenotype acute leukemia (MPAL) in 1. The prognosis of the patients was poor, and three patients died within 1 year despite of intensive treatment.<h4>Conclusion</h4>Patients with <i>PLCALM-MALLT10</i> can be diagnosed as AML, ALL, MPAL, and other extremely rare hematological malignancies, with mixed clinical manifestations and poor survival. Novel and intensive therapies, including hematopoietic stem cell transplantation, chimeric antigen receptor T-cell immunotherapy, and targeted agents such as the Bcl-2 inhibitor, could be considered in the future.

HTT
Also flagged:ADHDserotonin transporterDepressionsubstance useposttraumatic stress disordersPulmonary diseases
Journal Article 2024-11-05 ✓ 5 Snippets Ziegler GC, Groß S, Boreatti A, Heine M, McNeill RV, Kranz TM, Romanos M, Jacob CP, Reif A, Kittel-Schneider S, Lesch KP.
In-Text Gene Mentions

…ltered serotonin transporter (5-HTT, SERT, SLC6A4 )…

…patients, with lower5-HTTand lower 5-HT…

…Lower5-HTTbinding potential was…

…serotonin and the5-HTTgene in suicidal…

5-HTTis a classical…

Show Full Abstract

Adult ADHD is associated with increased risk for suicide attempts, as indicated by investigations of population- and community-based cohorts. However, there is little data regarding suicide attempts in a clinical setting. To address this, we used a comprehensively phenotyped clinical adult ADHD (aADHD) cohort to assess to which extent comorbidity, psychosocial adversity, personality, and ADHD symptoms contribute to suicidal behavior in ADHD. Furthermore, we investigated a triallelic variation in the serotonin transporter-linked polymorphic region (5-HTTLPR), which has previously been associated with suicidal behavior. Depression, substance use, eating, and posttraumatic stress disorders were independently associated with past suicide attempts, whereas anxiety, somatoform, and obsessive-compulsive spectrum disorders showed no association. Pulmonary diseases also showed an association with suicidal behavior. Psychosocial factors including occupational status, marital status/living situation, externalizing behavior and psychiatric family history were strongly associated with past suicide attempts. ADHD symptoms of inattention and hyperactivity/impulsivity were not associated with past suicide attempts after adjustment for psychiatric comorbidity and psychosocial adversity. However, the personality trait of neuroticism fully mediated the association between depression and suicidal behavior. 5-HTTLPR was not associated with suicidal behavior, but an interaction with ADHD symptoms and subtype was found. Our data suggest that psychiatric comorbidity and psychosocial adversity are key factors for suicidal behavior in aADHD, with neuroticism representing a critical mediator of the association between depression and suicidality. Further research, preferentially with longitudinal study designs is needed to better understand causal factors for suicidal behavior to enable effective preventive action.

SOX6
Also flagged:cerebral ischemiagene expressiondeathTrem2brain injuryorganization
Journal Article 2024-11-05 ✓ 1 Snippet Zucha D, Abaffy P, Kirdajova D, Jirak D, Kubista M, Anderova M, Valihrach L.
In-Text Gene Mentions

…cells (OPC; Pdgfra,Sox6), newly formed…

Show Full Abstract

The role of nonneuronal cells in the resolution of cerebral ischemia remains to be fully understood. To decode key molecular and cellular processes that occur after ischemia, we performed spatial and single-cell transcriptomic profiling of the male mouse brain during the first week of injury. Cortical gene expression was severely disrupted, defined by inflammation and cell death in the lesion core, and glial scar formation orchestrated by multiple cell types on the periphery. The glial scar was identified as a zone with intense cell-cell communication, with prominent ApoE-Trem2 signaling pathway modulating microglial activation. For each of the three major glial populations, an inflammatory-responsive state, resembling the reactive states observed in neurodegenerative contexts, was observed. The recovered spectrum of ischemia-induced oligodendrocyte states supports the emerging hypothesis that oligodendrocytes actively respond to and modulate the neuroinflammatory stimulus. The findings are further supported by analysis of other spatial transcriptomic datasets from different mouse models of ischemic brain injury. Collectively, we present a landmark transcriptomic dataset accompanied by interactive visualization that provides a comprehensive view of spatiotemporal organization of processes in the postischemic mouse brain.

Also flagged:synthesisdegradationnucleasesviral infectionsbindingtranscription factors
Journal Article 2024-11-05 No Snippets Mikutis S, Bernardes GJL.
Show Full Abstract

The vast majority of the human genome codes for RNA, but RNA-targeting therapeutics account for a small fraction of approved drugs. As such, there is great incentive to improve old and develop new approaches to RNA targeting. For many RNA targeting modalities, just binding is not sufficient to exert a therapeutic effect; thus, targeted RNA degradation and induced decay emerged as powerful approaches with a pronounced biological effect. This review covers the origins and advanced use cases of targeted RNA degrader technologies grouped by the nature of the targeting modality as well as by the mode of degradation. It covers both well-established methods and clinically successful platforms such as RNA interference, as well as emerging approaches such as recruitment of RNA quality control machinery, CRISPR, and direct targeted RNA degradation. We also share our thoughts on the biggest hurdles in this field, as well as possible ways to overcome them.

PTGIS
Also flagged:cancerTumorsCD45keratinizationexportinsRho GTPase
Journal Article 2024-11-05 ✓ 1 Snippet Del Toro K, Sayaman R, Thi K, Licon-Munoz Y, Hines WC.
In-Text Gene Mentions

…synthases PTGES, PTGS2,PTGIS, and PTGDS; the…

Show Full Abstract

A fundamental question in biology, central to our understanding of cancer and other pathologies, is determining how different cell types coordinate to form and maintain tissues. Recognizing the distinct features and capabilities of the cells that compose these tissues is critical. Unfortunately, the complexity of tissues often hinders our ability to distinguish between neighboring cell types and, in turn, scrutinize their transcriptomes and generate reliable and tractable cell models for studying their inherently different biologies. We have recently introduced a novel method that permits the identification and purification of the 12 cell types that compose the human breast-nearly all of which could be reliably propagated in the laboratory. Here, we explore the nature of these cell types. We sequence mRNAs from each purified population and investigate transcriptional patterns that reveal their distinguishing features. We describe the differentially expressed genes and enriched biological pathways that capture the essence of each cell type, and we highlight transcripts that display intriguing expression patterns. These data, analytic tools, and transcriptional analyses form a rich resource whose exploration provides remarkable insights into the inner workings of the cell types composing the breast, thus furthering our understanding of the rules governing normal cell and tissue function.

DCC
Also flagged:PDlipopolysaccharidebehavioraldopamineα-synucleinalpha synuclein
Journal Article 2024-11-05 ✓ 2 Snippets Massaro Cenere M, Tiberi M, Paldino E, D'Addario SL, Federici M, Giacomet C, Cutuli D, Matteocci A, Cossa F, Zarrilli B, Casadei N, Ledonne A, Petrosini L, Berretta N, Fusco FR, Chiurchiù V, Mercuri NB.
In-Text Gene Mentions

…neuronal cell count (TH-/DCC- negative neuron) among…

…of TH - /DCC+ neurons was…

Show Full Abstract

Increasing efforts have been made to elucidate how genetic and environmental factors interact in Parkinson's disease (PD). In the present study, we assessed the development of symptoms on a genetic PD rat model that overexpresses human α-synuclein (Snca<sup>+/+</sup>) at a presymptomatic age, exposed to a pro-inflammatory insult by intraperitoneal injection of lipopolysaccharide (LPS), using immunohistology, high-dimensional flow cytometry, constant potential amperometry, and behavioral analyses. A single injection of LPS into WT and Snca<sup>+/+</sup> rats triggered long-lasting increase in the activation of pro-inflammatory microglial markers, monocytes, and T lymphocytes. However, only LPS Snca<sup>+/+</sup> rats showed dopaminergic neuronal loss in the substantia nigra pars compacta (SNpc), associated with a reduction in the release of evoked dopamine in the striatum. No significant changes were observed in the behavioral domain. We propose our double-hit animal as a reliable model to investigate the mechanisms whereby α-synuclein and inflammation interact to promote neurodegeneration in PD.

DCC
Also flagged:Multiple sclerosisMSchronic inflammatory diseasenucleusCD68CD163
Journal Article 2024-11-05 ✓ 1 Snippet Lerma-Martin C, Badia-I-Mompel P, Ramirez Flores RO, Sekol P, Schäfer PSL, Riedl CJ, Hofmann A, Thäwel T, Wünnemann F, Ibarra-Arellano MA, Trobisch T, Eisele P, Schapiro D, Haeussler M, Hametner S, Saez-Rodriguez J, Schirmer L.
In-Text Gene Mentions

…, SLC22A17 ,DCC, BRCA2 ).…

Show Full Abstract

Multiple sclerosis (MS) is a chronic inflammatory disease of the central nervous system. Inflammation is gradually compartmentalized and restricted to specific tissue niches such as the lesion rim. However, the precise cell type composition of such niches, their interactions and changes between chronic active and inactive stages are incompletely understood. We used single-nucleus and spatial transcriptomics from subcortical MS and corresponding control tissues to map cell types and associated pathways to lesion and nonlesion areas. We identified niches such as perivascular spaces, the inflamed lesion rim or the lesion core that are associated with the glial scar and a cilia-forming astrocyte subtype. Focusing on the inflamed rim of chronic active lesions, we uncovered cell-cell communication events between myeloid, endothelial and glial cell types. Our results provide insight into the cellular composition, multicellular programs and intercellular communication in tissue niches along the conversion from a homeostatic to a dysfunctional state underlying lesion progression in MS.

Also flagged:arylamideshydroxyamideheterocycleterephthalic acid amidesdegradation
Journal Article 2024-11-05 No Snippets Stappert M, Kohnhäuser D, Seedorf T, Coetzee J, Rox K, Fuchs HLS, Cirnski K, Leitner C, Herrmann J, Kirschning A, Müller R, Brönstrup M.
Show Full Abstract

Novel scaffolds for broad-spectrum antibiotics are rare and in strong demand because of the increase in antimicrobial resistance. The cystobactamids, discovered from myxobacterial sources, have a unique hexapeptidic scaffold with five arylamides and possess potent, resistance-breaking properties. This study investigates the role of the central D-ring pharmacophore in cystobactamids, a para-aminobenzoic acid (PABA) moiety that is additionally substituted by hydroxy and isopropoxy functions. We varied the two oxygenated substituents and replaced both amide connectors with bioisosteres. Synthetic routes were developed that included metal-mediated aromatic functionalization or heterocycle formations, leading to 19 novel analogues. The antibiotic efficacy of all analogues was determined against bacteria from the ESKAPE pathogen panel. While the replacement and the repositioning of hydroxy and isopropoxy substituents was not advantageous, exchanging PABA by terephthalic acid amides led to the highly potent analogue 42 with broad-spectrum activity, insensitivity towards AlbD-mediated degradation and promising pharmacokinetic properties in mice. The study highlights the steep structure-activity relationships in the tetrasubstituted D-ring and a surprisingly favorable reversion of the amide connecting C and D.

Also flagged:ALSneurodegenerative diseasedeathfailureSOD1swallowing
Journal Article 2024-11-05 No Snippets Howard J, Chaouch A, Douglas AGL, MacLeod R, Roggenbuck J, McNeill A.
Show Full Abstract

Motor neuron disease (MND), also referred to as amyotrophic lateral sclerosis (ALS), is a monogenic disease in a minority of cases, with autosomal dominant inheritance. Increasing numbers of people with MND are requesting genetic testing, and indeed receiving a genetic diagnosis. Consequently, requests for genetic counselling and predictive testing (i.e. of unaffected family members) are similarly expected to rise, alongside pre-symptomatic clinical trials. Despite this, there is no evidence-based guideline for predictive genetic testing in MND. This paper provides an overview of the genomic basis of MND, focusing specifically on the most common monogenic causes of MND. It then lays out the complexities of MND predictive testing, including the genetic landscape characterised by incomplete penetrance, clinical and genetic heterogeneity, and an oligogenic mechanism of pathogenesis in some cases. Additionally, there is limited research on the psychosocial impact of predictive genetic testing for MND, with studies suggesting potential difficulty in adjusting to the news, in part due to a lack of support and follow-up. This underscores a case for evidence-based, disease-specific guidance for predictive testing in MND.

CSE1L
Also flagged:JMJD6interferongenes expressioninfectious bronchitisIBimmune responses
Journal Article 2024-11-05 ✓ 1 Snippet Yan W, Fu X, Li H, Wang K, Song C, Hou C, Lei C, Wang H, Yang X.
In-Text Gene Mentions

…such as DYRK,CSE1L, CK1, and KPNB1.…

Show Full Abstract

Infectious bronchitis virus (IBV) is the causative agent of infectious bronchitis (IB), a severe disease that primarily affects young chickens and poses a significant challenge to the global poultry industry. Understanding the complex interaction between the virus and its host is vital for developing innovative antiviral strategies. Long non-coding RNA (lncRNA) plays a crucial role in regulating host antiviral immune responses. Our previous studies have shown that IBV infection disrupts the stability of lncRNA in host cells, indicating a potential regulatory role for lncRNA in IBV pathogenesis. It is still not clear how lncRNA precisely modulates IBV replication. In this study, we observed down-regulation ofMSTRG.26120.58 (named lncRNA-DRNR) expression in various chicken cell lines upon IBV infection. We demonstrated that silencing lncRNA-DRNR using siRNA enhances intracellular replication of IBV. Through exploring genes encoding proteins upstream and downstream of lncRNA-DRNR within a 100 kb range, we identified chJMJD6 (chicken JMJD6) as a potential target gene negatively regulated by lncRNA-DRNR expression levels. Furthermore, chJMJD6 inhibits STAT1 methylation, thereby affecting the induction of interferon-stimulated genes (ISGs) through the activation of the IFN-β-mediated JAK-STAT signalling pathway, ultimately promoting the intracellular replication of IBV. In summary, our findings reveal the critical role played by lncRNA-DRNR during IBV infection, providing novel insights into mechanisms underlying coronavirus-induced disruption in lncRNA stability.

Also flagged:gene expressionatherosclerosisheart failuremyocardial infarctioncardiovascular diseasepathogenesis
Journal Article 2024-11-05 No Snippets Nazir A, Uwishema O, Shariff S, Franco WXG, El Masri N, Ayele ND, Munyangaju I, Alzain FE, Wojtara M.
Show Full Abstract

<h4>Introduction</h4>Cardiovascular diseases contribute significantly to global morbidity and mortality. MicroRNAs are crucial in the development and progression of these diseases by regulating gene expression in various cells and tissues. Their roles in conditions like atherosclerosis, heart failure, myocardial infarction, and arrhythmias have been widely researched.<h4>Materials and methods</h4>The present study provides an overview of existing evidence regarding miRNAs' role in cardiovascular disease pathogenesis. Furthermore, the study examines current state-of-the-art technologies used in the study of miRNAs in cardiovascular disease. As a final point, we examine how miRNAs may serve as disease biomarkers, therapeutic targets, and prognostic indicators.<h4>Results</h4>In cardiology, microRNAs, small noncoding RNA molecules, are crucial to the posttranscriptional regulation of genes. Their role in regulating cardiac cell differentiation and maturation is critical during the development of the heart. They maintain the cardiac function of an adult heart by contributing to its electrical and contractile activity. By binding to messenger RNA molecules, they inhibit protein translation or degrade mRNA. Several cardiovascular diseases are associated with dysregulation of miRNAs, including arrhythmias, hypertension, atherosclerosis, and heart failure. miRNAs can be used as biomarkers to diagnose and predict diseases as well as therapeutic targets. A variety of state-of-the-art technologies have aided researchers in discovering, profiling, and analyzing miRNAs, including microarray analysis, next-generation sequencing, and others.<h4>Conclusion</h4>Developing new diagnostics and therapeutic approaches is becoming more feasible as researchers refine their understanding of miRNA function. Ultimately, this will reduce the burden of cardiovascular disease around the world.

OLFM4
Also flagged:hematoxylinnucleusCellsegmentationsegmentationssynthesis
Journal Article 2024-11-05 ✓ 1 Snippet Remedios LW, Bao S, Remedios SW, Lee HH, Cai LY, Li T, Deng R, Newlin NR, Saunders AM, Cui C, Li J, Liu Q, Lau KS, Roland JT, Washington MK, Coburn LA, Wilson KT, Huo Y, Landman BA.
In-Text Gene Mentions

…DAPI, SMA, Sox9,OLFM4, Lysozyme, CD45, CD20,…

Show Full Abstract

<h4>Purpose</h4>Cells are building blocks for human physiology; consequently, understanding the way cells communicate, co-locate, and interrelate is essential to furthering our understanding of how the body functions in both health and disease. Hematoxylin and eosin (H&E) is the standard stain used in histological analysis of tissues in both clinical and research settings. Although H&E is ubiquitous and reveals tissue microanatomy, the classification and mapping of cell subtypes often require the use of specialized stains. The recent CoNIC Challenge focused on artificial intelligence classification of six types of cells on colon H&E but was unable to classify epithelial subtypes (progenitor, enteroendocrine, goblet), lymphocyte subtypes (B, helper T, cytotoxic T), and connective subtypes (fibroblasts). We propose to use inter-modality learning to label previously un-labelable cell types on H&E.<h4>Approach</h4>We took advantage of the cell classification information inherent in multiplexed immunofluorescence (MxIF) histology to create cell-level annotations for 14 subclasses. Then, we performed style transfer on the MxIF to synthesize realistic virtual H&E. We assessed the efficacy of a supervised learning scheme using the virtual H&E and 14 subclass labels. We evaluated our model on virtual H&E and real H&E.<h4>Results</h4>On virtual H&E, we were able to classify helper T cells and epithelial progenitors with positive predictive values of 0.34±0.15 (prevalence 0.03±0.01 ) and 0.47±0.1 (prevalence 0.07±0.02 ), respectively, when using ground truth centroid information. On real H&E, we needed to compute bounded metrics instead of direct metrics because our fine-grained virtual H&E predicted classes had to be matched to the closest available parent classes in the coarser labels from the real H&E dataset. For the real H&E, we could classify bounded metrics for the helper T cells and epithelial progenitors with upper bound positive predictive values of 0.43±0.03 (parent class prevalence 0.21) and 0.94±0.02 (parent class prevalence 0.49) when using ground truth centroid information.<h4>Conclusions</h4>This is the first work to provide cell type classification for helper T and epithelial progenitor nuclei on H&E.

Also flagged:Legius syndromeSPRED1membranelocalizationRasERK
Journal Article 2024-11-05 No Snippets Hirata Y, Brems H, Van der Auweraer S, Ohyagi M, Iizuka M, Mise-Omata S, Ito M, Messiaen L, Mizuno S, Takahashi S, Legius E, Yoshimura A.
Show Full Abstract

The SPRED family proteins act as negative regulators of the Ras-ERK pathway: the N-terminal EVH1 domain interacts with the Ras-GAP domain (GRD) of the NF1 protein, while the C-terminal Sprouty-related (SPR) domain promotes membrane localization of SPRED, thereby recruiting NF-1 to Ras. Loss-of-function mutations in the hSPRED1 cause Legius syndrome in an autosomal dominant manner. In this study, we investigated the effects of missense mutations in the SPR domain identified in patients with Legius syndrome. Among the 18 mutations we examined, six (C368S, M369L, V408E, P415A, P415L, and P422R) have defects in the palmitoylation of the SPRED1 protein, losing plasma membrane localization and forming cytoplasmic granular aggregates. To evaluate the in vivo effects of SPR mutations, knock-in (KI) mice with P415A and P415V substitutions or M417Afs∗4, a C-terminal 28 amino acid deletion, were generated. All these KI mice exhibited cranial malformations, a characteristic feature of Legius syndrome. However, both P415A and P415V mutants formed granular aggregates, whereas M417Afs∗4 showed a diffuse cytoplasmic distribution, and Spred1<sup>P415A</sup> and Spred1<sup>P415V</sup> mice, but not Spred1<sup>M417Afs∗4</sup> mice, developed cerebellar ataxia and Purkinje cell loss with age. These data suggest that in addition to loss of palmitoylation, the C-terminal region is required for the granular aggregate formation and Purkinje cell loss. The autophagy inducer spermidine rescued the ataxia phenotypes and Purkinje cell loss in Spred1<sup>P415A</sup> mice. These results suggest that some, but not all, SPR mutations that lose lipid modification induce abnormal cytoplasmic aggregation, which could be a target for autophagic clearance, and potentially cause neurodegenerative diseases.

DCC
Also flagged:bindingRNA polymerase IIPol IIsmall nuclear ribonucleoproteinAIDSCOVID-19
Journal Article 2024-11-05 ✓ 1 Snippet Liu H, Zhuo C, Gao J, Zeng C, Zhao Y.
In-Text Gene Mentions

DCC

Show Full Abstract

RNA complexes are essential components in many cellular processes. The functions of these complexes are linked to their tertiary structures, which are shaped by detailed interface information, such as binding sites, interface contact, and dynamic conformational changes. Network-based approaches have been widely used to analyze RNA complex structures. With their roots in the graph theory, these methods have a long history of providing insight into the static and dynamic properties of RNA molecules. These approaches have been effective in identifying functional binding sites and analyzing the dynamic behavior of RNA complexes. Recently, the advent of artificial intelligence (AI) has brought transformative changes to the field. These technologies have been increasingly applied to studying RNA complex structures, providing new avenues for understanding the complex interactions within RNA complexes. By integrating AI with traditional network analysis methods, researchers can build more accurate models of RNA complex structures, predict their dynamic behaviors, and even design RNA-based inhibitors. In this review, we introduce the integration of network-based methodologies with AI techniques to enhance the understanding of RNA complex structures. We examine how these advanced computational tools can be used to model and analyze the detailed interface information and dynamic behaviors of RNA molecules. Additionally, we explore the potential future directions of how AI-integrated networks can aid in the modeling and analyzing RNA complex structures.

OLFM4
Also flagged:reverse transcriptionpolymeraseHematoxylingene expressionLgr5Si
Journal Article 2024-11-05 ✓ 5 Snippets An S, Huh H, Ko JS, Moon JS, Cho KY.
In-Text Gene Mentions

…a decrease inOlfm4and Muc2 expression…

…4 ), whereasOlfm4gene expression was…

…decreased expression ofOlfm4and Muc2 ,…

…(stem cell marker),Olfm4(stem cell marker),…

…expression and decreasedOlfm4gene expression in…

Show Full Abstract

<h4>Purpose</h4>This study aimed to establish and characterize patient-derived intestinal organoids (PDOs) from children with Crohn's disease (CD).<h4>Methods</h4>To generate PDOs, endoscopic biopsy specimens were obtained from non-inflamed duodenal bulbs of normal controls and CD patients. To verify the presence of PDOs, histological staining and quantitative reverse transcription polymerase chain reaction (RT-qPCR) analyses were performed.<h4>Results</h4>PDOs were successfully established in normal controls (n=2) and CD patients (n=2). Hematoxylin and eosin staining of formalin-fixed, paraffin-embedded PDO sections revealed crypt and villus structures, whereas immunofluorescence staining with EpCAM and DAPI confirmed the epithelial-specific architecture of the PDOs. RT-qPCR results revealed a significant increase in <i>Lgr5</i>, <i>Si</i>, and <i>Chga</i> gene expression and a decrease in <i>Olfm4</i> and <i>Muc2</i> expression in CD patients compared to normal controls, suggesting altered stem cell activity and mucosal barrier function (<i>p</i><0.05).<h4>Conclusion</h4>We successfully established and characterized PDOs in children with CD, providing a valuable tool for understanding the pathophysiology of the disease and evaluating potential therapeutic approaches. The differential gene expression of PDOs in CD patients might be caused by the complex interplay between epithelial adaptation and inflammation in the intestinal epithelium.

SERPINC1
Also flagged:Curacozolecyanobactintranslationallypeptidesazolephenyloxazole
Journal Article 2024-11-05 ✓ 4 Snippets Hollands S, Tasch J, Simon DJ, Wassouf D, Barber I, Gessner A, Bechthold A, Zechel DL.
In-Text Gene Mentions

…of czl B1,czl C1C1, and czl…

…of czl D,czl C1C1, czl F,…

…While bothczl C1C1 and czl…

…r BGCs, onlyczl C1C1 has a…

Show Full Abstract

Curacozole is representative of a cyanobactin-like sub-family of ribosomally synthesized and post-translationally modified peptides (RiPPs). The molecule is distinguished by its small macrocyclic structure, a poly-azole sequence that includes a phenyloxazole moiety, and a d-<i>allo</i>-Ile residue. The enzymatic steps required for its formation are not well understood. The predicted biosynthetic gene cluster (BGC) for curacozole in <i>Streptomyces curacoi</i> is cryptic, but is shown to be potently activated upon constitutive expression of the <i>bldA</i>-specified Leu-tRNA(UUA) molecule. Heterologous expression and gene deletion studies have defined the minimum BGC as consisting of seven genes, <i>czl</i>A, D, E, B1, C1, F, and BC. The biosynthetic pathway is highly substrate tolerant, accepting six variants of the precursor peptide CzlA to form new curacozole derivatives. This includes replacing the phenyloxazole moiety of curacozole with indole and <i>p</i>-hydroxyphenyloxazole groups by conversion of the corresponding CzlA Phe18Trp and Phe18Tyr variants. <i>In vitro</i> experiments with purified enzymes demonstrate that CzlD and CzlBC perform cyclodehydration and dehydrogenation reactions, respectively, to form a single oxazole from Ser 22 of CzlA. The curacozole BGC is flanked by <i>czl</i>I, a non-essential but conserved gene of unknown function. <i>In vitro</i> studies demonstrate CzlI to be a non-heme iron(ii) and 2-oxoglutarate-dependent dioxygenase, catalyzing the hydroxylation of Phe18 on CzlA to form the CzlA Phe18Tyr variant, which is then processed to form the <i>p</i>-hydroxyphenyloxazole derivative of curacozole. Overall, this work highlights the amenability of RiPP biosynthesis for engineering the production of new compounds and adds to the repertoire of known RiPP enzymes.

Also flagged:Agingdeathhormonesimmune responsesmetabolismcerebral ischemia
Journal Article 2024-11-05 No Snippets Zhou D, Lin Y, Han Z, Zhang Z, Lin L, Lin S, Yang Q.
Show Full Abstract

With the progression of global aging, neurological diseases in elderly individuals have aroused widespread interest among researchers. Imbalances in the homeostasis of neuronal microenvironments, including neural progenitor cells and microglia, are the leading cause of worsening neurodegenerative diseases. The aging of various glial cells can further lead to abnormal functions in the central nervous system (CNS). Recent studies have shown that aging plays a vital role in a variety of degenerative diseases, including Huntington's disease (HD). In this manuscript, we describe the molecular mechanisms of aging, the cellular constitution of the neural microenvironment and the progression of aging in various neurodegenerative diseases, providing new targets and perspectives for the clinical treatment of various neurodegenerative diseases.

Also flagged:diabetes mellituschronic renal failureDNextracellulardiabetic nephropathyIFNAR2
Journal Article 2024-11-05 No Snippets Deng J, Wu P.
Show Full Abstract

<h4>Background</h4>Diabetic nephropathy (DN) is a common microvascular complication of diabetes mellitus and the main cause of chronic renal failure. This study explored the potential immunomodulation-related genes (IRGs) in DN using bioinformatics.<h4>Methods</h4>IRGs were identified using GeneCards, and differentially expressed genes were identified using the GSE99339, GSE96804, and GSE30122 datasets. We conducted enrichment analyses using Gene Ontology, gene set enrichment analysis (GSEA), and Kyoto Encyclopedia of Genes and Genomes to identify the associated signaling pathways. Prognostic models were constructed using Least Absolute Shrinkage and Selection Operator regression. The predictive power of IRGs was evaluated using receiver operating characteristic (ROC) curves. Furthermore, we utilized ssGSEA to determine the relative abundance of immune cell infiltration. The expression of five significant IRGs was further validated using immunohistochemistry (IHC) in individuals with DN and real-time PCR (RT-PCR) in animal experiments.<h4>Results</h4>In total, 17 immunomodulation-related differentially expressed genes were identified, which were enriched in immune-associated pathways and inflammation. GSEA unveiled substantial enrichments in metabolic irregularities and the structural composition of the extracellular matrix. ROC analysis results revealed that the diagnostic efficacy of <i>IFNAR2</i> and <i>CASP3</i> was comparatively high. Notably, we identified potential IRGs for DN, including <i>CASP3</i>, <i>LGALS9</i>, and <i>SST</i>, using IHC and RT-PCR.<h4>Conclusions</h4><i>CASP3, LGALS9,</i> and <i>SST</i> are potential IRGs in patients with DN. Our findings may offer a theoretical basis for developing more focused and innovative immunotherapy approaches for patients with DN.

POU3F2
Also flagged:Transcription Factorsdiabetic foot ulcersangiogenesisextracellulardiabetesoxygen
Journal Article 2024-11-05 ✓ 1 Snippet Rai V.
In-Text Gene Mentions

…with BMP4 andPOU3F2; ETV3 with FOXL2,…

Show Full Abstract

Non-healing diabetic foot ulcers (DFUs) not only significantly increase morbidity and mortality but also cost a lot and drain healthcare resources. Persistent inflammation, decreased angiogenesis, and altered extracellular matrix remodeling contribute to delayed healing or non-healing. Recent studies suggest an increasing trend of DFUs in diabetes patients, and non-healing DFYs increase the incidence of amputation. Despite the current treatment with offloading, dressing, antibiotics use, and oxygen therapy, the risk of amputation persists. Thus, there is a need to understand the molecular and cellular factors regulating healing in DFUs. The ongoing research based on proteomics and transcriptomics has predicted multiple potential targets, but there is no definitive therapy to enhance healing in chronic DFUs. Increased or decreased expression of various proteins encoded by genes, whose expression transcriptionally and post-transcriptionally is regulated by transcription factors (TFs) and microRNAs (miRs), regulates DFU healing. For this study, RNA sequencing was conducted on 20 DFU samples of ulcer tissue and non-ulcerated nearby healthy tissues. The IPA analysis revealed various activated and inhibited transcription factors and microRNAs. Further network analysis revealed interactions between the TFs and miRs and the molecular targets of these TFs and miRs. The analysis revealed 30 differentially expressed transcription factors (21 activated and 9 inhibited), two translational regulators (RPSA and EIF4G2), and seven miRs, including mir-486, mir-324, mir-23, mir-186, mir-210, mir-199, and mir-338 in upstream regulators (<i>p</i> < 0.05), while causal network analysis (<i>p</i> < 0.05) revealed 28 differentially expressed TFs (19 activated and 9 inhibited), two translational regulators (RPSA and EIF4G2), and five miRs including mir-155, mir-486, mir-324, mir-210, and mir-1225. The protein-protein interaction analysis revealed the interaction of various novel proteins with the proteins involved in regulating DFU pathogenesis and healing. The results of this study highlight many activated and inhibited novel TFs and miRs not reported in the literature so far, as well as the targeted molecules. Since proteins are the functional units during biological processes, alteration of gene expression may result in different proteoforms and protein species, making the wound microenvironment a complex protein interaction (proteome complexity). Thus, investigating the effects of these TFs and miRs on protein expression using proteomics and combining these results with transcriptomics will help advance research on DFU healing and delineate potential therapeutic strategies.

Also flagged:MeganucleasesI-SceInucleasesZinc finger nucleasestranscription activator-like effector nucleasesCas9
Journal Article 2024-11-05 No Snippets Fu B, Ma H, Huo X, Zhu Y, Liu D.
Show Full Abstract

Pigs have long been integral to human society for their roles in agriculture and medicine. Consequently, there is an urgent need for genetic improvement of pigs to meet human dual needs for medicine and food. In agriculture, gene editing can improve productivity traits, such as growth rate and disease resistance, which could lower farming costs and benefit consumers through enhanced meat quality. In biomedical research, gene-edited pigs offer invaluable resources as disease models and in xenotransplantation, providing organs compatible with human physiology. Currently, with CRISPR technology, especially the CRISPR/Cas9 system emerging as a transformative force in modern genetics, pigs are not only sources of sustenance but also cornerstones of biomedical innovation. This review aims to summarize the applications of CRISPR/Cas9 technology in developing pigs that serve dual roles in agriculture and biomedical applications. Compared to ZFNs and TALENs, the CRISPR/Cas9 system offers several advantages, including higher efficiency, greater specificity, ease of design and implementation, and the capability to target multiple genes simultaneously, significantly streamlining the process of genetic modifications in complex genomes. Therefore, CRISPR technology supports the enhancement of traits beneficial for agricultural productivity and facilitates applications in medicine. Furthermore, we must acknowledge the inherent deficiencies and technical challenges of the CRISPR/Cas9 technology while also anticipating emerging technologies poised to surpass CRISPR/Cas9 as the next milestones in gene editing. We hypothesize that with the continuous advancements in gene editing technologies and successful integration of traits beneficial to both agricultural productivity and medical applications, the goal of developing dual-purpose pigs for both agricultural and medical use can ultimately be achieved.

Also flagged:HemoglobinHemoglobinopathyBeta ThalassemiaHemoglobinopathiesβ-thalassemiasickle cell disease
Journal Article 2024-11-05 No Snippets Diamantidis MD, Ikonomou G, Argyrakouli I, Pantelidou D, Delicou S, International Hemoglobinopathy Research Network (INHERENT).
Show Full Abstract

Hemoglobinopathies, namely β-thalassemia and sickle cell disease (SCD), are hereditary diseases, characterized by molecular genetic aberrations in the beta chains of hemoglobin. These defects affect the normal production of hemoglobin with severe anemia due to less or no amount of beta globins in patients with β-thalassemia (quantitative disorder), while SCD is a serious disease in which a mutated form of hemoglobin distorts the red blood cells into a crescent shape at low oxygen levels (qualitative disorder). Despite the revolutionary progress in recent years with the approval of gene therapy and gene editing for specific patients, there is an unmet need for highlighting the mechanisms influencing hemoglobin production and for the development of novel drugs and targeted therapies. The identification of the transcription factors and other genetic modifiers of hemoglobin expression is of utmost importance for discovering novel therapeutic approaches for patients with hemoglobinopathies. The aim of this review is to describe these complex molecular mechanisms and pathways affecting hemoglobin expression and to highlight the relevant investigational approaches or pharmaceutical interventions focusing on restoring the hemoglobin normal function by linking the molecular background of the disease with the clinical perspective. All the associated drugs increasing the hemoglobin expression in patients with hemoglobinopathies, along with gene therapy and gene editing, are also discussed.

Also flagged:cancerneurodegenerative disordersbiomoleculeAmineaminoreceptor
Journal Article 2024-11-05 No Snippets Eustáquio R, Ramalho JPP, Arantes S, Candeias A, Caldeira AT, Pereira A.
Show Full Abstract

Fluorescent labels, commonly used in highly sensitive analytical techniques for detecting and tracking biomolecules in critical fields like cellular biology, medicine, medicinal chemistry, and environmental science, are currently too expensive for routine use in standard applications, with most exhibiting small Stokes shifts. This limitation underscores the potential of 4-diethylaminobenzaldehyde derivatives as a cost-effective alternative for developing new, bright fluorophores with larger Stokes shifts. In this work, using 4-diethylaminobenzaldehyde as starting material, we developed a simple, cost-effective, and efficient synthetic strategy to produce new affordable small molecules as effective fluorescent labels for biomolecules. Density functional theory and time-dependent density functional theory calculations were also conducted to gain insights into the observed photophysical properties.

HFE
Also flagged:IronMetabolismmineralmineralsTMPRSS6TF
Journal Article 2024-11-05 ✓ 5 Snippets Bösch ES, Spörri J, Scherr J.
In-Text Gene Mentions

…TwoHFESNPs (rs1800562 and…

…TheHFEvariant rs1800562 (also…

…significant effect ofHFEvariant rs1800562 against…

…of rs1799945 inHFE

…associations of theHFEvariant rs1799945 (also…

Show Full Abstract

<b>Background/Objectives:</b> Increased interest in personalized nutrition has led to a growing focus on exploring genetic variants and their impact on nutritional uptake (nutrigenomics). Nevertheless, no systematic review to date has compiled scientific evidence on genetic variants (such as single-nucleotide polymorphisms (SNPs)) affecting mineral metabolism in humans. This review aims to fill this gap and enable optimized personalized nutrition recommendations in health care. <b>Methods:</b> Cochrane, Embase and MEDLINE databases were systematically searched for English and German studies published between 2007 and 2023, focusing on genetic variants linked to nutrition. Studies on overweight, diseased, or underage individuals were excluded. Papers with verified findings were assessed for methodological quality using the Joanna Briggs Institute critical appraisal tool. <b>Results:</b> Twenty-one scientific papers on SNPs associated with mineral metabolism were included. The majority were observational studies (<i>n</i> = 19) conducted on Caucasian populations. Women outnumbered men (37.4%) women, 18.9% men, 43.7% sex not reported. All identified SNPs linked to minerals influenced iron parameters, with the TMPRSS6 gene showing the strongest correlation. Two HFE SNPs (rs1800562 and rs1799945) and one TF SNP (rs1799852) exhibited protective effects, while the other 11 SNPs were linked to increased risk of iron deficiency, suggesting potential benefits from iron supplementation for individuals with those genetic variants. <b>Conclusions:</b> This review provides comprehensive insights into the association between genetic variants and mineral metabolism, and the findings highlight the relevance of genetic makeup in optimizing health through nutritional interventions. The generalizability of the findings may be limited to Caucasians, warranting future research with diverse populations. This review was registered with the International Platform of Registered Systematic Review and Meta-Analysis Protocols (INPLASY) on 12 July 2022, under INPLASY202270068 and funded by the University Centre for Prevention and Sports Medicine at Balgrist University Hospital Zurich and the Swiss Innovation Agency Innosuisse, Switzerland.

HTT
Also flagged:encephalitisneurological diseasearboviral neurological diseaseequine encephalitisneurological diseasesarboviral disease
Journal Article 2024-11-05 ✓ 1 Snippet Yuen NKY, Harrison JJ, Wang ASW, McMahon IE, Habarugira G, Coyle MP, Bielefeldt-Ohmann H.
In-Text Gene Mentions

Pan-orthoflavivirusspecific monoclonal antibody…

Show Full Abstract

An incursion and outbreak of Japanese encephalitis virus (JEV) was reported in Australia in 2021 and 2022, respectively. There was speculation that JEV may have been circulating in Australia unknowingly prior to the detection. In this study, we determined sero-prevalence and transmission of West Nile virus (WNV), Murray Valley encephalitis virus (MVEV) and JEV, prior to and post JEV incursion in a sentinel equine population in south-east Queensland (SEQ), Australia, using blocking ELISAs (screening test) and virus neutralisation test (confirmatory). Serum samples collected between 2018 and 2020 (prior to JEV incursion; <i>n</i> = 607) from horses residing in SEQ revealed that sero-prevalence to pathogenic orthoflaviviruses was low, specifically WNV (1.3 %; 8/607), MVEV (1.2 %; 7/607), and JEV (4.9 %; 30/607). The significantly higher prevalence of JEV (<i>P</i> < 0.05) was skewed by the high proportion of horses previously enrolled in one or more JEV vaccine studies (17/30; 56.7 %) and the unknown JEV vaccination history due to international travel (6/30; 20 %). Thirty-two foals were enrolled as sentinels to monitor for arbovirus transmissions in SEQ between 2020 and 2023. Results showed that JEV seroconversion was first detected in April 2022 (<i>n</i> = 4), with seven more seroconversions detected in the following months until November 2022. This study (i) confirms that it is highly unlikely that JEV incursion in SEQ occurred prior to February 2022; (ii) circulation of WNV in SEQ remains very low; and (iii) highlights the complexity in the interpretation of orthoflavivirus serological results. The authors propose that horses should be included as sentinels for arbovirus transmission monitoring in Australia.

bioRxiv 2024-11-05 Preprint (No Snippets API) van Ewijk C, Jain G, Knelissen YK, Maity S, van der Wel P, Roos W.
Show Full Abstract

Amyloid fibril formation is a hallmark of various neurodegenerative diseases such as Huntington’s (HD), Alzheimer’s and Parkinson’s disease. The protein aggregation process involves slow nucleation events followed by rapid growth and elongation of formed fibrils. Understanding the pathways of amyloid formation is key to development of novel therapeutic agents that can interfere with the pathogenic protein misfolding events. Recent studies of aggregation by polypeptides from Alzheimer’s and Huntington’s disease have identified the importance of a poorly understood secondary nucleation process that may even be the dominant source of protein aggregate formation. Here we focus on the polyglutamine-expansion disorder HD and employ mechanistic and structural studies to study different aspects of secondary nucleation in the aggregation of huntingtin Exon 1 (HttEx1). Notably, we apply high-speed atomic force microscopy (HS-AFM) to directly observe the process on the single-particle level and in real time. Our observations show unique features of the amyloid formation dynamics in real time, including secondary nucleation, elongation and the formation of large bundles of fibrils as a result of nucleated branching. We examine the role of HttEx1 flanking segments during the aggregation process, revealing that the N-terminal Htt NT segment exhibits a clear primary nucleation-aggregation-enhancing ability, however, that it does not seem to induce or affect the secondary nucleation process. The obtained results illuminate the complex aggregation process of HttEx1 and have implications for attempts to inhibit or modulate it for therapeutic purposes.

medRxiv 2024-11-05 Preprint (No Snippets API) Kerr SM, Klaric L, Muckian MD, Johnston K, Drake C, Halachev M, Cowan E, Snadden L, Dean J, Zheng SL, Thami PK, Ware JS, Tzoneva G, Shuldiner AR, Miedzybrodzka Z, Wilson JF.
Show Full Abstract

The benefits of returning clinically actionable genetic results to participants in research cohorts are accruing, yet such a genome-first approach is challenging. Here, we describe the return of such results in two founder populations from Scotland. Between 2005 and 2015, we recruited >4,000 adults with grandparents from Orkney and Shetland into the Viking Genes research cohort. Return of genetic data was not offered at baseline, but in 2023 we sent invitations for consent to return of actionable genetic findings to participants. We generated exome sequence data from 4,198 participants, and used the ACMG v3.2 list of 81 genes, ClinVar review and pathogenicity status, plus manual curation, to develop a pipeline to identify potentially actionable variants. We identified 104 individuals (2.5%) carrying 108 actionable genotypes at 39 variants in 23 genes, and validated these. Working with the NHS clinical genetics service, which provided genetic counselling and clinical verification of the research results, and after expert clinical review, we notified 64 consenting participants (or their next of kin) of their actionable genotypes. Ten actionable variants across seven genes ( BRCA1, BRCA2, ATP7B, TTN, KCNH2, MUTYH, GAA ) have risen 50 to >3,000-fold in frequency through genetic drift in ancestral island localities. Viking Genes is one of the first UK research cohorts to return actionable findings, providing an ethical and logistical exemplar of return of results. The genetic structure in the Northern Isles of Scotland, with multiple founder effects, provides a unique opportunity for a tailored approach to primary and secondary prevention through genetic screening.

medRxiv 2024-11-05 Preprint (No Snippets API) Lansdon LA, Yoo B, Keskus A, Pushel I, Bi C, Ahmad T, Bryant A, Walter A, Gibson M, Rindler M, Li W, Habeebu SM, Cooley LD, Herriges J, Repnikova E, Zhang L, August KJ, Flatt TG, Gamis AS, Guest EM, Hays JA, Hetherington M, Lewing K, Pastinen T, Kolmogorov M, Farooqi MS.
Show Full Abstract

Gene fusions are common primary drivers of pediatric leukemias and are the result of underlying structural variant (SVs). Current clinical workflows to detect such alterations rely on a multimodal approach, which often increases analysis time and overall cost of testing. In this study, we used long-read sequencing (lrSeq) as a proof-of-concept to determine whether clinically relevant (cr) SVs could be detected within a small (n = 17) pediatric leukemia cohort. We show that this methodology successfully determined all known crSVs detected through routine clinical testing. We also identified crSVs, such as an ins(11;10)(q23.3;p12p12) forming a KMT2A::MLLT10 fusion, missed by routine clinical approaches, resulting in the classification of leukemia genetic subtypes for four additional patients. This study demonstrates the diagnostic potential of lrSeq as an assay for SV detection in pediatric leukemia and supports lrSeq as a valuable tool for the accurate detection of crSVs.

Also flagged:amino acidGFPalkynecoppertetrazinevimentin
Journal Article 2024-11-04 No Snippets Cai E, Chen Y, Zhang J, Li H, Li Y, Yan S, He Z, Yuan Q, Wang P.
Show Full Abstract

Fluorescence labeling <i>via</i> fluorescent proteins (FPs) or immunofluorescence has been routinely applied for microscopic imaging of specific proteins. However, due to these over-weight and oversized labels (<i>e.g.</i> GFP, 238 aa, 27 kDa, ∼4 nm in size), the potential physiological malfunctions of the target proteins are largely underestimated in living cells. Herein, for living cells, we report a small and minimally-invasive Raman reporter (about 2 aa and <1 kDa), which can be site-specifically introduced into proteins by genetic codon expansion. After a single unnatural amino acid (UAA) is precisely incorporated into the target protein, the strained alkyne can rapidly undergo copper-free Diels-Alder cycloaddition reactions with the tetrazine-functionalized Raman reporter, which features a fine vibrational spectrum in contrast to fluorescence. In our experimental results, the UAA-based Raman tag was successfully incorporated into vimentin, histone 3.3 and huntingtin (Htt74Q) proteins in living HeLa cells and further utilized for stimulated Raman imaging. The site-specific bioorthogonal fusion of small Raman tags with intracellular proteins will pave the way for minimally-invasive protein labeling and multi-color imaging in living cells.

Also flagged:UNC-51-like kinase 1ULK1serine/threonine kinasesautophagycanceraminopyrimidines
Journal Article 2024-11-04 No Snippets Zhang Z, Sun D, Yang Y, Abbas SY, Li H, Chen L.
Show Full Abstract

<h4>Introduction</h4>UNC-51-like kinase 1/2 (ULK1/2) are serine/threonine kinases that play a crucial role in autophagy activation and maintaining cellular homeostasis. Given their broad physiological relevance, ULK1/2 are candidate targets for treating various diseases. In recent years, ULK1/2 inhibitors have made significant progress, and the highly potent ULK1/2 inhibitors have entered clinical trials.<h4>Area covered</h4>This review aims to provide an updated analysis of patents describing ULK1/2 inhibitors and their potential therapeutic applications that were disclosed between 2019 and 2024.<h4>Expert opinion</h4>Due to their crucial role in various diseases, the invention of small-molecule drugs targeting ULK1/2 is particularly important, especially in cancer treatment. Despite the great success of ULK1/2 inhibitors development, ULK1/2 inhibitors are ATP competitive inhibitors of aminopyrimidines currently, and most ULK1/2 inhibitors are still in the preclinical research stage, with only DCC-3116 entered clinical research. Therefore, developing highly selective ULK1/2 inhibitors with low side effects and high bioavailability remains a challenging and promising research direction.

Also flagged:membranecytoplasmicPDendoplasmic reticulumcell wallpore
Journal Article 2024-11-04 No Snippets Tsang HT, Ganguly DR, Furbank RT, von Caemmerer S, Danila FR.
Show Full Abstract

Plasmodesmata (PD) are nanochannels that facilitate cell-to-cell transport in plants. More productive and photosynthetically efficient C<sub>4</sub> plants form more PD at the mesophyll (M)-bundle sheath (BS) interface in their leaves than their less efficient C<sub>3</sub> relatives. In C<sub>4</sub> leaves, PD play an essential role in facilitating the rapid metabolite exchange between the M and BS cells to operate a biochemical CO<sub>2</sub> concentrating mechanism, which increases the CO<sub>2</sub> partial pressure at the site of Rubisco in the BS cells and hence photosynthetic efficiency. The genetic mechanism controlling PD formation in C<sub>3</sub> and C<sub>4</sub> leaves is largely unknown, especially in monocot crops, due to the technical challenge of quantifying these nanostructures with electron microscopy. To address this issue, we have generated stably transformed lines of Oryza sativa (rice, C<sub>3</sub>) and Setaria viridis (setaria, C<sub>4</sub>) with fluorescent protein-tagged PD to build the first spatiotemporal atlas of leaf pit field (cluster of PD) density in monocots without the need for electron microscopy. Across leaf development, setaria had consistently more PD connections at the M-BS wall interface than rice while the difference in M-M pit field density varied. While light was a critical trigger of PD formation, cell type and function determined leaf pit field density. Complementary temporal mRNA sequencing and gene co-expression network analysis revealed that the pattern of pit field density correlated with differentially expressed PD-associated genes and photosynthesis-related genes. PD-associated genes identified from our co-expression network analysis are related to cell wall expansion, translation and chloroplast signalling.

POU3F2
Also flagged:extracellulargene expressionneurogenesisgene expressionsneuropsychiatric disordersautism
Journal Article 2024-11-04 ✓ 3 Snippets Guo X, Lee T, Sun J, Sun J, Cai W, Yang Q, Sun T.
In-Text Gene Mentions

…expressing CUX1 andPOU3F2were classified in…

…marker for examplePOU3F2was increased (Figure…

…markers such asPOU3F2in the SPN…

Show Full Abstract

The expansion of neural progenitors and production of distinct neurons are crucial for architectural assembly and formation of connectivity in human brains. Subplate neurons (SPNs) are among the firstborn neurons in the human fetal cerebral cortex, and play a critical role in establishing intra- and extracortical connections. However, little is known about SPN origin and developmental lineages. In this study, spatial landscapes and molecular trajectories of SPNs in the human fetal cortices from gestational weeks (GW) 10 to 25 are created by performing spatial transcriptomics and single-cell RNA sequencing. Genes known to be evolutionarily human-specific and genes associated with extracellular matrices (ECMs) are found to maintain stable proportions of subplate neurons among other neuronal types. Enriched ECM gene expression in SPNs varies in distinct cortical regions, with the highest level in the frontal lobe of human fetal brains. This study reveals molecular origin and lineage specification of subplate neurons in the human fetal cerebral cortices, and highlights underpinnings of SPNs to cortical neurogenesis and early structural folding.

ZNF644
Also flagged:Myopiarefractive errorsvisionhigh myopiahighPathologic
Journal Article 2024-11-04 ✓ 1 Snippet Šenk U, Čižman B, Writzl K, Tekavčič Pompe M.
In-Text Gene Mentions

…, UNC5D andZNF644) as the…

Show Full Abstract

<h4>Objective</h4>High myopia is a significant risk factor for irreversible vision loss and can occur in isolation or as a component of various syndromes. However, the genetic basis of early-onset high myopia remains poorly understood. We aimed to identify the causative genetic variants for high myopia in a cohort of Slovenian children.<h4>Methods</h4>The study included children referred to a tertiary paediatric ophthalmology centre at the University Eye Clinic in Ljubljana between 2010 and 2022. The participants met the following inclusion criteria: age ≤ 15 years and high myopia ≤-5.0 D before the age of 10 years. Genetic analysis included exome sequencing and/or molecular karyotyping. Participants were categorized based on clinical presentation: high myopia with systemic involvement, high myopia with ocular involvement, and isolated high myopia.<h4>Results</h4>Genetic analysis of 36 probands revealed a genetic cause of high myopia in 22 (61.1%) children. Among those with systemic involvement (50.0%), genetic causes were identified in 13 out of 18 children, with Stickler's and Pitt-Hopkins being the most common syndromes. Among cases of high myopia with ocular involvement (38.9%), a genetic cause was found in 8 out of 14 probands, including (likely) pathogenic variants in genes related to retinal dystrophies (CACNA1F, RPGR, RP2, NDP). The non-syndromic ARR3- associated high myopia was identified in the isolated high myopia group.<h4>Conclusions</h4>A genetic cause of high myopia was identified in 61.1% of children tested, demonstrating the value of genetic testing in this population for diagnosis and proactive counseling.

Also flagged:tumoroxygentumorstranslationalkinasesRNA-binding proteins
Journal Article 2024-11-04 No Snippets Kim YS, Kimball SR, Piskounova E, Begley TJ, Hempel N.
Show Full Abstract

From tumorigenesis to advanced metastatic stages, tumor cells encounter stress, ranging from limited nutrient and oxygen supply within the tumor microenvironment to extrinsic and intrinsic oxidative stress. Thus, tumor cells seize regulatory pathways to rapidly adapt to distinct physiologic conditions to promote cellular survival, including manipulation of mRNA translation. While it is now well established that metastatic tumor cells must up-regulate their antioxidant capacity to effectively spread and that regulation of antioxidant enzymes is imperative to disease progression, relatively few studies have assessed how translation and the hijacking of RNA systems contribute to antioxidant responses of tumors. Here, we review the major stress signaling pathways involved in translational regulation and discuss how these are affected by oxidative stress to promote prosurvival changes that manipulate antioxidant enzyme expression. We describe how tumors elicit these adaptive responses and detail how stress-induced translation can be regulated by kinases, RNA-binding proteins, RNA species, and RNA modification systems. We also highlight opportunities for further studies focused on the role of mRNA translation and RNA systems in the regulation of antioxidant enzyme expression, which may be of particular importance in the context of metastatic progression and therapeutic resistance.

Also flagged:Diabetesislet autoimmunitytype 1 diabetes mellitusT1DMorganizationinsulin
Journal Article 2024-11-04 No Snippets Lernmark Å, Agardh D, Akolkar B, Gesualdo P, Hagopian WA, Haller MJ, Hyöty H, Johnson SB, Elding Larsson H, Liu E, Lynch KF, McKinney EF, McIndoe R, Melin J, Norris JM, Rewers M, Rich SS, Toppari J, Triplett E, Vehik K, Virtanen SM, Ziegler AG, Schatz DA, Krischer J.
Show Full Abstract

The goal of the TEDDY (The Environmental Determinants of Diabetes in the Young) study is to elucidate factors leading to the initiation of islet autoimmunity (first primary outcome) and those related to progression to type 1 diabetes mellitus (T1DM; second primary outcome). This Review outlines the key findings so far, particularly related to the first primary outcome. The background, history and organization of the study are discussed. Recruitment and follow-up (from age 4 months to 15 years) of 8,667 children showed high retention and compliance. End points of the presence of autoantibodies against insulin, GAD65, IA-2 and ZnT8 revealed the HLA-associated early appearance of insulin autoantibodies (1-3 years of age) and the later appearance of GAD65 autoantibodies. Competing autoantibodies against tissue transglutaminase (marking coeliac disease autoimmunity) also appeared early (2-4 years). Genetic and environmental factors, including enterovirus infection and gastroenteritis, support mechanistic differences underlying one phenotype of autoimmunity against insulin and another against GAD65. Infant growth and both probiotics and high protein intake affect the two phenotypes differently, as do serious life events during pregnancy. As the end of the TEDDY sampling phase is approaching, major omics approaches are in progress to further dissect the mechanisms that might explain the two possible endotypes of T1DM.

Also flagged:strokedeathischemic strokestrokescerebral hemorrhagesubarachnoid hemorrhage
Journal Article 2024-11-04 No Snippets Zhuo B, Qin C, Deng S, Jiang H, Si S, Tao F, Cai F, Meng Z.
Show Full Abstract

Stroke, as a neurological disorder with a poor overall prognosis, has long plagued the patients. Current stroke therapy lacks effective treatments. Ferroptosis has emerged as a prominent subject of discourse across various maladies in recent years. As an emerging therapeutic target, notwithstanding its initial identification in tumor cells associated with brain diseases, it has lately been recognized as a pivotal factor in the pathological progression of stroke. Acyl-CoA synthetase long-chain family member 4 (ACSL4) is a potential target and biomarker of catalytic unsaturated fatty acids mediating ferroptosis in stroke. Specifically, the upregulation of ACSL4 leads to heightened accumulation of lipid peroxidation products and reactive oxygen species (ROS), thereby exacerbating the progression of ferroptosis in neuronal cells. ACSL4 is present in various tissues and involved in multiple pathways of ferroptosis. At present, the pharmacological mechanisms of targeting ACSL4 to inhibit ferroptosis have been found in many drugs, but the molecular mechanisms of targeting ACSL4 are still in the exploratory stage. This paper introduces the physiopathological mechanism of ACSL4 and the current status of the research involved in ferroptosis crosstalk and epigenetics, and summarizes the application status of ACSL4 in modern pharmacology research, and discusses the potential application value of ACSL4 in the field of stroke.

SERPINC1
Also flagged:COVID-19host cellsinfectionSerpin A10Complement C9cytokine
Journal Article 2024-11-04 ✓ 1 Snippet Song HW, Jo HY, Kim SC, Choi SS.
In-Text Gene Mentions

…Notably,Serpin C1C1 and Serpin…

Show Full Abstract

<h4>Background</h4>Numerous studies have investigated the molecular properties that contribute to the symptoms of COVID-19, such as the virus's genetic makeup, its replication mechanisms, and how it interacts with host cells. However, identifying the immunopathological properties, such as the immune system's response, cytokine levels, and the presence of specific biomarkers, that are associated with the severity of the infection remains crucial for developing effective treatments and preventions.<h4>Methods</h4>We analyzed blood protein factor profiles from 420 individuals to identify features differentiating between test-negative healthy, asymptomatic, and symptomatic individuals using statistical comparison and the least absolute shrinkage and selection operator (i.e., LASSO) algorithm. Additionally, we examined single-cell RNA sequencing data from 141 individuals to identify specific cell types associated with the COVID-19 symptoms.<h4>Results</h4>Healthy individuals who tested negative had distinct blood protein factor levels compared to asymptomatic individuals. We identified two key protein factors, Serpin A10 and Complement C9, that differentiate between asymptomatic and symptomatic patients. Symptomatic patients showed lower levels of CD4<sup>+</sup> T naïve, CD4<sup>+</sup> T effector & memory, and CD8<sup>+</sup> T naïve cells, along with higher levels of CD14<sup>+</sup> classical monocytes compared to asymptomatic patients. Additionally, CD16<sup>+</sup> non-classical monocytes, major producers of C1QA/B/C, appeared to contribute to the observed Complement C9 levels.<h4>Conclusions</h4>These findings advance our understanding of the immunopathological mechanisms underlying COVID-19 and may inform the development of targeted therapies and preventative measures. Future research should focus on further elucidating these mechanisms and exploring their potential clinical applications in managing COVID-19 severity.

Also flagged:synthesislipidalkyneAlkynesnitrogen atomsalkanes
Journal Article 2024-11-04 No Snippets Li J, Hu J, Jin D, Huo H, Chen N, Lin J, Lu X.
Show Full Abstract

<h4>Background</h4>The efficacy of mRNA-based vaccines and therapies relies on lipid nanoparticles (LNPs) as carriers to deliver mRNA into cells. The chemical structure of ionizable lipids (ILs) within LNPs is crucial in determining their delivery efficiency.<h4>Results</h4>In this study, we synthesized 623 alkyne-bearing ionizable lipids using the A<sup>3</sup> coupling reaction and assessed their effectiveness in mRNA delivery. ILs with specific structural features-18-carbon alkyl chains, a cis-double bond, and ethanolamine head groups-demonstrated superior mRNA delivery capabilities. Variations in saturation, double bond placement, and chain length correlated with decreased efficacy. Alkynes positioned adjacent to nitrogen atoms in ILs reduced the acid dissociation constant (pKa) of LNPs, thereby hindering mRNA delivery efficiency. Conversion of alkynes to alkanes significantly enhanced mRNA delivery of ILs both in vitro and in vivo. Moreover, combining optimized ILs with cKK-E12 yields synergistic LNPs that showed markedly augmented mRNA expression levels in vivo.<h4>Conclusions</h4>Overall, our study provides insights into the structure-function relationships of ILs, providing a foundation for the rational design of ILs to enhance the efficacy of LNPs in mRNA delivery.

SERPINC1
Also flagged:metabolismgene expressioncortisolresponse to stressproteinsresponse to repeated
Journal Article 2024-11-04 ✓ 1 Snippet Avalos JG, Champagne CD, Crocker DE, Khudyakov JI.
In-Text Gene Mentions

…proteins (F9, FGG,SERPINC1), which all increased…

Show Full Abstract

Animals in nature potentially experience multiple stressors, and those of anthropogenic origin are likely to be repeated or chronic. However, stress hormone levels are highly context-dependent and are not consistent predictors of chronic stress in wildlife. Profiling the downstream consequences of repeated stress responses, such as changes in metabolism or gene expression, may be more informative for predicting their individual-level health consequences and population-level impacts, which are key objectives for wildlife conservation. We previously found that in free-ranging juvenile elephant seals, the blubber transcriptome and proteome, but not cortisol levels, could distinguish between responses to single versus repeated stress axis stimulation. However, the blubber proteome response to stress was limited and mainly involved extra-cellular matrix proteins. In this study, we examined the plasma proteome response of four of the same animals to the repeated stress experiment, since multiple organs secrete proteins into the circulation, providing a readout of their activity and integration. We isolated plasma proteins, identified and quantified them using liquid chromatography and tandem mass spectrometry (LC-MS/MS) and compared their abundance between sampling times. We identified >200 proteins in plasma, of which 42 were altered in abundance, revealing complex protein dynamics in response to repeated stress challenges. These changes were delayed but sustained, suggesting that the plasma proteome may reflect longer term integration of multi-organ responses to recent, rather than immediate, challenges. Differentially abundant proteins included components of the osmoregulatory system, acute phase and complement proteins, organokines, apolipoproteins and hormone transport proteins, which coordinate physiological processes with significant implications for marine mammal health and may explain several aspects of marine mammal stress physiology, such as insulin resistance and high aldosterone levels. We identified several potentially novel biomarkers, such as AGT, HPX, TTR and APOA4, that may be useful for detecting recent and repeated stress exposure in marine mammals.

HFE
Also flagged:Hepatocellular Cancerviral hepatitiscirrhosishepatitisC virus infectiondeath
Journal Article 2024-11-04 ✓ 1 Snippet Ilagan-Ying YC, Gordon KS, Tate JP, Lim JK, Torgersen J, Lo Re V, Justice AC, Taddei TH.
In-Text Gene Mentions

…liver disease (ie,hemochromatosisand autoimmune hepatitis)…

Show Full Abstract

<h4>Importance</h4>Hepatocellular carcinoma (HCC) is typically detected only at advanced stages when treatment options are limited. Most of the current HCC risk models focus on patients with viral hepatitis or diagnosed cirrhosis or require variables not routinely available in clinical care.<h4>Objective</h4>To identify modifiable HCC risk factors in the general population and to develop a risk score to inform HCC screening and risk-factor modification interventions for high-risk individuals without viral hepatitis or decompensated cirrhosis.<h4>Design, setting, and participants</h4>This cohort study analyzed demographic, clinical, laboratory, and diagnostic data from the US Department of Veterans Affairs (VA) electronic health records. Data were divided into development and validation samples. Veterans aged 30 to 95 years were included, and those with hepatitis B or C virus infection, hepatic decompensation, or prevalent HCC were excluded. Patients were followed up until the occurrence of HCC diagnosis, death, or December 31, 2021. A Cox proportional hazards regression model for 10-year risk of HCC was developed and used to create an HCC risk score, and performance in development and validation samples and in patient subgroups was evaluated. One outpatient visit date per person at least 18 months after VA entry, between October 1, 2007, and March 31, 2020, was randomly selected and used as the index date for the start of follow-up. Analyses were performed from March 2023 to May 2024.<h4>Exposures</h4>Age, sex, race and ethnicity, body mass index, liver fibrosis (detected with Fibrosis-4 Index [FIB-4]), diabetes status, smoking status, and alcohol use.<h4>Main outcomes and measures</h4>First HCC diagnosis during follow-up. This information was ascertained from VA national cancer registry topography and histology codes and from International Classification of Diseases, Ninth Revision and International Statistical Classification of Diseases, Tenth Revision, Clinical Modification diagnosis codes for the inpatient or outpatient visits.<h4>Results</h4>This study of 6 509 288 veterans included 6 048 917 males (92.9%), with a median (IQR) age of 65 (54-74) years, who identified as being of Hispanic (5.3%), non-Hispanic Black (15.0%), non-Hispanic White (68.9%), or other (4.6%) race and ethnicity. Overall, 15 142 patients (0.2%) developed HCC, 69.5% of whom had FIB-4 of 3.25 or lower at baseline. While FIB-4 was the most important variable, age, sex, race and ethnicity, body mass index, diabetes, smoking, and alcohol use were also informative. Discrimination in the development sample was better than FIB-4 alone (C statistic, 0.83 [95% CI, 0.82-0.85] vs 0.79 [95% CI, 0.77-0.80]). The HCC risk score performed consistently well in the validation sample and in all subgroups. A FIB-4 threshold of 3.25 would screen 5.0% of the cohort at a cost of 28 false-positives for every true-positive; a model risk score of 58 would screen 4.7% of the cohort at a cost of 23 false-positives for every true-positive.<h4>Conclusions and relevance</h4>Results of this study suggest that a multivariable risk score that uses routinely available clinical data outperforms FIB-4 alone in identifying patients at risk of HCC who do not have viral hepatitis or hepatic decompensation at baseline.

OLFM4
Also flagged:PathogenesisHemorrhagic diseaseinfectionGCRV infectioncarbohydratelipid
Journal Article 2024-11-04 ✓ 2 Snippets Xie J, Jia Z, Li Y, Liao L, Zhu Z, Wang Y, Huang R.
In-Text Gene Mentions

…0.05) and XP_016324649.1 (OLFM4, FC = 0.32,…

OLFM4was significantly up-regulated…

Show Full Abstract

Hemorrhagic disease caused by grass carp reovirus (GCRV) infection is a major problem affecting the grass carp aquaculture industry. Therefore, inhibiting the spread of GCRV infection is of great economic significance. Herein, we sequenced five tissues (gill, liver, intestine, kidney, and muscle) from grass carp before and after GCRV infection using data-independent acquisition proteomic and untargeted metabolomic technologies, and quantitatively identified 10,808 proteins and 4040 metabolites. Then, we analyzed the differentially expressed proteins (DEPs) and metabolites (DEMs) before and after GCRV infection in the five tissues. Gene ontology analysis revealed that the five tissue DEPs were enriched in metabolic, including carbohydrate and lipid metabolic processes. Chemical taxonomy analysis showed that the categories of DEMs mainly included carbohydrates and lipids, such as fatty acids, glycerophospholipids, steroids, and their derivatives. Both the proteomic and the metabolomic data showed that GCRV affected the carbohydrate and lipid metabolism in the host. Shared pathway analysis was performed at both the protein and metabolic levels, showing significant enrichment of the glycolysis and pentose phosphate pathways (<i>p</i> < 0.001). Further analysis of glycolysis and pentose phosphate pathway inhibitors revealed that these two pathways are important for GCRV replication. As the kidney was the most affected among the five tissues, we analyzed the butanoate metabolism in the kidney, which revealed that most of the differentially expressed proteins and differently expressed metabolites in the butanoate metabolism were related to the TCA cycle. Further investigation showed that fumaric acid, an intermediate product in the TCA cycle, significantly inhibited GCRV replication in the CIK cells (<i>p</i> < 0.001), and that this inhibitory effect may be related to its induction of interferon system activation. The addition of fumaric acid to feed increased the survival rate of juvenile grass carp by 19.60% during GCRV infection, and protected the tissues of those infected with GCRV, making it a potential anti-GCRV feed additive. Our results provide new perspectives on GCRV pathogenesis and antiviral strategies for grass carp.

POU3F2
Also flagged:Ecto-NOX Disulfide-Thiol Exchanger 2ENOX2tNOXMalignant Melanomacancergrowth-associated protein
Journal Article 2024-11-04 ✓ 4 Snippets Böcker M, Chatziioannou E, Niessner H, Hirn C, Busch C, Ikenberg K, Kalbacher H, Handgretinger R, Sinnberg T.
In-Text Gene Mentions

…of BRAF ,POU3F2, hnRNP F…

…ENOX2 transcription factorPOU3F2[ 40 ,…

…the upregulation ofPOU3F2[ 73 ].…

…the transcription factorPOU3F2[ 73 ],…

Show Full Abstract

With an increasing incidence of malignant melanoma, new prognostic biomarkers for clinical decision making have become more important. In this study, we evaluated the role of ecto-NOX disulfide-thiol exchanger 2 (ENOX2/tNOX), a cancer- and growth-associated protein, in the prognosis and therapy of primary malignant melanoma. We conducted a tissue microarray analysis of immunohistochemical ENOX2 protein expression and The Cancer Genome Atlas (TCGA) <i>ENOX2</i> RNA expression analysis, as well as viability assays and Western blots of melanoma cell lines treated with the ENOX2 inhibitor phenoxodiol (PXD) and BRAF inhibitor (BRAFi) vemurafenib. We discovered that high ENOX2 expression is associated with decreased overall (OS), disease-specific (DSS) and metastasis-free survival (MFS) in primary melanoma (PM) and a reduction in electronic tumor-infiltrating lymphocytes (eTILs). A gradual rise in ENOX2 expression was found with an increase in malignant potential from benign nevi (BNs) via PMs to melanoma metastases (MMs), as well as with an increasing tumor thickness and stage. These results highlight the important role of ENOX2 in cancer growth, progression and metastasis. The ENOX2 expression was not limited to malignant cell lines but could also be found in keratinocytes, fibroblasts and melanocytes. The viability of melanoma cell lines could be inhibited by PXD. A reduced induction of phospho-AKT under PXD could prevent the development of acquired BRAFi resistance. In conclusion, ENOX2 may serve as a potential prognostic marker and therapeutic target in malignant melanoma.

HFE
Also flagged:bromide4-nitrophenolmetal ionsdegradationmetalssilver
Journal Article 2024-11-04 ✓ 1 Snippet Kumar A, Rayavarapu RG.
In-Text Gene Mentions

…as iron overload (hemochromatosis) and acute iron…

Show Full Abstract

Heavy metal ions and organic pollutants, such as 4-nitrophenol (4-NP), pose significant environmental and human health threats. Addressing these challenges necessitates using advanced nanoparticle-based systems capable of efficient detection and degradation. However, conventional approaches utilizing strong capping agents like cetrimonium bromide (CTAB) on nanoparticles lead to limitations due to the rigid nature of CTAB. This restricts its utility in heavy metal detection and 4-NP degradation, requiring additional surface modifications using linker molecules, thereby increasing process complexity and cost. To overcome these limitations, there is a critical need for the development of an easy-to-use, dual-functional, linker-free nanosystem capable of simultaneous detection of heavy metals and efficient degradation of 4-NP. For enabling linker-free/ligand-free detection of heavy metal ions and catalytic degradation of 4-NP, CTAB was engineered as a versatile capping agent on gold and silver nanoparticles. Various factors, including nanoparticle characteristics such as shape, size, metal composition, centrifugation, and NaOH amount, were investigated for their impact on the performance of CTAB-capped nanoparticles in heavy metal detection and 4-NP degradation. CTAB-Au nanospheres demonstrated limited heavy metal ion detection capability but exhibited remarkable efficiency in degrading 94.37% of 4-NP within 1 min. In contrast, silver nanospheres effectively detected Hg<sup>2+</sup>, Cu<sup>2+</sup>, and Fe<sup>3+</sup> at concentrations as low as 1 ppm and degraded 90.78% of 4-NP within 30 min. Moreover, anisotropic gold nanorods (CTAB-AuNR1 and CTAB-AuNR2) showed promising sensing capabilities towards Cu<sup>2+</sup>, Cr<sup>3+</sup>, and Hg<sup>2+</sup> at 0.5 OD, while efficiently degrading 4-NP within 5 min at 1 OD. This study emphasizes the importance of tailoring parameters of CTAB-capped nanoparticles for specific sensing and catalytic applications, offering potential solutions for environmental remediation and human health protection.

CACNA1E
Also flagged:pediatric-onset pulmonary hypertensionpulmonary hypertensionpulmonary arterial hypertensionpersistent pulmonary hypertensionBMPR2CHD7
Journal Article 2024-11-04 ✓ 1 Snippet Chen C, Zhou H, Fu F, Huang R, Wang Y, Guo F, Ma C, Li F, Wang D, Yu Q, Lu Y, Chen G, Lei T, Li R.
In-Text Gene Mentions

…= 1), andCACNA1E(n = 1).…

Show Full Abstract

<h4>Objective</h4>This single-center retrospective study aimed to investigate the genetic factors contributing to neonatal and pediatric pulmonary hypertension in a Chinese population using trio whole-exome sequencing (trio-WES).<h4>Method</h4>This retrospective analysis reviewed the clinical and genetic profiles of children under 18 years of age diagnosed with pulmonary hypertension between March 2017 and March 2022. The diagnosis of pediatric pulmonary hypertension was confirmed through echocardiography and catheterization. Trio-WES was performed on the patients and their parents after obtaining informed consent.<h4>Results</h4>A total of 51 children with neonatal and pediatric pulmonary hypertension were included, comprising 20 with pediatric pulmonary arterial hypertension and 31 with persistent pulmonary hypertension of the newborn. Trio-WES detected 16 pathogenic or likely pathogenic variants in 14 patients across ten genes, including: BMPR2 (n = 2), CHD7 (n = 2), FOXF1 (n = 2), MED13L (n = 1), TNNI3 (n = 2), ALMS1 (n = 1), KMT2D (n = 2), NKX2-1 (n = 1), NONO (n = 1), and CACNA1E (n = 1). In addition, two patients exhibited de novo pathogenic copy number variations.<h4>Conclusion</h4>Our findings demonstrate the significant diagnostic value of trio-WES in pediatric pulmonary hypertension, supporting its recommendation for these patients.

Also flagged:epigeneticThyroid cancerendocrine cancerPTCmitogen-associated protein kinasedeath
Journal Article 2024-11-04 No Snippets Sabi EM.
Show Full Abstract

Thyroid cancer (TC) is the most common endocrine cancer, which contributes to more than 43,600 deaths and 586,000 cases worldwide every year. Among the TC types, PTC and FTC comprise 90% of all TCs. Genetic modifications in genes are responsible for encoding proteins of mitogen-associated protein kinase cascade, which is closely related with numerous cellular mechanisms, including controlling programmed cell death, differentiation, proliferation, gene expression, as well as in genes encoding the PI3K (phosphatidylinositol 3-kinase)/protein kinase B (AKT) cascade, which has contribution in controlling cell motility, adhesion, survival, and glucose metabolism, have been associated with the TC pathogenesis. Various genetic modifications including BRAF mutations, RAS mutations, RET mutations, paired-box gene 8/peroxisome proliferator-activated receptor-gamma fusion oncogene, RET/PTC rearrangements, telomerase reverse transcriptase mutations, neurotrophic tyrosine receptor kinase fusion genes, TP53 mutations, and eukaryotic translation initiation factor 1A X-linked mutations can effectively serve as potential biomarkers in both diagnosis and prognosis of TC. On the other hand, epigenetic modifications can lead to aberrant functions or suppression of a range of signalling cascades, which can ultimately result in cancer. Various studies have observed the link between epigenetic modification and multiple cancers including TC. It has been reported that several epigenetic alterations including histone modifications, aberrant DNA methylation, and epigenetic modulations of non-coding RNAs can play significant roles as potential biomarkers in the diagnosis and prognosis of TC. Therefore, a good understanding regarding the genetic and epigenetic modifications is not only essential for the diagnosis and prognosis of TC, but also for the development of novel therapeutics. In this review, most of the major TC-related genetic and epigenetic modifications and their potential as biomarkers for TC diagnosis and prognosis have been extensively discussed.

TNFSF4
Also flagged:mitophagybreast cancerhormone receptorsHER2autophagymitochondria
Journal Article 2024-11-04 ✓ 2 Snippets Ding P, Pei S, Qu Z, Yang Y, Liu Q, Kong X, Wang Z, Wang J, Fang Y.
In-Text Gene Mentions

…which TNFSF15, ADORA2A,TNFSF4and CD160 were…

…including TNFSF15, ADORA2A,TNFSF4, and CD160, in…

Show Full Abstract

<h4>Background</h4>Triple-negative breast cancer (TNBC) is an aggressive subtype of breast cancer lacking hormone receptors and HER2 expression, leading to limited treatment options and poor prognosis. Mitophagy, a selective autophagy process targeting damaged mitochondria, plays a complex role in cancer progression, yet its prognostic significance in TNBC is not well understood.<h4>Methods</h4>This study utilized single-cell RNA sequencing data from the TCGA and GEO databases to identify mitophagy-related genes (MRGs) associated with TNBC. A prognostic model was developed using univariate Cox analysis and LASSO regression. The model was validated across multiple independent cohorts, and correlations between MRG expression, immune infiltration, and drug sensitivity were explored.<h4>Results</h4>Nine key MRGs were identified and used to stratify TNBC patients into high-risk and low-risk groups, with the high-risk group showing significantly worse survival outcomes. The model demonstrated strong predictive accuracy across various datasets. Additionally, the study revealed a correlation between higher MRG expression levels and increased immune cell infiltration, as well as potential responsiveness to specific chemotherapeutic agents.<h4>Conclusion</h4>The mitophagy-related prognostic model offers a novel method for predicting outcomes in TNBC patients and highlights the role of mitophagy in influencing the tumor microenvironment, with potential applications in personalized treatment strategies.

SERPINC1
Also flagged:Dentinogenesis imperfectaosteogenesis imperfectaendodontic diseaseapical periodontitishereditary disorderdentine formation
Journal Article 2024-11-04 ✓ 3 Snippets Piekos KM, Freeman A, Fleming K, Bell C.
In-Text Gene Mentions

…indicates that DGI-II,DGI-III, and DD-II are…

…the prototype forDGI-III, is caused by…

…those associated withDGI-III.…

Show Full Abstract

This case report details the diagnosis and treatment of dentinogenesis imperfecta in a 6-year-old neutered male Labrador, presenting without concurrent osteogenesis imperfecta. Diagnostic modalities, including radiographs, CT imaging, and histopathological examination, are reviewed in conjunction with the latest literature on canine dentinogenesis imperfecta. This patient presented at a more advanced age than typically reported cases. The clinical history, as provided by referring veterinarians, documented fractured deciduous teeth with delayed exfoliation. By 10 months of age, the patient's permanent dentition exhibited a translucent appearance and structural anomalies. Upon presentation to Eastcott Referrals the patient was experiencing significant oral pain and exhibited generalised coronal wear with yellow/brown intrinsic discolouration. CT imaging revealed that all teeth had endodontic disease and associated apical periodontitis, with varied root canal widths indicating that teeth succumbed to endodontic disease at different time points. The treatment protocol involved staged full-mouth extractions, resulting in the complete resolution of clinical symptoms. This case underscores the importance of early diagnosis and intervention in managing dentinogenesis imperfecta in dogs.

SERPINC1
Also flagged:sepsisinjurylactatemicrobial infectionacute kidney injurytissue inhibitor of metalloproteinases-2
Journal Article 2024-11-04 ✓ 1 Snippet Li C, Zhao K, Ren Q, Chen L, Zhang Y, Wang G, Xie K.
In-Text Gene Mentions

…BMI, HR, RR,APS-III, lactate, hemoglobin, WBC,…

Show Full Abstract

<h4>Background</h4>SAKI is a common and serious complication of sepsis, contributing significantly to high morbidity and mortality, especially in patients requiring RRT. Early identification of high-risk patients enables timely interventions and improvement in clinical outcomes. The objective of this study was to develop and validate a predictive model for in-hospital mortality in patients with SAKI receiving RRT.<h4>Methods</h4>Patients with SAKI receiving RRT from the MIMIC-IV database were retrospectively enrolled and randomly assigned to either the training cohort or the testing cohort in a 7:3 ratio. LASSO regression and Boruta algorithm were utilized for feature selection. Subsequently, three machine learning models-CART, SVM and LR-were constructed, and their predictive efficacy was assessed using a comprehensive set of performance indicators. Feature importance analysis was performed to determine the contribution of each feature to a model's predictions. Finally, DCA was employed to evaluate the clinical utility of the prediction models. Additionally, a clinical nomogram was developed to facilitate the interpretation and visualization of the LR model.<h4>Results</h4>A total of 1663 adults were ultimately enrolled and randomly allocated into the training cohort (n = 1164) or the testing cohort (n = 499). Twenty-eight variables were evaluated for feature selection, with eight ultimately retained in the final model: age, MAP, RR, lactate, Cr, PT-INR, TBIL and CVP. The LR model demonstrated commendable performance, exhibiting robust discrimination in both the training cohort (AUROC: 0.73 (95% CI 0.70-0.76); AUPRC: 0.75 (95% CI 0.72-0.79); accuracy: 0.66 (95% CI 0.63-0.68)) and the testing cohort (AUROC: 0.72 (95% CI 0.68-0.76); AUPRC: 0.73 (95% CI 0.67-0.79); accuracy: 0.65 (95% CI 0.61-0.69)). Furthermore, there was good concordance between predicted and observed values in both the training cohort (χ2 = 4.41, p = 0.82) and the testing cohort (χ2 = 4.16, p = 0.84). The results of the DCA revealed that the LR model provided a greater net benefit compared to other prediction models.<h4>Conclusions</h4>The LR model exhibited superior performance in predicting in-hospital mortality in patients with SAKI receiving RRT, suggesting its potential utility in identifying high-risk patients and guiding clinical decision-making.

Also flagged:heart failurecollagensextracellularheart diseaseFibrosismyocardial infarction
Journal Article 2024-11-04 No Snippets Psarras S.
Show Full Abstract

Stromal and immune cells and their interactions have gained the attention of cardiology researchers and clinicians in recent years as their contribution in cardiac repair is increasingly recognized. The repair process in the heart is a particularly critical constellation of complex molecular and cellular events and interactions that characteristically fail to ensure adequate recovery following injury, insult, or exposure to stress conditions in this regeneration-hostile organ. The tremendous consequence of this pronounced inability to maintain homeostatic states is being translated in numerous ways promoting progress into heart failure, a deadly, irreversible condition requiring organ transplantation. Fibrosis is in fact a repair response eventually promoting cardiac dysfunction and cardiac fibroblasts are the major cellular players in this process, overproducing collagens and other extracellular matrix components when activated. On the other hand, macrophages may differentially affect fibroblasts and cardiac repair depending on their status and subsets. The opposite interaction is also probable. We discuss here the multifaceted aspects and crosstalk of this cell dipole and the opportunities it may offer for beneficial manipulation approaches that will hopefully lead to progress in heart disease interventions.

DCC
Also flagged:methylationdepressionmajor depressive disordermicrotubule6 -methyladenosineadenosines
Journal Article 2024-11-04 ✓ 5 Snippets Mitsuhashi H, Lin R, Chawla A, Mechawar N, Nagy C, Turecki G.
In-Text Gene Mentions

…is binding toDCChas been associated…

…31 NTN1/DCCsignaling influences axonal…

…the adult brain, NTN1/DCCsignaling guides synaptic…

…dysregulated expression ofDCCdetermines susceptibility to…

…stress can modulate NTN1/DCCsignaling activity through…

Show Full Abstract

Adverse environmental stress represents a significant risk factor for major depressive disorder (MDD), often resulting in disrupted synaptic connectivity which is known to be partly regulated by epigenetic mechanisms. N<sup>6</sup>-methyladenosine (m6A), an epitranscriptomic modification, has emerged as a crucial regulator of activity-dependent gene regulation. In this study, we characterized m6A profiles in the ventromedial prefrontal cortex (vmPFC) of individuals with MDD. Using m6A sequencing, we identified a total of 30,279 high-confidence m6A peaks, exhibiting significant enrichment in genes related to neuronal and synaptic function. The m6A peaks between males and females with MDD that passed the significance threshold showed opposite m6A patterns, while the threshold-free m6A patterns were concordant. Distinct m6A profiles were found in MDD for each sex, with dysregulation associated with microtubule movement in males and neuronal projection in females. Our results suggest the potential roles of m6A as part of the dysregulated molecular network in MDD.

RC3H1
Also flagged:mitochondrialRNA-binding proteinironmetabolismbone resorptionactivation
Journal Article 2024-11-04 ✓ 5 Snippets Chen L, Su Y, Wang C, Huang Q, Chen W, Hai N, Wang J, Lian H, Zhao J, Xu J, Liu Q.
In-Text Gene Mentions

Rc3h1negatively regulates osteoclas…

Rc3h1, an RNA-binding protein,…

…precise role ofRc3h1in regulating iron…

…target gene ofRc3h1and its role…

…the effect ofRc3h1on mitochondrial respiration…

Show Full Abstract

<b>Rationale:</b> Osteoclasts are giant bone-resorbing cells that need vigorous mitochondrial respiration to support their activation. Rc3h1, an RNA-binding protein, precisely governs the homeostasis of mRNA. However, the precise role of Rc3h1 in regulating iron metabolism and mitochondrial respiration in osteoclasts is not yet understood. <b>Methods:</b> We generated Rc3h1-deficient mice in osteoclast precursors and mature osteoclasts. The bone mass and osteoclast activity in bone tissues were evaluated. Moreover, we assessed the differentiation, bone resorption, iron content, and mitochondrial function of osteoclasts <i>in vitro</i>. In the end, the target gene of Rc3h1 and its role in mediating the effect of Rc3h1 on mitochondrial respiration in osteoclasts were further investigated. <b>Results:</b> Mice lacking Rc3h1 exhibit low bone mass. In addition, Rc3h1 deletion in osteoclasts significantly promotes osteoclast activation. Mechanistically, Rc3h1 post-transcriptionally represses the expression of transferrin receptor 1 (Tfr1), restricting iron absorption and mitochondrial respiration in osteoclasts. Inhibition of Tfr1 in Rc3h1-deficient osteoclasts diminishes excessive osteoclast formation and mitochondrial respiration. <b>Conclusion:</b> These findings suggest that Rc3h1 has a negative effect on osteoclast activation via limiting iron resorption and mitochondrial respiration. Finally, targeting the Rc3h1/Tfr1 axis might represent a potential therapeutic approach for bone-loss diseases.

bioRxiv 2024-11-04 Preprint (No Snippets API) Nourreddine S, Doctor Y, Dailamy A, Forget A, Lee Y, Chinn B, Khaliq H, Polacco B, Muralidharan M, Pan E, Zhang Y, Sigaeva A, Hansen JN, Gao J, Parker JA, Obernier K, Clark T, Chen JY, Metallo C, Lundberg E, Ideker T, Krogan N, Mali P.
Show Full Abstract

<h4>SUMMARY</h4> Towards comprehensively investigating the genotype-phenotype relationships governing the human pluripotent stem cell state, we generated an expressed genome-scale CRISPRi Perturbation Cell Atlas in KOLF2.1J human induced pluripotent stem cells (hiPSCs) mapping transcriptional and fitness phenotypes associated with 11,739 targeted genes. Using the transcriptional phenotypes, we created a minimum distortion embedding map of the pluripotent state, demonstrating rich recapitulation of protein complexes, such as strong co-clustering of MRPL, BAF, SAGA, and Ragulator family members. Additionally, we uncovered transcriptional regulators that are uncoupled from cell fitness, discovering potential novel pluripotency (JOSD1, RNF7) and metabolic factors (ZBTB41). We validated these findings via phenotypic, protein-interaction, and metabolic tracing assays. Finally, we propose a contrastive human-cell engineering framework (CHEF), a machine learning architecture that learns from perturbation cell atlases to predict perturbation recipes that achieve desired transcriptional states. Taken together, our study presents a comprehensive resource for interrogating the regulatory networks governing pluripotency.

bioRxiv 2024-11-04 Preprint (No Snippets API) Chakraborty A, Mandal SM, Mankevich M, Mani RS, Shahabi S, Biswas T, Kodavati M, Sreenivasmurthy SG, Tapryal N, Krishnan B, Hegde ML, Weinfeld M, Ghosh G, Hazra T.
Show Full Abstract

Several reports have indicated that impaired mitochondrial function contributes to the development and progression of Huntington’s disease (HD). Mitochondrial genome damage, particularly DNA strand breaks, is a potential cause for its compromised functionality. Here we show that the activity of polynucleotide kinase 3’-phosphatase (PNKP), a critical DNA end-processing enzyme, is significantly decreased in the mitochondrial extract of HD patients’ brains due to a lower level of fructose-2,6 bisphosphate (F2,6BP), a biosynthetic product of 6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3 (PFKFB3). Such decrease in PNKP activity leads to persistent DNA strand breaks that are refractory to subsequent steps for repair completion. Both PFKFB3 and F2,6BP, an allosteric modulator of glycolysis, are also present in the mitochondria and PFKFB3 is part of a mitochondrial DNA repair complex containing HTT, PNKP, DNA Pol γ (POLG) and Lig IIIα. Notably, PNKP binds F2,6BP (Kd= 525±25 nM) and utilizes it as a cofactor. The levels of both F2,6BP and PFKFB3 are significantly decreased in the mitochondrial extract of HD mouse striatal neuronal cells and patients’ brain. Activity of PNKP is thus severely decreased in the mitochondrial extract; however, addition of F2,6BP restored its activity. Moreover, supplementation of F2,6BP in HD cells restored PFKFB3 level, mitochondrial genome integrity and partially restored mitochondrial membrane potential, mitochondrial respiration and prevented pathogenic aggregate formation. We also observed that supplementation with F2,6BP restored mitochondrial genome integrity in an HD Drosophila model. Our findings, therefore, suggest that F2,6BP-mediated restoration of PNKP activity could have a profound impact in ameliorating neurodegenerative symptoms in HD. <h4>Significance</h4> We reported earlier the loss of PNKP activity in the nuclear extracts from HD patients’ brain. However, a glycolytic metabolite, F2,6BP, can restore PNKP activity and rescue organismal phenotypes in HD fly models. As PNKP is present in mitochondria and several reports indicate that mitochondrial dysfunction contributes to HD, we therefore analyzed PNKP activity in the mitochondrial extract. Surprisingly, we found that PFKFB3 and its product, F2,6BP are present in mitochondria, but significantly low in patients’ brains. Exogenous addition of F2,6BP restored PNKP activity in patients’ brain mitochondrial extract. Moreover, supplementing F2,6BP in HD cells and fruit flies restored mitochondrial genome integrity suggesting maintaining adequate intracellular F2,6BP levels is critical for proper functionality of PNKP and thereby of brain health.

bioRxiv 2024-11-04 Preprint (No Snippets API) Mathews EW, Coffey SR, Gärtner A, Belgrad J, Bragg RM, O’Reilly D, Cantle JP, McHugh C, Summers A, Fentz J, Schwagarus T, Cornelius A, Lingos I, Burch Z, Kovalenko M, Andrew MA, Bennett FC, Kordasiewicz HB, Marchionini DM, Wilkinson H, Vogt TF, Pinto RM, Khvorova A, Howland D, Wheeler VC, Carroll JB.
Show Full Abstract

Huntington’s disease (HD) arises from a CAG expansion in the huntingtin ( HTT ) gene beyond a critical threshold. A major thrust of current HD therapeutic development is lowering levels of mutant HTT mRNA (m HTT ) and protein (mHTT) with the aim of reducing the toxicity of these product(s). Human genetic data also support a key role for somatic instability (SI) in HTT ’s CAG repeat – whereby it lengthens with age in specific somatic cell types – as a key driver of age of motor dysfunction onset. Thus, an attractive HD therapy would address both mHTT toxicity and SI, but to date the relationship between SI and HTT lowering remains unexplored. Here, we investigated multiple therapeutically-relevant HTT-lowering modalities to establish the relationship between HTT lowering and SI in HD knock-in mice. We find that repressing transcription of mutant Htt (m Htt ) provides robust protection from SI, using diverse genetic and pharmacological approaches (antisense oligonucleotides, CRISPR-Cas9 genome editing, the Lac repressor, and virally delivered zinc finger transcriptional repressor proteins, ZFPs). However, we find that small interfering RNA (siRNA), a potent HTT-lowering treatment, lowers HTT levels without influencing SI and that SI is also normal in mice lacking 50% of total HTT levels, suggesting HTT levels, per se , do not modulate SI in trans . Remarkably, modified ZFPs that bind the m Htt locus, but lack a repressive domain, robustly protect from SI, despite not reducing HTT mRNA or protein levels. These results have important therapeutic implications in HD, as they suggest that DNA-targeted HTT-lowering treatments may have significant advantages compared to other HTT-lowering approaches, and that interaction of a DNA-binding protein and HTT’ s CAG repeats may provide protection from SI while sparing HTT expression.

bioRxiv 2024-11-04 Preprint (No Snippets API) Dharshini SAP, Sanz-Ros J, Pan J, Tang W, Vallejo K, Otero-Garcia M, Cobos I.
Show Full Abstract

<h4>ABSTRACT</h4> Single-cell omics is advancing our understanding of selective neuronal vulnerability in Alzheimer’s disease (AD), revealing specific subtypes that are either susceptible or resilient to neurodegeneration. Using single-nucleus and spatial transcriptomics to compare neocortical regions affected early (prefrontal cortex and precuneus) or late (primary visual cortex) in AD, we identified a resilient excitatory population in layer 4 of the primary visual cortex expressing RORB , CUX2 , and EYA4 . Layer 4 neurons in association neocortex also remained relatively preserved as AD progressed and shared overlapping molecular signatures of resilience. Early in the disease, resilient neurons upregulated genes associated with synapse maintenance, synaptic plasticity, calcium homeostasis, and neuroprotective factors, including GRIN2A, RORA, NRXN1, NLGN1, NCAM2, FGF14, NRG3, NEGR1 , and CSMD1 . We also identified KCNIP4 , which encodes a voltage-gated potassium (Kv) channel-interacting protein that interacts with Kv4.2 channels and presenilins, as a key factor linked to resilience. KCNIP4 was consistently upregulated in the early stages of pathology. Furthermore, AAV-mediated overexpression of Kcnip4 in a humanized AD mouse model reduced the expression of the activity-dependent genes Arc and c-Fos , suggesting compensatory mechanisms against neuronal hyperexcitability. Our dataset provides a valuable resource for investigating mechanisms underlying resilience to neurodegeneration.

OLFM4
Also flagged:Gasdermin CIL-4RSTAT6deathacute colitisinfection
Journal Article 2024-11-03 ✓ 2 Snippets Gámez-Belmonte R, Wagner Y, Mahapatro M, Wang R, Erkert L, González-Acera M, Cineus R, Hainbuch S, Patankar JV, Voehringer D, Hegazy AN, Neurath MF, Wirtz S, Becker C.
In-Text Gene Mentions

…in Olfactomedin 4 (OLFM4) and ULEX immunostaining,…

…by Lgr5 expression,OLFM4and KI67 stainings…

Show Full Abstract

Gasdermin C is one of the least studied members of the gasdermin family of proteins, known for their critical involvement in pyroptosis and host defense. Furthermore, evidence for the role of Gasdermin C in the intestine is scarce and partly controversial. Here, we tested the functional role of Gasdermin C in intestinal homeostasis, inflammation and tumorigenesis. : We studied Gasdermin C in response to cytokines in intestinal organoids. We evaluated epithelial differentiation, cell death and immune infiltration under steady state conditions in a new mouse line deficient in Gasdermin C. The role of Gasdermin C was analyzed in acute colitis, infection and colitis-associated cancer. Gasdemin C is highly expressed in the intestinal epithelium and strongly induced by the type 2 cytokines IL-4 and IL-13 in a STAT6-dependent manner. Gasdermin C-deficient mice show no changes in tissue architecture and epithelial homeostasis. Epithelial organoids deficient in Gasdermin C develop normally and show no alterations in proliferation or cell death. No changes were found in models of acute colitis, type 2 intestinal infection and colitis-associated cancer. Gasdermin C genes are upregulated by type 2 immunity, yet appear dispensable for the development of intestinal inflammation, infection and colitis-associated cancer.

Also flagged:HO-1liver disorderlipidMetabolic-associated steatohepatitiscirrhosishepatocellular carcinoma
Journal Article 2024-11-03 No Snippets Li N, Hao L, Li S, Deng J, Yu F, Zhang J, Nie A, Hu X.
Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a progressive liver disorder with a rising prevalence. It begins with lipid accumulation in hepatocytes and gradually progresses to Metabolic-associated steatohepatitis (MASH), fibrosis, cirrhosis, and potentially hepatocellular carcinoma (HCC). The pathophysiology of MASLD is complex and involves multiple factors, with oxidative stress playing a crucial role. Oxidative stress drives the progression of MASLD by causing cellular damage, inflammatory responses, and fibrosis, making it a key pathogenic mechanism. The Nuclear Factor Erythroid 2-Related Factor 2 / Heme Oxygenase-1 (Nrf2/HO-1) signaling axis provides robust multi-organ protection against a spectrum of endogenous and exogenous insults, particularly oxidative stress. It plays a pivotal role in mediating antioxidant, anti-inflammatory, and anti-apoptotic responses. Many studies indicate that activating the Nrf2/HO-1 signaling pathway can significantly mitigate the progression of MASLD. This article examines the role of the Nrf2/HO-1 signaling pathway in MASLD and highlights natural compounds that protect against MASLD by targeting Nrf2/HO-1 activation. The findings indicate that the Nrf2/HO-1 signaling pathway holds great promise as a therapeutic target for MASLD.

DCC
Also flagged:lactationofmastitisdiapedesisimmune responseantibodies
Journal Article 2024-11-03 ✓ 1 Snippet Farschtschi S, Lengl M, Röhrl S, Klenk C, Hayden O, Diepold K, Pfaffl MW.
In-Text Gene Mentions

…Therefore, severalDCC-based biomarkers have been…

Show Full Abstract

For several years, the determination of a differential cell count of a raw milk sample has been proposed as a more accurate tool for monitoring the udder health of dairy cows compared with using the absolute somatic cell count. However, the required sample preparation and staining process can be labor- and cost-intensive. Therefore, the aim of our study was to demonstrate the feasibility of analyzing unlabeled blood and milk leukocytes from dairy cows by means of digital holographic microscopy (DHM). For this, we trained three different machine learning methods, i.e., k-Nearest Neighbor, Random Forests, and Support Vector Machine, on sorted leukocyte populations (granulocytes, lymphocytes, and monocytes/macrophages) isolated from blood and milk samples of three dairy cows by using fluorescence-activated cell sorting. Afterward, those classifiers were applied to differentiate unlabeled blood and milk samples analyzed by DHM. A total of 70 blood and 70 milk samples were used. Those samples were collected from five clinically healthy cows at 14-time points within a study period of 26 days. The outcome was compared with the results of the same samples analyzed by flow cytometry and (in the case of blood samples) also to routine analysis in an external laboratory. Moreover, a standard vaccination was used as an immune stimulus during the study to check for changes in cell morphology or cell counts. When applied to isolated leukocytes, Random Forests performed best, with a specificity of 0.93 for blood and 0.84 for milk cells and a sensitivity of 0.90 and 0.81, respectively. Although the results of the three analytical methods differed, it could be demonstrated that a DHM analysis is applicable for blood and milk leukocyte samples with high reliability. Compared with the flow cytometric results, Random Forests showed an MAE of 0.11 (SD = 0.04), an RMSE of 0.13 (SD = 0.14), and an MRE of 1.00 (SD = 1.11) for all blood leukocyte counts and an MAE of 0.20 (SD = 0.11), an RMSE of 0.21 (SD = 0.11) and an MRE of 1.95 (SD = 2.17) for all milk cell populations. Further studies with larger sample sizes and varying immune cell compositions are required to establish method-specific reference ranges.

DDX27
Also flagged:DNA-dependent protein kinaseDNA-PK-homologous end joiningcancertumorCas9
Journal Article 2024-11-03 ✓ 1 Snippet Kovina AP, Luzhin AV, Tatarskiy VV, Deriglazov DA, Petrova NV, Petrova NV, Kondratyeva LG, Kantidze OL, Razin SV, Velichko AK.
In-Text Gene Mentions

…, PKMYT1 ,DDX27, DDX18 ,…

Show Full Abstract

DNA-dependent protein kinase (DNA-PK) is a key effector of non-homologous end joining (NHEJ)-mediated double-strand break (DSB) repair. Since its identification, a substantial body of evidence has demonstrated that DNA-PK is frequently overexpressed in cancer, plays a critical role in tumor development and progression, and is associated with poor prognosis in cancer patients. Recent studies have also uncovered novel functions of DNA-PK, shifting the paradigm of the role of DNA-PK in oncogenesis and renewing interest in targeting DNA-PK for cancer therapy. To gain genetic insight into the cellular pathways requiring DNA-PK activity, we used a CRISPR/Cas9 screen to identify genes in which defects cause hypersensitivity to DNA-PK inhibitors. We identified over one hundred genes involved in DNA replication, cell cycle regulation, and RNA processing that promoted cell survival when DNA-PK kinase activity was suppressed. This gene set will be useful for characterizing novel biological processes that require DNA-PK activity and identifying predictive biomarkers of response to DNA-PK inhibition in the clinic. We also validated several genes from this set and reported previously undescribed genes that modulate the response to DNA-PK inhibitors. In particular, we found that compromising the mRNA splicing pathway led to marked hypersensitivity to DNA-PK inhibition, providing a possible rationale for the combined use of splicing inhibitors and DNA-PK inhibitors for cancer therapy.

bioRxiv 2024-11-03 Preprint (No Snippets API) Kuthethur R, Acharya A, Sengodan SK, Fonseca C, Nagar N, Nasrin VZ S, Ibini O, Manolika E, de Koning K, Braunshier S, Dessapt J, Fradet-Turcotte A, Lebbink JH, Kanaar R, Poluri KM, Sharan SK, Cejka P, Chaudhuri AR.
Show Full Abstract

<h4>ABSTRACT</h4> Homologous recombination (HR) deficiency upon BRCA2 loss arises from defects in the formation of RAD51 nucleoprotein filaments. Here, we demonstrate that loss of the anti-recombinase FIGNL1 retains RAD51 loading at DNA double-stranded breaks (DSBs) in BRCA2-deficient cells, leading to genome stability, HR proficiency, and viability of BRCA2-deficient mouse embryonic stem cells. Mechanistically, we directly show that strand invasion and subsequent HR defects upon BRCA2 loss primarily arises from the unrestricted removal of RAD51 from DSB sites by FIGNL1, rather than from defective RAD51 loading. Furthermore, we identify that the MMS22L-TONSL complex interacts with FIGNL1 and is critical for HR in BRCA2/FIGNL1 double-deficient cells. These findings identify a pathway for tightly regulating RAD51 activity to promote efficient HR, offering insights into mechanisms of chemoresistance in BRCA2-deficient tumors.

Also flagged:protein synthesisperipheral neuropathiesneurodevelopmental disorderscytoplasmicAminoacyl‐ tRNA synthetaseneurological diseases
Journal Article 2024-11-02 No Snippets Zhang H, Ling J.
Show Full Abstract

Aminoacyl-tRNA synthetases (aaRSs) are essential enzymes to support protein synthesis in all organisms. Recent studies, empowered by advancements in genome sequencing, have uncovered an increasing number of disease-causing mutations in aaRSs. Monoallelic aaRS mutations typically lead to dominant peripheral neuropathies such as Charcot-Marie-Tooth (CMT) disease, whereas biallelic aaRS mutations often impair the central nervous system (CNS) and cause neurodevelopmental disorders. Here, we review recent progress in the disease onsets, molecular basis, and potential therapies for diseases caused by aaRS mutations, with a focus on biallelic mutations in cytoplasmic aaRSs.

Also flagged:hydroxyapatiteinfectioncopperzincsilvercross-infection
Journal Article 2024-11-02 No Snippets Hassanain M, Abdel-Ghafar HM, Hamouda HI, El-Hosiny FI, Ewais EMM.
Show Full Abstract

Hydroxyapatite (HAp) and hydroxyapatite-based materials show promising potential in the healthcare sector due to their distinctive properties such as biocompatibility, antimicrobial efficacy, non-toxicity, and robust mechanical characteristics. This makes HAp materials play an important role in hindering infection spreading in healthcare provider institutions. This study assesses the antimicrobial efficacy of the developed hydroxyapatite-based composites incorporating copper, zinc, and silver nanoparticles. The synthesized HAp and its modified composite variants (Cu/HAp, Zn/HAp, and Ag/HAp) with varying ratios ranging from 0 to 15% (wt) were characterized using XRD, XPS, SEM, and TEM analyses. Furthermore, the antibacterial and antifungal properties of the synthesized HAp and HAp-based composites were evaluated. The antibacterial effectiveness of the HAp and its composites was evaluated using a modified disc diffusion test, where the resulting inhibition zones on the agar surface were observed. All the HAp and HAp-based composites (HAp, Cu/HAp, Zn/HAp, and Ag/HAp materials) elicited in the formation of inhibitory zones. The most substantial inhibition values were observed for the 5% Ag/HAp formulation, with values of 19.7 and 13.8, against E. coli and S. aureus, respectively. The 5% Ag/HAp concentration may strike an ideal balance, providing high antimicrobial activity without adverse effects on biocompatibility or material stability. These findings underscore the recommendation of the proposed HAp-based composites for infection control measures through their application on medical instruments, textiles, healthcare personnel attire, and patient garments.

SOX6
Also flagged:RAD52ALTtelomereneurofibromaNFmalignant peripheral nerve sheath tumor
Journal Article 2024-11-02 ✓ 1 Snippet Choi E, Lee J, Kim H, Kim YJ, Kim SH.
In-Text Gene Mentions

…= 0.004 ),SOX6( P =…

Show Full Abstract

To study telomere maintenance mechanism (TMM) activation during malignant transformation, we compared neurofibroma (NF) and malignant peripheral nerve sheath tumor (MPNST) in the same patient with type-1 neurofibromatosis (NF1), a total of 20 NF-MPNST pairs in 20 NF1 patients. These comparisons minimized genetic bias and contrasted only changes associated with malignant transformation, while subtracting changes that developed upon the transformation of normal cells to the benign tumor. TGF-β superfamily genes were found to activate the PAX and SOX transcription factors, leading to TMM activation. BMPER activates PAX6 through BMP2 and PAX7 through BMP4; BMP15 activates SOX14; and INHBC activates PAX9 and SOX14. The activated PAX and SOX genes sequentially establish the core architecture of the RAD52-dependent alternative lengthening of telomeres (ALT). Specifically, PAX7 activates the recombinase (RAD52) and a negative regulator (SLX4IP). PAX6 and SOX14 activate positive regulators (BLM and BRCA2, respectively). PAX9 and SOX14 activate RAD9B and FEN1, which are responsible for the stability of homologous recombination intermediates and increase, together with RAD52, the telomere length. Telomere elongation achieved by the activation of PAX7 and PAX9 is associated with a poor prognosis. We demonstrated that TGF-β superfamily-induced transcriptional activation pathways activated the RAD52-dependent ALT during malignant transformation of MPNSTs.

Also flagged:RRM2Immune ResponsesClear Cell Renal Cell CarcinomaccRCCRCCtyrosine kinase
Journal Article 2024-11-02 No Snippets Zhu X, Al-Danakh A, Jian Y, Safi M, Luo S, Chen Q, Wang S, Yang D.
Show Full Abstract

<h4>Background</h4>Clear cell renal cell carcinoma (ccRCC), the predominant subtype of RCC, is distinguished by unique biological characteristics and heterogeneity, including eosinophilic and clear subtypes. Notwithstanding progress in therapy, immune checkpoint inhibitors (ICIs), and tyrosine kinase inhibitors (TKIs), the prognosis for individuals with metastatic ccRCC remains poor, presumably owing to metabolic alterations leading to mitochondrial dysfunction, which affects treatment response variability.<h4>Methods</h4>We analyzed histological and immunohistochemical data from a cohort at Dalian Medical University's First Affiliated Hospital alongside RNA-sequencing transcriptome data from the TCGA database. Histologically, eosinophilic and clear ccRCC subtypes were evaluated using Kaplan-Meier and Cox proportional hazards models for survival analysis and prognosis. Differential gene expression (DEG) analysis and Gene Set Enrichment Analysis were performed to explore transcriptomic differences and relevant pathways.<h4>Results</h4>The study discovered substantial histological and molecular differences between the eosinophilic and clear cell subtypes of ccRCC. The eosinophilic subtype linked with frequent high-grade tumors (69.05% eosinophil vs 35.35% clear) and a poorer prognosis (HR=2.659, 95% CI:1.437-4.919, P=0.002). DEG analysis revealed distinct expression patterns among subtypes and identified a risk score signature that remained significant even after adjusting for clinical variables (HR=3.967, 95% CI: 1.665-9.449, P=0.002), showing less favorable survival in the high-risk group (P < 0.0001). RRM2 emerged as the most prognostic gene from this risk score, particularly in the eosinophilic subtype, alongside other clinical variables. By IHC, RRM2 shows high IHC score in eosinophilic compared to clear subtype (P=0.019). In addition, highly expressed RRM2 correlates with poor outcomes and is linked to mitochondrial genes, immunological pathways, and ICIs treatment.<h4>Conclusion</h4>These findings show significant differences in prognosis between subtypes. RRM2 was the most prognostic gene from the discovered novel risk score signature associated with subtypes. Future research is essential to validate these insights and their therapeutic implications for ccRCC management.

PRDX6
Also flagged:green fluorescent proteinGFPmitochondrialmembraneresponses to stresstransduction
Journal Article 2024-11-02 ✓ 1 Snippet Barakat S, Çimen Ş, Miri SM, Vatandaşlar E, Yelkenci HE, San Martín A, Beker MÇ, Kök K, Öztürk G, Eroglu E.
In-Text Gene Mentions

…reported upregulation ofPRDX6[ 6 ].…

Show Full Abstract

Fluorescent proteins (FPs) stand as pivotal tools extensively employed across diverse biological research endeavors in various model systems. However, long-standing concerns surround their use due to the numerous side effects associated with their expression. Recent investigations have brought to light the significance of hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) that is associated with the maturation process of green fluorescent protein (GFP) fluorophores. The structural and functional impairments associated with GFP expression are possibly linked to this amount of H<sub>2</sub>O<sub>2</sub>. In this study, we assess the impact of the GFP-based HyPer7 biosensor on cellular homeostasis and proteome changes, aiming to identify potential risks related to oxidative stress responses that potentially risks the application of such tools. Cells expressing genome-integrated HyPer7 demonstrated altered mitochondrial membrane potential (MMP), which was alleviated by the addition of antioxidants or culturing cells at physiological normoxia (5 kPa O<sub>2</sub>). Additionally, HyPer7-expressing cells also exhibited significant impairment in mitochondrial oxidative respiration, suggesting broader mitochondrial dysfunction. Through untargeted proteomics analysis, we identified 26 proteins exhibiting differential expression in HyPer7-expressing cells compared to respective control cells. Functional annotation analysis showed that the list of the delineated proteins is associated with cellular responses to stress and the regulation of antioxidant mechanisms. Our findings underscore the significance of caution and validation in ensuring a thorough comprehension of cellular responses when using fluorescent protein-based tools, thereby enhancing the reliability of the results.

PEBP1VSIG10
Also flagged:mineralphosphorusmonocalciummetabolismfolatebiosynthesis
Journal Article 2024-11-02 ✓ 2 Snippets Abitew YA, Reyer H, Hadlich F, Oster M, Trakooljul N, Sommerfeld V, Rodehutscord M, Wimmers K, Ponsuksili S.
In-Text Gene Mentions

…Protein 1 (PEBP1), V-Set Immunoregulatory…

…Receptor 10 (VSIG10), and Glutathione…

Show Full Abstract

Phosphorus (P) is an essential mineral for all forms of life including laying hens, playing a crucial role in growth and efficient egg production. Recent studies suggest that current P recommendations might exceed the physiological demand, leading to unnecessarily high P excretions. This study on Lohmann Brown (LB) and Lohmann Selected Leghorn (LSL) laying hens (n=80; 10 replicates per strain, production period, and dietary group) investigates transcriptional changes in the jejunum, a critical intestinal segment for mineral absorption, in response to a diet either without (P-) or with (P+) a mineral supplement from monocalcium phosphate, administered over a 4-week period during the transition (15-19 weeks) or onset of laying (20-24 weeks). DESeq2 analysis of RNA sequencing data revealed that most differentially expressed genes (DEGs) varied between strains and age groups, with less pronounced effects from dietary mineral P content. The 19-week-old LB hens showed a stronger response to dietary mineral P removal, with transcripts affiliated with increased adaptation of the metabolism and decreased immune pathway activation. The identified pathways such as folate biosynthesis and p53 signaling, potentially link altered energy and amino acid metabolism (2-oxocarboxylic acid and arginine). Interestingly, genes involved in calcium transport (CALB1) and cellular signaling (PRKCA, STEAP4) along with tight junctions (CLDN2) were affected by complete removal of mineral P supplements, suggesting a promoted intestinal mineral uptake. Transcriptional regulation in the jejunum in response to low dietary mineral content is strain-specific when the laying phase begins, which may contribute to a physiological Ca:P ratio.

HTT
Also flagged:hereditary neurodegenerative disorderHDcognitive declinebehavioralneurodegenerative diseasesNeuroinflammatory Proteins
Journal Article 2024-11-02 ✓ 4 Snippets Li X, Tong H, Xu S, Zhou G, Yang T, Yin S, Yang S, Li X, Li S.
In-Text Gene Mentions

…huntingtin gene (HTT).…

…encodes the huntingtin (HTT) protein with an…

…of the humanHTTgene.…

…well as full-lengthHTTKI models such…

Show Full Abstract

Huntington's disease (HD) is a hereditary neurodegenerative disorder caused by a CAG tract expansion in the huntingtin gene (<i>HTT</i>). HD is characterized by involuntary movements, cognitive decline, and behavioral changes. Pathologically, patients with HD show selective striatal neuronal vulnerability at the early disease stage, although the mutant protein is ubiquitously expressed. Activation of the immune system and glial cell-mediated neuroinflammatory responses are early pathological features and have been found in all neurodegenerative diseases (NDDs), including HD. However, the role of inflammation in HD, as well as its therapeutic significance, has been less extensively studied compared to other NDDs. This review highlights the significantly elevated levels of inflammatory proteins and cellular markers observed in various HD animal models and HD patient tissues, emphasizing the critical roles of microglia, astrocytes, and oligodendrocytes in mediating neuroinflammation in HD. Moreover, it expands on recent discoveries related to the peripheral immune system's involvement in HD. Although current immunomodulatory treatments and inflammatory biomarkers for adjunctive diagnosis in HD are limited, targeting inflammation in combination with other therapies, along with comprehensive personalized treatment approaches, shows promising therapeutic potential.

HFE
Also flagged:Ferroptosisdeathironoxygenlipidage-related diseases
Journal Article 2024-11-02 ✓ 1 Snippet Arbatskiy M, Balandin D, Akberdin I, Churov A.
In-Text Gene Mentions

…deficiency diseases likehemochromatosis, β-thalassemia, atransferrine…

Show Full Abstract

Ferroptosis is a regulated cell death process characterized by iron ion catalysis and reactive oxygen species, leading to lipid peroxidation. This mechanism plays a crucial role in age-related diseases, including cancer and cardiovascular and neurological disorders. To better mimic iron-induced cell death, predict the effects of various elements, and identify drugs capable of regulating ferroptosis, it is essential to develop precise models of this process. Such drugs can be tested on cellular models. Systems biology offers a powerful approach to studying biological processes through modeling, which involves accumulating and analyzing comprehensive research data. Once a model is created, it allows for examining the system's response to various stimuli. Our goal is to develop a modular framework for ferroptosis, enabling the prediction and screening of compounds with geroprotective and antiferroptotic effects. For modeling and analysis, we utilized BioUML (Biological Universal Modeling Language), which supports key standards in systems biology, modular and visual modeling, rapid simulation, parameter estimation, and a variety of numerical methods. This combination fulfills the requirements for modeling complex biological systems. The integrated modular model was validated on diverse datasets, including original experimental data. This framework encompasses essential molecular genetic processes such as the Fenton reaction, iron metabolism, lipid synthesis, and the antioxidant system. We identified structural relationships between molecular agents within each module and compared them to our proposed system for regulating the initiation and progression of ferroptosis. Our research highlights that no current models comprehensively cover all regulatory mechanisms of ferroptosis. By integrating data on ferroptosis modules into an integrated modular model, we can enhance our understanding of its mechanisms and assist in the discovery of new treatment targets for age-related diseases. A computational model of ferroptosis was developed based on a modular modeling approach and included 73 differential equations and 93 species.

Also flagged:Nucleotidepathogenesisgenetic diseasesspinocerebellar ataxiasmyotonic dystrophies type 1 andRAN
Journal Article 2024-11-02 No Snippets Atienzar-Aroca S, Kat M, López-Castel A.
Show Full Abstract

<i>Drosophila melanogaster</i> usage has provided substantial insights into the pathogenesis of several nucleotide repeat expansion diseases (NREDs), a group of genetic diseases characterized by the abnormal expansion of DNA repeats. Leveraging the genetic simplicity and manipulability of Drosophila, researchers have successfully modeled close to 15 NREDs such as Huntington's disease (HD), several spinocerebellar ataxias (SCA), and myotonic dystrophies type 1 and 2 (DM1/DM2). These models have been instrumental in characterizing the principal associated molecular mechanisms: protein aggregation, RNA toxicity, and protein function loss, thus recapitulating key features of human disease. Used in chemical and genetic screenings, they also enable us to identify promising small molecules and genetic modifiers that mitigate the toxic effects of expanded repeats. This review summarizes the close to 150 studies performed in this area during the last seven years. The relevant highlights are the achievement of the first fly-based models for some NREDs, the incorporation of new technologies such as CRISPR for developing or evaluating transgenic flies containing repeat expanded motifs, and the evaluation of less understood toxic mechanisms in NREDs such as RAN translation. Overall, <i>Drosophila melanogaster</i> remains a powerful platform for research in NREDs.

SERPINC1
Also flagged:antithrombin (AT) deficiencythrombophiliaAT deficiencyacute pulmonary thromboembolismSERPINE1
Journal Article 2024-11-02 ✓ 3 Snippets Patil K, Shah A, Saini G, Tawde S, Kharat S, Jivani F, Kamble A, Shetty S.
In-Text Gene Mentions

…A novelSERPINC1c.119G&gt;A (p.Cys40Tyr) mutat…

…to mutations inSERPINC1is known to…

…exon 2 ofSERPINC1, that is c.119…

Show Full Abstract

Hereditary antithrombin (AT) deficiency due to mutations in SERPINC1 is known to be the most severe form of thrombophilia. We report three members in a family with hereditary AT deficiency with a novel mutation in exon 2 of SERPINC1, that is c.119 G>A (p.Cys40Tyr). Two brothers presented with acute pulmonary thromboembolism (PTE) at 18 and 21 years of age, whereas their 58-year-old father did not have any thrombotic episode till date. The in-silico prediction of the variant was found to be highly damaging by PolyPhen-2, SIFT and MutationTaster. Clinical exome sequencing did not show any strong coinherited thrombophilia genes, except SERPINE1 -844 G>A variant in homozygous state in the two affected brothers as compared to the father who was heterozygous for this variant. The additive effect of SERPINE1 variant in the clinical expression in two siblings cannot be ruled out, in the absence of any other known environmental triggering factors.

OLFM4
Also flagged:ALSneurodegenerative disorderdeathmitochondrialimmune responsedegradation
Journal Article 2024-11-02 ✓ 1 Snippet Sneha NP, Dharshini SAP, Taguchi YH, Gromiha MM.
In-Text Gene Mentions

…Chemokine Ligand 17),OLFM4(Olfactomedin 4), and…

Show Full Abstract

<h4>Background/objectives</h4>Amyotrophic Lateral Sclerosis is a progressive neurodegenerative disorder characterized by the loss of upper and lower motor neurons. Key factors contributing to neuronal death include mitochondrial energy damage, oxidative stress, and excitotoxicity. The frontal cortex is crucial for action initiation, planning, and voluntary movements whereas the spinal cord facilitates communication with the brain, walking, and reflexes. By investigating transcriptome data from the frontal cortex and spinal cord, we aim to elucidate common pathological mechanisms and pathways involved in ALS for understanding the disease progression and identifying potential therapeutic targets.<h4>Methods</h4>In this study, we quantified gene and transcript expression patterns, predicted variants, and assessed their functional effects using computational tools. It also includes predicting variant-associated regulatory effects, constructing functional interaction networks, and performing a gene enrichment analysis.<h4>Results</h4>We found novel genes for the upregulation of immune response, and the downregulation of metabolic-related and defective degradation processes in both the spinal cord and frontal cortex. Additionally, we observed the dysregulation of histone regulation and blood pressure-related genes specifically in the frontal cortex.<h4>Conclusions</h4>These results highlight the distinct and shared molecular disruptions in ALS, emphasizing the critical roles of immune response and metabolic dysfunction in neuronal degeneration. Targeting these pathways may provide new therapeutic avenues to combat neurodegeneration and preserve neuronal health.

Also flagged:PiperineLiver Damageparacetamolalanine aminotransferaseALTTNF-α
Journal Article 2024-11-02 No Snippets Coelho AM, Queiroz IF, Perucci LO, Menezes TP, Lima WG, Talvani A, Costa DC.
Show Full Abstract

<b>Background/Objective:</b> Hepatic drug intoxication is becoming increasingly common with the increasing use of chronic medications. Piperine has emerged as a promising alternative for protecting the liver against drug-induced injury. We evaluated the prophylactic effects of piperine in C57BL/6 mice with an acute liver injury induced by a paracetamol (APAP) overdose. <b>Methods:</b> Piperine was administered at a dose of 20 mg/kg (P20) or 40 mg/kg (P40) for eight consecutive days before the animals were exposed to a hepatotoxic dose of paracetamol (500 mg/kg). The animals were euthanized 3 h after the paracetamol overdose. <b>Results:</b> The prophylactic treatment with piperine (P20 and P40) maintained the levels of alanine aminotransferase (ALT) and the biomarkers of oxidative damage (TBARS and carbonylated proteins), which were statistically similar to those for the control group. The extent of hepatocyte necrosis and TNF-α (tumor necrosis factor-alpha) levels were lower than those in the group exposed to liver injury (APAP group). Piperine modulated the gene expression of CYP2E1 (cytochrome P4502E1) and the inflammasome pathway (NLRP3, CASP-1, IL-1β, and IL-18), which play a crucial role in the inflammatory response. In the P40 group, the degree of hepatic hyperemia was similar to that in the control group, as was the increase in metalloproteinase 9 (MMP-9) activity. <b>Conclusion:</b> Piperine has demonstrated beneficial and promising effects for the prevention of liver injury resulting from paracetamol-induced drug intoxication.

HFE
Also flagged:iron deficiency anemiaanemiaironmalariaHboxygen
Journal Article 2024-11-02 ✓ 1 Snippet Burayu ET, Degefa BD.
In-Text Gene Mentions

…disorders such ashemochromatosis.…

Show Full Abstract

<h4>Background</h4>Anemia is a major problem in Ethiopia, affecting a large part of the population. Despite the importance of the problem, the causes of anemia, especially iron deficiency anemia, among pregnant women attending antenatal care (ANC) in the study area have been little studied. Therefore, the aim of this study was to investigate iron deficiency anemia and its associated factors in pregnant women seeking antenatal care in public health facilities in Southwest Ethiopia in 2023.<h4>Methods and materials</h4>A mixed facility-based cross-sectional study was conducted involving 364 pregnant women from selected health facilities in Ilubabor and Buno Bedele zones. Backward multiple logistic regression was used to analyze the relationship between dependent and independent variables, with statistical significance set at a <i>P</i> value less than .05.<h4>Results</h4>In this study, the prevalence of iron deficiency anemia was found to be 21.4%. Several factors have been significantly associated with iron deficiency anemia including; presence of malaria parasite [AOR=15.8, CI=5.1-48.4], presence of Helminthes [AOR=8.1, CI=2.8-23.9], consumption of leafy vegetables less than once a day [AOR=3.4, CI = 1.5-13.3] and not taking iron supplements/consumption [AOR=2.2, CI=1.1-4.4].<h4>Conclusion and recommendations</h4>The overall prevalence of iron deficiency anemia in the study area suggests that, it is a moderate public health problem. In order to improve the nutritional status of women, routine and consistent nutritional advice, the establishment of regular preventive systems and the implementation of feedback mechanisms are recommended.

HFE
Also flagged:Thyroid Stimulating HormoneMyxedema Comaprimary hypothyroidismhypothyroidismsepsisMyxedema
Journal Article 2024-11-02 ✓ 1 Snippet Hasan N, Yang D, Othman T, Dai-Ju J.
In-Text Gene Mentions

…as sarcoidosis andhemochromatosis.…

Show Full Abstract

Most cases of Myxedema Coma are associated with primary hypothyroidism characterized by significantly elevated thyroid stimulating hormone (TSH) levels. However, this case presents an atypical manifestation of myxedema coma with low TSH levels despite severe hypothyroidism. The rarity of this presentation lies in the absence of central lesions typically responsible for such TSH suppression. This highlights a critical consideration: the profound impact of severe sepsis on thyroid hormone regulation and the hypothalamus-pituitary-thyroid axis.

Research Square 2024-11-02 Preprint (No Snippets API) Zhan S, Li S, Guo H, Li J, Wu Z.
Show Full Abstract

<title>Abstract</title> <p>The working environment in underground mines is complex, with extreme conditions such as dim lighting, high dust levels, and high humidity, leading to difficulties in feature extraction, low detection and positioning accuracy when existing target detection algorithms are applied underground. Therefore, a target detection algorithm based on low-light image enhancement is proposed. Firstly, the LIENet image enhancement algorithm is introduced to enhance the quality and brightness of low-light images, designing a dual gamma enhancement curve to adjust image pixels, achieving adaptive brightness adjustment through a few iterations under the guidance of a non-reference loss function. Secondly, a hierarchical feature extraction method HFE is proposed, with a dual-branch structure designed to capture long-term correlations and local correlations of input images separately, increasing attention to the corner regions crucial for the detection task. Finally, the HFE method is combined with a feature pyramid structure, able to effectively obtain comprehensive feature representation information through a top-down global feature adjustment method. The proposed method is validated on a self-built dataset, and compared with other excellent detection algorithms, the average detection accuracy of the proposed algorithm reaches the highest. The mAP@0.5 reaches 96.96%, and mAP@0.5:0.95 reaches 71.1%, demonstrating the excellent detection performance of the proposed algorithm under low-light conditions in mines.</p>

SOX6
Also flagged:DNA-binding proteinsgene expressionbindingTFTranscription factorsP3h1
Journal Article 2024-11-01 ✓ 1 Snippet Negrón-Piñeiro LJ, Di Gregorio A.
In-Text Gene Mentions

SOX6

Show Full Abstract

Transcription factors (TFs) are DNA-binding proteins able to modulate the timing, location, and levels of gene expression by binding to regulatory DNA regions. Therefore, the repertoire of TFs present in the genome of a multicellular organism and the expression of variable constellations of TFs in different cellular cohorts determine the distinctive characteristics of developing tissues and organs. The information on tissue-specific assortments of TFs, their cross-regulatory interactions, and the genes/regulatory regions targeted by each TF is summarized in gene regulatory networks (GRNs), which provide genetic blueprints for the specification, development, and differentiation of multicellular structures. In this study, we review recent transcriptomic studies focused on the complement of TFs expressed in the notochord, a distinctive feature of all chordates. We analyzed notochord-specific datasets available from organisms representative of the three chordate subphyla, and highlighted lineage-specific variations in the suite of TFs expressed in their notochord. We framed the resulting findings within a provisional evolutionary scenario, which allows the formulation of hypotheses on the genetic/genomic changes that sculpted the structure and function of the notochord on an evolutionary scale.

HFE
Also flagged:ironiron deficiencyLIPL-type calcium channelscarbohydrateferric
Journal Article 2024-11-01 ✓ 2 Snippets Vera-Aviles M, Kabir SN, Shah A, Polzella P, Lim DY, Buckley P, Ball C, Swinkels D, Matlung H, Blans C, Holdship P, Nugent J, Anderson E, Desborough M, Piechnik S, Ferreira V, Lakhal-Littleton S.
In-Text Gene Mentions

…iron-overload disorders ofhemochromatosisand β-thalassaemia.…

…in thalassaemia andhemochromatosis.…

Show Full Abstract

<h4>Background and aims</h4>Intravenous iron therapies contain iron-carbohydrate complexes, designed to ensure iron becomes bioavailable via the intermediary of spleen and liver reticuloendothelial macrophages. How other tissues obtain and handle this iron remains unknown. This study addresses this question in the context of the heart.<h4>Methods</h4>A prospective observational study was conducted in 12 patients receiving ferric carboxymaltose (FCM) for iron deficiency. Myocardial, spleen, and liver magnetic resonance relaxation times and plasma iron markers were collected longitudinally. To examine the handling of iron taken up by the myocardium, intracellular labile iron pool (LIP) was imaged in FCM-treated mice and cells.<h4>Results</h4>In patients, myocardial relaxation time T1 dropped maximally 3 h post-FCM, remaining low 42 days later, while splenic T1 dropped maximally at 14 days, recovering by 42 days. In plasma, non-transferrin-bound iron (NTBI) peaked at 3 h, while ferritin peaked at 14 days. Changes in liver T1 diverged among patients. In mice, myocardial LIP rose 1 h and remained elevated 42 days after FCM. In cardiomyocytes, FCM exposure raised LIP rapidly. This was prevented by inhibitors of NTBI transporters T-type and L-type calcium channels and divalent metal transporter 1.<h4>Conclusions</h4>Intravenous iron therapy with FCM delivers iron to the myocardium rapidly through NTBI transporters, independently of reticuloendothelial macrophages. This iron remains labile for weeks, reflecting the myocardium's limited iron storage capacity. These findings challenge current notions of how the heart obtains iron from these therapies and highlight the potential for long-term dosing to cause cumulative iron build-up in the heart.

Also flagged:LevonorgestrelAtypical HyperplasiaEndometrial Cancerendometrial atypical hyperplasiaAHendometrioid endometrial cancer
Journal Article 2024-11-01 No Snippets Bowen MB, Melendez B, Zhang Q, Yang RK, Fellman BM, Lawson BC, Adjei NN, Celestino J, Wani KM, Singh B, Urbauer DL, Lazar AJ, Lu KH, Wargo JA, Westin SN, Yates MS.
Show Full Abstract

<h4>Purpose</h4>Nonsurgical treatment options are increasingly needed for endometrial atypical hyperplasia (AH) and endometrioid endometrial cancer (EEC). Despite promising initial response rates, prospective long-term data and determinants for relapse are limited.<h4>Materials and methods</h4>Follow-up data from patients in our prospective phase II trial of levonorgestrel intrauterine device (LIUD) for AH/G1EEC were collected from medical records. Spatial transcriptomics (Nanostring GeoMX digital spatial profiling) with in silico cell type deconvolution and pathway analyses were employed on longitudinal biopsy samples from five patients across pre-treatment, on-treatment, and relapse.<h4>Results</h4>Of 43 participants exhibiting initial response to LIUD, 41 had follow-up data. Sixteen (39%) experienced relapse. Clinical factors associated with shorter response duration included younger age, initial diagnosis of G1EEC, lack of response at 6 months, premenopausal status, and Hispanic ethnicity (P < 0.05), but only 6-month response status remained a significant predictor in a multivariate model (P = 0.023). LIUD increased abundance of NK cells (ΔMCP-counter score = 46.13, FDR = 0.004) and cytotoxic lymphocytes (ΔMCP-counter score = 277.67, FDR = 0.004), as well as lymphocyte cytotoxicity markers PRF1 (log2FC = 1.62, FDR = 0.025) and GZMA (log2FC = 2.47, FDR = 0.008). NK cells were reduced at relapse (ΔMCP-counter score = -55.96, FDR = 0.02). Immune-related pathways (IFNα response and TGFβ signaling) were enriched at relapse (FDR < 0.05). IDO1 expression, reflecting immune exhaustion, was upregulated at relapse (FDR < 0.05).<h4>Conclusions</h4>Upfront resistance and relapse after initial response to LIUD for AH/G1EEC impacts nearly half of patients, remaining a major hurdle for nonsurgical treatment of AH/G1EEC. Molecular studies evaluating longitudinal biopsies from a small cohort implicate immune mechanisms at relapse, including reversal of progestin-related immunomodulation and increased immune exhaustion. See related commentary by Johannet and Friedman, p. 5001.

OLFM4
Also flagged:Lung Inflammationtropical infectionbacterial pneumoniamelioidosisinfectionPulmonary melioidosis
Journal Article 2024-11-01 ✓ 1 Snippet Wright SW, Sengyee S, Ekchariyawat P, Phunpang R, Dulsuk A, Rerolle G, Bashmail A, Chantratita N, Gharib SA, West TE.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Pulmonary melioidosis is a severe tropical infection caused by <i>Burkholderia pseudomallei</i> and is associated with high mortality, despite early antibiotic treatment. γδ T cells have been increasingly implicated as drivers of the host neutrophil response during bacterial pneumonia, but their role in pulmonary melioidosis is unknown. Here, we report that in patients with melioidosis, a lower peripheral blood γδ T-cell concentration is associated with higher mortality, even when adjusting for severity of illness. γδ T cells were also enriched in the lung and protected against mortality in a mouse model of pulmonary melioidosis. γδ T-cell deficiency in infected mice induced an early recruitment of neutrophils to the lung, independent of bacterial burden. Subsequently, γδ T-cell deficiency resulted in increased neutrophil-associated inflammation in the lung as well as impaired bacterial clearance. In addition, γδ T cells influenced neutrophil function and subset diversity in the lung after infection. Our results indicate that γδ T cells serve a novel protective role in the lung during severe bacterial pneumonia by regulating excessive neutrophil-associated inflammation.

PTGIS
Also flagged:AMLdeathtumorsacute myeloid leukemiaMT1Ecell proliferation
Journal Article 2024-11-01 ✓ 1 Snippet Zhuang X, Chen P, Yang K, Yang R, Man X, Wang R, Shi Y.
In-Text Gene Mentions

…33 PYCARD, 34PTGIS, 35 FADD, 36…

Show Full Abstract

Regulated cell death (RCD) plays a crucial role in the initiation and progression of tumors, particularly in acute myeloid leukemia (AML). This study investigates the prognostic importance of RCD-related genes in AML and their correlation with immune infiltration. We combined TCGA and GTEx data, analyzing 1,488 RCD-related genes, to develop a predictive model using LASSO regression and survival analysis. The model's accuracy was validated against multiple databases, examining immune cell infiltration, therapy responses, and drug sensitivity among risk groups. RT-qPCR confirmed MT1E expression in AML patients and healthy bone marrow. CCK8 and Transwell assays measured cell proliferation, adhesion, migration, and invasion, while flow cytometry and Western blotting assessed apoptosis and protein expression. We developed a prognostic model using 10 RCD methods, which demonstrated strong predictive ability, showing an inverse correlation between age and risk scores with survival in AML patients. Functional enrichment analysis of the model is linked to immune modulation pathways. RT-qPCR revealed significantly lower MT1E expression in AML vs healthy bone marrow (P < 0.05). Consequently, experiments were designed to assess the function of MT1E overexpression. Findings indicated that MT1E overexpression showed it significantly reduced THP-1 cell proliferation and adhesion (P < 0.001), decreased migration (P < 0.001), and invasiveness (P < 0.05), and increased apoptosis (P < 0.05), with a notable rise in Caspase3 expression. A novel AML RCD risk model was developed, showing promise as a prognostic marker for evaluating outcomes and immune therapy effectiveness. Insights into MT1E's impact on AML cell proliferation and apoptosis open possibilities for improving patient outcomes and devising personalized treatment strategies.

Also flagged:sphingosine 1-phosphate receptor-1S1P receptor-1S1PR1endothelial dysfunctionS1Palbumin
Journal Article 2024-11-01 No Snippets Del Gaudio I, Nitzsche A, Boyé K, Bonnin P, Poulet M, Nguyen TQ, Couty L, Ha HTT, Nguyen DT, Cazenave-Gassiot A, Ben Alaya K, Thérond P, Chun J, Wenk MR, Proia RL, Henrion D, Nguyen LN, Eichmann A, Camerer E.
Show Full Abstract

<h4>Aims</h4>Circulating levels of sphingosine 1-phosphate (S1P), an HDL-associated ligand for the endothelial cell (EC) protective S1P receptor-1 (S1PR1), are reduced in disease states associated with endothelial dysfunction. Yet, as S1PR1 has high affinity for S1P and can be activated by ligand-independent mechanisms and EC autonomous S1P production, it is unclear if relative reductions in circulating S1P can cause endothelial dysfunction. It is also unclear how EC S1PR1 insufficiency, whether induced by deficiency in circulating ligand or by S1PR1-directed immunosuppressive therapy, affects different vascular subsets.<h4>Methods and results</h4>We here fine map the zonation of S1PR1 signalling in the murine blood and lymphatic vasculature, superimpose cell-type-specific and relative deficiencies in S1P production to define ligand source and dose dependence, and correlate receptor engagement to essential functions. In naïve blood vessels, despite broad expression, EC S1PR1 engagement was restricted to resistance-size arteries, lung capillaries, and a subset of high-endothelial venules (HEVs). Similar zonation was observed for albumin extravasation in EC S1PR1-deficient mice, and brain extravasation was reproduced with arterial EC-selective S1pr1 deletion. In lymphatic ECs, S1PR1 engagement was high in collecting vessels and lymph nodes and low in blind-ended capillaries that drain tissue fluids. While EC S1P production sustained S1PR1 signalling in lymphatics and HEV, haematopoietic cells provided ∼90% of plasma S1P and sustained signalling in resistance arteries and lung capillaries. S1PR1 signalling and endothelial function were both surprisingly sensitive to reductions in plasma S1P with apparent saturation around 50% of normal levels. S1PR1 engagement did not depend on sex or age but modestly increased in arteries in hypertension and diabetes. Sphingosine kinase (Sphk)-2 deficiency also increased S1PR1 engagement selectively in arteries, which could be attributed to Sphk1-dependent S1P release from perivascular macrophages.<h4>Conclusion</h4>This study highlights vessel subtype-specific S1PR1 functions and mechanisms of engagement and supports the relevance of S1P as circulating biomarker for endothelial function.

Also flagged:Jasmonic Acidmethyl jasmonatebiosynthesischloroplastsgene silencingmetabolism
Journal Article 2024-11-01 No Snippets Liu R, Shu B, Wang Y, Feng J, Yu B, Gan Y, Liang Y, Qiu Z, Yan S, Cao B.
Show Full Abstract

High-temperature stress (HTS) affects the growth and production of vegetable crops, including eggplant (Solanum melongena L.). Jasmonic acid (JA) plays key roles in regulating resistance to biotic and abiotic stresses in plants. Nonetheless, reports on the role of JA in heat tolerance in eggplant are rare. Herein, the effects of JA on heat tolerance in eggplant and the functions of the JA biosynthetic genes SmLOX4 and SmLOX5 were analyzed. The results showed that the JA content increased under high-temperature treatment (HTT) and exogenous methyl jasmonate (MeJA) treatment reduced the damage caused by HTT to eggplant. The expression of SmLOX4 and SmLOX5 was induced by HTT and significantly positively correlated with JA biosynthesis. SmLOX4 and SmLOX5 were localized in chloroplasts. The silencing of SmLOX4 and SmLOX5 by virus-induced gene silencing suppressed the heat tolerance of eggplant, whereas the overexpression of SmLOX4 and SmLOX5 enhanced the heat tolerance of Arabidopsis thaliana. JA content and the expression of JA signaling-related genes decreased in the SmLOX4- and SmLOX5-silenced plants but increased in the OE-SmLOX4 and OE-SmLOX5 transgenic plants. These results revealed that SmLOX4 and SmLOX5 improved eggplant heat tolerance by mediating JA biosynthesis and JA signaling pathways.

CACNA1E
Also flagged:gallbladder cancertumorcancerTP53SMAD4ERBB3
Journal Article 2024-11-01 ✓ 1 Snippet Awasthi S, Kumar R, Pradhan D, Rawal N, Goel H, Sahu P, Sisodiya S, Rana R, Kumar S, Dash NR, Das P, Agrawal U, Rath GK, Kaur T, Dhaliwal RS, Hussain S, Saluja SS, Tanwar P.
In-Text Gene Mentions

…(16%), ERBB3 (11%),CACNA1E(8%), KRAS (8%),…

Show Full Abstract

<h4>Background</h4>Gallbladder cancer (GBC) is a common gastrointestinal malignancy noted for its aggressive characteristics and poor prognosis, which is mostly caused by delayed detection. However, the scarcity of information regarding somatic mutations in Indian patients with GBC has hampered the development of efficient therapeutic options. In the present study, the authors attempted to bridge this gap by revealing the mutational profile of GBC.<h4>Materials and methods</h4>To evaluate the somatic mutation profile, whole exome sequencing (WES) was performed on 66 tumor and matched blood samples from individuals with GBC. Somatic variant calling was performed using GATK pipeline. Variants were annotated at pathogenic and oncogenic levels, using ANNOVAR, VEP tools and the OncoKB database. Mutational signature analysis, oncogenic pathway analysis and cancer driver genes identification were performed at the functional level by using the maftools package.<h4>Results</h4>Our findings focused on the eight most altered genes with pathogenic and oncogenic mutations: TP53, SMAD4, ERBB3, KRAS, ARID1A, PIK3CA, RB1, and AXIN1. Genes with pathogenic single nucleotide variations (SNVs) were enriched in oncogenic signaling pathways, particularly RTK-RAS, WNT, and TP53 pathways. Furthermore, our research related certain mutational signatures, such as cosmic 1, cosmic 6, and cosmic 18, 29, to known characteristics including patient age and tobacco smoking, providing important insights into disease etiology.<h4>Conclusions</h4>Given the scarcity of exome-based sequencing studies focusing on the Indian population, this study represents a significant step forward in providing a framework for additional in-depth mutational analysis. Genes with substantial oncogenic and pathogenic mutations are promising candidates for developing targeted mutation panels, particularly for GBC detection.

HFE
Also flagged:ironiron overload disordershereditary hemochromatosismetabolismbeta-thalassemiaerythropoiesis
Journal Article 2024-11-01 ✓ 1 Snippet Cheng AN, Al-Samkari H.
In-Text Gene Mentions

…far beyond classicalhemochromatosis.…

Show Full Abstract

<h4>Abstract</h4>Iron overload and its complications are recognized to be morbid and fatal in patients with congenital hemolytic anemias. In patients with iron overload caused by congenital hemolytic anemias, there has been no study evaluating the dose-response relationship between serum markers of iron overload and long-term health complications. Filling this critical gap was the aim of this study. We evaluated outcomes in a 5-hospital observational cohort study of adults with congenital hemolytic anemias diagnosed with iron overload over a 40-year period and assessed associations between depth and duration of iron overload, as well as clinical complications including diabetes, heart disease, malignancy, bone density disorders, and death. One hundred seventy patients with congenital hemolytic anemias developing iron overload were included. More years experienced of ferritin >500 ng/mL and >1000 ng/mL were associated with the development of diabetes mellitus, with adjusted odds ratios (ORs) of 2.61 per 10-year increment (P = .034) and 3.24 per 10-year increment (P = .035), respectively. More years experienced of ferritin >1000 ng/mL were associated with the development of heart disease (adjusted OR, 5.30 per 10-year increment; P = .002). Peak lifetime ferritin of >10 000 ng/mL was associated with sixfold odds of developing diabetes (P = .04) and 10-fold odds of developing heart disease (P = .007). A peak ferritin >10 000 ng/mL was associated with an increase in mortality (adjusted OR, 6.77; P = .033). In conclusion, iron overload in patients with congenital hemolytic anemias is associated with diabetes mellitus, cardiac disease, and death. Prolonged exposure to relatively modest iron overload was associated with nearly threefold increased odds of diabetes.

HFE
Also flagged:ironiron deficiency anemiaanemiaferroussulfategestation
Journal Article 2024-11-01 ✓ 1 Snippet Stanworth SJ, Churchill D, Sweity S, Holmes T, Hudson C, Brown R, Lax SJ, Murray J, Spiby H, Roy N, Farmer A, Gale C, Crayton E, Lorencatto F, Griffiths J, Mullings J, Last S, Knight M.
In-Text Gene Mentions

…were eligible) orhemochromatosis, a preexisting known…

Show Full Abstract

<h4>Abstract</h4>Oral iron is first-line medication for iron deficiency anemia in pregnancy. We conducted a pilot randomized trial to investigate the impact of different doses of oral iron supplementation started early in pregnancy on women without anemia for 4 main outcomes: recruitment and protocol compliance, adherence, maintenance of maternal hemoglobin, and side effects. At antenatal clinic visits, participants were allocated to 1 of 3 trial arms in a 1:1:1 ratio: 200 mg ferrous sulfate daily, alternate days, or 3 times per week. The participants were followed to delivery. Baseline characteristics of 300 recruited participants were well matched between trial arms. The mean proportion of tablets taken as expected per participant was 82.5% overall (72.3%, 89.6%, and 84.5% for the daily, alternate days, and 3 times a week arm, respectively). There was a lower overall adherence rate in the daily arm (47%) than in the alternate days (62%) and the 3 times per week (61%) arms. A reduction in hemoglobin between randomization and 28 weeks' gestation seemed smaller for the daily arm. A range of side effects were commonly reported at baseline before starting interventions and at later antenatal visits. Many side effects of iron overlapped with normal pregnancy symptoms. A daily iron dosing schedule might give the best opportunity for delivering an adequate iron load during pregnancy in women without anemia. Further randomized trials powered on clinical outcomes are needed to establish the clinical effectiveness of oral iron supplementation to prevent iron deficiency anemia. This study was registered (#ISRCTN12911644).

HFE
Also flagged:DMT1ironβ-thalassemia intermediairon-regulatory hormoneFPNmembrane
Journal Article 2024-11-01 ✓ 2 Snippets Yu Y, Woloshun RR, Lee JK, Ebea-Ugwuanyi PO, Shine JS, Zhu S, He Y, Collins JF.
In-Text Gene Mentions

…(KO) mice (modelinghemochromatosis).…

…that typifies murinehemochromatosis, and in vivo…

Show Full Abstract

<h4>Abstract</h4>β-thalassemia is an iron-loading anemia caused by homozygous mutation of the hemoglobin subunit β (HBB) gene. In β-thalassemia intermedia (βTI), a non-transfusion-dependent form of the disease, iron overload is caused by excessive absorption of dietary iron due to inappropriately low production of the iron-regulatory hormone hepcidin. Low hepcidin stabilizes the iron exporter ferroportin (FPN) on the basolateral membrane of enterocytes. High FPN activity may deplete intracellular iron and enhance expression of the predominant iron importer divalent metal-ion transporter 1 (DMT1). In mice, DMT1 mediates normal iron absorption under physiological conditions and excessive iron absorption in pathological iron overload (eg, hereditary hemochromatosis). Here, we hypothesized that DMT1 drives elevated iron absorption in βTI. Accordingly, we crossed Hbbth3/+ mice, a preclinical model of βTI, with intestine-specific DMT1-knockout mice. Ablation of intestinal DMT1 in Hbbth3/+ mice caused a pathophysiological shift from iron overload to an iron-deficiency phenotype with exacerbated anemia. DMT1 is thus required for iron absorption and iron loading in Hbbth3/+ mice. Based upon these outcomes, we further logically postulated that in vivo knockdown of intestinal DMT1 would mitigate iron loading in Hbbth3/+ mice. Ginger-derived, lipid nanoparticles carrying DMT1-specific (or control) small interfering RNAs (siRNAs) were administered by oral, intragastric gavage to 4-week-old Hbbth3/+ mice daily for 16 days. siRNA treatment reduced DMT1 expression by >80% and blunted iron loading, as indicated by significant reductions in liver iron and serum ferritin (which reflect body iron stores). These notable experimental outcomes establish intestinal DMT1 as a plausible therapeutic target to mitigate iron overload in βTI.

SUDS3
Also flagged:tumors5-azacitidineDNA methyltransferasevemurafenibBRAFtumor
Journal Article 2024-11-01 ✓ 1 Snippet Lee HM, Saw AK, Morris VK, Napolitano S, Bristow C, Srinivasan S, Peoples M, Sorokin A, Kanikarla Marie P, Schulz J, Singh AK, Terranova C, Coker O, Jain A, Kopetz S, Rai K.
In-Text Gene Mentions

…the involvement ofpolycomb repressiverepressive complex (PRC)…

Show Full Abstract

<h4>Purpose</h4>BRAFV600E-mutated colorectal cancer exhibits a strong correlation with DNA hypermethylation, suggesting that this subgroup of tumors presents unique epigenomic phenotypes. Nonetheless, 5-azacitidine, which inhibits DNA methyltransferase activity, is not efficacious in BRAFV600E colorectal cancer in vivo.<h4>Experimental design</h4>We randomized and treated mice implanted with patient-derived tumor xenografts harboring BRAFV600E mutation with control, 5-azacitidine, vemurafenib (BRAF inhibitor), or the combination. Comprehensive epigenomic profiling was conducted on control and 5-azacitidine-treated tumor samples, including DNA methylation, histone modifications, chromatin accessibility, and gene expression. Combinations of epigenetic agents were explored in preclinical BRAFV600E colorectal cancer models.<h4>Results</h4>A profound reduction of DNA methylation levels upon 5-azacitidine treatment was confirmed, however, transcriptional repression was not relieved. This study unbiasedly explored the adaptive engagement of other epigenomic modifications upon 5-azacitidine treatment. A loss of histone acetylation and a gain of histone methylations, including H3K27 and H3K4 trimethylation, were observed around these hypomethylated regions, suggesting the involvement of polycomb repressive complex (PRC) activity around the genome with loss of DNA methylation, therefore maintaining the repression of key tumor-suppressor genes. Combined inhibition of PRC activity through EZH2 inhibition with 5-azacitidine treatment additively improved efficacies in BRAFV600E colorectal cancer cells.<h4>Conclusions</h4>In conclusion, DNA hypomethylation by 5-azacitidine exhibits a close association with H3K27me3 and PRC activity in BRAFV600E colorectal cancer, and simultaneous blockade of DNA methyltransferase and EZH2 holds promise as a potential therapeutic strategy for patients with BRAFV600E-mutated colorectal cancer.

HTT
Also flagged:motor neuron diseaseneurological disordersamyotrophic lateral sclerosisALSC9ORF72hexanucleotide
Journal Article 2024-11-01 ✓ 5 Snippets Roos AK, Stenvall E, Kockum ES, Grönlund KÅ, Alstermark H, Wuolikainen A, Andersen PM, Nordin A, Forsberg KME.
In-Text Gene Mentions

…shown that huntingtin (HTT) repeat expansions with…

…without C9ORF72HRE whoseHTTgene status was…

…with antibodies againstHTT, p62, pTDP-43, Tau…

…the association betweenHTTgene expansion and…

…the association betweenHTTIA gene expansion…

Show Full Abstract

Short tandem repeat expansions in the human genome are overrepresented in a variety of neurological disorders. It was recently shown that huntingtin (HTT) repeat expansions with full penetrance, i.e. 40 or more CAG repeats, which normally cause Huntington's disease (HD), are overrepresented in patients with amyotrophic lateral sclerosis (ALS). Whether patients carrying HTT repeat expansions with reduced penetrance, (36-39 CAG repeats), or alleles with intermediate penetrance, (27-35 CAG repeats), have an increased risk of ALS has not yet been investigated. Here, we examined the role of HTT repeat expansions in a motor neuron disease (MND) cohort, searched for expanded HTT alleles, and investigated correlations with phenotype and neuropathology. MND patients harboring C9ORF72 hexanucleotide repeat expansions (HREs) were included, to investigate whether HTT repeat expansions were more common in this group. We found a high prevalence of intermediate (range 5.63%-6.61%) and reduced penetrance (range 0.57%-0.66%) HTT gene expansions in this cohort compared to other populations of European ancestry, but no differences between the MND cohort and the control cohort were observed, regardless of C9ORF72HRE status. Upon autopsy of three patients with intermediate or reduced penetrance HTT alleles, huntingtin inclusions were observed in the caudate nucleus and frontal lobe, but no significant somatic mosaicism was detected in different parts of the nervous system. Thus, we demonstrate, for the first time, huntingtin inclusions in individuals with MND and intermediate and reduced penetrance HTT repeat expansions but more clinicopathological investigations are needed to further understand the impact of HTT gene expansion-related pleiotropy.

SERPINC1
Also flagged:sleepcholesterolcognitiondementiaethylenediaminetraacetic acidhearing
Journal Article 2024-11-01 ✓ 2 Snippets Mellow ML, Dumuid D, Wade A, Olds T, Stanford T, Keage H, Hunter M, Ware N, Simpson FM, Karayanidis F, Smith AE.
In-Text Gene Mentions

…different associations withACE-IIIthan waist–hip ratio.…

…predicted change inACE-IIIand waist–hip ratio…

Show Full Abstract

<h4>Background</h4>Each day is made up of a composition of "time-use behaviors." These can be classified by their intensity (eg, light or moderate-vigorous physical activity [PA]) or domain (eg, chores, socializing). Intensity-based time-use behaviors are linked with cognitive function and cardiometabolic health in older adults, but it is unknown whether these relationships differ depending on the domain (or type/context) of behavior.<h4>Methods</h4>This study included 397 older adults (65.5 ± 3.0 years, 69% female, 16.0 ± 3.0 years education) from Adelaide and Newcastle, Australia. Time-use behaviors were recorded using the Multimedia Activity Recall for Children and Adults, cognitive function was measured using the Addenbrooke's Cognitive Examination III and Cambridge Neuropsychological Test Automated Battery, and systolic and diastolic blood pressure, total cholesterol, and waist-hip ratio were also recorded. Two 24-hour time-use compositions were derived from each participant's Multimedia Activity Recall for Children and Adults, including a 4-part intensity composition (sleep, sedentary behavior, light, and moderate-vigorous PA) and an 8-part domain composition (Sleep, Self-Care, Chores, Screen Time, Quiet Time, Household Administration, Sport/Exercise, and Social).<h4>Results</h4>Linear regressions found significant associations between the domain composition and both Addenbrooke's Cognitive Examination III (p = .010) and waist-hip ratio (p = .009), and between the intensity composition and waist-hip ratio (p = .025). Isotemporal substitution modeling demonstrated that the domains of sedentary behaviors and PA impacted their associations with Addenbrooke's Cognitive Examination III, while any PA appeared beneficial for waist-hip ratio.<h4>Conclusions</h4>Findings suggest the domain of behavior should be considered when aiming to support cognitive function, whereas, for cardiometabolic health, it appears sufficient to promote any type of PA.

Also flagged:Brain TumorsDeathlung cancersolid cancerlung adenomascarcinomas
Journal Article 2024-11-01 No Snippets Finkelstein SR, Patel R, Deland K, Mercer J, Starr B, Zhu D, Min H, Reinsvold M, Campos LDS, Williams NT, Luo L, Ma Y, Neff J, Hoenerhoff MJ, Moding EJ, Kirsch DG.
Show Full Abstract

The main deterrent to long-term space travel is the risk of Radiation Exposure Induced Death (REID). The National Aeronautics and Space Administration (NASA) has adopted Permissible Exposure Levels (PELs) to limit the probability of REID to 3% for the risk of death due to radiation-induced carcinogenesis. The most significant contributor to current REID estimates for astronauts is the risk of lung cancer. Recently updated lung cancer estimates from Japan's atomic bomb survivors showed that the excess relative risk of lung cancer by age 70 is roughly fourfold higher in females compared to males. However, whether sex differences may impact the risk of lung cancer due to exposure to high charge and energy (HZE) radiation is not well studied. Thus, to evaluate the impact of sex differences on the risk of solid cancer development after HZE radiation exposure, we irradiated Rbfl/fl, Trp53fl/+ male and female mice infected with Adeno-Cre with various doses of 320 kVp X rays or 600 MeV/n 56Fe ions and monitored them for any radiation-induced malignancies. We conducted complete necropsy and histopathology of major organs on 183 male and 157 female mice after following them for 350 days postirradiation. We observed that lung adenomas/carcinomas and esthesioneuroblastomas (ENBs) were the most common primary malignancies in mice exposed to X rays and 56Fe ions, respectively. In addition, 1 Gy 56Fe-ion exposure compared to X-ray exposure led to a significantly increased incidence of lung adenomas/carcinomas (P = 0.02) and ENBs (P < 0.0001) in mice. However, we did not find a significantly higher incidence of any solid malignancies in female mice as compared to male mice, regardless of radiation quality. Furthermore, gene expression analysis of ENBs suggested a distinct gene expression pattern with similar hallmark pathways altered, such as MYC targets and MTORC1 signaling, in ENBs induced by X rays and 56Fe ions. Thus, our data revealed that 56Fe-ion exposure significantly accelerated the development of lung adenomas/carcinomas and ENBs compared to X rays, but the rate of solid malignancies was similar between male and female mice, regardless of radiation quality.

Also flagged:p53metabolismPARP1degradationRRM2BNRF2
Journal Article 2024-11-01 No Snippets Elfar GA, Aning O, Ngai TW, Yeo P, Chan JWK, Sim SH, Goh L, Yuan J, Phua CZJ, Yeo JZZ, Mak SY, Goh BKP, Chow PK, Tam WL, Ho YS, Cheok CF.
Show Full Abstract

Mechanisms underlying p53-mediated protection of the replicating genome remain elusive, despite the quintessential role of p53 in maintaining genomic stability. Here, we uncover an unexpected function of p53 in curbing replication stress by limiting PARP1 activity and preventing the unscheduled degradation of deprotected stalled forks. We searched for p53-dependent factors and elucidated RRM2B as a prime factor. Deficiency in p53/RRM2B results in the activation of an NRF2 antioxidant transcriptional program, with a concomitant elevation in basal PARylation in cells. Dissecting the consequences of p53/RRM2B loss revealed a crosstalk between redox metabolism and genome integrity that is negotiated through a hitherto undescribed NRF2-PARP1 axis, and pinpoint G6PD as a primary oxidative stress-induced NRF2 target and activator of basal PARylation. This study elucidates how loss of p53 could be destabilizing for the replicating genome and, importantly, describes an unanticipated crosstalk between redox metabolism, PARP1 and p53 tumor suppressor pathway that is broadly relevant in cancers and can be leveraged therapeutically.

SERPINC1
Also flagged:vascular malformationportal hypertensionPHvascular malformationshepatic encephalopathyataxia
Journal Article 2024-11-01 ✓ 2 Snippets Takeuchi R, Ishigaki K, Yoshida O, Heishima T, Iida K, Asano K.
In-Text Gene Mentions

…low anti‐thrombin III (ATIII; 67%).…

…in APTT andATIII; thus, whole blood…

Show Full Abstract

Computed tomography angiography (CTA) was performed under general anaesthesia on a 7-month-old toy poodle that was referred with the chief complaints of salivation and neurological symptoms. The CTA revealed a rare form of posthepatic portosystemic shunt (PSS) via the suspected persistent left umbilical vein communicating with the internal thoracic vein in addition to an azygos continuation of the caudal vena cava (CVC). The patient underwent surgery for partial ligation of PSS on Day 4 after the initial examination. On Day 71, after the initial examination, a second surgery was performed for complete ligation. Approximately 10 years have passed since the patient's second surgery, and he is still healthy, and generally in good condition. Although the morphology of the shunt in this case was unusual and was accompanied by an azygos continuation of the CVC, a favourable course of treatment was obtained by ligating the shunt vessel. This case report suggests that CTA can reveal the complex morphological characteristics like our case. Surgical treatment in this case resulted in favourable progress, similar to that in dogs with commonly observed extrahepatic PSS.

Also flagged:STK19transcription-coupled repair factorsynthesistoRNA polymerase IITFIIH
Journal Article 2024-11-01 No Snippets Tan Y, Gao M, Huang Y, Zhan D, Wu S, An J, Zhang X, Hu J.
Show Full Abstract

Transcription-coupled repair (TCR) is the major pathway to remove transcription-blocking lesions. Although discovered for nearly 40 years, the mechanism and critical players of mammalian TCR remain unclear. STK19 is a factor affecting cell survival and recovery of RNA synthesis in response to DNA damage, however, whether it is a necessary component for TCR is unknown. Here, we demonstrated that STK19 is essential for human TCR. Mechanistically, STK19 is recruited to damage sites through direct interaction with CSA. It can also interact with RNA polymerase II in vitro. Once recruited, STK19 plays an important role in UVSSA ubiquitination which is needed for TCR. STK19 also promotes TCR independent of UVSSA ubiquitination by stimulating TFIIH recruitment through its direct interaction with TFIIH. In summary, our results suggest that STK19 is a key factor of human TCR that links CSA, UVSSA ubiquitination and TFIIH loading, shedding light on the molecular mechanisms of TCR.

STAU1
Also flagged:UPF1catalytic activitystructural proteinsNucleocapsidRNA helicasesMOV10
Journal Article 2024-11-01 ✓ 4 Snippets Mallick M, Boehm V, Xue G, Blackstone M, Gehring NH, Chakrabarti S.
In-Text Gene Mentions

…RNA binding proteinSTAU1and the eukaryotic…

…of UPF2 toSTAU1and UPF1 in…

…(UPF1–UPF2–UPF3 and UPF1–UPF2–STAU1), we observe a…

…binds UPF3 andSTAU1.…

Show Full Abstract

The RNA genome of the SARS-CoV-2 virus encodes for four structural proteins, 16 non-structural proteins and nine putative accessory factors. A high throughput analysis of interactions between human and SARS-CoV-2 proteins identified multiple interactions of the structural Nucleocapsid (N) protein with RNA processing factors. The N-protein, which is responsible for packaging of the viral genomic RNA was found to interact with two RNA helicases, UPF1 and MOV10 that are involved in nonsense-mediated mRNA decay (NMD). Using a combination of biochemical and biophysical methods, we investigated the interaction of the SARS-CoV-2 N-protein with NMD factors at a molecular level. Our studies led us to identify the core NMD factor, UPF2, as an interactor of N. The viral N-protein engages UPF2 in multipartite interactions and can negate the stimulatory effect of UPF2 on UPF1 catalytic activity. N also inhibits UPF1 ATPase and unwinding activities by competing in binding to the RNA substrate. We further investigate the functional implications of inhibition of UPF1 catalytic activity by N in mammalian cells. The interplay of SARS-CoV-2 N with human UPF1 and UPF2 does not affect decay of host cell NMD targets but might play a role in stabilizing the viral RNA genome.

TNFSF4PRDX6
Also flagged:MethylationDepressionmajor depressive disorderserotoninnorepinephrineRSPO2
Journal Article 2024-11-01 ✓ 4 Snippets Schiele MA, Crespo Salvador O, Lipovsek J, Schwarte K, Schlosser P, Zwanzger P, Arolt V, Baune BT, Köttgen A, Domschke K.
In-Text Gene Mentions

…subsequently annotated as lnc-TNFSF4-3( Volders et…

…Member 4 (TNFSF4) gene has…

…Peroxiredoxin 6 (PRDX6) gene.…

PRDX6has been linked…

Show Full Abstract

<h4>Background</h4>Despite the well-documented efficacy of antidepressant agents for the treatment of major depressive disorder (MDD), initial treatment nonresponse rates are high. Recent years have seen an increase in research into predictive biomarkers toward improving diagnosis and individualized treatment. Among those, epigenetic mechanisms such as DNA methylation constitute promising candidate markers in predicting antidepressant treatment response in MDD. The present study sought to address epigenome-wide DNA methylation as a predictor of antidepressant treatment response in the largest sample to date of patients with MDD.<h4>Methods</h4>Epigenome-wide DNA methylation was analyzed using the Infinium MethylationEPIC BeadChip in peripheral blood of n = 230 Caucasian patients with MDD receiving 6-week antidepressant treatment in a naturalistic in-patient setting as well as in a subsample of n = 107 patients primarily receiving continuous treatment with serotonin reuptake inhibitors or serotonin and norepinephrine reuptake inhibitors. Treatment response was assessed by means of the Hamilton Depression Scale.<h4>Results</h4>No genome-wide significant hits were observed. Suggestive (P < 1E-5) epigenome-wide evidence was discerned for altered DNA methylation at 6 CpG sites (LOC102724467, LOC100506023, RSPO2, SAG, IL16, PRKCI) to predict response to naturalistic antidepressant treatment. In patients treated with serotonin reuptake inhibitors or serotonin and norepinephrine reuptake inhibitors, differential DNA methylation at 11 CpGs, for example, mapping to the TIMP2, VDAC1, or SORL1 genes, was suggestively associated with treatment response.<h4>Conclusions</h4>The present results provide preliminary evidence for altered DNA methylation patterns to be associated with antidepressant treatment response in MDD. Provided significant replication in independent and larger samples, the present findings might in the future aid in clinical decision-making toward more individualized and thus more efficacious treatments of MDD.

RC3H1
Also flagged:behavioralmale sterilitydeterminationsex chromosomesspermatogenesisfertilization
Journal Article 2024-11-01 ✓ 1 Snippet Matsukawa K, Kato Y, Yoshida A, Onishi H, Nakano S, Itoh M, Takano-Shimizu-Kouno T.
In-Text Gene Mentions

…we typed theroquin-1isoform X2 marker…

Show Full Abstract

Sexual selection drives rapid evolution of morphological, physiological, and behavioral traits, especially in males, and it may also drive the rapid evolution of hybrid male sterility. Indeed, the faster male theory of speciation was once viewed as a major cause of Haldane's rule in male-heterogametic XY taxa, but is increasingly being replaced by the genetic conflict hypothesis partly because it cannot explain the faster evolution of hybrid female sterility in female-heterogametic ZW taxa. The theory nonetheless predicts that there should be more genes for hybrid male sterility than for hybrid female sterility even in such taxa, but this remains untested. Thus, finding evidence for the faster male theory of reproductive isolation beyond the F1 generation in ZW systems still represents a challenge to studying the impact of sexual selection. In this study, we examined F2 hybrids between the domesticated silkworm Bombyx mori and the wild silk moth Bombyx mandarina, which have ZW sex determination. We found that although only females showed reduced fertility in the F1 generation, the F2 hybrid males had a significant reduction in fertility compared with the parental and F1 males. Importantly, 27% of the F2 males and 15% of the F2 females were completely sterile, suggesting the presence of recessive incompatibilities causing male sterility in female-heterogametic taxa.

Also flagged:waterl -asparaginasel -asparaginasesmembrane proteinspolypeptideamino-acid
Journal Article 2024-11-01 No Snippets Wlodawer A, Dauter Z, Rubach P, Minor W, Loch JI, Brzezinski D, Gilski M, Jaskolski M.
Show Full Abstract

The absence of solvent molecules in high-resolution protein crystal structure models deposited in the Protein Data Bank (PDB) contradicts the fact that, for proteins crystallized from aqueous media, water molecules are always expected to bind to the protein surface, as well as to some sites in the protein interior. An analysis of the contents of the PDB indicated that the expected ratio of the number of water molecules to the number of amino-acid residues exceeds 1.5 in atomic resolution structures, decreasing to 0.25 at around 2.5 Å resolution. Nevertheless, almost 800 protein crystal structures determined at a resolution of 2.5 Å or higher are found in the current release of the PDB without any water molecules, whereas some other depositions have unusually low or high occupancies of modeled solvent. Detailed analysis of these depositions revealed that the lack of solvent molecules might be an indication of problems with either the diffraction data, the refinement protocol, the deposition process or a combination of these factors. It is postulated that problems with solvent structure should be flagged by the PDB and addressed by the depositors.

Also flagged:ankyrinHuntingtinelongation factor 3protein phosphatase 2Atarget of rapamycintandem repeat proteins
Journal Article 2024-11-01 No Snippets Arrías PN, Osmanli Z, Peralta E, Chinestrad PM, Monzon AM, Tosatto SCE.
Show Full Abstract

Alpha-solenoids are a significant and diverse subset of structured tandem repeat proteins (STRPs) that are important in various domains of life. This review examines their structural and functional diversity and highlights their role in critical cellular processes such as signaling, apoptosis, and transcriptional regulation. Alpha-solenoids can be classified into three geometric folds: low curvature, high curvature, and corkscrew, as well as eight subfolds: ankyrin repeats; Huntingtin, elongation factor 3, protein phosphatase 2A, and target of rapamycin; armadillo repeats; tetratricopeptide repeats; pentatricopeptide repeats; Pumilio repeats; transcription activator-like; and Sel-1 and Sel-1-like repeats. These subfolds represent distinct protein families with unique structural properties and functions, highlighting the versatility of alpha-solenoids. The review also discusses their association with disease, highlighting their potential as therapeutic targets and their role in protein design. Advances in state-of-the-art structure prediction methods provide new opportunities and challenges in the functional characterization and classification of this kind of fold, emphasizing the need for continued development of methods for their identification and proper data curation and deposition in the main databases.

Also flagged:Breast Cancercancertumor-associated antigensynthesiscell adhesionmembrane
Journal Article 2024-11-01 No Snippets Mokbel K.
Show Full Abstract

Expression of disialoganglioside GD2 in normal tissues is primarily limited to the central nervous system, peripheral sensory nerve fibers, dermal melanocytes, lymphocytes, and mesenchymal stem cells. Its widespread overexpression in various cancer types allows it to be classified as a tumor-associated antigen with potential diagnostic and therapeutic implications. This article reviews the synthesis pathways of GD2 and its role in cancer cell adhesion, proliferation, and metastasis with a focus on breast cancer. GD2 appears to be overexpressed on the outer membrane of most breast cancer cells and breast cancer stem cells (BCSCs) and is closely linked to epithelial-mesenchymal transition (EMT). GD3 synthase (GD3S) is considered to be the rate-determining step in GD2 synthesis. Clinical studies indicate that GD2 expression is increased in 35-70% of breast cancer samples, with higher levels in triple-negative breast cancer (TNBC). This overexpression correlates with more aggressive tumor features and worse prognosis. Therapeutic targeting of GD2 with monoclonal antibodies (moABs) like dinutuximab and naxitamab has demonstrated anti-cancer activity in preclinical cancer models and human clinical trials against high-risk neuroblastoma reducing tumor growth and enhancing survival. GD2-specific chimeric antigen receptor (CAR) T-cell therapy and GD3S inhibition present other promising therapeutic strategies to improve clinical outcomes. Furthermore, GD2-targeted vaccines are currently being investigated in cancer therapy. This narrative review article underscores the critical role of GD2 in breast cancer pathogenesis and highlights the promising therapeutic opportunities it offers. It advocates for the initiation of clinical trials to further explore the potential of GD2-targeted treatment in combination with standard breast cancer therapies.

HTT
Also flagged:axonADmental disordersAPPPS1retinoic acid
Journal Article 2024-11-01 ✓ 1 Snippet Benitez MJ, Retana D, Ordoñez-Gutiérrez L, Colmena I, Goméz MJ, Álvarez R, Ciorraga M, Dopazo A, Wandosell F, Garrido JJ.
In-Text Gene Mentions

… serotonin transporter Slc6a4/5-HTT(solute carrier family…

Show Full Abstract

Alzheimer´s disease (AD) is characterized by neuronal function loss and degeneration. The integrity of the axon initial segment (AIS) is essential to maintain neuronal function and output. AIS alterations are detected in human post-mortem AD brains and mice models, as well as, neurodevelopmental and mental disorders. However, the mechanisms leading to AIS deregulation in AD and the extrinsic glial origin are elusive. We studied early postnatal differences in AIS cellular/molecular mechanisms in wild-type or APP/PS1 mice and combined neuron-astrocyte co-cultures. We observed AIS integrity alterations, reduced ankyrinG expression and shortening, in APP/PS1 mice from P21 and loss of AIS integrity at 21 DIV in wild-type and APP/PS1 neurons in the presence of APP/PS1 astrocytes. AnkyrinG decrease is due to mRNAs and protein reduction of retinoic acid synthesis enzymes Rdh1 and Aldh1b1, as well as ADNP (Activity-dependent neuroprotective protein) in APP/PS1 astrocytes. This effect was mimicked by wild-type astrocytes expressing ADNP shRNA. In the presence of APP/PS1 astrocytes, wild-type neurons AIS is recovered by inhibition of retinoic acid degradation, and Adnp-derived NAP peptide (NAPVSIPQ) addition or P2X7 receptor inhibition, both regulated by retinoic acid levels. Moreover, P2X7 inhibitor treatment for 2 months impaired AIS disruption in APP/PS1 mice. Our findings extend current knowledge on AIS regulation, providing data to support the role of astrocytes in early postnatal AIS modulation. In conclusion, AD onset may be related to very early glial cell alterations that induce AIS and neuronal function changes, opening new therapeutic approaches to detect and avoid neuronal function loss.

TNFSF4
Also flagged:GUCA2AColorectal cancertranslationalcolon adenoma carcinomacancerCOAD
Journal Article 2024-11-01 ✓ 1 Snippet Jalali P, Aliyari S, Etesami M, Saeedi Niasar M, Taher S, Kavousi K, Nazemalhosseini Mojarad E, Salehi Z.
In-Text Gene Mentions

…TNFRSF25, TNFRSF4, TNFSF13B,TNFSF4, TNFSF9, and ULBP1…

Show Full Abstract

Colorectal cancer is a leading cause of global mortality and presents a significant barrier to improving life expectancy. The primary objective of this study was to discern a unique differentially expressed gene (DEG) that exhibits a strong association with colorectal cancer. By achieving this goal, the research aims to contribute valuable insights to the field of translational medicine. We performed analysis of colorectal cancer microarray and the TCGA colon adenoma carcinoma (COAD) datasets to identify DEGs associated with COAD and common DEGs were selected. Furthermore, a pan-cancer analysis encompassing 33 different cancer types was performed to identify differential genes significantly expressed only in COAD. Then, comprehensively in-silico analysis including gene set enrichment analysis, constructing Protein-Protein interaction, co-expression, and competing endogenous RNA (ceRNA) networks, investigating the correlation between tumor-immune signatures in distinct tumor microenvironment and also the potential interactions between the identified gene and various drugs was executed. Further, the candidate gene was experimentally validated in tumoral colorectal tissues and colorectal adenomatous polyps by qRael-Time PCR. GUCA2A emerged as a significant DEG specific to colorectal cancer (|log2FC|> 1 and adjusted q-value < 0.05). Importantly, GUCA2A exhibited excellent diagnostic performance for COAD, with a 99.6% and 78% area under the curve (AUC) based on TCGA-COAD and colon cancer patients. In addition, GUCA2A expression in adenomatous polyps equal to or larger than 5 mm was significantly lower compared to smaller than 5 mm. Moreover, low expression of GUCA2A significantly impacted overall patient survival. Significant correlations were observed between tumor-immune signatures and GUCA2A expression. The ceRNA constructed included GUCA2A, 8 shared miRNAs, and 61 circRNAs. This study identifies GUCA2A as a promising prognostic and diagnostic biomarker for colorectal cancer. Further investigations are warranted to explore the potential of GUCA2A as a therapeutic biomarker.

Also flagged:Neurodegenerative DiseasesNeurodegenerationAlzheimer's diseaseADβ-amyloidtranslational
Journal Article 2024-11-01 No Snippets Sacchini S.
Show Full Abstract

Neurodegeneration involves a wide range of neuropathological alterations affecting the integrity, physiology, and architecture of neural cells. Many studies have demonstrated neurodegeneration in different animals. In the case of Alzheimer's disease (AD), spontaneous animal models should display two neurohistopathological hallmarks: the deposition of β-amyloid and the arrangement of neurofibrillary tangles. However, no natural animal models that fulfill these conditions have been reported and most research into AD has been performed using transgenic rodents. Recent studies have also demonstrated that toothed whales - homeothermic, long-lived, top predatory marine mammals - show neuropathological signs of AD-like pathology. The neuropathological hallmarks in these cetaceans could help to better understand their endangered health as well as neurodegenerative diseases in humans. This systematic review analyzes all the literature published to date on this trending topic and the proposed causes for neurodegeneration in these iconic marine mammals are approached in the context of One Health/Planetary Health and translational medicine.

HFE
Also flagged:hepatocellular carcinomaInfectionchronic infectionchronic hepatitis Bchronic hepatitis Chepatitis B surface antigen
Journal Article 2024-11-01 ✓ 2 Snippets Jiang J, Shiels MS, Rivera D, Ghany MG, Engels EA, O'Brien TR.
In-Text Gene Mentions

…titrypsin deficiency); 275.0 (hemochromatosis); 275.1 (Wilson disease);…

…E83.111, E83.118, E83.119 (hemochromatosis); E83.01 (Wilson disease);…

Show Full Abstract

<h4>Background</h4>Incidence of hepatocellular carcinoma (HCC) had been increasing steadily among older Americans but plateaued in 2015-2017. Chronic infection with hepatitis B virus (HBV) or hepatitis C virus (HCV) are important causes of HCC. The impact of improved treatments for these infections on recent trends in HCC incidence is unclear.<h4>Aims</h4>To examine the relationship between use of antiviral therapy for chronic viral hepatis and HCC incidence in older Americans.<h4>Methods</h4>We used 2007-2017 data from the Surveillance, Epidemiology, and End Results-Medicare database to estimate age-standardized incidence rates and average annual percent changes (AAPCs) for viral hepatitis-attributable HCC among individuals ≥66 years. We analyzed data from Medicare Part D to determine the frequency of HBV and HCV treatment utilization in this population.<h4>Results</h4>Overall HCC incidence increased 10.5%, from 22.2/100,000 in 2007 to 24.5/100,000 in 2017 (AAPC, 1.3%). During that time, HBV-attributable HCC rates decreased from 2.5 to 2.0/100,000 (AAPC, -1.6%), while HCV-attributable HCC rose from 6.6 to 8.0/100,000 (AAPC, 2.0%). HBV treatment among patients with HBV infection increased by 66% (2007, 7.4%; 2015, 12.3%). Treatment for HCV was stable at <2% during 2006-2013 but rose to 6.9% in 2014 and 12.7% in 2015, coinciding with the introduction of direct acting antiviral agents for HCV.<h4>Conclusions</h4>A decreased incidence of HBV-attributable HCC corresponded with an increased uptake in treatment for that infection. Despite a marked increase in the effectiveness and frequency of HCV treatment in 2014 and 2015, HCV-attributable HCC had not begun to fall as of 2017.

Also flagged:α-synucleinfibrilsLewy body diseasesmultiple system atrophyPDE46K
Journal Article 2024-11-01 No Snippets Sokratian A, Zhou Y, Tatli M, Burbidge KJ, Xu E, Viverette E, Donzelli S, Duda AM, Yuan Y, Li H, Strader S, Patel N, Shiell L, Malankhanova T, Chen O, Mazzulli JR, Perera L, Stahlberg H, Borgnia M, Bartesaghi A, Lashuel HA, West AB.
Show Full Abstract

The intricate process of α-synuclein aggregation and fibrillization holds pivotal roles in Parkinson's disease (PD) and multiple system atrophy (MSA). While mouse α-synuclein can fibrillize in vitro, whether these fibrils commonly used in research to induce this process or form can reproduce structures in the human brain remains unknown. Here, we report the first atomic structure of mouse α-synuclein fibrils, which was solved in parallel by two independent teams. The structure shows striking similarity to MSA-amplified and PD-associated E46K fibrils. However, mouse α-synuclein fibrils display altered packing arrangements, reduced hydrophobicity, and heightened fragmentation sensitivity and evoke only weak immunological responses. Furthermore, mouse α-synuclein fibrils exhibit exacerbated pathological spread in neurons and humanized α-synuclein mice. These findings provide critical insights into the structural underpinnings of α-synuclein pathogenicity and emphasize a need to reassess the role of mouse α-synuclein fibrils in the development of related diagnostic probes and therapeutic interventions.

HTT
Also flagged:HDneurodegenerative diseasedystoniacognitive declineintellectual impairmentdisturbances
Journal Article 2024-11-01 ✓ 5 Snippets Choi W, Fattah M, Shang Y, Thompson MP, Carrow KP, Hu D, Liu Z, Avram MJ, Bailey K, Berger O, Qi X, Gianneschi NC.
In-Text Gene Mentions

…the huntingtin (Htt) gene produces…

…in the mouseHttgene ( 16…

…with full-length humanHttcontaining 73 polyglutamine…

…73 polyglutamine repeats (myc-Htt-Q73-FL construct, which was…

…anti-myc antibody (recognizesHtt-Q73-FL), and immunoprecipitan…

Show Full Abstract

Recently, it has been shown that blocking the binding of valosin-containing protein (VCP) to mutant huntingtin (mtHtt) can prevent neuronal mitochondrial autophagy in Huntington's disease (HD) models. Herein, we describe the development and efficacy of a protein-like polymer (PLP) for inhibiting this interaction in cellular and in vivo models of HD. PLPs exhibit bioactivity in HD mouse striatal cells by successfully inhibiting mitochondrial destruction. PLP is notably resilient to in vitro enzyme, serum, and liver microsome stability assays, which render analogous control oligopeptides ineffective. PLP demonstrates a 2000-fold increase in circulation half-life compared to peptides, exhibiting an elimination half-life of 152 hours. In vivo efficacy studies in HD transgenic mice (R6/2) confirm the superior bioactivity of PLP compared to free peptide through behavioral and neuropathological analyses. PLP functions by preventing pathologic VCP/mtHtt binding in HD animal models; exhibits enhanced efficacy over the parent, free peptide; and implicates the PLP as a platform with potential for translational central nervous system therapeutics.

Also flagged:OX40L
Journal Article 2024-11-01 No Snippets Maltzman JS.
Show Full Abstract

OX40L-CAR-T<sub>regs</sub> show promise for treating autoimmunity and transplantation rejection.

Also flagged:lithiumPI3KAkt
Journal Article 2024-11-01 No Snippets Dwyer DS.
Show Full Abstract

No abstract available.

POU3F2SOX6
Also flagged:demyelinating disordersglioblastomatumorSterol Regulatory Element Binding Transcription Factor 1SREBF1neurodegenerative disorders
Journal Article 2024-11-01 ✓ 5 Snippets Luciani M, Garsia C, Beretta S, Cifola I, Peano C, Merelli I, Petiti L, Miccio A, Meneghini V, Gritti A.
In-Text Gene Mentions

…( PAX6, NEUROD1,POU3F2, FOXN4, MEIS1, FOXA1…

…both early (POU3F2, RXRB, GRHL1 )…

…genes ( PAX6,POU3F2) (Supplementary Fig.…

…and multipotency (SOX6, RFX2, OLIG2 )…

…( ARNT2, OTX2,POU3F2) 108 ,…

Show Full Abstract

Human induced pluripotent stem cell-derived neural stem/progenitor cells (hiPSC-NSCs) hold promise for treating neurodegenerative and demyelinating disorders. However, comprehensive studies on their identity and safety remain limited. In this study, we demonstrate that hiPSC-NSCs adopt a radial glia-associated signature, sharing key epigenetic and transcriptional characteristics with human fetal neural stem cells (hfNSCs) while exhibiting divergent profiles from glioblastoma stem cells. Long-term transplantation studies in mice showed robust and stable engraftment of hiPSC-NSCs, with predominant differentiation into glial cells and no evidence of tumor formation. Additionally, we identified the Sterol Regulatory Element Binding Transcription Factor 1 (SREBF1) as a regulator of astroglial differentiation in hiPSC-NSCs. These findings provide valuable transcriptional and epigenetic reference datasets to prospectively define the maturation stage of NSCs derived from different hiPSC sources and demonstrate the long-term safety of hiPSC-NSCs, reinforcing their potential as a viable alternative to hfNSCs for clinical applications.

HFE
Also flagged:Metabolic dysfunctionliver diseasetype 2 diabetestype 2 diabetes mellitusheart failurealcohol
Journal Article 2024-11-01 ✓ 1 Snippet Oh R, Kim G, Lee KN, Cho SH, Kim JY, Kim S, Lee YB, Jin SM, Hur KY, Han K, Kim JH.
In-Text Gene Mentions

…abscess (K75.0; A06.4),hemochromatosis(E83.1), Wilson’s disease…

Show Full Abstract

<h4>Background and aims</h4>The association between metabolic dysfunction-associated steatotic liver disease (MASLD) and cardiovascular outcomes in patients with type 2 diabetes mellitus (T2DM) is unclear. This study aimed to investigate the impact of spectrum of SLD on the risk of heart failure and cardiovascular (CV) mortality in patients with T2DM.<h4>Methods</h4>In a nationwide cohort study, 2,745,689 adults with T2DM were followed from 2009 to 2012 until 2018. Participants were categorized into no steatotic liver disease (no SLD) and SLD groups. The SLD group was stratified based on metabolic risk factors, alcohol consumption and viral hepatitis. Cox proportional hazards models were used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for heart failure (HF) and CV mortality risk.<h4>Results</h4>The prevalence of MASLD, metabolic alcohol-associated liver disease (MetALD), alcohol-associated liver disease with metabolic dysfunction (ALD with MD) and MASLD with viral hepatitis (VH) was 49.6%, 7.2%, 2.3%, and 2.0%. Individuals with MASLD (adjusted HR [aHR], 1.11), MetALD (aHR, 1.14), ALD with MD (aHR, 1.32) and MASLD with VH (aHR, 1.12) had a higher risk of developing HF compared with the no SLD group. The risk of CV mortality was also increased in those with SLD groups compared to those with no SLD. The risk of new-onset HF and CV mortality showed a J-shaped association with alcohol consumption regardless of SLD status.<h4>Conclusion</h4>SLD is independent risk factor of new-onset HF and CV mortality in persons with T2DM, and alcohol consumption has a J-shaped association with risk of HF and CV mortality, regardless of SLD status.

HTT
Also flagged:antibodiesaminopeptidase NSbindingenteric diseaserespiratory infections
Journal Article 2024-11-01 ✓ 2 Snippets Rexhepaj M, Asarnow D, Perruzza L, Park YJ, Guarino B, Mccallum M, Culap K, Saliba C, Leoni G, Balmelli A, Yoshiyama CN, Dickinson MS, Quispe J, Brown JT, Tortorici MA, Sprouse KR, Taylor AL, Corti D, Starr TN, Benigni F, Veesler D.
In-Text Gene Mentions

…antibodies against emergingdelta-coronaviruses

delta-coronaviruses

Show Full Abstract

Porcine delta-coronavirus (PDCoV) spillovers were recently detected in febrile children, underscoring the recurrent zoonoses of divergent CoVs. To date, no vaccines or specific therapeutics are approved for use in humans against PDCoV. To prepare for possible future PDCoV epidemics, we isolated PDCoV spike (S)-directed monoclonal antibodies (mAbs) from humanized mice and found that two, designated PD33 and PD41, broadly neutralized a panel of PDCoV variants. Cryoelectron microscopy (cryo-EM) structures of PD33 and PD41 in complex with the S receptor-binding domain (RBD) and ectodomain trimer revealed the epitopes recognized by these mAbs, rationalizing their broad inhibitory activity. We show that both mAbs competitively interfere with host aminopeptidase N binding to neutralize PDCoV and used deep-mutational scanning epitope mapping to associate RBD antigenic sites with mAb-mediated neutralization potency. Our results indicate a PD33-PD41 mAb cocktail may heighten the barrier to escape. PD33 and PD41 are candidates for clinical advancement against future PDCoV outbreaks.

ECI2
Also flagged:MitochondriamitochondrialgliomaCPT2CD70CD200
Journal Article 2024-11-01 ✓ 5 Snippets Chen P, Wang H, Zhang Y, Qu S, Zhang Y, Yang Y, Zhang C, He K, Dang H, Yang Y, Li S, Yu Y.
In-Text Gene Mentions

…showed that CPT2,ECI2, and SUCLG2 were…

…prognosis of glioma (ECI2, MCCC2, OXCT1, SUCLG2,…

…ResultsECI2, MCCC2, OXCT1, SUCLG2,…

…); among which,ECI2, MCCC2, OXCT1, SUCLG2,…

…were identified, includingECI2, MCCC2, OXCT1, SUCLG2,…

Show Full Abstract

<h4>Background</h4>Numerous diseases are associated with the interplay of mitochondrial and macrophage polarization. However, the correlation of mitochondria-related genes (MRGs) and macrophage polarization-related genes (MPRGs) with the prognosis of glioma remains unclear. This study aimed to examine this relationship based on bioinformatic analysis.<h4>Methods</h4>Glioma-related datasets (TCGA-GBMLGG, mRNA-seq-325, mRNA-seq-693, GSE16011, GSE4290, and GSE138794) were included in this study. The intersection genes were obtained by overlapping differentially expressed genes (DEGs) from differential expression analysis in GSE16011, key module genes from WGCNA, and MRGs. Subsequently, the intersection genes were further screened to obtain prognostic genes. Following this, a risk model was developed and verified. After that, independent prognostic factors were identified, followed by the construction of a nomogram and subsequent evaluation of its predictive ability. Furthermore, immune microenvironment analysis and expression validation were implemented. The GSE138794 dataset was utilized to evaluate the expression of prognostic genes at a cellular level, followed by conducting an analysis on cell-to-cell communication. Finally, the results were validated in different datasets and tissue samples from patients.<h4>Results</h4>ECI2, MCCC2, OXCT1, SUCLG2, and CPT2 were identified as prognostic genes for glioma. The risk model constructed based on these genes in TCGA-GBMLGG demonstrated certain accuracy in predicting the occurrence of glioma. Additionally, the nomogram constructed based on risk score and grade exhibited strong performance in predicting patient survival. Significant differences were observed in the proportion of 27 immune cell types (e.g., activated B cells and macrophages) and the expression of 32 immune checkpoints (e.g., CD70, CD200, and CD48) between the two risk groups. Single-cell RNA sequencing showed that CPT2, ECI2, and SUCLG2 were highly expressed in oligodendrocytes, neural progenitor cells, and BMDMs, respectively. The results of cell-cell communication analysis revealed that both oligodendrocytes and BMDMs exhibited a substantial number of interactions with high strength.<h4>Conclusion</h4>This study revealed five genes associated with the prognosis of glioma (ECI2, MCCC2, OXCT1, SUCLG2, and CPT2), providing novel insights into individualized treatment and prognosis.

DCC
Also flagged:neurogenesisaxonsdendritessynapsestranscription factorsNeurogenins
Journal Article 2024-11-01 ✓ 1 Snippet de Martin X, Oliva B, Santpere G.
In-Text Gene Mentions

…, including Slit/Robo, Netrin/DCC, Netrin/Unc5, Semaphorin/Plex…

Show Full Abstract

Proneural factors of the basic helix-loop-helix family coordinate neurogenesis and neurodifferentiation. Among them, NEUROG2 and NEUROD2 subsequently act to specify neurons of the glutamatergic lineage. Disruption of these factors, their target genes and binding DNA motifs has been linked to various neuropsychiatric disorders. Proneural factors bind to specific DNA motifs called E-boxes (hexanucleotides of the form CANNTG, composed of two CAN half sites on opposed strands). While corticogenesis heavily relies on E-box activity, the collaboration of proneural factors on different E-box types and their chromatin remodeling mechanisms remain largely unknown. Here, we conducted a comprehensive analysis using chromatin immunoprecipitation followed by sequencing (ChIP-seq) data for NEUROG2 and NEUROD2, along with time-matched single-cell RNA-seq, ATAC-seq and DNA methylation data from the developing mouse cortex. Our findings show that these factors are highly enriched in transiently active genomic regions during intermediate stages of neuronal differentiation. Although they primarily bind CAG-containing E-boxes, their binding in dynamic regions is notably enriched in CAT-CAT E-boxes (i.e. CATATG, denoted as 5'3' half sites for dimers), which undergo significant DNA demethylation and exhibit the highest levels of evolutionary constraint. Aided by HT-SELEX data reanalysis, structural modeling and DNA footprinting, we propose that these proneural factors exert maximal chromatin remodeling influence during intermediate stages of neurogenesis by binding as homodimers to CAT-CAT motifs. This study provides an in-depth integrative analysis of the dynamic regulation of E-boxes during neuronal development, enhancing our understanding of the mechanisms underlying the binding specificity of critical proneural factors.

Also flagged:bacterial infectionsmultidrugwaterinfectionssalmonellosisbacterial diseases
Journal Article 2024-11-01 No Snippets Begum R, Asha NA, Dipu DCC, Roy M, Rahman A, Chowdhury MSR, Hossain H, Islam MR, Uddin MB, Rahman MM, Hossain MM.
Show Full Abstract

<h4>Background</h4>Salmonella spp., especially those are resistant to extended-spectrum β-lactamase (ESBL), are considered as major concern to global health due to their emergence and dissemination.<h4>Aim</h4>The aim of this study was to investigate the virulence and antimicrobial resistance (AMR) profile of Salmonella spp. from migratory and captive wild birds.<h4>Method</h4>A total 262 faecal samples were collected, and the identification of Salmonella spp. was carried out using a standard culture and PCR as well as molecular detection of virulence and AMR genes.<h4>Results</h4>The overall prevalence of Salmonella was determined to be 30.92% (95% CI = 25.63-36.75). Migratory birds exhibited highest prevalence (38.10%), whereas wild birds in captivity showed a lower prevalence (23.40%). The agfA gene was detected at a higher rate at 24.69%. Salmonella spp. exhibited 100% resistance to tetracycline, followed by 58% ampicillin and 46% streptomycin. In addition, there was a resistance rate to ceftriaxone of 17% and to colistin sulphate of 25%. Interestingly, levofloxacin alone displayed 100% sensitivity across all isolates, while ciprofloxacin and azithromycin showed 73% and 64% sensitivity, respectively. The MAR index was 0.25 and 0.42, and 74.07% of all isolates showed multidrug resistance (MDR). It was shown that migratory and captive wild birds contained ESBL genes blaTEM (94.34% and 49.06%) and blaSHV (13.33% and 10%), respectively. Genes responsible for sulphonamide (sul1) resistance were detected in 13.33% and 79% of wild and migratory birds, respectively.<h4>Conclusion</h4>Salmonella has been found in captive wild and migratory birds and could act as reservoirs for the transmission of MDR and ESBL bacteria.

Also flagged:Homoharringtonineacute myeloid leukemiaAMLhematological malignancyalkaloidprotein synthesis
Journal Article 2024-11-01 No Snippets Shen S, Zhuang H.
Show Full Abstract

Acute myeloid leukemia (AML) is a hematological malignancy characterized by the accumulation of immature myeloid precursor cells. Over half of AML patients fail to achieve long-term disease-free survival under existing therapy, and the overall prognosis is poor, necessitating the urgent development of novel therapeutic approaches. The plant alkaloid homoharringtonine (HHT), which has anticancer properties, was first identified more than 40 years ago. It works in a novel method of action that prevents the early elongation phase of protein synthesis. HHT has been widely utilized in the treatment of AML, with strong therapeutic effects, few toxic side effects, and the ability to enhance AML patients' prognoses. In AML, HHT can induce cell apoptosis through multiple pathways, exerting synergistic antitumor effects, according to clinical and pharmacological research. About its modes of action, some findings have been made recently. This paper reviews the development of research on the mechanisms of HHT in treating AML to offer insights for further research and clinical therapy.

HFE
Also flagged:IpragliflozinDiabetesMetabolic Dysfunction-associatedMyosteatosispathogenesissteatotic liver disease
Journal Article 2024-11-01 ✓ 1 Snippet Ishimaru Y, Kessoku T, Nonaka M, Kitajima Y, Hyogo H, Nakajima T, Imajo K, Kubotsu Y, Isoda H, Kawanaka M, Yoneda M, Anzai K, Nakajima A, Furukawa K, Kawaguchi A, Takahashi H.
In-Text Gene Mentions

…, drug-induced hepatotoxicity,hemochromatosis, Wilson's disease, or…

Show Full Abstract

Objective Myosteatosis affects the pathogenesis of metabolic dysfunction-associated steatotic liver disease (MASLD) and may be a potential therapeutic target. This study aimed to examine the effects of ipragliflozin (IPR) on myosteatosis in patients with type 2 diabetes mellitus (T2D) and MASLD. Methods Patients were treated with IPR group or a control (CTR) group for 72 weeks in a randomized trial. Changes in myosteatosis of the lumbar skeletal muscles were evaluated using computed tomography. The response of myosteatosis to treatment and the baseline characteristics of the patients were analyzed. Patients 44 participants (IPR group, 23; CTR group, 21) with MASLD complicated by T2D. Results Myosteatosis increased in the CTR group (n=21) but remained unchanged in the IPR group (n=23). The changes were apparent at 24 weeks (p=0.004), but were not significant after 24 weeks. A hierarchical cluster analysis was performed to identify clusters with and without improvement in myosteatosis. The clusters with decreasing intramuscular adipose tissue content (IMAC) at 48 and 72 weeks were not treated, but they had lower visceral fat area and severe liver steatosis at baseline. Improvements in glycemic control and resistance to decreasing abdominal skeletal muscle area from baseline to 24 weeks affected the decrease in IMAC at 48 and 72 weeks. Conclusion Ipragliflozin had a limited effect on skeletal muscle adiposity in patients with T2D and MASLD. Regardless of the treatment, a specific phenotype of adiposity and hepatic steatosis before treatment is associated with the long-term outcomes of myosteatosis. Maintaining skeletal muscle mass and better glycemic control during treatment are essential for the future improvement of myosteatosis.

Also flagged:Alzheimer's diseaseADextracellularamyloid‐beta 42synapsetau
Journal Article 2024-11-01 No Snippets Madhu LN, Kodali M, Upadhya R, Rao S, Somayaji Y, Attaluri S, Shuai B, Kirmani M, Gupta S, Maness N, Rao X, Cai JJ, Shetty AK.
Show Full Abstract

As current treatments for Alzheimer's disease (AD) lack disease-modifying interventions, novel therapies capable of restraining AD progression and maintaining better brain function have great significance. Anti-inflammatory extracellular vesicles (EVs) derived from human induced pluripotent stem cell (hiPSC)-derived neural stem cells (NSCs) hold promise as a disease-modifying biologic for AD. This study directly addressed this issue by examining the effects of intranasal (IN) administrations of hiPSC-NSC-EVs in 3-month-old 5xFAD mice. IN administered hiPSC-NSC-EVs incorporated into microglia, including plaque-associated microglia, and encountered astrocyte soma and processes in the brain. Single-cell RNA sequencing revealed transcriptomic changes indicative of diminished activation of microglia and astrocytes. Multiple genes linked to disease-associated microglia, NOD-, LRR-, and pyrin domain-containing protein 3 (NLRP3)-inflammasome and interferon-1 (IFN-1) signalling displayed reduced expression in microglia. Adding hiPSC-NSC-EVs to cultured human microglia challenged with amyloid-beta oligomers resulted in similar effects. Astrocytes also displayed reduced expression of genes linked to IFN-1 and interleukin-6 signalling. Furthermore, the modulatory effects of hiPSC-NSC-EVs on microglia in the hippocampus persisted 2 months post-EV treatment without impacting their phagocytosis function. Such effects were evidenced by reductions in microglial clusters and inflammasome complexes, concentrations of mediators, and end products of NLRP3 inflammasome activation, the expression of genes and/or proteins involved in the activation of p38/mitogen-activated protein kinase and IFN-1 signalling, and unaltered phagocytosis function. The extent of astrocyte hypertrophy, amyloid-beta plaques, and p-tau were also reduced in the hippocampus. Such modulatory effects of hiPSC-NSC-EVs also led to better cognitive and mood function. Thus, early hiPSC-NSC-EV intervention in AD can maintain better brain function by reducing adverse neuroinflammatory signalling cascades, amyloid-beta plaque load, and p-tau. These results reflect the first demonstration of the efficacy of hiPSC-NSC-EVs to restrain neuroinflammatory signalling cascades in an AD model by inducing transcriptomic changes in activated microglia and reactive astrocytes.

Also flagged:telomerechromosomeschromosomenucleotidestrinucleotidepentanucleotide
Journal Article 2024-11-01 No Snippets Halman A, Lonsdale A, Oshlack A.
Show Full Abstract

Short tandem repeats (STRs) and variable-number tandem repeats (VNTRs) are repetitive genomic sequences seen widely throughout the genome. These repeat expansions are currently known to cause ∼60 diseases, with expansions in new loci linked to rare diseases continuing to be discovered. Genome sequencing is an important tool for detecting disease-causing variants and several computational tools have been developed to analyze tandem repeats from genomic data, enabling the genotyping and the identification of expanded alleles. However, guidelines for conducting the analysis of these repeats and, more importantly, for assessing the findings are lacking. Understanding the tools and their technical limitations is important for accurately interpreting the results. This article provides detailed, step-by-step instructions for three key use cases in STR analysis from short-read genome sequencing data, which are also applicable to smaller VNTRs. First, it demonstrates an approach for genotyping known pathogenic loci and the identification of clinically significant expansions. Second, we offer guidance on defining tandem repeat loci and conducting genome-wide genotyping studies, which is also applicable to diploid organisms other than humans. Third, instructions are provided on how to find novel expansions at loci not previously known to be associated with disease, aiding in the discovery of new pathogenic loci. Moreover, we introduce the use of newly-developed helper tools that enable a complete and streamlined tandem repeat analysis protocol by addressing the gaps in current methods. All three protocols are compatible with human hg19, hg38, and the latest telomere-to-telomere (hs1) reference genomes. Additionally, this protocol provides an overview and discussion on how to interpret genotyping results. © 2024 The Author(s). Current Protocols published by Wiley Periodicals LLC. Basic Protocol 1: Genotyping known pathogenic tandem repeat loci Alternate Protocol: Genotyping known pathogenic tandem repeat loci with STRipy Support Protocol 1: Installation of tools and ExpansionHunter catalog modification Basic Protocol 2: Performing genome-wide genotyping of tandem repeats Basic Protocol 3: Discovering de novo tandem repeat expansions Support Protocol 2: Compiling ExpansionHunter Denovo from source code and generating STR profiles.

Also flagged:CannabidiolepilepsyclobazamEpilepsiesdrug‐resistant epilepsyDravet syndrome
Journal Article 2024-11-01 No Snippets Calonge Q, Besnard A, Bailly L, Damiano M, Pichit P, Dupont S, Gourfinkel-An I, Navarro V.
Show Full Abstract

<h4>Background and purpose</h4>Around 30% of patients with epilepsy show drug-resistant epilepsy (DRE). While cannabidiol has demonstrated efficacy as an adjunctive treatment in Dravet syndrome (DS), Lennox-Gastaut Syndrome (LGS), and epilepsy related to tuberous sclerosis complex (TSC), its more global effectiveness in adult patients with DRE apart from these three specific contexts needs to be clarified.<h4>Methods</h4>We conducted a retrospective study at the epilepsy unit of Pitié Salpêtrière Hospital. Patients initiating pharmaceutical cannabidiol treatment and followed for at least 1 year were included. Patients were categorized into "authorized" (LGS, DS, or TSC) and "off-label" groups. Cannabidiol effectiveness and tolerance were compared between groups, and characteristics of responders (patients with >50% reduction in seizure frequency) in the off-label group were examined.<h4>Results</h4>Ninety-one patients, followed by a median duration of 24 months, were included. A total of 35.2% of the patients were in the authorized group. No significant differences were observed in responder rates between groups (31.3% vs. 35.6%, p = 0.85) and retention rates at 1 year (75.0% vs. 74.6%, p = 0.97). Sleepiness was more commonly reported in the authorized group (50.0% vs. 22.0%, p = 0.01), with no other significant differences. Among off-label patients (n = 59), clobazam co-prescription was more prevalent in responders (71.4% vs. 28.9%, p = 0.002).<h4>Conclusion</h4>Our findings suggest that cannabidiol may benefit all adult patients with DRE, particularly those already receiving clobazam. Randomized controlled trials are warranted in off-label patients to validate these observational findings.

Also flagged:Myocardial infarctionMIdeathheart failureExtracellular vesiclesmembrane
Journal Article 2024-11-01 No Snippets Viola M, Bebelman MP, Maas RGC, de Voogt WS, Verweij FJ, Seinen CS, de Jager SCA, Vader P, Pegtel DM, Petrus Gerardus Sluijter J.
Show Full Abstract

Extracellular vesicles (EVs) have emerged as important mediators of intercellular communication in the heart under homeostatic and pathological conditions, such as myocardial infarction (MI). However, the basic mechanisms driving cardiomyocyte-derived EV (CM-EV) production following stress are poorly understood. In this study, we generated human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) that express NanoLuc-tetraspanin reporters. These modified hiPSC-CMs allow for quantification of tetraspanin-positive CM-EV secretion from small numbers of cells without the need for time-consuming EV isolation techniques. We subjected these cells to a panel of small molecules to study their effect on CM-EV biogenesis and secretion under basal and stress-associated conditions. We observed that EV biogenesis is context-dependent in hiPSC-CMs. Nutrient starvation decreases CM-EV secretion while hypoxia increases the production of CM-EVs in a nSmase2-dependent manner. Moreover, the inflammatory cytokine TNF-α increased CM-EV secretion through a process involving NLRP3 inflammasome activation and mTOR signalling. Here, we detailed for the first time the regulatory mechanisms of EV biogenesis in hiPSC-CMs upon MI-associated stressors.

SERPINC1
Also flagged:Polycystic Ovary SyndromePCOSproteaseapolipoprotein-AIAPOA1alpha-2-macroglobulin
Journal Article 2024-11-01 ✓ 2 Snippets Przewocki J, Łukaszuk A, Jakiel G, Wocławek-Potocka I, Kłosińska K, Olszewska J, Łukaszuk K.
In-Text Gene Mentions

…C1 inhibitor andantithrombin-IIIwere also found…

…and H1, alpha-2-macroglobulin,antithrombin-III, pigment epithelium-derived f…

Show Full Abstract

This study explores the proteomic composition of follicular fluid (FF) from women undergoing oocyte retrieval for in vitro fertilisation (IVF), with a focus on the effects of polycystic ovary syndrome (PCOS). FF samples were collected from 74 patients, including 34 with PCOS and 40 oocyte donors. Proteomic profiling using machine learning identified significant differences in protein abundance between the PCOS and control groups. Of the 484 quantified proteins, 20 showed significantly altered levels in the PCOS group. Functional annotation and pathway enrichment analysis pointed to the involvement of protease inhibitors and immune-related proteins in the pathophysiology of PCOS, suggesting that inflammation and immune dysregulation may play a key role. Additionally, HDL assembly was identified as a significant pathway, with apolipoprotein-AI (APOA1) and alpha-2-macroglobulin (A2M) as the major proteins involved. Notably, myosin light polypeptide 6 was the most downregulated protein, showing the highest absolute fold change, and may serve as a novel independent biomarker for PCOS.

UNC13C
Also flagged:AIDSHIVinfectionmethylationRHOARAD51
Journal Article 2024-11-01 ✓ 3 Snippets Long X, Liu G, Liu X, Zhang C, Shi L, Zhu Z.
In-Text Gene Mentions

…, GYPE ,UNC13C, COL1A1 ,…

…e-related genes (hsa-miR-1303:UNC13C, hsa-miR-4662a-5p: ADGRV1…

…miR-1303 positively regulatingUNC13C.…

Show Full Abstract

For research on HIV/AIDS, it is important to elucidate the complex viral-host interaction, host dependency factors (HDFs), and restriction factors. However, the regulatory network of HIV-resistance-related factors remains not well understood. Therefore, we integrated four publicly available HIV-related transcriptome datasets, along with three datasets on HIV-infection-related DNA methylation, miRNA, and ChIP-seq, to predict the factors influencing HIV resistance and infection. Our approach involved differential analysis, functional annotation, and protein-protein interaction network analysis. Through comprehensive analyses, we identified 25 potential HIV-resistance-related genes (including shared <i>EGF</i>) and 24 HIV-infection-related hub genes (including shared <i>JUN</i>). Additionally, we pinpointed five key differentially methylated genes, five crucial differentially expressed microRNAs, and five significant pathways associated with HIV resistance. We mapped the potential regulatory pathways involving these HIV-resistance-related factors. Among the predicted factors, RHOA, RAD51, GATA1, IRF4, and CXCL8 have been validated as HDFs or restriction factors. The identified factors, such as JUN, EGF, and PLEK, are potential HDFs or restriction factors. This study uncovers the gene signatures and regulatory networks associated with HIV-1 resistance, suggesting potential targets for the development of new therapies against HIV/AIDS.

Also flagged:oligonucleotidesneurological disordersgene expressionepileptic encephalopathiesneurodevelopmental delaydegradation
Journal Article 2024-11-01 No Snippets Quilón PG, Volpedo G, Cappato S, Ferrera L, Zara F, Bocciardi R, Riva A, Striano P.
Show Full Abstract

Developmental and epileptic encephalopathies (DEEs) comprise a complex spectrum of neurological disorders characterized by neurodevelopmental delay and early-onset seizures primarily caused by diverse genetic mutations. Traditional treatments have largely been symptomatic, focusing on seizure control without addressing the underlying genetic causes. The advent of gene therapy, particularly through antisense oligonucleotides (ASOs), offers a promising avenue toward targeted therapeutic interventions. ASOs by virtue of their ability to modulate gene expression at the mRNA level represent a sophisticated approach to counteract the effects of pathogenic mutations. This review delves into the recent advancements in ASO technology, highlighting its application in preclinical and clinical settings for DEEs. We present evidence of the efficacy of ASOs in ameliorating disease phenotypes in vitro and in vivo, alongside promising outcomes from ongoing clinical trials. The therapeutic landscape for DEEs is on the cusp of significant transformation, underscored by the potential of ASOs to offer precise, personalized, treatments that extend beyond symptomatic relief to potentially rectify the genetic underpinnings of these disorders.

HFE
Also flagged:Non-alcoholic fatty liver diseaseNAFLDmetabolic disordernon-alcoholic hepatic steatosisnon-alcoholic steatohepatitisNASH
Journal Article 2024-11-01 ✓ 1 Snippet Qi F, Li T, Deng Q, Fan A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) is a metabolic disorder that includes non-alcoholic hepatic steatosis without or with moderate inflammation and non-alcoholic steatohepatitis (NASH), characterized by necroinflammation and a more rapid progression of fibrosis. It is the primary pathological basis for hepatocellular carcinoma. With its prevalence escalating annually, NAFLD has emerged as a global health epidemic, presenting a significant hazard to public health worldwide. Existing studies have shown that physical activity and exercise training have a positive effect on NAFLD. However, the extent to which exercise improves NAFLD depends on the type, intensity, and duration. Therefore, the type of exercise that has the best effect on improving NAFLD remains to be explored. To date, the most valuable discussions involve aerobic and anaerobic exercise. Exercise intervenes in the pathological process of NAFLD by regulating physiological changes in cells through multiple signaling pathways. The review aims to summarize the signaling pathways affected by two different exercise types associated with the onset and progression of NAFLD. It provides a new basis for improving and managing NAFLD in clinical practice.

SERPINC1
Also flagged:antiphospholipid syndromeprotein Sheparinprotein S/Cdeficiencypulmonary embolism
Journal Article 2024-11-01 ✓ 1 Snippet Nishihara M, Nagae H, Otake S, Asatani S, Nagasawa Y, Akiya K, Inomata H, Kitamura N, Nakamura H.
In-Text Gene Mentions

…1 , althoughantithrombin-IIIwas normal, coagulation…

Show Full Abstract

<h4>Rationale</h4>Antiphospholipid antibody syndrome and protein S/C deficiency are diseases that are sometimes complicated by thrombus, and heparin-induced thrombosis (HIT) has also been reported.<h4>Patient concerns</h4>A male patient in his 60s with elevated D-dimer and superior mesenteric thrombus and portal vein thrombus underwent partial small intestine resection and thrombectomy. After administration of heparin, aortic thrombosis and pulmonary embolism occurred along with rapid thrombocytopenia.<h4>Diagnosis</h4>The patient was diagnosed with HIT combined with protein S deficiency and antiphospholipid antibody syndrome.<h4>Interventions and outcomes</h4>Heparin administration was discontinued, and plasma exchange with fresh frozen plasma replacement and argatroban administration were started. These treatments reduced D-dimer, restored platelet counts, and improved thrombosis.<h4>Lessons</h4>Although HIT alone can cause severe arteriovenous thrombosis, our case suggests that it is important to search for the underlying procoagulant factors.

TNFSF4
Also flagged:oesophageal squamous cell carcinomaESCCPRSoesophageal cancerlymph node metastasistumour
Journal Article 2024-11-01 ✓ 1 Snippet Tang P, Li B, Zhou Z, Wang H, Ma M, Gong L, Qiao Y, Ren P, Zhang H.
In-Text Gene Mentions

…LAIR1, BTLA, TNFRSF14,TNFSF4, CTLA4, CD28, LAG3,…

Show Full Abstract

The mortality rate of oesophageal squamous cell carcinoma (ESCC) remains high, and conventional TNM systems cannot accurately predict its prognosis, thus necessitating a predictive model. In this study, a 17-gene prognosis-related gene signature (PRS) predictive model was constructed using the random survival forest algorithm as the optimal algorithm among 99 machine-learning algorithm combinations based on data from 260 patients obtained from TCGA and GEO. The PRS model consistently outperformed other clinicopathological features and previously published signatures with superior prognostic accuracy, as evidenced by the receiver operating characteristic curve, C-index and decision curve analysis in both training and validation cohorts. In the Cox regression analysis, PRS score was an independent adverse prognostic factor. The 17 genes of PRS were predominantly expressed in malignant cells by single-cell RNA-seq analysis via the TISCH2 database. They were involved in immunological and metabolic pathways according to GSEA and GSVA. The high-risk group exhibited increased immune cell infiltration based on seven immunological algorithms, accompanied by a complex immune function status and elevated immune factor expression. Overall, the PRS model can serve as an excellent tool for overall survival prediction in ESCC and may facilitate individualized treatment strategies and predction of immunotherapy for patients with ESCC.

SERPINC1
Also flagged:dementialocalizationvascular dementiaall-cause dementiaCSNK2BNFATC3
Journal Article 2024-11-01 ✓ 2 Snippets Talaei M, Waters S, Portas L, Jacobs BM, Dodd JW, Marshall CR, Minelli C, Shaheen SO.
In-Text Gene Mentions

…time and inSERPINC1with FVC for…

…being lost (SERPINC1for FVC and…

Show Full Abstract

Lower lung function is associated with lower cognitive function and an increased risk of dementia. This has not been adequately explained and may partly reflect shared developmental pathways. In UK Biobank participants of European ancestry, we tested the association between lung function measures (forced vital capacity and forced expiratory volume in 1 s to forced vital capacity ratio; <i>n</i> = 306 476) and cognitive traits including nine cognitive function test scores (<i>n</i> = 32 321-428 609), all-cause dementia, Alzheimer's disease and vascular dementia (6805, 2859 and 1544 cases, respectively, and ∼421 241 controls). In the same population, we derived summary statistics for associations between common genetic variants in 55 lung development genes and lung function measures and cognitive traits using adjusted linear/logistic regression models. Using a hypothesis-driven Bayesian co-localization analysis, we finally investigated the presence of shared genetic signals between lung function measures and cognitive traits at each of these 55 genes. Higher lung function measures were generally associated with higher scores of cognitive function tests as well as lower risk of dementia. The strongest association was between forced vital capacity and vascular dementia (adjusted hazard ratio 0.74 per standard deviation increase, 95% confidence interval 0.67-0.83). Of the 55 genes of interest, we found shared variants in four genes, namely: <i>CSNK2B</i> rs9267531 (forced vital capacity and forced expiratory volume in 1 s to forced vital capacity ratio with fluid intelligence and pairs matching), <i>NFATC3</i> rs548092276 & rs11275011 (forced expiratory volume in 1 s to forced vital capacity ratio with fluid intelligence), <i>PTCH1</i> rs2297086 & rs539078574 (forced expiratory volume in 1 s to forced vital capacity ratio with reaction time) and <i>KAT8</i> rs138259061 (forced vital capacity with pairs matching). However, the direction of effects was not in keeping with our hypothesis, i.e. variants associated with lower lung function were associated with better cognitive function or vice versa. We also found distinct variants associated with lung function and cognitive function in <i>KAT8</i> (forced vital capacity and Alzheimer's disease) and <i>PTCH1</i> (forced vital capacity and forced expiratory volume in 1 s to forced vital capacity ratio with fluid intelligence and reaction time). The links between <i>CSNK2B</i> and <i>NFATC3</i> and cognitive traits have not been previously reported by genome-wide association studies. Despite shared genes and variants, our findings do not support the hypothesis that shared developmental signalling pathways explain the association of lower adult lung function with poorer cognitive function.

HFE
Also flagged:HjvironHHbone resorptionbone formationOsteopenia
Journal Article 2024-11-01 ✓ 5 Snippets Dogan DY, Hornung I, Pettinato M, Pagani A, Baschant U, Seebohm G, Hofbauer LC, Silvestri L, Rauner M, Rauner M, Steinbicker AU.
In-Text Gene Mentions

…phenotyping of murinehemochromatosismodels with deficiencies…

…in those withHFE‐dependent hereditary hemochro…

…in patients withhemochromatosis.…

…, 9 InHFE‐dependent hereditary hemochro…

…in patients withHFE‐HH.…

Show Full Abstract

Osteopenia is frequently observed in patients with iron overload, especially in those with HFE-dependent hereditary hemochromatosis (HH). Interestingly, not all mouse models of HH show bone loss, suggesting that iron overload alone may not suffice to induce bone loss. In this study, the bone phenotypes of Hjv<sup>-/-</sup> and hepatocyte-specific Alk2- and Alk3-deficient mice as additional mouse models of HH were investigated to further clarify, how high iron levels lead to bone loss and which signaling mechanisms are operational. Neither male nor female 12-week-old Hjv<sup>-/-</sup> mice had an altered trabecular or cortical bone mass or bone turnover, despite severe iron overload. Male 12-month-old Hjv<sup>-/-</sup> mice even presented with a higher femoral trabecular bone volume compared to wildtype mice. Similarly, female mice with hepatocyte-specific Alk2 or Alk3 deficiency did not show an altered bone phenotype at 3, 6, and 12 months of age. Male hepatocyte-specific Alk3-deficient mice also had a normal trabecular bone mass at all ages analyzed, despite showing increased bone resorption and decreased bone formation parameters. Interestingly, hepatocyte-specific Alk2-deficient mice showed reduced femoral trabecular bone at 6 months of age due to suppressed bone formation. Cortical thickness at the femur was reduced in both, 6-month-old male hepatocyte-specific Alk2- and Alk3-deficient mice. Raising hepatocyte-specific Alk2-deficient male mice on an iron-deficient diet rescued the bone phenotype. Taken together, despite iron overload, trabecular bone microarchitecture was not altered in mice deficient of Hjv or Alk3. Only male hepatocyte-specific Alk2-deficient mice showed site-specific lower trabecular and cortical bone mass at the femur, which was dependent on iron. Thus, bone loss does not correlate with the extent of iron overload in these mouse models, but may relate to the amount of iron-loaded macrophages, as precursors of osteoclasts, in the bone marrow.

ZNFX1
Also flagged:LINC01133CEAcarbohydrategastric cancerchronic superficial gastritischronic atrophic gastritis
Journal Article 2024-11-01 ✓ 1 Snippet Sui X, Zhang Q, Hao M, Chen Y.
In-Text Gene Mentions

…lncRNA HULC andZNFX1-AS1 could distinguish GC…

Show Full Abstract

<h4>Background</h4>Carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) are currently 2 major diagnostic biomarkers for gastric cancer (GC). The aims of study were to detect the expression of long intergenic nonprotein coding RNA 1133 (LINC01133), and to evaluate its diagnostic and prognostic value in GC. Furthermore, the clinical performance of the joint detection of LINC01133, CEA and CA19-9 was also evaluate in GC.<h4>Methods</h4>The data were collected from 156 GC, 96 chronic superficial gastritis, 77 chronic atrophic gastritis patients and 89 healthy controls. LINC01133 expression was determined by quantitative real-time PCR. Receiver operating characteristics analysis was used to evaluate the diagnostic value of LINC01133, CEA, CA19-9 individually and jointly. Kaplan-Meier method and log-rank test were used to conduct survival comparison analysis. Cox regression was used to screen the independent prognostic factors for GC.<h4>Results</h4>Serum LINC01133 expression was decreased in GC patients compared with chronic superficial gastritis, chronic atrophic gastritis and healthy controls, and had considerable diagnostic potential, and notably, the joint detection of LINC01133, CEA, and CA19-9 showed the highest diagnostic accuracy in distinguishing GC patients from healthy or gastritis patients. LINC01133 expression was associated with GC patients' CEA and CA19-9 levels, tumor size, differentiation, lymph node metastasis and tumor node metastasis stage. Low LINC01133 was associated with poor GC survival, and was an independent prognostic factor for GC.<h4>Conclusion</h4>Decreased serum LINC01133 had considerable diagnostic potential, and the joint detection of LINC01133, CEA, and CA19-9 might be a more efficient diagnostic strategy for GC patients. Reduced LINC01133 served as a prognostic biomarker to predict poor GC survival.

OLFM4
Also flagged:translationalmembraneoxygendigestiontype II collagenaseOrganoid Growth
Journal Article 2024-11-01 ✓ 3 Snippets Ye S, Marsee A, van Tienderen GS, Rezaeimoghaddam M, Sheikh H, Samsom RA, de Koning EJP, Fuchs S, Verstegen MMA, van der Laan LJW, van de Vosse F, Malda J, Ito K, Spee B, Schneeberger K.
In-Text Gene Mentions

…olfactomedin 4 (OLFM4), and the…

…on D14, andOLFM4was higher expressed…

…LGR5 , andOLFM4and proliferative marker…

Show Full Abstract

Conventional static culture of organoids necessitates weekly manual passaging and results in nonhomogeneous exposure of organoids to nutrients, oxygen, and toxic metabolites. Here, we developed a miniaturized spinning bioreactor, RPMotion, specifically optimized for accelerated and cost-effective culture of epithelial organoids under homogeneous conditions. We established tissue-specific RPMotion settings and standard operating protocols for the expansion of human epithelial organoids derived from the liver, intestine, and pancreas. All organoid types proliferated faster in the bioreactor (5.2-fold, 3-fold, and 4-fold, respectively) compared to static culture while keeping their organ-specific phenotypes. We confirmed that the bioreactor is suitable for organoid establishment directly from biopsies and for long-term expansion of liver organoids. Furthermore, we showed that after accelerated expansion, liver organoids can be differentiated into hepatocyte-like cells in the RPMotion bioreactor. In conclusion, this miniaturized bioreactor enables work-, time-, and cost-efficient organoid culture, holding great promise for organoid-based fundamental and translational research and development.

HFE
Also flagged:melanosispigmentationhepatic steatosishypertensiongastroesophageal reflux diseaseGERD
Journal Article 2024-11-01 ✓ 1 Snippet Kazacheuskaya L, Arora K.
In-Text Gene Mentions

…anthracosis), hemosiderosis orhemochromatosis, and lipofuscin pigment…

Show Full Abstract

<h4>Background</h4>Esophageal melanosis (EM) is a rare condition characterized by melanin pigmentation in the esophageal mucosa. It is not well understood and has been documented in less than 100 cases worldwide.<h4>Case summary</h4>We report two cases of African American patients who complained of significant weight loss (over 20 pounds in approximately six months) and abdominal pain during their first visit. The first case involves a 54-year female with a history of hepatic steatosis and polysubstance abuse, who also experiences nausea and vomiting. The second case is a 59-year-old male with hypertension and gastroesophageal reflux disease (GERD), who was diagnosed with esophageal squamous cell carcinoma. Both cases show benign melanocytes in the basal layer on the esophagus biopsy and are diagnosed as EM.<h4>Conclusion</h4>It is important to note that EM has been associated with malignancies such as carcinoma and melanoma. Therefore, accurate diagnosis and appropriate management are crucial. Patients with EM, especially those with concurrent risk factors (<i>e.g.</i>, GERD, smoking), should be carefully monitored for any signs of malignancy.

SOX6
Also flagged:methylationDNA methyltransferasesdinucleotidesnuclear transferpolar bodiesDNA methyltransferase
Journal Article 2024-11-01 ✓ 2 Snippets Wang J, Yuan W, Liu F, Liu GB, Geng XX, Li C, Zhang CC, Li N, Li XL.
In-Text Gene Mentions

…mCH near theSOX6gene in the…

…downstream regions ofSOX6in the adult…

Show Full Abstract

DNA methylation at non-CG dinucleotides (mCH, H=A, C, T) widely occurs and plays an important role in specific cell types, including pluripotent, neural, and germ cells. However, the functions and regulatory mechanisms of mCH, particularly in species other than humans and mice, remain inadequately explored. In this study, we analyzed the distribution of mCH across different bovine tissues, identifying significantly elevated mCH levels in bovine embryonic stem cells (bESCs), as well as brain, spleen, and ileum tissues compared to other tissues. Marked differences in mCH patterns between somatic cells and bESCs were observed, reflecting distinct base preferences and the differential expression of DNA methyltransferases. We also identified exon methylation in both CG and non-CG contexts, resembling gene-associated methylation patterns observed in plants. To characterize tissue-specific variations in mCH, we developed a novel method for differential mCH analysis. Results indicated that mCH is not randomly distributed but tends to be enriched in tissue-specific functional regions. Furthermore, regression models demonstrated a positional correlation between CG methylation and mCH. This study enhances our understanding of mCH distribution and function in bovine somatic and stem cells, providing new insights into its potential roles across species and tissues. These findings advance knowledge of epigenetic mechanisms, shedding light on the potential involvement of mCH in development and disease processes.

Also flagged:Alzheimer's diseaseADdementiamemory impairmentscognitive dysfunctionsaging
Journal Article 2024-11-01 No Snippets Dong Y, Song X, Wang X, Wang S, He Z.
Show Full Abstract

Diagnosis and prediction of Alzheimer's disease (AD) are increasingly pressing in the early stage of the disease because the biomarker-targeted therapies may be most effective. Diagnosis of AD largely depends on the clinical symptoms of AD. Currently, cerebrospinal fluid biomarkers and neuroimaging techniques are considered for clinical detection and diagnosis. However, these clinical diagnosis results could provide indications of the middle and/or late stages of AD rather than the early stage, and another limitation is the complexity attached to limited access, cost, and perceived invasiveness. Therefore, the prediction of AD still poses immense challenges, and the development of novel biomarkers is needed for early diagnosis and urgent intervention before the onset of obvious phenotypes of AD. Blood-based biomarkers may enable earlier diagnose and aid detection and prognosis for AD because various substances in the blood are vulnerable to AD pathophysiology. The application of a systematic biological paradigm based on high-throughput techniques has demonstrated accurate alterations of molecular levels during AD onset processes, such as protein levels and metabolite levels, which may facilitate the identification of AD at an early stage. Notably, proteomics and metabolomics have been used to identify candidate biomarkers in blood for AD diagnosis. This review summarizes data on potential blood-based biomarkers identified by proteomics and metabolomics that are closest to clinical implementation and discusses the current challenges and the future work of blood-based candidates to achieve the aim of early screening for AD. We also provide an overview of early diagnosis, drug target discovery and even promising therapeutic approaches for AD.

RABGAP1L
Also flagged:DHCR24Cognitive ImpairmentCerebral Small Vessel Diseasecholesterolmetabolism3β‐hydroxysterol‐Δ24 reductase
Journal Article 2024-11-01 ✓ 1 Snippet Shi Y, Xu M, Wang F, Zhang X, Cheng C, Han Y, Xi G, Mao H, Deng J, Gao Q, Ji Y, Ma X, Li M, Fang X.
In-Text Gene Mentions

…17 of theRABGAP1Lgene (Figure S3…

Show Full Abstract

<h4>Aims</h4>The study attempted to determine the underlying role and regulation mechanism of 3β-hydroxysterol-Δ24 reductase (DHCR24) in the pathophysiology of cerebral small vessel disease-associated cognitive impairment (CSVD-CI). An RNA high-throughput sequencing and independent verification were conducted to identify potential circRNAs becoming the upstream regulator.<h4>Methods</h4>RNA sequencing was performed in whole-blood samples in cohort 1 (10 CSVD-CI and 8 CSVD with cognitively normal [CSVD-CN] patients). The DHCR24 and candidate circRNAs were verified in an independent cohort 2 (45 CSVD-CI participants and 37 CSVD-CN ones). The study also analyzed comprehensive cognitive assessments, plasma molecular index, and brain structure imaging.<h4>Results</h4>The expression of DHCR24 and has_circ_0015335 in whole-blood samples of CSVD-CI patients was significantly reduced compared to CSVD-CN patients in RNA sequencing and independent verification. Furthermore, the levels of DHCR24 and has_circ_0015335 were significantly related to global cognitive impairment in CSVD-CI patients. Meanwhile, DHCR24 could regulate the correlation between has_circ_0015335 expression and alterations in brain cortex in surface area, thickness, and volume in CSVD-CI patients. Additionally, hsa_circ_0015335 interacted with DHCR24 for plasma 24(S)-hydroxycholesterol levels among CSVD-CI patients.<h4>Conclusion</h4>Interaction between DHCR24 and hsa_circ_0015335 cognitively impaired CSVD by affecting brain cholesterol metabolism and brain structural changes.

NEGR1HTT
Also flagged:depressionGRK4TRAIPRNF123RBMS3Major depressive disorder
Journal Article 2024-11-01 ✓ 2 Snippets Liu S, Wei Z, Carr DF, Moraros J.
In-Text Gene Mentions

…including TRAF3 ,NEGR1, DRD2, and HACE1…

…(intergenic), rs3905238 (HTT), rs4653218 (intergenic),…

Show Full Abstract

<h4>Background</h4>This study aims to explore the link between depression and dysmenorrhea by using an integrated and innovative approach that combines genomic, transcriptomic, and protein interaction data/information from various resources.<h4>Methods</h4>A two-sample, bidirectional, and multivariate Mendelian randomization (MR) approach was applied to determine causality between dysmenorrhea and depression. Genome-wide association study (GWAS) data were used to identify genetic variants associated with both dysmenorrhea and depression, followed by colocalization analysis of shared genetic influences. Expression quantitative trait locus (eQTL) data were analyzed from public databases to pinpoint target genes in relevant tissues. Additionally, a protein-protein interaction (PPI) network was constructed using the STRING database to analyze interactions among identified proteins.<h4>Results</h4>MR analysis confirmed a significant causal effect of depression on dysmenorrhea ['odds ratio' (95% confidence interval) = 1.51 (1.19, 1.91), P = 7.26 × 10-4]. Conversely, no evidence was found to support a causal effect of dysmenorrhea on depression (P = .74). Genetic analysis, using GWAS and eQTL data, identified single-nucleotide polymorphisms in several genes, including GRK4, TRAIP, and RNF123, indicating that depression may impact reproductive function through these genetic pathways, with a detailed picture presented by way of analysis in the PPI network. Colocalization analysis highlighted rs34341246(RBMS3) as a potential shared causal variant.<h4>Conclusions</h4>This study suggests that depression significantly affects dysmenorrhea and identifies key genes and proteins involved in this interaction. The findings underline the need for integrated clinical and public health approaches that screen for depression among women presenting with dysmenorrhea and suggest new targeted preventive strategies.

ECI2
Also flagged:Prostate cancerPCaperoxisomesmetabolismandrogen receptorAR
Journal Article 2024-11-01 ✓ 1 Snippet Hussein MAF, Lismont C, Costa CF, Li H, Claessens F, Fransen M.
In-Text Gene Mentions

…delta isomerase 2 (ECI2), AMACR, and trans-2-enoyl-Co…

Show Full Abstract

Prostate cancer (PCa) is associated with disruptions in cellular redox balance. Given the intricate role of peroxisomes in redox metabolism, we conducted comprehensive proteomics analyses to compare peroxisomal and redox protein profiles between benign (RWPE-1) and malignant (22Rv1, LNCaP, and PC3) prostate cell lines. Our analyses revealed significant enrichment of the "peroxisome" pathway among proteins notably upregulated in androgen receptor (AR)-positive cell lines. In addition, catalase (CAT) activity was consistently higher in these malignant cell lines compared to RWPE-1, which contrasts with previous studies reporting lower CAT levels and increased H<sub>2</sub>O<sub>2</sub> levels in PCa tissues compared to adjacent normal tissues. To mimic this clinical scenario, we used RNA interference to knock down CAT expression. Our results show that reduced CAT levels enhanced 22Rv1 and LNCaP cell proliferation. R1881-induced activation of AR, a key driver of PCa, increased expression of the H<sub>2</sub>O<sub>2</sub>-producing peroxisomal β-oxidation enzymes acyl-coenzyme A oxidase 1 and 3, reduced CAT expression and activity, and elevated peroxisomal H<sub>2</sub>O<sub>2</sub> levels. Considering these changes and other antioxidant enzyme profile alterations, we propose that enhanced AR activity in PCa reduces CAT function, leading to increased peroxisomal H<sub>2</sub>O<sub>2</sub> levels that trigger adaptive stress responses to promote cell survival, growth, and proliferation.

TNFSF4
Also flagged:EDNRAtumourendothelin receptor Acancertumoursgene expression
Journal Article 2024-11-01 ✓ 3 Snippets Wang M, Wang L, Li X, Dai M, Sheng B.
In-Text Gene Mentions

…ENTPD1, TMEM173, andTNFSF4in BLCA and…

…CD276, CD200, andTNFSF4, were also notably…

…CD276, CD200, andTNFSF4.…

Show Full Abstract

The potential role of endothelin receptor A (EDNRA) in cancer immunotherapy has been demonstrated; however, the mechanism of its therapeutic value remains to be investigated. This study aimed to reveal the potential link between cancer immunotherapy and EDNRA in human tumours. Clinical characteristics and gene expression information were acquired from the Cancer Genome Atlas database. The correlation between EDNRA expression and immune infiltration was analysed by tumour immune estimation resource (TIMER) and tumour-immune system interaction database (TISIDB). EDNRA expression in different cancer types were performed via qPCR. Immunohistochemistry was used to detect the relationships between EDNRA protein and immune checkpoints. The results have founded that EDNRA was differentially expressed in various tumours, and highly associated with patient's age and tumour stage. It is also of high potential prognostic value in predicting patient survival. It has been verified that the EDNRA, JAK-STAT, and TGF-β signalling pathways are involved in cancers. In general, EDNRA positively correlated with immunomodulatory agents, immune cell infiltration, and immunotherapy markers. Immunohistochemical analysis of breast cancer tissues showed that EDNRA was positively correlated with NRP1 expression. Furthermore, patients with low EDNRA levels showed a superior response to immunotherapy. The functional study found that EDNRA expression is upregulated in MDA-MB-231 and HepG2 cells, and knockdown of EDNRA inhibits proliferation and migration of cells. In conclusion, the immunotherapeutic function of EDNRA was elucidated in this study. EDNRA may be an important target in tumour immunotherapy and provide new insights for tumour immunotherapy.

Also flagged:type 2A hereditary hemochromatosisHHironMetabolic Liver DiseaseFerritintransaminases
Journal Article 2024-11-01 No Snippets Zhang W, Li YM, Xu AJ, Wang XM, Wang Y, Duan WJ, Zhao XY, Xu HX, Jiang JP, Jiang W, Huang J, Ou XJ.
Show Full Abstract

<b>Objective:</b> To analyze the clinical, genetic mutation characteristics, and treatment prognosis of type 2A hereditary hemochromatosis (HH) in China. <b>Methods:</b> Peripheral blood samples and clinical data of patients with primary iron overload were collected through the China Registry of Genetic/Metabolic Liver Disease from June 2015 to November 2023. HH-related genes were detected by Sanger sequencing. Clinical characteristics and gene mutation characteristics of HH patients carrying HJV gene mutations were analyzed. <b>Results:</b> Among the 37 cases with primary iron overload, ten cases (27.0%, 10/37) had detectable HJV gene mutations, which included four homozygous mutations, five compound heterozygous mutations, and one monoheterozygous mutation. p.Q6H and p.C321X (80.0%, 8/10) were the most common mutated sites. The average age of onset was 30.7±14.7 years. The age of diagnosis was 35.7±16.2 years, with male-to-female ratio of 7:3. Ferritin and transferrin saturation were (5 267±905) ng/ml, and 94.3%±1.2%, respectively. Magnetic resonance imaging showed iron overload in the liver, pancreas, and myocardium. Liver biopsy showed diffuse iron deposition within hepatocytes. All ten cases had elevated transaminases; one case (1/10, 10.0%) had liver cirrhosis; four cases (4/10, 40.0%) had heart failure and arrhythmia; five cases (5/10, 50.0%) had diabetes; six cases (6/10, 60.0%) had hypogonadism; six cases (6/10, 60.0%) had skin pigmentation; and six cases (6/10, 60.0%) had fatigue symptoms. All six cases underwent bloodletting therapy, and ferritin levels dropped to about 100 ng/ml. Two cases of oral administration of the iron chelator deferasirox did not meet the ferritin level standard, and one case died from acute heart failure following a confirmed diagnosis during hospitalization. <b>Conclusion:</b> The HJV gene may be one of the main pathogenic genes of HH in China. The p.Q6H and p.C321X mutations were one of the hotspot mutations. The onset age of HJV gene-related HH was between 20 and 30 years old, and their condition was severe. Therefore, early bloodletting treatment can have a favorable outcome.

Also flagged:endoplasmic reticulumUbiquitinationproteasomedegradationcell cycleautophagy
Journal Article 2024-11-01 No Snippets Selvaprakash K, Sideri CK, Henry M, Efeoglu E, Ryan D, Meleady P.
Show Full Abstract

Chinese hamster ovary (CHO) cells remain the most widely used host cell line for biotherapeutics production. Despite their widespread use, understanding endoplasmic reticulum (ER) stress conditions in recombinant protein production remains limited, often creating bottlenecks preventing improved production titers and product quality. Ubiquitination not only targets substrates (e.g., misfolded proteins) for proteasome degradation but also has important regulatory control functions including cell cycle regulation, translation, apoptosis, autophagy, etc. and hence is likely to be central to understanding and controlling the productivity of recombinant biotherapeutics. This study aimed to uncover differentially expressed ubiquitinated proteins following artificial induction of ER-stress in recombinant CHO cells. CHO cells were treated with the stress inducer tunicamycin and the proteasome inhibitor MG132, followed by LC-MS/MS proteomic analysis. We identified >4000 ubiquitinated peptides from CHO-DP12 cells under ER stress conditions and proteasome inhibition. Moreover, data analysis showed altered abundance levels of >900 ubiquitinated proteins under the combination of ER stress and proteasome inhibition compared to untreated controls. Gene Ontology (GO) analysis of these ubiquitinated proteins resulted in a significant enrichment of key pathways involving the proteasome, protein processing in the ER, N-glycan biosynthesis, and ubiquitin-mediated proteolysis. ER stress response proteins such as GRP78, HSP90B1, ATF6, HERPUD1, and PDIA4 were found to be highly ubiquitinated and exhibited a significant increase in abundance following induction of ER-stress conditions. This study broadens our comprehension of the roles played by protein ubiquitination in CHO cell stress responses, potentially revealing targets for tailored cell line engineering aimed at enhancing stress tolerance and production efficiency.

SERPINC1
Also flagged:Antiphospholipid Syndromeautoimmune disorderspreeclampsiamiscarriagestillbirtharthritis
Journal Article 2024-11-01 ✓ 1 Snippet Rezaieyazdi Z, Sahebari M, Shahideh K, Joghatayi M, Khodashahi M.
In-Text Gene Mentions

… thrombophilia panel (PrC-PrS-ATIII, mutant prothrombin, hyperhom…

Show Full Abstract

<h4>Objective</h4>Antiphospholipid syndrome (APS) is among the autoimmune disorders caused by antiphospholipid antibodies, which provoke blood clots (thrombosis) in arteries and veins. It can also cause such complications as severe preeclampsia, miscarriage, premature birth, and stillbirth in pregnant women. We investigated the clinical and serological characteristics of antiphospholipid syndrome patients.<h4>Methods</h4>This retrospective cross-sectional study was performed on those with persistently positive antiphospholipid syndrome. Data were extracted from medical records from the hospital information system(HIS) of rheumatology, neurology, cardiology, gynecology, general, and hematology wards of Ghaem Hospital and private rheumatology clinics of Mashhad, which were surveyed for 10 years (2008-2018).<h4>Results</h4>Of the 284 patients, 85.6% were female. The most common adverse outcome of pregnancy was miscarriage (68.1%). Non-criteria manifestations, including arthralgia and arthritis, were observed in 37.7% and 33.1% of the patients, respectively. Moreover, deep vein thrombosis (DVT) and cerebrovascular accident (CVA) (13%), organ gangrene (7.4%), and pulmonary thromboendarterectomy (PTE) and transient ischemic attack (TIA) (4.6%) were the most common thrombotic events in antiphospholipid syndrome patients. Deep vein thrombosis was seen in 70.3% of females (P=.005), and subclavian thrombosis was seen in 66.7% of males (P < .001). The risk of DVT in the presence of anti-cardiolipin Ab IgG positive was increased 2.7 times (CI: 95%, 1.2-5.7; P=.007), and it was increased 2.4 times in the presence of anti-β-2 glycoprotein 1 Ab IgG positive (CI: 95%, 1-5.8; P=.033) and 4.2 times in the presence of lupus anticoagulant Ab positive (CI: 95%, 1.9-9.1; P < .001). In patients with anti-β-2 glycoprotein 1 Ab IgG positive, the risk of placental dysfunction increased 4.3 times (CI: 95%, 0.9-20.3; P=.04).<h4>Conclusion</h4>This study's results found that this APS syndrome is mainly seen in women with a mean age of 38, and the most common symptoms associated with it are DVT, CVA, and abortion. Anti-β-2 Glycoprotein 1 Ab IgM and Anti-Cardiolipin Ab IgM were the most common positive antibodies in the patients.

SERPINC1
Also flagged:CortisolSecretionCoagulationadrenal adenomasdexamethasoneadrenal tumour
Journal Article 2024-11-01 ✓ 5 Snippets Bonaventura I, Minnetti M, Ferrari D, Hasenmajer V, Tomaselli A, De Alcubierre D, Lenzi A, Pofi R, Isidori AM.
In-Text Gene Mentions

…as antithrombin III (ATIII), protein C anticoagulant…

…= .002), andATIII(104% [IQR 93-116]…

…= .003) andATIII(females 105 ±…

…possible interaction forATIII, which approached statistical…

…coagulation inhibitors (ie,ATIII, protein C, and…

Show Full Abstract

<h4>Context</h4>Studies describing the coagulation profile in adrenal adenomas still need to be added.<h4>Objective</h4>We explored how sex and mild autonomous cortisol secretion (MACS) affect coagulation parameters in patients with adrenal adenomas.<h4>Design</h4>Cross-sectional study.<h4>Methods</h4>From January 2019 until April 2023, participants in the Impact of Adrenal IncidenTalomas and Possible Autonomous Cortisol Secretion on Cardiovascular and Metabolic Alterations trial (NCT04127552) diagnosed with adrenal adenoma were categorised according to the 1 mg overnight dexamethasone-suppression test (1 mg-DST). Coagulation parameters were evaluated, and two-way ANOVA was used to elucidate the cortisol-by-sex interaction.<h4>Results</h4>Of 153 patients screened, 90 were enrolled (62.2% female, mean age 62 ± 10 years): 41 with non-functioning adrenal tumour (1 mg-DST ≤ 1.8 µg/dL), and 49 with a MACS (1 mg-DST > 1.8 µg/dL). Platelet counts were higher in the MACS group (<i>P</i> = .01). Regression analysis identified female sex (B = 36.603, <i>P</i> = .011), 1mg-DST (B = 0.238, <i>P</i> = .042), and younger age (B = -1.452, <i>P</i> = .038) as independent predictors for elevated platelet count. In patients with MACS, women exhibited higher levels of procoagulant factors fibrinogen (<i>P</i> = .004) and factor VIII (<i>P</i> < .001), and coagulation inhibitors protein C (<i>P</i> = .003) and antithrombin III (<i>P</i> = .005) than males. No differences were observed in the non-functioning adrenal tumour group, providing a cortisol-by-sex interaction regarding fibrinogen (<i>P</i> = .047), factor VIII (<i>P</i> = .046), and protein C (<i>P</i> = .028).<h4>Conclusion</h4>Our findings revealed a worse coagulation profile in women with MACS, underscoring the need for a sex-specific approach in clinical practice to manage thrombotic risks effectively. Dedicated prospective studies are needed to validate and integrate these findings into clinical strategies for thromboprophylaxis.

SERPINC1
Also flagged:idiopathic pulmonary fibrosisinterstitial pneumonialung diseasecomplement activationimmune responseimmunoglobulin
Journal Article 2024-11-01 ✓ 1 Snippet Ngo LT, Rekowski MJ, Koestler DC, Yorozuya T, Saito A, Azeem I, Harrison A, Demoruelle MK, Boomer J, England BR, Wolters P, Molyneaux PL, Castro M, Lee JS, Solomon JJ, Koronuma K, Washburn MP, Matson SM.
In-Text Gene Mentions

…(C3, F2, SERPIND1,SERPINC1, C5, C9, C8B…

Show Full Abstract

<h4>Background</h4>Idiopathic interstitial pneumonias (IIPs), such as idiopathic pulmonary fibrosis and interstitial pneumonia with autoimmune features, present diagnostic and therapeutic challenges due to their heterogeneous nature. This study aimed to identify intrinsic molecular signatures within the lung microenvironment of these IIPs through proteomic analysis of bronchoalveolar lavage fluid (BALF).<h4>Methods</h4>Patients with IIP (n=23) underwent comprehensive clinical evaluation including pre-treatment bronchoscopy and were compared with controls without lung disease (n=5). Proteomic profiling of BALF was conducted using label-free quantitative methods. Unsupervised cluster analyses identified protein expression profiles that were then analysed to predict survival outcomes and investigate associated pathways.<h4>Results</h4>Proteomic profiling successfully differentiated IIP from controls. k-means clustering based on protein expression revealed three distinct IIP clusters, which were not associated with age, smoking history, or baseline pulmonary function. These clusters had unique survival trajectories and provided more accurate survival predictions than the Gender Age Physiology index (concordance index 0.794 <i>versus</i> 0.709). The cluster with the worst prognosis featured decreased inflammatory signalling and complement activation, with pathway analysis highlighting altered immune response pathways related to immunoglobulin production and B-cell-mediated immunity.<h4>Conclusions</h4>The unsupervised clustering of BALF proteomics provided a novel stratification of IIP patients, with potential implications for prognostic and therapeutic targeting. The identified molecular phenotypes underscore the diversity within the IIP classification and the potential importance of personalised treatments for these conditions. Future validation in larger, multi-ethnic cohorts is essential to confirm these findings and to explore their utility in clinical decision-making for patients with IIP.

Also flagged:Hydroxyapatitecalciumbone morphogenic proteincalcium phosphatecalcium carbonatediammonium
Journal Article 2024-11-01 No Snippets Idulhaq M, Mudigdo A, Utomo P, Wasita B, Trapsilantya ME.
Show Full Abstract

<h4>Introduction</h4>This study compares the quality of hydroxyapatite in Anadara granosa waste and laying chicken eggshell waste to commercial synthetic hydroxyapatite.<h4>Material and methods</h4>This experimental research included 27 samples of hydroxyapatite derived from clam shell waste (CSW-HAP), hydroxyapatite derived from eggshell waste (ESW-HAP), and commercial synthetic hydroxyapatite, with nine samples of each. The calcination method was used to process clam shell waste and eggshell waste into hydroxyapatite, which was then compared with synthetic hydroxyapatite from Bongros® for calcium and phosphate content. Scanning electron microscopy was used to compare their morphological structures.<h4>Result</h4>The mean calcium levels in the CW-HAP, EW-HAP, and control groups were 41.3±2.9%, 41.5±2.3%, and 39.6±5.0%, respectively. According to One Way ANOVA, there was no significant difference between the CW-HAP or EW-HAP groups and the control group (p=0.49). The mean phosphate levels in the CW-HAP, EW-HAP, and control groups were 8.1±1.2%, 8.1±1.3%, and 9.4±2.0%, respectively. The results were also not significant (p=0.146).<h4>Conclusion</h4>Clam shell waste and eggshells can be an alternative source of hydroxyapatite substitution, as demonstrated by the structural and porous formation of hydroxyapatite obtained from these sources (CW-HAP and EW-HAP) when compared to commercial synthetic hydroxyapatite.

Also flagged:Transcription factorTCF4hereditary diseasespsychiatric disordersdosage compensationgenetic disorder
Journal Article 2024-11-01 No Snippets Savchenko RR, Skryabin NA.
Show Full Abstract

Our understanding of human genes - particularly their structure, functions, and regulatory mechanisms - is still limited. The biological role of approximately 20 % of human proteins has not been established yet, and the molecular functions of the known part of the proteome remain poorly understood. This hinders progress in basic and applied biological and medical sciences, especially in treating hereditary diseases, which are caused by mutations and polymorphic variants in individual genes. Therefore, it is crucial to comprehend the mechanisms of protein functioning to address this problem. This further emphasizes the importance of investigating gene functions and molecular pathogenetic pathways associated with single-gene inherited diseases. This review focuses on the TCF4 gene that encodes a transcription factor crucial for nervous system development and functioning. Pathogenic variants in this gene have been linked to a rare genetic disorder, Pitt-Hopkins syndrome, and TCF4 polymorphic variants are associated with several socially significant diseases, including various psychiatric disorders. The pathogenetic mechanisms of these conditions remain unexplored, and the knowledge about TCF4 upregulation and its target genes is limited. TCF4 can be expressed in various isoforms due to the complex structure and regulation of its gene, which complicates the investigation of the protein's functions. Here, we consider the structure and functions of the TCF4 transcription factor. We discuss its potential target genes and the possible loss-of-function pathogenetic mechanisms identified in animal and cellular models of Pitt-Hopkins syndrome. The review also examines the advantages and limitations of potential therapies for Pitt-Hopkins syndrome that are based on TCF4 dosage compensation or altering the activity of TCF4 target genes.

HFE
Also flagged:Disordersadrenal exhaustioncortisolWilson's syndromeT3 receptorstestosterone
Journal Article 2024-11-01 ✓ 1 Snippet McDermott MT.
In-Text Gene Mentions

…pogonadism (pituitary disease,hemochromatosis, hyperprolactinemia, thyroid …

Show Full Abstract

"Pseudo-endocrine disorders" refer to proposed conditions that have never been scientifically proven to exist but, due to widespread misinformation available on the internet and other media, are relatively commonly diagnosed and treated with equally unproven and sometimes dangerous treatments. Adrenal fatigue is a nonexistent condition that supposedly results from adrenal exhaustion and atrophy due to chronic stress and has been promoted as a potential explanation for a variety of symptoms. Testing consists of nonvalidated online surveys and salivary cortisol profiles while treatment is not evidence-based at best and can be dangerous. Wilson's syndrome and reverse T3 syndrome are also nonexistent conditions that supposedly result from impaired T4 to T3 conversion and competition of excess reverse T3 with T3 for T3 receptors. Testing involves measurement of axillary temperature and treatment consists of T3 therapy, often at very high and dangerous doses. Hypogonadism ("low T") is frequently diagnosed in "men's health" clinics and other venues without actual hormone testing or further evaluation and is often treated with supraphysiologic testosterone therapy that suppresses endogenous gonadal testosterone and sperm production, leads to a lifelong need for testosterone therapy, and may have numerous other harmful effects. Low-dose naltrexone (LDN) therapy has been proposed as a treatment for multiple disorders including autoimmune conditions and other disorders resulting from aberrant immune mechanisms, but there is no valid evidence that LDN has any benefits. Management of patients with pseudo-endocrine disorders must involve careful listening, patient education, healthy lifestyle measures, and honesty, encouragement, and compassion.

LRRC7
Also flagged:ADdementiataudeathlysosome
Journal Article 2024-11-01 ✓ 5 Snippets Ghose U, Sproviero W, Winchester L, Amin N, Zhu T, Newby D, Ulm BS, Papathanasiou A, Shi L, Liu Q, Fernandes M, Adams C, Albukhari A, Almansouri M, Choudhry H, van Duijn C, Nevado-Holgado A.
In-Text Gene Mentions

…AD-associated genes, LINGO2,LRRC7, NRG3, PCDH9, ROR1,…

…SORL1 , andLRRC7.…

…tractable, and SPI1,LRRC7, APH1B, NRG3, and…

…Furthermore, SMYD3,LRRC7, NRG3, PCDH9, and…

…LINGO2, SMYD3, andLRRC7have been associated…

Show Full Abstract

Augmenting traditional genome-wide association studies (GWAS) with advanced machine learning algorithms can allow the detection of novel signals in available cohorts. We introduce "genome-wide association neural networks (GWANN)" a novel approach that uses neural networks (NNs) to perform a gene-level association study with family history of Alzheimer's disease (AD). In UK Biobank, we defined cases (n = 42 110) as those with AD or family history of AD and sampled an equal number of controls. The data was split into an 80:20 ratio of training and testing samples, and GWANN was trained on the former followed by identifying associated genes using its performance on the latter. Our method identified 18 genes to be associated with family history of AD. APOE, BIN1, SORL1, ADAM10, APH1B, and SPI1 have been identified by previous AD GWAS. Among the 12 new genes, PCDH9, NRG3, ROR1, LINGO2, SMYD3, and LRRC7 have been associated with neurofibrillary tangles or phosphorylated tau in previous studies. Furthermore, there is evidence for differential transcriptomic or proteomic expression between AD and healthy brains for 10 of the 12 new genes. A series of post hoc analyses resulted in a significantly enriched protein-protein interaction network (P-value < 1 × 10-16), and enrichment of relevant disease and biological pathways such as focal adhesion (P-value = 1 × 10-4), extracellular matrix organization (P-value = 1 × 10-4), Hippo signaling (P-value = 7 × 10-4), Alzheimer's disease (P-value = 3 × 10-4), and impaired cognition (P-value = 4 × 10-3). Applying NNs for GWAS illustrates their potential to complement existing algorithms and methods and enable the discovery of new associations without the need to expand existing cohorts.

SOX6
Also flagged:transcription factorscellular senescencegene expressionTFbindingcell senescence
Journal Article 2024-11-01 ✓ 2 Snippets Wu Y, Xu P, Wang L, Liu S, Hou Y, Lu H, Hu P, Li X, Yu X.
In-Text Gene Mentions

…ESRRG , andSOX6, which have…

…identified CUX1 ,SOX6, and SVIL…

Show Full Abstract

Machine learning has emerged as a transformative tool for elucidating cellular heterogeneity in single-cell RNA sequencing. However, a significant challenge lies in the "black box" nature of deep learning models, which obscures the decision-making process and limits interpretability in cell status annotation. In this study, we introduced scGO, a Gene Ontology (GO)-inspired deep learning framework designed to provide interpretable cell status annotation for scRNA-seq data. scGO employs sparse neural networks to leverage the intrinsic biological relationships among genes, transcription factors, and GO terms, significantly augmenting interpretability and reducing computational cost. scGO outperforms state-of-the-art methods in the precise characterization of cell subtypes across diverse datasets. Our extensive experimentation across a spectrum of scRNA-seq datasets underscored the remarkable efficacy of scGO in disease diagnosis, prediction of developmental stages, and evaluation of disease severity and cellular senescence status. Furthermore, we incorporated in silico individual gene manipulations into the scGO model, introducing an additional layer for discovering therapeutic targets. Our results provide an interpretable model for accurately annotating cell status, capturing latent biological knowledge, and informing clinical practice.

SERPINC1
Also flagged:neuritinneuron-specific enolasetraumatic brain injuryNSEspinal cord injurydeath
Journal Article 2024-11-01 ✓ 1 Snippet Pu B, Chen Y, Bi Q, Shen J, Wang L, Han Y.
In-Text Gene Mentions

…(D-D), antitrombina III (ATIII), proteina S100 (S100…

Show Full Abstract

<h4>Background</h4>Serum neuritin and neuron-specific enolase (NSE) have predictive value for the prognosis of patients with combined traumatic brain injury (TBI) and spinal cord injury (SCI). Studying their predictive effects has positive value for disease control and treatment.<h4>Methods</h4>Sixty patients with combined TBI and SCI were recruited and rolled into three groups according to prognosis: Group I (n=42, favourable prognosis), Group II (n=11, poor prognosis), and Group III (n=7, death). Clinical indicators were compared between the groups, and the predictive value of different indicators for prognosis was analyzed.<h4>Results</h4>The proportion of patients with combined injuries to other organs and hypotension, as well as levels of platelets (PLT), D-dimer (D-D), antithrombin III (AT-III), S100 protein (S100), NSE, and serum neurofilament levels were significantly higher in Groups II and III compared to Group I. Conversely, the Glasgow Coma Scale (GCS) scores were significantly lower in Group I (P<0.05). Multivariable logistic regression analysis revealed that other organ injuries, GCS score, PLT, D-D, and AT-III significantly influenced the prognosis of TBI combined with SCI patients (P<0.05), while hypotension, NSE, serum neurofilament levels, S100, and accompanying organ injuries were highly correlated with the prognosis of TBI combined with SCI patients (P<0.001). The predictive sensitivity, specificity, accuracy, positive predictive value, and negative predictive value of NSE combined with serum neurofilament in predicting the prognosis of TBI combined with SCI patients were significantly higher than the singular predictive efficacy of NSE or serum neurofilament alone (P<0.05).<h4>Conclusions</h4>To evaluate the prognosis of TBI combined with SCI patients, consideration should be given to factors such as other organ injuries, hypotension, consciousness assessment, and levels of various biomarkers. Furthermore, combined testing of serum neurofilament and NSE can more accurately predict the prognosis of TBI combined with SCI patients.

Also flagged:cell cycle phasecell cycleidiopathic pulmonary fibrosisinfectionsADbreast cancer
Journal Article 2024-11-01 No Snippets Shao Y, Gao Q, Wang L, Li D, Nixon AB, Chan C, Li QJ, Xie J.
Show Full Abstract

In single-cell studies, cells can be characterized with multiple sources of heterogeneity (SOH) such as cell type, developmental stage, cell cycle phase, activation state, and so on. In some studies, many nuisance SOH are of no interest, but may confound the identification of the SOH of interest, and thus affect the accurate annotate the corresponding cell subpopulations. In this paper, we develop B-Lightning, a novel and robust method designed to identify marker genes and cell subpopulations corresponding to an SOH (e.g. cell activation status), isolating it from other SOH (e.g. cell type, cell cycle phase). B-Lightning uses an iterative approach to enrich a small set of trustworthy marker genes to more reliable marker genes and boost the signals of the SOH of interest. Multiple numerical and experimental studies showed that B-Lightning outperforms existing methods in terms of sensitivity and robustness in identifying marker genes. Moreover, it increases the power to differentiate cell subpopulations of interest from other heterogeneous cohorts. B-Lightning successfully identified new senescence markers in ciliated cells from human idiopathic pulmonary fibrosis lung tissues, new T-cell memory and effector markers in the context of SARS-COV-2 infections, and their synchronized patterns that were previously neglected, new AD markers that can better differentiate AD severity, and new dendritic cell functioning markers with differential transcriptomics profiles across breast cancer subtypes. This paper highlights B-Lightning's potential as a powerful tool for single-cell data analysis, particularly in complex data sets where SOH of interest are entangled with numerous nuisance factors.

STAU1
Also flagged:cognitive impairmentsamyloid precursor proteinAlzheimer's diseaseFYNRPL28
Journal Article 2024-11-01 ✓ 1 Snippet Suresh PN, Kazemivash B, Jensen DM, Calhoun V, Liu J.
In-Text Gene Mentions

STAU1

Show Full Abstract

Understanding working memory's genetic and neural bases is crucial for advancing cognitive neuroscience and identifying biomarkers for cognitive impairments, particularly in the older population. This study integrates SNP and neuroimaging data from the UK biobank to improve the classification of high vs. low working memory capacity and reveal genetic factors associated with brain structure. 1060 SNPs belonging to Protein-Protein Interaction networks of amyloid precursor protein and Aβ of Alzheimer's disease were integrated with latent features of whole brain gray matter density, extracted by a pre-trained CNN, via supervised contrastive learning. Our model effectively extracts latent representations of both modalities through enhancing genetic-imaging relation within individuals and within working memory groups, in contrast to across individuals and groups. Features derived from contrastive learning outperformed other baseline models in terms of classification. Sparse canonical correlation analysis was applied to the latent representations and uncovered significantly related genetic variants and brain regions. Genetic components highlight SNPs in genes FYN, RPL28, MAPT, enriched in the pathways of dendrite and synapse, among others. The linked brain regions support the cerebellum and striatum's role in cognitive functions. These findings provide new insights into the genetic and neural mechanisms underlying working memory, potentially guiding future research and therapeutic strategies for cognitive impairment.

Also flagged:MEKplexiform neurofibromasoptic gliomasNeurofibromatosis type 1NF1retinopathy
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Diffuse midline gliomashighgliomasPRC2gene expressionPDGFRA
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Neurofibromatosis type 1NF1autosomal dominant disorderneoplasmsMitogen-activated protein kinaseneural tumor
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:IGF1RGlioblastomaGBMtumorIDH1infection
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:PPM1DDiffuse Intrinsic Pontine Gliomapediatric tumorsphosphataseTP53DIPG
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:brain tumorstumorbrain tumorIDH1gliomasglioma
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:MNK1GlioblastomaGBMmalignant tumortumorsArsenic trioxide
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

SOX6
Also flagged:FOXR2neuroblastomabrain tumortranscription factortumorsMEK
Journal Article 2024-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…as NKX2.1 andSOX6.…

Show Full Abstract

No abstract available.

Also flagged:ATRGlioblastomatumourtemozolomidedeathdamage response
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

VRK2
Also flagged:Glioblastomabrain cancerglioblastomasALDH1A1EGFRFGFR
Journal Article 2024-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…not known (e.g.VRK2) to be linked…

Show Full Abstract

No abstract available.

Also flagged:Tumorglioblastomaisocitrate dehydrogenaseIDHastrocytomamethylguanine-methyltransferase
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

CDK5RAP1
Also flagged:GBMbrain tumorgliomasgliomaadenosineTransfer RNA isopentenyl transferase 1
Journal Article 2024-11-01 ✓ 4 Snippets Unknown Authors
In-Text Gene Mentions

…subunit associated-protein 1 (CDK5RAP1) within mitochondrial tRNA.…

…also found thatCDK5RAP1in mitochondrial tRNAs…

CDK5RAP1maintains the self-renewal…

…Notably,CDK5RAP1abrogates the antitumor…

Show Full Abstract

No abstract available.

Also flagged:Glioblastomabrain tumourtumourgliomaERK5temozolomide
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:gliomasbrain cancerglioblastomasgliomatumourDDR
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:THY1MEDIATES TREATMENT RESISTANCEGlioblastomaGBMintracranial neoplasmtemozolomide
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Low-grade gliomasbrain cancersglioblastomasCDKN2APTENPDGFRA
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:NeurodegenerativeBrain DiseasesADmultiple sclerosisMSPD
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:RNU4-2neurodevelopmental disordersspliceosomeU4C21.intellectual disability
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

BTN3A3
Also flagged:Multiple Malformation/Anomalies Syndromesintellectual disabilityBRF1SLC35A3SCN1AEHMT1
Journal Article 2024-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

BTN3A3

Show Full Abstract

No abstract available.

Also flagged:Multiple Malformation/Anomalies SyndromesAlkuraya-Kučinskas syndromeBLTP1bridge-like lipid transfer proteinKIAA1109callosum
Journal Article 2024-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Research Square 2024-11-01 Preprint (No Snippets API) Bayoglu B, Akdeniz G, Kocabasoglu N, Poyraz CA, Dirican A, Cengiz M.
Show Full Abstract

<title>Abstract</title> <p> NEGR1 (neuronal growth regulator 1) is a cell adhesion molecule of the immunoglobulin (Ig) superfamily related to IgLON subgroup. NEGR1 promotes cell-cell adhesion and stimulates neurite growth of hypothalamic neurons and inhibits synapse formation. <italic>NEGR1</italic> is one of the genomic regions significantly associated with major depression disorder (MDD). The functional role of NEGR1 on MDD is still unknown. Fluoxetine, a selective serotonin reuptake inhibitor, is used in the treatment of MDD. Thus, we aimed to investigate the effects of fluoxetine on NEGR1 expression in MDD and to examine correlations between NEGR1 levels and symptom severity. In this study, mRNA expression of <italic>NEGR1</italic> in fluoxetine-treated and non-treated cultured peripheral blood mononuclear cells (PBMC) were detected by qPCR in 40 patients with MDD and 40 age‑matched healthy controls. The protein levels of NEGR1 in cultured PBMCs were detected by ELISA method. Hamilton Rating-Scale for Depression (HRSD) and Beck Depression Inventory (BDI) were used to evaluate depressive symptom severity. PBMC of MDD patients exhibited elevated NEGR1 protein levels when compared with healthy controls in both fluoxetine treated and non-treated groups (p = 0.01). Besides, a positive correlation was found between NEGR1 protein levels and Beck scores in fluoxetine treated MDD group (r = 0.33, p = 0.036). However, no significant relationship was observed in <italic>NEGR1</italic> mRNA levels between MDD patients and controls in both fluoxetine treated and non-treated group (p > 0.05). Fluoxetine had no effect on the protein levels of NEGR1 directly. On the other hand, NEGR1 protein levels may affect symptom severity in MDD patients treated with fluoxetine. </p>

bioRxiv 2024-11-01 Preprint (No Snippets API) Jayavelu AK, Liu JJ, Schriever SC, Pfluger PT, Schwarzer C, Krahmer N, Mann M.
Show Full Abstract

<h4>SUMMARY</h4> Reversible post-translational modification (PTMs) is a fundamental mechanism of cellular signal transduction. In vivo and ex vivo studies to profile PTMs have greatly advanced our understanding of the complexities of cellular signaling. However, apart from the most commonly studied PTMs, large-scale analysis is still very challenging, limiting our understanding of various cellular processes. PTM-bearing peptides often enriched by antibodies, followed by unbiased mass spectrometry (MS)-based readout of hundreds or thousands of sites. To extend the reach of this powerful technology to in vivo and ex vivo studies with small protein starting amounts, we here developed EasyAb, a streamlined and high throughput MS workflow for antibody-based PTM profiling. Using epidermal growth factor receptor (EGFR) signaling and acute myeloid leukemia (AML) cell systems, we demonstrate that EasyAb increases sensitivity and enables multiple large-scale systems-level studies. Furthermore, EasyAb resolves in vivo brain G protein-coupled receptor-mediated tyrosine kinase activation and reveals the long elusive hypothalamic neuron-specific leptin signaling architecture. <h4>Graphical Abstract</h4> <h4>HIGHLIGHTS</h4> EasyAb, a sensitive, rapid and high-throughput method to quantify post translationally modified peptides in diverse cell systems. EasyAb reveals differential tyrosine phosphorylation of mRNA splicing proteins in AML patient samples. Activation of KOR by “G-protein-biased” non-aversive agonist 6’GNTI elicits Src kinase activity in mice. Elucidation of in vivo hypothalamic Leptin induced LEPRb-Jak2 phosphotyrosine signaling architecture.