Gene Literature Dashboard

Viewing February 2025 — 737 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← January 2025 March 2025 →
HFE
Also flagged:hereditary diseasesanxietyTransthyretin Amyloidosismental illnessesdepressionAmyotrophic Lateral Sclerosis
Journal Article 2025-02-28 ✓ 1 Snippet Valentim J, Paneque M, Mendes Á.
In-Text Gene Mentions

…chado-Joseph’s disease (7.9%),Hemochromatosis(7.9%), and Neurofibromatosis…

Show Full Abstract

Stigma is defined as the perception of an undesirable attribute that leads to discrimination against individuals and groups. Stigmatisation is often triggered due to visible physical or cognitive differences. Although the literature consistently highlights the (fear of) stigmatisation as a significant concern among individuals living with hereditary conditions, no studies in Portugal have specifically provided evidence on this issue. This study aims to address this gap by examining the experiences and impact of stigma on individuals and families affected by hereditary diseases in Portugal. After receiving ethics approval, a total of 216 participants, including affected individuals, asymptomatic carriers and family members from families with a range of hereditary conditions, were recruited through patient support associations. Participants completed an online questionnaire via Limesurvey. Data were analysed through Exploratory Factor Analysis (EFA), median comparison tests, and thematic analysis. Of the participants, 78.7% were women, 55.6% had a university degree, and 20.4% were aged between 42 and 47 years. Findings indicate that stigma impacts individuals across various domains, including social interactions, institutional settings, the workplace, and healthcare. EFA identified a bi-factorial model of stigma, comprising Stigma Experiences and Perceived Support subscales, and the overall scale demonstrated high internal consistency (α = .879). Women and younger participants reported higher levels of stigma. Religiosity and humor emerged as key coping strategies. This study is the first in Portugal to assess stigma among individuals living with hereditary conditions. Our findings contributed to validating a measurement instrument, identified sociodemographic variations, and examined the psychosocial dimensions of stigma among affected patients. These findings highlight the need for comprehensive strategies to address and mitigate stigma, improve support systems, and enhance the well-being and healthcare experiences of individuals and families impacted by hereditary diseases.

PRDX6
Also flagged:pancreatic ductal adenocarcinomaPDACtumorglycolysisironmetabolism
Journal Article 2025-02-28 ✓ 1 Snippet Tao M, Liu W, Chen J, Liu R, Zou J, Yu B, Wang C, Huang M, Chen Q, Zhang Z, Chen Z, Sun H, Zhou C, Tan S, Zheng Y, Wang H.
In-Text Gene Mentions

…LGALS1 , andPRDX6) were highly…

Show Full Abstract

Cancer-associated fibroblasts (CAFs) play a crucial role in the progression of pancreatic ductal adenocarcinoma (PDAC). Here, integrated single-cell RNA sequencing analysis is utilized to comprehensively map CAFs in the human PDAC tumor microenvironment (TME). Normal fibroblasts (NFs) and nine distinct CAF subtypes are identified including newly identified CAF subtypes, CDCP1<sup>+</sup>FTL<sup>+</sup> CAFs, transitional CAFs (tCAFs), interferon simulated genes (ISG)<sup>+</sup> myofibroblastic CAFs (myCAFs), and proliferative CAFs (pCAFs). CDCP1<sup>+</sup>FTL<sup>+</sup> CAFs, pCAFs, and ISG<sup>+</sup> myCAFs are associated with unfavorable clinical outcomes. CDCP1<sup>+</sup>FTL<sup>+</sup> CAFs exhibit enhanced glycolysis and iron metabolism, resisting ferroptosis. The antigen-presenting CAFs (apCAFs) show high heterogeneity, consisting of multiple subtypes expressing distinct immune cell signatures. The CAF subtypes display differentiation plasticity, transitioning from early normal-like CAFs (nCAFs) to inflammatory CAFs (iCAFs) and myCAFs, ultimately leading to more invasive pCAFs. AP-1 family members FOS and JUN regulate the malignant phenotype conversion of NFs to nCAFs, while transforming growth factor-β (TGFβ) and interferon-γ (IFNγ) signals trigger the interconversion between classic myCAFs and iCAFs, respectively. A close interaction between CAFs and myeloid cells (especially neutrophils) is further observed in PDAC-TME, mainly mediated by CXCR4-CXCL12 chemotaxis. This work depicts a detailed CAF map and its dynamic interconvertible shift, providing important insights for combined targeted CAFs therapy.

DARS2
Also flagged:liver cancercell growthS-adenosylmethioninenicotinic acidmitochondrialNotch1
Journal Article 2025-02-28 ✓ 5 Snippets Liu WM, Chen CY, Ma HQ, Zhang QQ, Zhou X, Wu YL, Huang WJ, Qi XS, Zhang YX, Tang D, Sun HY, Wu HP, Jiao YF, He ZY, Yu WF, Yan HX.
In-Text Gene Mentions

…-AFP (Proteintech, USA), anti-DARS2(Proteintech, USA), anti-COX…

…drial aspartyl-tRNA synthetaseDARS2deficiency leads to…

…Immunofluorescent staining forDARS2, alongside TOM20—a marker…

…expression levels ofDARS2and COX IV…

…expression of AFP,DARS2, COX IV, TOM20…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC), the most common form of liver cancer, presents a challenging malignancy with scarce treatment options. Liver progenitor cells (LPCs) play a pivotal role in both liver regeneration and the progression of liver cancer, yet the specific functions of LPCs from different origins in liver cancer remain to be fully elucidated.<h4>Methods</h4>We explored the liver progenitor-like cells derived from human hepatocytes (HepLPCs) on the proliferation of HCC both in vitro and in vivo. The mitochondrial function was assessed through electron microscopy and functional experiments. Transcriptomic sequencing and western blot unveiled the fundamental mechanisms at play, whereas metabolomic sequencing pinpointed crucial effector molecules involved in the paracrine secretion of HepLPCs.<h4>Results</h4>By employing a co-culture system of HepLPCs and HCC cells, we found that HepLPCs markedly inhibited HCC growth by prompting mitochondrial dysfunction, which further led to the co-inhibition of the Notch1 and JAK1/STAT3 signaling pathways through paracrine actions involving S-adenosylmethionine (SAM) and Nicotinic acid (NA).<h4>Conclusions</h4>This study has uncovered that HepLPCs have a suppressive influence on the proliferation of HCC cells. This is achieved through the impairment of mitochondrial function and the inhibition of key signaling pathways, namely, Notch1 and JAK1/STAT3, which are critical drivers of cancer progression. The secretion of the metabolites SAM and NA by HepLPCs appears to be instrumental in mediating these effects. These findings provide a solid foundation for identifying new therapeutic targets and clarifying the mechanisms through which HepLPCs can be harnessed to effectively treat HCC.

CACNA1E
Also flagged:Gene-Expressiongene expressioncognitionataxiaszebrin IImitochondrial
Journal Article 2025-02-28 ✓ 3 Snippets Schilling K.
In-Text Gene Mentions

…sport/exchange (e.g., SLC24A4,CACNA1E, ATP2B4), and the…

…we find Grin3a,Cacna1e, Slc24a5, Neurod6 and…

…channels comprising theCACNA1E-encoded subunit α1E have…

Show Full Abstract

Cerebellar information processing is critically shaped by several types of inhibitory interneurons forming various intra-cerebellar feed-forward and feed-back loops. Evidence gathered over the past decades has focused interest on a non-uniform set of cortical inhibitory interneurons distinct from "classical" Golgi, basket or stellate cells, summarily referred to as PLIs (for Purkinje cell layer interneurons). Similarly, cerebellar nuclear inhibitory interneurons have gained increasing attention. Our understanding of the functions of these cells is still fragmentary. For humans, we lack functional data, and even any dependable morphological classification for these cells. Here, I used publicly available single cell based gene expression data to compare inhibitory interneurons from the cerebellar cortex and inhibitory nuclear neurons of humans and mice. Integration of nuclear and cortical cells revealed transcriptomic similarities between subsets of these cells and suggest known characteristics of cortical cell types may be helpful to devise strategies for the further characterization of nuclear inhibitory interneurons. Comparison of human and murine PLIs indicate that these strongly differ by the expression of genes used to characterize these cells in mice. This limits their utility to identify and classify human PLIs, and leaves the question open as to the number and characteristics of non-Golgi inhibitory interneurons resident in the cerebellar granule cell and Purkinje cell layers in humans.

Also flagged:IL-1βcolorectal cancercancerTranscription factorsmethylationgene expression
Journal Article 2025-02-28 No Snippets Sahoo K, Sundararajan V, Sundararajan V.
Show Full Abstract

<h4>Purpose</h4>Colorectal cancer (CRC) is the third most common cancer globally, necessitating novel biomarkers for early diagnosis and treatment. This study proposes an efficient pipeline leveraging an integrated bioinformatics and machine learning framework to enhance the identification of diagnostic and prognostic biomarkers for CRC.<h4>Methods</h4>A selection of methylated differentially expressed genes (MeDEGs) and features (genes) was made using both statistical and Machine learning (ML) approaches from publically available datasets. These genes were subjected to STRING network construction and hub genes estimation, separately. Also, essential miRNAs (micro-RNAs) and TFs (Transcription factors) as regulatory elements were revealed and findings were validated through scRNA-seq analysis, promoter methylation, gene expression levels correlated with pathological stage, and interaction with tumor-infiltrating immune cells.<h4>Results</h4>Through an integrated analysis pipeline, we identified 27 hub genes, among which CTNNB1, GSK3B, IL-1β, MYC, PXDN, TP53, EGFR, SRC, COL1A1, and TGBF1 showed better diagnostic behaviour. Machine learning approach includes the development of K-Nearest Neighbors (KNN), Artificial Neural Networks (ANN), and Random Forest (RF) models using TCGA datasets, achieving an accuracy range between 99 and 100%. The Area Under the Curve (AUC) value for each model is 1.00, signifying good classification performance. The high expression of some diagnostic genes was associated with poor prognosis, concluding IL-1β as both a prognostic and diagnostic biomarker. Additionally, the NF-κB and microRNAs (miR-548d-3p, miR-548-ac) and TFs (NFκB and STAT5A) play a major role in the comprehensive regulatory network for CRC. Furthermore, hub genes such as IL-1β, TGFB1, and COL1A1 were significantly correlated with immune infiltrates, suggesting their potential role in CRC progression.<h4>Conclusion</h4>Overall, the elevated expression of IL-1β coupled with abnormal DNA methylation, and its consequent effect on the PI3K/Akt signaling pathway are relevant prognostic and therapeutic marker in CRC. Additional molecular candidates reveal insights into the epigenetic regulatory targets of CRC and their association with immune cell infiltration.

Also flagged:octacalcium phosphatestromal-derived factor-1SDF-1OCPC-X-C motif chemokine receptor 4CXCR4
Journal Article 2025-02-28 No Snippets Kanabuchi R, Hamai R, Mori Y, Hamada S, Shiwaku Y, Sai Y, Tsuchiya K, Aizawa T, Suzuki O.
Show Full Abstract

This study investigated whether octacalcium phosphate (OCP) enhances bone regeneration through its synergistic effect with stromal-derived factor-1 (SDF-1). Recombinant SDF-1 (0.5-5.0 μg) was combined with OCP granules through lyophilization. OCP/SDF-1 granules were implanted into a rat femoral standardized defect for 2 and 4 weeks and subjected to histomorphometry, C-X-C motif chemokine receptor 4 (CXCR4) and osteocalcin immunohistomorphometry, and tartrate-resistant acid phosphatase (TRAP) staining. Calcium-deficient hydroxyapatite (CDHA) was used as a control for in vitro analyses. Mesenchymal stem cell (MSC) migration was estimated using a Transwell system with OCP/SDF-1. SDF-1 release from OCP/SDF-1 into the supernatant was determined without cells. SDF-1 adsorption in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer onto OCP, the chemical structure of OCP immersed in the medium using Fourier transform infrared spectroscopy, and the degree of supersaturation of the medium were determined. Bone regeneration and OCP degradation were enhanced the most by 1.0 μg of OCP/SDF-1 at 2 weeks after implantation by CT analysis and increasing CXCR4-positive, osteocalcin-positive, and TRAP-positive cells accumulation around the OCP. MSC migration increased until 48 h in the following order: SDF-1 only, CDHA/SDF-1, and OCP/SDF-1, with the greatest effect with 1.0 μg of SDF-1 than from OCP. CDHA promoted a greater release than OCP at 48 h. The physicochemical analyses indicated that SDF-1 interacted with OCP through Freundlich-type adsorption and that the adsorption controlled SDF-1 release from OCP during the hydrolysis into CDHA. Therefore, leveraging its molecular affinity for the OCP surface, OCP/SDF-1 facilitates MSC migration and enhances bone formation by ensuring the controlled, sustained release of SDF-1 from OCP.

Also flagged:abortionsgestationmiscarriagesmaternal diseasesautoimmune diseasesgestational diabetes
Journal Article 2025-02-28 No Snippets Drozdov GV, Kashevarova AA, Lebedev IN.
Show Full Abstract

The goal of this study was to analyze copy number variations (CNVs) in spontaneous abortions with a euploid karyotype, irrespective of the method used for CNV detection. This systematic review was performed in accordance with the PRISMA guidelines. Articles published between 2006 and 2023 were selected through the PubMed database. Studies were included if they involved CNV analysis in spontaneous abortions using any CNV detection method. The pathogenic significance of CNVs was interpreted based on the American College of Medical Genetics and Genomics (ACMG) guidelines. Nineteen publications met the inclusion criteria. A total of 1425 CNVs were identified in 550 samples from 3953 euploid spontaneous abortions, representing 14% of the cases. Among the detected CNVs, 9% were classified as pathogenic, and 7.5% were likely pathogenic. The most frequently observed pathogenic CNVs included 22q11.2 deletion/duplication, 16p13.11 deletion, 15q11.2 deletion/duplication, 1p36.33 duplication, and 17p13.3 duplication. The genomic regions with the highest frequency of CNVs, regardless of their pathogenic effect, were 8q24.3, 16p13.3, 21q22.3, Xp22.33, Xp22.31, and Xq28. No clear associations were found between specific CNVs and pregnancy loss. However, deletions in the 22q11.2 region emerged as the most likely candidates contributing to lethality during the early stages of embryonic development.

Also flagged:chromosomal disordersACTHsteroidinsulinsteroidsgene expression
Journal Article 2025-02-28 No Snippets Innes EA, Han VX, Patel S, Farrar MA, Gill D, Mohammad SS, Dale RC.
Show Full Abstract

<h4>Aim</h4>To review the aetiopathogenesis of infantile epileptic spasms syndrome (IESS) and mechanisms of action of adrenocorticotrophin hormone (ACTH)/corticosteroids established in humans.<h4>Method</h4>MEDLINE, PubMed, and Embase were systematically searched from inception to December 2023 to identify studies related to IESS aetiology and treatment response. Mechanistic themes were identified and through consensus meetings refined and grouped into five overarching hypotheses.<h4>Results</h4>Five hypotheses were generated from 17 mechanistic themes: (1) gene and epigenetic regulation altering expression of 'vulnerability' genes; (2) stress and hypothalamic-pituitary-adrenal axis activation; (3) neuroinflammation and altered immune function; (4) altered neuronal transmission and pathways; and (5) dysfunction of metabolic pathways.<h4>Interpretation</h4>The evidence that ACTH/corticosteroids alter these processes remains limited. It is plausible that these processes interact with one another, rather than existing independently, and affect maturational and regulatory processes in the central nervous system, consistent with proposals that IESS is a neurodevelopmental disorder. Understanding how ACTH/corticosteroids work in IESS may facilitate disease-modifying treatments and improve neurodevelopmental outcomes.

Also flagged:mitochondrialmitochondrial genomesnucleotidecytbnad 4degradation
Journal Article 2025-02-28 No Snippets Chen C, Ji L, Huang G, Liu X, Chen H, Wang Y, Yu L, Liu Y, Hong X, Wei C, Wu C, Luo L, Zhu X, Li W.
Show Full Abstract

Soft-shelled turtles, or Trionychia, are an enigmatic and fascinating group due to their specific morphological features and ecological adaptations. Based on mitochondrial DNA (mtDNA) and/or nuclear markers, previous studies showed the incongruent phylogenetic topologies within Trionychia (e.g., the Palea and its closely related species). In order to resolve the equivocal relationships and obtain some "genome-level" common evolutionary characters of soft-shelled turtles, in this study, we assembled and annotated the complete mitochondrial genomes of Palea steindachneri and Pelodiscus axenaria, both naturally distributed in Asia. The sizes of the two mitochondrial genomes were 16,811 bp and 17,143 bp, respectively. Typical vertebrate animal mtDNA features were observed, such as the usual gene components and arrangements (37 genes with a non-coding control region) and the A + T biased nucleotide compositions on the light strand (61.5% and 62.7%, respectively). All conserved blocks common to the vertebrates control region except for the extended terminal associated sequences (ETAS2) were found in the two soft-shelled turtles. The ω ratio averaged over all sites of each protein-coding gene (PCG) was below 1, which indicated purifying selection at the gene-wide level. However, a positive selection site at the 350-codon position in the cytb gene was detected, as estimated by Bayes empirical Bayes (BEB) analysis. Compared with the gene subsets, the mitogenomes provided the most robust phylogenetic resolution. The monophyly of the clades Amydona, Gigantaesuarochelys, and Apalonia was well supported. Topology discrepancies were observed among different datasets (e.g., the positions of Lissemys and Palea), reflecting the heterogeneous phylogenetic signals in the soft-shelled turtle mitogenomes. Precise date estimation based on Bayesian relaxed clock analyses indicated that the crown group age of extant Trionychia was approximately 115.84 Ma (95% HPD: 91.33-142.18 Ma). Paleoclimate changes, especially the Eocene - Oligocene transition, could be responsible for the speciation in these groups. Our results reiterated the necessity and effectiveness of incorporating entire mitochondrial genomes to delineate phylogenetic relationships in chelonian phylogeny studies.

SOX6
Also flagged:PARISZNF746transcriptional repressorphosphorylationMDM4mitochondrial
Journal Article 2025-02-28 ✓ 1 Snippet Kim JH, Yang S, Kim H, Vo DK, Maeng HJ, Jo A, Shin JH, Shin JH, Baek HM, Lee GH, Kim SH, Lim KH, Dawson VL, Dawson TM, Joo JY, Lee Y.
In-Text Gene Mentions

…death), include Calb1,Sox6, Ucp3, Ucp2, Rptor,…

Show Full Abstract

<h4>Background</h4>The parkin-interacting substrate (PARIS, also known as ZNF746) is a transcriptional repressor, whose accumulation and phosphorylation play central pathological roles in Parkinson's disease (PD). PARIS-induced transcriptional repression of PGC-1α or MDM4 contributes to mitochondrial dysfunction and p53-dependent neuron loss in PD. Despite the important role of PARIS in PD pathogenesis, unbiased transcriptomic profiles influenced by PARIS accumulation in dopaminergic neurons remain unexplored.<h4>Methods</h4>We engineered Tet-Off conditional transgenic mice expressing PARIS in dopaminergic neurons, driven by DAT-PF-tTA driver mice. The conditional PARIS transgenic mice were characterized by PD-associated pathologies, including progressive dopamine cell loss, neuroinflammation, PGC-1α repression, and mitochondrial proteome alteration. Motor impairment was assessed using pole and rotarod tests. L-DOPA and c-Abl inhibitors were administered to PARIS transgenic mice to evaluate their therapeutic efficacy. The transcriptomic profiles and gene ontology clusters were analyzed by bulk and single-nucleus RNA-seq for the ventral midbrains from PARIS transgenic and age-matched controls.<h4>Results</h4>Conditional dopaminergic PARIS expression in mice led to the robust and selective dopaminergic neuron degeneration, neuroinflammation, and striatal dopamine deficits, resulting in L-DOPA-responsive motor impairments. Consistent with the results of previous reports, PARIS suppressed dopaminergic PGC-1α expression, disturbed mitochondrial marker protein expression, and reduced COXIV-labeled mitochondria in dopamine neurons. Pharmacological inhibition of c-Abl activity in PARIS transgenic mice largely prevents PD-associated pathological features. Unbiased transcriptomic analysis revealed PARIS-regulated differentially expressed genes (DEGs), both collectively and in a cell-type-specific manner, along with enriched biological pathways linked to PD pathogenesis. Single-cell resolution transcriptomic analysis confirmed repression of PGC-1α and several mitochondria-related target genes in dopaminergic cells. Additionally, we identified distinct glial cell subpopulations and DEGs associated with PD pathogenesis.<h4>Conclusions</h4>Conditional PARIS transgenic mice recapitulate robust and dopaminergic neuron-selective pathological features of PD, allowing the preclinical evaluation of antisymptomatic and disease-modifying therapeutic strategies within a couple of months. Based on this new PD mouse model, we provide unbiased bulk and single-nucleus transcriptomic profiles that are regulated by PARIS and potentially contribute to PD pathogenesis. A PD mouse model with flexible pathology induction capacity and a whole transcriptome could serve as a useful resource for translational PD research.

OLFM4
Also flagged:Thrombinextracellularvesiclesgastrointestinal diseaseNECIL-1α
Journal Article 2025-02-28 ✓ 5 Snippets Hwang S, Sung SI, Kim YE, Yang M, Koh A, Ahn SY, Chang YS.
In-Text Gene Mentions

…SC-EVs significantly increasedOLFM4and claudin-4 expression…

…of E-cadherin, MUC2,OLFM4, villin, and chromogranin…

…(1:1000; Abcam), andOLFM4(1:1000; Cell Signaling,…

…genes olfactomedin 4 (OLFM4), leucine-rich repeat-contain…

…expression levels ofOLFM4and LGR5 were…

Show Full Abstract

<h4>Background</h4>Necrotizing enterocolitis (NEC) is a critical gastrointestinal disease in preterm infants, for which no specific treatment is established. We previously demonstrated that thrombin-preconditioned mesenchymal stromal cell-derived extracellular vesicles (thMSC-EVs) enhance protection against other neonatal tissue injuries. Therefore, this study aimed to evaluate the therapeutic potential of thMSC-EVs in modified in vitro, in vivo, and organoid models of NEC.<h4>Methods</h4>In vitro, the effects of thMSC-EVs and naïveMSC-EVs were compared in hyperosmotic, ischemic, and hypothermic (HIT)-stressed IEC-6 cells and LPS-treated peritoneal macrophages. In vivo, NEC was induced in P4 mouse pups by three cycles of formula feeding, oral LPS administration, hypoxia, and hypothermia, followed by overnight dam care. 2 × 10<sup>9</sup> thMSC-EVs were intraperitoneally administered daily for three days, and the therapeutic effects were assessed macroscopically, histologically, and biochemically. NEC mouse-derived organoids were established to evaluate the thMSC-EVs' effect in mature enterocytes. LC-MS/MS was performed to analyze the EV proteomics.<h4>Results</h4>In vitro, compared with naïveMSC-EVs, thMSC-EVs significantly improved cellular viability in HIT-induced IEC-6 cells and reduced pro-inflammatory (IL-1α, IL-1β, TNF-α) but increased anti-inflammatory (TGF-b) cytokine levels in LPS-treated peritoneal macrophages. In vivo, thMSC-EVs significantly attenuated clinical symptoms, reduced intestinal damage, and retained intestinal stem cell markers, showing more significant localization in NEC-induced intestines than in healthy intestines. In NEC mouse-derived organoids, thMSC-EVs significantly increased OLFM4 and claudin-4 expression and reduced stress-related markers such as sucrase-isomaltase, defensin, and chromogranin A. Proteomic analysis revealed that thMSC-EVs were greater enriched in anti-apoptotic, anti-inflammatory, cell adhesion, and Wnt signaling pathways than naïveMSC-EVs.<h4>Conclusion</h4>thMSC-EVs improved cellular viability, reduced apoptosis, attenuated inflammation, and upregulated key intestinal stem cell markers, collectively suggesting their tissue-protective effects and highlighting their potential as a treatment for NEC.

POU3F2
Also flagged:neuropsychiatric disordergene expressionAlcohol Use Disorderalcoholalcohol abusedeath
Journal Article 2025-02-28 ✓ 1 Snippet Warden AS, Salem NA, Brenner E, Sutherland GT, Stevens J, Kapoor M, Goate AM, Mayfield RD.
In-Text Gene Mentions

POU3F2

Show Full Abstract

<h4>Background</h4>Alcohol use disorder (AUD) is a prevalent neuropsychiatric disorder that is a major global health concern, affecting millions of people worldwide. Previous studies of AUD used underpowered single-cell analysis or bulk homogenates of postmortem brain tissue, which obscure gene expression changes in specific cell types. Therefore, we sought to conduct the largest-to-date single-nucleus RNA sequencing (snRNA-seq) postmortem brain study in AUD to elucidate transcriptomic pathology with cell type-specific resolution.<h4>Methods</h4>Here, we performed snRNA-seq and high-dimensional network analysis of 73 postmortem samples from individuals with AUD (n = 36, n<sub>nuclei</sub> = 248,873) and neurotypical control individuals (n = 37, n<sub>nuclei</sub> = 210,573) in the dorsolateral prefrontal cortex from both male and female donors. Additionally, we performed analysis for cell type-specific enrichment of aggregate genetic risk for AUD as well as integration of the AUD proteome for secondary validation.<h4>Results</h4>We identified 32 distinct cell clusters and found widespread cell type-specific transcriptomic changes across the cortex in AUD, particularly affecting glial populations. We found the greatest dysregulation in novel microglial and astrocytic subtypes that accounted for the majority of differential gene expression and coexpression modules linked to AUD. Differential gene expression was secondarily validated by integration of a publicly available AUD proteome. Finally, analysis for aggregate genetic risk for AUD identified subtypes of glia as potential key players not only affected by but also causally linked to the progression of AUD.<h4>Conclusions</h4>These results highlight the importance of cell type-specific molecular changes in AUD and offer opportunities to identify novel targets for treatment on the single-nucleus level.

HFE
Also flagged:waterSlc30a10Dmt1FpntamoxifenERT2
Journal Article 2025-02-28 ✓ 1 Snippet Prajapati M, Zhang JZ, Chong GS, Chiu L, Mercadante CJ, Kowalski HL, Antipova O, Lai B, Ralle M, Jackson BP, Punshon T, Guo S, Aghajan M, Bartnikas TB.
In-Text Gene Mentions

…levels in thehemochromatosismouse model.<h4>Conclusions</h…

Show Full Abstract

<h4>Background & aims</h4>SLC11A2 (DMT1) and SLC40A1 (ferroportin) are essential for dietary iron absorption, but their role in manganese transport is debated. SLC30A10 deficiency causes severe manganese excess due to loss of gastrointestinal manganese excretion. Patients are treated with chelators but also respond to oral iron, suggesting that iron can outcompete manganese for absorption in this disease. Here, we determine if divalent metal transport 1 (Dmt1) and ferroportin can transport manganese using Slc30a10-deficient mice as a model.<h4>Methods</h4>Manganese absorption and levels and other disease parameters were assessed in Slc30a10<sup>-/-</sup> mice with and without intestinal Dmt1 and ferroportin deficiency using gastric gavage, surgical bile collections, multiple metal assays, and other techniques. The contribution of intestinal Slc30a10 deficiency to ferroportin-dependent manganese absorption was explored by determining if intestinal Slc30a10 deficiency increases manganese absorption in a mouse model of hereditary hemochromatosis, a disease of iron excess due to ferroportin upregulation.<h4>Results</h4>Manganese absorption was increased in Slc30a10-deficient mice despite manganese excess. Intestinal Dmt1 and ferroportin deficiency attenuated manganese absorption and excess in Slc30a10-deficient mice. Intestinal Slc30a10 deficiency increased manganese absorption and levels in the hemochromatosis mouse model.<h4>Conclusions</h4>Aberrant absorption contributes prominently to SLC30A10 deficiency, a disease previously attributed to impaired excretion, and is dependent upon intestinal Dmt1 and ferroportin and exacerbated by loss of intestinal Slc30a10. This work expands our understanding of overlaps between manganese and iron transport and the mechanisms by which the body regulates absorption of 2 nutrients that can share transport pathways. We propose that a reconsideration of the role of Dmt1 and ferroportin in manganese homeostasis is warranted.

NEGR1
Also flagged:dementiacognitive declineADtaugene expressiontranscription factor
Journal Article 2025-02-28 ✓ 2 Snippets Soelter TM, Howton TC, Wilk EJ, Whitlock JH, Clark AD, Birnbaum A, Patterson DC, Cortes CJ, Lasseigne BN.
In-Text Gene Mentions

…However,Negr1and Stat3 were…

…Similarly,Negr1, which was…

Show Full Abstract

Alzheimer's disease (AD) is the most common form of dementia and is characterized by progressive memory loss and cognitive decline, affecting behavior, speech, and motor abilities. The neuropathology of AD includes the formation of extracellular amyloid-β plaques and intracellular neurofibrillary tangles of phosphorylated tau, along with neuronal loss. Although neuronal loss is an AD hallmark, cell-cell communication between neuronal and non-neuronal cell populations maintains neuronal health and brain homeostasis. To study changes in cell-cell communication during disease progression, we performed snRNA-sequencing of the hippocampus from female 3xTg-AD and wild-type littermates at 6 and 12 months. We inferred differential cell-cell communication between 3xTg-AD and wild-type mice across time points and between senders (astrocytes, microglia, oligodendrocytes, and OPCs) and receivers (excitatory and inhibitory neurons) of interest. We also assessed the downstream effects of altered glia-neuron communication using pseudobulk differential gene expression, functional enrichment, and gene regulatory analyses. We found that glia-neuron communication is increasingly dysregulated in 12-month 3xTg-AD mice. We also identified 23 AD-associated ligand-receptor pairs that are upregulated in the 12-month-old 3xTg-AD hippocampus. Our results suggest increased AD association of interactions originating from microglia. Signaling mediators were not significantly differentially expressed but showed altered gene regulation and transcription factor activity. Our findings indicate that altered glia-neuron communication is increasingly dysregulated and affects the gene regulatory mechanisms in neurons of 12-month-old 3xTg-AD mice.

Also flagged:LUADcancermethylationLung adenocarcinomalung cancertumor
Journal Article 2025-02-28 No Snippets He H, Wang L, Ma M.
Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is a highly heterogeneous cancer type with a poor prognosis. Accurate subtype identification can help guide its treatment. The traditional subtype identification methods using a single-omics approach make it difficult to comprehensively characterize the molecular features of LUAD. Identification of subtypes through multi-omics association strategies can effectively supplement the shortcomings of single-omics information.<h4>Methods</h4>In this study, we used the Generative Adversarial Network (GAN) to mine transcriptomic, proteomic, and epigenomic information and generate an integrated data set. The newly integrated data were then used to identify LUAD immune subtypes. In the improved GAN (MOGAN) method, we not only integrated multiple omics datasets but also included the interactions between proteins and genes and between methylation and genes. Thus, we achieved effective complementarity of multi-omics information.<h4>Results</h4>Two subtypes, MOGANTPM_S1 and MOGANTPM_S2, were identified using immune cell infiltration analysis and the integrated multi-omics data. MOGANTPM_S1 patients displayed higher immune cell infiltration, better prognosis, and sensitivity to immune checkpoint inhibitors (ICIs), while MOGANTPM_S2 had lower immune cell infiltration, poorer prognosis, and were insensitive to ICIs. Therefore, immunotherapy was more suitable for MOGANTPM_S1 patients in clinical practice. In addition, this study developed a LUAD subtype diagnostic model using the transcriptomic and proteomic features of five genes, which can be used to guide clinical subtype diagnosis.<h4>Conclusions</h4>In summary, the MOGAN method was applied to integrate three omics data types and successfully identify two LUAD immune subtypes with significant survival differences. This classification method may be useful for LUAD treatment decisions.

SOX6
Also flagged:SOX 6Diabetic NephropathyDNrenal diseasecreatininemembrane
Journal Article 2025-02-28 ✓ 5 Snippets Arslan G, Karabulut YY, Yeleser İ, Erdal ME, Demir S, Özdemir AA.
In-Text Gene Mentions

…the expression ofSOX6increases, hsa-miR-342-3p expr…

…Time PCR andSOX6expression by immunohistochemi…

…of hsa-miR-342-3p andSOX6was demonstrated.…

SOX6genetic expression was…

…Immunohistochemically,SOX6staining was observed…

Show Full Abstract

Diabetic nephropathy (DN) is one of the leading causes of end-stage renal disease. The most popular biomarkers in current research on DN are microRNAs. There are studies showing that while the expression of SOX6 increases, hsa-miR-342-3p expression decreases in kidney tissues with DN. The current study evaluated hsa-miR-342-3p expression by Real Time PCR and SOX6 expression by immunohistochemistry in a cohort of 110 DN biopsies, as well as their relationship with various clinical and histomorphological parameters. An inverse relationship between expression of hsa-miR-342-3p and SOX6 was demonstrated. SOX6 genetic expression was correlated with serum creatinine and tubular basement membrane thickening. Immunohistochemically, SOX6 staining was observed in mesangial cells and podocytes in 21 patients, with tubular staining in 45, and interstitial staining in 27 patients. Tubular staining was associated with proteinuria, interstitial fibrosis and inflammation; interstitial staining was associated with creatinine; and staining in the glomerular compartment was associated with advanced DN class. Our study is the first in the literature in which SOX6 was applied immunohistochemically in human kidney tissue, and its relation with DN classes was examined. We demonstrate its correlation with laboratory and histomorphological parameters, and provide a rational basis for future studies on larger patient groups that may result in the development of new biomarkers to predict the progression of DN and enhance its treatment.

SOX6
Also flagged:BCL11ANTN5OGNPapillary Renal Cell CarcinomasPRCCrenal clear cell carcinomas
Journal Article 2025-02-28 ✓ 1 Snippet Haghshenas Z, Fathi S, Ahmadzadeh A, Nazari E.
In-Text Gene Mentions

…family, such asSOX6, SOX12, and SOX2,…

Show Full Abstract

The prevalence of papillary renal cell carcinomas (PRCCs) is estimated to be between 10% and 15%. At present, there is no effective therapeutic approach available for patients with advanced PRCCs. The molecular biomarkers associated with PRCC diagnoses have been rarely studied compared to renal clear cell carcinomas; therefore, the necessity for the identification of novel molecular biomarkers to aid in the early identification of this disease. Bioinformatics and artificial intelligence technologies have become increasingly important in the search for diagnostic biomarkers for early cancer detection. In this study, three genes-BCL11A, NTN5, and OGN-were identified as diagnostic biomarkers using the Cancer Genome Atlas (TCGA) database and deep learning techniques. To identify the differential expression genes (DEGs), ribonucleic acid (RNA) expression profiles of PRCC patients were analyzed using a machine learning approach. A number of molecular pathways and coexpressions of DEGs have been analyzed and a correlation between DEGs and clinical data has been determined. Diagnostic markers were then determined via machine learning analysis. The 10 genes selected with the highest variable importance value (more than 0.9) were further investigated, with six upregulated (BCL11A, NTN5, SEL1L3, SKA3, TAPBP, SEMA6A) and four downregulated (OGN, ADCY4, SMOC2, CCL23). A combined receiver operating characteristic (ROC) curve analysis revealed that the BCL11A-NTN5-OGN genes, which have specificity and sensitivity values of 0.968 and 0.901, respectively, can be used as a diagnostic biomarker for PRCC. In general, the genes introduced in this study may be used as diagnostic biomarkers for the early diagnosis of PRCC, thus providing the possibility of early treatment and preventing the progression of the disease.

BTN2A1
Also flagged:diffuse midline gliomareceptortumorpamidronateGliomasdiffuse midline gliomas
Journal Article 2025-02-28 ✓ 5 Snippets Vazaios K, Hernández López P, Aarts-Riemens T, Daudeij A, Kemp V, Hoeben RC, Straetemans T, Hulleman E, Calkoen FG, van der Lugt J, Kuball J.
In-Text Gene Mentions

…infected cells viaBTN2A1and BTN3A.…

…the expression ofBTN2A1and BTN3A can…

…DMG, which expressesBTN2A1and BTN3A at…

…of BTN3A—but notBTN2A1—in DMG.…

…the butyrophilin 2A1 (BTN2A1) [ 4 ]…

Show Full Abstract

Due to the minimal survival benefits of existing therapies for pediatric diffuse midline glioma (DMG) patients, new therapeutic modalities are being investigated. Immunotherapies such as CAR-T cells and oncolytic viruses (OVs) are part of these efforts, as evidenced by the increasing number of clinical trials. αβ T cells engineered with a high-affinity γ9δ2 T-cell receptor (TEGs) are immune cells designed to target metabolic changes in malignant or virally infected cells via BTN2A1 and BTN3A. Because the expression of BTN2A1 and BTN3A can be altered in tumor and infected cells, combining TEGs and OVs could potentially enhance the anti-tumor response. We investigated this hypothesis in the following study. We demonstrate that TEGs can indeed target DMG, which expresses BTN2A1 and BTN3A at varying levels, and that OVs can further enhance the expression of BTN3A-but not BTN2A1-in DMG. Functionally, TEGs killed DMG cell cultures, and this killing was further increased after OV infection of the DMGs with either adenovirus Δ24-RGD or reovirus R124 under suboptimal conditions. However, this additive effect was lost when γ9δ2 TCR-ligand interaction was boosted by pamidronate. This study demonstrates the additive effect of combining OVs and Vγ9Vδ2 TCR-engineered immune cells under suboptimal conditions and supports a combination strategy to enhance the efficacy of both therapeutic modalities.

ZNFX1
Also flagged:Diabetes mellituschronic metabolic disorderhyperglycemiaendoplasmic reticulumnucleotidespathogenesis
Journal Article 2025-02-28 ✓ 1 Snippet Li L, Wu YQ, Yang JE.
In-Text Gene Mentions

ZNFX1antisense RNA 1…

Show Full Abstract

Diabetes mellitus (DM) is a chronic metabolic disorder and one of the most significant global health burdens worldwide. Key pathophysiological mechanisms underlying its onset and associated complications include hyperglycemia-related stresses, such as oxidative stress and endoplasmic reticulum stress (ER stress). Long non-coding RNAs (lncRNAs), defined as RNA transcripts longer than 200 nucleotides and lacking protein-coding capacity, play crucial roles in various biological processes and have emerged as crucial regulators in the pathogenesis of diabetes. This review provides a comprehensive overview of lncRNA biogenesis and its functional roles, emphasizing recent findings that link stress-related lncRNAs to diabetic pathology and complications. Also, we discuss how lncRNAs influence diabetes and its complications by modulating pathways involved in cell death, proliferation, inflammation, and fibrosis, which contribute to pancreatic β cell dysfunction, insulin resistance, diabetic nephropathy, and retinopathy. By analyzing current research, we aim to enhance understanding of lncRNA involvement in diabetes while identifying potential therapeutic targets and guiding future research directions to elucidate the complex mechanisms underlying this pervasive condition.

HFE
Also flagged:iron-deficiency anemiacancerferric derisomaltoseAMLferricderisomaltose
Journal Article 2025-02-28 ✓ 1 Snippet Sohn SH, Sul H, Kim B, Zang D.
In-Text Gene Mentions

…family history ofhemochromatosis; (9) Previous hypersensitivit…

Show Full Abstract

Functional iron-deficiency anemia (FIDA) is a side effect of many cancer treatments, occurring when chemotherapy drugs damage bone marrow cells, which are responsible for producing red blood cells, due to the myelosuppressive effects of chemotherapy, or to the cancer itself. This study was performed to compare the effects of darbepoetin alfa alone, or in combination with ferric derisomaltose in cancer patients with FIDA, and to elucidate the mechanism underlying the effects in F36E cells. F36E cells treated with darbepoetin alfa showed increased cell viability. AML and GC cells treated with darbepoetin alfa, ferric derisomaltose, or ferric derisomaltose plus darbepoetin alfa showed no induction of apoptosis. The effects of these drugs on the anticancer efficacy of PTX chemotherapy were examined by analyzing cell viability and induction of apoptosis. Darbepoetin alfa, ferric derisomaltose, and ferric derisomaltose plus darbepoetin alfa showed no significant inhibitory effects on the apoptosis-inducing activity of PTX in GC cell lines. Patients with chemotherapy-induced FIDA in Group I receiving ferric derisomaltose plus darbepoetin alfa showed higher hemoglobin levels, transferrin saturation, and ferritin levels compared to those in Group II, treated with darbepoetin alfa alone. In cancer patients with FIDA, the prognosis of anemia treatment was better in the ferric derisomaltose plus darbepoetin alfa combination group than in the group receiving darbepoetin alfa monotherapy.

HTT
Also flagged:neurological diseasestranslationalCentral Nervous System Diseasesneurological disorderscapsidneurological disease
Journal Article 2025-02-28 ✓ 1 Snippet Wang S, Xiao L.
In-Text Gene Mentions

…mutatedHTTprotein…

Show Full Abstract

As the blood-brain barrier (BBB) prevents molecules from accessing the central nervous system (CNS), the traditional systemic delivery of chemical drugs limits the development of neurological drugs. However, in recent years, innovative therapeutic strategies have tried to bypass the restriction of traditional drug delivery methods. In vivo gene therapy refers to emerging biopharma vectors that carry the specific genes and target and infect specific tissues; these infected cells and tissues then undergo fundamental changes at the genetic level and produce therapeutic proteins or substances, thus providing therapeutic benefits. Clinical and preclinical trials mainly utilize adeno-associated viruses (AAVs), lentiviruses (LVs), and other viruses as gene vectors for disease investigation. Although LVs have a higher gene-carrying capacity, the vector of choice for many neurological diseases is the AAV vector due to its safety and long-term transgene expression in neurons. Here, we review the basic biology of AAVs and summarize some key issues in recombinant AAV (rAAV) engineering in gene therapy research; then, we summarize recent clinical trials using rAAV treatment for neurological diseases and provide translational perspectives and future challenges on target selection.

Also flagged:polyesterN-acetylglucosamineCancercardiovascular diseasestumors
Journal Article 2025-02-28 No Snippets Shaikh A, Salve R, Sengar D, Gajbhiye V.
Show Full Abstract

Cancer, ranking just below cardiovascular diseases, is a leading cause of mortality worldwide. The key to enhancing survival rates among cancer patients lies in the early detection, removal, and treatment of tumors. However, the broad-spectrum nature of current treatments, including chemotherapy and radiation therapy, results in significant collateral damage to healthy cells and tissues. In this context, hyperbranched polymers present a promising avenue for more targeted therapy. These polymers can be loaded with chemotherapeutic drugs and modified with specific ligands to selectively target cancer cells via glucose transporters, which are overexpressed in many cancer types. To enhance the delivery of drugs to cancer cells, we have engineered an N-acetyl glucosamine conjugated version of this polymer. The characterization of these nanocarriers was evaluated using various techniques, including <sup>1</sup>H NMR, dynamic light scattering, and FTIR spectroscopy. Additionally, confocal microscopy was utilized to compare the accumulation of doxorubicin in cancer cells using both the N-acetyl glucosamine-conjugated and unmodified versions of H40 Boltorn™. Our observations indicated a superior accumulation of doxorubicin in cells treated with the modified H40 polymer. Further evaluation of the drug-loaded nanocarriers was conducted on MDA-MB-231 and 4T1 breast cancer cell lines, focusing on their cytotoxic effects. This suggests that the targeted delivery of anticancer drugs using the modified H40 Boltorn™ nanocarriers significantly enhances the ability to kill breast cancer cells, offering a more efficient and selective approach to chemotherapy that minimizes impact on healthy tissues and cells.

HFE
Also flagged:Metabolic syndromestrokecardiovascular diseasesCVDtype 2 diabetesnon-alcoholic fatty liver disease
Journal Article 2025-02-28 ✓ 1 Snippet Amirkalali B, Hassanzadeh P, Sheikholmolooki F, Gholizadeh E, Doustmohammadian A, Safarnezhad Tameshkel F, Motamed N, Maadi M, Sohrabi M, Sobhrakhshankhah E, Zamani F, Ajdarkosh H.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, viral infections, alcoholic…

Show Full Abstract

<h4>Introduction</h4>This study investigates the subclasses of metabolic syndrome (Mets) and their relationship with non-alcoholic fatty liver (NAFLD) and the probable predictive role of serum vitamin D and CRP levels.<h4>Methods</h4>This community-based, cross-sectional study was performed on adults in the framework of the Amol cohort prospective study (AmolCPS). Mets was defined as Adult Treatment Panel III criteria (ATP III) and ultrasound was used to diagnose NAFLD. Anthropometric and blood pressure measurements were conducted, and biochemical measurements were assessed after fasting. Data analysis included Latent class analysis, two-tailed χ2 statistics, one-way analysis of variance, and logistic regression using Mplus (version 7.4) and spss (version 26) softwares.<h4>Results</h4>The study involved 2308 participants, with a mean age of 43.17 ± 12.30 years. Mets prevalence was 25.64%, with three identified classes: Mets with Hypertension (HTN), Mets without HTN (Non-HTN), and Low Risk. Mets with HTN had a high probability of at least four components, particularly high SBP. Non-HTN had at least three high probable components, especially high TG and low HDL but not high SBP and DBP. The low-risk class had a low probability of all components except low HDL in women. Serum vitamin D and CRP levels did not significantly predict Mets classes in men, while CRP level significantly predicted the HTN class in women (OR:1.03, CI:1.004-1.067). Both HTN, and Non-HTN Mets classes significantly increased the odds of NAFLD compared to the low risk class, especially in women (HTN class OR: 4.20 vs 2.94; non-HTN class OR: 5.60 vs 3.12 in women and men respectively).<h4>Conclusion</h4>The latent class analysis in northern Iran identified three Mets classes: HTN, Non-HTN, and low-risk, with hypertension playing a crucial role in determining these classes. These classes were stronger predictors of NAFLD in women. Serum CRP and vitamin D levels did not emerge as significant predictors of the classes, except for serum CRP in the HTN class among women.

Also flagged:intrahepatic cholangiocarcinomaextrahepatic cholangiocarcinomaCholangiocarcinomaCCliver cancermalignant tumors
Journal Article 2025-02-28 No Snippets Medha R, Sreeram PSS, Daaboul O, Sophia D, Rahul S, Adejoke J, Ayesha C, Umer TM, Sharjeel AHM.
Show Full Abstract

<h4>Background</h4>A comprehensive review of 45-year trends in intrahepatic cholangiocarcinoma (ICC) and extrahepatic cholangiocarcinoma (ECC) in the United States has not been published. Given their rising incidence, our study aimed to analyze trends in incidence and survival, comparing ICC and ECC.<h4>Methods</h4>We extracted a 45-year dataset (1975-2020) from the Surveillance, Epidemiology, and End Results database. Age-adjusted incidence rates were calculated using SEERStat®. Annual Percent Change (APC) was estimated via weighted least squares. Relative survival (1- and 5-year) was calculated using the Ederer II method and compared across sexes and races.<h4>Results</h4>A significant rise in ICC and ECC incidence was observed in both sexes (APC 3.71 for ICC vs. 6.16 for ECC; P<0.001). In females, ECC incidence increased more than ICC (APC 5.96 vs. 4.09, P<0.05), whereas males showed a fluctuating ECC trend and a steady ICC rise. Survival rates significantly improved across all races and sexes (P<0.05). ICC survival rose from 17.45% to 41.41% (1-year) and 2.83% to 10.99% (5-year), while ECC increased from 30.33% to 41.12% (1-year) and 5.96% to 10.44% (5-year). Among white and other-race females, ECC showed less improvement than ICC. Black individuals lacked statistically significant data.<h4>Conclusions</h4>Our study highlights disparities in ICC and ECC incidence, with higher rates in males, but better survival for ECC in males and ICC in females. The underrepresentation of Black individuals warrants further study to explore contributing factors such as risk, access to care, and treatment.

Also flagged:TAR DNA-binding protein 43 kDaTDP-43proteinopathiesneurodegenerative diseasesamyotrophic lateral sclerosisfrontotemporal lobar degeneration
Journal Article 2025-02-28 No Snippets Stella R, Bertoli A, Lopreiato R, Peggion C.
Show Full Abstract

TAR DNA-binding protein 43 kDa (TDP-43) proteinopathies are a group of neurodegenerative diseases (NDs) characterized by the abnormal accumulation of the TDP-43 protein in neurons and glial cells. These proteinopathies are associated with several NDs, including amyotrophic lateral sclerosis, frontotemporal lobar degeneration, and some forms of Alzheimer's disease. Yeast models have proven valuable in ND research due to their simplicity, genetic tractability, and the conservation of many cellular processes shared with higher eukaryotes. For several decades, <i>Saccharomyces cerevisiae</i> has been used as a model organism to study the behavior and toxicity of TDP-43, facilitating the identification of genes and pathways that either exacerbate or mitigate its toxic effects. This review will discuss evidence showing that yeast models of TDP-43 exhibit defects in proteostasis, mitochondrial function, autophagy, and RNA metabolism, which are key features of TDP-43-related NDs. Additionally, we will explore how modulating proteins involved in these processes reduce TDP-43 toxicity, aiding in restoring normal TDP-43 function or preventing its pathological aggregation. These findings highlight potential therapeutic targets for the treatment of TDP-43-related diseases.

PLCL1
Also flagged:MethamphetamineGene ExpressionTatneurocognitive impairmenttransactivator of transcriptionbehavioral
Journal Article 2025-02-28 ✓ 1 Snippet Harahap-Carrillo IS, Fok D, Wong F, Malik G, Maung R, Qiu X, Ojeda-Juárez D, Thaney VE, Sanchez AB, Godzik A, Roberts AJ, Kaul M.
In-Text Gene Mentions

…, Pkd1 ,Plcl1, Pkhd1l1 ,…

Show Full Abstract

Methamphetamine (METH) use is frequent among people with HIV (PWH) and appears to increase the risk of neuronal injury and neurocognitive impairment (NCI). This study explored in vivo the effects of a 12 week (long-term), low-dose METH regimen in a transgenic animal model of neuroHIV with inducible expression of HIV-1 transactivator of transcription (Tat). Seven months after transient Tat induction and five months after METH exposure ended, we detected behavioral changes in the Barnes maze (BM) spatial memory task in the Tat and METH groups but not the combined Tat + METH group. The novel object recognition (NOR) task revealed that Tat extinguished discrimination in female animals with and without METH, although METH alone slightly improved NOR. In contrast, in males, Tat, METH, and Tat + METH all compromised NOR. Neuropathological examination detected sex-dependent and brain region-specific changes of pre-synaptic terminals, neurites, and activation of astrocytes and microglia. RNA-sequencing and quantitative reverse transcription polymerase chain reaction indicated that METH and Tat significantly altered gene expression, including factors linked to Alzheimer's disease-like NCI. In summary, chronic low-dose METH exerts long-term effects on behavioral function, neuropathology, and mRNA expression, and modulates the effects of Tat, suggesting sex-dependent and -independent mechanisms may converge in HIV brain injury and NCI.

PRDX6
Also flagged:Strokedeathbrain injuryIschemic strokesoxygenHemorrhagic stroke
Journal Article 2025-02-28 ✓ 1 Snippet Shannon GS, Rinendyaputri R, Sunarno S, Malik A.
In-Text Gene Mentions

…the antioxidant enzymePRDX6, thereby combating oxidative…

Show Full Abstract

Stroke, particularly ischemic stroke, is a leading cause of global mortality and disability. It is caused by blood flow obstruction and reduced oxygen delivery to brain tissue. Conventional treatments, such as tissue plasminogen activator (tPA) and mechanical thrombectomy (MT), have limited efficacy in repairing neural damage and carry risks of adverse effects. As a result, stem cell therapies, including mesenchymal stem cells (MSCs), have emerged as promising approaches for enhancing neural recovery and offering neuroprotection in ischemic stroke management. MSCs offer multifaceted benefits, such as reducing inflammation, protecting neurons, and promoting angiogenesis and neurogenesis. Recent evidence highlights the importance of MSC secretomes-extracellular vesicles (EVs) and exosomes rich in neuroprotective factors, such as microRNAs, proteins, and cytokines. These bioactive molecules demonstrated considerable efficacy in preclinical models by reducing neuroinflammation, preserving neurovascular integrity, and promoting cellular repair in ischemic environments. Preclinical <i>in vitro</i> and <i>in vivo</i> studies demonstrate the potential of the MSC secretomes to restore brain function after ischemic stroke. This is achieved by enhancing neuronal survival through mechanisms such as angiogenesis or vascular recovery, neuroprotection including modulation of immune or inflammatory responses, apoptosis, and autophagy, and promoting post-stroke neurogenesis. This review explores the translational challenges and future potential of integrating conventional ischemic stroke therapies with stem cell-based or cell-free approaches. The present study synthesizes current insights into the role of MSC-derived secretomes from both <i>in vitro</i> and <i>in vivo</i> studies.

SERPINC1
Also flagged:vitamin Kacute cerebral venous sinus thrombosisalbuminfibrinogen2 infectionvenous thromboembolism
Journal Article 2025-02-28 ✓ 1 Snippet Smit ER, Kreft IC, Camilleri E, Burggraaf-van Delft JLI, van Rein N, van Vlijmen BJM, Hulshof AM, van Bussel BCT, van Rosmalen F, van der Zwaan C, van de Berg T, Henskens Y, Ten Cate H, Coutinho JM, Kruip MJHA, Eikenboom JJC, Hoogendijk AJ, Cannegieter SC, van den Biggelaar M, in collaboration with BEAT-COVID group and Dutch COVID & Thrombosis Coalition.
In-Text Gene Mentions

…(ALB) and antithrombin (SERPINC1) ( Figure 2…

Show Full Abstract

<h4>Background</h4>The elevated health burden of thromboembolic events necessitates development of blood-based risk monitoring tools.<h4>Objectives</h4>We explored the potential of mass spectrometry-based plasma proteomics to provide insights into underlying plasma protein signatures associated with treatment and occurrence of thromboembolic events.<h4>Methods</h4>Utilizing a high-throughput, data-independent acquisition, discovery-based proteomics workflow, we analyzed 434 plasma proteomes from different groups of individuals with elevated risk of thromboembolic events, including individuals I) on vitamin K antagonists (VKAs; <i>n</i> = 130), II) with a prior venous thromboembolism (<i>n</i> = 10), III) with acute cerebral venous sinus thrombosis (<i>n</i> = 10, and IV) with SARS-CoV-2 infection (<i>n</i> = 67). Plasma protein levels measured with mass spectrometry were correlated with international normalized ratio and conventional clinical laboratory measurements. Plasma profile differences between different groups were assessed using principal component analysis, moderated <i>t</i>-test, and clustering analysis.<h4>Results</h4>Plasma protein levels were in agreement with conventional clinical laboratory parameters, including albumin and fibrinogen. Levels of vitamin K-dependent proteins inversely correlated with international normalized ratio. In the individual studies, we found decreased levels of vitamin K-dependent coagulation proteins in patients on VKAs, alterations in inflammatory signatures among CVST patients and a distinctive signature indicative of SARS-CoV-2 infection. However, no protein signature associated with a thromboembolic event could be identified neither in individual nor combined studies.<h4>Conclusion</h4>Although VKA treatment-specific and disease-specific signatures were captured, our study highlights that the challenges of discovering biomarkers in patients at risk of thromboembolic events lie in the heterogeneity of individual plasma profiles in relation to treatment and etiology.

Also flagged:chronic hepatitis E viral infectionchronichepatitis E virus infectionHepatitis Eliver diseaseacute hepatitis
Journal Article 2025-02-28 No Snippets Shafat Z, Ahmed M, Farooqui A, Khan N, Parveen S.
Show Full Abstract

Hepatitis E virus (HEV) is an emerging zoonotic pathogen and it is associated with chronic hepatitis E virus infection (CHE) in immuno-suppressed patients due to failure of viral clearance. A network of the CHE-associated-differentially expressed genes (DEGs) is known. Hence, a comprehensive assessment of the known protein-protein interaction (PPI) network is of interest. After network clustering, the hub gene-associated microRNAs (miRNAs) were explored and subsequently, these identified miRNAs (miR-129-2-3p, miR-130a-3p, miR-138-5p, miR-212-3p, miR-221-3p, miR-27b-3p and miR-29c-3p) were undertaken for enrichment analysis. It should be noted that these miRNAs are significantly associated with Hepatitis E virus infection for further validation and analysis.

Also flagged:Pulmonary arteriovenous malformationsCyanosisHereditary hemorrhagic telangiectasisHHTcardiac amyloidosisCA
Journal Article 2025-02-28 No Snippets Namirah NA, Nugraha NF, Nadiah Z, Haryawan ZL, Panggabean A.
Show Full Abstract

Pulmonary arteriovenous malformations (PAVMs) is a rare condition involving an abnormal connection of the pulmonary vasculature between the artery and vein, bypassing the capillary structure and causing a right-to-left shunt (RLS) of blood flow. This case report describes a 17-year-old female patient presenting with recurrent nose and tongue bleeding. Cyanosis and clubbing of the fingers were observed, along with visible telangiectasis on the skin and mucosal surfaces. Hereditary hemorrhagic telangiectasis (HHT) was diagnosed based on the Curaçao criteria. The RLS manifestations suggested a high probability of PAVM, confirmed by an agitated saline test showing a positive bubble appearance after four beats from the pulmonary vein to the left ventricle. An increased intraventricular wall diameter (19 mm) with a granular sparkling appearance indicated potential cardiac amyloidosis (CA). Speckle tracking echocardiography (STE) revealed a 'cherry-like' appearance in a 'bull's eye' pattern. This case illustrates a diagnostic approach for PAVM in an adolescent HHT patient with suspected CA in a rural setting using limited resources.

Also flagged:gemcitabineWNTFGF9NSCLCcancercarcinoma
Journal Article 2025-02-27 No Snippets Du X, Luo W, Li H, Gu Q, Huang P, Wang C, Li N, Liu F, Xia C.
Show Full Abstract

<h4>Background</h4>Non-small cell lung cancer (NSCLC) is the leading cause of cancer morbidity and mortality worldwide. The prognosis of patients has been significantly improved by chemotherapy, but acquired drug resistance remains a major obstacle to NSCLC treatment. Circular RNAs (circRNAs), which act as miRNA or protein sponges, are critically associated with the development and chemotherapy resistance of NSCLC.<h4>Methods</h4>CircRNA sequencing was performed to analyze the differential expression of circRNAs between A549 and A549-GR cells. Chromogenic in situ hybridization (CISH) and immunohistochemistry (IHC) technologies were used to detect the expression of hsa_circ_0125356, miR-582-5p,and FGF9 in NSCLC tissues and para-carcinoma tissues. Fluorescence in situ hybridization (FISH), dual-luciferase reporter assays and RNA immunoprecipitation (RIP) were conducted to evaluate the expression and regulation of hsa_circ_0125356, miR-582-5p, and FGF9. Furthermore, the regulation of hsa_circ_0125356/miR-582-5p/FGF9 on gemcitabine sensitivity was confirmed by TUNEL, Transwell, EdU, CCK8 and immunohistochemistry.<h4>Results</h4>We identified a novel hsa_circ_0125356 as a therapeutic target against gemcitabine resistance. Hsa_circ_0125356 was significantly elevated in clinical samples of patients with NSCLC. Moreover, hsa_circ_0125356 overexpression promoted gemcitabine resistance to NSCLC by upregulating FGF9 via sponging miR-582-5p in vivo and in vitro. Notably, WNT canonical (ERK/GSK3β/β-catenin) and non-canonical (Daam1/RhoA/ROCK2) signaling pathways were activated due to hsa_circ_0125356 acting as an endogenous miR-582-5p sponge to regulate the expression of FGF9, and thereby enhancing gemcitabine resistance via promoting DNA damage repair and inhibition of apoptosis. The results were further confirmed by two small molecule antagonists, WAY 316606 and XAV-939,which could inhibit the activation of WNT signaling pathway induced by hsa_circ_0125356.<h4>Conclusion</h4>We first demonstrated that hsa_circ_0125356 was significantly upregulated and served as a biomarker for gemcitabine resistance in NSCLC by sponging miR-582-5p/FGF9 axis to regulate the WNT canonical and non-canonical signaling pathways, which provided a new direction for identification of therapeutic targets for the treatment of gemcitabine resistance of NSCLC.

Also flagged:collagennanohydroxyapatiteosteochondritis dissecanscorticosteroidshyaluronic acidglucosamine
Journal Article 2025-02-27 No Snippets Guo Y, Peng X, Cao B, Liu Q, Li S, Chen F, Zhi D, Zhang S, Chen Z.
Show Full Abstract

<h4>Aims</h4>A large number of surgical operations are available to treat osteochondral defects of the knee. However, the knee joint arthroplasty materials cannot completely mimic the articular cartilage and subchondral bone, which may bring some obvious side effects. Thus, this study proposed a biocompatible osteochondral repair material prepared from a double-layer scaffold of collagen and nanohydroxyapatite (CHA), consisting of collagen hydrogel as the upper layer of the scaffold, and the composite of CHA as the lower layer of the scaffold.<h4>Methods</h4>The CHA scaffold was prepared, and properties including morphology, internal structure, and mechanical strength of the CHA scaffold were measured by scanning electron microscopy (SEM) and a MTS electronic universal testing machine. Then, biocompatibility and repair capability of the CHA scaffold were further evaluated using a rabbit knee cartilage defect model.<h4>Results</h4>The CHA scaffold was well suited for the repair of articular cartilage and subchondral bone; the in vitro results showed that the CHA scaffold had good cytocompatibility. In vivo experiments demonstrated that the material had high biocompatibility and effectively induced cartilage and subchondral bone regeneration.<h4>Conclusion</h4>The CHA scaffold has a high potential for commercialization and could be used as an effective knee repair material in clinical applications.

SERPINC1
Also flagged:Cognitioncognitive declinecomplement proteinscoagulationextracellularSERPINF1
Journal Article 2025-02-27 ✓ 1 Snippet Donald AMH, de Almeida LGN, Dabaja MZ, Orchard I, Ybema K, Tsegai V, Armstrong V, Smith S, Young D, Longman RS, Tyndall AV, Rawling JM, Hill MD, Tsai WH, Agbani E, Poulin MJ, Dufour A.
In-Text Gene Mentions

SERPINC1, SERPIND1, SERPINF1, and…

Show Full Abstract

The physiological basis of cognitive decline remains largely uncharacterized. We identified a protein panel signature, in living humans, that correlates to improvement in neurocognition over a period of 5 years. Our signature is composed of complement proteins, coagulation cascade, and extracellular matrix regulators. In our cohort, SERPINF1 is associated with greater maximal oxygen uptake after an aerobic exercise intervention. Sleep quality is also a key factor in relation to inter-alpha-trypsin inhibitor heavy chain H2, which was associated with greater sleep efficiency. Additionally, we validate that the coagulation profile of decliners' plasma contains procoagulant agonists, leading to greater platelet activation. ANN NEUROL 2025;97:1007-1018.

MLLT10
Also flagged:acute undifferentiated leukemiaPICALM
Journal Article 2025-02-27 ✓ 1 Snippet Mastrodicasa E, Pagliaro L, Pierini V, Bardelli V, Giaimo M, Zamponi R, Montanaro A, Tragni K, Arcaleni R, Massei MS, Capolsini I, Perruccio K, Varotto E, Buldini B, Gherli A, Romoli S, Matteucci C, Crocioni M, Arcioni F, Gurdo G, Cerri C, Caniglia M, Roti G, La Starza R.
In-Text Gene Mentions

…ntiated leukemia with PICALM::MLLT10

Show Full Abstract

No abstract available.

HFE
Also flagged:iron overload disordernonironoverloadhyperferritinaemiaobesity
Journal Article 2025-02-27 ✓ 5 Snippets Zhang GD, Chen J, Johnstone DM, Delatycki MB, Allen K, Olynyk JK.
In-Text Gene Mentions

…overload, and predictsHFE‐related haemochromatosis with…

…the presence ofHFE‐related haemochromatosis, due…

…testing for theHFEp.Cys282Tyr mutation is…

…for almost allHFEhaemochromatosis in Australia,…

…, 14 IfHFE haemochromatosishaemochromatosis is excluded,…

Show Full Abstract

No abstract available.

Also flagged:CDKN2AcopperdeathSkin cutaneous melanomacancersskin cancer
Journal Article 2025-02-27 No Snippets Li J, Yang X, Yin C, Li S, Xu Y, Liu B.
Show Full Abstract

Skin cutaneous melanoma (SKCM) is one of the most lethal cancers translating into 75% of skin cancer-related deaths. Despite the advances in SKCM management and treatment strategies, the overall survival of patients remains unsatisfactory due to the metastatic properties of SKCM as well as the absence of effective prognostic biomarkers. Recent studies have shown that overload copper renders accumulation of mitochondrial proteins and fuels a form of cell death at odds with known death mechanisms and is hinged on mitochondrial respiration, the so-called cuproptosis. However, the exact role of cuproptosis in SKCM development and progression is unknown, and painting a clear picture of its functions in SKCM is fraught with challenges. A more systematic investigation is justified. In this study, we were posed to dissect the clout and latent regulatory mechanisms of cuproptosis-related genes (CRGs) in reining in SKCM progression. Also, we identified three CRGs that stood out were used to construct a prognostic model, which could be employed to predict the prognosis of patients with SKCM. Finally, through pan-cancer analysis, we found that the four cuproptosis key genes play a role in multiple tumors, suggesting that cuproptosis may impact tumor progression at the pan-cancer level. Taken together, these findings may not only contribute to the development of treatment strategies but also provide clues for treatment decision-making.

Also flagged:mitochondriaplatelet activationconnexin 43Cx43gap junctionsLYN
Journal Article 2025-02-27 No Snippets Gao C, Dai Y, Spezza PA, Boasiako P, Tang A, Rasquinha G, Zhong H, Shao B, Liu Y, Shi PA, Lobo CA, An X, Guo A, Mitchell WB, Manwani D, Yazdanbakhsh K, Mendelson A.
Show Full Abstract

Newly produced platelets acquire a low activation state, but whether the megakaryocyte plays a role in this outcome has not been fully uncovered. Mesenchymal stem cells (MSCs) were previously shown to promote platelet production and lower platelet activation. We found that healthy megakaryocytes transfer mitochondria to MSCs, which is mediated by connexin 43 (Cx43) gap junctions on MSCs and leads to platelets at a low energetic state with increased LYN activation, characteristic of resting platelets with increased LYN activation, characteristic of resting platelets. On the contrary, MSCs have a limited ability to transfer mitochondria to megakaryocytes. Sickle cell disease (SCD) is characterized by hemolytic anemia and results in heightened platelet activation, contributing to numerous disease complications. Platelets in SCD mice and human samples had a heightened energetic state with increased glycolysis. MSC exposure to heme in SCD led to decreased Cx43 expression and a reduced ability to uptake mitochondria from megakaryocytes. This prevented LYN activation in platelets and contributed to increased platelet activation at steady state. Altogether, our findings demonstrate an effect of hemolysis in the microenvironment leading to increased platelet activation in SCD. These findings have the potential to inspire new therapeutic targets to relieve thrombosis-related complications of SCD and other hemolytic conditions.

HTT
Also flagged:G3BP1axonsinjuryaxonpeptideamino acids
Journal Article 2025-02-27 ✓ 1 Snippet Sahoo PK, Agrawal M, Hanovice N, Ward PJ, Desai M, Smith TP, SiMa H, Dulin JN, Vaughn LS, Tuszynski MH, Welshhans K, Benowitz LI, English AW, Houle JD, Twiss JL.
In-Text Gene Mentions

…disrupt mutant Huntingtin’s (HTT) protein–protein interactions…

Show Full Abstract

Depletion or inhibition of core stress granule proteins, G3BP1 in mammals and TIAR-2 in <i>Caenorhabditis elegans</i>, increases the growth of spontaneously regenerating axons. Inhibition of G3BP1 by expression of its acidic or "B-domain" accelerates axon regeneration after nerve injury, bringing a potential therapeutic strategy for peripheral nerve repair. Here, we asked whether G3BP1 inhibition is a viable strategy to promote regeneration in injured mammalian central nervous system (CNS) where axons do not regenerate spontaneously. G3BP1 B-domain expression was found to promote axon regeneration in the transected spinal cord provided with a permissive peripheral nerve graft (PNG) as well as in crushed optic nerve. Moreover, a cell-permeable peptide (CPP) to a subregion of B-domain (rodent G3BP1 amino acids 190 to 208) accelerated axon regeneration after peripheral nerve injury and promoted regrowth of reticulospinal axons into the distal transected spinal cord through a bridging PNG. G3BP1 CPP promoted axon growth from rodent and human neurons cultured on permissive substrates, and this function required alternating Glu/Asp-Pro repeats that impart a unique predicted tertiary structure. The G3BP1 CPP disassembles axonal G3BP1, G3BP2, and FMRP, but not FXR1, granules and selectively increases axonal protein synthesis in cortical neurons. These studies identify G3BP1 granules as a key regulator of axon growth in CNS neurons and demonstrate that disassembly of these granules promotes retinal axon regeneration in injured optic nerve and reticulospinal axon elongation into permissive environments after CNS injury. This work highlights G3BP1 granule disassembly as a potential therapeutic strategy for enhancing axon growth and neural repair.

Also flagged:collagenmineralizationbiomineralbiomineralsmineralbinding
Journal Article 2025-02-27 No Snippets Shen M, Zhang C, Zhang Y, Lu D, Yuan J, Wang Z, Wu M, Zhu M, Chen Q.
Show Full Abstract

Mesoscale building blocks are instrumental in bridging multilevel hierarchical mineralization, endowing macroscale entities with remarkable functionality and mechanical properties. However, the mechanism orchestrating the homogeneous morphology of mesoscale mineralized motifs in collagen-based hard tissues remains unknown. Here, utilizing avian tendons as a mineralization model, we reveal a robust correlation between the mesoscale mineralized spherules and the presence of phosvitin. By designing a phosvitin-stabilized biomineral cluster medium, we replicate the well-defined mesoscale spherical structure within collagen matrix in vitro and ex vivo. In-depth studies reveal that phosvitin undergoes a conformational transition in the presence of biominerals at physiological concentrations, and self-assembles into mineral-dense amyloid-like aggregates. The spatial binding of these mineral-dense aggregates to collagen serves as a template for guiding the formation of mineralized spherules on the mesoscale. On the nanoscale, this binding facilitates mineral precursor release and diffusion into the fibrils for intrafibrillar mineralization. This discovery underscores the pivotal role of phosvitin-biomineral aggregates in templating hierarchical mineralization from the mesoscale to the nanoscale. This study not only elucidates the intricate mechanism underlying the collagen-based mineralization hierarchy but also promotes a cutting-edge advance in highly biomimetic material design and regenerative medicine.

TNFSF4
Also flagged:ETV4head and neck squamous cell carcinomamalignant tumorETS variant transcription factor 4transcription factorcancers
Journal Article 2025-02-27 ✓ 1 Snippet Tang Y, Xie W, Hu T, Huang C, Yin W, Wei S, Lai F, Tang L.
In-Text Gene Mentions

…TNFRSF4, LAG3, CTLA4,TNFSF4, ICOS, LAIR1, and…

Show Full Abstract

Head and neck squamous cell carcinoma (HNSC) is a common malignant tumor with high incidence and mortality rates. ETS variant transcription factor 4 (ETV4), an important transcription factor, plays a key role in various cancers. However, the role of ETV4 in HNSC remains unclear. This study aimed to explore the potential prognostic value and oncogenic effects of ETV4 in HNSC. We analyzed ETV4 expression in HNSC patients' data from the TCGA database, alongside clinical pathological characteristics. The STRING and GEPIA databases were utilized to explore ETV4's interaction proteins and expression related genes. Gene Set Enrichment Analysis (GSEA) was performed on the stratified TCGA-HNSC cohort based on ETV4 expression levels. The correlation between ETV4 expression and immune cells, immune checkpoints, immune regulatory genes was further analyzed using R packages and TISIDB database. Finally, knockdown ETV4 in nasopharyngeal carcinoma cells (NPCs) using siRNA and evaluate cell proliferation, migration, and invasion using CCK-8, wound healing, clone formation, and Transwell assays. ETV4 was significantly overexpressed in HNSC and closely related with clinical pathological characteristics and prognosis. GSEA enrichment analysis showed significant enrichment of ETV4 in multiple immune suppression pathways. Further immune-related analysis indicated that ETV4 negatively correlated with most immune cells, immune checkpoints, tumor-infiltrating lymphocyte type characteristic molecules, immunoinhibitors, immune activators and MHC molecules. Knocking down ETV4 significantly inhibited the proliferation, migration and invasion of NPCs. ETV4 may serve as a prognostic biomarker and immunotherapy target in HNSC. High expression of ETV4 may have a negative regulatory effect on the immune level, matrix components and immune regulatory molecules.

SOX6
Also flagged:NGFextracellularosteoarthritisantibodieschondrocyte proliferationtropomyosin receptor kinase A
Journal Article 2025-02-27 ✓ 2 Snippets Wang M, Lian J, Ye M, An B.
In-Text Gene Mentions

…with Sox5 andSox6, plays a pivotal…

…Sox5 andSox6can form a…

Show Full Abstract

<h4>Objectives</h4>Nerve growth factor (NGF) is a key mediator in osteoarthritis pain signaling. Clinical studies revealed that anti-NGF antibodies are often accompanied by progressively worsening cartilage degeneration, although they exhibit significant analgesic effects. However, the relationship between NGF expression and cartilage destruction remains unclear. Our study aimed to investigate the effects of NGF on chondrocytes and to elucidate the underlying mechanisms involved.<h4>Methods</h4>The ATDC5 cells were induced to differentiate into chondrocytes and stimulated with NGF at different concentrations (0.5-10 ng/mL). The cell counting kit-8 assay (CCK-8) was used to measure the effects of NGF on chondrocyte proliferation. Chondrocytes were subsequently stimulated with varying doses of NGF to identify the expression levels of the extracellular matrix. Chondrocytes were pretreated with GNF5837 (a tropomyosin receptor kinase A inhibitor) or LY294002 (a phosphoinositide 3-kinase inhibitor) before exposure to 5 ng/mL NGF to analyze associated signaling pathways. Western blotting and immunofluorescence staining were employed to analyze expression of related proteins.<h4>Results</h4>Alcian blue, toluidine blue staining, and type II collagen immunofluorescence staining demonstrated that ATDC5 cells differentiated into functional chondrocytes after 14 days of chondrogenic induction. The CCK-8 assay confirmed that cell proliferation was unaffected. NGF (0.5-5 ng/mL) was found to enhance chondrocyte matrix synthesis in a dose-dependent fashion, particularly in the expression of aggrecan, type II collagen, Sox9, and through the activation of the PI3K/AKT signaling pathway. The highest promoting effects were exhibited at 5 ng/mL of NGF. Further analysis indicated that GNF5837 (TRKA inhibitor) or LY294002 (PI3K inhibitor) could reverse the protective effects of NGF on chondrocyte matrix synthesis.<h4>Conclusion</h4>Our study identified a potentially beneficial role of NGF at concentrations of 0.5-5 ng/mL in chondrocytes, enhancing extracellular matrix synthesis, with significant involvement of the PI3K/AKT signaling pathway in this process.

NEGR1
Also flagged:BIN1tumorALDH1NOTCHBridging integrator 1suppressor
Journal Article 2025-02-27 ✓ 1 Snippet Chen SY, Zhang YL, Li XR, Wang JR, Li KP, Wan S, Yang JW, Wang H, Cao JL, Wang CY, Fan XP, Fu SJ, Ding LY, Che TJ, Yang L.
In-Text Gene Mentions

…OGN, ABI3BP, AQP1,NEGR1, and GALNT1 (Fig.…

Show Full Abstract

<h4>Background</h4>Bladder cancer (BLCA) represents one of the most prevalent urological malignancies worldwide. Bridging integrator 1 (BIN1), a well-characterized tumor suppressor that interacts with and inhibits oncogenic Myc transcription factors, has demonstrated crucial roles in various cancer types. However, its specific functions and underlying molecular mechanisms in BLCA development and progression remain poorly understood. This study aims to elucidate the role of BIN1 in regulating BLCA cell proliferation, metastasis, and cancer stem cell properties.<h4>Methods</h4>Using urinary proteomics analysis, we identified BIN1 as a significantly dysregulated protein in BLCA. The clinical significance of BIN1 was further validated through comprehensive analyses of public databases. BIN1 expression levels defined distinct molecular and immunological subtypes of BLCA. Through proteomic profiling of BIN1-overexpressing UMUC3 cells and corresponding controls, we identified ALDH1 as a key downstream effector in the BIN1-regulated ALDH1/NOTCH signaling axis. We employed multiple experimental approaches, including Western blot analysis, quantitative RT-PCR, immunofluorescence staining, wound healing assays, transwell migration assays, colony formation assays, tumor sphere formation assays, flow cytometry, CCK8 proliferation assays, and cell transfection experiments.<h4>Results</h4>We observed significant downregulation of BIN1 in both BLCA tissues and cell lines compared to normal adjacent tissues and SV-HUC-1 cells, respectively. BIN1 overexpression inhibited cancer cell proliferation by promoting apoptosis and suppressed epithelial-mesenchymal transition (EMT), thereby reducing local invasion and distant metastasis. Additionally, BIN1 regulated cancer stem cell properties through modulation of ALDH1 expression, with NOTCH2 acting as a crucial downstream mediator of ALDH1 signaling.<h4>Conclusion</h4>Our findings demonstrate that BIN1 functions as a tumor suppressor in BLCA and suggest its potential utility as both a diagnostic biomarker and therapeutic target for BLCA treatment.

B4GALT5
Also flagged:α1,4-galactosyltransferaseShiga toxin receptorsA4galtglycosyltransferaseglycosphingolipidsglycoproteins
Journal Article 2025-02-27 ✓ 5 Snippets Mikołajczyk K.
In-Text Gene Mentions

B4GALT5-deficient CHO-Lec2 cells expr…

…disrupting the hamsterB4GALT5gene using CRISPR/Cas9…

…TheB4GALT5gene encodes β1,4-galactosyltr…

…B4GALT5 gene encodesβ1,4-galactosyltransferase 55 (B4galt5), synthesizing…

…β1,4-galactosyltransferase 5 (B4galt5), synthesizing lactosylcerami…

Show Full Abstract

Human α1,4-galactosyltransferase (A4galt) is a glycosyltransferase existing in humans as two isoforms, widespread A4galt (named A4G) and its rare variant with p.Q211E substitution (A4Gmut). Both isoforms produce Gb3 (Galα1→4Galβ1→4Glc-Cer) on glycosphingolipids and P1 glycotope (Galα1→4Galβ1→4GlcNAc-R) on glycoproteins, which serve as receptors for Shiga toxin types 1 and 2 (Stx1 and Stx2). Stx1 is bound by Gb3 and P1 glycotope, while Stx2 is recognized solely by Gb3. To elucidate the role of these receptors, CHO-Lec2 cells expressing human A4G and A4Gmut were modified by disrupting the hamster B4GALT5 gene using CRISPR/Cas9 technology. The B4GALT5 gene encodes β1,4-galactosyltransferase 5 (B4galt5), synthesizing lactosylceramide, the key substrate for Gb3 synthesis. Consequently, B4GALT5-deficient CHO-Lec2-expressing A4G and A4Gmut cells lacked Gb3 glycosphingolipid but retained the ability to synthesize glycoprotein-based P1 glycotope. Both B4GALT5-deficient CHO-Lec2 cells expressing A4G and A4Gmut demonstrated no binding of Stx1B and Stx2B. The cytotoxicity assay showed that B4GALT5-deficient CHO-Lec2 cells expressing A4G were completely resistant to Stx1 holotoxin while A4Gmut-expressing cells revealed reduced sensitivity to Stx2. The glycoengineered CHO-Lec2 cells obtained in this study provide a valuable model for studying receptors for Stxs, enabling a detailed assessment of their roles in toxin binding and cytotoxicity.

Also flagged:transcription factorsmyogenic regulatorsinsulin-like growth factorprotein synthesisdegradationlipogenesis
Journal Article 2025-02-27 No Snippets Liu W, Sun C, Gao H, He J, Yu A, Xie Y, Yao H, Hu J, Lei Z.
Show Full Abstract

<h4>Objective</h4>Supplementing animal feed with Allium mongolicum Regel powder (AMRP) additives can promote muscle production and improve meat quality. Here, we explored the effects of dietary AMRP supplementation on the performance, meat quality, and muscle transcriptome profile of Angus calves.<h4>Methods</h4>Twelve healthy female black Angus calves (average body weight = 280.4±15.74 kg, average age = 14±0.6 months) of the same genetic background were randomly assigned to two feed groups: control (CON; basal diet without any supplementation) and AMRP (basal diet supplemented with 20 g of AMRP per calf per day).<h4>Results</h4>In general, compared with the control group, dietary AMRP supplementation significantly increased the longissimus thoracis muscle area (p = 0.027) and pH24h (p = 0.027) but significantly reduced Warner-Bratzler shear force (p = 0.009) and cooking loss (p<0.001). Moreover, 1,284 differentially expressed genes (DEGs) were identified in AMRP-supplemented Angus calves. Pathway analysis revealed that the DEGs were involved in multiple pathways related to muscle development and fat deposition, such as the focal adhesion and MAPK pathways.<h4>Conclusion</h4>Dietary supplementation of AMRP improved muscle growth and development in Angus beef cattle. It also significantly modulated meat quality, possibly altering signaling pathways by influencing key gene expression. Our results provide novel insights into the development of the meat industry and indicate the mechanism through which AMRP regulates muscle development and improves meat quality at the molecular level.

HTT
Also flagged:Age-Related Neurodegenerative DiseasesNeurodegenerative diseasesneurogenesisAmyotrophic Lateral Sclerosisproteostasisdepression
Journal Article 2025-02-27 ✓ 2 Snippets Calvo B, Schembri-Wismayer P, Durán-Alonso MB.
In-Text Gene Mentions

…of the Huntingtin (HTT) protein (mHTT) that…

…1 of theHTTgene (also called…

Show Full Abstract

Neurodegenerative diseases encompass a number of very heterogeneous disorders, primarily characterized by neuronal loss and a concomitant decline in neurological function. Examples of this type of clinical condition are Alzheimer's Disease, Parkinson's Disease, Huntington's Disease and Amyotrophic Lateral Sclerosis. Age has been identified as a major risk in the etiology of these disorders, which explains their increased incidence in developed countries. Unfortunately, despite continued and intensive efforts, no cure has yet been found for any of these diseases; reliable markers that allow for an early diagnosis of the disease and the identification of key molecular events leading to disease onset and progression are lacking. Altered adult neurogenesis appears to precede the appearance of severe symptoms. Given the scarcity of human samples and the considerable differences with model species, increasingly complex human stem-cell-based models are being developed. These are shedding light on the molecular alterations that contribute to disease development, facilitating the identification of new clinical targets and providing a screening platform for the testing of candidate drugs. Moreover, the secretome and other promising features of these cell types are being explored, to use them as replacement cells of high plasticity or as co-adjuvant therapy in combinatorial treatments.

HTT
Also flagged:Autism spectrum disorderneurodevelopmental disorderubiquitinproteolysiscannabinoid receptorCDC5L
Journal Article 2025-02-27 ✓ 2 Snippets Remori V, Bondi H, Airoldi M, Pavinato L, Borini G, Carli D, Brusco A, Fasano M.
In-Text Gene Mentions

…APP , andHTTgenes are primarily…

…Moreover, APP andHTTare also annotated…

Show Full Abstract

Autism spectrum disorder (ASD) is a complex multifactorial neurodevelopmental disorder. Despite extensive research involving genome-wide association studies, copy number variant (CNV) testing, and genome sequencing, the comprehensive genetic landscape remains incomplete. In this context, we developed a systems biology approach to prioritize genes associated with ASD and uncover potential new candidates. A Protein-Protein Interaction (PPI) network was generated from genes associated to ASD in a public database. Leveraging gene topological properties, particularly betweenness centrality, we prioritized genes and unveiled potential novel candidates (e.g., <i>CDC5L</i>, <i>RYBP</i>, and <i>MEOX2</i>). To test this approach, a list of genes within CNVs of unknown significance, identified through array comparative genomic hybridization analysis in 135 ASD patients, was mapped onto the PPI network. A prioritized gene list was obtained through ranking by betweenness centrality score. Intriguingly, by over-representation analysis, significant enrichments emerged in pathways not strictly linked to ASD, including ubiquitin-mediated proteolysis and cannabinoid receptor signaling, suggesting their potential perturbation in ASD. Our systems biology approach provides a promising strategy for identifying ASD risk genes, especially in large and noisy datasets, and contributes to a deeper understanding of the disorder's complex genetic basis.

Also flagged:SynthesisMalaria-19Quinones1,4-naphthoquinonesbenzyl-
Journal Article 2025-02-27 No Snippets Presser A, Blaser G, Pferschy-Wenzig EM, Kaiser M, Mäser P, Schuehly W.
Show Full Abstract

Malaria remains a major global health problem that has been exacerbated by the impact of the COVID-19 pandemic on health systems. To combat this, the World Health Organization (WHO) has set a target of driving forward research into innovative treatment methods such as new drugs and vaccines. Quinones, particularly 1,4-naphthoquinones, have been identified as promising candidates for the development of antiprotozoal drugs. Herein, we report several methods for the preparation of 2-benzyl-1,4-naphthoquinones. In particular, the silver-catalyzed Kochi-Anderson radical decarboxylation is well suited for the preparation of these compounds. The antiprotozoal activity of all synthesized compounds was evaluated against <i>Plasmodium falciparum</i> NF54 and <i>Trypanosoma brucei rhodesiense</i> STIB900. Cytotoxicity towards L6 cells was also determined, and the respective selectivity indices (SI) were calculated. The synthesized compounds exhibited good antiplasmodial activity against the <i>P. falciparum</i> (NF54) strain, particularly (2-fluoro-5-trifluoromethylbenzyl)-menadione <b>2e</b>, which showed strong efficacy and high selectivity (IC<sub>50</sub> = 0.006 µM, SI = 7495). In addition, these compounds also displayed favorable physicochemical properties, suggesting that the benzylnaphthoquinone scaffold may be a viable option for new antiplasmodial drugs.

HTT
Also flagged:anxietydepressioncorticosteronecrocin IAnxiety disordersanxiety-
Journal Article 2025-02-27 ✓ 5 Snippets Zhang D, Wu Z, Yang D, Zhao G, Zhang Y, Mou W, Liang Y.
In-Text Gene Mentions

…of Serotonin transporter (5-HTT, JW.RA1057), dopamine (DA,…

…expression levels of5-HTT, GABA, DA, and…

…the content of5-HTTin the crocin…

…the overexpression of5-HTTin the brain…

…process mediated by5-HTT, and thereby increase…

Show Full Abstract

Anxiety disorders and depression often co-occur and lack broadly available treatments. Gardenia extract significantly associated with treatment of anxiety-like depression. Based on the dose effect hypothesis and previous studies, it is speculated that crocin I, the main component of gardenia, is significantly related to the treatment of anxiety-like depression. The present study aimed to verify the reversal effect of crocin I on chronic corticosterone-induced anxiety-like depression, and to further explore its metabolic process <i>in vivo</i>. Ultimately, a new method for rapid and sensitive detection of trace substances was established. In this study, the rat model of anxiety-like depression was induced by chronic corticosterone. The effects of crocin I were explored by combining behavioral, pathological sections and ELASA data. It is the first time that crocin I can reverse the morphological changes of hippocampus induced by corticosterone in rats. In terms of behavior, crocin Ⅰ can significantly improve the anxiety-like depressive behavior exhibited by model rats in water maze and sugar water preference experiments. It can also repair neuronal cell damage in the Dentate gyrus, CA1, and CA3 areas of the hippocampus. It also regulates the expression levels of monoamine neurotransmitters in the rat brain, thereby exerting an anti-anxiety-like depression effect. Pharmacokinetic analysis was performed to determine the metabolic process <i>in vivo</i>. Further integrating Surface-Enhanced Raman Scattering (SERS) technology, a highly sensitive and rapid detection method for trace substances had been established. It was first discovered that crocin I can reverse the changes in rat hippocampal morphology caused by corticosterone. It was determined that crocin Ⅰ can reverse the anxiety-like depression induced by chronic corticosterone and exert its therapeutic effect by regulating the levels of neurotransmitters in the brain. <i>In vivo</i> pharmacokinetic experiments revealed that crocin Ⅰ could not pass through the intestinal barrier into the blood, but its metabolite crocetin could pass through the intestinal barrier into the blood. Finally, by synthesizing silver nanoparticles, a detection method for trace amounts of the metabolite crocetin in blood samples was established for the first time.The calculated enhancement factor is 4.49 × 10<sup>11</sup>. The method was stable and reproducible over a week. This series of studies revealed the great potential of crocin I in treating comorbid anxiety and depression. It shortens the distance from theoretical research to clinical application.

TNFSF4
Also flagged:Tumorgene expressionB-cell lymphomarefractory large B-cell lymphomaCD19CD45RA
Journal Article 2025-02-27 ✓ 3 Snippets Tian Y, Budka J, Locke FL, Westin JR, To C, Tiwari G, Mao D, Bedognetti D, Shen RR, Andrade J, Filosto S.
In-Text Gene Mentions

…CD45RO, BCL2, IL-18R1,TNFSF4[OX40L], KLRB1 [CD161],…

…PSMB5, RPS6KB1, BCL2,TNFSF4, SERPINA9, DUSP5, NBN,…

…KLRB1 (CD161); KIR3DL2;TNFSF4(OX40L); DUSP5) (…

Show Full Abstract

<h4>Introduction</h4>CAR T cell therapy provided transformative outcomes for patients with B-cell lymphoma; however, a large fraction of patients remains at risk for relapse, underlying the need to uncover mechanisms of resistance and predictive biomarkers. Herein, we leveraged the ZUMA-7 phase III randomized trial of relapsed/refractory large B-cell lymphoma (LBCL) patients treated with axicabtagene ciloleucel (axi-cel; CD19-targeting CAR T cells) to discover tumor gene expression signatures (GES) associated with outcome.<h4>Methods</h4>With tumor transcriptomics from 134 axi-cel patients, we employed multivariate penalized Cox models analyzing event-free survival (EFS), progression-free survival (PFS), and duration of response (DOR).<h4>Results and discussion</h4>We identified two novel GES, a six-gene/transcript signature (6-GES; CD19, CD45RA, CCL22, KLRK1, SOX11, SIGLEC5) correlated with improved outcome after axi-cel (HR: 0.27, 95% CI: 0.16-0.44 for EFS), representing lymphomas with abundant target antigen (CD19) expression, adhesion molecules, and relatively low immune infiltration mostly composed of cytotoxic lymphocytes (T and NK cells) and DCs, and secondly, a 17-gene/transcript signature (17-GES; CD45RO, BCL2, IL-18R1, TNFSF4 [OX40L], KLRB1 [CD161], KIR3DL2, ITGB8, DUSP5, GPC4, PSMB5, RPS6KB1, SERPINA9, NBN,GLUD1, ESR1, ARID1A, and SLC16A1) correlated with disease progression after axi-cel (HR: 6.12, 95% CI: 3.57-10.50 for EFS), consistent with high immune inflammation and escape mechanisms, such as the upregulation of genes involved in repair of damaged DNA or chromatin remodeling, inhibition of apoptosis, and a metabolically restrictive environment. These signatures did not correlate with outcome in the standard-of-care arm of ZUMA-7 (chemotherapy, followed by transplant) or frontline therapy, supporting their predictive rather than prognostic value. The findings were technically reproduced in a subset of ZUMA-7 samples profiled by RNA-seq (axi-cel, n=124; SOC, n=125). The 6-GES was reduced, whereas the 17-GES was elevated at progression post axi-cel, consistent with the notion that these signatures represent features relevant for response and resistance to CAR T-cell therapy.<h4>Conclusion</h4>Our transcriptomic analysis identified gene expression signatures potentially predictive of outcome with CD19-directed CAR T-cell therapy, and these findings are informative for risk stratification and development of next-generation products.

Also flagged:waterzoonotic diseaseszoonosesinfectious diseasesbovine tuberculosisbrucellosis
Journal Article 2025-02-27 No Snippets Nguyen-Viet H, Lâm S, Alonso S, Unger F, Moodley A, Bett B, Fèvre EM, Knight-Jones T, Mor SM, Nguyen HTT, Grace D.
Show Full Abstract

For more than 15 years, the International Livestock Research Institute (ILRI) has been striving to understand and address One Health challenges at the intersection of livestock, humans, and the environment. We present an overview of ILRI One Health projects implemented with partners across Asia and Africa, reflecting on key learnings and future directions for One Health research and food systems transformation. Drawing on a review of peer-reviewed and grey literature, we analyzed processes and outcomes of ILRI-led and supported initiatives using a realist evaluation framework (context, mechanisms, outcomes), and present insights within select One Health topic areas such as zoonoses, food safety, antimicrobial resistance. Our findings emphasize the need for stronger cross-sectoral collaboration, greater engagement with policymakers to translate research findings into actionable strategies, and the development of adaptable and context-specific interventions.

SERPINC1
Also flagged:Gene Expressionproteasomecell adhesionglucocorticoid receptorHOXA10HOXA11
Journal Article 2025-02-27 ✓ 2 Snippets Grassi A, Rocca MS, Noventa M, Pozzato G, Pozzato A, Scioscia M, Andrisani A, Pontrelli G, Foresta C, De Toni L.
In-Text Gene Mentions

…hand, F10 andSERPINC1genes from the…

…p = 0.013,SERPINC1p = 0.018…

Show Full Abstract

<h4>Objectives</h4>The identification of methods to improve the endometrial receptivity (ER) is increasingly of interest. The effect of the electromagnetic field associated with Quantum Molecular Resonance (QMR) on ER was investigated here.<h4>Methods</h4>Ishikawa cells were used to evaluate the effects of QMR both on the expression of a group of genes involved in ER, i.e., <i>HOXA10</i>, <i>HOXA11</i>, <i>LIF</i>, <i>ITGB3</i>, and <i>ITGAV</i>, and on cell toxicity. Endometrial samples were obtained from six patients during routine diagnostic procedures, four of which were subsequently used to assess the transcriptional response to QMR through microarray.<h4>Results</h4>Compared to unexposed controls, a single exposure of Ishikawa cells to QMR for 20 min was associated with a significant and power-dependent up-regulation of all the selected ER-related genes up to 8 power units (PU). Repeated exposure to QMR, up to three consecutive days, showed a significant up-regulation of all the selected genes at power values of 4 PU, from day two onwards. Negligible cytotoxicity was observed. Gene set enrichment analysis, on microarray data of endometrial biopsies stimulated for three consecutive days at 4 PU, showed a significant enrichment of specific gene sets, related to the proteasome system, the cell adhesion, the glucocorticoid receptor, and cell cycle pathways.<h4>Conclusions</h4>Our results suggest a possible favorable impact of QMR on ER.

HFE
Also flagged:hyperpigmentationalkaloidmitragyninedopaminergic receptorslevetiracetampigmentation
Journal Article 2025-02-27 ✓ 1 Snippet Tassavor B, Young Eun C, Nikolskaia O, Jobarteh-Williams R.
In-Text Gene Mentions

…Bloodwork ruled outhemochromatosis, human immunodeficiency virus…

Show Full Abstract

Kratom, an opioid substitute derived from the leaves of <i>Mitragyna speciosa</i>, is commonly used for its opioid-like effects in East Asia and is gaining popularity in the United States. A rare side effect of chronic kratom use, previously noted in the literature, is skin hyperpigmentation. We present a unique case of diffuse, photodistributed hyperpigmentation in a patient with over a decade of kratom use. This case is accompanied by an evaluation of the adverse effect, focusing on its clinical presentation, histopathological findings, and potential mechanism. Additionally, we provide a brief literature review on the topic.

Also flagged:streptococcal pharyngitispharyngitisbacterial pharyngitisGAS pharyngitisinfectionGAS infections
Journal Article 2025-02-27 No Snippets Tu WC, Robertson IH, Blom A, Alfaro E, Shinkawa VAM, Hatchett DB, Sanchez JC, McManamen AM, Su X, Berthier E, Thongpang S, Wald ER, DeMuri GP, Theberge AB.
Show Full Abstract

<h4>State the purpose</h4>Obtaining high-quality samples to diagnose streptococcal pharyngitis in pediatric patients is challenging due to discomfort associated with traditional pharyngeal swabs. This may cause reluctance to go to the clinic, inaccurate diagnosis, or inappropriate treatment for children with sore throats. Here, we determined the efficacy of CandyCollect, a lollipop-inspired open-microfluidic pathogen collection device, to capture Group A <i>Streptococcus</i> (GAS) and compare user preference for CandyCollect, conventional pharyngeal swabs, or mouth swabs in children with pharyngitis and their caregivers.<h4>Results</h4>All child participants (30/30) were positive for GAS by qPCR on both the mouth swab and CandyCollect. Caregivers ranked CandyCollect as a good sampling method overall (27/30), and all caregivers (30/30) would recommend CandyCollect for children 5 years and older. Twenty-three of 30 children "really like" the taste and 24/30 would prefer to use CandyCollect if a future test were needed. All caregivers (30/30) and most children (28/30) would be willing to use CandyCollect at home.<h4>Conclusion</h4>All participants tested positive for GAS on all three collection methods (pharyngeal swab, mouth swab, and CandyCollect). While both caregivers and children like CandyCollect, some caregivers would prefer a shorter collection time. Future work includes additional studies with larger cohorts presenting with pharyngitis of unknown etiology and shortening collection time while maintaining the attractive form of the device.

Also flagged:Diabetesdiabetic complicationslipidmetabolismProteinS-acylation
Journal Article 2025-02-27 No Snippets Liu R, Xu N, Song X, Li Y, Bu J, Su R, Guo H, Jiang C, Zhuang P, Zhang Y, Yin Q.
Show Full Abstract

Diabetes involves multi-organ complications that seriously threaten human life and health, and has become a major public health problem of global concern. Unfortunately, clinical management strategies for diabetic complications are still in their "infancy", restricted by a limited understanding of their complex pathological mechanism. As is well established, lipid metabolism disorder is the characteristic pathological factors of diabetes, but the detailed molecular mechanisms driving the progression of multi-organ complications remain obscure. Protein S-acylation (often referred to as S-palmitoylation) is a reversible lipid modification that reversibly binds fatty acids to protein-specific cysteine (Cys) residues through palmitoyl acyl transferases (PATs, also known as DHHCs) and deacylation enzymes, which is involved in the pathological progression of a variety of complex diseases such as cancer, neurological disorders and metabolic syndrome. Notably, recent studies have shown that protein S-acylation drives the progression of diabetes and its multiple complications, and targeted intervention in the protein S-acylation process significantly alleviates the progression of diabetes and its complications, suggesting that protein S-acylation may be a common pathological link and intervention target of diabetes complications. Therefore, this review systematically comprehends the contribution of protein S-acylation to the progression of diabetes and its complications, summarizes the influence of the diabetic environment on S-acylation related enzymes, as well as providing an in-depth analysis of current drugs, measures, and challenges in targeting S-acylation. Finally, the accessibility of targeting protein S-acylation to prevent diabetes and its complications and the focus of future in-depth studies are envisioned, with a view to providing comprehensive and in-depth references and rationale for future novel strategies targeting protein S-acylation to prevent and treat diabetes and its multi-organ complications.

DDX27
Also flagged:response to salinitylipidmetabolismamino acidmembranesynthesis
Journal Article 2025-02-27 ✓ 2 Snippets Huang S, Jiang S, Jiang S, Huang J, Yang Q, Yang L, Shi J, Li E, Zhou F, Li Y.
In-Text Gene Mentions

…upregulated DEGs, includingATP-dependent RNA helicase DDX27RNA helicase DDX27,…

…ATP-dependent RNA helicasesDDX27, SC5DL, and ECH1,…

Show Full Abstract

No abstract available.

TNFSF4
Also flagged:methylationcancerprogrammed celldeathcolorectal cancerSERPINE1
Journal Article 2025-02-26 ✓ 1 Snippet Zhu L, Qiu X, Liang S, Huang S, Ning Q, Chen X, Chen N, Qin L, Huang J, Liu S.
In-Text Gene Mentions

…PDCD1LG2, TIGIT, TNFRSF14,TNFSF4, TNFSF9 in the…

Show Full Abstract

<h4>Background</h4>RNA methylation is a potential target for cancer therapy, while anoikis, a form of programmed cell death, is linked to cancer metastasis. However, the prognostic and immune significance of RNA methylation- and anoikis-related genes in colorectal cancer (CRC) remains unknown.<h4>Methods</h4>Transcriptomic and clinicopathological data for CRC were obtained from TCGA and the GEO databases. A novel signature was constructed based on RNA methylation- and anoikis-related genes using univariate and multivariate Cox regression as well as LASSO Cox regression methods. CRC patients were stratified into low- and high-risk groups based on this signature. Differences in prognosis, immune infiltration, and drug sensitivity between two groups were analyzed. Finally, immunohistochemistry, western blot, and RT-qPCR were employed to validate the expression of the key gene SERPINE1 in CRC tissues and cells, as well as the effect of FTO on its expression.<h4>Results</h4>We identified 79 differentially expressed RNA methylation-associated anoikis-related genes (RMRARGs) in both cancerous and normal tissues. A signature composed of 9 key genes (BID, FASN, PLK1, CDKN3, MYC, EPHA2, SERPINE1, CD36, PDK4) was established. Kaplan-Meier analysis revealed a poorer prognosis in the high-risk group. Compared to the other three published models, this signature demonstrated superior predictive performance based on the ROC curve analysis. Functional analyses highlighted differences in drug sensitivities and signaling pathways between risk groups. Furthermore, immune analysis results showed that risk score was associated with some immune cells and immune checkpoints. Immunohistochemistry showed high SERPINE1 expression in CRC tissues, with FTO expression positively correlated with SERPINE1. Furthermore, RT-qPCR and western blot indicated FTO knockdown markedly downregulated SERPINE1 levels.<h4>Conclusion</h4>Our findings underscore the prognostic value of this signature in CRC patients and its utility in assessing immune status. Additionally, the m6A demethylase FTO regulates the expression of the anoikis-related gene SERPINE1.

HFE
Also flagged:Mixed cryoglobulinemiahepatocellular carcinomahepatitis CMCcancerchronic hepatitis C
Journal Article 2025-02-26 ✓ 1 Snippet Chang ML, Cheng JS, Chen WT, Shen YJ, Kuo CJ, Chien RN.
In-Text Gene Mentions

…unodeficiency virus infection,hemochromatosis, autoimmune liver diseases,…

Show Full Abstract

How mixed cryoglobulinemia (MC) affects cancer risk in chronic hepatitis C patients with sustained virologic response (SVR) remains unclear. In a 12-year prospective study, post-SVR MC was assessed every 3‒6 months. Among the 891 SVR patients, 265 (29.7%) had baseline (24 weeks after completing anti-HCV therapy) MC, and the 12-year cancer cumulative incidence was 19.7%. Among the 73 patients who developed cancer, 37 (50.7%) had hepatocellular carcinoma (HCC), with the following associated baseline variables: for cancer, male sex, age and alanine aminotransferase (ALT) levels; for HCC, male sex, age, and cirrhosis; and for non-HCC cancer, rheumatoid factor levels. Among patients with post-SVR HCC, the mean time to HCC was longer in those with than in those without baseline MC (1545.4 ± 276.5 vs. 856.9 ± 115.2 days, <i>p</i> = 0.014). Patients with baseline MC had decreased circulating interleukin-10 (IL-10)-positive B cell (CD19+IL-10+cells/CD19+cells) (31.24 ± 16.14 vs. 40.08 ± 15.42%, <i>p</i> = 0.031), regulatory B cell (Breg) (CD19+CD24hi CD27+cells/CD19+cells) (10.45 ± 7.10 vs. 15.76 ± 9.14%, <i>p</i> = 0.035), IL-10-positive Breg (CD19+CD24hiCD27+IL-10+cells/CD19+cells) (5.06 ± 4.68 vs. 8.83 ± 5.46%, <i>p</i> = 0.015) and HCC-infiltrating Breg (18.6 ± 10 vs. 33.51 ± 6.8%, <i>p</i> = 0.022) ratios but comparable circulating and HCC-infiltrating regulatory T cell ratios relative to patients without baseline MC. In conclusion, old male SVR patients with elevated ALT levels or cirrhosis require intensive monitoring for cancer development, especially HCC. Tailored HCC follow-up is needed for SVR patients according to their baseline MC, which might downregulate Bregs to decelerate HCC development for almost 2 years.

UNC13C
Also flagged:RBPGlioblastomaGBMgliomatumorprimary
Journal Article 2025-02-26 ✓ 1 Snippet Latowska-Łysiak J, Zarębska Ż, Sajek MP, Grabowska A, Buratin A, Głodowicz P, Misiorek JO, Kuczyński K, Bortoluzzi S, Żywicki M, Kosiński JG, Rybak-Wolf A, Piestrzeniewicz R, Barciszewska AM, Rolle K.
In-Text Gene Mentions

…positive correlation forUNC13C, VCAN (GBM‐PRM) and…

Show Full Abstract

Glioblastoma (GBM) is the most aggressive and lethal type of glioma, characterized by aberrant expression of noncoding RNAs including circular RNAs (circRNAs). CircRNAs may impact cellular processes by interacting with other molecules-like RNA-binding proteins (RBPs). The diagnostic value of circRNA and circRNA/RBP complexes is still largely unknown. To explore circRNA and RBP transcript expression in GBM, we performed and further analyzed RNA-seq data from GBM patients' primary and recurrent tumor samples. We identified circRNAs differentially expressed in primary tumors, the circRNA progression markers in recurrent GBM samples, and the expression profile of RBP genes. Furthermore, we demonstrated the clinical potential of circRNAs and RBPs in GBM and proposed them as stratification markers in de novo assembled tumor subtypes. Additionally, we experimentally validated the subcellular localization of select circRNAs and their interactions with FUS. Subsequently, we showed that circARID1A may play a role in promoting GBM cell proliferation. Overall, we described circRNA-RBP interactions that could play a regulatory role in gliomagenesis and GBM progression and provided a list of molecular players in GBM for further extensive studies.

Also flagged:metabolismmitochondrialphosphorylationdegradationmitochondrial diseasesribosomal RNA
Journal Article 2025-02-26 No Snippets Duan T, Sun L, Ding K, Zhao Q, Xu L, Liu C, Sun L.
Show Full Abstract

<h4>Abstract</h4>In recent years, the roles of mitochondrial RNA and its associated human diseases have been reported to increase significantly. Treatments based on mtRNA metabolic processes and nuclear gene mutations are thus discussed. The mitochondrial oxidative phosphorylation process is affected by mtRNA metabolism, including mtRNA production, maturation, stabilization, and degradation, which leads to a variety of inherited human mitochondrial diseases. Moreover, mitochondrial diseases are caused by mitochondrial messenger RNA, mitochondrial transfer RNA, and mitochondrial ribosomal RNA gene mutations. This review presents the molecular mechanisms of human mtRNA metabolism and pathological mutations in mtRNA metabolism-related nuclear-encoded/nonencoded genes and mitochondrial DNA mutations to highlight the importance of mitochondrial RNA-related diseases and treatments.

Watching axons on the move.

Also flagged:axonsNetrinaxonchemotaxis
Journal Article 2025-02-26 No Snippets Lazaro-Pena MI, Diaz-Balzac CA.
Show Full Abstract

The ligand Netrin mediates axon guidance through a combination of haptotaxis over short distances and chemotaxis over longer distances.

Also flagged:mineralcalciumphosphorushydroxyapatitewatercollagen
Journal Article 2025-02-26 No Snippets Kim S, Larnani S, Son JE, Lappanakokiat N, Truong VM, Jin BH, Park YS.
Show Full Abstract

This study investigates the effects of different treatment sequences involving demineralization, brushing, and remineralization on the calcium and phosphorus (Ca/P) content, surface roughness, and microhardness of dentin specimens. Bovine dentin samples were subjected to the following five treatment conditions: control, demineralization, demineralization followed by remineralization, demineralization followed by brushing then remineralization, and demineralization followed by remineralization then brushing. X-ray fluorescence spectroscopy was then utilized to assess the elementary composition changes, while scanning electron microscopy provided microstructural analyses. Surface roughness and microhardness were also quantified to assess the physical changes in dentin. The control group retained significantly higher Ca/P content compared with all treated groups, indicating that demineralization, regardless of subsequent treatment, leads to a substantial loss of hydroxyapatite. Among the treated groups, those that underwent remineralization immediately after demineralization manifested higher Ca/P retention compared with those that included brushing before remineralization. Additionally, microhardness measurements indicated that post-demineralization brushing negatively affected dentin's microhardness. The sequence of demineralization, brushing, and remineralization treatments significantly affects Ca/P retention in dentin, along with its surface roughness and microhardness. Pre-remineralization brushing diminished mineral recovery, whereas exposure to mineral-rich beverage immediately after demineralization resulted in greater mineral deposition.

ABT1
Also flagged:transportationRFLNAFOXO1histoneagarosechromatin
Journal Article 2025-02-26 ✓ 3 Snippets Li X, Wang Z, Zhu M, Wang B, Teng S, Yan J, Wang H, Yuan P, Cao S, Qu X, Wang Z, Zhan K, Choudhury MP, Yang X, Bao Q, He S, Liu L, Zhao P, Jiang J, Xiang H, Fang L, Tang Z, Liao Y, Yi G.
In-Text Gene Mentions

…FOXO1 ), andactivator of basal transcription 1of basal transcription…

…transcription 1 (ABT1), which may…

…elements of theABT1gene, which plays…

Show Full Abstract

Horse domestication revolutionizes human civilization by transforming transportation, agriculture, and warfare patterns. Despite extensive studies on modern domestic horse origins, the intricate demographic history and genetic signatures underlying pony size remain unexplored. Here, a high-quality genome assembly of the Chinese Debao pony is presented, and 452 qualified individuals from 64 horse breeds worldwide are extensively analyzed. The authors' results reveal the conservation of ancient components in East Asian horses and close relationships between Asian horses and Western pony lineages. Genetic analyses suggest an Asian paternal origin for European pony breeds. These pony-sized horses share close genetic affinities, potentially attributed to their early expansion and adaptation to local environments. In addition, promising cis-regulatory elements influencing horse withers height by regulating genes such as RFLNA and FOXO1 are identified. Overall, this study provides insightful perspectives on the dispersal history and genetic determinants underlying body size in ponies, offering broader implications for horse population management and improvement.

LRRC7
Also flagged:chromosomescell cyclechromatincohesinchromosome-associated condensinsmitotic
Journal Article 2025-02-26 ✓ 3 Snippets Zhao H, Shu L, Qin S, Lyu F, Liu F, Lin E, Xia S, Wang B, Wang M, Shan F, Lin Y, Zhang L, Gu Y, Blobel GA, Huang K, Zhang H.
In-Text Gene Mentions

…find that: (i)Condensindisrupts extrusive-cohesin bin…

…ii)Condensindiminishes cohesive-cohesin pe…

Condensin

Show Full Abstract

Mammalian genomes are folded through the distinct actions of structural maintenance of chromosome (SMC) complexes, which include the chromatin loop-extruding cohesin (extrusive cohesin), the sister chromatid cohesive cohesin and the mitotic chromosome-associated condensins<sup>1-3</sup>. Although these complexes function at different stages of the cell cycle, they exist together on chromatin during the G2-to-M phase transition, when the genome structure undergoes substantial reorganization<sup>1,2</sup>. Yet, how the different SMC complexes affect each other and how their interactions orchestrate the dynamic folding of the three-dimensional genome remain unclear. Here we engineered all possible cohesin and condensin configurations on mitotic chromosomes to delineate the concerted, mutually influential action of SMC complexes. We show that condensin disrupts the binding of extrusive cohesin at CCCTC-binding factor (CTCF) sites, thereby promoting the disassembly of interphase topologically associating domains (TADs) and loops during mitotic progression. Conversely, extrusive cohesin impedes condensin-mediated mitotic chromosome spiralization. Condensin reduces peaks of cohesive cohesin, whereas cohesive cohesin antagonizes condensin-mediated longitudinal shortening of mitotic chromosomes. The presence of both extrusive and cohesive cohesin synergizes these effects and inhibits mitotic chromosome condensation. Extrusive cohesin positions cohesive cohesin at CTCF-binding sites. However, cohesive cohesin by itself cannot be arrested by CTCF molecules and is insufficient to establish TADs or loops. Moreover, it lacks loop-extrusion capacity, which indicates that cohesive cohesin has nonoverlapping functions with extrusive cohesin. Finally, cohesive cohesin restricts chromatin loop expansion mediated by extrusive cohesin. Collectively, our data describe a three-way interaction among major SMC complexes that dynamically modulates chromatin architecture during cell cycle progression.

Also flagged:cellulosealginatehydroxyapatitegraphene oxidetricarboxylic cellulosesodium alginate
Journal Article 2025-02-26 No Snippets Dacrory S, Ali LMA, Ouahrani-Bettache S, Daurat M, El-Sakhawy M, Hesemann P, Bettache N, Kamel S.
Show Full Abstract

Bone regeneration is one of the most effective methods for treating bone defects. In this work, tricarboxylic cellulose/sodium alginate loaded with hydroxyapatite (HA) and/or graphene oxide (GO) was coagulated by calcium ions to create beads as scaffolds. In the first, cellulose was oxidized to water-soluble tricarboxylic cellulose (TCC) by 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO), periodate, and chlorite oxidation. HA was extracted from eggshells via microwave treatment, and GO was synthesized using the Hummer method. The structural behavior of the formed beads was meticulously investigated through various characterization techniques such as Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), thermogravimetric analysis (TGA), and scanning electron microscopy (SEM). The SEM images confirmed the formation of particles of micrometric size without any specific morphology. Incorporating GO or HA does not affect the morphologies of the materials on the micrometric scale. The cytocompatibility of different bead preparations was studied on murine mesenchymal stem cells. Moreover, the swellability in water and biodegradability by cellulase enzyme of prepared beads were studied. The results show that the prepared beads may be promising for bone tissue engineering.

MMS22L
Also flagged:RNA polymeraseDONSONinitiationamino acidsamino acidBRCA2
Journal Article 2025-02-26 ✓ 3 Snippets Schmid EW, Walter JC.
In-Text Gene Mentions

…from STRING isMMS22L-RPA2, which is consistent…

…evidence that theMMS22L-TONSL complex binds to…

…63 ), andMMS22L-TONSL (SPOC=0.993; 64 –…

Show Full Abstract

Protein-protein interactions (PPIs) are ubiquitous in biology, yet a comprehensive structural characterization of the PPIs underlying cellular processes is lacking. AlphaFold-Multimer (AF-M) has the potential to fill this knowledge gap, but standard AF-M confidence metrics do not reliably separate relevant PPIs from an abundance of false positive predictions. To address this limitation, we used machine learning on curated datasets to train a structure prediction and omics-informed classifier (SPOC) that effectively separates true and false AF-M predictions of PPIs, including in proteome-wide screens. We applied SPOC to an all-by-all matrix of nearly 300 human genome maintenance proteins, generating ∼40,000 predictions that can be viewed at predictomes.org, where users can also score their own predictions with SPOC. High-confidence PPIs discovered using our approach enable hypothesis generation in genome maintenance. Our results provide a framework for interpreting large-scale AF-M screens and help lay the foundation for a proteome-wide structural interactome.

PRDX6
Also flagged:tumorhepatocellular carcinomaST6GALNAC4SEC61A1SSR3RPN2
Journal Article 2025-02-26 ✓ 1 Snippet Tang M, Xu Y, Pan M.
In-Text Gene Mentions

…PRDX4, PRDX5, andPRDX6, plays significant roles…

Show Full Abstract

<h4>Purpose</h4>The complexity and heterogeneity of the tumor immune microenvironment (TIME) are linked to the development and poor prognosis of hepatocellular carcinoma (HCC). However, the cell type within the TIME that is most closely associated with HCC development remains unclear. Herein, we aimed to identify cell clusters that significantly contribute to HCC development and their underlying mechanisms.<h4>Method and results</h4>Using single-cell RNA sequencing (scRNA-seq), we analyzed changes in the TIME of normal and tumor tissues, identifying plasma cells as the key cluster in HCC development. Based on plasma cell-related genes (PCRGs), we constructed and validated an eight-gene prognostic model (ST6GALNAC4, SEC61A1, SSR3, RPN2, PRDX4, TRAM1, SPCS2, CD79A) using internal and external datasets and a nomogram. Functional enrichment, miRNA network construction, and transcriptional regulation analyses were performed to explore underlying mechanisms. TIDE scores and the GDSC database were used to predict immunotherapy and chemotherapy sensitivity in different risk groups. Finally, SSR3's biological function was validated in vitro in HCC cell lines.<h4>Conclusion</h4>Plasma cells are key clusters in HCC development. A prognostic model based on the PCRGs can accurately predict the prognosis of patients with HCC and guide clinical treatment.

Also flagged:BerberineFatty Acidbeta-oxidationlipidfatty acid beta-oxidation-related proteinsACOX1
Journal Article 2025-02-26 No Snippets Zhang X, Cheng Y, Wei Q, Sang L, Li Q.
Show Full Abstract

<h4>Background</h4>Metabolic dysfunction-associated fatty liver disease (MAFLD) is a global concern. The gut microbiota and hepatic fatty acid beta-oxidation have been shown to be important factors in the development of MAFLD. Independently, exercise and berberine can significantly ameliorate symptoms of MAFLD, although the specific mechanism is not clear; moreover, it is not known whether the combination of exercise and berberine produces a better therapeutic effect.<h4>Methods</h4>Over an experimental period of 17 weeks, the effects of exercise, berberine, and a combined (exercise/berberine) intervention on the composition of the gut microbiota and the expression of hepatic fatty acid beta-oxidation related proteins were examined. The mice were divided into five treatment groups: CON (control group, n = 10), HFD (high-fat diet, n = 10), HFE (high-fat diet + exercise, n = 10), HFB (high-fat diet + berberine, n = 10), and HBE (high-fat-diet + exercise + berberine, n = 10). The dose of BBR administered for oral gavage was 300 mg/kg, once per day, for 8 weeks. Mice were subjected to treadmill exercise, 5 days per week for 8 weeks, and the intensity was increased gradually.<h4>Results</h4>Serological and histopathological results showed that exercise, berberine and a combined (exercise/berberine) intervention effectively improved liver lipid accumulation caused by a high-fat diet. Analysis of 16S rRNA showed that the three interventions restored the species and number of gut microbiota in MAFLD mice. The functional prediction of gut microbiota revealed significant differences in beta-oxidation-related units among groups. Simultaneously, exercise and berberine intervention regulated the expression of hepatic fatty acid beta-oxidation-related proteins ACOX1, HMGCS2, and CPT-1α, with the combined intervention having a more significant effect than each intervention alone.<h4>Conclusion</h4>Our findings indicate that exercise and berberine ameliorate MAFLD by regulating the gut microbiota and hepatic fatty acid beta-oxidation, suggesting that their combination may be a potential therapy for MALFD.

SLC2A14
Also flagged:GVHDtumorinterferonIFNcytotoxic responseprotein-synthesis
Journal Article 2025-02-26 ✓ 1 Snippet Bar M, El Anbari M, Rinchai D, Toufiq M, Kizhakayil D, Manjunath HS, Mathew R, Cavattoni I, Forer S, Recla M, Bibawi H, Alater A, Yahia R, Brown C, Miles NL, Vo P, Bedognetti D, Tomei S, Saleh A, Cugno C, Chaussabel D, Deola S.
In-Text Gene Mentions

…IFI16 ) andSLC2A14(cytokines/chemokines) emerged…

Show Full Abstract

<b>Background:</b> Graft versus host disease (GVHD) and the graft versus tumor (GVT) effect after allogeneic hematopoietic cell transplantation (allo-HCT) result from complex interactions between the donor immune system and the recipient environment. High-temporal longitudinal monitoring might be necessary to identify triggering events of GVHD and GVT and to intercept these events before their occurrence. But it would require an overall considerable amount of blood by venipuncture, which is unfeasible in such a fragile population. <b>Methods:</b> In this study, we implemented a targeted multiplex microfluidics q-PCR-based transcriptional fingerprint assay (TFA) on 50 µL of blood collected by a simple fingerstick to evaluate post-allo-HCT systemic immune perturbations associated with the development of GVHD. Fluctuations of a panel of 264 genes were measured in 31 allo-HCT patients by frequent (weekly or biweekly) analysis of 50 µL serial blood samples. Cross-sectional and longitudinal analyses correlated with detailed clinical annotations were performed. <b>Results:</b> Signatures of neutrophil activation and interferon (IFN) characterized the onset of acute GVHD, while an ongoing cytotoxic response was modulated in chronic mild GVHD and protein-synthesis and B-cell-related signatures characterized late acute/overlap GVHD. An unexpected erythroid signature distinguished patients with acute and mild chronic GVHD. <b>Conclusions:</b> Our micro-invasive approach unveiled the molecular heterogeneity of GVHD and identified hierarchically important biological processes conducive to different forms of GVHD. These findings increase our understanding of GVHD and reveal potentially targetable alterations. This approach might be implemented clinically to intercept GVHD before its occurrence and to modulate therapeutic interventions accordingly.

Also flagged:infectionsazurocidin 1topoisomerase Itropomyosin-1response to stimuluslocalization
Journal Article 2025-02-26 No Snippets Li J, Chen K, Zang C, Zhao X, Cheng Z, Li X, Wang C, Chen Y, Yang K.
Show Full Abstract

The somatic cell count (SCC) is widely used to assess milk quality and diagnose intramammary infections. Several whey proteins have been shown to correlate significantly with SCC and are considered potential indicators of udder health. However, the relationship between milk whey proteins and SCC has not been fully elucidated. In this study, milk samples were grouped into five categories based on SCC levels. Subsequently, whey proteins were identified using a label-free proteomics approach, and the differential abundance of proteins was validated through a selected reaction monitoring (SRM) method. The levels of various proteins, including azurocidin 1 and kininogen-2, exhibited an increase, whereas topoisomerase I, tropomyosin-1, and desmin showed a significant decrease depending on the SCCs. Principal component analysis unveiled that these proteins contributed to the developmental alterations in milk proteins. A majority of these differentially abundant proteins were associated with response to stimulus, localization, and defense response. Our results provide fundamental information on the SCC that can be utilized for evaluating milk quality and serve as potential indicators for detecting intramammary infections.

Also flagged:SeleniumHydroxyapatitecancerselenocystinesynthesisnanocrystals
Journal Article 2025-02-26 No Snippets Barbanente A, Di Cosola AM, Degli Esposti L, Iafisco M, Niso M, Margiotta N.
Show Full Abstract

Selenium (Se) is an essential micronutrient, recognized for its role in cellular redox systems and its therapeutic potential in cancer treatment. Organic selenium compounds, particularly selenocystine (SeCys), have demonstrated anticancer efficacy due to the ability to induce apoptosis and enhance the effects of chemotherapy agents. Recent studies have shown that SeCys exhibits selective toxicity against cancer cells while sparing normal cells. Unfortunately, its clinical application is limited by stability and solubility concerns. A possible solution to overcome these hurdles comes from recent advances in functionalized nanomaterials. In this study, we investigate the possible incorporation of SeCys with hydroxyapatite nanoparticles (HASeCys) via various methods (adsorption, co-precipitation, and co-precipitation through thermal decomplexation), resulting in the formation of nanocomposites with elemental selenium. The highest elemental selenium yield was achieved with a thermal decomplexing co-precipitation, highlighting the influence of synthesis parameters on Se allotrope formation. Finally, as a preliminary investigation, the HASeCys samples were tested on a panel of cancer cell lines, showing an interesting activity when the hydroxyapatite nanocrystals were functionalized with both crystalline gray and amorphous red selenium.

Also flagged:Calcium phosphateBone infectionbone infectionsantimicrobial peptidesgrapheneiodine
Journal Article 2025-02-26 No Snippets Liu X, Wang C, Wang H, Wang G, Zhang Y, Zhang Y.
Show Full Abstract

Bone infection remains a challenging condition to fully eradicate due to its intricate nature. Traditional treatment strategies, involving long-term and high-dose systemic antibiotic administration, often encounter difficulties in achieving therapeutic drug concentrations locally and may lead to antibiotic resistance. Bone cement, serving as a local drug delivery matrix, has emerged as an effective anti-infective approach validated in clinical settings. Calcium phosphate cements (CPCs) have garnered widespread attention and application in the local management of bone infections due to their injectable properties, biocompatibility, and degradability. The interconnected porous structure of calcium phosphate particles, not only promotes osteoconductivity and osteoinductivity, but also serves as an ideal carrier for antibacterial agents. Various antimicrobial agents, including polymeric compounds, antibiotics, antimicrobial peptides, therapeutic inorganic ions (TIIs) (and their nanoparticles), graphene, and iodine, have been integrated into CPC matrices in numerous studies aimed at treating bone infections in diverse applications such as defect filling, preparation of metal implant surface coatings, and coating of implant surfaces. Additionally, for bone defects and nonunions resulting from chronic bone infections, the utilization of calcium phosphate-calcium sulfate composite multifunctional cement loaded with antibacterial agents serves to efficiently deal with infection, stimulate new bone formation, and attain an optimal degradation rate of the bone cement matrix. This review briefly delves into various antibacterial strategies based on calcium phosphate cement for the prevention and treatment of bone infections, while also discussing the application of calcium phosphate-calcium sulfate composites in the development of multifunctional bone cement against bone infections.

SERPINC1
Also flagged:myasthenia gravisMGthymomaacute respiratory failureimmunoglobulinprednisone
Journal Article 2025-02-26 ✓ 1 Snippet Liu Z, Zhang L, Peng W, Chen Q, Hou Y, Zhan L, Li G.
In-Text Gene Mentions

…to inhibit both anti-thrombin-III(AT-III) and factor-IIa…

Show Full Abstract

This case report describes a geriatric male patient with myasthenia gravis (MG) secondary to giant thymoma, presenting with progressive muscle weakness and ptosis. The diagnosis of MG was confirmed through pathology, imaging, and laboratory evaluations. Considering the significant surgical risks associated with the giant thymoma, adjuvant chemotherapy was initiated. Unfortunately, 2 weeks following chemotherapy, the patient developed acute respiratory failure and sudden loss of consciousness. Emergency endotracheal intubation was performed, and he was then transferred to the intensive care unit (ICU) and treated with immunoglobulin, plasmapheresis, prednisone, and pyridostigmine. During ICU hospitalization, the patient developed severe lower limb edema accompanied by increased skin temperature, particularly on the left side. Ultrasound imaging confirmed extensive thrombosis in the left iliac and femoral veins, with thrombosis involving 50%-67% of the venous lumen. To prevent the risk of pulmonary embolism (PE), an inferior vena cava filter was implanted, and low-molecular weight heparin (LMWH) was prescribed for anticoagulation. Unfortunately, the patient later experienced intermittent melena and heparin-induced thrombocytopenia (HIT), with hemoglobin levels decreasing to 55 g/L and platelet counts decreasing to 57 × 10<sup>9</sup>/L. Given the adverse events associated with LMWH, sulodexide (SDX) was substituted as a novel anticoagulant with multiple benefits, including reduced thrombosis and bleeding risk, anti-inflammatory effects, and vascular endothelium protection. SDX demonstrated excellent efficacy and safety, with no adverse effects observed during the 3-year follow-up period. In conclusion, SDX should be considered an ideal potential option for long-term anticoagulation in patients with complex conditions such as MG with both thrombotic and bleeding risks.

CA10
Also flagged:amantadine hydrochlorideinfectionsefflux pumprhodamine 6GazoleAMH
Journal Article 2025-02-26 ✓ 1 Snippet Li X, Zhi Y, Duan X, Chen X, Cui M, Zheng S.
In-Text Gene Mentions

…phospholipase activity ofCA10, reducing its virulence.…

Show Full Abstract

<h4>Introduction</h4>The increasing resistance of <i>Candida albicans</i> (<i>C. albicans</i>) to conventional antifungal drugs poses a great challenge to the clinical treatment of infections caused by this yeast. Drug combinations are a potential therapeutic approach to overcome the drug- resistance of <i>C. albicans</i>. This study explored the synergistic effects of amantadine hydrochloride (AMH) combined with azole antifungal drugs against drug-resistant <i>C. albicans in vitro</i> and <i>in vivo</i>.<h4>Methods</h4>The <i>in vitro</i> sensitivity of <i>Candida</i> spp. to drugs was determined by the microdilution method. The effect of drugs on the efflux pump activity of <i>C. albicans</i> was determined by the rhodamine 6G tracer method. The egg yolk agar plate method was used to determine the activity of extracellular phospholipase, a <i>C. albicans</i> virulence factor. The <i>Galleria mellonella</i> model of <i>C. albicans</i> infection was used to test the <i>in vivo</i> efficacy of the combination therapy.<h4>Results</h4><i>In vitro</i> experiments showed that combinations of AMH with azole antifungal drugs had synergistic antifungal effects on planktonic cells of drug-resistant <i>C. albicans</i>, with fractional inhibitory concentration index values of <0.5. The <i>in vivo</i> synergistic effects and mechanism of drug combinations with AMH were further studied using fluconazole (FLC) as a representative azole antifungal drug. <i>In vivo</i>, <i>G. mellonella</i> larvae were used to evaluate the antifungal efficacy of AMH +FLC. AMH + FLC treatment increased the survival rate of larvae infected with drug-resistant <i>C. albicans</i> and reduced tissue invasion. Studies of the mechanism of synergy showed that AMH inhibited drug efflux pump activity in drug-resistant <i>C. albicans</i>, and that AMH + FLC synergistically inhibited early biofilms and the extracellular phospholipase activity of drug-resistant <i>C. albicans</i>.<h4>Conclusion</h4>This study provides strong evidence that combinations of non-antifungal drugs and antifungal drugs can effectively overcome drug-resistant <i>C. albicans</i> infection. Both AMH and FLC are FDA-approved drugs, eliminating concerns about safety. Our findings provide a foundation for further clinical antifungal research.

PLCL1
Also flagged:Renal cell carcinomaRCCmalignant tumorcancersccRCCsunitinib
Journal Article 2025-02-26 ✓ 5 Snippets Li W, Shi J, Lv Q, Miao D, Tan D, Lu X, Xiong H, Luo Q, Xia Y, Han Y, Dong X, Huang G, Zhang X, Yang H.
In-Text Gene Mentions

…phospholipase C-like 1 (PLCL1) reduced lipid accumulation…

…ession lentivirus (NM_032440),PLCL1shRNA lentivirus (NM_006226),…

…between NR2F1 andPLCL1, as well as…

…as RUNX1 andPLCL1.…

…full-length plasmids ofPLCL1promoter region, the…

Show Full Abstract

Clear cell renal cell carcinoma (ccRCC) is the typical pathological subtype of renal cell carcinoma (RCC), representing about 80% of RCC. Reprogramming of lipid metabolism is one of the nonnegligible pathogeneses in ccRCC. Currently, the underlying regulatory mechanisms of lipid metabolism in ccRCC remain inadequately understood. In this study, we performed bioinformatics analyses and experiments both <i>in vivo</i> and <i>in vitro</i> to explore the biological functions and specific mechanisms of the ligand dependent nuclear receptor corepressor LCOR in ccRCC. Mechanistically, RUNX1 was a transcriptional suppressor of PLCL1, LCOR could interact with RUNX1 to relieve RUNX1-mediated repression of PLCL1, leading to increased PLCL1 expression, which, in turn, inhibited the tumor progression and lipid accumulation in ccRCC. Furthermore, PLCL1 decreased lipid accumulation through UCP1-mediated lipid browning and facilitated tumor apoptosis by activating p38 phosphorylation. In conclusion, the LCOR-RUNX1-PLCL1 axis provides a novel molecular mechanism underlying the progression and lipid storage of ccRCC. LCOR modulation represents a potential therapeutic strategy for the treatment in ccRCC.

OLFM4
Also flagged:Olfactomedin-like protein 3OLFML3406amino acidglycoproteinhOLF44 1
Journal Article 2025-02-26 ✓ 3 Snippets Yu Q, Mei H, Gu Q, Zeng R, Li Y, Zhang J, Gao C, Fang H, Qu J, Liu J.
In-Text Gene Mentions

…that olfactomedin 4 (OLFM4), which possesses an…

…a connection betweenOLFM4and macrophages in…

…the function ofOLFM4in inhibiting cathepsin…

Show Full Abstract

Olfactomedin-like protein 3 (OLFML3), belonging to olfactomedin (OLF) protein family, has poorly defined functions. Recent studies have reported the functions of OLFML3 in anti-viral immunity and tumorigenesis. In this study, we investigated the roles of OLFML3 in macrophages. In LPS- or <i>Pseudomonas aeruginosa</i>-induced acute lung injury (ALI) mouse model, OLFML3 depletion exacerbated inflammatory response, leading to reduced survival. OLFML3 achieved the <i>in vivo</i> activity by regulating macrophage phagocytosis and migration. Mass spectrometry analysis revealed immunoresponsive gene 1 (IRG1) as an OLFML3-interacting protein. IRG1 is a mitochondrial decarboxylase that catalyzes the conversion of <i>cis</i>-aconitate to itaconate, a myeloid-borne mitochondrial metabolite with immunomodulatory activities. Further investigation showed that OLFML3 could prevent LPS-induced mitochondrial dysfunction in macrophages by maintaining the homeostasis of mitochondrial membrane potential (MMP), mitochondrial reactive oxygen species (mtROS) and itaconate-related metabolites. In-depth protein-protein interaction studies showed that OLFML3 could promote IRG1 mitochondrial localization via a mitochondrial transport protein, apoptosis inducing factor mitochondria associated 1 (AIFM1). In summary, our study showed that OLFML3 could facilitate IRG1 mitochondrial localization and prevent LPS-induced mitochondrial dysfunction in macrophages.

Also flagged:cardiac hypertrophypathogenesismyocardial hypertrophydegradationcycloheximidecarnitine palmitoyltransferase-1b
Journal Article 2025-02-26 No Snippets Chen L, Wang W, Zhao Y, Zhang S, Zhou X.
Show Full Abstract

<b>Background:</b> Circular RNAs (circRNAs) exhibit differential expression in cardiac hypertrophy; however, their functions and mechanisms remain largely unexplored. This study aimed to determine the involvement of circRNAs in the pathogenesis of myocardial hypertrophy. <b>Methods:</b> A mouse model of cardiac hypertrophy was established using transverse aortic constriction (TAC) and differentially expressed circRNAs were identified via high-throughput sequencing. To facilitate gene overexpression or knockdown, related viruses were injected into myocardial tissues of the mice. Cardiomyocyte hypertrophy was assessed using quantitative real-time PCR and immunofluorescence staining. RNA immunoprecipitation, RNA pull-down assay and fluorescence <i>in situ</i> hybridization were conducted to confirm the interaction between circRNAs and proteins. Protein expression and degradation were evaluated using cycloheximide-chase assay, immunoprecipitation, and western blotting. <b>Results:</b> Cardiac hypertrophy-associated circRNA (CHACR) was significantly downregulated in myocardial tissues from TAC mice. CHACR can attenuate cardiac hypertrophy through upregulating carnitine palmitoyltransferase-1b (CPT1b) expression. Mechanistically, CHACR directly interacted with CPT1b and decreased its protein degradation by inhibiting the ubiquitin-proteasome pathway to increase its expression in cardiomyocytes. Moreover, CPT1b overexpression decreased L-carnitine levels and inhibited the Jak2/Stat3 signaling pathway, which was associated with the pathogenesis of myocardial hypertrophy. <b>Conclusions:</b> CHACR attenuated cardiomyocyte hypertrophy by facilitating the expression of CPT1b, which plays a role in regulating the Jak2/Stat3 pathway via L-carnitine. CHACR may thus be a potential therapeutic target for pathological myocardial hypertrophy.

DCC
Also flagged:GnRHreproductioninfertilitygene expressioncell migrationsynapse
Journal Article 2025-02-26 ✓ 3 Snippets Zouaghi Y, Alpern D, Gardeux V, Russeil J, Deplancke B, Santoni F, Pitteloud N, Messina A.
In-Text Gene Mentions

…and humans likeDCC/Netrin (m9) 58 -…

…including NLGN3 ,DCC, NTN1 ,…

…, 56 , Netrin/DCC58 - 60…

Show Full Abstract

<b>Rationale:</b> Neurons producing Gonadotropin-Releasing Hormone (GnRH) are essential for human reproduction and have to migrate from nose to brain during prenatal life. Impaired GnRH neuron biology results in alterations of the reproductive axis, including delayed puberty and infertility, with considerable effects on quality of life and metabolic health. Although various genes have been implicated, the molecular causes of these conditions remain elusive, with most patients lacking a genetic diagnosis. <b>Methods:</b> GnRH neurons and non-GnRH cells were FACS-isolated from mouse embryo microdissections to perform high-resolution transcriptomic profiling during mouse embryonic development. We analyzed our dataset to reveal GnRH neuron molecular identity, gene expression dynamics, and cell-to-cell communication. The spatial context of candidate genes was validated using <i>in situ</i> hybridization and spatial transcriptomic analysis. The possible links with human reproduction in health and disease were explored using enrichment analysis on GWAS data and analyzing the genetic burden of patients with congenital GnRH deficiency. <b>Results:</b> GnRH neurons undergo a profound transcriptional shift as they migrate from the nose to the brain and display expression trajectories associating with distinct biological processes, including cell migration, neuronal projections, and synapse formation. We revealed a timely and spatially restricted modulation of signaling pathways involving known and novel molecules, including Semaphorins and Neurexins, respectively. A particular set of genes, whose expression in GnRH neurons timely rises in late developmental stages, showed a strong association with GWAS genes linked with human reproductive onset. Finally, some of the identified trajectories harbor a diagnostic potential for congenital hypogonadism. This is supported by genetic analysis in a large cohort of patients affected by congenital GnRH deficiency, revealing a high mutation burden in patients compared to healthy controls. <b>Conclusion:</b> We charted the landscape of gene expression dynamics underlying murine GnRH neuron embryonic development. Our study highlights new genes in GnRH neuron development and provides novel insights linking those genes with human reproduction.

DCC
Also flagged:neonatal respiratory distresscongenital malformationsmetabolic diseasesintrauterine growth restrictionoxygengestation
Journal Article 2025-02-26 ✓ 4 Snippets Wang T, Wang S, Zhou M, Duan Y, Chen W, Pan L, Li Z, Zhou J, Liu JQ.
In-Text Gene Mentions

…Basic characteristics ofDCCand ICC…

…(206/1418) in theDCCgroup compared to…

…the effects ofDCCversus ICC on…

…the effects ofDCCacross different maturity…

Show Full Abstract

<h4>Background</h4>Delayed cord clamping (DCC) has the potential to alleviate respiratory distress by augmenting blood volume and oxygenation, although there is currently a lack of direct evidence to support this. Late preterm and early term infants born via elective cesarean section (CS) are known to be more vulnerable to the neonatal respiratory distress (NRD). This study was designed to examine the effect of DCC on NRD of these infants.<h4>Methods</h4>Conducted from January 1, 2019 to January 31, 2024 at Shanghai First Maternity and Infant Hospital, this single-centre, phase Ⅲ, open-label randomised controlled trial included newborns delivered via elective CS between 34<sup>+0</sup> and 38<sup>+6</sup> weeks of gestation. Participants were excluded if fetus had suspected or confirmed congenital malformations, metabolic diseases, intrauterine growth restriction, late fetal heart rate deceleration or fetal distress. Pregnant women and their infants were randomised into immediate cord clamping (ICC) within 10 s of birth or DCC for 60 s and stratified by late preterm or early term. The primary outcome was the incidence of NRD which was defined as requiring oxygen or airway pressure support within the first 24 h of life. This study was approved from the Ethics Committee of Shanghai First Maternity and Infant Hospital, School of Medicine, Tongji University (KS 18126, KS1947). Chinese Clinical Trial Registry (ChiCTR1800017865), registered on August 18th, 2018.<h4>Findings</h4>Of 2610 randomised women, 1418 neonates were included in the DCC group and 1419 in the ICC group. The mean maternal age for both groups was 33 (4) years, and all mothers were of Han ethnicity. The mean gestational age of the neonates was 37.9 (0.9) weeks in both groups. NRD occurred in 119 (8.4%) in DCC versus 135 (9.5%) in ICC (Adjusted Relative Risk [aRR] 0.93, 95% CI 0.75-1.14). There were no significant differences in infant and maternal adverse events such as low Apgar score (aRR 0.74, 95% CI 0.25-2.19), hypothermia (aRR 1.00, 95% CI 0.89-1.12), hypoglycemia (aRR 1.04, 95% CI 0.77-1.38), maternal intrapartum massive bleeding (aRR 0.96, 95% CI 0.76-1.19), or the requirement for transfusion (aRR 0.34, 95% CI 0.10-1.15).<h4>Interpretation</h4>Delayed cord clamping was safe for both mothers and infants in late preterm and early term delivered by elective cesarean section, while it did not reduce the risk of early respiratory diseases.<h4>Funding</h4>This trial was funded by Shanghai Municipal Health Commission, China in 2019 (201940140) and National Natural Science Foundation of China in 2022 (82204047).

CSE1L
Also flagged:Mitochondrialmalignant tumorpermeability transition-driven necrosis-relatedpathogenesistumorsreverse transcription
Journal Article 2025-02-26 ✓ 1 Snippet Jin J, Wang M, Liu Y, Li W, Zhang X, Cheng Z.
In-Text Gene Mentions

…of BAK1 andCSE1Lwas found to…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a prevalent malignant tumor, and the current treatment methods exhibit various limitations. In recent years, the role of mitochondrial permeability transition-driven necrosis-related genes (MPT-DNRGs) in the pathogenesis and progression of severe diseases, particularly tumors, has garnered significant attention. This study aimed to identify new targets and concepts for MPT-DNRG-targeted therapy in HCC.<h4>Methods</h4>In this study, we utilized HCC-related datasets and MPT-DNRGs to identify differentially expressed genes (DEGs) between HCC patients and control groups. By conducting a cross-analysis of the results of DEGs and MPT-DNRGs, we screened candidate genes. Subsequently, univariate Cox regression and least absolute shrinkage and selection operator (LASSO) regression analysis methods were employed to identify prognostic genes, which were used to construct a risk model and calculate individual risk scores for HCC patients. Additionally, we performed univariate and multivariate Cox regression analyses to identify independent prognostic factors and constructed a column chart based on these factors to predict the survival probability of HCC patients. Furthermore, gene set enrichment analysis (GSEA), the immune microenvironment, chemotherapy drugs, and the expression of prognostic genes between the two groups were analyzed. Finally, the expression of these prognostic genes was further confirmed using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) technology.<h4>Results</h4>In this study, we identified 8,515 DEGs between HCC and control samples. By performing intersection analysis between DEGs and MPT-DNRGs, we pinpointed 15 candidate genes. Subsequently, through univariate Cox regression and LASSO regression analysis, we identified six genes (<i>LMNB2</i>, <i>LMNB1</i>, <i>BAK1</i>, <i>CASP7</i>, <i>LMNA</i>, and <i>AKT1</i>) that were significantly associated with overall survival (OS) in patients. Based on the median risk score, we categorized HCC patients into high-risk and low-risk groups. Kaplan-Meier (KM) survival analysis results demonstrated a significant difference in OS between the two groups, which was further validated through additional assessment. Furthermore, we constructed a nomogram to predict the survival probability of HCC patients. Moreover, GSEA revealed a crucial correlation between these genes and HCC, and highlighted a close association between risk scores and regulatory T cells. We also identified four chemotherapy drugs related to HCC. Finally, in both the training and validation cohorts, <i>LMNB2</i>, <i>LMNB1</i>, and <i>LMNA</i> exhibited high expression levels in tumor samples. Further validation using RT-qPCR confirmed that the expression of all prognostic genes was significantly higher in HCC group compared to the control group.<h4>Conclusions</h4>This study explored six prognostic genes (<i>LMNB2</i>, <i>LMNB1</i>, <i>BAK1</i>, <i>CASP7</i>, <i>LMNA</i> and <i>AKT1</i>) associated with MPT-DNRGs in HCC, which provides a reference for further research on HCC.

CACNA1E
Also flagged:pyroptosiscancerhepatocellular carcinomatranslationspyroptosis-relatedpyroptosis-
Journal Article 2025-02-26 ✓ 1 Snippet Chen R, Luo N, Li P, Song M, Ji L, Gao X, Xia X, Capasso M, Sun Y.
In-Text Gene Mentions

…, ARID1A ,CACNA1E, CCDC168 ,…

Show Full Abstract

<h4>Background</h4>Pyroptosis has been recently identified as a hallmark of cancer biology; however, the potential of pyroptosis-related genes (PRGs) as prognostic markers has not been fully elucidated in hepatocellular carcinoma (HCC). The aim of this study was to develop a PRG-associated risk signature for prediction prognosis in patients with HCC.<h4>Methods</h4>We identified 35 PRGs from the published literature, and pyroptosis subtypes were identified through bioinformatics methods. The risk score model was established by applying least absolute shrinkage and selection operator (LASSO) Cox regression method in The Cancer Genome Atlas (TCGA) cohort and validated in International Cancer Genome Consortium (ICGC) datasets. Additionally, immune infiltration, enriched pathways, and genomic alterations were compared between the high- and low-risk score subgroups. Finally, a nomogram containing the pyroptosis risk score and other prognosis-related clinical factors was developed for predicting the overall survival of patients with HCC.<h4>Results</h4>Based on the expression profile of PRGs, we determined two pyroptosis-related subtypes (cluster A and cluster B) of HCC associated with different immune characteristics and significantly different prognoses. The risk score model showed that upregulation of <i>GPX4, CASP8, NOD2,</i> and <i>GSDME</i> was associated with poor overall survival (OS), while high expression of <i>NLRP6</i> was associated with good prognosis. Compared with group with a lower risk score, the group with a high risk score had worse prognosis (P<0.001) and a high level of immune cell infiltration. Functional analysis indicated that the highly expressed genes in the high-risk group were mainly enriched in various signaling pathways, while the genes with low expression in the high-risk group were mainly enriched in different biochemical metabolic translations. Genomic alterations in high-risk and low-risk populations suggested that mutations in the <i>TP53</i> gene are highly associated with pyroptosis in patients with HCC. A nomogram including risk score and TNM stage demonstrated good prognostic ability in predicting 1-year, 3-year, and 5-year OS.<h4>Conclusions</h4>We developed and verified a prognostic risk model based on PRGs for patients with HCC, which may provide a robust tool for predicting outcomes in this setting.

DCC
Also flagged:periampullary carcinomafolinic acidoxaliplatingemcitabineprimary tumorcell cycle
Journal Article 2025-02-26 ✓ 1 Snippet Wang Q, Wang X, Shi Z, Yang Y, Ai L, Zhang H, Yang J.
In-Text Gene Mentions

…including AC, PC,DCC, and DC; (II)…

Show Full Abstract

<h4>Background</h4>Periampullary carcinoma (PAC) is a relatively rare but highly aggressive malignancy, posing challenges to the determination of the optimal therapeutic approach. The objective of this study was to clarify the potential of histopathological typing in guiding chemotherapy selection for patients with advanced PAC and to characterize the distinct molecular features, underlying functional changes, and regulatory mechanisms associated with the different subtypes.<h4>Methods</h4>We conducted a retrospective analysis of clinical data from patients with advanced PAC admitted to the Oncology Department of Xijing Hospital between January 2015 and May 2022. These patients received first-line chemotherapy with either FOLFOX (folinic acid, fluorouracil, and oxaliplatin) or gemcitabine-based regimens. Certain patients were divided into the pathological typing group and the control group. The pathological typing group received subtype-specific chemotherapy regimens, while the control group received chemotherapy regimens based on the primary tumor site. We compared the median progression-free survival (PFS) and overall survival (OS) between the two groups. Using publicly available databases (GSE60980), we conducted differential gene screening, enrichment analysis, and immune cell infiltration assessment. A protein-protein interaction (PPI) network was constructed based on the differentially expressed genes, resulting in the identification of 60 node genes. Subsequently, a core gene selection using the least absolute shrinkage and selection operator (LASSO) regression machine learning algorithm was performed to identify the key genes specific to PAC-PB subtype.<h4>Results</h4>The pathological typing group consisted of 46 patients, with 26 classified as the PB subtype and 20 as the IN subtype, while the control group comprised 40 patients. Compared to those in the control group, patients in the pathological typing group demonstrated significant improvements in overall response rate (20.5% <i>vs</i>. 12.9%; P=0.04), median PFS (8.1 <i>vs</i>. 5.4 months; P=0.04), and median OS (34 <i>vs</i>. 25.9 months; P=0.02). Multivariate Cox regression analysis revealed that pathological typing independently influenced PFS [hazard ratio (HR) =0.20, 95% confidence interval (CI): 0.10-0.44; P=0.009] and OS (HR =0.21, 95% CI: 0.17-0.71; P=0.02). Using a publicly available PAC cohort (GSE60980), we selected 154 differentially expressed genes, which were significantly enriched in signaling pathways related to the cell cycle, fibroblasts, and epithelial-mesenchymal transition. Analysis of immune cell infiltration indicated a significant increase in the abundance of fibroblast cells and a significant decrease in that of B cells and γδ T cells in the PAC-PB subtype. Furthermore, we identified core genes specific to the PAC-PB subtype and used them to construct a PAC-PB diagnostic model.<h4>Conclusions</h4>Pathologic typing-guided individualized chemotherapy resulted in prolonged survival for patients with advanced PAC. The PB and IN subtypes of PAC exhibit distinct molecular regulatory mechanisms and immune infiltration microenvironments. These findings underscore the importance of considering subtype-specific factors in the development of a PAC-PB diagnostic model.

HFE
Also flagged:Alopecia Areataautoimmune diseaseAAskin diseasesautoimmune responseHair
Journal Article 2025-02-26 ✓ 1 Snippet Al-Eitan LN, Alasmar MK, Aljamal HA, Mihyar AH, Alghamdi MA.
In-Text Gene Mentions

…[ 21 ],HFE(rs1799945) [ 22…

Show Full Abstract

<i>Background and Objectives</i>: Alopecia areata (AA) is a common cell-mediated autoimmune disease of the hair follicle that results in hair loss patches, affecting males and females of all ages and ethnicities. Although its etiology is not fully understood, AA is hypothesized to have a multifactorial basis with a strong genetic association. This study aims to replicate the genetic association of several risk loci in the Jordanian population for the first time. <i>Materials and Methods</i>: Genomic DNA samples of 152 patients with AA and 150 control individuals were extracted from EDTA blood tubes collected from dermatology clinics, in addition to the clinical data of participants. Genetic sequencing of the 21 targeted risk loci was carried out using the Sequenom MassARRAY<sup>®</sup> system (iPLEX GOLD), and the results were statistically analyzed using the Statistical Package for the Social Sciences. <i>Results</i>: The results compared the distribution of alleles and genotypes and the association between control individuals and AA patients. However, our results do not support a significant association of all of the 21 SNPs in our AA cohort (<i>p</i> > 0.05). <i>Conclusions:</i> Our data emphasize that AA has a varied genetic component between ethnic groups and suggest that other additional environmental and psychological triggers may be involved.

HFE
Also flagged:Ferroptosisdeathsignaling transductionneurodegenerative disorderscardiovascular ailmentsiron
Journal Article 2025-02-26 ✓ 1 Snippet Wang H, Xie Y.
In-Text Gene Mentions

…Diseases such ashemochromatosisand beta-thalassemia often…

Show Full Abstract

In recent years, ferroptosis, as an emerging modality of programmed cell death, has captured significant attention within the scientific community. This comprehensive review meticulously canvasses the pertinent literature of the past few years, spanning multiple facets. It delves into the intricate mechanisms underpinning ferroptosis, tracks the evolution of its inducers and inhibitors, and dissects its roles in a diverse array of diseases, as well as the resultant therapeutic implications. A profound exploration is conducted of the functional mechanisms of ferroptosis-related molecules, intracellular pathways, metabolic cascades, and signaling transduction routes. Novel ferroptosis inducers and inhibitors are introduced in detail, covering their design blueprints, synthetic methodologies, and bioactivity profiles. Moreover, an exhaustive account is provided regarding the involvement of ferroptosis in malignancies, neurodegenerative disorders, cardiovascular ailments, and other pathologies. By highlighting the pivotal status and potential therapeutic regimens of ferroptosis in various diseases, this review aspires to furnish a thorough and profound reference framework for future investigations and clinical translations in the ferroptosis domain.

PCDH17
Also flagged:MethylationTriple-Negative Breast Cancercancerestrogenprogesterone receptorsHER2
Journal Article 2025-02-26 ✓ 1 Snippet Tarhonska K, Wichtowski M, Wow T, Kołacińska-Wow A, Płoszka K, Fendler W, Zawlik I, Paszek S, Zuchowska A, Jabłońska E.
In-Text Gene Mentions

…tumor suppressor genePCDH17had significantly higher…

Show Full Abstract

<b>Objectives:</b> Triple-negative breast cancer (TNBC) is an aggressive cancer subtype with limited treatment options due to the absence of estrogen, progesterone receptors, and HER2 expression. This study examined the impact of DNA methylation and demethylation markers in tumor tissues on TNBC patients' response to neoadjuvant chemotherapy (NACT) and analyzed the correlation between 5-methylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) and clinicopathological characteristics, offering new insights into the predictive value of these epigenetic markers. <b>Methods:</b> The study included 53 TNBC female patients, 19 of whom received neoadjuvant chemotherapy (NACT) before surgery. Global DNA methylation and demethylation levels were quantified using an ELISA-based method to measure 5-mC and 5-hmC content in DNA isolated from pre-treatment biopsy samples (in patients undergoing NACT) and postoperative tissues (in patients without NACT). <b>Results:</b> In patients who received NACT, those with disease progression had significantly higher pretreatment levels of 5-hmC (<i>p</i> = 0.028) and a trend toward higher 5-mC levels (<i>p</i> = 0.054) compared to those with pathological complete response, partial response, or stable disease. Higher 5-mC and 5-hmC levels were significantly associated with higher tumor grade (<i>p</i> = 0.039 and <i>p</i> = 0.017, respectively). Additionally, a positive correlation was observed between the Ki-67 proliferation marker and both 5-mC (r<sub>S</sub> = 0.340, <i>p</i> = 0.049) and 5-hmC (r<sub>S</sub> = 0.341, <i>p</i> = 0.048) levels in postoperative tissues. <b>Conclusions:</b> Our study highlights the potential of global DNA methylation and demethylation markers as predictors of tumor aggressiveness and chemotherapy response in TNBC. Further research in larger cohorts is necessary to validate these markers' prognostic and predictive value.

HFE
Also flagged:lamin Adilated cardiomyopathycardiomyopathiessyndromic dilated cardiomyopathyintellectual disabilityhypergonadotropic hypogonadism
Journal Article 2025-02-26 ✓ 1 Snippet Flury G, Arquint F.
In-Text Gene Mentions

…EMD, FLNC, GATAD1,HFE, ILK, JUP, JPH2,…

Show Full Abstract

<h4>Background</h4>Phenotyping and genotyping of cardiomyopathies are becoming increasingly important. We describe a rare form of syndromic dilated cardiomyopathy, years after the initial diagnosis of intellectual disability and hypergonadotropic hypogonadism, known as Najjar-Malouf syndrome or cardiogenital syndrome.<h4>Case summary</h4>A 45-year-old woman was referred for inpatient treatment because of progressive dyspnoea, chest tightness, and ankle oedema. She had a diagnosis of undefined psychomotor development delay and hypergonadotropic hypogonadism, for which she has been receiving hormone substitution treatment since she was 19 years old. The physical examination revealed signs of congestion as well as a right convex thoracic scoliosis and hyperkyphosis. Cardiac biomarkers were elevated, and echocardiography showed severe dilated cardiomyopathy with impaired systolic function, severe pulmonary hypertension, and secondary mitral regurgitation. Cardiac magnetic resonance imaging showed a severely dilated left ventricle with severely reduced left ventricular ejection fraction (20%), thinned myocardium, and late-gadolinium enhancement predominantly in the septum. Genetic screening for dilatative cardiomyopathy-associated genes revealed no mutations, in particular, no mutation of the lamin A/C (LMNA) gene. The patient progressed to heart failure with severely reduced ejection fraction 26 years after diagnosis of psychomotor development delay and hypergonadotropic hypogonadism.<h4>Discussion</h4>The triad of intellectual disability, hypergonadotropic hypogonadism, and cardiomyopathy enabled the diagnosis of Najjar-Malouf syndrome, also known as cardiogenital syndrome. This case underscores the diagnostic and therapeutic challenges of Najjar-Malouf syndrome, emphasizing the significance of thorough evaluation and genetic testing, particularly considering the association with LMNA mutations. Further research is needed to improve understanding and management strategies for this rare syndrome.

TNFSF4
Also flagged:Vitamin DasthmaVit-Dimmune responsescalciumion homeostasis
Journal Article 2025-02-26 ✓ 1 Snippet Fangal VD, Kılıç A, Mirzakhani H, Litonjua AA, Demay MB, Levy BD, Weiss ST.
In-Text Gene Mentions

…Tbx21 , andTnfsf4, were upregulated,…

Show Full Abstract

Circulating Vitamin D (Vit-D) has emerged as a potent immune modulator in asthma, yet its direct impact on T<sub>H</sub>2 cell regulation, the central effectors of allergic inflammation, remains unclear. Preliminary transcriptomic analysis of neonatal cord blood revealed that gestational Vit-D deficiency corresponds to elevated adaptive and innate immune responses, driven by T<sub>H</sub>2 immunity and antimicrobial responses related to asthma inflammation. To elucidate cell-specific molecular mechanisms of Vit-D, we differentiated murine T<sub>H</sub>2 cells <i>in vitro</i> under conditions mimicking Vit-D sufficiency and deficiency. Our findings demonstrate that Vit-D exposure promotes intracellular calcium ion homeostasis while suppressing prominent inflammatory cytokines characteristic of asthma. Conversely, Vit-D deficiency reprograms T<sub>H</sub>2 cell lineage commitment, inducing overexpression of cytolytic molecules and major histocompatibility complex (MHC) class I molecules-traits typically associated with cytotoxicity rather than the canonical helper function. Our findings underscore Vit-D's role in stabilizing T<sub>H</sub>2 cell function and fate, offering insights into asthma and autoimmune disorders.

SUDS3
Also flagged:cellular senescenceshoulder tendinopathiesEnhancer of zeste 2EZH2tendinopathiesp16
Journal Article 2025-02-25 ✓ 1 Snippet Bühler D, Hilpert M, Barbero A, Müller AM, Müller SA, Martin I, Pelttari K.
In-Text Gene Mentions

…epigenetic master regulatorpolycomb repressiverepressive complex.…

Show Full Abstract

<h4>Aims</h4>Our aim was to investigate occurrence of senescent cells directly in tendon tissue biopsies from patients with chronic shoulder tendinopathies, and to correlate senescence with Enhancer of zeste 2 (EZH2) expression, the functional subunit of the epigenetic master regulator polycomb repressive complex.<h4>Methods</h4>Human proximal long head of biceps tendons from patients with different chronic shoulder pathologies (n = 22), and controls from patients with humerus fracture (n = 6) and pathology (n = 4), were histologically scored for degeneration and analyzed for gene and protein expression of tendon specific factors, senescence markers, and EZH2. Tissues were further exposed to senotherapeutic compounds and the USA Food and Drugs Administration-approved selective EZH2 inhibitor EPZ-6438 and their senescence-associated secretory phenotype (SASP) assessed.<h4>Results</h4>Expression of senescence markers (<i>CDKN2A</i>/p16, <i>CDKN2D</i>/p19) and <i>EZH2</i> was significantly higher in tendinopathies compared to fracture or healthy tissue controls and positively correlated with the degree of tissue degeneration. Immunofluorescent stainings demonstrated colocalization of p16 and p19 with EZH2 in tenocytes. Treatment of tendon biopsies with EPZ-6438 reduced secretion of a panel of SASP factors, including interleukin-6 (IL6), IL8, matrix metalloproteinase-3 (MMP3) or GRO1, similarly to the senotherapeutic compound AG490.<h4>Conclusion</h4>We demonstrate that senescence traits accumulate in pathological tendon tissues and positively correlate with tissue degeneration. Increased expression of <i>CDKN2A</i>/p16 and <i>CDKN2D</i>/p19 coincides with EZH2 expression, while its inhibition decreased the secretion of SASP factors, indicating a possible regulatory role of EZH2 in tenocyte senescence in tendinopathies. Reduction of cellular senescence, e.g. with EPZ-6438, opens ways to new potential therapeutic approaches for enhancing regeneration in chronic tendinopathies.

DNAH10
Also flagged:asthenoteratozoospermiamale infertilitydynein axonemal heavy chain 10Hematoxylinaxonememicrotubule
Journal Article 2025-02-25 ✓ 5 Snippets Shoaib M, Zubair M, Shah W, Uddin M, Hussain A, Mustafa G, Rahim F, Zhang H, Ali I, Abbas T, Raza Y, Fan SX, Shi QH.
In-Text Gene Mentions

…bi-allelic variants inDNAH10lead to multiple…

…chain 10 (DNAH10), in three…

…heterozygous mutation (DNAH10: c.9409C>A [p.P3137T];…

…heterozygous mutation (DNAH10: c.8849G>A [p.G2950D];…

…revealed loss ofDNAH10protein signals along…

Show Full Abstract

<h4>Abstract</h4>Multiple morphological abnormalities of sperm flagella (MMAF) is a severe form of asthenoteratozoospermia, characterized by morphological abnormalities and reduced motility of sperm, causing male infertility. Although approximately 60% of MMAF cases can be explained genetically, the etiology of the remaining cases is unclear. Here, we identified two novel compound heterozygous variants in the gene, dynein axonemal heavy chain 10 ( DNAH10 ), in three patients from two unrelated Pakistani families using whole-exome sequencing (WES), including one compound heterozygous mutation ( DNAH10 : c.9409C>A [p.P3137T]; c.12946G>C [p.D4316H]) in family 1 and another compound heterozygous mutation ( DNAH10 : c.8849G>A [p.G2950D]; c.11509C>T [p.R3687W]) in family 2. All the identified variants are absent or rare in public genome databases and are predicted to have deleterious effects according to multiple bioinformatic tools. Sanger sequencing revealed that these variants follow an autosomal recessive mode of inheritance. Hematoxylin and eosin (H&E) staining revealed MMAF, including sperm head abnormalities, in the patients. In addition, immunofluorescence staining revealed loss of DNAH10 protein signals along sperm flagella. These findings broaden the spectrum of DNAH10 variants and expand understanding of the genetic basis of male infertility associated with the MMAF phenotype.

SOX6
Also flagged:SOX2male infertilityIGSF1metabolismmitochondrialSOX17
Journal Article 2025-02-25 ✓ 1 Snippet He W, Luo Q, Zhao J, Wang M, Zhao A, Feng L, Reda A, Lindgren E, Stukenborg JB, Chen J, Deng Q.
In-Text Gene Mentions

…SOX15, SOX3 andSOX6was among our…

Show Full Abstract

Klinefelter syndrome (KS), characterized by the presence of at least one extra X-chromosome, is a common cause of male infertility. However, the mechanism underlying the failure of germline specification is not well studied. Intriguingly, the differentiation efficiency of female human pluripotent stem cells (hPSCs) is often lower than that of male. This study investigates how X-linked gene dosage affects human primordial germ cell-like cells (hPGCLCs) specification in both healthy and diseased conditions. This work reveals that X-linked genes play a multifaceted role against the fate competency to hPGCLCs, with escape genes IGSF1 and CHRDL1 inhibiting the TGF-beta/Activin A and BMP pathways, respectively. Notably, this work identifies a previously unrecognized role of SOX2, upregulated by the escape gene USP9X, elucidating a species-specific function in the mammalian germline. The USP9X-SOX2 regulatory axis profoundly influenced cellular metabolism, mitochondrial morphology, and progenitor competence in hPGCLCs specification. Furthermore, the inability to downregulate SOX2 and upregulate SOX17 in response to BMP signaling impedes downstream gene activation due to motif binding competition. These findings shed novel insights into the human germline specification by elucidating the divergent roles of SOX2 versus SOX17 in mammals, influenced by X-linked gene dosage effects. These results offer potential applications for improving the induction efficiency of hPGCLCs, facilitating disease mechanistic studies.

Also flagged:HOPSVam6polyphosphatemitochondrialimmune responseVps39
Journal Article 2025-02-25 No Snippets Sánchez-León E, Bhalla K, Hu G, Lee CWJ, Lagace M, Jung WH, Kronstad JW.
Show Full Abstract

<i>Cryptococcus neoformans</i> is considered one of the most dangerous fungal threats to human health, and the World Health Organization recently ranked it in the critical priority group for perceived public health importance. Proliferation of <i>C. neoformans</i> within mammalian hosts is supported by its ability to overcome nutritional limitations and endure stress conditions induced by the host immune response. Previously, we reported that the Vam6/Vps39/TRAP1-domain protein Vam6 was crucial for vacuolar morphology, iron acquisition, and virulence. However, the molecular mechanisms underlying the pleiotropic phenotypes resulting from loss of Vam6 remain poorly understood. In this study, we determined that Vam6 has roles in the HOPS complex for endomembrane trafficking to the vacuole and in the vCLAMP membrane contact site between the vacuole and mitochondria. Importantly, both of these roles regulate polyphosphate (polyP) metabolism, as demonstrated by a defect in trafficking of the VTC complex subunit Vtc2 for polyphosphate synthesis and by an influence on mitochondrial functions. In the latter case, Vam6 was required for polyP accumulation in response to electron transport chain inhibition and for overcoming oxidative stress. Overall, this work establishes connections between endomembrane trafficking, mitochondrial functions, and polyP homeostasis in <i>C. neoformans</i>.IMPORTANCEA detailed understanding of stress resistance by fungal pathogens of humans may provide new opportunities to improve antifungal therapy and combat life-threatening diseases. Here, we used a <i>vam6</i> deletion mutant to investigate the role of the homotypic fusion and vacuole protein sorting (HOPS) complex in mitochondrial functions and polyphosphate homeostasis in <i>Cryptococcus neoformans</i>, an important fungal pathogen of immunocompromised people including those suffering from HIV/AIDS. Specifically, we made use of mutants defective in late endocytic trafficking steps to establish connections to oxidative stress and membrane trafficking with mitochondria. In particular, we found that mutants lacking the Vam6 protein had altered mitochondrial function, and that the mutants were perturbed for additional mitochondria and vacuole-related phenotypes (e.g., membrane composition, polyphosphate accumulation, and drug sensitivity). Overall, our study establishes connections between endomembrane trafficking components, mitochondrial functions, and polyphosphate homeostasis in an important fungal pathogen of humans.

Also flagged:tumorphagocytosisantigen presentationcancermyelopoiesisangiogenesis
Journal Article 2025-02-25 No Snippets Toghraie FS, Bayat M, Hosseini MS, Ramezani A.
Show Full Abstract

Tumor-infiltrating myeloid cells (TIMs), which encompass tumor-associated macrophages (TAMs), tumor-associated neutrophils (TANs), myeloid-derived suppressor cells (MDSCs), and tumor-associated dendritic cells (TADCs), are of great importance in tumor microenvironment (TME) and are integral to both pro- and anti-tumor immunity. Nevertheless, the phenotypic heterogeneity and functional plasticity of TIMs have posed challenges in fully understanding their complexity roles within the TME. Emerging evidence suggested that the presence of TIMs is frequently linked to prevention of cancer treatment and improvement of patient outcomes and survival. Given their pivotal function in the TME, TIMs have recently been recognized as critical targets for therapeutic approaches aimed at augmenting immunostimulatory myeloid cell populations while depleting or modifying those that are immunosuppressive. This review will explore the important properties of TIMs related to immunity, angiogenesis, and metastasis. We will also document the latest therapeutic strategies targeting TIMs in preclinical and clinical settings. Our objective is to illustrate the potential of TIMs as immunological targets that may improve the outcomes of existing cancer treatments.

PRDX6
Also flagged:TM4SF4cell surfacehepatocellular carcinomatumormitochondrialphosphorylation
Journal Article 2025-02-25 ✓ 1 Snippet Wong KK, Ab Hamid SS.
In-Text Gene Mentions

…, COX6A1 ,PRDX6, COX8A ,…

Show Full Abstract

The clinical application of cellular immunotherapy in hepatocellular carcinoma (HCC) is impeded by the lack of a cell surface target frequently expressed in HCC cells and with minimal presence in normal tissues to reduce on-target, off-tumor toxicity. To address this, an in silico multomics analysis was conducted to identify an optimal therapeutic target in HCC. A longlist of genes (n = 12,948) expressed in HCCs according to The Human Protein Atlas database were examined. Eight genes were shortlisted to identify one with the highest expression in HCCs, without being shed into circulation, and with restrictive expression profile in other normal human tissues. A total of eight genes were shortlisted and subsequently ranked according to the combination of their transcript and protein expression levels in HCC cases (n = 791) derived from four independent datasets. TM4SF4 was the top-ranked target with the highest expression in HCCs. TM4SF4 showed more favorable expression profile with significantly lower expression in normal human tissues but more highly expressed in HCC compared with seven other common HCC therapeutic targets. Furthermore, scRNA-seq and immunohistochemistry datasets showed that TM4SF4 was absent in immune cell populations but highly expressed in the bile duct canaliculi of hepatocytes, regions inaccessible to immune cells. In scRNA-seq dataset of HCCs, TM4SF4 expression was positively associated with mitochondrial components and oxidative phosphorylation Gene Ontologies in HCC cells (n = 15,787 cells), suggesting its potential roles in mitochondrial-mediated oncogenic effects in HCC. Taken together, TM4SF4 is proposed as a promising cell surface target in HCC due to its high expression in HCC cells with restricted expression profile in non-cancerous tissues, and association with HCC oncogenic pathways.

PLCL1
Also flagged:C9orf72ALSTDP-43NucleusGene Expressioncognitive impairment
Journal Article 2025-02-25 ✓ 2 Snippets Wang HV, Xiang JF, Yuan C, Veire AM, Gendron TF, Murray ME, Tansey MG, Hu J, Gearing M, Glass JD, Jin P, Corces VG, McEachin ZT.
In-Text Gene Mentions

…Specifically,PLCL1is found in…

PLCL1is significantly upregulated…

Show Full Abstract

Repeat expansions in the <i>C9orf72</i> gene are the most common genetic cause of amyotrophic lateral sclerosis and familial frontotemporal dementia (ALS/FTD). To identify molecular defects that take place in the dorsolateral frontal cortex of patients with <i>C9orf72</i> ALS/FTD, we compared healthy controls with <i>C9orf72</i> ALS/FTD donor samples staged based on the levels of cortical phosphorylated TAR DNA binding protein (pTDP-43), a neuropathological hallmark of disease progression. We identified distinct molecular changes in different cell types that take place during FTD development. Loss of neurosurveillance microglia and activation of the complement cascade take place early, when pTDP-43 aggregates are absent or very low, and become more pronounced in late stages, suggesting an initial involvement of microglia in disease progression. Reduction of layer 2-3 cortical projection neurons with high expression of CUX2/LAMP5 also occurs early, and the reduction becomes more pronounced as pTDP-43 accumulates. Several unique features were observed only in samples with high levels of pTDP-43, including global alteration of chromatin accessibility in oligodendrocytes, microglia, and astrocytes; higher ratios of premature oligodendrocytes; increased levels of the noncoding RNA NEAT1 in astrocytes and neurons, and higher amount of phosphorylated ribosomal protein S6. Our findings reveal progressive functional changes in major cell types found in the prefrontal cortex of <i>C9orf72</i> ALS/FTD patients that shed light on the mechanisms underlying the pathology of this disease.

HTT
Also flagged:Neuromuscular Disordersneuromuscular diseasesneurologic disordersneurodevelopmental disorderMuscular dystrophyLimb‐girdle muscular dystrophy
Journal Article 2025-02-25 ✓ 1 Snippet Malfatti E, Caramizaru A, Lee H, Kim J, Shoaito H, Pennisi A, Souvannanorath S, Authier FJ, Dumitrescu A, Fahmy N, Escobar-Cedillo RE, Miranda-Duarte A, Luna-Angulo AB, Nouioua S, Benchaabi O, Tazir M, Hallal S, Martinez P, Castiglioni C, Dobrescu A, Tajsharghi H.
In-Text Gene Mentions

…, HOXD13 ,HTT, PABPN1 ,…

Show Full Abstract

Although substantial advancements have been made in genetic testing, several barriers continue to limit patient access, leading to delays in diagnosis, effective treatments, and preventative measures. The NEUROMYODredger-3billion Megaproject End the Diagnostic Odyssey grant offered free whole exome sequencing (WES) to 245 patients with undiagnosed neurodevelopmental or neuromuscular disorders in seven countries: Algeria, Chile, Egypt, France, Mexico, Peru, and Romania. We found pathogenic variants in 79 patients (diagnostic yield 32.24%)-36 neurodevelopmental (43.90%) and 43 neuromuscular (26.38%). Fifty patients harboured variants of uncertain significance (VUS, 20.40%)-14 neurodevelopmental (17.07%) and 36 neuromuscular (22.08%), and 116 patients had negative results (47.34%). NEUROMYODredger helped end the diagnostic odyssey in around 30% of patients, while ongoing functional studies and reanalysis strategies are used in order to reach more diagnoses. In conclusion, a singleton WES approach is valuable in determining the genetic diagnosis of neurodevelopmental and neuromuscular diseases, especially in low and middle-income countries.

Also flagged:Chronic kidney diseasemetabolic disorderkidney impairmentpathogenesisglomerulosclerosiskidney fibrosis
Journal Article 2025-02-25 No Snippets He X, Li H.
Show Full Abstract

Chronic kidney disease (CKD) is a clinical syndrome of metabolic disorder caused by progressive kidney impairment for more than 3 months. CKD has become a global public health problem due to its high morbidity and mortality, which is difficult to be cured for most patients. The pathogenesis of CKD is still unclear, which is closely related to glomerulosclerosis, kidney tubular injury and kidney fibrosis. LncRNA is a non-coding RNA with a length of more than 200 nucleotides. It not only participates in intracellular transcriptional regulation, post-transcriptional regulation and epigenetic activities, but also forms a regulatory network together with miRNA and mRNA, to further conduct the reticular regulation in cells. Recently, it has been found that lncRNA participates in pathophysiological mechanism of CKD by regulating glomerulosclerosis, kidney tubular injury and kidney fibrosis. This has also become a new direction of lncRNA in early diagnosis and targeted therapy of CKD.

Also flagged:Ironferroptosismuscle diseasesmetabolismdeathsarcopenia
Journal Article 2025-02-25 No Snippets Ru Q, Li Y, Zhang X, Chen L, Wu Y, Min J, Wang F.
Show Full Abstract

The muscular system plays a critical role in the human body by governing skeletal movement, cardiovascular function, and the activities of digestive organs. Additionally, muscle tissues serve an endocrine function by secreting myogenic cytokines, thereby regulating metabolism throughout the entire body. Maintaining muscle function requires iron homeostasis. Recent studies suggest that disruptions in iron metabolism and ferroptosis, a form of iron-dependent cell death, are essential contributors to the progression of a wide range of muscle diseases and disorders, including sarcopenia, cardiomyopathy, and amyotrophic lateral sclerosis. Thus, a comprehensive overview of the mechanisms regulating iron metabolism and ferroptosis in these conditions is crucial for identifying potential therapeutic targets and developing new strategies for disease treatment and/or prevention. This review aims to summarize recent advances in understanding the molecular mechanisms underlying ferroptosis in the context of muscle injury, as well as associated muscle diseases and disorders. Moreover, we discuss potential targets within the ferroptosis pathway and possible strategies for managing muscle disorders. Finally, we shed new light on current limitations and future prospects for therapeutic interventions targeting ferroptosis.

TNFSF4
Also flagged:FN1glioblastoma multiformeGBMalternativetumourC2
Journal Article 2025-02-25 ✓ 1 Snippet Liu X, Song J, Zhou Z, He Y, Wu S, Yang J, Ren Z.
In-Text Gene Mentions

…, TNFRSF9 ,TNFSF4, and TNFSF14…

Show Full Abstract

Aberrant alternative splicing and abnormal alternative splicing events (ASEs) in glioblastoma multiforme (GBM) remain largely elusive. The prognostic-associated ASEs in GBM were identified and summarized into 123 genes using GBM and LGG datasets from ASCancer Atlas and TCGA. The eleven genes (C2, COL3A1, CTSL, EIF3L, FKBP9, FN1, HPCAL1, HSPB1, IGFBP4, MANBA, PRKAR1B) were screened to develop an alternative splicing prognostic risk score (ASRS) model through machine learning algorithms. The model was trained on the TCGA-GBM cohort and validated with four external datasets from CGGA and GEO, achieving AUC values of 0.808, 0.814, 0.763, 0.859, and 0.836 for 3-year survival rates, respectively. ASRS could be an independent prognostic factor for GBM patients (HR > 1.8 across three datasets) through multivariate Cox regression analysis. The high-risk group demonstrated poorer prognosis, elevated immune scores, increased levels of immune cell infiltration, and greater differences in drug sensitivity. We found that FN1, used for model construction, contained 4 abnormal ASEs resulting in high expression of non-canonical transcripts and the presence of premature termination codon. These abnormal ASEs may be regulated by tumour-related splicing factors according to the PPI network. Furthermore, both mRNA and protein levels of FN1 were highly expressed in GBM compared to LGG, correlating with poor prognosis in GBM. In conclusion, our findings highlight the role of ASEs in affecting the progression of GBM, and the model showed a potential application for prognostic risk of patients. FN1 may serve as a promising splicing biomarker for GBM, and mechanisms of processes of aberrant splicing need to be revealed in the future.

OLFM4
Also flagged:Gastric cancerneoplasiagastric intestinal metaplasiaintestinal metaplasiagene expressioncancer
Journal Article 2025-02-25 ✓ 5 Snippets Huang RJ, Wichmann IA, Su A, Sathe A, Shum MV, Grimes SM, Meka R, Almeda A, Bai X, Shen J, Nguyen Q, Luo I, Han SS, Amieva MR, Hwang JH, Ji HP.
In-Text Gene Mentions

…cells (such asOLFM4) 21 ,…

…intestinal lineages (OLFM4, DMBT1 )…

…stem cells (OLFM4, LEFTY1 ).…

…intestinal cells (OLFM4, ADGRG7, CPS1…

…intestinal cells (OLFM4, CPS1, DMBT1) ,…

Show Full Abstract

Gastric cancer precursors demonstrate highly-variable rates of progression toward neoplasia. Certain high-risk precursors, such as gastric intestinal metaplasia with advanced histologic features, may be at up to 30-fold increased risk for progression compared to lower-risk intestinal metaplasia. The biological differences between high- and low-risk lesions have been incompletely explored. In this study, we use several clinical cohorts to characterize the microenvironment of advanced gastric cancer precursors relative to low-risk lesions using bulk, spatial, and single-cell gene expression assays. We identified a 26-gene panel which is associated with advanced lesions, localizes to metaplastic glands on histopathology, and is expressed in aberrant mature and immature intestinal cells not normally present in the healthy stomach. This gene expression signature suggests an important role of the immature intestinal lineages in promoting carcinogenesis in the metaplastic microenvironment. These findings may help to inform future biomarker development and strategies of gastric cancer prevention.

Also flagged:channelrhodopsinsphotosystemsbehavioralazobenzenephototoxicitylanthanide
Journal Article 2025-02-25 No Snippets Pongkulapa T, Yum JH, McLoughlin CD, Conklin B, Kumagai T, Goldston LL, Sugiyama H, Park S, Lee KB.
Show Full Abstract

Precise spatiotemporal control of drug delivery is extremely valuable for regulating stem cell fate, particularly in stem cell differentiation. A novel near-infrared (NIR)-mediated spatiotemporal delivery system is reported combining photo-switchable arylazopyrazole (AAP)-containing DNA strands and upconversion nanoparticles (UCNPs). This nano-drug delivery system (NDDS) enables precise modulation of DNA duplex structures in response to NIR stimuli, overcoming the limitations of traditional UV-responsive systems. AAP derivatives with enhanced photoswitching efficiency (≈98%) and significantly improved cis-form stability are engineered. The successful delivery of curcumin, a neurogenic compound with an affinity for the minor groove of DNA, to human neural stem cells (NSCs) is achieved using UCNP-DNA-AAP constructs. Upon 980 nm NIR light exposure, UCNPs efficiently up-converted NIR to UV light, triggering AAP photoisomerization and DNA dissociation, thus releasing curcumin. This approach enabled efficient spatiotemporal control over NSC differentiation while facilitating neuroprotection. Immunofluorescence and gene expression analyses demonstrated enhanced neuronal mRNA levels and neurite outgrowth in treated cells. In short, the NIR-mediated photo-switchable NDDS offers a precise and innovative approach to control stem cell fate, enabling spatiotemporal regulation of cellular processes. This technology has significant potential applications in nanomedicine and neuroscience, where precise drug delivery is crucial for targeted neural interventions.

Also flagged:Cardiac HypertrophyMyosin Light Chain 3pathogenesismyocardial hypertrophyMYL3autophagy
Journal Article 2025-02-25 No Snippets Wang W, Chen L, Zhao Y, Zhang S, Zhou X.
Show Full Abstract

Circular RNAs (circRNAs) are differentially expressed in cardiac hypertrophy; however, the exact function and mechanisms during hypertrophy development are still unknown. Here, we explored the role of a newly discovered circRNA in the pathogenesis of myocardial hypertrophy. It was found that circ-0001283 promoted the progression of cardiac hypertrophy by interacting with myosin light chain 3 (MYL3) to inhibit the protein ubiquitination and enhance its protein expression, not by the competitive endogenous RNA mechanism. Further investigation demonstrated that the reduced hypertrophy induced by circ-0001283 knockdown was counteracted by overexpression of MYL3. Mechanistically, MYL3 facilitated myocardial hypertrophy by inducing autophagy in cells via PI3K/Akt/mTOR and ERK signaling pathways. In summary, circ-0001283 can bind directly to MYL3 and up-regulate its expression, thereby promoting autophagy to accelerate cardiac hypertrophy. Circ-0001283 may serve as a potential therapeutic target for cardiac hypertrophy.

PRDX6
Also flagged:peroxidasesperoxidesPost-translational modificationsoxygencysteinePRDX5
Journal Article 2025-02-25 ✓ 1 Snippet Qiu T, Azizi SA, Pani S, Dickinson BC.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Peroxiredoxins (PRDXs) are a highly conserved family of peroxidases that serve as the primary scavengers of peroxides. Post-translational modifications play crucial roles modulating PRDX activities, tuning the balance between reactive oxygen species (ROS) signaling and stress. We previously reported that S-acylation occurs at the "peroxidatic" cysteine (Cp) site of PRDX5 and that it inhibits PRDX5 activity. Here, we show that the PRDX family more broadly is subject to S-acylation at the Cp site of all PRDXs and that PRDX S-acylation dynamically responds to cellular ROS levels. Using activity-based fluorescent imaging with DPP-Red, a red-shifted fluorescent indicator for acyl-protein thioesterase (APT) activity, we also discover that the instigation of ROS-stress via exogenous H<sub>2</sub>O<sub>2</sub> activates both the cytosolic and mitochondrial APTs, whereas epidermal growth factor (EGF)-stimulated endogenous H<sub>2</sub>O<sub>2</sub> deactivates the cytosolic APTs. These results indicate that APTs help tune H<sub>2</sub>O<sub>2</sub> signal transduction and ROS protection through PRDX S-deacylation.

Also flagged:cohesinJQ1activationgene expressiontranscription factorsRNA polymerase II
Journal Article 2025-02-25 No Snippets Tjalsma SJD, Rinzema NJ, Verstegen MJAM, Robers MJ, Nieto-Aliseda A, Gremmen RA, Allahyar A, Muraro MJ, Krijger PHL, de Laat W.
Show Full Abstract

Cell-type-specific gene activation is regulated by enhancers, sometimes located at large genomic distances from target gene promoters. Whether distal enhancers require specific factors to orchestrate gene regulation remains unclear. Here, we used enhancer distance-controlled reporter screens to find candidate factors. We depleted them and employed activity-by-contact predictions to genome-wide classify genes based on enhancer distance. Predicted distal enhancers typically control tissue-restricted genes and often are strong enhancers. We find cohesin, but also mediator, most specifically required for long-range activation, with cohesin repressing short-range gene activation and prioritizing distal over proximal HBB genes competing for shared enhancers. Long-range controlled genes are also most sensitive to perturbations of other regulatory proteins and to BET inhibitor JQ1, this being more a consequence of their distinct enhancer features than distance. Our work predicts that lengthening of intervening sequences can help limit the expression of target genes to specialized cells with optimal trans-factor environments.

HTT
Also flagged:carvedilolHuntington's diseaseautophagyHDneurodegenerative disordercognitive impairment
Journal Article 2025-02-25 ✓ 5 Snippets Cheng CY, Chen KP, Tseng TS, Hua KF, Ju TC.
In-Text Gene Mentions

…in the huntingtin (Htt) gene, leading to…

…the Huntingtin gene (HTT) located on chromosome…

…NormalHTTprotein plays crucial…

…of the humanHTTgene were acquired…

…nsfected with either pcDNA3.1-Htt-(Q)25-hrGFP or pcDNA3.1-Htt-(…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by the abnormal expansion of CAG repeats in the huntingtin (Htt) gene, leading to the aggregation of mutant huntingtin protein (mHTT) in cells, particularly in cortical and striatal neurons. This results in involuntary movements, cognitive impairment, and emotional instability. One of the critical pathogenic mechanisms in HD is impaired autophagy, which plays a vital role in cellular homeostasis by degrading damaged organelles and misfolded proteins through the formation of autophagosomes that fuse with lysosomes. However, the aggregation of mHTT disrupts autophagic function, leading to the accumulation of mHTT and exacerbating the disease's pathogenesis. Carvedilol is an established clinical medication used to treat hypertension and congestive heart failure. It exerts protective effects by blocking both β1-and β2-adrenergic receptors, reducing sympathetic nervous activity, and promoting vasodilation through α1-adrenergic blockade. Carvedilol has been shown to possess antioxidant and anti-inflammatory properties. In this study, we demonstrate that (R)-carvedilol promotes the nuclear translocation of the transcription factor binding to IGHM enhancer 3 (TFE3) by reducing glycogen synthase-3β (GSK-3β) activation, which increases the expression of autophagy-related proteins and facilitates the autophagy-lysosomal pathway (ALP), thereby enhancing mHTT degradation. Additionally, systemic administration of (R)-carvedilol improves mHTT degradation, provides neuroprotection, and inhibits gliosis, effectively ameliorating behavioral impairments and improving disease progression. Overall, these findings indicate that (R)-carvedilol has therapeutic potential for managing HD by promoting autophagy, facilitating the clearance of mHTT aggregates, and demonstrating advantageous properties in an HD transgenic mouse model, highlighting its promise as a treatment option for neurodegenerative diseases.

DCC
Also flagged:CancerERK2protein kinasesquamous cell carcinomastumorsERK
Journal Article 2025-02-25 ✓ 2 Snippets Torres Robles J, Stiegler AL, Boggon TJ, Turk BE.
In-Text Gene Mentions

…ERK-binding motifs, includingDCC(P-x-x-L-x-L), Far1 (P-x-P-L-x…

…classes, including theDCC(P-x-x-L-x-L) and MEF2…

Show Full Abstract

The protein kinase ERK2 is recurrently mutated in human squamous cell carcinomas and other tumors. ERK2 mutations cluster in an essential docking recruitment site that interacts with short linear motifs found within intrinsically disordered regions of ERK substrates and regulators. Cancer-associated mutations do not disrupt ERK2 docking interactions altogether but selectively inhibit some interactions while sparing others. However, the full scope of disrupted or maintained interactions remains unknown, limiting our understanding of how these mutations contribute to cancer. We recently defined the docking interactome of wild-type ERK2 by screening a yeast two-hybrid library of proteomic short linear motifs. Here, we apply this approach to the two most recurrent cancer-associated mutants. We find that most sequences binding to WT ERK2 also interact with both mutant forms. Analysis of differentially interacting sequences revealed that ERK2 mutants selectively lose the ability to bind sequences conforming to a specific motif. We solved the co-crystal structure of ERK2 in complex with a peptide fragment of ISG20, a screening hit that binds exclusively to the WT kinase. This structure demonstrated the mechanism by which cancer hotspot mutations at Glu81, Arg135, Asp321, and Glu322 selectively impact peptide binding. Finally, we found that cancer-associated ERK2 mutations had decreased activity in phosphorylating GEF-H1/ARHGEF2, a known ERK substrate harboring a WT-selective docking motif. Collectively, our studies provide a structural rationale for how a broad set of interactions are disrupted by ERK2 hotspot mutations, suggesting mechanisms for pathway rewiring in cancers harboring these mutations.

Also flagged:Neurodegenerative diseasesoxygenpathogenesismyelinADPD
Journal Article 2025-02-25 No Snippets Huang S, Lu Y, Fang W, Huang Y, Li Q, Xu Z.
Show Full Abstract

Neuroinflammation represents a critical pathway in the brain for the clearance of foreign bodies and the maintenance of homeostasis. When the neuroinflammatory process is dysregulate, such as the over-activation of microglia, which results in the excessive accumulation of free oxygen and inflammatory factors in the brain, among other factors, it can lead to an imbalance in homeostasis and the development of various diseases. Recent research has indicated that the development of numerous neurodegenerative diseases is closely associated with neuroinflammation. The pathogenesis of neuroinflammation in the brain is intricate, involving alterations in numerous genes and proteins, as well as the activation and inhibition of signaling pathways. Furthermore, excessive inflammation can result in neuronal cell apoptosis, which can further exacerbate the extent of the disease. This article presents a summary of recent studies on the relationship between neuronal apoptosis caused by excessive neuroinflammation and neurodegenerative diseases. The aim is to identify the link between the two and to provide new ideas and targets for exploring the pathogenesis, as well as the prevention and treatment of neurodegenerative diseases.

HFE
Also flagged:ironvitamin B12folic acidvitamin DFerritinvitamin D deficiency
Journal Article 2025-02-25 ✓ 1 Snippet Zgliczynska M, Ostrowska M, Zebrowska K, Rzucidlo-Szymanska I, Szymusik I, Kowalski K, Kosinska-Kaczynska K.
In-Text Gene Mentions

…ets, sarcoidosis, thalassemia,hemochromatosis, pernicious anemia, celiac…

Show Full Abstract

<h4>Background</h4>Multiple pregnancy constitutes a large metabolic expense, so women with twin pregnancies and neonates born as twins might be at risk for micronutrient deficiencies. Therefore, the aim of the study was to assess the supplementation used and supply with key micronutrients: iron, vitamin B12, folic acid and vitamin D in women with twin pregnancies and the correlations with cord blood indicators.<h4>Methods</h4>Maternal and cord blood samples were collected from 51 patients with twin pregnancies and 102 newborns born from those pregnancies between October 2020 and September 2023. Ferritin, vitamin B12, folic acid and vitamin D metabolites concentrations were measured. Additionally, the patients completed a questionnaire regarding pre-and intragestational supplementation.<h4>Results</h4>Iron, vitamin B12, and vitamin D deficiency were diagnosed in 20.8, 13.7 and 12.5% of women with twin pregnancies, respectively. No maternal folate deficiency was identified. Positive weak to moderate correlations were demonstrated between the concentrations of all studied indicators in the maternal and cord blood. Pregestational folic acid and vitamin D supplementation was associated with higher cord blood levels of folic acid and 3-epi-25(OH)D3, respectively. 25(OH)D3 and total 25(OH)D concentrations were higher in newborns whose mothers had supplemented vitamin D during pregnancy.<h4>Conclusion</h4>The problem of iron, vitamin B12 and vitamin D deficiencies in twin pregnancies is still valid. Pre-and intragestational supplementation, as well as maternal micronutrient supply affect the cord blood composition of twins.

Also flagged:Dipeptidyl peptidase IVDPP-IVserine proteasetype 2 diabetes mellitusCOVID-19synthesis
Journal Article 2025-02-25 No Snippets Petrov V, Aleksandrova T, Pashev A.
Show Full Abstract

Dipeptidyl peptidase IV (DPP-IV) is a serine protease whose inhibition has been an object of considerable interest in the context of developing novel treatments for type 2 diabetes mellitus. The development of novel DPP-IV inhibitors from natural or synthetic origin has seen a growing scientific interest in recent years, especially during the SARS-CoV-2 pandemic, when DPP-IV inhibitors were found to be of beneficial therapeutic value for COVID-19 patients. The present manuscript aims to summarize the most recent information on the synthesis of different DPP-IV inhibitors, emphasizing the various heterocyclic scaffolds that can be found in them. Special attention is devoted to DPP-IV inhibitors that are currently in clinical trials. Different synthetic approaches for the construction of DPP-IV inhibitors are discussed, as well as the most recent developments in the field.

Also flagged:fungal infectionsbloodstream infectionsinvasive candidiasisdeathinfectionscancer
Journal Article 2025-02-25 No Snippets Mkacher H, Chaâbane-Banaoues R, Hrichi S, Arnoux P, Babba H, Frochot C, Nasri H, Acherar S.
Show Full Abstract

In this work, we describe the synthesis of three new <i>meso</i>-arylporphyrins, named <i>meso</i>-tetrakis [4-(nicotinoyloxy)phenyl] porphyrin (<b>H<sub>2</sub>TNPP</b>), <i>meso</i>-tetrakis [4-(picolinoyloxy)phenyl] porphyrin (<b>H<sub>2</sub>TPPP</b>), and <i>meso</i>-tetrakis [4-(isonicotinoyloxy) phenyl] porphyrin (<b>H<sub>2</sub>TIPP</b>). These new synthesized <i>meso</i>-arylporphyrins are characterized using spectroscopic analysis: Fourier Transform Infrared Spectroscopy (FTIR) and One-dimensional Nuclear Magnetic Resonance (1D NMR), and mass spectrometry (MS). The photophysical studies (UV-visible absorption, singlet oxygen (<sup>1</sup>O<sub>2</sub>) luminescence, and fluorescence emissions) demonstrate their potential uses as photosensitizers (PSs) in photodynamic therapy (PDT) applications. An in vitro investigation of the anti-fungal activity of <b>H<sub>2</sub>TNPP</b>, <b>H<sub>2</sub>TPPP</b>, and <b>H<sub>2</sub>TIPP</b> against <i>Candida</i> (<i>C.</i>) species (<i>C. albicans</i>, <i>C. glabrata</i>, and <i>C. tropicalis</i>) reveals that their minimum inhibitory concentration (MIC) values ranged from 1.25 to 5 mg/mL. In addition, their in vitro anti-fungal susceptibilities against three dermatophyte clinical isolates (<i>Trichophyton rubrum</i>, <i>Microsporum canis</i>, and <i>Trichophyton mentagrophytes</i>) are also evaluated and they demonstrate good anti-fungal activities. A molecular docking study of these <i>meso</i>-arylporphyrins as anti-fungal agents against <i>C. tropicalis</i> extracellular aspartic proteinases, Protein data Bank in Europe (PDBe code: 1J71) and <i>Trichophyton rubrum</i> Sialidases (PDBe code: 7P1D) underlines the possible interactions of <b>H<sub>2</sub>TNPP</b>, <b>H<sub>2</sub>TPPP</b>, and <b>H<sub>2</sub>TIPP</b> with the key amino acid residues of these fungal target proteins.

Also flagged:Nutrient transporterhepatocellular carcinomatumorcell surface nutrient transporter2-DGBP MRs
Journal Article 2025-02-25 No Snippets Wang Y, Wang Z, Liu M, Chen C, Xi Q, Tang J, Yu Z, Wang S, Yu L, Yu M.
Show Full Abstract

Radiotherapy (RT) is the primary treatment modality for hepatocellular carcinoma (HCC). Inevitably, the X-ray exposure also increases the metabolic stress and energy demands in surviving tumor cells, which leads to metabolic reprogramming that reduces the sensitivity of HCC to clinical treatments including RT. Nevertheless, the current research in tumor metabolic therapy predominantly focuses on inhibiting glycolytic pathways, and the consequent metabolic compensation behavior of tumor cells exacerbates the risks of drug resistance and recurrence. To address this challenge, we innovatively proposed a tumor-specific multi-metabolic pathway regulation strategy navigated by tumor cell surface nutrient transporter (2-DG/BP MRs), which can be triggered by X-ray radiation to achieve dual blockade of glycolysis and glutamine metabolism pathways. Thus, this nanosystem reconfigured metabolic pathways within tumor cells to counteract RT-induced metabolic reprogramming through dual metabolic inhibition (glycolysis and glutamine metabolism). This approach disrupted the essential energy supply required for cancer cell proliferation without causing metabolic disorders in normal cells, thereby sensitizing HCC to RT. This tumor cell-specific metabolic intervention strategy provides a safe and effective approach for combination therapy in clinically RT-resistant tumors.

Also flagged:gene expressioncell physiologycell cyclecell proliferationcancerBrain tumours
Journal Article 2025-02-25 No Snippets Spinello Z, Besharat ZM, Mainiero F, Rughetti A, Masuelli L, Ferretti E, Catanzaro G.
Show Full Abstract

MicroRNAs (miRNAs) are small non-coding RNAs that act as critical regulators of gene expression by repressing mRNA translation. The role of miRNAs in cell physiology spans from cell cycle control to cell proliferation and differentiation, both during development and in adult tissues. Accordingly, dysregulated expression of miRNAs has been reported in several diseases, including cancer, where miRNAs can act as oncogenes or oncosuppressors. Of note, miRNA signatures are also under investigation for classification, diagnosis, and prognosis of cancer patients. Brain tumours are primarily associated with poor prognosis and high mortality, highlighting an urgent need for novel diagnostic, prognostic, and therapeutic tools. Among miRNAs investigated in brain tumours, miR-326 has been shown to act as a tumour suppressor in adult and paediatric brain cancers. In this review, we describe the role of miR-326 in malignant as well as benign cancers originating from brain tissue. In addition, since miR-326 expression can be regulated by other non-coding RNA species, adding a further layer of regulation in the cancer-promoting axis, we discuss this miRNA's role in targeted therapy for brain cancers.

Also flagged:Avian InfluenzaHAdeathcriticalinfectionsPB2
Journal Article 2025-02-25 No Snippets Jahid MJ, Nolting JM.
Show Full Abstract

In late 2021, Eurasian-lineage highly pathogenic avian influenza (HPAI) A(H5N1) viruses from HA clade 2.3.4.4b were first detected in the United States. These viruses have caused severe morbidity and mortality in poultry and have been detected in numerous wild and domestic animals, including cows and humans. Notably, infected cows transmitted the virus to cats, causing extreme pathogenicity and death. While human-to-human spread of the virus has not been recorded, efficient transmission of the bovine-origin virus has also led to extreme pathogenicity and death in ferret models. Recently, markers in PB2 (E627K) and HA (E186D, Q222H), indicating mammalian adaptation mutations, were detected in an H5N1-infected patient manifesting critical illness in Canada. These, combined with instances of interspecies spread of the virus, have raised global public health concerns. This could highlight the potential for the virus to successfully adapt to mammals, posing a serious risk of a global outbreak. A One Health approach is, thereby, necessary to monitor and control the outbreak. This review aims to analyze the epidemiology, transmission, and ecological impacts of HPAI A(H5N1) clade 2.3.4.4b in the U.S., identify knowledge gaps, and inform strategies for effective outbreak management and mitigation.

Also flagged:DPP-4EndotoxemiaNLRC4inflammatory responsesLinagliptintype 2 diabetes
Journal Article 2025-02-25 No Snippets Bianchi F, Roccabianca P, Vianello E, Gentile G, La Sala L, Bandera F, Tacchini L, Zoia R, Corsi Romanelli MM, Dozio E.
Show Full Abstract

Inflammasomes are protein complexes that trigger pro-inflammatory responses and promote many diseases, including adipose tissue dysfunction. Linagliptin (L), a DPP-4 inhibitor used for type 2 diabetes therapy, has putative anti-inflammatory effects. This work explores L effects on inflammasome regulation, inflammation, and adipose tissue dysfunction in obese mice. Male C57BL/6N mice were fed a normal chow (NC) diet, high-fat (HF) diet, or HF diet with L (HFL) for 15 weeks. Gene expression and histological examinations were performed on visceral (VAT) and subcutaneous (SAT) adipose tissue samples. Biomarkers were quantified on sera. Murine macrophages were utilized for in vitro analyses. L decreased HF-induced endotoxemia and circulating inflammatory indicators. Despite having no effect on body weight, L reduced VAT inflammation by decreasing endotoxemia-induced <i>NLRC4</i> inflammasome, inflammation severity, and fat cell hypertrophy. Although SAT response differed from VAT, inflammation was slightly reduced in this tissue too. In vitro, L modulated inflammation by directly reducing the pro-inflammatory macrophage phenotype. In obesity, increased <i>NLRC4</i> inflammasome expression links endotoxemia and VAT inflammation. L protected against endotoxemia, maybe by affecting gut permeability and VAT responses. The decreased polarization of macrophages toward a pro-inflammatory phenotype and the reduction in adipocyte hypertrophy are involved in the response to L.

SERPINC1
Also flagged:cognitioncognitive impairmentepirubicinbreast cancercancersmalignant tumour
Journal Article 2025-02-25 ✓ 2 Snippets Singh P, Leon C, Kaur S, Batra A, Tayade P, Prakash MS, Sharma R.
In-Text Gene Mentions

ACE-IIIalso had good…

…Furthermore, the totalACE-IIIscores of the…

Show Full Abstract

<h4>Introduction</h4>Breast cancer (BC) is the leading cause of morbidity and mortality worldwide. Owing to early diagnosis and better therapeutic care, survivorship in these patients have improved tremendously. Chemotherapy, cornerstone in BC management have been associated with debilitating side effects including the effect on cognitive function, which significantly impairs the quality of life in these patients. Thus, it is imperative to understand the timeline and magnitude of the effects of chemotherapy on cognition to develop better management strategies. This is even more relevant in developing country like India, where there is inconspicuous absence of data in this regard.<h4>Aim</h4>To study the acute and long-term effects of chemotherapy on the cognitive function in BC patients compared to chemotherapy naïve (Cx naïve) BC patients (disease controls) and matched healthy controls (HC) using subjective, objective questionnaires and neuropsychological tests (NPTs).<h4>Methods</h4>The current cross-sectional study involved 120 participants, 30 each of Cx naïve BC patients, during chemotherapy BC patients (during Cx), post-chemotherapy BC patients (post Cx) and HC; all matched for age and education levels. Both subjective and objective assessments of cognitive functions were done in all the groups. Hindi Mental State Examination (HMSE) and FACT Cog questionnaire V3 were used for subjective assessment while Addenbrooke Cognitive Examination-III (ACE-III) questionnaire and domain specific computer based NPT (Wisconsin card sorting task (WCST) (learning), Flanker's (attention and interference) and <i>n</i> back task (working memory) were done for objective assessment. The data were analysed for descriptive and inferential statistics, as appropriate using GraphPad Prism V9.<h4>Results</h4>The subjective assessment using HMSE questionnaire revealed a significantly lower score in post Cx group as compared to HC (<i>p</i> < 0.001); however, it was comparable in other groups. FACT Cog V3 questionnaire revealed significantly higher cognitive impairment among those during Cx compared to Cx naïve patients (<i>p</i> < 0.001), post Cx BC patients (<i>p</i> < 0.001) and HC (<i>p</i> < 0.0001). Meanwhile, the objective assessment using ACE-III examination revealed significantly lesser scores among during Cx patients (<i>p</i> < 0.001), and post Cx BC patients (<i>p</i> < 0.0001) compared to HC group. In NPTs, WCST and <i>N</i> back working memory task revealed significantly lower accuracy in Cx naïve versus post Cx (<i>p</i> = 0.0054, <i>p</i> = 0.0068, respectively) and HC versus post Cx (<i>p</i> = 0.0054, <i>p</i> = 0.0045, respectively), while no significant difference was found in Flanker's task. Furthermore, in WCST there were significantly higher scores present in total reaction time in post Cx compared to Cx naïve: <i>p</i> = 0.00444 and HC: <i>p</i> = 0.0003). In Flanker's task reaction time was higher in all the groups (Cx naïve: <i>p</i> = 0.002, during Cx: <i>p</i> = 0.0007 and Post Cx: <i>p</i> < 0.0001) compared to HC. In addition negative correlation was found between the duration of chemotherapy with Perceived Cognitive Abilities (<i>r</i> = -0.482; <i>p</i> = 0.006), between the total number of cycles with Fact Cog Total (<i>r</i> = -0.373, <i>p</i> = 0.04) and Perceived Cognitive abilities (<i>r</i> = 0.39, <i>p</i> = 0.03), and between total dose and perceived cognitive abilities (<i>r</i> = -0.42, <i>p</i> = 0.014) also a positive correlation was seen between dose of epirubicin with reaction time of <i>n</i> back (<i>r</i> = 0.373, <i>p</i> = 0.04).<h4>Conclusion</h4>Chemotherapy can have a negative impact on the cognitive function in BC patients, manifested as both acute and long-term effects, based on patient reported/subjective and laboratory based/objective cognitive function tests. The deficits were seen mostly seen in domains of attention and working memory across groups compared to matched HC.

bioRxiv 2025-02-25 Preprint (No Snippets API) Farrell C, Buhidma Y, Mumford P, Heywood WE, Hällqvist J, Flores-Aguilar L, Andrews E, Rahimzadah N, Taso OS, Doran E, Swarup V, Head E, Lashley T, Mills K, Toomey CE, Wiseman FK.
Show Full Abstract

Trisomy of chromosome 21, the cause of Down syndrome (DS), is the most commonly occurring genetic cause of Alzheimer’s disease (AD). Here, we compare the frontal cortex proteome of people with Down syndrome-Alzheimer’s disease (DSAD) to demographically matched cases of early-onset AD and healthy ageing controls. We find wide dysregulation of the proteome, beyond proteins encoded by chromosome 21, including an increase in the abundance of the key AD-associated protein, APOE, in people with DSAD compared to matched cases of AD. To understand the cell types that may contribute to changes in protein abundance, we undertook a matched single-nuclei RNA-sequencing study, which demonstrated that APOE expression was elevated in subtypes of astrocytes, endothelial cells and pericytes in DSAD. We further investigate how trisomy 21 may cause increased APOE. Increased abundance of APOE may impact the development of, or response to, AD pathology in the brain of people with DSAD, altering disease mechanisms with clinical implications. Overall, these data highlight that trisomy 21 alters both the transcriptome and proteome of people with DS in the context of AD, and that these differences should be considered when selecting therapeutic strategies for this vulnerable group of individuals who have high-risk of early-onset dementia.

bioRxiv 2025-02-25 Preprint (No Snippets API) Stocksdale JT, Leventhal MJ, Lam S, Xu Y, Wang YO, Wang KQ, Tomas R, Faghihmonzavi Z, Raghav Y, Smith C, Wu J, Miramontes R, Sarda K, Johnson H, Shin M, Huang T, Foster M, Barch M, Armani N, Paiz C, Easter L, Duderstadt E, Vaibhav V, Sundararaman N, Felsenfeld DP, Vogt TF, Van Eyk J, Finkbeiner S, Kaye JA, Fraenkel E, Thompson LM.
Show Full Abstract

<h4>Summary</h4> Huntington’s Disease (HD) is caused by a CAG repeat expansion in the gene encoding Huntingtin (HTT ) . While normal HTT function appears impacted by the mutation, the specific pathways unique to CAG repeat expansion versus loss of normal function are unclear. To understand the impact of the CAG repeat expansion, we evaluated biological signatures of HTT knockout ( HTT KO) versus those that occur from the CAG repeat expansion by applying multi-omics, live cell imaging, survival analysis and a novel feature-based pipeline to study cortical neurons (eCNs) derived from an isogenic human embryonic stem cell series (RUES2). HTT KO and the CAG repeat expansion influence developmental trajectories of eCNs, with opposing effects on the growth. Network analyses of differentially expressed genes and proteins associated with enriched epigenetic motifs identified subnetworks common to CAG repeat expansion and HTT KO that include neuronal differentiation, cell cycle regulation, and mechanisms related to transcriptional repression and may represent gain-of-function mechanisms that cannot be explained by HTT loss of function alone. A combination of dominant and loss-of-function mechanisms are likely involved in the aberrant neurodevelopmental and neurodegenerative features of HD that can help inform therapeutic strategies.

Also flagged:synthesisestercarbonatepolycarbonatescyclic carbonatespolycarbonate
Journal Article 2025-02-24 No Snippets Shi W, Senthamarai T, Lanzi M, Orlando P, Nogués Martín R, Kleij AW.
Show Full Abstract

We here report the synthesis of two types of six-membered cyclic carbonate monomers equipped with various drug molecules through ester linkages. The target compounds can be isolated in good yields and feature diagnostic IR and <sup>13</sup>C NMR spectroscopic fingerprints in line with their proposed connectivities. As a potential application, we investigated their ring-opening polymerization (ROP), showing that the nature of the cyclic carbonate is crucial towards macromolecular carbonate formation. The functionalized polycarbonates have molecular weights of up to 10 kg/mol, controllable functionality and a variable drug-to-carbonate ratio. This work demonstrates the adaptive synthesis of new types of functionalized six-membered cyclic carbonates with potential as precursors to polycarbonate-drug type macromolecules.

Also flagged:neurodegenerative diseasesdeathamyloidagingAD
Journal Article 2025-02-24 No Snippets Adam Wesołowski P, Yang B, Davolio AJ, Woods EJ, Pracht P, Bojarski KK, Wierbiłowicz K, Payne MC, Wales DJ.
Show Full Abstract

This study investigates the energy landscapes of amyloid monomers, which are crucial for understanding protein misfolding mechanisms in Alzheimer's disease. While proteins possess inherent thermodynamic stability, environmental factors can induce deviations from native folding pathways, leading to misfolding and aggregation, phenomena closely linked to solubility. Using the UNOPTIM program, which integrates the UNRES potential into the Cambridge energy landscape framework, we conducted single-ended transition state searches and employed discrete path sampling to compute kinetic transition networks starting from PDB structures. These kinetic transition networks consist of local energy minima and the transition states that connect them, which quantify the energy landscapes of the amyloid monomers. We defined clusters within each landscape using energy thresholds and selected their lowest-energy structures for the structural analysis. Applying graph convolutional networks, we identified solubility trends and correlated them with structural features. Our findings identify specific minima with low solubility, characteristic of aggregation-prone states, highlighting the key residues that drive reduced solubility. Notably, the exposure of the hydrophobic residue Phe19 to the solvent triggers a structural collapse by disrupting the neighboring helix. Additionally, we investigated selected minima to determine the first passage times between states, thereby elucidating the kinetics of these energy landscapes. This comprehensive approach provides valuable insights into the thermodynamics and kinetics of Aβ monomers. By integration of multiple analytical techniques to explore the energy landscapes, our study investigates structural features associated with reduced solubility. These insights have the potential to inform future therapeutic strategies aimed at addressing protein misfolding and aggregation in neurodegenerative diseases.

Also flagged:MembranesmembranePeriodontitistumorsangiogenesisPolytetrafluoroethylene
Journal Article 2025-02-24 No Snippets Chen S, Wu Z, Huang Z, Liang C, Lee SJ.
Show Full Abstract

<h4>Background</h4>Periodontitis and bone loss in the maxillofacial and dental areas pose considerable challenges for both functional and aesthetic outcomes. To date, implantable dental barrier membranes, designed to prevent epithelial migration into defects and create a favorable environment for targeted cells, have garnered significant interest from researchers. Consequently, a variety of materials and fabrication methods have been explored in extensive research on regenerative dental barrier membranes.<h4>Methods</h4>This review focuses on dental barrier membranes, summarizing the various biomaterials used in membrane manufacturing, fabrication methods, and state-of-the-art applications for dental tissue regeneration. Based on a discussion of the pros and cons of current membrane strategies, future research directions for improved membrane designs are proposed.<h4>Results and conclusion</h4>To endow dental membranes with various biological properties that accommodate different clinical situations, numerous biomaterials and manufacturing methods have been proposed. These approaches provide theoretical support and hold promise for advancements in dental tissue regeneration.

SUDS3
Also flagged:chromatinreproductionregulation ofgene expressiontranscription factorspioneer factors
Journal Article 2025-02-24 ✓ 1 Snippet Cheng Y, Wang X, Ding Y, Zhang H, Jia Z, Raikhel AS.
In-Text Gene Mentions

…via control ofchromatin modifiersmodifiers such as…

Show Full Abstract

Female mosquitoes are vectors of many devastating human diseases because they require blood feeding to initiate reproduction. Thus, elucidation of molecular mechanisms managing female mosquito reproduction is essential. Although the regulation of gene expression during the mosquito gonadotrophic cycle has been studied in detail, how this process is controlled at the chromatin level remains unclear. Chromatin must be accessible for transcription factors (TFs) governing gene expression. A specialized class of TFs, called pioneer factors (PFs), binds and remodels closed chromatin, permitting other TFs to bind DNA and activate the gene expression. Here, we identified a homolog of the vertebrate PF FoxA in the mosquito <i>Aedes aegypti</i> and used the CRISPR-Cas9 system to generate mosquitoes deficient in <i>AaFoxA</i>. We found that ovary development was severely retarded in mutant females. Multiomics and molecular biology analyses have shown that AaFoxA increased histone acetylation and decreased methylation of H3K27 by controlling the chromatin accessibility of histone modification enzymes and chromatin remodelers. AaFoxA is bound to the loci of chromatin remodelers, changing their chromatin accessibility and modulating their temporal expression patterns. AaFoxA increased the accessibility of the ecdysone receptor (EcR) and E74 loci, indicating the important role of AaFoxA in the hormonal regulation of mosquito reproductive events. Further, the CUT&RUN and ATAC-seq analyses revealed that AaFoxA temporarily bound closed chromatin, making it differentially accessible during the mosquito gonadotrophic cycle. Hence, this study demonstrates that AaFoxA modulates chromatin dynamics throughout female mosquito reproduction.

Also flagged:alginatecalciumsodiumwaterdivalent ionspolyethylene glycol
Journal Article 2025-02-24 No Snippets Harder P, Funke L, Reh JT, Lieleg O, Özkale B.
Show Full Abstract

Microgels offer broad applications in bioengineering due to their customizable properties, supporting innovations in mechanobiology, tissue engineering, drug delivery, and cell therapy. This study focuses on characterizing ionically cross-linked alginate microgels using a nanoindentation technique, enabling precise assessment of their mechanical properties at the microscale. We report on the microfluidic fabrication of alginate microgels with varying sizes at different cross-linker concentrations and on the mechanical characterization of the resulting microgels in terms of Young's moduli as well as viscoelastic behavior. Measurements conducted using dynamic nanoindentation reveal that microgel elasticity is strongly influenced by the ionic composition of the surrounding media, in particular, the concentration of calcium and sodium. We demonstrate that the highest Young's modulus observed for ionically cross-linked alginate microgels is in deionized water (7.2 ± 0.9 kPa). A drastic softening effect is observed when the calcium cross-linked microgels are placed into a storage buffer containing divalent ions (0.7 ± 0.1 kPa) and cell culture media consisting of Dulbecco's Modified Eagle Medium (0.2 ± 0.1 kPa) with fetal bovine serum (0.4 ± 0.1 kPa). High concentrations of sodium were found to disrupt ionic cross-links, decreasing stiffness and increasing viscosity, with reversible effects observed upon switching back to deionized water. These findings highlight the importance of media selection for applications requiring mechanical stability, and we provide guidelines for measuring the mechanical properties of microgels in a robust manner that is applicable to a wide range of different conditions.

TNFSF4
Also flagged:cancerSMARCAL1tumorcancersGliomaLUAD
Journal Article 2025-02-24 ✓ 1 Snippet Zhao WJ, Wang ML, Zhao YF, Zhao WP, Huang QH, Lu ZW, Jia F, Shi JJ, Liu BS, Han WH, Lu HW, Zhang BC, Wang ZX.
In-Text Gene Mentions

…including CD276, NRP1,TNFSF4, CD40, CD200, and…

Show Full Abstract

Although immune checkpoint inhibition in particular has shown promise in cancer immunotherapy, it is not always efficient. Recent studies suggest that SMARCAL1 may play a role in tumor immune evasion, yet its pan-cancer role is unclear. We conducted a comprehensive analysis of SMARCAL1 using TCGA, GTEx, and CCLE databases, evaluating its expression, genetic alterations, epigenetic modifications, and their clinical correlations across 33 cancer types. Our findings indicate that SMARCAL1 is overexpressed in several cancers, such as Glioma, LUAD, KIRC, and LIHC, impacting prognosis. Elevated SMARCAL1 is linked to poor outcomes in Glioma, LUAD, and LIHC but correlates with better survival in KIRC. We also found significant associations between SMARCAL1 expression and DNA methylation in 13 cancers. Furthermore, SMARCAL1 expression correlates with immune infiltration, suggesting it as a potential therapeutic target in cancer immunotherapy. This study underscores the need for further research on SMARCAL1 to enhance immunotherapeutic strategies.

Also flagged:cerebrovascular diseasescovid-19CVDischemic strokeIschemic CVDSARS-Cov-2 infections
Journal Article 2025-02-24 No Snippets Abbas-Kayano RT, Hahr Marques Hökerberg Y, de Vasconcellos Carvalhaes de Oliveira R.
Show Full Abstract

<h4>Background</h4>The rapid spread of covid-19 overwhelmed healthcare systems. This study aimed to investigate the impact of the covid-19 pandemic on hospitalizations and hospital deaths due to cerebrovascular diseases (CVD) in São Paulo state, Brazil.<h4>Methods</h4>This ecologic study evaluated the CVD hospitalizations and hospital deaths (2017-2021) by demographic features and CVD type. During the pandemic (2020-2021), segmented regression models were used to detect changes in CVD trends. We also evaluated the detrended cross-correlation between CVD deaths and hospitalization with the SARS-Cov-2 infection series.<h4>Results</h4>During the pandemic, there is a 35% reduction in CVD hospitalizations, mainly in elective admissions and ischemic stroke, but a 6.5% increase in deaths, especially in Black and Brown individuals, and those aged 20-29 years. From 2020 to 2021, Black and Brown individuals experience an earlier and more prolonged increase in hospital deaths. Ischemic CVD hospitalizations decrease in the first quarter of 2020. Older people exhibit a monthly increase of 2.9% in hospitalizations and 5.3% in deaths in the 2nd and 3rd quarters of 2021. SARS-Cov-2 infections are inversely correlated to CVD hospitalizations and directly correlated to CVD hospital deaths.<h4>Conclusions</h4>Covid-19 pandemic negatively affects CVD hospitalizations and deaths, particularly in Black and Brown individuals. The decrease in hospitalizations and increase in hospital deaths of ischemic CVD highlights vulnerability in accessing healthcare resources during the pandemic.

HTT
Also flagged:Atrial fibrillationAFcardiac arrhythmiamitochondrialmetabolismGene Expression
Journal Article 2025-02-24 ✓ 5 Snippets Yang X, Lan W, Lin C, Zhu C, Ye Z, Chen Z, Zheng G.
In-Text Gene Mentions

…genes ACAT1, ALDH1L2,HTT, OGDH, and SLC25A3,…

…, HADHA ,HTT, IDH3G ,…

…, OGDH ,HTT, ACAT1 ,…

…, ALDH1L2 ,HTT, OGDH ,…

…ACAT1, SLC25A3, andHTT, whereas SLC25A3 was…

Show Full Abstract

Atrial fibrillation (AF) is a predominant cardiac arrhythmia with unclear etiology. This study used bioinformatics and machine learning to explore the relationship between mitochondrial energy metabolism-related genes (MEMRGs) and immune infiltration in AF. The datasets GSE31821, GSE41177, and GSE79768 were retrieved from the Gene Expression Omnibus (GEO) database, and differential expression analysis identified 59 mitochondrial energy metabolism-related differentially expressed genes (MEMRDEGs) associated with AF. Key MEMRDEGs were selected using the least absolute shrinkage and selection operator (LASSO) and support vector machine (SVM) methods, and a diagnostic model was developed. Immune infiltration was assessed using single-sample gene set enrichment analysis (ssGSEA) and the microenvironment cell population counter (MCPcounter). The diagnostic model, based on the key genes ACAT1, ALDH1L2, HTT, OGDH, and SLC25A3, achieved an area under the curve (AUC) of 0.903. Significant differences in immune cell composition were observed between the AF and control groups. ALDH1L2 was positively correlated with most immune cells, while SLC25A3 showed a negatively correlated with the monocytic lineage. The findings indicate that MEMRGs interact with immune responses in AF, offering insights into the potential molecular mechanisms and therapeutic targets for AF.

DNAH10CCDC92
Also flagged:insulin resistanceIRinsulinglucosediabetesobesity
Journal Article 2025-02-24 ✓ 2 Snippets Yurchishin ML, Fowler LA, Goss AM, Garvey WT, Gower BA.
In-Text Gene Mentions
⭐ same-sentence co-mention

…, FAM13A ,DNAH10, and CCDC92…

⭐ same-sentence co-mention

…DNAH10 , andCCDC92) that have…

Show Full Abstract

<h4>Objective</h4>The study objective was to determine whether associations between a genetic risk score (GRS) for insulin resistance (IR) and measures of insulin sensitivity differ by race and/or BMI status in African American (AA) and European American (EA) adults without diabetes.<h4>Methods</h4>Fifty-three AA and 54 EA participants were classified into "high" or "low" BMI groups using the sample median (25.9 kg/m<sup>2</sup>) as the cut point. The GRS was derived from 52 previously identified genetic variants. Skeletal muscle insulin sensitivity was measured with the hyperinsulinemic-euglycemic clamp. The homeostasis model assessment of insulin resistance (HOMA-IR) and the Matsuda index of insulin sensitivity were calculated from oral glucose tolerance test values to determine hepatic and whole-body insulin sensitivity, respectively. Linear regression models, stratified by race, assessed interactions between BMI status and GRS on measures of insulin sensitivity.<h4>Results</h4>In EA participants, associations of GRS with HOMA-IR and the Matsuda index differed by BMI status, where the GRS was associated with IR in the high-BMI group only. In AA participants, associations from the clamp differed by BMI status, but an association was observed only in the low-BMI group.<h4>Conclusions</h4>These results highlight the heterogeneity of IR and support the hypothesis that the relationship between genetic predisposition for IR and obesity is race- and tissue-specific.

Also flagged:TDP-43axonTDP43Amyotrophic Lateral SclerosisALSpathogenesis
Journal Article 2025-02-24 No Snippets Djukic S, Zhao Z, Jørgensen LMH, Bak AN, Jensen DB, Meehan CF.
Show Full Abstract

A hyperexcitability of the motor system is consistently observed in Amyotrophic Lateral Sclerosis (ALS) and has been implicated in the disease pathogenesis. What drives this hyperexcitability in the vast majority of patients is unknown. This is important to know as existing treatments simply reduce all neuronal excitability and fail to distinguish between pathological changes and important homeostatic changes. Understanding what drives the initial pathological changes could therefore provide better treatments. One challenge is that patients represent a heterogeneous population and the vast majority of cases are sporadic. One pathological feature that almost all (~97%) cases (familial and sporadic) have in common are cytoplasmic aggregates of the protein TDP-43 which is normally located in the nucleus. In our experiments we investigated whether this pathology was sufficient to increase neuronal excitability and the mechanisms by which this occurs. We used the TDP-43(ΔNLS) mouse model which successfully recapitulates this pathology in a controllable way. We used in vivo intracellular recordings in this model to demonstrate that TDP-43 pathology is sufficient to drive a severe hyper-excitability of spinal motoneurones. Reductions in soma size and a lengthening and constriction of axon initial segments were observed, which would contribute to enhanced excitability. Resuppression of the transgene resulted in a return to normal excitability parameters by 6-8 weeks. We therefore conclude that TDP-43 pathology itself is sufficient to drive a severe but reversible hyperexcitability of spinal motoneurones.

Also flagged:Stress granulesmembranelessorganellesresponse to externalprotein synthesisribonucleoprotein
Journal Article 2025-02-24 No Snippets Desai M, Gulati K, Agrawal M, Ghumra S, Sahoo PK.
Show Full Abstract

Stress granules are membraneless organelles that serve as a protective cellular response to external stressors by sequestering non-translating messenger RNAs (mRNAs) and regulating protein synthesis. Stress granules formation mechanism is conserved across species, from yeast to mammals, and they play a critical role in minimizing cellular damage during stress. Composed of heterogeneous ribonucleoprotein complexes, stress granules are enriched not only in mRNAs but also in noncoding RNAs and various proteins, including translation initiation factors and RNA-binding proteins. Genetic mutations affecting stress granule assembly and disassembly can lead to abnormal stress granule accumulation, contributing to the progression of several diseases. Recent research indicates that stress granule dynamics are pivotal in determining their physiological and pathological functions, with acute stress granule formation offering protection and chronic stress granule accumulation being detrimental. This review focuses on the multifaceted roles of stress granules under diverse physiological conditions, such as regulation of mRNA transport, mRNA translation, apoptosis, germ cell development, phase separation processes that govern stress granule formation, and their emerging implications in pathophysiological scenarios, such as viral infections, cancer, neurodevelopmental disorders, neurodegeneration, and neuronal trauma.

Also flagged:neurodegenerative diseasescognitionextracellularneuropsychiatric disorderspathogenesissemaphorin
Journal Article 2025-02-24 No Snippets Yuasa-Kawada J, Kinoshita-Kawada M, Hiramoto M, Yamagishi S, Mishima T, Yasunaga S, Tsuboi Y, Hattori N, Wu JY.
Show Full Abstract

The nervous system processes a vast amount of information, performing computations that underlie perception, cognition, and behavior. During development, neuronal guidance genes, which encode extracellular cues, their receptors, and downstream signal transducers, organize neural wiring to generate the complex architecture of the nervous system. It is now evident that many of these neuroguidance cues and their receptors are active during development and are also expressed in the adult nervous system. This suggests that neuronal guidance pathways are critical not only for neural wiring but also for ongoing function and maintenance of the mature nervous system. Supporting this view, these pathways continue to regulate synaptic connectivity, plasticity, and remodeling, and overall brain homeostasis throughout adulthood. Genetic and transcriptomic analyses have further revealed many neuronal guidance genes to be associated with a wide range of neurodegenerative and neuropsychiatric disorders. Although the precise mechanisms by which aberrant neuronal guidance signaling drives the pathogenesis of these diseases remain to be clarified, emerging evidence points to several common themes, including dysfunction in neurons, microglia, astrocytes, and endothelial cells, along with dysregulation of neuron-microglia-astrocyte, neuroimmune, and neurovascular interactions. In this review, we explore recent advances in understanding the molecular and cellular mechanisms by which aberrant neuronal guidance signaling contributes to disease pathogenesis through altered cell-cell interactions. For instance, recent studies have unveiled two distinct semaphorin-plexin signaling pathways that affect microglial activation and neuroinflammation. We discuss the challenges ahead, along with the therapeutic potentials of targeting neuronal guidance pathways for treating neurodegenerative diseases. Particular focus is placed on how neuronal guidance mechanisms control neuron-glia and neuroimmune interactions and modulate microglial function under physiological and pathological conditions. Specifically, we examine the crosstalk between neuronal guidance signaling and TREM2, a master regulator of microglial function, in the context of pathogenic protein aggregates. It is well-established that age is a major risk factor for neurodegeneration. Future research should address how aging and neuronal guidance signaling interact to influence an individual's susceptibility to various late-onset neurological diseases and how the progression of these diseases could be therapeutically blocked by targeting neuronal guidance pathways.

CACNA1E
Also flagged:kinaseRIPK3viral infectionneurotransmissioninfectionreceptor-interacting protein kinase-3
Journal Article 2025-02-24 ✓ 1 Snippet Estevez I, Buckley BD, Lindman M, Panzera N, Chou TW, McCourt M, Vaglio BJ, Atkins C, Firestein BL, Daniels BP.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

While recent work has identified roles for immune mediators in regulating neural activity, how innate immune signaling within neurons influences neurotransmission remains poorly understood. Emerging evidence suggests that the modulation of neurotransmission may serve important roles in host protection during infection of the central nervous system. Here, we showed that receptor-interacting protein kinase-3 (RIPK3) preserved neuronal survival during flavivirus infection through the suppression of excitatory neurotransmission. These effects occurred independently of the traditional functions of RIPK3 in promoting necroptosis and inflammatory transcription. Instead, RIPK3 promoted phosphorylation of the neuronal regulatory kinase calcium/calmodulin-dependent protein kinase II (CaMKII), which in turn activated the transcription factor cyclic AMP response element-binding protein (CREB) to drive a neuroprotective transcriptional program and suppress deleterious glutamatergic signaling. These findings identify an unexpected function for a canonical cell death protein in promoting neuronal survival during viral infection through the modulation of neuronal activity, highlighting mechanisms of neuroimmune crosstalk.

Also flagged:synthesisorganizationelectronsbindingcationsdendrimers
Journal Article 2025-02-24 No Snippets Andrews KG.
Show Full Abstract

The bespoke environments in enzyme active sites can selectively accelerate chemical reactions by as much as 10<sup>19</sup>. Macromolecular and supramolecular chemists have been inspired to understand and mimic these accelerations and selectivities for applications in catalysis for sustainable synthesis. Over the past 60+ years, mimicry strategies have evolved with changing interests, understanding, and synthetic advances but, ubiquitously, research has focused on use of a molecular "cavity". The activities of different cavities vary with the subset of features available to a particular cavity type. Unsurprisingly, without synthetic access to mimics able to encompass more/all of the functional features of enzyme active sites, examples of cavity-catalyzed processes demonstrating enzyme-like rate accelerations remain rare. This perspective will briefly highlight some of the key advances in traditional cavity catalysis, by cavity type, in order to contextualize the recent development of robust organic cage catalysts, which can exploit stability, functionality, and reduced symmetry to enable promising catalytic modes.

CACNA1E
Also flagged:NRF2insulin resistanceglucoseinsulingestational diabetes mellituscell proliferation
Journal Article 2025-02-24 ✓ 1 Snippet Haidery F, Lambertini L, Tse I, Dodda S, Garcia-Ocaña A, Scott DK, Baumel-Alterzon S.
In-Text Gene Mentions

…alpha1 E (Cacna1e) [ 85…

Show Full Abstract

The late stages of mammalian pregnancy are accompanied by a mild increase in insulin resistance likely due to enhanced glucose demand of the growing fetus. Therefore, as an adaptive process to maintain euglycemia during pregnancy, maternal β-cell mass expands leading to increased insulin release. Defects in functional β-cell adaptive expansion during pregnancy can lead to gestational diabetes mellitus (GDM). While the exact mechanisms that promote GDM are poorly understood, GDM is associated with inadequate functional β-cell mass expansion and with a systematic increase of oxidative stress. Here, we show that NRF2 levels are upregulated in mouse β-cells at gestational day 15 (GD15). Inducible β-cell-specific Nrf2 deleted (βNrf2KO) mice display reduced β-cell proliferation, increased β-cell oxidative stress and lipid peroxidation, compromised β-cell function, and elevated β-cell death, leading to impaired β-cell mass expansion and dysregulated glucose homeostasis towards the end of pregnancy. Importantly, the gestational hormone 17-β-estradiol (E2) increases NRF2 levels, and downregulation of NRF2 suppresses E2-induced protection of β-cells against oxidative stress, suggesting that E2 exerts its antioxidant effects through activation of NRF2 signaling in β-cells. Collectively, these data highlight the critical role of NRF2 in regulating oxidative stress during the adaptive response of β-cells in pregnancy and identify NRF2 as a potential therapeutic target for GDM treatment.

Also flagged:idebenonecardiovascular diseaseCVDcell proliferationoxygenhematoxylin
Journal Article 2025-02-24 No Snippets Peng Y, Guo Y, Yang X, Liu Y, Xu X, Chen J, Liu X, Xie Z, Yu Z, Wu D, Chen Z.
Show Full Abstract

Oxidative stress-induced cardiomyocyte apoptosis was the primary causative factor of cardiovascular disease (CVD). However, the existing therapy drugs for oxidative stress were much less investigated, which underlined the necessity for new drug discovery and development. Herein, we aimed to synthesize several novel idebenone (IDE) derivatives and investigate the protective effect and mechanism of these derivatives against H<sub>2</sub>O<sub>2</sub>-induced oxidative stress injury in H9C2 cells by determining cell proliferation rate, detecting the reactive oxygen species (ROS) level, and the expression of related proteins. Additionally, the study also investigated the protective effect of IDE-1 pretreatment on Balb/c mice after hypoxia-reoxygenation. <i>In vivo</i> experiments, the damage to cardiomyocytes was assessed using hematoxylin-eosin (HE) staining and terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) staining. The results showed that IDE-1 possessed the highest antioxidant damage activity among all IDE derivatives, which could notably decrease the levels of intracellular ROS. Furthermore, the antioxidant mechanism was confirmed to be potentially linked to the expression levels of the oxidation-related pathway heme oxygenase-1 (HO-1) and the apoptosis-related pathway Bcl-2/Bax and caspase-3. Our results demonstrated that IDE derivatives could be a new research direction for the treatment of cardiovascular diseases associated with oxidative stress.

Also flagged:ironColorectal cancermetabolismexcretionhemeiron deficiency
Journal Article 2025-02-24 No Snippets Yousefi MH, Masoudi A, Saberi Rounkian M, Mansouri M, Hojat B, Kaveh Samani M, Veisi R, Honarvar Bakeshloo P, Nosratipour R, Afkhami H, Saeb S.
Show Full Abstract

Colorectal cancer (CRC) is a common and lethal malignancy that affects millions of people worldwide. Iron is an essential micronutrient that plays a vital role in various biological processes, but also has pro-oxidant and pro-inflammatory effects that may contribute to carcinogenesis. The relationship between iron and CRC is complex and influenced by multiple factors, such as dietary intake, absorption, storage, metabolism, and excretion of iron, as well as genetic and environmental factors that modulate iron homeostasis. This review article aims to provide an overview of the current evidences on the role of iron in CRC, discussing the potential mechanisms by which iron may affect CRC development and progression, as well as the implications for prevention and treatment. This review tries to focus on the following aspects: an introduction to iron and its role in CRC, role of heme and non-heme iron in CRC, dietary patterns, nutrition, and CRC, iron overload in CRC, iron deficiency and its role in CRC especially in surgery outcome and iron therapy and blood transfusion in CRC.

OLFM4
Also flagged:interstitial lung diseaserheumatoid arthritisRAsystemic autoimmune diseaseidiopathic pulmonary fibrosisusual interstitial pneumonia
Journal Article 2025-02-24 ✓ 1 Snippet Bernardinello N, Zen M, Castelli G, Cocconcelli E, Balestro E, Borie R, Spagnolo P.
In-Text Gene Mentions

…olfactomedin 4 (OLFM4), a baculoviral…

Show Full Abstract

Rheumatoid arthritis (RA) is a systemic autoimmune disease that affects millions of people worldwide and is characterized by persistent inflammation, pain, and joint destruction. In RA, the dysregulation of the immune system is well documented. However, the genetic basis of the disease is not fully understood, especially when extra-articular organs are involved. Interstitial lung disease (ILD) is a major cause of morbidity and mortality in patients with RA. Notably, RA-ILD shares several risk factors with idiopathic pulmonary fibrosis (IPF), namely male gender, smoking history, usual interstitial pneumonia (UIP) pattern of fibrosis, and association with the <i>MUC5B</i> rs35705950 polymorphism. In addition, other genetic susceptibilities are reported in RA-ILD for some HLA alleles and other less studied polymorphisms. However, the pathobiology of RA-ILD, particularly whether and to what extent genetic and environmental factors interact to determine the disease, remains elusive. In this review, we summarize and critically discuss the most recent literature on the genetics and pathogenesis of RA-ILD. The main clinical aspects of RA-ILD are also discussed.

DCC
Also flagged:Axon guidance proteinsneurological disorderspsychiatric disordersneurodegenerative diseasesaxon guidance proteindraxin
Journal Article 2025-02-24 ✓ 1 Snippet Shinmyo Y.
In-Text Gene Mentions

…in colorectal cancer (Dcc) and Neogenin (Neo1)…

Show Full Abstract

Axon guidance proteins not only play a role in the formation of proper neural circuits but also have other important functions, such as cell survival, migration, and proliferation in the brain. Therefore, mutations in the genes encoding these proteins frequently cause various types of neurological disorders, including psychiatric disorders and neurodegenerative diseases. We previously identified an axon guidance protein, draxin, that is essential for the development of several neural circuits and cell survival in the brain. Recently, the deletion of the <i>draxin</i> gene was identified in an inbred BTBR T<sup>+</sup> Itpr3<sup>tf</sup>/J (BTBR/J) mouse, which is a widely used model of Autism Spectrum Disorder (ASD), suggesting that <i>draxin</i> deletion is a genetic factor for ASD-like characteristics in BTBR/J mice. In this review, I summarize the neuroanatomical abnormalities in <i>draxin</i> knockout mice by comparing them to BTBR/J mice and discuss the possible contributions of draxin to anatomical and behavioral phenotypes in BTBR/J mice.

PEBP1
Also flagged:FerroptosispathogenesisAtherosclerosisAScardiovascular diseasedepression
Journal Article 2025-02-24 ✓ 5 Snippets Zhao Y, Ren P, Luo Q, Li X, Cheng X, Wen Y, Wu X, Zhou J.
In-Text Gene Mentions

…of the iron-death-associatedPEBP1-GPX4 pathway.…

…the expression ofPEBP1, ERK1/2, GPX4, FTH1,…

…mice Activation ofPEBP1-GPX4 Improve microglia cell…

…GPX4:Glutathione Peroxidase 4;PEBP1: Phosphatidylethanolamine Bin…

…mice by modulatingPEBP1-GPX4-mediated ferroptosis in …

Show Full Abstract

Atherosclerosis (AS)-related cardiovascular disease and depression are often comorbid, with patients with cardiovascular disease facing an increased risk of depression, which worsens AS. Both diseases are characterized by oxidative stress and lipid metabolism disorders. Ferroptosis, a form of cell death characterized by iron overload and harmful lipid peroxide accumulation, is found in various diseases, including AS and depression. Consistent with the iron deposition and lipid peroxidation (LPO) that characterize the ferroptosis mechanism, disturbances in iron and lipid metabolism are also crucial pathogenic mechanisms in AS and depression. The comorbid mechanisms are complex, posing challenges for clinical treatment. Chinese herbs hold significant potential owing to their multi-target pharmacological effects. Therefore, this review aims to investigate iron overload, LPO, and ferroptosis across various cell types, the shared pathogenesis of AS and depression with ferroptosis, and research on Chinese herbal medicine targeting ferroptosis in the treatment of anti-AS co-depression. This provides a comprehensive understanding of AS co-depression disease from the perspective of ferroptosis.

Also flagged:aggressiongenetic disordersbehaviouraltranslationalneurodevelopmental disordersautism spectrum disorder
Journal Article 2025-02-24 No Snippets Zhang K, Ibrahim GM, Venetucci Gouveia F.
Show Full Abstract

Nonsuicidal self-injurious behaviour (SIB) is a debilitating manifestation of physical aggression commonly observed across neurodevelopmental, psychiatric, and genetic disorders. This behaviour arises from a multifactorial aetiology involving genetic predispositions, epigenetic modifications, neurotransmitter dysregulation, and environmental stressors. Dysregulation in dopaminergic, serotonergic, glutamatergic, and GABAergic systems has been implicated in the pathophysiology of SIB, alongside structural and functional abnormalities within fronto-limbic-striatal circuits. These disruptions impair key processes, such as emotional regulation, reward processing, and behavioural inhibition, contributing to the emergence and reinforcement of SIB. Advances in preclinical research using genetic, lesion-based, pharmacological, and environmental animal models have been instrumental in elucidating the molecular and neurocircuitry underpinnings of SIB. Emerging neuromodulation therapies targeting critical nodes within the fronto-limbic-striatal network, particularly deep brain stimulation, have shown promise in treating severe, refractory SIB and improving quality of life. This review integrates current evidence from clinical studies, molecular research, and preclinical models to provide a comprehensive overview of the pathophysiology of SIB and therapeutic approaches. By focusing on the molecular mechanisms and neural circuits underlying SIB, we highlight the translational potential of emerging pharmacological and neuromodulatory therapies. A deeper understanding of these pathways will pave the way for precision-based interventions, bridging the gap between molecular research and clinical applications in SIB and related conditions.

Also flagged:Sulfonateglycosylationpost-translational modificationsSchiff baseglycopeptidesglycoproteins
Journal Article 2025-02-24 No Snippets Yang S, Jiang Y, Jiang S, Liu L, Liu S, Zhang H, Gu Z.
Show Full Abstract

Aberrant protein glycosylation is closely associated with a number of biological processes and diseases. However, characterizing the types of post-translational modifications (PTMs) from the complex biological samples is challenging for comprehensive glycoproteomic analysis. The development of high-performance enrichment materials and strategies during the sample pretreatment process is a prerequisite to glycoproteome research. Here in this work, a sulfonate-rich covalent organic framework (COF) called TpPa-(SO<sub>3</sub>H)<sub>2</sub> (referred to as SCOF-2) was synthesized using the Schiff base reaction for the identification of glycopeptides. Benefiting from high hydrophilicity and abundant sulfonate affinity, a total of 28 and 16 glycopeptides could be efficiently detected from the standard glycoproteins of horseradish peroxidase (HRP) and immunoglobulin G (IgG) tryptic digest, respectively. Moreover, the as-prepared sulfonate-rich SCOF-2 has an ultralow detection limit (0.01 fmol μL<sup>-1</sup>), excellent enrichment selectivity (molar ratio HRP:BSA = 1:5000), satisfactory recovery rate (89.1%), high adsorption capacity (150 mg g<sup>-1</sup>) and good reusability in the individual enrichment. Meanwhile, by using the SCOF-2 adsorbent, 196 and 194 endogenous glycopeptides in the serum of ovarian cancer patients and healthy people among triplicates were successfully enriched and identified, respectively, using combined nanoLC-MS/MS technology. It demonstrated its great application potential in glycoproteomics research and provided a novel insight for the design of affinity materials.

DCC
Also flagged:PyrethroidsWatercypermethrinβ-cypermethrincyfluthrinfenpropathrin
Journal Article 2025-02-24 ✓ 5 Snippets Hou S, Zhang D, Xu Z, Shen Y, Wang Y.
In-Text Gene Mentions

…Synthesis of A-DCC-KLH, A-DCC-BSA, and A-DCC-OVA…

…A-DCC-KLH, A-DCC-BSA, and A-DCC-OVA…

…-KLH, A-DCC-BSA, A-DCC-OVA, B-DCC-BSA, and C-DCC-OVA, the…

…protein concentrations for A-DCC-KLH, A-DCC-BSA, and A-DCC-OVA…

…ncentrations for A-DCC-KLH, A-DCC-BSA, and A-DCC-OVA were…

Show Full Abstract

Pyrethroids are one of the most commonly used insecticides worldwide in agriculture, public health, and household products. To monitor the presence of pyrethroids in the environment and in food, a broad-spectrum monoclonal antibody (mAb), CL/CN-1D2, was prepared. This mAb demonstrates a 50% inhibitory concentration (IC50) for different pyrethroids: cypermethrin (129.1 µg/L), β-cypermethrin (199.6 µg/L), cyfluthrin (215.5 µg/L), fenpropathrin (220.3 µg/L), λ-cyhalothrin (226.9 µg/L), β-cyfluthrin (241.7 µg/L), deltamethrin (591.2 µg/L), and fenvalerate (763.1 µg/L). Using the mAb CL/CN-1D2, a highly sensitive heterologous indirect competitive ELISA (ic-ELISA) was developed for the rapid detection of these pyrethroids. The limit of detection (LOD) for the eight pyrethroids in water, milk, celery, and leek matrices ranged from 24.4 to 152.2 μg/kg. The recoveries ranged from 65.1% to 112.4%, with a coefficient of variation (CV) below 15%. A robust correlation (<i>R</i><sup>2</sup> = 0.9945) between the ic-ELISA and GC indicated that the ic-ELISA is a reliable tool for the rapid and cost-effective screening of pyrethroids residues.

Also flagged:Formaldehydeirritable bowel syndromeIBSmicrobial infectionsarthritisbronchitis
Journal Article 2025-02-24 No Snippets Thulluri SP, Selvaraj K, Yerraguntla DP, Kumar SS.
Show Full Abstract

Formaldehyde, a pervasive environmental toxin, has well-documented deleterious effects on critical organ systems. This review examines the therapeutic potential of <i>Ferula asafoetida</i> (FA) root extracts in protecting the testes, kidneys, and liver against formaldehyde-induced toxicity in rodent models. The literature reveals that FA's active constituents, known for their potent antioxidant and anti-inflammatory activities, may counteract oxidative stress and cellular damage caused by formaldehyde exposure. The review explores formaldehyde-induced pathophysiological mechanisms and FA's protective effects, including mitigation of oxidative damage, inflammation, and apoptosis. By analyzing empirical evidence, it compares the efficacy of various extract preparations, dosage regimens, and treatment durations. The review also addresses methodological heterogeneity and challenges in extrapolating findings to humans. It concludes with a call for rigorous, controlled clinical trials to validate FA's therapeutic viability, offering hope for those affected by formaldehyde toxicity.

PCDH17
Also flagged:chromosomeschromosomeamino acidironautosomesamino acids
Journal Article 2025-02-24 ✓ 3 Snippets Gerhards K, Egerer C, Becker S, Willems H, Engel P, Koenig S, Reiner G.
In-Text Gene Mentions

…and protocadherin 17 (PCDH17), 7.8 Mbp to…

…ThePCDH17gene, located in…

…Circovirus Type 2PCDH17Protocadherin 17 PCDHA1…

Show Full Abstract

Tail docking is still used in pigs to reduce the prevalence of tail biting, although it is purely symptomatic and contrary to animal welfare. Genetic selection for shorter tails might, however, help to avoid tail docking and has therefore been proposed. A genetic basis for tail length is known for many species. Variability in tail length, including moderate heritability, has also been demonstrated in pigs. The aim of the present study was to identify genetic markers for tail length and to define candidate genes. To this end, 140 piglets were phenotyped and genotyped at 3 days of age and a genome-wide association study was performed. Seven SNPs were mapped on chromosomes 1, 2, 6, 11, and 15. Two linked SNPs on chromosome 2 resulted in a functional amino acid exchange. The genotypes at the SNPs were only associated with small differences in relative tail length of up to 16.5% (short genotype versus long genotype at SSC15), but at the same time with the occurrence of malformations in the form of tail kinks. The small effect size and the association between tail length and tail kinks, together with the generally pure symptomatic effect on tail biting, argue against the applicability of selection for shorter tails in pigs.

HFE
Also flagged:IronHomeostasisanemiaIron overloadred blood cell disorderssickle cell disease
Journal Article 2025-02-24 ✓ 1 Snippet Parry CS, Li Y, Kwofie SK, Valencia J, Tope Niedermaier CA, Ramadhar TR, Nekhai S, Wilson MD, Butcher RJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Disrupted iron balance causes anemia and iron overload leading to hypoxia and systemic oxidative stress. Iron overload may arise from red blood cell disorders such as sickle cell disease, thalassemia major and primary hemochromatosis, or from treatment with multiple transfusions. These hematological disorders are characterized by constant red blood cell hemolysis and the release of iron. Hemolysis is a continuous source of reactive oxygen species whose accumulation changes the redox potential in the erythrocyte, the endothelium and other tissue causing damage to organ systems. Iron overload and its consequences can be treated with iron chelating therapy. We have carried out structural studies of small molecule ligands that were previously reported for their iron chelating ability. The chelators were analyzed using mass spectrometry, proton nuclear magnetic resonance and infrared spectroscopy. The iron chelators, 2-benzoylpyridine-4,4-dimethyl-3-thiosemicarbazone, 3-ethyl-1-{[2-phenyl-1-(pyridin-2-yl)ethylidene]amino}thiourea and 1-{[2-phenyl-1-(pyridin-2-yl)ethylidene]amino}-3-(prop-2-en-1-yl)thiourea in their unbound conformation were crystallized and their structures were determined. This work addresses the evolution of a thiosemicarbazone class of iron chelators by analyzing and comparing the structure and properties of a series of closely related molecules, relating these to their <i>in vitro</i> activity thus providing valuable update to the search for newer, better and more effective iron chelators and metal-based therapeutics.

Also flagged:ALLB-cell acute lymphoblastic leukemiaB-ALLhematologicalreverse transcriptionhaematolymphoid tumors
Journal Article 2025-02-24 No Snippets Gupta SK, Leons GK.
Show Full Abstract

B-cell acute lymphoblastic leukemia (B-ALL) is the most common hematological malignancy of childhood. The initial risk-stratification includes the genetic evaluation for common recurrent translocations and aneuploidies in B-ALL using karyotyping, fluorescence in-situ hybridization (FISH), reverse transcription polymerase chain reaction (RT-PCR), etc. However, many cases remain genetically unclassified and are labeled as B-other ALL. Recent advances in the high throughput genomics have provided new insights and many distinct genetic subtypes have been identified in B-ALL. These new subtypes have been incorporated in the latest World Health Organization (WHO)-HAEM5 classification of haematolymphoid tumors and the International Consensus Classification. Besides the driver mutations, there is also a role of secondary genetic events like copy number alterations (CNAs) in the pathogenesis of B-ALL as well as for better risk-stratification. New molecular genetic risk evaluation like Moorman's criteria, IKZF1plus and MRplus scores have been recently validated which can risk-stratify B-ALL patients at baseline based on the CNA profile. The new diagnostic armamentarium now also includes flow-based ploidy analysis, cytokine receptor like factor 2 (CRLF2/TSLPR) overexpression screening on flow cytometry, multiplex ligation dependent probe amplification (MLPA) for CNAs, targeted RNA sequencing and whole transcriptome sequencing for detection of known and novel fusions. The gene expression profiling data can also be assessed with the machine learning based genetic classifiers for prediction of the newly identified subtypes of B-ALL. This review attempts to provide updates about the latest developments in the field of B-ALL genetics with inputs of Indian data, wherever available.

Research Square 2025-02-24 Preprint (No Snippets API) Liu M, Wang W, Liu H, Wang Z, Xiong Z, Li X, Yang H.
Show Full Abstract

<title>Abstract</title> <p><bold>Background</bold>: Ferroptosis, a novel form of regulated cell death, has emerged as a significant research focus due to its involvement in various cancers. This study combines single-cell RNA sequencing with Mendelian randomization (MR) methods to identify genetic factors that are associated with ferroptosis and explore their potential impact on the pathogenesis of glioblastoma (GBM). <bold>Methods</bold>: MR and multiple validation methods were used to identify ferroptosis-related genes in glioblastoma. Single-cell analysis was performed to evaluate the expression levels of ferroptosis markers across different glioblastoma cell types. Additionally, gene enrichment analysis was conducted to explore gene functions, while survival analysis examined the relationship between gene expression and patient prognosis. Immune cell infiltration analysis was also carried out for genes associated with prognosis. <bold>Results</bold>: MR and sensitivity analyses identified 9 ferroptosis-related genes that are associated with GBM: SIRT1, KDM3B, VCP, GPT2, PRDX6, CISD2, TP53, FLT3, and FANCD2. Co-localization analysis showed a significant association between the VCP gene and GBM. Single-cell analysis revealed that PRDX6 is highly expressed in tumor tissues. Gene enrichment analysis highlighted the biological processes such as cell metabolism, DNA repair, ubiquitination, and autophagy in the occurrence and progression of GBM. Immune infiltration and survival analyses suggest that CISD2 was related to CD8+ and CD4+ T cell infiltration, and may affect patient prognosis. <bold>Conclusions</bold>: This study combines MR analysis and single-cell analysis to reveal the crucial role of ferroptosis genes in GBM. These genes influence the occurrence and development of GBM by regulating processes such as metabolism, DNA repair, oxidative stress, and autophagy. Among them, PRDX6 plays an important role in microscopic research, while ubiquitination and autophagy are key drivers of GBM progression. The CISD2 gene may influence patient prognosis by regulating T cell infiltration, thereby promoting immune tolerance mechanisms in tumor cells.</p>

SHISA6
Also flagged:MyD88multiple sclerosisaxonalMSglutamate transport proteinsadaptor protein
Journal Article 2025-02-23 ✓ 2 Snippets Lohrberg M, Mortensen LS, Thomas C, Fries F, van der Meer F, Götz A, Landt C, Rhee HJ, Rhee J, Gómez-Varela D, Schmidt M, Möbius W, Ruhwedel T, Pardo LA, Remling L, Kramann N, Wrzos C, Bahn E, Stadelmann C, Barrantes-Freer A.
In-Text Gene Mentions

…Also,SHISA6which is important…

…the postsynapse, includingSHISA6and DLGAP1 (GKAP),…

Show Full Abstract

Progressive neurological decline in multiple sclerosis is associated with axonal loss and synaptic dysfunction in the non-demyelinated normal appearing gray matter (NAGM) and prominently in the cerebellum. In contrast to early disease stages, where synaptic and neuro-axonal pathology correlates with the extent of T cell infiltration, a prominent role of the innate immune system has been proposed for progressive MS. However, the specific contribution of microglia and astrocytes to synaptic cerebellar pathology in the NAGM- independent of an adaptive T cell response - remains largely unexplored. In the present study, we quantified synaptic changes in the cerebellar NAGM distant from demyelinated lesions in a mouse model of toxic demyelination. Proteomic analysis of the cerebellar cortex revealed differential regulation of synaptic and glutamate transport proteins in the absence of evident structural synaptic pathology or local gray matter demyelination. At the functional level, synaptic changes manifested as a reduction in frequency-dependent facilitation at the parallel fiber- Purkinje cell synapse. Further, deficiency of MyD88, an adaptor protein of the innate immune response, associated with a functional recovery in facilitation, reduced changes in the differential expression of synaptic and glutamate transport proteins, and reduced transcription levels of inflammatory cytokines. Nevertheless, the characteristics of demyelinating lesions and their associated cellular response were similar to wild type animals. Our work brings forward an experimental paradigm mimicking the diffuse synaptic pathology independent of demyelination in late stage MS and highlights the complex regulation of synaptic pathology in the cerebellar NAGM. Moreover, our findings suggest a role of astrocytes, in particular Bergmann glia, as key cellular determinants of cerebellar synaptic dysfunction.

HFE
Also flagged:Inflammatory bowel diseasehereditary hemochromatosiscolitiscolon cancerHHiron
Journal Article 2025-02-23 ✓ 5 Snippets Fein J, Hildreth A, Choi LJ, Huang JS.
In-Text Gene Mentions

…and variants inHFEwhich causes hereditary…

…iron overload andHFE‐related comorbidities.…

…Reports ofHFEvariants among IBD…

…patients with bothHFEgene variants and…

…the prevalence ofHFEvariants in the…

Show Full Abstract

We report a case series of three pediatric patients with inflammatory bowel disease (IBD) and variants in <i>HFE</i> which causes hereditary hemochromatosis (HH) type 1. Mice models suggest that these patients may be at increased risk for colitis and colon cancer. We detail the clinical course of these patients regarding IBD and iron overload and <i>HFE</i>-related comorbidities. We also review the known literature regarding HH and IBD overlap, HH detection and screening recommendations, HH management strategies, and iron management strategies in the context of both iron overload risk and IBD.

SOX6
Also flagged:STINGintervertebral disc degenerationcGASstimulator of interferonoxygenWnt
Journal Article 2025-02-22 ✓ 1 Snippet Luo L, Zhang S, Gong J, Zhang J, Xie P, Yin J, Zhang M, Zhang C, Chen H, Liu Y, Ni B, Li C, Tian Z.
In-Text Gene Mentions

…NPLCs, such assox6, krt19 ,…

Show Full Abstract

The hypoxic and high-pressure microenvironment of the intervertebral discs poses a major challenge to the survival and therapeutic efficiency of exogenous stem cells. Therefore, improving the utilization efficiency and therapeutic effect of exogenous stem cells to delay intervertebral disc degeneration (IVDD) is of great importance. Here, hypoxic induction studies are conducted in vivo and in vitro using rat costal cartilage-derived skeletal stem cells (SSCs) and find that hypoxia activates the cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS)/stimulator of interferon genes (STING) signaling pathway and increased reactive oxygen species (ROS) accumulation, triggering ferroptosis in SSCs through hypoxia-inducible factor-1 alpha-dependent mitophagy. Progressive hypoxia preconditioning reduce STING expression and ROS accumulation, inducing SSCs differentiation into nucleus pulposus-like cells via the Wnt signaling pathway. Considering this, a 3-D sustained-release culture carrier is generated by mixing SSCs with methacrylated hyaluronic acid and polydopamine nanoparticles coated with the STING inhibitor C-176 and evaluated its inhibitory effect on IVDD. This carrier is demonstrated to inhibit the cGAS/STING pathway and prevent ROS accumulation by continuously releasing C-176-coated polydopamine nanoparticles, thereby reducing ferroptosis, promoting differentiation, and ultimately attenuating IVDD, suggesting its potential as a novel treatment strategy.

Also flagged:SCN2ADystonia Parkinsonism
Journal Article 2025-02-22 No Snippets Bisquoli M, Cavallieri F, Di Rauso G, Monfrini E, Fioravanti V, Salomone G, Russo M, Rizzi R, Di Fonzo A, Valzania F.
Show Full Abstract

No abstract available.

HFE
Also flagged:IRIDAmicrocytic anaemiaironTMPRSS6iron deficiency anaemiarefractory iron deficiency anaemia
Journal Article 2025-02-22 ✓ 1 Snippet Hoving V, Donker AE, Schols SEM, Swinkels DW.
In-Text Gene Mentions

…disorders such asHFE‐hereditary hemochromatosis, w…

Show Full Abstract

Iron-refractory iron deficiency anaemia (IRIDA) is a rare hereditary microcytic anaemia characterized by partial or complete resistance to oral iron supplementation, caused by elevated plasma hepcidin levels resulting from pathogenic variants in the TMPRSS6 gene. Although intravenous iron supplementation is often effective, patient responses can vary significantly due to various factors, and potential side effects of this treatment remain unclear. Additionally, evidence-based international guidelines for diagnosing and managing IRIDA are lacking. This review aims to provide patient-tailored treatment strategies, informed by case studies and expert opinion, to address the specific therapeutic needs of both children and adults with IRIDA.

HTT
Also flagged:movement disordershypokinetic movement disordersdystoniachoreamyoclonusparkinsonism
Journal Article 2025-02-22 ✓ 1 Snippet Sartorelli J, Ng J, Rahim AA, Waddington SN, Kurian MA.
In-Text Gene Mentions

…repeat in theHTTgene.…

Show Full Abstract

Movement disorders are a group of heterogeneous neurological conditions associated with alterations of tone, posture and voluntary movement. They may either occur in isolation or as part of a multisystemic condition. More recently, the advent of next generation sequencing technologies has facilitated better understanding of the underlying causative genes and molecular pathways, thereby identifying targets for genetic therapy. In this review, we summarize the advances in genetic therapy approaches for both hyperkinetic and hypokinetic movement disorders, including Parkinson's Disease, Huntington's Disease and rarer monogenic conditions of childhood onset. While there have been significant advances in the field, multiple challenges remain, related to safety, toxicity, efficacy and brain biodistribution, which will need to be addressed by the next generation of genetic therapies.

DCC
Also flagged:sinonasal carcinomasrespiratory epithelial adenomatoid hamartomasseromucinoushamartomasadenoid cystic carcinomasAdCC
Journal Article 2025-02-22 ✓ 1 Snippet Bradová M, Agaimy A, Laco J, Martínek P, Ing SK, Badoual C, Damjanov I, Leivo I, Bacchi CE, Comperat E, Ihrler S, Rupp NJ, Šíma R, Šteiner P, Vaněček T, Mueller S, Ventelä S, Skálová A, Michal M.
In-Text Gene Mentions

…(CDKN2/p16) and 18q (DCC/DPC4).…

Show Full Abstract

The pathology of reactive, dysplastic, and neoplastic sinonasal seromucinous glands is complex, and their contribution to tumorigenesis of sinonasal carcinomas remains controversial. In our practice, we have observed the presence of respiratory epithelial adenomatoid hamartomas (REAH) and seromucinous hamartomas (SH) associated with adenoid cystic carcinomas (AdCC) in a subset of cases. In many of these cases, genuine atypical features and dysplastic characteristics of the glands were noted at the interface of SH and AdCC. To investigate this phenomenon further, 88 sinonasal AdCC cases were selected from the authors' files and analyzed histologically, immunohistochemically, and genetically searching for MYB/MYBL1 and NFIB gene fusions. HPV testing was also performed. Univariate statistical analysis was conducted on our cohort. Thirty-one cases (35%) showed features of atypical sinonasal glands arising in SH (ASGSH) at the SH-AdCC interface, characterized by bilayered epithelium, architectural disarray, mild nuclear polymorphism, and atypia, sometimes with colloid-like material in the lumen. The MYB immunomarker was negative in 14 ASGSHs (with a positive internal control in AdCC cells), while only two cases showed faint and moderate to weak expression of the antibody in ASGSH glands. In 12 cases, the immunostaining of ASGSH could not be properly assessed, while AdCC cells were negative. The immunostaining was not performed in five cases. Our findings suggest that a subset of sinonasal AdCC may originate in a multistep dysplastic process within SH, consistent with an SH-ASGSH-AdCC progression sequence.

Also flagged:spermatogenesismitotic divisionsaginggene expressionPlvapPdx1
Journal Article 2025-02-22 No Snippets Kawahara T, Suzuki S, Nakagawa T, Kamo Y, Kanouchi M, Fujita M, Hattori M, Suzuki A, Tanemura K, Yoshida S, Hara K.
Show Full Abstract

In male mammals, spermatogonial stem cells (SSCs) are essential for sustaining lifelong spermatogenesis within the testicular open niche, a unique environment that allows SSC migration over an extended niche area. As SSCs undergo continuous mitotic division, mutations accumulate and are transmitted to the descendant SSC clones. Therefore, SSC clonal fate behaviors, in terms of their efficiencies in completing spermatogenesis and undergoing expansion within the niche, influence sperm genomic diversity. We aimed to elucidate the effects of physiological aging on SSC clonal fate behavior within the testicular open niche. We used single-cell RNA sequencing, lineage tracing, and intravital live imaging to investigate SSC behavior in aged mouse testes, where spermatogenesis, although reduced, persists. We found that undifferentiated spermatogonia maintained gene expression heterogeneity during aging. Among these, GFRα1<sup>+</sup> cells, which exhibited state heterogeneity, showed accelerated proliferation and persistent motility, continuing to function as SSCs in older mice. In contrast, a subset of SSCs characterized by low Egr4 and Cops5 expression did not contribute to spermatid formation. These non-sperm-forming SSC clones increased in proportion among the total SSC clones and expanded spatially within the testicular open niche in old mice, a phenomenon not observed in young mice. The expansion of non-sperm-forming SSC clones in aged testes suggests that they occupy a niche space, limiting the availability of functional SSCs and potentially reducing sperm production and genetic diversity. These findings highlight age-specific clonal characteristics as hallmarks of stem cell aging within the testicular open niche and provide novel insights into the mechanisms governing reproductive aging.

PLCL1
Also flagged:Sialic acidmetabolismtumorARHGAP6ST3GAL1ADAM28
Journal Article 2025-02-22 ✓ 5 Snippets Jiang J, Chen Y, Zheng Y, Ding Y, Wang H, Zhou Q, Teng L, Zhang X.
In-Text Gene Mentions

…ST3GAL1, ADAM28, C7,PLCL1, and TTC28) was…

…ST3GAL1, ADAM28, C7,PLCL1, and TTC28) were…

…+ 0.310 *PLCL1+ 0.058 *…

…ST3GAL1, ADAM28, C7,PLCL1, and TTC28, have…

…ST3GAL1, ADAM28, C7,PLCL1, and TTC28), was…

Show Full Abstract

<h4>Background</h4>High heterogeneity in gastric cancer (GC) remains a challenge for standard treatments and prognosis prediction. Dysregulation of sialic acid metabolism (SiaM) is recognized as a key metabolic hallmark of tumor immune evasion and metastasis. Herein, we aimed to develop a SiaM-based metabolic classification in GC.<h4>Methods</h4>SiaM-related genes were obtained from the MsigDB database. Bulk and single-cell transcriptional data of 956 GC patients were acquired from the GEO, TCGA, and MEDLINE databases. Proteomic profiles of 20 GC samples were derived from our institution. The consensus clustering algorithm was applied to identify SiaM-based clusters. The SiaM-based model was established via LASSO regression and evaluated via Kaplan‒Meier curve and ROC curve analyses. In vitro and in vivo experiments were conducted to explore the function of ST3GAL1 in GC.<h4>Results</h4>Three SiaM clusters presented distinct patterns of clinicopathological features, transcriptomic alterations, and tumor immune microenvironment landscapes in GC. Compared with clusters A and B, cluster C presented elevated SiaM activity, higher metastatic potential, more abundant immunosuppressive features, and a worse prognosis. Based on the differentially expressed genes between these clusters, a risk model for six genes (ARHGAP6, ST3GAL1, ADAM28, C7, PLCL1, and TTC28) was then constructed. The model exhibited robust performance in predicting peritoneal metastasis and prognosis in four independent cohorts. As a hub gene in the model, ST3GAL1 promoted GC cell migration and invasion in vitro and in vivo.<h4>Conclusions</h4>Our study proposed a novel SiaM-based classification that identified three metabolic subtypes with distinct characteristics of tumor microenvironment and clinical outcomes in GC.

POU3F2
Also flagged:YY1Gabriele-de Vries syndromeGADEVSneurodevelopmental disorderintellectual disabilityNEUROG2
Journal Article 2025-02-22 ✓ 1 Snippet Pereira MF, Finazzi V, Rizzuti L, Aprile D, Aiello V, Mollica L, Riva M, Soriani C, Dossena F, Shyti R, Castaldi D, Tenderini E, Carminho-Rodrigues MT, Bally JF, de Vries BBA, Gabriele M, Vitriolo A, Testa G.
In-Text Gene Mentions

…as NFIB andPOU3F2, and RORB…

Show Full Abstract

Germline mutations of YY1 cause Gabriele-de Vries syndrome (GADEVS), a neurodevelopmental disorder featuring intellectual disability and a wide range of systemic manifestations. To dissect the cellular and molecular mechanisms underlying GADEVS, we combined large-scale imaging, single-cell multiomics and gene regulatory network reconstruction in 2D and 3D patient-derived physiopathologically relevant cell lineages. YY1 haploinsufficiency causes a pervasive alteration of cell type specific transcriptional networks, disrupting corticogenesis at the level of neural progenitors and terminally differentiated neurons, including cytoarchitectural defects reminiscent of GADEVS clinical features. Transcriptional alterations in neurons propagated to neighboring astrocytes through a major non-cell autonomous pro-inflammatory effect that grounds the rationale for modulatory interventions. Together, neurodevelopmental trajectories, synaptic formation and neuronal-astrocyte cross talk emerged as salient domains of YY1 dosage-dependent vulnerability. Mechanistically, cell type resolved reconstruction of gene regulatory networks uncovered the regulatory interplay between YY1, NEUROG2 and ETV5 and its aberrant rewiring in GADEVS. Our findings underscore the reach of advanced in vitro models in capturing developmental antecedents of clinical features and exposing their underlying mechanisms to guide the search for targeted interventions.

HFE
Also flagged:type 2 diabetesABCC8bindingPax4NF-kBtranscription factors
Journal Article 2025-02-22 ✓ 1 Snippet Rout M, Ramu D, Mariana M, Koshy T, Venkatesan V, Lopez-Alvarenga JC, Arya R, Ravichandran U, Sharma SK, Lodha S, Ponnala AR, Sharma KK, Shaik MV, Resendez RG, Venugopal P, R P, S N, Ezeilo JA, Almeida M, Paralta J, Mummidi S, Natesan C, Mehra NK, Singh JR, Wander GS, Ralhan S, Blackett PR, Blangero J, Medicherla KM, Thanikachalam S, Panchatcharam TS, K DK, Gupta R, Paul SFD, Ghosh AK, Aston CE, Duggirala R, Sanghera DK.
In-Text Gene Mentions

…secondary diabetes (e.g.,hemochromatosisor pancreatitis) were…

Show Full Abstract

<h4>Background</h4>Type 2 diabetes (T2D) etiology is highly complex due to its multiple roots of origin. Polygenic risk scores (PRS) based on genome-wide association studies (GWAS) can partially explain T2D risk. Asian Indian people have up to six times higher risk of developing T2D than European people, and underlying causes of this disparity are unknown.<h4>Methods</h4>We have performed targeted sequencing of ten T2D GWAS/candidate regions using endogamous Punjabi Sikh families and replication studies using unrelated Sikh people and families from three other Indian endogamous ethnic groups (EEGs).<h4>Results</h4>We detect rare and ultra-rare variants (RVs) in KCNJ11-ABCC8 and HNF4A (MODY genes) cosegregated with late-onset T2D. We also identify RV enrichment in two new genes, SLC38A11 and ANPEP, associated with T2D. Gene-burden analysis reveals the highest RV burden contributed by HNF4A (p = 0.0003), followed by KCNJ11/ABCC8 (p = 0.0061) and SLC38A11 (p = 0.03). Some RVs detected in Sikh people are also found in Agarwals from Jaipur, both from Northern India, but were monomorphic in other two EEGs from South Indian people. Despite carrying a high burden of T2D and RVs, most families have a significantly lower burden of PRS. Functional studies show that an intronic regulatory variant (RV) in ABCC8 affects the binding of Pax4 and NF-kB transcription factors, influencing downstream gene regulation.<h4>Conclusions</h4>The high burden of T2D in these families may stem from the enrichment of noncoding RVs in a small number of major known genes (including MODY genes) with oligogenic inheritance alongside RVs from genes associated with polygenic susceptibility. These findings highlight the need to conduct deeper evaluations of families from non-European ancestries to identify potential novel therapeutics and implement preventative strategies.

STAU1
Also flagged:PLAGL2NCOA4gastric cancerferroptosiscancerdeath
Journal Article 2025-02-22 ✓ 5 Snippets Huang S, Ji P, Xu P, Liu K, Ge H, Yan Z, Cheng Q, Lv J, Zhang D.
In-Text Gene Mentions

…PLAGL2-STAU1-NCOA4 axis enhances gastric…

…Binding Protein 1 (STAU1) to ferroptosis in…

…the RNA-binding proteinSTAU1is crucial for…

…Elevated levels ofSTAU1are linked to…

STAU1was up-regulated by…

Show Full Abstract

Peritoneal metastasis (PM) is the primary site of distant metastasis in gastric cancer (GC) and is associated with an advanced disease stage and poor prognosis. Due to its high resistance to chemotherapy, disseminated peritoneal lesions are often untreatable. A primary reason for therapy resistance in cancer cells is often their defective cell death execution mechanisms. Ferroptosis, a newly identified type of regulated cell death, is strongly linked to the emergence and formation of tumors. Earlier studies have demonstrated the significant role of RNA-binding proteins in ferroptosis. Nevertheless, the fundamental process linking Staufen Double-Stranded RNA Binding Protein 1 (STAU1) to ferroptosis in the peritoneal metastasis of gastric cancer is yet to be clarified. This study shows that the RNA-binding protein STAU1 is crucial for regulating ferroptosis in gastric cancer cells. Elevated levels of STAU1 are linked to unfavorable outcomes in individuals diagnosed with gastric cancer. STAU1 was up-regulated by PLAGL2 and decreased the stability of NCOA4 mRNA by binding to the 3'-untranslated region. Decreased NCOA4 expression inhibits the accumulation of reactive iron, the occurrence of the Fenton reaction, and cellular ROS generation in the GC cells. Additionally, we showed that NCOA4 is crucial in the process of ferritinophagy triggered by the reduction of STAU1 in gastric cancer cells. Ultimately, the process safeguards GC cells from ferroptosis. These findings elucidate the function of PLAGL2/STAU1/NCOA4 in the ferroptosis of gastric cancer cells and provide theoretical backing for possible diagnostic markers and treatment targets for peritoneal metastasis in gastric cancer.

DCC
Also flagged:netrin-1-stroke depressionloganinβ-asaronedendritic spinessynaptic vesicles
Journal Article 2025-02-22 ✓ 4 Snippets Zhao Y, Song A, Liu G, Chen Q, Wu Q, Gao Z, Li Z, Yu H, Wu Z.
In-Text Gene Mentions

…Modulation of netrin-1/DCCsignaling pathway by…

…and activity of Netrin-1/DCCsignaling pathway-related prot…

…in colorectal cancer (DCC), and focal adhesion…

…related to the netrin-1/DCCsignaling pathway.…

Show Full Abstract

Jiawei Kongsheng Zhenzhong Pill(JKZP) is based on Kongsheng Zhenzhong Pill contained in the Tang Dynasty's "Thousand Golden Prescriptions," which exhibited good anti-ischemic and antidepressant effects in the previous study. However, its specific effects on post-stroke depression (PSD) and the mechanism are not clear. This study aimed to investigate the effects of JKZP in the treatment of PSD and related mechanisms. The decoction of JKZP was first analyzed for its medicinal chemical composition and screened for representative components of JKZP. The Middle cerebral artery occlusion (MCAO) method combined with solitary rearing and chronic unpredictable mild stress (CUMS) was used to establish a rat model of PSD, and to observe the effects of JKZP on the behavior and synaptic plasticity of PSD rats, and to investigate the mechanism of JKZP in the treatment of PSD by detecting the mRNA level, protein expression and activity of Netrin-1/DCC signaling pathway-related proteins. The results showed that the JKZP decoction contained loganin, β-asarone and other pharmaceutical ingredients, which have been reported to protect against cerebral ischemic injury and antidepressant effects. JKZP significantly improved the depression-like behavior of PSD rats and improved the damage to pyramidal neurons in the medial prefrontal cortex (mPFC) of PSD rats. Moreover, JKZP increased the density of dendritic spines in the mPFC of PSD rats, improved synaptic gap width and thickness of the post-synaptic density, and increased the number of synaptic vesicles. The results of Real-Time quantitative reverse transcription PCR (qRT-PCR), Western blotting, and pull-down assays revealed that JKZP increased netrin-1, deleted in colorectal cancer (DCC), and focal adhesion kinase (FAK) mRNA and protein expression, elevated the p-FAK/FAK ratio, and decreased myosin II protein expression and Ras homolog gene family member A (RhoA-GTP) activity in the mPFC of PSD rats. Taken together, JKZP can affect synaptic structural remodeling and improve depressive manifestations and neuronal damage in PSD rats by regulating the expression and activity of signaling molecules related to the netrin-1/DCC signaling pathway.

Also flagged:OxygenColorectal Cancertumorcancerdeathimmune responses
Journal Article 2025-02-22 No Snippets Catalano T, Selvaggi F, Cotellese R, Aceto GM.
Show Full Abstract

Altered levels of reactive oxygen species (ROS) are recognized as one of the key factors in mediating tumor cell survival in the tissue microenvironment, where they play a role in the initiation, progression and recurrence/relapse of colorectal cancer (CRC). Tumor cells can adapt to oxidative stress (OS) using genetic or metabolic reprogramming in the long or short term. In addition, tumor cells defend themselves through positive regulation of antioxidant molecules, enhancing ROS-driven proliferation. Balanced oxidative eustress levels can influence chemotherapy resistance, allowing tumor cells to survive treatment. Secondary effects of chemotherapy include increased ROS production and redox stress, which can kill cancer cells and eliminate drug resistance. Anticancer treatments based on manipulating ROS levels could represent the gold standard in CRC therapy. Therefore, exploring the modulation of the response to OS in deregulated signaling pathways may lead to the development of new personalized CRC treatments to overcome therapy resistance. In this review, we explore the role of ROS in the initiation and progression of CRC and their diagnostic implications as biomarkers of disease. Furthermore, we focused on the involvement of ROS in different CRC therapeutic options, such as surgery, radiotherapy, theranostic imaging, chemotherapy and immunotherapy and other precision medicine approaches.

Also flagged:TumourOvarian CancerOCmalignant tumourtotumours
Journal Article 2025-02-22 No Snippets Asante DB, Tierno D, Grassi G, Scaggiante B.
Show Full Abstract

Globally, ovarian cancer (OC) is the eighth most common malignant tumour in women. Unfortunately, its symptoms-especially at the early stages-are vague and non-specific, and, thus, most patients are diagnosed at the advanced stages of the disease (stage III and IV) when treatment is not curative. The currently available approved biomarkers are not sufficient for effective screening, prognosis, or monitoring of OC. Liquid biopsy tests such as circulating tumour DNA (ctDNA) analysis has the advantage of monitoring response to treatment in real time and providing a comprehensive genotypic profile of primary, metastatic, and recurrent tumours. Thus, ctDNA analysis can be used as a complementary test for effective diagnosis and monitoring of OC. We comprehensively review current studies (2019-2024) on OC, critically highlighting recent developments and applications of ctDNA for the diagnosis and management of the disease.

HFE
Also flagged:Vitamin D Metabolismmineral bone diseasehypocalcemiahyperphosphatemiaparathyroid hormonePTH
Journal Article 2025-02-22 ✓ 1 Snippet Hryciuk M, Heleniak Z, Małgorzewicz S, Kowalski K, Antosiewicz J, Koelmer A, Żmijewski M, Dębska-Ślizień A.
In-Text Gene Mentions

…insufficiency, liver disease (hemochromatosis, Wilson’s disease), autoimmun…

Show Full Abstract

<h4>Background</h4>Patients with end-stage chronic diseases, especially those undergoing hemodialysis (HD), often experience mineral bone disease (MBD), leading to hypocalcemia, hyperphosphatemia, and elevated parathyroid hormone (PTH). Vitamin D deficiency and metabolism disorders are also common, resulting from impaired conversion of 25(OH)D3 to its active form, 1,25(OH)2D3, and reduced inactivation to 24,25(OH)2D3. This study aimed to assess the levels of 25(OH)D2, 25(OH)D3, 24,25(OH)2D3, 3-epi-25(OH)D3, and the vitamin D metabolism ratio (VMR) in patients with maintenance HD.<h4>Methods</h4>A cross-sectional study was conducted on 66 HD patients (22-90 years, average 61.3 ± 16.4), with a control group of 206 adults without chronic kidney disease (CKD), both without cholecalciferol supplementation.<h4>Results</h4>the HD patients had significantly lower 25(OH)D3 levels (15 ng/mL vs. 22 ng/mL) and higher deficiency rates (69% vs. 39%) compared to the controls. However, both groups showed similarly low levels of optimal vitamin D3. The HD patients had lower 24,25(OH)D3 levels (0.1 vs. 2.1 ng/mL) and a lower VMR (0.9% vs. 9%). 3-epi-25(OH)D3 levels and its ratio to 25(OH)D3 were significantly lower in the HD group. Alphacalcidol supplementation raised 1,25(OH)2D3 levels (30.4 vs. 16.2 pg/mL) without affecting other vitamin D metabolites. The HD patients had higher levels of 25(OH)D2 compared to the controls (0.61 vs. 0.31 ng/mL).<h4>Conclusions</h4>Vitamin D3 reserves are lower, and both functional deficiency and impaired catabolism of vitamin D3 are present in HD patients compared to the general population. The VMR index is the most sensitive parameter for vitamin D3 deficiency assessment, highlighting the importance of measuring 24,25(OH)D3. Alphacalcidol supplementation increases 1,25(OH)2D3 levels without affecting other vitamin D metabolites. 25(OH)D2 is the only metabolite that was higher in HD patients than the controls.

Also flagged:oligomenorrheagonadotropinsprimary amenorrheaamenorrheanucleotidePremature Ovarian Insufficiency
Journal Article 2025-02-22 No Snippets Cozette C, Pujalte M, Celton N, Bosquet D, Copin H, Cabry R, Garçon L, Benkhalifa M, Scheffler F, Jedraszak G.
Show Full Abstract

<b>Objective(s):</b> Premature ovarian insufficiency (POI), affecting 1% of women, is characterized by the loss of ovarian activity with amenorrhea or oligomenorrhea and increased gonadotropins occurring before the age of 40 years. Iatrogenic, autoimmune, and genetic causes are known to be involved in POI, but nearly 70% of all forms remain unexplained. Recent and new genetic analyses promote the identification of new candidate genes. The aim of this study was to evaluate the contribution of array-CGH and next-generation sequencing (NGS) in the diagnosis of POI. <b>Study design:</b> Twenty-eight idiopathic POI patients with primary or secondary amenorrhea underwent genetic screening by array-CGH and NGS using a custom capture design of 163 genes known or suspected to be involved in ovarian function. The clinical, biological, and ultrasound characteristics of the patients were also recorded. <b>Results:</b> Four of the twenty-eight patients had primary amenorrhea (14.3%), and twenty-four (85.7%) had secondary amenorrhea, with an average age at diagnosis of 27.7. Eleven patients (39.3%) had a family history of POI. Our study identified a genetic anomaly in 16 of 28 patients (57.1%): one patient carried a causal copy number variation (CNV), eight patients carried a causal single nucleotide variation (SNV)/indel variation (28.6%), and seven other patients carried variants of uncertain significance. <b>Conclusions:</b> Our study was the first to combine genetic analyses by using both array-CGH and NGS in the same patients. It confirmed the usefulness of both analyses in the identification of pathogenic variations responsible for idiopathic POI. Early genetic diagnosis plays a major role in the management of complications and the screening of relatives.

HTT
Also flagged:polyglutamine (polyQ) diseasesHuntington diseaseHDspinocerebellar ataxia type 3SCA3transduction
Journal Article 2025-02-22 ✓ 5 Snippets Surdyka M, Kalinowska-Pośka Ż, Niewiadomska-Cimicka A, Jesion E, Fiszer A, Singer-Mikosch E, Fievet L, Przybyl L, Caron NS, Hayden MR, Nguyen HP, Trottier Y, Figiel M.
In-Text Gene Mentions

…1 of theHTTgene and exon…

…mutant huntingtin protein (HTT) and similarly for…

…created by crossingHtt−/− Bac 21Q…

…21Q mice andHtt−/− Yac 128Q…

…mice on theHtt−/− background.…

Show Full Abstract

In polyglutamine (polyQ) diseases, including Huntington disease (HD) and spinocerebellar ataxia type 3 (SCA3), targeting the mutant CAG tract in mRNA could be a therapeutic strategy for lowering pathogenic protein. We explored the viability of this therapeutic strategy <i>in vivo</i> at the level of the reagent design, toxicity, systemic delivery, brain regions transduction, silencing efficiency, and allele preference. We designed a series of CAG-directed short hairpin RNAs (shRNAs) based on a previous A2 reagent, allele selective <i>in vitro</i>. Humanized HD (Hu<sup>128Q/21Q</sup>) and SCA3 (Ki<sup>150Q/21Q</sup>) mice with mutant ∼100 CAGs and normal 21 CAGs alleles were used to simulate biallelic conditions occurring in patients. We administered AAV-PHP.eB shRNAs-encoding vectors into the blood as an equivalent of non-invasive CAG-directed brain-targeted therapy crossing the blood-brain barrier. We demonstrate that optimized CAG-targeted A4(P10) and A4(P10,11) shReagents can lower mutant huntingtin and ataxin-3 protein and its aggregates by targeting brain regions selectively and with diminished toxicity compared to other tested shRNAs. The important considerations of the approach are the silencing efficiency depending on the transduction region and careful dose adjustment. Moreover, the CAG approach could be suitable to target somatic expansion. Our work paves the way toward developing the therapy for polyQ diseases, potentially shortening drug development.

HTT
Also flagged:neurological disordersglutamine(polyQ) disordersOseltamivirHDSpinocerebellar Ataxia
Journal Article 2025-02-22 ✓ 1 Snippet Singh K, Gupta K, Shukla S, Kumari AP, Kumar A.
In-Text Gene Mentions

…the specific genes (HTTand ATXN, respectively).…

Show Full Abstract

Huntington's disease (HD) and Spinocerebellar Ataxia (SCA) are debilitating neurological disorders triggered by the expansion of C<b>A</b>G sequences within the specific genes (HTT and ATXN, respectively). These are characterized as poly glutamine (polyQ) disorders, which are marked by widespread neurodegeneration and metabolic irregularities across systemic, cellular, and intracellular levels. This study aimed to identify small molecules that specifically interact with and target the toxic C<b>A</b>G repeat RNA. Here, we investigated the neuroprotective effects of Oseltamivir, an antiviral drug, against the HD and SCA-causing C<b>A</b>G repeats, through biophysical, cellular, and <i>Drosophila</i> model-based studies. Using a multidimensional approach encompassing biophysical techniques, cellular assays, and a <i>Drosophila</i> model, we explored Oseltamivir's interaction with toxic C<b>A</b>G repeat RNA. Our comprehensive analyses, including circular dichroism (CD), isothermal titration calorimetry (ITC), electrophoretic mobility shift assay (EMSA), and nuclear magnetic resonance (NMR) spectroscopy, demonstrated Oseltamivir's specific binding affinity for AA mismatches and its potential to mitigate the toxicity associated with polyQ aggregation. Moreover, the identified U.S. FDA-approved drug effectively mitigated polyQ-induced toxicity in both HD cells and the <i>Drosophila</i> model of the disease. The results obtained from this drug repurposing approach are indicative of the neuro-shielding role of Oseltamivir in HD and several SCAs, paving the way for its translation into clinical practice to benefit patients afflicted with these devastating diseases.

bioRxiv 2025-02-22 Preprint (No Snippets API) Zeisner TU, Auchynnikava T, Nurse P.
Show Full Abstract

Cell cycle events are ordered by cyclin-dependent kinases (CDKs), which phosphorylate hundreds of substrates. Multiple phosphatases oppose CDK substrate phosphorylation, yet a systematic understanding of how these phosphatases collectively influence phosphorylation timing is lacking. Here, we show that phosphatases influence the timing of CDK substrate phosphorylation during G2 and mitosis in fission yeast. We identify substrates of four phosphatases (PP2A-B55, PP2A-B56, CDC14, and PP1), showing that each phosphatase targets a distinct subset of CDK substrate sites. On average, sites dephosphorylated by CDC14 and PP2A-B56 are phosphorylated earlier during G2, followed by sites dephosphorylated by PP1 and then PP2A-B55. This suggests that the identity of the phosphatase impacts the timing of CDK substrate phosphorylation, establishing different phosphorylation thresholds at the G2/M transition. Consistent with this, depletion of PP2A-B55 and CDC14 advances mitotic onset independently of CDK activity regulation, likely due to the earlier phosphorylation of their respective CDK substrates.

bioRxiv 2025-02-22 Preprint (No Snippets API) Williams JPC, Auchynnikava T, McCarthy A, Bertran MT, Ojarikre OA, Weston AE, Leonce D, Olsen J, Niakan KK, Skehel M, Turner JMA, Walport LJ.
Show Full Abstract

<h4>Summary</h4> Oocyte cytoplasmic lattices are critical for early embryo development but their composition and function are not fully understood. Mutations in PADI6 , an essential component of cytoplasmic lattices, lead to early embryonic developmental arrest and female infertility. To investigate PADI6 function in mRNA storage, global protein levels, and lattice composition during early mammalian development we used single cell transcriptomics and proteomics methods to study two mouse models. Padi6 null mutation resulted in inhibition of embryonic genome activation, defective maternal mRNA degradation, and disruption to protein storage on the cytoplasmic lattices. Distinct developmental phenotypes were observed with a hypomorphic Padi6 mutation. By developing a powerful single cell proteomic fractionation method, we define the cytoplasmic lattice enriched proteome in which we find essential components of another major oocyte-specific compartment, the endolysosomal vesicular assembly (ELVA), suggesting previously unknown interconnections between them. Our findings highlight a critical scaffolding function of PADI6 and implicate cytoplasmic lattices as regulatory hubs for key processes in the oocyte and early embryo, including translation, respiration and protein degradation.

PRDX6
Also flagged:neurofilament light chainglial fibrillary acidic proteinWNV infectionencephalitismeningoencephalitisME
Journal Article 2025-02-21 ✓ 2 Snippets Dinoto A, Pacenti M, Mariotto S, Abate D, Lisi V, Satto S, Vogiatzis S, Chiodega V, Carta S, Ferrari S, Barzon L.
In-Text Gene Mentions

…(HMGB1) and peroxiredoxin-6 (PRDX6) in WNV-infected patients…

…while, unexpectedly, serumPRDX6concentrations were lower…

Show Full Abstract

West Nile virus (WNV) is a neurotropic mosquito-borne orthoflavivirus, representing a relevant public health threat. Identification of biomarkers that would predict the course of WNV infection is of interest for the early identification of patients at risk and for supporting decisions on therapeutic interventions. In this study, serum levels of glial fibrillary acidic protein (sGFAP) and neurofilament light chain (sNfL), which are markers of brain tissue damage and inflammation, were analysed in 103 subjects with laboratory-confirmed WNV infection, comprising 13 asymptomatic blood donors, 23 with WN fever (WNF), 50 with encephalitis/meningoencephalitis (E/ME) and 17 with acute flaccid paralysis (AFP). In addition, 55 WNV-negative subjects with fever, encephalitis or healthy asymptomatic were included as controls. Age-adjusted levels of both sNfL and sGFAP were significantly higher in patients with neuroinvasive disease than in those with fever or asymptomatic (both WNV-positive and WNV-negative), suggesting a broad association of these biomarkers with systemic inflammation and brain injury resulting from infection. In WNV patients, the combined analysis of sNfL and sGFAP early after symptom onset allowed discrimination between neuroinvasive disease and fever with 67.2% sensitivity and 91.3% specificity, but not between E/ME and AFP. Furthermore, high levels of sNfL and sGFAP were significantly associated with prolonged hospital stay, intensive care unit admission and the occurrence of death or severe sequelae. Detection of WNV RNA in CSF was associated with increased sGFAP. In conclusion, our study indicates the potential utility of sNfL and sGFAP as biomarkers of WNV disease severity and adverse outcome.

SOX6
Also flagged:degradationkidney diseaseskidney cancerdiabetic nephropathygene expressionwater
Journal Article 2025-02-21 ✓ 1 Snippet Liu Y, Shi S, Cheng T, Wang H, Wang H, Hu Y.
In-Text Gene Mentions

…of matrix metalloproteinase-3,SOX6, JAK/STAT and PTEN/AKT…

Show Full Abstract

MicroRNAs (miRNAs/miRs) are endogenous, small non‑coding RNAs conserved across species that post‑transcriptionally regulate gene expression by both suppressing translation and inducing mRNA degradation. miRNAs are found in various tissues, exhibit variable expression and their dysregulation is implicated in numerous disease processes. Furthermore, miRNA expression levels have a key role in the normal development of kidney tissue and are key regulators of kidney function, modulating diverse biological processes across renal cell lineages. miR‑378 participates in pathological processes associated with kidney diseases, including kidney cancer, kidney transplantation and diabetic nephropathy. Despite its considerable effects on these conditions, a comprehensive summary of the roles of miR‑378 is unavailable. In the present review, the existing literature on miR‑378 in kidney diseases is consolidated, and its validated gene targets and biological effects in both malignant and non‑malignant conditions are highlighted, thereby providing a foundation for future research.

SERPINC1
Also flagged:SynthesisOligosaccharidecarrageenanpolysaccharidesferritesugar
Journal Article 2025-02-21 ✓ 3 Snippets Porta-Zapata M, Carregal-Romero S, Saliba J, Urkola-Arsuaga A, Miranda Perez de Alejo CB, Orue I, Martínez-Parra L, Di Silvio D, Descamps-Mandine A, Daviaud C, Menard M, Hamami A, Musnier B, Cherfan J, Codault A, Manseur C, Jeannin M, Castejón D, Fruitier-Arnaudin I, Ruiz-Cabello J, Groult H.
In-Text Gene Mentions

…assay using antithrombin (ATIII), Thrombin (IIa), Factor…

…25 μL ofATIII(0.625 μg·μL –1…

…and form betweenATIII, IIa and OS.…

Show Full Abstract

λ-type carrageenan (λ-CAR) polysaccharides remain overlooked in the preparation of medical nanoparticles (NP) due to their unsuitable rheological properties and undesired biological effects, although they can also offer advantageous properties. To overcome these obstacles, oligosaccharide derivatives (λ-COS) have been successfully applied to the synthesis of stable NP incorporating both, ferrite cores and divalent manganese (Mn<sup>2+</sup>) releasable ions. The acute pro-inflammatory behavior and anticoagulant activity of native λ-CAR were significantly reduced in the case of λ-COS and λ-COS NP, rendering possible their use for medical applications. In vivo MRI studies in mice showed that the λ-COS NP framework is promising for two applications. The first is partial Mn<sup>2+</sup> release into the plasma to achieve intracellular Mn<sup>2+</sup>-based contrast of the myocardium and imaging of the hepatobiliary system. Second, it serves as a novel sugar-based coating that confers suitable pharmacokinetic properties to NP, making it promising for further targeted therapy applications.

SOX6
Also flagged:chronic kidney diseaseMethylationhypertensionnephron deficiencycytosinesDEPTOR
Journal Article 2025-02-21 ✓ 1 Snippet Milner AR, Johnson AC, Attipoe EM, Wu W, Challagundla L, Garrett MR.
In-Text Gene Mentions

Sox6

Show Full Abstract

Low nephron numbers are associated with an increased risk of developing chronic kidney disease (CKD) and hypertension, which are significant global health problems. To investigate the impact of nephron deficiency, our laboratory developed a novel inbred rat model (HSRA rat). In this model, ∼75% of offspring are born with a single kidney (HSRA-S), compared with two-kidney littermates (HSRA-C). HSRA-S rats show impaired kidney development, resulting in ∼20% fewer nephrons. Our previous data and current findings demonstrate that nephron deficit (failure of one kidney to form and altered development in the remaining kidney) predisposes HSRA-S to CKD late in life (with increased proteinuria by 18 mo of age in HSRA-S = 51 ± 3.4 vs. HSRA-C = 8 ± 1.5 mg/24 h). To understand early molecular mechanisms contributing to the increased predisposition to CKD, Methylseq using reduced representation bisulfite sequencing, single-nuclei (sn)RNAseq, and discovery proteomics were performed in kidneys of 4-wk-old HSRA rats. Methylation analysis revealed a small number of differences, including five differentially methylated cytosines and six differentially methylated regions between groups. The snRNAseq analysis identified differentially expressed genes in most kidney cell types, with several hundred genes dysregulated depending on the analysis method (Seurat vs. DESeq2). Notably, many genes are involved in kidney development. Discovery proteomic analysis identified 366 differentially expressed proteins. A key finding was dysregulation of <i>Deptor</i>/DEPTOR and <i>Amdhd2</i>/AMDHD2 across omics layers, suggesting a potential role in compensatory mechanisms or the genetic basis of altered kidney development. Further understanding of these mechanisms may guide interventions to preserve nephron health and slow kidney disease progression.<b>NEW & NOTEWORTHY</b> The HSRA rat is a novel model of nephron deficiency and provides a unique opportunity to study the association between nephron number and chronic kidney disease (CKD). Previous work characterized the impact of age, hypertension, and diabetes on the development of CKD in HSRA animals. This study examined early changes in epigenetics, cell-type specific transcriptome, and proteomic changes in the kidney that likely predispose the model to CKD with age.

SERPINC1
Also flagged:Deep vein thrombosisDVTalbuminALBsodiuminflammatory response
Journal Article 2025-02-21 ✓ 1 Snippet Yang S, Zhang E, Li Z, Long Y, Li Y, Zhang J, Wang F, Liu L, Wang T, Guo J, Hou Z.
In-Text Gene Mentions

…(APTT), antithrombin III (ATIII), fibrinogen (FIB), Internati…

Show Full Abstract

<h4>Background</h4>Deep Vein Thrombosis (DVT) represents a significant complication following orthopedic injuries, particularly patellar fractures. Despite the prevalence, comprehensive studies assessing the incidence rates and identifying specific risk factors in patellar fracture patients are limited.<h4>Methods</h4>This retrospective analysis reviewed electronic medical records from 3311 patients treated for patellar fractures at two tertiary hospitals between November 2013 and January 2023. The study focused on patient demographics, fracture characteristics, comorbidities, and laboratory parameters to evaluate the incidence and predictors of DVT. DVT prophylaxis measures and diagnostic criteria, including Doppler Ultrasound Scans, were rigorously applied.<h4>Results</h4>In patients with patellar fractures, the DVT incidence was 30.8%, with 1,790 clots identified in 1,021 diagnosed individuals, predominantly on the injured side (96.7%), and a minor portion on the uninjured side (3.2%). Key risk factors included older age (P<0.001, OR = 1.038), the presence of open injuries (P = 0.002, OR = 1.521), multiple injuries (P<0.001, OR = 3.623), and prolonged time from injury to surgical treatment (P<0.001, OR = 1.097). Conversely, higher levels of albumin (ALB) (P = 0.029, OR = 0.983) and sodium (Na) (P = 0.028, OR = 0.971) were identified as protective factors against DVT. Besides, ROC curve analysis revealed that the age of 52 years and a duration of 4 days from injury to surgery serve as predictive cut-off values for assessing the risk of DVT.<h4>Conclusion</h4>Our study investigates the incidence of thrombosis in patellar fracture patients and identifies key risk factors for DVT, including age, open and multiple injuries, and the time from injury to surgery. Additionally, we highlight sodium and albumin levels as protective factors. By establishing threshold values for age and surgical delay, our findings improve DVT risk assessment, facilitating earlier and more targeted interventions.

HFE
Also flagged:beta-thalassemiafibroblast growth factor 23FGF-23ironFGF23phosphorus
Journal Article 2025-02-21 ✓ 1 Snippet Jafri L, Jameel Farooqui A, Moiz B, Sheikh A, Majid H, Nadeem S, Quddus R, Khan S, Khan QU, Habib Khan A.
In-Text Gene Mentions

…imbalances, bone hypoxia,hemochromatosis, and chelation therapy…

Show Full Abstract

<h4>Introduction</h4>Children with beta-thalassemia major (β-TM) commonly experience metabolic bone diseases. Understanding fibroblast growth factor 23 (FGF-23) levels in these children can shed light on phosphate dysregulation. This study aimed to assess changes in phosphate homeostasis and associated factors, including FGF-23 and explore relationships between iron overload, FGF23 levels, and phosphorus regulation for clinical management of phosphate disorders, in children with β-TM.<h4>Methods</h4>143 β-TM patients (57.3% male, median age 12 years) were recruited from Fatimid Foundation Karachi, a blood transfusion facility from January to October 2022. Clinical and biochemical evaluations were conducted at Aga Khan University Hospital, including serum ferritin, calcium (Ca), phosphate (P), vitamin D levels, and FGF-23. Descriptive and inferential statistics including multivariable analysis were applied.<h4>Results</h4>This study enrolled 143 patients, with 57.3% males. The median age was 12 years, with 53% underweight. Blood transfusion rates varied, with 66.4% receiving 2/month. Bone/joint pain was reported by 76.2%, with 60.8% requiring analgesics. Median serum ferritin was 2768.3 ng/mL. Hypophosphatemia and hyperphosphatemia were observed in 5.6% and 3.5% of participants, respectively. Vitamin D deficiency/insufficiency affected 92.3%. Plasma c-FGF23 was elevated in 60.8%, while i-FGF23 was high in 14%. A low TMP-GFR (glomerular filtration rate) was associated with high c-FGF23 and low i-FGF23. Multivariable regression revealed c-FGF23, TMP:GFR, Corrected Ca, iPTH, and an interaction term between corrected Ca and iPTH as predictors of serum P variability (~75%).<h4>Conclusion</h4>The study identified contributors to the variations observed in serum P levels in individuals with β-TM and recommends multidisciplinary care and prospective future studies to form targeted interventions for this population.

DCCCSE1LSTAU1
Also flagged:GPX1behavioralgene expressionneurodegenerative diseasesAgingpeptide
Journal Article 2025-02-21 ✓ 5 Snippets Zhang Z, Zhu Y, Zhang J, He W, Han C.
In-Text Gene Mentions
⭐ same-sentence co-mention

…1 includes RANGAP1,CSE1L, and STAU1; Community…

⭐ same-sentence co-mention

…RANGAP1, CSE1L, andSTAU1; Community 2 includes…

…MAP2K2, RAF1, andDCC; Community 3 includes…

…genes such asCSE1Lwith intelligence were…

…Furthermore,CSE1Lis associated with…

Show Full Abstract

While genome-wide association studies (GWAS) have identified genetic variants associated with intelligence, their biological mechanisms remain largely unexplored. This study aimed to bridge this gap by integrating intelligence GWAS data with human brain proteomics and transcriptomics. We conducted proteome-wide (PWAS) and transcriptome-wide (TWAS) association studies, along with enrichment and protein-protein interaction (PPI) network analyses. PWAS identified 44 genes in the human brain proteome that influence intelligence through protein abundance regulation (FDR P <  0.05). Causal analysis revealed 36 genes, including GPX1, involved in the cis-regulation of protein abundance (P <  0.05). In independent PWAS analyses, 17 genes were validated, and 10 showed a positive correlation with intelligence (P <  0.05). TWAS revealed significant SNP-based heritability for mRNA in 28 proteins, and cis-regulation of mRNA levels for 20 genes was nominally associated with intelligence (FDR P <  0.05). This study identifies key genes that bridge genetic variants and protein-level mechanisms of intelligence, providing novel insights into its biological pathways and potential therapeutic targets.

HTT
Also flagged:CopperHuntingtinHuntington's diseaseHDneurodegenerative diseasepolyglutamine
Journal Article 2025-02-21 ✓ 5 Snippets Neupane D, Santos-Fernandez M, Fernandez-Lima F, Meier KK.
In-Text Gene Mentions

…of huntingtin protein (htt) that has a…

…of wild-type (WT)htt(fewer than 36Qs)…

…metals with WThttand the impact…

…an <i>in vitro</i>httmodel (N171-17Q).…

…of Cu(II) tohttinduces time- and…

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disease characterized by the expression of huntingtin protein (htt) that has a polyglutamine (CAG; polyQ) repeat domain consisting of 36 or more glutamines (mhtt). Historically, mhtt is more broadly associated with HD severity, as are elevated metal levels observed in HD patients. The depletion of wild-type (WT) htt (fewer than 36Qs) is also recognized as a contributing factor to HD progression; however, many questions remain about the interactions of biorelevant metals with WT htt and the impact of the interactions on protein aggregation. In the present work, we utilize a combination of biochemical assays and spectroscopic techniques to provide insights into the interaction of copper with an <i>in vitro</i> htt model (N171-17Q). Herein, we use sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and dynamic light scattering to show that the addition of equimolar or higher concentrations of Cu(II) to htt induces time- and temperature-dependent protein oligomerization/aggregation. Additionally, chelation assays, trapped ion mobility spectrometry, and mass spectrometry confirm the (i) rapid reduction of Cu(II) in the presence of N171-17Q htt, (ii) direct binding of multiple copper ions per protein, and (iii) complex Cu:htt speciation profile with a preference for three distinct Cu:htt states. These findings contribute to our molecular level understanding of copper's role in the depletion and oligomerization/aggregation of WT htt while underscoring the physiological significance of our work, its potential relevance to metal binding in mhtt, and its significance for identifying new avenues for biomarker exploration and therapeutic design strategies.

NEGR1DCC
Also flagged:schizophreniamental diseasescoronary artery diseasetype 2 diabetesstrokeosteoarthritis
Journal Article 2025-02-21 ✓ 5 Snippets Deng MG, Wang K, Liu F, Zhou X, Nie JQ, Zhao ZH, Liu J.
In-Text Gene Mentions
⭐ same-sentence co-mention

…2 risk genes,DCCand NEGR1 ,…

⭐ same-sentence co-mention

…genes, DCC andNEGR1, were shared…

…Colorectal Cancer (DCC) has shown…

…have suggested thatDCCmay participate in…

…Another gene,Neuronal growth regulator 1growth regulator 1…

Show Full Abstract

The complex relationship between frailty and schizophrenia has yet to be fully understood. This study aims to clarify their relationship by investigating their genetic links. We hypothesize a shared genetic architecture and a bidirectional causal relationship between the two conditions. Utilizing summary genetic data from European genome-wide association studies, we analyzed genetic associations through global and local correlations, shared genomic loci, tissue enrichments, and functional genes. Bidirectional Mendelian Randomization (MR) was employed to infer causality. Our findings show a positive genetic correlation between frailty and schizophrenia (LDSC: r<sub>g</sub> = 0.117, p = 6.686 × 10<sup>-7</sup>; HDL: r<sub>g</sub> = 0.101, p = 5.63 × 10<sup>-13</sup>) and local correlations in three genomic regions (chr9: 94167203-96671698, p = 2.21 × 10<sup>-6</sup>; chr11: 112459488-114257728, p = 1.01 × 10<sup>-5</sup>; and chr18: 77149991-78017158, p = 9.57 × 10<sup>-6</sup>). We identified 111 genomic loci associated with both conditions and demonstrated that genetic variants for frailty and schizophrenia share tissue enrichments and functional genes in brain. MR analysis suggests that frailty increases the likelihood of schizophrenia (OR: 1.763, 95% CI: 1.259-2.468, p = 0.001) and vice versa (β: 0.012, 95% CI: 0.006-0.018, p < 0.001). Our research supports the presence of a shared genetic basis and bidirectional causality between frailty and schizophrenia. These findings necessitate further investigation in diverse populations to confirm and expand on this genetic understanding.

SUDS3
Also flagged:DEKnucleosomebindingchromatinnucleosome-binding proteinheterochromatin
Journal Article 2025-02-21 ✓ 1 Snippet Kujirai T, Echigoya K, Kishi Y, Saeki M, Ito T, Kato J, Negishi L, Kimura H, Masumoto H, Takizawa Y, Gotoh Y, Kurumizaka H.
In-Text Gene Mentions

…50–130% amounts oflinker histoneshistones relative to…

Show Full Abstract

Structural diversity of the nucleosome affects chromatin conformations and regulates eukaryotic genome functions. Here we identify DEK, whose function is unknown, as a nucleosome-binding protein. In embryonic neural progenitor cells, DEK colocalizes with H3 K27 trimethylation (H3K27me3), the facultative heterochromatin mark. DEK stimulates the methyltransferase activity of Polycomb repressive complex 2 (PRC2), which is responsible for H3K27me3 deposition in vitro. Cryo-electron microscopy structures of the DEK-nucleosome complexes reveal that DEK binds the nucleosome by its tripartite DNA-binding mode on the dyad and linker DNAs and interacts with the nucleosomal acidic patch by its newly identified histone-binding region. The DEK-nucleosome interaction mediates linker DNA reorientation and induces chromatin compaction, which may facilitate PRC2 activation. These findings provide mechanistic insights into chromatin structure-mediated gene regulation by DEK.

Also flagged:infertilityCCR1LEGlactationgestationmastitis
Journal Article 2025-02-21 No Snippets Kiser JN, Seabury CM, Neupane M, Moraes JGN, Herrick AL, Dalton J, Burns GW, Spencer TE, Neibergs HL.
Show Full Abstract

<h4>Background</h4>The financial strain fertility issues cause the dairy cattle industry is substantial, with over $7 billion in lost revenue accrued annually due to a relatively low cow conception rate (CCR; 30-43%) for US dairy cows. While CCR has been improving through genomic selection, identification of causal mutations would help improve the rate of genetic progress with genomic selection and provide a better understanding of infertility. The objectives of this study were to: (1) identify genes and gene-sets associated with CCR to the first breeding (CCR1) and the number of breedings required to conceive (TBRD) in Holstein cows and (2) identify putative functional variants associated with CCR1 and TBRD through a custom genotype-by-sequencing array. The study consisted of 1,032 cows (494 pregnant to first breeding, 472 pregnant to subsequent [2-20] services, and 66 that never conceived). Cows were artificially inseminated, and pregnancy was determined 35d later by rectal palpation of uterine contents. Gene-set enrichment analyses with SNP data (GSEA-SNP) were conducted for CCR1 and TBRD with a normalized enrichment score (NES) ≥ 3.0 required for significance. Leading edge genes (LEG) and positional candidate genes from this and 26 additional studies were used to validate 100 loci associated (P < 1 × 10<sup>- 5</sup>) with cow fertility using a custom sequencing genotyping array of putative functional variants (exons, promoters, splice sites, and conserved regions).<h4>Results</h4>GSEA-SNP identified 95 gene-sets (1,473 LEG) enriched for CCR1 and 67 gene sets enriched (1,438 LEG) for TBRD (NES ≥ 3). Thirty-four gene-sets were shared between CCR1 and TBRD along with 788 LEG. The association analysis for TBRD identified three loci: BTA1 at 83 Mb, BTA1 at 145 Mb, and BTA 20 at 46 Mb (P < 1 × 10<sup>- 5</sup>). The loci associated with TBRD contained candidate genes with functions relating to implantation and uterine receptivity. No loci were associated with CCR1, however a single locus on BTA1 at 146 Mb trended toward significance with an FDR of 0.04.<h4>Conclusions</h4>The validation of three loci associated with CCR and TBRD in Holsteins can be used to improve fertility through genomic selection and provide insight into understanding infertility.

SERPINC1
Also flagged:tranexamic acidD-dimerfibrinogendegradationrenal insufficiencyliver failure
Journal Article 2025-02-21 ✓ 3 Snippets Luo JY, Zhou C, Shi SX, Wei QX, Chen Y, Ouyang J, Si YY.
In-Text Gene Mentions

…and antithrombin III (ATIII).…

…PT, APTT, FIB,ATIII, DD2, and FDPS…

…APTT, FIB, andATIIIon the day…

Show Full Abstract

<h4>Objective</h4>The objective of this study was to investigate the efficacy and safety of tranexamic acid (TXA) in hepatectomy when administered as per the standardized protocol of controlled low central venous pressure (CLCVP).<h4>Methods</h4>This study was a randomized, double-blind, controlled study. Patients who fulfilled the inclusion criteria were randomly assigned to the TXA group (group T) or the placebo group (group N). The central venous pressure (CVP) was maintained at below 5 cmH2O before complete dissection of the liver parenchyma. Patients in group T received an intravenous infusion of 10 mg/kg of TXA 30 min before surgery, and it was continuously pumped intravenously at a rate of 1 mg/(kg.h) until the end of surgery. Patients in group N were infused with 1 mL/kg of normal saline 30 min before surgery, and it was continuously pumped intravenously at a rate of 0.1 mL/(kg.h) until the end of surgery. The primary outcome indicators were intraoperative blood loss, blood transfusion rate, intraperitoneal drainage at 24 h after surgery, and the occurrence of compound bleeding within 30 days.<h4>Results</h4>The baseline indicators were similar (P > 0.05), and there was no significant difference in intraoperative blood loss between the two groups, but the red blood cell transfusion rate was lower in the T group than in the N group (P < 0.05). The infusion volume, surgical field grade, and surgery duration were comparable between the two groups (P > 0.05). Patients in group T had a shorter hilar occlusion time, lower D-dimer and fibrinogen degradation products (FDPs) on the day of surgery, and significantly less intraperitoneal drainage at 24 h after surgery (all P < 0.05). There were two cases of compound bleeding and three cases of thromboembolism among patients in group N, but there were no such complications in group T.<h4>Conclusion</h4>The use of TXA in hepatectomy under CLCVP reduced the intraoperative blood transfusion rate and improved the postoperative bleeding outcome without increasing the risk of adverse events such as hepatic and renal insufficiency and thrombosis.

SLC2A14
Also flagged:FerroptosispreeclampsiairondeathPEpathogenesis
Journal Article 2025-02-21 ✓ 2 Snippets He L, Zhan F, Li X, Yang H, Wu J.
In-Text Gene Mentions

…IDO1, HLF, LTF,SLC2A14, GCLM, CYBB, SLC2A12,…

…NDRG1, P4HA1, FABP4,SLC2A14, LDHA, BACH1, BYBB,…

Show Full Abstract

<h4>Introduction</h4>Preeclampsia (PE) is a severe pregnancy complication with limited early diagnostic and therapeutic options. Ferroptosis, an iron-dependent cell death pathway, has emerged as a potential mechanism in PE pathogenesis. This study investigated ferroptosis-related genes (FRGs) in PE to identify diagnostic biomarkers and therapeutic targets.<h4>Methods</h4>Differentially expressed genes were identified from GEO databases and intersected with FRGs. Hub genes were selected using RandomForest and LASSO algorithms. Their diagnostic potential was evaluated through ROC analysis. Regulatory networks were constructed using transcription factors, microRNAs and potential drug targets. Hub gene expression was validated through immunohistochemistry, Western blot, and RT-qPCR in placental tissues and hypoxic trophoblasts.<h4>Results</h4>We identified 25 ferroptosis-related differentially expressed genes enriched in ferroptosis and HIF-1 pathways. Four hub genes (NDRG1, P4HA1, LDHA, and IDO1) showed high diagnostic efficiency (AUC=0.9182). Immune cell analysis revealed altered levels of plasma cells, CD8+ T cells, Tregs, monocytes, and M2 macrophages in PE, correlating significantly with hub gene expression. We identified 84 mRNA-miRNA and 119 mRNA-TF interactions. Among 19 potential drugs, Tetrahydro-NAD showed promising targeting potential. Experimental validation confirmed elevated expression of NDRG1, P4HA1, and LDHA, and decreased IDO1 in PE tissues and hypoxic conditions.<h4>Discussion</h4>This study identified four FRGs as potential PE biomarkers and therapeutic targets, providing new insights into PE pathogenesis through integrated bioinformatics and experimental validation. These findings may facilitate early PE diagnosis and treatment development.

Also flagged:nucleotidecolorationwaterchromosomemacrochromosomesmicrochromosomes
Journal Article 2025-02-21 No Snippets Shakya SB, Edwards SV, Sackton TB.
Show Full Abstract

<h4>Background</h4>Convergent evolution is the independent evolution of similar traits in unrelated lineages across the Tree of Life. Various genomic signatures can help identify cases of convergent evolution at the molecular level, including changes in substitution rate in the same genes or gene networks. In this study, utilizing tarsus measurements of ~ 5400 species of birds, we identify independent shifts in tarsus length and use both comparative genomic and population genetic data to identify convergent evolutionary changes among focal clades with shifts to shorter optimal tarsus length.<h4>Results</h4>Using a newly generated, comprehensive and broadly accessible set of 932,467 avian conserved non-exonic elements (CNEEs) and a whole-genome alignment of 79 birds, we find strong evidence for convergent acceleration in short-tarsus clades among 14,422 elements. Analysis of 9854 protein-coding genes, however, yielded no evidence of convergent patterns of positive selection. Accelerated elements in short-tarsus clades are concentrated near genes with functions in development, with the strongest enrichment associated with skeletal system development. Analysis of gene networks supports convergent changes in regulation of broadly homologous limb developmental genes and pathways.<h4>Conclusions</h4>Our results highlight the important role of regulatory elements undergoing convergent acceleration in convergent skeletal traits and are consistent with previous studies showing the roles of regulatory elements and skeletal phenotypes.

Also flagged:chromatinhistonetranscription factorgene expressiontransposaseTF
Journal Article 2025-02-21 No Snippets Arthur TD, Nguyen JP, Henson BA, D'Antonio-Chronowska A, Jaureguy J, Silva N, iPSCORE Consortium, Panopoulos AD, Izpisua Belmonte JC, D'Antonio M, McVicker G, Frazer KA.
Show Full Abstract

Most GWAS loci are presumed to affect gene regulation; however, only ∼43% colocalize with expression quantitative trait loci (eQTLs). To address this colocalization gap, we map eQTLs, chromatin accessibility QTLs (caQTLs), and histone acetylation QTLs (haQTLs) using molecular samples from three early developmental-like tissues. Through colocalization, we annotate 10.4% (n = 540) of GWAS loci in 15 traits by QTL phenotype, temporal specificity, and complexity. We show that integration of chromatin QTLs results in a 2.3-fold higher annotation rate of GWAS loci because they capture distal GWAS loci missed by eQTLs, and that 5.4% (n = 13) of GWAS colocalizing eQTLs are early developmental specific. Finally, we utilize the iPSCORE multiomic QTLs to prioritize putative causal variants overlapping transcription factor motifs to elucidate the potential genetic underpinnings of 296 GWAS-QTL colocalizations.

Also flagged:colistinGlucosemcrpolymeraseconjugationtransfer
Journal Article 2025-02-21 No Snippets Le NT, Hoang PH, Nguyen Q, Truong MNH, Van Dang C, Ho TH, Hoang PL, Truong DQ, Nguyen HTT, Van Le C, Phan TTP.
Show Full Abstract

<h4>Background</h4>Colistin resistance poses a growing global challenge, particularly in low- and middle-income countries where antibiotic misuse is prevalent. This study investigates the prevalence of colistin resistance in Klebsiella spp. and characterizes the genetic features of resistant isolates, focusing on the mcr-8.2 gene identified in a Klebsiella pneumoniae isolate from pediatric diarrheal cases in southern Vietnam.<h4>Methods</h4>Stool samples were collected from 500 pediatric patients (aged 0-5 years) hospitalized with diarrhea in two tertiary hospitals in Ho Chi Minh City between March and September 2022. Samples were cultured on Violet Red Bile Glucose Agar, then presumptive Klebsiella spp. colonies were selected, purified on nutrient agar, and identified using MALDI-TOF MS. Colistin resistance was determined via minimum inhibitory concentration testing, and the presence of mcr genes was confirmed through polymerase chain reaction. Whole-genome sequencing was performed on the Klebsiella pneumoniae strain harboring mcr-8.2 to elucidate resistance mechanisms. Strain characterization was performed using multi-locus sequence typing, while conjugation experiments assessed horizontal gene transfer potential.<h4>Results</h4>Among 121 Klebsiella spp. isolates, 49 (40.5%) were resistant to colistin. The mcr-1 gene was detected in 31 isolates (25.6%), whereas the mcr-8 was identified in a single isolate (0.8%), with a colistin MIC of 16 µg/mL. Genomic analysis revealed 34 antibiotic resistance genes, including mcr-8.2 and multiple β-lactamase genes, alongside plasmid types IncFIB and IncFII. Chromosomal mutations in phoP, phoQ, and lpxM were also implicated in colistin resistance.<h4>Conclusions</h4>This study documents the emergence of mcr-8.2-mediated colistin resistance in K. pneumoniae from pediatric diarrhea in Vietnam and highlights a high prevalence of multidrug resistance in Klebsiella spp.. Continuous surveillance of mcr genes and novel therapeutic strategies are urgently needed.

Also flagged:collagenosteogenesisbone formationBone fracturesβ-tricalcium phosphatehydroxyapatite
Journal Article 2025-02-21 No Snippets Wang WT, Tseng CC, Cho HC, Chiu KY, Weng LW, Chang YH, Chen RF, Lee SS, Wu YC.
Show Full Abstract

<h4>Background</h4>Autologous bone remains the gold standard for surgical bone reconstruction but presents clinical challenges like donor site complications and operational difficulties.<h4>Method</h4>We investigate the osteogenic effects of a newly designed, ceramic and collagen-based, submicron-processed Flexible Hydrated-Hardening Bone Graft (FHBG), using both murine and human mesenchymal stem cells. We also compare the efficacy and safety of FHBG with a commercially available (CA) graft in New Zealand white rabbits with cranial bone defects. Rabbits were divided into three groups: no graft, CA, and FHBG, and evaluated using Micro-CT and histological analysis at three and six weeks post-surgery. Safety was assessed through blood samples.<h4>Results</h4>In vitro, FHBG promoted osteogenesis and upregulated osteogenic-associated genes in mesenchymal stem cells. In vivo, FHBG significantly enhanced bone regeneration, showing approximately 25% and 30% more improvement than the control at three and six weeks post-surgery. FHBG also had about half the residual content compared to the CA group. Blood analysis showed no hepatotoxicity or nephrotoxicity associated with the graft.<h4>Conclusion</h4>FHBG significantly promotes bone regeneration both in vitro and in vivo. Additionally, FHBG has been demonstrated to be safe, with fewer residuals remaining in the body compared to currently in-use clinical bone grafts. This study validates the ability of the newly designed FHBG to facilitate osteogenesis in vitro and demonstrates its efficacy and safety in new bone formation in vivo. The lower residual material further suggests a reduced long-term impact and associated risk with the graft.

Also flagged:hypoxic-ischemic encephalopathyHIEdeathHypothermiaencephalopathyreflexes
Journal Article 2025-02-21 No Snippets Natarajan G, McDonald SA, Shankaran S, Laptook AR, Bonifacio S, Sewell EK, Chalak L, NICHD Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To examine the association of a numerical Sarnat score (NSS) and modified Sarnat staging among newborn infants with moderate/severe hypoxic-ischemic encephalopathy and their neurodevelopmental outcomes at 18-22 months.<h4>Study design</h4>This secondary analysis included participants with gestational age ≥36 weeks and moderate/severe hypoxic-ischemic encephalopathy (HIE) from the Induced Hypothermia and Optimizing Cooling trials. Early (<6 hours age) neurologic examinations were performed by trained examiners to categorize HIE severity by modified Sarnat staging. The NSS was calculated by summing abnormal scores (2 for moderate, 3 for severe) in the 6 examination categories. The primary outcome was death or moderate/severe disability. Statistical analysis included logistic regression, adjusting for center, trial, and cooling group, and linear regression for continuous scales.<h4>Results</h4>The cohort (n = 528) included infants with 71% moderate and 29% severe HIE (37% Induced Hypothermia and 63% Optimizing Cooling participants). Median (IQR) NSS of infants with moderate and severe HIE were 11 (9-13) and 16 (16-17), respectively. There were significant associations among NSS, NSS tertiles, and modified Sarnat staging and death or disability, but there were no differences found in their area-under-the-curve estimates. Similar to modified Sarnat staging, NSS showed significant associations with Bayley-III cognitive, language, and motor scores and Bayley-II mental and psychomotor developmental indices.<h4>Conclusion</h4>Among infants with moderate or severe HIE, the NSS did not improve the predictive accuracy for death or disability at 18-22 months of age, compared with modified Sarnat staging performed in the initial 6 hours after birth by trained examiners.

DCC
Also flagged:Metformintype 2 diabetescancercell proliferationAMP-activated protein kinaseAMPK
Journal Article 2025-02-21 ✓ 1 Snippet Gillespie A, Mehdorn AS, Lim TQ, Wang T, Mooney BA, Ovens AJ, Orang A, Oakhill JS, Michael MZ, Petersen J.
In-Text Gene Mentions

…neither oligomycin norDCChad an inhibitory…

Show Full Abstract

Metformin is a well-tolerated drug frequently prescribed for managing type 2 diabetes. Extended metformin use has been linked to a significant decrease in cancer incidence across both diabetic and non-diabetic populations. Here we investigate the anti-proliferative effects of metformin on fission yeast <i>S. pombe</i>. Our findings demonstrate that metformin's inhibitory impact on cell proliferation is effective in the absence of AMP-activated protein kinase (AMPK). Using an unbiased genetic screen we identified the plasma membrane signalling scaffold Efr3, critical for phosphatidylinositol signalling and the generation of PI4Ps, as a key determinant of resistance to the anti-proliferative effect of metformin. Deletion of <i>efr3</i> resulted in both AMPK-dependent and AMPK-independent resistance to metformin. We show that Efr3 does not influence cell proliferation by controlling Ras1 activity or its cellular localization in yeast. We observe that <i>dnm1</i> (DRP1) mutants with elongated mitochondria are also resistant to the anti-proliferative effect of metformin and that metformin treatment promotes mitochondrial fusion. Metabolic measurements after prolonged metformin exposure demonstrated a reduction in respiration in both wild type and the <i>efr3</i> deletion, however, that reduction is less pronounced in the <i>efr3</i> deletion, which also contained elongated mitochondria. It is likely that mitochondrial fusion enhances yeast fitness in response to metformin exposure. Together we provide a new perspective on the cellular response to metformin.

Also flagged:translationallipidpalmitoyltransferasesacyl protein thioesteraseslocalizationsecretion
Journal Article 2025-02-21 No Snippets Qian YR, Zhao YJ, Zhang F.
Show Full Abstract

Protein palmitoylation, a reversible post-translational lipid modification, is catalyzed by the ZDHHC family of palmitoyltransferases and reversed by several acyl protein thioesterases, regulating protein localization, accumulation, secretion, and function. Neurological disorders encompass a spectrum of diseases that affect both the central and peripheral nervous system. Recently, accumulating studies have revealed that pathological protein associated with neurological diseases, such as β-amyloid, α-synuclein, and Huntingtin, could undergo palmitoylation, highlighting the crucial roles of protein palmitoylation in the onset and development of neurological diseases. However, few preclinical studies and clinical trials focus on the interventional strategies that target protein palmitoylation. Here, we comprehensively reviewed the emerging evidence on the role of protein palmitoylation in various neurological diseases and summarized the classification, processes, and functions of protein palmitoylation, highlighting its impact on protein stability, membrane localization, protein-protein interaction, as well as signal transduction. Furthermore, we also discussed the potential interventional strategies targeting ZDHHC proteins and elucidated their underlying pathogenic mechanisms in neurological diseases. Overall, an in-depth understanding of the functions and significances of protein palmitoylation provide new avenues for investigating the mechanisms and therapeutic approaches for neurological disorders.

Also flagged:lung cancerpathogenesismethylationhistone modificationscancergene expressions
Journal Article 2025-02-21 No Snippets Bi L, Wang X, Li J, Li W, Wang Z.
Show Full Abstract

The integration of liquid biopsy with epigenetic markers offers significant potential for early lung cancer detection and personalized treatment. Epigenetic alterations, including DNA methylation, histone modifications, and noncoding RNA changes, often precede genetic mutations and are critical in cancer progression. In this study, we explore how liquid biopsy, combined with epigenetic markers, can provide early detection of lung cancer, potentially predicting onset up to 4 years before clinical diagnosis. We discuss the challenges of targeting epigenetic regulators, which could disrupt cellular balance if overexploited, and the need for maintaining key gene expressions in therapeutic applications. This review highlights the promise and challenges of using liquid biopsy and epigenetic markers for early-stage lung cancer diagnosis, with a focus on optimizing treatment strategies for personalized and precision medicine.

Also flagged:Neurodegenerative diseasesneurodegenerative diseaseAlzheimer diseaseamyotrophic lateral sclerosisALSParkinson disease
Journal Article 2025-02-21 No Snippets Dilliott AA, Costanzo MC, Bandres-Ciga S, Blauwendraat C, Casey B, Hoang Q, Iwaki H, Jang D, Kim JJ, Leonard HL, Levine KS, Makarious M, Nguyen TT, Rouleau GA, Singleton AB, Smadbeck P, Solle J, Vitale D, Nalls M, Flannick J, Burtt NP, Farhan SMK.
Show Full Abstract

Although large-scale genetic association studies have proven useful for the delineation of neurodegenerative disease processes, we still lack a full understanding of the pathologic mechanisms of these diseases, resulting in few appropriate treatment options and diagnostic challenges. To mitigate these gaps, the Neurodegenerative Disease Knowledge Portal (NDKP) was created as an open-science initiative with the aim to aggregate, enable analysis, and display all available genomic datasets of neurodegenerative disease, while protecting the integrity and confidentiality of the underlying datasets. The portal contains 218 genomic datasets, including genotyping and sequencing studies, of individuals across 10 different phenotypic groups, including neurologic conditions such as Alzheimer disease, amyotrophic lateral sclerosis, Lewy body dementia, and Parkinson disease. In addition to securely hosting large genomic datasets, the NDKP provides accessible workflows and tools to effectively use the datasets and assist in the facilitation of customized genomic analyses. Here, we summarize the genomic datasets currently included within the portal, the bioinformatics processing of the datasets, and the variety of phenotypes captured. We also present example use cases of the various user interfaces and integrated analytic tools to demonstrate their extensive utility in enabling the extraction of high-quality results at the source, for both genomics experts and those in other disciplines. Overall, the NDKP promotes open science and collaboration, maximizing the potential for discovery from the large-scale datasets researchers and consortia are expending immense resources to produce and resulting in reproducible conclusions to improve diagnostic and therapeutic care for patients with neurodegenerative disease.

GPR52
Also flagged:schizophreniaG Protein-Coupled ReceptorsGPCRsGPCRcentral nervous system diseasesbinding
Journal Article 2025-02-21 ✓ 4 Snippets Demir S, Tunca Alparslan G.
In-Text Gene Mentions

…TargetingGPR52for potential agonists…

…three-dimensional structure ofGPR52, an orphan GPCR…

…molecule candidate forGPR52by using structure-based…

…pharmacokinetic studies forGPR52.…

Show Full Abstract

G Protein-Coupled Receptors (GPCRs) are one of the most attractive therapeutic targets due to their active role in different systems and disease types. The increasing three-dimensional structure information of GPCRs has made them interesting for Structure-Based Drug Design (SBDD) studies. There are various orphan GPCRs whose endogenous molecules have not yet been identified, although their structural information is known. The recent discovery of the three-dimensional structure of GPR52, an orphan GPCR involved in central nervous system diseases, made it stand out as a drug target. In this study, it is aimed to find a lead drug molecule candidate for GPR52 by using structure-based drug design techniques. The study comprises a set of SBDD methods, including preparation of a small molecule library, pharmacophore modeling, molecular docking, consensus scoring, molecular dynamics simulations, calculation of binding free energy, and in silico pharmacokinetic studies for GPR52. It is expected that the molecules obtained as a result of the study may be strong candidates for in vitro and in vivo experiments or could be used as lead drug molecules in new drug discovery and development studies.

Also flagged:dementiasantibodyalcohol-related dementiaamnesiasbeta-amyloidtau
Journal Article 2025-02-21 No Snippets Alanko V, Mravinacová S, Hall A, Hagman G, Mohanty R, Westman E, Nilsson P, Kivipelto M, Månberg A, Matton A.
Show Full Abstract

Alzheimer's disease and related dementias have a multifactorial aetiology and heterogeneous biology. The current study aims to identify different biological signatures in a deeply phenotyped memory clinic patient population. In this cross-sectional study, we analysed 49 pre-specified proteins using a multiplex antibody-based suspension bead array in 278 CSF samples from the real-world research database and biobank at the Karolinska University Hospital Memory Clinic, Solna, Sweden. Patients with a clinical diagnosis of subjective cognitive decline (<i>N</i> = 151), mild cognitive impairment (<i>N</i> = 61), Alzheimer's disease (<i>N</i> = 47), or other diagnoses (<i>N</i> = 19; vascular dementias, alcohol-related dementia, unspecified dementias, or other amnesias) were included. Principal component analyses were performed, and resulting principal components (PCs) were tested for associations with clinical variables and Alzheimer's disease biomarkers (CSF biomarkers beta-amyloid 42, beta-amyloid 42/40, phosphorylated tau 181, phosphorylated tau 181/beta-amyloid 42). PC 1 (explaining 52% of the variance between patients) was associated with the clinical Alzheimer's disease CSF biomarkers beta-amyloid 42, phosphorylated tau 181, and total tau but not with Alzheimer's disease-related neurodegeneration imaging markers, cognitive performance, or clinical diagnosis. PC 2 (explaining 9% of the variance) displayed an inflammatory profile with high contributions of chitinase 3 like 1 (CHI3L1) and triggering receptor expressed on myeloid cells 2 (TREM2) and significant correlation to CSF free light chain kappa. In contrast to PC 1, PC 3 (explaining 5% of the variance) showed associations with all the clinical Alzheimer's disease CSF biomarkers, the imaging markers, cognitive impairment and clinical diagnosis. Serpin family A member 3 (SERPINA3), chitinase 1 (CHIT1), and neuronal pentraxin 2 (NPTX2) contributed most to PC 3. PC 4 (explaining 4% of the variance) exhibited an inflammatory profile distinct from PC 2, with the largest contributions from TREM2, leucine-rich alpha-2-glycoprotein 1 (LRG1) and complement C9. The component was associated with peripheral inflammation. We found that CSF protein profiles in a memory clinic cohort reflect molecular differences across diagnostic groups. Our results emphasize that real-world memory clinic patients can have different ongoing biological processes despite receiving the same diagnosis. In the future, this information could be utilized to identify patient endotypes and uncover precision biomarkers and novel therapeutic targets.

Also flagged:Neuropathic painaxonmyelinationangiogenesisneurotrophic factorscell proliferation
Journal Article 2025-02-21 No Snippets Zhang WJ, Pi XW, Hu DX, Liu XP, Wu MM.
Show Full Abstract

Neuropathic pain (NPP) is caused by damage to the somatosensory nervous system. Its prominent symptoms are spontaneous pain, hyperalgesia and abnormal pain. This pain is long-lasting and unbearable, seriously affecting the patient's quality of life. At present, the clinical treatment effect of painkillers to relieve NPP is still not ideal, nor can it repair damaged nerves and achieve long-term treatment results. In recent years, the application of cell therapy strategies in the field of pain has yielded encouraging results, including preclinical studies and clinical trials. Mesenchymal stem cells (MSCs) are pluripotent progenitor cells derived from mesogenesis. They have the ability to self-renew and differentiate into multiple cell types and have been widely studied and applied in the field of neuroregenerative medicine. MSCs play an important mechanism functional role in promoting injured nerve regeneration and pain relief by regulating multiple processes in target cells, including immunoregulation, anti-inflammatory properties, promoting axon regeneration and re-myelination, promoting angiogenesis, and secreting neurotrophic factors. Moreover, MSCs can also release exosomes, which may be part of their analgesic effects. Exosomes derived from MSC also have the functional properties of mother cells and have therapeutic potential for treating NPP by promoting cell proliferation, regulating inflammatory responses, reducing cell death, promoting axon regeneration and angiogenesis. Therefore, in this article, we discussed current treatment strategies for NPP and explored the functional role and mechanism of MSCs in the treatment of NPP. We also analyzed the current problems and challenges in the application of MSCs in clinical trials of NPP.

TNFSF4
Also flagged:breast cancerBRCAPDCD1CD27IDO1TMIGD2
Journal Article 2025-02-21 ✓ 5 Snippets Tang C, Hu X, Hao D, Chen T, Wang P, Li C, Chen C, Li Y, Hao X, Yuan Z.
In-Text Gene Mentions

…CPRs (PDCD1/CD27 ratio, PDCD1/TNFSF4ratio, IDO1/TMIGD2 ratio,…

…IDO1/TMIGD2 ratio, and IDO1/TNFSF4ratio) were significantly…

…TNFRSF4, TNFRSF9, TNFSF14,TNFSF4, TNFSF9, HAVCR2, IDO1,…

…CD27, CD40L, TNFRSF18,TNFSF4, NCR3, PDCD1, IDO1,…

…CD27, CD40L, TNFRSF18,TNFSF4, and NCR3 were…

Show Full Abstract

<h4>Background</h4>Accumulating evidences suggested that immune checkpoints (ICPs) played an important role in malignancies including breast cancer (BRCA). We aimed to investigate whether inhibitory-to-stimulatory immune checkpoint ratio (ISICPR) could be used as a prognostic marker for BRCA.<h4>Methods</h4>BRCA patients were enrolled from The Cancer Genome Atlas (TCGA). Survival analysis was performed with Kaplan-Meier (KM) methods. X-tile was used to calculate the optimal cut-off values of ISICPRs. Univariate and multivariate Cox regression analysis were carried out to identify prognostic factors for BRCA patients. Tissue microarray was used to validate our findings.<h4>Results</h4>In total, 586 BRCA patients were collected, including 104 cases of stage I, 330 of stage II, 139 of stage III, and 13 of stage IV. Univariate analysis showed that four ISICPRs (PDCD1/CD27 ratio, PDCD1/TNFSF4 ratio, IDO1/TMIGD2 ratio, and IDO1/TNFSF4 ratio) were significantly associated with the survival of BRCA patients. After adjusting for confounders, multivariate analysis indicated that only the IDO1/TMIGD2 ratio was an independent prognostic factor. The optimal cut-off values for the IDO1/TMIGD2 ratio were set at 4.4 and 6.3. Survival analysis indicated that the high-ratio group (ratio > 6.3) had a worse prognosis than both the low-ratio (ratio < 4.4) and medium-ratio group (4.4 < ratio < 6.3) (P < 0.001), which was further validated by BRCA tissue microarray.<h4>Conclusions</h4>We found that IDO1/TMIGD2 ratio was an independent prognostic factor for BRCA. On one hand, dual targeting of IDO1 and TMIGD2 may be a more effective therapeutic strategy for patients with a high IDO1/TMIGD2 ratio. On the other hand, ISICPR was a promising indicator with high clinical values and worthy of further promotion in other cancers.

Also flagged:NanowiresHydroxyapatitemineralnanostructuresnanowiremetal ions
Journal Article 2025-02-21 No Snippets Zhang Y, Zhu YJ, Li SY, Dong LY, Yu HP.
Show Full Abstract

With an ultrahigh aspect ratio and a similar chemical composition to the biomineral in bone and tooth, ultralong hydroxyapatite nanowires (UHAPNWs) exhibit a meritorious combination of high flexibility, excellent mechanical performance, high biocompatibility, and bioactivity. Despite these exciting merits, the rapid and green synthesis of UHAPNWs remains challenging. In this work, we have developed an environment-friendly, rapid, and highly efficient synthesis of ultrathin UHAPNWs by the microwave-assisted calcium oleate precursor hydrothermal method using biogenic creatine phosphate as the bio-phosphorus source. Owing to the controllable hydrolysis of bio-phosphorus-containing creatine phosphate and the highly efficient heating of microwave irradiation, ultrathin UHAPNWs with a homogeneous morphology of several nanometers in diameter (single nanowire), several hundred micrometers in length, and ultrahigh aspect ratios (>10,000) can be rapidly synthesized within 60 min. This effectively shortens the synthesis time by about two orders of magnitude compared with the traditional hydrothermal method. Furthermore, ultrathin UHAPNWs are decorated in situ with bioactive creatine and self-assembled into nanowire bundles along their longitudinal direction at the nanoscale. In addition, ultrathin UHAPNWs exhibit a relatively high specific surface area of 84.30 m<sup>2</sup> g<sup>-1</sup> and high ibuprofen drug loading capacity. The flexible bio-paper constructed from interwoven ibuprofen-loaded ultrathin UHAPNWs can sustainably deliver ibuprofen in phosphate-buffered saline, which is promising for various biomedical applications such as tissue regeneration with anti-inflammatory and analgesic functions.

TNFSF4
Also flagged:LipidMetabolismGlioblastomaGBMbrain cancercellular senescence
Journal Article 2025-02-21 ✓ 1 Snippet Li Q, Liu H.
In-Text Gene Mentions

…LAIR1, TIGIT, TNFSF15,TNFSF4, and CD276 (…

Show Full Abstract

Glioblastoma (GBM) is the most aggressive primary brain cancer, with poor prognosis due to its aggressive behavior and high heterogeneity. This study aimed to identify cellular senescence (CS) and lipid metabolism (LM)-related prognostic genes to improve GBM prognosis and treatment. Transcriptome and scRNA-seq data, CS-associated genes (CSAGs), and LM-related genes (LMRGs) were acquired from public databases. Prognostic genes were identified by intersecting CSAGs, LMRGs, and differentially expressed genes (DEGs), followed by WGCNA and univariate Cox regression. A risk model and nomogram were constructed. Analyses covered clinicopathological features, immune microenvironment, somatic mutations, and drug sensitivity. GBM scRNA-seq data identified key cells and prognostic gene expression. SOCS1 and PHB2 were identified as prognostic markers, contributing to the construction of a robust risk model with excellent predictive ability. High-risk group (HRG) patients had poorer survival, higher immune and stromal scores, and distinct somatic mutation profiles. Drug sensitivity analysis revealed significant differences in IC50 values. In microglia differentiation, SOCS1 and PHB2 showed dynamic expression patterns. These findings provide new strategies for GBM prognosis and treatment.

ABT1
Also flagged:deathlipiderastinferroptosisoxygeniron
Journal Article 2025-02-21 ✓ 1 Snippet Likitsatian T, Koonyosying P, Paradee N, Roytrakul S, Ge H, Pourzand C, Srichairatanakool S.
In-Text Gene Mentions

…serving as anactivator of transcription 1of transcription 1…

Show Full Abstract

<h4>Background/objective</h4>Ferroptosis is an iron-dependent form of programmed cell death characterized by lipid peroxidation products (LPOs). A chemotherapeutic drug, 5-fluorouracil (5-FU), can induce epithelial mucositis and favor drug synergism with erastin in ferroptosis. <i>Camellia</i> tea saponin extract (TS) is known to exert antioxidative properties. This study aims to delineate the protective role of TS in mitigating 5-FU-induced ferroptosis and inflammation in human keratinocytes.<h4>Methods</h4>HaCaT cells were induced by 5-FU and erastin, treated with different TS doses, and their viability was then determined. Levels of cellular reactive oxygen species (ROS), LPOs, labile iron pool (LIP), glutathione (GSH), glutathione peroxidase 4 (GPX-4) activity, as well as IL-6, IL-1β, and TNF-α levels, and their wound healing properties were assessed.<h4>Results</h4>TS per se (at up to 25 µg/mL) was not toxic to HaCaT cells but was unable to restore the viability of 5-FU-induced cells up to the baseline levels. The compound significantly diminished increases in cellular ROS, LPOs, and LIP, while restoring GSH content and GPX-4 activity. Additionally, it suppressed the cytokine production of 5-FU-induced cells in a concentration-dependent manner. Moreover, TS exerted wound-healing effects against skin injuries and 5-FU damage significantly and dose dependently.<h4>Conclusions</h4>The insights of this work have identified biochemical mechanisms using tea saponin extract to protect against 5-FU-induced keratinocyte ferroptosis and inflammation. This study highlights the promising adjunctive potential of tea saponin in the mitigation and management of chemotherapy-induced mucositis.

Also flagged:gene silencinggene expressionmetabolic disordershearing lossMTLCEBPA
Journal Article 2025-02-21 No Snippets Qian Y, Liu C, Zeng X, Li LC.
Show Full Abstract

RNA activation (RNAa), a gene regulatory mechanism mediated by small activating RNAs (saRNAs) and microRNAs (miRNAs), has significant implications for therapeutic applications. Unlike small interfering RNA (siRNA), which is known for gene silencing in RNA interference (RNAi), synthetic saRNAs can stably upregulate target gene expression at the transcriptional level through the assembly of the RNA-induced transcriptional activation (RITA) complex. Moreover, the dual functionality of endogenous miRNAs in RNAa (hereafter referred to as mi-RNAa) reveals their complex role in cellular processes and disease pathology. Emerging studies suggest saRNAs' potential as a novel therapeutic modality for diseases such as metabolic disorders, hearing loss, tumors, and Alzheimer's. Notably, MTL-CEBPA, the first saRNA drug candidate, shows promise in hepatocellular carcinoma treatment, while RAG-01 is being explored for non-muscle-invasive bladder cancer, highlighting clinical advancements in RNAa. This review synthesizes our current understanding of the mechanisms of RNAa and highlights recent advancements in the study of mi-RNAa and the therapeutic development of saRNAs.

TNFSF4
Also flagged:Infectionhemorrhagic enteritisimmunosuppressioninfectionsTHEV infectiongene expression
Journal Article 2025-02-21 ✓ 2 Snippets Quaye A, Pickett BE, Griffitts JS, Berges BK, Poole BD.
In-Text Gene Mentions

…, TNFRSF8 ,TNFSF4), interferon-induced with…

…( IL18 ,TNFSF4, PKR ,…

Show Full Abstract

Infection with the turkey hemorrhagic enteritis virus (THEV) can cause hemorrhagic enteritis, which affects young turkeys. This disease is characterized by bloody diarrhea and immunosuppression (IMS), which is attributed to apoptosis of infected B cells. Secondary infections due to IMS exacerbate economic losses. We performed the first transcriptomic analysis of a THEV infection to elucidate the mechanisms mediating THEV-induced IMS. After infecting and sequencing mRNAs of a turkey B-cell line, trimmed reads were mapped to the host turkey genome, and gene expression was quantified with StringTie. Differential gene expression analysis was followed by functional enrichment analyses using gprofiler2 and DAVID from NCBI. RT-qPCR of select genes was performed to validate the RNA-seq data. A total of 2343 and 3295 differentially expressed genes (DEGs) were identified at 12 hpi and 24 hpi, respectively. The DEGs correlated with multiple biological processes including apoptosis, ER unfolded protein response, and cell maintenance. Multiple pro-apoptotic genes, including APAF1, BMF, BAK1, and FAS were upregulated. Genes that play a role in ER stress-induced unfolded protein response including VCP, UFD1, EDEM1, and ATF4 were also upregulated and may contribute to apoptosis. Our data suggest that several biological processes and pathways including apoptosis and ER response to stress are important aspects of the host cell response to THEV infection. It is possible that interplay between multiple processes may mediate apoptosis of infected B-cells, leading to IMS.

Also flagged:arachidonic acidtumorcancereicosanoidsimmune responseBLT
Journal Article 2025-02-20 No Snippets Tredicine M, Mucci M, Recchiuti A, Mattoscio D.
Show Full Abstract

The arachidonic acid (AA) pathway promotes tumor progression by modulating the complex interactions between cancer and immune cells within the microenvironment. In this Review, we summarize the knowledge acquired thus far concerning the intricate mechanisms through which eicosanoids either promote or suppress the antitumor immune response. In addition, we will discuss the impact of eicosanoids on immune cells and how they affect responsiveness to immunotherapy, as well as potential strategies for manipulating the AA pathway to improve anticancer immunotherapy. Understanding the molecular pathways and mechanisms underlying the role played by AA and its metabolites in tumor progression may contribute to the development of more effective anticancer immunotherapies.

HTT
Also flagged:Huntington's Diseasehereditary neurodegenerative disorderHDmovement disorderspositronhydrogen
Journal Article 2025-02-20 ✓ 1 Snippet Farag M, Knights H, Scahill RI, McColgan P, Estevez-Fraga C.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a hereditary neurodegenerative disorder characterized by cognitive, neuropsychiatric and motor symptoms caused by a CAG trinucleotide repeat expansion in the huntingtin gene. Imaging techniques are crucial for understanding HD pathophysiology and monitoring disease progression.<h4>Objectives</h4>This review is targeted at general neurologists and movement disorders specialists with an interest in HD and aims to bring complex imaging, including new experimental techniques, closer to the practicing clinician.<h4>Methods</h4>We provide a summary of findings from conventional structural, diffusion and functional imaging in HD studies, together with an update on emerging novel techniques, including multiparametric mapping, multi-shell diffusion techniques, ultra-high field 7-Tesla MRI, positron emission tomography and magnetoencephalography.<h4>Results</h4>Conventional imaging techniques have deepened our understanding of neuropathological progression in HD, from striatal atrophy to widespread cortical and white matter changes. The integration of novel imaging techniques reviewed has further improved our ability to interrogate, quantify and visualize disease-specific alterations with high precision.<h4>Conclusions</h4>Novel imaging techniques have promising roles to further our understanding of HD pathology and as imaging markers for clinical trials, disease staging and therapeutic monitoring. Additionally, the synergistic potential of combining imaging modalities with molecular and genetic data, along with wet biomarkers and clinical data, will help provide a complete and comprehensive view of HD pathology and progression.

PEBP1
Also flagged:dengue infectioninfectionsdengue feverdengue hemorrhagic fevershock syndromeregulators
Journal Article 2025-02-20 ✓ 2 Snippets Casadémont I, Ayala-Suárez R, Modhiran N, Tawfik A, Prot M, Paul R, Simon-Lorière E, Díez-Fuertes F, Ubol S, Alcamí J, Sakuntabhai A.
In-Text Gene Mentions

…mediates apoptosis, orPEBP1that enhances the…

…ANXA2, RCN2, TNFRSF10B,PEBP1) could be of…

Show Full Abstract

Dengue virus (DENV) is a global health threat, with approximately 390 million infections annually, ranging from mild dengue fever to severe dengue hemorrhagic fever and shock syndrome. MicroRNA (miRNA) are crucial post-transcriptional regulators which may regulate host resistance to DENV infection. This study aimed to identify miRNAs involved in natural resistance to DENV infection. Individuals from a dengue-endemic area were classified as susceptible (SD) or resistant (RD) according to their anti-DENV antibody status. RD individuals were seronegative despite high local DENV infection prevalence. Monocytes susceptibility to DENV infection was assessed in vitro. The miRNome profiles of the monocytes from 7 individuals per group were assessed upon mock or DENV-2 infection. The antiviral effect of differentially expressed miRNAs was analyzed using miRNA mimics in HeLa cells followed by infection with DENV-1, DENV-2, DENV-3, and DENV-4 serotypes. We performed RNA-seq on miRNA mimic-transfected cells to identify miRNA-targeted genes interacting with DENV proteins. Monocytes from RD individuals exhibit lower DENV-2 production in vitro. The miRNAs miR-155, miR-132-3p, miR-576-5p were overexpressed in monocytes from RD group upon DENV-2 infection. The transfection of miR-155-5p mimic reduced DENV infection and viral production in HeLa cells, regulating 18 genes interacting with DENV proteins and downregulating target genes involved in interferon response, TP53 regulation, apoptosis, and vesicle trafficking (e.g. HSD17B12, ANXA2). Therefore, we show that monocytes from RD individuals show a distinct miRNA expression profile and reduced viral production. In vitro miR-155-5p upregulation induces an antiviral state, revealing potential therapeutic targets to treat dengue.

Also flagged:endoplasmic reticulumCCL3ERSgene expressionsCD8cell proliferation
Journal Article 2025-02-20 No Snippets Zhu Y, Xu W, He Y, Yang W, Song S, Wen C.
Show Full Abstract

This study investigated ERS-related gene expressions in CESC, identifying two molecular subtypes, P1 and P2, and constructing a precise prognostic model based on these subtypes. TCGA's whole-genome expression profiles were used to recognize these subtypes through the ConsensusClusterPlus method, further refining prognostic models with univariate and Lasso Cox regression analyses validated by the GSE39001 dataset. The study analyzed the expression distribution of ERS marker genes within T cell subgroups using scRNA-seq data (GSE168652), highlighting T cell diversity. The critical role of the CCL3 gene in prognostic models was examined explicitly in CD8 + T cells from healthy individuals and CESC patients. Elevated CCL3 levels were observed in patients' CD8 + T cells compared to healthy controls. Functional experiments involving CCL3 knockdown and overexpression in HeLa and SiHa CESC cell lines were conducted to investigate its impact on cell proliferation, migration, and invasion. These findings were subsequently validated in a nude mouse model. The results demonstrated that suppressing CCL3 inhibited cell proliferation, migration, and invasion significantly, while its overexpression promoted these processes. In the mouse model, CCL3 silencing reduced tumor growth and decreased Ki-67 labeling within the tumor tissues, indicating the therapeutic potential of targeting CCL3 in CESC treatment, possibly through CD8 + T cell regulation. This study contributes new prognostic assessment tools and personalized treatment options for CESC patients, paving the way for more targeted therapies in CESC by discovering the CCL3 gene, presenting significant clinical implications.

Also flagged:sodium dodecyl sulfatepolyacrylamidebindingNS1SUMOsodium phosphate
Journal Article 2025-02-20 No Snippets Gonzales JE, Kim I, Bastiray A, Hwang W, Cho JH.
Show Full Abstract

Viral proteins frequently mutate to evade host innate immune responses, yet the impact of these mutations on the molecular energy landscape remains unclear. Epistasis, the intramolecular communications between mutations, often renders the combined mutational effects unpredictable. Nonstructural protein 1 (NS1) is a major virulence factor of the influenza A virus (IAV) that activates host PI3K by binding to its p85β subunit. Here, we present a deep analysis of the impact of evolutionary mutations in NS1 that emerged between the 1918 pandemic IAV strain and its descendant PR8 strain. Our analysis reveals how the mutations rewired interresidue communications, which underlie long-range allosteric and epistatic networks in NS1. Our findings show that PR8 NS1 binds to p85β with approximately 10-fold greater affinity than 1918 NS1 due to allosteric mutational effects, which are further tuned by epistasis. NMR chemical shift perturbation and methyl-axis order parameter analyses revealed that the mutations induced long-range structural and dynamic changes in PR8 NS1, relative to 1918 NS1, enhancing its affinity to p85β. Complementary molecular dynamics simulations and graph theory-based network analysis for conformational dynamics on the submicrosecond timescales uncover how these mutations rewire the dynamic network, which underlies the allosteric epistasis. Significantly, we find that conformational dynamics of residues with high betweenness centrality play a crucial role in communications between network communities and are highly conserved across influenza A virus evolution. These findings advance our mechanistic understanding of the allosteric and epistatic communications between distant residues and provide insight into their role in the molecular evolution of NS1.

BTN3A3
Also flagged:PSMB4depressionmental disorderTIMP4ITIH1mental disorders
Journal Article 2025-02-20 ✓ 5 Snippets Liu J.
In-Text Gene Mentions

…I found thatBTN3A3and PSMB4 play…

…associated with depression:BTN3A3( P value…

…candidate proteins includingBTN3A3, PSMB4, TIMP4, and…

…PSMB4, TIMP4, ITIH1,BTN3A3, ACAA1, SERPING1 and…

…Among these proteins,BTN3A3( P value…

Show Full Abstract

Depression is a common and severe mental disorder that affects more than 300 million people worldwide. While it is known to have a moderate genetic component, identifying specific genes that contribute to the disorder has been challenging. Previous Genome-wide association studies (GWASs) have identified over 100 genomic loci that are significantly associated with depression. But finding useful therapeutic targets and diagnostic biomarkers from this information has proven difficult. To address this challenge, I conducted a plasma protein proteome-wide association study (PWAS) for depression, using human plasma protein QTL (pQTL) and depression GWAS data. I identified four proteins that were significantly associated with depression: BTN3A3 (P value = 6.41 × 10<sup>-06</sup>), PSMB4 (P value = 1.42 × 10<sup>-05</sup>), TIMP4 (P value = 3.77 × 10<sup>-05</sup>), and ITIH1 (P value = 7.86 × 10<sup>-05</sup>). Specifically, I found that BTN3A3 and PSMB4 play a causal role in depression, as confirmed by colocalization and Mendelian Randomization (MR) analysis. Interestingly, I also discovered that PSMB4 was significantly associated with depression in both the brain proteome studies and the plasma PWAS results, which suggests that it may be a particularly promising candidate for further study. Overall, this work has identified 4 new risk proteins for depression and highlights the potential of plasma proteome data for uncovering novel therapeutic targets and diagnostic biomarkers.

Also flagged:inflammatory responseneurological disorderstraumatic brain injuryneuropsychiatricschizophreniadepression
Journal Article 2025-02-20 No Snippets Hoeferlin GF, Grabinski SE, Druschel LN, Duncan JL, Burkhart G, Weagraff GR, Lee AH, Hong C, Bambroo M, Olivares H, Bajwa T, Coleman J, Li L, Memberg W, Sweet J, Hamedani HA, Acharya AP, Hernandez-Reynoso AG, Donskey C, Jaskiw G, Ricky Chan E, Shoffstall AJ, Bolu Ajiboye A, von Recum HA, Zhang L, Capadona JR.
Show Full Abstract

Brain-machine interface performance can be affected by neuroinflammatory responses due to blood-brain barrier (BBB) damage following intracortical microelectrode implantation. Recent findings suggest that certain gut bacterial constituents might enter the brain through damaged BBB. Therefore, we hypothesized that damage to the BBB caused by microelectrode implantation could facilitate microbiome entry into the brain. In our study, we found bacterial sequences, including gut-related ones, in the brains of mice with implanted microelectrodes. These sequences changed over time. Mice treated with antibiotics showed a reduced presence of these bacteria and had a different inflammatory response, which temporarily improved microelectrode recording performance. However, long-term antibiotic use worsened performance and disrupted neurodegenerative pathways. Many bacterial sequences found were not present in the gut or in unimplanted brains. Together, the current study established a paradigm-shifting mechanism that may contribute to chronic intracortical microelectrode recording performance and affect overall brain health following intracortical microelectrode implantation.

Also flagged:gadoliniumpolyethylene glycolcholesterolmatrix metalloproteinase-13MMP13cartilage-
Journal Article 2025-02-20 No Snippets Xu J, Zhang Y, Lin M, Ma B, He H, Jiang F, He S, Yuan C.
Show Full Abstract

Early detection of cartilage injuries is crucial due to their limited self-repair capacity and risk of joint dysfunction. Conventional contrast agents like gadolinium-diethylenetriamine-pentaacetic acid (Gd-DTPA) offer low specificity and T1 relaxivity (r1), limiting MRI application. This study introduces NaGdF<sub>4</sub> nanoparticles (NPs) modified with polyethylene glycol (PEG) and cholesterol (CLS) to enhance hydrophilicity and lipophilicity. Targeting is achieved using a matrix metalloproteinase-13 (MMP13) cartilage-binding peptide. NaGdF<sub>4</sub>@PEG-CLS@MMP13 CBP NPs demonstrate an increased r1 value (8.07 mM<sup>-1</sup> s<sup>-1</sup>) compared to NaGdF<sub>4</sub>@PEG-CLS NPs (6.65 mM<sup>-1</sup> s<sup>-1</sup>) and Gd-DTPA (3.01 mM<sup>-1</sup> s<sup>-1</sup>), enabling deeper cartilage penetration and stronger cartilage affinity. Two hours post-injection, these NPs improved the signal-to-noise ratio at injury sites by 2.4-fold over pre-injection values. Biocompatibility was confirmed with no adverse effects in blood or organs, and the NPs were metabolized in kidneys and liver, with excretion via urine. This study supports NaGdF<sub>4</sub>@PEG-CLS@MMP13 CBP NPs as an effective MRI contrast agent, enhancing early detection of cartilage injuries.

Also flagged:transcription factoropioid dependenceL3MBTL3EPB41L2CREB1CTNNB1
Journal Article 2025-02-20 No Snippets Liu S, Gunzler DD, Gunzler SA, Crawford DC, Briggs FBS.
Show Full Abstract

Pain is a common and complex non-motor symptom in people with Parkinson's disease (PWP). Little is known about the genetic drivers of pain in PWP, and progress in its study has been challenging. Here, we conducted two genome-wide association studies (GWAS) to identify genetic variants associated with pain experienced during the earliest stages of Parkinson's disease. The study population consisted of 4,159 PWP of European ancestry who were mapped to five previously-described, longitudinal pain trajectories. In the first GWAS, the extreme pain trajectories (highest burden versus no significant pain over time) were compared, and in the second GWAS, a multinomial approach was undertaken. While no variant reached genome-wide significance, we identified promising associations, such as rs117108018 (OR<sub>GWAS-Extreme</sub>=8.96, p<sub>GWAS-Extreme</sub>=2.5 × 10<sup>- 7</sup>), a brain/nerve eQTL for L3MBTL3 and EPB41L2, and rs61881484 (p<sub>GWAS-Multinomial</sub>=2 × 10<sup>- 7</sup>), which intersects a transcription factor peak targeting CREB1, critical in sensory neuron synaptic plasticity and neuropathic pain regulation. Gene-based tests implicated CTNNB1 (p<sub>GWAS-Extreme</sub>=3.2 × 10<sup>- 5</sup>), KLK7 (p<sub>GWAS-Extreme</sub>=7 × 10<sup>- 5</sup>), and SLITRK3 (p<sub>GWAS-Multinomial</sub>=3.2 × 10<sup>- 5</sup>), which have been associated with neurodevelopment. At the pathway-level, there was an enrichment for genes involved in neurotransmitter regulation and opioid dependence. This study implicates neuropathic pain mechanisms as prominent drivers of elevated pain in PWP, suggests potential therapeutic genetic targets for further research.

Also flagged:tumoursegmentationorganizationvisionlungTumor
Journal Article 2025-02-20 No Snippets Tan J, Le H, Deng J, Liu Y, Hao Y, Hollenberg M, Liu W, Wang JM, Xia B, Ramaswami S, Mezzano V, Loomis C, Murrell N, Moreira AL, Cho K, Pass HI, Wong KK, Ban Y, Neel BG, Tsirigos A, Fenyö D.
Show Full Abstract

High-dimensional multiplexed imaging can reveal the spatial organization of tumour tissues at the molecular level. However, owing to the scale and information complexity of the imaging data, it is challenging to discover and thoroughly characterize the heterogeneity of tumour microenvironments. Here we show that self-supervised representation learning on data from imaging mass cytometry can be leveraged to distinguish morphological differences in tumour microenvironments and to precisely characterize distinct microenvironment signatures. We used self-supervised masked image modelling to train a vision transformer that directly takes high-dimensional multiplexed mass-cytometry images. In contrast with traditional spatial analyses relying on cellular segmentation, the vision transformer is segmentation-free, uses pixel-level information, and retains information on the local morphology and biomarker distribution. By applying the vision transformer to a lung-tumour dataset, we identified and validated a monocytic signature that is associated with poor prognosis.

HTT
Also flagged:laminopathiesdeathcanceraginglamin Aenvelope
Journal Article 2025-02-20 ✓ 1 Snippet Waldherr A, Fogtman A.
In-Text Gene Mentions

…, USH ,HTT, DMD ,…

Show Full Abstract

Ionizing radiation causes three divergent effects in the human body: On one side, tissue death (= deterministic effects) sets on, on the other side, mutations and cancer growth (= stochastic effects) can occur. In recent years, the additional phenomenon of accelerated aging has come to light. In the following, we argue that these seemingly contradictory radiation responses namely: (i) increased cancer growth, (ii) ablation of cancer tissue or (iii) deterministic senescence, share an underlying cause from damage at the lamin A C-terminus. In other words, besides the typically described genomic radiation impact, we propose an additional destabilization pathway via oxidation at the nuclear envelope. We propose five concrete hypotheses that draw a direct mechanistic model from radiation damage and cellular oxidative stress, to micronuclei and clinical symptoms. In conjunction with lamin B compensation, we might be able to explain why deterministic or stochastic responses dominate. If our model holds true, a novel target for radiotherapeutics and radiooncology arises, and a rationale to closer connect laminopathy and radioprotection research.

SERPINC1
Also flagged:Venous thrombosisdeep vein thrombosisDVTpulmonary embolismThrombophiliagenetic disorders
Journal Article 2025-02-20 ✓ 1 Snippet Assar M, Nilius H, Kearn N, Hopman W, Nagler M, Othman M.
In-Text Gene Mentions

…ealthineers), D‐dimer (Vidas),ATIII(functional assay), protein…

Show Full Abstract

<h4>Introduction</h4>Thrombophilia, a blood coagulation disorder, poses risks of venous thromboembolism (VTE). Coagulation assays may not be sufficient to assess VTE risk and global assays such as Rotational Thromboelastometry (ROTEM) may add valuable information. We investigated ROTEM's capacity to detect hypercoagulability in patients undergoing thrombophilia screening, its potential impact on patient outcomes, and limitations.<h4>Methods</h4>Comprehensive clinical, laboratory, genetic tests, and ROTEM (EXTEM and INTEM) were conducted for 356 patients referred for thrombophilia screening at an academic hospital outpatient unit. Hypercoagulability was identified as a shorter clot formation time (CFT), larger alpha angle (AA), and greater maximum clot firmness (MCF), and was compared in patients with and without VTE. Statistically this was analyzed using Mann-Whitney U and Chi-square tests with p < 0.05 considered significant.<h4>Results</h4>Among 356 patients, 64.6% had previous VTE, with 76.9% experiencing one event, 14.3% recurrent (35.6% unprovoked, 64.4% provoked). 22.5% of patients were on anticoagulation. Those with VTE history exhibited significant alterations in EXTEM and INTEM parameters compared to those without (p < 0.001), showing decreased CFT and increased AA and MCF. However, receiver operating characteristic curves for these variables indicated that none were able to discriminate between those individuals with and without thromboembolic complications.<h4>Conclusion</h4>ROTEM does not appear to be a strong discriminatory test. However, it can detect hypercoagulopathy in patients referred for thrombophilia screening. Abnormal ROTEM may indicate a higher risk for recurrence. However, this can only be determined in prospective cohort studies.

Also flagged:congenital heart diseasepathogenesisdefectretinitis pigmentosaBardet-Biedl syndrome1
Journal Article 2025-02-20 No Snippets Kars ME, Stein D, Stenson PD, Cooper DN, Chung WK, Gruber PJ, Seidman CE, Shen Y, Tristani-Firouzi M, Gelb BD, Itan Y.
Show Full Abstract

Congenital heart disease (CHD) is the most common congenital anomaly and a leading cause of infant morbidity and mortality. Despite extensive exploration of the monogenic causes of CHD over the last decades, ∼55% of cases still lack a molecular diagnosis. Investigating digenic interactions, the simplest form of oligogenic interactions, using high-throughput sequencing data can elucidate additional genetic factors contributing to the disease. Here, we conducted a comprehensive analysis of digenic interactions in CHD by utilizing a large CHD trio exome sequencing cohort, comprising 3,910 CHD and 3,644 control trios. We extracted pairs of presumably deleterious rare variants observed in CHD-affected and unaffected children but not in a single parent. Burden testing of gene pairs derived from these variant pairs revealed 29 nominally significant gene pairs. These gene pairs showed a significant enrichment for known CHD genes (p < 1.0 × 10<sup>-4</sup>) and exhibited a shorter average biological distance to known CHD genes than expected by chance (p = 3.0 × 10<sup>-4</sup>). Utilizing three complementary biological relatedness approaches including network analyses, biological distance calculations, and candidate gene prioritization methods, we prioritized 10 final gene pairs that are likely to underlie CHD. Analysis of bulk RNA-sequencing data showed that these genes are highly expressed in the developing embryonic heart (p < 1 × 10<sup>-4</sup>). In conclusion, our findings suggest the potential role of digenic interactions in CHD pathogenesis and provide insights into unresolved molecular diagnoses. We suggest that the application of the digenic approach to additional disease cohorts will significantly enhance genetic discovery rates.

TNFSF4
Also flagged:EZH1EZH2ACTcancerB cell lymphomaCD19
Journal Article 2025-02-20 ✓ 1 Snippet Porazzi P, Nason S, Yang Z, Carturan A, Ghilardi G, Guruprasad P, Patel RP, Tan M, Padmanabhan AA, Lemoine J, Fardella E, Zhang Y, Pajarillo R, Chen L, Ugwuanyi O, Markowitz K, Delman D, Angelos MG, Shestova O, Isshiki Y, Blanchard T, Béguelin W, Melnick AM, Linette GP, Beatty GL, Carreno BM, Cohen IJ, Paruzzo L, Schuster SJ, Ruella M.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Tumor resistance to chimeric antigen receptor T cell (CAR-T) and, in general, to adoptive cell immunotherapies (ACTs) is a major challenge in the clinic. We hypothesized that inhibiting the tumor drivers' methyltransferases EZH2 and EZH1 could enhance ACT by rewiring cancer cells to a more immunogenic state. In human B cell lymphoma, EZH2 inhibition (tazemetostat) improved the efficacy of anti-CD19 CAR-T by enhancing activation, expansion, and tumor infiltration. Mechanistically, tazemetostat-treated tumors showed upregulation of genes related to adhesion, B cell activation, and inflammatory responses, and increased avidity to CAR-T. Furthermore, tazemetostat improved CAR- and TCR-engineered T cell efficacy in multiple liquid (myeloma and acute myeloid leukemia) and solid (sarcoma, ovarian, and prostate) cancers. Lastly, combined EZH1/EZH2 inhibition (valemetostat) further boosted CAR-T efficacy and expansion in multiple cancers. This study shows that EZH1/2 inhibition reprograms tumors to a more immunogenic state and potentiates ACT in preclinical models of both liquid and solid cancers.

OLFM4
Also flagged:olfactomedin 4sepsisinflammatory responsesinfectionsneonatal sepsispolymerase
Journal Article 2025-02-20 ✓ 3 Snippets Mai DN, Nguyen Thi MA, Nguyen TT, Vu HA, Nguyen PNT.
In-Text Gene Mentions

…ackground</h4>Olfactomedin 4 (OLFM4) gene polymorphisms have…

…the association betweenOLFM4single nucleotide polymorphism…

… 0.03).<h4>Conclusions</h4>TheOLFM4rs17552047 AA/AG and…

Show Full Abstract

<h4>Background</h4>Olfactomedin 4 (OLFM4) gene polymorphisms have been associated with variations in inflammatory responses and the severity of infections. This study aimed to investigate the association between OLFM4 single nucleotide polymorphisms (SNPs) rs17552047 and rs1891944 and severe outcomes in preterm neonatal sepsis.<h4>Methods</h4>A prospective observational cohort study was conducted from April 2023 to April 2024, involving all preterm infants diagnosed with neonatal sepsis. Genotyping was performed using real-time polymerase chain reaction, and the associations with severe outcomes were analyzed using genetic models (dominant, recessive, and additive) through multivariate logistic regression and survival analysis.<h4>Results</h4>Among the 174 preterm newborns included in the study, 39 experienced severe outcomes. The AA/AG genotypes of SNP rs17552047 and TT/TC genotypes of rs1891944 were associated with a reduced risk of severe outcomes (adjusted hazard ratio: 0.271, 95 % confidence interval [CI]: 0.115-0.641, p = 0.003, and adjusted hazard ratio: 0.349, 95 % CI: 0.175-0.698, p = 0.003, respectively). The odds of severe outcomes decreased by 65 % for each additional A allele (95 % CI: 0.15-0.78, p = 0.01). The model incorporating both SNPs and clinical variables demonstrated good predictive capability (area under the receiver operating characteristic curve: 0.826, 95 % CI: 0.748-0.903, p = 0.03).<h4>Conclusions</h4>The OLFM4 rs17552047 AA/AG and rs1891944 TT/TC genotypes have been linked to favorable outcomes in neonatal sepsis. These SNPs hold promise for predicting severe outcomes in neonatal sepsis.

SERPINC1
Also flagged:Hemophiliahemostasisbleeding disorderscoagulation factor VIIIFIXhepatitis B
Journal Article 2025-02-20 ✓ 1 Snippet Lewandowska M, Nasr S, Shapiro AD.
In-Text Gene Mentions

…This silences antithrombinSERPINC1gene expression and…

Show Full Abstract

In recent years, gene therapy and bio-engineered hemostatic molecules have revolutionized treatment for people with hemophilia. These innovative therapies aim to decrease treatment burden and improve patient quality of life. Additional novel therapies, including next-generation mimetics and agents that rebalance hemostasis, are currently being evaluated in clinical trials. Technological advances such as point-of-care musculoskeletal ultrasound and artificial intelligence may improve patient diagnostic and treatment outcomes. However, for the majority of patients with hemophilia worldwide, diagnosis and effective treatment are inaccessible. Achieving health equity for all hemophilia patients requires improved identification of barriers to optimal care, including socioeconomic status, race/ethnicity, gender, disease severity, inhibitor status, age, and use of Hemophilia Treatment Centers. Access to novel hemophilia therapies should be ensured for all patients. Approaches to improving equity include a decision-making partnership between the patient and clinician, stakeholder engagement, and pharmaceutical industry support. The development of novel hemophilia therapies should be leveraged with a patient-centered care approach to improve health equity for all patients.

PRDX6
Also flagged:polyacrylamideperoxiredoxin 2alpha-internexindeathmajor depressive disordersubstance abuse
Journal Article 2025-02-20 ✓ 1 Snippet Rojo-Romero MA, Gutiérrez-Nájera NA, Cruz-Fuentes CS, Romero-Pimentel AL, Mendoza-Morales R, García-Dolores F, Morales-Marín ME, Castro-Martínez X, González-Sáenz E, Torres-Campuzano J, Medina-Sánchez T, Hernández-Fonseca K, Nicolini-Sánchez H, Jiménez-García LF.
In-Text Gene Mentions

…In addition,PRDX6was also found…

Show Full Abstract

<h4>Introduction</h4>Suicide is a significant public health problem, with increased rates in low- and middle-income countries such as Mexico; therefore, suicide prevention is important. Suicide is a complex and multifactorial phenomenon in which biological and social factors are involved. Several studies on the biological mechanisms of suicide have analyzed the proteome of the dorsolateral prefrontal cortex (DLPFC) in people who have died by suicide. The aim of this work was to analyze the protein expression profile in the DLPFC of individuals who died by suicide in comparison to age-matched controls in order to gain information on the molecular basis in the brain of these individuals and the selection of potential biomarkers for the identification of individuals at risk of suicide. In addition, this information was analyzed using machine learning (ML) algorithms to propose a model for predicting suicide.<h4>Methods</h4>Brain tissue (Brodmann area 9) was sampled from male cases (n=9) and age-matched controls (n=7). We analyzed the proteomic differences between the groups using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. Bioinformatics tools were used to clarify the biological relevance of the differentially expressed proteins. In addition, this information was analyzed using machine learning (ML) algorithms to propose a model for predicting suicide.<h4>Results</h4>Twelve differentially expressed proteins were also identified (<i>t</i> <sub>14</sub> ≤ 0.5). Using Western blotting, we validated the decrease in expression of peroxiredoxin 2 and alpha-internexin in the suicide cases. ML models were trained using densitometry data from the 2D gel images of each selected protein and the models could differentiate between both groups (control and suicide cases).<h4>Discussion</h4>Our exploratory pathway analysis highlighted oxidative stress responses and neurodevelopmental pathways as key processes perturbed in the DLPFC of suicides. Regarding ML models, KNeighborsClassifier was the best predicting conditions. Here we show that these proteins of the DLPFC may help to identify brain processes associated with suicide and they could be validated as potential biomarkers of this outcome.

VRK2
Also flagged:AFG3L2mitochondrialproteasesspinocerebellar ataxia type 28spastic ataxia 5spastic ataxia
Journal Article 2025-02-20 ✓ 3 Snippets Oeztuerk M, Herebian D, Dipali K, Hentschel A, Rademacher N, Kraft F, Horvath R, Distelmaier F, Meuth SG, Ruck T, Schara-Schmidt U, Roos A.
In-Text Gene Mentions

…Containing 12) andVRK2(Vaccinia Related Kinase…

…Similarly,VRK2, a kinase involved…

VRK2is known to…

Show Full Abstract

Mitochondrial integrity is fundamental to cellular function, upheld by a network of proteases that regulate proteostasis and mitochondrial dynamics. Among these proteases, AFG3L2 is critical due to its roles in maintaining mitochondrial homeostasis, regulating mitochondrial protein quality, and facilitating mitochondrial biogenesis. Mutations in AFG3L2 are implicated in a spectrum of diseases, including spinocerebellar ataxia type 28 (SCA28) and spastic ataxia 5 (SPAX5), as well as other systemic conditions. This study employs a multi-omics approach to investigate the biochemical impact of AFG3L2 mutations in immortalized lymphoblastoid cell lines derived from a patient with biallelic variants leading to spastic ataxia (SPAX5). Our proteomic analysis revealed AFG3L2 impairment, with significant dysregulation of proteins critical for mitochondrial function, cytoskeletal integrity, and cellular metabolism. Specifically, disruptions were observed in mitochondrial dynamics and calcium homeostasis, alongside downregulation of key proteins like COX11, a copper chaperone for complex IV assembly, and NFU1, an iron-sulfur cluster protein linked to spastic paraparesis and infection-related worsening. Lipidomic analysis highlighted substantial alterations in lipid composition, with significant decreases in sphingomyelins, phosphatidylethanolamine, and phosphatidylcholine, reflecting disruptions in lipid metabolism and membrane integrity. Metabolomic profiling did not reveal any significant findings. Our comprehensive investigation into loss of functional AFG3L2 elucidates a pathophysiology extending beyond mitochondrial proteostasis, implicating a wide array of cellular processes. The findings reveal substantial cellular disturbances at multiple levels, contributing to neurodegeneration through disrupted mitochondrial respiratory chain, calcium homeostasis, cytoskeletal integrity, and altered lipid homeostasis. This study underscores the complexity of SPAX5 pathophysiology and the importance of multi-omics approaches in developing effective strategies to address the impact of loss of functional AFG3L2. Our data also highlight the value of immortalized lymphoblastoid cells as a tool for pre-clinical testing and research, offering a detailed biochemical fingerprint that enhances our understanding of SPAX5 and identifies potential areas for further investigation.

Also flagged:injurysecretionlocomotioncollagenoxygeninfection
Journal Article 2025-02-20 No Snippets Zhou H, Chen Y, Yan W, Chen X, Zi Y.
Show Full Abstract

Tendon and enthesis injuries are a global health problem affecting millions of people, causing huge medical expenditure and labor loss every year. However, due to their intricate tissue architecture, unique mechanical properties, and especially their sluggish and limited innate regenerative capacity, repairing these injuries remains a formidable clinical challenge. Here, we present a comprehensive review of biomaterials advances in tendon and enthesis repair recently. These biomaterials are categorized into two primary groups based on their potential clinical application conditions: biomaterials for T/E repairing and biomaterials for T/E replacement. The T/E repairing biomaterials were further divided into two groups: mechanical-enhanced biomaterials and bioactive biomaterials, according to the approaches they used to improve sutured tendon healing. We delve into the characteristics and underlying mechanisms of these various biomaterials to gain a deeper understanding of the current landscape in tendon and enthesis repair biomaterials. This review aims to highlight the prominent advancements while identifying the remaining gaps, ultimately inspiring future biomaterial design strategies.

B4GALT5
Also flagged:behavioralglucosemetabolismimmune responsesto Thermallocomotion
Journal Article 2025-02-20 ✓ 1 Snippet Lin T, Meegaskumbura M.
In-Text Gene Mentions

…; miR-301a-3p targetsB4GALT5; and GALNT13…

Show Full Abstract

In the context of global warming, heat tolerance is becoming a crucial physiological trait influencing fish species' distribution and survival. While our understanding of fish heat tolerance and stress has expanded from behavioral studies to transcriptomic analyses, knowledge at the transcriptomic level is still limited. Recently, the highly conserved microRNAs (miRNAs) have provided new insights into the molecular mechanisms of heat stress in fish. This review systematically examines current research across three main reference databases to elucidate the universal responses and mechanisms of fish miRNAs under heat stress. Our initial screening of 569 articles identified 13 target papers for comprehensive analysis. Among these, at least 214 differentially expressed miRNAs (DEMs) were found, with 15 DEMs appearing in at least two studies (12 were upregulated and 13 were downregulated). The 15 recurrent DEMs were analyzed using DIANA mirPath v.3 and the microT-CDS v5.0 database to identify potential target genes. The results suggest that multiple miRNAs target various genes, forming a complex network that regulates glucose and energy metabolism, maintains homeostasis, and modulates inflammation and immune responses. Significantly, <i>miR-1</i>, <i>miR-122</i>, <i>let-7a</i>, and <i>miR-30b</i> were consistently differentially expressed in multiple studies, indicating their potential relevance in heat stress responses. However, these miRNAs should not be considered definitive biomarkers without further validation. Future research should focus on experimentally confirming their regulatory roles through functional assays, conducting transcriptomic comparisons across different species, and performing target validation studies. These miRNAs, conserved across species, could be valuable for monitoring wild fish health, enhancing aquaculture breeding, and guiding conservation strategies. However, the specific regulatory mechanisms of these miRNAs need clarification to confirm their reliability as biomarkers for thermal stress.

PTGIS
Also flagged:Prostaglandinslumenmeloxicamlipidvesicle-mediatedimmune response
Journal Article 2025-02-20 ✓ 1 Snippet Zhang B, Han Y, Wang S, Cheng M, Yan L, Zhou D, Wang A, Lin P, Jin Y.
In-Text Gene Mentions

…PG synthases (PTGS2,PTGIS, PTGES, PTGFS) in…

Show Full Abstract

In ruminants, the survival and development of the conceptus are heavily dependent on the composition of the uterine lumen fluid (ULF), which is influenced by prostaglandins (PGs). However, the variations in underlying PG-mediated ULF remain unclear. Herein, cycling heifers received an intrauterine infusion of vehicle as a control (CON) or meloxicam (MEL) on days 12-14 of the estrous cycle. Then, the ULF was collected on day 15 and alternations in its protein and lipid levels were analyzed. The suppression of prostaglandins induced by meloxicam resulted in 1343 differentially abundant proteins (DAPs) and 59 differentially altered lipids. These DAPs were primarily associated with vesicle-mediated transport, immune response, and actin filament organization, and were mainly concentrated on the ribosome, complement and coagulation cascades, cholesterol metabolism, chemokine signal pathway, regulation of actin cytoskeleton and starch and sucrose metabolism. These differential lipids reflected a physiological metabolic shift as the abundance of cell membrane-related lipids was modulated, including an accumulation of triacylglycerols and reductions in lysophosphatidylcholines, hexosyl ceramides, ceramides, and sphingomyelins species. Integration analysis of the DAPs and differentially altered lipid metabolites revealed that glycerophospholipid metabolism and choline metabolism were the core pathways. These findings highlight the potential roles of prostaglandins in ULF, providing new insights into the contributions of prostaglandins in the development of the conceptus.

HTT
Also flagged:DepressionAnxietyPsoriasisinflammatory diseasesubstance abusebipolar disorder
Journal Article 2025-02-20 ✓ 2 Snippets Siteneski A, Montes-Escobar K, de la Hoz-M J, Lapo-Talledo GJ, Gutiérrez Moreno G, Carlin Chavez E, Caicedo Quiroz R, Borja-Cabrera GP.
In-Text Gene Mentions

…of serotonin transporters (5-HTT) [ 7 ].…

…positive regulation of5-HTT[ 59 ,…

Show Full Abstract

<b>Background:</b> Patients with psoriasis often experience psychiatric comorbidities, such as depression and anxiety. These comorbidities can lead to poorer adherence to treatment regimens, reduced effectiveness of therapies, and a heightened disease burden. This study aims to explore the scientific output related to psoriasis, depression, and anxiety using a comprehensive analysis combining bibliometric statistical methods. <b>Methods:</b> The study performed a bibliometric analysis of publications related to psoriasis, depression, and anxiety between 1974 and December 2023. This study employed the Latent Dirichlet Allocation (LDA) algorithm to identify key research topics and used the HJ-Biplot technique to visualize the relationships between publications and research indicators. The inclusion criteria were limited to English-language research articles. <b>Results:</b> Over 49 years, the analysis identified 5059 documents published across 1151 sources. The annual growth rate for research was 12.26%. <i>The Journal of the European Academy of Dermatology and Venereology</i> and <i>The British Journal of Dermatology</i> were found to be the leading journals in this field. The United States emerged as the top contributor, followed by China, Italy, and Germany. The most prevalent research topics were inflammation and cellular function, with a significant focus on patient treatment and the impact of depression and anxiety. <b>Conclusions:</b> This bibliometric analysis underscores the increasing of studies on the comorbidities of depression and anxiety in patients with psoriasis. This study provides a comprehensive overview of research trends and emerging topics in this field, offering valuable insights for future investigations.

HFE
Also flagged:ironoxygenmenopauseneurodegenerative diseasecognitioniron deficiency
Journal Article 2025-02-20 ✓ 1 Snippet Barnett AL, Wenger MJ, Miles P, Wu D, Isingizwe ZR, Benbrook DM, Yuan H.
In-Text Gene Mentions

…iron overload (possiblehemochromatosis, sFt > 150…

Show Full Abstract

<h4>Background</h4>The literature on the relationships among blood iron levels, cognitive performance, and brain iron levels specific to women at the menopausal transition is ambiguous at best. The need to better understand these potential relationships in women for whom monthly blood loss (and thus iron loss) is ceasing is highlighted by iron's accumulation in brain tissue over time, thought to be a factor in the development of neurodegenerative disease.<h4>Methods</h4>Non-anemic women who were either low in iron or had normal iron levels for their age and race/ethnicity provided blood samples, underwent MRI scans to estimate brain iron levels, and performed a set of cognitive tasks with concurrent EEG.<h4>Results</h4>Cognitive performance and brain dynamics were positively related to iron levels, including measures associated with oxygen transport. There were no relationships between any of the blood measures of iron and brain iron.<h4>Conclusions</h4>Higher iron status was associated with better cognitive performance in a sample of women who were neither iron deficient nor anemic, without there being any indication that higher levels of systemic iron were related to higher levels of brain iron. Consequently, addressing low iron levels at the menopausal transition may be a candidate approach for alleviating the "brain fog" commonly experienced at menopause.

TNFSF4
Also flagged:tumorcancerliver cancerDecitabineMEKBCL-XL
Journal Article 2025-02-20 ✓ 1 Snippet Cannet F, Sequera C, Veloso PM, El Kaoutari A, Methia M, Richelme S, Kaya M, Cherni A, Dupont M, Borg JP, Morel C, Boursier Y, Maina F.
In-Text Gene Mentions

…Cd86 , Ox40L (Tnfsf4) , Galectin9 (…

Show Full Abstract

Immune cells within the tumor microenvironment impact cancer progression, resistance, response to treatments. Despite remarkable outcomes for some cancer patients, immunotherapies remain unsatisfactory for others. Here, we designed an experimental setting using the <i>Alb-R26</i> <sup><i>Met</i></sup> "inside-out" mouse model, faithfully recapitulating molecular features of liver cancer patients, to explore the effects of distinct anticancer targeted therapies on the tumor immune landscape. Using two treatments in clinical trials for different cancer types, Decitabine and MEK+BCL-XL blockage, we show their capability to trigger tumor regression in <i>Alb-R26</i> <sup><i>Met</i></sup> mice and to superimpose distinct profiles of immune cell types and immune-checkpoints, impacting immunotherapy response. A machine learning approach processing tumor imaging and immune profile data identified a putative signature predicting tumor treatment response in mice and patients. Outcomes exemplify how the tumor immune microenvironment is differentially reshaped by distinct anticancer agents and highlight the importance of measuring its modulation during treatment to optimize oncotherapy and immunotherapy combinations.

Also flagged:heparinfolic aciddexamethasonedoxorubicinfolate receptorsynthesis
Journal Article 2025-02-20 No Snippets Emami J, Kazemi M, Mirian M.
Show Full Abstract

<h4>Background and purpose</h4>Biodegradable polymeric micelles have emerged as one of the most promising platforms for targeted drug delivery. In the present study, a polymeric micelle composed of folic acid (FA), heparin (HEP), dexamethasone (DEX), and (FA-PEG-HEP-CA-TOC) was developed for the delivery of doxorubicin (DOX) to leukemic cells.<h4>Experimental approach</h4>FA-HEP-DEX was synthesized and characterized by 1H-NMR. DOX-loaded micelles were prepared using a dialysis method. The impact of various processing variables, including polymer-to-drug ratio, dialysis temperature, and solvent type, on the physicochemical properties of the micelles were evaluated. In vitro, cellular uptake and cytotoxicity of the micelles in folate receptor-positive (K562) and negative (HepG2) cells were evaluated.<h4>Findings/results</h4>The 1H-NMR results confirmed the successful synthesis of FA-HEP-DEX. DOX-loaded micelles exhibited an average particle size of 117 to 181 nm with a high drug entrapment efficiency (36% to 71%). DOX-loaded micelles also showed sustained drug-release behavior. DOX-loaded FA-HEP-DEX micelles exhibited higher cellular uptake and <i>in vitro</i> cytotoxicity than free DOX and DOX-loaded HEP-DEX micelles in K562 cells.<h4>Conclusions and implications</h4>DOX was well incorporated into the micelles with high entrapment efficiency due to high solubility of DOX in DEX as the hydrophobic component of the micelle structure. The higher cellular uptake and cell toxicity of targeted micelles correspond to the presence of FA on the micelle surface, which promotes cell internalization of the micelles <i>via</i>specific receptor-mediated endocytosis. Our results indicated the potential of DOX-loaded heparin-based micelles with desirable antitumor activity as a targeted drug delivery system in cancer therapy.

Also flagged:IGF2BP1N6-methyladenosinegene expressionlocalizationmethyltransferasedemethylase
Journal Article 2025-02-20 No Snippets Qiu L, Wu S, Zhang L, Li W, Xiang D, Kasim V.
Show Full Abstract

N6-methyladenosine (m6A) is the most abundant and well-investigated internal RNA modification in eukaryotic RNAs, affecting its target gene expression by controlling RNA localization, splicing, stability, and translation. m6A modifications are regulated by m6A methyltransferase complex, demethylase, and reading proteins. Insulin-like growth factor-2 mRNA-binding protein 1 (IGF2BP1), a member of a conserved family of single-stranded RNA-binding proteins, has recently been identified as a vital m6A reading protein. IGF2BP1 is highly expressed in various tumors and is associated with poor prognosis and treatment resistance. Furthermore, previous studies have shown that IGF2BP1 plays critical roles in regulating various cancer hallmarks, including sustained cell proliferation, cell death resistance, activation of invasion and metastasis, deregulated cellular energetics, immune evasion, and unlocking phenotypic plasticity. IGF2BP1 could promote the expression of cancer-related genes by recognizing their m6A sites, thereby altering cell characteristics, and eventually, malignancy. Therefore, IGF2BP1 might be a potential target for tumor diagnosis and anti-tumor therapeutic strategies. This review summarizes the current knowledge on the functional roles and underlying molecular mechanisms of IGF2BP1 in regulating cancer hallmarks. Moreover, we discuss the prospects of IGF2BP1 as a potential tumor diagnosis marker, as well as a potential target for an anti-tumor therapeutic strategy.

Also flagged:tubulindolastatins 10Antibodyconjugationorganellesapratoxin
Journal Article 2025-02-19 No Snippets Luesch H, Ellis EK, Chen QY, Ratnayake R.
Show Full Abstract

Covering 2010-April 2024There have been tremendous new discoveries and developments since 2010 in anticancer research based on marine cyanobacteria. Marine cyanobacteria are prolific sources of anticancer natural products, including the tubulin agents dolastatins 10 and 15 which were originally isolated from a mollusk that feeds on cyanobacteria. Decades of research have culminated in the approval of six antibody-drug conjugates (ADCs) and many ongoing clinical trials. Antibody conjugation has been enabling for several natural products, particularly cyanobacterial cytotoxins. Targeting tubulin dynamics has been a major strategy, leading to the discovery of the gatorbulin scaffold, acting on a new pharmacological site. Cyanobacterial compounds with different mechanisms of action (MOA), targeting novel or validated targets in a range of organelles, also show promise as anticancer agents. Important advances include the development of compounds with novel MOA, including apratoxin and coibamide A analogues, modulating cotranslational translocation at the level of Sec61 in the endoplasmic reticulum, largazole and santacruzamate A targeting class I histone deacetylases, and proteasome inhibitors based on carmaphycins, resembling the approved drug carfilzomib. The pipeline extends with SERCA inhibitors, mitochondrial cytotoxins and membrane-targeting agents, which have not yet advanced clinically since the biology is less understood and selectivity concerns remain to be addressed. In addition, efforts have also focused on the identification of chemosensitizing and antimetastatic agents. The review covers the state of current knowledge of marine cyanobacteria as anticancer agents with a focus on the mechanism, target identification and potential for drug development. We highlight the importance of solving the supply problem through chemical synthesis as well as illuminating the biological activity and in-depth mechanistic studies to increase the value of cyanobacterial natural products to catalyze their development.

Also flagged:SARS-CoV-2 infectionangiotensin-converting enzyme 2ACE2transmembrane protease serine 2TMPRSS2infection
Journal Article 2025-02-19 No Snippets Liu A, Ruetalo N, Raja Xavier JP, Lankapalli AK, Admard J, Camarena-Sainz M, Brucker SY, Singh Y, Schindler M, Salker MS.
Show Full Abstract

Vertical transmission of SARS-CoV-2 during human pregnancy remains highly controversial as most studies have focused on the third trimester or the peripartum period. Given the lack of early trimester data, determining the prevalence of vertical transmission during early pregnancy and assessing the potential risks for fetal morbidity and mortality pose a challenge. Therefore, we analysed the impact of SARS-CoV-2 infection on an endometrial 3D spheroid model system. The 3D spheroids are capable of decidualization and express angiotensin-converting enzyme 2 (ACE2) as well as transmembrane protease serine 2 (TMPRSS2), rendering them susceptible to SARS-CoV-2 infection. Employing this 3D cell model, we identified that SARS-CoV-2 can infect both non-decidualized and decidualized endometrial spheroids. Infection significantly increased the chemokine Monocyte chemoattractant protein-1 (MCP-1) compared to non-infected spheroids. Decidualized spheroids exhibited upregulated Interleukin (IL)-8 levels. Furthermore, RNA sequencing revealed dysregulation of several genes involved in tissue-specific immune response, Fc receptor signalling, angiotensin-activated signalling and actin function. Gene expression changes varied between SARS-CoV-2 infected non-decidualized and decidualized spheroids and genes associated with the innate immune system (CD38, LCN2 and NR4A3) were dysregulated as a potential mechanism for immune evasion of SARS-CoV-2. Altogether, our study demonstrates that endometrial spheroids are a useful model to examine the clinical implications of SARS-CoV-2 vertical transmission, warranting further investigations.

Also flagged:nucleuscytoplasm-mediated mRNA decayUpcytoplasmicresponse to cellular stress
Journal Article 2025-02-19 No Snippets McMahon M, Maquat LE.
Show Full Abstract

Discovered more than four decades ago, nonsense-mediated mRNA decay (NMD) plays a fundamental role in the regulation of gene expression and is a major contributor to numerous diseases. With advanced technologies, several novel approaches aim to directly circumvent the effects of disease-causing frameshift and nonsense mutations. Additional therapeutics aim to globally dampen the NMD pathway in diseases associated with pathway hyperactivation, one example being Fragile X syndrome. In other cases, therapeutics have been designed to hijack or inhibit the cellular NMD machinery to either activate or obviate transcript-specific NMD by modulating pre-mRNA splicing. Here, we discuss promising approaches employed to regulate NMD for therapeutic purposes and highlight potential challenges in future clinical development. We are optimistic that the future of developing target-specific and global modulators of NMD (inhibitors as well as activators) is bright and will revolutionize the treatment of many genetic disorders, especially those with high unmet medical need.

Also flagged:pathogenesismitochondrialmitochondrial diseaseMELASsynthesisrespiratory complex
Journal Article 2025-02-19 No Snippets Chujo T, Tomizawa K.
Show Full Abstract

Mitochondrial tRNA (mt-tRNA) modifications play pivotal roles in decoding and sustaining tRNA stability, thereby enabling the synthesis of essential respiratory complex proteins in mitochondria. Consequently, loss of human mt-tRNA modifications caused by mutations in the mitochondrial or nuclear genome can cause life-threatening mitochondrial diseases such as encephalopathy and cardiomyopathy. In this article, we first provide a comprehensive overview of the functions of mt-tRNA modifications, the responsible modification enzymes, and the diseases caused by the loss of mt-tRNA modifications. We then discuss progress and potential strategies to treat these diseases, including taurine supplementation for MELAS patients, targeted deletion of mtDNA variants, and overexpression of modification-related proteins. Finally, we discuss factors that need to be overcome to cure "mitochondrial tRNA modopathies."

Also flagged:RNA-binding proteinsribonucleoproteinRNPdegenerative diseaseslocalizationneuromuscular disease
Journal Article 2025-02-19 No Snippets Davenport ML, Swanson MS.
Show Full Abstract

As adaptors, catalysts, guides, messengers, scaffolds, and structural components, RNAs perform an impressive array of cellular regulatory functions often by recruiting RNA-binding proteins (RBPs) to form ribonucleoprotein complexes (RNPs). While this RNA-RBP interaction network allows precise RNP assembly and the subsequent structural dynamics required for normal functions, RNA motif mutations may trigger the formation of aberrant RNP structures that lead to cell dysfunction and disease. Here, we provide our perspective on one type of RNA motif mutation, RNA gain-of-function mutations associated with the abnormal expansion of short tandem repeats (STRs) that underlie multiple developmental and degenerative diseases. We first discuss our current understanding of normal polymorphic STR functions in RNA processing and localization followed by an assessment of the pathogenic roles of STR expansions in the neuromuscular disease myotonic dystrophy. We also highlight ongoing questions and controversies focused on STR-based insights into the regulation of nuclear RNA processing and export as well as the relevance of the RNA gain-of-function pathomechanism for other STR expansion disorders in both coding and noncoding genes.

HTT
Also flagged:Huntington's diseaseHDneurodegenerative disordermovement disorderpolyglutaminemitochondrial
Journal Article 2025-02-19 ✓ 5 Snippets Yablonska S, Strohlein CE, Baranov SV, Yeh SM, Patel A, Singh T, Jauhari A, Kim J, Khattar NK, Li F, Wang X, Chang YF, Lee CYD, Yang XW, Carlisle DL, Friedlander RM.
In-Text Gene Mentions

HTTis a 350…

…17 aa ofHTTare required for…

…the interaction ofHTTwith TIM23 (…

…SinceHTTand mHTT reside…

…the mechanisms ofHTTmitochondrial targeting to…

Show Full Abstract

Huntington's disease (HD), a neurodegenerative disease, affects approximately 30,000 people in the United States, with 200,000 more at risk. Mitochondrial dysfunction caused by mutant huntingtin (mHTT) drives early HD pathophysiology. mHTT binds the translocase of the mitochondrial inner membrane (TIM23) complex, inhibiting mitochondrial protein import and altering the mitochondrial proteome. The 17 aa HTT N-terminal sequence (N17) acts as a regulatory domain in HD pathogenesis; phosphomimetic modification of serines 13 and 16 of the N17 domain impacts subcellular localization and degradation and ameliorates toxicity in mouse and cell models of HD. Using cellular and mouse (either sex) HD models, we investigated the mechanisms by which HTT phosphorylation affects intracellular localization. We demonstrate that introducing phosphomimetic mutations within the mHTT fragment N17 domain decreased TIM23 binding affinity and reduced inhibition of mHTT-mediated mitochondrial protein import. BACHD-SD mice expressing full-length mHTT harboring the same two N17 phosphomimetic mutations have an ameliorated HD-like phenotype as compared with mice expressing mHTT. Consistent with reduced toxicity in vivo, we found that the amount of full-length mHTT in the brain mitochondria of BACHD-SD transgenic mice is less when the mHTT has two phosphomimetic mutations. To complement the relevance of the phosphomimetic HTT findings, endogenous N17 phospho-mHTT is less likely to translocate to the mitochondria compared with nonphosphorylated mHTT. We demonstrate that phosphorylation of mHTT at serines 13 and 16 is critical for negatively regulating mHTT mitochondrial targeting and that reducing mHTT mitochondrial localization and binding to TIM23 results in amelioration of mHTT-induced mitochondrial and neuronal toxicity.

HTT
Also flagged:gene silencingnucleusRNA polymerase IIDroshaDGCR8cytosol
Journal Article 2025-02-19 ✓ 1 Snippet Raak SB, Hanley JG, O'Donnell C.
In-Text Gene Mentions

…express native mouseHttonly) ( figure…

Show Full Abstract

MicroRNAS (miRNAs) are short non-coding RNAs that can repress mRNA translation to regulate protein synthesis. During their maturation, multiple types of pre-miRNAs compete for a shared pool of the enzyme Dicer. It is unknown how this competition for a shared resource influences the relative expression of mature miRNAs. We study this process in a computational model of pre-miRNA maturation, fitted to <i>in vitro Drosophila</i> S2 cell data. We find that those pre-miRNAs that efficiently interact with Dicer outcompete other pre-miRNAs, when Dicer is scarce. To test our model predictions, we re-analysed previously published <i>ex vivo</i> mouse striatum data with reduced <i>Dicer1</i> expression. We calculated a proxy measure for pre-miRNA affinity to TRBP (a protein that loads pre-miRNAs to Dicer). This measures well-predicted mature miRNA levels in the data, validating our assumptions. We used this as a basis to test the the model's predictions through further analysis of the data. We found that pre-miRNAs with strong TRBP association are over-represented in competition conditions, consistent with the modelling. Finally using further simulations, we discovered that pre-miRNAs with low maturation rates can affect the mature miRNA pool via competition among pre-miRNAs. Overall, this work presents evidence of pre-miRNA competition regulating the composition of mature miRNAs.

CCPG1
Also flagged:gene expressiongliomaSPP1Alzheimer's diseaseGliomasmalignant tumors
Journal Article 2025-02-19 ✓ 1 Snippet Wang M, Yu J, Ge D, Geng Z, Wei C, Xu D.
In-Text Gene Mentions

…PC_6 Genes:CCPG1, ADAMTS14, CDK2, etc.,…

Show Full Abstract

<h4>Background</h4>This study employs a comprehensive approach using Genome-Wide Association Studies (GWAS), protein-protein interaction networks, gene co-expression networks, gene interaction networks, and centrality analysis to explore genetic and network interactions related to glioma and Alzheimer's disease.<h4>Methods</h4>Through detailed analysis of glioma single-cell data, we found that gene expression patterns are closely related to cell types and states. Principal Component Analysis (PCA) and dimensionality reduction techniques like UMAP and t-SNE reveal cell population heterogeneity and potential subgroups. This research also involved building machine learning models to classify glioma and assessing their performances, as well as a model that can best classify each type..<h4>Results</h4>We investigated these cell interaction networks along with NRG signaling networks for glioma to discern cell-cell communication and signaling events. The SPP1 signaling pathway and gene expression analysis further triage the specific genes mediating the interactive role in glioma cells.<h4>Conclusion</h4>This study presented a comprehensive view of gene expression, cell cell interactions and signaling networks in glioma, which might be a crucial piece to understand glioma complexity and usher in new therapeutic strategies across medical divisions.

SUDS3
Also flagged:histonehistoneschromatinPOLE4MCM2-2Agene expression
Journal Article 2025-02-19 ✓ 1 Snippet Kollenstart L, Biran A, Alcaraz N, Reverón-Gómez N, Solis-Mezarino V, Völker-Albert M, Jenkinson F, Flury V, Groth A.
In-Text Gene Mentions

…both core andlinker histoneshistones, while the…

Show Full Abstract

In the process of DNA replication, the first steps in restoring the chromatin landscape involve parental histone recycling and new histone deposition. Disrupting histone recycling to either the leading or lagging strand induces asymmetric histone inheritance, affecting epigenome maintenance and cellular identity. However, the order and kinetics of these effects remain elusive. Here, we use inducible mutants to dissect the early and late consequences of impaired histone recycling. Simultaneous disruption of both leading (POLE4) and lagging strand (MCM2-2A) recycling pathways impairs the transmission of parental histones to newly synthesized DNA, releasing some parental histones to the soluble pool. Subsequently, H3K27me3 accumulates aberrantly during chromatin restoration in a manner preceding gene expression changes. Loss of histone inheritance and the ensuing chromatin restoration defects alter gene expression in embryonic stem cells and challenge differentiation programs and cell viability. Our findings demonstrate the importance of efficient transmission of histone-based information during DNA replication for maintaining chromatin landscapes, differentiation potential, and cellular viability.

SOX6
Also flagged:cancerscancercolorectal cancercell proliferationtumorARID1B
Journal Article 2025-02-19 ✓ 1 Snippet Bayraktar R, Tang Y, Dragomir MP, Ivan C, Peng X, Fabris L, Zhang J, Carugo A, Aneli S, Liu J, Chen MM, Srinivasan S, Sahnoune I, Bayraktar E, Akdemir KC, Chen M, Narayanan P, Huang W, Ott LF, Eterovic AK, Villarreal OE, Mohammad MM, Peoples MD, Walsh DM, Hernandez JA, Morgan MB, Shaw KR, Davis JS, Menter D, Tam CS, Yeh P, Dawson SJ, Rassenti LZ, Kipps TJ, Kunej T, Estrov Z, Joosse SA, Pagani L, Alix-Panabières C, Pantel K, Ferajoli A, Futreal A, Wistuba II, Radovich M, Kopetz S, Keating MJ, Draetta GF, Mattick JS, Liang H, Calin GA.
In-Text Gene Mentions

…ICGC CRC cohort:SOX6—5.77% amplifications and…

Show Full Abstract

The mutational landscape of phylogenetically ultraconserved elements (UCEs), especially those in noncoding DNAs (ncUCEs), and their functional relevance in cancers remain poorly characterized. Here, we perform a systematic analysis of whole-genome and in-house targeted UCE sequencing datasets from more than 3000 patients with cancer of 13,736 UCEs and demonstrate that ncUCE somatic alterations are common. Using a multiplexed CRISPR knockout screen in colorectal cancer cells, we show that the loss of several altered ncUCEs significantly affects cell proliferation. In-depth functional studies in vitro and in vivo further reveal that specific ncUCEs can be enhancers of tumor suppressors (such as ARID1B) and silencers of oncogenic proteins (such as RPS13). Moreover, several miRNAs located in ncUCEs are recurrently mutated. Mutations in miR-142 locus can affect the Drosha-mediated processing of precursor miRNAs, resulting in the down-regulation of the mature transcript. These results provide systematic evidence that specific ncUCEs play diverse regulatory roles in cancer.

Also flagged:ß-arrestinsSmoShh
Journal Article 2025-02-19 No Snippets Ascunce Gonzalez K.
Show Full Abstract

No abstract available.

NEGR1
Also flagged:Anorexia nervosaANmetabolismpsychiatric disordereating disordersED
Journal Article 2025-02-19 ✓ 5 Snippets Breton É, Kaufmann T.
In-Text Gene Mentions

…and MDD (NEGR1[ 42 ,…

…these genes (e.g.,NEGR1, PTBP2, BCL11A, ARNTL,…

…the identification ofNEGR1as overlapping between…

…is noteworthy, asNEGR1is involved in…

…controls at theNEGR1gene locus […

Show Full Abstract

Anorexia nervosa (AN) typically emerges around adolescence and predominantly affects females. Recent progress has been made in identifying biological correlates of AN, but more research is needed to pinpoint the specific mechanisms that lead to its development and maintenance. There is a known phenotypic link between AN, growth and sexual maturation, yet the genetic overlap between these phenotypes remains enigmatic. One may hypothesize that shared factors between AN, energy metabolism and reproductive functions may have been under recent evolutionary selection. Here, we characterize the genetic overlap between AN, BMI and age at menarche, and aimed to reveal recent evolutionary factors that may help explain the origin of AN. We obtained publicly available GWAS summary statistics of AN, BMI and age at menarche and studied the polygenic overlap between them. Next, we used Neandertal Selective Sweep scores to explore recent evolutionary selection. We found 22 loci overlapping between AN and BMI, and 9 loci between AN and age at menarche, with 7 of these not previously associated with AN. We found that loci associated with AN may have been under particular evolutionary dynamic. Chronobiology appeared relevant to the studied genetic overlaps and prone to recent evolutionary selection, offering a promising avenue for future research. Taken together, our findings contribute to the understanding of the genetic underpinning of AN. Ultimately, better knowledge of the biological origins of AN may help to target specific biological processes and facilitate early intervention in individuals who are most at risk.

Also flagged:MANFIntrahepatic cholangiocarcinomamesencephalic astrocyte-derived neurotrophic factorliver cancermembraneNotch2
Journal Article 2025-02-19 No Snippets Mei Q, Zhang Y, Li H, Ma W, Huang W, Wu Z, Huang Y, Liang Y, Wei C, Wang J, Ruan Y, Yang L, Huang Y, Shen Y, Liu J, Feng L, Shen Y.
Show Full Abstract

Intrahepatic cholangiocarcinoma (ICC) is characterized by poor prognosis and limited treatment. Hepatocytes have been considered as one of the origins of ICC, however, the underlying mechanisms remain unclear. Here, we found mesencephalic astrocyte-derived neurotrophic factor (MANF), a hepatoprotective factor, was exceptionally upregulated in human ICC tissues and experimental mouse ICC models induced by sleeping beauty transposon (SBT) or thioacetamide (TAA) challenge. We identified MANF as a biomarker for distinguishing the primary liver cancer and verified the oncogenic role of MANF in ICC using cell lines overexpressing/knocked down MANF and mice specifically knocked in/out MANF in hepatocytes. Lineage tracing revealed that MANF promoted mature hepatocyte transformation into ICC cells. Mechanistically, MANF interacted with CK19 at Ser35 to suppress CK19 membrane recruitment. Cytosolic CK19 bound to AR domain of Notch2 intracellular domain (NICD2) to stabilize NICD2 protein level and trigger Notch signaling, which contributed to hepatocyte transformation to ICC cells. We uncover a novel profile of MANF and the original mechanism, which shed light on ICC diagnosis and intervention.

CA10
Also flagged:ovarian cancerOCCLEC11AMFAP2TYMPPDIA3
Journal Article 2025-02-19 ✓ 2 Snippets Liu S, Lin H, Zhang K, Zhou Q, Shen Y.
In-Text Gene Mentions

…POFUT1, PREP, NTNG1,CA10, CACNA2D3, CA8, MAN1C1,…

…were > 0.75(GP5,CA10, CLEC11A and CACNA2D3),…

Show Full Abstract

<h4>Background</h4>The existing drugs for ovarian cancer (OC) are unsatisfactory and thus new drug targets are urgently required. We conducted proteome-wide Mendelian randomization (MR) and colocalization analysis to pinpoint potential targets for OC.<h4>Methods</h4>Data on protein quantitative trait loci (pQTL) for 734 plasma proteins were obtained from large genome-proteome-wide association studies. Genetic associations with OC were derived from the Ovarian Cancer Association Consortium, which included 25,509 cases and 40,941 controls. MR analysis was performed to evaluate the association between the proteins and the OC risk. Colocalization analysis was conducted to check whether the identified proteins and OC shared causal variants. In addition, the phenome-wide MR analysis was performed to clarify protein associations across the phenotype, and drug target databases were examined for target validation.<h4>Results</h4>Genetically predicted circulating levels of 44 proteins were associated with OC risk at Benjamini-Hochberg correction. Genetically predicted 17 proteins had evidence of the increased risk of OC (CLEC11A, MFAP2, TYMP, PDIA3, IL1R1, SPINK1, PLAU, DKK2, IL6ST, DLK1, LRRC15, CDON, ANGPTL1, SEMA4D, AKR1A1, TNFAIP6, and FCGR2B); 27 proteins decreased the risk of OC(SIGLEC9, RARRES1, SPINT3, TMEM132A, HAVCR2, CNTN2, TGFBI, GSTA1, HGFAC, TREML2, GRAMD1C, ASAH2, CPNE1, CCL25, MAPKAPK2, POFUT1, PREP, NTNG1, CA10, CACNA2D3, CA8, MAN1C1, MRC2, IL10RB, RBP4, GP5 and CALCOCO2). Bayesian colocalization demonstrated that GRAMD1C, RBP4, PLAU, PDIA3, MFAP2, POFUT1, MAN1C1 and DKK2 shared the same variant with OC. The phe-MR analyses assessed the side effects of these 44 identified proteins, and the drug target database offered information on both approved and investigational indications.<h4>Conclusion</h4>This study provides proof of a causal relationship between genetically predicted 44 proteins associated with OC risk, which could serve as promising drug targets for OC.

Also flagged:MMP28tumorMAPKJNKcytokinesecretion
Journal Article 2025-02-19 No Snippets Dong S, Li X, Chen Z, Shi H, Wang Z, Zhou W.
Show Full Abstract

<h4>Background</h4>Crosstalk between pancreatic cancer cells and tumor-associated macrophages (TAMs) is a critical driver of malignant progression, and plays an important role in the low response rate to immunotherapy in patients with for pancreatic cancer. Although it is known that cancer cells induce TAM infiltration and M2 polarization, the underlying mechanisms remain elusive. Herein, we identified matrix metalloproteinase 28 (MMP28), a highly expressed protein, as a key regulator of this process.<h4>Methods</h4>Immunohistochemical staining and qRT-PCR were used to validate MMP28 as a potential marker for the prognosis of patients with pancreatic cancer. We evaluated the tumor-promoting effect of MMP28 in vitro with CCK-8, Transwell, and EdU assay and Western blotting and explored the potential mechanism of MMP28-induced M2 polarization of TAMs with a coculture system, immunofluorescence staining and flow cytometry. A subcutaneous graft tumor model was constructed to assess the tumor-promoting effect of MMP28 and its ability to induce M2 TAM infiltration.<h4>Results</h4>The relevant results of this study revealed a strong correlation between MMP28 expression and TAM infiltration, with a predominance of M2-polarized TAMs in pancreatic cancer tissues. Mechanistic investigations demonstrated that MMP28 promotes the secretion of multiple cytokines, including IL-8 and VEGFA through the activation of the MAPK/JNK signaling pathway. These cytokines act as potent chemoattractants and polarizing factors for TAMs. Additionally, we discovered an interaction between MMP28 and ANXA2, which contributes to the regulation of TAM recruitment and polarization. In vivo studies confirmed the critical role of MMP28 in tumor growth and TAM infiltration. Depletion of macrophages, inhibition of JNK, or neutralization of IL-8 and VEGFA significantly suppressed tumor progression. Transcriptomic analysis suggested that IL-8 and VEGFA induce M2 TAM polarization by modulating TAM amino acid metabolism.<h4>Conclusions</h4>Collectively, our findings elucidate a novel mechanism by which pancreatic cancer cells manipulate the tumor microenvironment through MMP28-dependent cytokine secretion, promoting TAM infiltration and M2 polarization. These results highlight MMP28 as a promising therapeutic target for pancreatic cancer.

Also flagged:Dipeptidic PhosphonatesElastase BinfectionsphosphonatesPseudomonas aeruginosakeratitis
Journal Article 2025-02-19 No Snippets Kiefer AF, Schütz C, Englisch CN, Kolling D, Speicher S, Kany AM, Shafiei R, Wadood NA, Aljohmani A, Wirschem N, Jumde RP, Klein A, Sikandar A, Park YM, Krasteva-Christ G, Yildiz D, Abdelsamie AS, Rox K, Köhnke J, Müller R, Bischoff M, Haupenthal J, Hirsch AKH.
Show Full Abstract

The ubiquitous opportunistic pathogen Pseudomonas aeruginosa is responsible for severe infections and notoriously known for acquiring antimicrobial resistance. Inhibiting the bacterium's extracellular elastase, LasB - a zinc-dependent protease - presents a promising strategy to mitigate its virulence. Within this medicinal chemistry-driven hit-to-lead optimization campaign, a new series of highly potent dipeptidic phosphonates is designed and synthesized following a structure-based drug-discovery approach. In vitro and in vivo evaluation reveal beneficial pharmacokinetic profiles, excellent selectivity over human off-targets and good tolerability in murine toxicity studies. Ultimately, the scaffold presented herein demonstrates promising in vivo efficacy in a murine Pseudomonas aeruginosa keratitis model in combination with the antibiotic meropenem.

Also flagged:deathcortisolneurotransmitterspsychiatric disorderparasuicidepsychiatric disorders
Journal Article 2025-02-19 No Snippets Ponce-Regalado MD, Becerril-Villanueva E, Maldonado-García JL, Moreno-Lafont MC, Martínez-Ramírez G, Jacinto-Gutiérrez S, Arreola R, Sánchez-Huerta K, Contis-Montes de Oca A, López-Martínez KM, Bautista-Rodríguez E, Chin-Chan JM, Pavón L, Pérez-Sánchez G.
Show Full Abstract

Suicide is defined as the act of a person attempting to take their own life by causing death. Suicide is a complex phenomenon that is influenced by a multitude of factors, including psychosocial, cultural, and religious aspects, as well as genetic, biochemical, and environmental factors. From a biochemical perspective, it is crucial to consider the communication between the endocrine, immune, and nervous systems when studying the etiology of suicide. Several pathologies involve the bidirectional communication between the peripheral activity and the central nervous system by the action of molecules such as cytokines, hormones, and neurotransmitters. These humoral signals, when present in optimal quantities, are responsible for maintaining physiological homeostasis, including mood states. Stress elevates the cortisol and proinflammatory cytokines levels and alter neurotransmitters balance, thereby increasing the risk of developing a psychiatric disorder and subsequently the risk of suicidal behavior. This review provides an integrative perspective about the neurochemical, immunological, and endocrinological disturbances associated with suicidal behavior, with a particular focus on those alterations that may serve as potential risk markers and/or indicators of the state preceding such a tragic act.

BTN3A3
Also flagged:UlcerNFKB1FAIM3JUNDOral ulcerOral ulcers
Journal Article 2025-02-19 ✓ 1 Snippet Zhang X, Fan H, Zhang X, Wang Y, Chen G.
In-Text Gene Mentions

…CI = 1.019–1.060),BTN3A3(OR = 1.048,…

Show Full Abstract

<h4>Background and aims</h4>Oral ulcer (OU) is a complex issue with limited effective treatments. This study uses multi-omics data through summary Mendelian randomization (SMR) and colocalization analysis to identify specific gene associations with OU, aiming to find new therapeutic targets, repurpose existing drugs, and develop new treatment options.<h4>Methods</h4>Our study consists of two phases: first, extracting data from Genome-Wide Association Studies and using blood mQTL, eQTL, and pQTL data as exposure factors, then integrating these with OU gene data through SMR analysis. Then, we validate the results with UK Biobank data and perform colocalization analysis to confirm shared genetic variants.<h4>Results</h4>Genetically predicted levels of four circulating proteins are associated with OU. Under strong supportive evidence from mQTL, eQTL, and pQTL, genetically predicted levels of NFKB1 are negatively correlated with the risk of OU. With moderate supportive evidence from mQTL and pQTL, genetically predicted levels of FAIM3 are negatively correlated with the risk of OU. Meanwhile, under low supportive evidence from eQTL and pQTL, higher genetically predicted levels of JUND and lower levels of IL12β are associated with a higher risk of OU.<h4>Conclusion</h4>SMR approach employed in this study has pinpointed several proteins with tangible associations to the risk of OU. NFKB1, FAIM3, JUND, and IL12β stand out as promising therapeutic targets for OU, beckoning further exploration and research.

SOX6
Also flagged:RNA-Binding Proteinβ-globinγ-globinBCL11AZBTB7AKLF1
Journal Article 2025-02-19 ✓ 1 Snippet Habara A.
In-Text Gene Mentions

…miR-19b-3p to repressSOX6, a γ-globin suppressor,…

Show Full Abstract

β-globin gene cluster regulation involves complex mechanisms to ensure proper expression and function in RBCs. During development, switching occurs as γ-globin is replaced by β-globin. Key regulators, like BCL11A and ZBTB7A, repress γ-globin expression to facilitate this transition with other factors, like KLF1, LSD1, and PGC-1α; these regulators ensure an orchestrated transition from γ- to β-globin during development. While these mechanisms have been extensively studied, circRNAs have recently emerged as key contributors to gene regulation, but their role in β-globin gene cluster regulation remains largely unexplored. Although discovered in the 1970s, circRNAs have only recently been recognized for their functional roles, particularly in interactions with RNA-binding proteins. Understanding how circRNAs contribute to switching from γ- to β-globin could lead to new therapeutic strategies for hemoglobinopathies, such as sickle cell disease and β-thalassemia. This review uses the circAtlas 3.0 database to explore circRNA expressions in genes related to switching from γ- to β-globin expression, focusing on blood, bone marrow, liver, and spleen. It emphasizes the exploration of the potential interactions between circRNAs and RNA-binding proteins involved in β-globin gene cluster regulatory mechanisms, further enhancing our understanding of β-globin gene cluster expression.

HTT
Also flagged:neurodegenerative diseasestranslationalHDNeurodegenerative Diseasebrain diseasesdopamine
Journal Article 2025-02-19 ✓ 1 Snippet Marmion DJ, Deng P, Hiller BM, Lewis RL, Harms LJ, Cameron DL, Nolta JA, Kordower JH, Fink KD, Wakeman DR.
In-Text Gene Mentions

…transfer of mutantHttaggregates from the…

Show Full Abstract

The transplantation of human neurons into the central nervous system (CNS) offers transformative opportunities for modeling neurodegenerative diseases in vivo. This study evaluated the survival, integration, and functional properties of cryopreserved forebrain GABAergic neurons (iGABAs) derived from human induced pluripotent stem cells (iPSCs) across three species used in translational research. iGABAs were stereotactically injected into the striatum of Sprague-Dawley rats, immunodeficient RNU rats, R6/2 Huntington's disease (HD) mice, wild-type controls, and Cynomolgus monkeys. Post-transplantation, long-term assessments revealed robust neuronal survival, extensive neurite outgrowth, and integration with host CNS environments. In immunodeficient rats, iGABAs innervated the neuraxis, extending from the prefrontal cortex to the midbrain, while maintaining mature neuronal phenotypes without uncontrolled proliferation. Similarly, grafts in nonhuman primates showed localized survival and stable phenotype at one month. In the neurodegenerative milieu of HD mice, iGABAs survived up to six months, projecting into the host striatum and white matter, with evidence of mutant huntingtin aggregates localized within the graft, indicating pathological protein transfer. These findings underscore the utility of cryopreserved iGABAs as a reproducible, scalable model for disease-specific CNS investigations and mechanistic studies of proteinopathic propagation. This work establishes a critical platform for studying neurodegenerative diseases and developing therapeutic interventions.

Also flagged:Inflammatory Bowel DiseaseInflammatory bowel diseaseschronic inflammatory disordersinflammatory diseasesulcerative colitisimmune response
Journal Article 2025-02-19 No Snippets Ballesta-López O, Gil-Candel M, Centelles-Oria M, Megías-Vericat JE, Solana-Altabella A, Ribes-Artero H, Nos-Mateu P, García-Pellicer J, Poveda-Andrés JL.
Show Full Abstract

Inflammatory bowel diseases (IBDs) are chronic inflammatory disorders influenced by microbial, environmental, genetic, and immune factors. The introduction of biological agents has transformed IBD therapy, improving symptoms, reducing complications, and enhancing patients' quality of life. However, approximately 30% of patients exhibit primary non-response, and 50% experience a loss of response over time. Genetic and non-genetic factors contribute to variability in treatment outcomes. This systematic review aims to thoroughly analyze and assess existing studies exploring the relationships between genetic variations and individual responses to biologic drugs, in order to identify genetic markers that are predictive of treatment efficacy, risk of adverse effects, or drug toxicity, thereby informing clinical practice and guiding future research. PubMed and EMBASE papers were reviewed by three independent reviewers according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses [PRISMA] guidelines. Of the 883 records screened, 99 met the inclusion criteria. The findings of this review represent an initial step toward personalized medicine in IBD, with the potential to improve clinical outcomes in biological therapy.

Also flagged:Endometriosisestrogenendocrine disordersangiogenesisperitoneal endometriosisovarian endometriotic cysts
Journal Article 2025-02-19 No Snippets Chen Y, Li T.
Show Full Abstract

Endometriosis is a complicated, estrogen-dependent gynecological condition with a high morbidity rate. Pain, as the most common clinical symptom of endometriosis, severely affects women's physical and mental health and exacerbates socioeconomic burden. However, the specific mechanisms behind the occurrence of endometriosis-related pain remain unclear. It is currently believed that the occurrence of endometriosis pain is related to various factors, such as immune abnormalities, endocrine disorders, the brain-gut axis, angiogenesis, and mechanical stimulation. These factors induce systemic chronic inflammation, which stimulates the nerves and subsequently alters neural plasticity, leading to nociceptive sensitization and thereby causing chronic pain. In this paper, we compile and review the articles published on the study of nociceptive sensitization and endometriosis pain mechanisms. Starting from the factors influencing the chronic pain associated with endometriosis, we explain the relationship between these factors and chronic inflammation and further elaborate on the potential mechanisms by which chronic inflammation induces nociceptive sensitization. We aim to reveal the possible mechanisms of endometriosis pain, as well as nociceptive sensitization, and offer potential new targets for the treatment of endometriosis pain.

Also flagged:metabolismautoimmune disordersC-reactive proteinCRPIL-6lipopolysaccharides
Journal Article 2025-02-19 No Snippets Peña-Durán E, García-Galindo JJ, López-Murillo LD, Huerta-Huerta A, Balleza-Alejandri LR, Beltrán-Ramírez A, Anaya-Ambriz EJ, Suárez-Rico DO.
Show Full Abstract

The human microbiota, a complex ecosystem of microorganisms, plays a pivotal role in regulating host immunity and metabolism. This review investigates the interplay between microbiota and inflammatory markers, emphasizing their impact on metabolic and autoimmune disorders. Key inflammatory biomarkers, such as C-reactive protein (CRP), interleukin-6 (IL-6), lipopolysaccharides (LPS), zonulin (ZO-1), and netrin-1 (Ntn1), are discussed in the context of intestinal barrier integrity and chronic inflammation. Dysbiosis, characterized by alterations in microbial composition and function, directly modulates the levels and activity of these biomarkers, exacerbating inflammatory responses and compromising epithelial barriers. The disruption of microbiota is further correlated with increased intestinal permeability and chronic inflammation, serving as a precursor to conditions like type 2 diabetes (T2D), obesity, and non-alcoholic fatty liver disease. Additionally, this review <b>examines</b> therapeutic strategies, including probiotics and prebiotics, designed to restore microbial balance, mitigate inflammation, and enhance metabolic homeostasis. Emerging evidence positions microbiota-targeted interventions as critical components in the advancement of precision medicine, offering promising avenues for diagnosing and treating inflammatory and metabolic disorders.

Also flagged:Epithelial-to-mesenchymal transitiontranscription factorsepithelial-mesenchymal transition transcription factorstumorEMT-TFsTF
Journal Article 2025-02-19 No Snippets Wei Z, Babkirk K, Chen S, Pei M.
Show Full Abstract

The epithelial-mesenchymal transition transcription factors (EMT-TFs)-ZEB, SNAI, and TWIST families-have been extensively studied in embryonic development and tumor metastasis, providing valuable insight into their roles in cell behavior and transformation. These EMT-TFs have garnered increasing attention in the context of mesenchymal tissue regeneration, potentially contributing an approach for cell therapy. Given that dysregulated EMT-TF expression can impair cell survival and lineage differentiation, controlled regulation of their expression could offer significant advantages for tissue regeneration. However, there is a lack of comprehensive reviews to summarize the influence of the EMT-TFs on mesenchymal tissue regeneration and potential molecular mechanisms. This review explores the regulatory roles of ZEB, SNAI, and TWIST in the regeneration of bone, adipose, cartilage, muscle, and other mesenchymal tissues, with a focus on the underlying molecular signaling mechanisms. Gaining a deeper understanding of how EMT-TFs regulate cell proliferation, apoptosis, migration, and differentiation may offer new insights into the management of mesenchymal tissue repair and open novel avenues for enhancing tissue regeneration.

Also flagged:Alzheimer's diseaseADbrain disorderagingcognitive impairmenttau
Journal Article 2025-02-19 No Snippets Alarjani MS, Almarri BA.
Show Full Abstract

The prevalence of Alzheimer's disease (AD) poses a significant public health challenge. Distinguishing AD stages remains a complex process due to ambiguous variability within and across AD stages. Manual classification of such multifaceted and massive data of brain volumes is operationally inefficient and vulnerable to human errors. Here, we propose a precise and systematic framework for AD stages classification. The core of this framework discovers and analyzes functional connectivity among regions of interest (ROIs) of a human brain. Multivariate Pattern Analysis (MVPA) is applied to extract features that reveal complex functional connectivity patterns in the brain. These features are then used as inputs for an Extreme Learning Machine (ELM) model to classify AD stages. The model's performance is assessed through comprehensive evaluation metrics to ensure robustness and reliability. Applying this framework on datasets which contain meticulously validated fMRI scans such as the OASIS and AD Neuroimaging Initiative datasets, we validate the merit of this proposed work. The framework's results show improvement in the collective performance of two-class and multi-class classification. Feeding ELM with MVPA features yield decent outcomes given a generalizable and computationally-efficient model. This study underscores the effectiveness of the proposed approach in accurately distinguishing AD stages, offering potential improvements in AD and AD stages detection.

Also flagged:stroketype 2 diabetes mellitusoxygenhyperbilirubinemiaosteoarthritisKawasaki disease
Journal Article 2025-02-19 No Snippets Sepúlveda-Oviedo EH, Bermeo Clavijo LE, Carlos Méndez-Córdoba L.
Show Full Abstract

Research highlights the importance of applying physiological criteria for optimal umbilical cord clamping, underlining its lasting advantages. In response, the Division of Pediatrics, Perinatology, and Neonatology at the National University of Colombia has pioneered the Immediate Neonatal Adaptation Guideline, focusing on Physiologically-based Cord Clamping. This study has two main objectives: The first is to represent the medical guideline through a statechart model to enhance clarity and detail. Secondly, to evaluate the effectiveness of statechart models in depicting medical guidelines for educational and training purposes within a human-centric framework. In this study, a group of medical professionals and engineers designed the statechart model for the Immediate Neonatal Adaptation guideline through a progressive refinement method. The model comprises 20 states, 38 events, and 4 superstates, offering clear visual language for its evaluation by an interdisciplinary panel of engineers and health professionals. This visual representation facilitates a more explicit identification of patient states, criteria, and clinical indicators involved in the procedure. Feedback indicates general satisfaction with the <i>Versatility, Usability, Scalability</i> and <i>Moderate visual complexity</i> of the model.

Also flagged:extracellulartumorlung cancergelatinphotoncell cycle
Journal Article 2025-02-19 No Snippets Dong Y, Qian S, Wang X, Zhang W, Lu W, Qu J, Cui M, Chen L, Zhao Y, Gao Y, Giomo M, Urciuolo A, Feng J, Zheng Y, Jiang B, Shen R, Zhu X, Elvassore N.
Show Full Abstract

The mechanical properties and physical confinement of the extracellular matrix (ECM) are crucial roles in regulating tumor growth and progression. Extensive efforts have been dedicated to replicating the physical characteristics of tumor tissue by developing two-dimensional (2D) and three-dimensional (3D) <i>in vitro</i> models. However, it remains a significant challenge to modulate the local microenvironment around the specific cells according to the culture progress. In this study, we develop a 3D culture platform for multicellular lung cancer spheroids using a gelatin-based hydrogel with adjustable density and stiffness. Then, by utilizing a two-photon mediated bioprinting technique, we construct 3D confining microstructures with micrometer accuracy to enclose the selected spheroids within the hydrogel matrix. Diverse transcriptional profilings of cells are observed in response to the increased ECM density and stiffness compared to the additional confining stress. In addition, changed confining stress can regulate the tumor cells with contrary impacts on the cell cycle-related pathways. Our model not only allows for modifications to the mechanical microenvironment of the overall matrix but also facilitates localized adjustments throughout the culture evolution. This approach serves as a valuable tool for investigating tumor progression and understanding cell-ECM interactions.

Also flagged:Neurodegenerative Diseasesinflammatory responsechemokinesphosphorylationinflammatory responsesbrain injury
Journal Article 2025-02-19 No Snippets Gao R, Gao Y, Su W, Wang R.
Show Full Abstract

As the resident macrophages of the brain, microglia are crucial immune cells specific to the central nervous system (CNS). They constantly surveil their surroundings and trigger immunological reactions, playing a key role in various neurodegenerative diseases (ND). As illnesses progress, microglia exhibit multiple phenotypes. Traditionally, microglia have been classified into two main phenotypes upon activation: the pro-inflammatory M1 polarization and the anti-inflammatory M2 polarization. However, this classification is now considered overly simplistic, as it is unable to fully convey the intricacy and diversity of the inflammatory response. Immune regulatory factors, such as chemokines secreted by microglia, are essential for modulating brain development, maintaining the neural milieu, and orchestrating responses to injury, along with the subsequent repair processes. However, in recent years, the significance of metabolic reprogramming in both physiological microglial activity and ND has also become increasingly recognized. Upon activation-triggered by brain injury, infection, or ND-microglia typically modify their metabolic processes by transitioning from oxidative phosphorylation (OXPHOS) phosphorylation to glycolysis. This shift facilitates rapid energy production but may also enhance pro-inflammatory responses. This review seeks to summarize metabolic reprogramming and polarization in the function of microglia and their involvement in ND.

Also flagged:Cancercisplatinfenamic acidovarian tumorsbindingdeath
Journal Article 2025-02-18 No Snippets Teixeira T, Palmeira-Mello MV, Machado PH, Moraes CAF, Pinto C, Costa RC, Badaró W, Gomes Neto JA, Ellena J, Vieira Rocha F, Batista AA, Correa RS.
Show Full Abstract

Cancer resistance to chemotherapeutic agents such as cisplatin presents a significant challenge, leading to treatment failure and poor outcomes. Novel metal-based compounds offer a promising strategy to overcome drug resistance and to enhance efficacy. Four Ru(II) complexes with fenamic acid derivatives were synthesized and characterized: [Ru(L)(bipy)(dppp)]PF<sub>6</sub>, where L represents fenamic acid (HFen, complex <b>1</b>), mefenamic acid (HMFen, complex <b>2</b>), tolfenamic acid (HTFen, complex <b>3</b>), and flufenamic acid (HFFen, complex <b>4</b>). Their composition was supported by molar conductivity, elemental analysis, Fourier transform infrared spectroscopy, ultraviolet-visible spectroscopy, mass spectrometry, and <sup>31</sup>P{<sup>1</sup>H}, <sup>1</sup>H, and <sup>13</sup>C nuclear magnetic resonance, with the crystal structure of complex <b>1</b> confirmed via X-ray diffraction. Complexes <b>1</b>-<b>4</b> exhibited notable cytotoxicity against tested cell lines, particularly A2780 and A2780cisR (cisplatin-resistant ovarian tumors), compared to MDA-MB-231 (breast) and A549 (lung) lines. Mechanistic studies revealed weak DNA interactions through minor grooves or electrostatic binding. Cellular uptake assays showed effective internalization of complexes <b>1</b> (3.6%) and <b>2</b> (4.5%), correlating with potent IC<sub>50</sub> values. These complexes also altered cell morphology, reduced cell density, and inhibited colony formation in the A2780 cells. Staining assays indicated induced cell death and organelle damage, highlighting their potential as promising antitumor agents.

HFE
Also flagged:emotional dysregulationattention-deficit/hyperactivity disorderADHDmicronutrientsbehavioralbutyrate
Journal Article 2025-02-18 ✓ 1 Snippet Ast HK, Hammer M, Zhang S, Bruton A, Hatsu IE, Leung B, McClure R, Srikanth P, Farris Y, Norby-Adams L, Robinette LM, Arnold LE, Swann JR, Zhu J, Karstens L, Johnstone JM.
In-Text Gene Mentions

…Wilson’s disease orhemochromatosis.…

Show Full Abstract

Micronutrients have demonstrated promise in managing inattention and emotional dysregulation in children with attention-deficit/hyperactivity disorder (ADHD). One plausible pathway by which micronutrients improve symptoms is the gut microbiome. This study examines changes in fecal microbial composition and diversity after micronutrient supplementation in children with ADHD (<i>N</i> = 44) and highlights potential mechanisms responsible for the behavioral improvement, as determined by blinded clinician-rated global improvement response to micronutrients. Participants represent a sub-group of the Micronutrients for ADHD in Youth (MADDY) study, a double blind randomized controlled trial in which participants received micronutrients or placebo for 8 weeks, followed by an 8-week open extension. Stool samples collected at baseline, week 8, and week 16 were analyzed using 16S rRNA amplicon sequencing targeting the V4 hypervariable region. Pairwise compositional analyses investigated changes in fecal microbial composition between micronutrients versus placebo and responders versus non-responders. A significant change in microbial evenness, as measured by alpha diversity, and beta-diversity, as measured by Bray-Curtis, was observed following micronutrients supplementation. The phylum <i>Actinobacteriota</i> decreased in the micronutrients group compared to placebo. Two butyrate-producing bacterial families: <i>Rikenellaceae</i> and <i>Oscillospiraceae</i>, exhibited a significant increase in change following micronutrients between responders versus non-responders. These findings suggest that micronutrients modulated the composition of the fecal microbiota and identified specific bacterial changes associated with micronutrient responders.

Also flagged:postural orthostatic tachycardia syndromePOTSpathogenesissubstance-related disordersestrogendysautonomia
Journal Article 2025-02-18 No Snippets Qu H, Qu J, Chang X, Williams N, Mentch F, Snyder J, Lemma M, Nguyen K, Behr M, March M, Connolly J, Glessner J, Boris JR, Hakonarson H.
Show Full Abstract

<h4>Background</h4>Postural orthostatic tachycardia syndrome (POTS) is a complex disorder with serious health consequences, while its etiology remains largely elusive.<h4>Objective</h4>The purpose of this study was to investigate the genetic landscape of POTS using genomic approaches in a unique pediatric cohort.<h4>Methods</h4>We conducted a combined genome wide genotyping and whole exome sequencing (WES) study to systemically examine the molecular mechanisms of POTS pathogenesis. The patients were genotyped as two independent cohorts: a family cohort of 100 complete families and a case-control cohort of 207 unrelated European cases and 4063 ethnicity-matched control subjects. The WES component consisted of a subset of the genotyped subjects, including 87 unrelated European cases and 2719 unrelated European control subjects.<h4>Results</h4>The heterogeneous phenotype of POTS made achieving genome-wide significance improbable. Instead, 5670 SNPs with nominal significance (P < 0.05) were identified in both the family and case-control cohorts, with effects in the same direction. We conducted an over-representation analysis (ORA) by considering all genes that showed nominal significance. The ORA identified gene sets linked to cell-cell junction, early estrogen response, and substance-related disorders with statistical significance. Moreover, WES revealed 55 genes with genome-wide significance through rare variant burden analysis, harboring 92 variants classified as pathogenic or likely pathogenic by ClinVar.<h4>Conclusions</h4>This study showcases the complex interplay between common and rare genetic variants in POTS development, marking a pioneering step forward in deciphering its complex etiologies. The insights from this research enrich our understanding of POTS, offering new avenues for precise treatment strategies and highlighting areas for further research.

SHISA6
Also flagged:chromosomesbehavioraldegradationorganizationsaltethanol
Journal Article 2025-02-18 ✓ 1 Snippet Karabaş M, Yılmaz O.
In-Text Gene Mentions

…five genes (SHISA6, LOC114116871, DNAH9, ZNF18,…

Show Full Abstract

In the study, data obtained from OvineSNP50K SNP chips using the Illumina® iScan platform for Eşme sheep were used. The integrated haplotype score (iHS) and runs of homozygosity (ROH) statistical approaches were used to identify selection signatures. Using the iHS analysis, it was discovered that there are 10 genomic regions and 51 genes on ovine chromosomes 1, 9, 11, and 12 that are under selection. Three genomic regions and 97 genes on ovine chromosomes 6 and 11 were found to be under selection using the ROH analysis. Candidate genes associated with economic and ecological traits were detected using both approaches. Among the genetic diversity parameters considered in this study, the minor allele frequency (MAF), the genetic distance between individuals (D), as well as observed (Ho) and expected heterozygosities (He) values were 0.300, 0.309, 0.388, and 0.390, respectively. The obtained Ho, He and D values indicate a moderate level of genetic diversity. The ratio of polymorphic SNPs (PN) was 0.947, and the average values of F<sub>ROH</sub> and F<sub>HOM</sub> were 0.030 and 0.029, respectively. Considering the PN value obtained in the study, it is evident that the SNPs in the population exhibit a high level of polymorphism at 94.7%. While the F<sub>ROH</sub> value obtained indicates high genetic diversity among the individuals in the present study, the F<sub>HOM</sub> value suggests that the population is predominantly composed of heterozygous individuals. As a result, evidence indicating genetic advancements have been made for target traits in breeding programs within the population. Additionally, candidate genes suitable for future molecular marker-supported breeding programs have been identified. In addition, a better understanding of the genetic structure and production potential of the population has been achieved. Findings have shown that Eşme sheep are a breed with high meat production potential and strong adaptation abilities.

Also flagged:Allergic Rhinitischronic inflammatory airway diseaseallergic conjunctivitisasthmasleep disordersanxiety
Journal Article 2025-02-18 No Snippets Hao Y, Yang Y, Zhao H, Chen Y, Zuo T, Zhang Y, Yu H, Cui L, Song X.
Show Full Abstract

Allergic rhinitis (AR) is a common chronic inflammatory airway disease caused by inhaled allergens, and its prevalence has increased in recent decades. AR not only causes nasal leakage, itchy nose, nasal congestion, sneezing, and allergic conjunctivitis but also induces asthma, as well as sleep disorders, anxiety, depression, memory loss, and other phenomena that seriously affect the patient's ability to study and work, lower their quality of life, and burden society. The current methods used to diagnose and treat AR are still far from ideal. Multi-omics technology can be used to comprehensively and systematically analyze the differentially expressed DNA, RNA, proteins, and metabolites and their biological functions in patients with AR. These capabilities allow for an in-depth understanding of the intrinsic pathogenic mechanism of AR, the ability to explore key cells and molecules that drive its progression, and to design personalized treatment for AR. This article summarizes the progress made in studying AR by use of genomics, epigenomics, transcriptomics, proteomics, metabolomics, and microbiomics in order to illustrate the important role of multi-omics technologies in facilitating the precise diagnosis and treatment of AR.

HTT
Also flagged:bipolar disordermajor depressive disordermood disorderspsychiatric disordernucleusmood disorder
Journal Article 2025-02-18 ✓ 1 Snippet Boisvert M, Dugré JR, Potvin S.
In-Text Gene Mentions

…5-HT 6 , 5-HTT), dopamine (i.e., D…

Show Full Abstract

Offspring of parents with bipolar disorder (BD) or major depressive disorder (MDD) are at high biological risk (HR) of these disorders given their significant heritability. Thus, studying neural correlates in youths at HR-MDD and HR-BD appears essential to understand the development of mood disorders before their onset. Resting-state amplitudes of low-frequency fluctuations (ALFF) and fractioned ALFF (fALFF) shows moderate to high test-retest reliability which makes it a great tool to identify biomarkers. However, this avenue is still largely unexplored. Using the Healthy Brain Network biobank, we identified 150 children and adolescents HR-MDD, 50 HR-BD and 150 not at risk of any psychiatric disorder (i.e., the control group). We then examined differences in relative ALFF/fALFF signals during resting-state. At a corrected threshold, participants HR-MDD displayed lower resting-state ALFF signals in the dorsal caudate nucleus compared to the control group. The HR-BD group showed increased fALFF values in the primary motor cortex compared to the control group. Therefore, robust differences were noted in regions that could be linked to important symptoms of mood disorders, namely psychomotor retardation, and agitation. At an uncorrected threshold, differences were noted in the central opercular cortex and the cerebellar. The database is a community-referred cohort and heterogeneous in terms of children's psychiatric diagnosis and symptomatology, which may have altered the results. ALFF and fALFF results for the comparison between both HR groups and the control group overlapped, suggesting good convergence. More studies measuring ALFF/fALFF in HR are needed to replicate these results.

HFE
Also flagged:haemochromatosisHHironhyperferritinaemiaAPCHereditary haemochromatosis
Journal Article 2025-02-18 ✓ 4 Snippets Singh P, Millson C, Huang C, Driver RJ.
In-Text Gene Mentions

…Mutation to theHFEgene on chromosome…

…other genes (non-HFE) that cause…

…those without anyHFEmutations.…

…3 Non-HFEmutations are rare…

Show Full Abstract

<h4>Introduction</h4>Hereditary haemochromatosis (HH) is the most common genetic condition among populations of northern European ancestry, but it does not have a specific International Classification of Diseases 10th revision (ICD-10) diagnosis code. HH is commonly assigned the ICD-10 code E83.1 defined as 'disorders of iron metabolism'. However, the E83.1 diagnosis code is also applied to patients with transfusion-related iron overload and hyperferritinaemia from non-iron loading conditions. Venesection is the main treatment option for patients with HH and is assigned the Office of Population, Census and Surveys Classification of Interventions and Procedures, 4th revision (OPCS-4) code X36.2. We aimed to develop a novel algorithm to identify haemochromatosis patients with C282Y homozygosity from electronic patient records (EPR) using ICD-10 and OPCS-4 codes.<h4>Methods</h4>The Hospital Episode Statistics Admitted Patient Care (APC) database was used to identify all patients with the ICD-10 code E83.1 from 1 April 2018 to 31 March 2023 in our NHS Trust. Case notes were reviewed to evaluate the presence of HH, genotype, medical history and associated procedures. Algorithms were generated using Stata MP V.18 by applying a combination of ICD-10 and OPCS-4 codes to all patients with the diagnosis code E83.1 including those without HH gene mutations.<h4>Results</h4>A total of 9264 patient episodes were identified from the HES APC database corresponding to 787 unique patients: 479 (60.9%) C282Y homozygous, 107 (13.6%) C282Y/H63D compound heterozygotes, 42 (5.3%) other HH genetic mutations and 159 (20.2%) without any HH gene mutations. Six algorithms were developed to identify patients with HH within inpatient EPR, all of which showed improved positive predictive value (PPV) compared with the baseline cohort. The application of the OPCS-4 code for venesection (X36.2) in five of the algorithms resulted in large improvements in specificity and increased all their PPVs to >70%. Algorithms 4 and 6 had the best PPV at 74.3% and 74.4%, respectively, and included the removal of patients with ICD-10 codes associated with transfusion-related iron overload and other conditions treated with venesection.<h4>Conclusion</h4>These novel algorithms represent a more reliable method to detect haemochromatosis patients with C282Y homozygosity from EPR than the single ICD-10 code E83.1. It may be applied to large administrative datasets for investigation of HH in population studies.

Also flagged:metabolismadenosine triphosphatepathogenesisneurological diseasesmetabolic syndromesautoimmune disorders
Journal Article 2025-02-18 No Snippets Liu H, Wang S, Wang J, Guo X, Song Y, Fu K, Gao Z, Liu D, He W, Yang LL.
Show Full Abstract

Energy metabolism is indispensable for sustaining physiological functions in living organisms and assumes a pivotal role across physiological and pathological conditions. This review provides an extensive overview of advancements in energy metabolism research, elucidating critical pathways such as glycolysis, oxidative phosphorylation, fatty acid metabolism, and amino acid metabolism, along with their intricate regulatory mechanisms. The homeostatic balance of these processes is crucial; however, in pathological states such as neurodegenerative diseases, autoimmune disorders, and cancer, extensive metabolic reprogramming occurs, resulting in impaired glucose metabolism and mitochondrial dysfunction, which accelerate disease progression. Recent investigations into key regulatory pathways, including mechanistic target of rapamycin, sirtuins, and adenosine monophosphate-activated protein kinase, have considerably deepened our understanding of metabolic dysregulation and opened new avenues for therapeutic innovation. Emerging technologies, such as fluorescent probes, nano-biomaterials, and metabolomic analyses, promise substantial improvements in diagnostic precision. This review critically examines recent advancements and ongoing challenges in metabolism research, emphasizing its potential for precision diagnostics and personalized therapeutic interventions. Future studies should prioritize unraveling the regulatory mechanisms of energy metabolism and the dynamics of intercellular energy interactions. Integrating cutting-edge gene-editing technologies and multi-omics approaches, the development of multi-target pharmaceuticals in synergy with existing therapies such as immunotherapy and dietary interventions could enhance therapeutic efficacy. Personalized metabolic analysis is indispensable for crafting tailored treatment protocols, ultimately providing more accurate medical solutions for patients. This review aims to deepen the understanding and improve the application of energy metabolism to drive innovative diagnostic and therapeutic strategies.

ARFGEF2
Also flagged:Periventricular heterotopiaPHheterotopiadevelopmental delayFAT4DCHS1
Journal Article 2025-02-18 ✓ 1 Snippet Di Matteo F, Bonrath R, Pravata V, Schmidt H, Ayo Martin AC, Di Giaimo R, Menegaz D, Riesenberg S, de Vrij FMS, Maccarrone G, Holzapfel M, Straub T, Kushner SA, Robertson SP, Eder M, Cappello S.
In-Text Gene Mentions

…, FAT4 ,ARFGEF2, MAP1B ,…

Show Full Abstract

Periventricular heterotopia (PH), a common form of gray matter heterotopia associated with developmental delay and drug-resistant seizures, poses a challenge in understanding its neurophysiological basis. Human cerebral organoids (hCOs) derived from patients with causative mutations in FAT4 or DCHS1 mimic PH features. However, neuronal activity in these 3D models has not yet been investigated. Here we show that silicon probe recordings reveal exaggerated spontaneous spike activity in FAT4 and DCHS1 hCOs, suggesting functional changes in neuronal networks. Transcriptome and proteome analyses identify changes in neuronal morphology and synaptic function. Furthermore, patch-clamp recordings reveal a decreased spike threshold specifically in DCHS1 neurons, likely due to increased somatic voltage-gated sodium channels. Additional analyses reveal increased morphological complexity of PH neurons and synaptic alterations contributing to hyperactivity, with rescue observed in DCHS1 neurons by wild-type DCHS1 expression. Overall, we provide new comprehensive insights into the cellular changes underlying symptoms of gray matter heterotopia.

HTT
Also flagged:neurodegenerative disordersAmyloid-β42pathogenesisADneuroblastoma
Journal Article 2025-02-18 ✓ 1 Snippet Ramasamy VS, Nathan ABP, Choi MC, Kim SH, Ohn T.
In-Text Gene Mentions

…Huntingtin disease, expandedHttshifts to SGs…

Show Full Abstract

Stress granule (SG) formation has been linked to several neurodegenerative disorders, such as Alzheimer's disease (AD). Amyloid-β42 (Aβ42) is a key player in the pathogenesis of AD and is known to trigger various stress-related signaling pathways. However, the impact of Aβ on SG formation has not been fully understood. The primary aim of this study is to analyze the SG-inducing properties of Aβ42 and to uncover the molecular mechanisms underlying this process. Our results revealed that exposure to 20 μM Aβ42 led to a significant SG formation in neuroblastoma-derived (SH-SY5Y) and glioma-derived (U87) cell lines. Interestingly, we observed elevated levels of p-eIF2α, while overall protein translation levels remained unchanged. Monomeric and oligomeric forms of Aβ42 exhibited a 4-5 times stronger ability to induce SG formation compared to fibrillar forms. Additionally, treatment with familial mutants of Aβ42 (Dutch and Flemish) showed distinct effects on SG induction. Moreover, our findings using eIF2α kinases knockout (KO) cell lines demonstrated that Aβ-induced SG formation is primarily dependent on Protein Kinase R (PKR). Subsequent proximity ligation assay (PLA) analysis revealed a close proximity of PACT and PKR in Aβ-treated cells and in AD mouse hippocampus. Taken together, our study suggests that Aβ42 promotes SG formation through PKR kinase activation, which in turn requires PACT involvement.

Also flagged:TumorsLymphomatranslationalcancerantibodies
Journal Article 2025-02-18 No Snippets Belmonte B, Spada S, Allavena P, Benelli M, Bronte V, Casorati G, D'Ambrosio L, Ferrara R, Mondino A, Nisticò P, Sommaggio R, Tazzari M, Tripodo C, Sica A, Ferrucci PF.
Show Full Abstract

From 17 to 19th October 2024, the XXI Italian Network for Bio-Immunotherapy of Tumors Meeting (NIBIT) took place in Palermo, in the marvelous historical location of Teatro Politeama, under the auspices of the Italian Association of Medical Oncology (AIOM), Italian Association of Cancer Research (AIRC), Fondazione Pezcoller, Italian Alliance against Cancer (ACC), Italian Lymphoma Foundation (FIL), Grazia Focacci Foundation and Melagioco Foundation. The conference covered a spectrum of topics ranging from target discovery to therapeutic advances in immuno-oncology, bringing world-renowned experts to present groundbreaking innovations in basic, translational, and clinical cancer research. Six sessions focused on cellular therapies, digital pathology, vaccines, tertiary lymphoid structures, and microenvironment in order to get deep insights on how to personalize diagnosis and therapies in the clinical setting. Young investigators had the opportunity to meet and greet their mentors, promoting the synergy of the academic and industrial sectors within the national and international panorama, discussing the application of artificial intelligence on multi-specific antibodies, drug conjugates, and antibody fusion proteins that are advancing the efficacy of precision medicine and minimizing off-target effects.

PRDX6
Also flagged:Ferroptosisdeathtransferrin receptor protein 1lyso-phospholipidsinseminationoxygen
Journal Article 2025-02-18 ✓ 1 Snippet Hai E, Li B, Song Y, Zhang J, Zhang J.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6), have also been…

Show Full Abstract

<h4>Background</h4>Freezing-induced sperm damage, often associated with oxidative stress, can result in regulated cell death. Given that oxidative stress can trigger various forms of regulated cell death, the prevailing form during sperm cryopreservation remains unknown. Our study aimed to investigate this issue using cashmere goats as a model.<h4>Results</h4>We found a significant increase in lyso-phospholipids in frozen-thawed sperm suggested ferroptosis. Assessment of cryopreserved sperm, with or without prior treatment with ferroptosis or apoptosis inhibitors, demonstrated the significant efficacy of ferroptosis inhibitors in reducing freezing damage. This implicates ferroptosis as the primary form of regulated cell death induced during sperm cryopreservation. Additionally, the positive rate of transferrin receptor protein 1 was significantly lower in fresh live sperm (47.8%) than in thawed live sperm (71.5%), and the latter rate was lower than that in dead sperm (82.5%). By contrast, cleaved caspase-3 positivity showed no significant difference between fresh live sperm and thawed live sperm but was notably lower in thawed live sperm than in dead sperm.<h4>Conclusions</h4>Our findings establish ferroptosis as the dominant regulated cell death form during goat sperm cryopreservation, providing novel insights into freezing-induced sperm damage mechanisms. These findings have significant implications for optimizing cryopreservation protocols and enhancing sperm viability after freezing-thawing.

Also flagged:ResveratrolSIRT1NF-κBdepressionunpredictable mild stresspathogenesis
Journal Article 2025-02-18 No Snippets Wu Y, Zhu Y, Zheng S, Mingxing D.
Show Full Abstract

<h4>Background</h4>Currently, the pathogenesis of depression remains poorly understood, leading to many patients receiving ineffective treatment. Resveratrol has demonstrated beneficial effects in the prevention and treatment of depression. However, it remains unknown whether resveratrol administration can counteract depression-like behaviors by regulating the SIRT1/NF-κB signaling pathway.<h4>Methodology/principal findings</h4>Male C57BL/6 mice were randomly assigned to a control group, a depression group, and a resveratrol group. The depression model was established using chronic unpredictable mild stress (CUMS) for 5 weeks. Behavioral tests were conducted to assess depressive-like behaviors. The expression levels of SIRT1 and NF-κB in the hippocampus of mice and BV2 microglial cells were measured. After 5 weeks of modeling, the results indicated that mice in the depression group exhibited significant depressive-like behaviors and inhibited activation of the SIRT1/NF-κB signaling pathway. In contrast, resveratrol administration effectively reversed these changes. Results from in vitro experiments showed that LPS stimulation increased microglial activity and downregulated the SIRT1/NF-κB signaling pathway in microglia; however, resveratrol treatment mitigated these effects.<h4>Conclusions/significance</h4>Our findings suggested that resveratrol can alleviate CUMS-induced depression-like behaviors via the activation of the Sirt1/NF-κB pathway in microglia.

VRK2
Also flagged:colorectal cancerprotein kinasetumorcell growthcancerscancer
Journal Article 2025-02-18 ✓ 5 Snippets Wu YT, Gao M, Cheng KY, Li L, Wang BQ, He YN, Zhang Y, Liu XY, Du RL, Li GQ, Liang YX, Zhang JF, Zhang XD, Liu Y.
In-Text Gene Mentions

VRK2promotes colorectal cancer…

Vaccinia-Related Kinase 2Kinase 2 (VRK2),…

…Vaccinia-Related Kinase 2 (VRK2), a member of…

…this study assessesVRK2expression across 33…

VRK2's influence extends across…

Show Full Abstract

Vaccinia-Related Kinase 2 (VRK2), a member of the vaccinia virus-related protein kinase family, is crucial in regulating apoptosis and tumor cell growth signaling pathways. Despite its established roles in various cancers, investigations into its functions in colorectal cancer have been relatively limited. Utilizing The Cancer Genome Atlas and Genotype-Tissue Expression databases, this study assesses VRK2 expression across 33 cancer types, highlighting significant upregulation and diagnostic relevance, particularly in colorectal cancer, where it marks poor prognosis. VRK2's influence extends across multiple cancer-related signaling pathways, with focused experiments confirming its vital role in the E2F signaling pathway through transcriptomic sequencing and dual-luciferase reporter assays. Deletion of VRK2 markedly inhibits proliferation, cell cycle progression, migration, and tumorigenesis in colorectal cancer cells, whereas overexpression enhances these oncogenic traits. Additionally, VRK2 expression correlates with genomic instability and the tumor microenvironment, influencing antitumor immunity and response to immunotherapy. Importantly, our analysis reveals that VRK2 modulates the chemosensitivity of tumor cells, specifically enhancing resistance to the chemotherapeutic agent 5-FU. These findings underscore VRK2's multifaceted role in promoting colorectal cancer development and suggest its potential as a therapeutic target.

Also flagged:cancerproteasomeribosomal proteinscytoskeletonmembraneABC transporters
Journal Article 2025-02-18 No Snippets Martínez Fajardo C, López-Jiménez AJ, López-López S, Morote L, Moreno-Giménez E, Diretto G, Díaz-Guerra MJM, Rubio-Moraga Á, Ahrazem O, Gómez-Gómez L.
Show Full Abstract

Plant exosomes exhibit high stability and easy absorption, and have emerged as promising bioactive tools due to their potential health benefits and biomedical applications. Saffron tepals contain abundant metabolites with potential therapeutic properties and were used for exosome extraction by ultracentrifugation and gradient purification. The exosomes showed an average particle size of 151.5 ± 79.6 nm and exhibited a spherical morphology. Five well-conserved miRNAs-miR157, miR166, miR168, miR396, and miR398-were identified in the exosomes, which are involved in the coordination of growth and physiological plant responses with endogenous and environmental abiotic and biotic signals, and their potential targets in mammals are upregulated in specific cancer types and associated with inflammation. Proteome analysis revealed an enrichment of proteasome proteins, ribosomal proteins, and proteins involved in the cytoskeleton, transport across the membrane (ABC transporters), and vesicle trafficking (RAB GTPases, TM9SF and Coatomer subunits). Metabolite analyses showed mainly anthocyanins. The exosomes have selective stimulatory activity on macrophages, increasing the expression of surface molecules (<i>CD80</i> and <i>CD86</i>), and cytokines (<i>IL-1β</i>, <i>IL-6</i>, and <i>TNF-α</i>), but not the levels of <i>IL-10</i>. Overall, these results indicated that saffron flowers are an effective and abundant source of exosomes as new nanomedicines for human health.

Also flagged:Bladder Cancercancertumourscarcinoma in situNuclear matrix Protein 22Cytokeratins
Journal Article 2025-02-18 No Snippets Bitiņa-Barlote Ē, Bļizņuks D, Siliņa S, Šatcs M, Vjaters E, Lietuvietis V, Nakazawa-Miklaševiča M, Plonis J, Miklaševičs E, Daneberga Z, Gardovskis J.
Show Full Abstract

<b>Background/Objectives</b>: The timely diagnostics of bladder cancer is still a challenge in clinical settings. The reliability of conventional testing methods does not reach desirable accuracy and sensitivity, and it has an invasive nature. The present study examines the application of machine learning to improve bladder cancer diagnostics by integrating miRNA expression levels, demographic routine laboratory test results, and clinical data. We proposed that merging these datasets would enhance diagnostic accuracy. <b>Methods</b>: This study combined molecular biology methods for liquid biopsy, routine clinical data, and application of machine learning approach for the acquired data analysis. We evaluated urinary exosome miRNA expression data in combination with patient test results, as well as clinical and demographic data using three machine learning models: Random Forest, SVM, and XGBoost classifiers. <b>Results</b>: Based solely on miRNA data, the SVM model achieved an ROC curve area of 0.75. Patient analysis' clinical and demographic data obtained ROC curve area of 0.80. Combining both data types enhanced performance, resulting in an F1 score of 0.79 and an ROC of 0.85. The feature importance analysis identified key predictors, including erythrocytes in urine, age, and several miRNAs. <b>Conclusions</b>: Our findings indicate the potential of a multi-modal approach to improve the accuracy of bladder cancer diagnosis in a non-invasive manner.

Also flagged:brainagingmethylationsenile plaquescerebrovascular diseaseAD
Journal Article 2025-02-18 No Snippets Kuznetsov NV, Statsenko Y, Ljubisavljevic M.
Show Full Abstract

Over 400 articles on the pathophysiology of brain aging, neuroaging, and neurodegeneration were reviewed, with a focus on epigenetic mechanisms and numerous non-coding RNAs. In particular, this review the accent is on microRNAs, the discovery of whose pivotal role in gene regulation was recognized by the 2024 Nobel Prize in Physiology or Medicine. Aging is not a gradual process that can be easily modeled and described. Instead, multiple temporal processes occur during aging, and they can lead to mosaic changes that are not uniform in pace. The rate of change depends on a combination of external and internal factors and can be boosted in accelerated aging. The rate can decrease in decelerated aging due to individual structural and functional reserves created by cognitive, physical training, or pharmacological interventions. Neuroaging can be caused by genetic changes, epigenetic modifications, oxidative stress, inflammation, lifestyle, and environmental factors, which are especially noticeable in space environments where adaptive changes can trigger aging-like processes. Numerous candidate molecular biomarkers specific to neuroaging need to be validated to develop diagnostics and countermeasures.

SERPINC1
Also flagged:Glomerular Filtrationalbuminexcretionchronic kidney diseasekidney diseasepathogenesis
Journal Article 2025-02-18 ✓ 4 Snippets Khoza S, George JA, Naicker P, Stoychev SH, Mokoena RJ, Govender IS, Fabian J.
In-Text Gene Mentions

…FAM3C, EGF, andSERPINC1) as the highest…

…formation (SERPINA5 andSERPINC1), the common pathway…

…formation (SERPINA5 andSERPINC1), keratin sulphate biosynthes…

…(HSP90B1, IGFBP6, andSERPINC1).…

Show Full Abstract

Kidney function parameters including estimated glomerular filtration rate (eGFR) and urine albumin excretion are commonly used to diagnose chronic kidney disease (CKD). However, these parameters are relatively insensitive, limiting their utility for screening and early detection of kidney disease. Studies have suggested that urinary proteomic profiles differ by eGFR stage, offering potential insights into kidney disease pathogenesis alongside opportunities to increase the sensitivity of current testing strategies. In this study, we characterized and compared the urinary proteome across different eGFR stages in a Black African cohort from rural Mpumalanga Province, South Africa. We stratified 81 urine samples by eGFR stage (mL/min/1.73 m<sup>2</sup>): Stage G1 (eGFR ≥ 90; <i>n</i> = 36), Stage G2 (eGFR 60-89; <i>n</i> = 35), and Stage G3-G5 (eGFR < 60; <i>n</i> = 10). Urine proteomic analysis was performed using an Evosep One liquid chromatography system coupled to a Sciex 5600 TripleTOF in data-independent acquisition mode. Nonparametric multivariate analysis and receiver operating characteristic (ROC) curves were used to assess the performance of differentially abundant proteins (DAPs). Pathway analysis was performed on DAPs. Creatinine-based eGFR was calculated using the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation. In this study, thirty-eight urinary proteins were differentially abundant for eGFR Stages 3-5 when compared to Stages G1 (AUC = 0.95; CI: 0.86-1) and G2 (AUC = 0.84; CI: 0.64-0.98). Notably, only six urinary proteins (Cystatin M (CST6), glutathione hydrolase 6 (GGT6), sushi domain containing 2 (SUSD2), insulin-like growth factor binding protein 6 (IGFBP6), heat shock protein 90 beta family member 1 (HSP90B1), and mannosidase alpha class 1A member 1 (MAN1A1)) were differentially abundant when comparing Stage G1 and Stage G2 with a modest AUC = 0.81 (CI: 0.67-0.92). Pathway analysis indicated that DAPs were associated with haemostasis and fibrin clot formation. In a rural cohort from South Africa, the urinary proteome differed by eGFR stage, and we identified six differentially abundant proteins which, in combination, could help to differentiate earlier eGFR stages with higher predictive accuracy than the currently available tests.

Also flagged:MagnesiumHydroxyapatitechitosanpenicillinstreptomycinL-glutamine
Journal Article 2025-02-18 No Snippets Groza A, Hurjui ME, Yehia-Alexe SA, Staicu C, Bleotu C, Iconaru SL, Ciobanu CS, Ghegoiu L, Predoi D.
Show Full Abstract

Magnesium-doped hydroxyapatite/chitosan composite coatings produced by the radio-frequency magnetron sputtering technique were exposed to 5 MeV electron beams of 8 and 30 Gy radiation doses in a linear electron accelerator. The surfaces of unirradiated layers are smooth, while the irradiated ones exhibit nano-structures with sizes that increase from 60 nm at a 8 Gy dose to 200 nm at a 30 Gy dose. Young's modulus and the stiffness of the layers decrease from 58.9 GPa and 10 µN/nm to 5 GPa and 2.2 µN/nm, respectively, when the radiation doses are increased from 0 to 30 Gy. These data suggest the diminishing of the contribution of the chitosan to the elasticity of the magnesium-doped hydroxyapatite/chitosan composite layers after electron beam irradiation. The biological capabilities of the coatings were assessed before and after their immersion in RPMI-1640 cell culture medium for 7 and 14 days, respectively, and further cultured with a MG63 cell line (ATCC CRL1427) in Dulbecco's Modified Eagle Medium supplemented with fetal bovine serum, penicillin-streptomycin, and L-glutamine. Thus, 1 µm spherical structures were developed on the surfaces of the layers exposed to a 30 Gy radiation dose and immersed for 14 days in the RPMI-1640 biological medium. The molecular structures of all the RPMI-1640 immersed samples were modified by the growth of a carbonated hydroxyapatite layer characterized by a B-type substitution, as Fourier Transform Infrared Spectroscopy revealed. The biological assay proved the increased biocompatibility of the layers kept in RPMI-1640 medium and enhanced MG63 cell attachment and proliferation. Atomic force microscopy analysis indicated the elongated fibroblastic cell morphology of MG63 cells with minor alteration at 30 Gy irradiation doses as a result of layer biocompatibility modifications.

NEGR1
Also flagged:gene expressionneurogenesisextracellularbrainaginglong-term memories
Journal Article 2025-02-18 ✓ 1 Snippet Ramnauth AD, Tippani M, Divecha HR, Papariello AR, Miller RA, Nelson ED, Thompson JR, Pattie EA, Kleinman JE, Maynard KR, Collado-Torres L, Hyde TM, Martinowich K, Hicks SC, Page SC.
In-Text Gene Mentions

…NRG3 , andNEGR1( Figure 4C…

Show Full Abstract

The dentate gyrus of the hippocampus is important for many cognitive functions, including learning, memory, and mood. Here, we present transcriptome-wide spatial gene expression maps of the human dentate gyrus and investigate age-associated changes across the lifespan. Genes associated with neurogenesis and the extracellular matrix are enriched in infants and decline throughout development and maturation. Following infancy, inhibitory neuron markers increase, and cellular proliferation markers decrease. We also identify spatio-molecular signatures that support existing evidence for protracted maturation of granule cells during adulthood and age-associated increases in neuroinflammation-related gene expression. Our findings support the notion that the hippocampal neurogenic niche undergoes major changes following infancy and identify molecular regulators of brain aging in glial- and neuropil-enriched tissue.

BTN2A1
Also flagged:MR1butyrophilin 3A1pro-inflammatory cytokinespathogenesisCD8CD4
Journal Article 2025-02-18 ✓ 5 Snippets Loureiro JP, Vacchini A, Berloffa G, Devan J, Schaefer V, Nosi V, Colombo R, Beshirova A, Montanelli G, Meyer B, Sharpe T, Chancellor A, Recher M, Mori L, De Libero G.
In-Text Gene Mentions

…and butyrophilin 2A1 (BTN2A1) ( 22 –…

…interaction between theBTN2A1-B30.2 and BTN3A1-B30.2 domain…

…Without pAgs,BTN2A1and BTN3A1 ectodomains…

…supercomplex made ofBTN2A1homodimers and BTN3A1-3A2…

…TCR, with theBTN2A1binding the Vγ9…

Show Full Abstract

The TCR-mediated activation of T cells expressing the TCR Vγ9Vδ2 relies on an innate-like mechanism involving the butyrophilin 3A1, 3A2 and 2A1 molecules and phospho-antigens, without the participation of classical antigen-presenting molecules. Whether TCR Vγ9Vδ2 cells also recognize complexes composed of antigens and antigen-presenting molecules in an adaptive-like manner is unknown. Here, we identify MR1-autoreactive cells expressing the TCR Vγ9Vδ2. This MR1-restricted response is antigen- and CDR3δ-dependent and butyrophilin-independent. TCR gene transfer reconstitutes MR1-antigen recognition, and engineered TCR Vγ9Vδ2 tetramers interact with soluble MR1-antigen complexes in an antigen-dependent manner. These cells are present in healthy individuals with low frequency and are mostly CD8<sup>+</sup> or CD4-CD8 double negative. We also describe a patient with autoimmune symptoms and TCR γδ lymphocytosis in which ~10% of circulating T cells are MR1-self-reactive and express a TCR Vγ9Vδ2. These cells release pro-inflammatory cytokines, suggesting a possible participation in disease pathogenesis. Thus, MR1-self-antigen complexes can interact with some TCRs Vγ9Vδ2, promoting full cell activation and potentially contributing to diseases.

DCC
Also flagged:acute promyelocytic leukemialipidmetabolismpathogenesisPTK2lipoprotein
Journal Article 2025-02-18 ✓ 1 Snippet Wang S, Wang Q, Lv S, Qin L.
In-Text Gene Mentions

…GRB7, GRB2, CRK,DCC, TLN1, CASP7, PTPRA,…

Show Full Abstract

<h4>Background and purpose</h4>Dyslipidemia has been linked to acute promyelocytic leukemia (APL), with abnormal lipid metabolism observed during treatment. However, its role in APL pathogenesis remains unclear. This study investigates the relationship between serum lipid levels and clinical features, risk stratification, bleeding tendency, and prognosis of newly diagnosed APL patients, focusing on the role of the PTK2 gene in regulating lipid metabolism and its potential as a therapeutic target.<h4>Materials and methods</h4>We analyzed 90 newly diagnosed APL patients and 99 controls. Statistical analyses, including logistic regression, survival analysis, and protein-protein interaction (PPI) network, were used to assess lipid correlations with APL. Subgroup analyses explored specific clinical impacts, and functional experiments validated PTK2's role in lipid metabolism.<h4>Results</h4>Elevated triglycerides (TG) were positively associated with high-risk APL, while reduced high-density lipoprotein cholesterol (HDL-C) levels correlated with lower risk. Low-density lipoprotein cholesterol (LDL-C) was an independent prognostic marker, with lower levels linked to poorer outcomes. PTK2 expression significantly promoted APL cell proliferation, migration, and lipid metabolism, highlighting its role in APL pathogenesis. PTK2 regulates lipid metabolism-related factors, such as LDL and fibrinogen, through molecular pathways.<h4>Conclusion</h4>Dyslipidemia is closely related to APL, with TG and LDL-C levels being key prognostic indicators. PTK2 plays a crucial role in lipid metabolism regulation and APL progression, providing a new molecular basis for risk assessment and targeted therapy. These findings offer potential biomarkers for early diagnosis and personalized treatment strategies.

SOX6
Also flagged:sepsisimmune responseinfectionSepsis-cardiac dysfunctionpathogenesis
Journal Article 2025-02-18 ✓ 2 Snippets Liu Z, Li F, Li N, Chen Y, Chen Z.
In-Text Gene Mentions

…type HMG box (SOX6) and programmed cell…

…suggest that the miR-499-SOX6/PDCD4-Bcl2 signaling pathway …

Show Full Abstract

<h4>Introduction</h4>Sepsis, a life-threatening condition arising from an uncontrolled immune response to infection, can lead to organ dysfunction, with severe inflammation potentially causing multiple organ failures. Sepsis-induced cardiac dysfunction (SIMD) is a common and severe complication of sepsis, significantly increasing patient mortality. Understanding the pathogenesis of SIMD is crucial for improving treatment, and microRNAs (miRNAs) have emerged as important regulators in this process.<h4>Methods</h4>A comprehensive literature search was conducted in PubMed, Science Direct, and Embase databases up to September 2024. The search terms included ["miRNA" or "microRNA"] and ["Cardiac" or "Heart"] and ["Sepsis" or "Septic"], with the language limited to English. After initial filtering by the database search engine, Excel software was used to further screen references. Duplicate articles, those without abstracts or full texts, and review/meta-analyses or non-English articles were excluded. Finally, 106 relevant research articles were included for data extraction and analysis.<h4>Results</h4>The pathogenesis of SIMD is complex and involves mitochondrial dysfunction, oxidative stress, cardiomyocyte apoptosis and pyroptosis, dysregulation of myocardial calcium homeostasis, myocardial inhibitory factors, autonomic nervous regulation disorders, hemodynamic changes, and myocardial structural alterations. miRNAs play diverse roles in SIMD. They are involved in regulating the above-mentioned pathological processes.<h4>Discussion</h4>Although significant progress has been made in understanding the role of miRNAs in SIMD, there are still challenges. Some studies on the pathogenesis of SIMD have limitations such as small sample sizes and failure to account for confounding factors. Research on miRNAs also faces issues like inconsistent measurement techniques and unclear miRNA-target gene relationships. Moreover, the translation of miRNA-based research into clinical applications is hindered by problems related to miRNA stability, delivery mechanisms, off-target effects, and long-term safety. In conclusion, miRNAs play a significant role in the pathogenesis of SIMD and have potential as diagnostic biomarkers. Further research is needed to overcome existing challenges and fully exploit the potential of miRNAs in the diagnosis and treatment of SIMD.

HFE
Also flagged:sarcopeniachronic liver diseaseobesityliver diseaseMetabolic dysfunction-associatedsteatotic liver disease
Journal Article 2025-02-18 ✓ 1 Snippet Amer J, Abdoh Q, Salous Z, Alsoud EA, AbuBaker S, Salhab A, Badrasawi M.
In-Text Gene Mentions

…se, α1-antitrypsin deficiency,hemochromatosis, autoimmune liver disease,…

Show Full Abstract

<h4>Background</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) is a chronic liver disease linked to several adverse health consequences that include metabolic disturbances affecting skeletal muscle. Sarcopenia, characterized by skeletal muscle loss, is commonly observed in individuals with MASLD. Our study aimed to identify modifiable lifestyle factors associated with sarcopenia in patients with MASLD.<h4>Methods</h4>This study was a cross-sectional study that was conducted in three clinics in Nablus. A total of 162 adults diagnosed with MASLD were recruited for the study. The patients were interviewed and instructed to provide the necessary information, such as sociodemographic factors, medical and surgical history, lifestyle information, MASLD-related data, and nutritional and functional status. Sarcopenia was defined using the Foundation for the National Institutes of Health (FNIH) criteria, which includes the weight-adjusted skeletal muscle index (wSMI) with the cut-off scores (male subjects: 35.7% and female subjects: 30.7%). Statistical analysis was conducted using SPSS v.21. A chi-squared or independent samples t-test was utilized to identify the factors linked to sarcopenia in the study sample.<h4>Results</h4>Our data found that 44% of MASLD patients had sarcopenia. This condition was significantly associated with female gender (<i>p</i> < 0.0001), older age (p < 0.0001), presence of chronic diseases (<i>p</i> < 0.035), and medication use (<i>p</i> < 0.05). Regarding nutritional factors, sarcopenia had a significant association with obesity, a higher body fat percentage, a high waist-to-hip ratio, a low mid-upper arm circumference, and a reduced calf circumference (<i>p</i> < 0.001). Sarcopenic individuals often exhibit reduced handgrip strength. Lifestyle factors such as a history of smoking and the type of smoking were found to be positively associated with sarcopenia (<i>p</i> < 0.0001).<h4>Conclusion</h4>Sarcopenia was prevalent in the study population and was linked to modifiable risk factors that can be managed to reduce its progression. Future research using different study designs, such as longitudinal design, is recommended to identify the determinants of sarcopenia. Intervention studies are also required to improve the nutritional and functional status of MASLD patients.

SERPINC1
Also flagged:Hepatocellular carcinomacancerpathogenesisETNK1BICRAIL1R1
Journal Article 2025-02-18 ✓ 1 Snippet Rahimi-Farsi N, Ghorbani A, Mottaghi-Dastjerdi N, Shahbazi T, Bostanian F, Mohseni P, Yazdani F.
In-Text Gene Mentions

…four proteins, includingSERPINC1, SELP, and MYC,…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a leading cause of cancer-related mortality worldwide. This study aimed to explore the role of hsa-miR-101-3p in HCC pathogenesis by identifying key genes and pathways. A comprehensive bioinformatics analysis revealed twelve hub genes (ETNK1, BICRA, IL1R1, KDM3A, ARID2, GSK3β, EZH2, NOTCH1, SMARCA4, FOS, CREB1, and CASP3) and highlighted their involvement in crucial oncogenic pathways, including PI3K/Akt, mTOR, MAPK, and TGF-β. Gene expression analysis showed significant overexpression of ETNK1, KDM3A, EZH2, SMARCA4, and CASP3 in HCC tissues, correlating with poorer survival outcomes. Drug screening identified therapeutic candidates, including Tazemetostat for EZH2 and lithium compounds for GSK3β, underscoring their potential for targeted treatment. These findings provide novel insights into the complexity of HCC pathogenesis, suggesting that the identified hub genes could serve as diagnostic or prognostic biomarkers and therapeutic targets. While bioinformatics-driven, this study offers a strong basis for future clinical validation to advance precision medicine in HCC.

MLLT10
Also flagged:Breast Cancermigraineestrogen receptorERMCP
Journal Article 2025-02-18 ✓ 1 Snippet Yang H, Xie X, Lin L, Tan Z, Liu Z, Zhang Y, Ji F, Che Y.
In-Text Gene Mentions

…rs2183271, located inMLLT10gene, in regulating…

Show Full Abstract

<h4>Objective</h4>To evaluate potential genetic causal relationships between chronic pain subtypes like migraine and multi-site chronic pain (MCP) and their impact on breast cancer occurrence and survival rates.<h4>Background</h4>The association between chronic pain and breast cancer was reported before, yet the causal nature between them remained uncertain.<h4>Methods</h4>Data on chronic pain and breast cancer were sourced from publicly available European genome-wide association study (GWAS) datasets. Genetic association between chronic pain and breast cancer phenotypes was assessed using linkage disequilibrium genetic correlation (LDSC). Colocalization analysis further identified potential shared causal variation. Based on Inverse variance weighted method, 2-sample Mendelian Randomization (MR) was conducted to investigate causal associations between migraine, MCP, and breast cancer or breast cancer survival. Sensitive analysis was conducted to ensure the absence of heterogeneity and horizontal pleiotropy.<h4>Results</h4>LDSC demonstrated significant genetic correlations between migraine and both estrogen receptor-negative (ER-) and overall breast cancer, while also revealing a notable genetic association between MCP and ER- and ER+ breast cancer, as well as overall breast cancer. Through colocalization analysis, potential involvement of rs2183271, located in MLLT10 gene, in regulating MCP and ER+ breast cancer was identified. MR analysis revealed the association between migraine and elevated risk of ER- breast cancer (IVW, P = 4.95 × 10<sup>-3</sup>). Cochran's Q test ensured the absence of heterogeneity and MR-PRESSO global test, MR-Egger intercept test ensured the absence of horizontal pleiotropy.<h4>Conclusion</h4>Our results provided new insights into the role of migraine and MCP in breast cancer, paving the way for targeted preventive strategies and future investigations.

STAU1
Also flagged:major depressive disorderIL-6interleukin 6Immune dysregulationmental illnessimmune responses
Journal Article 2025-02-18 ✓ 1 Snippet Wiström ED, O'Connell KS, Koch E, Jaholkowski P, Hindley GFL, Steen NE, Parekh P, Charge Consortium, Frei O, Parker N, Shadrin A, Djurovic S, Dale A, Andreassen OA, Smeland OB.
In-Text Gene Mentions

…gene staufen1 (STAU1) , which specifically…

Show Full Abstract

<h4>Background</h4>Immune dysregulation may contribute to the pathophysiology of major depressive disorder (MDD). Here we aimed to identify genetic architecture jointly associated with MDD, white blood cell (WBC) count and interleukin 6 (IL-6) levels.<h4>Methods</h4>Using genome-wide association studies summary statistics on MDD (330,173 cases and 727,595 controls), WBC counts (<i>n</i> <sub><i>max</i></sub> = 563,946) and IL-6 (<i>n</i> = 52,654), we performed linkage disequilibrium (LD) score regression, bivariate causal mixture model (MiXeR), conjunctional false discovery rate (conjFDR) and Mendelian randomization (MR) analyses. Additionally, we used an independent MDD dataset (9,582 cases and 84,670 controls) from the Norwegian Mother, Father and Child Cohort Study for polygenic risk score (PRS) analyses.<h4>Findings</h4>We found a significant positive genetic correlation (rg = 0.22) between MDD and IL-6. MiXeR estimates indicated substantial differences in the polygenicity of MDD (13.7K variants), WBC subgroups (0.8K-1.8K variants), and IL-6 (0.2K variants), with 10.1 %-31.4 % of the variants influencing WBC subgroups overlapping with MDD. We identified MDD risk loci shared with basophils (8), eosinophils (17), lymphocytes (23), monocytes (14), neutrophils (20), and total WBC counts (20), as well as two loci shared between MDD and IL-6, at conjFDR <i><</i>0.05. PRS analysis showed a weak, but significantly increased risk for MDD dependent on monocyte count.<h4>Limitations</h4>The analyses only included European ancestry samples, and the causal genes associated with the identified genetic loci were not experimentally validated.<h4>Conclusions</h4>MDD shares genetic underpinnings with immune system components, which implicates immune- mediated pathways in the pathophysiology of MDD. However, this connection may only be relevant for a minority of patients.

Also flagged:complement activation componentephrin receptorsinflammatory responsesmetabolism16S rRNAV3-V4
Journal Article 2025-02-18 No Snippets Hinsu A, Dai X, Dadousis C, Hay M, Fosso B, Crotta M, Pandit R, Guitian J, Tomley F, Koringa P, Joshi C, Blake D, Psifidi A.
Show Full Abstract

Enteric microbiota plays a crucial role in the health and productivity of poultry, including influences on nutrient absorption, immune function, and pathogen resistance. In this study, we conducted a genome-wide association study (GWAS) to identify host genetic variants associated with selected bacterial genera found in chickens. We used high-density 600K SNP Affymetrix DNA arrays for genotyping, alongside 16S rRNA gene sequencing to profile caecal microbiota from the same individual chickens. A commercial broiler line (Cobb400, n = 300) and an indigenous (Kadaknath, n = 300) chicken breed from India were investigated, allowing for a comprehensive cross-ecotype analysis. Our analysis identified several host-genetic markers and candidate genes associated with the presence and abundance of specific bacterial genera with known pathogenic or commensal roles, and with specific caecal Enterotypes. Whole-genome sequencing data were then used to further investigate candidate regions around significantly associated variants from the high-density DNA array. Of note, we found markers nearby the genes coding for classical complement activation component C1q, ephrin receptors, and other immunity and inflammatory responses as well as genes coding for products associated with vitamin and co-factor metabolism. The results underscore the impact that host genetics has on the regulation of the gut microbiota and highlights potential pathways through which host genetic variation influences host-bacterial crosstalk and potentially modulates microbial community structure. These findings contribute to the growing understanding of the genetic basis of host-microbiota interactions and offer new avenues for improving poultry health and productivity through selective breeding strategies targeting the microbiome.

medRxiv 2025-02-18 Preprint (No Snippets API) Namuli KL, Drögemöller BI, Wright GE.
Show Full Abstract

<h4>Background</h4> Polyglutamine (polyQ) disorders, such as Huntington disease (HD) and several spinocerebellar ataxias, are severe neurological disorders caused by glutamine codon repeat expansions. These conditions lack effective treatments, with therapeutic research focused on pathogenic gene knockdown. <h4>Objectives</h4> We aimed to profile these genes using diverse human genomic data to inform therapeutic strategies by identifying new biology and assessing the potential on-target effects of knocking down these genes. <h4>Methods</h4> We conducted an unbiased phenome-wide study to identify human traits and diseases linked to polyQ disorder genes (Open Targets L2G>0.5). Network analyses explored shared trait associations and overlapping biological processes among these genes. Lastly, we assessed the theoretical druggability of polyQ disorder genes using recently identified features predictive of clinical trial success and compared them to repeat expansion (HD) modifier genes. <h4>Results</h4> We identified 215 human phenotype/polyQ disorder gene associations from 3,095 studies, indicating potential adverse effects from gene knockdown. Shared trait associations among genes suggested overlapping biological processes despite distinct functions. Drug target profile analysis revealed unfavorable risk profiles for polyQ disorder genes, particularly ATN1 , ATXN1 , ATXN7 , and HTT , due to genomic features such as constraint, molecular interactions, and tissue specificity. PolyQ disorder genes also showed significantly more safety-related risks than HD genetic modifier genes ( P =7.03×10 -3 ). <h4>Conclusion</h4> Our analyses emphasize the pleiotropic nature of polyQ disorder genes, highlighting their potential risks as drug targets. These findings reinforce the importance of exploring alternative therapeutic strategies, such as targeting genetic modifier genes, as well as allele-selective approaches, to mitigate these challenges.

Also flagged:hyaluronic acidnitrilotriacetic acidbindingProteinSynthesisprotein synthesis
Journal Article 2025-02-17 No Snippets Kaufmann A, Ivanova K, Thiele J.
Show Full Abstract

Cell-like platforms are being studied intensively for their application in synthetic biology to mimic aspects of life in an artificial environment. Here, micrometer-sized, bifunctional microgels are used as an experimental platform to investigate the interplay of cell-free protein synthesis (CFPS) and in situ protein accumulation inside the microgel volume. In detail, microgels made of hyaluronic acid (HA) are first modified with different amounts of nitrilotriacetic acid (NTA) moieties to characterize the capability and maximum capacity of binding His-tag modified GFP. CFPS is optimized for the system used here, particularly when using a linear DNA template. Afterward, HA-microgels are functionalized with the linear DNA template and Ni<sup>2+</sup>-activated NTA moieties to bind in situ synthesized GFP-His. CFPS and parallel protein accumulation within the microgels are observed over time to determine the GFP-His binding to the microgel platform. With this approach, the study presents the first steps for a platform to study the temporal-spatial regulation of protein synthesis by tailored protein binding or release from the microgel matrix-based reaction environment.

DCC
Also flagged:TumorCancerCysticbiliary tract cancerscancersperihilar cholangiocarcinoma
Journal Article 2025-02-17 ✓ 2 Snippets Ushida Y, Watanabe N, Kawakatsu S, Yamamoto R, Mizuno T, Onoe S, Yokoyama Y, Kokuryo T, Igami T, Yamaguchi J, Sunagawa M, Baba T, Shimoyama Y, Ebata T.
In-Text Gene Mentions

…20 had PCC,DCC, and CDC, respectively;…

…classifications of PCC,DCC, and CDC significantly…

Show Full Abstract

<h4>Objective</h4>To propose a shared T classification system for biliary tract cancers located around the cystic duct junction.<h4>Summary background data</h4>These cancers include perihilar cholangiocarcinoma (PCC), distal cholangiocarcinoma (DCC), and cystic duct carcinoma (CDC), which are staged according to discrete tumor classification.<h4>Methods</h4>From 2011 to 2019, patients with biliary tract cancers that clinically invaded the junction (junctional cholangiocarcinoma [JCC] ) were classified as having PCC, DCC, CDC, or unclassifiable tumor (UT) based on topologic predominance. The prognostic stratifying ability of the specific American Joint Committee on Cancer T system and depth-based classification were compared between patients with JCC and UT.<h4>Results</h4>Among 191 patients with JCC, 63, 20, and 20 had PCC, DCC, and CDC, respectively; the remaining 88 (46%) had UT. The DCC group showed a better survival rate of 70% at 5 years than the other groups (48% for UT, 36% for PCC, and 29% for CDC). Specific tumor classifications of PCC, DCC, and CDC significantly stratified survival in 88 patients with UT, with c-indices of 0.611, 0.613, and 0.563, respectively. Stratified by depth-based classification (T1, ≤1 mm; T2, >1-5; T3, 6-10; and T4, >10 mm), the 5-year survival rates were 83%, 67%, 44%, and 0% in the UT cohort ( P <0.001, C-index, 0.654) and 88%, 60%, 41%, and 24% in the entire JCC cohort ( P <0.001, C-index, 0.632), respectively.<h4>Conclusions</h4>The depth-based T classification significantly stratified survival in the clinical category of JCC and histologically defined UT. Cholangiocarcinoma and CDC in this region can be grouped under the banner of the JCC.

HFE
Also flagged:Vitamin Emetabolic dysfunction-associated steatohepatitisiron deficiencymetabolic dysfunction-associatedsteatotic liver diseasegene expression
Journal Article 2025-02-17 ✓ 1 Snippet Podszun MC, Alawad AS, Lingala S, Morris N, Huang WCA, Rotman Y.
In-Text Gene Mentions

HFE

Show Full Abstract

Vitamin E is an effective treatment for metabolic dysfunction-associated steatohepatitis (MASH) but associated with hemorrhagic complications when used for other indications. We aimed to determine the risk of developing iron deficiency during treatment of metabolic dysfunction-associated steatotic liver disease (MASLD) with vitamin E. Iron status was monitored prospectively in 20 people with MASLD treated with 200 - 800 IU/d vitamin E (https://clinicaltrials.gov/study/NCT01792115). To gain mechanistic insights liver histology, hepatic gene expression, hepatic 4-hydroxynonenal, haptoglobin genotype and plasma vitamin E levels were assessed. We found iron deficiency to occur in 11/20 subjects (55%) after a median 11 weeks (range 4-13) of vitamin E treatment, and anemia to occur in 6 of the 11 (30% of study population) after 23 weeks (16-36). Ferritin (84.5 ± 85.2 to 47.8 ± 54.9μg/L, <i>p</i> < 0.001) and mean corpuscular volume (MCV, 86.2 ± 4.9 to 84.3±4.3fL, <i>p</i> = 0.003) significantly decreased, with a concomitant rise in red-cell distribution width (RDW, 13.4 ± 1.3 to 14.4 ± 1.9%, <i>p</i> = 0.003). A gastrointestinal bleeding source was found in 75% of subjects with complete work-up. Iron deficiency occurred in all diabetics vs. 47% of non-diabetics (<i>p</i> 0.007). Iron deficiency risk was not associated with cirrhosis, platelet count, prothrombin time, haptoglobin genotype, or plasma vitamin E level. Changes in hepatic gene expression and oxidative stress were suggestive of an extrahepatic effect. Iron deficiency resolved with appropriate care even with continued vitamin E treatment. We conclude that occult gastrointestinal bleeding and iron deficiency were frequently observed during vitamin E treatment, possibly reflecting an effect on platelet function. Close monitoring is warranted during the first months of treatment, especially in diabetics and subjects with risk factors for gastrointestinal bleeding.

Also flagged:cytosinealbinismAxenfeld‐Rieger syndromeHermansky‐Pudlak syndromefmsnucleotide
Journal Article 2025-02-17 No Snippets Zheng S, Liu Y, Xia X, Xiao J, Ma H, Yuan X, Zhang Y, Chen Z, Peng G, Li W, Fei JF, Liu Y.
Show Full Abstract

Single-nucleotide variants (SNVs) represent a significant form of genetic variation linked to various diseases. CRISPR-mediated base editing has emerged as a powerful method for modeling diseases caused by SNVs, particularly in zebrafish, which serve as an excellent platform for investigating disease mechanisms and conducting drug screenings. However, existing cytosine base editors (CBEs) for zebrafish often have broad editing windows and strong sequence preferences, limiting their effectiveness. In this study, zebrafish (z) TadA-derived cytosine base editors, termed zTadA-CBEs, are developed by introducing key mutations into the TadA8e enzyme. These novel editors demonstrate improved efficiency and precision in cytosine base editing. Specifically, zTadA-BE4max and zTadA-BEmv offer complementary editing windows, while zTadA-SpRY-BE4max allows for PAM-flexible editing. Using zTadA-CBEs, a precise disease model for Axenfeld-Rieger syndrome is established, and created two new models for Hermansky-Pudlak syndrome. Additionally, a novel albinism model carrying two pathogenic SNVs in the F0 generation is developed. By employing specifically designed sgRNA, the fms<sup>ts±</sup> missense mutation is corrected back to the wild-type nucleotide (C > T), successfully restoring macrophage levels to normal. These findings underscore the potential of zTadA-CBEs to enhance genome editing techniques and their applications in developing therapies for SNV-related disorders.

Also flagged:degradationsarcopeniamuscular dystrophiescalciummitochondrialaging
Journal Article 2025-02-17 No Snippets Niasse-Sy Z, Zhao B, Lenardič A, Luong HTT, Bar-Nur O, Auwerx J, Wohlwend M.
Show Full Abstract

Fast twitch muscle fibers are prone to degradation in skeletal muscle pathologies, such as sarcopenia and muscular dystrophies. We previously showed that the exercise-induced long noncoding RNA CYTOR promotes fast-twitch myogenesis. Here, we identify an independent functional element within human CYTOR, and optimize its RNA delivery. In human primary myoblasts exogenous CYTOR exon 2 recapitulates the effect of full-length CYTOR by boosting fast-twitch myogenic differentiation. Furthermore, chemically modified CYTOR exon 2 RNA<sup>ΨU</sup> (N1-me-PseudoU, 7-methyl guanosine 5'Cap, polyA) enhances RNA stability and reduces immunogenicity to CYTOR<sup>exon2</sup> RNA. Viral- or chemically optimized RNA-mediated CYTOR<sup>exon2</sup> administration drives commitment toward myogenic maturation in Duchenne muscular dystrophy-derived primary myoblasts, myogenic progenitor cells, and mouse embryonic stem cells. Furthermore, CYTOR<sup>exon2, m1ΨU</sup> improves key disease characteristics in dystrophic myotubes, including calcium handling and mitochondrial bioenergetics. In summary, we identify CYTOR exon 2 as the functional domain of CYTOR that can be delivered in a disease context using chemical modifications. This is of particular importance given the susceptibility of fast muscle fibers in different muscle pathologies such as aging and dystrophies, and the oncogenic effect of CYTOR exon 1. This study, therefore, highlights the potential of identifying functional domains in noncoding RNAs. Delivery, or targeting of RNA domains might constitute next-generation RNA therapeutics.

Also flagged:tumoroxygenHydroxyapatiteNanospheresCancercatalase
Journal Article 2025-02-17 No Snippets Li M, Liu Q, Xie S, Weng D, He J, Yang X, Liu Y, You J, Liao J, Wang P, Lu X, Zhao J.
Show Full Abstract

Despite the promise of sonodynamic therapy (SDT)-mediated immunotherapy, the anticancer efficacy of current sonosensitizers is greatly limited by the immunosuppressive tumor microenvironment (TME) and their inability to selectively respond to it. Herein, oxygen vacancy-rich MnO<sub>2</sub>@hydroxyapatite (Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) core-shell nanospheres (denoted as O<sub>v</sub>-MO@CPO) as an advanced TME-responsive sonosensitizer for sonodynamic immunotherapy is demonstrated. The O<sub>v</sub>-MO@CPO maintains its structural integrity under neutral conditions but dissolves the pH-sensitive hydroxyapatite shell under acidic TME to release active oxygen vacancy-rich MnO<sub>2</sub> core, which reinvigorates H<sub>2</sub>O<sub>2</sub> consumption and hypoxia alleviation due to its catalase-like activity. Furthermore, the introduced oxygen vacancies optimize the electronic structure of O<sub>v</sub>-MO@CPO, with active electronic states near the Fermi level and higher d-band center. It results in accelerated electron-hole pair separation and lower catalytic energy barriers to boost ultrasound (US)-initiated ROS production. These multimodal synergistic effects effectively reverse the immunosuppressive tumor microenvironment, inhibiting tumor growth and metastasis in 4T1 tumor-bearing mice. No evident toxic effects are observed in normal mouse tissues. Additionally, when combined with an immune checkpoint inhibitor, O<sub>v</sub>-MO@CPO-mediated SDT further improves the effectiveness of immunotherapy. This work affords a new avenue for developing TME-dependent sonosensitizers for SDT-mediated immunotherapy.

Also flagged:learning disabilitiessubstance misuseorganic impairmentssynthesisCASPanxiety
Journal Article 2025-02-17 No Snippets Yang J, Glover N, Wood L.
Show Full Abstract

<h4>Purpose</h4>Crisis home treatment teams (CHTTs) provide rapid at-home assessments and crisis support to individuals experiencing mental health crises. Exploring patient feedback on CHTTs can provide policymakers and service planners useful insight regarding service enhancements and improvements in care quality. The current systematic review aims to explore patient experiences on CHTTs, to inform policy decision-making and care quality.<h4>Method</h4>The current review synthesised ten eligible qualitative studies (from Medline, PsycINFO, Embase and CINAHL) on patient experiences of CHTTs using thematic synthesis. Adult patients with a past or current experience of CHTTs, as well as a mental health diagnosis were included in the review.<h4>Results</h4>The current review revealed that patients valued the rapid accessibility of services and positive characteristics of staff that contributed to cultivating strong therapeutic relationships. Patients also appreciated having equal power in treatment decision-making. However, concerns were raised regarding staff timekeeping, receiving generic treatment not well-tailored to patient's unique circumstances, and inconsistencies in continuity of service delivery and smooth transition to other services.<h4>Conclusions</h4>Patient feedback on service improvements are useful for service planners and policymakers to improve CHTT services. Based on the results of this study, the importance of staff timeliness, having a smooth transition during the end of care, and tailored staff training for various demographics can improve CHTT service quality and delivery. Further qualitative research is needed to gain a comprehensive understanding of patient needs and experiences in various regions and demographics.

CSE1LZNFX1
Also flagged:cancermitochondrialcancersRhoAnucleotideneoplasms
Journal Article 2025-02-17 ✓ 2 Snippets Kellman LN, Neela PH, Srinivasan S, Siprashvili Z, Shanderson RL, Hong AW, Rao D, Porter DF, Reynolds DL, Meyers RM, Guo MG, Yang X, Zhao Y, Wozniak GG, Donohue LKH, Shenoy R, Ko LA, Nguyen DT, Mondal S, Garcia OS, Elcavage LE, Elfaki I, Abell NS, Tao S, Lopez CM, Montgomery SB, Khavari PA.
In-Text Gene Mentions

CSE1L

ZNFX1

Show Full Abstract

Single-nucleotide variants (SNVs) in regulatory DNA are linked to inherited cancer risk. Massively parallel reporter assays of 4,041 SNVs linked to 13 neoplasms comprising >90% of human malignancies were performed in pertinent primary human cell types and then integrated with matching chromatin accessibility, DNA looping and expression quantitative trait loci data to nominate 380 potentially regulatory SNVs and their putative target genes. The latter highlighted specific protein networks in lifetime cancer risk, including mitochondrial translation, DNA damage repair and Rho GTPase activity. A CRISPR knockout screen demonstrated that a subset of germline putative risk genes also enables the growth of established cancers. Editing one SNV, rs10411210 , showed that its risk allele increases rhophilin RHPN2 expression and stimulus-responsive RhoA activation, indicating that individual SNVs may upregulate cancer-linked pathways. These functional data are a resource for variant prioritization efforts and further interrogation of the mechanisms underlying inherited risk for cancer.

SOX6
Also flagged:brain developmentembryogenesisgene expressionorganizationchromatinchromosome
Journal Article 2025-02-17 ✓ 1 Snippet Clarence T, Bendl J, Cao X, Wang X, Zheng S, Hoffman GE, Kozlenkov A, Hong A, Iskhakova M, Jaiswal MK, Murphy S, Yu A, Haroutunian V, Dracheva S, Akbarian S, Fullard JF, Yuan GC, Lee D, Roussos P.
In-Text Gene Mentions

SOX6

Show Full Abstract

Human brain development spans from embryogenesis to adulthood, with dynamic gene expression controlled by cell-type-specific cis-regulatory element activity and three-dimensional genome organization. To advance our understanding of postnatal brain development, we simultaneously profiled gene expression and chromatin accessibility in 101,924 single nuclei from four brain regions across ten donors, covering five key postnatal stages from infancy to late adulthood. Using this dataset and chromosome conformation capture data, we constructed enhancer-based gene regulatory networks to identify cell-type-specific regulators of brain development and interpret genome-wide association study loci for ten main brain disorders. Our analysis connected 2,318 cell-specific loci to 1,149 unique genes, representing 41% of loci linked to the investigated traits, and highlighted 55 genes influencing several disease phenotypes. Pseudotime analysis revealed distinct stages of postnatal oligodendrogenesis and their regulatory programs. These findings provide a comprehensive dataset of cell-type-specific gene regulation at critical timepoints in postnatal brain development.

SERPINC1
Also flagged:ataxiaposturecognitive impairmentbehavioralwaterethanol
Journal Article 2025-02-17 ✓ 1 Snippet Zhou L, Song C, Yang H, Zhao L, Li X, Sun X, Gao K, Guo J.
In-Text Gene Mentions

…only two genes (Serpinc1and Ccl19) overlapped…

Show Full Abstract

A study was conducted to evaluate the three-dimensional clinostat simulated microgravity effect on mouse models, focusing on the central nervous system. Eighteen mice were divided into three groups: control, survival box, and clinostat + survival box. Behavioral tests, femur micro-CT, brain transcriptomics, serum metabolomics, and fecal microbiomics were performed. Results showed decreased activity, altered gait, enhanced fear memory, bone loss, immune/endocrine changes in brain transcriptome, and altered metabolic pathways in serum and gut microbiota in clinostat-treated mice. The model closely mimics spaceflight-induced transcriptome changes, suggesting its value in studying microgravity-related neurological alterations and highlighting the need for attention to emotional changes in space.

SERPINC1
Also flagged:peripheral artery diseasediabetes mellitusatherosclerosislipoproteindiabetesnon-communicable disease
Journal Article 2025-02-17 ✓ 1 Snippet Haile KE, Asgedom YS, Azeze GA, Amsalu AA, Kassie GA, Gebrekidan AY.
In-Text Gene Mentions

…of anticoagulants like ant-thrombin-IIIand protein C,…

Show Full Abstract

<h4>Background</h4>Diabetes is a non-communicable disease that presents a substantial public health challenge on a global scale. Peripheral artery disease is a significant macrovascular problem in diabetes mellitus characterized by atherosclerotic narrowing of the artery in the lower extremities, leading to compromised distal perfusion, primarily caused by atherosclerosis, and resulting in impaired functional capacity. Although existing studies on, peripheral artery disease among patients with diabetes mellitus are available, the results have been inconsistent.<h4>Objective</h4>To determine the pooled burden and associated factors of peripheral artery disease among patients with diabetes mellitus in sub-Saharan Africa.<h4>Methods</h4>A systematic review and meta-analysis were performed following the guidelines established by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses. To identify papers published in English up to August 10, 2024, the electronic databases of Medline, Science Direct, Excerpta Medica Database, Cochrane Library, African Journals Online, and Google Scholar were searched. A random-effects model was employed to estimate the pooled prevalence and associated factors of peripheral artery disease. To test for heterogeneity between studies and publication bias, forest plots and funnel plots were used.<h4>Results</h4>This study revealed that the pooled prevalence of peripheral artery disease among patients with diabetes mellitus was 32.97% (95% CI 29.7, 36.24), reflecting the significant impact of diabetes mellitus on vascular health. Age (OR = 2.51, 95% CI = 3.41-12.09), increased level of low density lipoprotein (OR = 1.64, 95% CI = 1.05-13.09), BMI (OR = 3.03, 95% CI = 1.74-7.56), and illness duration exceeding 10 years (OR = 2.44, 95% CI = 1.12-5.13), were the significant predictors.<h4>Conclusion</h4>Despite the alarming prevalence of peripheral artery disease among patients with diabetes in sub-Saharan Africa, it remains underdiagnosed; therefore, increased awareness, proactive screening initiatives, and management strategies within the clinical setting are necessary.<h4>Clinical trial number</h4>Not applicable.<h4>Prospero</h4>CRD42024594577.

Also flagged:colorectal cancertumorepithelial-to-mesenchymal transitionTGF-βPD-L1PD-L2
Journal Article 2025-02-17 No Snippets Tout I, Bougarn S, Toufiq M, Gopinath N, Hussein O, Sathappan A, Chin-Smith E, Rehaman F, Mathew R, Mathew L, Wang K, Liu L, Salhab A, Soloviov O, Tomei S, Hasan W, Da'as S, Bejaoui Y, Hajj NE, Maalej KM, Dermime S, Rasul K, Dellabona P, Casorati G, Turdo A, Todaro M, Stassi G, Ferrone S, Wang X, Maccalli C.
Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) initiating cells (CICs) possess self-renewal capabilities and are pivotal in tumor recurrence and resistance to conventional therapies, including immunotherapy. The mechanisms underlying their interaction with immune cells remain unclear.<h4>Methods</h4>We conducted a multi-omics analysis-encompassing DNA methylation, total RNA sequencing, and microRNAs (miRNAs; N = 800) profiling on primary CICs and differentiated tumor cell lines, including autologous pairs. Functional immunological assays were performed to assess the impact of miRNA modulation.<h4>Results</h4>CICs exhibited distinct methylation patterns, transcriptomic profiles, and miRNA expressions compared to differentiated tumor cells (p < 0.05 or 0.01). Notably, miRNA-15a and -196a were implicated in regulating tumorigenic pathways, such as epithelial-to-mesenchymal transition (EMT), TGF-β signaling, and immune modulation. The transfection of CICs with miRNA mimics led to the downregulation of oncogenic EMT markers (CRKL, lncRNA SOX2-OT, JUNB, SMAD3) and TGF-β pathway, resulting in a significant reduction of the in vitro proliferation and the tumorigenicity and migration in a zebrafish xenograft model. Additionally, miRNA-15a enhanced the expression of antigen processing machinery and decreased the expression of immune checkpoints (PD-L1, PD-L2, CTLA-4) and immunosuppressive cytokines (IL-4). The co-culture of HLA-matched lymphocytes with CICs overexpressing the miRNA-15a, elicited robust tumor-specific immune responses, characterized by a shift toward central and effector memory T cell phenotypes and prevented their terminal differentiation and exhaustion. The combination of miRNA modulation with Indoleamine 2,3-dioxygenase blockade and immunomodulating agents further potentiated these effects.<h4>Conclusions</h4>Our study demonstrates that the modulation of miRNA-15a in CICs not only suppresses the tumorigenic properties but also enhances their visibility to the immune system by upregulating antigen presentation and reducing immunomodulatory molecules. These findings suggest that combining miRNA modulation with epigenetic or immunomodulatory agents holds significant promise for overcoming treatment resistance in CRC.

Also flagged:thiol isomerasesVascular thiol isomerasesprotein disulfide isomerasePDIendoplasmic reticulum protein 5ERp5
Journal Article 2025-02-17 No Snippets Jiang L, Yuan C, Flaumenhaft R, Huang M.
Show Full Abstract

Vascular thiol isomerases (VTIs) encompass proteins such as protein disulfide isomerase (PDI), endoplasmic reticulum protein 5 (ERp5), ERp46, ERp57, ERp72, thioredoxin-related transmembrane protein 1 (TMX1), and TMX4, and play pivotal functions in platelet aggregation and formation of thrombosis. Investigating vascular thiol isomerases, their substrates implicated in thrombosis, the underlying regulatory mechanisms, and the development of inhibitors targeting these enzymes represents a rapidly advancing frontier within vascular biology. In this review, we summarize the structural characteristics and functional attributes of VTIs, describe the associations between these enzymes and thrombosis, and outline the progress in developing inhibitors of VTIs for potential antithrombotic therapeutic applications.

Also flagged:-calcium silicatehydroxyapatitecalcium phosphatescalcium silicatessodium
Journal Article 2025-02-17 No Snippets Beheshtizadeh N, Seraji AA, Azadpour B, Rezvantalab S.
Show Full Abstract

The fabrication of scaffolds for bone tissue engineering (BTE) applications often involves the utilization of two distinct categories of biomaterials, namely calcium phosphates and calcium silicates. The selection of these materials is based on their biocompatibility, bioactivity, and mechanical characteristics that closely resemble those of natural bone. The present research examined the utilization of hydroxyapatite (HAP) and tri-calcium silicate (TCS), which are among the most commonly utilized materials in calcium phosphates and calcium silicates, in the context of bone scaffolding applications. A molecular dynamics simulation was conducted to investigate the impact of different concentrations of ceramic nanoparticles, when combined with sodium alginate (SA) hydrogel, on the fabrication of bone scaffolds.The stability and self-assembly were assessed through several parameters, such as the solvent-accessible surface area (SASA), radius of gyration (Rg), radial distribution function (g(r)), root-mean-square deviation (RMSD), root-mean-square fluctuation (RMSF), hydrogen bonding, van der Waals, electrostatic, and total energies. The findings indicate that the addition of 10 wt% HAP and TCS to the SA hydrogel matrix results in a more compact, stable, and potentially less hydrated structure. Accordingly, the experimental validation of these simulation approved our in silico findings. Experimental rheology and mechanical properties evaluation validate our simulation results, indicating a superior characteristic of TCS10 and HAP10 inks and 3D-printed scaffolds among other composition ratios. This could potentially benefit the in vitro and in vivo performance of the scaffold and its interaction with cells. The aforementioned traits are considered fundamental for the successful execution of the scaffold in the field of BTE. The findings indicate that TCS samples exhibit superior properties when compared to HAP samples, specifically in terms of composition with SA hydrogel.

DCC
Also flagged:CancerPoly(ADP-ribose) polymerase1PARP1cancersniraparibrucaparib
Journal Article 2025-02-17 ✓ 1 Snippet Shanmugam N, Chatterjee S, Cisneros GA.
In-Text Gene Mentions

DCC

Show Full Abstract

Poly(ADP-ribose) polymerase1 (PARP1) plays a vital role in DNA repair, and its inhibition in cancer cells may cause cell apoptosis. In this study, we investigated the effects of a PARP1 variant, V762A, which is strongly associated with several cancers in humans, on the inhibition of PARP1 by three FDA-approved inhibitors: niraparib, rucaparib, and talazoparib. Specifically, we compared the inhibition of the mutant to that of wild-type (WT) PARP1. Additionally, we investigated how the mutation influences the binding of these inhibitors to PARP1. Our work suggests that while mutant PARP1 exhibits only minor differences in residual fluctuations, backbone deviations, and residue motion correlations compared to the WT under niraparib and rucaparib inhibitions, it shows significant and distinct differences in these features when inhibited by talazoparib. Among the three inhibitions, talazoparib inhibition uniquely lowers the average residue fluctuations in the mutant than the WT including lower fluctuations of mutant's N- and C-terminal residues in the catalytic domain, conserved H-Y-E traid residues, and donor loop (D-loop) residues which are important for catalysis more effectively than other inhibitions. However, talazoparib also significantly enhances destabilizing interactions between the mutation site in the HD domain in the mutant than WT. Further, among the three inhibitions, talazoparib inhibition uniquely and significantly disrupts the functional fluctuations of terminal regions in the mutant, which are otherwise present in the WT. The mutation and inhibition do not significantly affect PARP1's essential dynamics. Lastly, these inhibitors bind to the V762A mutant more effectively than to the WT, with similar binding free energies between them.

Also flagged:hydroxyapatitepolyethylene oxidechitosancalcium oxidecarbonateapatite
Journal Article 2025-02-17 No Snippets Habiburrohman MR, Jamilludin MA, Cahyati N, Herdianto N, Yusuf Y.
Show Full Abstract

A novel porous bone scaffold based on nano-carbonated hydroxyapatite reinforced with fibrous-like structured polyethylene oxide/chitosan network (nCHA/PEO/CS) was introduced and fabricated <i>via</i> freeze-drying. Prior to this, the nCHA was synthesized through a hydrothermal reaction based on cuttlefish bone (CFB, <i>Sepia officinalis</i>). The raw cuttlefish bone (raw-CFB) was first decomposed to obtain cuttlefish bone-derived calcium oxide (CaO-CFB) by calcination at 1000 °C, which was used for synthesizing nCHA. The chemical composition analysis showed that the nCHA formed AB-type CHA with a high carbonate content of 7.38 wt%, which is in the range of carbonate content in native bone (2-9 wt%). The Ca/P molar ratio of nCHA was 1.712, very close to the Ca/P of biological apatite of 1.71. Morphological analysis revealed that nCHA consists of nanosized particles, potentially offering a large surface area to volume to promote ion exchange and cell interaction. The excellent physicochemical and morphological properties of nCHA proposed suitability as a bone scaffold precursor combined with PEO and CS. The nCHA/PEO/CS scaffolds were freeze-dried with varying PEO/CS concentrations. Physicochemical analysis indicated that increasing the PEO/CS concentration decreased the crystallinity of the scaffold, causing it to be lower than the nCHA crystallinity, which may be beneficial for cell growth. Morphological analysis revealed that the scaffold structure comprised nCHA cross-linked within a fibrous-like structured PEO/CS network, which appropriately mimics the fibrous structure of extracellular matrix (ECM) in natural bone. However, the nCHA/PEO/CS-11 scaffold formed more appropriate pores with suitable porosity for cell development, blood vessel formation, and nutrient perfusion. The nCHA/PEO/CS-11 scaffold also demonstrated sufficient compressive strength and good swelling behavior, which may favor bone regeneration. The nCHA/PEO/CS-11 scaffold demonstrated high cytocompatibility and facilitated the adherence of MC3T3E1 cells on the scaffold surface. The nCHA/PEO/CS-11 scaffold also promoted cell osteogenic differentiation. Owing to its desirable and suitable characteristics, the nCHA/PEO/CS-11 scaffold is promising in bone tissue engineering.

Also flagged:RNA-binding proteinspeptidesneurological disordersschizophreniabipolar disordermajor depressive disorder
Journal Article 2025-02-17 No Snippets Hatzimanolis O, Sykes AM, Cristino AS.
Show Full Abstract

Non-coding RNAs (ncRNAs) have gained significant attention in recent years due to advancements in biotechnology, particularly high-throughput total RNA sequencing. These developments have led to new understandings of non-coding biology, revealing that approximately 80% of non-coding regions in the genome possesses biochemical functionality. Among ncRNAs, circular RNAs (circRNAs), first identified in 1976, have emerged as a prominent research field. CircRNAs are abundant in most human cell types, evolutionary conserved, highly stable, and formed by back-splicing events which generate covalently closed ends. Notably, circRNAs exhibit high expression levels in neural tissue and perform diverse biochemical functions, including acting as molecular sponges for microRNAs, interacting with RNA-binding proteins to regulate their availability and activity, modulating transcription and splicing, and even translating into functional peptides in some cases. Recent advancements in computational and experimental methods have enhanced our ability to identify and validate circRNAs, providing valuable insights into their biological roles. This review focuses on recent developments in circRNA research as they related to neuropsychiatric and neurodegenerative conditions. We also explore their potential applications in clinical diagnostics, therapeutics, and future research directions. CircRNAs remain a relatively underexplored area of non-coding biology, particularly in the context of neurological disorders. However, emerging evidence supports their role as critical players in the etiology and molecular mechanisms of conditions such as schizophrenia, bipolar disorder, major depressive disorder, Alzheimer's disease, and Parkinson's disease. These findings suggest that circRNAs may provide a novel framework contributing to the molecular dysfunctions underpinning these complex neurological conditions.

HTT
Also flagged:PYK2Huntington's diseaseHDnon-receptor tyrosine kinaseCamk2amotor activity
Journal Article 2025-02-17 ✓ 1 Snippet Al Massadi O, Labarchède M, de Pins B, Longueville S, Giralt A, Irinopoulou T, Savariradjane M, Subashi E, Ginés S, Caboche J, Mariani LL, Betuing S, Girault JA.
In-Text Gene Mentions

…mutation in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is a devastating disease due to autosomal dominant mutation in the HTT gene. Its pathophysiology involves multiple molecular alterations including transcriptional defects. We previously showed that in HD patients and mouse model, the protein levels of the non-receptor tyrosine kinase PYK2 were decreased in the hippocampus and that viral expression of PYK2 improved the hippocampal phenotype. Here, we investigated the possible contribution of PYK2 in the striatum, a brain region particularly altered in HD. PYK2 mRNA levels were decreased in the striatum and hippocampus of R6/2 mice, a severe HD model. Striatal PYK2 protein levels were also decreased in R6/2 mice and human patients. PYK2 knockout by itself did not result in motor symptoms observed in HD mouse models. We examined whether PYK2 deficiency participated in the R6/2 mice phenotype by expressing PYK2 in their dorsal striatum using AAV vectors. With an AAV1/Camk2a promoter, we did not observe significant improvement of body weight, clasping, motor activity and coordination (rotarod) alterations observed in R6/2 mice. With an AAV9/SYN1 promoter we found a slightly higher body weight and a trend to better rotarod performance. Both viruses similarly transduced striatal projection neurons and somatostatin-positive interneurons but only AAV9/SYN1 led to PYK2 expression in cholinergic and parvalbumin-positive interneurons. Expression of PYK2 in cholinergic interneurons may contribute to the slight effects observed. We conclude that PYK2 mRNA and protein levels are decreased in the striatum as in hippocampus of HD patients and mouse models. However, in contrast to hippocampus, striatal viral expression of PYK2 has only a minor effect on the R6/2 model striatal phenotype.

POU3F2
Also flagged:melaninchromosomeMTAPCDKN1Abiosynthesispigmentation
Journal Article 2025-02-17 ✓ 1 Snippet Kong S, Cai X, Cai B, Xian Y, Zhou Z, Cai D, Yang X, Lin D, Nie Q.
In-Text Gene Mentions

POU3F2, FOXE1, GAS1 ,…

Show Full Abstract

Small white-feather chickens (SWFC) have become popular as a hybrid strain recently. Shank color is a notable economic trait in this strain. Despite numerous studies on the green shank trait from both physiological and genetic perspectives, research focusing specifically on the green shank trait in hybrid chickens (HC) remains limited. In this study, to investigate the genetic mechanisms and molecular basis of the green shank trait in HC, we created a population by intercrossing white-feathered and yellow-feathered broilers, both with yellow shanks. Physiological analysis confirmed that melanin deposition in the shank dermis is the primary cause of the green shank trait in HC. By combining genome-wide association studies (GWAS) and population genomics analysis, the 83.20-85.68 Mb region on the Z chromosome was identified as a candidate region for the green shank trait in HC. Transcriptome sequencing revealed differentially expressed genes (DEGs) between green shank and yellow shank individuals, with MTAP and CDKN1A identified as candidate genes in the genomic region associated with the green shank trait. Notably, the green shank trait includes a light green phenotype. Our study is the first to identify genes associated with different color depths of the green shank. The candidate genes influence both the biosynthesis and deposition of pigments.

DNAJC1
Also flagged:Heat shock proteinsHSPsbindingliver cancerhepatocellular carcinomaHSP
Journal Article 2025-02-17 ✓ 5 Snippets Xiao H, Wang B, Xiong S, Li C, Ding Y, Chao D, Mei B, Shen N, Luo G.
In-Text Gene Mentions

…+ (0.03620 *DNAJC1) + (0.06078 *…

…levels of HSPD1,DNAJC1, DNAJC5, and DNAJC8…

…composed of HSPD1,DNAJC1, DNAJC5 and DNAJC8.…

DNAJC1, DNAJC5 and DNAJC8…

…we found thatDNAJC1, DNAJC5 and DNAJC8…

Show Full Abstract

<h4>Purpose</h4>Hepatocellular carcinoma (HCC) is a prevalent malignancy that not only imposes a substantial financial burden but also significantly impacts the quality of life and overall survival of affected individuals. Heat shock proteins (HSPs) are a protein class with significant involvement in safeguarding and restoring cellular integrity. They help restore proper protein structure by binding to and refolding denatured proteins. However, the specific role of HSPs in HCC requires further investigation.<h4>Methods</h4>We analyzed the genomic characteristics of HSPs in liver cancer in the TCGA and ICGC databases, and functional enriched analysis of HSPs. Construction of an HSPs-Related Prognostic Model for patients with hepatocellular carcinoma. HSP-related risk score (HRRS) was identified as an independent prognostic factor in patients with hepatocellular carcinoma, and the clinical pathological characteristics and immune microenvironment of high-risk and low-risk groups were compared. Further, we studied HRRS-based liver cancer treatment strategies and confirmed the protein expression of HSPD1 and DNAJC5 in normal liver tissues and hepatocellular carcinoma tissues by collecting human hepatocellular carcinoma tissues.<h4>Results</h4>We observed elevated expression levels of most HSPs across HCC tissues. In addition, 14 hSPs were found to be related to prognostic significance among HCC patients and utilized to develop HRRS prognostic model for prognosis prediction and risk stratification. The prognostic and immunotherapeutic response predictive value of HRRS was validated utilizing data from TCGA and GEO cohorts. Moreover, we created a nomogram to assess HRRS clinical utility and verified its efficiency through various methods. Through IHC was found that HSPD1 and DNAJC5 were significantly overexpressed in hepatocellular carcinoma tissues.<h4>Conclusion</h4>Our results lead us to conclude that HCC's development and progression are intimately associated with HSPs, and the HRRS model represents a potentially robust prognostic model that could assist in clinical decision-making regarding chemotherapy and immunotherapy for HCC patients. Moreover, HSPD1 and DNAJC5 have the potential to serve as therapeutic targets for HCC.

PLCL1
Also flagged:Prostate Cancernon-cutaneous cancergene expressionvitamin Dimmune responseprocessing
Journal Article 2025-02-17 ✓ 1 Snippet Morgan RA, Hazard ES, Savage SJ, Halbert CH, Gattoni-Celli S, Hardiman G.
In-Text Gene Mentions

…, GRIA3 ,PLCL1, GSTM5 ,…

Show Full Abstract

<h4>Background/objectives</h4>Prostate cancer (PC) is the most common non-cutaneous cancer in men globally, and one which displays significant racial disparities. Men of African descent (AF) are more likely to develop PC and face higher mortality compared to men of European descent (EU). The biological mechanisms underlying these differences remain unclear. Long non-coding RNAs (lncRNAs), recognized as key regulators of gene expression and immune processes, have emerged as potential contributors to these disparities. This study aimed to investigate the regulatory role of lncRNAs in localized PC in AF men relative to those of EU and assess their involvement in immune response and inflammation.<h4>Methods</h4>A systems biology approach was employed to analyze differentially expressed (DE) lncRNAs and their roles in prostate cancer (PC). Immune-related pathways were investigated through over-representation analysis of lncRNA-mRNA networks. The study also examined the effects of vitamin D supplementation on lncRNA expression in African descent (AF) PC patients, highlighting their potential regulatory roles in immune response and inflammation.<h4>Results</h4>Key lncRNAs specific to AF men were identified, with several being implicated for immune response and inflammatory processes. Notably, 10 out of the top 11 ranked lncRNAs demonstrated strong interactions with immune-related genes. Pathway analysis revealed their regulatory influence on antigen processing and presentation, chemokine signaling, and ribosome pathways, suggesting their critical roles in immune regulation.<h4>Conclusions</h4>These findings highlight the pivotal role of lncRNAs in PC racial disparities, particularly through immune modulation. The identified lncRNAs may serve as potential biomarkers or therapeutic targets to address racial disparities in PC outcomes.

Also flagged:Methylationglycerollecithinesterparturitioninsemination
Journal Article 2025-02-17 No Snippets Suwor F, Kubota S, Nawong S, Thuangsanthia A, Toyra M, Paengkoum P, Ponchunchoovong S.
Show Full Abstract

This study investigated the effects of various cryoprotectant combinations on post-thaw sperm quality, biomolecular changes, DNA methylation, and pregnancy rates using Boer goat semen. Synchrotron-based Fourier-transform infrared spectroscopy (SR-FTIR) was used to assess biomolecular changes. A Tris-based extender supplemented with 5% glycerol was used in combination with different concentrations of cryoprotectants, including 1% and 3% soybean lecithin and 10% and 18% egg yolk, with Andromed<sup>®</sup> serving as the control. SR-FTIR analysis revealed that the combination of 5% glycerol and 18% egg yolk (T4) resulted in significantly higher levels of lipids, ester lipids, and secondary protein structures (α-helix) compared with those under the other treatments (<i>p</i> < 0.05). Analysis of the principal component analysis (PCA) score plot and correlation loadings revealed a positive association between the cryoprotectant combination of T4 and increased levels of lipids and ester lipids, as well as enhanced sperm motility, progressive motility, and viability. Furthermore, this combination achieved a pregnancy and parturition rate of 66.67%, which was notably higher than the rate achieved with Andromed<sup>®</sup> (37.50%). Moreover, T4 did not show a significant difference in DNA methylation levels compared to Andromed<sup>®</sup> and fresh sperm (<i>p</i> > 0.05). Overall, the results indicated that specific cryoprotectant combinations play a key role in enhancing the biomolecular and functional integrity of freeze-thawed Boer goat semen.

Also flagged:SynthesisMemantineneurotrophinsantibodiesneurological diseasesretinoic acid
Journal Article 2025-02-17 No Snippets Turkez H, Oner S, Yıldırım OC, Arslan ME, Dimmito MP, Kahraman ÇY, Marinelli L, Sonmez E, Kiki Ö, Tatar A, Cacciatore I, Di Stefano A, Mardinoglu A.
Show Full Abstract

<b>Background/Objectives:</b> Over the past 25 years, numerous biological molecules, like recombinant lysosomal enzymes, neurotrophins, receptors, and therapeutic antibodies, have been tested in clinical trials for neurological diseases. However, achieving significant success in clinical applications has remained elusive. A primary challenge has been the inability of these molecules to traverse the blood-brain barrier (BBB). Recognizing this hurdle, our study aimed to utilize niosomes as delivery vehicles, leveraging the "molecular Trojan horse" technology, to enhance the transport of molecules across the BBB. <b>Methods:</b> Previously synthesized memantine derivatives (<b>MP1-4</b>) were encapsulated into niosomes for improved BBB permeability, hypothesizing that this approach could minimize peripheral drug toxicity while ensuring targeted brain delivery. Using the human neuroblastoma (SH-SY5Y) cell line differentiated into neuron-like structures with retinoic acid and then exposed to amyloid beta 1-42 peptide, we established an in vitro Alzheimer's disease (AD) model. In this model, the potential usability of <b>MP1-4</b> was assessed through viability tests (MTT) and toxicological response analysis. The niosomes' particle size and morphological structures were characterized using scanning electron microscopy (SEM), with their loading and release capacities determined via UV spectroscopy. Crucially, the ability of the niosomes to cross the BBB and their potential anti-Alzheimer efficacy were analyzed in an in vitro transwell system with endothelial cells. <b>Results:</b> The niosomal formulations demonstrated effective drug encapsulation (encapsulation efficiency: 85.3% ± 2.7%), controlled release (72 h release: 38.5% ± 1.2%), and stable morphology (PDI: 0.22 ± 0.03, zeta potential: -31.4 ± 1.5 mV). Among the derivatives, MP1, <b>MP2</b>, and <b>MP4</b> exhibited significant neuroprotective effects, enhancing cell viability by approximately 40% (<i>p</i> < 0.05) in the presence of Aβ1-42 at a concentration of 47 µg/mL. The niosomal delivery system improved BBB permeability by 2.5-fold compared to free drug derivatives, as confirmed using an in vitro bEnd.3 cell model. <b>Conclusions:</b> Memantine-loaded niosomes provide a promising platform for overcoming BBB limitations and enhancing the therapeutic efficacy of Alzheimer's disease treatments. This study highlights the potential of nanotechnology-based delivery systems in developing targeted therapies for neurodegenerative diseases. Further in vivo studies are warranted to validate these findings and explore clinical applications.

MLLT10DNAJC1
Also flagged:acute myeloid leukemiaAMLPediatrichematological disordercancerFLT3
Journal Article 2025-02-17 ✓ 2 Snippets Rao M, Luo W, Luo C, Wu B, Xu T, Wei Z, Deng H, Li K, Zhou D.
In-Text Gene Mentions
⭐ same-sentence co-mention

…NPM1-CCDC28A, TRIP12-NPM1, andMLLT10-DNAJC1, enabling precise diag…

⭐ same-sentence co-mention

…C28A, TRIP12-NPM1, and MLLT10-DNAJC1, enabling precise diagnosis…

Show Full Abstract

<h4>Background</h4>Pediatric AML prognosis research has advanced significantly, yet gaps in understanding genetic and molecular interactions persist. Despite improved outcomes, relapse/refractory cases and personalized treatment integration remain critical clinical challenges.<h4>Objective</h4>To analyze the global research landscape on pediatric AML prognosis, highlight influential components and collaborations, and identify major potential research trends.<h4>Methods</h4>Publications on pediatric AML prognosis research from 1999 to 2023 were retrieved from the Clarivate Analytics Web of Science Core Collection (WoSCC) database. Bibliometric analysis was conducted using CiteSpace and VOSviewer to identify leading countries, prominent institutions, high-impact journals, key research categories, influential authors, and emerging research topics.<h4>Results</h4>The bibliometric analysis encompassed 924 publications, with St. Jude Children's Research Hospital emerging as the most prolific institution. The United States leads globally in terms of countries, institutions, journals, and authors. Todd A. Alonzo ranks highest in publication volume, while U. Creutzig leads in citations. The top research categories were Oncology, Hematology, and Pediatrics. Key research topics included genomics, transcriptomics, epigenomics, targeted therapies, immune therapy, and integrative diagnostic approaches.<h4>Conclusion</h4>This bibliometric analysis highlights significant advancements in pediatric AML prognosis over the past 25 years, driven by the integration of genetic markers, immunological insights, transcriptomics, and epigenomics, which have collectively transformed risk stratification and treatment strategies. Overcoming challenges, such as discovering new therapeutic targets and enhancing treatment combinations, will depend on global collaboration and advanced technologies to propel the field forward.

Also flagged:ecdysteroidsanthraquinonesflavonoidsecdysteroneinokosterone20-hydroxyecdysone
Journal Article 2025-02-17 No Snippets Park MN, Choi J, Maharub Hossain Fahim M, Asevedo EA, Nurkolis F, Ribeiro RIMA, Kang HN, Kang S, Syahputra RA, Kim B.
Show Full Abstract

<i>Achyranthes japonica</i> (Miq.) Nakai (AJN) and <i>Melandrium firmum</i> (Siebold and Zucc.) Rohrb. (MFR) are medicinal plants recognized for their bioactive phytochemicals, including ecdysteroids, anthraquinones, and flavonoids. This study investigates the anticancer properties of key constituents of these plants, focusing on the BK002 formulation, a novel combination of AJN and MFR. Specifically, the research employs advanced molecular docking and <i>in silico</i> analyses to assess the interactions of bioactive compounds ecdysterone, inokosterone, and 20-hydroxyecdysone (20-HE) with key prostate cancer-related network proteins, including 5α-reductase, CYP17, DNMT1, Dicer, PD-1, and PD-L1. Molecular docking techniques were applied to evaluate the binding affinities contributions of the bioactive compounds in BK002 against prostate cancer-hub network targets. The primary focus was on enzymes like 5α-reductase and CYP17, which are central to androgen biosynthesis, as well as on cancer-related proteins such as DNA methyltransferase 1 (DNMT1), Dicer, programmed death-1 (PD-1), and programmed death ligand-1 (PD-L1). Based on data from prostate cancer patients, key target networks were identified, followed by <i>in silico</i> analysis of the primary bioactive components of BK002.In silico assessments were conducted to evaluate the safety profiles of these compounds, providing insights into their therapeutic potential. The docking studies revealed that ecdysterone, inokosterone, and 20-hydroxyecdysonec demonstrated strong binding affinities to the critical prostate cancer-related enzymes 5α-reductase and CYP17, contributing to a potential reduction in androgenic activity. These compounds also exhibited significant inhibitory interactions with DNMT1, Dicer, PD-1, and PD-L1, suggesting a capacity to interfere with key oncogenic and immune evasion pathways. Ecdysterone, inokosterone, and 20-hydroxyecdysone have demonstrated the ability to target key oncogenic pathways, and their favorable binding affinity profiles further underscore their potential as novel therapeutic agents for prostate cancer. These findings provide a strong rationale for further preclinical and clinical investigations, supporting the integration of BK002 into therapeutic regimens aimed at modulating tumor progression and immune responses.

LRRC7
Also flagged:Epidermal DifferentiationLRRC8Aanion channelcell proliferationpsoriasischronic inflammatory skin disease
Journal Article 2025-02-17 ✓ 1 Snippet Jahn M, Lang V, Rauh O, Fauth T, Buerger C.
In-Text Gene Mentions

…10 years ago,leucine-rich repeat-containing protein 8repeat-containing protein 8…

Show Full Abstract

Recent studies have shown that LRRC8A, the essential subunit of the volume-regulated anion channel LRRC8, which is responsible for mediating cell volume regulation during hypotonic stress, is predominantly localized in the basal layer of the epidermis. This prompted us to investigate whether LRRC8A plays a role in maintaining epidermal homeostasis by regulating key processes initiated in this layer, such as cell proliferation and/or differentiation. LRRC8A was found to be strongly upregulated in transiently amplifying cells at the onset of differentiation. While <i>LRRC8A</i> mRNA remains high when keratinocytes mature further, the LRRC8A protein is drastically downregulated. Interference with <i>LRRC8A</i> expression at this step inhibits the transition of keratinocyte stem cells into transiently amplifying cells and impairs terminal differentiation. As psoriasis is a common chronic inflammatory skin disease characterized by disturbed epidermal differentiation and aberrant function of transiently amplifying cells, we investigated the involvement of LRRC8A in this disease. Indeed, LRRC8A was strongly decreased in lesional psoriatic skin, which could also be mimicked in vitro using Th1/Th17 cytokine mixes. Thus, our data suggest that LRRC8 could serve as a therapeutic target for the topical treatment strategies of psoriatic lesions by restoring the capacity of keratinocytes to initiate differentiation.

LRRC7
Also flagged:chromatinPolycomb repressive complex 1PRC1chromosomecondensin Ihistone
Journal Article 2025-02-17 ✓ 4 Snippets Luo L, Yang M, Zhou Y.
In-Text Gene Mentions

Condensincomplexes are well…

Condensincomplexes were also…

Condensincomplexes participate in…

Condensincomplexes may also…

Show Full Abstract

The accurate chromatin states are essential for maintaining genome integrity and ensuring the normal transcription of genes. Polycomb group (PcG) proteins regulate chromatin states not only by modifying the chromatin, but also by influencing the chromatin three-dimensional (3D) structure. The core components of Polycomb repressive complex 1 (PRC1), B LYMPHOMA MOLONEY MURINE LEUKEMIA VIRUS INSERTION REGION 1 HOMOLOG 1A/B/C (BMI1s), have been reported to maintain the compartment domains (CDs) generally, but the mechanism by which they function remains elusive. Here, we reveal that condensin complexes, whose function are related to chromatin or chromosome, can interact with BMI1s. Removal of condensin I or II also leads to global impairment of CDs. The significantly impaired CDs in <i>bmi1a/b/c</i> and condensin mutants are basically the same and the CDs co-regulated by BMI1s and condensin complexes have higher strength in the wild-type (WT, Col-0) plant, indicating that BMI1s and condensin complexes cooperate to maintain CDs. This regulatory function is parallel to the function of histone modifications deposited by PcG in maintaining CDs, since removal of either condensin I or II does not obviously disrupt the genome-wide level of H3K27me3 and H2AK121ub. Moreover, we discovered that BMI1s and condensin complexes jointly influence the expression of a portion of genes to enable normal plant growth and may maintain the genome integrity under stress conditions. Thus, our work proides a perspective for the gene expression and epigenetic regulatory mechanism of PRC1, in <i>Arabidopsis</i>, in addition to histone modifications.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s42994-025-00202-x.

HFE
Also flagged:p-NitrophenolPeroxymonosulfateanionsdegradationperoxodisulfatehydrogen
Journal Article 2025-02-17 ✓ 1 Snippet Jeong WG, Kim JG, Alshawabkeh AN, Larese-Casanova P, Lim J, Baek K.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The utilization of biochar for peroxymonosulfate (PMS) activation has gained attention due to its functional groups and porous structure. Nonetheless, its practical application is limited by challenges in regulating reaction rates and the short catalyst lifespan due to natural organic matter (NOM) and anions. Furthermore, most studies have focused on batch-type experiments. To address these limitations, this study introduced a combined electrolysis (E) and biochar (BC) system for PMS activation in a flow-through reactor to remediate dissolved p-nitrophenol (p-NP) as a model pollutant. It is hypothesized that the E-BC-PMS system enhances degradation through three mechanisms: (1) simultaneous activation of PMS by biochar and electrochemical reactions, (2) adsorption of contaminants onto biochar, and (3) formation of diverse reactive species. The E-BC-PMS system removed 99.9 % of p-NP and showed the highest removal rate constant (0.497 min<sup>-1</sup>) suggesting a synergistic effect compared to individual PMS (1.1 %), BC (1.6 %), or E (48.8 %) systems. Moreover, the E-BC system utilizing PMS exhibited 3.7 and 4.5 times higher p-NP degradation rate constants than peroxodisulfate or hydrogen peroxide, respectively. Mechanistic investigations using scavenger tests, electron paramagnetic resonance, and x-ray photoelectron spectrometry revealed that non-radical (electron transfer, <sup>1</sup>O<sub>2</sub>) and radical (O<sub>2</sub> <sup>•-</sup> and •OH) pathways contributed to p-NP degradation. Overall, the E-BC-PMS system activates PMS through the electrochemical, functional groups, and alkaline activation. These findings suggest that the E-BC-PMS system is highly effective for p-NP removal and presents a promising strategy for groundwater remediation applications.

medRxiv 2025-02-17 Preprint (No Snippets API) Zhong X, Mitchell R, Billstrand C, Thompson E, Sakabe NJ, Aneas I, Salamone IM, Gu J, Sperling AI, Schoettler N, Nóbrega MA, He X, Ober C.
Show Full Abstract

<h4>Background</h4> Genome-wide association studies (GWAS) have identified hundreds of loci underlying adult-onset asthma (AOA) and childhood-onset asthma (COA). However, the causal variants, regulatory elements, and effector genes at these loci are largely unknown. <h4>Methods</h4> We performed heritability enrichment analysis to determine relevant cell types for AOA and COA, respectively. Next, we fine-mapped putative causal variants at AOA and COA loci. To improve the resolution of fine-mapping, we integrated ATAC-seq data in blood and lung cell types to annotate variants in candidate cis -regulatory elements (CREs). We then computationally prioritized candidate CREs underlying asthma risk, experimentally assessed their enhancer activity by massively parallel reporter assay (MPRA) in bronchial epithelial cells (BECs) and further validated a subset by luciferase assays. Combining chromatin interaction data and expression quantitative trait loci, we nominated genes targeted by candidate CREs and prioritized effector genes for AOA and COA. <h4>Results</h4> Heritability enrichment analysis suggested a shared role of immune cells in the development of both AOA and COA while highlighting the distinct contribution of lung structural cells in COA. Functional fine-mapping uncovered 21 and 67 credible sets for AOA and COA, respectively, with only 16% shared between the two. Notably, one-third of the loci contained multiple credible sets. Our CRE prioritization strategy nominated 62 and 169 candidate CREs for AOA and COA, respectively. Over 60% of these candidate CREs showed open chromatin in multiple cell lineages, suggesting their potential pleiotropic effects in different cell types. Furthermore, COA candidate CREs were enriched for enhancers experimentally validated by MPRA in BECs. The prioritized effector genes included many genes involved in immune and inflammatory responses. Notably, multiple genes, including TNFSF4 , a drug target undergoing clinical trials, were supported by two independent GWAS signals, indicating widespread allelic heterogeneity. Four out of six selected candidate CREs demonstrated allele-specific regulatory properties in luciferase assays in BECs. <h4>Conclusions</h4> We present a comprehensive characterization of causal variants, regulatory elements, and effector genes underlying AOA and COA genetics. Our results supported a distinct genetic basis between AOA and COA and highlighted regulatory complexity at many GWAS loci marked by both extensive pleiotropy and allelic heterogeneity.

DCC
Also flagged:Bisphenol SaxonogenesisaxonWNTbisphenol Aneurotransmitter
Journal Article 2025-02-16 ✓ 1 Snippet Guo W, Xiong W, Wang L, Wang X, Zhou Y, Chen Y, Li X, Zhang L, Ni M, Chen J.
In-Text Gene Mentions

…n guidance (Slit-Robo, Netrin-DCC, Semaphorin-Plexin) and WNT…

Show Full Abstract

Bisphenol S (BPS) is the main substitute for bisphenol A (BPA). However, the neurodevelopmental toxicity of BPS and the underlying mechanisms remain unraveled. In present study, the neuro-differentiating human embryonic stem cells, hESC, was exposed to BPS (0-375 µM) at different stages (the precursor stage, the precursor to maturation stage, and the whole differentiation stage) to assess the potential neurodevelopmental toxicity and its mechanisms. The results revealed that BPS exposure interrupted axonogenesis, manifesting a trend of initial stimulating followed by inhibition, and peaked at the intermediate dose (3.75 μM) significantly, then reached the nadir at the high dose (375 μM) significantly in the precursor to maturation stage and the whole differentiation stage. Transcriptomics analysis showed that the main interrupted pathway enriched in axonogenesis, myelination, and neurotransmitter secretion by the GO function analysis and immune-related pathway by the KEGG analysis, besides, conserved axon guidance (Slit-Robo, Netrin-DCC, Semaphorin-Plexin) and WNT signaling pathway was also enriched in KEGG pathway analysis, which previously proved to regulate axonogenesis by directly acting on growth cones and inhibit axon growth by neuroinflammatory responses. And we found that a higher neuroinflammatory response may be induced through whole-differentiation-stage exposure than the response of exposure through the precursor to maturation stage. Overall, our findings indicated the non-monotonic neurodevelopmental toxicity of BPS exposure, and the inhibition of axonogenesis was possibly mediated by conserved axon guidance and WNT signaling pathway, while neuro-immune related pathway should be further investigated.

LRRC7
Also flagged:SRBD1chromosomesister chromatidspindlemitosishistone
Journal Article 2025-02-16 ✓ 3 Snippets Lovejoy CA, Wessel SR, Bhowmick R, Hatoyama Y, Kanemaki MT, Zhao R, Cortez D.
In-Text Gene Mentions

Condensincomplexes and topoisomerase…

Condensin-mediated loop extrusion recru…

Condensinand topo IIα…

Show Full Abstract

Accurate sister chromatid segregation requires remodeling chromosome architecture, decatenation, and attachment to the mitotic spindle. Some of these events are initiated during S-phase, but they accelerate and conclude during mitosis. Here we describe SRBD1 as a histone and nucleic acid binding protein that prevents DNA damage in interphase cells, localizes to nascent DNA during replication and the chromosome scaffold in mitosis, and is required for chromosome segregation. SRBD1 inactivation causes micronuclei, chromatin bridges, and cell death. Inactivating SRBD1 immediately prior to mitotic entry causes anaphase failure, with a reduction in topoisomerase IIα localization to mitotic chromosomes and defects in properly condensing and decatenating chromosomes. In contrast, SRBD1 is not required to complete cell division after chromosomes are condensed. Strikingly, depleting condensin II reduces the severity of the anaphase defects in SRBD1-deficient cells by restoring topoisomerase IIα localization. Thus, SRBD1 is an essential genome maintenance protein required for mitotic chromosome organization and segregation.

Also flagged:Pancreatic carcinomacancerdeathmetastatic tumorcancerspancreatic cancer
Journal Article 2025-02-16 No Snippets Di Marco F, Cufaro MC, Damiani V, Dufrusine B, Pizzinato E, Di Ferdinando F, Sala G, Lattanzio R, Dainese E, Federici L, Ponsaerts P, De Laurenzi V, Cicalini I, Pieragostino D.
Show Full Abstract

Pancreatic carcinoma (PC) is the sixth leading cause of cancer death in both sexes in 2022, responsible for almost 5% of all cancer deaths worldwide; it is characterized by a poor prognosis since most patients present with an unresectable and metastatic tumor. To date, the decreasing trend in mortality rates related to the most common cancers has contributed to making pancreatic cancer a serious public health problem. In the last few years, scientific research has led to many advances in diagnostic approaches, perioperative management, radiotherapy techniques, and systemic therapies for advanced disease, but only with modest incremental progress in PC patient outcomes. Most of the causes of this high mortality are, unfortunately, late diagnosis and an important therapeutic resistance; for this reason, the most recent high-throughput proteomics technologies focus on the identification of novel biomarkers and molecular profiling to generate new insights in the study of PC, to improve diagnosis and prognosis and to monitor the therapies progress. In this work, we present and discuss the integration of results from different revised studies on protein biomarkers in a global proteomic meta-analysis to understand which path to pursue scientific research. In particular, cancer signaling, inflammatory response, and cell migration and signaling have emerged as the main pathways described in PC, as well as scavenging of free radicals and metabolic alteration concurrently highlighted new research insights on this disease. Interestingly, from the study of upstream regulators, some were found to be shared by collecting data relating to both biological fluid and tissue biomarkers, side by side: specifically, TNF, LPS, p38-MAPK, AGT, miR-323-5p, and miR-34a-5p. By integrating many biological components with their interactions and environmental relationships, it's possible to achieve an in-depth description of the pathological condition in PC and define correlations between concomitant symptoms and tumor genesis and progression. In conclusion, our work may represent a strategy to combine the results from different studies on various biological samples in a more comprehensive way.

SERPINC1
Also flagged:TumorKPNA2KIFC1bladder cancercancerPhosphoinositide 3-kinase
Journal Article 2025-02-16 ✓ 2 Snippets Yin C, Liufu C, Ye S, Zhu T, Jiang J, Wang M, Zhou L, Yao L, Wang Y, Shi B.
In-Text Gene Mentions

…between KPNA2 andKinesin Family Member C1Family Member C1…

Kinesin Family Member C1Family Member C1…

Show Full Abstract

<h4>Background</h4>Recent studies have illuminated the complexities of treating advanced bladder cancer (BCa), underscoring the importance of comprehending its molecular mechanisms for creating novel therapies. While the role of Karyopherin a2 (KPNA2) in promoting BCa growth is established, the precise mechanism remains elusive.<h4>Methods</h4>To investigate the regulatory role of KPNA2 in BCa, we employed a comprehensive approach integrating clinical case data and bioinformatics analysis to evaluate the expression of KPNA2 in BCa tissues. Mechanisms promoting cancer by KPNA2 were examined using both in vivo and in vitro models.<h4>Results</h4>Our research reveals that miR-26b-5p acts as an anticancer factor by targeting and inhibiting KPNA2 expression. Furthermore, we have observed that the interaction between KPNA2 and Kinesin Family Member C1 (KIFC1) facilitates the transition of BCa cells into the G2/M phase, thereby promoting tumor advancement via activation of the Phosphoinositide 3-kinase (PI3K)- Protein Kinase B (AKT) pathway. Importantly, this investigation is the first to identify KPNA2 expression in exosomes originating from BCa tissues. Plasma exosomes from patients with BCa exhibited notably increased levels of KPNA2 compared with healthy controls, suggesting KPNA2 as a potential new tumor indicator. Additionally, KPNA2 from BCa cells triggered the conversion of fibroblasts into cancer-associated fibroblasts (CAFs), which secreted elevated levels of interleukin-6 (IL-6), contributing to a tumor-supporting environment.<h4>Conclusions</h4>These findings suggest that KPNA2 is a key gene that promotes BCa progression, can potentially be a novel tumor marker, and may serve as a new therapeutic target for BCa.

HFE
Also flagged:ObesitylipidMetabolic DysfunctionFatty Liver Diseasecardiometabolic diseasesliver disease
Journal Article 2025-02-16 ✓ 1 Snippet Lajeunesse-Trempe F, Dugas S, Maltais-Payette I, Tremblay ÈJ, Piché ME, Dimitriadis GK, Lafortune A, Marceau S, Biertho L, Tchernof A.
In-Text Gene Mentions

…primary biliary cirrhosis,hemochromatosis, Wilson's disease and…

Show Full Abstract

<b>Introduction:</b> Metabolic dysfunction-associated fatty liver disease (MAFLD) is highly prevalent among people living with severe obesity (body mass index [BMI] ≥ 35 kg/m<sup>2</sup>). However, it remains unknown how sex and adipose tissue distribution are related to MAFLD onset and progression into metabolic dysfunction-associated steatohepatitis (MASH) or advanced stages of fibrosis. <b>Methodology:</b> We retrospectively studied patients with severe obesity who were eligible for bariatric surgery. Demographic characteristics, biomarkers, and cardiometabolic comorbidities were reported. Anthropometric indices such as BMI, waist circumference (WC), waist-to-hip ratio (WHR), waist-to-height ratio (WHtR), neck circumference (NC), lipid accumulation product (LAP), visceral adiposity index (VAI), body adiposity index (BAI), abdominal volume index (AVI), and body roundness index (BRI) were measured or calculated. MAFLD, MASH, and stages of fibrosis (F1-F4) were established from perioperative liver biopsies. Standardized univariate and multivariate logistic regression analyses were used to examine the association between demographic variables, anthropometric indices, cardiometabolic conditions, and the risk of MASH or severe fibrosis (F2-F4). <b>Results:</b> A total of 2091 participants with severe obesity were included in the analyses; BMI 47.9 ± 7.3 kg/m<sup>2</sup>, age 46.2 ± 11.2 years, and 68.4% females. Overall, MAFLD prevalence was 79.5%, with 44.5% having MASH and 24.4% having severe fibrosis (Stage 2 or higher). No anthropometric indices of adiposity were associated with MASH or fibrosis severity. In this population, female sex was a risk factor for severe fibrosis (OR: 1.27, 95% CI 1.01-1.59, <i>p</i> < 0.05). <b>Conclusions:</b> MAFLD and MASH are highly prevalent in individuals living with severe obesity, but no anthropometric indices or laboratory tests are good predictors of MAFLD or MASH in this population. When MAFLD is diagnosed, our results suggest that females with severe obesity might be at higher risk of advanced stages of fibrosis.

MLLT10
Also flagged:kazal-like domains proteoglycan 1tumorcancercervical squamous cell carcinomaendocervical adenocarcinomauterine corpus endometrial carcinomas
Journal Article 2025-02-16 ✓ 1 Snippet Karaman E, Yay F, Ayan D, Bayram E, Erturk S.
In-Text Gene Mentions

…follistatin like 1;MLLT10histone lysine methyltransfera…

Show Full Abstract

<b>Background:</b> Sparc/osteonectin, cwcv, and kazal-like domains proteoglycan 1 (<i>SPOCK1</i>) is an oncogene that promotes tumor formation and progression in certain types of cancer and is associated with poor survival rates. However, there is limited information on the importance of <i>SPOCK1</i> in gynecological cancers in the literature. The aim of this study was to explore the role of <i>SPOCK1</i> in ovarian serous cystadenocarcinoma (OV), cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), and uterine corpus endometrial carcinomas (UCEC). <b>Methods</b>: The data used in this study were obtained from the GEPIA2, TCGA, Kaplan-Meier Plotter, GeneMANIA, UALCAN, cBioPortal, and TIMER databases. Overall survival (OS) and relapse-free survival (RFS) rates were evaluated by Kaplan-Meier survival analysis. Spearman's rho and statistical significance values were obtained for the correlation between <i>SPOCK1</i> expression and tumor infiltration by different immune cells. <b>Results</b>: Lower <i>SPOCK1</i> gene expression was observed in CESC and UCEC compared to normal tissue (<i>p</i> < 0.05), but the OV did not differ significantly (<i>p</i> > 0.05). In OV, <i>SPOCK1</i> gene expression was solely linked to age; in CESC, it was linked to age, stage, weight, and histology; and in UCEC, it was linked to age, stage, weight, and menopausal status. <b>Conclusions:</b><i>SPOCK1</i> gene expression in UCEC showed weak positive correlations with CD8+ T cells and weak negative correlations with CD4+ T cells. <i>SPOCK1</i> may be a potential prognostic and therapeutic target for gynecological cancers.

PRDX6
Also flagged:superoxide dismutasepro-inflammatory cytokinesmitochondrialsynthesisnuclear factor erythroid 2-related factor 2NRF2
Journal Article 2025-02-16 ✓ 4 Snippets Cocksedge SP, Mantecón L, Castaño E, Infante C, Bailey SJ.
In-Text Gene Mentions

…(PRDX3) and 6 (PRDX6) [ 24 ].…

…the mitochondria, whereasPRDX6is mainly located…

…system (such asPRDX6), and other antioxidant…

…24 ], orPRDX6in human skeletal…

Show Full Abstract

<i>Tetraselmis chuii</i> (<i>T. chuii</i>) is a green, marine, eukaryotic, microalgae that was authorized in the European Union (EU) as a novel food for human consumption in 2014, and as a food supplement in 2017. This narrative review will provide an overview of preclinical and clinical trials assessing the efficacy of a <i>T. chuii</i>-derived ingredient, characterized by a high superoxide dismutase (SOD) activity (SOD-rich <i>T. chuii</i>), to improve various aspects of cellular health. Collectively, results from in vitro, and more importantly in vivo research, support SOD-rich <i>T. chuii</i> as a potential promoter of cellular health. Principally, the ingredient appears to function as an indirect antioxidant by boosting intracellular antioxidant systems. Moreover, it can positively modulate inflammatory status by up-regulating anti-inflammatory and down-regulating pro-inflammatory cytokines and factors. In addition, SOD-rich <i>T. chuii</i> appears to promote cellular health though protecting from DNA damage, boosting immune function, strengthening cell structure and integrity, and positively modulating cell signaling pathways. There is also some evidence to suggest that SOD-rich <i>T. chuii</i> may improve aspects of mitochondrial function through the up-regulation of genes linked to mitochondrial biogenesis and ATP synthesis. From the trials conducted to date, transcriptional activation of nuclear factor erythroid 2-related factor 2 (NRF2) and sirtuin 1 (SIRT1) appear to be important in mediating the effects of SOD-rich <i>T. chuii</i> on cellular health. These exciting preliminary observations suggest that SOD-rich <i>T. chuii</i> may represent a natural blue food supplement with the potential to enhance various aspects of cellular health.

CACNA1E
Also flagged:atypical parkinsonian disorderdeathorphanneurodegenerative disordersα-synucleinopathiesα-synuclein
Journal Article 2025-02-15 ✓ 2 Snippets Heras-Garvin A, Fellner L, Granata R, Wenning GK, Stefanova N.
In-Text Gene Mentions

…calcium signalling (Cacna1e, Necab3 )…

…cell signalling (Cacna1e, Gpr17 ,…

Show Full Abstract

Multiple system atrophy (MSA) is a fatal neurodegenerative disorder characterized by abnormal accumulation of α-synuclein, progressive neuronal loss, motor impairment and widespread pathological changes, which include significant involvement of the cerebellum. To understand the early molecular mechanisms that might underlie α-synuclein-triggered MSA cerebellar pathology, we performed RNA sequencing (RNA-Seq) of cerebellar samples from a well-established model of MSA. RNA-Seq and differential gene expression analysis was conducted in the PLP-αSyn model of MSA. Cerebellum from two and 12-month-old MSA and wildtype mice were used. Gene ontology (GO) and KEGG enrichment analyses of the differentially expressed genes (DEGs) were performed to explore processes involved in MSA-like disease progression. The overlap between transcriptional changes in MSA and those associated with aging was also evaluated. RNA-Seq analysis demonstrated significant transcriptional dysregulation in cerebellum from MSA mice, even at early stages. GO and KEGG analyses of DEGs point to a potential role of synaptic dysfunction, cellular signaling dysregulation and inflammation in the cerebellar pathology of MSA mice. In addition, those changes exacerbate with disease progression. Additionally, our analysis of aging in both control and PLP-αSyn mice showed that age-related transcriptional changes in mid-aged controls seem to be present in young MSA mice. Thus, MSA-like pathology might lead to an acceleration of aging-related mechanisms. Our findings demonstrate significant cerebellar transcriptional dysregulation triggered by oligodendroglial α-synucleinopathy in PLP-αSyn mice, revealing pathways that might be critical for the early cerebellar pathology of MSA, and that may serve as potential molecular targets for therapeutic interventions in this devastating disorder.

SOX6
Also flagged:SOXmethylationlung adenocarcinomaSOX15SOX8SOX17
Journal Article 2025-02-15 ✓ 5 Snippets Wang H, Hu Y, Lu H, Wu Z, Zhang Y.
In-Text Gene Mentions

…of SOX3, SOX5,SOX6, SOX12, SOX14, SOX15,…

…tissues, while SOX5,SOX6, SOX12, SOX17, SOX18,…

…–10 ) andSOX6( r =…

…genes (SOX3, SOX5,SOX6, SOX8, SOX12, SOX14,…

…For example,SOX6, SOX8, SOX12 and…

Show Full Abstract

<h4>Objective</h4>To analyze the expression of the SOX gene family in lung adenocarcinoma and its impact on the prognosis of lung adenocarcinoma patients using tumor databases.<h4>Methods</h4>The cBioPortal database was used to retrieve and analyze the mutation frequencies and variants of 10 genes in the SOX gene family in lung adenocarcinoma tissues. Using clinical information from the Kaplan-Meier plotter database, the potential prognostic values of 10 genes in the SOX gene family in lung adenocarcinoma patients were further explored. The UALCAN database and TCGA database were used to obtain the expression of methylation of SOX gene family members and compare the mRNA expression of 10 genes in lung adenocarcinoma tissues and paracancerous tissues, respectively. The miRCancer database was intersected with miRTarBase, ENCORI, and miRWalk databases to find the lung adenocarcinoma-related miRNAs that regulate the SOX gene family.<h4>Results</h4>Most members in the SOX gene family had expansion mutation, but SOX15 had a deletion mutation. Upregulation of SOX8 and SOX17 is associated with improved outcomes in LUAD patients (HR < 1, log-rank P < 0.05), whereas high expression of SOX3, SOX5, SOX6, SOX12, SOX14, SOX15, SOX18, and SRY correlates with poor prognosis in LUAD patients (HR > 1, log-rank P < 0.05). The mRNA expression of SOX3 and SOX15 was significantly higher in LUAD tissues compared to adjacent normal tissues, while SOX5, SOX6, SOX12, SOX17, SOX18, and SRY were lower in LUAD tissues than in adjacent normal tissues (P < 0.05). Moreover, SOX3, SOX5, SOX8, SOX14, SOX17 and SOX18 showed hypermethylation, while SOX15 showed hypomethylation in LUAD tissues (P < 0.05). Furthermore, hsa-miR-1-3p and miR-499a-5p were positively correlated with SOX5 (r = 0.272, P = 3.87 × 10<sup>-10</sup>) and SOX6 (r = 0.109, P = 1.34 × 10<sup>-2</sup>), respectively.<h4>Conclusion</h4>The SOX gene family is closely implicated in the onset and progression of lung adenocarcinoma, of which most members may be used as prognostic marker genes for patients.

BTN2A2
Also flagged:CDK8BCR-ABLdeathImatinib mesylatetyrosine kinaseBCR-ABLi
Journal Article 2025-02-15 ✓ 1 Snippet Khamidullina AI, Yastrebova MA, Bruter AV, Nuzhina JV, Vorobyeva NE, Khrustaleva AM, Varlamova EA, Tyakht AV, Abramenko IE, Ivanova ES, Zamkova MA, Li J, Lim CU, Chen M, Broude EV, Roninson IB, Shtil AA, Tatarskiy VV.
In-Text Gene Mentions

…, INHA andBTN2A2) were all…

Show Full Abstract

Imatinib mesylate (IM) and other BCR-ABL tyrosine kinase inhibitors (BCR-ABLi) are the mainstay of chronic myelogenous leukemia (CML) treatment. However, activation of circumventing signaling pathways and quiescence may limit BCR-ABLi efficacy. CDK8/19 Mediator kinases have been implicated in the emergence of non-genetic drug resistance. Dissecting the effects of pharmacological CDK8/19 inhibition on CML survival in response to BCR-ABLi, we found that a selective, non-toxic CDK8/19 inhibitor (CDK8/19i) Senexin B (SenB) and other CDK8/19i sensitized K562 cells to different BCR-ABLi via attenuation of cell cycle arrest. In particular, SenB prevented IM-induced upregulation of genes that negatively regulate cell cycle progression. SenB also antagonized IM-activated p27<sup>Kip1</sup> elevation thereby diminishing the population of G1-arrested cells. After transient G1 arrest, cells treated with IM + SenB re-entered the S phase, where they were halted and underwent replicative stress. Consequently, the combination of IM and SenB intensified apoptotic cell death, measured by activation of caspase 9 and 3, subsequent cleavage of poly(ADPriboso)polymerase 1, positive Annexin V staining and increase of subG1 fraction. In contrast, IM-treated BCR-ABL-positive KU812 CML cells, which did not induce p27<sup>Kip1</sup>, readily died regardless of SenB treatment. Thus, CDK8/19i prevent the quiescence-mediated escape from BCR-ABLi-induced apoptosis, suggesting a strategy for avoiding the CML relapse.

SUDS3
Also flagged:gene expressionbehaviouralorganizationreproductionregulation oftranscription factors
Journal Article 2025-02-15 ✓ 1 Snippet Brenman-Suttner DB, Rehan SM, Zayed A.
In-Text Gene Mentions

…st = 0.103),histone deacetylase complexdeacetylase complex subunit…

Show Full Abstract

Studies investigating social evolution often focus on species that are obligately eusocial, where presumably all of the adaptive genetic changes associated with sociality have already been completed. To fully understand eusociality, we must study species with facultative social behaviour. The small carpenter bee Ceratina calcarata is an ideal model for studying the genetics and molecular biology of eusocial evolution as it can exhibit both subsocial behaviour with parental care and social behaviour facilitated by the altruistic dwarf eldest daughter. Here, we sequenced the genomes of subsocial and social C. calcarata to identify mutations and genes associated with social behaviour and used these data to test several hypotheses related to the evolution of eusociality. Many single nucleotide polymorphisms that had high levels of genetic differentiation (F<sub>st</sub>) between social and subsocial C. calcarata were in or near genes or regions important for regulating gene expression. These results are consistent with the Genetic Toolkit Hypothesis of eusocial evolution. Our findings suggest that the low behavioural complexity observed in C. calcarata may involve modulation of existing regulatory genes and gene networks to generate phenotypes associated with social behaviour.

OLFM4
Also flagged:polyadenylationulcerative colitischronic intestinal diseasepathogenesisgene expressionRNA binding proteins
Journal Article 2025-02-15 ✓ 1 Snippet Zhang Z, Li D, Zheng S, Zheng C, Xu H, Wang X.
In-Text Gene Mentions

…LCN2, NOS2, CCL11,OLFM4, ANXA1, REG1A, S100A9,…

Show Full Abstract

<h4>Background</h4>Ulcerative colitis (UC) is an immune-mediated chronic intestinal disease, with a pathogenesis that remains incompletely understood. The purpose of this study is to analyze the difference of gene expression between UC patients and healthy controls using Oxford Nanopore Technology's long-read RNA sequencing (ONT-RNA-seq) and to explore how alternative polyadenylation (APA) site selection contributes to UC pathogenesis.<h4>Methods</h4>Colon tissue samples from UC and normal controls (NC) were collected, and total RNA was extracted and sequenced using ONT-RNA-seq technology. Various bioinformatics analyses were performed, including differential expression gene (DEG) analysis, functional enrichment analysis, APA site analysis, and prediction miRNAs and RNA binding proteins (RBPs) targets, to explore the molecular mechanism underlying UC.<h4>Results</h4>ONT-RNA-seq analysis revealed that the expression levels of ACSF2, NPY, SLC26A3, BRINP3, and PKLPP2 were significantly lower in UC patients compared to the NC group, while the expression levels of CCL20, CCL21, CD55, IDO1, LCN2, NOS2, CCL11, OLFM4, ANXA1, REG1A, S100A9, SLPI, SPINK1, and AGR2 were significantly higher. Functional enrichment analysis showed that DEGs were closely related to immune and inflammatory responses, which in turn are related to many challenges in the diagnosis and treatment of UC. Mechanistically, APA site selection was found to contribute to the regulation of gene expression in UC, and some APA genes were identified as potential regulators of miRNAs and RBPs. Vene diagram revealed significant overlap between miRNA- and RBP-targeted genes and DEGs, suggesting that APA genes may modulate genes expression in UC through miRNA and RBP targeting. Additionally, five key APA genes--CD38, NCALD, SMIM31, GPX7, and SWAP70--were identified as potentially playing crucial role in UC pathogenesis.<h4>Conclusions</h4>This study provides new insights into the molecular mechanisms of UC through ONT-RNA-seq technology, especially in gene expression regulation and APA site selection.

SERPINC1
Also flagged:metabolismto raceApolipoproteinApoA IVMicrofibril-associated glycoprotein 4MFAP4
Journal Article 2025-02-15 ✓ 2 Snippets Gotić J, Špelić L, Kuleš J, Horvatić A, Gelemanović A, Ljubić BB, Mrljak V, Bottegaro NB.
In-Text Gene Mentions

…(MFAP4), transferrin, andantithrombin-III.…

…E, MFAP4, transferrin,antithrombin-III, and a decrease…

Show Full Abstract

<h4>Background</h4>Long-term aerobic exercise during endurance racing places high demands on equine homeostasis. This study aimed to use proteomic analysis to elucidate complex biological responses during endurance exercise. It was hypothesized that different serum proteome changes would be noted, reflecting physiological processes as a response to race. The serum has been taken before and after an 80 km race from 13 endurance horses. Proteomic analysis of samples has been performed by TMT-based quantitative method. Apolipoprotein and haptoglobin values have been validated by enzyme-linked immunosorbent assay and biochemical assay respectively. The difference in protein abundance between pre and post-race values has been determined.<h4>Results</h4>In serum samples, 10 master proteins with significant p value differences between pre- and post-race abundances were detected. Increased protein abundance after the race was noted for the apolipoprotein groups: ApoA IV and E, Microfibril-associated glycoprotein 4 (MFAP4), transferrin, and antithrombin-III. Decreases in apolipoprotein C-II, C-III and R, alpha-1-microglobulin/bikunin precursor protein (AMBP) and haptoglobin abundance were reported after the race compared to before the race. Gene Ontology analysis revealed changes in triglyceride and acylglycerol homeostasis, lipid localization regulation, triglyceride catabolic processes, cholesterol binding, antioxidant activity and several cellular components.<h4>Conclusions</h4>The endurance race caused several homeostatic imbalances characterized by various alterations in serum protein levels. The most pronounced changes emphasize the adaptation of energy metabolism to a more pronounced consumption of lipids.

CCPG1
Also flagged:AutophagyMetabolic Cardiomyopathyobese cardiomyopathymetabolic disordersinsulin resistancetype 2 diabetes
Journal Article 2025-02-15 ✓ 1 Snippet Zhou R, Zhang Z, Li X, Duan Q, Miao Y, Zhang T, Wang M, Li J, Zhang W, Wang L, Jones OD, Xu M, Liu Y, Xu X.
In-Text Gene Mentions

…4; C57, C57BL/6;CCPG1, cell-cycle progression gene…

Show Full Abstract

Metabolic cardiomyopathy, encompassing diabetic and obese cardiomyopathy, is an escalating global health concern, driven by the rising prevalence of metabolic disorders such as insulin resistance, type 1 and type 2 diabetes, and obesity. These conditions induce structural and functional alterations in the heart, including left ventricular dysfunction, fibrosis, and ultimately heart failure, particularly in the presence of coronary artery disease or hypertension. Autophagy, a critical cellular process for maintaining cardiac homeostasis, is frequently disrupted in metabolic cardiomyopathy. This review explores the role of autophagy in the pathogenesis of high-fat diet (HFD) and streptozotocin (STZ)-induced metabolic cardiomyopathy, focusing on non-selective and selective autophagy pathways, including mitophagy, ER-phagy, and ferritinophagy. Key proteins and genes such as PINK1, Parkin, ULK1, AMPK, mTOR, ATG7, ATG5, Beclin-1, and miR-34a are central to the regulation of autophagy in metabolic cardiomyopathy. Dysregulated autophagic flux impairs mitochondrial function, promotes oxidative stress, and drives fibrosis in the heart. Additionally, selective autophagy processes such as lipophagy, regulated by PNPLA8, and ferritinophagy, modulated by NCOA4, play pivotal roles in lipid metabolism and iron homeostasis. Emerging therapeutic strategies targeting autophagy, including plant extracts (e.g., curcumin, dihydromyricetin), endogenous compounds (e.g., sirtuin 3, LC3), and lipid/glucose-lowering drugs, offer promising avenues for mitigating the effects of metabolic cardiomyopathy. Despite recent advances, the precise mechanisms underlying autophagy in this context remain poorly understood. A deeper understanding of autophagy's regulatory networks, particularly involving these critical genes and proteins, may lead to novel therapeutic approaches for treating metabolic cardiomyopathy.

HFE
Also flagged:CancermetabolismCardiomyopathyanthracyclinechildhood cancerhypertension
Journal Article 2025-02-15 ✓ 1 Snippet Fazzini L, Campana N, Cossu S, Deidda M, Madaudo C, Quagliariello V, Maurea N, Di Lisi D, Novo G, Zito C, Cadeddu Dessalvi C.
In-Text Gene Mentions

…synthase 3 HFHeart failure HFEfailure HFE Gene…

Show Full Abstract

Emerging evidence indicates that specific genetic variants are associated with an increased risk of toxicity from anticancer treatments and cancer-related cardiovascular complications. These genetic factors influence drug metabolism, efficacy, and susceptibility to adverse effects. For cancer patients, the genetic background can have two major cardiovascular implications, namely therapy-related cardiotoxicity and cancer-related cardiovascular complications. Baseline risk stratification is essential to identify higher-risk individuals and ensure they receive appropriate preventive and therapeutic interventions and more frequent follow-up. Current guidelines recommend stratification based on cardiovascular risk factors, but these factors alone cannot accurately define individual risk. Genetic background has been shown to enhance risk stratification. Beyond rare genetic variants, recent genome-wide association studies have identified single nucleotide polymorphisms implicated in cancer therapy toxicity. Despite their current limitations, polygenic risk scores are expected to play a significant role in risk stratification. This review aims to summarize the current evidence on the role of the genetic background of patients with cancer treated with potentially cardiotoxic drugs who develop cardiotoxicity, aiming to provide insights to refine risk stratification further and tailor the management of these patients.

Also flagged:Fatiguestroketraumatic brain injuryhypertensionatherosclerosisviral infection
Journal Article 2025-02-15 No Snippets Panossian A, Lemerond T, Efferth T.
Show Full Abstract

Long-lasting brain fatigue is a consequence of stroke or traumatic brain injury associated with emotional, psychological, and physical overload, distress in hypertension, atherosclerosis, viral infection, and aging-related chronic low-grade inflammatory disorders. The pathogenesis of brain fatigue is linked to disrupted neurotransmission, the glutamate-glutamine cycle imbalance, glucose metabolism, and ATP energy supply, which are associated with multiple molecular targets and signaling pathways in neuroendocrine-immune and blood circulation systems. Regeneration of damaged brain tissue is a long-lasting multistage process, including spontaneously regulating hypothalamus-pituitary (HPA) axis-controlled anabolic-catabolic homeostasis to recover harmonized sympathoadrenal system (SAS)-mediated function, brain energy supply, and deregulated gene expression in rehabilitation. The driving mechanism of spontaneous recovery and regeneration of brain tissue is a cross-talk of mediators of neuronal, microglia, immunocompetent, and endothelial cells collectively involved in neurogenesis and angiogenesis, which plant adaptogens can target. Adaptogens are small molecules of plant origin that increase the adaptability of cells and organisms to stress by interaction with the HPA axis and SAS of the stress system (neuroendocrine-immune and cardiovascular complex), targeting multiple mediators of adaptive GPCR signaling pathways. Two major groups of adaptogens comprise (i) phenolic phenethyl and phenylpropanoid derivatives and (ii) tetracyclic and pentacyclic glycosides, whose chemical structure can be distinguished as related correspondingly to (i) monoamine neurotransmitters of SAS (epinephrine, norepinephrine, and dopamine) and (ii) steroid hormones (cortisol, testosterone, and estradiol). In this narrative review, we discuss (i) the multitarget mechanism of integrated pharmacological activity of botanical adaptogens in stress overload, ischemic stroke, and long-lasting brain fatigue; (ii) the time-dependent dual response of physiological regulatory systems to adaptogens to support homeostasis in chronic stress and overload; and (iii) the dual dose-dependent reversal (hormetic) effect of botanical adaptogens. This narrative review shows that the adaptogenic concept cannot be reduced and rectified to the various effects of adaptogens on selected molecular targets or specific modes of action without estimating their interactions within the networks of mediators of the neuroendocrine-immune complex that, in turn, regulates other pharmacological systems (cardiovascular, gastrointestinal, reproductive systems) due to numerous intra- and extracellular communications and feedback regulations. These interactions result in polyvalent action and the pleiotropic pharmacological activity of adaptogens, which is essential for characterizing adaptogens as distinct types of botanicals. They trigger the defense adaptive stress response that leads to the extension of the limits of resilience to overload, inducing brain fatigue and mental disorders. For the first time, this review justifies the neurogenesis potential of adaptogens, particularly the botanical hybrid preparation (BHP) of Arctic Root and Ashwagandha, providing a rationale for potential use in individuals experiencing long-lasting brain fatigue. The review provided insight into future research on the network pharmacology of adaptogens in preventing and rehabilitating long-lasting brain fatigue following stroke, trauma, and viral infections.

Also flagged:QuinolinesynthesisMalariainfectionquininechloroquine
Journal Article 2025-02-15 No Snippets Srinivasa SB, Ullal SN, Kalal BS.
Show Full Abstract

Malaria, caused by the various <i>Plasmodium falciparum</i> strains, has been one of the deadliest diseases spread across the world. Over the years, several researchers have been employed to analyse molecular hybridization techniques for the synthesis of combination drugs to overcome the resistance gained by the parasite against the existing drugs. Hence, some of the significant contributions since 2019 till date have been summarised in the present review. Based on structure, the hybrids have been classified into bi-pharmacophores - having two pharmacologically active groups, tri-pharmacophores - having three pharmacologically active groups, metal-based and other miscellaneous hybrids. A thorough study of existing molecules could also reveal new leads for the development of anti-malarial agents with efficacy better than the preceding ones.

SERPINC1
Also flagged:CoagulationgestationfibrinogenFibpostpartum hemorrhagefetal growth restriction
Journal Article 2025-02-15 ✓ 1 Snippet Kou X, Li Q, Pan Z, Yang J.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Objectives</h4>To study the correlation between coagulation function indicators at 28-34 weeks of gestation and the occurrence, progression, and severity of hypertensive disorders in pregnancy (HDP), and to explore their potential predictive value for HDP. By analyzing the changes in coagulation function indicators during pregnancy, HDP can be detected early, the progression of HDP can be delayed, and the prognosis of mothers and infants can be improved.<h4>Methods</h4>This retrospective analysis encompassed 300 pregnant women who underwent antenatal examinations at the obstetrics outpatient department of Jinan Maternity and Child Care Hospital between October 2020 and October 2023. A total of 182 pregnant women diagnosed with HDP were selected as the observation group. Meanwhile, 118 healthy pregnant women from the same period served as the control group. General clinical data of all participants, such as age, gestational age, number of pregnancies, and number of deliveries, were collected. After an overnight fast, blood samples were drawn from all participants and immediately sent for testing to assess coagulation function indicators. Subsequently, these indicators were analyzed to explore their potential predictive value for the occurrence and severity of HDP.<h4>Results</h4>Platelet count (PLT), thrombin time (TT), and fibrinogen (Fib) were identified as independent prognostic factors for pregnant women with HDP. Additionally, pregnant women with HDP had a higher incidence of premature delivery, full-term birth, vaginal delivery, cesarean section, postpartum hemorrhage, fetal growth restriction, neonatal asphyxia, and perinatal death.<h4>Conclusion</h4>PT (Prothrombin Time), activated partial thromboplastin time (APTT), TT, Fib, and international normalized ratio can reflect the severity of hypertensive disorders in pregnancy.

Also flagged:GiantTrabecular Tumorthyroid neoplasmbronchitisneoplasmthyroid neoplasms
Journal Article 2025-02-15 No Snippets Hayashi K, Nakaya Y, Yoshida Y, Hayashi M, Izumi R, Suzuki A, Sato M, Kawahara E, Kobayashi Y.
Show Full Abstract

We describe the case of a 93-year-old woman with a giant thyroid neoplasm related to dyspnea and dysphagia. The patient visited our hospital for loss of appetite and dyspnea after bronchitis. Computed tomography revealed a massively enlarged thyroid gland compressing the trachea and esophagus. Cytological examination of the thyroid gland revealed features suggestive of hyalinizing trabecular tumor, a low-grade neoplasm. Videofluoroscopic swallowing examination demonstrated significant food retention and reflux in the esophagus, likely caused by upper esophageal compression. Despite recommending thyroidectomy, the patient declined surgery and received conservative and rehabilitative treatment, leading to improvement in her symptoms and discharge after 63 days. Giant thyroid neoplasms can compress surrounding organs, leading to respiratory and swallowing difficulties. The airway's proximity to the thyroid gland makes it particularly vulnerable to compression. This case demonstrates the potential for significant respiratory and swallowing complications associated with large thyroid tumors.

Also flagged:hepatitis Bviral hepatitishepatitisinfectionHBV infectiontenofovir disoproxil fumarate
Journal Article 2025-02-15 No Snippets Liu W, Liu R, Li P, Xia R, Zou Z, Zhang L, Shen M, Zhuang G.
Show Full Abstract

<h4>Background</h4>The World Health Organization (WHO) targets a 65% reduction in hepatitis B-related deaths by 2030 compared to 2015 to eliminate viral hepatitis as a major public health threat. It is unknown whether and how China can achieve this target despite significant intervention achievements. We aimed to predict the hepatitis B-related deaths in China and identify key developments needed to achieve the target.<h4>Methods</h4>An age- and time-dependent dynamic hepatitis B virus (HBV) transmission compartmental model was developed to predict the trend of hepatitis B-related deaths under base-case and subsequent scenarios from 2015 to 2040. In base-case scenario, we assumed the diagnosis and treatment (D&T) rate would reach 72% in 2030, as proposed by WHO. Subsequent scenarios were set based on the results of base-case and one-way sensitivity analysis.<h4>Results</h4>Compared with 2015, hepatitis B-related deaths would be reduced by 23.89% in 2030 and 51.79% in 2040, respectively, and the WHO's impact target of 65% reduction would not be achieved until 2038 at the earliest under base-case scenario. HBV clearance rate and current treatment effectiveness were the most sensitive parameters that significantly influenced the decline of hepatitis B-related deaths from 2015 to 2040. In the subsequent scenario, when D&T rate improving to 90% by 2030, with the current treatment effectiveness and HBV clearance rate being optimized from 2016, the WHO's impact target would be achieved in 2038. Increasing the clearance rate further from 2% to 2.8% during 2016-2030 linearly, the impact target would be achieved on time.<h4>Conclusions</h4>It is difficult for China to achieve the WHO's impact target of 65% reduction in hepatitis B-related deaths by 2030 even we assumed the D&T rate would reach 72% in 2030 and beyond. A comprehensive scale-up of available strategies, especially innovative drugs and technologies will ensure that China achieves the target on schedule.

SERPINC1
Also flagged:splanchnic vein thrombosisPortal vein thrombosisBudd-Chiari syndromevascular disorderscirrhosismyeloproliferative disease
Journal Article 2025-02-15 ✓ 1 Snippet Oguz Kozan E, Isguzar G, Ucbilek E, Yaras S, Gurkan E, Sezgin O, Sungur MA, Tombak A.
In-Text Gene Mentions

ATIII

Show Full Abstract

Portal vein thrombosis (PVT) and Budd-Chiari syndrome (BCS) are rare vascular disorders with both well-recognized and less commonly identified etiologies.<h4>Objectives</h4>This study aims to investigate the etiologies of portal vein thrombosis (PVT) and Budd-Chiari syndrome (BCS), thereby enhancing improving early detection and management strategies for these conditions. A retrospective review was undertaken to identify the etiologies of PVT and BCS.<h4>Methods</h4>A detailed clinical evaluation was performed and all underlying diseases, such as MPD, and related conditions (e.g. surgery) associated with thrombosis were recorded.<h4>Results</h4>The study comprised a total of 73 patients, with 58 diagnosed with PVT and 15 with BCS. Of these patients, 56 (76.7%) had at least one underlying disease. The most prevalent underlying diseases in patients with PVT were cirrhosis (32/58, 55.2%), myeloproliferative disease (3/58, 5.2%), malignancy (4/58, 6.9%), and rheumatological conditions (4/58, 6.9%). For BCS, 11/15 patients (73.3%) had at least one predisposing condition, including cirrhosis in six cases. Congenital causes were identified in 16/58 cases of PVT (27.6%), in 7/15 cases of BCS (46.7%). Thirty-two patients had previously undergone gastrointestinal surgery (PVT 24/58, BCS 8/15); surgery was the sole etiology in 15/73 patients (20.5%). Homocysteinemia was common (PVT 20/58, BCS 5/15). A multitude of rare etiologies were identified, including paroxysmal nocturnal haemoglobinuria, Crohn's disease, nephrotic syndrome, drug therapies, pregnancy, JAK2 mutation, and elevated factor VIII or fibrinogen.<h4>Conclusions</h4>The presence of a wide range of diverse frequent-infrequent etiologies of congenital or acquired splanchnic vein thrombosis in this cohort underscores the necessity for the implementation of appropriate diagnostic strategies in a broad spectrum of at-risk patients.

Also flagged:sleep disordersArteryChronic Obstructive Pulmonary DiseaseDiabetesArteriopathyAtherosclerosis
Journal Article 2025-02-14 No Snippets Iyer KR, Clarke SL, Guarischi-Sousa R, Gjoni K, Heath AS, Young EP, Stitziel NO, Laurie C, Broome JG, Khan AT, Lewis JP, Xu H, Montasser ME, Ashley KE, Hasbani NR, Boerwinkle E, Morrison AC, Chami N, Do R, Rocheleau G, Lloyd-Jones DM, Lemaitre RN, Bis JC, Floyd JS, Kinney GL, Bowden DW, Palmer ND, Benjamin EJ, Nayor M, Yanek LR, Kral BG, Becker LC, Kardia SLR, Smith JA, Bielak LF, Norwood AF, Min YI, Carson AP, Post WS, Rich SS, Herrington D, Guo X, Taylor KD, Manson JE, Franceschini N, Pollard KS, Mitchell BD, Loos RJF, Fornage M, Hou L, Psaty BM, Young KA, Regan EA, Freedman BI, Vasan RS, Levy D, Mathias RA, Peyser PA, Raffield LM, Kooperberg C, Reiner AP, Rotter JI, Jun G, de Vries PS, Assimes TL.
Show Full Abstract

<h4>Background</h4>Genome-wide association studies have identified several hundred susceptibility single nucleotide variants for coronary artery disease (CAD). Despite single nucleotide variant-based genome-wide association studies improving our understanding of the genetics of CAD, the contribution of structural variants (SVs) to the risk of CAD remains largely unclear.<h4>Method and results</h4>We leveraged SVs detected from high-coverage whole genome sequencing data in a diverse group of participants from the National Heart Lung and Blood Institute's Trans-Omics for Precision Medicine program. Single variant tests were performed on 58 706 SVs in a study sample of 11 556 CAD cases and 42 907 controls. Additionally, aggregate tests using sliding windows were performed to examine rare SVs. One genome-wide significant association was identified for a common biallelic intergenic duplication on chromosome 6q21 (<i>P</i>=1.54E-09, odds ratio=1.34). The sliding window-based aggregate tests found 1 region on chromosome 17q25.3, overlapping <i>USP36</i>, to be significantly associated with coronary artery disease (<i>P</i>=1.03E-10). <i>USP36</i> is highly expressed in arterial and adipose tissues while broadly affecting several cardiometabolic traits.<h4>Conclusions</h4>Our results suggest that SVs, both common and rare, may influence the risk of coronary artery disease.

Also flagged:Hydroxyapatiteapatiteporepoly caprolactonedeferoxaminemagnesium
Journal Article 2025-02-14 No Snippets Koushik TM, Miller CM, Antunes E.
Show Full Abstract

Porous scaffolds in bone tissue engineering (BTE) play a crucial role in facilitating osteointegration with host tissues and providing nutrients to cells involved in bone healing. Scaffold architecture influences osteointegration, biofunctionality and mechanical strength, necessitating a clear understanding of its impact. In this study, hydroxyapatite scaffolds are 3D printed with three types of triply periodic minimal surface (TPMS) structures: gyroid, lidinoid, and split-P, at porosities ranging from 50% to 80%. Split-P architecture exhibits the highest compression strength, between 15 and 25 MPa, but provides the least surface area for bone apatite precipitation. Conversely, gyroid and lidinoid structures demonstrate the highest levels of bone apatite precipitation across all porosities when immersed in simulated body fluid. To optimise scaffold design, graded structures were designed with multiple TPMS structures arranged in a core-shell configuration. A structure featuring a solid core and a 70% gyroid shell achieves the highest compression strength of 120 MPa, while also supporting cell attachment and differentiation comparable to that of a fully porous structure. This combination of compression strength similar to cancellous bone and ability for positive interaction with osteoblast cells makes it an ideal candidate for load-bearing applications in BTE.

Also flagged:creatine kinaseMBbicinchoninic acidBSADigestiontetraethylammonium
Journal Article 2025-02-14 No Snippets Lu Z, Liu Q, Fan Y, Xiao Q, Yin D, Li Y.
Show Full Abstract

<h4>Background</h4>Plasma protein alterations may occur in patients with acute myocardial infarction (AMI). In this study, we investigated the plasma proteomics of patients with first-onset AMI to identify a novel diagnostic target for myocardial infarction.<h4>Methods</h4>Using a case-control design, we recruited 6 patients with first-onset AMI and 6 age- and sex-matched healthy controls. Mass spectrometry was used to analyze their plasma proteomics. Additionally, we enrolled 156 patients with AMI and 232 healthy individuals to validate the differentially expressed proteins using ELISA.<h4>Results</h4>A total of 58 differentially expressed proteins were identified between the 2 groups (<i>P</i><0.05, fold change ≥2 or ≤1/2), including 36 upregulated and 22 downregulated proteins. Notably, we discovered a clinically significant protein, thymosin β4 (TMSB4), which was subsequently validated by ELISA. Plasma TMSB4 levels were significantly elevated in patients with first-onset AMI compared with the control group (1093 [701-1608] ng/mL versus 421 [245-658] ng/mL; <i>P</i><0.001). Univariate and multivariate logistic regression analyses indicated that TMSB4 is a risk factor for first-onset AMI. The receiver operating characteristic curve yielded an area under the curve value of 0.849, with an optimal cutoff of 682 ng/mL, sensitivity of 0.808, and specificity of 0.793. A robust correlation was observed between TMSB4 and cardiac troponin I (<i>r</i>=0.9044, <i>P</i><0.0001), and the κ test yielded a moderate concordance value (κ=0.590 [95% CI, 0.509-0.671]; <i>P</i><0.001).<h4>Conclusions</h4>TMSB4 holds diagnostic value for first-onset myocardial infarction and may therefore be considered a potential diagnostic marker for infarction.<h4>Registration</h4>URL: https://www.chictr.org.cn/; unique identifier: ChiCTR2300078144.

DCC
Also flagged:Sleepsynapsesglutamatesynapseautismtranscription factor
Journal Article 2025-02-14 ✓ 2 Snippets Vogt KE, Kulkarni A, Pandey R, Dehnad M, Konopka G, Greene RW.
In-Text Gene Mentions

…synapse numbers, includingDcc( Horn et…

…neurons, including Cdh13,Dcc, Glra2, Gpc6, Grik4,…

Show Full Abstract

Sleep loss increases AMPA-synaptic strength and number in the neocortex. However, this is only part of the synaptic sleep loss response. We report an increased AMPA/NMDA EPSC ratio in frontal-cortical pyramidal neurons of layers 2-3. Silent synapses are absent, decreasing the plastic potential to convert silent NMDA to active AMPA synapses. These sleep loss changes are recovered by sleep. Sleep genes are enriched for synaptic shaping cellular components controlling glutamate synapse phenotype, overlap with autism risk genes, and are primarily observed in excitatory pyramidal neurons projecting intra-telencephalically. These genes are enriched with genes controlled by the transcription factor, MEF2c, and its repressor, HDAC4. Sleep genes can thus provide a framework within which motor learning and training occur mediated by the sleep-dependent oscillation of glutamate-synaptic phenotypes.

OLFM4
Also flagged:CancerTumorgastric cancerEGFRWNTamphiregulin
Journal Article 2025-02-14 ✓ 5 Snippets Zhang G, Zhang X, Pan W, Chen X, Wan L, Liu C, Yong Y, Zhao Y, Sang S, Zhang L, Yao S, Guo Y, Wang M, Wang X, Peng G, Yan X, Wang Y, Zhang M.
In-Text Gene Mentions

…of SOX9 andOLFM4, promoting drug resistance…

…upregulating SOX9 andOLFM4, contributing to drug…

…by SOX9 andOLFM4), according to the…

…CD47, ANPEP, ALDH1A1,OLFM4, and SOX9), and…

…co‐staining of SOX9,OLFM4, and EpCAM in…

Show Full Abstract

Despite significant advancements in identifying novel therapeutic targets and compounds, cancer stem cells (CSCs) remain pivotal in driving therapeutic resistance and tumor progression in gastric cancer (GC). High-resolution knowledge of the transcriptional programs underlying the role of CSC niche in driving tumor stemness and progression is still lacking. Herein, spatial and single-cell RNA sequencing of 32 human gastric mucosa tissues at various stages of malignancy, illuminating the phenotypic plasticity of tumor epithelium and transcriptional trajectory from mature gastric chief cells to the CSC state, which is associated with activation of EGFR and WNT signaling pathways, is conducted. Moreover, the CSCs interact with not only the immunosuppressive CXCL13<sup>+</sup> T cells and CCL18<sup>+</sup> M2 macrophages to evade immune surveillance, but also the inflammatory cancer-associated fibroblasts (iCAFs) to promote tumorigenesis and maintain stemness, which construct the CSC niche leading to inferior prognosis. Notably, it is uncovered that amphiregulin (AREG) derived from iCAFs promotes tumor stemness by upregulating the expression of SOX9 in tumor cells, and contributes to drug resistance via the AREG-ERBB2 axis. This study provides valuable insight into the characteristics of CSC niche in driving tumor stemness and progression, offering novel perspective for designing effective strategies to overcome GC therapy resistance.

CSE1L
Also flagged:Ovarian Cancercancerglutaminolysislactatemalate enzyme 2ME2
Journal Article 2025-02-14 ✓ 1 Snippet Zheng C, Tan H, Niu G, Huang X, Lu J, Chen S, Li H, Zhu J, Zhou Z, Xu M, Pan C, Liu J, Li J.
In-Text Gene Mentions

…] including HSP90B,CSE1Land PSME1.…

Show Full Abstract

Lactate derived from aerobic glycolysis is crucial for DNA damage repair and chemoresistance. Nevertheless, it is frequently noted that cancer cells depend on glutaminolysis to replenish essential metabolites. Whether and how glutaminolysis might enhance lactate production and facilitate DNA repair in cancer cells remains unknown. Here, it is shown that malate enzyme 2 (ME2), which metabolizes glutamine-derived malate to pyruvate, contributes to lactate production and chemotherapy resistance in ovarian cancer. Mechanistically, chemotherapy reduces the expression of glucose transporters and impairs glucose uptake in cancer cells. The resultant decrease in intracellular glucose levels triggers the acetylation of ME2 at lysine 156 by ACAT1, which in turn potentiates ME2 enzyme activity and facilitates lactate production from glutamine. ME2-derived lactate contributes to the development of acquired chemoresistance in cancer cells subjected to prolonged chemotherapy, primarily by facilitating the lactylation of proteins involved in homologous recombination repair. Targeting ACAT1 to inhibit ME2 acetylation effectively reduced chemoresistance in both in vitro and in vivo models. These findings underscore the significance of acetylated ME2-mediated lactate production from glutamine in chemoresistance, particularly under conditions of reduced intracellular glucose within cancer cell, thereby complementing the Warburg effect and offering new perspectives on the metabolic links to chemotherapy resistance.

OLFM4
Also flagged:ghrelinPYYGLP-1gastric emptyingleptinlipolysis
Journal Article 2025-02-14 ✓ 3 Snippets Li Q, Tan D, Xiong S, Yu K, Su Y, Zhu W.
In-Text Gene Mentions

…primary antibodies targetingOlfm4(1:100 diluted; Cell…

…fluorescence intensity ofOlfm4and Muc2 protein…

…stem cell markerOlfm4in the colon…

Show Full Abstract

Previous clinical trials have shown that time-restricted feeding can be involved in regulating the metabolic health of humans and animals. However, the underlying mechanism has not been fully explored. In this study, the pig model was employed to simulate four prevalent human eating habits, with the aim of investigating the impact of gut microbiota and microbial metabolites on gut hormone secretion and appetite regulation. Compared to the <i>ad libitum</i> feeding (ALF) pattern, three time-restricted feeding patterns reduced total food intake and eating time. Meanwhile, three time-restricted feeding patterns induced elevated levels of serum and hypothalamic glucagon-like peptide-1 (GLP-1), while suppressing reward-related circuits in the hypothalamus. It is noteworthy that the early time-restricted feeding (eTRF) pattern increased the number of intestinal enteroendocrine cells (EECs) compared to ALF. Metagenomic and metabonomic analyses revealed that three time-restricted feeding patterns induced colonization of <i>Lactobacillus</i> and significantly increased the levels of its metabolite, indole-3-lactic acid (ILA). Dietary supplementation with ILA exhibited an increasing trend in fasting serum GLP-1 level of piglets. <i>In vitro</i> studies with pig intestinal organoids showed the <i>Lactobacillus</i> metabolite ILA enhanced GLP-1 secretion through the promotion of intestinal stem cell differentiation into EECs, rather than activating the ability of EECs to secrete GLP-1. Overall, time-restricted feeding promoted GLP-1 secretion and affected long-term appetite regulation by promoting the colonization of <i>Lactobacillus</i> and modulating microbial tryptophan metabolism.

HFE
Also flagged:deathcirrhosisportal hypertensionhepatic encephalopathyascitesHE
Journal Article 2025-02-14 ✓ 2 Snippets Mohammadi M, Hasjim BJ, Balbale SN, Polineni P, Huang AA, Paukner M, Banea T, Dentici O, Vitello DJ, Obayemi JE, Duarte-Rojo A, Nadig SN, VanWagner LB, Zhao L, Mehrotra S, Ladner DP.
In-Text Gene Mentions

…virus (HBV), autoimmune,hemochromatosis, and Wilson’s disease.…

…Wilson’s disease, orhemochromatosis, but also had…

Show Full Abstract

<h4>Background</h4>Cirrhosis is a dynamic disease process leading to liver-related death, which has increased by over 65% over the last decade. Unpredictable hepatic decompensation complications are a major source of morbidity and mortality. Thus, accurately characterizing disease progression through discrete stages of cirrhosis is critical towards implementing timely intervention and liver transplant (LT) waitlisting.<h4>Methods</h4>A retrospective, longitudinal, population-cohort study of adult patients with cirrhosis from a US metropolitan area (2006-2012) was conducted. Clinical diagnoses were defined by ICD-9 and CPT codes. Cirrhosis stages were defined as: compensated without portal hypertension (Stage 1), compensated with portal hypertension (Stage 2), variceal bleeding (Stage 3), hepatic encephalopathy (Stage 4a), ascites (Stage 4b), and ≥2 different decompensating complications (Stage 5). Multivariate Fine-Gray competing risk survival analysis adjusted for clinicodemographic covariates.<h4>Results</h4>Among 12,196 patients with cirrhosis, the mean (±SD) age was 56.8 (±11.7) years with a follow-up time of 2.35 (±1.81) years. A novel 5-stage disease progression framework was used. The 1-year mortality rates for each stage were 7.3% for Stage 1, 5.4% for Stage 2, 11.4% for Stage 3, 10.0% for Stage 4a, 20.2% for Stage 4b, and 43.8% for Stage 5. Compared to those in Stage 1, Stage 3 (sHR:1.83, 95% CI:1.36-2.48, P<0.001), Stage 4b (sHR:1.45, 95% CI:1.23-1.70, P<0.001), and Stage 5 (sHR:1.95, 95% CI:1.71-2.23, P<0.001) patients had higher risks of mortality. Additional disease progression rates were identified.<h4>Conclusion</h4>Even among patients with compensated cirrhosis, the 1-year mortality rate was as high as 7.3% and subsequently increases with each decompensation complication. This one-year mortality rate is higher than 5-years mortality rate reported in previously known non-US studies. The highest associated risk of death was observed among patients with ≥2 different decompensating complications (95.2%), variceal bleeding (83.2%) and ascites (44.9%). Overall, patients in advanced stages of cirrhosis were more likely to die than they were to receive a LT, suggesting that patients should be referred and waitlisted for LT earlier in the disease process.

STAU1
Also flagged:cancerlung cancerautophagytumorscancersbreast cancer
Journal Article 2025-02-14 ✓ 2 Snippets Wang S, Lei J, Zou X, Jin S.
In-Text Gene Mentions

…TPM1, DAPK1, PTGS2,STAU1, and FOS, were…

…22 ], andSTAU1is important for…

Show Full Abstract

Biological and dynamic mechanisms by which Drug-tolerant persister (DTP) cells contribute to the development of acquired drug resistance have not been fully elucidated. Here, by integrating multidimensional data from drug-treated PC9 cells, we developed a novel multiscale mathematical model from an evolutionary perspective that encompasses epigenetic and cellular population dynamics. By coupling stochastic simulation with quantitative analysis, we identified epigenetic instability as the most prominent kinetic feature related to the emergence of DTP cell subpopulations and the effectiveness of intermittent treatment. Moreover, we revealed the optimal schedule for intermittent treatment, including the optimal area for therapeutic time and drug holidays. By leveraging single-cell RNA-seq data characterizing the drug tolerance of lung cancer, we validated the predictions made by our model and further revealed previously unrecognized biological features of DTP cells, such as cell autophagy and migration, as well as new biomarker genes of therapeutic tolerance. Our work not only provides a paradigm for the integration of multiscale mathematical models with newly emerging genomics data but also improves our understanding of the crucial roles of DTP cells and offers guidance for developing new intermittent treatment strategies against acquired drug resistance in cancer.

DCC
Also flagged:behavioraldepressionLHlipopolysaccharidedegradationSCOP
Journal Article 2025-02-14 ✓ 5 Snippets Cheng P, Ding K, Chen D, Yang C, Wang J, Yang S, Chen M, Zhu G.
In-Text Gene Mentions

…regulation mechanism ofDCCin behavioral despair…

…an elevation inDCCexpression in the…

…Additionally, elevatedDCCexpression in the…

…LH mice uponDCCoverexpression.…

…By contrast, neutralizingDCCactivity ameliorated LH-induce…

Show Full Abstract

A longed lack of control over harmful stimuli can lead to learned helplessness (LH), a significant factor in depression. However, the cellular and molecular mechanisms underlying LH, and eventually behavioral despair, remain largely unknown. The deleted in colorectal cancer (dcc) gene is associated with the risk of depression. However, the therapeutic potential and regulation mechanism of DCC in behavioral despair are still uncertain. In this study, we showed that depressive stimulators, including LH, lipopolysaccharide, and unpredictable chronic mild stress, triggered an elevation in DCC expression in the medial prefrontal cortex (mPFC). Additionally, elevated DCC expression in the mPFC was crucial in inducing behavioral despair, as evidenced by the induction of behavioral despair in normal mice and exacerbation of behavioral despair in LH mice upon DCC overexpression. By contrast, neutralizing DCC activity ameliorated LH-induced behavioral despair. Importantly, we elucidated that pathological DCC expression was attributable to the excessive excitation of CaMKII<sup>+</sup> neurons in a manner dependent on the calpain-mediated degradation of SCOP and aberrant phosphorylation of the ERK signaling pathway. In addition, the increase in DCC expression led to a decreased excitability threshold in CaMKII<sup>+</sup> neurons in the mPFC, which was supported by the observation that the ligand netrin 1 increased the frequency of action potential firing and of spontaneous excitatory postsynaptic currents in CaMKII<sup>+</sup> neurons. In conclusion, our data indicate that LH triggers the excessive excitation of CaMKII<sup>+</sup> neurons and activation of calpain-SCOP/ERK signaling to promote DCC expression, and DCC represents a crucial target for the treatment of LH-induced behavioral despair in male mice.

Also flagged:phosphatescarbonatesapatitecarbonatephosphateminerals
Journal Article 2025-02-14 No Snippets Del Valle H, Rodríguez-Navarro AB, Moclán A, García-Medrano P, Cáceres I.
Show Full Abstract

Bone diagenesis is a complex process that modifies bone components in response to burial conditions. These modifications help to understand deposit formation and classify fossils by stratigraphy. The combined techniques of X-ray diffraction with Rietveld refinement and infrared spectroscopy were used to study the bone diagenetic processes along the complete stratigraphic sequence of Galería site (Sierra de Atapuerca, Spain). Eleven chemometric indices considering the different bone components (phosphates, carbonates, organic phase), together with the apatite unit cell parameters and cell volume were evaluated by 9 machine learning algorithms for bone diagenesis/stratigraphic classification. The results showed differences along the stratigraphic sequence due to changes in the apatite structure chemistry (i.e., F<sup>-</sup> and OH<sup>-</sup>), producing a gradual shift of the unit cell volume (from 531.9 to 526.1 Å<sup>3</sup>) from GII to GIV associated with coupled dissolution-precipitation processes. Two diagenetic pathways are indicated: The lowest unit (GII) is characterized by leaching and carbonate loss in bone, suggesting an acidic and wet burial environment with the formation of authigenic phosphate minerals. The uppermost units (GIII-GIV) show bone apatite undergoing F<sup>-</sup> and CO<sub>3</sub> incorporation, suggesting a slightly alkaline and drier environment. These differences enabled the development of classification models to understand deposit formation dynamics and also recontextualize dissociated fossil bones.

Also flagged:sepsisdeathinfectionsinfectioncytokineCD11b
Journal Article 2025-02-14 No Snippets Zhang J, Shao Y, Wu J, Zhang J, Xiong X, Mao J, Wei Y, Miao C, Zhang H.
Show Full Abstract

Sepsis remains the leading cause of death in intensive care units. Despite newer antimicrobial and supportive therapies, specific treatments are still lacking. Neutrophils are pivotal components of the effector phase of the host immune defense against pathogens and play a crucial role in the control of infections under normal circumstances. In addition to its anti-infective effects, the dysregulation and overactivation of neutrophils may lead to severe inflammation or tissue damage and are potential mechanisms for poor prognosis in sepsis. This review focuses on recent advancements in the understanding of the functional status of neutrophils across various pathological stages of sepsis to explore the mechanisms by which neutrophils participate in sepsis progression and provide insights for the treatment of sepsis by targeting neutrophils.

Also flagged:cancerprimary tumortumorWntGFPsignal transduction
Journal Article 2025-02-14 No Snippets Yang S, Seo J, Choi J, Kim SH, Kuk Y, Park KC, Kang M, Byun S, Joo JY.
Show Full Abstract

Delving into cancer dormancy has been an inherent task that may drive the lethal recurrence of cancer after primary tumor relief. Cells in quiescence can survive for a short or long term in silence, may undergo genetic or epigenetic changes, and can initiate relapse through certain contextual cues. The state of dormancy can be induced by multiple conditions including cancer drug treatment, in turn, undergoes a life cycle that generally occurs through dissemination, invasion, intravasation, circulation, immune evasion, extravasation, and colonization. Throughout this cascade, a cellular machinery governs the fate of individual cells, largely affected by gene regulation. Despite its significance, a precise view of cancer dormancy is yet hampered. Revolutionizing advanced single cell and long read sequencing through analysis methodologies and artificial intelligence, the most recent stage in the research tool progress, is expected to provide a holistic view of the diverse aspects of cancer dormancy.

Also flagged:Wound healinghemostasisdeathferroptosislipidperoxides
Journal Article 2025-02-14 No Snippets Zhao Y, Chen Z, Xie S, Xiao F, Hu Q, Ju Z.
Show Full Abstract

Wound healing is a complex biological process involving multiple steps, including hemostasis, inflammation, proliferation, and remodeling. A novel form of regulated cell death, ferroptosis, has garnered attention because of its involvement in these processes. Ferroptosis is characterized by the accumulation of lipid peroxides and is tightly regulated by lipid metabolism, iron metabolism, and the lipid-peroxide repair network, all of which exert a significant influence on wound healing. This review highlights the current findings and emerging concepts regarding the multifaceted roles of ferroptosis throughout the stages of normal and chronic wound healing. Additionally, the potential of targeted interventions aimed at modulating ferroptosis to improve wound-healing outcomes is discussed.

Also flagged:Nrf2iron overload diseasesIroniron overload disordersFriedreich's Ataxiadimethyl fumarate
Journal Article 2025-02-14 No Snippets Dong Y, Zheng M, Ding W, Guan H, Xiao J, Li F.
Show Full Abstract

Iron overload and related oxidative damage are seen in many rare diseases, due to mutation of iron homeostasis-related genes. As a core regulator on cellular antioxidant reaction, Nrf2 can also decrease systemic and cellular iron levels by regulating iron-related genes and pathways, making Nrf2 activators very good candidates for the treatment of iron overload disorders. Successful examples include the clinical use of omaveloxolone for Friedreich's Ataxia and dimethyl fumarate for relapsing-remitting multiple sclerosis. Despite these uses, the therapeutic potentials of Nrf2 activators for iron overload disorders may be overlooked in clinical practice. Therefore, this study talks about the potential use, possible mechanisms, and precautions of Nrf2 activators in treating rare iron overload diseases. In addition, a combination therapy with Nrf2 activators and iron chelators is proposed for clinical reference, aiming to facilitate the clinical use of Nrf2 activators for more iron overload disorders.

UNC13C
Also flagged:Neurocognitive Disorderscognitive impairmentesketaminewaterAnk1Cbln4
Journal Article 2025-02-14 ✓ 2 Snippets Hu W, Luo J, Li H, Luo Y, Zhang X, Wu Z, Yang Q, Zhao S, Hu B, Zou X.
In-Text Gene Mentions

…Cbln4, Grin3a, Gpld1,Unc13c, Glra3, Cntnap4, L1cam,…

…(Cbln4, Grin3a, Gpld1,Unc13c, Glra3, Cntnap4, L1cam,…

Show Full Abstract

<h4>Background</h4>Esketamine ameliorates propofol-induced brain damage and cognitive impairment in mice. However, the precise role and underlying mechanism of esketamine in perioperative neurocognitive disorders (PND) remain unclear. Therefore, this study aimed to investigate the key genes associated with the role of esketamine in PND through animal modeling and transcriptome sequencing.<h4>Methods</h4>The present study established a mice model of PND and administered esketamine intervention to the model, and mice were divided into control, surgical group, and surgical group with esketamine. Behavioral assessments were conducted using the Morris water maze and Y maze paradigms, while transcriptome sequencing was performed on hippocampal samples obtained from 3 groups. Differential expression analysis and weighted gene co-expression network analysis (WGCNA) were performed on sequencing data to identify candidate genes related to esketamine treating PND. Thereafter, protein-protein interaction (PPI) network analysis was implemented to select key genes. The genes obtained from each step were subjected to enrichment analysis, and a regulatory network for key genes was constructed.<h4>Results</h4>The Morris water maze and Y maze findings demonstrated the successful construction of our PND model, and indicated that esketamine exhibits a certain therapeutic efficacy for PND. Ank1, Cbln4, L1cam, Gap43, and Shh were designated as key genes for subsequent analysis. The 5 key genes were significantly enriched in cholesterol biosynthesis, nonsense mediated decay (NMD), formation of a pool of free 40s subunits, major pathway of rRNA processing in the nucleolus and cytosol, among others. Notably, the miRNAs, mmu-mir-155-5p and mmu-mir-1a-3p, functionally co-regulated the expression of Ank1, Gap43, and L1cam.<h4>Conclusion</h4>We uncovered the therapeutic efficacy of esketamine in treating PND and identified 5 key genes (Ank1, Cbln4, L1cam, Gap43, and Shh) that contribute to its therapeutic effects, providing a valuable reference for further mechanistic studies on esketamine's treatment of PND.

DCC
Also flagged:Fructoseleukemiamethylationgene expressionChromatincancer
Journal Article 2025-02-14 ✓ 5 Snippets Mateo-Fernández M, Alves-Martínez P, Del Río-Celestino M, Font R, Merinas-Amo T, Alonso-Moraga Á.
In-Text Gene Mentions

…FRU, PEP, andDCCin Drosophila melanogaster…

…and 18 mg/mL.DCCalso significantly increased…

…PEP andDCCgenerally hypermethylated AluM…

…are treated withDCC, for which the…

…FRU andDCCdid not exert…

Show Full Abstract

Fructose has been considered as an additive from soda beverages. For the approval of new additives or to extend the usage of an approved one, it is necessary to conduct toxicological studies in order to evaluate the DNA damage induced by these compounds. Our study is based on evaluating the safety and the nutraceutical potential of Fructose (FRU), a soda cola beverage (Pepsi-cola, PEP), and a diet soda cola (Diet Coke, DCC), characterizing the DNA changes induced in the <i>Drosophila melanogaster</i> organism model and in the human leukemia HL-60 cells performing different assays. Our results showed neither the toxicity nor mutagenic activity of FRU, PEP, and DCC in <i>Drosophila melanogaster</i>, while only PEP exhibited protective effects in the antitoxity assay, showing an 80% survival rate in combined treatments. FRU, but not PEP, enhanced lifespan parameters by up to 23 more days at the 5 mg/mL concentration. All three substances exhibited chemopreventive properties in some of the checkpoints carried out related to clastogenicity and methylation patterns in HL-60 cells. In conclusion, the tested compounds were safe at tested concentrations in <i>Drosophila</i> and showed moderate chemopreventive activity.

Also flagged:TP53Prostate cancercancercancerstumorPCa
Journal Article 2025-02-14 No Snippets Ofner H, Kramer G, Shariat SF, Hassler MR.
Show Full Abstract

Prostate cancer remains a leading cause of cancer-related mortality in men, with advanced stages posing significant treatment challenges due to high morbidity and mortality. Among genetic alterations, TP53 mutations are among the most prevalent in cancers and are strongly associated with poor clinical outcomes and therapeutic resistance. This review investigates the role of TP53 mutations in prostate cancer progression, prognosis, and therapeutic development. A comprehensive analysis of preclinical and clinical studies was conducted to elucidate the molecular mechanisms, clinical implications, and potential therapeutic approaches associated with TP53 alterations in prostate cancer. TP53 mutations are highly prevalent in advanced stages, contributing to genomic instability, aggressive tumor phenotypes, and resistance to standard treatments. Emerging evidence supports the utility of liquid biopsy techniques, such as circulating tumor DNA analysis, for detecting TP53 mutations, providing prognostic value and facilitating early intervention strategies. Novel therapeutic approaches targeting TP53 have shown promise in preclinical settings, but their clinical efficacy requires further validation. Overall, TP53 mutations represent a critical biomarker for disease progression and therapeutic response in prostate cancer. Advances in detection methods and targeted therapies hold significant potential to improve outcomes for patients with TP53-mutated prostate cancer. Further research is essential to integrate TP53-based strategies into routine clinical practice.

Also flagged:Mitochondrialconnective tissue disorderATP6CYBpathogenesisEDS
Journal Article 2025-02-14 No Snippets Shirvani A, Shirvani P, Jonah U, Moore BE, Holick MF.
Show Full Abstract

<b>Background/Objectives:</b> Hypermobile Ehlers-Danlos Syndrome (hEDS) is a complex connective tissue disorder with multi-systemic manifestations that significantly impact quality of life. This case report investigates the clinical course and molecular mechanisms of advanced hEDS through an in-depth case study and post-mortem findings. <b>Methods:</b> The clinical history of a 24-year-old patient with advanced hEDS was analyzed, focusing on progressive complications across multiple systems. Post-mortem examination and genetic analysis were performed to elucidate the underlying pathophysiology. <b>Results:</b> The patient's clinical course was marked by gastrointestinal, neurological, and immune complications requiring numerous surgical interventions. Post-mortem findings revealed severe gastrointestinal dysmotility and Alzheimer's Type II astrocytes. Genetic analysis identified variants in mtDNA genes ATP6, CYB, and ND, suggesting a potential role of impaired mitochondrial function in hEDS pathogenesis but requiring further validation through functional studies. <b>Conclusions:</b> This case report provides valuable insights into the potential role of mitochondrial dysfunction in advanced hEDS and highlights the need for further research in this area. Future studies should include comprehensive functional assays, longitudinal tissue sampling, family genetic analyses, and muscle biopsies to better understand the complex interplay between genetic factors, mitochondrial function, and clinical manifestations in hEDS. Establishing genetic bases and developing targeted therapies addressing both structural and metabolic aspects are crucial. The patient's legacy offers invaluable information that could significantly contribute to enhancing diagnostic accuracy and developing personalized treatment strategies for this challenging disorder, potentially leading to better care for individuals living with hEDS.

Also flagged:DeathCannabidiolTumorcannabinoidsautophagytransient receptor potential cation channels
Journal Article 2025-02-14 No Snippets Melo ESA, Asevedo EA, Duarte-Almeida JM, Nurkolis F, Syahputra RA, Park MN, Kim B, Couto ROD, Ribeiro RIMA.
Show Full Abstract

Commonly known as marijuana or hemp, <i>Cannabis sativa</i> L. (Cannabaceae), contains numerous active compounds, particularly cannabinoids, which have been extensively studied for their biological activities. Among these, cannabidiol (CBD) stands out for its therapeutic potential, especially given its non-psychotropic effects. This review evaluates the antitumor properties of CBD, highlighting its various mechanisms of action, including the induction of apoptosis, autophagy, and necrosis. By synthesizing findings from in vitro studies on the cell death mechanisms and signaling pathways activated by CBD in various human tumor cell lines, this literature review emphasizes the therapeutic promise of this natural antineoplastic agent. We conducted a comprehensive search of articles in PubMed, Scopus, Springer, Medline, Lilacs, and Scielo databases from 1984 to February 2022. Of the forty-three articles included, the majority (68.18%) reported that CBD activates apoptosis, while 18.18% observed simultaneous apoptosis and autophagy, 9.09% focused on autophagy alone, and 4.54% indicated necrosis. The antitumor effects of CBD appear to be mediated by transient receptor potential cation channels (TRPVs) in endometrial cancer, glioma, bladder cancer, and myeloma, with TRPV1, TRPV2, and TRPV4 playing key roles in activating apoptosis. This knowledge paves the way for innovative therapeutic strategies that may enhance cancer treatment outcomes while minimizing the toxicity and side effects associated with conventional therapies.

Also flagged:nucleotidesgene expressionmyogenesislipogenesislocalizationgelatin
Journal Article 2025-02-14 No Snippets Liu W, Chen M, Liu Y, Li X, Li H, Wang J.
Show Full Abstract

Long non-coding RNAs (lncRNAs) are RNA molecules exceeding 200 nucleotides in length. Recent studies have demonstrated their involvement in regulating gene expression and various biological processes. Among these, myogenesis and lipogenesis are particularly important because of their direct effects on muscle development and fat deposition in farm animals. These processes are crucial for determining meat quality, growth rates, and overall economic value in animal husbandry. Although the specific mechanisms through which lncRNAs influence these pathways are still under investigation, further research into their roles in muscle and fat development is crucial for optimizing farm animal breeding strategies. Here, we review the characteristics of lncRNAs, including their biogenesis, localization, and structures, with a particular focus on their association with myogenesis and adipogenesis. This review seeks to establish a theoretical foundation for enhancing farm animal production. In particular, focusing on lncRNAs may reveal how these molecules can enhance the economic traits of farm animals, thereby contributing to the optimization of farm animal breeding processes.

ECI2
Also flagged:homeostasisbile acidmetabolismlipidsynthesisnon
Journal Article 2025-02-14 ✓ 1 Snippet Shen J, Liang W, Zhao R, Chen Y, Liu Y, Cheng W, Chai T, Zhang Y, Chen S, Liu J, Chen X, Deng Y, Zhang Z, Huang Y, Yang H, Pang L, Qiu Q, Deng H, Pan S, Wang L, Ye J, Luo W, Jiang X, Huang X, Li W, Leung EL, Zhang L, Huang L, Yang Z, Chen R, Mei J, Yue Z, Wei H, Karsten K, Han L, Fang X.
In-Text Gene Mentions

…Acox1, Cpt1a, Acads,Eci2, Aadac, Acot1, Cyp4a10,…

Show Full Abstract

The gut microbiota influences host immunity and metabolism, and changes in its composition and function have been implicated in several non-communicable diseases. Here, comparing germ-free (GF) and specific pathogen-free (SPF) mice using spatial transcriptomics, single-cell RNA sequencing, and targeted bile acid metabolomics across multiple organs, we systematically assessed how the gut microbiota's absence affected organ morphology, immune homeostasis, bile acid, and lipid metabolism. Through integrated analysis, we detect marked aberration in B, myeloid, and T/natural killer cells, altered mucosal zonation and nutrient uptake, and significant shifts in bile acid profiles in feces, liver, and circulation, with the alternate synthesis pathway predominant in GF mice and pronounced changes in bile acid enterohepatic circulation. Particularly, autophagy-driven lipid droplet breakdown in ileum epithelium and the liver's zinc finger and BTB domain-containing protein (ZBTB20)-Lipoprotein lipase (LPL) (ZBTB20-LPL) axis are key to plasma lipid homeostasis in GF mice. Our results unveil the complexity of microbiota-host interactions in the crosstalk between commensal gut bacteria and the host.

Also flagged:Synthesisalkylglucamidealkyl-d -glucamidesacyl
Journal Article 2025-02-14 No Snippets Pecora D, Ballabio G, Brioschi G, Robescu MS, Semproli R, Mapelli B, Annunziata F, Speranza G, Cappelletti G, Ubiali D, Tamborini L.
Show Full Abstract

Surfactants are virtually used across all industries where they can fulfill a multitude of roles, such as detergents, emulsifiers, and dispersants, as well as wetting, foaming, and flotation agents. <i>N</i>-Acyl-<i>N</i>-alkyl-d-glucamides are nonionic surfactants that can be synthesized from inexpensive natural resources. They have a broad range of hydrophilic-lipophilic balance (HLB) values, depending on the length of the alkyl chain. This chemical diversity and versatility allow customization of surfactant properties, making these chemicals useful for a diverse range of industrial purposes. In this work, six <i>N</i>-acyl-<i>N</i>-alkyl-d-glucamides have been prepared by exploiting immobilized scavengers and reagents in a flow-batch mode. Moreover, the interfacial properties (both surface and interfacial tensions) of two selected glucamide-based surfactants were evaluated.

TNFSF4
Also flagged:membranelung cancerLUADGene Expressioncell proliferationECM-receptor
Journal Article 2025-02-14 ✓ 1 Snippet Zhang J, Zi R, Hu P, Jiang Z, Lv Y, Zhang H, Zhao Y, Wang Y, Zhao L.
In-Text Gene Mentions

…< 0.001), andTNFSF4( R =…

Show Full Abstract

<h4>Introduction</h4>Lung adenocarcinoma (LUAD) is the most prevalent subtype of lung cancer. Basal membrane (BM) is important to the invasive processes of LUAD. Our object is to explore hub BM-related genes in LUAD.<h4>Methods</h4>The gene expression data of LUAD were downloaded from The Cancer Genome Atlas and Gene Expression Omnibus databases. The weighted gene co-expression network analysis and differentially expressed gene analysis were used to identify candidates. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses were used to evaluate their functions. Univariate Cox regression analysis was used to evaluate the prognostic value, and multivariate Cox regression analysis was used to verify its independence as a prognostic risk factor. The qPCR and Western blot were performed to ascertain the hub gene expression. The survival curve of two groups was drawn using Kaplan-Meier method. The hub gene-related immune characteristics were analyzed in independent cohorts by ESTIMATE and CIBERSORT methods.<h4>Results</h4>We successfully identified <i>COL7A1</i> as a BM-related prognostic biomarker in LUAD, with elevated expression compared to controls, and associated with poor prognosis. Functional enrichment analysis revealed it was involved in pathways related to cell proliferation and inflammation like ECM-receptor interaction. Time-dependent ROC analysis results showed that the AUC of <i>COL7A1</i> in predicting 1-, 3-, and 5-year survival all exceeded 0.78. Immune infiltration characteristic analysis showed that the higher <i>COL7A1</i> expression group exhibited lower ESTIMATE scores and higher TIDE scores.<h4>Discussion</h4>Our study identified <i>COL7A1</i> as a reliable BM-related prognostic biomarker, providing a new reference for the mechanistic understanding and target therapy of LUAD.

HFE
Also flagged:Coronary Artery Diseaseoxygenobesityhypertensionlipiddyslipidemia
Journal Article 2025-02-14 ✓ 1 Snippet Ezekwueme F, Tolu-Akinnawo O, Smith Z, Ogunniyi KE.
In-Text Gene Mentions

…infiltrative processes likehemochromatosis.…

Show Full Abstract

Coronary artery disease (CAD) remains a significant public health concern due to its high morbidity and mortality rates. Early detection and timely evaluation are crucial for improving patient outcomes. While both invasive and non-invasive methods are available for assessing CAD risk, non-invasive approaches minimize the complications associated with invasive procedures. Over the past two decades, advancements in artificial intelligence (AI), particularly machine learning techniques such as deep learning and natural language processing, have revolutionized cardiology. These technologies enhance diagnostic accuracy and clinical efficiency in non-invasive CAD evaluation. However, the broader adoption of AI faces critical challenges, including ethical concerns such as data privacy, high computational costs, and resource allocation disparities. This article explores the current landscape of non-invasive CAD assessment, highlighting the transformative potential and associated challenges of AI integration.

HFE
Also flagged:decompensated cirrhosiscoronary artery diseaseend-stage liver diseasehypertensiondiabetessepsis
Journal Article 2025-02-14 ✓ 1 Snippet Vohra V, Bhangui P, Bhangui P, Sharma N, Gupta N, Bansal M, Soin AS.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>A combined liver transplant (LT) and coronary artery bypass grafting (CABG) may sometimes be needed for patients with decompensated cirrhosis who also have significant coronary artery disease (CAD). However, such a procedure is associated with significant morbidity and mortality.<h4>Methods</h4>From May 2012 to August 2020, eight patients with significant coronary artery disease (CAD) underwent combined off pump CABG (OPCAB) and living donor liver transplantation (LDLT) at our center. We analyzed patient demographics, preoperative clinical findings, operative details, and postoperative outcomes.<h4>Results</h4>Mean recipient age and body mass index were 59 ± 6 years and 26 ± 3kg/m<sup>2</sup>, respectively. The model for end-stage liver disease (MELD) score was 20. Four patients each had hypertension and diabetes. Mean total duration of the surgery was 982 ± 117 min, with 598 ± 89 min for living donor liver transplantation (LDLT). The mean volume of packed red blood cell transfusion was 2500ml. The duration of the ventilatory support (median 49 h post-surgery), and the median intensive care unit and hospital stay (8 and 18 days, respectively). Two patients died during the postoperative period due to sepsis with multiorgan failure No recipient had evidence of acute coronary syndrome, stress cardiomyopathy; none required interventional hemodynamic support. Four patients developed atrial arrhythmia's in the post-operative period, all were managed successfully with medical management.<h4>Conclusion</h4>Combined CABG and LDLT is feasible but poses significant challenges. Careful preprocedure planning, and meticulous intra- and post-operative management involving a multidisciplinary team of LT Surgeons and anesthetists, hepatologists, cardiologists, and cardiac surgeons is required to ensure optimal outcomes in these patients.

HFE
Also flagged:ironobesitymetabolismlipidSucroselinoleic acid
Journal Article 2025-02-14 ✓ 1 Snippet Guevara Agudelo FA, Leblanc N, Bourdeau-Julien I, St-Arnaud G, Dahhani F, Flamand N, Veilleux A, Di Marzo V, Raymond F.
In-Text Gene Mentions

…Fe-depleted diets orhemochromatosisin the Fe-enriched…

Show Full Abstract

The endocannabinoidome (eCBome) and the gut microbiota have been implicated in diet-induced obesity and impaired metabolism. While the eCBome and the gut microbiome are known to respond to diet macronutrient composition, interaction with micronutrient intake has been relatively unexplored. Iron (Fe) is an essential micronutrient for the function of enzymes involved in energy and lipid metabolism. Here, we evaluated how 28 days of Fe depletion and enrichment, in interaction with Low Fat-Low Sucrose (LFLS) or High Fat-High Sucrose (HFHS) diets, affect the host via the eCBome, and modulate intestinal gut microbial communities. Circulating levels of <i>N</i>-oleoyl-ethanolamine (OEA) showed an elevation associated with Fe-enriched LFLS diet, while the Fe-depleted HFHS diet showed an elevation of <i>N</i>-arachidonoyl-ethanolamine (anandamide, AEA) and a decrease of circulating linoleic acid. In parallel, the response of intestinal inflammatory mediators to Fe in the diet showed decreased levels of prostaglandins PGE<sub>1</sub>, PGE<sub>3</sub>, and 1a,1b-dihomo PGF<sub>2</sub>α in the caecum. Individual differences in microbial taxa were less pronounced in the ileum than in the caecum, where <i>Eubacterium coprostanoligenes</i> group showed an increase in relative abundance associated with Fe-depleted LFLS diets. In conclusion, our study shows that Fe intake modulates the response to the macronutrient composition of the diet in mice.

Preprints.org 2025-02-14 Preprint (No Snippets API) Karaman T, Oktem Okullu S, Bayram Akçapınar G, Sezerman OU.
Show Full Abstract

Thousands of biomarkers have been discovered to solve the mechanism of cancer but dynamic alterations of the parameters affecting the cancer progression cause chaotic disease status. This is the reason why it is essential to deal with cancer with an eye to analyzing all parameters including pathway information to understand the molecular level of action. In our study, we applied multi-omics data integration method for microbiome, transcriptome and microbial pathway datasets obtained from colorectal cancer patients by including the transcriptome pathway information. Cldn7 gene and Fusobacteria were found to be highly associated, and they both take role in stability of intestinal barrier (r= 0.71). Klf3 was another gene that played a significant role in activation of WNT1 and WNT/β-catein pathways and it demonstrated high correlation with Fusobacteria which was also found to be involved in same pathways. In addition, The Glutaryl-CoA degradation and p-cymene degradation pathways demonstrated a strong positive association with the expression of Ahcy, Eis2s2, Hsp90ab1, Psma7, Lbr, Rpl7l1, Cse1l, Cbx3, Ncl, Hspd1, Tpx2, and Top2a genes (r &amp;gt; 0.65), suggesting their potential involvement in the regulation and metabolic integration of these pathways at the transcriptional level.

OLFM4
Also flagged:hematopoiesisCD34CD45RACD15CD11bCD117
Journal Article 2025-02-13 ✓ 1 Snippet Signoretto I, Calzetti F, Finotti G, Lonardi S, Balanzin C, Bianchetto-Aguilera F, Gasperini S, Gardiman E, Castellucci M, Russignan A, Bonifacio M, Sica A, Vermi W, Tecchio C, Scapini P, Tamassia N, Cassatella MA.
In-Text Gene Mentions

…as CEACAM8 ,OLFM4and ARG1 )…

Show Full Abstract

Technological advances have greatly improved our knowledge of myelopoiesis, for example, with the discovery of granulocyte‒monocyte‒dendritic cell (DC) progenitors (GMDPs), monocyte‒DC progenitors (MDPs), common DC progenitors (CDPs) and common monocyte progenitors (cMoPs) on the basis of flow cytometry approaches. Concomitantly, some progress has been made in characterizing the very early phases of human neutropoiesis with the description of novel CD66b<sup>+</sup> progenitors, including eNePs, PMs w/o eNePs, ProNeus, and PreNeus. More recently, we identified four SSC<sup>lo</sup>Lin<sup>-</sup>CD66b<sup>-</sup>CD45<sup>dim</sup>CD34<sup>+</sup>/CD34<sup>dim/-</sup>CD64<sup>dim</sup>CD115<sup>-</sup> cells as the earliest precursors specifically committed to the neutrophil lineage present in human bone marrow (BM), which we called neutrophil-committed progenitors (NCPs, from NCP1s to NCP4s). In this study, we report the isolation and characterization of two new SSC<sup>hi</sup>CD66b<sup>-</sup>CD64<sup>dim</sup>CD115<sup>-</sup>NCPs that, by phenotypic, transcriptomic, maturation and immunohistochemistry properties, as well as by flow cytometric side-scattered light (SSC), stand after NCP4s but precede promyelocytes during the neutropoiesis cascade. Similar to SSC<sup>lo</sup>CD45RA<sup>+</sup>NCP2s/NCP3s and SSC<sup>lo</sup>CD45RA<sup>-</sup>NCP1s/NCP4s, these cells exhibit phenotypic differences in CD45RA expression levels and, therefore, were named SSC<sup>hi</sup>CD45RA<sup>+</sup>NCP5s and SSC<sup>hi</sup>CD45RA<sup>-</sup>NCP6s. Moreover, NCP5s were more immature than NCP6s, as determined by cell differentiation and proliferative potential, as well as by transcriptomic and phenotypical features. Finally, by examining whether NCPs and all other CD66b<sup>+</sup> neutrophil precursors are altered in representative hematological malignancies, we found that, in patients with chronic-phase chronic myeloid leukemia (CP-CML), but not with systemic mastocytosis (SM), there is an increased frequency of BM NCP4s, NCP6s, and all downstream CD45RA-negative neutrophil progenitors, suggesting their expansion in CML pathogenesis. Taken together, our data advance our knowledge of human neutropoiesis.

Also flagged:CoppercancerCuproptosisdeathmetabolic cancerstumor
Journal Article 2025-02-13 No Snippets Shan D, Song J, Ren Y, Zhang Y, Ba Y, Luo P, Cheng Q, Xu H, Weng S, Zuo A, Liu S, Han X, Deng J, Liu Z.
Show Full Abstract

Copper, one of the essential nutrients for the human body, acts as an electron relay in multiple pathways due to its redox properties. Both deficiencies and excesses of copper lead to cellular fragility. Therefore, it can manifest pro- and anti-cancer properties in tumors. Therefore, it is crucial to clarify the copper activity within the cell. We have thoughtfully summarized the metabolic activities of copper from a macro and micro perspective. Cuproptosis, as well as other forms of cell death, is directly or indirectly interfered with by Cu<sup>2+</sup>, causing cancer cell death. Meanwhile, we did pan-cancer analysis of cuproptosis-related genes to further clarify the roles of these genes. In addition, copper has been found to be involved in multiple pathways within the metastasis of cancer cells. Given the complexity of copper's role, we are compelled to ask: is copper a friend or a foe? Up to now, copper has been used in various clinical applications, including protocols for measurement of copper concentration and bioimaging of radioactive <sup>64</sup>Cu. But therapeutically it is still a continuation of the old medicine, and new possibilities need to be explored, such as the use of nanomaterials. Some studies have also shown that copper has considerable interventional power in metabolic cancers, which provides the great applications potential of copper therapy in specific cancer types. This paper reviews the dual roles played by cuproptosis in cancer from the new perspectives of oxidative stress, cell death, and tumor metastasis, and points out the value of its application in specific cancer types, summarizes the value of its testing and imaging from the perspective of clinical application as well as the current feasible options for the new use of the old drugs, and emphasizes the prospects for the application of nano-copper.

HTT
Also flagged:Huntington diseaseHDgenetic neurodegenerative disordercognitive declinebehavioralwater
Journal Article 2025-02-13 ✓ 1 Snippet Ramandi D, Sepers MD, Wang Z, Han B, Woodard CL, Murphy TH, Raymond LA.
In-Text Gene Mentions

…huntingtin gene (HTT).…

Show Full Abstract

Huntington disease (HD) is a genetic neurodegenerative disorder characterized by progressive motor dysfunction, cognitive decline, and neuropsychiatric symptoms. Assessing early motor skill deficits in HD mouse models is challenging with traditional behavioral tasks. This study uses a home cage-based lever-pulling task, PiPaw2.0, to evaluate motor learning in 6-7 months-old zQ175 knock-in HD mice in a more naturalistic environment. In this task, mice learn to pull a lever for a water reward, with the requirement to hold the lever within a specific goal range for a required hold time. As the mice improved, the required hold time increased, thereby gradually increasing the task demands. Both wild type (WT) and zQ175 mice initially showed similar task engagement, but zQ175 mice had significant deficits in adapting to increasing hold time. The WT mice refined their strategies over time, shifting from random to more precise lever pulls, while zQ175 mice failed to make this adjustment, maintaining erratic performance. Additionally, in group-housing WT mouse lever performance benefited from peer interactions, an effect absent in zQ175 mice. Post-task neural assessments revealed that WT mice developed experience-mediated synaptic plasticity in the left striatum (contralateral to lever-pulling paw), while zQ175 mice showed no significant changes, consistent with known corticostriatal plasticity impairments in HD mouse models. In conclusion, our findings demonstrate the effectiveness of group-housed, home cage-based assessments for evaluating motor learning and adaptation in HD mouse models. This study provides insights into the motor control and adaptive learning deficits in HD, emphasizing the value of automated home cage systems in advancing neurodegenerative disease research and highlighting the importance of peer influences on performance.

Also flagged:adenosinecolorectal cancerEpidermal growth factor receptorEGFRtumorcell death protein 1
Journal Article 2025-02-13 No Snippets Sun F, Yao F, Zeng C, Zhao Y, Liang B, Li S, Wang Y, Wu Q, Shi Y, Yao Z, Wang J, Jiang Y, Gu C, Huang Q, Liao W, Huang N, Wang C, Rong X, Wu J, Tan Y, Peng J, Li Y, Shi M.
Show Full Abstract

<h4>Background</h4>Patients with microsatellite stable (MSS) colorectal cancer (CRC) often display resistance to immunotherapy. Epidermal growth factor receptor (EGFR)-targeted therapies have shown potential in enhancing immunotherapy, yet clinical benefits remain unfulfilled, which may relate to inadequate patient stratification.<h4>Methods</h4>Circulating tumor cells and tumor tissues were collected from multicenter cohorts of patients with CRC receiving cetuximab to analyze EGFR variant type III (EGFRvIII) expression and immune infiltration. Syngeneic mouse models of EGFRvIII CRC were used to investigate the combined efficacy of adenosine inhibition and antiprogrammed cell death protein 1 (anti-PD-1).<h4>Results</h4>EGFRvIII mutations are found in about 10% of MSS CRC and are associated with poor response to cetuximab therapy. EGFRvIII-mutated patients with CRC exhibit an adenosine-mediated immunosuppressive tumor microenvironment (TME) subtype. Combination therapy with adenosine inhibitors remodels the TME, reversing cetuximab resistance and enhancing anti-PD-1 efficacy in EGFRvIII CRC.<h4>Conclusions</h4>Our findings identified EGFRvIII-positive CRC as a distinct subtype characterized by adenosine-mediated immunosuppressive TME. Targeting adenosine significantly improved the efficacy of anti-PD-1 in MSS CRC.

SERPINC1
Also flagged:extracellularvesiclesColorectal cancerzymogen granulesproteinscancer
Journal Article 2025-02-13 ✓ 1 Snippet Northrop-Albrecht EJ, Kim Y, Taylor WR, Majumder S, Kisiel JB, Lucien F.
In-Text Gene Mentions

…SERPINB6, SERPINA3, SERPINA1,SERPINC1) and the liver-derived…

Show Full Abstract

Colorectal cancer (CRC) is the 2<sup>nd</sup> most fatal cancer in the United States, but when detected early it is highly curable. Stool-derived extracellular vesicles (EVs) are a novel biomarker source that could augment the sensitivity for detection of CRC precursors. However, standardization of isolation methods for stool-derived EVs remains underexplored. We previously reported that size-exclusion chromatography (SEC) followed by ultrafiltration (UF-100kDa) was suitable for human stool supernatant EV isolation. In this study, we first assess alternative EV concentration methods (ultrafiltration [UF]; 10 kDa, 30 kDa, 50 kDa, 100 kDa and speed vacuum [SV]). Second, we investigate the host/bacterial EV proteomes by mass spectrometry. We report no difference in recovery, RNA and soluble protein contamination among concentration methods. Proteomic analysis reveals a diverse bacterial proteome, while human-derived proteins are more abundant. Specifically, pancreatic enzymes are among the most abundant proteins, further exploration revealed that zymogen granules are likely co-isolated in stool EV preparations. To enable discovery of EV-based molecular signatures of CRC precursors with high sensitivity, immunocapture strategies will likely be needed. Notably, we identified 10 surface proteins that may serve as candidates for the purification of colon-derived EVs. This work serves as framework for the future discovery and validation of EV-based biomarkers for CRC.

PTGIS
Also flagged:LMNAfamilial partial lipodystrophy of Dunnigan typeFPLD2metabolic disorderconnective tissue developmentautophagy
Journal Article 2025-02-13 ✓ 2 Snippets Ivanova OA, Predeus AV, Sorokina MY, Ignatieva EV, Bobkov DE, Sukhareva KS, Kostareva AA, Dmitrieva RI.
In-Text Gene Mentions

…were Glul, Mt1,Ptgis, and Romo1; among…

…CoA desaturase-1/2), andPtgis(prostaglandin I2 synthase)…

Show Full Abstract

LMNA mutations causing classical familial partial lipodystrophy of Dunnigan type (FPLD2) usually affect residue R482. FPLD is a severe metabolic disorder that often leads to cardiovascular and skeletal muscle complications. How LMNA mutations affect the functional properties of skeletal muscles is still not well understood. In the present project, we investigated the LMNA-R482L mutation-specific alterations in a transgenic mouse C2C12 cell line of myoblasts. Using single-cell RNA sequencing we have studied transcriptional diversity of cultured in vitro C2C12 cells. The LMNA-R482L mutation induces changes in C2C12 cluster composition and increases the expression of genes related to connective tissue development, oxidative stress, stress defense, and autophagy in a population-specific manner. Bulk RNA-seq confirmed these results and revealed the dysregulation of carbohydrate metabolism in differentiated R482L myotubes that was supported by ATP production profile evaluation. The measurement of reactive oxygen species (ROS) levels and glutathione accumulation in myoblasts and myotubes indicates R482L mutation-related dysregulation in mechanisms that control ROS production and scavenging through antioxidant glutathione system. The increased accumulation of autophagy-related structures in R482L myoblasts was also shown. Overall, our experiments showed a connection between the redox status and metabolic alterations with skeletal muscle pathological phenotypes in cells bearing pathogenic LMNA mutation.

NEGR1
Also flagged:Obesitytriglycerideslipid dropletsfatty acidstype-2 diabetessteatotic
Journal Article 2025-02-13 ✓ 1 Snippet Mazzaferro E, Mujica E, Zhang H, Emmanouilidou A, Jenseit A, Evcimen B, Metzendorf C, Dethlefsen O, Loos RJ, Vienberg SG, Larsson A, Allalou A, den Hoed M.
In-Text Gene Mentions

…(i.e., MC4R ,NEGR1, PCSK1 ,…

Show Full Abstract

Hundreds of loci have been robustly associated with obesity-related traits, but functional characterization of candidate genes remains a bottleneck. Aiming to systematically characterize candidate genes for a role in accumulation of lipids in adipocytes and other cardiometabolic traits, we developed a pipeline using CRISPR/Cas9, non-invasive, semi-automated fluorescence imaging and deep learning-based image analysis in live zebrafish larvae. Results from a dietary intervention show that 5 days of overfeeding is sufficient to increase the odds of lipid accumulation in adipocytes by 10 days post-fertilization (dpf, n = 275). However, subsequent experiments show that across 12 to 16 established obesity genes, 10 dpf is too early to detect an effect of CRISPR/Cas9-induced mutations on lipid accumulation in adipocytes (n = 1014), and effects on food intake at 8 dpf (n = 1127) are inconsistent with earlier results from mammals. Despite this, we observe effects of CRISPR/Cas9-induced mutations on ectopic accumulation of lipids in the vasculature (sh2b1 and sim1b) and liver (bdnf); as well as on body size (pcsk1, pomca, irs1); whole-body LDLc and/or total cholesterol content (irs2b and sh2b1); and pancreatic beta cell traits and/or glucose content (pcsk1, pomca, and sim1a). Taken together, our results illustrate that CRISPR/Cas9- and image-based experiments in zebrafish larvae can highlight direct effects of obesity genes on cardiometabolic traits, unconfounded by their - not yet apparent - effect on excess adiposity.

PLCL1HMGN4
Also flagged:coccidiosisgene expressioninfectiondeathmitochondrialcytoplasmic
Journal Article 2025-02-13 ✓ 2 Snippets Tu JH, Liu BG, Lin BJ, Liu HC, Guo SC, Ouyang QY, Fang LZ, He X, Song ZH, Zhang HH.
In-Text Gene Mentions

…, TOP2A ,HMGN4), T cells…

…, IL20RA ,PLCL1), and specific…

Show Full Abstract

Eimeria tenella (E. tenella) infection is a major cause of coccidiosis in chickens, leading to significant economic losses in the poultry industry due to its impact on the cecum. This study presents a comprehensive single-cell atlas of the chicken cecal epithelium by generating 7,394 cells using 10X Genomics single-cell RNA sequencing (scRNA-seq). We identified 13 distinct cell types, including key immune and epithelial populations, and characterized their gene expression profiles and cell-cell communication networks. Integration of this single-cell data with bulk RNA-seq data from E. tenella-infected chickens revealed significant alterations in cell type composition and state, particularly a marked decrease in APOB<sup>+</sup> enterocytes and an increase in cycling T cells during infection. Trajectory analysis of APOB<sup>+</sup> enterocytes uncovered shifts toward cellular states associated with cell death and a reduction in those linked to mitochondrial and cytoplasmic protection when infected with E. tenella. These findings highlight the substantial impact of E. tenella on epithelial integrity and immune responses, emphasizing the parasite's role in disrupting nutrient absorption and energy metabolism. Our single-cell atlas serves as a critical resource for understanding the cellular architecture of the chicken cecum and provides a valuable framework for future investigations into cecal diseases and metabolic functions, with potential applications in enhancing poultry health and productivity.

STAU1
Also flagged:STAU2RNA-binding proteinneurodegenerative diseasesamyotrophic lateral sclerosisALSspinocerebellar ataxia type 2
Journal Article 2025-02-13 ✓ 5 Snippets Paul S, Dansithong W, Figueroa KP, Gandelman M, Hivare P, Scoles DR, Pulst SM.
In-Text Gene Mentions

…its paralog, Staufen1 (STAU1), was overabundant in…

…AsSTAU1had shown increased…

…AsSTAU1levels were increased…

…to expression ofSTAU1and protein markers…

…that have overabundantSTAU1, as we previously…

Show Full Abstract

Staufen2 (STAU2) is an RNA-binding protein that controls mRNA trafficking and expression. Previously, we showed that its paralog, Staufen1 (STAU1), was overabundant in cellular and mouse models of neurodegenerative diseases and amyotrophic lateral sclerosis (ALS) patient spinal cord. Here, we investigated features of STAU2 that might parallel STAU1. STAU2 protein, but not mRNA, was overabundant in spinocerebellar ataxia type 2 (SCA2), ALS/frontotemporal dementia patient fibroblasts, ALS patient spinal cord tissues, and in central nervous system tissues from SCA2 and ALS animal models. Exogenous expression of STAU2 in human embryonic kidney 293 cells activated mechanistic target of rapamycin (mTOR) and stress granule formation. Targeting STAU2 by RNAi normalized mTOR in SCA2 and C9ORF72 cellular models. The microRNA miR-217, previously identified as downregulated in SCA2 mice, targets the STAU2 3'-UTR. We now demonstrate that exogenous expression of miR-217 significantly reduced STAU2 and mTOR levels in cellular models of neurodegenerative disease. These results suggest a functional link between STAU2 and mTOR signaling and identify a major role for miR-217 that could be exploited in therapeutic development.

TNFSF4
Also flagged:SPP1GliomasCancerGBMtumorSecreted Phosphoprotein 1
Journal Article 2025-02-13 ✓ 1 Snippet Wang K, Wan J, Zheng R, Xiao Y, Lv F, Ge H, Yang G, Cheng Y.
In-Text Gene Mentions

…TGFB1, VEGFA, IL4,TNFSF4, CD28, ICOS, ENTPD1,…

Show Full Abstract

<h4>Background</h4>Gliomas, including glioblastoma (GBM), present significant treatment challenges due to their poor prognosis and complex tumor microenvironment. This study investigates the role of Secreted Phosphoprotein 1 (SPP1) as a prognostic and immunotherapeutic biomarker in gliomas and other cancers through pan-cancer analysis.<h4>Methods</h4>A comprehensive pan-cancer analysis was conducted using datasets from UCSC TCGA Pan-Cancer, TCGA-GBM, UALCAN, and single-cell sequencing data from GEO and TISCH. The correlation of SPP1 expression with overall survival (OS), progression-free survival (PFS), immune cell infiltration, and immune checkpoint markers was analyzed. Functional validation was performed via SPP1 knockdown in glioma cell lines to evaluate effects on proliferation, invasion, and immune interactions.<h4>Results</h4>SPP1 was found to be overexpressed in 27 tumor types, with high expression correlating with poor OS, PFS, and increased immune cell infiltration, particularly with CD8+ T cells and macrophages. Single-cell analysis indicated SPP1 enrichment in macrophages interacting with malignant GBM cells. Knockdown of SPP1 significantly inhibited glioma cell proliferation, invasion, and promoted apoptosis.<h4>Conclusion</h4>The findings suggest that SPP1 is a promising target for immunotherapy, potentially improving outcomes for patients with gliomas and other cancers. Further research is warranted to explore SPP1-targeted therapies and their efficacy in clinical settings.

Also flagged:neurodegenerative disordersmitochondrialelectron transport chainmitophagyoxygenNeurodegenerative Diseases
Journal Article 2025-02-13 No Snippets Yang HM.
Show Full Abstract

Mitochondrial dysfunction represents a pivotal characteristic of numerous neurodegenerative disorders, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. These conditions, distinguished by unique clinical and pathological features, exhibit shared pathways leading to neuronal damage, all of which are closely associated with mitochondrial dysfunction. The high metabolic requirements of neurons make even minor mitochondrial deficiencies highly impactful, driving oxidative stress, energy deficits, and aberrant protein processing. Growing evidence from genetic, biochemical, and cellular investigations associates impaired electron transport chain activity and disrupted quality-control mechanisms, such as mitophagy, with the initial phases of disease progression. Furthermore, the overproduction of reactive oxygen species and persistent neuroinflammation can establish feedforward cycles that exacerbate neuronal deterioration. Recent clinical research has increasingly focused on interventions aimed at enhancing mitochondrial resilience-through antioxidants, small molecules that modulate the balance of mitochondrial fusion and fission, or gene-based therapeutic strategies. Concurrently, initiatives to identify dependable mitochondrial biomarkers seek to detect pathological changes prior to the manifestation of overt symptoms. By integrating the current body of knowledge, this review emphasizes the critical role of preserving mitochondrial homeostasis as a viable therapeutic approach. It also addresses the complexities of translating these findings into clinical practice and underscores the potential of innovative strategies designed to delay or potentially halt neurodegenerative processes.

SERPINC1
Also flagged:peptidespeptideACEα-glucosidasebiofilm formationdeath
Journal Article 2025-02-13 ✓ 1 Snippet Fernandez Cunha M, Coscueta ER, Brassesco ME, Almada F, Gonçalves D, Pintado MM.
In-Text Gene Mentions

…dipeptidyl peptidase III (DPP-III), related to cancer…

Show Full Abstract

Fish body mucus plays a protective role, especially in <i>Halobatrachus didactylus</i>, which inhabits intertidal zones vulnerable to anthropogenic contaminants. In silico predicted bioactive peptides were identified in its body mucus, namely, EDNSELGQETPTLR (HdKTLR), DPPNPKNL (HdKNL), PAPPPPPP (HdPPP), VYPFPGPLPN (HdVLPN), and PFPGPLPN (HdLPN). These peptides were studied in vitro for bioactivities and aggregation behavior under different ionic strengths and pH values. Size exclusion chromatography revealed significant peptide aggregation at 344 mM and 700 mM ionic strengths at pH 7.0, decreasing at pH 3.0 and pH 5.0. Although none exhibited antimicrobial properties, they inhibited <i>Pseudomonas aeruginosa</i> biofilm formation. Notably, HdVLPN demonstrated potential antioxidant activity (ORAC: 1.560 μmol TE/μmol of peptide; ABTS: 1.755 μmol TE/μmol of peptide) as well as HdLPN (ORAC: 0.195 μmol TE/μmol of peptide; ABTS: 0.128 μmol TE/μmol of peptide). Antioxidant activity decreased at pH 5.0 and pH 3.0. Interactions between the peptides and mucus synergistically enhanced antioxidant effects. HdVLPN and HdLPN were non-toxic to Caco-2 and HaCaT cells at 100 μg of peptide/mL. HdPPP showed potential antihypertensive and antidiabetic effects, with IC<sub>50</sub> values of 557 μg of peptide/mL for ACE inhibition and 1700 μg of peptide/mL for α-glucosidase inhibition. This study highlights the importance of validating peptide bioactivities in vitro, considering their native environment (mucus), and bioprospecting novel bioactive molecules while promoting species conservation.

Also flagged:PolyphenolsAlkaloidsTerpenoidsNeurodegenerationNeurodegenerative diseasesextracellular
Journal Article 2025-02-13 No Snippets de Lima EP, Laurindo LF, Catharin VCS, Direito R, Tanaka M, Jasmin Santos German I, Lamas CB, Guiguer EL, Araújo AC, Fiorini AMR, Barbalho SM.
Show Full Abstract

Neurodegenerative diseases comprise a group of chronic, usually age-related, disorders characterized by progressive neuronal loss, deformation of neuronal structure, or loss of neuronal function, leading to a substantially reduced quality of life. They remain a significant focus of scientific and clinical interest due to their increasing medical and social importance. Most neurodegenerative diseases present intracellular protein aggregation or their extracellular deposition (plaques), such as α-synuclein in Parkinson's disease and amyloid beta (Aβ)/tau aggregates in Alzheimer's. Conventional treatments for neurodegenerative conditions incur high costs and are related to the development of several adverse effects. In addition, many patients are irresponsive to them. For these reasons, there is a growing tendency to find new therapeutic approaches to help patients. This review intends to investigate some phytocompounds' effects on neurodegenerative diseases. These conditions are generally related to increased oxidative stress and inflammation, so phytocompounds can help prevent or treat neurodegenerative diseases. To achieve our aim to provide a critical assessment of the current literature about phytochemicals targeting neurodegeneration, we reviewed reputable databases, including PubMed, EMBASE, and COCHRANE, seeking clinical trials that utilized phytochemicals against neurodegenerative conditions. A few clinical trials investigated the effects of phytocompounds in humans, and after screening, 13 clinical trials were ultimately included following PRISMA guidelines. These compounds include polyphenols (flavonoids such as luteolin and quercetin, phenolic acids such as rosmarinic acid, ferulic acid, and caffeic acid, and other polyphenols like resveratrol), alkaloids (such as berberine, huperzine A, and caffeine), and terpenoids (such as ginkgolides and limonene). The gathered evidence underscores that quercetin, caffeine, ginkgolides, and other phytochemicals are primarily anti-inflammatory, antioxidant, and neuroprotective, counteracting neuroinflammation, neuronal oxidation, and synaptic dysfunctions, which are crucial aspects of neurodegenerative disease intervention in various included conditions, such as Alzheimer's and other dementias, depression, and neuropsychiatric disorders. In summary, they show that the use of these compounds is related to significant improvements in cognition, memory, disinhibition, irritability/lability, aberrant behavior, hallucinations, and mood disorders.

DCC
Also flagged:polyphenolepigallocatechin-3-gallatecatechincolorectal cancercolon cancerblood
Journal Article 2025-02-13 ✓ 1 Snippet Randisi F, Perletti G, Marras E, Gariboldi MB.
In-Text Gene Mentions

…Colorectal Cancer (DCC), further drive…

Show Full Abstract

Green tea consumption has been implicated in various biological activities, with particular emphasis on its anticancer properties. The antineoplastic effects of green tea are primarily attributed to its rich polyphenol content, among which, epigallocatechin-3-gallate (EGCG) is recognized as the most bioactive and potent catechin, responsible for the majority of its anticancer activity. This review provides a detailed examination of the in vitro and in vivo effects of green tea components, focusing on their potential therapeutic implications in colorectal cancer. The molecular mechanisms of action and bioactive constituents of green tea are systematically discussed, alongside an evaluation of experimental evidence supporting their efficacy. Furthermore, insights into the relationship between green tea dietary intake and colorectal cancer risk are analyzed, with a particular emphasis on clinical data and findings from meta-analyses involving patients diagnosed with colon cancer. The aggregated evidence underscores the necessity for well-designed randomized controlled trials and longitudinal cohort studies to substantiate the role of green tea as a chemopreventive agent. Additionally, future investigations should prioritize determining the optimal dosages, the appropriate durations of consumption, and the potential modulatory effects of dietary or lifestyle factors on green tea's anticancer efficacy.

Also flagged:Ubiquitin Ligasestumor suppressorTStumorkinasesE3 ubiquitin ligases
Journal Article 2025-02-13 No Snippets Ganesan IP, Kiyokawa H.
Show Full Abstract

The loss of functions of tumor suppressor (TS) genes plays a key role in not only tumor initiation but also tumor progression leading to poor prognosis. While therapeutic inhibition of oncogene-encoded kinases has shown clinical success, restoring TS functions remains challenging due to conceptual and technical limitations. E3 ubiquitin ligases that ubiquitinate TS proteins for accelerated degradation in cancers emerge as promising therapeutic targets. Unlike proteasomal inhibitors with a broad spectrum, inhibitors of an E3 ligase would offer superior selectivity and efficacy in enhancing expression of its substrate TS proteins as far as the TS proteins retain wild-type structures. Recent advances in developing E3 inhibitors, including MDM2 inhibitors, highlight their potential and ultimately guide the framework to establish E3 inhibition as effective strategies to treat specific types of cancers. This review explores E3 ligases that negatively regulate bona fide TS proteins, the developmental status of E3 inhibitors, and their promise and pitfalls as therapeutic agents for anti-cancer precision medicine.

PRDX6
Also flagged:X-adrenoleukodystrophyX-ALDperoxisomal metabolic disorderABCD1peroxisomal ABC transporteradrenoleukodystrophy protein
Journal Article 2025-02-13 ✓ 2 Snippets Kaur N, Singh J.
In-Text Gene Mentions

…ARG1, FIZZ1, andPRDX6were decreased in…

PRDX6was identified as…

Show Full Abstract

X-adrenoleukodystrophy (X-ALD) is a peroxisomal metabolic disorder caused by mutations in the ABCD1 gene encoding the peroxisomal ABC transporter adrenoleukodystrophy protein (ALDP). Similar mutations in ABCD1 may result in a spectrum of phenotypes in males with slow progressing adrenomyeloneuropathy (AMN) and fatal cerebral adrenoleukodystrophy (cALD) dominating most cases. Mouse models of X-ALD do not capture the phenotype differences and an appropriate model to investigate the mechanism of disease onset and progress remains a critical need. Here, we generated induced pluripotent stem cell (iPSC) lines from skin fibroblasts of two each of apparently healthy control, AMN, and cALD patients with non-integrating mRNA-based reprogramming. iPSC lines expanded normally and expressed pluripotency markers Oct4, SOX2, NANOG, SSEA, and TRA-1-60. Expression of markers SOX17, Brachyury, Desmin, OXT2, and beta tubulin III demonstrated the ability of the iPSCs to differentiate into all three germ layers. iPSC-derived lines from CTL, AMN, and cALD male patients were differentiated into astrocytes. Differentiated AMN and cALD astrocytes lacked ABCD1 expression and accumulated saturated very long chain fatty acids (VLCFAs), a hallmark of X-ALD, and demonstrated differential mitochondrial bioenergetics, cytokine gene expression, and differences in STAT3 and AMPK signaling between AMN and cALD astrocytes. These patient astrocytes provide disease-relevant tools to investigate the mechanism of differential neuroinflammatory response in X-ALD and will be valuable cell models for testing new therapeutics.

Also flagged:Steatotic Liver DiseaseNon-alcoholic fatty liver diseaseNAFLDmetabolic dysfunction-associated steatotic liver diseaseliver disorderobesity
Journal Article 2025-02-13 No Snippets Bourganou MV, Chondrogianni ME, Kyrou I, Flessa CM, Chatzigeorgiou A, Oikonomou E, Lambadiari V, Randeva HS, Kassi E.
Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD), now referred to as metabolic dysfunction-associated steatotic liver disease (MASLD), is the most prevalent liver disorder globally, linked to obesity, type 2 diabetes, and cardiovascular risk. Understanding its potential progression from simple steatosis to cirrhosis and hepatocellular carcinoma (HCC) is crucial for patient management and treatment strategies. The disease's complexity requires innovative approaches for early detection and personalized care. Omics technologies-such as genomics, transcriptomics, proteomics, metabolomics, and exposomics-are revolutionizing the study of MASLD. These high-throughput techniques allow for a deeper exploration of the molecular mechanisms driving disease progression. Genomics can identify genetic predispositions, whilst transcriptomics and proteomics reveal changes in gene expression and protein profiles during disease evolution. Metabolomics offers insights into the metabolic alterations associated with MASLD, while exposomics links environmental exposures to MASLD progression and pathology. By integrating data from various omics platforms, researchers can map out the intricate biochemical pathways involved in liver disease progression. This review discusses the roles of omics technologies in enhancing the understanding of disease progression and highlights potential diagnostic and therapeutic targets within the MASLD spectrum, emphasizing the need for non-invasive tools in disease staging and treatment development.

Also flagged:titaniumperi-implantitisbacterial infectioninfectionbiofilm formationoxide
Journal Article 2025-02-13 No Snippets Mishchenko O, Volchykhina K, Maksymov D, Manukhina O, Pogorielov M, Pavlenko M, Iatsunskyi I.
Show Full Abstract

This review explores the latest advancements in enhancing the biocompatibility and antibacterial properties of implantable structures, with a focus on titanium (Ti) and its alloys. Titanium implants, widely used in dental and orthopedic applications, demonstrate excellent mechanical strength and biocompatibility, yet face challenges such as peri-implantitis, a bacterial infection that can lead to implant failure. To address these issues, both passive and active surface modification strategies have been developed. Passive modifications, such as altering surface texture and chemistry, aim to prevent bacterial adhesion, while active approaches incorporate antimicrobial agents for sustained infection control. Nanotechnology has emerged as a transformative tool, enabling the creation of nanoscale materials and coatings like TiO<sub>2</sub> and ZnO that promote osseointegration and inhibit biofilm formation. Techniques such as plasma spraying, ion implantation, and plasma electrolytic oxidation (PEO) show promising results in improving implant integration and durability. Despite significant progress, further research is needed to refine these technologies, optimize surface properties, and address the clinical challenges associated with implant longevity and safety. This review highlights the intersection of surface engineering, nanotechnology, and biomedical innovation, paving the way for the next generation of implantable devices.

HTT
Also flagged:Fragile XHuntington diseasemyotonic dystrophy type 1nucleotidepathogenesisfragile X syndrome
Journal Article 2025-02-13 ✓ 1 Snippet Doss RM, Lopez-Ignacio S, Dischler A, Hiatt L, Dashnow H, Breuss MW, Dias CM.
In-Text Gene Mentions

…on FMR1 ,HTT, and DMPK…

Show Full Abstract

Fragile X, Huntington disease, and myotonic dystrophy type 1 are prototypical examples of human disorders caused by short tandem repeat variation, repetitive nucleotide stretches that are highly mutable both in the germline and somatic tissue. As short tandem repeats are unstable, they can expand, contract, and acquire and lose epigenetic marks in somatic tissue. This means within an individual, the genotype and epigenetic state at these loci can vary considerably from cell to cell. This somatic mosaicism may play a key role in clinical pathogenesis, and yet, our understanding of mosaicism in driving clinical phenotypes in short tandem repeat disorders is only just emerging. This review focuses on these three relatively well-studied examples where, given the advent of new technologies and bioinformatic approaches, a critical role for mosaicism is coming into focus both with respect to cellular physiology and clinical phenotypes.

SERPINC1
Also flagged:complementcomplement activationmembranous nephropathyIgA nephropathiesIgANcomplement proteins
Journal Article 2025-02-13 ✓ 1 Snippet Xu Y, Li Y, Zhang Y, Li G.
In-Text Gene Mentions

…VTN, CLU, andSerpinc1, were further validated…

Show Full Abstract

<h4>Background</h4>The onset and progression of membranous nephropathy (MN) have been associated with complement activation, yet the overall characteristics of this activation in the kidneys remain unclear. In our study, we utilized urine proteomic data to investigate the features of complement activation. We examined the relationship between urine complement components and both clinicopathological features and clinical outcomes in patients with MN.<h4>Methods</h4>Differential expression proteins (DEPs) analysis was performed using proteomic data from urine samples collected from 50 patients with MN, 50 patients with IgA nephropathies (IgAN), and 72 healthy controls (HC). Then, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were carried out on the DEPs identified in MN. We further investigated the differentially expressed urinary complement proteins in MN patients, exploring their relationships with clinicopathological features and clinical remission. Next, 11 representative complements were selected for validation. Immunohistochemistry and immunofluorescence techniques were employed to compare the expression of CD59 and C5b-9 in renal tissues from MN patients, with analyses conducted on both the clinical remission group and the no remission group (<i>n</i> = 6 in each group).<h4>Results</h4>Total 1,427 differentially expressed proteins were identified between the MN and HC groups. KEGG pathway analysis showed significant enrichment of these DEPs in the complement-activated pathway within the MN group. Additionally, a correlation was found between proteinuria and the levels of 27 urinary complement proteins. Notably, Collectin12 (collec12) and C1s were positively correlated with tubular atrophy/interstitial fibrosis (TIF) and monocyte infiltration. Furthermore, urine CD59 emerged as a predictor of clinical remission. Lower deposition of C5b-9 in renal tissue and higher expression of CD59 were detected in clinical remission group than non-remission group.<h4>Conclusion</h4>In patients with MN, abnormal levels of complement components in urine are commonly observed. Currently, the use of complement inhibitors has brought new hope for the treatment of MN. The factor B inhibitor LNP023 and the factor D inhibitor BCX9930 are undergoing clinical trials for the treatment of MN. Our study indicates that complement abnormalities could serve as clinical biomarkers for tracking the progression of MN, predicting clinical remission, and guiding targeted complement therapy for those affected.

Also flagged:Major depressive disorderpsychiatric disorderdepressionpathogenesisneurogenesisneural atrophy
Journal Article 2025-02-13 No Snippets Xu N, He Y, Wei YN, Bai L, Wang L.
Show Full Abstract

Major depressive disorder (MDD) is a highly prevalent and severely disabling psychiatric disorder that decreases quality of life and imposes substantial economic burden. Acupuncture has emerged as an effective adjunctive treatment for depression, it regulates neurotransmitters involved in mood regulation and modulates the activity of specific brain regions associated with emotional processing, as evidenced by neuroimaging and biochemical studies. Despite these insights, the precise neuroplastic mechanisms through which acupuncture exerts its antidepressant effects remain not fully elucidated. This review aims to summarize the current knowledge on acupuncture's modulation of neuroplasticity in depression, with a focus on the neuroplasticity-based targets associated with acupuncture's antidepressant effects. We encapsulate two decades of research into the neurobiological mechanisms underpinning the efficacy of acupuncture in treating depression. Additionally, we detail the acupoints and electroacupuncture parameters used in the treatment of depression to better serve clinical application.

OLFM4
Also flagged:mucinous appendiceal neoplasmstumorspseudomyxomagene expressiontumorgoblet cell differentiation
Journal Article 2025-02-13 ✓ 1 Snippet Ayala C, Sathe A, Bai X, Grimes SM, Shen J, Poultsides GA, Lee B, Ji HP.
In-Text Gene Mentions

…, ASCL2 ,OLFM4) and goblet…

Show Full Abstract

<h4>Introduction</h4>Appendiceal mucinous neoplasms (AMN) are rare tumors of the gastrointestinal tract. They metastasize with widespread abdominal dissemination leading to pseudomyxoma peritonei (PMP), a disease with poor prognosis. There are many unknowns about the cellular features of origin, differentiation and progression of AMN and PMP.<h4>Methods</h4>We characterized AMNs, PMPs and matched normal tissues using single-cell RNA-sequencing. We validated our findings with immunohistochemistry, mass spectrometry on malignant ascites from PMP patients and gene expression data from an independent set of PMP tumors.<h4>Results</h4>We identified previously undescribed cellular features and heterogeneity in AMN and PMP tumors. There were gene expression signatures specific to the tumor epithelial cells among AMN and PMP. These signatures included genes indicative of goblet cell differentiation and elevated mucin gene expression. Metastatic PMP cells had a distinct gene expression signature with increased lipid metabolism, inflammatory, JAK-STAT and RAS signaling pathway among others. We observed clonal heterogeneity in a single PMP tumor as well as PMP metastases from the same patient.<h4>Discussion</h4>Our study defined tumor cell gene signatures of AMN and PMP, successfully overcoming challenges of low cellularity and mucinous composition of these tumors. These gene expression signatures provide insights on tumor origin and differentiation, together with the identification of novel treatment targets. The heterogeneity observed within an individual tumor and between different tumors from the same patient, represents a potential source of treatment resistance.

Also flagged:Testicular Germ Cell TumourTGCTcancertesticular cancertesticular germ cell tumourscancers
Journal Article 2025-02-13 No Snippets Kuzbari Z, Rowlands CF, Wade I, Garrett A, Loveday C, Choi S, Torr B, Litchfield K, Reid A, Huddart R, Broderick P, Houlston RS, Turnbull C.
Show Full Abstract

<h4>Background and objective</h4>Testicular germ cell tumour (TGCT) is the most common cancer in young men, and over half of its high estimated heritability is unexplained. Our objective was to identify rare pathogenic germline variation driving TGCT susceptibility.<h4>Methods</h4>This study is a case-control meta-analysis of whole-exome sequencing data from three datasets (Institute of Cancer Research, The Cancer Genome Atlas, and UK Biobank). We retained unrelated male individuals of European ancestry comprising 1435 TGCT cases and 18 284 cancer-free controls. We performed gene-level association testing of protein-truncating variants and nonsynonymous disruptive variants across six candidate gene sets (733 genes) potentially biologically related to TGCT. We then analysed exome wide (19 355 genes) under dominant and recessive models, including X-linked genes.<h4>Key findings and limitations</h4>No individual gene-disease association was identified following multiple testing corrections. However, functional gene-set analyses identified an excess of associations with genes involved in microtubular/ciliary pathways (<i>p</i> = 1.69 × 10<sup>-8</sup>). Our study was well powered to detect rare variation of moderate/high effect sizes (odds ratio [OR] ≥5), but power diminished for modest effect sizes (OR <5).<h4>Conclusions and clinical implications</h4>Although this is the largest whole-exome analysis of TGCT to date and first exome-wide examination for recessively acting gene associations, larger studies are required to identify robust associations for individual genes.<h4>Patient summary</h4>We investigated samples from 1435 men with testicular cancer and 18 284 men without cancer to compare the rate of disruptive mutations in 19 355 genes. No evidence of specific genes associated with testicular cancer was discovered, although one gene group showed a strong association. Larger studies are needed to identify individual genes associated with causing testicular cancer.

Also flagged:isoquinolinequinazolineHuman epidermal growth factor receptor 2HER2cancersHER2 kinase
Journal Article 2025-02-13 No Snippets Lee JW, Im CG, Lee JM, Cho M, Kim M, Lee K, Nguyen HTT, Seo J, Seo JH, Min KH.
Show Full Abstract

Human epidermal growth factor receptor 2 (HER2) is a critical therapeutic target for HER2-positive or HER2-dependent cancers. While several HER2 kinase inhibitors have been identified, achieving high selectivity for HER2 over EGFR remains a significant challenge. In this study, we aimed to develop HER2-selective inhibitors with enhanced cellular activity. To improve the limited cellular activity of derivatives with a quinoline moiety against HER2, we synthesized a novel series of derivatives by bioisosteric replacement. These derivatives demonstrated significantly improved selectivity for HER2 over EGFR, with a 7- to 12-fold enhancement compared to lapatinib in kinase assays. Furthermore, they exhibited enhanced cellular activity, leading to improved anti-proliferative effects against HER2-dependent SKBR3 cells. Notably, the representative compound 14f demonstrated more potent inhibition of HER2 phosphorylation at the cellular level compared to lapatinib. Additionally, compound 14f exhibited high HER2 selectivity, significantly inhibited colony formation in SKBR3 cells, and displayed good metabolic stability. These findings suggest the potential of these compounds as novel therapeutic candidates for HER2-positive cancers.

Also flagged:SLEtype I IFNIL-4IL-21systemic lupus erythematosusBcl6
Journal Article 2025-02-13 No Snippets Georgakis S, Ioannidou K, Mora BB, Orfanakis M, Brenna C, Muller YD, Del Rio Estrada PM, Sharma AA, Pantaleo G, de Leval L, Comte D, Gottardo R, Petrovas C.
Show Full Abstract

<h4>Introduction</h4>Systemic lupus erythematosus (SLE) is characterized by dysregulated humoral immunity, leading to the generation of autoreactive B cells that can differentiate both within and outside of lymph node (LN) follicles.<h4>Methods</h4>Here, we employed spatial transcriptomics and multiplex imaging to investigate the follicular immune landscaping and the <i>in situ</i> transcriptomic profile in LNs from SLE individuals.<h4>Results</h4>Our spatial transcriptomic analysis revealed robust type I IFN and plasma cell signatures in SLE compared to reactive, control follicles. Cell deconvolution revealed that follicular T cell subsets are mainly affected by the type I IFN fingerprint of SLE follicles. Dysregulation of T<sub>FH</sub> differentiation was documented by i) the significant reduction of Bcl6<sup>hi</sup> T<sub>FH</sub> cells, ii) the reduced cell density of potential IL-4 producing T<sub>FH</sub> cell subsets associated with the impaired transcriptomic signature of follicular IL-4 signaling and iii) the loss of their correlation with GC-B cells. This profile was accompanied by a marked reduction of Bcl6<sup>hi</sup> B cells and an enrichment of extrafollicular CD19<sup>hi</sup>CD11c<sup>hi</sup>Tbet<sup>hi</sup>, age-associated B cells (ABCs), known for their autoreactive potential. The increased prevalence of follicular IL-21<sup>hi</sup> cells further reveals a hyperactive microenvironment in SLE compared to control.<h4>Discussion</h4>Taken together, our findings highlight the altered immunological landscape of SLE follicles, likely fueled by potent inflammatory signals such as sustained type I IFN and/or IL-21 signaling. Our work provides novel insights into the spatial molecular and cellular signatures of SLE follicular B and T<sub>FH</sub> cell dynamics, and points to druggable targets to restore immune tolerance and enhance vaccine responses in SLE patients.

HTT
Also flagged:USP7P53tumorpeptidesIRFcancers
Journal Article 2025-02-13 ✓ 5 Snippets Zhang XL, Yue HW, Liu YJ, Wang JY, Duan HT, Liu YH, Jiang LL, Hu HY.
In-Text Gene Mentions

…for encoding NLS-fusedHtt18Q -N171 (residues…

…-N171 (residues 1-171),Htt100Q -N171, Atax7…

…of PQE huntingtin (Htt) and ataxin-7 (Atx7),…

…, 11 namelyHtt-N171 and Atx7-N172, respectiv…

…10Q -N172 andHtt18Q -N171 without…

Show Full Abstract

Overexpression of USP7 and HDM2 inactivates P53 signaling in tumor cells and facilitates their progression, but suppression of these targets by conventional strategies to reactivate P53 function remains a challenge. We applied polyQ sequences and target-interacting peptides to engineer polyQ fusion proteins that specifically sequester the targets, hence depleting their availabilities and modulating the P53 functionality. We have revealed that the designer fusion Atx7<sub>93Q</sub>-N172-IRF (IRF sequence: SPGEGPSGTG) sequesters USP7 and/or HDM2 into aggregates and thereby increases the P53 level, but it depends on the IRF repeats fused, suggesting that depletion of the USP7 availability plays a dual role in controlling P53 stability. Direct sequestration of HDM2 by Atx7<sub>93Q</sub>-N172-PMI (PMI: TSFAEYWNLLSP) remarkably reduces the protein level of soluble HDM2 and hence increases the P53 level, which consequently up-regulates expression of the downstream genes. The polyQ-fusion strategy is feasible to modulate the P53 stability and functionality, furnishing a therapeutic potential for cancers.

Also flagged:cardiovascular diseasesgenetic disordershistonechromatinnucleotidegene expression
Journal Article 2025-02-13 No Snippets Khan A, Barapatre AR, Babar N, Doshi J, Ghaly M, Patel KG, Nawaz S, Hasana U, Khatri SP, Pathange S, Pesaru AR, Puvvada CS, Billoo M, Jamil U.
Show Full Abstract

Genomic medicine, which integrates genomics and bioinformatics into clinical care and diagnostics, is transforming healthcare by enabling personalized treatment approaches. Advances in technologies such as DNA sequencing, proteomics, and computational power have laid the foundation for individualized therapies that account for genetic variations influencing disease risk, progression, and treatment response. This review explores the historical milestones leading to current applications of genomic medicine, such as targeted therapies, gene therapies, and precision medicine, in fields including cardiovascular diseases, oncology, and rare genetic disorders. It highlights the use of next-generation sequencing and third-generation sequencing to improve diagnostic accuracy and treatment outcomes, emphasizing the role of genomic data in advancing personalized treatments. Furthermore, emerging therapies such as CRISPR/Cas-based genome editing and adeno-associated viral vectors showcase the potential of gene therapy in addressing complex diseases, including rare genetic disorders. Despite promising advancements, challenges remain in fully integrating genomic medicine into routine clinical practice, including cost barriers, data interpretation complexities, and the need for widespread genomic literacy among healthcare professionals. The future of genomic medicine holds transformative potential for revolutionizing the diagnosis, treatment, and management of both common and rare diseases.

Also flagged:PathogenesisHypertensiongene expressionmethylationtranscription factorendothelin-1
Journal Article 2025-02-12 No Snippets Alexander MR, Edwards TL, Harrison DG.
Show Full Abstract

Genome-wide association studies have identified >3500 associated single nucleotide polymorphisms and over 1000 independent loci associated with hypertension. These individually have small effect sizes, and few associated loci have been experimentally tested for causal roles in hypertension using animal models or in humans. Thus, methods to prioritize and maximize the relevance of identified single nucleotide polymorphisms and associated loci are critical to determine their importance in hypertension. We propose several approaches to aid in these efforts, including: (1) integration of genome-wide association study data with multiomic data sets, including proteomics, transcriptomics, and epigenomics, (2) utilizing linked clinical and genetic data sets to determine genetic contributions to hypertension subphenotypes with distinct drivers, and (3) performing whole exome/genome sequencing on cohorts of individuals with severe hypertension to enrich for rare variants with larger effect sizes. Rather than creating longer lists of hypertension-associated single nucleotide polymorphisms, these approaches are needed to identify key mediators of hypertension pathophysiology.

Also flagged:Movement Disordersneuropathy andADMDdystoniaParkinsonism
Journal Article 2025-02-12 No Snippets Damásio J, Costa S, Moura J, Santos M, Lemos C, Mendes A, Oliveira J, Barros J, Sequeiros J.
Show Full Abstract

<h4>Background</h4>Hereditary cerebellar ataxia (HCA) represents a complex group of disorders, with a wide spectrum of neurological symptoms. Among these, non-ataxia movement disorders (MD) have been increasingly acknowledged, with variable frequency across different forms.<h4>Objectives</h4>To characterize the type and frequency of MD in patients with HCA. To identify factors associated with MD and analyze their impact on disability.<h4>Methods</h4>We conducted a prospective study starting in 2017, with annual visits according to a structured protocol. Patients were selected from the study database and their clinical and genetic features analyzed.<h4>Results</h4>The cohort comprised 193 symptomatic patients. Machado-Joseph disease (MJD, also SCA3 or ATX-ATXN3) and cerebellar ataxia, neuropathy and vestibular areflexia syndrome (ATX-RFC1) were the most common autosomal dominant (AD) or recessive forms, with a frequency of 14.0% and 15.0%, respectively. MD were present in 95 (54.4%), with dystonia being the most common (49.2%). Tremor was identified in 10.9%, Parkinsonism in 4.1% and chorea in 3.6% patients. Myoclonus and tics were rare (2.6% and 0.5%). The presence of MD was associated with AD inheritance and ATXN3. MD, regardless of type, correlated with higher SARA score at baseline, increased fall frequency, confinement to wheelchair, and earlier occurrence of falls and of permanent use of walking aid.<h4>Conclusions</h4>Movement disorders, particularly dystonia, were common in our cohort. This highlights the possible role of the cerebellum in MD, but also extra-cerebellar involvement in some HCA. Presence of MD significantly worsened motor disability, highlighting the need for strategies of early identification and tailored management.

FBXL4
Also flagged:Mitochondrial DepletionMitophagyStem Cell Differentiationmitochondrial depletion syndromedevelopmental delayslactic acidosis
Journal Article 2025-02-12 ✓ 5 Snippets Prasun P.
In-Text Gene Mentions

FBXL4-Related Mitochondrial Depleti…

FBXL4- related mitochondrial deplet…

FBXL4encodes F-box and…

…FBXL4 encodesF-box and leucine-rich repeat protein 4and leucine-rich repeat…

…repeat protein 4 (FBXL4) which is involved…

Show Full Abstract

FBXL4- related mitochondrial depletion syndrome is a very rare inherited disorder characterized by global developmental delays, hypotonia, seizures, growth failure, and early onset lactic acidosis. Often, it is associated with structural brain and heart defects, and facial dysmorphism suggesting an embryogenesis defect. FBXL4 encodes F-box and leucine-rich repeat protein 4 (FBXL4) which is involved in mitochondrial quality control and maintenance by regulating mitophagy. A recent study suggests that FBXL4 deficiency leads to increased mitophagy. Fine tuning of mitophagy is essential for stem cell differentiation during embryogenesis. The disruption of this process is the likely explanation of developmental defects in FBXL4- related mitochondrial depletion syndrome.

Also flagged:biopolyestersynthesisSilibinincolorectal adenocarcinomapaclitaxelsilymarin
Journal Article 2025-02-12 No Snippets Vento F, Privitera A, Caruso G, Nicosia A.
Show Full Abstract

Poly(ε-caprolactone) (PCL) is a hydrolytically degradable biopolyester used in drug delivery to enhance drug solubility and bioavailability, where drugs are typically incorporated physically within the biopolymeric matrix rather than covalently bonded, due to the limited availability of functional groups required for covalent attachment. In pursuit of developing a facile method for the production of a biopolyester-drug covalent conjugate with effective drug loading capacity, this study reports the synthesis of a covalent Silibinin-PCL conjugate (Sil-PCL<sub>Hyd</sub>) through a two-step approach. This involves the controlled hydrolysis of a high molecular weight PCL to increase the concentration of carboxylic end groups, which are subsequently used for the catalyzed esterification with Silibinin. The Sil-PCL<sub>Hyd</sub> is characterized with mass spectrometry, gel permeation chromatography, thermogravimetric analysis, differential scanning calorimetry, and NMR and UV-vis spectroscopies. The cytotoxic effects of Sil-PCL<sub>Hyd</sub> against colorectal adenocarcinoma cells (Caco-2) are measured through the MTT assay. The results of the Sil-PCL<sub>Hyd</sub> characterization revealed a Silibinin loading of ≈9.8 wt.%. The MTT assay demonstrated that Sil-PCL<sub>Hyd</sub> induced cytotoxic effects at concentrations a hundred times lower than those required for free Silibinin. The proposed approach might represent a reliable pathway for the development of biopolyester-based covalent conjugates with a high drug loading capacity.

SOX6
Also flagged:DET1COP1E3 ubiquitin ligaseCUL4ADDB1RBX1
Journal Article 2025-02-12 ✓ 2 Snippets Karayel O, Soung A, Gurung H, Schubert AF, Klaeger S, Kschonsak M, Al-Maraghi A, Bhat AA, Alshabeeb Akil AS, Dugger DL, Webster JD, French DM, Anand D, Soni N, Fakhro KA, Rose CM, Harris SF, Ndoja A, Newton K, Dixit VM.
In-Text Gene Mentions

…SOX1 , andSOX6.…

…high expression ofSOX6may also inhibit…

Show Full Abstract

COP1 and DET1 are components of an E3 ubiquitin ligase that is conserved from plants to humans. Mammalian COP1 binds to DET1 and is a substrate adaptor for the CUL4A-DDB1-RBX1 RING E3 ligase. Transcription factor substrates, including c-Jun, ETV4, and ETV5, are targeted for proteasomal degradation to effect rapid transcriptional changes in response to cues such as growth factor deprivation. Here, we link a homozygous <i>DET1<sup>R26W</sup></i> mutation to lethal developmental abnormalities in humans. Experimental cryo-electron microscopy of the DET1 complex with DDB1 and DDA1, as well as co-immunoprecipitation experiments, revealed that DET1<sup>R26W</sup> impairs binding to DDB1, thereby compromising E3 ligase function. Accordingly, human-induced pluripotent stem cells homozygous for <i>DET1<sup>R26W</sup></i> expressed ETV4 and ETV5 highly, and exhibited defective mitochondrial homeostasis and aberrant caspase-dependent cell death when differentiated into neurons. Neuronal cell death was increased further in the presence of <i>Det1</i>-deficient microglia as compared to WT microglia, indicating that the deleterious effects of the <i>DET1</i> p.R26W mutation may stem from the dysregulation of multiple cell types. Mice lacking <i>Det1</i> died during embryogenesis, while <i>Det1</i> deletion just in neural stem cells elicited hydrocephalus, cerebellar dysplasia, and neonatal lethality. Our findings highlight an important role for DET1 in the neurological development of mice and humans.

Also flagged:oligonucleotideMSH3Huntington's diseaseneurodegenerative disorderHDDNA
Journal Article 2025-02-12 No Snippets Bunting EL, Donaldson J, Cumming SA, Olive J, Broom E, Miclăuș M, Hamilton J, Tegtmeyer M, Zhao HT, Brenton J, Lee WS, Handsaker RE, Li S, Ford B, Ryten M, McCarroll SA, Kordasiewicz HB, Monckton DG, Balmus G, Flower M, Tabrizi SJ.
Show Full Abstract

Expanded CAG alleles in the huntingtin (<i>HTT</i>) gene that cause the neurodegenerative disorder Huntington's disease (HD) are genetically unstable and continue to expand somatically throughout life, driving HD onset and progression. MSH3, a DNA mismatch repair protein, modifies HD onset and progression by driving this somatic CAG repeat expansion process. <i>MSH3</i> is relatively tolerant of loss-of-function variation in humans, making it a potential therapeutic target. Here, we show that an <i>MSH3</i>-targeting antisense oligonucleotide (ASO) effectively engaged with its RNA target in induced pluripotent stem cell (iPSC)-derived striatal neurons obtained from a patient with HD carrying <i>125 HTT</i> CAG repeats (the 125 CAG iPSC line). ASO treatment led to a dose-dependent reduction of MSH3 and subsequent stalling of CAG repeat expansion in these striatal neurons. Bulk RNA sequencing revealed a safe profile for <i>MSH3</i> reduction, even when reduced by >95%. Maximal knockdown of MSH3 also effectively slowed CAG repeat expansion in striatal neurons with an otherwise accelerated expansion rate, derived from the 125 CAG iPSC line where <i>FAN1</i> was knocked out by CRISPR-Cas9 editing. Last, we created a knock-in mouse model expressing the human <i>MSH3</i> gene and demonstrated effective in vivo reduction in human <i>MSH3</i> after ASO treatment. Our study shows that ASO-mediated MSH3 reduction can prevent <i>HTT</i> CAG repeat expansion in HD 125 CAG iPSC-derived striatal neurons, highlighting the therapeutic potential of this approach.

Also flagged:TIGITextrahepatic cholangiocarcinomaCD8malignant tumorimmunoreceptorIg
Journal Article 2025-02-12 No Snippets Tang T, Wang W, Gan L, Bai J, Tan D, Jiang Y, Zheng P, Zhang W, He Y, Zuo Q, Zhang L.
Show Full Abstract

Extrahepatic cholangiocarcinoma (ECCA) is a malignant tumor. The precise role of T-cell immunoreceptor with Ig and ITIM domains (TIGIT), an emerging immunosuppressive receptor, in ECCA, and its impact on CD8+ T cell exhaustion (Tex) remains unclear. We performed single-cell RNA sequencing (scRNA-seq) to characterize tumor-infiltrating lymphocytes (TILs) isolated from ECCA. We found that TIGIT was significantly overexpressed in TOX+CD8 T cells. Tissue microarray and immunohistochemistry staining demonstrated that increased TIGIT expression was associated with poorer patient survival. Flow cytometry analysis revealed that TIGIT+CD8+ T cells exhibited decreased TNF-α, IFN-γ, and TCF-1 expression, accompanied by elevated PD-1 and TIM-3 expression compared to TIGIT-CD8+ T cells. In the patient-derived xenograft (PDX) model, the anti-TIGIT treatment group demonstrated reduced tumor weight, enhanced CD8 frequency, and an increased IFN-γ proportion compared to the PBS treatment group. The TIGIT antibody-treated group exhibited a notably higher fraction of GRZB, and anti-TIGIT treatment led to elevated TCF-1 protein levels and decreased protein levels of TOX1 and NR4A1. Moreover, TIGIT+CD8 T cells from TILs appear to be in a state of exhaustion with low potential killing capacity in ECCA, as shown by scRNA-seq. Taken together, the present study underscores the significant role of TIGIT in ECCA, contributing to T cell exhaustion and a compromised CD8+ T cell immune response. Targeting TIGIT presents a promising therapeutic avenue to enhance the CD8+ T-cell response, thereby potentially improving ECCA therapeutic benefits.

Also flagged:thrombopoiesishemostasisthrombocytopeniableeding disorderstranscription factorsGATA-1
Journal Article 2025-02-12 No Snippets Fallatah W, Mary J, Dhinoja S, Vallabhaneni S, Jagadeeswaran P.
Show Full Abstract

Platelet production, or thrombopoiesis, is a critical process involving the differentiation of hematopoietic stem cells into megakaryocytes, which release platelets into circulation. This study employed a comprehensive screening approach through a piggyback knockdown strategy targeting 394 protein-encoding genes expressed explicitly in young thrombocytes. This approach led us to identify eight candidate genes associated with thrombopoiesis, including spi1b, a transcription factor that potentially regulates thrombocyte development. The sequencing of spi1b mutant progeny harboring a termination codon after Arg254 within the conserved ETS transcription factor domain confirmed the lethality of homozygous mutations, highlighting the essential role of Spi1b in embryonic development. Comparative analysis revealed homology between zebrafish Spi1b and human SPI1, suggesting evolutionary conservation of thrombopoiesis regulatory mechanisms. Additionally, analysis of spi1b knockdown zebrafish and the mutant demonstrated increased bleeding, further emphasizing the importance of spi1b in maintaining hemostasis. Our study provides novel insights into the regulatory networks governing thrombopoiesis and identifies Spi1b as a critical regulator of young thrombocyte development in zebrafish. Further investigations into the functional roles of identified genes in thrombocyte biology may elucidate mechanisms underlying thrombopoiesis and inform therapeutic strategies for bleeding disorders.

HTT
Also flagged:infectionreproductionwatermethyl bromidephosphinemalathion
Journal Article 2025-02-12 ✓ 1 Snippet Sharma P, Salunke A, Pandya N, Shah H, Pandya P, Parikh P.
In-Text Gene Mentions

…in Sod2, TBPH,htt, CG5948, cocoon, Ccs,…

Show Full Abstract

The use of synthetic insecticides has been crucial in the management of insect pests however the extensive use of insecticides can result in the development of resistance. Callosobruchus chinensis is a highly destructive pest of stored grains, it's a major feeder and infests a range of stored grains that are vital to both global food security and human nutrition. We extensively investigated gene expression changes of adults in response to deltamethrin to decipher the mechanism behind the insecticide resistance. The analysis of gene expression revealed 25,343 unigenes with a mean length of 1,435 bp. All the expressed genes were identified, and analyzed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment. Exposure to deltamethrin (4.6 ppm) causes 320 differentially expressed genes (DEGs), of which 280 down-regulated and 50 up-regulated. The transcriptome analysis revealed that DEGs were found to be enriched in pathways related to xenobiotics metabolism, signal transduction, cellular processes, organismal systems and information processing. The quantitative real-time PCR was used to validate the DEGs encoding metabolic detoxification. To the best of our knowledge, these results offer the first toxicity mechanisms enabling a more comprehensive comprehension of the action and detoxification of deltamethrin in C. chinensis.

OLFM4
Also flagged:serotonin5-HT4 receptorsion secretion5-HT3 receptorsirritant receptorTRPA1
Journal Article 2025-02-12 ✓ 1 Snippet Touhara KK, Rossen ND, Deng F, Castro J, Harrington AM, Chu T, Garcia-Caraballo S, Brizuela M, O'Donnell T, Xu J, Cil O, Brierley SM, Li Y, Julius D.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The crypt-villus structure of the small intestine serves as an essential protective barrier. The integrity of this barrier is monitored by the complex sensory system of the gut, in which serotonergic enterochromaffin (EC) cells play an important part<sup>1,2</sup>. These rare sensory epithelial cells surveil the mucosal environment for luminal stimuli and transmit signals both within and outside the gut<sup>3-6</sup>. However, whether EC cells in crypts and villi detect different stimuli or produce distinct physiological responses is unknown. Here we address these questions by developing a reporter mouse model to quantitatively measure the release and propagation of serotonin from EC cells in live intestines. Crypt EC cells exhibit a tonic low-level mode that activates epithelial serotonin 5-HT<sub>4</sub> receptors to modulate basal ion secretion and a stimulus-induced high-level mode that activates 5-HT<sub>3</sub> receptors on sensory nerve fibres. Both these modes can be initiated by the irritant receptor TRPA1, which is confined to crypt EC cells. The activation of TRPA1 by luminal irritants is enhanced when the protective mucus layer is compromised. Villus EC cells also signal damage through a distinct mechanism, whereby oxidative stress activates TRPM2 channels, which leads to the release of both serotonin and ATP and consequent excitation of sensory nerve fibres. This topological segregation of EC cell functionality along the mucosal architecture constitutes a mechanism for the surveillance, maintenance and protection of gut integrity under diverse physiological conditions.

Also flagged:envelopechromatinorganizationcell differentiationnuclear envelope proteinstranscription factors
Journal Article 2025-02-12 No Snippets Nair A, Khanna J, Kler J, Ragesh R, Sengupta K.
Show Full Abstract

The nuclear envelope plays an indispensable role in the spatiotemporal organization of chromatin and transcriptional regulation during the intricate process of cell differentiation. This review outlines the distinct regulatory networks between nuclear envelope proteins, transcription factors and epigenetic modifications in controlling the expression of cell lineage-specific genes during differentiation. Nuclear lamina with its associated nuclear envelope proteins organize heterochromatin via Lamina-Associated Domains (LADs), proximal to the nuclear periphery. Since nuclear lamina is mechanosensitive, we critically examine the impact of extracellular forces on differentiation outcomes. The nuclear envelope is spanned by nuclear pore complexes which, in addition to their central role in transport, are associated with chromatin organization. Furthermore, mutations in the nuclear envelope proteins disrupt differentiation, resulting in developmental disorders. Investigating the underlying nuclear envelope controlled regulatory mechanisms of chromatin remodelling during lineage commitment will accelerate our fundamental understanding of developmental biology and regenerative medicine.

HFE
Also flagged:hereditary hemochromatosisironmetabolismhomeostatic iron regulator proteinFerritin‐infections
Journal Article 2025-02-12 ✓ 5 Snippets Thorpe R, Masser B, Gemelli CN, Knight E, Jos C, Bentley PJ, Maddern J, O'Donovan J, Kakkos A, Welvaert M.
In-Text Gene Mentions

…the experiences ofhemochromatosis( HHC )…

…regulator protein genes (HFE).…

…enters the patient'sHFEgenetics and ferritin…

…donor's knowledge ofhemochromatosis, their compliance with…

…that include theHFElocus may also…

Show Full Abstract

<h4>Background</h4>People with hereditary hemochromatosis (HHC) require therapeutic phlebotomy on an ongoing basis. Little is known about the facilitators and barriers they experience in donating at a blood collection agency (BCA), nor how these impact their willingness to engage in an ongoing relationship with a BCA. This study explored the experiences of HHC donors undergoing therapeutic phlebotomy at the Australian Red Cross Lifeblood (Lifeblood) in Australia.<h4>Study design and methods</h4>All HHC donors who had made at least one donation at Lifeblood in the last 2 years were invited to complete a survey. In this paper, we report the findings on enablers and barriers to donating at Lifeblood, donor and patient identity, communication, knowledge of blood use and of plasma, interest in donating plasma, and engagement in positive word of mouth about donating.<h4>Results</h4>Data were obtained from 4350 therapeutic donors. Responders identified more enablers than barriers to donating at Lifeblood and 61.8% reported that Lifeblood used their blood. Responders were more likely to identify as donors than patients, and those with a stronger donor than patient identity were significantly more likely to report that their blood was used, had greater interest in donating plasma, and reported engaging in more positive word of mouth about donating.<h4>Discussion</h4>Findings indicate that BCAs can do more to educate donors with HHC about how their blood is used to help others. Doing so may help to retain them as donors and can be beneficial for the blood supply, as well as for the donors themselves.

Also flagged:reproductionalcoholsex chromosomesautosomesU2SLC7A7
Journal Article 2025-02-12 No Snippets Wang J, Chai J, Chen L, Zhang T, Long X, Diao S, Chen D, Guo Z, Tang G, Wu P.
Show Full Abstract

The increasing volume of genome sequencing data presents challenges for traditional genome-wide prediction methods in handling large datasets. Machine learning (ML) techniques, which can process high-dimensional data, offer promising solutions. This study aimed to find a genome-wide prediction method for local pig breeds, using 10 datasets with varying SNP densities derived from imputed sequencing data of 515 Rongchang pigs and the Pig QTL database. Three reproduction traits-litter weight, total number of piglets born, and number of piglets born alive-were predicted using six traditional methods and five ML methods, including kernel ridge regression, random forest, Gradient Boosting Decision Tree (GBDT), Light Gradient Boosting Machine, and Adaboost. The methods' efficacy was evaluated using fivefold cross-validation and independent tests. The predictive performance of both traditional and ML methods initially increased with SNP density, peaking at 800-900 k SNPs. ML methods outperformed traditional ones, showing improvements of 0.4-4.1%. The integration of GWAS and the Pig QTL database enhanced ML robustness. ML models exhibited superior generalizability, with high correlation coefficients (0.935-0.998) between cross-validation and independent test results. GBDT and random forest showed high computational efficiency, making them promising methods for genomic prediction in livestock breeding.

Also flagged:DimethylarginineMastitissymmetrical dimethylargininenitric oxidesynthesisrenal disease
Journal Article 2025-02-12 No Snippets Bronzo V, Sala G, Ciabattini I, Orsetti C, Armenia G, Meucci V, De Marchi L, Bertelloni F, Sgorbini M, Bonelli F.
Show Full Abstract

Mastitis is one of the most frequent diseases in dairy farms and occurs in both clinical and subclinical forms, resulting in substantial economic losses. Asymmetrical dimethylarginine (ADMA) and symmetrical dimethylarginine (SDMA) are biomarkers that inhibit nitric oxide synthesis. Elevated ADMA levels are associated with an increased risk of mortality both in human medicine and in dogs and a potential need for intensive care, while SDMA correlates with poor prognoses in humans and the progression of renal disease in horses, though its impact varies depending on renal function. This study examines the plasma levels of ADMA and SDMA in healthy cows (H) and cows with subclinical mastitis (SCM) and clinical mastitis (CM). Cows were classified as having mastitis when CMT > 1 and SCC ≥ 250,000 cells/mL. The SCM group showed no clinical signs or milk alterations, whereas the CM group exhibited udder and/or milk changes. The study included 196 blood samples to determine ADMA and SDMA concentrations, with 96 from healthy cows and 100 from pathological cows (58 SCM and 42 CM). The descriptive statistics were reported as the median because the data were not normally distributed (Shapiro-Wilk test). Data were analyzed using the Kruskal-Wallis test with Bonferroni post hoc correction, and the cut-off and accuracy index were calculated using the gold-standard measurement, the SCC. Statistically significant differences in ADMA levels were observed between healthy cows (0.11 µmol/L) and cows with mastitis (SCM 0.26 µmol/L; CM 0.26 µmol/L), but no differences were found in their SDMA levels. The cut-off for ADMA was >0.164 µmol/L, with a sensitivity of 80.41% and specificity of 77.78%. This study suggests that the blood concentration of ADMA is statistically higher in cows with subclinical and clinical mastitis and could be further explored as a potential biomarker for diagnosing these diseases.

SERPINC1
Also flagged:hairhair shaftsparaformaldehydehematoxylinureaprotease
Journal Article 2025-02-12 ✓ 1 Snippet Li S, Cui Y, Yu S, He J, Ma R, Liao B, Zhao P, Wei P, Robert N.
In-Text Gene Mentions

…proteins (Serpind1, Kng1,Serpinc1, Hrg, F2, and…

Show Full Abstract

Highland animals have unique hair growth mechanisms to allow them to adapt to harsh living environments. Compared with other species, their hair cycle growth is affected by more environmental factors. Yaks, as highland animals, have obvious periodic hair growth characteristics in a year; this biological process is regulated by numerous proteins, but the specific molecular regulatory mechanism is still unclear. Here we analyzed the histological characteristics of yak hair follicles (HFs) at each stage and conducted TMT proteomics research. The protein expression network of yak hair at each stage and the mechanism of the yak HF growth cycle were systematically explored, and the candidate proteins Sfrp1 and Ppard were verified. A total of 3176 proteins were quantifiable and 1142 differentially expressed proteins (DEPs) were obtained at five stages of the yak hair cycle. DEPs enriched in complement activation change, tissue development, lipid metabolism, WNT pathway, VEGF pathway, JAK-STAT pathway, and PPAR pathway may promote the growth of yak hair follicles, such as Serpinf1, Ppard, and Stat3. DEPs enriched in complement system, coagulation, cell adhesion, lipid metabolic process, proliferation of epidermal cells, and estrogen pathway may promote the degeneration of yak hair, such as Sfrp1, Eppk1, and Egfr. Using Protein-Protein Interaction (PPI) analysis, we found that core nodes of DEP networks in yak skin are significantly different at three critical time points in hair follicle development, and lipid metabolism proteins are common core DEP nodes during yak HF growth and degeneration. The expression of Sfrp1 and Ppard in yak hair follicles at different periods showed they are related to yak hair cycle control. This study showed that the protein regulatory network of the yak HF growth cycle is complex and dynamically changing and revealed key candidate proteins that may affect yak hair follicle development. These findings provided detailed data for further understanding of the plateau adaptation mechanism of the yak, which is of great significance to make better use of the yak livestock resources and enhance their economic value.

HTT
Also flagged:Depressionserotoninamitriptylineclomipramineduloxetinevenlafaxine
Journal Article 2025-02-12 ✓ 3 Snippets Dobrea CM, Morgovan C, Frum A, Butuca A, Chis AA, Arseniu AM, Ghibu S, Vonica RC, Gligor FG, Ilie IRP, Vonica Tincu AL.
In-Text Gene Mentions

…human 5-HT transporter (5-HTT), which increases 5-HT…

…has the highest5-HTTspecificity of the…

5-HT serotonin 5-HTTserotonin 5-HTT 5-HT…

Show Full Abstract

Depression persists as one of the illnesses described relentlessly through the centuries because it affects a large group of people. <b>Background/Objectives</b>: The treatment of depression consists of various therapeutic agents, among which selective serotonin reuptake inhibitors (SSRIs) are elective. As polypharmacy tends to become the norm in modern days, the study of the real-life occurrence of drug-drug interactions is imperative. The aim of this study was the evaluation of drug-drug interactions (DDIs) between antidepressant medicines, namely SSRIs (each representative) versus eleven representatives from other antidepressant classes. <b>Methods</b>: Based on the spontaneous safety reports (ICSRs) uploaded to EudraVigilance until the end of July 2024, the descriptive and the disproportionality analyses were performed, and results were interpreted in the context of pharmacologic variability. <b>Results</b>: SSRIs were the focus of 137,369 ICSRs while for the other antidepressants, namely amitriptyline, clomipramine, duloxetine, venlafaxine, mirtazapine, bupropion, trazodone, tianeptine, agomelatine, brexpiprazole, and esketamine, a total of 155,458 reports were registered. The most notable differences appeared in psychiatric adverse drug reactions. Except fluvoxamine (<i>n</i> = 463), the remaining SSRIs had a higher number of DDIs reported (<i>n</i> = 1049 for escitalopram and <i>n</i> = 1549 for sertraline) compared to other antidepressants. However, similar numbers of DDIs were reported for duloxetine (<i>n</i> = 1252) and venlafaxine (<i>n</i> = 1513). Sertraline unspecified DDIs were reported with a higher probability compared to all other drugs (e.g., esketamine ROR: 9.37, 95% CI: 5.17-16.96, tianeptine ROR: 4.08, 95% CI: 2.49-6.69, etc.). <b>Conclusions</b>: SSRIs, although known to influence various cytochrome P450 isoenzymes, have not shown higher inhibitory interactions compared to any of the drugs selected as reference. Sertraline appears in more reports concerning DDIs than the other antidepressants. Still, further real world studies related to the DDIs of SSRIs are needed to complete the relevant knowledge level.

Also flagged:Brain-Derived Neurotrophic Factorneurotrophinsnerve growth factorNGFBDNFneurotrophin-3
Journal Article 2025-02-12 No Snippets Numakawa T, Kajihara R.
Show Full Abstract

Among neurotrophins, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and neurotrophin-4 (NT-4/5), BDNF has been extensively studied for its physiological role in cell survival and synaptic regulation in the central nervous system's (CNS's) neurons. BDNF binds to TrkB (a tyrosine kinase) with high affinity, and the resulting downstream intracellular signaling cascades play crucial roles in determining cell fate, including neuronal differentiation and maturation of the CNS neurons. It has been well demonstrated that the downregulation/dysregulation of the BDNF/TrkB system is implicated in the pathogenesis of neurologic and psychiatric disorders, such as Alzheimer's disease (AD) and depression. Interestingly, the effects of BDNF mimetic compounds including flavonoids, small molecules which can activate TrkB-mediated signaling, have been extensively investigated as potential therapeutic strategies for brain diseases, given that p75NTR, a common neurotrophin receptor, also contributes to cell death under a variety of pathological conditions such as neurodegeneration. Since the downregulation of the BDNF/TrkB system is associated with the pathophysiology of neurodegenerative diseases and psychiatric disorders, understanding how alterations in the BDNF/TrkB system contribute to disease progression could provide valuable insight for the prevention of these brain diseases. The present review shows recent advances in the molecular mechanisms underlying the BDNF/TrkB system in neuronal survival and plasticity, providing critical insights into the potential therapeutic impact of BDNF mimetics in the pathophysiology of brain diseases.

HTT
Also flagged:pathogenesisCOVID-19diseasestransductionimmune responsegenetic disorders
Journal Article 2025-02-12 ✓ 5 Snippets Aliev TI, Yudkin DV.
In-Text Gene Mentions

…huntingtin gene (HTT).…

…AAVHtt100Q-infected mice showed…

…compared to AAVHtt18Q-infected mice, which…

…beam walking), AAVHtt100Q-infected mice showed…

…expression of exogenousHTT, both groups…

Show Full Abstract

The development of therapeutic drugs and vaccines requires the availability of appropriate model animals that replicate the pathogenesis of human diseases. Both native and transgenic animals can be utilized as models. The advantage of transgenic animals lies in their ability to simulate specific properties desired by researchers. However, there is often a need for the rapid production of transgenic animal models, especially in situations like a pandemic, as was evident during COVID-19. An important tool for transgenesis is the adeno-associated virus. The genome of adeno-associated virus serves as a convenient expression cassette for delivering various DNA constructs into cells, and this method has proven effective in practice. This review analyzes the features of the adeno-associated virus genome that make it an advantageous vector for transgenesis. Additionally, examples of utilizing adeno-associated viral vectors to create animal models for hereditary, oncological, and viral human diseases are provided.

SOX6
Also flagged:TNF-αIL-6Cognitive impairmentpost-viral infection disordersasmyalgic encephalomyelitis
Journal Article 2025-02-12 ✓ 1 Snippet Goshi N, Lam D, Bogguri C, George VK, Sebastian A, Cadena J, Leon NF, Hum NR, Weilhammer DR, Fischer NO, Enright HA.
In-Text Gene Mentions

…trocyte differentiation (e.g.,SOX6, SOX8, SOX9, VIM,…

Show Full Abstract

Cognitive impairment is one of the many symptoms reported by individuals suffering from long-COVID and other post-viral infection disorders such as myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS). A common factor among these conditions is a sustained immune response and increased levels of inflammatory cytokines. Tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) are two such cytokines that are elevated in patients diagnosed with long-COVID and ME/CFS. In this study, we characterized the changes in neural functionality, secreted cytokine profiles, and gene expression in co-cultures of human iPSC-derived neurons and primary astrocytes in response to prolonged exposure to TNF-α and IL-6. We found that exposure to TNF-α produced both a concentration-independent and concentration-dependent response in neural activity. Burst duration was significantly reduced within a few days of exposure regardless of concentration (1 pg/mL - 100 ng/mL) but returned to baseline after 7 days. Treatment with low concentrations of TNF-α (e.g., 1 and 25 pg/mL) did not lead to changes in the secreted cytokine profile or gene expression but still resulted in significant changes to electrophysiological features such as interspike interval and burst duration. Conversely, treatment with high concentrations of TNF-α (e.g., 10 and 100 ng/mL) led to reduced spiking activity, which may be correlated to changes in neural health, gene expression, and increases in inflammatory cytokine secretion (e.g., IL-1β, IL-4, and CXCL-10) that were observed at higher TNF-α concentrations. Prolonged exposure to IL-6 led to changes in bursting features, with significant reduction in the number of spikes in bursts across a wide range of treatment concentrations (i.e., 1 pg/mL-10 ng/mL). In combination, the addition of IL-6 appears to counteract the changes to neural function induced by low concentrations of TNF-α, while at high concentrations of TNF-α the addition of IL-6 had little to no effect. Conversely, the changes to electrophysiological features induced by IL-6 were lost when the cultures were co-stimulated with TNF-α regardless of the concentration, suggesting that TNF-α may play a more pronounced role in altering neural function. These results indicate that increased concentrations of key inflammatory cytokines associated with long-COVID can directly impact neural function and may be a component of the cognitive impairment associated with long-COVID and other post-viral infection disorders.

Also flagged:Atrial fibrillationAFpathogenesisatrial fibrosiscardiac arrhythmiaheart failure
Journal Article 2025-02-12 No Snippets Balan AI, Scridon A.
Show Full Abstract

Atrial fibrillation (AF) causes a heavy socio-economic burden on healthcare systems around the globe. Identification of new preventive, diagnostic, and treatment methods is imperative. In recent years, special attention has been paid to microRNAs (miRNAs) as potential regulators of AF pathogenesis. Through post-transcriptional regulation of genes, miRNAs have been shown to play crucial roles in AF-related structural and electrical atrial remodeling. Altered expression of different miRNAs has been related to proarrhythmic changes in the duration of action potentials and atrial fibrosis. In clinical studies, miRNA changes have been associated with AF, whereas in experimental studies miRNA manipulation has emerged as a potential therapeutic approach. It would appear that, with the advent of miRNAs, we may have found the Holy Grail, and that efficient and personalized AF therapy may be one step away. Yet, the clinical relevance of miRNA evaluation and manipulation remains questionable. Studies have identified numerous miRNAs associated with AF, but none of them have shown sufficient specificity for AF. MicroRNAs are not gene-specific but regulate the expression of a myriad of genes. Cardiac and non-cardiac off-target effects may thus occur following miRNA manipulation. A Pandora's box might thus have opened with the advent of these sophisticated molecules. In this paper, we provide a critical analysis of the clinical and experimental, epidemiological and mechanistic data linking miRNAs to AF, we discuss the most promising miRNA therapeutic approaches, we emphasize a number of questions that remain to be answered, and we identify hotspots for future research.

Also flagged:neurological diseasesmitochondrialbiosynthesisautophagypathogenesistranscription factors
Journal Article 2025-02-12 No Snippets Tang MB, Liu YX, Hu ZW, Luo HY, Zhang S, Shi CH, Xu YM.
Show Full Abstract

Peroxisome proliferator-activated receptor-<i>γ</i> coactivator-1α (PGC-1α), which is highly expressed in the central nervous system, is known to be involved in the regulation of mitochondrial biosynthesis, metabolic regulation, neuroinflammation, autophagy, and oxidative stress. This knowledge indicates a potential role of PGC-1α in a wide range of functions associated with neurological diseases. There is emerging evidence indicating a protective role of PGC-1α in the pathogenesis of several neurological diseases. As such, a deeper and broader understanding of PGC-1α and its role in neurological diseases is urgently needed. The present review provides a relatively complete overview of the current knowledge on PGC-1α, including its functions in different types of neurons, basic structural characteristics, and its interacting transcription factors. Furthermore, we present the role of PGC-1α in the pathogenesis of various neurological diseases, such as intracerebral hemorrhage, ischemic stroke, Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Huntington's disease, and other PolyQ diseases. Importantly, we discuss some compounds or drug-targeting strategies that have been studied to ameliorate the pathology of these neurological diseases and introduce the possible mechanistic pathways. Based on the available studies, we propose that targeting PGC-1α could serve as a promising novel therapeutic strategy for one or more neurological diseases.

HTT
Also flagged:Amyotrophic Lateral SclerosisALSneurodegenerative disorderpathogenesisC9ORF72SOD1
Journal Article 2025-02-12 ✓ 5 Snippets Sabetta E, Ferrari D, Massimo L, Kõks S.
In-Text Gene Mentions

…ATXN8 (SCA8) andHTT(Huntington’s disease) (…

…the Huntington gene (HTT).…

…TheHTTprotein has neuroprotective…

…the interaction betweenHTTand autophagy-related proteins…

…pathogenic role ofHTTREs within ALS.…

Show Full Abstract

Amyotrophic Lateral Sclerosis (ALS) is a neurodegenerative disorder leading to upper and lower motoneurons degeneration. Although several mechanisms potentially involved in disease development have been identified, its pathogenesis is not fully understood. From the patient side, ALS diagnosis, still based on clinical criteria, can be difficult and may take up to 1 year. More than 30 genes have been associated to genetically inherited ALS, among which four (C9ORF72, SOD1, TARDBP and FUS) would explain around 60-70% of cases. However, familial ALS represents only 5-10% of ALS cases while the remaining are sporadic, with genetics explaining 6-10% of such cases only. In this context, short tandem repeats (STRs) expansions, have recently been found in clinically diagnosed ALS patients. In this review, we discuss the recent discoveries on ALS associated STRs and their potential as biomarkers as well as prognosis and therapy targets.

Also flagged:ESRP1solid tumorCD44deathcardiovascular diseasescancer
Journal Article 2025-02-12 No Snippets Wang L, Zhang M, Zhao K, Yuan X, Zhao H, Liu Y, Ji Y, Lu P.
Show Full Abstract

According to the World Health Organization's statistics, cancer is the second leading cause of death worldwide, following cardiovascular diseases. Despite significant progress in the field of cancer treatment in recent years, cancer remains one of the main factors shortening human life expectancy. The field of cancer research is increasingly focusing on the role of tumor-related oncogenes and heterogeneous proteins in the development of cancer. Studies indicate that there is a close connection between solid tumors and epithelial splicing regulatory protein 1 (ESRP1). ESRP1 is a key intracellular molecule that plays a crucial role in cell growth and differentiation. As an emerging biomarker, ESRP1 has a decisive impact on the formation and development of solid tumors by regulating the alternative splicing of CD44 and the epithelial-mesenchymal transition (EMT) process. Research shows that abnormal expression of ESRP1 is closely related to the formation and development of various solid tumors, including breast cancer, lung cancer, stomach cancer, and others, and is closely associated with the invasiveness, metastasis, and poor prognosis of tumors. Therefore, given ESRP1's critical role in cancer development, it is gradually becoming a potential biomarker and therapeutic target. This review primarily discusses the molecular mechanisms of ESRP1 in regulating cancer metastasis, particularly its regulatory effects on CD44 splicing and the EMT process. These research findings provide new targets for cancer treatment, aiming to bring more precise diagnosis and more effective treatment strategies to patients.

OLFM4
Also flagged:tumorscancertumorprimary tumorcancerslung cancer
Journal Article 2025-02-12 ✓ 2 Snippets Yuan Y, Gao H, Li Y, Jiao X.
In-Text Gene Mentions

…expression of olfactomedin-4 (OLFM4) is involved in…

OLFM4may be a…

Show Full Abstract

The establishment of mouse models is critical for discovering the biological targets of tumorigenesis and cancer development, preclinical trials of targeted drugs, and formulation of personalized therapeutic regimens. Currently, the patient-derived xenograft (PDX) model is considered a reliable animal tumor model because of its ability to retain the characteristics of the primary tumor at the histopathological, molecular, and genetic levels, and to preserve the tumor microenvironment. The application of the PDX model has promoted in-depth research on tumors in recent years, focusing on drug development, tumor target discovery, and precise treatment of patients. However, there are still some common questions. This review introduces the latest research progress and common questions regarding tumors with high mortality rates, focusing on their application in targeted drug screening and the formulation of personalized medical strategies. The challenges faced, improvement methods, and future development of the PDX model in tumor treatment applications are also discussed. This article provides technical guidance and comprehensive expectations for anti-cancer drug screening and clinical personalized therapy.

medRxiv 2025-02-12 Preprint (No Snippets API) Casanova F, Tian Q, Williamson DS, Lucas MR, Zweibaum D, Ding J, Atkins JL, Melzer D, Ferrucci L, Pilling LC.
Show Full Abstract

<h4>Background</h4> Brain iron in specific subcortical regions increases risk of dementia and Parkinson’s Disease (PD). Genetic and environmental factors affect iron deposition, but the underlying mechanisms are unclear. <h4>Objective</h4> Identify risk factors and diseases associated with brain iron, and assess causality using genetics. <h4>Methods</h4> 41,581 UK Biobank participants had MRI-estimated brain iron in four dementia or PD-associated subcortical regions (Caudate, Putamen, Substantia Nigra, Thalamus). We investigated common risk factors (including adiposity, blood pressure, health behaviours, and inflammation) and diseases observationally, using covariate-adjusted regression models, and genetically, with Mendelian randomization. <h4>Results</h4> Participants diagnosed with Alzheimer’s disease, PD, or other diseases had higher brain iron. Anaemia, osteoporosis, and hyperparathyroidism were associated with lower brain iron. Higher BMI and blood pressure, history of smoking, and self-reported meat consumption, increased brain iron. Haematological parameters, inflammatory and kidney biomarkers, and calcium, were also associated. Genetics support causal effects of depression, type-2 diabetes, and 7 other diseases with increased iron, but not Alzheimer’s disease. Evidence supports a causal effect of osteoporosis on lower iron in the substantia nigra. We found causal associations between adiposity and proteins (such as IL-6 receptor and transferrin receptor) on subcortical brain iron. <h4>Conclusions</h4> We identified causal effects for liability to type-2 diabetes, depression, and other conditions, on subcortical iron deposition, but not to Alzheimer’s disease, supportive of dementia as a consequence of brain iron deposition, not a cause. The role of adiposity reducing interventions on brain iron should be investigated. Relationships between brain iron, osteoporosis, calcium, and hyperparathyroidism warrant further investigation.

bioRxiv 2025-02-12 Preprint (No Snippets API) Mukund K, Veraksa D, Frankhouser D, Yang L, Tomsic J, Pillai R, Atti S, Mesrizadeh Z, Schmolze D, Wu X, LeBlanc M, Miele L, Ochoa A, Seewaldt V, Subramaniam S.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Background</h4> Triple-negative breast cancer is a prevalent breast cancer subtype with the lowest 5-year survival. Several factors contribute to its treatment response, but the inherent molecular and cellular tumor heterogeneity are increasingly acknowledged as crucial determinants. <h4>Methods</h4> Spatial transcriptomic profiling was performed on FFPE tissues from a retrospective, treatment-naive group of women with differential prognoses (17 with >15 years survival-good prognosis (GPx) and 15 with <3 years survival-poor prognosis (PPx)) using GeoMX ® Digital Spatial Profiler. Regions of interest were segmented on pan-cytokeratin and analyzed for tumor and stromal components, probed using GeoMx human whole transcriptome atlas (WTA) panel. Data quality control, normalization, and differential analysis was performed in R using GeomxTools and linear mixed models. Additional analyses including cell-type deconvolution, spatial entropy, functional enrichment, TF-target / ligand-receptor analysis and convolution neural networks were employed to identify significant gene signatures contributing to differential prognosis. <h4>Results</h4> Here we report on the spatial and molecular heterogeneity underlying differential prognosis. We observe that the state of the epithelia and its microenvironment (TME) are transcriptionally distinct between the two groups. Invasive epithelia in GPx show a significant increase in immune transcripts with the TME exhibiting increased immune cell presence (via IF), while in PPx they are more metabolically and translationally active, with the TME being more mesenchymal/fibrotic. Specifically, pre-cancerous epithelia in PPx display a prescience of aggressiveness as evidenced by increased EMT-signaling. We identify distinct epithelial gene signatures for PPx and GPx, that can, with high accuracy, classify samples at the time of diagnosis and likely inform therapy. <h4>Conclusions</h4> To the best of our knowledge, this is the first study to leverage spatial transcriptomics for an in-depth delineation of the cellular and molecular underpinnings of differential prognosis in TNBC. Our study highlights the potential of spatial transcriptomics to not only uncover the molecular drivers of differential prognosis in TNBC but also to pave the way for precision diagnostics and tailored therapeutic strategies, transforming the clinical landscape for this aggressive breast cancer subtype.

Research Square 2025-02-12 Preprint (No Snippets API) Deane J, Welland J, Barrow H, Stansfeld P.
Show Full Abstract

<title>Abstract</title> <p>Glycosphingolipids (GSLs) are crucial membrane components involved in essential cellular pathways. Complex GSLs, known as gangliosides, are synthesised in the ER/Golgi by a series of glycosyltransferase enzymes. Imbalances in GSL metabolism can lead to severe diseases, often affecting the nervous system. B4GALNT1 is a key enzyme in the ganglioside synthetic pathway, synthesising complex gangliosides including GM2 and GD2 from GM3 and GD3. These products are precursors to the major brain gangliosides. Loss of B4GALNT1 function causes hereditary spastic paraplegia 26 (HSP26), while its overexpression is linked to cancers including childhood neuroblastoma. Here, we present crystal structures of the homodimeric B4GALNT1 enzyme demonstrating conformational changes upon binding of donor substrate ligands and product. These structures support a catalytic mechanism that involves dynamic remodelling of the substrate binding site during catalysis. We also demonstrate that processing of lipid substrates by B4GALNT1 is severely compromised when surface loops flanking the active site are mutated from hydrophobic residues to polar. Molecular dynamics simulations support that these loops can insert into the lipid bilayer explaining how B4GALNT1 accesses and processes lipid substrates. By combining structure prediction and molecular simulations we propose that this mechanism of dynamic membrane insertion is exploited by other, structurally distinct GSL synthesising enzymes.</p>

Also flagged:disc calcificationlocomotionmineralcell differentiationCitrate3
Journal Article 2025-02-11 No Snippets Ottone OK, Mundo JJ, Kwakye BN, Slaweski A, Collins JA, Wu Q, Connelly MA, Niaziorimi F, van de Wetering K, Risbud MV.
Show Full Abstract

Despite the high prevalence of age-dependent intervertebral disc calcification, there is a glaring lack of treatment options for this debilitating pathology. We investigated the efficacy of long-term oral K<sub>3</sub>Citrate supplementation in ameliorating disc calcification in LG/J mice, a model of spontaneous age-associated disc calcification. K<sub>3</sub>Citrate reduced the incidence of disc calcification without affecting the vertebral bone structure, knee calcification, plasma chemistry, or locomotion in LG/J mice. Notably, a positive effect on grip strength was evident in treated mice. FTIR spectroscopy of the persisting calcified nodules indicated K<sub>3</sub>Citrate did not alter the mineral composition. Mechanistically, activation of an endochondral differentiation in the cartilaginous endplates and nucleus pulposus (NP) compartment contributed to LG/J disc calcification. Importantly, K<sub>3</sub>Citrate reduced calcification incidence by Ca<sup>2+</sup> chelation throughout the disc while exhibiting a differential effect on NP and endplate cell differentiation. In the NP compartment, K<sub>3</sub>Citrate reduced the NP cell acquisition of a hypertrophic chondrocytic fate, but the pathologic endochondral program was unimpacted in the endplates. Overall, this study for the first time shows the therapeutic potential of oral K<sub>3</sub>Citrate as a systemic intervention strategy to ameliorate disc calcification.

Also flagged:neurodegenerative diseasesamyloid-betaantibodiesproteolysisdegradationAD
Journal Article 2025-02-11 No Snippets Kong D, Meng L, Lin P, Wu G.
Show Full Abstract

Neurodegenerative diseases are characterized by impairments in movement and cognitive functions. These disorders are frequently associated with the accumulation of misfolded protein aggregates, which present significant challenges for treatment with conventional small-molecule inhibitors. While FDA-approved amyloid-beta-directed antibodies, such as Lecanemab, have recently shown clinical success in modifying disease progression, there are currently no treatments capable of curing neurodegenerative diseases. Emerging technologies like proteolysis-targeting chimeras (PROTACs) offer additional promise by targeting disease-causing proteins for degradation, potentially opening new therapeutic avenues. Recent experiments have demonstrated that PROTACs can specifically target and degrade pathogenic proteins associated with neurodegenerative diseases, thereby offering potential therapeutic avenues. This review discusses the latest advances in employing PROTACs for treating neurodegenerative diseases and delves into the associated challenges and opportunities. Our goal is to provide researchers in drug development with new insights on creating novel PROTACs for therapeutic applications.

HTT
Also flagged:neurodegenerative diseasespathogenesisAlzheimer's diseasesParkinson's diseasesADdementia
Journal Article 2025-02-11 ✓ 1 Snippet Jin L, Nie L, Deng Y, Khana GJ, He N.
In-Text Gene Mentions

…a decrease ofHTTmRNA expression at…

Show Full Abstract

In spite of great advances in modern medicine, there are a few effective strategies for the treatment of neurodegenerative diseases characterised by neuron loss or degeneration. This results from complex pathogenesis of the diseases and the limited drug uptake of the brain due to the presence of blood-brain barrier. Nanoparticle-based drug delivery systems are expected to improve the drug utilisation. Polymeric nanoparticles represent promising drug delivery carriers to the brain due to their unique advantages such as good biodegradability and biocompatibility, flexibility in surface modification and nontoxicity. In addition, the delivery of genetic drugs may stop the progression of neurodegenerative diseases at the genetic level and even avoid the irreversible damage in the central nervous system. In this review, an overview of studies on polymer-based nanoparticles for drug delivery to the central nervous system in typical neurodegenerative diseases, especially Alzheimer's diseases and Parkinson's diseases, is described. Meanwhile, their applications in gene delivery in these disorders are discussed. And the challenges and future perspectives for the development of polymeric nanoparticles as drug delivery carriers in neurodegenerative diseases are concluded.

POU3F2
Also flagged:PhosphorylationPOU3F3Nuclear TranslocationATP5PFelectron transport chaincancer
Journal Article 2025-02-11 ✓ 2 Snippets Zeng QG, Li L, Chang T, Sun Y, Zheng B, Xue LN, Liu CL, Li XQ, Huang RT, Gu JX, An ZR, Yao HT, Zhou DY, Fan J, Dai Y.
In-Text Gene Mentions

…been reported thatPOU3F2might be involved…

…] For instance,POU3F2regulated cellular differentia…

Show Full Abstract

Targeting oxidative phosphorylation (OXPHOS) through inhibiting the electron transport chain (ETC) has shown promising pre-clinical efficacy in cancer therapy. Although aerobic glycolysis is a hallmark of cancer, emerging evidence suggest OXPHOS is frequently enhanced, providing metabolic advantages for cell proliferation, metastasis, and drug resistance in a variety of aggressive cancer types including non-small cell lung cancer (NSCLC), yet the underlying molecular mechanisms remain elusive. Here it is reported that POU-domain containing family protein POU3F3 is translocated into the nuclei of NSCLC cell lines harboring mutant RAS, where it activates transcription of ATP5PF, an essential component of mitochondrial ATP synthase and consequent ATP production, leading to enhanced NSCLC proliferation and migration. Moreover, it is further found out that ERK1 phosphorylates POU3F3 at the S393 site in the cytoplasm and promotes the nuclear translocation of POU3F3 via receptor importin β1 in RAS mutant NSCLC cells. Mechanistically, RNA sequencing analysis combined with chromatin immunoprecipitation (ChIP) assay revealed that POU3F3 binds to the promoter of ATP5PF, leading to enhanced ATP5PF transcription and ATP production. Together, this study uncovers a novel RAS-POU3F3-ATP5PF axis in facilitating NSCLC progression, providing a new perspective on the understanding of molecular mechanisms for NSCLC progression.

STAU1
Also flagged:autosomalmultisystemicdeathrespiratory failureventricular depolarizationarrhythmias
Journal Article 2025-02-11 ✓ 1 Snippet Hu RC, Zhang Y, Nitschke L, Johnson SJ, Hurley AE, Lagor WR, Xia Z, Cooper TA.
In-Text Gene Mentions

…protein Staufen 1 (STAU1), have been proposed…

Show Full Abstract

Myotonic dystrophy type 1 (DM1) is an autosomal dominant disease caused by a CTG repeat expansion in the dystrophia myotonica protein kinase (DMPK) gene. The expanded CUG repeat RNA (CUGexp RNA) transcribed from the mutant allele sequesters the muscleblind-like (MBNL) family of RNA-binding proteins, causing their loss of function and disrupting regulated pre-mRNA processing. We used a DM1 heart mouse model that inducibly expresses CUGexp RNA to test the contribution of MBNL loss to DM1 cardiac abnormalities and explored MBNL restoration as a potential therapy. AAV9-mediated overexpression of MBNL1 and/or MBNL2 significantly rescued DM1 cardiac phenotypes including conduction delays, contractile dysfunction, hypertrophy, and misregulated alternative splicing and gene expression. While robust, the rescue was partial compared with reduced CUGexp RNA and plateaued with increased exogenous MBNL expression. These findings demonstrate that MBNL loss is a major contributor to DM1 cardiac manifestations and suggest that additional mechanisms play a role, highlighting the complex nature of DM1 pathogenesis.

HTT
Also flagged:CBPFOXP2MVPdorsalgiaINPP5BDRD2
Journal Article 2025-02-11 ✓ 2 Snippets Stanaway IB, Suri P, Afari N, Dochtermann D, Gerstenberger A, Pyarajan S, Roseen EJ, Million Veteran Program, Gasperi M.
In-Text Gene Mentions

…( INPP5B, DRD2,HTT, SLC30A6 ) associated…

…( INPP5B, DRD2,HTT, SLC30A6 ) had…

Show Full Abstract

This multi-ancestry meta-analysis of genome-wide association studies (GWAS) investigated the genetic factors underlying chronic back pain (CBP) in a sample from the Million Veteran Program comprised of 553,601 Veterans of African (19.2%), European (72.6%), and Hispanic (8.2%) ancestry. The results revealed novel (N = 67) and known (N = 20) genome-wide significant loci associated with CBP, with 43 independent variants replicating in a non-overlapping contemporary meta-GWAS of the spinal pain dorsalgia phenotype. The most significant novel variant was rs12533005 (chr7:114416000, p = 1.61 × 10<sup>-20</sup>, OR = 0.96 (95% CI: 0.95-0.97), EA = C, EAF = 0.39), in an intron of the FOXP2 gene. In silico functional characterization revealed enrichment in brain and pituitary tissues. Mendelian randomization analysis of 62 variants for CBP-MVP revealed 48 with causal links to dorsalgia. Notably, four genes (INPP5B, DRD2, HTT, SLC30A6) associated with these variants are targets of existing drugs. Our findings more than double the number of previously reported genetic predictors across all spinal pain phenotypes.

HTT
Also flagged:agingHuntington neurodegenerative diseaseHDhistonepolycomb repressive complexesPRC1
Journal Article 2025-02-11 ✓ 4 Snippets Brulé B, Alcalá-Vida R, Penaud N, Scuto J, Mounier C, Seguin J, Khodaverdian SV, Cosquer B, Birmelé E, Le Gras S, Decraene C, Boutillier AL, Merienne K.
In-Text Gene Mentions

…the Huntingtin (HTT) gene, which produces…

HTTinteracts with PRC2…

…Second, Huntingtin (HTT), the protein mutated…

…(DDR) and mutatedHTTimpairs DDR 55…

Show Full Abstract

Loss of epigenetic information during physiological aging compromises cellular identity, leading to de-repression of developmental genes. Here, we assessed the epigenomic landscape of vulnerable neurons in two reference mouse models of Huntington neurodegenerative disease (HD), using cell-type-specific multi-omics, including temporal analysis at three disease stages via FANS-CUT&Tag. We show accelerated de-repression of developmental genes in HD striatal neurons, involving histone re-acetylation and depletion of H2AK119 ubiquitination and H3K27 trimethylation marks, which are catalyzed by polycomb repressive complexes 1 and 2 (PRC1 and PRC2), respectively. We further identify a PRC1-dependent subcluster of bivalent developmental transcription factors that is re-activated in HD striatal neurons. This mechanism likely involves progressive paralog switching between PRC1-CBX genes, which promotes the upregulation of normally low-expressed PRC1-CBX2/4/8 isoforms in striatal neurons, alongside the down-regulation of predominant PRC1-CBX isoforms in these cells (e.g., CBX6/7). Collectively, our data provide evidence for PRC1-dependent accelerated epigenetic aging in HD vulnerable neurons.

STAU1
Also flagged:Pituitary neuroendocrine tumorsintracranial tumorstranscription factorstumorTPITESRP1
Journal Article 2025-02-11 ✓ 3 Snippets Huang Y, Guo J, Han X, Zhao Y, Li X, Xing P, Liu Y, Sun Y, Wu S, Lv X, Zhou L, Zhang Y, Li C, Xie W, Liu Z.
In-Text Gene Mentions

STAU1and RBMX were…

…Staufen homolog 1 (STAU1) is a highly…

…results suggested thatSTAU1may serve as…

Show Full Abstract

Pituitary neuroendocrine tumors (PitNETs) are one of the most common intracranial tumors with diverse clinical manifestations. Current pathological classification systems rely primarily on histological hormone staining and transcription factors (TFs) expression. While effective in identifying three major lineages, molecular characteristics based on hormones and TFs lack sufficient resolution to fully capture the complex tumor heterogeneity. Transcriptional diversity by alternative splicing (AS) offered additional insight to address this challenge. Here, we perform bulk and full-length single-cell RNA sequencing to comprehensively investigate AS dysregulation across all PitNET lineages. We reveal pervasive splicing dysregulations that better depict tumor heterogeneity. Additionally, we delineate fundamental splicing heterogeneity at single-cell resolution, confirming bulk findings and refining splicing dysregulation varying among tumor cell types. Notably, we effectively distinguish the silent corticotroph subtype and define a distinct TPIT lineage subtype, which is associated with worse clinical outcomes and increased splicing abnormalities driven by altered ESRP1 expression. In conclusion, our results characterize the subtype specific AS landscape in PitNETs, enhancing the understanding of the PitNETs subtyping.

Also flagged:tumorscancertumorsynaptic transmissionion channelscancers
Journal Article 2025-02-11 No Snippets Bloomer H, Dame HB, Parker SR, Oudin MJ.
Show Full Abstract

Cellular plasticity and the ability to avoid terminal differentiation are hallmarks of cancer. Here, we review the evidence that tumor cells themselves can take on properties of neurons of the central nervous system, which can regulate tumor growth and metastasis. We discuss recent evidence that axon guidance molecules and regulators of electrical activity and synaptic transmission, such as ion channels and neurotransmitters, can drive the oncogenic and invasive properties of tumor cells from a range of cancers. We also review how FDA-approved treatments for neurological disorders are being tested in pre-clinical models and clinical trials for repurposing as anti-cancer agents, offering the potential for new therapies for cancer patients that can be accessed more quickly.

SERPINC1
Also flagged:Cerebral small vessel diseasebrain disordercoagulationinsulin-like growth factor-binding proteinscomplement cascadeIGFBP
Journal Article 2025-02-11 ✓ 2 Snippets Wang YC, Zhu HH, He LC, Yao YT, Zhang L, Xue XL, Li JY, Zhang L, Song B, Shi CH, Li YS, Gao Y, Yang JH, Xu YM.
In-Text Gene Mentions

…as plasminogen (PLG),antithrombin-III(SERPINC1), prothrombin (F2),…

…ogen (PLG), antithrombin-III (SERPINC1), prothrombin (F2), APOB,…

Show Full Abstract

Cerebral small vessel disease (CSVD) is a global brain disorder that is characterized by a series of clinical, neuroimaging, and neuropathological manifestations. However, the molecular pathophysiological mechanisms of CSVD have not been thoroughly investigated. Liquid chromatography-tandem mass spectrometry-based proteomics has broad application prospects in biomedicine. It is used to elucidate disease-related molecular processes and pathophysiological pathways, thus providing an important opportunity to explore the pathophysiological mechanisms of CSVD. Serum samples were obtained from 96 participants (58 with CSVD and 38 controls) consecutively recruited from The First Affiliated Hospital of Zhengzhou University. After removing high-abundance proteins, the serum samples were analyzed using high-resolution mass spectrometry. Bioinformatics methods were used for in-depth analysis of the obtained proteomic data, and the results were verified experimentally. Compared with the control group, 52 proteins were differentially expressed in the sera of the CSVD group. Furthermore, analyses indicated the involvement of these differentially expressed proteins in CSVD through participation in the overactivation of complement and coagulation cascades and dysregulation of insulin-like growth factor-binding proteins. The proteomic biomarker panel identified by the machine learning model combined with clinical features is expected to facilitate the diagnosis of CSVD (AUC = 0.947, 95% CI = 0.895-0.978). The study is the most in-depth study on CSVD proteomics to date and suggests that the overactivation of the complement cascade and the dysregulation of IGFBP on- IGF may be closely correlated with the occurrence and progression of CSVD, offering the potential to develop peripheral blood biomarkers and providing new insights into the biological basis of CSVD.

B4GALT5
Also flagged:MiglustatisoproterenolUGCGcardiovascular diseasesheart failureβ-adrenergic receptor
Journal Article 2025-02-11 ✓ 1 Snippet Liu J, Li W, Jiao R, Liu Z, Zhang T, Chai D, Meng L, Yang Z, Liu Y, Wu H, Gu X, Li X, Yang C.
In-Text Gene Mentions

…through connection withBeta-1,4-galactosyltransferase 55 (B4GalT5) to…

Show Full Abstract

<h4>Background</h4>Cardiac fibrosis is significant global health problem, which is associated with numerous cardiovascular diseases, and ultimately leads to the progression to heart failure. β-adrenergic receptor (β-AR) overactivation play a role in the development of cardiac fibrosis. Miglustat (Mig) has shown anti-fibrosis effects in multiple fibrotic diseases. However, it is unclear whether and how Mig can ameliorate cardiac fibrosis induced by β-AR overactivation.<h4>Methods</h4>In vivo, mice were injected with isoproterenol (ISO) to induce cardiac fibrosis and treated with Mig. In vitro, primary cardiac fibroblasts were stimulated by ISO and treated with Mig. Levels of cardiac fibrosis, cardiac dysfunction, activation of cardiac fibroblasts were evaluated by real-time polymerase chain reaction, western blots, sirius red staining, immunohistochemistry staining and echocardiography. Through GEO data and knockdown UDP-glucose ceramide glycosyltransferase (UGCG) in primary cardiac fibroblasts, whether Mig alleviates cardiac fibrosis by targeting UGCG was explored.<h4>Results</h4>The results indicated that Mig alleviated ISO-induced cardiac dysfunction. Consistently, Mig also suppressed ISO-induced cardiac fibrosis. Moreover, Mig attenuated ISO-induced cardiac fibroblasts (CFs) activation. To identify the protective mechanism of Mig on cardiac fibrosis, several classical β-AR downstream signaling pathways, including ERK, STAT3, Akt and GSK3β, were further analyzed. As expected, ISO activated the ERK, STAT3, Akt and GSK3β in both CFs and mouse hearts, but this effect was reversed pretreated with Mig. Besides, Mig ameliorates ISO-induced cardiac fibrosis by targeting UDP-glucose ceramide glycosyltransferase (UGCG) in CFs.<h4>Conclusions</h4>Mig ameliorates β-AR overactivation-induced cardiac fibrosis by inhibiting ERK, STAT3, Akt and GSK3β signaling and UGCG may be a potential target for the treatment of cardiac fibrosis.

Also flagged:ovarian insufficiencycyclemenopausemenstrual cycleAMHLH
Journal Article 2025-02-11 No Snippets Peng Y, Liu J, Li Y, Nie G, Cheng F, Feng D, Du Q, Huang J, Yang H.
Show Full Abstract

<h4>Background</h4>Premature ovarian insufficiency (POI), a condition impacting women under 40, is rising globally, posing significant risks to fertility, bone health, and cardiovascular function. Conventional hormone replacement therapy (HRT) alleviates symptoms but fails to restore ovarian function. Our prior studies have demonstrated that the Huyang Yangkun (HYYK) formula effectively supports menstrual cycle frequency and alleviates menopause-related symptoms in POI patients. This study aims to evaluate the efficacy and safety of the HYYK formula, a traditional Chinese medicine (TCM) approach, in enhancing residual follicle activity in POI patients.<h4>Methods</h4>This multicenter, randomized, double-blind, placebo-controlled trial will enroll 102 women with POI, who will be randomly assigned to receive either the HYYK formula or a placebo for 24 weeks. Primary outcomes will be assessed through Hoogland and Skouby scores (indicative of residual follicle activity) and menstrual cycle regularity. Secondary outcomes include hormone levels (AMH, FSH, LH, E2), ovarian volume, antral follicle count, and clinical symptom scales, such as the Greene Scale and the Female Sexual Function Index. Safety assessments will involve routine physical exams and adverse event monitoring.<h4>Discussion</h4>This is the first multicenter, randomized, double-blind, placebo-controlled study to investigate the efficacy of TCM in stimulating residual follicle recovery in POI patients. The trial rigorously investigates the potential of the HYYK formula as a therapeutic alternative for POI, aiming to deliver high-quality evidence that supports the use of TCM in POI management. This study will concentrate on stimulating residual follicle development in POI patients, offering a viable approach to delaying ovarian decline and generating compelling clinical evidence.<h4>Trial registration</h4>Chinese Clinical Trials.gov ChiCTR2100049604 Registered on August 6, 2021 ( http://www.chictr.org.cn ).

OLFM4
Also flagged:β-CateninWNTLuciferaseTCFExtracellularvesicles
Journal Article 2025-02-11 ✓ 2 Snippets Chugh RM, Bhanja P, Zitter R, Gunewardena S, Badkul R, Saha S.
In-Text Gene Mentions

…markers such asOLFM4, LGR5, BMI-1 compared…

…markers such asOLFM4, DCLK-1, LGR5 compared…

Show Full Abstract

<h4>Background</h4>Macrophages are the major source of WNT ligands. However, the regulation of WNT expression in macrophages has not been studied. In the present study, we have discovered that activation of canonical β-Catenin signaling suppresses WNT expression in macrophages. EVs from these pre-conditioned macrophages promoted intestinal stem cell regeneration and mitigated intestinal injury.<h4>Method</h4>ChIP-seq analysis and validation studies using recombinant DNA construct expressing Luciferase reporter under WNT promoter (e.g. WNT5a and WNT9b) were conducted to demonstrate the involvement of β-Catenin in the transcriptional regulation of WNT expression. The regulatory role of β-Catenin in WNT expression in macrophages was examined by treating these cells with a Tankyrase inhibitor. In addition, the gene expressing β-Catenin was deleted in macrophages using Csf1r.iCre; Ctnnb1<sup>fl/fl</sup> mice model. Both pharmacological and genetically modulated macrophages were examined for WNT expression and activity by qPCR and TCF/LEF luciferase assay respectively. Additionally, Csf1r.iCre; Ctnnb1<sup>fl/fl</sup> mice were exposed to irradiation to compare the radiosensitivity with their wildtype littermate. Extracellular vesicles (EVs) were isolated from pre-conditioned WNT-enriched macrophages and infused in irradiated C57BL/6 and Lgr5/eGFP-IRES-Cre-ERT2; R26-ACTB-tdTomato-EGFP mice to determine the regenerative response of intestinal stem cell (ISC) and epithelial repair. Regenerative effects of EVs were also examined in mice model DSS induced colitis.<h4>Result</h4>ChIP-seq analysis and subsequent validation study suggested physical association of β-Catenin with WNT promoters to suppress WNT expression. Macrophage specific deletion of gene expressing β-Catenin or pharmacological inhibition of Tankyrase improves the WNT expression in macrophages several folds compared to control. Transfusion of these preconditioned macrophages or EVs from these cells delivers optimum level of morphogenic WNT to injured epithelium, activates ISC regeneration and mitigated radiation induced intestinal injury. Intestinal epithelium in Csf1r.iCre; Ctnnb1<sup>fl/fl</sup> mice also showed radioresistance compared to wild type littermate. Moreover, EVs derived from WNT enriched macrophages can mitigate intestinal injury in mice model of DSS induced acute colitis.<h4>Conclusion</h4>The study provides substantial evidence that macrophage-targeted modulation of canonical WNT signaling induces WNT expression in macrophages. Treatment with preconditioned macrophage derived WNT-enriched EVs can be a promising therapeutic approach against intestinal injury.

SERPINC1
Also flagged:hereditary angioedemaC1 INHC4complement proteinstype II C1deficiency
Journal Article 2025-02-11 ✓ 2 Snippets Bocquet A, Pagnier A, Boccon-Gibod I, Defendi F, Dumestre-Perard C, Hardy G, Bouillet L.
In-Text Gene Mentions

…the complement system,C1 InhibitorInhibitor (C1 INH)…

…testing plasma forC1 InhibitorInhibitor (C1 INH)…

Show Full Abstract

<h4>Background</h4>When a member of a family has been diagnosed with hereditary angioedema (HAE) before a child is born, the question of early diagnosis arises. Indeed, the first attacks may occur at birth. Early diagnosis is complicated by biological issues. Due to the immaturity of the complement system, C1 Inhibitor (C1 INH) and C4 levels can be low at birth, generally in the range of 60 to 100% of adult reference values. Like most complement proteins, their levels generally normalize after one year of life. However, this is not always the case, and we report two counter-examples here.<h4>Case presentation</h4>A woman with well-documented HAE due to type II C1 INH deficiency gave birth to two children 4 years apart. Functional C1 INH assays performed at 8 and 7 months of age returned normal C1 INH inhibitory activity. However, a genetic exploration revealed the presence of the mother's pathogenic gene variant in both children. Subsequent monitoring of C1 INH activity at 3 and 4 years of age confirmed a pathological reduction in C1 INH inhibitory activity.<h4>Conclusion</h4>For the early detection of HAE in children, these cases lead us to recommend genetic testing for the index parent's pathological variant rather than reliance on results of C1 INH assays.

Also flagged:Melanomamembranessolid tumormalignant tumorskin cancersChromebox protein homolog 3
Journal Article 2025-02-11 No Snippets Chen W, Zhou L, Jiang J, Chen J, Geng D, Chen Y, Han X, Xie Q, Guo G, Chen X, Tang S, Zhong X.
Show Full Abstract

<h4>Background</h4>As one of the stem cell markers, chromobox protein homolog 3 (CBX3) participates in multiple signaling pathways that affect the progression of various tumors. However, the role of CBX3 in melanoma remains unclear, and the mechanisms by which CBX3 may regulate immunotherapy outcome remain largely unknown.<h4>Methods</h4>We used the Cancer Genome Atlas, Genotype-Tissue Expression portal, and Gene Expression Omnibus database to estimate CBX3 expression and its prognostic effect in melanoma. The role of CBX3 in proliferation and migration of melanoma cells were examined using the CCK8, cloning, wound healing, and transwell assays. The effect of CBX3 on melanoma tumorigenesis was assessed using an in vivo animal model. The role of CBX3 in cell cycle was examined using flow cytometry, and expression levels of cell cycle-related genes and proteins in cells with altered CBX3 levels were analyzed using qPCR and western blotting. The function of CBX3 in the immune microenvironment of melanoma was studied using single-cell RNA sequencing and public databases.<h4>Results</h4>We found that CBX3 was highly expressed in melanoma with poor prognosis. CBX3 promoted the proliferation and migration of melanoma cells in vivo and in vitro. Functional analysis revealed that CBX3 regulates cell cycle, as it accelerated the G1 to S transition, decreased p21 expression, and increased CDK6 expression. Finally, single-cell sequencing and immune-related assays showed that CBX3 is immunogenic and can change the immune microenvironment of melanoma.<h4>Conclusions</h4>We conclude that the stem cell marker, CBX3 activates the p21/CDK6 pathway and alters the immune microenvironment in melanoma.

OLFM4ZNFX1
Also flagged:cancertumorhemostasiscoagulationangiogenesisepithelial-mesenchymal transition
Journal Article 2025-02-11 ✓ 3 Snippets Morales-Pacheco M, Valenzuela-Mayen M, Gonzalez-Alatriste AM, Mendoza-Almanza G, Cortés-Ramírez SA, Losada-García A, Rodríguez-Martínez G, González-Ramírez I, Maldonado-Lagunas V, Vazquez-Santillan K, González-Covarrubias V, Pérez-Plasencia C, Rodríguez-Dorantes M.
In-Text Gene Mentions

…with Olfactomedin 4 (OLFM4) in tumor cells,…

…3 (MAGI2-AS3) andZNFX1antisense RNA 1…

ZNFX1antisense RNA 1…

Show Full Abstract

Platelets, anucleate blood cells essential for hemostasis, are increasingly recognized for their role in cancer, challenging the traditional notion of their sole involvement in blood coagulation. It has been demonstrated that platelets establish bidirectional communication with tumor cells, contributing to tumor progression and metastasis through diverse molecular mechanisms such as modulation of proliferation, angiogenesis, epithelial-mesenchymal transition, resistance to anoikis, immune evasion, extravasation, chemoresistance, among other processes. Reciprocally, cancer significantly alters platelets in their count and composition, including mRNA, non-coding RNA, proteins, and lipids, product of both internal synthesis and the uptake of tumor-derived molecules. This phenomenon gives rise to tumor-educated platelets (TEPs), which are emerging as promising tools for the development of liquid biopsies. In this review, we provide a detailed overview of the dynamic roles of platelets in tumor development and progression as well as their use in diagnosis and prognosis. We also provide our view on current limitations, challenges and future research areas, including the need to design more efficient strategies for their isolation and analysis, as well as the validation of their sensitivity and specificity through large-scale and rigorous clinical trials. This research will not only enable the evaluation of their clinical viability but could also open new opportunities to enhance diagnostic accuracy and develop personalized treatments in oncology.

Also flagged:metabolismorganizationGja5NppaTbx5Hey2
Journal Article 2025-02-11 No Snippets Mulleners OJ, van der Maarel LE, Christoffels VM, Jensen B.
Show Full Abstract

A poorly understood, major event in heart evolution is the convergent prioritization in mammals and birds of compact myocardium over trabecular myocardium. Compact myocardium is thought to facilitate the greater cardiac outputs that distinguish endothermic mammals and birds from ectotherms, but the underlying mechanism remains unclear. We used transcriptomics to investigate whether the compact layer myocardium is intrinsically different from that of the trabecular layer. In the embryonic mouse heart, spatial transcriptomics revealed that 3% of detected genes were differentially expressed between trabecular and compact myocardium. In the adult, this analysis yielded only 0.2% differentially expressed genes. Additionally, the transcriptomes of both embryonic trabecular and compact myocardium greatly differed from those of the adult myocardium. Reanalysis of available single-cell transcriptomes showed relationships between human embryonic and adult trabecular and compact myocardium similar to those in mice. Analysis of new and published transcriptomes from adult zebra finch, zebrafish, and tuna revealed few differentially expressed genes (<0.6%) and no conservation between species. We conclude that the transcriptional states of developing trabecular and compact myocardium do not persist into adulthood. In adult hearts, the compact layer myocardium is not intrinsically different from that of the trabecular layer despite the overt morphological differences.

HFE
Also flagged:Alkalinetumorimmune responsescytidine monophosphateguanosinecancer
Journal Article 2025-02-11 ✓ 2 Snippets Li B, Tan Y, Lei JH, Deng M, Yu X, Wang X, Lei LM, He L, Deng CX, Dai Y.
In-Text Gene Mentions

…iron‐regulating homeostasis (HFE, BMP6 ,…

…SNX2 , andHFE(Figure 5f ),…

Show Full Abstract

Failures of radiotherapy (RT) in adaptive antitumor immunomodulation often associate with recruited tissue-repairing macrophages. Although training these macrophages to phagocytose post-RT cancer cells reverses their protumoral performance, engulfed tumor antigens are severely underrated. In fact, regulating the processing and presentation of tumor antigens, a key determinant of tumor immunogenicity, can fundamentally affect adaptive immune responses. Here it is reported that a simple Alum-like adjuvant (MgAl-based hydrotalcite, bLDH) improves radioimmunotherapy via inducing antigen cross-presentation by macrophages, independent of phenotypes. It is identified that cytidine monophosphate guanosine oligodeoxynucleotide engenders macrophages to phagocytose irradiated cancer cells. However, as semiprofessional antigen-presenting cells, macrophages possess powerful proteolytic function that is detrimental to antigen presentation. The administration of alkaline bLDH intriguingly relieves the activity of phagolysosomal proteases with acidic pH optima by preventing phagosomal acidification resulting from the vacuolar-type ATPase proton pump. The adjuvant-modulated phagolysosomes thus limit antigen degradation and enhance tumor antigen cross-presentation over tenfold. To examine from an in vivo breast tumor model, trained macrophages successfully cross-prime antigen-specific CD8<sup>+</sup> T cells and curb RT-associated metastasis. The findings propose to pay close attention to the effect of adjuvants on precision immunotherapy and highlight the positive contribution of cross-presenting macrophages in radioimmunotherapy.

HTT
Also flagged:HuntingtinHDMsh3Pms1pathogenesismismatch repair
Journal Article 2025-02-11 ✓ 1 Snippet Wang N, Zhang S, Langfelder P, Ramanathan L, Gao F, Plascencia M, Vaca R, Gu X, Deng L, Dionisio LE, Vu H, Maciejewski E, Ernst J, Prasad BC, Vogt TF, Horvath S, Aaronson JS, Rosinski J, Yang XW.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) modifiers include mismatch-repair (MMR) genes, but their connections to neuronal pathogenesis remain unclear. Here, we genetically tested 9 HD genome-wide association study (GWAS)/MMR genes in mutant Huntingtin (mHtt) mice with 140 inherited CAG repeats (Q140). Knockout (KO) of genes encoding a distinct MMR complex either strongly (Msh3 and Pms1) or moderately (Msh2 and Mlh1) rescues phenotypes with early onset in striatal medium-spiny neurons (MSNs) and late onset in the cortical neurons: somatic CAG-repeat expansion, transcriptionopathy, and mHtt aggregation. Msh3 deficiency ameliorates open-chromatin dysregulation in Q140 neurons. Mechanistically, the fast linear rate of mHtt modal-CAG-repeat expansion in MSNs (8.8 repeats/month) is drastically reduced or stopped by MMR mutants. Msh3 or Pms1 deficiency prevents mHtt aggregation by keeping somatic MSN CAG length below 150. Importantly, Msh3 deficiency corrects synaptic, astrocytic, and locomotor defects in HD mice. Thus, Msh3 and Pms1 drive fast somatic mHtt CAG-expansion rates in HD-vulnerable neurons to elicit repeat-length/threshold-dependent, selective, and progressive pathogenesis in vivo.

Also flagged:Synapsinsynapsevesicle-synapsessynaptic proteins
Journal Article 2025-02-11 No Snippets Hoffmann C, Ruff KM, Edu IA, Shinn MK, Tromm JV, King MR, Pant A, Ausserwöger H, Morgan JR, Knowles TPJ, Pappu RV, Milovanovic D.
Show Full Abstract

Multiple biomolecular condensates coexist at the pre- and post- synapse to enable vesicle dynamics and controlled neurotransmitter release in the brain. In pre-synapses, intrinsically disordered regions (IDRs) of synaptic proteins are drivers of condensation that enable clustering of synaptic vesicles (SVs). Using computational analysis, we show that the IDRs of SV proteins feature evolutionarily conserved non-random compositional biases and sequence patterns. Synapsin-1 is essential for condensation of SVs, and its C-terminal IDR has been shown to be a key driver of condensation. Focusing on this IDR, we dissected the contributions of two conserved features namely the segregation of polar and proline residues along the linear sequence, and the compositional preference for arginine over lysine. Scrambling the blocks of polar and proline residues weakens the driving forces for forming micron-scale condensates. However, the extent of clustering in subsaturated solutions remains equivalent to that of the wild-type synapsin-1. In contrast, substituting arginine with lysine significantly weakens both the driving forces for condensation and the extent of clustering in subsaturated solutions. Co-expression of the scrambled variant of synapsin-1 with synaptophysin results in a gain-of-function phenotype in cells, whereas arginine to lysine substitutions eliminate condensation in cells. We report an emergent consequence of synapsin-1 condensation, which is the generation of interphase pH gradients that is realized via differential partitioning of protons between coexisting phases. This pH gradient is likely to be directly relevant for vesicular ATPase functions and the loading of neurotransmitters. Our studies highlight how conserved IDR grammars serve as drivers of synapsin-1 condensation.

HTT
Also flagged:hSynethanolneuroblastomapenicillinstreptomycinMyc
Journal Article 2025-02-11 ✓ 5 Snippets Zhang S, Wang S, Yang Z, Li Y, Li J, Chen X, Yao H, Zheng Z, Guo X.
In-Text Gene Mentions

…mitochondrial association ofHTTexon 1 with…

HTT-Q73-L7A mutation reduces mHTT…

…mHTT aggregation andHTT-Q73-induced neuronal cell dea…

HTT-Q73-L7A mutation mitigates HT…

…HTT-Q73-L7A mutation mitigatesHTT-Q73-induced mitochondrial dys…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by the abnormal expansion of CAG repeats in exon 1 of the HTT gene. Mutant huntingtin (mHTT) associates with mitochondria, resulting in mitochondrial dysfunction and neuronal cell death. However, the underlying molecular mechanisms remain unknown. In this study, we investigate the role of N-terminal first 17 amino acids (N17) of mHTT in regulating its mitochondrial localization. Specifically, we demonstrate that the mutation at leucine 7 of N17 domain suppresses the association of mHTT with mitochondria. Blocking mitochondrial localization of HTT exon 1 with 73 glutamine repeats (HTT-Q73) strongly ameliorates polyglutamine-induced reduction of mitochondrial membrane potential, increase of reactive oxygen species production, and decrease in NAD<sup>+</sup>/NADH ratio. We observe that HTT-Q73-mediated abnormal mitochondrial morphology, mitochondrial DNA deletion, and cell death are abolished by HTT-Q73-L7A mutation. Finally, overexpression of HTT-Q73-L7A do not cause neurodegeneration and motor dysfunction in vivo. These findings highlight the pivotal role of the L7 residue which contributes to mHTT-caused HD pathology. Targeting the L7 residue of N17 domain may be a novel therapeutic strategy to alleviate mitochondrial dysfunction and neurodegeneration in HD.

Also flagged:melanocytic nevimelanomacarcinomacancerGene Expressionnevi
Journal Article 2025-02-11 No Snippets Do HTT, Thangamurugan S, Helms V.
Show Full Abstract

<h4>Summary</h4>We present PPIXpress and PPICompare as two webservers that enable analysis of protein-protein interaction networks (PPINs). Given a reference PPIN and user-uploaded expression data from one or multiple samples, PPIXpress constructs context-dependent PPINs based on major transcripts and high-confidence domain interactions data. To derive a differential PPIN that distinguishes two groups of contextualized PPINs, PPICompare identifies statistically significant altered interactions between multiple context-dependent PPINs from PPIXpress. We present a case study where PPIXpress and PPICompare webservers were used in combination to construct the PPINs specific for melanocytic nevi and primary melanoma cells, and to detect the rewired protein interactions between these two sample types.<h4>Availability and implementation</h4>PPIXpress and PPICompare webservers are available at https://service.bioinformatik.uni-saarland.de/ppi-webserver/index_PPIXpress.jsp and https://service.bioinformatik.uni-saarland.de/ppi-webserver/index_PPICompare.jsp, respectively. Alternatively, the webservers and application updates can be found at https://service.bioinformatik.uni-saarland.de/ppi-webserver/.

Also flagged:Glioblastomabrain tumortranslationalGlioblastoma tumortumorglioblastomas
Journal Article 2025-02-11 No Snippets Stavrakaki E, Belcaid Z, Balvers RK, Vogelezang LB, van den Bossche WBL, Alderliesten D, Lila K, van den Bosch TPP, van Dongen JJM, Debets R, Teodosio C, Dirven CMF, Lamfers MLM.
Show Full Abstract

<b>Background and Objective</b>: Access to high-quality patient-derived brain tumor tissues is instrumental for translational neuro-oncology research. Glioblastoma tumor material resected by ultrasonic aspiration (UA) during surgery offers an abundant source of material; however, it is generally not used for research experiments. We hypothesize that UA-derived tumor tissue represents a source of tissue that accurately reflects the immune infiltrates of glioblastomas. <b>Methods</b>: In this study, we have utilized UA-derived tissue and performed a head-to-head comparison with paired resection tissue from the vital tumor core of the same patient. A combination of 16 fluorochrome-conjugated antibodies was designed to identify tumor-infiltrating T, B, and NK lymphocytes and characterize the TILs by spectral flow cytometry. Furthermore, a 5-plex panel was designed to spatially characterize the T cells, macrophages, and tumor cells on the paired UA and resection tissues. <b>Results</b>: UA-obtained cells exhibited a comparable yield and viability, as well as an abundance of tumor-infiltrating T, B, and NK lymphocytes compared to resection sample-derived cells. Importantly, we observed that there is a high concordance with respect to expression intensities of immune checkpoints by T cells in both types of tissue samples. <b>Conclusions</b>: These findings underscore the feasibility and reliability of utilizing the immune infiltrates from ultrasonic aspiration-acquired glioblastoma tissue.

SOX6
Also flagged:hematoxylinGnRHPPARinsulin resistancemTORAMPK
Journal Article 2025-02-11 ✓ 1 Snippet Wang Z, Yang C, Dong B, Chen A, Song Q, Bai H, Jiang Y, Chang G, Chen G.
In-Text Gene Mentions

…se-related pathways, includingSOX6, Esrrg ,…

Show Full Abstract

Excessive deposition of abdominal fat will cause a waste of resources. In order to explore the key miRNAs and circRNA/lncRNA-miRNA-mRNA ceRNA regulatory network involved in regulating abdominal fat deposition, hematoxylin and eosin (H&E) staining was performed on abdominal fat tissues of ducks in the high abdominal fat rate group (HF) and low abdominal fat rate group (LF) at 21 and 42 days of age, and whole transcriptome sequencing was performed on abdominal tissues of ducks in the HF and LF groups at 42 days of age. The results showed that the number of adipocytes in ducks in the HF group was significantly higher than that in the LF group at 21 days of age (<i>p</i> < 0.001), while the number of adipocytes in ducks in the HF group at 42 days of age was significantly lower than that in the LF group (<i>p</i> < 0.001). In addition, transcriptome sequencing screened out a total of 14 differentially expressed miRNAs (10 miRNAs were significantly up-regulated, and 4 miRNAs were significantly down-regulated). By predicting the target genes of these differentially expressed miRNAs, a total of 305 target genes were obtained. Further analysis of miRNA target genes using GO and KEGG functional enrichment analyses revealed that these target genes were significantly enriched in the GnRH signaling pathway, the PPAR signaling pathway, insulin resistance, the mTOR signaling pathway, the AMPK signaling pathway, the FoxO signaling pathway, and other pathways related to adipose development. In addition, miRNA-205-x, miRNA-6529-x, miRNA-194-x, miRNA-215-x, miRNA-3074-x, miRNA-2954-x, novel-m0133-3p, and novel-m0156-5p were found to be important candidate miRNAs for abdominal fat deposition in ducks. These miRNAs were related to the expression of <i>FOXO3</i>, <i>LIFR</i>, <i>Pdk4</i>, <i>PPARA</i>, <i>FBN1</i>, <i>MYH10</i>, <i>Cd44</i>, <i>PRELP</i>, <i>Esrrg</i>, <i>AKT3</i>, and <i>STC2</i>. Based on these eight candidate miRNAs, a ceRNA regulatory network of circRNA/lncRNA-miRNA-mRNA regulating abdominal fat deposition was successfully constructed. The results of this study will provide a useful reference for accelerating the understanding of the molecular mechanism of duck abdominal fat deposition.

TAOK3
Also flagged:DeferasiroxTAOK1p53Esophageal squamous cell carcinomaESCCiron
Journal Article 2025-02-11 ✓ 4 Snippets Li B, Liu S, Zhou X, Hou D, Jia H, Tang R, Zhang Y, Song M.
In-Text Gene Mentions

…TAOK1, TAOK2, andTAOK3, which act as…

…on TAOK2 andTAOK3of the potential…

…on TAOK2 andTAOK3, an MM-GBSA rescoring…

…for TAOK2 andTAOK3.…

Show Full Abstract

Esophageal squamous cell carcinoma (ESCC) is a highly aggressive malignancy with a poor prognosis and limited effective treatment options. This study investigates the therapeutic potential of Deferasirox (DFO), an iron chelator, in ESCC by targeting TAOK1, an STE20-type kinase implicated in cancer development. We demonstrate that DFO significantly inhibits the proliferation and colony formation of ESCC cells in a dose- and time-dependent manner. Mechanistic investigations reveal that DFO binds directly to TAOK1 and reduces its kinase activity. Proteomics and phosphorylated proteomic sequencing analysis further reveal that TAOK1 knocking down dramatically increased p53-mediated apoptosis. Moreover, the inhibition of TAOK1 by DFO or lenti-virus infection induces apoptosis in ESCC cells, as evidenced by the increased expression of p53, p-p53 (S15), p-p53 (S46), Puma, Noxa, and Bax, and the decreased expression of Bcl-2. Furthermore, in vivo studies using patient-derived xenograft (PDX) mouse models show that DFO treatment significantly reduces tumor volume without observable toxicity. Histological and immunohistochemical analyses confirm the down-regulation of TAOK1 and Ki-67, and the up-regulation of p53 expression in DFO-treated tumors. Our findings suggest that DFO exerts its antitumor effects in ESCC by targeting TAOK1, providing a potential therapeutic strategy for ESCC patients.

SOX6
Also flagged:chronic joint diseaseSRY-related HMG boxSOXtranscription factorspathogenesisOA
Journal Article 2025-02-11 ✓ 1 Snippet Baran K, Brzeziańska-Lasota E, Kryczka J, Boncela J, Czechowska A, Kopacz K, Padula G, Nowak K, Domżalski M.
In-Text Gene Mentions

…SOX-5, along withSOX6, enhances the effects…

Show Full Abstract

<b>Background/Objectives:</b><i>Osteoarthritis</i> (<i>OA</i>) is the most common degenerative and chronic joint disease and is a leading cause of pain and disability in adults worldwide. The SRY-related HMG box (SOX) family transcription factors (TFs) play a crucial role during the pathogenesis of OA; however, their exact mechanisms remain unexplored. The aim of our study was to conduct a bioinformatics analysis of the common interactions of SOX-5, SOX-9, and SOX-11 with other proteins, as well as their role in OA pathogenesis. <b>Methods:</b><i>SOX5</i>, <i>SOX9</i>, and <i>SOX11</i> mRNA expression levels in articular cartilage with subchondral bone and synovium from knee OA patients were assessed using the qPCR method. The study group consisted of thirty-one patients (n = 31). Total RNA was isolated from the articular cartilage with subchondral bone and synovium from the affected and unaffected area of the knee joint. <b>Results:</b> Our results revealed a regulatory network between SOX-5, SOX-9, and SOX-11, and various proteins involved in the pathogenesis of knee OA and their collective interactions, which are involved in the regulation of cartilage extracellular matrix (ECM) organization, response to stimulus, regulation of gene expression, inflammatory response, cartilage condensation, and ossification in chondrocytes. Higher expression levels of <i>SOX5</i>, <i>SOX9</i>, and <i>SOX11</i> mRNA were noted in OA-affected articular cartilage with subchondral bone compared to control tissue (<i>p</i> = 0.00015, <i>p</i> = 0.0024 and <i>p</i> > 0.05, respectively, Mann-Whitney U-test). All studied genes demonstrated elevated mRNA expression levels in the articular cartilage with subchondral bone from stage 4 patients than those with stage 3 (<i>p</i> > 0.05; Mann-Whitney U-test). Lower <i>SOX5</i>, <i>SOX9</i>, and <i>SOX11</i> mRNA expression levels were found in OA-affected synovium compared to the control tissue (<i>p</i> = 0.0003, <i>p</i> > 0.05 and <i>p</i> = 0.0007, respectively, Mann-Whitney U-test). Decreased <i>SOX9</i> mRNA expression levels in synovium were noted in patients with stage 4 disease than those with stage 3; however, <i>SOX5</i> and <i>SOX11</i> mRNA expression levels were higher in patients with stage 4 (<i>p</i> > 0.05; Mann-Whitney U-test). <b>Conclusions:</b> The results of our research show that the studied SOX TFs play a role in the development of OA, contributing to the formation of pathological changes not only in the articular cartilage, but also in the synovial membrane. The changes in the <i>SOX5</i>, <i>SOX9</i>, and <i>SOX11</i> mRNA expression levels in the articular cartilage with subchondral bone and synovium may serve as potential molecular diagnostic biomarkers for detecting OA and could indicate the progression of this disease; however, our observations require further investigation.

Also flagged:Neurodegenerative diseasesextracellulargap junctionsHCsporedeath
Journal Article 2025-02-11 No Snippets Denaro S, D'Aprile S, Vicario N, Parenti R.
Show Full Abstract

Neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD), Multiple Sclerosis (MS), and Huntington's disease (HD), although distinct in their clinical manifestations, share a common hallmark: a disrupted neuroinflammatory environment orchestrated by dysregulation of neuroglial intercellular communication. Neuroglial crosstalk is physiologically ensured by extracellular mediators and by the activity of connexins (Cxs), the forming proteins of gap junctions (Gjs) and hemichannels (HCs), which maintain intracellular and extracellular homeostasis. However, accumulating evidence suggests that Cxs can also act as pathological pore in neuroinflammatory conditions, thereby contributing to neurodegenerative phenomena such as synaptic dysfunction, oxidative stress, and ultimately cell death. This review explores mechanistic insights of Cxs-mediated intercellular communication in the progression of neurodegenerative diseases and discusses the therapeutic potential of targeting Cxs to restore cellular homeostasis.

Also flagged:Sudden Infant Death SyndromeSIDSdeathmucosal infectionsleepingcytokine
Journal Article 2025-02-11 No Snippets Opdal SH, Stray-Pedersen A, Eidahl JML, Vege Å, Ferrante L, Rognum TO.
Show Full Abstract

Sudden Infant Death Syndrome (SIDS) is the sudden and unexpected death of an otherwise healthy infant less than 1 year of age where the cause of death remains unexplained after a thorough post-mortem investigation and evaluation of the circumstances. Epidemiological, clinical, biochemical, immunological and pathological evidence indicates that three factors must coincide for SIDS to occur: a vulnerable developmental stage of the immune system and central nervous system in the infant, predisposing factors, and external trigger events. This model is referred to as the fatal triangle or triple risk hypothesis. The concept of a vicious spiral in SIDS, starting with the fatal triangle and ending in death, is proposed as a model to understand the death mechanism. The vicious spiral is initiated by a mucosal infection and immune activation in the upper respiratory and digestive tracts, increased production of cytokines, and an overstimulation of the immature and rapidly developing immune system. A second trigger is the prone sleeping position, which may lead to rebreathing and hypercapnia, in addition to intensify the immune stimulation. In susceptible infants, this induces an aberrant cytokine production that affects sleep regulation, induces hyperthermia, and disrupts arousal mechanisms. In turn, this initiates downregulation of respiration and hypoxemia, which is worsened by nicotine. Inefficient autoresuscitation results in severe hypoxia and accumulation of hypoxic markers which, if not prevented by a normally functioning serotonergic network, contribute to a self-amplifying vicious spiral that eventually leads to coma and death. The purpose of this review is to summarize the research that underpins the concept of the vicious spiral.

HFE
Also flagged:TumorThrombosishepatocellular carcinomaGene Expressiontranscription factorsTF
Journal Article 2025-02-11 ✓ 1 Snippet Kim JY, Dho SH, Kim LK.
In-Text Gene Mentions

…liver disease (ALD),hemochromatosis, and nonalcoholic fatty…

Show Full Abstract

<b>Background</b>: Portal vein tumor thrombosis (PVTT) is a frequent and serious complication of advanced hepatocellular carcinoma (HCC) that often results in poor prognosis. Although PVTT holds significant clinical relevance, the molecular mechanisms driving its formation are not well understood. Long non-coding RNAs (lncRNAs) have emerged as potential contributors to PVTT progression, prompting this study to explore lncRNAs as potential biomarkers for PVTT. <b>Methods</b>: We analyzed publicly available datasets from the Gene Expression Omnibus to identify differentially expressed lncRNAs and mRNAs across three comparisons: normal vs. HCC, normal vs. PVTT, and HCC vs. PVTT. Transcriptional profiles were characterized, and proteins interacting with HCC- and PVTT-specific lncRNAs were screened using online databases, revealing that all interacting proteins were transcription factors (TFs). We constructed lncRNA-TF-target gene regulatory networks by intersecting TF target genes with differentially expressed genes (DEGs) from each comparison. Protein-protein interaction (PPI) network analysis was performed to identify key clusters and hub genes, with TFs such as AR and ESR1 being highlighted. Gene Ontology analyses were conducted to understand the biological functions of the regulatory networks. <b>Results</b>: The study identified distinct transcriptional profiles for normal, HCC, and PVTT samples. Key regulatory networks, involving lncRNAs, TFs, and target genes, were constructed, and significant hub genes, including AR and ESR1, were identified as potential therapeutic targets. PPI network analysis revealed important clusters associated with PVTT progression, while Gene Ontology analyses provided insights into relevant biological functions. <b>Conclusions</b>: This study presents a novel framework for understanding lncRNA-TF-mediated gene regulation in PVTT. It identifies potential therapeutic targets and prognostic biomarkers that could facilitate the development of targeted therapies for PVTT, offering new opportunities to improve clinical outcomes.

Also flagged:transcription factorTFvisioncapsulefertilizationsex chromosomes
Journal Article 2025-02-10 No Snippets Levins J, Paukszto Ł, Krawczyk K, Maździarz M, Arch BC, Cargill DC, Flores-Sandoval E, Szablińska-Piernik J, Sulima P, Szczecińska M, Kulshrestha S, Davies KM, Sawicki J, Bowman JL.
Show Full Abstract

The genus Riccia is the most speciose of the Marchantiopsida, the complex thalloid liverworts. In contrast to the predicted ancestral liverwort and the majority of extant liverworts that are dioicous, most Riccia species are monoicous. Both the gametophyte and the sporophyte generations have undergone regressive evolution in Riccia, with the sporophyte lacking many adaptations for spore dispersal. Phylogenetic reconstructions suggest multiple transitions between dioicy and monoicy, and vice versa, within the Riccia. We analysed the genomes of two Riccia species and the transcriptomes of two additional Riccia species to explore the evolution of sexual systems and investigate genomic signatures of regressive evolution. Genomic analyses suggest a transition from dioicy to monoicy at the base of the Riccia clade and a subsequent reversion to dioicy with the concomitant evolution of a new sex chromosome, followed by further transitions back to monoicy. Additionally, Riccia species exhibit significant losses of transcription factors known to control aspects of sporophyte and gametophyte development. Comparisons with the monotypic sister genus, Ricciocarpos, suggest independent evolutions to both monoicy and reductive morphologies in the two genera. The reductive morphology has facilitated their colonization of extreme habitats but has perhaps canalized them to remain there.

Also flagged:Agingchronic pulmonary diseasedepressionneurocognitive impairmentchronic diseaseCD4
Journal Article 2025-02-10 No Snippets Ham L, Roesch S, Franklin DR, Ellis RJ, Grant I, Moore DJ.
Show Full Abstract

As the U.S. population of people with HIV (PWH) ages, PWH exhibit high rates of adverse health outcomes including everyday functioning decline. We aimed to (1) identify trajectories of self-reported everyday functioning and (2) examine baseline predictors (demographics, cognitive domains, psychiatric and medical comorbidities, HIV-disease characteristics) of trajectories among PWH. 742 PWH completed up to five semi-annual visits over two years. Latent growth mixture modeling identified a linear 3-class solution with good statistical fit and interpretability. Most PWH (88%) had good baseline functioning with stability. Two classes had elevated baseline functional declines with worsening (7%) or improvement (5%). Greater depressive symptoms and motor skills impairment predicted higher odds of impaired functioning. Having chronic pulmonary disease increased odds of improvement, which may reflect connection to care, while older age increased odds of worsening. Most aging PWH demonstrate stable everyday functioning; however, interventions for depression and motor skills may improve functioning.

SERPINC1
Also flagged:antithrombin deficiencypeptideATAT deficiencysecretionproteasome
Journal Article 2025-02-10 ✓ 1 Snippet Kikuchi Y, Nagaya S, Togashi T, Imai Y, Togashi M, Araiso Y, Nishiuchi T, Morishita E.
In-Text Gene Mentions

…antithrombin (AT) gene (SERPINC1), c.96 T>G, p.Cys32Trp…

Show Full Abstract

<h4>Introduction</h4>We identified a novel variant of the antithrombin (AT) gene (SERPINC1), c.96 T>G, p.Cys32Trp (C32W), located at the signal peptide cleavage site in a patient with congenital AT deficiency. The impact of signal peptide variants on the intracellular trafficking and secretion of AT proteins has not been previously studied. Thus, we analyzed the intracellular dynamics and signal peptide cleavage of the C32W variant of AT (AT-C32W).<h4>Materials and methods</h4>Wild-type AT (AT-WT) and AT-C32W expression vectors were transfected into HEK293 cells. Functional analyses were performed using western blotting and proteasome inhibition experiments. Signal peptide cleavage was evaluated by peptide sequencing.<h4>Results</h4>The AT antigen levels in the cell lysates and culture supernatants of the AT-C32W were reduced to 3.8% and 4.8%, respectively. Following proteasome inhibition, the AT-C32W level increased to 71.5% of that for AT-WT. Peptide sequencing identified a fragment corresponding to the N-terminal end of the signal peptide exclusively in AT-C32W.<h4>Discussion</h4>These results suggest that the signal peptide of AT-C32W is not cleaved properly, which causes intracellular degradation of AT-C32W by proteasomes that results in type I AT deficiency. Further studies on the intracellular dynamics of such variants may clarify the mechanisms underlying AT deficiency.

DCC
Also flagged:HybridizationAPPPS1antibodiesGFAPPSD-95
Journal Article 2025-02-10 ✓ 1 Snippet Yang X, Wang Y, Qiao Y, Lin J, Lau JKY, Fu WY, Fu AKY, Ip NY.
In-Text Gene Mentions

…the netrin receptorDcc, the microsomal…

Show Full Abstract

Cell surface receptors, including erythropoietin-producing hepatocellular A4 (EphA4), are important in regulating hippocampal synapse loss, which is the key driver of memory decline in Alzheimer's disease (AD). However, the cell-specific roles and mechanisms of EphA4 are unclear. Here, we show that EphA4 expression is elevated in hippocampal CA1 astrocytes in AD conditions. Specific knockout of astrocytic EphA4 ameliorates excitatory synapse loss in the hippocampus in AD transgenic mouse models. Single-nucleus RNA sequencing analysis revealed that EphA4 inhibition specifically decreases a reactive astrocyte subpopulation with enriched complement signaling, which is associated with synapse elimination by astrocytes in AD. Importantly, astrocytic EphA4 knockout in an AD transgenic mouse model decreases complement tagging on excitatory synapses and excitatory synapses within astrocytes. These findings suggest an important role of EphA4 in the astrocyte-mediated elimination of excitatory synapses in AD and highlight the crucial role of astrocytes in hippocampal synapse maintenance in AD.

HFE
Also flagged:β-thalassemiablood disorderβ-globinanemiaironinfertility
Journal Article 2025-02-10 ✓ 1 Snippet Aiemongkot S, Ruschadaariyachat S, Changsangfa C, Nuamsee K, Viwatpinyo K, Chaichompoo P, Svasti S, Buranaamnuay K.
In-Text Gene Mentions

…study were inducedhemochromatosisto simulate BT…

Show Full Abstract

Heterozygous β-globin gene knockout thalassemia (BKO) mice derived from C57BL/6 wild-type (WT) mice have phenotypic of β-thalassemia (BT) and have been widely used for studying this disease except reproductive disorders. The present study determined whether male BKO mice recapitulate reproductive problems as BT men. Mice were randomly assigned into groups depending on the genotype (WT vs. BKO) and intervention (control vs. iron-loaded). Euthanized mice were collected blood, testes, epididymides, hypothalamus, and anterior pituitary for assessing hematological parameters, plasma iron and testosterone levels, testis iron levels, sperm characteristics, and histological alterations. Iron administration caused significant increases of plasma and testis iron levels (p < 0.001) but had no significant influence on the hematological profile of BKO mice, which indeed had fewer erythrocyte, hemoglobin, and hematocrit but had greater reticulocyte than WT (p < 0.001 to p = 0.017). Furthermore, irrespective of the genotype, iron administration decreased plasma testosterone levels (p = 0.03 to p > 0.05), total sperm count (p < 0.001), and percent normal sperm morphology (p ≤ 0.01). Based on Perls' Prussian blue staining, excess iron was ubiquitously present in the anterior pituitary and testicular interstitium of iron-loaded mice. This mineral, however, caused no significant changes in reproductive organs microstructure as visualized by hematoxylin and eosin staining. In conclusion, besides physiological dysfunction of many organ systems, iron-loaded male BKO mice exhibit reproductive problems and abnormal sperm characteristics similar to BT men. Therefore, this animal model seems invaluable for future biomedical research involved in various aspects of BT-related male reproductive disorders.

Also flagged:Sigma-2 receptordry age-related macular degenerationRPE atrophygeographic atrophyGApathogenesis
Journal Article 2025-02-10 No Snippets Lizama BN, Keeling E, Cho E, Malagise EM, Knezovich N, Waybright L, Watto E, Look G, Di Caro V, Caggiano AO, Ratnayaka JA, Hamby ME.
Show Full Abstract

Trafficking defects in retinal pigmented epithelial (RPE) cells contribute to RPE atrophy, a hallmark of geographic atrophy (GA) in dry age-related macular degeneration (AMD). Dry AMD pathogenesis is multifactorial, including amyloid-β (Aβ) accumulation and oxidative stress-common features of Alzheimer's disease (AD). The Sigma-2 receptor (S2R) regulates lipid and protein trafficking, and S2R modulators reverse trafficking deficits in neurodegeneration in vitro models. Given overlapping mechanisms contributing to AD and AMD, S2R modulator effects on RPE function were investigated. The S2R modulator CT1812 is in clinical trials for AD, dementia with Lewy bodies, and GA. Leveraging AD trials testing CT1812, unbiased analyses of patient biofluid proteomes revealed that proteins altered by CT1812 associated with GA and macular degeneration disease ontologies and overlapped with proteins altered in dry AMD. Differential expression analysis of RPE transcripts from APP-Swedish/London mutant transgenic mice, a model featuring Aβ accumulation, revealed reversal of autophagy/trafficking transcripts in S2R modulator-treated animals versus vehicle toward healthy control levels. Photoreceptor outer segment (POS) trafficking in human RPE cells showed deficits in response to Aβ<sub>1-42</sub> or hydrogen peroxide compared to vehicle. S2R modulators normalized stressor-induced POS trafficking deficits, resembling healthy control. Taken together, S2R modulation may provide a novel therapeutic strategy for dry AMD.

HTT
Also flagged:lipidCRISPRCas9ribonucleoproteintropismGFP
Journal Article 2025-02-10 ✓ 5 Snippets Ling S, Zhang X, Dai Y, Jiang Z, Zhou X, Lu S, Qian X, Liu J, Selfjord N, Satir TM, Lundin A, Touza JL, Firth M, Van Zuydam N, Bilican B, Akcakaya P, Hong J, Cai Y.
In-Text Gene Mentions

…the WT mouseHttgene (RIDE-Htt) and…

…mouse Htt gene (RIDE-Htt) and a lentiviral…

…encoding viral cassette (RIDE-Htt-GFP) was injected into…

…, Distribution of RIDE-Htt-GFP in the mouse…

…the loss ofHTTexpression in the…

Show Full Abstract

In vivo CRISPR gene editing holds enormous potential for various diseases. Ideally, CRISPR delivery should be cell type-specific and time-restricted for optimal efficacy and safety, but customizable methods are lacking. Here we develop a cell-tropism programmable CRISPR-Cas9 ribonucleoprotein delivery system (RIDE) based on virus-like particles. The efficiency of RIDE was comparable to that of adeno-associated virus and lentiviral vectors and higher than lipid nanoparticles. RIDE could be readily reprogrammed to target dendritic cells, T cells and neurons, and significantly ameliorated the disease symptoms in both ocular neovascular and Huntington's disease models via cell-specific gene editing. In addition, RIDE could efficiently edit the huntingtin gene in patients' induced pluripotent stem cell-derived neurons and was tolerated in non-human primates. This study is expected to facilitate the development of in vivo CRISPR therapeutics.

Also flagged:Alcoholimmunodeficiency virusHIV) infection-associated neurocognitive disorderHANDalcohol use disorder
Journal Article 2025-02-10 No Snippets Fitzpatrick-Schmidt T, Mansouri A, Adamec J, Klein J, Coleman L, Edwards KN, Simon L, Molina PE, Salling MC, Edwards S.
Show Full Abstract

Human immunodeficiency virus (HIV) infection produces neurological comorbidities including HIV-associated neurocognitive disorder (HAND) and chronic pain. HIV also increases the risk of developing an alcohol use disorder (AUD). With the rising prevalence of AUD in women and people with HIV (PWH), understanding the neurobiological impact of alcohol in these populations is important. We examined proteomic alterations in the hippocampus and anterior cingulate cortex (ACC), brain regions critical for cognition and affective pain, in a female rhesus macaque model of chronic binge alcohol administration and SIV infection. Adult female rhesus macaques received either chronic binge alcohol (CBA, 13-14 g/kg/week of alcohol) or water (VEH) via gastric catheter. All animals were inoculated with simian immunodeficiency virus (SIV<sub>mac251</sub>) and treated with antiretroviral therapy (ART). Brain samples were processed for proteomic analysis, and quantitative discovery-based proteomics identified differentially expressed proteins in both brain regions comparing CBA treatment to VEH. Ingenuity Pathway Analysis (IPA) was also used to predict pathway activation. CBA significantly altered 147 proteins in the hippocampus and 176 proteins in the ACC. IPA revealed alterations in 39 canonical pathways in the hippocampus and 62 canonical pathways in the ACC. Fourteen common canonical pathways were enriched in both regions, including synaptogenesis and protein kinase A (PKA) signaling. These discoveries expand our understanding of how alcohol alters proteins of critical signaling pathways in vulnerable brain regions in the context of SIV/HIV infection and may lead to the development of new pharmacological treatment avenues for neurological dysfunction in women with HIV who use alcohol.

DCC
Also flagged:pulmonary hypertensionPHmonocrotalinepathogenesiscalciumMCT
Journal Article 2025-02-10 ✓ 2 Snippets Fu G, Qiu L, Wang J, Li S, Tian J, Wu J, Lin X, Zhu Y, Liu Z, Luo L, Wang K, Zhao F, Kuang J, Liang S, Liang S, Guo Y, Hong Y, Yi Y, Huang J, Niu Y, Kang K, Gou D.
In-Text Gene Mentions

…by CIRI2 andDCCacross all groups…

…by CIRI2 andDCCsoftware (Fig. 6…

Show Full Abstract

<h4>Background</h4>Pulmonary hypertension (PH) is a devastating disease marked by elevated pulmonary artery pressure, resulting in right ventricular (RV) failure and mortality. Despite the identification of several dysregulated genes in PH, the involvement of circular RNAs (circRNAs), a subset of long noncoding RNAs, remains largely unknown.<h4>Methods</h4>In this study, high-throughput RNA sequencing was performed to analyze the genome-wide expression patterns of circRNAs in pulmonary arteries from three models of PH rats induced by hypoxia (Hyp), hypoxia/Sugen5416 (HySu), and monocrotaline (MCT). Differentially expressed circRNAs (DEcircRNAs) were identified, and a weighted gene coexpression network was constructed to explore circRNA networks associated with PH pathogenesis. A circRNA-miRNA-mRNA regulatory network was built, and the functional significance of targeted mRNAs was evaluated. Single-cell RNA sequencing provided insights into the distribution of cell type-specific circRNAs across PH progression.<h4>Results</h4>Our analysis revealed 45 circRNAs exhibiting significant changes across all three PH rat models, with their host genes participating in the calcium signaling and muscle contraction. We identified 372 PH-related circRNA-miRNA-mRNA interactions, shedding light on the regulatory networks during PH development. Furthermore, we uncovered 186, 195 and 311 Hyp-, Hysu- and MCT-specific circRNAs, respectively. These circRNAs were enriched in distinct biological processes, emphasizing their unique regulatory roles. Single-cell spatial distribution analysis of these circRNAs in the pulmonary arteries of PH patients revealed that Hyp-specific circRNA predominantly appeared in the pulmonary vascular structural cells, while HySu- and MCT-specific circRNAs exhibited broader distribution, including significant enrichment in immune-related cells.<h4>Conclusion</h4>Our study presents the first comprehensive view of circRNA regulatory networks in the pulmonary arteries of three PH rat models. We provide insights into PH-associated circRNAs, particularly their involvement in calcium signaling and muscle contraction.

Also flagged:dinitroimidazoleazidethiolaminealkynecyclooctyne
Journal Article 2025-02-10 No Snippets Luo Q, Liu S, Hua Y, Long C, Lv S, Li J, Zhang Y.
Show Full Abstract

Dinitroimidazole (DNIm) was recently identified as a powerful bioconjugation agent that could selectively modify thiol over amine on biomolecules at an ultrahigh speed in an aqueous buffer. However, its derivative containing a DNIm module and a terminal alkyne module failed to construct functional agents bearing a DNIm warhead <i>via</i> the CuAAC reaction. To solve this problem, a heterobifunctional cross-linker was designed and synthesized by linking a DNIm module with an azide module <i>via</i> an oxoaliphatic amido bond spacer arm. Its two modules, DNIm and azide, reacted with a thiol and cyclooctyne, respectively, in an orthogonal way. The cross-linker facilitated the preparation of various functional agents bearing a DNIm warhead <i>via</i> SPAAC reaction and was further applied to protein functionalization (including biotinylation and fluorescence labeling) and oligonucleotide functionalization (including PEGylation, oligonucleotide-peptide and oligonucleotide-protein conjugate). Thus, the cross-linker not only provided convenient access to those functional agents bearing a DNIm warhead but also combined DNIm chemistry with click chemistry of SPAAC to enlarge their respective application range in the bioconjugation field.

ZNF311
Also flagged:COVID-19infectious diseasescoronavirus diseasedeathinfectionscorticosteroids
Journal Article 2025-02-10 ✓ 1 Snippet Ying H, Wu X, Jia X, Yang Q, Liu H, Zhao H, Chen Z, Xu M, Wang T, Li M, Zhao Z, Zheng R, Wang S, Lin H, Xu Y, Lu J, Wang W, Ning G, Zheng J, Bi Y.
In-Text Gene Mentions

…of NBEAL2 andZNF311were exclusively identified…

Show Full Abstract

<h4>Background</h4>COVID-19 continues to show long-term impacts on our health. Limited effective immune-mediated antiviral drugs have been launched.<h4>Methods</h4>We conducted a Mendelian randomization (MR) and colocalization analysis using 26,597 single-cell expression quantitative trait loci (sc-eQTL) to proxy effects of expressions of 16,597 genes in 14 peripheral blood immune cells and tested them against four COVID-19 outcomes from COVID-19 Genetic Housing Initiative GWAS meta-analysis Round 7. We also carried out additional validations including colocalization, linkage disequilibrium check and host-pathogen interactome predictions. We integrated MR findings with clinical trial evidence from several drug gene related databases to identify drugs with repurposing potential. Finally, we developed a tier system and identified immune-cell-based prioritized drug targets for COVID-19.<h4>Findings</h4>We identified 132 putative causal genes in 14 immune cells (343 MR associations) for COVID-19, with 58 genes that were not reported previously. 145 (73%) gene-COVID-19 pairs showed effects on COVID-19 in only one immune cell type, which implied widespread immune-cell specific effects. For pathway analyses, we found the putative causal genes were enriched in natural killer (NK) recruiting cells but de-enriched in NK cells. Using a deep learning model, we found 107 (81%) of the putative causal genes (41 novel genes) were predicted to interact with SARS-COV-2 proteins. Integrating the above evidence with drug trial information, we developed a tier system and prioritized 37 drug targets for COVID-19.<h4>Interpretation</h4>Our study showcased the central role of immune-mediated regulatory mechanisms for COVID-19 and prioritized drug targets that might inform interventions for viral infectious diseases.<h4>Funding</h4>This work was supported by grants from the National Key Research and Development Program of China (2022YFC2505203).

Also flagged:transcription factorsProstate cancerandrogenandrogen receptorARcastration-
Journal Article 2025-02-10 No Snippets Lee J, Lee Y.
Show Full Abstract

Prostate cancer is one of the most common malignancies in men, with most cases initially responding to androgen deprivation therapy. However, a significant number of patients eventually develop castration-resistant prostate cancer, an aggressive form of the disease. Although androgen receptor (AR) pathway inhibitors target AR signaling, and have extended survival in patients with castration-resistant prostate cancer, prolonged treatment can lead to the emergence of neuroendocrine prostate cancer (NEPC), a lethal subtype characterized by the expression of neuroendocrine markers and reduced AR activity. The transition from adenocarcinoma to NEPC is driven by lineage plasticity, wherein cancer cells adopt a neuroendocrine phenotype to evade treatment. Consequently, NEPC patients face poor clinical outcomes and limited effective treatment options. To improve outcomes, it is crucial to understand the molecular mechanisms driving NEPC development. In this review, we highlight the role of transcription factors in this process and explore their potential as therapeutic targets.

OLFM4
Also flagged:colitiswaterintestinal diseasesmucusjunctionglycocalyx
Journal Article 2025-02-10 ✓ 1 Snippet Zolotova N, Dzhalilova D, Tsvetkov I, Silina M, Fokichev N, Makarova O.
In-Text Gene Mentions

…Lgr5, Bmi1 andOlfm4, and the…

Show Full Abstract

<h4>Background</h4>Taking into account the global spread of microplastic (MP) pollution, the problem of the MP impact on human health is relevant. MP enters the organism predominantly with water and food, and is mostly detected in the large intestine. Therefore, the connection between MP pollution and the increase in colitis is an important question. In order to assess the toxic and pathogenetic effects of MP, experimental studies were actively conducted during recent years, mainly on laboratory mice.<h4>Objectives</h4>The aim of our review was to summarize and systematize the data on the MP effect on mice colon under normal conditions and during colitis in order to assess the role of MP in the development of intestinal diseases. This manuscript could be relevant for ecologists, experimental biologists, and physicians dealing with problems related to anthropogenic environmental changes and inflammatory bowel diseases.<h4>Survey methodology</h4>The search was conducted based on PubMed data about original experimental studies of the MP effects on the colon of healthy mice and mice with colitis.<h4>Results</h4>In healthy mice colon, MP can cause oxidative stress, increased permeability, immune cell infiltration, production of proinflammatory factors, and decreased mucus production. MP affects proliferation, apoptosis, and differentiation of epithelial cells, expression of tight junction components and glycocalyx, membrane transport, signaling pathways, metabolome, and intestinal microflora composition. In mice with acute and chronic experimental colitis, MP consumption leads to a more pronounced pathological process course.<h4>Conclusions</h4>MP may be one of the factors contributing to the development of colitis in humans. However, further research is needed.

PEBP1
Also flagged:epidermal growth factor receptorEGFRmesenchymal epithelial transition factorc-Metvascular endothelial growth factor AVEGF-A
Journal Article 2025-02-10 ✓ 2 Snippets Jin Y, Chen P, Zhou H, Mu G, Wu S, Zha Z, Ma B, Han C, Chiu ML.
In-Text Gene Mentions

…( PTK2 ,PEBP1and PPP1CC )…

…protein 1 (gene:PEBP1) ( 49…

Show Full Abstract

<h4>Introduction</h4>TAVO412, a multi-specific antibody targeting epidermal growth factor receptor (EGFR), mesenchymal epithelial transition factor (c-Met), and vascular endothelial growth factor A (VEGF-A), is undergoing clinical development for the treatment of solid tumors. TAVO412 has multiple mechanisms of action for tumor growth inhibition that include shutting down the EGFR, c-Met, and VEGF signaling pathways, having enhanced Fc effector functions, addressing drug resistance that can be mediated by the crosstalk amongst these three targets, as well as inhibiting angiogenesis. TAVO412 demonstrated strong <i>in vivo</i> tumor growth inhibition in 23 cell-line derived xenograft (CDX) models representing diverse cancer types, as well as in 9 patient-derived xenograft (PDX) lung tumor models.<h4>Methods</h4>Using preclinical CDX data, we established transcriptomic biomarkers based on gene expression profiles that were correlated with anti-tumor response or distinguished between responders and non-responders. Together with specific driver mutation that associated with efficacy and the targets of TAVO412, a set of 21-gene biomarker was identified to predict the efficacy. A biomarker predictor was formulated based on the Linear Prediction Score (LPS) to estimate the probability of patients or tumor model response to TAVO412 treatment.<h4>Results</h4>This efficacy predictor for TAVO412 demonstrated 78% accuracy in the CDX training models. The biomarker model was further validated in the PDX data set and resulted in comparable accuracy.<h4>Conclusions</h4>In implementing precision medicine by leveraging preclinical model data, a predictive transcriptomic biomarker empowered by next-generation sequencing was identified that could optimize the selection of patients that may benefit most from TAVO412 treatment.

HFE
Also flagged:X-linked sideroblastic anemiaXLSAsideroblastic anemiaironmitochondriaheme
Journal Article 2025-02-10 ✓ 1 Snippet Al Kindi S, Al-Mamari A, Al-Zadjali S, Al-Rawahi M, Al Madhani A, Pathare AV.
In-Text Gene Mentions

…mutations in theHFEgene may also…

Show Full Abstract

X-linked sideroblastic anemia (XLSA) (MIM 300752) is the most common genetic form of sideroblastic anemia, a heterogeneous group of disorders characterized by iron deposits in the mitochondria of erythroid precursors. It is due to mutations of the erythroid-specific enzyme <i>ALAS2</i>, the first enzyme of the heme biosynthetic pathway. Herein, we report a novel 11-bp deletion in exon 11 leading to a frameshift in the C-terminal region of the <i>ALAS2</i> gene with a non-functional longer polypeptide of 614 amino acids leading to a loss-of-function mutation manifested as an X-linked sideroblastic anemia phenotype. The proband was a 29-year-old man with moderately severe microcytic hypochromic anemia with splenomegaly and increased ring sideroblasts in the bone marrow with considerable iron overload. Sanger sequencing documented a missense mutation leading to a frameshift with an elongated polypeptide of 614 AA instead of the normal 587 AA protein c.1743_1753 del (p.Gln581Hisfs*35). This mutation affected the interaction with cofactor pyridoxal 5'-phosphate since the patient's hemoglobin improved with oral administration of pyridoxine tablets. His iron overload also responded to sustained oral iron chelation therapy with deferasirox. The screening of the entire family's kindred revealed that two other male siblings were also hemizygous for the same mutation with hypochromic microcytic anemia and tissue iron overload, whereas, three female siblings and their mother were heterozygous for the mutant allele. They did not have anemia or iron overload.

Also flagged:Myeloid sarcomaMSextramedullary acute myeloid leukaemia tumourhematopoietic neoplasmacute myeloid leukaemiaAML
Journal Article 2025-02-10 No Snippets Patkowska E, Krzywdzinska A, Solarska I, Wojtas M, Prochorec-Sobieszek M.
Show Full Abstract

Myeloid sarcoma (MS), or extramedullary acute myeloid leukaemia tumour (eAML), is a rare hematopoietic neoplasm. Recognised as a distinct entity within acute myeloid leukaemia (AML), MS presents significant diagnostic challenges due to its rarity, clinical heterogeneity, and variable immunophenotypic and genetic characteristics. The mechanisms by which leukaemic stem cells (LSCs) migrate to form solid tumours in extramedullary (EM) sites remain unclear. MS can occur de novo, precede AML, and manifest alongside AML relapse. It can also develop with myelodysplastic syndromes (MDSs) or myeloproliferative neoplasms (MPNs). MS frequently presents in organs such as the skin, lymph nodes, gastrointestinal (GI) tract, and central nervous system (CNS), often resulting in diverse clinical manifestations. Diagnosis relies on a comprehensive approach, including tissue biopsy, bone marrow (BM) evaluation, and advanced imaging modalities. Accurate diagnosis is crucial for risk stratification and treatment selection. Prognosis is influenced by several factors: MS's anatomical location, timing of MS diagnosis, genetic profile, and possible treatment. This review emphasises the need for comprehensive diagnostic methods to better define individual MS characteristics and prognosis. It explores the role of novel targeted therapies in improving patient outcomes and further highlights the critical need for future multicentre data collection to optimise diagnostic and therapeutic approaches.

HFE
Also flagged:Diabetes MellitusLiver Diseaseschronic liver diseasesdiabetesNonalcoholic fatty liver diseaseNAFLD
Journal Article 2025-02-10 ✓ 1 Snippet Mahmoud MR, Ibrahim S, Shahien MM, Alshammari AD, Alenazi FS, Alreshidi F, Aljadani A, Abdel Khalik A, Elhaj AH, Khalifa AM, Alreshidi HF, El-Horany HE, Said KB, Abdallah MH, Metwaly AA.
In-Text Gene Mentions

…causes chronic HCV,hemochromatosis, and hepatic autoimmune…

Show Full Abstract

<b>Background</b>: The risk of dying from chronic liver diseases (CLDs) is two to three times higher for patients with diabetes (DM). Nonalcoholic fatty liver disease (NAFLD) is the primary cause of this increased risk, which has an etiology unrelated to alcohol or viruses. Previous research reported that diabetes and CLD are related, since they influence each other. <b>Aim</b>: Estimation of the impact of diabetes (DM) on liver diseases (LD), and of the impact of liver diseases on DM among Egyptian and Saudi patients. It is a descriptive and prospective analytical study design. The investigation was carried out in Saudi Arabia and Egypt at gastroenterology outpatient clinics. <b>Methods</b>: Prospective data were collected through face-to-face patient interviews during clinic visits between June 2021 and June 2023. The interviews covered the patients' basic characteristics and information on DM and LD. Certain laboratory tests were conducted on these patients, such as liver function, glucose level, lipid profile, INR, and prothrombin time. <b>Results</b>: The total of 2748 participants in this study included 1242 diabetic patients of both genders from Saudi Arabia and 1506 from Egypt. Most Saudis had between 10 and 20 years' duration of DM (35.5%), with HbA1c (7-10%) values of 47.8%, while the Egyptian patients had >20 years' duration of DM (39.8%), with HbA1c (7-10%) values of 49.8%. Regarding the impact of DM on the development of liver diseases, about 35.5% (Saudis) vs. 23.5% (Egyptians) had liver diseases due to DM, a significant difference (<i>p</i>-value = 0.011). Liver enzymes were increased in many of the Egyptian and Saudi patients (41.4% vs. 33%), while the presence of fatty liver (28.2% vs. 35.7%) and hepatocellular carcinoma (13.7% vs. 6.1%) were also significantly different (<i>p</i>-value = 0.047). While the impact of liver diseases on DM was observed more among Egyptian (59%) than among Saudi (46.4%) patients because of liver cirrhosis (HCV or HBV), known to be a reason for diabetes in Egyptians (27.9%) vs. Saudis (8.0%), a higher incidence of fatty liver leading to DM was observed in Saudis than in Egyptians (15.9% vs. 11.6%) (<i>p</i>-value = 0.000. Obesity was more prevalent among Saudi patients (63.8%) than among Egyptian patients (48.6%) (<i>p</i>-value = 0.019). Fewer Egyptians (about 65%) suffered from dyslipidemia than Saudis (about 80%). Higher INR and longer prothrombin times were observed in Egyptians (29.9% and 29.1%, respectively) than in Saudis (20.3% and 18.8%, respectively), with a significant difference between the two nations (<i>p</i>-value < 0.050). <b>Conclusions</b>: We may conclude that diabetes in most patients has a negative impact on the development of liver diseases (particularly fatty liver in Saudi patients). In addition, most liver diseases (liver cirrhosis) have a negative influence on the development of DM (more so in Egyptian patients). There is a link between DM and liver disease. In particular, liver cirrhosis and diabetes were found to influence each other. Therefore, correct medication, adherence to treatment, lifestyle modifications, successful cirrhosis control (in patients with liver diseases), and diabetic control (in diabetic patients) could lead to effective management of both diseases. The negative fallouts in the two cases were prompted by obesity, morbid eating, and poor quality of life.

Also flagged:cancerlipidoxygenmetabolismfatty acidsynthesis
Journal Article 2025-02-10 No Snippets Li S, Yuan H, Li L, Li Q, Lin P, Li K.
Show Full Abstract

Oxidative stress is a common event involved in cancer pathophysiology, frequently accompanied by unique lipid metabolic reprogramming phenomena. Oxidative stress is caused mainly by an imbalance between the production of reactive oxygen species (ROS) and the antioxidant system in cancer cells. Emerging evidence has reported that oxidative stress regulates the expression and activity of lipid metabolism-related enzymes, leading to the alteration of cellular lipid metabolism; this involves a significant increase in fatty acid synthesis and a shift in the way in which lipids are taken up and utilized. The dysregulation of lipid metabolism provides abundant intermediates to synthesize biological macromolecules for the rapid proliferation of cancer cells; moreover, it contributes to the maintenance of intracellular redox homeostasis by producing a variety of reducing agents. Moreover, lipid derivatives and metabolites play critical roles in signal transduction within cancer cells and in the tumor microenvironment that evades immune destruction and facilitates tumor invasion and metastasis. These findings suggest a close relationship between oxidative stress and lipid metabolism during the malignant progression of cancers. This review focuses on the crosstalk between the redox system and lipid metabolic reprogramming, which provides an in-depth insight into the modulation of ROS on lipid metabolic reprogramming in cancers and discusses potential strategies for targeting lipid metabolism for cancer therapy.

Also flagged:Acute lymphoblastic leukemiaALLpediatric cancerblood cancerB-cell ALLAcute B-Cell Lymphoblastic Leukemia
Journal Article 2025-02-10 No Snippets Vllahu M, Savarese M, Cantiello I, Munno C, Sarcina R, Stellato P, Leone O, Alfieri M.
Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer, comprising almost 25% of all malignancies diagnosed in children younger than 20 years, and its incidence is still increasing. ALL is a blood cancer arising from the unregulated proliferation of clonal lymphoid progenitor cells. To make a diagnosis of B-cell ALL, bone marrow morphology and immunophenotyping are needed; cerebrospinal fluid examination, and chromosomal analysis are currently used as stratification exams. Currently, almost 70% of children affected by B-cell ALL are characterized by well-known cytogenetic abnormalities. However, the integration of results with "omic" techniques (genomics, transcriptomics, proteomics, and metabolomics, both individually and integrated) able to analyze simultaneously thousands of molecules, has enabled a deeper definition of the molecular scenario of B-cell ALL and the identification of new genetic alterations. Studies based on omics have greatly deepened our knowledge of ALL, expanding the horizon from the traditional morphologic and cytogenetic point of view. In this review, we focus our attention on the "omic" approaches mainly used to improve the understanding and management of B-cell ALL, crucial for the diagnosis, prognosis, and treatment of the disease, offering a pathway toward more precise and personalized therapeutic interventions.

DCC
Also flagged:VHLcancersHypoxia-inducible factors 1 and 2 alphasvascular endothelial growth factorcancerrectal cancer
Journal Article 2025-02-10 ✓ 1 Snippet Moon SW, Lee JC, Lee JH, Kim TY, Park JH.
In-Text Gene Mentions

…APC, MMR, K-ras,DCC, and p53 genes…

Show Full Abstract

<i>Background and Objectives</i>: Von Hippel-Lindau (VHL) disease is caused by mutations in the VHL gene and can develop various cancers. Hypoxia-inducible factors 1 and 2 alphas, regulated by the VHL gene, can increase the levels of vascular endothelial growth factor, thereby activating cancer progression. Here, we demonstrated clinical and prognostic values of VHL expression in rectal cancer (RC). <i>Materials and Methods</i>: Von Hippel-Lindau mRNA expression was examined in 60 patients with RC. Furthermore, we evaluated survival to determine the prognostic significance of VHL mRNA expression levels in RC using the Cancer Genome Atlas (TCGA) data. <i>Results</i>: Lower VHL expression was correlated with the recurrence (<i>p</i> = 0.058) and lymphatic invasion (<i>p</i> = 0.078), although it was not statistically significant. In TCGA data, VHL expression level was correlated with the M stage (<i>p</i> = 0.044); however, it had a possible association with lymphatic invasion (<i>p</i> = 0.068) and N stage (<i>p</i> = 0.104). Survival analysis showed that lower VHL gene expression predicted poorer survival in both patients with RC and TCGA data. <i>Conclusions</i>: This study identified a significant correlation between VHL gene expression and RC for the first time using patient tissues and TCGA data, suggesting that the VHL gene expression level could be a potential biomarker or candidate for the treatment of RC. Further studies are required to identify the molecular pathogenesis and clinical characteristics of VHL disease in RC.

Also flagged:immune responseinfectious diseasesreverse transcriptionLSDV infectionpathogenesisLumpy Skin Disease
Journal Article 2025-02-10 No Snippets Truong AD, Tran HTT, Phan L, Phan TH, Chu NT, Vu TH, Nguyen HM, Nguyen LP, Kim C, Dang HV, Hong YH.
Show Full Abstract

Exosomal miRNAs from individual cells are crucial in regulating the immune response to infectious diseases. In this study, we performed small RNA sequencing (small RNA-seq) analysis to identify the expressed and associated exosomal miRNAs in the serum of cattle infected with lumpy skin disease virus (LSDV). Cattle were infected with a 10<sup>6.5</sup> TCID50/mL LSDV Vietnam/HaTinh/CX01 (HT10) strain and exosomal miRNA expression in the serum of infected cattle was analyzed using small RNA sequencing (small RNA-seq). We identified 59 differentially expressed (DE) miRNAs in LSDV-infected cattle compared to uninfected controls, including 18 upregulated and 41 downregulated miRNAs. These 59 miRNAs were used to predict 7656 target genes. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the target genes were enriched in several biological processes and pathways associated with viral replication, immune response, virus-host interactions, and signal transduction. Additionally, we identified 708 potentially novel cattle miRNAs corresponding to 710 genomic loci. The transcription levels of five miRNA genes (bta-miR-11985, bta-miR-1281, bta-miR-12034, bta-miR-let-7i, and bta-miR-17-5p) were validated using reverse transcription quantitative real-time PCR, showing consistency with the small RNA-seq results. Overall, these findings provide significant insights into the immune and protective responses during LSDV infection in cattle, offering valuable information on identifying new biomarkers and understanding the pathogenesis of LSDV.

Also flagged:metal ionstumoroligonucleotideCancerdeathimmune responses
Journal Article 2025-02-10 No Snippets Yang N, He Z, Lang T.
Show Full Abstract

Metal-organic frameworks (MOFs) are a class of inorganic-organic hybrid nanoparticles formed by the coordination of metal ions/clusters and organic ligands. Due to their high porosities, large surface areas, adjustable structures, and responsiveness to light/sound, etc., MOFs have shown great clinical potential in the field of tumor therapy. Tumor immunotherapy exerts antitumor effects through reshaping tumor immune microenvironment, showing significant preclinical and clinical advantages. Based on the mechanisms of immunity activation, the tumor immunotherapy agents can be divided into chemotherapeutic agents, immunomodulators, enzymes, tumor vaccines and oligonucleotide drugs, etc. Herein, we review the MOFs-based drug delivery systems for tumor immunotherapy. The classification of MOFs, followed by their antitumor immunity activation mechanisms, are first introduced. Drug delivery systems based on MOFs with different immunotherapy agents are also summarized, especially the synergetic immunity activation mechanisms triggered by MOFs and their loadings. Furthermore, the merits and drawbacks of MOFs and the potential strategies for MOFs to promote their clinical applications are discussed.

Also flagged:Melanomaskin cancerTumorsolid tumorsoxadiazolecyclohexyl
Journal Article 2025-02-10 No Snippets Araújo HM, Moura GA, Rocha YM, Pinheiro Gomes CV, Melo de Oliveira VNE, Oliveira RN, Figueiredo Nicolete LD, Magalhães EP, de Menezes RRPPB, Nicolete R.
Show Full Abstract

Melanoma is the most aggressive and lethal type of skin cancer, responsible for approximately 60,000 deaths annually. The main strategy for treating melanoma is surgery to completely remove the lesion and its margins. However, for more advanced cases with a high recurrence rate, the preferred approach is to combine chemotherapy with immunotherapy treatments. Tumor-associated macrophages (TAMs) are the most abundant leukocytes in solid tumors. Current immunotherapy approaches target TAMs by inhibiting pro-tumoral TAMs and activating anti-tumoral TAMs, repolarizing them to the M1 phenotype. The antitumor and immunomodulatory activities of molecules derived from 1,2,4-oxadiazole, as demonstrated in the literature, highlight the potential of this class as a source of promising candidates for therapeutic applications. Thus, the present study aims to evaluate the antitumor and immunomodulatory effects of the synthetic derivative 1,2,4-oxadiazole, N-cyclohexyl-3-(3-methylphenyl)-1,2,4-oxadiazole-5-amine (1,2,4-oxadiazole derivative 2), in melanoma cells and murine Bone Marrow-Derived Macrophages (BMDMs). Cytotoxicity in B16-F10 and BMDMs cells was assessed using the (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) MTT method. 1,2,4-oxadiazole derivative 2 exhibited antiproliferative effects on both cell lines, being 2.6 times more selective for B16-F10. Necrosis was identified as the active induced death pathway. BMDMs isolated and exposed to 1,2,4-oxadiazole derivative 2 polarize to the M1 phenotype and induce TNF-α at a concentration of 64.34 μM. Exposure to melanoma murine supernatants also promotes M1 polarization. Supernatants containing traces of 1,2,4-oxadiazole derivative 2 (Supernatants B, C, and D) increased the percentage of M1 cells compared to Supernatant A, as well as elevated levels of nitrite, TNF-α, and IL-12. 1,2,4-oxadiazole derivative 2 combined with Supernatant A and 1,2,4-oxadiazole derivative 2 combined with LPS also resulted in higher M1 polarization, suggesting a synergistic effect on M1 polarization and TNF-α production. Our findings underscore the significance of the 1,2,4-oxadiazole compound class and highlight the potential of 1,2,4-oxadiazole derivative 2 as an antitumoral and immunotherapeutic agent.

PRDX6
Also flagged:Resorcylic Acid LactonesCopperPRDX1CuproptosisTriple-negative breast cancerbreast cancer
Journal Article 2025-02-10 ✓ 1 Snippet Feng L, Wu TZ, Guo XR, Wang YJ, Wang XJ, Liu SX, Zhang R, Ma Y, Tan NH, Bian JL, Wang Z.
In-Text Gene Mentions

…3.98 μM forPRDX6( Figure S11…

Show Full Abstract

Triple-negative breast cancer (TNBC) is a highly aggressive subtype of breast cancer. Cuproptosis, a novel identified cell death form, is triggered by the direct binding of copper to lipoylated components of the tricarboxylic acid cycle. Identifying new effective drug targets and copper ionophores inducing cuproptosis for TNBC therapy is an urgent clinical need. In this study, a total of 24 resorcylic acid lactones (RALs, <b>1</b>-<b>24</b>), including 9 previously unreported ones, were isolated from the endophyte <i>Ilyonectria</i> sp. Various assays demonstrated that pochonin D (<b>16</b>, PoD) effectively inhibited the proliferation of TNBC cells <i>in vivo</i> and <i>in vitro</i>. Further investigations, including transcriptomics, proteomics, bioinformatics analysis, CMap, OTTER, clinical samples, and the use of PoD as molecular probe, revealed that PRDX1 is associated with cuproptosis and served as a potential target in TNBC. Mechanistically, PRDX1 was involved in the process of cuproptosis, and PoD bound to the Cys173 site of PRDX1, inhibited its enzymatic activity, and intervened with cuproptosis, thereby exerting anti-TNBC activity. Our study revealed that PRDX1 is not only a promising biomarker associated with cuproptosis but also a therapeutic target for TNBC, and PoD is a novel copper ionophore capable of inducing cuproptosis in TNBC cells by targeting PRDX1.

Also flagged:Lipid dropletsorganelleslipidtriglyceridescholesteryl-estersfatty acids
Journal Article 2025-02-10 No Snippets Smolková K, Gotvaldová K.
Show Full Abstract

The current understanding of lipid droplets (LDs) in cell biology has evolved from being viewed merely as storage compartments. LDs are now recognized as metabolic hubs that act as cytosolic buffers against the detrimental effects of free fatty acids (FAs). Upon activation, FAs traverse various cellular pathways, including oxidation in mitochondria, integration into complex lipids, or storage in triacylglycerols (TGs). Maintaining a balance among these processes is crucial in cellular FA trafficking, and under metabolically challenging circumstances the routes of FA metabolism adapt to meet the current cellular needs. This typically involves an increased demand for anabolic intermediates or energy and the prevention of redox stress. Surprisingly, LDs accumulate under certain conditions such as amino acid starvation. This review explores the biochemical aspects of FA utilization in both physiological contexts and within cancer cells, focusing on the metabolism of TGs, cholesteryl esters (CEs), and mitochondrial FA oxidation. Emphasis is placed on the potential toxicity associated with non-esterified FAs in cytosolic and mitochondrial compartments. Additionally, we discuss mechanisms that lead to increased LD biogenesis due to an inhibited mitochondrial import of FAs.

POU3F2
Also flagged:TAF7SAA1triple-negative breast cancerTATA-box binding protein associated factor 7serum amyloid A1binding
Journal Article 2025-02-10 ✓ 1 Snippet Zhang W, Wang J, Li H, Zhang X, Yao D, Zhang H, Zhou X, Nie J, Lai T, Zhu H, Gong Y, Tanaka Y, Li X, Liao X, Su L.
In-Text Gene Mentions

…of transcription factorPOU3F2, SOX2, SALL2, and…

Show Full Abstract

Identification of metastasis drivers of triple-negative breast cancer (TNBC) is a multifaceted challenge. Here, we identified TATA-box binding protein associated factor 7 (TAF7) as a candidate to modulate TNBC metastasis. TAF7 exhibited high expression in metastatic TNBC patients, and its elevated expression showed a negative correlation with overall survival in TNBC patients. The knockdown of TAF7 suppressed the migration and invasion of TNBC, suggesting TAF7 plays a role in the metastatic processes. Further, TAF7 was enhancing serum amyloid A1 (SAA1) transcription by binding to a specific motif in the SAA1 gene promoter. The elevated SAA1 in TNBC cells directly increased E-cadherin and N-cadherin phosphorylation thereby regulating cell adhesion. Mechanistically, TAF7 modulated cell invasion, migration, and lung metastasis through an SAA1-dependent manner <i>in vitro</i> and <i>in vivo</i> experiments. Taken together, it is likely that TAF7 could directly act on the SAA1 gene promoter, upregulating SAA1 and consequently promoting TNBC metastasis.

CSE1L
Also flagged:amino acidtumortumorscolorectal cancerprolineazetidine
Journal Article 2025-02-10 ✓ 1 Snippet Tian B, Wang S, Ding J, Qu W, Zhang C, Luan F, Wang N, Hou Y, Suo M, Liu H, Chen Y, Liu Y, Yan J, Zhang J, Li J, Wang L, Shi Y, Xiang R.
In-Text Gene Mentions

…Among these proteins,CSE1L, ERAP1, POLA1, STK10…

Show Full Abstract

The fundamental issue in immunotherapy is the lack of tumor-specific antigens in most types of tumors, leading to immune tolerance. For approximately 85% of patients with microsatellite stable (MSS) colorectal cancer (CRC), the absence of tumor neoantigens results in poor immunotherapy efficacy. Our previous study demonstrated that the misincorporation of non-proteinogenic proline (Pro) analog azetidine-2-carboxylic acid (AZE) could generate mutated proteins that significantly enhance tumor cell antigenicity and anti-tumor immune responses. <b>Methods:</b> To activate more specific anti-tumor immune responses with fewer side effects, we utilized the non-proteinogenic serine (Ser) analog β-N-methylamino-L-alanine (BMAA), which can be misincorporated into proteins as a Ser substitute by seryl tRNA synthetase at an appropriate rate. BMAA misincorporated neoantigens were detected using mass spectrometry (MS), and cancer cell-enriched peptides with high antigenicity were selected in a murine CRC model for the preparation of BMAA-based self-assembling nanoparticles (SAN). Single-cell sequencing was performed to analyze immune responses induced by SAN vaccination combined with a toll-like receptor 7 agonist (TLRa) adjuvant and BMAA treatment. <b>Results:</b> SAN-TLRa vaccination with BMAA treatment induced an anti-tumor immune microenvironment. This combination stimulated the generation of specific CD8<sup>+</sup> T cells and IgG targeting BMAA misincorporated neoepitopes, ultimately promoting immune activation, tumor suppression, and prolonged survival in the CRC murine model. Additionally, BMAA combined with SAN vaccine significantly enhanced the efficacy of the immune checkpoint inhibitor anti-PD-1 antibody. <b>Conclusion:</b> Our findings provide a promising strategy for artificially introducing neoantigens using BMAA, which can break immune tolerance without disrupting systemic immune balance. This approach offers novel avenues for CRC immunotherapy.

SOX6
Also flagged:Conotoxinsα-conotoxinsbone remodelingmineralizationosteoclast proliferationosteoblast
Journal Article 2025-02-10 ✓ 1 Snippet Iduarte-Frias B, Fournier PGJ, Galindo-Torres P, Ventura-López C, Licea-Navarro AF, Bernáldez-Sarabia J, Juárez P.
In-Text Gene Mentions

…( Sox5 ,Sox6, and Sox9)…

Show Full Abstract

The ocean provides food and shelter to diverse marine species, and it is an exceptional source of potential bioactive natural products with promising medicinal properties. Among these, α-conotoxins from venom sea snails show tremendous potential. Our study characterized the effects of synthetic α-conotoxins, sXm1b and sVc1.1, on bone remodeling. Transcriptomic analysis showed significant modulation of critical biological processes, leading to increased osteoclast activity and decreased osteoblast mineralization. sXm1b and sVc1.1 treatment also promoted genes involved in osteoblast and osteoclast proliferation. Interestingly, sVC1.1 showed higher osteoclast gene modulation and reduced the expression of genes critical for osteoblast development and differentiation. In vitro, functional evaluations demonstrated increased osteoclastogenesis and resorption, along with decreased differentiation and mineralization by osteoblasts. In a 3D ex vivo calvaria culture model, these conotoxins significantly decreased bone area, increased osteoclast number, and modulated the expression of osteoclast- and osteoblast-related genes. The findings highlight the promise of α-conotoxins as modulators of bone remodeling for treating non-genetic bone mass accumulation problems while also cautioning about potential adverse effects on bone in individuals undergoing conotoxin therapy for pain management.

Research Square 2025-02-10 Preprint (No Snippets API) Zhu C, Mai X, Jiang Y, Ji Z, Abdylla G, Zhou D.
Show Full Abstract

<title>Abstract</title> <p>Background The mechanism responsible for lung fibrosis remain unknown. This purpose of this study is to investigate the impact of alpha1,2-fucosylation on bleomycin-induced pulmonary fibrosis in a murine model. Methods Wild-type and knockout mice deficient of alpha1,2 fucose (DFTKO) were treated by bleomycin and lung fibrosis was studied. Bronchoalveolar lavage fluid was collected on Day 7 and Day 14 for Tandem Mass Tag-labeled (TMT) mass spectrometry proteomic analysis. Results Lung fibrosis is less severe in mice lacking alpha1,2 fucose. Multiple bronchoalveolar lavage proteins were elevated 7 days after bleomycin treatment, including 1) proteins involved in lipid metabolism, antimicrobial defense and inflammation: Bpifa2, Apoa1, Apoa2, C1qtnf5, Serpina3n; 2) proteins involved in TGF-beta signaling, and extracellular matrix: Fst, Bgn, Timp1, Vcan, Ltbp1, Sparcl1, Mmp2; 3) Collagens: Col5a1, Col5a2. Several proteins involved in detoxification of reactive oxygen species (ROS) were found to be decreased 7 days after bleomycin treatment: Hspa1a, Selenbp1, Glrx5, Uqcrc1, Npc1, Ifi30, Hadh, Prdx6. When wild-type and knockout mice deficient of alpha1,2 fucose were compared 7 days after bleomycin treatment, multiple proteins were elevated in knockout mice: 1) proteins involved in DNA damage repair and maintenance of genome stability: H3c1, Ssbp1, Hmga1; 2) proteins involved in inflammation: S100a8, S100a9; 3) proteins involved in signaling pathways of wound healing and tissue remodeling: Hdgfl3, Plekhf2, Ceacam1. Conclusions Alpha1,2 fucosylated structures are found to play protective roles by upregulating components of three critical pathways, while exact mechanisms will be focus of our future study. Identification of alpha1,2 fucosylated structures as facilitators of lung fibrosis also provide an interesting target for therapeutic interventions for lung fibrosis.</p>

Also flagged:antithrombin deficiencythrombophiliasheparinbindingAntithrombinvenous thromboembolism
Journal Article 2025-02-09 No Snippets Bravo-Pérez C, Corral J, Orlando C, Ignjatovic V, Ilonczai P, Bereczky Z.
Show Full Abstract

<h4>Background</h4>Antithrombin deficiency represents one of the most severe inherited thrombophilias. Albeit a rare disorder, available knowledge suggests that antithrombin deficiency is underestimated due to the limitations of current diagnostic algorithms. The high clinical variability of this patient population may be another cause of underdiagnosis. Heterozygous type I (quantitative) variants are normally associated with a severe thrombophilic phenotype, while heterozygous type II (qualitative) variants are heterogeneous, including heparin-binding site defects, which are mild/moderate and the most prevalent. Antithrombin Budapest 3 (p.Leu131Phe) is the most frequent type II/heparin-binding site deficiency in Europe, particularly in the Roma population, with a remarkable existence of homozygous subjects.<h4>Objectives</h4>To determine the clinical features, diagnostic procedures, and management of patients with severe antithrombin deficiency, leveraging the study of cases homozygous for the antithrombin Budapest 3 variant.<h4>Methods</h4>Patients were selected from 699 subjects with antithrombin deficiency and recruited over 25 years from reference centers in Spain, Belgium, and Hungary.<h4>Results</h4>Guided by 2 illustrative cases with homozygous antithrombin Budapest 3, we report the spectrum and clinical management of patients with this disorder. These cases, with very low antithrombin activity (<20%) and juvenile and recurrent venous thromboembolism, recapitulate numerous issues that one might encounter when treating patients with antithrombin deficiency. In addition, special clinical scenarios for which no formal evidence-based guidelines exist might be found more frequently in these patients, including heparin resistance, vena cava anomalies, and obstetric complications.<h4>Conclusion</h4>Expert proposals on the optimal management of these controversial areas, as well as future perspectives, are also formulated.

NEGR1
Also flagged:PEgestationnew-onset hypertensionfetal growth restrictioneclampsiapro-inflammatory cytokines
Journal Article 2025-02-08 ✓ 1 Snippet Viana-Mattioli S, Fonseca-Alaniz MH, Pinheiro-de-Sousa I, Junior RR, Mastella MH, de Carvalho Cavalli R, Sandrim VC.
In-Text Gene Mentions

…, ITGBL1 ,NEGR1, GNB5 ,…

Show Full Abstract

Preeclampsia (PE) is a challenge in maternal healthcare due to its complex nature, characterized by high blood pressure, protein in the urine, and damage to various organs. There is evidence linking PE to endothelial dysfunction (ED), triggered by substances released from an oxygen-deprived placenta. Previous in vitro studies have not considered the impact of in vivo elements, such as the different patterns of blood flow, and laminar (LSS) vs. oscillatory (OSS) shear stress, on the development of ED. We investigated the impact of plasma from healthy pregnant women (HP), subjects with gestational hypertension (GH), and PE patients on global gene expression of human coronary endothelial cells (HCAECs) under LSS and OSS. Our findings revealed a unique transcriptional profile of endothelial cells induced by plasma incubation in LSS. Notably, OSS resulted in similar transcriptomes irrespective of plasma treatment. Under LSS, GH plasma resulted in a proliferative profile, whereas PE plasma was linked to pro-inflammatory and antioxidant profiles compared to HP plasma. Our findings demonstrate that shear stress levels influence the endothelial cell transcriptome in response to plasma from hypertensive pregnancy patients. Both PE and GH can induce endothelial dysfunction under atheroprotective LSS, with a more significant effect observed with PE-derived plasma.

OLFM4
Also flagged:GlycomacropeptideGene ExpressionDigestioninterferon ITNFpeptides
Journal Article 2025-02-08 ✓ 5 Snippets Cian RE, Tena-Garitaonaindia M, Sánchez de Medina F, Martínez-Augustin O.
In-Text Gene Mentions

…genes ( Lgr5,Olfm4, and Lct…

…Inhibition ofOlfm4by GMPe was…

…GMPe, GMPe-D inducedOlfm4, Lgr5 ,…

…Pla2g2a , andOlfm4.…

…basal conditions ofOlfm4, Lgr5 ,…

Show Full Abstract

κ-Casein glycomacropeptide (GMP) exerts anti-inflammatory and immune modulatory effects. A bovine GMP concentrate and its <i>in vitro</i> digestion product were obtained. GMP was also microencapsulated with phycocolloids and further digested. These products were tested in three-dimensional (3D) and open monolayer two-dimensional (2D) mouse jejunal organoids. Almost no effect was observed on the 2D organoids. In 3D organoids, GMP induced intestinal proliferation (<i>Axin</i>2, <i>Pcna</i>) and differentiation (<i>Vil1, Alpl</i>) genes together with <i>Muc</i>3, antibacterial genes (<i>Lyz1, Pla2g2a</i>), and <i>Cxcl1</i>. GMP also induced interferon I defense genes (<i>Ifnb1, Ifr3, Oas2, Oas3, Rnasel</i>) under basal conditions and in TNF-stimulated organoids. <i>In vitro</i> digestion abrogated the effects of GMP and induced new genes (<i>Lgr5, Olfm4</i>, and <i>Lct</i>). In TNF-stimulated organoids, digested GMP repressed multiple genes. Encapsulation largely preserved the GMP effects. In conclusion, GMP showed differential effects in 3D and 2D organoids. The effects of digestion peptides were also different, suggesting distinct potential as functional foods.

Also flagged:tuberculosischronic infectious diseaseTBIL-17TB infectionphosphoantigens
Journal Article 2025-02-08 No Snippets Guo F, Song Y, Dong S, Wei J, Li B, Xu T, Wang H.
Show Full Abstract

Tuberculosis (TB) is a chronic infectious disease caused by <i>Mycobacterium tuberculosis</i> (Mtb) that poses a severe threat to human health. A variety of highly immunogenic tuberculosis proteins have been used as targets in vaccine development to mitigate the spread of TB. Although Th1-type immunity has long been considered a crucial part of resistance to Mtb, γδ T cells, the predominant source of IL-17, are not negligible in controlling the early stages of TB infection. In addition to classical phosphoantigens, <i>Mycobacterium tuberculosis</i> heat-resistant antigens (HAg), a complex containing 564 proteins obtained from live tuberculosis bacteria after heat treatment at 121 °C for 20 min, have been confirmed to be highly effective γδ T cell stimulators as well. Several studies have demonstrated that HAg-activated γδ T cells can participate in TB immunity by secreting multiple cytokines against Mtb or by interacting with other innate immune cells. In this review, we present a possible mechanism of HAg stimulation of γδ T cells and the role of HAg-activated γδ T cells in anti-TB immunity. We also highlight the limitations of studies on HAg activation of γδ T cells and suggest further research directions on the relationship between HAg and γδ T cells.

DARS2
Also flagged:ChromosomeDnaAcyclesynthesisnucleotideDARS
Journal Article 2025-02-08 ✓ 5 Snippets Kanoh K, Su'etsugu M.
In-Text Gene Mentions

…later stages, whileDARS2counteracted this inhibition.…

…region with theDARS2sequence.…

…the DnaA-reactivating sequenceDARS2.…

DARS2activity depends on…

…RCR components, theDARS2- pathway can be…

Show Full Abstract

Chromosome replication in Escherichia coli is primarily regulated at the initiation stage, where the DnaA protein activates replication at the chromosomal origin, oriC. Both DnaA and oriC undergo feedback regulation based on replication progression. Previously, we reconstituted the entire replication cycle using 26 purified proteins in a system termed replication cycle reaction (RCR). This system enables the exponential propagation of oriC circular DNA through autonomous replication cycles. In this study, we integrated regulatory mechanisms into the RCR and analyzed their effects on DNA propagation using real-time detection. The oriC sequestration system involves SeqA binding to hemimethylated oriC-generated during nascent DNA synthesis to prevent reinitiation. SeqA inhibited RCR, but the addition of Dam methylase relieved this inhibition. In the DnaA regulation system, active ATP-DnaA is inactivated by Hda in association with the DNA-loaded clamp, converting it to ADP-DnaA. Reactivation occurs through nucleotide exchange facilitated by the DnaA-reactivating sequence (DARS). Hda suppressed replication in RCR, while DARS restored activity. These results demonstrate that regulatory mechanisms controlling replication initiation in the RCR system faithfully replicate the cell cycle regulation of chromosome replication observed in vivo.

SOX6
Also flagged:PD-1PD-L1Ovarian clear cell carcinomaprogrammed cell death ligand 1tumorsPDL1
Journal Article 2025-02-08 ✓ 1 Snippet Fu M, Zhou H, Yang J, Cao D, Yuan Z.
In-Text Gene Mentions

…as APOBEC3 andSOX6, have been further…

Show Full Abstract

Ovarian clear cell carcinoma (OCCC) is resistant to chemotherapy, with limited treatment options for advanced and recurrent disease. The prevalence of OCCC differs by region. Assessing the expression of programmed cell death ligand 1 (PD-L1), PD-1, and CD8<sup>+</sup>T cell infiltration in OCCC is crucial, as their correlation with patient survival may provide valuable prognostic insights. We collected data from 36 samples from 18 OCCC patients, including 18 pairs of tumors and adjacent nonneoplastic samples. The optimized multiplex immunofluorescence technique was used to stain paraffin sections for immune factors related to the immune microenvironment of OCCC and clinical prognosis. The expression of PDL1 and PD1 in the tumor cells and tumor stromal cells was not significantly correlated with prognosis. Professional quantitative pathological analysis software was used to count the CD8<sup>+</sup> cytotoxic T-cells in tumor regions and adjacent nonneoplastic regions in postoperative specimens. There were more CD8<sup>+</sup> cytotoxic T-cells in the adjacent nonneoplastic areas than in the tumor tissue samples (p < 0.001). Further analysis revealed that a difference in cell density between CD8<sup>+</sup> non-tumor-infiltrating lymphocytes (NTILs) and CD8<sup>+</sup> tumor-infiltrating lymphocytes (TILs) exceeding 70 cells/mm<sup>2</sup> was associated with poorer progression-free survival (PFS) (p = 0.042). In adjacent nonneoplastic regions, worse PFS was significantly observed in patients with high CD8<sup>+</sup> T-cell expression in both total and stromal cells than those with low expression (p = 0.012 vs p = 0.007). The presence of CD8<sup>+</sup> T-cells had significant potential for predicting the prognosis of patients with OCCC, which lays a foundation for the development of biomarkers for immune checkpoint blockade treatment response in OCCC patients.

RABGAP1L
Also flagged:NLREP300CPN60NASHmetabolic dysfunction-associated fatty liver diseasenon-alcoholic steatohepatitis
Journal Article 2025-02-08 ✓ 1 Snippet Matboli M, El-Attar NE, Abdelbaky I, Khaled R, Saad M, Ghani AMA, Barakat E, Guirguis RNM, Khairy E, Hamady S.
In-Text Gene Mentions

…RNAs, miR-6881-5p, and LncRNA-RABGAP1L-DT-206) using an integrated…

Show Full Abstract

<h4>Background</h4>Given the increasing prevalence of metabolic dysfunction-associated fatty liver disease (MAFLD) and non-alcoholic steatohepatitis (NASH), there is a critical need for accurate non-invasive early diagnostic markers.<h4>Objective</h4>This study aimed to validate NLRP3-related RNA signatures (EP300, CPN60, and ITGB1 mRNAs, miR-6881-5p, and LncRNA-RABGAP1L-DT-206) using an integrated molecular approach and advanced machine-learning algorithms to identify robust biomarkers for early diagnosis of NASH.<h4>Methods</h4>A cohort of 237 participants (117 Healthy controls, 60 MAFLD, 120 NASH) was utilized. Twenty-five demographic, clinical, and molecular features were collected from each participant. Various machine learning models were trained on the dataset.<h4>Results</h4>The Random Forest algorithm emerged as the most effective classifier. The model identified nine key features: EP300 mRNA, CPN60 mRNA, AST, D. bilirubin, Albumin, GGT, HbA1c, HOMA-IR, and BMI, achieving an impressive 97 % accuracy in distinguishing NASH from non-NASH cases.<h4>Conclusion</h4>The integration of molecular, clinical, and demographic data with machine learning algorithms provides a highly accurate method for the early diagnosis of NASH. This model holds promise for early detection in individuals at risk of progressing to cirrhosis or liver cancer and may aid in identifying new therapeutic targets for managing NASH.

Also flagged:OX40OX40Ltumor necrosis factorchronic hepatitisantibodyCD8
Journal Article 2025-02-08 No Snippets Zhan M, Zhong S, Niu J, Gao X.
Show Full Abstract

<h4>Background & aims</h4>The costimulatory molecules OX40 and OX40L, members of the tumor necrosis factor (receptor) superfamily, play an important role in viral control through the activation of T cells. We speculate that activating the immune checkpoint OX40 may promote the inhibition of hepatitis B virus (HBV) replication.<h4>Methods</h4>To test this hypothesis, we investigated the expression dynamics of OX40/OX40L and studied the effects of activation of OX40 on HBV replication, and further explored the possible mechanism.<h4>Results</h4>We found that the percentage of T cells expressing OX40 was lower in adult patients with chronic hepatitis B (CHB) than in healthy adults and was negatively correlated with serum viral load. In contrast, the percentage of B cells and monocytes expressing OX40L was increased in adult patients with CHB and positively correlated with liver inflammatory indicators. The expression of OX40 in T cells and OX40L in monocytes was positively correlated with age in healthy donors. In addition, the levels of serum HBsAg and intrahepatic HBV DNA decreased in an HBV mouse model with an agonistic antibody that activates OX40. This viral inhibition process coincides with changes in liver inflammation, the ratio of T cell subsets, and T cell-related cytokines. Finally, we found that the OX40 activation-mediated inhibition of HBV replication was more dependent on CD8<sup>+</sup> T cells than on CD4<sup>+</sup> T cells.<h4>Conclusions</h4>The expression levels of the immune checkpoints OX40/OX40L in adult patients with CHB are closely related to virus clearance. The activation of OX40 can suppress HBV replication through a mechanism that is more dependent on CD8<sup>+</sup> T cells than on CD4<sup>+</sup> T cells. Thus, OX40 is a promising therapeutic target for the treatment of CHB.

Also flagged:Cannabinoidsdelta-9-tetrahydrocannabinolcannabidiolendocannabinoidcannabinoidcarboxy
Journal Article 2025-02-08 No Snippets Aks IR, Patel H, Pelham WE, Huestis MA, Wade NE.
Show Full Abstract

<h4>Background</h4>Cannabis is one of the most widely used drugs in early adolescence, a crucial time for development. Cannabinoids within the cannabis plant (e.g., delta-9-tetrahydrocannabinol [THC], and cannabidiol [CBD]) are suggested to have a range of health implications. These may differ by sex, given sex differences in the endocannabinoid system (ECS). Yet, how aspects of mental and physical health are related to cannabis use as measured by hair concentrations, both within early adolescence and across sexes, is so far inconclusive.<h4>Methods</h4>We analyzed hair toxicology data from three cannabinoid analytes (THC, CBD, and 11-nor-9-carboxy-THC [THCCOOH]) and multiple mental and physical health measures in 9-15 year-old youth (49 % female) from the Adolescent Brain Cognitive Development (ABCD) Study (N = 2262). Two-part linear regression models were fit to assess the effects of cannabis constituent presence, concentrations, and THC concentrations + CBD presence on externalizing and internalizing symptoms, physical and strengthening exercise, asthma presence, and sleep duration. Secondary analyses fit the same models but stratified by sex. Finally, to further characterize these relationships, we conducted two exploratory analyses: we assessed health variables prospectively and concurrently predicting cannabinoid concentrations. False discovery rate corrections were employed for all analyses.<h4>Results</h4>In the full sample, greater THC concentrations predicted more frequent strength exercise one year later; greater CBD concentrations predicted fewer strength exercise days; and greater THCCOOH concentrations predicted shorter sleep duration. Among males, cannabinoids differentially predicted exercise days; greater THC and THCCOOH concentrations predicted shorter sleep duration. Among females, greater THC and THCCOOH concentrations predicted strength exercise frequency, and THC concentrations predicted shorter sleep duration. In exploratory models, asthma presence predicted THCCOOH concentration one year later. Concurrently, THC concentration alone and in the presence of CBD predicted both sleep duration and lower exercise days, while THCCOOH concentration predicted lower exercise days, less asthma presence, as well as greater internalizing and externalizing symptoms.<h4>Conclusion</h4>In a nationwide study of youth ages 9-15 years old, we found cannabinoid hair concentrations predicted differences in health outcomes a year later, suggesting potential differential mechanisms for THC and CBD effects on health. Furthermore, sex-specific observations in these prospective associations emphasize the importance of considering sex assigned at birth when investigating correlates of cannabis use. Analysis of cannabinoid hair concentrations can reveal key links to mental health, physical activity, and sleep, aiding understanding of complex cannabis effects.

Also flagged:PERKCancertype I protein kinaseendoplasmicreticulumER
Journal Article 2025-02-08 No Snippets Mazzolini L, Touriol C.
Show Full Abstract

The type I protein kinase PERK is an endoplasmic reticulum (ER) transmembrane protein that plays a multifaceted role in cancer development and progression, influencing tumor growth, metastasis, and cellular stress responses. The activation of PERK represents one of the three signaling pathways induced during the unfolded protein response (UPR), which is triggered, in particular, in tumor cells that constitutively experience various intracellular and extracellular stresses that impair protein folding within the ER. PERK activation can lead to both pro-survival and proapoptotic outcomes, depending on the cellular context and the extent of ER stress. It helps the reprogramming of the gene expression in cancer cells, thereby ensuring survival in the face of oncogenic stress, such as replicative stress and DNA damage, and also microenvironmental challenges, including hypoxia, angiogenesis, and metastasis. Consequently, PERK contributes to tumor initiation, transformation, adaptation to the microenvironment, and chemoresistance. However, sustained PERK activation in cells can also impair cell proliferation and promote apoptotic death by various interconnected processes, including mitochondrial dysfunction, translational inhibition, the accumulation of various cellular stresses, and the specific induction of multifunctional proapoptotic factors, such as CHOP. The dual role of PERK in promoting both tumor progression and suppression makes it a complex target for therapeutic interventions. A comprehensive understanding of the intricacies of PERK pathway activation and their impact is essential for the development of effective therapeutic strategies, particularly in diseases like cancer, where the ER stress response is deregulated in most, if not all, of the solid and liquid tumors. This article provides an overview of the knowledge acquired from the study of animal models of cancer and tumor cell lines cultured in vitro on PERK's intracellular functions and their impact on cancer cells and their microenvironment, thus highlighting potential new therapeutic avenues that could target this protein.

Also flagged:membrane proteinsmembranesY-chromosome-cell surfaceCell surface proteinbiotinylation
Journal Article 2025-02-08 No Snippets Pinto-Pinho P, Quelhas J, Impens F, Dufour S, Van Haver D, Lopes G, Rocha A, Pinto-Leite R, Fardilha M, Colaço B.
Show Full Abstract

Current sperm sexing methods are costly and largely restricted to cattle, while immunological techniques targeting sex-specific membrane proteins may offer more economical alternatives. To advance these methods, understanding the proteomic differences between the cell membranes of X- and Y-chromosome-bearing spermatozoa is essential. This study aimed to characterize the cell surface proteome of bovine sperm and identify potential targets for sperm sexing through LC-MS/MS analysis. Cell surface protein lysates were extracted from unsexed, X-sperm (BX), and Y-sperm (BY) samples via biotinylation. Promising targets were identified through functional annotation (UniProt, eggNOG-mapper v.2.1.7) and topology prediction (DeepTMHMM v.1.0.13). Additionally, statistical overrepresentation (PANTHER 18.0) and orthology analyses were performed. Excluding contaminants, 130 proteins were detected, of which 64 proteins were detected in the BX samples and not in the BY samples. Of these, five transmembrane proteins stood out as potential X-sperm targets (ADAM2, ATP11C, DG1, MCT1, and PMCA4). They were identified as potential cell surface targets, based on GO terms and topology predictions, detected in at least two replicates of the BX samples, and shown to share orthology with other livestock species. These findings enhance our understanding of bovine sperm proteomics; however, further validation is required to confirm the utility of these five proteins in sperm sexing technologies.

HTT
Also flagged:HDhereditary neurodegenerative disordercytosineadenineguaninecognitive impairments
Journal Article 2025-02-08 ✓ 2 Snippets Hu N, Chen Z, Zhao X, Peng X, Wu Y, Yang K, Sun T.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, which results…

…form of theHTTprotein, which is…

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder characterized by motor, cognitive, and psychiatric symptoms. While traditionally viewed through the lens of neuronal dysfunction, emerging evidence highlights the critical role of endothelial dysfunction in HD pathogenesis. This review provides a comprehensive overview of endothelial dysfunction in HD, drawing on findings from both animal models and human studies. Key features of endothelial dysfunction in HD include impaired angiogenesis, altered cerebral blood flow, compromised neurovascular coupling and cerebrovascular reactivity, and increased blood-brain barrier permeability. Genetic factors such as the mutant huntingtin protein, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), Brain-derived neurotrophic factor (BDNF), and the adenosine A2A receptor (ADORA2A) interact to influence endothelial function in complex ways. Various therapeutic approaches targeting endothelial dysfunction, including antioxidants, nitric oxide enhancers, calcium channel blockers, statins, and metformin, have shown promise in preclinical HD models but face translational challenges, particularly regarding optimal timing of intervention and patient stratification. The implications of these findings suggest that reconceptualizing HD as a neurovascular disorder, rather than purely neuronal, could lead to more effective treatment strategies. Future research priorities should include: (1) developing validated vascular biomarkers for disease progression, (2) advancing neuroimaging techniques to monitor endothelial dysfunction in real-time. These directions will be crucial for bridging the current gap between preclinical promise and clinical success in vascular-targeted HD therapeutics.

bioRxiv 2025-02-08 Preprint (No Snippets API) Blumenstock S, Arakelyan D, del Grosso N, Schneider S, Shao Y, Gjoni E, Klein R, Dudanova I, Komiyama T.
Show Full Abstract

Huntington’s disease (HD) is a devastating movement disorder without a current cure. Although the monogenic basis of HD is well-defined, the complex downstream effects that underlie behavioral symptoms are poorly understood. These effects include cortical dysfunctions, yet the role of specific cortical neuronal subtypes in HD symptoms remain largely unexplored. Here, we used longitudinal in vivo two-photon calcium imaging to examine the activity of two cortical inhibitory neuron (IN) subtypes and excitatory corticostriatal projection neurons (CSPNs) in the motor cortex of R6/2 HD mouse model throughout disease progression. We found that motor deficits in R6/2 mice were accompanied by neuron type-specific abnormalities in movement-related activity, including hypoactivity of vasoactive intestinal peptide (VIP)-INs and CSPNs. Optogenetic activation of VIP-INs in R6/2 mice restored healthy levels of activity in VIP-INs and their downstream CSPNs and ameliorated motor deficits in R6/2 mice. Our findings highlight cortical INs as a potential therapeutic target for HD and possibly other neurological diseases.

bioRxiv 2025-02-08 Preprint (No Snippets API) Pramanik J, Zhao Q, Yamashita-Kanemaru Y, Hussein H, Homer NZM, Chakraborty S, Shaji SK, Okkenhaug K, Roychoudhuri R, Mahata B.
Show Full Abstract

<h4>SUMMARY</h4> Mast cells, ancient immune sentinels, are crucial in immune responses, tissue homeostasis and inflammatory pathologies. This study unveils a previously unknown regulatory mechanism in mast cell biology: de novo steroidogenesis. Through comprehensive multi-omics analysis and functional assays, we demonstrate that mast cells express Cyp11a1 and produce pregnenolone, representing a primitive form of steroidogenesis. This cell-intrinsic steroidogenic pathway is essential for mast cell development, survival, and functional regulation. Genetic abrogation of mast cell steroidogenesis leads to exaggerated inflammatory and anaphylactic responses in vivo . Our integrative approach reveals extensive transcriptional and proteomic remodelling during mast cell regranulation, with steroidogenesis playing a pivotal role in coordinating recovery and tissue repair processes. We uncover significant sexual dimorphism in mast cell proteomes and a global uncoupling of transcriptional and translational programmes. These findings advance our understanding of mast cell physiology and provide a foundation for developing targeted therapies for mast cell-associated pathologies.

bioRxiv 2025-02-08 Preprint (No Snippets API) Chawla B, Jatia S, Sloan DE, Csankovszki G.
Show Full Abstract

Dosage compensation (DC) in C. elegans utilizes a condensin complex that resembles mitotic condensins, but differs by one subunit, DPY-27. DPY-27 replaces SMC-4, one of the Structural Maintenance of Chromosome (SMC) proteins that is responsible for hydrolyzing ATP, required for condensation of DNA and other mitotic condensin functions. To understand if the ATPase function is required in DC, we first demonstrated that DPY-27 is capable of hydrolyzing ATP in vitro . Then, we used CRISPR/Cas9-mediated genome editing to generate an ATPase mutation in dpy-27 and demonstrated that this mutation results in a loss of DC. Specifically, we found that without ATPase function, DPY-27 containing condensin I DC has reduced capacity to bind DNA, condense the X chromosomes, and facilitate H4K20me1 enrichment on the X-chromosomes. Our results suggest that condensin I DC , like mitotic condensins, uses ATP hydrolysis to perform its functions, making C. elegans DC a model for how activities attributed to mitotic condensins can be used to regulate gene expression.

Also flagged:Hyaluronic acidcurcuminautoimmune uveitisuveitisinflammatory disordersblindness
Journal Article 2025-02-07 No Snippets Tang W, Huang X, Yi YD, Cao F, Deng M, Fan J, Jiang ZX, Tao LM, Wang X, Shi L.
Show Full Abstract

Globally, uveitis is a collection of intraocular inflammatory disorders that affect mainly the uvea, resulting in irreversible blindness and a heavy socioeconomic burden. Excessive autoimmune inflammation and oxidative stress are major drivers that contribute to the initiation and progression of uveitis. Nevertheless, current therapeutic methods for uveitis are limited and are accompanied by several serious adverse effects. Recently, nanotechnology-based antioxidant strategies have provided novel options for the treatment of ocular diseases. Although curcumin (CUR) has prominent antioxidant capacity and reactive oxygen species (ROS) scavenging ability, its low bioavailability and undetermined mechanisms limit its extensive application. This investigation demonstrated that esterified hyaluronic acid-curcumin nanoparticles (HA-CUR NPs) with superior aqueous dispersion exhibited exceptional antioxidant enzyme mimetic activity, incorporating superoxide dismutase (SOD), glutathione (GSH), catalase (CAT), and free radical scavenging ability. Further in vitro and in vivo experimental results validated the protective function of HA-CUR NPs against oxidative stress-induced damage and inflammatory responses, attenuated pathological progression, relieved microvascular damage, and regulated fundus blood flow in retinal vascular networks. This may be attributable to the specific ability of HA-CUR NPs to target the CD44 receptor and activate the Keap1/Nrf2/HO-1 signaling pathway, suggesting a potential mechanism. In summary, this study revealed that HA-CUR NPs, which are composed of a natural product and biomacromolecules with outstanding artificial antioxidant enzyme activities, may be novel agents for effectively and safely treating uveitis and other ROS-related diseases.

OLFM4
Also flagged:inflammatory diseasesInflammatory Bowel Diseaseglycocalyxglycanssugarimmune response
Journal Article 2025-02-07 ✓ 1 Snippet Rodrigues CS, Gaifem J, Pereira MS, Alves MF, Silva M, Padrão N, Cavadas B, Moreira-Barbosa C, Alves I, Marcos-Pinto R, Torres J, Lavelle A, Colombel JF, Sokol H, Pinho SS.
In-Text Gene Mentions

…, RGMB ,OLFM4), Paneth (…

Show Full Abstract

The perturbation of the symbiotic relationship between microbes and intestinal immune system contributes to gut inflammation and Inflammatory Bowel Disease (IBD) development. The host mucosa glycans (glycocalyx) creates a major biological interface between gut microorganisms and host immunity that remains ill-defined. Glycans are essential players in IBD immunopathogenesis, even years before disease onset. However, how changes in mucosa glycosylation shape microbiome and how this impact gut immune response and inflammation remains to be clarified. Here, we revealed that alterations in the expression of complex branched <i>N</i>-glycans at gut mucosa surface, modeled in glycoengineered mice, resulted in dysbiosis, with a deficiency in Firmicutes bacteria. Concomitantly, this mucosa <i>N</i>-glycan switch was associated with a downregulation of type 3 innate lymphoid cells (ILC3)-mediated immune response, leading to the transition of ILC3 toward an ILC1 proinflammatory phenotype and increased TNFα production. In addition, we demonstrated that the mucosa glycosylation remodeling through prophylactic supplementation with glycans at steady state was able to restore microbial-derived short-chain fatty acids and microbial sensing (by <i>NOD2</i> expression) alongside the rescue of the expression of ILC3 module, suppressing intestinal inflammation and controlling disease onset. In a complementary approach, we further showed that IBD patients, often displaying dysbiosis, exhibited a tendency of decreased <i>MGAT5</i> expression at epithelial cells that was accompanied by reduced ILC3 expression in gut mucosa. Altogether, these results unlock the effects of alterations in mucosa glycome composition in the regulation of the bidirectional crosstalk between microbiota and gut immune response, revealing host branched <i>N</i>-glycans/microbiota/ILC3 axis as an essential pathway in gut homeostasis and in preventing health to intestinal inflammation transition.

Also flagged:colorectal cancerGATA6gene expressionCTCForganizationAID
Journal Article 2025-02-07 No Snippets Lyu H, Chen X, Cheng Y, Zhang T, Wang P, Wong JH, Wang J, Stasiak L, Sun L, Yang G, Yang G, Wang L, Yue F.
Show Full Abstract

Colorectal cancer (CRC) is one of the most lethal and prevalent malignancies. While the overexpression of pioneer factor GATA6 in CRC has been linked with metastasis, its role in genome-wide gene expression dysregulation remains unclear. Through studies of primary human CRC tissues and analysis of the TCGA data, we found that GATA6 preferentially binds at CRC-specific active enhancers, with enrichment at enhancer-promoter loop anchors. GATA6 protein also physically interacts with CTCF, suggesting its critical role in 3D genome organization. The ablation of GATA6 through AID and CRISPR systems severely impaired cancer cell clonogenicity and proliferation. Mechanistically, GATA6 knockout induced global loss of CRC-specific open chromatins and extensive alterations of critical enhancer-promoter interactions for CRC oncogenes. Last, we showed that GATA6 knockout greatly reduced tumor growth and improved survival in mice. Together, we revealed a previously unidentified mechanism by which GATA6 contributes to the pathogenesis of colorectal cancer.

TNFSF4
Also flagged:gene expressionAgeageingferroptosisnecroptosistranscription factors
Journal Article 2025-02-07 ✓ 1 Snippet Xu L, Wang J, Zhong J, Lin W, Shen G, He N, Mao X, Fu C, Huang Z, Zhao F, Ye X, Zhu Y, Zheng M, Li H, Wang LL, Zhong K, Zhu L, Chen YY.
In-Text Gene Mentions

…, Tnfsf13b ,Tnfsf4, Tnfrsf14 ,…

Show Full Abstract

Age-related long-term disability is attracting increasing attention due to the growing ageing population worldwide. However, the current understanding of the senescent spinal cord remains insufficient. Bulk RNA sequencing reveals that 526 genes are upregulated and 300 genes are downregulated in senescent spinal cords. Pathway enrichment analysis of differentially expressed genes shows that senescence in spinal cords is related to phagosome function, neuroinflammation, ferroptosis, and necroptosis. Prediction of upstream transcription factors and interactome analysis identify Spi1 as a transcription factor that potentially plays a core role in senescent spinal cords. Spatial transcriptomics illustrates the spatial distribution of the transcriptomic landscape in both young and senescent spinal cords and identifies distinct neuronal and glial subtypes. The ferroptosis-associated gene Fth1 is upregulated in aged spinal cords. Flow cytometry reveals increased accumulation of free Fe<sup>2+</sup> and ROS in senescent mixed glial cells; however, CCK-8 assays reveal that these cells are resistant to ferroptosis. SiRNA and lentivirus experiments indicate that the overexpression of Fth1 in normal mixed glial cells reduces their sensitivity to ferroptosis, whereas Fth1 knockdown increases their sensitivity to ferroptosis. In summary, spatial and bulk transcriptomics elucidate the transcriptional characteristics of young versus senescent spinal cords, thus highlighting the role of Fth1 in mediating ferroptosis resistance in senescent mixed glial cells.

Also flagged:cell proliferationAgingestrous cycleproliferating cell nuclear antigenPCNAageing
Journal Article 2025-02-07 No Snippets Asmaz ED, Ceylani T, Genc Aİ, Sertkaya ZT, Teker HT.
Show Full Abstract

Aging is associated with a disruptive decline in gastrointestinal health leading to decreased duodenal cell proliferation ultimately affecting the digestive and absorptive capacity of intestines in all species. This study investigates the novel application of blood plasma therapy to enhance duodenal cell proliferation associated with aging. In the presented study, the effects of middle aged plasma therapy on the aged rat duodenum were investigated. For this purpose, using a randomized controlled design, Female Wistar rats (aged 12-15 months) (n:7) were treated with heterologus pooled plasma (0.5 mL per day for 30 days, infused intravenously into the tail vein) collected from middle aged (6 months old, n:28) rats during all stages of the estrous cycle. The groups were divided into three as the Experimental group (aged 12-15 months) receiving middle aged plasma, the control group (aged 12-15 months) not receiving treatment, and the middle aged rat (6 months) as the positive control group. At the end of the experiment, each group's duodenum were collected, fixed, and analyzed using histological techniques for morphometric parameters. Additionally cell proliferation density and proliferation index were determined by proliferating cell nuclear antigen (PCNA). The finding of the study suggests that plasma therapy significantly improves cell proliferation, villus height (µm), crypt depth (µm), total mucosal thickness (µm), the ratio of villus height to crypt depth (µm), and surface absorption area (mm<sup>2</sup>) in the experimental group compared to control. Likewise, we determined that middle aged plasma application supports cell proliferation. However, further research is warranted to explore the underlying mechanisms and potential clinical applications of this innovative approach.

HTTPCDH17
Also flagged:Behavioral variant frontotemporal dementiacognitive impairmentsC9orf72GRNMAPTbrain atrophy
Journal Article 2025-02-07 ✓ 2 Snippets Shen T, Vogel JW, Van Deerlin VM, Suh E, Dratch L, Phillips JS, Massimo L, Lee EB, Irwin DJ, McMillan CT.
In-Text Gene Mentions

…(5-HT1 A and5-HTT receptorsreceptors) and dopaminergic…

…protocadherin 17 (PCDH17), formin 2…

Show Full Abstract

<h4>Background</h4>Cortical atrophy is a common manifestation in behavioral variant frontotemporal degeneration (bvFTD), exhibiting spatial heterogeneity across various genetic subgroups, which may be driven by distinct biological mechanisms.<h4>Methods</h4>We employed an integrative imaging transcriptomics approach to identify both disparate and shared transcriptomic signatures associated with cortical thickness in bvFTD with C9orf72 repeat expansions or pathogenic variants in GRN or MAPT. Functional enrichment analyses were conducted on each gene list significantly associated with cortical thickness. Additionally, we mapped neurotransmitter receptor/transporter density maps to the cortical thickness maps, to uncover different correlation patterns for each genetic form. Furthermore, we examined whether the identified genes were enriched for pathology-related genes by using previously identified genes linked to TDP-43 positive neurons and genes associated with tau pathology.<h4>Results</h4>For each genetic form of bvFTD, we identified cortical thickness signatures and gene sets associated with them. The cortical thickness associated genes for GRN-bvFTD were significantly involved in neurotransmitter system and circadian entrainment. The different patterns of spatial correlations between synaptic density and cortical thinning, further confirmed the critical role of neurotransmission and synaptic signaling in shaping brain structure, especially in the GRN-bvFTD group. Furthermore, we observed significant overlap between genes linked to TDP-43 pathology and the gene sets associated with cortical thickness in C9orf72-bvFTD and GRN-bvFTD but not the MAPT-bvFTD group providing specificity for our associations. C9orf72-bvFTD and GRN-bvFTD also shared genes displaying consistent directionality, with those exhibiting either positive or negative correlations with cortical thickness in C9orf72-bvFTD showing the same direction (positive or negative) in GRN-bvFTD. MAPT-bvFTD displayed more pronounced differences in transcriptomic signatures compared to the other two genetic forms. The genes that exhibited significantly positive or negative correlations with cortical thickness in MAPT-bvFTD showed opposing directionality in C9orf72-bvFTD and GRN-bvFTD.<h4>Conclusions</h4>Overall, this integrative transcriptomic approach identified several new shared and disparate genes associated with regional vulnerability with increased biological interpretation including overlap with synaptic density maps and pathologically-specific gene expression. These findings illuminated the intricate molecular underpinnings contributing to the heterogeneous nature of disease distribution in bvFTD with distinct genetic backgrounds.

VRK2
Also flagged:mitochondrialmembranecyclic gmp-amp synthasecGASneurological disordersMitochondria
Journal Article 2025-02-07 ✓ 1 Snippet Zhang G, Wei H, Zhao A, Yan X, Zhang X, Gan J, Guo M, Wang J, Zhang F, Jiang Y, Liu X, Yang Z, Jiang X.
In-Text Gene Mentions

Vaccinia-related kinase 2kinase 2…

Show Full Abstract

Mitochondrial dysfunction is a pivotal instigator of neuroinflammation, with mitochondrial DNA (mtDNA) leakage as a critical intermediary. This review delineates the intricate pathways leading to mtDNA release, which include membrane permeabilization, vesicular trafficking, disruption of homeostatic regulation, and abnormalities in mitochondrial dynamics. The escaped mtDNA activates cytosolic DNA sensors, especially cyclic gmp-amp synthase (cGAS) signalling and inflammasome, initiating neuroinflammatory cascades via pathways, exacerbating a spectrum of neurological pathologies. The therapeutic promise of targeting mtDNA leakage is discussed in detail, underscoring the necessity for a multifaceted strategy that encompasses the preservation of mtDNA homeostasis, prevention of membrane leakage, reestablishment of mitochondrial dynamics, and inhibition the activation of cytosolic DNA sensors. Advancing our understanding of the complex interplay between mtDNA leakage and neuroinflammation is imperative for developing precision therapeutic interventions for neurological disorders.

Also flagged:gene expressionkeloidskeloidRASAL3COL13A1PRKAA2
Journal Article 2025-02-07 No Snippets Luo Y, Ye Z, Li Y, Wong CW, Xu S, Deng Y, Su Z, Li X, Huang Y, Han B.
Show Full Abstract

<h4>Objectives</h4>The purpose of this study was to determine the relationship between protein-coding RNA (messenger RNA, mRNA) and long noncoding RNA (lncRNA) expressed in vascular endothelial cells (VECs) in keloids by reanalyzing Gene Expression Omnibus (GEO) microarray chip data.<h4>Materials and methods</h4>The GSE121618 database and clinical information of these samples were downloaded and reanalyzed by the R language package. Expression differences in mRNA and lncRNA between keloids and normal skin were calculated. GO/KEGG enrichment analysis was conducted to determine the function of these genes, and an interaction network of lncRNAs-mRNAs was constructed. Magnetic Sorting of VECs and qRT-PCR were used to verify these bioinformatic results.<h4>Results</h4>The expression of three hundred and five mRNAs in the keloid group was significantly different from that in the normal group, and 98 lncRNAs were different, 21 of which were upregulated and 118 of which were downregulated. The hub relationship between the upregulated lncRNA‒mRNA interaction was lncRNA LINC01546-RASAL3/COL13A1, while the downregulated hub was lncRNA LOC101929787-PRKAA2/KRT71/SSTR1. qPCR verification result showed no obvious statistical differences.<h4>Conclusions</h4>Through the in-depth mining of keloid microarray data using bioinformatic methods, we speculated that VECs can affect the development and progression of keloids by epigenomic regulation via lncRNA‒mRNA interactions.

FBXL4
Also flagged:mitochondrialmitochondriamitophagyPINK1ParkinNIX
Journal Article 2025-02-07 ✓ 1 Snippet Clague MJ, Urbé S.
In-Text Gene Mentions

…regulated by the SCF<sup>FBXL4</sup> ubiquitin ligase comple…

Show Full Abstract

The selective removal of mitochondria by mitophagy proceeds via multiple mechanisms and is essential for human well-being. The PINK1/Parkin and NIX/BNIP3 pathways are strongly linked to mitochondrial dysfunction and hypoxia, respectively. Both are regulated by ubiquitylation and mitochondrial import. Recent studies have elucidated how the ubiquitin kinase PINK1 acts as a sensor of mitochondrial import stress through stable interaction with a mitochondrial import supercomplex. The stability of BNIP3 and NIX is regulated by the SCF<sup>FBXL4</sup> ubiquitin ligase complex. Substrate recognition requires an adaptor molecule, PPTC7, whose availability is limited by mitochondrial import. Unravelling the functional implications of each mode of mitophagy remains a critical challenge. We propose that mitochondrial import stress prompts a switch between these two pathways.

Also flagged:biliary tract cancerbiliary obstructionmalignant biliary obstructioncancergemcitabinecisplatin
Journal Article 2025-02-07 No Snippets Imamura S, Watanabe K, Inoue K, Taira T, Shibuki T, Satake T, Yamaguchi S, Sasaki M, Imaoka H, Mitsunaga S, Ikeda M.
Show Full Abstract

<h4>Objectives</h4>With the improved prognosis of patients with biliary tract cancer (BTC) owing to advances in chemotherapy, long-term stent patency has become an important goal in patients undergoing biliary stent placement. We compared the duration of stent patency between unresectable BTC patients undergoing multi-stenting for malignant hilar biliary obstruction by the side-by-side (SBS) and stent-in-stent (SIS) techniques during systemic chemotherapy.<h4>Methods</h4>We retrospectively evaluated the data of 62 unresectable BTC patients who underwent multi-stenting before the first or second cycle of first-line chemotherapy. Stent deployment was performed by the SBS technique in 40 patients (SBS group) and by the SIS technique in 22 patients (SIS group).<h4>Results</h4>The median time-to-recurrent biliary obstruction was 147 days in the SBS group and 252 days in the SIS (<i>p</i> = 0.029), being longer in the SIS group. The rates of development of early adverse events were 28% and 9% (<i>p</i> = 0.09) and the rates of development of late adverse events were 26% and 14% in the SBS and SIS groups (<i>p</i> = 0.27). The median overall survival was 480 days in the SBS group and 563 days in the SIS group (<i>p</i> = 0.92).<h4>Conclusion</h4>The duration of stent patency was shorter in the SBS group than in the SIS group; thus, the SIS technique is preferable to the SBS technique for biliary stent deployment in unresectable BTC patients during systemic chemotherapy.

HFE
Also flagged:IronBreast CancercancerdeathFerritinmetastatic disease
Journal Article 2025-02-07 ✓ 1 Snippet De Troy J, Fendt SM, Hatse S, Neven P, Smeets A, Laenen A, Wildiers H.
In-Text Gene Mentions

Hemochromatosishas also been…

Show Full Abstract

<h4>Background</h4>Breast cancer is the most common malignancy in women and the leading cause of cancer-related death. Although most early-stage patients are cured, 20% to 30% develop metastases, significantly reducing survival rates. Recent research highlights the role of iron in cancer progression, although its full impact on breast cancer metastasis is not yet fully understood.<h4>Objectives</h4>The aim of this study is to investigate the association between plasma iron levels at diagnosis of early-stage breast cancer and the risk of developing metastatic disease.<h4>Design</h4>Retrospective single-center study.<h4>Methods</h4>Patients with stage I to III breast cancer, diagnosed between 2007 and 2017, and with serum iron, transferrin saturation, and ferritin values available within 1.5 months before or after diagnosis were included. Cox proportional hazard models were applied to determine the association between iron levels and risk of metastasis.<h4>Results</h4>In total, 1113 patients were included, 10% of them developed distant metastasis over a median follow-up period of 7 years. In multivariable analysis adjusting for age, stage, and subtype, transferrin saturation and serum iron were significantly associated with an increased risk of breast cancer metastasis. For each 10% increment of transferrin saturation at baseline, there was a 19% increase in metastatic risk (hazard ratio [HR] = 1.19; 95% confidence interval [CI] = [1.02-1.38]). Similarly, a serum iron increment of 10 µg/dL led to a 6% increase in risk (HR = 1.06; 95% CI = [1.01-1.12]). Ferritin was found not to be associated with metastatic risk (HR = 0.99; 95% CI = [0.98, 1.01]). There was no significant association with metastatic site or breast cancer subtype when adjusting for age and stage.<h4>Conclusion</h4>Elevated transferrin saturation and serum iron at early breast cancer diagnosis are associated with increased risk for metastatic disease but not with location of metastases or breast cancer subtype. Further research is needed to understand the underlying mechanisms and to explore the potential of iron-targeted therapies.

DCC
Also flagged:GPX3Traumatic Brain Injuryneurological disorderneurodegenerative diseasesPDtranscription factor
Journal Article 2025-02-07 ✓ 1 Snippet Wang Y, Fang J, Yuan Q, Yu J, Hu J.
In-Text Gene Mentions

…genes identified areDCC, GPX3, HBA2, RBM3,…

Show Full Abstract

<h4>Background</h4>Traumatic brain injury (TBI) is a prevalent neurological disorder associated with significant public health burdens and long-term risks, including neurodegenerative diseases such as Parkinson's disease (PD). Emerging evidence suggests a strong link between moderate to severe TBI and an elevated risk of PD, though the underlying mechanisms remain poorly understood.<h4>Materials and methods</h4>Common differentially expressed genes (DEGs) were identified in GEO datasets of patients with traumatic brain injury (TBI) and Parkinson's disease (PD). Further analyses, including GO and KEGG pathway enrichment, protein-protein interaction (PPI) network construction, hub gene identification, as well as miRNA and transcription factor prediction and drug candidate screening, were conducted. Subsequently, the expression of hub genes was validated using additional TBI- and PD-related GEO datasets and the Comparative Toxicogenomics Database (CTD). Finally, the expression of hub genes was further validated in a mouse model of TBI induced by controlled cortical impact (CCI).<h4>Results</h4>Shared transcriptional signatures between TBI and PD were uncovered, highlighting overlapping molecular networks and pathways. The glutathione peroxidase 3 (GPX3) gene emerged as a pivotal hub gene, with its expression significantly altered in both TBI and PD datasets.<h4>Conclusion</h4>This study underscores the critical role of GPX3 in the molecular intersection of TBI and PD, suggesting it as a novel and potential therapeutic target, offering new insights into potential therapeutic strategies.

HFE
Also flagged:Alcohol-related Liver DiseaseModel for End-Stage Liver Diseasealcoholalcohol-related cirrhosisEnd-Stage Liver Diseasehepatocellular carcinoma
Journal Article 2025-02-07 ✓ 1 Snippet Oldroyd C, Aluvihare V, Holt A, Chew Y, Masson S, Parker R, Rajoriya N, Ryan J, Shepherd L, Simpson K, Wai C, Webzell I, Walton S, Verne J, Allison MED.
In-Text Gene Mentions

…(n = 9),hemochromatosis(n = 6),…

Show Full Abstract

<h4>Background</h4>Alcohol-related liver disease (ArLD) is the most common indication for liver transplantation in Europe and the United States. Few studies have examined the characteristics of patients with ArLD formally assessed for liver transplants.<h4>Methods</h4>We collected prospective data on every patient with ArLD formally assessed for liver transplantation in the United Kingdom during a 12-mo period.<h4>Results</h4>Five hundred forty-nine patients with ArLD were assessed for liver transplantation. The median Model for End-Stage Liver Disease (MELD) score was 15 and the UK MELD score was 54. 24% were women. The median duration of abstinence was 12 mo. Listing outcomes were 59% listed, 4% deferred, and 37% not listed. The reasons for not listing were medical comorbidities (29%), too early for transplantation (20%), potential recoverability (18%), recent alcohol use (12%), and other (21%). Patients listed for transplant had a higher median MELD (16 versus 13; <i>P</i> < 0.001) and UK MELD scores (55 versus 53; <i>P</i> < 0.001), longer duration of abstinence (median 12 versus 10 mo; <i>P</i> = 0.026), and no differences in sex (<i>P</i> = 0.258), age distribution (<i>P</i> = 0.53), or deprivation deciles compared with those not listed. Comparing patients assessed for transplantation to national data on deaths from ArLD revealed a lower proportion of female patients (24% assessed versus 36% deaths; <i>P</i> < 0.001) and patients from areas of high deprivation (assessments: deaths, most deprived decile 1:20 versus least deprived decile 1:9).<h4>Conclusions</h4>This study provides the first complete national profile of evaluations for liver transplantation for patients with ArLD. Women and patients from the most deprived deciles of the population may be relatively underrepresented.

SOX6
Also flagged:chromosomeCEP112TOM1L1STX8genetic diseasesSH3RF2
Journal Article 2025-02-07 ✓ 1 Snippet Zhang L, Huang Z, Luo M, Wu Z, Zhang X, Chen J, Lin Z, Tian Y, Huang Y, Li X.
In-Text Gene Mentions

…MyoD1 , andSOX6, played important…

Show Full Abstract

Copy number variation (CNV) is an important type of genetic variations contributing to phenotypic differences in animals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for molecular breeding. We used whole-genome sequencing data to investigate the characteristic of CNVs and their associations with body weight and size traits for 504 120-day Lion-head geese. We detected 1,184,695 CNVs which consisted of 1,148,401 deletions and 36,294 duplications. Based on these CNVs, we obtained 8,043 CNV regions (CNVRs) including 7,578 deletions, 228 duplications and 237 mixeds, which covered 7.76% of the reference genome. The 81.03% of CNVRs had the length ranging from 50bp to1000bp. We filtered 8,767 high-quality genotyped CNVs (7,960 deletions and 807 duplications) to conduct the association analysis of the body weight and 11 body size traits with these CNVs. We found 42 chromosome-wide significant CNVs, among which 40 were novel, and 2 CNVs had the high linkage disequilibrium (r<sup>2</sup>>0.20) with adjacent SNPs with chromosome-wide significance. According to these significant CNVs, we annotated 47 genes. Among these genes, CEP112, TOM1L1 and STX8 simultaneously influenced body weight and other body size traits, which was worthy of further study.

HTT
Also flagged:ubiquitinproteasomaldegradationNeurodegenerative diseasesproteasomeprotease
Journal Article 2025-02-07 ✓ 4 Snippets Church TR, Margolis SS.
In-Text Gene Mentions

…of the huntingtin (HTT) gene that leads…

…interferes with normalHTTroles in cellular…

…the species ofHTTprotein present (e.g.,…

…SomeHTTfound in HD…

Show Full Abstract

Neurodegenerative diseases are characterized by the progressive breakdown of neuronal structure and function and the pathological accumulation of misfolded protein aggregates and toxic protein oligomers. A major contributor to the deterioration of neuronal physiology is the disruption of protein catabolic pathways mediated by the proteasome, a large protease complex responsible for most cellular protein degradation. Previously, it was believed that proteolysis by the proteasome required tagging of protein targets with polyubiquitin chains, a pathway called the ubiquitin-proteasome system (UPS). Because of this, most research on proteasomal roles in neurodegeneration has historically focused on the UPS. However, additional ubiquitin-independent pathways and their importance in neurodegeneration are increasingly recognized. In this review, we discuss the range of ubiquitin-independent proteasome pathways, focusing on substrate identification and targeting, regulatory molecules and adaptors, proteasome activators and alternative caps, and diverse proteasome complexes including the 20S proteasome, the neuronal membrane proteasome, the immunoproteasome, extracellular proteasomes, and hybrid proteasomes. These pathways are further discussed in the context of aging, oxidative stress, protein aggregation, and age-associated neurodegenerative diseases, with a special focus on Alzheimer's Disease, Huntington's Disease, and Parkinson's Disease. A mechanistic understanding of ubiquitin-independent proteasome function and regulation in neurodegeneration is critical for the development of therapies to treat these devastating conditions. This review summarizes the current state of ubiquitin-independent proteasome research in neurodegeneration.

Also flagged:GlioblastomaGBbrain tumorsbrain tumorcancercentral nervous system tumors
Journal Article 2025-02-07 No Snippets Conte L, Caruso G, Philip AK, Cucci F, De Nunzio G, Cascio D, Caffo M.
Show Full Abstract

<i>Background</i>: Artificial intelligence (AI) has emerged as a transformative tool in healthcare, particularly in drug and biomarker discovery, where it can enhance precision, streamline discovery processes, and optimize treatment strategies. Despite its potential, the application of AI in glioblastoma (GB) research, especially in identifying novel biomarkers and therapeutic targets, remains underexplored. The aim of this review is to map the existing literature on AI-driven approaches for biomarker and drug discovery in GB, highlighting key trends and gaps in current research. <i>Design</i>: Following a PRISMA methodology, this scoping review examined studies published between 2012 and 2024. Searches were conducted across multiple databases, including MEDLINE (PubMed), Scopus, the Cochrane Library, and Web of Science (WOS). Eligible studies were screened, and relevant data were extracted and synthesized to provide a comprehensive overview of AI applications in GB research. <i>Results</i>: A total of 224 records were identified, including 210 from PubMed, 104 from Scopus, 4 from WOS, and 6 from the Cochrane Library. After screening and applying eligibility criteria, 33 studies were included in the final review. These studies showcased diverse AI methodologies applied to both drug discovery and biomarker identification, focusing on various aspects of GB biology and treatment. <i>Conclusions</i>: This scoping review reveals an increasing interest in AI-driven strategies for biomarker and drug discovery in GB, with promising initial results. However, further large-scale, rigorous studies are needed to validate real-world applications of AI and the development of standardized protocols to enhance reproducibility and clinical translation.

HTT
Also flagged:autosomal dominant neurodegenerative disordernucleotidepathogenesisHDgene expressionribosomes
Journal Article 2025-02-07 ✓ 5 Snippets Salemi M, Di Stefano V, Schillaci FA, Marchese G, Salluzzo MG, Cordella A, De Leo I, Perrotta CS, Nibali G, Lanza G, Ferri R.
In-Text Gene Mentions

…the huntingtin (HTT) gene.…

…exon of theHTTgene.…

…the huntingtin (HTT) gene […

…gene and mutantHTTgene (mHTT) were…

…50% of wild-typeHTTmRNA localizes to…

Show Full Abstract

<b>Background/Objectives</b>: Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by the expansion of the CAG nucleotide repeat in the first exon of the huntingtin (<i>HTT</i>) gene. The disease typically manifests between the second and third decades of life and progresses gradually. The pathogenesis of HD involves the dysregulation of gene expression, influenced by various molecular processes ranging from transcription to protein stability. <b>Methods</b>: To investigate potential variations in gene expression associated with HD, a transcriptome study was conducted using peripheral blood mononuclear cell samples from 15 HD patients and 15 controls, all of Sicilian origin. <b>Results</b>: The analysis identified 7179 statistically significant differentially expressed genes between the two groups. Gene Set Enrichment Analysis (GSEA) and Gene Ontology (GO) terms were applied to identify the pathways affected by these differentially expressed mRNAs. The GSEA results highlighted significant associations between HD and GO pathways related to ribosomal functions and structure. These pathways were predominantly characterized by negative expression, with a substantial number of genes showing dysregulation. This suggests that the molecular processes leading to protein translation via ribosomes may be impaired in HD. Furthermore, dysregulation was observed in genes and non-coding RNAs involved in regulatory roles across various transcriptional processes. <b>Conclusions</b>: These findings support the hypothesis that the entire process, from transcription to translation, is disrupted in HD patients carrying the CAG repeat expansion in the first exon of the <i>HTT</i> gene.

Also flagged:Quorum sensingbiofilm formationfood poisoninginfectionsphenolsalkaloids
Journal Article 2025-02-07 No Snippets Al-Daghistani HI, Matalqah SM, Shadid KA, Abu-Niaaj LF, Zein S, Abo-Ali RM.
Show Full Abstract

Quorum sensing (QS) is a molecular communication mechanism among bacterial cells. It is critical in regulating virulence factors, motility, antibiotic resistance, and biofilm formation. <i>Pseudomonas aeruginosa</i> is a Gram-negative opportunistic pathogen linked to healthcare-associated infections, food poisoning, and biofilm formation. Treating infections caused by pathogenic bacteria has become a challenge due to the development of multi-antibiotic resistance upon continuous exposure of bacteria to antibiotics. An alternative strategy to conventional antimicrobials to decrease the bacterial pathogenicity is QS inhibition, also known as quorum quenching. Using plant-derived compounds is an environmentally friendly strategy to block the bacterial QS and inhibit bacterial growth. <i>Portulaca oleracea</i> is a popular plant in different countries and is also used in traditional medicine. It is widely consumed raw in salads and as garnishes, though it can be cooked as a vegetarian dish. This study evaluates the antimicrobial activity of the methanolic extract of <i>P. oleracea</i> and its effectiveness in blocking or attenuating the QS of <i>P. aeruginosa</i>. The agar well diffusion method used for screening the antibacterial activity showed a significant growth inhibition of <i>P. aeruginosa</i> by the extract at 500 mg/mL with a minimum inhibitory concentration of 31.25 mg/mL. A bioindicator bacterium, <i>Chromobacterium violaceum</i> CV026, was used to determine the effect of the methanolic extract on the QS of <i>P. aeruginosa.</i> The results indicated a significant reduction in biofilm formation, pyocyanin production, and LasA staphylolytic activity. The phytochemical analysis by Gas Chromatography-Mass Spectrometry showed that the methanolic extract contained several phenols, alkaloids, esters, and other compounds previously reported to have antibacterial and antioxidant effects. These findings highlight the effectiveness of <i>P. oleracea</i> methanolic extract in attenuating the QS and virulence factors of <i>P. aeruginosa.</i> This study suggests that <i>P. oleracea</i> is an important source of natural antimicrobials and its use would be beneficial in food and pharmaceutical applications.

SERPINC1SOX6
Also flagged:oxygentranscription factorTFbindinghemephosphorylation
Journal Article 2025-02-07 ✓ 3 Snippets Hao R, Ao X, Xu Y, Gao M, Jia C, Dong X, Cirenluobu, Shang P, Ye Y, Wei Z.
In-Text Gene Mentions

…MYBL1, SNAI2, SOX13,SOX6, SPI1, TAL1, TWIST2…

…coagulation cascade (SERPINC1, FGA, FGB FGG…

…al., 2010 ),SOX6( Cantù et…

Show Full Abstract

Tibetan chicken (TBC) is one of the native poultry species that is well adapted to the high-altitude environment of the Qinghai-Tibet Plateau. To elucidate the genetic mechanisms underlying adaptation, the transcriptomes of five tissues (heart (HE), lung (LU), liver (LI), ovary (OV), and abdominal fat (AB)) were compared between TBCs and Roman chickens (RMCs) inhabiting the plateau for one year. Moreover, weighted gene co-expression network analysis (WGCNA) was applied to detect tissue-associated modules and hub genes. A total of 1105, 239, 400, 483, and 275 differentially expressed genes (DEGs) were identified in the LI, HE, LU, AB, and OV tissues, respectively. Fifteen tissue-specific modules were identified in TBC and thirteen in RMC. Analysis of transcription factor (TF) binding sites revealed nineteen hub TFs in TBC and twenty in RMC across the pool of hub genes in these two breeds. Functional enrichment analyses demonstrated that TBC exhibited robust capacity for oxygen transport, heme binding, oxidative phosphorylation, and antioxidant responses in high-altitude regions. Further investigation of the function of hub TFs indicated the involvement of ATF4, CEBPA, TCF7L1, and GFI1B in improving oxygen transport in TBCs. These hub TFs were associated with angiogenesis or hematopoiesis and likely linked to various regulatory functions and facilitate communication across multiple tissues. In conclusion, TBCs have developed a systemic adaptive mechanism to cope with high altitudes, involving the coordinated transcriptional regulation in multi-tissues to enhance oxygen transport and utilization, along with amelioration of oxidative stress.

PRDX6
Also flagged:EGFRNSCLCstat3GPX4epidermal growth factor receptornon-small cell lung cancer
Journal Article 2025-02-07 ✓ 4 Snippets Yu Y, Lei C, Li Y, Ma C, Ding L, Xiao Z, Tang Q, Chen Y, Jiang R, Su Y, Han L, Zhu Y, Zhang H.
In-Text Gene Mentions

…5′- TTCTCCTCGGTGACGTTCAG -3′;PRDX6Forward primer: 5′-…

… 5′- CATCCGTTTCCACGACTTTCT-3′;PRDX6Reverse primer: 5′-…

…GPX4, SOD2 andPRDX6, when compared with…

…Dual oxidase 1PRDX6Peroxiredoxin 6 SOD2…

Show Full Abstract

<h4>Objectives</h4>Our aim is to explore the combined effects and the potential mechanism between Huang-qin decoction (HQD) and epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) in non-small cell lung cancer (NSCLC) cells <i>in vitro</i> and <i>in vivo</i>.<h4>Methods</h4>Ultra-high performance liquid chromatography (UPLC) was done to detect the consistency of ingredients in different batches of HQD. Cell counting kit-8 (CCK-8) assay, 5-Ethynyl-2'-deoxyuridine (EdU) assay, colony formation assay and Annexin V-FITC/PI assay were performed to detect the anti-cancer effects of HQD and EGFR-TKIs (1st generation EGFR-TKI gefitinib or 3rd generation EGFR-TKI Osimertinib) in different NSCLC cell lines. ATP assay was applied to detect the effect of HQD and EGFR-TKIs in NSCLC cell lines and organoids in three-dimensional (3D) culture. The mRNA expression levels of lung cancer stem cell markers makers and redox related genes, such as sex determining region Y-box 2 (SOX2), aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), glutathione peroxidase 4 (GPX4), dual oxidase 1 (DUOX1) and dual oxidase 2 (DUOX2), were detected by using quantitative real-time PCR assay. Western blot methods were done to detect the effects of EGFR-TKIs and HQD on the protein expression levels of SOX2, ALDH1A1, GPX4, signal transducer and activator of transcription 3 (stat3) and p-stat3. Besides, the alteration of intracellular total reactive oxygen species (ROS) levels of NSCLC cells in 2D culture and 3D culture after the treatments were detected using DCFH-DA staining assay and fluorimetric intracellular total ROS activity assay, respectively. Femtosecond laser labeling free imaging (FLI) method was used to detect the redox ratio of NSCLC cells in 3D culture. <i>In vivo</i> experiments included subcutaneous mice xenografts of PC-9-PIK3CA-M cells to validate the anti-cancer effect, mechanism and safety of gefitinib and HQD <i>in vivo</i>.<h4>Results</h4>The consistency of ingredients in different batches of HQD was confirmed. HQD enhanced the anti-proliferation and pro-apoptosis effect of gefitinib or Osimertinib in NSCLC cell lines and organoids both in 2D culture and 3D culture <i>in vitro</i>. The combination of HQD and EGFR-TKIs could regulate stat3/GPX4 signal pathway to induce redox ratio, thus increasing ROS levels to inhibit CSC markers <i>in vitro</i>. Moreover, the drug safety, anti-cancer effect and potential mechanism of the therapy of HQD and EGFR-TKIs were confirmed <i>in vivo</i>.<h4>Conclusions</h4>HQD enhances the anti-cancer effect of EGFR-TKIs in NSCLC through ROS-mediated CSC makers inhibition by suppressing stat3/GPX4 axis to induce redox ratio, providing a novel strategy for the treatment of NSCLC patients.

Also flagged:IQGAP3cancersstomach stem cell factorRASERKgastric cancer
Journal Article 2025-02-06 No Snippets Shimura M, Matsuo J, Pang S, Jangphattananont N, Hussain A, Rahmat MB, Lee JW, Douchi D, Tong JJL, Myint K, Srivastava S, Teh M, Koh V, Yong WP, So JBY, Tan P, Yeoh KG, Unno M, Chuang LSH, Ito Y.
Show Full Abstract

<h4>Background</h4>The elevation of IQGAP3 expression in diverse cancers indicates a key role for IQGAP3 in carcinogenesis. Although IQGAP3 was established as a proliferating stomach stem cell factor and a regulator of the RAS-ERK pathway, how it drives cancer growth remains unclear.<h4>Objective</h4>We define the function of IQGAP3 in gastric cancer (GC) development and progression.<h4>Design</h4>We studied the phenotypic changes caused by IQGAP3 knockdown in three molecularly diverse GC cell lines by RNA-sequencing. In vivo tumorigenesis and lung metastasis assays corroborated IQGAP3 as a mediator of oncogenic signalling. Spatial analysis was performed to evaluate the intratumoral transcriptional and functional differences between control tumours and IQGAP3 knockdown tumours.<h4>Results</h4>Transcriptomic profiling showed that IQGAP3 inhibition attenuates signal transduction networks, such as KRAS signalling, via phosphorylation blockade. IQGAP3 knockdown was associated with significant inhibition of MEK/ERK signalling-associated growth factors, including TGFβ1, concomitant with gene signatures predictive of impaired tumour microenvironment formation and reduced metastatic potential. Xenografts involving IQGAP3 knockdown cells showed attenuated tumorigenesis and lung metastasis in immunodeficient mice. Accordingly, immunofluorescence staining revealed significant reductions of TGFβ/SMAD signalling and αSMA-positive stromal cells; digital spatial analysis indicated that IQGAP3 is indispensable for the formation of two phenotypically diverse cell subpopulations, which played crucial but distinct roles in promoting oncogenic functions.<h4>Conclusion</h4>IQGAP3 knockdown suppressed the RAS-TGFβ signalling crosstalk, leading to a significant reduction of the tumour microenvironment. In particular, IQGAP3 maintains functional heterogeneity of cancer cells to enhance malignant growth. IQGAP3 is thus a highly relevant therapy target in GC.

DCC
Also flagged:osteoarthritisextracellularOAaldehydephenylboronic acidsodium alginate
Journal Article 2025-02-06 ✓ 3 Snippets Qin W, Ma Z, Bai G, Qin W, Li L, Hao D, Wang Y, Yan J, Han X, Niu W, Niu L, Jiao K.
In-Text Gene Mentions

…Santa Cruz Biotechnology),DCC(1:300, sc-515834, Santa…

…including Cyclooxygenase 2,DCC netrin 1 receptornetrin 1 receptor…

…netrin 1 receptor (DCC), and substance P…

Show Full Abstract

Treating osteoarthritis (OA) associated pain is a challenge with the potential to significantly improve patients lives. Here, we report on a hydrogel for extracellular RNA scavenging and releasing bevacizumab to block neurovascularization at the osteochondral interface, thereby mitigating OA pain and disease progression. The hydrogel is formed by cross-linking aldehyde-phenylboronic acid-modified sodium alginate/polyethyleneimine-grafted protocatechuic acid (OSAP/PPCA) and bevacizumab sustained-release nanoparticles (BGN@Be), termed OSPPB. The dynamic Schiff base bonds and boronic ester bonds allow for injectability, self-healing, and pH/reactive oxygen species dual responsiveness. The OSPPB hydrogel can significantly inhibit angiogenesis and neurogenesis in vitro. In an in vivo OA model, intraarticular injection of OSPPB accelerates the healing process of condyles and alleviates chronic pain by inhibiting neurovascularization at the osteochondral interface. The injectable hydrogel represents a promising technique to treat OA and OA associated pain.

PEBP1
Also flagged:Osteonecrosis of the femoral headorthopedic disorderosteonecrosisalcoholsickle cell anemiacoagulation
Journal Article 2025-02-06 ✓ 1 Snippet Shi W, Li D, Xu Q, Zhang K, Liang X, Li H, Li Z, Zhang H.
In-Text Gene Mentions

…NCOA4, BAP1, BECN1,PEBP1, CARS, VDAC2, RAB7A,…

Show Full Abstract

<h4>Objective</h4>Recent studies highlight the role of H-type vasculature in bone regeneration. This study, based on single-cell RNA sequencing (scRNA-seq), aims to explore the changes in H-type vasculature endothelial cells (H_ECs) in osteonecrosis of the femoral head (ONFH) and hip osteoarthritis (HOA), focusing on the death modes such as ferroptosis, pyroptosis, and parthanatos.<h4>Methods</h4>We re-analyzed the scRNA-seq data of femoral head samples publicly available in 2022. This study selected nine femoral head samples (3 each from HOA, ONFH stage 3 A, and ONFH stage 4). CD31 + EMCN + endothelial cells were classified as H_ECs. Molecular differences were assessed using Gene Ontology and KEGG analysis. Hypoxia, ferroptosis, pyroptosis, and parthanatos indices were calculated, and transcription factors were predicted using SENIC. Cell communication was analyzed with CellChat.<h4>Results</h4>After integrating the 9 samples, 14 cell types were identified: B cells, Mesenchymal stem cells, Osteoblasts, Endothelial cells, Monocytes, T cells, NK cells, Fibroblasts, Macrophages, Common myeloid progenitors, Chondrocytes, Myelocytes, Osteoclasts, and Pericytes. The number of endothelial cells and H_ECs decreased with necrosis severity. H_ECs showed higher angiogenic capacity but lower stress resistance compared to other endothelial cells. Angiogenic capacity decreased in necrotic samples, accompanied by an elevation in inflammation levels. The hypoxia index was higher, with ferroptosis increased in stage 3 A and parthanatos in stages 3 A and 4. No change was observed in pyroptosis. Cell communication analysis revealed downregulation of SLIT3-ROBO4 signaling during necrosis.<h4>Conclusion</h4>H_ECs show molecular differences compared to other endothelial cells. Ferroptosis and parthanatos contribute to the demise of H_ECs in ONFH, with pericytes and fibroblasts supporting H_EC angiogenesis.

HFE
Also flagged:myocardial fibrosisgadoliniumMFsustained ventricular tachycardianon-ischemic cardiomyopathycontractions
Journal Article 2025-02-06 ✓ 1 Snippet Gil KE, Truong VT, Rajpal S, Zareba KM.
In-Text Gene Mentions

…hypertensive heart disease,hemochromatosis, ischemic CMP, congenital…

Show Full Abstract

<h4>Background</h4>Patients with non-ischemic cardiomyopathy exhibit a range of myocardial fibrosis (MF) patterns on cardiovascular magnetic resonance (CMR) late gadolinium enhancement (LGE) imaging. Data suggests that ring-like MF is associated with worse prognosis. In the present study it was sought to analyze the prevalence of parametric mapping abnormalities in ring-like MF and their prognostic value for arrhythmic events.<h4>Methods</h4>Patients undergoing clinical CMR at 1.5T/3T were evaluated for ring-like MF defined as midwall/subepicardial fibrosis involving ≥ 3 contiguous left ventricular segments. CMR protocol included cine imaging, T1 and T2 mapping, and LGE. Mean native T1, ECV, and T2 values and a number of mid short axis segments with elevated values were calculated. LGE extent was assessed segmentally. Arrhythmic outcomes were defined as appropriate device shock, premature ventricular contractions ≥ 10%, non-sustained/sustained ventricular tachycardia, or ventricular fibrillation.<h4>Results</h4>In total 49 patients (53 ± 17 years, 26.5% female) were analyzed. Many patients had elevated global/segmental mapping values: 45%/76% in native T1, 57%/57% in T2, and 57%/78% in ECV. During median follow-up of 12 months, arrhythmic events occurred in 65% of patients. There was no association between native T1/T2 elevation or number of LGE segments and arrhythmic outcomes. There was a significant association between ECV and arrhythmic outcomes, both septal ECV (p = 0.036) and any segmental ECV elevation (p = 0.03).<h4>Conclusion</h4>T1 and T2 myocardial tissue abnormalities are common in patients with ring-like MF. ECV elevation was associated with arrhythmic events in this cohort. Further studies are needed to establish the diagnostic and prognostic value of parametric mapping in patients with ring-like MF.

POU3F2
Also flagged:androgen receptorARprostate cancersTumorscastration-resistant prostate cancerCRPC
Journal Article 2025-02-06 ✓ 1 Snippet Pitzen SP, Rudenick AN, Qiu Y, Zhang W, Munro SA, McCluskey BM, Forster C, Bergom HE, Ali A, Boytim E, Lafin JT, Linder S, Ismail M, Devlies W, Sessions CJ, Claessens F, Joniau S, Attard G, Zwart W, Nelson PS, Corey E, Wang Y, Lang JM, Beltran H, Strand D, Antonarakis ES, Hwang J, Murugan P, Huang RS, Dehm SM.
In-Text Gene Mentions

…( ASCL1 ,POU3F2, SOX2 ,…

Show Full Abstract

Inhibiting the androgen receptor (AR) is effective for treatment of advanced prostate cancers because of their AR-dependent luminal epithelial cell identity. Tumors progress during therapy to castration-resistant prostate cancer (CRPC) by restoring AR signaling and maintaining luminal identity or by converting through lineage plasticity to a neuroendocrine (NE) identity or double-negative CRPC (DNPC) lacking luminal or NE identities. Here, we show that DNPC cells express genes defining basal, club, and hillock epithelial cells from benign prostate. We identified KLF5 as a regulator of genes defining this mixed basal, club, and hillock cell identity in DNPC models. KLF5-mediated upregulation of <i>RARG</i> uncovered a DNPC sensitivity to growth inhibition by retinoic acid receptor agonists, which down-regulated KLF5 and up-regulated AR. These findings offer CRPC classifications based on prostate epithelial cell identities and nominate KLF5 and RARG as therapeutic targets for CRPC displaying a mixed basal, club, and hillock identity.

HFE
Also flagged:metabolic disordermetabolic dysfunctionassociated fatty liver diseasenonalcoholic fatty liver diseaseobesitytype 2 diabetes mellitus
Journal Article 2025-02-06 ✓ 1 Snippet Qu H, Zhou L, Wang J, Tang D, Zhang Q, Shi J.
In-Text Gene Mentions

…iron metabolism (e.g.,hemochromatosis, iron‐deficiency anemia, mens…

Show Full Abstract

<h4>Objective</h4>The relationship between iron metabolism disturbances and metabolic dysfunction-associated fatty liver disease (MAFLD) remains controversial. This study aimed to investigate the association of iron overload with MAFLD in patients with type 2 diabetes mellitus (T2DM).<h4>Methods</h4>This study included 155 Chinese inpatients with T2DM. MAFLD was diagnosed and grouped using magnetic resonance imaging (MRI). MRI biomarkers such as proton density fat fraction and iron accumulation ( R 2 * ) were measured. Their clinical characteristics were compared, and the association of iron metabolism markers with MAFLD in patients with T2DM was analyzed.<h4>Results</h4>Iron metabolism markers, including MRI- R 2 * , ferritin, serum iron, hepcidin, and total iron-binding capacity, were overloaded in groups with MAFLD (p < 0.001 for trend). They were positively correlated with MAFLD and reflected the severity of MAFLD. The five markers of logistic regression analysis revealed an increased MAFLD risk (p < 0.001 for trend). The areas under the curve of five markers all exceeded 0.5, indicating certain predictive values for MAFLD.<h4>Conclusions</h4>MAFLD is associated with significant iron overload in Chinese patients with T2DM. Serum iron, ferritin, total iron-binding capacity, hepcidin, and R 2 * value are essential iron metabolism markers to evaluate and predict the progression of MAFLD in patients with T2DM.

FBXL4CCDC92
Also flagged:heart failuremitochondrialmetabolismLPAubiquitinproteasome
Journal Article 2025-02-06 ✓ 2 Snippets Rasooly D, Giambartolomei C, Peloso GM, Dashti H, Ferolito BR, Golden D, Horimoto ARVR, Pietzner M, Farber-Eger EH, Wells QS, Bini G, Proietti G, Tartaglia GG, Kosik NM, Wilson PWF, Phillips LS, Munroe PB, Petersen SE, Cho K, Gaziano JM, Leach AR, VA Million Veteran Program, Whittaker J, Langenberg C, Aung N, Sun YV, Pereira AC, Casas JP, Joseph J.
In-Text Gene Mentions

CCDC92

FBXL4

Show Full Abstract

Heart failure (HF) has limited therapeutic options. In this study, we differentiated the pathophysiological underpinnings of the HF subtypes-HF with reduced ejection fraction (HFrEF) and HF with preserved ejection fraction (HFpEF)-and uncovered subtype-specific therapeutic strategies. We investigated the causal roles of the human proteome and transcriptome using Mendelian randomization on more than 420,000 participants from the Million Veteran Program (27,799 HFrEF and 27,579 HFpEF cases). We created therapeutic target profiles covering efficacy, safety, novelty, druggability and mechanism of action. We replicated findings on more than 175,000 participants of diverse ancestries. We identified 70 HFrEF and 10 HFpEF targets, of which 58 were not previously reported; notably, the HFrEF and HFpEF targets are non-overlapping, suggesting the need for subtype-specific therapies. We classified 14 previously unclassified HF loci as HFrEF. We substantiated the role of ubiquitin-proteasome system, small ubiquitin-related modifier pathway, inflammation and mitochondrial metabolism in HFrEF. Among druggable genes, IL6R, ADM and EDNRA emerged as potential HFrEF targets, and LPA emerged as a potential target for both subtypes.

HFE
Also flagged:complexmetabolismchromosomesprostate-specific antigenPSAprostate cancer
Journal Article 2025-02-06 ✓ 2 Snippets Xu H, Ma Y, Xu LL, Li Y, Liu Y, Li Y, Zhou XJ, Zhou W, Lee S, Zhang P, Yue W, Bi W.
In-Text Gene Mentions

…rs1800562 (nearest geneHFE) and rs855791…

…the relationship betweenHFEgene and iron…

Show Full Abstract

Sample relatedness is a major confounder in genome-wide association studies (GWAS), potentially leading to inflated type I error rates if not appropriately controlled. A common strategy is to incorporate a random effect related to genetic relatedness matrix (GRM) into regression models. However, this approach is challenging for large-scale GWAS of complex traits, such as longitudinal traits. Here we propose a scalable and accurate analysis framework, SPA<sub>GRM</sub>, which controls for sample relatedness via a precise approximation of the joint distribution of genotypes. SPA<sub>GRM</sub> can utilize GRM-free models and thus is applicable to various trait types and statistical methods, including linear mixed models and generalized estimation equations for longitudinal traits. A hybrid strategy incorporating saddlepoint approximation greatly increases the accuracy to analyze low-frequency and rare genetic variants, especially in unbalanced phenotypic distributions. We also introduce SPA<sub>GRM(CCT)</sub> to aggregate the results following different models via Cauchy combination test. Extensive simulations and real data analyses demonstrated that SPA<sub>GRM</sub> maintains well-controlled type I error rates and SPA<sub>GRM(CCT)</sub> can serve as a broadly effective method. Applying SPA<sub>GRM</sub> to 79 longitudinal traits extracted from UK Biobank primary care data, we identified 7,463 genetic loci, making a pioneering attempt to conduct GWAS for these traits as longitudinal traits.

TNFSF4
Also flagged:lung squamous cell carcinomaLUSCnon-small cell lung cancerNSCLClung cancertumor
Journal Article 2025-02-06 ✓ 1 Snippet Yang F, Jia X, Ma Z, Liu S, Liu C, Chen D, Wang X, Qian N, Ma H.
In-Text Gene Mentions

…, TNFRSF9 andTNFSF4, were expressed…

Show Full Abstract

Despite advances in diagnostic and therapeutic strategies, the prognosis of lung squamous cell carcinoma (LUSC) patients remains poor, and the potential of microbiome-based prognostic biomarkers and therapeutic targets remains largely unexplored. LUSC patient data from The Cancer Genome Atlas (TCGA), including microbial genus level abundance data and RNA sequencing (RNA-Seq) data, were used as a training dataset. Two other independent datasets GSE19188 and GSE157009 serve as validation datasets. A microbiome-based risk score (RS) model was constructed by univariate Cox regression analysis combined with the least absolute contraction and selection operator (LASSO) regression. 18 microbial genera were found to be significantly associated with RFS in LUSC patients. The microbial signature built with these microbial genera, exhibited robust predictive accuracy in both the training and validation datasets. Furthermore, hub mRNA between high- and low-risk groups were selected by XGBOOST and intersect with mRNAs screened by univariate Cox regression analysis, finally identifying four mRNA significantly associated with LUSC prognosis. This study reveals a complex interplay between the lung microbiome and genetic biomarkers, and identifies specific microbial-based and mRNA associated with prognosis in LUSC. These findings provide a basis for future studies aimed to elucidate the mechanisms underlying these associations and provide potential biomarkers for guiding treatment decisions and improving patient outcomes.

HFE
Also flagged:hyperinsulinemiametabolic dysfunction-associated fatty liver diseaseinsulin resistanceobesitycardiovascular diseasesdiabetes
Journal Article 2025-02-06 ✓ 1 Snippet Nikparast A, Razavi M, Mirzaei P, Dehghan P, Amani Farani M, Asghari G.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, viral infections, and…

Show Full Abstract

Lifestyle and dietary intake play a pivotal role in development of metabolic dysfunction-associated fatty liver disease(MAFLD). We performed this cross-sectional study to evaluate the association between lifestyle and dietary insulinemic potential and odds of MAFLD in overweight and obese children and adolescents. The insulinemic potential of the diet and lifestyle was assessed by computing the scores of the empirical dietary index for hyperinsulinemia(EDIH), the empirical lifestyle index for hyperinsulinemia(ELIH), the empirical dietary index for insulin resistance(EDIR), and the empirical lifestyle index for insulin resistance(ELIR). MAFLD was diagnosed according to the consensus definitions. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by logistic regression. A total of 334 (49.1% boys) with mean ± SD age and BMI-for-age-Z-score of 9.3 ± 1.8 and 2.55 ± 0.69, respectively, were enrolled. After adjusting for all potential confounders, participants in the highest quartile of ELIH score had greater odds of developing MAFLD (OR:3.50;95%CI:1.49-8.22) compared with those in the lowest quartile. This association remained significant among boys and pubertal ones. However, no significant association between EDIH, EDIR, or ELIR and odds of MAFLD was found. Our study suggests that the collective insulinemic potential of dietary intake, BMI, and physical activity is associated with increased odds of MAFLD.

Also flagged:melaninfungal infectionsmelanosomesfucoxanthinEumelaninpigmentation
Journal Article 2025-02-06 No Snippets Zhou W, Li X, Zhang X, Zhu L, Peng Y, Zhang CL, Han Z, Yang R, Bai X, Wang Q, Zhao Y, Liu S.
Show Full Abstract

<h4>Objective</h4>Black wool can effectively prevent sheep from DNA damage as well as fungal infection, and can improve reproductive performance. In order to explore the candidate genes related to black wool formation in Qira sheep.<h4>Methods</h4>We selected 123 adult healthy ewes with different coat colors in Qira sheep groups (black (B), brown (Y) and grey (G)) and extracted DNA from their venous blood to obtain Illumina Ovine SNP 50K chip data. Subsequently, our PCA, NJ-tree, and Admixture population structure analyses of the 3 wool color Qira sheep populations showed that the 3 middle wool color populations exhibited the same genetic traits. Fst, xp-EHH, iHS, and π were detected for selection signals, and the 5% SNPs loci positively selected from the analyses were annotated based on SheepOar_v4.0. The region of exon 1 of the TYRP1 gene was further screened, amplified and sequenced through the DNA of the Qira sheep and associated with goodness-of-fit using the chi-square test.<h4>Results</h4>The results showed that 71 SNPs associated with black wool traits, among which TYRP1, PARD3 and CDH2 genes were strongly associated with black wool production. Three mutations were detected in the exon 1 region of the TYRP1 gene that were significantly associated with coat color variation inQira sheep (2:81,183,168, 2:81,183,281 and 2:81,183,284).<h4>Conclusion</h4>In this paper, Qira sheep could not differentiate the genetic structure of this population by wool color, and obtained 71 SNPs related to black wool. Detection of mutation sites on the TYRP1 gene affecting hair color change provides a basis for black sheep line selection as well as breed conservation.

ZNF322ABT1
Also flagged:MHCORMHC class Iolfactory receptorOlfactory receptorsG protein-coupled receptors
Journal Article 2025-02-06 ✓ 4 Snippets Kang M, Ahn B, Shin JY, Cho HS, Lee J, Park C.
In-Text Gene Mentions
⭐ same-sentence co-mention

…These loci includeABT1, ZNF322, POM121L2, ZNF184…

⭐ same-sentence co-mention

…loci include ABT1,ZNF322, POM121L2, ZNF184 ,…

⭐ same-sentence co-mention

…gene located betweenABT1and ZNF322 in…

⭐ same-sentence co-mention

…between ABT1 andZNF322in Euungulata, but…

Show Full Abstract

<h4>Background</h4>Olfactory receptor (OR) genes are highly polymorphic and form extensive families that recognize a wide range of vertebrate odorants. To explore the genetic diversity of MHC-linked OR genes and their connection to MHC genes, we conducted a combined haplotype analysis of MHC-linked OR and MHC class I genes to determine the influence of MHC on OR diversity, which could be associated with MHC-based mate selection.<h4>Results</h4>We selected nine MHC-linked OR genes based on their expression levels in pig testes and developed a sequence-based typing method for these genes. We then performed high-resolution typing of these OR genes, along with three major classical MHC class I genes (SLA-1, -2, and - 3), in 48 pigs across six breeds. We observed significantly higher allelic diversity (P < 0.01) in ORs with strong linkage disequilibrium (LD) to SLA compared to those with weak or no LD, and we identified 48 SLA class I-OR haplotypes using the expectation-maximization algorithm. The genetic diversity of SLA-linked ORs was positively correlated with their expression levels in the testis. Specifically, SLA-linked ORs with higher testicular expression (FPKM ≥ 0.1) exhibited an increase in the number of codons under mutually diversifying selection with SLA compared to those with lower expression (FPKM < 0.1).<h4>Conclusions</h4>The presence of evolutionary interactions between MHC and linked OR genes supports the potential involvement of MHC-linked ORs in MHC-based mate selection. The use of combined haplotype information for MHC and linked ORs could provide new insights into the reproductive biology of animals.

HTT
Also flagged:dendritescytoskeletal proteinsRNA-Binding ProteinsArgonaute 2AGO2RNA helicases
Journal Article 2025-02-06 ✓ 1 Snippet Shilikbay T, Nawaz A, Doon M, Ceman S.
In-Text Gene Mentions

…the huntingtin protein (HTT).…

Show Full Abstract

<h4>Background</h4>RNA helicase MOV10 is highly expressed in postnatal brain and associates with FMRP and AGO2, suggesting a role in translation regulation in learning and memory.<h4>Results</h4>We generated a brain-specific knockout mouse (Mov10 Deletion) with greatly reduced MOV10 expression in cortex and hippocampus. Behavior testing revealed enhanced fear memory, similar to that observed in a mouse with reduced brain microRNA production, supporting MOV10's reported role as an AGO2 cofactor. Cultured hippocampal neurons have elongated distal dendrites, a reported feature of augmin/HAUS over-expression in Drosophila da sensory neurons. In mitotic spindle formation, HAUS is antagonized by the microtubule bundling protein NUMA1. Numa1 mRNA is a MOV10 CLIP target and is among the genes significantly decreased in Mov10 Deletion hippocampus. Restoration of NUMA1 expression and knockdown of HAUS rescued phenotypes of the Mov10 Deletion hippocampal neurons.<h4>Conclusions</h4>This is the first evidence of translation regulation of NUMA1 by MOV10 as a control point in dendritogenesis.

ZNFX1
Also flagged:ferroptosisSLC25A28clear cell renal cell carcinomairondeathlipid
Journal Article 2025-02-06 ✓ 1 Snippet Tao Q, Li Y, Zhang W, Zhang M, Li X, Jin H, Zheng J, Li Y.
In-Text Gene Mentions

…NFX1 type-containing 1 (ZNFX1) antisense RNA 1…

Show Full Abstract

Ferroptosis is a novel, iron-dependent regulated cell death mode. The biochemical features of ferroptosis include iron accumulation, lipid peroxidation, inhibition of glutathione peroxidase 4 (GPX4) and antioxidant glutathione (GSH) decrease through inhibition of the system xc<sup>-</sup> transporter. Zinc finger NFX1 type-containing 1 (ZNFX1) antisense RNA 1 (ZFAS1) is a long non-coding RNA that has been identified as an oncogene in various types of cancers. However, its regulatory role and molecular mechanisms in clear cell renal cell carcinoma (ccRCC) ferroptosis remain unclear. In this study, the ferroptosis inducers (FINS) (erastin and RSL3) were found to increase ZFAS1 expression through the facilitation of SP1 binding to the ZFAS1 promoter. ZFAS1 increased mRNA and protein levels of solute carrier family 25 member 28 (SLC25A28) via functioning as a miR-185-5p sponge. Overexpressed SLC25A28 increased the production of ROS and caused a decrease in NADPH and GSH in cells treated with FINS. In addition, overexpression of ZFAS1 enhanced ferroptosis both in vitro and in vivo. Altogether, this study demonstrates that ZFAS1 is a crucial element of ferroptosis in ccRCC, as it is responsible for the regulation of miR-185-5p and SLC25A28. Introducing ferroptosis could be a beneficial approach to treat ccRCC patients with high ZFAS1 levels.

HFE
Also flagged:HepatokinesHeart failuredeathpathogenesisCardiac hepatopathycirrhotic cardiomyopathy
Journal Article 2025-02-06 ✓ 1 Snippet Shouman WA, Najmeddine S, Sinno L, Dib Nehme R, Ghawi A, Ziade JA, Altara R, Amin G, Booz GW, Zouein FA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Heart failure is one of the leading causes of death and disease worldwide. It is a condition that affects multiple systems within the body. There is a large body of evidence supporting that the liver is a major organ involved in the pathogenesis of heart failure. Cardiac hepatopathy and cirrhotic cardiomyopathy are two conditions that are associated with poor clinical outcomes in patients with heart failure. Despite the extensive proposed explanations of the mechanisms entailing heart failure, there remains a gap in the role of proteins and metabolic regulators produced by hepatocytes and their effect on the development, progression, and prognosis of heart failure, including adverse cardiac remodeling, fibrosis, cardiac cachexia, and renal dysfunction associated with heart failure. The aim of this review is to identify the major hepatokines being studied (adropin, fetuin-A, fetuin-B, FGF-21, selenoprotein P and α1-microglobulin) as modulators of metabolic homeostasis and cardiac dysfunction in heart failure. Research suggests that these factors play a role in modulating oxidative stress, fibrosis, apoptosis, inflammatory responses, immune cell activation, mitochondrial dysfunction, and cellular migration. The exact role of each of these hepatokines is under on-going research and requires more investigations for future clinical use.

Also flagged:Bisphosphonatesosteoporosiscancerbisphosphonatebetulinsynthesis
Journal Article 2025-02-06 No Snippets Kozicka D, Krześniak M, Grymel M, Adamek J, Łasut-Szyszka B, Cichoń T, Kuźnik A.
Show Full Abstract

Bisphosphonates (BPs) are a well-established group of drugs that have been used for decades in the prevention and treatment of osteoporosis and cancer treatment-induced bone loss. Their unique properties such as high bone affinity, enzymatic stability as well as a multidirectional biological activity prompt the creation of BP conjugates. In this study, we designed and synthesized three new bisphosphonate conjugates with betulin, a natural product with a high safety profile and a broad spectrum of biological activity. The designed conjugates differed in the type of linker used and the number of bisphosphonate moieties attached (mono- or disubstituted derivatives). The proposed method for their synthesis proceeds under mild reaction conditions and gives good yields of products. In addition, as we have shown, the reaction can be assisted by ultrasound, which significantly reduced the reaction time (from 48 hours to 2 hours) and improved the overall product yield (up to 92%). The cytotoxicity of the new conjugates was evaluated against osteosarcoma (U-2 OS), lung adenocarcinoma (A549) and gastric adenocarcinoma (AGS) cell lines. The results of preliminary biological studies showed that the obtained conjugates had improved solubility compared to that of betulin and exhibited a cytotoxic effect on all three tested cell lines at the micromolar level. The betulin analog having two bisphosphonate groups 6 demonstrated the highest cytotoxic activity against tested cell lines (IC50 between 5.16 and 6.21 μM).

Also flagged:SUMOylationpost-translational modificationubiquitin-like modifiersinnate immunityimmune responsesviral infections
Journal Article 2025-02-06 No Snippets Imbert F, Langford D.
Show Full Abstract

SUMOylation, the post-translational modification of proteins by small ubiquitin-like modifiers, plays a critical role in regulating various cellular processes, including innate immunity. This modification is essential for modulating immune responses and influencing signaling pathways that govern the activation and function of immune cells. Recent studies suggest that SUMOylation also contributes to the pathophysiology of central nervous system (CNS) viral infections, where it contributes to the host response and viral replication dynamics. Here, we explore the multifaceted role of SUMOylation in innate immune signaling and its implications for viral infections within the CNS. Notably, we present novel proteomic analyses aimed at elucidating the role of the small ubiquitin-related modifier (SUMO) in human immunodeficiency virus (HIV) latency in microglial cells. Our findings indicate that SUMOylation may regulate key proteins involved in maintaining viral latency, suggesting a potential mechanism by which HIV evades immune detection in the CNS. By integrating insights from proteomics with functional studies, we anticipate these findings to be the groundwork for future studies on HIV-host interactions and the mechanisms that underlie SUMOylation during latent and productive infection.

Also flagged:Palatogenesisorofacial cleftingTGF-βBMPFGFWNT
Journal Article 2025-02-06 No Snippets Im H, Song Y, Kim JK, Park DK, Kim DS, Kim H, Shin JO.
Show Full Abstract

Palatogenesis is a complex developmental process requiring temporospatially coordinated cellular and molecular events. The following review focuses on genetic, epigenetic, and environmental aspects directing palatal formation and their implication in orofacial clefting genesis. Essential for palatal shelf development and elevation (TGF-β, BMP, FGF, and WNT), the subsequent processes of fusion (SHH) and proliferation, migration, differentiation, and apoptosis of neural crest-derived cells are controlled through signaling pathways. Interruptions to these processes may result in the birth defect cleft lip and/or palate (CL/P), which happens in approximately 1 in every 700 live births worldwide. Recent progress has emphasized epigenetic regulations via the class of non-coding RNAs with microRNAs based on critically important biological processes, such as proliferation, apoptosis, and epithelial-mesenchymal transition. These environmental risks (maternal smoking, alcohol, retinoic acid, and folate deficiency) interact with genetic and epigenetic factors during palatogenesis, while teratogens like dexamethasone and TCDD inhibit palatal fusion. In orofacial cleft, genetic, epigenetic, and environmental impact on the complex epidemiology. This is an extensive review, offering current perspectives on gene-environment interactions, as well as non-coding RNAs, in palatogenesis and emphasizing open questions regarding these interactions in palatal development.

HFE
Also flagged:HepcidinIronIron overload diseaseRubiadinmetabolismtransferrin receptor 1
Journal Article 2025-02-06 ✓ 5 Snippets Xie X, Chang L, Zhu X, Gong F, Che L, Zhang R, Wang L, Gong C, Fang C, Yao C, Hu D, Zhao W, Zhou Y, Zhu S.
In-Text Gene Mentions

Hemochromatosisis defined as…

…Mutations in theHFEgene are the…

…common cause ofhemochromatosisin adults, primarily…

…athological characteristics ofhemochromatosis.…

…InHFE, gene mutation induced…

Show Full Abstract

Iron overload disease is characterized by the excessive accumulation of iron in the body. To better alleviate iron overload, there is an urgent need for safe and effective small molecule compounds. Rubiadin, the active ingredient derived from the Chinese herb Prismatomeris tetrandra, possesses notable anti-inflammatory and hepatoprotective properties. Nevertheless, its impact on iron metabolism remains largely unexplored. To determine the role of rubiadin on iron metabolism, Western blot analysis, real-time PCR analysis, and the measurement of serum iron were performed. Herein, we discovered that rubiadin significantly downregulated the expression of transferrin receptor 1, ferroportin 1, and ferritin light chain in ferric-ammonium-citrate-treated or -untreated HepG2 cells. Moreover, intraperitoneal administration of rubiadin remarkably decreased serum iron and duodenal iron content and upregulated expression of hepcidin mRNA in the livers of high-iron-fed mice. Mechanistically, bone morphogenetic protein 6 (BMP6) inhibitor LDN-193189 completely reversed the hepcidin upregulation and suppressor of mother against decapentaplegic 1/5/9 (SMAD1/5/9) phosphorylation induced by rubiadin. These results suggested that rubiadin increased hepcidin expression through the BMP6/SMAD1/5/9-signaling pathway. Collectively, our findings uncover a crucial mechanism through which rubiadin modulates iron metabolism and highlight it as a potential natural compound for alleviating iron-overload-related diseases.

SERPINC1
Also flagged:CancerTumorMelanomaRasRAFMAPK
Journal Article 2025-02-06 ✓ 1 Snippet Kilmister EJ, Tan ST.
In-Text Gene Mentions

…Angiotensin receptor blockerATIIIAngiotensin III ATIV…

Show Full Abstract

Multiple signaling pathways are dysregulated in melanoma, notably the Ras/RAF/MAPK/ERK and PI3K/AKT/mTOR pathways, which can be targeted therapeutically. The high immunogenicity of melanoma has been exploited using checkpoint inhibitors. Whilst targeted therapies and immune checkpoint inhibitors have improved the survival of patients with advanced melanoma, treatment resistance, their side effect profiles, and the prohibitive cost remain a challenge, and the survival outcomes remain suboptimal. Treatment resistance has been attributed to the presence of cancer stem cells (CSCs), a small subpopulation of pluripotent, highly tumorigenic cells proposed to drive cancer progression, recurrence, metastasis, and treatment resistance. CSCs reside within the tumor microenvironment (TME) regulated by the immune system, and the paracrine renin-angiotensin system, which is expressed in many cancer types, including melanoma. This narrative review discusses the role of CSCs and the paracrine renin-angiotensin system in the melanoma TME, and its implications on the current treatment of advanced melanoma with targeted therapy and immune checkpoint blockers. It also highlights the regulation of the Ras/RAF/MAPK/ERK and PI3K/AKT/mTOR pathways by the renin-angiotensin system via pro-renin receptors, and how this may relate to CSCs and treatment resistance, underscoring the potential for improving the efficacy of targeted therapy and immunotherapy by concurrently modulating the renin-angiotensin system.

Also flagged:glassesosteogenesisangiogenesisoxygenceriumsynthesis
Journal Article 2025-02-06 No Snippets Giordana A, Cavazzoli C, Fraulini F, Zardi P, Zambon A, Cerrato G, Lusvardi G.
Show Full Abstract

(1) Background: The onset of inflammation and oxidative stress after biomaterial implantation can lead to complications and prolonged recovery times. To address this, bioactive mesoporous glasses doped with cerium (0, 3.6 and 5.3 mol%) were loaded with three different biomolecules-3-hydroxyflavone, quercetin and morin hydrate-to enhance antioxidant properties while preserving bioactivity. (2) Methods: Elemental analysis, specific surface area determination, spectroscopic techniques, evaluation of antioxidant activity and in vitro bioactivity assessment were performed to characterize mesoporous glass loaded with biomolecules. (3) Results: Biomolecule loading gives values in the range of 0.5-2.0% and 10.3-39.6% for loading content and loading efficiency, respectively. The loading order is quercetin > morine hydrate > 3-hydroxyflavone, and a cerium percentage of 3.6 seems to be a good compromise. The antioxidant properties evaluated on both solids and solutions in contact with simulated biological fluids improve markedly over loaded glasses, and the most promising results are obtained with quercetin. In the most efficient systems, the bioactivity results were delayed and more evident at longer times (168 h) but were still retained. (4) Conclusions: We obtained new materials still bioactive with improved antioxidant properties that can be proposed for the regeneration of both hard and soft tissues.

Also flagged:magnesiumoxidemetalsirontitaniumaluminum
Journal Article 2025-02-06 No Snippets Chi J, Zhang H, Song S, Zhang W, He X, Nong Z, Cui X, Liu T, Man T.
Show Full Abstract

As one of the lightest metallic structural materials, magnesium (Mg) alloys possess numerous distinctive properties and are utilized across a broad spectrum of applications. However, the poor corrosion resistance of Mg alloys limits their application. Micro-arc oxidation (MAO) is an effective surface treatment method that enhances the corrosion resistance of Mg alloys. Nevertheless, the intrinsic porous structure of MAO coatings hinders significant improvement in corrosion resistance. Research indicates that the pre- and post-treatment processes associated with MAO markedly enhance the densification of the oxide coatings, thereby improving their overall performance. This paper aims to provide a comprehensive review and analysis of the effects of various pre- and post-treatment processes, highlighting key advancements and research gaps in improving MAO coatings on Mg alloys. An in-depth analysis of the crucial role of pre-treatment in optimizing interfacial bonding and post-treatment in enhancing coating density is conducted using electrochemical testing and scanning electron microscopy (SEM). Finally, the future development of pre- and post-treatment processes are discussed.

Also flagged:polyhydroxyalkanoateCurcuminPolyhydroxyoctanoateHydroxyapatitemetalspolyhydroxyalkanoates
Journal Article 2025-02-06 No Snippets Miu DM, Pavaloiu RD, Sha'at F, Vladu MG, Neagu G, Manoiu VS, Eremia MC.
Show Full Abstract

Biomaterials represent a distinct class of materials used in various medical applications, such as replicating the shape or function of damaged tissue caused by disease or trauma. The increasing focus on polyhydroxyalkanoate (PHA) research can be attributed to their properties, such as biodegradability, biocompatibility, and bioresorbability. PHAs can be incorporated into polymeric complexes or combined with bioceramics or bioactive substances. Films of PHO-HAp-Curcumin were prepared, and optimization studies were conducted using Design-Expert software (Stat-Ease 360-Trial Version). The effects of independent variables (amount of PHO, HAp, and curcumin) on biodegradability, film thickness, and curcumin release were studied. Statistical modeling revealed significant interactions among the components, with the 2FI and quadratic models providing strong predictive accuracy. The interaction of HAp and PHO amounts (X<sub>2</sub>X<sub>3</sub>) has a significant effect on biodegradability (Y<sub>1</sub>) and film thickness (Y<sub>3</sub>). For the degree of the cumulative release of curcumin (CDR), there was no significant interaction between the independent variables (curcumin-X<sub>1</sub>, HAp-X<sub>2</sub>, and PHO-X<sub>3</sub>). Optimized film exhibited a maximum desirability of 0.777 with 1 mg of curcumin, 100 mg of HAp, and 172.31 mg of PHO. A morphological analysis of optimized film revealed a rough, particle-rich surface favorable for biomedical use. The findings highlight the promise of PHO-HAp-Curcumin composite films in advancing tissue engineering.

Also flagged:Peptidespeptidefibrilsphenylalaninebindingamino acid
Journal Article 2025-02-06 No Snippets Middleton D.
Show Full Abstract

Peptides are an important class of biomolecules that perform many physiological functions and which occupy a significant and increasing share of the pharmaceutical market. Methods to determine the solid-state structures of peptides in different environments are important to help understand their biological functions and to aid the development of drug formulations. Here, a new magic-angle spinning (MAS) solid-state nuclear magnetic resonance (SSNMR) approach is described for the structural analysis of uniformly <sup>13</sup>C-labeled solid peptides. Double-quantum (DQ) coherence between selective pairs of <sup>13</sup>C nuclei in peptide backbone and side-chain CH<sub>3</sub> groups is excited to provide restraints on (i) <sup>13</sup>C-<sup>13</sup>C internuclear distances and (ii) the relative orientations of C-H bonds. DQ coherence is selected by adjusting the MAS frequency to the difference in the resonance frequencies of selected nuclear pairs (the rotational resonance condition), which reintroduces the dipolar coupling between the nuclei. Interatomic distances are then measured using a constant time SSNMR experiment to eliminate uncertainties arising from relaxation effects. Further, the relative orientations of C-H bond vectors are determined using a DQ heteronuclear local field SSNMR experiment, employing <sup>13</sup>C-<sup>1</sup>H coupling amplification to increase sensitivity. These methods are applied to determine the molecular conformation of a uniformly <sup>13</sup>C-labeled peptide, N-formyl-l-methionyl-l-leucyl-l-phenylalanine (fMLF). From just six distance and six angular restraints, two possible molecular conformations are determined, one of which is in excellent agreement with the crystal structure of a closely related peptide. The method is envisaged to a useful addition to the SSNMR repertoire for the solid-state structure determination of peptides in a variety of forms, including amyloid fibrils and pharmaceutical formulations.

Also flagged:CYTBcolorationlidocaineethanolalkaloidmitochondrial
Journal Article 2025-02-06 No Snippets Betancourth-Cundar M, Ríos-Orjuela JC, Crawford AJ, Cannatella DC, Tarvin RD.
Show Full Abstract

The number of amphibian species described yearly shows no signs of slowing down, especially in tropical regions, implying that the biodiversity of amphibians remains woefully underestimated. A new species of poison frog is described from the Pacific lowlands of southwestern Colombia: <i>Epipedobatescurrulao</i> <b>sp. nov.</b>, named for the Pacific music and dance genre known as "currulao" or "bambuco viejo". This species inhabits lowland forests from 0-260 m a.s.l. This taxon differs from congeners by having a combination of bright yellow blotches in the dorsal anterior region of the thigh and upper arm, homogenous dark-brown dorsal coloration, and advertisement calls of long duration and many pulses. We also describe the courtship call of <i>E.currulao</i> <b>sp. nov.</b>, which is lower in frequency and shorter in duration than its advertisement call. Molecular phylogenetic analyses confirm the monophyly of the populations sampled and its position as the sister species of <i>Epipedobatesnarinensis</i>, which occurs in southwestern Colombia. Among species of <i>Epipedobates</i>, the new species has been previously confused with <i>E.boulengeri</i>, but the two species are allopatric and represent two divergent clades (1.77% divergent for 12S-16S and 5.39% for CYTB). These species can be distinguished by the presence of a bright yellow blotch on the dorsal anterior region of the thigh and on the upper arm of <i>E.currulao</i> <b>sp. nov.</b>, blotches that are either more white than yellow or absent in <i>E.boulengeri</i>. In addition, the advertisement calls are distinct, with <i>E.currulao</i> <b>sp. nov.</b> having a single but long call in each call series while <i>E.boulengeri</i> has 2-6 calls in a series with each call being much shorter in length. <i>Epipedobatescurrulao</i> <b>sp. nov.</b> is the most northern species of <i>Epipedobates</i>, which extends southwards along the western edge of the Andes. Known as the Chocó, this biogeographic region has been largely converted to agriculture in Ecuador and is experiencing widespread transformation in Colombia, which may endanger <i>E.currulao</i> <b>sp. nov.</b> and biodiversity in the region. A Spanish translation of the main text is available in Suppl. material 8.

HTT
Also flagged:neurodegenerative diseasescancerATXN1ATXN2Parkinson diseaseneurodegenerative disease
Journal Article 2025-02-06 ✓ 5 Snippets Pérez-Oliveira S, Álvarez I, Menéndez-González M, Duarte-Herrera ID, Blázquez-Estrada M, Castilla-Silgado J, Suárez E, García-Fernández C, Siso-García P, García-González P, Rosende-Roca M, Boada M, Ruiz A, Infante J, De la Casa-Fages B, González-Aramburu I, Álvarez V, Pastor P.
In-Text Gene Mentions

HTT, ATXN1 and ATXN2…

…ATXN1, ATXN2 andHTTgenes on the…

…an association ofHTT, ATXN1 and ATXN2…

…ATXN2 a ndHTTgenes, respectively.…

…repeats in theHTTgene.…

Show Full Abstract

Parkinson's disease genetic embraces genetic and non-genetic factors. It has been suggested a link between CAG repeat number in the <i>HTT, ATXN1</i> and <i>ATXN2</i> genes and different neurodegenerative diseases. Several genetic factors involved in Parkinson's disease development are indeed associated with cancer pathways. Moreover, several studies found a low prevalence of cancer in neurodegenerative diseases that can be associated with a low CAG repeat size in several genes. This study aimed to investigate the influence of CAG repeat sizes in <i>ATXN1, ATXN2</i> and <i>HTT</i> genes on the risk for developing cancer and Parkinson's disease in a large cohort of patients with idiopathic Parkinson's disease and healthy controls. The work included 1052 patients with idiopathic Parkinson's disease and 1070 controls of European ancestry. CAG repeat sizes in <i>HTT, ATXN1</i> and <i>ATXN</i>2 genes were analysed. Dunn's multiple comparison test for quantitative variables and logistic and linear regression were used. The long <i>ATXN1</i> and <i>HTT</i> alleles and CAG size and both the <i>ATXN2</i> short and long alleles were predictors for the Parkinson's disease risk. The long CAG <i>ATXN1</i> allele gene was associated with the risk of cancer. No association was observed between CAG size in the <i>HTT</i> and <i>ATXN2</i> genes and risk of cancer in patients with Parkinson's disease. We described an association of <i>HTT, ATXN1</i> and <i>ATXN2</i> with the risk of Parkinson's disease, which reinforce the hypothesis of the common pathway of neurodegeneration. Besides, <i>ATXN1</i> could be a predictor of cancer risk among patients with Parkinson's disease, and these results suggest that cancer and neurodegeneration processes can share common pathways.

TNFSF4
Also flagged:thyroid tumorsendocrine tumorSenescencecancerstumorcell senescence
Journal Article 2025-02-06 ✓ 2 Snippets Zhang B, Pang Y.
In-Text Gene Mentions

…CD80, IDO2, TNFRSF4,TNFSF4, and TNFSF9 had…

…CD80, IDO2, TNFRSF4,TNFSF4, and TNFSF9—were associated…

Show Full Abstract

<h4>Introduction</h4>Thyroid cancer (THCA) is the most common endocrine tumor. Research on Cell Senescence Associated Genes (CSAGs), which impact many cancers, remains limited in the THCA field.<h4>Methods</h4>In this study, we downloaded THCA sample data from several public databases and selected a set of CSAGs for subsequent analysis. Differential expression genes (DEGs) obtained through differential analysis were intersected with prognostic genes identified by Cox regression analysis to explore the correlation among these crossed genes. We constructed a prognostic model using the Least Absolute Shrinkage and Selection Operator (LASSO) algorithm and verified its efficacy. Kaplan-Meier survival curves were plotted, and Receiver Operating Characteristic (ROC) curves rigorously confirmed the accuracy of model predictions.<h4>Results</h4>To evaluate the predictive power of prognostic models across different phenotypic traits, we performed survival analysis, Gene Set Enrichment Analysis (GSEA), and immune-related differential analysis. Differences in tumor mutation burden (TMB) and treatment response between high-risk and low-risk patient groups were also analyzed. Finally, the predictive effect of our model on immunotherapy response was validated, showing promising results for THCA patients.<h4>Discussion</h4>Our study enhances the understanding of THCA cell senescence and provides new therapeutic insights. The proposed model not only accurately predicts patient survival but also reveals factors related to immunotherapy response, offering new perspectives for personalized medicine.

Also flagged:TRIMintervertebral disc degenerationTripartite Motif-containing)deathextracellularmetabolism
Journal Article 2025-02-06 No Snippets Li S, Jiang W, Chen F, Qian J, Yang J.
Show Full Abstract

Intervertebral disc degeneration (IVDD) is a leading cause of chronic back pain, contributing significantly to reduced quality of life and global public health burdens. The TRIM (Tripartite Motif-containing) protein family, with its diverse regulatory roles, has emerged as a key player in critical cellular processes such as inflammation, cell death, and extracellular matrix (ECM) metabolism. Recent findings underscore the involvement of TRIM proteins in IVDD pathogenesis, where they regulate stress responses, maintain cellular homeostasis, and influence the functional integrity of nucleus pulposus (NP) and annulus fibrosus (AF) cells. This review explores the multifaceted roles of TRIM proteins in IVDD, highlighting their contributions to pathological pathways and their potential as therapeutic targets. Advancing our understanding of TRIM protein-mediated mechanisms may pave the way for innovative and precise therapeutic strategies to combat IVDD.

BTN3A3
Also flagged:CancertumorWNTNF-kappa-BNOTCHHedgehog
Journal Article 2025-02-06 ✓ 1 Snippet Verona F, Di Bella S, Schirano R, Manfredi C, Angeloro F, Bozzari G, Todaro M, Giannini G, Stassi G, Veschi V.
In-Text Gene Mentions

…(such as CD90/CD11b, LSECtin/BTN3A3, EPHA4/Ephrin) interaction.…

Show Full Abstract

Cancer stem cells (CSCs) are a small subset within the tumor mass significantly contributing to cancer progression through dysregulation of various oncogenic pathways, driving tumor growth, chemoresistance and metastasis formation. The aggressive behavior of CSCs is guided by several intracellular signaling pathways such as WNT, NF-kappa-B, NOTCH, Hedgehog, JAK-STAT, PI3K/AKT1/MTOR, TGF/SMAD, PPAR and MAPK kinases, as well as extracellular vesicles such as exosomes, and extracellular signaling molecules such as cytokines, chemokines, pro-angiogenetic and growth factors, which finely regulate CSC phenotype. In this scenario, tumor microenvironment (TME) is a key player in the establishment of a permissive tumor niche, where CSCs engage in intricate communications with diverse immune cells. The "oncogenic" immune cells are mainly represented by B and T lymphocytes, NK cells, and dendritic cells. Among immune cells, macrophages exhibit a more plastic and adaptable phenotype due to their different subpopulations, which are characterized by both immunosuppressive and inflammatory phenotypes. Specifically, tumor-associated macrophages (TAMs) create an immunosuppressive milieu through the production of a plethora of paracrine factors (IL-6, IL-12, TNF-alpha, TGF-beta, CCL1, CCL18) promoting the acquisition by CSCs of a stem-like, invasive and metastatic phenotype. TAMs have demonstrated the ability to communicate with CSCs via direct ligand/receptor (such as CD90/CD11b, LSECtin/BTN3A3, EPHA4/Ephrin) interaction. On the other hand, CSCs exhibited their capacity to influence immune cells, creating a favorable microenvironment for cancer progression. Interestingly, the bidirectional influence of CSCs and TME leads to an epigenetic reprogramming which sustains malignant transformation. Nowadays, the integration of biological and computational data obtained by cutting-edge technologies (single-cell RNA sequencing, spatial transcriptomics, trajectory analysis) has significantly improved the comprehension of the biunivocal multicellular dialogue, providing a comprehensive view of the heterogeneity and dynamics of CSCs, and uncovering alternative mechanisms of immune evasion and therapeutic resistance. Moreover, the combination of biology and computational data will lead to the development of innovative target therapies dampening CSC-TME interaction. Here, we aim to elucidate the most recent insights on CSCs biology and their complex interactions with TME immune cells, specifically TAMs, tracing an exhaustive scenario from the primary tumor to metastasis formation.

Also flagged:hydrocephaluscadherinN-cadherinobstructive hydrocephaluscommunicating hydrocephaluspathogenesis
Journal Article 2025-02-06 No Snippets Chen Z, He J, Guo Y, Hao Y, Lv W, Chen Z, Wang J, Yang Y, Wang K, Liu Z, Ouyang Q, Su Z, Hu P, Xiao G.
Show Full Abstract

In all epithelial cells, the adherent junctions (AJs) with cadherin as the core play an important role in the maintenance of the connection and the formation of apical-basal polarity. The ependymal cells close to the ventricular system rely on AJs with N-cadherin at the core to maintain their normal morphology and function. Therefore, it has an important impact on the function and disease of the central nervous system. Hydrocephalus is a pathological phenomenon of excessive cerebrospinal fluid accumulating in the ventricular system accompanied by continuous ventricular dilatation, which can be divided into obstructive hydrocephalus and communicating hydrocephalus according to the pathogenesis. Obstructive hydrocephalus is often associated with excessive ependymal cells produced by differentiation of radial glial cells. The etiology of communicating hydrocephalus is mainly related to the dyskinesia of cerebrospinal fluid. In addition, the damage of the brain barrier can lead to brain edema and aggravate the symptoms. At present, the researches on the pathogenesis of hydrocephalus are mainly focused on the development of ependymal cells and cilia, while less attention has been paid to molecules such as AJs, which play an important role in maintaining the polarity of ependymal cells. This paper discusses the formation and function of AJs and their role in preventing hydrocephalus by preserving the polarity of ependymal cilia, regulating the number of ependymal cells, and upholding the brain barrier integrity to impede hydrocephalus exacerbation, which provides a new direction for the study of hydrocephalus.

Also flagged:hydroxy Butyrate3-hydroxybutyratemethyl methacrylatedegradationpoly(3-hydroxyalkanoatesPoly(3-hydroxybutyrate
Journal Article 2025-02-06 No Snippets Hazer B, Keleş Ö.
Show Full Abstract

Poly(3-hydroxybutyrate) (PHB) derivatives are attractive for sustainable polymer production, yet their role in controlling radical polymerization kinetics remains underexplored. In this study, we compare the polymerization kinetics of methyl methacrylate (MMA) using two PHB-based macroinitiators: a macro chain transfer agent (PHB-macro reversible addition-fragmentation chain transfer (RAFT)) and a macroazo initiator (PHBai). RAFT polymerizations (PHB-R-PMMA) were conducted at 70 °C with PHB-macro RAFT in the presence of 2,2'-azobis(isobutyronitrile), while conventional free radical polymerizations (PHBaiPMMA) were carried out using PHBai under identical conditions. The RAFT system exhibited a slightly lower overall rate constant (<i>k</i> = 1.11 × 10<sup>-4</sup> L/mol·s) compared to the azo-initiated system (<i>k</i> = 1.28 × 10<sup>-4</sup> L/mol·s). Both systems showed a gradual decrease in the PHB content over time, indicating effective copolymer formation with increasing MMA incorporation. Activation energies for PHB-macro RAFT and PHBai were calculated as 0.88 and 1.05 kJ/mol, respectively, demonstrating RAFT's superior control over molecular architecture. The resulting PHB-PMMA block copolymers offer promising applications in orthopedic surgery (e.g., bone cements), packaging, medical implants, drug delivery, and dental materials. This study provides the first direct comparison of PHB-based macro RAFT and azo systems for MMA polymerization, highlighting RAFT's advantage in achieving controlled polymer architectures and expanding biomedical and industrial utility.

HFE
Also flagged:Metabolic SyndromeobesitydyslipidemiadiabetesRAlipid
Journal Article 2025-02-06 ✓ 1 Snippet Nandan A, Haritha J, Maniscalco D, Gill R, Puri P, Rodriguez V, Syed H.
In-Text Gene Mentions

…NASH (such ashemochromatosis, alpha-antitrypsin 1 deficien…

Show Full Abstract

<h4>Objectives</h4>Hepatotoxicity is a frequent reason why disease-modifying anti-rheumatic drugs (DMARDs) are stopped or changed. We hypothesize that features of metabolic syndrome (such as obesity, dyslipidemia, and diabetes) are risk factors for hepatotoxicity leading to DMARD change in rheumatoid arthritis (RA).<h4>Methods</h4> We conducted a retrospective chart review of 361 patients with RA. Demographic information, lipid panels, smoking status, prior alcohol use, BMI, statin use, seropositive status, viral hepatitis serologies, and type of DMARD use were noted at the initial visit and at the time of DMARD change due to hepatotoxicity if applicable. Using exact logistic regression, odds ratios for the risk factors of DMARD change due to hepatotoxicity (primary outcome) were calculated.<h4>Results</h4>Twenty out of 361 patients with RA had their DMARD changed due to hepatotoxicity. Methotrexate (odds ratio {OR} 3.07) and leflunomide (OR 6.11) carried the highest OR for DMARD change. BMI > 35 (OR 2.14), diabetes mellitus II (OR 2.01), and alcohol abuse (OR 3.5) were associated with DMARD change due to hepatotoxicity but were not statistically significant. Rheumatoid factor or anti-CCP seropositivity did not appear to be associated with increased risk for the primary outcome.<h4>Conclusion</h4>Our study does suggest that several surrogates of metabolic syndrome may be associated with the risk of hepatotoxicity due to methotrexate and leflunomide. Though the study was underpowered to assess the risk for glycated hemoglobin (HbA1c) and obesity, these variables did trend toward increasing the risk. Clinicians should consider features of metabolic syndrome as potential risk factors for hepatotoxicity with DMARD use.

SERPINC1
Also flagged:CoagulopathyC reactive proteinLDHtissue plasminogen activatortPAAntithrombin 3
Journal Article 2025-02-06 ✓ 5 Snippets Sharma S, Patel S, Pandit V, Tirunelvely N, Jondhale S, Patel M, Jain A, Yadav P.
In-Text Gene Mentions

…(tPA), Antithrombin 3 (ATIII) levels as coagulopathy,…

…= 0.012) andATIII{1299.66 (1078.5-1362.5); 1358…

…P < 0.01);ATIII(0.480, P =…

…riable) tPA (pre-transfusion),ATIII(pre-transfusion) (predictor v…

…(P < 0.01);ATIII(posttransfusion) (dependent v…

Show Full Abstract

Transfusion of Packed RBC units (PRBC) in multi-transfused patients often results in a progressive rise in transfusion requirements. To evaluate the procoagulant potential of PRBC in multi-transfused patients. We conducted this prospective cohort study (2020-2022) on multi-transfused patients (n = 31) having a lifetime transfusion of ≧ 4 units PRBCs. Biochemical parameters pre-, post-transfusion (≤ 24 hours) samples included, highly sensitive C reactive protein (HsCRP) for inflammation, LDH for hemolysis, tissue plasminogen activator (tPA), Antithrombin 3 (ATIII) levels as coagulopathy, anti-hemostatic marker and blood microparticle (MPs) (flowcytometry) as Annexin 5+ (AV+) events for TF. We performed Wilcoxon signed rank test (P≤ 0.05), pre-, posttransfusion (P≤ 0.05) and association pre- and posttransfusion by Spearman's rho correlation coefficient (CC), Linear regression (r<sup>2</sup>). Median (95% CI; P≤ 0.05) biochemical parameters pre-, posttransfusion, tPA {7.88 (2.63-20.44); 14.40 (5.29-27.08)} (P = 0.012) and ATIII {1299.66 (1078.5-1362.5); 1358.92 (1216 -1384.3)} (P = 0.011) respectively. A pre-, posttransfusion comparison of HsCRP (P = 0.45); LDH (P = 0.87) and MPs (number of events) (P = 0.54) pre-, posttransfusion were not significantly different. We observed a significant CC pre-posttransfusion HsCRP (0.61, P < 0.01); ATIII (0.480, P = 0.006); tPA (0.807, P < 0.01); MPs (0.625, P < 0.004) and r<sup>2</sup> tPA (posttransfusion) (dependent variable) tPA (pre-transfusion), ATIII (pre-transfusion) (predictor variables) r<sup>2</sup> = 0.85 (P < 0.01); ATIII (posttransfusion) (dependent variable) and ATIII (pre-transfusion); LDH (pre-transfusion) (predictor variable) r<sup>2</sup> = 0.45 (P = 0.026). A significant differences tPA, ATIII (pre-posttransfusion) and an association 'pre-posttransfusion' may be attributed to PRBC transfusions. tPA levels with corresponding changes in ATIII indicate coagulopathic response, following PRBC transfusions.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s12288-025-01978-0.

Also flagged:watersaltphosphorusmineralizationphosphate fixationalkaline phosphatases
Journal Article 2025-02-06 No Snippets Ye Y, Guo X, Li Y, Min W, Guo H.
Show Full Abstract

Saline water drip irrigation is a potential solution for addressing freshwater scarcity in arid regions. However, prolonged use can accumulate soil salinity and reduce phosphorus (P) availability. Biochar and straw amendments have been shown to alleviate these effects, but their mechanisms in regulating microbial genes involved in P transformation under long-term saline irrigation remain unclear. This study aimed to evaluate the impact of biochar and straw incorporation on soil microbial community structure and P availability in saline-irrigated cotton fields. Based on a 14-year field trial, three treatments were developed: saline water irrigation alone (CK), saline water irrigation with biochar (BC), and saline water irrigation with straw (ST). Results indicated that both amendments significantly enhanced soil water content, organic carbon, total P, available P, and inorganic P fractions (Ca<sub>10</sub>-P, Al-P, Fe-P, and O-P) while reducing soil electrical conductivity and Ca<sub>2</sub>-P and Ca<sub>8</sub>-P fractions. Biochar increased the relative abundance of Chloroflexi, Gemmatimonadetes, and Verrucomicrobia, while straw promoted Proteobacteria and Planctomycetota. Both treatments decreased the abundance of several P mineralization genes (e.g., <i>phoD</i>, <i>phoA</i>) and increased genes associated with P solubilization (e.g., <i>gcd</i>). Microbial populations and P cycling genes were shown to be tightly associated with soil characteristics, with Ca<sub>2</sub>-P and Al-P serving as important mediators, according to correlation studies. Generally, under long-term salty irrigation, biochar, and straw amendments reduced soil salinity, raised soil P availability, decreased the expression of phosphorus cycling-related microbial genes, and improved soil characteristics. These results made them excellent techniques for sustainable soil management.

Research Square 2025-02-06 Preprint (No Snippets API) Dai X, Hinsu A, Dadousis C, Hay M, Fosso B, Crotta M, Pandit R, Guitian J, Tomley F, Koringa P, Joshi C, Blake DP, Psifidi A.
Show Full Abstract

<title>Abstract</title> <p>Background: Enteric microbiota are crucial for animal health and performance, but their role is often challenging to determine. Host genetics appear to influence gut microbial communities, even among individuals in similar environments. This study aimed to identify host genetic variation associated with the caecal microbiota in two chicken breeds: the indigenous Indian Kadaknath and commercial Cobb400 broilers. Blood and caecal contents were collected from 300 chickens per breed in Western India. Genotyping was performed using the 600K Affymetrix Axiom HD single nucleotide polymorphism (SNP) array, and caecal microbiota were characterized using 16S rRNA gene sequencing. A subset of 40 chicken underwent whole genome sequencing for deeper genetic insights. SNP-based heritability estimates and genome-wide association studies (GWAS) were conducted separately for both breeds to explore the genetic background of caecal microbial structure (alpha and beta diversity) and the host’s influence on the establishment of different bacterial genera in the caeca, with a focus on potential pathogens. <h4>Results:</h4> The GWAS in Kadaknath chickens identified 108 significant SNPs across 26 <italic>Gallus gallus</italic> chromosomes (GGC1–GGC23, GGC27, and GGC28), associated with heritable caecal microbial traits, including microbiota structure and the abundance of specific genera. SNP-based heritability estimates ranged from 0.12 to 0.76, with the nearest genes predominantly involved in immune response and cell signaling pathways. In Cobb400 chickens, 71 significant SNPs were identified across 22 chromosomes (GGC1–GGC5, GGC7–GGC11, GGC14, GGC17–GGC22, GGC25–GGC28, and GGCZ), linked to heritable caecal microbial traits with heritability estimates from 0.16 to 0.61. Genes nearest to these SNPs were primarily associated with microbial regulation, growth processes, and adaptation under stress conditions. These findings underscore the role of host genetic variation in shaping caecal microbiota composition and diversity in indigenous and commercial chicken breeds and reveal breed-specific genetic architectures underlying caecal microbiota-related traits. <h4>Conclusion:</h4> This study provides valuable insights into the genetic basis of host-microbiome interactions in chickens, highlighting distinct breed-specific genetic influences on caecal microbiota composition. These findings have the potential to inform future genomic selection strategies aimed at enhancing protective or productive gut microbial populations while reducing reliance on antibiotics in poultry production.</p>

bioRxiv 2025-02-06 Preprint (No Snippets API) Campbell AS, Minařík M, Buckley D, Anand T, Gela D, Pšenička M, Baker CVH.
Show Full Abstract

In fishes and aquatic-stage amphibians, mechanosensory neuromasts are arranged in characteristic lines in the skin of the head and trunk, with afferent innervation from anterior or posterior lateral line nerves. In electroreceptive non-teleost jawed fishes and amphibians, fields of electrosensory ampullary organs flank some or all of the cranial neuromast lines, innervated by the anterior lateral line nerve. Like the mechanosensory hair cells found in neuromasts and the inner ear, electroreceptor cells in ampullary organs form specialised ribbon synapses with afferent nerve terminals. Ribbon synapses in hair cells are distinct from other glutamatergic synapses, including the ribbon synapses in photoreceptors: otoferlin is the Ca 2+ sensor for synaptic vesicle exocytosis and synaptic vesicles are loaded with glutamate by vGlut3. We previously showed that the genes encoding otoferlin and vGlut3 are expressed by ampullary organs as well as neuromasts in a chondrostean ray-finned fish, the Mississippi paddlefish ( Polyodon spathula ), suggesting that electroreceptor ribbon synapses are very similar to those in hair cells. In this study, we selected seven additional synapse-related candidate genes from our previously published dataset of putatively lateral line organ-enriched genes from late-larval paddlefish, and examined their expression in developing lateral line organs in a related chondrostean, the sterlet sturgeon ( Acipenser ruthenus ). We found that genes encoding the presynaptic cell adhesion molecule Nrxn3, the calcium-independent synaptotagmin Syt14, the high-affinity glutamate re-uptake transporter EAAT1 (GLAST), calmodulin regulator protein PCP4 (PEP-19) and cell adhesion molecule DSCAML1 were expressed in both neuromasts and ampullary organs. In contrast, Cbln18 , encoding a secreted trans-synaptic scaffolding protein, was only expressed in neuromasts and Tulp1 , encoding tubby-related protein 1 (required for the development and function of photoreceptor ribbon synapses), was only expressed in ampullary organs. Our results support electroreceptor ribbon synapses being glutamatergic and suggest further commonalities, but also some differences, with hair cell ribbon synapses.

bioRxiv 2025-02-06 Preprint (No Snippets API) Cuvertino S, Martirosian E, Cheng P, Garner T, Donaldson IJ, Jackson A, Stevens A, Sharrocks AD, Kimber SJ, Banka S.
Show Full Abstract

<h4>ABSTRACT</h4> Kabuki syndrome type 1 (KS1) is a neurodevelopmental disorder caused by loss-of-function variants in KMT2D which encodes a H3K4 methyltransferase. The mechanisms underlying neurodevelopmental problems in KS1 are still largely unknown. Here, we track the epigenome and transcriptome across three stages of neuronal differentiation using patient-derived induced pluripotent stem cells (iPSCs) to gain insights into the disease mechanism of KS1. In KS1 iPSCs we detected significantly lower levels of functional KMT2D transcript and KMT2D protein, and lower global H3K4me1 and H3K4me2 levels. We identify loss of thousands of H3K4me1 peaks in iPSCs, neuronal progenitors (NPs) and early cortical neurons (CNs) in KS1. We show that the number of lost peaks increase as differentiation progresses. We also identify hundreds of differentially expressed genes (DEGs) in iPSCs, NPs and CNs in KS1. In contrast with the epigenomic changes, the number of DEGs decrease as differentiation progresses. Our analysis reveals significant enrichment of differentially downregulated genes in areas containing putative enhancer regions with H3K4me1 loss. We also identify a set of distinct transcription factor binding sites in differentially methylated regions and a set of DEGs related to KS1 phenotypes. We find that genes regulated by SUZ12, a subunit of Polycomb Repressive complex 2, are over-represented in KS1 DEGs at early stages of differentiation. In conclusion, we present a disease-relevant human cellular model for KS1 that provides mechanistic insights for the disorder and could be used for high throughput drug screening for KS1.

Also flagged:metabolismdetoxificationprotein synthesisimmune responseLiver diseasesAcute liver diseases
Journal Article 2025-02-05 No Snippets Gan C, Yuan Y, Shen H, Gao J, Kong X, Che Z, Guo Y, Wang H, Dong E, Xiao J.
Show Full Abstract

As a highly complex organ with digestive, endocrine, and immune-regulatory functions, the liver is pivotal in maintaining physiological homeostasis through its roles in metabolism, detoxification, and immune response. Various factors including viruses, alcohol, metabolites, toxins, and other pathogenic agents can compromise liver function, leading to acute or chronic injury that may progress to end-stage liver diseases. While sharing common features, liver diseases exhibit distinct pathophysiological, clinical, and therapeutic profiles. Currently, liver diseases contribute to approximately 2 million deaths globally each year, imposing significant economic and social burdens worldwide. However, there is no cure for many kinds of liver diseases, partly due to a lack of thorough understanding of the development of these liver diseases. Therefore, this review provides a comprehensive examination of the epidemiology and characteristics of liver diseases, covering a spectrum from acute and chronic conditions to end-stage manifestations. We also highlight the multifaceted mechanisms underlying the initiation and progression of liver diseases, spanning molecular and cellular levels to organ networks. Additionally, this review offers updates on innovative diagnostic techniques, current treatments, and potential therapeutic targets presently under clinical evaluation. Recent advances in understanding the pathogenesis of liver diseases hold critical implications and translational value for the development of novel therapeutic strategies.

Also flagged:methylationParkinson's diseasehypermethylationLPIN1neurodegenerative disordersSLC7A11
Journal Article 2025-02-05 No Snippets Lie IH, Tan MMX, Andersen MS, Toft M, Pihlstrøm L.
Show Full Abstract

<h4>Objectives</h4>An increasing body of evidence indicates altered DNA methylation in Parkinson's disease, yet the reproducibility and utility of such methylation changes are largely unexplored. We aimed to further elucidate the role of dysregulated DNA methylation in Parkinson's disease and to evaluate the biomarker potential of methylation-based profiling.<h4>Methods</h4>We conducted an epigenome-wide association study (EWAS) in whole blood, including 280 Parkinson's disease and 279 control participants from Oslo, Norway. Next, we took advantage of data from the Parkinson's Progression Markers Initiative (PPMI) and a previously published EWAS to conduct a whole blood EWAS meta-analysis in Parkinson's disease, incorporating results from a total of 3068 participants. Finally, we generated multiple methylation-based scores for each Oslo and PPMI participant and tested their association with disease status, individually and in a joint multiscore model.<h4>Results</h4>In EWAS meta-analysis, we confirm SLC7A11 hypermethylation and nominate a novel differentially methylated CpG near LPIN1. A joint multiscore model incorporating polygenic risk and methylation-based estimates of epigenetic Parkinson's disease risk, smoking, and leukocyte proportions differentiated patients from control participants with an area under the receiver-operator curve of 0.82 in the Oslo cohort and 0.65 in PPMI.<h4>Interpretation</h4>Our results highlight the power of DNA methylation profiling to capture multiple aspects of disease risk, indicating a biomarker potential for precision medicine in neurodegenerative disorders. The reproducibility of specific differentially methylated CpGs across data sets was limited but may improve if future studies are designed to account for disease stage and incorporate environmental exposure data.

Also flagged:coronary heart diseasecardiovascular diseaseCVDageingnitratescalcium channel
Journal Article 2025-02-05 No Snippets Nguyen TV, Nguyen HTT, Truong DN, Nguyen VQ, Nguyen HQ, Nguyen HQ, Ngo TTK, Amsalu E, Wong WJ, Nguyen TN.
Show Full Abstract

<h4>Aims</h4>This study aimed to assess medication adherence among older people with coronary heart disease and its relationship with hospitalizations.<h4>Methods</h4>This is a prospective cohort study conducted at the outpatient clinics of a major hospital in Vietnam from November 2022 to June 2023. Consecutive older patients with coronary heart disease were recruited and followed for 6 months. Medication adherence was defined using the five-item Medication Adherence Report Scale (MARS-5). Multivariable logistic regression models were applied to examine the impact of medication adherence on hospitalization due to cardiovascular disease (CVD) and all-cause hospitalization.<h4>Results</h4>There were 643 participants, mean age 73 ± 8 years, 74.3% were male. Overall, 76.4% (491/643) were classified as 'adherent'. Over 6 months follow-up, 23.3% of the participants were admitted to hospital and of these hospitalizations, 9.2% were due to CVD. The CVD-related hospitalization rate was significantly higher in the non-adherent group compared to the adherent group (13.8% vs. 7.7%, P = 0.023, respectively). In logistic regression models, medication adherence was associated with significantly reduced odds of CVD-related hospitalization (adjusted odds ratio [OR] 0.48, 95% confidence interval [CI] 0.27-0.86). Medication adherence was also associated with a trend of reduced all-cause hospitalization (adjusted OR 0.75, 95% CI 0.49-1.15).<h4>Conclusions</h4>This study showed a positive relationship between medication adherence and reduced risk of CVD-related hospitalization in older people with coronary heart disease. Healthcare providers should consider incorporating adherence assessment into the long-term care for older patients with coronary heart disease.

TNFSF4
Also flagged:tumorscancertumorCD8TGF-βT-bet
Journal Article 2025-02-05 ✓ 1 Snippet Tan SN, Hao J, Ge J, Yang Y, Liu L, Huang J, Lin M, Zhao X, Wang G, Yang Z, Ni L, Dong C.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Regulatory T (Treg) cells are known to impede antitumor immunity, yet the regulatory mechanisms and functional roles of these cells remain poorly understood. In this study, through the characterization of multiple cancer models, we identified a substantial presence of peripherally induced Treg cells in the tumor microenvironment (TME). Depletion of these cells triggered antitumor responses and provided potent therapeutic effects by increasing functional CD8+ T cells. Fate-mapping and transfer experiments revealed that IFN-γ-expressing T helper (Th) 1 cells differentiated into Treg cells in response to TGF-β signaling in tumors. Pseudotime trajectory analysis further revealed the terminal differentiation of Th1-like Treg cells from Th1 cells in the TME. Tumor-resident Treg cells highly expressed T-bet, which was essential for their functions in the TME. Additionally, CD39 was highly expressed by T-bet+ Treg cells in both mouse and human tumors, and was necessary for Treg cell-mediated suppression of CD8+ T cell responses. Our study elucidated the developmental pathway of intratumoral Treg cells and highlighted novel strategies for targeting them in cancer patients.

Also flagged:synthesisNHE-1buthutin Ahydrogenamidecarbon
Journal Article 2025-02-05 No Snippets Liu Y, Wang FQ, Hua XH, Yang SH, Wang LN, Xu YS, Shao CY, Gou XB, Liu YM.
Show Full Abstract

Natural products are the important sources in cardiovascular drug development. In this study, twenty-nine buthutin derivatives were designed, synthesized, and evaluated for their NHE-1 inhibition and protective effects on cardiomyocyte injury. The structure of the newly synthesized compounds had been confirmed by <sup>1</sup>H-NMR, <sup>13</sup>C-NMR, and HR-ESI-MS spectra. Among all target compounds at 1 μM, compounds 9d, 9f, 9k, 9m, and 9n, with a protection ratio exceeding 30%, exerted stronger protective effects on H9c2 cardiomyocyte than positive control dexrazoxane and buthutin A. Meanwhile, compounds 9k, 9m, and 9o showed the significant NHE-1 inhibitory activities on H9c2 cardiomyocyte, all with a dpHi/min value less than 0.23. What is more, compounds 9k, 9m, 9o and buthutin A all exhibited the specificity on NHE-1 inhibition. Molecular modelling studies suggested the ability of compounds 9m and 9o to establish interactions with three hydrogen bonds to Asp267 and Glu346 of NHE-1, but also the ability with much lower CDOCKER energies than positive control cariporide and buthutin A. The structure-activity relationship (SAR) studies suggested that the presences of amide group, four-carbon linker, and para hydroxyl benzene ring were advantageous pharmacophores for above two pharmacological actions. This research would open new avenues for developing amide-guanidine-based cardioprotective agents.

OLFM4
Also flagged:Prmt5protein arginine methyltransferase 5localizationcolitisHdac9histone deacetylases
Journal Article 2025-02-05 ✓ 5 Snippets Yang L, Li X, Shi C, Zhao B.
In-Text Gene Mentions

…of ISC markerOlfm4and found that…

…the number ofOlfm4+ cells in…

…markers Lgr5 andOlfm4following Prmt5 deletion…

…as Lgr5 ,Olfm4, and Ki67 upon…

…mmunohistochemical staining ofOlfm4(Fig. 2 F).…

Show Full Abstract

Intestinal homeostasis relies on the continuous renewal of intestinal stem cells (ISCs), which could be epigenetically regulated. While protein arginine methyltransferase 5 (Prmt5) is known to play a key role in multiple organs as an epigenetic modifier, its specific function in maintaining intestinal homeostasis remains to be elucidated. Here, we show that Prmt5 is highly expressed in mouse crypts. The deletion of Prmt5 results in ISCs deficiency, ectopic localization of Paneth cells, and spontaneous colitis. Mechanistically, Prmt5 sustains a high level of H3K27ac accumulation by inhibiting Hdac9 expression in the intestinal epithelium, and maintains the stemness of ISCs in a cell-autonomous manner. Notably, inhibition of histone deacetylases can rescue both self-renewal and differentiation capacities of Prmt5-depleted ISCs. These findings highlight Prmt5 as a critical regulator in intestinal epithelium development and tissue homeostasis.

HTT
Also flagged:Huntingtinadaptor proteinsmotor proteinsorganellesBDNFvesicles
Journal Article 2025-02-05 ✓ 2 Snippets Prowse ENP, Turkalj BA, Gursu L, Hendricks AG.
In-Text Gene Mentions

…Huntingtin (HTT) is a ubiquitously…

HTTis remarkable in…

Show Full Abstract

A dynamic network of scaffolding molecules, adaptor proteins, and motor proteins work together to orchestrate the movement of proteins, mRNA, and vesicular cargoes. Defects in intracellular transport can often lead to neurodegeneration. Huntingtin (HTT) is a ubiquitously expressed scaffolding protein with a multitude of cellular roles, including regulating the transport of various organelles. HTT is remarkable in its ability to regulate the transport of a wide range of cargoes, including BDNF vesicles, APP vesicles, early endosomes, autophagosomes, lysosomes, and mitochondria. This interaction network allows huntingtin to control microtubule-based transport by kinesin and dynein, as well as actin-based transport by myosin VI. By forming complexes with multiple motor adaptors, huntingtin regulates a variety of cargoes and guides cargoes through the different stages of biosynthesis, signaling, and degradation. Accordingly, pathogenic polyglutamine expansions seen in Huntington's Disease (HD) dysregulate huntingtin transport complexes, resulting in defects in transport and neurodegeneration.

ARFGEF2
Also flagged:bladder cancercancertumoroncogenessuppressorsprotease
Journal Article 2025-02-05 ✓ 1 Snippet Alem D, García-Laviña CX, Garagorry F, Centurión D, Farias J, Pazos-Espinosa H, Cuitiño-Mendiberry MN, Villadóniga C, Castro-Sowinski S, Fló M, Carrión F, Iglesias B, Madauss K, Canclini L.
In-Text Gene Mentions

…mutations (GNB2 andARFGEF2) were also found…

Show Full Abstract

Despite the current diagnostic and therapeutic approaches to bladder cancer being widely accepted, there have been few significant advancements in this field over the past decades. This underscores the necessity for a paradigm shift in the approach to bladder cancer. The role of amyloids in cancer remains unclear despite their identification in several other pathologies. In this study, we present evidence of amyloids in bladder cancer, both in vitro and in vivo. In a murine model of bladder cancer, a positive correlation was observed between amyloids and tumor stage, indicating an association between amyloids and bladder cancer progression. Subsequently, the amyloid proteome of the RT4 non-invasive and HT1197 invasive bladder cancer cell lines was identified and included oncogenes, tumor suppressors, and highly expressed cancer-related proteins. It is proposed that amyloids function as structures that sequester key proteins. Therefore, amyloids should be considered in the study and diagnosis of bladder cancer.

Also flagged:carbon dioxideheterocyclescarboncyclic carbonatesoxazolidinoneketimine
Journal Article 2025-02-05 No Snippets Shi W, Benet-Buchholz J, Kleij AW.
Show Full Abstract

Converting carbon dioxide (CO<sub>2</sub>) into valuable heterocycles is of great synthetic value but is usually limited to five- and six-membered ring compounds. Here, we report a catalytic approach for transforming this carbon renewable into seven-membered heterocycles using a double-stage approach, combining a silver-catalyzed alkyne/CO<sub>2</sub> coupling and a subsequent base-catalyzed ring-expansion. This methodology avoids the formation of thermodynamically more stable, smaller-ring by-products and has good functional group tolerance. The synthetic application of these larger-ring cyclic carbonates is further demonstrated by showing their unique ability to serve as synthons for the preparation of bicyclic oxazolidinone pharmacores through an intramolecular domino sequence that involves a transient ketimine group, and various other intermolecular transformations. The results described herein significantly expand on the use of CO<sub>2</sub> as a cheap and versatile carbon feedstock generating elusive heterocycles and pharmaceutically relevant compounds.

TNFSF4
Also flagged:Stomach adenocarcinomaSTADprogrammed celldeathextracellulartumor
Journal Article 2025-02-05 ✓ 1 Snippet Zhou Z, Yang L, Fang Y, Xu R, Wang X, Wang Y, Fang Z.
In-Text Gene Mentions

…TNFSF18, CD200, NRP1,TNFSF4(R > 0.2, Fig.…

Show Full Abstract

Stomach adenocarcinoma (STAD) is the most prevalent gastrointestinal malignancy and seriously threatens the life of the global population. Anoikis, a process of programmed cell death that occurs when cells detach from the extracellular matrix, is closely associated with tumor invasion and metastasis. In this study, we used the TCGA-STAD database to identify the expression patterns and prognostic relevance of anoikis-related genes (ARGs) in STAD. Functional enrichment analysis was used to explore the potential pathway. LASSO and Cox regression were used to construct anoikis-related prognostic signature. The anoikis risk score (ARS) incorporated 7 genes and stratified patients into highand low-risk subgroups by median value splitting. In addition, external validation was performed based on GSE66229, GSE15459, and GSE84437 cohorts. Nomograms were created based on risk characteristics in combination with clinical variants and the performance of the model was validated with time-dependent AUC, calibration curves, and decision curve analysis (DCA). The prognostic signature indicated that the low-risk subgroup had better outcomes and significant correlations with tumor microenvironment, immune landscape, immunotherapy response, and drug sensitivity. In addition, single-cell analysis displayed the cell types, the subcellular localization of prognostic genes, and the cellular interaction to reveal the potential molecular communication mechanism of anoikis resistance. Finally, in vitro experiments confirmed the critical role of CRABP2 in STAD. The results indicated that CRABP2 knockdown inhibited gastric cancer cell proliferation, migration and invasion, and promoted apoptosis. In summary, ARS can serve as a biomarker for predicting survival outcomes in STAD patients, providing new tools for personalized treatment decisions for STAD patients.

Also flagged:doxorubicincarfilzomibCanceranthracyclineproteasomeheart failure
Journal Article 2025-02-05 No Snippets Kelly C, Kiltschewskij DJ, Leong AJW, Haw TJ, Croft AJ, Balachandran L, Chen D, Bond DR, Lee HJ, Cairns MJ, Sverdlov AL, Ngo DTM.
Show Full Abstract

Cancer therapy-related cardiovascular toxicity (CTR-CVT) is now recognised as one of the leading causes of long-term morbidity and mortality in cancer patients. To date, potential overlapping cardiotoxicity mechanism(s) across different chemotherapeutic classes have not been elucidated. Doxorubicin, an anthracycline, and Carfilzomib, a proteasome inhibitor, are both known to cause heart failure in some patients. Given this common cardiotoxic effect of these chemotherapies, we aimed to investigate differential and common mechanism(s) associated with Doxorubicin and Carfilzomib-induced cardiac dysfunction. Primary human cardiomyocyte-like cells (HCM-ls) were treated with 1 µM of either Doxorubicin or Carfilzomib for 72 h. Both Doxorubicin and Carfilzomib induced a significant reduction in HCM cell viability and cell damage. DNA methylation analysis performed using MethylationEPIC array showed distinct and common changes induced by Doxorubicin and Carfilzomib (10,270 or approximately 12.9% of the DMPs for either treatment overlapped). RNA-seq analyses identified 5,643 differentially expressed genes (DEGs) that were commonly dysregulated for both treatments. Pathway analysis revealed that the PI3K-Akt signalling pathway was the most significantly enriched pathway with common DEGs, shared between Doxorubicin and Carfilzomib. We identified that there are shared cardiotoxicity mechanisms for Doxorubicin and Carfilzomib pathways that can be potential therapeutic targets for treatments across 2 classes of anti-cancer agents.

Also flagged:CD73Lung adenocarcinomaLUADlung cancercancerefferocytosis
Journal Article 2025-02-05 No Snippets Chen L, Qi T, Zhang B, Wang X, Zheng M.
Show Full Abstract

Lung adenocarcinoma (LUAD), the most common type of lung cancer, is a leading cause of cancer-related mortality. NT5E, an ecto-5'-nucleotidase enzyme, has been implicated in cancer progression, particularly in efferocytosis. Despite its potential involvement, the prognostic significance of NT5E and relationship with immune cell infiltration in LUAD have not been extensively explored. In this study, we performed a comprehensive analysis to elucidate the expression patterns of NT5E and its prognostic implications in LUAD using data from diverse public databases. Multiple computational algorithms, including CIBERSORT, ESTIMATE, and xCell, were employed to assess the correlation between NT5E expression and immune cell infiltration. We found that NT5E was significantly overexpressed at both the mRNA and protein levels in LUAD tissues. Elevated NT5E expression was significantly linked to multiple clinicopathological factors, including metastasis and pathological stage, and served as a strong predictor of poor prognosis in LUAD patients. Gene Set Enrichment Analysis (GSEA) indicated that NT5E plays a crucial role in regulating immune responses, as evidenced by differential gene expression associated with NT5E levels. A strong positive correlation was observed between NT5E expression and the presence of immune cells, including dendritic cells, macrophages, and CD4<sup>+</sup> T cells, as well as the expression of various immune cell markers, suggesting that NT5E may influence the prognosis of LUAD patients by regulating immune cell infiltration. Additionally, drug sensitivity analysis highlights the potential of selumetinib and PD318088, both MEK1/2 inhibitors, to target NT5E in LUAD treatment, suggesting their use as single agents or in combination with other therapies. Collectively, these findings establish NT5E as a promising prognostic biomarker and therapeutic target in LUAD, particularly in the context of immune cell infiltration.

HFE
Also flagged:acuteosteofascial compartment syndromerenal failureinfectioninflammatory diseaseferroptosis
Journal Article 2025-02-05 ✓ 1 Snippet Lu Q, Ling H, Lao Y, Liu J, Su W, Huang Z.
In-Text Gene Mentions

…overload in ahemochromatosismouse model […

Show Full Abstract

<h4>Background</h4>Acute Osteofascial Compartment Syndrome (AOCS) stands as a critical surgical emergency, often secondary to various diseases. Its clinical manifestation arises from increased pressure within the fascial compartment, resulting in diminished tissue perfusion and consequential ischemic damage. Presently, clinical diagnostics lack effective biological markers, and patients face a grim prognosis, experiencing muscle contractures, necrosis, amputations, renal failure, and even mortality. The primary treatment, fasciotomy, poses infection risks and potential nerve damage. Hence, there is an urgent need for research elucidating AOCS's pathogenic mechanism and exploring novel treatments.<h4>Methods</h4>To address this, we established a rat model of AOCS, extracting toe flexor muscles from both experimental and control groups. Employing second-generation high-throughput sequencing, we obtained comprehensive mRNA, lncRNA, circRNA, and miRNA data. Comparative analysis of expression differences between AOCS and control groups, followed by in-depth examination, allowed us to unravel the intricacies of AOCS occurrence from a multi-omics perspective.<h4>Results</h4>Our research findings indicate that AOCS is an immune-mediated inflammatory disease, primarily involving immune cells, especially neutrophils. In addition, genes associated with ferroptosis, a form of regulated cell death, are found to be upregulated in the rat model, with non-coding RNAs playing a role in regulatory interactions.<h4>Conclusions</h4>These results suggest that neutrophils may undergo ferroptosis, thereby enhancing inflammation and immune responses in the fascial compartment, which promotes disease progression. Furthermore, these findings reveal the interactions between immune molecules and pathways in AOCS, which are significant for a deeper understanding of the pathogenesis of the disease and the development of targeted therapeutic strategies.

ECI2
Also flagged:post-translational modificationsgene expressionrenal cell carcinomaO-GlcNAc TransferaseOGTmethylation
Journal Article 2025-02-05 ✓ 2 Snippets Boyd SS, Slawson C, Thompson JA.
In-Text Gene Mentions

…ECI1 (T,P) andECI2(T,P).…

…notable exception ofECI2with consistent up-regulation…

Show Full Abstract

<h4>Background</h4>Multi-omic studies provide comprehensive insight into biological systems by evaluating cellular changes between normal and pathological conditions at multiple levels of measurement. Biological networks, which represent interactions or associations between biomolecules, have been highly effective in facilitating omic analysis. However, current network-based methods lack generalizability to accommodate multiple data types across a range of diverse experiments.<h4>Results</h4>We present AMEND 2.0, an updated active module identification method which can analyze multiplex and/or heterogeneous networks integrated with multi-omic data in a highly generalizable framework, in contrast to existing methods, which are mostly appropriate for at most two specific omic types. It is powered by Random Walk with Restart for multiplex-heterogeneous networks, with additional capabilities including degree bias adjustment and biased random walk for multi-objective module identification. AMEND was applied to two real-world multi-omic datasets: renal cell carcinoma data from The cancer genome atlas and an O-GlcNAc Transferase knockout study. Additional analyses investigate the performance of various subroutines of AMEND on tasks of node ranking and degree bias adjustment.<h4>Conclusions</h4>While the analysis of multi-omic datasets in a network context is poised to provide deeper understanding of health and disease, new methods are required to fully take advantage of this increasingly complex data. The current study combines several network analysis techniques into a single versatile method for analyzing biological networks with multi-omic data that can be applied in many diverse scenarios. Software is freely available in the R programming language at https://github.com/samboyd0/AMEND .

Also flagged:gene expressioncancergenetic disordersinfectionRNA polymerase IIIpol III
Journal Article 2025-02-05 No Snippets Liu S, Hamilton MC, Cowart T, Barrera A, Bounds LR, Nelson AC, Dornbaum SF, Riley JW, Doty RW, Allen AS, Crawford GE, Majoros WH, Gersbach CA.
Show Full Abstract

Single-cell RNA sequencing CRISPR (perturb-seq) screens enable high-throughput investigation of the genome, allowing for characterization of thousands of genomic perturbations on gene expression. Ambient gRNAs, which are contaminating gRNAs, are a major source of noise in perturb-seq experiments because they result in an excess of false-positive gRNA assignments. Here, we utilize CRISPR barnyard assays to characterize ambient gRNAs in perturb-seq screens. We use these datasets to develop CRISPR Library Evaluation and Ambient Noise Suppression for Enhanced single-cell RNA-seq (CLEANSER), a mixture model that filters ambient gRNAs. CLEANSER includes both gRNA and cell-specific normalization parameters, correcting for confounding technical factors that affect individual gRNAs and cells. The output of CLEANSER is the probability that a gRNA-cell assignment is in the native distribution over the ambient distribution. We find that ambient gRNA filtering methods impact differential gene expression analysis outcomes and that CLEANSER outperforms alternate approaches by increasing gRNA-cell assignment accuracy across multiple screen formats.

SERPINC1
Also flagged:circulationdilated cardiomyopathyretinoic acidsynthesisall-trans retinoic acidheart failure
Journal Article 2025-02-05 ✓ 1 Snippet Zhang F, Wang Y, Zhu J, Wang J, Li Q, Feng J, Liu M, Li K, Tan J, Luo R, Yang H, Hou Y, He F, Qin J, Ding C, Yang W.
In-Text Gene Mentions

…inhibitors such asSerpinc1, Serpind1, and Serpinf2…

Show Full Abstract

The heart is a vital muscular organ in vertebrate animals, responsible for maintaining blood circulation through rhythmic contraction. Although previous studies have investigated the heart proteome, the full hierarchical molecular network at cell-type- and region-resolved level, illustrating the specialized roles and crosstalk among different cell-types and regions, remains unclear. Here, we presented an atlas of cell-type-resolved proteome for mouse heart and region-resolved proteome for both mouse and human hearts. In-depth proteomic analysis identified 11,794 proteins across four cell-types and 11,995 proteins across six regions of the mouse heart. To further illustrate protein expression patterns in both physiological and pathological conditions, we conducted proteomic analysis on human heart samples from four regions with dilated cardiomyopathy (DCM). We quantified 8201 proteins in DCM tissue and 8316 proteins in adjacent unaffected myocardium tissue across the four human heart regions. Notably, we found that the retinoic acid synthesis pathway was significantly enriched in the DCM-affected left ventricle, and functional experiments demonstrated that all-trans retinoic acid efficiently rescued Ang II-induced myocardial hypertrophy and transverse aorta constriction-induced heart failure. In conclusion, our datasets uncovered the functional features of different cell-types and their synergistic cooperation centered by cell-type-specific transcription factors (TFs) in different regions, while these TF-TG (target gene) axes were significantly altered in DCM. Additionally, all-trans retinoic acid was demonstrated to be an efficient treatment for heart failure. This work presented a panoramic heart proteome map, offering a valuable resource for future cardiovascular research.

Also flagged:Tumorgene expressioncancerchromatinwound healingEMP
Journal Article 2025-02-05 No Snippets Yuan Y, Tang Y, Fang Z, Wen J, Wicha MS, Luo M.
Show Full Abstract

Long non-coding RNAs (lncRNAs) are a class of non-coding RNA molecules with transcripts longer than 200 bp, which were initially thought to be noise from genomic transcription without biological function. However, since the discovery of H19 in 1980 and Xist in 1990, increasing evidence has shown that lncRNAs regulate gene expression at epigenetic, transcriptional, and post-transcriptional levels through specific regulatory actions and are involved in the development of cancer and other diseases. Despite many lncRNAs being expressed at lower levels than those of protein-coding genes with less sequence conservation across species, lncRNAs have become an intense area of RNA research. They exert diverse biological functions such as inducing chromatin remodeling, recruiting transcriptional machinery, acting as competitive endogenous RNAs for microRNAs, and modulating protein-protein interactions. Epithelial-mesenchymal transition (EMT) is a developmental process, associated with embryonic development, wound healing, and cancer progression. In the context of oncogenesis, the EMT program is transiently activated and confers migratory/invasive and cancer stem cell (CSC) properties to tumor cells, which are crucial for malignant progression, metastasis, and therapeutic resistance. Accumulating evidence has revealed that lncRNAs play crucial roles in the regulation of tumor epithelial/mesenchymal plasticity (EMP) and cancer stemness. Here, we summarize the emerging roles and molecular mechanisms of lncRNAs in regulating tumor cell EMP and their effects on tumor initiation and progression through regulation of CSCs. We also discuss the potential of lncRNAs as diagnostic and prognostic biomarkers and therapeutic targets.

Also flagged:CRISPRCas9polymalic acidpolyglutamic acidpolyaspartic acidtrileucine
Journal Article 2025-02-05 No Snippets Chepurna O, Chatterjee A, Li Y, Ding H, Murali R, Black KL, Sun T.
Show Full Abstract

Despite wide applications of CRISPR/Cas9 technology, effective approaches for CRISPR delivery with functional control are limited. In an attempt to develop a nanoscale CRSIPR/Cas9 delivery platform, we discovered that several biocompatible polymers, including polymalic acid (PMLA), polyglutamic acid (PGA), and polyaspartic acid (PLD), when conjugated with a trileucine (LLL) moiety, can effectively inhibit Cas9 nuclease function. The Cas9 inhibition by those polymers is dose-dependent, with varying efficiency to achieve 100% inhibition. Further biophysical studies revealed that PMLA-LLL directly binds the Cas9 protein, resulting in a substantial decrease in Cas9/sgRNA binding affinity. Transmission electron microscopy and molecular docking were performed to provide a possible binding mechanism for PMLA-LLL to interact with Cas9. This work identified a new class of Cas9 inhibitor in nano-polymer form. These biodegradable polymers may serve as novel Cas9 delivery vehicles with a potential to enhance the precision of Cas9-mediated gene editing.

Also flagged:developmental delayDDautism spectrum disorderintellectual disabilityIDattention-deficit/hyperactivity disorder
Journal Article 2025-02-05 No Snippets Lamilla J, Castro-Cuesta TA, Rueda-Gaitán P, Rios Pinto LC, Rodríguez Gutiérrez DA, Sanchez Rubio YN, Estrada-Serrato C, Londoño O, Rucinski C, Arcos-Burgos M, Isaza-Ruget M, López Rivera JJ.
Show Full Abstract

<b>Background and Objectives</b>: Neurodevelopmental disorders (NDDs), including developmental delay (DD), autism spectrum disorder (ASD), intellectual disability (ID), attention-deficit/hyperactivity disorder (ADHD), and specific learning disorders, affect 15% of children and adolescents worldwide. Advances in next-generation sequencing, particularly whole exome sequencing (WES), have improved the understanding of NDD genetics. <b>Methodology</b>: This study analyzed 3244 patients undergoing WES (single, duo, trio analyses), with 1028 meeting inclusion criteria (67% male; aged 0-50 years). <b>Results</b>: Pathogenic (P) or likely pathogenic (LP) variants were identified in 190 patients, achieving a diagnostic yield of 13.4% (singleton), 14% (duo), and 21.2% (trio). A total of 207 P/LP variants were identified in NDD-associated genes: 38% were missense (48 de novo), 29% frameshift (26 de novo), 21% nonsense (14 de novo), 11% splicing site (14 de novo), and 1% inframe (1 de novo). De novo variants accounted for 49.8% of cases, with 86 novels de novo variants and 27 novel non de novo variants unreported in databases like ClinVar or scientific literature. <b>Conclusions</b>: This is the largest study on WES in Colombian children with NDDs and one of the largest in Latino populations. It highlights WES as a cost-effective first-tier diagnostic tool in low-income settings, reducing diagnostic timelines and improving clinical care. These findings underscore the feasibility of implementing WES in underserved populations and contribute significantly to understanding NDD genetics, identifying novel variants with potential for further research and clinical applications.

MLLT10
Also flagged:ALLcancerdactinomycincytarabinesolid tumorstranslational
Journal Article 2025-02-05 ✓ 1 Snippet Chiu SK, Ferrari E, Oommen J, Malinge S, Cheung LC, Kotecha RS.
In-Text Gene Mentions

…the t(10;11) or KMT2A/MLLT10translocation) at 1…

Show Full Abstract

<i>Background/Objectives</i>: Infants with <i>KMT2A</i>-rearranged B-cell acute lymphoblastic leukemia (ALL) have high rates of relapse and poor survival compared with children. Few new therapies have been identified over the past twenty years. The aim of this study was to identify existing anti-cancer agents that have the potential to be repurposed for the treatment of infant ALL. <i>Methods</i>: Eight extensively characterized infant ALL cell lines were treated with 62 anti-neoplastic drugs in vitro to identify agents that exhibit significant cytotoxicity. From this screen, we selected the most effective and clinically translatable agent for further in vitro and in vivo assessment to determine the potential for use in the clinical setting. <i>Results</i>: Our anti-cancer drug screen revealed significant activity of dactinomycin across all infant ALL cell lines. Further in vitro testing identified low half-maximal inhibitory concentrations (IC<sub>50</sub>) across our infant ALL cell lines in the nanomolar range. Combination testing with the conventional chemotherapeutic agents currently used to treat infants with ALL demonstrated additivity with cytarabine. In vivo assessment of dactinomycin identified 36 μg/kg as the maximum tolerated dose, with unacceptable toxicities at higher dose treatment. Treatment using doses of 18 μg/kg administered either once or twice a week derived a small but significant survival benefit in patient-derived xenografts. <i>Conclusions</i>: Dactinomycin is extensively used for the treatment of solid tumors in children and has an acceptable safety profile when used to treat infants in this context. However, despite being readily translational and exhibiting promising in vitro cytotoxicity, dactinomycin showed limited efficacy in vivo and therefore does not represent a priority candidate for integrating into therapy for infants with ALL.

Also flagged:Ferroptosishead and neck squamous cell carcinomaHNSCCoropharyngeal squamous cell carcinomaapoptotic cell deathcancer
Journal Article 2025-02-05 No Snippets Lenoci D, Serafini MS, Lucchetta M, Cavalieri S, Brakenhoff RH, Hoebers F, Scheckenbach K, Poli T, Licitra L, De Cecco L.
Show Full Abstract

<h4>Background</h4>Despite advances in the management of head and neck squamous cell carcinoma (HNSCC), prognostic models and treatment strategies remain inadequate, particularly for HPV-positive oropharyngeal squamous cell carcinoma (OPSCC). The rising incidence of HPV-positive OPSCC highlights an urgent need for innovative therapeutic approaches. Ferroptosis, a regulated form of non-apoptotic cell death, has gained attention for its role in cancer progression, but its potential as a prognostic and therapeutic target in HPV-positive OPSCC remains largely unexplored. This study investigates the role of ferroptosis in HPV-positive OPSCC, aiming to identify prognostic markers and provide insights into potential therapeutic strategies that could improve patient outcomes.<h4>Methods</h4>Thirteen ferroptosis gene expression signatures were retrieved from the literature, and their performance and association to the immune microenvironment were validated on a meta-analysis of 267 HPV-positive cases (Metanalysis-HPV267) and 286 samples from the BD2Decide project (BD2-HPV286).<h4>Results</h4>Our analysis revealed that specific ferroptosis-related gene expression signatures, particularly FER3, FER4, FER6, and FER12, are significantly associated (<i>p</i>-value < 0.05) with high-risk patient groups and adverse tumor microenvironment features, including suppressed immune activity and enhanced stromal involvement. Elevated expression of CAV1, a ferroptosis suppressor, further delineates high-risk profiles.<h4>Conclusions</h4>These findings highlight the prognostic significance of ferroptosis in stratifying patients and identifying those with poorer clinical outcomes. Targeting ferroptosis pathways represents a novel and promising approach to addressing the unmet need for effective prognostic and therapeutic strategies in HPV-positive OPSCC. Future research should focus on translating these findings into clinical applications to advance precision oncology and improve outcomes for this growing patient population.

DNAH10
Also flagged:inseminationspermatogenesisDNAI2PNLDC1RSPH3DYNLT1
Journal Article 2025-02-05 ✓ 5 Snippets Zhang X, Xu Z, Lin Q, Gao Y, Qiu X, Li J, Xie S.
In-Text Gene Mentions

…chain 10 (DNAH10), strawberry notch…

…The candidate genesDNAH10(Duroc), DNAI2 (Landrace),…

DNAH10(Duroc) and DNAI2…

…eQTL of theDNAH10gene in testis…

…expression of theDNAH10gene.…

Show Full Abstract

High-quality semen is an essential factor for the success of artificial insemination, and revealing the genetic structure of pig semen traits helps improve semen quality. This study aimed to identify candidate genes associated with semen traits in three pig breeds (Duroc, Landrace, and Yorkshire) through weighted GWAS and multi-tissue transcriptome analysis. In this study, to identify candidate genes associated with semen traits in Duroc, Landrace, and Yorkshire, we performed weighted GWAS in four traits (sperm motility, sperm progressive motility, sperm abnormality rate, and total sperm count) using 936 pigs and multi-tissue transcriptome analysis using 34 tissues RNA-seq data of 5457 pigs from FarmGTEx. It was found that 16, 9, and 12 significant SNPs associated with semen traits were identified in Duroc, Landrace, and Yorkshire, with corresponding 7, 5, and 7 candidate genes in these three breeds, respectively, which may be involved in mammal spermatogenesis, testicular function, and male fertility. Moreover, we not only found the same candidate gene <i>DNAI2</i> as in previous studies but also found two new candidate genes <i>PNLDC1</i> and <i>RSPH3</i>, which were identified simultaneously in both Landrace and Yorkshire. By integrating the GWAS and multi-tissue transcriptome analysis results, we found that candidate genes associated with semen traits of three pig breeds were highly expressed in the testis tissue. The three genotypes of rs320928244 had significant effects on the expression of the <i>DYNLT1</i> gene in the testis tissue of Landrace. These results together showed that these candidate genes were mainly related to sperm motility defects. This study helps deepen the understanding of the genetic basis of semen traits and provides a theoretical foundation for improving the semen quality of Duroc, Landrace, and Yorkshire breeds.

Also flagged:type I fimbriaeorganellesbiotinhydrazideglycansglycosidase
Journal Article 2025-02-05 No Snippets Kavanaugh DW, Sivignon A, Rossez Y, Chouit Z, Chambon C, Béal L, Bonnet M, Hébraud M, Guérardel Y, Nguyen HTT, Barnich N.
Show Full Abstract

The <i>Escherichia coli</i> surfaceome consists mainly of the large surface organelles expressed by the organism to navigate and interact with the surrounding environment. The current study focuses on type I fimbriae and flagella. These large polymeric surface organelles are composed of hundreds to thousands of subunits, with their large size often preventing them from being studied in their native form. Recent studies are accumulating which demonstrate the glycosylation of surface proteins or virulence factors in pathogens, including <i>E. coli</i>. Using biochemical and glycobiological techniques, including biotin-hydrazide labeling of glycans and chemical and glycosidase treatments, we demonstrate (i) the presence of a well-defined and chemically resistant FimA oligomer in several strains of pathogenic and non-pathogenic <i>E. coli</i>, (ii) the major subunit of type I fimbriae, FimA, in pathogenic and laboratory strains is recognized by concanavalin A, (iii) standard methods to remove <i>N</i>-glycans (PNGase F) or a broad-specificity mannosidase fail to remove the glycan structure, despite the treatments resulting in altered migration in SDS-PAGE, (iv) PNGase F treatment results in a novel 32 kDa band recognized by anti-FliC antiserum. While the exact identity of the glycan(s) and their site of attachment currently elude detection by conventional glycomics/glycoproteomics, the current findings highlight a potential additional layer of complexity of the surface (glyco) proteome of the commensal or adhesive and invasive <i>E. coli</i> strains studied.

STAU1
Also flagged:AKTneurodegenerative disorderPDα-synucleinα-SynNF-κB
Journal Article 2025-02-05 ✓ 1 Snippet Ranxhi B, Bangash ZR, Chbihi ZM, Todi SV, LeWitt PA, Tsou WL.
In-Text Gene Mentions

…mTOR, LC3-II, p62,STAU1, BiP, and CHOP…

Show Full Abstract

Parkinson's disease (PD) is a progressive neurodegenerative disorder affecting millions of individuals worldwide. A hallmark of PD pathology is the accumulation of α-synuclein (α-Syn), a small protein known to support neuronal development and function. However, in PD, α-Syn cumulatively misfolds into toxic aggregates that disrupt cellular processes and contribute to neuronal damage and neurodegeneration. Previous studies implicated the AKT signaling pathway in α-Syn toxicity in cellular models of PD, suggesting AKT as a potential therapeutic target. Here, we investigated the effect of AKT inhibition in a <i>Drosophila</i> model of synucleinopathy. We observed that administration of the AKT inhibitor, A-443654 led to mild improvements in both survival and motor function in flies expressing human α-Syn. Genetic studies revealed that reduction of AKT levels decreased α-Syn protein levels, concomitant with improved physiological outcomes. The protective effects of AKT reduction appear to operate through the fly ortholog of NF-κB, Relish, suggesting a link between AKT and NF-κB in regulating α-Syn levels. These findings highlight the AKT cascade as a potential therapeutic target for synucleinopathies and provide insights into mechanisms that could be utilized to reduce α-Syn toxicity in PD and related disorders, such as multiple system atrophy.

Also flagged:ischemic strokestrokehypertensiondiabetesheart diseasedyslipidemia
Journal Article 2025-02-05 No Snippets Chen W, Li J, Zhou J, Yi X, Chen H.
Show Full Abstract

<h4>Aim</h4>Evaluate the correlation between ischemic stroke and genetic variations related to inflammation and endothelial function.<h4>Methods</h4>This was a multicenter cross-sectional research conducted in southwestern China. Residents aged ≥40 years voluntarily join in the face-to-face survey in 8 communities. 2,377 participants were at high risk of stroke, of which 429 had a previous history of ischemic stroke. We selected the 429 ischemic stroke patients as the research subjects, and adopted a 1:1 matching method to select 429 healthy people with a 2-year age difference and the same gender and hypertension as the control group. We detected genotypes of 19 variants in 10 genes related to inflammation and endothelial function. Analyze gene-gene interaction through generalized multifactor dimensionality reduction (GMDR).<h4>Results</h4>Analysis found no statistically significant differences in age, gender, hypertension, BMI, and smoking history between ischemic stroke patients and healthy control group. Compared with the healthy group, ischemic stroke group has a higher proportion of diabetes, heart disease, dyslipidemia, stroke family history, and a higher proportion of lack of exercise. <i>HABP2</i> rs7923349, <i>NOS2A</i> rs8081248, <i>HABP2</i> rs932650 were related to stroke in univariate analysis. GMDR analysis showed significant gene-gene interactions between <i>HABP2</i> rs7923349, <i>HABP2</i> rs932650. After adjusting for covariates, high-risk interaction genotypes between these two variants were independently associated with higher stroke risk (OR, 3.578, 95% CI: 2.618-4.890, <i>p</i> < 0.001).<h4>Conclusion</h4>This study found that specific variations in genes related to inflammation and endothelial function are associated with ischemic stroke. The high-risk interactive genotypes among <i>HABP2</i> rs7923349, <i>HABP2</i> rs932650 distinctly increased the risk of ischemic stroke.

Also flagged:Ironferroptosiskidney diseaserenal disordersacute kidney injuryrenal ischemia
Journal Article 2025-02-05 No Snippets Wang W, Chen J, Zhan L, Zou H, Wang L, Guo M, Gao H, Xu J, Wu W.
Show Full Abstract

Maintaining iron homeostasis is necessary for kidney functioning. There is more and more research indicating that kidney disease is often caused by iron imbalance. Over the past decade, ferroptosis' role in mediating the development and progression of renal disorders, such as acute kidney injury (renal ischemia-reperfusion injury, drug-induced acute kidney injury, severe acute pancreatitis induced acute kidney injury and sepsis-associated acute kidney injury), chronic kidney disease (diabetic nephropathy, renal fibrosis, autosomal dominant polycystic kidney disease) and renal cell carcinoma, has come into focus. Thus, knowing kidney iron metabolism and ferroptosis regulation may enhance disease therapy. In this review, we discuss the metabolic and molecular mechanisms of iron signaling and ferroptosis in kidney disease. We also explore the possible targets of ferroptosis in the therapy of renal illness, as well as their existing limitations and future strategies.

SERPINC1
Also flagged:anticoagulant deficiencycerebral venous thrombosisdeep venous thrombosisDVTvenous thromboembolismProtein C
Journal Article 2025-02-05 ✓ 2 Snippets Tran SG, Vu MP, Nguyen TTM, Nguyen TT, Pham PT, Hoang TH, Vu H, Kieu TVO, Duong HY.
In-Text Gene Mentions

…, PROS1 andSERPINC1genes, respectively (…

…PROC, PROS1 andSERPINC1gene mutations, respectively…

Show Full Abstract

The impact of a deficiency in natural anticoagulants on the occurrence of cerebral venous thrombosis (CVT) is controversial, as well as whether there is a difference between CVT and deep venous thrombosis (DVT). The present study aimed to evaluate the association between a deficiency in natural anticoagulants and the occurrence of CVT vs. DVT. For this purpose, 274 patients newly diagnosed with venous thromboembolism (VTE), including 114 patients with DVT (41.6%), 81 patients with CVT (29.6%) and 79 patients (28.8%) with another type of VTE were retrospectively analyzed. In addition, 219 patients without thrombosis were used as the control group. Protein C (PC), protein S (PS) and antithrombin III (AT III) assays were performed prior to commencing treatment. The rates of PC, PS, AT III deficiency in the VTE group were 23.7, 28.8 and 14.2%, respectively. The rates of PC, PS, AT III deficiency in the CVT group were 21, 29.6 and 7.4%, respectively. The rates of PC, PS, AT III deficiency in the DVT group were 28, 34.2 and 15.8%, respectively. There was no significant difference between the DVT and CVT groups. Univariable and multivariable regression analysis revealed that PS deficiency was associated with the occurrence of all VTE types, DVT and CVT with odds ratios of 1.895, 2.330 and 2.052, respectively. On the whole, the present study demonstrates that PS deficiency is associated with the occurrence of CVT. No marked differences were noted between the deficiency in natural anticoagulants and CVT and DVT. These results may prove to be useful in deciding whether to perform natural anticoagulants testing in patients with CVT.

HTT
Also flagged:neurodegenerative diseasecytosineadenineguanineHuntingtons Disease
Journal Article 2025-02-05 ✓ 1 Snippet Lotspeich SC, Garcia TP.
In-Text Gene Mentions

HTT

Show Full Abstract

Modeling symptom progression to identify ideal subjects for a Huntington's disease clinical trial is problematic since time to diagnosis, a key covariate, can be heavily censored. Imputation is an appealing strategy that replaces the censored covariate with its conditional mean, but existing methods saw over 200% bias under heavy censoring. Calculating conditional means well requires estimating and then integrating over the survival function of the censored covariate from the censored value to infinity. To estimate the survival function flexibly, existing methods use the semiparametric Cox model with Breslow's estimator, leaving the integrand for the conditional means (the survival function) undefined beyond the observed data. The integral is then estimated up to the largest observed covariate value, and this approximation can cut off the tail of the survival function and lead to severe bias. We combine the semiparametric survival estimator with a parametric extension to approximate the integral up to infinity. In simulations, our proposed extrapolation-before-imputation approach substantially reduces the bias seen with existing imputation methods, sometimes even when the parametric extension was misspecified. We further demonstrate how imputing with corrected conditional means can prioritize subjects for clinical trials. The R code to reproduce results is available in the Supplementary Material.

HTT
Also flagged:ViolenceaggressionConduct DisorderOppositional Defiant DisorderDisruptive Mood Dysregulation DisorderAutism Spectrum Disorders
Journal Article 2025-02-05 ✓ 1 Snippet Dugré JR, Hopfer CJ, Winters DE.
In-Text Gene Mentions

…5-HT 6 , 5-HTT), dopamine (i.e., D…

Show Full Abstract

Aggression is a worldwide issue that has significant consequences for both the victims and societies. However, aggression may vary in its underlying motivation (i.e., reactive versus proactive) and the forms in which it occurs (i.e., physical versus verbal). Yet, functional brain correlates differentiating these types remains largely unknown. A systematic search was conducted up to May 1st 2023, using PubMed, Google Scholar, and Web of Science, to identify relevant functional neuroimaging studies that included measures of General Aggression, Reactive Aggression, Proactive Aggression, Physical Aggression and Verbal Aggression. Coordinate-based meta-analysis was conducted using both spatial convergence (ALE) and effect-size (SDM-PSI) approaches. Sixty-seven functional neuroimaging studies met the inclusion criteria. Meta-analysis revealed similar yet distinct neural correlates for General Aggression (i.e., Amygdala, Precuneus, Intraparietal Sulcus, Angular and Middle Temporal Gyri), Reactive Aggression (i.e., Amygdala, Periaqueductal Grey, Posterior Insula, & Central Opercular Cortex), Proactive Aggression (i.e., Septal Area, & Amygdala), Physical Aggression (i.e., Dorsal Premotor Cortex, Dorsal Caudate, & Dorsal Anterior Cingulate Cortex), and Verbal (i.e., Dorsal Anterior Cingulate Cortex). Exploratory analyses revealed the importance of affective, cognitive and social cognition processes as well as serotoninergic, dopaminergic, and cholinergic systems in the neural underpinnings of aggressive behaviors. Our findings highlight the importance of examining the types of aggression (i.e., motivation and forms) within a transdiagnostic framework. Therefore, characterizing the neurobiological substrates of aggression may expand our search for targeted neuromodulation and pharmacological treatments.

Article Highlights

HTT
Also flagged:atypical depressionattention deficit hyperactivity disorderbrain disorderaddictiondeathmental disorder
Journal Article 2025-02-05 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…transporter gene (5-HTT), three focused on …

Show Full Abstract

No abstract available.

ISEV2020 Abstract Book

STAU1
Also flagged:extracellularvesicleExtracellular Vesiclesextracellular vesicleRal GTPasesvesicles
Journal Article 2025-02-05 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…adhesion molecule; DHX30,STAU1and VCAM1, respectively.…

Show Full Abstract

No abstract available.

OLFM4
Also flagged:extracellularvesiclesautophagyferroptosisSepsisacute respiratory distress syndrome
Journal Article 2025-02-04 ✓ 5 Snippets Ye R, Wei Y, Li J, Zhong Y, Chen X, Li C.
In-Text Gene Mentions

…2-5p, miR-125b-5p, miR-223-3p,OLFM4, and LCN2) have…

…(Cloud-Clone Corp, China),OLFM4(ELK Biotechnology, China),…

…of CD177, SLPI,OLFM4, and LCN2 were…

…the levels ofOLFM4and LCN2 were…

…2-5p, miR-125b-5p, miR-223-3p,OLFM4, and LCN2 in…

Show Full Abstract

Sepsis-induced acute respiratory distress syndrome (ARDS) is a severe complication of sepsis and the leading cause of mortality. Although the role of alveolar macrophages (AMs) in stabilizing pulmonary homeostasis is well established, the effects of circulating extracellular vesicles (EVs) on AMs remain largely unknown. In this study, an investigation was conducted to map the miRNA and protein expression profiles of EVs derived from septic plasma. Notably, EV-based panels (miR-122-5p, miR-125b-5p, miR-223-3p, OLFM4, and LCN2) have been found to be associated with the severity or prognosis of sepsis, with promising AUC values. Moreover, the levels of LCN2, miR-122-5p, and miR-223-3p were identified as independent predictors of septic ARDS. The in vitro coculture results revealed that the effects of LPS-EVs from the plasma of sepsis-induced acute lung injury (ALI), which carry pro-inflammatory EVs, were partly mediated by miR-223-3p, as evidenced by the promotion of inflammation, autophagy and ferroptosis in AMs. Mechanistically, the upregulation of miR-223-3p in LPS-EVs triggers autophagy and ferroptosis in AMs by activating Hippo signaling via the targeting of MEF2C. In vivo, the inhibition of miR-223-3p effectively mitigated LPS-EV-induced inflammation and AM death in the lungs, as well as histological lesions. Overall, miR-223-3p in LPS-EVs contributes to sepsis-induced ALI by priming AMs for autophagy and ferroptosis through the MEF2C/Hippo signaling pathway. These findings suggest a novel mechanism of plasma-AM interaction in sepsis-induced ALI, offering a plausible strategy for assessing septic progression and treating lung injury.

HTT
Also flagged:Metformincolon cancertumorcolorectal canceradenocarcinomamethylcellulose
Journal Article 2025-02-04 ✓ 1 Snippet Shabkhizan R, Avci ÇB, Haiaty S, Moslehian MS, Sadeghsoltani F, Bazmani A, Mahdipour M, Takanlou LS, Takanlou MS, Zamani ARN, Rahbarghazi R.
In-Text Gene Mentions

…(6.17-fold and 2.90-fold),HTT(sixfold and 4.84-fold),…

Show Full Abstract

<h4>Background</h4>Despite the existence of promising outcomes from standard 2D culture systems, these data are not completely akin to in vivo tumor parenchyma. Therefore, the development and fabrication of various 3D culture systems can in part mimic intricate cell-to-cell interaction within the real tumor mass. Here, we aimed to evaluate the tumoricidal impacts of metformin (MTF) on colorectal cancer (CRC) tumoroids in an in vitro system via the modulation of autophagy.<h4>Methods</h4>CRC tumoroids were developed using human umbilical vein endothelial cells (HUVECs), adenocarcinoma HT29 cells, and fibroblasts (HFFF2) in a ratio of 1: 2: 1 and 2.5% methylcellulose. Tumoroids were exposed to different concentrations of MTF, ranging from 20 to 1000 mM, for 72 h. The survival rate was detected using an LDH release assay. The expression and protein levels of autophagy-related factors were measured using PCR array and western blotting, respectively. Using H & E, and immunofluorescence staining (Ki-67), the integrity and proliferation rate of CRC tumoroids were examined.<h4>Results</h4>The current protocol yielded typical compact tumoroids with a dark central region. Despite slight changes in released LDH contents, no statistically significant differences were achieved in terms of cell toxicity in MTF-exposed groups compared to the control tumoroids, indicating the insufficiency of MTF in the induction of tumor cell death (p > 0.05). Western blotting indicated that the LC3II/I ratio was reduced in tumoroids exposed to 120 mM MTF (p < 0.05). These data coincided with the reduction of intracellular p62 content in MTF 120 mM-treated tumoroids compared to MTF 40 mM and control groups (p < 0.05). PCR array analysis confirmed the up-regulation, and down-regulation of several genes related to various signaling transduction pathways associated with autophagy machinery and shared effectors between autophagy and apoptosis in 40 and 120 mM MTF groups compared to the non-treated control group (p < 0.05). These changes were more prominent in tumoroids incubated with 120 mM MTF. Histological examination confirmed the loosening integrity of tumoroids in MTF-treated groups, especially 120 mM MTF, with the increase in cell death via the induction of apoptosis (chromatin marginalization) and necrotic (pyknotic nuclei) changes. In the 120 mM MTF group, spindle-shaped cells with the remnants of a fibrillar matrix were detected. Data indicated the reduction of proliferating Ki-67<sup>+</sup> cells within the tumoroids by increasing the MTF concentration from 40 to 120 mM.<h4>Conclusions</h4>Different shared autophagy/apoptosis genes were modulated in CRC tumoroids after MTF treatment coinciding with both typical necrotic and apoptotic cells within the tumoroid structure. MTF can inhibit the integrity and proliferation of CRC tumoroids in dose-dependent manner.

PRDX6
Also flagged:Redoxmale infertilitycapacitationoxidasemembranesuperoxide anion
Journal Article 2025-02-04 ✓ 3 Snippets O'Flaherty C.
In-Text Gene Mentions

…Among them,PRDX6, which possesses peroxidase…

…is regulated byPRDX6iPLA 2 ,…

…PRDXs, particularlyPRDX6, are antioxidant enzymes…

Show Full Abstract

<h4>Abstract</h4>Reactive oxygen species (ROS) play a dual role in mammalian spermatozoa. At high levels, they are detrimental to sperm function since they can promote oxidative stress that produces oxidation of protein, lipids, and sperm DNA. This oxidative damage is associated with male infertility. On the other hand, when ROS are produced at low levels, they participate in the redox signaling necessary for sperm capacitation. Capacitation-associated ROS are produced by the sperm oxidase, whose identity is still elusive, located in the plasma membrane of the spermatozoon. ROS, such as superoxide anion, hydrogen peroxide, nitric oxide, and peroxynitrite, activate protein kinases and inactivate protein phosphatases with the net increase of specific phosphorylation events. Peroxiredoxins (PRDXs), antioxidant enzymes that fight against oxidative stress, regulate redox signaling during capacitation. Among them, PRDX6, which possesses peroxidase and calcium-independent phospholipase A 2 (iPLA 2 ) activities, is the primary regulator of redox signaling and the antioxidant response in human spermatozoa. The lysophosphatidic acid signaling is essential to maintain sperm viability by activating the phosphatidylinositol 3-kinase/protein kinase (PI3K/AKT) pathway, and it is regulated by PRDX6 iPLA 2 , protein kinase C (PKC), and receptor-type protein tyrosine kinase. The understanding of redox signaling is crucial to pave the way for novel diagnostic tools and treatments of male infertility.

ZNFX1
Also flagged:interferonIFNsvirus infectiontype I IFNsinfectiontype III IFN
Journal Article 2025-02-04 ✓ 1 Snippet Wang X, Dong M, Wu X, Schnepf D, Thiel J, Sun W, Wolfrum C, Li S, Jin W, Staeheli P, Ye L.
In-Text Gene Mentions

…Parp14, Ch25h, Zcchc3,Znfx1, Rbbp6, Ido1, Cxcl10,…

Show Full Abstract

Type III interferons (IFNs) primarily act on epithelial cells and protect against virus infection of the mucosa, whereas type I IFNs act more systemically. To date, it has been unknown which epithelial subtypes in the upper airways, the primary site for initial infection for most respiratory viruses, primarily rely on type III IFN or type I IFNs for antiviral protection. To address this question, we performed a single-cell transcriptomics analysis of the epithelial IFN-mediated response focusing on the upper airways of mice. This work identified nine distinct cell types derived from the olfactory epithelium and thirteen distinct cell types from the respiratory epithelium. Interestingly, type I IFNs induced a stronger antiviral transcriptional response than type III IFN in respiratory epithelial cells, whereas in olfactory epithelial cells, including sustentacular (SUS) and Bowman's gland cells (BGC), type III IFN was more dominant compared to type I IFN. SUS and BGC, which provide structural support and maintain the integrity of olfactory sensory neurons, were highly susceptible to infection with a mouse-adapted variant of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2 MA20) but were protected against infection if the animals were prophylactically treated with type III IFN. These findings demonstrate a high degree of cell type heterogeneity in terms of interferon-mediated antiviral responses and reveal a potent role for type III IFNs in protecting the olfactory epithelium.IMPORTANCESARS-CoV-2 infects SUS and BGC in the olfactory epithelium, causing an impairment of structural support and integrity of olfactory sensory neurons that can result in severe olfactory dysfunctions. We observed an unexpected compartmentalization of the IFN-mediated transcriptional response within the airway epithelium, and we found that olfactory epithelial cells preferentially respond to type III IFN, which resulted in robust antiviral protection of SUS and BGC. Given the proximity of the olfactory epithelium to the central nervous system, we hypothesize that evolution favored a type III IFN-biased antiviral immune response in this tissue to limit inflammatory responses in the brain. Cell type-specific antiviral responses in the upper airways, triggered by the different types of IFNs, should be investigated in more detail and carefully taken into consideration during the development of IFN-based antivirals for clinical use.

RC3H1
Also flagged:Myotonic dystrophy type 1autosomal dominant neuromuscular disordersCNBPpathogenesismetabolismgene expression
Journal Article 2025-02-04 ✓ 1 Snippet Srinivasan A, Magner D, Kozłowski P, Philips A, Kajdasz A, Wojciechowski P, Wojciechowska M.
In-Text Gene Mentions

…ulated SE-circRNAs (e.g., hsa-RC3H1_0001 and hsa-DCLK2_0001 had…

Show Full Abstract

Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular disorders associated with expansions of microsatellites, respectively, in DMPK and CNBP. Their pathogenesis is linked to the global aberrant alternative splicing (AAS) of many genes and marks mostly muscular and neuronal tissues, while blood is the least affected. Recent data in DM1 skeletal muscles indicated that abnormalities in RNA metabolism also include global upregulation of circular RNAs (circRNAs). CircRNAs are a heterogeneous group considered splicing errors and by-products of canonical splicing. To elucidate whether circRNA dysregulation is an inherent feature of the myotonic environment, we perform their analysis in the frontal cortex and whole blood of DM1 and DM2 patients. We find a global elevation of circRNAs in both tissues, and its magnitude is neither correlated with the differences in their parental gene expression nor is associated with AAS published earlier. Aberrantly spliced cassette exons of linear transcripts affected in DM1 and DM2 are not among the circularized exons, which unique genomic features prerequisite back-splicing. However, the blueprint of the AAS of linear RNAs is found in a variety of circRNA isoforms. The heterogeneity of circRNAs also originates from the utilization of exonic and intronic cryptic donors/acceptors in back splice junctions, and intron-containing circRNAs are more characteristic of the blood. Overall, this study reveals circRNA dysregulation in various tissues from DM1 and DM2; however, their levels do not correlate with the AAS in linear RNAs, suggesting a potential independent regulatory mechanism underlying circRNA upregulation in myotonic dystrophy.

Also flagged:cytochrome bmitochondrialcytBinfectionketamine hydrochloridexylazine hydrochloride
Journal Article 2025-02-04 No Snippets Dos Anjos Pacheco T, Lee DAB, Maia MO, Semedo TBF, de Mendonça RFB, Pedroni F, Dutra V, Nakazato L, Rossi RV, André MR, de Campos Pacheco R.
Show Full Abstract

The order Piroplasmida (e.g., Babesia, Theileria, Cytauxzoon, and Rangelia) and suborder Adelorina (e.g., Hepatozoon) comprise protozoa of the phylum Apicomplexa, which are related to significant economic, veterinary, and medical concerns. This study aimed to investigate the molecular occurrence and evaluate the phylogenetic placement of the Hepatozoon and Piroplasmida agents in small mammals (rodents and marsupials) in midwestern Brazil. The maximum likelihood phylogenetic inference positioned the 18S ribosomal RNA (18S rRNA) sequences of Hepatozoon obtained from Hylaeamys megacephalus with those previously detected in Didelphis aurita from Brazil; however, the sequences of Hepatozoon retrieved from Nectomys rattus and Neacomys amoenus clustered in a sub-clade sister to a clade of sequences detected in small rodents from Brazil. Phylogenetic inference positioned the piroplasmid 18S rRNA sequences detected in Thrichomys pachyurus in a single sub-clade sister to a clade containing sequences previously detected in the Phyllostomidae bat Phyllostomus discolor from midwestern Brazil. In contrast, the piroplasmid cytochrome b mitochondrial gene (cytB) sequences obtained from T. pachyurus clustered into a single clade. In conclusion, a new host record is provided for Hepatozoon spp. from the rodent N. amoenus. Furthermore, this study expanded the Piroplasmida order diversity by identifying novel genotypes in T. pachyurus rodents, which were genetically related to the piroplasmid clade found in Neotropical bats and named herein the "South American Rodentia group."

Also flagged:azoles5-flucytosineERG11CIT1invasive infectionsinfections
Journal Article 2025-02-04 No Snippets Guan Q, Alasmari F, Li C, Mfarrej S, Mukahal M, Arold ST, AlMutairi TS, Pain A.
Show Full Abstract

<i>Candida auris</i>, a pathogenic yeast responsible for global healthcare-associated outbreaks, was involved in a significant outbreak at King Fahad Medical City (KFMC) in Riyadh, affecting 20 patients from August 2018 to May 2019. Our study analyzed 23 <i>C</i>. <i>auris</i> isolates from these patients, utilizing whole genome sequencing, single-nucleotide polymorphism (SNP) analysis, phylogenetic analysis, and transmission network construction. We identified four phylogeographic clades in Saudi Arabia, with two present among the KFMC isolates. The transmission network predominantly displayed two star-like patterns, indicative of super-spreader events. Resistance to various azoles was common, and one isolate was resistant to 5-flucytosine, linked to specific mutations in the ERG11 and CIT1 genes. High genetic similarity of the isolates suggested a nosocomial origin of the KFMC outbreak. The distribution of phylogeographic clades suggests at least four separate introductions into Saudi Arabia from 2017 to 2019 and two into KFMC, underscoring both direct and nosocomial transmission pathways within the hospital.IMPORTANCE<i>Candida auris</i> is an emerging multidrug-resistant yeast that poses a significant threat in healthcare settings worldwide. This study is one of the largest genomic investigations of a <i>Candida auris</i> outbreak in the Middle East, focusing on a hospital in Riyadh, Saudi Arabia. By analyzing the genomes of isolates from 20 patients, we uncovered multiple independent introductions of <i>C. auris</i> into the region, as well as its subsequent spread within a hospital. The findings highlight the complex transmission dynamics and the challenges in controlling this pathogenic yeast in healthcare environments. This research underscores the critical need for robust genomic surveillance and accurate identification methods to prevent and manage <i>C. auris</i> outbreaks, which are increasingly linked to high mortality rates and limited treatment options. The insights gained from this study contribute to our understanding of <i>C. auris</i> transmission and resistance, offering valuable guidance for public health strategies.

DCC
Also flagged:Cervical cancercancerdeathlocallytumorcell cycle
Journal Article 2025-02-04 ✓ 2 Snippets Zhang L, Ma J, Zhang J, Hu M, Cheng J, Hu B, Zhou J, Zhou D, Bai Y, Ma X, Tang J, Chen H, Jing Y.
In-Text Gene Mentions

…increased proportion ofDCCNetrin 1 Receptor‐positive…

…1 Receptor‐positive apCAF (DCC+ apCAF) in the…

Show Full Abstract

A notable number of locally advanced cervical carcinoma (LACC) patients experience local or distant disease relapse following radiotherapy. The contribution of tumor microenvironment (TME) to tumor recurrence at different sites remains unclear. Here, single-nucleus RNA sequencing data from 28 pre- and on-treatment LACC samples from patients with different disease relapse patterns is analyzed. The findings revealed opposing alterations in the expression levels of the cellular senescence pathway after radiotherapy in patients with local and distant relapses. In contrast, an increase in the expression of the epithelial-mesenchymal transition module after radiotherapy in both relapse groups is observed. Cell-cell interactions, drug-target expression analyses in malignant cells after radiation, and multiplex immunofluorescence of tumor tissue identified interleukin-1 receptor type I (IL1R1) as a potential therapeutic target. It is demonstrated that combining the IL1R1 inhibitor anakinra with radiation can mitigate the effects of radiation on tumor cells. This study highlights the distinct roles of cellular senescence and EMT in tumor recurrence.

Also flagged:TSPAN13temozolomideGlioblastomaGBMprimary tumor of thecell proliferation
Journal Article 2025-02-04 No Snippets Wang H, Liu Z, Peng Z, Lv P, Fu P, Jiang X, Jiang X.
Show Full Abstract

Glioblastoma (GBM) is the most lethal primary tumor of the central nervous system, with its resistance to treatment posing significant challenges. This study aims to develop a comprehensive prognostic model to identify biomarkers associated with temozolomide (TMZ) resistance. We employed a multifaceted approach, combining differential expression and univariate Cox regression analyses to screen for TMZ resistance-related differentially expressed genes (TMZR-RDEGs) in GBM. Using LASSO Cox analysis, we selected 12 TMZR-RDEGs to construct a risk score model, which was evaluated for performance through survival analysis, time-dependent ROC, and stratified analyses. Functional enrichment and mutation analyses were conducted to explore the underlying mechanisms of the risk score and its relationship with immune cell infiltration levels in GBM. The prognostic risk score model, based on the 12 TMZR-RDEGs, demonstrated high efficacy in predicting GBM patient outcomes and emerged as an independent predictive factor. Additionally, we focused on the molecule TSPAN13, whose role in GBM is not well understood. We assessed cell proliferation, migration, and invasion capabilities through in vitro assays (including CCK-8, Edu, wound healing, and transwell assays) and quantitatively analyzed TSPAN13 expression levels in clinical glioma samples using tissue microarray immunohistochemistry. The impact of TSPAN13 on TMZ resistance in GBM cells was validated through in vitro experiments and a mouse orthotopic xenograft model. Notably, TSPAN13 was upregulated in GBM and correlated with poorer patient prognosis. Knockdown of TSPAN13 inhibited GBM cell proliferation, migration, and invasion, and enhanced sensitivity to TMZ treatment. This study provides a valuable prognostic tool for GBM and identifies TSPAN13 as a critical target for therapeutic intervention.

HTT
Also flagged:-19dopamineserotonincortisol5-HT 1A receptorserotonin transporter
Journal Article 2025-02-04 ✓ 1 Snippet Bu F, Bone JK, Fancourt D.
In-Text Gene Mentions

…and serotonin transporter5-HTThave also been…

Show Full Abstract

<h4>Background</h4>Mood is known to change over seasons of the year, days of the week, and even over the course of the day (diurnally). But although broader mental health and well-being also vary over months and weeks, it is unclear whether there are diurnal changes in how people experience and report their mental health.<h4>Objective</h4>To assess time-of-day association with depression, anxiety, well-being and loneliness.<h4>Methods</h4>The study analysed data from 49 218 adults drawn from the University College London COVID-19 Social Study, which gathered detailed repeated measurements from the same participants across time over a 2-year period (March 2020-March 2022, 18.5 observation per person). Data were analysed using linear mixed-effects models.<h4>Findings</h4>There is a clear time-of-day pattern in self-reported mental health and well-being, with people generally waking up feeling best and feeling worst around midnight. There is also an association with day of the week and season, with particularly strong evidence for better mental health and well-being in the summer. Time-of-day patterns are moderated by day, with more variation in mental health and individual well-being during weekends compared with weekdays. Loneliness is relatively more stable.<h4>Conclusions</h4>Generally, things do seem better in the morning. Hedonic and eudemonic well-being have the most variation, and social well-being is most stable.<h4>Clinical implications</h4>Our findings indicate the importance of considering time, day and season in research design, analyses, intervention delivery, and the planning and provision of public health services.

Also flagged:medulloblastomaOLIG2tumorSHHphosphorylationbinding
Journal Article 2025-02-04 No Snippets Li Y, Lim C, Dismuke T, Malawsky DS, Oasa S, Bruce ZC, Offenhäuser C, Baumgartner U, D'Souza RCJ, Edwards SL, French JD, Ock LSH, Nair S, Sivakumaran H, Harris L, Tikunov AP, Hwang D, Alicea Pauneto CDM, Maybury M, Hassall T, Wainwright B, Kesari S, Stein G, Piper M, Johns TG, Sokolsky-Papkov M, Terenius L, Vukojević V, McSwain LF, Gershon TR, Day BW.
Show Full Abstract

OLIG2-expressing tumor stem cells have been shown to drive recurrence in Sonic Hedgehog (SHH)-subgroup medulloblastoma (MB) and patients urgently need specific therapies to target this tumor cell population. Here, we investigate the therapeutic potential of the brain-penetrant orally bioavailable, OLIG2 inhibitor CT-179, using SHH-MB explant organoids, PDX and GEM SHH-MB models. We find that CT-179 disrupts OLIG2 dimerization, phosphorylation and DNA binding and alters tumor cell-cycle kinetics, increasing differentiation and apoptosis. CT-179 prolongs survival in SHH-MB PDX and GEM models and potentiates radiotherapy (RT) in vivo. Single cell transcriptomic studies (scRNA-seq) confirm that CT-179 increases differentiation and implicate Cdk4 up-regulation in maintaining proliferation during treatment. Consistent with CDK4 mediating CT-179 resistance, CT-179 combines effectively with the CDK4/6 inhibitor palbociclib, further prolonging survival in vivo. These data support therapeutic targeting of OLIG2+ tumor stem cells in regimens for SHH-driven MB, to improve response, delay recurrence and ultimately improve MB patient outcomes.

HTT
Also flagged:psychosisPsychiatric disordersschizophreniacognitive deficitsdelusionssegmentation
Journal Article 2025-02-04 ✓ 3 Snippets Tang X, Wei Y, Pang J, Xu L, Cui H, Liu X, Hu Y, Ju M, Tang Y, Long B, Liu W, Su M, Zhang T, Wang J.
In-Text Gene Mentions

…uding serotonin transporters (5-HTT; r ≈ 0.62–0.74),…

…the serotonin transporter (5-HTT) and norepinephrine transport…

…the serotonin transporter (5-HTT), dopamine (D2 receptors),…

Show Full Abstract

To explore the neurobiological heterogeneity within the Clinical High-Risk (CHR) for psychosis population, this study aimed to identify and characterize distinct neurobiological biotypes within CHR using features from resting-state functional networks. A total of 239 participants from the Shanghai At Risk for Psychosis (SHARP) program were enrolled, consisting of 151 CHR individuals and 88 matched healthy controls (HCs). Functional connectivity (FC) features that were correlated with symptom severity were subjected to the single-cell interpretation through multikernel learning (SIMLR) algorithm in order to identify latent homogeneous subgroups. The cognitive function, clinical symptoms, FC patterns, and correlation with neurotransmitter systems of biotype profiles were compared. Three distinct CHR biotypes were identified based on 646 significant ROI-ROI connectivity features, comprising 29.8%, 19.2%, and 51.0% of the CHR sample, respectively. Despite the absence of overall FC differences between CHR and HC groups, each CHR biotype demonstrated unique FC abnormalities. Biotype 1 displayed augmented somatomotor connection, Biotype 2 shown compromised working memory with heightened subcortical and network-specific connectivity, and Biotype 3, characterized by significant negative symptoms, revealed extensive connectivity reductions along with increased limbic-subcortical connectivity. The neurotransmitter correlates differed across biotypes. Biotype 2 revealed an inverse trend to Biotype 3, as increased neurotransmitter concentrations improved functional connectivity in Biotype 2 but reduced it in Biotype 3. The identification of CHR biotypes provides compelling evidence for the early manifestation of heterogeneity within the psychosis spectrum, suggesting that distinct pathophysiological mechanisms may underlie these subgroups.

Also flagged:gene expressiontranscription factorbindingCTCFnucleotidesTF
Journal Article 2025-02-04 No Snippets Moore MM, Wekhande S, Issner R, Collins A, Cruz AJ, Liu YV, Javed N, Casaní-Galdón S, Buenrostro JD, Epstein CB, Mattei E, Doench JG, Bernstein BE, Shoresh N, Najm FJ.
Show Full Abstract

A critical goal in functional genomics is evaluating which non-coding elements contribute to gene expression, cellular function, and disease. Functional characterization remains a challenge due to the abundance and complexity of candidate elements. Here, we develop a CRISPRi-based approach for multi-locus screening of putative transcription factor binding sites with a single truncated guide. A truncated guide with hundreds of sequence match sites can reliably disrupt enhancer activity, which expands the targeting scope of CRISPRi while maintaining repressive efficacy. We screen over 13,000 possible CTCF binding sites with 24 guides at 10 nucleotides in spacer length. These truncated guides direct CRISPRi-mediated deposition of repressive H3K9me3 marks and disrupt transcription factor binding at most sequence match target sites. This approach can be a valuable screening step for testing transcription factor binding motifs or other repeated genomic sequences and is easily implemented with existing tools.

SOX6
Also flagged:CD4Wound healingK5response to injuryCD49fCD34
Journal Article 2025-02-04 ✓ 4 Snippets Brandes N, Hahn H, Uhmann A.
In-Text Gene Mentions

…and K31, K10,SOX6, K5, LRIG1, SCA-1…

…interscale BL-IFE markerSOX6expanded (Fig. 2…

…are overgrown withSOX6+ sc-SCs and…

…fc-SCs decreases andSOX6+ sc-SCs expand…

Show Full Abstract

The balance of stem cell populations is essential for the maintenance, renewal, and repair of the mammalian epidermis. Here, we report that CD4, which is a typical marker of helper T cells, monocytes, macrophages, and dendritic cells, is also expressed on murine K5<sup>+</sup> keratinocytes. Lineage tracing of CD4<sup>+</sup> cells reveals that their epidermal progeny has self-renewal abilities and clonogenic potential. The progeny of CD4<sup>+</sup> epidermal cells contributes to epidermal renewal and progressively colonizes the interfollicular epidermis and hair follicles with age, thereby developing to all epidermal lineages. Wound healing studies furthermore show that the progeny of CD4<sup>+</sup> epidermal cells accumulates at wound sites. Finally, using CD4 knockout mice we demonstrate that CD4 expression is essential for maintaining fast-cycling epidermal stem cells during homeostasis and that CD4 loss mitigates the age-related decline in wound repair capacity. Collectively, our data support the conclusion that CD4 expression is required for long-term maintenance of the epidermal stem cell balance.

MLLT10
Also flagged:Meningiomatumorsintracranial meningiomasmeningiomasgene expressionBreast cancer
Journal Article 2025-02-04 ✓ 2 Snippets Ding L, Chen B, Zhou Z, Mei Z, Cao K, Lu X, Chen W.
In-Text Gene Mentions

…(eQTL) (rs7084454)near theMLLT10promoter, with the…

…the same time,MLLT10expression was positively…

Show Full Abstract

Previous studies have indicated a significantly higher prevalence of breast cancer (BC) among female patients with meningioma compared to the general female population. Therefore, this study aimed to assess the causal relationship between BC and meningioma at the genetic level. Genetic instrumental variables (IVs) for BC were identified from the Breast Cancer Association Consortium (BCAC), the Discovery Biology and Risk of Inherited Variants in Breast Cancer Consortium (DRIVE), the Collaborative Oncological Gene-environment Study (iCOGS), and 11 other BC genome-wide association studies (GWAS). Meningioma GWAS data were obtained from the FinnGen consortium and were further divided into intracranial and spinal meningioma groups for analysis. The primary analysis employed the inverse-variance weighted (IVW) method, supported by sensitivity analysis to address pleiotropy and enhance robustness. Next, linkage disequilibrium score regression (LDSC) was used to assess the genetic correlation between BC and meningioma. Finally, we applied the Functional Mapping and Annotation (FUMA) platform to conduct an in-depth analysis of the GWAS data. After rigorous screening and Mendelian randomization (MR) tests, genetically predicted overall BC (OR: 1.17, P = 0.0045) and ER(estrogen receptors) + BC (OR: 1.21, P = 0.0006) showed a potential causal association with intracranial meningioma. No causal relationships were found between intracranial meningioma and three BC subtypes. No bidirectional causal relationships were found between spinal meningioma and any BC subtype. The LDSC results suggested a modest positive genetic correlation between overall BC (rg: 0.152, SE: 0.077, P = 0.048), ER + BC (rg: 0.181, SE: 0.086, P = 0.035), and intracranial meningioma. FUMA analysis identified PITPNB, TTC28, and CHEK2 as shared risk genes between overall BC, ER + BC, and intracranial meningioma. These findings suggest that BC, especially ER + BC, may be a risk factor for intracranial meningioma. ER-related signaling pathways and the regulation of DNA damage may play a critical role in the pathogenesis of both diseases.

Also flagged:osteoporosismale osteoporosisUbiquitinproteolysisAmyotrophic lateral sclerosisSETD2
Journal Article 2025-02-04 No Snippets Li J, Guo S, Sun Q, An N, Lin J, Fei Q.
Show Full Abstract

<h4>Background</h4>The pathogenesis of male osteoporosis (MOP) remains unclear, with the role of genetic factors attracting the attention of researchers. In the present study, we aimed to investigate critical circRNA biomarkers associated with male osteoporosis.<h4>Methods</h4>RNA-sequencing was performed to investigate the circRNA expression profiles between 3 men with osteoporosis and 3 with normal mass density. Then, shared mRNAs between host genes acquired in this present study and mRNAs acquired in previous study were identified to screen vital circRNAs associated with male osteoporosis. PPI networks of shared mRNAs were constructed and the hub genes in the PPI networks were identified with CytoHubba, a plugin in Cytoscape software (3.10.1). Finally, a ceRNA network of four circRNAs derived from three hub genes was constructed. Validation experiments were performed on selected circRNAs and related miRNAs in this ceRNA network using peripheral blood clinical samples.<h4>Results</h4>In total, 657 circRNAs were detected in male osteoporosis. The shared mRNAs were significantly enriched in the metabolic pathways, RNA transport, Ubiquitin mediated proteolysis and Amyotrophic lateral sclerosis. Then, three genes, including SETD2, ATM and XPO1, were identified as hub genes with four algorithms. Ultimately, the ceRNA network, involving 4 circRNAs, 40 miRNAs, and 592 mRNAs, was obtained. Using 35 clinical samples, three potential circRNAs and three miRNAs associated with male osteoporosis were selected for validation. It was ultimately found that three miRNAs were upregulated in MOP, while hsa-circ-9130, novel_circ_0014940 and hsa-circ-0054894 were upregulated, hsa-circ-2484 and novel_circ_0033084 were downregulated in patients with MOP.<h4>Conclusion</h4>We emphasized the roles of several significantly up- and down-regulated circRNAs and four circRNAs derived from three hub genes in male osteoporosis. Differences in expression were confirmed for three miRNAs and five circRNAs in the ceRNA network among patients with male osteoporosis.

Also flagged:Spinal cord injuryautonomic dysfunctiontranslationalgene expressiontranscription factorTF
Journal Article 2025-02-04 No Snippets Grillo-Risco R, Hidalgo MR, Martínez-Rojas B, Moreno-Manzano V, García-García F.
Show Full Abstract

Spinal cord injury (SCI) is a devastating condition that leads to motor, sensory, and autonomic dysfunction. Current therapeutic options remain limited, emphasizing the need for a comprehensive understanding of the underlying SCI-associated molecular mechanisms. This study characterized distinct SCI phases and severities at the gene and functional levels, focusing on biomarker gene identification. Our approach involved a systematic review, individual transcriptomic analysis, gene meta-analysis, and functional characterization. We compiled a total of fourteen studies with 273 samples, leading to the identification of severity- and phase-specific biomarker genes that allow the precise classification of transcriptomic profiles. We investigated the potential transferability of severity-specific biomarkers and identified a twelve-gene signature that predicted injury prognosis from human blood samples. We also report the development of MetaSCI-app - an interactive web application designed for researchers - that allows the exploration and visualization of all generated results ( https://metasci-cbl.shinyapps.io/metaSCI ). Overall, we present a transcriptomic reference and provide a comprehensive framework for assessing SCI considering severity and time perspectives, all integrated into a user-friendly tool.

TNFSF4
Also flagged:Esophageal Squamous Cell CarcinomaESCCdigestive tract tumorcancerdeathtumor
Journal Article 2025-02-04 ✓ 5 Snippets Sheng K, Chen J, Xu R, Sun H, Liu R, Wang Y, Xu W, Guo J, Zhang M, Liu S, Lei J, Sun Y, Jia Y, Guo D.
In-Text Gene Mentions

…HLA-DQA1 andTNFSF4expression increased in…

TNFSF4is a key…

…signal at theTNFSF4promoter, accompanied by…

…s-regulatory elements enhancedTNFSF4transcriptional activity in…

…T cells onTNFSF4upregulation in the…

Show Full Abstract

<h4>Background</h4>Chromatin accessibility plays a crucial role in mediating transcriptional dysregulation and heterogeneity in Esophageal Squamous Cell Carcinoma (ESCC). Examining the chromatin accessibility of ESCC at single-cell level is imperative to understand how it activates oncogenes and contributes to the onset and metastasis of ESCC.<h4>Methods</h4>We performed single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) on cancerous and adjacent noncancerous tissues from four ESCC patients who were pathological staged as T1a, T2b, T3b, or T4a, to investigate whether regulatory elements are pivotal in instigating cellular heterogeneity during ESCC metastasis. In conjunction, we integrated these data with 55 scRNA-seq datasets, ChIP-seq or CUT&Tag sequencing data, Hi-C sequencing data, bulk RNA-seq data, and bulk ATAC-seq data from ESCC cell lines to dissect the mechanisms underlying the heterogeneity of ESCC and tumor microenvironment (TME).<h4>Results</h4>Our study identified enhancer-specific activation within epithelial cells orchestrated by the three-dimensional structure of chromatin that regulates SERPINH1 transcription, and promotes the epithelial-mesenchymal transition (EMT) and metastasis of ESCC. Additionally, chromatin element activation facilitated the expression of TNFSF4 in CD8 + exhausted T cells, thereby activating Tregs. Furthermore, we observed that chromatin accessibility promoted the differentiation of tumor-associated macrophages (TAMs) and cancer associated fibroblasts (CAFs).<h4>Conclusions</h4>In summary, utilizing multiomics analyses, we have revealed chromatin accessibility maps and illuminated the intricate molecular mechanisms that underlie cellular heterogeneity during ESCC metastasis, offering valuable insights to further advance research on tumor progression and deterioration.

SOX6
Also flagged:immune responsesTranscription factorTFdetoxificationcell cyclephagocytosis
Journal Article 2025-02-04 ✓ 5 Snippets Lin L, Huang T, Li L, Lin Y, Chen F, Zheng Z, Zhou J, Wang Y, You W, Duan Y, An Y, He S, Ye W.
In-Text Gene Mentions

…fibroblasts, CXCL14 +SOX6+ fibroblasts, HIPP…

…and CXCL14 +SOX6+ fibroblasts were…

…of CXCL14 +SOX6+ fibroblasts to…

…Moreover, CXCL14 +SOX6+ fibroblasts presented…

…in CXCL14 +SOX6+ fibroblasts; IL7…

Show Full Abstract

<h4>Purpose</h4>To identify key cellular changes and molecular events in atrophic mucosa, we aimed to elucidate the molecular mechanisms driving the occurrence of chronic atrophic gastritis (CAG).<h4>Methods</h4>We used single-cell RNA sequencing (scRNA-seq) to characterize changes in the epithelial state and tissue microenvironment associated with CAG. The molecular changes were identified by comparing differentially expressed genes (DEGs) between the two mucosa states. Gene Ontology (GO) pathway enrichment analysis was used to explore the potential functional changes in each cell subtype in atrophic mucosa. Gene set score analysis was conducted to compare the functional roles of different fibroblast subtypes and functional changes in cell subtypes between the CAG and control groups. Metabolic analysis was performed to compare the metabolic activity of C1Q<sup>+</sup> macrophages under different conditions. NichNet analysis was used to analyze the regulatory relationships between CCL11<sup>+</sup>APOE<sup>+</sup> fibroblasts and C1Q<sup>+</sup> macrophages and between CCL11<sup>+</sup>APOE<sup>+</sup> fibroblasts and CD8<sup>+</sup> effector T cells. Transcription factor (TF) analysis was performed to determine the transcription status of different T-cell subtypes in atrophic and normal mucosa.<h4>Results</h4>We generated a single-cell transcriptomic atlas from 3 CAG biopsy samples and paired adjacent normal tissues. Our analysis revealed that chief cells and parietal cells exhibited a loss of detoxification ability and that surface mucous cells displayed a reduced antimicrobial defense ability in CAG lesions. The mucous neck cells in CAG lesions showed upregulation of genes related to cell cycle transition, which may lead to aberrant DNA replication. Additionally, cells with the T exhaustion phenotype infiltrated under CAG condition. C1Q<sup>+</sup> macrophages exhibited reduced phagocytosis, downregulated expression of pattern recognition receptors and decreased metabolic activity. NichNet analysis revealed that a subpopulation of CXCL11<sup>+</sup>APOE<sup>+</sup> fibroblasts regulated the inflammatory response in the pathogenesis of atrophic gastritis. APSN<sup>+</sup>CXCL11<sup>+</sup>APOE<sup>+</sup> fibroblasts were found to be associated with gastric cancer (GC) development.<h4>Conclusions</h4>The main goal of this study was to comprehensively elucidate the cellular changes in CAG lesions. We observed an immune decline in the mucosal microenvironment during the development of CAG, including a reduced immune response of C1Q<sup>+</sup> macrophages, reduced cytotoxicity of T cells, and increased infiltration of exhausted T cells. Specifically, we demonstrated that different epithelial subtypes aberrantly express genes related to susceptibility to external bacterial infection and aberrant cell cycle progression. Our study provides new insights into the functions of epithelial changes and immune alterations during the development of CAG.

ARFGEF2
Also flagged:gene expressionTissuetranscription factorTFbindingnucleotide
Journal Article 2025-02-04 ✓ 2 Snippets Wang H, Li X, Li T, Li Z, Sham PC, Zhang YD.
In-Text Gene Mentions

…mechanism through whichARFGEF2influences intelligence is…

…start site ofARFGEF2is only about…

Show Full Abstract

Transcriptome-wide association study (TWAS) has emerged as a powerful tool for translating the myriad variations identified by genome-wide association studies (GWAS) into regulated genes in the post-GWAS era. While integrating annotation information has been shown to enhance power, current annotation-assisted TWAS tools predominantly focus on epigenomic annotations. When including more annotations, the assumption of a positive correlation between annotation scores and SNPs' effect sizes, as adopted by current methods, often falls short. Here, we propose MAAT expanding the horizons of existing TWAS studies, generating a new model incorporating multiple annotations into TWAS and a new metric indicating the most important annotation.

SOX6
Also flagged:SOX5Lamb-Shaffer syndromeintellectual disabilitygene expressioncell cycleACAN
Journal Article 2025-02-04 ✓ 5 Snippets Yang X, Gan Z, Guo X, Huang X, Liu J, Zheng Y, Zhou X, Lian J, Liu Y, Yang T, Li C, Chen F, He F, Xu X, Zhou Y, Liu Q, Yang X, Xiong F.
In-Text Gene Mentions

…, SOX9 andSOX6constitute the SOX…

…In conjunction withSOX6, SOX5 modulates…

…the deficiency of SOX5/SOX6in oligodendroglia can…

…( SOX5 ,SOX6and SOX9 ),…

…Alongside SOX5 andSOX6, the proteins…

Show Full Abstract

<h4>Objectives</h4>The SOX5 gene has been identified as the pathogenic gene responsible for Lamb-Shaffer syndrome. In this study, we examined the SOX5 variant (c.221C > T, p.Thr74Met) within a Chinese family presenting with intellectual disability and evaluated the functional implications of SOX5 by in vitro experiment.<h4>Materials and methods</h4>The family underwent a clinical assessment of intellectual development, which included precise clinical exome sequencing to identify causative genetic variants. The potential deleterious effects and pathogenicity of the variant were predicted using bioinformatics tools such as Mutation Taster, PROVEAN, and SIFT. Additionally, protein stability was evaluated using I-Mutant, and 3D protein structures were modeled with I-TASSER. Western blots and QPCR were employed to assess gene expression and protein stability. Flow cytometry was utilized to compare the cell cycle dynamics between wild-type and mutant cells.<h4>Results</h4>A previously identified missense variant (c.221C > T) in the SOX5 gene was determined to be the underlying cause of intellectual disability in a Chinese family. Functional assays demonstrated that mutant cells exhibited increased levels of SOX5 mRNA and protein relative to wild-type cells, accompanied by enhanced protein stability. Additionally, the mutant SOX5 protein was found to alter the cell cycle and downregulate the mRNA expression levels of the ACAN, AXIN2, SOX9, and PDGFRA genes.<h4>Conclusions</h4>We confirmed that the SOX5 p.Thr74Met variant is associated with intellectual disability in a second-generation Chinese family. This mutant protein potentially exhibits increased stability, influences the cell cycle, and downregulates genes related to bone and neural functions.

SERPINC1HTT
Also flagged:organophosphatecoagulationLXRRXRS100A8VWF
Journal Article 2025-02-04 ✓ 2 Snippets Sandilya V, El-Gameel D, Atashi M, Nguyen T, Fowowe M, Bhuiyan MMAA, Daramola O, Nwaiwu J, Hamdy NA, Ghanem M, El-Khordagui LK, Abdallah SM, El-Yazbi A, Mechref Y.
In-Text Gene Mentions

SERPINC1

HTT

Show Full Abstract

The utilization of organophosphate pesticides (OPs) has escalated in response to the growing global food demand driven by a rapidly increasing population and the environmental disruptions caused by climate change. While acute exposure leads to cholinergic poisoning, chronic OP exposure has been linked to organ dysfunction, inflammation, and carcinogenesis. Serum samples from healthy individuals (<i>n</i> = 11), patients with acute OP exposure (<i>n</i> = 12), and those with chronic OP exposure (<i>n</i> = 31) were analyzed to discern the differentially expressed pathways after acute and chronic OP exposure. Differential expression analysis identified 132 proteins altered in chronic exposure vs control, 86 in acute exposure vs control, and 124 in chronic vs acute exposure. Pathway analysis revealed increased blood coagulation and reduced LXR/RXR activation and DCHR24 signaling in both acute and chronic exposures. Elevated levels of pro-inflammatory proteins, such as S100A8, VWF, and GPIBA, were observed, particularly in chronic exposure, highlighting significant inflammatory effects of OP exposure. These findings provide insights into the pathological mechanisms underlying chronic OP exposure and its contribution to inflammation and long-term health risks.

SOX6
Also flagged:ZincmetabolismmembranemetalloenzymesZinc deficiencymineralization
Journal Article 2025-02-04 ✓ 3 Snippets Xue N, Zhao J, Yin J, Liu L, Yang Z, Zhai S, Bian X, Gao X.
In-Text Gene Mentions

SOX6and NKX3.2 are…

…transcriptional activity ofSOX6is suppressed in…

…a complex with L-SOX5/SOX6during chondrogenesis to…

Show Full Abstract

Zinc ions play a pivotal role in facilitating the development of cartilage in mice. Nevertheless, the precise underlying mechanism remains elusive. Our investigation was centered on elucidating the impact of zinc deficiency on cartilage maturation by modulating SUMO1 and UBC9 at both the protein and mRNA levels. We administered a regimen inducing zinc deficiency to gravid mice from E0.5 until euthanasia. Subsequently, we subjected the embryos to scrutiny employing HE, Safranin O staining and IHC. Primary chondrocytes were isolated from fetal mouse femoral condyles and utilized for Western blot analysis to discern the expression profiles of SUMO1, SUMO2/3, UBC9, SOX9, MMP13, Collagen II, RUNX2, and aggrecan. Furthermore, ATDC5 murine chondrocytes were subjected to treatment with ZnCl<sub>2</sub>, followed by RT-PCR assessment to scrutinize the expression levels of MMP13, Collagen II, RUNX2, and aggrecan. Additionally, we conducted Co-IP assays on ZnCl<sub>2</sub>-treated ATDC5 cells to explore the interaction between SOX9 and SUMO1. Our investigation unveiled that zinc deficiency led to a reduction in cartilage development, as evidenced by the HE results in fetal murine femur. Moreover, diminished expression levels of SUMO1 and UBC9 were observed in the IHC and Western blot results. Furthermore, Western blot and Co-IP assays revealed an augmented interaction between SOX9 and SUMO1, which was potentiated by ZnCl<sub>2</sub> treatment. Significantly, mutations at the SUMOylation site of SOX9 resulted in alterations in the expression patterns of crucial chondrogenesis factors. This research underscores how zinc ions promote cartilage development through the modification of SOX9 by SUMO1.

Also flagged:OsteoarthritisOAdegenerative joint diseaseagingextracellulartype II collagen
Journal Article 2025-02-04 No Snippets Li Z, Dai A, Fang X, Tang K, Chen K, Gao P, Su J, Chen X, Yang S, Deng Z, Li L.
Show Full Abstract

<h4>Background</h4>Osteoarthritis (OA) is a long-term degenerative joint disease worsening over time. Aging and chondrocyte senescence contribute to OA progression. MicroRNAs have been confirmed to regulate different cellular processes. They contribute to OA pathology and may help to identify novel biomarkers and therapies for OA.<h4>Methods</h4>This study used bioinformatics and experimental investigations to analyze and validate differentially expressed miRNAs in OA that might affect chondrocyte apoptosis and senescence.<h4>Results</h4>miR-6779 was found to be significantly down-regulated in OA. Seventy-six of the predicted and miR-6779 targeted genes and the OA-associated disease genes overlapped, and these were enriched in cell proliferation, cell apoptosis, and cell cycle. miR-6779 overexpression remarkably attenuated IL-1β effects on chondrocytes by reducing MMP3 and MMP13 levels, promoting cell apoptosis, suppressing cell senescence, and increasing caspase-3, caspase-9 and reducing P16 and P21 levels. miR-6779 targeted inhibition of X-linked inhibitor of apoptosis protein (XIAP) expression. XIAP knockdown partially improved IL-1β-induced chondrocyte senescence and dysfunction. Lastly, when co-transfected with a miR-6779 agomir, the XIAP overexpression vector partially attenuated the effects of miR-6779 overexpression on chondrocytes; miR-6779 improved IL-1β-induced senescence and dysfunction in chondrocytes through targeting XIAP.<h4>Conclusion</h4>miR-6779 is down-regulated, and XIAP is up-regulated in OA cartilage and IL-1β-treated chondrocytes. miR-6779 inhibits XIAP expression, thereby promoting senescent chondrocyte cell apoptosis and reducing chondrocyte senescence and ECM loss through XIAP.

Also flagged:mTOReverolimusadvancedcancerreceptor tyrosine kinasesneratinib
Journal Article 2025-02-04 No Snippets Piha-Paul SA, Tseng C, Tran HT, Naing A, Dumbrava EE, Karp DD, Rodon J, Yap TA, Raghav KP, Damodaran S, Le X, Soliman PT, Lim J, Meric-Bernstam F.
Show Full Abstract

<h4>Background</h4>The ErbB family of receptor tyrosine kinases are key targets for antitumor therapy. Although neratinib, a pan-ErbB kinase inhibitor, is approved in ErbB2-positive breast cancer, drug resistance is common. Preclinical data suggest that combining neratinib with the mTOR inhibitor everolimus may overcome such resistance.<h4>Patients and methods</h4>Our trial evaluated this combination's safety and efficacy in advanced cancers with ErbB alterations. We conducted a phase I dose-escalation trial of neratinib and everolimus. Primary objectives were to assess safety, tolerability, and dose-limiting toxicities (DLTs) and establish the maximum tolerated dose (MTD). Secondary objectives included objective response by RECIST v1.1 and pharmacokinetic analyses.<h4>Results</h4>Twenty-two patients (median age 61, median of four prior therapies) with ErbB alterations (mutations 63.6%, amplification 36.3%, or ErbB2-overexpressed by immunohistochemistry 9.1%) were enrolled. Common tumor types included breast (31.8%), colorectal (18.2%), cervical (9.1%), and endometrial (9.1%) cancers. Frequent grade (G) 3 treatment-related adverse events were diarrhea (18.2%), anemia (9.1%), mucositis (9.1%), and acute kidney injury (9.1%). DLTs included G3 mucositis and diarrhea at dose level (DL) 5, and G3 increased creatinine at DL4. The MTD was DL4: neratinib 240 mg with everolimus 7.5 mg. The objective response rate was 19% with partial response in four patients. Stable disease ≥16 weeks was seen in two patients (9.5%), resulting in a clinical benefit rate of 28.6%.<h4>Conclusion</h4>Pharmacokinetic data indicated reduced neratinib clearance possibly due to CYP3A4 pathway saturation by everolimus. Combination therapy with neratinib and everolimus has a tolerable safety profile and clinical activity in ErbB-altered patients. ErbB family receptors and the PI3K pathway are commonly implicated in oncogenesis. This clinical study of neratinib and everolimus demonstrated favorable clinical activity and tolerability.

CDK5RAP1
Also flagged:mitochondriallung adenocarcinomaLung cancercancerpathogenesisLUAD
Journal Article 2025-02-04 ✓ 1 Snippet Zhang X, Liu J, Cao Y, Wang W, Lin H, Yu Y.
In-Text Gene Mentions

…For instance,CDK5RAP1is generally a…

Show Full Abstract

Lung cancer remains the leading cause of cancer-related deaths, driven by complex pathogenesis and poor prognosis. Recognizing the pivotal role of mitochondrial RNA modifications (MRM) in cancer progression, this study aims to provide a comprehensive analysis of MRM-related genes and their clinical relevance in lung adenocarcinoma (LUAD). Integrating multi-omic datasets, we systematically explored the molecular features of MRM-related genes across various cancers and identified distinct expression patterns and prognostic associations. Single-cell analysis further reveals MRM-driven cell-cell interactions and pathway activation, particularly in cycling and epithelial cells. Using advanced machine learning techniques, we developed a novel prognostic signature-the Mitochondrial RNA Modification-related Signature (MRMS)-comprising nine genes: TXN, LDHA, HMGA1, SFTPB, KRT8, ALG3, S100A16, HSPD1, and ALDOA. The MRMS demonstrates superior predictive performance for LUAD survival compared to previously reported models. Our findings uniquely link MRMS to increased tumor mutational burden, genetic instability, and an immunosuppressive tumor microenvironment characterized by reduced immune cell infiltration and elevated tumor purity. Additionally, MRMS is associated with immunotherapy-related features, suggesting its potential in predicting treatment response. Experimental validation identified ALG3 as an oncogenic driver in LUAD, influencing tumor cell proliferation, migration, and invasion. In conclusion, this study establishes MRMS as a robust prognostic biomarker and highlights its dual role in shaping the tumor immune microenvironment and guiding therapeutic strategies. These findings provide novel insights into mitochondrial RNA modifications and their potential applications in personalized treatment for LUAD.

Also flagged:Endoplasmic reticulumprotein degradationdegradationER-associated degradation-autophagy
Journal Article 2025-02-04 No Snippets Wu SA, Li ZJ, Qi L.
Show Full Abstract

Protein misfolding and aggregation in the endoplasmic reticulum (ER) have been causally linked to a variety of human diseases. Two key pathways for eliminating misfolded proteins and aggregates in the ER are ER-associated degradation (ERAD) and ER-phagy, respectively. While both pathways have been well characterized biochemically, our understanding of their physiological relevance and significance remains limited. In recent years, significant advances have been made, including the generation and characterization of various knockout and knockin mouse models, the identification of human disease-associated or -causing variants, and insights into the coordination between ERAD and autophagy in physiological contexts. In this review, we summarize these advancements, highlighting the key roles of a highly conserved suppressor of lin-12-like-hydroxymethyl glutaryl-coenzyme A reductase degradation 1 (SEL1L-HRD1) protein complex of ERAD and ER-phagy in health and disease.

SOX6
Also flagged:Acetonitrilemethanolformic acidLysyl endopeptidasetrypsinIonomycin
Journal Article 2025-02-04 ✓ 1 Snippet Yang Y, Chen C, Li K, Zhang Y, Chen L, Shi J, Mu Q, Xu Y, Zhao Q.
In-Text Gene Mentions

…lncRNA annotated as lnc-SOX6-1 in human bone…

Show Full Abstract

Noncanonical micropeptides, or called novel microproteins, i.e., polypeptides mostly under 10 kDa, are encoded by genomic sequences that have been previously annotated as noncoding but now known as small open reading frames (sORFs). The recent identification of microproteins encoded by sORFs has provided evidence that many sORFs encode functional microproteins that play crucial roles in various biological processes. T cell activation is a critical biological process for adaptive immune response. Understanding key players in this process will allow us to decipher the complex mechanisms as well as develop immunotherapy for treating a wide range of diseases. Although there have been extensive studies on canonical proteins in T cell activation, the novel microproteins in T cells and their roles have been uncharted water to date. Nascent proteins are defined as newly synthesized polypeptides that emerged during the translation of mRNA. In this study, we combined nascent proteomics and quantitative proteomics to identify 411 novel microproteins in primary human T cells, including 83 nascent microproteins. We activated the T cell function with either PMA/Ionomycin (distal activation) or CD3/CD28 activating antibodies (proximal activation) and obtained a comprehensive canonical protein and microprotein profiles to pinpoint common and distinct differentially expressed proteins under these two activation conditions. After experimental testing, three microproteins numbered T1, T2 and T3 were found to be functional in regulating T cell activation. Bioinformatic and proteomic analyses suggested that T1 was functional related to immune as negative feedback to T cell activation. Our study not only established an integrated approach to uncover and elucidate novel microproteins but also highlights the significant role of microproteins in regulating T cell activation.

Also flagged:Eosinophilic EsophagitisMUC16ADGRE1TENM3gene expressionimmune response
Journal Article 2025-02-04 No Snippets Allen-Brady K, Clayton F, Hazel MW, Stevens J, Pyne AL, Pletneva MA, Cessna M, Stubben C, Robson J, Fang J, Peterson KA.
Show Full Abstract

<h4>Background & aims</h4>Evidence for a genetic contribution to eosinophilic esophagitis (EoE) exists from family and genome-wide association studies. Extensive investigation into rare variants contributing to EoE has not been performed. The study's aim was to evaluate families with multiple cases of EoE by genomic and transcriptomic sequencing to identify genes predisposing to EoE.<h4>Methods</h4>Distant relative pairs (eg, cousins) in extended EoE families and other affected relatives were whole exome sequenced to identify rare, shared, potentially pathologic variants. RNA sequencing was performed in nuclear families with multiple EoE cases. We compared the overlap of genes from DNA and RNA sequencing for relevance to disease manifestations.<h4>Results</h4>Whole exome sequencing was performed in 50 familial cases in 21 EoE extended pedigrees. We observed 189 rare candidate predisposition variants in 181 genes with complete sharing among all affected family members within each pedigree. RNA sequencing was performed for 43 EoE cases in 18 nuclear families, including 6 relatives without EoE. We observed 698 total differentially expressed genes compared with controls. We identified 3 genes (MUC16, ADGRE1, and TENM3) with evidence of rare variant sharing among all affected family members and differential gene expression. We identified 36 other genes with partial sharing of rare variants among some affected family members and with differential gene expression. Several genes identified as prominent in EoE were also differentially expressed in unaffected relatives.<h4>Conclusions</h4>Genes related to immune response, barrier dysfunction, and cell adhesion were identified in familial EoE cases and unaffected family members, supporting a genetic familial predisposition and a possible multihit background to disease pathophysiology.

Also flagged:fatty acidbiosynthesislipiddigestionPPARmonoglyceride lipases
Journal Article 2025-02-04 No Snippets Liu J, Cui S, Ye Z, Chen J, Tang M, Chen C, Xu Y, Wang Z, Yang W, Zhang Z, Wang X.
Show Full Abstract

The transcriptome analysis following an 8-week feeding trial was employed to investigate the impacts of dietary terrestrial animal fats (TAFs includes lard oil (LO), beef tallow (BT) and poultry oil (PO)) replacing fish oil (FO) on the metabolic mechanism in hepatopancreas of mud crabs (Scylla paramamosain). The fatty acid (FA) transport, biosynthesis and lipid absorption and digestion were reduced through the regulation of PPAR pathway and the mRNA expressions of monoglyceride lipases (mgls), phosphatidate phosphatase-1 (pap1), acyl-sn-glycerol-3-phosphate acyltransferase delta (plcd), cAMP-dependent protein kinase catalytic (pkac), FA-binding protein 1 (fabp-1), FA transport protein 4 (fatp-4), short/branched chain specific acyl-CoA dehydrogenase (acdsb) and enoyl-CoA delta isomerase 2 (eci2), etc., after replacing FO with BT or LO. At the same time, dietary BT and LO regulated glycolysis, gluconeogenesis and insulin signals through increasing the genes of pyruvate dehydrogenase E1 (pdh), phosphoenolpyruvate carboxykinase (pepck) and phosphatidylinositol 3-kinase (pi3k) and regulated immunity status by down regulating the mRNA expressions of heat shock proteins 27 (hsp 27), cytochrome P450 (cyp 450), etc. Replacing FO with PO enhanced phospholipid storage, fat deposition, and inhibited glucose transport by up regulating pap1, mgls, lipin 1, lipinβ and down regulating glycosyl transferase (gt) and glucose transporter type 4 (glut4) expressions. The present study showed the signaling pathways and genes that were significantly regulated by TAFs replacing dietary FO, and revealed molecular mechanisms of TAFs in S. paramamosain. This would be conducive to the application of TAFs in aquatic feed.

Also flagged:synthesisInjuryinfectionsautoimmune disordersmatrix metalloproteinasesMMPs
Journal Article 2025-02-04 No Snippets Zhu Z, Zhang X, Lin X, Wang Y, Han C, Wang S.
Show Full Abstract

Tissue injury repair is a multifaceted and dynamic process characterized by complex interactions among various immune cells, with M2 macrophages assuming a crucial role. Exosomes derived from M2-type macrophages (M2-Exos) significantly influence the injury repair process through intercellular communication mediated by enriched microRNAs (miRNAs). This review aims to elucidate the biological processes underlying exosome formation, the synthesis and function of miRNAs, and the diverse methodologies employed for exosome extraction. Furthermore, we provide a comprehensive summary of the established multifarious functions and mechanisms of M2-Exos miRNAs in tissue injury repair across different systems, while also exploring their potential applications in disease prevention, diagnosis, and clinical practice. Despite the challenges encountered, the therapeutic use of M2-Exos in clinical contexts appears promising, prompting research efforts to focus on improving the efficiency of exosome extraction and application, as well as ensuring the safety of their clinical utilization.

SOX6
Also flagged:Extracellular Vesiclesextracellularvesicleswound healingaginghyperpigmentation
Journal Article 2025-02-04 ✓ 1 Snippet Kee LT, Foo JB, How CW, Nur Azurah AG, Chan HH, Mohd Yunus MH, Ng SN, Ng MH, Law JX.
In-Text Gene Mentions

…Myo5a, Wnt3a, IGF1R,SOX6, and receptor-interacting ser…

Show Full Abstract

<h4>Introduction</h4>Research has unveiled the remarkable properties of extracellular vesicles derived from mesenchymal stromal cells (MSCs), particularly in promoting wound healing, aiding re-epithelialization, revitalizing aging skin, and inhibiting hyperpigmentation. However, investigations into the potential of small extracellular vesicles from umbilical cord-derived MSCs (UC-MSC-sEVs) in reducing scarring and preventing hyperpigmentation remain limited. Therefore, this study aims to evaluate the impact of UC-MSC-sEVs on the synthesis of the skin's extracellular matrix (ECM) and pigmentation using in vitro models.<h4>Methods</h4>The study investigated the impact of characterized UC-MSC-sEVs on various aspects including the proliferation, migration, antioxidant activity, and ECM gene expression of human dermal fibroblasts (HDF). Additionally, the effects of UC-MSC-sEVs on the proliferation, melanin content, and tyrosinase (TYR) activity of human melanoma cells (MNT-1) were examined. Furthermore, ex vivo models were employed to evaluate the skin permeation of PKH26-labelled UC-MSC-sEVs.<h4>Results</h4>The findings indicated that a high concentration of UC-MSC-sEVs positively influenced the proliferation of HDF. However, no changes in cell migration rate were observed. While the expressions of collagen type 1 and type 3 remained unaffected by UC-MSC-sEVs treatment, there were dose-dependent increases in the gene expressions of fibronectin, matrix metallopeptidase (MMP) 1, and MMP 3. Furthermore, UC-MSC-sEVs treatment did not impact the antioxidative superoxide dismutase (SOD) expression in HDF. Although UC-MSC-sEVs did not alter the proliferation of MNT-1 cells, it did result in a dose-dependent reduction in melanin synthesis without affecting TYR activity. However, when it was applied topically, UC-MSC-sEVs failed to penetrate the skin barrier and remained localized within the stratum corneum layer even after 18 hours.<h4>Conclusion</h4>These results highlight the potential of UC-MSC-sEVs in stimulating HDF proliferation, regulating ECM synthesis, and reducing melanin production. This demonstrates the promising application of UC-MSC-sEVs in medical aesthetics for benefits such as scar reduction, skin rejuvenation, and skin lightening.

Also flagged:OsteogenesisWntTGF-βBMPPTHHedgehog
Journal Article 2025-02-04 No Snippets Wang L, Ruan M, Bu Q, Zhao C.
Show Full Abstract

Mesenchymal stem cells (MSCs) are crucial for skeletal development, homeostasis, and repair, primarily through their differentiation into osteoblasts and other skeletal lineage cells. Key signaling pathways, including Wnt, TGF-β/BMP, PTH, Hedgehog, and IGF, act as critical regulators of MSC osteogenesis, playing pivotal roles in maintaining bone homeostasis and facilitating regeneration. These pathways interact in distinct ways at various stages of bone development, mineralization, and remodeling. This review provides an overview of the molecular mechanisms by which these pathways regulate MSC osteogenesis, their influence on bone tissue formation, and their implications in bone diseases and therapeutic strategies. Additionally, we explore the potential applications of these pathways in bone tissue engineering, with a particular focus on promoting the use of MSCs as seed cells for bone defect repair. Ultimately, this review aims to highlight potential avenues for advancing bone biology research, treating bone disorders, and enhancing regenerative medicine.

Also flagged:colorectal cancercarcinomacell proliferationgastrointestinal cancercancertumor
Journal Article 2025-02-04 No Snippets Zhang G, Wu X, Fu H, Sun D.
Show Full Abstract

<h4>Introduction</h4>Endoscopic tissue biopsy combined with histopathology is the gold standard for the diagnosis of colorectal cancer (CRC); however, the invasive nature of this procedure hinders its acceptance by patients. Therefore, there exists a critical need to identify novel markers facilitating early CRC detection and prognosis. Circular RNAs (circRNAs) hold promise as novel clinical diagnostic markers. This study aimed to investigate the impact of circDOCK1 on CRC metastasis and prognosis as well as its underlying molecular mechanisms.<h4>Methods</h4>We explored circRNA expression profiles in four pairs of CRC tissues and adjacent non-carcinoma tissues via microarray analysis. After Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and circRNA-miRNA network analyses, circDOCK1 was chosen for further investigation. We evaluated its clinical relevance in 80 CRC tissue pairs and adjacent controls, correlating circDOCK1 expression with clinical characteristics. Follow-up data from patient telephone interviews were analyzed for survival outcomes. Transfection efficiency was confirmed via qRT-PCR in HCT116 and SW480 colon cells, and the effects of circDOCK1 on cell proliferation, migration, and invasion were assessed.<h4>Results</h4>Microarray data revealed 149 significantly differentially expressed circRNAs, including 71 upregulated and 78 downregulated circRNAs, in CRC tissues. CircDOCK1 exhibited elevated expression in patients with CRC and emerged as an independent prognostic factor. Kaplan-Meier curve analysis suggested that circDOCK1 expression is an unfavorable prognostic factor in patients with CRC. <i>In vivo</i> experiments revealed that circDOCK1 overexpression enhanced the proliferation, migration, and invasion of CRC cells, with consistent results upon circDOCK1 downregulation.<h4>Conclusion</h4>These data indicate that circDOCK1 may play a role in promoting the proliferation, migration, and invasion of CRC cells, suggesting its potential as a CRC biomarker.

Also flagged:tumorsimmunoregulationimmunological responseCD4Foxp3adhesion molecules
Journal Article 2025-02-04 No Snippets Bose S, Do V, Testini C, Jadhav SS, Sailliet N, Kho AT, Komatsu M, Boneschansker L, Kong SW, Wedel J, Briscoe DM.
Show Full Abstract

It is increasingly appreciated that the expression of immunoregulatory molecules within tumors have potential to shape a microenvironment that promotes local immunoevasion and immunoregulation. However, little is known about tissue-intrinsic immunomodulatory mechanisms following transplantation. We propose that differences in the phenotype of microvascular endothelial cells impact the alloantigenicity of the graft and its potential to promote immunoregulation following transplantation. We focus this review on the concept that graft-dependent immunoregulation may evolve post-transplantation, and that it is dependent on the phenotype of select subsets of intragraft endothelial cells. We also discuss evidence that long-term graft survival is critically dependent on adaptive interactions among immune cells and endothelial cells within the transplanted tissue microenvironment.

Also flagged:endocarditisKingella kingae infectionsK. kingae diseaseK. kingae infectionsosteoarthritisinfections
Journal Article 2025-02-04 No Snippets Yagupsky P.
Show Full Abstract

Although <i>Kingella kingae</i> infections are usually sporadic, outbreaks of <i>K. kingae</i> disease have been reported. Outbreaks of invasive <i>K. kingae</i> infections in daycare centers were searched through the Pubmed database. Twenty-seven outbreaks have been detected in North America, Western Europe, and Israel. The median age of the 72 affected attendees was 14 months, and the attack rate was 18%. Osteoarthritis was diagnosed in 66 (92%) attendees, and endocarditis in 3 (4%), 2 of whom died. A high prevalence of the invasive strains was found among asymptomatic classmates. Genomic analysis of the available strains identified the highly invasive sequence-type complexes 23/25, 14, or 6 in 12 of 13 (92%) outbreaks. <i>Kingella kingae</i> strains causing daycare outbreaks exhibit enhanced colonization, transmissibility, and virulence. Increased awareness of this emerging public health problem and the use of molecular diagnostic methods are recommended for early identification of outbreaks and prevention of fatal outcomes.

Also flagged:insulin
Journal Article 2025-02-04 No Snippets Herrero L, Cano M, Ratwani R, Sánchez L, Sánchez B, Sancibrián R, Peralta G.
Show Full Abstract

Integrating advanced technologies like medical devices in healthcare is crucial for addressing critical challenges, but patient safety must remain the top priority. In modern clinical settings, medical devices, such as infusion devices used to administer fluids and drugs, carry risks from use errors, requiring a focus on usability and human factors engineering (HFE). Despite the significance of integrating HFE into technology selection processes, it is often overlooked. A review of five key articles demonstrates how applying HFE principles in procurement strategies can enhance device usability and patient safety. Although designed to reduce medication errors, infusion devices can still cause over-infusion or delays, indicating the need for improved safety features that must be considered in the context of sociotechnical systems. The reviewed studies suggest incorporating HFE in design, purchasing, and implementation to address these issues. The studies highlight various HFE methodologies, showing a wide variation in design, deployment, interpretation, and reporting. This comprehensive examination underscores the importance of standardised evaluations to ensure safer and more effective medical devices, emphasizing the essential role of HFE in advancing patient safety within healthcare settings.

Also flagged:Inositol Phosphates and Synthesizing EnzymesInositolsugarMyo-inositolphosphoinositol phosphates
Journal Article 2025-02-04 No Snippets Onu CJ, Adu M, Chakkour M, Kumar V, Greenberg ML.
Show Full Abstract

Inositol is a vital sugar molecule involved in numerous signaling pathways required for cellular homeostasis and cell survival. Myo-inositol and its phospho-derivatives, inositol phosphates (IPs), are the most prevalent forms of inositol found in living cells. They are involved in regulating ion channels, metabolic flux, stress response, and other key biological processes. While emerging research has highlighted the significant roles of inositol phosphates in immunity, cancer, and metabolic diseases, there is a lack of comprehensive reviews on their roles in psychiatric and neurological disorders. This review aims to fill that gap by analyzing the existing literature on the importance of inositol phosphates in severe psychiatric and neurological conditions such as Parkinson's disease, Alzheimer's disease, bipolar disorder, amyotrophic lateral sclerosis, schizophrenia, and Huntington's disease, underscoring the potential to pave the way for new treatment regimens for these debilitating disorders targeting inositol pathways.

SERPINC1
Also flagged:Waterpeptidesangiotensin-converting enzymedipeptidyl-peptidase IVdipeptidyl-peptidase IIIubiquitin
Journal Article 2025-02-04 ✓ 1 Snippet Givonetti A, Tonello S, Cattaneo C, D'Onghia D, Vercellino N, Sainaghi PP, Colangelo D, Cavaletto M.
In-Text Gene Mentions

…inhibition of DPP-IV,DPP-III, and ACE; antioxidant…

Show Full Abstract

Hempseeds, from the <i>Cannabis sativa</i> plant, and its derivates are a versatile food option for various dietary preferences. Due to their aminoacidic profile, researchers have studied the presence of bioactive peptides in hempseed proteins. In this study, the water-soluble fraction of hempseed protein was extracted, and the derived peptides were analyzed. The investigation focused on their biological function, particularly their antioxidant activity. Several biological functions have arisen, such as angiotensin-converting enzyme inhibition activity, dipeptidyl-peptidase IV, dipeptidyl-peptidase III inhibition, and ubiquitin-mediated proteolysis activation. The hydrolysates show greater 2,2-azinobis-[3-ethylbenzothiazoline-6-sulphonic acid (ABTS) radical scavenging activity compared to the proteins (97.95 ± 4.48 versus 81.04 ± 10.63). Furthermore, the impact of these proteins and peptides on the U937 cell line was evaluated to assess cell viability and their potential role in modulating inflammation associated with gastrointestinal autoimmune diseases. Protein treatment resulted in a significant reduction in cell viability, as opposed to hydrolysates, which did not affect it.

Also flagged:ChromosomeDosage compensationgene expressionsex chromosomesgenes expressionsex determination
Journal Article 2025-02-04 No Snippets Xie X, Zhang Y, Peng H, Deng Z.
Show Full Abstract

Dosage compensation (DC) is of crucial importance in balancing the sex-linked gene expression between males and females. It serves to guarantee that the proteins or other enzymatic products encoded by the sex chromosome exhibit quantitative parity between the two genders. During the evolutionary process of achieving dose compensation, insects have developed a wide variety of mechanisms. There exist two primary modes of dosage compensation mechanisms, including the up-regulation of heterogametic sex chromosomes in the heterogamety and down-regulation of homogametic sex chromosomes in the homogamety. Although extensive investigations have been conducted on dosage compensation in model insects, many questions still remain unresolved. Meanwhile, research on non-model insects is attracting increasing attention. This paper systematically summarizes the current advances in the field of insect dosage compensation with respect to its types and mechanisms. The principal insects involved in this study include the <i>Drosophila melanogaster</i>, <i>Tribolium castaneum</i>, <i>Bombyx mori</i>, and other lepidopteran insects. This paper analyzes the controversial issues about insect dosage compensation and also provides prospects for future research.

LRRC7
Also flagged:orofacial cleftsfolic acidorofacial cleftOrofacial CleftingfolateNCKAP5
Journal Article 2025-02-04 ✓ 5 Snippets Rasevic N, Bastasic J, Rubini M, Rakesh MR, Burkett KM, Ray D, Mossey PA, Peterlin B, Khan MFJ, Ravaei A, Autelitano L, Meazzini MC, Little J, Roy-Gagnon MH.
In-Text Gene Mentions

…close to genesLRRC7(maternal gene-folate interact…

…located in theLRRC7gene was significant…

…region of theLRRC7gene on chromosome…

…expression of theLRRC7gene is notable…

…in or aroundLRRC7, NCKAP5 ,…

Show Full Abstract

<b>Background/Objectives:</b> We investigated maternal and parent-of-origin (PoO) gene-environment interaction effects on the risk of nonsyndromic orofacial clefts for two maternal environmental factors: periconceptional smoking and folic acid supplementation. <b>Methods:</b> Genome-wide single nucleotide polymorphisms (SNPs) genotypes and TopMed-imputed genotypes were obtained for case-parent triads from the EUROCRAN and ITALCLEFT studies. Candidate regions were selected around target SNPs from a previous genome-wide association study, resulting in 12 (726 SNPs) and 11 regions (730 SNPs) for maternal and PoO effects, respectively. Log-linear models were used to analyze 404 case-parent triads and 40 case-parent dyads. <i>p</i>-values were combined across regions. <b>Results:</b> None of the interactions reached statistical significance after correction for the number of regions tested. Nominally significant (pooled <i>p</i>-values < 0.05) interactions pointed to regions in or close to genes <i>LRRC7</i> (maternal gene-folate interaction), <i>NCKAP5</i> (PoO-smoking interaction), and <i>IFT43</i> and <i>GPATCH2L</i> (PoO-folate interaction). <b>Conclusions:</b> Our results suggested that the genetic effects in or around these genes were heightened under periconceptional exposure to tobacco or no folic acid supplementation. The involvement of these genes in orofacial cleft development, in conjunction with environmental exposures, should be further studied.

BTN2A2
Also flagged:tumorsolid tumorsextracellularcarbodiimideantibodiescollagen
Journal Article 2025-02-04 ✓ 5 Snippets Tian Y, Li J, Yang N, Zhao Y, Zuo J, Xiong H, Pan Y, Xiao L, Su M, Han F, He Z, Hu R.
In-Text Gene Mentions

…cs-based construction of anti-BTN2A2gel droplet cell…

…surface modified withBTN2A2antibodies and internally…

…Firstly, the surfaceBTN2A2antibodies effectively inhibit…

BTN2A2belongs to the…

…had shown thatBTN2A2was highly expressed…

Show Full Abstract

Tumor infiltrating lymphocyte therapy (TIL therapy) is one of the effective treatments for solid tumors. However, certain periods or sites of solid tumors are not amenable to surgical resection. Meanwhile, the abundant and dense extracellular matrix (ECM) and regulatory cells (e.g., regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSC)) in solid tumors when infused back into the treatment will prevent T cell infiltration and proliferation, thus inhibiting the efficacy of this approach. In this study, a novel cell preparation was successfully developed by integrating microfluidic chip design with carbodiimide chemical modification. This preparation was surface modified with BTN2A2 antibodies and internally contained T cells isolated from the blood of tumor hosts, along with simulated collagen peptide CMP. Specifically, the cell preparation exerted its anti-tumor effects through multiple mechanisms: Firstly, the surface BTN2A2 antibodies effectively inhibited the proliferation of Tregs and MDSCs within the tumor microenvironment; Secondly, leveraging the T cell antigen receptors (TCRs) present in the blood T cells, which were similar to those of tumor-infiltrating lymphocytes, significantly enhanced their targeting and cytotoxic capabilities; Furthermore, the CMP component within the droplets effectively promoted the infiltration of T cells into tumor tissues. In the complex immunosuppressive microenvironment, the synergistic action of these components markedly enhanced the clearance efficacy of the immune system. Experimental results demonstrated that this cellular preparation exhibited promising therapeutic effects in both melanoma and pancreatic cancer models. This research provided a novel platform for the synergistic cooperation of various methods in tumor immunotherapy, holding broad application prospects.

Also flagged:gene expressionorgan developmentoxygencarbon dioxidetissue homeostasisadherens junctions
Journal Article 2025-02-03 No Snippets Sharma A, Niethamer TK.
Show Full Abstract

Endothelial cells (ECs) develop organ-specific gene expression and function in response to signals from the surrounding tissue. In turn, ECs can affect organ development and morphogenesis and promote or hinder disease response. In the lung, ECs play an essential role in gas exchange with the external environment, requiring both a close physical connection and a strong axis of communication with alveolar epithelial cells. A complete picture of the composition of the pulmonary endothelium is therefore critical for a full understanding of development, maintenance, and repair of the gas exchange interface. Defining the factors that control lung-specific EC specification, establish EC heterogeneity within the lung, and promote the differing contributions of EC subtypes to development, health, and disease will facilitate the development of much-needed regenerative therapies. This includes targeting therapeutics directly to ECs, developing pluripotent or primary cell-derived ECs to replace damaged or diseased vasculature, and vascularizing engineered tissues for transplant.

Also flagged:immune responseglial fibrillary acidic proteinGFAPS100 calcium-binding protein BS100Bcalcium
Journal Article 2025-02-03 No Snippets Gonzales J, Gulbransen BD.
Show Full Abstract

Enteric glia are the partners of neurons in the enteric nervous system throughout the gastrointestinal tract. Roles fulfilled by enteric glia are diverse and contribute to maintaining intestinal homeostasis through interactions with neurons, immune cells, and the intestinal epithelium. Glial influences optimize physiological gut processes such as intestinal motility and epithelial barrier integrity through actions that regulate the microenvironment of the enteric nervous system, the activity of enteric neurons, intestinal epithelial functions, and immune response. Changes to glial phenotype in disease switch glial functions and contribute to intestinal inflammation, dysmotility, pain, neuroplasticity, and tumorigenesis. This review summarizes current concepts regarding the physiological roles of enteric glial cells and their potential contributions to gut disease. The discussion is focused on recent evidence that suggests important glial contributions to gastrointestinal health and pathophysiology.

Also flagged:Neurodegenerative diseasesdeathMetal ionsironmanganesecopper
Journal Article 2025-02-03 No Snippets Chen L, Shen Q, Liu Y, Zhang Y, Sun L, Ma X, Song N, Xie J.
Show Full Abstract

As essential micronutrients, metal ions such as iron, manganese, copper, and zinc, are required for a wide range of physiological processes in the brain. However, an imbalance in metal ions, whether excessive or insufficient, is detrimental and can contribute to neuronal death through oxidative stress, ferroptosis, cuproptosis, cell senescence, or neuroinflammation. These processes have been found to be involved in the pathological mechanisms of neurodegenerative diseases. In this review, the research history and milestone events of studying metal ions, including iron, manganese, copper, and zinc in neurodegenerative diseases such as Parkinson's disease (PD), Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD), will be introduced. Then, the upstream regulators, downstream effector, and crosstalk of mental ions under both physiologic and pathologic conditions will be summarized. Finally, the therapeutic effects of metal ion chelators, such as clioquinol, quercetin, curcumin, coumarin, and their derivatives for the treatment of neurodegenerative diseases will be discussed. Additionally, the promising results and limitations observed in clinical trials of these metal ion chelators will also be addressed. This review will not only provide a comprehensive understanding of the role of metal ions in disease development but also offer perspectives on their modulation for the prevention or treatment of neurodegenerative diseases.

Also flagged:organellemitochondrialgenomePDHA1pyruvate dehydrogenasepyruvate
Journal Article 2025-02-03 No Snippets Alexandre PA, Keogh K, Reverter A, Hudson NJ.
Show Full Abstract

The mitochondrion is a sophisticated, versatile, and dynamic organelle whose function is incompletely understood. Intending to provide a framework for mitochondrial visualisation and interpretation of genome-wide molecular data, we reverse-engineered a co-expression network whose final structure represented mRNA encoding more than half of the entire mitochondrial proteome. We drew upon 723 RNA-seq data sets representing 91 tissues and cell types from 441 individual cattle. A mitochondrial landscape was formed comprising a main network and many smaller sub-networks. One of the discrete sub-networks contains all 13 mRNA (e.g. MT-ND1, MT -CYTB, MT -COX2, MT -ATP8) plus 15/22 tRNA (e.g. MT-TT) encoded by the mt-genome itself, indicating some independent regulation from the nuclear genome with whom it must cooperate. Intriguingly, this mtDNA sub-network also contains a single nuclear-encoded gene, that of PDHA1. PDHA1 encodes a subunit of the pyruvate dehydrogenase complex that governs the conversion of pyruvate to Acetyl CoA. This enzyme is extremely influential, representing the fundamental cellular connection between the ancient, conserved pathway of glycolysis that occurs exclusively in the cytoplasm, and the TCA cycle that occurs within the mitochondrial matrix. To demonstrate the downstream utility of our approach, we overlaid Longissimus dorsi muscle transcriptome data from differentially feed efficient Charolais and Holstein Friesian cattle. This approach highlighted expression patterns sensitive to both breed and diet in a complex manner. An analytic advantage of this approach is that relatively subtle (<2-fold) but coordinated changes that may be overlooked by conventional gene-by-gene significance testing become readily apparent. Finally, intending to understand the transcriptional regulation of mitochondrial function more thoroughly, we engineered a network built with transcription factors in addition to those mRNA encoding mitochondrial proteins. Here, a set of influential nuclear hormone receptors (e.g. PPARA) are enriched among the most highly and/or well-connected TF.

FBXL4
Also flagged:Dnajc5bmitochondrialcysteine-string protein betaexocytosisspermatogenesismembrane
Journal Article 2025-02-03 ✓ 3 Snippets Chen D, Zhou S, Tang J, Xiong H, Li J, Li F.
In-Text Gene Mentions

FBXL4inhibits mitophagy through…

…(1:2000, Abclonal, A7198),FBXL4(1:1000, Zen-Bio, 863894),…

…the mitophagy repressorFBXL4decreased in the…

Show Full Abstract

DnaJ heat shock protein family member C5 beta (DNAJC5B), also known as cysteine-string protein beta, exhibits a prominent expression in testicular tissue and plays an important role in acrosomal exocytosis in vitro. Nevertheless, the precise role and underlying mechanism of DNAJC5B in spermatogenesis and male fertility remain poorly understood. The meta-analysis of RNA-sequencing datasets from porcine and murine testes reveals that Dnajc5b could be a pivotal factor in spermatogenesis. This study illustrates that male fertility declines with an increased ratio of abnormal spermatozoa in germ-cell knockout Dnajc5b mice. DNAJC5B has been identified as a mitochondrial protein with high expression in spermatids. The absence of DNAJC5B induces a cascade of mitochondrial damages, including oxidative stress, mitochondrial stress in the testes, and lower mitochondrial membrane potential of spermatozoa. In vivo and in vitro evidence demonstrates that DNAJC5B mitigates excessive cellular autophagy and mitophagy via DNAJ domain under environmental stress conditions, such as starvation or exposure to mitochondrial uncouplers FCCP and CCCP. This study highlights the important role of DNAJC5B in safeguarding male fertility by preserving mitochondrial function and regulating autophagy during spermiogenesis.

DCC
Also flagged:tumororal squamous cell carcinomacell proliferation
Journal Article 2025-02-03 ✓ 2 Snippets Terashima S, Tatemura R, Saito W, Hosokawa Y.
In-Text Gene Mentions

…InDCC, cell proliferation assays…

…e performed.<h4>Results</h4>InDCC, irradiation of co-cultured…

Show Full Abstract

<h4>Purpose</h4>A non-targeted effect called radiation-induced cohort effect, which results in interactions among irradiated neighboring cells through cellular communication, has been reported. In high-precision radiotherapy, the dose is localized to the tumor, and rapid spatial changes occur in dose distribution. However, the effect of irradiating a population of cells with non-uniform doses remains unknown. In this study, we evaluated the influence of cohort effect by creating cell populations irradiated with different doses using human oral squamous cell carcinoma (SAS) and human lung (A549) cells.<h4>Materials and methods</h4>Cell populations irradiated with different doses were created in two ways: direct contact co-culture (DCC) using a cell tracer dye and indirect contact co-culture (ICC) using cell culture inserts to assess the effects of soluble factors. Target cells were irradiated with 4 Gy and co-cultured cells with 0, 0.8, 3.2, and 4 Gy. In DCC, cell proliferation assays were performed using a flow cytometer, and in ICC, modified high-density survival, clonogenic, and apoptosis assays were performed.<h4>Results</h4>In DCC, irradiation of co-cultured cells with X-rays increased the relative proliferation rate of the target cells. Similarly, irradiating co-cultured cells using ICC with X-rays increased the relative survival rate of target cells.<h4>Conclusions</h4>The results of this study showed that, even if there is a sharp decrease in dose near the tumor, the cytocidal effect on the tumor is not adversely affected. In addition, soluble factors were found to be involved in cohort effect.

OLFM4
Also flagged:PRMT5Protein arginine methyltransferases 5cell proliferationcell divisioncell cyclep53
Journal Article 2025-02-03 ✓ 2 Snippets Li L, Zhang Z, Wang X, Zhao H, Liu L, Xiao Y, Hua S, Chen YG.
In-Text Gene Mentions

…Abcam, ab15580), rabbit anti‐Olfm4(1:500, CST, Cat#19141),…

…cells, marked byOlfm4, also showed a…

Show Full Abstract

Intestinal homeostasis is sustained by self-renewal of intestinal stem cells, which continuously divide and produce proliferative transit-amplifying (TA) and progenitor cells. Protein arginine methyltransferases 5 (PRMT5) plays a crucial role in regulating homeostasis of various mammalian tissues. However, its function in intestinal homeostasis remains elusive. In this study, conditional knockout of Prmt5 in the mouse intestinal epithelium leads to a reduction in stem cell population, suppression of cell proliferation, and increased cell apoptosis within the intestinal crypts, accompanied with shortened gut length, decreased mouse body weight, and eventual animal mortality. Additionally, Prmt5 deletion or its enzymatic inhibition in intestinal organoids in vitro also shows resembling cellular phenotypes. Methylome profiling identifies 90 potential Prmt5 substrates, which are involved in RNA-related biological processes and cell division. Consistently, Prmt5 depletion in intestinal organoids leads to aberrant alternative splicing in a subset of genes related to the mitotic cell cycle. Furthermore, Prmt5 loss triggers p53-mediated apoptosis in the intestinal epithelium. Collectively, the findings uncover an indispensable role of PRMT5 in promoting cell proliferation and survival, as well as maintaining stem cells in the gut epithelium.

Also flagged:Endolysosomeproteasesviral infectionshydroxychloroquineorganellelysosome-targeted
Journal Article 2025-02-03 No Snippets Petcherski A, Tingley BM, Martin A, Adams S, Brownstein AJ, Steinberg RA, Shabane B, Ngo J, Osto C, Garcia G, Veliova M, Arumugaswami V, Colby AH, Shirihai OS, Grinstaff MW.
Show Full Abstract

SARS-CoV-2 can infect cells through endocytic uptake, a process that is targeted by inhibition of lysosomal proteases. However, clinically this approach to treat viral infections has afforded mixed results, with some studies detailing an oral regimen of hydroxychloroquine accompanied by significant off-target toxicities. We rationalized that an organelle-targeted approach will avoid toxicity while increasing the concentration of the drug at the target. Here, we describe a lysosome-targeted, mefloquine-loaded poly(glycerol monostearate-co-ε-caprolactone) nanoparticle (MFQ-NP) for pulmonary delivery via inhalation. Mefloquine is a more effective inhibitor of viral endocytosis than hydroxychloroquine in cellular models of COVID-19. MFQ-NPs are less toxic than molecular mefloquine, are 100-150 nm in diameter, and possess a negative surface charge, which facilitates uptake via endocytosis allowing inhibition of lysosomal proteases. MFQ-NPs inhibit coronavirus infection in mouse MHV-A59 and human OC43 coronavirus model systems and inhibit SARS-CoV-2 WA1 and its Omicron variant in a human lung epithelium model. Organelle-targeted delivery is an effective means to inhibit viral infection.

Also flagged:waterinsulincoppersilicone rubberlinalylacetate
Journal Article 2025-02-03 No Snippets Li F, Sun S, Wan X, Sun M, Zhang SL, Xu M.
Show Full Abstract

Soft pumps have the potential to transform industries including soft robotics, wearable devices, microfluidics and biomedical devices, but their efficiency and power supply limitations hinder prolonged operation. Here, we report a self-powered triboelectric-electrohydrodynamic pump, which combines a soft electrohydrodynamic pump driven by an electrostatic generator, specifically a triboelectric nanogenerator. The triboelectric nanogenerator collects ambient energy and converts it into high-voltage power source, allowing it to self-power an electrohydrodynamic pump and thus eliminating the need for external power supply. Using power management circuit, geometric shape optimization, and stacking methods, we achieve a maximum pressure of 4.49 kPa and a maximum flow rate of 502 mL/min. We demonstrate the pump's versatility in applications such as self-powered soft actuators, oil pumping in microfluidics, and oil purification. The triboelectric-electrohydrodynamic pump holds promising applications, and offers new insights for the development of fully self-powered systems.

Also flagged:CRP
Journal Article 2025-02-03 No Snippets Rehman N, Anjum R, Petros FB.
Show Full Abstract

This paper describes a consensus-based approach for dealing with multi-person decision-making problems which incorporate probability hesitant fuzzy preference relations. The procedure begins with establishing expected fuzzy preference relations based on the delivered hesitant fuzzy preference relations using a probabilistic aggregation approach, providing the platform for the framework to make decisions. Then, a multiplicative transitive closure formula is defined to construct multiplicative consistent expected fuzzy preference relations and symmetrical matrices, ensuring the reliability of the preference relations. Following that, a consistency analysis is undertaken to assess the consistency levels of the information provided by experts, allowing them to be assigned information priority weights while also guaranteeing that their inputs are balanced and reliable. In order to make sure that all pertinent factors are taken into account during the decision-making process, the ultimate priority weights for the experts are determined through the combination of consistency-based weights with any specified priority weights, if applicable. The consensus process eventually decides whether to aggregate the data and choose the optimal option based on the collective inputs. To strengthen the experts' consensus measure, an enhancement method is provided that detects weak viewpoints in cases of poor consensus and allows for targeted modifications. To highlight the suggested scheme's practicality and usefulness, a comparison example is provided, with results indicating that the method provides valuable insights into the multi-person decision-making process, making it a potential option for achieving agreement in complicated decision-making settings.

SERPINC1
Also flagged:COVID-19oral squamous cell carcinomaALDHWntpathogenesisOSCC
Journal Article 2025-02-03 ✓ 4 Snippets Yadalam PK, Arumuganainar D, Natarajan PM, Ardila CM.
In-Text Gene Mentions

…included ALDH1A1, MT-CO2,SERPINC1, FGB, and TF.…

…include ALDH1A1, MT-CO2,SERPINC1, FGB, and TF.…

SERPINC1, a gene encoding…

…dysregulation through theSERPINC1gene may be…

Show Full Abstract

Understanding shared pathways and mechanisms involved in the pathogenesis of diseases like oral squamous cell carcinoma (OSCC) and COVID-19 could lead to the development of novel therapeutic strategies and diagnostic biomarkers. This study aims to predict the interactome of OSCC and COVID-19 based on salivary inflammatory proteins. Datasets for OSCC and COVID-19 were obtained from https://www.salivaryproteome.org/differential-expression and selected for differential gene expression analysis. Differential gene expression analysis was performed using log transformation and a fold change of two. Hub proteins were identified using Cytoscape and Cytohubba, and machine learning algorithms including naïve Bayes, neural networks, gradient boosting, and random forest were used to predict hub genes. Top hub genes identified included ALDH1A1, MT-CO2, SERPINC1, FGB, and TF. The random forest model achieved the highest accuracy (93%) and class accuracy (84%). The naive Bayes model had lower accuracy (63%) and class accuracy (66%), while the neural network model showed 55% accuracy and class accuracy, possibly due to data pre-processing issues. The gradient boosting model outperformed all models with an accuracy of 95% and class accuracy of 95%. Salivary proteomic interactome analysis revealed novel hub proteins as potential common biomarkers.

Also flagged:NUAK1PD-L1GSK-3βhepatocellular carcinomatumordiethylnitrosamine
Journal Article 2025-02-03 No Snippets Yao CY, Tao HT, He JJ, Zhu FY, Xie CQ, Cheng YN, Li JQ, Liu ZZ, Hou CY, Liu XL, Fan YL, Fang D, Lv XR.
Show Full Abstract

<h4>Background</h4>NUAK1 is associated with metastasis and drug resistance in hepatocellular carcinoma (HCC). However, little is known about the immune functions of NUAK1 in HCC. Therefore, the aim of this study was to elucidate the novel role of NUAK1 in facilitating immune evasion in HCC and to investigate the mechanisms underpinning this process.<h4>Method</h4>The levels of NUAK1 expression and the infiltration of CD8<sup>+</sup> T cells were assessed in tumor tissues from HCC patients and mice xenograft model. HCC cell lines were used to validate the role of NUAK1 in regulating the transcription of PD-L1, the diethylnitrosamine-induced HCC model was established and the expression levels of NUAK1 and PD-L1 proteins in the rat livers were detected. Western blotting, immunofluorescence, real time PCR, and immunohistochemical staining were used to investigate the underlying mechanisms by which NUAK1 regulates PD-L1 expression in hepatocellular carcinoma.<h4>Results</h4>NUAK1 expression was negatively correlated with CD8<sup>+</sup> T cell infiltration in tumor tissues from HCC patients and mice xenograft model. Both gain and loss of functions have identified NUAK1 promoted PD-L1 expression at transcriptional level in HCC cells. The increased expression of NUAK1 and PD-L1 proteins were observed in the rat livers of diethylnitrosamine-induced HCC model. Moreover, overexpression of NUAK1 promotes GSK3β Ser<sup>9</sup> phosphorylation, β-catenin expression and nuclear accumulation in HCC cells. By contrast, knockdown of NUAK1 has opposite effects. Inhibition of GSK3β activity significantly promoted β-catenin expression and PD-L1 expression in HCC cells. IHC analyses of tumor tissues from HCC patients suggested that the levels of p-GSK3β and β-catenin were positively correlated with NUAK1 expression. Knockdown of β-catenin also reversed NUAK1-mediated PD-L1 expression in HCC cells.<h4>Conclusions</h4>This study revealed a novel role for NUAK1, which promotes the transcriptional expression of PD-L1 by activating GSK3β/β-catenin signaling pathway, leading to immune escape of hepatocellular carcinoma. Registry and the registration no. of the study/trial: Not applicable.

Also flagged:angiotensin-converting enzyme 2ACE2peptidaseMas receptorvasodilationrespiratory viral infections
Journal Article 2025-02-03 No Snippets Okal EF, Romero PA, Heinzelman P.
Show Full Abstract

<h4>Background</h4>Angiotensin-Converting Enzyme 2 (ACE2) is a crucial peptidase in human peptide hormone signaling, catalyzing the conversion of Angiotensin-II to Angiotensin-(1-7), which activates the Mas receptor and elicits vasodilation, increased blood flow, reduced inflammation, and decreased pathological tissue remodeling. This study leverages protein engineering to enhance ACE2's therapeutic potential for treating conditions such as respiratory viral infections, acute respiratory distress syndrome, and diabetes. Surrogate substrates used in traditional high-throughput screening methods for peptidases often fail to accurately mimic native substrates, leading to less effective enzyme variants. Here, we developed an ultra-high-throughput droplet microfluidic platform to screen peptidases on native peptide substrates. Our assay detects substrate cleavage via free amino acid release, providing a precise measurement of biologically relevant peptidase activity.<h4>Results</h4>Using this new platform, we screened a large library of ACE2 variants, identifying position 187 as a hotspot for enhancing enzyme activity. Further focused screening revealed the K187T variant, which exhibited a fourfold increase in catalytic efficiency (k<sub>cat</sub>/K<sub>M</sub>) over wild-type ACE2.<h4>Conclusions</h4>This work demonstrates the potential of droplet microfluidics for therapeutic peptidase engineering, offering a robust and accessible method to optimize enzyme properties for clinical applications.

Also flagged:Gastric cancerstomach cancercancerMitogen-Activated Protein KinaseMAP3Kserine/threonine protein kinases
Journal Article 2025-02-03 No Snippets Wei S, Li Y, Zhou J, Xia Y.
Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) presents a significant global health burden, necessitating a deeper understanding of its molecular underpinnings for improved diagnostics and therapeutics.<h4>Methods</h4>In this study, we investigated the expression profiles and clinical implications of MAP3K genes in GC using in silico and in vitro experiments.<h4>Results</h4>Utilizing RT-qPCR analysis, we observed significant up-regulation of MAP3K1, MAP3K4, MAP3K5, MAP3K6, MAP3K7, MAP3K8, MAP3K9, and MAP3K10 in GC cell lines, while MAP3K2, MAP3K3, MAP3K11, MAP3K12, MAP3K13, MAP3K14, and MAP3K15 exhibited down-regulation. Prognostic evaluation revealed that elevated expression of MAP3K1, MAP3K4, MAP3K7, MAP3K8, MAP3K9, and MAP3K10 was associated with shorter overall survival (OS), emphasizing their clinical significance. Furthermore, the diagnostic potential was demonstrated through robust Receiver operating characteristics (ROC) curve analysis, indicating the strong discriminatory power of these genes in distinguishing GC patients. Proteomic analysis further confirmed the higher expression of MAP3K1, MAP3K4, MAP3K7, MAP3K8, MAP3K9, and MAP3K10 genes in GC. Methylation profiling further supported the idea that promoter hypomethylation of MAP3K1, MAP3K4, MAP3K7, MAP3K8, MAP3K9, and MAP3K10 genes was associated with their up-regulation. Single-cell functional analysis elucidated the involvement of MAP3K genes in shaping the tumor microenvironment. miRNA-mRNA network analysis revealed intricate regulatory mechanisms, with hsa-mir-200b-3p emerging as a key regulator. Finally, the MAP3K1 knockdown has shown significant impacts on the cellular behavior of the BGC823 cells.<h4>Conclusion</h4>This comprehensive assessment provides valuable insights into the role of MAP3K genes in GC, offering avenues for further research and therapeutic exploration.

HTT
Also flagged:FKBP51neuromelaninα-synucleinα-synLewy bodiesPD
Journal Article 2025-02-03 ✓ 1 Snippet Garcia-Gomara M, Legarra-Marcos N, Serena M, Rojas-de-Miguel E, Espelosin M, Marcilla I, Perez-Mediavilla A, Luquin MR, Lanciego JL, Burrell MA, Cuadrado-Tejedor M, Garcia-Osta A.
In-Text Gene Mentions

HTT

Show Full Abstract

Parkinson's disease (PD) is characterized by the loss of neuromelanin (NM)-containing dopaminergic (DA) neurons in the substantia nigra (SN) pars compacta (SNpc) and the buildup of α-synuclein (α-syn) inclusions, called Lewy bodies. To investigate the roles of NM and α-syn in DA neuron degeneration, we modeled PD by inducing NM accumulation in a humanized α-syn mouse model (Snca<sup>-</sup>; PAC-Tg(SNCA<sup>WT</sup>)) via the expression of human tyrosinase in the SN. We found that this mouse strain develops naturally progressive motor dysfunction and dopaminergic neuronal loss in the SN with aging. Upon tyrosinase injection, NM-containing neurons developed p62 and ubiquitin inclusions. Furthermore, the upregulation of genes associated with microglial activation in the midbrain indicated a role of pro-inflammatory factors in neurodegeneration. Midbrain RNA sequencing confirmed the microglial response and identified Fkbp5 as one of the more dysregulated genes. Next, we showed that FKBP51(51 kDa) was significantly upregulated with aging and in PD human brains. Pharmacological treatment with SAFit2, a potent FKBP51 inhibitor, led to a reduction in ubiquitin-positive inclusions, prevention of neurodegeneration in the SNpc, and improved motor function in NM-SNCAWT mice. These results highlight the critical role of FKBP51 in PD and propose SAFit2 as a promising therapeutic candidate for reducing neurodegeneration in PD.

Also flagged:Insulincollagenasedigestionglucosepenicillinstreptomycin
Journal Article 2025-02-03 No Snippets Madey YF, Syed SK, Van Horn RD, Pineros AR, Efanov AM.
Show Full Abstract

Insulin, a critical metabolic hormone to maintain blood glucose homeostasis, is synthesized and folded in the endoplasmic reticulum (ER) of pancreatic β-cells as the insulin precursor proinsulin (ProIns). ProIns misfolding and aggregation detected in diabetic β-cells induces ER stress and obstructs normal trafficking, processing, and secretion of insulin, which eventually can result in pancreatic β-cell dedifferentiation and death. We have developed quantitative methods to measure misfolded and aggregated ProIns in β-cells by utilizing ProIns oligomer-specific ELISA and proximity ligation assay. Under conditions of induced ER stress, both assays detected significant accumulation of aggregated ProIns in β-cells. ProIns aggregation was also observed in isolated pancreatic islets cultured at high glucose levels. Moreover, high glucose in β-cells downregulated expression of genes mediating clearance of misfolded proteins from the secretory pathway through ER autophagy and ER-associated protein degradation. Inhibition of autophagy in β-cells induced strong induction of misfolded ProIns accumulation, whereas ER-associated degradation inhibition was not effective in generating ProIns aggregates. Finally, we observed subcellular colocalization of aggregated ProIns with protein markers of autophagosomes. Our results indicate that autophagy controls degradation of aggregated misfolded ProIns under conditions of hyperglycemia and diabetes.

Also flagged:CalciumMitochondriamitochondrialsynthesismembranedeath
Journal Article 2025-02-03 No Snippets Borbolis F, Ploumi C, Palikaras K.
Show Full Abstract

Calcium signaling plays a pivotal role in diverse cellular processes through precise spatiotemporal regulation and interaction with effector proteins across distinct subcellular compartments. Mitochondria, in particular, act as central hubs for calcium buffering, orchestrating energy production, redox balance and apoptotic signaling, among others. While controlled mitochondrial calcium uptake supports ATP synthesis and metabolic regulation, excessive accumulation can trigger oxidative stress, mitochondrial membrane permeabilization, and cell death. Emerging findings underscore the intricate interplay between calcium homeostasis and mitophagy, a selective type of autophagy for mitochondria elimination. Although the literature is still emerging, this review delves into the bidirectional relationship between calcium signaling and mitophagy pathways, providing compelling mechanistic insights. Furthermore, we discuss how disruptions in calcium homeostasis impair mitophagy, contributing to mitochondrial dysfunction and the pathogenesis of common neurodegenerative diseases.

Also flagged:Type 2 diabetes mellitusmetabolic disorderinsulin resistancehyperglycemiaoleic acidphenolic compounds
Journal Article 2025-02-03 No Snippets Munteanu C, Kotova P, Schwartz B.
Show Full Abstract

Type 2 diabetes mellitus (T2DM) is a multifactorial metabolic disorder characterized by insulin resistance and beta cell dysfunction, resulting in hyperglycemia. Olive oil, a cornerstone of the Mediterranean diet, has attracted considerable attention due to its potential health benefits, including reducing the risk of developing T2DM. This literature review aims to critically examine and synthesize existing research regarding the impact of olive oil on the expression of genes relevant to T2DM. This paper also seeks to provide an immunological and genetic perspective on the signaling pathways of the main components of extra virgin olive oil. Key bioactive components of olive oil, such as oleic acid and phenolic compounds, were identified as modulators of insulin signaling. These compounds enhanced the insulin signaling pathway, improved lipid metabolism, and reduced oxidative stress by decreasing reactive oxygen species (ROS) production. Additionally, they were shown to alleviate inflammation by inhibiting the NF-κB pathway and downregulating pro-inflammatory cytokines and enzymes. Furthermore, these bioactive compounds were observed to mitigate endoplasmic reticulum (ER) stress by downregulating stress markers, thereby protecting beta cells from apoptosis and preserving their function. In summary, olive oil, particularly its bioactive constituents, has been demonstrated to enhance insulin sensitivity, protect beta cell function, and reduce inflammation and oxidative stress by modulating key genes involved in these processes. These findings underscore olive oil's therapeutic potential in managing T2DM. However, further research, including well-designed human clinical trials, is required to fully elucidate the role of olive oil in personalized nutrition strategies for the prevention and treatment of T2DM.

Also flagged:Duchenne Muscular Dystrophyoligonucleotidesdystrophinmuscular dystrophyheart failureDMD
Journal Article 2025-02-03 No Snippets Matsuo M.
Show Full Abstract

Thirty years ago, in 1995, I proposed a fundamental treatment for Duchenne Muscular Dystrophy (DMD) using antisense oligonucleotides (ASOs) to induce exon skipping and restore dystrophin expression. DMD is a progressive and fatal muscular dystrophy, and the establishment of an effective therapy has been a pressing demand among patients worldwide. Exon-skipping therapy utilizing ASOs has garnered significant attention as one of the most promising treatments for DMD, stimulating global research and development efforts in ASO technology. Two decades later, in 2016, one ASO was conditionally approved by the U.S. FDA as the first DMD treatment. This review summarizes the current status and challenges of ASO-based exon-skipping therapies for DMD and explores the prospects of pseudoexon skipping using ASOs, which holds the potential for achieving a complete cure for DMD.

DNAH10
Also flagged:TumorImmunityBreast Cancerimmune responsebreast tumorsgene expression
Journal Article 2025-02-03 ✓ 1 Snippet Harris AR, Pichardo CM, Franklin J, Liu H, Wooten W, Panigrahi G, Lawrence WR, Pichardo MS, Jenkins BD, Dorsey TH, Ioffe OB, Yfantis HG, Agurs-Collins T, Ambs S.
In-Text Gene Mentions

…( CCL18 ,DNAH10, and F8A3…

Show Full Abstract

<h4>Importance</h4>The mechanisms through which chronic stressors may be associated with tumor biologic characteristics, immune response, and health disparities remain insufficiently understood.<h4>Objective</h4>To investigate the proteomic, transcriptomic, and genomic effects associated with multilevel chronic stressors (perceived stress, perceived inadequate social support, perceived racial and ethnic discrimination, and neighborhood deprivation) in Black and White women with breast cancer.<h4>Design, setting, and participants</h4>This cross-sectional study was conducted from February 28, 2012, to September 5, 2023, in which blood samples, breast tumors, and adjacent noncancerous tissues were collected from women with breast cancer. Participants, recruited at 2 Baltimore, Maryland, hospitals, completed demographic and psychosocial questionnaires. Data analysis was conducted from September 2023 to April 2024.<h4>Exposures</h4>Perceived stress, perceived social support, perceived racial and ethnic discrimination, and the 2010 census tract-level neighborhood deprivation index, in which scores range from -2.51 to 6.77, with higher scores indicating greater deprivation.<h4>Main outcomes and measures</h4>The main outcomes included levels of 92 circulating immune-oncologic markers and associated biologic pathways, tumor immune cell profiles, breast tissue gene expression, and tumor mutational burden. Data were analyzed using covariate-adjusted linear regression modeling for continuous outcomes with effect estimates presented as β values with 95% CIs.<h4>Results</h4>The study included 121 women with breast cancer (mean [SD] age, 56.27 [12.62] years), of whom 56 (46.3%) were Black, and 65 (53.7%) were White. The analytic subsample sizes included 117 blood samples, 48 breast tumors, and 41 adjacent noncancerous tissues. Levels of perceived stress and social support were comparable by race, while Black women resided in more socioeconomically deprived neighborhoods (mean [SD] neighborhood deprivation index, 2.28 [2.30] for Black women compared with -0.22 [2.01] for White women). Greater perceived social support was associated with more favorable immune-stimulatory changes (eg, increased serum IL-5 [β, 0.06 (95% CI, 0.02-0.10); P = .003] and activated natural killer cells in noncancerous breast tissue of Black women [β, 0.11 (95% CI, 0.04-0.17); P = .002). Higher levels of perceived stress, exposure to discrimination, and neighborhood deprivation were associated with systemic inflammation (eg, serum IL-6 with both perceived stress [β, 0.04 (95% CI, 0.01-0.07); P = .006] and discrimination [β, 0.69 (95% CI, 0.15-1.23); P = .01]); deleterious immune cell profiles (eg, tumor-associated M2 macrophages with discrimination [β, 0.82 (95% CI, 0.14-1.51); P = .02]); and aggressive tumor biologic characteristics. Race-stratified analyses uncovered distinct immunologic features in Black women associated with stressors, including chemotaxis with stress (β, 0.28 [95% CI, 0.001-0.56]; P = .049) and immune suppression with stress (β, 0.37 [95% CI, -0.002 to 0.75]; P = .05) at the systemic level and increased tumor-associated myeloid cells (monocytes and M1 and M2 macrophages) at the tissue level. Perceived stress was associated with elevated tumor mutational burden (β, 0.02 [95% CI, 0.01-0.04]; P = .04).<h4>Conclusions and relevance</h4>The findings of this cross-sectional study of Black and White women with breast cancer suggest that perceived stress, perceived inadequate social support, perceived racial and ethnic discrimination, and neighborhood deprivation were associated with deleterious alterations to the systemic and tumor immune environment, particularly for Black women. Understanding biology as a possible mediator of cancer health disparities may inform prevention and public health interventions.

Also flagged:tuberculosischronicautoimmune arthritisTBdeathinfectious disease
Journal Article 2025-02-03 No Snippets Picchianti-Diamanti A, Aiello A, De Lorenzo C, Migliori GB, Goletti D.
Show Full Abstract

Tuberculosis (TB) is the leading cause of death in the world from an infectious disease. Its etiologic agent, the <i>Mycobacterium tuberculosis</i> (Mtb), is a slow-growing bacterium that has coexisted in humans for thousands of years. According to the World Health Organization, 10.6 million new cases of TB and over 1 million deaths were reported in 2022. It is widely recognized that patients affected by chronic autoimmune arthritis such as rheumatoid arthritis (RA), psoriatic arthritis (PsA), and ankylosing spondylitis (AS) have an increased incidence rate of TB disease compared to the general population. As conceivable, the risk is associated with age ≥65 years and is higher in endemic regions, but immunosuppressive therapy plays a pivotal role. Several systematic reviews have analysed the impact of anti-TNF-α agents on the risk of TB in patients with chronic autoimmune arthritis, as well as for other biologic disease-modifying immunosuppressive anti-rheumatic drugs (bDMARDs) such as rituximab, abatacept, tocilizumab, ustekinumab, and secukinumab. However, the data are less robust compared to those available with TNF-α inhibitors. Conversely, data on anti-IL23 agents and JAK inhibitors (JAK-i), which have been more recently introduced for the treatment of RA and PsA/AS, are limited. TB screening and preventive therapy are recommended in Mtb-infected patients undergoing bDMARDs and targeted synthetic (ts)DMARDs. In this review, we evaluate the current evidence from randomized clinical trials, long-term extension studies, and real-life studies regarding the risk of TB in patients with RA, PsA, and AS treated with bDMARDs and tsDMARDs. According to the current evidence, TNF-α inhibitors carry the greatest risk of TB progression among bDMARDs and tsDMARDs, such as JAK inhibitors and anti-IL-6R agents. The management of TB screening and the updated preventive therapy are reported.

Also flagged:neuromyelitis optica spectrum disordersteroidAQP4antibodiesIL-10interferon
Journal Article 2025-02-03 No Snippets Yamamura R, Kinoshita M, Yasumizu Y, Yata T, Kihara K, Motooka D, Shiraishi N, Sugiyama Y, Beppu S, Murata H, Koizumi N, Sano I, Koda T, Okuno T, Mochizuki H.
Show Full Abstract

<h4>Background</h4>The advent of biologics has significantly transformed treatment strategies for neuromyelitis optica spectrum disorder (NMOSD). However, there are no biomarkers that predict relapses associated with steroid tapering; therefore, it is critical to identify potential indicators of disease activity. In this study, we collected peripheral blood mononuclear cells (PBMCs) from NMOSD patients during steroid tapering and performed bulk RNA sequencing to analyze changes in immune dynamics caused by steroid reduction.<h4>Methods</h4>PBMCs were collected at 3-5 timepoints from 10 NMOSD patients at our hospital (including one relapse case), and bulk RNA sequencing was performed. All patients were positive for anti-AQP4 antibodies and had no history of biologic use.<h4>Results</h4>In one relapsed patient, gene groups with decreased expression at relapse were observed predominantly in monocytes, with upregulation in anti-inflammatory pathways such as IL-10, while the upregulated genes were related to interferon signaling. Moreover, after steroid tapering, in non-relapsed patients, genes with increased expression were enriched in inflammatory pathways, represented by interferon signaling, while genes with decreased expression were enriched in pathways related to IL-10 and glucocorticoid receptors. Weighted gene co-expression network analysis identified modules that correlated with steroid dosage, and the modules inversely correlated with steroid dosage were enriched in monocytes, with marked immune signature of interferon pathway.<h4>Conclusion</h4>This study identified peripheral blood transcriptome signatures that could lead to the identification of clinically relevant NMOSD disease activity biomarkers, and further highlights the pivotal role of interferon and IL-10 signaling in NMOSD.

HFE
Also flagged:hypertrophic cardiomyopathyATTR amyloidosiscardiac diseasesmyocardial fibrosisarrhythmiasatrial fibrillation
Journal Article 2025-02-03 ✓ 1 Snippet Hamidi J, Hanel Y, Dittmann S, Gerding WM, Nguyen HP, Klingel K, Schulze-Bahr E.
In-Text Gene Mentions

…evidence for ahemochromatosis, glycogenosis as well…

Show Full Abstract

<h4>Background</h4>Hypertrophic cardiomyopathy (HCM) is characterized by an increased left ventricular (LV) wall thickness and LV mass. With an estimated prevalence of 1:200-500, HCM is among the most common genetically determined cardiac diseases. Functionally, enhanced tissue stiffness and reduced elasticity, combined with diastolic dysfunction and myocardial fibrosis, can eventually lead to life-threatening arrhythmias and impaired blood flow through the heart chamber. Typical symptoms associated with HCM include atrial fibrillation (AF), syncope, ventricular fibrillation, and cardiac arrest. At the molecular level, various genetic and/or non-genetic etiologies can lead to HCM.<h4>Case summary</h4>In this case, we report on a 60-year-old male patient with severe, progressive hypertrophic cardiomyopathy (HCM) in an uncommon and ambivalent setting. Right ventricular (RV) biopsy and multi-phase skeletal scintigraphy diagnosed transthyretin amyloidosis with cardiac involvement. Sanger sequencing of the transthyretin gene revealed a wild-type sequence. Phenotypically, the patient initially presented with syncopal episodes, atrioventricular (AV) block, and atrial fibrillation. Subsequently, bilateral carpal tunnel syndrome and polyneuropathy developed. However, the progressive and early onset of left ventricular hypertrophy did not align with the typical presentation of HCM in the context of ATTR. Therefore, next-generation sequencing (NGS) analysis revealed a rare chromosomal duplication in both cardiac myosin genes, <i>MYH6</i> and <i>MYH7</i>. Consequently, two distinct and rare disease entities co-occurred in this patient, both ultimately leading to HCM.<h4>Discussion</h4>To date, no other case featuring wild-type transthyretin amyloidosis (wtATTR) concurrently with a chromosomal duplication affecting both cardiac myosin heavy chain genes has been reported in the literature. This highlights the extreme rarity of this condition, making it challenging to ascertain the extent to which a presumably mutated hybrid myosin gene construct or the TTR amyloid fibrils contribute to stiffness, tissue fibrosis, and cardiac dysfunction. Ultimately, both effects converged in this case, leading to the same cardiac disease with an exacerbated phenotypical outcome of hypertrophic cardiomyopathy (HCM). While early onset wtATTR is an uncommon clinical finding, another significant clinical condition was identified in this patient, marked by an unusual copy number variation (CNV) in the genes <i>MYH6</i> and <i>MYH7</i>.

DCC
Also flagged:cancerplatinumtumorMYChead and neck squamous cell carcinomaHNSCC
Journal Article 2025-02-03 ✓ 1 Snippet Pathak L, Pal B, Talukdar J, Saikia PJ, Sandhya S, Tasabehji W, Li H, Phukan J, Bhuyan A, Patra S, Das B.
In-Text Gene Mentions

…usual cues forDCCreactivation (favorable niche…

Show Full Abstract

<h4>Background</h4>Head and neck cancers harbor dormant cancer stem cells (CSCs). This study explores how platinum therapy impacts these cells in a non-genetic manner and the role of hypoxia in this process. Previously, we identified a novel population of CSCs exhibiting an "altruistic" phenotype, sacrificing self-renewal to promote niche defense (tumor stemness defense, TSD), potentially protecting a dormant subpopulation of CSCs, the reawakening CSC (R-CSC) retaining stress memory. This TSD phenotype involves the activation of the MYC-HIF2α pathway and, importantly, is linked to a hypoxic tumor microenvironment. We termed these TSD+ CSCs "altruistic cancer stem cells" (A-CSCs). Here we investigated the potential role of tumor hypoxia in the mobilization of TSD+ CSCs to the circulation as a part of niche defense against platinum therapy.<h4>Methods</h4>We isolated CTCs and primary tumor cells from head and neck squamous cell carcinoma (HNSCC) patients undergoing platinum therapy (<i>n</i> = 14). We analyzed the TSD phenotype and markers of hypoxia in these cells. Additionally, we further characterized a previously reported pre-clinical model of platinum-induced tumor stemness to study the link between hypoxia, TSD+ CSC emergence, and mobilization to the circulation and bone marrow.<h4>Results</h4>We isolated TSD+ CTCs with a hypoxic signature from eight out of 14 HNSCC patients. These cells displayed increased proliferation and invasion upon cisplatin treatment, suggesting a role in niche defense. Our pre-clinical model confirmed that hypoxia directly correlates with the expansion of TSD+ CSCs and their mobilization into the circulation and bone marrow following cisplatin treatment. We demonstrated the protection of R-CSCs by TSD+ CSCs. Notably, inhibiting hypoxia alone with tirapazamine did not reduce TSD+ CSCs, CTCs, or R-CSCs. However, combining tirapazamine with FM19G11, a MYC-HIF2α pathway inhibitor, significantly reduced the platinum-induced expansion of both TSD+ CSCs, CTCs, and the presence of R-CSCs in the bone marrow.<h4>Conclusions</h4>This study reveals that HNSCC patients undergoing platinum therapy can harbor TSD+ CTCs exhibiting an altruistic phenotype and a hypoxic signature. Additionally, the pre-clinical study provides a novel non-genetic mechanism of therapy resistance-the altruistic tumor self-defense. The tumor microenvironment, through the emergence of TSD+ CSCs, appears to act collectively to defend the tumor self-identity by hijacking an altruistic stem cell niche defense mechanism.

HTT
Also flagged:neurodegenerative disorderHDNeomycinchaperoneHSF1Iba1
Journal Article 2025-02-03 ✓ 1 Snippet Solem MA, G Pelzel R, Rozema NB, Brown TG, Reid E, Mansky RH, Gomez-Pastor R.
In-Text Gene Mentions

HTT

Show Full Abstract

BackgroundHuntington's disease (HD) is a neurodegenerative disorder causing motor, cognitive, and psychiatric impairments, with the striatum being the most affected brain region. However, the role of other regions, such as the hippocampus, in HD remains less understood.ObjectiveHere, we study the comparative impact of enhanced mHTT aggregation and neuropathology in the striatum and hippocampus of two HD mouse models.MethodsWe utilized the zQ175 as a control HD mouse model and the Q175DN mice lacking the PGK-Neomycin cassette generated in house. We performed a comparative characterization of the neuropathology between zQ175 and Q175DN mice in the striatum and the hippocampus by assessing HTT aggregation, neuronal and glial pathology, chaperone expression, and synaptic density.ResultsWe showed that Q175DN mice presented enhanced mHTT aggregation in both striatum and hippocampus compared to zQ175. Striatal neurons showed a greater susceptibility to enhanced accumulation of mHTT in Q175DN. On the contrary, no signs of hippocampal pathology were found in zQ175 and absence of hippocampal pathology persisted in Q175DN mice despite higher levels of mHTT. In addition, Q175DN hippocampus presented increased synaptic density, decreased Iba1<sup>+</sup> microglia density and enhanced HSF1 levels in specific subregions of the hippocampus compared to zQ175.ConclusionsQ175DN mice are a valuable tool to understand the fundamental susceptibility differences to mHTT toxicity between striatal neurons and other neuronal subtypes. Furthermore, our findings also suggest that cognitive deficits observed in HD animals might arise from either striatum dysfunction or other regions involved in cognitive processes but not from hippocampal degeneration.

SOX6
Also flagged:Breast CancertumorStigmasterolcancerJAK3malignant tumors
Journal Article 2025-02-03 ✓ 1 Snippet Zhou R, Zhang Y, Xu L, Sun Y.
In-Text Gene Mentions

…masterol effectively inhibitedSOX6.…

Show Full Abstract

<b>Background:</b> Breast cancer stem-like cells (BCSCs) are considered a source of tumor origins, metastasis and drug resistance, thereby limiting current treatment regimens. Stigmasterol has been reported to inhibit various cancer processes, but its effects and mechanisms in BCSCs have not been investigated. <b>Methods:</b> To generate spheroids, we enriched parental and SUM159 cells with BCSCs in a serum-free medium. The effects on the stemness, metastasis and drug resistance of CSC-enriched SUM159 cells were detected for the first time by <i>in vivo</i> and <i>in vitro</i> experiments. <b>Results:</b> CSC-enriched SUM159 and 4T1 cells demonstrated higher potential for tumorigenesis and metastasis. Stigmasterol suppresses BCSCs' spheroid formation, cell viability, and migration ability and promotes cell apoptosis. Stigmasterol also inhibited BCSCs-originated cancer formation in rat models. Stigmasterol also attenuated the growth of TNBC organoids from human breast cancer tissues. These data revealed the inhibitory effects of stigmasterol on BCSC traits. In the meantime, we found that JAK3 was upregulated in BCSCs, and Stigmasterol could effectively inhibit its expression. In addition, JAK3 was evidenced to negatively regulate BCSC activity and stemness both <i>in vitro</i> and <i>in vivo</i>. More importantly, the results indicated that Stigmasterol suppresses BCSC activity by inhibiting JAK3 expression. <b>Conclusion:</b> This study is the first to demonstrate that Stigmasterol inhibited metastasis and stemness of BCSCs by downregulating JAK3, which might provide a new method for the clinical application of Stigmasterol in breast cancer.

Also flagged:MethylationEsophageal Squamous Cell CarcinomaEsophageal cancerESCCmethylationshypomethylation
Journal Article 2025-02-03 No Snippets Li Z, Chen X, Li Y, Xu Y, Zhou Y.
Show Full Abstract

Esophageal cancer is a significant global health concern, with esophageal squamous cell carcinoma being the predominant subtype in high-incidence regions like China. Despite advances in multidisciplinary treatments, the prognosis for ESCC remains poor, with systemic chemotherapy facing the challenge of drug resistance. Epigenetic alterations, particularly DNA methylation, play a crucial role in ESCC carcinogenesis and therapeutic response. Aberrant DNA methylations, including global hypomethylation and promoter-specific hyper-methylation, disrupt critical pathways such as cell cycle regulation, apoptosis, and DNA repair, contributing to chemoresistance. Several studies have identified methylation markers that predict treatment response, particularly for chemotherapy, targeted therapy and immunotherapy, such as <i>p16</i> and <i>GPX3</i> for cisplatin, <i>MTHFR</i> for 5-FU, <i>CHFR</i> for paclitaxel. DNA methyltransferase inhibitors and other epigenetic therapies are being explored to reverse these methylation changes and enhance therapeutic efficacy. However, the clinical utility of these markers remains limited due to the lack of large-scale validation and concerns over off-target effects. This review aims to summarize all aberrant methylation alterations in ESCC and the clinical implications of aberrantly methylated candidate genes identified in ESCC systemic chemotherapy, with the goal of further understanding the underlying molecular mechanisms, refining methylation-targeting therapies, and integrating them with conventional treatments to improve patient outcomes.

Also flagged:bacteriocinBacteriocinsbiosynthesisfermentationnisinamino acid
Journal Article 2025-02-03 No Snippets Liang Q, Zhou W, Peng S, Liang Z, Liu Z, Zhu C, Mou H.
Show Full Abstract

Lactic acid bacteria (LAB) have been widely applied in the food industry and have brought many beneficial effects on food products, and some of those benefits are related to their metabolic product. Bacteriocins produced by LAB have attracted the attentions for application in the food industry as natural food bio-preservatives because of their antimicrobial activity against the food spoilage and pathogenic bacteria. With the increasing demands of consumers for more healthier food and investigations on natural food preservatives, the bioactivity of bacteriocins allows them to give the application values to the bacteriocin-producing LAB. Accordingly, the capacity of LAB to produce bacteriocin in the aspects of classifications, mode of action, biosynthesis mechanisms are introduced, which leads to further consideration of the current status and potential values of bacteriocin-producing LAB applied in the food industry. The comparation of guidelines of LAB and bacteriocins for food application are also proposed for better understanding their practical application promising. This review will be helpful for current and future researches on the application of bacteriocin-producing LAB in the food industry.

Also flagged:deathimmune responsesoxygentumormitochondrialrespiratory chain
Journal Article 2025-02-03 No Snippets Zhang J, Jing Q, Yuan L, Zhou X, Di D, Li J, Pei D, Fan Z, Hai J.
Show Full Abstract

Gas therapy (GT) and/or phototherapy have been recently employed as immunogenic cell death (ICD) agents for activating immunotherapy, whereas the effective activation of sufficient immune responses remains an enormous challenge in such single therapeutic modality. In this study, a near-infrared (NIR)-triggered programmable nanomotor with hydrogen sulfide (H<sub>2</sub>S) and nitric oxide (NO) generation is well designed to achieve oncotherapy by cascading mild photothermal, gas, and reactive oxygen species (ROS)-reinforced immunogenic cell death. In brief, a gas signal molecule donor NOSH with H<sub>2</sub>S and NO capable of on-demand H<sub>2</sub>S and NO release was synthesized and then loaded into hollow mesoporous copper sulfide nanoparticles (termed as HCuSNPs) with an inherent NIR absorption and surface modification activity to obtain the programmable nanomotor (termed as NOSH@PEG-HCuSNPs). In particular, NOSH@PEG-HCuSNPs can effectively achieve the simultaneous spatiotemporal co-delivery of NOSH and HCuSNPs, thereby exerting the synergistic effects of GT and mild photothermal therapy (mPTT). It is worth noting that the anti-tumor response of mPTT is effectively enhanced by GT by disrupting the mitochondrial respiratory chain, inhibiting ATP production, and promoting tumor cell apoptosis. One by one, a large number of peroxynitrite anion (ONOO<sup>-</sup>) radicals are generated by the interactions of ROS from mPTT and NO from NOSH. Meanwhile, the unique protective mechanism of H<sub>2</sub>S is utilized to induce tumor thermal ablation by reducing the overexpression of heat shock protein 90 (HSP 90) and minimize the unnecessary damage toward normal tissues. Finally, ICD is markedly augmented by the cascading effects of mPTT, ONOO⁻radicals, and H<sub>2</sub>S. Concurrently, the immunosuppressive tumor microenvironment is reprogrammed, effectively inhibiting distant tumor tissues and preventing metastasis and tumor recurrence. Taken together, this study provides a new perspective for innovation in the field of oncotherapy.

Also flagged:CSF-1CSF-1RpathogenesisfibrosistumorColony stimulating factor-1
Journal Article 2025-02-03 No Snippets Shang Q, Zhang P, Lei X, Du L, Qu B.
Show Full Abstract

Macrophage plays an important role in homeostasis and immunity, and dysfunctional macrophage polarization is believed to be associated with the pathogenesis of tissue fibrosis and tumor progression. Colony stimulating factor-1 (CSF-1), a polypeptide chain cytokine, through its receptor (CSF-1R) regulates the differentiation of macrophages. Recently, the promising therapeutic potential of CSF-1/CSF-1R signaling pathway inhibition in cancer treatment is widely used. Furthermore, inhibition of CSF-1/CSF-1R signaling combined with radiotherapy has been extensively studied to reduce immunosuppression and promote abscopal effect. In addition, cumulative evidence demonstrated that M2 phenotype macrophage is dominant in tissue fibrosis and the inhibition of CSF-1/CSF-1R signaling pathway ameliorated pulmonary fibrosis, including radiation-induced lung fibrosis. Herein, we provide a comprehensive review of the CSF-1/CSF-1R signaling pathway in radiotherapy, with a focus on advances in macrophage-targeted strategies in the treatment of cancer and pulmonary fibrosis.

Also flagged:Autophagydegradationcytoplasmiclysosomesmacroautophagychaperone
Journal Article 2025-02-03 No Snippets Wang Y, Liu J, Wang H, Jiang P, Cao L, Lu S, Zhang S, Yang R, Feng H, Cao L, Song X.
Show Full Abstract

Autophagy refers to the proteolytic degradation of cytoplasmic components by lysosomes, and includes three defined types: macroautophagy, chaperone-mediated autophagy (CMA), and microautophagy. Although the regulatory pathways of macroautophagy are well defined, how CMA is accurately regulated remains less understood. In recent years, emerging evidence has suggested that chaperone-mediated autophagy is regulated by multiple mechanisms at nucleic acid and protein levels. In this review, we summarized recent progress on multiple regulatory mechanisms and functions concerning CMA, as well as novel treatments targeting specific regulation sites.

Also flagged:epileptic encephalopathiesand epileptic encephalopathiesDEEmovement disordersencephalopathygenetic metabolic disorders
Journal Article 2025-02-03 No Snippets Yuan M, Wang X, Yang Z, Luo H, Gan J, Luo R.
Show Full Abstract

Genetic developmental and epileptic encephalopathies (DEE) are often associated with movement disorders. Accurate identification and classification of movement disorders are essential for management of these diseases. In this review, we describe the characteristics of various movement disorders associated with DEE and summarize the distribution of common DEE-related gene mutations reported in previous studies, aiming to provide references for the diagnosis and treatment of these disorders.

RC3H1
Also flagged:infectionacute respiratory distress syndromefurinGM-CSFcancerimmune response
Journal Article 2025-02-03 ✓ 1 Snippet Nemunaitis J, Stanbery L, Senzer N.
In-Text Gene Mentions

…Regnase-1 (ZC3H12A), Roquin (RC3H1)] [ 60 ].…

Show Full Abstract

No abstract available.

Research Square 2025-02-03 Preprint (No Snippets API) Dunican C, Wilson C, Habgood-Coote D, Patterson S, Noursadeghi M, Moseki R, Stek C, Wilkinson R, Agyeman P, Beudeker C, Biesbroek G, von Both U, Brengel-Pesce K, Carrol E, Coin L, D'Souza G, De T, Emonts M, Fidler K, Fink C, Flier MVd, Georgaki I, Kolberg L, Kolnik M, Kuijpers T, Martinon-Torres F, Mommert-Tripon M, Nichols S, Paulus S, Pokorn M, Pollard A, Rivero-Calle I, Rudzate A, Schlapbach L, Schweintzger N, Shen C, Shrestha S, Tan C, Tsolia M, Usuf E, Velden Fvd, Vermont C, Voice M, Yeung S, Zavadska D, Zenz W, Wright V, Levin# M, Herberg J, Lai R, Meintjes G, Chiu C, Barahona M, Kaforou M, Cunnington A.
Show Full Abstract

<title>Abstract</title> <p>Transcriptomic analyses reveal the status of cells, tissues, or organisms, across states of health and disease. RNA velocity adds a temporal dimension to single cell analyses, predicting future transcriptomic and phenotypic states, based on current spliced and unspliced mRNA of each cell. We hypothesized that RNA velocity could be adapted to predict future clinical status of individuals with acute illness using their whole-blood transcriptome. We developed a method for quantitative prediction of transitions in clinical state from a single time-point sample, which we call VeloCD. This predicted transcriptomic trajectories and future infection status in influenza A and SARS-CoV-2 human challenge studies. In HIV-TB coinfected individuals, it predicted the onset of immune reconstitution inflammatory syndrome. In a multinational observational study of acutely unwell febrile children, VeloCD predicted those with greatest medical care requirements. Our results demonstrate a novel application of RNA velocity to predict the trajectory of acute illness.</p>

Research Square 2025-02-03 Preprint (No Snippets API) Reiff T, Zipper L, Ramon-Cañellas P, Akkas F.
Show Full Abstract

<title>Abstract</title> <p>Adult epithelial organs undergo continual steady-state turnover that is achieved by tight coupling of stem cell production with replacement of worn-out epithelial cells by local intercellular signaling. Like many eukaryotic epithelia, absorptive enterocytes (EC) of the adult Drosophila midgut are arranged in a hexagonal, honeycomb-like pattern. On tricellular nexuses of EC, intestinal stem cells (ISC) are scattered in a way so that around two thirds of EC can be renewed directly by adjacent ISC. However, the mechanism for replacement of the remaining third of remotely located EC is unknown. Here we show that a conserved axonal guidance cue directs enteroblasts (EB), the immediate ISC daughters, to selectively replace worn-out adjacent and remote EC with identical frequency. Worn-out EC express Netrin-B ligands that attract Frazzled/DCC-receptor dependent EB protrusions and our ‘Hamelin’ assay confirms EB migration towards Netrin-B sources, as a matter of fact luring endodermal midgut progenitors across an organ boundary into the ectodermal hindgut. Visualisation of dissemination from intestinal tumours suggests a new pathological role for Frazzled/DCC-signalling in early steps of metastasis. Our data establishes spatially directed EB migration as essential for intestinal homeostasis and provides mechanistic support for recent findings resuscitating Netrins and Frazzled/DCC-signalling as therapeutic target in metastasis.</p>

bioRxiv 2025-02-03 Preprint (No Snippets API) Swanson MEV, Tan AYS, Tippett LJ, Turner CP, Curtis MA, Scotter EL, Lashuel HA, Dragunow M, Faull RLM, Murray HC, Singh-Bains MK.
Show Full Abstract

Huntington’s disease (HD) is a hereditary neurodegenerative condition caused by a CAG repeat expansion mutation in the gene encoding the huntingtin (Htt) protein. The accumulation of Htt inclusion bodies is a pathological hallmark of HD and a common target for therapeutic strategies. However, the limited efficacy of treatments targeting the Htt protein highlights the need for a better understanding of the role of Htt inclusion bodies in HD pathogenesis. This study examined the heterogeneity of Htt inclusion body composition by co-labelling with three Htt epitope-specific antibodies to characterize Htt inclusion body ‘immunophenotype’. We then characterized the size and sub-cellular location of Htt inclusions with distinct immunophenotypes. Using multiplex immunohistochemistry, we also examined the ubiquitination profile of each immunophenotype. Our findings demonstrate that Htt inclusions have a range of immunophenotypes, with some labelled by only one of the three antibodies and others exhibiting co-labelling by several antibodies, thus demonstrating the heterogeneity in inclusion composition and structure. We outline evidence that inclusion bodies exclusively labelled with the EM48 antibody are small, non-nuclear, and more abundant in HD cases with increased CAG repeat length, higher Vonsattel grade, and earlier age of onset. We also find that Htt inclusion bodies labelled by multiple antibodies are more likely to be ubiquitinated, predominantly by K63-rather than K48-linked ubiquitin, suggesting preferential degradation by autophagy. Lastly, we show that ubiquitinated Htt inclusion bodies are more highly immunoreactive for ubiquilin 2 than p62. Our findings highlight the need for multiple antibodies to capture the full spectrum of Htt pathology in HD and imply that future studies should consider the diversity of inclusion body composition and structure when correlating pathology formation to neurodegeneration, clinical symptoms, or disease severity.

Also flagged:waterinfectious diseasesreverse transcriptionCOVID-19cholerainfluenza
Journal Article 2025-02-02 No Snippets Huang YH, Jiang S.
Show Full Abstract

Rapid and onsite detection of pathogens in water is a critical first step in preventing the spread of infectious diseases from the environment to humans. However, current microbial monitoring practices are tedious, expensive, and slow. These limitations significantly impede our ability to promptly identify potential risks to public health, leading to delays in implementing the necessary interventions. In this study, we report the development of a portable centrifugal microfluidic disc (CD) that integrates sample concentration, purification, and a droplet digital reverse transcription LAMP (ddRT-LAMP) assay as a lab-on-a-chip system for rapid virus detection in the environment. Coupled with the pseudo- and nonpseudo forces generated during the CD rotation or oscillation, the assay steps for sample purification, concentration, and quantification were completed in less than 1.5 h. The results showed that the on-CD sample preparation procedures are comparable to the traditional in-tube sample preparation assay. Furthermore, the indigenous pepper mild mottle virus (PMMoV) in raw sewage at concentrations ranging from 6.0 × 10<sup>4</sup> to 2.1 × 10<sup>7</sup> copies/ml was successfully quantified using the complete on-CD assay, which includes on-CD sample preparation procedures and on-CD ddRT-LAMP. The concentrations of PMMoV detected by the CD assay matched well with those detected by the state-of-the-art virus nucleic acid extraction and ddRT-PCR assay for wastewater and wastewater-spiked environmental water samples, demonstrating the potential of this CD platform for environmental applications.

Also flagged:alkylthyroid diseasecancerinjuryhydrocarbonwater
Journal Article 2025-02-02 No Snippets Mauge-Lewis KA, Ramaiahgari SC, Auerbach SS, Roberts GK, Waidyanatha S, Fenton SE, Phadke DP, Balik-Meisner MR, Tandon A, Mav D, Howard B, Shah R, Sparrow B, Gorospe J, Ferguson SS.
Show Full Abstract

Aqueous film-forming foams (AFFFs) are complex product mixtures that often contain per- and polyfluorinated alkyl substances (PFAS) to enhance fire suppression and protect firefighters. However, PFAS have been associated with a range of adverse health effects (e.g., liver and thyroid disease and cancer), and innovative approach methods to better understand their toxicity potential and identify safer alternatives are needed. In this study, we investigated a set of 30 substances (e.g., AFFF, PFAS, and clinical drugs) using differentiated cultures of human hepatocytes (HepaRG, 2D), high-throughput transcriptomics, deep learning of cell morphology images, and liver enzyme leakage assays with benchmark dose analysis to (1) predict the potency ranges for human liver injury, (2) delineate gene- and pathway-level transcriptomic points-of-departure for molecular hazard characterization and prioritization, (3) characterize human hepatocellular response similarities to inform regulatory read-across efforts, and (4) introduce an innovative approach to translate mechanistic hepatocellular response data to predict the potency ranges for PFAS-induced hepatomegaly in vivo. Collectively, these data fill important mechanistic knowledge gaps with PFAS/AFFF and represent a scalable platform to address the thousands of PFAS in commerce for greener chemistries and next-generation risk assessments.

TNFSF4
Also flagged:PDACtumortumorsgene expressiongene expressionsmitochondrial
Journal Article 2025-02-02 ✓ 1 Snippet Li Y, Ding Z, Cheng T, Hu Y, Zhong F, Ren S, Wang S.
In-Text Gene Mentions

…as CD252 orTNFSF4), TNFRSF4 transmits co-stimul…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is a highly lethal malignant tumor characterized by a complex tumor microenvironment (TME) with significant heterogeneity, posing immense challenges for devising effective therapeutic strategies. This study aims to elucidate the dynamic changes in the TME during PDAC progression and develop a prognostic model using single-cell RNA sequencing (scRNA-seq) data. We utilized a previously published comprehensive dataset comprising 31 samples (including 8 PDAC I, 9 PDAC II, 6 PDAC III, and 8 PDAC IV) to characterize the changes in TME composition with PDAC progression through advanced scRNA-seq analysis. We found that as cancer progresses, immune cells gradually become a predominant component in late-stage PDAC. We defined a novel Treg and exhausted T cell signature gene, TNFRSF4. Additionally, we identified a prognostic gene set (RPS10, MIF, MT-ATP6, CSTB, IFI30, NPC2, BTG1, CTSD, FCGR2A, SEC61G, IER3, HSPB1, HMOX1, and ZFP36L1) and differentiated high-risk from low-risk PDAC patients based on median risk score threshold. Based on these findings, we developed a novel prognostic model that identifies poorer prognosis in high-risk groups. Furthermore, our analysis revealed significant interactions between cells at different stages of PDAC and identified three promising therapeutic agents (XR-11576, Ixabepilone, and AMONAFIDE) based on correlated genes. Finally, molecular docking studies validated their potential by confirming stable binding with key protein targets. This study not only provides insights into the evolving TME of PDAC but also offers a new prognostic model and potential therapeutic strategies, contributing to improved management and treatment of this aggressive cancer.

SERPINC1
Also flagged:Cytolethal distending toxincdtdistending toxinsDNasecell cyclecdt type I
Journal Article 2025-02-02 ✓ 1 Snippet Huerta-Cantillo J, Chavez-Dueñas L, Zaidi MB, Estrada-García T, Navarro-Garcia F.
In-Text Gene Mentions

…other by CDT-II,CDT-IIIand CDT-V, the…

Show Full Abstract

Cytolethal distending toxins (CDTs), encoded by cdtABC genes, have DNase activity leading to cellular and nuclear distention, resulting in actin remodeling, irreversible cell cycle arrest and apoptosis of target cells. PCR cdt-positive Escherichia coli strains have been isolated from children with diarrhea worldwide. However, toxin production and biological activity of cdt<sup>+</sup> strains are rarely confirmed. Here, we characterized the biological activity of cdt<sup>+</sup> E. coli of clinical isolates from Mexican children with severe diarrhea and its relationship with the harbored cdt type. Ten isolates from seven patients containing cdt<sup>+</sup> E. coli, one isolate from a patient containing cdt<sup>-</sup> E. coli, and a prototype CDT-producing E. coli were used to determine the harbored cdt-type, cell distention, actin remodeling and cell cycle arrest on epithelial cells. Three isolates harbored cdt type I, one type II, two type III, two type IV and two simultaneously type II and III. Lysates from eight cdt<sup>+</sup> E. coli isolates caused cell distention, actin cytoskeletal remodeling and cell cycle arrest but two isolates from the same patient harboring simultaneously cdt type II/III did not. The cdt genes were necessary and enough to cause the cytolethal distending pathology. Mutants in cdtAB<sub>I</sub>C (O86:H34 strain; cdt-I) and cdtAB<sub>II</sub>C (isolate; cdt-II) were complemented by cdtAB<sub>II</sub>C genes and both recovered the CDT-induced phenotypes. Transformation of E. coli BL21 by cdtAB<sub>II</sub>C genes caused this cytolethal distending pathology. These data indicate that cdt + E. coli isolates are potentially dangerous bacteria to cause serious epithelial cell damage and cell death to aggravate childhood diarrhea.

RC3H1
Also flagged:DLBCLtumorsBCL10diffuse large B-cell lymphomalymphomaBTK
Journal Article 2025-02-02 ✓ 1 Snippet Coughlin CA, Chahar D, Lekakis M, Youssfi AA, Li L, Roberts E, Gallego NC, Volmar CH, Landgren O, Brothers S, Griswold AJ, Amador C, Bilbao D, Maura F, Schatz JH.
In-Text Gene Mentions

…of Regnase-1 andRoquin-1/2 [ 13 ].…

Show Full Abstract

Disparate pathogenic mechanisms complicate precision-medicine efforts to treat diffuse large B-cell lymphoma (DLBCL), the most common lymphoma diagnosis. Though potentially curable with frontline combination chemoimmunotherapy, DLBCL carries persistently poor prognosis for those with relapsed or refractory (rel/ref) disease, despite recent advances in immunotherapy. Here, we build on recent findings implicating gain-of-function mutations in the BCL10 signaling protein as drivers of resistance to Bruton's tyrosine kinase (BTK) inhibitors. We show mutant BCL10-driven DLBCL is resistant to multiple additional drug classes, demonstrating urgency to derive mechanistically rooted strategies to overcome undruggable BCL10 mutants that stabilize BTK-independent signaling filaments upstream of NF-kB activation. BCL10 mutants promote a cytokine-reinforced positive feedback loop of lymphomagenesis driving not just NF-kB but multiple additional pathways converging on diffuse activation of oncogenic transcription factors. Up-regulation of anti-apoptotic genes increases mitochondrial membrane potential, underlying multidrug resistance. Increased expression of BCL2, BCL2L1 (BCL-XL), and BCL2A1 (BFL1) drives resistance to venetoclax, but expression can be overcome by the potent non-covalent BTK inhibitor pirtobrutinib. Venetoclax plus pirtobrutinib synergized in overcoming resistance and potently killed BCL10-mutant lymphomas in vitro and in vivo. BTK therefore retains key roles protecting DLBCL from apoptosis even when downstream activation of the BCL10 signaling complex activates NF-kB independently.

Also flagged:Burn injuryinflammatory responseglucosemetabolismcardiovascular diseasediabetes
Journal Article 2025-02-02 No Snippets Carlton M, Zang T, Parker TJ, Punyadeera C, Voisey J, Cuttle L.
Show Full Abstract

Saliva is a child appropriate biofluid, but it has not previously been used to evaluate the systemic response to burn injury in children. The aim of this study was to investigate the salivary proteome of children with small area thermal skin burns relative to different burn characteristics (mechanism, time to re-epithelialization and risk of emotional distress). SWATH Mass Spectrometry was used to quantify the abundance of 742 proteins in the saliva of children with burns (n = 22) and healthy controls (n = 37). Eight proteins were differentially abundant in the saliva of children with burns compared to healthy children, and these were associated with immune processes, epidermal cell differentiation and transferrin receptor binding. Eleven proteins were differentially abundant in patients with burns of different mechanisms. Scald burns had an over-representation of immune/inflammatory response processes, and contact burns had an over-representation of cornification, intermediate filament assembly and cell death cellular processes. Four proteins were elevated in patients who were at high risk for emotional distress and 15 proteins were correlated with time to wound re-epithelialization. This pilot study proves that saliva can be used for paediatric biomarker discovery and can be used as a diagnostic and prognostic sample to investigate systemic changes in a paediatric burn cohort.

DCC
Also flagged:Biliary Tract Cancerstumorintrahepatic cholangiocarcinomaperihilar cholangiocarcinomadistal cholangiocarcinomagallbladder cancer
Journal Article 2025-02-02 ✓ 5 Snippets Seo YD, Acidi B, Newton A, Haddad A, Chiang YJ, Coelho R, Newhook TE, Tzeng CD, Chun YS, Ludmir EB, Koay EJ, Javle M, Vauthey JN, Cao HST.
In-Text Gene Mentions

…2689 PHC, 3092DCC, and 10,186 GBC…

…and 1444 forDCC, and 4110 and…

…the PHC andDCCcohorts, adjuvant XRT…

…in PHC andDCCare less definitive,…

…whereas PHC andDCCwere grouped together…

Show Full Abstract

<b>Background</b>: Biliary tract cancers (BTCs) have distinct tumor biology but share a poor prognosis, with a 5-year-survival-rate of 5-19%. Surgical resection is the only potential cure, but recurrences are common. The role of adjuvant radiotherapy (XRT) remains unclear. <b>Methods</b>: Using the National Cancer Database (2006-2018), we analyzed resected non-metastatic BTCs. Patients who survived beyond 90 days post-surgery were included, while those with R2 resections or neoadjuvant therapy were excluded. Propensity matching was performed based on predictors of adjuvant radiation, age, and sex. Survival outcomes were compared between no adjuvant therapy, chemotherapy alone, and XRT ± chemotherapy. <b>Results</b>: Among 21,275 patients, including 5308 intrahepatic cholangiocarcinoma (IHC), 2689 perihilar cholangiocarcinoma (PHC), 3092 distal cholangiocarcinoma (DCC), and 10,186 gallbladder cancer (GBC) cases, adjuvant XRT did not improve survival for IHC. For PHC and DCC, XRT improved survival over no adjuvant therapy (PHC: 31.2 vs. 26.3 months, <i>p</i> = 0.004; DCC: 33.7 vs. 27.0 months, <i>p</i> = 0.015) but not over chemotherapy alone. For GBC, XRT significantly improved survival compared to both no adjuvant therapy and chemotherapy (30.2 vs. 26.6 and 24.6 months; <i>p</i> = 0.05 and <i>p</i> = 0.001). <b>Conclusions</b>: XRT provides a survival benefit for GBC, especially in node-positive and R1-resected patients. For PHC and DCC, XRT improves outcomes compared to no therapy, but its benefit over chemotherapy is uncertain. No benefit was observed for IHC.

CA10
Also flagged:Tetracyclineprg Wcopasa1tettetM
Journal Article 2025-02-02 ✓ 1 Snippet Pandova M, Kizheva Y, Hristova P.
In-Text Gene Mentions

…mundtii strain CA8,E. pallens strain CA10pallens strain CA10…

Show Full Abstract

Non-clinical enterococci are relatively poorly studied by means of acquired antibiotic resistance to tetracycline and by the distribution, functionality and role of their CRISPR systems. <b>Background:</b> In our study, 72 enterococcal strains, isolated from various non-clinical origins, were investigated for their phenotypic and genotypic (<i>tet</i>(M), <i>tet</i>(O), <i>tet</i>(S), <i>tet</i>(L), <i>tet</i>(K), <i>tet</i>(T) and <i>tet</i>(W)) tetracycline resistance. <b>Methods:</b> The genetic determinants for HGT (MGEs (<i>Int-Tn</i> and <i>prg</i>W), inducible pheromones (<i>cpd</i>, <i>cop</i> and <i>cff</i>), aggregation substances (<i>agg</i>, <i>asa1</i>, <i>prgB</i> and <i>asa373</i>) and CRISPR-Cas systems were characterized by PCR and whole-genome sequencing. <b>Results:</b> Four <i>tet</i> genes (<i>tetM</i>, <i>tetO</i>, <i>tetS</i> and <i>tetT</i>) were detected in 39% (n = 28) of our enterococcal population, with <i>tet</i>M (31%) being dominant. The gene location was linked to the Tn6009 transposon. All strains that contained <i>tet</i> genes also had genes for HGT. No <i>tet</i> genes were found in <i>E. casseliflavus</i> and <i>E. gilvus</i>. In our study, 79% of all <i>tet</i>-positive strains correlated with non-functional CRISPR systems. The strain <i>E. faecalis</i> BM15 was the only one containing a combination of a functional CRISPR system (<i>cas1</i>, <i>cas2</i>, <i>csn2</i> and <i>csn</i>1/<i>cas</i>9) and <i>tet</i> genes. The CRISPR subtype repeats II-A, III-B, IV-A2 and VI-B1 were identified among <i>E. faecalis</i> strains (CM4-II-A, III-B and VI-B1; BM5-IV-A2, II-A and III-B; BM12 and BM15-II-A). The subtype II-A was the most present. These repeats enclosed a great number of spacers (1-10 spacers) with lengths of 31 to 36 bp. One CRISPR locus was identified in plasmid (p.Firmicutes1 in strain <i>E. faecalis</i> BM5). We described the presence of CRISPR loci in the species <i>E. pseudoavium</i>, <i>E. pallens</i> and <i>E. devriesei</i> and their lack in <i>E. gilvus</i>, <i>E. malodoratus</i> and <i>E. mundtii</i>. <b>Conclusions:</b> Our findings generally describe the acquisition of foreign DNA as a consequence of CRISPR inactivation, and self-targeting spacers as the main cause.

Also flagged:AutophagyCancerautophagosomestumorChronic myeloid leukemiaCML
Journal Article 2025-02-02 No Snippets Kausar MA, Anwar S, Khan YS, Saleh AA, Ahmed MAA, Kaur S, Iqbal N, Siddiqui WA, Najm MZ.
Show Full Abstract

Autophagy is a critical cellular process that maintains homeostasis by recycling damaged or aberrant components. This process is orchestrated by a network of proteins that form autophagosomes, which engulf and degrade intracellular material. In cancer, autophagy plays a dual role: it suppresses tumor initiation in the early stages but supports tumor growth and survival in advanced stages. Chronic myeloid leukemia (CML), a hematological malignancy, is characterized by the Philadelphia chromosome, a chromosomal abnormality resulting from a translocation between chromosomes 9 and 22. Autophagy has emerged as a key factor in CML pathogenesis, promoting cancer cell survival and contributing to resistance against tyrosine kinase inhibitors (TKIs), the primary treatment for CML. Targeting autophagic pathways is being actively explored as a therapeutic approach to overcome drug resistance and enhance cancer cell death. Recent research highlights the intricate interplay between autophagy and CML progression, underscoring its role in disease biology and treatment outcomes. This review aims to provide a comprehensive analysis of the molecular and cellular mechanisms underlying CML, with a focus on the therapeutic potential of targeting autophagy.

HTT
Also flagged:Chronic wasting diseaseprion diseasesPrPpathogenesisimmune responsesprion disease
Journal Article 2025-02-02 ✓ 1 Snippet Zerr I.
In-Text Gene Mentions

…toplasmic wild-type HTT (wtHTT) proteins ex…

Show Full Abstract

No abstract available.

Also flagged:pulmonary infectionsMABC infectionsPEPPECFrespiratory infections
Journal Article 2025-02-01 No Snippets Olawoye IB, Waglechner N, McIntosh F, Akochy PM, Cloutier N, Grandjean Lapierre S, Tannir B, Greenaway C, Matouk E, Poirier L, Levesque RC, Boyle B, Quach C, Soualhine H, Batt J, Behr MA, Lee RS, Guthrie JL.
Show Full Abstract

<h4>Background</h4>Mycobacterium abscessus complex (MABC), an opportunistic nontuberculous mycobacteria, can lead to poor clinical outcomes in pulmonary infections. Conflicting data exist on person-to-person transmission of MABC within and across health care facilities. To investigate further, a comprehensive retrospective study across 5 health care institutions on the Island of Montréal was undertaken.<h4>Methods</h4>We analyzed the genomes of 221 MABC isolates obtained from 115 individuals (2010-2018) to identify possible links. Genetic similarity, defined as ≤25 single-nucleotide polymorphisms (SNPs), was investigated through a blinded epidemiological inquiry.<h4>Results</h4>Bioinformatics analyses identified 28 sequence types, including globally observed dominant circulating clones (DCCs). Further analysis revealed 210 isolate pairs within the SNP threshold. Among these pairs, there was 1 possible laboratory contamination where isolates from different patients processed in the same laboratory differed by only 2 SNPs. There were 37 isolate pairs from patients who had provided specimens from the same hospital; however, epidemiological analysis found no evidence of health care-associated person-to-person transmission between these patients. Additionally, pangenome analysis showed higher discriminatory power than core genome analysis for examining genomic similarity.<h4>Conclusions</h4>Genomics alone is insufficient to establish MABC transmission, particularly considering the genetic similarity and wide distribution of DCCs, although pangenome analysis has the potential to add further insight. Our findings indicate that MABC infections in Montréal are unlikely attributable to health care-associated person-to-person transmission.

VRK2
Also flagged:innate immunitymitochondriamitochondrialcytosollumenimmune response
Journal Article 2025-02-01 ✓ 1 Snippet Rai P, Fessler MB.
In-Text Gene Mentions

virus-related kinase 2

Show Full Abstract

In recent years, a growing number of roles have been identified for mitochondria in innate immunity. One principal mechanism is that the translocation of mitochondrial nucleic acid species from the mitochondrial matrix to the cytosol and endolysosomal lumen in response to an array of microbial and non-microbial environmental stressors has been found to serve as a second messenger event in the cell signaling of the innate immune response. Thus, mitochondrial DNA and RNA have been shown to access the cytosol through several regulated mechanisms involving remodeling of the mitochondrial inner and outer membranes and to access lysosomes via vesicular transport, thereby activating cytosolic [e.g. cyclic GMP-AMP synthase (cGAS), retinoic acid-inducible gene I (RIG-I)-like receptors], and endolysosomal (Toll-like receptor 7, 9) nucleic acid receptors that induce type I interferons and pro-inflammatory cytokines. In this mini-review, we discuss these molecular mechanisms of mitochondrial nucleic acid mislocalization and their roles in host defense, autoimmunity, and auto-inflammatory disorders. The emergent paradigm is one in which host-derived DNA interestingly serves as a signal amplifier in the innate immune response and also as an alarm signal for disturbances in organellar homeostasis. The apparent vast excess of mitochondria and mitochondrial DNA nucleoids per cell may thus serve to sensitize the cell response to stressors while ensuring an underlying reserve of intact mitochondria to sustain cellular metabolism. An improved understanding of these molecular mechanisms will hopefully afford future opportunities for therapeutic intervention in human disease.

Also flagged:Chronic myelomonocytic leukemiaNPM1acute myeloid leukemiaCMMLAML
Journal Article 2025-02-01 No Snippets Castaño-Díez S, Álamo JR, López-Guerra M, Gómez-Hernando M, Zugasti I, Jiménez-Vicente C, Guijarro F, López-Oreja I, Esteban D, Charry P, Torrecillas V, Mont-de Torres L, Cortés-Bullich A, Bataller Á, Guardia A, Munárriz D, Carcelero E, Riu G, Triguero A, Tovar N, Vela D, Beà S, Costa D, Colomer D, Rozman M, Esteve J, Díaz-Beyá M.
Show Full Abstract

The 2022 WHO revision and the ICC classification have recently modified the diagnostic criteria for chronic myelomonocytic leukemia (CMML) and acute myeloid leukemia. However, there is no consensus on whether CMML with NPM1 mutation (NPM1mut) should be diagnosed as AML. Nowadays, it is a subject of discussion because of its diagnostic and therapeutic implications. Therefore, we describe a case of a patient diagnosed with CMML NPM1mut and briefly review the literature to highlight the uncertainty about how to classify a CMML with NPM1 mutation. We emphasize the importance of a comprehensive molecular study, which is crucial to optimize the individualized treatment of patients, enabling them to access targeted therapies.

OLFM4
Also flagged:PneumoniaPI3CD177RAP1GAP1PRSS23IFI27
Journal Article 2025-02-01 ✓ 4 Snippets Williams DJ, Gautam S, Creech CB, Jimenez N, Anderson EJ, Bosinger SE, Grimes T, Arnold SR, McCullers JA, Goll J, Edwards KM, Ramilo O, 16-0036 Study Team .
In-Text Gene Mentions

…, IFI27 ,OLFM4, ABO ).…

…, IFI27 ,OLFM4, CHI3L1 ,…

…, RAP1GAP1 ,OLFM4, and ABO…

…Finally, PI3 ,OLFM4, and ABO…

Show Full Abstract

<h4>Background</h4>Challenges remain in discerning microbiologic etiology and disease severity in childhood pneumonia. Defining host transcriptomic profiles during illness may facilitate improved diagnostic and prognostic approaches.<h4>Methods</h4>Using whole blood RNA sequencing from 222 hospitalized children with radiographic pneumonia and 45 age-matched controls, we identified differentially expressed (DE) genes that best identified children according to detected microbial pathogens (viral only vs bacterial only and typical vs atypical bacterial [with or without [±] viral co-detection]) and an ordinal measure of phenotypic severity (moderate, severe, very severe).<h4>Results</h4>Overall, 135 (61%) children had viral-only detections, 15 (7%) had typical bacterial detections (± viral co-detections), and 26 (12%) had atypical bacterial detections (± viral co-detections). Eleven DE genes distinguished between viral-only and bacterial-only detections. Sixteen DE genes distinguished between atypical and typical bacterial detections (± viral co-detections). Nineteen DE genes distinguished between levels of pneumonia severity, including 4 genes also identified in the viral-only versus bacterial-only model (IGHGP, PI3, CD177, RAP1GAP1) and 4 genes from the typical versus atypical bacterial model (PRSS23, IFI27, OLFM4, ABO).<h4>Conclusions</h4>We identified transcriptomic biomarkers associated with microbial detections and phenotypic severity in children hospitalized with pneumonia. These DE genes are promising candidates for validation and translation into diagnostic and prognostic tools.

HFE
Also flagged:BMPironHepcidinbone morphogenetic proteinsBMPsSlc40a1
Journal Article 2025-02-01 ✓ 1 Snippet Fisher AL, Phillips S, Wang CY, Paulo JA, Xiao X, Xu Y, Moschetta GA, Xue Y, Mancias JD, Babitt JL.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Abstract</h4>The liver hormone hepcidin regulates systemic iron homeostasis to provide enough iron for vital processes while limiting toxicity. Hepcidin acts by degrading its receptor ferroportin (encoded by Slc40a1) to decrease iron export to plasma. Iron controls hepcidin production in part by inducing liver endothelial cells (LECs) to produce bone morphogenetic proteins (BMPs) that activate hepcidin transcription in hepatocytes. Here, we used in vitro and in vivo models to investigate whether ferroportin contributes to LEC intracellular iron content to modulate BMP expression and, thereby, hepcidin. Quantitative proteomics of LECs from mice fed different iron diets demonstrated an inverse relationship between dietary iron and endothelial ferroportin expression. Slc40a1 knockdown primary mouse LECs and endothelial Slc40a1 knockout mice exhibited increased LEC iron and BMP ligand expression. Endothelial Slc40a1 knockout mice also exhibited altered systemic iron homeostasis with decreased serum and total liver iron but preserved erythropoiesis. Although endothelial Slc40a1 knockout mice had similar hepcidin expression to control mice, hepcidin levels were inappropriately high relative to iron levels. Moreover, when iron levels were equalized with iron treatment, hepcidin levels were higher in endothelial Slc40a1 knockout mice than in controls. Finally, LEC ferroportin levels were inversely correlated with hepcidin levels in multiple mouse models, and treatment of hepcidin-deficient mice with mini-hepcidin decreased LEC ferroportin expression. Overall, these data show that LEC ferroportin modulates LEC iron and consequently BMP expression to influence hepcidin production. Furthermore, LEC ferroportin expression is regulated by hepcidin, demonstrating a bidirectional communication between LECs and hepatocytes to orchestrate systemic iron homeostasis.

PRDX6
Also flagged:Clear cell renal cell carcinomaccRCCrenal cancerpembrolizumabchromosometumor
Journal Article 2025-02-01 ✓ 1 Snippet Bischoff ME, Shamsaei B, Yang J, Secic D, Vemuri B, Reisz JA, D'Alessandro A, Bartolacci C, Adamczak R, Schmidt L, Wang J, Martines A, Venkat J, Tcheuyap VT, Biesiada J, Behrmann CA, Vest KE, Brugarolas J, Scaglioni PP, Plas DR, Patra KC, Gulati S, Landero Figueroa JA, Meller J, Cunningham JT, Czyzyk-Krzeska MF.
In-Text Gene Mentions

…SH-dependent peroxiredoxin 6 (PRDX6), were not affected…

Show Full Abstract

<h4>Significance</h4>The work establishes a requirement for glucose-dependent coordination between energy production and redox homeostasis, which is fundamental for the survival of cancer cells that accumulate Cu and contributes to tumor growth.

Also flagged:PP2AIGFBP2SecretionUterine serous carcinomauterine carcinosarcomatumors
Journal Article 2025-02-01 No Snippets Haanen TJ, Boock S, Callahan CG, Peris I, Zawacki KP, Raines B, Nino CA, Tran B, Harold A, Hodges Onishi G, Hinderman M, Dowdican A, Huang W, Taylor DJ, Taylor SE, Jackson MW, DiFeo A, O'Connor CM, Narla G.
Show Full Abstract

Uterine serous carcinoma (USC) and uterine carcinosarcoma (UCS) tumors are uniquely aggressive, suggesting that the primary tumor is intrinsically equipped to disseminate and metastasize. Previous work identified mutational hotspots within PPP2R1A, which encodes the Aα scaffolding subunit of protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine phosphatase. Two recurrent heterozygous PPP2R1A mutations, P179R and S256F, occur exclusively within high-grade subtypes of uterine cancer and can drive tumorigenesis and metastasis. Elucidation of the mechanisms by which PP2A Aα mutants promote tumor development and progression could help identify therapeutic opportunities. Here, we showed that expression of these mutants in USC/UCS cell lines enhanced tumor-initiating capacity, drove a hybrid epithelial-to-mesenchymal plasticity phenotype, and elevated secretion of the tumorigenic cytokine insulin growth factor (IGF) binding protein 2 (IGFBP2). Therapeutic targeting of the IGFBP2/IGF receptor 1 signaling axis using small molecules and genetic approaches resulted in marked tumor growth inhibition. Mechanistically, PP2A regulated IGFBP2 expression through the transcription factor, NF-κB, which harbors a B56 recognition motif. Collectively, these results identify a role for PP2A in regulating paracrine cancer cell signaling that can be targeted to block the initiation and metastasis of high-grade uterine cancer. Significance: Elevated IGFBP2 secretion by uterine cancer cells with heterozygous PPP2R1A mutations supports tumor progression and confers a vulnerability to IGFBP2/IGF1R inhibition as a therapeutic approach for this highly aggressive cancer subtype.

MLLT10
Also flagged:hematopoiesisautoimmune thrombocytopeniaITPhemopoiesisthrombopoietin receptorTPO
Journal Article 2025-02-01 ✓ 1 Snippet Fattizzo B, Marchetti A, Bosi A, Gurnari C, Giannotta JA, Pedone GL, Rossi E, Carrai V, Guido A, Brioschi F, Carpenedo M, Crugnola M, Caramazza D, Leuzzi L, Marchetti M, Merati G, Malato S, Vianello F, Patriarca A, Awada H, Bortolotti M, Canzi M, Bolli N, Capecchi M, Chen F, Artoni A, Maciejewski JP, Barcellini W.
In-Text Gene Mentions

…KMT2A, MECOM, MET,MLLT10, MLLT3, MYBL1, MYH11,…

Show Full Abstract

<h4>Abstract</h4>Diagnostic boundaries between immune thrombocytopenia (ITP) and other thrombocytopenic states, such as thrombocytopenic myelodysplastic syndromes, may be difficult to establish, and the detection of somatic mutations by next-generation sequencing (NGS) may be of aid. Here, we aimed at characterizing the prevalence and clinical significance of clonal hematopoiesis in ITP. In this multicentric retrospective observational study, we enrolled 167 adult patients with ITP, followed at 13 centers in Italy, United Kingdom, and the United States. Patients underwent NGS evaluation after a median of 3.6 years from ITP onset, and 83% had received at least 1 therapy line, for a median of 2 lines (range, 0-9); 51 of 167 patients (30%) had at least 1 mutation. After exclusion of germ line variants and polymorphisms, 31 of 167 (18.5%) were defined as having clonal hemopoiesis. Most commonly mutated genes were TET2, DNMT3A, SRSF2, and ASXL1 (median variant allele frequency, 29%); 19 of 31 patients (68%) had high-risk variants, and 8 had multiple mutations. Mutated patients were more frequently older males and showed a shorter time from first to second-line therapy, particularly with thrombopoietin receptor agonist (TPO-RA). Additionally, clonal hematopoiesis was associated with increased thrombotic risk (26% vs 8% in NGS-negative cases; P = .01), independently from TPO-RA exposure, though with an age effect. These data demonstrated the prevalence of clonal hematopoiesis in 18% of adult patients with ITP, which is associated with older age, relapsed/refractory disease, and high risk of thrombotic complications.

Also flagged:BCL2BCL-XLacute lymphoblastic leukemialeukemiaALLB-cell acute lymphoblastic leukemia
Journal Article 2025-02-01 No Snippets Kannan S, Li Y, Baran N, Yang X, Ghotbaldini S, Zhang Tatarata Q, Yoshimura S, Li Z, Hsiao Y, Balachander S, Andersen CL, Cidado J, Yu J, Jain N, Yang JJ, Konopleva M.
Show Full Abstract

<h4>Abstract</h4>The upregulation of B-cell lymphoma 2 (BCL2) and B-cell lymphoma-extra large (BCL-XL), 2 proteins in the BCL2 family of proteins, leads to a disproportional expression of prodeath and prosurvival proteins in favor of leukemia survival, tumorigenesis, and chemoresistance. In different subsets of acute lymphoblastic leukemia (ALL), the proportion of these 2 proteins varies, and their potential as therapeutic targets needs detailed characterization. Here, we investigated BCL2 and BCL-XL, the genes that encode BCL2 and BCL-XL, and their expression differences between B-cell acute lymphoblastic leukemia (B-ALL) and T-cell ALL (T-ALL). We also evaluated the therapeutic potential of targeting these proteins with AZD0466, a novel drug-dendrimer conjugate of the BCL2/BCL-XL inhibitor AZD4320, and with BCL2 inhibitor venetoclax (ABT-199). Gene expression and activity analyses supported by the protein expression patterns in ALL cell lines and primary samples demonstrated increased levels of BCL2 expression in B-ALL, with high sensitivity to venetoclax or AZD4320. In contrast, strong BCL-XL expression and sensitivity to dual BCL2/BCL-XL inhibition was observed specifically in T-ALL samples. This observation was confirmed by BH3 profiling, demonstrating BCL2/BCL-XL codependence in T-ALL and BCL2 dependence in B-ALL. In a mouse model of T-ALL, AZD0466 but not venetoclax reduced leukemic burden and prolonged survival without significant toxicities. Our findings therefore suggest that the novel dual BCL2/BCL-XL inhibitor AZD0466 outperforms single BCL2 inhibition by venetoclax in T-ALL. These findings facilitate the translation of dual BCL2/BCL-XL inhibitors into ALL clinical trials, either alone or in combination with standard-of-care chemotherapy and immune therapies.

MLLT10
Also flagged:gene expressionhistonesmethylationacute myeloid leukemiaAMLchromatin
Journal Article 2025-02-01 ✓ 5 Snippets Schurer A, Glushakow-Smith SG, Gritsman K.
In-Text Gene Mentions

…(AF4), MLLT3 (AF9),MLLT10(AF10), MLLT1 (ENL),…

…hematopoiesis, MLLT3 andMLLT10function as readers…

…Chromatin-bound MLLT3 andMLLT10bind DOT1L and…

…by MLLT3 andMLLT10are lost and…

…fusion partners (MLLT3,MLLT10) recruit DOT1L to…

Show Full Abstract

Acute myeloid leukemia (AML) is a devastating hematologic malignancy with high rates of relapse, which can, in part, be attributed to the dysregulation of chromatin modifications. These epigenetic modifications can affect the capacity of hematopoietic cells to self-renew or differentiate, which can lead to transformation. Aberrant histone modifications contribute to the derepression of self-renewal genes such as HOXA/B and MEIS1 in committed hematopoietic progenitors, which is considered a key mechanism of leukemogenesis in MLL-rearranged (MLL-r) and NPM1-mutated AML. As regulators of some of the key histone modifications in this disease, the menin-KMT2A and polycomb repressive (PRC1/2) complexes have been identified as promising targets for the treatment of AML. This review explores recent discoveries of how leukemic cells hijack these complexes and their interactions with other chromatin regulators to promote disease progression. We also discuss inhibitors targeting these complexes that have demonstrated therapeutic efficacy in preclinical and clinical studies and propose novel therapeutic combinations targeting the KMT2A and PRC1/2 broader interacting networks to overcome issues of resistance to existing monotherapies.

TAOK3
Also flagged:TumorPancreatic Cancerpancreatic ductal adenocarcinomaPDACkinasetumors
Journal Article 2025-02-01 ✓ 1 Snippet Xu Y, Peng XL, East MP, McCabe IC, Stroman GC, Jenner MR, Chan PS, Morrison AB, Shen EC, Hererra SG, Joisa CU, Rashid NU, Iuga AC, Gomez SM, Miller-Phillips L, Boeck S, Heinemann V, Haas M, Ormanns S, Johnson GL, Yeh JJ.
In-Text Gene Mentions

TAOK3

Show Full Abstract

<h4>Significance</h4>We provide a comprehensive tumor-intrinsic kinome landscape that provides a roadmap for the use of kinase inhibitors in PDAC treatment approaches.

DCC
Also flagged:TumorERBB2Breast CancerHER2Cancertumors
Journal Article 2025-02-01 ✓ 1 Snippet Han HS, Aldrich AL, Garg SK, Weinfurtner RJ, Nguyen JV, Mo Q, Whiting J, Childress J, Soliman H, Costa R, Armaghani A, Soyano A, Kiluk J, Hoover S, Lee MC, Khakpour N, Shenoi N, Jameel Z, Koski GK, Czerniecki BJ.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Importance</h4>Current chemotherapy regimens for patients with ERBB2 (formerly HER2)-positive breast cancer are associated with considerable morbidity. These patients may benefit from more effective and less toxic therapies.<h4>Objective</h4>To evaluate the safety, immunogenicity, and preliminary efficacy of intratumoral (IT) delivery of conventional type 1 dendritic cells (cDC1) in combination with ERBB2-targeted therapies.<h4>Design, setting, and participants</h4>This phase 1 (lead-in phase of a single-center phase 2 trial) nonrandomized clinical trial was conducted at Moffitt Cancer Center (Tampa, Florida). Patients were enrolled from October 2021 to October 2022. Data were analyzed in 2023 Patients with early-stage ERBB2-positive breast cancer with tumors 1 cm or larger were eligible.<h4>Interventions</h4>Treatment included IT delivery of cDC1, 6 times weekly, followed by paclitaxel, 80 mg/m2, intravenously, 12 times weekly. Trastuzumab (8 mg/kg loading dose, then 6 mg/kg) and pertuzumab (840 mg loading dose, then 420 mg) were administered intravenously every 3 weeks for 6 cycles starting from day 1 of cDC1 injections. Two dose levels (DLs) of IT cDC1 (DL1 = 50 million and DL2 = 100 million cells) were evaluated, including 6 patients in each DL.<h4>Main outcomes and measures</h4>The primary outcomes were the safety and immune response, and the secondary outcomes were the antitumor efficacy as measured by breast magnetic resonance imaging and residual cancer burden at surgery following neoadjuvant therapy.<h4>Results</h4>Twelve ERBB2-positive patients were enrolled and received treatment (DL1 = 6 and DL2 = 6). Nine patients had hormone receptor-positive disease and 3 had hormone receptor-negative disease, with clinical stage I (n = 5), II (n = 4), and III (n = 3). The most frequently observed adverse events with cDC1 were grade 1 to 2 chills (50%), fatigue (41.7%), headache (33%), and injection site reactions (33%). DL2 was associated with a diminished anti-ERBB2 CD4 T-helper 1 blood response with a concomitant increase in innate and adaptive responses within the tumor. Preimmunotherapy and postimmunotherapy breast magnetic resonance imaging results showed 9 objective responses, 6 partial responses, 3 complete responses, and 3 stable diseases. Following surgery, 7 patients had a pathologic complete response.<h4>Conclusions and relevance</h4>In this nonrandomized clinical trial, the addition of IT cDC1 and trastuzumab/pertuzumab before neoadjuvant chemotherapy was well tolerated with manageable adverse effects. Based on safety and immunogenicity, DL2 was selected for the phase 2 dose.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT05325632.

Also flagged:eIF4EGATA-3T-cell lymphomastumornuclear export proteinXPO1
Journal Article 2025-02-01 No Snippets Kady N, Abdelrahman S, Rauf AM, Burgess A, Weiss J, Gunasekara H, Ramseier N, Maine IP, Zevallos-Morales A, Perez-Silos V, Wolfe A, Hristov AC, Brown NA, Inamdar K, Sverdlov M, Hu YS, Murga-Zamalloa C, Wang C, Wilcox RA.
Show Full Abstract

<h4>Abstract</h4>The transcription factor GATA-binding protein 3 (GATA-3) and the transcriptional program it regulates have emerged as oncogenic drivers across diverse T-cell lymphomas (TCLs), many of which are resistant to conventional chemotherapeutic agents and characterized by recurrent losses of key tumor suppressor genes, including TP53 and PTEN, both of which are clients of the nuclear export protein XPO1. Here, we demonstrated that XPO1 is highly expressed by malignant T cells expressing GATA-3 and by lymphoma-associated macrophages (LAMs) within their tumor microenvironment (TME). Using complementary genetically engineered mouse models, we demonstrated that TP53- and/or phosphate and tensin homolog (PTEN)-deficient TCLs, and LAMs within their TME, are sensitive to the selective exportin-1 (XPO1) antagonist selinexor. In an effort to identify TP53- and PTEN-independent mechanisms, we used complementary and orthogonal approaches to investigate the role of eIF4E and XPO1-dependent messenger RNA nuclear export in these TCLs. We identified a novel role for eIF4E/XPO1 in exporting GATA-3 and GATA-3-dependent transcripts from the nucleus in TCLs, and in the export of therapeutically relevant transcripts, including colony-stimulating factor-1 receptor, from LAMs. Therefore, XPO1 antagonism, by impairing oncogenic transcriptional programs in TCLs and depleting LAMs from their TME, is a novel approach to target 2 independent dependencies in a group of therapeutically challenging TCLs.

NEGR1
Also flagged:gene expressionschizophrenianeuropsychiatric diseasesimmune responseRP11RNA binding protein
Journal Article 2025-02-01 ✓ 1 Snippet Choudhury M, Yamamoto R, Xiao X.
In-Text Gene Mentions

NEGR1

Show Full Abstract

Genome wide association studies (GWAS) have been conducted over the past decades to investigate the underlying genetic origin of neuropsychiatric diseases, such as schizophrenia (SCZ). While these studies demonstrated the significance of disease-phenotype associations, there is a pressing need to fully characterize the functional relevance of disease-associated genetic variants. Functional genetic loci can affect transcriptional and post-transcriptional phenotypes that may contribute to disease pathology. Here, we investigate the associations between genetic variation and RNA editing, splicing, and overall gene expression through identification of quantitative trait loci (QTL) in the CommonMind Consortium SCZ cohort. We find that editing QTL (edQTL), splicing QTL (sQTL) and expression QTL (eQTL) possess both unique and common gene targets, which are involved in many disease-relevant pathways, including brain function and immune response. We identified two QTL that fall into all three QTL categories (seedQTL), one of which, rs146498205, targets the lincRNA gene, RP11-156P1.3. In addition, we observe that the RNA binding protein AKAP1, with known roles in neuronal regulation and mitochondrial function, had enriched binding sites among edQTL, including the seedQTL, rs146498205. We conduct colocalization with various brain disorders and find that all QTL have top colocalizations with SCZ and related neuropsychiatric diseases. Furthermore, we identify QTL within biologically relevant GWAS loci, such as in ELA2, an important tRNA processing gene associated with SCZ risk. This work presents the investigation of multiple QTL types in parallel and demonstrates how they target both distinct and overlapping SCZ-relevant genes and pathways.

HFE
Also flagged:ironferric uptake transcriptional regulatorFuraconitaseamino acidscarbon
Journal Article 2025-02-01 ✓ 1 Snippet Rios-Delgado G, McReynolds AKG, Pagella EA, Norambuena J, Briaud P, Zheng V, Munneke MJ, Kim J, Racine H, Carroll RK, Zelzion E, Skaar E, Bose JL, Parker D, Lalaouna D, Boyd JM.
In-Text Gene Mentions

…the inborn diseasehemochromatosishave increased Fe…

Show Full Abstract

Staphylococcus aureus has evolved mechanisms to cope with low iron (Fe) availability in host tissues. Staphylococcus aureus uses the ferric uptake transcriptional regulator (Fur) to sense titers of cytosolic Fe. Upon Fe depletion, apo-Fur relieves transcriptional repression of genes utilized for Fe uptake. We demonstrate that an S. aureus Δfur mutant has decreased expression of acnA, which codes for the Fe-dependent enzyme aconitase. This prevents the Δfur mutant from growing with amino acids as sole carbon and energy sources. We used a suppressor screen to exploit this phenotype and determined that a mutation that decreases the transcription of isrR, which produces a regulatory RNA, increased acnA expression, thereby enabling growth. Directed mutation of bases predicted to facilitate the interaction between the acnA transcript and IsrR, decreased the ability of IsrR to control acnA expression in vivo and IsrR bound to the acnA transcript in vitro. IsrR also bound transcripts coding the alternate tricarboxylic acid cycle proteins sdhC, mqo, citZ and citM. Whole-cell metal analyses suggest that IsrR promotes Fe uptake and increases intracellular Fe not ligated by macromolecules. Lastly, we determined that Fur and IsrR promote infection using murine skin and acute pneumonia models.

PLCL1
Also flagged:nucleotidePLD1ANTXR1CPECTNNA3osteogenesis
Journal Article 2025-02-01 ✓ 1 Snippet Pi T, Yi W, Hu M, Quan X, Tian L, Sun H, Yan S.
In-Text Gene Mentions

…including PLD1, ANTXR1,PLCL1, CPE, and CTNNA3,…

Show Full Abstract

Red deer is a species of family Cervidae that is widely distributed in the world and is often raised to provide antlers, as a trophy or traditional medicine materials, and meat. Currently, the whole genomic data for red deer are very limited. Qingyuan Wapiti (QYW), China's first breed of red deer by artificial breeding, is well known for its high yield of antlers and large body size. The phylogenetic tree showed that QYW had a closer genetic relationship with Tarim red deer than European red deer. To explore the genetic diversity and selection signatures, the whole genome of 28 QYW individuals was sequenced, and 19 401 749 biallelic SNPs and 1 849 784 indels were obtained. The value of observed heterozygosity, expected heterozygosity, and nucleotide diversity were 0.258598, 0.268844, and 0.002193, respectively. Based on Tajima's D and integrated haplotype score analyses, the candidate regions containing 187 genes were detected, including PLD1, ANTXR1, PLCL1, CPE, and CTNNA3, which have been reported to be correlated with osteogenesis and mineralization, growth, and body size by previous studies. The results obtained in this study will contribute to elucidating the genetic mechanisms underlying the formation of excellent traits in QYW and provide the whole genome data for future exploration of genomic diversity and adaptation evolution of red deer worldwide.

VRK2
Also flagged:Schizophreniapsychiatric disordersdelusionsschizophrenicreproductionmating
Journal Article 2025-02-01 ✓ 1 Snippet Sandroni V, Chaumette B.
In-Text Gene Mentions

…, NRXN1 ,VRK2, and ZNF804A…

Show Full Abstract

Schizophrenia is a frequent and disabling disease. The persistence of the disorder despite its harmful consequences represents an evolutionary paradox. Based on recent discoveries in genetics, scientists have formulated the "price-to-pay" hypothesis: schizophrenia would be intimately related to human evolution, particularly to brain development and human-specific higher cognitive functions. The objective of the present work is to question scientific literature about the relationship between schizophrenia and human evolution from a genetic point of view. In the last two decades, research investigated the association between schizophrenia and a few genetic evolutionary markers: Human accelerated regions, segmental duplications, and highly repetitive DNA such as the Olduvai domain. Other studies focused on the action of natural selection on schizophrenia-associated genetic variants, also thanks to the complete sequencing of archaic hominins' genomes (Neanderthal, Denisova). Results suggested that a connection between human evolution and schizophrenia may exist; nonetheless, much research is still needed, and it is possible that a definitive answer to the evolutionary paradox of schizophrenia will never be found.

SERPINC1
Also flagged:peptides-amino acidsbiomoleculedegradationnucleotide
Journal Article 2025-02-01 ✓ 4 Snippets Fong-Zazueta R, Krueger J, Alba DM, Aymerich X, Beck RMD, Cappellini E, Carrillo-Martin G, Cirilli O, Clark N, Cornejo OE, Farh KK, Ferrández-Peral L, Juan D, Kelley JL, Kuderna LFK, Little J, Orkin JD, Paterson RS, Pawar H, Marques-Bonet T, Lizano E.
In-Text Gene Mentions

…member 1 protein (SERPINC1), tuftelin 1 (TUFT1),…

…ENAM, MMP20, ODAM,SERPINC1, TUFT1, COL1A1, COL1A2,…

…AHSG, ALB, ODAM,SERPINC1, and TUFT1.…

…COL1A2, COL17A1, andSERPINC1.…

Show Full Abstract

Ancient tooth enamel, and to some extent dentin and bone, contain characteristic peptides that persist for long periods of time. In particular, peptides from the enamel proteome (enamelome) have been used to reconstruct the phylogenetic relationships of fossil taxa. However, the enamelome is based on only about 10 genes, whose protein products undergo fragmentation in vivo and post mortem. This raises the question as to whether the enamelome alone provides enough information for reliable phylogenetic inference. We address these considerations on a selection of enamel-associated proteins that has been computationally predicted from genomic data from 232 primate species. We created multiple sequence alignments for each protein and estimated the evolutionary rate for each site. We examined which sites overlap with the parts of the protein sequences that are typically isolated from fossils. Based on this, we simulated ancient data with different degrees of sequence fragmentation, followed by phylogenetic analysis. We compared these trees to a reference species tree. Up to a degree of fragmentation that is similar to that of fossil samples from 1 to 2 million years ago, the phylogenetic placements of most nodes at family level are consistent with the reference species tree. We tested phylogenetic analysis on combinations of different enamel proteins and found that the composition of the proteome can influence deep splits in the phylogeny. With our methods, we provide guidance for researchers on how to evaluate the potential of paleoproteomics for phylogenetic studies before sampling valuable ancient specimens.

OLFM4
Also flagged:Immunityinfectiongene expressioninterferonR. aegyptiacus infectionantiviral response
Journal Article 2025-02-01 ✓ 2 Snippets Levinger R, Tussia-Cohen D, Friedman S, Lender Y, Nissan Y, Fraimovitch E, Gavriel Y, Tearle JLE, Kolodziejczyk AA, Moon KM, Gomes T, Kunowska N, Weinberg M, Donati G, Foster LJ, James KR, Yovel Y, Hagai T.
In-Text Gene Mentions

…SCs—we also usedOLFM4, Enterocytes—ALDOB, RBP2, gob…

…the expression ofOLFM4( Clemmensen et…

Show Full Abstract

Bats have adapted to pathogens through diverse mechanisms, including increased resistance-rapid pathogen elimination, and tolerance-limiting tissue damage following infection. In the Egyptian fruit bat (an important model in comparative immunology), several mechanisms conferring disease tolerance were discovered, but mechanisms underpinning resistance remain poorly understood. Previous studies on other species suggested that the elevated basal expression of innate immune genes may lead to increased resistance to infection. Here, we test whether such transcriptional patterns occur in Egyptian fruit bat tissues through single-cell and spatial transcriptomics of gut, lung, and blood cells, comparing gene expression between bat, mouse, and human. Despite numerous recent loss and expansion events of interferons in the bat genome, interferon expression and induction are remarkably similar to that of mouse. In contrast, central complement system genes are highly and uniquely expressed in key regions in bat lung and gut epithelium, unlike in human and mouse. Interestingly, the unique expression of these genes in the bat gut is strongest in the crypt, where developmental expression programs are highly conserved. The complement system genes also evolve rapidly in their coding sequences across the bat lineage. Finally, the bat complement system displays strong hemolytic activity. Together, these results indicate a distinctive transcriptional divergence of the complement system, which may be linked to bat resistance, and highlight the intricate evolutionary landscape of bat immunity.

DNAH10
Also flagged:amino acidamino acidsTitinSHAPlocalizationpost‐translational modifications
Journal Article 2025-02-01 ✓ 1 Snippet Pir MS, Timucin E.
In-Text Gene Mentions

DNAH10

Show Full Abstract

Protein structure holds immense potential for pathogenicity prediction, albeit structure-based predictors are limited compared to the sequence-based counterparts due to the "structure knowledge gap" between large number of available protein sequences and relatively limited number of structures. Leveraging the highly accurate protein structures predicted by AlphaFold2 (AF2), we introduce AFFIPred, an ensemble machine learning classifier that combines sequence and AF2-based structural characteristics to predict missense variant pathogenicity. Based on the assessments on unseen datasets, AFFIPred reached a comparable level of performance with the state-of-the-art predictors such as AlphaMissense. We also showed that the recruitment of AF2 structures that are full-length and represent the unbound states ensures more precise SASA calculations compared to the recruitment of experimental structures. In line with the completeness of the AF2 structures, their use provide a more comprehensive view of the structural characteristics of the missense variation datasets by capturing all variants. AFFIPred maintains high-level accuracy without the limitations of PDB-based classifiers. AFFIPred has predicted over 210 million variations of the human proteome, which are accessible at https://affipred.timucinlab.com/.

HTT
Also flagged:embryo developmentKLF4TGFBR1ITGB5GATA6stem cell proliferation
Journal Article 2025-02-01 ✓ 2 Snippets Li S, Cai B, Liu J, Xu Y, Ding C, Lai M, Zhou C, Xu Y.
In-Text Gene Mentions

…genes LRRC4 ,HTTand HES4 in…

…, HES4 andHTT, as well…

Show Full Abstract

No abstract available.

OLFM4
Also flagged:lumenextracellular spacemucuswaterchronic inflammatory disordersinflammatory bowel disease
Journal Article 2025-02-01 ✓ 1 Snippet Sanchez Alvarez R, Montalban-Arques A, Morsy Y, Gottier C, Häfliger J, Atrott K, Bircher A, Katkeviciute E, Pöhlmann D, Linzmeier L, Determann M, Mamie C, Niechcial A, Schwarzfischer M, Zeissig S, Lang S, Scharl M, Spalinger M.
In-Text Gene Mentions

…Co-staining forOLFM4and KI67 demonstrated…

Show Full Abstract

<h4>Background and aims</h4>Protein tyrosine phosphatase nonreceptor type 23 (PTPN23) regulates the internalization of growth factor receptors such as the epithelial growth factor receptor (EGFR). Given the crucial function of such receptors in intestinal epithelial cells (IECs), we assessed the involvement of PTPN23 in intestinal homeostasis and epithelial proliferation.<h4>Methods</h4>We generated mouse models with constitutive (PTPN23fl/flVilCre+/-) or inducible (PTPN23fl/flVilCreERT+/-) deletion of PTPN23 in IEC. To elucidate the functional consequences of PTPN23 deletion in IEC, we performed barrier function studies, flow cytometry, RNAseq, and in vivo experiments applying EGFR inhibition, antibiotic treatment, or co-housing approaches to further delineate the observed phenotype.<h4>Results</h4>Deletion of PTPN23 in IECs resulted in a severe early-onset phenotype in both models. Mice were characterized by elongated colon, epithelial hyperproliferation, splenomegaly, and diarrhea leading to the death of the mice within 3 weeks of PTNP23 deletion. Compromised gut barrier integrity resulted in enhanced bacterial translocation accompanied by reduced IgA transcytosis in PTPN23fl/flVilCreERT+/- compared to wild-type mice. Although EGFR surface expression was increased upon PTPN23-deletion, inhibition of EGFR signaling did not prevent disease. In contrast, and in accordance with defective bacterial handling, antibiotic treatment, but not co-housing, fully rescued the phenotype.<h4>Conclusions</h4>The absence of PTPN23 in IECs leads to lethal dysregulation of intestinal homeostasis, triggered by bacterial infiltration due to defects in the intestinal epithelial barrier and impaired IgA transcytosis. Thus, we identify PTPN23 as a novel key player in preserving intestinal epithelial homeostasis, ultimately preventing bacterial overgrowth and excessive immune activation in the intestine.

Also flagged:hereditary hemorrhagic telangiectasiaHHTsystemic vascular dysplasiamucocutaneous telangiectasiasarteriovenous malformationsBevacizumab
Journal Article 2025-02-01 No Snippets Taha AM, Fareed A, Elewa M, Hasan MT, Elboraay T, Abouelmagd K, Abdeljawad MM.
Show Full Abstract

<h4>Background</h4>Hereditary Hemorrhagic Telangiectasia (HHT) is an autosomal multi-systemic vascular dysplasia caused by gene mutations that lead to recurrent epistaxis and other serious complications including mucocutaneous telangiectasias, gastrointestinal bleeding, and arteriovenous malformations. Treatment is limited to symptomatic relief with no approved standard therapy. Bevacizumab is a monoclonal antibody used primarily in treating metastatic malignancies and ophthalmology. Several studies have shown that bevacizumab is effective in the treatment of HHT-related epistaxis with a high safety profile.<h4>Purpose</h4>This systematic review and network meta-analysis aims to explore the efficacy and safety of bevacizumab in the treatment of HHT epistaxis.<h4>Methods</h4>A comprehensive literature search was done in many databases, including PubMed, Web of Science, Scopus, and the Cochrane Library. We conducted our network meta-analysis using R version 4.2.2 and R Studio version 2022.07.2. Dichotomous data was analyzed as risk ratio and 95% confidence interval and continuous data as mean difference and 95% confidence interval.<h4>Results</h4>We included four randomized clinical trials in our network meta-analysis. Different doses of bevacizumab failed to yield any statistically significant difference in reducing the epistaxis severity score, the number of epistaxis episodes, the duration of epistaxis, or improving hemoglobin levels compared to placebo or other comparators. The pooled effect sizes for all outcomes were homogenous.<h4>Conclusion</h4>Bevacizumab failed to show any significant difference compared to tranexamic acid, estriol, or placebo. These findings underscore the challenges in addressing HHT-related symptoms and highlight the ongoing need for innovative and more effective interventions.

TNFSF4
Also flagged:tumor-type gastric adenocarcinomaGastric adenocarcinomaCD8HAVCR2VCAM1
Journal Article 2025-02-01 ✓ 2 Snippets Wang Q, Chen J, Wang Y, Li X, Ping X, Shen J, Yang S, Shen L.
In-Text Gene Mentions

…significant LR pairs:TNFSF4- TNFRSF4 (mean…

…- HAVCR2 andTNFSF4- TNFRSF4 axes…

Show Full Abstract

<h4>Background</h4>Gastric adenocarcinoma (GAC), particularly the Lauren intestinal-type GAC (IGAC), leads to significant mortality in China due to the limited effectiveness of current treatments. This study aims to investigate the mechanisms of immune suppression in IGAC to identify potential targets for enhancing immunotherapy outcomes.<h4>Methods</h4>Performing an extensive collection and re-analysis of single-cell RNA sequencing (scRNA-seq) of tumor tissues and the corresponding noncancerous mucosae from 15 Chinese patients diagnosed with IGAC, we identified cell subpopulations involved in immune suppression within the tumor microenvironment (TME). We further validated our findings using spatially resolved transcriptomics (SRT), immunofluorescence (IF), and flow cytometry (FCM) on tissues from IGAC patients.<h4>Results</h4>We demonstrated that the TME of IGAC harbors CD8<sup>+</sup> exhausted T cells (Texs) and various subtypes that mediate immunity. We identified specific subpopulations of Texs (HAVCR2<sup>+</sup>VCAM1<sup>+</sup>) and regulatory T cells (Tregs) (LAYN<sup>+</sup>TNFRSF4<sup>+</sup>) contributing to immune suppression. Furthermore, TNFRSF12A<sup>+</sup> cancer-associated fibroblasts (CAFs), CTSB<sup>+</sup> macrophages, and SOD2<sup>+</sup> monocytes were found to be involved in maintaining the immunosuppressive milieu. SRT and IF assays confirmed the presence and colocalization of these cell types within the tumor tissues, highlighting their functional interactions. FCM assays indicated that the prevalence of HAVCR2<sup>+</sup>VCAM1<sup>+</sup> Texs and LAYN<sup>+</sup>TNFRSF4<sup>+</sup> Tregs in tumor tissues was positively associated with IGAC progression.<h4>Conclusions</h4>Detailed profiles of immunosuppressive cell subpopulations in IGAC provide valuable insights into the complexity and heterogeneity of immunosuppression. These findings underscore the necessity for targeted strategies that disrupt specific immunosuppressive pathways, potentially enhancing the efficacy of immunotherapeutic interventions in IGAC.

SLC2A14
Also flagged:COVID-19chronic thromboembolic pulmonary hypertensionCTEPHinfectionCo-ExpressionDNAJA1
Journal Article 2025-02-01 ✓ 1 Snippet Li Q, Shi X, Tang Y, Fu Y, Fu X.
In-Text Gene Mentions

…genes-DNAJA1, NDUFA5, andSLC2A14-were identified with robust…

Show Full Abstract

Chronic thromboembolic pulmonary hypertension (CTEPH) and COVID-19 share molecular pathways yet remain poorly understood in their interrelation. Using RNA-seq datasets (GSE130391 and GSE169687), we identified 645, 206, and 1,543 differentially expressed genes (DEGs) for long-COVID (16 and 24 weeks post-infection) and CTEPH, respectively. Weighted Gene Co-Expression Network Analysis (WGCNA) pinpointed 234 intersecting key module genes. Three hub genes-DNAJA1, NDUFA5, and SLC2A14-were identified with robust discriminatory capabilities (AUC ≥ 0.7). Enrichment analyses revealed shared pathways linked to immune modulation, oxidative stress, and metabolic dysfunction. Immune analysis highlighted activated CD8 T cells as critical regulators. Regulatory networks implicated TFs and miRNAs, including STAT1 and hsa-mir-23a-3p. Drug prediction identified potential therapeutic compounds with strong molecular docking interactions. These findings unravel critical molecular linkages, emphasizing shared pathogeneses and guiding experimental validations for improved diagnostic and therapeutic strategies in COVID-19 and CTEPH.

POU3F2
Also flagged:ACVR2AgestationplacentationpreeclampsiaPEpathogenesis
Journal Article 2025-02-01 ✓ 3 Snippets Honarpour A, Majd A, Sadeghi H, Jamaldini S, Rahimi M, Kazemzadeh P, Mirfakhraie R.
In-Text Gene Mentions

…motif for thePOU3F2TF, 1.3 kb…

…for binding thePOU3F2TF.…

POU3F2is among TFs…

Show Full Abstract

<h4>Background</h4>The activin A receptor type 2A gene (ACVR2A) plays an important role in normal gestation, particularly in decidualization, trophoblastic invasion, and placentation. Although several studies have investigated the association between ACVR2A maternal variants and preeclampsia (PE) susceptibility; however, controversial results were obtained. Moreover, in none of the previous studies, the role of ACVR2A fetal variants was explored. The aim of the present study was to investigate the role of ACVR2A rs1424954 and rs1424941 polymorphisms in PE susceptibility considering the impact of both fetal and maternal genotypes.<h4>Methods</h4>For genotyping of ACVR2A rs1424954 and rs1424941, we performed TP-ARMS-PCR on 600 samples, including 400 peripheral blood samples from preeclamptic and normal women and 200 umbilical cord blood samples from each group of pregnant women.<h4>Results</h4>Regarding rs1424954, only the fetal genotypes were associated with an increased risk of PE in both dominant and recessive inheritance models (OR = 2.88, 95% CI: 1.58-5.25, p = 0.0005; and OR = 2.43, 95% CI: 1.21-4.87, p = 0.012; respectively). For ACVR2A rs1424941variant, both maternal and fetal heterozygote genotypes were associated with PE susceptibility (OR = 1.57, 95% CI: 1.02-2.04, p = 0.04; and OR = 1.90, 95% CI: 1.02-3.54, p = 0.04; respectively).<h4>Conclusion</h4>The present study confirmed the role of fetal ACVR2A polymorphisms in PE pathogenesis for the first time. However, replicated studies in diverse ethnicities are necessary to confirm the role of fetal genotype on susceptibility to PE.

SERPINC1
Also flagged:developmental defects of enamelmineralizationproteasesserine proteaseskallikrein 4extracellular
Journal Article 2025-02-01 ✓ 1 Snippet Jessica S, Sekar R, Ghosh S, Dhungel S, B K, Ramakrishnan M, Jh SF, Prasad M, I J, Subramani S.
In-Text Gene Mentions

…I, Serum Albumin,Anti-thrombin IIIIII, Alpha-1-Antitrypsin, Hist…

Show Full Abstract

<h4>Objective</h4>This study aims to identify the proteins in hypomineralized second primary molars (HSPMs) and correlate their function in Amelogenesis. HSPM is a qualitative defect of the enamel of the second primary molars with no clear etiology.<h4>Material and methods</h4>Total protein quantification was performed using the Bradford Protein Assay, followed by the electrophoretic separation of samples using 2D-Gel electrophoresis to identify the proteins.<h4>Results</h4>The results from the Bradford Protein Assay unveiled a five-fold increase in the protein content in HSPM. Proteins such as Dentin sialo-phosphoprotein (DSPP), Keratin, type I, Serum Albumin, Anti-thrombin III, Alpha-1-Antitrypsin, Histone H3.2, Actin, Heat shock Protein, Vimentin, Desmoglein-3, Glyceraldehyde-3-phosphate dehydrogenase, Inosine-5'-monophosphate dehydrogenase 2, Zinc Alpha 2 glycoprotein, Lysozyme C, Prothrombin, Vit-D binding Protein, Apolipoprotein A-1, Defensin 1, Immunoglobulin Gamma, Immunoglobulin Kappa, and Alpha-Amylase were all upregulated (p < 0.05) in HSPM.<h4>Conclusion</h4>This investigation conclusively demonstrates that HSPM-affected teeth have higher protein content than healthy teeth. The study also supports the theory of proteolytic inhibition attributed to reduced protease activity and heightened protease inhibitor activity.

Also flagged:solid tumorsHER2tumorNRG1CancerHER3
Journal Article 2025-02-01 No Snippets Schram AM, Goto K, Kim DW, Macarulla T, Hollebecque A, O'Reilly EM, Ou SI, Rodon J, Rha SY, Nishino K, Duruisseaux M, Park JO, Neuzillet C, Liu SV, Weinberg BA, Cleary JM, Calvo E, Umemoto K, Nagasaka M, Springfeld C, Bekaii-Saab T, O'Kane GM, Opdam F, Reiss KA, Joe AK, Wasserman E, Stalbovskaya V, Ford J, Adeyemi S, Jain L, Jauhari S, Drilon A, eNRGy Investigators.
Show Full Abstract

<h4>Background</h4>Neuregulin 1 (<i>NRG1</i>) fusions are recurrent oncogenic drivers found in multiple solid tumors. NRG1 binds to human epidermal growth factor receptor 3 (HER3), leading to heterodimerization with HER2 and activation of downstream growth and proliferation pathways. The efficacy and safety of zenocutuzumab, a bispecific antibody against HER2 and HER3, in patients with <i>NRG1</i> fusion-positive solid tumors are unclear.<h4>Methods</h4>In this registrational, phase 2 clinical study, we assigned patients with advanced <i>NRG1</i> fusion-positive cancer involving any tumor type to receive zenocutuzumab at a dose of 750 mg intravenously every 2 weeks. The primary end point was overall response (complete or partial response) according to investigator assessment. Secondary end points included duration of response, progression-free survival, and safety.<h4>Results</h4>A total of 204 patients with 12 tumor types were enrolled and treated. Among 158 patients who had measurable disease and were enrolled at least 24 weeks before the data-cutoff date, a response occurred in 30% (95% confidence interval [CI], 23 to 37). The median duration of response was 11.1 months (95% CI, 7.4 to 12.9); 19% of responses were ongoing at the data-cutoff date. Responses were observed in multiple tumor types - including in 27 of 93 patients (29%; 95% CI, 20 to 39) with non-small-cell lung cancer (NSCLC) and 15 of 36 patients (42%; 95% CI, 25 to 59) with pancreatic cancer - and across multiple <i>NRG1</i> fusion partners. The median progression-free survival was 6.8 months (95% CI, 5.5 to 9.1). Adverse events were primarily grade 1 or 2. The most common adverse events that were considered by the investigator to be related to zenocutuzumab were diarrhea (in 18% of the patients), fatigue (in 12%), and nausea (in 11%). Infusion-related reactions (composite term) were observed in 14% of the patients. One patient discontinued zenocutuzumab owing to a treatment-related adverse event.<h4>Conclusions</h4>Zenocutuzumab showed efficacy in patients with advanced <i>NRG1</i> fusion-positive cancer, notably NSCLC and pancreatic cancer, with mainly low-grade adverse events. (Funded by Merus; eNRGy ClinicalTrials.gov number, NCT02912949.).

HFE
Also flagged:ironchronic diseasesobesityc-reactive proteintransferrin receptormineral
Journal Article 2025-02-01 ✓ 2 Snippets Barad A, Xu Y, Bender E, Kang W, Xu R, Gu Z, Pressman EK, O'Brien KO.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

<h4>Background</h4>Excess body iron (Fe) accrual is linked to chronic diseases. East Asian (EA) adults (median age 50 y) were reported to have higher Fe stores compared to other populations despite lacking the mutation that causes Fe overload in Northern European (NE) adults. It is unknown if these differences are evident in a healthy population under 50 y of age.<h4>Objectives</h4>This cross-sectional study aims to compare Fe-related markers in young adults of EA and NE ancestry and identify determinants of Fe status.<h4>Methods</h4>Participants were healthy United States males and premenopausal/nonpregnant females of genetically confirmed EA (n = 251) or NE (n = 253) ancestry, aged 18-50 y and without obesity. A complete blood count was obtained. Serum ferritin (SF; μg/L), c-reactive protein, and interleukin-6 were measured by immunoassay, and serum soluble transferrin receptor (mg/L) and transferrin by quantitative immunoturbidimetry. Total body Fe (mg/kg) was calculated. Elevated Fe stores were defined as SF >200 (females) or >300 (males) and c-reactive protein <5 mg/L. Results are shown as the geometric mean 95% confidence interval (CI) or mean ± standard deviation.<h4>Results</h4>The mean age of the population was (26.3 y; 25.6, 26.9 y), with 69.2% of participants aged under 30 y. SF was higher in EA (172; 152, 194) compared with NE (85.3; 76.8, 94.8) males (P < 0.001), and in EA (42.6; 36.7, 49.5) compared with NE (31.9; 27.8, 36.5) females (P = 0.004). The prevalence of elevated Fe stores was 16.7% in EA compared with 0.8% in NE males (P < 0.001) and 1.6% in EA compared with 0% in NE females (P = 0.47). Total body Fe was higher in EA (11.7 ± 2.7) compared with NE (9.1 ± 2.6) males (P < 0.001) and in EA (6.7 ± 3.6) compared with NE (5.6 ± 3.4) females (P = 0.01). All differences persisted after adjustment for confounders (all P < 0.05).<h4>Conclusions</h4>Individuals of EA ancestry had a significantly greater body Fe burden compared to NE individuals. Of concern, these differences were evident in a cohort primarily consisting of young individuals aged 18-29 y. This trial was registered at clinicaltrials.gov as NCT04198545.

HFE
Also flagged:Ironhormonesobesitytransferrin receptorC-reactive proteinIL-6
Journal Article 2025-02-01 ✓ 2 Snippets Barad A, Xu Y, Bender E, Pressman EK, Gu Z, O'Brien KO.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

<h4>Background</h4>Individuals of East Asian (EA) ancestry have greater risk of elevated iron (Fe) stores compared with individuals of Northern European (NE) ancestry, but no studies have assessed differences in Fe regulatory hormones between these populations.<h4>Objectives</h4>This study aimed to evaluate hepcidin, erythropoietin, and erythroferrone as a function of ancestry and examine their associations with Fe status markers in United States adults of genetically confirmed EA or NE ancestry.<h4>Methods</h4>Participants in this cross-sectional study were healthy EA (n = 251) or NE (n = 253) males and premenopausal, nonpregnant females, aged 18-50 y, and without obesity. Serum hepcidin, erythropoietin, and erythroferrone concentrations were measured using ELISAs. Fe status [serum ferritin (SF), soluble transferrin receptor, total body iron, and transferrin], hematologic (complete blood count), and inflammatory (C-reactive protein and IL-6) markers were measured. Results are shown as the geometric mean (95% CI).<h4>Results</h4>Hepcidin (ng/mL) was significantly higher in EA (43.9; 95% CI: 39.6, 48.7) compared with NE (31.3; 95% CI: 28.4, 34.5) males (P < 0.001) but did not differ between EA (21.8; 95% CI: 19.4, 24.6) and NE (21.3; 95% CI: 19.0, 23.8) females (P = 0.66). Interestingly, the hepcidin:SF ratio was lower in EA males (0.26; 95% CI: 0.23, 0.28) and females (0.51; 95% CI: 0.46, 0.57) compared with NE males (0.37; 95% CI: 0.33, 0.40; P < 0.001) and females (0.65; 95% CI: 0.57, 0.73; P = 0.01), respectively. These differences remained significant after adjustment for C-reactive protein (males: P-adjusted < 0.001; females: P-adjusted = 0.008) or IL-6 (males: P-adjusted < 0.001; females: P-adjusted = 0.006). Erythropoietin did not differ between ancestry groups in males (P = 0.11) or females (P = 0.96). Lastly, erythroferrone (ng/mL) was higher in EA (1.3; 95% CI: 0.8, 1.9) compared with NE (0.6; 95% CI: 0.4, 0.9; P = 0.009) males but did not differ between females (EA: 0.7; 95% CI: 0.5, 1.1; NE: 0.5; 95% CI: 0.3, 0.7; P = 0.11).<h4>Conclusions</h4>A lower hepcidin:SF ratio in EA compared with NE participants suggests that among EAs, hepcidin concentrations are lower relative to the load of Fe present. Further studies are needed to elucidate the mechanisms underlying the observed differences. This study was registered at clinicaltrials.gov as NCT04198545.

HFE
Also flagged:ironobesitytransferrin receptormicronutrient deficienciesanemiaimmune response
Journal Article 2025-02-01 ✓ 2 Snippets Barad A, Xu Y, Bender E, Pressman EK, Gu Z, O'Brien KO.
In-Text Gene Mentions

Hemochromatosis

HFE

Show Full Abstract

<h4>Background</h4>Because humans lack mechanisms for excreting excess iron (Fe), dietary Fe absorption must be tightly regulated to ensure optimal Fe levels. We previously showed that East Asian (EA) individuals have higher Fe stores compared with Northern European (NE) individuals, but the physiological basis for this difference is unknown.<h4>Objectives</h4>Our aim is to compare nonheme Fe absorption and its regulation in healthy participants of genetically confirmed EA or NE ancestry.<h4>Methods</h4>Participants of this cross-sectional study were males and premenopausal, nonpregnant females of EA (n = 253) or NE (n = 251) ancestry, aged 18-50 y, and without obesity. Participants ingested a stable <sup>57</sup>Fe isotope as a FeSO<sub>4</sub> solution mixed with syrup. Percent Fe absorption was calculated based on erythrocyte <sup>57</sup>Fe enrichment 2 wk postdosing measured using magnetic sector thermal ionization mass spectrometry and normalized to a fixed serum ferritin (SF) level. Fe status traits (SF, soluble transferrin receptor, total body Fe), hormones (hepcidin, erythropoietin, erythroferrone), and inflammatory markers were evaluated.<h4>Results</h4>SF-corrected % Fe absorption was higher in EA females [27.4 (95% confidence interval (CI): 23.4, 32.0)] and males [19.8 (95% CI: 14.9, 26.4)] compared with NE females [14.8 (95% CI: 11.8, 18.2)] and males [14.9 (95% CI: 11.8, 18.9)], respectively (both P < 0.001). Percent Fe absorption was consistently associated with hepcidin in EA males [β = -0.64; standard error (SE) = 0.24; P = 0.008] and females (β = -0.61; SE = 0.12; P < 0.001), and in NE males (β = -0.63; SE = 0.22; P = 0.005) and females (β = -0.71; SE = 0.14; P < 0.001). Percent Fe absorption was linearly associated with SF in EA females (β = -0.57; SE = 0.09; P < 0.001) and NE males (β = -0.73; SE = 0.21; P < 0.001) and females (β = -0.68; SE = 0.12; P < 0.001), but in EA males, a U-shaped relationship was observed (P = 0.003).<h4>Conclusions</h4>EA individuals have a greater SF-corrected Fe absorption compared with NE individuals. Increased Fe absorption and resulting excess Fe accumulation suggests that EA individuals may be at greater risk of Fe overload-related diseases. Further studies are needed to evaluate the long-term implications of these findings. This trial was registered at clinicaltrials.gov as NCT04198545.

Also flagged:lipidCardiovascular diseasesCVDdeathintercellularextracellular
Journal Article 2025-02-01 No Snippets Li H, Wang L, Cheng H, Zhang Q, Wang S, Zhong W, He C, Wei Q.
Show Full Abstract

Extracellular vesicles (EVs) are micro-nanoscale biological particles encapsulated by phospholipid bilayers, which regulate cell migration, angiogenesis and tumour cell growth by transmitting various biomolecules such as nucleic acids and proteins. EVs are composed of exosomes, microparticles and apoptotic bodies. Its benefits pass through biofilms and are not degraded by various enzymes, so it can be used as a biomarker in potential diseases and has attracted much attention from researchers. Current studies have found that EVs are involved in the development of various cardiovascular diseases (CVD), such as heart failure and myocardial ischemia-reperfusion injury. In addition, stem cell-derived EVs play an important role in the diagnosis and treatment of a variety of CVD. In this review, we present the biological features of EVs, the role of EVs in various CVD, and the challenges they encounter in the treatment of CVD.

FBXL4
Also flagged:Oxygentranscription factorshypoxia‐inducible factorsprolyl hydroxylase domainPHDE3 ubiquitin ligase
Journal Article 2025-02-01 ✓ 1 Snippet Liu C, Qu D, Li C, Pu W, Li J, Cai L.
In-Text Gene Mentions

…splice site ofFbxl4, the retained…

Show Full Abstract

<h4>Background</h4>Intermittent hypoxia (IH), as a key pathogenic factor of obstructive sleep apnea syndrome (OSAS), can cause many diseases, such as increased inflammation and oxidative stress, diabetes, cardiovascular disease, and Alzheimer's disease (AD). The response of cells to hypoxia involves multiple levels of regulatory mechanisms, including transcriptional regulation of gene expression, regulation of mRNA stability, post-transcriptional regulation, and post-translational modification regulation.<h4>Aims</h4>The regulation of miRNA and alternative splicing (AS) in neuronal response to intermittent hypoxia deserve further study.<h4>Materials & methods</h4>By establishing a mouse model of intermittent hypoxia, we conducted functional studies on key miRNAs and splicing factor using methods such as miRNA sequencing, bioinformatics, and molecular biology.<h4>Results</h4>In the mouse hippocampus, intermittent hypoxia altered the expression of many miRNAs, with miR-448-3p and miR-1264-3p changing over the course of more than three time periods. Interestingly, the expression of Fam76b, the common target gene of these two miRNAs, also changed under intermittent hypoxia. Further studies showed that Fam76b may regulate the ratio of Nbr1 and Dph3 transcripts in response to hypoxia by affecting the localization of hnRNPA2B1 protein within cells.<h4>Discussion</h4>Research into intermittent hypoxia-induced disorders, including Alzheimer's disease and other neurodegenerative diseases, might benefit from a better understanding of the regulatory mechanisms of miRNA and alternative splicing in hypoxic response at the animal and cell levels.<h4>Conclusion</h4>This study demonstrates that intermittent hypoxia alters the expression of miR-448-3p and miR-1264-3p, as well as the localization of the splicing factor hnRNPA2B1 in the cell nucleus. These findings enhance our understanding of the molecular mechanisms of neuronal responses to hypoxia and hold potential implications for treating hypoxia-related diseases like Alzheimer's disease.

HTT
Also flagged:synapsememoriesSerotonin Transporterserotoninanxietydepression
Journal Article 2025-02-01 ✓ 1 Snippet Lima J, Panayi MC, Sharp T, McHugh SB, Bannerman DM.
In-Text Gene Mentions

…uced serotonin transporter (5‐HTT) function, which increases…

Show Full Abstract

Recent theories suggest that reduced serotonin transporter (5-HTT) function, which increases serotonin (5-HT) levels at the synapse, enhances neural plasticity and affects sensitivity to environmental cues. This may promote learning about emotionally relevant events. However, the boundaries that define such emotional learning remain to be established. This was investigated using 5-HTT knockout (5-HTTKO) mice which provide a model of long-term elevated 5-HT transmission and are associated with increased anxiety. Compared to wild-type controls, 5-HTTKO mice were faster to discriminate between an auditory cue that predicted footshock (CS+) and a cue predicting no footshock (CS-). Notably, this enhanced discrimination performance was driven not by faster learning that the CS+ predicted footshock, but rather by faster learning that the CS- cue signals the absence of footshock and thus provides temporary relief from fear/anxiety. Similarly, 5-HTTKO mice were also faster to reduce their fear of the CS+ cue during subsequent extinction. These findings are consistent with facilitated inhibitory learning that predicts the absence of potential threats in 5-HTTKO mice. However, 5-HTTKO mice also exhibited increased generalisation of fear learning about ambiguous aversive cues in a novel context, different from the training context. Thus, 5-HTTKO mice can exhibit both more and less fear compared to wild-type controls. Taken together, our results support the idea that loss of 5-HTT function, and corresponding increases in synaptic 5-HT availability, may facilitate learning by priming of aversive memories. This both facilitates inhibitory learning for fear memories but also enhances generalisation of fear.

HFE
Also flagged:Ironneurodegenerative diseasesFe regulatory proteinsAgingMAPcircadian rhythms
Journal Article 2025-02-01 ✓ 3 Snippets Cornelis MC, Fazlollahi A, Bennett DA, Schneider JA, Ayton S.
In-Text Gene Mentions

…homeostasis such ashemochromatosis( HFE )…

…as hemochromatosis (HFE) and beta‐thalassemia…

HFEencodes a homeostatic…

Show Full Abstract

Brain iron (Fe) dyshomeostasis is implicated in neurodegenerative diseases. Genome-wide association studies (GWAS) have identified plausible loci correlated with peripheral levels of Fe. Systemic organs and the brain share several Fe regulatory proteins but there likely exist different homeostatic pathways. We performed the first GWAS of inductively coupled plasma mass spectrometry measures of postmortem brain Fe from 635 Rush Memory and Aging Project (MAP) participants. Sixteen single nucleotide polymorphisms (SNPs) associated with Fe in at least one of four brain regions were measured (p < 5 × 10<sup>-8</sup>). Promising SNPs (p < 5 × 10<sup>-6</sup>) were followed up for replication in published GWAS of blood, spleen, and brain imaging Fe traits and mapped to candidate genes for targeted cortical transcriptomic and epigenetic analysis of postmortem Fe in MAP. Results for SNPs previously associated with other Fe traits were also examined. Ninety-eight SNPs associated with postmortem brain Fe were at least nominally (p < 0.05) associated with one or more related Fe traits. Most novel loci identified had no direct links to Fe regulatory pathways but rather endoplasmic reticulum-Golgi trafficking (SORL1, SORCS2, MARCH1, CLTC), heparan sulfate (HS3ST4, HS3ST1), and coenzyme A (SLC5A6, PANK3); supported by nearest gene function and omic analyses. We replicated (p < 0.05) several previously published Fe loci mapping to candidate genes in cellular and systemic Fe regulation. Finally, novel loci (BMAL, COQ5, SLC25A11) and replication of prior loci (PINK1, PPIF, LONP1) lend support to the role of circadian rhythms and mitochondria function in Fe regulation more generally. In summary, we provide support for novel loci linked to pathways that may have greater relevance to brain Fe accumulation; some of which are implicated in neurodegeneration. However, replication of a subset of prior loci for blood Fe suggests that genetic determinants or biological pathways underlying Fe accumulation in the brain are not completely distinct from those of Fe circulating in the periphery.

BTN3A3BTN2A1
Also flagged:SynthesistriazolearylacyloxyBTN3A1hydroxy
Journal Article 2025-02-01 ✓ 2 Snippets Singh U, Pawge G, Kintigh PA, Sarno JP, Rani S, Hsiao CC, Wiemer AJ, Wiemer DF.
In-Text Gene Mentions

BTN2A1

BTN3A3

Show Full Abstract

The most effective natural ligand for the butyrophilins is (E)-4-hydroxy-3-methyl-but-2-enyl diphosphate. However, due to its susceptibility to plasma hydrolysis and its high charge that limits passive diffusion across cell membranes, its potential as a drug is limited. Our efforts to identify compounds that stimulate γδ T cell proliferation have been focused on phosphonates to gain metabolic stability and phosphonate prodrugs to improve diffusion into cells. To identify potential prodrugs that are soluble, relatively stable in plasma, and undergo facile hydrolysis once inside the cell, we have prepared a series of aryl acyloxyesters where the acyl group includes a triazole moiety. Several of these novel prodrug forms have been shown to demonstrate nanomolar potency for T cell activation and relatively long half-lives in plasma. Interestingly, compound 26b stimulated T cells at sub-nanomolar levels (proliferation EC<sub>50</sub> = 0.49 nM) while achieving a half-life of 63 min in human plasma. The details of these syntheses and the biological evaluation are presented here.

DARS2
Also flagged:mitochondrialphosphorylationgene expressiontaurineregulation ofmitochondria-related
Journal Article 2025-02-01 ✓ 2 Snippets Shi X, Ma C, Chen N, Xu MM, Kambal S, Cai ZF, Yang Q, Adeola AC, Liu LS, Wang J, Lu WF, Li Y, Msalya GM, Lei C, Mwacharo JM, Han JL, Hanotte O, Zhang YP, Peng MS.
In-Text Gene Mentions

…potential roles ofDARS2and MRPS33 ,…

…high-mito genes, includingDARS2and MRPS33 (…

Show Full Abstract

Mitochondrial function relies on the coordinated interactions between genes in the mitochondrial DNA and nuclear genomes. Imperfect interactions following mitonuclear incompatibility may lead to reduced fitness. Mitochondrial DNA introgressions across species and populations are common and well documented. Various strategies may be expected to reconcile mitonuclear incompatibility in hybrids or admixed individuals. African admixed cattle (Bos taurus × B. indicus) show sex-biased admixture, with taurine (B. taurus) mitochondrial DNA and a nuclear genome predominantly of humped zebu (B. indicus). Here, we leveraged local ancestry inference approaches to identify the ancestry and distribution patterns of nuclear functional genes associated with the mitochondrial oxidative phosphorylation process in the genomes of African admixed cattle. We show that most of the nuclear genes involved in mitonuclear interactions are under selection and of humped zebu ancestry. Variations in mitochondrial DNA copy number may have contributed to the recovery of optimal mitochondrial function following admixture with the regulation of gene expression, alleviating or nullifying mitochondrial dysfunction. Interestingly, some nuclear mitochondrial genes with enrichment in taurine ancestry may have originated from ancient African aurochs (B. primigenius africanus) introgression. They may have contributed to the local adaptation of African cattle to pathogen burdens. Our study provides further support and new evidence showing that the successful settlement of cattle across the continent was a complex mechanism involving adaptive introgression, mitochondrial DNA copy number variation, regulation of gene expression, and selection of ancestral mitochondria-related genes.

Also flagged:inflammatory responsehypersensitivityNeuropathicnerve lesionsdepressionneurodevelopmental disorders
Journal Article 2025-02-01 No Snippets Chen Y, Bajpai AK, Li N, Xiang J, Wang A, Gu Q, Ruan J, Zhang R, Chen G, Lu L.
Show Full Abstract

<h4>Aims</h4>Chronic pain is an impeding condition that affects day-to-day life and poses a substantial economic burden, surpassing many other health conditions. This study employs a cross-species integrated approach to uncover novel pain mediators/regulators.<h4>Methods</h4>We used weighted gene coexpression network analysis to identify pain-enriched gene module. Functional analysis and protein-protein interaction (PPI) network analysis of the module genes were conducted. RNA sequencing compared pain model and control mice. PheWAS was performed to link genes to pain-related GWAS traits. Finally, candidates were prioritized based on node degree, differential expression, GWAS associations, and phenotype correlations.<h4>Results</h4>A gene module significantly over-enriched with the pain reference set was identified (referred to as "pain module"). Analysis revealed 141 pain module genes interacting with 46 pain reference genes in the PPI network, which included 88 differentially expressed genes. PheWAS analysis linked 53 of these genes to pain-related GWAS traits. Expression correlation analysis identified Vdac1, Add2, Syt2, and Syt4 as significantly correlated with pain phenotypes across eight brain regions. NCAM1, VAMP2, SYT2, ADD2, and KCND3 were identified as top pain response/regulator genes.<h4>Conclusion</h4>The identified genes and molecular mechanisms may enhance understanding of pain pathways and contribute to better drug target identification.

HTT
Also flagged:cognitive impairmentneurodegenerative diseasesmyelinwaterapolipoprotein EAPOE
Journal Article 2025-02-01 ✓ 2 Snippets Zhi Y, Shi Y, Lu D, Xu D.
In-Text Gene Mentions

…In addition,HTTprotein is required…

…migration, loss ofHTTduring embryonic period…

Show Full Abstract

<h4>Background</h4>Hereditary spastic paraplegia (HSP) is a group of rare genetic neurodegenerative disorders characterized by corticospinal tract abnormalities. But frequently, abnormalities of proteins implicated in HSP have been identified in brain disorders of childhood, raising the possibility that early brain developmental mechanism underlying HSP.<h4>Results and conclusions</h4>Here we summarized the clinical features of 89 HSP subtypes and found most have onset of symptoms earliest reported in infancy or early childhood. Importantly, HSP patients showed early brain developmental related phenotypes such as microcephaly, ventricular enlargement, and corpus callosum dysplasia. In addition, the expression trajectories analysis showed HSP genes were diffusely expressed across all human prenatal cortical regions and most genes enriched from post-conception weeks 8-24, periods characterized by neuro progenitor proliferation and neurogenesis. Furthermore, studies utilizing patient derived induced pluripotent stem cells (iPSCs)/organoids and mouse models have suggested that most HSP proteins play either direct or indirect roles in the development of the central nervous system. Therefore, HSP possesses a neurodevelopmental aspect and is not merely a degenerative disease, which may aid in better understanding the pathogenesis of this disease.

HTT
Also flagged:serotonin transporterserotoninanxietysegmentationVGluT2GAD67
Journal Article 2025-02-01 ✓ 3 Snippets Guo CC, Xu Y, Shan L, Foka K, Memoli S, Mulveen C, Gijsbrechts B, Verheij MM, Homberg JR.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) show increased anxiety…

…We found that5-HTTknockout rats displayed…

…cortex subregions of5-HTTknockout rats.…

Show Full Abstract

The prefrontal cortex regulates emotions and is influenced by serotonin. Rodents lacking the serotonin transporter (5-HTT) show increased anxiety and changes in excitatory and inhibitory cell markers in the prefrontal cortex. However, these observations are constrained by limitations in brain representation and cell segmentation, as standard immunohistochemistry is inadequate to consider volume variations in regions of interest. We utilized the deep learning network of the StarDist method in combination with novel open-source methods for automated cell counts in a wide range of prefrontal cortex subregions. We found that 5-HTT knockout rats displayed increased anxiety and diminished relative numbers of subclass excitatory VGluT2+ and activated ΔFosB+ cells in the infralimbic and prelimbic cortices and of inhibitory GAD67+ cells in the prelimbic cortex. Anxiety levels and ΔFosB cell counts were positively correlated in wild-type, but not in knockout, rats. In conclusion, we present a novel method to quantify whole brain subregions of multilabeled cells in animal models and demonstrate reduced excitatory and inhibitory neuronal marker expression in prefrontal cortex subregions of 5-HTT knockout rats.

Also flagged:neuraltranscription factorstranscription factorchromosomeschromosomebinding
Journal Article 2025-02-01 No Snippets Liu C, Zhang X, Yuan J, Xiang J, Li F.
Show Full Abstract

Noncoding microRNAs tend to evolve within introns of coding genes that provide them with transcriptional opportunity. As an outcome of natural selection, the intragenic position of microRNAs is crucial for their expression, evolution, and functional cooperation with the host gene. Therefore, understanding the evolution of intragenic microRNA structures may bring novel insights into genetic and phenotypic evolution. However, it remains largely unexplored. Here, by analyzing microRNA genomics in 34 metazoan species, we found that the majority (630/1,154) of microRNA families originated from introns of coding genes that provided them with initial transcriptional capacity. The most rapid expansion of intragenic microRNAs happened at the advent of vertebrates when 21 microRNA families emerged from introns of neural genes and reorganized the gene regulatory network, leading to the rise of vertebrate-specific neural crest cells, which transformed the invertebrate head and enabled the ecological shift from filter feeding to active predation. Intragenic microRNAs gradually gain independence from their host genes, which is accelerated by whole-genome duplications. After a whole-genome duplication, the purging of redundant host genes often set an orphaned microRNA "free" to diversify with the transcriptional elements inherited from the host. Whole-genome duplications facilitated a dramatic microRNA diversification during the initial divergence of vertebrates, as the intragenic status of 12 neural crest-regulating microRNAs was retained in jawed vertebrates but was lost in jawless cyclostomes, which diverged their neural crest development. We propose that coding genes not only facilitate the origination of new microRNAs, but also "sacrifice" themselves to help microRNA diversification.

HTT
Also flagged:Wilson diseaseWDDeoxyribonucleic acidATP7Bcopperceruloplasmin
Journal Article 2025-02-01 ✓ 1 Snippet Al-Obaidi RG, Al-Musawi BM.
In-Text Gene Mentions

…MTHFR, ESD, INO80,HTT, and others.…

Show Full Abstract

<h4>Objectives</h4>To study the spectrum and classification of <i>ATP7B</i> variants in Iraqi children with Wilson disease by direct gene sequencing with clinical correlation.<h4>Methods</h4>Fifty-five unrelated children with a clinical diagnosis of Wilson disease (WD) were recruited. Deoxyribonucleic acid was extracted from peripheral blood samples, and variants in the <i>ATP7B</i> gene were identified using next-generation sequencing.<h4>Results</h4>Seventy-six deleterious variants were detected in 97 out of 110 alleles of the <i>ATP7B</i> gene. Thirty (54.5%) patients had 2 disease-causing variants (15 homozygous and 15 compound heterozygous). Twelve (21.8%) patients had one disease-causing variant and one variant of uncertain significance (VUS) with potential pathogenicity. Thirteen (23.6%) patients were carriers of a single disease-causing variant. The most frequent variants, c.3305T>C and c.956delC, were detected in 4 alleles each, followed by c.3741-3742dupCA and c.3694A>C, which were detected in 3 alleles each. Among the 76 variants, 42 were missense, 13 were stop-gain, 9 were frameshift, 1 was an in-frame deletion, and 11 were intronic variants. Notably, the globally common variant H1069Q was not detected in this study.<h4>Conclusion</h4>The mutational spectrum of <i>ATP7B</i> in the Iraqi population is diverse, despite the high rates of consanguinity. It differs from that of neighboring countries. We provided evidence for ten VUS to be reclassified as deleterious, raising questions about the diagnostic criteria for patients with higher Leipzig scores and a single deleterious variant.

PRDX6
Also flagged:axonsAlcoholalcohol spectrum disorderalcohol use disordergene expressionmyelination
Journal Article 2025-02-01 ✓ 1 Snippet Bazzi SA, Maguire C, Mayfield RD, Melamed E.
In-Text Gene Mentions

…and peroxiredoxin 6 (Prdx6) (Table S3 ).…

Show Full Abstract

Oligodendrocytes are a key cell type within the central nervous system (CNS) that generates the myelin sheath covering axons, enabling fast propagation of neuronal signals. Alcohol consumption is known to affect oligodendrocytes and white matter in the CNS. However, most studies have focused on foetal alcohol spectrum disorder and severe alcohol use disorder. Additionally, the impact of alcohol dosage on oligodendrocytes has not been previously investigated. In this study, we evaluated transcriptomic changes in C57BL6/J cultured mature oligodendrocytes following exposure to moderate and high concentrations of alcohol. We found that high concentrations of alcohol elicited gene expression changes across a wide range of biological pathways, including myelination, protein translation, integrin signalling, cell cycle regulation and inflammation. Further, our results demonstrate that transcriptomic changes are indeed dependent on alcohol concentration, with moderate and high concentrations of alcohol provoking distinct gene expression profiles. In conclusion, our study demonstrates that alcohol-induced transcriptomic changes in oligodendrocytes are concentration-dependent and may have critical downstream impacts on myelin production. Targeting alcohol-induced changes in cell cycle regulation, integrin signalling, inflammation or protein translation regulation may uncover mechanisms for modulating myelin production or inhibition. Furthermore, gaining a deeper understanding of alcohol's effects on oligodendrocyte demyelination and remyelination could help uncover therapeutic pathways that can be utilized independently of alcohol to aid in remyelinating drug design.

HTT
Also flagged:neurodegenerative diseasesaggregationprotein degradationamyloid precursor proteinAPPtau
Journal Article 2025-02-01 ✓ 3 Snippets Xu Q, Liu D, Zhu LQ, Su Y, Huang HZ.
In-Text Gene Mentions

…(encoded by theHTTgene), 10 and…

…phosphorylated tau andHTTsuggests the potential…

…aggregation process ofHTTprotein.…

Show Full Abstract

The characteristic events in neurodegenerative diseases (NDDs) encompass protein misfolding, aggregation, accumulation, and their related cellular dysfunction, synaptic function loss. While distinct proteins are implicated in the pathological processes of different NDDs, the process of protein misfolding and aggregation remains notably similar across various conditions. Specifically, proteins undergo misfolding into beta-folded (β-folded) conformation, resulting in the formation of insoluble amyloid proteins. Despite advancements in comprehending protein aggregation, certain facets of this intricate process remain incompletely elucidated. In recent years, the concept that long non-coding RNAs (lncRNAs) contribute to protein aggregation has gained recognition. LncRNAs influence the formation of protein aggregates by facilitating protein overexpression through the regulation of gene transcription and translation, inhibiting protein degradation via lysosomal and autophagic pathways, and targeting aberrant modifications and phase transitions of proteins. A better understanding of the relationship between lncRNAs and aberrant protein aggregation is an important step in dissecting the underlying molecular mechanisms and will contribute to the discovery of new therapeutic targets and strategies. HIGHLIGHTS: NDDs are marked by protein misfolding, aggregation, and accumulation, leading to cellular dysfunction and loss of synaptic function. Despite different proteins being involved in various NDDs, the process of misfolding into β-folded conformations and forming insoluble amyloid proteins is consistent across conditions. The role of lncRNAs in protein aggregation has gained attention, as they regulate gene transcription and translation, inhibit protein degradation, and target aberrant protein modifications. Understanding the link between lncRNAs and protein aggregation is crucial for uncovering molecular mechanisms and developing new therapeutic targets.

Also flagged:ageingdeathcardiac arrestbrain injuryoxygenadenosine triphosphate
Journal Article 2025-02-01 No Snippets Chen Z, Wang S, Shu T, Xia S, He Y, Yang Y.
Show Full Abstract

Ischaemic damage to the brain is the main cause of brain injury after cardiac arrest. The current treatment focuses on early reperfusion, but reperfusion tends to cause reperfusion injury, which is a significant problem. Cell death is an irreversible and normal end to cell life, playing key roles in maintaining the homeostasis and development of multicellular organisms. To date, cell death can be classified into two categories: accidental cell death (ACD) and regulated cell death (RCD). Cell death plays an indispensable role in cerebral ischaemia injury. An increasing number of scholars are exploring the mechanisms and sites of cell death during targeted inhibition of cerebral ischaemia to treat cerebral ischaemia injury. In addition to the established cell death pathways, namely, the apoptosis, pyroptosis and necroptosis pathways, ferroptosis and cuproptosis pathways have been discovered. This article reviews the cell death pathways involved in ischaemic brain injury, discusses the roles played by these death modalities, and suggests therapeutic directions for future targeting of cell death sites.

STAU1
Also flagged:autoimmune diseasecancergene expressionpathogenesisskin-related disordersmalignant diseases
Journal Article 2025-02-01 ✓ 1 Snippet Zuccotti A, Al-Fatyan F, Ferretti GDS, Bertolini I, Long DT, Sahin O, Rodriguez-Blanco J, Barnoud T.
In-Text Gene Mentions

STAU1

Show Full Abstract

Human skin is the largest organ of the human body and accounts for approximately fifteen percent of the total bodyweight. Its main physiological role is to protect the body against a wide range of environmental factors including pathogens, ultraviolet light, and injury. Importantly, the skin can regenerate and heal upon injury in large part by the differentiation of keratinocytes. Not surprisingly, dysregulation of cutaneous differentiation and self-renewal can result in a variety of skin-related pathologies, including autoimmune disease and cancer. Increasing evidence supports the premise that long non-coding RNAs (lncRNAs) act as critical mediators of gene expression and regulate important biological processes within the skin. Notably, dysregulation of lncRNAs has been shown to influence diverse physiological and pathological consequences. More recently, numerous reports have revealed new mechanistic insight on the role that lncRNAs play in skin homeostasis as well as their contribution to the pathogenesis of skin-related disorders. Here, we review the biological functions of cutaneous lncRNAs and their impact on skin homeostasis. We also describe the fundamental roles of lncRNAs in the pathogenesis of skin-related disorders, including fibrotic, autoimmune, and malignant diseases. Lastly, we will highlight how a better understanding of lncRNAs at the molecular level may reveal novel therapeutic approaches for the improvement of cutaneous disorders.

Also flagged:StrokedeathIStissue plasminogen activatortPAcerebral ischemia
Journal Article 2025-02-01 No Snippets Lv J, Jiao Y, Zhao X, Kong X, Chen Y, Li L, Chen X, Tao X, Dong D.
Show Full Abstract

<h4>Background</h4>Ischemic stroke, a major cause of disability and the second leading cause of death, poses a significant public health challenge. Post-stroke inflammation can harm the blood-brain barrier and worsen neurological deficits, which are key factors in neuronal damage in patients with ischemic stroke. Microglia are crucial in the central nervous system, involved in inflammation, neuronal damage, and repair after cerebral ischemia. While cellular immune metabolism has been widely studied, its role in ischamic stroke remains unclear.<h4>Aim</h4>This review aims to examine how inflammation affects the phenotypic characteristics of immune cells after ischemic stroke and to explore the effects of the immune metabolic microenvironment on the phenotypic profiles and functions of microglia in ischemic stroke.<h4>Method</h4>The review refers to the available literature in PubMed, searching for critical terms related to Ischemic stroke, neuroinflammation, microglia, and immunometabolism.<h4>Result</h4>In this review, we found that during stroke progression, microglia can dynamically switch between pro-inflammatory and anti-inflammatory phenotypes. Microglial glycometabolism includes oxidative phosphorylation and glycolysis, and lipid metabolism involves lipid synthesis and breakdown. Modulating the production of inflammatory mediator precursors can induce an anti-inflammatory phenotype in microglia.<h4>Conclusion</h4>Thus, studying microglial metabolic pathways and their products may offer new insights for ischemic stroke treatment.

Also flagged:tumorBone Metastatic Cancermembraneglutathione reductaseGR1CD34
Journal Article 2025-02-01 No Snippets Li C, Xue Y, Yinwang E, Ye Z.
Show Full Abstract

<h4>Background</h4>MDSCs are immature neutrophils and monocytes with immunosuppressive potentials, involving mononuclear MDSCs (M-MDSCs) and polymorphonuclear MDSCs (PMN-MDSCs).<h4>Recent findings</h4>They are significant components of the tumor microenvironment (TME). Besides, recent studies also verified that MDSCs also facilitated the progression of bone metastasis by regulating the network of cytokines and the function of immune cells.<h4>Conclusion</h4>It is necessary to summarize the mechanisms of MDSC recruitment and immunosuppression, and their impact on bone metastasis.

Also flagged:Gene ExpressionBipolar Disorderdepressionmaniahypomaniaeuthymia
Journal Article 2025-02-01 No Snippets Zhang L, Yan H, Zhang C, Li X, Liang J, Tang C, Wu W, Deng W, Xie G, Guo W.
Show Full Abstract

<h4>Background</h4>The resting-state functional connectivity (FC) patterns of the fronto-parietal network (FPN) and language network (LN) underlying bipolar disorder (BD) are obscure. This study aimed to uncover abnormal FC patterns of FPN and LN underlying BD and their evolution following treatment.<h4>Methods</h4>Imaging data at rest state and clinical variables were acquired from 82 patients with BD (with 43 finishing the follow-up) and 88 healthy controls (HCs). Seed-based FC analysis was performed, and correlations between FCs and clinical variables were investigated with whole-brain multiple regression analyses. Furthermore, a neuroimaging-transcription spatial association analysis was conducted.<h4>Results</h4>At baseline, BD patients presented elevated FPN-LN and FPN-prefrontal gyrus FCs, and hyperconnectivity between the LN and bilateral thalamus, right angular gyrus (AG), and right cerebellum. Following 3 months of treatment intervention, there were decreased FCs between the FPN and left superior temporal gyrus (STG), left superior frontal gyrus (SFG), left insula, and bilateral middle temporal gyrus (MTG) (part of LN). Neuroimaging transcription analysis discovered genes correlated with FC alterations in BD.<h4>Conclusions</h4>Aberrant FC patterns of FPN and LN might be involved in the neural pathogenetic and therapeutic mechanisms of BD. We also provided potential genetic pathways underlying these functional impairments in BD.

DCC
Also flagged:ischemic mild cognitive impairmentS100A10senkyunolide Hcryptotanshinonedendritic spinespostsynaptic density protein 95
Journal Article 2025-02-01 ✓ 1 Snippet Wu Q, Zhou Y, Ou C, Gao Z, Wu X, Zhao Y, Wang Y, Wu Z, Yu H.
In-Text Gene Mentions

…modulation of the Netrin‐1/DCCsignaling pathway in…

Show Full Abstract

<h4>Aims</h4>To evaluate the effects of Jiawei Kongsheng Zhenzhong Pill (JKZP) on rats with ischemic mild cognitive impairment (MCI) and investigate the underlying mechanisms.<h4>Methods</h4>The components of JKZP were analyzed using Q-Orbitrap high-resolution mass spectrometry (HRMS). The MCI rat model was prepared through gradual bilateral common carotid artery occlusion (BCCAO). The cognitive function, hippocampal pathological lesions, dendritic spine damage, synapse-related, and S100 calcium-binding protein A10 (S100A10)/tissue-type plasminogen activator (tPA)/brain-derived neurotrophic factor (BDNF) pathway-associated molecules alterations were measured. Primary hippocampus neurons were subjected to oxygen-glucose deprivation/reperfusion (OGD/R) injury, and JKZP-containing serum was utilized for treatment. Lentiviral-infected neurons were constructed with S100A10 knockdown using RNAi technology to investigate whether JKZP exerted its anti-MCI effects via S100A10/tPA/BDNF pathway.<h4>Results</h4>A total of 64 major components, including β-asarone, ferulic acid, loganin, senkyunolide H, and cryptotanshinone, were identified by Q-Orbitrap HRMS technology. JKZP had a notable impact on enhancing the cognitive abilities of rats with MCI. JKZP reduced the damage to the hippocampal CA1 region neuron and synaptic structure, reversed the decrease in dendritic spines, and increased the expressions of synapse-associated proteins such as synaptophysin (SYN), growth-associated protein 43 (GAP43), and postsynaptic density protein 95 (PSD95). Furthermore, JKZP treatment dramatically reduced the ratio of protein of BDNF (proBDNF)/mature BDNF (mBDNF) by activating S100A10/tPA, which was confirmed in primary hippocampus neurons in vitro. Moreover, sh-S100A10 tremendously mitigated the inhibitory action of JKZP on OGD/R-mediated synapse injury, decreased the activity of tPA, and thus improved the downstream pathway targets' ratio, proBDNF/mBDNF.<h4>Conclusions</h4>These results manifested that JKZP promoted neurological recovery after chronic cerebral ischemia by alleviating synaptic damage and activating the S100A10/tPA/BDNF pathway, thereby providing a novel perspective and a solid foundation against MCI.

DNAJC1
Also flagged:Plantamajosidetype 2 diabetes mellitusendoplasmic reticulumglucosepalmitic acidgene expression
Journal Article 2025-02-01 ✓ 5 Snippets Wang D, Wang YS, Zhao HM, Lu P, Li M, Li W, Cui HT, Zhang ZY, Lv SQ.
In-Text Gene Mentions

…of the geneDnajc1.…

…of Bcl-2 andDnajc1.…

…were abolished uponDnajc1silencing.…

…of Bcl-2 andDnajc1in a T2DM…

…of action involvesDnajc1activation, which subsequently…

Show Full Abstract

<h4>Background</h4>Plantamajoside (PMS) has shown potential in mitigating cell damage caused by high glucose (HG) levels. Despite this, the precise therapeutic effects of PMS on type 2 diabetes mellitus (T2DM) and the underlying regulatory mechanisms require further exploration.<h4>Aim</h4>To investigate PMS therapeutic effects on T2DM in mice and elucidate its mechanisms of action through <i>in vivo</i> and <i>in vitro</i> experiments.<h4>Methods</h4>An <i>in vitro</i> damage model of MIN6 cells was established using HG and palmitic acid (PA). PMS's protective effect on cell damage was assessed. Next, transcriptomics was employed to examine how PMS treatment affects gene expression of MIN6 cells. Furthermore, the effect of PMS on protein processing in endoplasmic reticulum and apoptosis pathways was validated. A T2DM mouse model was used to validate the therapeutic effects and mechanisms of PMS <i>in vivo</i>.<h4>Results</h4>PMS intervention ameliorated cell injury in HG + PA-induced MIN6 cell damage. Transcriptomic analysis revealed that protein processing in the endoplasmic reticulum and apoptosis pathways were enriched in cells treated with PMS, with significant downregulation of the gene Dnajc1. Further validation indicated that PMS significantly inhibited the expression of apoptosis-related factors (Bax, CytC) and endoplasmic reticulum stress (ERS)-related factors [ATF6, XBP1, Ddit3 (CHOP), GRP78], while promoting the expression of Bcl-2 and Dnajc1. Additionally, the inhibitory effects of PMS on ERS and apoptosis were abolished upon Dnajc1 silencing. Furthermore, <i>in vivo</i> experiments demonstrated that PMS intervention effectively improved pancreatic damage, suppressed the expression of apoptosis-related factors (Bax, CytC), and ERS-related factors [ATF6, XBP1, Ddit3 (CHOP), GRP78], while promoting the expression of Bcl-2 and Dnajc1 in a T2DM model mice.<h4>Conclusion</h4>PMS intervention could alleviate pancreatic tissue damage effectively. The mechanism of action involves Dnajc1 activation, which subsequently inhibits apoptosis and ERS, ameliorating damage to pancreatic β-cells.

Also flagged:TBdeathlinezolidnitrobenzyloxyoxazine
Journal Article 2025-02-01 No Snippets Thuy HTT, Padmapriyadarsini C, Chuchottaworn C, Foraida S, Hadigal S, Birajdar AR.
Show Full Abstract

<h4>Objective</h4>To summarise the efficacy and safety of pretomanid (Pa) based regimens in patients with drug-resistant TB (DR-TB).<h4>Methods</h4>We included clinical trials, operational research and observational studies reporting the efficacy and safety of Pa-based regimens in DR-TB. The duration of the treatment was at least 24 weeks. Efficacy was reported as a favourable/unfavourable outcome and culture conversion. Safety was reported in terms of death and frequency of adverse events of special interest.<h4>Results</h4>Of the 127 articles identified, 13 were included. The proportion of favourable outcomes reported was 76-100%, and the median time to culture conversion was 4-6 weeks. Culture conversion rates ranged from 80-100% by the end of 3 months of treatment, regardless of the type of drug resistance. Treatment completion rates in the operational research studies varied between 18-93%. Safety events were not proportionate among the studies included, possibly due to the differing linezolid dosing (more frequent in the 1,200 mg dose regimen).<h4>Conclusion</h4>Our review supports the use of Pa-based regimens in patients with DR-TB. The results indicate that Pa-based regimens are efficacious with tolerable safety profile in DR-TB patients.

DARS2SERPINC1
Also flagged:FGF21systemic diseaseinsulin resistanceATF4phosphorylationmitochondrial
Journal Article 2025-02-01 ✓ 3 Snippets Tang S, Borlak J.
In-Text Gene Mentions

…the thrombin inhibitorSERPINC1were negative (Figure…

…UnlikeDARS2deficient heart mitochondria,…

…observed significantly reducedDARS2expression in MASLD…

Show Full Abstract

<h4>Background</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) is a systemic disease with insulin resistance at its core. It affects one-third of the world population. Fibroblast growth factor (FGF21)-based therapies are effective in lowering hepatic fat content and fibrosis resolution; yet, its molecular functions remain uncertain. To gain insight into FGF21 mode of action (MoA), we investigated the transcriptomes of MASLD liver biopsies in relation to FGF21 expression.<h4>Methods</h4>We compared N = 66 healthy controls with 396 MASLD patients and considered clinical characteristics relative to NAS disease activity scores (steatosis, lobular inflammation and ballooning), fibrosis grades and sex. We performed comparative genomics to identify FGF21-responsive DEGs, utilised information from FGF21-transgenic and FGF21-knockout mice and evaluated DEGs following FGF21 treatment of MASLD animal models. Eventually, we explored 188 validated FGF21 targets, and for ≥10 patients showing the same changes, we constructed MASLD-associated networks to determine the effects of FGF21 in reverting metabolic dysfunction.<h4>Results</h4>We identified patients with increased 30% (N = 117), decreased 40% (N = 159) or unchanged 30% (N = 120) FGF21 expression, and the differences are caused by changes in FGF21 transcriptional control with ATF4 functioning as a key regulator. Based on comparative genomics, we discovered molecular circuitries of FGF21 in MASLD, notably FGF21-dependent induction of autophagy and oxidative phosphorylation/mitochondrial respiration. Conversely, FGF21 repressed hepatic glycogen-storage, its glucose release and gluconeogenesis, and therefore reduced glucose flux in conditions of insulin resistance. Furthermore, FGF21 repressed lipid transporters, and acetyl-CoA carboxylase-β to attenuate hepatic lipid overload and lipogenesis. Strikingly, FGF21 dampened immune response by repressing complement factors, MARCO, CD163, MRC1/CD206, CD4, CD45 and pro-inflammatory cytokine receptors. It also reverted procoagulant imbalance in MASLD, stimulated extracellular matrix degradation, repressed TGFβ- and integrin-signalling and lessened liver sinusoidal endothelial cell defenestration in support of fibrosis resolution.<h4>Conclusions</h4>We gained deep insight into FGF21-MoA in MASLD. However, heterogeneity in FGF21 expression calls for molecular stratifications as to identify patients which likely benefit from FGF21-based therapies.<h4>Key points</h4>Performed comprehensive genomics across liver biopsies of 396 MASLD patients and identified patients with increased, decreased and unchanged FGF21 expression. Used genomic data from FGF21 transgenic, knock-out and animal MASLD models treated with synthetic FGF21 analogues to identify FGF21-mode-of-action and metabolic networks in human MASLD. Given the significant heterogeneity in FGF21 expression, not all patients will benefit from FGF21-based therapies.

HFE
Also flagged:Diabetic Kidney Diseaseiron deficiency anemiaIDAironiron deficiencycytokine
Journal Article 2025-02-01 ✓ 1 Snippet Huang B, Wen W, Ye S.
In-Text Gene Mentions

…HIF‐1α via the β2‐M/HFEcomplex, ultimately inducing…

Show Full Abstract

<h4>Objective</h4>This study aims to explore the link between iron deficiency anemia (IDA) and diabetic kidney disease (DKD) and assess the safety of iron supplementation. It also investigates key mechanisms and molecules involved in iron deficiency's role in disease development.<h4>Methods</h4>A retrospective analysis was conducted on 1,398 T2DM patients using propensity score matching to identify risk factors for DKD. Mendelian randomization (MR) was used to explore causal relationships between IDA, iron supplementation, liver iron content, and DKD. The GSE27999 dataset was analyzed to examine how an iron-deficient diet affects kidney-related gene expression. Key pathways and molecules were identified through GSEA, GO/KEGG, and PPI analysis.<h4>Results</h4>Retrospective data showed a correlation between hemoglobin levels and DKD risk. Logistic regression confirmed that IDA increased DKD risk independently of other factors. MR revealed a causal link between IDA and DKD, with no significant effect from iron supplementation. GSE27999 analysis identified 580 differentially expressed genes, enriched in pathways like cytokine signaling, oxidative biology, and small molecule transport. PPI analysis highlighted 10 key hub genes, including Cyp2d26 and Fgf4.<h4>Conclusion</h4>IDA increases susceptibility to DKD, possibly through oxidative stress and altered small molecule transport. However, iron supplementation does not appear to increase the risk of DKD.

HFE
Also flagged:Ascorbic AcidoxygenHbvitamin Ctranexamic acidblood-borne infections
Journal Article 2025-02-01 ✓ 1 Snippet Hosseini-Monfared P, Mirahmadi A, Sarzaeem MM, Pourshahryari S, Aminnia P, Poursalehian M, Kazemi SM.
In-Text Gene Mentions

…cell disease, andhemochromatosis, and patients currently…

Show Full Abstract

<h4>Background</h4>Blood loss is among the main complications of total knee arthroplasty (TKA) and oxidative stress, and hemolysis caused by reactive oxygen species are one of the causes of hemoglobin (Hb) drop. Ascorbic acid is a potent antioxidant that can protect against reactive oxygen species. In this study, we aim to explore the antioxidant effect of ascorbic acid on blood loss and patient-reported outcomes following outpatient TKA.<h4>Methods</h4>Patients scheduled for outpatient primary TKA were enrolled in this randomized, double-blind clinical trial and were assigned to 1 of the 2 groups. The patients in the ascorbic acid group received intravenous vitamin C perioperatively. Patients in the placebo group received only normal saline. We calculated the blood loss using the Hb drop. Patient-reported outcomes such as Oxford Knee Score, Western Ontario and McMaster Universities Osteoarthritis Index, Knee Injury and Osteoarthritis Outcome Score, and Forgotten Joint Score were used to evaluate the postoperative pain and function in the 6-month follow-up.<h4>Results</h4>The patients who have received ascorbic acid had lower Hb drop (g/dL) (1.30 ± 0.72 vs 1.91 ± 0.84, <i>P</i> value < .001) and total blood loss in the first postoperative day (463.60 ± 274.37 vs 732.11 ± 347.78, <i>P</i> value < .001). Also, fewer patients reached the minimum clinically important difference level for Hb drop in the ascorbic acid group. The patients' postoperative functional and pain scores were not different between the 2 groups.<h4>Conclusions</h4>Our findings demonstrated that perioperative use of ascorbic acid can reduce blood loss by nearly 36% on the first postoperative day and should be considered as an effective blood-preserving agent in conjunction with tranexamic acid during TKA.

SUDS3
Also flagged:ExtracellularHistonesnucleosomechromatingene expressionchronic diseases
Journal Article 2025-02-01 ✓ 1 Snippet Singh B, Fredriksson Sundbom M, Muthukrishnan U, Natarajan B, Stransky S, Görgens A, Nordin JZ, Wiklander OPB, Sandblad L, Sidoli S, El Andaloussi S, Haney M, Gilthorpe JD.
In-Text Gene Mentions

…that core andlinker histoneshistones localize to…

Show Full Abstract

Histones are conserved nuclear proteins that function as part of the nucleosome in the regulation of chromatin structure and gene expression. Interestingly, extracellular histones populate biofluids from healthy individuals, and when elevated, may contribute to various acute and chronic diseases. It is generally assumed that most extracellular histones exist as nucleosomes, as components of extracellular chromatin. We analysed cell culture models under normal and stressed conditions to identify pathways of histone secretion. We report that core and linker histones localize to extracellular vesicles (EVs) and are secreted via the multivesicular body/exosome pathway. Upregulation of EV histone secretion occurs in response to cellular stress, with enhanced vesicle secretion and a shift towards a population of smaller EVs. Most histones were membrane associated with the outer surface of EVs. Degradation of EV-DNA did not impact significantly on EV-histone association. Individual histones  and histone octamers bound strongly to liposomes and EVs, but nucleosomes did not, showing histones do not require DNA for EV binding. Histones colocalized to tetraspanin positive EVs but using genetic or pharmacological intervention, we found that all known pathways of exosome biogenesis acted positively on histone secretion. Inhibition of autophagy and lysosomal degradation had a strong positive effect on EV histone release. Unexpectedly, EV-associated histones lacked the extensive post-translational modification of their nuclear counterparts, suggesting loss of PTMs may be involved in their trafficking or secretion. Our data does not support a significant role for EV-histones existing as nucleosomes. We show for the first time that histones are secreted from cells as membrane proteins via EVs/exosomes. This fundamental discovery provides support for further investigation of the biological activity of exosome associated histones and their role in disease.

Also flagged:extracellularwound healingperiodontitistissuehostresponse
Journal Article 2025-02-01 No Snippets Smedås AK, Paris LG, Al-Sharabi N, Kristoffersen EK, Sanz M, Mustafa K, Bunæs DF, Shanbhag S.
Show Full Abstract

<h4>Objective</h4>Cell secretomes represent a promising strategy for periodontal and bone regeneration. The objective of this study was to characterize the secretome of human gingival fibroblasts (GF) from periodontally diseased tissues (GF-perio) using proteomics.<h4>Materials and methods</h4>Conditioned media of GF-perio from periodontitis patients (n = 6, 48-h serum-free culture) were subjected to liquid chromatography with tandem mass spectrometry. Global profiles, differentially expressed proteins (DEPs), and functional/gene-set enrichment (FEA) were analyzed using bioinformatics. Selected bone regeneration-related proteins were additionally measured using a multiplex immunoassay. Conditioned media of GF from periodontally healthy subjects were used as a reference.<h4>Results</h4>Overall, 1833 proteins were detected in GF-perio secretomes, including several growth factors, cytokines, chemokines, and extracellular matrix proteins important for wound healing and regeneration. Key bone-related cytokines (FGF2, MCP1, GPNMB, MMP2, IL6, IL8) were confirmed by an immunoassay. Compared to the reference group, 127 exclusive proteins and 73 DEPs (p < 0.05) were identified in the GF-perio group. FEA revealed significant enrichment of "exosome" and "cytoplasm" related cellular components in GF-perio secretomes.<h4>Conclusion</h4>The secretome of GF from periodontally diseased tissues may hold therapeutic potential, with several proteins important for wound healing and regeneration, especially those related to exosome functions.

VSIG10
Also flagged:DNMT1DNA methyltransferase 1methylationhistonemodificationsgene expression
Journal Article 2025-02-01 ✓ 2 Snippets Elder E, Lemieux A, Legault LM, Caron M, Bertrand-Lehouillier V, Dupas T, Raynal NJ, Bourque G, Sinnett D, Gévry N, McGraw S.
In-Text Gene Mentions

…Hcn2 , andVsig10), albeit with…

…216 ], andVSIG10to COVID-19 […

Show Full Abstract

Epigenetic mechanisms are crucial for developmental programming and can be disrupted by environmental stressors, increasing susceptibility to disease. This has sparked interest in therapies for restoring epigenetic balance, but it remains uncertain whether disordered epigenetic mechanisms can be fully corrected. Disruption of DNA methyltransferase 1 (DNMT1), responsible for DNA methylation maintenance, has particularly devastating biological consequences. Therefore, here we explored if rescuing DNMT1 activity is sufficient to reverse the effects of its loss utilizing mouse embryonic stem cells. However, only partial reversal could be achieved. Extensive changes in DNA methylation, histone modifications, and gene expression were detected, along with transposable element derepression and genomic instability. Reduction of cellular size, complexity, and proliferation rate were observed, as well as lasting effects in germ layer lineages and embryoid bodies. Interestingly, by analyzing the impact on imprinted regions, we uncovered 20 regions exhibiting imprinted-like signatures. Notably, while many permanent effects persisted throughout Dnmt1 inactivation and rescue, others arose from the rescue intervention. Lastly, rescuing DNMT1 after differentiation initiation worsened outcomes, reinforcing the need for early intervention. Our findings highlight the far-reaching functions of DNMT1 and provide valuable perspectives on the repercussions of epigenetic perturbations during early development and the challenges of rescue interventions.

DARS2
Also flagged:protein synthesisconjugationchromosomethyminesynthesisthymidine
Journal Article 2025-02-01 ✓ 1 Snippet Herrick J, Norris V, Kohiyama M.
In-Text Gene Mentions

…chaperones, DatA, DARS1,DARS2, DiaA, SeqA, AphA,…

Show Full Abstract

The <i>Replicon Theory</i> has guided the way experiments into DNA replication have been designed and interpreted for 60 years. As part of the related, explanatory package guiding experiments, it is thought that the timing of the cell cycle depends in some way on a critical mass for initiation, <i>Mi</i>, as licensed by a variety of macromolecules and molecules reflecting the state of the cell. To help in the re-interpretation of this data, we focus mainly on the roles of DnaA, RNA polymerase, SeqA, and ribonucleotide reductase in the context of the "nucleotypic effect".

SOX6
Also flagged:Valproic AcidCognitioncognitive impairmentbehavioralanxietyion homeostasis
Journal Article 2025-02-01 ✓ 2 Snippets Shen K, Zhang Y, Huang Y, Xie Y, Ding J, Wang X.
In-Text Gene Mentions

SOX6, which is present…

…the number ofSOX6+ cells in…

Show Full Abstract

<h4>Aims</h4>Valproic acid (VPA) exposure during the gestational period has been found to impair the cognition of the offspring. The study aimed to investigate whether VPA leads to offspring cognitive impairment through disturbing interneuron development.<h4>Methods</h4>Pregnant mice were injected with VPA peritoneally to establish the prenatal VPA exposure model. Cortical interneurons were labeled with Rosa26-EYFP/- reporter mice activated by Nkx2.1-Cre. Interneuron subtypes both in the cortex and the hippocampus were detected by immunofluorescence. A battery of behavioral tests was conducted on postnatal Day 28 to assess the cognition and anxiety of the offspring. RNA-Seq analysis was performed to investigate the underlying molecular mechanisms.<h4>Results</h4>We found that after the exposure to VPA, all the groups of the male offspring exerted anxiety. When VPA injection was performed on gestational Day 12.5, the memory of the offspring was impaired. Mechanistically, the distribution of cortical interneurons was disrupted. The distribution of interneuron subtypes was abnormal both in the cortex and hippocampus after the VPA exposure, which affected the somatostatin-positive neurons but not the parvalbumin-positive neurons, indicating the effects of VPA were subtype specific. Biological processes related to ion homeostasis were greatly changed after VPA exposure.<h4>Conclusion</h4>Prenatal VPA exposure during the neurogenic period impaired the cognition of the offspring by disrupting interneuron migration and differentiation. The study provides a novel perspective on the influence of VPA over neurodevelopment.

PRDX6
Also flagged:glyphosategene expressionenrofloxacincolistinammoniummaduramicin
Journal Article 2025-02-01 ✓ 3 Snippets Laptev GY, Tiurina DG, Yildirim EA, Gorfunkel EP, Ilina LA, Filippova VA, Dubrovin AV, Dubrovina AS, Brazhnik EA, Novikova NI, Melikidi VK, Sokolova KA, Ponomareva ES, Zaikin VA, Griffin DK, Romanov MN.
In-Text Gene Mentions

…peroxiredoxin 6 (PRDX6)) by up…

…)、超氧化物歧化酶1( SOD1 )和过氧化还原酶6(PRDX6))的表达下调高达98.6%。实验组中还观察到血清免疫学特性…

PRDX6

Show Full Abstract

Drugs and pesticide residues in broiler feed can compromise the therapeutic and production benefits of antibiotic (ANT) application and affect gene expression. In this study, we analyzed the expression of 13 key pancreatic genes and blood physiology parameters after administering one maximum residue limit of herbicide glyphosate (GLY), two ANTs, and one anticoccidial drug (AD). A total of 260 Ross 308 broilers aged 1‍-‍40 d were divided into the following four groups of 65 birds each: control group, which was fed the main diet (MD), and three experimental groups, which were fed MD supplemented with GLY, GLY+ANTs (enrofloxacin and colistin methanesulfonate), and GLY+AD (ammonium maduramicin), respectively. The results showed that the addition of GLY, GLY+ANTs, and GLY+AD caused significant changes in the expression of several genes of physiological and economic importance. In particular, genes related to inflammation and apoptosis (interleukin 6 (<i>IL6</i>), prostaglandin-endoperoxide synthase 2 (<i>PTGS2</i>), and caspase 6 (<i>CASP6</i>)) were downregulated by up to 99.1%, and those related to antioxidant protection (catalase (<i>CAT</i>), superoxide dismutase 1 (<i>SOD1</i>) and peroxiredoxin 6 (<i>PRDX6</i>)) by up to 98.6%, compared to controls. There was also a significant decline in the values of immunological characteristics in the blood serum observed in the experimental groups, and certain changes in gene expression were concordant with changes in the functioning of the pancreas and blood. The changes revealed in gene expression and blood indices in response to GLY, ANTs, and AD provide insights into the possible mechanisms of action of these agents at the molecular level. Specifically, these changes may be indicative of physiological mechanisms to overcome the negative effects of GLY, GLY+ANTs, and GLY+AD in broilers.

Also flagged:CancernucleotideGSTP1SLC22A1UGT1A7CYP2D6
Journal Article 2025-02-01 No Snippets Sharafshah A, Motovali-Bashi M, Keshavarz P.
Show Full Abstract

<h4>Background</h4>Next-Generation Sequencing (NGS) methods specifically Whole-Exome Sequencing (WES) have demonstrated promising findings with a high accuracy of 91%-99% in Pharmacogenomics (PGx). A PGx-based panel can be utilized to minimize adverse drug reactions (ADRs) and maximize the treatment efficacy. Remarkably, Cancer Pain Management (CPM) is a cutting-edge concept in modern medicine. Thus, this study aimed to investigate the WES results by a PGx-based panel containing genes involved in Pain, Anti-inflammatory, and Immunomodulating agents (PAIma) signaling pathways.<h4>Methods</h4>A total of 200 unrelated Iranians (100 western and 100 northern) were included. 100 WES results were analyzed through the PAIma panel. After DNA extraction, 100 samples were genotyped by Multiplex-Amplification-Refractory Mutation System (ARMS) PCR. A primary <i>in silico</i> investigation performed on 128 candidate genes through Protein-Protein Interactions (PPIs) and Gene-miRNA Interactions (GMIs) via the STRING database, and miRTargetLink2, respectively. Additionally, Enrichment Analysis (EA) was applied to find the unknown interplays among these three major pathways by Enrichr.<h4>Results</h4>55,590 annotations through 21 curated pathways were filtered, 900 variants were found, and 128 genes were refined. Finally, 54 candidate variants (48 non-synonymous single nucleotide variants (nsSNVs), 2 stop-gained, 1 frameshift, and 3 splicing) remained.<h4>Conclusion</h4>Conclusively, six potentially actionable variants including rs1695 (<i>GSTP1</i>), rs628031 (<i>SLC22A1</i>), rs17863778 (<i>UGT1A7</i>), rs16947 (<i>CYP2D6</i>), rs2257401 (<i>CYP3A7</i>), and rs2515641 (<i>CYP2E1</i>) had the most deviations among Iranians, compared with the reference genome, which should be genotyped for drug prescribing. Remarkably, PPIs, GMIs, and EA revealed potential risks of carcinogenesis and cancer phenotypes resulting from PAIma pathways genes.

Also flagged:Obesityepidemic diseasesarcopeniatestosteroneoestrogenmineral
Journal Article 2025-02-01 No Snippets Viola V, Samanta T, Nava MLD, Celli A, Armamento-Villareal R, Nguyen NHL, Colleluori G, Barnouin Y, Napoli N, Qualls C, Kaipparettu BA, Villareal DT.
Show Full Abstract

<h4>Background</h4>Testosterone replacement therapy (TRT) added to lifestyle therapy can mitigate weight-loss-induced reduction of muscle mass and bone mineral density (BMD) in older men with obesity and hypogonadism.<h4>Objective</h4>To investigate the molecular mechanisms underlying the attenuation of muscle and BMD loss in response to TRT during intensive lifestyle intervention in this high-risk older population.<h4>Methods</h4>Among 83 older (≥ 65 years) men with obesity (BMI ≥ 30 kg/m<sup>2</sup>) and hypogonadism (early AM testosterone persistently < 300 ng/dL) associated with frailty (Modified Physical Performance Test score ≤ 31) randomized into 26-week lifestyle therapy plus testosterone (LT+TRT) or placebo (LT+Pbo) in the LITROS trial, 38 underwent serial muscle biopsies for the muscle transcriptomics substudy.<h4>Results</h4>Despite similar ~10% weight loss, lean body mass and thigh muscle volume decreased less in LT+TRT than LT+Pbo (-2% vs. -4%, respectively; p = 0.04). Hip BMD was preserved in LT+TRT compared with LT+Pbo (0.4% vs. -1.3%; p = 0.03). Muscle strength increased similarly in LT+TRT and LT+Pbo (23% vs. 24%; p = 0.95). Total testosterone increased more in LT+TRT than LT+Pbo (133% vs. 32%; p = 0.005). Based on Next Generation Sequencing, of the 39 160 and 39 115 genes detected in LT+TRT and LT+Pbo, respectively, 195 were differentially expressed in LT+TRT and 158 in LT+Pbo. Gene Ontology enrichment analyses revealed that in LT+TRT, just four muscle-related pathways (muscle organ development, muscle organ morphogenesis, regulation of skeletal muscle contraction, muscle atrophy) were downregulated and one pathway (muscle system process) was upregulated. In contrast, in LT+Pbo, nine muscle-related pathways (muscle system process, muscle tissue development, muscle organ development, skeletal muscle tissue development, skeletal muscle organ development, skeletal muscle cell differentiation, muscle organ morphogenesis, response to stimuli involved in regulation of muscle adaptation, muscle atrophy) and one pathway related to bone (bone mineralization involved in bone maturation) were downregulated. Muscle system process was upregulated in LT+TRT but downregulated in LT+Pbo. RT-PCR analyses showed that LT+TRT resulted in a higher expression of MYOD1 (p = 0.02) and WNT4 (p = 0.02), key genes involved in muscle and bone metabolism, respectively, compared with LT+Pbo. We also observed significantly higher mRNA expression of MYBPH (p = 0.006), SCN3B (p = 0.02) and DSC2 (p = 0.01), genes involved in the muscle system process, in response to LT+TRT compared with LT+Pbo.<h4>Conclusion</h4>The addition of TRT to lifestyle therapy mitigates the weight-loss-induced reduction of muscle mass and BMD via countering the weight-loss-induced downregulation of genes involved in muscle and bone anabolism.

SOX6
Also flagged:NucleusAgingneurological diseasesgene expressioncognitive impairmentneurological disorders
Journal Article 2025-02-01 ✓ 5 Snippets Xiong LL, Niu RZ, Chen L, Huangfu LR, Li J, Xue LL, Sun YF, Wang LM, Li YP, Liu J, Wang TH.
In-Text Gene Mentions

…cells and establishedSOX6, ADAMTS19 ,…

…of SOX5 andSOX6compared with other…

…by GLAST +SOX6+ ADAMTS19 +…

…and GLAST +SOX6+ MAP2 +…

…Although GLAST /SOX6/ MAP2 triple-positive…

Show Full Abstract

The tree shrew brain has garnered considerable attention due to its remarkable similarities to human brain. However, the cellular composition and genetic signatures of tree shrew hippocampus across postnatal life remain poorly characterized. Here, we establish the first single-nucleus transcriptomic atlas of tree shrew hippocampus spanning postnatal life, detailing the dynamics and diversity of the neurogenic lineage, oligodendrocytes, microglia, and endothelial cells. Notably, cross-species transcriptomic comparison among humans, macaques, tree shrews, and mice reveals that the tree shrew transcriptome resembles that of macaques, making it a promising model for simulating human neurological diseases. More interestingly, we identified a unique class of tree shrew-specific neural stem cells and established SOX6, ADAMTS19, and MAP2 as their markers. Furthermore, aberrant gene expression and cellular dysfunction in the tree shrew hippocampus are linked to neuroinflammation and cognitive impairment during tree shrew aging. Our study provides extensive resources on cell composition and transcriptomic profiles, serving as a foundation for future research on neurodevelopmental and neurological disorders in tree shrews.

Also flagged:regulation ofgene expressionnucleosomecancermethylationcytosine
Journal Article 2025-02-01 No Snippets Wang S, Xu Y.
Show Full Abstract

We discovered that the Z-form DNA-RNA hybrid stabilized by methylated CpG repeats impacts on the initiation and elongation of Okazaki fragments, contributing to blocking DNA replication at first time. We further present the first Z-form DNA-RNA hybrid structure by using NMR spectroscopy and dynamic computation, revealing the molecular mechanism of inhibition, indicating that a distinctive zig-zag strand pattern of the Z-form hybrid with a smaller helical diameter (15 Å) and a very narrow minor groove (8.3 Å) plays the key role in the repression toward DNA replication.

Also flagged:breast cancercancertumourPolymersethylene glycolsolid tumours
Journal Article 2025-02-01 No Snippets Mitry MMA, Osborn HMI, Greco F.
Show Full Abstract

Non-toxic prodrugs have proved of great value in medicinal chemistry programmes for cancer, due to their ability to selectively deliver toxic components at tumour sites once they are activated by a localised mechanism. Since activation of the prodrug to afford the toxic drug is a prerequisite for success of the approach, much interest has focused on the localised chemical and enzymatic mechanisms for activating the prodrugs. Bioorthogonal chemistry has positively impacted this area by providing biocompatible reactions that enable on-demand prodrug activation and active drug release. However, to be effective, it is essential that one of the components of the bioorthogonal reaction is localised at the tumour, in order to initiate the on-demand and on-target activation of the prodrug. Polymers such as poly(ethylene glycol) (PEG) are known to target solid tumours by passive targeting <i>via</i> the enhanced permeability and retention (EPR) effect. In this paper, the feasibility of derivatising long PEG chains to afford bioorthogonal activators (PEG-azide and PEG-tetrazine) for prodrug activation <i>via</i> the Staudinger ligation and the tetrazine ligation reactions, respectively, is evaluated. The molecular weight of the PEG in the activator and the type of linkage in the prodrug moiety were shown to significantly affect the rate of prodrug activation and hence the rate of drug release. <i>In vitro</i> cytotoxicity studies on breast cancer cells (MCF-7 and MDA-MB-231) showed ∼68-76% restoration of the parent drug's cytotoxicity for the Staudinger ligation-based prodrug activation strategy, and 100% restoration of the parent drug's cytotoxicity for the tetrazine ligation-based prodrug activation strategy. Restoration of doxorubicin's ability to intercalate with DNA upon activation of the prodrug by the PEG-activators was also demonstrated <i>via</i> fluorescence spectroscopy. Moreover, conjugation of the tetrazine bioorthogonal activator to a 10 kDa PEG polymer improved its serum stability in comparison with other reported tetrazine activators that completely lose their stability in serum over the same period of time. The feasibility of the combined passive targeting/bioorthogonal prodrug activation approach has therefore been demonstrated using a range of prodrugs, activation mechanisms, and <i>in vitro</i> assays.

DARS2
Also flagged:Right ventricular volume overloadcongenital heart diseasemitochondrialphosphorylationhypoplastic left heart syndromeHLHS
Journal Article 2025-02-01 ✓ 1 Snippet Cao J, Xiao Y, Hong H, Chen Z, Qin W.
In-Text Gene Mentions

Dars2

Show Full Abstract

Right ventricular volume overload (RVVO) is a common hemodynamic abnormality in patients with congenital heart disease (CHD) and frequently leads to pathological cardiac remodeling. Our previous research demonstrated that RVVO disrupts the metabolic maturation of cardiomyocytes. Mitochondrial metabolic maturation, a crucial process in postnatal cardiomyocyte development, remains poorly understood under RVVO conditions. In this study, an mouse RVVO model was established on postnatal day 7 by creating a fistula between the abdominal aorta and inferior vena cava, confirmed by abdominal ultrasound and echocardiography. Transcriptomic analyses revealed significant downregulation of genes linked to mitochondrial metabolic maturation. Transmission electron microscopy showed impaired mitochondrial structure and maturation markers, while Seahorse assays demonstrated a marked reduction in oxidative phosphorylation rates in RVVO cardiomyocytes. These findings collectively indicated that RVVO restricted mitochondrial metabolic maturation in the postnatal RV. Targeting mitochondrial metabolic maturation could offer a promising therapeutic strategy to mitigate RVVO-induced pathological remodeling.

HFE
Also flagged:Thalassemiablood disorderβ-thalassemiablood disordersthalassemia majorintermedia
Journal Article 2025-02-01 ✓ 1 Snippet Safwan M, Bourgleh MS, Alsudays A, Haider KH.
In-Text Gene Mentions

…overload”, “iron chelation”, “hemochromatosis”, “cardiac siderosis”, “cardi…

Show Full Abstract

<h4>Background</h4>Iron overload cardiomyopathy is a significant cause of morbidity and mortality in transfusion-dependent thalassemia patients. Standard iron chelation therapy is less efficient in alleviating iron accumulation in many organs, especially when iron enters the cells <i>via</i> specific calcium channels.<h4>Aim</h4>To validate our hypothesis that adding amlodipine to the iron chelation regimen is more efficient in alleviating myocardial iron overload.<h4>Methods</h4>Five databases, including PubMed, Cochrane Library, Embase, ScienceDirect, and ClinicalTrials.gov, were systematically searched, and three randomized controlled trials involving 144 pediatric patients with transfusion-dependent thalassemia were included in our meta-analysis based on the predefined eligibility criteria. The quality of the included studies was assessed based on the Cochrane collaboration tool for bias assessment. The primary outcome assessed was myocardial-T2 and myocardial iron concentration, while the secondary results showed serum ferritin level, liver iron concentration, and treatment adverse outcomes. Weighted mean difference and odds ratio were calculated to measure the changes in the estimated treatment effects.<h4>Results</h4>During the follow-up period, Amlodipine treatment significantly improved cardiac T2 by 2.79 ms compared to the control group [95% confidence interval (CI): 0.34-5.24, <i>P</i> = 0.03, <i>I</i> <sup>2</sup> = 0%]. Additionally, a significant reduction of 0.31 in myocardial iron concentration was observed with amlodipine treatment compared to the control group [95%CI: -0.38-(-0.25), <i>P</i> < 0.00001, <i>I</i> <sup>2</sup> = 0%]. Liver iron concentration was slightly lower in the amlodipine group by -0.04 mg/g, but this difference was not statistically significant (95%CI: -0.33-0.24, <i>P</i> = 0.77, <i>I</i> <sup>2</sup> = 0%). Amlodipine also showed a non-significant trend toward a reduction in serum ferritin levels (-328.86 ng/mL, 95%CI: -1212.34-554.62, <i>P</i> = 0.47, <i>I</i> <sup>2</sup> = 90%). Regarding safety, there were no significant differences between the groups in the incidence of gastrointestinal upset, hypotension, or lower limb edema.<h4>Conclusion</h4>Amlodipine with iron chelation therapy significantly improved cardiac parameters, including cardiac-T2 and myocardial iron, in patients with transfusion-dependent thalassemia without causing significant adverse events but enhancing the efficacy of iron chelation therapy.

Also flagged:cytoskeletonmembraneviral infectionhost cellmembranescytoskeletons
Journal Article 2025-02-01 No Snippets Gao X, Chen X, Yu L, Zhao S, Jiu Y.
Show Full Abstract

Viral epidemics pose major threats to global health and economies. A hallmark of viral infection is the reshaping of host cell membranes and cytoskeletons to form organelle-like structures, known as viral factories, which support viral genome replication. Viral infection in many cases induces the cytoskeletal network to form cage-like structures around viral factories, including actin rings, microtubule cages, and intermediate filament cages. Viruses hijack various organelles to create these replication factories, such as viroplasms, spherules, double-membrane vesicles, tubes, and nuclear viral factories. This review specifically examines the roles of cytoskeletal elements and the endomembrane system in material transport, structural support, and biochemical regulation during viral factory formation. Furthermore, we discuss the broader implications of these interactions for viral replication and highlight potential future research directions.

Also flagged:immune responsegene expressioncancerformaldehydemethylamine
Journal Article 2025-02-01 No Snippets Wilson T, Kuch M, Poinar D, Rockarts J, Wainman B, Morgello S, Poinar H.
Show Full Abstract

Archival fixed tissues hold key insights into the evolutionary history of RNA viruses and the associated host immune response, yet access to the RNA sequence data is limited by a lack of robust methods for RNA extraction and sequence retrieval from these tissue types. Here we compared three commercial RNA extraction techniques (bead, column, and phase-based) on five fixed human brain tissues done in triplicate, that have been stored for up to 43 years. We found that for this sample set, bead-based extractions captured longer molecules and yielded a greater proportion of unique reads when aligned to the human genome, than did column and phase-based extraction methods. Via the incorporation of multiple extraction replicates, we quantified the variability in sequencing metrics resulting from tissue sample and extraction technique heterogeneity. Additionally, we compared pre- and post-sequencing metrics and found that the former poorly predicted post-sequencing on-target success. Our findings help inform future research on the recovery of RNA from archival fixed tissues.

Also flagged:Metabolic dysfunctionliver diseaseobesitysteatotic liver diseasemetabolic dysfunction-associated steatohepatitisType 2 Diabetes
Journal Article 2025-02-01 No Snippets Panganiban J, Kehar M, Ibrahim SH, Hartmann P, Sood S, Hassan S, Ramirez CM, Kohli R, Censani M, Mauney E, Cuda S, Karjoo S.
Show Full Abstract

<h4>Introduction</h4>This Obesity Medicine Association (OMA) Expert Joint Perspective examines steatotic liver disease (SLD), which is composed of metabolic dysfunction-associated steatotic liver disease (MASLD), and metabolic dysfunction-associated steatohepatitis (MASH) in children with obesity. The prevalence of obesity is increasing, rates have tripled since 1963 from 5 % to now 19 % of US children affected in 2018. MASLD, is the most common liver disease seen in children, can be a precursor to the development of Type 2 Diabetes (T2DM) and is the primary reason for liver transplant listing in young adults. We must be vigilant in prevention and treatment of MASLD in childhood to prevent further progression.<h4>Methods</h4>This joint clinical perspective is based upon scientific evidence, peer and clinical expertise. The medical literature was reviewed via PubMed search and appropriate articles were included in this review. This work was formulated from the collaboration of eight hepatologists/gastroenterologists with MASLD expertise and two physicians from the OMA.<h4>Results</h4>The authors who are experts in the field, determined sentinel questions often asked by clinicians regarding MASLD in children with obesity. They created a consensus and clinical guideline for clinicians on the screening, diagnosis, and treatment of MASLD associated with obesity in children.<h4>Conclusions</h4>Obesity and the comorbidity of MASLD is increasing in children, and this is a medical problem that needs to be addressed urgently. It is well known that children with metabolic associated chronic disease often continue to have these chronic diseases as adults, which leads to reduced life expectancy, quality of life, and increasing healthcare needs and financial burden. The authors of this paper recommend healthy weight reduction not only through lifestyle modification but through obesity pharmacotherapy and bariatric surgery. Therefore, this guidance reviews available therapies to achieve healthy weight reduction and reverse MASLD to prevent progressive liver fibrosis, and metabolic disease.

Also flagged:PHPmetabolismbehavioralDown syndromeMR1
Journal Article 2025-02-01 No Snippets Vidva R, Raza MA, Prabhakaran J, Sheikh A, Sharp A, Ott H, Moore A, Fleisher C, Netherton H, Goldstein E, Pitychoutis PM, Nguyen TV, Sathyanesan A.
Show Full Abstract

Management of research-animal colonies is vital for lab productivity in preclinical research. Labs often rely on inefficient paper-based or spreadsheet-based methods to manage animal colonies. Dedicated software-based solutions are generally expensive and many lack remote access. Currently available open-source alternatives are difficult to implement and deploy. These solutions also do not have the capability to track ambient variables that affect colony well-being. We built <i>MyVivarium</i>, an open-source database management web application to address these gaps. MyVivarium can be easily deployed to the cloud and sustained for a cost comparable to starting and maintaining a lab website. Using MyVivarium, lab members can collaboratively track individual animals within a database. Physical identities of cages map onto the database using QR codes, enabling quick and easy record-keeping on mobile devices. Lab administrators can assign tasks to users with reminders for experiments or cage maintenance. Finally, we designed a low-cost system to sense ambient humidity, temperature, vivarium worker activity, and room illuminance. These data are then sent to MyVivarium in realtime providing information relevant to colony well-being. Taken together, MyVivarium is a novel, open-source, cloud-based application template that provides a low-cost, simple, and efficient way to digitally manage research-animal colonies.

OLFM4
Also flagged:nucleusCDmalnutritionsegmentationhematoxylinlocalization
Journal Article 2025-02-01 ✓ 1 Snippet Rudravaram G, Bao S, Krishnan AR, Remedios LW, Kim ME, Saunders AM, Liu Q, Lau KS, Roland JT, Washington MK, Coburn LA, Wilson KT, Huo Y, Landman BA.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Crohn's disease (CD) is a chronic inflammatory condition of the gastrointestinal tract characterized by alternating periods of activity and remission. This study investigates whether the cellular environments of quiescent (inactive disease) and normal tissues show similarities or differences, exploring potential residual effects from disease and tissue recovery patterns. While active CD can typically be characterized by high neutrophil density, whereas quiescent tissues present less pronounced inflammatory markers. This study leverages multiplexed immunofluorescence (MxIF) data to examine the distributions and patterns of various nuclei subtypes in quiescent versus normal tissues, aiming to determine how similar or different these tissues are in the absence of active inflammation. In our study, we analyze four tissue samples labeled as normal and five as quiescent from CD patients, as determined by a pathologist. We use rigid and deformable registration of MxIF images to analyze these tissues in a unified space and classify the nuclei into 13 subtypes. Using a KD tree, we identify the 10 nearest neighbors for each nucleus, building a combined distance-weighted neighborhood matrix representing both normal and quiescent tissues. We projected these neighborhoods into 2 dimensions using t-distributed stochastic nearest neighbor(t-SNE), clustered them, and calculated the enrichment for each subtype between normal and quiescent states within each of 20 and 40 clusters. In the 20-cluster analysis, we find monocytes enrich in one cluster and leukocytes enrich in two clusters for normal and quiescent tissues respectively. For the 40-cluster analysis, we observe monocytes, macrophages, and leukocytes enrich in one cluster each in normal tissues, and in the quiescent condition, one cluster enriched with enteroendocrine cells, and two clusters enriched with leukocytes. The results were statistically significant as determined by a chi-squared test (𝑝 < 0.01). These differences suggest a possible association with the tissue state and its microenvironment dynamics between normal and quiescent CD.

OLFM4
Also flagged:AgingCell-cycleNucleusCytoplasmcelldeath
Journal Article 2025-02-01 ✓ 1 Snippet Bao S, Wang Y, Rudravaram G, Zhang R, Deng R, Yu X, Gao C, Li J, Li Y, Roland JT, Zuo L, Liu Q, Lau KS, Coburn LA, Wilson KT, Landman BA, Huo Y.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Understanding epithelial cell aging in bowel tissue can provide critical insights into gastrointestinal (GI) health, potentially leading to improved diagnosis, treatment, and prevention strategies for various GI conditions. Despite the significance of cellular aging in the GI tract, previous studies have not quantified epithelial cell maturity development along the base-to-surface axis of colon crypts due to the labor-intensive nature of manual quantification and the lack of a clear definition of cellular age. Moreover, the process faces tremendous challenges when tissue is cut in 2D and examines results solely from one or a few biopsy cuts without reconstructing the full 3D space, as the original cell structure is 3D, leading to variability based on the cut angle. This research addresses these challenges by systematically analyzing the relationship between epithelial cell morphology and their position from the base to the surface in colon crypt tissue. Our approach involves using multiplex immunofluorescence (MxIF) imaging for cell nuclei segmentation, identifying the potential full longitudinal cut, and manually annotating the surface and base of the colon crypts. By analyzing the epithelial cells, we create density maps to investigate the relationship between nucleus size and the surface-to-base distance ratio, defining this ratio as cell age. We also examine the nucleus-to-cytoplasm (N/C) ratio in relation to cell age. For the statistical analysis, we use a robust linear regression model to remove outliers and a random effects model for the final regression. Our results show a decreasing trend in both the N/C ratio and nucleus size as epithelial cells move from the base to the surface. These findings provide a quantitative pipeline for single-cell profiling in a spatial manner, facilitating broader analysis of epithelial cell aging and its implications for GI health.

HTT
Also flagged:major depressive disorderpro-inflammatory cytokinesTNF-αIL-1βserotonin transporterindoleamine 2,3-dioxygenase
Journal Article 2025-02-01 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

…tivate serotonin transporter (5-HTT) and indoleamine 2,3-dioxygen…

…increase cytokines and5-HTTin mice.[6] The…

Show Full Abstract

No abstract available.

Also flagged:physical illnessα-amylasecortisolisomenthonelimonene
Journal Article 2025-02-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

SHISA6
Also flagged:cancerPONVpropofoldesfluraneCNTN5RBFOX1
Journal Article 2025-02-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…SNPs in theSHISA6and RBFOX1 gene…

Show Full Abstract

No abstract available.

Authorea Preprints 2025-02-01 Preprint (No Snippets API) Krishnan ST, Bansal A, Ghangas J, Sethiya NK, Kalonia H, Singh I, SINHA A.
Show Full Abstract

Huntington’s disease (HD) was initially described in 1872 by George Huntington (an American physician). HD is a progressive neurodegenerative disease characterized by chorea, cognitive, psychiatric and motor impairments with extreme phenotypes that include irregular circadian rhythm, weight reduction and muscle atrophy. The global distribution of this progressive neurodegenerative disease is reported to be 2.71 in 100,000 individuals. Since HD manifestations become apparent in mid or later stages of life, the individuals in their mid-life who are unaffected carriers of HD gene mutations could have passed on to their offsprings resulting in the existence of substantial population of young mutant huntington (Htt) carriers who are currently asymptomatic and undiagnosed for HD. Notably, aggregation of intracellular mutant Htt with neurotoxic outcomes is stated to be a significant hallmark of HD. Considering its genetic predictability, HD could be one of the most perceptive neurodegenerative diseases to early intervention. This makes HD as a potent model system to develop therapeutic interventions for other similar neurodegenerative diseases. Taken together, this comprehensive review is intended to cover all aspects of this fatal and dynamic autosomal dominant neurodegenerative disorder including pathogenesis, inter-correlation of various molecular signaling pathways involved in HD progression, preclinical HD animal models, various therapeutic interventions and HD associated diagnostic biomarkers.