Gene Literature Dashboard

Viewing July 2025 — 872 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← June 2025 August 2025 →
TNFSF4
Also flagged:glioblastomaGBMcancersprogrammed death-ligand 1PD-L1Gene expression
Journal Article 2025-07-31 ✓ 1 Snippet Zottel A, Šamec N, Jovčevska I.
In-Text Gene Mentions

…as CD276, TNFRSF14,TNFSF4, CD40, and TNFRSF18,…

Show Full Abstract

Glioblastoma (GBM) is one of the deadliest cancers, and the survival rate has remained low for decades. The aim of the study was the construction of the programmed death-ligand 1 (PD-L1) network, identification of its interactors and over-represented pathways, and analysis of the association between the identified genes and the immunosuppressive microenvironment of GBM. The PD-L1 network was constructed using Cytoscape and Search Tool for the Retrieval of Interacting Genes/Proteins (STRING). Over-representation analysis was performed on WebGestalt using Kyoto Encyclopedia of Genes and Genomes (KEGG), Protein ANalysis THrough Evolutionary Relationships (Panther), and Reactome Pathway Database (Reactome). Gene expression levels were examined in silico using three large datasets (The Cancer Genome Atlas (TCGA), Chinese Glioma Genome Atlas (CGGA), and Rembrandt), as well as with qPCR. The association between PD-L1 gene expression and immune cell infiltration was analyzed using the Tumor Immune Estimation Resource (TIMER 2.0) online tool. Cluster of differentiation 44 (CD44) and tumor necrosis factor superfamily member 14 (TNFSF14) were found to be significantly overexpressed in GBM compared to lower-grade glioma (LGG) and normal brain tissue. Their overexpression was associated with worse overall survival and demonstrated a strong ability to differentiate between GBM and reference brain tissue. Notably, CD44 and TNFSF14 were linked to the mesenchymal subtype of GBM and positively correlated with the presence of regulatory T cells, resting natural killer (NK) cells, and PD-L1 expression. Our findings highlight the overexpression of CD44 and TNFSF14 in GBM and their potential involvement in creating an immunosuppressive microenvironment. Unraveling the PD-L1 interaction network and its associated pathways offers the potential not only to identify novel biomarkers for GBM prognosis but also to pinpoint alternative therapeutic targets that could be more effective in overcoming the immunosuppressive hurdles inherent in GBM treatment.

Also flagged:antibodiesenvelope glycoproteinEnvbindingsomatic hypermutationantibody
Journal Article 2025-07-31 No Snippets Caniels TG, Prabhakaran M, Ozorowski G, MacPhee KJ, Wu W, van der Straten K, Agrawal S, Derking R, Reiss EIMM, Millard K, Turroja M, Desrosiers A, Bethony J, Malkin E, Liesdek MH, van der Veen A, Klouwens M, Snitselaar JL, Bouhuijs JH, Bronson R, Jean-Baptiste J, Gajjala S, Rikhtegaran Tehrani Z, Benner A, Ramaswami M, Duff MO, Liu YW, Sato AH, Kim JY, Baken IJL, Mendes Silva C, Bijl TPL, van Rijswijk J, Burger JA, Cupo A, Yasmeen A, Phulera S, Lee WH, Randall KN, Zhang S, Corcoran MM, Regadas I, Sullivan AC, Brown DM, Bohl JA, Greene KM, Gao H, Yates NL, Sawant S, Prins JM, Kootstra NA, Kaminsky SM, Barin B, Rahaman F, Meller M, Philiponis V, Laufer DS, Lombardo A, Mwoga L, Shotorbani S, Holman D, Koup RA, Klasse PJ, Karlsson Hedestam GB, Tomaras GD, van Gils MJ, Montefiori DC, McDermott AB, Hyrien O, Moore JP, Wilson IA, Ward AB, Diemert DJ, de Bree GJ, Andrews SF, Caskey M, Sanders RW.
Show Full Abstract

A protective HIV vaccine will need to induce broadly neutralizing antibodies (bnAbs) in humans, but priming rare bnAb precursor B cells has been challenging. In a double-blinded, placebo-controlled phase 1 human clinical trial, the recombinant, germline-targeting envelope glycoprotein (Env) trimer BG505 SOSIP.v4.1-GT1.1, adjuvanted with AS01<sub>B</sub>, induced bnAb precursors of the VRC01-class at a high frequency in the majority of vaccine recipients. These bnAb precursors, which target the CD4 receptor binding site, had undergone somatic hypermutation characteristic of the VRC01-class. A subset of isolated VRC01-class monoclonal antibodies neutralized wild-type pseudoviruses and was structurally extremely similar to bnAb VRC01. These results further support germline-targeting approaches for human HIV vaccine design and demonstrate atomic-level manipulation of B cell responses with rational vaccine design.

Also flagged:ADP-ribosylation-translational modificationADP-ribosyl-transferasesdiphtheria toxinART
Journal Article 2025-07-31 No Snippets Di Paola S, Grimaldi G, Corda D.
Show Full Abstract

ADP-ribosyl-transferases (ARTs) are versatile post-translational regulators. Mammalian ARTs include poly- and mono-ADP-ribosylating enzymes, which transfer ADP-ribose molecules deriving from β-NAD+ to their targets. Mono-ADP-ribosylation (MARylation), which is catalyzed by mono-ARTs such as PARP3, PARP6-PARP12 and PARP14-PARP16, tunes the activity of targets involved in fundamental cell processes and various signaling pathways, ranging from those regulating cell survival and proliferation to those modulating the cellular response to stress and viral infection. Recent advancements of techniques that enable the discovery of MARylation targets across cellular compartments have further expanded our knowledge about the physiological roles of these targets and the potential connection between MARylation and the onset of pathologies. Furthermore, increasing efforts in the development of specific drugs targeting the different MARylating PARP proteins are opening avenues for innovative pharmacological treatments. In this Review, we illustrate the cell cycle progression, intracellular membrane trafficking and cellular stress pathways regulated by mono-ART PARP proteins. We then describe what is known about the roles of MARylating PARP proteins in the context of viral infection and cancer. Finally, we discuss potential future directions towards mapping out the complex network of PARP targets and functions.

ARFGEF2
Also flagged:RBM10ascorbate peroxidase 2APEX2-RNA-binding motif protein 10degradation
Journal Article 2025-07-31 ✓ 1 Snippet Li B, Hao Y, Meng X, Wang X, Li Q, Jia R, Yang Y, Yang J, Yu B, Chen T, Zhang W, Zhang X, Wang X, Hu Q.
In-Text Gene Mentions

…Vpu, including RBM10,ARFGEF2, FAR1, and BTAF1.…

Show Full Abstract

Viral protein U (Vpu), an accessory protein of HIV-1, functions by antagonizing or hijacking various host factors to allow the virus to evade host immune surveillance and facilitate viral release. Nevertheless, there is limited understanding regarding the impact of Vpu on the biogenesis of HIV-1 RNAs. In this study, we utilized ascorbate peroxidase 2 (APEX2)-based proximity labeling techniques in combination with mass spectrometry and immunoprecipitation-mass spectrometry (IP-MS) to characterize interactions between HIV-1 Vpu and host proteins. We identified nine cellular targets of Vpu. Among these targets, our research demonstrated the interaction between Vpu and RNA-binding motif protein 10 (RBM10), which results in the degradation of RBM10 through the ubiquitin-proteasome pathway. The expression of RBM10 exerted an inhibitory effect on virus replication by binding to viral RNA and reducing the levels of incompletely spliced HIV-1 transcripts. Additionally, it promoted the transcription of various antiviral genes. The findings elucidate the role of HIV-1 Vpu in RNA replication and identify RBM10 as a novel regulator of HIV-1 transcription.IMPORTANCEA comprehensive analysis utilizing APEX2-MS and IP-MS techniques identified a total of 24 cellular targets of Vpu, three of which have been documented as restriction factors. Vpu-interacting proteins were found to be significantly enriched in pathways related to cell adhesion, RNA transport, and the spliceosome. The identification of RBM10 as a novel regulator of HIV-1 replication and infectivity, and RBM10 regulated transcription of both viral and host RNA transcripts. Vpu interacted with RBM10 and promoted its degradation through the ubiquitin-proteasome pathway.

Also flagged:malignant diseasespancreatic fistulasurgical site infectioncoagulopathycholangitisbacterobilia
Journal Article 2025-07-31 No Snippets Yang Y, Duan Y, Su C, Sheng J, Zhu L, Xie Y, Liu H, Tang N, Qiu Y, Lu C, Chen C, Mao L, Fu X.
Show Full Abstract

<h4>Background</h4>Preoperative biliary drainage (PBD) may be performed for jaundiced patients with periampullary tumors. This study aimed to evaluate the impact of PBD on biliary microbiome and perioperative complications in patients undergoing pancreaticoduodenectomy (PD).<h4>Methods</h4>This retrospective study enrolled 323 patients who underwent PD between March 2018 and March 2024. Intraoperative bile specimens were obtained for microbiological analysis of species identification and antimicrobial resistance patterns..<h4>Results</h4>PBD was performed in 191 (59.1%) of the 323 patients. Organ/space surgical site infection (SSI) (51.8% vs 37.9%, <i>p</i> < 0.001) and bacterial colonization of bile (90.6% vs 28.0%, <i>p</i> < 0.001) were significantly more frequent in patients with PBD. PBD was identified as an independent risk factor of organ/space SSI (OR = 1.837, 95% CI: 1.158-2.916, <i>p</i> = 0.010) and associated with increased contamination with polymicrobial mixed flora (47.1% vs 4.5%, <i>p</i> < 0.001), <i>K. pneumoniae</i> (23.6% vs 0.8%, <i>p</i> < 0.001), <i>E. faecalis</i> (14.1% vs 1.5%, <i>p</i> < 0.001), <i>E. faecium</i> (6.8% vs 0.8%, <i>p</i> = 0.009). This shift corresponded to higher resistance to piperacillin-tazobactam (23.1% vs 0.0%, <i>p</i> = 0.038), cefoperazone-sulbactam (25.3% vs 0.0%, <i>p</i> = 0.021), ciprofloxacin (36.1% vs 6.3%, <i>p</i> = 0.006), and levofloxacin (47.4% vs 4.8%, <i>p</i> < 0.001). Patients with positive bile culture had a significantly higher occurrence of organ/space SSI than the negative group (53.3% vs 32.7%, <i>p</i> < 0.001). <i>K. pneumoniae</i> was identified as an independent risk factor for organ/space SSI (OR = 2.636, 95% CI: 1.353-5.137, <i>p</i> = 0.004).<h4>Conclusions</h4>There were fundamental differences in the bile microbiome profile and antibiotic resistance of patients with/without PBD. These findings suggest that adjusting perioperative antibiotic regimens based on biliary culture may be warranted.

Also flagged:1,4-DiaminesphosphineiminecopperImines2-azatrienes
Journal Article 2025-07-31 No Snippets Zhou P, Zhu J, Zhang A, Nuomin H, Malcolmson SJ.
Show Full Abstract

We introduce a method for the 6,5-hydrofunctionalization of 2-azatrienes with <i>N</i>-phosphinoyl imine electrophiles under CuH catalysis to prepare 1,4-diamines bearing two stereogenic centers with excellent regio-, diastereo-, and enantiocontrol. In comparison to previously disclosed 6,3-hydrofunctionalizations of azatrienes with (Ph-BPE)CuH or (<i>t</i>-Bu-BDPP)CuH, the use of Josiphos SL-J001-1 as the supporting ligand facilitates regiodivergent introduction of the electrophile. We identify the electronic character of each phosphine of the ligand as critical to the observed regioselectivity and the utilization of an <i>N</i>-phosphinoyl group on the imine to be essential. Steric modification of the azatriene's activating group may enhance regioselectivity in challenging cases. Electronic modification of the <i>N</i>-phosphinoyl group can improve chemoselectivity to favor reductive coupling over imine reduction in several instances, a discovery that translates to couplings with other copper catalysts in forming 1,2-diamines. Experiments illustrate the delicate balance in favoring 1,4-diamine formation over all other processes and, along with density functional theory (DFT) calculations, lead us to a mechanistic proposal for this catalytic reaction.

DCC
Also flagged:microsphereswatergestationketaminexylazineisoflurane
Journal Article 2025-07-31 ✓ 1 Snippet Smolich JJ.
In-Text Gene Mentions

…first unaffected byDCC, but then increased…

Show Full Abstract

A widely held view is that an increased pulmonary arterial (PA) blood flow at birth is not triggered until the onset of lung aeration, but experimental data indicate that the non-ventilatory events of a reduction in lung liquid volume, complete fetal delivery, and umbilical cord clamping can also increase fetal PA flow. However, the effect of cord clamping strategy on the contribution of these non-ventilatory events to birth-related rises in PA flow is unknown. Accordingly, PA blood flow was measured via transit-time flow probe in anaesthetized, acutely instrumented preterm fetal lambs at baseline, after a ∼35% reduction in lung liquid volume, following complete fetal delivery, and then after (1) delayed cord clamping (DCC) preceded by ventilation lasting ∼100 s (n = 11), or (2) early cord clamping (ECC) followed by either a non-asphyxial (∼35 s, n = 10) or an asphyxial interval (∼100 s, PO2${P_{{{\mathrm{O}}_2}}}$  < 10 mmHg, n = 10) before ventilation. PA flow rose stepwise after reduction of lung liquid volume (P < 0.001) and fetal delivery (P < 0.001), as well as initial ventilation (P < 0.001) and subsequent DCC (P = 0.002). PA flow also rose after ECC (P < 0.001), with flow maintained in the non-asphyxial group, but markedly reduced to near-baseline fetal levels by pulmonary vasoconstriction in the asphyxial group (P = 0.009), before rising with ventilation (P < 0.001). Overall, non-ventilatory events cumulatively accounted for ∼30% of the fetal baseline-to-peak newborn increment in PA flow. These findings suggest that (1) non-ventilatory events substantially contribute to a perinatal rise in PA blood flow with ECC or DCC, and (2) this contribution is negated if an asphyxial level of arterial oxygenation develops after ECC. KEY POINTS: Although a widely held view is that an increased pulmonary blood flow (PBF) at birth is not triggered until onset of lung aeration, reduction of lung liquid volume, complete fetal delivery and umbilical cord clamping also increase fetal PBF. The contribution of these non-ventilatory events to birth-related rises in PBF is unknown, particularly with different cord clamping strategies. Anaesthetized preterm fetal lambs instrumented with central arterial flow probes underwent birth via delayed cord clamping (DCC) preceded by ventilation, or early cord clamping (ECC) followed by either a non-asphyxial or asphyxial interval before ventilation. PBF rose with reduction of lung liquid volume, fetal delivery, ECC and DCC. However, while an increased PBF after ECC was maintained with a non-asphyxial interval, it fell markedly after ECC with an asphyxial interval, before rebounding with ventilation. Cumulatively, non-ventilatory events accounted for ∼ 30% of the perinatal increase in PBF occurring with DCC or ECC birth strategies.

TNFSF4
Also flagged:NDUFB10non-small cell lung cancertumorLUADmitochondria-relatedGZMB
Journal Article 2025-07-31 ✓ 1 Snippet Zhang P, Zhang M, Liu J, Zhou Z, Zhang L, Luo P, Zhang Z.
In-Text Gene Mentions

…molecules (including ENTPD1,TNFSF4, CD80, TNFSF13B, CD86),…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is the most common subtype of non-small cell lung cancer. Although immune checkpoint inhibitors (ICIs) have brought new treatment options for advanced patients, a considerable proportion still shows limited response. Mitochondrial dysfunction plays a crucial role in tumor development and immune evasion, but its regulatory mechanisms in LUAD immune microenvironment remain unclear.<h4>Methods</h4>We integrated 149 mitochondria-related pathways (1,136 coding proteins) to develop and validate the Mitochondrial Pathway Signature (MitoPS) using machine learning approaches across seven independent LUAD cohorts (n=1,231). The system was systematically compared with 129 published LUAD prognostic signatures and validated in seven immunotherapy cohorts (n=451). Multiomics analysis, immunofluorescence staining, and experimental validation were performed to investigate its molecular mechanism.<h4>Results</h4>MitoPS demonstrated consistent predictive performance across validation cohorts, with high scores indicating poor prognosis, outperforming 129 existing prognostic models. In immunotherapy cohorts, MitoPS reliably predicted treatment response and prognosis. Immune microenvironment analysis revealed that low MitoPS scores correlated with higher immune cell infiltration and active immune function. Mechanistic studies identified mitochondria-related gene NDUFB10 as a core gene of MitoPS (r=0.38, p<0.05), where its high expression was significantly associated with immune desert phenotype and worse prognosis. Functional experiments confirmed that NDUFB10 knockdown significantly enhanced ICIs therapy and increased GZMB+CD8+T cell infiltration, indicating NDUFB10's crucial role in regulating tumor immune microenvironment and immunotherapy response.<h4>Conclusion</h4>The MitoPS scoring system reliably predicts prognosis and immunotherapy response in patients with LUAD, providing a novel reference for clinical decision-making. Furthermore, its core gene NDUFB10 regulates tumor immune microenvironment, offering a potential therapeutic target for improving immunotherapy outcomes.

Also flagged:silicahydroxyapatitecarbonphosphorusvesiclesnanotubes
Journal Article 2025-07-31 No Snippets Unabara D, Sato YK, Hamaguchi T, Yonekura K.
Show Full Abstract

Cryogenic transmission electron microscopy (cryo-TEM) enables the visualization of liquid-phase materials, including nanoparticles and soft/biomaterials, under cryogenic conditions while minimizing radiation damage. Cryo-TEM imaging provides insights into particle size, shape, and dispersion. Beyond such conventional structural information, acquiring elemental composition data allows for a more detailed analysis and evaluation. In this study, we developed a method for elemental mapping of nanoparticles and soft/biomaterials in frozen solvent by integrating electron energy loss spectroscopy (EELS) with energy-filtered (EF) cryo-EM. Cryo-EELS and analysis were performed using the three-window method, following the alignment and correction of stage drift during image acquisition and interexposure drift between different energy windows. This approach, by balancing accurate and reliable signal extraction with electron dose, enabled the generation of elemental maps for nanoparticles as small as 10 nm in frozen solvent. Furthermore, we extended the technique to protein-coated silica nanoparticles and hydroxyapatite (HAp) nanoparticles in vitrified solvent, selecting specific energy loss values to identify multiple constituent elements. As a result, we successfully mapped silica from the nanoparticle cores, carbon from the protein shell of the nanoparticles, and phosphorus and calcium─key light elements in biological systems─within the same imaging area of the HAp particles.

Also flagged:sphingolipidmetabolismmembranesmembranesignal transductioncell differentiation
Journal Article 2025-07-31 No Snippets Li T, He H, Zhang E, Hu F, Wang Z, Xu J, Zeng M, Peng B.
Show Full Abstract

Sphingolipids are essential, complex lipids that are abundant in the cell membranes of eukaryotic cells, particularly concentrated in the myelin and neuronal membranes of the central nervous system (CNS). These lipids are crucial components of the cell membrane, affecting their structure and fluidity, and thus regulating various biological processes, including signal transduction, cell differentiation, apoptosis, and autophagy. The metabolic pathways of sphingolipids are highly complex and conserved, and this metabolic process can produce multiple metabolites. Metabolites such as ceramide (Cer) and sphingosine-1-phosphate (S1P) are vital in CNS signaling, affecting neurodevelopment, myelination, and synaptic plasticity. Thus, disruption of sphingolipid metabolism is closely related to neurological disorders. This article provides the latest studies concerning the known features of sphingolipid and sphingolipid metabolism, highlighting its physiological and pathological roles in the CNS.

Also flagged:centromerestelomeresCasmetabolismCRISPRCas9
Journal Article 2025-07-31 No Snippets Park EJ, Kim H.
Show Full Abstract

CRISPR-Cas-based genome imaging opened a new era of genome visualization in living cells. While genomic loci with repetitive sequences, such as centromeres and telomeres, can be reliably imaged, applying the technique to nonrepetitive genomic loci has remained challenging. Recent advancements in the design of CRISPR RNAs and Cas proteins, the development of novel fluorophores and the combination of CRISPR-Cas with other molecular machinery amplified target-specific signals and suppressed background signals, revolutionizing this unique genome imaging technique and enabling the tracking of genomic loci with a small number of CRISPR-Cas complexes, down to a single complex. Here we review the latest advancements in CRISPR-Cas-based genome imaging techniques and their application to imaging nonrepetitive genomic loci. The challenges that these techniques are currently facing are the cellular toxicity and genomic instability induced by the expression of CRISPR-Cas and its interference with DNA metabolism, which impacts DNA replication and genome maintenance. Recently reported adverse effects of CRISPR-Cas-based genome labeling are discussed here, along with perspectives on how to overcome the problem.

NEGR1
Also flagged:Coenzymepantothenatevitamin B5pantothenate kinasePANKphosphopantothenoylcysteine synthetase
Journal Article 2025-07-31 ✓ 1 Snippet Zhang F, Dorn T, Gnutti B, Anikster Y, Kuebler S, Ahrens-Nicklas R, Gosselin R, Rahman S, Durst R, Zanuttigh E, Güra MA, Poch CM, Meier AB, Laugwitz KL, Schüller HJ, Messias AC, Sibon OC, Finazzi D, Rippert A, Li D, Truxal K, Nandi D, Lampert BC, Yeo M, Gardham A, Nissan B, Horowitz Cederboim S, Moretti A, Iuso A.
In-Text Gene Mentions

…contains exon1 ofNEGR1, which is not…

Show Full Abstract

<h4>Background</h4>PPCS deficiency disorder (PPCS DD) is an ultra-rare, autosomal recessive form of dilated cardiomyopathy (DCM) caused by pathogenic variants in PPCS, which encodes the enzyme catalyzing the second step in the coenzyme A (CoA) biosynthesis pathway. To date, only six patients worldwide have been identified.<h4>Methods</h4>Whole-exome sequencing was performed to identify pathogenic PPCS variants in affected individuals. Protein stability was assessed by Western blotting. CoA levels were quantified using a microplate-based assay in patient-derived fibroblasts, cardiac progenitor cells, and cardiomyocytes. Functional evaluation of cardiac cells and engineered heart patches was conducted to investigate contractile performance and arrhythmogenicity. Pantethine was tested as a potential therapeutic agent both in vitro and through long-term clinical follow-up in patients.<h4>Results</h4>Causative PPCS variants are identified in six individuals with DCM and variable associated features, including neuromuscular and neurological symptoms. Identified variants lead to reduced PPCS protein stability and decreased cellular CoA levels. Cardiac cells exhibit impaired contractility and arrhythmias, which are partially rescued by pantethine treatment. Clinically, patients receiving pantethine show sustained improvement over time.<h4>Conclusions</h4>Our study expands the genetic and clinical spectrum of PPCS deficiency disorder, identifying six new cases with diverse phenotypes. Functional investigations reveal reduced CoA levels and dysfunction in patient-derived cardiac cells. Pantethine treatment shows promise in partially rescuing DCM phenotypes, both in vitro and in patients. However, complete reversal may require early intervention. These findings underscore the importance of timely diagnosis and treatment in PPCS DD. Future research should focus on optimizing pantethine supplementation and exploring additional therapies to enhance CoA levels and cardiac function in affected individuals.

HFE
Also flagged:Fibrosismetabolic dysfunction associated steatotic liver diseasecardiovascular diseasesextrahepatic cancerscancerschronic kidney disease
Journal Article 2025-07-31 ✓ 1 Snippet Feng Q, Izzi-Engbeaya CN, Manousou P, Woodward M.
In-Text Gene Mentions

…sis, hepatocellular carcinoma,hemochromatosis, Wilson’s disease, biliary…

Show Full Abstract

<h4>Introduction</h4>People with metabolic-dysfunction associated steatotic liver disease (MASLD) had higher risk of extrahepatic multimorbidity, and fibrosis is the strongest prognostic factor for mortality in MASLD. This study aimed to investigate how fibrosis was associated with multimorbidity and their relationships with all-cause mortality.<h4>Methods</h4>We utilized data from the UK Biobank. MASLD was identified via a Fatty Liver Index ≥ 60 and the presence of cardiometabolic risk factors. The fibrosis-4 (FIB4) score was used to measure liver fibrosis. Multimorbidity was defined as having two or more long-term conditions (LTCs) from a prespecified list of 47 LTCs. Logistic regressions estimated the cross-sectional association between FIB4 scores and multimorbidity prevalence, while Cox models assessed the prospective association between FIB4 scores, multimorbidity and mortality.<h4>Results</h4>We included 127,470 participants with MASLD (41.7% female, age 57.4 years, 21.3% with multimorbidity, 2.2% with high FIB4 scores). 14,471 deaths were recorded during 13-year follow-up. Compared to low FIB4 scores, high FIB4 scores were associated with 41% higher prevalence of multimorbidity (OR 1.41 (95%CI 1.30-1.54)), and 94% higher all-cause mortality (HR 1.94 (95%CI 1.77-2.13)), while adjusting for multimorbidity reduced the association by 10%, primarily driven by contributions from cardiovascular diseases, extrahepatic cancers, and chronic kidney disease.<h4>Conclusion</h4>FIB4 scores were positively associated with higher multimorbidity and mortality in MASLD patients. Adjustment for multimorbidity reduced 10% the relationship between fibrosis and mortality, with cardiovascular diseases, cancers and chronic kidney disease contributing notably to this reduction. These findings underscore the importance of managing both fibrosis and multimorbidity in MASLD patients.

Also flagged:Neuroendocrine Prostate Cancercastration-resistant prostate cancerCRPCtumorandrogen receptorAR
Journal Article 2025-07-31 No Snippets Cai M, Zheng F, Ren YZ, Zhen C, Fu D, Song XL, Li Q, Qu Y, Chen ZS, Zhao SC.
Show Full Abstract

Neuroendocrine prostate cancer (NEPC), an aggressive and highly malignant subtype of castration-resistant prostate cancer (CRPC), arises through drug resistance mechanisms involving genomic alterations, epigenetic remodeling, tumor microenvironment (TME) reprogramming, and lineage plasticity. A hallmark of NEPC is its independence from the androgen receptor (AR) pathway, evidenced by diminished or absent AR expression-a key barrier to effective clinical management. Therefore, a comprehensive understanding of NEPC pathogenesis and progression is essential, as it facilitates the identification of potential therapeutic targets and the development of more effective therapies. In this review, we summarize the typical characteristics of NEPC and describe its clinical diagnosis, relevant imaging modalities, current treatment strategies, and associated therapeutic difficulties. We also highlight the core events driving NEPC formation. Furthermore, we discuss potential therapeutic targets for the disease and review pharmacological agents that have demonstrated efficacy against NEPC, aiming to offer innovative perspectives and potential research directions for future NEPC treatment.

HFE
Also flagged:Ironnuclear factor erythroid 2‐related factor 2Nrf2glutathione peroxidase 4GPX4glutathione
Journal Article 2025-07-31 ✓ 5 Snippets Nolt M, Neely E, Kheirabadi S, Jaberi A, Sheikhi A, Connor J.
In-Text Gene Mentions

…regulatory gene, H67DHFE, impacts the antioxidant…

…H67D or wild‐typeHFEgenotype to determine…

…the mechanism underlyingHFEmutation neuroprotection in…

…H67DHFEastrocytes exhibited alteratio…

…characteristics of H67DHFEastrocytes might be…

Show Full Abstract

Astrocytes play a vital role in maintaining homeostasis and function in the central nervous system, including their involvement in reparative processes. Here, we examined how a common mutation in the homeostatic iron regulatory gene, H67D HFE, impacts the antioxidant mechanism of astrocytes and migration under normal and reparative conditions. Previous data from our group suggested that this mutation may modify disease progression through an antioxidant mechanism involving nuclear factor erythroid 2-related factor 2 (Nrf2), glutathione peroxidase 4 (GPX4), and ferritin. In this study, we used primary murine astrocytes with either the H67D or wild-type HFE genotype to determine whether astrocytes contribute to the antioxidant protective mechanism previously observed. We analyzed their antioxidant profile and migration both at baseline and after a scratch wound injury. We found that H67D HFE astrocytes expressed the HFE protein and exhibited an enhanced antioxidant profile, marked by increased glutathione and GPX4 at baseline, and a reduced migration length into three-dimensional granular hydrogel scaffolds. However, following scratch wound injury, these astrocytes exhibited a shift in migratory behavior, leading to faster wound infiltration. Moreover, their antioxidant response became even more pronounced after injury, with increased expression of Nrf2, GPX4, and H-ferritin (FTH1). These results suggest that the mechanism underlying HFE mutation neuroprotection in disease processes involves an antioxidant profile in astrocytes, which is increased upon insult to activate the astrocytic reparative mechanism.

Also flagged:lung adenocarcinomapost-translational modificationsLUADtumorschromosomalLung adenocarcinomas
Journal Article 2025-07-31 No Snippets Satpathy S, Clark NM, Chen YJ, Hosseini N, Chang YH, Hsiao Y, Lei JT, Petralia F, Chen JS, Geffen Y, Heiman DI, Paul I, Cho H, Hollenberg M, Marino GB, Lin KT, Mannan R, White CJ, Allen J, Avanessian SC, Kane MH, Wolfe A, Kinarivala M, Liu W, Anand S, Lin MW, Haines M, Bergstrom EJ, Hussey G, Li GX, Mani DC, Fang H, Jaehnig EJ, Keshishian H, Miller B, Su KY, Hsiao YJ, Hsu HH, Hsieh MS, Hsu KH, Monovoukas A, Gohsman S, Thorup JR, Deng Y, Akiyama Y, Deng E, Sheng-Wen Chen E, Krek A, Espinoza R, Ma W, Charytonowicz D, Sebra R, Lin JH, Chen YS, Hsu YC, Lin ZS, Chen KC, Yeh CW, Wang YT, Lazar AJ, Mesri M, An E, Zhang X, Clauser KR, Fenyö D, Chinnaiyan AM, Zhang B, Ding L, Ruggles K, Newton C, Zhang H, Wang P, Hostetter G, Omenn GS, Kumar-Sinha C, Thiagarajan M, Govindan R, Paik P, Parolia A, Li QK, Ma'ayan A, Getz GA, Dhanasekaran SM, Robles AI, Chang GC, Yang PC, Yu SL, Chen HY, Nesvizhskii AI, Carr SA, Mani DR, Cieslik MP, Chen YJ, Gillette MA, Taiwan Cancer Moonshot Program, Clinical Proteomic Tumor Analysis Consortium.
Show Full Abstract

Lung adenocarcinomas (LUAD) are a pressing global health problem with enduring lethality and rapidly shifting epidemiology. Proteogenomic studies integrating proteomics and post-translational modifications with genomics can identify clinical strata and oncogenic mechanisms, but have been underpowered to examine effects of ethnicity, smoking and environmental exposures, or sex on this heterogeneous disease. This comprehensive proteogenomic analysis of LUAD tumors and matched normal adjacent tissues from 406 patients across diverse geographic and demographic backgrounds explores the impact of understudied driver mutations, prognostic role of chromosomal instability, patterns of immune signaling, differential and sex-specific effects of endogenous mutagens and environmental carcinogens, and pathobiology of early-stage tumors with "late-like" characteristics. Candidate protein biomarkers are proposed for unstable tumors with highly fragmented genomes and for carcinogen exposures, and a LUAD subtype-specific atlas of therapeutic vulnerabilities is presented. These observations and the associated data resource advance the objective of precision management strategies for this devastating disease.

PTGIS
Also flagged:ovarian cancerOCtumorstumorBrca1COX
Journal Article 2025-07-31 ✓ 1 Snippet Ghisoni E, Benedetti F, Minasyan A, Desbuisson M, Cunnea P, Grimm AJ, Fahr N, Capt C, Rayroux N, De Carlo F, Gulhan DC, Dagher J, Barras D, Morotti M, Marín-Jiménez JA, Chap BS, Santoro T, Spagnol G, Fleury M, Fortis K, Dorier J, Townsend MK, Tissot S, Rusakiewicz S, Ferreira HJ, Kraemer AI, Bassani-Stenberg M, Swisher EM, Kandalaft LA, Mastroyannis SA, Montone KT, Powell DJ, Banerjee S, Terry KL, Tworoger SS, Pittet MJ, Tanyi JL, Coukos G, Merritt MA, Fotopoulou C, Conejo-Garcia JR, Laniti DD.
In-Text Gene Mentions

Ptgis

Show Full Abstract

Immunotherapy has shown limited success in recurrent ovarian cancer (OC), with prognostic insights largely derived from treatment-naive tumors. We analyzed 697 tumor samples (566 primary and 131 recurrent) from 595 OC patients across five independent cohorts, capturing tumor-infiltrating lymphocytes (TILs) heterogeneity and identifying four immune phenotypes linked to prognosis and TIL:myeloid networks driving malignant progression. We found that in preclinical mouse models, mirroring inflamed human OCs, the recurrent Brca1<sup>mut</sup> tumors maintained activated TILs:dendritic cells (DCs) niches but evaded immune control through upregulation of COX/PGE<sub>2</sub> signaling. Conversely, recurrent Brca1<sup>wt</sup> tumors displayed loss of TILs:DCs niches and accumulated immunosuppressive tumor microenvironment (TME) networks featuring Trem2/ApoE<sup>high</sup> tumor associated macrophages (TAMs) and Nduf4l2<sup>high</sup>/Galectin3<sup>high</sup> malignant states. Recurrent tumors recapitulate the immunogenic landscapes of original cancers. Our findings reveal BRCA-dependent TIL:myeloid crosstalk as key to persistent immunogenicity in recurrent OC and propose new targets to enhance chemotherapy efficacy.

Also flagged:tauADdementiaAPOEanxiety
Journal Article 2025-07-31 No Snippets Aguilar-Dominguez P, Palpatzis E, Akinci M, Canal-Garcia A, Pereira JB, Bejanin A, Arenaza-Urquijo EM, Alzheimer’s Disease Neuroimaging Initiative.
Show Full Abstract

<h4>Background</h4>Psychiatric symptoms are increasingly recognized as early manifestations of Alzheimer's disease (AD). These symptoms may reflect or contribute to underlying neurobiological changes, including tau burden, which represents more advanced AD pathology. Understanding factors associated with tau burden may help identify individuals at elevated risk and improve early detection strategies.<h4>Objectives</h4>To investigate the temporal relationships between neuropsychiatric symptoms, demographic factors, and tau burden, by examining amyloid (Aβ)-dependent, -independent, and interactive associations.<h4>Design</h4>Retrospective cohort study.<h4>Setting</h4>Alzheimer's Disease Neuroimaging Initiative.<h4>Participants</h4>We included 681 participants without dementia (mean age = 71.2 years, 51.8 % female).<h4>Measurements</h4>The participants underwent tau PET scanning with prior amyloid PET and Neuropsychiatric Inventory (NPI) interview assessments clustered around three time periods relative to tau PET: closest (0 - 2 years), mid (3 - 5 years), and furthest (6 - 8 years). Linear regression analyses, adjusting for age and APOE ε4 alleles, examined associations of NPI scores, sex, education, and their Aβ-status interactions with tau burden.<h4>Results</h4>Higher total NPI scores up to 2 years prior to tau PET were associated with greater tau burden independently of Aβ status, whereas anxiety symptoms demonstrated an Aβ-dependent relationship with tau. (NPI: β=0.117, 95 % CI: 0.049 to 0.185, p=0.001, Anxiety: β=0.249, 95 % CI: 0.073 to 0.424, p=0.006). NPI measured up to 5 years prior to tau PET interacted with Aβ on tau burden (0-2 years: β=0.272, 95 % CI: 0.136 to 0.407, p<0.001, 3-5 years: β=0.336, 95 % CI: 0.127 to 0.544, p=0.002). Sex and education showed minimal associations with tau at uncorrected statistical levels.<h4>Conclusions</h4>Neuropsychiatric symptoms were associated with tau burden up to two years before tau sampling, independently of Aβ, and interacted with Aβ status up to five years prior, suggesting that neuropsychiatric symptoms are related to tau in the short term and may represent manifestations of advancing AD pathology. Demographic factors showed minimal associations. These findings highlight the importance of evaluating neuropsychiatric and anxiety symptoms as potential indicators of increased tau pathology.

HTT
Also flagged:Huntington's diseaseHDautosomal-dominant inherited neurological disorderdeathpolyphenolneurodegenerative diseases
Journal Article 2025-07-31 ✓ 2 Snippets Cisternas-Olmedo M, Urra-Alvarez V, Huerta TJ, Urbina-Muñoz V, Saavedra B, Valdés I, Riquelme E, Saez M, Pérez-Arancibia R, Delporte C, Vidal RL.
In-Text Gene Mentions

…kDa huntingtin protein (Htt).…

…effect on mutantHtt(mHtt).…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant inherited neurological disorder caused by an unstable trinucleotide CAG repeat expansion at the N-terminus of the IT-15 gene, which encodes the ∼350 kDa huntingtin protein (Htt). This mutation confers toxic properties, promoting neuronal dysfunction and death through multiple mechanisms. Effective treatments for HD are still lacking. Therefore, early-stage interventions could represent a promising approach to addressing the pathological aspects of HD. Recently, our laboratory explored the potential neuroprotective effect of murtilla (Ugni molinae, Turcz) fruit extract (ETE 19-1) in an HD cellular model and observed a significant anti-aggregation effect on mutant Htt (mHtt). In this study, we determine the beneficial effects of ETE 19-1 on HD progression in both brain and gut tissues. Our results show that a ETE 19-1 reduces motor impairment, decreases mHtt levels, and mitigates microglia activation in the striatum brain region of R6/2 mice. Moreover, we observed a reduction in gastrointestinal inflammation and an increase the gut microbiota biodiversity in R6/2 mice treated with ETE 19-1 extract. These findings highlight the impact of polyphenol-enriched natural products on the brain and gut inflammatory process during the progression of neurodegenerative diseases.

Also flagged:VP35viral protein 35pathogenesispolymerasesynthesisnucleocapsid
Journal Article 2025-07-31 No Snippets Uwase G, Leung DW, Amarasinghe GK.
Show Full Abstract

Ebola virus (EBOV) is a highly virulent non-segmented, negative-sense RNA virus and a causative agent of severe, often fatal disease in humans. EBOV encodes 7 genes and viral protein 35 (VP35) plays a key role in EBOV pathogenesis. VP35 is an EBOV polymerase cofactor that facilitates host immune evasion, viral RNA synthesis, and nucleocapsid assembly. Over the past 25 years since the first recognition that VP35 can antagonize innate immune responses, considerable progress has been made to define the molecular mechanisms by which VP35 mediates its multiple functions and interactions with host factors. Much of this work is based on our understanding of the VP35 sequence and structure as it relates to function. Here, we will provide a comprehensive review of the VP35 structure and known insights into function. Given its significant role, VP35 has also emerged as a therapeutic target for the development of countermeasures against EBOV.

Also flagged:TLR4RAGEextracellularHMGB1CD11bmacrophage scavenger receptor 1
Journal Article 2025-07-31 No Snippets I T, Kanai R, Seki M, Agata H, Kagami H, Murata H, Asahina I, Tran SD, Sumita Y.
Show Full Abstract

<h4>Introduction</h4>We recently developed a new therapy using effective-mononuclear cells (E-MNCs) and demonstrated its efficacy in treating radiation-damaged salivary glands (SGs). The activity of E-MNCs in part involves constituent immunoregulatory -CD11b/macrophage scavenger receptor 1(Msr1)-positive-M2 macrophages, which exert anti-inflammatory and tissue-regenerating effects via phagocytic clearance of extracellular high mobility group box 1 (HMGB1). Focusing on the phenomena, this study investigated significance of regulating the HMGB1/toll-like receptor 4 (TLR4)/receptor for advanced glycation end products (RAGE) signaling pathway in the treatment of SG dysfunction caused by radiation damage.<h4>Methods</h4>E-MNCs were transplanted into radiation-damaged mice SGs, and changes of TLR4/RAGE expression were observed. Furthermore, the activation of downstream signals was investigated in both intact SGs and cultured SG epithelial cells after irradiation. Subsequently, TLR4-knock-out (KO) mice were employed to examine how HMGB1/TLR4/RAGE signaling affected damage progression.<h4>Results</h4>Expression of both TLR4 and RAGE was diminished in ductal cells and macrophages/vascular endothelial cells of damaged SGs with E-MNC transplantation, respectively. Meanwhile, expression of TLR2/4 and RAGE in damaged SGs markedly increased in association with extracellular HMGB1 accumulation. Downstream signals were activated, and intranuclear localization of phospho-nuclear factor-kappa B (p-NF-KB) in ductal cells and production of IL-6, tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ) were observed. Additionally, culture supernatant of irradiated cultured SG epithelial cells contained damaged associated molecular pattern (DAMP)/senescence-associated secretory phenotype (SASP) factors. Treatment of cultured SG epithelial cells with this supernatant activated TLR4 signaling pathway and induced cellular senescence. In TLR4-KO mice, onset of radiogenic SG dysfunction was markedly delayed. However, TLR2/RAGE signalings were alternatively activated, and SG function was impaired.<h4>Conclusions</h4>Clearance of DAMPs such as HMGB1 may attenuate sterile inflammation in damaged SGs via suppression of the TLR4/RAGE signaling pathway. This cellular mechanism may have significant implications for the development of future cell-based regenerative therapies.

Also flagged:Glucose TransportersGlucosecarbonbiosynthesisfacilitative glucose transportersGLUTs
Journal Article 2025-07-31 No Snippets Szablewski L.
Show Full Abstract

Glucose is the main source of energy and the source of carbon for the biosynthesis of several molecules, such as neurotransmitters, for most mammalian cells. Therefore, the transport of glucose into cells is very important. There are described three distinct families of glucose transporters: facilitative glucose transporters (GLUTs), sodium-dependent glucose cotransporters (SGLTs), and a uniporter, the SWEET protein. Impaired function and/or expression of these transporters due to, for example, mutations in their genes, may cause severe diseases. Associations with the impaired function of glucose transporters have been described in the case of neurodegenerative diseases (NDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, GLUT1-deficiency syndrome, stroke, and traumatic brain injury. Changes in the presence of glucose transporters may be a cause of NDs, and they may be the effect of NDs. On the other hand, in many cases of neurodegenerative diseases, changes in the expression of glucose transporters may be a targeted therapy in the treatment of patients with these diseases.

OLFM4
Also flagged:S100A14diverticular diseaseadenomasGene expressioncolorectal cancerColon Cancer
Journal Article 2025-07-31 ✓ 1 Snippet Adam P, Salée C, Quesada Calvo F, Lavergne A, Merli AM, Massot C, Blétard N, Somja J, Baiwir D, Mazzucchelli G, Coimbra Marques C, Delvenne P, Louis E, Meuwis MA.
In-Text Gene Mentions

…(expressing LGR5 ,OLFM4, ASCL2 ),…

Show Full Abstract

Accounting for 15-30% of colorectal cancer cases, the serrated pathway remains poorly characterized compared to the adenoma-carcinoma sequence. It involves sessile serrated lesions as precursors and is characterized by BRAF mutations (BRAF<sup>V600E</sup>), CpG island hypermethylation, and microsatellite instability (MSI). Using label-free proteomics, we compared normal tissue margins from patients with diverticular disease, sessile serrated lesions, low-grade adenomas, and high-grade adenomas. We identified S100A14 as significantly overexpressed in sessile serrated lesions compared to low-grade adenomas, high-grade adenomas, and normal tissues. This overexpression was confirmed by immunohistochemical scoring in an independent cohort. Gene expression analyses of public datasets showed higher S100A14 expression in BRAF<sup>V600E</sup>-mutated and MSI-H colorectal cancers compared to microsatellite stable BRAF<sup>wt</sup> tumors. This finding was confirmed by immunohistochemical scoring in an independent colorectal cancer cohort. Furthermore, single-cell RNA sequencing analysis from the Human Colon Cancer Atlas revealed that S100A14 expression in tumor cells positively correlated with the abundance of tumoral CD8<sup>+</sup> cytotoxic T cells, particularly the CD8<sup>+</sup> CXCL13<sup>+</sup> subset, known for its association with a favorable response to immunotherapy. Collectively, our results demonstrate for the first time that S100A14 is a potential biomarker of serrated neoplasia and further suggests its potential role in predicting immunotherapy responses in colorectal cancer.

Also flagged:glucagon-like peptide-1 receptorGLP-1RG protein-coupled receptorGPCRmetabolic disorderstype 2 diabetes
Journal Article 2025-07-31 No Snippets Xu M, Vogel H, Yuan S.
Show Full Abstract

The glucagon-like peptide-1 receptor (GLP-1R), which belongs to the class B1 G protein-coupled receptor (GPCR) family, is an important target for treatment of metabolic disorders, including type 2 diabetes and obesity. The growing interest in GLP-1R-based therapies is driven by the development of various functional agonists as well as the huge commercial market. Thus, understanding the structural details of ligand-induced signaling are important for developing improved GLP-1R drugs. Here, we investigated the conformational dynamics of the receptor in complex with a selection of prototypical functional agonists, including CHU-128 (small molecule-biased), danuglipron (small molecule balanced), and Peptide 19 (peptide balanced), which exhibit unique, distinct binding modes and induced helix packing. Furthermore, our all-atom molecular dynamics (MD) simulations revealed atomic feature how different those ligands led to signaling pathway preference. Our findings offer valuable insights into the mechanistic principle of GLP-1R activation, which are helpful for the rational design of next-generation GLP-1R drug molecules.

Also flagged:excretionsynthesistuberculapigmentationwaterspindle
Journal Article 2025-07-31 No Snippets Glasby CJ, Biriukova O, Martin P, Dyne GR, Utevsky S, Wilson RS.
Show Full Abstract

Phylum Annelida are ubiquitous metazoans found in almost every terrestrial and aquatic habitat on Earth. Historically, taxonomic studies on the phylum have been focused largely on its majorgroups, polychaetes, oligochaetes and leeches, so that while family-level keys for each group are available, no single-source identification guide exists to the world's annelid families. Here, the first illustrated linear key to annelid families is provided and family-level descriptions and diagnoses that distinguish individuals of each family from those of other families in the phylum are updated. This information is generated from an annelid DELTA database of 334 characters and 166 mostly family-level taxa. A link is provided to downloadable software (ANNiKEY Interactive) allowing the same data to be interrogated using the open-source DELTA program Intkey, which enables both interactive identification and taxonomic query functionality. For each family-level taxon, a diagnosis, full description, links to taxonomic data at the World Register of Marine Species, illustrations of diagnostic features, and a summary of the recent literature, including a list of published keys to genera and species are provided.

Also flagged:GlucosedihydroartemisininmalariaArtemisininsdithiodipropionic acidoctadecylamine
Journal Article 2025-07-31 No Snippets Wang R, Yang J, Qiang J, Li Q, Wang G, Ping C, Liu K, Wang R, Zheng B, Ren G, Zhang S.
Show Full Abstract

Although malaria has been effectively controlled, it still poses a threat to global health. Artemisinins are the first-line antimalarial drugs. However, their therapeutic efficacy is significantly limited by poor solubility and short biological half-life. To overcome these limitations and enhance drug accumulation in <i>Plasmodium</i>, we developed a glucose-functionalized redox-responsive dihydroartemisinin (DHA) prodrug nanosystem (D@GLU-PMs-SS). The nanosystem was prepared by using DHA-dithiodipropionic acid-octadecylamine prodrug and D-α-Tocopherol polyethylene glycol 1000 succinate-arbutin conjugate. The resultant D@GLU-PMs-SS exhibited excellent stability under conditions of storage and physiological environment. D@GLU-PMs-SS could be activated by glutathione (GSH), leading to the dissociation of nanoparticles and subsequent release of free DHA. <i>In vitro</i> experiments revealed that the host erythrocyte uptake of glucose-functionalized nanoparticles was significantly enhanced <i>via</i> GLUT-mediated transport. Cellular experiments illustrated that D@GLU-PMs-SS effectively reduced GSH concentrations in <i>Plasmodium</i>. Furthermore, D@GLU-PMs-SS displayed remarkable efficacy in inhibiting the growth of <i>Plasmodium</i> while maintaining biosafety. Overall, this study developed a strategy to enhance the targeting of nanoparticles to improve their therapeutic efficacy against malaria, warranting further investigation in clinical trials.

HFE
Also flagged:Chronic Kidney Diseasecardiovascular diseasedeathInflammatory rheumatic systemic diseasesrheumatic systemic diseasessystemic lupus erythematosus
Journal Article 2025-07-31 ✓ 1 Snippet Patschan D, Marahrens B, Matyukhin I, Hansen-Nootbaar H, Safi W, Ritter O, Patschan S.
In-Text Gene Mentions

…joint manifestations ofhemochromatosis.…

Show Full Abstract

Chronic kidney disease (CKD) affects an estimated 15% of all adults in Central Europe. Those affected are at high risk of cardiovascular disease and death. Inflammatory rheumatic systemic diseases manifest themselves extra-articularly with varying frequency. This article summarized the prevalence and pathogenetic mechanisms of CKD in rheumatic systemic diseases. The following databases were searched for references: PubMed, Web of Science, Cochrane Library, Scopus. The search period spanned from 1975 to 2025. Kidney involvement is almost always present in systemic lupus erythematosus and certain types of systemic vasculitis. In the context of rheumatic diseases, there are additional mechanisms that can contribute to enhancing the functional and structural integrity of the kidneys. These mechanisms include inflammation and an increase in cardiovascular risk. The prevalence of CKD is disproportionately high in certain entities of the rheumatic form. Given the disproportionately high prevalence of CKD in relevant entities of the inflammatory rheumatic group and the associated increase in the risk of cardiovascular disease and death, CKD screening should be an integral part of the care of affected patients.

Also flagged:GolgiRas-superfamily proteinsmembranecoatsArf1Arf3
Journal Article 2025-07-31 No Snippets Dejgaard SY, Presley JF.
Show Full Abstract

Arfs are small Ras-superfamily proteins important for regulating membrane trafficking including the recruitment of vesicular coats as well as a diverse range of other functions. There are five Arfs in humans: two Class I Arfs (Arf1 and Arf3), two Class II Arfs (Arf4 and Arf5) and one Class III Arf (Arf6), with Class I and Class II Arfs present on the Golgi apparatus among other locations. These Golgi Arfs (Arf1, Arf3, Arf4 and Arf5) are highly similar in sequence, and knockout studies have established a complex pattern of redundancy, with Arf4 alone able to support cell survival in tissue culture. Moreover, adding to the complexity, functions of Arfs on distinct membranes can involve non-overlapping sets of effectors (e.g., COPI on <i>cis</i>-Golgi membranes and clathrin adaptors on <i>trans</i>-Golgi network). The three classes of Arfs are found in most metazoans, suggesting biologically important specialization the details of which are beginning to emerge. This review examines recent studies using siRNA and CRISPR/Cas9 knockouts of mammalian Arfs combined with functional assays of the secretory pathway in the context of detailed localization of fluorescently-tagged Arfs by fluorescent and super-resolution microscopy and the existing literature using more conventional techniques. We suggest that specificity of effector recruitment involves additional membrane determinants which need to be considered in future studies.

Also flagged:Tumorcancerimmune responsesCSF1RmTORSyk
Journal Article 2025-07-31 No Snippets Chen H, Xu Z, Varner J.
Show Full Abstract

Tumor immunosuppression remains a major barrier to effective cancer immunotherapy and is often driven by the immunoregulatory activities of innate immune cells, such as myeloid cells within the tumor microenvironment (TME). Myeloid populations-including tumor-associated macrophages (TAMs), dendritic cells, granulocytes, monocytes and myeloid-derived suppressor cells (MDSCs)-play pivotal roles in dampening anti-tumor immune responses and promoting tumor progression. Recent advances in our understanding of myeloid cell biology have unveiled new therapeutic opportunities to disrupt these immunosuppressive mechanisms associated with tumor inflammation. This review highlights key signaling pathways and surface molecules involved in myeloid-mediated immune suppression, including CSF1R, PI3Kγ, mTOR, Syk, MerTK/Axl, and immune checkpoints such as Trem2, LILRBs, VISTA, and CD40. We examine preclinical and clinical findings that support targeting these pathways to reprogram the TME and enhance anti-tumor immunity. By integrating insights from mechanistic studies and therapeutic development, this review underscores the potential of myeloid cell-targeting strategies as promising adjuncts to current cancer immunotherapies. Finally, we discuss future directions and challenges in translating these approaches into durable clinical benefit.

Also flagged:immunoglobulinautoimmune diseasesantiphospholipid syndromesystemic lupus erythematosuschronic inflammatory demyelinating polyneuropathymultiple sclerosis
Journal Article 2025-07-31 No Snippets McGrosso D, Raygoza J, Kumar AJ, Lam MTY, Barnes LA, Karandashova S, Perryman A, Geriak M, Odish MF, Coufal NG, Lichtenstein B, Sakoulas G, Meier A, Nizet V, Masso-Silva JA.
Show Full Abstract

<h4>Introduction</h4>Intravenous immunoglobulin (IVIG) is a therapy that uses pooled immunoglobulins from thousands of different donors. While it is primarily used to treat immunodeficiency and autoimmune diseases due to its immunomodulatory properties, IVIG has also been used as an off-label therapy for respiratory infections, including COVID-19. Clinical data regarding the efficacy of IVIG for COVID-19 has been controversial, and although some smaller studies have shown beneficial effects, others including a large randomized trial found no significant clinical impact but noted detrimental secondary effects.<h4>Methods</h4>We describe the first proteomic analysis from the plasma of COVID-19 patients treated with IVIG, as well as clinical outcomes.<h4>Results</h4>Patients that received IVIG early upon hospitalization have faster clinical improvement. Proteomic analysis showed that serum from patients with COVID-19 has increased levels of proteins associated with inflammatory responses, activation of coagulation and complement pathways, and dysregulation of lipid metabolism. IVIG therapy significantly impacted pathways related to coagulation. Given known crosstalk between coagulation and complement pathways, we also analyzed complement-related proteins. Overall, treatment with IVIG appeared to modulate coagulation (KNG1, ACTB, FGA, F13B, and CPB2) and complement (C1RL, C8G and CFD) related proteins.<h4>Discussion</h4>Our data is supported by similar findings observed in disease states other than COVID-19, where IVIG can impact coagulation and complement proteins. However, early administration seems to be critical determinants to optimize responsiveness to IVIG therapy in COVID-19.

Also flagged:fungal diseasefungal infectionsinvasive aspergillosisironmetabolisminfection
Journal Article 2025-07-31 No Snippets Baldin C, Binder U, Scheler J, Werner ER, Gsaller F, Bromley MJ, Haas H.
Show Full Abstract

Recent advancements in genetic engineering have enabled the creation of extensive mutant libraries across various species, driving the need for efficient screening methods to identify mutants of interest. In this study, we developed and optimized two rapid and straightforward screening techniques to identify genes involved in iron metabolism. Iron is an essential element for almost all organisms, and in pathogens, the ability to acquire iron from the environment and mitigate the toxic effects of intracellular iron often plays a crucial role in virulence. The first screening method exploits the autofluorescence property of porphyrins, while the second one is an optimization of growth assay on solid-agar suitable for large scale analyses. To validate these methods, we applied them to a recently published protein kinase deletion mutant library in <i>Aspergillus fumigatus</i>, a fungal pathogen that causes severe diseases in immunocompromised individuals. Our iron-specific screening approaches successfully identified strains with altered iron metabolism, including both previously known and novel mutants, generating a small set of genes that can serve as new targets for antifungal therapies. These methodologies provide the first large-scale tool for exploring iron metabolism-related genes and can be adapted for other organisms with available mutant libraries.

Also flagged:mineralironsulfurmetalsdetoxificationnitrogen fixation
Journal Article 2025-07-31 No Snippets Pradhan N, Singh S, Saxena G, Pradhan N, Koul M, Kharkwal AC, Sayyed R.
Show Full Abstract

Mineral-microbe interaction is a driving environmental changes, regulating the biogeochemical cycling of elements, and contributing to the formation of ore deposits. Microorganisms are fundamental to mineral transformation processes, exerting a profound influence on biogeochemical cycles and the bioavailability of critical nutrients required for plant growth. In this review, we delve into the various mechanisms by which microbes facilitate mineral dissolution, precipitation, and transformation, with a particular focus on how these processes regulate the availability of both macronutrients and micronutrients in soils. Essential microbial activities such as phosphate solubilization, iron chelation, and sulfur oxidation play a pivotal role in enhancing nutrient uptake in plants, thereby supporting sustainable agricultural practices and reducing dependence on chemical fertilizers. Furthermore, microbial-driven mineral transformations are vital for environmental remediation efforts, as they contribute to the immobilization of toxic metals and the detoxification of contaminated soils. By examining key microbial-mineral interactions-including nitrogen fixation, siderophore production, and metal precipitation-this review underscores the indispensable role of microorganisms in improving soil fertility, fostering plant growth, and bolstering ecosystem resilience. The exploration of these microbial processes reveals significant potential for advancing bioremediation strategies and the development of biofertilizers, offering promising solutions to enhance agricultural productivity and address environmental challenges.

OLFM4
Also flagged:16S rRNASepsisinfectionimmune responsesmultiple organ dysfunction syndromeMODS
Journal Article 2025-07-31 ✓ 5 Snippets Deng Y, Lu L, Li J, Gao L, Wang Y, Petrović N, Yang F, Li Y, Meng M.
In-Text Gene Mentions

…After blocking with 10% normal goat serum for 20 min at room temperature, sections were incubated withOLFM4(39141, CST, Danvers, MA, United States) at 4°C overnight.…

…2.4 Immunofluorescent co-staining of EdU/olfactomedin 4(OLFM4)/epithelial cellular adhesion molecule (EpCAM)…

…Therefore, we analyzed the expression of ATF4 and stemness-related markers,OLFM4and Sox9, in the intestinal tissues of septic mice.…

…Additionally, the protein levels of ATF4,OLFM4, and Sox9 in the intestinal tissues of septic mice were significantly upregulated after HSF treatment ( Figures 3C,D ).…

…of EdU/olfactomedin 4 (OLFM4)/epithelial cellular adhesion…

Show Full Abstract

<h4>Introduction</h4>Shenfu injection (SFI) is widely used in clinical severe conditions including sepsis due to its pharmacological effects of invigorating Qi and reviving Yang for resuscitation. SFI is known to alleviate sepsis-related intestinal injury. However, the underlying mechanism remains exclusive. This study aimed to investigate the regulatory role of SFI in the self-renewal of intestinal stem cells as well as gut microbiota during sepsis.<h4>Methods</h4>Plasma of septic patients was collected for detecting intestinal dysfunction markers. Mechanistic investigations were performed using immunofluorescent co-staining, Western Blotting, hematoxylin-eosin(H&E) staining, immunohistochemical (IHC) staining, TUNEL staining, Enzyme-linked immunosorbent assay (ELISA), quantitative reverse transcription-PCR (RT-qPCR) and 16S rRNA gene sequencing.<h4>Results</h4>Plasma levels of D-lactate and intestinal-type fatty acid-binding protein (I-FABP) in septic patients with intestinal dysfunction were significantly reduced following SFI administration. Compared to the control mice, sepsis induced severe mucosal damage in the intestine, including the decrease of the villus length and the number of crypts, which was significantly inhibited by SFI administration. In addition, SFI significantly reduced the levels of pro-inflammatory cytokines Interleukin 1β (IL-1β), Interleukin 6 (IL-6), and tumor necrosis factor-α (TNF-α) in septic mice. Cell proliferation and migration in the intestine were significantly increased in the intestine of septic mice upon SFI treatment. Mechanically, SFI facilitated the expression of activating transcription factor 4 (ATF4) to promote the transcription of SRY-Box Transcription Factor 9 (Sox9), thereby activating the stemness and proliferation of crypt stem cells. Moreover, the gut microbiota composition in septic mice was modulated by SFI administration. In particular, high dose of SFI (HSF) treatment was found to decrease the proportion of harmful bacteria including Proteobacteria and Escherichia-Shigella, while increase the abundance of beneficial bacteria such as Alloprevotella and Butyricimonas in septic mice.<h4>Discussion</h4>Our findings revealed that SFI protects against sepsis-induced intestinal injury via promoting the self-renewal of crypt stem cells and regulating the gut microbiota composition, providing strong evidence for the potential of SFI in treating sepsis-related intestinal dysfunction.

Also flagged:Cardiovascular diseasesAutophagyagingcardiovascular diseasecardiacregulation of
Journal Article 2025-07-31 No Snippets Scalabrin S, Cagnin S.
Show Full Abstract

Autophagy is a crucial mechanism implicated in both aging and cardiovascular disease, which are two closely interconnected conditions. Modulation of autophagy is expected to have profound impacts on cellular aging and maintenance of cardiovascular functions under physiological or pathological conditions. Consequently, modulation of autophagy could be an effective strategy for counteracting age-induced vascular and cardiac remodelling as well as alleviating cardiovascular disease. The present review comprehensively elucidates the multifaceted impacts of autophagy on aging of the cardiovascular system. We comprehensively analyse both vascular and cardiac tissues, including vascular and cardiac malignancies, in distinct contexts. We also emphasize the significance of non-coding RNAs (ncRNAs) in the epigenetic regulation of gene expression and their roles as biomarkers of cardiovascular pathologies while maintaining clear distinctions between the vascular and cardiac tissues. Preclinical and clinical models are described herein to highlight the importance of ncRNAs in disease treatment by considering their involvement in the modulation of autophagy within the cardiocirculatory system. Finally, we conducted a comprehensive meta-analysis of transcriptomic data to underscore the paramount importance of autophagy while demonstrating it as a process that is frequently dysregulated in both cardiac and vascular cells under pathological conditions. The findings presented herein emphasize the importance of investigating novel strategies for modulating autophagy as a potential therapeutic approach to the management of age-related cardiovascular disorders.

HTT
Also flagged:tauHuntington's diseaseHDneurodegenerative diseasebehavioralglutamine
Journal Article 2025-07-31 ✓ 1 Snippet Hincks JC, Stair JG, Liachko NF.
In-Text Gene Mentions

…expansions within theHTTgene cause Huntington's…

Show Full Abstract

CAG repeat expansions within the HTT gene cause Huntington's disease (HD), a devastating neurodegenerative disease characterized by progressive movement, cognitive, and behavioral symptoms. These expansions result in the expression and accumulation of neurotoxic poly-glutamine (polyQ). Disease initiation depends on the length of the expansion, with fewer than 35 repeats of polyQ typically not pathogenic, while 40 or greater repeats almost always result in HD. Longer expansions correlate with earlier onset of disease; however, there may be other factors that contribute to disease initiation or progression, particularly in individuals with repeat lengths close to or below the 40 repeat length pathogenic threshold. Aggregates of the protein tau are a frequent co-pathology in HD and may modify disease presentation. To examine relationships between tau and polyQ <i>in vivo</i> , we generated <i>C. elegans</i> co-expressing 40 repeats of polyQ (polyQ(40)) and human tau pan-neuronally. We found that co-expression of tau and polyQ(40) results in mild worsening of motility defects and increased accumulation of total and phosphorylated tau but not polyQ. These results suggest that co-morbid tau and polyQ can worsen neuronal dysfunction, and the presence of tau pathology may contribute to disease phenotypes in patients with HD, particularly individuals with repeat lengths close to the pathogenic threshold.

SOX6
Also flagged:Non-small Cell Lung Cancerlung cancerNSCLCCDK4transductiongene expression
Journal Article 2025-07-31 ✓ 1 Snippet Teh TRD, Fernandez KCJ, Cruz MKDM, Moreno PGG, Nacario RC, Completo GC, Heralde FM.
In-Text Gene Mentions

…SNAI1 MET ZEB1SOX6HOXC13 RDM1 SNAI2…

Show Full Abstract

<h4>Background and objectives</h4>Cell lines serve as invaluable tools in studying lung cancer biology and developing new therapies to combat the disease. However, commercially available cell lines are typically of Caucasian origin and may be less representative of the local genetic background. To address this, our lab previously immortalized cells from pleural fluid of a Filipino non-small cell lung cancer (NSCLC) patient via CDK4 transduction. Copy number variations (CNVs) are a type of genetic variation which may affect physiology and disease by disrupting gene function or altering gene expression, and in cancer, these may be associated with patient outcomes. CNV profiling can be valuable for understanding the biology of our immortalized cells and identifying genes that could serve as potential targets for diagnostic, prognostic, and therapeutic interventions. This study aimed to characterize previously immortalized NSCLC-derived cells, GL01, in comparison with an established lung adenocarcinoma (LUAD) cell line, A549, through whole-genome microarray-based copy number profiling.<h4>Methods</h4>DNA was extracted from GL01 and A549 cells using a commercially-available silica-based DNA extraction kit. DNA extracts were quantified and normalized for microarray analysis. Whole-genome copy number profiling was done using the OncoScan CNV Plus Assay following the manufacturer's protocols, and data was analyzed using the Chromosome Analysis Suite software. Functional analysis of genes identified to be involved in copy number aberrations was done using the PANTHER Classification System.<h4>Results</h4>Copy number aberrations span 1,592,737,105 bp in GL01 and 1,715,708,552 bp in A549, with a high degree of concordance between the two. Largescale and focal copy number aberrations previously identified to be recurrent in various LUAD cohorts were present in both GL01 and A549. Focal copy number aberrations associated with previously described lung cancer-related genes involve the PDE4D gene in GL01 and the SKIL and CDKN2A/CDKN2B genes in both GL01 and A549. PANTHER Pathway analysis of genes positively correlated with mRNA expression showed that the ubiquitin proteasome pathway was significantly overrepresented in both GL01 (FDR p = 0.000074) and A549 (FDR p = 0.000075), with 20 genes involved. Additionally, the KRAS:p.G12C/S:c.34G>T/A somatic mutation variant was detected in both GL01 and A549.<h4>Conclusion</h4>This study provides a method for identifying potentially clinically-relevant genes associated with a sample's copy number aberrations and the pathways they represent, providing personalized mechanistic, prognostic, and therapeutic insights into the cancer biology of our cells.

Also flagged:Gastric Cancerantibodycytotoxin-associated gene ACatalaseouter membrane proteinOMP
Journal Article 2025-07-31 No Snippets Rao W, Xue C, Gan D, Liu B.
Show Full Abstract

Background Although <i>Helicobacter</i> <i>pylori </i>infection is a primary risk factor for gastric cancer (GC), the specific bacterial components that causally drive carcinogenesis remain poorly understood. Traditional epidemiological studies are limited by confounding variables and the potential for reverse causation. This study aimed to dissect the causal effects of host antibody responses to various <i>H. pylori</i> antigens on GC risk using Mendelian randomization (MR). Methodology We conducted a two-sample MR study using summary statistics from large-scale genome-wide association studies (GWAS) of European-ancestry populations. Genetic instruments were selected for general <i>H. pylori</i> seropositivity and antibody levels against six antigens: cytotoxin-associated gene A (CagA), Catalase, GroEL, outer membrane protein (OMP), urease subunit A (UreA), and vacuolating cytotoxin A (VacA). The primary outcome was GC. Inverse-variance weighted (IVW) MR served as the main analysis, with comprehensive sensitivity analyses to assess the robustness of results. Multivariable MR (MVMR) was used to estimate the direct effects of each serotype, and a two-step mediation analysis was performed to explore potential mediating pathways. Results Genetically predicted general <i>H. pylori</i> seropositivity was causally associated with an increased risk of GC (odds ratio (OR): 1.12, 95% confidence interval (CI): 1.01-1.24; <i>P </i>= 0.027). The host antibody response to OMP showed a stronger causal effect (OR: 1.19, 95% CI: 1.08-1.30; <i>P </i>< 0.001). In contrast, no causal effects were observed for antibody responses to the classic virulence factors CagA or VacA (<i>P</i> > 0.05). In multivariable analysis, the effect of the anti-OMP response remained robust (OR: 1.18, 95% CI: 1.07-1.30; <i>P </i>= 0.001), while the association for general seropositivity was attenuated to null. Mediation analysis implicated tumor necrosis factor ligand superfamily member 18 (TNFSF18) as a potential mediator of the <i>H. pylori</i>-GC pathway, accounting for a substantial portion of the total effect (estimated at 47.0%), though this finding did not reach statistical significance (<i>P </i>= 0.077). Conclusions This MR study provides genetic evidence that the host immune response to <i>H. pylori</i> OMPs, rather than to classic virulence factors like CagA, is a key contributor to gastric carcinogenesis. This effect appears to be partially mediated by the inflammatory TNFSF18 pathway, suggesting that the chronic host-bacterial interactions at the gastric epithelial surface are critical to malignant transformation.

Also flagged:cognitiondopaminepsychiatric disordersPDaldehyde dehydrogenase 1A1ALDH1A1
Journal Article 2025-07-31 No Snippets Cai H, Gerfen C.
Show Full Abstract

No abstract available.

bioRxiv 2025-07-31 Preprint (No Snippets API) Bragg RM, Landles C, Smith EJ, Osborne GF, Cantle JP, Bates GP, Carroll JB.
Show Full Abstract

<h4> Abstract </h4> Huntington’s disease (HD) arises from the toxic gain of function caused by a CAG expansion in the coding region of the HTT gene. HD is increasingly appreciated to emerge from multiple pathogenic processes, including somatic instability in mutant HTT’s ( mHTT ) CAG repeat tract, which leads to diverse deleterious consequences. These include the alternative processing of HTT pre-mRNA to generate the HTT1a transcript that encodes the very toxic, mHTT isoform referred to as HTT1a. We set out to compare the efficacy and safety of allele-selective lowering of mHTT compared to non-allele-selective lowering using antisense oligonucleotides (ASOs) in heterozygous Htt Q111 (Q111) mice. We developed a mutant specific ASO (MutASO) targeting Htt intron-1 that selectively reduced mutant full-length HTT, as well as HTT1a, in the brains of Q111 mice. Compared to the rescue provided by a pan-allele-targeting ASO (PanASO) that lowers wild-type HTT and full-length mHTT (sparing HTT1a), the MutASO essentially eliminated aggregate formation, and provided marked protection from transcriptional dysregulation in HD knock-in mice. Thus, by targeting the ASO to the region upstream of the cryptic polyadenylation sites required to generate the HTT1a transcript, our allele-selective MutASO potently reduced HTT1a protein levels. Here, our findings advocate that HTT1a may have a disproportionate impact on aggregate formation and transcriptional dysregulation and that lowering the levels of HTT1a could provide benefit when designing HTT-lowering based therapeutic strategies for HD.

Preprints.org 2025-07-31 Preprint (No Snippets API) Tekin Neijmann S, Gunes D, Karaca M, Karaman V, Balci MC, Gokcay GF, Gedikbasi A.
Show Full Abstract

Fibroblast growth factor 21 (FGF21), a pleiotropic hormone, is a significant modulator of energy homeostasis. We evaluated serum FGF21 levels in patients with a deficiency of mitochondrial aminoacyl t-RNA synthetase (aARSs). Six patients with mitochondrial aminoacyl tRNA synthetase deficiency and twelve healthy volunteers were included in this study. Whole-exome sequencing was used for molecular diagnosis. Serum FGF21 levels in the case group and healthy volunteers were analyzed using the enzyme-linked immunosorbent assay. Exome sequencing test revealed nine different pathogenic variants in the AARS2, EARS2, DARS2, SARS2, and WARS2 genes. A statistically significant difference was found between the serum FGF21 levels of the case and control groups: case group (n = 6), 882.49 ± 923.60 pg/mL; control group (n = 12), 20.89 ± 2.63 pg/mL (p &lt; 0.001). The area under the ROC Curve for FGF21 in the differential diagnosis of mitochondrial aminoacyl-tRNA Synthetase Deficiency was 0.933 (0.786-0.962). Sensitivity and Specificity 100%, Positive and Negative Predicted Value 100% were found for FGF21 &gt;27.4 pg/mL cut-off value. Assessment of FGF 21 levels as an indicator of mitochondrial damage in mt-aARS deficiency may provide insight into the level of damage. Investigating the biochemical mechanisms underlying the varying levels of damage caused by different aminoacyl tRNA synthetases is crucial for elucidating clinical heterogeneity.

bioRxiv 2025-07-31 Preprint (No Snippets API) Hanson B, Svrzikapa N, Feng N, Friedrichsen HJ, Lennaárd AJ, Abuhamdah R, Hemmer N, Chwalenia K, Drake M, Jad Y, Andaloussi SE, Wood MJ, Roberts TC.
Show Full Abstract

Upstream open reading frames (uORFs) are short translated regions that occur in the 5□ untranslated regions (5□ UTRs) of mRNA transcripts where they primarily serve to repress expression translation of the downstream primary open reading frame (pORF). Their widespread presence across mammalian transcriptomes suggests an important role in shaping the proteome, although the mechanistic basis of their regulatory effects remain incompletely understood. Here we present an integrated experimental and computational investigation into the features that govern uORF-mediated translation control. Using high-resolution proteomics data from 29 healthy human tissues and machine learning-based simulations, we have systematically dissected how features including uORF length, amino acid composition, start codon position, stop codon position, and Kozak context influence repressive activity, and performed experimental validation using reporter gene constructs. We also investigated how multiple uORFs within a single 5□ UTR can interact in synergistic or antagonistic ways, with the potential to produce counterintuitive effects on pORF translation. From these studies, we present a model of uORF function, suggesting a hierarchy of uORF feature importance, and proposing that a combination of uORF translation initiation probability, ribosome recycling rate, intercistronic ternary complex recharging requirements, and ribosome stalling mechanisms underlie uORF repressive activity. Together, these studies provide a comprehensive view of the molecular logic underlying uORF activity, offering new insights into their endogenous and highlighting their potential as targets for drug development.

Also flagged:diabetesdiabetic neuropathyribosomeGCN2GCN2 kinasemethylglyoxal
Journal Article 2025-07-30 No Snippets Meyer AR, García G, Mikesell AR, O'Flanagan S, Stucky CL, Campbell ZT.
Show Full Abstract

<h4>Abstract</h4>Neuropathic pain is pervasive among people with diabetes. The integrated stress response (ISR) is a key mechanism of translational regulation implicated in diabetic pain. In this study, we demonstrate that a reactive glycolytic metabolite, methylglyoxal (MGO), which is strongly associated with painful diabetic neuropathy, activates the ISR through the kinase general control nonderepressible 2 (GCN2). Methylglyoxal disrupts elongating ribosomes, triggering the recruitment of ribosome quality control factors and collision sensors. GCN2 activation by MGO requires the ribosomal P-stalk, a critical sensor for elongation factors. Moreover, neuronal sensitization and mechanical allodynia produced by MGO are GCN2-dependent. Overall, this study links ribosomal elongation dysfunction to metabolic pain and identifies GCN2 as a novel analgesic target for diabetic neuropathy.

HFE
Also flagged:pathogenesistype 1 diabetestype 2 diabetesobesityinsulin resistanceautoimmune disease
Journal Article 2025-07-30 ✓ 1 Snippet Aamodt KI, Powers AC.
In-Text Gene Mentions

…fibrocalculous pancreatopathy,hemochromatosis, surgery or trauma,…

Show Full Abstract

Type 1 diabetes is characterised by the autoimmune destruction of pancreatic β-cells, leading to an absolute or near-absolute insulin deficiency. Although traditionally associated with childhood onset, it can manifest at any age, and it is increasingly recognised that there is significant heterogeneity in its clinical presentation. This review examines the intricate interplay between genetic susceptibility, environmental factors, and autoimmune mechanisms that contribute to the pathogenesis of type 1 diabetes. The role of clinical phenotype, along with diagnostic and clinical measurements of autoantibodies and C-peptide, in the classification of type 1 diabetes is discussed, alongside the challenges in diagnosing and classifying the disease. Emerging insights from studies into the heterogeneity of type 1 diabetes phenotypes and mechanistic endotypes underscore the need for refined diagnostic criteria, particularly in identifying autoimmunity in individuals initially diagnosed with type 2 diabetes. The impact of obesity and insulin resistance on disease progression and clinical management is also examined. Overall, this review aims to provide a comprehensive understanding of the evolving landscape of type 1 diabetes, highlighting critical areas for future research and potential therapeutic approaches tailored to individual patient profiles. PLAIN LANGUAGE SUMMARY: Type 1 diabetes is an autoimmune disease where the body does not produce insulin, leading to high blood sugar levels. Traditionally thought to start in children and young adults, type 1 diabetes can occur at any age. However, many factors contribute to when someone develops type 1 diabetes and how rapidly the disease progresses, including a person's combination of genetic factors, including specific genes that can either be protective or high-risk for the development of type 1 diabetes. Although it is widely assumed that a triggering event or events initiate the autoimmune process, the trigger or triggers remain unknown. However, it is this autoimmune process that causes progressive destruction of insulin-producing Β-cells in the pancreas that eventually leads to high blood sugar and the diagnosis of diabetes. Although we have several tools to diagnose and classify diabetes, including measuring autoimmune markers (antibodies) in the blood, there is significant variation in how individuals with type 1 diabetes can present, which can make recognizing and appropriately treating type 1 diabetes more challenging. Finding better ways to characterize the unique characteristics of each subgroup of individuals may provide new insights into how we can best tailor treatment to each of these patient groups.

HTT
Also flagged:translationalneurodegenerative diseasesgene expressionregulation ofRNA-binding proteinstranscription factors
Journal Article 2025-07-30 ✓ 1 Snippet Xu J, Hörner M, Atienza EB, Manibarathi K, Nagel M, Hauser S, Admard J, Casadei N, Ossowski S, Schuele R.
In-Text Gene Mentions

…disease (HD), theHTTgene produces multiple…

Show Full Abstract

Long-read RNA sequencing has transformed transcriptome analysis by enabling comprehensive mapping of full-length transcripts, providing an unprecedented resolution of transcript diversity, alternative splicing and transcript-specific regulation. In this study, we employed nanopore long-read RNA sequencing to profile the transcriptomes of three cell types commonly used to model brain disorders, human fibroblasts, induced pluripotent stem cells and stem cell-derived cortical neurons, identifying extensive transcript diversity with 15 072 transcripts in stem cell-derived cortical neurons, 13 048 in fibroblasts and 12 759 in induced pluripotent stem cells. Our analyses uncovered 35 519 differential transcript expression events and 5135 differential transcript usage events, underscoring the complexity of transcriptomic regulation across these cell types. Importantly, by integrating differential transcript expression and usage analyses, we gained deeper insights into transcript dynamics that are not captured by gene-level expression analysis alone. Differential transcript usage analysis highlighted transcript-specific changes in disease-relevant genes such as <i>APP</i>, <i>KIF2A</i> and <i>BSCL2</i>, associated with Alzheimer's disease, neuronal migration disorders and degenerative axonopathies, respectively. This added resolution emphasizes the significance of transcript-level variations that often remain hidden in traditional differential gene expression analyses. Overall, our work provides a framework for understanding transcript diversity in both pluripotent and specialized cell types, which can be used to investigate transcriptomic changes in disease states in future work. Additionally, this study underscores the utility of differential transcript usage analysis in advancing our understanding of neurodevelopmental and neurodegenerative diseases, paving the way for identifying transcript-specific therapeutic targets.

Also flagged:aerosolinfectiontuberculosisTBpulmonary granulomagranulomas
Journal Article 2025-07-30 No Snippets Gern BH, Klas JM, Foster KA, Kanagy ME, Cohen SB, Plumlee CR, Duffy FJ, Neal ML, Halima M, Gustin AT, Stull SM, Wilson JJ, Diercks AH, Aderem A, Gale M, Aitchison JD, Gerner MY, Urdahl KB.
Show Full Abstract

Pulmonary Mycobacterium tuberculosis (Mtb) infection results in a variety of heterogeneous lesion structures, from necrotic granulomas to alveolitis, but the mechanisms regulating their development remain unclear. Using a mouse model of concomitant immunity and subsequent aerosol infection, we demonstrate that counter regulation between neutrophils and CD4 T cells occurs very early during infection and governs these distinct pathologies. In primary Mtb infection, a dysregulated feed-forward circuit of neutrophil recruitment occurs, in which neutrophils hinder CD4 T cell interactions with infected macrophages, cause granuloma necrosis, and establish a replicative niche that drives a two-log increase in lung bacterial burden. Conversely, the rapid recruitment and activation of T cells due to concomitant immunity promotes local macrophage activation and dampens detrimental neutrophil responses. Together, these studies uncover fundamental determinants of tuberculosis lung pathology, which have important implications for new strategies to prevent or treat tuberculosis.

DCC
Also flagged:axonscytokinesisciliogenesisgrowth conesorganizationinterphase
Journal Article 2025-07-30 ✓ 1 Snippet Miller KE, Oprea F, Alam S, Grodsky A, Craig EM.
In-Text Gene Mentions

…for example, the Netrin–DCCpathway, allowing extracellula…

Show Full Abstract

Although synaptic evolution has been extensively studied, how axons first arose remains unexplored. Because evolution often occurs by coopting existing features, we review the evolutionary histories, biophysics, and cell biology of cytokinesis, cell crawling, and ciliogenesis to explore the origin of axons. Although we found that cilia and axons are outwardly similar, and growth cones strongly resemble the leading edge of crawling cells, the biophysical processes and the critical proteins that drive each seem weakly linked to axons as a structure. In contrast, the traction force machinery that pulls daughter cells apart during cytokinesis and the cytoskeletal organization of cytokinetic bridges appear to have a one-to-one correspondence to neuronal growth cones and axons. Based on these observations, we propose the hypothesis that axons evolved due to mutations that partially activated cytokinesis in an interphase cell. To rigorously test this hypothesis, we suggest conducting systematic phylogenetic analysis of the genes essential for each process, paired with molecular genetic studies in which critical genes are systematically disrupted. Doing so will provide a framework for understanding the relationship between diverse cellular processes, the early evolution of neurons, and insights that could potentially assist in treating cancer and promoting neuronal regeneration.

SOX6
Also flagged:NPC1CholesterolHedgehogglycosphingolipidslysosomesmembrane
Journal Article 2025-07-30 ✓ 2 Snippets Nair SV, Jaimon E, Adhikari A, Nikoloff J, Pfeffer SR.
In-Text Gene Mentions

…a subset of Aldh1a1/Sox6+ neurons that…

…og signaling to Anxa1/Aldh1a1/Sox6+ neuronal vulnerability.…

Show Full Abstract

Parkinson's disease is characterized by loss of dopamine neurons that project to the dorsal striatum, and mutations in <i>LRRK2</i> and <i>GBA1</i> are the most common genetic causes of familial Parkinson's disease. Previously, we showed that pathogenic <i>LRRK2</i> mutations inhibit primary cilia formation in rare interneurons and astrocytes of the mouse and human dorsal striatum. This blocks Hedgehog signaling and reduces synthesis of neuroprotective GDNF and NRTN, which normally support dopamine neurons vulnerable in PD. Here, we show that <i>GBA1</i> mutations also impair Hedgehog signaling and Hedgehog-dependent neuroprotective factor production by a distinct mechanism. Loss of GBA1 activity increases lysosomal accessible cholesterol and thus decreases accessible cholesterol in primary cilia of cultured cells; this change in lipid composition blocks ciliary Hedgehog signaling that depends on accessible cholesterol. Consistent with defects in Hedgehog signaling in the mouse dorsal striatum, <i>GBA1</i> mutant mice show reduced Hedgehog-induced <i>Gdnf</i> RNA expression in striatal cholinergic interneurons, with no detectable impact on cilia formation. Also, both <i>LRRK2</i> and <i>GBA1</i> mutations suppress Hedgehog-induced <i>Bdnf</i> expression in striatal astrocytes. These findings underscore the role of Hedgehog signaling in the nigrostriatal circuit and reveal a convergent mechanism by which distinct <i>LRRK2</i> and <i>GBA1</i> mutations may contribute to PD pathogenesis.

Also flagged:cancerbreast cancercancerstumormetastatic breast cancertumors
Journal Article 2025-07-30 No Snippets Yakavets I, Kheiri S, Cruickshank J, Hickman RJ, Rakhshani F, Aldeghi M, Rajaonson EM, Young EWK, Aspuru-Guzik A, Cescon DW, Kumacheva E.
Show Full Abstract

Combination therapies enhance the therapeutic effect of cancer treatment; however, identifying effective interdependent doses, durations, and sequences of multidrug administration regimens is a time- and labor-intensive task. Here, we integrated machine learning, automation, and large microfluidic arrays of cancer spheroids or patient-derived organoids formed in a tissue-mimetic hydrogel to achieve notable acceleration of the discovery of effective multidrug administration regimens. For the clinically approved drug combination, we found a sequential administration regimen leading to a substantial reduction in the total drug dose, in comparison with concurrent drug supply, both at comparable drug efficacy. For the drugs that are currently under clinical development, we found a synergistic effect of concurrently administered drugs and showed that the synergy diminishes for the sequential drug supply. The developed strategy holds promise for the discovery of effective combination therapies for advanced cancer treatment, including personalized chemotherapies.

PRDX6
Also flagged:cross-presentationtumorimmune responsesdegradationantigen presentationgold
Journal Article 2025-07-30 ✓ 1 Snippet Wang Z, Zhou H, Su Q, Qiu Q, Deng W, Zhang M, Xu Z, Li J, Xiao J, Duan X.
In-Text Gene Mentions

…, Prdx4 ,Prdx6, Tpi1 ,…

Show Full Abstract

In situ tumor vaccines have immense potential for immunotherapy because they generate whole tumor-derived antigens (TDAs) to activate antitumor immune responses. However, the rapid degradation and clearance of the released TDAs severely hinder subsequent antigen presentation and the final efficacy of the in situ vaccine. Here, we synthesized gold nanoxanthium coated with polydopamine (AuNX-PDA) to mimic the morphological and biological adhesion properties of xanthium and mussels, respectively. AuNX-PDA facilitated effective absorption of released TDAs after near-infrared II photothermal treatment and delivery of the absorbed TDAs to the endoplasmic reticulum and Golgi apparatus of dendritic cells for cross-presentation, thereby activating CD8<sup>+</sup> T cells for efficient tumor-specific immunity. The nanovaccine (NV) significantly inhibited irradiated primary tumors and nonirradiated distant tumors by producing robust antitumor immune responses in B16F10 melanoma and 4T1 breast cancer mouse models. These findings highlight the potency of morphology- and adhesion-dual biomimetic NVs in whole-tumor vaccine therapy.

OLFM4
Also flagged:congenitalintestinal obstructionHirschsprung-associated enterocolitisHSCRobstructionLeucine
Journal Article 2025-07-30 ✓ 5 Snippets Zhang Z, Lee D, Liu L, Xiong Y, Lee C, Kim JE, Chusilp S, Lau E, Tian Y, Feizi M, Alganabi M, Lafreniere A, Cheng T, Zhou R, Han L, Wu L, Xiao P, Gao Y, Benedetti G, Holland L, Tullie L, Giobbe GG, Li L, Li Q, Yamataka A, Li VSW, De Coppi P, Jiang Q, Pierro A, Li B.
In-Text Gene Mentions

…markers (CLU, LGR5,OLFM4) ( Fig. 3A-B…

…the LGR5+ andOLFM4+/LGR5low population ( Fig.…

…emergence of theOLFM4+ population, and OLFM4+/FABP1…

…OLFM4+ population, andOLFM4+/FABP1.…

…7 ), andOLFM4is broadly expressed…

Show Full Abstract

Hirschsprung disease (HSCR) is a congenital condition characterized by the improper migration of enteric neural crest cells, leading to aganglionosis most commonly in the rectosigmoid colon. This severe and life-threatening disorder often results in the development of Hirschsprung-associated enterocolitis (HAEC), which can occur either before or after surgical resection of the affected bowel segment. Using colonic tissue from patients with HSCR alongside the well-established endothelin receptor B knockout mouse model, we investigated epithelial regeneration dynamics and stromal-epithelial cross-talk in the distal ganglionic colon, a critical site for HAEC development. In individuals with HSCR but without epithelial damage, the distal ganglionic colon displayed impaired epithelial regeneration and alteration of intestinal stem cell dynamics, characterized by the reduction of leucine-rich repeat-containing G protein-coupled receptor 5 (LGR5<sup>+</sup>) epithelial stem cells. This phenomenon was consistent in the mouse model, where impaired regenerative ability preceded HAEC when epithelial damage occurred on site. Patients with HSCR also exhibited remodeling in stromal cells in this distal ganglionic colon region, with fewer primary sources of Wingless-related integration site (Wnt) signal-releasing stromal cells and the exclusive presence of proinflammatory (matrix metalloproteinase 1<sup>+</sup>) stromal cells. Stromal cells from the HSCR distal ganglionic colon failed to sustain the growth of colonic organoids. However, ibuprofen suppressed the proinflammatory stromal cells, leading to effective restoration of epithelial organoid growth. These observations underscore the crucial role of impaired stromal-epithelial cross-talk in HSCR and the pathogenesis of HAEC and suggest potential therapeutic targets for the prevention or treatment of the condition.

HFE
Also flagged:Congenital dyserythropoietic anemia type Idisorder oferythropoiesismacrocytic anemiaironanemia
Journal Article 2025-07-30 ✓ 2 Snippets Asleh M, Khalaila A, Eshel Y, Al-Athamen K, Kapelushnik J, Miskin H.
In-Text Gene Mentions

…iron secondary tohemochromatosisinduces lipid oxidation…

Hemochromatosis, chronic hemolysis, and…

Show Full Abstract

<p>Introduction: Congenital dyserythropoietic anemia type I (CDA-I) is a rare disorder of erythropoiesis. All CDA-I patients are expected to have iron overload and chronic hemolysis. Patients with severe anemia may undergo splenectomy. Hemochromatosis, chronic hemolysis, and splenectomy are all found to increase risk for thromboembolism in thalassemic patients. As CDA-I patients have similar findings, we sought to evaluate prevalence of thromboembolic events (TEEs) in these patients.<h4>Methods</h4>A retrospective case-control study was conducted, including 110 CDA-I patients (study group) and 326 age- and sex-matched iron deficiency anemia patients of the same ethnicity (control group). Patients were risk-stratified using Risk Assessment Models for thromboembolism.<h4>Results</h4>We identified 3 cases (2.7%) with TEEs in the CDA group and 1 case (0.3%) in the control group. All patients were females. VTE risk scores were low to moderate for CDA patients and higher for IDA patient. When compared to control group, CDA-I patients were nine times more likely to develop TEE (OR 9.11, 95% CI = 1.15-185.27, p = 0.057). All 3 CDA patients had a history of remarkable hemolysis and iron overload. Two underwent splenectomy.<h4>Conclusion</h4>These findings show that CDA patients appear to be at increased risk for TEEs. </p>.

Also flagged:Olig2Emx1synapselocalizationstranscription factorneurogenesis
Journal Article 2025-07-30 No Snippets Zhou J, Vitali I, Roig-Puiggros S, Javed A, Cantando I, Puglisi M, Bezzi P, Jabaudon D, Mayer C, Bocchi R.
Show Full Abstract

Astrocytes are not a uniform population but exhibit diverse morphological, molecular, and functional characteristics. However, how this diversity originates and becomes establishes during development, remains largely unknown. Here, using single-cell RNA sequencing and spatial transcriptomics, we identify five astrocyte subtypes with unique molecular features, spatial distributions and functions in the mouse neocortex and characterize essential regulators for their formation. Using TrackerSeq to trace clonally related astrocytes, we identify two distinct lineages that give rise to these five subtypes. One lineage derives from Emx1<sup>+</sup> radial glial cells that initially generate neurons and later switch to astrocyte production. The other, with minimal neuronal output, predominantly produces a distinct subset of astrocytes marked by Olig2. Olig2 knockout disrupts lineage specification, leading to changes at molecular, morphological and functional levels. These findings shed light on the cellular mechanisms underlying astrocyte diversity, highlighting the presence of multiple radial glial cell subtypes responsible for generating cortical astrocyte subtypes.

HTT
Also flagged:transporterscognitionbindingModafinilneuroreceptorsneuropsychiatric disorders
Journal Article 2025-07-30 ✓ 2 Snippets Nakuci J, Bansal K.
In-Text Gene Mentions

…5-HT2A, 5-HT4, 5-HT6, 5-HTT), acetylcholine (α4β2, M1,…

…5-HT2A, 5-HT4, 5-HT6,5-HTT), acetylcholine (α4β2, M1,…

Show Full Abstract

Determining the neuromodulators driving brain activity is critical for understanding cognition and neuropathology. Neuromodulators act through neuroreceptors in a coordinated manner, yet their interconnected dynamics are often overlooked. We show that a neuroreceptor-based modeling framework using cortical density maps of 19 neuroreceptors and transporters from Positron Emission Tomography (PET) can model BOLD-derived brain activity. This framework reconstructs activity across four datasets (N = 314) identifying two neuroreceptor modules linked to higher-order associative or somatomotor and visual networks. Applying the framework to independent datasets, we recover the binding profiles of LSD and Modafinil, demonstrating consistency with known pharmacological and neurobiological associations. Additionally, it uncovered associations between neuroreceptors, transporters, and altered brain activity in neuropsychiatric disorders. These findings demonstrate the framework's potential to elucidate neuromodulatory mechanisms and advance our understanding of brain function across diverse states and conditions.

SLC2A14
Also flagged:TNFautism spectrum disorderJAK3CUL2CARD11TNFSF10
Journal Article 2025-07-30 ✓ 1 Snippet Nour-Eldine W, Ltaief SM, Ouararhni K, Abdul Manaph NP, de la Fuente A, Bensmail I, Abdesselem HB, Al-Shammari AR.
In-Text Gene Mentions

…RORA, CASP8, DIABLO,SLC2A14, TRIM29, PTPRK, ZBTB16,…

Show Full Abstract

Peripheral immune dysregulation is frequently reported in autism spectrum disorder (ASD); however, the underlying molecular mechanisms remain unclear. We recruited a well-defined cohort of young Arab children with ASD, aged 2-4 years, along with matched controls in Qatar. Using a multimodal approach, we integrated transcriptomic, proteomic, and single-cell RNA-seq data analyses from this cohort. Targeted transcriptomic profiling identified differential expression of 50 immune-related genes in the circulating PBMCs of children with ASD, three of which (JAK3, CUL2, and CARD11) negatively correlated with ASD symptom severity. These gene signatures were validated in independent studies using blood and brain tissues from individuals with ASD. Enrichment analysis revealed involvement of these genes in immune function, particularly through TNF signaling pathway. Proteomic analysis highlighted disrupted TNF signaling and upregulated levels of TNFSF10 (TRAIL), TNFSF11 (RANKL), and TNFSF12 (TWEAK) in plasma of individuals with ASD. Single-cell RNA-seq revealed that B cells, CD4 T cells, and NK cells potentially contributed to these upregulations in ASD. Dysregulated TRAIL, RANKL, and TWEAK signaling pathways were specifically observed in CD8 T cells, CD4 T cells, and NK cells of individuals with ASD. These findings provide new insights into immune dysregulation mechanisms in ASD and highlight potential therapeutic targets.

Also flagged:butyric acidfermentationlactic acidpropionic acidestersterpenoids
Journal Article 2025-07-30 No Snippets Jiajie Z, Xiaochen D, Junfeng H, Mingjiu W, Gentu G.
Show Full Abstract

<h4>Background</h4>Oat silage is a key feed source in animal husbandry due to its high nutritional value and adaptability. However, off-flavors caused by butyric acid fermentation significantly reduce its quality, with Clostridium bacteria being the main cause. The mechanisms underlying microbiota dynamics and volatile metabolite interactions remain unclear. In this study, we integrated microbial sequencing and metabolomics to analyze the key microorganisms and metabolic pathways involved in off-flavor formation, aiming to provide a theoretical basis for optimizing the fermentation process.<h4>Results</h4>The pH of the off-flavor group (UO) increased to 5.90, with reduced lactic acid content and elevated butyric acid and propionic acid. Nutritional analysis showed increased neutral detergent fiber and acid detergent fiber in the UO group, along with a decline in crude protein, indicating hindered fiber decomposition and increased nutrient loss. Microbial community analysis revealed decreased Lactobacillus spp. abundance, increased Clostridium spp. and Enterococcus spp., and a significant rise in the α-diversity index. Volatile metabolomics detected 734 metabolites, with a significant up-regulation of 454 compounds in the UO group of esters (19.71%) and terpenoids (19.86%), with an increase in the abundance of sweetness and fruity related substances such as methyl phenylpropionate and 3-methylphenylmethyl butyrate. Correlation analysis revealed that Clostridium (e.g. Clostridium tyrobutyricum) was positively correlated with butyric acid and off-flavor metabolites (e.g., 2-methoxy-4-vinylphenol) (p < 0.05), whereas Lactobacillus was strongly correlated with lactic acid content and indicators of high-quality fermentation (low pH, high DM).KEGG pathway analysis further revealed that secondary metabolite biosynthesis (e.g., terpenoids) and phenylpropane metabolic pathways are the core mechanisms of off-flavor formation.<h4>Conclusion</h4>Oat silage off-flavors result from Clostridium-driven butyric acid fermentation, which converts carbohydrates and lactic acid into butyric acid and volatile esters. This process raises pH, affects fiber degradation (31.1% rise in NDF), and causes nutrient loss (16.3% drop in CP). The imbalance between Clostridium and Enterococcus, worsened by a 11.2% decrease in lactic acid bacteria, further degrades fermentation quality. The study innovatively used multi-omics analysis to clarify the molecular mechanisms of microbial dynamics and metabolite interactions behind off-flavor formation. It showed that boosting Lactobacillus abundance can suppress Clostridium activity.

Also flagged:PSD95phosphorylationneurological diseasesserinebrain injuryTraumatic brain injury
Journal Article 2025-07-30 No Snippets Zhang Z, Gao J, Li G, Cheng J, Yu J, Wang P, Liu R, Jiang C, Ma H, Zhao Y.
Show Full Abstract

<h4>Background</h4>Traumatic brain injury (TBI) is a global public health problem. Pathophysiology of TBI remains unclear. Thus, methods of TBI treatment are limited. Phosphorylation plays a vital role in many neurological diseases, including TBI. As an emerging technique, phosphoproteomic has been widely applied in many fields.<h4>Methods</h4>Rats were subjected to controlled cortical impact (CCI) or divided to sham group. Protein was extracted from cortex, digested and labeled by iTRAQ. After undergoing mass spectrometry (MS), differential expressed phosphorylated sites (DEPSs) were identified, and proteins of these DEPSs were also listed. PSD95 was chosen as a target protein for further research. ZL006 was used to treat TBI rats. Nissl staining was applied to assess lesion volume, apoptosis was evaluated by TUNEL immunofluorescence staining, and PSD95 phosphorylation was further validated by Western blot.<h4>Results</h4>A total of 2753 phosphorylation sites across 1001 proteins were identified. A total of 221 DEPSs were identified. Phosphorylation of PSD95 at serine 417 and 418 were significantly upregulated after TBI. PSD95 had most interactions with other differential expressed phosphorylated proteins (DEPPs). Following ZL006 treatment, brain lesion volume and apoptotic rate were significantly reduced, and phosphorylation of PSD95 at Ser418 was decreased.<h4>Conclusions</h4>After TBI, PSD95 was significantly phosphorylated at Ser417 and Ser418. ZL006 markedly reduced brain lesion volume and apoptotic rate and suppressed the phosphorylation of PSD95 at Ser418.

Also flagged:bindingamylinpeptideBRCA1G3BP1common cytokine receptor γ-chain
Journal Article 2025-07-30 No Snippets Liu C, Wu K, Choi H, Han HL, Zhang X, Watson JL, Ahn G, Zhang JZ, Shijo S, Good LL, Fischer CM, Bera AK, Kang A, Brackenbrough E, Coventry B, Hick DR, Qamar S, Li X, Decarreau J, Gerben SR, Yang W, Goreshnik I, Vafeados D, Wang X, Lamb M, Murray A, Kenny S, Bauer MS, Hoofnagle AN, Zhu P, Knowles TPJ, Baker D.
Show Full Abstract

Proteins that bind to intrinsically disordered proteins (IDPs) and intrinsically disordered regions (IDRs) with high affinity and specificity could be useful for therapeutic and diagnostic applications<sup>1-4</sup>. However, a general methodology for targeting IDPs or IDRs has yet to be developed. Here we show that starting only from the target sequence of the input, and freely sampling both target and binding protein conformations, RFdiffusion<sup>5</sup> can generate binders to IDPs and IDRs in a wide range of conformations. We used this approach to generate binders to the IDPs amylin, C-peptide, VP48 and BRCA1_ARATH in diverse conformations with a dissociation constant (K<sub>d</sub>) ranging from 3 to 100 nM. For the IDRs G3BP1, common cytokine receptor γ-chain (IL-2RG) and prion protein, we diffused binders to β-strand conformations of the targets, obtaining K<sub>d</sub> between 10 and 100 nM. Fluorescence imaging experiments show that the binders bind to their respective targets in cells. The G3BP1 binder disrupts stress granule formation in cells, and the amylin binder inhibits amyloid fibril formation and dissociates existing fibres, enables targeting of both monomeric and fibrillar amylin to lysosomes, and increases the sensitivity of mass spectrometry-based amylin detection. Our approach should be useful for creating binders to flexible IDPs or IDRs spanning a wide range of intrinsic conformational preferences.

DCC
Also flagged:mitochondrialmRNAPR8 acid polymeraseERBB2influenza infectionantibody
Journal Article 2025-07-30 ✓ 5 Snippets Chia SB, Johnson BJ, Hu J, Valença-Pereira F, Chadeau-Hyam M, Guntoro F, Montgomery H, Boorgula MP, Sreekanth V, Goodspeed A, Davenport B, De Dominici M, Zaberezhnyy V, Schleicher WE, Gao D, Cadar AN, Petriz-Otaño L, Papanicolaou M, Beheshti A, Baylin SB, Guarnieri JW, Wallace DC, Costello JC, Bartley JM, Morrison TE, Vermeulen R, Aguirre-Ghiso JA, Rincon M, DeGregori J.
In-Text Gene Mentions

…This risk peaked in the months after infection, paralleling mouse models showing greater than 100-foldDCCexpansion into metastatic lesions within two weeks.…

…Second, this expansion is followed by a return to quiescence and establishment of CD4 + cell niches that inhibitDCC elimination, partly through the suppression of CD8 + cells (Extended Data Fig. 12f ).…

…Importantly, we show that a mouse-adapted SARS-CoV-2 virus similarly leads to IL-6-dependentDCC expansionin lungs.…

…Collectively, these findings underscore the substantial metastatic risk COVID-19 posed to cancer survivors, withdormant DCC reactivationpotentially driving this phenomenon.…

…Our studies highlight the importance of developing interventions to minimize the risk oflung DCC awakeningand metastatic disease in the millions of cancer survivors who experience respiratory virus infections.…

Show Full Abstract

Breast cancer is the second most common cancer globally, with most deaths caused by metastatic disease, often following long periods of clinical dormancy<sup>1</sup>. Understanding the mechanisms that disrupt the quiescence of dormant disseminated cancer cells (DCCs) is crucial for addressing metastatic progression. Infections caused by respiratory viruses such as influenza and SARS-CoV-2 trigger both local and systemic inflammation<sup>2,3</sup>. Here we demonstrate, in mice, that influenza and SARS-CoV-2 infections lead to loss of the pro-dormancy phenotype in breast DCCs in the lung, causing DCC proliferation within days of infection and a massive expansion of carcinoma cells into metastatic lesions within two weeks. These phenotypic transitions and expansions are interleukin-6 dependent. We show that DCCs impair lung T cell activation and that CD4<sup>+</sup> T cells sustain the pulmonary metastatic burden after the influenza infection by inhibiting CD8<sup>+</sup> T cell activation and cytotoxicity. Crucially, these experimental findings align with human observational data. Analyses of cancer survivors from the UK Biobank (all cancers) and Flatiron Health (breast cancer) databases reveal that SARS-CoV-2 infection substantially increases the risk of cancer-related mortality and lung metastasis compared with uninfected cancer survivors. These discoveries underscore the huge impact of respiratory viral infections on metastatic cancer resurgence, offering new insights into the connection between infectious diseases and cancer metastasis.

ZNFX1
Also flagged:systemic autoinflammatory disordersSAIDsimmunedysregulation disordersinherited disordersautoimmune diseasesautoinflammatory disease
Journal Article 2025-07-30 ✓ 5 Snippets AlSaleem A, Al-Mayouf SM.
In-Text Gene Mentions

…, ISG15 ,ZNFX1, STAT1 ,…

…, STAT1 ,ZNFX1, SOCS1 ),…

ZNFX1-related interferonopathy was …

…novel variants inZNFX1, SOCS1 ,…

ZNFX1deficiency in humans…

Show Full Abstract

BACKGROUND: Systemic Autoinflammatory disorders (SAIDs) are a group of immunedysregulation disorders driven by aberrant activation of the innate immune system, often linked to single-gene mutations. While consanguinity is a known risk factor for inherited disorders, including autoimmune diseases, its impact in the prevalence and genetic variability of SAIDs remains insufficiently explored. OBJECTIVE: To assess the consanguinity rate among patients with SAIDs and to evaluate its impact on the prevalence and genetic variability of rare monogenic SAIDs. METHODS: We conducted a descriptive, longitudinal, observational study at the main tertiary center in Saudi Arabia. Medical records of patients with a confirmed SAIDs were retrospectively reviewed. Rare SAIDs were defined as those with ≤ 50 globally reported cases. Demographic, clinical, and genetic data of patients with rare SAIDs were collected and analyzed to assess consanguinity and its impact on prevalence and genetic variability. RESULTS: A total of 200 patients with SAIDs were included in this study, with data derived from the autoinflammatory disease clinic database. Consanguinity was observed in 78% of patients, while 52% had a positive family history of SAIDs. Genomic DNA sequencing was performed on 85% of the cohort, utilizing whole exome sequencing (75%), Sanger sequencing (14.7%), and targeted gene panel sequencing (9.4%). The diagnostic genetic yield revealed a confirmed monogenic etiology in 67% of the cases. The cohort encompassed various types of SAIDs, including Pyrin inflammasopathies (n = 48), other inflammasopathies (n = 20), type I interferonopathies (n = 29), NF-kB mediated SAIDs (n = 7), miscellaneous SAIDs (n = 15), undifferentiated SAIDs (n = 42), and polygenic SAIDs (n = 39). Notably, 38 patients were classified as rare monogenic SAIDs, linked to mutations in genes, including NLRC4, LPIN2, RIPK1, PLCG2, PIK3CD, ISG15, ZNFX1, STAT1, SOCS1, OTULIN, PTEN, GJB2, SLC29A3, and IL-17RA. Among these, consanguinity was reported in 78% of first-and second-degree relatives. Additionally, novel pathogenic or likely pathogenic variants were identified in 70% of patients with rare monogenic SAIDs, spanning 14 distinct genes. CONCLUSION: Our cohort demonstrates that rare monogenic SAIDs and novel pathogenic variants tend to cluster within consanguineous families. These findings highlight the importance of considering consanguinity and family history in the clinical assessment of SAIDs. Larger studies involving consanguineous populations are needed to further investigate their impact on prevelance and clinical outcome. CLINICAL TRIAL NUMBER: Not applicable.

LRRC7
Also flagged:tumorinflammatory celldeathoxygennitrogenpyroptosis
Journal Article 2025-07-30 ✓ 1 Snippet Xu XS, Ren WW, Zhang H, Huo DL, Lyu Q, Zhan MX, Xu HX, Wang LY, Huo MF, Shi JL.
In-Text Gene Mentions

…( Zbp1 ),leucine-rich repeat flightless-interacting protein 7repeat flightless-interacting …

Show Full Abstract

<h4>Background</h4>PANoptosis has been identified as a robust inflammatory cell death pathway triggered upon host defense against invaded pathogens such as bacteria and viruses, however, pathogen-free tumor PANoptosis has not been achieved yet. Reactive oxygen and nitrogen species capable of inducing robust and diverse cell death pathways such as pyroptosis, apoptosis, and necroptosis are supposed to be the potential triggers for tumor PANoptosis by ultrasound (US)-controlled sono-piezodynamic therapy.<h4>Methods</h4>S-nitrosothiols (SNO)-zinc peroxide (ZnO<sub>2</sub>)@cyclic dinucleotide (CDN)@mesoporous tetragonal barium titanate (mtBTO) nanoparticles (NZCB NPs) were synthesized by hydrothermal method with subsequent annealing, in situ growth, and finally surface functionalization. Scanning electron microscopy, transmission electron microscopy, X-ray diffraction, atomic force microscopy, Fourier transform infrared spectroscopy, and electron spin resonance were used for materials characterizations. Murine melanoma B16 cells are employed to investigate the in vitro US-initiated tumor PANoptosis by NZCB NPs. In vivo US-initiated tumor PANoptosis was investigated on B16 tumor-bearing C57BL/6J mice.<h4>Results</h4>A "boiling-bubbling" strategy is developed to endow the piezoelectric BTO nanocatalysts, with mesoporous architecture, which enables the encapsulation of the immune-agonist CDN (9.4 wt%) to initiate innate immunity of the host. Then, SNO-functionalized ZnO<sub>2</sub> was further employed to cap the mesoporous nanocatalysts, forming multifunctional piezocatalytic NZCB NPs. Under US irradiation, intracellular massive reactive oxygen and nitrogen species such as superoxide anion radicals, nitric oxide (NO), and peroxynitrite (ONOO<sup>-</sup>) could be produced from the piezoelectric NZCB NPs, which, synergized with CDN-triggered antitumoral immunity, lead to highly immunogenic tumor PANoptosis by NZCB NPs through the tumor microenvironment remodeling. Intratumoral injection of NZCB NPs leads to substantial tumor PANoptosis with immune potentiation, ultimately destroying the tumor xenografts effectively.<h4>Conclusion</h4>The present work presents the mesostructure design of piezocatalytic nanomaterials and the crosstalk between oxidative stress and antitumor immunity within the tumor, facilitating promising tumor PANoptosis by nanocatalytic oxidation with high effectiveness and biocompatibility.

Also flagged:TEM-1catalytic activityβ-lactamasecefotaximeβ-lactamantimicrobial-resistant infections
Journal Article 2025-07-30 No Snippets Shahryari S, Ahmad S, Foik IP, Jankowski P, Samborski A, Równicki M, Vasantham SK, Garstecki P.
Show Full Abstract

Bacterial populations can display different susceptibilities to antibiotics among individual cells, even though they originate from the same parent cell. This variability can lead to treatment failure and the emergence of resistant bacteria. Understanding the factors influencing this variability is crucial for developing effective antibiotic treatments. The underlying cause of variation in susceptibility distribution within bacterial populations remains unclear, necessitating the development of new tools for measurement. Here, we use a droplet microfluidic single-cell antibiotic susceptibility assay and focus on antibiotic resistance conveyed by the TEM β-lactamases family. We investigate how the catalytic activity of β-lactamase, and the genetic characteristics of the host strains affect the susceptibility distribution within bacterial populations at the single-cell level. For this purpose, we selected TEM-1 with the least catalytic activity against cefotaxime, followed by its two variants, R164S and G238S, exhibiting moderate and significant catalytic activity, respectively. The results showed that increasing the catalytic activity causes an increase in the population's mean level of antibiotic resistance. While the type of β-lactamase influences the susceptibility distribution of the strains, this effect is independent of the catalytic activity of the strains. Besides, the genetic characteristics of the strains receiving the β-lactam resistance gene is an important factor that plays a role in the distribution of susceptibility.

DCC
Also flagged:strokechronic HFheart failureadhesionspolyesterpericardial
Journal Article 2025-07-30 ✓ 5 Snippets Hager MP, Ganguly P, Letsou GV.
In-Text Gene Mentions

…This review summarizesDCCdevelopment and advances…

DCCdevelopment is progressing…

…several conclusions concerningDCC: 1.…

…RecentDCCdevelopment is progressing…

…current understanding ofDCC.…

Show Full Abstract

Direct cardiac compression (DCC) devices, under development as a new modality for mechanical cardiac support (MCS), offer several advantages over presently available forms of MCS. DCC devices avoid the blood contact obligatory with other implantable MCS devices, the complications associated with blood contact and hematologic incompatibility, such as thrombosis, stroke, and the need for anticoagulation are avoided, and DCC does not require vascular access eliminating challenges such as bleeding and extremity ischemia. Arterial pressure pulsatility is also maintained with DCC. Significant and underappreciated advancements in DCC technology have occurred over the last decades with notable dramatic improvements in cardiac performance and minimal tissue damage. One device has entered clinical trials with a second device anticipated to follow. DCC is poorly understood by most cardiologists and cardiac surgeons. This review summarizes DCC development and advances so that upcoming human clinical trials can be properly assessed.

Also flagged:cognitionorganizationnucleusBDNFnerve growth factorNGF
Journal Article 2025-07-30 No Snippets Guillamón-Vivancos T, Aníbal-Martínez M, Puche-Aroca L, Martini FJ, López-Bendito G.
Show Full Abstract

The thalamus is an essential element for sensory information processing, serving as a link between peripheral sensory stimuli and cortical circuits. Consequently, the development of thalamocortical (TC) projections has been a central focus in systems neuroscience. Although substantial progress has been made in understanding the mechanisms guiding thalamic axon navigation from the diencephalon to the cortex, our understanding of the processes underlying sensory modality specificity in TC circuits remains incomplete. Modern genomic, physiological and imaging approaches have yielded exciting results, providing novel insights into the specialization of visual, somatosensory and auditory TC circuits. Recent findings have shed light on the genetic and spontaneous activity mechanisms involved in the formation of distinct sensory modalities, rekindling the interest in the thalamus and opening new research perspectives on the development of this diencephalic structure.

TNFSF4SERPINC1
Also flagged:agingchronic diseasessenescencecell cycledoxorubicinmitochondrial
Journal Article 2025-07-30 ✓ 4 Snippets Patel SK, Bons J, Rose JP, Chappel JR, Beres RL, Watson MA, Webster C, Burton JB, Bruderer R, Desprez PY, Reiter L, Campisi J, Baker ES, Schilling B.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4).…

…senescence, such asAntithrombin-III(SERPINC1), Prothrombin (F2),…

…such as Antithrombin-III (SERPINC1), Prothrombin (F2), Coagulati…

…inhibitors (SERPIN family,SERPINC1), Prothrombin (F2), Coagulati…

Show Full Abstract

Senescence emerged as significant mechanism of aging and age-related diseases, offering an attractive target for clinical interventions. Senescent cells release a senescence-associated secretory phenotype (SASP), including exosomes that may act as signal transducers between distal tissues, and propagate secondary senescence. However, the composition of exosomal SASP components remains underexplored. We identified ~1,300 exosome proteins released by senescent primary human lung fibroblasts induced by three different senescence inducers. In parallel, a small human plasma cohort from young (20-26 years) and old (65-74 years) individuals revealed 1,350 exosome proteins and 171 plasma exosome proteins were altered in old individuals. Of the age-regulated plasma exosome proteins, we observed 52 exosomal SASP factors that were also regulated in exosomes from the senescent fibroblasts, SERPINs, Prothrombin, Coagulation factor V, Plasminogen, and Reelin. We identified 247 exosome lipids. Following senescence induction phosphatidylcholines, phosphatidylethanolamines, and sphingomyelins increased significantly indicating cellular membrane changes. Significantly changed proteins were related to extracellular matrix remodeling and inflammation, both potentially detrimental pathways that can damage surrounding tissues and even induce secondary senescence. Our proof-of-principle study - even though initially from a rather small human cohort - suggested potential senescence biomarker candidates, enabling future surveillance of senescence burden in the aging population.

OLFM4
Also flagged:Nur77necroptosisendoplasmic reticulumNuclear receptordeathsepsis
Journal Article 2025-07-30 ✓ 1 Snippet Cui C, Huo Q, Ran S, Wang W, Wei H, Peng J.
In-Text Gene Mentions

…olfactomedin 4 (Olfm4) ( Fig.…

Show Full Abstract

<h4>Introduction</h4>Sepsis, a systemic inflammatory syndrome, is frequently associated with intestinal dysfunction, which in turn exacerbates disease severity. Intestinal epithelial Paneth cells exhibit increased susceptibility to necroptosis upon inflammatory stimulation. Nuclear receptor Nur77 has been implicated in multiple programmed cell death pathways. However, the precise role of Nur77 in regulating Paneth cell necroptosis during sepsis remains unclear.<h4>Objectives</h4>This study elucidates the role and underlying molecular mechanisms of nuclear receptor Nur77 in regulating Paneth cell necroptosis during sepsis.<h4>Methods</h4>We employed both systemic and Paneth cell-specific Nur77 knockout mouse models. Paneth cell necroptosis was assessed using TUNEL staining, immunofluorescence, and transmission electron microscopy. Endoplasmic reticulum (ER) homeostasis was evaluated based on ultrastructural integrity, ER-phagy, and ER stress. Protein modification and protein-protein interaction were validated by structure prediction and immunoprecipitation.<h4>Results</h4>Systemic or Paneth cell-specific Nur77 knockout exacerbated intestinal inflammation by enhancing Paneth cell necroptosis during sepsis. Nur77 deficiency in Paneth cells altered ileal microbiota rather than intestinal stem cell niche after LPS challenge. Nur77 deficiency-induced Paneth cell necroptosis was attributed to impaired ER homeostasis caused by defective ER-phagy. Mechanistically, LPS induced Nur77-PKCα interaction and their subsequent translocation to the ER, which promoted AMFR phosphorylation, FAM134B ubiquitination and subsequently ER-phagy. Treatment with Nur77 agonists (BTP and Csn-B) alleviated intestinal inflammation and restored Paneth cell homeostasis in sepsis mice.<h4>Conclusion</h4>This study demonstrates that Paneth cell necroptosis plays a critical role in intestinal inflammation. Our work also identifies Nur77 as a potential therapeutic target to protect Paneth cells and maintain intestinal homeostasis during sepsis, pointing out the therapeutic potential of Nur77 agonist in sepsis.

Also flagged:DIO3ovarian cancerDeiodinase type 3metabolismextracellularlactate
Journal Article 2025-07-30 No Snippets Moskovich D, Beilinson D, Rosemarin A, Cohen A, Fabian I, Lifschytz T, Lerer B, Mugesh G, Gottfried M, Ashur-Fabian O.
Show Full Abstract

<h4>Objective</h4>Metabolic reprogramming emerges as a central driver of therapy resistance and survival disadvantage in ovarian cancer. We recently demonstrated that inhibiting the enzyme Deiodinase type 3 (DIO3) reduces ovarian cancer growth, although the underlying mechanism remains unclear.<h4>Methods</h4>We studied DIO3 role in metabolism in genetically manipulated ovarian cancer cells using protein expression analysis, integrative proteomics, endogenous and extracellular metabolomics, metabolic assays including lactate and glutamate secretion, reactive oxygen species (ROS) production and the Seahorse Cell Mito Stress test.<h4>Results</h4>We reveled that inhibiting DIO3 suppresses glycolysis while enhancing ATP production through oxidative phosphorylation (OXPHOS). We corroborated these findings using two models of ovarian cancer xenografts, demonstrating a marked reduction in glycolytic proteins upon silencing or inhibiting DIO3 using our first in class small molecule. Moreover, altered glutamine metabolism was also documented, favoring urea cycle and TCA cycle engagement over antioxidant production, accompanied by elevated ROS. Intriguingly, DIO3 depletion in fallopian tube cells, the precursor of HGSOC, displayed distinct metabolic adaptations, including enhanced glycolysis and lipid metabolism, suggesting tissue-specific roles for DIO3.<h4>Conclusions</h4>These collective findings position DIO3 as a potential regulator of ovarian cancer metabolism, with implications for targeting this enzyme to disrupt tumor energetics as a novel therapeutic approach.

Also flagged:Endometrial cancergynecologic malignanciesadvancedcancercancersmalignant epithelial tumor of the uterus
Journal Article 2025-07-30 No Snippets Gui N, Cheewakriangkrai C, Chaiyawat P, Udomruk S.
Show Full Abstract

Endometrial cancer is one of the most prevalent gynecologic malignancies in developed countries, with its incidence steadily increasing each year. Early diagnosis is crucial for a favorable prognosis; however, certain patients experience recurrence and distant metastasis after surgery, similar to advanced cancer patients, with limited treatment options. Therefore, effective strategies for early screening, diagnosis, predicting local recurrence, and guiding rapid treatment interventions are essential for improving survival rates and prognosis. Liquid biopsy, a method known for being non-invasive, safe, and effective, has attracted widespread attention for cancer diagnosis and treatment. Although its clinical application in endometrial cancer is less established than in other cancers, research on biomarkers using liquid biopsy in endometrial cancer patients is currently in progress. This review examines the latest advancements in non-invasive biomarkers identified through liquid biopsy and provides a comprehensive overview of their clinical applications in endometrial cancer. Additionally, it discusses the challenges and future prospects of liquid biopsy, offering valuable insights into the diagnosis and personalized treatment of endometrial cancer.

CSE1L
Also flagged:Colorectal Cancershort-chain fatty acidsbutyrateDysbiosisneuropsychiatric disorderscardiovascular diseases
Journal Article 2025-07-30 ✓ 1 Snippet Yang YC, Chang SC, Hung CS, Shen MH, Lai CL, Huang CJ.
In-Text Gene Mentions

…HDACs Histone deacetylasesCSE1LChromosome segregation 1…

Show Full Abstract

The human gut microbiota significantly influences host health through its metabolic products and interaction with immune, neural, and metabolic systems. Among these, short-chain fatty acids (SCFAs), especially butyrate, play key roles in maintaining gut barrier integrity, modulating inflammation, and supporting metabolic regulation. Dysbiosis is increasingly linked to diverse conditions such as gastrointestinal, metabolic, and neuropsychiatric disorders, cardiovascular diseases, and colorectal cancer (CRC). Probiotics offer therapeutic potential by restoring microbial balance, enhancing epithelial defenses, and modulating immune responses. This review highlights the physiological functions of gut microbiota and SCFAs, with a particular focus on butyrate's anti-inflammatory and anti-cancer effects in CRC. It also examines emerging microbial therapies like probiotics, synbiotics, postbiotics, and engineered microbes. Emphasis is placed on the need for precision microbiome medicine, tailored to individual host-microbiome interactions and metabolomic profiles. These insights underscore the promising role of gut microbiota modulation in advancing preventive and personalized healthcare.

SERPINC1
Also flagged:NisinUrolithin BLymphomaimmune responsescancerAlamar Blue
Journal Article 2025-07-30 ✓ 1 Snippet Al-Khazaleh AK, Alsherbiny MA, Chang D, Münch G, Bhuyan DJ.
In-Text Gene Mentions

SERPINC1(Log 2 FC…

Show Full Abstract

Lymphoma continues to pose a serious challenge to global health, underscoring the urgent need for new therapeutic strategies. Recently, the gut microbiome has been shown to play a potential role in regulating immune responses and influencing cancer progression. However, its molecular mechanisms of action in lymphoma remain poorly understood. This study investigates the antiproliferative and apoptotic activities of gut microbiota-derived metabolites, specifically nisin (N) and urolithin B (UB), individually and in combination 7:3 (5750 μM), against the human lymphoma cell line HKB-11. Comprehensive evaluations were performed using Alamar Blue viability assays, combination index (CI) analyses, reactive oxygen species (ROS) quantification, flow cytometry for apoptosis detection, and advanced bottom-up proteomics analyses. N and UB exhibited potent antiproliferative activity, with the 7:3 combination demonstrating strong synergistic effects (CI < 1), significantly enhancing apoptosis (<i>p</i> < 0.01) and ROS production (<i>p</i> < 0.0001) compared to the untreated control. Proteomics analyses revealed substantial alterations in proteins crucial to ribosomal biogenesis, mitochondrial function, cell cycle control, and apoptosis regulation, including a marked downregulation of ribosomal proteins (RPS27; Log<sub>2</sub>FC = -3.47) and UBE2N (Log<sub>2</sub>FC = -0.60). These findings highlight the potential of N and UB combinations as a novel and practical therapeutic approach for lymphoma treatment, warranting further in vivo exploration and clinical validation.

Also flagged:infectionTNFextracellularvesiclesVisceral leishmaniasisVL
Journal Article 2025-07-30 No Snippets Bernardo L, Montero-Calle A, Solana JC, Lozano-Rendal M, Torres A, Sánchez C, Barderas R, Moreno J, Carrillo E.
Show Full Abstract

<h4>Introduction</h4>Visceral leishmaniasis (VL) occurs more frequently in immunosuppressed individuals, especially those undergoing immunosuppressive drug therapy for an autoimmune disease. In those receiving TNF antagonist therapy (anti-TNF), the course of VL is more severe and the response to traditional leishmanicidal treatments, such as antimonials (Sb), is often reduced. This effect of anti-TNF treatment is observed in our immunosuppressed-mouse model of VL. In this model, we compared anti-TNF immunosuppression with no immunosuppression before and after VL treatment with Sb.<h4>Methods</h4>Serum-derived extracellular vesicles (EVs) were analyzed through label-free quantitative proteomics to identify proteins involved in both VL severity and the impact of anti-TNF immunosuppression on treatment outcome.<h4>Results</h4>In total, 223 dysregulated proteins were found in the pre-treatment groups, the majority of which, such as vitronectin, haemopexin or caveolin-1, were downregulated in the anti-TNF samples. In contrast, 173 proteins were identified in the Sb-treatment groups, most of which were found enriched in the anti-TNF plus treatment samples (anti-TNF+Sb) including fibronectin, transferrin, vitronectin and dipeptidyl peptidase-4. These differentially-expressed proteins were associated with pathways related to the immune system, liver regeneration, and ion transport.<h4>Conclusion</h4>Our findings have useful implications for the clinical management of VL patients under anti-TNF immunosuppression.

Also flagged:Malignant tumors of the urinary systemkidney cancerbladder cancerprostate cancerurological tumorsmodifications
Journal Article 2025-07-30 No Snippets Xue W, Zhao Y, Zhang G, Li Z, Li J, Fei X.
Show Full Abstract

Malignant tumors of the urinary system, such as kidney cancer, bladder cancer, and prostate cancer, remain a significant challenge despite the various treatment options available. Identifying therapeutic targets for urological tumors is crucial due to the potential for recurrence and metastasis. Recent research has highlighted the importance of RNA modifications in post-transcriptional regulation, impacting various biological functions in urological tumors, including tumorigenesis, progression, metastasis, and drug resistance. However, the specific mechanisms underlying these interactions are not fully understood. This review will focus on exploring the regulatory role of RNA modifications like m1A, m5C, and m7G in urological tumors, shedding light on the pathways and molecular mechanisms involved. This analysis aims to provide new insights for the treatment of urological tumors.

Also flagged:Gold NanoparticlessynthesisMetal nanoparticlesactivityGold nanoparticlenanoparticles
Journal Article 2025-07-30 No Snippets Sati A, Mali SN, Samdani N, Annadurai S, Dongre R, Satpute N, Ranade TN, Pratap AP.
Show Full Abstract

Gold nanoparticles (<b>AuNPs</b>) are renowned for their unique optical, electronic, and biocompatible properties, making them ideal for applications in drug delivery, diagnostics, imaging, and materials science. With green chemistry-based biological synthesis methods gaining popularity, eco-friendly alternatives to traditional chemical and physical methods techniques have emerged. Plant extract-derived AuNPs stand out for their remarkable medicinal properties, stability, and low reactivity, enhancing their biological applicability. This review explores the different synthesis methodschemical, physical, and biologicalhighlighting their advantages and challenges. We summarize the latest research (Updated until <b>March, 2025</b>), focusing on the most recent developments in the synthesis and multifield application of AuNPs, offering a comprehensive perspective on their potential.

Also flagged:transductionferricyanideelectron transferbindingsignal transductionboron
Journal Article 2025-07-30 No Snippets Sekhon S, Bayford R, Demosthenous A.
Show Full Abstract

Capacitive sensors are platforms that enable label-free, real-time detection at low non-perturbing voltages. These sensors do not rely on Faradaic processes, thereby eliminating the need for redox-active species and simplifying system integration for point-of-care diagnostics. However, their sensitivity in high-ionic-strength solutions, such as bodily fluids, is limited due to a reduced Debye length and non-specific interactions. The present review highlights advances in material integration, surface modification, and signal enhancement techniques to mitigate the challenges of deploying capacitive sensors in biofluids (sweat, saliva, blood, serum). This work further expands on the promise of such sensors for advancing liquid biopsies and highlights key technical challenges in translating capacitive systems to clinics.

HTT
Also flagged:Depressionalcoholhyperglycemiaglucosegamma-glutamyl transferaseGGT
Journal Article 2025-07-30 ✓ 2 Snippets Mitincu-Caramfil SD, Stoian AP, Moroianu LA, Plesea-Condratovici C, Bradeanu AV, Drima E.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT) have been associated…

…Hypothalamic–Pituitary–Adrenal5-HTTSerotonin Transporter Gene…

Show Full Abstract

<i>Background and Objectives</i>: This study investigated whether the interaction between heavy alcohol use and depression amplifies the risk of hyperglycemia in psychiatric patients. <i>Materials and Methods</i>: We conducted a cross-sectional study on 172 patients (aged 18-65) hospitalized at the "Elisabeta Doamna" Clinical Psychiatric Hospital, Romania. The data included fasting blood glucose, gamma-glutamyl transferase (GGT), Beck Depression Inventory (BDI), and Alcohol Use Disorders Identification Test (AUDIT) scores. <i>Results</i>: Moderate positive correlations were observed between depression scores and blood glucose (r = 0.44) and between alcohol consumption and blood glucose (r = 0.43). The interaction term (BDI × AUDIT) was statistically significant in multiple regression (β = 0.012, <i>p</i> = 0.001), and the model explained 39.1% of glucose variability. Logistic regression analysis revealed that neither high alcohol consumption (OR = 1.38, <i>p</i> = 0.441) nor severe depression alone (OR = 1.30, <i>p</i> = 0.582) were significantly associated with hyperglycemia. However, their interaction demonstrated a strong and statistically significant effect (OR = 19.3, 95% CI: 3.22-115.81, <i>p</i> = 0.001). The prevalence of hyperglycemia reached 95.8% in patients with both risk factors. <i>Conclusions</i>: The combined presence of high alcohol consumption and severe depression significantly increases the risk of hyperglycemia. These findings highlight the importance of integrated screening and interventions in psychiatric settings.

Also flagged:Mannuronic AcidGoldviral infectioncell-cell communicationimmune responsesgold nanoparticles
Journal Article 2025-07-30 No Snippets Basaran R, Budhadev D, Dimitriou E, Wootton HS, Miller GJ, Kempf A, Nehlmeier I, Pöhlmann S, Guo Y, Zhou D.
Show Full Abstract

Multivalent lectin-glycan interactions (MLGIs) are vital for viral infection, cell-cell communication and regulation of immune responses. Their structural and biophysical data are thus important, not only for providing insights into their underlying mechanisms but also for designing potent glycoconjugate therapeutics against target MLGIs. However, such information remains to be limited for some important MLGIs, significantly restricting the research progress. We have recently demonstrated that functional nanoparticles, including ∼4 nm quantum dots and varying sized gold nanoparticles (GNPs), densely glycosylated with various natural mono- and oligo- saccharides, are powerful biophysical probes for MLGIs. Using two important viral receptors, DC-SIGN and DC-SIGNR (together denoted as DC-SIGN/R hereafter), as model multimeric lectins, we have shown that α-mannose and α-manno-α-1,2-biose (abbreviated as Man and DiMan, respectively) coated GNPs not only can provide sensitive measurement of MLGI affinities but also reveal critical structural information (e.g., binding site orientation and mode) which are important for MLGI targeting. In this study, we produced mannuronic acid (ManA) coated GNPs (GNP-ManA) of two different sizes to probe the effect of glycan modification on their MLGI affinity and antiviral property. Using our recently developed GNP fluorescence quenching assay, we find that GNP-ManA binds effectively to both DC-SIGN/R and increasing the size of GNP significantly enhances their MLGI affinity. Consistent with this, increasing the GNP size also significantly enhances their ability to block DC-SIGN/R-augmented virus entry into host cells. Particularly, ManA coated 13 nm GNP potently block Ebola virus glycoprotein-driven entry into DC-SIGN/R-expressing cells with sub-nM levels of <i>EC</i><sub>50</sub>. Our findings suggest that GNP-ManA probes can act as a useful tool to quantify the characteristics of MLGIs, where increasing the GNP scaffold size substantially enhances their MLGI affinity and antiviral potency.

Also flagged:FAPmuscular dystrophiesDuchenne muscular dystrophyFibrosismembrane fibroblast activation proteincollagen
Journal Article 2025-07-30 No Snippets Ferrand M, Rocca CJ, Corre G, Buffa V, Frin S, Garnache-Ottou F, Bôle-Richard E, Albini S, Richard I, Galy A.
Show Full Abstract

Tissue fibrosis is a pathological feature of many diseases including muscular dystrophies such as Duchenne muscular dystrophy (DMD). Fibrosis may limit the effectiveness of gene therapy in muscle impacting on viral dosing but direct evidence is lacking. Strategies to reduce skeletal muscle fibrosis are limited. The fibrosis <i>Fap</i> gene is over-expressed in the skeletal muscles of a severe mouse model of DMD, suggesting that cells expressing membrane fibroblast activation protein (FAP) could be targeted by chimeric antigen receptor (CAR)-T cells. Two consecutive administrations of FAP-specific CAR-T cells in the severe DMD model reduced collagen deposits and fibrotic biomarkers and also reduced the number of FAP-positive cells in muscle. Single cell transcriptomics revealed that FAP-CAR-T cells triggered cellular interactions with otherwise inactive muscle resident macrophages and depleted specific subsets of FAP-highly-expressing fibro-adipogenic progenitor cells, pointing to their importance in the fibrosis process. Reducing fibrosis with FAP-CAR-T cells enhanced adeno-associated virus (AAV) microdystrophin gene transfer in the model by increasing vector copies, demonstrating that fibrosis is a restriction factor for AAV gene delivery in skeletal muscle. These results provide novel insights into therapeutic strategies for DMD or other fibrotic diseases.

HFE
Also flagged:Alanine AminotransferaseALTNon-Communicable Diseaseliver diseasesliver diseasemetabolic dysfunction-associated steatotic liver disease
Journal Article 2025-07-30 ✓ 2 Snippets Ahmadi B, Naleini F, Moradinazar M, Anvari B.
In-Text Gene Mentions

…disease, Wilson disease,hemochromatosis, autoimmune or drug…

Hemochromatosis, Wilson’s disease, autoimmune…

Show Full Abstract

<h4>Background</h4>Alanine aminotransferase (ALT) has a variable normal range according to race and ethnicity. So, the upper normal level of ALT localized for the Iranian population was determined in the Ravansar Non-Communicable Disease (RaNCD) cohort population by re-evaluation of high-risk people.<h4>Methods</h4>A cohort population with normal ALT results based on the current kit was checked for a history of liver diseases. After excluding them, the remaining population was included in the distribution diagram of individuals with apparently healthy livers. Participants whose ALT values were in the 90th to 100th percentile were re-evaluated by ultrasonography (US) and a checklist of liver disease. Patients identified as having liver disease or those with other abnormal liver enzymes were excluded, and the 95th percentile was extracted from the distribution diagram of the remaining population.<h4>Results</h4>After excluding liver disease, among 8046 participants of RaNCD, US and re-evaluation were performed in 543 high-risk individuals. Liver disease was diagnosed in 74.6% by US. The most common liver disease was metabolic dysfunction-associated steatotic liver disease (MASLD), accounting for 69.7%. Grade 2 or 3 of MASLD was found in 23.2%. After excluding patients with abnormal liver enzymes and liver disease, the 95th percentile of ALT was 29 U/L in women (sensitivity: 53%, specificity: 82%) and 36 U/L in men (sensitivity: 28%, specificity: 90%).<h4>Conclusion</h4>The calculated 95th percentile was lower than the routine cut-off value of the current kit in both sexes. Generalizability is a significant advantage of our results, provided by the lack of exclusion of patients with metabolic risk factors and the use of US to exclude MASLD.

bioRxiv 2025-07-30 Preprint (No Snippets API) Raji H, Bertoli F, Perez MJ, Lam A, Volpicelli-Daley L, Deleidi M.
Show Full Abstract

Human midbrain organoids (hMOs) derived from induced pluripotent stem cells provide a powerful system to model disorders involving dopamine (DA) dysfunction, including Parkinson’s disease (PD) and neuropsychiatric conditions. However, current differentiation protocols still fall short in recapitulating early specification, substantia nigra pars compacta (SNpc)-like identity, and the functional maturation of vulnerable DA neurons. Here, we established a differentiation strategy that combines tri-phasic WNT modulation with dynamic bioreactor culture to generate hMOs enriched in SNpc-like DA neurons. This approach significantly increases the yield of TH⁺/GIRK2⁺ and TH⁺/ALDH1A1⁺ DA neurons and promotes enhanced synaptic maturation, robust electrophysiological activity, and elevated DA release. Single-cell transcriptomics revealed that this strategy drives the emergence of SOX6 + / GIRK2 + SNpc-like neurons, accompanied by upregulation of synaptic, metabolic, and maturation programs, alongside reduced cell stress and apoptotic signaling. Importantly, hMOs demonstrated vulnerability upon exposure to α-synuclein preformed fibrils, resulting in aggregate formation and DA neuron degeneration, supporting their use as a human model of PD-relevant pathology. Overall, this system provides a scalable and physiologically relevant approach to investigate molecular mechanisms underlying neurodegeneration and DA-related disorders.

bioRxiv 2025-07-30 Preprint (No Snippets API) Solomon R, Botero Rute LM, Kumar R, Mesika R, Toyber I, Doron Faigenbaum A, Winkler S, Tovar Herrera OE, Gerbi S, Gajbhiye DS, Wein T, Mizrahi I, Jami E.
Show Full Abstract

Microbial interactions are fundamental to global ecological and evolutionary processes, exemplified by endosymbiosis between prokaryotes and single-cell eukaryotes that gave rise to organelles. While such associations remain widespread and ecologically important, the diversity and evolutionary dynamics of intracellular symbioses in many microbial ecosystems remain poorly understood. Here, we uncover a hidden layer of microbial complexity in the rumen ecosystem by identifying multiple endosymbiotic associations between ciliate protozoa and bacteria. Using genome-resolved metagenomics on protozoa enriched rumen fractions, we reveal diverse bacterial genomes exhibiting hallmarks of an obligate intracellular lifestyle. These candidate symbionts span several bacterial phyla and include close relatives of known endosymbionts and parasites of protists as well as previously unclassified or presumed free-living bacterial lineages that likely represent overlooked symbiont specialists. Our findings therefore expand the known distribution of bacterial endosymbiosis, establish the rumen – a key site of global carbon and nitrogen cycling – as a promising model for symbiosis research, and demonstrate the power of our approach to uncover hidden symbiotic associations across complex microbial communities. Overall, our results highlight the ubiquity and evolutionary significance of intracellular symbiosis as a shaping force in microbial ecosystems.

Also flagged:Gene ExpressionD-Amino Acid OxidaseDAOD-amino acidsoxo acidshydrogen
Journal Article 2025-07-29 No Snippets Trinh HTT, Shishido Y, Tran NH, Tran DH, Kim SH, Sogabe H, Fukui K.
Show Full Abstract

D-amino acid oxidase (DAO) catalyzes oxidative deamination of D-amino acids, producing 2-oxo acids, hydrogen peroxide, and ammonia. In mammals, DAO is essential for metabolizing both endogenous and exogenous D-amino acids. Previous studies on human DAO identify two promoter regions (P1 and P2), a negative regulatory element in intron 1, and several transcription factor (TF) binding sites. In this study, the regulatory mechanism of mouse DAO gene expression is investigated to compare with the human system. To determine the promoter activity in the upstream region of the initiation site, plasmids containing mouse DAO gene fragments inserted into the pGL4 [luc2P/Hygro] vector and assessed luciferase activity in LLC-PK1 cells are constructed. A series of deletion constructs is analyzed, revealing promoter activity in all tested fragments. The highest promoter activity is detected in the -333/-87 subregion, with residual activities in the -87/ + 111 region. Bioinformatics analysis identifies TFs, including NEUR, EGRF, ZF07, ZF11, KLFS, SP1F, and ZF02, which bind to both the human and mouse DAO genes at conserved positions, suggesting their critical role in regulating DAO promoter activity.

DCC
Also flagged:Lymph Nodeextrahepatic cholangiocarcinomacholangiocarcinomacancerperihilar cholangiocarcinomadistal cholangiocarcinoma
Journal Article 2025-07-29 ✓ 5 Snippets Kiritani S, Kawaguchi Y, Kazami Y, Ito K, Nishioka Y, Mihara Y, Ichida A, Takamoto T, Akamatsu N, Hasegawa K.
In-Text Gene Mentions

…was selected forDCC.…

…into PhCC andDCC, the number of…

…and those forDCCare shown in…

…in PhCC andDCC, but our study…

…for PhCC andDCC[ 17 ,…

Show Full Abstract

<h4>Background</h4>Lymph node (LN) metastasis in extrahepatic cholangiocarcinoma (eCCA) is associated with poor prognosis, but the impact of specific metastatic sites is unclear. This study investigated the clinical significance of LN metastasis around the common hepatic artery (N [CHA]) in eCCA.<h4>Methods</h4>A total of 291 patients who underwent curative resection for eCCA between 2002 and 2022 were retrospectively reviewed. Patients were classified as N1 (CHA), N1 (other, regional LN metastasis without CHA), or N0. Clinical characteristics and long-term outcomes were compared. The short-to-long axis ratio (SLR) of CHA nodes on preoperative CT was evaluated for diagnostic value.<h4>Results</h4>Of 291 patients, 164 had perihilar and 127 had distal cholangiocarcinoma. The N1 (CHA), N1 (other), and N0 groups included 33, 103, and 155 patients, respectively. Five-year cancer-specific survival (CSS) rates were 6.9% (N1 [CHA]), 24.7% (N1 [other]), and 60.3% (N0). N1 (CHA) and N1 (other) had CSS hazard ratios of 3.34 and 1.86, respectively (p < 0.01). The area under the receiver operating characteristics curve for SLR in predicting N1 (CHA) was 0.779.<h4>Conclusions</h4>N1 (CHA) is a strong negative prognostic factor in eCCA. CHA node status may serve as a useful imaging-based marker of biological resectability.

Also flagged:calcium sulfateinfectionmonocalcium phosphate-tricalcium phosphateporehemihydrate
Journal Article 2025-07-29 No Snippets Bai J, Liu D, Ding L, Liu G, Li J, Wang H, Dong L, Cui C, Hong Y, He S, Chen S, Zhang H.
Show Full Abstract

The critical bone defect is a common clinical challenge worldwide, characterized by long recovery times, a substantial risk of infection, and high disability rates. There remains a significant demand for synthetic bone-repairing materials to address this issue. In this study, porous monetite was synthesized through the reaction between monocalcium phosphate monohydrate and β-tricalcium phosphate, using paraffin microspheres as pore-forming agents. An injectable biphasic cement was then developed by blending the monetite granules with hemihydrate calcium sulfate, designed for minimally invasive surgical applications. The cement demonstrated excellent biocompatibility and osteogenic properties in vitro. Furthermore, in vivo studies confirmed the cement's superior bone repair capabilities, indicating its promising potential for the treatment of critical bone defects.

PLCL1
Also flagged:gene expressionForkhead transcription factorDMRT transcription factorFoxFtranscriptional regulatorsendothelial cell development
Journal Article 2025-07-29 ✓ 1 Snippet Stefanakis N, Xi J, Jiang J, Shaham S.
In-Text Gene Mentions

…, gbb-2/GABBR2 and pll-1/PLCL1, are enriched…

Show Full Abstract

Endothelial cells form the inner layer of blood vessels and play key roles in circulatory system development and function. A variety of endothelial cell types have been described through gene expression and transcriptome studies; nonetheless, the transcriptional programs that specify endothelial cell fate and maintenance are not well understood. To uncover such regulatory programs, we studied the C. elegans head mesodermal cell (HMC), a non-contractile mesodermal cell bearing molecular and functional similarities to vertebrate endothelial cells. Here, we demonstrate that a Forkhead transcription factor, LET-381, is required for HMC fate specification and maintenance of HMC gene expression. DMD-4, a DMRT transcription factor, acts downstream of and in conjunction with LET-381 to mediate these functions. Independently of LET-381, DMD-4 also represses the expression of genes associated with a different, non-HMC, mesodermal fate. Our studies uncover essential roles for FoxF transcriptional regulators in endothelial cell development and suggest that FoxF co-functioning target transcription factors promote specific non-contractile mesodermal fates.

HFE
Also flagged:haemochromatosisironGHarthritisGenetic haemochromatosispituitary dysfunction
Journal Article 2025-07-29 ✓ 5 Snippets Craven-Smith L, McClements N, Gomes D, Pointon V.
In-Text Gene Mentions

Type 1 haemochromatosis1 haemochromatosis is…

…mutations in theHFEgene [ 1…

…and diagnosis ofHFE(type 1) GH…

…for phlebotomies withHFE-related hemochromatosis [ 45…

…phlebotomies with HFE-relatedhemochromatosis[ 45 ,…

Show Full Abstract

<h4>Background</h4>Genetic haemochromatosis (GH) is a long-term genetic condition which results in increased iron absorption into the blood and accumulation of iron into certain organs overtime. Increased absorption and accumulation can be fatal. GH can cause many symptoms including arthritis/joint pain, chronic fatigue, and cognitive difficulties. The aim of this study was to measure quality of life (QoL) in people diagnosed with GH (GH-diagnosed) compared to a healthy sample and identify possible explanations for this.<h4>Methodology</h4>QoL was measured in 535 healthy people and 1039 GH-diagnosed, through completion of the World Health Organisation Quality of Life-100 survey (WHOQOL-100). 985 GH-diagnosed respondents completed a GH-focussed survey, which was developed to get further details of the impact of GH.<h4>Results</h4>Comparison of the WHOQOL-100 overall QoL score between GH-diagnosed and the healthy sample found a significantly lower score in the GH-diagnosed. Physical, psychological, level of independence, and spiritual domains were significantly lower in the GH-diagnosed group. The GH-focussed survey found a high incidence of physical and mental symptoms, and some impact on social and work life. Areas in which participants suggest would improve their QoL included: improved healthcare especially with increased understanding of GH in medical professionals, increased access to appointments, in-person appointments, regular checks for organ damage, more nutrition or dietary advice, and local support groups.<h4>Conclusions</h4>Based on the WHOQOL-100 scores and GH-focussed survey, overall QoL is worse in people diagnosed with GH due to worse physical and psychological symptoms. Improved healthcare may aid in reducing the difference in QoL.

Also flagged:synthesissodiumsulfatehydrateanionswater
Journal Article 2025-07-29 No Snippets Fowles DJ, Connaughton BJ, Carter JW, Mitchell JBO, Palmer DS.
Show Full Abstract

Accurate prediction of aqueous solubility for organic molecules is of great importance across a range of fields, from the design and manufacturing of energy materials, to assessing the environmental impact of potential pollutants. It is of particular significance to the pharmaceutical industry, in which problems with low aqueous solubility frequently hamper the development of new drugs. Experimental measurements of solubility are used extensively, but are often time-consuming, resource intensive and only applicable to already synthesized molecules. As such, there is a need for the development of computational approaches to predict solubility. In recent years, there have been considerable advances in physics-based methods, with several contrasting techniques able to give accurate predictions of solubility and a wealth of thermodynamic data for structural optimization. Here, we provide the reader with a thorough understanding of the theoretical background and practical applications of these physics-based methods to predict solubility. This includes discussions of the various advantages and disadvantages of each approach, and an indication of areas of continuing research. Experimental and data-driven methods to assess solubility are also discussed to provide context.

Also flagged:Inflammatory bowel diseaseulcerative colitischronic inflammatory disorderpathogenesispsychological stressferroptosis
Journal Article 2025-07-29 No Snippets Zhang F, Jiang X, Chen X, Wang Z, Xia J, Wang B, Wang M, Ding Y.
Show Full Abstract

<h4>Purpose</h4>To identify ferroptosis-related genes associated with the development of Ulcerative colitis (UC), through bioinformatics and basic experiments.<h4>Methods</h4>Ferroptosis-related genes were identified from UC microarray data extracted from the GEO database and FerrDb. GO and KEGG pathway enrichment analyses were performed. Hub genes were identified through PPI analysis, leading to TF-hub gene and miRNA-hub gene regulatory network, predicting potential drug candidates by DSigDB. RT-qPCR, WB and IHC were employed to validate hub gene expression in animal samples. Clinical samples were gathered from Normal examiners and UC patients and IHC was performed to verify SLC7A5.<h4>Results</h4>Eleven ferroptosis-related DEGs were identified (nine upregulated and two downregulated genes) in UC, with eight genes chosen from the PPI network. MCC algorithm demonstrated that SLC7A11, PSAT1, SLC7A5, ACSF2, and ACSL4 were hub genes, predicting TFs, miRNAs and drugs. RT-qPCR confirmed significant differential expression of SLC7A5, ACSL4, and ACSF2. WB and IHC of mouse samples, as well as IHC of clinical samples, revealed significantly elevated SLC7A5 expression in the UC group compared to controls.<h4>Conclusion</h4>SLC7A5 emerged as a potential focus for understanding UC pathogenesis, potentially influencing ferroptosis. FOXP3, STAT6, and hsa-miR-186-5p are implicated in UC and ferroptosis, with minocycline identified as a potential treatment by inhibiting ferroptosis.

SERPINC1
Also flagged:Pterinsnitrogenaminooxopteridinepteridineglutamate
Journal Article 2025-07-29 ✓ 1 Snippet Ong HB, Wyllie S, Fairlamb AH.
In-Text Gene Mentions

…whereas C. fasciculataCf C1C1 [ 56…

Show Full Abstract

Mammalian cells synthesise tetrahydrobiopterin de novo, an essential cofactor for hydroxylation of aromatic amino acids, cleavage of ether lipids and the synthesis of nitric oxide. In contrast, kinetoplastid parasites are pterin auxotrophs and none of the above metabolic functions can account for the essential requirement of an unconjugated pterin for growth. Here we investigate the pterin requirements for growth and survival of two medically important parasites (T. brucei and L. major) in comparison with the model insect parasite, Crithidia fasciculata. The pterin concentration required to support 50% of maximum growth of each parasite was determined in defined pterin-free media for a variety of naturally occurring pterins. T. brucei and C. fasciculata showed an identical order of preference with the most active being 6-biopterin, followed by dihydrobiopterin > tetrahydrobiopterin > L-neopterin > sepiapterin. In contrast, L. major showed a pronounced growth preference (>200-fold) for the reduced pterins over the the oxidised forms 6-biopterin and L-neopterin. The unnatural isomers 7-biopterin or D-neopterin supported growth poorly, or not at all, in these organisms. Other pterins were inactive. HPLC analysis of pterins supporting growth established that these were metabolised to the tetrahydro-forms (>95%) with no evidence of further interconversion. In the absence of pterins, the parasites failed to grow and lost viability with <1% surviving beyond 5-14 days. Relatively high concentrations of folate or dihydrofolate (>500 nM) could support growth in the absence of unconjugated pterin and HPLC analysis identified pteridoxamine and 6-hydroxymethylpterin (as tetrahydro-form) in cell extracts. A common feature of pterins that support growth is the presence of at least one or more linear carbon substituents at position 6 of the pteridine ring with at least one hydroxyl group, ideally in the 1S configuration. The possible essential roles of these important metabolites are discussed.

PCDH17
Also flagged:gene expressionneurotransmitter receptorsmetabolismoxygenorganizationnitrous oxide
Journal Article 2025-07-29 ✓ 1 Snippet Farahani A, Liu ZQ, Ceballos EG, Hansen JY, Wennberg K, Zeighami Y, Dadar M, Gauthier CJ, Dagher A, Misic B.
In-Text Gene Mentions

…NR4A2, NTNG2, OPRK1,PCDH17, PCDH20, PCP4, PDE1A,…

Show Full Abstract

Blood perfusion delivers oxygen and nutrients to all cells, making it a fundamental feature of brain organization. How cerebral blood perfusion maps onto micro-, meso- and macro-scale brain structure and function is therefore a key question in neuroscience. Here we analyze pseudo-continuous arterial spin labeling (ASL) data from 1305 healthy individuals in the HCP Lifespan studies (5-22 and 36-100 years) to reconstruct a high-resolution normative cerebral blood perfusion map. At the cellular and molecular level, cerebral blood perfusion co-localizes with granular layer IV, biological pathways for maintenance of cellular relaxation potential and mitochondrial organization, and with neurotransmitter and neuropeptide receptors involved in vasomodulation. At the regional level, blood perfusion aligns with cortical arealization and is greatest in regions with high metabolic demand and resting-state functional hubs. Looking across individuals, blood perfusion is dynamic throughout the lifespan, follows micro-architectural changes in development, and maps onto individual differences in physiological changes in aging. In addition, we find that cortical atrophy in multiple neurodegenerative diseases (late-onset Alzheimer's disease, TDP-43C, and dementia with Lewy bodies) is most pronounced in regions with lower perfusion, highlighting the utility of perfusion topography as an indicator of transdiagnostic vulnerability. Finally, we show that ASL-derived perfusion can be used to delineate arterial territories in a data-driven manner, providing insights into how the vascular system is linked to human brain function. Collectively, this work highlights how cerebral blood perfusion is central to, and interlinked with, multiple structural and functional systems in the brain.

Also flagged:SynthesisE3 ligasedegradationcancerneurological disordersprotein degradation
Journal Article 2025-07-29 No Snippets Vicente ATS, Moura SPSP, Salvador JAR.
Show Full Abstract

PROteolysis-Targeting Chimeras (PROTACs) are an emerging class of molecules capable of inducing a forced approximation between a protein of interest (POI) and an E3 ligase enzyme (e.g., Cereblon), leading to the degradation of the POI by the cell's own machinery. Although in early stages of development, PROTACs' unique mechanisms of action offer a novel therapeutic strategy, which has attracted growing interest worldwide. Cereblon-based PROTACs are the most studied class of PROTACs and have been actively researched in recent years for the treatment of different diseases, from cancer to neurological disorders, with some of them already in clinical trials. In this review, we provide a comprehensive and critical analysis covering the recent advances, potential challenges and future prospects regarding the design and synthesis, as well as pre- and clinical evaluation of cereblon-based PROTACs. By integrating insights from drug discovery and development, a broad yet in-depth discussion is given to guide future research on cereblon-based PROTACs.

HFE
Also flagged:chronic liver diseasedeathcirrhosissarcopeniachronic viral hepatitisalcohol
Journal Article 2025-07-29 ✓ 1 Snippet Gage BL, Gela D, Wurjine TH, Habte T.
In-Text Gene Mentions

…liver conditions (e.g.,hemochromatosis, Wilson’s disease) can…

Show Full Abstract

<h4>Background</h4>Chronic liver disease (CLD) is a growing global public health issue and ranks as the seventh leading cause of death in Ethiopia. However, regional-level data particularly from the West Arsi Zone are scarce. This study aimed to fill this gap by assessing the burden and key determinants of CLD among adults attending liver clinics, providing essential evidence for targeted interventions.<h4>Objective</h4>To determine the magnitude and associated factors with medically confirmed CLD among adult patients (≥ 18 years) undergoing follow-up for suspected or confirmed CLD in three public hospitals in the West Arsi Zone.<h4>Methodology</h4>An institution-based cross-sectional study was conducted from February to July 2022. A total of 384 adult participants were selected using systematic random sampling. Data were collected through structured interviews and medical record reviews. Multivariable binary logistic regression was used to identify factors associated with CLD, with adjusted odds ratios (AOR) and 95% confidence intervals (CI) reported.<h4>Results</h4>All 384 selected participants completed the study, yielding a response rate of 100%. Among them, 60.2% (231/384) were clinically diagnosed with chronic liver disease (CLD), with a higher prevalence observed among males (62%).

TNFSF4
Also flagged:hepatocellular carcinomacancercancersgene expressiontumorCEP55
Journal Article 2025-07-29 ✓ 1 Snippet Wu XS, Wei D, Zhu Y, Zhao SL, Liu LX, Tian FM, Liu X, Shi ZT.
In-Text Gene Mentions

…TIGIT, TNFRSF9, TNFRSF14,TNFSF4, CD28, LGALS9, CD70,…

Show Full Abstract

<h4>Background</h4>Immune escape is a critical barrier to effective cancer immunotherapy for cancers such as hepatocellular carcinoma (HCC). The aim of this study was to identify prognostic genes associated with immune escape and to analyse immune infiltration in HCC.<h4>Methods</h4>The TCGA-LIHC cohort gene expression matrix and TCGA cohort were downloaded from the UCSC Xena and TCGA databases, respectively, for differential expression analysis, as well as for clinical data and survival information. Additionally, gene expression matrices from HCC tumor tissue samples were downloaded from the ICGC database to validate prognostic models. Subsequently, enrichment analysis utilizing the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) were conducted. Risk modeling was subsequently performed, followed by univariate and multivariate Cox regression analyses, as well as LASSO regression analysis. Overall survival (OS) curves, receiver operating characteristic (ROC) curves, and nomograms were also generated. Finally, immune infiltration analysis was performed by single-sample genomic enrichment analysis (ssGSEA) and GeneMANIA to predict the functions and pathways of associated with prognostic genes.<h4>Results</h4>A total of 4489 differential expression genes were obtained, including 3259 up-regulated, and 1230 down-regulated. Among them, 2123 GO biological functions and 334 KEGG results were enriched. Subsequently, eight differential genes related to immune escape became candidate genes. Finally, we constructed a risk model using three genes, CEP55, GPAA1 and PIGU, and demonstrated better results. The results of immune infiltration showed that the prognostic genes affected the patient's condition through these immune cells. Subsequently, we performed drug sensitivity analysis and finally discovered that CEP55 and PIGU were positively associated with five drugs in the high-risk group. And these three key prognostic genes have high expression levels in HCC tumor tissues.<h4>Conclusion</h4>Our study found that three prognostic genes: CEP55, GPAA1 and PIGU have good prognostic value for HCC patients, and are the pivotal prognostic biomarkers.

HFE
Also flagged:type 2 diabetes mellitushyperglycemiadiabetesendoplasmic reticulummitochondriatype 2 diabetes
Journal Article 2025-07-29 ✓ 1 Snippet Mehyar N, Alhajeri Z, Alosaimi M, Alanazi Z, Alanazi A, Abusaris R.
In-Text Gene Mentions

…hepatitis C, andhemochromatosis( 9 –…

Show Full Abstract

<h4>Introduction</h4>Increasing evidence shows that hyperglycemia-induced glucotoxicity and lipotoxicity that usually accompany diabetes development damage the endoplasmic reticulum and mitochondria of the hepatocytes in diabetic patients. Clinical studies highlighted the association between type 2 diabetes mellitus, comorbidities, and medications with liver function. The objective of this study is to explore the association between liver function tests' abnormalities and comorbidities, medications, and other risk factors in type 2 diabetes patients registered in the Best-Care system of the Saudi Ministry of National Guard-Health Affairs.<h4>Methods</h4>This is a cross-sectional study employing a chart of patients diagnosed with type 2 diabetes mellitus. We drew a simple random sample of 523 T2DM patients who had a liver function test from the Best-Care database of the Ministry. We applied various statistical analyses, including Student's independent t-test, Pearson's chi-squared test, Fisher's exact test, and odd ratios, to measure associations between different variables and liver function tests' abnormalities.<h4>Results</h4>About 35% of patients included in this study showed an abnormal level of gamma-glutamyl transferase and prothrombin time. Abnormalities of serum albumin, prothrombin time, and total serum protein tests were significantly associated with age (P < 0.05). Gamma-glutamyl transferase test abnormalities were significantly associated with gender (P < 0.05). The study found associations between several comorbidities and the abnormalities of liver function tests. These tests include the total bilirubin, albumin, total serum protein, gamma-glutamyl trans, international normalized ratio, and alanine aminotransferase. The associations were at significant levels (P < 0.05). Liraglutide was significantly associated with aspartate aminotransferase (OR = 14.40, 95% CI = 2.8, 73.2), while allopurinol was significantly associated with international normalized ratios (OR = 24.67, 95% CI = 2.95, 206.58) and total serum protein (OR = 5.44, 95% CI = 1.43, 20.83).<h4>Discussion</h4>This study is the first to examine the association between type 2 diabetes mellitus and liver function tests' abnormalities in Saudi Arabia. Although the results have a limited generalizability due to inherent biases, the findings align with similar studies in other populations. The study stresses the need to monitor liver functions, especially of T2DM patients who suffer from other conditions.

Also flagged:HLA-Gprimary biliary cholangitisautoimmune liver diseaseautoimmune hepatitis type 1AIH-11
Journal Article 2025-07-29 No Snippets Miglianti M, Mocci S, Littera R, Serra G, Balestieri C, Conti M, Pes F, Deidda S, Lorrai M, Mereu C, Murgia M, Sanna C, Mascia A, Sedda F, Duś-Ilnicka I, Cipri S, Carta MG, Lai S, Giuressi E, Melis M, Zolfino T, Giglio S, Perra A, Chessa L.
Show Full Abstract

<h4>Introduction</h4>Primary biliary cholangitis (PBC) is a rare autoimmune liver disease involving bile duct damage and fibrosis. This study explores the role of HLA-G, an immunomodulatory molecule crucial for immune tolerance, in PBC pathogenesis and treatment.<h4>Methods</h4>A cohort of 166 PBC patients from Sardinia was compared to 180 healthy controls and 205 autoimmune hepatitis type 1 (AIH-1) patients. Plasma soluble HLA-G (sHLA-G) levels, <i>HLA-G</i> alleles, and <i>3'UTR</i> haplotypes were analyzed alongside clinical data, including therapy response to ursodeoxycholic acid.<h4>Results</h4>The UTR-1 haplotype was significantly more frequent in PBC patients than in controls (48.2% vs 34.3%, Pc= 0.0018). The extended haplotype <i>HLA-G*01:01:01:08/UTR-1</i> was also strongly associated with PBC (23.2% vs 12.5% in controls, Pc = 0.008; 23.2% vs 6.6% in AIH-1, Pc= 2.6×10<sub>-9</sub>). PBC patients exhibited lower sHLA-G levels compared to controls and AIH-1 (9.1 U/mL vs 24.03 U/mL and 13.9 U/mL, respectively). Among <i>UTR-1</i> carriers, sHLA-G levels were particularly reduced in PBC patients. The <i>HLA-G*01:01:01:08/UTR-1</i> haplotype correlated with the lowest sHLA-G levels and poorer therapy response (60% vs 24.1%, P = 0.0001).<h4>Discussion</h4>These findings suggest HLA-G variants, especially <i>HLA-G*01:01:01:08/UTR-1</i>, as potential biomarkers for PBC prognosis and treatment outcomes.

TRIM38
Also flagged:immune responsechronic infectious diseasebrucellosisInfectioninnate immunitytype IV secretion
Journal Article 2025-07-29 ✓ 1 Snippet Wang L, Lu P, Wang X, Song X, Tong X, Yang S, Li Z.
In-Text Gene Mentions

…BspF-mediated crotonylation atTRIM38’s K142 site, regulating…

Show Full Abstract

<h4>Introduction</h4><i>Brucella</i> bacteria are adept at evading the human immune system, leading to a chronic infectious disease known as brucellosis, which poses significant global health challenges. This study addresses a notable gap in bibliometric analyses concerning the immune response to brucellosis.<h4>Methods</h4>We conducted a comprehensive literature screening from the Web of Science Core Collection, covering publications from 1980 to 2024. Relevant publications were analyzed using R software, VOSviewer, and CiteSpace for bibliometric analysis.<h4>Results</h4>A total of 733 publications were included in this study, revealing an average annual growth rate of 5.91% in publications. The United States led in publication volume and citations, followed by China and France. Prominent research institutions included INSERM (France) and CONICET (Argentina). <i>Infection and Immunity</i> was identified as a leading journal in the field, publishing 97 papers with 5,184 citations. Keyword co-occurrence analysis delineated three main research clusters: <i>Brucella</i> vaccine development and immune protection, <i>Brucella</i> molecular mechanisms and intracellular survival strategies, and host innate immunity and <i>Brucella</i> interaction mechanisms. Burst analysis highlighted increasing attention on keywords such as "protection," "type IV secretion system," "pathogenesis," and "prediction" since 2018.<h4>Discussion</h4>This bibliometric analysis sheds light on the global research landscape regarding the immune response in human brucellosis, pinpointing trends and gaps, with a focus on immune escape mechanisms and the future development of safe, effective vaccines.

HFE
Also flagged:wound infectioninfectiongangreneinfectionsVibrio vulnificus infectionwound infections
Journal Article 2025-07-29 ✓ 1 Snippet Zhang E, Chen Z, Feng D, Chen G, Yin D.
In-Text Gene Mentions

…ysfunction, diabetes mellitus,hemochromatosis, AIDS, malignancies, or…

Show Full Abstract

In this paper, we report a case of traumatic wound infection caused by dorsal fin puncture of live fish. A 69-year-old woman developed progressive swelling of her right pinky finger after being stabbed by the dorsal fin of a live fish. The infection was confirmed by bacterial culture as a <i>Vibrio vulnificus</i> infection of a traumatic wound. The patient underwent antibiotic treatment, surgical decompression, debridement, and excision of necrotic tissue. Finally, the right pinkie finger was amputated due to dry gangrene. Early intervention and combined antibiotic therapy led to a good prognosis. As global ocean temperatures rise, the infection rate of this bacterium increases, and vigilance is needed. Clinical practice suggests that such infections should be considered in patients with a history of contact with seafood or seawater; Early diagnosis, active antibiotic therapy and necessary surgical intervention are the keys to improving the prognosis.

Also flagged:Flecainideventricular tachycardiaarrhythmiasatrial fibrillationAFparoxysmal supraventricular tachycardia
Journal Article 2025-07-29 No Snippets Kumar A, Gupta M, Varshney A, Kumar R.
Show Full Abstract

<h4>Background</h4>Flecainide is a Class IC antiarrhythmic drug used to treat arrhythmias such as atrial fibrillation (AF), paroxysmal supraventricular tachycardia, and ventricular tachycardia (VT). Its mechanism involves blocking sodium channels, leading to QRS widening, especially at higher heart rates. This property increases the risk of pro-arrhythmic events, particularly in patients with structural heart disease or ischaemia.<h4>Case summary</h4>A 67-year-old woman receiving flecainide for AF suffered an ischaemic stroke and later developed VT resistant to amiodarone and direct current cardioversion. Her condition improved significantly after intravenous sodium bicarbonate was administered, which counteracted the effects of sodium channel blockade. Later, she was found to have hyponatremia and slightly elevated flecainide values above the upper limit. This case highlights the complexities of flecainide therapy and the importance of timely intervention in managing arrhythmias.<h4>Discussion</h4>This case underscores the arrhythmogenic potential of flecainide. The development of VT suggests that flecainide may have created a substrate for arrhythmias due to its effects on cardiac conduction. The successful use of sodium bicarbonate illustrates an effective treatment strategy for reversing flecainide-induced toxicity. Clinicians should remain vigilant and consider alternative therapies in managing patients at risk for arrhythmias while on flecainide.

Also flagged:Diabetic NephropathyDNdiabetesdeathdiabetes mellitusglucose
Journal Article 2025-07-29 No Snippets Wang X, Jing R, Yang T, Shao R, Yang F, Shi Y, Yang X, An D, Liang Y.
Show Full Abstract

Diabetic Nephropathy (DN), a leading cause of disability and mortality in patients with diabetes, has become a complex global clinical issue that poses a severe challenge to public health. Research indicates that Non-coding RNAs (ncRNAs) participate in cell death and fibrosis through an endogenous competitive RNA (ceRNA) network. This network regulates kidney-specific cells such as podocytes, mesangial cells, and renal tubular epithelial cells, thereby establishing a multifaceted regulatory mechanism in DN progression. Furthermore, exosomal ncRNAs and their ceRNA networks, stem cell-derived exosomal ncRNAs, related biomolecules, and the targeted regulation of ncRNAs and ceRNA networks by traditional Chinese medicine all play significant roles in the advancement of DN. This review systematically summarizes the content of ncRNAs, ceRNA networks and DN, exosome ncRNA intervention in DN progression, and targeted regulation of ncRNA intervention in DN progression. Concurrently, it discusses the research progress and therapeutic status of ncRNAs as clinical biomarkers, challenges facing ncRNA-targeted therapy, therapeutic efficacy of exosomal ncRNAs and stem cell-derived exosomal ncRNAs, pharmacokinetic limitations of Chinese medicine components in regulating DN progression through ncRNA intervention, and analyses the bottlenecks in ncRNA-based diagnosis and cross-species conservation of circRNAs/lncRNAs. This study aimed to provide new insights for the in-depth exploration of the molecular mechanisms underlying DN and the development of targeted therapeutic strategies.

SERPINC1
Also flagged:segmentationoligonucleotidedeathphenylketonuriacoagulationCRISP
Journal Article 2025-07-29 ✓ 2 Snippets Henry JA.
In-Text Gene Mentions

…anels* Antithrombin DeficiencySERPINC1(e.g., c.391C >…

…c.391C > T)SERPINC1Two Panels Protein…

Show Full Abstract

<h4>Introduction</h4>The Population Health Management (PHM) Genomic Newborn Screens (GNBS) and Multi-Omics Intercepts for Human Phenotype Ontology (HPO) using Federated Data Platforms (FDP) represent a groundbreaking innovation in global health. This reform, supported by the UK's Genomic Medical Services (GMS) through "The Generation Study," aims to significantly reduce infant mortality by identifying and managing over 200 rare diseases from birth, paving the way for personalised health planning.<h4>Methods</h4>Using an ecosystem approach, this study evaluates a diverse pangenome to predict health outcomes or confirm diagnoses prior to symptomatic manifestations. GNBS standardises care by integrating diagnostic techniques such as blood spot analysis and full blood cell diagnostics to stratify risk. The approach enhances the understanding of rare diseases in primary care medicine, with biomedical and haematology diagnoses re-evaluated. Scientific proof of concept and fit-for-purpose technology align multi-omics in pre-eXams (X = Gen AI).<h4>Recommendations</h4>The Digital Regulation Service (DRS) assembles an agile group of experts to enhance medical science through human phenotype ontology (HPO) for precise disease segmentation, scheduling accurate eXam intercepts where needed. This team strategically plans regulation services for digital HPO eXam assurance and implements Higher Expert Medical Science Safety (HEMSS) frameworks. The DRS is responsible for overseeing gene, oligonucleotide, and recombinant protein intercepts; commissioning blood pathology HPO eXam intercepts; and monitoring preliminary eXams with advanced imaging techniques.<h4>Discussion</h4>In pursuit of excellence in PHM of HPO, HEMSS with Agile Group Development leverages the Genomic Newborn Screens (GNBS) and multi-omics to create personalised health plans integrated with NHS England Genomics and AI-driven DRS. The discourse extends to examining GNBS predictors and intercepts, focusing on their impact on public health and patient safety. Discussions encompass structured HPO knowledge addressing newborn health, ethical considerations, family privacy, and the benefits and limitations of pre-eXam screenings and life eXam intercepts. These debates involve stakeholders in adopting HPO-enhanced clinical pathways through Alliances for Health Systems Networking-Genomic Enterprise Partnerships (AHSN-GEP).<h4>Conclusion</h4>"The Generation Study" represents a paradigm in digital child health management using an HPO-X-Gen-AI framework, transitioning from trusted research to evidence-based discovery. This approach sets a standard for personalised healthcare practices, incorporating ontology risk stratification and future-ready analytics as outlined in the NHS Constitution. The discourse on higher expert medical science safety governance will continue in the forthcoming manuscript, "PHM Fit Lifecycles in Future Analytics," which will further explore developing localised health solutions for "Our Future Health."

HFE
Also flagged:Hepatitis BLiver DiseaseChronic Hepatitis BCirrhosischronic hepatitisliver cirrhosis
Journal Article 2025-07-29 ✓ 1 Snippet Oh J, Baritugo KG, Kim J, Park G, Han KJ, Lee S, Sung GH.
In-Text Gene Mentions

…injury, Wilson’s disease,hemochromatosis, or biliary tract…

Show Full Abstract

<b>Background/Objective:</b> The hepatitis B virus (HBV) can cause chronic hepatitis B (CHB), which can rapidly progress into fatal liver cirrhosis (CHB-LC) and hepatocellular carcinoma (CHB-HCC). <b>Methods:</b> In this study, we investigated metabolites associated with distinct clinical stages of HBV infection for the identification of stage-specific serum metabolite biomarkers using <sup>1</sup>H-NMR-based metabolomics. <b>Results:</b> A total of 64 serum metabolites were identified, among which six core discriminatory metabolites, namely isoleucine, tryptophan, histamine (for CHB), and pyruvate, TMAO, lactate (for CHB-HCC), were consistently significant across univariate and multivariate statistical analyses, including ANOVA with FDR, OPLS-DA, and VIP scoring. These metabolites were closely linked to key metabolic pathways, such as propanoate metabolism, pyruvate metabolism, and the Warburg effect. <b>Conclusions:</b> The findings suggest that these six core metabolites serve as potential stage-specific biomarkers for CHB, CHB-LC, and CHB-HCC, respectively, and offer a foundation for the future development of metabolomics-based diagnostic and therapeutic strategies.

DCC
Also flagged:gene expressionATP2A3UNC5CACTN3α-actinin-3ACE
Journal Article 2025-07-29 ✓ 1 Snippet Kozuma A, Bulgay C, Zempo H, Saito M, Deguchi M, Homma H, Matsumoto S, Matsumoto R, Kasakolu A, Kazan HH, Bıyıklı T, Koncagül S, Baydaş G, Ergun MA, Szabo A, Semenova EA, Larin AK, Kulemin NA, Generozov EV, Okamoto T, Nakazato K, Ahmetov II, Kikuchi N.
In-Text Gene Mentions

…reported that the NTN1/DCCsignaling pathway involving…

Show Full Abstract

<h4>Background</h4>In recent years, comprehensive analyses using a genome-wide association study (GWAS) have been conducted to identify genetic factors related to athletic performance. In this study, we investigated the association between genetic variants and elite wrestling status across multiple ethnic groups using a genome-wide genotyping approach.<h4>Methods</h4>This study included 168 elite wrestlers (64 Japanese, 67 Turkish, and 36 Russian), all of whom had competed in international tournaments, including the Olympic Games. Control groups consisted of 306 Japanese, 137 Turkish, and 173 Russian individuals without elite athletic backgrounds. We performed a GWAS comparing allele frequencies of single-nucleotide polymorphisms (SNPs) between elite wrestlers and controls in each ethnic cohort. Cross-population analysis comprised (1) identifying SNPs with nominal significance (<i>p</i> < 0.05) in all three groups, then (2) meta-analyzing overlapped SNPs to assess effect consistency and combined significance. Finally, we investigated whether the most significant SNPs were associated with gene expression in skeletal muscle in 23 physically active men.<h4>Results</h4>The GWAS identified 328,388 (Japanese), 23,932 (Turkish), and 30,385 (Russian) SNPs reaching nominal significance. Meta-analysis revealed that the <i>ATP2A3</i> rs6502758 and <i>UNC5C</i> rs265061 polymorphisms were associated (<i>p</i> < 0.0001) with elite wrestling status across all three populations. Both variants are located in intronic regions and influence the expression of their respective genes in skeletal muscle.<h4>Conclusions</h4>This is the first study to investigate gene polymorphisms associated with elite wrestling status in a multi-ethnic cohort. <i>ATP2A3</i> rs6502758 and <i>UNC5C</i> rs265061 polymorphisms may represent important genetic factors associated with achieving an elite status in wrestling, irrespective of ethnicity.

Also flagged:EPAS1hypoxia-inducible transcription factorsmatinginseminationInfectious diseasesviral diarrhea
Journal Article 2025-07-29 No Snippets Naz S, Chatha AMM, Ullah Q, Farooq M, Jamil T, Muner RD, Kiran A.
Show Full Abstract

The yak (<i>Bos grunniens</i>) is a key species in high-altitude rangelands of Asia. Despite their ecological and economic importance, yak production faces persistent challenges, including low milk yields, vulnerability to climate changes, emerging diseases, and a lack of systematic breeding programs. This review presents the genomic, physiological, and environmental dimensions of yak biology and husbandry. Genes such as <i>EPAS1</i>, which encodes hypoxia-inducible transcription factors, underpin physiological adaptations, including enlarged cardiopulmonary structures, elevated erythrocyte concentrations, and specialized thermoregulatory mechanisms that enable their survival at elevations of 3000 m and above. Copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) present promising markers for improving milk and meat production, disease resistance, and metabolic efficiency. F1 and F2 generations of yak-cattle hybrids show superior growth and milk yields, but reproductive barriers, such as natural mating or artificial insemination, and environmental factors limit the success of these hybrids beyond second generation. Infectious diseases, such as bovine viral diarrhea and antimicrobial-resistant and biofilm-forming <i>Enterococcus</i> and <i>E. coli</i>, pose risks to herd health and food safety. Rising ambient temperatures, declining forage biomass, and increased disease prevalence due to climate changes risk yak economic performance and welfare. Addressing these challenges by nutritional, environmental, and genetic interventions will safeguard yak pastoralism. This review describes the genes associated with different yak traits and provides an overview of the genetic adaptations of yaks (<i>Bos grunniens</i>) to environmental stresses at high altitudes and emphasizes the need for conservation and improvement strategies for sustainable husbandry of these yaks.

Also flagged:insomnia disordermental diseasesbehavioralinsomniacapsulesinsomnia disorder comorbid with chronic pain
Journal Article 2025-07-29 No Snippets Kwok YL, Wang R, Tang HT, Chen S, Yeung A, Bian Z, Yu DJ.
Show Full Abstract

<h4>Background</h4>Over 20 % of adults with insomnia disorder also experience chronic pain, termed insomnia disorder comorbid with chronic pain (ICCP), increasing risks for physical and mental diseases. Current treatments like cognitive behavioral therapy for insomnia show inconsistent pain relief, and non-opioid analgesics may exacerbate insomnia, underscoring the need for alternative approaches. Chinese herbal medicine (CHM) and acupuncture, guided by traditional Chinese medicine, may offer transdiagnostic benefits for ICCP, but a comprehensive review is lacking. This scoping review evaluates their therapeutic effects and mechanisms for ICCP.<h4>Methods</h4>PubMed, Wanfang, ClinicalTrials.gov and Google Scholar were searched up to December 31, 2024, for randomized controlled trials (RCTs) involving adults (≥18 years) with Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition-defined insomnia and the International Association for the Study of Pain-defined chronic pain, treated with CHM or acupuncture. Effect sizes (modified Cohen's d) assessed efficacy of interventions, and the Cochrane Risk of Bias 2 tool evaluated the risk of bias.<h4>Results</h4>Six RCTs (487 participants) were included. CHM (modified Guipi decoction) showed medium to large effects for insomnia (<i>d</i> = 0.70-1.17) and pain (<i>d</i> = 0.67-1.42) versus diazepam/estazolam. Acupuncture had medium to large effects for insomnia (<i>d</i> = 0.64-0.99) and pain (<i>d</i> = 0.80-1.33) compared to treatment as usual. Combined CHM (Da Huoluo capsules) and acupuncture showed medium effects (<i>d</i> = 0.72 for insomnia; <i>d</i> = 0.57 for pain) versus multi-medications/traction. Most studies (83.33 %) had high risk of bias.<h4>Conclusion</h4>CHM and acupuncture show promise for ICCP management, but high risk of bias warrants cautious interpretation and further high-quality RCTs.

OLFM4
Also flagged:FructoseKetohexokinaseagingAstragaloside IVKHKmetabolism
Journal Article 2025-07-29 ✓ 5 Snippets Wu Q, Li Y, Zhao Y, Zhang R, Tong J, Ji C, Zhao Y, Wu M, Jin X, Wang D, Tong H, Sun L, Liu F.
In-Text Gene Mentions

…(no. 34330), rabbitOLFM4(D6Y5A) mAb (no.…

…mmunofluorescence staining forOLFM4and Ki67 in…

…dilution) or rabbitOLFM4(D6Y5A) mAb (no.…

…the density ofOLFM4-positive stem cells in…

…ISC markers, includingOlfm4, Lgr5 ,…

Show Full Abstract

Excessive fructose intake drives intestinal aging and impairs intestinal stem cell (ISC) function, yet effective therapeutic interventions remain elusive. Astragaloside IV (AS-IV), a natural saponin from <i>Astragalus membranaceus</i>, has been widely recognized for its antiaging, anti-inflammatory, and gut-protective properties. Here, we revealed that AS-IV alleviates fructose-induced intestinal metabolic senescence via direct inhibition of ketohexokinase (KHK), the key rate-limiting enzyme in fructose metabolism. Molecular docking and site-directed mutagenesis identified Asn261 and Ala226 as distinct binding sites for AS-IV on KHK, with Asn261 also serving as a critical catalytic residue that is essential for KHK activity. Mutation at Asn261 abolished KHK enzymatic function, reduced the accumulation of fructose-derived metabolites such as palmitic acid and ceramide, and thereby prevented fructose-induced ISC cycle arrest. AS-IV's therapeutic efficacy was validated across <i>Drosophila</i>, murine intestinal organoids, and mice, where treatment consistently reversed high-fructose-induced intestinal metabolic senescence phenotypes, restored ISC proliferation, and preserved ISC homeostasis. These findings indicate that KHK is a previously unrecognized molecular target of AS-IV and reveal a conserved mechanism by which AS-IV modulates fructose metabolism to interfere with gut aging. Our results highlight its therapeutic potential in treating fructose-driven intestinal aging and associated metabolic disorders.

SERPINC1
Also flagged:Liver Cirrhosisportal vein thrombosisportal hypertensionendotoxemiametabolic syndromecoagulation
Journal Article 2025-07-29 ✓ 2 Snippets Yang Z, Zhao Y, Chen H, Zhang H, Tan M, Li X, Tao L, Zhao H.
In-Text Gene Mentions

SERPINC1Causing the deficiency…

…PS, protein S;SERPINC1, serpin family C…

Show Full Abstract

Actively identifying the risk factors and predictive indicators associated with portal vein thrombosis (PVT) in liver cirrhosis (LC) can enable early diagnosis and treatment, which is of great significance for prolonging the survival of patients with LC. Hemodynamic disturbances, advanced LC, vascular endothelial injury, and mutations in thrombophilic genetic factors are established risk factors for PVT-LC. Venous dilatation and decreased blood flow velocity contribute to hemodynamic disturbances. The severity of LC can be assessed by the degree of portal hypertension, liver metabolic function biomarkers, and validated liver scoring systems. Iatrogenic interventions, endotoxemia, and metabolic syndrome may induce vascular endothelial injury and hypercoagulability, the latter of which can be quantified via coagulation-anticoagulation-fibrinolysis biomarkers. Mutations in thrombophilic genetic factors, such as Factor V Leiden, MTHFR C667T, and JAK2 V617F, disrupt coagulation-anticoagulation homeostasis and predispose patients to PVT-LC. This review specifically focuses on comprehensively delineating established risk factors and predictive indicators for PVT-LC, thereby providing a theoretical foundation for the construction of clinically applicable PVT predictive models to guide early interventions and improve the prognosis. Future research should further validate the associations between recently proposed risk factors and PVT-LC, while simultaneously establishing cutoff values for indicators with robust predictive value to construct a clinically applicable PVT prediction framework.

DCC
Also flagged:axonal projectionsorganizationgene expressionbrain disordersmajor depressive disorderschizophrenia
Journal Article 2025-07-29 ✓ 5 Snippets Jin S, Li J, Wang J.
In-Text Gene Mentions

…neurons, resulting inDCCvalues of 1.660…

…resulting in aDCCof 6.197 (…

…also examined theDCCof the hub…

…bridge edges (i.e.,DCC> 1), whereas…

…cell types hadDCC> 1.…

Show Full Abstract

Single-subject morphological brain networks derived from cross-feature correlation of macroscopic MRI-derived morphological measures provide an important means for studying the brain connectome. However, the validity of this approach remains to be confirmed at the microscopic level. Here, we constructed morphological brain networks at the single-cell level by extending features from macroscopic morphological measures to microscopic descriptions of neuronal morphology. We demonstrated the feasibility and generalizability of the method using neurons in the somatosensory cortex of a rat, neurons over the whole brain of a mouse, and neurons in the middle temporal gyrus (MTG) of a human. We found that interneuron morphological similarity was higher for intra- than interclass connections, depended on cytoarchitectonic, chemoarchitectonic, and laminar classification of neurons (rat), differed between regions with different evolutionary timelines (mouse), and correlated with neuronal axonal projections (mouse). Furthermore, highly connected hub neurons were disproportionately from superficial layers (rat), inhibitory neurons (rat), and subcortical regions (mouse), and exhibited unique morphology. Finally, we demonstrated a more segregated, less integrated, and economic network architecture with worse resistance to targeted attacks for neurons in human MTG than neurons in a mouse's primary visual cortex. Overall, our method provides an alternative avenue to study neuronal wiring diagrams in brains.

bioRxiv 2025-07-29 Preprint (No Snippets API) Sharysh D, Nogales P, Morales-Cano D, Markov A, Izquierdo-Serrano R, Carramolino L, Albarrán-Juárez J, Bentzon J.
Show Full Abstract

The proliferation and phenotypic modulation of smooth muscle cells (SMCs) to alternative mesenchymal states is a key process by which atherosclerotic lesions grow. The underlying mechanisms can be studied in mouse and pig atherosclerosis, but it remains unclear to what extent the mesenchymal plaque cell types in these species recapitulate human disease. Here, we integrate published and new single-cell RNA sequencing data of plaque mesenchymal cells from human carotid and coronary arteries, pig aorta and coronary arteries, and mouse brachiocephalic arteries. By applying consensus across multiple integration and gene homology-matching strategies, we identify a conserved core continuum of mesenchymal plaque cells, ranging from SMCs to extracellular matrix-producing fibroblast-like cells, which is stable across species and vascular beds. Notably, several other populations differed between human and experimental lesions. Subpopulations of SMCs marked by DLX5 and RERGL expression were specific to human carotid and coronary plaques, respectively. Mesenchymal cell states with strong pro-angiogenic and inflammation-associated gene signatures were identified in pig, but not human, coronary plaque datasets, with the pro-angiogenic phenotype associated with early stages of necrotic core development. Pericytes were solely present in pig and human plaques, while chondrocyte-like cells were unique to mouse lesions. The presented interspecies maps of mesenchymal cell diversity, and their markers may inform translational research into the role of SMCs and their derived progeny in atherosclerosis.

Also flagged:nucleic acidsinfectious diseasessynthesisionsbindingoligonucleotide
Journal Article 2025-07-28 No Snippets Aguanell A, Hennebelle M, Ortega MÁ, Pérez-Fernández R.
Show Full Abstract

Protein-directed dynamic combinatorial chemistry (P-D DCC) is a powerful strategy for identifying ligands to protein targets of pharmacological significance. It leverages a thermodynamic templated effect, where proteins selectively amplify high-affinity binders. In contrast, although nucleic acids play critical roles in gene regulation and disease and offer significant therapeutic potential, they remain underexplored in drug discovery. While P-D DCC has been widely applied, the use of nucleic acid-directed dynamic combinatorial chemistry (NA-D DCC) is relatively limited. Expanding these methodologies is essential for tackling emerging infectious diseases and advancing therapeutic development. This review examines the applications, experimental design considerations, recent advancements, and P-D DCC and NA-D DCC perspectives.

Also flagged:polymersvesiclemembranessynthesismembranevesicles
Journal Article 2025-07-28 No Snippets Coats JP, Nikoletić A, Heuberger L, Mihali V, Schoenenberger CA, Dinu IA, Palivan CG.
Show Full Abstract

pH-responsive nanocarriers have gain significant attention due to their ability to provide controlled cargo delivery with high precision in response to specific stimuli. However, the polymers used in the self-assembly of these nanocarriers must be carefully designed to meet the requirements of bio-relevant delivery. Here, we present an optimized synthesis of poly(2-methyl-2-oxazoline)-block-poly(2-(diisopropylamino)ethyl methacrylate) (PMOXA-b-PDPA) block copolymers tailored for obtaining carriers with vesicle architecture and thin membranes for an improved release behavior. By systematically modifying the synthesis conditions, we obtain a small library of copolymers, focusing on low molecular weight (MW) variants to reduce the membrane thickness of the resulting vesicles. We investigate the impact of membrane thickness on the kinetics and efficiency of cargo release in response to a pH shift from neutral to slightly acidic conditions that are particularly relevant in pathological environments like tumors. Model cargos of varying MWs, including doxorubicin hydrochloride, exhibited differential release profiles under these pH conditions. Together with no cytotoxicity, the thin membrane represents key aspects that support further development of such carriers for therapeutic applications.

HTT
Also flagged:OPTNjuvenile open-angle glaucomanucleotidedeathpathogenesisglaucoma
Journal Article 2025-07-28 ✓ 3 Snippets Yadav M, Dhull CS, Sachdeva S, Yadav A, Bhardwaj A, Panghal V, Kumari A, Yadav R, Sharma S, Tanwar M.
In-Text Gene Mentions

…such as Rab8,Htt, myosin VI, and…

…between optineurin andhttprotein is vital…

…interactions among OPTN,Htt, Rab8, and TBK1…

Show Full Abstract

<h4>Purpose</h4>In the current study, we have screened the OPTN gene in a cohort of unrelated juvenile open-angle glaucoma (JOAG) patients negative for possible pathogenic variants in CYP1B1 and MYOC genes.<h4>Methods</h4>Polymerase chain reaction (PCR) amplification and sequencing were employed to identify nucleotide variants within the coding sequence and intron-exon boundaries of the OPTN gene in 85 JOAG patients and 100 controls. A pathogenicity prediction of identified variants was performed by six distinct online algorithms. Possible structural alterations caused by pathogenic variants were investigated using GOR IV, PyMol, ChimeraX, and molecular dynamics simulations using Gromacs software.<h4>Results and discussion</h4>PCR amplification and sequencing revealed a total of 27 variations, encompassing eight missense, six synonymous, and 13 intronic changes. Out of the 85 patients, three JOAG individuals exhibited possible pathogenic variants. A novel missense variant p.(Q518L) was also observed and registered at NCBI with accession number PP898303. Computational algorithms identified three potential pathogenic variants. These variants induce disruptions and structural alterations which in turn compromise their functionality. This ultimately leads to retinal ganglion cells death and the eventual manifestation of glaucomatous damage resulting in vision loss.<h4>Conclusion</h4>This is the first report showing the involvement of pathogenic OPTN gene variants in JOAG cases from North Indian population which was unknown till now. This study provides population-specific data on genetic contribution of OPTN genes in JOAG pathogenesis. Genetic investigations like this may help in the understanding of disease pathogenesis and development of therapy for glaucoma management/treatment in the near future.

HTT
Also flagged:HDneurodegenerative disorderbehaviouralcognitive impairmentHuntingtinsarcopenia
Journal Article 2025-07-28 ✓ 1 Snippet Peball M, Schörghuber P, Carbone F, Zinganell A, Di Pauli F, Schwarzová K, Djamshidian A, Seppi K, Heim B.
In-Text Gene Mentions

…neration, dysfunctional mutantHTT-protein itself or its…

Show Full Abstract

Huntington´s Disease (HD) is an autosomal dominant, neurodegenerative disorder with characteristic motor, behavioural, and cognitive impairment. Mutant Huntingtin may also affect peripheral tissue. We aimed to assess skeletal muscle (SMM) and fat mass, sarcopenia (EWGSOP2), and malnutrition in HD patients in early disease stages compared to age- and sex-matched healthy subjects. Body composition was evaluated by bioelectrical impedance analysis. The Unified HD Rating Scale and cognitive assessments were used for clinical characterization. Twenty early-stage HD patients (45% females) with a median age of 57 years, body mass index of 22 kg/m<sup>2</sup>, Total Motor Score of 17 points, and Total Functional Capacity of 10 points were included consecutively and prospectively. Confirmed sarcopenia (15%, n = 3) was uncommon. Appendicular SMM index was reduced in 60% (n = 12) and body fat mass in 35% (n = 7). SMM reduction was significantly associated with low weight (p = 0.049) and body fat (p = 0.048). Patients in disease-stage2 (n = 11) had a lower weight (p = 0.009) and body fat (p = 0.008) than patients in disease-stage1 (n = 9; i.e., patients without functional decline). Weight was also lower (p = 0.011) when compared to 20 healthy controls (45% females; median age 56 years). Fifty-five % of HD patients were at risk for malnutrition or malnourished (Mini Nutritional Assessment). The latter correlated with weight (r<sub>s</sub> = 0.724, p < 0.001), SMM (r<sub>s</sub> = 0.473, p = 0.035), body fat mass (r<sub>s</sub> = 0.611, p = 0.004), motor symptoms (r<sub>s</sub> = - 0.519, p = 0.019), independence (r<sub>s</sub> = 0.450, p = 0.046), and executive function (r<sub>s</sub> = 0.526, p = 0.017). Reduction of muscle or fat mass and malnutrition are common even in early-stage HD, which may contribute to progressive wasting and dependence.

Also flagged:cancerMHCtumoradaptive immunityCD4CD8
Journal Article 2025-07-28 No Snippets Yousefi MJ, Afshar Y, Amoozadehsamakoosh A, Naseri A, Soltani F, Yazdanpanah N, Saleki K, Rezaei N.
Show Full Abstract

Innate-like T cells (ILTCs) have recently emerged as a new target of several cancer immunotherapies. Some unique features, such as rapid MHC-independent recognition of antigens, performing heterogeneous anti-tumor activities, and being less susceptible to tumor-induced suppression, suggest promising roles of ILTCs in cancer immunology. On the other hand, these cells exhibit a dualistic nature in cancer, which includes both pro-tumor and anti-tumor effects, highlighting the importance of the complex regulatory environment of their functioning and activation. The functions and evolution of ILTC are greatly influenced by microRNAs (miRNAs), small non-coding RNA molecules that mediate post-transcriptional regulation. Considering the kind of ILTCs, miRNA, and cancer type, this interaction resembles both a tumor promoter and suppressor. ILTC functions and evolution are closely associated with microRNAs (miRNAs), small noncoding RNA molecules that play posttranscriptional regulatory roles. Depending on the type of ILTCs, miRNA, and cancer, this interaction resembles both a Tumor promoter and a tumor Suppressor. This review addresses the complicated relationship between ILTCs and different miRNAs, such as miR-155, let-7 s, and miR-181a, expressed in tumor cells, ILTCs, or packed in tumor-derived exosomes. We will underscore the synergetic effects of the expression of miRNA in tumor and immune cells, influencing ILTC's function and cancer progression. We emphasized the recent and innovative therapeutic approaches, novel delivery systems, and CAR-T cell-based strategy, and the therapeutic potential of modifying the expression of miRNA to regulate the miRNA expression to modulate ILTC activity and improve cancer treatment.

Also flagged:Obesitychronic diseasestype 2 diabetesheart diseasenon-communicable diseasesmetabolic syndrome
Journal Article 2025-07-28 No Snippets Ercan SN, Sanlier N.
Show Full Abstract

<h4>Purpose of review</h4>This review examines the role of adipokines and gene polymorphisms in the development of depression and obesity. It is of great importance to understand the mechanisms that may be effective in the development of obesity and depression as their incidence increases.<h4>Recent findings</h4>Adipokines are released from adipose tissues and primarily regulate the connection between the metabolic and inflammatory effects of obesity and the brain cells and adipose tissue. Adipokines may potentially contribute to the pathophysiology of depression by influencing the HPA axis and neurotransmitters. According to some estimates, the genetic overlap between obesity and depression is as high as 12 percent. Furthermore, these genes may be linked to significant interconnected signaling networks that have a role in the etiology of both disorders. Obesity and depression are both on the rise globally, and it is thought that there is a bidirectional relationship between these two conditions. Obesity and obesity-induced depression seriously limit the psychosocial functionality of individuals and impair their quality of life. Having a high body mass index (BMI) raises the likelihood of developing depression. On the other hand, as the BMI elevates in people suffering from depression, the possibility of developing obesity also rises.

PEBP1
Also flagged:Lung cancercancerSCLCsmall‐cell lung cancerNSCLCnon‐small‐cell lung cancer
Journal Article 2025-07-28 ✓ 5 Snippets Raquel-Cunha A, Pinheiro J, Marques RF, Fontão P, Cardoso-Carneiro D, Mendes A, Gomes INF, Laus AC, da Silva-Oliveira RJ, Reis RM, Martinho O.
In-Text Gene Mentions

…hanolamine‐binding protein 1 (PEBP1), is a multifunctional…

…gene symbol “PEBP1.”…

…comparative analysis ofPEBP1expression levels was…

…predictive value ofPEBP1expression levels in…

…RKIP low (PEBP1: EXP <…

Show Full Abstract

Lung adenocarcinoma (LUAD), the most common subtype of non-small-cell lung cancer (NSCLC), is often driven by mutations, particularly in epidermal growth factor receptor (EGFR), that guide targeted therapy choices. However, resistance to these treatments remains a major clinical challenge. Raf kinase inhibitory protein (RKIP), encoded by the PEBP1 gene, a metastasis suppressor, modulates key oncogenic pathways and may influence tumor aggressiveness and therapy response. Yet, its specific role in NSCLC remains unclear. This study investigates the influence of RKIP expression on NSCLC aggressiveness and explores its impact on therapy response, particularly to EGFR-targeted therapies. In silico analyses revealed that lower RKIP mRNA expression correlates with poorer survival outcomes in LUAD patients but not in other NSCLC subtypes. Genetic modulation of RKIP expression in LUAD cell lines demonstrated that its overexpression reduced migration, spheroid integrity, and suppressed tumor growth, whereas RKIP knockout had opposite effects, particularly in vivo. Expression profiling showed that RKIP overexpression impacts the activation of mitogen-activated protein kinase (MAPK), RAC serine/threonine-protein kinase (AKT), and signal transducer and activator of transcription 3 (STAT3) pathways, as well as processes related to extracellular matrix regulation and inflammatory responses. Importantly, in vitro and in vivo experiments demonstrated that RKIP overexpression sensitizes cells to anti-EGFR treatments, whereas RKIP knockout diminished their sensitivity. Overall, our findings indicate that RKIP modulates LUAD progression and response to EGFR-targeted therapies, although its clinical value as a biomarker requires further validation. These findings highlight RKIP's potential in overcoming therapeutic resistance and the need for further investigation into its regulatory mechanisms.

TNFSF4
Also flagged:Chronic rhinosinusitisnasal congestionolfactionnasal polypsimmune responseseosinophil
Journal Article 2025-07-28 ✓ 1 Snippet Jin Y, Liang Y, Wang Z, Jiang Y, Yuan F, Zhang T.
In-Text Gene Mentions

…cell subpopulations, ligandsTNFSF4, CD80, CD70, and…

Show Full Abstract

<h4>Background</h4>Chronic rhinosinusitis (CRS) with nasal polyps is a heterogeneous chronic inflammatory disease generally divided into two phenotypes including eosinophilic CRS with nasal polyps (eCRSwNP) and non-eosinophilic CRS with nasal polyps (neCRSwNP). However, its pathogenesis remains largely unknown. The aim of this study was to explore mechanistic differences between eCRSwNP and neCRSwNP using a bioinformatics approach.<h4>Methods</h4>We comprehensively analyzed single-cell RNA sequencing data from 3 healthy controls and 6 patients with CRSwNP (including 3 with eCRSwNP and 3 with neCRSwNP) to explore the heterogeneity and potential mechanisms of CRSwNP.<h4>Results</h4>Cluster analysis based on differential gene expression delineated 14 cell clusters. The eCRSwNP group exhibited a markedly higher prevalence of glandular cells and a notable reduction in fibroblasts, myoepithelial cells, and secretory cells compared to patients with neCRSwNP. Functional enrichment analysis of differentially expressed genes revealed the activation of pathways such as IL2-STAT5 signaling and the inhibition of apoptotic pathways in eCRSwNP compared to neCRSwNP. Significant differences in the metabolic profiles of epithelial cell subpopulations were observed between eCRSwNP and neCRSwNP. Furthermore, there were notable discrepancies in the numbers and functionality of immune cells between eCRSwNP and neCRSwNP. The CD4+Th2 cell subsets were found to be significantly enriched in eCRSwNP. The highest number of cellular communications from type 2 conventional dendritic cells (cDC2) to CD4+Th2 cells was found in CRSwNP, where the ICAM1-CD226 pathway from cDC2 to CD4+Th2 was significantly upregulated in eCRSwNP. In addition, eCRSwNP was mainly infiltrated with tissue-resident macrophages, whereas neCRSwNP was mainly infiltrated with monocyte-derived macrophages.<h4>Conclusions</h4>Our study provides new insights into the heterogeneity, molecular mechanisms, and biomarkers of CRSwNP, contributing to improved diagnostic and therapeutic options for this condition.

Also flagged:transportationDstageingdegradationhydrogenacetylene
Journal Article 2025-07-28 No Snippets Figueroa MG, Acevedo DDH, Porta DS.
Show Full Abstract

Geomagnetic storms represent a critical yet sometimes overlooked factor affecting the reliability of modern power systems. This study examines the relationship between geomagnetic storm activity-characterized by the Dst index and categorized into weak, moderate, strong, severe, and extreme intensities-and reported power outages of unknown or unusual origin in the United States from 2006 to 2023. Outage data come from the DOE OE-417 Annual Summaries, while heliospheric and solar wind parameters (including proton density, plasma speed, and the interplanetary magnetic field) were obtained from NASA's OMNIWeb database. Results indicate that years with a higher total count of geomagnetic storms, especially those featuring multiple strong or severe events, exhibit elevated incidences of unexplained power interruptions. Correlation analyses further reveal that increasingly negative Dst values, enhanced solar wind velocity, and higher alpha/proton ratios align with greater numbers of outages attributed to unknown causes, underscoring the pivotal role of solar wind-magnetosphere coupling. A simple regression model confirms that storm intensity and average magnetic field strength are statistically significant predictors of unexplained outages, more so than broad indicators such as sunspot number alone. These findings highlight the importance of monitoring high-intensity geomagnetic storms and associated heliospheric variables to mitigate potential risks. Greater attention to space weather impacts and improved reporting of outage causes could bolster grid resilience, helping operators anticipate and manage disruptions linked to geomagnetic disturbances.

Also flagged:ExtracellularVesiclesExtracellular vesiclespathogenesisvesiclelipid
Journal Article 2025-07-28 No Snippets Tran HL, Zheng W, Issadore DA, Im H, Cho YK, Zhang Y, Liu D, Liu Y, Li B, Liu F, Wong DTW, Sun J, Qian K, He M, Wan M, Zeng Y, Cheng K, Huang TJ, Chiu DT, Lee LP, Zheng L, Godwin AK, Kalluri R, Soper SA, Hu TY.
Show Full Abstract

Extracellular vesicles (EVs) play a crucial role in intercellular communication, signaling pathways, and disease pathogenesis by transporting biomolecules such as DNA, RNA, proteins, and lipids derived from their cells of origin, and they have demonstrated substantial potential in clinical applications. Their clinical significance underscores the need for sensitive methods to fully harness their diagnostic potential. In this comprehensive review, we explore EV heterogeneity related to biogenesis, structure, content, origin, sample type, and function roles; the use of EVs as disease biomarkers; and the evolving landscape of EV measurement for clinical diagnostics, highlighting the progression from bulk measurement to single vesicle analysis. This review covers emerging technologies such as single-particle tracking microscopy, single-vesicle RNA sequencing, and various nanopore-, nanoplasmonic-, immuno-digital droplet-, microfluidic-, and nanomaterial-based techniques. Unlike traditional bulk analysis methods, these methods contribute uniquely to EV characterization. Techniques like droplet-based single EV-counting enzyme-linked immunosorbent assays (ELISA), proximity-dependent barcoding assays, and surface-enhanced Raman spectroscopy further enhance our ability to precisely identify biomarkers, detect diseases earlier, and significantly improve clinical outcomes. These innovations provide access to intricate molecular details that expand our understanding of EV composition, with profound diagnostic implications. This review also examines key research challenges in the field, including the complexities of sample analysis, technique sensitivity and specificity, the level of detail provided by analytical methods, and practical applications, and we identify directions for future research. This review underscores the value of advanced EV analysis methods, which contribute to deep insights into EV-mediated pathological diversity and enhanced clinical diagnostics.

SOX6
Also flagged:L-glutaminepenicillinstreptomycinPer2LuciferaseBMAL1
Journal Article 2025-07-28 ✓ 1 Snippet Cuddapah VA, Chen D, Cho B, Moore R, Suri M, Safraou H, Tran-Mau-Them F, Wilson A, Odgis J, Rehman AU, Saunders C, Ganesan S, Jobanputra V, Scherer SW, Helbig I, Sehgal A.
In-Text Gene Mentions

…including RRAS2 andSOX6.…

Show Full Abstract

Through international gene-matching efforts, we identified 10 individuals with ultrarare heterozygous variants, including 5 de novo variants, in <i>BMAL1</i>, a core component of the molecular clock. Instead of an isolated circadian phenotype seen with disease-causing variants in other molecular clock genes, all individuals carrying <i>BMAL1</i> variants surprisingly share a clinical syndrome manifest as developmental delay and autism spectrum disorder, with variably penetrant sleep disturbances, seizures, and marfanoid habitus. Variants were functionally tested in cultured cells using a <i>Per2</i>-promoter driven luciferase reporter and revealed both loss-of-function and gain-of-function changes in circadian rhythms. The tested <i>BMAL1</i> variants disrupted <i>PER2</i> mRNA cycling, but did not cause significant shifts in cellular localization or binding with CLOCK. Conserved variants were further tested in <i>Drosophila</i>, which confirmed variant-dependent effects on behavioral rhythms. Remarkably, flies expressing variant <i>cycle</i>, the ortholog of <i>BMAL1</i>, also demonstrated deficits in short- and long-term memory, reminiscent of the highly prevalent developmental delay observed in our cohort. We suggest that ultrarare variants in the <i>BMAL1</i> core clock gene contribute to a neurodevelopmental disorder.

OLFM4
Also flagged:inflammatory bowel diseasesulcerative colitisimmune responseTNF-αIL-6IL-1β
Journal Article 2025-07-28 ✓ 1 Snippet Kojima T, Hayashi T, Kageyama Y, Nakamura T, Akiyama T.
In-Text Gene Mentions

…positive for olfactmedin4 (OLFM4) at the crypt…

Show Full Abstract

Inflammation plays a key role in the pathogenesis of various diseases, including inflammatory bowel diseases such as ulcerative colitis and Crohn's disease. Similar to animals, plant cells produce exosome-like nanovesicles (ELNs) that play a role in transmitting biological signals from specific types of cells or tissues to other cells or tissues. Here we show that ELNs derived from Peucedanum japonicum (PjELNs) exhibit potent anti-inflammatory effects on macrophages and are effective in a mouse colitis model induced by dextran sodium sulfate (DSS). RNA sequence analysis reveals that PjELNs suppress multiple inflammatory cytokine-mediated signaling pathways in LPS-stimulated macrophage cell lines. We further show that PjENLs promote the differentiation of goblet cells, thereby enhancing mucin production and providing a protective effect on mucosal damage in a DSS-induced murine model of colitis. We also demonstrate that PjELNs inhibit the DSS-induced reduction in the number of transit amplifying cells. PjELNs exhibit anti-inflammatory properties, partly due to the presence of miRNA-like small RNAs that directly regulate the expression of the inflammatory cytokine IL6. Importantly, these small RNAs exhibit cross-species effects in both humans and mice. These findings reveal the mechanism by which plant-derived ELNs modulate inflammatory responses, suggesting their potential as a preventive and therapeutic strategy for inflammatory diseases of the colon.

VRK2DCC
Also flagged:Developmental stutteringautismdepressionneurogenic stutteringfluency disordersbehavioral
Journal Article 2025-07-28 ✓ 5 Snippets Polikowsky HG, Scartozzi AC, Shaw DM, Pruett DG, Chen HH, Petty LE, Petty AS, Lowther EJ, Cho SH, Yu Y, 23andMe Research Team, Mozaffari S, Avery CL, Harris KM, Gordon RL, Beilby JM, Viljoen KZ, Jones RM, Huff CD, Highland HM, Kraft SJ, Below JE.
In-Text Gene Mentions

…male GWAS implicatedVRK2, CAMTA1 ,…

…implicated SLC39A8 ,DCC, SRPK2 ,…

…implicated SLC39A8 ,VRK2, CAMTA1 ,…

…, CBLN4 andDCCas the most…

…implicated CAMTA1 ,VRK2and KCTD10 as…

Show Full Abstract

Developmental stuttering is a highly heritable, common speech condition characterized by prolongations, blocks and repetitions of speech. Although stuttering is highly heritable and enriched within families, the genetic architecture is largely understudied. We reasoned that there are both shared and distinct genetic variants impacting stuttering risk within sex and ancestry groups. To test this idea, we performed eight primary genome-wide association analyses of self-reported stuttering that were stratified by sex and ancestry, as well as secondary meta-analyses of more than one million individuals (99,776 cases and 1,023,243 controls), identifying 57 unique loci. We validated the genetic risk of self-reported stuttering in two independent datasets. We further show genetic similarity of stuttering with autism, depression and impaired musical rhythm across sexes, with follow-up analyses highlighting potentially causal relationships among these traits. Our findings provide well-powered insights into genetic factors underlying stuttering.

TNFSF4
Also flagged:CDKN2Bbrain cancerpathogenesismethylationgene expressionCDKN2A
Journal Article 2025-07-28 ✓ 1 Snippet Ye Z, Yuan J, Yi Q, Xu P, Liu W.
In-Text Gene Mentions

…ENTPD1, CD40, CD86,TNFSF4, TNFRSF14, TNFSF13, KLRC1,…

Show Full Abstract

Brain cancer represents a complex disease influenced by a multitude of genetic and epigenetic factors. This study aims to elucidate the role of specific single nucleotide polymorphisms (SNPs) and long non-coding RNAs (lncRNAs) in the pathogenesis of brain cancer, employing a multi-omics approach. We conducted extensive eQTL, mQTL, haQTL, sQTL, and caQTL analyses to identify genetic variants and lncRNAs associated with brain cancer. Integration with GWAS-GWAS colocalization analysis provided insights into shared genetic mechanisms with other diseases. We further investigated copy number variation (CNV) and methylation status in relation to gene expression, and their prognostic implications in different brain cancer subtypes. SNP rs615552_AL359922.1 exhibited significant colocalization with key genes CDKN2A, CDKN2B, and CDKN2B-AS1, implicating its role in the regulation of gene expression. The long non-coding RNA CDKN2B-AS1 demonstrated both co-occurrence and co-expression with CDKN2A and CDKN2B, suggesting a coordinated regulatory mechanism among these genes. TERT emerged as a gene with shared susceptibility across brain cancer and other diseases, indicating a common genetic pathway. Methylation sites associated with mQTL, such as cg03935379 (TERT) and cg14069088 (CDKN2A), were identified as independent prognostic factors for lower-grade glioma (LGG), but not for glioblastoma multiforme (GBM). Bulk RNA-seq, spatial, and single-cell transcriptomic analyses revealed that CDKN2B-AS1 is predominantly expressed in malignant and dendritic cells (DCs), and is associated with DNA repair pathways in malignant cells and antigen presentation genes in DCs. This study offers a comprehensive perspective on the genetic and molecular factors influencing brain cancer. The results highlight the intricate nature of gene regulation in cancer and suggest the potential of CDKN2B-AS1 as a key regulator of immune responses and tumor suppressor genes. The SNP rs615552_AL359922.1 represents a significant pathogenic SNP for brain cancer. The identification of shared genetic mechanisms, particularly involving TERT, with other diseases points to new opportunities for developing therapeutic targets and diagnostic tools. Future research should focus on functional validation and the investigation of environmental interactions to fully leverage these findings for advancing brain cancer management.

PRDX6
Also flagged:PRDX4breast cancerperoxiredoxintumorsCancermethylation
Journal Article 2025-07-28 ✓ 5 Snippets Jiang W, Wang M, Chen Q, Yu X, Liu G, He X, Mei C, Ou C.
In-Text Gene Mentions

…PRDX4, PRDX5, andPRDX6, can utilise thioredoxin…

…whereas that ofPRDX6was decreased (Fig.…

…However,PRDX6expression in breast…

…mRNA expression ofPRDX6at all breast…

…In addition,PRDX6mRNA expression in…

Show Full Abstract

The incidence of breast cancer continues to increase annually, posing a significant challenge for countries worldwide in terms of its prevention and treatment. Therefore, identifying novel therapeutic targets for breast cancer is urgently needed. The peroxiredoxin (PRDX) family is regarded as a good diagnostic marker for various tumors. However, the expression and prognostic significance of PRDX family members in breast cancer remain unclear and require systematic investigation. By using bioinformatic tools such as UALCAN, TIMER2.0, Human Protein Atlas Project (HPA), Gene Set Cancer Analysis (GSCA), and the cBioportal database, we systematically analyzed the expression pattern, prognostic value, methylation status and immune infiltrating association of PRDX gene family members in breast cancer. Through comprehensive analysis, we found that PRDX4 has good prognostic value and is closely related to immune infiltration, and further exploration of its oncogenic function in breast cancer is warranted. Subsequently, we performed a series of cellular assays to explore the potential role of PRDX4 in the progression of breast cancer. We demonstrated that PRDX4 promoted the proliferation, invasion, metastasis, and inhibited the apoptosis of breast cancer cells. In addition, PRDX4 expression was associated with the half maximal inhibitory concentration (IC<sub>50</sub>) of neratinib which primarily targets human epidermal growth factor receptor 2 (HER2) and showed good binding in molecular docking. Our subsequent experiments showed that the PRDX4-HER2 axis may serve as a potential combined target for neratinib therapy. Our findings suggest that PRDX4 may be a potential diagnostic and prognostic marker for breast cancer, and targeting PRDX4 could represent a novel strategy to improve the efficacy of targeted therapy for patients with HER2-positive breast cancer.

Also flagged:hydrogenpolymerspolyesterspolyesteroligoalaninenanofibers
Journal Article 2025-07-28 No Snippets Thiele S, Plummer CJG, Piveteau L, Frauenrath H.
Show Full Abstract

The dynamic nature of supramolecular networks of telechelic polymers offers new avenues for the design of novel materials with enhanced melt strength and extensibility, increased energy at break, or self-healing properties. However, monitoring the kinetics of the underlying molecular-level scission-reaggregation events remains challenging, particularly in high-molar-mass polymers in the bulk state. Here, we employ solid-state <sup>1</sup>H NMR spectroscopy relaxation dispersion experiments to investigate the aggregation-scission dynamics in poly(ε-caprolactone) modified with oligopeptide end groups that form one-dimensional hydrogen-bonded aggregates. We have successfully determined the timescale of end-group dissociation directly and independently of any relaxation of the polymer segments at different temperatures in the bulk semi-crystalline and melt state. This site-specific, non-destructive method is applicable to entangled, high-molar-mass polymers without chemical modifications or modeling, provides critical insight into the dynamics of supramolecular networks in the bulk state, and promises to be a valuable tool for the directed development of next-generation functional materials.

Also flagged:cancertumorhematological malignanciessolid tumorsascancers of the breast
Journal Article 2025-07-28 No Snippets Debnath I, Kundu M.
Show Full Abstract

Cancer stem cells (CSCs) are a specific subset of cancer cells that possess the ability to self-renew, resist therapies, and promote metastasis, making them a crucial target in cancer treatment. This study investigates the therapeutic potential of natural compounds in targeting CSCs, particularly their ability to inhibit key signaling pathways, induce apoptosis, and alter the tumor microenvironment. This article reviews the molecular mechanisms that maintain CSCs and contribute to their resistance, focusing on the roles of the WNT/β-catenin, Hedgehog, Notch, and PI3K/ATK/mTOR pathways. Several natural compounds, including curcumin, resveratrol, epigallocatechin gallate, and sulforaphane, were assessed for their effectiveness in targeting CSCs. The finding revealed that these natural compounds can inhibit CSC proliferation, enhance sensitivity to chemotherapy, and suppress the tumor-supportive microenvironment. Notably, compounds such as berberine and piperine were found to reverse drug resistance by downregulating efflux transporters, while quercetin and salinomycin selectively induced apoptosis in CSCs. Overall, natural compounds show promising potential for targeting CSCs in therapy. However, challenges related to bioavailability and metabolic stability must be addressed through advanced drug delivery systems and combination therapy.

PRDX6
Also flagged:PLA2G6FerroptosisParkinson's DiseaseFTH1GPX4PD
Journal Article 2025-07-28 ✓ 5 Snippets Li T, Liu J, Huang X, Xie Y, Hu Y, Xu Q, Tang B, Tan J, Guo J.
In-Text Gene Mentions

…via Disruption ofPRDX6/FTH1/GPX4 Axis.…

…identify peroxiredoxin 6 (PRDX6) as a direct…

…of iPLA2β destabilizesPRDX6, promoting its degradation…

…Notably, restoration ofPRDX6expression alleviates ferropto…

…role for thePRDX6/FTH1/GPX4 axis in maintaining…

Show Full Abstract

Parkinson's disease (PD) is a progressive neurodegenerative disorder primarily characterized by the progressive loss of dopaminergic neurons. Mutations in the PLA2G6 gene, which encodes calcium-independent phospholipase A2 (iPLA2β), have been associated with autosomal recessive early-onset parkinsonism, a subtype of neurodegeneration marked by brain iron accumulation. Although the pathogenic mechanisms underlying PLA2G6-related neurodegeneration remains unclear, disturbances in iron metabolism, neuroinflammation, and mitochondrial dysfunction are thought to play key roles. Ferroptosis, an iron-dependent form of regulated cell death driven by lipid peroxidation, has recently been implicated in PD. Here, we demonstrate that the iPLA2β deficiency in dopaminergic neurons induces ferroptosis, aggravating neurodegeneration and motor deficits in a mouse model of PLA2G6-associated neurodegeneration (PLAN). This ferroptotic phenotype is characterized by increased iron accumulation, elevated lipid peroxidation, and impaired antioxidant defenses, including downregulation of ferritin heavy chain 1 (FTH1) and glutathione peroxidase 4 (GPX4). We further identify peroxiredoxin 6 (PRDX6) as a direct binding partner of iPLA2β and a critical regulator of ferroptosis. Loss of iPLA2β destabilizes PRDX6, promoting its degradation and thereby enhancing ferroptotic susceptibility. Notably, restoration of PRDX6 expression alleviates ferroptosis in iPLA2β-deficient cells, highlighting the protective role for the PRDX6/FTH1/GPX4 axis in maintaining redox homeostasis. Furthermore, treatment with the ferroptosis inhibitor Liproxstatin-1 (Lip-1) attenuated motor dysfunction and dopaminergic neuron loss in PLA2G6 knockout (KO) mice. Collectively, our findings uncover a novel mechanism linking iPLA2β deficiency to ferroptosis in PD and suggest ferroptosis inhibition as a promising therapeutic strategy for PD patients with PLA2G6 mutations.

BTN2A1
Also flagged:breast cancercancerTumorestrogen receptorERprogesterone receptor
Journal Article 2025-07-28 ✓ 1 Snippet Zhu M, Lin J, Liu H, Wang J, Liu N, Li Y, Lai H, Shi Q.
In-Text Gene Mentions

…whereas CD274 (PDL1),BTN2A1, CD160, and CD80…

Show Full Abstract

<h4>Background</h4>Epigenetic acetylation plays an essential role in the development and drug resistance of luminal breast cancer. However, the acetylation regulatory network in luminal breast cancer remains underexplored.<h4>Methods</h4>We used the TCGA-BRCA database to explore the acetylation regulatory network in luminal breast cancer. Spearman correlation coefficients, Cox proportional hazards, and the STRING database were used to identify genes that were correlated with acetylation regulatory molecules in luminal breast cancer and could predict patient outcomes. An acetylation regulatory risk model was constructed via Consensus Cluster Plus and the LASSO risk model. GSEA, K‒M survival analysis, and receiver operating characteristic (ROC) curve analysis were used to analyze survival and possible regulatory pathways of the risk model. TIDE, Microenvironment Cell Populations-counter, and CIBERSORT algorithms were used to analyze the immune landscape of the risk model population. Patients' tumor specimens were used to detect the expression of KAT2B and TAF1L. The luminal breast cancer cell lines MCF-7 and T47D were used in cell viability, Transwell, western blotting, and RT‒qPCR experiments to confirm the risk model. Mouse model was constructed for in vivo validation of KAT2B and TAF1L function.<h4>Results</h4>In our study, we utilized the TCGA-BRCA database to conduct a comprehensive analysis of the acetylation regulatory pattern in luminal breast cancer. Using Consensus Cluster Plus and the LASSO risk model, we screened 6 acetylation-related genes (KAT2B, TAF1L, CDC37, CCDC107, C17orf106, and ASPSCR1) and constructed a 6-gene risk model of luminal breast cancer. Based on this model, luminal breast cancer patients were classified into high- and low-risk subgroups. The high-risk subgroup had a poor prognosis. Further analysis revealed that the high-risk subgroup was associated with lower CD8 + T-cell infiltration and greater responsiveness to immune checkpoint inhibitor therapy. In vitro and in vivo experiments revealed that knockdown of KAT2B and TAF1L dramatically inhibited tumor cell proliferation. In vitro experiments also showed knockdown of KAT2B and TAF1L dramatically inhibited tumor cell migration, increased lymphocyte infiltration, and significantly upregulated the expression of CD8 + T-cell-associated chemokines in luminal breast cancer cells.<h4>Conclusions</h4>In this study, we successfully constructed a 6-gene acetylation-associated risk model for luminal breast cancer, providing a new direction and evidence for personalized treatment. Our results also suggested that KAT2B and TAF1L might serve as potential therapeutic targets in luminal breast cancer.

HFE
Also flagged:diabetesobesitylipidtriglycerideglucosenon-alcoholic fatty liver disease
Journal Article 2025-07-28 ✓ 1 Snippet Mohit M, Homayounfar R, Saadi AF, Hejazi N.
In-Text Gene Mentions

…injury, viral hepatitis,hemochromatosis, autoimmune hepatitis, Wilson…

Show Full Abstract

<h4>Background</h4>The quantity and quality of diet are directly associated with the development of obesity and diseases. This study aims to investigate the relationship between the Healthy Eating Index-2015 (HEI-2015) and anthropometric measurements, including body mass index (BMI), body adiposity index (BAI), body roundness index (BRI), visceral adiposity index (VAI), a body shape index (ABSI), lipid accumulation product (LAP) index, and triglyceride glucose index (TyG) index in non-alcoholic fatty liver disease (NAFLD) patients with diabetes.<h4>Methods</h4>This is a cross-sectional study that was conducted on the baseline data from Fasa cohort study. The socio-demographic, anthropometric, and dietary data of 384 individuals with diabetes and NAFLD were extracted. Multiple linear regression was used in various models adjusted for potential confounders to determine the associations.<h4>Results</h4>Out of the 384 eligible individuals, 74.5% were women. The mean age of men was 55.74 ± 7.85 years, whereas that of women was 54.68 ± 8.54 years. After adjusting for possible confounders, including age, marital status, occupation, education status, smoking status, physical activity, and total energy intake, there was no significant association between the quartiles of HEI score and any of the anthropometric measurements, including BMI, ABSI, BAI, BRI, VAI, LAP index, and TyG index among both men and women.<h4>Conclusion</h4>Higher HEI score was not associated with anthropometric indices in NAFLD patients with diabetes, according to our findings. It is recommended that further observational studies should be conducted to clarify the current findings.

STAU1
Also flagged:acute infectionchronic immunodeficiencyAIDShost cellsToll-like receptorsTLR
Journal Article 2025-07-28 ✓ 5 Snippets Fatima N, Baig MS, Rizvi AH, Arzoo A, Sharma M, Shahadab M, Arya A, Das AK, Batra VV, Mohanty KK, Alam MA, Ahmad E, Ali S, Selvapandiyan A, Ansari MA.
In-Text Gene Mentions

…HostSTAU1, an RNA-binding protein,…

…one isoform a (STAU1), as Staufen1 ribonucleoprote…

STAU1(Staufen1) presence in…

STAU1is an RNA-binding…

STAU1binds to the…

Show Full Abstract

<h4>Objectives</h4>The objective of this research is to investigate the pathophysiological progression of HIV from acute infection to chronic immunodeficiency (AIDS) and to understand the host's immunological responses, which are pivotal for elucidating disease aetiology and optimizing antiretroviral therapy (ART). Additionally, the study aims to explore the role of exosomes (40-130 nm bilipid-layered vesicles released by nearly all cell types) as key mediators of intercellular communication in the context of HIV infection.<h4>Materials and methods</h4>Recent research has uncovered that cells infected with HIV-1 release exosomes carrying a mix of viral and host components such as proteins, nucleic acids, lipids, and other metabolites. To decipher the plausible role of exosome-derived proteins in HIV disease progression, the exosomes isolated from HIV patient's serum were subjected to LC-MS/MS analysis to identify exosome-derived human and viral protein sequences. The identified proteins were then investigated, annotated, and explored for protein-protein interaction (PPI) network between HIV and the human host's proteins. Earlier experimental efforts focused on identifying PPI networks in host cells or only within the virus.<h4>Results</h4>The analysis showed that out of twelve exosome-derived host proteins identified from HIV-1 patient's samples, only five of the proteins were associated with Toll-like receptors (TLR), inflammasome-activation, inhibition of apoptosis, innate immune response modulation, and autophagy pathways. In the TLR pathway, CDH5, ENO1, OGT, TJP1, and TRAF6 exosome-derived host proteins participated in regulation. Notably, CDH5, ENO1, OGT, and TRAF6 were shared among these pathways, BioGRID version 4.4 showed that HIV-1 Gag, Gag-pol, Env, and Nef proteins interact with 196, 162, 158, and 80 human proteins, respectively, associated with different innate immune response pathways.<h4>Conclusion</h4>These findings are a step ahead in comprehending the pathophysiology of HIV1 and the innate immune response pathways, providing excellent opportunities to explore further exosome-based biomarkers for theranostic approaches.

LRRC7
Also flagged:CohesinkinetochoreCENP-Anucleosomescentromerechromosome
Journal Article 2025-07-28 ✓ 1 Snippet Haase J, Aktar K, Bonner MK, Colin L, Gupta H, Marinoni BE, Morgan DO, Kelly AE.
In-Text Gene Mentions

Condensin

Show Full Abstract

The constitutive centromere-associated network (CCAN) of the inner kinetochore links CENP-A-containing nucleosomes of the centromere to the outer kinetochore, ensuring accurate chromosome segregation during mitosis. CCAN binding at the centromere is stabilized upon mitotic entry, but the underlying mechanisms remain unclear. Here, we demonstrate that cohesin is essential for CCAN stability. The chromosomal passenger complex (CPC), independently of its kinase subunit Aurora B, regulates cohesin-mediated CCAN stability via heterochromatin protein-1 (HP1), Haspin kinase, and phosphorylation of the cohesin-release factor WAPL, which weakens WAPL's affinity for PDS5B. While cohesin depletion disrupts CCAN stability, neither separase-mediated cohesin cleavage nor depletion of the cohesion-essential Esco2 acetyltransferase affects CCAN stability, indicating that cohesin stabilizes the CCAN independently of sister chromatid cohesion. Furthermore, we show that WAPL phosphorylation maintains a centromere-proximal pool of cohesin and promotes the formation of the primary constriction. These findings establish a non-cohesive function of cohesin in stabilizing the CCAN during mitosis and suggest that cohesin-mediated organization of centromeric chromatin strengthens kinetochore engagement to ensure faithful chromosome segregation.

SOX6
Also flagged:Colorectal cancerrectal cancertumorcancerextracellulargene expression
Journal Article 2025-07-28 ✓ 5 Snippets Huang L, Lu W, Wu R, Li Y, Ou Z, Chen J, Liu Y, Yang W, Xue W, Mu P, Xu R, Zhang Z, Shen L, Wang Y, Wan J, Xia F, Xiao Z, Zhang H, Zhang Z.
In-Text Gene Mentions

…TheSOX6+ CAF cluster…

…cell state (SOX6, WNT4 ,…

…decrease in myCAFs,SOX6+ CAFs, and…

…and MCAM ),SOX6+ CAF-related genes…

…populations, including myCAFs,SOX6+ CAFs, and…

Show Full Abstract

The efficacy of neoadjuvant radiotherapy (RT) in patients with rectal cancer (RC) is hindered by the plasticity and heterogeneity of cancer-associated fibroblasts (CAFs). However, the underlying mechanisms remain poorly understood. In this study, single-cell RNA sequencing of patients with RC samples revealed a CAF subpopulation characterized by high interferon (IFN) regulatory factor 1 (IRF1) expression. These IFN-licensed CAFs (ilCAFs) are enriched in tumors with enhanced RT responses across various solid tumors, including RC. Mechanistically, IFN gamma (IFN-γ) signaling drives the polarization of ilCAFs, leading to the recruitment of T cells and dendritic cells via CCL4/CCL5 secretion. Activation of IFN-γ/stimulator of IFN genes (STING) signaling reprograms the stroma and augments anti-tumor immunity in both RT-sensitive and RT-resistant colorectal cancer. Silencing STING in CAFs impairs ilCAF enrichment and diminishes tumor sensitivity to RT. Combining STING agonists with RT results in robust tumor control, providing a compelling rationale for clinical translation.

Also flagged:depressionCLBPmajor depressive disorderosteopathymusculoskeletal disordersinteroception
Journal Article 2025-07-28 No Snippets Bohlen L, Eggart M, Müller-Oerlinghausen B, Lorenz J, Schleip R, Liem T, Cerritelli F, Esteves JE, Shedden-Mora M, Schmidt T.
Show Full Abstract

<h4>Introduction</h4>Chronic low back pain (CLBP) and depressive symptoms (DS) are highly prevalent, burdensome, costly and comorbid health conditions. Osteopathic manipulative treatment (OMT) was shown to improve pain and disability in patients with CLBP; however, the effect on comorbid DS remains less certain. Interestingly, CLBP and DS seem to be associated with changes in interoception, which may be reversed by OMT.<h4>Methods and analysis</h4>The study protocol proposes a single-blinded, parallel-group, randomised controlled trial to investigate the effect of OMT on clinical symptoms (depression, pain and disability) and interoceptive functions (interoceptive accuracy, sensibility and awareness) in patients with CLBP and comorbid DS. A sample of 60 adult subjects with CLBP and comorbid DS shall be recruited from osteopathic, orthopaedic and physiotherapeutic practices and educational institutes for osteopathy, sports science, psychology and medicine in Hamburg, Germany. Participants will be randomly allocated (1:1 ratio) to receive six 45 min treatment sessions of either OMT (standard-OMT group) or sham treatment imitating OMT (sham-OMT group). Primarily, symptoms of depression, pain and disability will be assessed with the Beck's Depression Inventory, Second Edition (BDI-II), Numeric Rating Scale (NRS) and Oswestry Disability Index (ODI). Secondarily, interoceptive accuracy, sensibility and awareness will be evaluated using the Heartbeat Tracking Task (HTT), Multidimensional Assessment of Interoceptive Awareness (MAIA-2) and confidence-accuracy correspondence (CAC). Ancillary, the therapeutic alliance will be investigated with the Helping Alliance Questionnaire. Data will be collected at baseline (t<sub>0</sub>), the first, third and sixth treatment sessions (t<sub>1</sub>, t<sub>3</sub>, t<sub>6</sub>) and at 3 months follow-up (t<sub>7</sub>). The findings will be analysed for between-group differences using descriptive (mean and SD) and inductive statistics (mixed analysis of variance). It is hypothesised that standard-OMT, compared with sham-OMT, will reduce depression, pain and disability (BDI-II, NRS, ODI) and increase interoceptive accuracy, sensibility and awareness (HTT, MAIA-2, CAC) in patients with CLBP and comorbid DS.<h4>Ethics and dissemination</h4>The study was approved by the ethics committee of the Medical School Hamburg (MSH-2023/288). The anonymised dataset will be published in an online repository, and the results will be published in peer-reviewed scientific journals.<h4>Trial registration number</h4>DRKS00031694.

DCC
Also flagged:cancerserinephosphorylationPoly(ADP-ribose) polymerase 2PARP2pancreatic cancer
Journal Article 2025-07-28 ✓ 1 Snippet Hughes B, Chatterjee S, Ghafari M, Cisneros GA.
In-Text Gene Mentions

DCC

Show Full Abstract

Poly(ADP-ribose) polymerase 2 (PARP2) plays a crucial role in DNA repair. A common single-nucleotide polymorphism (SNP) in the PARP2 gene, rs3093921, has been associated with pancreatic cancer and marginal zone lymphoma. This SNP results in a missense mutation, D235G, in the PARP2 protein. PARP2 is also reported to undergo posttranslational modifications (PTMs), particularly phosphorylation at serine residues 226, 232, and 353. The C-terminal region of PARP2 includes the Trp-Gly-Arg (WGR) domain, the ADP-ribosyl transferase (ART) domain, and the helical subdomain (HD). The latter two, spanning residues 220-583, comprise the catalytic region of PARP2. The DNA-induced enzymatic activation of PARP2 is regulated by local destabilization of the HD domain. We used molecular dynamics simulations to investigate the impact of these three PTMs on both the wild-type (WT) and the mutant (D235G) forms of PARP2. Our simulations suggest that the mutation leads to a change in structure and residual flexibility in specific regions of the HD domain compared with the WT. The presence of the PTMs also shows altered structure of the HD domain, although the residual flexibility remains unchanged compared with the unmodified WT. This is further supported by the destabilizing interactions between the mutation site and the HD domain observed in the presence of both the mutation and the PTMs. Importantly, our results suggest that the three PTMs mitigate the changes in structure and residual flexibility caused by the mutation, helping the PTM-modified mutant protein retain WT-like features. We observe that, while the PTMs alter the dominant mode of motion in the native protein, this shift is not observed in the mutant, further indicating that PTMs mitigate the structural and dynamic consequences of the mutation, preserving WT-like behavior. The mutation and PTMs cause notable changes in correlated motions within the WGR and ART domains, with the PTM-modified mutant structure showing the strongest correlations. Interestingly, a similar trend is observed for anticorrelated motions, particularly between the WGR and ART domains, where the PTM-modified mutant structure again exhibits the highest level of anticorrelation. Additionally the mutation in PARP2 markedly weakens interdomain interactions between the HD and ART domains, as well as between the HD and WGR domains. By contrast, the PTMs alone show no change on the HD-ART interaction, although they weaken the HD-WGR interaction. For the PTM-modified mutant structure the HD-ART interaction remains disrupted compared with the WT, but the extent of disruption is less than that caused by the mutation alone-suggesting a partial compensatory effect of the PTMs. Additionally, the HD-WGR interaction remains consistently weakened in all modified systems.

HTT
Also flagged:Serotoninneurotransmitterbrain developmentneurogenesisneuronal migrationaxonal
Journal Article 2025-07-28 ✓ 5 Snippets Koc D, Nørgaard M, Ganz M, Muetzel RL, El Marroun H, Tiemeier H, Frokjaer VG.
In-Text Gene Mentions

…with a transporter (5-HTT).…

…the functionality of5-HTT( Malave et…

…is enriched with5-HTTcompared to other…

…predominantly enriched with5-HTTbut not postsynaptic…

…spatial distribution of5-HTTrelates to brain…

Show Full Abstract

We aimed to investigate the association of brain morphology with behavioral and emotional problems in early adolescence using a brain atlas of the serotonin system. This pre-registered study used data from the Generation R Study, a large birth cohort in Rotterdam, the Netherlands. A total of 2492 children were included at age 10 years, with neuroimaging data and self-reported behavioral and emotional problems. Cortical surface area and thickness were measured in ten serotonin-coupled brain regions. Our primary analysis revealed that higher total, attention, and externalizing problem scores were associated with smaller cortical surface area in Regions 8, 9, and 10 (covering cingulate, orbitofrontal, temporal, and parietal areas) after adjusting for intracranial volume, highlighting region-specific effects less confounded by overall head size. Among these regions, only Region 9 showed relative enrichment for 5-HT<sub>1A</sub> receptors, suggesting potential serotonergic involvement in externalizing problems. Secondary analyses showed that greater cortical thickness in Region 2, enriched with serotonin transporters (5-HTT) and involving parts of the temporal cortex and insula, was associated with higher total, attention, and internalizing problem scores (β = 0.07, PFDR = 0.003). A follow-up analysis in an independent adult sample (n = 100), with the same-subject structural MRI and molecular 5-HTT imaging, revealed a specific negative association between 5-HTT availability and cortical thickness in Region 2 (β = -0.22, P = 0.02). These findings suggest selective serotonergic contributions to cortical morphology related to behavioral problems.

DCC
Also flagged:Netrin-1axonalneurodegenerative diseasesleukocyte migrationimmune cell migrationNeurodegenerative Disease
Journal Article 2025-07-28 ✓ 2 Snippets Farahani H, Ganji A, Mosayebi G, Monfared ME, Ghazavi A.
In-Text Gene Mentions

…in colorectal cancer (DCC) and UNC-5 receptors…

…Binding toDCC receptorsreceptors promotes neuronal…

Show Full Abstract

Netrin-1, a central axonal guidance molecule discovered for its role in neuronal development, is also essential in neurodegenerative diseases. Netrin-1 inhibits leukocyte migration and inflammation-related tissue damage outside the central nervous system. Therefore, it can be viewed as a potential biomarker for inflammatory activity in neurodegenerative diseases. Recent studies highlight the dual roles of Netrin-1 in neuroinflammation and neurodegenerative diseases. In the context of neurodegeneration, Netrin-1 demonstrates both protective and harmful effects. This review highlights recent advancements in research regarding the dual roles of Netrin-1 in neuroinflammation and neurodegeneration. We discuss its involvement in protecting the blood-brain barrier (BBB) and regulating immune cell migration and its effects on various neurodegenerative diseases. A greater understanding of the multifunctionality of Netrin-1 could potentially be employed in developing new treatment modalities.

Also flagged:host cellsinfectionRIG-ILGP2TLR3TLR7
Journal Article 2025-07-28 No Snippets Jung Y, Grainger H, Yang S, Mondal S, Lukong KE, Conn K, Wu Y.
Show Full Abstract

The 2002 movie <i>Catch Me If You Can</i> is a cat-and-mouse story in which Frank Abagnale Jr. successfully conned his way into several high-profile jobs while evading capture by FBI agent Carl Hanratty. Similarly, after entering host cells, viruses interact with or hijack host cellular machinery to replicate their genetical materials and assemble themselves for the next round of infection. Analogous to an FBI agent, host cells have numerous molecular "detectives" that recognize viral nucleic acids (NAs). These include RIG-I, MDA5, LGP2, TLR3, TLR7, TLR8, DHX36, DICER1, PKR, OAS1, ZAP, and NLRP1/6 for viral RNA, as well as cGAS, TLR9, AIM2, IFI16, IFIX, Ku70, MRE11, RNA polymerase III, hnRNPA2B1, LRRFIP1, DAI, DHX9 and DDX41 for viral DNA. However, much like the brilliant Frank Abagnale Jr., viruses have developed various strategies to evade host cellular surveillance-for example, by sequestering or modifying viral NAs and inhibiting or degrading host sensors. In this review, we will summarize the host sensors identified so far, discuss the latest understandings of the various strategies employed by viruses, and highlight the challenges associated with drug development to target virus or host factors. Considering recent global health challenges such as the COVID-19 pandemic and undergoing measles outbreak, understanding virus-host interactions at the molecular and cellular levels remains essential for the development of novel therapeutic strategies.

TNFSF4
Also flagged:cancermitochondrial permeabilitymitochondrialmitochondrial permeability transition-cell cycleHepatocellular carcinoma
Journal Article 2025-07-28 ✓ 1 Snippet Lin Z, Yu J, Chen Z, Chen J, Chi X, Lin H, Chen Y.
In-Text Gene Mentions

…CD40LG, CD276, HHLA2,TNFSF4, TNFSF9, CD70, ADORA2A,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is the second leading cause of cancer-related deaths in China. It has a high rate of postoperative recurrence and lacks prognostic markers. In this study, we first analyzed mitochondrial permeability transition (MPT) necrosis-associated long non-coding RNAs (lncRNAs), integrated multi-omics, and constructed a prognostic model. We also revealed the mechanism by which it regulates the immune microenvironment. This provides a new target for targeted therapy in HCC.<h4>Objective</h4>Screening and construction of a prognostic risk score model for MPT-driven necrosis-associated lncRNAs in HCC and exploration of their potential role in HCC.<h4>Methods</h4>Pearson's correlation analysis, in conjunction with The Cancer Genome Atlas (TCGA) and gene set enrichment analysis (GSEA) databases, was utilized for the identification of lncRNAs associated with mitochondrial permeability transition-driven necrosis. The development of a risk prognostic score for mitochondrial permeability transition-driven necrosis-associated lncRNAs was accomplished through the implementation of one-way regression analysis and Least Absolute Shrinkage and Selection Operator (LASSO) regression analysis. Bioinformatics analysis was performed to validate the prognostic ability and clinical application efficacy of the risk score model and prognostic genes and to explore their biological significance.<h4>Results</h4>MPT-driven necrosis-related lncRNAs (MPTDNRlncRNAs) strongly correlated with HCC were obtained through Pearson's correlation analysis. Additionally, MPT-driven necrosis-related prognostic lncRNAs were obtained through univariate Cox regression analysis. A new prognostic risk model consisting of three MPTDNRlncRNAs was constructed using LASSO-Cox regression. The model was tested using multiple bioinformatics methods, which suggested that it could significantly differentiate between high- and low-risk groups (p < 0.05) and demonstrated good survival prediction efficacy [area under the curve (AUC) = 0.725]. Differential genes in the high- and low-risk groups were enriched in pathways related to the cell cycle and cellular composition. Combined with immune cell infiltration and immune function scores, these results showed that the patients in the low-risk group had a more significant clinical response to immunotherapy (p < 0.05). Furthermore, the expression level of prognostic genes was verified using the RT-qPCR method on cancerous and paracancerous tissues from HCC patients who underwent HCC resection at our hospital.<h4>Conclusion</h4>The risk scoring model and prognostic genes in this study have been shown to possess satisfactory predictive values, which may prove beneficial for the assessment of risk and the selection of individualized chemotherapy regimens for patients with HCC. A preliminary discussion is presented on the potential biological significance of risk scores in HCC.

SOX6
Also flagged:Cholinergic Receptor Nicotinic Beta 2acetylcholine receptorCHRNB2Cell proliferationtumorColorectal Cancer
Journal Article 2025-07-28 ✓ 1 Snippet Umeda S, Tanaka K, Kishida T, Hattori N, Tanaka H, Shimizu D, Takami H, Hayashi M, Tanaka C, Nakayama G, Kanda M.
In-Text Gene Mentions

…SRY, SOX17, andSOX6[ 21 ].…

Show Full Abstract

<h4>Background</h4>Peritoneal dissemination in colorectal cancer (CRC) is associated with poor prognosis due to limited efficacy of current therapeutic strategies. The cholinergic receptor nicotinic beta 2 subunit (<i>CHRNB2</i>), a component of the acetylcholine receptor, has been implicated in other malignancies, but its role in CRC remains unknown.<h4>Methods</h4>This study evaluated the expression and function of CHRNB2 in CRC. CHRNB2 mRNA levels were quantified by qRT-PCR in cell lines and clinical specimens. Functional assays were conducted using CRC cell lines with high CHRNB2 expression, in which CHRNB2 was knocked down by shRNA. Cell proliferation, migration, and invasion were assessed in vitro. In vivo effects were evaluated using subcutaneous and peritoneal xenograft models. The impact of CHRNB2 monoclonal antibody (mAb) treatment on CRC cell proliferation was also examined. Clinical correlations were assessed between CHRNB2 expression and clinicopathological features, including recurrence patterns.<h4>Results</h4>CHRNB2 expression varied among CRC cell lines, with the highest levels observed in LOVO cells. CHRNB2 knockdown significantly inhibited proliferation, migration, and invasion in vitro and suppressed tumor growth in vivo. CHRNB2 mAb treatment reduced cell proliferation. Clinically, high CHRNB2 expression correlated with a significantly higher cumulative rate of peritoneal recurrence, but not with recurrence in the liver, lungs, or lymph nodes. Multivariate analysis identified high CHRNB2 expression and T4 tumor depth as independent predictors of peritoneal recurrence.<h4>Conclusions</h4>CHRNB2 promotes the malignant phenotype of CRC, particularly in peritoneal dissemination. These findings suggest that CHRNB2 may serve as a novel diagnostic biomarker and therapeutic target for CRC with peritoneal metastasis.

Also flagged:Splicingneurologic disordersADneurodegenerative disorderMild cognitive impairmentCognitive Impairment
Journal Article 2025-07-28 No Snippets D'Angiolini S, Gugliandolo A, Calì G, Chiricosta L.
Show Full Abstract

About one billion people worldwide are affected by neurologic disorders. Among the various neurologic disorders, one of the most common is Alzheimer's disease (AD). AD is a neurodegenerative disorder that progressively affects cognitive functions, disrupting the daily lives of millions of individuals. Mild cognitive impairment (MCI) is often considered a prodromal stage of Alzheimer's disease. In this article, we retrieved data from the online available dataset GSE63060, which includes transcriptomic data of 329 blood samples, of which there are 104 cognitively normal controls, 80 MCI patients, and 145 AD patients. We used transcriptomic data related to all three groups to perform an over-representation analysis of the gene ontologies followed by a network analysis. The aim of our study is to pinpoint alterations, detectable through a non-invasive method, in biological processes affected in MCI that persist during AD. Our goal is to uncover transcriptomic changes that could support earlier diagnosis and the development of more effective therapeutic strategies, starting from the early stages of the disease, to slow down or mitigate its progression. Our work provides a consistent picture of the transcriptomic unbalance of many genes strongly involved in ribosomal formation and biogenesis and splicing processes both in patients with MCI and with AD.

HTT
Also flagged:Fatty Acidhepatic steatosisHDlipidmetabolismmonounsaturated
Journal Article 2025-07-28 ✓ 5 Snippets Gregorczyk M, Mika A, Śledziński T, Tomczyk M, Rybakowska I.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, resulting in…

…repeats in theHTTgene, the disease…

…of the humanHTTgene encoding the…

…into the mouseHttgene and exhibit…

…the fact thatHTTgene expression was…

Show Full Abstract

Huntington's disease (HD) is characterized by progressive neurodegeneration, but increasing evidence points to multisystemic involvement, including early hepatic steatosis in pediatric HD. Therefore, it is important to consider systemic alterations, particularly in liver lipid metabolism. In this study, we analyzed fatty acid (FA) profiles in two symptomatic HD mouse models: 2-month-old <i>R6/2</i> mice representing early-onset HD and 22-month-old <i>Hdh<sup>Q150/Q150</sup></i> (<i>Hdh</i>) mice representing late-onset HD, along with age-matched wild-type (<i>WT</i>) controls. FA composition in liver tissue was assessed by gas chromatography-mass spectrometry (GC-MS). In <i>R6/2</i> mice, we observed increased levels of total iso-branched chain, monounsaturated, and n-6 polyunsaturated FAs compared to WT. In contrast, only a few FA species showed reduced concentrations in <i>Hdh</i> mice. Overall, our results indicate that <i>R6/2</i> mice exhibit more pronounced alterations in hepatic FA profiles than <i>Hdh</i> mice, suggesting that early-onset HD may be associated with more severe peripheral metabolic dysregulation.

Also flagged:germ celltestosteronesynthesisspermatogenesismethylationhistone modifications
Journal Article 2025-07-28 No Snippets Anjum S, Khurshid Y, Du Plessis SS, Omolaoye TS.
Show Full Abstract

The epigenetic landscape plays a pivotal role in regulating the functions of both germ and somatic cells (Sertoli and Leydig cells) within the testis, which are essential for male fertility. While somatic cells support germ cell maturation and testosterone synthesis, the epigenetic regulation of germ cells is critical for proper spermatogenesis and function. Epigenetic modifications such as DNA methylation, histone modifications, chromatin remodeling, and non-coding RNAs (ncRNAs) are crucial for regulating gene expression that is essential for spermatogenesis and reproductive function. Although numerous studies have highlighted the significance of the epigenome and its implications for male reproductive health, a comprehensive overview of the existing literature and knowledge is lacking. This review aims to provide an in-depth analysis of the role of epigenetics in spermatogenesis and reproductive health, with a specific focus on DNA methylation, histone remodeling, and small noncoding RNAs (sncRNAs). Additionally, we examine the impact of lifestyle and environmental factors, such as diet, smoking, physical activity, and exposure to endocrine-disrupting chemicals, on the sperm epigenome. We emphasize how these factors influence fertility, embryonic development, and potential transgenerational inheritance. This review underscores how recent advances in the understanding of the epigenetic modulation of testicular function can inform the pathophysiology of male infertility, thereby paving the way for the development of targeted diagnostic and therapeutic strategies.

Also flagged:Neurodegenerative diseasesneurodegenerative disorderspolysaccharidesunsaturated fatty acidstriterpenoidssterols
Journal Article 2025-07-28 No Snippets Godela A, Rogacz D, Pawłowska B, Biczak R.
Show Full Abstract

Neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis remain incurable. Current therapeutic strategies primarily focus on slowing disease progression, alleviating symptoms, and improving patients' quality of life, including the management of comorbid conditions. Over the past few decades, the incidence of diagnosed neurodegenerative disorders has risen significantly. As the number of affected individuals continues to grow, so does the urgent need for effective treatments that can halt or mitigate the progression of these diseases. Among the most promising therapeutic resources are bioactive compounds derived from fungi. The high quality of proteins, polysaccharides, unsaturated fatty acids, triterpenoids, sterols, and secondary metabolites found in fungi have attracted growing interest from researchers across multiple disciplines. One intensively studied direction involves the use of naturally occurring fungi-derived nutraceuticals in the treatment of various diseases, including neurodegenerative conditions. This article provides an overview of recent findings on fungal compounds-such as phenolic compounds, carbohydrates, peptides and proteins, and lipids-that may have potential applications in the treatment of neurodegenerative diseases and the alleviation of their symptoms.

Also flagged:ALSSOD1Amyotrophic Lateral SclerosisAmyotrophic lateral sclerosisneurodegenerative diseasetranslational
Journal Article 2025-07-28 No Snippets Sanghai N, Tranmer GK.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a rare motor neurodegenerative disease affecting multiple cellular proteins during the progression of the disease. ALS was first discovered by Charcot in 1869, and since then, scientists have been unable to identify a singular cause of the disease. Further, there are no effective treatments available to cure ALS. The benchmark discovery of humanized preclinical SOD1 mouse models, which recapitulates the clinical and pathological phenotypes of human ALS, gives hope to medicinal chemists and neuroscientists around the globe that a suitable drug-like molecule can be discovered and translated into human beings as a means to slow down the progression of the disease. However, little success has been achieved until now in terms of finding an effective treatment for heterogenic and incurable ALS. One area marked for improvement is the use of semiquantitative, antibody-based targeted Western blotting (WB) experiments, which lack the power to analyze multiple cellular events within the entire dysregulated proteomic system. With the inconsistency of WB experiments, unexpected cellular pathways go undiscovered, and hence, loss of translation with no target engagement is seen from preclinical to human clinical ALS. Recent advancements in discovery-based quantitative proteomics have many advantages over WB. These innovative techniques could help solve the inherent problem in WB and their inability to discover multiple altered proteins with the added capability of longitudinal analysis in preclinical SOD1 models, further validating the findings in human ALS. Herein, we applied a holistic approach to summarize various reports on the use of proteomics in ALS from the published literature, and importantly, we found that using a discovery-based proteomics approach in SOD1 preclinical ALS models has revealed a more diverse and global picture of pathological proteins that affect multiple pathways during different stages of disease progression. Furthermore, we found that the proteomic profiling of the humanized SOD1 mouse model provided a proof of principle for translating the diverse pathological biomarker proteins identified in clinical human ALS cases. Moreover, we believe that advancements in the proteomics approach toward ALS biomarkers could bridge the gap between preclinical and clinical studies, enabling scientists worldwide to discover novel biomarkers and treatments that modify the progression of ALS.

ZNF664CCDC92
Also flagged:cardiovascular diseasesstructural disordersrhythm disordersdeathautosomesconduction disorder bundle branch block
Journal Article 2025-07-28 ✓ 2 Snippets Yeung MW, van de Leur RR, Benjamins JW, Vessies MB, Ruijsink B, Puyol-Antón E, van Tintelen JP, Verweij N, van Es R, van der Harst P.
In-Text Gene Mentions
⭐ same-sentence co-mention

…, AFAP1 ,CCDC92/ZNF664/FAM101A, and SNCAIP, h…

⭐ same-sentence co-mention

…, AFAP1 , CCDC92/ZNF664/FAM101A, and SNCAIP, have…

Show Full Abstract

Conventional approaches to analyzing electrocardiograms (ECG) in discrete parameters (such as the PR interval) ignored the high dimensionality of data omitted subtle but relevant information. We applied a variational auto-encoder to learn the underlying distributions of the ECG of 41,927 UK Biobank participants, generating 32-dimensional representation (latent factors). The latent factors showed correlations to conventional ECG parameters and strong associations to cardiac phenotypes estimated from magnetic resonance imaging. We found definitive associations of the latent factors to conduction, rhythm, and structural disorders (all <i>p</i> < 4.51 × 10<sup>-308</sup>) and additionally value in mortality prediction. Genome wide association study (GWAS) of the latent factors, revealed 170 genetic loci with 29 not previously associated with electrocardiographic phenotypes. Further characterization of the genetic signals suggested involvement in cardiac development, contractility, and electrophysiology. Our results supported that the deep representation learning of 12-lead ECG could provide clinically meaningful and interpretable insights into cardiovascular biology and health.

MLLT10
Also flagged:Lung cancercancerNon-small cell lung cancerNSCLClung cancersplatinum
Journal Article 2025-07-28 ✓ 2 Snippets Lee JH, Kwon Y, Yoon K.
In-Text Gene Mentions

… 5'-UAGCUGAGUGCACGUUGAAAG-3'),MLLT10(#1 5'-GGACCGUGGUUUUGCAGGA-3',…

…TFDP2, TCF7L2, andMLLT10).…

Show Full Abstract

Platinum-based chemotherapy is the standard treatment for advanced non-small cell lung cancer (NSCLC); however, innate and acquired resistance is a major obstacle. To determine the transcriptional regulators of resistance, we first classified three-dimensional tumor spheroids derived from 11 NSCLC cell lines into cisplatin-sensitive or -resistant groups based on their cisplatin sensitivity and selected signature genes that were differentially altered between the groups. Using reverse engineering methods and functional validation, cAMP response element-binding protein 1 (CREB) was identified as a major regulator of cisplatin resistance. Among the putative target genes of CREB responsible for cisplatin resistance, cisplatin treatment significantly decreased the occupancy of CREB in the regulatory regions of <i>TNKS</i> and <i>KDM6A</i> in cisplatin-sensitive cells, but not in resistant cells, resulting in decreased expression of these protein in the sensitive group. Furthermore, CREB knockdown led to increased sensitivity to cisplatin with reduced levels of TNKS and KDM6A in both cisplatin-resistant tumor spheroids and tumors in a xenograft mouse model. In conclusion, our study delineates the role of CREB in cisplatin resistance and suggests that CREB inhibition is a potential therapeutic strategy for cisplatin-resistant NSCLCs.

PRDX6
Also flagged:Hepatocellular carcinomaliver cancerhepatic cancershepatitisHBV) infectioncancer
Journal Article 2025-07-28 ✓ 1 Snippet Zhang Q, Cao Z, Cao H, Wu H, Yan S, Kan Y, Cui X, Feng Y, Liu Z.
In-Text Gene Mentions

…CXCL8, LGALS3, BSG,PRDX6, NQO1, MMP9, LGALS1,…

Show Full Abstract

The acquisition of resistance to anoikis is a critical driver of metastasis in various tumor types. However, the combined role of anoikis apoptosis in the progression and prognosis of hepatocellular carcinoma (HCC) remains largely unexplored. This study integrates known anoikis genes with single-cell datasets to identify differentially expressed Anoikis (DE-Anoikis) through unsupervised clustering, enabling the classification of samples from The Cancer Genome Atlas (TCGA). A prognostic risk model was constructed using univariate Cox proportional hazards regression and validated with external datasets from the International Cancer Genome Consortium (ICGC) and the Gene Expression Omnibus (GEO). The results revealed significant prognostic differences among DE-Anoikis-based HCC molecular subtypes, with functional enrichment analyses highlighting metabolic reprogramming differences. Furthermore, the anoikis-related prognostic model demonstrated robust predictive accuracy across multiple validation datasets. Two potential therapeutic drugs exhibited sensitivity in low-risk patients, offering novel insights into HCC treatment. Overall, this study identifies a unique subgroup of apoptosis-associated HCC and a prognostic model, providing further biological insights into the molecular mechanisms and therapeutic strategies for HCC.

HFE
Also flagged:oxygeninfectiondeathanemiaacetylsalicylic acidP2Y12
Journal Article 2025-07-28 ✓ 1 Snippet Kletzer J, Kreibich M, Czerny M, Berger T, Fagu A, Micek L, Franke U, Eschenhagen M, Hartikainen TS, Wild M, Bockelmann D.
In-Text Gene Mentions

…genetic factors (e.g.,HFEmutations affecting iron…

Show Full Abstract

<b>Background:</b> While timely blood transfusion is critical for restoring oxygen-carrying capacity after coronary artery bypass grafting (CABG), allogeneic blood product transfusions are independently associated with increased long-term mortality, necessitating a risk-stratified approach to balance oxygen delivery against immunological complications and infection risks. <b>Methods:</b> We retrospectively analyzed 3376 patients undergoing isolated CABG between 2005 and 2023 at a single tertiary center. Patients who died during their perioperative hospital stay within 30 days were excluded. Transfusion burden was assessed both as the absolute number of blood product units (packed red blood cells, platelet transfusion, fresh frozen plasma) and as a percentage of calculated patient blood volume. The primary outcome was all-cause mortality at 5 years. Flexible Cox regression with penalized smoothing splines, adjusted for EuroSCORE II, was used to model dose-response relationships. <b>Results:</b> From our cohort of 3376 patients, a total of 137 patients (4.05%) received >10 units of packed red blood cells (PRBC) perioperatively. These patients were older (median 71 vs. 68 years, <i>p</i> < 0.001), more often female (29% vs. 15%, <i>p</i> < 0.001), and had higher preoperative risk (EuroSCORE II: 2.53 vs. 1.41, <i>p</i> < 0.001). After 5 years, mortality was 42% in the massive transfusion group versus 10% in controls. Spline regression revealed an exponential increase in mortality with transfused units: 14 units yielded a 1.5-fold higher hazard of death (HR 1.46, 95% CI 1.31-1.64), rising to HR 2.71 (95% CI 2.12-3.47) at 30 units. When transfusion was indexed to blood volume, this relationship became linear and more tightly correlated with mortality, with lower maximum hazard ratios and narrower confidence intervals. <b>Conclusions:</b> Indexing transfusion burden to the percentage of patient blood volume replaced provides a more accurate and clinically actionable predictor of 5-year mortality after CABG than absolute unit counts. Our findings support a shift toward individualized, volume-based transfusion strategies to optimize patient outcomes and resource stewardship in a time of limited availability of blood products.

Also flagged:RivastigminecholinesterasesbutyrylcholinesteraseacetylcholinesteraseAChEneuroblastoma
Journal Article 2025-07-28 No Snippets Dias I, Emmanuel M, Vogt P, Guerreiro-Oliveira C, Melo-Marques I, Cardoso SM, Guedes RC, Chaves S, Santos MA.
Show Full Abstract

A series of rivastigmine hybrids, incorporating rivastigmine fragments (RIV) and a set of different antioxidant scaffolds, were designed, synthesized, and evaluated as multifunctional agents for the potential therapy of Alzheimer's disease (AD). In vitro bioactivity assays indicated that some compounds have very good antioxidant (radical-scavenging) activity. The compounds also displayed good inhibitory activity against cholinesterases, though the bigger-sized hybrids showed higher inhibitory ability for butyrylcholinesterase (BChE) than for acetylcholinesterase (AChE), due to the larger active site cavity of BChE. All the hybrids exhibited an inhibition capacity for self-induced amyloid-β (Aβ<sub>1-42</sub>) aggregation. Furthermore, cell assays demonstrated that some compounds showed capacity for rescuing neuroblastoma cells from toxicity induced by reactive oxygen species (ROS). Among these RIV hybrids, the best in vitro multifunctional capacity was found for the caffeic acid derivatives enclosing catechol moieties (<b>4AY5</b>, <b>4AY6</b>), though the Trolox derivatives (<b>4AY2</b>, <b>4BY2</b>) presented the best cell neuroprotective activity against oxidative damage. Molecular-docking studies provided structural insights into the binding modes of RIV-based hybrids to the cholinesterases, revealing key interaction patterns despite some lack of correlation with inhibitory potency. Overall, the balanced multifunctional profiles of these hybrids render them potentially promising candidates for treating AD, thus deserving further investigation.

Also flagged:OsteosarcomaOSbone cancertumorepigeneticpathogenesis
Journal Article 2025-07-28 No Snippets Katsianou MA, Andreou D, Korkolopoulou P, Vetsika EK, Piperi C.
Show Full Abstract

Osteosarcoma (OS), the most common primary bone cancer of mesenchymal origin in children and young adolescents, remains a challenge due to metastasis and resistance to chemotherapy. It displays severe aneuploidy and a high mutation frequency which drive tumor initiation and progression; however, recent studies have highlighted the role of epigenetic modifications as a key driver of OS pathogenesis, independent of genetic mutations. DNA and RNA methylation, histone modifications and non-coding RNAs are among the major epigenetic modifications which can modulate the expression of oncogenes. Abnormal activity of these mechanisms contributes to gene dysregulation, metastasis and immune evasion. Therapeutic targeting against these epigenetic mechanisms, including inhibitors of DNA and RNA methylation as well as regulators of RNA modifications, can enhance tumor suppressor gene activity. In this review, we examine recent studies elucidating the role of epigenetic regulation in OS pathogenesis and discuss emerging drugs or interventions with potential clinical utility. Understanding of tumor- specific epigenetic alterations, coupled with innovative therapeutic strategies and AI-driven biomarker discovery, could pave the way for personalized therapies based on the molecular profile of each tumor and improve the management of patients with OS.

PEBP1
Also flagged:ferroptosisasthmaBronchial asthma-apoptotic cell deathpathogenesisAGPS
Journal Article 2025-07-27 ✓ 3 Snippets Chen Y, Wang J, Zhang Y, Zhang Z, Chen H, Hu J, Zhu K, Wu L, Xu F.
In-Text Gene Mentions

…proteins such asPEBP1, 15LO-1, GPX-4, and…

…mediated by the 15LO2-PEBP1pathway 18 ,…

…pathways, including the 15LO1-PEBP1axis, exacerbating airway…

Show Full Abstract

Bronchial asthma is a complex and heterogeneous disease, with ferroptosis, a form of non-apoptotic cell death, contributing to its pathogenesis by inducing airway epithelial damage, inflammatory infiltration, and airway remodeling. Investigating ferroptosis-related characteristic genes and potential therapeutic compounds may enhance asthma management. This study employed differential analysis and machine learning to identify ferroptosis-related characteristic genes in asthma using the GSE179156 dataset and FerrDb V2 database. Immune infiltration analysis explored the associations between these genes and immune cells, while potential small-molecule drugs were screened through the Connectivity Map (CMap) database and evaluated via molecular docking and molecular dynamics simulations. Two ferroptosis-related characteristic genes, AGPS and APELA, were identified, with AGPS upregulated and APELA downregulated in asthma, both significantly correlated with various immune cells. A diagnostic model based on these genes demonstrated high predictive accuracy. Additionally, KU-55933 was identified as a potential small-molecule inhibitor of AGPS, with stable binding confirmed through computational simulations. These findings emphasize the role of ferroptosis-related genes in asthma and propose promising therapeutic candidates, providing novel insights into its diagnosis and treatment.

DARS2
Also flagged:Primary liver cancermalignant tumorscancerhepatocellular carcinomaliver cancerpathogenesis
Journal Article 2025-07-27 ✓ 3 Snippets Lin Q, Chen J, Zhou L, Fang M, Wei C, Huang T, Xu Y, Gao J, Liu F, Tang Z, Zhu JK, Yang W.
In-Text Gene Mentions

…were identified: OBSCN,DARS2, NDUFAF6, PNPLA8, TWNK,…

…levels of OBSCN,DARS2, and NDUFAF6 were…

…LMRGs, including OBSCN,DARS2, and NDUFAF6, which…

Show Full Abstract

<h4>Background</h4>Although recent research has highlighted lactylation, a post-translational modification driven by elevated lactate levels, as a critical regulator of key cellular pathways in hepatocellular carcinoma (HCC), its contribution to the poor prognosis of Clonorchis sinensis (Cs)-infected HCC remains poorly understood.<h4>Methods</h4>We first identified the significant upregulation of the lactate metabolism enzyme LDH in Cs-infected HCC patients through clinical retrospective analysis. We then conducted a multi-omics analysis (RNA-Seq, ATAC-Seq, WGBS-Seq, oxWGBS-Seq, and ChIP-Seq) to examine the differences in 392 lactate metabolism-related genes (LMRGs) between Cs-infected and Cs-noninfected HCC tumors. Six key differentially expressed LMRGs were further validated using RT-qPCR assays to confirm their expression and potential role in HCC progression.<h4>Results</h4>The differential expression levels of 8 LMRGs, along with 71 accessible regions and 42 CpG sites in the promoters of LMRGs, were identified. Notably, we also demonstrated that histone modifications, including H3K9ac, H3K79me2, H3K4me2, H3K4me3, H3K27ac, and H3K4me1, were associated with chromatin accessibility in the promoters of LMRGs. Finally, the TCGA-LIHC cohort confirmed that the differential expression of LMRGs between Cs-infected and Cs-noninfected HCC tumors significantly affects the survival outcomes of HCC.<h4>Conclusions</h4>Our findings revealed that lactylation plays an important role in reshaping the characteristics of HCC during Cs infection, expanding our understanding of the unique features of Cs-infected HCC.

LRRC7NEGR1
Also flagged:ChromosomeHypotoniaCryptorchidismintellectual disabilityfailure to thrivemicrocephaly
Journal Article 2025-07-27 ✓ 5 Snippets Mikhailova T, Garg R.
In-Text Gene Mentions

…located within theLRRC7coding region (Supporting…

…neuronal growth regulator (NEGR1), located at…

…study exhibit aNEGR1deletion, consistently present…

…affecting only theNEGR1gene, presenting with…

…mechanism by whichNEGR1deletion could contribute…

Show Full Abstract

Deletions within the chromosomal locus 1p31.1 are rare, with only a limited number of documented cases. The typical clinical presentation includes intellectual disability, failure to thrive, and craniofacial abnormalities. Some cases may also present with cardiac, gastrointestinal, and genitourinary malformations. Variability in deletion size contributes to a broad spectrum of clinical phenotypes, and a comprehensive understanding of the syndrome's manifestations is still evolving. This case study aims to provide additional insights into 1p31.1 microdeletion syndrome, enhancing knowledge of its genetic and phenotypic characteristics to improve recognition by clinicians. Here, we report a case featuring a 14.385 Mb deletion isolated to the 1p31.1 region, encompassing 41 genes. The deletion manifested with microcephaly, distinctive facial morphology, hypotonia, developmental delay, bilateral cryptorchidism, and flat feet. Notably, our case also exhibited congenital thickening of the lingual and labial frenulum, a trait not typically associated with this deletion.

HFE
Also flagged:SteatosisMetabolic DysfunctionMetabolic dysfunction-steatotic liver diseasesteatohepatitisliver fibrosis
Journal Article 2025-07-27 ✓ 1 Snippet Altaf A, Abbas Z, Qadeer MA, Siyal M.
In-Text Gene Mentions

…(e.g., Wilson's disease,hemochromatosis) were excluded based…

Show Full Abstract

Objective Metabolic dysfunction-associated steatotic liver disease (MASLD) can rapidly progress to steatohepatitis, liver fibrosis, and hepatocellular carcinoma. However, it is a multisystem disease, and most of the MASLD-related morbidity and mortality is due to its extrahepatic complications. In light of the growing impact of MASLD on extrahepatic organs, we aimed to evaluate spleen fat deposition and compare it with liver fat deposition by vibration-controlled transient elastography using its attenuation parameter. Design Eighty patients from the outpatient department, who met the criteria of MASLD, were included in the study. Both liver and spleen elastography were performed via FibroScan at the same time before treatment. Results Out of the 80 people studied, 69 (86.3%) were male patients. Their age ranged from 22 to 86 years (mean 42.44± 11.92), and BMI ranged between 20.5 to 39.8 kg/m<sup>2</sup> (28.12± 3.99). Hypertension was present in 45 (56.3%) patients. Sixteen (20%) patients had mild liver steatosis, 26 (32.5%) had moderate, and 28 (35%) patients recorded the presence of severe fatty liver. Using the same cut-off values for spleen, 28 (35%) patients had normal attenuation (steatosis), four (5%) had mild spleen steatosis, 17 (21.3%) had moderate, and 31 (38.8%) patients had severe fatty spleen. A bivariate correlation analysis revealed a significant correlation between hepatic and splenic steatosis (p=0.01). Furthermore, patients with elevated spleen steatosis demonstrated higher liver fat content as indicated by raised liver controlled attenuation parameter (CAP) values (289.79±30.10 dB/m) compared to those without spleen steatosis (264.67±41.85 dB/m). Conclusion This study shows correlation of fatty liver with that of steatosis of the spleen, highlighting the extrahepatic multiorgan effects of the MASLD.

HTT
Also flagged:Insulin-like growth factor 2AKTHuntingtinHDneurodegenerative disorderIGF2
Journal Article 2025-07-26 ✓ 2 Snippets Tung YS, Tung CW, Chan SC, Chen YC, Wu PM, Cheng PH, Chen CM, Yang SH.
In-Text Gene Mentions

…Huntingtin gene (mHTT) with expanded…

…of the humanHTTpromoter, were used…

Show Full Abstract

BACKGROUND: Aggregation of misfolded mutant Huntingtin (mHTT) is a pathological characteristic in Huntington’s disease (HD), implying clearance of mHTT is a therapeutical direction for this neurodegenerative disorder. Based on previous studies, Insulin-like growth factor 2 (IGF2) enhances microfilament polymerization in HD models; however, the role of IGF2 against mHTT aggregates is still unclear. RESULTS: Here, we demonstrate that IGF2 expression is significantly lower in symptomatic HD patients compared to presymptomatic individuals, and IGF2 activation mechanistically enhances phosphorylation of Protein Kinase B(AKT; serine/threonine kinase), which subsequently reduces mHTT aggregates in vitro. Furthermore, IGF2 stimulates Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling, promoting the secretion of mHTT within extracellular vesicles, thereby aiding cellular clearance. In vivo studies in R6/2 HD transgenic mice reveal that IGF2 administration improves motor functions and decreases mHTT levels. CONCLUSIONS: Collectively, our findings elucidate the multifaceted role of IGF2 in HD, highlighting its therapeutic potential through modulation of AKT and NF-κB signaling pathways.

PRDX6
Also flagged:Peroxiredoxin 1NLRP3Prdx1experimental colitisantibodycolitis
Journal Article 2025-07-26 ✓ 1 Snippet Li S, Xia Q, He Y, Wu W, Tang D, Deng Z, Zeng Z, Tu S, Chen B, Gu L, Yang X, Peng Y, Yang H, Peng Z.
In-Text Gene Mentions

…effects observed inPrdx6-deficient mice in…

Show Full Abstract

Damage-associated molecular patterns (DAMPs) are a cause of Crohn's disease (CD). Peroxiredoxin 1 (Prdx1), a newly identified DAMP, plays a critical role in organ injury with its potent proinflammatory properties. However, its specific role in CD remains unclear. Here, we identify serum Prdx1 as a DAMP involved in CD. Serum Prdx1 levels were significantly increased and positively correlated with the severity of intestinal inflammation in both CD patients and mice with experimental colitis. Genetic knockout of Prdx1 or administration of a Prdx1-neutralizing antibody attenuated colitis in mice, as evidenced by restoration of the colonic epithelium, improved disease activity, and reduced colonic inflammation. These protective effects were impaired by introduction of recombinant Prdx1 (rPrdx1). Mechanistically, Prdx1 exacerbated intestinal inflammation by promoting macrophage infiltration and subsequent cytokine production. Depletion of macrophages abolished the rPrdx1-mediated exacerbation of colitis. Further, rPrdx1 was internalized by macrophages, leading to lysosomal disruption and subsequent activation of the NLRP3 inflammasome. Pharmacological inhibition of NLRP3 effectively abrogated rPrdx1-induced exacerbation of colitis. In conclusion, serum Prdx1 promotes intestinal inflammation in CD at least in part by activating the NLRP3 inflammasome through lysosomal disruption in macrophages. These findings highlight the pathogenic role of Prdx1 in CD and reveal therapeutic potential of managing CD via neutralization of circulating Prdx1.

SOX6
Also flagged:kidney diseasesorganogenesisfertilizationlhx1aTgCas9
Journal Article 2025-07-26 ✓ 1 Snippet Peng Z, Vanichapol T, Nguyen PD, Chang HG, Kocha KM, O'Brien LL, Currie PD, Huang P, Davidson AJ.
In-Text Gene Mentions

…, msi2b andsox6, which are…

Show Full Abstract

For over a century it has been believed that the vertebrate kidney arises exclusively from the intermediate mesoderm. Here, we overturn this paradigm by demonstrating that some nephrons, the functional units of the kidney, originate from the somites- blocks of paraxial mesoderm best known for their contribution to muscle and connective tissues. Using a combination of the GESTALT technique to assign developmental ancestry, somite transplantation experiments and Cre-lox fate-mapping, we show that somites can contribute to the nephrons in the adult zebrafish kidney. Our findings uncover an unexpected developmental connection between the somites and kidneys, potentially offering new pathways for developing regenerative treatments for kidney diseases.

HFE
Also flagged:agingchronic diseasesOsteoporosisage-related diseasemenopauseestrogen
Journal Article 2025-07-26 ✓ 1 Snippet Farshbaf-Khalili A, Malekmirzaei E, Babaie S, Pakpour V.
In-Text Gene Mentions

…ases (hemophilia, thalassemia,hemochromatosis), endocrine disorders (such…

Show Full Abstract

Effective management of osteoporosis requires individuals to take responsibility for following medication, exercise, and dietary guidelines. The aim of this study was to provide important insights into self-care behaviors and their determinants, especially dietary patterns related to vitamin D and calcium intake among elderly women, both healthy and those with osteoporosis. This cross-sectional descriptive-comparative study included 250 postmenopausal women aged 60 and above, consisting of 125 healthy women and 125 women with osteoporosis which conducted in Tabriz, Iran. The data collection instruments comprised a demographic questionnaire, Menopausal Self-Care Questionnaire, and Vitamin D and Calcium Food Frequency Questionnaire. Multivariate linear regression models were employed to identify predictors of self-care behaviors and dietary intakes. The mean (Standard deviation: SD) total self-care score (33-165) in healthy women was higher 118.97 ± 19.92 compared to osteoporotic women 84.7 ± 14.98 (p < 0.001). Healthy women also exhibited significantly higher daily dietary intakes of calcium (850.52 ± 147.92 mg vs. 546.71 ± 60.28 mg, p < 0.001) and vitamin D (3.38 ± 0.65 mg vs. 2.0 ± 0.34 mg, p < 0.001) than osteoporotic women. Multivariate analysis identified household income, age, education, exercise, and BMI as key predictors of self-care behaviors and dietary intakes (p < 0.05) in healthy and osteoporotic elderly women. Postmenopausal women with osteoporosis exhibited poorer self-care behaviors and lower calcium/vitamin D intake compared to healthy peers, with socioeconomic factors (income, education), exercise, age, and BMI as key predictors.

Also flagged:OsteodifferentiationextracellularmineralizationmineralcollagenDifferentiation
Journal Article 2025-07-26 No Snippets Bispo DS, Graça ICR, Rodrigues JA, Martins JTS, Nolasco MM, Marques MPM, Nogueira HIS, Mano JF, Oliveira MB, Ribeiro-Claro PJA, Gil AM.
Show Full Abstract

The application of vibrational microspectroscopy to the study of in vitro mesenchymal stem cells (MSC) osteogenic differentiation is a promising approach towards the understanding of the molecular processes involved in bone fabrication. Both infrared (IR) and Raman microspectroscopies have been applied, with a clear predominance of the latter. Bone marrow MSC have been the target of most studies, followed by those originating from dental/oral and adipose tissues. Interests have increasingly addressed single cell and extracellular matrix characterization at the molecular level. Most studies have focused on the characteristics and maturity of time-course mineralization, attempting to localize mineral aggregates formed onto the evolving collagen strands. Some reports have focused on time-dependent changes in protein structure and other components of extracellular matrix components. Besides spectral band examination through position, linewidth and shape, selected band ratios have proved largely informative to assess mineral species evolution and mineral-to-organic matrix interactions over time. The increasing use of multivariate analysis (or chemometrics) and machine learning strategies to detect finer spectral variations is evident, as is the promise of more recent IR and Raman variations to provide higher sensitivity and spatial resolution conditions. The label-free non-invasive nature of vibrational microspectroscopy makes it particularly promising for rapid and effective selection of suitable MSC donors, to support scale-up procedures for translation to the clinic. Some of the challenges to be faced are briefly discussed.

SERPINC1
Also flagged:chronic thromboembolic pulmonary hypertensionCTEPHpathogenesispulmonary embolismPEvWF
Journal Article 2025-07-26 ✓ 1 Snippet Dodson MW, Allen-Brady K, Stevens J, Cirulis MM, Alotaibi M, Fernandes TM, Kim NH, Kerr KM, Papamatheakis DG, Poch DS, Desmarais J, Best DH, Hatton ND, Ryan JJ, Elliott CG, Cannon-Albright LA.
In-Text Gene Mentions

…and 1.3% inSERPINC1, the gene…

Show Full Abstract

<h4>Background</h4>The pathogenesis of chronic thromboembolic pulmonary hypertension (CTEPH) is poorly understood. Studies of the genetic risk factors for CTEPH are likely to improve our understanding of CTEPH pathogenesis and may lead to novel treatment and prevention strategies. Genetic analysis focused on shared gene variants in high-risk disease pedigrees can aid in the identification of rare variants with a strong effect on disease risk.<h4>Methods</h4>We identified 13 CTEPH high-risk pedigrees and performed whole-exome sequencing in 22 CTEPH cases from these pedigrees, focusing on rare and deleterious variants that were shared between related CTEPH cases. We validated CTEPH candidate gene variants in two independent CTEPH cohorts, one from Utah (n=78) and one from the University of California San Diego (n=238), and compared them to controls from the UK Biobank.<h4>Results</h4>A rare and predicted deleterious missense variant in <i>STAB2</i> was identified in two related CTEPH cases. Qualifying <i>STAB2</i> variant alleles were observed more frequently in both CTEPH cohorts (pooled allele frequency 4.6%) than in subjects from the UK Biobank with a history of pulmonary embolism (PE) (allele frequency 2.2%, p=0.0002) or without a history of PE (allele frequency 1.9%, p<0.0001). CTEPH subjects with qualifying <i>STAB2</i> variants had elevated levels of plasma von Willebrand Factor (vWF) and factor VIII, consistent with the known role of <i>STAB2</i> as a genetic regulator of circulating vWF levels.<h4>Conclusions</h4>Rare variants in <i>STAB2</i> are identified in a CTEPH high-risk pedigree and are over-represented in nonrelated CTEPH cases compared to controls with PE. These data suggest that <i>STAB2</i> is a CTEPH risk gene.

PEBP1
Also flagged:GlycolysisAsthmapathogenesisadenosine triphosphatelipidcancer
Journal Article 2025-07-26 ✓ 5 Snippets Luo J, Ge X.
In-Text Gene Mentions

…PE binding protein-1 (PEBP1).…

PEBP1drives the dynamic…

…high expression of 15LO1-PEBP1and LC3-II in…

…autophagy by the 15LO1-PEBP1complex presents a…

…15LO1, 15 lipoxygenase-1;PEBP1, PE binding protein-1;…

Show Full Abstract

Asthma is a chronic, complex, and heterogeneous respiratory condition marked by airway hyperresponsiveness and reversible airflow limitation. Recent evidence highlights the significant role of metabolic changes, particularly glycolytic reprogramming, in the pathogenesis of asthma. Glycolysis, a fundamental pathway for both anaerobic and aerobic oxidation, not only generates adenosine triphosphate (ATP) but also supplies substrates for lipid-based ATP storage. While initially studied in the context of cancer, glycolysis has been associated with asthma through its interplay with programmed cell death, which is crucial in asthma pathophysiology. This study offers a comprehensive overview of current research on glycolytic reprogramming in asthma, emphasizing its potential implications and significance. The findings aim to inform future studies and contribute to the development of asthma-related precision medicine. A deeper understanding of the interplay between glycolysis and the development and progression of asthma may facilitate the development of innovative therapeutic approaches for this complex condition.

Also flagged:genes
Journal Article 2025-07-26 No Snippets Costantini M, Guida F, Amorim CG, da Nóbrega LB, Esposito R, Zupo V, Fleury BG.
Show Full Abstract

<i>Tubastraea coccinea</i> and <i>T. tagusensis</i>, commonly known as sun corals, are two species of stony corals (Scleractinia, Dendrophylliidae) native to the Indo-Pacific region (<i>T. coccinea</i>) and the Galapagos Islands (<i>T. tagusensis</i>), respectively. They are considered highly invasive species, particularly in the Western Atlantic Ocean, due to high adaptability to various ecological conditions and notable resilience. Given their demonstrated invasiveness, it is important to delve into their physiology and the molecular bases supporting their resilience. However, to date, only a few molecular tools are available for the study of these organisms. The primary objective of the present study was the development of an efficient RNA extraction protocol for <i>Tubastraea coccinea</i> and <i>T.a tagusensis</i> samples collected off Ilha Grande Bay, Rio de Janeiro (Brazil). The quantity of isolated RNA was evaluated using NanoDrop, while its purity and quality were determined by evaluating the A260/A280 and A260/230 ratios. Subsequently, based on genes known for <i>T. coccinea</i>, two housekeeping genes and seven stress response-related genes were isolated and characterized, for the first time for both species, using a molecular approach. An interactomic analysis was also conducted, which revealed functional interactions among these genes. This study represents the first report on gene networks in <i>Tubastraea</i> spp., opening new perspectives for understanding the chemical ecology and the cellular mechanisms underlying the invasiveness of these species. The results obtained will be useful for ecological conservation purposes, contributing to the formulation of strategies to limit their further expansion.

ZNFX1
Also flagged:extrapulmonary diseasespulmonary diseaseinfectionNTM infectionscervical lymphadenitislocalized lymphadenitis
Journal Article 2025-07-26 ✓ 2 Snippets Abukhalid N, Alzahrani N, Alsager K, Alsowailmi B, Albawardi A.
In-Text Gene Mentions

…by mutation inZNFX1gene which is…

…is normal inZNFX1-deficient patients [38] ,…

Show Full Abstract

We present a case series of six children who were infected with different species of Nontuberculous mycobacteria (NTM) and <i>Mycobacterium riyadhense</i> was the most prevalent isolate representing 50% of the total pathogens. Four of the reported cases were immunocompromised with disseminated NTM diseases and two were infected with <i>M. avium</i>, <i>M. abscessus</i>, and the other two infected with <i>M. riyadhense</i>. Most patients responded to medical therapy, except for the <i>M. avium</i> case, which was fatal despite combination therapy. Due to the presence of mycolic acid in the cell wall of NTM isolates, prolonged combination therapy is required for treatment, and in some cases, natural resistance may also emerge. Most of the patients reported in our study were immunocompetent. This suggests that NTM can infect children at various body sites regardless of immune status. We highlighted our experience in diagnosing and treating these patients, with special attention to <i>M. riyadhense</i>.

HFE
Also flagged:SGLT2Metabolic Dysfunction-Associated Steatotic Liver Diseasealanine aminotransferaseALTalkaline phosphataseALP
Journal Article 2025-07-26 ✓ 2 Snippets Suki M, Imam A, Amer J, Milgrom Y, Massarwa M, Hazou W, Tiram Y, Perzon O, Sharif Y, Sackran J, Alon R, Lourie N, Hershko Klement A, Shibli S, Safadi T, Raz I, Khalaileh A, Safadi R.
In-Text Gene Mentions

…cholangitis, Wilson’s disease,hemochromatosis, or alpha-1 antitrypsin…

…primary biliary cirrhosis,hemochromatosis, etc.).…

Show Full Abstract

<b>Background and Aims</b>: Sodium-glucose cotransporter-2 (SGLT2) inhibitors have shown promise in metabolic dysfunction-associated steatotic liver disease (MASLD). This large real-world study aimed to evaluate the effects of SGLT2 inhibitors on MASLD patients' clinical outcomes and liver-related complications over extended follow-up. <b>Patients and Method</b>: Data were sourced from TriNetX, a global health research platform with de-identified electronic medical records spanning 135 million patients across 112 healthcare organizations worldwide. We included MASLD adults diagnosed according to ICD9/10 criteria. Following propensity score matching based on 34 variables (demographics, comorbidities, laboratory tests and medication history), SGLT2 inhibitor-treated (n = 19,922) patients were compared with non-SGLT2 inhibitor (n = 19,922) cases. Exclusion criteria included baseline improved alanine aminotransferase (ALT) and alkaline phosphatase (ALP) levels > 4 upper normal limit (UNL), baseline advanced liver disease, liver transplant and cancer, past anticoagulation and non-MASLD etiologies. Assessed outcomes included survival, biochemical, hematologic, AFP, metabolic and cardiovascular parameters, progression to advanced liver disease (ALD), synthetic function, and metabolic markers over 1, 5, and 10 years. <b>Results</b>: Following matching, both cohorts were well-balanced across baseline characteristics. After one year, the SGLT2 inhibitor group demonstrated significantly reduced BMI (33.2 ± 6.2 vs. 34.1 ± 6.5 kg/m<sup>2</sup>, <i>p</i> < 0.001), improved ALT (40.3 ± 31.5 vs. 48.3 ± 41.2 U/L, <i>p</i> < 0.001), and better glycemic control (HbA1c 7.35 ± 1.51% vs. 7.93 ± 1.72%, <i>p</i> < 0.001). The SGLT2 inhibitor group showed higher 10-year survival rates (95.00% vs. 88.69%, <i>p</i> < 0.001), fewer cardiovascular events (10.19% vs. 11.80%, <i>p</i> < 0.001), and markedly reduced progression to advanced liver disease (6.90% vs. 14.15%, <i>p</i> < 0.001). These benefits were consistent across clinical, laboratory, and medication-defined ALD categories. Notably, rates of hepatic decompensation events were significantly lower with SGLT2 inhibitor therapy. <b>Conclusions</b>: In this large real-world cohort, SGLT2 inhibitor use in MASLD patients was associated with significantly improved long-term survival, cardiovascular, and liver-related outcomes over 10 years of follow-up. These benefits likely result from combined metabolic improvements, anti-inflammatory effects, and direct hepatoprotective mechanisms. SGLT2 inhibitors represent a promising therapeutic strategy for improving outcomes in MASLD.

Also flagged:phosphatidic acidsacylPhosphatidic AcidGlycerophospholipidGlycerophospholipidsGPL
Journal Article 2025-07-25 No Snippets Schlichter A, Wolf A, Ferrand T, Cocq A, Riachy L, Vertueux S, Beauvais B, Courvalet M, Henry PJ, Tanguy E, Gonzales L, Ferlet R, Laguerre F, Decraene C, Pellissier A, Sebban M, Sabot C, Jeandel L, Cianférani S, Strub JM, Bénard M, Flon V, Peulon-Agasse V, Cardinael P, Ory S, Gasman S, Renard PY, Montero-Hadjadje M, Vitale N, Balieu S.
Show Full Abstract

Glycerophospholipids (GPLs) play important roles in cellular compartmentalization and signaling. Among them, phosphatidic acids (PA) exist as many distinct species depending on acyl chain composition, each one potentially displaying unique signaling function. Although the signaling functions of PA have already been demonstrated in multiple cellular processes, the specific roles of individual PA species remain obscure due to a lack of appropriate tools. Indeed, current synthetic PA analogues fail to preserve all the functions of natural PA. To circumvent these limitations, we developed a novel synthetic approach to produce PA analogues without compromising structural integrity of acyl chains. Moreover, addition of a clickable moiety allowed flexible grafting of different molecules to PA analogues for various biological applications. Hence, this innovation also provides powerful tools to investigate specific biological activities of individual PA species, with potential applications in unraveling complex GPL-mediated signaling pathways.

HTT
Also flagged:huntington's diseaseautosomal dominant neurodegenerative disordermotorcognitive declineHDmitochondrial
Journal Article 2025-07-25 ✓ 1 Snippet Goel F, Dobhal V, Kumar D, Rai SN, Yadav DK.
In-Text Gene Mentions

…mutation within theHTTgene, which leads…

Show Full Abstract

Huntington's disease is an autosomal dominant neurodegenerative disorder of variable progression. Its major features are motor dysfunction, cognitive decline, and psychiatric disturbances. The onset of HD in a patient occurs because of a polyglutamine-expanding mutation within the HTT gene, which leads to the formation of mutant huntingtin protein that aggregates and disrupts neuronal function. Epidemiologically, HD afflicts about 5-10 people per 100,000 throughout the world. However, among populations of European descent, its prevalence is increased. Even after much study into the disorder, myths prevail relating to onset and inheritance of this disorder; including myths such as non-genetic transmission, along with myths such as variation in symptoms, the myths feed on stigma, contributing to a delay in diagnosis and management. Neurodegenerative level in HD affects the basal ganglia especially the striatum leading to impaired motor coordination, chorea, and cognitive deficits. Pathophysiology encompasses excitotoxicity, mitochondrial dysfunction, oxidative stress, and impaired protein clearance mechanisms that end in neuronal loss. The future research areas in the management of HD include gene silencing techniques, stem cell therapy, and even advanced neuroprotective agents acting through a disease-modifying mechanism. The hope of CRISPR-Cas9 gene editing is correction at the source level, and ASOs target reduction in the expression of the mutant huntingtin protein. The introduction of personalized medicine for discovery based on biomarkers could further buttress early diagnosis and effectiveness of treatment. The most revolutionary approach towards the treatment of HD can be a multi-disciplinary approach encompassing conventional therapies and novel genetic techniques.

TNFSF4
Also flagged:osteoarthritisOAcartilage degenerationinterleukin-1 receptor type 2IL-1R2membrane
Journal Article 2025-07-25 ✓ 1 Snippet Deng C, Yu L, Zhao X, Chen Y, Mei J, Wei J, Chen X, Lei G, Zeng C.
In-Text Gene Mentions

…, Tnfsf15 ,Tnfsf4, Tnfsf8 ,…

Show Full Abstract

Osteoarthritis (OA) is a multifactorial disease characterized by joint inflammation and cartilage degeneration, with no disease-modifying drugs available. The vicious cycle between the inflammatory microenvironment (inflamed soil) and dysfunctional chondrocytes (degeneration-related seeds) drives the chronic progressive deterioration of OA. Here, we report a genetically engineered chondrocyte-mimetic nanoplatform (termed HKL-GECM@MPNPs) comprising a honokiol (HKL)-loaded mitochondrion-targeting nanoparticle core coated with an interleukin-1 receptor type 2 (IL-1R2)-overexpressing chondrocyte membrane. HKL-GECM@MPNPs fuse with OA chondrocytes, transferring IL-1R2 onto the plasma membrane and reprogramming the inflamed microenvironment through IL-1β blockade. Mitochondrion-targeting cores then directly deliver HKL to restore mitochondrial sirtuin-3 in OA chondrocytes, reprogramming the cells' pathological phenotype. Intra-articular injection of HKL-GECM@MPNPs in OA mice reduces inflammation, alleviates joint pain, and mitigates cartilage damage through a synergistic effect. Moreover, HKL-GECM@MPNPs effectively reverse cartilage degeneration in human OA cartilage explants. This approach highlights the potential of HKL-GECM@MPNPs to combine IL-1β blockade and mitochondrial sirtuin-3 restoration as a promising strategy for OA treatment.

SUDS3
Also flagged:PELP1ribosomeheterochromatinprolineAAA-ATPaseMDN1
Journal Article 2025-07-25 ✓ 1 Snippet Gordon J, Kaminski AM, Bommu SR, Skrajna A, Petrovich RM, Pedersen LC, McGinty RK, Warren AJ, Stanley RE.
In-Text Gene Mentions

…We also observedlinker histoneshistones by total…

Show Full Abstract

The rixosome is a large multisubunit complex that initiates RNA decay during critical nuclear transactions including ribosome assembly and heterochromatin maintenance. The overall architecture of the complex remains undefined because several subunits contain intrinsically disordered regions (IDRs). Here, we combined structural and functional approaches to establish PELP1 as the central scaffold of the rixosome upon which the enzymatic subunits modularly assemble. The C-terminal half of PELP1 is composed of a proline-rich IDR that mediates association with the AAA-ATPase MDN1, histones, and the SUMO-specific protease SENP3. The PELP1 IDR contains a glutamic acid-rich region that we establish can chaperone the histone octamer in vitro. Last, the x-ray structure of a small linear motif (SLiM) from the PELP IDR bound to SENP3 reveals how PELP1 allosterically activates SUMO protease activity. This work provides an integrated structural model for understanding the rixosome's dynamic architecture and how it modularly coordinates several cellular functions.

Also flagged:SynthesisNicotinateTrem2secretionoxygengene expression
Journal Article 2025-07-25 No Snippets Joseph E, Kunze LH, Schaefer R, Palumbo G, Kugelmann B, Wagner S, Lammich S, Feederle R, Willem M, Werner RA, Brendel M, Lindner S.
Show Full Abstract

Microglia, the innate immune cells of the central nervous system (CNS), act as first responders to brain injury. Their ability to switch between different neuroprotective and neurotoxic phenotypes, plays a central role in maintaining brain homeostasis. Recently, the P2Y12 receptor (P2Y12R) has been identified as a promising molecular biomarker for microglia activity, as its expression level is dependent on microglia phenotype and function. P2Y12R positron emission tomography (PET) might be a valuable diagnostic tool, however, tracers with sufficient brain retention have not been reported so far. Herein, we report a brain-permeable P2Y12R PET tracer for <i>in vivo</i> imaging of P2Y12R-positive microglia. Nicotinate [<sup>18</sup>F]<b>12</b> exhibited nanomolar affinity and specificity for the target receptor and showed a reduced uptake in microglia-depleted (PLX) mice, in comparison to WT and Trem2 knockout (Trem2<sup>-/-</sup>) mice. <i>Ex vivo</i> immunohistochemistry (IHC) and PET data revealed a strong correlation between microglia abundance, P2Y12R expression levels and tracer uptake.

PRDX6CACNA1E
Also flagged:transcription factorsintermediate filamentsall- trans retinoic acidcell maturationtesticular teratocarcinomatranslational
Journal Article 2025-07-25 ✓ 3 Snippets Kedracka-Krok S, Fic E, Cepil Z, Rybczyński P, Szlaga A, Cacała R, Lasota S, Blasiak A, Dziedzicka-Wasylewska M.
In-Text Gene Mentions

…such as VIM,PRDX6, GSTM3, GSTM1, and…

…ltage-gated calcium channels (CACNA1E, CACNA1C, CACNA2D1, CACNA2D2,…

…subunit alpha1 E (CACNA1E) involved in firing…

Show Full Abstract

<h4>Background</h4>Obtaining human neurons and astrocytes for in vitro studies presents a significant challenge owing to the complexity of replicating their development and functionality outside the human brain. The Ntera-2 cell line is a valuable source of human neurons and astrocytes in neuroscience research. However, differentiating Ntera-2 cells into neurons and astrocytes with all-trans retinoic acid is complicated by the lack of reliable markers to monitor differentiation stages effectively. This study aimed to characterize neuron-enriched and pure astrocyte cultures at two maturation stages and to compare these with the original Ntera-2 cells. Ntera-2 cells and NT2 cells are used interchangeably in this publication.<h4>Methods</h4>Using an advanced proteomic approach, we assessed the protein composition and abundance of neuron and astrocyte co-cultures and discovered that the astrocytic protein profile in co-culture with neurons was more representative compared with that in pure astrocyte cultures. Additionally, electrophysiological studies were conducted to investigate the best astrocyte content for neuronal functionality.<h4>Results</h4>Mass spectrometry-based analysis provided insights into over 9000 proteins, covering well-known protein markers, proteins unique to specific cell types, and differentially expressed proteins. Notably, differences in transcription factors, regulatory proteins, intermediate filaments, and proteins unique to early and mature astrocytes highlighted the distinct maturation, activation, and functional profiles of the various cells. These findings offer a straightforward tool for characterization and monitoring the differentiation process. Three weeks of maturation in pure culture yielded immature astrocytes; however, extending the maturation period to 6 weeks significantly altered the composition of the cellular proteome, indicating increased astrocyte maturity. Studies revealed a broader repertoire of astrocytic proteins in co-culture with neurons. Meanwhile, electrophysiological analyses demonstrated that a high content of astrocytes is essential for neuronal functional maturity.<h4>Conclusions</h4>Astrocyte-neuron co-cultures offer a more accurate model of neural tissue than pure cultures, highlighting the complexity of cell maturation and providing insights for improving in vitro modeling of human neural development.

Also flagged:intervertebral disc degenerationnucleusRNase RluciferaseRNA-binding proteinextracellular matrix
Journal Article 2025-07-25 No Snippets Xiong S, Zhao Q, Zhang Y, Li Y, Yang X, Xiao L.
Show Full Abstract

BACKGROUND: Circular RNA (circRNA) plays a pivotal role in regulating nucleus pulposus cells (NPCs) function, making it a promising therapeutic target for intervertebral disc degeneration (IDD). This study aimed to identify circRNA closely associated with IDD and assess their potential as therapeutic target. METHODS: Circ_0003251 was identified via circRNA sequencing and validated in degenerated human nucleus pulposus (NP) tissues. Its properties were characterized using Sanger sequencing, oligo(dT) primers, RNase R treatment, and fluorescence in situ hybridization. Functional experiments assessed its role in vitro, while molecular mechanisms were explored through luciferase reporter assays, RNA-binding protein immunoprecipitation, and immunofluorescence. To assess therapeutic potential, circ_0003251 was encapsulated in PLGA (poly(lactic-co-glycolic acid)) microspheres (MS) and evaluated in vitro and in vivo. RESULTS: Circ_0003251 expression was significantly downregulated in degenerated NPCs and NP tissues. Its upregulation enhanced NPCs proliferation, extracellular matrix synthesis, and reduced apoptosis. Mechanistically, circ_0003251 acted as a miR-637 sponge, inhibiting AKT1 suppression and alleviating NPCs degeneration. PLGA MS successfully delivered circ_0003251, enhancing its therapeutic effect and delaying IDD in vivo. CONCLUSION: Circ_0003251 was a promising biomarker and therapeutic target for IDD. PLGA MS delivery ensured effective application, offering a novel strategy for IDD treatment.

Also flagged:Sarcomassoft tissue sarcomacancersarcomaTumorcolony-stimulating factor 1
Journal Article 2025-07-25 No Snippets Rosenbaum E, Seier K, Bradic M, Movva S, Kelly CM, Dickson MA, Keohan ML, Gounder MM, Chi P, Nacev BA, Chan JE, Avutu V, Biniakewitz M, Jasnani S, Duchemin M, Desir R, Wong P, Erinjeri J, Hwang S, Antonescu CR, Qin LX, Tap WD, D'Angelo SP.
Show Full Abstract

<h4>Background</h4>Sarcomas are frequently infiltrated with immunosuppressive myeloid cells. Vimseltinib is an inhibitor of the colony-stimulating factor 1 receptor kinase and has been shown to decrease tumor-infiltrating myeloid cells in preclinical models. We hypothesized that vimseltinib combined with the Programmed death-ligand 1 (PD-L1) inhibitor avelumab would be safe, tolerable, and clinically effective in patients with advanced sarcoma.<h4>Methods</h4>This was a phase I study of vimseltinib plus avelumab in patients with unresectable or metastatic sarcoma. The study used a standard 3 + 3 dose-escalation design, followed by dose expansion in patients with select histological subtypes. Vimseltinib was administered daily by mouth in 28-day cycles; avelumab was administered intravenously every 2 weeks. The primary objectives of the dose-escalation and dose-expansion phases were to determine the recommended phase II dose and to estimate the best objective response rate by RECIST version 1.1.<h4>Results</h4>Thirteen patients were treated in the dose-escalation phase, and 19 patients were treated in the dose-expansion phase. The most common treatment-related adverse events were asymptomatic increases in serum levels of amylase, lipase, creatine phosphokinase, aspartate aminotransferase, and alanine aminotransferase. One of six patients treated at the highest dose level had a dose-limiting toxicity (grade 4 increase in aspartate aminotransferase). The highest dose level was determined to be the recommended phase II dose. There were no objective responses. The median progression-free survival of patients treated at the recommended phase II dose was 1.55 months (95% confidence interval 1.25-1.78 months). Flow cytometric analysis of peripheral blood mononuclear cells revealed a decrease in myeloid-derived suppressor cells and regulatory T cells after treatment. RNA sequencing of paired tumor samples revealed an increase in tumor-infiltrating T cells and a decrease in macrophages after treatment.<h4>Conclusions</h4>Vimseltinib plus avelumab was generally safe and well tolerated. This combination had minimal clinical efficacy in our population of heavily pretreated patients with sarcoma.

SOX6
Also flagged:infectionsinfectious mononucleosisIMinfectionEBV infectionas
Journal Article 2025-07-25 ✓ 1 Snippet Shen J, He Y, Zheng H, Xiao J, Li F, Chen K, Guo B, He Y, Liu L, Lin Z, Wang D, Liu L, Wang S, Zhou W, Zhang Y, Wei J, Wang Y, Hu R, Tang D, Wang D, Yang M.
In-Text Gene Mentions

…scores: MAFG, GTF2B,SOX6, TCF7L1, ETV7, IRF7,…

Show Full Abstract

Epstein-Barr virus-associated hemophagocytic lymphohistiocytosis (EBV-HLH) is a fatal hyperinflammatory disorder distinct from self-limiting EBV-induced infectious mononucleosis (IM). However, the immunological mechanisms underlying the divergence between benign EBV infection and fulminant HLH-particularly in the absence of inherited immunodeficiency-remains unclear, and systematic comparisons of immune landscapes across EBV-associated disease spectra are lacking. In this study, by enrolling children with IM and healthy volunteers as controls, we utilize single-cell RNA sequencing to identify unique immunological characteristics of EBV-HLH. Our analysis indicates that patients with EBV-HLH exhibite widespread activation of NF-κB signaling pathway. Furthermore, excessive cytokine secretion by T and NK cells is observed, along with a shift in monocyte differentiation towards an inflammatory phenotype, and the aggregation of IDO1<sup>+</sup> monocytes. Metabolic pathway analysis reveals that L-kynurenine, a downstream metabolite of IDO1, is specifically elevated in EBV-HLH and mediates the production of multiple pro-inflammatory cytokines. Collectively, our study maps the immune landscape in pediatric EBV-HLH at single-cell resolution, uncovering potential role of IDO1<sup>+</sup> monocytes and L-kynurenine as biomarkers.

CCPG1
Also flagged:BNIP3NIXmitophagyautophagydegradationorganelle-
Journal Article 2025-07-25 ✓ 5 Snippets Adriaenssens E, Schaar S, Cook ASI, Stuke JFM, Sawa-Makarska J, Nguyen TN, Ren X, Schuschnig M, Romanov J, Khuu G, Uoselis L, Lazarou M, Hummer G, Hurley JH, Martens S.
In-Text Gene Mentions

…44060, AB_2799259 ), anti-CCPG1(1:1,000, Cell Signaling…

…To purifyCCPG1-GST, the cytosol-exposed doma…

…cytosol-exposed domain ofCCPG1(1–212 aa) fused…

…( Q9P1Z2 ),CCPG1( Q9ULG6 ),…

…and FAM134C, withCCPG1(ipTM 0.2) serving…

Show Full Abstract

Selective autophagy is a lysosomal degradation pathway that is critical for maintaining cellular homeostasis by disposing of harmful cellular material. Although the mechanisms by which soluble cargo receptors recruit the autophagy machinery are becoming increasingly clear, the principles governing how organelle-localized transmembrane cargo receptors initiate selective autophagy remain poorly understood. Here we demonstrate that the human transmembrane cargo receptors can initiate autophagosome biogenesis not only by recruiting the upstream FIP200/ULK1 complex but also via a WIPI-ATG13 complex. This latter pathway is employed by the BNIP3/NIX receptors to trigger mitophagy. Additionally, other transmembrane mitophagy receptors, including FUNDC1 and BCL2L13, exclusively use the FIP200/ULK1 complex, whereas FKBP8 and the ER-phagy receptor TEX264 are capable of utilizing both pathways to initiate autophagy. Our study defines the molecular rules for initiation by transmembrane cargo receptors, revealing remarkable flexibility in the assembly and activation of the autophagy machinery, with important implications for therapeutic interventions.

Also flagged:waterethanolglucosepenicillinstreptomycinsodium
Journal Article 2025-07-25 No Snippets Borovská I, Zhang C, Dülk SJ, Morandi E, Cardoso MFS, Bourkia BM, van den Homberg DAL, Wolfinger MT, Velema WA, Incarnato D.
Show Full Abstract

RNA molecules can populate ensembles of alternative structural conformations; however, comprehensively mapping RNA conformational landscapes within living cells presents notable challenges and has, as such, so far remained elusive. Here, we generate transcriptome-scale maps of RNA secondary structure ensembles in both Escherichia coli and human cells, uncovering features of structurally heterogeneous regions. By combining ensemble deconvolution and covariation analyses, we report the discovery of several bacterial RNA thermometers in the 5' untranslated regions (UTRs) of the cspG, cspI, cpxP and lpxP mRNAs of Escherichia coli. We mechanistically characterize how these thermometers switch structure in response to cold shock and reveal the CspE chaperone-mediated regulation of lpxP. Furthermore, we introduce a method for the transcriptome-scale mapping of 5' UTR structures in eukaryotes and leverage it to uncover RNA structural switches regulating the differential usage of open reading frames in the 5' UTRs of the CKS2 and TXNL4A mRNAs in HEK293 cells. Collectively, this work reveals the complexity of RNA structural dynamics in living cells and provides a resource to accelerate the discovery of regulatory RNA switches.

HFE
Also flagged:membraneventricular arrhythmiasantibodyperipheral vascular diseasecardiac amyloidosistransthyretin
Journal Article 2025-07-25 ✓ 1 Snippet Hsich EM, Khush KK, Schold JD, Parker WF, Blackstone EH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The Organ Donation and Transplantation Network (OPTN) will soon undergo a historic transformation to modernize the national organ transplant system. For the first time in 40 years, the OPTN contract will transition from 1 vendor to 5 to improve transparency, strengthen patient-centered communication, improve patient safety, better manage finances, and upgrade information technology (IT) for organ transplantation. This will be a remarkable change with bipartisan Congressional support. However, the Health Resources and Services Administration, which oversees OPTN, has recognized the complexity of updating the OPTN IT system. On January 17, 2025, it requested submissions for a multiple-award blanket purchase agreement called OPTN Next-Generation IT to help with modernization to improve the OPTN database for patient care and research. This perspective piece reviews the strengths and weaknesses of the current OPTN database using heart transplantation as an example and provides a blueprint to achieve the goals of a flexible database, more comprehensive data collection with clear definitions, and necessary changes to improve efficiency. It also reviews the involvement of the Health Resources and Services Administration and Congress in improving the OPTN, and of sharing OPTN data with the Scientific Registry of Transplant Recipients to generate Scientific Registry of Transplant Recipients national and program reports as well as research.

Also flagged:mitochondrialmitochondrial respiratory chain diseaseguanylate cyclaseprimary mitochondrial diseasemitochondrial encephalomyopathylactic acidosis
Journal Article 2025-07-25 No Snippets Burg L, Yoon H, Peng M, Germano P, Reesey Gretzmacher E, Xiao R, Anderson VE, Nakamaru-Ogiso E, Falk MJ.
Show Full Abstract

<h4>Background</h4>Zagociguat (zag) is a CNS-penetrant, soluble guanylate cyclase (sGC) stimulator that has been evaluated in phase 2a, with phase 2b ongoing, clinical studies of primary mitochondrial disease (PMD) subjects with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes syndrome (MELAS). To explore its utility in a broader array of PMDs and secondary mitochondrial disorders, we performed prfeclinical modeling of zag across larval and adult zebrafish models with biochemical deficiencies in diverse respiratory chain (RC) complexes or dihydrolipoamide dehydrogenase (Dldh).<h4>Methods</h4>Zag was evaluated for tissue uptake, gross toxicity, protection from RC toxin-induced brain death, neuromuscular dysfunction, heartbeat loss, and biochemical dysfunction in transgenic or toxin-exposed zebrafish with mitochondrial enzyme deficiencies in complex I (<i>ndufs2</i> <sup><i>-/-</i></sup> or rotenone-exposed wild type (WT)), complex IV (<i>surf1</i> <sup><i>-/-</i></sup> or azide-exposed WT), multiple RC complexes (<i>fbxl4</i> <sup><i>-/-</i></sup> ), or pyruvate dehydrogenase complex (<i>dldh</i> <sup><i>-/-</i></sup> ). Zag effects were also studied on the whole-body oxygen consumption capacity (MO<sub>2</sub>) and swimming activity of WT and complex IV disease adult zebrafish.<h4>Results</h4>Similar zag levels were observed in adult brains and tail muscle. No morphological or functional toxic effects of zag were observed on larvae viability. Zag provided neuromuscular protection in complex I deficient genetic and pharmacologic inhibitor models. In complex IV deficient models, prevention from brain death occurred at 100 nM zag in high-dose azide-exposed WT larvae; however, no rescue of swimming or neuromuscular phenotypes in low-dose azide-exposed <i>surf1</i> <sup><i>-/-</i></sup> larvae was observed. A total of 100 nM zag rescued MO<sub>2</sub> and maximum swimming speed in adult <i>surf1</i> <sup><i>-/-</i></sup> zebrafish. Larval swimming activity was also preserved with 10 nM zag treatment in azide-stressed <i>fbxl4</i> <sup><i>-/-</i></sup> larvae but not at 10 nM, 100 nM, or 1 µM zag in <i>dldh</i> <sup><i>-/-</i></sup> larvae. Zag (10 nM) enhanced complex I enzyme activity that is suggestive of mitochondrial biogenesis and key aspects of mitochondrial physiology in azide-exposed <i>surf1</i> <sup><i>-/-</i></sup> and <i>fbxl4</i> <sup>-/-</sup> larvae.<h4>Conclusion</h4>Preclinical evaluation of zag demonstrated its safety, significant protection of neuromuscular dysfunction and/or acute RC stressor-induced decompensation, and improved mitochondrial physiology across multiple different genetic and/or pharmacologic models of RC-deficient PMD. Thus, zag may yield therapeutic potential for an array of diseases with mitochondrial dysfunction beyond MELAS, potentially including Leigh syndrome spectrum disorder and primary mitochondrial myopathies.

Also flagged:intervertebral disc degenerationspinal disordersflavonoidsquercetinhyperosideglycosides
Journal Article 2025-07-25 No Snippets Wu Z, Chen J, Luo W, Kuang T.
Show Full Abstract

Intervertebral disc degeneration (IDD) is a leading cause of spinal disorders worldwide. Current clinical therapies for IDD are often constrained by limited efficacy, notable adverse effects, and high treatment costs. Thus, there is a pressing need for safer and more effective treatment strategies. In recent years, natural product-based therapies have garnered increasing attention due to their multi-target mechanisms and relatively low toxicity. This review comprehensively summarizes recent advances in the application of natural products for IDD treatment, with a focus on flavonoids (e.g., quercetin, hyperoside), glycosides (e.g., ginsenosides, notoginsenosides), terpenoids (e.g., aucubin, celastrol), phenolic compounds (e.g., curcumin, resveratrol), and alkaloids (e.g., berberine, evodiamine). These compounds exert their therapeutic effects by modulating critical signaling pathways, including Sirtuin-1 (SIRT1), Nuclear Factor-kappa B (NF-κB), Mitogen-Activated Protein Kinase (MAPK), Phosphoinositide 3-Kinase/Protein Kinase B (PI3K/Akt), and Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2). Collectively, they exhibit potent anti-inflammatory, antioxidant, anti-apoptotic, anti-senescence, and regenerative properties. The insights presented herein provide a robust theoretical foundation to support future preclinical and clinical investigations, highlighting the considerable promise of natural products in IDD management.

Also flagged:tumoradenocarcinomalung cancernon-small-cell lung cancerNSCLCCD4
Journal Article 2025-07-25 No Snippets Wang W, Zhou W, Fan J, Jiang T, Yang G, Song C, Xu S, Luo H, Liu H.
Show Full Abstract

<h4>Background</h4>Spread through air spaces (STAS) represents a novel invasion mechanism in adenocarcinoma that considerably influences lung cancer clinical outcomes; however, studies of its mechanisms at the spatial level are lacking.<h4>Methods</h4>We used the NanoString GeoMx digital spatial profiling (DSP) technology to conduct a spatial transcriptomic analysis of surgically resected tissues from non-small-cell lung cancer (NSCLC) patients with or without STAS.<h4>Results</h4>Compared with tumor nests in non-STAS patients, <i>HLA-DRB5</i> and <i>RASGRF1</i> were significantly less expressed in compartments of STAS, suggesting their inhibitory roles in the occurrence of STAS. Meanwhile, an increase in CD4 T memory cells and a decrease in B cells were observed in the tumor immune microenvironment of STAS. Furthermore, distinct molecular profiles were observed between tumor cells in tumor nests and in air spaces in STAS patients, which was highlighted by the elevated <i>ITGA2</i> expression in the air spaces. These results were validated in an independent cohort by multiplex immunofluorescence stainings.<h4>Conclusion</h4>This study is the first to use DSP to analyze spatial transcriptomic profiles of NSCLC tumor nests and air space tumors, and it identifies potential module features that may be used for STAS identification and prognosis.

Also flagged:glycerolphotonbenzyl alcoholbenzyl benzoatepositronflavin adenine dinucleotide
Journal Article 2025-07-25 No Snippets Makki M, Molander ZA, Pineda-Castillo SA, Laurence DW, Singhal S, Eltwafsha Y, Holzapfel GA, Gu T, Lee CH.
Show Full Abstract

<h4>Introduction</h4>Protocols for tissue clearing have been established and optimized for the central nervous system. However, significant modifications are required for clearing different tissue types. Therefore, effective optical clearing for cardiovascular tissue remains a major challenge. The goal of this study is to better understand the responses of porcine left anterior descending artery (LADA) to label-free multiphoton imaging.<h4>Methods</h4>To this end, the effects of different clearing methods (i.e., benzyl alcohol benzyl benzoate-BABB and glycerol), formalin fixation, variations in formalin fixation times (0-240 min), and extended storage in BABB (up to 14 days) are investigated. We compare tissue characteristics under different conditions (e.g., tissue clearing reagent and/or tissue fixation), particularly with regard to tissue preservation and transparency across z-stacks (i.e., imaging depths).<h4>Results</h4>The glycerol clearing method exhibited relatively lower tissue transparency, whereas BABB increased mean AF-AUC from 0.0035 ± 0.0009 to 0.1205 ± 0.0168 and SHG-AUC from 0.0003 ± 0.0002 to 0.0072 ± 0.0040 (<i>p</i>< 0.001), enabling robust signal intensities at deeper layers of LADA tissue. In addition, we observed that BABB preserves fluorescent signals even after extended tissue storage with no significant loss in integrity over 14 days. Finally, we found that formalin fixation in combination with the glycerol clearing method significantly improved tissue preservation compared to the glycerol clearing method alone. However, in combination with the BABB clearing method, fixation reduced tissue transparency and signal intensity compared to BABB clearing without fixation.<h4>Discussion</h4>These findings establish BABB as the superior, label-free clearing agent for deep 3D multiphoton microscopy/second harmonic generation imaging of cardiovascular tissue and underscore the necessity of tailoring fixation parameters to the chosen clearing method.

SOX6
Also flagged:glioblastomabrain tumorGBMtumorYEATS4transcription factor
Journal Article 2025-07-25 ✓ 5 Snippets Ma S, Sun Y, Zheng S, Fu Y, Wang L, Liu D, Jiao H, Zhu X, Li X, Yan D, Chen D, Ye Z.
In-Text Gene Mentions

…with downregulation ofSOX6, in the…

…risk scores, whereasSOX6exhibited the opposite…

…those with highSOX6expression showed survival…

…PGRS group, whereasSOX6was specifically enriched…

…, while onlySOX6displayed a negative…

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) was considered the most aggressive type of primary brain tumor, marked by poor clinical outcomes and a high tendency to relapse. The therapeutic efficacy of GBM was significantly compromised by tumor heterogeneity, dysregulated metabolic pathways, the formation of an immunosuppressive microenvironment, and treatment resistance. Therefore, multi-dimensional therapeutic strategies targeting GBM-specific molecular features, its intrinsic properties, and microenvironmental regulatory networks were considered to potentially provide new breakthroughs for overcoming treatment resistance in GBM.<h4>Methods</h4>We analyzed single-cell RNA sequencing (scRNA-seq) data processed with the Seurat package to accurately identify cell types. Spatial transcriptomics integrated Multimodal Intersection Analysis, TransferData, and Robust Cell Type Decomposition techniques to characterize the spatial distribution patterns of key cell subtypes. CellChat was employed to assess intercellular communication networks. Furthermore, <i>in vitro</i> experiments confirmed the main regulatory role of YEATS4 (key transcription factor of C2 <i>PCLAF</i>+ subtype) in GBM malignant progression.<h4>Results</h4>Through scRNA-seq, we identified the C2 <i>PCLAF</i>+ subtype in GBM and analyzed its molecular characteristics and functional role in tumor progression. This subtype exhibited a unique malignant phenotype, marked by significant proliferative activity, characteristic metabolic reprogramming, and dysregulated cell death regulation mechanisms. Spatial transcriptomics revealed its preferential localization within specific tumor niches. Furthermore, the C2 <i>PCLAF</i>+ subtype established a specific interaction with fibroblasts through the MDK-LRP1 ligand-receptor pair. Critically, silencing <i>YEATS4 in vitro</i> significantly inhibited GBM malignancy. Additionally, the prognostic risk score model based on the C2 <i>PCLAF</i>+ subtype demonstrated significant clinical translational value.<h4>Conclusion</h4>Our study systematically elucidated the malignant characteristics of the C2 <i>PCLAF</i>+ subtype and its molecular mechanisms driving GBM progression. This subtype promoted therapeutic resistance through unique metabolic reprogramming, MDK-LRP1-mediated microenvironmental interactions, and immunosuppressive properties. <i>YEATS4</i> knockdown effectively suppressed malignant tumor behaviors, highlighting its therapeutic potential. These findings provided novel targeted intervention strategies to address GBM heterogeneity and treatment resistance, offering promising avenues for overcoming current therapeutic limitations.

Also flagged:lung adenocarcinomaLUAD-transcription factorSELENBP1tumor
Journal Article 2025-07-25 No Snippets Mu Q, Zhang H, Shi Y, Xue M, Wang J, Ding Y, Tan L, Yuan H, Li X, Sun D.
Show Full Abstract

<h4>Background</h4>Lymph node metastasis markedly worsens prognosis in lung adenocarcinoma (LUAD); however, the evolutionary dynamics and regulatory mechanisms underlying the heterogeneity of malignant epithelial cells during this process remain poorly understood and warrant comprehensive investigation.<h4>Methods</h4>We performed a comprehensive single-cell transcriptomic analysis of epithelial cells from 18 samples comprising normal lung tissue and lymph node metastases. Malignant epithelial cells were identified via inferred copy number variation (CNV) profiles. Key malignant subpopulations were further characterized through trajectory inference, cell-cell communication mapping, gene set variation analysis (GSVA), and reconstruction of transcription factor regulatory networks. To assess clinical relevance, we developed and validated a prognostic model-termed the EAS score-based on the transcriptional signatures of malignant epithelial subsets, using integrated data from multiple TCGA and GEO cohorts. The functional role of the hub gene SELENBP1 was experimentally validated through quantitative PCR (qPCR), Western blotting, immunohistochemistry (IHC), Transwell migration assays, colony formation assays, flow cytometry, ROS quantification, and subcutaneous tumorigenesis assays <i>in vivo</i>.<h4>Results</h4>Single-cell transcriptomic analysis identified four distinct malignant epithelial subtypes (Clusters 0-3), each characterized by unique patterns of CNV. Leveraging these defined cellular subpopulations, we constructed a highly accurate model for prognostication in LUAD, enabling reliable classification of patients based on clinical outcomes. Through detailed comparisons between groups with divergent prognostic risks, the study revealed notable differences across the tumor microenvironment (TME), including alterations in pathway activity, gene enrichment distributions, mutation profiles, and anticipated responses to immune checkpoint blockade. In addition, functional validation experiments confirmed that SELENBP1 plays a tumor-suppressive role, further supporting its relevance as a potential intervention target in LUAD.<h4>Conclusion</h4>This research provides insights into the evolutionary complexity and heterogeneity of malignant epithelial populations in lymph node metastatic sites of LUAD. It also presents a scoring system based on prognostic indicators, which serves as a reliable tool for forecasting patient survival outcomes. Moreover, the discovery of SELENBP1 as a candidate tumor suppressor emphasizes its importance in guiding both clinical risk categorization and the design of personalized treatment strategies for individuals classified as high-risk LUAD cases.

TNFSF4
Also flagged:TumorNeuropeptideshead and neck squamous cell carcinomaneurotrophic factorsNTRK1cancer
Journal Article 2025-07-25 ✓ 1 Snippet Kishan R, Zhang G, Yang W, Su Y.
In-Text Gene Mentions

…WhileTNFSF4/OX40L (0.8), Programmed Cell…

Show Full Abstract

<b>Background/Objectives:</b> Emerging studies have indicated the importance of intra-tumoral neuronal signals in tumor progression and immune modulation. However, there is limited insight into neuroimmune crosstalk, and the molecules involved are largely unknown. This study investigates the relationship between tumor-derived neuropeptides and immune modulation in head and neck squamous cell carcinoma (HNSC). <b>Methods:</b> By utilizing neuropeptide databases and web tools leveraging TCGA data, neuropeptides' expression and their associations with neurotrophic factors, immune cell infiltration, and immune checkpoints were analyzed, followed by survival analysis. <b>Results:</b> Over half of the neuropeptides were expressed in HNSC, with 16% exhibiting differential expression compared to normal counterparts. Notably, differentially expressed neuropeptides showed significant correlations with neurotrophic factors, immune cell infiltration, and checkpoint genes. Further, their expression was significantly different in responder and non-responder patient samples subjected to immune checkpoint therapy. Neuropeptide genes-PTHLH, NMB, GAST, APLN, and LYNX1-were identified and emerged as crucial mediators in neuroimmune crosstalk. Additionally, the neurotrophic gene NTRK1 exhibited extensive correlation with immune checkpoint genes, underscoring the prevalence of neuroimmune crosstalk in HNSC. <b>Conclusions:</b> These findings shed light on the role of tumor-derived neuropeptides in neuroimmune regulation in HNSC, offering valuable insights for future studies to decode the cancer neuroscience of HNSC progression and therapy.

Also flagged:Colorectal Cancergene expressioncell proliferationIER3pathogenesis
Journal Article 2025-07-25 No Snippets Cen M, Wen Y, Feng Z, Shu Y, Hu C.
Show Full Abstract

The serrated pathway represents a significant route to colorectal cancer (CRC), accounting for approximately 15-30% of cases, yet the specific epithelial cell subpopulations driving this pathway remain poorly understood. This study explores the causal relationship between serrated epithelial cells and CRC risk using single-cell transcriptomics and Mendelian randomization (MR). Publicly available single-cell RNA sequencing data were utilized to analyze epithelial cell subpopulations in CRC, focusing on specific serrated cells (SSCs). By integrating genome-wide association study data, MR was employed to assess the causal relationship between gene expression patterns and CRC risk. The study found that an increase in SSCs is closely associated with CRC progression. MR analysis revealed a significant correlation between expression changes in specific genes, such as <i>IER3</i> in SSCs, and CRC risk (<i>p</i> < 0.05). Functional analyses indicated that <i>IER3</i> may promote malignancy by regulating cell proliferation, adhesion, and immune evasion. Several genetic loci related to SSC gene expression were identified and validated for CRC risk association. This study demonstrates the significant role of serrated epithelial cell subpopulations in CRC development, particularly through key genes such as <i>IER3</i>, providing new perspectives for understanding CRC pathogenesis and future therapeutic strategies.

Also flagged:secretiontranslationalendoplasmic reticulumfermentationhosthost cells
Journal Article 2025-07-25 No Snippets Rives D, Richbourg T, Gurtler S, Martone J, Blenner MA.
Show Full Abstract

Chinese hamster ovary (CHO) cells are the most common protein production platform for glycosylated biopharmaceuticals due to their relatively efficient secretion systems, post-translational modification (PTM) machinery, and quality control mechanisms. However, high productivity and titer demands can overburden these processes. In particular, the endoplasmic reticulum (ER) can become overwhelmed with misfolded proteins, triggering the unfolded protein response (UPR) as evidence of ER stress. The UPR increases the expression of multiple genes/proteins, which are beneficial to protein folding and secretion. However, if the stressed ER cannot return to a state of homeostasis, a prolonged UPR results in apoptosis. Because ER stress poses a substantial bottleneck for secreting protein therapeutics, CHO cells are both selected for and engineered to improve high-quality protein production through optimized UPR and ER stress management. This is vital for optimizing industrial CHO cell fermentation. This review begins with an overview of common ER-stress related markers. Next, the optimal UPR profile of high-producing CHO cells is discussed followed by the context-dependency of a UPR profile for any given recombinant CHO cell line. Recent efforts to control and engineer ER stress-related responses in CHO cell lines through the use of various bioprocess operations and activation/inhibition strategies are elucidated. Finally, this review concludes with a discussion on future directions for engineering the CHO cell UPR.

Also flagged:inflammatory bowel diseaseulcerative colitiscolorectal cancercancerdeathpathogenesis
Journal Article 2025-07-25 No Snippets Zhang C, Akanyibah FA, Wang X, Mao F, Shang A.
Show Full Abstract

Inflammatory bowel disease (IBD), which includes ulcerative colitis (UC) and Crohn's disease (CD), is a significant global health issue characterized by a complex etiology and high rates of recurrence. IBD increases the risk of acquiring colorectal cancer (CRC). CRC, the third leading cause of cancer worldwide, is becoming increasingly prevalent each year. Treatments targeting IBD and associated CRC do not yield effective results. One of the cell death processes associated with IBD pathogenesis is apoptosis. Although apoptosis helps maintain the intestinal barrier of the gut, excessive apoptosis is linked to the development of IBD and contributes to the growth and progression of CRC. In IBD, pro-apoptotic molecules are elevated, while they decrease in CRC. Therefore, therapies that inhibit pro-apoptotic molecules in IBD and enhance apoptosis in CRC may help prevent IBD and the associated CRC. This article reviews the mechanisms of apoptosis and its involvement in IBD and CRC. It also examines possible therapies, including gene and combination therapies that target apoptosis molecules and their signaling pathways in IBD and CRC.

RABGAP1L
Also flagged:cognitive impairmentcerebral hypoperfusioncognitive declineartery stenosisLuxol fast bluecresyl violet
Journal Article 2025-07-25 ✓ 1 Snippet Tabassum NI, Selvaraji S, Fan Y, Lim VJ, Cheng X, Peng X, Arora A, Rajeev V, Ratcliffe J, Johnson CJ, Datta KK, Lowe R, Ebrahimi M, Dinh QN, De Silva TM, Sobey CG, Wong P, Weng EF, Jo DG, Chen CP, Lai MKP, Arumugam TV.
In-Text Gene Mentions

…pathways included: (1) TBC/RABGAPsignaling, implicating vesicul…

Show Full Abstract

<b>Rationale:</b> Vascular dementia (VaD), driven by chronic cerebral hypoperfusion (CCH), leads to synaptic degeneration and cognitive decline, yet mechanisms linking vascular dysfunction to synaptic loss remain unclear. Intermittent fasting (IF) has emerged as a potential intervention, but its effects on synaptic integrity in VaD are unknown. This study aims to investigate the effects of IF against synaptic degeneration and cognitive impairment induced by CCH. Methods: Bilateral common carotid artery stenosis (BCAS) was employed to induce chronic CCH by placing 0.18 mm micro-coils around each common carotid artery in mice. To assess temporal differences, the coils remained in place for 1, 7, 14, or 30 days. IF was implemented for 16 hours daily over three months prior to BCAS induction. Cognitive impairment was evaluated using the Barnes maze test. White matter lesions (WMLs) and neuronal loss were assessed using Luxol fast blue and cresyl violet staining, respectively. Immunoblotting and immunohistochemistry were performed to quantify synaptic protein levels. Synaptic integrity was examined using transmission electron microscopy. Proteomic analysis of the hippocampus was conducted to investigate molecular adaptations to IF following CCH. <b>Results:</b> We demonstrate that a 16-hour IF regimen preserves cognitive function and synaptic density despite persistent hypoperfusion. Behavioral assays revealed that IF prevented spatial memory deficits in BCAS mice, while electron microscopy confirmed synaptic preservation without altering baseline architecture. Surprisingly, key synaptic protein levels remained unchanged, suggesting IF protects synaptic function rather than abundance. Proteomic profiling revealed dynamic hippocampal adaptations under IF, including upregulation of synaptic stabilizers, enhanced GABAergic signaling, and suppression of neuroinflammatory mediators. CCH induced microglial engulfment of synapses, suggesting a role in complement-mediated synaptic pruning. Temporal pathway analysis revealed IF's multi-phase neuroprotection: early synaptic reinforcement, mid-phase metabolic optimization, and late-phase suppression of chronic neuroinflammation. <b>Conclusion:</b> These findings establish IF as a potent modulator of synaptic resilience in VaD, acting through coordinated preservation of synaptic structure, inhibition of inflammatory synapse loss, and metabolic reprogramming. Our results highlight IF's potential as a non-pharmacological strategy to combat vascular cognitive impairment by targeting the synaptic vulnerability underlying dementia progression.

Also flagged:Cancercell growthangiogenesistumournuclear exportRNA-modifying proteins
Journal Article 2025-07-25 No Snippets Mao Z, Tian Y, Wu L, Zhang Y.
Show Full Abstract

Cancer is an extremely complex disease characterized by abnormal cell growth due to genetic and environmental factors. With the rise of the field of epigenetic transcriptomics, 5-methylcytidine (m<sup>5</sup>C) modification has been identified as one of the most common chemical modifications occurring in various RNA types. The writers, erasers, and readers of m<sup>5</sup>C modification regulate cancer initiation, progression, and therapeutic responses, such as the proliferation, metastasis, angiogenesis, metabolic reprogramming, immune escape, and therapeutic resistance of tumour cells, by regulating RNA stability, translation, nuclear export, and splicing processes. In this review, we elucidate the biological process of m<sup>5</sup>C modification, summarize the abnormal expression of RNA-modifying proteins (RMPs) in common malignant tumours, explore their functional effects on malignant hallmarks of cancer and molecular mechanisms, and prospect the potential clinical application value of m<sup>5</sup>C.

Also flagged:MastitisWaterMethicillinBovine mastitisinflammatory diseaseinfection
Journal Article 2025-07-25 No Snippets Javed S, McClure JA, Ullah I, Ali S, Ejaz M, Tabassum S, Syed MA, Zhang K.
Show Full Abstract

Water buffalo (<i>Bubalus bubalis</i>) are a primary source of milk in Pakistan, where bovine mastitis is a significant health issue among cattle, leading to substantial economic losses. <i>Staphylococcus aureus</i> is a predominant pathogen associated with mastitis; however, a detailed molecular characterization of the strains in the country remains limited. We previously characterized mastitis strains from the Hazara division of Khyber Pakhtunkhwa, Pakistan. In this study, we investigated mastitis cases in the Peshawar division, including samples from both animals and human farm workers for comparison. Higher rates of mastitis (67.27% of animals) and sub-clinical mastitis (91.03% of positive animals) were identified in Peshawar than for those (34.55% and 75.31%, respectively) previously observed in Hazara. Methicillin-susceptible <i>S. aureus</i> (MSSA) belonging to clonal complex 9 (ST2454) were predominant. Methicillin-resistant <i>S. aureus</i> (MRSA) belonging to ST22 and ST8 were also detected in the Nowshera district. While no <i>S. aureus</i> colonization was observed among animal handlers, evidence of hand contamination suggests a potential route for pathogen spread. Low levels of antibiotic resistance were noted amongst isolates, but higher rates were seen in MRSA. This study presents only the second comprehensive molecular investigation of <i>S. aureus</i> isolated from buffalo mastitis in Pakistan and indicates a concerning rise in mastitis within the province.

ZNFX1
Also flagged:cancertumorsyncytium formationantibodiesnucleotidesCas9
Journal Article 2025-07-25 ✓ 1 Snippet Zhang Y, Feng S, Yi G, Jin S, Zhu Y, Liu X, Zhou J, Li H.
In-Text Gene Mentions

…the upregulated genes,ZNFX1is capable of…

Show Full Abstract

Viral oncolysis is considered a promising cancer treatment method because of its good tolerability and durable anti-tumor effects. Compared with other oncolytic viruses, Newcastle disease virus (NDV) has some distinct advantages. As an RNA virus, NDV does not recombine with the host genome, making it safer compared with DNA viruses and retroviruses; NDV can induce syncytium formation, allowing the virus to spread among cells without exposure to host neutralizing antibodies; and its genome adheres to the hexamer genetic code rule (genome length as a multiple of six nucleotides), ensuring accurate replication, low recombination rates, and high genetic stability. Although wild-type NDV has a killing effect on various tumor cells, its oncolytic effect and working mechanism are diverse, increasing the complexity of generating engineered oncolytic viruses with NDV. This study aims to employ whole-genome CRISPR-Cas9 knockout screening and RNA sequencing to identify putative key regulatory factors involved in the interaction between NDV and human colon cancer HCT116 cells and map their global interaction networks. The results suggests that NDV infection disrupts cellular homeostasis, thereby exerting oncolytic effects by inhibiting cell metabolism and proliferation. Meanwhile, the antiviral immune response triggered by NDV infection, along with the activation of anti-apoptotic signaling pathways, may be responsible for the limited oncolytic efficacy of NDV against HCT116 cells. These findings not only enhance our understanding of the oncolytic mechanism of NDV against colonic carcinoma but also provide potential strategies and targets for the development of NDV-based engineered oncolytic viruses.

SOX6
Also flagged:cancerCTNNB1tumor protein p53TP53telomerase reverse transcriptaseTERTp
Journal Article 2025-07-25 ✓ 1 Snippet Mallela VR, Rajtmajerová M, Ali E, Červenková L, Trailin A, Hošek P, Pálek R, Daum O, Liška V, Hemminki K, Ambrozkiewicz F.
In-Text Gene Mentions

…Factor 6 (SOX6) [ 20…

Show Full Abstract

<h4>Background & aims</h4>Hepatocellular carcinoma (HCC) is the third deadliest cancer worldwide. Its high mortality is primarily attributed to late-stage diagnosis. While mutations in driver genes, such as those encoding β-catenin (CTNNB1), tumor protein p53 (TP53), and telomerase reverse transcriptase promoter (TERTp) are well-documented in the literature, dysregulation of microRNAs (miRNAs), small non-coding RNAs that serve as crucial translational regulators, remains poorly understood.<h4>Methods</h4>We conducted microRNA profiling by microarrays in 45 paired (tumor and non-tumor adjacent tissue) samples from non-viral HCC patients. We performed clinical correlation, ROC analysis and survival analysis of time to recurrence (TTR), disease-free survival (DFS) and overall survival.<h4>Results</h4>We identified 23 significantly dysregulated miRNAs (p ≤ 0.05, fold change ≥2). We investigated their differential expression and its relationship with clinical and pathological variables. Further, we found that miRNA-1972 may serve as an important positive prognostic marker because its high levels were associated with longer TTR and DFS. Significant positive results were obtained in receiver operating characteristic analysis for miR-1972, miR-3651 and miR-486-5p.<h4>Conclusion</h4>miRNA-1972 is a strong prognostic marker in non-viral HCC. Dysregulation of several other miRNAs relates to pathological variables such as amount of stroma within tumor, microvascular invasion and micronodularity.

PEBP1
Also flagged:cancerproto-oncogenescancersRascell growthtumors
Journal Article 2025-07-25 ✓ 1 Snippet McDonald RA, Varela-Ramirez A, Ashley AK.
In-Text Gene Mentions

PEBP1, PEBP2, PEBP3—phosphatidyleth…

Show Full Abstract

Proto-oncogenes in the <i>RAS</i> superfamily play dual roles in maintaining cellular homeostasis, such as regulating growth signals and contributing to cancer development through proliferation and deregulation. Activating proto-oncogenes in vitro transforms cells, underscoring their centrality in gene regulation and cellular networks. Despite decades of research, poor outcomes in advanced cancers reveal gaps in understanding Ras-driven mechanisms or therapeutic strategies. This narrative review examines <i>RAS</i> genes and Ras proteins in both housekeeping functions, such as cell growth, apoptosis, and protein trafficking, as well as in tumorigenesis, integrating insights from human (<i>HRAS</i>, <i>KRAS</i>, <i>NRAS</i>), mouse (<i>Hras</i>, <i>Kras</i>, <i>Nras</i>), and <i>Drosophila melanogaster</i> (<i>ras</i>) models. While <i>RAS</i> mutations are tightly linked to human tumors, the interplay between their standard and oncogenic functions remains complex. Even within the same tissue, distinct cancer pathways-such as the mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) pathways-can drive varied disease courses, complicating treatment. Advanced-stage cancers add further challenges, including heterogeneity, protective microenvironments, drug resistance, and adaptive progression. This synthesis organizes current knowledge of RAS gene regulation and Ras protein function from genomic alterations and intracellular signaling to membrane dynamics and extracellular interactions, offering a layered perspective on the Ras pathway's role in both housekeeping and tumorigenic contexts.

Also flagged:ironcoppermanganesezincmetalssynthesis
Journal Article 2025-07-25 No Snippets Jomova K, Alomar SY, Valko R, Nepovimova E, Kuca K, Valko M.
Show Full Abstract

Given the key importance played by the redox-active metals iron (Fe), copper (Cu), and manganese (Mn) in vital cellular processes, such as DNA synthesis, oxidative phosphorylation, the detoxification of reactive oxygen species (ROS), and angiogenesis, it is not surprising that their dysregulation plays a causative role in many human diseases. The same applies to redox-inactive zinc (Zn), which is involved in numerous biological functions, and serves as a structural element, a catalyst, and a participant in both intracellular and intercellular signaling and in maintaining immune system function. An imbalance in redox active (Fe, Cu, Mn) or redox inactive (Zn) metal ions, whether in excess or deficiency, is harmful and may disrupt the structural, regulatory, and catalytic roles of various antioxidant enzymes (superoxide dismutases (SODs), catalase (CAT), glutathione peroxidases (GPxs)), proteins, receptors, transporters, alter sulfhydryl homeostasis, generate high levels of ROS (e.g., hydroxyl radicals by the Fenton reaction), initiate lipid peroxidation, cause DNA damage, and lead to cell death via mechanisms such as ferroptosis, cuproptosis, cellular senescence, or inflammation. Maintaining redox homeostasis is essential for regulating numerous cellular signaling pathways. Redox-sensitive signaling pathways, such as the nuclear factor kappa B (NF-κB), mitogen-activated protein kinase kinase (MAPK), and nuclear factor erythroid 2-related factor 2 (Nrf2) pathways, form an intricate network that governs cellular responses to redox metal-induced oxidative stress and inflammation. The Nrf2 pathway is primarily responsible for mediating antioxidant defenses, whereas the NF-κB and MAPK pathways play roles in proinflammatory and stress-related responses. Dysregulation of redox-active Fe, Cu, Mn, and redox-inactive Zn can alter epigenetic regulatory mechanisms such as DNA methylation, histone modification, and non-coding RNA expression. The dyshomeostasis of metal ions is closely related to the pathogenesis of lung, renal, and gastrointestinal diseases, neurodegenerative disorders (Alzheimer's disease, Parkinson's disease, and Huntington's disease), psychiatric conditions (schizophrenia), and various cancers. This review summarizes recent findings on the role of iron, copper, manganese, and zinc in maintaining physiological functions, redox homeostasis, and human diseases. See also the graphical abstract(Fig. 1).

Also flagged:Alzheimer's diseaseADneurodegenerative disordercognitive declinedementiaaging
Journal Article 2025-07-25 No Snippets Ren F, Wei J, Chen Q, Hu M, Yu L, Mi J, Zhou X, Qin D, Wu J, Wu A.
Show Full Abstract

Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized by cognitive decline and memory loss, with few effective treatments currently available. The multifactorial nature of AD, shaped by genetic, environmental, and biological factors, complicates both research and clinical management. Recent advances in artificial intelligence (AI) and multi-omics technologies provide new opportunities to elucidate the molecular mechanisms of AD and identify early biomarkers for diagnosis and prognosis. AI-driven approaches such as machine learning, deep learning, and network-based models have enabled the integration of large-scale genomic, transcriptomic, proteomic, metabolomic, and microbiomic datasets. These efforts have facilitated the discovery of novel molecular signatures and therapeutic targets. Methods including deep belief networks and joint deep semi-non-negative matrix factorization have contributed to improvements in disease classification and patient stratification. However, ongoing challenges remain. These include data heterogeneity, limited interpretability of complex models, a lack of large and diverse datasets, and insufficient clinical validation. The absence of standardized multi-omics data processing methods further restricts progress. This review systematically summarizes recent advances in AI-driven multi-omics research in AD, highlighting achievements in early diagnosis and biomarker discovery while discussing limitations and future directions needed to advance these approaches toward clinical application.

Also flagged:cell differentiationtranscription factorsgene expressionnicotinic acetylcholine receptor subunit alpha 1Chrna1binding
Journal Article 2025-07-24 No Snippets Choe N, Jeong A, Joung H, Jeong D, Kim YK, Kook H, Kwon DH.
Show Full Abstract

Skeletal muscle differentiation is a complex process regulated by a network of genes and transcription factors. Recent studies have revealed the roles of circular RNAs (circRNAs) and microRNAs (miRNAs) in modulating gene expression during myogenesis. In this study, we focused on the functional interplay between circAtxn10, miR-143-3p, and the nicotinic acetylcholine receptor subunit alpha 1 (Chrna1) in skeletal muscle differentiation. Our results demonstrate that circAtxn10 expression increases during myogenic differentiation and acts as a sponge for miR-143-3p through direct binding. We identified Chrna1 as a direct target of miR-143-3p through three binding sites in its 3'-UTR and showed that both miR-143-3p mimic and Chrna1 knockdown significantly impair myogenesis. Notably, Chrna1 overexpression dramatically enhanced myogenic marker expression and myotube formation. Our findings establish a regulatory axis involving circAtxn10, miR-143-3p, and Chrna1 that plays a critical role in modulating skeletal muscle differentiation, providing new insights into the complex molecular mechanisms regulating myogenesis.

PEBP1
Also flagged:InterferonFerroptosisasthmastimulator of interferon genesSTINGovalbumin
Journal Article 2025-07-24 ✓ 2 Snippets Chen S, Jiang X, Li X, Wang T, Yang N.
In-Text Gene Mentions

…hanolamine-binding protein 1 (PEBP1)/15-LOX complex is a…

…The co-localization ofPEBP1and 15-LOX is…

Show Full Abstract

Ferroptosis is closely associated with the various pathological manifestations of asthma. This study aimed to explore the role of the stimulator of interferon genes (STING) in modulating airway inflammation in asthma, with a particular focus on regulating ferroptosis in airway epithelial cells. Using an ovalbumin (OVA)-sensitized mouse model of asthma, the OVA group exhibited significant inflammatory cell infiltration in the airways, increased mucus secretion, and elevated levels of inflammatory cytokines compared with those noted in the normal group. Additionally, the ferroptosis-related protein acyl-CoA synthetase long-chain family member 4 (ACSL4) was upregulated, whereas glutathione peroxidase 4 (GPX4) was downregulated, accompanied by elevated malondialdehyde (MDA) levels and reduced superoxide dismutase (SOD) activity. Furthermore, both messenger ribonucleic acid and protein levels of STING were significantly increased in the lungs of OVA-sensitized mice, with predominant expression in airway epithelial cells. After intervention with STING inhibitor C-176, the OVA + C-176 group demonstrated reduced inflammatory cell infiltration and mucus hypersecretion in the airways, along with decreased serum levels of IgE and Th2-associated cytokines (IL-4 and IL-13), but increased levels of the Th1 cytokine IFN-γ. Moreover, ACSL4 protein and MDA levels were significantly decreased, whereas SOD activity was significantly restored following C-176 intervention. Double immunofluorescence staining revealed the colocalization of STING and ACSL4, with their expression levels significantly reduced following C-176 treatment. Co-immunoprecipitation confirms the interaction between STING and ACSL4. Collectively, these findings indicate that STING regulates airway inflammation in asthma by modulating ferroptosis and lipid peroxidation, highlighting STING as a potential therapeutic target for asthma.

HTT
Also flagged:immune responseamino acidHuntington's diseaseHDbindingantibodies
Journal Article 2025-07-24 ✓ 5 Snippets Parlato R, Jain G, Lasorsa A, van der Wel PCA.
In-Text Gene Mentions

…in the huntingtin (HTT) gene and characterized…

…antibodies interact withHTTexon 1 (HTTex1)…

…Multiple anti‐HTTantibodies are used…

…in the huntingtin (HTT) protein. […

…7 ]HTT‐binding antibodies have been…

Show Full Abstract

Antibodies are critical for the immune response and serve as important tools due to their ability to recognize specific amino acid sequences, or epitopes. Based on the latter, they are utilized as diagnostic tools in biological and biomedical research. Huntington's disease (HD) is a neurodegenerative condition caused by CAG repeat expansions in the huntingtin (HTT) gene and characterized by amyloid-like protein deposits in patients. Multiple anti-HTT antibodies are used in HD research for their ability to recognize specific HTT inclusions in both post-mortem tissue and in laboratory conditions. Some of the antibodies are seen as detectors of distinct structural motifs. However, most knowledge of their binding mechanism stems from studies of soluble monomers or short fragments of the epitopes, rather than the aggregated, misfolded target protein. Here, we investigate how MW8 antibodies interact with HTT exon 1 (HTTex1) fibrils, using solid-state NMR, electron microscopy, and complementary techniques. Magic angle spinning (MAS) NMR revealed localized impacts of the antibody on exposed parts of the HTTex1 fibrils: the flanking segments that form its "fuzzy coat". Antibody binding affected the structure and dynamics of the fuzzy coat, but also modulated the propensity for forming supramolecular fibril clusters, which has important implications for (reducing) cytotoxicity.

CCPG1
Also flagged:LC3autophagy-membranesbindingpost-translational modifications
Journal Article 2025-07-24 ✓ 1 Snippet North BJ, Fracchiolla D, Ragusa MJ, Martens S, Shoemaker CJ.
In-Text Gene Mentions

…al., 2024 ),CCPG1( Zhou et…

Show Full Abstract

LC3-interacting regions (LIRs), or Atg8-interacting motifs (AIMs), are short linear motifs found in unstructured loops or intrinsically disordered regions of many autophagy-related proteins. LIRs were initially identified for their role in binding to Atg8 family proteins on autophagosomal membranes. However, emerging evidence suggests that LIRs and their surrounding residues mediate interactions with a wide array of proteins beyond Atg8s. This broadens the biological significance of LIRs in autophagy, rendering them an organizing principle of the autophagy machinery. In this perspective, we explore recent advances highlighting the multifunctional roles of LIRs, including their capacity to mediate binding with diverse factors. We discuss insights into the mechanisms underlying LIR-mediated interactions and propose an updated model to explain Atg8 diversification in higher eukaryotes. We conclude by addressing key challenges and outlining future directions for understanding LIR biology and its broader implications for cellular homeostasis.

CACNA1E
Also flagged:TDP43Transactive response DNA binding protein 43 kDaproteinopathyneurodegenerative diseasesAmyotrophic Lateral SclerosisALS
Journal Article 2025-07-24 ✓ 1 Snippet Ganssauge J, Hawkins S, Namboori SC, Leung SK, Mill J, Bhinge A.
In-Text Gene Mentions

CACNA1Eand KCNQ2 displayed…

Show Full Abstract

Transactive response DNA binding protein 43 kDa (TDP43) proteinopathy, characterized by the mislocalization and aggregation of TDP43, is a hallmark of several neurodegenerative diseases, including Amyotrophic Lateral Sclerosis (ALS). In this study, we describe the development of a new model of TDP43 proteinopathy using human induced pluripotent stem cell (iPSC)-derived neurons. Utilizing a genome engineering approach, we induced the mislocalization of endogenous TDP43 from the nucleus to the cytoplasm without mutating the TDP43 gene or using chemical stressors. Our model successfully recapitulates key early and late pathological features of TDP43 proteinopathy, including neuronal loss, reduced neurite complexity, and cytoplasmic accumulation and aggregation of TDP43. Concurrently, the loss of nuclear TDP43 leads to splicing defects, while its cytoplasmic gain adversely affects microRNA expression. Strikingly, our observations suggest that TDP43 is capable of sustaining its own mislocalization, thereby perpetuating and further aggravating the proteinopathy. This innovative model provides a valuable tool for the in-depth investigation of the consequences of TDP43 proteinopathy. It offers a clinically relevant platform that will accelerate the identification of potential therapeutic targets for the treatment of TDP43-associated neurodegenerative diseases, including sporadic ALS.

Also flagged:SynthesiscalciumbindingL -amino acidtumornitrogen
Journal Article 2025-07-24 No Snippets Ciaglia T, Napolitano V, Miranda MR, La Gioia D, Musella S, Schiano Moriello A, Merciai F, Di Sarno V, De Vita S, Colarusso E, Smaldone G, Di Matteo F, Sommella EM, Kumar P, Allarà M, Ligresti A, Gomez-Monterrey IM, Bifulco G, Lauro G, Campiglia P, Ostacolo C, Vestuto V, Bertamino A.
Show Full Abstract

Molecular diversity is one of the most pursued objectives in drug discovery, and diversity-oriented synthesis (DOS) perfectly responds to the achievement of this goal. In this paper, we describe a DOS approach applied to the antitumor field with the aim of identifying new anticancer structures and their associated targets. To accomplish this ambitious project, after an initial stage of phenotypic evaluation, we set up an integrated platform of inverse virtual screening (IVS), bioinformatics, and omics to predict the biological targets of the most promising compounds <b>31</b> and <b>63</b>. Several proteins emerged from this study, and the most interesting ones were assessed by biophysical and in cellulo experiments, leading to the validation of six targets involved in calcium regulation, endoplasmic reticulum stress, and apoptosis. This work allowed us to identify two hit compounds with an interesting antitumor mechanism, but principally, to validate our platform as a fruitful tool for untargeted DOS campaigns.

Also flagged:Polysaccharidespolysaccharidecapsulesnanofibersmembranessynthesis
Journal Article 2025-07-24 No Snippets Sousa V, Monteiro LPG, Rocha DHA, Rodrigues JMM, Borges J, Mano JF.
Show Full Abstract

Marine polysaccharides are widely available sustainable renewable macromolecules, which have attracted considerable attention owing to their enhanced biocompatibility, biodegradability, noncytotoxic, nonimmunogenic properties, and close similarity to the native cellular microenvironment of tissues and organs. Herein, a comprehensive overview of the main sources and properties of most studied cationic, anionic, and neutral marine-origin polysaccharides, their main chemical functionalization strategies, as well as their processing into advanced biofunctional materials/devices is provided. Several recent examples are given on the bottom-up processing of marine-origin polysaccharide-based biomaterials in the form of nano-/microparticles and capsules, nanofibers, thin films, membranes, hydrogels, cryogels, and (bio)inks to be used as high added-value antimicrobial coatings, adhesives, and wound dressings, or in food packaging, cosmetics, controlled drug delivery, <i>in vitro</i> disease modeling, or tissue engineering and regenerative medicine. The main challenges hampering the clinical translation and commercialization of most marine-origin polysaccharide-based biomaterials and devices, and future perspectives in the field are also discussed.

HTT
Also flagged:neurodegenerative diseasesHDHuntingtinpathogenesisfibrilsphototoxicity
Journal Article 2025-07-24 ✓ 1 Snippet Ibrahim KA, Cathala C, Bevilacqua C, Feletti L, Prevedel R, Lashuel HA, Radenovic A.
In-Text Gene Mentions

…of the Huntingtin (Htt) protein (Httex1), leading…

Show Full Abstract

The process of protein aggregation, central to neurodegenerative diseases like Huntington's, is challenging to study due to its unpredictable nature and relatively rapid kinetics. Understanding its biomechanics is crucial for unraveling its role in disease progression and cellular toxicity. Brillouin microscopy offers unique advantages for studying biomechanical properties, yet is limited by slow imaging speed, complicating its use for rapid and dynamic processes like protein aggregation. To overcome these limitations, we developed a self-driving microscope that uses deep learning to predict the onset of aggregation from a single fluorescence image of soluble protein, achieving 91% accuracy. The system triggers optimized multimodal imaging when aggregation is imminent, enabling intelligent Brillouin microscopy of this dynamic biomechanical process. Furthermore, we demonstrate that by detecting mature aggregates in real time using brightfield images and a neural network, Brillouin microscopy can be used to study their biomechanical properties without the need for fluorescence labeling, minimizing phototoxicity and preserving sample health. This autonomous microscopy approach advances the study of aggregation kinetics and biomechanics in living cells, offering a powerful tool for investigating the role of protein misfolding and aggregation in neurodegeneration.

OLFM4
Also flagged:PDneurological disorderdopamineα-synucleinidiopathic PDmitochondrial complex I
Journal Article 2025-07-24 ✓ 1 Snippet Tsalenchuk M, Farmer K, Castro S, Scheirer A, Ye Y, Timothy Greenamyre J, Rocha EM, Marzi SJ.
In-Text Gene Mentions

…23 , whileOLFM4, a gene…

Show Full Abstract

Pesticide exposure is increasingly recognized as a potential environmental factor in idiopathic Parkinson's disease, though the molecular mechanisms remain unclear. This study explores how pesticide exposure alters gene regulation in key brain regions using the rotenone rat model. We performed H3K27ac ChIP-sequencing to profile active regulatory elements in the substantia nigra and motor cortex. Despite uniform complex I inhibition across regions, we observed region-specific epigenomic changes associated with rotenone exposure. RNA-sequencing confirmed transcriptomic alterations. We identified a strong, rotenone-induced immune response in the substantia nigra, including increased activity in the C1q complement pathway, suggesting immune involvement driven by regulatory mechanisms. In contrast, the cortex showed dysregulation of synaptic function at the gene regulatory level. Our results highlight a role for gene regulatory mechanisms potentially mediating the effects of pesticide exposure, driving region-specific functional responses in the brain that may contribute to the pathology and selective vulnerability that characterise Parkinson's disease.

SOX6
Also flagged:synapseneurogenesisparvalbuminPVsomatostatinSST
Journal Article 2025-07-24 ✓ 3 Snippets Reichard J, Wolff P, Xie S, Zuo K, Fullio CL, Du J, Graff S, Linde J, Yildiz CB, Pitschelatow G, Nabbefeld G, Dorp L, Vollmer J, Biemans L, Kempf S, Singh M, Mohan KN, Kuo CC, Vogel T, Carloni P, Musall S, Zimmer-Bensch G.
In-Text Gene Mentions

…Dlx2, Dlx5 ,Sox6, Maf ,…

…the transcription factorsSox6and Dlx2 ,…

…factors such asSox6, Maf ,…

Show Full Abstract

The coordinated development of cortical circuits composed of excitatory and inhibitory neurons is critical for proper brain function, and disruptions are linked to a spectrum of neuropsychiatric disorders. While excitatory neurons are generated locally in the cortical proliferative zones, inhibitory cortical interneurons (cINs) originate in the basal telencephalon and migrate tangentially into the cortex. Here, we show that DNA methyltransferase 1 (DNMT1) is essential for the migration and integration of somatostatin (SST)-expressing interneurons in mice. Dnmt1 deletion causes premature exit of SST<sup>+</sup> cINs from the superficial migratory stream and alters the expression of key developmental genes. Unexpectedly, Dnmt1-deficient SST<sup>+</sup> interneurons also exert non-cell-autonomous effects on cortical progenitor cells, resulting in subtle yet lasting alterations in cortical layering. These findings propose a role for DNMT1 in governing the migration of SST<sup>+</sup> interneurons and mediating their instructive signaling to cortical progenitor cells, thereby shaping cortical architecture and influencing long-term network function.

Also flagged:lung adenocarcinomamicrobial lung infectionslung cancerLUADlung infectioninfection
Journal Article 2025-07-24 No Snippets Sheervalilou M, Ghanei M, Arabfard M.
Show Full Abstract

<h4>Background</h4>Microbial lung infections may promote development of lung cancer through overlapping molecular mechanisms. This analysis aimed to identify a co-regulated peripheral blood gene signature in lung adenocarcinoma (LUAD) and microbial lung infections.<h4>Methods</h4>A total of 403 peripheral blood transcriptomic profiles from five GEO test datasets-two LUAD (GSE39345, GSE103527) and three infection-related (GSE40012, GSE65682, GSE103119)-were analyzed using the limma package. Differentially expressed genes (DEGs) were defined by|log<sub>2</sub>FC| >1 and p < 0.05. Two additional GEO datasets (GSE42826 and GSE42830), comprising 30 blood samples (16 LUAD, 14 lung infection), served as validation sets. Shared DEGs were subjected to KEGG and GO enrichment analyses. Protein-protein interaction (PPI) networks were constructed in Cytoscape, and the top 10 hub genes were identified. Expression data of hub genes were compared between validation LUAD and lung infection samples using the Mann-Whitney U test, followed by linear regression and Pearson correlation to confirm co-regulation. Immune cell infiltration was assessed using xCell deconvolution algorithm.<h4>Results</h4>Ninety-three significant DEGs were shared between LUAD and infection datasets, including 40 upregulated and 53 downregulated genes. Eight hub genes showed consistent differential expression in both LUAD and lung infection: BCL6, CD163, S100A12 (upregulated); and FLT3LG, RPL13, RPL14, RPL22, RPS4X (downregulated), of which BCL6, S100A12, FLT3LG, RPL13, RPL14, RPL22 and RPS4X were significantly co-regulated (R<sup>2</sup> >0.8, p < 0.001) and correlated (p < 0.05). Immune profiling revealed that upregulated genes were associated with immunosuppressive cells such as Tregs and M2 macrophages, while downregulated genes were positively correlated with antitumor immune cell infiltration including CD8<sup>+</sup> T cells and M1 macrophages. Consistent immune, stroma and microenvironment scores were observed between LUAD and lung infection.<h4>Conclusion</h4>This analysis identified a blood-based 7-gene signature shared between LUAD and microbial lung infections, associated with immunosuppressive microenvironment features, suggesting a potential link between infection-driven inflammation and tumor-promoting immune modulation.

MLLT10
Also flagged:leukemiastumorsKMT2Aleukemiatumor-associated antigens
Journal Article 2025-07-24 ✓ 5 Snippets Tirtakusuma R, Ghonim MA, Schattgen S, Muller B, Van de Velde LA, Khan TM, Crawford JC, Ma J, Abdelhamed S, Vegesana K, Awad W, Allen EK, Iacobucci I, Mullighan CG, Klco JM, Thomas PG.
In-Text Gene Mentions

…, PICALM ::MLLT10, or DEK…

…ALL sample with PICALM::MLLT10(SJALL048457).…

…ements, NUP98::NSD1 , PICALM::MLLT10, RUNX1:RUNX1T1 ,…

…RUNX1:RUNX1T1 , and ZNF384::MLLT10molecular alterations (Table…

…the KMT2A ::MLLT10fusion gene showed…

Show Full Abstract

Pediatric patients with fusion-driven leukemias frequently have a poor prognosis and need more effective therapies. Adoptive T-cell therapies, using expanded autologous T cells, have shown promise as an immunotherapeutic for patients with tumors characterized by high mutational burdens. However, this approach has not been shown to be effective in pediatric leukemias. In this study, we analyzed samples from pediatric patients with fusion-driven acute lymphoblastic, acute myeloid, and mixed phenotypic leukemias, including those with KMT2A-rearrangements. T cells were attained from bone marrow samples, expanded, and their reactivity against autologous leukemic blasts was tested. Strikingly, we observed leukemia-reactive T cells in nearly all patients (33 of 34) at diagnosis or relapse. Furthermore, some patients contained clones reactive to fusion neoantigens and other tumor-associated antigens, and candidate samples were further enriched by selecting for PD1<sup>hi</sup> and CD39<sup>+</sup> T-cell populations. These clones were only present at the initial diagnostic timepoint and could not be detected at later times after treatment, even with deep sequence profiling. Altogether, our data suggest that adoptive T cell therapy, using expanded leukemia-reactive T cells identified at diagnosis, has potential as a novel therapeutic for these patients.

HTT
Also flagged:synthesisHDneurodegenerative disordermovement disorderchoreacognition
Journal Article 2025-07-24 ✓ 1 Snippet Thompson A, Quarrell O, Strong M.
In-Text Gene Mentions

…exon of theHTTgene [ 1…

Show Full Abstract

There is significant variation in the reported estimates of Huntington's disease (HD) prevalence in different settings. This systematic review was undertaken to describe and assess the sources of heterogeneity in estimated prevalence values, and to consider the role of quantitative synthesis in the context of such heterogeneity. Observational studies from which a prevalence estimate (point or period) or cumulative incidence of HD could be calculated between 1993 and 2024 were sought from Medline and Embase databases. The study features are described and the sources of heterogeneity are discussed. A meta-regression was conducted including predictor variables: continent, median age of population, number of years since 1993, case ascertainment method, and Healthcare Access and Quality Index score. 43 studies met the inclusion criteria. Significant clinical and methodological heterogeneity between studies is described, including differences in case definitions and ascertainment methods, and in the estimates of disease burden calculated. There were differences in the estimated point prevalence between regions and populations within regions, while the estimated point prevalence was shown to be increasing since 1993. Wide prediction intervals in the overall pooled point prevalence (95% prediction interval: 0.32-37.55 cases per 100,000), and the European pooled point prevalence (95% prediction interval: 1.64-19.18 cases per 100,000), indicate the scale of heterogeneity between studies and settings. While such heterogeneity currently limits the validity and utility of quantitative synthesis, developing an accepted consensus on the minimum standards and reporting requirements for HD prevalence studies could reduce the methodological heterogeneity between future studies, enabling more valid and meaningful quantitative synthesis in future.

TNFSF4
Also flagged:LAMP3cervical cancerorganellesacid hydrolasesautophagycancer
Journal Article 2025-07-24 ✓ 1 Snippet Ji H, Zheng J, Liu L, Liu Q, Cai X, Ji L, Sun Y.
In-Text Gene Mentions

…TNFRSF4, TNFRSF18, TNFRSF14,TNFSF4, and TNFSF18) (Fig.…

Show Full Abstract

<h4>Background</h4>Lysosomes are monolayer membrane-encapsulated organelles containing acid hydrolases, crucial for intracellular substance breakdown and cellular homeostasis. They are also involved in autophagy. Although autophagy is linked to cancer, the role of lysosome-related genes in cervical cancer prognosis remains unclear. This study aimed to develop a prognostic model for cervical cancer based on lysosome-related genes and explore its applications in the tumor microenvironment, radiotherapy prognosis, and clinical pharmacology.<h4>Methods</h4>We identified differentially expressed lysosome-related genes in cervical cancer and normal tissues using the TCGA database. A prognostic model was constructed using LASSO-Cox regression, validated with ROC curves and PCA analysis, and further verified using the GEO dataset GSE63514. In vitro and in vivo experiments were conducted to explore key genes, and their biological significance and pharmacological potential were analyzed.<h4>Results</h4>A five-gene (AP1B1, DNASE2, LAMP3, NPC1, and LAPTM4A) lysosome-associated prognostic model was developed. LAMP3 was identified as the most differentially expressed gene. Knockdown of LAMP3 significantly reduced cervical cancer cell migration and invasion through lysosomal and autophagic pathways. Daidzein was found to have high binding affinity for LAMP3, suggesting its therapeutic potential.<h4>Conclusion</h4>Lysosome-related gene modeling has significant clinical value. LAMP3 knockdown inhibits cervical cancer progression by reducing autophagy and lysosomal function. Daidzein shows potential as a novel therapeutic agent. However, further validation in larger cohorts is needed due to the limited sample size in this study.

POU3F2SOX6
Also flagged:transcription factorsTForganizationcancergene expressionbinding
Journal Article 2025-07-24 ✓ 2 Snippets Feng Z, Chen X, Duren Z, Xin J, Miao H, Yuan Q, Wang Y, Wong WH.
In-Text Gene Mentions

…as Pax6/3/7, Neurog1/2,Pou3f2, and Ascl1 (Additional…

…137 ] andSox6/8/10 [ 138 ]…

Show Full Abstract

Advances in single-cell technology enable large-scale generation of omics data, promising for clarifying gene regulatory networks governing different cell type/states. Nonetheless, prevailing methods fail to account for universal and reusable regulatory modules in GRNs, which are fundamental underpinnings of cell type landscape. We introduce cRegulon to infer regulatory modules by modeling combinatorial regulation of transcription factors based on diverse GRNs from single-cell multi-omics data. Through benchmarking and applications using simulated datasets and real datasets, cRegulon outperforms existing approaches in identifying TF combinatorial modules as regulatory units and annotating cell types. cRegulon offers new insights and methodology into combinatorial regulation.

PEBP1
Also flagged:cardioembolic strokeatherosclerosisASFerroptosisdeathCS
Journal Article 2025-07-24 ✓ 5 Snippets Zhang T, Yuan C, Chen M, Liu J, Shao W, Cheng N.
In-Text Gene Mentions

…CIRBP, CREB5, MAPK14,PEBP1, and PTGS2, were…

…hub genes (CREBP,PEBP1, PTGS2, CREB5, and…

…expression of CIRBP,PEBP1, PTGS2, CREB5, and…

…and CREB5 andPEBP1were significantly downregulat…

…(AUC = 0.922),PEBP1(AUC = 0.825),…

Show Full Abstract

<h4>Background</h4>Cardioembolic stroke (CS) and atherosclerosis (AS) are closely related diseases. Ferroptosis, a novel form of programmed cell death, may play a key role in CS and AS. However, the pathophysiological mechanisms underlying their coexistence remain unclear. This study aims to identify the hub genes and pathways involved in developing both diseases.<h4>Methods</h4>CS (GSE58294) and AS (GSE20129) datasets were obtained from the Gene Expression Omnibus database, and a ferroptosis (FR)-related gene dataset was downloaded from the FR database. A study was conducted to examine differentially expressed genes (DEGs) in healthy individuals and patients diagnosed with CS and AS. Gene ontology and Kyoto encyclopedia of genes and genomes analyses were performed to explore the functions of common FR-related DEGs (FRDEGs). Two machine learning algorithms, Least Absolute Shrinkage and Selection Operator (LASSO) regression and Support Vector Machine Recursive Feature Elimination (SVM-RFE), were used to screen for overlapping FRDEGs in CS and AS. To validate the prediction results, blood samples were collected from healthy controls and patients with CS and AS for quantitative real-time PCR. The correlation between biomarkers and clinical features was also evaluated.<h4>Results</h4>A total of 69 and 39 FRDEGs were identified in CS and AS, respectively. The hub genes, CIRBP, CREB5, MAPK14, PEBP1, and PTGS2, were identified using multiple methods. The area under the curve was > 0.7 for both models constructed using CS and AS datasets. A strong correlation was observed between neutrophil levels and expression of the hub genes. Additionally, several types of cancer indicated elevated expression of these hub genes compared to normal tissues.<h4>Conclusions</h4>In summary, the diagnostic model based on the FR-related gene PTGS2 demonstrated significant and specific diagnostic value for CS and AS, reflecting the status of blood lymphocytes, monocytes, and neutrophils. A pan-cancer study suggested it could serve as a new clinical prognostic marker and therapeutic target across various cancer types. This model may aid in the diagnosis of CS and AS. The findings offer new insights into the pathogenesis of these diseases.

Also flagged:genetic disordercardiomyopathyscoliosisFACHILDFriedreich AtaxiaFRDA
Journal Article 2025-07-24 No Snippets Rummey C, Perlman S, Subramony SH, Corti M, Farmer J, Lynch DR.
Show Full Abstract

BackgroundFriedreich ataxia is a rare genetic disorder caused by mutations in the <i>FXN</i> gene, typically presenting with balance and coordination difficulties between ages 7 and 15 years. Neurologic symptoms are progressive and lead to loss of ambulation and especially in children other symptoms such as cardiomyopathy, scoliosis, and fatigue are common. The FACHILD natural history study aimed to expand knowledge about the disease course and evaluate clinical outcome assessments in children. We report on functional performance testing, clinical rating scales, and patient-reported outcomes as clinical outcome assessments for Friedreich ataxia. Over a 3-year period, all tests and assessments were conducted to evaluate their sensitivity to progression and correlate with established measures such as neurologic rating scales.MethodsIndividuals with genetically confirmed Friedreich ataxia, aged 7-18 years, were enrolled from October 2017 to November 2022. This analysis focused on ambulatory individuals, including timed walks (25-foot, 1 minute, and 6 minutes), the timed up and go, and the 9-hole pegboard test. Additionally, the Berg Balance Scale and FA-Activities of Daily Living were assessed. Progression data were analyzed using mixed models for repeated measures, with detailed analyses of intermittent missing data. Data from the Friedreich Ataxia Clinical Outcome Measures Study was used to augment analyses when available.Findings and InterpretationFunctional performance outcome measures are sensitive and clinically relevant tools for assessing disease progression in children with Friedreich ataxia. In early to moderately affected populations, the 1-Minute Walk demonstrated promising properties, showing comparable sensitivity to the modified Friedreich Ataxia Rating Scale and the Upright Stability Score.

Also flagged:Synthesistrifluoroacetic acid2,3,5,6‐tetrafluoroanilineSchiff basetetrafluoroanilinemembranes
Journal Article 2025-07-24 No Snippets Jiménez-Duro M, Martínez-Fernández M, Cabrera-Trujillo JJ, Osuna E, Humanes MF, Gómez-Navarro C, Gómez-Herrero J, Zamora F, Segura JL.
Show Full Abstract

Two-dimensional covalent organic frameworks (COFs) are a special kind of crystalline polymers produced by the polycondensation reaction of organic linkers. However, the polymerization is often uncontrolled and conventionally yields polycrystalline powders. For that reason, the development of new methods to obtain single-crystalline COFs is an urgent need. Herein, we report a modulated, room-temperature, and fast synthesis of a highly fluorinated COF where the reaction conditions were systematically analyzed to yield single-crystalline rods of around three microns. The increase in crystal size enabled the analysis of precise structural features such as the mechanical properties or the different aggregation states of the bidimensional framework. In addition, the reaction mechanism was computationally elucidated, and the roles of the modulator agent and the catalyst were analyzed, confirming the critical importance of trifluoroacetic acid and 2,3,5,6-tetrafluoroaniline in modulating Schiff base bond formation and, consequently, the crystallinity of the resulting COF. This study reveals new insights into the crystallization of high-quality 2D COFs.

Also flagged:acute inflammatory diseasescytokinesepsisARDSCOVID-19cancer
Journal Article 2025-07-24 No Snippets Song Y, Stephens AD, Deng H, Füredi AD, Su SH, Ye Y, Chen Y, Newstead M, Yin Q, Lehto J, Fahim Z, Singer BH, Kurabayashi K.
Show Full Abstract

Time-course monitoring of blood biomarkers with rapid turnaround has the potential to revolutionize the diagnosis, stratification of phenotypes, and therapeutic/prognostic approaches for various acute inflammatory diseases in both clinical and preclinical studies. Current approaches, however, are hampered by slow turnaround times and large sample volume requirements, limiting the exploration of disease mechanisms and therapeutic strategies. Here, we developed a microfluidic digital ELISA platform prototype, combining single-molecule counting with whole blood assay capability for the first time from small animal models. This platform is semi-automated and enables repeated, rapid biomarker monitoring with just 3.5 μL of whole blood collected from the tail. Our platform demonstrated high sensitivity and multiplexity, allowing real-time cytokine profiling within a 2-h turnaround. Using a murine sepsis model, we achieved precise temporal monitoring of cytokine levels, demonstrating prognostic capability by correlating early-stage cytokine levels with a liver-injury biomarker. This microfluidic platform enables high temporal resolution and rapid monitoring of biomarker dynamics in a single mouse using freshly collected whole blood, significantly reducing the number of animals needed for preclinical studies. This technology has strong potential to transform ICU therapeutic strategies and preclinical research, enabling personalized treatment based on real-time biomarker profiles.

Also flagged:NMDA receptorsneurodegenerative diseasesNMDARsNMDARcalciumpathogenesis
Journal Article 2025-07-24 No Snippets Zhang K, Wen M, Nan X, Zhao S, Li H, Ai Y, Zhu H.
Show Full Abstract

NMDA receptors (NMDARs) are widely distributed throughout the central nervous system (CNS) and play pivotal roles in normal physiological processes such as synaptic plasticity, learning, and memory. Substantial evidence indicates that NMDAR dysfunction, particularly excessive calcium influx, critically contributes to the pathogenesis of major neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS). Dysregulated glutamatergic signaling synergizes with pathological protein aggregation (e.g., Aβ, <i>α</i>-synuclein, mutant huntingtin) to drive neuronal loss. We systematically delineate NMDAR-related mechanisms underlying neurodegeneration, highlighting spatial-specific roles (e.g., synaptic NMDAR-mediated neuroprotection versus extrasynaptic NMDAR-mediated excitotoxicity) and crosstalk with mitochondrial dysfunction and oxidative stress. We critically evaluate current therapeutic strategies targeting NMDARs, including subunit-selective modulators, downstream effector modulation, and glutamate transporter modulation designed to restore NMDAR homeostasis. Consequently, NMDARs and their modulators represent promising therapeutic targets for these refractory conditions. This review comprehensively summarizes current research on the involvement of NMDARs and the glutamatergic system in neurodegenerative diseases. Furthermore, we discuss the clinical application of NMDAR-targeting agents and explore emerging therapeutic strategies focused on modulating NMDAR-related pathways. This article aims to provide a reference for elucidating the molecular mechanisms underlying these neurodegenerative disorders and to highlight potential avenues for future drug development.

HTT
Also flagged:brain tumorsglioblastoma multiformeGBMneurodegenerative diseasestumorbrain
Journal Article 2025-07-24 ✓ 3 Snippets Kirit E, Gokce C, Altun B, Yilmazer A.
In-Text Gene Mentions

…of the huntingtin (HTT) gene.…

…of the mutantHTTprotein have shown…

…expressing a mutantHTTgene have been…

Show Full Abstract

The blood-brain barrier (BBB) is the main obstacle preventing access to the central nervous system (CNS). It is therefore a major challenge in CNS studies, e.g., investigations of novel therapeutic agents for brain tumors, such as glioblastoma multiforme (GBM). Ensuring the structural and functional integrity of the BBB is essential for such studies. Therefore, the BBB and blood-brain-tumor barrier (BBTB) behaviors must be further investigated to enhance the treatment effectiveness in neurodegenerative diseases (NDDs). Researchers are striving to use nanoparticles (NPs) and/or develop nano delivery systems (NDSs) to efficiently overcome the barriers to transporting neurotherapeutics to the brain, focusing on targeting disease or tumor sites. In this regard, BBB disease modeling enables examination of the transport of these molecules and/or systems from the bloodstream to the brain. Facilitating their transport is likely to enhance their investigation in CNS studies and potentially lead to their use in treating various NDDs. This review describes the BBB, NPs, and/or NDSs used in BBB studies and evaluates the ability of existing BBB disease models to precisely forecast the in vivo efficacy of NPs or NDSs.

HFEDCC
Also flagged:Hepatocellular CarcinomaIntrahepatic Cholangiocarcinomasolid tumorCK-7Glypican 3TTF-1
Journal Article 2025-07-24 ✓ 3 Snippets Konošenoka KM, Zdanovskis N, Kratovska A, Šilovs A, Zaiceva V.
In-Text Gene Mentions

…alcohol-related cirrhosis, andhemochromatosis[ 7 ].…

…(PCC), and distal (DCC) subtypes.…

…and, more rarely,hemochromatosisand chronic pancreatitis…

Show Full Abstract

<b>Background and Objectives</b>: Accurate noninvasive differentiation between hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC) remains a clinical challenge. This study aimed to assess the dignostic performance of apparent diffusion coefficient (ADC) values from diffusion-weighted MRI in distinguishing between HCC and ICC, with histological confirmation as the gold standard. <b>Materials and Methods</b>: A retrospective analysis was performed on 61 patients (41 HCC, 20 ICC) who underwent liver MRI and percutaneous biopsy between 2019 and 2024. ADC values were measured from diffusion-weighted sequences (b-values of 0, 500, and 1000 s/mm<sup>2</sup>), and regions of interest were placed over solid tumor areas. Statistical analyses included <i>t</i>-tests, one-way ANOVA, and ROC curve analysis. <b>Results</b>: Mean ADC values did not differ significantly between HCC (1.09 ± 0.19 × 10<sup>-3</sup> mm<sup>2</sup>/s) and ICC (1.08 ± 0.11 × 10<sup>-3</sup> mm<sup>2</sup>/s). ROC analysis showed poor discriminative ability (AUC = 0.520; <i>p</i> = 0.806). In HCC, ADC values decreased with lower differentiation grades (<i>p</i> = 0.008, η<sup>2</sup> = 0.224). No significant trend was observed in ICC (<i>p</i> = 0.410, η<sup>2</sup> = 0.100). Immunohistochemical markers such as CK-7, Glypican 3, and TTF-1 showed significant diagnostic value between tumor subtypes. <b>Conclusions</b>: ADC values have limited utility for distinguishing HCC from ICC but may aid in HCC grading. Immunohistochemistry remains essential for accurate diagnosis, especially in poorly differentiated tumors. Further studies with larger cohorts are recommended to improve noninvasive diagnostic protocols.

PEBP1
Also flagged:CancerRKIPLKB1STK11Tumortumors
Journal Article 2025-07-24 ✓ 5 Snippets Skouradaki E, Zaravinos A, Panagopoulou M, Chatzaki E, Dovrolis N, Baritaki S.
In-Text Gene Mentions

…Analysis of RKIP (&lt;i&gt;PEBP1&lt;/i&gt;) and LKB1 (&lt;i&gt…

…LKB1, encoded by <i>PEBP1</i> and <i>STK11</i>, respect…

…We investigated <i>PEBP1/STK11</i> co-expression and i…

…verse correlations between <i>PEBP1/STK11</i> co-expression and T…

…subset of tumors, <i>PEBP1/STK11</i> co-expression was s…

Show Full Abstract

RKIP and LKB1, encoded by <i>PEBP1</i> and <i>STK11</i>, respectively, have emerged as key regulators of cancer pathophysiology. However, their role in shaping tumor progression through modulation of the tumor microenvironment (TME) is not yet fully understood. To address this, we performed a comprehensive pan-cancer analysis using TCGA transcriptomic data across 33 cancer types, grouped by their tissue of origin. We investigated <i>PEBP1/STK11</i> co-expression and its association with transcriptomic reprogramming in major TME components, including immune, mechanical, metabolic, and hypoxic subtypes. Our results revealed both positive and inverse correlations between <i>PEBP1/STK11</i> co-expression and TME-related molecular signatures, which did not align with classical cancer categorizations. In a subset of tumors, <i>PEBP1/STK11</i> co-expression was significantly associated with improved overall survival and reduced mortality (HR < 1). Notably, we predominantly observed inverse correlations with pro-inflammatory and immunosuppressive chemokines, immune checkpoints, extracellular matrix components, and key regulators of epithelial-to-mesenchymal transition. In contrast, we found positive associations with anti-inflammatory chemokines and their receptors. Importantly, <i>PEBP1/STK11</i> co-expression was consistently linked to reduced expression of drug resistance genes and greater chemosensitivity across multiple tumor types. Our findings underscore the co-expression of <i>PEBP1</i> and <i>STK11</i> as a promising target for future studies aimed at elucidating its potential as a biomarker for prognosis and therapeutic response in precision oncology.

Also flagged:LactateLung CancermetabolismADAMTS3FADS2RTBDN
Journal Article 2025-07-24 No Snippets Li Q, Shen L, Yang Y, Tai G, Zhu Q, Liu C, Ge Q, Yi Q.
Show Full Abstract

Radiotherapy is a standard treatment for advanced lung cancer, but resistance remains a significant cause of treatment failure. This study aimed to investigate lactate-associated genes to identify patients likely to benefit from radiotherapy. RNA-seq data from 99 patients with lung cancer who underwent radiotherapy were analyzed to identify differentially expressed genes (DEGs) between resistant and sensitive cases. Bioinformatics tools were used to assess the prognostic relevance of lactate-related genes, and a risk score model was develpoed based on these genes. Dysregulation of these genes in patients with lung cancer undergoing radiotherapy was validated through <i>in vitro</i> experiments. Molecular docking was used to explore potential radiosensitizers. The analysis identified 1482 DEGs, with enrichment analysis highlighting lactate metabolism pathways. A risk score model was constructed using the lactate-related genes ADAMTS3, FADS2, and RTBDN to classify patients into high- and low-risk subgroups. Functional enrichment analysis revealed the model's impact on DNA repair and tumor immunity. A nomogram was developed for clinical implementation. Wet lab experiments further confirmed these findings. In conclusion, a novel risk score model based on lactate-related genes was developed to predict radiotherapy outcomes in lung cancer. FADS2 was identified as a potential biomarker for predicting resistance to radiotherapy. This study is the first to examine the predictive value of lactate-related genes for radiotherapy efficacy in lung cancer, offering valuable insights for personalized treatment strategies to improve therapeutic outcomes.

Also flagged:Nitropropionic Acid3-Nitropropionic acidnitroalkanesuccinatesuccinate dehydrogenasemitochondrial
Journal Article 2025-07-24 No Snippets Feng ML, Li ZH, Shi BB.
Show Full Abstract

3-Nitropropionic acid (3-NPA) is a deadly neurotoxic nitroalkane found in numerous fungi and leguminous plants. 3-NPA, known as an antimetabolite of succinate, irreversibly inhibits succinate dehydrogenase and disrupts mitochondrial oxidative phosphorylation. Its utility in modeling Huntington's disease (HD) and oxidative stress has garnered significant research interest. Derivatives of 3-NPA, formed through esterification, have a wide range of biological activities including neurotoxic, antiviral, insecticidal, antimicrobial and antioxidant properties. This review systematically summarizes the structural characteristics, biological activities, and chemical synthesis of 3-NPA-derived compounds, providing valuable insights for further research and therapeutic applications.

Also flagged:LipophagyLiver DiseasesMetabolic dysfunction-associated steatotic liver diseasehepatic steatosisasmetabolic dysfunction-associated steatohepatitis
Journal Article 2025-07-24 No Snippets Hwang JS, Lai TH, Kim DR.
Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) encompasses a range of liver conditions, from simple hepatic steatosis to its more severe inflammatory form known as metabolic dysfunction-associated steatohepatitis (MASH). Despite its growing clinical significance and association with cirrhosis and cancer, there are currently few pharmacological treatments available for MASLD, highlighting the urgent need for new therapeutic strategies. This narrative review aims to elucidate the molecular mechanisms of lipophagy in MASLD progression, emphasizing how its dysfunction contributes to hepatic steatosis and lipotoxicity. We also explore the intersection of lipophagy failure with oxidative stress and inflammation in the liver, focusing on key signaling pathways, such as mTORC1 and AMPK, and discuss the therapeutic potential of targeting these pathways by systematically reviewing the literature from PubMed, Scopus, and Google Scholar databases. Recent studies suggest that lipophagy, the selective autophagic degradation of lipid droplets, is crucial for maintaining hepatic lipid homeostasis. Indeed, some vital components of the lipophagy machinery seem to be functionally inhibited in MASLD, resulting in the accumulation of intracellular triacylglycerol (TAG), lipotoxicity, and subsequent oxidative stress, all of which contribute to disease progression. In summary, impaired lipophagy is a central pathological mechanism in MASLD, making it an important therapeutic target. A deeper understanding of these mechanisms may offer new strategic insights for combating the progression of MASLD/MASH.

OLFM4
Also flagged:CEACAM5tumorClaudin-4CLDN4bindingantibody
Journal Article 2025-07-24 ✓ 3 Snippets Martinelli S, Peri S, Anceschi C, Laurenzana A, Fortuna L, Mello T, Naldi L, Marroncini G, Tricomi J, Biagioni A, Amedei A, Cianchi F.
In-Text Gene Mentions

…(#A12912), PIGR (#A6130),Olfm4(#A15387), and anti-EpCAM…

…29 ], olfactomedin4 (OLFM4) [ 30 ,…

…Although EpCAM, PIGR,OLFM4, and CLDN4 have…

Show Full Abstract

<b>Background</b>: Gastric cancer (GC) is a malignant tumor of the gastrointestinal tract, characterized by high mortality rates and responsible for about one million new cases each year globally. Surgery is the main treatment, but achieving radical resection remains a relevant intraoperative challenge. Fluorescence-guided surgery offers clinicians greater capabilities for real-time detection of tumor nodules and visualization of tumor margins. In this field, the main challenge remains the development of fluorescent dyes that can selectively target tumor tissues. <b>Methods</b>: we examined the expression of the most suitable GC markers, including carcinoembryonic antigen cell adhesion molecule-5 (CEACAM5) and Claudin-4 (CLDN4), in GC cell lines. To further evaluate their expression, we performed immunohistochemistry (IHC) on tumor and healthy tissue samples from 30 GC patients who underwent partial gastrectomy at the Digestive System Surgery Unit, AOU Careggi, Florence. Additionally, we validated anti-CEACAM5 expression on patient-derived organoids. Furthermore, we developed a fluorescent molecule targeting CEACAM5 on the surface of GC cells and assessed its binding properties on patient tissue slices and fragments. <b>Results</b>: in this work, we first identified CEACAM5 as an optimal GC biomarker, and then we developed a fluorescent antibody specific for CEACAM5. We also evaluated its binding specificity for GC cell lines and patient-derived tumor tissue, achieving an optimal ability to discriminate tumor tissue from healthy mucosa. <b>Conclusions</b>: Overall, our results support the development of our fluorescent antibody as a promising tumor-specific imaging agent that, after further in vivo validation, could improve the accuracy of complete tumor resection.

bioRxiv 2025-07-24 Preprint (No Snippets API) Morigaki R, Yoshida T, Fujikawa J, Crittenden JR, Graybiel AM.
Show Full Abstract

The pathogenesis of Huntington’s disease is still incompletely understood, despite the remarkable advances in identifying the molecular effects of the Htt mutation in this disease. When we focus on movement disorders, clinical studies offer us some hints about this issue. Human studies employing positron emission tomography have identified a reduction in phosphodiesterase 10A (PDE10A) as the earliest event in the brain of patients with Huntington’s disease, which occurs about 25 years before symptom onset. A PDE10A mutation is also known to cause childhood-onset chorea. GNAL encodes the olfactory type G-protein α subunit (Gα olf ), strongly expressed in the striatum, and its mutation causes familial dystonia. PDE10A and Gα olf are both critical regulators of cyclic AMP and are abundant in striatal spiny projection neurons. These findings suggest that maintaining cyclic AMP levels in the striatum might be an essential target for the pathogenesis of movement disorders such as chorea and dystonia. Why and how these changes in the striatum cause movement disorder are still a mystery. Here we suggest that a key might be evaluating these messenger systems in light of the circuit-level compartmental organization of the striatum, in which there is particular vulnerability of the striosome compartment. We developed machine learning algorithms to define with high precision and reproducibility the borders of striosomes in the brains of q175 Huntington’s disease model mice from 3-12 months of age. We demonstrate that multiple molecules including Gα olf , PDE10A, dopamine D1 and D2 receptors, adenosine 2A receptors, and mu-opioid receptors differentially change their expression patterns in striosomes across ages by comparison with their expression patterns in the matrix compartment. An early and pronounced differential vulnerability of striosomes has been demonstrated in studies of post-mortem Huntington’s brains. Our findings here, mapping the molecular distributions across age in a widely studied mouse model of Huntington’s disease, may help to pinpoint the pathogenic mechanisms of Huntington’s disease by demonstrating the differential molecular changes in the striosome compartment.

bioRxiv 2025-07-24 Preprint (No Snippets API) Walther T, Dalaka E, Fläschner G, Platzman I, Pashapour S, Emmert M, Roca-Cusachs P, Trepat X, Göpfrich K.
Show Full Abstract

Hydrogel microparticles (HMPs) are powerful tools to study and manipulate cellular behavior in 3D cell culture systems and animal models. Here, fully DNA-based HMPs are presented, whose material properties can be precisely tuned by sequence-programmable design of self-assembling DNA nanostructures. These DNA-HMPs offer control over size, stiffness, viscoelasticity and ligand presentation. They are formed by microfluidic encapsulation of two types of orthogonal DNA nanostars and a sequence-complementary DNA linker in water-in-oil droplets. By varying the valency of the DNA nanostar designs, tunable mechanical properties are achieved – spanning three orders of magnitude in Young’s modulus from 30 Pa to 6.5 kPa with distinct viscoelastic behavior. Click-chemistry based functionalization with the small fibronectin-derived peptide cyclic-RGD (c[RGD]) enables integration into fibroblast spheroids. DNA-HMPs are stably retained within the spheroids for several days and undergo design- and stiffness-dependent remodeling, indicating active interactions between the cells and the DNA-HMPs. Combining tunable material properties and inherent biocompatibility of DNA with straightforward functionalization and stimuli-responsiveness, these DNA-HMPs represent a versatile tool to probe and manipulate tissue behaviors in 3D cell cultures and in vivo models. <h4>Table of Contents</h4> DNA hydrogel microparticles are designed to exhibit controllable viscoelasticity and stiffness across three orders of magnitude from 30 Pa to 6.5 kPa. They are uptaken into fibroblast spheroids where they are actively remodeled by cellular forces depending on their mechanical properties.

bioRxiv 2025-07-24 Preprint (No Snippets API) Pradhan S, Gaikwad S, Tsai C, Smith C, Zhang N, Bush K, Chakraborty A, Yuan S, Choudhary S, Keene CD, Ellerby LM, Hazra TK, La Spada AR, Wairkar YP, Ashizawa T, Tainer JA, Pandita TK, Thompson LM, Sarkar PS.
Show Full Abstract

<h4>SUMMARY</h4> Huntingtin (HTT) function is enigmatic, as the native protein plays critical roles in neuronal health, while mutant HTT (mHTT), carrying an expanded polyglutamine stretch, triggers neurotoxicity and contributes to the pathogenesis of Huntington’s disease (HD). We recently found that HTT is part of a nuclear transcription-coupled DNA repair (TCR) complex with DNA repair enzymes including polynucleotide-kinase-3’-phosphatase (PNKP). This complex resolves DNA lesions during transcription to maintain genome integrity, while in HD, mHTT impairs the activity of this complex, resulting in accumulation of DNA lesions. Using molecular, cellular biology and computational methods, we find that HTT has a role in assembling a functional DNA repair complex in mitochondria. Together with mitochondrial RNA polymerase and transcription factors, HTT resolves mitochondrial DNA lesions to preserve mitochondrial genome integrity and function. Pathogenic mHTT impairs this activity, resulting in persistent DNA lesions and reduced mitochondrial function in HD. Importantly, restoring activity of this complex in a Drosophila HD model through ectopic HTT or PNKP expression significantly improves mitochondrial genome integrity and ameliorates motor deficits. <h4>HIGHLIGHTS</h4> HTT organizes a functional, multifactorial mitochondrial DNA repair complex Mutant HTT impairs the mitochondrial DNA repair complex causing DNA damage accumulation HTT-associated repair complex resolves mitochondrial DNA lesions and DNA integrity Restoring repair activity in HD flies rescues mitochondrial DNA integrity and motor defects

SOX6
Also flagged:pigmentationmelaninopsinschromatinvesiclegene expression
Journal Article 2025-07-23 ✓ 1 Snippet Fatieieva Y, Galimullina R, Isaev S, Klimovich A, Lemaire LA, Adameyko I.
In-Text Gene Mentions

…Tbx1 + ,Sox6+ and others) or…

Show Full Abstract

In vertebrates, two major cell types produce extensive pigmentation: neuroepithelium-derived retinal pigment epithelium (RPE) of the eye and neural crest-derived melanocytes. Both produce melanin, express opsins, and exhibit photosensory functions. However, the evolutionary relationship between these cells - whether pigmentation was coopted or they share a common ancestry - remains unclear. We explore these scenarios including the hypothesis of a shared origin from an ancestral pigmented photosensory structure. For this, we harness single cell transcriptomics, chromatin accessibility and spatial transcriptomics data, to connect the transcriptional programs in melanocytes, pinealocytes and RPE with that of the pigmented cells in the sensory vesicle of the tunicate Ciona. The results reveal common regulatory gene expression modules spanning beyond pigment production, including photoreception, metabolism and biosynthesis. This evidence does not favor a model where pigmentation was coopted into one of these cell types, and rather supports the homology of melanocytes and RPE. Further, phylotranscriptomics approach expose recently-evolved melanocyte-specific and RPE-specific functions, which diversified after these types split from the ancestral cell type. Overall, our results support that melanocytes and RPE evolved from ancestral pigmented photosensory structures in chordates, initiating the origin of the neural crest - a major evolutionary driver of the vertebrate lineage.

Also flagged:CobaltChromiumMolybdenumcancerBacterial infectionbiofilm formation
Journal Article 2025-07-23 No Snippets Bandyopadhyay A, Orozco CL, Upadhayay L, Dash A.
Show Full Abstract

CoCrMo (Cobalt-Chromium-Molybdenum, CCM) alloys offer excellent wear resistance for the articulating surfaces of load-bearing implants. However, cancer-causing cobalt ions may be released <i>in vivo</i> during articulation. Bacterial infection and biofilm formation on the implant surface are also contributing factors to the failure of these implants. Systemic or localized antibiotics are often not effective against such bacterial infections. Naturally, there is a need to design alloys that show inherent bacterial resistance with minimal release of cobalt ions. This study uses a potential biomedical alloy with copper (Cu) to provide inherent bacterial resistance and hydroxyapatite (HA) ceramic to enhance wear resistance by forming a solid lubricating tribofilm. CCM, CCM-3Cu, CCM-3Cu-1HA, and CCM-3Cu-2HA were processed using a laser-based directed energy deposition (L-DED) additive manufacturing (AM) technique. Antibacterial efficacy was evaluated using <i>Pseudomonas aeruginosa</i>, a Gram-negative bacterium, over 48 and 72 h. An extensive tribocorrosion study was conducted in physiologically relevant Dulbecco's Modified Eagle Medium (DMEM) at loads of 5 and 10 N, accompanied by microstructural analysis. Copper exhibits enhanced bacterial resistance, and the addition of HA improves wear resistance while also decreasing cobalt ion release. The wear resistance of CCM-3Cu-2HA showed a 6-fold improvement compared to CCM. These results indicate that HA-reinforced CCM-3Cu alloys are promising for the articulating surfaces of load-bearing implants.

Also flagged:ULK1myeloproliferative neoplasmshematopoiesiskinasehematopoietic stem cell differentiationJAK2
Journal Article 2025-07-23 No Snippets Saleiro D, Wen JQ, Zannikou M, Lee B, Kosciuczuk EM, Nehlsen SD, Munshi A, Chen X, Oku CV, Hryhorysak B, Guillen Magaña JN, Heneche J, Fischietti M, Ilut L, Small SH, Cotton A, Hall T, Payton MA, Beauchamp EM, Yue F, Kocherginsky M, Bartom ET, Hoffman R, Crispino JD, Platanias LC.
Show Full Abstract

Defining the mechanisms that promote development and progression of myeloproliferative neoplasms (MPNs) is important for understanding the mechanisms of malignant hematopoiesis and critical development of new treatment approaches. We provide evidence for a key and essential role of the kinase ULK1 in MPN pathophysiology. Our studies demonstrate that genetic or pharmacological targeting of ULK1 delays substantially disease development in <i>Jak2</i><sup>V617F</sup>-mutant MPN models in vivo and establish that ULK1 activity is required for transcription of genes that control hematopoietic stem cell differentiation. Pharmacological targeting of ULK1 exhibits potent therapeutic effects, resulting in reduction of early stage erythroid progenitors in spleen and bone marrow, decreased levels of hemoglobin, and reduced spleen size in MPN mouse models in vivo. Taken together, these findings provide the first evidence for a novel protumorigenic role for ULK1 downstream of the hyperactive JAK2 signaling in MPNs and raise the potential of ULK1 as a new therapeutic target for the treatment of MPNs.

Also flagged:peptidespeptide hormonesinsulinoxytocinvasopressingonadotropin-releasing hormones
Journal Article 2025-07-23 No Snippets Lombardi L, Genio VD, Albericio F, Williams DR.
Show Full Abstract

Over the past two decades, peptide drug discovery has experienced a remarkable renaissance, with organic chemistry and biotechnology emerging as pivotal tools for developing peptidomimetics that exhibit improved stability, specificity, and bioavailability compared to conventional peptides. This review systematically examines methodologies for modifying peptide backbones to achieve targeted properties, highlighting recent advances facilitated by modern biotechnological innovations for novel molecular transformations. Additionally, the review emphasizes the practical applications of peptides and peptidomimetics, showcasing their successful integration into medicine and pharmacology. This manuscript evaluates achievements and challenges in the field and identifies critical areas for further research. Its overarching aim is to synthesize current knowledge and propose strategic directions for advancing peptide-based therapeutics.

Also flagged:synthesisHDACnorborneneprostate cancerHDACitumour
Journal Article 2025-07-23 No Snippets Mathew J, Mishra A, Le TN, Liou JP, Lai MJ, Rao Neralla V.
Show Full Abstract

This study investigated the incorporation of C5, a pan-HDAC inhibitor, into a norbornene-derived block copolymer with pH-sensitive hydrolysis (PNEG-b-P(Nor-PABA-C5)) to generate NPs for prostate cancer treatment. Amphiphilic PNEG-b-P(Nor-PABA-C5) formed NPs in aqueous environments, with hydrophobic Nor-PABA-C5 monomers in the core and hydrophilic PNEG monomers on the surface. DLS analysis showed a particle size of 122 ± 12 nm with a PDI of 0.35, confirmed by SEM and TEM. TEM imaging revealed spherical morphology, enabling the NPs to transport hydrophobic pan-HDACi drugs to PC-3 tumour sites and facilitate release through hydrolysis under acidic conditions. The NPs exhibited pH-hydrolysis characteristics, with enhanced drug release (61 ± 1.7%) at pH 6.2 compared to pH 7.4 (35 ± 0.8%). MTT assay confirmed antiproliferative effect. Analysis of FITC/(PNEG-b-P(Nor-PABA-C5)) cellular uptake showed increased absorption in prostate tumours. Live/dead cell assays showed loss of viability, with increased red fluorescence and morphological disruption at higher concentrations over 48 and 72 h.

Also flagged:food allergyasthmaADEczemaAtopic dermatitissleep
Journal Article 2025-07-23 No Snippets Simpson EL, Michaels LC, Ramsey K, Fagnan LJ, Nease DE, Henningfield M, Dolor RJ, Lapidus J, Martinez-Ziegenfuss X, Vu A, Ferrara L, Zuckerman KE, Morris CD, Williams HC, CASCADE Consortium.
Show Full Abstract

<h4>Importance</h4>Atopic dermatitis (AD) imposes a global health burden for children and is a risk factor for developing food allergy and asthma. Few studies have evaluated emollient intervention for primary AD prevention in infants not selected for risk.<h4>Objective</h4>To determine whether emollient intervention in infants not selected for risk reduces AD incidence by age 24 months.<h4>Design, setting, and participants</h4>A randomized, decentralized pragmatic clinical trial was conducted that involving 1247 infant-parent dyads recruited from 25 community-based pediatric and family medicine clinics that are members of 4 statewide practice-based research networks. Participants were recruited from July 2018 to February 2021, with follow-up completed through February 2023.<h4>Intervention</h4>Dyads were randomized to 1 of 2 groups: a daily full-body emollient application daily moisturizer group starting by age 9 weeks or a control group that refrained from emollient use.<h4>Main outcomes and measures</h4>The primary outcome was physician-diagnosed AD recorded in the patient's medical record by age 24 months. Participants completed quarterly electronic surveys to report adverse events and alert the team if an AD diagnosis had been made. Trained research coordinators abstracted participants' medical records.<h4>Results</h4>Of 1247 infants, 553 (44.3%) were female, and the mean (SD) age at randomization was 23.9 (16.3) days. At 24 months, the cumulative incidence of AD was 36.1% (SE, 2.1) in the daily moisturizer group and 43.0% (SE 2.1) in the control group, with a relative risk (RR) of 0.84 (95% CI, 0.73-0.97; P = .02), and the magnitude of effect was larger in the population not at high risk of AD (RR, 0.75; 95% CI, 0.60-0.90; P = .01). The protective effect was significantly modified by the presence of a dog in the home (RR, 0.68; 95% CI, 0.50-0.90; P = .01). There were no between-group differences in cutaneous adverse events.<h4>Conclusions and relevance</h4>This randomized clinical trial found that daily emollient application beginning before age 9 weeks in a representative US population not selected for risk reduced the cumulative incidence of AD at age 24 months. Implementing this approach to pediatric skin care may be a feasible way to reduce the burden of AD in US communities.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT03409367.

Also flagged:infectious diseasesacute respiratory infectioninfectionsSevere Acute Respiratory SyndromeCoronavirus disease 2019COVID-19
Journal Article 2025-07-23 No Snippets Pollett SD, Colombo RE, Richard SA, Lalani T, Barton B, Malloy A, Fries A, Parmelee E, Merritt S, Fritschlanski M, Mitre EE, Laing ED, Pratt K, Garges EC, Mende K, Simons M, Agan B, Tribble D, O'Connell R, Burgess TH.
Show Full Abstract

<h4>Background</h4>Acute respiratory infections (ARI) are a major cause of morbidity and lost workdays in both military and non-military populations. To better understand these infections and their outcomes, the Infectious Diseases Clinical Research Program has enabled nine major ARI clinical research protocols in the last decade, including observational studies and trials, spanning emerging and reemerging ARI threats including Severe Acute Respiratory Syndrome Coronavirus 2, influenza, adenovirus, entero/rhinovirus, human metapneumovirus, respiratory syncytial virus, and other pathogens. These protocols have resulted in epidemiological, clinical and laboratory data and biospecimens from over 26,000 participants, most of whom were beneficiaries of a geographically distributed Military Health System.<h4>Methods</h4>The Acute Respiratory Infection Repository Protocol establishes a unique Department of Defense (DoD) research resource through the pooling of data and specimens from nine ARI protocols into a master, standardized database with a linked specimen repository. This will enable further targeted scientific questions in participant-level pooled meta-analyses and will serve as an on-demand repository for rapid assay development, sample size estimations for prospective studies, and observational study/clinical trial design (including as part of future rapid pandemic research response). Accordingly, the objectives and study design of this protocol are broad. This protocol will allow analyses on outcomes including: (i) short-term ARI outcomes such as hospitalization, work days lost, symptom severity and duration; (ii) post-acute ARI outcomes, including persistence of symptoms, return-to-health, post-ARI medical encounters; (iii) vaccine effectiveness for Coronavirus disease 2019 (COVID-19), influenza, and adenovirus vaccines; (iv) ARI infection and vaccination elicited immune responses (humoral, T-cell, other); (v) therapeutic effectiveness of COVID-19 and influenza antivirals (acute symptoms, hospitalization, post-acute sequelae); (vi) effectiveness of non-pharmaceutical interventions (e.g., masking) against infection; (vii) prognostic and mechanistic host viral biomarkers which correlate with the above outcomes; (viii) ARI diagnostic assay validity and performance. This repository protocol is inherently broad in scope; the collation of standardized data and phenotype-linked specimens is a fundamental, primary objective.<h4>Discussion</h4>This protocol will support statistical and laboratory analyses, including activities related to rapid epidemic response such as assay development and rapid sample size calculations for clinical trials. A series of more specific scientific questions from current and future collaborators will leverage this joint database and specimen repository; these questions will target important aspects of ARI infection, transmission, outcomes, and treatment. Future protocols (and ongoing data from existing IDCRP protocols) will be added to this collaborative repository protocol.

HFE
Also flagged:Hepatic steatosislipidchronic) infectionliver diseasesteatosis
Journal Article 2025-07-23 ✓ 1 Snippet Torgersen J, Newcomb CW, Carbonari DM, Smith SM, Brecker KL, Rajapakse CS, Jones BC, Cottrell C, Grewal R, Price JC, Baker JF, Kostman JR, Trooskin S, Hubbard RA, Zemel BS, Leonard MB, Lo Re Iii V.
In-Text Gene Mentions

…B virus infection,hemochromatosis, α-1-antitrypsin, autoimmune …

Show Full Abstract

<h4>Background</h4>Chronic hepatitis C virus (HCV) infection may influence cytokine and insulin-like growth factor (IGF-1) levels, which could contribute to increased hepatic steatosis. We utilized MRI to compare three-dimensional volumetric liver fat fraction by chronic HCV status and evaluated associations between liver fat fraction and inflammatory cytokines and IGF-1.<h4>Methods</h4>Participants with untreated, non-genotype 3 chronic HCV and participants without HCV were enrolled between 2019-2022 and underwent MRI to quantify three-dimensional volumetric liver fat fraction. Interleukin (IL)-6, IL-18, tumor necrosis factor (TNF)-α, and IGF-1 were also measured. Multivariable linear regression was used to determine associations between liver fat fraction, chronic HCV, and cytokine and IGF-1 levels.<h4>Results</h4>Among 54 participants with HCV and 54 without HCV, median volumetric liver fat fraction was 12.4% (IQR: 9.3, 18.0%) and 10.9% (IQR: 8.7, 13.3%), respectively. After adjustment for age, sex, and body mass index, mean liver fat fraction was 2.28% (95% CI: 0.55, 4.02%) higher in participants with HCV. HCV was associated with higher mean log TNF-α (0.11 [95% CI: 0.06, 0.16]) and IL-18 (0.14 [95% CI: 0.05, 0.24]), but lower mean log IGF-1 (-0.18 [95% CI: -0.26, -0.11]) when compared to those without HCV. IL-6, IL-18, TNF-α, and IGF-1 were not associated with liver fat fraction.<h4>Conclusion</h4>Chronic HCV is associated with higher volumetric liver fat fraction by MRI. TNF-α and IL-18 levels were higher with chronic HCV but were not associated with liver fat fraction. Further research is needed to identify alternative mechanisms that potentiate liver fat deposition in chronic HCV.

Genetic history of Scythia.

HFE
Also flagged:Ironfructoseintolerancefructose intoleranceobesityendocrine disorders
Journal Article 2025-07-23 ✓ 3 Snippets Andreeva TV, Soshkina AD, Gusev FE, Malyarchuk AB, Dotsenko GS, Dudko NA, Plotnikova MY, Kunizheva SS, Manakhov AD, Ustkachkintseva TV, Protasova MS, Volodin SA, Buzhilova AP, Razuvaev YD, Berezina NY, Berezin YB, Kantorovich AR, Maslov VE, Barinov DG, Dobrovolskaya MV, Rogaev EI.
In-Text Gene Mentions

…variant in theHFEgene.…

…linked to clinicalhemochromatosiswith reduced penetrance…

…the characteristics ofhemochromatosis( 44 ).…

Show Full Abstract

Great Scythia was the ancient Greek name for the area stretching from the northern Black Sea coast to the Middle Don. Using high-quality genomic data generated from 131 ancient individuals from Great Scythia and neighboring regions of the Bronze Age and the Iron Age, we established the genetic structure of the Scythians, revealing their diverse origin with major European Bronze Age ancestral components, and genetic traces of migration and invasions. We uncovered relationships between Scythians, including elite Scythians. Substantial endogamy in the Scythian clan was found. We examined Scythians' phenotypes and medical-genetic background and found a harmful gene mutation causing fructose intolerance. This ancient "Scythian" mutation has spread throughout West Eurasia and has become the most prevalent genetic cause of fructose intolerance in contemporary European populations.

RABGAP1L
Also flagged:SLAMF1CD4Mycobacterium tuberculosis infectionoxygeninfectionadaptive immunity
Journal Article 2025-07-23 ✓ 2 Snippets Krishna Prasad GVR, Grigsby SJ, Erkenswick GA, Portal-Celhay C, Mittal E, Yang G, Fallon SM, Chen F, Klevorn T, Jain N, Li Y, Mitreva M, Martinot AJ, Ernst JD, Philips JA.
In-Text Gene Mentions

…( Slamf1 andRabgap1l) (Fig. 1H…

…markedly upregulated thanRabgap1l.…

Show Full Abstract

CD4+ T cells are crucial for protective immunity to intracellular pathogens. In addition to secreting cytokines, CD4+ T cells promote control of Mycobacterium tuberculosis infection through cognate interactions with macrophages, but the mechanism has been unclear. Here, we show that SLAMF1/CD150 is highly and uniquely induced in macrophages by antigen-specific interactions with CD4+ T cells. In macrophages, SLAMF1 enhances the generation of reactive oxygen species and restricts Mtb replication. Mtb-infection of mice promotes SLAMF1 expression specifically on infected macrophages, not uninfected bystanders. SLAMF1 expression depends on adaptive immunity and also autophagy. Moreover, Slamf1<sup>-/-</sup> mice have higher Mtb burden and more rapid disease progression than wild type mice. Using Slamf1<sup>fl/fl</sup> conditional knock-out mice, we show that in vivo Slamf1 is specifically required in macrophages to restrict mycobacterial growth and limit IL-1β production. In macaques, macrophage SLAMFI expression also correlates with T cell responses and protection. Combined, these data demonstrate that SLAMF1 is a marker of macrophage-T cells interactions, and it promotes protection against Mtb.

SOX6
Also flagged:Dravet syndromeneurodevelopmental disordercognitive impairmentsSCN1Atranscription factorssevere myoclonic epilepsy of infancy
Journal Article 2025-07-23 ✓ 1 Snippet Luginbühl J, Prabhu AV, Yip CW, Ando Y, Leon J, Yasuzawa K, Hon CC, Moody J, Roudnicky F, Kremer T, Shin JW.
In-Text Gene Mentions

…NPY, SST, andSOX6in DS neurons,…

Show Full Abstract

Dravet syndrome (DS) is a severe neurodevelopmental disorder associated with physical and cognitive impairments, often attributed to mutations in the SCN1A gene. However, gene regulatory features that modulate SCN1A expression found in vivo and in vitro models remain elusive. This study elucidates cell type-specific cis-regulatory elements (CRE) regulating SCN1A expression in cortical fast-spiking GABAergic inhibitory interneurons, the predominantly affected cell type in DS. We establish a differentiation protocol from human induced pluripotent stem cells (iPSCs) for both healthy control and DS patient-derived lines, followed by single-cell 5' RNA-seq at different stages of interneuron maturation. Through this analysis, we identify interneuron-enriched transcriptional start sites (TSSs) in cell type-restricted promoters regulated by a distinct set of transcription factors. Furthermore, we investigate SCN1A anti-sense (AS) transcripts and emphasize the importance of accurate 5' gene annotation in the context of developing targeted gene therapeutics. This work highlights the complexities and dynamics of studying DS at the molecular level and the need for comprehensive gene regulation analysis in vitro and ex vivo to enable precision medicine therapeutic approaches for DS.

HFE
Also flagged:alcoholalcohol use disorderalcohol use disordersstrokeacute kidney failureurinary tract infections
Journal Article 2025-07-23 ✓ 1 Snippet Petr F, Jan H, Jiri W, Adam K, Kristyna K, Dariusz G, David P.
In-Text Gene Mentions

…diseases, such ashemochromatosis, viral hepatitis, Wilson’s…

Show Full Abstract

<h4>Purpose</h4>Alcohol use disorder (AUD) is a medical condition characterized by an impaired ability to stop or control alcohol consumption despite adverse social, occupational, or health consequences. The aim of the study is to evaluate the outcomes of shoulder joint replacement in traumatic conditions in patients with AUD and compare them with the results of the control group.<h4>Methods</h4>We evaluated the outcomes of hemiarthroplasty and reverse shoulder arthroplasty divided into subgroups (AUD and control). The study includes a total of 238 patients with an average follow-up of 8 years. Clinical evaluation included the Constant Shoulder Score (CSS), abduction of the arm and pain. The results were statistically evaluated.<h4>Results</h4>We found no significant differences between the hemi-control and hemi-abusus groups in either measurement (CSS: p = 0.312, Cohen's d = 0.262; abduction: p = 0.771, Cohen's d = 0.073) or between the reverse-control and reverse-abusus groups in the abduction parameter (p = 0.394, Cohen's d = 0.153). However, a significant difference was observed in the CSS parameter within the reverse group (p = 0.015, Cohen's d = 0.447). Additionally, we identified a higher incidence of postoperative complications in patients with AUD for both implant types (hemi group: χ²(1) = 7.11, p = 0.0077; reverse group: χ²(1) = 11.25, p = 0.00080).<h4>Conclusions</h4>In this prospective study, we demonstrated the negative effect of alcohol use on the outcomes and function of shoulder joint replacements in cases of traumatic indications. The negative impact was observed following both hemiarthroplasty and reverse shoulder arthroplasty implantation. In both groups, a higher number of complications were recorded in patients with AUD.

Also flagged:Sepsisfailureinfectionseptic shockmetabolismpediatric sepsis
Journal Article 2025-07-23 No Snippets Fan S, Liu X, Zhao Z, Liu Y, Jiang Y, Zeng S.
Show Full Abstract

<h4>Background</h4>Current sepsis biomarkers have limitations, but mass spectrometry-based proteomics can identify patients at high risk of mortality or organ dysfunction, identify the molecular mechanisms of pediatric sepsis, and reveal personalized biomarkers and therapeutic strategies, with high-risk cohorts benefiting from early and accurate identification through clinical biomarkers.<h4>Methods</h4>The young mice were randomly divided into sepsis and sham groups(D0), and then the plasma was dissected at D0, Day 1(D1), Day 3(D3), and Day 7(D7) after surgery for additional protein identification by liquid chromatography-mass spectrometry (LC/MS) proteomics. Subsequently, data from 66 cases of children diagnosed with sepsis upon admission to Pediatric Intensive Care Unit at Hunan Provincial People's Hospital and The First Affiliated Hospital of Hunan Normal University were gathered. Dynamic plasma samples (D1, D3, D7) were obtained for ELISA verification and correlation analysis of the candidate biomarkers to determine the clinical significance of sepsis candidate plasma biomarkers.<h4>Results</h4>Among the 6578 proteins identified, the septic mice groups (D1, D3, D7) demonstrated 161 differently upregulated plasma proteins. The main enriched pathways in the KEGG study were related to complement and coagulation cascades, focal adhesion, and phagosomes. ELISA test results indicated that among pediatric patients, the five candidate biomarkers (AT III, CFD, Col1α1, EGFR, Thbs1) all showed varying degrees of decrease in diagnosing sepsis. Correlation study results suggested that AT III was adversely linked with IgA, IgG, IgM, C3, with Pearson's coefficients of -0.543, -0.217, -0.526, -0.128, respectively. CFD was positively connected with IgA, IgG, IgM, and negatively correlated with C3. Col1α1, CFD, EGFR, and Thbs1 demonstrated negative correlation with suppressive CD8 + cells, while Col1α1, EGFR, and Thbs1 showed positive correlation with B cells (CD19 +). Furthermore, Col1α1, CFD, EGFR, and Thbs1 revealed positive connection with CD4 + /CD8 + . Additionally, AT III demonstrated positive connection with PT, APTT, INR, D-Dimer, and Fbg. Conversely, Col1α1 and EGFR showed negative association with PT, APTT, INR, D-Dimer, and Fbg. CFD was positively correlated with Fbg, and Thbs1 showed positive correlation with D-Dimer.<h4>Conclusion</h4>Within 1 week of sepsis onset, 161 proteins revealed alterations in young mice, with the complement and coagulation cascades, focal adhesion, and phagosome pathways showing the most significant correlations. All prospective markers reduced following the recognition of sepsis and were associated with coagulation and immunological function in pediatric patients.

HTT
Also flagged:Huntington's diseaseHDneurodegenerative disordercognitive declinedeathpolyglutamine
Journal Article 2025-07-23 ✓ 5 Snippets Podvin S, Rosenthal B, Mosier C, Wei E, Fisch KM, Hook V.
In-Text Gene Mentions

…of the mutantHTTgene results in…

…of the huntingtin (HTT) protein.…

…MutantHTTprotein with expanded…

…twelve clusters ofHTTinteracting proteins of…

…whether these identifiedHTTinteracting proteins, observed…

Show Full Abstract

BackgroundHuman Huntington's disease (HD) is a genetic neurodegenerative disorder caused by the mutant <i>HTT</i> gene containing CAG repeat expansions, resulting in motor dysfunction and behavioral deficits. CAG repeats of 40-53 occur in adult HD and 60-120 repeats occur in early onset juvenile HD, differing from the normal range of 5-35 repeats.ObjectiveThe <i>HTT</i> gene is translated to the huntingtin (HTT) protein that interacts with proteins in the development of HD. There have been few studies of HTT protein interactors in human HD brain. Therefore, this study evaluated the hypothesis that dysregulation of HTT protein interactors occurs in human juvenile HD brains.MethodsThe strategy of this study was to analyze proteomic data of human juvenile HD brain putamen and cortex regions for dysregulation of HTT interacting proteins, using a database that we compiled of HTT interactors identified in HD model systems from yeast to HD mice.ResultsResults showed significant dysregulation of HTT protein interactors of mitochondria, signal transduction, RNA splicing, chromatin organization, translation, membrane trafficking, endocytosis, vesicle, protein modification, granule membrane, and macroautophagy pathways. The majority of downregulated and upregulated HTT interactors occurred in the putamen region compared to cortex. Dysregulation displayed downregulation of mitochondria and signal transduction interactors, combined with upregulation of RNA splicing, chromatin organization, and translational interactors. Network analysis revealed interactions among clusters of HTT interactors.ConclusionsThese findings demonstrate prevalent dysregulation of HTT protein interactors in human juvenile HD brain, especially in the putamen region that controls movement deficits in HD.

Also flagged:cell proliferationpolyacrylamidehistidinewaterpairingmembrane
Journal Article 2025-07-23 No Snippets Wu H, Fang J, Chen J, Wang Y, Zheng B.
Show Full Abstract

Protein display technology enables high-throughput screening and plays an important role in protein discovery and engineering. Conventional <i>in vivo</i> display methods face challenges such as inefficient gene transformation and complex cell proliferation dynamics, while <i>in vitro</i> display methods are often limited to affinity-based selection and suffer from expression bias due to homogeneous reaction conditions. Here, we present a hydrogel particle-based protein display method enabled by particle-templated emulsification. This approach uses functionalized polyacrylamide hydrogel particles as isolated microreactors, incorporating DNA primers for genotype immobilization and Ni-NTA groups for capturing histidine-tagged protein phenotypes. Displayed proteins are synthesized <i>via</i> cell-free protein expression within isolated droplets, overcoming the limitations of <i>in vivo</i> cell culture and enabling compartmentalized screening, which is challenging in conventional homogeneous <i>in vitro</i> systems. Using particle-templated emulsification, single hydrogel particles can be rapidly encapsulated with individual DNA templates into isolated water-in-oil droplets within 30 seconds, without the need for specialized instrumentation. Up to 10<sup>9</sup> particles can be emulsified in a standard 50 ml conical tube. Compared to conventional droplet microfluidics, particle-templated emulsification achieves higher single-particle encapsulation and improved one-to-one particle-DNA pairing efficiency, reducing reagent consumption and minimizing DNA library loss caused by improper pairing. Digital PCR and cell-free protein expression are sequentially performed within droplets, with both the amplified DNA and the expressed protein immobilized on the same particle, thereby establishing a stable genotype-phenotype linkage. This method eliminates the need for cell handling, enables compartmentalized functional screening, and provides a fast, scalable, and user-friendly workflow for protein display, offering strong potential in directed evolution and protein engineering.

Also flagged:CLN2TPP1neuronal ceroid lipofuscinosis type 2outer retinal degenerationvisionsubunit C
Journal Article 2025-07-23 No Snippets Corti S, Kim KH, Chen T, Botezatu A, Cora V, Ma K, Pashkovskaia N, Bernal Vergara A, Sperlich D, Dave K, Tolone A, Reddinger RM, Tully CB, Higgins M, Kleger A, Breunig M, Lopatta P, Wingerter S, Cipriano M, Bolz S, Ueffing M, Buss N, Loskill P, Liebau S, Achberger K.
Show Full Abstract

Mutations in the tripeptidyl peptidase 1 (TPP1) gene lead to neuronal ceroid lipofuscinosis type 2 (CLN2), characterized by lysosomal accumulation of lipofuscins predominantly in the brain and retina. The ocular phenotype is characterized by outer retinal degeneration that leads to vision loss. Leveraging human induced pluripotent stem cell (hiPSC)-derived retinal organoids (ROs), retinal pigmented epithelial cells, and the retina-on-chip system, we establish an in vitro CLN2 model that recreates the principal histological hallmarks, namely the accumulation of subunit C of mitochondrial ATP synthase (SCMAS) and lipids mainly in the outer retina. Furthermore, single-cell RNA sequencing reveals a dysregulation of translational and mitochondrial function in CLN2 cones. Finally, adeno-associated virus (AAV)-mediated TPP1 gene therapy can restore TPP1 expression and decrease and even prevent SCMAS accumulations. Our study uses an innovative human-relevant microphysiological retinal disease models, uncovers previously uncharacterized mechanisms of CLN2 pathophysiology, and demonstrates the potential of AAV9.hCLN2 gene therapy for CLN2 disease, potentially treating patient blindness.

Also flagged:Zinc FingerLipidHuntington's DiseaseHuntingtinHDcytosine
Journal Article 2025-07-23 No Snippets Iwanowicz A, Boudi A, Seeley C, Sapp E, Miller R, Liu S, Chase K, Shing K, Batista AR, Siena-Esteves M, Aronin N, DiFiglia M, Kegel-Gleason KB.
Show Full Abstract

Reducing the burden of mutant Huntingtin (mHTT) protein in brain cells is a strategy for treating Huntington's disease (HD). However, it is still unclear what pathological changes can be reproducibly reversed by mHTT lowering and whether these changes can be measured in peripheral biofluids. We previously found that lipid changes that occur in brain with HD progression could be prevented by attenuating HTT transcription of the mutant allele in a genetic mouse model (LacQ140) with inducible whole body lowering. Here, we tested whether intrastriatal injection of a therapeutic capable of repressing the mutant <i>HTT</i> allele with expanded cytosine-adenine-guanine (CAG) can provide similar protection against lipid changes in HD mice with a deletion of neo cassette (zQ175DN). Wild-type or zQ175DN mice were injected with adeno-associated virus 9 (AAV9) bearing a cDNA for a zinc finger protein (ZFP), which preferentially targets mutant HTT (ZFP-HTT) to repress transcription. Proteins from brain tissues were analyzed using western blot, capillary electrophoresis, and nitrocellulose filtration methods. Lipid analyses of brain tissue and plasma collected from the same mice were conducted by liquid chromatography and mass spectrometry (LC-MS). Somatic instability index was assessed using capillary gel electrophoresis of PCR products and was shown to be impeded by ZFP-HTT. Lowering mHTT levels by 43% for 4 months prevented loss of total lipid content including the subclasses sphingomyelin, ceramide, phosphatidylethanolamine and others of caudate-putamen in zQ175DN mice. Moreover, LC-MS analysis of plasma demonstrated total lipid increases and lipid changes in monogalactosyl monoacylglyceride and certain phosphatidylcholine species were reversed with the therapy. In summary, our data demonstrate that analyzing lipid signatures of brain tissue and peripheral biofluids are valuable approaches for evaluating potential therapies in a preclinical model of HD.

SERPINC1
Also flagged:hepatomasecretiontriglyceridelipoproteinscholesterolhypercholesterolemia
Journal Article 2025-07-23 ✓ 1 Snippet Valmiki S, Rosario S, Mooring A, Prakashmurthy C, Schlamp F, Prakash B, Chattopadhyay A, Ansari A, Alemán JO, Pamir N, Hussain MM.
In-Text Gene Mentions

…and anti-thrombin III (SERPINC1) in Ako cells.…

Show Full Abstract

ApoB is an essential structural protein for the assembly and secretion of triglyceride-rich lipoproteins and therefore remains a potential target to lower plasma cholesterol levels in hypercholesterolemia patients. To understand the global consequences of APOB gene deficiency, we employed CRISPR-Cas9 system to generate apoB-deficient human hepatoma Huh-7 cells (Ako cells). ApoB was not detectable in the cells and media of the Ako cells. ApoB deficiency had no effect on microsomal triglyceride transfer protein expression and activity. These cells supported apoB48 secretion when transfected with plasmids for the expression of apoB48 suggesting that these cells retain all the lipoprotein assembly and secretion machinery except for apoB expression. APOB gene deficiency had no significant effect on cellular lipid levels, cell growth, and ER stress markers. Proteome analysis of secreted proteins revealed that the most upregulated protein was the vitamin D binding protein, while the most downregulated protein was apoB in Ako cells compared to control cells. This analysis also identified coagulation as an upregulated pathway. Total RNA transcriptome analysis identified DNA replication and complement and coagulation pathways as the most upregulated pathways in Ako cells. Further detailed studies are needed to establish how apoB regulates these pathways. These Ako cells may be useful in studying structure-function analysis of apoB peptides and to address the cellular consequences of disruptions in lipoprotein assembly and secretion.

HTT
Also flagged:genetic diseasesDMPKdevelopmental delayautism spectrum disorderintellectual disabilitygene expression
Journal Article 2025-07-23 ✓ 1 Snippet Xu S, Luo X, Xiao B, Liu H, Xu T, Chen L, Yang T, Xu N, Fan Y, Qiu W, Wang R, Zhang H, Chen Y, Yu Y, Sun Y.
In-Text Gene Mentions

HTT

Show Full Abstract

Short tandem repeats (STRs) are associated with 70 genetic diseases. Because of the short read length of exome sequencing (ES), STR analysis is not routinely analyzed in clinical ES. So far, there has been limited systematic evaluation using large-scale clinical ES data to assess the diagnostic yield of pathogenic STR expansion. This study retrospectively analyzed 9580 exomes referred to our genetic laboratory between July 2019 and June 2024. The samples were divided into two groups: a genetically undiagnosed cohort (n = 4692) and a reference cohort with a low probability of carrying pathogenic STR expansions (n = 4888). An analysis pipeline was developed on the basis of the combination of multiple algorithms to analyze STRs detected in 30 known disease-related loci, achieving a precision of 54.9% and a sensitivity of 100%. STR verification by capillary electrophoresis analysis of STR confirmed 28 cases (0.6%) with pathogenic STR expansions in known disease-related loci. Fourteen of these cases (0.3%) could be explained by the STR findings, including seven neonates with DMPK expansions. The pipeline showed the potential to identity abnormal STR expansions at novel sites. In conclusion, this study demonstrates the clinical utility of ES-based STR analysis and advocates for its incorporation into the clinical ES workflow in genetic laboratories.

SERPINC1
Also flagged:Fatal Liver FailureAcute Necrotizing HepatitisHerpesvirusdisseminated infectionshepatitis
Journal Article 2025-07-23 ✓ 1 Snippet Rösner T, Grenz J, Schaumäker M, Cuntz S, Blank N, Charbel A, Flechtenmacher C, Michl P, Pfeiffenberger J, Boxberger M, Mohr I.
In-Text Gene Mentions

…(pTT) 41 s,antithrombin-III-activity 60%, fibrinogen 1.0…

Show Full Abstract

Herpes simplex virus (HSV) infections are common in the European population, typically presenting with mucocutaneous and anogenital manifestations. However, disseminated infections and organ involvement are rare, usually occurring in immunocompromised individuals, particularly after hematopoietic stem cell or solid organ transplantation. HSV1/2-induced hepatitis is infrequent but can result in acute liver failure (ALF) and increased mortality. We present a case of fulminant ALF caused by disseminated primary HSV2 infection in a fifty-year-old male with rheumatoid arthritis treated with the JAK-inhibitor upadacitinib for 3 months prior to presentation. Clinical examination revealed severe oropharyngeal mucositis and hepatic encephalopathy. Initial laboratory results showed bicytopenia, significantly elevated transaminases, bilirubin, inflammatory markers, and severe coagulopathy. Empirical treatment with an antimicrobial regimen, intravenous aciclovir, acetylcysteine, and plasmapheresis (PPH) was initiated. The patient was listed for urgent liver transplantation based on King's College criteria. Further investigations revealed a high viral load of HSV2 DNA in the blood, and transjugular liver biopsy confirmed extensive liver necrosis with positive HSV staining. Despite antiviral therapy, the HSV2 viral load remained high, indicating resistance, and the patient was deemed "nontransplantable" due to clinical deterioration with progressive hepatic coma, hemorrhagic-septic shock, multiorgan failure, and secondary bowel ischemia, ultimately leading to the patient's death from refractory shock. This is only the second documented case of fulminant ALF due to HSV2 hepatitis in a patient undergoing JAK inhibition, and the first involving upadacitinib. It highlights the importance of considering primary herpesvirus infection as a potential cause of ALF, particularly in immunocompromised patients, and underscores the need for early antiviral intervention to improve outcomes.

Also flagged:egg-layingprogesteronegonadotropin-releasing hormoneTGF-βWntMAPK
Journal Article 2025-07-23 No Snippets Zhang J, Cao X, Zhang H, Tang H, Jiang Y, Wei Q, Kang L.
Show Full Abstract

Sexual maturity is a pivotal reproductive trait in laying hens because it is directly related to egg production. The age at first egg is a definitive indicator of sexual maturity attainment in laying hens. Most Chinese indigenous chicken breeds exhibit a late onset of lay, significantly affecting their egg-laying performance. The Jining Bairi chicken, with its unique precocious sexual maturity (approximately 100 days of age at first lay), is an ideal model for deciphering the molecular mechanisms of avian sexual precocity. In this study, hypothalamic and ovarian tissues were systematically collected from Jining Bairi chickens at three developmental stages: 60 days (60 d), 100 days (100 d), and 140 days (140 d) of age. The 140 d cohort consisted of three non-laying (designated 140a) and three laying hens (designated 140b) for RNA-seq-based transcriptomic profiling and cross-tissue regulatory network construction. Bioinformatics approaches, including temporal expression clustering, protein-protein interaction networks, Venn analysis, and weighted gene co-expression network analysis, were employed to identify key genes and elucidate potential molecular regulatory networks governing sexual maturity differences. Results revealed significant enrichment of core reproductive pathways, including progesterone-mediated oocyte maturation, oocyte meiosis, gonadotropin-releasing hormone signaling, TGF-β signaling, Wnt signaling, and MAPK signaling pathways. Furthermore, pathways potentially implicated in sexual maturation regulation included FoxO signaling pathway, Toll-like receptor signaling pathway, mTOR signaling pathway, neuroactive ligand-receptor interaction, apelin signaling pathway, and necroptosis. Notably, neuroactive ligand-receptor interaction, apelin signaling pathway, and necroptosis were involved in regulating sexual maturation in chickens. Integrative screening revealed NPY4R, GALR1L, GRIN2C, POLR1B, ITGB3, ALDH18A1, PPP1R26, HTR1B, GABRA6, TSHB, APLNR, APELA, and GSL as hub genes contributing to phenotypic divergence between pre- and post-sexual maturity stages in chickens. These findings systematically delineate the molecular network underpinning sexual maturation through coordinated actions of hub genes and their associated signaling cascades.

LRRC7
Also flagged:Synapsestomembranecytoskeletal proteinssynaptopathiesneurological disorders
Journal Article 2025-07-23 ✓ 1 Snippet Matsubayashi J, Takano T.
In-Text Gene Mentions

…disrupted interactions betweenDensin-180and PP1α (…

Show Full Abstract

Synapses are fundamental units of neurotransmission and play a central role in the formation and function of neural circuits. These dynamic structures exhibit morphological and functional plasticity in response to experience and activity, supporting higher brain functions such as learning, memory, and emotion. Their molecular composition includes diverse membrane-associated and cytoskeletal proteins that mediate intercellular signaling, regulate synaptic plasticity, and maintain structural stability. Disruptions in these protein networks, often referred to as synaptopathies, are closely linked to psychiatric and neurological disorders. Such disruptions commonly manifest as region-specific changes in synapse number, morphology, or signaling efficacy. Although a large number of synaptic proteins have been identified through conventional proteomic approaches, our understanding of synaptic specificity and plasticity remains limited. This is primarily due to insufficient spatial resolution, lack of cell-type specificity, and challenges in applying these methods to intact neural circuits <i>in vivo</i>. Recent advances in proximity labeling techniques such as BioID and APEX can spatial proteomics limiting cell compartments and cell-type. BioID also enables proteomic analysis within synaptic compartments under both physiological and pathological conditions <i>in vivo</i>. These technologies allow unbiased, high-resolution profiling of protein networks in specific synapse types, synaptic clefts, and glial-neuronal interfaces, thereby providing new insights into the molecular basis of synaptic diversity and function. In this short review, we summarize recent developments in synaptic proteomics enabled by proximity labeling. We also discuss how these approaches have advanced our understanding of synapse-specific molecular architecture and their potential to inform the mechanisms of synapse-related brain disorders, as well as the development of targeted diagnostic and therapeutic strategies.

PRDX6
Also flagged:celastrolPRDX1cancercancerstumoroxygen
Journal Article 2025-07-23 ✓ 1 Snippet Guan L, Geng Y, Wang Y, Niu MM, Shi K.
In-Text Gene Mentions

…2-Cys); and iii)PRDX6(1-Cys) ( Ding…

Show Full Abstract

<h4>Background</h4>Peroxiredoxin 1 (PRDX1) is an antioxidant enzyme overexpressed in several cancers that protects tumor cells from oxidative damage by scavenging excess reactive oxygen species making it a potential strategy for cancer therapy.<h4>Methods</h4>In this study, a multi-step screening strategy combining molecular docking, enzyme inhibition assay, enzyme kinetic studies, molecular dynamics (MD) simulations, MST assays, MTT assays and <i>in vivo</i> toxicity assay was used to discover PRDX1 inhibitors.<h4>Results</h4>Five compounds (CPs 1-5) targeting PRDX1 were identified through molecular docking screening. CPs 1-5 showed significant PRDX1 inhibition at the nanomolar level. Among them, CP1 exhibited the most potent inhibitory activity (IC<sub>50</sub> = 0.08 ± 0.01 nM) and high selectivity against PRDX1. The kinetic study showed that CP1 acted as noncompetitive PRDX1 inhibitor. MD simulations confirmed the stability of the CP1-PRDX1 complex. MST assays revealed that CP1 displayed a significant binding affinity for PRDX1 (<i>K</i> <sub>d</sub> = 0.06 ± 0.001 nM). Importantly, CP1 exhibited significant antiproliferative effects on A549, HepG2 and MCF-7 tumor cells without toxicity to other normal cells. Meanwhile, CP1 did not exhibit significant hepatotoxicity or renal toxicity in mice.<h4>Conclusion</h4>The results suggest that CP1 is a promising antitumor candidate for cancer therapy and merits further investigation.

Also flagged:Colorectal cancercancerstumortranslationalpathogenesiscancer
Journal Article 2025-07-23 No Snippets Lin H, Zhou J, He Y, Zhu Y, Chen P, Yan H, Huang J, Gong E, Wang X.
Show Full Abstract

Colorectal cancer (CRC) represents a highly common gastrointestinal malignancy ranking among the top three most frequently diagnosed cancers in the digestive system. The disease's high mortality rate makes treatment particularly difficult. As a result, thorough research into the cause and effective treatment of CRC is especially crucial. The macrophage's remarkable functional flexibility, as a cell with strong immunological effects, allows it to demonstrate both anti-tumor and tumor-inducing activities. MicroRNAs (miRNAs), functioning as short non-protein-coding RNAs, mediate post-transcriptional regulation through mRNA destabilization and translational suppression, and they play a unique function in macrophage formation, polarization processes, and anti-inflammatory activity. Elucidating the crosstalk between miRNA-mediated gene regulation and macrophage functional polarization in CRC pathogenesis constitutes a critical research priority. We first provide a brief overview of the epidemiological of CRC, systematically summarising the origin of macrophages, their physiological functions, and their potential pathogenic mechanisms in colorectal carcinogenesis. Subsequently, we elaborated in depth on the critical role of miRNAs in regulating macrophage polarisation status. Ultimately, this paper comprehensively explores the mechanistic involvement of miRNA-macrophage interactions in CRC progression.

PRDX6
Also flagged:extracellularmetabolismwound healingsecretionmatrix metalloproteinasesMMP1
Journal Article 2025-07-23 ✓ 1 Snippet Song S, Xiang R, Chen S, Wu J, Chen W, Li X.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6).…

Show Full Abstract

<h4>Background</h4>Effective skin repair requires rapid wound closure accompanied by precise extracellular matrix (ECM) remodeling and balanced cellular metabolism. Saliva-derived exosomes (S-Exo) have emerged as promising therapeutic agents due to their rich bioactive components; however, their mechanisms in ECM remodeling and metabolic regulation remain unclear. This study aimed to elucidate how S-Exo modulate ECM turnover through metabolic reprogramming, particularly glycolysis, in human skin fibroblasts (HSFs), and identify critical exosomal molecules mediating these effects.<h4>Methods</h4>S-Exo were isolated and characterized. A rat full-thickness skin defect model and <i>in vitro</i> assays with human skin fibroblasts and HaCaT keratinocytes were employed to evaluate S-Exo effects on wound closure, ECM remodeling, and cellular metabolism. Transcriptomic profiling of wound tissues, targeted metabolomic analysis of fibroblasts, and proteomic evaluation of S-Exo cargo were performed to explore underlying mechanisms. Metabolic interventions further confirmed the contribution of metabolic modulation to S-Exo-mediated wound healing.<h4>Results</h4>S-Exo significantly accelerated wound healing by enhancing fibroblast viability, migration, and ECM remodeling, characterized by elevated secretion of matrix metalloproteinases (MMP1 and MMP3). Transcriptomic, metabolomic, and proteomic analyses revealed that S-Exo robustly activated key metabolic pathways, particularly glycolysis, reflected by increased expression of glycolytic genes (e.g., GLUT1, HK2, PFKM) and enhanced glycolytic flux in fibroblasts. Remarkably, S-Exo were found to carry nearly all enzymes involved in glycolysis, indicating an underlying enzyme-transfer mechanism for sustained metabolic modulation. Importantly, glycolytic activity positively correlated with MMP secretion, and inhibition of glycolysis significantly reduced MMP production, highlighting glycolysis as a crucial regulator of ECM remodeling.<h4>Conclusion</h4>Saliva-derived exosomes promote wound healing by potentially modulating fibroblast metabolism via exosome-associated glycolytic enzymes, enhancing glycolytic flux, and thereby regulating ECM remodeling via increased MMP secretion. These findings provide novel insights into metabolism-targeted exosome therapies for wound healing.

Also flagged:Inflammatory Bowel Diseaseulcerative colitisimmune responsesoxygenpro-inflammatory cytokinesextracellular
Journal Article 2025-07-23 No Snippets Ortega-Zapero M, Gomez-Bris R, Pascual-Laguna I, Saez A, Gonzalez-Granado JM.
Show Full Abstract

Inflammatory Bowel Disease (IBD), which includes ulcerative colitis (UC) and Crohn's disease (CD), results from dysregulated immune responses that drive chronic intestinal inflammation. Neutrophils, as key effectors of the innate immune system, contribute to IBD through multiple mechanisms, including the release of reactive oxygen species (ROS), pro-inflammatory cytokines, and neutrophil extracellular traps (NETs). NETs are web-like structures composed of DNA, histones, and associated proteins including proteolytic enzymes and antimicrobial peptides. NET formation is increased in IBD and has a context-dependent role; under controlled conditions, NETs support antimicrobial defense and tissue repair, whereas excessive or dysregulated NETosis contributes to epithelial injury, barrier disruption, microbial imbalance, and thrombotic risk. This review examines the roles of neutrophils and NETs in IBD. We summarize recent single-cell and spatial-omics studies that reveal extensive neutrophil heterogeneity in the inflamed gut. We then address the dual role of neutrophils in promoting tissue damage-through cytokine release, immune cell recruitment, ROS production, and NET formation-and in supporting microbial clearance and mucosal healing. We also analyze the molecular mechanisms regulating NETosis, as well as the pathways involved in NET degradation and clearance. Focus is given to the ways in which NETs disrupt the epithelial barrier, remodel the extracellular matrix, contribute to thrombosis, and influence the gut microbiota. Finally, we discuss emerging therapeutic strategies aimed at restoring NET homeostasis-such as PAD4 inhibitors, NADPH oxidase and ROS pathway modulators, and DNase I-while emphasizing the need to preserve antimicrobial host defenses. Understanding neutrophil heterogeneity and NET-related functions may facilitate the development of new therapies and biomarkers for IBD, requiring improved detection tools and integrated multi-omics and clinical data.

Also flagged:UnnaturalAmino AcidMechanosensitive ion channelsOSCA1.2membranelipid
Journal Article 2025-07-23 No Snippets Duran-Morales S, Reyes-Lizana R, Fernández G, Loncon-Pavez M, Duarte Y, Marquez-Miranda V, Diaz-Franulic I.
Show Full Abstract

Mechanosensitive ion channels such as OSCA1.2 enable cells to sense and respond to mechanical forces by translating membrane tension into ionic flux. While lipid rearrangement in the inter-subunit cleft has been proposed as a key activation mechanism, the contributions of other domains to OSCA gating remain unresolved. Here, we combined the genetic encoding of the photoactivatable crosslinker p-benzoyl-L-phenylalanine (BzF) with functional Ca<sup>2+</sup> imaging and molecular dynamics simulations to dissect the roles of specific residues in OSCA1.2 gating. Targeted UV-induced crosslinking at positions F22, H236, and R343 locked the channel in a non-conducting state, indicating their functional relevance. Structural analysis revealed that these residues are strategically positioned: F22 interacts with lipids near the activation gate, H236 lines the lipid-filled cavity, and R343 forms cross-subunit contacts. Together, these results support a model in which mechanical gating involves a distributed network of residues across multiple channel regions, allosterically converging on the activation gate. This study expands our understanding of mechanotransduction by revealing how distant structural elements contribute to force sensing in OSCA channels.

ZNFX1
Also flagged:mycobacterial diseaseMSMDIL-12IFN-γinfectionsviral infections
Journal Article 2025-07-23 ✓ 1 Snippet Cornelissen H, Glanzmann B, van Coller A, Glashoff R, Goda R, Abdelmajeed O, Erwa N, Esser M.
In-Text Gene Mentions

…in STAT1, IRF8,ZNFX1, TYK2, JAK1, ISG15,…

Show Full Abstract

<h4>Background</h4>Mendelian susceptibility to mycobacterial disease (MSMD) is a rare inborn error of immunity caused by defects in IL-12 or IFN-γ signaling pathways, essential for intracellular pathogen control. While classically linked to nontuberculous mycobacteria, MSMD also predisposes to bacterial, fungal, and viral infections.<h4>Objective</h4>We sought to provide a practical framework for diagnosing and managing MSMD in African settings. Recommendations integrate clinical evaluation, baseline immunologic testing, and molecular diagnostics.<h4>Methods</h4>A review of clinical presentation, diagnostic strategies, and therapeutic approaches was conducted, emphasizing applicability in resource-limited environments.<h4>Results</h4>MSMD presents across a wide clinical spectrum that includes severe disseminated early-onset infections and localized later-onset disease. While classically characterized by increased susceptibility to nontuberculous mycobacteria, MSMD also predisposes to bacterial, fungal, and viral infections. Standard immunologic screening often yields unremarkable findings, necessitating a tiered diagnostic approach that includes molecular testing for confirmation. Long-term antimicrobial therapy remains the cornerstone of management, with prophylaxis warranted in recurrent or severe cases. Early identification significantly reduces morbidity and mortality. Molecular diagnostic methods facilitate genotype-guided management, enabling precision medicine approaches in this context.<h4>Conclusion</h4>Timely recognition of MSMD, particularly in tuberculosis-endemic settings, is critical to prevent severe disease progression. A structured diagnostic algorithm, combined with molecular testing and individualized treatment strategies, enhances outcomes. MSMD underscores the significance of genotype-driven management.

CA10
Also flagged:methylationbladder cancercancercell proliferationcell cycletumor
Journal Article 2025-07-23 ✓ 5 Snippets Mo Q, Lu Y, Wu J, Zhang X.
In-Text Gene Mentions

…DNA methylation ofCA10regulates the proliferation…

…the role ofCA10gene DNA methylation…

…hylation significantly reducesCA10expression in tumor…

…ethylation-driven silencing ofCA10as a key…

…Notably,CA10emerged as one…

Show Full Abstract

This study investigated the role of <i>CA10</i> gene DNA methylation in bladder cancer progression, revealing that hypermethylation significantly reduces <i>CA10</i> expression in tumor tissues compared to adjacent tissues. Utilizing TCGA data analysis with the ChAMP package for DMPs/DMRs, alongside qRT-PCR/semiquantitative RT-PCR for methylation and expression validation, researchers found that treatment with the demethylating agent 5-Aza-dC restored <i>CA10</i> expression. Functional assays (flow cytometry, MTT, transwell) demonstrated that this restoration inhibited cancer cell proliferation, migration, and cell cycle progression. Furthermore, <i>in vivo</i> tumor xenograft models confirmed <i>CA10</i>'s tumor-suppressive role and the efficacy of epigenetic therapy in inhibiting tumor growth. The study identifies DNA methylation-driven silencing of <i>CA10</i> as a key mechanism in bladder carcinogenesis and highlights its broader diagnostic potential across cancers.

Also flagged:gene expressionorganizationtumorstumorcancerlung cancer
Journal Article 2025-07-23 No Snippets Higgins C, Li JJ, Carey M.
Show Full Abstract

Recent advancements in spatial transcriptomics (ST) technologies allow researchers to simultaneously measure RNA expression levels for hundreds to thousands of genes while preserving spatial information within tissues, providing critical insights into spatial gene expression patterns, tissue organization, and gene functionality. However, existing methods for clustering spatially variable genes (SVGs) into co-expression modules often fail to detect rare or unique spatial expression patterns. To address this, we present spatial transcriptomics iterative hierarchical clustering (stIHC), a novel method for clustering SVGs into co-expression modules, representing groups of genes with shared spatial expression patterns. Through three simulations and applications to ST datasets from technologies such as 10x Visium, 10x Xenium, and Spatial Transcriptomics, stIHC outperforms clustering approaches used by popular SVG detection methods, including SPARK, SPARK-X, MERINGUE, and SpatialDE. Gene ontology enrichment analysis confirms that genes within each module share consistent biological functions, supporting the functional relevance of spatial co-expression. Robust across technologies with varying gene numbers and spatial resolution, stIHC provides a powerful tool for decoding the spatial organization of gene expression and the functional structure of complex tissues.

bioRxiv 2025-07-23 Preprint (No Snippets API) Verani M, Martufi P, Petricca L, Caricasole A, Spiezia MC, Larsson O, Tomei L, Fodale V, Munoz-Sanjuan I, Vogt TF, Dominguez C, Doherty EM, Lee R, Cariulo C.
Show Full Abstract

Huntington’s disease (HD) is a progressive neurodegenerative disease caused by the pathologic expansion of a CAG repeat in the first exon of the huntingtin ( HTT ) gene, resulting in a huntingtin (HTT) protein with an expanded polyglutamine (polyQ) tract. Phosphorylation at residue S421 (pS421) is one of the post-translational modifications proposed to influence the biology of wild-type and mutant (m)HTT, such as HTT stability and clearance, HTT subcellular localization, mHTT toxicity, and regulation of HTT function in axonal transport. However, the detection and quantification of S421-HTT phosphorylation in relevant biological contexts have remained challenging and the consequences of pS421 in HD pathogenesis remains unclear. Here we report the development of a novel ultrasensitive immunoassay enabling the specific and sensitive detection of pS421-HTT in a variety of biologically relevant contexts. With this assay we conducted a longitudinal assessment of pS421 levels in tissues from a mouse model of HD to investigate the relationship between S421 phosphorylation and phenotypic progression. We also identified PRKACA, the cAMP-regulated catalytic α subunit of PKA, as a kinase capable of phosphorylating S421-HTT, demonstrating its ability to regulate endogenous pS421 in human cells. Finally, we exploited the sensitivity of the assay to detect endogenous pS421-HTT in cerebrospinal fluid (CSF) from nonhuman primates, showing for the first time that phosphorylation at S421-HTT can be detected in this bio-fluid. These reagents and assay will enable investigation of the biological consequence and the relevance of pS421 in the natural history of HD.

HTT
Also flagged:gene-expressionorganizationbrain developmentgene expressiony-aminobutyric acid receptorGABA A R
Journal Article 2025-07-22 ✓ 2 Snippets Ecker C, Pretzsch CM, Leyhausen J, Berg LM, Gurr C, Seelemeyer H, McAlonan G, Puts NA, Loth E, Dell'Aqua F, Mason L, Charman T, Oakley B, Bourgeron T, Beckmann C, Buitelaar JK, Arango C, Banaschewski T, Chiocchetti AG, Freitag CM, Hattingen E, Krueger-Burg D, Schmeisser MJ, Repple J, Reif A, Murphy DG.
In-Text Gene Mentions

…the 5-HT transporter (5-HTT) 15 .…

…the 5-HT transporter (5-HTT), which is predominantly…

Show Full Abstract

Imaging transcriptomics has become a power tool for linking imaging-derived phenotypes (IDPs) to genomic mechanisms. Yet, its potential for guiding CNS drug discovery remains underexplored. Here, utilizing spatially-dense representations of the human brain transcriptome, we present an analytical framework for the transcriptomic decoding of high-resolution surface-based neuroimaging patterns, and for linking IDPs to the transcriptomic landscape of complex neurotransmission systems in vivo. Leveraging publicly available Positron Emission Tomography (PET) data, we initially validated our approach against molecular targets with a high correspondence between gene expression and protein binding. Subsequently, we used the cortical gene expression profiles of candidate genes to dissect two discrete classes of GABA<sub>A</sub>-receptor subunits, each characterized by a distinct cortical expression pattern, and to link these to specific behavioural symptoms and traits. Our approach thus represents a future avenue for in vivo pharmacotranscriptomics that may guide the development of targeted pharmacotherapies and personalized interventions.

TNFSF4
Also flagged:LARS2methylationColon cancersolid tumortumorstumor
Journal Article 2025-07-22 ✓ 1 Snippet Fu Y, Xie W, Ren Q, Wu J, Long Y, Liu Y.
In-Text Gene Mentions

…of CXCL10, CXCL9,TNFSF4, IFNG, VEGFA, CCL5,…

Show Full Abstract

Colon cancer is a highly aggressive solid tumor. Because most studies have focused on the intrinsic oncogenic pathways of tumors, we focused on the relationship between DNA methylation genes in the tumor immune microenvironment and colon cancer prognosis. We download RNA-seq data from the TCGA dataset. DNA methylation genes were scored using the GSVA method, and this score was subjected to GSEA, GO and KEGG enrichment analysis. Then, in vitro experiments examined the effect of silencing LARS2 on the proliferation and apoptosis of HCT116 cells. We obtained 2635 genes, 144 were obtained after single factor screening, and 8 genes were obtained through random forest dimensionality reduction. They are LARS2, TEX2, BRIP1, QSOX2, HOOK1, COX19, NEK4 and STXBP4. Survival analysis indicated that patients with high Riskscore had poor prognosis. There were significant differences in the expression of DNA methylation genes between the two groups with high and low Riskscore. The immune checkpoints of different Riskscore groups include Antigen present, Ligand, Receptor, Co-inhibitor, Co-stimulator, Other, and Cell adhesion. There were significant differences in the expression of genes and DNA integrity checkpoint, histone deacetylation, mitotic DNA damage checkpoint, TGF-beta signaling pathway, Platinum drug resistance and Protein processing in endoplasmic reticlum pathway at the level of Antigen present. Silencing of LARS2 decreased the proliferative capacity and increased the apoptosis rate of HCT116. Our findings suggest that LARS2 methylation could affects colon cancer development.

HFE
Also flagged:DysfunctionSteatotic Liver DiseaseHepatocellular Carcinomaalcoholtype 2 diabetes mellitushepatic steatosis
Journal Article 2025-07-22 ✓ 1 Snippet Cho SH, Kim G, Lee KN, Oh R, Kim JY, Jang M, Lee YB, Jin SM, Hur KY, Han K, Kim JH.
In-Text Gene Mentions

…abscess (K75.0, A06.4),hemochromatosis(E83.1), Wilson’s disease…

Show Full Abstract

<h4>Backgruound</h4>We investigated the incidence rates of hepatocellular carcinoma (HCC) in metabolic dysfunction-associated steatotic liver disease (MASLD) categories, focusing on its association with alcohol consumption in patients with type 2 diabetes mellitus (T2DM).<h4>Methods</h4>This study included 2,418,858 patients with T2DM aged 20 years and older who underwent a health examination between 2009 and 2012. Participants were categorized into five groups according to hepatic steatosis, cardiometabolic risk factors, other liver diseases, and alcohol consumption. Hepatic steatosis was defined as the fatty liver index ≥30. Cox regression analysis was used to analyze the association between steatotic liver disease and development of HCC.<h4>Results</h4>The MASLD group showed a higher risk of HCC development regardless of alcohol consumption or presence of other liver diseases (adjusted hazard ratio [aHR], 1.38; 95% confidence interval [CI], 1.33 to 1.44). The MASLD with other combined group expressed the highest risk (aHR, 5.02; 95% CI, 4.79 to 5.27). In the metabolic dysfunction and alcohol-related steatotic liver disease and alcohol-related liver disease groups, heavy to excessive alcohol consumption increased the risk of HCC development, with a higher risk associated with greater alcohol intake (aHR, 2.40; 95% CI, 2.27 to 2.53 and aHR, 3.16; 95% CI, 2.93 to 3.41). Fine and Gray analysis also exhibited a consistent trend.<h4>Conclusion</h4>MASLD in patients with T2DM was associated with an increased risk of developing HCC, particularly when accompanied by other liver diseases. Moreover, alcohol consumption proportionally increased the risk of HCC with the amount of alcohol consumed.

PCDH17
Also flagged:FAM20AAI1Gsecretionnephrocalcinosisgingival fibromatosisgene expression
Journal Article 2025-07-22 ✓ 1 Snippet Sriwattanapong K, Thaweesapphithak S, Khamwachirapitak C, Sae-Ear P, Prommanee S, Sa-Ard-Iam N, Phothichailert S, Jung HS, Shotelersuk V, Porntaveetus T.
In-Text Gene Mentions

…However,PCDH17expression showed no…

Show Full Abstract

Amelogenesis imperfecta type 1G (AI1G), also known as Enamel-Renal-Gingival Syndrome (ERGS), is an autosomal recessive disorder caused by variants in FAM20A, encoding a Golgi apparatus protein crucial for protein processing and secretion. AI1G presents with enamel defects, nephrocalcinosis and gingival overgrowth. Building upon our previous findings demonstrating the impact of FAM20A insufficiency on deciduous dental pulp cells, this study investigated the molecular mechanisms underlying gingival fibromatosis in AI1G. RNA sequencing of gingival fibroblasts from an AI1G patient revealed widespread differential gene expression (DEG). Gene Ontology (GO) analysis demonstrated enrichment of DEGs in biological processes related to cell adhesion, differentiation, proliferation (including positive regulation and cell division), cell cycle regulation, apoptosis and signal transduction. Pathway analysis (Reactome and KEGG) further highlighted the dysregulation of signalling pathways, including Wnt, TGF-β, cell cycle, DNA replication, Rho GTPase signalling and extracellular matrix organisation. Functional assays confirmed these findings, revealing delayed initial attachment and spreading, impaired osteogenic differentiation (evidenced by reduced mineralization and downregulation of DLX5, OCN, RUNX2 and OPN), enhanced cell cycle progression and proliferation (increased colony size and proliferation rates, along with a shift from G0/G1 to G2/M phase) and suppressed apoptosis in FAM20A-insufficient fibroblasts. These results suggest that FAM20A plays a critical role in regulating fundamental processes in gingival fibroblasts, and its insufficiency contributes to the gingival fibromatosis phenotype observed in AI1G through the disruption of cell adhesion, differentiation, proliferation and apoptosis. This study proposes novel insights into the pathogenesis of AI1G and highlights potential therapeutic targets for this complex disorder.

SERPINC1
Also flagged:cancerimmunoglobulincardiovascular diseaseGlycansGolgi apparatusdisorders of glycosylation
Journal Article 2025-07-22 ✓ 4 Snippets Lin EB, Meregini S, Zhang Z, Roy A, Argula T, Mitchell JM, Israelsen WJ, Ludwig S, Russell J, Quan J, Hildebrand S, Nair-Gill E, Beutler B, SoRelle JA.
In-Text Gene Mentions

…ELISA kits, includingATIII(Biotang Inc.), insulin…

…also known asATIII; protein C, inactivator…

…(ALT) and decreasedATIIIand IGF-1 (…

…such as decreasedATIIIand IGF-1 (…

Show Full Abstract

Glycans are one of the 4 major macromolecules essential for life and are the most abundant family of organic molecules. However, in contrast with DNA and RNA, glycan structures have no template; this results in limited tools to study this challenging macromolecule with a diversity of glycan structures. A central bottleneck in studying glycosylation in vivo is that inhibitors and complete KOs are lethal. In a forward genetic screen, we identified a viable, hypomorphic mutation at a conserved site in mannose phosphate isomerase (Mpi) that causes a multisystemic phenotype affecting RBCs, liver, stomach, intestines, skin, size, fat, and fluid balance in mice. The phenotype could be rescued with mannose. Analyses of glycopeptides in mice with this mutation showed a 500% increase in unoccupied N-glycan sites. This is equivalent to a "glycan knockdown," which would be useful for examining the role of glycans in biology and disease. Therefore, we report an in vivo tool to study global N-glycosylation deficiency with tissue-specific targeting and a rescue mechanism with mannose.

HTT
Also flagged:infectionanxietydepressionmemory impairmentinnate immunitysynapses
Journal Article 2025-07-22 ✓ 1 Snippet Coleon A, Larrous F, Kergoat L, Tichit M, Hardy D, Obadia T, Kornobis E, Bourhy H, de Melo GD.
In-Text Gene Mentions

…expression of ATXN1,HTT, KIF5A, LRRK2 (…

Show Full Abstract

Following infection with SARS-CoV-2, patients may experience with one or more symptoms that appear or persist over time. Neurological symptoms associated with long COVID include anxiety, depression, and memory impairment. However, the exact underlying mechanisms are not yet fully understood. Using golden hamsters as a model, we provide further evidence that SARS-CoV-2 is neuroinvasive and can persistently infect the brain, as viral RNA and replicative virus are detected in the brainstem 80 days after the initial infection. Infected hamsters exhibit a neurodegenerative signature in the brainstem, characterized by overexpression of innate immunity genes, and altered expression of genes involved in the dopaminergic and glutamatergic synapses, in energy metabolism, and in proteostasis. These infected animals exhibit persistent depression-like behavior, impaired short-term memory, and late-onset signs of anxiety. Finally, we provide evidence that viral and immunometabolic mechanisms coexist in the brainstem of SARS-CoV-2-infected hamsters, contributing to the manifestation of neuropsychiatric and cognitive symptoms.

HTT
Also flagged:metabolismwaterextracellularneurotransmitter receptortransportercognition
Journal Article 2025-07-22 ✓ 2 Snippets Sadikov A, Choi HL, Xiao J, Cai LT, Mukherjee P.
In-Text Gene Mentions

…the concentration of5-HTT, D1, DAT, NMDA,…

…fugal areas, including5-HTT, 5-HT1a, cholinergic, dopamin…

Show Full Abstract

Despite advances in diffusion MRI, which have led to remarkable progress in mapping white matter of the living human brain, our understanding of cerebral cortical microstructure in vivo and its relationship to macrostructure, myeloarchitecture, cytoarchitecture, chemoarchitecture, metabolism, and function lag far behind. We present neuromaps of 21 microstructural metrics derived from diffusion tensor, diffusion kurtosis, mean apparent propagator, and neurite orientation dispersion and density imaging of the young adult cerebral cortex. These 21 metrics are explained by four composite factors that correspond to diffusion kurtosis (intracellular volume fraction/neurite density), isotropic diffusion (free water fraction), heterogenous diffusion (extracellular volume fraction) and diffusion anisotropy (neurite orientation dispersion). We demonstrate how cortical microstructure follows cytoarchitectural and laminar differentiation, aligns with the macroscale sensory-fugal and sensorimotor-association axes, and contributes to functional brain networks, neural oscillatory dynamics, neurotransmitter receptor/transporter distributions, and cognition and behavior.

BTN2A2
Also flagged:gliomaautophagyfocal adhesionneuroactive ligandreceptorPTEN
Journal Article 2025-07-22 ✓ 1 Snippet Wan M, Zhuang C, Li W, Yan R, Chen W, Cheng J, Yue C, Chen L, Quan Y.
In-Text Gene Mentions

…(including BTN3A1 andBTN2A2) in the high…

Show Full Abstract

Previous studies majorly focused on the role of driver gene variation in the occurrence, development and treatment of glioma. Here, we revealed the effect of signaling pathway abnormality by accumulated genetic mutations on patient survival and explored potential mechanism in glioma. We found that abnormalities of three signaling pathways, including autophagy-animal, focal adhesion and neuroactive ligand-receptor interaction, were associated with progression-free survival (PFS) in glioma. Based on the three pathways, we constructed and validated a biological pathway score (BPS) model to predict patient prognosis. Both PFS and overall survival (OS) were poorer in glioma patients with high BPS. In the glioma patients with high BPS, mutation frequencies of PTEN, TTN and EGFR were significantly increased. Immune checkpoints (PD-1, PD-L1 and TIM-3) were strikingly expressed in the high BPS patients with glioma, despite observed high levels of infiltrating immune cells. Differential expression genes in the high BPS patients were enriched in proliferation-related pathways. These results revealed potential reasons of poor prognosis in the high BPS patients with glioma. In addition, we found that low BPS patients with glioma might benefit from sevoflurane during surgery anesthesia. Overall, this study exhibited that the abnormalities of PFS-related signaling pathways by genetic mutations impacted survival of patients and revealed potential mechanism of poor PFS in glioma.

OLFM4
Also flagged:immune responsetumorcolorectal cancerimmune responsesadenomasgene expression
Journal Article 2025-07-22 ✓ 1 Snippet Bagley E, Seal S, Fanning LR, Anoma JS, Crawford T, Vincent BG, Barry EL, Shrubsole MJ, Kirk E, Baron JA, Snover DC, Lewin DN, Mackenzie TA, Gao X, Troester MA, Alekseyenko AV, Wallace K.
In-Text Gene Mentions

…, ITLN1 ,OLFM4, SELENBP1 ).…

Show Full Abstract

<h4>Background</h4>Immune expression profiling in colorectal lesions may provide insights into the origins of antitumor immunity and senescence. Optimal approaches for analyzing samples with lower quality RNA from molecularly diverse lesions are lacking. Therefore, we developed a NanoString nCounter-based approach for quality control (QC), normalization, and differential expression (DE) analysis, optimized for FFPE samples in contexts of high biologic heterogeneity.<h4>Methods</h4>The approach incorporates a colon specific positive control gene set (11 genes) to minimize sample exclusions. We evaluated three normalization methods Removal of Unwanted Variation (RUVg), NanoStringDiff (NSDiff), and nSolver using a 277 gene immune panel to compare 100 samples, including sessile serrated lesions (SSLs) (n = 25), tubulovillous and villous adenomas (TVs) (n = 27), and tubular adenomas (TAs) (n = 48) We assessed Type I error rates, computational efficiency, and gene significance via FDR-corrected q-values.<h4>Results</h4>Incorporating the colon-specific QC set reduced sample exclusions by 63% compared to standard methods (13 vs. 35 sample exclusions). All three normalization approaches identified DE genes between SSLs and TAs (e.g., TFF1, MUC5AC, MUC6). For TVs vs. TAs, only RUVg and NSDiff detected significant DE genes, revealing wide-spread under-expression of innate and adaptive genes. While NSDiff labeled twice as many significant genes as RUVg, suggesting greater sensitivity, it also exhibited higher Type I error rates and increased computational demand.<h4>Conclusions</h4>RUVg achieved a balance between computational efficiency and low Type I error, while NSDiff was more sensitive but computationally demanding and exhibited higher Type I error. Our approach provides a robust framework for profiling immune genes in heterogeneous lesions.

ZNF644
Also flagged:Radiation-induced pulmonary fibrosiscancersepithelial-mesenchymal transitionpathogenesistranscription factorsgraphene
Journal Article 2025-07-22 ✓ 1 Snippet Hou Y, Zhou S, Wang P, Wang D, Liu Y, Ao X, Liang X, Zhu J, Yan Z, Liu X, Zhou L, Chen H, Zeng Y, Gu Y.
In-Text Gene Mentions

…USF1, RUNX1T1, WIZ,ZNF644, NFATC3, CEBPA, TFAP2C,…

Show Full Abstract

Radiation-induced pulmonary fibrosis (RIPF) constitutes a significant complication in radiotherapy for various cancers, often severely limiting its efficacy. Recent studies suggest that epithelial-mesenchymal transition (EMT) plays a vital role in the pathogenesis of RIPF. Elucidating the involvement of microRNAs (miRNAs) in EMT could provide valuable insights into the mechanisms underlying RIPF and potentially reveal therapeutic targets. In this study, twelve dishes of BEAS-2B cells were irradiated with 6 Gy <sup>60</sup>Co γ-rays, and RNA was extracted at 0, 6, and 48 h after irradiation. High-throughput sequencing analysis of miRNA samples revealed miRNA significant changes in the BEAS-2B cells after irradiation, which was verified by RT-PCR. Additionally, the upstream transcription factors (TFs) were predicted through graphene oxide-based analysis. Transcription factors regulate the expression and transcriptional levels of miRNAs, and their functions may be associated with inflammatory or oxidative stress responses. The functional roles of these TFs were characterized through gene ontology (GO) analysis. Overall, we successfully screened and identified a set of miRNAs associated with ionizing radiation-induced EMT in lung epithelial cells and performed predictive identification of their upstream TFs and downstream regulatory target proteins. These data provide a firm foundation for future studies of the mechanism of radiation-induced EMT processes and related changes in biological function.

TNFSF4HFE
Also flagged:inflammatory bowel diseaseTNFCrohn's diseaseulcerative colitisimmune responses5‐aminosalicylates
Journal Article 2025-07-22 ✓ 2 Snippets Askari M, Ghavami SB, Fatemi N, Haghipanah M, Kazemifard N, Aghdaei HA, Cheraghpour M, Mahdizadeh H, Shahrokh S, Totonchi M.
In-Text Gene Mentions

…rs2071303 in geneHFEand response to…

…status in theTNFSF4gene with various…

Show Full Abstract

<h4>Background</h4>A major characterization of inflammatory bowel disease (IBD) is significant heterogeneity in treatment responses. Despite the increase in therapeutic agents, discovering an optimal patient-level treatment is still a major milestone. This study aims to provide a systematic review of the existing literature on the predictive biomarkers of the response to IBD treatment.<h4>Methods</h4>On April 15, 2025, a literature search was conducted using the PubMed and Scopus databases, as well as a manual search. Controlled trials, case-control studies, cross-sectional studies, and cohort studies addressing predictive biomarkers for treatment response in adults with IBD were eligible for inclusion. The CASP tool was used to assess the quality of the methodologies employed in the included research. Due to a lack of information and expected heterogeneity, a qualitative study was planned instead of a quantitative one.<h4>Results</h4>Of the 7570 identified articles, 31 met the inclusion criteria. DNA markers were assessed as predictive biomarkers. The majority of studies attempted to predict the response to anti-TNF drugs. There is significant variability across studies in both the definition of response and the considered biomarkers.<h4>Conclusions</h4>At the moment, no biomarker provides sufficient predictive ability for clinical practice. Thus, we are still in the early stages of the quest for predictive biomarkers, and existing literature is lacking. Future studies should address the large heterogeneity among patients within prospective trials by conducting objective response evaluations. Prediction models are likely to be developed by combining multiple molecular markers from integrated omics levels and clinical characteristics.

DCC
Also flagged:CCKbehavioralcholecystokininpeptideB20peptides
Journal Article 2025-07-22 ✓ 1 Snippet Zhang G, Ding XY, Romanova EV, Liu CP, Barry MA, Doda A, Chen QX, Reaver C, Jin QC, Rubakhin SS, Li F, Jin YF, Kan YS, Liu YL, Guo SQ, Xue YY, Mei YS, Fu P, Xu JP, Mao RT, Liu CY, Zhang YC, Zhang YL, Chang JH, Wu SQ, Wang HY, Liu WJ, Chen P, Zhou Z, Zhou HB, Yu Q, Checco JW, Sweedler JV, Cropper EC, Jing J.
In-Text Gene Mentions

…repurified with aDCCkit.…

Show Full Abstract

Transitions from hunger to satiety involve multiple behavioral changes, including modulation and inhibition of feeding behavior. In mammals, cholecystokinin (CCK) is a key satiety peptide implicated in these processes; however, whether and how CCK might induce satiety via synaptic and intrinsic plasticity remains unclear. Here, we investigate CCK-type signaling in the protostome mollusk Aplysia californica. We demonstrate that Aplysia CCK (apCCK) acts as a conserved brain-gut peptide. Gut-localized apCCK-expressing neurons project centrally and release apCCK near the feeding-pattern generator. In vivo, apCCK suppresses food intake, while in vitro, it shifts motor output toward egestive patterns and inhibits feeding programs. Mechanistically, apCCK modulates the excitability of the egestive-promoting B20 interneuron and suppresses synaptic input to protraction-phase motoneurons, thereby altering program selection and inhibiting feeding-program generation. These findings highlight the importance of both synaptic and intrinsic plasticity in specific circuit elements for implementing motivational shifts driven by satiety signaling.

RC3H1MLLT10
Also flagged:KMT2Aacute myeloid leukemiaAMLMLLT3ELLAFDN
Journal Article 2025-07-22 ✓ 5 Snippets Petersen LM, Sainger R, Sanchez P, Burke J, Wemmer JD, Patay B, Miller JE.
In-Text Gene Mentions

…ELL , AFDN,MLLT10, and AFF1…

…( MYB ,RC3H1, SNAPC3 ,…

…42 MYB ,RC3H1, SNAPC3 ,…

…fusions, KMT2A ::RC3H1, KMT2A ::…

…, AFDN ,MLLT10, and AFF1…

Show Full Abstract

KMT2A fusions are a critical oncogenic driver in 5% to 10% of patients with acute myeloid leukemia (AML) and are associated with poor prognosis. Currently, there are no published somatic guidelines for fusions in AML, and developing methods to accurately classify fusions, especially those involving KMT2A, is essential for patient care. Therefore, the Laboratory for Personalized Molecular Medicine (LabPMM) KMT2A Fusions Workflow was developed utilizing the framework of the somatic guidelines by Horak et al, where classification of oncogenicity is based on points awarded for varying types of evidence. Fusions previously detected by LabPMM's CAP/CLIA-certified MyAML and MyMRD gene panels were used to test this workflow. A total of 100 KMT2A fusions were reassessed, and 97 of these had a breakpoint in the major breakpoint cluster region. There were 20 distinct partner genes for KMT2A, and the most common partners were MLLT3, ELL, AFDN, MLLT10, and AFF1. Five KMT2A fusions had a novel partner (MYB, RC3H1, SNAPC3, STPG1, and HPSE2). Breakpoints in the partner genes were assessed to better understand their potential role in driving leukemogenesis. Of the 100 fusions reassessed, 9 had a classification change. This LabPMM KMT2A Fusions Workflow provides a points-based system for curation that allows for standardization and clarity both within and among genetic diagnostic laboratories reporting on KMT2A fusions in AML.

VRK2
Also flagged:BANF1host proteinbarrier-to-autointegration factor 1cytoplasmiccGASSTING
Journal Article 2025-07-22 ✓ 1 Snippet Dupré J, Dolata KM, Pei G, Molouki A, Goatley LC, Küchler R, Soh TK, Bosse JB, Fablet A, Le Dimna M, Karadjian G, Hirchaud E, Netherton CL, Dixon LK, Reis AL, Vitour D, Le Potier MF, Karger A, Caignard G.
In-Text Gene Mentions

…ine/threonine-protein kinase (VRK2), responsible for phosphoryla…

Show Full Abstract

African swine fever virus (ASFV) causes a lethal disease in pigs and represents a significant threat to the global pork industry due to the lack of effective vaccines or treatments. Despite intensive research, many ASFV proteins remain uncharacterized. This study aimed to elucidate the functions of two ASFV proteins, pMGF360-21R and pA151R, through comprehensive analysis of their interactions with host proteins. Using affinity purification-mass spectrometry and yeast two-hybrid screening approaches, we identified the host protein barrier-to-autointegration factor 1 (BANF1) as a key interactor of both viral proteins. Biochemical and colocalization assays confirmed these interactions and demonstrated that MGF360-21R and A151R expression leads to cytoplasmic relocation of BANF1. Functionally, BANF1 silencing significantly reduced ASFV replication, indicating its proviral role. Given BANF1's established function in regulating the cGAS/STING-dependent type I interferon (IFN-I) response, we postulated that A151R and MGF360-21R could inhibit this pathway. Using different strategies, we showed that both A151R and MGF360-21R did indeed inhibit IFN-I induction. Generation of ASFV deficient of A151R or MGF360-21R showed that both mutant viruses enhanced the host IFN response in primary porcine macrophages compared to wild-type virus. However, their capacity to inhibit this pathway could occur through mechanisms independent of BANF1. Proteomic analysis of BANF1 interactors during ASFV infection highlighted potentially roles in chromatin remodeling, nuclear transport, and innate immune response pathways. Altogether, our data provide new insights into ASFV-host interactions, identifying BANF1 as an important new host factor required for replication and uncovering novel functions for A151R and MGF360-21R.

HTT
Also flagged:autophagypathogenesisdegradationneurodegenerative diseasesmacroautophagylipophagy
Journal Article 2025-07-22 ✓ 1 Snippet Righes G, Semenzato L, Koutsikos K, Zanato V, Pinton P, Giorgi C, Patergnani S.
In-Text Gene Mentions

…kDa protein 8 (HTT) Huntingtin (LAMP-2A) lysosom…

Show Full Abstract

Autophagy is a crucial cellular process responsible for the degradation and recycling of damaged or unnecessary components, maintaining cellular homeostasis and protecting against stress. Dysregulation of autophagy has been implicated in a variety of neurodegenerative diseases, including multiple sclerosis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease. Various types of autophagy exist, each with distinct mechanisms, such as macroautophagy, mitophagy, lipophagy, and chaperone-mediated autophagy. These processes are essential for the removal of toxic substrates like protein aggregates and dysfunctional mitochondria, which are vital for neuronal health. In neurodegenerative diseases, the impairment of these clearance mechanisms leads to the accumulation of harmful substances, which accelerate disease progression. Modulating autophagy has emerged as a promising therapeutic strategy, with ongoing studies investigating molecules that can either stimulate or regulate this process. However, despite its potential, significant challenges remain in translating preclinical findings into clinically effective treatments. In this review, we will explore the different types of autophagy, their roles in neurodegenerative diseases, and the therapeutic potential associated with modulating these processes.

OLFM4
Also flagged:sepsisGene Expressionimmune responsescell adhesioncyclosporin Aacute kidney injury
Journal Article 2025-07-22 ✓ 1 Snippet Lin C, Zheng M, Wu W, Wang Z, Lu G, Feng S, Zhang X.
In-Text Gene Mentions

…SLPI, PTX3, TIMP1,OLFM4, LCN2 , and…

Show Full Abstract

<h4>Background</h4>Sepsis frequently induces acute kidney injury (AKI), and the complex interplay between these two conditions worsens prognosis, prolongs hospitalization, and increases mortality. Despite therapeutic options such as antibiotics and supportive care, early diagnosis and treatment remain a challenge. Understanding the underlying molecular mechanisms linking sepsis and AKI is critical for the development of effective diagnostic tools and therapeutic strategies.<h4>Methods</h4>We used two sepsis (GSE57065 and GSE28750) and three AKI (GSE30718, GSE139061, and GSE67401) datasets from the NCBI Gene Expression Omnibus (GEO) for model development and validation, and performed batch effect mitigation, differential gene, and functional enrichment analysis using R software packages. We assessed 113 combinations of 12 different algorithms to develop an internally and externally validated machine-learning model for diagnosing AKI. Finally, we used functional enrichment analysis to identify potential therapeutic agents for AKI.<h4>Results</h4>We identified 556 and 725 DEGs associated with sepsis and AKI, respectively, with 28 overlapping genes suggesting shared pathways. Functional enrichment analysis revealed important associations of AKI with immune responses and cell adhesion processes. The immune infiltration analysis showed significant differences in immune cell presence between sepsis and AKI patients compared with the control group. The machine-learning models identified eight key genes (<i>NR3C2</i>, <i>PLEKHO1</i>, <i>CEACAM1</i>, <i>CDC25B</i>, <i>HEPACAM2</i>, <i>VNN1</i>, <i>SLC2A3</i>, <i>RPL36</i>) with potential for diagnosing AKI. The diagnostic performance of the model constructed in this way was excellent (area under the curve = 0.978), especially in the under 60 years and male patient subgroups. The diagnostic performance outperformed previous models in both the training and validation sets. In addition, cyclosporin A and nine other drugs were identified as potential agents for treating sepsis-associated AKI.<h4>Conclusion</h4>This study highlights the potential of integrating bioinformatics and machine-learning approaches to generate a new diagnostic model for sepsis-associated AKI using molecular crossovers with sepsis. The genes identified have potential to serve as biomarkers and therapeutic targets, providing avenues for future research aimed at enhancing sepsis-associated AKI diagnosis and treatment.

HTT
Also flagged:DeuteriummitochondrialcopperhydrogenmitochondriaATPase pumps
Journal Article 2025-07-22 ✓ 5 Snippets Seneff S, Kyriakopoulos AM.
In-Text Gene Mentions

Httinclusion bodies are…

…way in whichHttaggregates could cause…

…Huntington’s disease, mutantHttaccumulates in the…

…mice with mutatedHttshow an increased…

…speculate that mutantHttentering mitochondrial membran…

Show Full Abstract

Deuterium is a natural heavy isotope of hydrogen, containing an extra neutron. Eukaryotic organisms have devised complex metabolic policies that restrict the amount of deuterium reaching the mitochondria, because it damages the ATPase pumps, leading to release of excessive reactive oxygen species and inefficiencies in ATP production. Human metabolism relies heavily on the gut microbiome to assure an abundant supply of deuterium depleted (deupleted) nutrients to the host. Mitochondrial dysfunction is a hallmark of many chronic diseases, and deuterium overload, often due to gut dysbiosis, may be a major factor contributing to this issue. In this paper, we explore the potential role of certain amyloidogenic proteins, including amylin, amyloid beta, the prion protein, huntingtin, and <i>α</i>-synuclein, in disease processes that result in the accumulation of deposits of protein fibrils, along with lipid membrane components of damaged mitochondria, which we argue may be a mechanism to sequester deuterium in order to reduce the deuterium burden in the tissues. We show how cardiolipin, an anionic lipid synthesized in mitochondria and localized to the mitochondrial membrane, may play a central role both in trapping deuterium in the mitochondrial membrane and in inducing protein misfolding to facilitate the formation of deuterium-rich deposits. We focus on the potential role of the amino acid histidine and its interaction with the mineral copper, both to catalyze certain essential reactions and to facilitate the misfolding of amyloidogenic proteins triggered by contact with anionic phospholipids, particularly cardiolipin, and especially in the outer mitochondrial membrane of deuterium-damaged mitochondria.

PRDX6
Also flagged:autoantibodiescancerautoantigensbreast cancerProtein APRPF19
Journal Article 2025-07-22 ✓ 5 Snippets Zheng N, Li Y, Peng Z, Tang Y, Liang Z, Wang H, Dai H, Tan G.
In-Text Gene Mentions

…SDHA, ENO1, PTBP2,PRDX6, ANP32A, VDAC1, MMP14…

…against HSPA4, ENO1,PRDX6, PRPF19 and MMP14…

… anti-PRPF19, anti-ENO1, anti-PRDX6, and anti-MMP14 autoantibodie…

…(HSPA4, PRPF19, ENO1,PRDX6, and MMP14) were…

…autoantibodies (HSPA4, ENO1,PRDX6, PRPF19, and MMP14)…

Show Full Abstract

<h4>Objective</h4>Comprehensive identification and profiling of antigens in serum immune complexes (ICs) is crucial for developing early diagnostic biomarkers for cancer. We therefore undertook this study to identify novel IC-derived autoantigens and autoantibodies in patients with breast cancer, and to evaluate their potential as new biomarkers.<h4>Methods</h4>ICs were purified from serum with C1q and Protein A/G affinity capture. The isolated complexes were digested with papain and analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Twelve candidate autoantibodies revealed by LC-MS/MS were first verified with a digital liquid chip method (DLCM) in baseline serum from 40 breast cancer patients and eight healthy controls. Five autoantibodies were then validated in independent cohorts of 33 breast cancer patients and 45 healthy controls, using DLCM.<h4>Results</h4>Autoantibodies targeting PF4, PSMB3, PRPF19, RTCB, SDHA, ENO1, PTBP2, PRDX6, ANP32A, VDAC1, MMP14 and HSPA4 were identified both purification methods. In the verification cohort, IgG autoantibodies against HSPA4, ENO1, PRDX6, PRPF19 and MMP14 were significantly increased in breast cancer patients with areas under the curve (AUCs) of 0.90, 0.89, 0.82, 0.78 and 0.77, respectively. Their combined panel discriminated breast cancer from controls with an AUC of 0.97. In the validation cohort, the same autoantibodies achieved AUCs of 0.79, 0.81, 0.73, 0.87, and 0.82, and the combination of these five autoantibodies yielded an AUC of 0.88.<h4>Conclusions</h4>The autoantibodies identified from ICs can serve as effective serum biomarkers for breast cancer. Anti-HSPA4, anti-PRPF19, anti-ENO1, anti-PRDX6, and anti-MMP14 autoantibodies showed significant increases in breast cancer patients.

Also flagged:cancertumorsecretiontumorscell proliferationcolon tumor
Journal Article 2025-07-22 No Snippets Xin-Yi J, Yan-Ran W, Pin-Ru D, Shi-Yi Q, Hai-Tao J.
Show Full Abstract

Organoid technology has significantly advanced biomedical research, offering deep insights into tumor biology and therapeutic efficacy. While existing publications have covered organoid applications, this review uniquely stresses their transformative role in cancer research. We highlight their importance in studying intratumoral heterogeneity and microenvironment interactions. Our analysis addresses knowledge gaps by detailing how organoids function as models in cancer initiation, drug screening, target identification, and sensitivity assessment. We also explore their applications in personalized medicine, such as developing patient-derived models for treatment prediction and immune therapy evaluation. This review discusses the latest progress in using organoids for cancer treatment, like predicting patient responses to precision medicine. However, challenges remain, including maintaining genetic stability and mimicking <i>in vivo</i> conditions. By addressing these limitations, this review provides a novel perspective on how organoid technology may overcome current barriers and drive innovation in cancer therapy. Our analysis suggests that advancements in organoid systems could enhance personalized treatment strategies and improve oncology patient outcomes.

Also flagged:metabolismexcretionGram-positive infectionscystatin Cbacterial infectionsinfections
Journal Article 2025-07-22 No Snippets Dzierżyńska M, Sawicka J, Łada K, Gajewicz-Skretna A, Deptuła M, Chernobrovkin A, Pogorzelska A, Grubb A, Zubarev RA, Pikuła M, Kasprzykowski F, Rodziewicz-Motowidło S.
Show Full Abstract

The emergence of drug-resistant Gram-positive pathogens, particularly<i>Staphylococcus aureus</i>and<i>Streptococcus pyogenes</i>, has driven the need for novel antimicrobial agents. This study explores 21 newly synthesized peptidomimetic analogues of cystatin C <i>N</i>-terminal fragment, designed to enhance bioactivity, solubility, and safety. These compounds were evaluated for antimicrobial potency, cytotoxicity, pro-proliferative effects, and pharmacokinetic properties. Key findings indicate that analogues A-192 and A-164 exhibited the strongest antimicrobial effects against <i>S. aureus</i> and <i>S. pyogenes</i>. Most compounds were inactive against Gram-negative bacteria. Cytotoxicity profiling identified several derivatives with low to moderate toxicity and favorable pro-proliferative effects at specific concentrations. Stability tests confirmed the robustness in aqueous and plasma environments. Computational absorption, distribution, metabolism, excretion, and toxicity (ADMET) modeling revealed low gastrointestinal absorption, but favorable parameters for topical applications. Exploratory analyses (principal component analysis (PCA) and two-way hierarchical cluster analysis (2D-HCA)) linked structural featuressuch as branching, molecular weight, and solubility, with biological activity. These results support the potential of structurally optimized peptidomimetics as targeted, topical therapeutics for Gram-positive infections and provide a rationale for further preclinical development.

Also flagged:HydroxyapatiteOsteogenesispeptidebone matrix proteinsosteonectinSPARC
Journal Article 2025-07-22 No Snippets Lo Furno D, Romano IR, Russo V, Rizzo MG, Mannino G, Calabrese G, Giuffrida R, D'Aprile S, Salvatorelli L, Magro G, Bendoni R, Dolcini L, Zappalà A, Guglielmino SPP, Conoci S, Parenti R.
Show Full Abstract

Mesenchymal stem cells have been widely investigated in the field of regenerative medicine and also used as a model to study the differentiation-induction properties of a variety of biomaterials. This study evaluates the osteoinductive potential of novel hydroxyapatite scaffolds functionalized with a phage-displayed peptide (SC1) selected via biopanning for its similarity to bone matrix proteins. The peptide, identified through sequence alignment as a mimotope of osteonectin (SPARC), was used to functionalize scaffolds. Results from SC1 were gathered at different time points (14, 28 and 46 days) and compared with those from nonfunctionalized hydroxyapatite (HA) scaffolds. In vitro experiments, by seeding human adipose-derived stem cells (hASCs), indicated satisfactory biocompatibility for both types of scaffolds. Histochemical observations showed that SC1, better than HA scaffolds, was able to improve hASC osteogenic differentiation, as evaluated through Alizarin Red staining (showing on average a darker staining of 100%). An increase was also observed, especially at early stages (14 days), for osterix (up to 60% increase) and osteonectin immunoexpression (up to 50% increase). In in vivo experiments, cell-free scaffolds of both types were subcutaneously implanted into the backs of mice and analyzed after 2, 4, 8 and 16 weeks. Also, in this case, SC1 more effectively promoted the osteogenic differentiation of infiltrated resident cells. In particular, increased immunoexpression of osterix and osteonectin (+30% and 35%, respectively) was found already at 2 weeks. It can be concluded that SC1 scaffolds may represent a valuable tool to address critical-sized bone defects.

SUDS3
Also flagged:chromatintranscription factorsgene expressionMyoDTFbinding
Journal Article 2025-07-22 ✓ 1 Snippet Fetch DR, Jumamyradova A, Chapa CM, Ge Y, Mohamadzadeh M, Soshnev AA.
In-Text Gene Mentions

…Other factors, includinglinker histoneshistones (H1) and…

Show Full Abstract

Multicellular organisms arise from a single genome template in the zygote, necessitating the cells of the developing embryo to up- and downregulate specific genes to establish and maintain their identity. This template is maintained, propagated, and interpreted as chromatin, a polymer of nucleic acids and associated structural and regulatory proteins. Recent genome-wide surveys documented a wealth of disease-associated mutations in chromatin factors, indicating their fundamental significance and potential for therapeutic targeting. However, chromatin factors exist in a complex balance, with a single deficiency often leading to pleiotropic downstream effects. Here, we review the mechanisms of chromatin regulation and partitioning, highlighting examples of how these processes are altered in human diseases. We argue that loss of chromatin fidelity, both locally at specific genes and regulatory elements, and globally at the megabase-scale, contributes to many pathological states and may thus represent an intriguing target for corrective interventions.

Also flagged:Embolic Strokeparadoxicalstroketissue plasminogen activatorrivaroxabanischemic stroke
Journal Article 2025-07-22 No Snippets Meixia Z, Xiaoling P, Hongfang C.
Show Full Abstract

Isolated pulmonary arteriovenous fistula (PAVF) leading to paradoxical embolism and stroke is rare, particularly in cases involving large vessel occlusions. Here, we present the case of a 69-year-old female with occlusion of the M2 segment of the middle cerebral artery (MCA) and stenosis of the common carotid artery (CCA) caused by PAVF, which mimicked artery-to-artery embolism. CT angiography revealed occlusion of the left M2 segment of the MCA and stenosis of the CCA. After administration of recombinant tissue plasminogen activator, both the left MCA occlusion and CCA stenosis were completely recanalized. Transthoracic contrast echocardiography revealed a significant right-to-left shunt both at rest and during the Valsalva maneuver, while chest CT angiography indicated the presence of PAVF in the lower lobe of the right lung. The anticoagulant medication rivaroxaban (15 mg) was administered to prevent the recurrence of ischemic stroke. Pulmonary arterial angiography confirmed the diagnosis of PAVF, and PAVF embolization using coils was successfully performed. At the one-year follow-up, the patient had no stroke recurrence. PAVF is a potentially fatal but treatable disease. Even in patients with large vessel occlusions, it is essential to consider PAVF as a rare underlying cause. The mechanism of PAVF-related stroke might be mistaken for artery-to-artery embolism.

Also flagged:membrane proteinspeptide transporterbindingpeptidehydrogenlipid
Journal Article 2025-07-22 No Snippets Carrasco-Faus G, Márquez-Miranda V, Diaz-Franulic I.
Show Full Abstract

Cold environments challenge the structural and functional integrity of membrane proteins, requiring specialized adaptations to maintain activity under low thermal energy. Here, we investigate the molecular basis of cold tolerance in the peptide transporter PepT1 from the Antarctic icefish (<i>Chionodraco hamatus</i>, ChPepT1) using molecular dynamics simulations, binding free energy calculations (MM/GBSA), and dynamic network analysis. We compare ChPepT1 to its human ortholog (hPepT1), a non-cold-adapted variant, to reveal key features enabling psychrophilic function. Our simulations show that ChPepT1 displays enhanced global flexibility, particularly in domains adjacent to the substrate-binding site and the C-terminal domain (CTD). While hPepT1 loses substrate binding affinity as temperature increases, ChPepT1 maintains stable peptide interactions across a broad thermal range. This thermodynamic buffering results from temperature-sensitive rearrangement of hydrogen bond networks and more dynamic lipid interactions. Importantly, we identify a temperature-responsive segment (TRS, residues 660-670) within the proximal CTD that undergoes an α-helix to coil transition, modulating long-range coupling with transmembrane helices. Dynamic cross-correlation analyses further suggest that ChPepT1, unlike hPepT1, reorganizes its interdomain communication in response to temperature shifts. Our findings suggest that cold tolerance in ChPepT1 arises from a combination of structural flexibility, resilient substrate binding, and temperature-sensitive interdomain dynamics. These results provide new mechanistic insight into thermal adaptation in membrane transporters and offer a framework for engineering proteins with enhanced functionality in extreme environments.

Also flagged:Multiple SclerosisPrimary Headachecognitive impairmentprimary headachesmigrainemigraines
Journal Article 2025-07-22 No Snippets Tiralongo G, Monte G, Ferilli MAN, Ursitti F, Sforza G, Ruscitto C, Mazzeo G, Borrelli A, Valeriani M, Papetti L.
Show Full Abstract

<h4>Background</h4>Pediatric-onset multiple sclerosis (POMS) is a rare but often more aggressive form of multiple sclerosis, associated with early cognitive impairment and significant impact on quality of life. Multiple sclerosis and primary headaches, particularly migraine, are well established in adults, but data on pediatric populations remain limited.<h4>Methods</h4>The purpose of this retrospective study was to examine 64 POMS patients, divided into groups with and without headaches, to determine potential correlations between headache presence, age at POMS onset, and MRI lesion burden.<h4>Results</h4>Headaches were reported by 78% of patients, predominantly migraines (68%), with a significantly higher prevalence in females (74%). No significant differences were found in age at MS onset or lesion load on brain MRI between patients with and without headaches. Among those with headaches, migraines represented a higher frequency of attacks and a greater need for prophylactic treatment compared to other headache types. Headache characteristics, including pain location and associated symptoms, showed no correlation with age at MS onset or lesion burden.<h4>Conclusions</h4>These findings indicate that while headaches are common in POMS and more frequent in females, their presence and features do not appear to directly influence the clinical or neuroradiological course of the disease. Further research with larger cohorts and longitudinal follow-up is warranted to better understand the underlying mechanisms and long-term impact of headaches in pediatric MS.

Also flagged:Neurodegenerative DiseasesCas9
Journal Article 2025-07-22 No Snippets Akbar A, Haider R, Agnello L, Noor B, Maqsood N, Atif F, Ali W, Ciaccio M, Tariq H.
Show Full Abstract

Neurodegenerative diseases (NDs) pose a major challenge to global healthcare systems owing to their devastating effects and limited treatment options. These disorders are characterized by progressive loss of neuronal structure and function, resulting in cognitive and motor impairments. Current therapies primarily focus on symptom management rather than on targeting the underlying causes. However, clustered regularly interspaced short palindromic repeat (CRISPR) technology offers a promising alternative by enabling precise genetic modifications that could halt or even reverse ND progression. CRISPR-Cas9, the most widely used CRISPR system, acts as a molecular scissor targeting specific DNA sequences for editing. By designing guide RNAs (gRNAs) to match sequences in genes associated with NDs, researchers can leverage CRISPR to knockout harmful genes, correct mutations, or insert protective genes. This review explores the potential of CRISPR-based therapies in comparison with traditional treatments for NDs. As research advances, CRISPR has the potential to revolutionize ND treatment by addressing its genetic underpinnings. Ongoing clinical trials and preclinical studies continue to expand our understanding and application of this powerful tool to fight debilitating conditions.

ZNFX1
Also flagged:Immune ResponsePancreatic Tumourspancreatic cancertumourshematoxylintransporter associated with antigen processing
Journal Article 2025-07-22 ✓ 2 Snippets Mouratidis P, Ferreira RC, Anbalagan S, Chauhan R, Rivens I, Ter Haar G.
In-Text Gene Mentions

…C4B, CLU, RTP4,ZNFX1, DDX60, PML, IFIT3,…

…DDX60, TLR6, andZNFX1) ( Figure A6…

Show Full Abstract

<b>Background</b>: Boiling histotripsy (BH) uses high-amplitude, short-pulse focused ultrasound to disrupt tissue mechanically. Oncolytic virotherapy using reovirus has shown modest clinical benefit in pancreatic cancer patients. Here, reovirus and BH were used to treat pancreatic tumours, and their effects on the immune transcriptome of these tumours were characterised. <b>Methods</b>: Orthotopic syngeneic murine pancreatic KPC tumours grown in immune-competent subjects, were allocated to control, reovirus, BH and combined BH and reovirus treatment groups. Acoustic cavitation was monitored using a passive broadband cavitation sensor. Treatment effects were assessed histologically with hematoxylin and eosin staining. Single-cell multi-omics combining whole-transcriptome analysis with the expression of surface-expressed immune proteins was used to assess the effects of treatments on tumoural leukocytes. <b>Results</b>: Acoustic cavitation was detected in all subjects exposed to BH, causing cellular disruption in tumours 6 h after treatment. Distinct cell clusters were identified in the pancreatic tumours 24 h post-treatment. These included neutrophils and cytotoxic T cells overexpressing genes associated with an N2-like and an exhaustion phenotype, respectively. Reovirus decreased macrophages, and BH decreased regulatory T cells compared to controls. The combined treatments increased neutrophils and the ratio of various immune cells to Treg. All treatments overexpressed genes associated with an innate immune response, while ultrasound treatments downregulated genes associated with the transporter associated with antigen processing (TAP) complex. <b>Conclusions</b>: Our results show that the combined BH and reovirus treatments maximise the overexpression of genes associated with the innate immune response compared to that seen with each individual treatment, and illustrate the anti-immune phenotype of key immune cells in the pancreatic tumour microenvironment.

Also flagged:cardiovascular diseasesmetabolisminflammatory responsesFerroptosisdeathiron
Journal Article 2025-07-21 No Snippets Zhang T, Han Y, Wang Y, Wang X, Zhao M, Cheng Z, Zhang S.
Show Full Abstract

Myocardial ischemia-reperfusion injury (MIRI) is a common fatal event in cardiovascular diseases. Oxidative stress, energy metabolism disorders, and inflammatory responses that occur during this process cause severe damage to myocardial cells. Ferroptosis is a novel form of cell death closely related to cellular damage in MIRI. Numerous studies have demonstrated that specific active ingredients can regulate iron homeostasis and inhibit ferroptosis, thereby protecting myocardial function and enhancing the prognosis of patients. At the same time, traditional Chinese medicine monomers also provide a new perspective for the treatment of MIRI. This review summarizes the recent advances in understanding the mechanisms underlying ferroptosis, with the aim of providing potential novel therapeutic strategies for the clinical management of MIRI.

Also flagged:fistulastress urinary incontinenceoveractive bladdermixed urinary incontinenceincontinencevesicovaginal fistula
Journal Article 2025-07-21 No Snippets Goh J, Browning A, Slinger G, Trautvetter L.
Show Full Abstract

Post-obstetric fistula repair incontinence (POFRI) is not unusual in fistula patients, and the diagnosis, as well as ongoing management of POFRI, can be challenging for surgeons, care teams, and patients alike. To address this issue and to start establishing consensus, FIGO (the International Federation of Gynecology & Obstetrics) held an Expert Fistula Surgical Workshop at the Addis Ababa Fistula Hospital in Ethiopia in early 2024. Recommendations, based on expert opinion from the gathering, including the use of standard terminology, history-taking, clinical examination, and investigations for further assessment such as residual urine volume, urinary diary, pad test, and urodynamics or single channel cystometry, are described in detail with the aim of giving concrete guidance. These will aid in the correct diagnosis of POFRI and tailor management to the patient's needs. In addition, the paper provides direction on how the different types of POFRI should be treated, including conservative and surgical options once diagnosed, with the accompanying flowchart serving as a practical visual overview. Women with pure stress urinary incontinence may be offered surgery, whereas women with pure overactive bladder symptoms should be treated conservatively. In women with mixed urinary incontinence, predominantly overactive bladder symptoms, careful consideration should be undertaken before performing surgery.

HFE
Also flagged:bindingironmajor facilitatortransportersmembranescobalt
Journal Article 2025-07-21 ✓ 2 Snippets Amadei M, De Lauro A, Polticelli F, Musci G, Bonaccorsi di Patti MC.
In-Text Gene Mentions

…dominant form ofhemochromatosiswith parenchymal and/or…

…mutations identified inhemochromatosispatients, D181V was…

Show Full Abstract

Ferroportin, the only known cellular iron exporter, belongs to the major facilitator superfamily of transporters, which cycle between inward-open, occluded and outward-open conformations to translocate substrates across membranes. Recently reported cryoEM structures of ferroportin identified two metal-binding sites in the central cavity of the protein, with site S1 that includes residues D39 and H43, while site S2 is formed by C326 and H507. Here we have employed fluorescence spectroscopy to evaluate the binding affinity for cobalt of human ferroportin. The results suggest that S2 has a higher affinity for cobalt than S1. Results are discussed in view of available structural data on the outward-open conformation of Fpn and of a novel structural model of the inward-open conformation, obtained with a custom implementation of AlphaFold 2. We propose a mechanism by which the outward flux of iron could be driven by the different affinity of the two sites.

Also flagged:Fascioliasisparasitic diseaseneglected tropical diseasewaterinfectionzoonotic diseases
Journal Article 2025-07-21 No Snippets Quang VH, Levecke B, Do Trung D, Thi Lam BV, Dung LT, Nguyen TD, Tuyen TT, Nguyen HTT, Ha NN, Devleesschauwer B, Goossens K, de Jong T, Paredis L, De Wilde N, Polman K, Callens S, Dorny P, Dermauw V.
Show Full Abstract

<h4>Background</h4>Fascioliasis, caused by Fasciola hepatica and Fasciola gigantica, is a zoonotic disease that significantly impacts public health in agricultural communities, particularly in Vietnam. This study aims to assess the knowledge, attitudes, and practices (KAP) regarding fascioliasis among residents in a rural community in Vietnam.<h4>Methodology/principal findings</h4>A cross-sectional study was conducted in Dong Thanh commune, north-central Vietnam. A random sample of 621 households was selected, and 1,398 individuals participated in this study. All participants were interviewed to assess their KAP regarding fascioliasis. Household heads were also interviewed about household practices, including life cycle knowledge, health-seeking behavior, water and sanitation practices, livestock and crop management, and dietary habits. Descriptive statistics were used to assess KAP, and generalized linear models were applied to examine the associations between socio-demographic variables and KAP. Awareness of fascioliasis was low, with 85% (1,193/1,398) of respondents reporting no prior knowledge. Detailed understanding of transmission, symptoms, and prevention was limited. Only 9% (124/1,398) of participants could accurately identify the symptoms, while 12% (168/1,398) were knowledgeable about preventive measures. A high percentage of households treated drinking water (99%, 613/619), and consumption of raw vegetables was widespread, with 93% (1,083/1,168) of individuals and 95% of households reporting this practice. Males were less likely to engage in non-risky practices than females (odds ratio: 0.696; 95% confidence interval: 0.591-0.819). Most households (85%, 522/617) sourced plants from their parcels, and 67% (395/588) used animal manure as fertilizer.<h4>Conclusion/significance</h4>The study reveals significant gaps in KAP related to fascioliasis in Dong Thanh commune. There is a pressing need for targeted educational programs to enhance community awareness and promote safer practices to mitigate the risk of fascioliasis transmission. Future interventions should emphasize gender-specific education and broader community involvement to address these gaps effectively.

DARS2
Also flagged:major vault proteinMVPpoly (ADP-ribose) polymerase 4PARP4telomerase component 1TEP1
Journal Article 2025-07-21 ✓ 3 Snippets Lodwick JE, Shen R, Erramilli S, Xie Y, Roganowicz K, Ritchey S, Kossiakoff AA, Zhao M.
In-Text Gene Mentions

…33 , andDARS2.…

…a tRNA synthetase,DARS2has recently been…

DARS2

Show Full Abstract

Vault is a massive ribonucleoprotein complex found across Eukaryota. The major vault protein (MVP) oligomerizes into an ovular cage, which contains several minor vault components (MVCs) and is thought to transport transiently bound "cargo" molecules. Vertebrate vaults house a poly (ADP-ribose) polymerase (known as PARP4 in humans), which is the only MVC with known enzymatic activity. Despite being discovered decades ago, the molecular basis for PARP4's interaction with MVP remains unclear. In this study, we determined the structure of the human vault cage in complex with PARP4 and its enzymatic substrate NAD<sup>+</sup>. The structures reveal atomic-level details of the protein-binding interface, as well as unexpected binding sites for NAD<sup>+</sup> and related nucleotides within the interior of the vault cage. In addition, proteomics data show that human vaults purified from wild-type and PARP4-depleted cells interact with distinct subsets of proteins. Our results thereby support a model in which PARP4's specific incorporation into the vault cage helps to regulate vault's selection of cargo and its subcellular localization. Further, PARP4's proximity to MVP's NAD<sup>+</sup>-binding sites could support its enzymatic function within the vault.

SERPINC1
Also flagged:semaglutideMetabolic dysfunction-associated steatohepatitischronic liver diseaseglucagon-like peptide-1 receptormetabolismsteatohepatitis
Journal Article 2025-07-21 ✓ 5 Snippets Jara M, Norlin J, Kjær MS, Almholt K, Bendtsen KM, Bugianesi E, Cusi K, Galsgaard ED, Geybels M, Gluud LL, Harder LM, Loomba R, Mazzoni G, Newsome PN, Nitze LM, Palle MS, Ratziu V, Sejling AS, Wong VW, Anstee QM, Knudsen LB.
In-Text Gene Mentions

…the following rationale:SERPINC1and APOF had…

…Levels ofSERPINC1and APOF in…

…In contrast toSERPINC1and APOF, levels…

…APOF andSERPINC1are implicated in…

SERPINC1acts as a…

Show Full Abstract

Metabolic dysfunction-associated steatohepatitis (MASH) is a chronic liver disease strongly associated with cardiometabolic risk factors. Semaglutide, a glucagon-like peptide-1 receptor agonist, improves liver histology in MASH, but the underlying signals and pathways driving semaglutide-induced MASH resolution are not well understood. Here we show that, in two preclinical MASH models, semaglutide improved histological markers of fibrosis and inflammation and reduced hepatic expression of fibrosis-related and inflammation-related gene pathways. Aptamer-based proteomic analyses of serum samples from patients with MASH in a clinical trial identified 72 proteins significantly associated with MASH resolution and semaglutide treatment, with most related to metabolism and several implicated in fibrosis and inflammation. An independent real-world cohort verified the pathophysiological relevance of this signature, showing that the same 72 proteins are differentially expressed in patients with MASH relative to healthy individuals. Taken together, these data suggest that semaglutide may revert the circulating proteome associated with MASH to the proteomic pattern observed in healthy individuals.

SERPINC1
Also flagged:MTHFRThrombotic StrokeStrokedeathischemic strokestrokes
Journal Article 2025-07-21 ✓ 1 Snippet Zain AM, El-Halfaway KA, Megeed AAA, Elbadee AA, Khalil H.
In-Text Gene Mentions

…the GP6 (rs1613662),SERPINC1(rs2227589), F11 (rs2036914…

Show Full Abstract

Stroke is the second leading cause of death globally and a major contributor to disability. Developing countries report the highest rates of stroke, with ischemic stroke being the most prevalent type. This study aimed to explore the potential association between specific single nucleotide polymorphisms (SNPs) and thrombotic strokes in Egyptian patients, as well as the role of DNA methylation in the promoter regions of genes associated with these SNPs. The study involved 100 adult patients who were consecutively admitted to the International Medical Center. These patients, diagnosed with acute ischemic stroke, were compared to age-matched control subjects (± 3 years). Molecular analysis was conducted on six thrombosis-related SNPs: FV (R506Q, H1299R, Y1702C), FII (G20210A), and MTHFR (C677T, A1298C) using blood samples from both stroke patients and healthy controls. DNA methylation in the promoter regions of the FV, FII, and MTHFR genes was assessed through a sodium bisulfite conversion protocol and genomic DNA digestion with the methylation-dependent restriction enzyme MspJI, using specific primers for the promoter regions of FV, FII, and MTHFR in all derived samples. The biochemical analysis of the derived samples revealed elevated levels of homocysteine, ESR, and LDL in stroke patients, alongside reduced levels of both vitamin B12 and serum folate. The SNP analysis of samples from healthy controls and stroke patients, conducted using the TaqMan™ SNP genotyping assay, identified the homozygous SNPs in the FV, FII, and MTHFR genes. The results clearly show that the MTHFR C677T heterozygous mutation is present in nearly all stroke patient samples, with a very low likelihood of this mutation co-occurring with SNP mutations in the other indicated genes. Analysis of methylation activities in the promoter regions of the indicated genes showed hypermethylation in the MTHFR promoter region, while methylation levels in the FV and FII promoter regions were normal. The analysis showed increased methylation of cytosine nucleotide in the MTHFR promoter region, potentially inhibiting MTHFR expression and contributing to the development of thrombotic strokes in patients. Overall, the data support an association between the MTHFR C677T mutation, hypermethylation in its promoter region, and stroke development in the study participants.

Also flagged:NKX2-1prostate cancercastration-resistant prostate cancerCRPCchromatintumors
Journal Article 2025-07-21 No Snippets Lu X, Keo V, Cheng I, Xie W, Gritsina G, Wang J, Lu L, Shiau CK, He Y, Jin Q, Jin P, Sanda MG, Corces VG, Altemose N, Gao R, Zhao JC, Yu J.
Show Full Abstract

A substantial amount of castration-resistant prostate cancer (CRPC) progresses into a neuroendocrine (NE) subtype, known as NEPC, which is associated with poor clinical outcomes. Here we report distinct three-dimensional chromatin architectures between NEPC and CRPC tumors, which were recapitulated by isogenic cell lines undergoing NE transformation (NET). Mechanistically, pioneer factors such as FOXA2 initiate binding at NE enhancers to mediate regional DNA demethylation and induce neural transcription factor (TF) NKX2-1 expression. NKX2-1 preferentially binds gene promoters and interacts with enhancer-bound FOXA2 through chromatin looping. NKX2-1 is highly expressed in NEPC and indispensable for NET of prostate cancer. NKX2-1/FOXA2 further recruits p300/CBP to activate NE enhancers, and pharmacological inhibition of p300/CBP effectively blunts NE gene expression and abolishes NEPC tumor growth. Taken together, our study reports a hierarchical network of TFs governed by NKX2-1 in critically regulating chromatin remodeling and driving luminal-to-NE transformation and suggests promising therapeutic approaches to mitigate NEPC.

ECI2
Also flagged:Rheumatoid arthritisRACRPmethotrexateleflunomidehydroxychloroquine
Journal Article 2025-07-21 ✓ 2 Snippets He S, Zhu C, Liu Y, Xu Z, Sun R, Yang B, Guo X, Herrmann I M, Muñoz LE, Gjertsson I, Holmdahl R, Dai L, Zhao Y.
In-Text Gene Mentions

…MYH9, COL1A1 andECI2(MTX + LEF),…

…in responders, whileECI2, COL1A1, and CBR1…

Show Full Abstract

Rheumatoid arthritis (RA) is a systemic inflammatory condition posing challenges in identifying biomarkers for onset, severity and treatment responses. Here we investigate the plasma proteome in a longitudinal cohort of 278 RA patients, alongside 60 at-risk individuals and 99 healthy controls. We observe distinct proteome signatures in at-risk individuals and RA patients, with protein levels alterations correlating with disease activity, notably at DAS28-CRP thresholds of 3.1, 3.8 and 5.0. The combination of methotrexate (MTX) and leflunomide (LEF) modulates proinflammatory pathways, whereas MTX plus hydroxychloroquine (HCQ) impact energy metabolism. A machine-learning model is trained for predicting responses, and achieves average receiver operating characteristic (ROC) scores of 0.88 (MTX + LEF) and 0.82 (MTX + HCQ) in the testing sets. The efficiency of these models is further validated in independent cohorts using enzyme-linked immunosorbent assay data. Overall, our study unveils distinct plasma proteome signatures across various stages and subtypes of RA, providing valuable biomarkers for predicting disease onset and treatment responses.

HFE
Also flagged:Hepatic steatosischronic liver diseasessteatotic liver diseasemetabolic dysfunction-associated steatotic liver diseasenon-alcoholic fatty liver diseaseNAFLD
Journal Article 2025-07-21 ✓ 4 Snippets Maushagen J, Nattenmüller J, von Krüchten R, Thorand B, Peters A, Rathmann W, Adamski J, Schlett CL, Bamberg F, Wang-Sattler R, Rospleszcz S.
In-Text Gene Mentions

…variants in theHFEgene, predisposing to…

…allele G|A), inHFEas the lead…

…whereas rs1800562 (HFE) was tentatively…

…and rs1800562 (HFE) was positively…

Show Full Abstract

<h4>Background</h4>Steatotic liver disease is a major public health issue, with hepatic iron overload exacerbating fibrotic conditions. This study aimed to identify metabolites associated with hepatic fat and/or iron overload using targeted metabolomics in a population-based cohort.<h4>Methods</h4>We used the cross-sectional KORA-MRI study (N = 376 individuals). Hepatic fat and iron content were derived by magnetic resonance imaging, and serum metabolite concentrations were quantified through targeted metabolomics. Associations between 146 metabolites and 40 indicators with hepatic phenotypes were analyzed, adjusted for confounders, and corrected for multiple testing. Formal pathway analyses and mediation analyses including genetic data were conducted. Performance of metabolomics to diagnose steatosis or hepatic iron overload was evaluated using ROC curves, and compared to the fatty liver index (FLI).<h4>Results</h4>Overall, 50.8% of participants (mean age 56.4 years) had hepatic steatosis, and 43.6% iron overload. Twelve unique metabolites/indicators (amino acids, lysophosphatidylcholine, acyl-alkyl-phosphatidylcholine), and sums of branched chain and aromatic amino acids, and five lipids, and ratio of acyl-alkyl-phosphatidylcholines to diacyl-phosphatidylcholines were associated with hepatic fat content. 27 metabolites/indicators, including 25 lipids, were associated with hepatic iron content. Addition of these metabolites to the FLI improved diagnosis of steatosis and iron overload nominally. Glycerophospholipid metabolism, phenylalanine, tyrosine and tryptophan biosynthesis and glycerophospholipid metabolism were shared pathway between steatosis and iron overload. Alanine, isoleucine, glutamine and pimeloylcarnitine (C7-DC) mediated effects between genetic variants and hepatic phenotypes.<h4>Conclusion</h4>Metabolites were associated with hepatic fat and iron content, shared common pathways, and improved diagnosis of steatosis and iron overload, highlighting the role of iron in hepatic disorders.

VRK2SOX6
Also flagged:fatty acidsamino acidsamino acidfatty acidthreoninelysine
Journal Article 2025-07-21 ✓ 2 Snippets Han H, Kuai Z, Yao Z, Lei X, Shi H, Li J, Liu K, Yin H, Wang Y, Quan K.
In-Text Gene Mentions

…HTR2B , andVRK2(downregulated), were associat…

…WFIKKN2 , andSOX6as upregulated genes…

Show Full Abstract

<h4>Background</h4>The aim of this study was to investigate the effects of age and sex on the composition of fatty acids, amino acids, and vitamins in the longissimus thoracis et lumborum (LTL) of Huai goats.<h4>Methods</h4>The longissimus thoracis et lumborum tissues of eight Huai goats were collected postslaughter and analyzed for amino acids, fatty acids, and vitamins by gas chromatography‒mass spectrometry (GC‒MS) and standard methods. RNA sequencing (RNA-Seq) was conducted to identify differentially expressed genes (DEGs) across different ages and sexes. Metabolite profiling was performed by liquid chromatography‒mass spectrometry (LC‒MS) to detect and quantify metabolites.<h4>Results</h4>This study revealed significant differences in amino acid and fatty acid profiles between male and female Huai goats. Compared to females, males presented higher levels of several essential amino acids (e.g., threonine, lysine, and phenylalanine) and nonessential amino acids (e.g., glutamic acid, aspartic acid, and glycine). Additionally, males had higher levels of unsaturated fatty acids such as linoleic acid (C18:2n6c) and arachidonic acid (C20:4n6) compared to those of females. The vitamin B1 content was higher in 6-month-old goats than in 24-month-old goats. Transcriptomic analysis revealed 294 DEGs in the sex group comparison and 580 DEGs in the age group comparison. Key genes involved in collagen production (COL1A1, COL1A2, and COL4A2) and amino acid metabolism (PHGDH and PSAT1) were significantly upregulated in male goats. Functional enrichment analysis revealed significant enrichment in collagen-related Gene Ontology (GO) terms and pathways related to amino acid metabolism. Metabolomic analysis revealed 79 differentially abundant metabolites in the sex group comparison and 69 in the age group comparison, with significant enrichment in pathways related to glycerophospholipid metabolism, oxidative phosphorylation, and amino acid metabolism. Notably, several amino acids and their metabolites, such as lysine, glutamic acid, and serine, exhibited significant differences between male and female goats, which was consistent with the transcriptomic findings.<h4>Conclusion</h4>The findings indicate that sex and age significantly influence the chemical composition and flavor profile of Huai goat meat. The identified DEGs and differentially abundant metabolites provide a molecular basis for understanding the variations in meat quality and flavor. These results highlight the potential for optimizing meat production practices to increase the quality and flavor of Huai goat meat.

HFE
Also flagged:IronRegulatorsickle cell diseasehydroxyureaSickle Cell AnemiaEthylenediaminetetraacetic acid
Journal Article 2025-07-21 ✓ 5 Snippets Appiah SK, Nkansah C, Daud S, Abbam G, Osei-Boakye F, Adom L, Rauf ROA, Addae GT, Sarpong L, Appiah GA, Derigubah CA, Mensah JO, Kalu OC, Usanga VU, Ukwah BN, Chukwurah EF.
In-Text Gene Mentions

…H63D rs1799945 ofHFEgene and clinico‐hematological…

…homeostatic iron regulator (HFE), transferrin receptor 2…

…TheHFEgene on chromosome…

…TheHFE, particularly the H63D…

…variant of theHFEgene that may…

Show Full Abstract

<h4>Background and aim</h4>The study assessed the polymorphic distribution of H63D rs1799945 of HFE gene and clinico-hematological parameters of SCA patients.<h4>Methods</h4>Sixty sickle cell anemia (SCA) patients and 30 healthy controls without sickle cell disease between the ages of 2-38 years were selected for this case-control study from March to July, 2023 in the Northern Ghana. Ethylenediaminetetraacetic acid (EDTA)-anticoagulated blood samples were used for complete blood count estimation using a 5-part hematology autoanalyzer (URIT-5250 China). Genomic DNA was extracted from whole blood using the spin-column protocol for DNA (Qiagen Kit) and genotyping of H63D rs1799945 gene was performed using Agena MassARRAY with iPLEX PCR (Agena Biosciene, USA).<h4>Results</h4>The median age of the participants was 15.8 (2.0-38.0) years. All the study participants possess only the wild-type allele (CC) of the H63D rs1799945 gene. The mutant variants (CG and GG) were not detected among the study population. There were significant reductions in the RBC (<i>p</i> < 0.001), Hb (<i>p</i> < 0.001), and HCT (<i>p</i> < 0.001), but higher levels of ferritin (<i>p</i> < 0.001), CRP (<i>p</i> < 0.001), MCV (<i>p</i> = 0.001), RDW-CV% (<i>p</i> < 0.001), TWBC (<i>p</i> < 0.001) and platelet count (<i>p</i> = 0.002) in SCA participants than the controls. Incidence of vaso-occlusive crisis (VOC) correlated with increased levels of ferritin (<i>r</i> = 0.458, <i>p</i> < 0.001), CRP (<i>r</i> = 0.461, <i>p</i> < 0.001), platelet (<i>r</i> = 0.537, <i>p</i> < 0.001) and WBC (<i>r</i> = 0.302, <i>p</i> = 0.019) counts but inversely correlated with Hb levels (<i>r</i> = -517, <i>p</i> < 0.001) of SCA patients. Also, levels of ferritin (<i>p</i> < 0.001), Hb (<i>p</i> = 0.001), TWBC (<i>p</i> = 0.018), platelet (<i>p</i> < 0.001), frequencies of VOC (<i>p</i> < 0.001) and number of hospitalization (<i>p</i> < 0.001), were significantly improved in participants on hydroxyurea therapy than the hydroxyurea naïve participants.<h4>Conclusion</h4>The mutant G allele is very rare among the study population. The study also observed severe hematological alterations in SCA participants compared to the controls group. Hydroxyurea was found to improve the clinico-hematological parameters and the need to encourage its usage.

HTT
Also flagged:pathogenesisimmune responseIL-6ESRVDRpolymerase
Journal Article 2025-07-21 ✓ 3 Snippets Gomes-Souza L, Fatturi AL, Scariot R, Machado-Souza C, Küchler EC, Brancher JA, Feltrin-Souza J.
In-Text Gene Mentions

…and rs2228570), and5-HTTgenes (rs1042173 and…

…Serotonin Transporter (5-HTT) —which encodes a…

…VDR , and5-HTTgenes (p>0.05).…

Show Full Abstract

<h4>Background</h4>Certain genes present variants associated with molar-incisor hypomineralization (MIH) pathogenesis, especially genes encoding enamel development proteins related to morphogenesis, immune response, and hormone transcription and reception, demonstrating that MIH is likely a gene-environment issue with multiple genes having small individual effects.<h4>Objective</h4>To evaluate the association between single nucleotide polymorphisms (SNPs) and MIH.<h4>Methodology</h4>A sample of 90 children with MIH and 262 children without MIH were included in this study. Calibrated examiners diagnosed MIH (Kappa≥0.75) using the European Academy of Paediatric Dentistry (EAPD) criteria and modified DDE index in clinical exams. SNPs in the IL-6 (rs2069840 and rs2069833), ESR (rs9340799, rs1256049, rs4986938, and rs2234693), VDR (rs739837 and rs2228570), and 5-HTT genes (rs1042173 and rs38133034) were genotyped by real-time polymerase chain reaction from oral mucosa cells collected. Associations between MIH and SNPs genotypes (recessive and dominant models) and allele frequencies were tested using the chi-square test. Odds ratio (OR) and confidence intervals (CI) were calculated. A significance level of 5% was adopted. Genotypes were tested by the Hardy-Weinberg Equilibrium using chi-square.<h4>Results</h4>In rs4986938 (ESR2 gene), children with CT/TT presented significantly lower odds of MIH than CC (OR=0.57, CI 95% [0.35-0.92]). There was no significant association between MIH and other evaluated genes.<h4>Conclusion</h4>The genetic polymorphism in the ESR gene is associated with MIH, suggesting that MIH etiology presents a polygenetic involvement.

Also flagged:waterSox10Phox2bCFPYFPpolymerase
Journal Article 2025-07-21 No Snippets Avila JA, Benthal JT, Schafer JC, Flaherty DK, Southard-Smith EM.
Show Full Abstract

<h4>Background & aims</h4>Enteric nervous system (ENS) development requires migration, proliferation, and differentiation of progenitors for normal gastrointestinal (GI) motility. Sox10 deficit causes aganglionosis, modeling Hirschsprung disease (HSCR), and disrupts ratios of postnatal enteric neurons in proximal ganglionated bowel. How Sox10 deficiency alters enteric neuron ratios is unclear. Sox10's prominent expression in enteric neural crest-derived progenitors (ENCPs) and lack of this gene in mature enteric neurons led us to examine Sox10<sup>Dom</sup> effects in early ENS development.<h4>Methods</h4>Immunohistochemistry localized SOX10 in the developing ENS relative to HuC/D. ENS progenitors, developing neurons, and enteric glia were isolated from Sox10<sup>+/+</sup> and Sox10<sup>Dom/+</sup> littermates for single-cell RNA sequencing (scRNA-seq). scRNA-seq data was processed to identify cell type-specific markers, differentially expressed genes, cell fate trajectories, and gene regulatory network activity between genotypes. Hybridization chain reaction (HCR) coupled with immunohistochemistry validated expression changes.<h4>Results</h4>SOX10 protein was detected in early ENS neurons. scRNA-seq profiles detected three neuronal trajectories emerging via two transition pathways accompanied by elevated activity of Hox gene regulatory networks (GRN). Sox10<sup>Dom/+</sup> scRNA-seq profiles exhibited a novel progenitor cluster, reduced numbers of cells in transitional states, and shifts in cell abundance between neuronal trajectories. Hoxa6 was differentially expressed in the neuronal trajectories impacted in Sox10<sup>Dom/+</sup> mutants, and HCR identified altered Hoxa6 expression in early developing neurons of Sox10<sup>Dom/+</sup> ENS.<h4>Conclusions</h4>Sox10<sup>Dom/+</sup> mutation shifts enteric neuron types by altering neuronal trajectories early in ENS development. Multiple neurogenic transcription factors are reduced in Sox10<sup>Dom/+</sup> scRNA-seq profiles. This work is the first to correlate changes in Hox expression, notably Hoxa6, with alterations in enteric neuron trajectories.

HTT
Also flagged:Huntington diseaseHDpsychosisaggressionautosomalneurodegenerative disease
Journal Article 2025-07-21 ✓ 1 Snippet Shiino S, Moroz S, Stovall J, Petrie WM, Claassen DO, McDonell KE.
In-Text Gene Mentions

…repeat in theHTTgene.…

Show Full Abstract

<h4>Objective</h4>Neuropsychiatric symptoms are common clinical features of Huntington disease (HD) that can result in mental health emergencies. However, there are no established guidelines for inpatient psychiatric treatment in HD. In this study, the investigators reviewed psychiatric hospitalizations in a large medical center to better understand the mental health needs of patients with HD and identify potential gaps in care.<h4>Methods</h4>Charts were reviewed to identify patients with HD at Vanderbilt University Medical Center who were admitted to psychiatry between 2013 and 2020. Clinical data and demographic information were obtained from the electrical health record along with the indication for each psychiatric admission, actions taken during the admission, and follow-up care.<h4>Results</h4>Among this cohort, 32 of 287 patients (11.1 %) were admitted to inpatient psychiatry at least once. Age at first admission ranged from 17 to 74 years, with 84.4 % of patients in the motor-manifest stage. The most common reasons for admission were suicidal ideation or attempt (57.6 %), psychosis (39.4 %), and aggression (36.4 %). Most patients were able to return to their previous level of care, although readmissions were common.<h4>Conclusions</h4>These results emphasize the frequency and severity of psychiatric crises in HD and support the need for expanded access to emergency psychiatry care across the disease course. Further research is warranted to develop an integrated, disease-specific approach to early recognition and management of psychiatric symptoms in HD.

PRDX6PTGIS
Also flagged:Prolyl HydroxylaseHIFChronic kidney diseaseanemiaHypoxia-inducible factorangiogenesis
Journal Article 2025-07-21 ✓ 4 Snippets Gáll T, Pethő D, Nagy A, Póliska S, Balla G, Balla J.
In-Text Gene Mentions

…ignificantly decreased (FGF18,PTGIS, CYP1B1, CCL2, SEMA4A,…

…(KCNK2, VASN, ARNT2,PTGIS, PPARGC1A, CYP1A1) in…

…(PRDX3), peroxiredoxin 6 (PRDX6), thioredoxin 2 (TXN2),…

…decreased (PRDX1, PRDX3,PRDX6, TXN2, GSTK1, GSS,…

Show Full Abstract

Chronic kidney disease (CKD)-associated anemia is a global health concern and is linked to vascular and ocular complications. Hypoxia-inducible factor (HIF) stabilizers, or HIF prolyl hydroxylase inhibitors (PHIs), are promising candidates for the treatment of CKD-associated anemia. Since hypoxia and angiogenesis are involved in eye diseases, this study examined the effects of HIF-PHIs on metabolism and gene expression in retinal pigment epithelium (RPE) cells. Results revealed that PHIs differentially induced angiogenic (VEGFA, ANG) and glycolytic (PDK1, GLUT1) gene expression, with Roxadustat causing the strongest transcriptional changes. However, Roxadustat-induced angiogenic signals did not promote endothelial tube formation. Moreover, it did not induce oxidative stress, inflammation, or significant antioxidant gene responses in ARPE-19 cells. Roxadustat also reduced the inflammatory cytokine response to tumor necrosis factor-α, including IL-6, IL-8, and MCP-1, and did not exacerbate VEGF expression under high-glucose conditions. Overall, Roxadustat triggered complex gene expression changes without promoting inflammation or oxidative stress in RPE cells. Despite these findings, ophthalmologic monitoring is advised during PHI treatment in CKD patients receiving HIF-PHIs.

PTGIS
Also flagged:15-Hydroxyprostaglandin DehydrogenaseCelecoxibCyclooxygenase-2gene expressionbenign gynecologic diseasepolymerase
Journal Article 2025-07-21 ✓ 4 Snippets Han KH, Park S, Lee S, Ham J, Lim W, Song G, Kim HS.
In-Text Gene Mentions

…I2 synthase (PTGIS), aldo-keto reductase…

…findings, we selectedPTGIS, PTGES ,…

…genes, including PTGES,PTGIS, and AKR1C3, are…

…prostaglandin E synthasePTGIS prostaglandin I 2 synthaseprostaglandin I 2…

Show Full Abstract

<b>Background</b>: Peritoneal stretching from CO<sub>2</sub> insufflation is a primary mechanism of pain associated with laparoscopy. Cyclooxygenase-2 inhibitors are promising anti-inflammatory and analgesic agents. This study aimed to evaluate the effect of celecoxib on postoperative pain reduction and associated changes in peritoneal gene expression after laparoendoscopic single-site (LESS) surgery for benign gynecologic disease. <b>Methods</b>: In this randomized, double-blind, placebo-controlled pilot study, 70 patients were randomly assigned to receive either celecoxib or placebo (400 mg) 40 min before surgery. Peritoneal tissues were collected before and after CO<sub>2</sub> insufflation. We analyzed changes in expressions of prostaglandin I<sub>2</sub> synthase, prostaglandin E synthase (<i>PTGES</i>), <i>PTGES3</i>, aldo-keto reductase family 1 member C1, and 15-hydroxyprostaglandin dehydrogenase (<i>HPGD</i>). Numeric Rating Scale (NRS) pain scores were also compared between groups. <b>Results</b>: A total of 62 patients completed the study: 30 in the celecoxib group and 32 in the placebo group. The mean CO<sub>2</sub> exposure time was 60.4 min. In a quantitative real-time polymerase chain reaction analysis, <i>HPGD</i> mRNA expression significantly increased after surgery in patients exposed to CO<sub>2</sub> for more than 60 min. Patients treated with celecoxib showed a significantly higher rate of grade 3 expression (83.3% vs. 37.5%; <i>p</i> = 0.01) and a level 2 increase in <i>HPGD</i> expression on in situ hybridization (58.3% vs. 12.5%; <i>p</i> = 0.01), despite no significant difference on immunohistochemistry. Moreover, celecoxib effectively reduced NRS pain scores compared to placebo. <b>Conclusions</b>: In this pilot study, celecoxib appeared to reduce postoperative pain and was associated with increased HPGD mRNA expression in the peritoneal tissue of patients with prolonged CO<sub>2</sub> exposure during LESS surgery. These exploratory findings warrant confirmation in larger trials with functional validation of HPGD expression (ClinicalTrials.gov, NCT03391570).

Also flagged:Sex Hormone-Binding GlobulinSHBGtestosteroneUterine Fibroiduterine fibroidsBAIAP2L1
Journal Article 2025-07-21 No Snippets Ponomarenko M, Reshetnikov E, Churnosova M, Aristova I, Abramova M, Novakov V, Churnosov V, Polonikov A, Plotnikov D, Churnosov M, Ponomarenko I.
Show Full Abstract

In this study we searched for correlations between polymorphic variants that determine sex hormone-binding globulin concentration (SHBG<sub>con</sub>) and uterine fibroids (UFs). The work was performed on a sample of 1542 women (569 with UFs and 973 without UFs [control]), from whom we obtained experimental data on the distribution of nine single-nucleotide polymorphisms (SNPs) affecting the SHBG<sub>con</sub> (data confirmed in genome-wide association studies [GWASs]). When searching for associations with UFs, both the independent effects of SNPs and the effects of their SNP-SNP interactions (SNP-SNP<sub>ints</sub>) were taken into account during the "deep study" of the functionality of seven important UF loci and 115 strongly linked [r<sup>2</sup> ≥ 0.80] variants (an in silico methodology was used). As the results show, two SHBG<sub>con</sub>-related SNPs correlated with UF risk: rs3779195 [T/A] <i>BAIAP2L1</i> (OR<sub>AA</sub> = 0.38; 95%CI<sub>AA</sub> = 0.20-0.91; p<sub>perm(AA)</sub> = 0.023) and rs440837 [A/G] <i>ZBTB10</i> (OR<sub>GG</sub> = 1.93; 95%CI<sub>GG</sub> = 1.17-3.14; p<sub>perm(GG)</sub> = 0.010). At the same time, seven SHBG<sub>con</sub>-related SNPs interacting with each other (four models of such SNP-SNP<sub>ints</sub> [p<sub>perm</sub> ≤ 0.01)] were found to influence UF risk. These SHBG<sub>con</sub>-related SNPs, determining susceptibility to UF, showed strong functional relevance and were involved in pathways of gene transcription regulation, interactions with hormone ligand-binding receptors, the content control of SHBG, testosterone, liver enzymes, lipids, etc. This study's results demonstrate the effect of significant SHBG<sub>con</sub>-related genetic determinants of UF risk.

Also flagged:MicroplasmaHydroxyapatitetitaniumzirconiumhypersensitivitymetals
Journal Article 2025-07-21 No Snippets Voinarovych S, Maksimov S, Kaliuzhnyi S, Kyslytsia O, Safarova Yantsen Y, Alontseva D.
Show Full Abstract

Hydroxyapatite (HA) has become a widely used material for bone grafting and surface modification of titanium-based orthopedic implants due to its excellent biocompatibility. Among various coating techniques, microplasma spraying (MPS) has gained significant industrial relevance. However, the clinical success of HA coatings also depends on their adhesion to the implant substrate. Achieving durable fixation and reliable biological integration of orthopedic implants remains a major challenge due to insufficient coating adhesion and limited osseointegration. This study addresses challenges in dental and orthopedic implantology by evaluating the microstructure, mechanical properties, and biological behavior of bilayer coatings composed of a zirconium (Zr) sublayer and an HA top layer, applied via MPS onto titanium alloy. Surface roughness, porosity, and adhesion were characterized, and pull-off and shear tests were used to assess mechanical performance. In vitro biocompatibility was tested using rat mesenchymal stem cells (MSCs) to model osteointegration. The results showed that the MPS-fabricated Zr-HA bilayer coatings achieved a pull-off strength of 28.0 ± 4.2 MPa and a shear strength of 32.3 ± 3.2 MPa, exceeding standard requirements. Biologically, the HA top layer promoted a 45% increase in MSC proliferation over three days compared to the uncoated titanium substrate. Antibacterial testing also revealed suppression of <i>E. coli</i> growth after 14 h. These findings support the potential of MPS-applied Zr-HA coatings to enhance both the mechanical integrity and biological performance of titanium-based orthopedic implants.

HFE
Also flagged:Semaglutidesteatotic liver diseasetriglyceridesliver diseaseAFPadvanced
Journal Article 2025-07-21 ✓ 1 Snippet Suki M, Amer J, Milgrom Y, Massarwa M, Hazou W, Tiram Y, Perzon O, Sharif Y, Sackran J, Alon R, Lourie NEE, Raz I, Imam A, Khalaileh A, Safadi R.
In-Text Gene Mentions

…cholangitis, Wilson’s disease,hemochromatosis, or alpha-1 antitrypsin…

Show Full Abstract

<b>Introduction</b>: Semaglutide (SEMA) has shown potential benefits in metabolic dysfunction-associated steatotic liver disease (MASLD). This large real-world study aimed to evaluate the effects of SEMA on MASLD patients' clinical outcomes and liver-related complications. <b>Results</b>: Following propensity score matching based on 34 variables (demographics, comorbidities, laboratory tests, and medication history), SEMA-treated (<i>n</i> = 19,112) patients were compared with non-SEMA (<i>n</i> = 19,112) cases. Both cohorts were well-balanced, except for higher BMI in the SEMA group (36.60 ± 6.25 vs. 34.89 ± 6.84 kg/m<sup>2</sup>). After one year, the SEMA group demonstrated ~one BMI point reduction but maintained significantly higher BMI (35.51 ± 6.34 vs. 34.11 ± 6.64, <i>p</i> < 0.001). LDL, triglycerides, and HbA1c levels significantly improved with SEMA, as evidenced by decreased rates of poor metabolic markers (31.13% vs. 34.32%, <i>p</i> < 0.001). The SEMA-treated patients demonstrated significantly higher survival, lower cardiovascular risk, and reduced progression to advanced liver disease compared to controls. <b>Discussion</b>: In this large real-world cohort, SEMA use in MASLD patients was associated with significantly improved 1-year survival, cardiovascular, and liver-related outcomes. These benefits appear to result primarily from metabolic improvements and anti-inflammatory effects. <b>Materials and Methods</b>: Data were sourced from TriNetX, a global health research platform with de-identified electronic medical records spanning 135 million patients across 112 healthcare organizations worldwide. We included MASLD adults diagnosed according to ICD9 criteria. Assessed outcomes included survival, biochemical, hematologic, AFP, metabolic and cardiovascular parameters, advanced liver disease (ALD), synthetic function, and metabolic markers. <b>Conclusions</b>: Semaglutide may serve as an effective therapeutic strategy to improve outcomes in MASLD.

Also flagged:Colorectal Cancercancertumorβ-mannanasepolyethylene glycolglucomannan
Journal Article 2025-07-21 No Snippets Zhang X, Lian R, Fan B, Meng L, Zhang P, Zhang Y, Sun W.
Show Full Abstract

<b>Objectives:</b> Colorectal cancer (CRC) is a leading cause of cancer-related mortality, driven by chronic inflammation, gut microbiota dysbiosis, and complex tumor microenvironment interactions. Current therapies are limited by systemic toxicity and poor tumor accumulation. This study aimed to develop a ROS/enzyme dual-responsive oral drug delivery system, KGM-CUR/PSM microspheres, to achieve precise drug release in CRC and enhance tumor-specific drug accumulation, which leverages high ROS levels in CRC and the β-mannanase overexpression in colorectal tissues. <b>Methods:</b> In this study, we synthesized a ROS-responsive prodrug polymer (PSM) by conjugating polyethylene glycol monomethyl ether (mPEG) and mesalazine (MSL) via a thioether bond. CUR was then encapsulated into PSM using thin-film hydration to form tumor microenvironment-responsive micelles (CUR/PSM). Subsequently, konjac glucomannan (KGM) was employed to fabricate KGM-CUR/PSM microspheres, enabling targeted delivery for colorectal cancer therapy. The ROS/enzyme dual-response properties were confirmed through in vitro drug release studies. Cytotoxicity, cellular uptake, and cell migration were assessed in SW480 cells. In vivo efficacy was evaluated in AOM/DSS-induced CRC mice, monitoring tumor growth, inflammatory markers (TNF-α, IL-1β, IL-6, MPO), and gut microbiota composition. <b>Results:</b> In vitro drug release studies demonstrated that KGM-CUR/PSM microspheres exhibited ROS/enzyme-responsive release profiles. CUR/PSM micelles demonstrated significant anti-CRC efficacy in cytotoxicity assays, cellular uptake studies, and cell migration assays. In AOM/DSS-induced CRC mice, KGM-CUR/PSM microspheres significantly improved survival and inhibited CRC tumor growth, and effectively reduced the expression of inflammatory cytokines (TNF-α, IL-1β, IL-6) and myeloperoxidase (MPO). Histopathological and microbiological analyses revealed near-normal colon architecture and microbial diversity in the KGM-CUR/PSM group, confirming the system's ability to disrupt the "inflammation-microbiota-tumor" axis. <b>Conclusions:</b> The KGM-CUR/PSM microspheres demonstrated a synergistic enhancement of anti-tumor efficacy by inducing apoptosis, alleviating inflammation, and modulating the intestinal microbiota, which offers a promising stimuli-responsive drug delivery system for future clinical treatment of CRC.

HFE
Also flagged:ironmanganesebone formationbiodegradationsilvercalcium
Journal Article 2025-07-21 ✓ 1 Snippet Putra NE, Xu J, Leeflang MA, Kops N, Klimopoulou M, Moosabeiki V, Fratila-Apachitei LE, Zhou J, van Osch GJVM, Farrell E, Zadpoor AA.
In-Text Gene Mentions

…or progression tohemochromatosis.…

Show Full Abstract

Additively manufactured (AM) iron (Fe)-based scaffolds have been developed as promising biodegradable bone-substituting biomaterials. Multi-material extrusion-based 3D printing has recently yielded Fe-manganese (Mn) alloy-based scaffolds that can resolve ferromagnetism and cytotoxicity associated with Fe-based biomaterials. Herein, we, for the first time, present the findings from <i>in vivo</i> study on extrusion-based AM FeMn-akermanite (Ak) scaffolds for critical-size bone defect repair. The scaffolds comprised Fe, 35 wt% Mn, and 20 or 30 vol% Ak, with microporous struts and 61-63 % porosity. Both scaffolds exhibited mechanical properties within the range of trabecular bone and provided suitable sites for Ca/P deposition during <i>in vitro</i> biodegradation. <i>In vitro</i> cell cultures demonstrated favorable cell responses without negating the osteogenic potential of cells. An <i>in vivo</i> study was conducted in a murine semi-orthotopic subcutaneous model. With this model, 4 bovine bone plugs were implanted subcutaneously with critical-size defects created at their cores. Scaffolds were placed into these critical-size defects to assess biodegradation and bone formation. After 16 weeks, the volume of scaffolds decreased by 6-8 %. The FeMn-20Ak scaffolds retained their yield strength and elastic modulus during the 16 weeks <i>in vivo</i>, whereas the mechanical integrity of FeMn-30Ak scaffolds deteriorated after mechanical push-out tests. Excellent osseointegration of both scaffold groups was apparent. 3D reconstruction of CT images revealed that FeMn-30Ak scaffolds had more newly formed tissue in the macro-pores than FeMn-20Ak. Altogether, our findings demonstrate the potential of AM FeMn-Ak scaffolds as biodegradable bone substitutes, encouraging further <i>in vivo</i> research in a large animal model.

SERPINC1
Also flagged:peripheral artery diseasetype 2 diabetesPADDiabetestype 2 diabetes mellituslipoprotein
Journal Article 2025-07-21 ✓ 1 Snippet Haile KE, Amsalu AA, Kassie GA, Asgedom YS, Azeze GA, Gebrekidan AY.
In-Text Gene Mentions

…of anticoagulants like anti-thrombin-IIIand protein C,…

Show Full Abstract

<h4>Background</h4>Type 2 diabetes and lower-extremity peripheral artery disease (PAD) are growing global health problems associated with considerable cardiovascular and limb-related morbidity and mortality, poor quality of life, and high healthcare resource use and costs. Diabetes is a well-known risk factor for PAD, which further increases the risk of long-term complications. The primary aim of this systematic review was to ascertain the aggregated prevalence of PAD among individuals diagnosed with type 2 diabetes mellitus (T2DM) residing in sub-Saharan Africa.<h4>Objective</h4>The aim of this study was to determine the pooled prevalence and associated factors of PAD among patients with T2DM in sub-Saharan Africa.<h4>Methods</h4>A systematic review and meta-analysis was performed in alignment with the guidelines established by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses. To identify papers published in English up to 8 November 2024, the electronic databases of Medline, Web of Science, Science Direct, Excerpta Medica Database, Cochrane Library, African Journals Online, and Google Scholar were searched. A random-effects model was employed to estimate the pooled prevalence and associated factors of PAD.<h4>Results</h4>This study revealed that the pooled prevalence of PAD among patients with T2DM was 35.7% [95% confidence interval (CI) 28.7, 42.7], reflecting the significant impact of DM on vascular health with statistically significant heterogeneity observed between studies (<i>I</i> <sup>2</sup> = 94.9%, <i>p</i> < 0.001). Age, elevated low-density lipoprotein, elevated body mass index (BMI), and diabetes illness duration exceeding 10 years were the significant predictors.<h4>Conclusion</h4>The aggregate burden of PAD in individuals with T2DM within the sub-Saharan African region is estimated at 35.7%, suggesting that a considerable segment of the sub-Saharan population has been impacted. Epidemiological studies utilizing precise assessment tools can enhance the early detection and prevention of PAD in T2DM and improve the certainty of findings.<h4>Clinical implication</h4>There is a need for integrated care approaches that prioritize the screening and management of PAD in individuals with T2DM. Given the high prevalence and associated complications, healthcare providers should implement routine PAD assessments in diabetes care protocols. Future research should focus on longitudinal studies that explore the causal relationships between risk factors and the development of PAD in patients with T2DM.<h4>Systematic review registration</h4>https://www.crd.york.ac.uk/prospero, identifier CRD42024611838.

BTN2A1
Also flagged:JMJD8breast cancercGASSTINGtumorBRCA
Journal Article 2025-07-21 ✓ 1 Snippet Zhu C, Xi T, Yang G, Lu W, Wang S, Cao J.
In-Text Gene Mentions

…p < 0.001),BTN2A1(r = 0.144,…

Show Full Abstract

<h4>Background</h4>Breast cancer has severe consequences due to late diagnosis and the lack of effective therapies. Currently, potential biomarkers for breast cancer have not been systematically evaluated. Research has shown that JMJD8 is associated with cGAS-STING pathway and plays a role in various tumor microenvironments, but its relationship with breast cancer remains unclear. We investigate the relationship between JMJD8 and the prognosis and immune infiltration microenvironment of breast cancer, exploring its potential as a prognostic biomarker for this type of cancer.<h4>Methods</h4>In this study, we utilized data from The Cancer Genome Atlas (TCGA) to assess the association between JMJD8 expression and clinical characteristics in breast cancer (BRCA) patients through the Wilcoxon signed-rank test and logistic regression. Additionally, we employed Kaplan-Meier and Cox regression methods to confirm the impact of JMJD8 expression levels on overall survival. We constructed JMJD8 knockout BRCA cell lines and studied the effects of JMJD8 protein on tumor cell proliferation and anti-tumor immunity at both cellular and animal levels.<h4>Results</h4>Compared to normal tissues, JMJD8 expression levels were significantly elevated in BRCA tissues. High JMJD8 expression was closely associated with advanced pathological stages and was identified as an independent factor negatively impacting overall survival. In both cellular and animal experiments, JMJD8 knockout relieved the inhibition of the cGAS-STING pathway. This resulted in a significant enhancement of the anti-tumor immune response, as it induced dendritic cell (DC) antigen presentation and maturation, ultimately inhibiting the proliferation of BRCA cells. Furthermore, the JMJD8 expression was positively correlated with the infiltration of M2 macrophages in the tumor microenvironment, suggesting that JMJD8 may contribute to the deterioration of the tumor immunosuppressive microenvironment, potentially leading to reduced patient survival.<h4>Conclusion</h4>The elevated expression of JMJD8 in breast cancer tissues is indicative of its involvement in the progression of the disease and its association with immune cell infiltration patterns. Our findings support the hypothesis that JMJD8 could serve as a prognostic biomarker, reflecting the immunosuppressive characteristics of the tumor microenvironment and aiding in the development of targeted therapeutic strategies for breast cancer management.

TNFSF4
Also flagged:lung adenocarcinomaLUADGene ExpressionANLNcell proliferationanillin
Journal Article 2025-07-21 ✓ 1 Snippet Ma K, Xu J, Wang C, Cao X, Yu W, Xi J, Zhang X, Zhan J, Liu Y, Yu A, Liu S, Liu Y, Chen C, Mai X.
In-Text Gene Mentions

…PDCD1LG2, TNFRSF18, TNFRSF9,TNFSF4and TNFSF9 were…

Show Full Abstract

<h4>Introduction</h4>The development of high-throughput sequencing technologies and targeted therapeutic strategies has significantly improved the prognosis of lung adenocarcinoma (LUAD) patients with sensitive gene mutations. However, patients harboring rare or no actionable mutations were rarely benefit from these targeted therapies. This study aimed to identify novel molecular subtypes and construct a prognostic signature to enhance the stratification of LUAD prognosis.<h4>Materials and methods</h4>Novel molecular subtypes of LUAD patients were identified by applying 10 distinct clustering algorithms on multi-omics data. Single-cell RNA-sequencing (scRNA-seq) data were integrated to characterize subtype-specific immune microenvironments. A multi-omics and machine learning-driven prognostic signature (MO-MLPS) was constructed in The Cancer Genome Atlas (TCGA) LUAD dataset using ten machine learning algorithms and subsequently validated across six independent datasets from the Gene Expression Omnibus (GEO) database. The robustness of the model was assessed using the concordance index (C-index), Kaplan-Meier survival analyses, receiver operating characteristic (ROC) curves, and both univariate and multivariate Cox regression analyses. We further confirmed the effects of ANLN knockdown and the expression of a domain-negative anillin protein (dnANLN) via western blotting, cell proliferation assays, flow cytometry, and transwell migration assays <i>in vitro</i>.<h4>Results</h4>Our analysis revealed that the novel molecular subtypes exhibited differences in prognoses, biological functions, and immune infiltration profiles in LUAD. The MO-MLPS was successfully established and validated across TCGA-LUAD cohorts, six independent GEO datasets, and their composite meta-cohort. Higher risk scores from the MO-MLPS correlated with poorer prognosis in LUAD, with AUC values exceeding 0.5 at 1, 3, and 5 years across various cohorts. The signature outperformed 49 previously published prognostic signatures. Furthermore, patients classified as high risk exhibited significantly worse overall and progression-free survival than those classified as low risk. Notably, ANLN knockdown and dnANLN expression significantly inhibited cell proliferation and migration <i>in vitro</i> and enhanced the efficacy of docetaxel.<h4>Conclusion</h4>A comprehensive analysis of multi-omics data redefines the molecular subtype of LUAD patients. The MO-MLPS derived from subtype characteristics has the potential to serve as a clinically valuable prognostic tool. Furthermore, ANLN emerges as a promising novel therapeutic target in the treatment of LUAD.

Also flagged:cell proliferationgene expressionmetabolismascorbic acidOAECM proteins
Journal Article 2025-07-21 No Snippets Bozhokin MS, Korneva YS, Bozhkova SA, Mikhaylova ER, Marchenko DM, Rakhimov BR, Nashchekina YA, Khotin MG.
Show Full Abstract

Hyaline cartilage (HC) is a specialized connective tissue that covers the surfaces of major joints and is characterized by its limited regenerative capacity. Modern therapeutic approaches to HC restoration often do not provide complete regeneration of damaged tissue. Developed tissue engineering methods show promise as effective approaches for restoring various types of HC damage. Due to the rapid evolution of various technologies in research practice, the range of methods available for analysis of TE constructs has expanded, including for the study of tissue engineering of hyaline cartilage (TEHC). Because of the complexity of the HC's structure, a whole range of methods is needed to assess characteristics of the scaffold, such as structure and strength. It is also important to study the behavior of cells inside the TE construct at all stages of cultivation, including post transplantation into the damaged area. The opacity of the scaffold and the complexity of its architecture often cause issues with the cell visualization and assessment of their viability. Therefore, there is a need to optimize each specific method for each specific scaffold. Despite the active study of TEHC, the results remain unsatisfactory. In this study, we have systematized data on the effectiveness and feasibility of methods to analyze structure, mechanical characteristics, cell interaction with the scaffold, and their ability to form new tissue before and after transplantation.

Also flagged:ferroptosisdeathironautophagyAlzheimer's diseaseAD
Journal Article 2025-07-21 No Snippets Zhou B, Li J, Wu A, Wang X, Cheng L, Yang G, Gao D, Zhu C.
Show Full Abstract

Ferroptosis is a newly discovered form of programmed cell death, primarily caused by an imbalance between iron-dependent oxidative damage and antioxidant defense mechanisms within the cell. It differs from previously reported forms of cell death, such as apoptosis, necrosis, and autophagy, in terms of morphology, biochemistry, and genetics. Alzheimer's disease (AD) is the most common neurodegenerative disorder, characterized by pathological features including neurofibrillary tangles (NFTs), senile plaques (SPs), and abnormal iron deposition, suggesting that ferroptosis may be involved in its disease progression. Although recent studies have made significant progress, the mechanisms underlying neuronal ferroptosis in AD remain incompletely understood. This review, based on elucidating the process and regulatory mechanisms of cellular ferroptosis, explores, and supplements the correlation between iron overload and redox imbalance with the main pathological mechanisms of AD, providing new insights for the treatment of AD and the development of new drugs.

PEBP1
Also flagged:ferroptosispathogenesisgene expressionoxygenironNRF2
Journal Article 2025-07-21 ✓ 5 Snippets Chen L, Chen B, Su X.
In-Text Gene Mentions

…biomimetic nanovesicles forPEBP1mRNA delivery to…

…dataset GSE237230 highlightedPEBP1as a key…

…Overexpression ofPEBP1in VSMCs enhanced…

…effective delivery ofPEBP1mRNA.…

…targeting ferroptosis throughPEBP1mRNA delivery, offering…

Show Full Abstract

An abdominal aortic aneurysm (AAA) is a life-threatening vascular condition characterized by the dilation of the abdominal aorta, with ferroptosis playing a significant role in its pathogenesis. This study investigates the therapeutic potential of engineering biomimetic nanovesicles to deliver phosphatidylethanolamine-binding protein 1 (PEBP1) mRNA for inhibiting ferroptosis in vascular smooth muscle cells (VSMCs) and preventing AAA progression. Differential gene expression analysis of the AAA transcriptomic dataset GSE57691 identified 243 differentially expressed genes (DEGs), intersecting with 12 ferroptosis-related genes. Single-cell analysis of dataset GSE237230 highlighted PEBP1 as a key gene in VSMCs. Overexpression of PEBP1 in VSMCs enhanced proliferation, reduced reactive oxygen species (ROS) and iron levels, and inhibited apoptosis and ferroptosis via the NRF2/GPX4 axis. The engineered biomimetic nanovesicles demonstrated significant uptake by VSMCs and effective delivery of PEBP1 mRNA. In vivo studies confirmed that these nanovesicles substantially inhibited AAA progression in mice. This study presents a novel bioengineering approach for AAA treatment by targeting ferroptosis through PEBP1 mRNA delivery, offering a promising molecular strategy for the prevention and management of AAA.

DCC
Also flagged:distal cholangiocarcinomamalignant neoplasmextrahepatic cholangiocarcinomaEHCCpancreatic duct adenocarcinomaPDAC
Journal Article 2025-07-21 ✓ 4 Snippets Xu S, Zhang XP, Wang JP, Zhao ZM, Gao YX, Han B, Chen X, Ma YT, Xu ZZ, Liu Z, Li ES, Yu GS, Liu R, Liu J.
In-Text Gene Mentions

…duct adenocarcinoma (PDAC),DCCis typically diagnosed…

…operative pathology confirmingDCC; (IV) American Society…

DCCis a highly…

…to patients withDCC, with studies indicating…

Show Full Abstract

<h4>Background</h4>Pancreaticoduodenectomy (PD) is the only potentially curative treatment for distal cholangiocarcinoma (DCC). This multicenter propensity score matching (PSM) study aimed to compare the perioperative and oncological outcomes of laparoscopic PD (LPD) and robotic PD (RPD) after the learning curve of surgeons.<h4>Methods</h4>Consecutive patients with DCC who underwent curative LPD or RPD at eight Chinese centers between January 2016 and December 2022 were included. PSM was performed to minimize selection bias. Univariate and multivariate logistic regression analyses were used to identify independent prognostic factors for textbook outcome (TO) in these patients.<h4>Results</h4>Overall, 529 patients who underwent PD for DCC were included, of which 251 underwent LPD and 278 underwent RPD. After PSM, 227 patients were enrolled into each group. There were no significant differences in estimated blood loss (EBL), lymph node harvest, intraoperative transfusion, vascular resection, R0 resection, severe complications, readmission, 30-day mortality, or long-term survival between the two groups. However, after the learning curve, RPD had a perioperative advantage over LPD, especially in terms of operation time (270 <i>vs</i>. 300 min, P<0.001). Similar conclusions were drawn in the subgroup analysis. Multivariable analysis showed that comorbidities (P=0.001), main pancreatic duct (MPD) >3 mm (P=0.001), and operative time >360 min (P=0.006) were significantly associated with TO.<h4>Conclusions</h4>After the surgeon's learning curve, the feasibility and safety of LPD and RPD for DCC patients are comparable. Randomized controlled trials (RCTs) should be performed to confirm these findings.

bioRxiv 2025-07-21 Preprint (No Snippets API) Brás IC, Xie Y, Southwell AL.
Show Full Abstract

Huntington disease (HD) is a neurodegenerative disease caused by a trinucleotide repeat expansion in the HTT gene encoding an elongated polyglutamine tract in the huntingtin (HTT) protein. The use of biomarkers has become a major component in preclinical studies focusing on HTT lowering strategies. Quantification of soluble mutant HTT (mHTT) in cerebrospinal fluid (CSF) has served as a pharmacodynamic readout and as potential disease progression biomarker. However, development of future assays for HTT measurement from other biofluids, such as blood, will facilitate the access to human samples since CSF collection is an invasive outpatient procedure. Brain cells, in particular neurons, secrete extracellular vesicles (EVs) that cross the blood-brain barrier and circulate in blood. Importantly, EVs have been identified to be involved in HTT export from cells to the extracellular space. However, it is unknow which vesicle subtype correlates better with HD progression. Our work investigates the potential of EVs as non-invasive sources of clinical biomarkers in liquid biopsies. We developed an optimized ultracentrifugation protocol for the purification of ectosomes and exosomes from human samples and plasma of humanized HD mouse models. Ectosomes are larger vesicles that bud from the plasma membrane of cells, whereas exosomes originate from multivesicular bodies and are afterwards released to the extracellular space. Consistent with previous published data in other model systems, ectosomes isolated from plasma of the Hu97/18 mouse model contain both wild-type (wt) and mHTT in higher levels than in exosomes. Similar results were observed in media from HD induced pluripotent stem cells (iPSCs)-differentiated neurons and in Hu97/18 primary neuronal cultures. Interestingly, we also found higher levels of HTT transcripts in this EV subtype. We further demonstrate that initial storage of the samples using a slow freezing protocol preserves HTT and EV protein marker levels, highlighting the importance of sample preparation for EV isolation and analysis. Our results also show that plasma contains vesicles originated from neuronal cells that can be isolated using neuron-specific markers, such as ATPase Na+/K+ transporting subunit alpha 3 (ATP1A3), allowing the evaluation of HTT levels in the brain through vesicles circulating in the blood. Overall, our results demonstrate that HTT protein measurement from EVs isolated from blood can be a potential less-invasive disease biomarker. We also demonstrate that EVs subtypes contain different HTT protein and RNA levels, important for the development of consistent and reliable biomarkers. Further characterization of neuron-specific EVs content from patient-derived biofluids will lead to the development of novel clinical biomarkers and for evaluation of therapeutic strategies.

PRDX6
Also flagged:FerritinophagyFerroptosisIschemic Strokecerebrovascular diseasedeathcerebral infarction
Journal Article 2025-07-20 ✓ 1 Snippet Shi Z, Chen K, Wang Y, Du H.
In-Text Gene Mentions

…CDKN1A, PRDX1, andPRDX6were significantly correlated…

Show Full Abstract

Ischemic stroke is a common cerebrovascular disease accompanied by a large number of neuronal death and severe functional impairment. In recent years, the role of ferroptosis and ferritinophagy in neuronal death after cerebral infarction has attracted great interest in the field of ischemic stroke. Ferroptosis is a newly discovered programmed cell death pattern characterized by iron overload, dysregulation of the xCT/GSH/GPX4 system, and lipid peroxidation system, which is closely associated with neurological damage after ischemic stroke. Ferritinophagy is a selective autophagy mediated by NCOA4 that regulates intracellular iron metabolism, and can be regulated by factors such as intracellular iron content and HERC2-FBXL5-IPR2 axis. Under normal physiological conditions, ferritinophagy maintains the balance of intracellular iron elements, and excessive activation can cause ferroptosis. Here, we mainly review the general mechanisms of ferroptosis and ferritinophagy, and focus on the relationship between ischemic stroke and ferroptosis/ferritinophagy. Specifically, we explored the crosstalk of ferroptosis and ferritinophagy in ischemic stroke and outlined current treatment strategies and key challenges. These observations may help to further understand the pathological events of ischemic stroke and bridge the gap between basic and translational research to provide novel insights for its treatment.

Also flagged:Cas9endonucleasecell cycleCRISPRgenetic diseasessickle cell anaemia
Journal Article 2025-07-20 No Snippets Far BF, Akbari M, Habibi MA, Katavand M, Nasseri S.
Show Full Abstract

CRISPR-Cas9 technology has rapidly advanced as a transformative genome-editing platform, facilitating precise genetic modifications and expanding therapeutic opportunities across various diseases. This review explores recent developments and clinical translations of CRISPR applications in oncology, genetic and neurological disorders, infectious diseases, immunotherapy, diagnostics, and epigenome editing. CRISPR has notably progressed in oncology, where it enables the identification of novel cancer drivers, elucidation of resistance mechanisms, and improvement of immunotherapies through engineered T cells, including PD-1 knockout CAR-T cells. Clinical trials employing CRISPR-edited cells are demonstrating promising results in hematologic malignancies and solid tumours. In genetic disorders, such as hemoglobinopathies and muscular dystrophies, CRISPR-Cas9 alongside advanced editors like base and prime editors show significant potential for correcting pathogenic mutations. This potential was affirmed with the FDA's first approval of a CRISPR-based therapy, Casgevy, for sickle cell disease in 2023. Neurological disorders, including Alzheimer's, ALS, and Huntington's disease, are increasingly targeted by CRISPR approaches for disease modelling and potential therapeutic intervention. In infectious diseases, CRISPR-based diagnostics such as SHERLOCK and DETECTR provide rapid, sensitive nucleic acid detection, particularly valuable in pathogen outbreaks like SARS-CoV-2. Therapeutically, CRISPR systems target viral and bacterial genomes, offering novel treatment modalities. Additionally, CRISPR-mediated epigenome editing enables precise regulation of gene expression, expanding therapeutic possibilities. Despite these advances, significant challenges remain, including off-target effects, delivery methodologies, immune responses, and long-term genomic safety concerns. Future improvements in editor precision, innovative delivery platforms, and enhanced safety assessments will be essential to fully integrate CRISPR-based interventions into standard clinical practice, significantly advancing personalised medicine.

MLLT10
Also flagged:waterbehavioralserotonindopaminemetabolismgene expression
Journal Article 2025-07-20 ✓ 2 Snippets Rozenberg JM, Boguslavsky D, Chistopolsky I, Zakharov I, Dyakonova V.
In-Text Gene Mentions

…Smurf2; Bptf; Dgkb;Mllt10; and Cacnb2.…

Mllt10and Bptf are…

Show Full Abstract

In the freshwater snail <i>L. stagnalis</i>, two hours of shallow water crawling exercise are accompanied by the formation of memory, metabolic, neuronal, and behavioral changes, such as faster orientation in a novel environment. Interestingly, rest following exercise enhances serotonin and dopamine metabolism linked to the formation of memory and adaptation to novel conditions. However, the underlying transcriptional responses are not characterized. In this paper, we show that, while two hours of forced crawling exercise in <i>L. stagnalis</i> produce significant changes in nervous system gene expression, the subsequent rest induces a completely distinct transcriptional program. Chromatin-modifying, vesicle transport, and cell cycle genes were induced, whereas neurodevelopmental, behavioral, synaptic, and hormone response genes were preferentially repressed immediately after two hours of exercise. These changes were normalized after two hours of the subsequent rest. In turn, rest induced the expression of genes functioning in neuron differentiation and synapse structure/activity, while mitotic, translational, and protein degradation genes were repressed. Our findings are likely relevant to the physiology of exercise, rest, and learning in other species. For example, chronic voluntary exercise training in mice affects the expression of many homologous genes in the hippocampus. Moreover, in humans, homologous genes are pivotal for normal development and complex neurological functions, and their mutations are associated with behavioral, learning, and neurodevelopmental abnormalities.

HFE
Also flagged:IronHereditary hemochromatosisliver cirrhosisdilated cardiomyopathyheart failurediabetes
Journal Article 2025-07-20 ✓ 5 Snippets Batool M, Ehsan N, Imran M, Qaisar W, Malik MN.
In-Text Gene Mentions

…tary hemochromatosis protein (HFE) gene are most…

…commonly associated withhemochromatosisin the Caucasian…

…South Asian populations,HFEgene mutations are…

…mutation in theHFEgene causes dysregulated…

…a case ofhemochromatosismay prove to…

Show Full Abstract

Hereditary hemochromatosis is characterized by excessive iron absorption through the gut and its deposition in the body. In many instances, symptoms do not arise until significant organ damage has occurred. Diagnosing a case of hereditary hemochromatosis is difficult even after the appearance of symptoms due to the diverse clinical presentations. Genetic testing should be done, whenever possible, to determine the underlying genetic abnormality. We present the case of a 42-year-old man who came to us with complaints of generalized body swelling and shortness of breath on exertion. He was found to have liver cirrhosis, dilated cardiomyopathy, and heart failure with reduced ejection fraction, bronze diabetes, and hypogonadotropic hypogonadism. He was diagnosed with hereditary hemochromatosis based on the clinical findings, markedly elevated serum ferritin levels (>2000 ng/dl), transferrin saturation (98%), and imaging, which revealed pathology involving the liver, pancreas, spleen, and the pituitary gland. Genetic testing could not be done due to the scarcity of resources. The patient underwent phlebotomy initially but was later put on an oral iron chelator, deferasirox, due to a drop in hemoglobin levels. This publication highlights the diagnostic challenge posed by hereditary hemochromatosis, particularly in regions with low disease prevalence, and the need for early detection to prevent advanced organ dysfunction.

Also flagged:diabetesatherosclerosischronic kidney diseasetissue homeostasisagingcalcium
Journal Article 2025-07-19 No Snippets Nogueira LFB, de Melo MT, Cominal JG, da Silva KR, Fukada SY, Bottini M, Brizuela L, Ciancaglini P, Mebarek S, Ramos AP.
Show Full Abstract

Pathological calcification of soft tissue, particularly in vascular structures, is a hallmark of several cardiovascular diseases and significantly contributes to vascular stiffening and dysfunction. Despite sharing similarities with physiological ossification, the mechanisms driving the transdifferentiation of mouse vascular smooth muscle cells (MOVAS) into osteochondroblast-like phenotypes remain poorly understood. This transdifferentiation plays a critical role in the initiation and progression of pathological calcification. In this study, we developed a bioinspired 3D scaffold, composed of type I collagen (Col) and κ-carrageenan (κ-Carr), designed to mimic key aspects of the vascular extracellular matrix (ECM). This novel scaffold provides a physiologically relevant platform to study soft tissue calcification under osteogenic conditions. We demonstrated that this 3D system supports MOVAS cell adhesion, spreading, and transdifferentiation into a mineralizing phenotype in a controlled manner, as evidenced by the overexpression of osteogenic markers (TNAP and RUNX2), increased alkaline phosphatase activity, and controlled calcium phosphate deposition. Spectroscopic and thermogravimetric analyses revealed the formation of carbonated apatite minerals and a calcium-deficient apatite structure, indicative of controlled mineral deposition within the organic matrix. The incorporation of κ-carrageenan enhanced the calcification process, underscoring the importance of biochemical cues in directing the MOVAS phenotype changes. This scaffold system effectively replicates the spatial organization and physicochemical cues of the vascular ECM, providing a unique and innovative model to study pathological calcification processes. Moreover, this approach holds significant potential for developing regenerative biomaterials and therapeutic strategies aimed at preventing vascular calcification, opening new avenues for clinical applications and therapeutic interventions in cardiovascular disease.

Also flagged:mitochondrialcox1
Journal Article 2025-07-19 No Snippets Rajapakse RPVJ, Karunathilake KJK, Fernando TSP, Doan HTT, Blair D, Le TH.
Show Full Abstract

Post-mortem examinations of elephants in Sri Lanka's Yala National Park morphologically identified amphistome flukes as Pseudodiscus collinsi, a species previously found in Indian elephants. These Sri Lankan worms had 100% ITS-2 sequence identity with that of the Indian P. collinsi Wayanad specimen (GenBank: PQ046280). This species is currently placed in the paramphistomoid family Gastrodiscidae. We compared three markers, ITS-2, partial 28S rDNA (D1-D3 domain), and partial mitochondrial cox1 sequences to previously published data and constructed three maximum likelihood (ML) phylogenies. Across the three phylogenies, the Sri Lankan sequences grouped with other members of the Gastrodiscidae only in the tree inferred from cox1 sequences, albeit with low bootstrap support. The three ML phylogenies revealed inconsistent generic and familial interrelationships. They also suggested that the placement of P. collinsi in the Gastrodiscidae, may need to be reconsidered We report the first record of the amphistome Pseudodiscus collinsi Cobbold, 1875 Sonsino, 1895 (Paramphistomoidea: Platyhelminthes), using morphological and molecular identification, in wild elephants in Sri Lanka.

CACNA1E
Also flagged:ADtauage-associated cognitive impairmentnucleusgene expressionglutamate
Journal Article 2025-07-19 ✓ 1 Snippet Bartas K, Nguyen M, Zhao W, Hui M, Nie Q, Beier KT.
In-Text Gene Mentions

…ion channel genesCacna1e, Cacna1b ,…

Show Full Abstract

Analysis of system-wide cellular communication changes in Alzheimer's disease (AD) has recently been enabled by single nucleus RNA sequencing (snRNA-seq) and new computational methods. Here, we combined these to analyze data from postmortem human tissue from the entorhinal cortex of people with AD and compared our findings to those from multiomic data from the 5xFAD amyloidogenic mouse model at two different time points. Using the cellular communication inference tool CellChat we found that disease-related changes were largely related to neuronal excitability as well as synaptic communication, with specific signaling pathways including BMP, EGF, and EPHA, and relatively poor conservation of glial-related changes during disease. Further analysis using the neuron-specific NeuronChat revealed changes relating to metabotropic glutamate receptors as well as neuronal adhesion molecules including neurexins and neuroligins. Our results that cellular processes relating to excitotoxicity are the best conserved between 5xFAD mice and AD suggest that excitotoxicity is the main common feature between pathogenesis in 5xFAD mice and people with AD.

Also flagged:17-β-hydroxysteroid dehydrogenase 4HSD17B4oxidoreductasesteroidlipidmetabolism
Journal Article 2025-07-19 No Snippets Liao MB, Lau ATY, Xu YM.
Show Full Abstract

17-β-hydroxysteroid dehydrogenase 4 (HSD17B4), abundantly present in the peroxisomal regions of mammalian cells, is an oxidoreductase that catalyzes the oxidoreduction of steroid substrates. Impairment of lipid metabolism represents one of the most critical metabolic alterations in cancer, with lipid metabolic processes tightly linked to tumor cell proliferation, survival, invasion, and metastasis. HSD17B4 is primarily involved in the regulation of cellular fatty acid and hormone metabolism. Therefore, HSD17B4 is closely related to tumors, but few relevant studies exist. Polymorphisms and methylation of the HSD17B4 gene, as well as acetylation of the HSD17B4 protein, influence its expression and function, impacting cancer progression and therapeutic response. Recent findings also highlight HSD17B4 as a potential therapeutic target and prognostic biomarker in various cancers. Here, we will discuss the latest literature on human HSD17B4 and its clinical implications.

Also flagged:eye diseaseocular diseasesphagocytosisvisionchoroidal neovascularizationneovascular AMD
Journal Article 2025-07-19 No Snippets Yan C, Figueiredo CA, Pompös IM, Ugursu B, Arribas-Lange P, Skosyrski S, Yang S, Althoff P, Kociok N, Joussen AM, Wolf SA.
Show Full Abstract

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide, with a clinical presentation that varies between sexes. In late-stage AMD, choroidal neovascularization (CNV) triggers retinal inflammation and degeneration, processes that are exacerbated by an overactive response of retinal microglial cells. Short-chain fatty acids (SCFAs) have emerged as potential treatments for AMD due to their anti-inflammatory properties. In this study, we investigate the effects of SCFA treatment in a laser-induced CNV mouse model, focusing on sex-dependent differences in disease progression and microglial response. Our findings demonstrate distinct sex-specific patterns in the development of CNV and associated pathological hallmarks. SCFA treatment resulted in a slight increase in density of Iba1<sup>+</sup> microglial cells in females at 3 days post-laser (3dpl), while it prevented an increase in males at 7 dpl, with both sexes showing enhanced microglial ramification. The dynamics of microglial density were likely linked to protective effects on CNV lesion, leakage size, and inflammation, which occurred earlier in females and later in males. At transcriptional level, SCFA showed mixed effects, mainly targeting inflammation resolution, mitochondrial support, and neuronal repair in a sex-dependent manner. In vitro, SCFAs reduced microglial phagocytosis of retinal debris, suggesting a potential anti-inflammatory action. This study underscores the importance of considering sex-specific responses in the development of AMD treatments, such as SCFAs, and highlights the need for personalized therapeutic strategies.

OLFM4
Also flagged:brain injuryinflammatory responsesimmune responseimmune responseschemotaxisSerpine 1
Journal Article 2025-07-19 ✓ 5 Snippets Bremer AS, Henschel N, Burkard H, Bernis ME, Ulas T, Sabir H.
In-Text Gene Mentions

…were e.g. Olfactomedin (Olfm4), Selectin P (Selp),…

…other conditions Selp,Olfm4, Serpine1 and pro-apoptotic…

…the four groups,Olfm4, Selp, Serpine 1,…

Olfm4was significantly upregulated…

Olfm4is expressed in…

Show Full Abstract

<h4>Background</h4>Inflammation-sensitized hypoxic-ischemic brain injury significantly contributes to neonatal mortality as affected neonates do not benefit from standard cooling treatments. To get further insight into inflammatory responses involved, we experimentally investigated the immune response of microglia in an inflammation-sensitized neonatal hypoxia-ischemia (HI) model.<h4>Results</h4>Transcriptomic analysis of microglia isolated from brains following inflammation-sensitized HI brain injury revealed a strong upregulation of leukocyte recruitment and pro-inflammatory markers. Specifically, markers associated with neutrophil-mediated immune responses and chemotaxis were upregulated in the inflammation-sensitized HI group compared to the non-inflammation-sensitized HI and control groups. Serpine 1 and Selp could be identified as specifically upregulated markers indicating an acute inflammatory condition before HI injury.<h4>Conclusion</h4>Our study revealed preliminary data about a microglia population which is primed to recruit peripheral neutrophils to infiltrate the brain and mediate neutrophil immune response. We showed a contribution to neutrophil activation in case of inflammation following HI in the brain. Targeting microglia-mediated neutrophil recruitment can indicate a possible treatment approach in case of inflammation-sensitized HI brain injury.

Also flagged:Inositol-5-PhosphataseSHIP1acute lymphoblastic leukemiaALLPI3KAKT
Journal Article 2025-07-19 No Snippets Ehm P, Jücker M.
Show Full Abstract

Despite the successes achieved in recent years in the treatment of childhood acute lymphoblastic leukemia (ALL), high-risk ALL in particular still represents a considerable challenge, with poorer outcomes. The PI3K/AKT/mTOR signaling pathway is frequently constitutively activated in ALL and consequently leads to unrestricted cell proliferation, without showing frequent mutations in the most important representatives of the signaling pathway. Recent studies have shown that fine balanced protein expression is a common way to adjust oncogenic B cell directed receptor signaling and to mediate malignant cell proliferation and survival in leukemic cells. Too low expression of inhibitory phosphatases can lead to constitutive signaling of kinases, which are important for cell proliferation and survival. In contrast, marked high expression levels of key phosphatases enable cells with distinct pronounced oncogenic B cell directed receptor signaling to escape negative selection by attenuating signal strength and thus raising the threshold for deletion checkpoint activation. One of the most important B cell receptor-dependent signaling cascades is the PI3K/AKT signaling pathway, with its important antagonist SHIP1. However, recent data show that the inositol-5-phosphatase SHIP1 is differentially expressed across the heterogeneity of the ALL subtypes, making the overall therapeutic strategy targeting SHIP1 more complex. The aim of this article is therefore to provide an overview of the current knowledge about SHIP1, its expression in the various subtypes of ALL, its regulation, and the molecules that influence its gene and protein expression, to better understand its role in the pathogenesis of leukemia and other human cancers.

PLCL1
Also flagged:CLCN5fatty acidclear cell renal cell carcinomaEnoyl CoA hydrataseccRCClipid
Journal Article 2025-07-19 ✓ 1 Snippet Yu T, Li W, Meng X, Yang W, Ruan H, Xiao W, Zhang X.
In-Text Gene Mentions

…be controlled byPLCL1/UCP1-mediated lipid browning …

Show Full Abstract

Clear cell renal cell carcinoma (ccRCC), a globally prevalent and highly aggressive malignancy, is characterized by abnormal lipid accumulation and high morbidity. However, the complex pathological mechanisms underlying its development remain largely unexplored, necessitating further research efforts. In this study, we employed Weighted Gene Co-expression Network Analysis (WGCNA) and identified Chloride Voltage-Gated Channel 5 (CLCN5), a member of the CIC family, as a potential hub gene involved in fatty acid degradation. Our findings suggest that downregulated CLCN5 was negatively correlated with the malignant characteristics and prognosis of ccRCC. <i>In vitro</i> experiments demonstrated that CLCN5 overexpression significantly impacts fatty acid oxidation and inhibits tumor proliferation, metastasis, migration, and invasion in ccRCC. Mechanistically, CLCN5 restrains the proliferation and migration of ccRCC cells by decreasing lipid accumulation through the effects of Enoyl CoA hydratase and 3-Hydroxyacyl CoA dehydrogenase (EHHADH). Collectively, these findings suggest that CLCN5/EHHADH-mediated fatty acid metabolism could be a potential strategy for ccRCC treatment.

Also flagged:methylationbladder cancerpolymerasecancerurological tumorprostate cancer
Journal Article 2025-07-19 No Snippets Sun X, Wang D, Zhang S, Wang J, Ning H, Wu H, Wu F, Tang D, Lyu J.
Show Full Abstract

In recent years, the detection urinary DNA methylation in bladder cancer has witnessed significant advancements. Important breakthroughs have been achieved in the diagnosis of bladder cancer through the use of DNA methylation biomarkers in urine. Several clinical studies have successfully established multiple biomarkers and developed reliable diagnostic models. Additionally, certain assay kits are certified by the Food and Drug Administration or the National Medical Products Administration and provide dependable tools for clinical applications. However, traditional techniques have limitations in terms of sample requirements, operational complexity, and stability. This review presents the application of novel technologies for the detection of urinary DNA methylation in bladder cancer, including microfluidic, digital polymerase chain reaction, and CRISPR technologies. The introduction of these innovative approaches holds promise for enhancing the early diagnosis and prognosis of bladder cancer. These advances are expected to drive further research and clinical applications in this field.

Also flagged:carboncalcitemineralcarbonationsodiumpotassium
Journal Article 2025-07-19 No Snippets Alam MJ, MacDonald JM.
Show Full Abstract

Global warming over the past 70 years has been driven by rising atmospheric CO<sub>2</sub> levels, largely resulting from industrialization. During this period, large quantities of alkaline waste materials were generated, many of which have the potential to capture atmospheric CO<sub>2</sub> through mineral carbonation, hence offsetting some of these industrial emissions. One such material is paper mill sludge (PMS), a by-product of paper production. Significant volumes of legacy PMS exist worldwide, offering an untapped resource for carbon sequestration. To assess its carbon capture potential, this study maps and quantifies legacy PMS deposits in Scotland, a region with a long history of paper-making. Using historical records and GIS-based spatial analysis, 23 PMS deposits were identified across Scotland, primarily concentrated in the central and northeastern regions. The total volume of these deposits was estimated at 1,450,745 m<sup>3</sup>. X-ray diffraction (XRD) analysis revealed that PMS samples are composed predominantly of calcite (∼95%), indicating near-complete carbonation. This equates to the sequestration of approximately 1.72 million tonnes of atmospheric CO<sub>2</sub> since deposition. Spatial analysis examined the co-location of PMS deposits with designated ecological and cultural protection zones, revealing minimal overlap. This underscores the need for targeted management strategies to safeguard these carbon sinks from urban development or land-use changes that could release stored CO<sub>2</sub> back into the atmosphere.

CCDC92
Also flagged:agingenergy homeostasistriglyceridesleptinadiponectinlipid
Journal Article 2025-07-19 ✓ 1 Snippet Aging Biomarker Consortium, Yu J, Zhang Y, Zhang T, Bi Y, Chen Y, Chen Z, Dai Z, Guo F, Guo L, Hu C, Kong X, Li J, Liu P, Liu Y, Qu J, Tang Q, Wang C, Wang L, Wang J, Weng J, Xu A, Xu L, Zhang H, Zhao J, Zhang J, Zhang W, Zhao T, Zhang W, Zhu Z, Liu GH, Ning G, Pei G, Qiang L, Liu F, Ma X.
In-Text Gene Mentions

…CWF19L1 , andCCDC92in human VAT…

Show Full Abstract

Adipose tissue serves as a crucial energy storage and metabolic organ in the human body. With the surging of elderly population in China comes significant challenges in preventing and managing age-associated diseases, while adipose tissue aging represents one of the pivotal initiating events for multi-organ senescence. To address these challenges, the Aging China Biomarkers Consortium (ABC) has established an expert consensus on biomarkers of adipose tissue aging by digesting literature and collecting insights from scientists and clinicians. This consensus provides a comprehensive evaluation of the key changes and characteristics, as well as biomarkers related to adipose tissue aging and proposes a systematic framework categorizing these biomarkers into functional, structural and humoral dimensions. Within each dimension, the ABC recommends clinically and empirically validated biomarkers and parameters for assessing both physiological and pathological changes in adipose tissue during aging, which aims to establish a foundation for future prediction, diagnosis, early warning and treatment for adipose tissue aging and its related diseases, with the ultimate goal of improving adipose tissue health and promoting healthy aging in elderly populations both in China and worldwide.

HFE
Also flagged:SKIC3Tricho-hepato-enteric syndromeSKIC2liver diseaseneonatal hemochromatosisiron
Journal Article 2025-07-18 ✓ 1 Snippet Ochiai K, Aoki Y, Yamada N, Aman M, Yamashita A, Yamaguchi M, Nakato D, Takenouchi T, Kosaki K, Kodama Y, Moritake H.
In-Text Gene Mentions

…o-hepato-enteric syndrome withhemochromatosis

Show Full Abstract

Tricho-hepato-enteric syndrome (THES), a rare autosomal recessive disorder caused by variants in the SKIC3 or SKIC2 gene, is characterized by intractable diarrhea, woolly hair, growth restriction and liver disease. Here we report a neonatal case of THES with neonatal hemochromatosis, in which the novel compound heterozygous SKIC3 variants NM_014639.4:c.815_816del p.(Gly272AlafsTer9) and NM_014639.4:c.2284G>A p.(Gly762Arg) were identified. Further research is needed to elucidate the mechanisms underlying iron metabolism dysregulation in THES.

OLFM4
Also flagged:necrotizing enterocolitislipopolysaccharidelactationNECIL-6TNF-α
Journal Article 2025-07-18 ✓ 1 Snippet Gao R, Huang Y, Li B, Zhang R, Lee C, Alganabi M, Yamoto M, Peng X, He W, Cao Y, Pierro A, Shen C, Zhu H.
In-Text Gene Mentions

…markers (Lgr5 andOlfm4), increased following exosome…

Show Full Abstract

<h4>Objective</h4>Human milk-derived exosomes can protect intestinal organoids from lipopolysaccharide induced injury. The aim of this study is to investigate effects of exosomes derived from different periods of lactation on intestinal injury caused by experimental necrotizing enterocolitis (NEC).<h4>Methods</h4>Colostrum and mature milk from healthy lactating human mothers were collected and isolated exosomes using serial ultracentrifugation and filtration. NEC was induced in mice pups by hypoxia, gavage of feeding of formula, and lipopolysaccharide (LPS) administration between postnatal days 5 and 9. Breast-fed pups were used as controls. NEC groups received daily gavage feeding of formula with added phosphate-buffered saline (PBS), colostrum exosomes or mature breast milk exosomes. The distal ileum was examined for NEC histology, inflammatory cytokines, and intestinal regeneration abilities.<h4>Results</h4>Compared to NEC group, administration of colostrum and mature milk exosomes in NEC mice resulted in a significant reduction in histological scores of intestinal tissues and decreased expression of inflammatory genes IL-6 and TNF-α. Furthermore, the expression of PCNA, as well as stem cell markers (Lgr5 and Olfm4), increased following exosome treatment, with a corresponding rise in the immunofluorescence staining of Ki67. Compared to mature breast milk exosomes, colostrum exosomes were more effective at enhancing enterocyte proliferation and intestinal regeneration.<h4>Conclusions</h4>Human milk-derived exosome treatment decreases the severity of experimental NEC. Colostrum exosomes induce greater intestinal regeneration compared to mature breast milk exosomes.

SERPINC1
Also flagged:Idiopathic Portal HypertensionHepatocellular Carcinomaportal hypertensioncarbonesophageal varicesliver disease
Journal Article 2025-07-18 ✓ 1 Snippet Sato A, Kumano R, Ariizumi Y, Matsumoto N.
In-Text Gene Mentions

…<0.5 μg/mL) andantithrombin-III(AT-III) was 88%…

Show Full Abstract

BACKGROUND Idiopathic portal hypertension (IPH) is a rare disease of unknown etiology that causes hypersplenism, splenomegaly, and portal hypertension. There have been rare reports of hepatocellular carcinoma (HCC) in patients with IPH, but no causal relationship has been confirmed. This report details the case of an 88-year-old Japanese woman who developed HCC after a 30-year history of IPH and was treated with carbon-ion radiotherapy. CASE REPORT An 88-year-old Japanese woman had presented to our hospital 33 years earlier with bleeding from esophageal varices. Liver function test results were normal. Computed tomography (CT) showed marked splenomegaly. She had no known causative factors for liver disease, and IPH was suspected. Endoscopic injection sclerotherapy was performed repeatedly for episodes of bleeding from esophageal varices until 4 years after presentation, when she underwent Hassab's procedure. A liver biopsy showed preserved lobular architecture and moderate fibrous enlargement of the portal area without necro-inflammatory reaction. She had a stroke 18 years later and was started on clopidogrel. Nine years later, CT revealed a 24-mm HCC in S8, and portal vein thrombosis (PVT). Carbon-ion radiotherapy was administered, followed by edoxaban. Three months later, CT showed shrinkage of the HCC and complete resolution of the PVT. Almost 3 years later, CT showed no recurrence of HCC or PVT. CONCLUSIONS We report a rare case of IPH and HCC co-existing in a patient followed up for more than 30 years. Although there is no recognized association between IPH and HCC, this report highlights the importance of continued clinical follow-up of patients with chronic liver disease.

BTN2A1
Also flagged:pancreatic adenocarcinomacuproptosiscancerCEP55pancreatic cancerPD-1
Journal Article 2025-07-18 ✓ 1 Snippet Zhang R, Xu Z, Zhuang Y, Shi Y, Guo Z, Chen C.
In-Text Gene Mentions

…including ADORA2A, BTLA,BTN2A1, BTNL3 , and…

Show Full Abstract

<h4>Background</h4>Background. Pancreatic adenocarcinoma (PAAD) is a malignancy with a very poor prognosis. The clinical significance of cuproptosis in PAAD combining single cell data with The Cancer Genome Atlas (TCGA) data is unclear.<h4>Materials and methods</h4>In this study, we first identified gene modules associated with cuproptosis by performing single-cell analysis and weighted co-expression network analysis (WCGNA). According to TCGA data, Cox regression and LASSO regression analysis were used to establish prognostic models, and PAAD patients were divided into high-risk and low-risk groups according to cuproptosis-related risk score. Then 7 algorithms were used to evaluate cancer immune microenvironment, followed by the mutation analysis. The expression levels and prognostic significance of the 8 model genes were analysed using single-gene analysis, Kaplan-Meier survival plots, and quantitative PCR (qPCR) validation. Finally, the biological function of <i>CEP55</i> in PAAD was verified by in vitro experiments.<h4>Results</h4>We identified cuproptosis-related genes (CRG) in PAAD by performing single-cell analysis and WCGNA, and constructed a cuproptosis-related prognostic model of PAAD by comprehensive bioinformatics analyses. Based on cuproptosis-related risk score, there were significant differences in survival time between two groups. We further constructed a cuproptosis-related risk score-based nomogram to accurately assess PAAD patient prognosis. Immune infiltration analysis revealed that PAAD samples with higher cuproptosis-related scores exhibited significantly lower immune infiltration levels, which may mechanistically underlie their poorer clinical outcomes. Furthermore, the high-risk group had a higher mutation rate of the same mutated gene, which means that they are more likely to benefit from immunotherapy. Finally, we identified that <i>CEP55</i> was significantly overexpressed in PAAD and correlated with poor patient prognosis. In vitro knockdown of <i>CEP55</i> effectively suppressed proliferation and invasion capabilities in pancreatic cancer cell lines.<h4>Conclusions</h4>In this study, a novel prognostic model of PAAD was constructed to evaluate the prognosis and immune microenvironment of PAAD patients, and <i>CEP55</i> was identified as a central gene of PAAD. In vitro studies verified the biological function of <i>CEP55</i>, providing a new potential target for the treatment of PAAD.

OLFM4
Also flagged:cancerstem cell proliferationNotchstem cell16S Ribosomal RNAGapdh
Journal Article 2025-07-18 ✓ 5 Snippets Zhao X, Cai Y, Hou Y, Wu Y, Wei T, Li L, Duan Z, Lu X, Meng J, Zhou H, Wang Q, Wang J, Xu C, Du L, Fan S, Wang F, Liu Q, Liu Y.
In-Text Gene Mentions

…The number ofOlfm4 + ISCs in cryptsand Ki67‐positive cells was reduced in irradiated mice, but was notably restored following FMT and FVT treatments (Figure 2I, J ).…

…Further, we found that the numbers of Olfm4 + ISCs, Ki67 + proliferating cells,PCNA + Olfm4 + proliferating stem cells, Paneth cells, and goblet cells were all significantly reduced in the AV‐treated group, indicating attenuated ISCs regeneration and reduced secretory lineage cells (Figure 3H–L ; Figure S5B, C , Supporting Information).…

…Likewise, while the number ofOlfm4‐positive stem cellssignificantly decreased in AV and irradiation‐treated wild‐type mice, there was no significant change observed in Ddx58 −/− mice (Figure 6H ).…

…Similarly, the number ofPCNA + Olfm4 + proliferating stem cellswas significantly reduced in AV‐treated wild‐type mice after radiation, whereas no significant change was observed in AV‐treated Ddx58 −/− mice under the same conditions (Figure S9 , Supporting Information).…

…antibodies used wereOlfm4(Cell Signaling Technology,…

Show Full Abstract

Radiation-induced intestinal injury is a common complication of abdominopelvic cancer radiotherapy, often associated with gut bacteriome dysbiosis. However, the involvement of gut virome in this process remains largely underexplored. Here, it was found that radiation disrupted the gut virome, altered the distribution of phages and their bacterial host. Fecal virome transplantation (FVT) from healthy donors ameliorated radiation-induced intestinal damage and promoted stem cell proliferation by enriching phages targeting Salmonella. Conversely, decreased virome load exacerbated intestinal damage, reduced proliferating stem cells, and impaired secretory lineage differentiation. Mechanistically, exacerbated intestinal injury was associated with hyperactivation of RIG-I and Notch signaling in intestinal stem cells, which was absent in RIG-I-deficient mice. Organoids from RIG-I-deficient mice displayed decreased Notch signals and increased regenerative capacity post radiation. These findings shed light on the intricate interplay between gut virome, intestinal injury, and stem cell responses, highlighting potential therapeutic interventions for targeting the virome to mitigate radiation-induced intestinal damage.

Also flagged:pollinationsexual reproductionreproductionfloweringwaterflower opening
Journal Article 2025-07-18 No Snippets Xie Y, Thammavong HT, Turner AL, Turner BI, Park DS.
Show Full Abstract

Potential and realized climate change-driven phenological mismatches have been reported across a variety of pairwise species' interactions. However, species often engage in more than one type of temporally structured interaction - therefore, the consequences of phenological shifts must be evaluated in this context. Synthesizing data from natural history collections, community science initiatives, and remote-sensing platforms, we analyzed the phenology of the flowering of an understory spring ephemeral species, the emergence of its specialist pollinator, and the closure of the canopy above. We determined how variation in phenological responses to climate across these interacting guilds impacts the potential pollination window of the spring ephemerals. We demonstrate that phenological responses to climate change can vary greatly among the three guilds across their interacting range. The potential pollination window was predicted to undergo divergent shifts among ecoregions across the landscape in the near future, which can impact the fitness and reproductive success of both flowers and pollinators. Our study represents a first step toward integrating phenological knowledge across multiple interacting guilds. Expanding such efforts will be critical to improving our ability to predict how ecosystems, communities, and the ecological interactions therein will be impacted by global change.

DARS2
Also flagged:nerolidolacute myocardial infarctionantibodiespathogenesisischemiamyocardial infarction
Journal Article 2025-07-18 ✓ 5 Snippets Erdoğan MM, Erdoğan E, Kocaman N, Telo S, Biçen H, Erdoğdu H, Yerlikaya Kavak S, Karakuzulu FT.
In-Text Gene Mentions

…asprosin, spexin, andDARS2antibodies in the…

…spexin (SPX), andDARS2expressions in myocardial…

…ASP, SPX, andDARS2in the MI…

…with NRD normalizing SPX/DARS2and partially reducing…

…kers while modulating ASP/SPX/DARS2pathways, suggesting their…

Show Full Abstract

<h4>Background</h4>Oxidative stress and inflammation are pivotal in pathogenesis of brain ischemia-reperfusion (I/R) injury. This study evaluated neuroprotective effects of nerolidol (NRD) on asprosin (ASP), spexin (SPX), and DARS2 expressions in myocardial infarction (MI) induced cerebral I/R injury, and systemic inflammatory responses by measuring serum cytokine levels.<h4>Methods and results</h4>Twenty-eight Wistar rats were divided into: Control, MI (200 mg/kg isoproterenol), NRD (100 mg/kg/day), and MI + NRD groups. After 14 days, brain cortex tissues were analyzed histopathologically and immunohistochemically, while serum TAS, TOS, and cytokines were measured via ELISA. Histopathological examination revealed severe cortical damage in MI rats, which was significantly attenuated by NRD treatment. Immunohistochemistry showed marked upregulation of ASP, SPX, and DARS2 in the MI group, with NRD normalizing SPX/DARS2 and partially reducing ASP. Serum analysis revealed comprehensive therapeutic effects of NRD, effectively counteracting the metabolic and inflammatory disturbances caused by MI. The treatment completely restored depleted Metrnl levels to normal values, demonstrating its metabolic regulatory capacity. NRD also showed potent anti-inflammatory action, significantly lowering elevated levels of key pro-inflammatory cytokines while maintaining a balanced immune response. Furthermore, it effectively corrected the oxidative imbalance characteristic of I/R injury, normalizing both oxidant and antioxidant markers to near-control levels. NRD effectively reduces cerebral I/R injury after MI by combining antioxidant, anti-inflammatory, and metabolic regulatory actions. It normalizes Metrnl, cytokines, and oxidative stress markers while modulating ASP/SPX/DARS2 pathways, suggesting their role in both injury and recovery.<h4>Conclusions</h4>These findings highlight the potential of NRD in preventing post-MI brain damage and the need for further research on optimal dosing and mechanistic pathways.

HFE
Also flagged:cardiovascular diseasegenetic disordersneurodevelopmental disordersdeafnesscardiogenetic syndromessalt
Journal Article 2025-07-18 ✓ 1 Snippet Hanna EM, Mehawej C, Hoblos Y, Rahy K, Megarbane A, Chouery E.
In-Text Gene Mentions

…variants in theHFEgene were identified…

Show Full Abstract

Advances in next-generation sequencing enabled its integration into genetic diagnosis and have led to the uncovering of secondary findings. In this paper, we analyzed 500 Lebanese participants for pathogenic and likely-pathogenic variants in 81 recommended genes listed by the American College of Medical Genetics (ACMG). In this retrospective study, 500 individuals seeking genetic diagnosis through Exome Sequencing were included. Variants were analyzed and their pathogenicity assessed based on ACMG/AMP criteria and ClinVar. Secondary findings were identified in 16.8% of cases based on ACMG/AMP criteria, which decreased to 6% when relying on ClinVar. Dominant cardiovascular disease variants were predominant, constituting 6.6% based on ACMG/AMP assessments and 2% according to ClinVar. Additionally, using ACMG/AMP criteria, dominant oncogenic variants were identified in 4.2% of individuals, while recessive pathogenic variants were found in 4.8%. In contrast, ClinVar-based analysis reported these variants in 1% and 2.6% of the cohort, respectively. The high discordance between ACMG/AMP and ClinVar classifications (16.8% vs. 6%) underscores ethical dilemmas in deciding which criteria to prioritize for patient disclosure. Indeed, the absence of ACMG-classified pathogenic or likely pathogenic variants in ClinVar complicates reporting due to a lack of evidence linking them to disease in other individuals. Finally, the significant discrepancy between ACMG/AMP and ClinVar classifications emphasizes the urgent need to harmonize variant databases and update ClinVar entries, particularly for understudied populations such as the Lebanese cohort.

PRDX6
Also flagged:pyroptosiscolon adenocarcinomacolorectal cancerCOADGlycolysisgene expression
Journal Article 2025-07-18 ✓ 1 Snippet Wang Y, Yuan Z, Lao Y, He J, Mo S, Chen K, Ye Y, Huang L.
In-Text Gene Mentions

…PECAM1, PINK1, PPARG,PRDX6, RBBP7, SDHB, SERPINH1,…

Show Full Abstract

<h4>Background</h4>The exact mechanisms driving colorectal cancer (CRC) are yet to be fully elucidated. This study aims to confirm the reliability of a prognostic model for colon adenocarcinoma (COAD) by analyzing the varied expression levels of Glycolysis & Pyroptosis-Related Differentially Expressed Genes (G&PRDEGs) in COAD using bioinformatics tools.<h4>Methods</h4>We retrieved gene expression data and clinical details for COAD patients from the Cancer Genome Atlas (TCGA) database. These data were analyzed to categorize the samples into pyroptosis-positive and pyroptosis-negative groups based on their expression of G&PRDEGs. A prognostic model for COAD was then developed using LASSO Cox regression analysis, focusing on these differentially expressed genes (DEGs). Kaplan-Meier curves were plotted to assess the differences in survival between the two groups. Furthermore, we conducted multivariate Cox regression analyses to evaluate the influence of clinical parameters and model-derived risk scores. Analyses of pathway enrichment were performed using R software, alongside single-sample gene-set enrichment analysis (ssGSEA) to explore the role of immune cells and functions associated with G&PRDEGs.<h4>Results</h4>A predictive model was developed using 53 G&PRDEGs that were expressed differentially. An examination of survival rates revealed that the high-risk groups exhibited a noticeably diminished overall survival (OS) in comparison to the low-risk groups in the TCGA database (P < 0.001). An examination of the receiver operating characteristic (ROC) curve indicated that the risk score effectively predicted outcomes at 1, 3, and 5 years, with a space beneath the curve greater than 0.7. The risk score significantly affected the survival of COAD sufferers in the TCGA database, on the basis of the multivariate Cox regression analysis. The high-risk groups had a hazard ratio (HR) of 3.988 (95% CI 2.865 ~ 5.551, P < 0.001) in contrast to the low-risk groups. Examinations of enrichment identified an increase in the expression of DEGs in the high-risk groups, in contrast to the low-risk cohort, on the basis of the TCGA database. SsGSEA revealed elevated levels of immune cell soakage in the high-risk groups in contrast to the low-risk groups.<h4>Conclusion</h4>The COAD prognosis model, developed using G&PRDEGs, exhibits predictive capability for the prognosis of COAD sufferers and offers utility in prognostic analysis for COAD sufferers.

Also flagged:bipolar disorderbipolar disordersmajor depressive disordersDepressionemotional abusesexual abuse
Journal Article 2025-07-18 No Snippets Zhang X, Liao Y, Han X, Shi G, Wang W, Guo L, He Y, Li Y, Zhang H, Zhao H, Chen Y, Sun X, Liu Y, Hao J, Wen C, Phan L, Mclntyre RS, Fan B, Lu C.
Show Full Abstract

Early and accurate identification and management of bipolar disorders (BDs) among major depressive disorders (MDDs) in clinical practice would place these patients in progressive early-onset bipolar care. The associations between childhood maltreatment, exercise and transition from MDD to BD remain unclear. To determine whether MDD patients reporting childhood maltreatment are at an increased risk of transition to BD. The secondary objective is to evaluate the moderating effects of exercise on the association. This prospective cohort study with a maximum follow-up of four years was based on the Depression Cohort in China. 1392 MDD with 18-65 years of age were enrolled between March 2019 and November 2023 after diagnosis by trained psychiatrists using the Mini-International Neuropsychiatric Interview and 1034 with complete data were finally included in the primary analysis. The Childhood Trauma Questionnaire-Short Form and exercise were collected at baseline, and clinician referrals for BD were confirmed at follow-up. Of the 1034 MDD patients included, the mean(SD) age was 28.32(7.00) years, and 714(69.1%) were women. 58 transitions to BD (39.64 per 1000 person years) were reported among MDD patients. Childhood emotional abuse (aHR, 1.05; 95%CI, 1.00-1.11; P = 0.04) and sexual abuse (aHR, 1.15; 95%CI, 1.04-1.27; P = 0.008) were positively associated with transition to BD. Stratified analyses showed that childhood emotional abuse (aHR, 1.08; 95%CI, 1.02-1.14; P = 0.007) was associated with transition to BD among patients without habitual exercise, but not among those with habitual exercise. Childhood emotional abuse and sexual abuse may be significant risk factors for the transition from MDD to BD, while exercise may partly offset the risk effects of emotional abuse and this transition. MDD patients who reported related childhood maltreatment, their families and health professionals should monitor closely and screen frequently for the possible emergence of BD.

Also flagged:fatty acidsfatty acidmyristicpalmiticstearic,
Journal Article 2025-07-18 No Snippets Salatta BM, Muniz MMM, Fonseca LFS, Mota LFM, de Souza Teixeira C, Frezarim GB, Serna-García M, Dos Santos Silva DB, Pereira ASC, Baldi F, de Albuquerque LG.
Show Full Abstract

This study aimed to identify differentially expressed (DE) long non-coding RNAs (lncRNAs) in muscle tissue of Nellore cattle clustered by their fatty acid profile. Longissimus thoracis muscle samples from 48 young bulls were used to quantify fatty acid (FA) (myristic, palmitic, stearic, oleic, linoleic, conjugated linoleic (CLA), α-linolenic and the groups of saturated fatty acids (SFA), monounsaturated (MUFA), polyunsaturated (PUFA), ω3, ω6, PUFA/SFA ratio and ω6/ω3) and to generate RNA-Sequencing data for transcriptomic analyses. The K-means analysis was used to classify the 48 animals into three clusters based on their FA patterns. The C1 had significantly (p ≤ 0.05) higher PUFA, ω3, ω6, linoleic and α-linolenic content. The proportion of SFA, myristic, palmitic and stearic were significantly (p ≤ 0.05) higher in C3, while C2 presented an intermediate profile. DE analyses were performed on three different comparisons, C1 vs. C2, C1 vs. C3 and C2 vs. C3, and 22, 28 and 22 DE lncRNAs (fold change > | 2 |, p-value < 0.01 and false discovery rate (FDR) < 0.05) were found, respectively. For three comparisons, the novel DE transcripts, lncRNA_15786.3, lncRNA_13894.1 and lincRNA_17393.3 interacted with CCN1, BNIP3, and CNOT2 genes, respectively, and appeared to contribute to a PUFA-enriched fatty acid profile. These genes are responsible for regulating the lipogenic genes, lipid metabolism, immune response and lipid synthesis. Meanwhile, the intergenic DE lncRNAs (lincRNA_18394.1, lincRNA_2526.3 and lincRNA_17681.1) were associated with the genes DDX1, EIF4E and APOL3, and appeared to contribute to a SFA-enriched fatty acid profile. The gene DDX1 was enriched by GO terms related to RNA splicing (GO:0008380), while the other genes (e.g., EIF4E and APOL3) were enriched to GO terms related to lipid transport (GO:0006869), localization (GO:0010876) and to cellular response to lipid (GO:0071396). These findings offer new insights into the biological mechanisms underlying the gene regulation of FA composition in beef and may provide a valuable foundation for further investigations regarding the interactions between lncRNAs and mRNAs, as well as their potential impact on meat quality.

ZNF322SOX6
Also flagged:bindingtranscription factorsShhsyndactylyTFchromatin
Journal Article 2025-07-18 ✓ 2 Snippets Todd CD, Ijaz J, Torabi F, Dovgusha O, Bevan S, Cracknell O, Lohoff T, Clark S, Argelaguet R, Pierce J, Kafetzopoulos I, Santambrogio A, Nichols J, von Meyenn F, Günesdogan U, Schoenfelder S, Reik W.
In-Text Gene Mentions

…41 ] andSOX6[ 42 ]…

…significantly enriched (KLF14,ZNF322, ZNF768, OCT:OCT, POU1F1,…

Show Full Abstract

<h4>Background</h4>Embryonic development requires the accurate spatiotemporal execution of cell lineage-specific gene expression programs, which are controlled by transcriptional enhancers. Developmental enhancers adopt a primed chromatin state prior to their activation. How this primed enhancer state is established and maintained and how it affects the regulation of developmental gene networks remains poorly understood.<h4>Results</h4>Here, we use comparative multi-omic analyses of human and mouse early embryonic development to identify subsets of postgastrulation lineage-specific enhancers which are epigenetically primed ahead of their activation, marked by the histone modification H3K4me1 within the epiblast. We show that epigenetic priming occurs at lineage-specific enhancers for all three germ layers and that epigenetic priming of enhancers confers lineage-specific regulation of key developmental gene networks. Surprisingly in some cases, lineage-specific enhancers are epigenetically marked already in the zygote, weeks before their activation during lineage specification. Moreover, we outline a generalizable strategy to use naturally occurring human genetic variation to delineate important sequence determinants of primed enhancer function.<h4>Conclusions</h4>Our findings identify an evolutionarily conserved program of enhancer priming and begin to dissect the temporal dynamics and mechanisms of its establishment and maintenance during early mammalian development.

HFE
Also flagged:Siglec-15AntibodyOsteogenesisOsteogenesis imperfectasialic acidbinding
Journal Article 2025-07-18 ✓ 1 Snippet Seide K, Mulcrone JE, Chacko J, Carter EM, Veneziale A, Pleshko N, Kothari P, Langermann S, Selvam S, Raggio CL.
In-Text Gene Mentions

…is a heterogenoustype 1 collagenopathy1 collagenopathy that…

Show Full Abstract

Osteogenesis imperfecta (OI) is a heterogenous type 1 collagenopathy that results in bone fragility and fractures. There is no standard-of-care treatment to reduce fracture risk for adults with OI. The sialic acid-binding immunoglobulin-like lectin 15 (Siglec 15) immunoreceptor modulates osteoclast development and bone resorption. Prior studies in growing rats demonstrated that Siglec 15 antibodies increased bone mass and improved bone mechanical properties. This study evaluated the safety and efficacy of a Siglec 15 monoclonal antibody, NP159 (NextCure Inc.), in female oim/oim and wildtype (WT) mice. Mice (n = 20/group) were treated from 14 to 26 weeks with either NP159 (10 mg/kg/dose weekly for 4 weeks, then biweekly for 8 weeks), weekly alendronate (ALN, 0.21 mg/kg), or weekly saline (equivalent to NP159). Faxitron images (anterior-posterior and medial-lateral) were taken at enrollment and sacrifice to evaluate fracture incidence and healing. Left femurs were analyzed for length, micro-CT parameters, and biomechanical testing. Right tibias were analyzed by Fourier transform infrared spectroscopy. NP159 reduced fracture incidence in oim/oim, 85% of whom were fracture-free at sacrifice compared to 65% in the ALN group and 55% in the saline group. NP159 treatment enhanced bone strength and structure in oim/oim, with mineral:matrix and carbonate:phosphate content that normalized towards the WT saline group. Unlike ALN, NP159 had a larger increase in bone stiffness(p < 0.05) and enhanced both bone microarchitecture and mineralization without altering Bone Mineral Density. Overall, these findings demonstrate the therapeutic value of NP159 in addressing the presently unmet clinical need for safe and efficacious long-term treatments for adults with OI.

PTGIS
Also flagged:Progesteroneestrusgene expressioninseminationestradiolCXCL8
Journal Article 2025-07-18 ✓ 1 Snippet Marques JCS, Maciel JPO, Denis-Robichaud J, Conceicao RS, Moore S, Piau T, Bartolomeu CC, Cerri RLA.
In-Text Gene Mentions

…processes (AKR1B1, AKR1C4,PTGIS, HPGD) regardless of…

Show Full Abstract

The main objective of this study was to evaluate if different concentrations of progesterone (P4) during superovulation and different intensities of estrous expression affected endometrial gene expression 7 d after artificial insemination (AI) in Holstein heifers. Our secondary objective was to explore the potential role of estradiol (E2) concentrations before estrus in relation to these factors. Post-puberty Holstein heifers were randomly assigned into 2 treatment groups: high P4 or low P4. Animals received a presynchronization protocol followed by a protocol of superovulation that included the assigned P4 treatment. Activity was monitored by an automated wearable sensor, and estrous behavior (intensity and duration) was recorded. A total of 39 heifers (high P4: n = 19; low P4: n = 20) were submitted to uterine biopsy 7 d after AI. We conducted RNA extraction for each sample, and the count of mRNA molecules for 91 target genes were determined using the NanoString nCounter system. The intensity and duration of estrus were used to categorize heifers as high or low estrous expression using the median. Count outcome data were normalized to housekeeping genes and analyzed using a mixed linear regression model with heifer as random effect. Significance for differential expression was set at false discovery rate <0.1 and absolute fold change ≥1.5. The P4 treatment or estrous expression alone were not associated with changes in endometrial gene expression; however, their interaction significantly influenced the expression of 12 target genes. Most of these genes were related to the immune system signaling (CXCL8, IL1B, MUC1, PTX3), indicating an upregulation of this biological function in the endometrium of heifers treated with low P4 and having low estrous expression. Pathway analysis confirmed the involvement of the immune response with downstream effects linked to transmigration of leukocytes, cell movement of monocytes, accumulation of phagocytes and mobilization of neutrophils. Additional E2 analysis demonstrated that concentrations of E2 before estrus influenced the expression of genes related to extracellular matrix remodeling (MMP14, MMP19, POSTN), immune system (MUC1, IL1B, CSF1), growth factors (IGF1, IGF1R, FGF2), and eicosanoid metabolic processes (AKR1B1, AKR1C4, PTGIS, HPGD) regardless of the P4 treatment. In conclusion, heifers treated with low P4 during superovulation and exhibiting low intensity and duration of estrus had distinct endometrial gene expression profiles 7 d after AI compared with those treated with high P4. Additional E2 analysis demonstrated that concentrations of E2 2 d before estrus influenced post-estrus endometrial gene expression independently of the pre-estrus P4 profile.

Also flagged:NK-cell lymphoproliferative disorderlymphoproliferative disorderprimaryintestinal NK-cell lymphomaJAK3CD3
Journal Article 2025-07-18 No Snippets Wang L, Ye Z, Wu H, Zhang Y, Tang Z, Lu X, Miao S, Sun H, Wu J, Jiang Z, Huang Y.
Show Full Abstract

No abstract available.

STAU1
Also flagged:RNA-binding proteinsofgene expressionribonucleoproteinspsoralendigestion
Journal Article 2025-07-18 ✓ 1 Snippet Garraffo R, Beltran Nebot M.
In-Text Gene Mentions

…proteins, such asSTAU1or ADAR1/2, play…

Show Full Abstract

Circular RNAs (circRNAs) are covalently closed RNA molecules generated through a non-canonical splicing event known as back-splicing. This particular class of non-coding RNAs has attracted growing interest due to its evolutionary conservation across eukaryotes, high expression in the central nervous system, and frequent dysregulation in various pathological conditions, including cancer. Traditionally, circRNAs have been characterised by their ability to function as microRNA (miRNA) and protein sponges. However, recent discoveries from multiple research groups have uncovered a novel and potentially transformative mechanism of action: the direct interaction of circRNAs with messenger RNAs (mRNAs) to regulate their fate. These interactions can influence mRNA stability and translation, revealing a new layer of post-transcriptional gene regulation. In this review, we present and analyse the latest evidence supporting the emerging role of circRNAs in diverse biological contexts. We highlight the growing body of research demonstrating circRNA-mRNA interactions as a functional regulatory mechanism and explore their involvement in key physiological and pathophysiological processes. Understanding this novel mechanism expands our knowledge of RNA-based regulation and opens new opportunities for therapeutic strategies targeting circRNA-mRNA networks in human disease.

DCC
Also flagged:pathogenesisinfectiongene expressionE165RNetrinAfrican swine fever
Journal Article 2025-07-18 ✓ 4 Snippets Wang L, Sun S, Liu L, Chen Y, Zheng H, Tang Z.
In-Text Gene Mentions

…its receptors (e.g.,DCC, UNC5B, NEO1) are…

…components including NTN4,DCC, and NEO1.…

…for receptors includingDCCand NEO1, which…

…signaling components (NTN4,DCC, NEO1) in AntiviralMac…

Show Full Abstract

African swine fever virus (ASFV) causes global swine outbreaks, but its cellular pathogenesis is poorly understood. Using single-cell RNA data from ASFV-infected pig spleens across four timepoints, we identified macrophages as the primary viral reservoir, with infection driving lymphoid depletion and myeloid expansion. We characterized four functionally distinct macrophage subsets, including a metabolically reprogrammed SusceptibleMac population serving as the major viral niche and an AntiviralMac subset rapidly depleted during infection. Viral gene expression analysis revealed E165R as a central hub in viral replication networks, while host transcriptomics uncovered disruption of Netrin signaling pathways that may facilitate immune evasion. Pseudotime analysis revealed dynamic macrophage state transitions during infection. These findings provide a high-resolution cellular atlas of ASFV pathogenesis, revealing macrophage subset-specific responses that shape disease outcomes and identifying potential targets for therapeutic intervention.

SUDS3
Also flagged:Csn5mitochondriallysinehistonesH2Bgene expression
Journal Article 2025-07-18 ✓ 1 Snippet Cirigliano A, Schifano E, Ricelli A, Bianchi MM, Pick E, Rinaldi T, Montanari A.
In-Text Gene Mentions

…suggesting that otherSAGA complexcomplex components, such…

Show Full Abstract

In this study, we investigated the mitochondrial defects resulting from the deletion of <i>GCN5</i>, a lysine-acetyltransferase, in the yeast <i>Saccharomyces cerevisiae</i>. Gcn5 serves as the catalytic subunit of the SAGA acetylation complex and functions as an epigenetic regulator, primarily acetylating N-terminal lysine residues on histones H2B and H3 to modulate gene expression. The loss of <i>GCN5</i> leads to mitochondrial abnormalities, including defects in mitochondrial morphology, a reduced mitochondrial DNA copy number, and defective mitochondrial inheritance due to the depolarization of actin filaments. These defects collectively trigger the activation of the mitophagy pathway. Interestingly, deleting <i>CSN5</i>, which encodes to Csn5/Rri1 (Csn5), the catalytic subunit of the COP9 signalosome complex, rescues the mitochondrial phenotypes observed in the <i>gcn5</i>Δ strain. Furthermore, these defects are suppressed by exogenous ergosterol supplementation, suggesting a link between the rescue effect mediated by <i>CSN5</i> deletion and the regulatory role of Csn5 in the ergosterol biosynthetic pathway.

Also flagged:OxygenCaleosin/peroxygenasesCLOoxylipinmetabolismbiosynthesis
Journal Article 2025-07-18 No Snippets Tran AD, Cho K, Vu MA, Kim JI, Nguyen HTT, Han O.
Show Full Abstract

Caleosin/peroxygenases (CLO/PXGs) play critical functional roles during plant development, oxylipin metabolism, and the response to abiotic/biotic stressors and environmental toxins. In <i>Oryza sativa</i>, peroxygenase-9 (OsPXG9) catabolizes intermediates in oxylipin biosynthesis produced by lipoxygenase-9 (9-LOX) and scavenges HOOH and CuOOH by transferring oxygen to hydroxy fatty acids (HFAs) but not to the free fatty acids. The resulting epoxide derivatives of HFAs are then enzymatically or non-enzymatically hydrolyzed into the corresponding trihydroxy derivatives. Results presented here demonstrate OsPXG9's specificity for catabolizing products of the 9-LOX (and not for the 13-LOX) pathway of oxylipin biosynthesis. Overexpression of <i>OsPXG9</i> reduces ROS (reactive oxygen species) abundance and reduces drought- and salt-stress-induced apoptotic cell death. The high expression level of <i>OsPXG9</i> also stimulates drought- and salt-induced but not basal expression of antioxidant enzymes/pathways in plants, thereby increasing cellular resistance to drought. These results suggest that OsPXG9 decreases ROS abundance and is essential to increase resilience in rice plants exposed to exogenous or endogenous abiotic stress.

Also flagged:Neutropeniachronic idiopathic neutropeniaCINinfectionsleukopenialymphocytopenia
Journal Article 2025-07-18 No Snippets Grossi A, Tsaknakis G, Rosamilia F, Rusmini M, Uva P, Ceccherini I, Giarratana MC, Vozzi D, Mavroudi I, Dufour C, Papadaki HA, Fioredda F.
Show Full Abstract

Non-remitting neutropenia in children and chronic idiopathic neutropenia (CIN) in adults have been described previously as peculiar subgroups of neutropenic patients carrying similar clinical and immunological features. The present collection comprising 25 subjects (16 adults and 9 children) mostly affected with mild (84%) and moderate (16%) neutropenia aimed to identify the underlying (possibly common) genetic background. The phenotype of these patients resemble the one described previously: no severe infections, presence of rheumathological signs, leukopenia in almost all patients and lymphocytopenia in one-third of the cohort. The pediatric patients did not share common genes with the adults, based on the results of the multisample test, while some singular variants in neutropenia potentially associated with immune dysregulation likely consistent with the phenotype were found. <i>SPINK5</i>, <i>RELA</i> and <i>CARD11</i> were retrieved and seem to be consistent with the clinical picture characterized by neutropenia associated to immune dysregulation. The enrichment and burden tests performed in comparison with a control group underline that the products of expression by the variants involved belong to the autoimmunity and immune regulation pathways (i.e., <i>SPINK5</i>, <i>PTPN22</i> and <i>PSMB9</i>). Even with the limitation of this study's low number of patients, these results may suggest that non-remitting neutropenia and CIN in adults deserve deep genetic study and enlarged consideration in comparison with classical neutropenia.

HTT
Also flagged:Major DepressiondepressionCYP2C19CYP2D6SLC6A4HTR2A
Journal Article 2025-07-18 ✓ 1 Snippet Fornaguera A, Miarons M.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) and was significantly…

Show Full Abstract

<b>Background/Objectives</b>: Major depressive disorder (MDD), including late-onset forms, is a prevalent and disabling condition. Despite multiple pharmacological treatment options, over half of patients fail to achieve full remission. This systematic review aims to assess current evidence on the influence of pharmacogenetic factors on antidepressant response and safety, with a focus on patients with major and late-life depression. <b>Methods</b>: We conducted a systematic review following PRISMA guidelines (PROSPERO: CRD42020212345). Studies published in the past five years involving adult patients with MDD or late-onset depression and pharmacogenetic data were included. <b>Results</b>: From 793 abstracts screened, 29 studies with 39,975 participants were included. CYP2C19 and CYP2D6 were the most frequently analyzed genes (41% and 17% of studies, respectively). Poor metabolizers for CYP2C19 showed higher plasma levels of SSRIs, leading to increased adverse effects. In contrast, ultrarapid metabolizers had significantly lower response rates. Variants in SLC6A4 and other genes (e.g., HTR2A, ABCB1) were also associated with treatment outcomes. Combinatorial pharmacogenetic testing showed superior predictive value compared to single-gene approaches. <b>Conclusions</b>: Genetic variants in CYP2C19, CYP2D6, and SLC6A4 may affect the efficacy and tolerability of antidepressant therapy. Integrating this information into clinical practice may allow more personalized prescribing and improved outcomes.

HFE
Also flagged:Hbalpha-thalassemiahemoglobin Hchronic hemolytic anemiaH diseasethalassemia
Journal Article 2025-07-18 ✓ 1 Snippet Kerdsinchai P, Tantiworawit A, Manosroi W, Niprapan P, Srichairatanakool S, Punnachet T, Hantrakun N, Piriyakhuntorn P, Rattanathammethee T, Hantrakool S, Chai-Adisaksopha C, Rattarittamrong E, Norasetthada L, Fanhchaksai K, Charoenkwan P.
In-Text Gene Mentions

…majority being secondaryhemochromatosis(28.3 %) and…

Show Full Abstract

<h4>Background</h4>Patients with beta-thalassemia have been shown to exhibit lower HbA1c levels, often correlating with reduced hemoglobin (Hb) concentrations. Similarly, individual with alpha-thalassemia, particularly those with hemoglobin H (HbH) disease, experience chronic hemolytic anemia, which may also influence HbA1c measurements. This study aimed to investigate the effect of alpha-thalassemia on HbA1c levels.<h4>Methods</h4>This cross-sectional study was conducted between September 2022 and April 2024 at the Tertiary care University Hospital. Non-diabetic patients with alpha-thalassemia (hemoglobin H disease) were enrolled and compared with age- and sex-matched control without thalassemia. Statistical analysis was performed using independent t-tests based on distribution of data. Linear regression analysis was used to assess the association between HbH disease and HbA1c levels.<h4>Results</h4>A total of 92 participants were enrolled, comprising 46 patients with HbH disease and 46 matched controls. The mean ± SD HbA1c levels were significantly lower in the HbH group (4.09 ± 0.64 %) compared to the control group (5.39 ± 0.50 %) (P < 0.001). The mean difference in HbA1c levels between the two groups was -1.31 ± 0.12 % [95 % CI -1.54 to -1.07](P < 0.001).<h4>Conclusion</h4>Patients with HbH exhibit significantly lower HbA1c levels compared to control group. These finding highlight the need to establish specific HbA1c reference ranges for patients with thalassemia to avoid misinterpretation in the diagnosis and management of diabetes mellitus.

DDX27
Also flagged:PI3KAKToral squamous cell carcinomatumorOral Cancerphosphatidylinositol 3-kinase
Journal Article 2025-07-18 ✓ 1 Snippet Veerasamy V, Veeran V, Nagini S.
In-Text Gene Mentions

…DEAD-box helicase 27 (DDX27) levels.…

Show Full Abstract

The phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) pathway is one of the most frequently dysregulated signaling networks in oral squamous cell carcinoma (OSCC). Although the tumor microenvironment (TME) and epigenetic modifiers are recognized to play a pivotal role in aberrant activation of the PI3K/AKT pathway in OSCC, the available evidence is fragmentary and a comprehensive analysis is warranted. This review evaluates the intricate mechanisms by which various components of the TME facilitate proliferation, apoptosis evasion, invasion, migration, angiogenesis, metastasis, as well as therapy resistance in OSCC through activation of PI3K/AKT signalling. The review has also analysed how epigenetic modifiers such as DNA methylation, histone modifications, and noncoding RNAs that have emerged as key players in orchestrating OSCC development and progression influence the PI3K/AKT pathway. Preclinical studies and clinical trials on the efficacy of PI3K/AKT inhibitors as viable options for OSCC treatment are discussed. Overall, this review supports the tenet that the PI3K/AKT pathway, which functions as a central hub through crosstalk with several oncogenic signaling pathways and overarching impact on all the hallmark traits of cancer, offers immense potential as a biomarker and oncotherapeutic target for OSCC.

PRDX6
Also flagged:GPX4tumorcolorectal adenocarcinomaCOADGlutathione peroxidase 4cancer
Journal Article 2025-07-18 ✓ 3 Snippets Zhang YU, Wang Q, Han Y, Piao J, Jin X.
In-Text Gene Mentions

…GRSF1, HPGDS, HSPA5,PRDX6, GSTO2, GSTP1, GSTO1,…

…of HPGDS andPRDX6were substantially lower…

…of GSTO1, GSS,PRDX6, and GSR (Fig.…

Show Full Abstract

<h4>Background</h4>Colorectal adenocarcinoma (COAD) is one of the most common gastrointestinal malignancies. There is a pressing need to recognize reliable biomarkers that can improve diagnostic accuracy, predict prognosis, and serve as effective molecular targets. Glutathione peroxidase 4 (GPX4) is an important antioxidant protein. Evidence demonstrates that abnormal expression of GPX4 is related to cancer initiation and progression. However, the role of GPX4 in COAD remains unclear.<h4>Methods</h4>We employed bioinformatics analysis and conducted subsequent validation of biological processes, including cell counting kit-8 assay (CCK-8), colony formation assay, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), 5-ethynyl-2'-deoxyuridine assay (EdU), western blot, immunohistochemistry, senescence associated β-galactosidase (SA-β-gal) staining and immunofluorescence to explore the expression status, prognostic value and biological function of GPX4 in COAD.<h4>Results</h4>Our data revealed that GPX4 mRNA expression was upregulated in COAD tissues and could predict the prognosis in patients with COAD. High GPX4 expression was associated with increased infiltration of malignant cells. We also performed a series of cell experiments confirming that GPX4 knockdown inhibited proliferation and induced cellular senescence, as determined by using CCK-8, colony formation, and EdU assay. In addition, SA-β-gal staining and senescence-associated secretory phenotype (SASP) components, such as P21 and Interleukin-6 (IL-6), were increased in GPX4 knockdown cells, while Lamin B1 was decreased. Moreover, we predicted that high expression of GPX4 was related to low immune cell infiltration.<h4>Conclusion</h4>This study demonstrates that GPX4 is a potential prognostic biomarker and target gene for COAD.

FBXL4
Also flagged:FBXL3F-box proteindegradationTCF12transcription factorMyoD
Journal Article 2025-07-18 ✓ 1 Snippet He W, Han S, Wu Y, Chen M, Xue T, You H, Chang Y, Liu SB, Sun Y, Tang Y, Shi X, Han X, Ma Z, Qian P, Geng S, Wu C, Liang Y, Li Y, Xu Y, Song YH.
In-Text Gene Mentions

F-box and leucine-rich repeat protein 3and leucine-rich repeat…

Show Full Abstract

Muscle regeneration hinges on the proliferation and differentiation of satellite cells. FBXL3, a member of the F-box protein family known for its role as a negative regulator of the circadian clock, is implicated in myogenesis. In this study, we demonstrate the expression of FBXL3 in satellite cells of adult mice, where it acts as a negative regulator of myogenic regeneration. This regulation occurs through the promotion of ubiquitination and degradation of TCF12, a transcription factor crucial for differentiation. Loss of FBXL3 activates MyoD and myogenin, thereby augmenting myogenic differentiation and regeneration. The role of FBXL3 in muscle regeneration was also confirmed using the tamoxifen-inducible Pax7-CreER recombination system. To unravel the regulatory mechanism of MyoD and myogenin by FBXL3, we conducted RNA sequencing on <i>Fbxl3<sup>+/+</sup></i> and <i>Fbxl3<sup>-/-</sup></i> primary myoblasts. Gene set enrichment analysis (GSEA) revealed that FBXL3 deficiency enriches the gene set associated with striated muscle cell development, including MEF2C, a regulator of myogenin expression. Through a search in the ChEA3 database, TCF12 emerged as the downstream candidate gene regulated by FBXL3 to modulate MEF2C. ChIP-PCR assays confirmed the enrichment of TCF12 on MEF2C promoter at three consensus sites. Dual-luciferase reporter assay validated that TCF12 activates the MEF2C promoter. This comprehensive study underscores the crucial role of FBXL3 in satellite cell-mediated myogenic regeneration and provides insights into the intricate regulatory network involving TCF12 and MEF2C.

Also flagged:camptothecinKRAScancerssotorasibpancreatic ductal adenocarcinomabromide
Journal Article 2025-07-18 No Snippets Ramalingam PS, Chellasamy G, Hussain MS, Kodiveri Muthukaliannan G, Hussain T, Alrokayan S, Yun K, Mekala JR, Arumugam S.
Show Full Abstract

<h4>Background</h4>Sotorasib (AMG510) is a first-in-class irreversible, covalent, and selective KRAS G12C inhibitor. However, in patients, acquired clinical resistance was observed within 1 year of its FDA approval. Researchers are exploring combination and repurposing strategies to help overcome this resistance and improve therapeutic efficacy. Several natural compounds have been extensively investigated for their therapeutic potential against various cancers, both individually and in combination with other chemotherapeutic agents. In this study, we examined the synergistic potential of camptothecin and sotorasib in KRAS G12C-mutated MIA PaCa-2 and KRAS G12D-mutated PANC-1 pancreatic ductal adenocarcinoma (PDAC) cells.<h4>Methods</h4>We assessed the half maximal inhibitory concentration (IC50) values of camptothecin and sotorasib using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, and predicted their synergistic potential using combination index (CI) values and isobologram plots. Proliferation, wound healing, and colony formation assays were performed to examine the chemotherapeutic potential of camptothecin and sotorasib (combination and monotherapy). Reactive oxygen species induction, DNA fragmentation, autophagy flux, and apoptosis and cell cycle analyses were performed using 2',7'-dichlorofluorescein diacetate (DCFH-DA), 4',6-diamidino-2-phenylindole (DAPI), LC3-II quantification assays, and flow cytometry analysis. Furthermore, quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to analyze gene expression patterns in both pancreatic ductal adenocarcinoma cell lines. Additionally, network pharmacology, gene ontology, and Kyoto Encyclopedia of and Genomes pathway enrichment were performed for camptothecin in PDAC.<h4>Results</h4>The combination therapy with camptothecin and sotorasib resulted in significantly inhibited proliferation, migration, and colony formation; elevated intracellular ROS levels; and induced DNA fragmentation compared with monotherapies in both PDAC cell lines. Flow cytometry and cell cycle analysis revealed that the combination treatment induced apoptosis and G1/S cell cycle arrest. Furthermore, qRT-PCR analysis revealed that the combination therapy significantly upregulated pro-apoptotic genes and downregulated KRAS pathway-related genes, cleaved poly (ADP-ribose) polymerase, anti-apoptotic-related genes as well as autophagy-related genes in both PDAC cell lines. Network pharmacology analysis supports that the identified hub genes play a role in apoptosis and autophagy.<h4>Conclusion</h4>We observed a synergistic relationship between camptothecin and sotorasib in <i>KRAS</i>-mutated cancer cells. Furthermore, we recommend examining more natural compounds with chemotherapeutic potential to help overcome clinical resistance of approved chemotherapeutic drugs in the near future.

Also flagged:venous thromboembolismmalignanciescardiometabolic disorderspulmonary hypertensionAcutedeath
Journal Article 2025-07-18 No Snippets Goyal A, Hurjkaliani S, Alexander KM, Xu J, Pareek M, Qamar A.
Show Full Abstract

Venous thromboembolism (VTE) is a significant global health concern, with >1 million cases annually in the United States, making it a leading cause of preventable hospital-related deaths. Advances in genetic research, particularly genome-wide association studies, have demonstrated the polygenic nature of VTE by identifying numerous single-nucleotide polymorphisms associated with susceptibility. The polygenic risk score (PRS), which aggregates the effects of multiple single-nucleotide polymorphisms, has emerged as a valuable tool for improving VTE risk assessment. Recent studies have demonstrated that PRS significantly improves VTE risk prediction beyond traditional clinical factors. Integrating genetic and clinical data enhances predictive accuracy, with individuals at high risk identified by PRS showing nearly 8 times the VTE risk of those at low risk. Additionally, PRS models have been developed to predict VTE risk in various predisposing conditions, including malignancies, cardiometabolic disorders, and pulmonary hypertension. These findings indicate that PRS could inform thromboprophylaxis decisions for high-risk patients. Further evidence indicates that PRS improves VTE risk prediction, even in individuals without conventional risk factors, such as family history or lifestyle contributors. The future of PRS in VTE risk stratification is promising, offering refined risk assessment, optimized anticoagulation management, and tailored thromboprophylaxis. However, challenges persist, including the development of multiancestry PRS models to enhance predictive accuracy across diverse populations. Continued research and validation will be essential to unlocking the full clinical potential of PRS in VTE management.

Also flagged:degradationcarbosilanedendrimersalkynehydroxylazide
Journal Article 2025-07-18 No Snippets Muñoz-Sánchez S, Gong J, de la Mata FJ, Gillies ER, García-Gallego S.
Show Full Abstract

In the biomedical field, the design of materials with controlled degradation is highly desired. Herein, we present a family of dendritic hydrogels accomplished through copper-assisted azide-alkyne cycloaddition click reaction between dendritic cross-linkers and complementary linear polymers. As cross-linkers, an innovative family of bifunctional carbosilane dendrimers was designed for this purpose, bearing multiple alkyne groups available for network formation as well as pendant hydroxyl groups for postfunctionalization. Additionally, different azide-pendant polymers were employed, including difunctional poly-(ethylene glycol) with cleavable and noncleavable nature, as well as poly-(ethyl glyoxylate) with and without self-immolative behavior. The rational design of the dendritic hydrogels, through the careful selection of these two components, enabled an accurate manipulation of properties like swelling and mechanical properties. The network degradation could be tuned from a few hours, for a traditional ester-cleavable dendritic hydrogel, to several days under pH-controlled conditions, for the self-immolative hydrogel (SIH). The impact of network degradation on the release of curcumin as a model drug was also confirmed. This work showcased the potential of dendritic SIHs for biomedical applications.

bioRxiv 2025-07-18 Preprint (No Snippets API) Lara MK, Carrette LLG, Sanches TM, Polesskaya O, Avelar A, Beeson A, Beldjoud H, Boomhower B, Brennan M, Chen D, China L, Chitre AS, Conlisk DE, Fannon M, Johnson BB, Keung E, Kimbrough A, Kononoff J, Martinez AR, Maturin L, Nguyen K, Morgan A, Mosquera J, Othman D, Plasil SL, Ramborger J, Schweitzer P, Sedighim S, Seshie O, Shankar K, Sichel B, Simpson S, Smith LC, Sneddon EA, Tieu L, Velarde N, Zahedi S, Solberg Woods LC, Kallupi M, de Guglielmo G, Palmer AA, George O.
Show Full Abstract

<h4>Background</h4> Cocaine use disorder (CUD) is a major public health crisis with detrimental individual and societal effects. The specific genes mediating CUD remain largely unknown. <h4>Methods</h4> We conducted a genome-wide association study (GWAS) using outbred N/NIH Heterogeneous Stock (HS; n = 836, female = 415, male = 421) rats. We examined multiple CUD-related phenotypes that captured acquisition of self-administration, escalation of intake, and compulsive-like responding. <h4>Results</h4> Consistent with the existing literature, these traits were phenotypically and genetically correlated and exhibited modest heritability (h 2 = 0.07 – 0.16). We identified six genome-wide significant associations. One locus on chromosome 19 was associated with the variable time between cocaine infusions (post infusion interval) and contains several carboxylesterase genes that are orthologous to the human CES1 gene; notably, carboxylesterases metabolize cocaine. Three non-synonymous coding variants in the genes Ces1c and Ces1d were in perfect linkage disequilibrium with this locus, suggesting that one or more of them might be the causal SNP. The other 5 loci also contained promising coding and expression variants, including Trak2, a gene previously associated with CUD in human GWAS and Slc10a7 , Plcl1 , and Satb2 which have been associated with alcohol and tobacco use disorder. <h4>Conclusions</h4> This is the largest genetic study of cocaine self-administration ever conducted in any species. Our results replicate previous loci associated with CUD in humans and provide several novel biological insights including the potential of pharmacological strategies targeting carboxylesterases for the treatment of CUD.

medRxiv 2025-07-18 Preprint (No Snippets API) Rjoob K, McGurk KA, Zheng SL, Curran L, Ibrahim M, Zeng L, Kim V, Tahasildar S, Kalaie S, Senevirathne DS, Gifani P, Losev V, Zheng J, Bai W, de Marvao A, Ware JS, Bender C, O’Regan DP.
Show Full Abstract

Understanding gene-disease associations is important for uncovering pathological mechanisms and identifying potential therapeutic targets. Knowledge graphs offer a powerful solution for representing and integrating data from multiple biomedical sources, but lack individual-level information on target organ structure and function. Here we developed CardioKG, a knowledge graph integrating over 200,000 computer vision-derived cardiovascular phenotypes from biomedical images with data extracted from 18 diverse biological databases modelling over a million relationships. A variational graph auto-encoder was used to generate node embeddings from the knowledge graph, which were used as input features to predict gene-disease associations, assess druggability and propose drug repurposing strategies. The model predicted new genetic associations and therapeutic strategies for leading causes of cardiovascular disease which were also associated with improved survival. Candidate therapies included methotrexate for heart failure and gliptins for atrial fibrillation. Imaging enhanced the ability to leverage biological data for pathway discovery. These capabilities represent an important step toward using biomedical imaging to enhance graph-structured models for identifying treatable disease mechanisms.

bioRxiv 2025-07-18 Preprint (No Snippets API) Lee E, Kim W, Beier DH, Lee Y, Kovalenko M, Saif F, Oliver E, Murtha R, Andrew MA, Gillis T, Demelo B, Srinageshwar B, Ruliera J, Lucente D, Kwak S, Lee R, Pinto RM, MacDonald ME, Gusella JF, O’Brien PJ, Wheeler VC, Seong IS.
Show Full Abstract

Huntington’s disease (HD) is a fatal neurodegenerative disorder caused by inheriting an expanded CAG repeat tract in the huntingtin gene ( HTT ) that further expands in somatic cells over an individual’s lifetime. Genome-wide association studies have provided critical insight into factors that modify the course of disease. These include DNA repair genes that alter the rate of somatic expansion and other genes that do not appear to directly influence this process. One modifier gene is DNA ligase 1 ( LIG1 ), in which a variant specifying a lysine to asparagine substitution (K845N) is associated with a profound (7-8 year) delay in the onset of motor signs. Here, we have taken a multifaceted approach to gain insight into the protective nature of this variant in HD. We demonstrate using in vitro ligase assays and enzyme kinetics that K845N enhances discrimination towards mismatched substrates and increases repair fidelity. Consistent with increased ligation fidelity, K845N confers protection against oxidative stress in cell-based assays. Finally, we demonstrate that the mouse LIG1 K843N orthologue suppresses somatic CAG expansion in HD knock-in mice. Overall, our data provide evidence that altered LIG1 function due to the K845N substitution may contribute to HD clinical delay by slowing somatic expansion in the brain and protecting the genome globally against damage. Significantly, our results provide a mechanistic foundation for considering DNA ligase fidelity as a therapeutic target in HD and potentially in other trinucleotide repeat disorders. <h4>Significance Statement</h4> We analyzed a missense variant in DNA Ligase 1 (K845N) that is associated with a profound delay in the onset of Huntington’s disease (HD). We find that K845N enhances substrate discrimination towards mismatched substrates, thus increasing repair fidelity, conferring protection against oxidative stress and slows somatic expansion of the HD CAG repeat. Our observations provide insight into underlying mechanisms of disease modification and suggest avenues that can be harnessed for disease-modifying therapeutic intervention. Classification: Biological Sciences, Genetics

Also flagged:autophagythyroid cancerlocalizationLC3Bp62thyroid carcinoma
Journal Article 2025-07-17 No Snippets Sailaubekova Y, Matsuda K, Akazawa Y, Kurohama H, Matsuoka Y, Suzuki K, Kerimbayeva A, Kondo H, Nguyen VPT, Nguyen TNA, Nguyen TN, Satoh S, Shindo H, Yamashita H, Nakashima M.
Show Full Abstract

This study aimed to clarify the expression levels of autophagy-related molecules, such as β-catenin, LC3B, and p62, in thyroid carcinoma (TC) cases of different histological types and clinicopathological characteristics. A total of 70 surgically resected thyroid nodules, including 43 papillary thyroid carcinoma (PTC), and other control groups such as five follicular adenoma (FA), five hyalinizing trabecular tumor (HTT), five follicular TC (FTC), six poorly differentiated TC (PDTC), and six anaplastic follicular cell-derived thyroid carcinoma (ATC), were analyzed by dual-color immunofluorescence for β-catenin, LC3B, and p62. Statistical analyses were used to determine the association of autophagy-related molecules with BRAF<sup>V600E</sup>/TERT promoter mutations, Ki-67 labeling index, and clinicopathological characteristics. p62 immunoreactivity was most frequently observed in PTC, particularly in classical and tall cell subtypes. This protein appeared to co-localize with LC3B and β-catenin in intranuclear cytoplasmic inclusions (INIs) of PTC. Conversely, p62 expression was rarely observed in either FTC or PDTC. The expression levels of p62 and its co-localization with β-catenin and LC3B correlated significantly with the presence of the BRAF<sup>V600E</sup> mutation. Frequent co-localization of dot-shaped perinuclear β-catenin signals with a component of the trans-Golgi apparatus in tall cell PTC subtype was also observed. This study revealed differences in the expression patterns of β-catenin, LC3B, and p62 among different TC types. Abnormal β-catenin expression may be linked to autophagy dysfunction, which triggers genomic instability and promotes tumor aggressiveness. These autophagy-related molecules may be cooperatively associated with INI formation during PTC carcinogenesis.

HFE
Also flagged:gastrointestinal disordersVitamin Cdiabetespolyphenolic compoundsquercetinflavonoids
Journal Article 2025-07-17 ✓ 1 Snippet El-Feky AM, AbdelRahman MAE.
In-Text Gene Mentions

…to neurological conditions,hemochromatosis, emphysema, acquired immunode…

Show Full Abstract

Guava (Psidium guajava L.) leaves are deemed promising reservoir of phytoconstituents, with their characteristics potentially influenced by the timing of harvest and the dynamics of soil-plant interactions. The study revealed varying concentrations of minerals and vitamins in guava leaves, predominantly featuring vitamins B and C. Assessment of pigments using HPLC revealed that guava leaves collected in March had higher pigment concentration (461.233 mg/100 g) than that collected in August (447.084 mg/100 g). Quantification of total phenolics in guava leaves collected in March and August resulted in measurements of 435.21 ± 0.17 mgGAE/g and 294.31 ± 0.14 mgGAE/g, respectively. HPLC analysis demonstrated a diverse array of phenolic and flavonoid compounds present in Psidium guajava, with greater abundance and concentration of phenolic and flavonoid compounds in the samples harvested in March compared to those collected in August. For biological evaluation, guava leaves harvested in March demonstrated strong scavenging effect on DPPH and ABTS radicals, and considerable inhibition of carbohydrate-metabolizing enzymes (α-amylase, α-glucosidase, and β-galactosidase) in a dose-dependent manner. Furthermore, the March-collected guava leaves exhibited notable inhibition of COX-2 and 5-LOX enzyme activities, surpassing the effects of leaves collected in August. The study's outcomes demonstrate richness of phytoconstituents in guava leaves, which underpin various biological functions, particularly during spring relative to the summer. This highlights the importance of the timing of collection in assessing phytochemical properties and their biological implications, highlighting the necessity of considering this aspect when sampling guava leaves.

PEBP1
Also flagged:DDX56RNA-binding proteinsmetabolismRBPcancerslung adenocarcinoma
Journal Article 2025-07-17 ✓ 1 Snippet Jiang H, Zheng H, Zhao X, Xiang Y, Li J, Wang K, Wang G, Du J.
In-Text Gene Mentions

…CKAP4, LDHA, andPEBP1.…

Show Full Abstract

RNA-binding proteins (RBPs) play a fundamental role in cellular metabolism, with their disturbance leading to large-scale transcriptomic dysregulation. RBP dysregulation is highly prevalent in human cancers; however, its role in lung adenocarcinoma (LUAD) has not been systematically investigated. To establish a more effective and robust risk model, a machine learning integration program was used to screen hub prognostic RBPs. Our risk model C-index performed extremely well among 103 published signatures. The high-risk group had a lower immune score and worse immunotherapy effects. As one of the members of the RNA helicase family, DDX56 can interact with certain transcription factors, thereby regulating the expression of its downstream targets. DDX56 exerts an anti-apoptotic effect and reduces the sensitivity to carboplatin treatment by promoting Bcl-2 transcription in LUAD cells. Additionally, DDX56 activates NF-kB signaling pathways, which may be related to DDX56-mediated promotion of Bcl-2 transcription, proliferation, migration, and invasion in LUAD patients.

Also flagged:gene transferchromosomecytoplasmnucleotideswatercytosine
Journal Article 2025-07-17 No Snippets Bohunická M, Johansen JR, Pietrasiak N, Jusko BM, Mesfin M, Becerra-Absalón I.
Show Full Abstract

Numerous cyanobacterial strains previously identified as Scytonema hyalinum were determined to be phylogenetically distant from the type species of Scytonema, S. hofmannii. Morphological and molecular evidence suggests this distinct clade necessitates placement in a new genus, and we have described Kalymmatonema gen. nov. herein. Kalymmatonema has been demonstrated to exhibit five ribosomal operons, all of which differed in both sequence and secondary structure of conserved helical domains in the 16S-23S internal transcribed spacer rRNA region. Four of these operon copies were highly similar in 16S and 23S rRNA gene sequences, whereas the divergent fifth copy is thought to represent a whole-operon horizontal gene transfer event. Through in-depth analysis, we were able to recognize seven species new to science, the type species K. desertorum sp. nov., K. arcangelii comb. nov., K. chimaera sp. nov., K. ethiopiense sp. nov., K. gypsitolerans sp. nov., K. mateoae sp. nov., and K. oahuense sp. nov. We also created the new combination, K. hyalinum comb. nov., in order to include the original Scytonema hyalinum in this new genus based upon the common morphological feature of a mucilaginous apical cap on the trichomes. Kalymmatonema displays a complex evolution of its ribosomal operons, with evidence not only of horizontal gene transfer but also of internal rearrangements and mobile genetic elements that have transposed the tRNA-containing region of the ITS rRNA region among the four similar operons. Additional investigation of the evolutionary history of this interesting genus will likely lead to a better understanding of the processes shaping ribosomal evolution in cyanobacteria.

Also flagged:GlycopolymerPolylactic AcidCopolymersaccharidebindingsaccharides
Journal Article 2025-07-17 No Snippets Green KA, Kulkarni AS, Jankoski PE, Worden RM, Loving BM, Derbigny B, Clemons TD, Watkins DL, Morgan SE.
Show Full Abstract

Stereospecific arrangements of saccharide molecules control biological recognition and binding with proteins. These properties can also be utilized in the design of biomaterials for applications such as polymeric drug delivery, where saccharides may enhance the ability to target specific cells. Glycopolymer block copolymers incorporating pendant saccharides at high concentration have potential for use in applications; however, there is a need for further evaluation of their structure-property relationships. Accordingly, noncytotoxic amphiphilic, hybrid block copolymers (HBCs), synthesized by coupling branched polylactic acid (PLA) with linear polyacrylamides containing hydroxyethyl, β-d-glucose, or β-d-galactose moieties, were studied to determine the influence of the stereochemistry and structure of the pendant saccharide on nanoparticle formation, cargo loading, and lectin binding properties. HBCs were prepared at a target 50:50 PLA/hydrophilic block content; all compositions yielded similar spherical nanoparticle morphologies with comparable diameters on nanoprecipitation. Thermal properties and hydrophilic dye loading levels, however, were dependent on the pendant saccharide structure, attributed to differences in intramolecular interactions in the glycopolymer blocks. These findings demonstrate the importance of understanding the structure-dependent behavior for designing HBC-based therapies.

CCPG1
Also flagged:myocardial infarctionMIheart failureAutocrine Motility Factor ReceptorAMFRFAM134B
Journal Article 2025-07-17 ✓ 5 Snippets Wang Z, Niu K, Liu W, Wang X, Yang B, Li T, Chen Y, Jin Y, Chen Y, Lin Y, Jin X.
In-Text Gene Mentions

…FAM134B, ATL3, SEC62,CCPG1, TEX264, CALCOCO1, etc.…

…induced cardiotoxicity throughCCPG1‐mediated signaling. […

…P, Proteintech, 1:1000), anti‐CCPG1(#500 520, Huabio,…

…15 ] andCCPG1, [ 12 ]…

…Among these, Fam134b,Ccpg1, and Sec62 were…

Show Full Abstract

Progressive cardiac fibrosis post myocardial infarction (MI) drives pathological remodeling and heart failure, yet the role of endoplasmic reticulum-selective autophagy (ER-phagy) in this process remains unclear. Autocrine Motility Factor Receptor (AMFR) is a recently identified ER-phagy regulator, whose function under myocardial pathology remains poorly understood. Here, it is found that FAM134B-mediated ER-phagy activity is elevated in fibrotic mouse heart tissues post-MI and in cardiac fibroblasts stimulated by TGF-β1. AMFR knockout in mice aggravated cardiac fibrosis post-MI and worsened cardiac function, with scRNA-seq analysis demonstrating that AMFR-null cardiac fibroblasts exhibit a myofibroblast phenotype. Simultaneously, AMFR overexpression in cardiac fibroblasts reduces the expression of profibrogenic proteins in response to TGF-β1 stimulation. AMFR regulates ER-phagy flux and turnover of FAM134B, which leads to the suppression of cardiac fibroblasts activation. Mechanistically, AMFR catalyzed K27-linked (predominant) and K33-linked ubiquitination of FAM134B and enhanced ER-phagy flux, thereby inhibiting the phosphorylation of mTORC1 downstream targets such as S6K1 and 4E-BP. These findings highlight the therapeutic potential of AMFR-driven ER-phagy in suppressing cardiac fibrosis post-MI.

HFE
Also flagged:STAT6Ferroptosissecretiontissue plasminogen activatorsignal transducer and activator of transduction 6mitophagy
Journal Article 2025-07-17 ✓ 1 Snippet Yang Y, Huang G, Zhang T, Ling Y, Jiang J, Du D, Ma Y, Tao S.
In-Text Gene Mentions

…Iron overload inHfe‐deficient mice further corrob…

Show Full Abstract

Pulmonary fibrosis (PF) remains a clinically intractable condition with limited therapies. Ferroptosis has emerged as a critical driver of PF. The previous study demonstrates that increased secretion of tissue plasminogen activator from ferroptotic airway epithelial cells contributes to PF progression in a paracrine manner. Herein, the indispensable role of signal transducer and activator of transduction 6 (STAT6) is further elucidated in maintaining airway epithelial homeostasis during PF and uncovers a novel mechanism by which STAT6 regulates mitophagy to modulate ferroptosis. Specifically, mitophagy is induced during PF along with STAT6 activation, and deficiency of STAT6 significantly alleviates epithelial ferroptosis and PF. Mechanistically, STAT6 directly binds to the parkin RBR E3 ubiquitin protein ligase (PRKN) promoter region at the site (-990 to -976), inhibiting PRKN transcription and thereby impairing mitophagy. Consistently, lentivirus-mediated PRKN interference in both wild-type and STAT6 knockout mice aggravates ferroptosis and PF. Furthermore, virtual screening identifies rifabutin as a potential STAT6 inhibitor, that exhibits therapeutic effects against PF both in vivo and in vitro. Collectively, these findings reveal an unreported mechanism by which STAT6 promotes PF by inhibiting PRKN-mediated mitophagy in the airway epithelium. Rifabutin is further identified and validated as a promising STAT6 inhibitor to alleviate PF, offering new insights into therapy development.

PRDX6
Also flagged:capacitationfertilizationbindingovulationcell surface(
Journal Article 2025-07-17 ✓ 5 Snippets Mahé C, Mowinska AM, Albrecht E, Reynaud K, Lavigne R, Com E, Pineau C, Mermillod P, Saint-Dizier M, Schoen J.
In-Text Gene Mentions

…(OVGP1) and peroxiredoxin-6 (PRDX6)…

…Abcam, UK), and anti-PRDX6(1.25 μg/mL; ABIN2783305,…

…(CD109) and peroxiredoxin-6 (PRDX6) were among the…

…localization of CAT,PRDX6and OVGP1…

…Proteins (CAT,PRDX6and OVGP1) with…

Show Full Abstract

<h4>In brief</h4>The molecular interactions between spermatozoa and the oviduct epithelium that are involved in capacitation and sperm availability during fertilization still remain largely unknown in many species. This study provides comprehensive proteomes of the apical and basal part of the bovine oviduct epithelium (isthmus and ampulla, pre- and post-ovulatory) and presents new protein candidates for sperm binding in the bovine functional sperm reservoir.<h4>Abstract</h4>The proximal region of the oviduct (isthmus) serves as a sperm reservoir in many mammalian species. This reservoir is composed of epithelial cells that bind sperm primarily to their apical cilia and ensure the survival of high-quality sperm until ovulation. The species-specific molecular interactions between spermatozoa and the oviduct epithelium, however, are still poorly understood. The aim of this study is to identify new candidates for sperm-interacting proteins in the bovine reservoir using laser capture proteomics. Ipsilateral oviducts were collected from cyclic cows at pre- and post-ovulatory stages. Isthmus and ampulla tissue samples were fixed, paraffin-embedded, sectioned and subjected to laser microdissection to establish pools of microsamples separating the apical part of the epithelium, containing potential sperm-interacting proteins, from the basal part, containing proteins not currently located or secreted on the cell surface. Proteins were analyzed by nanoLC-MS/MS, and differentially abundant proteins (DAPs) were identified using t-tests. A total of 505 and 512 proteins could be identified in apical and basal microsamples, respectively. Only 8/141 regional and 1/79 cycle stage-related DAPs were shared between both epithelium parts, indicating a selective regulation of protein expression. Of the apical proteins, 19 were predicted to be candidates for sperm interactions, including annexins (ANXA) 1, 2, 5 and 8; oviduct glycoprotein 1 (OVGP1); voltage-dependent anion-selective channel proteins (VDAC) 1 and 2; apolipoprotein A1 (APOA1). This work provides the first proteomic characterization of microdissected cellular compartments of the bovine oviduct epithelium and presents new candidates for improving sperm quality in assisted reproductive technologies.

PRDX6
Also flagged:gene expressioncitric acidantimicrobial peptidespeptidesmatingchromosomes
Journal Article 2025-07-17 ✓ 3 Snippets Ortiz R, Dabydeen LC, Kosinski C, Gera P, Carvajal-Castro JD, Akilov V, Howell HJ, Powell E, Santos JC.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6).…

…antioxidants TRX andPRDX6, which were not…

…in proteins, andPRDX6reduces hydrogen peroxide…

Show Full Abstract

Resilience in amphibians lies in their ecological adaptability, driven by their genetic makeup. Eleutherodactylus coqui, native to Puerto Rico (PR) and a beloved symbol there, is among the most successful invasive amphibians. This species is extensively studied in terms of its biology and genetics, including being the first Eleutherodactylus with a draft genome. Its potential to spread to new habitats and rapid breeding are notable. Transcriptome analyses of E. coqui are limited but provide insights into their invasiveness and differential gene expression. We compared the skin transcriptomes of E. coqui from PR (native) to those from an area under citric acid treatment in Los Angeles, California (invasive) population. Our results show differences in stress response gene signatures between both populations. In the native population, we hypothesize these responses are due to immunity against diverse parasites, potentially helping control their native populations in PR. Additionally, these coquis expressed several antimicrobial peptides, which were previously reported to be absent in coquis. These peptides may play a role in the invasiveness of the common coqui and its tolerance to urban and degraded habitats. We also provide novel draft transcriptomes of close relatives of E. coqui: Eleutherodactylus planirostris, Eleutherodactylus johnstonei, Eleutherodactylus cochranae, and Pristimantis unistrigatus.

Also flagged:axon guidanceaxonorganizationGALNT2PLD3axons
Journal Article 2025-07-17 No Snippets Onesto MM, Amin ND, Pan C, Chen X, Kim JI, Reis N, Kanton S, Valencia AM, Hudacova Z, McQueen JP, Tessier-Lavigne M, Pașca SP.
Show Full Abstract

Organizers orchestrate cell patterning and axon guidance in the developing nervous system. Although nonhuman models have led to fundamental discoveries about floor plate (FP)-mediated midline organization, an experimental model of the human FP would enable insights into human neurodevelopment and midline connectivity. Here, we developed organoids resembling human FP (hFpOs) and assembled them with human spinal cord organoids (hSpOs) to generate midline assembloids (hMAs). We demonstrate that hFpOs promote ventral patterning, commissural axon guidance, and bilateral connectivity. To investigate midline regulators, we profiled the hFpO secretome, identifying 27 human-enriched genes compared with mouse. In an arrayed CRISPR screen of hMAs, we discovered that loss of <i>GALNT2</i> and <i>PLD3</i> impaired FP-mediated guidance of axons. This platform holds promise for revealing aspects of human-specific neurobiology and disease.

Also flagged:gene expressiontesticularPTdiffuse large B-cell lymphomaDLBCLlymphoma
Journal Article 2025-07-17 No Snippets Shi W, Xu-Monette ZY, Jia Y, Tzankov A, Go H, Li L, Ponzoni M, Wang Y, Zhai Q, Perry AM, Wang S, Wang X, Chiu A, Xu ML, Visco C, Dybkaer K, Withers H, Long M, Yuan AF, Miao Y, Macias E, Wu D, Shuai W, Wang B, Li J, Bhagat G, Zu Y, Pan Z, Choi W, Montes-Moreno S, Chen W, Krieken JHV, Møller MB, Yu X, Parsons BM, Zhang S, Hsi ED, Sohani AR, Abramson JS, Ferreri AJM, Xu B, Li Y, Young KH.
Show Full Abstract

Primary testicular (PT) diffuse large B-cell lymphoma (DLBCL) is a rare and aggressive lymphoma with distinct clinical and molecular characteristics. To identify prognostic biomarkers in PT-DLBCL, in this study we analyzed DNA and RNA samples of PT-DLBCL tumors from 206 patients using next-generation sequencing platforms and assays. Genetic alteration analysis found that multiple chromosomal copy number variations (CNVs), TP53 transcript mutations with high variant allele frequency, and MCD subtype had significantly adverse prognostic effects, whereas elevated microsatellite instability had a significantly favorable prognostic effect in PT-DLBCL. Targeted RNA-seq analysis identified a PTL gene expression signature by comparing PT-DLBCL with systemic DLBCL and revealed the heterogeneity within PT-DLBCL by unsupervised clustering, which classified PT-DLBCLs into a testicular lymphoma tumor (TLT) subtype and a microenvironment (ME) subtype. The TLT subtype featured upregulation of genes functioning in DNA damage response, DNA repair, chromatin remodeling, the cell cycle, and the nucleus, and was associated with significantly poorer patient survival and higher frequencies of MYD88 mutations, multiple CNVs, MCD subtype, bulk tumors, and elderly patients in the PT-DLBCL cohort. In contrast, the ME subtype distinctively featured upregulation of various signaling pathway genes involving the tumor microenvironment and downregulation of BTK and B-cell receptor signaling genes, and was associated with significantly better clinical outcome than the TLT subtype of PT-DLBCL independently of CNVs, MCD and MYD88 mutation and than systemic DLBCL. Moreover, genomic microRNA profiling analysis identified a PTL microRNA signature significantly differentially expressed between PT-DLBCL and systemic DLBCL patients and within the PT-DLBCL cohort, and PT-DLBCL patients with higher expression of 16 PTL microRNAs (14 are testicular tissue-specific) had significantly better survival. In summary, this study revealed the molecular heterogeneity in genetic abnormalities and expression profiles of coding genes and microRNAs within the PT-DLBCL entity, and identified significant prognostic biomarkers and PTL signatures.

Also flagged:infectionmetabolic disorderstumorscolorectal cancerimmune responsep53
Journal Article 2025-07-17 No Snippets Li JX, Liu CG, Chen J.
Show Full Abstract

Gut microbes are considered to be key factors regulating host health and are closely related to tumorigenesis. Although the exact mechanism has not been clearly explained, many studies have shown that specific bacteria can affect cancer-related bioactive molecules, such as p53, Wnt, MAPK, and EGFR. Among them, p53 is the most commonly mutated gene in all tumor types. In this review, we systematically examine the gut microbes and metabolites that affect the tumor process by regulating p53, as well as the role of p53 in shaping the gut microbiota, and discuss their potential in the diagnosis and prognosis of tumors and the application value of clinical anti-tumor therapy. This study provides an important theoretical basis for the in-depth understanding and development of relevant treatment strategies.

Also flagged:synthesismycophenolic acidaryl estersphenolspancreatic cancermycophenolate mofetil
Journal Article 2025-07-17 No Snippets Walczak J, Iwaszkiewicz-Grześ D, Śliwka-Kaszyńska M, Kurdyn A, Augustin E, Viapiana A, Plenis A, Cholewiński G.
Show Full Abstract

Naturally occurring phenols were incorporated into the mycophenolic acid (MPA) core to form sixteen new MPA derivatives. Ester conjugates of MPA with isoeugenol, methyl o-coumarate, and raspberry ketone exhibited the highest antioxidant activity in the DPPH test. These derivatives were then tested against the human pancreatic cancer AsPC-1 cells, showing cytotoxicity similar to that of the referential parent compounds MPA and mycophenolate mofetil (MMF). Subsequently, most of the obtained MPA esters proved activity against the T-Jurkat cells and peripheral blood mononuclear cells (PBMCs), serving as an immunosuppressive model, and worked as inosine-5'-monophosphate dehydrogenase (IMPDH) inhibitors. The most promising immunosuppressive conjugates were the esters of MPA with sesamol and raspberry ketone structural motifs, which held the highest selectivity index (SI) for PBMCs, thus serving as a good starting point for new drug development.

HFE
Also flagged:metabolismtacrolimusmalarianicotine dependencehereditary hemochromatosismethotrexate
Journal Article 2025-07-17 ✓ 2 Snippets Mariño-Ramírez L, Sharma S, Hamilton JM, Nguyen TL, Gupta S, Natarajan AV, Nagar SD, Menuey JL, Chen WA, Sánchez-Gómez A, Satizábal-Soto JM, Martínez B, Marrugo J, Medina-Rivas MA, Gallo JE, Jordan IK, Valderrama-Aguirre A.
In-Text Gene Mentions

…with malaria resistance,hemochromatosis type 1type 1, and…

…Homeostatic Iron Regulator (HFE) encoding gene, which…

Show Full Abstract

The Consortium for Genomic Diversity, Ancestry, and Health in Colombia (CÓDIGO) aims to build a community of Colombian researchers in support of local capacity in genomics, bioinformatics, and precision health. Here, we present the first CÓDIGO data release and the consortium web platform, including annotations for more than 95 million genetic variants from 1441 samples representing 14 populations from across the country. CÓDIGO samples show a wide range of African (16.7%), Indigenous American (32.8%), and European (50.6%) genetic ancestry components, with five distinct ancestry clusters. Thousands of ancestry-enriched variants, with divergent allele frequencies across clusters, show pharmacogenomic and clinical genetic associations. Examples include African ancestry-enriched variants associated with fast metabolism of the immunosuppressive drug tacrolimus and malaria resistance, and European ancestry-enriched variants associated with nicotine dependence and hereditary hemochromatosis. CÓDIGO reveals the nexus between ancestry and health in Colombia and underscores the utility of collaborative genome sequence analysis efforts.

HTT
Also flagged:neurodegenerative diseaseHDmitochondrialautophagyCurcuminepigallocatechin-gallate
Journal Article 2025-07-17 ✓ 5 Snippets Salman A, Eid AH, Khalaf SS, El-Dessouki AM, El-Shiekh RA, Aly SH.
In-Text Gene Mentions

…and lack ofHTTortholog limit clinical…

…models expressing N-terminalHTTfragments (N208-105Q) showed…

…system for studyingHTTfunction, showing conserved…

…binds to mutanthttproteins and impedes…

…and impedes thehttaggregation process, hence…

Show Full Abstract

Huntington's disease (HD), a neurodegenerative disease, typically begins in the prime of adulthood, followed by a gradual onset of specific mental abnormalities and cognitive and physical impairment. To the best of our knowledge, no medication exists to totally stop the progression of HD. Among numerous therapy techniques, extensive literature reviews have confirmed the medicinal importance of natural products in HD experimental models. This review provides a literature survey of natural compounds and medicinal plants used as neuroprotective agents against HD. Relevant studies were found in a variety of scientific databases, including PubMed, ScienceDirect, Scopus, and Google Scholar. Overall, natural products provided various levels of neuroprotection in preclinical HD investigations through antioxidant and anti-inflammatory activities, mitochondrial function maintenance, apoptosis suppression, and autophagy induction. Plants such as Bacopa monnieri, Ginkgo biloba, Panax ginseng, and Withaniasomnifera were identified as the most promising anti-HD possibilities, with several of them known as CNS-active medicines. Curcumin, epigallocatechin-gallate, ginsenosides, kaempferol, naringin, and resveratrol were identified as anti-HD compounds, some of which are well recognized neuroprotectants. Further study is required to assess the therapeutic efficacy of new herbal extracts in HD animals.

SOX6DCC
Also flagged:cognitive impairmentneurodegenerative disordersepilepsymyelinstatus epilepticusdrug-resistant epilepsy
Journal Article 2025-07-17 ✓ 3 Snippets Wang L, Ma JQ, Bian YQ, Qu XP, Zhang Y, Wang C, Gao GD, Zheng LL, Fang QX, Song LJ, Shen LL, Liu B.
In-Text Gene Mentions

…Considering thatSox6binds to the…

…target genes, includingDcc, Nf2, and Rgs7,…

…in OLs targetsSOX6in OPCs and…

Show Full Abstract

Myelin regeneration has been shown in previous studies to ameliorate varying degrees of cognitive impairment in patients with neurodegenerative disorders such as epilepsy. The problem of myelin regeneration in adults with drug-resistant status epilepticus is a major key to the difficulty of treating cognitive impairment in adults with drug-resistant epilepsy (DRE). The purpose of this study is to provide a molecular map of myelin-related molecules under the cognitive deficits seen in DRE. We used a lamotrigine-pentylenetetrazol-resistant epilepsy mouse model and verified the cognitive problems and myelin changes using a water maze and conventional molecular biology techniques. We then analyzed the OLs in the hippocampus of the mice and the effect on myelin using sn RNA-seq technology. We found that the problem of cognitive impairment in drug-resistant epileptic mice is due to altered myelin plasticity. OL maturation induces pathological myelin regeneration which ultimately leads to cognitive impairment. The three glial cell types are closely related to the occurrence of myelin regeneration and jointly promote pathological myelin regeneration. Our study revealed the presence of myelin regeneration in DRE. All of this evidence suggests that normal myelin regeneration contributes to cognitive impairment improvement, but pathological myelin regeneration impairs cognition.

Also flagged:primary headache disordertension-type headacheanxietydepressionbehavioralmigraine
Journal Article 2025-07-17 No Snippets Pan LH, Ling YH, Wang SJ, Al-Hassany L, Chen WT, Chiang CC, Cho SJ, Chu MK, Coppola G, Pietra AD, Dong Z, Ekizoglu E, Els C, Farham F, Garcia-Azorin D, Ha WS, Hsiao FJ, Ishii R, Kim BK, Kissani N, Labastida-Ramirez A, Lange KS, Lytvyak E, Onan D, Ozge A, Papetti L, Pellesi L, Raffaelli B, Raggi A, Straube S, Takizawa T, Tanprawate S, Uludüz DU, Vongvaivanich K, Waliszewska-Prosół M, Wang Y, Wijeratne T, Wu JW, Yener SM, Martelletti P.
Show Full Abstract

<h4>Background and aim</h4>Tension-type headache is the most prevalent primary headache disorder. While the episodic subtype is more common, chronic tension-type headache significantly impacts health-related quality of life and contribute to increased healthcare utilization and disability. Despite considerable advances in the understanding of tension-type headache, critical gaps persist. This paper aims to provide a comprehensive review of the hallmarks of tension-type headache, from its pathophysiology, comorbidities, treatment options, to psychosocial impact.<h4>Main results</h4>Multiple factors are associated with tension-type headache, including peripheral mechanisms (increased muscle tenderness and myofascial trigger points), central sensitization, genetic predisposition, and psychological comorbidities such as anxiety and depression. Neuroimaging and neurophysiological studies demonstrated altered pain processing in cortical and subcortical regions in patients with tension-type headache. Regarding treatment strategy, in addition to pharmacological treatment, novel insights into non-pharmacological interventions such as cognitive behavioral therapy, neuromodulation techniques, physical therapy, mindfulness, lifestyle management, and patient education were highlighted as valuable components of comprehensive management strategies.<h4>Conclusions</h4>A complex interplay between peripheral and central mechanisms and psychosocial stressors underpins tension-type headache. Integrated multidisciplinary approaches combining pharmacological and non-pharmacological interventions are critical for optimal patient outcomes. Further research should continue to refine the understanding of these mechanisms to improve targeted therapeutic strategies and reduce the global burden of tension-type headache.

Also flagged:Yes-associated proteintranscriptional coactivatorbindingTAZtissue homeostasispathogenesis
Journal Article 2025-07-17 No Snippets Zhang Z, He P, Yang L, Gong J, Qin R, Wang M.
Show Full Abstract

Yes-associated protein (YAP) and its paralog, transcriptional coactivator with PDZ-binding motif (TAZ), are critical effectors of the Hippo pathway, as well as other biochemical and biophysical signals. Through their interaction with DNA-binding partners, YAP/TAZ can modulate the transcription of many genes critical for organ size regulation and tissue homeostasis maintenance. Aberrant expression or activation of YAP/TAZ is implicated in the pathogenesis of many cancers and noncancerous diseases. Notably, their functional outputs demonstrate remarkable diversity, with context-dependent roles emerging across distinct disease models and tissue microenvironments. Posttranslational modifications (PTMs) exert profound impacts on the stability, subcellular localization, and function of YAP/TAZ. The canonical Hippo pathway-mediated phosphorylation and ubiquitination have been well characterized as mechanisms that downregulate YAP/TAZ stability and transcriptional activity. Recent studies have identified novel phosphorylation sites, atypical ubiquitination patterns, along with ubiquitin-like modifications, glycosylation, methylation, acetylation, and lactylation on YAP/TAZ. These PTMs exhibit dynamic regulation in response to microenvironmental stimuli, providing molecular insights into the context-dependent functional versatility of YAP/TAZ. This review systematically synthesizes current understanding of YAP/TAZ PTM networks and discusses their therapeutic implications.

SOX6
Also flagged:DNMT1SOX21CKS2tumorepithelial-mesenchymal transitiongastric cancer
Journal Article 2025-07-17 ✓ 1 Snippet Wei J, Xue S, Du X, Dai Y, Ji Y, He G.
In-Text Gene Mentions

…multiforme along withSOX6[ 9 ].…

Show Full Abstract

BACKGROUND: The dysregulation of SOXs is related to tumor invasion, metastasis, proliferation, apoptosis, and epithelial-mesenchymal transition. This research sought to investigate the function and mechanisms of SOX21 in gastric cancer (GC). METHODS: Multiple databases were included to determine the hub transcription factors in GC. In addition, RT-qPCR and Western blot were used to validate gene expression in tissues from GC patients. CCK-8, EdU, colony formation, wound healing, Transwell assays, and a xenograft tumor model were used to determine the function of SOX21 in GC. The targets of SOX21 were predicted and verified using ChIP, dual-luciferase reporter, and functional assays. SOX21 DNA methylation in GC cells was determined by qMSP. Rescue experiments were carried out in GC cells with DNMT1 silencing alone or in combination with SOX21 silencing. RESULTS: SOX21 was downregulated in GC tissues and cells. Ectopic expression of SOX21 inhibited cell growth, invasion, and migration, and induced apoptosis of GC cells. CKS2 was a target of SOX21, and overexpression of CKS2 promoted cell viability and mobility in GC cells overexpressing SOX21. The downregulation of SOX21 was related to the DNA hypermethylation catalyzed by DNMT1. The silencing of SOX21, by contrast, overturned the anti-tumor effects of sh-DNMT1 in vitro and in vivo. CONCLUSION: Our data showed that DNMT1 overexpression upregulated CKS2 expression via hypermethylation of SOX21, thus promoting GC cell proliferation and growth, indicating that the DNMT1/SOX21/CKS2 axis could be a target for GC treatment.

Also flagged:interleukin-10oxidizedphospholipidsinfectionspattern recognition receptorsimmune response
Journal Article 2025-07-17 No Snippets Di Gioia M, Poli V, Tan PJ, Spreafico R, Chu A, Cuenca AG, Wu Z, Benamar M, Pandolfi L, Meloni F, Askarian F, Hsiao J, Borroum E, Nizet V, Gordts PLSM, Witztum JL, Chatila TA, Chou J, Zhou X, Springstead JR, Zanoni I.
Show Full Abstract

Phagocytes initiate immunity to invading microorganisms by detecting pathogen-associated molecular patterns via pattern recognition receptors. Pathogen encounter and consequent activation of the immune system cause tissue damage and the release of host-derived damage-associated molecular patterns, contributing to shape immunity. However, how self-derived factors are sensed by phagocytes and impact the immune response remains poorly understood. Here, we demonstrated that host-derived oxidized phospholipids (oxPLs) are formed after microbial encounter in both mice and humans. oxPLs exacerbated inflammation without affecting pathogen burden. Mechanistically, oxPLs bound and inhibited AKT, potentiating the methionine cycle and the activity of the epigenetic writer EZH2. EZH2 epigenetically dampened the pluripotent anti-inflammatory cytokine IL-10, contributing to the death of the host. Overall, we found that host-derived oxPLs set the balance between protective and detrimental antimicrobial responses and that they can be prophylactically or therapeutically targeted to protect the host against deranged inflammation and immunopathology.

PEBP1
Also flagged:ferroptosisdiabetic retinopathydiabetesreverse transcriptionPLIN2PIEZO1
Journal Article 2025-07-17 ✓ 1 Snippet Hou XY, Li HF, Jie CH, Liu Z, Bi XQ, Wang JJ, Deng Y, Zhang W.
In-Text Gene Mentions

…HSPA5, HMOX1, andPEBP1.…

Show Full Abstract

Diabetic retinopathy (DR) is one of the most prevalent and devastating microvascular consequences of diabetes. While the role of ferroptosis in the etiology of DR is acknowledged by some researchers, the precise mechanisms underlying its pathophysiology and the potential therapeutic implications remain to be fully elucidated. The GSE221521 dataset, derived from peripheral blood mononuclear cells (PBMCs), was used to assess differentially expressed genes (DEGs) between controls and DR patients. WGCNA was used to identify gene coexpression modules that are significantly associated with DR. The machine algorithm techniques are used to select genes with significant predictive power. The diagnostic potential of these genes was validated by assessing their performance through ROC curve analysis. The identified key genes were further validated via two external datasets and reverse transcription quantitative polymerase chain reaction (RT‒qPCR). Finally, a total of 3706 DEGs were screened from the GSE221521 dataset. The intersection of 610 genes identified from the 3706 DEGs and WGCNA with 484 ferroptosis genes yielded 16 ferroptosis-related DEGs. These 16 genes were subjected to further analysis via the LASSO and SVM-RFE methods, alongside five additional genes of interest: PLIN2, PIEZO1, HSPA5, HMOX1, and PEBP1. The validation demonstrated that the differences in the expression of PIEZO1 and HSPA5 were statistically significant across both datasets. RT‒qPCR revealed significant upregulation of PIEZO1 and HSPA5 in the peripheral blood of DR patients (P < 0.05). In conclusion, our study identified PIEZO1 and HSPA5 as pivotal genes associated with ferroptosis in the context of DR.

PRDX6
Also flagged:PSD-95NMDA receptorsynaptosomescognitive declinedementiabehavioral disorders
Journal Article 2025-07-17 ✓ 1 Snippet Godoy-Lugo JA, Hicks D, Durra S, Massey ER, Shkirkova K, Sauri AI, Kerstiens E, Chen S, Zhao L, Sioutas C, Mack WJ, Finch CE, Thorwald MA.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Air pollution (AirP) increases the risk of accelerated cognitive decline, dementia, and behavioral disorders associated with oxidative damage in humans. These AirP responses are shared with rodent models. The underlying impact of AirP-mediated molecular changes on synapses remains unexplored. We examined synaptosomes extracted from cerebral cortex of mice chronically exposed to inhaled diesel exhaust particles (DEP) for 8 weeks. DEP selectively decreased postsynaptic proteins (PSD-95; p = 0.04, SAP97; p = 0.01) by at least 20 % and NMDA receptor subunits (GluN1; p = 0.03, N2A; p = 0.009, N2B; p = 0.01) by 15 %, without altering the evaluated pre-synaptic proteins. Antioxidant enzymes for oxidized phospholipid repair (GPx4; p = 0.015), iron metabolism (HMOX1; p = 0.04), and glutathione synthesis (GCLC; p = 0.008), which participate in mitigating ferroptosis, a form of cell death present in Alzheimer's disease, increased by at least 15 %. These findings suggest subcellular responses to AirP in glutamatergic synapses. Further analyses of the impact of AirP on synapses may consider protective mechanisms by antioxidant enzymes to enhance cognitive health at all ages.

Also flagged:insulin resistancemetabolic disorderstype II diabetesobesitysteatotic liver diseaseoxygen
Journal Article 2025-07-17 No Snippets Kumar R, Chinala A, Grandhe D, Endicott SJ, Garcia MA, Campen MJ, Gullapalli RR.
Show Full Abstract

Insulin resistance is a major pathophysiological process underlying a variety of human metabolic disorders such as type II diabetes, obesity and metabolic (dysfunction) associated steatotic liver disease (MASLD). The etiology of insulin resistance and human metabolic disorders is complex, involving an interplay of genetics, gut microbiome, dietary intake, sedentary behavior, and environmental exposures. Of these, the role of environmental exposures is perhaps the least explored in the pathophysiology of insulin resistance. Due to a multitude of causal factors implicated in the etiopathogenesis of insulin resistance, it has been difficult to delineate specific roles of individual risk factors. However, from a biochemical and pathophysiological perspective, there are common cellular drivers that are universally accepted as key drivers of insulin resistance. These include-altered cell signaling, abnormal reactive oxygen species (ROS) production, mitochondrial dysfunction, and sustained bioenergetic imbalances. Target cell dysfunction is a common theme driving insulin resistance irrespective of the organ (e.g., liver, muscle and adipose tissue). While humans are exposed to numerous chemicals on a routine basis, some of the most potent environmental exposures implicated in chronic disease causation fall into the category of heavy metals. This review explores the role of sustained, low-dose heavy metal exposures in the specific context of hepatic insulin resistance. Despite being a major site for heavy metal accumulation with decades-long half-lives, our understanding of the long-term impacts of these heavy metals on human liver health remains minimal at the current time.

SERPINC1
Also flagged:cognitioncognitive impairmentnitrogen dioxidenitrogen oxidescarbonsulphur dioxide
Journal Article 2025-07-17 ✓ 1 Snippet Canning T, Arias-de la Torre J, Fisher HL, Gulliver J, Hansell AL, Hardy R, Hatch SL, Mudway IS, Ronaldson A, Cartlidge M, James SN, Keuss SE, Schott JM, Richards M, Bakolis I.
In-Text Gene Mentions

…included in theACE-IIIanalysis.…

Show Full Abstract

<h4>Background</h4>Previous research has linked higher exposure to air pollution to increased cognitive impairment at older ages. We aimed to extend the existing evidence in this area by incorporating exposures across the life course in addition to measures of cognition and brain structural imaging in participants at midlife to older age.<h4>Methods</h4>For this population-based study, we used data from the Medical Research Council National Survey of Health and Development (NSHD; also known as the 1946 British Birth Cohort) and a neuroimaging substudy of the NSHD known as Insight 46. Participants were recruited after birth in a single week during March, 1946. Our objectives were to assess whether exposure to air pollutants in midlife (age 45-64 years) was associated with poorer processing speed and poorer verbal memory between the ages of 43 years and 69 years, and whether exposures were associated with poorer cognitive state and brain structure outcomes at age 69-71 years. Air pollution exposure data were available for nitrogen dioxide (NO<sub>2</sub>; ages 45-64 years); particulate matter with diameter less than 10 μm (PM<sub>10</sub>; ages 55-64 years); and nitrogen oxides (NO<sub>x</sub>) and particulate matter with diameters less than 2·5 μm (PM<sub>2·5</sub>) and between 2·5 μm and less than 10 μm (PM<sub>coarse</sub>) and particulate matter absorbance (PM<sub>2·5</sub>abs) as a measure of black carbon absorption (ages 60-64 years), with adjustments for early-life exposures to black smoke and sulphur dioxide. Verbal memory was tested with a 15-item recall task and processing speed with a visual search task at ages 43, 53, 60-64, and 69 years. The Addenbrooke's Cognitive Examination III (ACE-III), a measure of cognitive state, was conducted at age 69 years. Whole-brain, ventricular, hippocampal, and white matter hyperintensity volumes were assessed by MRI at age 69-71 years. Generalised linear models and generalised mixed linear models were used to explore associations between pollution exposure, cognitive measures, and brain structural outcomes, adjusted for sociodemographic factors including smoking status and neighbourhood deprivation.<h4>Findings</h4>Between the ages of 43 years and 69 years, we included 1534 NSHD participants in the verbal memory and processing speed analysis. Of 2148 participants who underwent testing during the wave of follow-up in 2015-16, at age 69 years, 1761 were included in the ACE-III analysis. Of the 502 NSHD participants recruited into the Insight 46 substudy, 453 were included in the analysis. Higher exposure to NO<sub>2</sub> and PM<sub>10</sub> was associated with slower processing speed between the ages of 43 years and 69 years (NO<sub>2</sub> β -8·121 [95% CI -10·338 to -5·905 per IQR increase in exposure]; PM<sub>10</sub> β -4·518 [-6·680 to -2·357]). Higher exposure to all tested pollutants was associated with lower ACE-III score at age 69 years (eg, NO<sub>2</sub> β -0·589 [-0·921 to -0·257]). Higher exposure to NO<sub>x</sub> was associated with smaller hippocampal volume (β -0·088 [-0·172 to -0·004]) and higher exposure to NO<sub>2</sub> and PM<sub>10</sub> was associated with larger ventricular volume (NO<sub>2</sub> β 2·259 [0·457 to 4·061]; PM<sub>10</sub> β 1·841 [0·013 to 3·669]) at age 69-71 years.<h4>Interpretation</h4>Acknowledging the probable effects of exposure early in life, higher exposure to nitrogen dioxide, nitrogen oxides, and coarse particulate matter in midlife to older age was associated with poorer cognition, processing speed, and brain structural outcomes, strengthening evidence for the adverse effects of air pollution on brain function in older age.<h4>Funding</h4>The National Institute for Health and Care Research, the Medical Research Council (MRC), Alzheimer's Research UK, the Alzheimer's Association, MRC Dementias Platform UK, and Brain Research UK.

Also flagged:irondinitrogenhydrideNitrogenasehydrogenammonia
Journal Article 2025-07-17 No Snippets Dong W, Wang H, Kamali S, Tyler DR, Guo Y, Yan L, Balesdent CG, Crossland JL, Case DA, Yoda Y, Zhao J, Cramer SP.
Show Full Abstract

Nitrogenase (N<sub>2</sub>ase) is a critical enzyme which catalyzes the reaction of N<sub>2</sub> → NH<sub>3</sub> in nature. Studies on the spectroscopy and photochemistry of <i>trans</i>-[Fe<sup>II</sup>(DMeOPrPE)<sub>2</sub>(N<sub>2</sub>)H][BPh<sub>4</sub>] (1) and its isotopologues (2-6) provide a possible first step to evaluate the geometries and properties of the real N<sub>2</sub>ase-N<sub>2</sub> structure(s). In this article, we have used FT-IR, FT-Raman, synchrotron-based nuclear resonant vibrational spectroscopy (NRVS) and DFT calculations to examine and assign the normal modes of these complexes. In addition, we have monitored their wavelength dependent photochemistry using mid-IR, near-IR, NRVS, and Mössbauer spectroscopies. Two distinct photolysis pathways are observed with mid-IR at (nominal) 4 K - (1) the cleavage of Fe-N<sub>2</sub> bond in UV or visible light photolyses, which presents a unipolar disappearance of the N<sub>2</sub> peak at 2094 cm<sup>-1</sup> and is recombinable; (2) the ejection of <i>trans</i> hydrogen atom with UV irradiation, which has a pair of bipolar peaks with the disappearance of N<sub>2</sub> at 2094 cm<sup>-1</sup> and the appearance of a new species at 2056 cm<sup>-1</sup> and is non-recombinable. The latter peak is well aligned with the N<sub>2</sub> peak in an Fe<sup>I</sup> reference complex (7). The combination of mid IR monitored photolysis/recombination and NRVS monitored photolysis form the central evidence for the conclusions in this article. In particular, the Fe<sup>II</sup>-N<sub>2</sub> and Fe<sup>I</sup>-H·dissociations are in competition with each other in UV or UV-inclusive photolyses of this dinitrogen hydride complex. In addition, near-IR and Mössbauer also provide consistent evidence about Fe<sup>I</sup>. This wavelength dependent photochemical work is the first one on a reaction active N<sub>2</sub>ase-N<sub>2</sub> model complex and it also demonstrates the competition ejection between two axial ligands (H· and N<sub>2</sub>). It offers valuable information for future studies on real N<sub>2</sub>ase-N<sub>2</sub> and its photolysis products.

Also flagged:triclocarbansulfurmetabolismnitrogennitratehydrogenase
Journal Article 2025-07-17 No Snippets Li ZY, Li M, Zhang XN, Zheng K, Xiao HB, Wang AJ, Sun YL.
Show Full Abstract

Triclocarban (TCC), a persistent antimicrobial compound widely present in municipal wastewater, poses potential risks to biological nitrogen removal processes. However, the potential risks posed by TCC to advanced treatment processes-particularly sulfur-metabolism biofilm reactor-remain poorly understood and require further elucidation. This study investigated the impact of TCC on sulfur-metabolism biofilm base on sulfur-metabolism biofilm reactor, focusing on nitrogen removal performance, TCC transformation pathways, and microbial community dynamics. The results showed that sulfur-metabolism biofilm maintained stable nitrogen removal efficiency under trace TCC (≤ 25 μg/L) stress with nitrate removal improved from 93 % to 98 %, whereas performance declined significantly at 100 μg/L, reducing nitrate removal to 81.8 ± 3.9 % and increasing effluent NO<sub>2</sub>⁻-N and N<sub>2</sub>O-N by 6.0- and 28.0-fold, respectively. Functional predictions via FAPROTAX suggested TCC-induced alterations in sulfur and nitrogen metabolic pathways. In addition, TCC and its transformation intermediates (MCC, DCC, NCC, 3,4-DCA, 4-CA) accumulated in the biofilm. Network analysis revealed syntrophic interactions between sulfur-oxidizing bacteria (e.g., Sulfurisoma and Sulfuritalea) and hydrogenase-rich TCC degraders (e.g., Unclassified Chloroflexi). These findings highlight the potential of sulfur-metabolism biofilm to achieve simultaneous nitrogen removal and micropollutant transformation in low-carbon, sulfur-rich wastewater environments, offering a sustainable solution for advanced wastewater treatment systems.

Also flagged:Obesitychronic diseasescancerdermatological disordersmetabolismMC4R
Journal Article 2025-07-17 No Snippets Lu X, Ji L, Chen D, Lian X, Yuan M.
Show Full Abstract

Obesity is a major global public health issue linked to a wide range of chronic diseases. Understanding its complex causal pathways requires robust analytical methods. Mendelian randomization (MR), which employs genetic variants as instrumental variables, effectively addresses confounding and reverse causation and has become a key tool in obesity research. This review summarizes the development of MR methodologies, from single-sample to multivariable, mediation, and time-series models, and highlights key findings from the past decade. MR studies have revealed causal associations between obesity and nine major disease categories, including cardiovascular, metabolic, cancer, psychiatric, respiratory, renal, reproductive, musculoskeletal, and dermatological disorders. Obesity influences disease risk through mechanisms involving energy metabolism, hormonal regulation, and inflammation, with heterogeneity by age, sex, and fat distribution. Key genes such as <i>MC4R, LEPR, FTO</i>, and <i>FGF21</i> have been identified as potential therapeutic targets. Current challenges include instrument strength, pleiotropy, population stratification, and the external validity of GWAS data. Future research that integrates multi-ancestry GWAS, functional validation, and multi-omics approaches may further enhance the utility of Mendelian randomization. MR provides a robust genetic framework for elucidating obesity's causal effects and informing targeted interventions and personalized treatment strategies.

Also flagged:CHthyroid hormone deficiencyintellectual disabilityThyroid hormoneshypothyroidismPrimary CH
Journal Article 2025-07-17 No Snippets Wahoud F, Essadki S, Zirar K, Lamsyah R, Hajjaji W, Amrani R.
Show Full Abstract

Congenital hypothyroidism (CH) is one of the major preventable causes of intellectual disability. This study evaluates the incidence of CH through a newborn screening (NBS) program in eastern Morocco. A descriptive cross-sectional design was used and heel prick blood samples were collected on blotting paper to measure Thyroid-Stimulating Hormone (TSH) using an immunofluorimetric assay. 4062 newborns were screened (51.3% male, 48.7% female). TSH levels significantly varied by age: newborns sampled before 24 h had a higher median TSH (3.7 µU/mL [0.10-28.90]) compared to those sampled at 24 h or more (2.1 µU/mL [0.10-32.30]; <i>p</i> < 0.001). Using age-specific cut-off values, 18 suspected CH cases were recalled (recall rate: 0.44%). Among the 16 cases who completed confirmatory testing, 4 had transient hyperthyrotropinemia (HTT), characterized by mildly abnormal serum TSH and T4 levels that normalized spontaneously after few months without treatment. Three cases were diagnosed with CH confirmed at birth with markedly elevated serum TSH concentrations and significantly reduced T4 levels. Consequently, the birth prevalence of CH confirmed at birth was 1:1354 live births. The median preanalytical delay was 6 days (IQR: 3-12) and the TSH result turnaround was 8 days (IQR: 5-15), potentially affecting timely intervention. This first report from eastern Morocco confirms the relevance of neonatal screening but highlights delays that must be addressed to enhance early diagnosis and management.

Also flagged:genetic disordersnucleotidegenetic diseasesCas9methylationgenetic
Journal Article 2025-07-17 No Snippets Moustakli E, Christopoulos P, Potiris A, Zikopoulos A, Mavrogianni D, Karampas G, Kathopoulis N, Anagnostaki I, Domali E, Tzallas AT, Drakakis P, Stavros S.
Show Full Abstract

Rare genetic diseases are often caused by structural variants (SVs), such as insertions, deletions, duplications, inversions, and complex rearrangements. However, due to the technical limitations of short-read sequencing, these variants remain underdiagnosed. Long-read sequencing technologies, including Oxford Nanopore and Pacific Biosciences high-fidelity (HiFi), have recently advanced to the point that they can accurately find SVs throughout the genome, including in previously unreachable areas like repetitive sequences and segmental duplications. This study underscores the transformative role of long-read sequencing in diagnosing rare diseases, emphasizing the bioinformatics tools designed for detecting and interpreting structural variants (SVs). Comprehensive methods are reviewed, including methylation profiling, RNA-seq, phasing analysis, and long-read sequencing. The effectiveness and applications of well-known tools like Sniffles2, SVIM, and cuteSV are also assessed. Case studies illustrate how this technique has revealed new pathogenic pathways and solved cases that were previously undetected. Along with outlining potential future paths like telomere-to-telomere assemblies and pan-genome integration, we also address existing issues, including cost, clinical validation, and computational complexity. For uncommon genetic illnesses, long-read sequencing has the potential to completely change the molecular diagnostic picture as it approaches clinical adoption.

POU3F2
Also flagged:Solar lentiginesskin disorderssolar lentigoSimple Summary Solar lentiginesage spotsskin lesions
Journal Article 2025-07-17 ✓ 1 Snippet Cai D, Zhang H, Zhang C, Xiao X, Cui X, Gu X, Chen L.
In-Text Gene Mentions

…as SOX9 ,POU3F2( BRN2 ),…

Show Full Abstract

Solar lentigines, commonly caused by prolonged ultraviolet exposure, raise the risk of skin disorders and remain challenging to manage due to their complex mechanisms. Understanding the molecular mechanisms driving the progression of solar lentigines is crucial for developing effective protective strategies. In this study, we introduced a novel method, Dynamic Network Driver (DND), which identifies upstream regulators that drive disease progression by integrating the Dynamic Network Biomarker (DNB) approach with network control theory. By applying DND to multi-omics data from solar lentigines subjects, we (1) identified the key drivers associated with solar lentigo progression, with their functions involved in differentiation and dermal-epidermal junction; and (2) highlighted <i>ARNT2</i> and <i>TBX2</i> as significant master factors supported by in vitro validation in melanocytes and pigmented 3D living skin equivalent models. These results demonstrate the potency of DND for uncovering the molecular mechanisms behind solar lentigines and informing therapeutic strategies. In summary, the DND approach identified novel drivers of solar lentigo progression, acting as new markers for spot mitigation in 3D spot mimic models.

DCC
Also flagged:infectious diseasesTGF-βimmune responsesantibodybindingimmune response
Journal Article 2025-07-17 ✓ 1 Snippet Yu D, Ma X, Huang C, Wang T, Zhang M, Feng F, Wu X, La Y, Guo X, Yan P, Zhang D, Liang C.
In-Text Gene Mentions

…Colorectal Cancer (DCC), Ceramide Kinase-Like…

Show Full Abstract

The yak is a vital livestock resource on the Qinghai-Tibet Plateau, renowned for its strong disease resistance and high-quality meat. However, various diseases pose significant threats to its health and lead to substantial economic losses. Current feeding management practices, along with available drugs and vaccines, have demonstrated limited effectiveness in preventing and controlling infectious diseases. Additionally, challenges such as drug resistance and the safety of animal products persist. Therefore, enhancing the disease-resistant breeding capacity of yaks is crucial. In this study, we examined 192 yaks by measuring the concentrations of 10 immune indicators in serum by using the ELISA method and conducting whole-genome resequencing, which identified 19,182,942 SNP loci. Through genome-wide association analysis, we detected 323 significant SNPs located near or within 125 candidate genes, most of which are associated with disease and significantly enriched in the TGF-β signaling pathway. Overall, our study identified a series of novel variants and candidate genes associated with disease resistance traits in yaks, providing important information for the molecular breeding of disease resistance in yaks. These results not only contribute to a deeper understanding of the function of disease resistance genes in yaks but also hold great potential for accelerating precision disease resistance breeding in yaks.

Also flagged:infectionsgene expressionnucleotidescytoplasmbindingpairing
Journal Article 2025-07-17 No Snippets Trufin II, Ungureanu L, Halmágyi SR, Apostu AP, Șenilă SC.
Show Full Abstract

<b>Background:</b> Long non-coding RNAs (lncRNAs) are increasingly recognized as pivotal regulators in both inflammatory and neoplastic skin disorders. Their implications in numerous biological processes, including gene expression, immune responses, and epidermal homeostasis, suggest potential applications as diagnostic and prognostic markers, as well as therapeutic targets. <b>Methods:</b> We conducted a literature search on lncRNAs involved in both psoriasis and cutaneous squamous cell carcinoma (cSCC), highlighting overlapping pathogenic mechanisms. <b>Results:</b> Several lncRNAs, such as <i>HOTAIR, MALAT-1</i>, <i>H19</i>, and <i>uc.291</i>, display dysregulated expression in both psoriasis and cSCC, influencing keratinocyte proliferation and apoptosis, immune modulation, cytokine signaling, and the synthesis of epidermal proteins. <b>Conclusions:</b> The intersection of lncRNA function in chronic inflammation and skin carcinogenesis underscores their role in mediating the transition from psoriatic inflammation to tumorigenesis, offering new insights into disease susceptibility; further investigation through functional studies and clinical validation are required. The study of lncRNA-mediated molecular pathways is particularly relevant given the increased risk of non-melanoma skin cancers and lymphoproliferative disorders among patients with chronic and severe forms of psoriasis.

Also flagged:Tyrosine KinaseGastrointestinal Stromal TumorGastrointestinal stromal tumorsmesenchymal tumorsKITCD117
Journal Article 2025-07-17 No Snippets Xiao XH, Zhang QS, Hu JY, Zhang YX, Song H.
Show Full Abstract

Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract, primarily driven by activating mutations in KIT (CD117) and platelet-derived growth factor receptor alpha (PDGFRA). The introduction of tyrosine kinase inhibitors (TKIs), especially imatinib, has significantly transformed GIST treatment. However, the emergence of both primary and secondary resistance to imatinib presents ongoing therapeutic challenges. This review comprehensively explores the mechanisms underlying imatinib resistance and evaluates subsequent TKI therapies. Sunitinib, regorafenib, and ripretinib are currently approved as standard second-, third-, and fourth-line therapies, each demonstrating efficacy against distinct mutational profiles. Avapritinib, notably effective against PDGFRA D842V mutations, represents a milestone for previously untreatable subgroups. Several alternative agents-such as nilotinib, masitinib, sorafenib, dovitinib, pazopanib, and ponatinib-have shown varying degrees of success in refractory cases or specific genotypes. Investigational compounds, including crenolanib, bezuclastinib, famitinib, motesanib, midostaurin, IDRX-42, and olverembatinib, are under development to address resistant or wild-type GISTs. Despite progress, long-term efficacy remains limited due to evolving resistance. Future strategies include precision medicine approaches such as ctDNA-guided therapy, rational drug combinations, and novel drug delivery systems to optimize bioavailability and reduce toxicity. Ongoing research will be crucial for refining treatment sequencing and expanding therapeutic options, especially for rare GIST subtypes.

DNAH10
Also flagged:primary ciliary dyskinesiagenetic disorderrespiratory infectionsorganizationaxonemepathogenesis
Journal Article 2025-07-17 ✓ 2 Snippets de Ceuninck van Capelle C, Luo L, Leitner A, Tschanz SA, Latzin P, Ott S, Herren T, Müller L, Ishikawa T.
In-Text Gene Mentions

…This corresponds toDNAH10, which was found…

…HCs: DNAH9 andDNAH10( Figure 4d…

Show Full Abstract

<h4>Introduction</h4>Primary ciliary dyskinesia (PCD) is a genetic disorder affecting motile cilia across various organs, leading to recurrent respiratory infections, subfertility, and laterality defects. While several diagnostic tools exist-such as high-speed video microscopy, immunofluorescence staining, electron microscopy, and genetic screening-the relationship between different pathogenic variants within a single PCD gene and their effects on ciliary composition, structure, and clinical phenotype remains poorly understood.<h4>Methods</h4>To investigate this, we analyzed cilia from PCD patients with different mutations in axonemal dynein heavy chain <i>dnah5</i> using mass spectrometry and cryo-electron tomography. These methods allowed us to examine both the protein composition and ultrastructural organization of motile cilia in affected individuals.<h4>Results</h4>Though all analyzed patients present similarly in traditional diagnostic methods, we observed differences in axonemal composition among patients carrying different <i>dnah5</i> mutations. Specific reductions in ciliary components varied between individuals, indicating a mutation-specific impact. Notably, proteins such as VWA3B, KIAA1430/CFAP97, and DTHD1-not previously identified as components of human respiratory motile cilia-were detected in wild type cilia, but not in patient cilia. Lastly, we confirmed some changes in protein abundance in the 96-nm repeated unit of the axoneme between wild-type and PCD samples.<h4>Discussion</h4>These findings suggest that mutations in <i>dnah5</i> result in varied and specific alterations in axonemal composition, reflecting the heterogeneity of the disease at the molecular level. The discovery of novel ciliary proteins and mutation-specific differences enhances our understanding of the complexity of PCD pathogenesis and may inform future diagnostic and therapeutic strategies.

FBXL4
Also flagged:mitochondrialpreeclampsiaPEmitochondriametabolismpathogenesis
Journal Article 2025-07-17 ✓ 1 Snippet Li C, Liu F, Li C, Zhao X, Lv Q, Jiang A, Zhao S.
In-Text Gene Mentions

…, BTD ,FBXL4, FOXO1 ,…

Show Full Abstract

Preeclampsia(PE) is closely linked to adverse maternal and fetal outcomes. Given the pivotal roles of mitochondria in various human diseases and the limited research on their involvement in PE, this study identified biomarkers linked to mitochondrial metabolism in PE and their roles in its pathogenesis. Data from three datasets were integrated using the ComBat algorithm to mitigate batch effects. Differential expression analysis identified genes differentially expressed between PE cases and Control group. Cross-referencing these genes with mitochondrial energy metabolism-related genes (MMRGs) isolated mitochondrial energy metabolism-related differentially expressed genes (MMRDEGs). GO and KEGG analysis were performed to elucidate the functions of the MMRDEGs. A diagnostic model using Random Forest and logistic regression was validated by ROC curve analysis. mRNA expressions of <i>OCRL</i>, <i>TPI1</i>, <i>GAPDH</i>, and <i>LDHA</i> were quantified via qPCR. Immune characteristics were explored, and PPI, mRNA-miRNA, mRNA-TF and mRNA-RBP interaction networks were constructed. AlphaFold analyzed protein structures of <i>OCRL, TPI1, GAPDH</i>, and <i>LDHA.</i> A total of 1073 DEGs and 24 MMRDEGs were identified. <i>OCRL, TPI1, GAPDH</i>, and <i>LDHA</i> formed the diagnostic model, which were predominantly enriched in pyruvate metabolism, glycolysis, and ATP metabolism pathways. CIBERSORT highlighted immune cell composition variations between PE and Control groups. <i>OCRL, TPI1, GAPDH</i>, and <i>LDHA</i> exhibited increased mRNA expression levels in preeclamptic placentas. Therefore, MMRDEGs may play a critical role in the mechanism of oxidative stress and inflammatory response in PE by mediating metabolic regulation and immune modulation, potentially serving as diagnostic biomarkers associated with mitochondrial metabolism in preeclampsia.

Also flagged:peptidemajor histocompatibility complexMHCMHC class ICD1MHC-related protein 1
Journal Article 2025-07-17 No Snippets Laub A, Rodrigues de Almeida N, Huang S.
Show Full Abstract

Unlike conventional T cells that detect peptide antigens loaded to major histocompatibility complex (MHC) molecules, unconventional T cells respond to non-peptidic metabolite antigens presented by MHC class I-like proteins, such as CD1 and MHC-related protein 1 (MR1). Semi-invariant mucosal-associated invariant T (MAIT) cells, γδ T cells, and invariant natural killer T (iNKT) cells, together with other CD1- or MR1-restricted T cell subsets expressing diverse T cell receptors (TCR), elicit an innate-like response independent of diverse MHC genetics. In contrast to an overall enhanced response to bacterial-derived riboflavin precursor metabolites in infections, MAIT cells often exhibit an immunosuppressive or exhausted phenotype in glioblastoma, lung cancer, colorectal cancer, and various hematological malignancies. Whereas some tumor cells can activate MAIT cells, the structures and functions of tumor-derived MR1 ligands remain largely unknown. Novel discoveries of mammalian-derived agonists and antagonists binding to MR1 protein are our knowledge of MR1 ligand structures and functions from MAIT cell activation in healthy conditions to anti-cancer immunity. Recent findings reveal that nucleoside and nucleobase analogs, as self-metabolites to activate MR1-restricted T cells, are regulated in the tumor microenvironment. Likewise, iNKT cells exhibit a dynamic role in cancer, capable of both protumor and antitumor immunity. Similarly, γδ T cells have also demonstrated both protective and tumor-promoting roles, via recognizing stress-induced protein and metabolite ligands. This review further depicts the distinct kinetics of responses, highlighting a rapid activation of unconventional T cells in solid versus hematological cancers. Emerging therapeutic strategies, including antigen-loaded MR1 and CD1, adoptive T cell transfer, chimeric antigen receptor-T (CAR-T) cells, T cell receptor-T (TCR-T) cells, and combination treatments with immune checkpoint inhibitors, yet remain challenging, hold promise in overcoming tumor-induced immunosuppression and genetic restriction of conventional T cell therapies. By addressing critical gaps, such as novel structures and functions of cancer metabolite antigens, unconventional T cells offer unique advantages in anti-cancer immunotherapy.

HTT
Also flagged:amyotrophic lateral sclerosisALSneurodegenerative disorderC9orf72ATXN2CACNA1A
Journal Article 2025-07-17 ✓ 2 Snippets Sabetta E, Rallmann K, Bergquist J, Taba P, Pfaff AL, Poudel BH, Ferrari D, Locatelli M, Kõks S.
In-Text Gene Mentions

…ATXN8 (SCA8) andHTT(Huntington’s disease) […

…DM1-AS, PPP2R2B, ATXN8OS,HTT, CACNA1A, ATXN3, and…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder presenting progressive weakness of the bulbar and extremity muscles, leading to a wide-ranging clinical phenotype. More than 30 genes have been associated to genetically inherited ALS yet, approximately 85%-90% of ALS cases are sporadic. Short tandem repeats expansions, have recently been found in clinically diagnosed ALS patients and are currently investigated as potential genetic biomarkers. In this paper we compare the investigation of pathological tandem repeat expansions on a group of ALS patients by comparing the standard short-read sequencing (SRS) technique with a long-read-sequencing (LRS) method which has recently become more accessible. Blood samples from 47 sporadic ALS cases were subjected to SRS by Illumina Whole Genome Sequencing. The genome-wide tandem repeat expansions were genotyped using GangSTR, while wANNOVAR was used for variant annotation. Uncertain cases were further explored using LRS. SRS identified pathological expansions in <i>HTT</i>, <i>ATXN2</i>, and <i>CACNA1A</i> genes in one patient, which were not confirmed with LRS. The latter identified large tandem repeat expansions in the C9orf72 gene of one patient that were missed by SRS. Our findings suggest that LRS should be preferred to SRS for accurate identification of pathological tandem repeat expansions.

Also flagged:vitamin D deficiencydeliriumvitamin Dsurgical site infectionsvitamin D insufficiencychronic kidney disease
Journal Article 2025-07-17 No Snippets Hung KC, Yu TS, Liao SW, Lai YC, Fu PH, Feng PH, Chen IW.
Show Full Abstract

<h4>Background</h4>To assess the impact of preoperative vitamin D deficiency (VDD) on the risk of postoperative delirium (POD) in patients undergoing musculoskeletal surgery.<h4>Methods</h4>This cohort study utilized the TriNetX Healthcare Commercial Organizations database. We included patients aged 50 years or older who underwent musculoskeletal surgery requiring hospital admission. Patients were categorized according to their preoperative vitamin D levels into three groups: deficient (≤20 ng/mL), insufficient (21-29 ng/mL), and sufficient (≥30 ng/mL). The primary outcome was POD within 30 days of surgery. Secondary outcomes included risks of surgical site infections, emergency department (ED) visits, and intensive care unit (ICU) admissions. Risk factors for POD were assessed using multivariate logistic regression analysis.<h4>Results</h4>After matching, 6,218 pairs of vitamin D-deficient and sufficient patients were compared. VDD was related to a significantly higher risk of POD [1.0% vs. 0.5%; odds ratio (OR): 2.18, 95% confidence interval (CI): 1.41-3.36, <i>p</i> < 0.001]. Vitamin D-deficient patients also had higher rates of ED visits (OR: 1.36, 95% CI: 1.18-1.57, <i>p</i> < 0.001) and ICU admissions (OR: 1.51, 95% CI: 1.19-1.91, <i>p</i> < 0.001). Similarly, vitamin D insufficiency (10,764 matched pairs) was associated a smaller but significant increase in delirium risk (OR: 1.49, 95%CI: 1.05-2.12, <i>p</i> = 0.023), along with increased ED visits (OR: 1.16, 95% CI: 1.03-1.30, <i>p</i> = 0.013) and ICU admissions (OR: 1.25, 95% CI: 1.03-1.52, <i>p</i> = 0.0261), suggesting a dose-dependent relationship. Risk factor analysis revealed that advanced age, male sex, chronic kidney disease, and malnutrition were significant predictors of POD in patients with VDD.<h4>Conclusion</h4>Individuals with VDD experienced a higher risk of POD, suggesting the potential benefits of preoperative vitamin D screening and supplementation as a strategy to improve outcomes in surgical patients. While our findings highlight the potential benefit of vitamin D assessment and optimization before surgery, the retrospective design limits the ability to draw causal inferences. Prospective interventional studies are warranted to determine whether treating VDD can meaningfully lower the risk of POD.

DCC
Also flagged:scaffold proteinsfolliculogenesisinfertilityPremature ovarian insufficiencycardiovascular diseaseosteoporosis
Journal Article 2025-07-17 ✓ 1 Snippet Saunders DC, Laronda MM.
In-Text Gene Mentions

DCC

Show Full Abstract

Many individuals with ovaries that utilize fertility preservation because of their progressive disease or gonadotoxic treatment must use ovarian tissue cryopreservation (OTC). Currently, the only option for fertility and hormone restoration after OTC is ovarian tissue transplantation (OTT), or autologous grafting of ovarian tissue. Individuals with disease in their ovaries do not have options to produce a biological child or restore their full ovarian hormone milieu. The goal of developing a bioprosthetic ovary would support full fertility and hormone restoration long-term as a safer and ideally more efficient option than current OTT techniques. In order to develop a bioprosthetic ovary, the field must understand how to control the rate of primordial follicle activation and support the follicle growth through development and maturation into a good quality egg. The follicular microenvironment changes across the lifespan and the growing oocyte is surrounded by a different microenvironment as it is localized in different compartments within the ovary over folliculogenesis. The human ovarian interstitial cells, scaffold proteins and the juxtracrine, paracrine and endocrine signals that influence folliculogenesis are just being realized with the increased data generated by mapping technologies. Recent research has utilized bioengineering tools to interrogate these follicular microenvironment components and better understand the components that are necessary and sufficient to sustain folliculogenesis and produce good quality eggs. However, there are several biological, scalability and regulatory hurdles to overcome in order to realize a bioprosthetic ovary, including the ability to isolate sufficient primordial follicles from their dense stroma while maintaining their quiescence and subsequent transplant longevity. This chapter reviews these components and encourages researchers to continue on these research quests to increase the foundational understanding of human folliculogenesis and develop near-future solutions for infertility on the way to developing the ideal bioprosthetic ovary.

Also flagged:type 2 diabetesmetabolic disorderinsulinglucosemetabolisminsulin resistance
Journal Article 2025-07-17 No Snippets Amine IM, Salsabil H, Fadil B, Adnane B, Khaoula E.
Show Full Abstract

Type 2 diabetes (T2D) is a complex metabolic disorder with rising global prevalence. This review examines the diverse roles of non-coding RNAs (ncRNAs) in T2D, focusing on their involvement in key biological processes such as insulin signaling, glucose metabolism, oxidative stress, and inflammation. We explore how ncRNAs interact with known T2D risk genes and contribute to epigenetic regulation associated with disease progression. Particular attention is given to the emerging potential of ncRNAs as biomarkers for early diagnosis and as targets for personalized therapeutic strategies. We also discuss current advances in modulating ncRNA expression, including findings from experimental models and clinical trials published between 1998 and 2025. Finally, the review considers how lifestyle factors and common comorbidities influence ncRNA expression, highlighting their wider implications in the context of T2D. Overall, the findings underscore the growing importance of ncRNAs in understanding, diagnosing, and treating T2D.

Also flagged:Infectionpeptidesimmune responseE. coli infectioncytoskeleton proteinsribosomal protein
Journal Article 2025-07-17 No Snippets Khan A, Ali S, Ullah W, Dawar F.
Show Full Abstract

No abstract available.

bioRxiv 2025-07-17 Preprint (No Snippets API) Chowdhury MMH, Quenum AJI, Rioux-Perreault C, Lucier J, Ilangumaran S, Piché A, Allard-Chamard H, Ramanathan S.
Show Full Abstract

Persistent symptoms following SARS-CoV-2 infection are the hallmark of post-COVID condition (PCC), also referred to as long COVID. However, our knowledge is limited on the underlying molecular mechanisms. In this study, we performed data-independent acquisition mass spectrometry plasma proteomics (DIA-MS) to identify molecular alterations associated with PCC. DIA-MS proteomic analysis revealed a few proteins linked to oxidative stress that had altered expression. Notably, PCC samples exhibited downregulation of the antioxidant protein peroxiredoxin 6 (PRDX6) and upregulation of oxidative stress-associated proteins particularly vanin-1 (VNN1) and paraoxonase-3 (PON3). Additionally, the PCC group showed significantly higher levels of six proteins (PCSK9, CST3, C1Q, CPB2, KNG1 GAPDH), which were linked to pathways involving glycolysis, complement and coagulation cascades, and inflammation. Oxidative stress analysis confirmed that PCC samples had significantly higher levels of DNA damage (8-OHdG) than the convalescent group, whereas antioxidant markers, such as reduced and oxidized glutathione (GSH and GSSG), were significantly lower in PCC samples than in uninfected controls. Our observations point towards ongoing oxidative and inflammatory processes in PCC and suggest potential targets for biomarker development and therapeutic intervention.

bioRxiv 2025-07-17 Preprint (No Snippets API) Akhter S, Miller JH.
Show Full Abstract

Bacteriocins offer a promising solution to antibiotic resistance, possessing the ability to target a wide range of bacteria with precision. Thus, there is an urgent need for a computational model to predict new bacteriocins and aid in drug development. This work centers on constructing predictive models with XGBoost machine learning algorithm, using physicochemical structural properties and sequence profiles of protein sequences. We employed correlation analyses, cross-validation, and hypergraph-based techniques to select features. Cross-validation feature evaluation (CVFE) partitions the dataset, selects features within each partition, and identifies common features, ensuring representativeness. On the contrary, hypergraph-based feature evaluation (HFE) focuses on minimizing hypergraph cut conductance, leveraging higher-order data relationships to precisely utilize information regarding feature and sample correlations. The XGBoost models were built using the selected features obtained from these two feature evaluation methods. Our HFE-based approach achieved 99.11% accuracy and an AUC of 0.9974 on the test data, overall outperforming the CVFE-based feature evaluation method and yielding results comparable to existing approaches. We also analyzed the feature contributions directly from the best model using SHapley Additive exPlanations (SHAP). Our web application, accessible at https://shiny.tricities.wsu.edu/bacteriocin-prediction/ , offers prediction results, probability scores, and SHAP plots using both cross-validation- and hypergraph-based methods, along with previously implemented approaches for feature selection.

Also flagged:GFAPautosomal dominant leukodystrophyglial fibrillar acidic proteinAlexander diseasebladder dysfunctionupper airway dysfunction
Journal Article 2025-07-16 No Snippets Gagliardi D, Wade C, Tucci A, Houlden H, Chataway J, Barkhof F, Lynch DS.
Show Full Abstract

<h4>Background</h4>Alexander disease is an autosomal dominant leukodystrophy caused by heterozygous pathogenic variants in the glial fibrillar acidic protein (GFAP) gene. Although increasingly recognised, there is evidence that Alexander disease, particularly later-onset disease, is significantly underdiagnosed and its true prevalence is unknown (the only population-based prevalence was estimated at one in 2.7 million). Using the extensive UK Biobank dataset, we analysed the frequency of pathogenic and likely pathogenic variants, <i>GFAP</i> variants, within the UK population and identified clinical and radiological phenotypes linked to these variants.<h4>Methods</h4>Pathogenic, likely pathogenic and <i>GFAP</i> variants of uncertain significance were identified in the UK Biobank whole-exome sequencing data (n=4 70 000). Demographic information, previous medical history-including symptoms associated with Alexander disease-collected from self-reported data and hospital records, family history and various MRI metrics were compared between variant carriers and controls.<h4>Results</h4>We identified 36 unique pathogenic and likely pathogenic <i>GFAP</i> variants in 106 carriers, yielding a carrier frequency of approximately 1 in 4435. Modelling based on the UK population estimated a prevalence of 6.8 per 100 000. Carriers of pathogenic and likely pathogenic <i>GFAP</i> variants had higher odds of bladder dysfunction (OR 3.17, p<0.0001), upper airway dysfunction (OR 7.82, p=0.004) and psychiatric conditions (OR 1.51, p=0.04). Additionally, carriers were more likely to report a paternal history of dementia (OR 2.79, p<0.0001). MRI data revealed significant atrophy in brainstem regions among variant carriers.<h4>Conclusion</h4>Pathogenic and likely pathogenic <i>GFAP</i> variants are more prevalent in the general population than previously expected and are associated with clinical and radiological characteristics of Alexander disease. This study indicates that Alexander disease may be under-reported, misdiagnosed, or exhibit reduced penetrance.

PRDX6
Also flagged:immune responseenvelopeblood circulationmicrovillireproductionplacentation
Journal Article 2025-07-16 ✓ 1 Snippet Li J, Campbell P, Meyer A, Reznick D.
In-Text Gene Mentions

…Cyp17a1, Edn2, Cyp24A1,Prdx6and Plb1 )…

Show Full Abstract

Placentas evolved nine times in the fish family Poeciliidae. Each time, the egg follicle is the maternal contribution to the placenta. In non-placental species, the follicle fully provisions the egg before fertilization. In placental species, provisioning continues throughout development, and the follicle becomes a more elaborate, well-vascularized organ. We generated transcriptomes for follicles from yolking eggs and developing embryos from two pairs of closely related placental and non-placental species that represent independent origins of placentation plus one non-placental outgroup. We identified genes expressed in eggs but not embryos of non-placental species that continue to be expressed during embryonic development in placental species. Their functions include the maternal transfer of nutrients and immunity. We then reconstructed the ancestral state of the non-placental common ancestor of each species pair and identified genes that were either upregulated or downregulated in developing embryos of placental species relative to non-placental species. These include clusters associated with lipid metabolism, immune response and tissue structure. The two placental lineages were convergent in the function of these genes, but few genes were in common between them. Thus, diverse gene regulatory changes converge on shared essential functions in the independent origins of a complex trait.

Also flagged:lipogenesisFatty acid synthaseFASNlipidmetabolismfatty acid
Journal Article 2025-07-16 No Snippets Song J, Lv Z, Guo Y.
Show Full Abstract

Chicken meat quality directly influences consumer acceptability and is crucial for the economic success of the poultry industry. Genetics and nutrition are key determinants of the meat quality traits in broilers. This review summarizes the research advances in this field, with a focus on the genetic and nutritional foundations that regulate intramuscular fat (IMF) deposition and meat quality in chickens over the past decade. The effects of embryonic nutrition, both maternal nutrition and in ovo feeding (IOF), on skeletal muscle development, the IMF content, and meat quality traits in broilers are also discussed. In genetics, single-cell RNA sequencing revealed that de novo lipogenesis predominantly occurs in myocytes, which is key to the formation of IMF in chicken muscle tissue. Fatty acid synthase (FASN) is the key enzyme involved in this process. This discovery has reshaped the traditional understanding of intramuscular lipid metabolism in poultry. Key genes, proteins, and pathways, such as FASN, FABP4, PPARG, C/EBPα, SLC27A1; LPL, APOA1, COL1A1; PPAR and ECM-receptor interactions signaling, have been identified to regulate IMF content and distribution by modulating fatty acid metabolism and adipogenesis. LncHLFF was innovatively found to promote ectopic IMF deposition in chickens via exosome-mediated mechanisms without affecting abdominal fat deposition. MiR-27b-3p and miR-128-3p were found to inhibit adipogenic differentiation by targeting PPARG, thereby affecting IMF formation. In nutrition, nutrigenomics research has shown that fructose enhances IMF deposition by activating ChREBP, providing new targets for nutritional interventions. Adjusting dietary components, including energy, protein, amino acids, fatty acids, and phytochemicals (e.g., rutin), has been shown to significantly improve meat quality in broilers. Maternal nutrition (e.g., intake of energy, amino acids, vitamins, and trace elements) and IOF (e.g., N-carbamylglutamate) have also been confirmed to significantly impact offspring meat quality, opening new avenues for improving embryonic nutrition. Based on these significant advancements, this review proposes strategies that integrate genetic and nutritional approaches. These strategies aim to modulate the differentiation fate of paraxial mesenchymal stem cells toward myogenic or adipogenic lineages and the interaction between muscle and adipose tissues. These insights would help to improve meat quality while ensuring the growth performance of broiler chickens.

SOX6
Also flagged:androgen receptorbindinggene expressionRunt-related transcription factor 2ArRunx2
Journal Article 2025-07-16 ✓ 1 Snippet Ghione CR, Schultz NG, Park S, Menke DB, Dean MD.
In-Text Gene Mentions

…– for exampleSox6, Sox9 , and…

Show Full Abstract

The baculum, a bone in the penis of many mammal species, shows an astonishing level of morphological divergence between species. Despite hundreds of years of interest, biologists have been unable to directly test its function. The goal of the current study is to uncover molecular details that could allow selective disruption of the baculum while allowing normal sexual differentiation and skeletal development. We compare patterns of androgen receptor binding and single cell gene expression in the developing penis, forelimbs and hindlimbs of mice. We identified chondrocytes in all three tissue types, but those from the developing penis show several unique features, including a population of chondrocytes that express both Runt-related transcription factor 2 (Runx2) and Androgen receptor (Ar). By combining a Runx2-Cre allele with a floxed Ar allele in mice, we selectively knocked out androgen signaling in late chondrocytes, resulting in a range of defects in baculum morphology. Males with the most disrupted bacula were unable to copulate, and their bacula appears to be disconnected from the corpus cavernosum muscle. Our study provides insights into the diversity of molecular mechanisms leading to bone and offers the first opportunity to directly test the function of the baculum.

CA10
Also flagged:ADnucleusAgingtranscription factorZFXZFY
Journal Article 2025-07-16 ✓ 1 Snippet Trivedi MR, Joshi AM, Shah J, Readhead BP, Wilson MA, Su Y, Reiman EM, Wu T, Wang Q.
In-Text Gene Mentions

…RPH3A, SVOP, andCA10, their fold changes…

Show Full Abstract

The utilization of artificial intelligence in studying the dysregulation of gene expression in Alzheimer's disease (AD) affected brain tissues remains underexplored, particularly in delineating common and specific transcriptomic signatures across different brain regions implicated in AD-related cellular and molecular processes, which could help illuminate novel disease biology for biomarker and target discovery. Herein we developed a deep learning framework, which consisted of multi-layer perceptron (MLP) models to classify neuropathologically confirmed AD versus controls, using bulk tissue RNA-seq data from the RNAseq Harmonization Study of the Accelerating Medicines Project for Alzheimer's Disease (AMP-AD) consortium. The models were trained based on data from three distinct brain regions, including dorsolateral prefrontal cortex (DLPFC), posterior cingulate cortex (PCC), and head of the caudate nucleus (HCN), obtained from the Religious Orders Study/Memory and Aging Project (ROSMAP). Subsequently, we inferred a disease progression trajectory for each brain region by applying unsupervised dimensionality transformation to the distribution of the subjects' expression profiles. To interpret the MLP models, we employed an interpretable method for deep neural network models, obtaining SHapley Additive exPlanations (SHAP) values and identified the most significantly AD-implicated genes for gene co-expression network analysis. Our models demonstrated robust performance in classification and prediction across two other external datasets from the Mayo RNA-seq (MAYO) cohort and the Mount Sinai Brain Bank (MSBB) cohort of AMP-AD. By interpreting the models both mechanistically and biologically, our study elucidated subtle molecular alterations in various brain regions, uncovering shared transcriptomic signatures activated in microglia and sex-specific modules in neurons relevant to AD. Notably, we identified, for the first time, a sex-linked transcription factor pair (ZFX/ZFY) associated with more pronounced neuronal loss in AD females, shedding light on a novel mechanism for sex dimorphism in AD. This study lays the groundwork for leveraging artificial intelligence methodologies to investigate AD at the molecular level, which is not readily achievable from conventional analysis approaches such as differential gene expression (DGE) analysis. The transcription factor implicated in sex difference also underpins a new molecular mechanistic basis of women's greater neurodegeneration in AD warranting further study.

TAOK3
Also flagged:MNAT1TDP-43neurodegenerative diseasesamyotrophic lateral sclerosisALSfrontotemporal degeneration
Journal Article 2025-07-16 ✓ 1 Snippet Tanaka Y, Sunamura N, Kajitani R, Ikeguchi M, Kunimoto R.
In-Text Gene Mentions

…, CAMK2B ,TAOK3, PRKAR2A ,…

Show Full Abstract

Understanding the role of transcript isoforms is essential for elucidating disease mechanisms. TDP-43 regulates RNA splicing, and its dysfunction in neurons is a hallmark of some neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal degeneration (FTD). While an association between TDP-43-dependent cryptic exons and disease pathogenesis has been suggested, an approach to investigate how cryptic exons disrupt transcript isoforms has yet to be established. In this study, we developed IsoRefiner, a novel method for identifying full-length transcript structures using long-read RNA-seq. Leveraging this method, we performed long-read RNA-seq, guided by prior short-read RNA-seq, to comprehensively determine the full-length structures of aberrant transcripts due to TDP-43 dysregulation in human iPSC-derived motor neurons. We identified a novel TDP-43-dependent cryptic exon in the MNAT1 gene, along with its full-length transcript structure. Furthermore, we confirmed the presence of the MNAT1 cryptic exon in patients with ALS and FTD. Our findings deepen understanding of TDP-43 proteinopathy and advance splicing research.

MMS22L
Also flagged:omega-3 fatty acidendocannabinoidscytokineneurogenesiseicosapentaenoyldocosahexaenoyl ethanolamide
Journal Article 2025-07-16 ✓ 1 Snippet Mandal G, Alboni S, Cattane N, Marizzoni M, Saleri S, Arslanovski N, Mariani N, Kirkpatrick M, Cattaneo A, Pariante CM, Borsini A.
In-Text Gene Mentions

…repair gene (MMS22L) , which is…

Show Full Abstract

The dietary ligands, omega-3 fatty acid endocannabinoids (eCBs) eicosapentaenoyl ethanolamide (EPEA) and docosahexaenoyl ethanolamide (DHEA), and short-chain fatty acids (SCFAs) acetate, propionate and butyrate, have anti-inflammatory and antidepressant properties. However, the molecular mechanisms underlying their action in the human brain remain elusive. Here, we treated human hippocampal neurons (HPC0A07/03 C) with eCBs (EPEA (300 pM) or DHEA (700 pM)), or SCFAs (acetate (200 uM), propionate (30 uM), butyrate (20 uM)), followed by interleukin (IL)1β (10,000 pg/ml) or IL6 (50 pg/ml). We found that treatment with either eCBs or SCFAs prevented IL1β- and IL6-induced reduction in neurogenesis and increase in apoptosis. These effects were mediated by IL1β-induced production of IL6, interferon-gamma (IFNγ) and tumour necrosis factor-alpha (TNFα), and by IL6-induced IL1β, IL8 and IL13, all of which were prevented by treatment with eCBs. In contrast, IL1β-induced production of IL6, IL12 and fractalkine (CX3CL1), and IL6-induced production of CX3CL1, were prevented by SCFAs. Treatment with IL1β and IL6 also increased the production of candidate kynurenine pathway metabolites, such as kynurenine (KYN) and nicotinic acid (NICA), which again were prevented by eCBs and SCFAs. We then conducted mRNA sequencing analysis to investigate cellular genes and signalling pathways relevant for the neuro-inflammatory changes previously observed, and putatively prevented by eCB and SCFA treatment. We found that IL1β decreased the expression of the neuroplasticity gene, FRY microtubule binding gene (FRY), and increased the expression of the neuroinflammation gene, U3 small nucleolar ribonucleoprotein homolog C subunit processome component (UTP14C), and both these effects were prevented by either acetate or propionate. Similarly, the expression of the proinflammatory gene, ADAM metallopeptidase with thrombospondin type 1 motif 1 (ADAMTS1), was increased by IL6, an effect that was prevented by either EPEA or acetate. Altogether, we identify novel anti-inflammatory and neurogenic mechanisms mediating the effect of eCBs and SCFAs on human hippocampal neurogenesis, which can be significant as potential future treatment candidates in the context of neuropsychiatric disorders.

SLC2A14
Also flagged:Malignant breast tumoursfemale tumourbreast cancerhormone-receptoroestrogen receptorER
Journal Article 2025-07-16 ✓ 1 Snippet Liu Y, Chen J, Ma L, Zhao S, Hui X, Xiong W, Cheng S, Zhang Y.
In-Text Gene Mentions

…2 member 14 (SLC2A14), and dual oxidase…

Show Full Abstract

Tamoxifen is a critical drug for the treatment of oestrogen receptor (ER)-positive breast cancer (BC), which represents the majority of BC subtypes. However, many BC tumours that initially respond eventually develop acquired Tamoxifen resistance. Bioinformatics analysis was conducted on genes affected by Tamoxifen and upregulated in Tamoxifen-resistant cells to identify the biological processes associated with Tamoxifen resistance. Metabolomics analysis was conducted to identify the metabolites that were altered in BC with tamoxifen resistance. Resistance to Tamoxifen was evaluated by cell viability, proliferation, invasion, and colony formation in vitro, and by tumour growth in vivo. Metabolomic profiling and the detection of relevant enzymes and metabolites corroborated the metabolic reprogramming towards glycolysis in tamoxifen - resistant BC. The produced lactic acid induced the lactylation of ZMIZ1. This post-translational modification at K843 (but not K537) increased protein stability by suppressing SUMOylation and ubiquitination. The elevated total level of ZMIZ1 increased the enrichment of ZMIZ1 binding to Nanog, resulting in increased transcriptional activity of Nanog, including in OCT4 and NPC2 genes. Therefore, it leads to increased stemness and cholesterol accumulation in Tamoxifen-resistant BC. Knockdown of ZMIZ1 impaired Tamoxifen resistance, but this effect was reversed by Nanog overexpression. In summary, this study identified an important mechanism underlying Tamoxifen resistance and revealed a potential association of glucose glycolysis with cholesterol metabolism through the ZMIZ1/Nanog/NPC2 axis.

Also flagged:Nociceptorrheumatoid arthritisprostaglandinsbone morphogenetic proteinsephrinsynaptogenesis
Journal Article 2025-07-16 No Snippets O'Brien JA, Lesnak JB, Price TJ.
Show Full Abstract

<h4>Purpose of review</h4>Pain is one of the most debilitating sequelae of rheumatoid arthritis. Established and emerging therapies offer effective disease control for many patients, though they often have underwhelming efficacy for pain relief. The uncoupling of pain intensity from disease activity and inflammation presents an ongoing challenge in both our understanding of the pathophysiology and our ability to treat joint pain. The generation of high-parameter, unbiased -omic data sets generated from patient-derived tissues is changing how we think about rheumatoid arthritis pain. In this review, we discuss the peripheral drivers of pain in rheumatoid arthritis-affected joints and their innervating primary afferents. We evaluate how human molecular immunology and neuroscience approaches are helping us unravel the heterogeneity of pain in rheumatoid arthritis and propose future directions to clarify how pain is maintained in the absence of inflammation.<h4>Recent findings</h4>Synovial fibroblasts have emerged as key pronociceptive drivers within the rheumatic joint. Further to the classical proinflammatory mediators known to drive pain, such as cytokines and prostaglandins, bone morphogenetic proteins, ephrin signaling, and netrins appear to be upregulated in both rheumatoid arthritis-affected synovium and the innervating sensory neurons. Resulting adaptations to innervating primary afferents such as synaptogenesis and neurite outgrowth may occur in a sensory neuron subtype-specific manner causing pain that is disproportionate to inflammation. Nociceptor sprouting in the joint may explain why pain tends to persist despite adequate disease control. Future mechanistic work exploring the conditions under which these nociceptors sprout into the joint will provide new therapeutic avenues for ensuring that pain resolves alongside the inflammation associated with rheumatoid arthritis.

Also flagged:IGF1RBRD4bindingtranscription factorsphosphorylationamino acid
Journal Article 2025-07-16 No Snippets Chen J, Jakovlić I, Sablin M, Xia S, Xu Z, Guo Y, Kuang R, Zhong J, Jia Y, Tran NTT, Yang H, Ma H, Šprem N, Han J, Liu D, Zhao Y, Zhao S.
Show Full Abstract

<h4>Background</h4>Domestic piglets often die of hypothermia, whereas Eurasian wild boar (Sus scrofa) thrives from tropical lowlands to subarctic forests. The thermoregulation of wild boar offers a natural experiment to uncover the genetic basis of cold adaptation.<h4>Methods</h4>We conducted whole-genome resequencing on wild populations from cold regions (northern and northeastern Asia, with six samples) and warm regions (southeastern Asia and southern China, with five samples). By integrating publicly available data, we compiled a core dataset of 48 wild boar samples and an extended dataset of 445 wild boar and domestic pig samples to identify candidate genes related to cold adaptation. To investigate the functional effects of two candidate variants under positive selection, we performed CUT&Tag and RNA-seq using the northeastern Asian Min pig breed as a proxy for a cold-adapted population.<h4>Results</h4>Our study identified candidate genes associated with cold adaptation, which are significantly enriched in thermogenesis, fat cell development, and adipose tissue pathways. We discovered two enhancer variants under positive selection: an intronic variant of IGF1R (rs341219502) and an exonic variant of BRD4 (rs327139795). These variants exhibited the highest differentiation between populations of wild boar and domestic pigs in cold and warm region populations. Furthermore, these rare variants were absent in outgroup species and warm-region wild boars but were nearly fixed in cold-region populations. The H3K27ac CUT&Tag profiling revealed that the rs341219502 variant of IGF1R is linked to the gain of novel binding sites for three transcription factors involving regulatory changes in enhancer function. In contrast, the rs327139795 variant of BRD4 may result in the loss of a phosphorylation site due to an alteration in the amino acid sequence.<h4>Conclusion</h4>Our study identified candidate genes for cold adaptation in wild boar. The variant rs341219502 in the IGF1R enhancer and the variant rs327139795 in the BRD4 exon, both of which were under positive selection and nearly fixed in populations from cold regions, suggest they may have originated de novo in these populations. Further analysis indicated that rs341219502 could influence enhancer function, while rs327139795 may affect amino acid alterations. Overall, our study highlights the adaptive evolution of genomic molecules that contribute to the remarkable environmental flexibility of wild boar.

SOX6
Also flagged:limb developmentnucleotidebindingtranscription factorsreproductionWnt
Journal Article 2025-07-16 ✓ 1 Snippet Zhang Z, Yu Z, Chong Y, Liu Y, Liu J, Ren W, Xu S, Yang G.
In-Text Gene Mentions

…confirmed upregulation ofSox6, Tbx1 ,…

Show Full Abstract

<h4>Background</h4>Limb morphology is particularly important for animals to inhabit different environments. Limb modifications (e.g., flipper-like forelimbs and hindlimb regression) are among the most critical secondary aquatic adaptation mechanisms enabling cetaceans to fully adapt to an aquatic environment. Exploring the molecular mechanisms underlying limb evolution in cetaceans has attracted considerable attention from evolutionary biologists.<h4>Results</h4>In the present study, conserved non-coding elements (CNEs) closely associated with limb development, which exhibited lineage-specific sequence divergence (nucleotide mutations and indels) in cetaceans, were identified using comparative genomics. These sequence divergences might have led to the loss of binding motifs for transcription factors involved in limb development and significant alterations in autoregulatory activity. A transgenic mouse was constructed to carry a cetacean-specific enhancer (i.e., hs1586), which exhibited a significant phenotypic difference in forelimb buds at embryonic day (E)10.5, supported by transcriptomic and epigenomic evidence. However, the phenotypic recovery after E11.5 suggested that enhancer redundancy in the mouse genome may have compensated for the effects caused by the incorporation of cetacean hs1586. This further suggests that the complex phenotypic changes of limbs in cetaceans are likely not driven by a single CNE but rather involve multiple CNEs and/or genes.<h4>Conclusions</h4>In summary, our study supports the functional role of CNE sequence divergence and the complex mechanisms underlying limb morphology changes in cetaceans.

HTT
Also flagged:Mitochondriamitochondrialmembranemitochondria-Transmitophagydeath
Journal Article 2025-07-16 ✓ 5 Snippets López-Molina L, Pereda-Velarde A, di Franco N, Aerts I, Sebastià E, Valls-Roca L, Guitart-Mampel M, Garrabou G, Gines S.
In-Text Gene Mentions

…encoding the Huntingtin (Htt) protein.…

…that huntingtin protein (Htt) associates with mitochondria…

…To determine whetherHttwas also present…

…which specifically recognizeHttprotein (Fig. 6…

…with MAB2166 revealedHttlocalization on some…

Show Full Abstract

<h4>Background</h4>Deficits in mitochondrial bioenergetics and dynamics are strongly implicated in the selective vulnerability of striatal neurons in Huntington´s disease. Beyond these neuron-intrinsic factor, increasing evidence suggest that non-neuronal mechanisms, particularly astrocytic dysfunction involving disrupted homeostasis and metabolic support also contribute to disease progression. These findings underscore the critical role of metabolic crosstalk between neurons and astrocytes in maintaining striatal integrity. However, it remains unclear whether this impaired communication affects the transfer of mitochondria from astrocytes to striatal neurons, a potential metabolic support mechanism that may be compromised in Huntington´s Disease.<h4>Methods</h4>Primary striatal astrocytes were obtained from wild-type and R6/1 mice to investigate mitochondrial dynamics. Expression levels of key mitochondrial fusion and fission proteins were quantified by Western blotting and RT-PCR. Mitochondria morphology, oxidative stress and membrane potential were assessed using confocal microscopy following staining with mitochondria-specific dyes. Mitochondrial respiration was measured using the Oxygraph-2k respirometer system (Oroboros Instruments). Transmitophagy was evaluated by confocal imaging after labeling astrocytic mitochondria with Mitotracker dyes. To assess the functional impact of mitochondrial transfer on neurons, Sholl analysis, neuronal death and oxidative stress levels were quantified using specific fluorogenic probes.<h4>Results</h4>Striatal astrocytes from HD mice exhibited a significant increase in mitochondrial fission, and mitochondrial oxidative stress, mirroring alterations previously reported in striatal neurons. Analysis of mitochondrial oxygen consumption rate (OCR) revealed elevated respiration activity and enhanced ATP-linked respiration, indicative of a hypermetabolic state. Concurrently, increased lactate production suggested a shift toward dysregulated astrocytic energy metabolism. These mitochondrial alterations were functionally detrimental: astrocytic mitochondria derived from HD mice when taken up by striatal neurons via transmitophagy, led to reduced neuronal branching and disrupted oxidative homeostasis.<h4>Conclusions</h4>Our findings demonstrate that striatal astrocytes from HD mice exhibit a hypermetabolic phenotype, characterized by increased mitochondrial respiration, disrupted mitochondrial dynamics, and elevated mitochondrial oxidative stress. Importantly, we identify a novel mechanism of astrocyte-neuron interaction involving the transfer of dysfunctional mitochondria from astrocytes to neurons. The uptake of these compromised mitochondria by striatal neurons results in reduced neuronal branching and increased reactive oxygen species (ROS) production. Collectively, these results highlight the pathological relevance of impaired astrocyte-to-neuron mitochondrial transfer and emphasize the contributory role of astrocytic dysfunction in Huntington´s disease progression.

SERPINC1
Also flagged:coagulationtranexamic acidheparinrenal impairmentfibrinolysisprotamine
Journal Article 2025-07-16 ✓ 1 Snippet Ihtasham A, Waqas S, Hamza M, Imran H, Chaudhary SS, Qayyum T, Batool S, Devi N, Muzammil MA, Oduoye MO.
In-Text Gene Mentions

…works by increasingATIIIactivity, thus improving…

Show Full Abstract

The challenging management of coagulation in cardiothoracic surgery requires a multifaceted approach. The use of pharmacological interventions such as tranexamic acid, heparin, and aprotinin minimizes bleeding but increases the associated risks of renal impairment and seizures. However, aprotinin has been replaced by tranexamic acid for safety reasons. Supplementing nonpharmacological techniques, such as hemostatic agents and mechanical devices, with these pharmacological strategies can enhance surgical coagulation management. During cardiopulmonary bypass, factors such as hypothermia, acidosis, and fibrinolysis worsen coagulation disturbances, and protamine sulfate is administered for heparin reversal during the procedure. Point-of-care devices, including thromboelastography (TEG®) and rotational thromboelastometry (ROTEM®), provide real-time monitoring of coagulation, hence guiding clinical interventions effectively, and have demonstrated a reduction in postoperative bleeding. Nonetheless, tailored approaches are critical, especially in patients with preexisting coagulation disorders as well as in pediatric surgery. Pharmacogenomics also plays a role in selecting appropriate dosages and minimizing adverse outcomes. Recent advancements in this context include novel hemostatic agents, prothrombin complex concentrates, and direct oral anticoagulants. Future research should not only explore the combined use of pharmacological and nonpharmacological strategies but also evaluate the long-term effects and cost-effectiveness of integrated approaches during cardiothoracic surgery, particularly in high-risk populations.

SUDS3
Also flagged:Histone deacetylase complex 1PIF4Photomorphogenesisphytochrome BphyBHDAC
Journal Article 2025-07-16 ✓ 1 Snippet Fang W, Baldini A, Locci G, Battaglia F, Capó JD, Radio S, Aiese Cigliano R, Conti L, Perrella G.
In-Text Gene Mentions

…member of thehistone deacetylation complexdeacetylation complex (HDAC)…

Show Full Abstract

Photomorphogenesis is a transitional response occurring when seedlings are exposed to light. Upon red-light exposure, this process depends on the nuclear translocation of phytochrome B (phyB) and its interaction with downstream components. Histone deacetylase complex 1 (HDC1) is a member of the histone deacetylation complex (HDAC) that regulates the sensitivity of Arabidopsis seedlings to environmental cues. Here, we show that HDC1 is a positive regulator of hypocotyl elongation when plants are exposed to red light. By employing protein interaction assays and mutant combinations, we demonstrate that HDC1 interacts with PIF4 and regulates its abundance. Chromatin immunoprecipitation sequencing (ChIP-seq) reveals that HDC1 modulates the expression of growth-promoting genes by deacetylating promoter regions and that HDC1 is required for PIF4 association over DNA targets. Altogether, our findings explore the connection between red-light signaling and chromatin states and assign another function to a member of the HDAC complex in plants.

SOX6
Also flagged:chromatingene expressiontranscription factorTFbindingPou2f2
Journal Article 2025-07-16 ✓ 1 Snippet Zhang I, Boezio GLM, Cornwall-Scoones J, Frith T, Finnie E, Luo J, Jiang M, Howell M, Lovell-Badge R, Sagner A, Briscoe J, Delás MJ.
In-Text Gene Mentions

…(e.g., Rfx4 andSox6) were downregulated…

Show Full Abstract

The vertebrate neural tube generates a large diversity of molecularly and functionally distinct neurons and glia from a small progenitor pool. While the role of spatial patterning in organizing cell fate specification has been extensively studied, temporal patterning, which controls the timing of cell type generation, is equally important. Here, we define a global temporal program operating in progenitors throughout the mouse nervous systems that governs cell fate choices by controlling chromatin accessibility. Perturbation of this cis-regulatory program affects sequential cell fate transitions in neural progenitors and the identity of their progeny. The temporal program operates in parallel to spatial patterning, ensuring the timely availability of regulatory elements for spatial determinants to direct cell-type-specific gene expression. These findings identify a chronotopic spatiotemporal integration strategy in which a global temporal chromatin program determines the output of a spatial gene regulatory network resulting in the ordered allocation of cell type identity.

HFE
Also flagged:agingredox homeostasisthiolmetabolismironglioblastoma
Journal Article 2025-07-16 ✓ 3 Snippets Godwin M, Hine C.
In-Text Gene Mentions

…sickle cell anemia,hemochromatosis, and frequent blood…

…as shown inhemochromatosis[ 240 ,…

…in patients withhemochromatosisand thalassemia […

Show Full Abstract

Global growth in aged population demographics is a testament to medical and societal innovations over the past 100 years. However, with advanced age comes declines in various organs and tissues, thus limiting quality of life in one's later years. There are numerous hypotheses for what the driving and causative factors are for biological aging, with each proposing molecular targets and their therapeutic strategies. One such hypothesis is that dysfunctions in cellular and systemic redox homeostasis are to blame, in that aging-related increases in oxidative stress and diminished thiol-mediated protections and signaling activity drive macromolecular damage leading to tissue failure, particularly in the brain. Addressing redox dysfunction has been somewhat a challenge clinically, as antioxidant supplementation has not shown to be universally effective at slowing the aging process. Thus, geroscience interventions that can bolster our endogenous redox machinery may be more effective. In this review, we highlight hydrogen sulfide (H<sub>2</sub>S) and its associated metabolism and gasotransmitter signaling as potent redox mechanisms that can be leveraged via macro- and/or micro-nutrient interventions. Specifically, dietary restriction (DR) and iron status greatly impact the enzymatic and non-enzymatic production, metabolism, and thiol modifications of H<sub>2</sub>S. As both DR and iron status can have profound impacts on redox homeostasis and aging in the brain, we discuss how all these factors are intertwined in glioblastoma (GBM) and neurodegeneration, two of the most significant aging-related disorders of the brain that limit both lifespan and healthspan.

PRDX6
Also flagged:peroxidaseembryogenesisoxygenN-acetylcysteinemyeloid cell developmentPeroxiredoxin6
Journal Article 2025-07-16 ✓ 5 Snippets Kim M, Lee HK, Lee H, Lee HS.
In-Text Gene Mentions

…developmental role ofPrdx6remains poorly understood.…

…numbers, suggesting thatPrdx6supports primitive myeloid…

…novel role ofPrdx6in ROS-dependent proliferation…

Prdx6regulates in vivo…

…ABSTRACT Peroxiredoxin6 (Prdx6) is a bifunctional…

Show Full Abstract

Peroxiredoxin6 (Prdx6) is a bifunctional antioxidant enzyme with both peroxidase and phospholipase A₂ activities. Although its molecular roles are well established, the developmental role of Prdx6 remains poorly understood. To address this gap in the literature, this study aimed to examine the <i>in vivo</i> function of Prdx6 in primitive myelopoiesis using <i>Xenopus laevis</i> embryos. We found that <i>prdx6</i> is specifically expressed in myeloid progenitors originating from the anterior ventral blood island during early embryogenesis. Knockdown of <i>prdx6</i> significantly reduced the number of myeloid cells, without affecting their migration ability. Embryos depleted of <i>prdx6</i> exhibited elevated levels of reactive oxygen species (ROS) and decreased cellular proliferation. Co-injection of morpholino (MO)-resistant <i>prdx6</i> mRNA or treatment with N-acetylcysteine (NAC) successfully restored both ROS levels and myeloid cell numbers, suggesting that Prdx6 supports primitive myeloid cell development by maintaining redox homeostasis. These findings reveal a novel role of Prdx6 in ROS-dependent proliferation of myeloid progenitors during early vertebrate development.

Also flagged:mitochondriamitochondrialcytosolchaperonesmembranetranslocase
Journal Article 2025-07-16 No Snippets Romanelli S, Trempe JF.
Show Full Abstract

Mitochondrial quality control has emerged as an important area of research over the past decade, with more than 2000 publications exploring the molecular pathways that regulate it. Mitochondria are essential for energy production and various cellular functions but are highly susceptible to damage from stressors such as protein misfolding, reactive oxygen species, and chemicals that disrupt the electron transport chain. If left unresolved, mitochondrial dysfunction can lead to health complications, including neurodegenerative disorders, cardiovascular diseases, and cancer. To maintain cellular health, cells evolved quality control pathways to remove damaged mitochondrial components. This review focuses on three key quality control responses: the PTEN-induced kinase 1-Parkin pathway, the DELE1-HRI pathway, and the mitochondrial unfolded protein response. While these pathways have distinct functions, there is ongoing debate about how they overlap and which responds first in different contexts. In this review, we discuss the physiological and structural mechanisms behind each pathway, explore how they interconnect, and highlight their differences and relevance to disease. By summarizing this information in a single review, we aim to enhance the molecular understanding of mitochondrial quality control, which can help highlight avenues for novel therapeutics for diseases associated to dysfunctional mitochondria.

Also flagged:peroxisomeendoplasmic reticulumVery-long-chain fatty acidsZinc oxidelipidmetabolism
Journal Article 2025-07-16 No Snippets Zhong J, Liu X, Wang J, Liu H, Liu G, Wen X, Wu K.
Show Full Abstract

Very-long-chain fatty acids (VLCFAs) are vital for growth, development, and overall health. Zinc oxide nanoparticles (ZnO NPs), recognized for their high bioavailability and wide use in medicine and nutrition, have an unclear impact on lipid metabolism. This study explores how ZnO NPs impact VLCFA metabolism using yellow catfish (Pelteobagrus fulvidraco) as a model organism. In vivo, 240 yellow catfish were divided into a control group and a group fed 10 mg/kg ZnO NPs diet for 10 weeks. Administration of ZnO NPs significantly increased hepatic VLCFA content, accompanied by elevated triglyceride (TG) and total cholesterol (T-CHO) levels. Additionally, ZnO NPs reduced peroxisomal β-oxidation and peroxisome-ER (Po-ER) contacts. In vitro studies with yellow catfish hepatocytes confirmed these findings and explored the underlying mechanisms. ZnO NPs reduced Po-ER attachment and significantly decreased peroxisomal β-oxidation levels. ZnO NPs markedly decreased the expression and localization of ACBD5, a key protein involved in Po-ER interactions and VLCFA degradation. Overexpression of ACBD5 counteracted these effects, whereas knockdown mimicked them. Further experiments revealed that FOXO3 directly regulates ACBD5 by binding to its promoter. ZnO NPs increased the acetylation level of hepatocytes, inhibited the nuclear entry of FOXO3, and reduced the protein level of SIRT1. SIRT1 directly regulates FOXO3 deacetylation at lysine 243. Overall, ZnO NPs disrupt lipid homeostasis by downregulating ACBD5 via the SIRT1/FOXO3 axis, impairing peroxisomal function and Po-ER contacts. This study highlights the significance of the SIRT1 - FOXO3 - ACBD5 axis in managing VLCFA-related metabolic disorders.

Also flagged:Raf-kinase inhibitor proteinRKIPcolon cancercell homeostasiscancerscolorectal cancer
Journal Article 2025-07-16 No Snippets Kumari S, Peela S, Bramhachari PV, Mallikarjuna K, Nagaraju GP, Srilatha M.
Show Full Abstract

Raf-kinase inhibitor protein (RKIP) plays a significant role in maintaining cell homeostasis, and its downregulation is a hallmark of various cancers, including colorectal cancer (CRC). It modulates several signals, including MAPK (Raf/MEK/ERK), NF-κB, STAT3, cell cycle, and GPCR signaling by modulating phosphorylation state. It's binding to Raf-1 inhibits phosphorylation and makes the signaling molecules inactive. In the case of NF-κB, which plays a central role in drug resistance, RKIP interacts with IκBα and inhibits IKKα, IKKβ, and NIK by preventing their phosphorylation, thereby maintaining NF-κB in an inactive state. A reduction in the expression level of RKIP increases the metastasis and promotes the signaling associated with cancer progression. This review examines the role of RKIP in the aggressiveness and metastasis of CRC. Several signal pathways influenced by changes in the expression level of RKIP are discussed in detail. Strategies like the use of inhibitors, understanding the role of miRNA, immunotherapy, and combined therapies have been discussed in detail, along with the clinical implications of RKIP in CRC.

Also flagged:Alcoholneurodevelopmental disabilitybrain developmentfetal anemiametabolism-
Journal Article 2025-07-16 No Snippets Smith SM.
Show Full Abstract

<h4>Purpose</h4>Prenatal alcohol exposure (PAE) is a leading cause of persistent neurodevelopmental disability, with additional adverse consequences to the offspring's growth, metabolism, cardiovascular health, and immunity, among others. Alcohol disrupts offspring development through myriad mechanisms, many of which involve direct interactions between alcohol and the embryo and fetus (i.e., the conceptus). This limited narrative review instead focuses on mechanisms that are exogenous to the fetus. Many of these are relatively unexplored and are also mechanistically interrelated. Thus, they represent novel opportunities for the design of interventions that ameliorate alcohol-related pathologies.<h4>Search methods</h4>Literature from 2020 to October 2024 was searched using the terms "fetal alcohol spectrum disorder"[MeSH] OR "fetal alcohol"[Ti/Ab] with the filter "review." These reviews were inspected to extract nonfetal mechanisms of alcohol. Literature from 2000 to October 2024 was then searched in PubMed, Embase, and Google Scholar for seven mechanisms, using the search terms "fetal alcohol spectrum disorder OR fetal alcohol" AND one of the following: "placenta," "paternal," "metabolism OR insulin OR amino acid," "inflammation OR neuroinflammation OR cytokine," "epigenetic," "iron OR iron deficiency OR anemia," "microbiome." Only primary research articles, both clinical and preclinical, were included.<h4>Search results</h4>The literature scan identified seven mechanisms for which targeted literature searches were conducted. These searches yielded relevant studies that explored mechanisms involving the microbiome (<i>n</i> = 5 studies), inflammation (<i>n</i> = 72 studies), epigenetics (<i>n</i> = 30 studies), paternal alcohol exposure (<i>n</i> = 34 studies), placenta (<i>n</i> = 53 studies), metabolism (<i>n</i> = 37 studies), and functional iron deficiency (<i>n</i> = 23 studies).<h4>Discussion and conclusions</h4>Exogenous mechanisms of alcohol's teratogenicity are intertwined. Alcohol remodels the maternal enteric microbiome, with potential consequences to fetal immune function, nutrient availability, and brain development. Microbial endotoxins may further magnify alcohol's proinflammatory actions. This inflammation might also drive a fetal anemia associated with PAE. Alcohol alters maternal and fetal metabolism and could limit fetal nutrient availability. This altered metabolism could also reprogram placental and fetal epigenetics, as could paternal exposure to alcohol. Both epigenetic effects and inflammation can impair placental function and modulate the placenta-brain axis that modulates brain development. The review discusses limitations in the current understanding of these mechanisms and highlights future research avenues that would provide clarity and inform future interventions.

SERPINC1
Also flagged:Endothelin B ReceptorglycocalyxmechanotransductionheparansulfateEndothelin-1
Journal Article 2025-07-16 ✓ 2 Snippets Holm C, Nguyen SN, Mensah SA.
In-Text Gene Mentions

…with 15 mU/mLheparinase-IIIduring SS exposure.…

…is degraded byheparinase-III(Hep-III), an HS…

Show Full Abstract

The endothelial glycocalyx (GCX) plays a crucial role in vascular health and integrity and influences many biochemical activities through mechanotransduction, in which heparan sulfate (HS) plays a major role. Endothelin-1 (ET-1) is a potent vasoregulator that binds to the endothelin B receptor (ETB) on endothelial cells (ECs), stimulating vasodilation, and to the endothelin A receptor on smooth muscle cells, stimulating vasoconstriction. While the shear stress (SS) dependence of ET-1 and HS is well documented, there is limited research documenting the SS dependence of the ETB. Understanding the SS dependence of the ETB is crucial for clarifying the role of hemodynamic forces in the endothelin system. We hypothesize that GCX HS regulates the expression of the ETB on the EC surface in an SS-dependent manner. Human lung microvascular ECs were exposed to SS in a parallel-plate flow chamber for 12 h. Damage to the GCX was simulated by treatment with 15 mU/mL heparinase-III during SS exposure. Immunostaining and qPCR were used to evaluate changes in ET-1, ETB, and HS expression. Results indicate that ETB expression is SS sensitive, with at least a 1.3-fold increase in ETB protein expression and a 0.6 to 0.4-fold-change decrease in ETB mRNA expression under SS. This discrepancy suggests post-translational regulation. In some cases, enzymatic degradation of HS attenuated the SS-induced increase in ETB protein, reducing the fold-change difference to 1.1 relative to static controls. This implies that ETB expression may be partially dependent on HS-mediated mechanotransduction, though inconclusively. Furthermore, ET-1 mRNA levels were elevated two-fold under SS without a corresponding rise in ET-1 protein expression or significant impact from HS degradation, implying that post-translational regulation of ET-1 occurs independently of HS.

TRIM38
Also flagged:Tripartite Motif ProteinsUrological Cancerstripartite motif (TRIM) proteinskidney cancersbladder cancersprostate cancers
Journal Article 2025-07-16 ✓ 1 Snippet Yamada Y, Kimura N, Maki K, Hakozaki Y, Urabe F, Kimura S, Fujimura T, Inoue S, Kume H.
In-Text Gene Mentions

…tumor-suppressive: TRIM19 andTRIM38).…

Show Full Abstract

We aimed to investigate the roles of tripartite motif (TRIM) proteins in urological cancers. <b>Methods</b>: A systematic review was conducted to investigate the oncological role of tripartite motif proteins in urological cancers. <b>Results</b>: A total of 84 articles were identified for the final analysis (26 articles on kidney cancers, 19 on bladder cancers, 37 on prostate cancers, and 1 on testicular cancers). In total, 27 TRIM family proteins were involved in kidney cancer, of which 9 were associated with tumor-promoting findings (TRIM24, TRIM27, TRIM37, TRIM44, TRIM46, TRIM47, TRIM59, TRIM63, and TRIM65) and of which 9 TRIM proteins were tumor-suppressive (TRIM2, TRIM7, TRIM8, TRIM13, TRIM21, TRIM26, TRIM28, TRIM33, and TRIM58). Fourteen TRIM family proteins were associated with bladder cancer (tumor-promoting: TRIM9, TRIM25, TRIM26, TRIM28, TRIM29, TRIM59, TRIM65, and TRIM66; tumor-suppressive: TRIM19 and TRIM38). Ten TRIM family proteins were associated with prostate cancer (tumor-promoting: TRIM11, TRIM24, TRIM28, TRIM33, TRIM44, TRIM59, TRIM63, TRIM66, and TRIM68; tumor-suppressive: TRIM32 and TRIM36). Twenty-eight TRIM family proteins were identified to be associated with prostate cancer (tumor-promoting: TRIM11, TRIM24, TRIM28, TRIM33, TRIM44, TRIM59, TRIM63, TRIM66, and TRIM68; tumor-suppressive: TRIM32 and TRIM36). TRIM proteins regulate urological cancers by ubiquitination or modulation of oncologic pathways. <b>Conclusions</b>: This review identifies TRIM proteins that are involved in urological cancers. Some of these proteins have the potential to be the therapeutic target.

Also flagged:Thiopheneheterocyclecarbon atomsulfursugarsCancer
Journal Article 2025-07-16 No Snippets Mara BI, Mioc A, Deveseleanu-Corici LN, Șoica C, Cseh L.
Show Full Abstract

Thiophene derivatives are particularly attractive for application in drug development for their versatile pharmacological properties. We synthesized a series of four compounds with thiophene carboxamide as a scaffold. The structures were established based on HR-MS and 1D- and 2D-NMR. The purity of the compounds was established to be greater than 92% by thin-layer chromatography and NMR. The cytotoxic effects of the newly synthesized compounds were evaluated against the normal HaCaT cell line and A375, HT-29, and MCF-7 cancer cell lines. The cytotoxic assessment revealed that two compounds exhibit a significant cytotoxic effect on all cancer cell lines. To investigate their potential underlying mechanisms of action, several tests were performed: immunofluorescence imaging, caspase-3/7 assay, mitochondrial membrane potential (JC-1) assay, and 2',7'-dichlorofluorescein diacetate (DCFDA) assay. <b>MB-D2</b> proved to be the most cytotoxic and effective in terms of caspase 3/7 activation, mitochondrial depolarization and decrease in ROS production; these effects did not occur in normal HaCaT cells, revealing that <b>MB-D2</b> has a high selectivity against A375 cancer cells.

PCDH17
Also flagged:Gastric Cancertumorgene expressionTGFB3INHASERPINE1
Journal Article 2025-07-16 ✓ 1 Snippet Nguyen MH, Ta HDK, Nguyen DPQ, Le VH, Le NQK.
In-Text Gene Mentions

…higher rate ofPCDH17than the high-risk…

Show Full Abstract

<b>Background</b>: Hypoxia and immune components significantly shape the tumor microenvironment and influence prognosis and immunotherapy response in gastric cancer (GC). This study aimed to develop hypoxia- and immune-related gene signatures for prognostic evaluation in GC. <b>Methods</b>: Transcriptomic data from TCGA-STAD were integrated with hypoxia- and immune-related genes from InnateDB and MSigDB. A prognostic gene signature was constructed using Cox regression analyses and validated on an independent GSE84437 cohort and single-cell RNA dataset. We further analyzed immune cell infiltration, molecular characteristics of different risk groups, and their association with immunotherapy response. Single-cell RNA-seq data from the TISCH database were used to explore gene expression patterns across cell types. <b>Results</b>: Five genes (<i>TGFB3</i>, <i>INHA</i>, <i>SERPINE1</i>, <i>GPC3</i>, <i>SRPX</i>) were identified. The risk score effectively stratified patients by prognosis, with the high-risk group showing lower overall survival and lower T-cell expression. The gene signature had an association with immune suppression, <i>ARID1A</i> mutation, EMT features, and poorer response to immunotherapy. Gene signature, especially <i>SRPX</i> was enriched in fibroblasts. <b>Conclusions</b>: We developed a robust hypoxia- and immune-related gene signature that predicts prognosis and may help guide immunotherapy strategies for GC patients.

Also flagged:bindingwaterRAPStyrene Butadienesynthesis
Journal Article 2025-07-16 No Snippets Eleyedath A, Ali A, Mehta Y.
Show Full Abstract

The cold recycling (CR) technique is gaining traction, with an increasing demand for sustainable pavement construction practices. Cold in-place recycling (CIR) and cold central plant recycling (CCPR) are two strategies under the umbrella of cold recycling. These techniques use reclaimed asphalt pavement (RAP) to rehabilitate pavement, and CCPR offers the added advantage of utilizing stockpiled RAP. While many agencies have expertise in cold recycling techniques including CCPR, the lack of pavement performance data prevented the largescale implementation of these technologies. Recent studies in high-traffic volume applications demonstrate that CCPR technology can be implemented on the entire road network across all traffic levels. This reignited interest in the widespread implementation of CCPR. Therefore, the purpose of this study is to provide agencies with the most up-to-date information on CCPR to help them make informed decisions. To this end, this paper comprehensively reviews the mix-design for CCPR, the structural design of pavements containing CCPR layers, best construction practices, and the agency experience in using this technology on high-traffic volume roads to provide in-depth information on the steps to follow from project selection to field implementation. The findings specify the suitable laboratory curing conditions to achieve the optimum mix design and specimen preparation procedures to accurately capture the material properties. Additionally, this review synthesizes existing quantitative data from previous studies, providing context for the comparison of findings, where applicable. The empirical and mechanistic-empirical design inputs, along with the limitations of AASHTOWare Pavement ME software for analyzing this non-conventional material, are also presented.

Also flagged:LCORLMEF2BFASNVRTNNR6A1MSTN
Journal Article 2025-07-16 No Snippets Han Y, Akhtar MF, Chen W, Liu X, Zhao M, Shi L, Khan MZ, Wang C.
Show Full Abstract

This review examines the genetic basis of meat production phenotypic traits in sheep, addressing the challenge of enhancing carcass and meat quality to meet global demand. The article identifies key potential genes associated with vertebral traits, body size, muscle development, and fat deposition across diverse sheep breeds worldwide. Through comprehensive analysis of recent literature (2018-2025), the study synthesizes findings from genome-wide association studies, candidate gene approaches, and transcriptomic analyses. Specific potential genes like <i>VRTN, NR6A1, MSTN, ADIPOQ, LCORL, MEF2B, FASN, FABP4, SCD, DGAT1, BMP</i> and <i>HOX</i> family genes demonstrate significant associations with economically valuable traits. The potential genes influencing meat production phenotypic traits (intramuscular fat contents, growth, vertebral traits and body size traits) have been highlighted in this review. This comprehensive genetic marker catalog serves as a critical resource repository for implementing marker-assisted selection programs, providing breeders and researchers with validated genetic targets to accelerate breeding efficiency and enhance meat production in sheep worldwide.

DCC
Also flagged:AgingGFAPIBA1nucleusgene expression
Journal Article 2025-07-16 ✓ 2 Snippets Avey DR, Ng B, Vialle RA, Kearns NA, de Paiva Lopes K, Iatrou A, De Tissera S, Vyas H, Saunders DM, Flood DJ, Xu J, Tasaki S, Gaiteri C, Bennett DA, Wang Y.
In-Text Gene Mentions

…show LRs ( APP-DCC, APP-VLDLR ,…

…( RPH3A-NRXN1 , DSCAM-DCC, GNB3-GABBR2, RIMS1-SLC17A7, …

Show Full Abstract

<h4>Background</h4>Amyloid-beta (Aβ) plaques and their associated glial responses are hallmark features of Alzheimer's disease (AD), yet their interactions within the human brain remain poorly defined.<h4>Methods</h4>We applied spatial transcriptomics (ST) and immunohistochemistry (IHC) to 78 postmortem brain sections from 21 individuals in the Religious Orders Study and Memory and Aging Project (ROSMAP). We paired ST with histological data and stratified spots into major categories of plaque-glia niches based on Aβ, GFAP, and IBA1 intensity. Leveraging published ROSMAP single-nucleus RNA-seq data, we examined differences in gene expression, cellular composition, and intercellular communication across these niches. Neuronal and glial changes were validated by IHC and quantitative analyses. We further characterized glial responses using gene set enrichment analysis (GSEA) with known mouse glial signatures and human AD-associated microglial states. Finally, we used iPSC-derived multicellular cultures and single-cell RNA sequencing (scRNA-seq) to identify cell types that, upon short-term Aβ exposure, recapitulate the glial responses observed in the human spatial data.<h4>Results</h4>Low-Aβ regions, enriched for diffuse plaques, exhibited transcriptomic profiles consistent with greater neuronal loss than high-Aβ regions. High-glia regions showed increased expression of inflammatory and neurodegenerative pathways. Spatial glial responses aligned with established gene modules, including plaque-induced genes (PIGs), oligodendrocyte (OLIG) responses, disease-associated microglia (DAM), disease-associated astrocytes (DAA), and human AD-associated microglial states, indicating that diverse glial phenotypes emerge around plaques and shape the local immune environment. IHC confirmed elevated neuronal apoptosis near low-Aβ plaques and greater CD68 abundance and synaptic loss near glia-high plaques. In vitro, iPSC-derived microglia-but not astrocytes-exposed to Aβ displayed transcriptomic changes that closely mirrored the glial states identified in our ST dataset.<h4>Conclusions</h4>Our study provides a comprehensive spatial transcriptomic dataset from human AD brain tissue and bridges spatial gene expression with traditional neuropathology. By integrating ST, snRNA-seq, and human multicellular models, we map cellular states and molecular events within plaque-glia niches. This work offers a spatially resolved framework for dissecting plaque-glia interactions and reveals new insights into the cellular and molecular heterogeneity underlying neurodegenerative pathology.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1186/s44477-025-00002-z.

HFE
Also flagged:Anthracyclinesdoxorubicindaunorubicinepirubicinidarubicinchildhood cancers
Journal Article 2025-07-16 ✓ 2 Snippets Wong LYF, Sutcliffe AG, Ho CLT, Lu Y, Williams CL, Afzal F, Purkayastha M.
In-Text Gene Mentions

…(0.62; 0.46–0.84) andHFErs1799945 (0.63; 0.49–0.80).…

…( GSTA2 rs2180314,HFErs1799945 and ABCC5…

Show Full Abstract

<h4>Background</h4>Anthracyclines are widely used paediatric chemotherapy drugs, but anthracycline-induced cardiotoxicity (ACT) can cause heart failure in 16% of children. Previous studies have linked genetic variants to ACT and proposed pharmacogenomic testing for anthracycline-treated children; however, this approach remains unrealised. Therefore, this systematic review and meta-analysis evaluates the effectiveness of pharmacogenomic testing for ACT in childhood cancer.<h4>Methods</h4>Nine bibliographic databases, three trial registers, reference lists and conference abstracts were searched from inception until October 2024. Two reviewers independently performed study selection, data extraction and quality assessment. Clinical effectiveness was defined as: 1) genetic associations, assessed using random-effects meta-analyses of odds ratios (OR) and mean differences (MD) with 95% confidence intervals (CI) for variants examined in ≥2 studies; and 2) prediction accuracy, measured using area under the receiver operating characteristic curve (AUC) of pharmacogenomic models. Cost-effectiveness was assessed using incremental cost-effectiveness ratio (ICER).<h4>Results</h4>Among 1,215 de-duplicated records, we included 37 clinical effectiveness studies (26,446 patients). Five cardiotoxic (<i>ABCC2</i> rs8187710, <i>ETFB</i> rs79338777, <i>GPR35</i> rs12468485, <i>HNMT</i> rs17583889 and <i>UGT1A6</i> rs17863783; pooled OR range 1.84-6.12; CI range 1.04-18.56) and two cardioprotective (<i>GSTA2</i> rs2180314 and <i>HFE</i> rs1799945; pooled OR range 0.62-0.63; CI range 0.46-0.84) variants were significantly associated with ACT. Another cardioprotective variant, <i>ABCC5</i> rs7627754, increased left ventricular ejection fraction (MD 7.39%; CI 4.63%-10.14%) and fractional shortening (MD 5.04%; CI 2.00%-8.08%). Pharmacogenomic models using clinical and genetic variables (AUC range 0.67-0.87) showed higher accuracy in predicting ACT than those using clinical variables (AUC range 0.57-0.81) across five studies. We identified only one cost-effectiveness study (100 patients), showing one of these models reduced costs (-5.7%) and mortality (-17%) compared to standard care (ICER-negative). Overall, the evidence was graded as very-low-certainty across all outcomes due to imprecision, inconsistency and publication bias.<h4>Conclusion</h4>Despite promising results, this review highlights the lack of robust evidence to support pharmacogenomic testing for ACT in children. Further cost-effectiveness studies and ethnically diverse prediction models are needed to demonstrate the impact of pharmacogenomic testing on ACT prognosis and clinical decision-making prior to adoption.<h4>Systematic review registration</h4>PROSPERO identifier CRD42024557946.

PRDX6
Also flagged:Agingchronic diseasescellular senescencemacroautophagymitochondrialstem cell exhaustion
Journal Article 2025-07-16 ✓ 1 Snippet Huang X, Chou T, Liu X, Zeng K, Sun L, Yan Z, Mei S, Xi W, Zhan Z, Liu Y, Dong S, Liu S, Zhao J.
In-Text Gene Mentions

…GSTP1, PRDX1, PRDX2,PRDX6, SOD1, and TXN,…

Show Full Abstract

<h4>Background</h4>In conjunction with age, aqueous humor (AH) proteomics can affect the occurrence and development of age-related eye diseases, which are poorly understood.<h4>Objective</h4>We characterized the proteomic changes in AH throughout the aging process to better understand the aging mechanisms of the intraocular environment.<h4>Methods</h4>We analyzed the AH proteomes of 33 older and 19 younger individuals using liquid chromatography-tandem mass spectrometry, from which we clustered similar expression trajectories of AH proteomics using local regression analysis. Aging proteins (APs) and their functional enrichment were evaluated using various statistical and bioinformatics methods, while aging modulators were predicted using multiple machine-learning models.<h4>Results</h4>AH proteomic expression patterns exhibited various types of linear and nonlinear changes across the age groups. A set of 179 proteins identified as significant APs were enriched in various eye processes, such as detoxification, eye development, negative regulation of hydrolase activity, and humoral immune response. According to AH proteomics, hallmarks of aging include oxidative damage, defective extracellular matrices, and loss of proteostasis. A total of 11 APs were considered senescence signatures for predicting AH age with strong predictive ability. Furthermore, 22 APs were classified as modulators that may affect the aging process in the eye.<h4>Conclusion</h4>These findings establish a framework for age-related changes in the AH proteome and provide potential senescence biomarkers and therapeutic targets for age-related eye diseases.

Also flagged:Epithelial ovarian cancergynecologic malignancytumorsSNCGS100A1VWA2
Journal Article 2025-07-16 No Snippets Werner L, Ittner E, Swenson H, Rönnerman EW, Mateoiu C, Kovács A, Dahm-Kähler P, Karlsson P, Thorsell A, Rekabdar E, Esmaeili P, Levander F, Forssell-Aronsson E, Tullberg AS, Saed G, Parris TZ, Helou K.
Show Full Abstract

Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, yet clinical tools for diagnosis, prognosis, and treatment remain limited, and molecular profiling of histotypes is lacking. Here, we leverage proteomic data to further stratify four main EOC histotypes, borderline (BL) and benign (B) tumors, and identify candidate prognostic and diagnostic biomarkers. Using proteomic data from 300 patient samples, we identified differentially abundant proteins (DAPs) such as SNCG, S100A1, VWA2, AGR2, CTH, and SPINK1 and biomarker panels to stratify the tissues. Enrichment of biological processes profiled histotypes and involvement of DAPs. Survival analysis identified candidate biomarkers predicting overall- and disease-specific survival with histotype-specificity. Of these, GLYR1, RPL12, GDPGP1, and POLR2M were associated with favorable outcomes, while SDF4, PPP3CC, EIF2AK2, and STX6 were linked to unfavorable outcomes. Collectively, these findings provide histotype-specific attributes for known and EOC biomarkers that may serve as clinical tools for EOC diagnosis and treatment decisions.

Also flagged:TumorEwing sarcomatumorscancerpenicillinstreptomycin
Journal Article 2025-07-16 No Snippets Parent C, Honari H, Tocci T, Simon F, Zaidi S, Jan A, Aubert V, Delattre O, Isambert H, Wilhelm C, Viovy JL.
Show Full Abstract

An integrated approach is proposed to rapidly evaluate the effects of anticancer treatments in 3D models, combining a droplet-based microfluidic platform for spheroid formation and single-spheroid chemotherapy application, label-free morphological analysis, and machine learning to assess treatment response. Morphological features of spheroids, such as size and color intensity, are extracted and selected using the multivariate information-based inductive causation algorithm, and used to train a neural network for spheroid classification into viability classes, derived from metabolic assays performed within the same platform as a benchmark. The model is tested on Ewing sarcoma cell lines and patient-derived xenograft (PDX) cells, demonstrating robust performance across datasets. It accurately predicts spheroid viability, used to generate dose-response curves and to determine half maximal inhibitory concentration (IC50) values comparable to traditional biochemical assays. Notably, a model trained on cell line spheroids successfully classifies PDX spheroids, highlighting its adaptability. Compared to convolutional neural network-based approaches, this method works with smaller training datasets and provides greater interpretability by identifying key morphological features. The droplet platform further reduces cell requirements, while single-spheroid confinement enhances classification quality. Overall, this label-free experimental and analytical platform is confirmed as a scalable, efficient, and dynamic tool for drug screening.

Research Square 2025-07-16 Preprint (No Snippets API) Wang J, Li Y.
Show Full Abstract

<title>Abstract</title> <p>Oogenesis is an energy-intensive process critical for reproductive success. To ensure proper coordination with developmental stages and nutritional status, complex regulatory mechanisms have evolved. Using <italic>C. elegans</italic> previous studies have emphasized the role of hypodermis and intestinal cells—key tissues that sense developmental status and environmental nutrition—as major regulators of oogenesis and reproduction, while whether and how neurons also play a role in regulating oogenesis is not well studied. In this study, we found that a neuron derived signaling pathway, Netrin-1/UNC-6 and its receptors DCC/UNC-40 and UNC-5 regulates germ cell apoptosis. Our results indicate that Deleted in Colorectal Cancer, DCC/UNC-40 differently regulate germ cell apoptosis depending on the presence of its ligand Netrin-1/UNC-6. Loss-of DCC/UNC-40 promotes apoptosis in the presence of Netrin-1/UNC-6, while inhibits apoptosis in the absence of Netrin-1/UNC-6. The alternative receptor of Netrin-1/UNC-6, UNC-5 compensates for the loss-of DCC/UNC-40, and partially explains for the opposite effect of DCC/UNC-40 in regulating apoptosis, dependent on its ligand Netrin-1/UNC-6. Our results revealed a potential compensation mechanism of the controversial function of DCC/UNC-40 on regulating apoptosis, as well as colorectal cancer development, and thus provided a potential therapy for colorectal cancer by synthetically targeting DCC/UNC-40 with its ligand Netrin-1/UNC-6, or with its competitive Netrin-1/UNC-6 receptor UNC-5.</p>

MLLT10
Also flagged:multiple myelomaprimary plasma cell leukemiaLDHthrombocytopeniaplasma cell leukemiaMyeloma
Journal Article 2025-07-15 ✓ 1 Snippet Tian M, An G, Fu W, Yan W, Li L, Sun C, Li Z, Chen L, Liao A, Gao G, Qin X, Li M, Li C, Xue H, Gao L, Wang Y, He A, Zhou F, Guo D, Dong Y, Fang Z, Chu X, Mi J, Fu C, Zeng H, Hou S, Wang X, Wang H, Wei Y, Liang X, Yi X, Sun Y, Qiu L, Dai Y, Jin F.
In-Text Gene Mentions

…(e.g., EZH2 andMLLT10), mitotic cell…

Show Full Abstract

<h4>Background</h4>The existing risk models for multiple myeloma (MM) are suboptimal for the stratification of patients with primary plasma cell leukemia (pPCL), a rare and peculiar MM. In this study, we aimed to develop a staging system for pPCL defined as the presence of ≥ 5% circulating plasma cells (CPC) according to the new diagnostic criteria, utilizing one of the largest series of patients with pPCL.<h4>Methods</h4>This multicenter retrospective study included 340 patients with pPCL (the training cohort) from 25 centers nationwide in China. The prognostic impact of baseline characteristics and cytogenetic abnormalities was evaluated. Univariate and multivariate analyses were conducted to identify variables predicting overall survival (OS) to develop a staging system. Its performance was then validated in an independent cohort (n = 80). Genome-wide DNA and RNA sequencing were performed to explore the molecular basis for inter-stage clinical heterogeneity.<h4>Results</h4>Del(17p), t(4;14), and t(14;16), but not 1q+, were verified as high-risk cytogenetic abnormalities (HRCAs) of pPCL. HRCA, elevated LDH, and thrombocytopenia had the highest impact on OS and were used to create a simple algorithm, stratifying patients with pPCL into stages I, II, and III, with median OS of 54.1, 24.0, and 5.4 months (II vs. I: HR, 1.986; 95% CI, 1.034-3.814; P = 0.0394; III vs. II: HR, 3.206; 95% CI, 1.757-5.852; P = 0.0001) in the training cohort and 62.1, 31.6, and 21.8 months (II vs. I: HR, 2.013; 95% CI, 0.954-4.251; P = 0.0664; III vs. II: HR, 2.694; 95% CI, 1.136-6.392; P = 0.0245) in the independent validation cohort. The accuracy (c-index 0.711) was higher than other models. Moreover, patients with different stages had highly diverse genomic and transcriptomic aberrations.<h4>Conclusions</h4>We propose a pPCL-specific staging system based on LDH, thrombocytopenia, and cytogenetic abnormalities, which warrants further validation, particularly in a prospective setting.

Also flagged:Ferroptosisdeathironlipidextracellularvesicles
Journal Article 2025-07-15 No Snippets Zayed M, Elwakeel E, Ezzat P, Jeong BH.
Show Full Abstract

Ferroptosis, a regulated type of cell death directed by iron-dependent lipid peroxidation, is associated with a variety of pathological diseases. Recent findings have highlighted the therapeutic potential of mesenchymal stem cell-derived exosomes (MSC-Exos) in modulating ferroptosis. These nano-sized extracellular vesicles carry bioactive substances, including proteins, lipids, and microRNAs, which regulate vital pathways related to ferroptosis, such as reactive oxygen species production, glutathione metabolism, and lipid peroxidation. Preclinical studies suggest that MSC-Exos can alleviate ferroptosis-induced damage by enhancing antioxidant defenses, mitigating oxidative stress, upregulating anti-ferroptotic regulators, and suppressing lipid peroxidation. Notably, in cancer, MSC-Exos may protect non-malignant tissues from chemotherapy-induced ferroptosis. By exploiting their regenerative and immunomodulatory properties, MSC-Exos offer a promising therapeutic platform for targeting ferroptosis in diverse pathological conditions. This review summarizes the biological and functional characteristics of MSC-Exos, elucidates their roles in ferroptosis regulation across multiple disease models, and discusses current challenges and future directions for clinical translation.

SOX6
Also flagged:calciumMYCtransposasechromatinSOX5transcription factors
Journal Article 2025-07-15 ✓ 5 Snippets Wu X, Fu Y, Ma J, Wang H, Li C, Zhu Y, Wang Q, Guo X, Zhang T, He A.
In-Text Gene Mentions

…ich subsequently reduced SOX5/SOX6levels, important transcriptio…

…stream matrix-associated SOX5/SOX6genes.…

…antibodies: MGP, TWIST2,SOX6, Collagen I, GAPDH…

…GCAAAAAG—CAGTGGCAATGGGGATCTGT;SOX6: AGCCTGTAAAGTCCCCAACG—TCCTGAT…

…expression of SOX5,SOX6and SOX9 after…

Show Full Abstract

Tissue engineering technology for cartilage regeneration has increasingly emerged as a preferred method for repairing cartilage defects. However, the loss of chondrocyte-specific phenotypes during in vitro expansion, commonly referred to as dedifferentiation, impedes cartilage regeneration. Current research has yet to fully elucidate this phenomenon, hindering the development of improved cartilage regeneration. Our study employed single-cell sequencing and transposase-accessible chromatin sequencing to identify biomarkers, cell lineages and cellular characteristics within auricular chondrocytes during in vitro expansion. Our results showed that lower passage (P3) chondrocytes exhibited more dedifferentiated phenotypes with increased chromatin accessibility, while higher passage (P6) chondrocytes demonstrated hypertrophic characteristics. Furthermore, we identified that increased calcium influx was closely associated with the early dedifferentiation of chondrocytes, while inhibiting calcium signaling in early dedifferentiated cell could reverse cell phenotypes and promoted cartilage regeneration. In-depth mechanism research revealed that the expression of MYC mRNA was downregulated by increased calcium influx, which subsequently reduced SOX5/SOX6 levels, important transcription factors for chondrocytes, leading to diminished extracellular matrix production and early dedifferentiation. In conclusion, we provide a comprehensive understanding of chondrocyte dedifferentiation and propose new strategies for optimizing cartilage regeneration systems.

HTT
Also flagged:Genetic ConditionHuntington's Choreaneurodegenerative disordercognitive declinepsychiatricHuntington's disease
Journal Article 2025-07-15 ✓ 1 Snippet Sharma M, Deshmukh S, Thakre T, Waskar R, Senger N.
In-Text Gene Mentions

…mutation in theHTTgene, leading to…

Show Full Abstract

<h4>Background</h4>Huntington's Chorea is a progressive neurodegenerative disorder characterized by involuntary movements, cognitive decline, and psychiatric disturbances. It is caused by an autosomal dominant mutation in the HTT gene, leading to an abnormal expansion of CAG repeats. The disease typically manifests in mid-adulthood and gradually worsens over time. The progressive nature of the disease leads to motor, cognitive, and psychiatric impairments, significantly affecting the quality of life.<h4>Aim</h4>This study aims to highlight the progressive nature of Huntington's disease, its impact on motor and cognitive functions, and the role of symptomatic management in improving the patient's quality of life through Ayurveda.<h4>Methods</h4>A 40-year-old male presented with involuntary movement in the upper and lower extremities, difficulty in doing daily routine work, anxiety, difficulty in walking, and sleeplessness for a year. A thorough Huntington's disease mutation analysis was conducted to confirm the diagnosis. The patient was treated with Ayurvedic shodana (Bio-purification), Sarvanga Snehan with Prasarini Taila, followed by Shashtik Shali Pinda Swedan, Nasya with Shadbindu Taila, Shiropichu with Brahmi Taila, Sarvang Dhara with dashmoola kwath, Erandmooladi niruh basti, and shamana (palliative) chikitsa (treatment), Zandopa powder, Balasaireyakadi Kashaya, Kalyanak ghrit, and capsule palsineuron orally for 4 months.<h4>Result</h4>Ayurvedic management promoted substantial improvements in behavioral health, neuromotor function, and activities of daily living as assessed by the Universidade Federal de Minas Gerais (UFMG) Sydenham's Chorea Rating Scale (USCRS).<h4>Discussion</h4>The patient's clinical presentation and diagnostic findings were consistent with Huntington's Chorea.<h4>Conclusion</h4>Huntington's Chorea is a debilitating condition with no definitive cure. Early diagnosis and a multidisciplinary management approach can help alleviate symptoms and improve patient well-being. Genetic counseling plays a crucial role in managing the familial impact of the disease.<h4>Keywords</h4>HTT gene, Genetic Counseling, CAG Repeat Expansion, Huntington's Chorea, Motor Dysfunction, Ayurvedic Medicine, Case Report.

Also flagged:Biotransformationmetalsdetoxificationchromiummanganesearsenic
Journal Article 2025-07-15 No Snippets Naziębło A, Dobrzyński J.
Show Full Abstract

Heavy metals are among the key environmental contaminants which pose a threat to all the living organisms. Bacteria can help detoxify these elements by a range of mechanisms associated to bacterial metabolic processes. One of them is biotransformation, which consists in change in the oxidative state of an element, often followed by its absorption or precipitation. Pseudomonadota-a vast and diverse bacterial phylum-belong to the best studied microorganisms involved in the process. Our review shows their contribution to the redox-based detoxification of four trace elements: chromium, manganese, mercury, and arsenic. Based on a comprehensive literature survey, we try to assess the importance of individual orders and selected genera in redox transformations; we also identify potential risks associated with the use of Pseudomonadota in bioremediation and suggest the most promising directions for future studies and applications. The review leads to a conclusion that the potential of non-pathogenic rhizobia Hyphomicrobiales is particularly worth further exploration.

OLFM4
Also flagged:NFAT5Nuclear factor of activated T cells 5transcription factorcolitisRegIIIlysozyme
Journal Article 2025-07-15 ✓ 5 Snippets Park SH, Cheon DH, Kim YM, Choi Y, Cho YJ, Hong BK, Cho SH, Kweon MN, Kwon HM, Chang EB, Kim D, Kim WU.
In-Text Gene Mentions

…the number ofOLFM4+ cells, a…

…of Lgr5 andOlfm4mRNA and the…

…the number ofOLFM4+ cells were…

…The data showed that Nfat5 depletion significantly reduced the mRNA expression of ISC-related genes, such as EphB2 and Lgr5 , as well as the number ofOLFM4 + cells, a marker protein of ISCs, in ileal epithelial cells ( Supplemental Figure 6 , C and D), indicating NFAT5-mediated regulation of ISCs.…

…As shown in Figure 6, I and J , the levels of Lgr5 and Olfm4 mRNA and the number ofOLFM4 + cellswere substantially reduced in the ileal epithelium of Nfat5 IEC-KO mice.…

Show Full Abstract

Hypertonic and hyperosmolar stimuli frequently pose challenges to the intestinal tract. Therefore, a resilient epithelial barrier is essential for maintaining gut homeostasis in the presence of osmotic perturbations. Nuclear factor of activated T cells 5 (NFAT5), an osmosensitive transcription factor, primarily maintains cellular homeostasis under hypertonic conditions. However, the osmoprotective role of NFAT5 in enterocyte homeostasis is poorly understood. Here, we demonstrate that NFAT5 was critical for the survival and proliferation of intestinal epithelial cells (IECs) and that its deficiency accelerated chemically induced or spontaneous colitis in mice. Mechanistically, NFAT5 promoted the survival of IECs and the renewal of intestinal stem cells, thereby regulating the production of mucus and antimicrobial compounds, including RegIII and lysozyme, which consequently shape the gut microbial composition to prevent colitis. Transcriptome analysis identified HSP70 as a key downstream target of NFAT5 in epithelial regeneration. Loss- and gain-of-function experiments involving HSP70 revealed that NFAT5 mitigated experimental colitis through IEC Hsp70, which protected stem cells from inflammation-induced injury and maintained barrier function. In conclusion, our study demonstrates what we believe to be a previously unknown role for NFAT5 in dictating the crosstalk between intestinal stem cells and the microbiota, underscoring the importance of the NFAT5/HSP70 axis in maintaining epithelial regeneration related to gut barrier function, balancing microbial composition, and subsequently preventing colitis progression.

Also flagged:NEDD4LmitochondrialE3 ligaseHDdeathcalcium
Journal Article 2025-07-15 No Snippets Fan P, Liu Y, Liu C, Yao H, Xu S, Jiang Y, Wu Y, Liu Y, Guo X.
Show Full Abstract

Impairment of mitochondrial protein stability is associated with neurodegeneration in Huntington's disease (HD). However, the E3 ligase responsible for maintaining mitochondrial protein homeostasis in HD remains poorly understood. In this study, we demonstrate that NEDD4L protein levels are elevated in human striatal organoids (hSOs) derived from induced pluripotent stem cells of patients as well as in a mouse model of HD. Overexpression of NEDD4L leads to degeneration and cell death of medium spiny neurons (MSNs), along with a reduction in motor activities. Conversely, deletion of NEDD4L restores abnormal MSN morphology, corrects deficits in calcium signaling, alleviates neurodegeneration in HD-hSOs, and improves motor dysfunction observed in YAC128 mice. Mechanistically, NEDD4L disrupts mitochondrial function by binding to lipoyl(octanoyl) transferase 2 (LIPT2) and promoting its degradation through ubiquitination and lysosomal pathways. This process impairs lipoic acid biosynthesis and the lipoylation of E2 subunits of alpha-ketoglutarate dehydrogenase (α-KGDH E2). Furthermore, either overexpressing LIPT2 or administering lipoic acid mitigates neurodegeneration and rectifies deficits in motor coordination activity. These findings unveil a molecular mechanism underlying the regulation of lipoic acid metabolism and underscore the potential therapeutic role of protein lipoylation in the treatment of HD.

HFE
Also flagged:OzonePostherpetic Neuralgiaherpes zosterAnxietyDepressionlidocaine
Journal Article 2025-07-15 ✓ 1 Snippet Xiang D, Deng L, Zhou R, Zhang X, Zhou Y, Zhou D, Peng Y.
In-Text Gene Mentions

…patients who havehemochromatosisor copper/iron therapy;…

Show Full Abstract

<h4>Background</h4>Previous studies have demonstrated that ozone injection into the dorsal root ganglion significantly reduces pain scores associated with herpes zoster, suggesting its therapeutic potential for managing postherpetic neuralgia (PHN) via the intervertebral foramen epidural space. However, there are no specific reports addressing the treatment of herpes zoster and PHN by involving the thoracic and lumbar nerves under computed tomography (CT) guidance. Our research focuses on the effect of medical ozone administered through the intervertebral foramen epidural space on PHN.<h4>Objective</h4>This is a protocol for a prospective, randomized, controlled, and double-blind trial to detect whether the injection of medical ozone via the intervertebral foramen epidural space can reduce the incidence of PHN.<h4>Methods</h4>After signing the written informed consent, patients meeting eligibility criteria will be allocated into the medical ozone group and the control group in a 1:1 ratio according to the randomized grouping information, with 35 patients in each group. Patients in both groups accepting the surgical procedure under CT guidance will be injected with 5 mL of therapeutic liquid. Subsequently, medical ozone (30 μg/mL, 5 mL in each segment) will be slowly administered in the medical ozone group versus a sham procedure in the control group. The primary outcome will be the incidence of PHN 3 months after the subsidence of rashes and vesicles. The secondary outcomes will be the times of injection treatment, complications during the surgical procedure, times of remedial analgesia with ultrasound-guided nerve block, numerical rating score and tactile sensation, Hospital Anxiety and Depression Scale score, and the use of lidocaine cataplasms and oral analgesics before and after the surgical procedure under CT guidance. Data analyses between the 2 groups will be compared using the 2-sided Student t test or Wilcoxon Mann-Whitney test based on the viability of the normality assumption, while chi-square or Fisher exact test will be used to compare the categorical data.<h4>Results</h4>This study was approved by the medical ethics committee of Deyang People's Hospital on February 27, 2024 (2024-03-002-K01). The first patient was enrolled on May 14, 2024. As of November 2024, 25 participants have been enrolled out of 70 who received screening. The analysis of the efficacy and safety data is expected to be performed in about May 2025 after all the patients have enrolled, with the approximate publication of results by September 2025.<h4>Conclusions</h4>If this exploratory trial proves effective, medical ozone administered via the intervertebral foramen epidural space may be utilized to aid in the recovery of the infected nerves and decrease the incidence of PHN in clinical settings. Positive outcomes will bolster the potential of employing medical ozone in the treatment of herpes zoster, thereby contributing to a reduction in the incidence of PHN.<h4>Trial registration</h4>Chinese Clinical Trial Registry ChiCTR2400084014; https://tinyurl.com/jk6p9hn2.<h4>International registered report identifier (irrid)</h4>DERR1-10.2196/68847.

BTN2A1
Also flagged:conjugationEGFRcancerchimeric antigen receptorB-cell lymphomaantibodies
Journal Article 2025-07-15 ✓ 1 Snippet Li HK, Wu TS, Ru Y, Kuo YC, Lee CY, Leng PJ, Hsieh YC, Chiang YJ, Cheng ZF, Lin YL, Hsiao SC, Tang SW.
In-Text Gene Mentions

…has demonstrated thatBTN2A1directly binds the…

Show Full Abstract

<h4>Background</h4>Targeting epidermal growth factor receptor (EGFR) has become a strategic approach in cancer therapy, using various modalities including chimeric antigen receptor (CAR)-αβT cell therapies. Despite significant advancements in autologous CAR-αβT cell therapies in B-cell lymphoma, current cell therapies face challenges such as potential risks associated with genetic engineering, waiting time and high costs of autologous CAR-αβT cell therapies. Innovations in click chemistry and bioorthogonal chemistry have enabled the development of antibody-cell conjugation (ACC) technology, which links cancer-targeting antibodies to immune cells without genetic modifications, potentially providing a safer profile.<h4>Methods</h4>In this study, we introduce ACE2016, an innovative allogeneic cell therapy targeting EGFR. ACE2016 is generated by ACC technology to conjugate donor-derived γδ2 T cells with the EGFR-specific antibody cetuximab.<h4>Results</h4>Our preclinical studies demonstrate that ACE2016 exhibits superior cytotoxicity against various EGFR-expressing cancer cell lines and minimal cytotoxic effects on normal cells. Mechanistic studies revealed that ACE2016 enhances cytotoxicity through increased capacity towards EGFR-expressing cancer cells, enhanced levels of cytotoxic cytokines and recruitment of peripheral cytotoxic cells, reflecting significant tumor suppression and prolonged survival in ACE2016-treated groups without causing treatment-related toxicity in vivo.<h4>Conclusions</h4>These findings support the clinical potential of ACE2016 as an off-the-shelf γδ2 T-cell therapy for EGFR-expressing cancers, offering a combination of specificity, scalability, and safety in the development of solid tumor therapy.

SERPINC1
Also flagged:Venous thromboembolismULBP2IL18BPMAN1A2CCL25ICAM2
Journal Article 2025-07-15 ✓ 1 Snippet Kong Y, Tang W, Kang H, Guan Y, Li S, Cao X, Shao Z, Jiang Y, Wang C, Hao X.
In-Text Gene Mentions

…F2, F5 andSERPINC1, were not validated…

Show Full Abstract

Venous thromboembolism is a life-threatening vascular event with high prevalence and genetic determinants. PWAS has become a popular strategy to identify therapeutic targets of complex diseases. However, the current PWAS model only considers the linear relationship between protein and disease. Here, we propose a novel non-linear PWAS pipeline and identify 43 proteins exhibiting non-linear associations with venous thromboembolism in the UK Biobank, of which eight proteins cannot be captured by linear PWAS. We further conduct prospective cohort replication in the UK Biobank Pharma Proteomics Project, and replicate eight proteins with similar non-linear trends, including ULBP2, IL18BP, MAN1A2, CCL25, ICAM2, LGALS4, VSIG2 and ABO. Pathway enrichment analysis suggests that the identified non-linear proteins are involved in endothelium development, fluid shear stress and atherosclerosis pathways. In summary, we develop a novel non-linear PWAS analysis pipeline, and identify 43 non-linear proteins with venous thromboembolism, highlighting the importance of incorporating non-linear analysis in PWAS.

TNFSF4
Also flagged:colorectal carcinomacolon cancerscolorectal cancersgene expressiontumorwound healing
Journal Article 2025-07-15 ✓ 2 Snippets Luo Y, Huang Y, Luo Y, Yin Y, Wang P.
In-Text Gene Mentions

TNFSF4exhibited variances between…

…checkpoint inhibitor targetTNFSF4(Fig. 7 H)…

Show Full Abstract

Numerous reports have highlighted distinct clinical and biological characteristics between right-sided and left-sided colon cancers. Despite this research on commonalities and divergences among colorectal cancers (CRC) at different locations remain sparse. In order to elucidate gene expression disparities across various intestinal regions in CRC, we sourced several data series from the Gene Expression Omnibus (GEO) database. We isolated 344 tumor and 54 normal cases spanning seven locations: sigmoid, ascending, caecum, rectum, transverse, descending, and recto-sigmoid. Cell biological functions were assessed utilizing CCK8, EdU assays, Transwell assays, and wound healing assays. We identified location-related differentially expressed genes (DEGs) and their functional enrichment. TNFSF4 exhibited variances between the transverse and descending regions, allowing for discrimination of tumor tissues across four locations (sigmoid, ascending, caecum, and descending) via immune cells. Moreover, we identified 16 hub genes that collectively indicate commonality among the seven different tissue origins. Furthermore, 6 location-related genes, including DCBLD2, GTF3A, GSS, PDK1, TEAD3 and EGR2 were identified for targeted interventions. In vitro experiments indicated that increased GZMB and decreased IER3 reduced CRC cell proliferation, migration, and invasion. In summary, 16 hub genes and 6 location-related genes enhance our understanding of the potential molecular mechanisms underlying CRC spatial heterogeneity. Furthermore, GZMB and IER3 might be potential targets for CRC therapy.

Also flagged:metalsmercuryleadcadmiumarsenicnitrates
Journal Article 2025-07-15 No Snippets Singh S, Murugesan G, Vinayagam R, Varadavenkatesan T, Selvaraj R.
Show Full Abstract

Fluoride contamination in groundwater threatens human health and ecological systems, necessitating cost-effective and efficient remediation strategies. This study synthesized hydroxyapatite (MRS-HAp) from Marcia recens shells through chemical precipitation to serve as a potential adsorbent for the removal of fluoride. The prepared MRS-HAp exhibited a specific surface area of 100.42 m<sup>2</sup>/g. FESEM analysis revealed an irregular, closely packed structure with a mean diameter of 28.89 nm. EDS determined a Ca/P molar ratio of 1.6, while XRD analysis confirmed a hexagonal crystalline lattice with a crystallite diameter of 32.18 nm. XPS identified a fluoride peak at 684.58 eV, confirming adsorption. The adsorption dataset obeyed pseudo-second-order kinetics and Langmuir isotherm, pointing to chemisorption and monolayer coverage, with a maximum adsorption capacity of 19.19 mg/g. Spiked water experiments demonstrated robust fluoride removal efficiencies across diverse real-world water matrices. MRS-HAp showed reasonable regeneration potential for fluoride removal, retaining significant adsorption capacity over four cycles. These results position MRS-HAp as a cost-effective and sustainable adsorbent for fluoride removal in water treatment applications.

Also flagged:triglycerideglucosecolorectal cancerinsulin resistancesynthesiscancers
Journal Article 2025-07-15 No Snippets Omer HFE, Alghazali M, Ibrahim MY, Abdalla NMY, Hassan AHM, Yousif EAS, Abdhameed AEB, Naser YWS, Hamad NME, Abdalla MAI, Idres MOM, Ahmed AAO, Elhadi YAM, Mohamed SOO.
Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is one of the most common malignancies worldwide, with increasing evidence linking metabolic dysregulation, such as insulin resistance and chronic inflammation, to its development and progression. A potential useful predictor of CRC risk is the triglyceride-glucose (TyG) index, a marker for insulin resistance that is determined using fasting triglyceride and glucose levels. The purpose of this systematic review was to assess the relationship between the TyG index and CRC and ascertain whether the TyG index is associated with the development and outcomes of CRC.<h4>Methods</h4>A systematic review and meta-analysis was reported in accordance with the PRISMA guidelines. Comprehensive searches of PubMed, Web of Science, Scopus, and World Health Organization Virtual Health Library were conducted in 24th March 2025 to find studies assessing the relationship between the TyG index and CRC. Results of association between TyG index and CRC were summarized and a meta-analysis was done to calculate pooled hazard ratio (HR) with 95% confidence interval (CI).<h4>Results</h4>A total of eight studies were included in the systematic review, of which five met the criteria for inclusion in the quantitative synthesis. The pooled analysis showed that the hazard of developing CRC was significantly greater for those with a higher TyG index (HR = 1.18; 95% CI: 1.12-1.25; P <.001). In addition, meta-analysis indicated that hazard of developing CRC significantly increased for each one-unit increase in the TyG index (HR = 1.28, 95% CI: 1.18 to 1.39, P <.001).<h4>Conclusion</h4>Higher TyG index level is substantially linked to an elevated hazard of developing CRC. Therefore, the TyG index can be a useful tool for CRC risk identification. Standardizing cut-off values and researching clinical applicability in various populations should be the main goals of future research. Due to the limitations posed by the small number of studies, further prospective studies are needed to generate more robust and generalizable evidence.

Also flagged:GelatinHydroxyapatitebone illnessesbiopolymersdoxycyclinecell adhesion
Journal Article 2025-07-15 No Snippets Motta SD, Passos Leite PH, Nascimento AD, Sinisterra RD, Cortés ME.
Show Full Abstract

Worldwide, bone illnesses and disorders are on the rise. Artificial bone substitutes may replace autogenous bone transplants. Due to its cytocompatibility, nontoxic breakdown, infinite supply, and disease resistance, biopolymers are becoming more attractive in biomedical applications. Most graft materials used in composites lack the antibacterial properties necessary for matrix biocompatibility. This study aims to develop two hybrid polymeric composites incorporating doxycycline to enhance cell compatibility and antibacterial activity, using gelatin-Hydroxyapatite-gelatin (HA-gel) cross-linked with 1% w/v (1-ethyl-3-(3-(dimethylamino)propyl)) carbodiimide (EDC) and 0.3, 0.7, and 1.2% doxycycline. The gelatin-hydroxyapatite scaffold with 1% EDC cross-linker and 0.3% doxycycline (1.1) demonstrated reduced cytotoxicity in L929 fibroblasts and MC3T3 preosteoblastic cells. At 21 days, scaffolds increased preosteoblastic cell (MC3T3) proliferation, cell adhesion, and ALP. The <i>in vitro</i> drug release profiles and steady enzymatic biodegradation are consistent with the bone regeneration time. Doxycycline-enhanced gelatin-HA composites have porosity, controlled breakdown, and swelling, making them biocompatible for bone tissue regeneration. Doxycycline increased preosteoblastic cell proliferation, offered antibacterial characteristics, and regulated breakdown to meet bone repair timelines. The composite improved cell adherence and regulated drug release, making it a viable tissue engineering and drug delivery medium.

Also flagged:Serotonin transporterbehavioralspider phobiaanxiety disordersarachnophobia
Journal Article 2025-07-15 No Snippets Schrammen E, Hilbrich C, Böhnlein J, Roesmann K, Gathmann B, Herrmann MJ, Junghöfer M, Schwarzmeier H, Seeger FR, Siminski N, Straube T, Weber H, Lueken U, Dannlowski U, Domschke K, Schiele MA, Leehr EJ.
Show Full Abstract

Identifying biomarkers predicting therapy outcomes before treatment holds great promise for advancing precision medicine. Genetic variants such as the serotonin transporter gene linked polymorphic region (5-HTTLPR) may be associated with response to cognitive behavioral therapy in anxiety disorders, albeit results so far are controversial. Contributing to the ongoing debate, we investigated whether treatment response to a highly standardized one-session virtual reality exposure therapy (VRET) was predicted by 5-HTTLPR genotype. N = 194 patients with arachnophobia (spider phobia) were genotyped for 5-HTTLPR and the functionally related single nucleotide polymorphism rs25531 and grouped into high- (LA/LA), and low-expression (S/S, S/LG, LG/LG, S/LA, LG/LA) genotype. At baseline, after VRET, and at a 6-month follow-up, participants underwent a standardized behavioral avoidance task (BAT) and the spider phobia questionnaire (SPQ) to assess symptom severity. Chi-square tests revealed a significant association between 5-HTTLPR/rs25531 and behavioral treatment outcome, that remained significant at the 6-month follow-up. No association was found between genotype and self-reported symptom severity measured with the SPQ. Our results support the idea that while LA/LA genotype carriers might benefit from highly standardized treatment, lower 5-HTT expression may convey risk to poorer treatment response, likely necessitating more tailored psychotherapeutic interventions to promote sufficient response.

SERPINC1
Also flagged:preeclampsiaPEAMBPinter-alpha trypsin inhibitor light chainVTNvitronectin
Journal Article 2025-07-15 ✓ 5 Snippets Pinto-Souza CC, Kaihara JNS, Rossini BC, Cavalli RC, Dos Santos LD, Sandrim VC.
In-Text Gene Mentions

…in PE+; whereasSERPINC1(antithrombin), PSG1 (pregnanc…

…and four downregulated (SERPINC1, PSG1, ITIH4, and…

…intensity data forSERPINC1, PSG1, APCS, HBB,…

…the other hand,SERPINC1, PSG1, ITIH4 and…

…Interestingly, together withSERPINC1, a plasma protease…

Show Full Abstract

<h4>Objective</h4>This study aims to compare the plasma protein profiles between 7 preeclampsia patients with severe features (PE+) and 7 preeclampsia patients without severe features (PE-) and 10 healthy pregnancies (HP); identify differentially expressed proteins among these groups and explore the altered signaling pathways and their association with the severity of this cardiovascular condition.<h4>Methods</h4>Plasma proteins were quantified using mass spectrometry, followed by comprehensive bioinformatics and statistical analyses. Protein identification and annotation were performed using UniProt and PatternLab for Proteomics. Multivariate statistical analyses, including PLS-DA and sPLS-DA, as well as VIP score evaluation and Volcano plot visualization, were conducted with MetaboAnalyst to assess group separation and identify key discriminative features. Functional enrichment and pathway analyses were carried out using Metascape.<h4>Results</h4>Using a fold change and volcano plot validation of 1.2, comparisons between HP and PE+ revealed that proteins such as AMBP (inter-alpha trypsin inhibitor light chain), VTN (vitronectin), CLU (clusterin), F2 (prothrombin), and PZP (pregnancy zone protein) were upregulated in PE+. Conversely, ITIH4 (inter-alpha trypsin inhibitor heavy chain H4), APOL1 (apolipoprotein 1) and SERPIND1 (heparin cofactor II) were downregulated in PE+ relative to HP. When comparing HP with PE-, SERPINA3 (alpha-1-antichymotrypsin) and HBB (hemoglobin subunit beta) were downregulated in PE-. Between PE- and PE+, APCS (serum amyloid P component) and HBB were upregulated in PE+; whereas SERPINC1 (antithrombin), PSG1 (pregnancy-specific beta-1-glycoprotein 1), ITIH4, and C5 (complement C5) were downregulated in PE+ compared to PE-.<h4>Conclusion</h4>These findings offer valuable insights into the different pathophysiological mechanisms underlying the two subgroups of PE. The upregulated proteins in PE+ (AMBP, VTN, CLU, F2, PZP, APCS, and HBB) play key roles in regulating blood pressure, modulating the extracellular matrix and influencing immune responses. Overall, this research deepens our understanding of the complexity and clinical significance of PE.

OLFM4
Also flagged:DiabetespeptidedextranWnt3atrimethylaminelipopolysaccharide-binding protein
Journal Article 2025-07-15 ✓ 2 Snippets Chittimalli K, Manandhar I, Adkins S, Rahman M, Toelle A, Tummala R, Joe B, Jarajapu YPR.
In-Text Gene Mentions

…occludin, Lgr5 +Olfm4+ intestinal stem…

Olfm4

Show Full Abstract

Diabetes promotes inflammation by compromising colon epithelial barrier integrity and upregulation of myelopoiesis in the bone marrow (BM). Angiotensin-(1-7) (Ang-(1-7)) is a cardiovascular protective peptide in diabetes. This study tested if Ang-(1-7) restores the colon epithelial barrier integrity and myelopoiesis in diabetes via restructuring dysbiotic gut microbiota and the BM-inflammatory landscape. Nondiabetic (ND) or streptozotocin-induced type 1 or db/db type 2 diabetic mice were treated with saline or Ang-(1-7). The intestinal permeability was evaluated by using FITC-dextran. Claudin1, occludin, Lgr5<sup>+</sup>Olfm4<sup>+</sup> intestinal stem cells (ISCs), Wnt3a and β-catenin were evaluated by immunohistochemistry or western blotting. Fecal microbiome was analyzed by 16S rRNA sequencing. Monocyte-macrophages were characterized by flow cytometry. Plasma trimethylamine N-oxide (TMAO) and lipopolysaccharide-binding protein (LBP) levels or BM-cytokines were quantified. Increased intestinal permeability in both models of diabetes was reversed by Ang-(1-7) (P < 0.001, n = 5). In db/db colons, Wnt3a and the active β-catenin levels were lower compared to the ND, which were restored by Ang-(1-7). Monocytes and pro-inflammatory macrophages were higher diabetic mice that were decreased by Ang-(1-7), which was accompanied by decreased pro-inflammatory factors, IL6, M-CSF, leptin and others, in the db/db BM-supernatants. Ang-(1-7) increased Bacteroidetes over Firmicutes with abundance of Lactobacillaceae and Akkermansiaceae in the db/db gut microbiota, and decreased the plasma levels of TMAO and LBP in the plasma. The study provides compelling evidence for the pharmacological potential of Ang-(1-7) in ameliorating diabetic disruption of colon barrier integrity and inflammation by restoring the regenerative ISCs and by reversing myelopoiesis.

PRDX6
Also flagged:male infertilityvaricoceleselenoprotein PGPX3ThioredoxinTXN
Journal Article 2025-07-15 ✓ 2 Snippets Milardi D, Vergani E, Mancini F, Di Nicuolo F, Teveroni E, Vodola EP, Oliva A, Grande G, Cina A, Iezzi R, Cicchinelli M, Iavarone F, Baroni S, Ferlin A, Urbani A, Pontecorvi A.
In-Text Gene Mentions

…PRDX1, PRDX3 andPRDX6.…

…with PRDX1 andPRDX6, were validated by…

Show Full Abstract

<h4>Background</h4>Varicocele is a common condition involving the dilation of veins in the scrotum, often linked to male infertility and testicular dysfunction. This study aimed to elucidate the molecular effects of successful varicocele treatment on sperm proteomes following percutaneous sclero-embolization.<h4>Methods</h4>High-resolution tandem mass spectrometry was performed for proteomic profiling of pooled sperm lysates from five patients exhibiting improved semen parameters before and after (3 and 6 months) varicocele sclero-embolization. Data were validated by Western blot analysis.<h4>Results</h4>Seven proteins were found exclusively in varicocele patients before surgery-such as stathmin, IFT20, selenide, and ADAM21-linked to inflammation and oxidative stress. After sclero-embolization, 55 new proteins emerged, including antioxidant enzymes like selenoprotein P and GPX3. Thioredoxin (TXN) and peroxiredoxin (PRDX3) were upregulated, indicating restoration of key antioxidant pathways. Additionally, the downregulation of some histones and the autophagy-related protein ATG9A suggests a shift toward an improved chromatin organization and a healthier cellular environment post-treatment.<h4>Conclusions</h4>Varicocele treatment that improves sperm quality and fertility parameters leads to significant proteome modulation. These changes include reduced oxidative stress and broadly restored sperm maturation. Despite the limited patient cohort analyzed, these preliminary findings provide valuable insights into how varicocele treatment might enhance male fertility and suggest potential biomarkers for improved male infertility treatment strategies.

Also flagged:PathogenesisAutoimmunitySLEautoantibodiesBAFFB cell activating factor
Journal Article 2025-07-15 No Snippets Shiozawa S.
Show Full Abstract

SLE is characterized by the generation of a variety of autoantibodies including anti-dsDNA autoantibodies, causing damage in various organs. If autoimmunity is defined by the generation of a variety of autoantibodies against the self, SLE is the only disease to qualify. Identification of the SLE-causing factor must fulfill the following criteria: (i) the factor induces SLE, (ii) the factor is operating in active SLE and (iii) SLE heals after removal of the factor. All candidate factors are reviewed from this viewpoint in this review. As to the cause of SLE, high levels of interferon α can induce SLE; however, interferon α in most patients did not reach this high level. BAFF (B cell activating factor of the TNF family) is increased in SLE. BAFF itself induced some manifestation of SLE, whereas removal of interferon α or BAFF by an antibody (Ab) did not heal SLE. BXSB male mice with a duplicated <i>TLR7</i> gene develop SLE; however, the gene <i>Sle1</i> is also required for the development of SLE. In addition, <i>sanroque</i> mice develop a variety of autoantibodies and SLE; the <i>sanroque</i> mutation, which disrupts one of the repressors of ICOS, results in increased CCR7<sup>lo</sup> CXCR5<sup>+</sup>Tfh cells, IL-21 and SLE. ICOS<sup>+</sup>T follicular helper (Tfh) cells increase in SLE and SLE-model (NZBxNZW)F1 mice, and the blockade of Tfh development ameliorated SLE, indicating the importance of Tfh cells in the pathogenesis of SLE. Self-organized criticality theory shows that SLE is caused by repeated infection, wherein SLE-inducing pathogens can vary individually depending on one's HLA; however, the pathogen presented on HLA stimulates the T cell receptor (TCR) strongly beyond self-organized criticality. This stimulation generates TCR-revised, autoreactive DOCK8<sup>+</sup>Tfh cells, which induced a variety of autoantibodies and SLE. The SARS-CoV-2 virus is an example pathogen because SLE occurs after SARS-CoV-2 infection and vaccination. DOCK8<sup>+</sup>Tfh cells and SLE decreased after conventional or anti-DOCK Ab therapies. Thus, DOCK8<sup>+</sup>Tfh cells newly generated after repeated infection fulfill the criteria (i), (ii) and (iii) as the cause of SLE.

Also flagged:deathcoronary artery diseasecerebrovascular diseaseCDperipheral artery diseasePAD
Journal Article 2025-07-15 No Snippets Król M, Kupnicka P, Żychowska J, Kapczuk P, Szućko-Kociuba I, Prajwos E, Chlubek D.
Show Full Abstract

Cardiovascular diseases (CVDs) are the leading cause of global mortality, with type 2 diabetes mellitus (T2DM) and obesity significantly increasing the risk of CVD. Glucagon-like peptide-1 receptor agonists (GLP-1 RAs) and dipeptidyl peptidase-4 inhibitors (DPP-4is) have gained attention for their potential cardioprotective effects. Therefore, this review aims to explore the molecular mechanisms underlying the cardiovascular benefits of these agents. A literature review was conducted searching PubMed databases from 1990 to January 2025, including research on the effects of GLP-1 RA and DPP-4i on cardiovascular health, specifically concerning atherosclerosis, coronary artery disease, vascular health, cardiac arrhythmias, myocardial infarction (MI), and heart failure, with a focus on the biochemical and molecular effects of these drugs. We analyzed 131 scientific publications, which indicate that GLP-1 RA and DPP-4i significantly reduce cardiovascular risk and major adverse cardiovascular events (MACEs), including atherosclerosis, myocardial infarction, and cardiac arrhythmias. These clinical outcomes are attributed to the mitigation of oxidative stress, inflammation, and endothelial dysfunction as well as improvement in mitochondrial function and lipid metabolism. GLP-1 RAs offer substantial cardiovascular benefits, making them valuable in managing T2DM and reducing CVD risk. Their integration into treatment regimens for CVD can reduce hospitalization rates, improve quality of life, and extend life expectancy. DPP-4is, while beneficial, are less effective in cardiovascular protection. Further research is needed to optimize therapeutic strategies and broaden the clinical application of these agents in cardiometabolic care.

HTT
Also flagged:HDtranslationalsleepautosomal dominant neurodegenerative disorderchromosomedeath
Journal Article 2025-07-15 ✓ 1 Snippet Chmiel J, Nadobnik J, Smerdel S, Niedzielska M.
In-Text Gene Mentions

…in the huntingtin (HTT) gene on chromosome…

Show Full Abstract

<b>Introduction</b>: Huntington's disease (HD) disrupts cortico-striato-thalamocortical circuits decades before clinical onset. Electroencephalography (EEG) offers millisecond temporal resolution, low cost, and broad accessibility, yet its mechanistic and biomarker potential in HD remains underexplored. We conducted a mechanistic review to synthesize half a century of EEG findings, identify reproducible electrophysiological signatures, and outline translational next steps. <b>Methods</b>: Two independent reviewers searched PubMed, Scopus, Google Scholar, ResearchGate, and the Cochrane Library (January 1970-April 2025) using the terms "EEG" OR "electroencephalography" AND "Huntington's disease". Clinical trials published in English that reported raw EEG (not ERP-only) in human HD gene carriers were eligible. Abstract/title screening, full-text appraisal, and cross-reference mining yielded 22 studies (~700 HD recordings, ~600 controls). We extracted sample characteristics, acquisition protocols, spectral/connectivity metrics, and neuroclinical correlations. <b>Results</b>: Across diverse platforms, a consistent spectral trajectory emerged: (i) presymptomatic carriers show a focal 7-9 Hz (low-alpha) power loss that scales with CAG repeat length; (ii) early-manifest patients exhibit widespread alpha attenuation, delta-theta excess, and a flattened anterior-posterior gradient; (iii) advanced disease is characterized by global slow-wave dominance and low-voltage tracings. Source-resolved studies reveal early alpha hypocoherence and progressive delta/high-beta hypersynchrony, microstate shifts (A/B ↑, C/D ↓), and rising omega complexity. These electrophysiological changes correlate with motor burden, cognitive slowing, sleep fragmentation, and neurovascular uncoupling, and achieve 80-90% diagnostic accuracy in shallow machine-learning pipelines. <b>Conclusions</b>: EEG offers a coherent, stage-sensitive window on HD pathophysiology-from early thalamocortical disinhibition to late network fragmentation-and fulfills key biomarker criteria. Translation now depends on large, longitudinal, multi-center cohorts with harmonized high-density protocols, rigorous artifact control, and linkage to clinical milestones. Such infrastructure will enable the qualification of alpha-band restoration, delta-band hypersynchrony, and neurovascular coupling as pharmacodynamic readouts, fostering precision monitoring and network-targeted therapy in Huntington's disease.

Also flagged:Matrix Metalloproteinase-2PeptidetumorMMP-2breast cancerpaclitaxel
Journal Article 2025-07-15 No Snippets Zhao X, Li Y.
Show Full Abstract

<b>Background/Objectives</b>: PEGylated liposomes are widely recognized for their biocompatibility and capacity to extend systemic circulation via "stealth" properties. However, the PEG corona often limits tumor penetration and cellular internalization. Targeting matrix metalloproteinase-2 (MMP-2), frequently upregulated in breast cancer stroma, presents an opportunity to enhance tissue-specific drug delivery. In this study, we engineered MMP-2-responsive GPLGVRG peptide-modified cleavable PEGylated liposomes for targeted paclitaxel (PTX) delivery. <b>Methods</b>: Molecular docking simulations employed the MMP-2 crystal structure (PDB ID: 7XJO) to assess GPLGVRG peptide binding affinity. A cleavable, enzyme-sensitive peptide-PEG conjugate (Chol-PEG<sub>2K</sub>-GPLGVRG-PEG<sub>5K</sub>) was synthesized via small-molecule liquid-phase synthesis and characterized by <sup>1</sup>H NMR and MALDI-TOF MS. Liposomes incorporating this conjugate (S-Peps-PEG<sub>5K</sub>) were formulated to evaluate whether MMP-2-mediated peptide degradation triggers detachment of long-chain PEG moieties, thereby enhancing internalization by 4T1 breast cancer cells. Additionally, the effects of tumor microenvironmental pH (~6.5) and MMP-2 concentration on drug release dynamics were investigated. <b>Results</b>: Molecular docking revealed robust GPLGVRG-MMP-2 interactions, yielding a binding energy of -7.1 kcal/mol. The peptide formed hydrogen bonds with MMP-2 residues Tyr A:23 and Arg A:53 (bond lengths: 2.4-2.5 Å) and engaged in hydrophobic contacts, confirming MMP-2 as the primary recognition site. Formulations containing 5 mol% Chol-PEG<sub>2K</sub>-GPLGVRG-PEG<sub>5K</sub> combined with 0.15 µg/mL MMP-2 (S-Peps-PEG<sub>5K</sub> +MMP) exhibited superior internalization efficiency and significantly reduced clonogenic survival compared to controls. Notably, acidic pH (~6.5) induced MMP-2-mediated cleavage of the GPLGVRG peptide, accelerating S-Peps-PEG<sub>5K</sub> dissociation and facilitating drug release. <b>Conclusions</b>: MMP-2-responsive, cleavable PEGylated liposomes markedly improve PTX accumulation and controlled release at tumor sites by dynamically modulating their stealth properties, offering a promising strategy to enhance chemotherapy efficacy in breast cancer.

HTT
Also flagged:mitochondrialagingphosphorylationoxygenprotein synthesisdegradation
Journal Article 2025-07-15 ✓ 1 Snippet Sen MK, Dunville K, Miles N, Newbery M, Ng NS, Ooi L.
In-Text Gene Mentions

…Parkinson's disease, mutantHttin Huntington's disease…

Show Full Abstract

No abstract available.

Also flagged:chondroitinsulfatemanganeseMusculoskeletal diseasesGlycosaminoglycansbone disorders
Journal Article 2025-07-15 No Snippets Muñoz JA, Martins TDS, Garbossa PLM, Pimentel LBF, Barbalho CB, da Silva MM, de Arruda AF, Baraldi-Artoni SM, Araújo CSDS, Pereira ASC.
Show Full Abstract

Musculoskeletal disorders in broiler chickens are often related to immature connective tissue. This study aimed to evaluate the effects of dietary supplementation with chondroitin sulfate (CS) and manganese (Mn) on performance, bone quality, and the optimal CS:Mn ratio for skeletal development in broilers. A total of 1152 male Cobb chicks were reared for 47 days in a completely randomized 4 × 3 factorial design comprising four CS levels (0.00, 0.06, 0.12, and 0.18 % w/w) and three Mn levels (0, 40, and 80 mg/kg), resulting in 12 treatments with eight replicates of 12 birds each. Supplementation with CS and Mn did not affect (<i>P</i> > 0.10) feed intake, body weight, weight gain, bone mineral content, bone mineral density, phosphorus and manganese levels, ash content, absolute bone weight, or diaphyseal perimeter of the tibiotarsus. A significant interaction between CS and Mn levels was observed for feed conversion (FC), which increased linearly with Mn inclusion in diets lacking CS (<i>P</i> = 0.003). In diets without Mn, CS levels exhibited a quadratic effect on FC (<i>P</i> <i>=</i> 0.003). Flock viability and productive efficiency index increased linearly with increasing CS inclusion. A significant CS × Mn interaction was also observed for maximum bone breaking strength, with a linear decrease with increasing Mn in diets containing 0.12 % CS (<i>P</i> <i>=</i> 0.019). CS had a quadratic effect on the Seedor index, bone area, and morphometric traits of the proximal and distal tibiotarsus, with 0.06-0.12 % CS yielding optimal outcomes. Mn supplementation showed quadratic effects on bone area (<i>P</i> <i>=</i> 0.09) and calcium content (<i>P</i> <i>=</i> 0.005), with peak values at 40 mg Mn/kg. The results suggest that supplementation with CS and the inclusion of 40 mg Mn/kg in broiler diets could be used as a nutritional strategy to improve tibiotarsal bone quality, particularly morphometric attributes, calcium content, and breaking strength. Furthermore, CS supplementation may contribute to reducing mortality and improving productivity metrics in broilers.

TRIM38
Also flagged:NUDCD3intermediateKelch-likeKLHLKLHL16Giant Axonal Neuropathy
Journal Article 2025-07-15 ✓ 1 Snippet Phillips CL, So C, Gillis MF, Harrison J, Hsu CH, Armao D, Snider NT.
In-Text Gene Mentions

TRIM38

Show Full Abstract

Gigaxonin is an intermediate filament (IF)-interacting partner belonging to the Kelch-like (KLHL) protein family. Gigaxonin is encoded by the KLHL16 gene, which is mutated in Giant Axonal Neuropathy (GAN). The lack of functional gigaxonin in GAN patient cells impairs IF proteostasis by affecting IF protein degradation and transport. This leads to focal abnormal accumulations of IFs and compromised cellular function, with neurons being most severely impacted. We hypothesized that gigaxonin forms molecular interactions via specific sequence motifs to regulate IF proteostasis. The goal of this study was to examine how distinct Kelch motifs on gigaxonin regulate IF protein degradation and filament morphology. We analyzed vimentin IFs in HEK293 cells overexpressing wild type (WT) gigaxonin, or gigaxonin lacking each of the six individual Kelch motifs, K1-K6. All six gigaxonin deletion mutants (ΔK1-ΔK6) promoted the degradation of soluble vimentin. Compared to WT-gigaxonin, ΔK3-gigaxonin exhibited increased soluble vimentin degradation and increased presence of thick bundles of vimentin IFs. The ΔK4 mutant showed similar, but milder phenotypes compared to ΔK3. Using mass spectrometry proteomics we found that, relative to WT gigaxonin, ΔK3 gigaxonin had increased associations with ubiquitination-associated and mitochondrial proteins but lost the association with the NudC domain-containing protein 3 (NUDCD3), a molecular chaperone enriched in the nervous system. AlphaFold modeling revealed loss of gigaxonin-NUDCD3 binding with ΔK3 and altered binding with ΔK4. Collectively, our cell biological data show the induction of an abnormal GAN-like IF phenotype in cells expressing ΔK3- and, to a lesser extent, ΔK4-gigaxonin, while our proteomic profiling links the loss of gigaxonin-NUDCD3 interactions with defective IF proteostasis.

HFE
Also flagged:PorphyriaPorphyria cutanea tardaporphyrinskin fragilityprimary Sjögren syndromehydroxychloroquine
Journal Article 2025-07-15 ✓ 5 Snippets Baltazar AM, Savka L, Carreira NR.
In-Text Gene Mentions

…heterozygosity for theHFEH63D mutation who…

…iron overload (includinghemochromatosis) - excess iron…

…mutations in theHFEgene, which is…

…shown that theHFEH63D and C282Y…

…who carries theHFEH63D mutation, has…

Show Full Abstract

Porphyria cutanea tarda (PCT) is a disorder characterized by porphyrin accumulation leading to photosensitivity and skin fragility, often triggered by a combination of genetic, autoimmune, and environmental factors. This case describes a 39-year-old woman with primary Sjögren syndrome (pSS) and heterozygosity for the HFE H63D mutation who developed PCT following hydroxychloroquine (HCQ) therapy. Initial symptoms included xerostomia, fatigue, and skin lesions. Laboratory tests showed liver enzyme elevation, leukopenia, hyperferritinemia, and positive anti-SSA/SSB antibodies. Hydroxychloroquine-induced hepatotoxicity prompted treatment discontinuation, and porphyrin analysis confirmed PCT. Despite the absence of UROD gene mutations, the interplay between pSS, iron overload, and medication exposure supported a diagnosis of sporadic PCT. The patient was successfully managed with low-dose HCQ for porphyrin clearance and azathioprine for autoimmune disease control. This case highlights the importance of recognizing multifactorial contributors in PCT and tailoring treatment accordingly to avoid complications.

TNFSF4
Also flagged:sepsisdeathinfectioninflammatory responsespattern recognition receptorscoagulation
Journal Article 2025-07-15 ✓ 1 Snippet Wu D, Zhang H, Miao C.
In-Text Gene Mentions

…the ligand OX40L (TNFSF4/CD252), supporting T cell…

Show Full Abstract

Sepsis poses a critical threat to global health, mainly due to the disruption of immune homeostasis, which critically influences both early death and long-term adverse outcomes. Current evidence shows that regulatory T (Treg) cells-key mediators of adaptive immunity-play an essential role in maintaining immunological balance during sepsis progression. During the initial hyperinflammatory phase, Treg cells actively suppress excessive inflammation, reducing tissue damage. Paradoxically, in the subsequent immunosuppressive phase, expanded Treg populations may exacerbate immunosuppression by inhibiting effector cell function, ultimately leading to poorer clinical outcomes. Recent research has identified novel Treg-specific biomarkers in sepsis and explained how the septic environment affects Treg cell numbers and function through various signaling pathways. This review combines current understanding of the phenotypic features and roles of Treg cells in sepsis, examines the regulatory mechanisms controlling Treg dynamics within the inflammatory setting, and explores therapeutic strategies targeting Treg cells across different immune phases, emphasizing both existing challenges and future directions.

Also flagged:SF3B1cancer
Journal Article 2025-07-15 No Snippets Xue M, An J, Hu E, Deng W, Yin S.
Show Full Abstract

No abstract available.

Research Square 2025-07-15 Preprint (No Snippets API) Heissmeyer V, Wong E, Cantini G, Behrens G, Raj T, Ito-Kureha T, Moyon L, Xin C, Hoefig K, Xu M, Kifinger L, Negraschus A, Kronbeck N, Tkacheva E, Monticelli S, Schor J, Csaba G, Zimmer R, Lyszkiewicz M, Marsico A.
Show Full Abstract

<title>Abstract</title> <p>Defining the RNA targets of ROQUIN-1 is essential for understanding post-transcriptional gene regulation in immunity, autoimmunity, and cancer immunotherapy. We systematically mapped transcriptome-wide ROQUIN-1/RNA interactions in mouse and human lymphocytes. Novel targets were enriched in signaling molecules, transcription factors, epigenetic regulators, and mediators of immune cell differentiation. Cross-species analysis revealed conservation at binding sites, suggesting evolutionary preservation of ROQUIN-mediated regulation. Notably, ROQUIN-1 bound all mRNAs of the Id1–Id4 gene family—transcriptional regulators critical for lymphocyte differentiation. Functional perturbation through Id1-3 overexpression impaired thymocyte and B cell development. Similarly, inactivation of Roquin-1/2 increased Id3 expression in thymocytes and developing B cells, delayed double-negative thymocyte progression and blocked B cell development before the pro-B cell stage. Uncovering Roquin's role in controlling gene expression driving lymphocyte development, our dataset also provides a valuable resource for functional genomics to dissect RNA-based regulation in immunity and offers mechanistic insights into ROQUIN function across species.</p>

CACNA1E
Also flagged:intracranial aneurysmsaneurysmspathogenesiscancerintracranial aneurysmERK
Journal Article 2025-07-14 ✓ 1 Snippet McAvoy M, Ratner B, Ferreira MJ, Levitt MR.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Treatment of intracranial aneurysms is currently limited to invasive surgical and endovascular modalities, and some aneurysms are not treatable with these methods. Identification and targeting of specific molecular pathways involved in the pathogenesis of aneurysms may improve outcomes. Low frequency somatic variants found in cancer related genes have been linked to intracranial aneurysm development. In particular, mutations in the <i>PDGFRB</i> gene lead to constitutively activated ERK and nuclear factor κB signaling pathways, which can be targeted with tyrosine kinase inhibitors. In this review, we describe how low frequency somatic variants in oncogenic and other genes affect the pathogenesis of aneurysm development, with a focus on gene therapy applications, such as endovascular in situ delivery of chemotherapeutics.

DCC
Also flagged:dopaminedelta 9-tetrahydrocannabinolaxonsNetrin-1 receptorinnervationdelta 9 – tetrahydrocannabinol
Journal Article 2025-07-14 ✓ 5 Snippets Capolicchio T, Hernandez G, Shi SSW, Dube E, Estrada K, Giroux M, Nieman BJ, Pausova Z, Flores C.
In-Text Gene Mentions

…the Netrin-1 receptor,DCC, which is regulated…

…impact of decreasedDccon dopamine development.…

…THC dysregulates the miR-218/DCCpathway, prompting mistargetin…

DCC

DCC receptor

Show Full Abstract

The increasing exposure to delta 9-tetrahydrocannabinol (THC) in youth sparks concerns about disruption of ongoing neurodevelopment. During adolescence, dopamine axons continue to grow from the striatum to the prefrontal cortex, promoting the refinement of inhibitory control. This process is coordinated by the Netrin-1 receptor, DCC, which is regulated by microRNA miR-218. In addition, microglial actions significantly influence adolescent cortical refinement. Here, we show that THC in adolescent mice has sex-specific effects on dopamine innervation in the adult prefrontal cortex. While females show no changes, in males, THC leads to a reduction in the volume occupied by dopamine axons in the medial prefrontal cortex and a decrease in the density of their presynaptic sites. However, it increases dopamine innervation in the orbitofrontal cortex. Assessment of the effects of THC in adolescence on impulse control in adulthood, using the Go-No/Go task, revealed male-specific alterations - THC increased premature responding but reduced the number of commission errors. Molecular analysis showed that, one week after adolescent THC, males display increased Dcc and decreased miR-218 levels. In contrast, females exhibit decreased Dcc levels without changes in miR-218. Furthermore, in the medial prefrontal cortex, females show smaller microglia soma size, potentially mitigating the impact of decreased Dcc on dopamine development. These findings suggest that in adolescent males, THC dysregulates the miR-218/DCC pathway, prompting mistargeting of dopamine axons and diverting their growth from medial to orbitofrontal regions. This work highlights the sex-specific impact of adolescent THC on dopamine and impulse control development and uncovers potential divergent molecular and epigenetic processes.

Also flagged:health disordersaggressionhistone deacetylasebehavioralinnervationvasopressin
Journal Article 2025-07-14 No Snippets Moran KM, Milewski TM, Curley JP, Delville Y.
Show Full Abstract

In Golden hamsters (Mesocricetus auratus), a two-week exposure to chronic social stress in adolescence causes acceleration of agonistic behavior, enhanced adult aggression, impaired waiting impulsivity, and higher food intake, body fat, and long-term increased body weight. In adult rodents, stress is accompanied by widespread alterations in gene expression in the brain. As stress is a potent modulator of both gene expression and behavior, the present research investigated possible mechanistic-related transcriptomic changes in the lateral, dorsomedial, and arcuate nucleus of the hypothalamus caused by adolescent stress using RNA Tag-sequencing, as these areas are involved in the regulation of metabolic and motivated behaviors. In each region, there were approximately 250 genes with higher expression compared to controls and 250 genes with lower expression. Many of the most significantly affected genes have been associated with metabolism and sex hormone function. For example, in the lateral hypothalamus, melanocortin 3 receptor, growth hormone releasing factor, both involved in metabolic processes, and neuropeptide VF precursor, involved in growth hormone inhibitory hormone production, were among the most increased in expression in stressed subjects. In the dorsomedial hypothalamus, neuropeptide W, involved in feeding cessation, was significantly decreased in expression in stressed animals. Across both regions, G-protein coupled receptor 50, involved in thermoregulation, sleep, and sex-related mood disorders, was significantly altered, but in opposite directions. In the arcuate nucleus, a number of blood brain barrier- and inflammation-related genes were altered as well. Furthermore, there were consistent patterns of genetic ensembles identified through gene ontology analysis and weighted gene correlation network analysis that were altered across each region. Many of these involved roles in RNA processing, DNA methylation, myelination, and synaptic organization. These findings reinforce prior behavioral, hormonal, and metabolic changes observed in this developmental model, and help guide future directions of research related to the negative consequences of early life stress.

Also flagged:Rab3GTP-binding proteinsRab3aRab3bRab3cRab3d
Journal Article 2025-07-14 No Snippets He H, Ai R, Fang EF, Palikaras K.
Show Full Abstract

The Rab3 protein family is composed of a series of small GTP-binding proteins, including Rab3a, Rab3b, Rab3c, and Rab3d, termed Rab3s. They play crucial roles in health, including in brain function, such as through the regulation of synaptic transmission and neuronal activities. In the high-energy-demanding and high-traffic neurons, the Rab3s regulate essential cellular processes, including trafficking of synaptic vesicles and lysosomal positioning, which are pivotal for the maintenance of synaptic integrity and neuronal physiology. Emerging findings suggest that alterations in Rab3s expression are associated with age-related neurodegenerative pathologies, including Alzheimer's disease, Parkinson's disease, and Huntington's disease, among others. Here, we provide an overview of how Rab3s dysregulation disrupts neuronal homeostasis, contributing to impaired autophagy, synaptic dysfunction, and eventually leading to neuronal death. We highlight emerging questions on how Rab3s safeguards the brain and how their dysfunction contributes to the different neurodegenerative diseases. We propose fine-tuning the Rab3s signaling directly or indirectly, such as via targeting their upstream protein AMPK, holding therapeutic potential.

Also flagged:pegolage-related macular degenerationpolyneuropathytransthyretinamyloidosisSARS-CoV-2 infections
Journal Article 2025-07-14 No Snippets Wang S, Weissman D, Dong Y.
Show Full Abstract

RNA-based therapeutics have made substantial clinical advances, primarily due to the unique chemical and biological profiles of RNA molecules. As evidenced by the approval of various RNA drugs, some initial challenges related to RNA-based therapeutics, including issues associated with large-scale production, effective delivery and immunogenicity properties, are now being addressed. Extensive efforts have focused on chemically modifying RNA molecules to enhance their stability, increase protein production, extend circulation time and improve target specificity. Three RNA categories - small RNA, translatable RNA and CRISPR guide RNA - are now being extensively developed for therapeutic applications. This Review summarizes the synthetic methods applied to these three RNA categories, describes key chemical modification strategies being used to enhance their properties and highlights current therapeutic applications and future opportunities.

Also flagged:paraformaldehydesucroseRNAseacetateTritondiethyl
Journal Article 2025-07-14 No Snippets Kim J, Poddar A, Sandoval K, Chu J, Horton E, Cui D, Nakamura K, Lu IL, Mui M, Bartels T, Wood CM, Ramos SI, Rowitch DH, Tsankova NM, Kim H, Sherwood CC, Kramer BW, Roberts AC, Ross PJ, Xu D, Robertson NJ, Maga EA, Ji P, Paredes MF.
Show Full Abstract

Cortical GABAergic interneurons generated in the ventral developing brain travel long distances to their final destinations. While there are examples of interneuron migration in the neonatal human brain, the extent of postnatal migration across species and how it contributes to cortical interneuron composition remains unknown. Here we demonstrate that neonatal gyrencephalic brains, including humans, nonhuman primates and piglets, harbor an elaborate subventricular zone, termed the Arc, due to its curved morphology and expanded neuroblast populations. The Arc is absent in lissencephalic marmoset and mouse brains. Transcriptomic and histological approaches revealed that Arc neurons are diverse interneurons from the medial and caudal ganglionic eminences that migrate into the frontal, cingulate and temporal cortex. Arc-cortical targets exhibit an increase in VIP<sup>+</sup> neuronal density compared to other regions. Our findings reveal that the Arc is a developmental structure that supports the expansion of postnatal neuronal migration for cortical interneuron patterning in gyrencephalic brains.

SOX6
Also flagged:BMP4TGF-βpenicillinstreptomycintrypsinphenol red
Journal Article 2025-07-14 ✓ 1 Snippet Hu W, Sancho-Serra C, Gantner CW, Szafranska HM, Solanky N, Metcalfe K, Vento-Tormo R, Zernicka-Goetz M.
In-Text Gene Mentions

…, HAND2 andSOX6were highly expressed…

Show Full Abstract

The amnion is a critical extra-embryonic structure that supports foetal development, yet its ontogeny remains poorly defined. Here, using single-cell transcriptomics, we identified major cell types and subtypes in the human amnion across the first trimester of pregnancy, broadly categorized into epithelial, mesenchymal and macrophage lineages. We uncovered epithelial-mesenchymal and epithelial-immune transitions, highlighting dynamic remodelling during early pregnancy. Our results further revealed key intercellular communication pathways, including BMP4 signalling from mesenchymal to epithelial cells and TGF-β signalling from macrophages to mesenchymal cells, suggesting coordinated interactions that drive amnion morphogenesis. In addition, integrative comparisons across humans, non-human primates and in vitro stem cell-based models reveal that stem cell-based models recapitulate various stages of amnion development, emphasizing the need for careful selection of model systems to accurately recapitulate in vivo amnion formation. Collectively, our findings provide a detailed view of amnion cellular composition and interactions, advancing our understanding of its developmental role and regenerative potential.

Also flagged:waterLgr5mitochondrialethanolmitochondriadimethyl
Journal Article 2025-07-14 No Snippets Andersson S, Bui H, Viitanen A, Borshagovski D, Salminen E, Kilpinen S, Gebhart A, Kuuluvainen E, Gopalakrishnan S, Peltokangas N, James M, Achim K, Jokitalo E, Auvinen P, Hietakangas V, Katajisto P.
Show Full Abstract

Cellular metabolism is a key regulator of cell fate<sup>1</sup>, raising the possibility that the recently discovered metabolic heterogeneity between newly synthesized and chronologically old organelles may affect stem cell fate in tissues<sup>2,3</sup>. In the small intestine, intestinal stem cells (ISCs)<sup>4</sup> produce metabolically distinct progeny<sup>5</sup>, including their Paneth cell (PC) niche<sup>6</sup>. Here we show that asymmetric cell division of mouse ISCs generates a subset enriched for old mitochondria (ISC<sup>mito-O</sup>), which are metabolically distinct, and form organoids independently of niche because of their ability to recreate the PC niche. ISC<sup>mito-O</sup> mitochondria produce more α-ketoglutarate, driving ten-eleven translocation-mediated epigenetic changes that promote PC formation. In vivo α-ketoglutarate supplementation enhanced PC turnover and niche renewal, aiding recovery from chemotherapy-induced damage in aged mice. Our results reveal a subpopulation of ISCs whose old mitochondria metabolically regulate cell fate, and provide proof of principle for metabolically promoted replacement of specific aged cell types in vivo.

Also flagged:prostate cancerPCacancertumorPPATASC
Journal Article 2025-07-14 No Snippets Sacca PA, Calvo JC.
Show Full Abstract

Prostate cancer (PCa) is the most prevalent cancer among men, highlighting the urgent need for innovative treatment strategies. The periprostatic adipose tissue (PPAT) plays a crucial role in the PCa tumor microenvironment, with direct crosstalk between PPAT and PCa cells, particularly in advanced stages with extraprostatic extension-a feature linked to poor prognosis. Owing to their migratory capacity, adipose stem cells (ASCs) are promising in regenerative medicine and play a key role in tissue engineering and cancer research. These findings offer potential for novel approaches in targeted drug delivery and gene therapy for PCa. While ASCs within PPAT influence the tumor stroma, the mechanisms behind their interactions with PCa cells are not fully understood, with studies reporting both inhibitory and promoting effects on cancer progression. The adipose tissue secretome, including PPAT-ASC exosomal proteins, mediates communication between PPAT and PCa cells, with exosomal dysregulation observed in stage T3 PCa. This dysregulation implicates key cancer pathways such as integrin-mediated cell interactions, epithelialmesenchymal transition, and mRNA stability regulation. Although ASCs show promise as therapeutic carriers, their use is complicated by the need to prevent unwanted interactions with cancer cells. Moreover, environmental contaminants such as endocrine disruptors can alter ASC behavior, potentially influencing PCa development. This review synthesizes current knowledge on the multifaceted roles of ASCs and ASC-derived exosomes in PCa biology, their therapeutic applications, and the impact of environmental toxicants on their function and cancer-related outcomes. Further research into the underlying biological mechanisms is needed, highlighting the need for safe, targeted therapeutic approaches in PCa treatment.

MLLT10
Also flagged:MED12chromatinhematopoiesishematological malignanciesacute myeloid leukemiaAML
Journal Article 2025-07-14 ✓ 1 Snippet Chavan A, Jones C, Lawrence W, Choudhury SR.
In-Text Gene Mentions

…n = 93), KMT2A–MLLT10( n =…

Show Full Abstract

<h4>Background</h4>MED12 is a key regulator of transcription and chromatin architecture, essential for normal hematopoiesis. While its dysregulation has been implicated in hematological malignancies, the mechanisms driving its upregulation in acute myeloid leukemia (AML) remain poorly understood. We investigated MED12 expression across AML subgroups by integrating chromatin accessibility profiling, histone modification landscapes, and DNA methylation (DNAm) patterns. Functional assays using DNMT inhibition were performed to dissect the underlying regulatory mechanisms.<h4>Results</h4>MED12 shows subtype-specific upregulation in AML compared to hematopoietic stem and progenitor cells, independent of somatic mutations. Chromatin accessibility profiling reveals that the MED12 locus is epigenetically primed in AML blasts, with increased DNase hypersensitivity at regulatory elements. Histone modification analysis demonstrates strong H3K4me3 and H3K27ac enrichment around the transcription start site (TSS), consistent with promoter activation, while upstream and intragenic regions exhibit enhancer-associated marks (H3K4me1, H3K27ac). Notably, hypermethylation within TSS-proximal regulatory regions (TPRRs)-including promoter-overlapping and adjacent CpG islands-correlates with ectopic MED12 overexpression, challenging the canonical view of DNAm as strictly repressive. Functional studies show that DNMT inhibition via 5-azacytidine reduces MED12 expression despite promoter demethylation in cells with hypermethylated TPRRs, suggesting a noncanonical role for DNA methylation in maintaining active transcription. Furthermore, MED12 expression positively correlates with DNMT3A and DNMT3B expression, implicating these methyltransferases in sustaining its epigenetic activation.<h4>Conclusion</h4>This study identifies a novel regulatory axis in which aberrant DNA methylation, rather than genetic mutation, drives MED12 upregulation in AML. Our findings suggest that TPRR hypermethylation may function noncanonically to support transcriptional activation, likely in cooperation with enhancer elements. These results underscore the importance of epigenetic mechanisms in AML and highlight enhancer-linked methylation as a potential contributor to oncogene dysregulation. Future studies should further explore the role of noncanonical methylation-mediated gene activation in AML pathogenesis and therapeutic targeting.

NEGR1
Also flagged:-nucleuscytoplasmicELF1photoreceptorsvision
Journal Article 2025-07-14 ✓ 2 Snippets Yang L, Tao Y, Pan Q, Cai T, Ye Y, Liu J, Zhou Y, Shao Y, Yi Q, Lu ZH, Chen L, McKay G, Rankin R, Meng W.
In-Text Gene Mentions

…in mlCones) andNEGR1-NEGR1 interactions (prob =…

…in mlCones) and NEGR1-NEGR1interactions (prob =…

Show Full Abstract

<h4>Background</h4>Current human retina studies predominantly utilize post-mortem tissue, and the sample accessibility constraints make the characterization of the living human retina at single-cell resolution a challenge. Although single-nucleus RNA-seq expands the utility of frozen samples, it provides a nuclear-centric view, potentially missing key cytoplasmic information and transient biological processes. Thus, it is important to generate resources directly from living human retinal tissue to complement existing datasets.<h4>Methods</h4>We profiled 106,829 single cells from nine unfrozen human retina samples. Living samples were collected within 10 min of therapeutic enucleation and four postmortem samples were collected within 6 h. After standardized dissociation, single-cell transcriptomes were generated using 10x Genomics 3' RNA-seq and applied scVI to generate batch-corrected integrated atlas. Major cell types and subtypes were annotated through iterative Leiden clustering, canonical markers. Subsequent analyses included differential expression comparisons between cell states and regulon activity profiling to further characterize cellular identities and regulatory networks. Transcriptional dynamics were assessed using RNA velocity, and cell-cell signaling pathways were inferred with CellChat. Key findings were validated in independent samples from two additional donors (four samples) using the identical workflow.<h4>Results</h4>We contribute to establishing a reference for retinal cell type proportions and cellular states. Our analysis revealed ELF1-mlCone, a distinct cluster of mlCone photoreceptors identified by distinct transcriptional features. The presence and transcriptional features of this cluster were validated in independent samples. Additionally, by comparing living and post-mortem samples, our study highlights differences in transcriptional dynamics: living tissue preserved coherent RNA velocity streams, enabling clear dynamic state transitions, while post-mortem tissue exhibited disorganized patterns. These findings suggest that using living tissue can improve the capture of active cellular states and transitions.<h4>Conclusions</h4>Our atlas provides a single-cell reference contrasting living versus early postmortem human retina, integrating cell type composition, transcriptional diversity, and functional insights. It may serve as a useful resource for retinal research and for understanding aspects of human retinal biology, particularly given its inclusion of living tissue and diverse pathological states.

HFE
Also flagged:erythropoietin receptormyelodysplastic syndromeroxadustatacute leukemiathyroid dysfunctionhematopoietic stem cell disorders
Journal Article 2025-07-14 ✓ 1 Snippet Ikenoue T, Furumatsu Y, Kitamura T.
In-Text Gene Mentions

…heart failure, secondaryhemochromatosis, and a diagnosis…

Show Full Abstract

We report a case of a 65-year-old Japanese woman with low-risk myelodysplastic syndrome (MDS) on hemodialysis who achieved transfusion independence for over eight years with combined epoetin beta pegol (continuous erythropoietin receptor activator, CERA) and roxadustat. Transfusion-dependent since 2008, she showed a temporary response to darbepoetin and CERA, initiated in August 2016. Roxadustat was added in January 2020, leading to sustained transfusion independence. No serious adverse events, such as progression to acute leukemia or clinically significant thyroid dysfunction, were observed during this period.

HFE
Also flagged:ursodeoxycholic acidRituximabantibodyCD20liver injuryDILI
Journal Article 2025-07-14 ✓ 1 Snippet Armendariz-Pineda SM, Vargas-Beltran AM, Corredor-Nassar MJ, Gamboa-Domínguez A, Santos-Reyes DA, Cordova-Gallardo J.
In-Text Gene Mentions

…ytomegalovirus, Ebstein-Barr),hemochromatosis, metabolic, and autoimmune…

Show Full Abstract

<h4>Abbreviations</h4>DILI: drug-induced liver injury, HBV: Hepatitis B virus, LFT: liver function test, RRMS: Relapsing-remitting multiple sclerosis, UDCA: ursodeoxycholic acid. Rituximab is a human chimeric monoclonal antibody that targets CD20 on B cells. The incidence of rituximab-associated drug-induced liver injury (DILI) is 19 cases per 100 000 people annually. This condition is characterized by a rapid increase in aminotransferase levels and hepatocellular injury, primarily due to reactivation of the hepatitis B virus (HBV). Nevertheless, there have been rare cases of DILI occurring in the absence of HBV reactivation. This case presents a 25-year-old male with relapsing-remitting multiple sclerosis (RRMS) that was treated with rituximab. After treatment, the patient demonstrated a hepatocellular damage pattern and biopsy confirmed the diagnosis. Following the administration of ursodeoxycholic acid (UDCA), the patient's liver function tests (LFTs) returned to normal levels, demonstrating that DILI from rituximab can occur after any infusion, regardless of therapy duration or dosage.

HFE
Also flagged:obesitytype 2 diabetes mellitusdiabetescentral obesityinsulin resistanceglucose
Journal Article 2025-07-14 ✓ 1 Snippet Nie H, Liu M, Duan J, Liu H.
In-Text Gene Mentions

…Acute infections; (4)Hemochromatosis; (5) Chronic inflammatory…

Show Full Abstract

<h4>Purpose</h4>This study investigates the clinical significance of ectopic fat and iron deposition in the liver and pancreas for glucose metabolism in elderly obese patients, with a focus on their potential for early diabetes screening and intervention.<h4>Methods</h4>We conducted a cross-sectional study of 140 elderly obese patients (aged 65-80 years, BMI ≥28 kg/m²) who underwent MRI quantification of hepatic and pancreatic fat (MRI-PDFF) and iron content (R2* values), along with measurements of visceral and subcutaneous fat via T2-weighted imaging. Glucose metabolism was assessed through oral glucose tolerance testing and related biomarkers.<h4>Results</h4>Compared to normal glucose tolerance (NGT) and impaired glucose regulation (IGR) groups, elderly obese patients with type 2 diabetes mellitus (T2DM) showed significantly higher ectopic fat in the liver (16.6% vs 6.9-13.4%) and pancreas (13.5% vs 8.5-9.0%), as well as increased visceral fat area (198.0cm² vs 137.8-163.9cm²). Liver fat percentage >11.8% was identified as an independent risk factor for abnormal glucose metabolism (<i>OR</i>=2.05, 95% <i>CI</i> 1.22-3.14), with a 2.05-fold increased risk compared to lower levels. The optimal diagnostic thresholds were determined as 11.8% for liver fat (sensitivity 83.2%, specificity 56.1%; AUC = 0.823) and 6.9% for pancreatic fat (sensitivity 72.2%, specificity 50.2%; AUC = 0.688), highlighting their clinical utility for early risk stratification.<h4>Conclusion</h4>Ectopic fat deposition in the liver, particularly when exceeding 11.8%, is a significant independent risk factor for glucose metabolism abnormalities in elderly obese patients. Our findings demonstrate that MRI-based quantification of hepatic fat provides a valuable tool for early identification of diabetes risk, enabling targeted interventions to prevent disease progression. This study highlights the clinical importance of monitoring ectopic fat deposition in clinical practice for elderly obese populations.

Also flagged:Cervical cancermalignant tumorshuman papillomavirus infectionN6-methyladenosinetumordegradation
Journal Article 2025-07-14 No Snippets Xu M, Yang F, Chen H, Jiang F.
Show Full Abstract

Cervical cancer is one of the most common malignant tumors among women worldwide. Its primary etiology is closely associated with human papillomavirus infection, which poses a serious threat to the health of women. N6-methyladenosine (m6A) modifications notably affect the biological characteristics of tumor cells, such as their proliferation, metastasis and chemoresistance, by regulating the stability, translation and degradation of RNA. It also serves an important regulatory role in the pathogenesis of cervical cancer. The present review details the mechanisms underlying m6A modification in cervical cancer and analyzes its impact on tumor progression. Moreover, it explores the potential clinical applications of m6A modification as a biomarker and therapeutic target to provide new insights and evidence regarding the early diagnosis and individualized treatment of patients with cervical cancer.

HFE
Also flagged:NucleatedCellDeathphosphatidylserineprothrombinasethrombin
Journal Article 2025-07-14 ✓ 2 Snippets Li C, Braun A, Zu J, Gudermann T, Mammadova-Bach E, Anders HJ.
In-Text Gene Mentions

…Interestingly,hemochromatosiswith iron overload…

…in patients withhemochromatosis[ 81 ],…

Show Full Abstract

Procoagulant platelets are a specialized subset of activated platelets that externalize phosphatidylserine (PS) on their surface, facilitating the assembly of tenase and prothrombinase complexes and enhancing thrombin generation and clot formation. Although procoagulant platelet formation shares certain features with nucleated cell death pathways, such as mitochondrial dysfunction, calcium (Ca<sup>2+</sup>) overload, membrane blebbing, and microvesiculation, it differs in key molecular mechanisms, notably lacking nuclei and caspase-dependent deoxyribonucleic acid (DNA) fragmentation. Interestingly, molecular components of nucleated cell death pathways in platelets can promote thrombus formation without impacting platelet lifespan. Under pathological conditions, excessive platelet activation may result in platelet lysis, resembling the complete activation of nucleated cell death pathways and contribute to thrombocytopenia. This review compares procoagulant platelet formation with various nucleated cell death pathways, including necrosis, necroptosis, pyroptosis, and ferroptosis, and explores their role in pathological thrombosis and blood clotting. A deeper understanding of mechanisms may help in developing targeted therapies to prevent aberrant blood clotting, platelet death and thrombocytopenia.

HTT
Also flagged:LipidAutism spectrum disorderneurodevelopmental disorderDocosahexaenoic acidω-3 fatty acidsmembrane
Journal Article 2025-07-14 ✓ 3 Snippets Woo T, Ahmed NI, Appenteng MK, King C, Li R, Fritsche KL, Sun GY, Cui J, Will MJ, Maurer SV, Stevens HE, Beversdorf DQ, Greenlief CM.
In-Text Gene Mentions

…are related to5-HTTtranscription levels in…

…reduced levels of5-HTTand decreased uptake…

…independent of their5-HTT+/− genotypic mother,…

Show Full Abstract

Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by restricted social communication and repetitive behaviors. Prenatal stress is critical in neurodevelopment and increases risk for ASD, particularly in those with greater genetic susceptibility to stress. Docosahexaenoic acid (DHA) is one of the most abundant ω-3 fatty acids in the membrane phospholipids of the mammalian brain, and dietary DHA plays an important role in brain development and maintenance of brain structure. In this study, we investigated whether peri-natal supplementation of DHA can alleviate autistic-like behaviors in a genetic risk/stress mouse model and how it alters lipid peroxidation activity and GABAergic system gene expression in the forebrain. Pregnant heterozygous serotonin transporter knockout (SERT-KO) and wild-type (WT) dams were placed in either non-stressed control conditions or chronic variable stress (CVS) conditions and fed either a control diet or a DHA-rich (1% by weight) diet. Offspring of each group were assessed for anxiety and autism-associated behavior at post-natal day 60 using an open field test, elevated plus maze test, repetitive behavior, and the 3-chamber social approach test. A liquid chromatography-mass spectrometry (LC-MS)-based method was used to follow changes in levels of lipid peroxidation products in the cerebral cortex. Male offspring of prenatally stressed SERT-het KO dams exhibited decreased social preference behaviors and increased repetitive grooming behaviors compared to WT control offspring. Moreover, DHA supplementation in male SERT-het mice decreased frequency of grooming behaviors albeit showing no associated effects on social behaviors. Regardless of stress conditions, supplementation of DHA to the WT mice did not result in alterations in grooming nor social interaction in the offspring. Furthermore, no apparent changes were observed in the lipid peroxidation products comparing the stressed and non-stressed brains. <i>Gad2</i> was downregulated in the cortex of female offspring of prenatally stressed SERT-KO dams, and this change appeared to be rescued by DHA supplementation in offspring. <i>Gad2</i> was upregulated in the striatum of male offspring of prenatally stressed SERT-KO dams, but DHA did not significantly alter the expression compared to the control diet condition.

Also flagged:gestationantigen-presenting moleculesMHC-IICD80CD86secretion
Journal Article 2025-07-14 No Snippets Liu H, Zhang L.
Show Full Abstract

At the maternal-fetal interface from human early pregnancy, decidual macrophages (dMφs) comprise approximately 20% of the leukocyte population, displaying a distinct immunophenotype characterized by hybrid functional features that transcend conventional M1/M2 polarization paradigms. The dynamic balance between M1-like dMφs and M2-like dMφs in human early pregnancy is closely related to the success of pregnancy. However, the comprehensive subsets profiling of dMφs and the factors influencing polarization haven't been elucidated until recent years. In this review, we first delineate the dMφs compositional proportion and subsets profiling during early gestation. Second, we clarify the mechanisms underlying dMφs recruitment and tissue residency. Finally, we comprehensively synthesize molecular drivers of dMφs polarization and the functional specialization of polarized dMφs in sustaining successful pregnancy. A comprehensive understanding of the molecular network governing dMφs polarization dynamics and their functional contributions to gestational processes will provide crucial insights for developing targeted therapeutic strategies to address pregnancy-related complications.

Also flagged:gestational diabetes mellitusGene Expressionribonucleoproteinribosomeneurodegenerative diseasesphosphorylation
Journal Article 2025-07-14 No Snippets Liu C, Wei C, Lu Y, Chai F, Wang C, Zeng Y, Huang H.
Show Full Abstract

Gestational diabetes mellitus (GDM) is a common pregnancy-related disorder with potential impacts on the fetoplacental unit. To uncover the underlying molecular mechanisms, we conducted a comprehensive bioinformatics analysis using a dataset from Gene Expression Omnibus, which included 37 primary human fetoplacental vascular endothelial cells (FPVEs) from healthy and GDM-complicated pregnancies. We identified 613 differentially expressed genes (DEGs) through the limma package, with 260 up-regulated and 353 down-regulated. Weighted gene co-expression network analysis was then performed, clustering genes into 11 modules. The MEdarkgreen module, containing 1,391 co-expression genes, showed the highest correlation with FPVE programming. After intersecting with DEGs, 192 co-expression hub genes were obtained. Gene Ontology enrichment analysis of these hub genes revealed enrichment in biological processes such as ribonucleoprotein complex biogenesis and ncRNA processing. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed significant enrichment in pathways related to ribosome function, neurodegenerative diseases, and oxidative phosphorylation. Protein-protein interaction network analysis led to the identification of five signature genes (RPS13, MRPS5, MRPL22, MRPL21, and NDUFS3). These genes exhibited significantly lower expression in FPVEs from GDM pregnancies and demonstrated excellent diagnostic performance, with high area under the curve values in receiver operating characteristic analysis. Further KEGG signaling pathway analysis elucidated the multiple signaling pathways in which these signature genes are involved under GDM conditions. We also constructed LncRNA-miRNA-target genes interaction networks for the signature genes. The networks showed that the expression of these genes is regulated by multiple miRNAs and LncRNAs, highlighting the complex post-transcriptional regulatory mechanisms at play. Overall, our study provides novel insights into the molecular basis of FPVE programming in GDM and potential biomarkers for its diagnosis and understanding.

Also flagged:CandidiasisCOVID-19deathoral candidiasiscorticosteroidReverse Transcription
Journal Article 2025-07-14 No Snippets Mitra S, Sharma P, Ganguly K.
Show Full Abstract

Introduction People around the world faced the possibility of death during the COVID-19 outbreak, including in India in 2019. Coinfection of oral candidiasis-like symptoms was not uncommon among COVID-19-infected patients undergoing treatment with prolonged broad-spectrum antibiotics or corticosteroid therapy. The present study aims to characterize the prevalence profile of <i>Candida</i> species and their antifungal drug susceptibility patterns among patients with COVID-19. Material and methods A short-term, hospital-based observational study was conducted on patients with Reverse Transcription Polymerase Chain Reaction (RT-PCR)-confirmed COVID-19 infections admitted to the critical care unit of a medical college hospital who presented with oral candidiasis-like symptoms. Oral swab samples were collected and cultured on Sabouraud dextrose agar. Species identification was performed using the VITEK-2 automated system (Biomerieux, France). Results Among 544 patients diagnosed with COVID-19, 20 were microbiologically positive for oral candidiasis. <i>Candida albicans</i> was the predominant species, followed by <i>Candida glabrata</i>, <i>Candida tropicalis</i>, and <i>Candida kefyr</i>. Females (55%) exhibited a slightly higher susceptibility than males (45%). Antifungal susceptibility testing revealed one isolate with multidrug resistance and five additional isolates displaying resistant or intermediate drug sensitivity patterns. COVID-19-related immune suppression and associated overuse of antibiotics and corticosteroids contributed to an increased incidence of oral candidiasis due to opportunistic fungi, including <i>Candida albicans</i> and non-<i>albicans Candida</i> species. Conclusion The candidal species profile associated with oral candidiasis did not significantly alter during the COVID-19 period compared to pre-COVID-19 baselines. Key message There was no occurrence of emerging <i>Candida species</i> during the COVID-19 period.

SHISA6
Also flagged:Celiac diseasehuman leukocyte antigenHLAautoimmune diseasesautoimmune disorderstype 1 diabetes
Journal Article 2025-07-14 ✓ 3 Snippets Tsali L, Tsilidis K, Katsanos K, Ntzani E, Manou M, Papandreou C, Markozannes G, Chalitsios CV.
In-Text Gene Mentions

…chromosome 17p12 (SHISA6), with 27…

…Meanwhile, rs205047, withinSHISA6, has been…

…chromosome 17p12 (SHISA6).…

Show Full Abstract

<h4>Objective</h4>Refractory celiac disease-type II (RCDII) is the more severe and adverse form of celiac disease; however, its association with other autoimmune diseases remains unclear. We conducted a phenome-wide association study (PheWAS) to examine the association between the polygenic risk score (PRS) for RCDII and autoimmune diseases.<h4>Methods</h4>To construct the PRS-RCDII, we extracted summary statistics for three non-human leukocyte antigen genetic variants, which were independently associated with RCDII ( r2 < 0.001; P < 5 × 10 -5 ) in a genome-wide association study. We then conducted a PRS-PheWAS in the UK Biobank to investigate the associations of PRS-RCDII with 27 autoimmune diseases, adjusting for age, sex, genetic batch, and genetic ancestry. False discovery rate (FDR < 0.05) correction was applied to account for multiple comparisons.<h4>Results</h4>Our study population comprised 373 022 UK Biobank participants (mean age: 57.2 years), of whom 202 865 (54.4%) were females. We constructed the PRS-RCDII, using three genetic variants, namely rs2041570 on chromosome 7p14.3 ( FAM188B ), rs7324708 on chromosome 13q22.1 ( KLF12 ), and rs205047 on chromosome 17p12 ( SHISA6 ). In the PRS-PheWAS, two phenotypes were initially associated with RCDII at a nominal P value threshold, ankylosing spondylitis and systemic sclerosis; however, after adjusting for multiple comparisons, only the association with ankylosing spondylitis remained statistically significant (odds ratio per 1 SD increase = 1.13; 95% confidence interval: 1.04-1.22; PFDR = 0.023). Sex-stratified and single-nucleotide polymorphism (SNP)-by-SNP analyses revealed no significant heterogeneity.<h4>Conclusion</h4>Our study identified an association between the genetic risk score for RCDII and ankylosing spondylitis, but not with other autoimmune diseases. This finding may have clinical importance for people with RCDII, although replication in future studies is needed.

MLLT10
Also flagged:B-Cell Acute Lymphoblastic LeukemiaB-cell acute lymphoblastic leukaemiaB-ALLvisionoptic disc oedemaALL
Journal Article 2025-07-14 ✓ 1 Snippet Bates B, Narayanan D, Cooksey R, Aung MH, Day Ghafoori S.
In-Text Gene Mentions

MLLT10

Show Full Abstract

We report a case that describes the relapse of histopathologically confirmed B-cell acute lymphoblastic leukaemia (B-ALL) in a 21-year-old male who presented with monocular subacute vision loss, photopsia, and floaters. His exam was notable for optic disc oedema and peripapillary choroidal thickening. He underwent trans-retinal choroidal biopsy where B-ALL recurrence was confirmed, and external beam radiation was initiated. This case demonstrates how choroidal biopsy can assist with establishing the diagnosis of ALL relapse in clinically atypical cases. ALL relapse isolated to the optic nerve and choroid is rare but should be considered in patients with appropriate medical history. Prompt diagnosis and initiation of treatment can yield excellent visual recovery, prevent irreversible vision loss, and potentially avert systemic relapse.

bioRxiv 2025-07-14 Preprint (No Snippets API) Merrion HG, Barber CN, Renuse SS, Cutler J, Kreimer S, Bygrave AM, Meyers DJ, Hale WD, Pandey A, Huganir RL.
Show Full Abstract

Synaptic plasticity in the central nervous system enables the encoding, storing, and integrating new information. AMPA-type glutamate receptors (AMPARs) are ligand-gated ion channels that mediate most fast excitatory synaptic transmission in the brain, and plasticity of AMPARs signaling underlies the long-lasting changes in synaptic efficacy and strength important for learning and memory. 1,2 Recent work has indicated that the enigmatic N-terminal domain (NTD) of AMPARs may be a critical regulator of synaptic targeting and plasticity of AMPARs. However, few synaptic proteins have been identified that regulate AMPAR plasticity through interactions with AMPAR NTDs. Moreover, the scope of AMPAR NTD interactors that are important for synaptic plasticity remains unknown. Here, we present the dynamic, extracellular interactome for AMPARs during synaptic plasticity. Using surface-restricted proximity labeling and BioSITe-based proteomics, we identified 70 proteins that were differentially labeled by APEX2-tagged AMPARs after induction of chemical Long-term potentiation of synapses (cLTP) in cultured neurons. Included in this list, were four members of the IgLON family of GPI-anchored proteins (Ntm, OBCAM/Opcml, Negr1, Lsamp). We show OBCAM and NTM directly interact with the extracellular domains of AMPARs. Moreover, overexpression of NTM significantly attenuates the mobility of surface AMPARs in dendritic spines. These data represent a significant first step at uncovering the unexplored extracellular regulation of AMPARs, with broad implications for synapse function and synaptic plasticity. <h4>Significance Statement</h4> Over the past 30 years, significant effort has been focused on understanding the mechanisms that induce long-lasting changes in synapse strength (synaptic plasticity) that drive learning and memory. While many studies have investigated intracellular mechanisms that enable plasticity, especially those acting on AMPA-type glutamate receptors (AMPARs), significantly less is known regarding extracellular mechanisms that shape changes in synapse function. Here, we identified 70 proteins that differentially associate with the extracellular region of AMPARs during chemically-induced synaptic plasticity. We show that OBCAM and NTM directly interact with the NTD of AMPARs and regulate their mobility on the surface of neurons. These data advance our understanding of extracellular AMPAR regulation, with broad implications for synapse function and synaptic plasticity.

Research Square 2025-07-14 Preprint (No Snippets API) Wang Z, Xiong Z, Zeng T, Zhang D, Yang M, Pu J, Wang B.
Show Full Abstract

<title>Abstract</title> <p> <bold>Background</bold> : The development of esophageal cancer (ESCA) is a complex biological process. An in-depth understanding of the possible pathogenesis mechanisms of ESCA and the identification of new effective biomarkers could improve diagnostic and treatment strategies for ESCA. <bold>Methods</bold> : To determine the differences in BRI3BP expression between tumor and normal tissue samples and the relationship between BRI3BP expression and clinical characteristics of ESCA patients, we assessed TCGA and GEO data. <bold>Results</bold> : The expression of the BRI3BP gene is significantly greater in tumor samples than in normal samples from ESCA patients in the TCGA and GEO (GSE5362, GSE23400, and GSE199967) cohorts. In addition, BRI3BP expression is a good predictor of the immunotherapeutic response in patients with ESCA. BRI3BP affects m6A modification in ESCA by regulating RBMX. BRI3BP may play an important role in cuproptosis in ESCA by regulating CDK5RAP1 and ultimately affecting the development and prognosis of ESCA. Furthermore, we predict that the MAPKAPK5-AS1−hsa-miR-145-5p−BRI3BP ceRNA network may play an important role in the development of ESCA. <bold>Conclusion</bold> : BRI3BP is a potential biomarker for ESCA diagnosis and treatment and is associated with immune infiltration, m6A modification, cuproptosis and the ceRNA regulatory network in ESCA. </p>

medRxiv 2025-07-14 Preprint (No Snippets API) Akhter S, Miller JH.
Show Full Abstract

<h4>Background</h4> Cardiovascular disease (CVD) remains the foremost contributor to global illness and death, underscoring the critical need for effective tools that can predict risk at early stages to support preventive care and timely clinical decisions. With the growing complexity of healthcare data, machine learning has shown considerable promise in extracting insights that enhance medical decision-making. Nonetheless, the effectiveness and clarity of machine learning models largely rely on the relevance and quality of input features. <h4>Methods</h4> In this work, we explored and compared three distinct feature selection strategies—Alternating Decision Tree (ADT)-based analysis, Cross-Validated Feature Evaluation (CVFE), and Hypergraph-Based Feature Evaluation (HFE)—to isolate the most predictive clinical variables for assessing CVD risk. Our analysis utilized data from the National Health and Nutrition Examination Survey (NHANES), administered by the National Center for Health Statistics under the Centers for Disease Control and Prevention (CDC), encompassing demographic, clinical, laboratory, and survey data collected across the U.S. from August 2021 through August 2023. Distinct sets of features obtained through the selection techniques were used to develop eXtreme Gradient Boosting (XGBoost) models, which were then assessed for predictive effectiveness. To improve clarity and understand the model’s decision-making, SHapley Additive exPlanations (SHAP) was utilized to interpret the influence of each feature in the top-performing model. <h4>Results</h4> Among the approaches, the HFE method achieved the most accurate results, reaching 75% accuracy and an AUC of 0.7857, outperforming the alternatives. The most influential predictors identified by the best model included age, total cholesterol, glycohemoglobin levels, systolic blood pressure, smoking history, and a diagnosis of diabetes. The web application, accessible at https://shiny.tricities.wsu.edu/cvdr-prediction/ , presents predictive results, probability scores, and a SHAP plot generated from the model trained using the feature set selected by the hypergraph-based approach. <h4>Conclusions</h4> This study highlights the importance of strategic feature selection in refining predictive accuracy and interpretability, offering a practical data-centric approach that could aid clinicians in evaluating cardiovascular risk and tailoring preventive care. <h4>Trial registration</h4> Not applicable as this research is not a clinical trial.

SUDS3
Also flagged:Chromatinlatent infectionnucleusviral genomehost cellnucleosome
Journal Article 2025-07-13 ✓ 1 Snippet Lieberman PM, Tempera I.
In-Text Gene Mentions

linker histones

Show Full Abstract

Epstein-Barr Virus (EBV) establishes latent infection as a circular, chromatinized episome that can persist in the nucleus of dividing and quiescent B cells, as well as in some NK, T, and epithelial cancer cells. During latency, the viral genome can express a diverse program of viral genes that have profound effects on the host cell, including capacity for immortalization, metabolic shifts, and immune evasion. The selective expression of viral genes during latency requires complex coordination between viral and host factors. This coordination is regulated by the chromatin structure and epigenetic programming of the viral genome. Epigenetic programming is determined by chromatin assembly, nucleosome positioning, histone and DNA modifications, transcription factor binding, RNA polymerase signaling, DNA looping, higher-ordered chromatin architecture, and interactions with host chromosome domains and territories. In addition, the latent viral genome divides using host replication and chromosome segregation machinery. Under stress conditions, the viral episome can switch into a lytic cycle where many additional viral factors are expressed to control late gene expression and viral rolling-circle replication followed by virion assembly and packaging. How the chromatin structure of the virus controls and is coordinated with all of these different processes and transitions is the focus of this chapter. Here we highlight recent advances in EBV chromatin control since the first edition of this chapter.

PRDX6
Also flagged:ferroptosisnuclear H ferritinFTH1ferritin heavy chainNSCLCBET
Journal Article 2025-07-13 ✓ 1 Snippet Scicchitano S, Garofalo C, Stella B, Santamaria G, Cozzolino F, Monaco V, Biamonte F, Monti M, Vecchio E, Faniello MC.
In-Text Gene Mentions

…the antioxidant enzymePRDX6[ 31 ]…

Show Full Abstract

Recent studies emphasize the involvement of the nuclear H ferritin subunit (FTH1; also known as ferritin heavy chain) in DNA protection from oxidative damage and transcriptional regulation. Bromodomain and extra-terminal domain (BET) proteins act as epigenome readers for transcriptional regulation. Among them, the role of bromodomain-containing protein 2 (BRD2) in non-small cell lung carcinoma (NSCLC) remains unclear. Moreover, the clinical utilization of BET bromodomain inhibition is severely limited by different sensitivities among NSCLC subtypes. This study provides the first evidence of nuclear BRD2-FTH1 functional interplay. Nuclear FTH1 is associated with BRD2, not bromodomain-containing protein 4 (BRD4), in a panel of NSCLC cell lines and affects BRD2 protein stability only in more aggressive types of NSCLC cells. In addition, the protective function of FTH1 was abrogated in FTH1-silenced cells that are resistant to synthetic BET bromodomain inhibitor JQ1 (a thieno-triazolo-1,4-diazepine) but not in JQ1-sensitive cells, leading to an increase in mortality. Then, the potential mechanism by which the combination of JQ1 with FTH1 silencing induces cell death was explored. The results show that ferroptosis is involved in the anticancer effect of JQ1 upon FTH1 silencing only in JQ1-insensitive cells. Moreover, the expression of ferroptosis-associated genes glutathione peroxidase 4 (GPX4), solute carrier family 7 member 11 (SLC7A11) and solute carrier family 3 member 2 (SLC3A2) was downregulated under JQ1 treatment only after FTH1 silencing, indicating that the BRD2 inhibition due to the co-treatment could regulate the expression of ferroptosis-associated genes. In summary, for the first time, our data suggest that FTH1 silencing may serve as an effective anti-tumor strategy to enhance the activity of JQ1, acting to overcome the chemotherapy resistance in more aggressive NSCLCs.

Also flagged:canine babesiosisheat shock protein 70cytochrome c oxidase subunit 1cytochrome oxidase c subunit 3cytochrome bpiroplasmosis
Journal Article 2025-07-13 No Snippets Baggio-Souza V, Berger L, Mallmann-Bohn R, Reis AO, Basilio LG, Pereira YS, Tirelli L, Fagundes-Moreira R, da Silva JVDSA, das Neves LF, Moroz LR, Santos HA, Espinoza MEM, Daudt C, Gregori F, Giroto-Soares A, da Silva FRC, Garcia JL, de Aguiar DM, Peixoto MP, Venzal JM, Dantas-Torres F, André MR, Soares JF.
Show Full Abstract

<h4>Background</h4>In South America, Babesia vogeli is the primary causative agent of canine babesiosis, and brown dog ticks (Rhipicephalus sanguineus sensu lato) are the vectors. The recent separation of brown dog ticks into Rhipicephalus sanguineus sensu stricto ("temperate lineage") and Rhipicephalus linnaei ("tropical lineage") raised suspicions of the possibility of two distinct Babesia genotypes or even species being transmitted by these tick species.<h4>Methods</h4>To investigate this hypothesis, dog blood samples from Brazil (eight states), Paraguay, and Uruguay were collected to determine the genetic diversity of B. vogeli in South America. The samples were collected from temperate regions (southern Brazil and Uruguay), where the putative vector is R. sanguineus, and from the tropical areas (southeastern, midwestern, northeastern, and northern Brazil and Paraguay), where R. linnaei is the vector. DNA samples from B. vogeli-positive dogs were extracted to amplify the 18S ribosomal RNA, internal transcribed spacers 1 and 2, heat shock protein 70, cytochrome c oxidase subunit 1, cytochrome oxidase c subunit 3, and cytochrome b genes. The sequences obtained were aligned with available B. vogeli sequences in GenBank and other homologous sequences to construct phylogenetic trees, haplotype networks, and matrices.<h4>Results</h4>Our haplotypic and phylogenetic analyses congruently indicated the existence of one genotype in temperate areas and another in tropical areas, where R. sanguineus and R. linnaei act as vectors, respectively. While the percentage of similarity varied among the evaluated genetic markers, the results indicated a clear differentiation between the B. vogeli genotypes associated with temperate and tropical regions.<h4>Conclusions</h4>Our data indicate the existence of two B. vogeli genotypes in South America, associated with temperate and tropical areas. This contributes to a better understanding of B. vogeli's genetic diversity and opens new avenues for researching the ecology and coevolution of B. vogeli genotypes and their tick vectors. Owing to their correlation with the climatic region and the historical nomenclature of their vectors, we suggest the nomenclature of "temperate" and "tropical" B. vogeli genotypes.

OLFM4
Also flagged:LAPTM4BLGR5Lysosomal‐Associated Transmembrane Protein 4BColorectal Cancertumorlysosome‐associated transmembrane protein 4B
Journal Article 2025-07-13 ✓ 1 Snippet Fang Y, Fu T, Xiong Z, Zhang Q, Liu W, Yu K, Le A.
In-Text Gene Mentions

…includes LGR5 ,OLFM4, TMEM19 ,…

Show Full Abstract

Colorectal cancer (CRC) exhibits substantial intertumoral heterogeneity, largely attributable to multiple tumor stem-like cell populations, whose molecular identities and clinical significance remain incompletely defined. This study delineates tumor-intrinsic stem-like cell diversity and its prognostic implications through single-cell transcriptomic profiling of 171,906 tumor epithelial cells (<i>n</i> = 152), integrated with bulk transcriptomic (<i>n</i> = 1389) and genomic (<i>n</i> = 1077) datasets. Functional validation was conducted via in vitro assays and multiplex immunofluorescence. A previously unrecognized lysosome-associated transmembrane protein 4B-positive (LAPTM4B<sup>+</sup>) stem-like cell cluster was identified, distinct from the classical leucine-rich repeat-containing G-protein coupled receptor 5-positive (LGR5<sup>+</sup>) population. LAPTM4B<sup>+</sup> cells exhibited MYC pathway activation and 8q chromosomal gains, with preferential enrichment in microsatellite-stable, <i>POLE</i> wild-type, and left-sided tumors. Stratification based on LAPTM4B<sup>+</sup>/LGR5<sup>+</sup> stem-like cell ratios defined four CRC stem-like subtypes (CSS), with CSS2 (LAPTM4B<sup>+</sup>-dominant) associated with the poorest prognosis (HR = 2.31, <i>p</i> < 0.001). The combined expression of LAPTM4B and LGR5 demonstrated superior predictive power for CRC progression compared to either marker alone (AUC = 0.820 vs. 0.715/0.699), underscoring the synergistic influence of distinct stem-like cell populations on patient outcomes. These findings provide novel insights into CRC heterogeneity and cooperative interactions among diverse stem-like populations shaping disease outcomes.

Also flagged:Oral cancerOCcancerssquamous cell carcinomasOSCCoral potentially malignant disorders
Journal Article 2025-07-13 No Snippets Starska-Kowarska K.
Show Full Abstract

(1) Background: Oral cancer (OC) is one of the most frequently diagnosed human cancers and remains a challenge for biologists and clinicians. More than 90% of OC cases are squamous cell carcinomas (OSCCs). Despite the use of modern diagnostic and prognostic methods, the 5-year survival rate remains unsatisfactory due to the late diagnosis of the neoplastic process and its resistance to treatment. This comprehensive review aims to present the latest literature data on the use and effectiveness of saliva as a non-invasive biomarker in patients with oral cancer. (2) Methods: The article reviews the current literature on the use of salivary omics biomarkers as an effective method in diagnosing and modifying treatment in patients with OSCC; the research corpus was acquired from the PubMed/Google/Scopus/Cochrane Library/Web of Science databases in accordance with the Systematic Reviews and Meta-Analyses extension for Scoping Reviews (PRISMA 2020) guidelines. (3) Results: The identification of salivary omics biomarkers involved in carcinogenesis and neoplastic transformation may be a potential alternative to traditional invasive diagnostic methods. Saliva, being both an abundant reservoir of organic and inorganic components derived from epithelial cells as well as a cell-free environment, is becoming an interesting diagnostic material for studies in the field of proteomics, genomics, metagenomics, and metabolomics. (4) Conclusions: Saliva-based analysis is a modern and promising method for the early diagnosis and improvement of treatment outcomes in patients with OSCC and oral potentially malignant disorders (OPMDs), with high diagnostic, therapeutic, and prognostic potential.

HFE
Also flagged:ironosteoporosisHepcidiniron hormonebindingdegradation
Journal Article 2025-07-13 ✓ 5 Snippets Steele-Perkins P, Yilmaz D, Walther Y, Wagner A, Paganoni R, Rauner M, Rauner M, Baschant U, Vujić Spasić M.
In-Text Gene Mentions

…loss in genetichemochromatosis.…

…were reported inHFE-hemochromatosis patients, 6 ,…

…were reported in HFE-hemochromatosispatients, 6 ,…

…nstitutive and tissue-specificHfedeficiency 31 and…

…iron levels inHFE-HH are insufficient to…

Show Full Abstract

More than 18% of the global population suffers from osteoporosis and its associated fracture risk each year. Among the many factors implicated in osteoporosis development, high iron levels have been implicated in bone loss in mice and patients. Here, we performed a comparative analysis of the effect of iron overload induced via diet, injections, or genetic factors, on overall bone health and mechanical bone strength. We used female mice, given the higher risk of osteoporosis and associated fractures in women than in men. We show that dietary iron overload induced trabecular remodeling in the spine but not in the femur, with potentially pre-pathogenic structural changes. By contrast, iron injections caused severe bone deficits across all sites measured. Interestingly, the loss of cortical bone emerged as a common hallmark of secondary iron overload and was associated with decreased mechanical strength in mice. However, no bone anomalies were observed in mice with genetic iron overload, demonstrating that iron overload per se does not suffice to induce bone loss in genetic hemochromatosis. Collectively, our study shows that iron overload-induced by diet and injections, but not genetically, induces selective and specific bone deficits, which are associated with decreased bone mechanical strength in mice.

PRDX6
Also flagged:ferroptosisidiopathic pulmonary arterial hypertensionIPAHpulmonary vascular disorderirondeath
Journal Article 2025-07-12 ✓ 4 Snippets Zhang Y, Qian T, Jiang W, Yuan H, Lu T, Yin N, Wu Z, Huang C.
In-Text Gene Mentions

…by peroxiredoxin 6 (PRDX6), plays a role…

…-dependent peroxidases (PRDX1-PRDX6) 44 .…

…al. Found thatPRDX6was expressed in…

…They suggested thatPRDX6mediates PAEC ferroptosis…

Show Full Abstract

Idiopathic pulmonary arterial hypertension (IPAH), a rare and devastating pulmonary vascular disorder, is characterized by cellular proliferation and vascular remodeling. Although previous studies have underscored that ferroptosis, an iron-dependent cell death process, plays an important regulatory role in pulmonary artery hypertension, its role remains understudied. Gene expression profiles were downloaded from the Gene Expression Omnibus(GEO). Differentially expressed genes (DEGs) were screened using R software and intersected with a ferroptosis database (FerrDb V1) to identify ferroptosis-related DEGs. GO and KEGG analyses were performed to explore biological functions and potential pathways. LASSO and SVM-RFE algorithms were used to identify optimal gene biomarkers for IPAH. GSVA and GSEA were conducted to explore biological functions and potential pathways associated with these biomarkers. The CIBESORT software was employed to predict immune genes and functions. Of 237 ferroptosis-related genes (FRGs), 27 differentially expressed FRGs (DE-FRGs) showed significant differences between IPAH and normal samples in GSE48149, with 15 downregulated and 12 upregulated genes. Six DE-FRGs, including KEAP1, TNFAIP3, MEG3, NFS1, PRDX1, and BEX1, were identified as predictive diagnostic genes for IPAH. Among these DE-FRGs, PRDX1 and TNFAIP3 were the most promising diagnostic genes for IPAH and may play a corresponding role in IPAH by participating in the cell cycle, lysosomes, immune response, vascular smooth muscle contraction, and various diseases. CIBERSORT analysis revealed a positive correlation between neutrophils and TNFAIP3, whereas macrophages M0 exhibited a negative correlation with PRDX1. Through comprehensive bioinformatics analysis, we identified six differentially expressed ferroptosis-related genes (DE-FRGs)-KEAP1, TNFAIP3, MEG3, NFS1, PRDX1, and BEX1-in idiopathic pulmonary arterial hypertension (IPAH). Among these, PRDX1 and TNFAIP3, which play key roles in IPAH pathogenesis, emerged as the most promising diagnostic biomarkers.

PRDX6
Also flagged:MethyltransferaseZC3H13ferroptosissepsisp53SLC7A11
Journal Article 2025-07-12 ✓ 5 Snippets Liang J, Liu Z, He Y, Li H, Wu W.
In-Text Gene Mentions

…lung injury viaPRDX6/p53/SLC7A11 axis.…

…Peroxiredoxin 6 (PRDX6) is widely acknowledged…

…specific involvement ofPRDX6in regulating macrophage…

…mechanistic role ofPRDX6in modulating macrophage…

…with either aPRDX6overexpression lentivirus or…

Show Full Abstract

Peroxiredoxin 6 (PRDX6) is widely acknowledged as a suppressor of ferroptosis, and recent studies have demonstrated that inhibition of macrophage ferroptosis can alleviate sepsis-associated acute lung injury (SA-ALI). Nonetheless, the specific involvement of PRDX6 in regulating macrophage ferroptosis during SA-ALI remains unexplored. This study aims to elucidate the mechanistic role of PRDX6 in modulating macrophage ferroptosis within the context of SA-ALI. Mouse alveolar macrophages (MH-S cells) were infected with either a PRDX6 overexpression lentivirus or a ZC3H13 knockdown lentivirus prior to lipopolysaccharide (LPS) treatment. In vivo, mice were treated with the same lentiviral constructs and subjected to a SA-ALI model via cecal ligation and puncture (CLP). This study demonstrates that PRDX6 overexpression or ZC3H13 knockdown significantly attenuated LPS-induced ferroptosis in alveolar macrophages and alleviated lung injury in CLP-induced SA-ALI mouse models. However, simultaneous knockdown of both ZC3H13 and PRDX6 abolished the protective effect conferred by ZC3H13 silencing, indicating that PRDX6 mediates the anti-ferroptotic role of ZC3H13 inhibition. Mechanistically, PRDX6 suppresses p53 expression, thereby upregulating SLC7A11 and inhibiting ferroptosis. Additionally, ZC3H13 promotes the m6A modification of PRDX6 mRNA, which facilitates its degradation in a YTHDF2-dependent manner, ultimately leading to reduced PRDX6 expression. Overall, these findings demonstrate that the methyltransferase ZC3H13 modulates PRDX6 expression by elevating the m6A methylation level of PRDX6 mRNA in a YTHDF2-dependent manner, thereby influencing the p53/SLC7A11 axis and promoting ferroptosis in alveolar macrophages, ultimately contributing to the progression of SA-ALI.

MMS22L
Also flagged:agingmineralCOL11A1PTHLHETFATWIST1
Journal Article 2025-07-12 ✓ 3 Snippets Wang FM, Ruby JG, Sethi A, Veras MA, Telis N, Melamud E.
In-Text Gene Mentions

…repair ( RAD9A,MMS22L, HIF1A, RAB28 )…

…near RAB28 andMMS22Lgenes showed a…

…8 (intracellular trafficking),MMS22L(DNA double-strand break…

Show Full Abstract

<h4>Background</h4>Increased spinal curvature is one of the most recognizable aging traits in the human population. However, despite high prevalence, the etiology of this condition remains poorly understood.<h4>Methods</h4>To gain better insight into the physiological, biochemical, and genetic risk factors involved, we developed a novel machine learning method to automatically derive thoracic kyphosis and lumbar lordosis angles from dual-energy X-ray absorptiometry (DXA) scans in the UK Biobank Imaging cohort. We carry out genome-wide association and epidemiological association studies to identify genetic and physiological risk factors for both traits.<h4>Results</h4>In 41,212 participants, we find that on average males and females gain 2.42° in kyphotic and 1.48° in lordotic angle per decade of life. Increased spinal curvature shows a strong association with decreased muscle mass and bone mineral density. Adiposity demonstrates opposing associations, with decreased kyphosis and increased lordosis. Using Mendelian randomization, we show that genes fundamental to the maintenance of musculoskeletal function (COL11A1, PTHLH, ETFA, TWIST1) and cellular homeostasis such as RNA transcription and DNA repair (RAD9A, MMS22L, HIF1A, RAB28) are likely involved in increased spinal curvature.<h4>Conclusions</h4>Our findings reveal a complex interplay between genetics, musculoskeletal health, and age-related changes in spinal curvature, suggesting potential drivers of this universal aging trait.

SERPINC1
Also flagged:PeptidepeptidesproteasesdigestionACEDPP-IV
Journal Article 2025-07-12 ✓ 1 Snippet Garbacz K, Wawrzykowski J, Czelej M, Waśko A.
In-Text Gene Mentions

…observed, along withDPP-IIIinhibitors and peptides…

Show Full Abstract

Rapeseed meal, a byproduct of oil extraction, is increasingly recognised as a valuable source of plant protein and health-promoting peptides. This study aimed to identify key proteins in cold-pressed rapeseed meal and assess their potential to release bioactive peptides through in silico hydrolysis using plant-derived proteases, namely papain, bromelain, and ficin. Proteomic profiling via two-dimensional electrophoresis and MALDI-TOF/TOF mass spectrometry revealed cruciferin as the dominant protein, along with other metabolic and defence-related proteins. In silico digestion of these sequences using the BIOPEP database generated thousands of peptide fragments, of which over 50% were predicted to exhibit bioactivities, including ACE and DPP-IV inhibition, as well as antioxidant, neuroprotective, and anticancer effects. Among the evaluated enzymes, bromelain exhibited the highest efficacy, yielding the greatest quantity and diversity of bioactive peptides. Notably, peptides with antihypertensive and antidiabetic properties were consistently identified across all of the protein and enzyme variants. Although certain rare functions, such as anticancer and antibacterial activities, were observed only in specific hydrolysates, their presence underscores the broader functional potential of peptides derived from rapeseed. These findings highlight the potential of rapeseed meal as a sustainable source of functional ingredients while emphasising the necessity for experimental validation to confirm the predicted bioactivities.

Also flagged:COVID-19oligonucleotidesribonucleic acidcytoplasmNucleic acidmembrane receptor
Journal Article 2025-07-12 No Snippets Tufeu M, Herkenne C, Kalia YN.
Show Full Abstract

<b>Background/Objectives:</b> After many years of research and the successful development of therapeutic products by a few industrial actors, the COVID-19 vaccines brought messenger RNAs, as well as other nucleic acid modalities, such as antisense oligonucleotides, small interfering RNA, and aptamers, into the spotlight, eliciting renewed interest from both academia and industry. However, owing to their structure, relative "fragility", and the (usually) intracellular site of action, the delivery of these therapeutics has frequently proven to be a key limitation, especially when considering endosomal escape, which still needs to be overcome. <b>Methods</b>: By compiling delivery-related data on approved and late clinical-phase ribonucleic acid therapeutics, this review aims to assess the delivery strategies that have proven to be successful or are emerging, as well as areas where more research is needed. <b>Results</b>: In very specific cases, some strategies appeared to be quite effective, such as the N-acetylgalactosamine moiety in the case of liver delivery. Surprisingly, it also appears that for some modalities, efforts in molecular design have led to more "drug-like" properties, enablingthe administration of naked nucleic acids, without any form of encapsulation. This appears to be especially true when local administration, i.e., by injection, is possible, as this provides de facto targeting and a high local concentration, which can compensate for the small proportion of nucleic acids that reach the cytoplasm. <b>Conclusions</b>: Nucleic acid-based therapeutics have come a long way in terms of their physicochemical properties. However, due to their inherent limitations, targeting appears to be crucial for their efficacy, even more so than for traditional pharmaceutical modalities.

TRIM38
Also flagged:TRIM13CD3Dmyocardial infarctionMIcardiovascular diseasedeath
Journal Article 2025-07-12 ✓ 1 Snippet Wu F, Zheng X, Wu Q, Hong L, Yue L, Yang R, Chen D, Zhou Y.
In-Text Gene Mentions

…10 demonstrated thatTRIM38can reduce cardiac…

Show Full Abstract

Myocardial infarction (MI) is a common cardiovascular disease with a high risk of sudden death. We aim to develop potential and more effective therapeutic strategies for treating and preventing MI. A mouse model of MI was established, and cardiac tissue sample microarray data and GSE236374 dataset were collected to screen and 120 upregulation and 15 downregulation genes were obtained, and related to T cells and cell immunity. Further obtained 7 key genes, including Cd8b1, Pdcd1, Klrd1, Klrk1, Cd3g, Cd74, and Cd3d, and had high expression in MI mice. The ceRNA regulation network found that protein TRIM13 was upstream of CD3D. <i>In vitro</i> and <i>in vivo</i> knockdown of CD3D relieved the effect of OGD-induced cardiomyocyte apoptosis. TRIM13 interacts with CD3D. Knockdown of TRIM13 promotes CD3D ubiquitination and restores the effect of OGD-induced cardiomyocyte apoptosis through downregulation of CD3D. Knockdown of TRIM13 could relieve cardiomyocyte apoptosis through downregulation of CD3D in MI.

bioRxiv 2025-07-12 Preprint (No Snippets API) Hasenpusch-Theil K, Lesayova A, Kozic Z, Beltran M, Wilson G, Henderson NC, Dando O, Theil T.
Show Full Abstract

<h4>ABSTRACT</h4> Primary cilia control cell-cell signalling and their dysfunction has been implicated in Autism Spectrum Disorders (ASD) but their roles in the ASD aetiology remain largely unexplored. Here, we analysed the impact of ASD mutations in CEP41 using human corticogenesis. CEP41 encodes a centrosomal protein located at the basal body and the ciliary axoneme and is mutated in ASD individuals and in Joubert syndrome, a ciliopathy with high incidence of ASD. To gain insights into CEP41 ’s role in ASD aetiology, we characterised human cortical organoids carrying the CEP41 R242H point mutations found in ASD individuals. This mutation did not interfere with CEP41’s ciliary localisation but cilia were shorter and had lower levels of tubulin polyglutamylation, which is indicative of altered cilia stability and signalling. Moreover, scRNAseq analyses revealed that the expression of several transcription factors with critical roles in interneuron development was altered in mutant interneurons and their progenitors. The CEP41 mutation also caused decreased cortical progenitor proliferation and an augmented formation of upper layer cortical neurons. Taken together, these findings indicate that CEP41 controls excitatory and inhibitory neuron differentiation, alterations in which might lead to an excitation/inhibition imbalance that is widely recognized as a convergent mechanism underlying neurodevelopmental disorders.

Also flagged:lung cancertranscription factorsmethylationangiogenesisCas9oligonucleotides
Journal Article 2025-07-11 No Snippets Li Z, Zhang H, Chen Z, Wu G, Guo W, Li Y.
Show Full Abstract

In this review, the role of microRNA‑21 (miRNA‑21) as an oncogene in lung cancer was investigated. Studies have shown that miRNA‑21 can promote the progression of lung cancer by targeting downstream target genes, and its expression can be modulated by transcription factors, DNA methylation or competitive endogenous RNA as an upstream regulator. This review highlights that miRNA‑21 can promote the progression of lung cancer through multiple signaling pathways, with a focus on the PI3K/AKT, MEK/ERK, TGF‑β/SMAD, Hippo, NF‑κB and STAT3 signaling pathways. Mechanistically, miRNA‑21 plays an important role in the progression of lung cancer by regulating multiple biological processes, such as proliferation, invasion, metastasis, apoptosis and angiogenesis in lung cancer cells. Higher expression of miRNA‑21 is associated with chemotherapy, radiotherapy and immune resistance in lung cancer. Targeting these molecular pathways may be a novel therapeutic strategy for treating lung cancer. Additionally, miRNA‑21 can serve as a biomarker for lung cancer diagnosis, prognosis and treatment response. This review also summarized the following: i) Current methods employed to inhibit the expression of miRNA‑21 in lung cancer, including CRISPR/Cas9 technology; ii) the application of natural anticancer agents, oligonucleotides, small molecules and miRNA sponges; and iii) the nano‑delivery systems developed for miRNA‑21 inhibitors. Finally, the advancements in research on miRNA mimics and inhibitors in clinical trials, which may promote the application of miRNA‑21 in clinical trials in lung cancer, were discussed. Given that lung cancer is a considerable public health challenge, these studies provide new ways of treating patients with lung cancer.

Also flagged:Neurodegenerative diseasesdeathagingAlzheimer's diseaseADParkinson's disease
Journal Article 2025-07-11 No Snippets Sun Y, Wei K, Liao X, Wang J, Gao L, Pang B.
Show Full Abstract

Neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis, are characterized by progressive neuronal loss and neuroinflammation, with microglial dysfunction emerging as a central driver of pathogenesis. Microglia, the central nervous system‑resident immune cells, exhibit dual pro‑inflammatory and anti‑inflammatory phenotypes, dynamically regulated by lipid metabolic reprogramming. Chronic activation of M1 microglia exacerbates neuronal damage, while M2 microglia promote tissue repair via phagocytic clearance and neurotrophic factor secretion. Lipid dysregulation‑marked by ceramide accumulation, cholesterol esterification defects and oxidized lipid‑driven neuroinflammation‑critically modulates microglial polarization. Mechanistic studies reveal that mitochondrial dysfunction, lysosomal stress and ferroptosis intersect with lipid metabolic pathways to amplify neurotoxicity. Therapeutic strategies targeting lipid homeostasis, such as TREM2 agonism, demonstrate efficacy in preclinical models by restoring microglial function and mitigating pathology. This review synthesizes emerging evidence linking microglial lipid metabolism to NDD progression, highlighting novel biomarkers and therapeutic avenues to disrupt the lipid‑neuroinflammation axis in neurodegeneration.

NEGR1
Also flagged:LactationsynthesissecretionWaternucleusTRHDE
Journal Article 2025-07-11 ✓ 1 Snippet Dai D, Si J, Jiang L, Han B, Wang K, Wang X, Yan S, Yin Y, Chen W, Mao H, Pauciullo A, Li ST, Fang L, Zhang Y.
In-Text Gene Mentions

…another ligand‐receptor pair,NEGR1is involved in…

Show Full Abstract

Characterizing the cell type-specific transcriptome is crucial for understanding the cellular and molecular regulatory mechanisms underlying adaptive evolution and complex phenotypes. Here, single-cell/nucleus RNA sequencing (sc/snRNA-seq) is used to construct a cell transcriptomic atlas of 397,011 cells, representing 57 cell types, from 12 tissues in river and swamp buffalo, which exhibit significant divergence in milk production. Differential expression analyses identify metabolic and secretory tissues (i.e., liver, mammary gland, and pituitary) and cell types (e.g., hepatocytes, luminal cells, somatotropes, and lactotropes) that mediate the divergence of milk production. Lactotrope-specific downregulation of TRHDE in river buffalo is associated with high milk production. Integrative analyses of sc/snRNA-seq data with genomic data in buffalo and cattle reveal key cell types (e.g., luminal cells and excitatory neurons) and genes (e.g., RPL13 and LALBA) associated with milk production. Ultimately, the Buffalo Cell Atlas (http://bovomicshub.com) will serve as a valuable resource for advancing buffalo genetics and genomics research, enabling cross-species comparative transcriptome studies and providing deeper insights into the regulation of milk synthesis and secretion.

TNFSF4
Also flagged:SRCcancer-receptor tyrosine kinasecell growthcancersimmune response
Journal Article 2025-07-11 ✓ 2 Snippets Huang L, Lu Y, Yi L, Zhao Y, Si T, Zhang M.
In-Text Gene Mentions

…ICAM1, TNF, BTN3A1,TNFSF4, among others.…

…ICAM1, TNF, BTN3A1,TNFSF4, and others.…

Show Full Abstract

<h4>Background</h4>Tyrosine-Protein Kinase Src (SRC), a non-receptor tyrosine kinase encoded by the Src gene, plays a crucial role in cell growth, division, migration, and survival signaling pathways. Dysregulation of SRC expression and activity is associated with advanced stages of several human cancers and poor prognosis. However, the prognostic value of SRC across multiple cancers and its involvement in immune response remain unclear. Therefore, this study aimed to investigate the relationship between SRC expression levels and cancer patient prognosis, as well as its potential impact on the immune microenvironment.<h4>Methods</h4>In this study, we utilized the Sangerbox database to investigate the differential expression of SRC in various types of cancer tumors and adjacent normal tissues. Survival outcomes of SRC expression levels in pan cancer were analyzed by Cox risk ratio and Kaplan Meier analysis. We further explored the relationship between SRC expression and immune regulatory genes, tumor mutation load, microsatellite instability, and the immune microenvironment of pan cancer using the Sangerbox database.<h4>Results</h4>Compared to normal tissues, SRC expression is upregulated in various tumor tissues. SRC is significantly correlated with OS and in tumors such as LIHC and PRAD. Furthermore, SRC expression is significantly associated with mutation burden and microsatellite instability in tumors such as LUAD and COAD. In addition, SRC expression is related to the abundance of infiltrating immune cells in tumors such as LIHC and PRAD. These findings suggest that SRC may serve as a potential prognostic biomarker and therapeutic target for various cancers, and may be associated with the immune microenvironment of tumors.<h4>Conclusion</h4>Our results suggest that SRC may play a role in regulating immune infiltration and impacting the prognosis of cancer patients, highlighting its potential as a therapeutic target and biomarker for various cancers.

Also flagged:nephrotic syndromeminimal change diseaseMCDfocal segmental glomerulosclerosisFSGSglomerular disease
Journal Article 2025-07-11 No Snippets Cummins TD, Mariani LH, Wilkey DW, Jortani SA, Helmuth M, Rane MJ, Merchant ML, Kamigaki Y, Theesfeld C, McCown PJ, Ju W, Dougherty JA, McRitchie S, Pathmasiri W, Kretzler M, Sumner SJ, Smoyer WE, Klein JB, Cure Glomerulonephropathy (CureGN) Consortium.
Show Full Abstract

The molecular pathophysiology of nephrotic syndrome remains largely elusive in pediatric patients. While most children with minimal change disease (MCD) show favorable responses to immunosuppressive therapy, those with focal segmental glomerulosclerosis (FSGS) often exhibit poorer treatment responses, with many experiencing either partial remission or no remission of proteinuria. The need for reliable glomerular disease biomarkers to predict treatment response and understand molecular pathways governing responsiveness and resistance is a critical unmet need in pediatric nephrology. In this study, we sought to characterize urine proteomes in children with MCD and FSGS to identify biomarkers distinguishing disease activity and associated molecular pathways. Using quantitative proteomics, urine proteins from children with MCD and FSGS in the CureGN Study were identified and correlated with disease onset and activity. Unbiased cluster analyses of nephrotic urine proteomes demonstrated a cluster with relatively increased immune response and complement proteins, suggesting important distinctions in disease characteristics within the nephrotic subgroups. These analyses yielded patient subpopulations with proteinuria and distinct urine proteome differences associated with 116 proteins exerting cluster separation in the multivariate analyses. These findings highlight the potential of unsupervised clustering to identify disease subgroups and provide insights into the underlying molecular heterogeneity within nephrotic syndrome, paving the way for more tailored therapeutic strategies and improved patient management.

BTN2A1
Also flagged:deathPancreatic adenocarcinomaprogrammed cell-ITGA3CDCP1
Journal Article 2025-07-11 ✓ 1 Snippet Wang B, Long Z, Zou X, Sun Z, Xiao Y.
In-Text Gene Mentions

…related genes, includingBTN2A1, CD40 ,…

Show Full Abstract

Pancreatic adenocarcinoma (PAAD) is a highly lethal malignancy with limited effective prognostic biomarkers. In this study, 1,034 samples from TCGA-PAAD, GSE62452, GSE28735, GSE183795, and ICGC cohorts were systematically integrated to identify key programmed cell death-related genes (PCDRGs) associated with patient prognosis. Differential expression analysis and Univariate Cox regression analysis identified 17 candidate PCD-related genes significantly associated with overall survival. Using a comprehensive machine learning framework involving 117 algorithmic combinations under a Leave-one-out cross-validation (LOOCV) strategy, we identified the StepCox[both] + Ridge as the best algorithms composition to construct a prognostic model based on six PCDRGs, ITGA3, CDCP1, IL1RAP, CLU, PBK, and PLAU. The model was validated to have robust predictive performance. Risk scores were significantly correlated with clinical features, immune microenvironment characteristics, and chemotherapeutic sensitivity. High-risk patients exhibited worse prognosis and immunosuppressive infiltration patterns. Furthermore, consensus clustering identified two PAAD molecular subtypes with distinct PCDRGs expression patterns and survival outcomes. A nomogram integrating risk score and clinical variables exhibited strong prognostic accuracy for 1-, 3-, and 5-year survival prediction. In summary, we established and validated a PCD-related prognostic signature that effectively stratifies PAAD patients by clinical outcome, immune contexture, and therapeutic response, providing novel insights for personalized management strategies.

Also flagged:TRIM33androgen receptorARtranscription factorprostate cancerchromatin
Journal Article 2025-07-11 No Snippets Eickhoff N, Janetzko J, Padrão N, Gregoricchio S, Siefert JC, Hoekman L, Linder S, Bleijerveld O, Bergman AM, Zwart W.
Show Full Abstract

The Androgen Receptor (AR) is a ligand-dependent transcription factor that drives prostate cancer development and progression. Although, a detailed effect on AR biology has been described for a number of interacting proteins, many AR coregulators remain to be characterized in relation to their distinct impact on AR function. Here, we describe TRIM33 as a conserved AR-interactor across multiple prostate cancer cell lines. We observed that TRIM33 and AR share overall chromatin interaction profiles, in which TRIM33 is involved in downstream responsive transcriptomic output. In contrast to prior reports, we show that TRIM33 does not impact AR protein stability, but instead propose a model in which TRIM33 facilitates maximal AR activity by interfering with H2BK120 ubiquitination levels.

MLLT10
Also flagged:waterreproductionstillbirthinseminationcalvinggestation
Journal Article 2025-07-11 ✓ 1 Snippet Maddahi N, Sadeghi M, Miraee Ashtiani SR, Kholghi M, Jalil Sarghale A.
In-Text Gene Mentions

…TheMLLT10gene in BTA22…

Show Full Abstract

<h4>Background</h4>The reproduction process in domestic animals is one of the most important challenges of animal husbandry. Fertility is an important trait that contributes to herd profitability and can be improved by genomic information. One of the best ways to investigate the association between single nucleotide polymorphisms (SNPs) and phenotypic performance is the genome-wide association study (GWAS). The aim of our study was to identify the genomic regions affecting reproductive traits, interval between first and last insemination (IFL), days open (DO), days from calving to first service (DFS), number of services per conception (NSPC), age at first calving (AFC) and age at first insemination (AFI) using SNP chip data in Iranian Holstein cows.<h4>Results</h4>GWAS analysis for all reproductive traits based on the significant-association threshold P < 1 × 10<sup>-8</sup>, led to the identification of 55 single nucleotide polymorphisms (SNPs) for IFL (n = 3), DFS (n = 0), DO (n = 5), NSPC (n = 5), AFI (n = 33), and AFC (n = 9) traits. Based on the results of gene ontology analysis, 54 different candidate genes for reproductive traits were identified in this study. For IFL, NSPCC, DO, AFC, and AFI traits 4, 8, 11, 10, and 21 candidate genes were identified in the vicinity of significant SNPs, respectively. Key genes with biologically important positions for heifers (ATG7, PTPN5, STAC, GAD2, PLXDC2, KARS1, PRIM2, and ZNF597) and cows (LPL, SERP2, BIRC6, CENPU, PIK3C3, and MYLK3) can be mentioned.<h4>Conclusions</h4>Our results identified 55 marker-trait associations (MTAs) and 54 different candidate genes associated with reproductive traits. As a result, the SNPs and candidate genes discovered in this study can be used in genomic experiments to improve the reproductive performance of Iranian Holstein dairy cows and provide new information about the genetic architecture of these traits.

Also flagged:gallstonescholesterollipidmembranesdigestionbile acid
Journal Article 2025-07-11 No Snippets Wuerch EC, Yong VW.
Show Full Abstract

Cholesterol plays critical roles throughout the body, including its function in cellular membrane formation and as a precursor for hormones and bile acids. Notably, the brain contains 25% of the body’s cholesterol, which remains separate from peripheral sources. Consequently, cholesterol within the central nervous system (CNS) must be efficiently recycled among neural cells, and disruptions in this recycling and metabolism have pathological consequences. This review explores the physiological functions of cholesterol particularly in the CNS, highlights lipid metabolism and recycling mechanisms within CNS cells for remyelination, and examines the role of cholesterol dysregulation in multiple sclerosis. Finally, we discuss therapeutic approaches targeting cholesterol metabolism, including statins, cyclodextrins and liver X receptor (LXR) agonists.

NEGR1
Also flagged:Obesitychronic metabolic diseaseenergy homeostasispathogenesislipasePYY
Journal Article 2025-07-11 ✓ 1 Snippet Tonin G, Eržen S, Mlinarič Z, Eržen DJ, Horvat S, Kunej T, Klen J.
In-Text Gene Mentions

neuronal growth regulator 1growth regulator 1…

Show Full Abstract

Obesity is a chronic metabolic disease characterized by disturbances in energy homeostasis, leading to excessive fat accumulation. The pathogenesis of the disease is shaped by a complex interplay of genetic, epigenetic, biological, psychological, and environmental factors. These contributors affect regulatory mechanisms in the hypothalamus, hormonal signaling, and the gut-brain axis, all of which control energy intake, expenditure, and energy utilization in body tissues. In this context, particular attention is given to the role of genetic factors, which have a major impact on an individual's susceptibility to disease and support the development of personalized preventive and therapeutic approaches. Modern obesity treatment goes beyond weight reduction and focuses on optimizing body composition by reducing fat mass and increasing lean mass. This review includes a detailed overview of the mechanisms and clinical effects of current pharmacological approaches to obesity treatment, alongside other established strategies such as lifestyle modifications and bariatric surgery. It specifically discusses lipase inhibitors, opioid antagonists, sympathomimetics, and GLP-1 receptor agonists. Looking ahead, emerging therapies-such as microbiota modulation, dual and triple drug combinations, PYY agonists, and monoclonal antibodies-are expected to play a crucial role in the management of obesity. Furthermore, this review explores the potential of CRISPR-based technology for monogenic obesity, opening new avenues for targeted obesity treatments and identifying promising research directions. In the time to come, personalized medicine might have a fundamental place in the management of obesity, providing tailored and more effective therapeutic approaches that prioritize the long-term improvement of body composition and health outcomes in patients.

PEBP1
Also flagged:Ferroptosis Suppressor Protein 1Ferroptosisdeathironlipidperoxides
Journal Article 2025-07-11 ✓ 1 Snippet Ventura C, Bogetti X, Lee JY, Bahar I.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Ferroptosis is a form of cell death characterized by iron-dependent accumulation of lipid peroxides. Ferroptosis suppressor protein 1 (FSP1) has been shown to work with glutathione peroxidase 4 (GPX4) to suppress ferroptosis through different antioxidant pathways. Many studies have been conducted on FSP1 to better understand its function and mechanism of action, which remained inconclusive in the absence of structural information on FSP1. Recent elucidation of FSP1 structures in different forms and advances in computational characterization of functional changes in its conformation provide us with the opportunity of dissecting FSP1 mechanism of action and gaining insights into critical sites and interactions that control its activity. We present the results from elastic network model analyses of cooperative changes in FSP1 structure, as well as those from molecular dynamics simulations of its interactions with the lipid bilayer and small molecules, toward assisting in future development of modulators of ferroptosis targeting FSP1. Our study reveals the critical role of N-terminal myristoylated tail in modulating the accessibility of the ligand-binding sites and in anchoring FSP1 to the membrane, giving insights into mechanisms of regulating FSP1 function.

Also flagged:endo-fucoidanasePsf1fucoidanoligosaccharidesfucoseglycoside hydrolase
Journal Article 2025-07-11 No Snippets Trang VTD, Mikkelsen MD, Christensen MD, Meier S, Hunt CJ, Holck J, Hreggviðsson GÓ, Freysdottir J, Cao HTT, Khanh HHN, Meyer AS.
Show Full Abstract

Bioactive sulfated fucoidans have high fucose content and are derived from brown seaweeds. Here we report the discovery of the first cold-adapted endo-α(1 → 3)-fucoidanase (EC 3.2.1.211), Psf1. The psf1 gene was found in the genome of Pseudoalteromonas sp. S3178, a bacterium isolated from a shrimp near Antarctica. Phylogenetic analyses designated Psf1 as a putative member of glycoside hydrolase family 107 (GH107). Substrate selectivity analysis confirmed Psf1 as being endo-acting and indicated that the enzyme catalyzes hydrolysis of α(1 → 3)-glycosidic fucoidan linkages. Psf1 had temperature optimum of 10-30 °C but retained activity at 1 °C. Structural modeling indicated similarity to the crystal structure of P5A_FcnA (Psychromonas sp. SW5A), yet distinct high variability regions were identified by RMSF. Psf1 released low molecular weight fucoidan oligosaccharides from Saccharina latissima fucoidan that dose-dependently reduced IL-12p40 secretion in dendritic cells, and lowered IFN-γ and IL-10 levels in dendritic cells co-cultured with allogeneic CD4<sup>+</sup> T-cells, without affecting IL-17 secretion, indicating a suppression of Th1-mediated immune response. Treatment of dendritic cells with native fucoidan from S. latissima did not affect cell viability or cytokine secretion. These findings have potential to enable new enzyme-assisted production, at low temperatures, of bioactive fucoidan oligosaccharides from S. latissima grown in the Northern Hemisphere.

Also flagged:Sjögren's Syndromechronic autoimmune disorderlymphomapathogenesiscytokinedesiccation syndrome
Journal Article 2025-07-11 No Snippets Hu Y, Wen B, Zhang Y, Wang X, Duan X, Li H, Fan Y, Shang H, Jing Y.
Show Full Abstract

Sjögren's syndrome (SS) is a chronic autoimmune disorder characterized by T-cell-mediated B-cell hyperactivity and cytokine production, clinically manifesting, dry mouth and eyes, accompanied by pain and fatigue. The disease may progress from asymptomatic glandular involvement to systemic manifestations or even lymphoma. The pathogenesis of SS is intricate, involving a multifaceted interplay of genetic, environmental, and immunological factors. There is still uncertainty regarding the effectiveness of SS-targeted treatments, due to the significant diversity in disease phenotypes and potentially varying responses to immunomodulatory therapies, stringent enrollment criteria and adoption of outcome metrics in clinical trials may partially explain the failure of many trials to achieve their primary outcomes. Despite the current lack of effective treatments, recent advancements have been made in epidemiology, the development of classification criteria, and the establishment of systems for assessing disease activity. Notably, enhanced insights into the pathogenesis have paved the way for the potential development of targeted therapies. This review aims to systematically synthesize the latest research advancements in the epidemiological characteristics, diagnostic criteria, molecular mechanisms, and clinical manifestations of SS, thereby providing a scientific foundation for the development of future therapeutic strategies.

VRK2
Also flagged:MAPKWntPI3KAktmTORRUNX2
Journal Article 2025-07-11 ✓ 1 Snippet Rong Y, Ao X, Han M, Xia Q, Shang F, Lv Q, Wang Z, Su R, Zhao Y, Zhang Y, Wang R.
In-Text Gene Mentions

…nine genes includingVRK2, FANCL, and FRY…

Show Full Abstract

<h4>Objective</h4>Inner Mongolia cashmere goats are superior indigenous breeds developed through long-term natural selection and systematic artificial selection, which have experienced a certain intensity of selection pressure during the breeding process, leading to bipolar differentiation trends in cashmere traits. Therefore, identifying genomic selection signatures associated with cashmere traits in Inner Mongolia cashmere goats is crucial for breeding high-quality cashmere-producing goats.<h4>Methods</h4>To unravel the genetic basis of cashmere traits, this study stratified 375 Inner Mongolia cashmere goats into eight subgroups based on breeding values for cashmere traits: high-yield vs low-yield cashmere types (HYCG vs LYCG), fine vs coarse cashmere types (FCG vs CCG), long vs short cashmere types (LCG vs SCG), and long vs short fleece types (LFCG vs SFCG). Whole-genome resequencing was performed for genotyping, followed by detection of selection signatures.<h4>Results</h4>Results revealed 144, 158, 147, and 147 high-frequency run of homozygosity (ROH) regions in HYCG, FCG, LCG, and LFCG subgroups, respectively, annotating to 515, 565, 510, and 521 genes. Additionally, genomic regions under positive selection were identified using Fst, θπ ratios, and XP-EHH methods, with overlapping regions detected by ≥2 methods defined as candidate regions. Gene annotation identified 777, 660, 712, and 726 candidate genes in HYCG vs LYCG, FCG vs CCG, LCG vs SCG, and LFCG vs SFCG comparisons, respectively. These genes were enriched in 3,051 GO terms and 318 KEGG pathways, including Hippo, MAPK, Wnt, PI3K-Akt, and mTOR signaling pathways associated with cashmere growth and development, involving genes such as LGR6, RUNX2, IGF1R, FGF9, and TCF7L1.<h4>Conclusion</h4>In this study, we employed four complementary approaches, including ROHs, Fst, θπ ratios, and XP-EHH, to identify genomic signatures of selection for cashmere traits in Inner Mongolia cashmere goats. These findings provide valuable insights for improving cashmere production performance and developing novel strains with highquality cashmere in Inner Mongolia cashmere goats.

Also flagged:Obesitychronic metabolic diseasetype 2 diabetescoronary heart diseasehypertensionobstructive sleep apnea
Journal Article 2025-07-11 No Snippets Khusainova R, Minniakhmetov I, Vasyukova O, Yalaev B, Salakhov R, Kopytina D, Guseinova R, Dobreva E, Melnichenko G, Dedov I, Mokrysheva N.
Show Full Abstract

Obesity is a chronic metabolic disease characterized by excessive accumulation or uneven distribution of fat in the body, which poses a serious threat to health. Obesity significantly increases the risk of developing сonditions such as type 2 diabetes, coronary heart disease, hypertension, obstructive sleep apnea, and some types of cancer. The prevalence of obesity, especially in childhood, has increased significantly worldwide over the past few decades. The World Health Organization predicts that 250 million children and adolescents aged 5-19 years will be obese by 2030, which indicates a global problem with far-reaching consequences. Advances in genomic technologies have led to the identification of multiple genetic loci associated with the disease ranging from severe cases with early onset to common multifactorial polygenic forms. Epigenetic changes driven by dietary and lifestyle factors are now recognized as crucial contributors to obesity. These modifications can alter gene expression and thereby link environmental influences to the observable clinical features of the disease. Significant progress has been made in deciphering the genetic architecture of obesity, particularly in pediatric populations. However, further advancement requires integrative multiomics analyses that encompass genomic, epigenomic, transcriptomic, proteomic, metabolomic, and microbiome data. To better understand the complex molecular underpinnings and clinical variability of obesity, researchers are increasingly applying methods from machine learning and artificial intelligence. These technologies help analyze large-scale genomic and phenotypic datasets, allowing for the identification of biological pathways involved in weight regulation. In the future, this may support the design of individualized diagnostic tools and targeted treatment plans that reflect a patient's genetic profile, lifestyle, and environmental exposures. To implement the principles of personalized and precision medicine in the treatment of obesity, it is crucial to identify risk profiles by assessing multiple contributing factors. This approach not only enables the prediction of an individual's risk of obesity and its associated diseases but also facilitates the optimization of treatment based on the patient's genetic profile. This study provides a comprehensive overview of the current understanding of childhood obesity, including its prevalence, genetic determinants, and pathophysiological mechanisms. It highlights the contribution of genetic factors to hereditary and syndromic forms, the role of gene-environment interactions (including nutrition and environmental pollutants), and the influence of epigenetic modifications on metabolic disturbances associated with polygenic obesity.

GPR52
Also flagged:Orphan Class A GPCRsGastric CancerGPR176TumorWntGPCRs
Journal Article 2025-07-11 ✓ 1 Snippet Lin J, Ke L, Cheng S, Lu W, Hu Y, He X, Luo T, Liu Y, Xu C, Qi J.
In-Text Gene Mentions

…GPR176, GPR1, GPR4,GPR52, and GPR85, with…

Show Full Abstract

<b>Background:</b> Orphan class A G protein-coupled receptors (GPCRs) are a large and diverse family with broad tissue expression, and their roles in tumors are increasingly recognized. However, their involvement in gastric cancer (GC) remains unclear. <b>Methods:</b> We performed survival and differential expression analyses to characterize orphan class A GPCR expression patterns in stomach adenocarcinoma (STAD). A prognostic risk model was developed using univariate Cox and LASSO regression analysis and validated in the GEO database. Drug sensitivity and immune infiltration were evaluated across different risk groups. The role of GPR176 in GC and its relationship with tumor immunity were further explored using cellular assays. <b>Results:</b> A model incorporating nine orphan class A GPCRs (GPR15, GPR150, GPR176, GPR4, GPR26, GPR78, GPR101, GPR34, and GPR87) was constructed, showing a positive correlation with M2 macrophages and naive B cells. Low-risk patients showed higher sensitivity to AZD6482, BX.795, GDC0941, and pazopanib. GPR176 was found to be upregulated in GC, and functional assays demonstrated that its knockdown suppressed proliferation and migration in the GC cell lines SGC-7901 and HGC-27. GPR176 also modulated the Wnt/β-catenin pathway and M2 macrophage polarization. <b>Conclusion:</b> These findings may provide new insights into the role of orphan class A GPR genes in STAD and identify GPR176 as a new therapeutic target for GC.

Also flagged:cervical cancerpeptidecancerprostate cancerpeptidesnaproxen
Journal Article 2025-07-11 No Snippets Castellar-Almonacid DA, Barragán-Cárdenas AC, Rodríguez-Mejia KG, Maldonado-Sanabria LA, Ardila-Chantré N, Mendoza-Mendoza JD, Parra-Giraldo CM, Rivera-Monroy JE, Rivera-Monroy ZJ, García-Castañeda JE, Fierro-Medina R.
Show Full Abstract

Previous studies have shown that the palindromic peptide RWQWRWQWR derived from bovine lactoferricin (LfcinB) has exhibited selective <i>in vitro</i> cytotoxic effects against multiple cancer cells such as cervical, breast, and prostate cancer. We designed and synthesized peptides based on this palindromic sequence conjugated with non-steroidal anti-inflammatory drugs (NSAIDs) such as naproxen and ibuprofen to obtain novel hybrid peptides that could trigger inflammatory processes within cancer cells. Incorporating the non-natural amino acid ornithine as a spacer was done to improve the aqueous solubility of the NSAID-peptide conjugates. The antibacterial activity of the conjugated peptides was evaluated, and these peptides showed significant activity against <i>E. coli</i> strain ATCC 25922, with MIC values of 12 μM. Cytotoxicity was assessed in human cervical cancer cells (HeLa) and human melanoma cells (A375), showing that the NSAID-conjugated peptides retained and even exhibited better anticancer activity compared to the palindromic peptide from which they were derived. The NSAID-LfcinB conjugates showed good selectivity towards cancer cells in the concentration ranges evaluated, being non-hemolytic. The cytotoxic effect of the IBU-Orn<sub>3</sub>-1 and NAP-Orn<sub>3</sub>-1 peptides was rapid and selective, inducing severe morphological changes, including rounding, shrinkage, and vacuole formation, which are associated with apoptosis. Flow cytometry assays revealed that the ibuprofen-conjugated palindromic sequence induced apoptosis independently of peptide concentration and treatment duration. These results suggest that the palindromic peptide RWQWRWQWR could be used for new applications in cancer research, such as delivering small molecules with anti-inflammatory activity in tumoral environments. The conjugation of NSAIDs to anticancer peptide sequences is a novel, viable, and rapid strategy that facilitates the synthesis of hybrid peptides with enhanced anticancer activity, thereby expanding the pool of promising molecules for preclinical and clinical studies in cancer therapy development.

OLFM4
Also flagged:depressionmood disorderpathogenesisBipolar DisorderSchizophrenianeurological disorders
Journal Article 2025-07-11 ✓ 1 Snippet Yan M, Chen M, Jiang Q, Huang H, Wu Y.
In-Text Gene Mentions

…17 genes (includingOLFM4, PXDNL, NDUFA2, etc.)…

Show Full Abstract

<h4>Introduction</h4>Major Depressive Disorder (MDD), also known simply as depression, is a serious and common mood disorder. However, the potential pathogenesis and target genes of the disease have not been well illustrated.<h4>Methods</h4>We identified differentially expressed genes(DEG) using the published transcriptome data GSE80655 from postmortem brain tissues of 69 MDD patients, 71 Bipolar Disorder (BD) patients, and 71 Schizophrenia(SZ) patients and 70 controls. Another brain expression dataset included geneexpression profiles from six cortical and limbic brain regions of 34 patients with MDD and 55 control subjects without any history of psychiatric or neurological disorders. GO enrichment analysis was performed on DEGs.Weighted gene Co-expression network analysis (WGCNA) was conducted on DEGs. Subsequently,we extracted the modules determined by WGCNA and calculated the correlation of the modules with diseases or brain tissue regions. The modules specifically related to MDD were screened. Module genes are employed for gene function enrichment analysis.Enriched genes in biological pathways are used to construct the gene regulatory network, and the genes with the highest connectivity are classified as hub genes.<h4>Results</h4>DEGs related to MDD, BD, or SZ were screened. And by WGCNA, we determined the gene modules associated with MDD but not with BD and SZ. The MDD-related modules were further compared with the gene expression data from postmortem brain tissue of MDD patients in another group, and one of the gene modules which was enriched in the biological pathway related to mitochondrial oxidative phosphorylation and ubiquitination, was screened.Gene regulatory network analysis showed that the hub genes were PARK2, CUL1, SKP1, CYC1, and ATP5A1.The mitochondrial oxidative phosphorylation and ubiquitination related biological pathways are involved in the process of MDD.<h4>Discussion</h4>The hub genes may provide possible candidates for MDD targeted therapy that is worth exploring.

DCC
Also flagged:methylationesophageal cancermalignant tumorcancercancersesophageal squamous cell carcinoma
Journal Article 2025-07-11 ✓ 2 Snippets Tang J, Shi X, Song C, Zhang W, Yan Y, Dai L, Wu D, Qiu J, Liu J, Wang T, Lu Z.
In-Text Gene Mentions

…in colorectal cancer (DCC) gene is absent…

…al. found thatDCCmethylation was detected…

Show Full Abstract

Esophageal cancer (EC) is a malignant tumor with high mortality rates, where early screening and diagnosis are critical for improving patient outcomes. DNA methylation, a key epigenetic modification, has emerged as a significant biomarker for early detection of EC. The advancement in DNA methylation sequencing technologies, including first-generation and next-generation sequencing (NGS), has revolutionized the way we identify and analyze these biomarkers. First-generation sequencing, has been instrumental in identifying specific methylation sites. However, its limited throughput renders it impractical for large-scale screening of multiple samples. In contrast, NGS offers high-throughput capabilities, allowing for the simultaneous analysis of thousands of DNA fragments. NGS significantly enhances the efficiency and accuracy of DNA methylation profiling, permitting genome-wide identification of multiple methylation markers. This approach offers a promising avenue for the enhanced early detection of EC by providing a comprehensive view of the methylation landscape. The integration of NGS into clinical practice is capable of transforming EC screening by offering heightened sensitive and specific approach to identifying patients at risk. As our comprehension of the role of DNA methylation in cancer progression deepens, the development of targeted therapies based on methylation profiles may also become a reality. In conclusion, the evolution of DNA methylation sequencing technologies has unlocked new avenues for the early EC detection. While first-generation sequencing has laid the groundwork for characterizing specific methylation events, NGS has expanded the scope of screening, offering a more robust and scalable solution for identifying early-stage EC.

OLFM4
Also flagged:Sepsisimmune responsesinfectioncytokinelymphocyte differentiationantigen presentation
Journal Article 2025-07-11 ✓ 5 Snippets Taha S, Bindayna K, Aljishi M, Sultan A, Almansour N.
In-Text Gene Mentions

…transcriptomic assay targetingOLFM4, S100A12, and HLA-DRA.…

…ElevatedOLFM4and S100A12 combined…

…lammatory signaling, includingOLFM4, LCN2 ,…

…neutrophil-associated genes (OLFM4, S100A12 )…

…diagnostic panel targetingOLFM4and S100A12 could…

Show Full Abstract

Sepsis is a life-threatening condition characterized by dysregulated immune responses to infection. To elucidate early transcriptional changes in sepsis, we conducted a case-control study profiling gene expression in whole blood from 20 early-stage sepsis patients and 9 healthy controls. Using Affymetrix Clariom D Human Arrays and robust preprocessing, we identified differentially expressed genes (DEGs) using standard bioinformatic pipelines. A total of 344 genes were significantly upregulated, while 9703 were significantly downregulated in sepsis patients (|log2FC| > 1, adjusted <i>p</i> < 0.05). Pathway enrichment and Gene Ontology analysis revealed activation of innate immune pathways, neutrophil degranulation, and cytokine signaling, alongside suppression of lymphocyte differentiation and antigen presentation. These results suggest a shift toward an innately driven inflammatory state in early sepsis. Our findings provide transcriptomic insights that may support the development of early diagnostic biomarkers and therapeutic targets.

Also flagged:Cancerpolyglutamic acidbiotintetraphenylethyleneiminepaclitaxel
Journal Article 2025-07-11 No Snippets Liu Z, Zong Z, Li X, Sun S.
Show Full Abstract

In this paper, a multifunctional polymer BT-PGA-TPE-HNPE was designed and synthesized by modifying γ-polyglutamic acid (γ-PGA) with biotin, the tetraphenylethylene derivative O-TPE-HNPE and an acid-sensitive imine bond. The polymer was used to fabricate paclitaxel (PTX)-loaded micelles. As expected, the BT-PGA-TPE-HNPE micelles demonstrated strong AIE characteristics, fluorescing yellow under normal conditions and blue in acidic settings. Moreover, the drug was specifically released under acidic conditions. In vitro and in vivo tumor suppression experiments showed that the micelles had enhanced antitumor activity with minimal systemic toxicity. The BT-PGA-TPE-HNPE micelles had wide application prospects in the fields of chemotherapy and bioimaging.

CCPG1
Also flagged:CYP4AdegradationSQSTM1p62P450 hemoproteinsendoplasmic reticulum
Journal Article 2025-07-11 ✓ 1 Snippet He L, Kwon D, Trnka MJ, Liu Y, Yang J, Li KH, Totah RA, Johnson EF, Burlingame AL, Correia MA.
In-Text Gene Mentions

…FAM134B, RTN3L, SEC62,CCPG1, ATL3, and TEX264.…

Show Full Abstract

The hepatic P450 hemoproteins CYPs 4A are typical N-terminally anchored type I endoplasmic reticulum (ER) proteins, inducible by many hypolipidemic drugs and peroxisome proliferators. They are engaged in the ω-/ω-1-oxidation of various fatty acids including arachidonic acid, prostaglandins, and leukotrienes and in the biotransformation of some therapeutic drugs. Because the proteolytic turnover of the mammalian liver CYPs 4A remains obscure, we have characterized it. We report that of these proteins, human CYP4A11 and mouse Cyp4a12a are preferential targets of the ER-lysosome-associated degradation. Consequently, these proteins are stabilized 2- to 3-fold both as 1%Triton X100-soluble and insoluble species in mouse hepatocytes and HepG2 cells deficient in the autophagic initiation ATG5 gene. Despite exhibiting surface microtubule-associated protein light chain 3-interacting regions that could target them directly to the autophagosome, they nevertheless interact intimately with the autophagic receptor SQSTM1/p62. Through structural deletion analyses and site-directed mutagenesis, we have identified the CYP4A-interacting p62 subdomain to lie between residues 170 and 233, which include its Traf6-binding and LIM-binding subdomains. Mice carrying a liver-specific genetic deletion of p62 residues 69-251 (p62Mut) that includes the CYP4A-interacting subdomain also exhibit Cyp4a-protein stabilization as 1% Triton X100-soluble and insoluble species. Consistently, p62Mut mouse liver microsomes exhibit 1.5- to 2-fold enhanced ω- and ω-1-arachidonic acid hydroxylation to its physiologically active metabolites 19 and 20-HETEs relative to the corresponding wild-type mouse liver microsomes. Collectively, our findings suggest that disruption of CYP4A ER-lysosome-associated degradation results in functionally active P450 protein stabilization and consequent proinflammatory metabolite generation along with insoluble CYP4A aggregates, which may contribute to pathological aggregates, ie, Mallory-Denk bodies/inclusions, hallmarks of many liver diseases. SIGNIFICANCE STATEMENT: Human CYP4A11 and mouse Cyp4a12a, liver P450 enzymes engaged in ω-/ω-1-oxidation of arachidonic acid, prostaglandins, and leukotrienes, are documented to physiologically turn over via endoplasmic reticulum-lysosome-associated autophagic degradation, which involves their intimate association with the autophagic receptor SQSTM1/p62. Genetic endoplasmic reticulum-lysosome-associated autophagic degradation disruption or deletion of their hepatic p62-interaction subdomain in mice results in Cyp4a-protein stabilization as functionally active solubilizable species with consequently enhanced proinflammatory 20-HETE arachidonate metabolite generation and insoluble Cyp4a aggregates, potential contributors to pathologic liver inclusions.

POU3F2
Also flagged:POU3F3hepatocellular carcinomasorafenibferroptosistumorchromatin
Journal Article 2025-07-10 ✓ 1 Snippet Tian Y, Bao X, Lei S, Huang Y, Wang X, Tu Y, He Q, Zhang F, Xu H, Ashrafizadeh M, Sethi G, Wang F, Zeng Z.
In-Text Gene Mentions

…by the genePOU3F2) has been shown…

Show Full Abstract

<h4>Background</h4>Sorafenib, a ferroptosis agonist, is a first-line treatment for advanced hepatocellular carcinoma (HCC). However, its clinical efficacy is limited due to drug resistance, resulting in modest improvements in patient survival. Hence, the present study has been designed to identify critical molecular targets associated with sorafenib resistance and investigate the potential inhibitors in overcoming this therapeutic challenge.<h4>Methods</h4>In vivo whole-genome CRISPR/Cas9 library screens were conducted to identify resistance factors to ferroptosis agonists, such as RSL3 and sorafenib, in HCC. The effects and underlying molecular mechanisms of these resistance factors were investigated in HCC cells using ferroptosis detection assays, xenograft tumor models, chromatin immunoprecipitation (ChIP), and dual-luciferase reporter assays. Potential inhibitors targeting these factors were evaluated through computer-aided virtual screening, molecular dynamics simulations, surface plasmon resonance analysis, and functional evaluations.<h4>Results</h4>A retinoic acid metabolism gene cluster, including ADH4, ALDH1A1, ALDH1A3, FABP5, RBP1, and RDH10, was found demonstrating upregulation in HCC cells treated with ferroptosis agonist, sorafenib. This gene cluster contributes to the ferroptosis resistance by producing the strong reducing agent retinoic acid. The transcription factor POU3F3 was identified as a key regulator for the retinoic acid metabolism gene cluster, which simultaneously binds to their promoters, increasing their transcription and promoting retinoic acid production. Knockdown of POU3F3 significantly enhanced the pro-ferroptotic and inhibitory effects of sorafenib on HCC cells by suppressing retinoic acid metabolism. Furthermore, rosarin was identified as a POU3F3 inhibitor, with an equilibrium dissociation constant of 7.57 µM, and demonstrated a synergistic effect with sorafenib against HCC cells both in vitro and in vivo.<h4>Conclusions</h4>According to the results, POU3F3 acts as a protective regulator against sorafenib-induced ferroptosis in HCC cells by enhancing the transcription of multiple retinoic acid metabolism genes and promoting retinoic acid production. The POU3F3 inhibitor, rosarin, shows potential as an ideal candidate for overcoming sorafenib resistance in HCC.

Also flagged:Acute Leukemiasacute leukemiaMPALacute undifferentiated leukemiaMRRUNX1
Journal Article 2025-07-10 No Snippets Kirtek TJ, Weinberg OK.
Show Full Abstract

The recent fifth edition WHO classification and ICC classification systems have moved further toward genetically defined classifications of acute leukemias. Both now recognize myelodysplasia-related (MR) mutations as defining of MDS-related AML (AML-MR). Acute leukemias of ambiguous lineage (ALAL) are a heterogenous group of acute leukemias characterized by leukemic blasts that either express markers of multiple lineages, mixed phenotype acute leukemia (MPAL), or too few to be assigned a definitive lineage, acute undifferentiated leukemia (AUL). However, the recent classifications are unclear on how ALALs should be categorized in the presence of MR mutations. In short, the current recommendations are to classify cases that are immunophenotypically consistent with ALAL but harbor MR cytogenetics or mutations as AML-MR. Due to their rarity, investigations into the genetic basis of ALAL are limited but show great heterogeneity in their mutational landscapes. Data on the frequencies and significance of MR mutations in ALAL is particularly scant. Our comprehensive review of the literature reporting on the genetic landscapes of MPAL and AUL shows that a significant proportion of MPAL and AUL cases, ~32% and ~59% on average respectively, may harbor one or more mutations in MR genes, with mutations in RUNX1 and ASXL1 among the most common. Additional research is needed into the clinical, immunophenotypic, and genetic characteristics of ALAL to aid in refining classification and to support therapeutic decision making.

HFE
Also flagged:liver cirrhosisdiabetesliver diseaseBCAAcirrhosisamino acids
Journal Article 2025-07-10 ✓ 1 Snippet Li Y, Chvatal-Medina M, Trillos-Almanza MC, Connelly MA, Moshage H, Bakker SJL, de Meijer VE, Blokzijl H, Dullaart RPF, TransplantLines Investigators.
In-Text Gene Mentions

…(e.g. Wilson's disease,hemochromatosisand alpha‐1 antitrypsin…

Show Full Abstract

<h4>Background and aims</h4>Branched-chain amino acids (BCAA) have gained increasing recognition for their role in liver disease. This study investigated plasma BCAA alterations in patients with cirrhosis and liver transplant recipients (LTRs) and examined their associations with all-cause mortality and new-onset type 2 diabetes in LTRs.<h4>Methods</h4>Plasma BCAA concentrations were measured using nuclear magnetic resonance spectroscopy in 129 patients with cirrhosis and 367 LTRs from the TransplantLines cohort study (NCT03272841), and compared with 4834 participants from the population-based PREVEND cohort. Kaplan-Meier survival analysis and Cox regression analysis were performed.<h4>Results</h4>Total BCAA levels were significantly lower in patients with cirrhosis and LTRs than in PREVEND participants (p < .001). While total BCAA levels increased post-transplant, they remained lower than those in PREVEND (p < .001). The highest total BCAA tertile was associated with better survival versus the lowest BCAA tertile in patients with cirrhosis (log-rank p = .002). In Cox regression analysis adjusted for relevant co-variates, higher total BCAA levels were also associated with reduced mortality in patients with cirrhosis (HR .19 [95% CI: .04-.86], p = .031). In LTRs, the highest total BCAA tertile conferred a higher probability of new-onset diabetes (log-rank p = .004) but was not linked to mortality (log-rank p = .65). After adjusting for age, sex, and immunosuppressant use, the highest tertile of total BCAA levels remained independently associated with new-onset diabetes in LTRs (HR 1.42 [95% CI: 1.10-1.82], p = .006).<h4>Conclusions</h4>Total BCAA levels increase after liver transplantation. In patients with cirrhosis, higher total BCAA levels are associated with reduced all-cause mortality. Although this association is not evident in LTRs, higher total BCAA levels are strongly linked to an increased risk of new-onset type 2 diabetes, warranting further investigation.

MLLT10
Also flagged:LIM domain only 2LMO2transcription factorsGATATAL1LYL1
Journal Article 2025-07-10 ✓ 1 Snippet Stanulović VS, Binhassan S, Jaber BA, Alazmi S, Saleman FMB, Potluri S, Pratt G, Ludwig C, Ward DG, Hoogenkamp M.
In-Text Gene Mentions

…the KMT2A andMLLT10subtypes.…

Show Full Abstract

The transcriptional mediator LIM domain only 2 (LMO2) forms a large multi-protein complex together with TAL1/LYL1, HEB/ E2A, LDB1 and GATA. This complex regulates transcription from the onset of hematopoietic development and during differentiation. Chromosomal re-arrangements involving LMO2 and TAL1 are causative for T-cell lymphoblastic leukemia (T-ALL). We have identified Plant Homeodomain (PHD)-like Finger 6 (PHF6) as a new LMO2-interacting factor. Somatic mutations in PHF6 have been found to occur in several types of leukemia. We show that PHF6 interacts with LMO2 as a part of the TAL1, GATA2, LDB1 complex in T-ALL and binds to the DNA. These findings show that PHF6 associates with the TAL1/LMO2/LDB1/ GATA2 complex and regulates genes that have a major role in blood development, such as SPI1 (PU.1).

Also flagged:neurofilamentneurofilament lightneurological disordersGFAPtaumultiple sclerosis
Journal Article 2025-07-10 No Snippets Coleman A, Touzé A, Farag M, Pengo M, Murphy MJ, Hassan Y, Thackeray O, Fayer K, Field S, Nakajima M, Broom EL, Hobbs NZ, Huxford B, Donkor N, Camboe E, Dey KC, Zirra A, Ahmed A, Gameiro Costa AR, Sorrell H, Zampedri L, Lombardi V, Wade C, Mangion S, Fneich B, Heslegrave A, Zetterberg H, Scahill R, Noyce A, Malaspina A, Chataway J, Tabrizi SJ, Byrne LM.
Show Full Abstract

Promising blood-based biomarkers of neuropathology have emerged with potential for therapeutic development and disease monitoring. However, these tools will require specialist tertiary services for integration into clinical management. Remote sampling for biomarker assessment could reduce burden of in-person clinical visits for such tests as well as increasing the sampling frequency and patient geographical outreach. Here, we evaluated a finger-prick blood collection approach for remote quantification of neurofilament light (NfL), a candidate blood-based biomarker evident in various neurological disorders, and other exploratory markers of neuronal injury and neuroinflammation (GFAP, tau). Matched samples from venepuncture and finger-prick were collected and processed into plasma and/or serum to directly compare analyte levels from a multi-disease discovery cohort (n = 54 healthy controls; n = 57 Huntington's disease (HD); n = 34 multiple sclerosis; n = 7 amyotrophic lateral sclerosis; n = 11 Parkinson's disease), and a HD confirmatory cohort (n = 57 healthy controls; n = 64 HD). Two delayed processing conditions were compared, three- and seven-day delay, simulating ambient shipment. Capillary NfL and GFAP concentrations were equivalent to those in venous serum and plasma in the multi-disease discovery cohort and HD confirmatory cohort. Only NfL remained stable after a seven-day processing delay in both venous and capillary serum samples. Using NfL concentrations from capillary blood, we replicated previously published disease group differences measured in venous blood. This data supports our finger-prick approach for remote collection and quantification of NfL. With the widespread applications for NfL across the spectrum of neurological disorders, this has the potential to transform disease monitoring, prognosis, and therapeutic development within clinical practice and research.

TNFSF4
Also flagged:RORAgastric cancerEBVaGCimmune responsetumorgene expression
Journal Article 2025-07-10 ✓ 1 Snippet Du C, Liang S, Wang X, Qi Y, Li S, Li H.
In-Text Gene Mentions

…CD86, HHLA2, CD160,TNFSF4, TNFSF18, TNFRSF8, CD244,…

Show Full Abstract

<h4>Background</h4>Epstein-Barr virus-associated gastric cancer (EBVaGC) represents a distinct molecular subtype of gastric cancer. EBV encodes various viral RNAs, including BamHI-A rightward transcripts (BARTs), which are implicated in the carcinogenic processes of EBVaGC. This study aims to explore the function and underlying mechanisms of EBV-miR-BART5-5p in gastric cancer, providing a basis for the identification of more effective biomarkers for EBVaGC.<h4>Methods</h4>Gene expression data were first downloaded from the GSE51575 dataset to identify differentially expressed genes and construct a WGCNA network, which led to the identification of RORA as a key gene associated with EBV-miR-BART5-5p. We then analyzed the TCGA dataset to investigate the differential expression and prognostic significance of RORA in gastric cancer. Further analysis explored RORA's enriched pathways and its relationship with immune response, tumor mutation burden, and drug sensitivity. Single-cell gene expression characteristics of RORA were assessed using the GSE134520 dataset. RT-qPCR was employed to determine RORA expression levels in both EBV-positive and -negative gastric cancer cell lines. Western blotting and dual-luciferase reporter assays confirmed the targeting of RORA's 3' UTR by EBV-miR-BART5-5p. Finally, a series of functional experiments demonstrated that EBV-miR-BART5-5p promotes proliferation and migration of both EBV-positive and -negative gastric cancer cells.<h4>Results</h4>In this study, differential expression and WGCNA analyses identified 910 co-expressed genes. We then investigated miR-BART5-5p in EBV-positive gastric cancer and identified RORA as a potential target gene. Our analysis revealed that RORA expression is lower in tumor samples compared to normal samples, and single-cell analysis showed significant upregulation of RORA in CD8 + T cells. Experimental data further demonstrated that RORA is expressed at lower levels in EBV-positive gastric cancer cell lines and that EBV-miR-BART5-5p targets the 3' UTR of RORA. This suggests that EBV-miR-BART5-5p may promote gastric cancer cell proliferation and migration by regulating RORA.<h4>Conclusion</h4>Our study reveals the molecular characteristics of EBV-associated gastric cancer, establishes a prognostic model for RORA in gastric cancer, and demonstrates that EBV-miR-BART5-5p may target and inhibit RORA to promote gastric cancer cell proliferation and migration. These findings highlight EBV-miR-BART5-5p could serve as a diagnostic biomarker and a potential therapeutic target for gastric cancer.

Also flagged:coronavirus disease 2019COVID-19infectionanxietydepressionsleep
Journal Article 2025-07-10 No Snippets Guo Y, Pan N, Zou Y, Long Y, Zhang X, Li Q, Suo X, Singh MK, Wang S, Gong Q.
Show Full Abstract

The COVID-19 pandemic has posed an unprecedented threat to global health. However, neural substrates underlying mental health vulnerabilities brought by the pandemic remain elusive. We conducted a systematic review relating structural and functional brain abnormalities to mental health issues associated with COVID-19 at brain regional and network levels. A literature search on neuroimaging studies of mental health problems derived by COVID-19 was conducted in the PubMed, Web of Science and MEDLINE databases. We identified 46 studies across various imaging techniques and found that COVID-19-related mental health problems were principally associated with brain structural and functional alterations in the prefrontal cortex, insula, cingulate, hippocampus, and amygdala, as well as the affective cortical network. This review may facilitate the targeted development of therapies tailored to the pandemic context and provide insights for proactive prevention against future collective stressors and traumas.

TNFSF4
Also flagged:NSUN6cancersmethylationcentrosomescancercarcinoma
Journal Article 2025-07-10 ✓ 1 Snippet Gao J, Xu Y, Tian C, Zhang Q, Zhang M, Shan H, Shi J, Ming Z, Yang S, Yang X.
In-Text Gene Mentions

…, LAIR1 ,TNFSF4, CD244 ,…

Show Full Abstract

<h4>Background</h4>NSUN6 is a regulator of tRNA methylation that partially exists in the Golgi and centrosomes. It catalyzes the methylation of tRNA<sup>Cys</sup> and tRNA<sup>Thr</sup> at the C72 site, which affects tRNA generation. However, its expression, prognosis, and immune invasion in pan-cancer have not been studied. This extensive research tapped into the TCGA database, gathering 33 carefully paired sets of cancer and nearby normal tissues, covering a broad spectrum of 33 different cancer types. Moreover, this study explored how NSUN6 expression relates to the presence of immune and stromal cells in the tumor's intricate immune environment. To further understand NSUN6's role, a detailed Gene Set Enrichment Analysis (GSEA) was conducted, revealing its enrichment patterns in various carcinoma subtypes and hinting at its involvement in tumor growth. Analysis of NSUN6 expression patterns revealed a significant increase in eight cancer types, including lung adenocarcinoma and pancreatic cancer (P < 0.001). Additionally, a reduction was observed in six cancer types, such as cholangiocarcinoma and thyroid cancer (P < 0.001). Survival analysis indicated that individuals with lung adenocarcinoma, pancreatic cancer, and other cancers expressing high levels of NSUN6 had improved prognosis. The association between NSUN6 expression and patient outcomes was evident, including overall survival, disease-specific survival, disease-free interval, and progression-free interval. Furthermore, individuals with high levels of NSUN6 expression showed significantly longer survival times than those with low levels (P < 0.05). The involvement of NSUN6 in immune infiltration was evident, GSEA showed a significant correlation between NSUN6 expression and the five most significant enrichment pathways in different tumors. The NSUN6 gene functions as an initial indicator for diagnosis in renal clear cell carcinoma, pancreatic cancer, lung adenocarcinoma, and low-grade brain glioma. There is an association between its elevated expression and the predictive outcome, as well as the immune system's infiltration, in 33 varieties of cancer. This study is limited by its reliance on in silico analyses without experimental validation. Additionally, the use of publicly available datasets may introduce variability due to differences in data sources and platforms.

Also flagged:Diabetes mellitusinsulin resistanceinsulincardiovascular diseaserenal insufficiencyretinopathy
Journal Article 2025-07-10 No Snippets Wang Y, Li H.
Show Full Abstract

Thyroid eye disease (TED) and diabetes mellitus (DM) cause vision loss, with DM aggravating TED. In this study, we aimed to explore the mechanisms of this interaction, and therefore, analyzed gene expression data from representative TED and DM datasets using bioinformatic tools. Following normalization and differential expression analysis, common differentially expressed genes (CDEGs) between the datasets were identified and subjected to Gene Set Enrichment Analysis (GSEA), as well as Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analyses. Interaction networks were constructed and the diagnostic potential of the CDEGs was assessed using receiver operating characteristic (ROC) curve analysis. The TED_Dataset and DM_Dataset contained 449 and 108 DEGs, respectively, with seven CDEGs. GO and KEGG analyses linked the CDEGs to biological processes including leukocyte adhesion and apoptosis. GSEA emphasized their roles in inflammation and fibrosis. Protein-protein interaction network analysis identified MFAP4 as a key hub gene. Constructed mRNA-transcription factor, mRNA-RNA binding protein, mRNA-microRNA, and mRNA-drug interaction networks revealed extensive regulatory relationships. ROC curve analysis demonstrated that CXCL12 and SFRP4 were potential diagnostic biomarkers for TED, and SFRP4, IL6, MFAP4, and CRISPLD2 were potential diagnostic biomarkers for DM. Altogether, our findings provide comprehensive molecular insights into DM and TED, identifying novel targets for therapeutic intervention and diagnostic biomarkers.

Also flagged:TumorEsophageal Squamous Cell Carcinomaangiogenesisesophageal cancerCD31alpha smooth muscle actin
Journal Article 2025-07-10 No Snippets Tun HT, Fujisawa M, Ohara T, Nishimura S, Kunitomo T, Noma K, Matsukawa A.
Show Full Abstract

<h4>Background</h4>Angiogenesis is essential for tumor progression. Microvessel density (MVD) is a widely used histological method to assess angiogenesis using immunostained sections, but its prognostic significance in esophageal cancer remains controversial. Recently, the evaluation of microvascular architecture has gained importance as a method to assess tumor aggressiveness. The present study aimed to identify the histological characteristics of tumor microvessels that are associated with the aggressiveness of esophageal squamous cell carcinoma.<h4>Patients and methods</h4>A total of 108 esophageal squamous cell carcinoma tissues were immunohistochemically stained with blood vessel markers and angiogenesis-related markers, including CD31, alpha smooth muscle actin, vascular endothelial growth factor A (VEGF-A), CD206, and D2-40. MVD, microvessel pericyte coverage index (MPI), and tumor vascular morphology were evaluated by microscopy.<h4>Results</h4>MVD was significantly associated with patient outcomes, whereas neither MPI nor VEGF-A expression throughout the tumor showed a significant correlation. In addition, the presence of blood vessels encircling clusters of tumor cells, termed C-shaped microvessels, and excessively branching microvessels, termed X-shaped microvessels, was significantly associated with poor prognosis. These vessel types were also correlated with clinicopathological parameters, including deeper invasion of the primary tumor, presence of lymph node metastasis, advanced pathological stage, and distant metastasis. Focal VEGF-A immunoexpression in tumor cells was higher in areas containing C-shaped or X-shaped microvessels compared with areas lacking these vessel morphologies.<h4>Conclusions</h4>The data suggest that tumor microvessels with specific morphologies (C-shaped and X-shaped microvessels) may serve as a promising prognostic factor in esophageal squamous cell carcinoma.

SOX6
Also flagged:Critical limb ischemiadiabetesdiabeticangiogenesisoxygenextracellular
Journal Article 2025-07-10 ✓ 5 Snippets Cheng Z, Truongcao MM, Mallaredy V, Cimini M, Thej C, Joladarashi D, Gonzalez C, Benedict C, Verma SK, Garikipati VNS, Kishore R.
In-Text Gene Mentions

…Further, we identifySOX6as a direct…

…targets transcription factorSOX6in ECs…

…and Mirtarget identifiedSOX6, a member of…

…human and murineSOX63’UTR (Fig. S6…

…HMVECs significantly reducedSOX6mRNA expression compared…

Show Full Abstract

<h4>Background</h4>Emerging evidence suggests that skeletal muscle cells (SKMC) play critical roles in the defective angiogenic response in diabetic critical limb ischemia. However, the molecular mechanisms linking skeletal muscle to impaired angiogenic properties of endothelial cells (EC) remain unidentified. The current study investigates how muscle-specific miR-499-5p may impair EC function in diabetic ischemic limbs.<h4>Methods</h4>Eight-week-old, male C57BL/6 J, db/ + and db/db mice were employed. Hind limb ischemia was established by unilateral ligation of the left femoral artery, and blood flow recovery was monitored using Laser Doppler perfusion imaging (LDPI). ECs and SKMCs were isolated from sham or ischemic hind limbs (IHL). SKMC-derived small extracellular vesicles (SKMC-sEVs) were isolated from the culture medium of SKMCs by ultra-centrifugation.<h4>Results</h4>miR-499-5p level was markedly increased in SKMCs and unexpectedly in ECs from hindlimb of db/db mice. Ischemic injury further enhanced miR-499-5p levels in ECs from IHL of db/db mice. Angiogenic activity was reduced in ECs from IHL of db/db mice and in miR-499-5p-overexpressing ECs. Intramuscular injection of lentiviral-anti-miR-499-5p improved blood perfusion and angiogenesis in IHL of db/db mice. Mechanistically, we found that diabetic SKMC sEVs carried high levels of miR-499-5p and transferred miR-499-5p to ECs. Intramuscular injection of diabetic SKMC-sEVs repressed IHL recovery in wildtype mice. Blocking sEV biosynthesis/release by GW4869 markedly improved neovascularization and blood perfusion in IHL of db/db mice. We identified that SRY (Sex-Determining Region Y)-Box 6 (SOX6) is a direct downstream target of miR-499-5p. Silencing of SOX6 suppressed release of proangiogenic factors from ECs. Targeted reduction of miR-499-5p significantly enhanced SOX6 levels in ECs from IHL of db/db mice. Finally, overexpression of SOX6 improved the angiogenic property of ECs from IHL of db/db mice.<h4>Conclusions</h4>SKMC-sEV-mediated transfer of myo-miR-499-5p and subsequent suppression of SOX6 plays a critical role in diabetes-impaired neovascularization in IHL of db/db mice. Targeting miR-499-5p-mediated pathogenic communication between SKMCs and ECs may be a novel therapeutic avenue for critical limb ischemia in diabetic patients.

Also flagged:Triple-negative breast cancerbreast cancerhormone receptorsHER2tumorstumor
Journal Article 2025-07-10 No Snippets Nimbalkar VP, Snijesh VP, Rajarajan S, Anupama CE, Mahalakshmi S, Alexander A, Dechamma D, Moorthy M, Ramaswamy G, Ramesh R, Srinath BS, Prabhu JS.
Show Full Abstract

<h4>Background</h4>Triple-negative breast cancer (TNBC) lacks targeted therapies, leading to a poor prognosis. Younger patients with TNBC often present with aggressive disease and exhibit distinct tumor microenvironments (TME). We performed spatial profiling to understand the influence of menopausal status on the immune environment, tumor progression, and therapy response.<h4>Methods</h4>Eleven treatment-naive TNBC tumors were examined in epithelial and non-epithelial areas using digital spatial profiling to identify differentially expressed markers and pathways. Deconvolution methods were employed to identify immune cell subtypes, and the protein expression of T and B cells was confirmed. The prognostic utility of the identified genes and pathways was validated using the METABRIC and SCAN-B datasets. The expression of target genes was analyzed in the I-SPY 2 trial data to understand their influence on the response to specific therapies.<h4>Results</h4>Premenopausal tumors formed a distinct cluster characterized by the upregulation of cell activation and antigen presentation pathways. In contrast, T cell checkpoint, cancer antigen, and PI3K-AKT pathways were downregulated. External datasets validated these findings, showing a lower hazard and better prognosis for genes upregulated in premenopausal tumors. An enrichment of CD8 + T cells, endothelial cells, and monocytes was observed, along with increased intratumoral protein expression of CD8, CD4, and CD20. Premenopausal tumors demonstrated better responses to PARP and HSP90 inhibitors but showed lower sensitivity to Pembrolizumab and PI3K-AKT inhibitors compared to postmenopausal tumors in the I-SPY 2 trial data.<h4>Conclusion</h4>Our study underscores the importance of menopausal status in shaping the TME within TNBC, revealing distinct immune landscapes and therapy responses. These findings highlight the need for larger prospective studies to validate differential treatment strategies in younger patients.

Also flagged:solute carriertransportersironsolute carrier family 11SLC11SLC11A1
Journal Article 2025-07-10 No Snippets Banerjee R, Bintee B, Manickasamy MK, Jha S, Alqahtani MS, Abbas M, Goel A, Sethi G, Ma Z, Kunnumakkara AB.
Show Full Abstract

Iron is an essential trace element in the human body, and its imbalance is closely linked to the initiation and progression of various malignancies. The solute carrier family 11 (SLC11) transporters, comprising SLC11A1 and SLC11A2, play pivotal roles in iron metabolism and cellular homeostasis, processes intricately linked to oncogenesis. SLC11A1, primarily expressed in macrophages, modulates immune responses and reshapes the tumor microenvironment, while SLC11A2, a ubiquitous iron transporter, regulates dietary iron absorption and ferroptosis, an iron-dependent form of programmed cell death. Dysregulation of these transporters is associated with tumor initiation, progression, metastasis, and therapy resistance. In this review, we provide an overview of the physiological functions of SLC11 transporters in iron metabolism and their pathological roles in cancer biology. Emerging evidence highlights their involvement in key oncogenic pathways, including p53, JAK/STAT, Wnt and HIF signaling. Pharmacological and genetic interventions targeting SLC11 transporters have shown the potential to disrupt tumor progression and enhance treatment efficacy. By exploring the intricate roles of SLC11A1 and SLC11A2 in cancer progression, this review offers insights into their potential as biomarkers and therapeutic targets, paving the way for innovative cancer treatment strategies.

Also flagged:ribosomeprotein synthesisUbiquitinationUbiquitintranslationalgene expression
Journal Article 2025-07-10 No Snippets Wooters HC, Nimmagadda NC, Darnell AM, Silva GM.
Show Full Abstract

It has become evident that a complex code of ribosome ubiquitination regulates protein synthesis, particularly in stress conditions. Ubiquitin is known largely for its role in protein stability; however, new high-throughput screening and advances in proteomics are underscoring its novel role as a master regulator of ribosome function. Still, much remains to be discovered about how this code acts and supports translation reprogramming in a context-specific manner. Here we discuss the nature of this code, the dynamics of site-specific ribosome ubiquitination, and the unique roles that multiple enzymes play in defining the translatome and cotranslational quality control pathways. We also provide insights on the importance of unraveling this code to understand the physiological impact of modified ribosome subpopulations in cellular stress and human disease.

Also flagged:ribosometranslationalpolypeptidelysinecytochrome c oxidase 1MTCO1
Journal Article 2025-07-10 No Snippets Uematsu S, Qian SB.
Show Full Abstract

Translation takes a central position in gene expression, and its swift response to environmental stress is evolutionarily conserved. Upon chemical damage to the messenger RNA (mRNA) or the lack of building blocks, the ribosome stalls during elongation and halts the production line. Even under normal growth conditions, the translation machinery encounters constant hindrances such as varied codon composition or nascent chains with distinct features. However, it is challenging to define these kinetics experimentally, partly due to the inherent variations of ribosome behavior during mRNA translation. To ensure the flow of ribosomal traffic, cells employ several mechanisms to circumvent the traffic jam. When the roadblock is not resolved timely, trailing ribosomes can collide with stalled ribosomes. However, the boundary between physiological queuing and pathological collision is often blurred, representing a fundamental gap in our understanding of ribosome dynamics. To cope with translational barriers, several signaling pathways are activated to adjust the rate of global translation and rescue the local stalled ribosome. Deficiencies in cellular response to translational stress have been associated with a wide array of human diseases. In this review, we focus on fundamental aspects of the ribosome dynamics during mRNA translation. We provide an overview of causes, outcomes, and cellular responses to ribosome stalling and collision on mRNA. We highlight questions that may clarify the biological roles of distinct ribosome behavior during mRNA translation and emphasize the mechanistic connection between altered ribosome dynamics and human diseases.

HFE
Also flagged:ureacell proliferationRASRAFMEKERK
Journal Article 2025-07-10 ✓ 1 Snippet Fu Y, Fang W, Qiu F, Lai J, Xu Y, Chen B, Li Y, Zhu X.
In-Text Gene Mentions

…ike α1-antitrypsin deficiency,hemochromatosis, and autoimmune conditions.…

Show Full Abstract

<h4>Introduction</h4>Hepatocellular carcinoma (HCC) ranks among the three most prevalent cancer-related diseases in terms of incidence. Hence, exploring drugs for HCC therapy is of great significance. Compounds with a diaryl urea structure have been reported to exhibit a broad range of biological activities, including anticancer activity. This study focuses on the specific diaryl urea derivative 4-(4-(3-(2-chloro-3-(trifluoromethyl)phenyl)ureido)phenoxy)-N-methylpicolinamide (SMCl), with particular emphasis on investigating its therapeutic effects against hepatocellular carcinoma (HCC) and elucidating the underlying molecular mechanisms.<h4>Methods</h4><i>In vitro</i> anti-cancer effects of SMCl were evaluated in HCC cell lines using MTS, colony formation, and wound healing assays. Western blot analyzed RAS/RAF/MEK/ERK pathway modulation. <i>In vivo</i> efficacy was assessed using a xenograft model.<h4>Results</h4>The MTS and colony formation assays demonstrated that SMCl significantly decreased the viability of HCC cells. Western blot analysis demonstrated that SMCl effectively suppressed hepatocellular carcinoma proliferation by markedly inhibiting the RAS/RAF/MEK/ERK signaling pathway, with this inhibitory effect exhibiting both time- and concentration-dependent characteristics. SMCl also demonstrated significant therapeutic efficacy in the xenograft tumor model, achieving a tumor inhibition rate of 72.37%. Notably, it showed no significant impact on spleen weight or body weight in mice, indicating low toxicity to normal tissues.<h4>Conclusion</h4>This study first elucidates the effects of SMCl on HCC cells and its impact on the RAS/RAF/MEK/ERK signaling pathway, providing a potential active compound for the clinical treatment of liver cancer.

HTT
Also flagged:curcuminagingneurodegenerative diseasespolyphenolicoxygenmitochondrial
Journal Article 2025-07-10 ✓ 1 Snippet Wang G, Zhou X, Pang X, Ma K, Li L, Song Y, Hou D, Wang X.
In-Text Gene Mentions

…of Huntingtin (HTT) gene, which…

Show Full Abstract

With the global population aging, the incidence of neurodegenerative diseases (NDs), such as Alzheimer's disease, Parkinson's disease, Huntington's disease and amyotrophic lateral sclerosis, has been progressively increasing. However, effective therapeutic strategies and clinical drugs for these disorders remain scarce. Curcumin, a natural polyphenolic compound primarily derived from the herbaceous plant <i>Curcuma longa</i> L., has been proposed as a promising candidate for ND treatment based on the excellent antioxidant, anti-inflammatory and neuroprotective properties. Its pharmacological activities encompass scavenging reactive oxygen species, mitigating toxic protein aggregation and cytotoxicity, repairing mitochondrial dysfunction, and inhibiting excessive neuronal apoptosis. Compared with synthetic drugs, curcumin demonstrates a more favorable safety profile with fewer side effects. Nevertheless, its clinical application is substantially hindered by poor bioavailability, which stems from low aqueous solubility, inefficient intestinal absorption, and rapid metabolism and systemic elimination. Conventional administration methods often fail to achieve effective concentrations <i>in vivo</i>. Further clinical trials are also required to validate the therapeutic efficacy and potential adverse effects in human subjects. This article systematically reviews the pathogenesis of NDs and the knowledge on curcumin including pharmacological effects, neuroprotective mechanisms, functions across specific NDs and advanced strategies to enhance the bioavailability, with the aim of promoting the development and clinical translation of curcumin-based therapeutics for NDs.

Also flagged:HearingLossNIHLhearing impairmentSensorineuralcochlear degeneration
Journal Article 2025-07-10 No Snippets Öztan G, İşsever H, Kurt ÖK, Canbaz S, Oğuz F, İşsever T, Öztürk Ö.
Show Full Abstract

Noise-induced hearing loss (NIHL) is a significant occupational health issue, characterized by permanent damage to the cochlea due to prolonged exposure to high-intensity noise. Circulating microRNAs (c-miRNAs) have emerged as promising non-invasive indicators of inner ear pathology and potential modulators of cellular stress responses. Nevertheless, their specific roles in NIHL remain inadequately characterized. This study evaluated miRNA expression in the peripheral blood of individuals with bilateral NIHL (<i>n</i> = 12) and matched healthy controls (<i>n</i> = 6) using GeneChip<sup>®</sup> miRNA 4.0 arrays. The Transcriptome Analysis Console software was used for differential expression analysis, and bioinformatic predictions of gene targets and pathway enrichment were performed using TargetScan (version 8.0) and the Enrichr tool. Among the 72 differentially expressed miRNAs (FDR < 0.05), hsa-miR-486-2, hsa-miR-664b-3p, hsa-miR-4485, hsa-miR-501, and hsa-miR-663b were notably upregulated, while hsa-miR-6723, hsa-miR-194-2, hsa-miR-668-5p, hsa-miR-4722-3p, and hsa-miR-4716 showed significant downregulation. Enrichment analyses indicated involvement in apoptosis regulation, mitochondrial stability, and cell cycle control. Principal component analysis (PCA) and clustering methods revealed clear molecular distinctions between the patient and control groups. The observed alterations in c-miRNA profiles highlight their relevance to NIHL-related cellular stress and degeneration. These findings support their utility as candidate biomarkers for diagnosis and prognosis, warranting further validation in functional and longitudinal studies.

bioRxiv 2025-07-10 Preprint (No Snippets API) Rosignol I, Dokuzluoglu Z, Caldarelli A, Oprişoreanu A, Ushakova S, Siddiqui T, Grover R, Guerlich H, Falkenburger B, Diez S, Grass T, Becker CG, Rodriguez-Muela N.
Show Full Abstract

Spinal muscular atrophy (SMA) is a devastating motor neuron disease, caused by recessive mutations or deletions of the SMN1 gene, representing the leading genetic cause of infant mortality. Available therapies, aimed at increasing SMN protein levels, can only partially halt motor neuron (MN) degeneration in a select number of patients, reinforcing the need for combinatorial treatments to improve clinical outcomes. We previously showed that mTORC1 overactivation and impaired autophagosome clearance in SMA MNs lead to the accumulation of protein aggregates, contributing to MN degeneration. However, the mechanistic link between SMN protein deficiency and autophagy-lysosomal dysfunction remained unknown. Here, using patient iPSC-derived MNs along with isogenic and healthy controls, we show that SMA MNs exhibit reduced lysosome numbers and impaired functionality. Furthermore, the master regulator of lysosomal biogenesis and autophagy, TFEB, is downregulated, and its nuclear translocation compromised upon SMN deficiency. We further propose the upregulation of the mTORC1 positive modulator TPT1 as contributor to TFEB dysregulation. Notably, TFEB overexpression ameliorates protein aggregate accumulation in SMA MNs and enhances MN survival both in vitro and in a zebrafish SMA model. Our findings identify lysosomal dysfunction as a key player in SMA pathology and highlight TFEB activation as a potential therapeutic strategy for SMA treatment. <h4>One Sentence Summary</h4> TFEB activation restores lysosomal function and improves motor neuron survival in SMA, highlighting its potential as a therapeutic target.

DCC
Also flagged:axonsaxon guidance moleculesaxonal growthsingle pass transmembrane proteinsSlit receptorssignal transduction
Journal Article 2025-07-09 ✓ 5 Snippets Sanhueza N, Avilés EC, Oliva C.
In-Text Gene Mentions

…colorectal cancer suppressor (DCC, also known as…

…attractive action of Netrin1-DCCon motor axons…

…between Slit–Robo and Netrin-DCCpathways during midline…

…the Slit–Robo and Netrin-DCCsignalling pathways during…

…by its receptorDCC.…

Show Full Abstract

During nervous system development, growing axons find their targets with the help of guidance cues. These cues, which can be secreted molecules provided by neighbouring cells or transmembrane proteins mediating cell-cell contacts with the growing axons, act as either chemoattractants or chemorepellents. Over the last decades, several axon guidance molecules have been identified. One of the classical guidance cues is the Slit protein. Slit is a secreted protein, initially identified in a genetic screen in the fruit fly <i>Drosophila melanogaster</i> but later shown to be present in other organisms including vertebrates. Slit was originally classified as a repellent guidance cue, but nowadays it is recognized as a promoter of axonal growth in some contexts. Slit action is mediated mainly by the Roundabout (Robo) family of single pass transmembrane proteins, although it has been shown more recently that other proteins can also function as Slit receptors. In this review, we describe the main aspects of Slit-Robo signalling during development of the nervous system. We start with a historical view of the discovery of these proteins, followed by a description of their main molecular characteristics. We then explore specific examples that describe the functions and signal transduction mechanisms of this signalling pathway.

Also flagged:phagocytosissynapsesynapsesagingneurodegenerative diseasesfrontotemporal dementia
Journal Article 2025-07-09 No Snippets Choi Y, Chung WS.
Show Full Abstract

Glia, as resident immune and supportive cells of the central nervous system, play a critical role in maintaining brain homeostasis. One of their key homeostatic functions is phagocytic capacity in pruning synapses and removing cellular debris/protein aggregates, a process vital for synaptic plasticity and brain maintenance. However, these phagocytic functions are often dysregulated with aging and in neurodegenerative diseases (NDs), such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and frontotemporal dementia. This review aims to examine the phagocytic roles of glia under both physiological and pathological conditions, with a special focus on their interactions with misfolded protein aggregates, including amyloid beta, tau, alpha synuclein, prion, huntingtin, and TAR DNA-binding protein 43. We also explore the fate of ingested molecules after being phagocytosed by glia-whether they are degraded, accumulate intracellularly, or are transferred between cells-and their implications for disease progression. Finally, we review current therapeutic strategies and the potential approaches for modulating glial phagocytosis to mitigate several NDs. We believe that understanding the exact mechanisms of glial phagocytosis and clearance will serve as key elements in developing future treatments for NDs.

Also flagged:METTL3ERbreast cancermethyltransferasemethyladenosineSTM2457
Journal Article 2025-07-09 No Snippets Petri BJ, Piell KM, Avila-Valdes BL, Stanley CG, Winkler LJ, Brown JT, Ulett R, Sanchez G, Chariker JH, Rouchka EC, Klinge CM.
Show Full Abstract

The role of epitranscriptomic changes in the development of acquired endocrine therapy (ET)- resistance in estrogen receptor α (ER) expressing breast cancer (BC) is unknown. We tested the hypothesis that inhibition of METTL3, the methyltransferase responsible for the mRNA modification N-6 methyladenosine (m6A), alters m6A modifications and differentially regulates the abundance of mRNA transcripts in ET-sensitive MCF-7 versus resistant LCC9 ER + human BC cells. Differential m6A modifications were identified using direct mRNA sequencing (DRS) performed on five replicates for each cell line ± 1 µM STM2457, a selective METTL3 inhibitor, using Nanopore MinION long read RNA-seq. Parallel short read Illumina RNA-seq quantified differential transcript abundance in the same samples. Selected results were validated by RT-qPCR, m6A-RIP-qPCR, reporter assays, and western blot analysis. Statistical analysis combined m6Anet, a machine-learning algorithm designed to call m6A modified bases, with a generalized linear model following a binomial distribution analysis to identify significant differential m6A modification ratios (DMR). Distinct METTL3 dependent m6A modification patterns in LCC9 and MCF-7 cells were observed in differentially expressed genes (DEG) associated with ET-resistance, including EEF1A2, ACTB, FLNA, PDIA6, AMIGO2, TPT1, XBP1, and CITED4. Select results were validated in additional ET-resistant BC cell lines. m6A-RIP-RT-qPCR validated specific m6A sites. We examined the proximity of m6A sites to estrogen receptor α (ER α)-mRNA binding sites reported in MCF-7 cells. ACTB, PDIA6, and XBP1 demonstrated a short-range proximity, with m6A sites located within 100 bp of ERα binding sites, suggesting a role for m6A in influencing ERα-mRNA binding. Our work provides a framework for integrating DRS and DEG omics data. Our results suggest a role for dysregulation of m6A modifications in pathways implicated in ET resistance in BC.

Also flagged:locomotionneodymiumironboronlithiumphenyl
Journal Article 2025-07-09 No Snippets Cao Y, Xie R, Schönhöfer PWA, Burdis R, Wang R, Sun R, Xie K, Zou J, Song X, Lau QY, Lin J, Kim JA, Georgiev D, Tang J, Ng HC, Bibikova O, Zuo Y, Lu XL, Glotzer SC, Stevens MM.
Show Full Abstract

Microrobots hold substantial potential for precision medicine. However, challenges remain in balancing multifunctional cargo loading with efficient locomotion and in predicting behavior in complex biological environments. Here, we present permanent magnetic droplet-derived microrobots (PMDMs) with superior cargo loading capacity and dynamic locomotion capabilities. Produced rapidly via cascade tubing microfluidics, PMDMs can self-assemble, disassemble, and reassemble into chains that autonomously switch among four locomotion modes-walking, crawling, swinging, and lateral movement. Their reconfigurable design allows navigation through complex and constrained biomimetic environments, including obstacle negotiation and stair climbing with record speed at the submillimeter scale. We also developed a molecular dynamics-based computational platform that predicts PMDM assembly and motion. PMDMs demonstrated precise, programmable cargo delivery (e.g., drugs and cells) with postdelivery retrieval. These results establish a physical and in silico foundation for future microrobot design and represent a key step toward clinical translation.

Also flagged:aminestrifluoromethylalcoholaminealcoholsAcid
Journal Article 2025-07-09 No Snippets Profous D, Kriegelstein M, Jurečka P, Cankař P.
Show Full Abstract

Axially chiral 2-(2-(trifluoromethyl)-1<i>H</i>-benzo[<i>d</i>]imidazol-1-yl)benzoic acid (TBBA) was employed as a chiral derivatizing agent for determining the absolute α-configuration of primary amines and secondary alcohols via <sup>19</sup>F NMR spectroscopy. The method utilizes the trifluoromethyl group as a sensor, detecting the shielding effects induced by individual alcohol or amine substituents. This approach was tested on 46 alcohols and amines, demonstrating greater efficiency compared to the standard MTPA method.

POU3F2
Also flagged:cortical disordersneuropsychiatric disordertranscription factorTFcorticogenesisautism
Journal Article 2025-07-09 ✓ 5 Snippets Mato-Blanco X, Kim SK, Jourdon A, Ma S, Choi SH, Giani AM, Paredes MI, Tebbenkamp ATN, Liu F, Duque A, Vaccarino FM, Sestan N, Colantuoni C, Rakic P, Santpere G, Micali N.
In-Text Gene Mentions

…R&D Systems, AF8150), anti-POU3F2(1:200; Abcam, ab137469),…

…NSC fate regulatorsPOU3F2and LHX2 ,…

…the expression ofPOU3F2, the nucleic acid–binding…

…effects, such asPOU3F2KO, which promoted…

…MEIS2 , andPOU3F2, whose deleterious…

Show Full Abstract

The implications of the early phases of human telencephalic development, involving neural stem cells (NSCs), in the etiology of cortical disorders remain elusive. Here, we explore the expression dynamics of cortical and neuropsychiatric disorder-associated genes in datasets generated from human NSCs across telencephalic fate transitions in vitro and in vivo. We identify risk genes expressed in brain organizers and sequential gene regulatory networks throughout corticogenesis, revealing disease-specific critical phases when NSCs may be more vulnerable to gene dysfunction and converging signaling across multiple diseases. Further, we simulate the impact of risk transcription factor (TF) depletions on neural cell trajectories traversing human corticogenesis and observe a spatiotemporal-dependent effect for each perturbation. Finally, single-cell transcriptomics of autism-affected patient-derived NSCs in vitro reveals recurrent expression alteration of TFs orchestrating brain patterning and NSC lineage commitment. This work opens perspectives to explore human brain dysfunction at early phases of development.

MLLT10
Also flagged:acute myeloid leukemiaAMLprimary refractory diseasegraft-versus-host-diseaseGvHD-versus-leukemia
Journal Article 2025-07-09 ✓ 2 Snippets Rettinger E, Rettinger E, Heckl D, Gibson B, Sauer M, Turkiewicz D, Kleinschmidt K, Kalwak K, Reinhardt D, Locatelli F, Klusmann JH, Pediatric Diseases Working Party of the European Society for Blood and Marrow Transplantation.
In-Text Gene Mentions

…DN; t(10;11)(p12;q23) →KMT2A::MLLT10.…

…Junction Formation Factor,MLLT10Histone Lysine Methyltransfera…

Show Full Abstract

Allogeneic hematopoietic stem cell transplantation (HSCT) has significantly improved the outcome of children with high-risk (HR) acute myeloid leukemia (AML). Implementing allogeneic HSCT depends on numerous factors, including adverse cytogenetics, molecular abnormalities, poor response to first-line treatment, or relapsed or primary refractory disease. In HR AML, allogeneic HSCT is considered to be the consolidation strategy of choice in first complete remission (CR1) and offers the best chance of cure for patients with relapsed disease. Advances in donor/recipient typing, conditioning regimens, graft-versus-host-disease (GvHD) management, and supportive care have contributed to this improvement in overall-and transplant-outcome. This review will comprehensively discuss indications for HSCT and its modalities in pediatric AML by examining past, current, and future strategies for disease- and response-related stratification. We will examine the key importance of low/negative measurable residual disease (MRD) before transplantation and discuss conditioning regimens and graft variables, as well as novel approaches to harness the graft-versus-leukemia (GvL) effect, including targeted immunotherapy. The review will also address toxicities associated with HSCT, GvHD prophylaxis, and the management of treatment failure. Ultimately, this review seeks to inform clinical practice and highlights how improved outcomes have been achieved through the collective efforts of international study groups.

SLC2A14
Also flagged:hepatocellular carcinomatumorHBV infectiontumorsMT1GMDK
Journal Article 2025-07-09 ✓ 1 Snippet Liu Z, Naz W, Yousaf T, Sun J, Wu Q, Guo M, Tian G, Sun G.
In-Text Gene Mentions

…POTEI, EFR3B, ZNF497,SLC2A14, IL5RA, ARHGAP28, NPTX1,…

Show Full Abstract

The tumor microenvironment (TME) is a crucial mediator of tumor progression and treatment response. Here, we compare the immune microenvironments of HBV and non-HBV hepatocellular carcinoma (HCC) and investigate the reason for the persistence of HBV infection in the liver. We combine the Viral-Track method with scRNA sequencing and profile the transcriptomes of 70,056 cells from HBV and non-HBV-HCC patients. In addition to hepatocytes and macrophages, HBV transcripts were also detected in T and B cells using the Viral-Track method, confirming the lymphotropic nature of HBV in scRNA-sequencing data for the first time, to the best of our knowledge. HBV-HCC tumors have reduced levels of NK cells, macrophages, DCs, and increased malignant hepatocytes compared with those in non-HBV HCC. Notably, we report the enrichment of metallothioneins (MTs), particularly MT1G, in HBV-related HCC TAMs, which is associated with a worse prognosis. HBV-tumor-infiltrated CD8⁺ T cells exhibit a dysfunctional cytotoxic phenotype, characterized by upregulated MDK and CTLA4 expression and reduced IFN-γ production, unlike the non-HBV-HCC. Additionally, HBV-HCC exhibits immunosuppressive ligand-receptor interactions, whereas non-HBV-HCC exhibits antitumor ligand-receptor interactions. Our deeper understanding of the HBV-HCC ecosystem using Viral-Track integrated scRNA sequencing provides insights into immune evasion mechanisms and HBV lymphotropism associated with viral persistence.

HFE
Also flagged:type 2 diabetesmetabolic disordershypertensionhepatic fibrosisASTtransaminases
Journal Article 2025-07-09 ✓ 1 Snippet Datta D, Seshadri KG, Ghosal S.
In-Text Gene Mentions

…a history ofhemochromatosisor Wilson’s disease,…

Show Full Abstract

Hepatic fibrosis is a critical complication of metabolic disorders, particularly in patients with Type 2 Diabetes (T2D). This study aimed to evaluate the performance of the Fibrosis 4 index (FIB 4) score in detecting significant fibrosis (transient elastography [TE] ≥ 8 kPa) and identify key predictors of significant fibrosis using logistic regression analysis in patients with T2D. This cross-sectional study, conducted across three tertiary care centres in India, prospectively enrolled and propensity-matched T2D and non-T2D patients to balance cohorts, resulting in a final analysis cohort of 472 patients (236 T2D, 236 non-T2D). Sensitivity, specificity, and Cohen's Kappa were used to assess agreement between FIB 4 score ≥ 1.3 and TE ≥ 8 kPa. Logistic regression models were used to identify independent predictors of significant fibrosis. The predictive performance of the models was evaluated using ROC curves. The FIB 4 score demonstrated high sensitivity (85.3%) but low specificity (13.7%) in the T2D cohort, with a Cohen's Kappa of -0.01, indicating no agreement with TE. In the non-T2D cohort, specificity improved to 47.2% with a Cohen's Kappa of 0.16. Logistic regression identified BMI, hypertension, and HbA1c as significant predictors of hepatic fibrosis in T2D patients, with odds ratios of 1.076, 1.824, and 1.279, respectively. Male sex, BMI, AST, and HbA1c were retained in the refined multivariate model, achieving an AUC of 0.735, indicating good discriminatory ability. Elevated transaminases were weakly associated with fibrosis, while BMI and HbA1c showed stronger associations. While FIB 4 is sensitive for detecting significant fibrosis, its low specificity limits its utility as a standalone diagnostic test, particularly in T2D patients. Logistic regression highlighted BMI, AST, and HbA1c as key predictors of fibrosis, emphasising the need to combine non-invasive tools with clinical variables for more accurate risk stratification and improved management of MASLD. Future research should focus on refining diagnostic algorithms to better address the burden of significant fibrosis in at-risk populations.

B4GALT5
Also flagged:extracellularvesiclesFOSGene expressionschizophreniafirst-onset schizophrenia
Journal Article 2025-07-09 ✓ 5 Snippets Du X, Hu W, Li X, Gao Y, Li J, Hu X, Wang X, Zhao W, Cheng L, Cao X, Cao H, Ren Z, Zhang Y, Xu Y, Liu S.
In-Text Gene Mentions

…40,087,476+, hsa-miR-22-3p andB4GALT5were correlated with…

…3266–17883550+—hsa-miR-502-3p—B4GALT5) were selected for…

…C5orf24, hsa-miR-502-3p andB4GALT5) in plasma EVs.…

…hr19:17883266–17,883,550 + andB4GALT5decreased, the expression…

…b), 0.8356 forB4GALT5(specificity:0.839, sensitivit…

Show Full Abstract

<h4>Background</h4>The circRNA-miRNA-mRNA networks of extracellular vesicles (EVs) in first-onset schizophrenia (FOS) have not been reported yet. Here, we constructed circRNA-miRNA-mRNA networks of EVs, and examined their diagnostic efficiency in FOS.<h4>Methods</h4>The expression levels of circRNAs, miRNAs and mRNAs in EVs derived from 10 FOS patients and 10 healthy controls (HC) were determined by high-throughput sequencing. The circRNA-miRNA-mRNA networks was constructed based on the overlapped miRNAs between differentially expressed (DE) miRNAs and circRNA-targted miRNAs, and overlapped mRNAs between DE-mRNAs and miRNA-targeted mRNAs. Gene expression levels were validated using quantitative real-time PCR in 31 FOS and 31 HC cases. Receiver operating characteristic (ROC) curve analysis was performed to examine the diagnostic efficacy. Correlation analysis was performed using Pearson's or Spearman's correlation coefficient.<h4>Results</h4>There were 26,194 DE-circRNAs, 22 DE-miRNAs, and 2637 DE-mRNAs in plasma EVs of FOS patients. Then, the circRNA-miRNA-mRNA networks consisting of 9 circRNA, 6 miRNA and 16 mRNA, were constructed. Three network (chr15:93496587-93499879+-hsa-miR-20b-5p-ANKH; chr7:40037093-40087476+-hsa-miR-22-3p-C5orf24; and chr19:17883266-17883550+-hsa-miR-502-3p-B4GALT5) were selected for further investigation. The expression levels of 9 genes in validation data were consistent with the results of the high-throughput sequencing. The area under the ROC curve (AUC) of the circRNA-miRNA-mRNA network was higher than that of circRNA, miRNA or mRNA alone in plasma EVs, and the AUC of mRNAs in plasma EVs was higher than that of mRNAs in peripheral blood. The expression levels of chr15:93496587-93,499,879+, chr7:40037093-40,087,476+, hsa-miR-22-3p and B4GALT5 were correlated with the PANSS score.<h4>Conclusion</h4>We constructed the circRNA-miRNA-mRNA networks of plasma EVs in FOS, demonstrating their potential as a biomarker for FOS.

HTT
Also flagged:neurodegenerative disorderpolyglutamineHDpathogenesisgene expressionbinding
Journal Article 2025-07-09 ✓ 5 Snippets Kozłowska E, Ciołak A, Adamek G, Szcześniak J, Fiszer A.
In-Text Gene Mentions

HTTloss-of-function contributes t…

…repeats in theHTTgene, which results…

…the huntingtin protein (HTT).…

…regulates TWIST1 andHTTexpression via a…

…in HD- andHTT-deficient neuronal cells.…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a neurodegenerative disorder caused by the expansion of CAG repeats in the HTT gene, which results in a long polyglutamine tract in the huntingtin protein (HTT). One of the earliest key molecular mechanisms underlying HD pathogenesis is transcriptional dysregulation, which is already present in the developing brain. In this study, we searched for networks of deregulated RNAs crucial for initial transcriptional changes in HD- and HTT-deficient neuronal cells.<h4>Results</h4>RNA-seq (including small RNAs) was used to analyze a set of isogenic human neural stem cells. The results were validated using additional methods, rescue experiments, and in the medium spiny neuron-like cells. We observed numerous changes in gene expression and substantial dysregulation of miRNA expression in HD and HTT-knockout (HTT-KO) cell lines. The overlapping set of genes upregulated in both HD and HTT-KO cells was enriched in genes associated with DNA binding and the regulation of transcription. We observed substantial upregulation of the following transcription factors: TWIST1, SIX1, TBX1, TBX15, MSX2, MEOX2 and FOXD1. Moreover, we identified miRNAs that were consistently deregulated in HD and HTT-KO cells, including miR-214, miR-199, and miR-9. These miRNAs may function in the network that regulates TWIST1 and HTT expression via a regulatory feed-forward loop in HD.<h4>Conclusions</h4>On the basis of overlapping changes in the mRNA and miRNA profiles of HD and HTT-KO cell lines, we propose that transcriptional deregulation in HD at early neuronal stages is largely caused by a deficiency of properly functioning HTT rather than a typical gain-of-function mechanism.

Also flagged:LDLRBRCA1MSH2translationalfamilial hypercholesterolemiamaturity-onset diabetes of the
Journal Article 2025-07-09 No Snippets Bhat V, Yu T, Brown L, Pejaver V, Lebo M, Harrison S, Cassa CA.
Show Full Abstract

Genomic medicine requires a robust evidence base of variant phenotypic impacts, which remains incomplete even in extensively studied genes with monogenic disease associations. Here, we evaluated the broad potential of using population cohort data to identify evidence that can be used in variant assessment. Across 41 genes related to 18 clinically actionable monogenic phenotypes, we calculated variant-level odds ratios of disease enrichment using data from 469,803 UK Biobank participants. We found significant differences in odds ratio values between ClinVar-labeled pathogenic and benign variants in 11 phenotypes, spanning both common and rare disorders. To facilitate clinical translation, we calibrated the strength of evidence provided by variant-level odds ratios to align with American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG/AMP) interpretation guidelines (PS4 criterion) and found that odds ratios may reach "moderate," "strong," or "very strong" evidence, varying by phenotype and gene. Overall, we found that 2.6% (N = 12,350) of participants harbor a rare variant of uncertain significance (VUS) with at least moderate evidence of pathogenicity-an indication of potentially unrecognized disease risk. Finally, by incorporating computational and functional data alongside population-based odds ratios, we identified variants that met the criteria for clinical reclassification. Notably, using this approach, we identified that 12.4% of rare VUSs in LDLR seen in participants meet diagnostic criteria to be classified as likely pathogenic, demonstrating its potential to scale the reclassification of VUSs.

PTGIS
Also flagged:ProstacyclinmembranepPROMmembranesProstaglandinswound-healing process
Journal Article 2025-07-09 ✓ 5 Snippets Takakura M, Kawamura Y, Ueda Y, Matsuzaka S, Yasuda E, Matsuzaka Y, Inohaya A, Chigusa Y, Mandai M, Narumiya S, Yuhki KI, Mogami H.
In-Text Gene Mentions

…, Ptgs2 ,PtgismRNA, and PGI…

…Ptgs2 (COX2), andPtgis[PGI 2 synthase…

…[PGI 2 synthase (PTGIS)] mRNAs was increased…

…Expression ofPTGISand its Receptor…

PTGISwas weakly expressed…

Show Full Abstract

Preterm prelabor rupture of membrane (pPROM) is a risk factor for preterm birth. However, spontaneous healing of ruptured fetal membranes is occasionally clinically observed. Prostaglandins are involved in the wound-healing process in various tissues. Here, the role of prostacyclin (PGI<sub>2</sub>) in the repair of fetal membranes was investigated in a mouse model. Ptgs1, Ptgs2, Ptgis mRNA, and PGI<sub>2</sub> were increased in the ruptured murine fetal membranes. Compared with the number of amnion mesenchymal cells at the intact site, the number of these cells at the rupture site was greater, and PGI<sub>2</sub> synthase was increased in the mesenchymal cells of the amnion. Repair of the ruptured amnion was compromised by treatment with a PGI<sub>2</sub> receptor (IP) antagonist, which decreased proliferation of the amnion mesenchymal cells. In contrast, an IP agonist partially restored repair of the amnion under the suppression of prostaglandin synthesis by a cyclooxygenase inhibitor. Compared with wild-type fetuses, IP-deficient fetuses exhibited impaired amnion repair, characterized by reduced proliferation of amnion mesenchymal cells observed at the rupture site. In vitro, the proliferation and migration of cultured human amnion mesenchymal cells were stimulated by an IP agonist and inhibited by an IP antagonist. These findings suggest that PGI<sub>2</sub> facilitates amnion repair by promoting the proliferation and migration of amnion mesenchymal cells.

FBXL4
Also flagged:mitochondrial leukoencephalopathiesLeukoencephalopathiesmitochondrial diseasesMDmitochondriallactate
Journal Article 2025-07-09 ✓ 1 Snippet Sharma S, Peterson J, Alves CA, Xiao R, Goldstein A.
In-Text Gene Mentions

…diffuse abnormalities inFBXL4mutations reflect the…

Show Full Abstract

<h4>Background and objectives</h4>Leukoencephalopathies are characterized by white matter (WM) abnormalities and include various primary mitochondrial diseases (MD) that impact mitochondrial function across all neuroglial cells. Understanding these associations is vital for effective clinical management.<h4>Methods</h4>We performed a retrospective analysis of patients with genetically confirmed MD who exhibited white matter abnormalities at a pediatric academic medical center. Data were obtained through medical record reviews, collecting information on demographics, genetic etiology, features of WM involvement, and other areas such as the basal ganglia, cortex, cerebellum, and spine on MRI. Biomarkers like CSF protein and plasma lactate levels were also recorded. Statistical analysis was conducted using R version 4.4.1 to assess significance of specific MRI features in relation to nuclear vs. mitochondrial DNA.<h4>Results</h4>Among 192 MD patients, 142 had available neuroimaging. Of these, 43 (30 %) patients with a median age of 15.5 months exhibited WM involvement, with 53.4 % being female. The most common findings were periventricular (32 %), diffuse (42 %), and multifocal (17 %) WM lesions, with corpus callosum involvement in 51 % of cases. Distinct patterns observed included cystic changes (19 %), diffusion restriction (42 %), and white matter volume loss (40 %). Genetic analysis revealed a diverse range of mutations affecting mtDNA (30 %) and nDNA (70 %) genes.<h4>Discussion</h4>Our study highlights specific neuroimaging patterns associated with leukoencephalopathies in MD. For example, periventricular involvement in MTRFR mutations and diffuse abnormalities in FBXL4 mutations reflect the variability of WM manifestations. These findings can help clinicians identify the genetic etiology in this patient cohort.

TNFSF4
Also flagged:head and neck squamous cell carcinomaHNSCCmalignant tumortumorimmune responsehead and neck tumors
Journal Article 2025-07-09 ✓ 1 Snippet Lin Y, Wu F, Huang X, Zhang Z, Liu C, Lin Y, Xu Y, Guo H, Hong C.
In-Text Gene Mentions

…NRP1, PVR, TNFSF18,TNFSF4, TNFSF9, VTCN1, and…

Show Full Abstract

<h4>Background</h4>Head and neck squamous cell carcinoma (HNSCC) is a highly aggressive and heterogeneous malignant tumor. Mast cells are one of the immune cells widely distributed in the tumor microenvironment (TME), and their immune response with various immune cells is essential in promoting or inhibiting tumor growth and metastasis. However, the role played by mast cells in HNSCC has yet to be fully clarified.<h4>Methods</h4>We identified mast cell marker genes using single-cell RNA sequencing (scRNA-seq) from the GSE103322 of the GEO database. The HNSCC data from the TCGA databases was divided into training and validation groups. Cox regression and LASSO regression analyses were used to screen the prognostically relevant mast cell-related genes (MRGs) to construct a prognostic signature and differentiate risk groups. The receiver operating characteristic (ROC) and calibration curves were used to test the model's accuracy. We revealed the immune landscape of HNSCC by immune infiltration, immune checkpoint levels, ESTIMATE, and TIDE analyses. Drug sensitivity analyses were used to understand the sensitivity of different risk groups to drug therapy.<h4>Result</h4>The 14-MRGs prognostic signature classified patients into high- and low-risk groups, and the overall survival (OS) of the low-risk group was significantly higher than that of the high-risk group (p < 0.05). The areas under the ROC curves of the nomogram were 0.740, 0.737 and 0.707 at 1-, 3-, and 5-year, and they also showed better detection efficacy in the validation group than other independent predictors. The low-risk group had richer immune cell infiltration and higher immune scores. The lower TIDE score in the low-risk group demonstrates that patients in this group were less prone to have immune escape and more likely to benefit from immunotherapy. In addition, the low-risk group was more sensitive to a broader range of drugs than the high-risk group.<h4>Conclusion</h4>We combined scRNA-seq data and bulk RNA-seq data to construct a 14-MRGs-based prognostic model capable of well predicting the prognosis of HNSCC patients. This model may also help identify patients who can benefit from immunotherapy.

HTT
Also flagged:sarcopeniadiabetic nephropathyDNmitochondriamitochondrialbinding
Journal Article 2025-07-09 ✓ 5 Snippets Chen YW, He S, Wang Y, Hu LY, Chen QK, Liu SY.
In-Text Gene Mentions

…mitochondria-related genes -HTTand TTC19 -…

…enrichment analysis linkedHTTand TTC19 to…

…acetaminophen and theHTTprotein.…

…Our study identifiesHTTand TTC19 as…

…, HSPE1 ,HTT, NFKBIA ,…

Show Full Abstract

<h4>Introduction</h4>Clinical studies reveal bidirectional links between sarcopenia (SP) and diabetic nephropathy (DN). Damage to mitochondria in DN may result in diminished energy production, which consequently triggers SP. Consequently, mitochondria seem to function as critical nodes connecting DN with SP. The objective of this research was to pinpoint biomarkers associated with mitochondrial dysfunction in DN and SP.<h4>Methods</h4>By analyzing the Gene Expression Omnibus (GEO) repository, we identified shared differentially expressed genes (DEGs) in the DN (GSE96804, GSE30528) and SP (GSE1428, GSE136344) datasets that displayed similar expression trends in mitochondrial genes. Using Least Absolute Shrinkage and Selection Operator (LASSO), Support Vector Machine (SVM), Extreme Gradient Boosting (XGB), and Random Forest (RF) algorithms, we identified three key mitochondrial hub genes. Diagnostic nomograms were created to predict DN and SP risk. We assessed immune infiltration using CIBERSORT and built a drug-gene network with Cytoscape. Molecular docking determined binding affinities between potential drugs and hub genes, which were validated in the datasets.<h4>Results</h4>Analysis of GEO datasets identified 80 shared DEGs between DN and SP, including 10 mitochondria-related genes. Utilizing four machine learning algorithms (LASSO, SVM, XGBoost, RF), we pinpointed three mitochondrial hub genes. Subsequent validation confirmed two key mitochondria-related genes - <i>HTT</i> and <i>TTC19</i> - as shared diagnostic biomarkers for both DN and SP. These biomarkers demonstrated strong diagnostic power (AUC >0.8), leading to the construction of diagnostic nomograms. Immune infiltration analysis revealed elevated M1 macrophages in DN and increased M2 macrophages in SP, with both biomarkers showing significant correlations with various immune cells. Gene set enrichment analysis linked <i>HTT</i> and <i>TTC19</i> to mitochondrial metabolic processes. Crucially, <i>in silico</i> drug prediction identified 156 potential drugs, and molecular docking confirmed a high binding affinity between acetaminophen and the <i>HTT</i> protein.<h4>Conclusion</h4>Our study identifies <i>HTT</i> and <i>TTC19</i> as novel mitochondria-immune related biomarkers common to both DN and SP, providing insights into their shared pathogenesis involving mitochondrial dysfunction and immune dysregulation. The computational prediction of acetaminophen interaction highlights a potential avenue for therapeutic exploration. Further clinical and mechanistic studies are warranted to validate these findings and elucidate the underlying pathways.

TNFSF4
Also flagged:CA9OSCCcancerDocetaxelpaclitaxeloral squamous cell carcinoma
Journal Article 2025-07-09 ✓ 1 Snippet Zhao Y, Yang J, Jiang Y, Wu J.
In-Text Gene Mentions

…BTN3A2, TNFSF9, TNF,TNFSF4, IL1B, CD70, TNFRSF18,…

Show Full Abstract

<h4>Background</h4>Oral squamous cell carcinoma (OSCC) is a challenging malignancy with poor prognosis despite therapeutic advancements. This study seeks to derive a precise molecular subtyping and prognostic model for personalized treatment strategies.<h4>Methods</h4>Multi-omics data from TCGA cohort was analyzed using consensus clustering algorithms for subtype classification. Based on the classification, a multi-omics cancer subtyping signature (MSCC) model was constructed using machine learning methods. The model's clinical utility was assessed by evaluating immune features and immunotherapy response. Potential therapeutic agents were identified through drug sensitivity analysis.<h4>Results</h4>Three distinct OSCC subtypes with unique genetic and immunological profiles were identified. The MSCC model, developed using the StepCox [both]+plsRcox algorithm, demonstrated superior prognostic performance compared to existing models. High MSCC scores correlated with poor prognosis, reduced immune cell infiltration, and decreased likelihood of benefiting from immune checkpoint inhibitor therapy. Docetaxel and paclitaxel emerged as potential therapeutic candidates. <i>In vitro</i> experiments validated CA9 as a promising therapeutic target, with its knockdown significantly inhibiting OSCC cell proliferation and migration.<h4>Conclusion</h4>This multi-omics analysis unveiled subtype-specific differences in OSCC and established an MSCC model for predicting prognosis and treatment response. These findings provide a foundation for early diagnosis, molecular subtyping, and personalized treatment strategies in OSCC.

Also flagged:CalciumPhosphorusmineralmetabolismHomeostasismineral transporters
Journal Article 2025-07-09 No Snippets Liu W, Zhang C, Kuang X, Zeng X, Zhang J, Wang Q, Yang H.
Show Full Abstract

Optimal dietary calcium (Ca) and phosphorus (P) requirements remain undetermined for Ningxiang pigs, a valuable indigenous Chinese breed. This study conducted a continuous feeding trial with two growth phases (grower: 30-50 kg; finisher: 50-80 kg) using fixed Ca/P ratios to systematically evaluate the effects of Ca/P levels on growth performance and mineral metabolism. A total of 180 pigs per phase were allocated to four Ca/P levels. During the grower phase, a dietary regimen of 0.83% Ca/0.67% P significantly increased the average daily feed intake (ADFI), average daily gain (ADG), and apparent total tract digestibility (ATTD) of energy and P. In the finisher phase, 0.60/0.48% Ca/P showed optimal growth performance, upregulated jejunal mineral transporters (<i>CaSR</i> and <i>SLC34A2</i>), enhanced bone mineralization (metatarsal ash content), and improved intestinal morphology (duodenal and jejunal villus height, jejunal villus surface area). This regimen also selectively enriched <i>Peptostreptococcaceae</i> abundance, indicating improved host-microbe interactions. Based on these findings, stage-specific nutritional strategies were recommended: 0.83% Ca/0.67% P during the grower phase and 0.60% Ca/0.48% P during the finisher phase. These protocols synergistically improve microbial ecology, intestinal function, and bone metabolism, thereby maximizing the growth potential of Ningxiang pigs.

Also flagged:p53Ferroptosisdeathphospholipidirontumor
Journal Article 2025-07-09 No Snippets Punziano C, Trombetti S, Grosso M, Tornesello ML, Faraonio R, Faraonio R.
Show Full Abstract

Ferroptosis is a type of cell death executed by phospholipid peroxidation in an iron-dependent manner. Ferroptosis plays a central role in inhibiting tumor growth, enhancing the immune response, and is now considered a strategy to combat resistance to anticancer therapies. The oncosuppressor p53 is one of the major regulators of ferroptosis and can either promote or inhibit ferroptosis, depending on the context and/or extent of the damage. p53 governs the transcription of many genes that modulate cell susceptibility to ferroptosis, using this manner of death to fulfill its role as tumor suppressor. The diverse functions of p53 are related to non-coding RNAs (ncRNAs), especially microRNAs (miRNAs), and long non-coding RNAs (lncRNAs), since they can either regulate p53 or be regulated by p53. Therefore, an intricate metabolic network between ncRNAs and p53 ensures the correct response. In this review, we will discuss recent studies on the molecular interplay between p53-mediated ferroptosis and ncRNAs and how this contributes directly or indirectly to the outcome of ferroptosis.

Also flagged:Spinal cord injuryinflammatory responsesaxonaldeathcystssecretion
Journal Article 2025-07-09 No Snippets Wu YY, Gao YM, Feng T, Rao JS, Zhao C.
Show Full Abstract

Spinal cord injury (SCI) is a severe neurological condition that typically results in irreversible loss of motor and sensory function. Emerging evidence indicates that neuroplasticity, the ability of the nervous system to reorganize by forming new neural connections, plays a pivotal role in structural and functional recovery post-injury. This insight lays the groundwork for the development of rehabilitation and therapeutic strategies designed to leverage neuroplasticity. In this review, we offer an exhaustive overview of the neuroplastic alterations and mechanisms that occur following an SCI. We examine the role of neuroplasticity in functional recovery and outline therapeutic approaches designed to augment neuroplasticity post-SCI. The process of neuroplasticity post-SCI involves several physiological processes, such as neurogenesis, synaptic remodeling, dendritic spine formation, and axonal sprouting. Together, these processes contribute to the reestablishment of neural circuits and functional restoration. Enhancing neuroplasticity is a promising strategy for improving functional outcomes post-SCI; however, its effectiveness is influenced by numerous factors, including age, injury severity, time since the injury, and the specific therapeutic interventions employed. A variety of strategies have been suggested to promote neuroplasticity and expedite recovery, including pharmacological treatments, biomaterial-based therapies, gene editing, stem cell transplantation, and rehabilitative training. The combination of personalized rehabilitation programs with innovative therapeutic techniques holds considerable potential for maximizing the benefits of neuroplasticity and enhancing clinical outcomes in SCI management.

Also flagged:neurodegenerative diseasesmitobiogenesisautophagycircadian rhythmshort-chain fatty acidsβ-hydroxybutyrate
Journal Article 2025-07-09 No Snippets Hein ZM, Arbain MFF, Kumar S, Mehat MZ, Hamid HA, Che Ramli MD, Che Mohd Nassir CMN.
Show Full Abstract

Intermittent fasting (IF) is emerging as a heterogeneous neurometabolic intervention with the possibility of changing the course of neurodegenerative diseases. Through the modulation of the gut-brain axis (GBA), cellular bioenergetics (or metabolic) reprogramming, and involvement in preserved stress adaptation pathways, IF influences a range of physiological mechanisms, including mitobiogenesis, autophagy, circadian rhythm alignment, and neuroinflammation. This review critically synthesises current preclinical and early clinical evidence illustrating IF's capability to supplement synaptic plasticity and integrity, reduce toxic proteins (proteotoxic) burden, and rehabilitate glial and immune homeostasis across models of Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. The key players behind these effects are bioactive metabolites such as short-chain fatty acids (SCFA) and β-hydroxybutyrate (BHB), and molecular mediators such as brain-derived neurotrophic factor (BDNF). We feature the therapeutic pertinence of IF-induced changes in gut microbiota composition, immune response, and mitochondrial dynamics, and we discuss emerging approaches for merging IF into precision medicine frameworks. Crucial challenges include individual variability, protocol optimisation, safety in cognitively vulnerable populations, and the need for biomarker-guided, ethically grounded clinical trials. Finally, we propose IF as a scalable and flexible intervention that, when personalised and integrated with other modalities, may reframe neurodegeneration from a model of irreversible decline to one of modifiable resilience.

Also flagged:catecholaminenoradrenalinehydroxylcatecholβ 2 -adrenoreceptorsα 2 -adrenoreceptors
Journal Article 2025-07-08 No Snippets Buczynski SA, Li A, Chang-Weinberg J, Nawsheen SS, Banghart MR.
Show Full Abstract

Photoactivatable neurotransmitters provide spatiotemporally precise experimenter control over endogenous receptor activation in living tissue. The resulting optical stimulus-neuronal response relationship provides a sensitive assay that can drive quantitative studies into receptor signaling. Here, we report a photocaged derivative of the prominent catecholamine neurotransmitter noradrenaline (NA). Appending a carboxynitroveratryl (CNV) caging group to the 4-hydroxyl of the catechol group produced CNV-NA, which displays good aqueous solubility and chemical stability. We verified CNV-NA's lack of activity at α<sub>1B</sub>- and β<sub>2</sub>-adrenoreceptors expressed in HEK cells using a live-cell cAMP assay. We validated CNV-NA photoactivation at native α<sub>2</sub>-adrenoreceptors in brain slices of rat locus coeruleus using whole cell electrophysiological recordings. Monitoring the stereotyped outward current response to repeated CNV-NA photoactivation revealed that the neuropeptide substance P suppresses α<sub>2</sub>-adrenoreceptor signaling in locus coeruleus neurons. This work adds a new reagent to the growing library of photocaged neuroactive ligands, thereby expanding the scope and applications of photopharmacology.

Also flagged:Melioidosisinfectious diseasepathogenesishost cellphagosomesecretion
Journal Article 2025-07-08 No Snippets Khongpraphan S, Sanongkiet S, Luangjindarat C, Thairat S, Munyoo B, Chabang N, Charoensutthivarakul S, Borwornpinyo S, Tuchinda P, Ponpuak M, Utaisincharoen P, Pudla M.
Show Full Abstract

<h4>Background</h4>Melioidosis is an infectious disease caused by an intracellular Gram-negative bacterium, Burkholderia pseudomallei, which is a common cause of community-acquired sepsis in Southeast Asia and Northern Australia. The mortality rate in acute melioidosis patients, which is caused by sepsis, is very high (47.1%). Therefore, reducing inflammation may lead to the treatment of patients with acute melioidosis. Previously, ECDD-S16 was reported to be a potential compound for inhibiting inflammatory cell death (pyroptosis).<h4>Objective</h4>In this study, we further investigated the involvement of ECDD-S16 in pyroptosis induced by B. pseudomallei in the U937 human macrophage cell line.<h4>Methods</h4>To investigate the biological activity of ECDD-S16, U937 macrophages were infected with B. pseudomallei before treatment with the compound. The expression of pyroptosis marker was determined by lactate dehydrogenase (LDH) assay, western blotting and ELISA assay. Additionally, the intracellular growth of B. pseudomallei was examined by CFU determination. Furthermore, colocalization of the bacteria with phagosome acidification was observed by immunofluorescent staining.<h4>Results</h4>The results showed that ECDD-S16 decreased LDH release and levels of pyroptosis-related proteins in B. pseudomallei-infected cells by inhibiting phagolysosome acidification. Moreover, the attenuation of pyroptosis did not interfere with the intracellular survival of B. pseudomallei in U937 macrophages.<h4>Conclusion</h4>Our findings indicated that ECDD-S16, a novel compound, interferes with caspase-1/4/5 activation, which may lead to the prevention of sepsis in acute melioidosis patients.

Also flagged:malariaartemisininK13aminoacyl-tRNA synthetasesamino acidsmupirocin
Journal Article 2025-07-08 No Snippets Ketprasit N, Tai CW, Sharma VK, Manickam Y, Khandokar Y, Ye X, Dogovski C, Hilko DH, Morton CJ, Braun AC, Leeming MG, Siddharam B, Shami GJ, Pradeepkumar PI, Panjikar S, Poulsen SA, Griffin MDW, Sharma A, Tilley L, Xie SC.
Show Full Abstract

Malaria poses an enormous threat to human health. With ever-increasing resistance to currently deployed antimalarials, new targets and starting point compounds with novel mechanisms of action need to be identified. Here, we explore the antimalarial activity of the Streptomyces sp natural product, 5'-O-sulfamoyl-2-chloroadenosine (dealanylascamycin, DACM) and compare it with the synthetic adenosine monophosphate (AMP) mimic, 5-O-sulfamoyladenosine (AMS). These nucleoside sulfamates exhibit potent inhibition of P. falciparum growth with an efficacy comparable to that of the current front-line antimalarial, dihydroartemisinin. Exposure of P. falciparum to DACM leads to inhibition of protein translation, driven by eIF2α phosphorylation. We show that DACM targets multiple aminoacyl-tRNA synthetases (aaRSs), including the cytoplasmic aspartyl tRNA synthetase (AspRS). The mechanism involves hijacking of the reaction product, leading to the formation of a tightly bound inhibitory amino acid-sulfamate conjugate. We show that recombinant P. falciparum and P. vivax AspRS are susceptible to hijacking by DACM and AMS, generating Asp-DACM and Asp-AMS adducts that stabilize these proteins. By contrast, human AspRS appears less susceptible to hijacking. X-ray crystallography reveals that apo P. vivax AspRS exhibits a stabilized flipping loop over the active site that is poised to bind substrates. By contrast, human AspRS exhibits disorder in an extended region around the flexible flipping loop as well as in a loop in motif II. These structural differences may underpin the decreased susceptibility of human AspRS to reaction-hijacking by DACM and AMS. Our work reveals Plasmodium AspRS as a promising antimalarial target and highlights structural features that underpin differences in the susceptibility of aaRSs to reaction hijacking inhibition.

SERPINC1
Also flagged:Venous thromboembolismdeathfibrinogencoagulation factors IIprotein Sprotein C
Journal Article 2025-07-08 ✓ 2 Snippets Mauge L, Madar H, Carré J, Fiore M, Gendron N, Mouton C, Proulle V, Suchon P, Trillot N, Lechat T, Sentilhes L, Macchi L, TITAN group of the French Society of Thrombosis and Haemostasis (SFTH).
In-Text Gene Mentions

…gene coding AT,SERPINC1, 17 and…

…genetic analysis ofSERPINC1is thus important,…

Show Full Abstract

Inherited antithrombin deficiency (ATD) is associated with a high risk of venous thromboembolic complications. Association of ATD with other conditions such as pregnancy obviously increases thromboembolic risk and may require anticoagulant therapy for prevention. Although there are several/heterogenous international guidelines regarding thromboprophylaxis in pregnant patients with ATD, data on anticoagulant prophylaxis in this context are scarce in the literature. Thus, this situation remains a challenge both in the antepartum period and during delivery. Physicians from the French Society of Thrombosis and Haemostasis (SFTH) performed a review of the literature to suggest propositions regarding the management of thrombosis prevention based on anticoagulation and antithrombin substitution in ATD pregnant women. In this review, after reporting the thrombotic risk associated with ATD, the indication of anticoagulant therapy, its dosing regimen and monitoring, and the indication of antithrombin concentrates during pregnancy and the postpartum period are discussed as well as peripartum management. Finally, this work confirms the complex management of thrombotic prevention in pregnant patients with ATD. Indeed, it requires to take into account a multiplicity of features cited in our propositions that will hopefully provide some help in this field. This work also highlights the importance of multidisciplinary discussions for pregnant women with ATD who should be counseled in an expert center including hematologist, obstetrician, and anesthetist to optimize their management.

HFE
Also flagged:somatoform disordersmitochondrialsuperoxide dismutase 2SOD2manganese superoxide dismutasesuperoxide
Journal Article 2025-07-08 ✓ 1 Snippet Golomb BA, Bui L, Berg BK.
In-Text Gene Mentions

…carrier status forhemochromatosis(called the “Celtic…

Show Full Abstract

Multiple chemical sensitivity (MCS), though viewed by many as psychogenic, was presumptively tied to genetic variation in superoxide dismutase 2 (SOD2), involved in conversion of mitochondrial superoxide to hydrogen peroxide, in Japanese paper pulp workers. Gulf War veterans (GWV) have increased MCS compared to nondeployed persons. In data from GWV and nonveterans, we assessed whether altered oxidative stress management via SOD2 polymorphism was tied to self-rated chemical sensitivity. Sixty white predominantly male GWV and age-similar nonveterans completed self-ratings of chemical sensitivity, and underwent both nuclear DNA analysis for SOD2 variants and mitochondrial haplogroup assessment. SOD2 Ala16 (vs. Val16) significantly predicted self-rated chemical sensitivity in GWV and in the total sample (ordinal logistic regression with robust SEs): OR(SE)[95% CI] = 3.56(1.83)[1.30, 9.74], p = 0.013 (total sample); OR[95% CI](SE) = 6.36(4.85)[1.42, 28.4], p = 0.015 (Gulf-deployed). Significance was sustained with adjustment for mitochondrial haplogroup U (not itself significant) and when reappraised with nonparametric trend tests (Kendall's Tau, Spearman Ranked Correlation Coefficient). The findings extend evidence of SOD2 polymorphism ramifications for chemical sensitivity to a new chemically exposed sample, implicating mitochondrial oxidative stress management as a (though not necessarily the exclusive) key factor in chemical sensitivity. Findings comport with burgeoning evidence inculpating mitochondrial impairment and oxidative stress in many drug/chemical/environmental factors' toxicity irrespective of the agent's nominal mechanism of action. This supports chemical sensitivity as a physiological, not a psychogenic condition.

Also flagged:Cancerdeathcaspaseapoptosis-inducing factor-1AIF-1receptor-interacting protein kinase-1
Journal Article 2025-07-08 No Snippets Chauhan P, Pandey P, Singh A, Jayakumar SS, Lakhanpal S, Verma M, Upadhye VJ, Khan F.
Show Full Abstract

Copper and iron are essential elements that play critical roles in several biological processes, including cancer cell survival and metabolism. Their dysregulation can cause cellular stress and malfunction, ultimately leading to regulated cell death (RCD). Recently, cuproptosis and ferroptosis have emerged as newly discovered RCDs, reflecting promising results in the context of cancer management. Unlike other RCDs, ferroptosis and cuproptosis have distinct morphological, genetic, and biological mechanisms. Accumulated iron-driven ferroptosis and copper-induced cuproptosis disturb several cellular processes by altering key proteins, signalling pathways, and cell cycles. These disruptions ultimately lead to mitochondrial dysfunction, formation of excessive reactive oxygen species (ROS), impairment of lipid layers, and modulation of immunological functions, altogether paving the direction towards cancer suppression and providing novel avenues towards targeted therapeutic strategies. Therefore, this study aimed to understand the fundamental mechanisms of ferroptosis and cuproptosis, especially in cancer cell mortality. Furthermore, this study highlights the multifaceted roles of phytocompounds, nanomedicines, and chemotherapeutic agents in inducing ferroptosis and cuproptosis. Thus, contributing to significant improvements in the development of cancer treatments.

POU3F2
Also flagged:chromatinneurogenesistranscription factorNFIBwaterdlx6a
Journal Article 2025-07-08 ✓ 2 Snippets Bright AR, Kotlyarenko Y, Neuhaus F, Rodrigues D, Feng C, Peters C, Vitali I, Dönmez E, Myoga MH, Dvoretskova E, Mayer C.
In-Text Gene Mentions

…with Nfia, Nfix,Pou3f2, Meis2 and Tcf4.…

…regulator of NFIA,POU3F2, MEIS2 and TCF4…

Show Full Abstract

Diverse types of GABAergic projection neuron and interneurons of the telencephalon derive from progenitors in a ventral germinal zone called the ganglionic eminence. Using single-cell transcriptomics, chromatin accessibility profiling, lineage tracing, birthdating, transplantation across developmental stages and perturbation sequencing in mouse embryos, we investigated how progenitor competence influences the maturation and differentiation of these neurons. We found that the temporal progression of neurogenesis shapes maturation competence in ganglionic eminence progenitors, influencing how their progeny progress toward mature states. By contrast, differentiation competence-defined as the ability of progenitors to produce diverse transcriptomic identities-was maintained throughout neurogenesis. Chromatin remodeling, together with a regulatory module composed of the transcription factor NFIB and its target genes, influenced maturation competence in late-born neurons. These findings reveal how transcriptional programs and chromatin accessibility govern neuronal maturation and the diversification of GABAergic neuron subtypes during neurodevelopment.

SERPINC1
Also flagged:Extracellular Vesiclescancerlipidextracellularvesiclestissue homeostasis
Journal Article 2025-07-08 ✓ 1 Snippet Jurj A, Paul D, Calin GA.
In-Text Gene Mentions

…serpin F2, andserpin C1C1 in HDL-co-precipitated…

Show Full Abstract

Cancer progression, along with other hallmarks of cancer, is sustained through bidirectional cell-to-cell communication. This function is primarily facilitated by lipid-rich nanoparticles expelled into the extracellular matrix by stromal and/or malignant cells. These entities, known as extracellular vesicles, contain a vast repertoire of bioactive molecules and hold promise as potential biomarkers and nanovehicles for drug delivery. Intriguingly, the cellular and molecular mechanisms governing the functions of extracellular vesicles remain poorly understood. In the present manuscript, we highlight the intracellular and intercellular journey of extracellular vesicles, from their inception to the present day, their implications in various hallmarks of cancer, and their clinical applications.

HFE
Also flagged:Chronic hepatitis Cchronic liver diseaseliver cirrhosishepatocellular carcinomaliver cancerextrahepatic
Journal Article 2025-07-08 ✓ 1 Snippet Li Z, Ye Y, Zhang Y, Xu W, Liu Y.
In-Text Gene Mentions

…hormones or combinedhemochromatosis, chronic pancreatitis, pancre…

Show Full Abstract

<h4>Background</h4>Chronic hepatitis C (CHC) is associated with an increased risk of type 2 diabetes mellitus (T2DM). However, regional variations in HCV genotypes and clinical characteristics may influence this association. This study aimed to investigate the association between chronic hepatitis C virus (CHC) infection and the development of T2DM in CHC patients in Southern China.<h4>Methods</h4>A retrospective case-control cohort study analyzed 442 CHC patients (242 without T2DM, 200 with T2DM) from 2010 to 2018. Biochemical parameters, HCV genotypes, and clinical characteristics were compared. Multivariate logistic regression and ROC analysis were performed to evaluate predictors of T2DM.<h4>Results</h4>The CHC + T2DM group exhibited significantly higher age (P < 0.001), BMI (P = 0.001), fasting blood glucose (P < 0.001), fasting insulin (P = 0.015), HOMA-IR (Homeostasis Model Assessment-Insulin Resistance) index (P < 0.001), transaminases alanine transaminase (ALT) (P < 0.001) and aspartate transaminase (AST) (P < 0.001), total bilirubin (P < 0.001), γ-Glutamyl Transferase (GGT) (P < 0.001), and cirrhosis prevalence (P < 0.001). Logistic regression analysis showed that age (OR: 1.09), fasting blood glucose (OR: 16.20), fasting insulin (OR: 1.23), HOMA-IR (OR: 0.48), and GGT (OR: 1.01), cirrhosis (OR: 15.32) and hypertension (OR: 31.00) were the risk factors of T2DM in CHC patients. HCV genotype distribution differed significantly between CHC and CHC + DM groups (P = 0.008), with genotype 3a more prevalent in CHC + DM (2.07% vs. 11.36%, P = 0.032). Receiver Operating Characteristic curve analysis highlighted fasting glucose (AUC = 0.904) as the strongest predictor.<h4>Conclusion</h4>Age, metabolic dysregulation, liver cirrhosis, hypertension, and HCV genotype 3a are key risk factors for T2DM in CHC patients. Early screening for glucose intolerance and genotype-specific interventions are critical in high-risk populations.

Also flagged:translationaland developmental disabilitychromosomeDown syndromemorphogenesisintellectual and developmental disability
Journal Article 2025-07-08 No Snippets Waugh KA, Wilkins HM, Smith KP, Ptomey LT.
Show Full Abstract

The most common genetic cause of intellectual and developmental disability is trisomy of human chromosome 21 (trisomy 21) or Down syndrome. Relative to the general population, individuals with Down syndrome heterogeneously experience atypical morphogenesis, a distinct neurocognitive profile, and a unique spectrum of diverse medical conditions that impact every major organ system. How trisomy 21 results in the highly variable manifestations of Down syndrome remains largely unknown and an active area of heavy investigation with therapeutic implications. For example, common inflammatory and metabolic signatures have begun to emerge across various co-occurring conditions in Down syndrome with assorted impacts on diverse yet intertwined organ systems that could directly or indirectly impact brain health. Here, we review current progress, resources, knowledge gaps, and bottlenecks for precision medicine approaches to promote brain health across the lifespan among individuals with Down syndrome within the larger context of research efforts geared towards our other distinct yet intertwined organ systems. Within this framework, we advocate for interdisciplinary pursuit of systems-level biomarkers to facilitate holistic intervention strategies that precisely benefit individuals with trisomy 21 each experiencing Down syndrome in their own unique way. To this end, we quantitatively assess clinical studies that are actively recruiting participants with Down syndrome and provide historical context through summary figures sourced to user-friendly tables that have been curated from federal websites to empower efficient exploration of research opportunities for interdisciplinary collaborations.

PEBP1
Also flagged:Androgenferroptosisspermatogenesissecretionglutathioneresponse to oxidative stress
Journal Article 2025-07-08 ✓ 1 Snippet An K, Tan Y, Yang K, Kang Y, Liu P, Hao B, Kang J, Su J.
In-Text Gene Mentions

…genes, such asPebp1, Rhox5 ,…

Show Full Abstract

BACKGROUND: Numerous animal species employ seasonal breeding strategies to cope with the challenges posed by environmental stress. Males exhibit periodic testicular development and spermatogenesis, which involves complex gene regulation and various cellular response mechanisms. However, the differences among species largely constrain our comprehensive understanding of this ecological adaptation phenomenon. Here, we explored the regulatory mechanism of seasonal testicular regression in plateau zokor (Eospalax baileyi), a typical seasonal breeding animal, through natural population survey and laboratory verification. RESULTS: In natural populations, testicular regression was accompanied by reduction in androgen secretion and glutathione (GSH) concentration and the downregulated of GSH peroxidase 4 (Gpx4) gene, suggesting that androgen may induce ferroptosis to participate in the breeding regulation of plateau zokor. To this end, we carried out an indoor control experiment to deprive animals of androgen signals during the breeding season, and observed gonadal regression, abnormal spermatogenesis, and hormone level disorders. RNA-Seq analysis revealed, the induction of the expression of 658 genes in the testis of zokor in response to the regulation of androgen signaling. These differentially expressed genes were enriched in response to oxidative stress, GSH metabolism, and ferroptosis. By measuring GSH concentration and observing the downregulation of Gpx4, we confirmed that androgen is a regulatory factor that induces ferroptosis in the testis of plateau zokor. CONCLUSIONS: Overall, we reported, for the first time, the role of ferroptosis in the regulation of seasonal breeding, providing a reference for understanding the regulatory mechanism underlying the seasonal breeding strategies of animals.

HTT
Also flagged:Strokedeathcognitive impairmentscognitive dysfunctioncognitive impairmentIschemic stroke
Journal Article 2025-07-08 ✓ 1 Snippet Kazmi S, Farokhi-Sisakht F, Davoody S, Bahlakeh G, Abbaszadeh F, Rahbarghazi R, Shekarchi A, Karimipour M.
In-Text Gene Mentions

…ha-synuclein, and Huntington (Htt) proteins are the…

Show Full Abstract

BACKGROUND: The role of autophagy following stroke and its underlying cascades have not yet been investigated in detail. The ischemic brain is characterized by complex pathophysiological mechanisms, including increased excitotoxicity, oxidative stress, inflammatory responses, intrinsic and extrinsic apoptotic pathways, blood-brain barrier (BBB) integrity, neurotoxic proteins, and neurodegeneration. By engaging multiple molecular pathways, autophagy plays both protective and detrimental roles in ischemic stroke. Main text: This review explores the state-of-the-art regarding autophagy’s role in neurotoxic protein clearance, neuroinflammation, oxidative stress, BBB, and neural tissue regeneration during and after ischemic stroke. Additionally, neuroinflammation is modulated by autophagy such that the inflammasomes and proinflammatory complexes that cause post-ischemic neuroinflammation are degraded. However, autophagy can be dysregulated, resulting in chronic neuro-inflammation. Moreover to counteract the excessive oxidative stress, autophagy is triggered mainly through the PINK1/Parkin pathway. In contrast, over-activated autophagy may cause neuronal damage and cell death. Autophagy maintains BBB integrity by restoring tight junction proteins. However, if dysregulated, the infiltration of inflammatory neurotoxic substances can exacerbate ischemic injury, highlighting the need for balanced regulation of autophagy. As the central nervous system (CNS) has limited regenerative capability, neural stem and progenitor cells are activated to promote neurogenesis following stroke. Autophagy can also enhance those regenerative processes. Conclusions Modulating autophagy offers potential therapeutic strategies in stroke patients by enhancing the protective effects of autophagy while minimizing its harmful consequences.

LRRC7
Also flagged:mild cognitive impairmentAlzheimer's diseaseADcognitive declinecell senescenceneurodegenerative diseases
Journal Article 2025-07-08 ✓ 1 Snippet Chen X, Chen S, Chen L, Zheng H, Nie J, Yang L, Li X, Ju K.
In-Text Gene Mentions

…RPS6KA5, SH3TC2 andLRRC7were targeted by…

Show Full Abstract

The rising global prevalence of Alzheimer's disease (AD) and mild cognitive impairment (MCI) underscores the urgent need to elucidate their underlying pathogenic mechanisms. This study investigated the dynamic alterations of plasma-derived exosomal miRNAs across the cognitive spectrum from normal cognition (NC) through MCI to AD, and their potential pathogenetic implications. Here, we enrolled 10 AD patients, 9 MCI patients, and 10 normal cognitive (NC) patients rigorously diagnosed using amyloid PET imaging, cerebrospinal fluid biomarkers, and standardized neuropsychological assessments. Serum exosomes were isolated and identified, then small RNA sequencing was performed. The results revealed distinct exosomal miRNA expression profiles across disease stages, with 10 conserved miRNAs showing progressive dysregulation along the NC-MCI-AD continuum. Target gene prediction formed numerous miRNA-mRNA pairs. GO and KEGG enrichment indicated that exosomal miRNAs might affect cognitive decline by regulating neurodevelopment and cell senescence. Strikingly, ROC analysis demonstrated superior diagnostic performance for miR-151a-3p and miR-210-3p in distinguishing disease states. Our findings not only characterize stage-specific exosomal miRNA signatures during AD progression but also identify novel circulating biomarkers with diagnostic potential. This work provides mechanistic insights into exosome-mediated pathological processes and advances the development of liquid biopsy approaches for early detection and therapeutic monitoring in neurodegenerative diseases.

SOX6
Also flagged:Muscle atrophyinnervationamyotrophic lateral sclerosisALSsarcopeniacachexia
Journal Article 2025-07-08 ✓ 2 Snippets Dos Santos M, Bezprozvannaya S, McAnally JR, Cai C, Liu N, Olson EN.
In-Text Gene Mentions

…, Rora ,Sox6, Nfib ,…

…transcription factors Rora,Sox6, Nfib, and Mef2c…

Show Full Abstract

Neuromuscular diseases such as amyotrophic lateral sclerosis and sarcopenia cause muscle atrophy, which preferentially affects fast-twitch glycolytic myofibers. The mechanisms underlying the susceptibility of fast myofibers to disease remain unclear. To investigate this, we analyzed the transcriptional profiles of myonuclei from denervated muscle fibers. We found that the fast muscle gene program and the transcription factor Maf were repressed upon denervation. Overexpression of Maf in mice prevented loss of muscle mass caused by denervation by repressing atrophic genes and restoring fast gene expression. Similar repression of fast genes and Maf was observed in muscles from mice and humans with amyotrophic lateral sclerosis. Notably, Maf overexpression in human skeletal muscle cells in vitro prevented muscle atrophy and activated the expression of fast muscle genes. Our findings highlight a key role for Maf in maintaining muscle mass and could offer a promising therapeutic strategy to preserve muscle function during disease, aging, and injury.

Also flagged:Ferroptosisocular diseasesdeathpathogenesisFerritinautophagy
Journal Article 2025-07-08 No Snippets Huang S, Sun Y, Yu X, Ren X, Wang L, Sun Y, Deng A.
Show Full Abstract

<h4>Background</h4>Ocular diseases pose a significant threat to visual health, with ferritin ferroptosis playing a critical role in the pathogenesis of many such conditions. Ferritin accumulation, coupled with ferritin autophagy-mediated release of labile Fe<sup>2+</sup>, triggers iron-dependent lipid peroxidation and ferroptosis. These include disruptions in iron metabolism, oxidative stress imbalances, altered intracellular signaling, and changes to the local microenvironment. Such aberrant ferritin deposits not only compromise the structure and function of ocular cells but also accelerate disease progression. Ferroptosis, a newly recognized form of cell death characterized by iron-dependent lipid peroxidation, differs from traditional cell death mechanisms, including apoptosis.<h4>Materials and methods</h4>This review systematically evaluated the role of ferroptosis in ocular diseases using a predefined search strategy. In brief, PubMed was searched for studies published between 2012 and 2025 using keywords combining ferroptosis, ocular diseases, retinal, corneal etc. After excluding non-ocular studies and duplicates, 188 articles were included following a full-text review.<h4>Conclusion</h4>This review examines the molecular mechanisms underlying ferroptosis and its implications for major ocular diseases. It explores how ferroptosis contributes to disease pathology in retinal diseases, offering novel insights for future therapeutic strategies. The potential for targeting ferroptosis pathways with iron modulators holds promise for advancing clinical treatments in ophthalmology.

HTT
Also flagged:psychopathologyemotion dysregulationdepressionmaternal depressionEDattention deficit hyperactivity disorder
Journal Article 2025-07-08 ✓ 2 Snippets Sabalbal A, El Hayek S, Baroud E, Shamseddeen W.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT) and a polymorphic…

…onnaire Dysregulation Profile;5-HTT, serotonin transporter gene;…

Show Full Abstract

<h4>Background</h4>Parental depression is an important risk factor for the development of psychopathology in children/adolescents. Many children who suffer from psychopathology also experience emotion dysregulation, which is characterized by an inability to modulate the intensity and quality of emotions. Emotion dysregulation carries high morbidity and predicts ongoing mood/behavior problems. To develop more effective intervention and prevention programs, it is important to understand the variables that mediate and moderate the relationship between parental depression and children's emotion dysregulation. This study aimed to systematically explore possible mediators and moderators.<h4>Methods</h4>The PubMed, Scopus, PsycINFO, and Embase databases were systematically searched from day of inception until January 12, 2024. The reference lists of the reviews of interest identified during the screening were included. Two authors screened/collected articles through title and abstract screening, followed by full-text screening. The results were qualitatively synthesized. The inclusion criteria were: <i>population</i>, children/adolescents (aged 0-17 years); <i>exposure</i>, parental depression; <i>outcome</i>, emotion dysregulation; and <i>study design</i>, quantitative.<h4>Results</h4>A total of 1,731 studies were identified, of which 556 were potentially eligible. After removing duplicates/retracted articles, 380 records were screened (title/abstract), following which 315 records were excluded. Of the remaining 65 studies, eight met the inclusion criteria after full-text screening. Most of the studies (<i>n</i> = 6) included mothers. Biological variables and variables related to the child, to parental depression severity, and to child-parent interactions emerged. The biological variables (the child's genotype and left parietal alpha asymmetry) highlight a biological vulnerability to dysregulation beyond parent-child effects and environmental factors: left parietal alpha asymmetry was a partial mediator, while genotype was a moderator as children carriers of the S/LG genotypes experienced higher levels of dysregulation as a function of exposure to higher levels of prenatal maternal depression. Depression severity and parent-child dyadic variability were moderators as elevated levels of dysregulation among girls were predicted by greater maternal depression severity and mothers who were more inconsistent in parenting behaviors were more likely to have toddlers with dysregulation, especially if the mothers were depressed. Diet was a mediator, and more severely depressed mothers were more likely to feed their children unhealthy diets, in turn leading to greater dysregulation in later years. Parenting stress mediated the relationship between maternal depression and dysregulation in toddlers.<h4>Conclusions</h4>Children of depressed parents are a vulnerable group and are prone to developing emotion dysregulation. The findings suggest that prevention/intervention programs should target the children of more severely depressed parents and those of parents who engage in more negative interactions with them. Children's diet and parenting stress are also potential evidence-based, modifiable intervention targets.<h4>Systematic review registration</h4>https://www.crd.york.ac.uk/PROSPERO/, identifier CRD42024502390.

NEGR1
Also flagged:obesityautismdepressionion channelstransportersAP-1
Journal Article 2025-07-08 ✓ 5 Snippets Maigoro AY, Kim J, Cho S, Yoo A, Lee S.
In-Text Gene Mentions

…gene dysregulation inNegr1-deficient mice: insights into…

…growth regulator 1 (NEGR1) is a brain-enriched…

…studies have implicatedNEGR1as a risk…

…novel role forNEGR1in modulating peripheral…

…IntroductionNeuronal growth regulator 1growth regulator 1…

Show Full Abstract

<h4>Introduction</h4>Neuronal growth regulator 1 (NEGR1) is a brain-enriched membrane protein with mild expression in peripheral tissues such as adipose tissue and skeletal muscle. Genome-wide association studies have implicated NEGR1 as a risk factor for human diseases including obesity, autism, and depression, but its molecular function remains poorly understood.<h4>Methods</h4>To explore NEGR1's role in peripheral-to-brain communication, we conducted RNA-seq analysis on four peripheral tissues-intestine, skeletal muscle, liver, and epididymal white adipose tissue-collected from <i>Negr1</i> knockout mice. Differentially expressed genes (DEGs) were identified and subjected to Gene Ontology (GO) enrichment analyses.<h4>Results</h4>The DEG analysis revealed dysregulation of ion channels and transporters, potentially contributing to AP-1-mediated inflammatory responses in peripheral tissues. Additionally, interleukin (IL)-17 signaling emerged as a key pathway that may mediate systemic inflammation in <i>Negr1</i>-deficient mice.<h4>Discussion</h4>These findings suggest a novel role for NEGR1 in modulating peripheral inflammatory responses and support the hypothesis that peripheral immune dysregulation may contribute to depressive-like behaviors in <i>Negr1</i>-deficient mice. This work enhances our understanding of NEGR1's function in peripheral tissues and its possible involvement in peripheral-central immune crosstalk relevant to psychiatric disorders.

Also flagged:CannabinoidsNeurodegenerative Disordersneurodegenerative diseasesimmune system disordersCNS diseasesCNS disorders
Journal Article 2025-07-08 No Snippets Tomaszewska-Zaremba D, Gajewska A, Misztal T.
Show Full Abstract

Many neurodegenerative diseases are associated with immune system disorders, while neurodegenerative processes often occur in inflammatory conditions of the Central Nervous System (CNS). Cannabinoids exhibit significant therapeutic potential due to their dual ability to modulate both neural and immune functions. These compounds have a broad spectrum of action, allowing them to target multiple pathological mechanisms underlying neurodegenerative and inflammatory CNS diseases. The present review outlines the therapeutic potential of cannabinoids, with a focus on their anti-inflammatory properties, in the treatment of neurodegenerative conditions, including Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease, as well as inflammatory CNS disorders like multiple sclerosis and HIV-associated dementia.

HFE
Also flagged:metalshepatocellular carcinomaCopperzincironcancer
Journal Article 2025-07-08 ✓ 1 Snippet Parisse S, Andreani G, Mischitelli M, Gianoncelli A, Malucelli E, Fratini M, Ferri F, Carlucci M, Lai Q, Ascione A, Mennini G, Rossi M, Iotti S, Isani G, Ginanni Corradini S.
In-Text Gene Mentions

…failure, Wilson’s disease,hemochromatosis, and thyroid disease…

Show Full Abstract

This study aimed to compare the contents of copper (Cu), zinc (Zn), magnesium (Mg), and iron (Fe) in healthy liver tissue from deceased liver donors (DGs), in cirrhotic tissue from patients without (CIR) or with hepatocellular carcinoma (CIR-HCC) and in HCC tissue from the latter patients. Liver tissue samples were obtained from cirrhotic liver transplant recipients, with (<i>n</i> = 14) and without HCC (<i>n</i> = 14), and from DGs (<i>n</i> = 18). In patients with HCC, both cirrhotic and tumor tissue was collected. The tissue metal content was measured using atomic absorption spectrometry. The Cu content of DG tissue was significantly lower than that of CIR-HCC and HCC tissue but not CIR tissue. The tissue Zn and Mg contents were significantly higher in DG tissue than in CIR, CIR-HCC, and HCC tissues. No difference was observed for Fe. The Cu/Zn ratio progressively increased in DG, CIR, CIR-HCC, and HCC tissues. The increased Cu content in cirrhotic and tumor tissue of HCC patients and the fact that the latter had the highest value for the Cu/Zn ratio indirectly suggest the potential role of these metals in hepatocarcinogenesis. These findings support a pathophysiological basis for further experimental studies to investigate the potential therapeutic implications of pharmacological agents targeting metal homeostasis in this malignancy.

Also flagged:transcription factorsproteinsbindingdegradationtumortumors
Journal Article 2025-07-08 No Snippets Zhou Z, Liang J, Cheng B, Li Y, Zhou W, Tian H, Shi W, Liu K, Fang L, Li H, Shao X.
Show Full Abstract

Targeted degradation technologies, primarily referring to targeted protein degradation, have emerged as promising drug discovery strategies. In contrast to traditional "occupancy-driven" inhibition approaches, these technologies ingeniously leverage the cell's endogenous degradation mechanisms to achieve specific elimination of disease-causing targets. Autophagy, a highly conserved cellular clearance pathway, possesses broad substrate recognition capabilities, enabling degradation of not only individual proteins but also protein aggregates, damaged organelles, and invading pathogens. Given these characteristics, researchers are actively exploring the application of autophagy mechanisms in targeted degradation technologies. Herein, we summarize recent advances in autophagy-dependent degradation approaches, including autophagosome tethering compounds (ATTEC), autophagy-targeting chimeras (AUTAC), autophagy-targeting Chimera (AUTOTAC), chaperone-mediated autophagy (CMA)-based methods, nanotechnology-based strategies, and the newly introduced autophagy-induced antibody (AUTAB) technique, highlighting their mechanisms, advantages, and potential applications in treating tumors, neurodegenerative diseases, and other challenging conditions.

PRDX6
Also flagged:watertinoxygensuperoxide dismutaseSODcatalase
Journal Article 2025-07-08 ✓ 3 Snippets Zhao C, Suo A, Ding D, Song W.
In-Text Gene Mentions

Prdx6, an antioxidant,…

Prdx6expression in haarder…

…liver by activatingPRDX6.…

Show Full Abstract

In coastal waters, tributyltin chloride (TBTC), a persistent organic pollutant, is extensively present. It is uncertain, therefore, if exposure to TBTC can harm haarders and how. This study exposed the fish for 60 days in order to investigate the molecular mechanism of haarder following TBTC poisoning. Our findings demonstrated that growth indices dropped, liver tissue was damaged, and the liver's total tin concentration rose following TBTC exposure. Furthermore, we discovered that blood reactive oxygen species rose while total blood cell count decreased. As malondialdehyde levels rose, total antioxidant capacity and antioxidant enzyme activity (superoxide dismutase, catalase, and glutathione peroxidase) were markedly reduced. After being exposed to TBTC, liver cells displayed clear signs of apoptosis. Differentially expressed genes were primarily linked to oxidative stress, energy metabolism, and apoptosis, according to the transcriptome study of livers. Overall, the long-term stress of TBTC resulted in the antioxidant system being harmed, as well as serious malfunction of the energy metabolism and apoptotic response.

Also flagged:watercarbonvanillintannic acidboric acidrosin
Journal Article 2025-07-08 No Snippets Tran HTT, Baur J, Radjef R, Nikzad M, Bjekovic R, Carosella S, Middendorf P, Fox B.
Show Full Abstract

This work presents the development of two vanillin-based vitrimer epoxy flax fibre-reinforced composites, with both the VER1-1-FFRC (a vitrimer-to-epoxy ratio of 1:1) and VER1-2-FFRC (a vitrimer-to-epoxy ratio of 1:2), via a vacuum-assisted resin infusion. The thermal and mechanical properties of the resulting vitrimer epoxy flax composites were characterised using thermal gravimetric analysis (TGA), differential scanning calorimetry (DSC), dynamic mechanical analysis (DMA), and mechanical four-point bending tests, alongside studies of solvent resistance and chemical recyclability. Both the VER1-1-FFRC (degradation temperature T<sub>deg</sub> of 377.0 °C) and VER1-2-FFRC (T<sub>deg</sub> of 395.9 °C) exhibited relatively high thermal stability, which is comparable to the reference ER-FFRC (T<sub>deg</sub> of 396.7 °C). The VER1-1-FFRC, VER1-2-FFRC, and ER-FFRC demonstrated glass transition temperatures T<sub>g</sub> of 54.1 °C, 68.8 °C, and 83.4 °C, respectively. The low T<sub>g</sub> of the vitrimer composite is due to the low crosslink density in the vitrimer epoxy resin. Particularly, the crosslinked density of the VER1-1-FFRC was measured to be 319.5 mol·m<sup>-3</sup>, which is lower than that obtained from the VER1-2-FFRC (434.7 mol·m<sup>-3</sup>) and ER-FFRC (442.9 mol·m<sup>-3</sup>). Furthermore, the mechanical properties of these composites are also affected by the low crosslink density. Indeed, the flexural strength of the VER1-1-FFRC was found to be 76.7 MPa, which was significantly lower than the VER1-2-FFRC (116.2 MPa) and the ER-FFRC (138.3 MPa). Despite their lower thermal and mechanical performance, these vitrimer composites offer promising recyclability and contribute to advancing sustainable composite materials.

Also flagged:neurodegenerative diseasesagingmembraneADneurological diseasesamyotrophic lateral sclerosis
Journal Article 2025-07-08 No Snippets Sun Z, Li C, Leitner D, Wu M, Zhang J, Wisniewski T, Ge Y.
Show Full Abstract

The choroid plexus (ChP), a highly vascularized brain structure responsible for cerebrospinal fluid (CSF) production, undergoes significant age-related changes that may contribute to neurodegenerative diseases involving disrupted immune regulation, fluid homeostasis and waste clearance. Compared to other brain regions, vascular research on the ChP remains limited despite its critical role as a central interface between the blood and CSF. This review focuses on age-related vascular and structural alterations in the ChP from both histopathological and neuroimaging perspectives, and explores their impact on CSF dynamics, immune regulation, and the integrity of the blood-CSF barrier (BCSFB). Rather than shrinking, the aging ChP often enlarges due to dystrophic changes, as shown in volumetric MRI studies. Histological studies reveal epithelial degeneration, basement membrane thickening, and stromal fibrosis in the normal aging process. In dementia such as Alzheimer's disease (AD), proteomic studies have identified upregulation of AD- and immune-related proteins, along with downregulation of proteins linked to CSF clearance and metabolic support. Emerging high-resolution contrast-enhanced MRI techniques now allow in vivo visualization of microvascular changes within the ChP, shedding light on its normal and abnormal aging processes. Understanding these alterations is critical, as they may influence the onset and progression of various neurological diseases such as AD, Parkinson's disease (PD), normal pressure hydrocephalus, and amyotrophic lateral sclerosis (ALS). The recent advancements and challenges described in this study underscore the need for deeper investigation into ChP aging to inform future diagnostic and therapeutic strategies of neurodegenerative diseases.

Also flagged:response to stressACTHadrenocorticotropic hormonecorticosteroneto stressanxiety
Journal Article 2025-07-08 No Snippets Vijayaram S, Mahendran K, Razafindralambo H, Ringø E, Kannan S, Sun YZ.
Show Full Abstract

The gut microbiome plays a significant role in regulating gastrointestinal (GI) function and modulating the gut-brain axis, which describes the bidirectional communication between the GI tract and the central nervous system (CNS). Its involvement in digestion, immunity, and neurophysiology is well recognized. This study offers novel insights by focusing on psychobiotics, a class of probiotics with targeted neuroactive properties. These microorganisms influence brain function through defined mechanisms, including modulation of neuroinflammation, neurotransmitter production (GABA, serotonin), regulation of the hypothalamic-pituitary-adrenal (HPA) axis, and vagus nerve signaling. Our work critically examines recent advances in applications of psychobiotics for neurological disorders such as Parkinson's disease, Alzheimer's disease, multiple sclerosis, and autism spectrum disorder. By integrating evidence from microbiome research, neuroimmunology, and clinical studies, we identify promising microbial strains and mechanistic pathways with therapeutic potential. This study contributes original perspectives by highlighting underexplored microbe-host interactions and proposing targeted microbial interventions as adjuncts to conventional neurotherapies. Further research is needed to validate strain-specific effects, long-term efficacy, and safety profiles in clinical settings.

SUDS3
Also flagged:SAP25peptidepeptidestranslational modificationschromatinarginine
Journal Article 2025-07-07 ✓ 2 Snippets Goswami P, Cesare J, Rekowski MJ, Clark Z, Thornton J, Washburn MP.
In-Text Gene Mentions

…HDAC1, BRMS1L, ARID4A,SUDS3, ARID4B and SAP30L…

…ARID4B, SAP30L, andSUDS3were present with…

Show Full Abstract

In this study, we analyzed the combination of affinity purification mass spectrometry (AP-MS) with high-field asymmetric waveform ion mobility spectrometry (FAIMS), integrated between nanoLC-MS and an Orbitrap Ascend tribrid mass spectrometer. Our primary objective was to evaluate the application of the FAIMS interface for detecting affinity purified SAP25 protein complexes with enhanced sensitivity and robustness. As a result, we observed that nanoLC-FAIMS-MS (with FAIMS) significantly improved the sensitivity and detection limits at the protein level, peptide level and significantly reduced chemical contaminants compared to nanoLC-MS alone without FAIMS (No FAIMS). This FAIMS configuration resulted in 42% and 92% increases for the total proteins and unique proteins, respectively, and 44% and 88% increases for total peptides and unique peptides compared to the No FAIMS configuration. Our in-depth comparison of FAIMS and No FAIMS shows that FAIMS outperforms by significantly reducing the missing value by <15% in datasets and plays a significant role in filtering chemical contaminants. Lastly, we searched the datasets for multiple post-translational modifications important in chromatin remodeling and found several arginine methylation sites on the bait protein SAP25. Our findings highlight the potential of FAIMS with Orbitrap Ascend tribrid mass spectrometer to enhance the depth of AP-MS analysis. The data were deposited with the MASSIVE repository with the identifier MSV000096548.

Also flagged:IsoindolinoneHuntingtinHuntington's diseaseHDpolyglutamineisoindolinones
Journal Article 2025-07-07 No Snippets Liu L, Johnson PD, Mills MR, Turner PA, Prime ME, Brown CJ, Kotey A, Coe S, Giles PR, Lloyd C, Hayes S, Marlin FJ, Rota F, Herrmann F, Heßmann M, Schaertl S, Zajicek F, De Lombaerde S, Elvas F, Verhaeghe J, Staelens S, Bertoglio D, Chen X, Conlon MP, Davis R, Ensor SF, Haber J, Haber KC, Hsai MM, Mangette JE, Penniman WF, Anzillotti L, Esposito S, Lembo A, Orsatti L, Ventre D, Veneziano M, Sandiego C, Haller S, Marriner GA, Munoz-Sanjuan I, Khetarpal V, Bard JA, Dominguez C.
Show Full Abstract

Huntington's disease (HD) is caused by the repeat expansion of the CAG trinucleotide in the mutant Huntingtin gene (m<i>HTT</i>) within the exon1 region, resulting in an expanded polyglutamine-containing mHTT exon1 protein that serves as the source of the hallmark mHTT aggregates in people with HD (PwHD). To better understand aggregation formation during disease progression and its utility as a pharmacodynamic biomarker, we have been targeting mHTT aggregates for developing PET imaging tracers and have identified a series of isoindolinones that show significantly higher binding potential (BP, a ratio of Bmax over <i>K</i><sub>D</sub>) in HD mouse models as well as increased binding in HD post-mortem brains, compared to first generation ligands. We present the structure-activity relationship (SAR) work leading to three candidate tracers progressed for human studies: [<sup>11</sup>C]CHDI-009 (<b>6</b>), [<sup>18</sup>F]CHDI-385 (<b>29</b>) and [<sup>18</sup>F]CHDI-386 (<b>30</b>).

TNFSF4
Also flagged:cancerhead and neck cancerhead and neck squamous cell carcinomaHNSCCalcoholviral infections
Journal Article 2025-07-07 ✓ 1 Snippet Zhang L, Ren S, Lan T, Marco V, Liu N, Wei B, Chen Y, Wu J, Li Q, Wu F, Lu P, Miao J, Lin H, Wang X, Zhong J, Li J, Fan S.
In-Text Gene Mentions

…formation, including CXCL13,TNFSF4, CTLA4, and CXCR6,…

Show Full Abstract

Mature tertiary lymphoid structures (TLSs) are immune aggregates associated with immune checkpoint blockade (ICB) responses in various cancers, yet their role in chemoimmunotherapy response in head and neck squamous cell carcinoma (HNSCC) remains unclear. By analyzing TCGA-HNSC transcriptomic data and pathology slides, we identified an immune subtype enriched in TLSs, predominantly in HPV-positive tumors, which correlated with favorable immunotherapy response. Single-cell and spatial transcriptomics further revealed distinct TLS compositions, with mature TLSs enriched in germinal center B cells, follicular helper T cells, and resident memory CD8 T cells, while immature TLSs contained FCRL4+ B cells and peripheral helper T cells. Multispectral immunohistochemistry, flow cytometry, and ELISA validated these findings. Notably, neoadjuvant chemoimmunotherapy promoted mature TLS formation. These results suggest that TLS maturity correlates with HPV status and response to anti-PD-1-based chemoimmunotherapy, providing insights for potential therapeutic strategies in HNSCC.

PTGIS
Also flagged:NUT CarcinomatumorsNUTM1BRD4Gene Expressiontumor
Journal Article 2025-07-07 ✓ 1 Snippet Bell D, Choby G, Afkhami M, Maghami E, Ferrarotto R, Snyderman C, Wang E, Hanna E, Seethala R.
In-Text Gene Mentions

…, COL6A3 ,PTGIS).…

Show Full Abstract

<h4>Background</h4>Nuclear protein in testis (NUT) carcinomas (NCs) are rare, clinically aggressive tumors with characteristic translocation involving NUTM1 and BRD4 genes. While NCs are generally characterized by undifferentiated basaloid cells with focal/abrupt squamous differentiation, tumoral heterogeneity remains unexplored. This may have therapeutic implications as NC frequently develops drug resistance and metastasis. Spatial transcriptomics (ST) sequencing technology emerged as an approach to elucidate tumoral heterogeneity by integrating cellular transcriptome and spatial distributions within tissues, providing insights into the interactions among different cell types and overall tissue genomic architecture.<h4>Methods</h4>Three cases of sinonasal NC with formalin-fixed paraffin embedded tissue formed the study material. A representative region of each NC was subjected to 10X Genomics Visium Spatial Gene Expression analysis. Resulting data were analyzed in 10X Genomics Loupe Browser.<h4>Results</h4>All cases demonstrated statistically distinct (graph-neural network based) transcriptomic clusters. These clusters were correlated with histologic characteristics by parsing all spots by region types based on tissue distribution including tumor, limited stroma, and normal epithelium. Cluster constitution and transcriptomic pattern were consistent with the morphologic features of each tissue region. NC#3 had a relatively low number of tumor clusters in comparison to NC#1 and NC#2.<h4>Conclusions</h4>Spatial transcriptomic profiling corresponds to histopathologic features in NC and yet highlights cell type diversity across tumors and in the case of NC#2, within a given tumor. Behavioral correlates are speculative, but NC#3 for which the patient had a rapidly lethal outcome showed a preponderance of neural gene expression which may be of interest in tumor cell progression/evolution.

SERPINC1
Also flagged:SIRSkidney failureARDSsepsislactatecoagulation
Journal Article 2025-07-07 ✓ 2 Snippets Brauckmann V, Enke SR, Dietrich AKIM, Neunaber C, Roth S, Wilhelmi M.
In-Text Gene Mentions

…(PCC), antithrombin III (ATIII), and factor XIII.…

…inistration (e.g., fibrinogen,ATIII).…

Show Full Abstract

<h4>Purpose</h4>This study evaluates an updated demographic and epidemiological analysis of polytrauma patients, examining sex-specific outcomes, age distribution, and injury severity measured by the Injury Severity Score (ISS).<h4>Methods</h4>This retrospective observational cohort analysis at a level I trauma center in Germany analyzed data from polytrauma patients with an ISS > 16, which were treated in an ICU between 2018 and 2021. Parameters collected included injury scores, pre-hospital data, and clinical outcomes. Assessed was distribution and correlation in pre-hospital and in-hospital outcomes.<h4>Results</h4>In a cohort of 87 polytrauma patients (78.2% male, mean age 45.6 years, mean ISS of 35.4) thoracic injuries were the most frequent (83.9%), followed by injuries of the lower extremity, head, and upper extremity. Females had higher Apache scores and more severe head and neck injuries (p < 0.05). Mortality was 15%, deceased patients showing significantly higher ISS. Younger patients had longer hospital stays, averaging 26.1 days. Complications occurred in 90% of patients, predominantly SIRS, followed by kidney failure, ARDS, and sepsis. Prehospital care, including on-scene time, showed no overall correlation with outcomes, except chest drainage, which was associated with higher ARDS and MODS rates. Females received more platelet concentrates, FFPs and TXA.Higher ISS correlated with increased Apache, SOFA, lactate levels and required more blood transfusions and coagulation therapy (p < 0.001).<h4>Conclusion</h4>Sex and age were shown to be associated with variations in injury severity, physical response and coagulation management, with females showing distinct injury patterns and physiological burdens. These findings highlight the importance of demographic factors in optimizing polytrauma management and guiding future evidence-based approaches to improve patient care.

SERPINC1
Also flagged:Thrombusplatelet aggregationCardiovascular diseasesof theaneurysmcoagulation
Journal Article 2025-07-07 ✓ 2 Snippets Cardillo G, Barakat AI.
In-Text Gene Mentions

…by antithrombin III (ATIII).…

…thrombin, prothrombin, andATIII, by adding a…

Show Full Abstract

Thrombotic deposition plays a critical role in the evolution of various vascular pathologies and is a major consideration in the development of cardiovascular devices. Although experimental evidence has shown that shear gradients in blood flow play a critical role in thrombogenesis, the impact of these gradients has not been included in previous computational models of thrombosis. The goal of the present work is to develop a predictive computational model of platelet plug formation that accounts for the role of shear gradients. A 2D computational model of platelet-mediated thrombogenesis was developed using the commercial finite element solver COMSOL Multiphysics 5.6. The model includes platelet transport, activation, adhesion and aggregation induced by both biochemical and mechanical factors. Platelet and agonist transport are described by a coupled set of convection-diffusion-reaction equations. Platelet adhesion and aggregation at the vascular surface are modeled via flux boundary conditions. Thrombus growth and its impact on blood flow are modeled using a moving surface mesh. The model provides the spatiotemporal evolution of a platelet plug in the flow field. After validation against experimental data in the literature, the model was used to predict the location and growth dynamics of platelet plugs in various vascular geometries. The results confirm the importance of considering both mechanical and chemical platelet aggregation and underscore the essential role that shear gradients play in platelet plug formation. The developed model represents a potentially useful tool for thrombogenesis prediction in pathological scenarios and for the optimization of endovascular device design.

Also flagged:factorsvirulence factorsinfectionvirulence factortype-III secretionhost cell
Journal Article 2025-07-07 No Snippets Greene J, Cotten KL, Snyder RA, Huiszoon RC, Chu S, Braza RED, Chapin AA, Stine JM, Bentley WE, Ghodssi R, Davis KM.
Show Full Abstract

It has been long appreciated that expression of the Yersinia type-III secretion system (T3SS) in culture is associated with growth arrest. Here we sought to understand whether T3SS expression is sufficient to trigger loss of exponential phase markers, and utilized a fluorescent reporter for ribosomal protein expression to detect changes in bacterial growth state. Using a fluorescent transcriptional reporter with the rpsJ/S10 promoter fused to a destabilized gfp variant, we confirmed reporter expression significantly increases in exponential phase and decreases as cells transition to stationary phase. In a mouse model of systemic Y. pseudotuberculosis infection, we found multiple subsets of bacterial cells in the mouse spleen, including cells with high T3SS and low S10 expression and cells with high expression of both markers. In bacterial media, growth inhibition with T3SS induction and a reduction in S10 expression were observed, but a significant proportion of cells retained high expression of both T3SS and S10. Paradoxically, while loss of T3SS expression rescued growth, lower S10 expression was detected, again indicating bacteria can express both markers simultaneously. In media, bacteria grow planktonically as individual cells, while in mouse tissues, bacteria form clustered extracellular communities. We utilized droplet-based microfluidics to encapsulate bacteria in spherical agarose droplets and model clustered growth, and observed high expression of T3SS without an impact on S10 levels. Finally, we show that T3SS expression is sufficient to promote antibiotic tolerance, but surviving bacteria in a gentamicin treatment mouse model specifically express low S10. Collectively, these data indicate that the growth arrest associated with T3SS induction can reduce antibiotic susceptibility, but cells surviving antibiotic treatment display lower levels of the exponential phase marker, S10.

Also flagged:grapheneoxidecalciumphosphateglycolic acidmicrospheres
Journal Article 2025-07-07 No Snippets Hosseini FS, Whitfield T, Orlando JD, Deng C, Abedini AA, Argyrou C, Kan HM, Ghosh D, Maye PF, Lo KW, Nair L, Sydlik SA, Laurencin CT.
Show Full Abstract

Bone regeneration continues to be a challenge due to the complex nature of the tissue. Identifying new materials that stimulate regeneration while providing mechanical properties is an active area of research. One class of promising material in bone regeneration is graphene and its derivatives including graphene oxide (GO), the oxidized form of graphene. Recently, calcium phosphate graphene (CaPG), synthesized from GO, has been proven to have osteoinductive properties in vivo. However, CaPG is a powder, and therefore, processing is difficult. Here, we present a method for creating porous CaPG matrices by incorporating it in poly(lactic-co-glycolic acid) (PLGA). This research has comprehensively evaluated CaPG-encapsulated PLGA-based microspheres for localized delivery of osteoinductive inducerons, calcium, and phosphate ions for bone regenerative engineering. CaPG distribution improved mechanical properties and matrix hydrophilicity. CaPG-integrated matrices successfully supported cell viability, proliferation, and enhanced osteogenic differentiation of MC3T3-E1 cells assessed by alkaline phosphatase activity and calcium deposition. Major osteogenic gene expression significantly increased, including Sp7, bone gamma-carboxyglutamate protein, COL1A1, bone sialoprotein, and dentin matrix protein1. The CaPG-containing matrices induced the endogenous canonical Wnt/β-catenin signaling pathway, with no significant difference when treated with DKK1 inhibition, demonstrating its possible selective activation mechanism. The increased protein expression of pathway-specific target genes, Bone morphogenic protein-2 (BMP-2) and WNT-1-inducible-signaling pathway protein 1 (WISP-1), further confirmed endogenous activation of canonical Wnt/β-catenin signaling. These results suggest that CaPG-modified matrices improve the cellular osteogenic differentiation via the canonical Wnt/β-catenin signaling pathway. This study provides further mechanistic insights into the nature of crosstalk between cells and inducerons-rich functionalized matrices for osteoblastic differentiation and improved bone regeneration.

OLFM4
Also flagged:stem cell differentiationCREPTRPRD1BclusterinCLUtumors
Journal Article 2025-07-07 ✓ 2 Snippets Lan T, Li M, Duan X, Jia H, Cao Y, Wang Y, Ren F, Sheng J, Xu J, Chang Z.
In-Text Gene Mentions

…study, Lgr5 andOlfm4were used to…

…vs. 17.9%) orOlfm4+ cells (10.5%…

Show Full Abstract

Revival stem cells (revSCs) defined by transient induction of clusterin (CLU) expression rapidly expand and differentiate into multiple IEC lineages during intestinal regeneration. Although revSC induction is well-studied, the mechanisms governing their differentiation remain unclear. In this study, we demonstrate that CREPT/RPRD1B, a protein highly expressed in tumors and essential for crypt-base columnar cell (CBC) maintenance, was required for revSC differentiation during intestinal regeneration. Using Villin-Cre-mediated CREPT knockout (Vil-CREPT<sup>KO</sup>) mice, we found that CREPT deletion leads to regeneration failure following irradiation-induced damage. Interestingly, revSCs were remarkably accumulated, but enterocytes were decreased in Vil-CREPT<sup>KO</sup> mice. Our single-cell transcriptome analyses demonstrated that CREPT deletion impaired the stem potential of revSCs and inhibited their differentiation into enterocytes and goblet cells. Lineage tracing experiments confirmed the reduced regenerative capacity of CREPT-deficient revSCs in vivo. Together, our findings identified CREPT as an important regulator of revSC differentiation during intestinal regeneration.

ZNF322
Also flagged:Nasopharyngeal carcinomahead and neck cancerpersistent infectiontumorEBV infectionregulation of
Journal Article 2025-07-07 ✓ 2 Snippets Wang TM, Zhang WL, Xie JR, He YQ, Tang M, Xue WQ, Yang DW, Deng CM, Diao H, Mai ZM, Xiao RW, Liao Y, Li DH, Wu YX, Jiang CT, Zhang JB, Chen XY, Du Y, Tang CL, Jia WH, Zhou T, Li XZ, Zhang PF, Zheng XH, Zhang SD, Hu YZ, Cai Y, Zheng Y, Zhang Z, Jin G, Chen W, Mai HQ, Sun Y, Hu Z, Liu J, Guan XY, Bai F, Bei J, Ma J, Zeng M, Lung ML, Adami HO, Ye W, Lam TH, Shen H, Jia WH.
In-Text Gene Mentions

…ZNF619 , andZNF322), RNA processing…

…Lastly,ZNF322(6p22.2 locus, PPH4…

Show Full Abstract

<h4>Background</h4>Nasopharyngeal carcinoma is an aggressive malignancy originating from the nasopharyngeal mucosa and associated with genetic factors. Many nasopharyngeal carcinoma susceptibility loci have been identified by genome-wide association studies (GWASs), but their underlying functional insights are largely unexplained.<h4>Results</h4>A meta-GWAS including 5073 nasopharyngeal carcinoma patients and 5860 controls from nasopharyngeal carcinoma endemic areas identifies a total of 863 significant SNPs, including SNPs at a novel locus 3p24.1 (rs56365817; nearby genes: CMC1/EOMES). By integrating the GWAS signals with single-cell and bulk profiles, we find nasopharyngeal carcinoma susceptibility robustly associated with T cells in different methods and datasets. In nasopharyngeal carcinoma-associated cell type, we identify 234 putative susceptibility genes (81.62% of them novel), mainly enriched in immune-related biological processes. Five putative causal genes are prioritized. We perform in-depth bioinformatic analysis and functional experiments for EOMES, finding that the nasopharyngeal carcinoma-risk alleles of four functional SNPs upregulate EOMES expression by promoting the activity of regulatory elements in T cells, and EOMES participates in nasopharyngeal carcinoma tumorigenesis via regulation of CD8<sup>+</sup> T cell exhaustion in the tumor microenvironment.<h4>Conclusions</h4>This study uncovers novel nasopharyngeal carcinoma susceptibility genes and their functional cell types, which improves the understanding of nasopharyngeal carcinoma genetic etiology.

TNFSF4
Also flagged:Pancreatic cancercancerTNFcell proliferationtumorTNFSF
Journal Article 2025-07-07 ✓ 5 Snippets Deng Z, Li L, Yang Z, Zeng G, Liu R.
In-Text Gene Mentions

…its ligand OX40L (TNFSF4) are key members…

…the role ofTNFSF4in tumor progression,…

…the potential ofTNFSF4as a predictive…

…findings suggest thatTNFSF4plays a critical…

…the correlation betweenTNFSF4and these markers.…

Show Full Abstract

The tumor necrosis factor (TNF) ligand superfamily plays a critical role in immune regulation and has emerged as a promising target in cancer immunotherapy. By binding to its receptor OX40 (CD134), TNFSF4 promotes the proliferation and survival of T cells and plays an important role in the tumor immune microenvironment, but its role in pancreatic cancer is unclear. This study aimed to investigate the expression patterns and prognostic significance of TNF ligand family members in pancreatic cancer (PC), with a specific focus on TNFSF4. We analyzed single-cell RNA sequencing data from the GSE212966 dataset to assess the expression of TNFSF ligands across immune cell types. TCGA-PAAD bulk RNA-seq data were used for non-negative matrix factorization (NMF) clustering to identify molecular subtypes based on TNFSF ligand expression profiles. Immune infiltration was quantified using single-sample gene set enrichment analysis (ssGSEA), and Kaplan-Meier survival curves were used to compare overall survival (OS) and progression-free survival (PFS) between subtypes. Immunotherapy response prediction was evaluated using tumor mutational burden (TMB), immunophenoscore (IPS), and tumor immune dysfunction and exclusion (TIDE) scores. Gene expression validation was performed using qRT-PCR. TNFSF ligands were predominantly expressed in antigen-presenting cells, particularly B cells and macrophages. NMF clustering identified two molecular subtypes of PC, with cluster 2 associated with significantly better OS and PFS (p < 0.05). TNFSF4, highly enriched in B cells, was found to regulate immune-related pathways such as B cell receptor signaling and cytokine-cytokine receptor interaction, as revealed by KEGG pathway analysis. TNFSF4 expression also correlated with favorable immunotherapy markers, suggesting its potential role as a predictive biomarker. These findings were supported by qRT-PCR validation. This study provides a TNFSF ligand-based molecular classification of pancreatic cancer and highlights the immunoregulatory role of TNFSF4. Its association with patient prognosis and immunotherapy responsiveness suggests potential clinical utility in guiding treatment strategies.

Also flagged:methylationHeart failurepathogenesisgene expressionisoproterenolPrkag2
Journal Article 2025-07-07 No Snippets Lahue C, Wong E, Dalal A, Tan Lek Wen W, Ren S, Foo R, Wang Y, Rau CD.
Show Full Abstract

Heart failure (HF) is a major global health challenge, contributing to over 18 million deaths annually. While the roles of genetic and environmental factors are widely studied, the role of DNA methylation in HF pathogenesis is not fully understood. This study leverages the Hybrid Mouse Diversity Panel (HMDP) to investigate the relationship between DNA methylation, gene expression, and HF phenotypes under isoproterenol-induced cardiac stress. Using reduced representational bisulfite sequencing, we analyzed DNA methylation profiles in the left ventricles of 90 HMDP strains. Epigenome-wide association studies identified 56 CpG loci linked to HF phenotypes, with 18 loci predicting HF progression. Key genes, including Prkag2, Anks1a, and Mospd3, were implicated through integration with gene expression and phenotypic data. In vitro validation confirmed the roles of Anks1aand Mospd3 in attenuating isoproterenol-induced hypertrophy. Additionally, treatment with the DNA methyltransferase inhibitor RG108 mitigated cardiac hypertrophy, preserved ejection fraction, and restored methylation-sensitive gene expression, underscoring the therapeutic potential of targeting DNA methylation in HF. This study highlights the interplay between DNA methylation, gene expression, and HF progression, offering new insights into its molecular underpinnings. The findings emphasize the role of epigenetic regulation in HF and suggest DNA methylation as a promising target for therapeutic intervention.

ZNFX1
Also flagged:translationalchromatinremodelingmolecular chaperonescancertumor
Journal Article 2025-07-07 ✓ 3 Snippets Chiu HS, Somvanshi S, Chang CT, de Bony de Lavergne EJ, Wei Z, Hsieh CH, Trypsteen W, Scorsone KA, Patel E, Tang TT, Flint DB, Najaf Panah MJ, Kim HR, Rathi P, Lee YW, Woodfield SE, Vasudevan SA, Heczey AA, Gaber MW, Sawakuchi GO, Chen TW, Mestdagh P, Yang X, Sumazin P.
In-Text Gene Mentions

…the dysregulation ofZNFX1, which shares…

…DICER1 but notZNFX1mRNA ( Figure…

…DICER1 (but notZNFX1) expression in…

Show Full Abstract

The determination of long non-coding RNA (lncRNA) function is a major challenge in RNA biology with applications to basic, translational, and medical research. We developed BigHorn to computationally infer lncRNA-DNA interactions that mediate transcription and chromatin-remodeling factor activity. Its accurate inference enabled the identification of lncRNAs that coordinately regulate both the transcriptional and post-transcriptional processing of their targets. These lncRNAs may act as molecular chaperones, regulating the stability and translation of mRNAs they helped transcribe, leading to tightly coupled expression profiles. Our analysis suggests that lncRNAs regulate cancer genes across tumor contexts, thus propagating the effects of non-coding alterations to effectively dysregulate cancer programs. As a proof of principle, we studied the regulation of DICER1, a cancer gene that plays a key role in microRNA biogenesis, by the lncRNA ZFAS1. We showed that ZFAS1 helps activate DICER1 transcription and block its mRNA degradation to phenomimic DICER1 and regulate its target microRNAs.

DCC
Also flagged:Colorectal cancercancerdeathagingbehavioralsenescence
Journal Article 2025-07-07 ✓ 2 Snippets Jung SY, Pellegrini M, Tan X, Yu H.
In-Text Gene Mentions

…from age) andDCC(decelerated age, i.e.,…

…did those withDCC.…

Show Full Abstract

<h4>Background</h4>Epigenetic clocks, estimated via DNA methylation (DNAm), reflect individuals' biological aging in multiple tissues and are associated with age-related diseases, but their functional role in colorectal cancer (CRC), an age-associated disease, remains unconclusive. DNAm in tumor tissues exclusively exhibits cancerization with expansion of a stem cell pool, leading to the lowest DNAm age; this raises a question about its cancer predictability. Thus, the DNAm aging marker in pre-diagnostic peripheral blood leukocytes (PBLs) may provide key information on CRC etiology and prevention. We aim to examine pre-diagnostic epigenetic makers for aging in PBLs in association with CRC development and risk modification by lifestyles.<h4>Methods</h4>Using data from a large cohort study of white postmenopausal women, we examined biological aging status in PBLs via three well-established epigenetic clocks-Horvath's, Hannum's and Levine's-and prospectively evaluated CRC development in relation to the aging markers and risk modification by lifestyle factors.<h4>Results</h4>The epigenetic clocks strongly correlated with chronological age, and older DNAm age and age acceleration were significantly associated with increased risk for CRC. Women with bilateral oophorectomy before natural menopause had substantially higher risk for CRC development when they also had epigenetically accelerated aging phenotypes. Among women who maintained healthy dietary patterns, no apparently higher risk was found in those with accelerated aging compared with those with decelerated aging.<h4>Conclusions</h4>Our findings contribute to better understanding of the role of a pre-diagnostic epigenetic aging biomarker and its interplay with lifestyles in CRC carcinogenesis, informing risk stratification strategies for aged individuals.

CACNA1E
Also flagged:Histone Deacetylase 5substance use disorderscocaineHDAC5sucrosesynapse-associated
Journal Article 2025-07-07 ✓ 2 Snippets Barry SM, Huebschman JL, Devries DM, McCue LM, Tsvetkov E, Akiki RM, Limbaker C, Anderson EM, Wood DJ, Siemsen BM, Berto S, Scofield MD, Taniguchi M, Penrod RD, Cowan CW.
In-Text Gene Mentions

…voltage-gated calcium channelCacna1e.…

…use disorder, andCacna1e, a voltage-gated…

Show Full Abstract

<h4>Background</h4>Repeated cocaine use produces neuroadaptations that support drug craving and relapse in substance use disorders (SUDs). Powerful associations formed with drug use environments can promote a return to active drug use in patients with SUD, but the molecular mechanisms that control the formation of these prepotent drug-context associations remain unclear.<h4>Methods</h4>In an animal model of intravenous cocaine self-administration (SA), we used male Sprague Dawley rats to examine the role of histone deacetylase 5 (HDAC5) in the prelimbic cortex (PrL) and infralimbic cortex in context-associated drug seeking. To this end, we employed viral molecular tools, chemogenetics, RNA sequencing, electrophysiology, and immunohistochemistry.<h4>Results</h4>In the PrL, reduction of endogenous HDAC5 augmented context-associated but not cue- or drug prime-reinstated cocaine seeking, whereas overexpression of HDAC5 in the PrL, but not in the infralimbic cortex, reduced context-associated cocaine seeking but had no effects on sucrose seeking. In contrast, PrL HDAC5 overexpression following acquisition had no effects on future cocaine seeking. We found that HDAC5 and cocaine SA altered expression of numerous PrL genes, including many synapse-associated genes. HDAC5 significantly increased inhibitory synaptic transmission onto PrL deep-layer pyramidal neurons and reduced the induction of FOS-positive neurons in the cocaine SA environment.<h4>Conclusions</h4>Our findings reveal an essential and selective role for PrL HDAC5 to limit associations formed in cocaine, but not sucrose, SA environments, and that PrL HDAC5 alters the PrL excitatory/inhibitory balance, possibly through epigenetic regulation of synaptic genes. These results further position HDAC5 as a key factor regulating reward-circuit neuroadaptations that underlie common relapse triggers in SUDs.

DCC
Also flagged:benign prostatic hyperplasiaprogesterone receptorRBMS1bindingcell cycledeath
Journal Article 2025-07-07 ✓ 1 Snippet Siqueira MHB.
In-Text Gene Mentions

…lutathione synthesis), UNC13A,DCC, BTBD3 (dendritic organizatio…

Show Full Abstract

No abstract available.

Also flagged:hexagonal boron nitridesbone remodelingnanomaterialscalciumbarium titanateminerals
Journal Article 2025-07-07 No Snippets Adiguzel S, Cicek N, Cobandede Z, Misirlioglu FB, Yilmaz H, Culha M.
Show Full Abstract

Bone tissue, also known as bone, is a hard and specialized connective tissue consisting of various bone cells. Internally, it has a honeycomb-like matrix providing rigidity to the bone and a piezoelectric feature contributing to bone remodeling. Bone remodeling is a crucial process involving osteoblastic replacement and resorption by osteoclastic cells to maintain structural integrity and mechanical properties of the bone tissue as it grows. However, in cases of fracture or degeneration, the natural self-regeneration process or inherent piezoelectricity of the body may not be sufficient to repair the damage. To address this, the use of piezoelectric nanomaterials (NMs) in bone tissue engineering was investigated. In this study, the influence of the piezoelectric hexagonal boron nitrides (hBNs) and barium titanate (BaTiO<sub>3</sub>) on human osteoblasts (HOb) was comparatively evaluated. The synthesized hBNs and purchased BaTiO<sub>3</sub> were used after their full characterization by imaging and spectroscopic techniques. The piezoelectric behavior of both NMs was evaluated using piezoresponse force microscopy (PRFM). During in vitro studies, the piezoelectricity of the NMs was stimulated with ultrasound (US) exposure. The results showed that the NMs are not cytotoxic at the concentrations tested and the migration ability and calcium deposit formation of the cells treated with the NMs and upon US exposure were significantly increased. These results demonstrate that the hBNs have the potential to accelerate bone tissue regeneration and promote bone healing. These findings offer a promising avenue for developing new therapies for bone-related injuries and conditions requiring significant bone remodeling.

Also flagged:Dentin hypersensitivitytheobromine3, 7 dimethylxanthinealkaloidfluoridehydroxyapatite
Journal Article 2025-07-07 No Snippets Mohammad MS, Jehad RH.
Show Full Abstract

<h4>Background</h4>Obstructing dentinal tubules is a valuable approach for managing dentin hypersensitivity. Although various agents promote dentin remineralization, direct comparisons between theobromine, bioactive glass (BAG), and nano-hydroxyapatite (Nano-HAP) under simulated oral conditions remain limited. To fill this gap, this in vitro study aimed to evaluate and compare the effectiveness of these three treatments on exposed cervical dentin. The assessment focused on their chemical, morphological, and mechanical effects on dentin.<h4>Materials and methods</h4>Forty-eight human dentin slabs were obtained from the cervical portions of twelve sound premolar teeth. Baseline Raman spectroscopy and VMH tests were done to exclude outliers. All specimens were treated with 6 % citric acid (pH 2.0) for 2 min to remove the smear layer. They randomly assigned to four groups (n = 12): artificial saliva (AS), theobromine, BAG, and Nano-HAP. Evaluations were conducted using Raman spectroscopy (phosphate peak intensity at 960cm<sup>-1</sup>), Vickers microhardness testing (VMH), and morphological assessment under scanning electron microscopy (SEM).<h4>Results</h4>Theobromine, BAG, and nano-HAP groups demonstrated a statistically significant increase in Raman phosphate peak intensity (960cm<sup>-1</sup>) and Vickers microhardness values (p < 0.05), indicating surface remineralization. In contrast, the artificial saliva group exhibited a significant decrease in phosphate peak intensity and microhardness values (p < 0.05).<h4>Conclusion</h4>All tested agents significantly enhanced the Raman phosphate peaks and microhardness values compared to the control. Nano-HAP showed the highest potential for promoting the remineralization of exposed dentin surfaces. Within the study's limitations, it can be concluded that theobromine, BAG, and nano-HAP are effective in occluding dentinal tubules.

HFE
Also flagged:LIFRBMP4leukemia inhibitory factorLIFGP130ALK
Journal Article 2025-07-07 ✓ 1 Snippet Li Y, Wang H, Li Z, Wang H, Gao Y, Wu C, Wei B, Guo Z, Wang X, Jing G, Wang S.
In-Text Gene Mentions

…levels of TFR2,HFEand NEO1 were…

Show Full Abstract

In the cultivation of mouse embryonic stem cells (mESCs), leukemia inhibitory factor (LIF) and mitotically inactive mouse embryonic fibroblasts (MEFs) are usually used to maintain the self-renewal and pluripotency of mESCs. However, the high cost of LIF and the immunogenicity of MEFs limit their clinical application in stable culture and large-scale expansion of mESCs. Therefore, it is necessary to pursue a low-cost, convenient, and safe alternative. This study found that Fe-doped metal organic framework nanoparticles (Fe MOF) have good biocompatibility under long-term cultivation and could maintain the self-renewal of mESCs in the absence of LIF and MEFs, without destroying the potential of mESCs to differentiate into three germ layer cells. Through transcriptome sequencing, it was demonstrated that Fe MOF nanomaterials could not only upregulate the expression of LIFR/GP130, but more importantly, they could activate the Fe<sup>3+</sup> mediated BMP4/ALK/SMAD signaling pathway. The experimental results indicate that Fe MOF nanomaterials could effectively maintain the self-renewal and pluripotency of mESCs. This study demonstrates that Fe MOF could not only replace the LIF factor, but also has a stronger ability to promote the self-renewal of mESCs owe to its multi-signal pathway regulation function, providing application prospects in the in vitro cultivation of mESCs.

SHISA6
Also flagged:middle cerebral artery occlusionStrokedeathneurological diseasesIschemic strokeIS
Journal Article 2025-07-07 ✓ 1 Snippet Li M, Wang L, An H, Li X, Chen Y, Wei D, Zhang Z.
In-Text Gene Mentions

…GRIA1 and CNIH2,SHISA6, which are the…

Show Full Abstract

Stroke, which leads to death and disability in high proportions globally, is one of the most deleterious neurological diseases. Ischemic stroke (IS) is the major cause of disease attack and accounts for ~70% of all incident stroke cases in China. Up to now, only two therapies for IS were officially approved, which are intravenous administration of recombinant tissue-plasminogen activator (rt-PA) and endovascular mechanical thrombectomy to rapidly recanalize the occluded artery, which both recanalize the occluded artery rapidly to reduce disability, but are limited in a fixed time window. In this study, the therapeutic effect of a traditional Chinese medicine, DengZhanXiXin injection (DZXI), was evaluated on middle cerebral artery occlusion (MCAO) rats at the neurobehavioral and pathophysiological levels through neurological tests, neurohistological staining, proteomic assay, and biological information analysis. We found that DZXI significantly ameliorated the neurological deficit, prevented infarct volume evolution, and protected cortical neural cells from death in ischemia penumbra on MCAO rats. Furthermore, corresponding therapeutic molecular targets were investigated through proteomic analysis of ischemic hemispheres of MCAO rats. One hundred ninety-one differentially expressed proteins involved in response to metal ions, neurofilament bundle assembly, and modulation of chemical synaptic transmission were identified between the MCAO model and DZXI groups after 7 days. DZXI influenced the expression levels of proteins in 13 specific biological functions, with cell signaling and chemical synaptic transmission-associated proteins being most affected. Subsequent molecular docking analysis predicted binding potential between key target proteins and DZXI compounds. The results suggested that DZXI ameliorates neurological deficits by potentially affecting cellular signaling and chemical synaptic transmission physiological processes.

TNFSF4
Also flagged:tumorGene Expressionmethylationesophageal cancermethyladenosinemethyltransferase
Journal Article 2025-07-07 ✓ 1 Snippet Song P, Ye J, Zhang H, Li Y, Cao R, Feng Y, Zhang L, Sun M.
In-Text Gene Mentions

…CD200, NRP1, TNFSF15,TNFSF4, CD40, TNFRSF14, LGALS9,…

Show Full Abstract

<h4>Background</h4>Esophageal cancer (EC) remains a significant clinical challenge, characterized by its aggressive nature and poor prognosis. Current therapeutic strategies, including targeted therapies, have limitations due to the complex interplay between tumor heterogeneity and the tumor microenvironment (TME). However, the specific contributions of N6-methyladenosine (m<sup>6</sup>A) methylation to the TME in EC are yet to be fully elucidated.<h4>Methods</h4>Through comprehensive bioinformatics analyses, a detailed examination of m<sup>6</sup>A regulators were conducted in EC using datasets from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO). Single-cell RNA sequencing (scRNA-seq) and a consensus clustering algorithm was employed to classify m<sup>6</sup>A modification patterns and analyze their relationships with immune cell infiltration and clinical outcomes. Additionally, an m<sup>6</sup>A scoring system was developed based on principal component analysis to assess the prognostic value of identified m<sup>6</sup>A modification patterns.<h4>Results</h4>The findings revealed two distinct m<sup>6</sup>A modification clusters associated with divergent TME characteristics and immune infiltration profiles. Patients exhibiting the immune-inflamed phenotype (m<sup>6</sup>A cluster B) demonstrated significantly improved survival compared to those with the immune-excluded phenotype (m<sup>6</sup>A cluster A). Notably, m<sup>6</sup>A scores correlated positively with immune cell presence and related with adverse prognostic outcomes, indicating their potential as predictive biomarkers for immunotherapy responses. A low m<sup>6</sup>A score indicated a better response to immunotherapy.<h4>Conclusion</h4>This study highlights the critical role of m<sup>6</sup>A methylation in shaping the TME and influencing immune dynamics in EC. The m<sup>6</sup>A score developed herein provides a novel quantitative tool for predicting tumor behavior and treatment efficacy, paving the way for more personalized immunotherapeutic strategies in clinical practice. This scoring system illustrates a strong correlation of EC with TME immune cell composition, suggesting potential as a biomarker for targeted therapeutic strategies for EC.

SUDS3
Also flagged:16S rDNAV-setCOVID-19 infectionsmetabolismphosphatidylinositolmembrane
Journal Article 2025-07-07 ✓ 1 Snippet Xu H, Li H, Xu J, Chen Y, Deng L, Chen X, Xu Y.
In-Text Gene Mentions

…are classified aslinker histoneshistones, playing a…

Show Full Abstract

<h4>Objective</h4>Most research reports on COVID-19 infections have focused on the correlation between the severity of the disease symptoms and immune deficits, while the mechanisms affecting the susceptibility to SARS-CoV-2 remain largely unknown. The study aimed to comprehensively analyze the differences in immunity, gut microbiota, metabolism, and proteomics between the SARS-CoV-2 resistant population and the susceptible population.<h4>Methods and results</h4>In this cohort comparison study, participants were rigorously selected based on inclusion and exclusion criteria in a continuous enrollment manner using combined questionnaires and clinical data, ultimately including 25 SARS-CoV-2 resistant volunteers versus 16 SARS-CoV-2 infected patients. The clinical information of the participants was recorded in detail, and fecal and blood samples were collected in a standardized manner for subsequent multi-omics analysis, including gut microbiota sequencing, metabolomics, and proteomics. This study has preliminarily elucidated the characteristics of the gut microbiota, serum metabolites, and serum proteins in the SARS-CoV-2 resistant population. It exhibits a unique metabolic signature characterized by elevated levels of serum phosphatidylinositol and the abundance of Prevotella, which may serve as a potential predictive biomarker for resistance to SARS-CoV-2.<h4>Conclusion</h4>Given the crucial role of phosphatidylinositol in cell membrane architecture and viral infectivity, this study provides a promising entry point for further research into the pathogenesis and prevention strategies of COVID-19.

HTT
Also flagged:chaperoninTCP-1chaperonin-containing TCP-1CCTCCT1CCT8
Journal Article 2025-07-07 ✓ 5 Snippets Varte V, Rincon-Limas DE.
In-Text Gene Mentions

…HeLa cells expressingHtt-exon1 (Q78)-GFP increased the…

…to decrease expandedHttaggregation and extend…

…physically with theHttExon 1 and…

…CCT2 interacts withHttfragments and with…

…for instance, promotesHttaggregation and toxicity,…

Show Full Abstract

The chaperonin TCP-1 ring complex (TRiC), also known as chaperonin-containing TCP-1 (CCT) complex, plays a crucial role in protein folding and quality control within the cell. Comprising eight distinct subunits (CCT1 - CCT8), TRiC assists in the folding of a wide range of client proteins, ensuring their proper conformation and functionality. This mini review explores the assembly, structure, and cellular functions of TRiC and discusses its involvement in protein aggregation and neurodegenerative diseases. We emphasize the emerging role of CCT2 in modulating the formation of abnormal amyloid aggregates, including amyloid beta, tau, and polyglutamine (polyQ) deposits, which are central to the pathogenesis of various neurological conditions. Lastly, we provide evidence supporting the neuroprotective role of CCT2 <i>in vivo</i> and also highlight therapeutic implications and key unresolved questions in the field, offering a foundation for new research opportunities.

DNAJC1
Also flagged:Nrf1transcription factorsNrf2redox homeostasismetabolismCNC-bZIP transcription factor
Journal Article 2025-07-07 ✓ 1 Snippet Zhang Y, Chen X, Wang M, Zhu Y, Shi W, Li C, Zhang Z, Taniguchi H, Ao P.
In-Text Gene Mentions

…HSPA4, HSPA8, HSPA9,DNAJC1, DNAJA2 ), the…

Show Full Abstract

Differential and even opposing functions of two major antioxidant transcription factors Nrf1 and Nrf2 (encoded by <i>Nfe2l1</i> and <i>Nfe2l2</i>, respectively) are determined by distinctions in their tempospatial positioning, topological repartitioning, proteolytic processing, and biochemical modification, as well as in their shared evolutionary origin. As a matter of fact, the allelopathic potentials of Nrf1 and Nrf2 (both resembling two entangled 'Yin-Yang' quanta that comply with a dialectic law of the unity of opposites) are fulfilled to coordinately control redox physiological homeostasis so as to be maintained within the presetting thresholds. By putative exponential curves of redox stress and intrinsic anti-redox capability, there is inferable to exist a set point at approaching zero with the 'Golden Mean' for the healthy survival (i.e., dubbed the 'zero theory'). A bulk of the hitherto accumulating evidence demonstrates that the set point of redox homeostasis is dictated selectively by multi-hierarchical threshold settings, in which the living fossil-like Nrf1 acts as a robust indispensable determinon, whereas Nrf2 serves as a versatile chameleon-like master regulon, in governing the redox homeodynamic ranges. This is attributable to the facts that Nrf2 has exerted certain 'double-edged sword' effects on life process, whereas Nrf1 executes its essential physiobiological functions, along with unique pathophysiological phenotypes, by integrating its 'three-in-one' roles elicited as a specific triplet of direct sensor, transducer and effector within multi-hierarchical stress responsive signaling to redox metabolism and target gene reprogramming. Here, we also critically reviewed redox regulation of physio-pathological functions from the eco-evo-devo perspectives, through those coding rules (redox code, stress-coping code, and topogenetic code). The evolving concepts on stress and redox stress were also further revisited by scientific principles of physics and chemistry. Besides, several novel concepts such as oncoprotists, Reverse Central Dogma, and Grand Redox-Unifying Theory' (GRUT) of life, together with diffusive reactive species (DRS)-based murburn concept integrating all stochastic electron-, proton- and/or moiety-transfer reactive and interactive processes (e.g., PCHEMS), are introduced in this interdisciplinary and synthetic review.

Also flagged:OsteoporosismineralageingCOL1A1COL1A2osteogenesis
Journal Article 2025-07-07 No Snippets Zurel F, Bux H, Diveli A, Rashid Z.
Show Full Abstract

Osteoporosis is a chronic skeletal disorder marked by reduced bone mineral density (BMD) and increased fracture risk, posing a substantial global health burden. Traditionally considered multifactorial, growing evidence highlights a significant genetic contribution across both early-onset monogenic and adult-onset polygenic forms. Understanding the molecular and genetic architecture of osteoporosis is crucial for guiding targeted diagnostics and developing personalised therapeutic strategies. This review aimed to: (1) identify and summarise genetic mutations and polymorphisms associated with osteoporosis, classifying them into monogenic and multifactorial causes; (2) distinguish between syndromic and non-syndromic forms of genetically influenced osteoporosis; (3) evaluate how specific genetic variations influence the risk, onset, and severity of osteoporosis, particularly in postmenopausal populations; (4) examine current anti-resorptive and anabolic treatments in the context of genetic backgrounds; and (5) identify gaps in knowledge to guide future research into genetics-based screening and individualised treatment. A comprehensive literature search was conducted across PubMed, Embase, CINAHL, and the Cochrane Library for studies published between 2000 and 2025. Medical Subject Headings (MeSH) and free-text keywords were used to retrieve peer-reviewed articles, clinical trials, genetic association studies, and systematic reviews. Eligible studies explored genetic variants, bone signalling pathways (e.g., WNT/β-catenin, Notch), or pharmacological therapies in relation to BMD, fracture incidence, or osteogenesis. Data were extracted and thematically analysed under the following three core domains: genetic and molecular mechanisms, osteogenesis and bone remodelling, and treatment responses linked to genetic profiles. The review identified a wide spectrum of genetic contributors to osteoporosis. Monogenic forms, often syndromic, were linked to mutations in genes such as <i>COL1A1</i>, <i>COL1A2</i>, and <i>WNT1</i>, whereas multifactorial osteoporosis, particularly postmenopausal, was associated with variants in <i>LRP5</i>, <i>SOST</i>, <i>VDR</i>, and other GWAS-identified loci. The interplay between these variants and osteogenic signalling cascades was found to influence bone homeostasis. Treatments were categorised as anti-resorptive (e.g., bisphosphonates, denosumab) or anabolic (e.g., parathyroid hormone analogues, romosozumab), with genetic factors influencing efficacy. The evidence suggests a future need for personalised therapeutic strategies based on genetic profiling. There remains a need for further large-scale studies to validate genotype-phenotype correlations and treatment responses across diverse populations. Further exploration into pharmacogenomics, microRNA regulation, and gene-targeted interventions is required. Advancing osteoporosis care will depend on integrating genetic insights into clinical practice to enable earlier diagnosis, individualised treatment, and improved patient outcomes.

Also flagged:leiomyomaBenign metastasizing leiomyomauterine leiomyomasleiomyomasuterine fibroidsprogesterone receptor
Journal Article 2025-07-07 No Snippets Vu HTT, Bui HTS, Nguyen HQ, Huynh HP, Vo DT, Nguyen DH, Tran TN, Le MHN.
Show Full Abstract

Benign metastasizing leiomyoma (BML) is a rare disorder occurring in women with a history of uterine leiomyomas and having detection of leiomyomas in extrauterine locations. This case report describes a 39-year-old female with a six-month history of fatigue and worsening exertional dyspnea. She had undergone a previous myomectomy due to multiple uterine fibroids. A transthoracic echocardiogram revealed a large mass involving the right atrium and the inferior vena cava. Chest and abdominal computed tomography scans demonstrated the presence of this mass in the right hepatic vein, along with a nodule in the right lobe of the liver and multiple uterine fibroids. She underwent surgery to remove the cardiovascular mass, and histopathological results confirmed the benign nature of the smooth muscle cells. Immunohistochemical staining was positive for actin, progesterone receptor, desmin, and Ki67, consistent with a diagnosis of BML. Subsequently, she underwent hysterectomy and bilateral salpingo-oophorectomy, revealing a benign leiomyoma and endometriosis. This case emphasizes the importance of imaging in accurately diagnosing and preoperatively evaluating cardiac mass.<h4>Learning objective</h4>Benign metastasizing leiomyoma should be considered in patients presenting with an atypical cardiac mass and a history of uterine leiomyoma, myomectomy, or hysterectomy. Multiple imaging modalities are crucial for diagnosis, preoperative evaluation, and surgical treatment guidance.

Also flagged:Cas9tumorsinfectionstumorviral infectionclustered regularly short
Journal Article 2025-07-07 No Snippets Lang S, Lin X, Wang S, Sun W, Yang Y, Yang C, Bao Z, Feng W, Wang Y, Luo Y.
Show Full Abstract

Pathogenic xenobiotics are ubiquitous in the environment. Environmental carcinogens induce mutations leading to tumors; pathogens relying on environmental media transmission cause infections; exposure to chemical or biological pollutants triggers toxicant poisoning. The mechanisms of xenobiotics work by abnormal expression of genes. Since their inception, genome-wide CRISPR/Cas9 knockout libraries have been rapidly applied <i>in vitro</i> to dissect the mechanism of diseases. Genome-wide screening of CRISPR/Cas9 knockout libraries has helped to identify genes essential for tumor survival, combinations of genes for synthetic lethal effects, and genes associated with drug resistance or susceptibility. In addition, key host factors and complex toxicological mechanisms of viral infection have been elucidated, contributing to the development of antidotes and the reduction of the incidence of adverse effects. CRISPR/Cas9 library screening can be combined with single-cell sequencing and organoid technologies to identify novel gene interactions and more reliable preclinical data. Future trends in such screening aim to identify more potential molecular targets for more exogenous pathogenic factors, combine screening with other emerging technologies to expand its use in <i>in vitro</i> models, and develop more accurate, accessible, and cost-effective genome editing tools.

Also flagged:cancerzincurological tumorsprostate cancercalcium saltsatherosclerosis
Journal Article 2025-07-07 No Snippets Gosling SB, Arnold EL, Adams L, Cool P, Geraki K, Kitchen MO, Lyburn ID, Rogers KD, Snow T, Stone N, Greenwood CE.
Show Full Abstract

Calcifications across the body offer snapshots of the surrounding ionic environment at the time of their formation. Links between prostate calcification chemistry and cancer are becoming of increasing interest, particularly in identifying biomarkers for disease. This study utilizes X-ray fluorescence mapping of 72 human prostate calcifications, measured at the I18 beamline at the Diamond Light Source, to determine the links between calcifications and their environment. This paper offers the first investigation of the elemental heterogeneity of prostate calcifications, demonstrating lower relative levels of minor elements at the calcification center compared to the edge but higher levels of zinc. Importantly, this study uniquely presents links between average Fe, Cr, Mn, Cu, and Ni ratios and grade Group (a classification system for urological tumors, specifically for prostate cancer), highlighting a potential avenue of exploration for biomarkers in prostate calcifications.

Also flagged:depressionrheumatoid arthritisRAchronic autoimmune diseasetranslationsarthritis
Journal Article 2025-07-07 No Snippets Tran HTT, Hoang LB, Van Nguyen H, Van Nguyen T, Le HTT, Nguyen YH, Nguyen HT, Doan HT, Ngo KT, Le TC, Vu CT, Lai DT, Vu TS, Nguyen LT, Pham NTN, Duong TM.
Show Full Abstract

This study aimed to validate the Vietnamese version of the Montgomery-Asberg Depression Rating Scale (MADRS) in patients with rheumatoid arthritis (RA). A cross-sectional study was conducted on RA patients, with depression severity assessed using both MADRS and the Patient Health Questionnaire-9 (PHQ-9). Internal consistency was evaluated using Cronbach's alpha, and the correlation between MADRS and PHQ-9 was measured using Spearman's correlation. Face validity was established through a back-translation process to ensure language equivalence. The translated version underwent exploratory and confirmatory factor analysis to evaluate its construct validity. The Vietnamese MADRS demonstrated excellent internal consistency (Cronbach's alpha = 0.93) and a strong linear correlation with PHQ-9 (Spearman's r = 0.88). Exploratory factor analysis identified a two-factor structure, categorizing depressive symptoms into general and severe clusters, which was confirmed in confirmatory factor analysis with borderline goodness of fit. Despite limitations such as sample specificity and the absence of a gold standard diagnostic tool, the study suggests that the Vietnamese MADRS can be effectively used in clinical and research settings in Vietnam for assessing depression in RA patients.

medRxiv 2025-07-07 Preprint (No Snippets API) Wang X, Wang Y, Hu W, Zhang Y, Zhang X, Lu C, Hu J, Yan Z, Liu X, Duan H, Mou Y, Jiang T, Briggs M, Price S, Li C.
Show Full Abstract

Accurate integration of histological and molecular features is central to modern cancer diagnostics, but it is often hampered by resource-intensive parallel workflows, limited tissues, and increased diagnostic complexity. We present CAMPaS (Cross-modal AI for Integrated Molecular Pathology Diagnosis and Stratification), a clinical AI prototype that addresses challenges in real-world translation of jointly predicting glioma histology, molecular markers, and WHO 2021 integrative diagnoses from hematoxylin and eosin-stained slides. Trained and validated on 3,367 patients (6,043 slides) across eight cohorts (six retrospective, two prospective), CAMPaS achieved high diagnostic performance (AUC 0.895-0.916 in training; 0.946-0.955 in prospective cohorts) and generalized robustly across diverse settings. Its interpretable cross-modal predictions aligned with histopathological annotations and genomic profiles, revealing biologically coherent features. CAMPaS identified histological features for molecular markers, and its clinical utility was validated for enhancing real-world clinical diagnostics. Crucially, CAMPaS stratifies prognosis and treatment response, offering a scalable and biologically grounded solution to accelerate precision oncology.

bioRxiv 2025-07-07 Preprint (No Snippets API) Bortot M, Vallortigara G.
Show Full Abstract

The ability to extract regularities from the sensory input is important for adaptation to a complex environment and to support behavioral flexibility. Honeybees have sophisticated cognitive and learning capacities, including categorization of stimuli on the basis of perceptual (e.g., symmetry) and abstract (e.g., sameness/difference) concepts. Here we investigated whether bees could extrapolate the temporal regularity of a sequence. By exploiting the olfactory conditioning of the proboscis extension response (PER), we investigated whether honeybees could learn and generalize a particular sequence structure composed of different odors presented in a specific temporal order. Different conditioning paradigms (i.e., absolute, differential, generalization) were employed. Bees used different strategies, such as an early tendency to encode the single odor properties, instead of learning the entire sequence pattern. The use of a generalization paradigm potentially uncovered a spontaneous tendency to transfer over similar structures one hour after the training irrespective of the single-element properties, though this finding is not yet conclusive. These results shed light on the strategies used by bees to solve an odor abstraction task, highlighting the crucial role of the type of conditioning to let them emerge.

FBXL4
Also flagged:mitophagymitochondrialiver failureacute liver failureubiquitinating enzymeArih1
Journal Article 2025-07-06 ✓ 1 Snippet Luo S, Wu F, Yang X.
In-Text Gene Mentions

…pathogenic mutations inFBXL4exhibit defective degradation…

Show Full Abstract

<h4>Background and purpose</h4>Mitochondrial autophagy, also referred to as mitophagy, clears damaged mitochondria and has dual functions in disease development and liver homeostasis in response to liver pathologies. Mesenchymal stem/stromal cells (MSCs) are most commonly used to treat liver failure because they are easy to obtain and present no ethical problems. However, the molecular mechanisms by which MSCs promote liver failure progression are not fully understood. This study explored the distinct mitophagy states in hepatocytes and macrophages during MSCs therapy.<h4>Experimental approach</h4>To investigate tissue-specific mitophagy in acute liver failure (ALF), we generated a single-cell transcriptome (scRNA-seq) atlas of liver tissue from healthy mice, ALF mice and human umbilical cord mesenchymal stem/stromal cell (hUC-MSC)-transplanted mice.<h4>Key results</h4>The data revealed the complex cellular landscape of liver tissue during ALF progression, revealing alterations in metabolic fluxes and mitophagy activation. Through the intersection of single-cell sequencing data with mitophagy-related genes (MRGs), a total of 24 differentially expressed MRGs were identified. Gene Ontology (GO) analysis further revealed that the ubiquitinating enzyme Arih1 was significantly upregulated after MSC transplantation, whereas the mitophagy genes Bnip3L/NIX and Beciln1 were significantly downregulated in mononuclear phagocytes(MPs).<h4>Conclusions and implications</h4>Our research demonstrated that during the development of ALF, mitophagy within hepatocytes is suppressed, whereas in MPs, mitophagy is excessively activated. MSCs are capable of alleviating disease progression by modulating the distinct mitophagy states of cells, providing an important resource for investigating mitophagy regulation in hepatic homeostasis and disease development.

PTGIS
Also flagged:Annexin-A1Cardiovascular diseaseANXA1tissue homeostasisangiotensin IImitochondrial
Journal Article 2025-07-06 ✓ 1 Snippet Singh J, Jackson KL, Fang H, Tang FS, Gueguen C, Parker AM, Chen H, Nowell CJ, Kiriazis H, Salimova E, Woodman OL, Ritchie RH, Head GA, Greening DW, Qin CX.
In-Text Gene Mentions

…mice respectively, andPtgisand Cd47 in…

Show Full Abstract

Cardiovascular disease exhibits distinct sex-based differences, yet the mechanisms underlying these differences remain under-explored. The pro-resolving mediator annexin-A1 (ANXA1) is a pivotal regulator in inflammation resolution and tissue homeostasis, including within the cardiovascular system. However, the sex-specific differences in ANXA1 in blood pressure regulation have not been investigated. Here, we demonstrate that deficiency of ANXA1 exacerbates angiotensin II-induced adverse aortic and cardiac structural remodeling, mitochondrial proteome dysregulation, and impaired mitochondrial function in preclinical hypertensive models, exacerbated in females. Mechanistically, we demonstrate that estrogen upregulates ANXA1 levels, associated with dysregulation of inflammatory and mitochondrial networks, suggesting that the estrogen-ANXA1 axis plays a critical role in modulating inflammation and preventing pathological remodeling. In conclusion, this study advances the understanding of female-specific cardiac and aortic tissue and cellular alterations in hypertension, providing a platform for developing therapeutic ANXA1 mimetics that address the unique pathophysiological features of hypertension in females.

CCPG1
Also flagged:endoplasmic reticulumautophagyPeriodontitischronic inflammatory diseasemembranesER-phagy
Journal Article 2025-07-06 ✓ 1 Snippet Wang R, Hu J, Sun Q, Guo S, Zhang G, Lu A, Liu S, Yang X, Wang L.
In-Text Gene Mentions

…CD22, ATG3, PSMA4,CCPG1, KLRB1, CALR, CANX,…

Show Full Abstract

Periodontitis is a chronic inflammatory disease that mainly occurs in the dental supporting tissues. Endoplasmic reticulum autophagy (ER-phagy) is a new type of selective autophagy. The main function of ER-phagy is to degrade excess ER membranes or toxic protein aggregates, control the volume of ER, and maintain cell homeostasis. This study utilized bioinformatics to identify and validate potential ER-phagy-related biomarkers for periodontitis. The relationship between immune cell infiltration and periodontitis as well as potential biomarkers was analyzed, to identify new targets for the diagnosis and treatment of periodontitis. Data from GeneCards and Gene Expression Omnibus (GEO) databases were utilized to identify differentially-expressed ER-phagy-related genes, and to conduct functional enrichment and pathway analyses. Random forest, least absolute shrinkage and selection operator (LASSO) and support vector machine-recursive feature removal (SVM-RFE) algorithms were used to identify hub genes. Receiver operating characteristic (ROC) curves and areas under the curve (AUCs) were calculated to assess diagnostic performance and identify potential biomarkers for periodontitis. The CIBERSORT deconvolution algorithm was used to study the link between potential biomarkers and distinct types of immune cells. In addition, clinical samples were examined using Real-time quantitative polymerase chain reaction (RT-qPCR) to verify the expression of genes related to ER-phagy in periodontitis and identify a signature which may better predict this disease. Bioinformatics analysis identified 88 differentially-expressed ER-phagy-related genes (DE-ERGs). 6 hub genes were found using LASSO, SVM-RFE and Random forest, namely ATP1A1, CD69, DNAJB11, GANAB, IL7, and PSME2. ATP1A1 and GANAB exhibited robust diagnostic efficacy in both the training set and validation set. The results of immune cell infiltration analysis revealed a significantly greater abundance of plasma cells in periodontitis tissue samples compared to healthy periodontal tissue samples (P < 0.05). Correlation analysis between potential biomarkers and immune cells demonstrated that the expression levels of ATP1A1 and GANAB were correlated with plasma cells and resting dendritic cells. Clinical samples examined by RT-qPCR verified that these ER-phagy-related signature genes in periodontitis may better predict the development of periodontitis.ER-phagy is closely related to the pathological process of periodontitis. The infiltration of immune cells differs between tissues affected by periodontitis and healthy periodontal tissues, and a variety of immune cell subsets are significantly correlated with ATP1A1 and GANAB, thus ATP1A1 and GANAB have good diagnostic efficiency for periodontitis and can be used as potential biomarkers for early diagnosis.

POU3F2
Also flagged:Merkel Cell Carcinomametastatic diseaseBonemetastatic bone diseaseimmunosuppressionplatinum
Journal Article 2025-07-06 ✓ 1 Snippet Scotti B, Broseghini E, Ricci C, Corti B, Viola C, Misciali C, Baraldi C, Vaccari S, Lambertini M, Venturi F, Magnaterra E, Alessandrini A, Ferrari T, Lepri M, Argenziano G, Melotti B, Campione E, Campana D, Ferracin M, Dika E.
In-Text Gene Mentions

…Subunit Alpha PI3KPhosphoinositide 3-Kinase POU3F23-Kinase POU3F2 POU…

Show Full Abstract

<h4>Background/objectives</h4>Despite advancements in early diagnosis and clinical practices guided by standardized care protocols, Merkel cell carcinoma (MCC) is marked by an unfavorable prognosis with a 5-year relative survival rate of 65%, based primarily on data collected prior to the introduction of immunotherapy. Regional nodal metastases affect 40-50% of MCC patients, while approximately 33% experience distant dissemination. Among these, bone and bone marrow metastases are particularly notable, although the characteristics and clinical implications of this metastatic disease in MCC remain poorly understood.<h4>Methods</h4>A comprehensive review was conducted using the Medline database (via PubMed) up to January 2025. The search strategy included the string "(Merkel cell carcinoma AND (bone OR marrow))".<h4>Results</h4>A total of 1133 (69.3% male and 30.7% female) patients diagnosed with advanced MCC were collected. The median (IQR) age at diagnosis was 67.5 (12.65) years old. Overall, 201 (20.8%) cases of bone and/or bone marrow metastases were identified and linked to a primary known MCC in 75.7% of cases. Bone metastases (BMs) appear as the third most common metastatic site, following the liver (second) and lymph nodes (first). They show mixed biological and radiological behavior, with a marked preference for the axial skeleton over the appendicular one. Addressing the characteristics of metastatic bone disease, neurological symptoms were the most documented, whereas bone marrow involvement and leukemic spread seemed to be primarily related to immunosuppression. Multimodal treatment strategies, including platinum-based chemotherapy and radiotherapy, were the primary approaches adopted, reflecting therapeutic practices from the pre-immunotherapy era.<h4>Conclusions</h4>The pattern of metastatic spread in MCC differs among studies, with the bones resulting as the third most common site of distant spread. Excluding head and neck MCC, which seems to be more regularly associated with liver metastases, the relationship between the primary tumor site and the development of bone or bone marrow metastases appears inconsistent. Overall, BMs mostly correlated with advanced MCC stages and poorer survival outcomes, with a median overall survival (OS) of 8 months (range 12.75-4). The integration of international guidelines, evolving evidence from clinical trials, and the expanding role of immune checkpoint inhibitors (ICIs) will contribute to improving systemic disease control and enhance patient care.

DCC
Also flagged:schizophreniaNeuropsychiatric disorderscognitionanxietyinsomniadepression
Journal Article 2025-07-05 ✓ 1 Snippet Federmann LM, Sindermann L, Primus S, Raimondo F, Oexle K, Goltermann J, Winkelmann J, Nöthen MM, Amunts K, Mühleisen TW, Cichon S, Eickhoff SB, Hoffstaedter F, Dannlowski U, Patil KR, Forstner AJ.
In-Text Gene Mentions

…netrin-1 receptor geneDCC, which has…

Show Full Abstract

Neuropsychiatric disorders show shared and distinct neurobiological correlates. A cross-disorder genome-wide association study (GWAS) identified 23 highly pleiotropic single-nucleotide polymorphisms (SNPs) that were associated with at least four neuropsychiatric disorders, and 22 SNPs that were associated predominantly with schizophrenia. Exploring their link to brain-related traits might advance understanding their distinct neurobiological processes. Using the UK Biobank data (n = 28,952), this study examined the association of both a genetic risk score (GRS) for highly pleiotropic SNPs (PleioPsych-GRS), and a GRS for predominantly schizophrenia-associated SNPs (SCZ-GRS) with 154 measures of subcortical volume, cortical thickness, and surface area as well as 12 outcomes related to mental health. To generate further insights at the individual SNP level, the association between SNPs and brain structure was examined using GWAS summary statistics. The PleioPsych-GRS showed no significant association with brain structure after correction for multiple testing. The SCZ-GRS showed a significant association with an increased surface area of the lateral orbitofrontal region, and an increased volume of the putamen, among others. The PleioPsych-GRS and the SCZ-GRS were associated with eight and four outcomes related to mental health, respectively. Two highly pleiotropic and 10 SCZ-associated SNPs were associated with several structural brain phenotypes. Taken together, these findings indicated that GRSs of highly pleiotropic SNPs and predominantly schizophrenia-associated SNPs have partly distinct associations with brain structure and outcomes related to mental health. Thus, investigating schizophrenia-specific and pleiotropic variants may improve our understanding of the neurobiology of neuropsychiatric disorders.

NEGR1
Also flagged:neurodevelopmental disabilitiessinglenucleustranscription factorsribosomecalcium
Journal Article 2025-07-05 ✓ 1 Snippet Ianevski A, Cámara-Quílez M, Wang W, Suganthan R, Hildrestrand G, Grini JV, Døskeland DS, Ye J, Bjørås M.
In-Text Gene Mentions

…Bcl6 modified Bcl11b,Negr1, and Lsamp; and…

Show Full Abstract

Neonatal hypoxic-ischemic (H-I) brain injury, a leading cause of neurodevelopmental disabilities, severely affects the metabolically active and neurogenic hippocampus. To investigate its acute effects and identify drug targets for early therapeutic windows, we applied single-nucleus RNA sequencing on postnatal day 8 (P8) mouse hippocampi under sham, hypoxic, and hypoxic-ischemic conditions. We constructed a comprehensive hippocampal cell atlas and developed a machine-learning classifier for precise cell type identification. Our analysis reveals early vulnerabilities in mature neurons and notable resilience in immature DG, GABAergic, and Cajal-Retzius cells following H-I. Gene regulatory network analysis identified key transcription factors associated with neuronal vulnerability, along with upregulated ribosome biogenesis and dysregulated calcium homeostasis pathways. We observed rapid activation of astrocytes and microglia, with Runx1 identified as a potential key transcription factor associated with early microglia immune responses. Endothelial cells displayed complex transcriptional changes and predicted intercellular signaling patterns that may influence vascular repair and recovery. Our study advances the understanding of immediate cellular and transcriptional responses to neonatal H-I injury, providing new insights into hippocampal cell heterogeneity and pathophysiology. The integrated hippocampal atlas, post-H-I atlas, and machine learning classifier are available at https://hippo-seq.org .

Also flagged:Alpha-synucleinASPDgene expressiontype II interferonlymphocyte activation
Journal Article 2025-07-05 No Snippets Shin C, Ruhno KE, Shin JH, Hwang S, Go JR, Kang M, Kim HJ, Moon JH, Kim HJ.
Show Full Abstract

Alpha-synuclein (AS) accumulation is found in the nerve plexuses of the gastrointestinal tract in patients with Parknison's disease (PD). Moreover, alterations in microbiome composition and its metabolites were confirmed in the colon of patients with PD. However, there has been no study that evaluates transcriptomic alterations of the nerve plexus and intestinal epithelium simultaneously using in vivo tissue of patients with PD. Therefore, we aimed to investigate the gene expression profiles of the myenteric plexus and intestinal epithelium of the colon of patients with PD. Ten full-depth slides of paraffin-embedded surgical specimens of the colon or rectum from five patients with PD and five controls were included. AS accumulation was found in the myenteric plexus in all patients with PD. We performed spatial-specific transcriptomic profiling of the myenteric plexus and epithelium using the GeoMX Digital Spatial Profiler. Forty-one differentially expressed genes (DEGs) (36 up-regulated and 5 down-regulated) were identified in the myenteric plexus of patients with PD compared to controls. In the intestinal epithelium, 240 DEGs (81 up-regulated and 159 down-regulated) were identified. Pathway analysis showed upregulated response to type II interferon and lymphocyte activation, while downregulated cellular response to zinc and copper ions in the intestinal epithelium of patients with PD. In the myenteric plexus, neuroepithelial cell differentiation and axon development were upregulated. Network analysis showed the following key genes: and HLA-DRA, SERPINA1, and metallothioneins in the intestinal epithelium, and LAMP1, TUBB2A, and S100B in the myenteric plexus. This study suggests that inflammatory processes may occur in the intestinal epithelium, while neuronal regeneration mechanisms may be active in the myenteric plexus in patients with overtly developed PD. A spatial transcriptomic analysis of the brain and the gastrointestinal tract will enable a better understanding of the gut-brain axis in PD.

Also flagged:pathogenesisneurodegenerative disordersNeurodegenerative diseasesamyotrophic lateral sclerosisPIWItranslational
Journal Article 2025-07-05 No Snippets Singh A, Subramanian M, Singh A.
Show Full Abstract

Neurodegenerative diseases (neurodegenerative disorders) are marked by the progressive degeneration of the structure and function of the central nervous system. They may result in the deterioration of cognitive, motor, and functional abilities. Diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis represent some of the most prominent examples of neurodegenerative disorders. Despite scientific advancement in understanding disease pathology and prognosis, the therapeutic strategies available for management remain limited. In recent years, microRNAs, small non-coding RNA molecules, have emerged as key players in the pathogenesis of neurodegenerative disorders. Therefore, understanding how these microRNAs affect disease pathology and pathway signaling is essential, and may open microRNAs as new avenues for potential therapeutic intervention. This review explores the role of microRNAs in various neurodegenerative diseases, discuss how microRNAs affect signaling pathways, and examine the potential of microRNAs as therapeutic targets.

PRDX6
Also flagged:NCOA5tumorcisplatinnon-small cell lung cancerNSCLClipid
Journal Article 2025-07-05 ✓ 5 Snippets Wu DN, Huang P, Zhang KL, Chen RH, Huang RS.
In-Text Gene Mentions

…by interfering withPRDX6transcription.…

…that NCOA5 repressedPRDX6expression by interfering…

…Depletion ofPRDX6phenocopied the NCOA5-overexpr…

…enforced expression ofPRDX6blunted the effects…

…Thus, targeting the NCOA5/PRDX6axis may be…

Show Full Abstract

Cisplatin (CDDP)-based chemotherapy is an important treatment modality for non-small cell lung cancer (NSCLC), yet its efficacy is limited by the development of drug resistance. Chemoresistance is associated with aberrant lipid metabolism. We analyzed differentially expressed lipid metabolism-related genes based on public data and searched for a novel regulator of NSCLC chemoresistance. NCOA5, a regulator of cholesterol efflux, was found to be downregulated in CDDP-resistant NSCLC cells and surgically resected NSCLC tissues. Low NCOA5 expression was significantly associated with lymph node metastasis, TNM stage, and prognosis in NSCLC. NCOA5 knockdown increased the proliferation, invasion, and tumorigenesis of NSCLC cells. Overexpression of NCOA5 reversed the CDDP resistance of NSCLC cells both in vitro and in vivo. The chemosensitive effect of NCOA5 on CDDP-resistant NSCLC cells was impaired by N-acetylcysteine, an inhibitor of reactive oxygen species (ROS). Mechanistic investigations revealed that NCOA5 repressed PRDX6 expression by interfering with NRF2-mediated transactivation. Depletion of PRDX6 phenocopied the NCOA5-overexpressing cells and resulted in increased ROS generation and CDDP sensitivity. Furthermore, enforced expression of PRDX6 blunted the effects of NCOA5 on ROS production and CDDP sensitivity in NSCLC cells. Our data reveal a crucial role for NCOA5 in NSCLC progression and CDDP resistance. Thus, targeting the NCOA5/PRDX6 axis may be a promising strategy to overcome CDDP resistance in NSCLC.

ECI2
Also flagged:mitochondrialNDUFA8ACADMacute myocardial infarctionpathogenesismyocardial infarction
Journal Article 2025-07-05 ✓ 2 Snippets Hao Y, Fan C, Wen W, Li R, Gao Y, Hou X, Lu L, Shen Y.
In-Text Gene Mentions

…mitochondrial genes NDUFA8,ECI2, and ACADM in…

…of MRDEGs (NDUFA8,ECI2, and ACADM) in…

Show Full Abstract

Mitochondrial function plays a crucial role in understanding the pathogenesis of acute myocardial infarction.This study investigates mitochondrial function-related genes (MFRGs) in acute myocardial infarction (AMI) through bioinformatics and rigorous experimental validation. Using three integrated GEO datasets (149 samples: 80 AMI, 69 control), we applied machine learning methods (Random Forest, Support Vector Machine, Least Absolute Shrinkage and Selection Operator), phenotype scoring, consensus clustering, and weighted gene co-expression network analysis in three subgrouping stages to refine the selection of MFRGs. The intersection of three subgroup analyses results identified 11 key Mitochondrial function-Related Differentially Expressed Genes (MRDEGs). Gene Ontology / Kyoto Encyclopedia of Genes and Genomes analysis (GOKEGG), Gene Set Enrichment Analysis (GSEA), Gene Set Variation Analysis (GSVA), and immune infiltration analyses revealed significant pathways and suggested alterations in the composition of immune cell subpopulations. Single-cell analysis revealed increased expression of MRDEGs (NDUFA8, ECI2, and ACADM) in cardiomyocytes, fibroblasts, and macrophages, along with dynamic expression trends along the pseudotime trajectory. Subgroup analysis of cardiomyocytes based on mitochondrial gene scoring was performed to explore functional enrichment characteristics. Furthermore, we robustly validated these genes' expression in the cardiomyocyte hypoxia/reoxygenation model and the mouse model of myocardial infarction using flow cytometry, immunohistochemistry, and Western blot. Finally, this study constructed the mRNA regulatory network of key MRDEGs and preliminarily explored the potential therapeutic value of valproic acid and acetaminophen through molecular docking.These findings reveal the role of mitochondrial dysfunction in the mechanisms of AMI and its associated cell subpopulations, along with the involved biological pathways, offering new insights for AMI research.

PTGIS
Also flagged:extracellularcardiovascular diseaseatherosclerosisECM proteinsHIF-1αeNOS
Journal Article 2025-07-05 ✓ 1 Snippet Jørgensen SM, Huang S, Lorentzen LG, Teoh FKY, Karlsson R, Harkness JR, Miller RL, Davies MJ, Chuang CY.
In-Text Gene Mentions

…were prostacyclin synthase (PTGIS), solute carrier family…

Show Full Abstract

Normal endothelial cell (EC) function is essential for vascular wall homeostasis, whereas dysfunction increases the risk of cardiovascular disease. Low O<sub>2</sub> tension (hypoxia) promotes EC dysfunction and the formation of atherosclerotic plaques. Increasing evidence suggests that hypoxia drives extracellular matrix (ECM) remodeling, an established contributing factor in atherosclerosis. However, the effects of hypoxia on ECs and associated ECM proteins are poorly understood. The aim of this study was to investigate whether the culture of human coronary artery ECs under 1% O<sub>2</sub> (hypoxia) alters the ECM generated by these cells, and whether this affects HCAEC function. Exposure of HCAECs to 1% O<sub>2</sub> resulted in a hypoxic response (HIF-1α stabilization), dysfunction (increased oxidant formation and decreased eNOS), and inflammatory activation (increased IL-6 and ICAM-1 expression). Proteomic analysis of HCAECs cultured under 1% and 20% O<sub>2</sub> for 7 days revealed many hypoxia-induced changes to extracellular proteins, particularly increased versican, a key ECM proteoglycan. Increased versican expression and deposition were confirmed at the mRNA and protein level, along with its glycosaminoglycan (chondroitin sulfate) chains and particularly 6-O-sulfated species. This versican-rich ECM showed increased hyaluronan binding and decreased cell adhesiveness, but attached cells proliferated at a greater rate. The generation of a versican-rich ECM under 1% O<sub>2</sub> provides a link between hypoxia and atherosclerosis, since versican is reported to accumulate in plaques, where it binds and retains low-density lipoproteins and is involved in inflammatory cell recruitment, thereby potentiating low-density lipoprotein modification and the accumulation of lipid-laden (foam) cells.

Also flagged:HomeostasisPathogenesisneurodegenerative diseasespsychiatric disordersmetabolic syndromescancers
Journal Article 2025-07-05 No Snippets Yan X, Shi L, Zhu X, Zhao Y, Luo J, Li Q, Xu Z, Zhao J.
Show Full Abstract

As a pivotal ecological regulator in humans, the gut microbiota profoundly participates in the pathological processes of neurodegenerative diseases, psychiatric disorders, metabolic syndromes, and cancers through metabolite exchange, epigenetic regulation, and gut-brain axis signaling. This review focuses on analyzing relationships between gut microbial communities and four major disease spectra: neurodegenerative diseases (Alzheimer's disease, Parkinson's disease, Huntington's disease)-revealing microbiota-derived lipopolysaccharide activation of microglia and gut-brain transmission pathways of α-synuclein; mental health disorders (depression, schizophrenia, bipolar disorder)-elucidating dysregulated tryptophan metabolism and gut-derived neurotransmitter imbalances; metabolic diseases (obesity, diabetes, gout)-analyzing molecular mechanisms by which short-chain fatty acids regulate insulin sensitivity and uric acid metabolism; malignant tumors (lung cancer, breast cancer, prostate cancer)-exploring microbial remodeling of immune checkpoint inhibitor responses and regulatory effects on estrogen metabolism. We integrate existing evidence to systematically expound the roles of gut microbiota alterations in the pathogenesis of neurodegenerative diseases, psychiatric disorders, metabolic dysregulation, and malignant tumors, with in-depth analysis of mechanisms through which dysbiosis promotes disease progression, aiming to provide a theoretical foundation and scientific recommendations for developing microbiota-targeted precision intervention strategies (including, but not limited to synthetic microbial community transplantation and metabolite-directed regulation).

STAU1
Also flagged:GIGYF2Gene ExpressionGrb10-interacting GYF protein 2adaptor proteinVCPp97
Journal Article 2025-07-05 ✓ 1 Snippet Zhao CS, Liu SH, Li ZY, Chen JY, Xiong XY.
In-Text Gene Mentions

…instance, while the GIGYF2-STAU1-PTEN axis has been…

Show Full Abstract

GIGYF2 (Grb10-interacting GYF protein 2) functions as a versatile adaptor protein that regulates gene expression at various levels. At the transcriptional level, GIGYF2 facilitates VCP/p97-mediated extraction of ubiquitylated Rpb1 from stalled RNA polymerase II complexes during DNA damage response. In mRNA surveillance, GIGYF2 participates in ribosome collision-induced quality control, nonsense-mediated decay, no-go decay, and non-stop decay pathways. Furthermore, GIGYF2 interacts with key factors including 4EHP, TTP, CCR4-NOT, DDX6, ZNF598, and TNRC6A to mediate translational repression and mRNA degradation. Additionally, dysregulation of GIGYF2 has been implicated in various pathological conditions, including metabolic diseases, vascular aging, viral infections, and neurodegenerative disorders. This review summarizes the structural and functional characteristics of GIGYF2, highlighting its importance in transcriptional regulation, mRNA surveillance, translational inhibition, and mRNA degradation, while also elucidating its potential as a therapeutic target for disease treatment.

SERPINC1
Also flagged:gene expressionPDK4GLULPFKMLDHAHIF-1
Journal Article 2025-07-05 ✓ 1 Snippet Zhang X, Liu Y, Ma W, Li L, Bai D, Dugarjaviin M.
In-Text Gene Mentions

…proteins include CPB2,SERPINC1, HABP2, AMBP, KNG1,…

Show Full Abstract

Mongolian horses are renowned for their remarkable endurance and ability to adapt to harsh environments. To delve deeper into the molecular mechanisms that underlie these traits, researchers conducted a comprehensive analysis of transcriptomic and proteomic changes in Mongolian horses at three distinct time points: before, immediately after, and 24 h following a 20 km run. The transcriptomic analysis uncovered significant variations in gene expression patterns across these time points. Specifically, 291 differentially expressed genes (DEGs) were identified when comparing pre-exercise to post-exercise conditions, 832 DEGs in the comparison between post-exercise and 24 h post-exercise, and 127 DEGs in the comparison of pre-exercise to 24 h post-exercise. Notably, key genes involved in metabolic activities and cellular proliferation, such as <i>PI3K</i> and <i>LDHA</i>, exhibited significant upregulation immediately after exercise but demonstrated a downward trend 24 h post-exercise. Concurrently, the proteomic analysis revealed 49 differentially expressed proteins (DEPs) in the pre-exercise versus post-exercise comparison, 61 DEPs in the post-exercise versus 24 h post-exercise comparison, and 101 DEPs in the pre-exercise versus 24 h post-exercise comparison. Some proteins, like PDK4 and GLUL, remained upregulated at 24 h post-exercise, whereas others, such as PFKM and LDHA, showed signs of recovery or downregulation. By integrating the transcriptomic and proteomic data, we were able to pinpoint overlapping DEGs/DEPs and implicate crucial signaling pathways, including the HIF-1 signaling pathway and glycolysis, in the molecular response of Mongolian horses to exercise. These findings offer insights into the endurance adaptation mechanisms of the Mongolian horse.

Also flagged:Cas9gene expressiontranslationalchromosomal regionssynthesisMSTN
Journal Article 2025-07-05 No Snippets Nawaz AH, Ding J, Ali M, Leng D, Mukhtar N, Ali A, Feng C.
Show Full Abstract

Body weight and growth are crucial traits in chickens, regulated by an intricate genetic architecture that remains challenging to understand completely. Multiple quantitative trait loci (QTL) mapping and genome-wide association studies (GWAS) have revealed numerous genetic variations associated with these economically important traits, but the application of these findings for sustainable and efficient poultry production is limited. This review synthesizes existing knowledge on the genetic regulation of chicken growth, challenging the traditional approach and encouraging the development of integrated strategies to comprehend the regulatory mechanisms underlying complex growth phenotypes. This review highlights recent advances in omics studies (genomics, transcriptomics, proteomics, and metabolomics), emphasising the utility of single-cell RNA sequencing (scRNA-seq) in addressing cellular heterogeneity within growth-related tissues. The advancement of genome sequencing technologies, combined with progress in CRISPR/Cas9-mediated genome editing, has opened new avenues for the precision breeding of economically important traits in chickens. It also discusses how the newly developed Chicken Genotype-Tissue Expression (ChickenGTEx) project and other related data resources could potentially serve as crucial tools to reveal the regulatory mechanisms related to chicken growth, offering insights into tissue specific gene expression. By elucidating regulatory networks and identifying key knowledge gaps, this review intends to accelerate the development of precision breeding approaches for sustainable and efficient poultry production, ultimately enhancing global food security.

Also flagged:triclocarbandigestiondegradationcarbanilide4-chloroanilineaniline
Journal Article 2025-07-05 No Snippets Tang X, Zheng M, Zhang Q, He D, Liu W, Wang Y, Yang J.
Show Full Abstract

Triclocarban (TCC) is universally present in municipal sludge, posing a high ecological health risk. Advanced anaerobic digestion can effectively remove TCC in sludge, but its degradation and transformation mechanism remains unclear. Thus, DNA-based stable isotope probing was conducted to investigate the degradation behavior and mechanism of TCC during municipal sludge anaerobic digestion. The results showed that TCC was mainly adsorbed in the sludge phase, and TCC in the aqueous phase was effectively removed (max 95.2 %). Hydrolysis and microbial transformation significantly influenced the removal of TCC, and the contribution of microbial transformation was 18.3-23.5 %. After advanced anaerobic digestion, four previously reported products (4,4'-dichlorocarbanilide (DCC), carbanilide (NCC), 4-chloroaniline, and aniline) and a new product (4,5-dichloro-2-(methylamino) phenol) were formed through hydrolysis, dechlorination, and hydroxylation. Dominant functional microorganisms (Pseudomonadota and Bacteroidota) enhanced the degradation of TCC, DCC, and NCC. Metabolic pathways dominated all functional categories, especially carbohydrate and amino acid metabolisms, accounting for 9.09 % and 7.59 %, respectively. TCC hydrolysis functional gene tccA had a high copy number in the heavy fraction of DNA. The functional microorganisms carrying the tccA gene preferentially utilized ¹ ³C, while others ¹ ²C utilized. This study provides a new insight into the environmental behavior, fate, and pollution control of TCC during the advanced anaerobic digestion of municipal sludge.

FBXL4
Also flagged:cancerbreast cancerlung cancerERPRHER2
Journal Article 2025-07-05 ✓ 2 Snippets Pei W, Dai L, Li M, Cao S, Xiao Y, Yang Y, Ma M, Deng M, Mo Y, Liu M.
In-Text Gene Mentions

…Intriguingly,F-box and leucine-rich repeat protein 4and leucine-rich repeat…

…repeat protein 4 (FBXL4) acts as a…

Show Full Abstract

Breast cancer is the leading threat to the health of women, with a rising global incidence linked to social and psychological factors. Among its subtypes, triple-negative breast cancer (TNBC), which lacks <i>estrogen receptor (ER)</i>, <i>progesterone receptor (PR)</i>, and <i>human epidermal growth factor receptor 2 (HER2)</i> expression, is highly heterogeneous with early metastasis and a poor prognosis, making it the most challenging subtype. Mounting evidence shows that the mitochondrial quality control (MQC) system is vital for maintaining cellular homeostasis. Dysfunction of the MQC is tied to tumor cell invasiveness, metastasis, and chemoresistance. This paper comprehensively reviews the molecular link between MQC and TNBC development. We focused on how abnormal MQC affects TNBC progression by influencing chemoresistance, immune evasion, metastasis, and cancer stemness. On the basis of current studies, new TNBC treatment strategies targeting key MQC nodes have been proposed. These findings increase the understanding of TNBC pathogenesis and offer a theoretical basis for overcoming treatment challenges, providing new research angles and intervention targets for effective precision therapy for TNBC.

Also flagged:colorectal cancerfatty acidlipogenesisglutaminolysiscancerintestinal diseases
Journal Article 2025-07-05 No Snippets Modeel S, Siwach S, Dolkar P, Chaurasia M, Yadav P, Atri A, Yadav A, Negi T, Negi RK.
Show Full Abstract

The pathophysiology of many ailments, including neurological, gastrointestinal, and metabolic problems, is well known to be influenced by intestinal dysbiosis. Clinical research has provided evidence suggesting a strong correlation between dysbiosis of the gut microbiome and colorectal cancer (CRC) development. The active reprogramming of metabolic pathways to boost glycolysis, fatty acid production, lipogenesis, and glutaminolysis constitutes a major metabolic shift in cancer development, including CRC. The complex combination of different factors leads to CRC, making it an environmental disease. These factors include food and lifestyle choices, genetics and family history, age, underlying intestinal diseases, and dysbiosis of the gut microbiota. One of the primary risk factors for carcinoma development is diet, which impacts an individual's gut microbiome. In addition to impacting CRC formation, the gut microbiome also has immunomodulatory effects, including various immunological interactions and the underlying mechanisms governing them. Microbial interactions in CRC have been extensively studied, yet numerous unresolved queries exist on how gut bacteria can influence treatment. It is possible to perform microbiome-driven immunotherapies focusing on probiotics, prebiotics, and synbiotics. However, large-scale treatment utilization in CRC patients is limited by several issues, including variations in the microbial makeup of each patient's gut and a lack of established methods. The study highlights the impact of several risk factors, including dysbiosis of the gut microbiome and different approaches to halting and treating CRC progression with a focus on diet changes and modulation of the gut flora. Given the foregoing, we propose that if research gaps are addressed and immunotherapy is paired with microbial interventions, microbiota-based therapeutics could potentially impede the growth of tumors and treat CRC.

PRDX6
Also flagged:thiolporphyrincysteinesAP2B1diamidecysteine
Journal Article 2025-07-05 ✓ 1 Snippet Liu Z, Ma S, Zhang Y, Yao J, Lu H.
In-Text Gene Mentions

…E and 5F),PRDX6, which is annotated…

Show Full Abstract

Profiling the thiol proteome in live cells is a critical yet challenging task for elucidating oxidative stress-related processes due to the scarcity of multifunctional probes that directly integrate fluorescence imaging with chemical proteomics. Here, we constructed a fluorescent, enrichable, and mass spectrometry-compatible probe based on fluorinated porphyrin, termed the FP probe. By eliminating the need for attaching separate reporter modules after probe labeling, the FP probe not only directly visualizes the thiol proteome in cells but also enables the visualization of thiol proteome enrichment for reliable site identification by mass spectrometry. This capability drives the development of a visualization-guided proteomics (VGP) workflow, which seamlessly merges fluorescence imaging with chemical proteomics. In addition, the FP probe demonstrated an advantage in the capture of cysteines with low solvent accessibility. We successfully identified Cys818 of AP2B1, a residue with a relative solvent accessible area of 0.02 that is sensitive to the protein interactions induced by diamide stress in live cells. Our probe may pave the way for the design of multifunctional probes and become an important tool for applications including target identification, drug discovery, and diagnostics.

Also flagged:Serotonin5‐hydroxytryptaminemonoamineamino acidtryptophanaggression
Journal Article 2025-07-04 No Snippets Andreozzi G, Karkoszka N, Sparaco R, Corvino A, Severino B, Santagada V, Magli E, Gibuła-Tarłowska E, Kotlińska JH, Gawel K, Capasso R, Lesniak A, Semenko N, Kaczor AA, Bielenica A, Biała G, Caliendo G, Kędzierska E, Fiorino F.
Show Full Abstract

The synthesis of a new series of long-chain arylpiperazine as serotoninergic ligands (FG 1-18) is described. The combination of structural elements including heterocyclic nucleus, propyl chain, and 4,5-dihydrothiazol-2-ylphenylpiperazines leads to the preparation of different derivatives tested for their affinity toward 5-HT<sub>1A</sub>, 5-HT<sub>2A</sub>, and 5-HT<sub>2C</sub> receptors. The compounds with better affinity and selectivity binding profiles toward 5-HT<sub>1A</sub> and 5-HT<sub>2C</sub> (FG-1, FG-4, FG-5, FG-6, FG-7, FG-8, and FG-18) are selected for further in vivo assays to determine their functional activity. Finally, to rationalize the obtained results, molecular docking studies are performed. The results of pharmacological studies show that compounds FG-1, FG-5, FG-8, and FG-6 exert antidepressant-like effects, and FG-1, FG-18, FG-6, and FG-7 reveal also significant anxiolytic properties. Among the developed derivatives, the most promising compounds seem to be FG-1, which exhibit antidepressant, anxiolytic, and anticonvulsant properties, FG-7 and FG-18 that show features as anxiolytic combine to a pro-cognitive property and notable affinity and selectivity for 5-HT<sub>2C</sub> receptor, respectively.

Also flagged:Psychiatric Disorderspathogenesis18 kDa translocator proteinTSPOmajor depressive disorderPTSD
Journal Article 2025-07-04 No Snippets Liu YD, Chang YH, Xie XT, Wang XY, Ma HY, Liu MC, Zhang HM.
Show Full Abstract

Recent advancements in neuroinflammation research have significantly enhanced our understanding of its pivotal role in the pathogenesis and pathophysiology of psychiatric disorders. Positron emission tomography (PET) imaging, leveraging its unique ability to quantify biological processes in vivo non-invasively, has emerged as a transformative tool for investigating neuroimmune mechanisms. The 18 kDa translocator protein (TSPO), a biomarker of activated microglia and astrocytes during neuroinflammation, enables PET-based visualization of neuroinflammatory activity, offering novel insights into the neurobiological underpinnings of psychiatric conditions. This review synthesizes recent TSPO PET imaging findings across major psychiatric disorders, including major depressive disorder (MDD), obsessive-compulsive disorder (OCD), posttraumatic stress disorder (PTSD), schizophrenia, and psychosis. We critically evaluate how TSPO PET elucidates neuroinflammatory signatures linked to disease progression, treatment responses, and therapeutic stratification. Furthermore, we explore the translational potential of anti-inflammatory agents (e.g., celecoxib and minocycline) and TSPO-targeted ligands (e.g., etifoxine and XBD173) in modulating neurosteroid synthesis and neuroimmune interactions. By bridging methodological innovations with clinical applications, this review underscores the promise of TSPO PET in advancing diagnostic precision, personalized treatment strategies, and mechanistic insights into neuroinflammation-driven psychiatric pathologies. Challenges such as genetic polymorphisms (e.g., rs6971), partial volume effects (PVEs), and quantification biases are discussed to guide future research directions.

Also flagged:SilicaSynthesisCancerdimethyl sulfoxidecell growthdoxorubicin
Journal Article 2025-07-04 No Snippets van Haaften C, Koek J, van Eendenburg JDH, van Wiltenburg J, Kluitmans DJF, Grobben Y, Zaman GJR, Ten Hoeve W.
Show Full Abstract

The sesquiterpene lactone eremophila-1(10),11(13)-dien-12,8β-olide (EPD), isolated from leaves of the <i>Calomeria amaranthoides</i> plant, has shown cytotoxic activity on human cancer cell lines, including ovarian cancer-derived cells. To enable further preclinical investigation of EPD as a potential anticancer agent, a chemical synthetic route was developed. NMR and HPLC analysis confirmed that synthetic EPD was identical to natural EPD. The absolute configuration of EPD was established by 3D electron diffraction of a solid precursor. Parallel testing on a panel of more than one hundred human cancer cell lines derived from diverse solid tumors and hematologic malignancies revealed an almost identical profile for synthetic and natural EPD. Furthermore, this profile was unique among 248 anticancer agents that have been profiled on the same panel. These studies merit further investigation of EPD and synthetic analogs for the development of novel anticancer therapies for cancers with high unmet need, including ovarian cancer.

Also flagged:translationalfatty acylcysteinelocalizationNOD-like receptor subfamily P3NLRP3
Journal Article 2025-07-04 No Snippets Martin NR, Fairn GD.
Show Full Abstract

Over the past decade, S-acylation has emerged as a crucial regulator of several innate immune signaling pathways, with new insights continually being gained. S-acylation, a reversible post-translational modification, involves the attachment of fatty acyl chains to cysteine residues, influencing protein localization, function, and stability. In this mini-review, we examine the accumulating evidence of the role of S-acylation in regulating nucleotide oligomerization domain (NOD)-like receptors. NOD-like receptor subfamily P3 (NLRP3), a key player in inflammasome formation, undergoes S-acylation at specific cysteine residues, which are essential for its localization to the trans-Golgi network and other organelles. Various zinc finger Asp-His-His-Cys motif-containing (zDHHC) enzymes mediate this modification, with zDHHC5 being particularly important for activation and the ability of NLRP3 to interact with never in mitosis gene A (NIMA)-related protein kinase 7 (NEK7), promoting inflammasome assembly, caspase-1 activation, and pyroptosis. Alternatively, S-acylation by zDHHC12 targets NLRP3 for chaperone-mediated autophagy, preventing excessive inflammation. NOD2, another NLR, requires S-acylation for membrane localization and effective signaling via the NF-κB and mitogen-activated protein kinase pathways in response to peptidoglycan components. Dysregulation of S-acylation in NOD2 is associated with Crohn's Disease (hypo-acylated) and Blau syndrome/early-onset sarcoidosis (hyper-acylated). Soluble NOD2 lacking S-acylation is ubiquitinated and eliminated by the autophagic pathway. This review highlights the significance of understanding the S-acylation cycle and its regulatory mechanisms in developing potential therapeutic interventions for related inflammatory diseases. We also discuss unresolved questions regarding the S-acylation of NOD2 and NLRP3, as well as the regulation of S-acylation in general.

SERPINC1
Also flagged:anxietyanxiety disordersbehavioralseparation anxietygeneralized anxietyaggression
Journal Article 2025-07-04 ✓ 1 Snippet Gaither C, Popp R, Borchers CH, Beaudry F, Desmarchelier M.
In-Text Gene Mentions

…FGG, SERPINA5, andSERPINC1) follow the same…

Show Full Abstract

<h4>Purpose</h4>Anxiety is the most common underlying cause of behavioral problems in dogs, which remain a top reason for relinquishment and euthanasia. Despite its high prevalence, anxiety is often underdiagnosed, partly due to a limited understanding of biological processes and absence of diagnostic biomarkers. Our study aims to address this knowledge gap.<h4>Experimental design</h4>Plasma from 10 anxious and 10 matched control dogs were analyzed following a label-free quantitation proteomics workflow based on data-dependent acquisition using a Thermo Q Exactive Plus coupled to an EASY-nLC 1200, Vanquish UHPLC, or Evosep One. Data were processed with Proteome Discoverer 2.4 (Thermo), Perseus (Max Planck Institute), Cytoscape and other bioinformatic tools.<h4>Results</h4>Between 279 and 350 proteins were identified, and proteins such as fibrinogen, apolipoproteins, and complement system and coagulation cascade proteins were significantly different between groups. Additionally, we identified two putative subgroups of anxious dogs, suggesting potentially different underlying pathophysiological mechanisms for a single anxiety phenotype.<h4>Conclusions and clinical relevance</h4>To our knowledge, this is the first comprehensive clinical in-depth proteomic profiling of plasma from anxious dogs. Our findings lay the foundation for elucidating the pathophysiology of canine anxiety and for the future validation and establishment of novel candidate biomarkers for disease diagnosis. Novel biomarkers would allow for a more effective and objective diagnosis of anxiety, even when not phenotypically apparent.<h4>Summary</h4>Previous mass spectrometry (MS) studies have found proteomic profile differences in other diseases and other animal species. This is to our knowledge, the first unbiased and comprehensive clinical in-depth proteomic profiling of plasma from dogs suffering from anxiety disorders. These findings have an impact on animal health as they set the foundation to elucidate the pathophysiology of canine anxiety so that in the future novel candidate biomarkers can be established and validated, furthering the potential development of new drugs and guiding patient-specific therapeutic interventions based on biomarker profiles. In the clinic, novel biomarkers could allow for a more effective and objective diagnosis of anxiety disorders, even when not phenotypically apparent. Detection and measurement of early stages of anxiety disorders as well as treatment monitoring in pet dogs would allow patients to be treated quicker, before the potential onset of aggression, and a faster recovery, thus improving the welfare of companion animals.

Also flagged:methylationgene expressionnucleosomesmethyltransferaseDOT1Ldisruptor of telomeric silencing 1-like
Journal Article 2025-07-04 No Snippets Cooke EW, Zeng C, Nur SM, Jia Y, Huang A, Chen J, Gao P, Chen FX, Jin F, Cao K.
Show Full Abstract

Metazoan nucleosomes harboring H3K79 methylation (H3K79me) deposited by the methyltransferase DOT1L (disruptor of telomeric silencing 1-like) decorate actively transcribed genes. While DOT1L regulates transcription and the pathogenesis of leukemia and neurological disorders, the role of H3K79me remains elusive. Here, we reveal a functional synergism between H3K79me and H3K36 trimethylation (H3K36me3) in regulating gene expression and cellular differentiation. Simultaneous catalytic inactivation of DOT1L and the H3K36 methyltransferase SETD2 (SET domain containing 2) leads to hyperactive transcription and failures in neural differentiation. H3K79me/H3K36me3 loss causes increased transcription elongation, gained chromatin accessibility at a group of enhancers, and increased recruitment of TEAD4 (TEA domain transcription factor 4) and its coactivator YAP1 (Yes-associated protein 1) to these enhancers. Furthermore, YAP-TEAD inhibition restores the expression levels of genes hyperactivated by H3K79me/H3K36me3 loss. Together, we demonstrate a synergism of H3K79me and H3K36me3 in regulating transcription and cell fate transition, unveil the underlying mechanisms, and provide insight into targeting diseases driven by misregulation/mutations of DOT1L and/or SETD2.

Also flagged:MTHFRhomocysteinetype 2 diabetes mellitusalbumincreatininehyperhomocysteinemia
Journal Article 2025-07-04 No Snippets Pham NTN, Le TTT, Phan HM, Ho HTT, Nguyen HH.
Show Full Abstract

BackgroundA1298C polymorphism of the MTHFR gene and blood homocysteine levels are reported to be associated with the development of proteinuria in patients with type 2 diabetes mellitus; however, data remain limited.ObjectivesTo determine the characteristics of A1298C polymorphism and blood homocysteine levels as well as their association with proteinuria in patients with type 2 diabetes mellitus.Materials and methodsA cross-sectional study with convenient sampling was performed among patients with type 2 diabetes mellitus who visited the Can Tho University of Medicine and Pharmacy Hospital between August 2023 and August 2024. Blood samples were collected for genetic sequencing and homocysteine level testing. Proteinuria was defined as an albumin-to-creatinine ratio ≥30 mg/g.ResultsIn total, 192 patients with a mean age of 63.9 ± 13.1 years were enrolled. Males accounted for 34.9% of the study population. Analysis of A1298C polymorphism revealed genotype distributions of AA, AC, and CC genotypes as 51.6%, 41.1%, and 7.3%, respectively. A significant association was observed between A1298C polymorphism and elevated homocysteine levels, with CC genotype exhibiting a higher prevalence of hyperhomocysteinemia (28.6%) than AA (6.1%) and AC (22.8%) genotypes. Patients carrying AC+CC genotypes had a 2.40-fold higher risk of developing proteinuria (95% confidence interval: 1.30-4.41, p <<i> </i>0.05) than those with AA genotype. Elevated blood homocysteine levels were associated with an 8.98-fold increased risk of proteinuria (95% confidence interval: 2.06-39.11, p <<i> </i>0.05). Independent factors associated with proteinuria included age (odds ratio = 0.97), elevated homocysteine levels (odds ratio = 8.79), and AC+CC genotype (odds ratio = 2.08).ConclusionA1298C polymorphism was characterized by allele frequencies of 72.1% for A and 27.9% for C. In addition to age, the presence of the C allele and elevated blood homocysteine levels were identified as independent risk factors for proteinuria in patients with type 2 diabetes mellitus.

LRRC7
Also flagged:Duplicationautism spectrum disorderautism-nucleusidiopathic autism
Journal Article 2025-07-04 ✓ 1 Snippet Perez Y, Velmeshev D, Wang L, White ML, Siebert C, Baltazar J, Zuo G, Moriano JA, Chen S, Steffen DM, Dutton NG, Wang S, Wick B, Haeussler M, Chamberlain S, Alvarez-Buylla A, Kriegstein A.
In-Text Gene Mentions

…of synaptic contacts,LRRC7, a regulator…

Show Full Abstract

Duplication 15q (dup15q) syndrome is a leading genetic cause of autism spectrum disorder, offering a key model for studying autism-related mechanisms. Using single-cell and single-nucleus RNA sequencing of cortical organoids from dup15q patient-derived iPSCs and post-mortem brain samples, we identify increased glycolysis, disrupted layer-specific marker expression, and aberrant morphology in deep-layer neurons during fetal-stage organoid development. In adolescent-adult postmortem brains, upper-layer neurons exhibit heightened transcriptional burden related to synaptic signaling, a pattern shared with idiopathic autism. Using spatial transcriptomics, we confirm these cell-type-specific disruptions in brain tissue. By gene co-expression network analysis, we reveal disease-associated modules that are well preserved between postmortem and organoid samples, suggesting metabolic dysregulation that may lead to altered neuron projection, synaptic dysfunction, and neuron hyperexcitability in dup15q syndrome.

SOX6
Also flagged:ossificationangiogenesisosteogenesisKrt8Has1bone formation
Journal Article 2025-07-04 ✓ 1 Snippet Zhang X, Jiang W, Wu X, Xie C, Zhang Y, Li L, Gu Y, Hu Z, Zhai X, Liang R, Zhang T, Sun W, Ye J, Wei W, Wang X, Hong Y, Zhang S, Cai Y, Zou X, Hu Y, Ouyang H.
In-Text Gene Mentions

…expression of Sox5,Sox6, Sox9 and Runx2…

Show Full Abstract

Current approaches for bone repair predominantly target localized delivery of growth factors that are aimed at the coupling of angiogenesis and osteogenesis. However, delayed revascularization and regeneration of critical-sized bone defects are still challenging. In this study, we engineer an ossification center-like organoid (OCO) that consist of an inner-core bone morphogenetic and neurotrophic spheroid generated via MSCs-loaded 3D printing, alongside the interstitially distributed outer-shell proangiogenic neurotrophic phase. Our results demonstrate that collective implantation of OCOs achieves rapid bone bridging with successive OC-like bone ossicles formation across the bone defect in a "divide-and-conquer" way. Single-cell RNA sequencing analysis unveils a developmentally mimicking stem cell community that dominated with Krt8<sup>+</sup> skeletal stem cells (SSCs) is uniquely recruited by the pro-regenerative in-situ organoid fusion and maturation. Particularly noteworthy is the specific expansion of Krt8<sup>+</sup> SSCs concomitant with the simultaneous reduction of Has1<sup>+</sup> migratory fibroblasts (MFs) post-OCO implantation. Furthermore, cross-species comparisons employing machine learning reveal high resemblance of the relative Krt8<sup>+</sup> SSCs/Has1<sup>+</sup> MFs composition in bone regeneration with that in public data from developmental bone tissues. Our findings advocate an approach akin to "divide-and-conquer" utilizing engineered OC-like organoids for prompt regeneration of large-sized bone defects.

OLFM4
Also flagged:cancercolorectal cancertumorsFGF2AP-1tumor
Journal Article 2025-07-04 ✓ 1 Snippet Xiong L, Xu Y, Gao Z, Shi J, Wang Y, Wang X, Huang W, Li M, Wang L, Xu J, Li C, Gu J, Deng H, Qu M.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Phenotypic plasticity is a hallmark feature driving cancer progression, metastasis, and therapy resistance. Fetal-like transcriptional programs have been increasingly implicated in promoting plastic cell states, yet their roles remain difficult to study due to limitations of existing culture models. Here, we establish a chemically defined patient-derived organoid system that enables long-term expansion of colorectal cancer (CRC) cells while preserving fetal-like features associated with phenotypic plasticity. Using this model, we identify an oncofetal state (OnFS) that is enriched in advanced tumors and linked to key features of plasticity, including epithelial-mesenchymal plasticity, as well as increased metastasis and treatment resistance. Mechanistically, we show that FGF2-AP-1 signaling maintains the OnFS program and associated phenotypic plasticity in CRC. This model offers a powerful platform for studying the fetal-like features underlying cancer cell plasticity and their role in tumor progression and treatment resistance in CRC.

OLFM4
Also flagged:extracellulargene expressionTumourExtracellular TrapsPancreatic Ductal AdenocarcinomaPDAC
Journal Article 2025-07-04 ✓ 3 Snippets McDonald PC, Topham JT, Awrey S, Tavakoli H, Carroll R, Brown WS, Gerbec ZJ, Kalloger SE, Karasinska JM, Tang P, Goodwin R, Jones SJM, Laskin J, Marra MA, Morin GB, Renouf DJ, Schaeffer DF, Dedhar S.
In-Text Gene Mentions

…Olfactomedin 4 (OLFM4) 31 , 32…

…gene clusters intoOLFM4-high and OLFM4…

…OLFM4 -high andOLFM4-low groups (Fig.…

Show Full Abstract

Tumour associated neutrophils (TANs) promote metastasis through interactions of Neutrophil Extracellular Traps (NETs) with tumour cells. However, molecular details surrounding the interactions between NETs and Pancreatic Ductal Adenocarcinoma (PDAC) cells are poorly understood. Here, we examine the contribution of NETs in the progression of PDAC, which is characterized by high metastatic propensity. We carry out consensus clustering and pathway enrichment analysis of NET-related genes in an integrated cohort of 369 resectable and metastatic PDAC patient tumour samples, and compile two gene expression signatures comprising of either, integrin-actin cytoskeleton and Epithelial to Mesenchymal Transition (EMT) signaling, or cell death signaling, which identifies patients with very poor to better overall survival, respectively. Tumour Infiltrating neutrophils and NETs associate with ITGB1, CCDC25 and ILK, within clinical and experimental PDAC tumours. Functionally, exposure of PDAC cells to NETs identifies a cytoskeletal dynamic-associated CCDC25-ITGB1-ILK signaling complex which stimulates EMT and migration/invasion. NETosis-driven experimental metastasis to the lungs of PDAC cells delivered through the tail vein of female non-obese diabetic (NOD) scid gamma (NSG) mice is significantly inhibited by ILK knock down. Our data identify novel NET-related gene expression signatures for PDAC patient stratification, and reveal targetable signaling axes to prevent and treat disease progression.

VRK2
Also flagged:CDS1CDS2uveal melanomaCDP-diacylglycerol synthase 2CDP-diacylglycerol synthase 1phosphoinositide
Journal Article 2025-07-04 ✓ 2 Snippets Chan PY, Alexander D, Mehta I, Matsuyama LSAS, Harle V, Olvera-León R, Park JS, Arriaga-González FG, van der Weyden L, Cheema S, Iyer V, Offord V, Barneda D, Hawkins PT, Stephens L, Kozik Z, Woods M, Wong K, Balmus G, Vinceti A, Thompson NA, Del Castillo Velasco-Herrera M, Wessels L, van de Haar J, Gonçalves E, Sinha S, Vázquez-Cruz ME, Bisceglia L, Raimondi F, Choudhary J, Patiyal S, Venkatesh A, Iorio F, Ryan CJ, Adams DJ.
In-Text Gene Mentions

…for VRK1 /VRK2, where VRK1…

…in glioblastoma becauseVRK2is frequently silenced…

Show Full Abstract

Metastatic uveal melanoma is an aggressive disease with limited effective therapeutic options. To comprehensively map monogenic and digenic dependencies, we performed CRISPR-Cas9 screening in ten extensively profiled human uveal melanoma cell line models. Analysis involved genome-wide single-gene and combinatorial paired-gene CRISPR libraries. Among our 76 uveal melanoma-specific essential genes and 105 synthetic lethal gene pairs, we identified and validated the CDP-diacylglycerol synthase 2 gene (CDS2) as a genetic dependency in the context of low CDP-diacylglycerol synthase 1 gene (CDS1) expression. We further demonstrate that CDS1/CDS2 forms a synthetic lethal interaction in vivo and reveal that CDS2 knockout results in the disruption of phosphoinositide synthesis and increased cellular apoptosis and that re-expression of CDS1 rescues this cell fitness defect. We extend our analysis using pan-cancer data, confirming increased CDS2 essentiality in diverse tumor types with low CDS1 expression. Thus, the CDS1/CDS2 axis is a therapeutic target across a range of cancers.

OLFM4
Also flagged:Colorectal CancerLiver MetastasisColorectal carcinomacarcinomascolorectal cancer liver metastasescomplement
Journal Article 2025-07-04 ✓ 2 Snippets Nissen P, Popova NV, Gocke A, Smit DJ, Wong GYM, McKay MJ, Hugh TJ, David K, Juhl H, Voß H, Marquardt JU, Nashan B, Schlüter H, Molloy MP, Jücker M.
In-Text Gene Mentions

…DCN, TIMP3, andOLFM4for CRLM-CA and…

…(DCN), and olfactomedin-4 (OLFM4) ( Fig. 6…

Show Full Abstract

Colorectal carcinoma is a major global disease with the second highest mortality rate among carcinomas. The liver is the most common site for metastases which portends a poor prognosis. Nonetheless, considerable heterogeneity of colorectal cancer liver metastases (CRC-LM) exists, evidenced by varied recurrence and survival patterns in patients undergoing curative-intent resection. Our understanding of the basis for this biological heterogeneity is limited. We investigated this by proteomic analysis of 152 CRC-LM obtained from three different medical centers in Germany and Australia using mass spectrometry-based differential quantitative proteomics. The proteomics data of the individual cohorts were harmonized through batch-effect correction algorithms to build a large multicenter cohort. Applying ConsensusClusterPlus to the proteome data yielded three distinct CRC-LM phenotypes (referred to as CRLM-SD (splice-driven), CRLM-CA (complement-associated), and CRLM-OM (oxidative metabolic)). The CRLM-SD phenotype showed higher abundance of key regulators of alternative splicing as well as extracellular matrix proteins commonly associated with tumor cell growth. The CRLM-CA phenotype was characterized by a higher abundance of proteins involved in the classical pathway part of the complement system including the membrane attack complex proteins and those with antithrombotic activity. The CRLM-OM phenotype showed higher abundance of proteins involved in various metabolic pathways including amino acids and fatty acids metabolism, which correlated in the literature with advanced proliferation of metastases and increased recurrence. Patients classified as CRLM-OM had a significantly lower overall survival in comparison to CRLM-CA patients. Finally, we identified a set of prognosis-associated biomarkers for each group including EpCAM, CEACAM1, CEACAM5, and CEACAM6 for CRLM-SD, DCN, TIMP3, and OLFM4 for CRLM-CA and FMO3, CES2 and AGXT for CRLM-OM. In summary, the discovery of three proteomic subgroups associated with distinct signaling pathways and survival of the CRC-LM patients provides a novel classification for risk stratification, prognosis and potentially novel therapeutic targets in CRC-LM.

SOX6
Also flagged:Seleniumtranscription factorbindingwound healinghydrogendeath
Journal Article 2025-07-04 ✓ 1 Snippet Subramaniam R, Selvan Christyraj JRS, Pantam V, Senthilkumar P, Selvan Christyraj JD, Azhaguchamy M, Yesudhason BV.
In-Text Gene Mentions

Sox6

Show Full Abstract

Selenium, an essential trace element, plays a critical role in antioxidant defence and cellular homeostasis. Selenium injection (500 nM to 300 µM) significantly enhanced anterior blastema regeneration in the earthworm <i>Perionyx excavatus</i>, with maximal blastema length observed at 300 µM (4.30 ± 0.12 mm vs. 3.09 ± 0.08 mm in controls). Histological analysis revealed concentration-dependent tissue restoration, including longitudinal muscle layer thickness (40.9 ± 0.43 µm at 300 µM vs. 29.5 ± 0.38 µm in controls) and expansion of epithelial/circular muscle layers. Quantitative PCR identified pex-miR-219 as uniquely suppressed by selenium, showing progressive downregulation (0.60-, 0.47-, 0.36-, and 0.22-fold at 1 µM, 100 µM, 200 µM, and 300 µM, respectively; p < 0.001). Computational target prediction (miRanda, RNAhybrid, RNA22) and qPCR validation confirmed transcription factor Su(H) as a high-affinity target of pex-miR-219, with Su(H) mRNA upregulated 8.26-fold at 300 µM (p < 0.001). Molecular dynamics simulations demonstrated stable binding between pex-miR-219 and Su(H), evidenced by RMSD stabilization (~ 0.25 nm after 4 ns), low RMSF in helical regions, and persistent hydrogen bonds (30-35 bonds). These findings establish a selenium-mediated regulatory axis where suppression of pex-miR-219 relieves Su(H) repression, accelerating blastemal growth and tissue restoration. The study shows that selenium could be used as a treatment to influence miRNA pathways, which helps improve healing processes. By elucidating the pex-miR-219/Su(H) interaction, this work provides a molecular framework for developing selenium-based interventions in regenerative medicine, particularly for conditions requiring accelerated tissue repair, such as wound healing or post-traumatic regeneration. These insights could inform future strategies to harness trace elements for targeted gene regulation in human regenerative therapies.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s13205-025-04406-2.

HFE
Also flagged:Hereditary hemochromatosisHHironhepcidin hormonemetabolismexcretion
Journal Article 2025-07-04 ✓ 5 Snippets Pagliosa CM, Franco VKB, Matias TS, Dias BV, Hoepers ATC.
In-Text Gene Mentions

…related to theHFEgene, defined as…

…HH of otherHFEgenotypes could also…

…overload-related subtype amongHFEmutations.…

…allele frequencies ofHFEmutations can be…

…genetic heterogeneity, whereHFEmutations and the…

Show Full Abstract

<h4>Background</h4>Investigating the frequency and characteristics of iron overload cases with HFE gene mutation is crucial, given the population-level risks associated with excessive iron.<h4>Objective</h4>To determine the frequency of HFE mutations in patients with iron overload in Santa Catarina, Brazil.<h4>Design and setting</h4>A cross-sectional study of patients with iron overload at the Ambulatory Department of the Centro de Hematologia e Hemoterapia de Santa Catarina (Hemorrede-HEMOSC) in Santa Catarina.<h4>Methods</h4>HFE genotype frequencies were determined, and a division were made between carriers of HFE -C282Y/C282Y mutations and carriers of other HFE-non-C282Y/C282Y mutations, according to each region of Santa Catarina. Binary logistic regression was used for association between sex and age with genetic mutation trait.<h4>Results</h4>Among the 1,022 patients, 10.4% had secondary hemochromatosis, and 89.6% were evaluated for iron overload due to hereditary hemochromatosis (HH). Of these, 367 underwent genetic testing, which revealed HFE mutations in 77.3%. Most patients with HFE mutations had non-C282Y/C282Y-hemochromatosis, especially H63D/WT (> 39%), regardless of the Santa Catarina region. The frequency of C282Y/C282Y was higher in the West (20.9%) and North (28.3%) regions. Adjusted association analysis showed that men have an increased chance of hemochromatosis when involving 'non-C282Y/C282Y' mutations (OR: 2.77; 95% CI: 1.60-6.608).<h4>Conclusions</h4>The data show the magnitude and characteristics of iron overload cases with HFE mutations in Santa Catarina. As most patients referred for treatment have H63D mutation, we suggest further studies to assess whether other factors, including dietary habits and mandatory iron fortification policies, contribute to iron overload or HH manifestation.

Also flagged:anemiaHbironiron deficiency anemianecrotizing enterocolitisintraventricular hemorrhage
Journal Article 2025-07-04 No Snippets Bilgiç FŞ, Karaahmet AY, Alaybeyoğlu A.
Show Full Abstract

<h4>Objective</h4>The aim of this study was to determine the effect of umbilical cord clamping time and milking on blood parameters in preterm neonates.<h4>Methods</h4>A literature search was conducted between July and September 2024 in four databases. The search was performed using MeSH-based keywords.<h4>Results</h4>In this study, the results of 14 studies covering a total of 1,609 preterm neonates were analyzed. Follow-up after intervention showed no statistically significant difference in hemoglobin (standardized mean difference=0.22, 95%CI 0.04-0.48, Z=1.65, p=0.10) and bilirubin (standardized mean difference=0.22, 95%CI 0.30-0.74, Z=0.82, p=0.41) between the groups. There was a statistically significant difference in ferritin (standardized mean difference=0.73, 95%CI 0.30-1.15, Z=3.37, p=0.00008) and hematocrit (standardized mean difference=0.30, 95%CI 0.05-0.54, Z=2.41, p=0.02) values, and the effect size was positive. According to the subgroup analysis of the combined results of the studies, it was seen that there was no statistically significant difference in the adverse health outcomes in preterms (OR 0.92, 95%CI 0.74-1.15, Z=0.72, p=0.47).<h4>Conclusion</h4>From the analysis, it can be observed that late cord clamping and cord milking can prevent premature anemia by increasing hematocrit and ferritin formation in preterm newborns.

Also flagged:neuropsychiatric disorderspathogenesismethylbrain diseasesneurodevelopmental disordersautism spectrum disorder
Journal Article 2025-07-04 No Snippets Nohesara S, Mostafavi Abdolmaleky H, Pirani A, Thiagalingam S.
Show Full Abstract

Neuroinflammation is a hallmark of many neuropsychiatric disorders (NPD), which are among the leading causes of disability worldwide. Emerging evidence highlights the significant role of the gut microbiota (GM)-immune system-brain axis in neuroinflammation and the pathogenesis of NPD, primarily through epigenetic mechanisms. Gut microbes and their metabolites influence immune cell activity and brain function, thereby contributing to neuroinflammation and the development and progression of NPD. The enteric nervous system, the autonomic nervous system, neuroendocrine signaling, and the immune system all participate in bidirectional communication between the gut and the brain. Importantly, the interaction of each of these systems with the GM influences epigenetic pathways. Here, we first explore the intricate relationship among intestinal microbes, microbial metabolites, and immune cell activity, with a focus on epigenetic mechanisms involved in NPD pathogenesis. Next, we provide background information on the association between inflammation and epigenetic aberrations in the context of NPD. Additionally, we review emerging therapeutic strategies-such as prebiotics, probiotics, methyl-rich diets, ketogenic diet, and medications-that may modulate the GM-immune system-brain axis via epigenetic regulation for the prevention or treatment of NPD. Finally, we discuss the challenges and future directions in investigating the critical role of this axis in mental health.

ECI2
Also flagged:Prostate CancerCancercell proliferationorganellemitochondriaendoplasmic reticulum
Journal Article 2025-07-04 ✓ 5 Snippets Hussein MAF, Lismont C, Li H, Chai R, Claessens F, Fransen M.
In-Text Gene Mentions

…(ii) 2-enoyl-CoA isomerase (ECI2), also known as…

…of DECR2 andECI2, whereas those with…

…processed either byECI2alone or through…

…to peroxisomes, whileECI2and ECH1 are…

…and colleagues identifiedECI2as a key…

Show Full Abstract

Cancer is hallmarked by uncontrolled cell proliferation and enhanced cell survival, driven by a complex interplay of factors-including genetic and epigenetic changes-that disrupt metabolic and signaling pathways and impair organelle function. While the roles of mitochondria and the endoplasmic reticulum in cancer are widely recognized, emerging research is now drawing attention to the involvement of peroxisomes in tumor biology. Peroxisomes are essential for lipid metabolism, including fatty acid α- and β-oxidation, the synthesis of docosahexaenoic acid, bile acids, and ether lipids, as well as maintaining redox balance. Despite their critical functions, the role of peroxisomes in oncogenesis remains inadequately explored. Prostate cancer (PCa), the second most common cancer in men worldwide, exhibits a unique metabolic profile compared to other solid tumors. In contrast to the glycolysis-driven Warburg effect, primary PCa relies primarily on lipogenesis and oxidative phosphorylation. Peroxisomes are intricately involved in the metabolic adaptations of PCa, influencing both disease progression and therapy resistance. Key alterations in peroxisomal activity in PCa include the increased oxidation of branched-chain fatty acids, upregulation of α-methylacyl coenzyme A racemase (a prominent PCa biomarker), and downregulation of 1-alkyl-glycerone-3-phosphate synthase and catalase. This review critically examines the role of peroxisomes in PCa metabolism, progression, and therapeutic response, exploring their potential as biomarkers and targets for therapy. We also consider their relationship with androgen receptor signaling. A deeper understanding of peroxisome biology in PCa could pave the way for new therapies to improve patient outcomes.

Also flagged:waterflavonoidcholinesteraseAChEα-amylaseα-glucosidase
Journal Article 2025-07-04 No Snippets Nilofar N, Zengin G, Cetiz MV, Yildiztugay E, Cziáky Z, Jeko J, Ferrante C, Kostka T, Esatbeyoglu T, Dall'Acqua S.
Show Full Abstract

The current study investigates the chemical profiling, antioxidant activities, and enzyme inhibitory and cytotoxic potential of the water and methanolic extracts of different parts (flower, leaf, and bulb) of <i>Muscari armeniacum</i>. Chemical profiling was performed using UHPLC-MS/MS. At the same time, different in vitro assays were employed to support the results for antioxidant potential, such as DPPH, ABTS, FRAP, CUPRAC, metal chelation, and PBD, along with the measurement of total phenolic and flavonoid contents. Enzyme inhibition was investigated for cholinesterase (AChE and BChE), α-amylase, α-glucosidase, and tyrosinase enzymes. Additionally, the relative expression of NRF2, HMOX1, and YGS was evaluated by qPCR. LC-MS/MS analysis indicated the presence of some significant compounds, including apigenin, muscaroside, hyacinthacine A, B, and C, and luteolin. According to the results, the highest TPC and TFC were obtained with both extracts of the leaves, followed by the water extract (flower) and methanolic extract of the bulb. In contrast, the methanolic extract from the bulb exhibited the highest antioxidant potential using DPPH, ABTS, CUPRAC, and FRAP, followed by the extracts of leaves. In contrast, the leaf extracts had the highest values for the PBD assay and maximum chelation ability compared to other tested extracts. According to the enzyme inhibition studies, the methanolic extract from the bulb appeared to be the most potent inhibitor for all the tested enzymes, with the highest values obtained for AChE (1.96 ± 0.05), BChE (2.19 ± 0.33), α-amylase (0.56 ± 0.02), α-glucosidase (2.32 ± 0.01), and tyrosinase (57.19 ± 0.87). Interestingly, the water extract from the bulb did not inhibit most of the tested enzymes. The relative expression of <i>NRF2</i> based on qPCR analysis was considerably greater in the flower methanol extract compared to the other extracts (<i>p</i> < 0.05). The relative expression of HMOX1 was stable in all the extracts, whereas YGS expression remained stable in all the treatments and had no statistical differences. The current results indicate that the components of <i>M. armeniacum</i> (leaves, flowers, and bulb) may be a useful source of natural bioactive compounds that are effective against oxidative stress-related conditions, including hyperglycemia, skin disorders, and neurodegenerative diseases. Complementary in silico approaches, including molecular docking, dynamics simulations, and transcription factor (TF) network analysis for <i>NFE2L2</i>, supported the experimental findings and suggested possible multi-target interactions for the selected compounds.

SERPINC1
Also flagged:T-cell lymphoblastic lymphomaacute lymphoblastic leukemiaALLcoagulationTcerebral venous sinus thrombosis
Journal Article 2025-07-04 ✓ 3 Snippets Ahmed SAI, AlHanbali AS.
In-Text Gene Mentions

…Persistently lowATIIIlevels rendered heparin…

…day 21 post-PEG-Asp,ATIIIand fibrinogen levels…

…including antithrombin III (ATIII), protein C, and…

Show Full Abstract

Asparaginase is a cornerstone in the treatment of acute lymphoblastic leukemia (ALL) and its variant, T-cell lymphoblastic lymphoma (T-LBL), particularly in adolescents and young adults (AYA). However, its use is associated with a significant risk of thrombotic complications due to its profound effects on coagulation pathways. We report a catastrophic case of asparaginase-induced cerebral and systemic thrombosis in a previously healthy 20-year-old female with T-LBL. Despite prophylactic anticoagulation, the patient developed extensive cerebral venous sinus thrombosis, deep vein thrombosis, and pulmonary embolism, necessitating mechanical thrombectomy, Argatroban therapy, and long-term anticoagulation. This case underscores the multifactorial pathophysiology of asparaginase-associated thrombosis and highlights the need for individualized risk assessment, vigilant monitoring, and dynamic anticoagulation strategies. A comprehensive literature review is provided to contextualize the epidemiology, mechanisms, risk factors, prevention, and management of this life-threatening complication, with practical recommendations for optimizing care in high-risk patients.

Also flagged:pathogenesisprotein synthesiscancercardiovascular disordersviral infectionsaging
Journal Article 2025-07-04 No Snippets Chiglintseva DA, Patutina OA, Zenkova MA.
Show Full Abstract

The selective regulation of gene expression at the RNA level represents a rapidly evolving field offering substantial clinical potential. This review examines the molecular mechanisms of intracellular enzymatic systems that utilize single-stranded nucleic acids to downregulate specific RNA targets. The analysis encompasses antisense oligonucleotides and synthetic mimics of small interfering RNA (siRNA), microRNA (miRNA), transfer RNA-derived small RNA (tsRNA), and PIWI-interacting RNA (piRNA), elucidating their intricate interactions with crucial cellular machinery, specifically RNase H1, RNase P, AGO, and PIWI proteins, mediating their biological effects. The functional and structural characteristics of these endonucleases are examined in relation to their mechanisms of action and resultant therapeutic outcomes. This comprehensive analysis illuminates the interactions between single-stranded nucleic acids and their endonuclease partners, covering antisense inhibition pathways as well as RNA interference processes. This field of research has important implications for advancing targeted RNA modulation strategies across various disease contexts.

SOX6
Also flagged:ossificationbone formationIHHfibroblast growth factorFGFparathyroid hormone-related protein
Journal Article 2025-07-04 ✓ 1 Snippet Chen H, Cui Y, Li J, Duan M, Pi C, Zhou X, Xie J.
In-Text Gene Mentions

…with SOX5 andSOX6(termed the Sox…

Show Full Abstract

Fibroblast growth factor 19 (FGF19) has received increasing attention in metabolic disorders of the skeletal system, but its role in cartilage development is poorly understood. In the present study, we used <i>ex vivo</i> metatarsal organ model for nascent cartilage and an AAV-FGF19 overexpression model for adolescent growth plates to demonstrate the influence of FGF19 on cartilage development. We found that FGF19 could impair chondrocyte maturation at the neonatal stage and decrease growth plate thickness at the adolescent stage. FGF19 reduces chondrogenic differentiation of mesenchymal stem cells and the chondrocyte maturation via downregulation of Wnt/β-catenin signalling. FGF19-mediated chondrocyte maturation and cartilage differentiation require the participation of FGFR4 with the aid of β-klotho (KLB). FGF19 signalling entered the cytoplasm through FGFR4, activated the expression of SFRP1, WIF1 and DKK2, which are antagonists of β-catenin signalling, and hindered chondrocyte proliferation and cartilage growth. This study demonstrates for the first time that FGF19 inhibits cartilage development through the FGFR4/β-catenin axis, providing evidence for the vital role of FGF19 in growth plate chondrogenesis and endochondral ossification.

Also flagged:METTL16cancerregulation ofgene expressionmethylationcell proliferation
Journal Article 2025-07-04 No Snippets Qiu K, Zhong S, Liu J, Li W, Chen C, Li Y, Zeng C.
Show Full Abstract

The regulation of gene expression is pivotal in cancer development, with increasing emphasis on epigenetic modifications such as RNA methylation. N6-methyladenosine (m<sup>6</sup>A), the most abundant RNA modification, critically impacts RNA function and stability. METTL16, an m<sup>6</sup>A methyltransferase or "writer", is essential in this modification process. Aberrant expression of METTL16 is closely linked to cancer cell proliferation, invasion, metastasis, and drug resistance, through modulation of RNA metabolism. Despite extensive research on RNA-modifying enzymes, the specific mechanisms and roles of METTL16 in cancer remain poorly understood. This review provides a detailed examination of METTL16's functions and regulatory mechanisms in cancer, emphasizing its m<sup>6</sup>A-dependent and m<sup>6</sup>A-independent roles in regulating RNA stability and function. Furthermore, it proposes that targeting METTL16 represents a promising avenue for cancer therapy.

Research Square 2025-07-04 Preprint (No Snippets API) Kuuskmäe C, Mikheim K, Mohammadrahimi N, Kilk K, Kaare M, Jayaram M, Ilnitski G, Leidmaa E, Philips M, Vasar E.
Show Full Abstract

<title>Abstract</title> <p> The NEGR1 gene has been implicated in several psychiatric disorders, and increased NMDA receptor binding density has been demonstrated <italic>in vitro</italic> in hippocampal slices from <italic>Negr1</italic> -deficient mice. In this study, we expanded on these findings by investigating the behavioural response to NMDA receptor antagonism, expression of NMDA receptor subunits, and kynurenine pathway metabolites in a <italic>Negr1</italic> -deficient mouse model. Male and female wild-type and <italic>Negr1</italic> -deficient mice received daily injections of MK-801, a non-competitive NMDA receptor antagonist, until behavioural tolerance developed in the open field test (after 9 days in males and 5 days in females). In drug-naive animals, acute MK-801 administration (0.2 mg/kg) elicited a stronger motor response in <italic>Negr1</italic> -deficient males compared to wild-type controls. However, with repeated dosing, <italic>Negr1</italic> -deficient males exhibited a blunted behavioural response and attenuated progression of rapid behavioural tolerance during every-second-day MK-801 administration, suggesting altered receptor sensitivity. Gene expression analysis revealed sex- and brain region-specific changes in NMDA receptor subunit expression. Additionally, kynurenine pathway metabolites showed genotype- and sex-dependent alterations. These findings suggest that Negr1 modulates NMDA receptor function and tryptophan metabolism in a sex-dependent manner, highlighting the importance of considering both genetic background and sex in models of glutamatergic dysfunction relevant to neuropsychiatric disorders. </p>

DCC
Also flagged:cognitionmental health disordersanxietydepressionbehavioralnucleus
Journal Article 2025-07-03 ✓ 2 Snippets Goodpaster CM, Christensen CR, Alturki MB, DeNardo LA.
In-Text Gene Mentions

…in colorectal cancer (DCC) and netrin-1 are…

…adolescence (P22–31) disruptedDCC/netrin-1 signaling and led…

Show Full Abstract

The medial prefrontal cortex (mPFC) plays an essential role in cognition and emotional regulation. The mPFC undergoes an extended development that is regulated by both genetic programs and activity-dependent processes. During this time, experiences feedback on developing mPFC circuits, allowing individuals to develop nuanced, age-appropriate responses to their environment. However, this protracted development also opens an extended window when adverse experiences such as neglect or maltreatment can alter the trajectory of mPFC development, leading to the emergence of mental health disorders like anxiety and depression. These disorders are characterized by excessive avoidance of perceived threats and impaired emotional regulation. These behavioral functions are encoded in the activity of mPFC neural circuits, particularly in mPFC connections with limbic centers like the basolateral amygdala and nucleus accumbens. To understand how mental health disorders emerge, it is critical to understand how frontolimbic circuits typically develop, and how early life adversity can alter their development. Here we review recent studies that examined the synaptic, cellular, and circuit development of frontolimbic circuits and the underlying molecular and activity-dependent mechanisms. We then review studies that measured the effects of early life stress on mPFC maturation and discuss the implications for therapeutic strategies.

Also flagged:EpilepsydeathLevetiracetamsynaptic vesicle glycoprotein 2Ametabolismcytochrome P450
Journal Article 2025-07-03 No Snippets Al Faysal A, Şenel P, Erdoğan T, Gölcü A.
Show Full Abstract

Levetiracetam (LEV) is an innovative antiepileptic medication utilized for the management of diverse seizure types associated with epilepsy. The present study aims to elucidate the molecular interaction mechanisms between LEV and fish sperm DNA (dsDNA) through a combination of spectroscopic techniques, viscosity measurements, and molecular docking analyses. Spectroscopic investigations, including UV absorption and fluorescence, confirm the formation of a complex between LEV and dsDNA. The groove binding process is indicated by the measured binding constant. Viscosity, dye-displacement test, and DNA thermal denaturing investigations are used to confirm these results. Docking studies further verify the results, which show that LEV is linked to the minor groove of dsDNA. Furthermore, an LEV-dsDNA biosensor for low-concentration LEV detection using the differential pulse voltammetry technique is created. A sensitive determination of LEV in pH 4.80 acetate buffer is made possible by the voltammetric examination of the peak current drop in the deoxyguanosine (dGuo) oxidation signals that resulted from the interaction between LEV and dsDNA. The oxidation signals of dGuo demonstrate a linear correlation within the concentration range of 2.5-20 μM LEV. The limit of detection and limit of determination are found to be 0.70 and 2.31 μM, respectively.

HFE
Also flagged:reverse transcriptionchondrogenesisrelatedextracellularproteoglycanscollagen
Journal Article 2025-07-03 ✓ 1 Snippet Ekholm J, Vukusic K, Brantsing C, Shaw G, Ur Rehman Bhatti F, Simonsson S, Falk A, Murphy M, Rotter Sopasakis V, Lindahl A.
In-Text Gene Mentions

…metabolic disorders (e.g.,hemochromatosis, diabetes), congenital joint…

Show Full Abstract

<i>Background.</i> Post-traumatic chondral and osteochondral lesions can be treated with autologous chondrocyte implantation (ACI), but the high cost of autologous cell expansion under strict Good Manufacturing Practice (GMP) regulations limits patient access. Stem cell-based advanced therapy medicinal products (ATMPs) offer more cost-effective alternatives, with human induced pluripotent stem cells (iPSC) showing great promise due to their expandability, low immunogenicity, commercialization potential, and fewer ethical concerns. <i>Aim.</i> To develop a protocol to direct iPSC through a mesenchymal stage into chondroprogenitors (iCHOp), resembling autologous chondroprogenitor cells used in ACI. <i>Methods.</i> The derived chondroprogenitor cells were expanded in monolayer and in 3-dimensional (3D) cultures and subsequently analyzed using transcriptomic profiling via RNA sequencing and reverse transcription quantitative polymerase chain reaction and compared with ACI chondrocytes. <i>Results.</i> Transcriptomic profiling confirmed successful differentiation, with iCHOp showing 83% similarity to ACI chondrocytes. Further 3D culture maturation led to upregulation of chondrogenesis-related genes and activation of cartilage-specific pathways. Histological analysis confirmed extracellular matrix production, including proteoglycans, collagen, and versican. Furthermore, the protocol's reproducibility was demonstrated using 3 distinct iPSC lines, successfully expanded in both serum-containing and defined serum-free media. <i>Conclusion.</i> Our optimized approach yields iCHOp with phenotypes closely matching ACI chondrocytes, offering a solid foundation for further development and potential clinical applications in cartilage repair.

CACNA1E
Also flagged:membraneGM2 gangliosidosesGlycosphingolipidssialic acidsgangliosidesganglioside
Journal Article 2025-07-03 ✓ 2 Snippets Nicholson AS, Priestman DA, Antrobus R, Williamson JC, Bush R, McKie SJ, Barrow HG, Smith E, Dobrenis K, Bright NA, Platt FM, Deane JE.
In-Text Gene Mentions

…GM2 gangliosidoses includingCACNA1E, CACNG8 and synaptotagmin…

CACNA1Eis a subunit…

Show Full Abstract

Glycosphingolipids (GSL) are important bioactive membrane components. GSLs containing sialic acids, known as gangliosides, are highly abundant in the brain and diseases of ganglioside metabolism cause severe early-onset neurodegeneration. The ganglioside GM2 is processed by β-hexosaminidase A and when non-functional GM2 accumulates causing Tay-Sachs and Sandhoff diseases. We have developed i3Neuron-based disease models demonstrating storage of GM2 and severe endolysosomal dysfunction. Additionally, the plasma membrane (PM) is significantly altered in its lipid and protein composition. These changes are driven in part by lysosomal exocytosis causing inappropriate accumulation of lysosomal proteins on the cell surface. There are also significant changes in synaptic protein abundances with direct functional impact on neuronal activity. Lysosomal proteins are also enriched at the PM in GM1 gangliosidosis supporting that lysosomal exocytosis is a conserved mechanism of PM proteome change in these diseases. This work provides mechanistic insights into neuronal dysfunction in gangliosidoses highlighting that these are severe PM disorders with implications for other lysosomal and neurodegenerative diseases.

SERPINC1
Also flagged:tumordeathgliomaintracranial infectionlymphomapathogenesis
Journal Article 2025-07-03 ✓ 2 Snippets Ma Q, Zhang M, Fan Y, Zhao H, Wang K, Wang X, Mu Y.
In-Text Gene Mentions

…the expression ofantithrombin-III(P01008) and complement…

…the increase ofantithrombin-III(P01008) expression could…

Show Full Abstract

Thiol compounds can serve as markers for the antioxidant and prognostic status of lymphoma, playing a crucial role in early tumor diagnosis. However, their high polarity and lack of chromophores pose challenges for multivariate analysis. This study aims to measure thiols associated proteins and develop novel diagnostic models in serum and cerebrospinal fluid from PCNSL to verify potential association and early warning effectiveness. A highly sensitive and selective method was established for simultaneous determination of 7 different thiols and 340 related proteins based on self-developed mass spectrometry probe, Br-OTPP labeled by UHPLC-HRMS. Furthermore, a novel PCNSL monitoring model was developed based on different those combined with machine learning algorithm. Thiols has good linear relationship with correlation coefficients ≥ 0.9995 and suitable precision with inter-day and intra-day coefficients variation was 2.08-5.49% and 1.58-5.53%. Satisfactory accuracy with recoveries between 85.28 and 97.88% was observed. The limit of detection (S/N = 3) was 0.8-9.0 fmol. Ultimately, this method greatly improves discrimination efficiency of model with accuracy of 98.83%. The proposed method could successfully apply into measurement of thiols associated proteins and development of multi-omics clinical evaluation model for PCNSL patients.

SOX6
Also flagged:sorafenibhepatocellular carcinomamultikinasecell growthangiogenesisaquaglyceroporin-7
Journal Article 2025-07-03 ✓ 1 Snippet He G, Shao W, Wang W, Sun L, Gao B, Wei J.
In-Text Gene Mentions

…TRPS1, TBX19, andSOX6(Fig. S4 A).…

Show Full Abstract

Sorafenib, a multikinase inhibitor targeting cell growth and angiogenesis, was approved for advanced unresectable hepatocellular carcinoma (HCC) in 2007. This investigation aims to elucidate the involvement of aquaglyceroporin-7 (AQP7) in regulating sorafenib resistance (SR) in HCC. AQP7 was downregulated in HCC-SR cells. AQP7 upregulation inhibited lipid accumulation, enhanced the sorafenib sensitivity of SR cells, and improved immune evasion. TBX19 protein was elevated in HCC-SR cells, and TBX19 repressed AQP7 transcription by binding to its promoter. E3-ubiquitin ligase MGRN1 was reduced in HCC, and its overexpression promoted TBX19 degradation. MGRN1 overexpression enhanced AQP7 and improved SR and immune evasion in HCC, which was reversed by TBX19 overexpression. Mouse HCC cells Hepa1-6 were used to construct an orthotopic tumor model and to analyze the effects of AQP7 and MGRN1 expression on the in vivo antitumor effects of Sorafenib, lipid accumulation in tumor tissues, and immune cell infiltration. MGRN1 silencing in Hepa1-6 cells induced sorafenib resistance and created an immunosuppressive tumor microenvironment, which was repressed by AQP7 upregulation. In conclusion, MGRN1 loss in HCC-SR cells blocked TBX19 degradation and strengthened TBX19-mediated AQP7 repression, leading to immune evasion. Targeting this signaling might offer a promising therapeutic strategy to overcome SR in HCC.

SUDS3
Also flagged:Cancerimmune responsechromatinp53prostate cancerDNMT
Journal Article 2025-07-03 ✓ 1 Snippet Patel D, Tiusanen V, Karttunen K, Pihlajamaa P, Sahu B.
In-Text Gene Mentions

…that recruits repressivechromatin modifiermodifier enzymes (CME)…

Show Full Abstract

Derepression of transposable elements (TE) by epigenetic therapy leads to the activation of immune response in cancer cells. However, the molecular mechanism of TE regulation by distinct chromatin modifier enzymes (CME) in context of p53 is still elusive. Here, we used FDA-approved epigenetic drugs to systematically inhibit distinct CMEs in p53 wild-type and p53-mutant colorectal, esophageal, and prostate cancer cells. We show that distinct TE subfamilies are derepressed by inhibition of different CMEs in cell type-specific manner. Co-inhibition of DNMT and HDAC (DNMTi-HDACi) had the most consistent effect across cancer types. Loss of p53 results in stronger TE activation and TE-chimeric transcript expression and this effect is largely mediated by the non-genomic actions of p53. Robust immune response elicited by DNMTi-HDACi is due to induced inverted repeat Alu expression concomitant with reduced ADAR1-mediated Alu RNA editing. Collectively, our systematic analyses provide insights for rational use of epigenetic therapies in distinct cancers.

PEBP1
Also flagged:CUGBP Elav-like familyheart failureCELF4RNA-binding proteintumorTGF-β1
Journal Article 2025-07-03 ✓ 2 Snippets Zhang X, Wang J, Li J, Lu Q, Xu W, Zhuang J, Tang B.
In-Text Gene Mentions

…the 3’UTR ofPEBP1, thereby inhibiting the…

…the 3’UTR ofPEBP1and VEGFA respectively.…

Show Full Abstract

<h4>Background</h4>Cardiac fibrosis exerts a lasting influence on the development of heart failure (HF), whereas there is no specific and effective therapeutic strategy to combat cardiac fibrosis.<h4>Objectives</h4>CUGBP Elav-like family member 4 (CELF4), an RNA-binding protein, influences tumor progression through post-transcription regulation, while the role of CELF4 in HF remains elusive.<h4>Methods</h4>Transverse aortic constriction (TAC) was applied to induce pressure overload-induced cardiac remodeling in 6-week-old male mice. Global CELF4 knockout (CELF4<sup>-/-</sup>) mice were generated and littermate wild-type (CELF4<sup>+/+</sup>) mice were used as control. Primary mouse cardiac fibroblasts (CFs) were isolated and used to determine the cellular and molecular mechanisms of CELF4.<h4>Results</h4>The mRNA expression of CELF4 was significantly upregulated in mouse failing heart after TAC. In vitro experiments showed that CELF4 was specifically induced by TGF-β1 in CFs, but no change was observed in cardiomyocytes. CELF4 deficiency attenuated cardiac fibrosis and preserved the functions of pressure overload-induced hearts. We observed that depletion of CELF4 markedly reduced CF proliferation and migration induced by TGF-β1. Furthermore, depletion of CELF4 alleviated Collagen I and α-SMA expression in CFs as determined by western blots. Using RNA pull-down and Luciferase assay, we found an intrinsic binding of CELF4 with 3'UTR of flavin containing monooxygenase 2 (FMO2), which blunted the phosphorylation of Smad2/3 in CFs after TGF-β1 stimulation.<h4>Conclusion</h4>Our study delineates that decreased CELF4 retards cardiac fibrosis and HF via interaction with FMO2 and suppression of Smad2/3 signaling. Inhibition of CELF4 may become a potential therapy target for cardiac fibrosis and HF.

Also flagged:autophagyNeuroblastomaNBsolid tumoradaptive immunitycancer
Journal Article 2025-07-03 No Snippets De Mitri F, Giansanti M, Melaiu O, Haas D, Ebert S, Tumino N, Vulpis E, Gatto F, Martuscelli B, Antonioli M, Sangiuliano E, Caruso S, Scarsella M, De Stefanis C, Marabitti V, Campello S, Fruci D, Vacca P, Caruana I, Nazio F.
Show Full Abstract

Neuroblastoma (NB) is the most common extracranial solid tumor in children characterized by poor immune infiltration and resistance to adaptive immunity, contributing to its limited response to immunotherapy. A key mechanism underlying immune evasion in cancer is autophagy, a cellular process that plays many roles in cancer by supporting tumor survival and regulating immune interactions. In this study, we investigate the impact of autophagy inhibition on NB tumor growth, immune modulation, and the efficacy of immunotherapy. Using both murine and human NB cell lines, we demonstrate that genetic and pharmacological inhibition of autophagy significantly reduces 3D spheroid growth and upregulates major histocompatibility complex class I (MHC-I) expression. In vivo studies further confirm that targeting autophagy suppresses tumor progression and promotes immune infiltration into the tumor. Notably, we observe a significant increase in CD8<sup>+</sup> T cell recruitment and activation, suggesting that autophagy inhibition reshapes the immune landscape of NB, rendering it more susceptible to immune-mediated clearance. Crucially, autophagy inhibition also sensitizes NB cells to T cell-mediated cytotoxicity and enhances the therapeutic efficacy of GD2.CAR T-cell therapy. In vitro co-culture assays reveal increased CAR T cell-mediated tumor killing upon autophagy blockade, while in vivo models show prolonged tumor control and improved survival in treated mice compared to CAR T-cell therapy alone. These findings highlight autophagy as a key regulator of immune evasion in NB and suggest that its inhibition could serve as a promising therapeutic strategy to enhance immune recognition and improve the efficacy of immunotherapy.

HFE
Also flagged:Gaucher diseaselysosomal disorderType 1 GDglucocerebrosidasebone diseaseParkinson's disease
Journal Article 2025-07-03 ✓ 1 Snippet Camou F, Berger MG.
In-Text Gene Mentions

…Associatedhemochromatosiscan be investigated…

Show Full Abstract

Knowledge about Gaucher disease (GD), considered a model for rare diseases, has considerably increased since its discovery. The pathophysiology of this lysosomal disorder is better known, and specific therapies that can control many aspects of the disease have been developed, particularly for the most common form, Type 1 GD. Yet, in part because of the rarity of GD, but also because of a lack of awareness by physicians, diagnostic delay too often leads to a belated management of patients having accumulated comorbidities. Gaucher cells, the most visible consequence of glucocerebrosidase deficiency, have been known for many years. However, the pathophysiological mechanisms underlying some major lesions, such as bone disease, predisposition to Parkinson's disease in Type 1 GD, or neurological involvement in Type 2 and Type 3 GD, remain poorly understood. Diagnostic, therapeutic, and follow-up issues associated with these symptoms remain critical to optimize the care of these patients. In this review, clinical characteristics, pathophysiology, diagnosis, treatment, and prognosis of GD are successively considered, highlighting for each of them the remaining challenges. Continued efforts to better understand pathophysiological mechanisms, use of the most modern methods such as artificial intelligence, international collaboration, and development of new therapeutic strategies seem essential for the future of this rare disease.

Also flagged:xanthoneEumitrin Lacetonedepsidonesdibenzofuranphenolics
Journal Article 2025-07-03 No Snippets Phan HV, Hoang LT, Trung DG, Nguyen-Si HV, Dong PS, Nguyen VK, Vo TM, Sangvichien E, Chavasiri W, Le HTT.
Show Full Abstract

Eumitrin L (<b>1</b>), a new dimeric xanthone, was isolated from the crude acetone extract of the lichen <i>U. baileyi</i>, together with 13 known compounds, including one dimeric xanthone (<b>2</b>), five depsidones (<b>3-7</b>), two depsides (<b>8-9</b>), one dibenzofuran (<b>10</b>) and four mono phenolics (<b>11-14</b>). Spectroscopic analyses (1D, 2D NMR), compared to related references, were employed for structural elucidation, while DP4 probability and ECD spectrum helped identify the absolute configuration of <b>1</b>. Bioactivity evaluation of the isolated compounds revealed <b>6</b>, <b>7</b>, <b>8</b>, <b>11</b> as active tyrosinase inhibitors, and <b>3</b>, <b>10</b>, <b>13</b>, <b>14</b> as significant antioxidants. Among them, protocetraric acid (<b>6</b>) (IC<sub>50</sub> 37.86  μM) and usnic acid (<b>10</b>) (IC<sub>50</sub> 15.92  μM) were found as the most active components. Molecular docking simulation on these two compounds further confirmed their notable activities, based on effective H-bond formation and excellent binding energy with the tyrosinase protein (2Y9X), and DPPH proteins (2CDU and 3RP8), respectively.

Also flagged:Rhabdomyosarcomapediatric cancermyogenesisPAX3FOXO1transcription factor
Journal Article 2025-07-03 No Snippets Kucinski J, Tallan A, Taslim C, Vontell AM, Silvius KM, Wang M, Cannon MV, Stanton BZ, Kendall GC.
Show Full Abstract

Fusion-positive rhabdomyosarcoma is an aggressive pediatric cancer molecularly characterized by arrested myogenesis. The defining genetic driver, PAX3::FOXO1, encodes a chimeric gain-of-function transcription factor. An incomplete understanding of the in vivo chromatin regulatory mechanisms of PAX3::FOXO1 has hindered therapeutic development. Here, we establish a PAX3::FOXO1 zebrafish injection model and a semi-automated ChIP-seq normalization strategy to evaluate how PAX3::FOXO1 initially interfaces with and modulates chromatin in a developmental context. We find that PAX3::FOXO1 interacts with inaccessible chromatin through partial/homeobox motif recognition consistent with pioneering activity. However, PAX3::FOXO1-genome binding through a composite paired box/homeobox motif alters chromatin accessibility and redistributes H3K27ac to activate neural transcriptional programs. We uncover neural signatures that are highly representative of clinical rhabdomyosarcoma gene expression programs that are enriched following chemotherapy. Overall, we identify partial/homeobox motif recognition as a key mode for PAX3::FOXO1 pioneer function and identify neural signatures as a potentially critical PAX3::FOXO1 tumor initiation event.

LRRC7
Also flagged:gene expressionamino acidsshort-chainfatty acidsacetic acidpropionic acid
Journal Article 2025-07-03 ✓ 2 Snippets Schäfer L, Grundmann SM, Hepp V, Herrero-Encinas J, Rühl M, Most E, Ringseis R, Eder K.
In-Text Gene Mentions

…less well-characterized genesleucine-rich repeat-containing 7repeat-containing 7 (…

…repeat-containing 7 (LRRC7), neuron-specific gene…

Show Full Abstract

Mushrooms, the fruiting bodies of edible fungi, are widely used as food for humans. However, their potential, as well as that of fungal mycelia, as feed components for poultry is less acknowledged. Recent studies have shown that feeding the vegetative mycelium of Pleurotus sapidus does not affect growth performance or nutrient digestibility and causes only minimal changes in the cecal microbiota structure, liver transcriptome, and plasma metabolome of broilers. The present study aimed to comprehensively investigate the effects of feeding the fruiting bodies of P. sapidus on performance metrics, ileal nutrient digestibility, cecal microbiota composition, cecal integrity, liver transcriptome, and the expression of genes involved in protein turnover in breast muscle of broilers. A total of 72 male, 1-day-old Cobb 500 broilers were randomly assigned to three groups and fed three distinct diets containing either 0 g (PSA-F0), 25 g (PSA-F25), or 50 g (PSA-F50) of freeze-dried P. sapidus fruiting bodies per kg diet in a 35-day, three-phase feeding regimen. Final body weights and weight gain during the finisher and the whole period were significantly lower in groups PSA-F50 and PSA-F25 compared to group PSA-F0 (P < 0.05). Feed intake during the finisher and the whole period tended to be lower in groups PSA-F50 and PSA-F25 compared to group PSA-F0 (P < 0.1). Average daily apparently digested amounts of most indispensable amino acids were lower in group PSA-F50 than in group PSA-F0 (P < 0.05). Cecal microbial α-diversity indicators (Chao1 and Richness) were significantly higher in the PSA-F50 group compared to the PSA-F0 group (P < 0.05), whereas β-diversity indicators were similar between groups. Taxonomic analysis showed a higher abundance of the class Bacilli and the species unknown_Erysipelatoclostridium and a lower abundance of the class Clostridia in the PSA-F50 group compared to the PSA-F0 group (P < 0.05). Concentrations of total and individual short-chain fatty acids, including acetic acid and propionic acid, in the cecal digesta were lower in the PSA-F50 group compared to the PSA-F0 group (P < 0.05). A total of 66 differentially expressed transcripts were identified in the liver between PSA-F50 and PSA-F0 groups based on filter criteria (FC > 1.3 or FC < -1.3, P < 0.05). The mRNA levels of genes involved in critical pathways such as protein synthesis and degradation-including the mammalian target of rapamycin pathway, myogenesis, the ubiquitin-proteasome system, autophagy-lysosomal pathway, and GCN2/eIF2α pathway-did not vary across the groups. Plasma lipopolysaccharide concentration was similar across all groups. The mRNA levels of CLDN3, MUC2, and MUC5AC were elevated in the PSA-F50 group compared to the PSA-F0 group (P < 0.05), while mRNA levels of CLDN5, OCLN, MUC13, and several pro-inflammatory genes in cecal mucosa remained unchanged across groups. The observed impairment in growth performance suggests that P. sapidus fruiting bodies cannot be recommended as dietary components for broilers at the tested doses. Considering the higher β-glucan content of fruiting bodies compared to vegetative mycelia, the negative effects observed on broiler performance may be associated with their β-glucan content.

Also flagged:dementiasynaptic vesiclesmembranesynaptopathiesadult-onset neuronal ceroid lipofuscinosisexocytosis
Journal Article 2025-07-03 No Snippets Rosene MJ, Benitez BA.
Show Full Abstract

The maintenance of protein homeostasis and overall protein quality control dysfunction are associated with dementia. Cysteine string protein α (CSPα) is an endolysosomal cochaperone that facilitates the fusion of secretory and synaptic vesicles to the cell membrane. CSPα interacts with multiple proteins related to the proteostasis network and exocytic pathways and is often dysfunctional in synaptopathies. Since the initial discovery of CSPα 30 years ago, subsequent research has demonstrated a protective role of CSPα, especially in synaptic maintenance. However, the discovery of heterozygous CSPα mutations in 2011 causing adult-onset neuronal ceroid lipofuscinosis (ANCL) shifted the back-then prevalent dogma of unique synaptic function to include an endolysosomal role for CSPα. Recently, CSPα has been involved in the exocytosis of aggregate-prone proteins through either the misfolding-associated protein secretion (MAPS) or unconventional secretory pathways linking the molecular mechanism of rare and common neurodegenerative diseases. Here, we propose a novel molecular and pathophysiological model of CSPα-associated dementia, outline the increasing evidence of a broader role of CSPα in neurodegeneration, propose the role of CSPα in the synaptic secretion of neurodegenerative-associated proteins, and discuss the modulation of CSPα as a molecular target for common dementias.

SERPINC1
Also flagged:infectionsimmune responsebeta-2-microglobulinalpha-2-HS-glycoproteincoagulationalpha-1-antiproteinase S-1
Journal Article 2025-07-03 ✓ 5 Snippets Duangurai T, Reamtong O, Thiangtrongjit T, Jala S, Chienwichai P, Thengchaisri N.
In-Text Gene Mentions

…S-glycoprotein), coagulation (antithrombin-III, alpha-1-antiproteinase S-1),…

…included beta-2-microglobulin,antithrombin-III, retinol-binding proteins, an…

…of proteins likeantithrombin-IIIand sprouty homolog…

…The overexpression ofantithrombin-III, as seen in…

…For example,antithrombin-IIIwas upregulated in…

Show Full Abstract

<i>Encephalitozoon cuniculi</i> causes both clinical and subclinical infections in rabbits, complicating a diagnosis due to the limitations of conventional tools like ELISA. This study analyzes serum proteomic profiles across clinical, subclinical, and healthy rabbits to identify discriminatory biomarkers. Serum from 90 pet rabbits (30 per group) was pooled (10 samples per pool, 3 pools per group) and analyzed using one-dimensional gel electrophoresis and mass spectrometry. The proteomic analysis revealed 109, 98, and 74 proteins expressed in healthy, subclinical, and clinical groups, respectively. Of these, 50, 40, and 33 proteins were unique to the healthy, subclinical, and clinical groups, respectively, with only 10 proteins shared across all. A total of 88 proteins were differentially expressed in infected groups compared to healthy controls. Importantly, 12 proteins were consistently upregulated in both subclinical and clinical infections. These include markers related to the immune response (beta-2-microglobulin, alpha-2-HS-glycoprotein), coagulation (antithrombin-III, alpha-1-antiproteinase S-1), vitamin A transport (retinol-binding proteins), lipid metabolism (apolipoprotein C-III), cytoskeletal regulation (actin-depolymerizing factor), extracellular matrix integrity (fibrillin 2), and oxidative stress (monooxygenase DBH-like 1). Additionally, Gc-globulin and ER lipid-raft-associated 1 were linked to immune modulation and signaling. These findings identify specific serum proteins as promising biomarkers for distinguishing subclinical from clinical encephalitozoonosis in rabbits, enabling an early diagnosis and effective disease monitoring.

DCC
Also flagged:TumorNATCEABCL-2Ku70EGFR
Journal Article 2025-07-03 ✓ 3 Snippets Machado Carvalho JV, Meyer J, Ris F, Durham A, Bornand A, Ricoeur A, Corrò C, Koessler T.
In-Text Gene Mentions

…APAF-1, BCL2, CD34,DCC, EGFR, GLUT-1, HER2,…

…for APAF-1, CD-34,DCC, GLUT-1, HER-2, MMR…

…Circulating tumor DNADCCDeleted in colon…

Show Full Abstract

<b>Background/Objectives:</b> Treatment of locally advanced rectal cancer (LARC) very often requires a neoadjuvant multimodal approach. Neoadjuvant treatment (NAT) encompasses treatments like chemoradiotherapy (CRT), short-course radiotherapy (SCRT), radiotherapy (RT) or a combination of either of these two with additional induction or consolidation chemotherapy, namely total neoadjuvant treatment (TNT). In case of complete radiological and clinical response, the non-operative watch-and-wait strategy can be adopted in selected patients. This strategy is impacted by a regrowth rate of approximately 30%. Predicting biomarkers of tumor response to NAT could improve guidance of clinicians during clinical decision making, improving treatment outcomes and decreasing unnecessary treatment exposure. To this day, there is no validated biomarker to predict tumor response to any NAT strategies in clinical use. Most research focused on CRT neglects the study of other regimens. <b>Methods</b>: We conducted a narrative literature review which aimed at summarizing the status of biomarkers predicting tumor response to NAT other than CRT in LARC. <b>Results</b>: Two hundred and fourteen articles were identified. After screening, twenty-one full-text articles were included. Statistically significant markers associated with improved tumor response pre-treatment were as follows: low circulating CEA levels; BCL-2 expression; high cellular expression of Ku70, MIB-1(Ki-67) and EGFR; low cellular expression of VEGF, hPEBP4 and nuclear β-catenin; the absence of TP53, SMAD4, KRAS and LRP1B mutations; the presence of the G-allel of LCS-6; and MRI features such as the conventional biexponential fitting pseudodiffusion (Dp) mean value and standard deviation (SD), the variable projection Dp mean value and lymph node characteristics (short axis, smooth contour, homogeneity and Zhang et al. radiomic score). In the interval post-treatment and before surgery, significant markers were as follows: a reduction in the median value of circulating free DNA, higher presence of monocytic myeloid-derived suppressor cells, lower presence of CTLA4+ or PD1+ regulatory T cells and standardized index of shape changes on MRI. <b>Conclusions</b>: Responders to neoadjuvant SCRT and RT tended to have a tumor microenvironment with an immune-active phenotype, whereas responders to TNT tended to have a less active tumor profile. Although some biomarkers hold great promise, scarce publications, inconsistent results, low statistical power, and low reproducibility prevent them from reliably predicting tumor response following NAT.

Also flagged:acute myeloid leukemiaAMLKDM6Alysine demethylase 6Achromatingene expression
Journal Article 2025-07-03 No Snippets Zhao Y, Niu L, Yang S, Yu L, Zhao T, Jiang H, Xu L, Wang Y, Zhang X, Huang X, Jiang Q, Tang F.
Show Full Abstract

<b>Background/Objectives</b>: The role of <i>KDM6A</i> gene mutations in acute myeloid leukemia (AML) remains poorly understood. This study aimed to evaluate the impact of <i>KDM6A</i> mutations on relapse risk, cumulative incidence of relapse (CIR), relapse-free survival (RFS), and overall survival (OS) in adult AML patients, with a particular focus on those with <i>RUNX1::RUNX1T1</i> fusion. <b>Methods</b>: the retrospective analysis was conducted on 1970 adult AML patients treated at Peking University People's Hospital. Of these, 1676 patients who achieved complete remission (CR) were included. Among them, 27 harbored <i>KDM6A</i> mutations. Propensity score matching (PSM) was used (1:10 ratio) to compare outcomes between patients with and without <i>KDM6A</i> mutations. Further analysis focused on 207 patients with <i>RUNX1::RUNX1T1</i> fusion, among whom 13 had <i>KDM6A</i> mutations (PSM 1:5). <b>Results</b>: In the overall cohort, <i>KDM6A</i> variants (<i>n</i> = 27) had a higher 2-year CIR (45.7% vs. 28.6%, <i>p</i> = 0.04). Fine-Gray analysis showed <i>KDM6A</i> variants independently increased relapse risk (HR = 1.98 [1.08-3.63], <i>p</i> = 0.03). <i>KDM6A</i> mutations were associated with inferior 2-year RFS (36.3% vs. 60.9%, <i>p</i> = 0.044). Multivariable analysis confirmed <i>KDM6A</i> mutations as independent predictors of poor RFS (HR = 3.08 [1.56-6.08], <i>p</i> = 0.001). Among <i>RUNX1::RUNX1T1</i> patients, <i>KDM6A</i> mutations significantly increased relapse risk (75.0% vs. 21.7%, <i>p</i> < 0.001), raised 2-year CIR (46.9% vs. 24.0%, <i>p</i> = 0.05), worsened 2-year RFS (31.3% vs. 71.9%, <i>p</i> < 0.001), and lowered 2-year OS (63.3% vs. 86.4%, <i>p</i> = 0.002). They were also independent predictors of CIR (HR = 2.46 [1.11-5.47], <i>p</i> = 0.03), RFS (HR = 5.1, [2.5-10.5], <i>p</i> < 0.001) and OS (HR = 12.9, [4.3-38.7], <i>p</i> < 0.001). <b>Conclusions</b>: <i>KDM6A</i> mutations are significantly associated with increased relapse risk and poor prognosis in AML, especially in patients with <i>RUNX1::RUNX1T1</i> fusion, and may serve as a valuable prognostic biomarker.

Also flagged:Synthesisfloridosideacylatedinflammatory responsesthioglycosideglycerol
Journal Article 2025-07-03 No Snippets Pinheiro L, Cipriano C, Santos F, Máximo P, Fernandes E, Freitas M, Branco PS.
Show Full Abstract

Floridoside (2-<i>O</i>-D-glycerol-<i>α</i>-D-galactopyranoside) is a natural product typically found in red algae. It serves as the algae's carbon reserve and is produced as a protective response against osmotic and heat stress. Both floridoside and its acylated derivatives have been associated with modulating redox homeostasis and inflammatory responses. Therefore, we aimed to evaluate whether the newly synthesized floridoside phosphotriesters (<b>1b</b>-<b>1d</b>, <b>1f</b>-<b>1h</b>) and acylated floridoside derivative (<b>1e</b>) can modulate the oxidative burst in stimulated human neutrophils. Synthetic strategies included the glycosylation of the thioglycoside donor with glycerol derivatives, having NIS/TfOH as the promoter. Phosphorylation was achieved with POCl<sub>3</sub> in the presence of pyridine. The compounds were analysed for their cytotoxicity, with <b>1b</b> and <b>1h</b> being cytotoxic at 50 μM, while the others showed no cytotoxicity in the tested concentrations. The detection of the neutrophils' oxidative burst was performed using multiple probes [luminol, aminophenyl fluorescein (APF), and Amplex Red (AR)] to evaluate reactive species levels. Compound <b>1e</b> prevented the oxidative burst in activated human neutrophils (IC<sub>50</sub> = 83 ± 7 μM). All the other tested compounds were ineffective in inhibiting APF and AR oxidation under the present experimental conditions. These findings highlight the potential of floridoside-based derivatives as candidates for targeting inflammatory pathways.

HFE
Also flagged:OsteoarthritisPathogenesisOAdegenerative joint diseasecartilagedegradation
Journal Article 2025-07-03 ✓ 2 Snippets Iantomasi T, Aurilia C, Donati S, Falsetti I, Palmini G, Carossino R, Zonefrati R, Ranaldi F, Brandi ML.
In-Text Gene Mentions

…II diabetes, andhemochromatosis, are risk factors…

…overload, such ashemochromatosis, thalassemia, hemophilia, but…

Show Full Abstract

Osteoarthritis (OA) is the most common degenerative joint disease, characterized by articular cartilage degradation, synovial inflammation, and ligament lesions. Non-coding RNAs (ncRNAs) do not encode any protein products and play a fundamental role in regulating gene expression in several physiological processes, such as in the regulation of cartilage homeostasis. When deregulated, they affect the expression of genes involved in cartilage degradation and synovial inflammation, contributing to the onset and progression of OA. Oxidative stress is also involved in the pathogenesis of OA by contributing to the inflammatory response, degradation of the extracellular matrix, and induction of chondrocyte apoptosis. Studies in the literature show a reciprocal relationship between the altered expression of a number of ncRNAs, including microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), and oxidative stress. The aim of this review is to highlight the role of oxidative stress, miRNAs, and lncRNAs and their cross-talk in OA in order to understand the main molecular mechanisms involved and to identify possible targets that may be useful for the identification and development of new diagnostic and therapeutic approaches for this disease.

Also flagged:Medulloblastomacentral nervous system tumortumorantibodiesantibodyantigen receptor
Journal Article 2025-07-03 No Snippets Poggi A, Reggiani F, Azevedo HS, Raffaghello L, Pereira RC.
Show Full Abstract

Medulloblastoma is an aggressive central nervous system tumor affecting children more commonly between the ages of 5-9. It is usually localized in the cerebellum, leading to diffusion of tumor cells through the cerebrospinal fluid and metastases to other portions of the brain and spinal cord. Conventional treatment consists of surgical resection followed by adjuvant radiation and/or chemotherapy. The side effects of these therapies are critical to consider, especially given that patients are in a distinct stage of their lives. In addition, the overall survival is not satisfactory ranging from 50-90% depending on the type of medulloblastoma. The molecular characterization has broadly subdivided medulloblastoma into four subgroups, and more recently, the single-cell transcriptomics studies have further identified several other subgroups. Important advances have been reported on the cell origin, their plasticity, heterogeneity of genetic and epigenetic alteration, and interaction with the immune and stromal components of the tumor microenvironment. Research studies on these key points are essential to make advances in planning the application of conventional therapies together with immunotherapies. Herein, we discuss the main advances recently obtained on medulloblastoma biology and immunotherapies. Overall, the biological and molecular features of medulloblastoma are briefly summarized to understand the reason for the application of the old and new immunotherapies. Immunotherapies considered include the identification of potential medulloblastoma neoantigens and tumor-associated antigens to generate antigen-specific T lymphocytes. The main antigens expressed by medulloblastoma cells and/or by components of the tumor microenvironment will be considered as the molecular targets of antibodies, antibody derivatives, and chimeric antigen receptor effector cells to improve the conventional therapies. In the last portion of this review, the brief analysis of the activating and inhibiting receptors expressed by antitumor T, natural killer, and unconventional T cells can give new insights into the potential treatment of medulloblastoma.

ZNFX1
Also flagged:chromosomechromosomesresponse to stressoxytocinAPOHNLRP9
Journal Article 2025-07-03 ✓ 3 Snippets Pinto LFB, Lewis RM, Rocha AO, Freking BA, Murphy TW, Wilson CS, Nilson SM, Burke JM, Brito LF.
In-Text Gene Mentions

…, HADH ,ZNFX1, ZSCAN4 ,…

…region is theZNFX1(zinc finger NFX1-type…

…reproduction is unclear,ZNFX1had increased expression…

Show Full Abstract

Ewe longevity indicators are complex traits that are lowly heritable, expressed late in life, and sex-limited, making them challenging to include in breeding programs. In this context, genome-wide association studies (GWASs) can provide more information on the complex genetic control of these traits. Therefore, the primary objective of this study was to carry out association analyses for 8 longevity-related traits in 12,734 Katahdin ewes. A total of 126 associations at the chromosome-wide level and 3 at genome-wide level were found. These associations involved 86 single-nucleotide polymorphisms (SNPs) located across 22 chromosomes, with 24 of these SNPs associated with two or more traits. The variants overlapped with genes previously associated with prolificacy (<i>APOH</i>, <i>NLRP9</i>, <i>H3PXD2A</i>, <i>CKB</i>, and <i>HERC4</i>), ovarian follicle pool (<i>GALNT13</i>, <i>TMEM150B</i>, and <i>BRSK1</i>), synthesis and release of reproductive hormones (<i>SULT1B1</i>, <i>LEF1</i>, and <i>EIF5</i>), and early pregnancy events (<i>ITGAV</i>, <i>HADH</i>, <i>ZNFX1</i>, <i>ZSCAN4</i>, <i>EPN1</i>, <i>FBXW8</i>, <i>NOS1</i>, <i>ST3GAL4</i>, and <i>GFRA1</i>). Moreover, genes related to response to stress or pathological conditions (<i>ADCY5</i>, <i>HADH</i>, <i>ATRNL1</i>, <i>LEP</i>, <i>IL11</i>, <i>NLRP9</i>, <i>PRKCG</i>, <i>PRKCA</i>, <i>NEDD4L</i>, <i>FECH</i>, <i>CTNNA3</i>, <i>HECTD1</i>, <i>LRRTM3</i>, and zinc-finger proteins), growth performance (<i>GRID2</i>, <i>MED13L</i>, <i>DCPS</i>, and <i>LEP</i>), and carcass traits (<i>CMYA5</i> and <i>SETD3</i>) were also implicated. Metabolic pathways such as oxytocin signaling and cardiac-related pathways were enriched. These findings suggest that longevity indicators in Katahdin ewes are highly polygenic traits influenced by a combination of voluntary and involuntary culling reasons. Candidate genes and metabolic pathways influencing reproductive performance and health may play a key role in the functional longevity of Katahdin ewes.

Also flagged:Cadmiumwatermethylationhistone modificationsgene expressiondeath
Journal Article 2025-07-03 No Snippets Yousaf S, Arshad M, Raza M, Fatima A, Mammadova K.
Show Full Abstract

This review highlights the pivotal roles of autophagy, ferroptosis, and endoplasmic reticulum (ER) stress in mediating cadmium (Cd)-induced nephrotoxicity. Cadmium exposure results in ER stress, which in turn activates major UPR pathways such as IRE1, ATF6, and PERK. By encouraging lipid peroxidation and suppressing cellular antioxidant defence, these mechanisms worsen ferroptosis and produce a feedback mechanism that increases cellular damage. There are two roles of autophagy in Cd-induced ferroptosis, which include its action in reducing cadmium-induced cytotoxicity by breaking down damaged components, and excessive autophagy, namely ferritinophagy, which promotes ferroptosis by iron dysregulation. The rise of mitochondrial ROS (MitoROS) caused by Cd-induced mitochondrial malfunction aids ferroptosis. This, in turn, causes ER stress and autophagy. This implies that focusing on mitochondrial health could be a useful treatment strategy. Effective treatment approaches include autophagy inhibitors like chloroquine, which have been shown to effectively reduce Cd-induced ferroptosis, and promising medicines that suppress ER stress, such as TUDCA. Desferrioxamine and other iron chelators effectively lower lipid peroxidation and iron dysregulation, therefore preventing ferroptotic cell death. Additionally, a multi-targeted treatment plan is suggested that targets iron metabolism, ER stress, and autophagy. In order to create tailored treatments for Cd-induced nephrotoxicity, this review emphasizes the need for additional study into the molecular pathways of Cd-induced ferroptosis, namely the ER stress-autophagy axis. The goal of future research should be to apply these mechanistic insights to clinical settings to enhance public health outcomes and create efficient therapies for renal failure brought on by cadmium toxicity.

Also flagged:Melatoninoxygennitrogenlipidmitochondrialneurogenesis
Journal Article 2025-07-03 No Snippets Kołodziejska R, Woźniak A, Bilski R, Wesołowski R, Kupczyk D, Porzych M, Wróblewska W, Pawluk H.
Show Full Abstract

Melatonin (MEL)is an endogenous hormone with antioxidant potential that plays an important role in maintaining redox homeostasis. MEL and its derivatives directly scavenge free oxygen and nitrogen radicals. Melatonin inhibits lipid peroxidation, stimulates antioxidant enzymes, and reduces metal toxicity. It stabilizes mitochondrial activity and suppresses inflammatory signaling. It takes part in neurogenesis, neuroprotection, and modulation of the cardiovascular system. It prevents many diseases of free radical etiology, i.e., neurodegenerative and circulatory system diseases and ischemic stroke. Supplementation with this antioxidant can slow down the aging process and provide protection against diseases of the central nervous system and support the body's natural antioxidant system. This study uses current reports from the literature and meta-analyses of the antioxidant mechanisms of melatonin and its importance in neurodegenerative diseases.

TNFSF4
Also flagged:EIF4EBP1tumorbreast cancerBRCAGene Expressionlysosome
Journal Article 2025-07-03 ✓ 1 Snippet Wang B, Wei N, He M, Zhong G, Zhang S.
In-Text Gene Mentions

…only CD276 andTNFSF4being highly expressed…

Show Full Abstract

<h4>Background</h4>Lysosomal dysfunction is significantly associated with tumor progression. This study aimed to identify and develop a new predictive panel for breast cancer (BRCA) and examine its relationship with the immune environment and therapeutical status.<h4>Methods</h4>We developed a prognostic panel employing lysosomal genes from The Cancer Genome Atlas Program (TCGA) and then validated and assessed it externally in the Gene Expression Omnibus (GEO). Furthermore, the disparities were identified between high and low-risk subgroups by examining the infiltration of microenvironment cells, gene expression of immune checkpoints, and small molecular compounds. Ultimately, the cancerous function and potential pathway of core LRG were verified using a series of <i>in vitro</i> tests.<h4>Results and discussion</h4>First, the predictive panel of lysosome-related genes (LRGs) was generated <i>via</i> the least absolute shrinkage and selection operator. High-risk populations showed the shortest survival times. Meanwhile, the area under the curves (AUC) for predicting 1-, 3-, and 5-year survival rates indicated good predictive performance across all cohorts. Subsequent extensive investigations revealed a strong correlation between the risk score and the pathological stage, drug sensitivity, and tumor mutation burden (TMB). Then, we discovered that the levels of GPLD1, PLA2G5, and STX7 were reduced in BRCA tissues, whereas the expressions of PLA2G10, LAMP3, EIF4EBP1, and LPCAT1 were elevated in BRCA tissues compared to paracancerous tissues. Patients exhibiting high EIF4EBP1 expression experienced a more unfavorable outcome compared to those with low expression. EIF4EBP1 disruption dramatically impeded BRCA cell growth and invasive capacity, as demonstrated by CCK8, wound healing, and transwell assays. Moreover, EIF4EBP1 silencing in BRCA cells significantly restricted the TGF-β pathway.<h4>Conclusion</h4>Our 9-LRG panel is a promising classifier for assessing the prognosis of BRCA. Notably, targeting EIF4EBP1 could potentially serve as a theoretical foundation for enhancing the prognosis of BRCA patients.

bioRxiv 2025-07-03 Preprint (No Snippets API) Tolle HM, Luppi AI, Lawn T, Roseman L, Nutt D, Carhart-Harris RL, Mediano PAM.
Show Full Abstract

Conventional antidepressants show moderate efficacy in treating major depressive disorder. Psychedelic-assisted therapy holds promise, yet individual responses vary, underscoring the need for predictive tools to guide treatment selection. Here, we present graphTRIP (graph-based Treatment Response Interpretability and Prediction) – a geometric deep learning architecture that enables three advances: 1) accurate prediction of post-treatment depression severity using only pretreatment clinical and neuroimaging data; 2) identification of robust biomarkers; and 3) causal analysis of treatment effects and underlying mechanisms. Trained on data from a clinical trial comparing psilocybin and escitalopram ( NCT03429075 ), graphTRIP achieves strong predictive accuracy ( r = 0.72, p = 6.8 ×10 −8 ), and shows clear generalization to both an independent dataset and across brain atlases. The model identifies stronger functional connectivity within sensory networks as a robust predictor of poorer response across both treatments. In contrast, causal analysis implicates frontoparietal and default mode networks as key moderators of differential response, with stronger 5-HT1A- and 5-HT2A-related signalling in the frontoparietal network predicting escitalopram response but psilocybin resistance. Overall, this work advances precision medicine and biomarker discovery in depression.

bioRxiv 2025-07-03 Preprint (No Snippets API) Cruz-Santos M, Kidd E, Li Z, De La Fuent DC, Davies S, Vinh N, Fjodorova M, Li M.
Show Full Abstract

Distorted GABAergic neurodevelopment is believed to underscore cortical network dysfunction that lies at the heart of neurodevelopmental disorders (NDD) such as autism and schizophrenia. GABAergic neuron diversity is sculptured by cortical environmental cues during protracted postmitotic differentiation. However, the mechanism by which the NDD environment influences GABAergic neuronal development remains largely unknown. Oxysterols are oxidized metabolites of cholesterol that can interact with developmental signaling pathways. Using an iPSC model recapitulating human forebrain GABAergic neuron development and single-cell transcriptomic profiling, we show that 24S, 25-epoxysterol, an NDD-affected oxysterol highly enriched in the fetal brain, promotes neurogenesis, and disturbs the composition of GABAergic neuronal subtypes. Moreover, pharmacological and genetic interrogation identified the liver X receptor as a regulatory pathway mediating the action of 24S, 25-epoxysterol. These findings provide insights into the roles of cholesterol metabolism in neuronal development and a potential mechanism by which dysregulated brain oxysterols contribute to the pathogenesis of NDD.

Also flagged:Uridineagingidiopathic pulmonary fibrosispathogenesiscell cycleepithelial-mesenchymal transition
Journal Article 2025-07-02 No Snippets Ding C, Zuo R, Liao Q, Guo Z, He J, Ye Z, Liu G.
Show Full Abstract

Idiopathic pulmonary fibrosis (IPF) is an age-related disease with an unclear pathogenesis. The senescence and insufficient regeneration of alveolar epithelial cells are significant factors in the development and progression of IPF. Currently, effective treatment methods are lacking. The aim of this study is to explore the mechanism of action of uridine in delaying the aging of AECs and intervening in IPF. In vitro, Western blot and qRT-PCR analyzed uridine's effects on bleomycin-induced senescence, EMT, cell viability, and cell cycle. In vivo, uridine's impact on lung aging and fibrosis in BLM-induced mice was assessed by weight, staining, Ashcroft scoring, and Western blot. Uridine reduced senescence markers in A549 cells, suppressed epithelial-mesenchymal transition, improved antioxidant capacity, and delayed pulmonary fibrosis and lung aging in mice. The effects of uridine were mediated through the NRF2 signaling pathway, which regulates antioxidant defense and autophagy. Uridine enhanced autophagic degradation of Keap1, possibly through p62/SQSTM1-mediated autophagy. These findings suggest that uridine inhibits AEC senescence via the NRF2 pathway, mitigating IPF progression and offering a potential strategy for treating age-related pulmonary fibrosis by targeting oxidative stress.

TNFSF4
Also flagged:multiple myelomatumorcyclophosphamideWee1osimertinibJQ1
Journal Article 2025-07-02 ✓ 1 Snippet Feng Y, Wang S, Zhang J, Liu C, Zhang L, Liu J.
In-Text Gene Mentions

…KIR3DL2, PVR, TNFSF18,TNFSF4, and TNFSF9 (…

Show Full Abstract

PANoptosis is closely associated with tumorigenesis and therapeutic response, yet its role in multiple myeloma (MM) remains unclear. This study analyzed bulk transcriptomic and clinical data from the TCGA and GEO databases to identify seven PANoptosis-related genes (PRGs) using machine learning (LASSO regression and random forest models) and univariate Cox analysis, and constructed a prognostic risk model. The model demonstrated robust predictive performance across three external validation cohorts. High-risk patients exhibited higher tumor purity, increased tumor mutational burden, and distinct immune cell infiltration patterns. Drug sensitivity analysis revealed heightened sensitivity to cyclophosphamide, Sinularin, Wee1 inhibitor, osimertinib, JQ1, VE-822, and AZD6738 in high-risk patients. Single-cell transcriptomic analysis revealed significant enrichment of PARP1, ZBP1, LY96, and CASP3 in plasma cells. Quantitative PCR (qPCR) further validated differential expression patterns of the seven core PRGs between MM patients and healthy controls. Immunohistochemical analysis demonstrated distinct expression profiles of PARP1, ZBP1, LY96, and CASP3 in high-risk versus standard-risk MM patients. Furthermore, CCK-8 assays and Wright-Giemsa staining confirmed the crucial role of PARP1 in regulating MM cell viability. This PANoptosis-based prognostic model provides a valuable tool for predicting MM prognosis and guiding personalized treatment.

Also flagged:gene expressionulcerative colitiscolorectal cancertranscription factorTFtranscription factors
Journal Article 2025-07-02 No Snippets Yan T, Su T, Zhu M, Qing Q, Huang B, Liu J, Ma T.
Show Full Abstract

There is a complex interrelationship between colorectal cancer (CRC) and ulcerative colitis (UC). This study aimed to identify key molecules and pathways involved in the co-occurrence of CRC and UC, as well as the role of oxidative stress in disease progression, through bioinformatics analysis of public RNA sequencing databases. We downloaded datasets from public repositories and conducted gene set enrichment analysis (GSEA), screening for oxidative stress-related differentially expressed genes (OXSRDEGs) to evaluate their diagnostic potential. Subsequently, we performed Gene Ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) analyses, followed by immune infiltration analysis using the single-sample gene-set enrichment analysis (ssGSEA) and CIBERSORT algorithms. By constructing a multivariate Cox prognostic model using Kaplan-Meier curves and least absolute shrinkage and selection operator (LASSO) regression analysis, we assessed the model's prognostic capability. Furthermore, we utilized the STRING database and Cytoscape to establish a protein-protein interaction (PPI) network and constructed an mRNA-transcription factor (TF) and mRNA-miRNA interaction networks. The molecular functions and signaling pathways enriched in OXSRDEGs were determined. The robust diagnostic efficacy of OXSRDEGs was verified. This analysis suggests that immune cells may collaborate with OXSRDEGs to impact the onset and progression of diseases. A total of 6 OXSRDEGs with prognostic significance were identified, and the multifactorial Cox regression model constructed demonstrated a strong clinical predictive capacity. The mRNA-transcription factor (TF) and mRNA-miRNA interaction networks revealed that OXSRDEGs are regulated by multiple miRNAs and many transcription factors. Common biomarkers of oxidative stress in the pathogenesis, disease progression, gene expression, and transcription of ulcerative colitis and colorectal cancer have been identified, presenting potential therapeutic targets. The model may be beneficial in prognostic prediction and guiding treatment decisions.

Also flagged:hydrogencarbonoxygencarbon dioxidenitrogen oxidenitrogen
Journal Article 2025-07-02 No Snippets Huang Z, Zhu T, Wang L, Wang L, Ali AS, Nassef MGA, Wang T, Ahmed RH.
Show Full Abstract

Hydrogen, as a renewable zero-carbon fuel, is an ideal alternative to internal combustion engine fuels. The paper numerically investigates the effect of piston geometry on lean combustion in hydrogen engines, focusing on early and late injection strategies. Two novel piston bowl designs, referred to as the right-concave piston and left-concave piston, were analyzed for their interaction with hydrogen jets during mixture formation and combustion processes. Validation of the numerical outputs were conducted using an experimental testbench. Results reveal that the right-piston had a stronger and larger scale tumble, compared to the flat-top piston, facilitating hydrogen diffusion. However, due to their early injection timing, mixture distribution at ignition timing was relatively uniform, resulting in comparable indicated thermal efficiency (ITE) and NOx emissions. Conversely, the left-concave piston demonstrated inferior ITE and higher emissions under single injection but achieved superior performance with an optimized dual injection strategy. This strategy improved mixture stratification increased thermal efficiency, and significantly reduced NOx emissions. The key findings highlight the critical role of piston geometry and injection strategy in optimizing hydrogen combustion engines for higher efficiency and lower emissions.

SERPINC1
Also flagged:lactationmetabolismsugarsamino acidsinsulinbiosynthesis
Journal Article 2025-07-02 ✓ 4 Snippets Kittur PM, Satheesan L, Gunturu NT, Somagond YM, Madhusoodan AP, Gandham RK, Alex R, Dang AK.
In-Text Gene Mentions

…APOA1, APOE, VTN,SERPINC1, PLG, TTR, and…

SERPINC1inhibits proteases by…

…D7 (PLG, VTN,SERPINC1, APOA1, TTR, APOE,…

…and coagulation systems (SERPINC1, SERPIND1, SERPING1, F2,…

Show Full Abstract

Buffalo milk is renowned for its nutritional and functional properties. Milk somatic cells protect the mammary gland, contribute to the functionality of the udder, and also aid in the health and development of newborn calves, particularly during the critical early lactation period. However, proteomic changes in buffalo milk somatic cells during the transition from colostrum to mature milk remain poorly understood. This study was formulated to characterize the proteomic dynamics of buffalo milk somatic cells using Liquid chromatography-tandem mass spectrometry (LC-MS/MS) during colostrum-to-mature milk transition and to reveal shifts in metabolic and immune functions. A total of 4,429 high-confidence proteins were identified in the colostrum and milk of buffaloes. Up-regulated proteins [P<sub>adj</sub><0.05, log<sub>2</sub>(Fold change, FC) ≥ 1.5] across different days of sampling were involved in metabolism of sugars, lipids, and amino acids, pentose-phosphate pathway, insulin-signaling, biosynthesis of amino acids and cofactors, and ubiquitin-proteasome system. Down-regulated proteins [P<sub>adj</sub><0.05, log<sub>2</sub>(FC) ≤ 0.5] were associated with lipid transport, aldosterone synthesis and secretion, mineral balance, complement-coagulation system, antigen processing and presentation, and mRNA processing. A notable shift in hub proteins was detected, and selected ones were validated by real-time qPCR. These findings highlight significant changes in the proteome profile, biological functions, and specific pathways in milk somatic cells during early lactation in buffaloes. In conclusion, milk somatic cells contribute not only to mammary immunity but also to the nutritional support of the growing calf.

PEBP1
Also flagged:Anapc5Anapc7KIF18Akinesin family member 18 Amicrotubulechromosome
Journal Article 2025-07-02 ✓ 1 Snippet Nesbit C, Martin W, Czechanski A, Byers C, Raghupathy N, Ferraj A, Stumpff J, Reinholdt L.
In-Text Gene Mentions

…, Kntc1 ,Pebp1, Rbm19 ,…

Show Full Abstract

The kinesin family member 18 A (KIF18A) is an essential regulator of microtubule dynamics and chromosome alignment during mitosis. Functional dependency on KIF18A varies by cell type and genetic context but the heritable factors that influence this dependency remain unknown. To address this, we took advantage of the variable penetrance observed in different mouse strain backgrounds to screen for loci that modulate germ cell depletion in the absence of KIF18A. We found a significant association at a Chr5 locus where anaphase promoting complex subunits 5 (Anapc5) and 7 (Anapc7) were the top candidate genes. We found that both genes were differentially expressed in a sensitive strain background when compared to resistant strain background at key timepoints in gonadal development. We also identified a novel retroviral insertion in Anapc7 that may in part explain the observed expression differences. In cell line models, we found that depletion of KIF18A induced mitotic arrest, which was partially rescued by co-depletion of ANAPC7 (APC7) and exacerbated by co-depletion of ANAPC5 (APC5). These findings suggest that differential expression and activity of Anapc5 and Anapc7 may influence sensitivity to KIF18A depletion in germ cells and CIN cells, with potential implications for optimizing antineoplastic therapies.

Also flagged:organizationmembraneoxygencarbon dioxideNeurological DisordersStroke
Journal Article 2025-07-02 No Snippets Molkov Y, Borgmann A, Koizumi H, Hama N, Zhang R, Smith J.
Show Full Abstract

Unraveling synaptic interactions between excitatory and inhibitory interneurons within rhythmic neural circuits, such as central pattern generation (CPG) circuits for rhythmic motor behaviors, is critical for deciphering circuit interactions and functional architecture, which is a major problem for understanding how neural circuits operate. Here, we present a general method for extracting and separating patterns of inhibitory and excitatory synaptic conductances at high temporal resolution from single neuronal intracellular recordings in rhythmically active networks. These post-synaptic conductances reflect the combined synaptic inputs from the key interacting neuronal populations and can reveal the functional connectome of the active circuits. To illustrate the applicability of our analytic technique, we employ our method to infer the synaptic conductance profiles in identified rhythmically active interneurons within key microcircuits of the mammalian (mature rat) brainstem respiratory CPG and provide a perspective on how our approach can resolve the functional interactions and circuit organization of these interneuron populations. We demonstrate the versatility of our approach, which can be applied to any other rhythmic circuits where conditions allow for neuronal intracellular recordings.

SERPINC1
Also flagged:frontotemporal dementiaprogressive nonfluent aphasialogopenic progressive aphasiaADcognitiondementias
Journal Article 2025-07-02 ✓ 1 Snippet Foxe D, Muggleton J, Cheung SC, Mueller N, Ahmed RM, Narasimhan M, Burrell JR, Hwang YT, Cordato NJ, Piguet O.
In-Text Gene Mentions

…LowerACE-IIIin bvFTD, LPA,…

Show Full Abstract

<h4>Aim</h4>To evaluate the survival rates in well-characterized cohorts of frontotemporal dementia (FTD) subtypes - behavioral variant (bvFTD), progressive nonfluent aphasia (PNFA), and semantic dementia (SD) - and both typical (amnestic) and atypical (aphasic: logopenic progressive aphasia [LPA]) presentations of Alzheimer's disease (AD).<h4>Patients & methods</h4>Three hundred and twenty-one participants (54 bvFTD, 26 PNFA, 22 SD, 20 LPA, 32 AD, 167 controls) were recruited. Patients underwent a comprehensive baseline assessment and annual reviews. Survival data were analyzed using Kaplan-Meier curves and Cox proportional hazard models.<h4>Results</h4>Median survival from symptom onset was longest in SD (11.9 years) and shortest in LPA (7 years). Median survival for the bvFTD, PNFA, and AD groups was 8.7, 8.6, and 10 years, respectively. SD survival was significantly longer than PNFA and AD. Female sex was associated with shorter survival in LPA. Shorter symptom duration at baseline assessment was related to shorter survival in bvFTD, SD, LPA, and AD. Lower overall cognition in bvFTD, LPA, and AD, and worse functional outcomes in SD and AD at baseline were associated with shorter survival.<h4>Conclusions</h4>Our findings demonstrate distinct survival patterns across FTD and AD subtypes. Demographic and presenting clinical features provide valuable prognostic insights for survival.

PRDX6
Also flagged:PhospholipasePAFAH2Lipidferroptosiscancermembrane
Journal Article 2025-07-02 ✓ 1 Snippet Ruiz SB, Tylawsky DE, Shah J, Saoi M, Cuevas B, Desai S, Racz B, Perea AM, Izawa-Ishiguro AR, Cross J, Heller DA.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Although ferroptosis resistance is prevalent among many cancer cell types, precisely how ferroptosis surveillance mechanisms are induced remains elusive due to the heterogeneity of the cellular mutational status and metabolic states. Here, we find that phospholipase PAFAH2 regulates ferroptosis through its unique ability to specifically detoxify membrane-bound oxidized phospholipids in KEAP1 mutant and NRF2-active cancer cells. We show that the genetic or chemical perturbation of PAFAH2 is sufficient to sensitize KEAP1 mutant lung adenocarcinoma cells to ferroptosis. Lipidomic analyses reveal that PAFAH2 inhibition shifts the cellular lipidome to a distinctly ferroptosis state characterized by the enrichment of key phospholipids previously identified to be important in ferroptosis, like ether-linked phosphatidylethanolamines. Finally, we comparatively assessed the antitumor efficacy of PAFAH2 inhibitor monotherapy versus cotreatment with a nanoparticle-stabilized GPX4 inhibitor formulation. Our findings support that the broad applicability of PAFAH2 inhibition can be used in ferroptosis induction and abrogation of ferroptosis resistance across cancer types.

STAU1
Also flagged:RBPPCBP2extracellularvesiclesRNA-binding proteinsCLIP
Journal Article 2025-07-02 ✓ 1 Snippet Marocco F, Garbo S, Montaldo C, Colantoni A, Quattrocchi L, Gaboardi G, Sabarese G, Cicchini C, Lecce M, Carnevale A, Paolini R, Tartaglia GG, Battistelli C, Tripodi M.
In-Text Gene Mentions

…2015 ), andSTAU1binds to double-stranded…

Show Full Abstract

While it is accepted that extracellular vesicles (EVs)-mediated transfer of microRNAs contributes to intercellular communication, the knowledge about molecular mechanisms controlling the selective and dynamic miRNA-loading in EVs is still limited to few specific RNA-binding proteins interacting with sequence determinants. Moreover, although mutagenesis analysis demonstrated the presence/function of specific intracellular retention motifs, the interacting protein/s remained unknown. Here, PCBP2 was identified as a direct interactor of an intracellular retention motif: CLIP coupled to RNA pull-down and proteomic analysis demonstrated that it binds to miRNAs embedding this motif and mutagenesis proved the binding specificity. Notably, PCBP2 binding requires SYNCRIP, a previously characterized miRNA EV-loader as indicated by SYNCRIP knock-down. SYNCRIP and PCBP2 may contemporarily bind to miRNAs as demonstrated by EMSA assays and PCBP2 knock-down causes EV loading of intracellular microRNAs. This evidence highlights that multiple proteins/miRNA interactions govern miRNA compartmentalization and identifies PCBP2 as a dominant inhibitor of SYNCRIP function in murine hepatocytes.

POU3F2
Also flagged:neurodevelopmental disordersautism spectrum disorderschizophreniadendritesneurogenesistranscriptional regulators
Journal Article 2025-07-02 ✓ 1 Snippet Bose M, Ravindran S, Kumari S, Srivastava A, Iyer A, Vedak B, Talwar I, Narayanan R, Tole S.
In-Text Gene Mentions

…upper layer markerPOU3F2similar to controls…

Show Full Abstract

In the mammalian neocortex, the two hemispheres communicate via the corpus callosum. We investigated mechanisms regulating dendritic arbors and spines of callosal neurons. The transcription factor LIM Homeodomain 2 (<i>Lhx2</i>), a key regulator of cortical development, is expressed in postmitotic layer II/III neurons and their progenitors. Loss of <i>Lhx2</i> in either population caused similar but distinct phenotypes: reduced dendritic arbors, altered spine morphology, and changed electrophysiological properties. Morphometric defects were more severe when <i>Lhx2</i> was disrupted in progenitors and were recapitulated by its specific loss in basal progenitors. <i>Lhx2</i> loss in progenitors aberrantly up-regulated <i>Neurog2</i> in postmitotic neurons, and <i>Neurog2</i> knockdown partially rescued the phenotype. Loss of <i>Lhx2</i> at either stage also up-regulated Wnt signaling pathway genes. The mutant phenotype was mimicked by constitutive activation of β-CATENIN in postmitotic neurons. Our findings reveal previously unidentified LHX2-dependent mechanisms of dendritic morphogenesis, highlighting its temporally dynamic and diverse roles in neocortical development.

DCC
Also flagged:membrane proteinmembrane proteinsmembranebindingGPCRion channel
Journal Article 2025-07-02 ✓ 1 Snippet Pliushcheuskaya P, Künze G.
In-Text Gene Mentions

…(median DVO andDCCof 0.00 and…

Show Full Abstract

Increasing structural and biophysical evidence suggests that many drug molecules bind to the protein-membrane interface region in membrane protein structures. An important starting point for drug discovery is the determination of a ligand's binding site; however, this information is missing for many membrane proteins, especially for their membrane-embedded parts. Therefore, we tested the performance of computational methods for ligand binding site prediction in the protein intramembrane region. We compiled data sets containing GPCR- and ion channel-ligand complexes and compared method performance relative to a soluble protein data set obtained from PDBBind. We tested state-of-the-art geometry-based (Fpocket, ConCavity), energy probe-based (FTSite), machine learning-based (P2Rank, GRaSP), and deep learning-based (PUResNet, DeepPocket, PUResNetV2.0) methods and evaluated them using the center-to-center distance (DCC) and discretized volume overlap (DVO) between the predicted binding site and the actual ligand position. The three best-ranking methods based on success rates on GPCRs were DeepPocket, PUResNetV2.0, and ConCavity, and for ion channels, these were DeepPocket, PUResNetV2.0, and FTSite. However, average DCC and DVO values were lower for all methods compared to the soluble protein data set, for which DVO and normalized DCC values ranked between 0.33 and 0.72 in their best case, respectively. In conclusion, this study provides an overview of the performance of state-of-the-art binding site prediction methods on their ability to identify pockets in the protein-membrane interface region. It also underscores the need for further method development in the prediction of protein-membrane ligand binding sites.

Also flagged:immune responsespathogenesisCCR2Cell cycleacquired immunodeficiency syndromeAIDS
Journal Article 2025-07-02 No Snippets Li N, He C.
Show Full Abstract

The acquisition of human immunodeficiency virus (HIV) is influenced by environmental and genetic factors, such as viral inoculum dose, host behavior, and immune responses. Despite advances in understanding HIV pathogenesis, no effective vaccine exists, underscoring the urgent need to deepen our comprehension of host immune mechanisms to enhance preventive strategies. Genetic predisposition and certain immunity characteristics of the host might play essential roles in the risk of HIV-1 acquisition. Mendelian randomization (MR) and colocalization analysis are utilized to investigate the causal relationships between immune responses and HIV-1 risk, aiming to identify targets for potential eradication strategies. We employed a two-sample MR approach to explore the causal links between 731 immunophenotypes and HIV-1 acquisition, using genetic variants from publicly available GWAS summary statistics as instrumental variables. Sources included GWAS data for immune traits and a meta-analysis from European cohorts for HIV-1 acquisition. We validated our findings using Summary-data-based MR analysis, integrating eQTL and mQTL data from the GTEx project. Bayesian colocalization analysis was conducted to identify shared causal variants. Functional and pathway enrichment analysis employing Metascape and Enrichr websets were performed to elucidate potential biological pathways linking immunephenotypes to HIV-1 risk. Our MR analysis identified significant causal associations between 26 specific immunophenotypes and HIV-1 acquisition, indicating a causal association with HIV risk. Colocalization analysis showed that none demonstrated genome-wide evidence of genetic colocalization (regional PP.H4.abf > 0.70). SMR and HEIDI analysis confirmed pleiotropic associations, particularly noting CCR2 on granulocytes as significant. Functional enrichment analysis of 39 SMR-identified genes revealed critical pathways linking immunophenotypes to HIV-1 susceptibility. The "NABA MATRISOME ASSOCIATED" canonical pathway emerged as the most significant pathway using Metascape. Protein-protein interaction networks demonstrated 5 functionally cohesive clusters. Multi-database analyses using Enrichr Analysis revealed functionally similar pathway enrichment: Cell cycle regulation ("G2 Phase", Reactome; "G1/S Control", WikiPathways), shedding light on crucial immune regulation mechanisms potentially instrumental in HIV-1 acquisition.

Also flagged:AMLNUP98
Journal Article 2025-07-02 No Snippets Huang W, Wang M, Xie J, Wang Q, Dai H, Chen S, Wang Q.
Show Full Abstract

No abstract available.

MLLT10
Also flagged:DOT1LosteosarcomaSYKEGFRP53SHP2
Journal Article 2025-07-02 ✓ 5 Snippets Hu F.
In-Text Gene Mentions

…DOT1L and H3K79me2 (MLLT10), DOT1L and H3K79me3…

…H3K79me3 (NEAT1), H3K79me2 (MLLT10) and SYK, H3K79me2…

…and SYK, H3K79me2 (MLLT10) and EGFR, and…

…EGFR, and H3K79me2 (MLLT10) and P53 (TP53).…

…DOT1L and H3K79me2 (MLLT10) are positively correlated…

Show Full Abstract

DOT1L, acting as a key epigenetic regulator, plays important roles in various biological processes, offering significant insights for the development of new cancer therapeutic strategies. This study investigates the impact of DOT1L on pyroptosis in osteosarcoma and its molecular mechanisms. Bioinformatics analysis was performed to identify genes associated with DOT1L. Western blotting was used to detect the expression levels of relevant proteins; flow cytometry was used to assess apoptosis in Saos-2 cells; transmission electron microscopy was used to observe the number of pyroptotic bodies in Saos-2 cells; subcutaneous xenograft experiments in nude mice were used to evaluate the progression of osteosarcoma; immunohistochemical staining was used to detect the expression of DOT1L, p-SYK, p-EGFR, p-SHP2, and NLRP3 in tumor tissues. Bioinformatics analysis revealed that DOT1L is associated with H3K79me2/3. Under hypoxic conditions and with cGAMP treatment, DOT1L promoted the expression of H3K79me2/3, SYK, EGFR, p-SYK, p-EGFR, p-STING, p-TBK1, p-IRF3, P53, NLRP3, IL-1β, GSDMD, and apoptosis in Saos-2 cells, while inhibiting the expression of p-SHP2 and SHP2. DOT1L mediated the SYK/EGFR/SHP2 signaling pathway to increase the number of pyroptotic bodies in Saos-2 cells. Additionally, DOT1L suppressed the progression of osteosarcoma and enhanced the expression of p-SYK, p-EGFR, and NLRP3 in tumor tissues, while inhibiting p-SHP2 expression. DOT1L suppressed the progression of osteosarcoma by modulating SYK/EGFR/P53 and SHP2-induced STING-NLRP3-pyroptosis signaling.

SHISA6
Also flagged:MossyCerebellar-ocular reflexautism-spectrum disorderanxietymossy fiber
Journal Article 2025-07-02 ✓ 1 Snippet Lee JH, Guo C, Wu S, Norton A, Seo S, Yao Z, Regehr WG.
In-Text Gene Mentions

…AMPAR auxiliary subunitSHISA6decreased GC-PC EPSCs…

Show Full Abstract

Mossy fiber inputs are transformed into cerebellar Purkinje cell (PC) outputs by granule cell (GC)-dependent processing. Cerebellar dysfunction leads to motor, learning, emotional, and social deficits that are usually attributed to altered PC firing arising from impaired processing of mossy fiber inputs, even though PCs also fire independently of GCs. To isolate their contributions to cerebellum-dependent behaviors, we either disrupt GC signaling while leaving PC firing intact, or disrupt PC signaling to eliminate the influence of PCs. Experiments were performed in mice of both sexes. We find that both GC and PC signaling are essential for eyeblink conditioning and vestibulo-ocular reflex (VOR) learning. Remarkably, disrupting PC signaling impairs VOR, anxiety, and social behavior, but abolishing GC signaling does not. This establishes that while GC signaling is critical for motor learning, it does not influence many behaviors including those associated with autism-spectrum disorder. It suggests that GC-independent behaviors can potentially be rescued by restoring altered firing in downstream regions.

TNFSF4
Also flagged:osteoporosisOPALPNAPGNCOA1TRIM44
Journal Article 2025-07-02 ✓ 1 Snippet Liu Z, Yang X, Wang Z, Li Q, Gu H, Meng Q, Zhang Y.
In-Text Gene Mentions

…positively correlated withTNFSF4( r =…

Show Full Abstract

The association between oxidative stress and osteoporosis (OP) has been substantiated by numerous studies; however, the precise underlying mechanism remains elusive. Hence, we employed bioinformatics methodologies to investigate this phenomenon. OP-related datasets (GSE56815 and GSE7158) were utilized in this study. Key module genes linked to oxidative stress-related genes (OS-RGs) were acquired through weighted gene coexpression network analysis (WGCNA). By crossing key module genes and differentially expressed genes (DEGs) from differential expression analysis, candidate genes were obtained. Subsequently, diagnostic genes were obtained through receiver operating characteristic (ROC) curve analysis and expression evaluation. Furthermore, a nomogram model was developed utilizing these genes to assess the collective predictive capacity of the diagnostic genes for OP comprehensively. Additionally, gene set variation analysis (GSVA), immune analysis, and construction of a molecular regulatory network were implemented to further understand the mechanism of the diagnostic genes in OP. We also preliminarily verified the effect of NAPG on osteogenic differentiation through experiments such as ALP, ARS and Western Blot. A total of 101 candidate genes were identified by crossing 395 DEGs and 1,730 key module genes. Importantly, NAPG, NCOA1, and TRIM44 were identified as diagnostic genes associated with oxidative stress in OP. The nomogram model showed the potential predictive ability of OP. Moreover, the GSVA results demonstrated that low expression of NAPG, NCOA1, and TRIM44 was enriched in the oestrogen response early signalling pathway. Moreover, these diagnostic genes were strongly correlated with multiple immune-related genes in the two datasets. Additionally, we identified several important factors that have regulatory relationships with diagnostic genes, such as MEF2A, STAT3, YY1, CREB1, hsa-mir-132-3p, and hsa-mir-148a-3p. Finally, it was verified at the protein and cellular levels that NAPG inhibits osteogenic differentiation and may play a crucial role in osteoporosis. NAPG, NCOA1, and TRIM44 were found to be associated with the diagnosis of OP, suggesting novel opportunities for diagnosing and treating OP.

Also flagged:CEBPDCD47MAP4K4chromatintumorcancer
Journal Article 2025-07-02 No Snippets Lee JW, Lee D, Shin KJ, Son KH, Cho JY.
Show Full Abstract

Circulating immune cells that have interacted with tumor tissue exhibit distinct characteristics compared to those in healthy individuals, providing potential biomarkers for tumor presence and malignancy. However, the epigenetic mechanisms governing these immune cells, particularly chromatin accessibility, remain poorly understood in cancer. In this study, we investigated chromatin accessibility and transcription factor binding in peripheral blood mononuclear cells from dogs with mammary gland tumors using ATAC-seq. Our analysis revealed significant changes in chromatin accessibility near genes associated with immune function, neuronal activity, and lipid metabolism. Notably, we identified CEBPD-bound peaks that were upregulated in PBMCs from tumor-bearing dogs and demonstrated that the transcription of their associated genes, CD47 and MAP4K4, was also elevated in monocytes under cancer co-culture conditions. This effect was mitigated following CRISPR interference of these regulatory regions. These findings highlight the crucial role of chromatin accessibility in shaping the immune response to cancer and suggest potential therapeutic targets for immune modulation.

HTT
Also flagged:neurodegenerative diseasecognitive impairmentsacidHDnitric oxideglutathione
Journal Article 2025-07-02 ✓ 2 Snippets Alenezi SK.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, which result…

…repeats in theHTTgene, resulting in…

Show Full Abstract

Huntington's Disease (HD), a neurodegenerative disease characterized by motor and cognitive impairments, arises from genetic mutations causing protein aggregation within the brain. The 3-Nitropropionic acid (3-NPA) rat model mimics key features of HD. This study explored the therapeutic efficacy of barbigerone, a compound with antioxidant and anti-inflammatory properties, in ameliorating 3-NPA-induced neurodegeneration and cognitive deficits in rats. Male Wistar rats were randomized into four groups: a normal control group, a 3-NPA control group, and two groups treated with different doses of barbigerone along with 3-NPA. Behavioral test, biochemical assays, and histopathological examinations were performed. Barbigerone significantly (P < 0.0001) restored motor coordination, grip strength, and mobility compared to 3-NPA-induced HD rats. Barbigerone concomitantly reduced oxidative stress by lowering malondialdehyde (MDA) and nitric oxide (NO) levels, while enhancing antioxidant enzymes such as glutathione (GSH), superoxide dismutase (SOD), and catalase (CAT). Furthermore, treatment modulated the pro-inflammatory cytokines, suggesting a reduction in neuroinflammation. Barbigerone significantly (P < 0.0001) impacted changes in acetylcholinesterase (AChE) activity and modulated levels of key neurotransmitters, such as acetylcholine (ACh), norepinephrine (NE), serotonin (5-HT), gamma-aminobutyric acid (GABA), dopamine (DA), and glutamate (GLU). Additionally, barbigerone effectively attenuated the 3-NPA-induced elevation of caspase-3 and caspase-9, while upregulating brain-derived neurotrophic factor (BDNF), which is crucial for neuronal survival and cognitive function. Histopathological examination revealed that barbigerone significantly restored the altered striatal architecture, indicating a protective effect against neurodegeneration. Barbigerone exhibits potential as a therapeutic choice for HD, offering the possibility of alleviating motor impairments, oxidative stress, inflammation, and cognitive dysfunction.

ECI2
Also flagged:fatty acidmetabolismglucosetriglyceridescholesterolgene expression
Journal Article 2025-07-02 ✓ 1 Snippet Mei Z, Song Z, Zhou H, Zheng B, Xiong Y, Sheng Z, Gong Y.
In-Text Gene Mentions

…isomerase 2 (ECI2)), we correlated…

Show Full Abstract

<h4>Background</h4>Heat stress poses a major challenge to global poultry production, but the molecular mechanisms driving the acute heat stress response in multiple organs of chickens remain poorly understood. The present study aimed to elucidate these mechanisms by establishing an acute heat stress chicken model and analyzing the multi-tissue transcriptome and physiological responses.<h4>Results</h4>Exposure to 36℃ for 6 h induced marked physiological changes, including elevated rectal temperatures, severe multi-organ damage, and disrupted energy metabolism (increased serum glucose [GLU] and decreased triglycerides [TG] and total cholesterol [TCHO]). Comparative transcriptomic analysis of heart, liver, spleen, lung, and kidney tissues revealed tissue-specific differential gene expression, with the liver and heart showing the highest number of differentially expressed genes (DEGs). KEGG enrichment analyses identified lipid metabolism pathways that are key to the multi-tissue acute heat stress response. Weighted gene co-expression network analysis (WGCNA) further identified 58 differentially modularized hub genes (DMHGs), of which 42 were hepatic differentially expressed genes, and most of these DMHGs were significantly enriched for fatty acid metabolic pathways. Fatty acid metabolic pathway-associated DMHGs were significantly correlated with rectal temperature, serum GLU, TG, lactate dehydrogenase (LDH), and aspartate aminotransferase (AST). Functional validation in primary hepatocytes demonstrated that overexpression of FASN attenuated heat stress-induced reductions in triglyceride levels.<h4>Conclusions</h4>The critical role of hepatic fatty acid metabolism in mediating the acute heat stress response in chickens was revealed by a multi-tissue comparative transcriptome, and it was determined that FASN provides actionable insights into improving heat tolerance in poultry through metabolic interventions.

SERPINC1
Also flagged:chronic diseasesDementiasubtle cognitive declinemild cognitive impairmentADcognitive impairment
Journal Article 2025-07-02 ✓ 2 Snippets Su H, Zhu J, Wang Y, Jin J, Guo Q.
In-Text Gene Mentions

…P < 0.001),ACE-III( r =…

…to MoCA-B andACE-IIIin distinguishing obj-SCD…

Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is one of the most common chronic diseases among the elderly. The Quick Dementia Rating System (QDRS) is a recognized cognitive assessment tool. The purpose of the current study was to evaluate the Chinese version of the QDRS (C-QDRS) as an early screening tool for elderly individuals.<h4>Methods</h4>The QDRS was translated into Chinese and its reliability and validity were assessed. A total of 366 people were recruited for the study, and all participants completed comprehensive neuropsychological tests. For reliability analysis, internal consistency was calculated using Cronbach's alpha coefficient. For validity analysis, the exploratory factor analysis (EFA) and confirmatory factor analysis (CFA) were carried out. Receiver operating characteristic (ROC) curve analyses were performed to evaluate the discriminative ability of the C-QDRS to identify cognitive impairment.<h4>Results</h4>C-QDRS scores increased progressively across groups: normal controls, objective subtle cognitive decline (obj-SCD), mild cognitive impairment (MCI), and AD. The C-QDRS demonstrated strong consistency, with a Cronbach's alpha of 0.923. The EFA showed a two-factor structure, and the CFA indicated that the model fit was satisfactory (χ<sup>2</sup>/df = 2.81, P < 0.001). There were strong correlations between the C-QDRS and standardized neuropsychological tests, indicating that the C-QDRS exhibited concurrent validity (all P < 0.001). ROC analyses showed optimal cutoff values of 1.0 for obj-SCD, 2.5 for MCI, and 5.0 for AD, with AUCs of 0.802, 0.840, and 0.907, respectively. The C-QDRS showed statistically superior discriminative ability compared to ACE-III and MoCA-B in detecting obj-SCD (both P < 0.05).<h4>Conclusions</h4>The C-QDRS is a precise and effective tool for screening both AD and preclinical AD in China.

SERPINC1
Also flagged:Sarcopeniacreatininecystatin CMild Cognitive ImpairmentADAging
Journal Article 2025-07-02 ✓ 1 Snippet Ren C, Hu T, Zhu J, Chu H, Guo Q.
In-Text Gene Mentions

…= 0.007) andACE-III( r =…

Show Full Abstract

<h4>Background</h4>Sarcopenia index (SI) is a novel biomarker calculated as serum creatinine/cystatin C for estimating skeletal muscle mass. Higher SI indicates a higher degree of muscle loss and reduced muscle function. The study aimed to determine whether SI could potentially serve as a predictive marker for MCI (Mild Cognitive Impairment) and AD (Alzheimer's disease).<h4>Methods</h4>A total of 176 participants ≥ 65 years of age were reviewed from the Department of Geriatrics at Shanghai Sixth People's Hospital between January 2019 and June 2021, and tracked their mortality between January 2019 and June 2021 were recorded. MCI and AD were respectively adapted from the criteria proposed by the Petersen RC and the National Institute on Aging-Alzheimer's Association workgroups on diagnostic guidelines for Alzheimer's disease. SI was calculated by serum creatinine (mg/dL)/cystatin C (mg/L) ×100. Logistic regression was used to examine the association between SI and the prevalence of MCI and AD. Cox regression was employed to analyze the relationship between SI and mortality.<h4>Results</h4>After adjusting for potential confounders, increasing levels of SI indicated lower odds of MCI and AD, and showed more pronounced OR values (OR per 1-SD = 0.47, 95% CI: 0.27-0.83 in MCI; OR per 1-SD = 0.38, 95% CI: 0.20-0.71 in AD). The best SI cut-off value for AD was 76.2, and for MCI was 75.7. A total of 27 participants with MCI or AD (20.0%) died. The mortality according to the tertiles of the SI was 36.5%, 13.3% and 5.3% in low (< 76.9), medium (76.9-88.2) and high (> 88.2) groups, respectively (P for trend < 0.001). A higher SI had a lower risk of 3-year all-cause mortality after adjusting for potential confounders (HR per 1-SD = 0.40, 95% CI: 0.22-0.72). MCI and AD patients in the high SI group (SI > 88.2) exhibited the highest survival rates.<h4>Conclusion</h4>Our study demonstrated that SI was independently associated with both MCI and AD in individuals aged 65 and older, and it can serve as a predictor of mortality in these populations.

Also flagged:gangliosidecell growthbrain tumourcancertumoursglioblastoma
Journal Article 2025-07-02 No Snippets Hein V, Baeza-Kallee N, Bergès R, Essakhi N, Soubéran A, Colin C, Morando P, Appay R, Graillon T, Tchoghandjian A, Figarella-Branger D, Tabouret E.
Show Full Abstract

<h4>Background</h4>Glioblastoma is the most aggressive primary brain tumour with no curative treatment and inevitable relapse. Therapeutic resistance is, at least, related to the presence of cancer stem-like cells in these tumours. Here, we aimed to demonstrate that the GD3 ganglioside was a relevant marker and actionable target for glioblastoma cancer stem-like cells.<h4>Methods</h4>To this end, we used commercial glioblastoma cell lines, human glioblastoma samples, organotypic culture and xenografted mouse models to study GD3 antigen expression and consequences of its downregulation through a shRNA strategy targeting the ST8SIA1 mRNA which encodes the key enzyme for GD3 synthesis. We performed mono-dimensional Thin Layer Chromatography to analyse ganglioside composition of the glioblastoma samples and RNA-seq analyses to reveal oncogenic pathways and more specifically transcripts affected by ST8SIA1 silencing. Besides, we evaluated GD3 role in stemness of glioblastoma cancer cell, phenotype, microenvironment interaction, and invasion abilities.<h4>Results</h4>We showed that GD3 is the main ganglioside in glioblastoma and that patient-derived cancer stem-like cell lines strongly expressed GD3. This GD3 + population decreased significantly after cell differentiation. GD3<sup>+</sup> cells sorted from patient samples had stem-like cell properties: they were plastic, clonogenic, and tumorigenic after orthotopic engraftment. Silencing of ST8SIA1/GD3 was associated with a decrease in sphere size, self-renewal and migratory capacities and increased mouse survival. Moreover, increased temozolomide sensitivity was recorded. Finally, data from RNA-seq showed that silencing ST8SIA1/GD3 decreased oncogenic pathways and more specifically the expression of ADAMTS1 and IL33 transcripts.<h4>Conclusions</h4>Taken together, our results suggest that GD3 ganglioside is essential for glioblastoma cancer stem-like cell properties, opening promising targeted therapeutic development.

SERPINC1
Also flagged:Equine Metabolic Syndromeendocrine disordermetabolic syndromeobesityinsulinID
Journal Article 2025-07-02 ✓ 1 Snippet Espinosa-López EM, Ortiz-Guisado B, Diez de Castro E, Durham A, Aguilera-Tejero E, Gómez-Baena G.
In-Text Gene Mentions

…the coagulation cascade (antithrombin-III(UniProtKB F7CYR1), coagulatio…

Show Full Abstract

BACKGROUND: Equine Metabolic Syndrome (EMS) is a multifactorial endocrine disorder characterized by obesity, insulin dysregulation (ID), and an increase in the risk of laminitis, a painful condition that can lead to euthanasia in severe cases. Diagnosing EMS is challenging and often relies on clinical history including obesity, difficulty in losing weight, and recurring episodes of laminitis. The gold standard for laboratory support of an EMS diagnosis is the identification of ID, with basal insulin being the simplest and most accessible method, especially in a field setting. However, various factors such as diet, age, stress, season, medications administered, and testing protocols can influence results. Dynamic tests like the oral sugar test (OST) are preferred but present limitations due to low sensitivity and poor repeatability. These diagnostic challenges make EMS difficult to detect in veterinary medicine highlighting the need for an effective method of the early detection of EMS to prevent laminitis and its associated complications. RESULTS: Mass spectrometry-based proteomics represents a powerful tool to identify biomarkers and explore molecular pathways related to the underlying pathology. In the current study we established an integrated proteomics pipeline to identify plasma biomarkers for EMS diagnosis. We compared plasma proteomes from healthy horses, non-ID obese horses and animals diagnosed with EMS. This comparison revealed 76 proteins with significant changes (1% FDR) between groups. CONCLUSIONS: Our study demonstrates that the complement system, the coagulation cascade and extracellular matrix remodelling pathways are altered in EMS. These findings offer new insights into the molecular basis of the development of EMS and led to the nomination of several proteins as potential biomarkers for its early detection.

ZNF644
Also flagged:Pancreatic ductal adenocarcinomaPDACcarcinomacancerdeathtumor
Journal Article 2025-07-02 ✓ 4 Snippets Guo P, Fang H, Shi H, Zhang J, Song G, Fan C, Qiu X, Lin X, Wen S, Feng J, Huang H, Teng T.
In-Text Gene Mentions

…Five proteins (ZDHHC20,ZNF644, GNL2, PDGFRB, and…

…B), with ZDHHC20,ZNF644, and INE80E significantly…

…xpressions, including ZDHHC20,ZNF644, and INE80E, were…

…altered proteins (ZDHHC20,ZNF644, GNL2, PDGFRB, INO80E),…

Show Full Abstract

<h4>Background</h4>Patient-derived xenograft (PDX) models are crucial for tumor biology and therapeutic response evaluations. The metabolic, transcriptomic, and proteomic changes in PDX models derived from pancreatic ductal adenocarcinoma (PDAC) during serial passaging remain poorly understood.<h4>Methods</h4>We established 33 PDX models from 43 PDAC patients and collected 40 benign pancreatic tissues as controls for metabolomic analysis using <sup>1</sup>H NMR spectroscopy. Multi-generational PDX models (P1-P3) from six patients were analyzed for molecular characteristics. Transcriptomic and proteomic analyses were performed using RNA-seq and 4D-DIA mass spectrometry, identifying differentially expressed genes (DEGs) and proteins, which were then subjected to enrichment analysis to uncover key biological functions. A gene-protein interaction network was constructed to identify functional modules across passages.<h4>Results</h4>PDX tumors closely mirrored primary tumors in metabolic characteristics, maintaining key metabolic features of PDAC with minor variations in amino acid metabolism, particularly glutamine and aspartate levels. PDX-2 and PDX-3 showed dysregulation in aminoacyl-tRNA biosynthesis and glycine, serine, and threonine metabolism. DEGs progressively increased across passages, with later-generation PDX models exhibiting transcriptional dysregulation, including enhanced MAPK signaling activity and reduced immune-related pathway expression. Proteomic analysis identified five consistently altered proteins (ZDHHC20, ZNF644, GNL2, PDGFRB, INO80E), indicative of enhanced signal transduction, cell cycle regulation, and DNA repair. Gene-protein interaction analysis identified four core functional modules involved in protein degradation, DNA repair, ribosome biogenesis, and inflammatory response.<h4>Conclusion</h4>PDX models undergo adaptive changes during serial passaging while retain primary tumor characteristics, making them a valuable tool for understanding tumor evolution and informing therapeutic strategies, provided that passage-related drift is carefully considered.

HFE
Also flagged:NR2F6orphan receptorironmetabolismiron regulatory proteinshypoferremia
Journal Article 2025-07-02 ✓ 1 Snippet Woelk J, Pfeifhofer-Obermair C, Benz J, Brigo N, Bamberger M, Kleiter A, Hermann M, Weiss G, Hermann-Kleiter N.
In-Text Gene Mentions

…iron regulator (Hfe), an atypical…

Show Full Abstract

Nuclear receptors regulate key functions of mononuclear phagocytes and are critical components of the innate immune system, acting as regulators of organ health and disease. In healthy mice, the loss of the nuclear orphan receptor NR2F6 alters tissue-resident macrophage populations in the liver, lung, and spleen. In response to Salmonella Typhimurium infection, Nr2f6-deficient mice exhibit improved clinical outcomes, characterized by reduced weight loss, bacterial loads in the spleen and liver, and decreased plasma pro-inflammatory cytokines. Despite unchanged basal iron metabolism in the spleen and liver, iron regulatory proteins and the interleukin (IL)-6-hepcidin axis are altered in Nr2f6-deficient mice during Salmonella infection, reducing hypoferremia. Transcriptomic analysis of splenic red pulp macrophages reveals significant alterations of phagocytosis-related genes, including upregulation of signal-regulatory protein alpha (Sirpa). In vitro, phagocytosis of red blood cells, regulated by the inhibitory CD47-Sirpα axis, and Salmonella Typhimurium phagocytosis are significantly impaired in Nr2f6-deficient splenic macrophages. Blocking Sirpα in vitro restores the phagocytic activity of Nr2f6-deficient macrophages to wild-type levels. In vivo, Salmonella Typhimurium loads are partially increased post-infection in anti-Sirpα treated Nr2f6-deficient mice. These findings uncover a previously unrecognized role of NR2F6 in host-pathogen interactions, positioning it as a potential therapeutic target for infectious diseases.

Also flagged:FerritinTransferrinironmenopausehemeTS
Journal Article 2025-07-02 No Snippets Barton JC, Barton JC, Acton RT.
Show Full Abstract

<h4>Background</h4>We sought to determine associations of serum ferritin (SF) with live birth numbers and other iron-related variables in women with <i>HFE</i> p.C282Y (rs1800562) homozygosity.<h4>Methods</h4>We studied non-pregnant, non-Hispanic white women in post-screening evaluations to determine associations of SF with age, pregnancy and live birth numbers, dichotomous menopause and therapeutic phlebotomy reports, daily food and supplemental iron intakes, and transferrin saturation (TS).<h4>Results</h4>There were 136 women with mean age 51 ± 13 (SD) years and median SF 238 µg/L (range: 8, 2960). There were 376 pregnancies (median: 3/woman (1, 8)) and 296 live births (median: 2/woman (0, 6)). A total of 70 women (51.5%) reported menopause and 31 women (22.8%) reported phlebotomy. Median heme + non-heme food iron intake was 13.4 mg/d (3.1, 57.3). Mean TS was 62 ± 25%. Pearson's coefficient of ln SF versus age was 0.1955 (<i>p</i> = 0.0226). Median SF of women with and without menopause was 386 µg/L (8, 2960) and 165 µg/L (8, 1894), respectively (<i>p</i> < 0.0002). SF associations with phlebotomy and iron intakes were not significant. Spearman's coefficient of SF versus TS was 0.5079 (<i>p</i> < 0.0001). Four mean ln SF values of 66 women without menopause subgrouped by live birth numbers were similar (one-way ANOVA <i>p</i> = 0.4460). Multiple regressions on SF using pregnancy numbers revealed positive associations with menopause (<i>p</i> = 0.0157) and TS (<i>p</i> < 0.0001) and using live birth numbers revealed positive associations with live births (<i>p</i> = 0.0389), menopause (<i>p</i> = 0.0305), and TS (<i>p</i> < 0.0001).<h4>Conclusions</h4>SF levels in 136 women with p.C282Y homozygosity are positively associated with age, numbers of live births, menopause reports and TS.

Also flagged:sepsisGene expressionTNFIL-10CCL3CCL4
Journal Article 2025-07-02 No Snippets Wu SC, Rau CS, Wu YC, Lin CW, Lu TH, Tsai CW, Yang MY, Hsieh CH.
Show Full Abstract

<h4>Background</h4>Sepsis-induced acute lung injury remains a leading cause of mortality in critically ill patients, with limited effective treatments beyond supportive care. This study investigates the therapeutic efficacy and underlying mechanisms of adipose-derived stem cell (ADSC) exosomes on sepsis-induced lung injury and characterizes underlying cellular and molecular mechanisms.<h4>Methods</h4>We employed a cecal ligation and puncture (CLP) mouse model of sepsis and using male C57BL/6J mice ( Mus musculus , 8-10 weeks old) and administered ADSC-derived exosomes intravenously. Animals were randomly assigned to Sham, CLP, or CLP + ADSC-exosome groups. Survival rates ( n =12 for each group) and lung histopathology ( n =5 for each group) were assessed. Single-cell RNA sequencing was performed on lung tissues to analyze cell type-specific transcriptomic changes and intercellular communication networks ( n =2 for each group).<h4>Results</h4>ADSC exosome treatment significantly improved survival rates and reduced lung pathology in CLP mice. Treatment altered lung cellular composition, increasing neutrophils, NKT cells, and monocytes while decreasing B and T cells. Gene expression analysis revealed downregulation of pro-inflammatory markers (TNF, IL-10, CCL3, and CCL4) and upregulation of tissue repair pathways. In neutrophils, exosomes reduced expression of respiratory burst genes while enhancing tissue repair mechanisms. In monocytes, treatment suppressed inflammatory cytokine production while promoting anti-inflammatory phenotypes. Exosome treatment is associated with transcriptomic changes suggestive of restored intercellular communication networks disrupted by sepsis, with increased signaling via CSF3, ANGPT, SPP1, and CCL pathways.<h4>Conclusion</h4>ADSC-derived exosomes effectively treat sepsis-induced lung injury by rebalancing the cellular environment and restoring homeostasis through modulation of immune cell function and intercellular communication, offering potential as a cell-free novel therapeutic approach for sepsis-related pulmonary complications.

Also flagged:Prostate cancercancerlocalized diseasemetastatic prostate cancerandrogentestosterone
Journal Article 2025-07-02 No Snippets Severson TM, Minnee E, Zhu Y, Schuurman K, Nguyen HM, Brown LG, Hakkola S, Menezes R, Gregoricchio S, Kim Y, Kneppers J, Linder S, Stelloo S, Lieftink C, van der Heijden MS, Nykter M, van der Noort V, Sanders J, Morris B, Jenster G, van Leenders GJ, Pomerantz M, Freedman ML, Beijersbergen RL, Urbanucci A, Wessels L, Nelson PS, Corey E, Prekovic S, Zwart W, Bergman AM.
Show Full Abstract

Androgen receptor (AR) signaling inhibitors, including enzalutamide, are treatment options for patients with metastatic castration-resistant prostate cancer (mCRPC), but resistance inevitably develops. Using metastatic samples from a prospective phase 2 clinical trial, we epigenetically profile enhancer/promoter activities with acetylation of lysine residue 27 on histone 3 (H3K27ac) chromatin immunoprecipitation followed by sequencing, before and after AR-targeted therapy. We identify a distinct subset of H3K27ac-differentially marked regions that are associated with treatment responsiveness, which we successfully validate in mCRPC patient-derived xenograft (PDX) models. In silico analyses reveal histone deacetylase (HDAC)3 to critically drive resistance to hormonal interventions, which we validate in vitro. Critically, we identify the pan-HDAC inhibitor vorinostat to be effective in decreasing tumor cell proliferation, both in vitro and in vivo. Moreover, we uncover evidence for HDAC3 working together with glucocorticoid receptor (GR) as a potential mechanism for this therapeutic effect. These findings demonstrate the rationale for therapeutic strategies including HDAC inhibitors to improve patient outcome in advanced stages of mCRPC.

DCC
Also flagged:axon guidance receptorsRobo receptorsaxonsRobo1Robo3axon guidance
Journal Article 2025-07-02 ✓ 1 Snippet Loy A, Daiber T, Evans TA.
In-Text Gene Mentions

DCC

Show Full Abstract

The Roundabout (Robo) family is an evolutionarily conserved group of axon guidance receptors that regulate midline crossing in a wide range of animal groups by signaling midline repulsion in response to Slit ligands. However, it is not known whether Robo receptors from different species signal midline repulsion via equivalent mechanisms. To examine the evolutionary conservation of midline repulsive signaling, here we express Robo family proteins from mouse in neurons of the fruit fly, Drosophila melanogaster. We show that Robo proteins which normally function in canonical Slit-dependent midline repulsion in the mouse (mRobo1 and mRobo2) can also repel Drosophila axons from the midline in the fly embryonic ventral nerve cord, and can partially rescue the ectopic midline crossing defects caused by loss of Drosophila robo1, though less efficiently as Drosophila Robo1 itself. In contrast, mouse Robo3 isoforms (mRobo3.1 and mRobo3.2) which do not normally respond to Slit have no detectable effect on axon guidance when expressed in fly embryos. We further show that the differences in midline repulsive signaling effectiveness between fly and mouse Robos is not due to a simple difference in Slit affinity conferred by the Slit-binding Ig1 domain. Together, our results support the idea that the core signaling mechanisms employed by Robo family receptors are conserved across bilaterians, though some degree of evolutionary divergence has decreased the ability of receptors from different bilaterian clades to directly substitute for one another.

HTT
Also flagged:Neurodegenerative diseasesageingADPDHDAmyotrophic lateral sclerosis
Journal Article 2025-07-02 ✓ 1 Snippet Chen P, Wang F, Ling B, Zhu Y, Lin H, Huang J, Wang X.
In-Text Gene Mentions

…sequences in theHTTgene, resulting in…

Show Full Abstract

Neurodegenerative diseases are a group of chronic diseases characterized by a gradual loss of neurons that worsens over time and dysfunction. These diseases are extremely harmful, not only affecting the physical health of the patients, but also having a serious impact on their quality of life. They mainly include Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), Amyotrophic lateral sclerosis (ALS), etc. Their pathogenesis is complex, and it is difficult for the existing treatments to effectively slow down the progression of the disease. In recent years, Mesenchymal Stem Cells (MSCs) have received widespread attention for their anti-inflammatory, immunomodulatory and neuroprotective properties. In this context, MSC-derived Extracellular Vesicles (MSC-EVs) have demonstrated unique therapeutic potential as a cell-free therapeutic strategy. MSC-EVs are rich in bioactive substances such as proteins, lipids, mRNAs and miRNAs, which can pass through the blood-brain barrier and be targeted to the diseased area to regulate neuronal survival, synaptic plasticity and neuroinflammatory responses. In addition, compared with stem cell therapy, MSC-EVs have the advantages of low immunogenicity, easy storage and transportation, and avoiding ethical controversies. However, their clinical application still faces challenges: standardized isolation and purification techniques have not been unified, vesicle loading efficiency and targeting need to be further optimized, and long-term safety needs to be systematically evaluated. This review focuses on the role of MSC-EVs in the development of neurological diseases and explores their possible dual roles, both favorable and unfavorable, in the context of neurological diseases. In addition, this review provides a review of current studies on EVs as potential biomarkers for the diagnosis and treatment of neurodegenerative diseases and provides a comprehensive review of the prospects and challenges of MSC-EVs in clinical applications.

Also flagged:p62AutophagyorganellesSQSTM1bindingmicrotubule-associated protein light chain 3
Journal Article 2025-07-02 No Snippets Xiao S, Yu Y, Liao M, Song D, Xu X, Tian L, Zhang R, Lyu H, Guo D, Zhang Q, Chen XZ, Zhou C, Tang J.
Show Full Abstract

Autophagy is a highly conserved cellular process that plays a crucial role in maintaining cellular homeostasis by degrading damaged organelles, misfolded proteins, and other cellular components. p62/SQSTM1 functions as a selective autophagy receptor by binding polyubiquitinated cargo through its UBA domain and linking it to microtubule-associated protein light chain 3 (LC3)-decorated autophagosomes. Moreover, p62 acts as a signaling hub and is essential in response to various stressors, including nutrient deprivation and oxidative stress. Post-translational modifications (PTMs) critically regulate p62's multifaceted roles, controlling p62's phase separation, cargo recruitment, signaling interactions, and autophagic degradation efficiency. The dysregulation of p62 PTMs is closely related to the occurrence and development of human diseases, particularly neurodegenerative disorders and certain cancers. This review summarizes the main PTM events of p62 discovered to date that influence the autophagy process, including phosphorylation, acetylation, ubiquitination, and S-acylation, as well as their known contributions to protein aggregation and disease. The PTMs of p62 dynamically regulate autophagy, protein aggregation, and cellular signaling, underscoring its importance as a potential therapeutic target and biomarker for these diseases.

SOX6
Also flagged:articular cartilage injurieshypoxia-inducible factor-1αHIF-1αSRY-box transcription factor 9SOX9osteoarthritis
Journal Article 2025-07-02 ✓ 1 Snippet Nakamura K, Inoue A, Arai Y, Nakagawa S, Fujii Y, Cha R, Sugie K, Hayashi K, Kishida T, Mazda O, Takahashi K.
In-Text Gene Mentions

…with SOX5 andSOX6, forms the SOX…

Show Full Abstract

Bone marrow stimulation is a treatment for articular cartilage injuries that promotes cartilage repair by inducing the migration and accumulation of mesenchymal stem cells (MSCs), but often results in fibrocartilage with limited durability. This study aimed to investigate the effect of hypoxic conditions on cartilage repair using a rat osteochondral defect model. Osteochondral defects (1.0 mm in diameter) were created in the femoral trochlear groove, and rats were exposed to hypoxic conditions (12% O<sub>2</sub>) for 4 weeks postoperatively. Histological analysis was performed, and protein expression of hypoxia-inducible factor-1α (HIF-1α) and SRY-box transcription factor 9 (SOX9) in the repair tissue was evaluated after 1 week. As a result, after 1 week, protein expression of HIF-1α and SOX9 in the Hypoxia group was significantly increased compared to the Normoxia group. After 4 weeks, the Hypoxia group exhibited a hyaline cartilage-like tissue structure with a significantly lower Modified Wakitani score compared to the Normoxia group. Furthermore, after 4 weeks, the inhibition of HIF-1α suppressed cartilage repair. These findings suggest that hypoxic conditions promote SOX9 expression via HIF-1α during the early phase of MSC chondrogenic differentiation and promote the formation of hyaline cartilage-like repair tissue. In conclusion, bone marrow stimulation under hypoxic conditions may enhance the repair effect on articular cartilage injuries.

HTTSOX6
Also flagged:Epigenomegene expressionmetabolic disordersbindingzinc-finger proteinschromatin
Journal Article 2025-07-02 ✓ 2 Snippets Kovalev MA, Mamaeva NY, Kristovskiy NV, Feskin PG, Vinnikov RS, Oleinikov PD, Sosnovtseva AO, Yakovlev VA, Glukhov GS, Shaytan AK.
In-Text Gene Mentions

…repeats in theHTTgene, which encodes…

…the SOX5 andSOX6genes.…

Show Full Abstract

Epigenome engineering, particularly utilizing CRISPR/dCas-based systems, is a powerful strategy to modulate gene expression and genome functioning without altering the DNA sequence. In this review we summarized current achievements and prospects in dCas-mediated epigenome editing, primarily focusing on its applications in biomedicine, but also providing a wider context for its applications in biotechnology. The diversity of CRISPR/dCas architectures is outlined, recent innovations in the design of epigenetic editors and delivery methods are highlighted, and the therapeutic potential across a wide range of diseases, including hereditary, neurodegenerative, and metabolic disorders, is examined. Opportunities for the application of dCas-based tools in animal, agricultural, and industrial biotechnology are also discussed. Despite substantial progress, challenges, such as delivery efficiency, specificity, stability of induced epigenetic modifications, and clinical translation, are emphasized. Future directions aimed at enhancing the efficacy, safety, and practical applicability of epigenome engineering technologies are proposed.

ZNF644
Also flagged:Spinal cord injuryfecal incontinenceoxygennucleosomechromatinhistones
Journal Article 2025-07-02 ✓ 1 Snippet Sun Y, Gao J, Jing J.
In-Text Gene Mentions

…construction: ZNF883, ZNF614,ZNF644, ZNF280C, TP53, ZNF140,…

Show Full Abstract

<h4>Introduction</h4>The biological roles of histone lactylation (HLA) modification-related genes (HLMRGs) in spinal cord injury (SCI) remain unclear. This study aimed to investigate the expression patterns and molecular mechanisms of HLMRGs in SCI through bioinformatics approaches.<h4>Methods</h4>Data from GSE151371, GSE47681, and 10 HLMRGs were analyzed. Subsequently, biomarkers were identified based on receiver operating characteristic (ROC) curves, followed by logistic regression modeling and nomogram construction. Gene set enrichment analysis (GSEA) was performed to assess the functional roles of these biomarkers. Clustering analysis of samples based on biomarkers revealed distinct groups, and differentially expressed genes between these groups were analyzed. Inter-cluster comparisons were conducted to examine Hallmark pathways, HLA genes, and immune functions. Weighted gene co-expression network analysis (WGCNA) was applied to identify cluster-related module genes, which were further used for protein-protein interaction (PPI) network construction to pinpoint key proteins. Networks linking miRNAs, transcription factors (TFs), and biomarkers, as well as drug-biomarker interactions, were established. The expression of biomarkers was validated through reverse transcription-quantitative polymerase chain reaction (RT-qPCR).<h4>Results</h4>In GSE151371, eight biomarkers (<i>HDAC1</i>, <i>HDAC2</i>, <i>HDAC3</i>, <i>SIRT1</i>, <i>SIRT3</i>, <i>LDHA</i>, <i>LDHB</i>, and <i>GCN5</i> [<i>KAT2A</i>]) exhibited area under the curve (AUC) > 0.7 and were significantly differentially expressed between SCI and control samples. These biomarkers also showed differential expression across the two identified clusters. Differential expression analysis between clusters 1 and 2 revealed enrichment in pathways such as the 'phosphatidylinositol signaling system.' Finally, a miRNA-TF-biomarker network involving the eight biomarkers was constructed, and their expression was validated by RT-qPCR. It is noteworthy that the expression of <i>HDAC2</i>, <i>GCN5</i> (<i>KAT2A</i>), <i>LDHA</i>, <i>HDAC3</i>, and <i>SIRT3</i> showed significant differences between SCI and control samples. This suggests that these genes may have potential clinical significance in SCI and warrant further validation. Additionally, by exploring their mechanisms of action in depth, they may provide important biomarkers for the early diagnosis, treatment strategy optimization, and personalized medicine of SCI, thereby advancing clinical research and drug development related to SCI.<h4>Conclusion</h4>In summary, 8 biomarkers playing an important role in SCI were identified, providing a reference for the application of HLMRGs in SCI.

Also flagged:Nucleotideamino acidnucleotidesretrotranspositionhereditary disordersdideoxynucleotides
Journal Article 2025-07-02 No Snippets Chaushevska M, Alapont-Celaya K, Schack AK, Krych L, Garrido Navas MC, Krithara A, Madjarov G.
Show Full Abstract

Short tandem repeats (STRs) are repetitive DNA sequences that contribute to genetic diversity and play a significant role in disease susceptibility. The human genome contains approximately 1.5 million STR loci, collectively covering around 3% of the total sequence. Certain repeat expansions can significantly impact cellular function by altering protein synthesis, impairing DNA repair, and leading to neurodegenerative and neuromuscular diseases. Traditional short-read sequencing struggles to accurately characterize STRs due to its limited read length, which limits the ability to resolve repeat expansions, increases mapping errors, and reduces sensitivity for detecting large insertions or interruptions. This review examines how long-read sequencing technologies, particularly Oxford Nanopore and PacBio, overcome these limitations by enabling direct sequencing of full STR regions with improved accuracy. We discuss challenges in sequencing, bioinformatics workflows, and the latest computational tools for STR detection. Additionally, we highlight the strengths and limitations of different methods, providing deeper insight into the future of STR genotyping.

UNC13C
Also flagged:olfactioncognitive impairmentolfactory disordersanxietyshort-chainfatty acids
Journal Article 2025-07-02 ✓ 2 Snippets Zhao X, Xue C, Wang Y, Liu X, Li R, Yi X.
In-Text Gene Mentions

…(CPLX1), Uncoordinated-13 C (UNC13C), and Second vesicular…

…level of CPLX1,UNC13C, and VGLUT2 was…

Show Full Abstract

<h4>Introduction</h4>Olfactory dysfunction and cognition decline are frequently observed; however, very little is known about whether olfactory disorders trigger cognitive impairment.<h4>Methods</h4>Here, we induced olfactory loss in mice and investigated whether and how olfactory loss induces cognitive impairment and anxiety behavior.<h4>Results</h4>Olfactory loss not only causes a significant decrease in food intake and body weight and an increase in O<sub>2</sub> consumption but also induces cognitive impairment and anxiety behavior. Olfactory loss-induced alteration of the gut microbiota is associated with subsequent changes in cecal short-chain fatty acids and serum neurotransmitter levels. Hippocampus proteome and fecal microbial transplantation provide further support for the mechanisms by which olfactory loss triggers cognitive impairment and anxiety behavior via the microbiota-gut-brain axis.<h4>Discussion</h4>Our study is expected to provide some evidence for olfactory dysfunction in triggering cognitive impairment through the microbiota-gut-brain axis.

Also flagged:Cancertumourstumourviral tumourtumorsinfectious disease
Journal Article 2025-07-02 No Snippets Maimets T.
Show Full Abstract

John Cairns, a British molecular biologist, has pointed out that biology and cancer research have always developed together, and cancer theories have followed "whatever branch of biology happens at the time to be fashionable and exciting". Indeed, following the long historical development of biological thought confirms this observation. However, tumour theories have never been merely a "fellow runner" to more modern biology theories. Cancer is an exceptionally large medical and economic problem, and the practical results of cancer research are carefully followed and critically analysed by the community. If the expected results do not arrive and the scientific data do not fit into the old theory, then the theory must be corrected. In other words, tumour theories not only derive from the prevailing biological worldview, but they also influence and, if necessary, actively change it. That is exactly what we are witnessing today-the ruling reductionist Somatic Mutations Theory (SMT) does not explain many new experimental findings and extensive research over the last 50 years has not brought major breakthroughs in cancer treatment. This century brings back the attention to developmental biology (embryology) in connection with the epigenetic revolution in biology, and the causes of tumours are searched for in the disorders of differentiation of cells/tissues and communication between them in the organism.

Also flagged:kinasetranscriptional co-activatorbindingTAZcell proliferationlarge tumor suppressor kinase 1
Journal Article 2025-07-02 No Snippets Zhang J, Wu H, Ren X, Chen Z, Ye S, Chen S, Fang J, Wu Q, Zhao T.
Show Full Abstract

The Hippo/yes-associated protein (YAP) signaling is an evolutionarily conserved regulator in organ size control, which plays pivotal roles in cell proliferation, differentiation, apoptosis, and tissue regeneration. In cancer, dysregulation of Hippo/YAP signaling is typically recognized as one of the crucial drivers in tumorigenesis. However, beyond its canonical transcriptional targets, Hippo/YAP signaling engages in extensive crosstalk with multiple pathways to form an intricate regulatory network, thereby giving rise to its content-dependent influence on tumor initiation, progression and metastasis. This review focuses on the molecular mechanisms underlying the interplay between Hippo/YAP and pivotal signaling pathways such as nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), wingless-type (Wnt)/β-catenin signaling pathway, transforming growth factor-beta (TGF-β), Hedgehog, Notch and other signaling pathways, as well as their implications in cancer biology. Ultimately, exploiting these mechanisms may represent promising therapeutic strategies for cancer.

DCC
Also flagged:tearsshoulder disordersdegradationrotator cuff tearsTNF-αIL-6
Journal Article 2025-07-02 ✓ 3 Snippets Inoue K, Uchida K, Matsumoto M, Tazawa R, Ohta E, Hattori A, Kenmoku T, Ito Y, Uekusa Y, Inoue G, Takaso M.
In-Text Gene Mentions

…models, aberrant netrin-1:DCCsignaling drives pathological…

…mor-derived netrin-1 activatesDCCto promote nociceptive…

…neuron sprouting, andDCCinhibition attenuates hyperalg…

Show Full Abstract

Rotator cuff tears are a leading cause of shoulder pain and dysfunction, yet the molecular mechanisms that link tendon injury to inflammation and nociceptive signaling remain poorly understood. Netrin-1, a classical axon guidance cue signaling through dependence receptors UNC5B and Neogenin-1, has been implicated in both neuronal plasticity and inflammatory processes, but its role in tendon pathology has not been explored. A rat supraspinatus tear model was employed to assess, in vivo, the expression of genes encoding netrin-1 (<i>Ntn1</i>) and its receptors (<i>Unc5b</i> and <i>Neo1</i>) at 0, 7, 14, 28, and 56 days post-injury (n = 10 per time point). Primary rat tenocytes isolated from rotator cuff tissue were treated in vitro with recombinant netrin-1, and transcriptional changes in genes encoding TNF-α (<i>Tnfa</i>), IL-6 (<i>Il6</i>), MMP-1 (<i>Mmp1</i>), and MMP-3 (<i>Mmp3</i>) were quantified by qRT-PCR. Separately, human iPSC-derived sensory neurons were exposed to netrin-1, and dose- and time-dependent effects on neurite outgrowth were measured at 4 and 14 days in culture. In injured tendons, <i>Ntn1</i> mRNA increased significantly at day 14 (<i>p</i> = 0.010) and 28 (<i>p</i> = 0.042), <i>Unc5b</i> at day 7 (<i>p</i> = 0.002) and 14 (<i>p</i> < 0.001), and <i>Neo1</i> at day 14 (<i>p</i> < 0.001) versus intact controls. Tenocyte exposure to 500 ng/mL netrin-1 induced transient upregulation of <i>Tnfa</i> (3 h, <i>p</i> = 0.023; 6 h, <i>p</i> = 0.009) and <i>Il6</i> (3 h-24 h, all <i>p</i> < 0.013), as well as <i>Mmp3</i> (3-24 h, <i>p</i> < 0.043) and <i>Mmp1</i> (6 h-24 h, <i>p</i> < 0.024); no induction was observed at 50 ng/mL. In sensory neurons, 50 ng/mL of netrin-1 enhanced neurite extension at day 4 (<i>p</i> = 0.006) but not at 500 ng/mL or at day 14 for either dose. Netrin-1 and its receptors are upregulated in a rat rotator cuff tear model, and netrin-1 elicits distinct pro-inflammatory and matrix-remodeling responses in tenocytes while promoting early neurite growth in sensory neurons. These findings suggest netrin-1 as a key modulator of tendon inflammation, matrix turnover, and peripheral nerve plasticity following injury.

Also flagged:sodiumsulfatepolyacrylamidereproductioncatalytic activityhydrolase
Journal Article 2025-07-02 No Snippets Diansyah AM, Santoso S, Herdis H, Hasbi H, Saili T, Suyatno S, Said S, Kostaman T, Surachman M, Pamungkas FA, Adiati U, Anwar RI, Iskandar H, Rahmat R, Hasrin H.
Show Full Abstract

<h4>Objective</h4>This study aimed to conduct a proteomic analysis of the seminal plasma using advanced proteomic techniques in Bali-polled bulls in order to assess fertility.<h4>Materials and methods</h4>Semen samples from Bali-polled bulls (<i>n =</i> 5) were analyzed via one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis for protein separation, followed by liquid chromatography-mass spectrometry for peptide identification. Data were processed using the UniProt bovine protein database and STRING software.<h4>Result</h4>A total of 84 proteins were identified, with two remaining unclassified. These proteins were categorized into key biological processes, including reproduction, regulation of biological quality, and catabolic processes. Molecular functions predominantly included catalytic activity, hydrolase activity, and peptidase regulator activity, while cellular components were primarily associated with the extracellular region, vesicles, and lysosomes. Thirteen proteins were identified as directly linked to fertility functions: SPADH1, Binder of Sperm Proteins 3, SPADH2, ANG, Binder of Sperm Proteins 5, TEX101, ELSPBP1, FOLR3, TCP1, LDHC, HEXA, SPAM1, and CTSB. These proteins were further analyzed for their functional relevance to reproductive biology.<h4>Conclusion</h4>While these findings provide preliminary insights into fertility-related biomarkers for Bali-polled bulls, further validation and statistical analysis are required to confirm their diagnostic and breeding potential. This proteomic analysis represents a first step toward understanding the molecular mechanisms of fertility in this underrepresented breed, contributing to improved breeding strategies and genetic resource management. Future studies should aim to expand the sample size, validate the identified biomarkers through experimental assays, and explore their potential for broader applications in bovine fertility management.

PTGIS
Also flagged:CTEPHpulmonary hypertensionPHright heart failuredeathpulmonary embolism
Journal Article 2025-07-02 ✓ 1 Snippet Man HJ, Zhao YD, Asghar U, Wu L, Yeung JC, Granton JT, de Perrot M.
In-Text Gene Mentions

…or prostacyclin synthase (PTGIS) (Supplementary Fig. 10…

Show Full Abstract

Chronic thromboembolic pulmonary hypertension (CTEPH) is a life-threatening condition characterized by unresolved thrombi obstructing the pulmonary arteries. Endothelial cells (ECs) are essential regulators of thrombosis and thrombus resolution, yet their molecular phenotypes in CTEPH are incompletely understood. Using single-cell RNA sequencing of CTEPH surgical specimens and control ECs from the Human Lung Cell Atlas, we uncover marked EC heterogeneity in CTEPH. Compared to controls, CTEPH ECs display marked phenotypic shifts, with the loss and emergence of distinct EC subpopulations, including a unique subset co-expressing pulmonary and bronchial EC markers. Our analysis reveals perturbed endothelial thrombosis regulation, encompassing coagulation, fibrinolysis, inflammation, TGF-β signaling, and angiogenesis, while identifying novel target genes. These findings provide a comprehensive view of endothelial contributions to delayed thrombus resolution, offering new insights into the pathophysiology of CTEPH and potential therapeutic targets.

Research Square 2025-07-02 Preprint (No Snippets API) Qausain S, Khan FI, Rehman MT, AlAjmi MF, Khan MKA.
Show Full Abstract

<title>Abstract</title> <p>1-Cys Peroxiredoxin 6 (Prdx6) is a unique bifunctional antioxidant enzyme highly expressed in mammalian lungs. It plays a dual role in cancer, acting as both a suppressor and promoter during different stages of tumor development. Prdx6 exhibits two distinct enzymatic activities: phospholipase A2 (PLA2) activity for phospholipid cleavage and peroxidase activity that reduces reactive oxygen species. The peroxidase catalytic site comprises Pro40, Thr44, Cys47, and Arg132, while second-shell residues—Glu50, Leu71, Ser72, His79, and Arg155—surround the active site and are conserved across peroxiredoxin families. Despite growing interest in Prdx6 as a therapeutic target, the structural determinants that stabilize its active conformation remain poorly understood. Particularly, the α5-helix region of Prdx6 can shift between fully folded and locally unfolded conformations to facilitate substrate binding and catalysis. This study focused on Arg155, a conserved second-shell residue, to assess its role in enzyme structure and function. Using site-directed mutagenesis, we generated Arg155 mutants and compared them with wild-type Prdx6 through biochemical, biophysical, and in silico analyses. The mutants displayed reduced thermal and urea stability, diminished peroxidase activity, and conformational alterations. These losses were attributed to the absence of stabilizing interactions normally provided by the Arg155 side chain. Our findings highlight Arg155 as a critical determinant of Prdx6 structural stability and catalytic efficiency. Understanding its role may aid in developing selective inhibitors or modulators of Prdx6 for oxidative stress-related diseases, including cancer.</p>

HFE
Also flagged:Ironmineraliron overload disordersosteoporosisoverloadingalcohol
Journal Article 2025-07-01 ✓ 5 Snippets Burden AM, Martinez-De la Torre A, Burkard T, Immoos M, Hofbauer LC, Steinbicker AU, Rauner M, Rauner M.
In-Text Gene Mentions

…cell disease, orhemochromatosis.…

…to screen forhemochromatosis—but they can also…

…a diagnosis ofhemochromatosis, thalassemia, sickle cell…

…code for thalassemia,hemochromatosis, or sickle cell…

…a diagnosis ofhemochromatosis(n = 4288,…

Show Full Abstract

<h4>Introduction</h4>Iron overloading disorders are associated with decreased bone mineral density. However, evidence on fracture risk is scarce. Therefore, we evaluated the risk of fracture associated with iron overload disorders compared to matched controls.<h4>Methods</h4>Using The Healthcare Improvement Network, a Cegedim database of UK general practice data, we identified patients >18 years with elevated iron (ferritin value >1000 µg/L) or an eligible diagnosis code for iron overloading disorders between 2010 and 2022. The first date of elevated iron or a diagnosis code defined the index date for iron overload patients, who were matched with up to 10 controls. Time-varying confounder-adjusted Cox proportional hazard models estimated the hazard ratios (HRs) and 95% confidence intervals. Analyses were stratified by osteoporotic fracture site (hip, vertebral, humerus, forearm) and evidence of elevated serum ferritin at baseline (ferritin >1000 µg/L), and sex.<h4>Results</h4>We identified 20 264 eligible patients and 192 956 controls. Overall, there was a 55% increased risk of any fracture among iron overload patients (HR 1.55 [1.42-1.68]). Fracture risk was increased at all sites, with the highest risk observed for vertebral fractures (HR 1.97 [1.63-2.10]). Patients with ferritin >1000 µg/L had a 91% increased risk of any fracture (HR 1.91 [1.73-2.16]) and a 2.5-fold increased risk of vertebral fractures (HR 2.51 [2.01-3.12]). There was no increased risk among patients without elevated serum ferritin at any site. Fracture risk was similar between sexes.<h4>Discussion</h4>This large population-based cohort study found a 55% increased risk of fracture associated with iron overload. The risk was highest among patients with laboratory-confirmed iron overload, highlighting the importance for clinicians to consider initiating osteoporosis therapy in patients with serum ferritin >1000 µg/L to minimize fracture risk.

DCC
Also flagged:medulloblastomaorganizationnucleuschromatintumorsingle-nucleus
Journal Article 2025-07-01 ✓ 1 Snippet Li J, Liu H, Wang Z, Zhang J, Chen X, Daniels C, Wu X, Saulnier O, Suzuki H, De Antonellis P, Rasnitsyn A, Ong W, Wang EY, Hendrikse LD, Su Y, Tian Y, Han D, Wang R, Mo J, Liu F, Deng K, Wang D, Feng Z, Jiang Y, Li Y, Ma Y, Liu Z, Li M, Tian P, Shi Y, Jiang Y, Yang T, Li S, Liang J, Wu J, Wang Y, Zou W, Jiang Y, Wang L, Chen F, Jin X, Li S, Qiu X, Li C, Gao Y, Tang Y, Taylor MD, Jiang T.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background</h4>Despite numerous studies on medulloblastoma (MB) cell heterogeneity, the spatial characteristics of cellular states remain unclear.<h4>Methods</h4>We analyze single-nucleus and spatial transcriptomes and chromatin accessibility from human MB spanning four subgroups, to identify malignant cell populations and describe the spatial evolutionary trajectories. The spatial copy number variations (CNVs) patterns and niches were analyzed to investigate the cellular interactions.<h4>Results</h4>Three main malignant cell populations were identified, including progenitor-like, cycling, and differentiated populations. Gene signatures of cell populations strongly correlate to clinical outcomes. These tumor cell populations are geographically organized as stem-like and mature regions, highlighting their spatially heterogeneous nature. Progenitor-like and cycling cells are mainly concentrated in stem-like regions, whereas various differentiated populations are primarily distributed in mature regions. By analyzing chromosomal alterations, we find that stem-like regions typically harbor a single pattern of CNVs, reflecting high originality and uniformity, which is in stark contrast to mature regions exhibiting multiple patterns with a broader range of biological functions. Projecting cellular state programs onto spatial sections fully illustrates the evolution from stem-like regions to various functional zones in mature regions, which is correlated to microenvironmental components along the paths to maintain stemness or promote differentiation.<h4>Conclusions</h4>This multi-omics database comprehensively facilitates the understanding of MB spatial evolutionary organization.

HFE
Also flagged:Atherosclerotic cardiovascular diseaseASCVDheart failurediabetes mellitusdiabetessodium-glucose cotransporter 2
Journal Article 2025-07-01 ✓ 4 Snippets Chen SY, Wu JY, Liao KM, Lin YM.
In-Text Gene Mentions

HFEwas defined using…

…< 0.0001) andHFE(HR 0.77; 95%…

…and 1.69 forHFE, respectively ( Table…

…CI 0.73-0.83), andHFE(HR 0.77; 95%…

Show Full Abstract

<h4>Aims</h4>Managing patients with atherosclerotic cardiovascular disease (ASCVD) and heart failure (HF) is challenging. While sodium-glucose cotransporter 2 inhibitors (SGLT2i) and glucagon-like peptide-1 receptor agonists (GLP-1 RA) show cardiovascular benefits, the impact of combining these agents is unclear. This study evaluated whether adding GLP-1 RA to SGLT2i provides additional benefits in patients with both ASCVD and HF.<h4>Methods and results</h4>This retrospective observational study utilized the TriNetX database to analyse patients with ASCVD and HF who initiated GLP-1 RA with SGLT2i or SGLT2i alone from 1 August 2016 to 30 September 2024. A total of 2 797 317 patients were identified, with 96 051 patients meeting inclusion criteria. After propensity score matching, 5272 patients in each group were analysed. Primary outcomes included mortality or hospitalization within 1 year; secondary outcomes examined mortality, hospitalization, and heart failure exacerbation (HFE). Patients receiving GLP-1RA and SGLT2i therapies had significantly lower risk of mortality or hospitalization [hazard ratio (HR) 0.78; 95% confidence interval (CI) 0.74-0.83], mortality (HR 0.72; 95% CI 0.62-0.84), hospitalization (HR 0.78; 95% CI 0.73-0.83), and HFE (HR 0.77; 95% CI 0.72-0.83) vs. SGLT2i alone. Subgroup analyses showed consistent benefits in patients with HFpEF, HFrEF, patients with diabetes, obesity, chronic kidney disease, or those using semaglutide or dulaglutide, while liraglutide use showed a neutral effect. Drug-related side effects were monitored as safety outcomes, which showed no significant differences between groups.<h4>Conclusions</h4>In ASCVD and HF patients, adding GLP-1 RA to SGLT2i reduces 1-year mortality and hospitalization, warranting further investigation in diverse settings.

Also flagged:ProteostasisIBMFSgenetic disorders of impairedhematopoiesisribosomopathiesprotein synthesis
Journal Article 2025-07-01 No Snippets Yu H, Signer RAJ.
Show Full Abstract

<h4>Abstract</h4>Inherited bone marrow failure syndromes (IBMFS) are genetic disorders of impaired hematopoiesis that manifest in childhood with both cytopenias and extrahematologic findings. Although several IBMFS are categorized as ribosomopathies owing to shared underlying ribosomal dysfunction, there is a broader disruption of the protein homeostasis (proteostasis) network across both classic and emerging IBMFS. Precise regulation of the proteostasis network, including mechanisms of protein synthesis, folding, trafficking, and degradation and associated stress response pathways, has emerged as essential for maintaining hematopoietic stem cell function, providing new potential mechanistic insights into IBMFS pathogenesis. Furthermore, the varied clinical trajectories of patients with IBMFS with possible divergent outcomes of malignancy and spontaneous remission may reflect developmental and temporal changes in proteostasis activity and be driven by strong selective pressures to restore proteostasis. These new insights are spurring fresh therapeutic approaches to target proteostasis. Thus, further evaluation of proteostasis regulation and the consequences of proteostasis disruption in IBMFS could aid in developing new biomarkers, therapeutic agents, and preventive approaches for patients.

DCC
Also flagged:Oral squamous cell carcinomaOSCChead and neck canceralcoholviral infectionscancer
Journal Article 2025-07-01 ✓ 1 Snippet Stabile R, Tucci FA, Verhagen MP, Embregts C, van den Bosch TPP, Joosten R, De Herdt MJ, van der Steen B, Nigg AL, Koljenović S, Hardillo JA, Verrijzer CP, Biddle A, Baatenburg de Jong RJ, Leenen PJM, Fodde R.
In-Text Gene Mentions

…and detection withDCC(Ventana #760-240) for…

Show Full Abstract

<h4>Background</h4>Phenotypic plasticity and inflammation, 2 well-established hallmarks of cancer, play key roles in local invasion and distant metastasis by enabling the rapid adaptation of tumor cells to dynamic micro-environmental changes.<h4>Results</h4>Here, we show that in oral squamous carcinoma cell carcinoma (OSCC), the competition between the Nucleosome Remodeling and Deacetylase (NuRD) and SWItch/Sucrose Non-Fermentable (SWI/SNF) chromatin remodeling complexes plays a pivotal role in regulating both epithelial-mesenchymal plasticity (EMP) and inflammation. By perturbing these complexes, we demonstrated their opposing downstream effects on the inflammatory pathways and EMP regulation. In particular, downregulation of the BRG1-specific SWI/SNF complex deregulates key inflammatory genes, such as TNF-α and IL6, in opposite ways when compared with the loss of CDK2AP1, a key member of the NuRD complex. We showed that CDK2AP1 genetic ablation triggers a pro-inflammatory secretome encompassing several chemokines and cytokines, thus promoting the recruitment of monocytes into the tumor microenvironment (TME). Furthermore, CDK2AP1 deletion stimulates their differentiation into M2-like macrophages, as validated on tumor microarrays from OSCC patient-derived tumor samples. Further analysis of the inverse correlation between CDK2AP1 expression and TME immune infiltration revealed specific downstream effects on the abundance and localization of CD68+ macrophages.<h4>Conclusions</h4>Our study sheds light on the role of chromatin remodeling complexes in OSCC locoregional invasion and highlights the potential of CDK2AP1 and other members of NuRD and SWI/SNF chromatin remodeling complexes as prognostic markers and therapeutic targets.

HFEBTN2A1
Also flagged:HHironmetabolismexporterHepcidinmajor histocompatibility complex
Journal Article 2025-07-01 ✓ 5 Snippets Erdogdu D, Becoku I, Huber V, Wang Y, Eyrich M, Hashimoto H, Döring M, Schulte J, Schilbach K.
In-Text Gene Mentions

HFE-related hemochromatosishemochromatosis (HH) is…

…homozygous mutations inHFE, a major…

…gene that encodesHFEprotein.…

…common mutations ofHFEhave been identified;…

…ligand model assumesBTN2A1and BTN3A1 extracellular…

Show Full Abstract

<h4>Abstract</h4>HFE-related hemochromatosis induces systemic iron overload. Although extensive studies indicate a pivotal role for iron homeostasis in αβ T-cell immunity, its effect on γδ T cells is unknown. Here, we found a reversal of the Vδ2+/Vδ2- ratio in the γδ T-cell compartment as a feature of hemochromatosis, which is associated with a Vδ2+ population that cannot be enriched by zoledronic acid (ZOL) stimulation, despite evidence of T-cell receptor (TCR)-ligand formation and strong proliferative behavior. In vivo, reactive oxygen species (ROS) production and exhaustion marker expression are significantly increased on Vδ2+ T cells in hemochromatosis compared with healthy individuals. Ex vivo, hemochromatosis donor-derived Vδ2+ cells are hyporesponsive to TCR stimulation in terms of ROS production but significantly increase their paramount expression of exhaustion markers. Fas-Fas ligand coexpression indicates their high susceptibility to activation-induced cell death. Consistent therewith, FeSO4 alone induces Vδ2+ subset-specific proliferation in healthy peripheral blood mononuclear cells comparable to stimulation by ZOL, and blocking experiments identify FeSO4-induced proliferation as BTN3A1/TCR mediated. Pyrophosphate is key for Vδ2+-TCR ligand formation. Iron, by suppressing pyrophosphatase alkaline phosphatase, promotes their stability. Therefore, our data suggest that the transcriptional repression of pyrophosphatases, as under the conditions of iron overload in hemochromatosis in vivo, leads to the constitutive availability of stress-signaling Vδ2+-TCR ligand and permanent TCR triggering in Vδ2+ T cells even under homeostatic conditions, which ultimately results in their subset-specific, activation-induced cell death. A similar phenotype was observed in patients with iron overload due to inborn hemoglobinopathies, suggesting an inverted Vδ2+/Vδ2- ratio in the γδ T-cell compartment as a hallmark of iron overload.

DCC
Also flagged:TumorHead and Neck Squamous Cell CarcinomaHNSCCtumorscisplatinEGFR
Journal Article 2025-07-01 ✓ 1 Snippet Um JH, Zheng Y, Mao Q, Nam C, Zhao H, Koh YW, Shin SJ, Park YM, Lin DC.
In-Text Gene Mentions

DCC

Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) remains a significant health burden because of tumor heterogeneity and treatment resistance, emphasizing the need for improved biological understanding and tailored therapies. In this study, we enrolled 31 patients with HNSCC for the establishment of patient-derived tumor organoids (PDO), which faithfully maintained the genomic features and histopathologic traits of the primary tumors. Long-term culture preserved key characteristics, affirming PDOs as robust representative models. PDOs demonstrated predictive capability for cisplatin treatment responses, with ex vivo drug sensitivity correlating with patient outcomes. Bulk and single-cell RNA sequencing unveiled molecular subtypes and intratumor transcriptional heterogeneity (ITH) in PDOs, paralleling patient tumors. Notably, a hybrid epithelial-mesenchymal transition-like ITH program was associated with cisplatin resistance and poor patient survival. Functional analyses identified amphiregulin as a potential regulator of the hybrid epithelial-mesenchymal state. Moreover, amphiregulin contributed to cisplatin resistance via EGFR pathway activation, corroborated by clinical samples. In summary, HNSCC PDOs serve as reliable and versatile models, offer predictive insights into ITH programs and treatment responses, and uncover potential therapeutic targets for personalized medicine.<h4>Significance</h4>Profiling of patient-derived organoids uncovers intertumoral heterogeneity and a hybrid epithelial-mesenchymal transition program conferring cisplatin resistance and highlights amphiregulin as a regulator of cellular plasticity and potential therapeutic target for HNSCC treatment.

HFE
Also flagged:Autoimmune regulatorsterile epididymitistranscriptional regulatorinfertilitymalesubfertility
Journal Article 2025-07-01 ✓ 1 Snippet Ahn SH, Halgren K, Grzesiak G, MacRenaris KW, Sue A, Xie H, Demireva E, O'Halloran TV, Petroff MG.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Autoimmune regulator (AIRE), a transcriptional regulator expressed by medullary thymic epithelial cells, is required for shaping the self-antigen tolerant T cell receptor repertoire. In humans, AIRE mutations caues autoimmune polyglandular syndrome type 1. Among other symptoms, men with autoimmune polyglandular syndrome type 1 commonly experience testicular insufficiency and infertility, but the mechanisms causing infertility are unknown. Using an Aire-deficient mouse model, we demonstrate that male subfertility is caused by sterile epididymitis characterized by immune cell infiltration and extensive fibrosis. In addition, we reveal that the presence of autoreactive immune cells and inflammation in epididymides of Aire-deficient mice are required for iron deposition in the interstitium, which is brought on by macrophages. We further demonstrate that male subfertility is associated with a decrease in metals zinc, copper, and selenium, which serve as cofactors in several antioxidant enzymes. We also show an increase in DNA damage of epididymal sperm of Aire-/- animals as a key contributing factor to subfertility. The absence of Aire results in autoimmune attack of the epididymis leading to fibrosis, iron deposition, and copper, zinc, and selenium imbalance, ultimately resulting in sperm DNA damage and subfertility. These results highlight the requirement of Aire to promote immune tolerance to the epididymis, and that its disruption causes an imbalance of inorganic elements with resulting consequence on male fertility.

DNAH10CCDC92
Also flagged:Obesitycardiovascular diseasestype 2 diabetescardiovascular diseaseRSPO3COBLL1
Journal Article 2025-07-01 ✓ 5 Snippets Odoemelam CS, Naz A, Thanaj M, Sorokin EP, Whitcher B, Sattar N, Bell JD, Thomas EL, Cule M, Yaghootkar H.
In-Text Gene Mentions
⭐ same-sentence co-mention

…RSPO3 , andDNAH10/ CCDC92 (…

⭐ same-sentence co-mention

…and DNAH10 /CCDC92( Supplementary Fig.…

…6E−89), rs7133378 nearDNAH10(eQTL for DNAH10OS…

⭐ same-sentence co-mention

…nearby genes likeDNAH10and CCDC92 ,…

⭐ same-sentence co-mention

…like DNAH10 andCCDC92, both involved…

Show Full Abstract

We aimed to identify distinct axes of obesity using advanced magnetic resonance imaging (MRI)-derived phenotypes. We used 24 MRI-derived fat distribution and muscle volume measures (UK Biobank; N = 33,122) to construct obesity axes through principal component analysis. Genome-wide association studies were performed for each axis to uncover genetic factors, followed by pathway enrichment, genetic correlation, and Mendelian randomization analyses to investigate disease associations. Four primary obesity axes were identified: 1) general obesity, reflecting higher fat accumulation in all regions (visceral, subcutaneous, and ectopic fat); 2) muscle dominant, indicating greater muscle volume; 3) peripheral fat, associated with higher subcutaneous fat in abdominal and thigh regions; and 4) lower-body fat, characterized by increased lower-body subcutaneous fat and reduced ectopic fat. Each axis was associated with distinct genetic loci and pathways. For instance, the lower-body fat axis was associated with RSPO3 and COBLL1, which are emerging as promising candidates for therapeutic targeting. Disease risks varied across axes; the general obesity axis was correlated with higher risks of metabolic and cardiovascular diseases, whereas the lower-body fat axis seemed to protect against type 2 diabetes and cardiovascular disease. This study highlights the heterogeneity of obesity through the identification of obesity axes and emphasizes the potential to extend beyond BMI in defining and treating obesity for obesity-related disease management.<h4>Article highlights</h4>This study aimed to address potential limitations of BMI by exploring the heterogeneity of obesity using magnetic resonance imaging-derived fat distribution and muscle volume measures. We sought to identify distinct obesity axes and investigate their genetic, metabolic, and disease associations. Four obesity axes were identified (general obesity, muscle dominant, peripheral fat, and lower-body fat), each linked to unique genetic loci, metabolic traits, and disease risks. These findings emphasize the potential to extend beyond BMI in defining and managing obesity, offering a more nuanced framework for understanding and treating obesity-related diseases.

HTT
Also flagged:HDneurodegenerative disorderbasal ganglia disease-aminobutyric acidcell cyclingneuronal differentiation
Journal Article 2025-07-01 ✓ 5 Snippets Galicia Aguirre C, Tshilenge KT, Battistoni E, Lopez-Ramirez A, Naphade S, Perez K, Gerencser AA, Song S, Mooney SD, Melov S, Ehrlich ME, Ellerby LM.
In-Text Gene Mentions

…the huntingtin (HTT) gene that…

…the encoded protein (HTT), and patients with…

…Despite the mutantHTT(mHTT) protein being…

…of the huntingtin (HTT) gene, resulting in…

…in a mutantHTT(mHTT) protein.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by an expansion of CAG repeats in exon 1 of the huntingtin (HTT) gene, resulting in a mutant HTT (mHTT) protein. Although mHTT is expressed in all tissues, it significantly affects medium spiny neurons (MSNs) in the striatum, resulting in their loss and the subsequent motor function impairment in HD. While HD symptoms typically emerge in midlife, disrupted MSN neurodevelopment is important. To explore the effects of mHTT on MSN development, we differentiated HD-induced pluripotent stem cells (iPSCs) and isogenic controls into neuronal stem cells, and then generated a developing MSN population encompassing early, intermediate progenitors, and nascent MSNs. Single-cell RNA sequencing revealed that the developmental trajectory of MSNs in our model closely emulated the trajectory of human fetal striatal neurons. However, in the HD MSN cultures, several crucial genes required for proper MSN maturation were downregulated, including members of the DLX family of transcription factors. Our analysis also uncovered a progressive dysregulation of multiple HD-related pathways as MSNs developed, including the NRF2-mediated oxidative stress response and mitogen-activated protein kinase signaling. Using the transcriptional profile of developing HD MSNs, we searched the L1000 dataset for small molecules that induce the opposite gene expression pattern. We pinpointed numerous small molecules with known benefits in HD models and previously untested novel molecules. A top candidate, Cerulenin, partially restored the DARPP-32 levels and electrical activity in HD MSNs, and also modulated genes involved in multiple HD-related pathways.

DCC
Also flagged:mitochondrialjunctionsmitochondriaacetylcholine (ACh) receptorsACh receptornerve
Journal Article 2025-07-01 ✓ 2 Snippets Deschenes MR, Rackley M, Fernandez S, Heidebrecht M, Hamilton K, Paez HG, Paez CR, Alway SE.
In-Text Gene Mentions

…experimental groups ofC57BL/six micemice (10–14 per…

…limb in maleC57BL/six micemice (Jackson Labs,…

Show Full Abstract

Neuromuscular diseases and damage affect many people of all ages and are responsible for an exorbitant medical cost, more than $200 million annually. Accordingly, finding an appropriate model to investigate potential curative interventions is necessary. One currently used involves the application of toxic agents on skeletal muscle followed by mitochondrial transplant therapy. A question regarding this model is whether such toxins impact not only muscle tissue but also the neuromuscular junctions (NMJs) responsible for exciting the muscle tissue. This question was addressed here by forming four experimental groups of C57BL/six mice (10-14 per group) that were 8-12 weeks of age: 1) controls whose muscles had not been injured or treated, 2) muscles taken from mice that were injured and then treated with mitochondrial supplement, 3) muscles that had not been injured but were still treated with mitochondria, and 4) muscles that were injured and received no mitochondrial treatment. Several pre- and postsynaptic features of NMJs were subject to immunofluorescent staining procedures before having morphological features assessed with confocal microscopy. Results revealed that only postsynaptic acetylcholine (ACh) receptors showed any significant (p < 0.05) between-group differences, including decreased area size and perimeter length around ACh receptor clusters in injured NMJs. However, presynaptic nerve terminal branching was not different (p > 0.05) among treatment groups, and structural features were not different between groups with the exception of dispersion of postsynaptic receptors. Overall, these results suggest that skeletal muscles damaged with toxin accurately mimic what occurs during toxin-induced damage and post-injury recovery and can be used as a faithful model of occurrences during damage to NMJs as a result of muscle damage along with recovery from that insult.

HFE
Also flagged:ErythrocytosisType 2 Diabetes MellitustestosteroneHbhypogonadismSGLT2i
Journal Article 2025-07-01 ✓ 1 Snippet Kabha M, Dana H, Kassem S, Dekel Y, Cohen H, Zaina A.
In-Text Gene Mentions

…presence of thehemochromatosisgene mutation without…

Show Full Abstract

Hypogonadism is commonly linked to type 2 diabetes mellitus (T2DM), with testosterone replacement therapy (TRT) representing a key treatment option. Sodium glucose cotransporter-2 inhibitors (SGLT-2i) class is part of T2DM management. Both treatments can increase Hct, Hb and RBC levels with a potential risk for secondary erythrocytosis. This study compares Hct, RBC and Hb changes between T2DM patients treated with and without SGLT-2i and TRT for hypogonadism.<h4>Methods</h4>Data from Clalit Healthcare Services (2015-2023) was analysed from male T2DM patients with hypogonadism. Mixed linear regression assessed SGLT-2i effects on Hct, Hb and RBC levels, while generalised estimation equations were used to predict the proportion of patients with Hct > 54%.<h4>Results</h4>In total, 5235 male patients met the inclusion criteria, with 3146 in the SGLT-2i (+) group, while 2089 comprised the SGLT-2i (-) group. Mean age was 63.8 ± 11.0 years, mean Hct was 43.3% ± 4.4%, BMI was 30.8 ± 5.2 kg/m<sup>2</sup> and eGFR was 84.9 ± 19.3 mL/min/1.73m<sup>2</sup>. The SGLT-2i (+) group demonstrated a statistically significant increase in Hct, Hb, and RBC after TRT initiation (p < 0.001). While the overall increase in Hct > 54% was not statistically significant after TRT initiation with OR = 1.85 [95% CI 0.96-3.67], p = 0.06. However, in the SGLT2i (+) group, it was significantly higher than for those in the SGLT2i (-) group, OR = 4.85 [95% CI 3.06-7.69], p = 0.02.<h4>Conclusions</h4>SGLT-2i and TRT co-administration are associated with an increased chance of developing secondary erythrocytosis in T2DM. Awareness and potential treatment discontinuation may prevent unnecessary investigations. Frequent monitoring of these parameters is essential.

Also flagged:Liver FibrosisAlpha-1Antitrypsinalpha-1 antitrypsindeficiencyAATD
Journal Article 2025-07-01 No Snippets Boeckmans J, Schattenberg JM, Fromme M, Strnad P, Hagström H.
Show Full Abstract

Severe alpha-1 antitrypsin deficiency (AATD) is a rare genetic condition characterised by low systemic levels of alpha-1 antitrypsin due to its retention in the liver. Consequently, it predisposes individuals to the development of chronic obstructive pulmonary disease and liver cirrhosis. Much progress has been made to non-invasively monitor liver fibrosis and cirrhosis in individuals with other liver diseases, but it remains unclear how to assess liver disease in people with AATD. This narrative review examined the available evidence on non-invasive tests (NITs) to stage liver fibrosis and predict incident major adverse liver outcomes in people with AATD. Liver stiffness measurement (LSM) using vibration-controlled transient elastography (VCTE), blood-based NITs, and serum liver enzymes are generally normal or mildly elevated in individuals with AATD. Further, VCTE-LSM and blood-based NITs, including the AST to platelet ratio index and fibrosis-4 score, have diagnostic utility for predicting F2 and F3 fibrosis and hold excellent (AUROC ≥ 0.90) prognostic value for incident major adverse liver outcomes. Gamma-glutamyl transferase also exhibits diagnostic and prognostic utility but is subject to multiple non-AATD-related fluctuations. A potential strategy to non-invasively assess liver disease stage and estimate the risk of major adverse liver outcomes in people with AATD could consist of a combination of VCTE-LSM with blood-based biomarker panels. Future studies should explore if liver stiffness naturally fluctuates over time in people with AATD, assess the ideal frequency of follow-up, and evaluate if NITs can guide the treatment of AATD-related liver disease.

HTTDCC
Also flagged:Serotonin Transporterbrain developmentneurodevelopmental disordershydroxyinnervationgene expression
Journal Article 2025-07-01 ✓ 5 Snippets Kroeze Y, Oti M, Cooijmans RHM, van Beusekom E, Kroeze LI, Middelman A, van Bokhoven H, Kolk SM, Homberg JR, Zhou H.
In-Text Gene Mentions

…In addition, the 5‐HTT+/+ and 5‐HTT…

…5‐HTT +/+ and 5‐HTT−/− mPFC samples,…

…(e.g., Ntn1, Nrp2,Dcc, and Sema3c…

…p < 0.05);Dcc( t (1,7)…

…significantly upregulated, andDccshowed a trend…

Show Full Abstract

Reduced expression of the serotonin transporter (5-hydroxytryptamine transporter, 5-HTT) in early life has been associated with a delay in postnatal brain development and endophenotypes of a variety of neuropsychiatric and neurodevelopmental disorders in adolescence and adulthood. How a reduction in functional 5-HTT can disrupt neurodevelopment is still largely unknown. Here, we studied genome-wide gene expression using transcriptome analysis (RNA-seq) and global levels of DNA (hydroxy)methylation (5(h)mC) using high-performance liquid chromatography-tandem mass spectrometry in 5-HTT wild-type (5-HTT<sup>+/+</sup>) and 5-HTT homozygous knockout (5-HTT<sup>-/-</sup>) rats across life (postnatal day [PND] 8, 14, 21, 35, and 70) in the medial prefrontal cortex (mPFC); a brain region with an extensive serotonergic innervation involved in several neuropsychiatric endophenotypes. We observed most gene expression changes in the mPFC during early postnatal life (PND8) and found at this time point an enrichment of genes linked to neuronal and developmental processes like neurotransmission, neuropeptide signaling, and cell migration. Genome-wide DNA 5(h)mC analysis showed a global increase in 5-hydroxymethylcytosine (5hmC) in the mPFC during development in both genotypes and a significant increase in global 5hmC in 5-HTT<sup>-/-</sup> compared to 5-HTT<sup>+/+</sup> rats at PND35. The differences in the regulation of gene expression in 5-HTT<sup>-/-</sup> versus 5-HTT<sup>+/+</sup> rats during early postnatal life can dysregulate neurodevelopmental processes resulting in aberrant brain wiring and functioning. This can result in lifelong consequences for prefrontal context-dependent executive functioning.

HFE
Also flagged:Metabolic dysfunctionsteatotic liver diseaseneoplastic diseasesinsulin resistancesteatosiscirrhosis
Journal Article 2025-07-01 ✓ 4 Snippets Pettinato M, Furiosi V, Carleo R, Bavuso Volpe L, Guo S, Mannella V, Musco G, Gilberti E, De Palma G, Federico G, Carlomagno F, Cherubini A, Pelusi S, Dano A, Nai A, Valenti L, Altamura S, Pagani A, Silvestri L.
In-Text Gene Mentions

…that variants inHFEand TMPRSS6 ,…

…interaction between thehemochromatosisproteins HFE and…

…the hemochromatosis proteinsHFEand TFR2.…

…as occurs inhemochromatosis, is frequently associated…

Show Full Abstract

<h4>Background and aims</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) is the most common cause of liver disease and a leading contributor to liver-related morbidity and mortality. Currently, no pharmacological approach has demonstrated consistent and long-lasting benefits across all patients. Therefore, identifying new therapeutic targets remains an urgent clinical need. The hepatic serine protease matriptase-2, encoded by TMPRSS6, inhibits the BMP-SMAD pathway. Interestingly, reduced BMP-SMAD signalling in the liver is frequently associated with altered lipid metabolism in patients. Conversely, inactivation of Tmprss6 has been linked to reduced high-fat diet-induced obesity. Based on these findings, we hypothesize that TMPRSS6 represents a novel and promising target for the treatment of MASLD.<h4>Methods</h4>Hepatic TMPRSS6 expression was analysed in obese patients with or without MASLD. Adult male mice were fed a MASLD-MASH diet, and once hepatosteatosis was established, they were treated with antisense oligonucleotides targeting Tmprss6 while continuing the dietary regimen for an additional 6 weeks.<h4>Results</h4>The expression of the BMP-SMAD inhibitor TMPRSS6 was increased in people with MASLD and negatively correlated with PPARα signaling, a key regulator of hepatic lipid metabolism. In experimental MASLD, downregulation of hepatocytic Tmprss6 using GalNAc-ASO significantly reduced steatohepatitis and fibrosis and attenuated MASLD-MASH-associated ferroptosis by reshaping hepatic transcription factor activity towards PPARα and SMAD4/SMAD5-driven signalling. Consistently, enhanced BMP-SMAD signalling increased PPARα activity in vivo.<h4>Conclusions</h4>Our findings reveal a novel functional crosstalk between TMPRSS6 and PPARα. Pharmacological downregulation of Tmprss6 in experimental MASLD mitigates hepatosteatosis, inflammation and fibrosis by enhancing PPARα signalling and attenuating ferroptosis.

Also flagged:Systemic SclerosisPrimary graft dysfunctioninterstitial lung diseasedeathpulmonary hypertensionconnective-tissue disorder
Journal Article 2025-07-01 No Snippets Singh J, Meng X, Leader JK, Ryan J, Pu L, Deitz R, Chan EG, Shigemura N, Hage CA, Sanchez PG, Pu J.
Show Full Abstract

<h4>Introduction</h4>Primary graft dysfunction (PGD) is a significant barrier to survival in lung transplant (LTx) recipients. PGD in patients with systemic sclerosis (SSc) remains especially underrepresented in research.<h4>Methods</h4>We investigated 92 SSc recipients (mean age 51 years ± 10) who underwent bilateral LTx between 2007 and 2020. PGD was defined as grade 3 PGD at 72 h post-LTx. A comprehensive set of CT image features was automatically computed from recipient chest CT scans using deep learning algorithms. Volumetric analysis of recipients' lungs and chest cavity was used to estimate lung-size matching. Four machine learning (ML) algorithms were developed to predict PGD, including multivariate logistic regression, support vector machine (SVM), random forest classifier (RFC), and multilayer perceptron (MLP).<h4>Results</h4>PGD was significantly associated with BMI >30 kg/m<sup>2</sup> (p = 0.009), African American race (p = 0.011), lower Preop FEV1 (p = 0.002) and FVC (p = 0.004), longer waitlist time (p = 0.014), higher lung allocation score (LAS) (p = 0.028), and interstitial lung disease (p = 0.050). From CT analysis, PGD was significantly associated with decreased lung volume (p < 0.001), increased heart-chest cavity volume ratio (p < 0.001), epicardial (p = 0.033) and total heart (p = 0.049) adipose tissue, and five cardiopulmonary features (p < 0.050). Oversized donor allografts estimated using CT analysis were significantly associated with PGD (p < 0.050). The MLP model achieved a maximum AUROC of 0.85 (95% CI: 0.81-0.88) in predicting PGD with four features: Preop FEV1, heart-chest cavity volume ratio, waitlist time, and donor to recipient chest cavity volume ratio.<h4>Conclusion</h4>CT-derived features are significantly associated with PGD, and models incorporating these features can predict PGD in SSc recipients.

DARS2
Also flagged:MitochondriopathyMitochondriopathiesmitochondrialvalineVARS2mitochondrial encephalopathies
Journal Article 2025-07-01 ✓ 1 Snippet Marquez J, Viviano S, Rahman F, Strohbehn SD, Allworth A, Perez N, University of Washington Center for Rare Disease Research, Undiagnosed Diseases Network, Saneto RP, Anna S, Penón Portmann M, Blue EE, Glass IA, Deniz E, Shelkowitz E.
In-Text Gene Mentions

DARS2

Show Full Abstract

Mitochondriopathies are a diverse group of disorders caused by disruption of typical mitochondrial function. Heterogenous in nature, many of these disorders arise due to variants in genes encoding key mitochondrial proteins involved in transcription and translation of mitochondrial machinery. One such gene, VARS2, encodes a mitochondrial aminoacyl-tRNA synthetase that catalyzes the attachment of valine to its cognate tRNA molecule. Bi-allelic variants in VARS2 have been linked to several forms of mitochondrial encephalopathies or cardiomyoencephalopathies. While associated clinical phenotypes vary, they can include developmental delays, axial hypotonia, limb spasticity, and epilepsy. Here, we describe three additional clinical cases of VARS2-related mitochondriopathy with sequencing-confirmed variants in VARS2 that illustrate the phenotypic variability of this disorder. These include three novel variants: Lys225Glu, Cys281Tyr, and Leu732Cysfs*29. We further assess the pathogenicity and severity of the effects of the variants underlying these cases in a Xenopus model of disease through assaying both cardiac function and brain size. In addition, we use this model of VARS2 loss of function to assess the therapeutic potential of previously proposed amino acid supplementation. Through this approach, we demonstrate that the beneficial effects of valine supplementation in VARS2 mitochondriopathy may be dependent on residual enzyme activity.

Also flagged:matingphotoreceptionopsinG protein-coupled receptorsopsinsrhodopsin
Journal Article 2025-07-01 No Snippets Policarpo M, Fogg LG, Cortesi F, Salzburger W.
Show Full Abstract

Photoreception-the detection of light for image formation (vision) as well as for nonimage-forming purposes (circadian regulation and DNA repair)-is critical to the survival of most animals. In vertebrates, photoreception is mediated by opsin proteins, which are classified, according to their function, into visual and nonvisual opsins. Here, we provide the most comprehensive study to date on the evolution of the opsin gene family in the largest class of vertebrates, actinopterygians, with a particular focus on the understudied nonvisual opsins. Based on an in-depth analysis of 535 high-quality genomes, we document great variation in gene numbers in the different opsin gene subfamilies across ray-finned fishes and show that visual opsins are more prone to duplications and losses than nonvisual opsins. We provide evidence that visual and nonvisual opsins coevolve in ray-finned fishes, both in terms of copy numbers and selective pressures acting on their coding sequences, probably in response to the different photic environments they inhabit. Species that live in dim light or in the dark (such as in caves or the deep sea) had reduced visual and nonvisual opsin gene repertoires, while polar species feature accelerated evolution in both. Fishes that rely on electroreception show a slight reduction in the number of visual and nonvisual opsin genes and accelerated evolution of the remaining genes. We further found that genes of the phototransduction cascade coevolve with opsins. Finally, the finding that nonvisual opsins are mainly expressed in the testes and ovaries (after the eyes) supports a function in gamete biology.

VRK2
Also flagged:Phosphorylationpost-translational modificationsphosphoproteinsphosphopeptideskinasephosphatase
Journal Article 2025-07-01 ✓ 1 Snippet Chen M, Gou Y, Lei M, Xiao L, Zhao M, Huang X, Liu D, Feng Z, Peng D, Xue Y.
In-Text Gene Mentions

…al. discovered thatVRK2 kinasekinase phosphorylated PLK1…

Show Full Abstract

As one of the most crucial post-translational modifications, protein phosphorylation regulates a broad range of biological processes in eukaryotes. Biocuration, integration, and annotation of reported phosphorylation events will deliver a valuable resource for the community. Here, we present an updated database, the eukaryotic phosphorylation site database 2.0 (EPSD 2.0), which includes 2,769,163 experimentally identified phosphorylation sites (p-sites) in 362,707 phosphoproteins from 223 eukaryotes. From the literature, 873,718 new p-sites identified through high-throughput phosphoproteomic research were first collected, and 1,078,888 original phosphopeptides together with primary references were reserved. Then, this dataset was merged into EPSD 1.0, comprising 1,616,804 p-sites within 209,326 proteins across 68 eukaryotic organisms. We also integrated 362,190 additional known p-sites from 10 public databases. After redundancy clearance, we manually re-checked each p-site and annotated 88,074 functional events for 32,762 p-sites, covering 58 types of downstream effects on phosphoproteins, and regulatory impacts on 107 biological processes. In addition, phosphoproteins and p-sites in 8 model organisms were meticulously annotated utilizing information supplied by 100 external platforms encompassing 15 areas. These areas included kinase/phosphatase, transcription regulators, three-dimensional structures, physicochemical characteristics, genomic variations, functional descriptions, protein domains, molecular interactions, drug-target associations, disease-related data, orthologs, transcript expression levels, proteomics, subcellular localization, and regulatory pathways. We expect that EPSD 2.0 will become a useful database supporting comprehensive studies on phosphorylation in eukaryotes. The EPSD 2.0 database is freely accessible online at https://epsd.biocuckoo.cn/.

PRDX6
Also flagged:Breast CancerMitochondrialoxygencancersmembranephosphorylation
Journal Article 2025-07-01 ✓ 5 Snippets Dai M, Zhang D.
In-Text Gene Mentions

PRDX6Drives Breast Cancer…

…AlthoughPRDX6is involved in…

…Overexpression ofPRDX6enhanced BRCA cell…

PRDX6reduced ROS levels,…

PRDX6also promoted tumor…

Show Full Abstract

<h4>Background</h4>Peroxiredoxin 6 (PRDX6) scavenges reactive oxygen species (ROS) and plays a key role in antioxidant defense. Although PRDX6 is involved in various cancers, its role in breast cancer (BRCA) remains unclear.<h4>Methods</h4>Cell proliferation was assessed using CCK-8, EdU staining, and colony formation assays. Migration and invasion were evaluated via wound-healing and transwell assays. ROS levels and mitochondrial membrane potential were measured by fluorescence microscopy or flow cytometry. Oxidative phosphorylation (OXPHOS) activity was determined by ATP production and NAD<sup>+</sup>/NADH ratio. Mitochondria were visualized by TEM, and mitochondrial complex subunits were detected by quantitative real-time PCR and Western blotting. In vivo effects were evaluated using a xenograft tumor model.<h4>Results</h4>Although PRDX6 was downregulated in BRCA overall, it showed elevated expression in aggressive subtypes and advanced-stage tumors, correlating with poor prognosis. Overexpression of PRDX6 enhanced BRCA cell proliferation, migration, and invasion. PRDX6 reduced ROS levels, upregulated mitochondrial transcription factor A (TFAM) expression, and promoted mitochondrial complex subunit expression and OXPHOS. Inhibition of TFAM led to a decrease in the expression of some of the mitochondrial complex subunits, which reversed the pro-carcinogenic phenotype of the tumor. PRDX6 also promoted tumor growth in vivo.<h4>Conclusion</h4>PRDX6 maintains intracellular homeostasis by reducing ROS and promotes mitochondrial biogenesis and OXPHOS through TFAM-dependent and -independent pathways, driving BRCA progression.

SERPINC1
Also flagged:dementiamotor neuron diseasemild cognitive impairmentcognitive declineACEAlzheimer's disease
Journal Article 2025-07-01 ✓ 2 Snippets Carrick J, Cheung SC, Foxe D, Piguet O.
In-Text Gene Mentions

…decline on theACE-III.<h4>Conclusions</h4>This stud…

…data on theACE-IIIin a range…

Show Full Abstract

<h4>Background</h4>The Addenbrooke's Cognitive Examination-III (ACE-III) is a common cognitive screening measure. We provide performance deciles, descriptive performance bands and indices of reliable change between repeat assessments using the ACE-III in a large cohort of dementia participants and healthy controls.<h4>Methods</h4>Baseline data from 727 participants diagnosed with a dementia syndrome and 157 healthy controls were used to calculate performance deciles and descriptive bands. A subset of 393 participants diagnosed with a dementia syndrome completed two annual assessments. These data were used to calculate 95% confidence intervals of characteristic yearly change in each dementia syndrome. Data from a subset of 74 healthy participants who completed two assessments were used to calculate reliable change indices.<h4>Results</h4>Baseline performance was grouped into five descriptive performance bands across the entire spectrum of scores: Very Mild, Mild, Moderate, Severe and Very Severe. Deciles and performance bands are provided for all dementia participants combined, for each syndrome where n > 50, and for healthy controls, stratified by group, sex and years of education. A decline of -7 to -9 points yearly was characteristic for the dementia population, and this varied between syndromes. Reliable change calculations indicate that a 5-point decline from within the 'normal' range (88-100) is the minimum clinically important decline on the ACE-III.<h4>Conclusions</h4>This study presents a suite of reference data on the ACE-III in a range of dementia syndromes, providing important insight and support to clinicians who work with people living with cognitive impairments.

Also flagged:cancercardiovascular disordersCRISPRCasCas9gene silencing
Journal Article 2025-07-01 No Snippets Park BS, Lee M, Kim J, Kim T.
Show Full Abstract

Despite more than two decades since the completion of the first draft of the Human Genome Project, a substantial proportion of human genes remain poorly characterized in terms of their functions. Functional genomics aims to elucidate the roles and interactions of genes and genetic elements, providing insights into their involvement in various biological processes. In this context, the perturbomics approach-a systematic analysis of phenotypic changes resulting from gene function modulation-offers valuable insights into the function of unannotated genes. With the advent of CRISPR-Cas-based genome and epigenome editing, CRISPR screens have become the method of choice for perturbomics studies, enabling the identification of target genes whose modulation may hold therapeutic potential for diseases such as cancer, cardiovascular disorders and neurodegeneration. These findings contribute to the development of targeted drug therapies and the design of gene and cell therapies for regenerative medicine. Here we highlight recent technical advances in CRISPR-based perturbomics, focusing on more physiologically relevant, single-cell-level analyses and their successful applications in discovering novel therapeutic strategies.

Also flagged:Tumourmelanomamelanomasskin cancermalignant tumourshaematoxylin
Journal Article 2025-07-01 No Snippets Hartmann D, Swarlik A, Buttgereit L, Stärr L, Kerl-French K, Flaig M, Sattler EC, French LE, Deußing M.
Show Full Abstract

Ex vivo confocal laser microscopy (EVCM) represents a promising diagnostic tool for the immediate assessment of fresh tissue, with significant potential for the management of melanoma. This study aimed to evaluate the accuracy of EVCM in determining perioperative tumour thickness, a critical factor in guiding treatment strategies for melanoma. A total of 27 confirmed melanomas of varying thickness and from multiple anatomic sites were analysed using both EVCM and gold standard conventional histopathology. Tumour thickness was independently measured using confocal tumour thickness (CTT) and histopathological tumour thickness (HTT) and subsequently compared using correlation analysis, Spearman's correlation coefficient and Bland-Altman plot. Our findings demonstrate a high correlation between HTT and CTT, with a Spearman's correlation coefficient of 0.94. Bland-Altman analysis revealed a mean difference of -0.19 ± 0.72 mm between CTT and HTT, indicating a strong agreement between the two measurement methods. These results underscore the potential of EVCM as a reliable tool for perioperative evaluation of tumour thickness in melanoma, potentially streamlining the decision-making process for surgical margins and improving patient outcomes. Further studies with larger sample sizes are warranted to validate these findings and explore the broader applicability of EVCM in clinical practice.

Also flagged:Parkinson'sHuntington's diseasesNeurodegenerative disordersHuntington's diseasesynucleinneurodegenerative diseases
Journal Article 2025-07-01 No Snippets Chowdhury R, Hendlinger A, Riess O, Schulze-Hentrich J.
Show Full Abstract

Neurodegenerative disorders, like Parkinson's and Huntington's disease, have a profound global impact but currently lack effective treatments. Accumulations of misfolded proteins of <i>α</i>-synuclein and huntingtin are a common pathological hallmark in these diseases, respectiveley. Recently, the role of microglia and innate immune memory in modulating neurodegenerative diseases has been studied in more detail. This review explores the mechanisms of microglial activation in Parkinson's and Huntington's, emphasizing innate immune memory, epigenetic reprogramming, and the influence of external triggers such as lipopolysaccharides (LPS) and high-fat diets (HFD). The review also examines therapeutic strategies targeting microglia to mitigate neurodegeneration, including shifting microglial phenotypes from pro-inflammatory to anti-inflammatory states using epigenetic interventions. To support this review, a structured literature search was conducted using PubMed, Scopus, and Web of Science. Keywords included microglia, innate immune memory, epigenetics, neuroinflammation, and disease-specific terms. Future research should focus on improving animal models, investigating environmental stressors, and developing reliable biomarkers to strengthen translational approaches for neuroinflammatory-driven neurodegenerative diseases.

Also flagged:tumorcell proliferationcell cycle-relatedangiogenesisNF-κB
Journal Article 2025-07-01 No Snippets Wang S, Wang X, Zheng X, Jiang H, Liu L, Ma N, Dong X.
Show Full Abstract

Curcumin (Cur), a natural bioactive compound extracted from Curcuma longa, has garnered extensive interest due to its modulation of inflammation, antioxidant, and anti-tumor properties. However, its therapeutic translation remains constrained by limited systemic bioavailability. Triple-negative breast cancer (TNBC), an aggressive variant of breast malignancies, exhibits strong resistance to conventional therapies and poor prognosis. The present study was designed to clarify the mechanism through which NGR-modified nanovesicles loaded with Cur (NGR-NVs@Cur) reverse immunotherapy resistance in TNBC. Using transcriptomic and network pharmacology analysis, we identified key genes involved in TNBC development and immunotherapy resistance to determine the targets of Cur. In vitro experiments, including SA-β-gal staining, flow cytometry, and glycolysis analysis, validated that TNBC cells induce glycolysis and CD8<sup>+</sup> T cell senescence. NGR-NVs@Cur were successfully constructed and marked by transmission electron microscopy (TEM), dynamic light scattering (DLS), pH-responsive release, and cellular uptake assays. Further cell-based studies demonstrated that NGR-NVs@Cur suppressed TNBC cell proliferation, migration, glycolysis, and reversed CD8<sup>+</sup> T cell senescence. In vivo, both subcutaneous xenograft and adoptive T cell transfer models were developed to evaluate the therapeutic effects of NGR-NVs@Cur in combination with immune checkpoint inhibitors (ICIs, e.g., J43). The results revealed that Cur inhibited TNBC cell glycolysis and T cell senescence by activating TLR9 and suppressing the mTOR pathway, and that NGR-NVs@Cur enhanced targeted Cur delivery and effectively reversed immunotherapy resistance. This study demonstrated a novel strategy by which Cur, delivered via tumor-targeted nanovesicles, modulates glycolysis and CD8<sup>+</sup> T cell senescence through the TLR9-mTOR axis, offering promising insights into overcoming immune resistance in TNBC.

PEBP1
Also flagged:manganesemetabolismcancerkidney cancerGBMtumour
Journal Article 2025-07-01 ✓ 5 Snippets Liu Y, Ye H, Zhang R, Liu X, Liu R.
In-Text Gene Mentions

…CAT, PLG, PPARGC1A,PEBP1, and TFAP2A show…

…the PCK1, PLG,PEBP1, and CAT show…

…in epithelial cells,PEBP1is mainly expressed…

…For instance,PEBP1is significantly positively…

…- 0.014800812 \times {\text{PEBP1}} - 0.070778384 \\…

Show Full Abstract

<h4>Background</h4>Manganese modulates tumorigenesis and immune regulation. High levels of manganese may promote cancer progression. While manganese toxicity causes renal tubular damage and chronic impairment, its association with kidney cancer remains poorly understood.<h4>Methods</h4>We systematically analyzed manganese metabolism genes in KIRC using the TCGA dataset. Through integrated bioinformatics approaches, including differential expression analysis, univariate Cox regression, and three machine learning algorithms (Boruta, GBM, and RFS), we identified prognosis-related MMCG. The Ward.D2 method was used to identify MMCG subtypes, while Lasso-cox regression analysis was performed to establish the MMCG risk model. The predictive performance was validated through time-dependent ROC analysis, calibration curves, and decision curve analysis.<h4>Results</h4>We identified 11 prognosis-related manganese metabolism core genes (MMCGs). KIRC patients were stratified into two clusters based on MMCG expression levels. Patients in Cluster I showed poorer outcomes, which were associated with tumour progression. The MMCG risk score was subsequently developed using LASSO-Cox regression analysis, and patients were classified into high- and low-risk groups. Survival analysis revealed that the outcomes of high-risk group patients were poorer than those of the low-risk group. Univariate and multivariate analyses confirmed the MMCG risk score as an independent prognostic biomarker. Pathway enrichment analysis showed differential enrichment of immune and metabolic pathways across subtypes and risk groups. We constructed a clinical nomogram incorporating the MMCG risk score and other clinical parameters, which demonstrated highly accurate predictive capabilities. Immune infiltration analysis and immune therapy response predictions indicated that patients in Cluster I and the high-risk group showed low responses to immune therapy.<h4>Conclusion</h4>Our findings provide a basis for clinical stratification strategies and future research on manganese-based interventions for renal cell carcinoma (RCC).

DARS2
Also flagged:lactatetumorlung adenocarcinomaLUADlung cancercarboplatin
Journal Article 2025-07-01 ✓ 4 Snippets Wang Y, Li H, Chen C, Yu H, Xu L.
In-Text Gene Mentions

…COL4A1 *0.044 +DARS2* 0.032 +…

…, COL4A1 ,DARS2, C1QBP ,…

…, RXYLT1 ,DARS2, C1QBP , and…

…PLEC, SOD1, RXYLT1,DARS2, C1QBP, and ACAT2…

Show Full Abstract

<h4>Background</h4>Lactate plays a critical role in tumor development, metastasis, drug resistance, and regulation of tumor microenvironment. This study aimed to develop a prognostic signature for lung adenocarcinoma (LUAD) based on lactate-related genes (LRGs).<h4>Methods</h4>We initially performed univariate Cox regression analysis on 269 cases of LRGs in TCGA- LUAD cohort to determine LRGs related to overall survival (OS). Fourteen LRGs were used to construct a prognostic risk model and verified in three external cohorts (GSE31210, GSE68465, and GSE30219). The relationship between risk model and immune cell infiltration, as well as drug sensitivity was explored. The expression of 14 key genes in lung cancer cell lines (A549, NCI-H2009, and NCI-H1975) and normal bronchial epithelial cell line (BEAS-2B) was detected by qRT-PCR.<h4>Results</h4>A 14-LRG prognosis signature was constructed. Patients in the high-risk group had significant worse OS compared to those in the low-risk group (HR = 2.33; 95%CI, 1.72-3.14; P < 0.0001). Three independent external verification cohorts were used to verify our results, and consistent results were observed in them. There are significant differences in the infiltration of seven kinds of immune cells between high-risk and low-risk patients with LUAD. Low-risk patients responded well to carboplatin and paclitaxel, whereas high-risk patients were more sensitive to docetaxel (P < 0.05). Additionally, qRT-PCR confirmed that the expression of prognostic genes was basically consistent with the results of bioinformatics analysis.<h4>Conclusion</h4>We successfully developed and validated a 14-LRG prognostic signature for LUAD, which was associated with immune status and drug resistance.

Also flagged:Tumorcancerneoplasmstumourtumoursinnervation
Journal Article 2025-07-01 No Snippets Wang X, Fan Y, Wang Q, Shu X, Lin J, Guo J, Li Z, Xu J.
Show Full Abstract

Cancer neuroscience has evolved as a novel discipline that elucidates the intricate relationships between the neurological system and neoplasms. Research indicates that the ablation of particular nerve types, including parasympathetic, sympathetic, or sensory nerves, can suppress tumour growth in a tissue-specific manner. Moreover, numerous tumours exhibit greater innervation density than their normal tissue equivalents, prompting essential enquiries on the processes of tumour innervation and its molecular contribution to disease progression. These findings underscore the significant clinical ramifications of tumour axon production and establish a theoretical foundation for the development of anticancer treatments aimed at neural mechanisms. Current studies have investigated the potential effectiveness of repurposing neuroactive pharmaceuticals as anticancer medicines, and emerging therapies for chemotherapy-induced peripheral neuropathy. This review seeks to encapsulate the function of tumor-infiltrating nerves in carcinogenesis and disease advancement, while also examining novel therapeutic approaches in this domain.

Also flagged:efferocytosistumorcervical squamous carcinomaGene ExpressionPRER
Journal Article 2025-07-01 No Snippets Ma LL, Zhao LJ, Zhang Y, Ma YF, Shang Q, Liu XL.
Show Full Abstract

<h4>Background</h4>Genes associated efferocytosis play a critical role in tumor invasion, metastasis, and clinical outcomes in several malignancies. However, their prognostic relevance in cervical squamous carcinoma (CESC) is currently unclear.<h4>Methods</h4>Data from the Cancer Genome Atlas (TCGA) database were used to create the TCGA-CESC cohort. Additional CESC-related datasets (GSE44001 and GSE168652) were retrieved from the Gene Expression Omnibus database. Single-cell analysis of the GSE168652 dataset was conducted to identify differentially expressed genes (DEGs), associated with efferocytosis (ER-DEGs). CESC samples from the TCGA cohort were classified into clusters, and prognosis-related DEGs (PR-DEGs) were identified by comparing these clusters. The intersection of ER-DEGs and PR-DEGs generated a subset of prognosis-efferocytosis related DEGs (PER-DEGs). Subsequently, a risk model was developed using univariate Cox regression and least absolute shrinkage and selection operator analysis. Independent prognostic factors were further analyzed using Cox regression analysis. Functional pathways were examined through gene set enrichment analysis.<h4>Results</h4>A total of 15 cell clusters were identified from the GSE168652 dataset and categorized into seven distinct cell types. Comparative analysis indicated 774 ER-DEGs between groups with high and low ERG expression levels. From these, 332 PER-DEGs were identified. A prognostic risk model was constructed based on seven characteristic genes: ITGA5, SNRPF, EGLN1, NDUFB7, NDUFA2, SRGAP3, and PCNA. Risk score and pathologic-N emerged as independent prognostic factors. These genes were found to be associated with multiple pathways implicated in the pathogenesis of CESC.<h4>Conclusion</h4>Seven efferocytosis-related prognostic genes were identified as prognostic markers for CESC, providing a scientific basis for further research on their role in disease progression.

Also flagged:IgA NephropathyNephropathyIgA vasculitisgene expressioncomplement activationendoplasmic reticulum
Journal Article 2025-07-01 No Snippets Levin A, Schwarz A, van Hoef V, Wijkström J, Bruchfeld A, Herthelius M, Wennberg L, Bárány P, Witasp A, Wernerson A.
Show Full Abstract

No abstract available.

HFE
Also flagged:glucocorticoid receptorcholesterolGRHDL receptorslipoproteinatherosclerosis
Journal Article 2025-07-01 ✓ 1 Snippet Durumutla HB, Haller A, Noble G, Prabakaran AD, McFarland K, Latimer H, Rajput A, Akinborewa O, Namjou-Khales B, Hui DY, Quattrocelli M.
In-Text Gene Mentions

…, SLC22A1 ,HFE, MYLIP ,…

Show Full Abstract

Elevated cholesterol poses cardiovascular risks. The glucocorticoid receptor (GR) harbors a still undefined role in cholesterol regulation. Here, we report that a coding SNP in the gene encoding the GR, rs6190, is associated with increased cholesterol in women according to UK Biobank and All of Us (NIH) datasets. In SNP-genocopying mice, we found that the SNP enhanced hepatic GR activity to transactivate Pcsk9 and Bhlhe40, negative regulators of LDL and HDL receptors, respectively. In mice, the SNP was sufficient to elevate circulating cholesterol across all lipoprotein fractions and the risk and severity of atherosclerotic lesions on the proatherogenic hAPOE*2/*2 background. The SNP effect on atherosclerosis was blocked by in vivo liver knockdown of Pcsk9 and Bhlhe40. Also, corticosterone and testosterone were protective against the mutant GR program in cholesterol and atherosclerosis in male mice, while the SNP effect was additive to estrogen loss in females. Remarkably, we found that the mutant GR program was conserved in human hepatocyte-like cells using CRISPR-engineered, SNP-genocopying human induced pluripotent stem cells. Taken together, our study leverages a nonrare human variant to uncover a GR-dependent mechanism contributing to atherogenic risk, particularly in women.

Also flagged:cell divisionimmune responsesmetabolic diseaseT cell receptorrespiratory infectionsangina
Journal Article 2025-07-01 No Snippets Sandhar B, Vyas V, Harding D, Ragazzini R, Bonfanti P, Marelli-Berg FM, Bell CG, Chain BM, Longhi MP.
Show Full Abstract

BACKGROUNDThymic involution with age leads to reduced T cell output and impaired adaptive immunity. However, the extent to which thymic activity persists later in life and how this contributes to immunological aging remains unclear. This study aimed to assess the presence and function of thymic tissue in older adults and identify factors influencing residual thymopoiesis.METHODSPatients aged 50 or older undergoing cardiothoracic surgery were recruited. Thymic structures within mediastinal adipose tissue were evaluated using histology, immunofluorescence, flow cytometry, T cell receptor (TCR) sequencing, and RNA sequencing. Recent thymic emigrants (RTEs) were quantified in peripheral blood and correlated with transcriptomic, epigenetic, and TCR repertoire data. Primary outcomes included thymic tissue identification, RTE frequency, and immune correlates.RESULTSFunctional thymic tissue was identified in mediastinal adipose tissue of older individuals. The frequency of CD31+CD4+ T cells (RTEs) positively correlated with the presence of thymic tissue. Thymic output showed substantial heterogeneity and was influenced by sex and smoking history. Thymic activity was associated with increased TCR repertoire diversity, improved immune protection against infections, and reduced epigenetic aging. Detailed profiling uncovered functional and phenotypic heterogeneity within naive CD4+ T cell subsets shaped by thymic activity.CONCLUSIONThis study demonstrates that thymic function can persist into later life and is modulated by factors such as sex and smoking. These findings suggest that thymic activity during aging is heterogeneous and influenced by more than chronological age alone, with potential implications for immune competence in older adults.

Also flagged:synthesissilverureaseα-glucosidasecarbonic anhydrase IIxanthine oxidase
Journal Article 2025-07-01 No Snippets Din IU, Ajaj R, Rauf A, Ahmad Z, Muhammad N, Ali S, Hemeg HA, Ullah I.
Show Full Abstract

In this work, Silver (Ag) nanoparticles (NPs) were synthesized via green synthesis using Ficus benghalensis root extract (FBRE), serving as a capping and stabilizing agent. The synthesized Ag NPs were characterized via complementary characterization techniques, including SEM, XRD, EDS, UV-Vis, and FT-IR. SEM analysis revealed the fabrication of spherical NPs with an average size of 41.55 nm. A plasmon resonance peak was observed at 430 nm. FBRE effectively capped and stabilized the Ag NPs, ensuring their structural integrity over time, and is confirmed via FT-IR scan. DFT calculation revealed a thermodynamically and mechanically stable system. Moreover, optoelectronic properties confirmed the metallic behavior of Ag with a major contribution from 4d orbital near the fermi level and 5s orbital contribution to the conduction band with light absorption in the visible spectrum. Biological evaluations demonstrated significant enzyme inhibition. Ag NPs inhibited urease (80.76%), α-glucosidase (80.98%), carbonic anhydrase II (89.32%), and xanthine oxidase (49.9%), outperforming FBRE. In Vivo, Ag NPs exhibited dose-dependent analgesic (83.09% writhing inhibition at 10 mg/kg, similar to diclofenac) and sedative (16.09% locomotor reduction at 10 mg/kg) effects. Molecular docking confirmed strong enzyme-ligand interactions. These findings highlight the biomedical potential of FBRE-synthesized Ag NPs, particularly for enzyme inhibition and pharmacological applications.

Also flagged:infectious diseasesInfectious DiseaseCOVID-19metals-19silver
Journal Article 2025-07-01 No Snippets Ben Ameur H, Jamaani F, Abu Alfoul MN.
Show Full Abstract

This study investigates the co-movements between prominent financial assets-crude oil, natural gas, gold, and Bitcoin-and uncertainty indices, including the Infectious Disease Equity Market Volatility Tracker (IDEMV) and the Geopolitical Risk Index (GPR), from January 2017 to January 2023. By employing advanced wavelet techniques-Wavelet Power Spectrum (WPS), Bi-Wavelet Coherence (WCA), Multiple Wavelet Coherence (MWC), and Partial Wavelet Coherence (PWC)-we analyze their time- and frequency-dependent responses to market shocks. The results reveal that Bitcoin and WTI exhibit time-varying sensitivity to IDEMV, particularly at short- and medium-term frequencies, highlighting their vulnerability to health-related crises like COVID-19. In contrast, gold and natural gas respond more strongly to GPR, with gold demonstrating a long-term leading role during geopolitical uncertainties, while Bitcoin and WTI lead in health-related shocks. The Russia-Ukraine conflict further amplified GPR's impact on Bitcoin and increased natural gas's vulnerability to geopolitical disruptions. These findings underscore the need for tailored strategies to address health and geopolitical risks. Policymakers should enhance crisis-response frameworks for Bitcoin and crude oil, while investors can reduce uncertainty by diversifying portfolios with resilient assets like gold and natural gas.

LRRC7
Also flagged:organizationStructural Maintenance of ChromosomescohesinchromosomesCondensin Imitosis
Journal Article 2025-07-01 ✓ 1 Snippet Isenhart R, Nguyen SC, Rosin L, Cao W, Walsh P, Muzaffar H, Ellison CE, Joyce EF.
In-Text Gene Mentions

CondensinII shapes chromosomes…

Show Full Abstract

The spatial organization of the genome is crucial for its function and integrity. Although the ring-like SMC complex condensin II has a well-documented role in organizing mitotic chromosomes, its function in interphase chromatin structure has remained more enigmatic. Using a combination of Oligopaint fluorescence in situ hybridization (FISH) and Hi-C, we show that altering condensin II levels in diploid Drosophila cells significantly changes chromosome architecture at large length scales between chromatin compartments. Notably, condensin II overexpression disrupts the robust boundary between heterochromatin and euchromatin, leading to interactions that span entire chromosomes. These interactions occur independent from transcriptional changes, suggesting that the mechanisms driving compartment formation and their interactions might be distinct aspects of genome organization. Our results provide new insights into the dynamic nature of chromosome organization and underscore the importance of condensin II in maintaining genomic stability.

HFE
Also flagged:caspase-8deathmembranephosphatidylserinemitochondrialprogrammed cell death
Journal Article 2025-07-01 ✓ 1 Snippet Tkachenko A, Alfhili MA, Alsughayyir J, Attanzio A, Al Mamun Bhuyan A, Bukowska B, Cilla A, Quintanar-Escorza MA, Föller M, Havranek O, Jilani K, Onishchenko A, Pretorius E, Prokopiuk V, Restivo I, Tesoriere L, Virzì GM, Wieder T.
In-Text Gene Mentions

…iron overload inhemochromatosispatients is associated…

Show Full Abstract

Early studies have shown that erythrocytes have caspase-3 and caspase-8 and are capable of dying through an apoptotic-like cell death triggered by Ca<sup>2+</sup> ionophores. This cell death is associated with apoptosis-like morphological signs, including cell shrinkage, membrane blebbing, and phosphatidylserine externalization. To emphasize that mature erythrocytes don't have the apoptotic mitochondrial machinery and distinguish this unique cell death modality from apoptosis, it was named "eryptosis". Over recent decades, our knowledge of eryptosis has been significantly expanded, providing more insights into the uniqueness of cell death pathways in erythrocytes. In this review, we aim to summarize our current understanding of eryptosis, formulate the nomenclature and guidelines to interpret results of eryptosis studies, provide a synopsis of morphological and biochemical features of eryptosis, and highlight the role of eryptosis in health and disease, including its druggability.

MMS22L
Also flagged:BAHCC1MCMmethylationhistonecell cycleMini-chromosome Maintenance
Journal Article 2025-07-01 ✓ 1 Snippet Li D, Zhang ZM, Mei L, Yu Y, Guo Y, Mackintosh SG, Chen J, Allison DF, Kim A, Storey AJ, Edmondson RD, Byrum SD, Tackett AJ, Cai L, Cook JG, Song J, Wang GG.
In-Text Gene Mentions

…pair complexes (namely, TONSL–MMS22Land BARD1–BRCA1) for…

Show Full Abstract

Mono-methylation of histone H4 lysine 20 (H4K20me1) regulates DNA replication, cell cycle progression and DNA damage repair. How exactly H4K20me1 regulates these biological processes remains unclear. Here, we report that an evolutionarily conserved tandem Tudor domain (TTD) in BAHCC1 (BAHCC1<sup>TTD</sup>) selectively reads H4K20me1 for facilitating replication origin activation and DNA replication. Our biochemical, structural, genomic and cellular analyses demonstrate that BAHCC1<sup>TTD</sup> preferentially recognizes H4K20me1 to promote the recruitment of BAHCC1 and its interacting partners, notably Mini-chromosome Maintenance (MCM) complex, to replication origin sites. Combined actions of the H4K20me1-reading BAHCC1 and the H4K20me2-reading Origin Recognition Complex (ORC) ensure genomic loading of MCM for replication. Depletion of BAHCC1, or disruption of the BAHCC1<sup>TTD</sup>:H4K20me1 interaction, reduces H4K20me1 levels and MCM loading, leading to defects in replication origin activation and cell cycle progression. In summary, this study identifies BAHCC1<sup>TTD</sup> as an effector transducing H4K20me1 signals into MCM recruitment to promote DNA replication.

DARS2
Also flagged:lung adenocarcinomacancerLUADPOSTNLung cancercancers
Journal Article 2025-07-01 ✓ 1 Snippet Zhao J, Jing C, Fan R, Zhang W.
In-Text Gene Mentions

…36 , andDARS2has been identified…

Show Full Abstract

Cancer-associated fibroblasts (CAFs) play important roles in the progression of lung adenocarcinoma (LUAD). We examined CAF subgroups via gene ontology, pseudo-time, and cell communication analyses and explored their prognostic value in LUAD using a digital cytometric machine learning algorithm. Next, we got a prognostic model based on CAF subgroups. We also screened potential therapeutic target genes in LUAD and experimentally validated the proliferation, migration, and invasion phenotypes related to these target genes. We identified myofibroblastic CAFs (MyCAFs) and Immune-related CAFs (ImmCAFs) as the major CAF subgroups in LUAD. Further, our inverse convolution algorithm showed that MyCAFs have prognostic potential in LUAD, and via LASSO-COX model regression, we obtained a MyCAFs-related prognostic model. We found POSTN as a potential therapeutic target in LUAD. These findings serve as a foundation for further studies on CAFs.

SUDS3
Also flagged:curcuminoidosteoclast differentiationNF-κBCurcuminoidsbone resorptionnuclear factor I-A
Journal Article 2025-07-01 ✓ 1 Snippet Jantarawong S, Khimmaktong W, Swangphon P, Lauterbach N, Nanakorn N, Panichayupakaranant P, Pengjam Y.
In-Text Gene Mentions

…modifiers, such aspolycomb repressiverepressive complex, which…

Show Full Abstract

Curcuminoids, the major bioactive compounds in Curcuma longa L., inhibit osteoclast differentiation-a key process in bone resorption. microRNA-223 regulates osteoclast differentiation by targeting nuclear factor I-A. How curcuminoids influence osteoclast differentiation through microRNA-223 is unclear. This study investigated the effects of CRE-Bin-a binary curcuminoid complex of a curcuminoid-rich extract and hydroxypropyl-β-cyclodextrin-on osteoclast differentiation. In murine receptor activator of nuclear factor-κB ligand-stimulated RAW 264.7 macrophages, CRE-Bin inhibited osteoclast differentiation and bone resorption by reducing tartrate-resistant acid phosphatase activity, cathepsin K expression, reactive oxygen species production, and canonical NF-κB signaling pathway. CRE-Bin suppressed microRNA-223 expression at the primary, precursor, and mature stages while upregulating nuclear factor I-A expression, suggesting dual regulatory effects. Molecular docking simulations demonstrated strong interactions between microRNA-223 and the IκBα/p50/p65 complex, indicating crosstalk between microRNA-223 and canonical NF-κB signaling pathway. Binding affinity predictions revealed moderate interactions between curcuminoids and mature microRNA-223, underscoring their potential for microRNA-targeted modulation. These findings position CRE-Bin as a promising multitarget therapeutic agent for bone-related disorders and diseases, warranting experimental and computational investigations.

DCC
Also flagged:intraventriculary hemorrhagegestationintraventricular hemorrhagedeathplacenta previaabruption
Journal Article 2025-07-01 ✓ 2 Snippets Akyol Ozkara K, Alan S, Ozalp Akin E, Okulu E, Bingoler Pekcici EB, Caglar E, Erdeve O, Atasay B, Arsan S.
In-Text Gene Mentions

…Furthermore,DCCis associated with…

…outcomes compared toDCC, and in some…

Show Full Abstract

To evaluate the effect of intact cord milking (I-UCM) compared to immediate cord clamping (ICC) on neurodevelopmental outcomes at seven years of age in very preterm infants. This prospective single-blind cohort study included children who were previously participated in a randomized controlled trial comparing I-UCM and ICC. At about 7 years of age, participants were administered the Vineland Adaptive Behavior Scales, Second Edition (Vineland-II) and the Wechsler Intelligence Scale for Children, Fourth Edition (WISC-IV). A total of 31 children were included in the follow-up study. The mean age of participants was 6.4 ± 0.5 years. The mean gestational age at birth was 28.5 ± 1.7 weeks. There were no cases with grade ≥ 3 intraventriculary hemorrhage (IVH) in the present study cohort. Although the I-UCM group showed a trend toward higher median full-scale IQ, the difference was not statistically significant (p: 0.057). A significantly higher percentage of cases in the I-UCM group achived a full-scale IQ above 85 in the WISC-IV (p = 0.048). The mean of the "written language scaled score" subdomain among Vineland-II scores was found to be significantly higher in the I-UCM group. A significantly higher percentage of cases in the I-UCM group had a written language scaled score above 12 (p: 0.029).<h4>Conclusion</h4>A comparison of I-UCM with ICC in preterm infants born at a mean age of 28 weeks and without severe IVH revealed that I-UCM did not result in long-term neurodevelopmental adverse outcomes. I-UCM even had positive effects in some subdomains of detailed neurodevelopmental tests.<h4>What is known</h4>• Compared to immediate cord clamping, umbilical cord milking improves the short-term postnatal outcomes of very preterm infants. There is a lack of robust data regarding the long-term neurodevelopmental effects of umbilical cord milking  in preterm infants.<h4>What is new</h4>• Among very preterm infants without severe intraventricular hemorrhage, intact umbilical cord milking was not associated with long-term adverse neurodevelopmental outcomes. Intact-umbilical cord milking even had positive effects in some subdomains of detailed neurodevelopmental tests.

B4GALT5
Also flagged:membraneGlycosphingolipidsgangliosidesglycosyltransferasemetabolismneurological diseases
Journal Article 2025-07-01 ✓ 1 Snippet Welland JWJ, Barrow HG, Stansfeld PJ, Deane JE.
In-Text Gene Mentions

…in the pathway,B4GALT5/6, that synthesises LacCer,…

Show Full Abstract

Glycosphingolipids (GSLs) are crucial membrane components involved in essential cellular pathways. Complex GSLs, known as gangliosides, are synthesised by glycosyltransferase enzymes and imbalances in GSL metabolism cause severe neurological diseases. B4GALNT1 synthesises the precursors to the major brain gangliosides. Loss of B4GALNT1 function causes hereditary spastic paraplegia, while its overexpression is linked to cancers including childhood neuroblastoma. Here, we present crystal structures of the human homodimeric B4GALNT1 enzyme demonstrating dynamic remodelling of the substrate binding site during catalysis. We show that processing of lipid substrates by B4GALNT1 is severely compromised when surface loops flanking the active site are mutated from hydrophobic residues to polar. Molecular dynamics simulations support that these loops can insert into the lipid bilayer explaining how B4GALNT1 accesses and processes lipid substrates. By combining structure prediction and molecular simulations we propose that this mechanism of dynamic membrane insertion is exploited by other, structurally distinct GSL synthesising enzymes.

PCDH17
Also flagged:γ-secretaseProteasesintramembranebindingcleavingprotease
Journal Article 2025-07-01 ✓ 1 Snippet Breimann S, Kamp F, Basset G, Abou-Ajram C, Güner G, Yanagida K, Okochi M, Müller SA, Lichtenthaler SF, Langosch D, Frishman D, Steiner H.
In-Text Gene Mentions

…candidates CLMP, ICAM1,PCDH17, as well as…

Show Full Abstract

Proteases recognize substrates by decoding sequence information-an essential cellular process elusive when recognition motifs are absent. Here, we unravel this problem for γ-secretase, an intramembrane-cleaving protease associated with Alzheimer's disease and cancer, by developing Comparative Physicochemical Profiling (CPP), a sequence-based algorithm for identifying interpretable physicochemical features. We show that CPP deciphers a γ-secretase substrate signature with single-residue resolution, which can explain the conformational transitions observed in substrates upon γ-secretase binding. Using machine learning, we predict the entire human γ-secretase substrate scope, revealing numerous previously unknown substrates. Our approach outperforms state-of-the-art protein language models, improving prediction accuracy from 60% to 90%, and achieves an 88% success rate in experimental validation. Building on these advancements, we identify pathways and diseases not linked before to γ-secretase. Generally, CPP decodes physicochemical signatures-a concept that extends beyond sequence motifs. We anticipate that our approach will be broadly applicable to diverse molecular recognition processes.

SUDS3
Also flagged:HistonenucleosomechromatinFLOWERING LOCUS CFLCgene silencing
Journal Article 2025-07-01 ✓ 1 Snippet Montez M, Zhu D, Huertas J, Maristany MJ, Rutjens B, Nielsen M, Collepardo-Guevara R, Dean C.
In-Text Gene Mentions

…DNA and thehistone complexcomplex), referred to…

Show Full Abstract

Temperature influences nucleosome dynamics, and thus chromatin, to regulate gene expression. Such mechanisms underlie the epigenetic silencing of Arabidopsis FLOWERING LOCUS C (FLC) by prolonged cold. Here, we show a temperature-dependent transition in local chromatin structure at the H3K27me3 nucleation region, from a modality active for transcription to a state that can be Polycomb silenced. In vivo chromatin measurements and coarse-grained simulations at near-atomistic resolution show that the active transcription state is characterised by a highly dynamic nucleosome arrangement that exposes the FLC transcription start site (TSS). Cold exposure then changes the chromatin by reducing nucleosome dynamics and re-positioning the + 1 nucleosome, leading to transcriptional repression. This local chromatin transition partially depends on VERNALIZATION1 (VRN1), a non-sequence-specific DNA-binding protein. Loss of VRN1 results in hyperaccumulation of H2A.Z, more dynamic nucleosomes and an inability to accumulate H2Aub and H3K27me3. Our work highlights how local nucleosome dynamics link to chromatin structure transitions to integrate temperature inputs into epigenetic switching mechanisms in plants.

POU3F2
Also flagged:cancergene expressionmethylationovarian cancerchromatingene expressions
Journal Article 2025-07-01 ✓ 1 Snippet Castellano-Escuder P, Zachman DK, Han K, Hirschey MD.
In-Text Gene Mentions

…Sox2, Neurog1, Pou3f1,Pou3f2, Sox11, and Crabp2.…

Show Full Abstract

Integrating high-dimensional cellular multi-omics data is crucial for understanding various layers of biological control. Single 'omic methods provide important insights, but often fall short in handling the complex relationships between genes, proteins, metabolites and beyond. Here, we present a novel, non-linear, and unsupervised method called GAUDI (Group Aggregation via UMAP Data Integration) that leverages independent UMAP embeddings for the concurrent analysis of multiple data types. GAUDI uncovers non-linear relationships among different omics data better than several state-of-the-art methods. This approach not only clusters samples by their multi-omic profiles but also identifies latent factors across each omics dataset, thereby enabling interpretation of the underlying features contributing to each cluster. Consequently, GAUDI facilitates more intuitive, interpretable visualizations to identify novel insights and potential biomarkers from a wide range of experimental designs.

OLFM4
Also flagged:Lipoic acidagingsynthesisα-lipoic acidmTORrapamycin
Journal Article 2025-07-01 ✓ 5 Snippets Zhang Z, Wan Q, Zhu Y, Ye J, Fu F, Fan X, Chen H, Ren G, Jiang W, Guo X, Zhou J, Yan, Yan J, Liu X, Yuan Y, Chen Y, Chen H.
In-Text Gene Mentions

…CY5400) and anti-mouseOlfm4(1:100, Cell Signaling…

…echnology, 62016S), anti-mouseOlfm4(1:100, Cell Signaling…

…Lysozyme + cells,Olfm4+ cells and…

…Lysozyme + ,Olfm4+ cells and…

…+ cells andOlfm4+ ISCs (Fig.…

Show Full Abstract

Intestinal stem cell (ISC) aging diminishes the regenerative capacity of the intestinal epithelia, but effective therapeutic strategies to counteract human ISC aging remain elusive. Here, we find that the synthesis of α-lipoic acid (ALA) is reduced in old human small intestine. Notably, ALA supplementation inhibits ISC aging and decreases the number of atypical Paneth cells in old human intestinal organoids and in old mouse small intestines. Importantly, we discern that the effect of ALA on mitigating ISC aging is contingent upon the presence of Paneth cells. Inhibiting the mTOR pathway in Paneth cells with ALA or rapamycin significantly increases cyclic ADP ribose (cADPR) secretion and decreases Notum secretion, which, in turn, enhances ISC functions. In this work, our findings substantiate the role of ALA in inhibiting human ISC aging and present a potential therapeutic approach for managing age-related human intestinal diseases.

SOX6
Also flagged:muscarinic M4-receptordopamineacetylcholinePDmuscarinic M4 receptorM4 receptor
Journal Article 2025-07-01 ✓ 1 Snippet Nielsen BE, Ford CP.
In-Text Gene Mentions

…prominent loss wereSox6+ 44 .…

Show Full Abstract

In Parkinson's disease (PD), imbalances in dorsal striatum pathways are thought to lead to motor dysfunction due to loss of dopamine (DA) and the disruption of coordinated modulation with acetylcholine (ACh). Here, we examined changes in cholinergic modulation of striatal direct pathway medium spiny neurons (dMSNs) in mice that were partially or completely depleted of DA, to model early and advanced stages of PD. We found a reduction in muscarinic M4 receptor signaling in the dorsolateral striatum (DLS) following partial DA loss of DA, which was not evident in the dorsomedial region (DMS) until DA loss was nearly complete. This decrease resulted from reduced postsynaptic M4 receptor function, as ACh release or clearance was unaffected, and could not be rescued by L-DOPA. These findings reveal how changes in cholinergic modulation follow the temporal and regional pattern of dopaminergic degeneration, which is critical for understanding their shared role in PD progression.

HFE
Also flagged:carbon dotssynthesisethylene glycol tetraacetic acidascorbic aciddopamineamino acids
Journal Article 2025-07-01 ✓ 1 Snippet Iqbal K, Iqbal A, Qin W, Imran M, Ajmal Z, Khan I, Xing G.
In-Text Gene Mentions

…with conditions likehemochromatosis, kidney damage, increased…

Show Full Abstract

We present a novel, one-step hydrothermal synthesis of carbon dots (CDs) with intense blue fluorescence and a remarkably high quantum yield of 50%, using ethylene glycol tetraacetic acid (EGTA) as a single precursor eliminating the need for additional passivation agents. This streamlined strategy represents a significant advancement in the efficient production of functional CDs. The resulting CDs exhibit dual-mode fluorescence sensing, selectively detecting Fe<sup>3+</sup> through a fluorescence quenching mechanism, with an ultra-low detection limit of 23 nM. Notably, the quenched fluorescence is fully restored upon the introduction of ascorbic acid (AA), enabling a highly sensitive "off-on" detection system with a detection limit of 21 nM. This approach demonstrates excellent selectivity for AA over dopamine and other amino acids, providing a reliable method for distinguishing AA in complex biological matrices. Furthermore, the CDs-based Fe<sup>3+</sup>/AA sensing system proves highly effective for bioimaging applications, allowing for clear visualization of Fe<sup>3+</sup> and AA in living cells. Compared to conventional commercial assays, this method is cost-effective, simple, and scalable, offering a powerful tool for next-generation biosensing and bioimaging. The fluorescence-based "off-on" mechanism, combined with the versatility of CDs in real-sample analysis, highlights the innovation and practical value of this approach.

NEGR1
Also flagged:PCOSPolycystic ovary syndromecomplex endocrine disorderobesitygene expressionCytoplasmic Polyadenylation Element Binding Protein 4
Journal Article 2025-07-01 ✓ 4 Snippets Cui J, Chang H, Song Y, Wang H, Sun L.
In-Text Gene Mentions

…Growth Regulator 1 (NEGR1), may regulate exosomal…

…the involvement ofNEGR1in cell adhesion…

…PLTP, TP53I3, andNEGR1, were identified through…

…key genes—PLTP, TP53I3,NEGR1, and CPEB4—that play…

Show Full Abstract

Polycystic ovary syndrome (PCOS) is a complex endocrine disorder often worsened by obesity, leading to chronic inflammation, metabolic dysregulation, and reproductive dysfunction. This study aims to uncover the molecular mechanisms underlying reproductive dysfunction in obese PCOS patients by identifying key regulatory genes, pathways, and immune interactions, with a focus on cross-tissue regulators and potential therapeutic targets. We analyzed transcriptomic data from multiple datasets, including GSE43322, GSE43264, GSE124226, GSE54250, GSE48301, and GSE114419. Differential gene expression analysis, weighted gene co-expression network analysis, immune infiltration profiling, and pathway enrichment were performed. Cross-tissue comparisons identified overlapping genes, and molecular docking was conducted to screen FDA-approved small molecules targeting key regulators. qPCR was conducted on PBMCs from 5 PCOS patients and 5 controls to validate the expression of Cytoplasmic Polyadenylation Element Binding Protein 4 (CPEB4). CPEB4 was identified as a critical cross-tissue regulator linking systemic metabolic dysregulation with local ovarian dysfunction. It was enriched in pathways related to oocyte maturation and meiosis, highlighting its role in reproductive health. Immune infiltration analysis revealed increased pro-inflammatory M1 macrophages and decreased anti-inflammatory M2 macrophages in adipose tissue, contributing to chronic inflammation. qPCR results confirmed a significant upregulation of CPEB4 in PBMCs from PCOS patients compared to controls, with a 2.8-fold increase (p < 0.01). Molecular docking identified several small molecules with high binding affinity to CPEB4, including 6-aminohexanoic acid and N-hydroxyacetamide, as potential therapeutic candidates. This study provides novel insights into the pathophysiology of obese PCOS, emphasizing the role of CPEB4 as a key regulator connecting metabolic and reproductive dysfunction. The qPCR validation in PBMCs further supports the systemic relevance of CPEB4 in PCOS. Targeting CPEB4 with small-molecule therapeutics offers a promising strategy for addressing both systemic and reproductive abnormalities in obese patients with PCOS.

FBXL4
Also flagged:rhythmsgene expressionCircadian rhythmshormone secretioncognitionnucleus
Journal Article 2025-07-01 ✓ 1 Snippet Zacharias AM, O'Connor CD, Topouza DG, Fang ZY, Ghazinejad H, Chen H, Duan Q, Ghasemlou N.
In-Text Gene Mentions

…Only Rbm6 ,Fbxl4, Rfx4 ,…

Show Full Abstract

Biological rhythms control gene expression, but effects on central nervous system (CNS) cells and structures remain poorly defined. While circadian (24-hour) rhythms are most studied, many genes have periods of greater and less than 24-hours; these fluctuations can be both site- and cell-specific. Identifying patterns of gene rhythmicity across the CNS is necessary for both the study of chronobiology and to make sense of data obtained in the laboratory. We now identify cycling mRNAs, miRNAs, gene networks and mRNA-miRNA co-expression pairs in the cortex, hypothalamus, and corpus striatum of male C57BL/6J mice using high-dimensional datasets. A searchable catalogue ( https://www.ghasemloulab.ca/chronoCNS ) helps refine the analysis of cellular and molecular rhythmicity across the CNS (using the liver as a control). Immunofluorescence confirms the rhythmicity of key targets across cells in these structures, with strong cycling signatures in resting oligodendrocytes. Our study sheds light on the contribution of diurnal, ultradian, and infradian rhythms and mRNA-miRNA interactions to CNS function.

TNFSF4
Also flagged:TMBIM6gliomaendoplasmic reticulumcancergliomasGene Expression
Journal Article 2025-07-01 ✓ 2 Snippets Khatun MS, Rashid MMU, Ullah A, Kim HR.
In-Text Gene Mentions

…TNFRSF25, TNFSF13, TNFSF13B,TNFSF4, TNFSF9) (Fig. 6…

…TNFRSF4, TNFSF13, TNFSF13B,TNFSF4, TNFSF9) were statistically…

Show Full Abstract

TMBIM6, a transmembrane BAX inhibitor motif containing 6, located in the endoplasmic reticulum, is linked to various cellular processes and cancer progression. Previous investigations showed a substantial association between TMBIM6 and survival in patients diagnosed with various cancer types. However, the lack of extensive studies addressing the correlation between TMBIM6 and gliomas necessitates a comprehensive investigation to explore its potential as a prognosis marker for glioma. This study investigates TMBIM6's prognostic value by using data from TCGA (The Cancer Genome Atlas), GEO (Gene Expression Omnibus), and CGGA (Chinese Glioma Genome Atlas) databases, along with histopathological analysis of tissue microarray slide. Survival analysis confirmed the prognostic significance of TMBIM6 in glioma, while co-expression analysis identified positively and negatively correlated genes with TMBIM6, and Enrichment analysis suggested TMBIM6's association with protein processing in the ER and NOD-like receptor signaling pathways. A strong correlation was observed between TMBIM6 expression and immune infiltration, especially with M2 macrophages. Additionally, hsa-miR-128-3p was identified as an upstream regulator of TMBIM6. These findings highlight TMBIM6's potential as a prognostic biomarker for glioma, offering new insights into its role in glioma progression.

CCDC92BTN2A1
Also flagged:posttraumatic stress disorderpost-traumatic stress disorderdepressioncalciumPTSDpsychological stress
Journal Article 2025-07-01 ✓ 3 Snippets Shen J, Valentim W, Friligkou E, Overstreet C, Choi KW, Koller D, O'Donnell CJ, Stein MB, Gelernter J, Posttraumatic Stress Disorder Working Group of the Psychiatric Genomics Consortium, Lv H, Sun L, Falcone GJ, Polimanti R, Pathak GA.
In-Text Gene Mentions

…(e.g., ATG7 ,CCDC92, CNNM2 ,…

…pleiotropic genes includedCCDC92, SIRPA and…

…the two methods:BTN2A1, BTN3A2 ,…

Show Full Abstract

Patients with post-traumatic stress disorder face increased cardiovascular risk. This study examines shared genetic regions between post-traumatic stress disorder and 246 cardiovascular conditions across electronic health records, 82 cardiac imaging, and health behaviors defined by Life's Essential 8. Post-traumatic stress disorder is genetically correlated with cardiovascular diagnoses in 33 regions, imaging traits in 4 regions, and health behaviors in 44 regions. Potentially shared causal variants between post-traumatic stress disorder and 17 cardiovascular conditions were observed in 11 regions. Subsequent observational analysis in AllofUS cohort showed post-traumatic stress disorder is associated with 13 diagnoses even after accounting for socioeconomic factors and depression. Genetically regulated proteome expression in brain and blood tissues identified 33 blood and 122 brain genes shared between the two conditions, revealing neuronal, immune, metabolic, and calcium-related mechanisms, with several genes as targets for existing drugs. These findings exhibit shared risk loci and genes are involved in tissue-specific mechanisms.

HFE
Also flagged:FPN1ironviral infectionsdegradationexporterE3 ubiquitin ligase
Journal Article 2025-07-01 ✓ 1 Snippet Tong L, Wang J, Ma Y, Wang C, Fu Y, Li Q, Gao C, Song H, Qin Y, Zhao C, Zhao W.
In-Text Gene Mentions

…US2 38 targetHFE, a protein that…

Show Full Abstract

Viruses rely on intracellular materials, including iron, to complete their life cycles and iron withholding may limit viral infections. However, the mechanisms through which viruses disrupt host iron homeostasis and the impact of intracellular iron on the host's antiviral defense aren't well studied. Here we show that viral infections facilitate the polyubiquitination and degradation of ferroportin (FPN1, the only cellular iron exporter) by upregulating the host E3 ubiquitin ligase DTX3L, leading to an elevation in cellular iron levels. Excessive ferrous iron suppresses type I IFN responses and autophagy by promoting TBK1 hydroxylation and STING carbonylation in macrophages. FPN1 deficiency suppresses host antiviral defense and facilitates viral replication in vitro and in vivo, while DTX3L deficiency has the opposite effect. These results reveal that viruses hijack host FPN1 to disrupt iron withholding and achieve immune escape, and suggest that iron homeostasis maintained by FPN1 is required for the optimal activation of TBK1- and STING-dependent antiviral responses.

HTT
Also flagged:neurofilamentorganizationHDautosomal dominant neurodegenerative disordercytosineadenine
Journal Article 2025-07-01 ✓ 3 Snippets Estevez-Fraga C, Sebenius I, Hansen JY, Hänisch B, Zeun P, Scahill RI, Gregory S, Johnson EB, Wild EJ, Byrne LM, Durr A, Landwehrmeyer B, Leavitt BR, Misic B, Valk SL, Rees G, Tabrizi SJ, McColgan P.
In-Text Gene Mentions

…exon of theHTTgene, encoding for…

…5-HT 6 , 5-HTT), dopamine (D 1…

…the serotoninergic transporter5-HTT(36.44%) followed by…

Show Full Abstract

Hyperconnectivity in functional brain networks occurs decades before disease onset in Huntington's disease. However, the biological mechanisms remain unknown. We investigate connectivity in Huntington's disease using Morphometric INverse Divergence (MIND) in three Huntington's disease cohorts (N = 512) spanning from two decades before the onset of symptoms through to functional decline. Here, we identify stage-specific profiles, with hyperconnectivity 22 years from predicted motor onset, progressing to hypoconnectivity through the late premanifest and manifest stages, showing that hypoconnectivity is correlated with neurofilament light concentrations. To understand the biological mechanisms, we investigate associations with cortical organization principles including disease epicentres and cell-autonomous systems, in particular neurotransmitter distribution. The contribution from disease epicentres is limited to late premanifest while cell-autonomous associations are demonstrated across the Huntington's disease lifespan. Specific relationships to cholinergic and serotoninergic systems localized to granular and infragranular cortical layers are identified, consistent with serotoninergic layer 5a neuronal vulnerability previously identified in post-mortem brains.

PTGIS
Also flagged:lipid15-hydroxyprostaglandin dehydrogenase15-lipoxygenasedifferentiationProtectin-D1dystrophies
Journal Article 2025-07-01 ✓ 2 Snippets Fabre P, Molina T, Larose J, Greffard K, Généreux-Gamache G, Deprez A, Mokhtari I, Pellerito O, Duchesne E, Dort J, Bilodeau JF, Dumont NA.
In-Text Gene Mentions

…prostaglandin-I2 synthase (Ptgis), and thromboxane-A…

…enzymes Tbxas1 ,Ptgis, and Ptges…

Show Full Abstract

The muscle stem cell niche is well-described as influencing myogenic cell fate decision; however, the intrinsic mechanisms driving muscle stem cell progression during myogenesis are not yet fully elucidated. Here, we demonstrate that bioactive lipid class switching, an auto-regulatory mechanism originally described during the inflammatory process, is conserved during myogenesis. During the transition from proliferation to differentiation, myogenic cells shift from pro-inflammatory to pro-resolution pathways, a process partially mediated by 15Δ-PGJ<sub>2</sub> that promotes the expression of the prostaglandin inactivation enzyme 15-hydroxyprostaglandin dehydrogenase. Using pharmacological inhibitors and knockout models of the pro-resolution enzyme 15-lipoxygenase, we show that blocking the bioactive lipid class switching impairs myoblast differentiation in vitro and muscle regeneration in vivo. Administration of the pro-resolving mediator Protectin-D1 restores myogenesis, enhances muscle regeneration post-injury and improves muscle phenotype in a dystrophic mouse model. Overall, these findings provide a better comprehension of the mechanisms regulating myogenic progression, which opens new therapeutic avenues for muscle regeneration and dystrophies.

SLC2A14
Also flagged:Multiple sclerosisMSneurodegenerative disorderpathogenesisexperimental autoimmune encephalitisphosphorylation
Journal Article 2025-07-01 ✓ 1 Snippet Patel R, King D, LaBarre B, Lokhande H, Caefer D, Varghese JF, Warner K, Bouffard MA, Saxena S, Zhirova A, Bakshi R, Chitnis T.
In-Text Gene Mentions

…SLC2A6 , andSLC2A14, key glycolytic…

Show Full Abstract

Multiple sclerosis (MS) involves dysregulation of innate immune cells including monocytes, especially in progressive MS. Fatty acid binding proteins (FABP) are essential for fatty acid transport and metabolism in multiple cell types. FABP7, a brain-FABP, maintains metabolic function in astrocytes and neural stem cells, but the effect of FABP7 on monocytes is unknown. Here we find elevated levels of FABP7 in the serum and cerebrospinal fluid of patients with secondary progressive MS. Elevated serum FABP7 levels positively correlate with higher disability scores, brain lesion volumes, and lower brain volumes. FABP7 levels are increased in astrocytes from MS postmortem brain lesion. Mechanistically, in vitro treatment of FABP7 induces CD16, CD80 and IL-1β expression in monocytes via increased glycolysis. FABP7-induced gene expression reflects enhanced inflammation, chemotaxis and glucose metabolism in monocytes. In conclusion, we find that FABP7 induces pro-inflammatory profiles in monocytes, correlates with disability and represents a potential biomarker and therapeutic target for progressive MS.

HTT
Also flagged:extracellularvesiclesExtracellular vesiclesmicrovesiclesapoptotic bodiespeptides
Journal Article 2025-07-01 ✓ 1 Snippet Wu CC, Tsantilas KA, Park J, Plubell D, Sanders JA, Naicker P, Govender I, Buthelezi S, Stoychev S, Jordaan J, Merrihew G, Huang E, Parker ED, Riffle M, Hoofnagle AN, Noble WS, Poston KL, Montine TJ, MacCoss MJ.
In-Text Gene Mentions

…by the geneHTT.…

Show Full Abstract

Extracellular vesicles (EVs) in plasma are composed of exosomes, microvesicles, and apoptotic bodies. We report a plasma EV enrichment strategy using magnetic beads called Mag-Net. Proteomic interrogation of this plasma EV fraction enables the detection of proteins that are beyond the dynamic range of liquid chromatography-mass spectrometry of unfractionated plasma. Mag-Net is robust, reproducible, inexpensive, and requires <100 μL plasma input. Coupled to data-independent mass spectrometry, we demonstrate the measurement of >37,000 peptides from >4,000 proteins. Using Mag-Net on a pilot cohort of patients with neurodegenerative disease and healthy controls, we find 204 proteins that differentiate (q-value < 0.05) patients with Alzheimer's disease dementia (ADD) from those without ADD. There are also 310 proteins that differ between individuals with Parkinson's disease and without. Using machine learning we distinguish between individuals with ADD and not ADD with an area under the receiver operating characteristic curve (AUROC) = 0.98 ± 0.06.

SLC2A14
Also flagged:tumorscircadian rhythmsBMAL1tumorcancerVon Hippel-Lindau
Journal Article 2025-07-01 ✓ 3 Snippets Mello RM, Gomez Ceballos D, Sandate CR, Wang S, Jouffe C, Agudelo D, Uhlenhaut NH, Thomä NH, Simon MC, Lamia KA.
In-Text Gene Mentions

…on BMAL1 (e.g.,SLC2A14) or on…

…decreased expression ofSLC2A14and ADM following…

…its effects onSLC2A14and less so…

Show Full Abstract

Circadian disruption enhances cancer risk, and many tumors exhibit disordered circadian gene expression. We show rhythmic gene expression is unexpectedly robust in clear cell renal cell carcinoma (ccRCC). The core circadian transcription factor BMAL1 is closely related to ARNT, and we show that BMAL1-HIF2α regulates a subset of HIF2α target genes in ccRCC cells. Depletion of BMAL1 selectively reduces HIF2α chromatin association and target gene expression and reduces ccRCC growth in culture and in xenografts. Analysis of pre-existing data reveals higher BMAL1 in patient-derived xenografts that are sensitive to growth suppression by a HIF2α antagonist (PT2399). BMAL1-HIF2α is more sensitive than ARNT-HIF2α is to suppression by PT2399, and the effectiveness of PT2399 for suppressing xenograft tumor growth in vivo depends on the time of day at which it is delivered. Together, these findings indicate that an alternate HIF2α heterodimer containing the circadian partner BMAL1 influences HIF2α activity, growth, and sensitivity to HIF2α antagonist drugs in ccRCC cells.

Also flagged:RBPMS2NLRP3caspase-1GSDMDpyroptosisGastric cancer
Journal Article 2025-07-01 No Snippets Zhang N, Yan L, Cao H, Zhang N, Zhang T, Guan S, Liu Q.
Show Full Abstract

Gastric cancer (GC) is one of the most common malignancies worldwide, and its development is closely associated with the abnormal expression of numerous genes. RNA - binding protein with multiple splicing 2 (RBPMS2), a member of the RNA - binding protein family, has recently been found to be abnormally activated in GC cells. Meanwhile, pyroptosis, a form of programmed cell death, is related to tumorigenesis, development, and immune responses.This study investigated the role of the RNA - binding protein RBPMS2 in GC. It revealed the high expression of RBPMS2 in GC cells and its association with poor prognosis. RBPMS2 promoted the proliferation, invasion, and migration of GC cells while inhibiting pyroptosis by suppressing the NLR family pyrin domain containing 3 (NLRP3)/caspase - 1/gasdermin (DGSDMD) signaling pathway. Knocking out RBPMS2 activated pyroptosis, leading to cell membrane damage and increased expression of pyroptosis - related proteins. The NLRP3 inhibitor MCC950 reversed these effects, confirming the involvement of this pathway. These findings suggest that RBPMS2 may be a potential therapeutic target for inducing pyroptosis in gastric cancer cells, providing novel insights into treatment strategies for gastric cancer.

PEBP1
Also flagged:Down syndromeAD-onset ADLOADautosomal dominant ADamyloid-β
Journal Article 2025-07-01 ✓ 1 Snippet Montoliu-Gaya L, Bian S, Dammer EB, Alcolea D, Sauer M, Martá-Ariza M, Ashton NJ, Belbin O, Fuchs J, Watson CM, Ping L, Duong DM, Nilsson J, Barroeta I, Lantero-Rodriguez J, Videla L, Benejam B, Roberts BR, Blennow K, Seyfried NT, Levey AI, Carmona-Iragui M, Gobom J, Lleó A, Wisniewski T, Zetterberg H, Fortea J, Johnson ECB.
In-Text Gene Mentions

…hanolamine-binding protein 1 (PEBP1), and glyceraldehyde-3-phosph…

Show Full Abstract

Almost all individuals with Down Syndrome (DS) develop Alzheimer's disease (AD) by mid to late life. However, the degree to which AD in DS shares pathological changes with sporadic late-onset AD (LOAD) and autosomal dominant AD (ADAD) beyond core AD biomarkers such as amyloid-β (Aβ) and tau is unknown. Here, we used proteomics of cerebrospinal fluid from individuals with DS (n = 229) in the Down Alzheimer Barcelona Neuroimaging Initiative (DABNI) cohort to assess the evolution of AD pathophysiology from asymptomatic to dementia stages and compared the proteomic biomarker changes in DS to those observed in LOAD and ADAD. Although many proteomic alterations were shared across DS, LOAD, and ADAD, DS demonstrated more severe changes in immune-related proteins, extracellular matrix pathways, and plasma proteins likely related to blood-brain barrier dysfunction compared to LOAD. These changes were present in young adults with DS prior to the onset of Aβ or tau pathology, suggesting they are associated with trisomy 21 and may serve as risk factors for DSAD. DSAD showed an earlier increase in markers of axonal and white matter pathology and earlier changes in markers potentially associated with cerebral amyloid angiopathy compared to ADAD. The unique features of DSAD may have important implications for treatment strategies in this population.

Also flagged:COMTbehavioral disordersANKK1SLC6A3DRD4TPH2
Journal Article 2025-07-01 No Snippets Marcos-Prieto P, Ordali E, Mariotti V, Palumbo S, Vellucci S, Ricciardi E, Boncinelli L, Pietrini P, Pellegrini S, Bilancini E.
Show Full Abstract

Genetic variants in dopaminergic and serotonergic pathways have been linked to individual differences in social behavior. In this study, we investigated the relationship between eight allelic variants within these pathways and both behavior and beliefs in 99 participants playing an online Public Goods Game (PGG) with and without punishment. Our results show that individuals with the 5-HTTLPR L/L genotype contributed less and had lower expectations of others' contributions in the absence of punishment; the 5-HTR1B-rs13212041 T/T genotype was associated with lower expectations of antisocial and spiteful punishment; the COMT-rs4680 A/A (Met/Met) genotype was linked to lower expectations of contributions in the presence of punishment. These findings suggest that specific alleles modulate both cooperative behavior and social expectations, suggesting a genetic contribution to individual variability in responses to social dilemmas.

Also flagged:hydroxyapatitecalciumcarbonatecationdegradationmineralization
Journal Article 2025-07-01 No Snippets Zhang C, Zhao G, Wang X, Li M, Li Z, E Y, Cao X, Chen M, Liu C.
Show Full Abstract

Imperfect hydroxyapatite (IHA) bioceramics, which contain defects such as calcium deficiency, carbonate substitution, and metal cation substitution, exhibit improved osteogenic properties. In this study, we used a two-step calcination-hydrothermal process to manufacture two types of golden pomfret bone-derived imperfect hydroxyapatite bioceramics (G-IHA): carbonated calcium-deficient hydroxyapatite (CD-IHA) and carbonated hydroxyapatite (C-IHA). Their composition, surface morphology, zeta potential, degradation capacity, mineralization and osteogenic properties were systematically investigated. The results revealed that G-IHA with a higher defect content, including A-type carbonate substitution and Ca vacancies, had negatively charged surface. As a result, G-IHA surfaces are more favourable to ion exchange and interaction with cations (e.g., Na<sup>+</sup>, Ca<sup>2+</sup>) in the microenvironment, which results in improved degradation and mineralization. Specifically, after 28 days of degradation, G-IHA showed significantly higher weight losses (CD-IHA and C-IHA were 17% and 13%, respectively) than commercial hydroxyapatite (CHA; 7%). In addition, G-IHA have a higher better bone-like apatite formation ability, and a higher degree of osteogenic differentiation than CHA. Notably, carbonated calcium-deficient imperfect hydroxyapatite (CD-IHA) exhibited the highest bioactivity and osteogenic capacity as evidenced by its increased alkaline phosphatase activity and improved bone matrix mineralization capacity. In conclusion, this study revealed that imperfect hydroxyapatite bioceramics derived from golden pomfret bone have the potential to enhance osteogenic properties and be employed in clinical settings as bone substitute materials.

OLFM4
Also flagged:PECAM-1type 2 diabetes mellitusPlatelet endothelial cell adhesion molecule-1transcription factorsCREB3GATAD1
Journal Article 2025-07-01 ✓ 1 Snippet Xu JJ, Cai HZ, Sun H, Chen X, Cai XM.
In-Text Gene Mentions

OLFM4, CEACAM6 (CEA adhesion…

Show Full Abstract

Vascular injury is a common complication of type 2 diabetes mellitus (T2DM). Platelet endothelial cell adhesion molecule-1 (PECAM-1) is a vascular regulator. This study is to explore the possible pathological mechanism of PECAM-1 in vascular injury in T2DM. Plasma PECAM-1 was detected using ELISA in plasma samples of T2DMs and normal subjects. NetworkAnalyst was used to analyze the PECAM-1 transcript genes. PECAM-1 transcriptional gene variation in T2DM was analyzed from GSE26168 data from the GEO database. STRING line network database was used to obtain the proteins related to PECAM-1, and the ClusterProfiler package in R language was applied to perform PPI, GO and KEGG enrichment analysis. PECAM-1targeted drugs prediction was performed by Drugbank. Compared with 66 healthy controls, the plasma PECAM-1 levels in 66 patients with T2DM were significantly decreased (p < 0.001). Moreover, multivariate regression analysis indicated that PECAM-1 was an independent risk factor for vascular injury in T2DM patients. GSE26168 data of T2DM blood mRNA showed that the levels of the PECAM-1 gene transcription factors CREB3, GATAD1 and TEAD3 were significantly reduced, while CUX1 and RELA were significantly increased in T2DM patients. Functional enrichment analysis of PPI, GO and KEGG suggested that PECAM-1 was involved in regulation of vascular stability, endothelial function, and angiogenesis. DrugBank search revealed that fostamatinib is a targeted drug closely matching the PECAM-1 molecule. In patients with T2DM, the decrease in PECAM-1 is an independent risk factor for vascular injury. Abnormalities in PECAM-1 transcriptional factors are likely associated with the reduction in plasma PECAM-1 levels, which may be involved in the mechanism of vascular injury in T2DM. Fostamatinib may be a candidate drug for vascular injury in T2DMs.

SERPINC1
Also flagged:extracellularvesiclesinnate immunitycoagulationlipidsepsis
Journal Article 2025-07-01 ✓ 3 Snippets Park C, Ryu T, Mohamed-Hinds R, Kim K, Kim JH, Zou L, Williams B, Na CH, Chao W.
In-Text Gene Mentions

…factor III/tissue factor,serpin C1C1/AT-III, serpin E1/PAI-1,…

…gulation factor/tissue factor,serpin C1C1/AT-III, CXCL4/PF4, IL1β,…

…the M7 module,Antithrombin-III(SerpinC1) and Complement…

Show Full Abstract

Plasma extracellular vesicles (EVs) are cell-derived lipid particles and reportedly play a role in sepsis pathogenesis. This study aimed to identify EV cargo proteins in septic patients and explore their association with key sepsis pathophysiology. Plasma EVs were subjected to Tandem Mass Tag (TMT)-based quantitative proteomic analysis. We identified 522 differentially expressed (DE) EV proteins in septic patients (n = 15) compared to the healthy controls (n = 10). The KEGG analysis of the DE proteins revealed multiple functional pathways linked to sepsis, e.g., complement/coagulation, platelet activation, phagosome, inflammation, and neutrophil extracellular trap formation. Weighted Gene Coexpression Network Analysis of 1,642 EV proteins identified nine unique protein modules, some of which were highly correlated with the sepsis diagnosis and diverse endotype markers including organ injury, inflammation, coagulopathy, and endothelial activation, and mortality. ROC analysis revealed a list of novel EV proteins that exhibited strong diagnostic performance. Cell type-specific enrichment analysis revealed the cellular origins of EVs, including immune and epithelial cells, neurons, and glial cells. Thus, the current study discovered complex proteomic signatures in plasma EVs that are closely associated with key pathophysiological responses in sepsis. These findings support the importance of EV cargo proteins in the patients' immune responses, coagulation, and endothelial activation and lay the foundation for future mechanistic study of plasma EVs and their clinical application as potential diagnostic and prognostic markers.

Also flagged:translation elongationprotein synthesiscancersynthesisHead and Neck Squamous Cell CarcinomaHNSCC
Journal Article 2025-07-01 No Snippets Gomes N, Frederick B, Tentler J, Su TT.
Show Full Abstract

Inhibitors of protein synthesis hold promise for cancer therapy because many cancer driver proteins are unstable and blocking synthesis leads to their depletion. We described previously SVC112, a small molecule inhibitor of translation elongation that inactivates Head and Neck Squamous Cell Carcinoma (HNSCC) stem cells in vitro and prevents the regrowth of HNSCC tumor xenografts in mice after radiation treatment. Here we report that SVC112 also shows activity on its own (without radiation) but with a 1600-fold range in growth inhibition among cancer cell lines of various origins. Our efforts to define molecular correlates of SVC112 sensitivity found that basal expression of apoptosis/survival factors correlates with SVC112-induced apoptosis in hematologic cancer cell lines, while phosphorylation of c-Myc correlates with sensitivity to SVC112 in colorectal cancer cell lines. Apoptosis induction by SVC112 predicts tumor growth control and survival benefit in mouse xenograft models. We suggest a paradigm wherein utility of translation inhibitors is defined by (1) inherent dependence of cancer cells on specific survival factors and (2) post-translational modifications that affect the stability of oncogenic driver proteins.

LRRC7
Also flagged:NCAPD2cancerhepatocellular carcinomaNon-SMC condensin I complex subunit D2condensin Ichromosome
Journal Article 2025-07-01 ✓ 1 Snippet Ma W, Tian Y, Shen W, Song Z, Yang B, Zhou D, Ye D.
In-Text Gene Mentions

Condensinas the multi-subunits…

Show Full Abstract

Present studies indicated that NCAPD2 (Non-SMC condensin I complex subunit D2) has emerged as an essential participant of condensin I involved in the mitotic chromosome assembly and dissociation. However, its comprehensive role in pan-cancer and its underlying mechanisms remain underexplored. This study systematically analyzed NCAPD2's prognostic significance, functional mechanisms, and immune infiltration correlations in pan-cancer, with a focus on hepatocellular carcinoma (HCC). Using databases such as TCGA, TIMER2.0, and HPA, we evaluated NCAPD2's association with oncogenesis, prognosis, methylation, and immune infiltration. Experimental techniques, including BrdU, Transwell, flow cytometry, RT-qPCR, western blotting, and immunofluorescence, were employed to investigate NCAPD2's functional role. Results revealed that NCAPD2 is aberrantly expressed in multiple cancers, with upregulation linked to poor prognosis. NCAPD2 mutations, methylation changes, and microsatellite instability were also observed in various cancers. In HCC, NCAPD2 expression correlated significantly with immune cell infiltration and immunotherapy response. Mechanistically, NCAPD2 knockdown suppressed HCC cell proliferation, induced G0/G1 phase arrest, and promoted apoptosis. Additionally, NCAPD2 facilitated liver cancer cell migration and regulated the cell cycle via the AKT/GSK-3β signaling axis. Silencing NCAPD2 inhibited AKT and GSK-3β phosphorylation while upregulating p21 expression. In conclusion, NCAPD2 is a potential diagnostic and prognostic marker in pan-cancer, particularly for HCC. It promotes tumor progression through the AKT/GSK-3β pathway and influences immune infiltration, offering insights for immunotherapy and precision medicine strategies in HCC.

Also flagged:ZinccytoplasmZn 2+ -transportingmitochondrialysosomesvesicles
Journal Article 2025-07-01 No Snippets Chistyakov DV, Belousov AS, Shevelyova MP, Iomdina EN, Baksheeva VE, Shebardina NG, Moysenovich AM, Bulgakov TK, Petrov SY, Shishkin ML, Tulush SS, Tiulina VV, Pogodina EI, Gancharova OS, Filippova OM, Baldin AV, Goriainov SV, Nikolskaya AI, Zalevsky AO, Deviatkin AA, Vologzhannikova AA, Gorokhovets NV, Litus EA, Komarov SV, Devred F, Sergeeva MG, Mishin AV, Bukhdruker SS, Wu L, Araujo EA, Zamyatnin AA, Senin II, Zinchenko DV, Tsvetkov PO, Borshchevskiy VI, Permyakov SE, Zernii EY.
Show Full Abstract

Glaucoma is a neurodegenerative condition involving optic nerve damage and retinal ganglion cells death. Animal studies suggested that the pathway linking these events can be mediated by mobile zinc secreted into the intraretinal space and exerting cytotoxic effects. Whether this mechanism is relevant for human glaucoma and what are the targets of extracellular zinc is unknown. We report that increased zinc content in the aqueous humor and retina is indeed a characteristic of glaucomatous neuropathy, and excess extracellular zinc may be recognized by the key retinal neurotrophic factor PEDF. Biophysical and X-ray crystallographic studies show that PEDF coordinates zinc ions in five types of intermolecular high-affinity sites, leading to a decrease in negative surface charge and reversible oligomerization of the protein, thereby masking the target recognition sites responsible for its neurotrophic and antiangiogenic activities and collagen binding. Notably, PEDF secretion is enhanced in both glaucoma and retinal cell models in response to zinc stress; however, zinc binding negatively affects axogenic, differentiative and prosurvival functions of PEDF by suppressing its ability to activate receptor PEDF-R/PNPLA2. We suggest that glaucomatous neurodegeneration is associated with direct inhibition of PEDF signaling by extracellular zinc, making their complex a promising target for neuroprotective therapy.

Also flagged:Depressionmental illnesspathogenesisTestosteronemajor depressive disorderbinding
Journal Article 2025-07-01 No Snippets Lu W, He X, Peng H, Lei P, Liu J, Ding Y, Yan B, Ma X, Yang J.
Show Full Abstract

<h4>Background</h4>The association between major depressive disorder (MDD) and testosterone levels is controversial, and whether they are genetically correlated remains unclear. The present study aimed to investigate the shared genetic architecture between MDD and three testosterone traits.<h4>Methods</h4>We acquired genetic datasets of MDD and testosterone traits from publicly available genome-wide association studies. The bivariate causal mixture modeling (MiXeR) method was applied to estimate the polygenic overlap between MDD and testosterone, and the conjunctional false discovery rate (conjFDR) tool was used to identify shared genomic loci.<h4>Results</h4>Analysis with MiXeR suggested total testosterone (TT) and sex hormone-binding globulin (SHBG) were negative correlated with MDD, while the correlation between bioavailable testosterone (BT) and MDD was negligible. At least 47% of testosterone-related variants were predicted to influence MDD. The conjFDR identified a range of 28 to 79 genomic loci that were jointly associated with testosterone traits and MDD. Among these loci, NT5C2 was simultaneously associated with SHBG, TT and MDD. Functional annotation revealed that the mapped genes were mainly enriched in immune-related pathways.<h4>Conclusions</h4>The present study reported extensive polygenic overlap between MDD and testosterone traits, identified multiple targets delivering shared biological mechanisms, and highlighted the role of the hypothalamic-pituitary-adrenal axis in the pathophysiological processes of MDD and testosterone regulation.

Also flagged:immunodeficiencycancermalnutritionmetabolic disorderschronic liver diseaselipid
Journal Article 2025-07-01 No Snippets de Leon CDA, Amantea SL, Pereira RA, Dantas EO, Loekmanwidjaja J, Costa-Carvalho BT, Mazzucchelli JTL, Aranda CS, González-Serrano ME, De La Cruz Córdoba EA, Bezrodnik L, Moreira I, Ferreira JFS, Dantas VM, Sales VSF, Navarrete CL, Vilela MMS, Motta IP, Franco JL, Arango JCO, Álvarez-Álvarez JA, Cardozo LRR, Orellana JC, Condino-Neto A, Kokron CM, Barros MT, Regairaz L, Cabanillas D, Suarez CLN, Rosario NA, Chong-Neto HJ, Takano OA, Nadaf MISV, Moraes LSL, Tavares FS, Rabelo F, Pino J, Calderon WC, Mendoza-Quispe D, Goudouris ES, Patiño V, Montenegro C, Souza MS, Castelo Branco ABXC, Forte WCN, Carvalho FAA, Segundo G, Cheik MFA, Roxo-Junior P, Peres M, Oliveira AM, Neto ACP, Ortega-López MC, Lozano A, Lozano NA, Nieto LH, Grumach AS, Costa DC, Antunes NMN, Nudelman V, Pereira CTM, Martinez MDM, Quiroz FJR, Cardona AA, Nuñez-Nuñez ME, Rodriguez JA, Cuellar CM, Vijoditz G, Bichuetti-Silva DC, Prando CCM.
Show Full Abstract

<h4>Background</h4>Ataxia-telangiectasia (A-T) is a DNA repair disorder characterized by progressive degeneration, immunodeficiency, cancer predisposition, malnutrition, metabolic disorders, and chronic liver disease. The study aims to describe the nutritional status and plasma levels of biomarkers of lipid status, metabolic profile, and liver function of patients with A-T.<h4>Results</h4>A total of 218 patients from 9 Latin American countries were included in the study. The distribution of patients according to nutritional status by age group revealed an over-time increase in the proportion of patients with severe thinness (p = 0.016). High glucose and triglyceride levels were observed in 9.5% and 23.6% of patients, respectively. Total cholesterol was high in 31.7, and 34.0% had abnormal LDL-c levels. In the analysis of paired samples, a progressive increase in aspartate aminotransferase was observed over time.<h4>Conclusions</h4>The present results are comparable to those of previous studies also showing changes in nutritional status and in lipid, metabolic, and liver profiles over time. These findings confirm a high rate of thinness in patients with A-T and progressive deterioration as the disease progresses, as well as changes in plasma levels of biomarkers of lipid status, metabolic profile, and liver function.

Also flagged:gene expressionBEND2PPP1R2MED14NFU1IDUA
Journal Article 2025-07-01 No Snippets Stark JC, Pipko N, Liang Y, Szuto A, Tsoi CT, Dickson MA, Yuki KE, Hou H, Scholten S, Pulsifer K, Acker M, Laver M, Murthy H, Moran OM, Bonnell E, Liang N, Sidhu J, Dupuis L, Seno MMG, Care4Rare Canada Consortium, Chard M, Jobling RK, Cameron J, Chami R, Inbar-Feigenberg M, Wilson MD, Chitayat DA, Boycott KM, Kyriakopoulou L, Mendoza-Londono R, Marshall CR, Dowling JJ, Costain G, Deshwar AR.
Show Full Abstract

<h4>Background</h4>RNA sequencing (RNA-seq) is emerging as a valuable tool for identifying disease-causing RNA transcript aberrations that cannot be identified by DNA-based testing alone. Previous studies demonstrated some success in utilizing RNA-seq as a first-line test for rare inborn genetic conditions. However, DNA-based testing (increasingly, whole genome sequencing) remains the standard initial testing approach in clinical practice. The indications for RNA-seq after a patient has undergone DNA-based sequencing remain poorly defined, which hinders broad implementation and funding/reimbursement.<h4>Methods</h4>In this study, we identified four specific and familiar clinical scenarios, and investigated in each the diagnostic utility of RNA-seq on clinically accessible tissues: (i) clarifying the impact of putative intronic or exonic splice variants (outside of the canonical splice sites), (ii) evaluating canonical splice site variants in patients with atypical phenotypes, (iii) defining the impact of an intragenic copy number variation on gene expression, and (iv) assessing variants within regulatory elements and genic untranslated regions.<h4>Results</h4>These hypothesis-driven RNA-seq analyses confirmed a molecular diagnosis and pathomechanism for 45% of participants with a candidate variant, provided supportive evidence for a DNA finding for another 21%, and allowed us to exclude a candidate DNA variant for an additional 24%. We generated evidence that supports two novel Mendelian gene-disease associations (caused by variants in PPP1R2 and MED14) and several new disease mechanisms, including the following: (1) a splice isoform switch due to a non-coding variant in NFU1, (2) complete allele skew from a transcriptional start site variant in IDUA, and (3) evidence of a germline gene fusion of MAMLD1-BEND2. In contrast, RNA-seq in individuals with suspected rare inborn genetic conditions and negative whole genome sequencing yielded only a single new potential diagnostic finding.<h4>Conclusions</h4>In summary, RNA-seq had high diagnostic utility as an ancillary test across specific real-world clinical scenarios. The findings also underscore the ability of RNA-seq to reveal novel disease mechanisms relevant to diagnostics and treatment.

Also flagged:CeramideCeramidesCell Biolsphingolipidsphingoid basefatty acid
Journal Article 2025-07-01 No Snippets Thakkar H, Vincent V, Chaurasia B.
Show Full Abstract

Ceramides are bioactive lipids that play a crucial role in cellular signaling and structural integrity (Nat Rev Mol Cell Biol 19:175-191, 2018). As members of the sphingolipid family, ceramides consist of a sphingoid base attached to a fatty acid (Annu Rev Biophys 47:633-654, 2018). Their unique structure confers both hydrophobic and amphipathic properties, enabling them to organize into membrane microdomains that influence cellular dynamics (Annu Rev Biophys 47:633-654, 2018). In recent years, ceramides have garnered attention for their role in modulating a range of cellular and organismal functions. Unlike other lipids that primarily serve structural roles, ceramides act as bioactive lipids in key signaling pathways, mediating stress responses such as inflammation, oxidative stress, growth inhibition, metabolism, autophagy, and apoptosis (J Lipid Res 60:913-918, 2019). Their regulatory effects are particularly important in immune cells, where ceramides can influence cell fate, modulate cellular metabolism, affect cytokine production, and dictate responses to external stimuli (Nature 510:58-67, 2014). Since ceramides maintain a dynamic equilibrium with other sphingolipids within a cell, understanding their role in immune cells in isolation provides only a partial perspective. Nevertheless, as a bioactive lipid and the central precursor of other sphingolipids, ceramides play a pivotal role in immune cells, deserving focused attention.

DCC
Also flagged:cancerpulmonary noduleslung cancernodulesmalignant tumorpulmonary
Journal Article 2025-07-01 ✓ 1 Snippet Zhou N, Li K, Xie L.
In-Text Gene Mentions

…their receptors (e.g.,DCC, Robos, Plexins, Ephs).…

Show Full Abstract

<h4>Background</h4>tRNA-derived small RNAs (tsRNAs) have garnered significant attention in the field of cancer research, however, exosomal tsRNAs remain relatively understudied as potential biomarkers in the pulmonary nodules. This study aims to identify exosomal tsRNAs that are differentially expressed between benign and malignant pulmonary nodules, integrate these findings with other clinical parameters, and develop a novel predictive model to estimate the likelihood of malignancy in pulmonary nodules.<h4>Methods</h4>Exosomes were extracted from plasma of patients with benign pulmonary nodules and malignant pulmonary nodules (early-stage lung cancer), then characterized using transmission electron microscopy (TEM), qNano, and western blot. Differentially expressed tsRNAs were identified through small RNA microarray screening and validated by Quantitative Real-Time PCR (qRT-PCR). Receiver operating characteristic (ROC) analysis evaluated their diagnostic efficiency, while logistic regression integrated blood and imaging data to build a predictive model. Diagnostic performance was further assessed using random forest and nomogram analyses.<h4>Results</h4>A total of 43 differentially expressed tsRNAs were identified through small RNA array analysis. Among these, the expression levels of 3'tiRNA-43-GlyGCC-4 and tRF3-17-GlyTCC were significantly higher in patients with benign pulmonary nodules compared to those with early-stage lung cancer. Conversely, the expression of 5'Leader-ValAAC-1-2 was significantly lower in benign cases than in early-stage lung cancer patients. Using logistic regression, a predictive model was constructed by combining these tsRNA biomarkers with blood-based and imaging parameters. The model demonstrated excellent performance in distinguishing early-stage lung cancer from benign pulmonary nodules, achieving an area under the curve (AUC) of 0.9559, with a sensitivity of 91.06% and a specificity of 91.53%.<h4>Conclusion</h4>Our model highlights its potential as a robust tool for predicting the malignancy probability of pulmonary nodules.

SOX6CA10
Also flagged:degradationT-cell receptorFYNFYB1nitrogenmetabolism
Journal Article 2025-07-01 ✓ 5 Snippets Cai B, Kang Y, Xiong L, Pei J, Ge Q, Wu X, Gan M, Guo X.
In-Text Gene Mentions

…development genes (SOX6), which may…

…( CA8 ,CA10) and adherens…

…carbonic anhydrase familyCA10, CA8 (zinc…

SOX6and CTNNA1 are…

…development genes (SOX6), potentially reflecting…

Show Full Abstract

<h4>Background</h4>The distinctive geography and climate of Gansu Province have given rise to three indigenous cattle breeds-Zaosheng, Anxi, and Yangba. Renowned for their superior meat quality and remarkable adaptability, these breeds are crucial for maintaining genetic diversity. However, they are under threat from intensive farming practices, environmental degradation, and genetic drift, which could lead to an irreversible loss of genetic resources. Thanks to natural and artificial selection, these breeds possess genetic markers that enhance their adaptation to extreme environments and improve key economic traits. By integrating comprehensive genome data from multiple breeds, this study aims to analyze population genetics, detect composite selection signals, and perform functional enrichment to uncover the mechanisms behind genetic differentiation and adaptive evolution. This research is pivotal for developing resilient breeds and ensuring sustainable resource management.<h4>Results</h4>The genetic background of local cattle breeds in Gansu shows a mix between indicine cattle (Bos indicus) and taurine cattle (Bos taurus), with geographical differentiation: Yangba cattle in the southeast mainly exhibit indicine ancestry (54.43%), while Anxi and Zaosheng cattle in the northwest show a predominance of taurine ancestry (86.51% and 74.81%, respectively). This divergence is closely related to historical ethnic migrations, geographic barriers, and gene flow along the Silk Road. Selection signal analysis has revealed specific adaptation mechanisms in different populations: Yangba cattle exhibit strong selection signals in the T-cell receptor pathway (FYN, FYB1) and skeletal development genes (SOX6), which may be related to their adaptation to hot and humid environments and mountainous terrain; Anxi cattle show adaptive evolution in nitrogen metabolism (CA8, CA10) and adherens junction pathways (CTNNA2), possibly reflecting the genetic basis for their adaptation to arid conditions; Zaosheng cattle display strong selection signals in muscle development (LARGE1, SGCZ) and immune regulation genes (SLAMF family), likely associated with enhanced meat production performance and increased pathogen resistance driven by artificial breeding.<h4>Conclusion</h4>This study explores the drivers of genetic diversity and adaptive evolution in Gansu's native cattle breeds, emphasizing the impact of geography and human activity on genetic divergence. It provides a theoretical basis for conserving breed resources, identifying functional genes, and developing breeding strategies.

Also flagged:ENPP5sepsiscell cyclePPARDZSCAN2ABI2
Journal Article 2025-07-01 No Snippets Gao J, Li Y, Huang J, Wei C, Chen J, Huang A, Liu N, Lu Y, Yang S.
Show Full Abstract

<h4>Background</h4>The rising mortality rates in sepsis highlight the current lack of reliable therapeutic biomarkers. This study aims to identify markers associated with biological functions to offer new strategies for sepsis diagnosis.<h4>Methods</h4>We conducted differential expression analysis to identify differentially expressed messenger RNAs (DEmRs), long non-coding RNA (DElncRs), and microRNAs (DEmiRs) in sepsis compared to healthy controls. Enrichment analysis was performed using DEmRs, and a lncRNA-miRNA-mRNA competing endogenous RNA network was constructed. Least absolute shrinkage and selection operator (LASSO) and random forest models were applied to identify diagnostic mRNAs. The optimal diagnostic model was determined through decision curve analysis, resulting in the identification of seven hub genes. The key gene, determined by its highest importance and the largest area under the receiver operating characteristics curve (AUC) value, was further validated. Additionally, we analyzed the correlation of the key gene with microenvironment cell infiltration and immune genes.<h4>Results</h4>A total of 4,450 intersected DEmRs (GSE66099, GSE13904, GSE154918, GSE8121) that were significantly involved in the cell cycle. We obtained 13 mRNAs, and further screened seven hub genes, including PPARD, ZSCAN2, ABI2, ENPP5, FMNL3, CD3E, and CAMK4. Subsequently, ENPP5 was as the key gene based on importance and AUC value. Moreover, Neutrophil cells and macrophages had a high abundance in sepsis patients. ENPP5 was positively associated with T cells but negatively associated with mast cells.<h4>Conclusion</h4>ENPP5, identified as a key gene, exhibits significant associations with immune cell infiltration and immune-related genes. This suggests its potential role as a biomarker for novel therapeutic strategies in sepsis.

PRDX6
Also flagged:tumorcancersdeathcancergene expressionmethylation
Journal Article 2025-07-01 ✓ 2 Snippets Xu S, Chen Z, Chen X, Chu H, Huang X, Chen C, Liu H, Qu Y, Lu Z.
In-Text Gene Mentions

…In diabetic neuropathy,PRDX6coordinates S-palmitoylation-d…

…For example,PRDX6-mediated palmitoylation in ne…

Show Full Abstract

The recent elucidation of disulfidptosis, a unique form of cell death, has opened new paths for the development of targeted cancer therapies. However, a thorough examination of disulfidptosis-related genes (DRGs) across various cancer types has been lacking. Our extensive analysis of DRGs through genomic, transcriptional, and immune profiling has yielded substantial insights. Utilizing The Cancer Genome Atlas (TCGA), we have identified key changes in gene expression, including alterations in copy number and DNA methylation, and evaluated their impact on cancer prognosis. We constructed a disulfidptosis-related signature (DFRS) using LASSO regression and multivariate Cox regression analysis, which demonstrated a strong prognostic connection across diverse cancer types. The DFRS score is linked with poorer clinical outcomes, reflects the immune characteristics of the tumor microenvironment (TME), and predicts responsiveness to immunotherapy and other treatments. Notably, the DFRS score interacts with critical oncogenic pathways, highlighting the potential benefits of targeting disulfidptosis in cancer treatment. Our findings underscore the critical influence of disulfidptosis on cancer prognosis and therapeutic response, offering meaningful clinical insights.

TNFSF4
Also flagged:Keloid disorderpathogenesiscollagenwound healingtype III collagentype I collagen
Journal Article 2025-07-01 ✓ 1 Snippet Zheng B, Qiao J, Yu X, Zhou H, Wang A, Zhang X.
In-Text Gene Mentions

…pathway (IL4R, CCL11,TNFSF4/OX40L), the Th1 pathway…

Show Full Abstract

<h4>Background</h4>Keloid disorder (KD) encompasses a spectrum of fibroproliferative dermal conditions, the pathogenesis remains complex and incompletely understood. This study sought to identify biomarkers and potential therapeutic targets for KD through an integrative bioinformatics approach and machine learning analysis of RNA sequencing data.<h4>Methods</h4>RNA sequencing was performed on skin tissue samples from 13 patients with KD and 14 healthy controls. Using weighted gene co-expression network analysis and differential expression analysis revealed differentially expressed key module genes, and the CytoHubba plugin identified candidate genes. Subsequently analyzed using least absolute shrinkage and selection operator (LASSO) and support vector machine recursive feature elimination (SVM-RFE) methods to pinpoint feature genes associated with KD. Following this, biomarkers were determined through expression level validation, enrichment analysis, and immune infiltration analysis.<h4>Results</h4>A total of 420 differentially expressed key module genes were identified, and the top 10 genes with DMNC values were selected as candidate genes. Five feature genes were selected through LASSO and SVM-RFE, with NID2, MFAP2, COL8A1, and P4HA3 showing significant expression differences between KD and control samples, along with consistent expression patterns across datasets, identified as potential biomarkers. These four biomarkers were proved to possess high diagnostic potential, and they were found to exhibit significant positive correlations with one another. Functional enrichment analysis indicated that the primary KEGG pathways associated with these biomarkers included "steroid hormone biosynthesis" and "cytokine-cytokine receptor interaction." Moreover, immune infiltration analysis revealed that the four biomarkers were negatively correlated with type 17 T helper cells and positively correlated with 15 immune cell types, including activated B cells and central memory CD4 T cells.<h4>Conclusion</h4>In conclusion, NID2, MFAP2, COL8A1, and P4HA3 were identified as key biomarkers for KD, offering new avenues for more targeted and effective diagnostic and therapeutic strategies for managing this condition.

CSE1L
Also flagged:gene expressionchromatinnucleotidesPOLR1BTADA2AURB1
Journal Article 2025-07-01 ✓ 2 Snippets Yin H, Yang L, Zhao Q, Yao W, Teng J, Gao Y, Xu Z, Lin Q, Diao S, Liu X, Zhao F, Zhou Z, Wang Q, Li J, Zhang Z, Zhou H, Groenen MAM, Madsen O, Bai L, Guan D, Fang L, Li K.
In-Text Gene Mentions

…SNP of theCSE1Lgene, was significantly…

…rs332843141 genotypes withCSE1Lgene expression in…

Show Full Abstract

<h4>Background</h4>Investigating the functional impact of genomic variants is essential to uncover the molecular mechanisms behind complex traits. This study compiled a comprehensive dataset of 1,817 whole-genome sequences from diverse pig breeds and populations, capturing the global pig genetic diversity.<h4>Results</h4>Our analyses first revealed 27,167 loss-of-function variants (LoFs), the majority of which also influenced gene expression and splicing, and enriched in genomic regions associated with complex traits in pigs. We further genome-wide annotated non-coding variants, and then focused on these resided in 5' untranslated region (5'UTR). Although they had lower deleterious impact on protein sequence compared to coding variants, they enriched in promoters and exhibited functional consequences on gene expression and splicing and finally complex traits. We employed the Basenji deep learning model and ATAC-seq to predict the impact of these SNPs on chromatin accessibility in 13 pig tissues. SNPs with higher predicted scores demonstrated stronger effects on gene expression/splicing and complex traits-particularly average backfat thickness-compared to variants with lower scores.<h4>Conclusions</h4>In summary, our study provides a comprehensive catalog of genomic variants in both protein-coding and non-coding regions, and elucidated their functional consequences on epigenome, transcriptome, and complex traits in pigs.

PEBP1
Also flagged:GlioblastomaGBMbrain tumourtumourcancerextracellular
Journal Article 2025-07-01 ✓ 1 Snippet Ji L, Xia D, Zhou Y, Hu Y, Yang Z, Yin Y, Wang J, Zhang B, Gong L, Li K, Zou J, Wang M.
In-Text Gene Mentions

…CST3, OLFM1, SNAP25,PEBP1, PTGDS and TUBB2B),…

Show Full Abstract

<h4>Background</h4>Chemoresistance and recurrence following treatment are the greatest impediments to the prognosis of glioblastoma (GBM). Increasing evidence indicates that cancer-associated fibroblasts (CAFs) play a significant role in the progression of glioblastoma. Nevertheless, the role and source of CAFs in recurrent and chemotherapy-resistant GBMs still remain ambiguous.<h4>Methods</h4>Spatial transcriptome (ST) sequencing was conducted on the tissue microarray encompassing primary and recurrent glioma samples in order to characterize the cellular composition. Subsequently, the infiltration of CAFs in our formerly established in vivo temozolomide (TMZ)-resistant model was inspected through immunohistochemical staining. Additionally, we carried out RNA-seq and label-free quantitation (LFQ) proteomics on HCMECs co-cultured with TMZ-sensitive (TMZ-S) or TMZ-resistant (TMZ-R) cells to explore the mechanism.<h4>Results</h4>This investigation revealed that CAFs and astrocytes are enriched in recurrent GBM, and this phenotype is associated with the expression of extracellular matrix (ECM) proteins associated with COL1A1 and FN1 deposition. Further investigations revealed that tenascin-C (TNC) and filamin C (FLNC), which potentially mediate endothelial-to-mesenchymal transition (EndMT), are the predominant factors that induce the deposition of ECM proteins in the resistance-promoting microenvironment. Additionally, the natural product punicalin (PNC) was found to downregulate EndMT-related proteins, multidrug resistance-associated membrane proteins, and collagen-related proteins by targeting TNC and FLNC, thereby increasing the susceptibility of temozolomide (TMZ)-resistant cells to chemotherapeutic agents both in vitro and in vivo.<h4>Conclusion</h4>These discoveries indicate that TNC and FLNC induced EndMT was a key resource of CAFs and targeting TNC and FLNC to inhibit EndMT and the collagen pathway is a promising tactic for reversing drug resistance in tumours. The development of combined chemotherapeutic strategies based on the features of tumour microenvironment endothelial cells and ECM deposition has high potential clinical value in increasing the efficacy of tumour treatment.

Also flagged:post-translational modificationsserineamino acidamino acidsnucleotidesynthesis
Journal Article 2025-07-01 No Snippets Shu M, Liu Y, Wang J.
Show Full Abstract

Serine is a non-essential amino acid, serving as a precursor for other amino acids, lipids, and nucleotide synthesis. Its supply is ensured by two main mechanisms: exogenous uptake and endogenous synthesis. The serine synthesis pathway (SSP) connects glycolysis with the one-carbon cycle and plays an important role in cellular homeostasis by regulating substance synthesis, redox homeostasis, and gene expression. The de novo SSP involves three successive enzymatic reactions catalyzed by phosphoglycerate dehydrogenase (PHGDH), phosphoserine aminotransferase 1 (PSAT1), and phosphoserine phosphatase (PSPH). Post-translational modifications (PTMs), as essential regulatory mechanisms of proteins, play pivotal roles in physiological and pathological processes. This review focuses on the regulatory mode of PTMs on PHGDH, PSAT1, and PSPH, including phosphorylation, ubiquitination, acetylation, methylation, S-palmitoylation, S-nitrosylation, deamidation, SUMOylation, and lactylation. We summarize how these PTMs participate in the metabolic reprogramming of SSP. It helps us better understand the molecular mechanisms and physiological significance of the PTM network in serine synthetic metabolism, providing guidance for subsequent research and development in the future.

TNFSF4
Also flagged:Lung cancermalignant tumor of the respiratorysmall cell lung cancerSCLCnon-small cell lung cancerNSCLC
Journal Article 2025-07-01 ✓ 2 Snippets Dong Y, Zhang Y, Liu H, Jiang X, Xie S, Wang P.
In-Text Gene Mentions

…ICAM1, TNFSF9, andTNFSF4were highly expressed…

TNFSF4is a costimulatory…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is one of the common malignant tumors worldwide, and the 5-year survival rate remains unsatisfactory. Reliable prognostic biomarkers are needed to provide references for personalized treatment of patients. Some studies have shown that disulfidptosis-related genes (DRGs) are closely associated with tumorigenesis and development. This study constructed a prognostic risk model to explore the prognostic value of DRGs in LUAD and provide a reference for formulating personalized treatment plans for LUAD patients.<h4>Methods</h4>RNA-seq data of LUAD tissues and adjacent or normal lung tissues were downloaded from TCGA database and GEO database. A risk scores model was constructed through univariate Cox analysis, Lasso analysis, and multivariate Cox analysis. ROC curves and nomogram models were drawn to evaluate the risk model. External validation was performed using LUAD data, data in the LUAD single-cell dataset, and other data in the GEO database. In addition, the immune microenvironment and drug sensitivity of the high-risk and low-risk groups were analyzed. The key gene PPP1R14B in the model was further experimentally verified by in vitro cell experiments.<h4>Results</h4>In this study, a risk model composed of four genes was constructed, and the overall survival (OS) of the low-risk group was higher than that of the high-risk group (P < 0.001). The area under the curve (AUC) of the ROC curves of the training set risk model at 1-, 3-, and 5-year were 0.767, 0.759, and 0.711, respectively. Drug sensitivity analysis showed that there was a statistical significance between the high-risk and low-risk groups of patients for drugs such as gefitinib, afatinib, lapatinib, and paclitaxel (P < 0.001). The results of in vitro cell experiments showed that the proliferation and migration of knockdown PPP1R14B LUAD cells were significantly inhibited, and the number of apoptosis of LUAD cells was significantly increased (P < 0.05).<h4>Conclusion</h4>The risk model constructed based on four DRGs can predict the prognosis of LUAD patients with relative accuracy. There are differences in the immune microenvironment between the high-risk and low-risk groups. Patients in the high-risk group are more sensitive to drugs such as gefitinib, afatinib, lapatinib, and paclitaxel, providing a reference for personalized treatment of LUAD patients. Knockdown PPP1R14B significantly inhibited the proliferation and migration of LUAD cells and promoted the apoptosis of LUAD cells.

Also flagged:fatty acidmetabolismmetabolic syndromeobesitycholesteryl esterslipid
Journal Article 2025-07-01 No Snippets Oskarsdottir H, Palsson A, Olafsdottir EB, Giedraitis V, Mohammad S, Risérus U, Schiöth HB, Skuladottir GV, Mwinyi J.
Show Full Abstract

<h4>Background</h4>Genetic risk variants for obesity and metabolic syndrome (MetS) have been identified, but their link to relevant metabolic health parameters warrants further attention. This study aimed to investigate the extent to which single-nucleotide polymorphisms (SNPs) associated with obesity are linked to changes in fatty acid (FA) profiles in serum cholesteryl esters, lipid metabolism, and MetS risk.<h4>Method</h4>Data from the Uppsala Longitudinal Study of Adult Men (ULSAM), conducted in men at age 50 (N = 1973) and age 70 (N = 982), were used to investigate SNPs associated with body mass index (BMI) in genome-wide association studies with metabolic parameters at age 50. The significant SNPs and associated lipid parameters were then used as predictors of MetS over a 20-year follow-up period, at age 70 in binary regression models.<h4>Results</h4>The two genes, the brain-derived neurotrophic factor gene (BDNF) (rs7103411) and the fat mass and obesity-associated gene (FTO) (rs1558902), together with delta-5-desaturase (D5D) activity, 20:5n-3 in serum cholesteryl esters (CE), fasting blood glucose, abdominal skinfold thickness, apolipoprotein-B, and high-density lipoprotein cholesterol (HDL-C) at age 50, significantly predicted the risk of MetS at age 70.<h4>Conclusion</h4>The findings suggest a considerable contribution of the SNPs BDNF rs7103411, FTO rs1558902, and ETV5 rs9816226, along with low D5D activities and serum levels of HDL-C in men at age 50, to the risk for MetS 20 years later.

Also flagged:glutaminemetabolismcancertumorsmTORC1cell proliferation
Journal Article 2025-07-01 No Snippets Zou W, Han Z, Wang Z, Liu Q.
Show Full Abstract

Metabolic reprogramming is a hallmark of cancer cells, and the advent of "glutamine addiction" in numerous tumors signifies a pivotal advancement for precision-targeted therapy. This review demonstrates that glutamine metabolism is a pivotal factor in the development of malignant phenotypes in tumors by modulating multifaceted regulatory networks (Hippo/YAP, mTORC1 signaling pathway, and non-coding RNAs). These networks play a crucial role in the reprogramming of glutamine metabolism, which in turn affects various hallmarks of cancer, including cancer cell proliferation, ROS-mediated inhibition of apoptosis, and EMT-associated invasive metastasis. With respect to targeted therapeutic strategies, the focus on key transporters and metabolizing enzymes (ASCT2/GLS1) provides a theoretical foundation for the development of multi-targeted combination therapeutic regimens based on the inhibition of glutamine metabolism. A body of research has demonstrated that the metabolic processes of glutamine regulate a variety of immune system functions, including T cell depletion/activation, the polarization of TAMs, and the function of NK cells. This regulatory relationship, termed the metabolic-immune axis, is a crucial factor in the development of immune escape mechanisms by tumors. The study further suggests that a combination of targeted intervention strategies, involving the modulation of glutamine metabolism, has the potential to reshape the immune microenvironment and enhance the efficacy of CAR-T cell therapy. It is important to note that glutamine metabolism also affects tumor stroma formation by remodeling cancer-associated fibroblasts (CAFs). In response to therapeutic resistance mechanisms, tumor cells form adaptive escapes through ASNS and GAD metabolic branch activation, glucose/lipid metabolic compensation, and ATF4 transcriptional stress networks. This review systematically integrates the critical role of glutamine metabolism in tumor development and therapeutic resistance, providing new perspectives and translational pathways for the development of precision therapeutic strategy selection based on metabolic plasticity modulation.

Also flagged:hypersensitivitysystemic capillary leak-like syndromeperitoneal effusionsinterstitial pulmonary edemahyponatremiahypoalbuminemia
Journal Article 2025-07-01 No Snippets Nguyen NX, Pham NT, Le HTT, Tran QV, Tran HNT, Do AT.
Show Full Abstract

<h4>Background</h4>Systemic capillary leak syndrome (SCLS) is a rare disorder characterized by increased vascular permeability leading to third-spacing of fluids and protein. Drug-induced hypersensitivity reactions can mimic SCLS clinically and radiologically.<h4>Case presentation</h4>A 42-year-old Vietnamese man developed abdominal distension, facial edema, and dyspnea after initiation of Helicobacter pylori eradication therapy. Imaging revealed pleural, pericardial, and peritoneal effusions, periportal edema, and interstitial pulmonary edema. Laboratory results showed hyponatremia, hypoalbuminemia, and mild anemia. Autoimmune screening revealed ANA positivity (1:80, speckled) and lupus anticoagulant, though extractable nuclear antigens were negative. The patient improved rapidly with corticosteroids and antihistamines.<h4>Conclusion</h4>This case suggests a probable drug-induced systemic hypersensitivity reaction mimicking capillary leak syndrome, occurring in a patient with latent immune dysregulation. Awareness of this presentation may facilitate early recognition and appropriate immunomodulatory treatment while avoiding unnecessary interventions.

Also flagged:mitochondriamitochondrialcancerneurodegenerative diseasesendocrine disordersskeletal system diseases
Journal Article 2025-07-01 No Snippets Gao C, Ding P, Zhang C, Gao J.
Show Full Abstract

As a physicochemical mechanism, phase separation is a spatial and temporal regulator of specific molecules within a cell, and it provides a new perspective for understanding cellular pathophysiology. Phase separation is closely associated with multiple metabolic processes in the body, including the regulation of key metabolic enzymes and the physiology of mitochondria. Mitochondria also regulate multiple physiological functions through phase separation, including protecting healthy mitochondria and mRNAs in oocytes and regulating crosstalk between nuclear and mitochondrial. Importantly, abnormal phase separation in vivo is associated with the development of diseases, including cancer, neurodegenerative diseases, endocrine disorders, skeletal system diseases, and infectious diseases. This review summarizes the relationship between phase separation and metabolism under both physiological and pathological conditions, as well as the therapeutic potential of phase separation in the treatment of relevant diseases, aiming to explore the possibility of treating diseases by regulating phase separation.

NEGR1
Also flagged:ChondromatosisSynovial chondromatosisSCjoint disorderextracellularsynthesis
Journal Article 2025-07-01 ✓ 1 Snippet Zhao H, Jiang F, Zhang P, Bi Y, Shen Y, Ma J, Gong J, Han K, Zhang L, Yu T, Xiao X.
In-Text Gene Mentions

…IFI6 (module 1),NEGR1(module 2), and…

Show Full Abstract

Synovial chondromatosis (SC) is a rare joint disorder characterized by cartilaginous loose bodies, yet its cellular underpinnings remain incompletely understood. To define the cellular landscape in SC, single-cell RNA sequencing was performed on synovial tissue obtained from both healthy individuals and SC patients. Analysis of this comprehensive dataset revealed significant alterations in the cellular composition and unique transcriptional profiles of key synovial cell populations within SC synovium. Specifically, a marked increase in the proportion of distinct fibroblast subpopulations (F3 and F4) engaged in extracellular matrix (ECM) synthesis and degradation was observed. Concurrently, the macrophage compartment exhibited a notable shift towards M2-like and M4-like phenotypes. Furthermore, an expanded and dynamically transitioning proliferative immune cell (ProIC) population was identified, with distinct C0 and C1 subpopulations showing unique functional characteristics and a differentiation trajectory from C0 to C1. Beyond individual cellular characteristics, interrogation of intercellular communication networks revealed potentially enhanced signaling, particularly between fibroblasts and macrophages mediated by FTL-SCARA5 interactions, and between macrophages and ProICs via CD74-MIF/other CD74 ligand interactions. These findings offer a comprehensive and detailed characterization of the cellular heterogeneity and altered cellular states associated with SC. This detailed cellular atlas provides a crucial foundation for future functional studies aimed at dissecting the precise roles of these observed cellular alterations in SC pathogenesis and exploring potential therapeutic targets.

Also flagged:peripheral neuropathydiabetic peripheral neuropathyType -2 Diabetes MellitusglucoseInsulin ResistanceIR
Journal Article 2025-07-01 No Snippets Somisetty KG, Shetty GB, Sujatha KJ, Shetty P.
Show Full Abstract

<h4>Background</h4>With the high prevalence of diabetic peripheral neuropathy among Type -2 Diabetes Mellitus (T2DM) patients, diagnosis and management of subclinical peripheral neuropathy are gaining concern to prevent its complications. A wide variety of alternative lifestyle interventions emphasizing improving glycemic control, promoting weight loss, and a prudent diet were found to be effective in improving nerve conduction abnormalities individually.<h4>Objective</h4>To study the impact of naturopathy and yoga intervention in the prevention and management of nerve damage among T2DM-associated neuropathic signs.<h4>Methods</h4>In this matched control trial (gender and age-matched), 76 patients with subclinical diabetic peripheral neuropathy were recruited to (i) Intervention Group (IG), n=38 who received naturopathy and yoga-based interventions for 9 days, (ii) Control Group (CG), n=38 continued regular oral hypoglycemic medications. Neuroelectrophysiological parameters like amplitude and velocity of bilateral median motor and sensory and deep peroneal nerve, fasting blood glucose, postprandial blood glucose Homeostatic Model for Insulin Resistance (HOMA-IR), steady state beta cell function (%B), and insulin sensitivity (%S) were assessed at baseline and after 9 days.<h4>Results</h4>Weight, BMI, FBG, HOMA-IR, and %S significantly (p<0.05) improved among IG. In comparison, FBG, PPBG, %S, right median sensory amplitude, and left median sensory nerve conduction velocity had shown a significant difference between the groups.<h4>Conclusion</h4>A significant reduction in modifiable risk factors of neuropathy like insulin resistance and weight after the intervention shows the effectiveness of lifestyle-based naturopathy and yoga intervention in preventing peripheral neuropathy among diabetics.

HFE
Also flagged:IronColorectal Cancercancertumorsdeferoxaminecolon cancer
Journal Article 2025-07-01 ✓ 1 Snippet Vidanapathirana G, Islam MS, Gamage S, Lam AK, Gopalan V.
In-Text Gene Mentions

…a, transfusion‐induced anemia,hemochromatosis, and hematological malignanci…

Show Full Abstract

<h4>Background</h4>Despite significant therapeutic advancements in recent decades, colorectal cancer (CRC) continues to exhibit high rates of mortality and morbidity. Chemoresistance and cancer recurrence remain substantial challenges, underscoring the need for novel treatment approaches. Iron chelation therapy has gained profound interest over the years as a potential cancer treatment, leveraging the increased iron demand by tumors. This review evaluates the effects of iron chelation therapy on CRC progression and the underlying mechanisms.<h4>Method</h4>A comprehensive review of in vivo and in vitro studies was conducted to assess the effectiveness of iron chelation therapy in CRC. The literature search covered PubMed, Scopus, Medline (via Web of Science), and EMBASE between January 1995 and March 2024.<h4>Results</h4>Several in vitro and in vivo studies have investigated the impact of iron chelators, such as deferoxamine, deferasirox, thiosemicarbazone-based chelators, quilamine-based chelators, and other novel compounds on CRC. Natural plant extracts with iron-chelating properties have also been explored as potential treatments. Most studies indicate that iron chelation can inhibit the proliferation of colon cancer cells, though some studies suggest cancer-promoting effects. Mechanistically, iron chelation affects several hallmarks of CRC by modulating histone methylation, upregulating NDRG1, and influencing the Wnt/β-catenin and p53 signaling pathways. However, certain iron chelators may inhibit TRAIL-mediated apoptosis and activate the hypoxia-inducible factor (HIF), potentially accelerating CRC progression.<h4>Conclusion</h4>Future exploration of iron chelation therapy in CRC should focus on extensive in vitro, in vivo, and clinical studies to elucidate the precise mechanisms involved. A deeper understanding of the genetic and cellular alterations induced by iron chelation will enhance the development of effective therapeutic strategies for CRC.

SOX6
Also flagged:CSF1tissue homeostasisIL-34CSF1Rbacterial infectionCD81
Journal Article 2025-07-01 ✓ 2 Snippets Nonaka D, Yoshida S, Nakano K, Li X, Okamura T, Umemoto E, Yamada T, Watanabe M, Jinno S, Ito M, Tsuda M, Noguchi N, Jiang JX, Sumiya E, Sawa S.
In-Text Gene Mentions

…high expression ofSox6, Bmp5 ,…

…These cells were characterized byhigh expression of Sox6 , Bmp5 , and Pdgfra.…

Show Full Abstract

Macrophages play essential roles in immune defense and tissue homeostasis, but the mechanisms underlying their colonization in the gut mucosa remain incompletely understood. Here, we identify CSF1, primarily derived from fibroblasts, as the dominant factor maintaining mucosal macrophage colonization, whereas IL-34 deficiency alone has a minimal impact. We reveal that CSF1R ligands originate from distinct cellular sources: macrophages at the upper villus region depend on fibroblast-derived CSF1 and IL-34, while macrophages in the lower villus and the submucosal (lower villus + SM) region are regulated by CSF1 from both fibroblasts and endothelial cells. Additionally, within the lower villus + SM region, CSF1-producing CD81<sup>+</sup> LepR<sup>+</sup> fibroblasts directly interact with CD163<sup>+</sup> macrophages, forming a localized niche. The loss of CSF1 in fibroblasts results in accelerated systemic dissemination of Salmonella Typhimurium, highlighting fibroblast-derived CSF1 as a key regulator of gut macrophage function in host defense. Collectively, our findings uncover a previously unrecognized fibroblast-macrophage crosstalk that governs gut macrophage homeostasis and immunity.

HFE
Also flagged:TTNhypercholesterolemiafamilial hypercholesterolemiaBRCA1BRCA2DSG2
Journal Article 2025-07-01 ✓ 2 Snippets Johnston JJ, Sapp JC, Yoo S, Wermers Z, Hernandez S, Motsinger-Reif A, Burkholder A, Fargo D, Emerson JL, Hall JE, Biesecker LG.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

<h4>Purpose</h4>Optimizing return of secondary findings (SFs) in research settings requires an understanding of the complexities and challenges.<h4>Methods</h4>Genome sequence was generated for 4737 participants in a genetic and environmental health study, and 4630 of them consented to SF return. Variants in the American College of Medical Genetics and Genomics v3.0 genes were classified using the American College of Medical Genetics and Genomics/Association for Molecular Pathology criteria with ClinGen-approved modifications.<h4>Results</h4>Eighty-six variants were eligible for return to 102 participants. Average time to initial recontact attempt was 5.8 years. Recontact attempts reached 95 of 102 individuals. Results were returned to 57 participants. The remainder passively declined (25), actively declined (11), were lost to follow-up (5), were deceased (3), or had prior knowledge of the result (1). Return of results was positively associated with education status (2 × 3 C<sup>2</sup>, P = .0035).<h4>Conclusion</h4>The interest in receiving SFs was high at the time of consenting, but a clinically validated result was returned to just over half of the individuals with an SF. Approximately 1 in 3 participants with an SF who had consented to receive them subsequently actively or passively declined receipt of the result. Given the health importance of return of SF, minimizing the time from consent to results return and tailoring outreach to education level may optimize uptake of SF return.

HTT
Also flagged:Alzheimer's diseaseADneurodegenerative dementiadementiaagingdementias
Journal Article 2025-07-01 ✓ 1 Snippet Gezegen H, Alaylıoğlu M, Şahin E, Swann O, Veleva E, Güven G, Yaman U, Salih DA, Bilgiç B, Hanağası H, Gürvit H, Emre M, Gezen-Ak D, Dursun E, Zetterberg H, Hardy J, Heslegrave A, Shoai M, Samanci B.
In-Text Gene Mentions

…high correlations forHTT, SNCA, SOD1, TARDBP…

Show Full Abstract

<h4>Introduction</h4>Diagnosing Alzheimer's disease (AD) is challenging due to overlapping symptoms with other dementias and the invasiveness of current biomarkers. This study introduces the NULISA platform, a novel proteomics technology, to evaluate diagnostic accuracy of known biomarkers and uncover novel biomarkers underlying different dementias.<h4>Methods</h4>We analyzed plasma and cerebrospinal fluid (CSF) samples from 248 participants diagnosed with Alzheimer's disease (AD), dementia with Lewy bodies (DLB), frontotemporal dementia (FTD), and mild cognitive impairment (MCI). Plasma biomarkers were evaluated using regression models, receiver operating characteristics curve (ROC) analysis, and pathway enrichment.<h4>Results</h4>Plasma phosphorylated Tau217 (pTau217) demonstrated the highest diagnostic accuracy for AD, DLB, and FTD (area under the curve [AUCs]: 0.9, 0.84, and 0.79, respectively). CXCL1 (fractalkine), synaptosomal-associated protein 25 (SNAP25), triggering receptor expressed on myeloid cells 1 (TREM1), β-synuclein, and tyrosine kinase (TEK) are expressed differently in DLB and FTD than AD. Ingenuity pathway analyses revealed astrocytic, synaptic, and inflammatory pathways as shared and distinct mechanisms across these dementia types.<h4>Conclusion</h4>Our findings establish plasma pTau217 as a robust diagnostic marker. This study provides new plasma biomarkers for differential diagnosis of dementias with a noninvasive method.<h4>Highlights</h4>Plasma pTau217 showed high diagnostic accuracy for AD, DLB, and FTD. CXCL1, SNAP25, TREM1, β-synuclein, and TEK are novel markers distinguishing other dementias from AD. Noninvasive plasma biomarkers enable diagnosis and differentiation of dementias.

HTT
Also flagged:gene expressionsex determinationchromosomePregnancysexual reproductionsex chromosomes
Journal Article 2025-07-01 ✓ 1 Snippet Dubin A, Parker J, Böhne A, Roth O.
In-Text Gene Mentions

…included huntingtin (htt, species-sex: NO-F),…

Show Full Abstract

The allocation of energy toward gamete production, parental care, mate choice, and secondary sexual signals fosters divergence in selection between the sexes, giving rise to opposing fitness strategies and sexual antagonism. The shared genetic makeup results in single genomic loci that harbor a gene or variant with varying fitness impacts on each sex. The resolution of this intralocus sexual conflict relies on intersex bias in gene expression and/or the formation of sex-linked genomic regions, which may also play a role in regulating sex determination. Shifts in the sex determination locus may happen. While the precise mechanisms driving these shifts are unknown, sexual antagonism was long believed to be a major contributor. To investigate the link between sexual antagonism and sex determination, we selected three syngnathid species along the gradient of their unique male pregnancy that evolved with different intensities of precopulatory sexual selection, i.e. sex-specific roles in mate choice. Examining intersex genetic divergence (Fst) and patterns of sex-biased expression, we revealed that precopulatory sexual selection and male pregnancy, rather than male pregnancy alone, are the primary drivers of sexual antagonism. In addition, we identified processes involving noncoding RNAs and biased variant expression as mediators of sexual antagonism. Notably, we discovered an intraspecies sex chromosome polymorphism in the seahorse Hippocampus erectus. The polymorphism may have resulted from generations of captive breeding or represents a natural polymorphism in wild populations. Our findings suggest that sexual antagonism resolution mechanisms can directly shape sex determination evolution across species, providing key insights into the molecular pathways underlying reproductive adaptation and diversification.

HFE
Also flagged:CNTNAP1LaryngealParalysisPolyneuropathyLeonberger polyneuropathy type 2Laryngeal paralysis polyneuropathy type 3
Journal Article 2025-07-01 ✓ 2 Snippets Shelton GD, Carpentier MC, Kimura YM, Guo LT, Minor KM.
In-Text Gene Mentions

…classified as LPN1 (Leonberger polyneuropathy type 1polyneuropathy type 1),…

leonberger polyneuropathy type 1polyneuropathy type 1…

Show Full Abstract

<h4>Background</h4>Major genetic risk loci and causative mutations classified as LPN1 (Leonberger polyneuropathy type 1), LPN2 (Leonberger polyneuropathy type 2), and LPPN3 (Laryngeal paralysis polyneuropathy type 3) have been identified in Leonberger and Saint Bernard dogs with laryngeal paralysis and polyneuropathy (LPPN). Other large breed dogs, including the Great Dane, can present clinically with LPPN, and this breed previously was identified as a carrier of the LPPN3 variant. To date, homozygosity for this variant has not been identified in Great Dane dogs.<h4>Interventions</h4>Results of neurological examination, electrodiagnostic testing, and muscle and nerve biopsy samples were consistent with lower motor neuron disease associated with axonal degeneration and large nerve fiber loss in two young Great Dane dogs with gait abnormalities and respiratory difficulty. TaqMan genotyping for the three known LPPN variants confirmed a homozygous missense variant in CNTNAP1, the variant associated with LPPN3.<h4>Conclusion and clinical relevance</h4>A homozygous missense CNTNAP1 variant (p.G937E, XP_548083.3) has been confirmed in young Great Dane dogs that should expand the genetic testing available for LPPN in this breed and aid in the direction of breeding programs. Both dogs were euthanized because of progression of clinical signs approximately 6 months after the original diagnosis.

Also flagged:Pancreatic ductal adenocarcinomaPDACKRAStumorSHP2SOS1
Journal Article 2025-07-01 No Snippets Khan N, Raza U, Ali Zaidi SA, Nuer M, Abudurousuli K, Paerhati Y, Aikebaier A, Zhou W.
Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy with a poor prognosis that is driven primarily by oncogenic KRAS mutations present in > 90% of cases. KRAS mutations, particularly the G12D mutation which dominates in PDAC, fuel tumor initiation, progression, and immune evasion, thereby contributing to therapy resistance. Nevertheless, KRAS has long been considered "undruggable" due to its structure. Recent advances have spurred transformative progress in direct KRAS inhibition. While FDA-approved mutation-specific and pan-KRAS inhibitors show limited efficacy in PDAC, emerging agents (MRTX1133 and RMC-9805) have demonstrated preclinical promise. However, resistance remains a critical hurdle and is driven by pathway reactivation, secondary mutations, and metabolic adaptations. Alternative strategies targeting upstream regulators (SHP2 and SOS1) aim to block KRAS activation and associated resistance mechanisms. Preclinical studies have also highlighted synergistic benefits of combining KRAS inhibitors with MEK, PI3K, or CDK4/6 inhibitors, which are now undergoing clinical evaluation. Immunotherapies, including KRAS-targeted vaccines and adoptive T-cell therapies, have further expanded the therapeutic landscape of enhancing KRAS-targeted therapies in PDAC. The molecular basis of KRAS-driven PDAC, current inhibitors, resistance mechanisms, and innovative strategies are discussed herein to address treatment barriers. Opportunities to improve clinical outcomes are underscored in this challenging malignancy by integrating insights from preclinical and clinical research.

Also flagged:nucleotidesgene expressionchromatincancercardiovascular diseasesexonuclease
Journal Article 2025-07-01 No Snippets Li J, Zou Q, Zhan C.
Show Full Abstract

Accurate identification of diverse RNA types, including messenger RNAs (mRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs), is essential for understanding their roles in gene regulation, disease progression, and epigenetic modification. Existing studies have primarily focused on binary classification tasks, such as distinguishing lncRNAs from mRNAs or identifying specific circRNAs, often overlooking the complex sequence patterns shared across multiple RNA types. To address this limitation, we developed AttenRNA, a multi-class classification model that integrates multi-scale k-mer embeddings and attention mechanisms to simultaneously differentiate between various RNA classes. AttenRNA achieved high weighted F1 scores of 89.8% and 89.6% on the validation and test sets, respectively, demonstrating strong classification performance and robustness. Dimensionality reduction using Uniform Manifold Approximation and Projection further confirmed the model's ability to learn discriminative features among RNA types. Additionally, AttenRNA exhibited strong generalization ability on cross-species data, achieving weighted F1 scores of 83.89% and 83.38% on the mouse RNA validation and test sets, respectively. These results suggest that AttenRNA offers a reliable and scalable solution for systematic RNA function analysis.

HFE
Also flagged:visceral leishmaniasisVLinfectious diseaseanaemiainfectionhypersplenism
Journal Article 2025-07-01 ✓ 2 Snippets Freitas AFA, Neto ASL, de Moura CMC, Silva GD, Silva MSABE, Vilges KMA, Ferreira FMAM, Costa DL, Costa CHN.
In-Text Gene Mentions

…TfR2) and thehemochromatosisprotein HFE.…

…the hemochromatosis proteinHFE.…

Show Full Abstract

Kala-azar, or visceral leishmaniasis (VL), is a parasitic disease caused by Leishmania spp., characterised by fever, weight loss, splenomegaly, hepatomegaly, and anaemia. This study evaluated the relationship between hepcidin, inflammation, iron metabolism, and hypersplenism in VL-associated anaemia. In this cross-sectional study, confirmed VL patients without recent transfusions were assessed. Haematological and inflammatory parameters were analysed using correlation and multivariate regression tests. Anaemia was present in 95.2% of the sample, predominantly normocytic (59.5%) and normochromic (76.2%), or microcytic (40.5%) and hypochromic (23.8%). Inflammatory markers were markedly elevated in most patients, particularly hepcidin, which was increased in 97.6% of cases (median: 351.46 ng/mL), suggesting persistent inflammation and impaired iron bioavailability. However, IL-6, CRP, and ferritin showed weak to moderate negative correlations with hepcidin (ρ = -0.33, ρ = -0.66, and ρ = -0.30, respectively). These findings highlight the complex interplay between anaemia and inflammation in kala-azar, with elevated hepcidin levels and paradoxical correlations with inflammatory markers. They underscore the central role of splenomegaly in VL-related anaemia and suggest potential contributions from other factors affecting iron metabolism, such as erythropoietin and erythroferrone. Understanding the dynamics of these markers throughout disease progression and treatment may further elucidate the pathophysiology of VL and support the development of targeted therapies.

FBXL4
Also flagged:amnesiaion channelstranslationalsleepbehavioralmembranes
Journal Article 2025-07-01 ✓ 1 Snippet Gao JY, Luo T, Liu C.
In-Text Gene Mentions

…al., 2016 CLOCK-dependentFbxl4expression rhythmically down-r…

Show Full Abstract

General anesthesia (GA) is a pharmacologically induced, reversible state characterized by unconsciousness, amnesia, analgesia, and immobility in response to noxious stimuli. Accumulating evidence from animal models has elucidated diverse mechanisms of the action underlying GA, including disruption of large-scale brain network connectivity, regulation of multiple neural pathways, and modulation of specific receptors and ion channels. Despite advances in dissecting the neurobiological basis of anesthetic action, the precise cellular and circuit-level processes remain incompletely understood, limiting the development of safer and more effective strategies. Recent studies in <i>Drosophila melanogaster</i>, a genetically tractable model organism offering robust genetic analysis, advanced imaging capabilities, and compact neural architecture, have yielded critical insights into the conserved neurobiological mechanisms of GA, offering translational value for mammalian systems. This review outlines: 1) experimental paradigms used to evaluate anesthetic sensitivity and behavioral responses in <i>Drosophila</i>; 2) molecular targets and their mechanistic roles in mediating GA; and 3) neural circuit architectures and activity patterns shared by GA and sleep. Cross-species comparisons are integrated to highlight conserved mechanisms that may guide the development of more refined anesthetic strategies.

HFE
Also flagged:Ironsecondary transporterstransmembranemembranesferroportin 1exporter
Journal Article 2025-07-01 ✓ 3 Snippets Le Tertre M, Elbahnsi A, Ged C, Uguen K, Gourlaouen I, Férec C, Ka C, Le Gac G, Callebaut I.
In-Text Gene Mentions

…those of theHFE, HFE2 ,…

…rare forms ofhemochromatosis; details available on…

…causal mutation inHFE.…

Show Full Abstract

The Major Facilitator Superfamily (MFS) is the largest known family of secondary transporters. These proteins share a common architecture comprising two lobes, each including 6 transmembrane (TM) helices, related by twofold pseudosymmetry. They transport a wide range of substrates through large conformational changes relying on the opening and closing of gates located on either side of biological membranes. Human ferroportin 1 (HsFPN1), the sole characterized mammalian iron exporter, follows this pattern. It is, however, characterized by an unusual intracellular gate, formed by two asymmetric networks of non-covalent bonds linking the two lobes. We studied the behavior of these networks in all-atom molecular dynamics simulations and functionally assessed the effect of alanine substitutions on HsFPN1 plasma membrane expression and iron export activity. We identified two new critical residues, Arg156 and Tyr318, connecting the networks to each other and to one of two metal-coordinating sites, located in an unwound region of TM7. We extended the analysis to a previously unreported missense variation, p.Gln478Arg, which was found to have a very strong impact on one of the two inter-lobe connection networks, and to result in a significant HsFPN1 loss-of-function. This led us to present the p.Gln478Arg substitution as a new pathogenic variation causing ferroportin disease. Together, our results provide new insights into the structure and dynamics of the human FPN1 inner gate and its asymmetry, shedding light on its potential role in the mechanism of iron export while offering a framework to better understand previously unexplained clinical observations.

Also flagged:esophageal squamous cell carcinomaEsophageal cancerpathogenesisESCCnucleotidesgene expression
Journal Article 2025-07-01 No Snippets Lin Y, Lv Z, Xie H, Zhao W, Pu R, Zhang Z, Jin H.
Show Full Abstract

Esophageal cancer (EC) is a highly prevalent and lethal malignancy of the digestive system, characterized by a complex pathogenesis involving multigene abnormalities and epigenetic regulation. Long non-coding RNAs (lncRNAs) are key regulatory elements in esophageal squamous cell carcinoma (ESCC). lncRNAs, defined as ncRNA molecules >200 nucleotides in length, modulate gene expression through diverse mechanisms, including epigenetic modification, competing endogenous RNA networks and RNA-protein interactions. lncRNAs participate in regulating key biological processes in ESCC, such as tumor cell proliferation, invasion, metastasis, apoptosis, drug resistance, radioresistance, stem cell properties and epithelial-mesenchymal transition. The present review summarizes the regulatory roles of lncRNAs in ESCC pathophysiology and their potential clinical application, emphasizing specific regulatory axes and mechanistic pathways implicated in esophageal carcinogenesis. Future studies should explore the molecular mechanisms of lncRNAs and their translational application to improve prognostic outcomes for patients with ESCC and identify novel therapeutic targets. These efforts may provide innovative strategies and directions for advancing precision oncology in ESCC management.

HFE
Also flagged:SarcopeniaDynapeniaprotein synthesisdiabetesosteoporosiscognitive impairment
Journal Article 2025-07-01 ✓ 1 Snippet López I, Mielgo-Ayuso J, Fernández-López JR, Aznar JM, Castañeda-Babarro A.
In-Text Gene Mentions

…GCKR, ADCY5, GIPR,HFE, TF) [ 74…

Show Full Abstract

<b>Background:</b> Sarcopenia (loss of muscle mass) and dynapenia (loss of strength) are prevalent in older adults aged 70 years and over. Both have an impact on their functional ability and quality of life, with type II muscle fibres being particularly affected. Although traditional resistance training (TRT) is effective, it presents technical difficulties and an increased risk of injury among this vulnerable population. Isometric strength training (IST) is a potentially safer, more accessible and more effective alternative. <b>Objective:</b> To describe the protocol of a single-arm, pre-post intervention trial designed to evaluate the efficacy and applicability of a 16-week IST programme on muscle strength, skeletal muscle mass, quality of life and applicability (safety, acceptability, perceived difficulty) in 18 older adults aged 70 years and above with a diagnosis of sarcopenia and dynapenia. The influence of genetic and environmental factors on the variability of response to IST will also be explored. <b>Methodology:</b> The participants, who have all been diagnosed with sarcopenia according to EWGSOP2 (European Working Group on Sarcopenia in Older People 2) criteria, will perform two IST sessions per week for 16 weeks. Each 30-min session will consist of one progressive set (total duration 45 s to 90 s) for each of the eight major muscle groups. This series will include phases at 20% and 40% of individual Maximal Voluntary Isometric Contraction (MVIC), culminating in 100% Maximal Effort (ME), using the CIEX SYSTEM machine with visual feedback. The primary outcome variables will be: change in knee extensor MVIC and change in Appendicular Skeletal Muscle Mass Index (ASMMI). Secondary variables will be measured (other components of sarcopenia, quality of life by EQ-5D-5L, use of Likert scales, posture and physiological variables), and saliva samples will be collected for exploratory genetic analyses. The main statistical analyses will be performed with <i>t</i>-tests for related samples or their non-parametric analogues. <b>Discussion:</b> This protocol details a specific IST intervention and a comprehensive evaluation plan. The results are expected to provide evidence on the feasibility and effects of IST among older adults with sarcopenia and dynapenia. Understanding individual variability in response, including genetic influence, could inform the design of more personalised and effective exercise strategies for this population in the future.

Also flagged:Cas12f1SpCas12f1CRISPRCasCRISPR-CasCas9
Journal Article 2025-07-01 No Snippets Madariaga-Marcos J, Baltramonaitis M, Henkel-Heinecke S, Kauert DJ, Irmisch P, Bigelyte-Stankeviciene G, Silanskas A, Karvelis T, Siksnys V, Sasnauskas G, Seidel R.
Show Full Abstract

Miniature CRISPR-Cas12f1 effector complexes have recently attracted considerable interest for genome engineering applications due to their compact size. Unlike other Class 2 effectors, Cas12f1 functions as a homodimer bound to a single ∼200 nt RNA. While the basic biochemical properties of Cas12f1, such as its use of a single catalytic center for catalysis, have been characterized, the orchestration of the different events occurring during Cas12f1 reactions remained little explored. To gain insights into the dynamics and mechanisms involved in DNA recognition and cleavage by Cas12f1 from Syntrophomonas palmitatica (SpCas12f1), we solved the structure of SpCas12f1 bound to target DNA and employed single-molecule magnetic tweezers measurements in combination with ensemble kinetic measurements. Our data indicate that SpCas12f1 forms 18 bp R-loops, in which local contacts of the protein to the R-loop stabilize R-loop intermediates. DNA cleavage is catalyzed by a single SpCas12f1 catalytic center, which first rapidly degrades a ∼11 bp region on the nontarget strand by cutting at random sites. Subsequent target strand cleavage is slower and requires at least a nick in the nontarget strand.

PRDX6
Also flagged:Salvianolic Acid BFerroptosisAcute Kidney InjurycisplatindeathSAB
Journal Article 2025-07-01 ✓ 2 Snippets Tao Y, Fu S, Lu J, Fu B, Liu S, Li L.
In-Text Gene Mentions

PRDX6was found to…

…Overexpression ofPRDX6inhibits renal apoptosis…

Show Full Abstract

Acute kidney injury (AKI) is a common side effect of the chemotherapy agent cisplatin, and ferroptosis serves as the primary mechanism underlying cell death in renal tubular epithelium in such cases. Salvianolic acid B (SAB), a compound derived from Salvia miltiorrhiza, has demonstrated promising anti-inflammatory and antioxidant properties. However, its impact on ferroptosis in the context of AKI remains to be fully explored. In this study, we utilized cisplatin-induced and folic acid-induced AKI models to investigate the protective mechanisms of SAB on renal tissue and tubular epithelial cell injury. The impact of SAB on renal cell ferroptosis was thoroughly examined and confirmed in both AKI models. To predict the potential mechanism through which SAB regulates ferroptosis, we employed an online target prediction database and subsequently verified the specific target proteins involved. Furthermore, we used drug affinity responsive target stability (DARTS), cellular thermal shift assay (CETSA) and molecular docking techniques to assess the binding capacity of SAB to the target protein. Our results reveal that SAB alleviated cisplatin- and folic acid-induced renal dysfunction in vivo and improved cisplatin-induced HK-2 cell injury. Mechanistically, SAB targeted and bound to PRDX5, enhancing its redox activity, which in turn potentiated the inhibitory effect of SLC7A11 and GPX4 on cisplatin-induced ferroptosis. Silencing PRDX5 in HK-2 cells could partially abrogate the protective effect of SAB. These results provide strong evidence for the potential of SAB in the treatment of AKI.

CCPG1
Also flagged:Leucine-rich repeat-containing protein 19colorectal cancercyclin-dependent kinase 6E2F1cancertumor
Journal Article 2025-07-01 ✓ 1 Snippet Huang SS, Chen W, Vaishnani DK, Huang LJ, Li JZ, Huang SR, Li YZ, Xie QP.
In-Text Gene Mentions

… including AC005614.3, DYX1C1-CCPG1, and LA16C60D12.2, were…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is a leading cause of cancer-related mortality worldwide, primarily due to tumor heterogeneity and treatment resistance. The leucine-rich repeat-containing protein 19 (LRRC19) has been linked to immune regulation and tumor suppression, yet its specific role in CRC remains poorly understood.<h4>Aim</h4>To investigate the tumor-suppressive role of LRRC19 in CRC, focusing on cell cycle, immune microenvironment, and chemotherapy response.<h4>Methods</h4>Bioinformatics analyses of Gene Expression Omnibus and The Cancer Genome Atlas databases identified differentially expressed genes in CRC. LRRC19 expression was validated in CRC tissues and cell lines by quantitative PCR, immunohistochemistry, and Western blotting. Functional assays, including proliferation, soft agar colony formation, flow cytometry, and xenograft models, assessed biological effects. Mechanistic studies with dual-luciferase reporter assays, molecular docking, and drug sensitivity testing explored LRRC19's interaction with the cyclin-dependent kinase 6 (CDK6)/E2F1 axis and oxaliplatin (OXA) response. Single-cell sequencing and immune infiltration analyses assessed its impact on the immune microenvironment.<h4>Results</h4>LRRC19 expression was significantly downregulated in CRC and associated with poor prognosis. Overexpression of LRRC19 inhibited CRC cell proliferation, induced G0/G1 phase arrest, and suppressed tumor growth <i>in vivo</i>. Mechanistically, LRRC19 suppressed CDK6 transcription by downregulating E2F1, leading to cell cycle arrest. Additionally, LRRC19 promoted immune cell infiltration, particularly B cells and CD4+ T cells, while decreasing immunosuppressive cells. LRRC19 also sensitized CRC cells to OXA, enhancing chemotherapy efficacy.<h4>Conclusion</h4>LRRC19 suppresses CRC by targeting the CDK6/E2F1 axis, modulating the immune microenvironment, and enhancing chemotherapy sensitivity, making it a promising therapeutic target for precision medicine in CRC.

HFE
Also flagged:β2-microglobulinβ2-Malanine aminotransferaseaspartate aminotransferaseureanitrogen
Journal Article 2025-07-01 ✓ 1 Snippet Gao GF, Wang XY, Yu J.
In-Text Gene Mentions

…olecystitis, Wilson's disease,hemochromatosis), α-1-antitrypsin deficiency,…

Show Full Abstract

<h4>Background</h4>Patients with chronic hepatitis B (CHB) require long-term antiviral therapy. The effects of different antiviral drugs on kidney function are unclear. There is a lack of effective markers for monitoring early renal impairment.<h4>Aim</h4>To investigate the rate of abnormal renal function index and related potential hazards in patients with CHB.<h4>Methods</h4>Clinical data of patients with CHB with urinary β2-microglobulin (β2-M) detection, including demographic characteristics, hepatitis B virus (HBV) DNA, serum liver function (alanine aminotransferase, aspartate aminotransferase, total bilirubin, direct bilirubin), serum renal function (urea nitrogen, creatinine), blood lipid index (high density lipoprotein, low density lipoprotein, cholesterol, triglyceride), liver imaging, and other routine tests were retrospectively collected. The normal level of urinary β2-M and estimated glomerular filtration rate (eGFR) is defined as < 0.173 mg/L and ≥ 90 mL/min/1.73 m<sup>2</sup>, retrospectively. The proportion of patients with abnormal renal function index and related risk factors were analyzed.<h4>Results</h4>A total of 500 patients with CHB were enrolled; these patients were aged 44.7 ± 10.8 years, 67.2% (336/500) were male, 57.2% (286/500) were treated with antiviral drugs, and 52.2% (261/500) had an HBV-related family history. In total, 28.8% (144/500) of patients had fatty liver, 35.0% (175/500) had liver fibrosis, and 13.2% (66/500) had cirrhosis. The proportion of patients with eGFR < 90 mL/min/1.73 m<sup>2</sup> was 43.2% (216/500), and the abnormal rate of urinary β2-M was 56.2% (281/500). There was no significant difference in the abnormal rate of urinary β2-M between the untreated group and the antiviral treated group (54.2% <i>vs</i> 57.7%; <i>P</i>= 0.25). The abnormal rate of β2-M after long-term entecavir treatment (more than 1 year) was 54.6% (89/163). In the treatment group, 56.4% (92/163) of patients with eGFR ≥ 90 mL/min/1.73 m<sup>2</sup> had abnormal urinary β2-M.<h4>Conclusion</h4>In patients with CHB, a higher proportion had greater urinary β2-M levels than eGFR for renal injury. Male patients should pay more attention to renal function and use antiviral regimens with a renal safety profile.

Also flagged:Infectionhuman leukocyte antigen‐EreceptorCD8RL9IL9
Journal Article 2025-07-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

HFE
Also flagged:ArthropathymacronutrientscarbohydratesIronVitamin Agamma-tocopherol
Journal Article 2025-07-01 ✓ 1 Snippet Xu W, Xia R, Peng D, Chen X.
In-Text Gene Mentions

…29 ]Hfe-knockout mouse models showed…

Show Full Abstract

Arthropathy was related to macronutrients in an increasing number of studies nowadays. However, the causal effect of macronutrients and micronutrients on them remains unknown. The macronutrient and micronutrient summary statistics from the greatest genome-wide meta-analysis produced by the DietGen and other cohorts and genome-wide association studies statistics of arthropathy from FinnGen were used in this two-sample bidirectional Mendelian randomization investigation. The causal relationship between macronutrients and arthropathy was investigated using inverse variance weighting (IVW), Mendelian randomization (MR)-Egger regression, weighted median, weighted model, and simple mode. IVW estimates suggested that carbohydrates, Iron, Vitamin A, and gamma-tocopherol had casual associations with arthropathy. As for gonarthrosis, the IVW estimate of the carbohydrate (OR: 2.11, 95% CI: 1.20-3.73, PIVW  = 9.70E-3); as for adhesive capsulitis of shoulder, the IVW estimate of Iron (OR: 1.29, 95% CI: 1.16-1.43, PIVW = 2.80E-6); as for rheumatoid arthritis, the IVW estimate of Iron (OR: 1.17, 95% CI: 1.06-1.30, PIVW = 3.00E-3); as for Coxarthrosis, the IVW estimate of Vitamin A (OR: 0.95, 95% CI: 0.94-0.97, PIVW = 2.70E-8); as for adhesive capsulitis of shoulder, the IVW estimate of gamma-tocopherol (OR: 0.36, 95% CI: 0.29-0.44, PIVW = 3.50E-21); in the reserve MR analysis, as for carbohydrate, the IVW estimate of juvenile arthritis (OR: 0.99, 95% CI: 0.99-1.00, PIVW = 4.50E-3); as for protein, the IVW estimate of juvenile arthtitis (OR: 1.01, 95% CI: 1.00-1.01, PIVW = 2.40E-3). As risk factors, this MR investigation discovered that in macronutrients, carbohydrates were causally linked to gonarthrosis and juvenile arthritis. Protein was related to juvenile arthritis. Iron was obviously associated with adhesive capsulitis of the shoulder and rheumatoid arthritis. Vitamin A was related to Coxarthrosis. Gamma-tocopherol related to adhesive capsulitis of the shoulder and gout. To fully understand how they affect arthropathy, more research is required.

HFE
Also flagged:liver diseaseMetabolic dysfunction-associatedsteatotic liver diseasemetabolic disorderFAM19A5cytokine
Journal Article 2025-07-01 ✓ 1 Snippet Huang X, Wu M, Wu Z, Lu K, Lin Y, Ho K, Zhang Y.
In-Text Gene Mentions

…liver diseases (includinghemochromatosis, glycogen storage disease,…

Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a prevalent metabolic disorder characterized by liver fat accumulation. Family with sequence similarity 19 member A5 (FAM19A5), a cytokine involved in metabolic regulation, may serve as a potential biomarker for MASLD diagnosis and treatment. A cross-sectional study was conducted on 37 participants from Quanzhou First Hospital between January and April 2024, including 18 MASLD patients and 19 healthy controls. Demographic data, anthropometric measurements, and clinical parameters were collected, and plasma FAM19A5 levels were quantified using Enzyme-Linked Immunosorbent Assay. After univariable analysis to screen variables associated with FAM19A5 levels, significant variables were included and potential confounders were adjusted for, followed by constructing multivariable linear regression models via stepwise variable selection. All statistical analyses were carried out using SPSS 26.0. Significant negative correlations were found between FAM19A5 levels and MASLD, body mass index, and total cholesterol. The expression of FAM19A5 was notably lower in MASLD patients, suggesting its potential role in the disease's pathophysiology. FAM19A5 could be a novel diagnostic biomarker for MASLD, with lower expression levels associated with the disease. Further research involving a broader patient population is needed to establish causality and explore its clinical implications.

POU3F2OLFM4
Also flagged:CancertumourtumoursleukaemiaALDH1ABC transporters
Journal Article 2025-07-01 ✓ 4 Snippets Wang H, Li J, Du F, Deng H.
In-Text Gene Mentions

…ecological niche forOLFM4+ CSCs through…

…and found thatOLFM4+ CSCs first…

OLFM4+ stem cells…

…sential transcription factors‐POU3F2, SOX2, SALL2 and…

Show Full Abstract

Cancer stem cells (CSCs) are a core subpopulation of tumour tissues exhibiting stem cell properties. Although they constitute only a minority of tumour cells, CSCs have become a central force driving tumourigenesis, metastasis, recurrence and resistance to therapy, owing to their abilities for self-renewal, multi-lineage differentiation and tumour-initiating ability. Recent advances in multi-omics analysis, lineage tracing and single-cell sequencing technologies have systematically elucidated the dynamic biology of CSCs, including their epigenetic plasticity, metabolic adaptations and phenotypic heterogeneity, which depend on their ecological niche. In this review, we summarise the biological properties of CSCs, the molecular regulatory mechanisms and the complex interactions with the tumour microenvironment. We focus on strategies to target CSCs and the clinical translational challenges associated with these approaches. Collectively, this review organically integrates basic mechanisms and clinical translational research on CSCs, offering a comprehensive framework for understanding tumour biology and developing precision therapeutic strategies. HIGHLIGHTS: Systems integration of CSC biology: Elucidate the dynamic properties, self-renewal, plasticity and drug resistance. Microenvironmental interactions: Bidirectional interactions between CSCs and other cells, providing insights into niche-driven immune evasion and metastasis. Therapeutic strategies: Evaluate emerging therapies targeting CSC-specific markers and signals. Future directions: Challenges are discussed, with proposed solutions including multi-omics-guided precision medicine and microenvironment remodelling.

Also flagged:AngiosarcomaASTP53POT1MYCPTPRB
Journal Article 2025-07-01 No Snippets Luong HTT, Vercammen S, de Marco A, de Rooster H, Cosma A.
Show Full Abstract

Angiosarcoma is a rare, aggressive vascular malignancy characterized by rapid proliferation, early metastasis, and limited therapeutic options, resulting in poor prognosis. The etiopathogenesis of AS remains elusive and diagnosis is challenging due to its similarity to other vascular lesions. This systematic review aims to synthesize existing literature on biomarkers in human AS tissue, encompassing genomic alterations, metabolic pathway changes, specific protein, and their implications for diagnosis, prognosis, and therapy. Eighty-seven studies were identified as meeting predefined eligibility criteria following a systematic search of Pubmed and Embase between 1996 and 2024. The review highlights recurrent mutations (e.g., TP53, POT1, MYC, PTPRB, KDR), altered metabolic pathways (VEGF, ANGPT-TIE, PI3K/Akt/mTOR, MAPK/ERK), and diverse protein expression patterns (e.g., ERG, CD31, CD34, vWF). These biomarkers underscore the complex molecular landscape of AS and offer potential targets for improved diagnostic, prognostic, and therapeutic strategies. This review provides a foundation for further research and the development of novel diagnostic and therapeutic approaches for this challenging malignancy.<h4>Systematic review registration</h4>https://www.crd.york.ac.uk/PROSPERO/view/CRD420251019523, identifier (CRD420251019523).

Also flagged:Neuroendocrine tumorsneoplasmsNETneuropeptidesecretionacromegaly
Journal Article 2025-07-01 No Snippets Streit L, Tanguy E, Brunaud L, Tóth P, Vitale N, Ory S, Gasman S.
Show Full Abstract

Neuroendocrine tumors (NETs) constitute a heterogeneous group of neoplasms arising from hormone-releasing cells. Secretion of hormones stored in vesicles occurs through calcium-regulated exocytosis, a process that needs to be tightly controlled to avoid unbalanced levels of hormones. A critical feature shared by most of the NETs is a dysfunctional secretory pathway mainly leading to hypersecretion, which often induces clinical complications. In this review, we focus on the cellular process of hormone exocytosis and discuss the potential molecular mechanisms leading to deregulated hormone secretion in various NETs. Particular attention is paid to expression level modifications for genes and proteins involved in the exocytic pathway in NETs.

Also flagged:strokeironcerebrovascular diseasestrokescardiovascular diseaseiron deficiency
Journal Article 2025-07-01 No Snippets Zheng W, Wang Y, Xia Z, Liu D.
Show Full Abstract

<h4>Background and purpose</h4>Serum ferritin, a well-established biomarker of iron status, has been inconsistently linked to stroke risk in previous studies. This meta-analysis aims to systematically evaluate the association between serum ferritin levels and the risk of stroke.<h4>Methods</h4>We conducted a systematic literature search across the PubMed and Embase databases to identify relevant studies. Studies meeting predefined eligibility criteria were selected, and relevant data were extracted. Statistical analysis was performed using Stata 12.0.<h4>Results</h4>Ten studies, including eight longitudinal and three cross-sectional, were included in our meta-analysis. Cross-sectional studies showed that stroke patients had significantly higher serum ferritin levels than controls. Longitudinal studies suggested a 22% increase in stroke risk in individuals with higher serum ferritin. Subgroup analysis indicated that further high-quality population-based cohort studies are warranted to validate these findings. Dose-response meta-analysis confirmed a positive association between serum ferritin levels and stroke risk.<h4>Conclusion</h4>This meta-analysis provides evidence of a positive association between increased serum ferritin levels and stroke incidence. While these results are promising, definitive conclusions cannot be drawn at this time. Therefore, additional robust, prospective cohort studies are imperative to substantiate this relationship.

BTN2A1
Also flagged:kidney stonekidney stonesalcoholEGFRCACYS
Journal Article 2025-07-01 ✓ 1 Snippet Wang R, Jiang M, Li Z, Xu C, Liang H, Shen J, Zhong H.
In-Text Gene Mentions

…level ratio andBTN2A1/IL18BP protein level ratio.…

Show Full Abstract

This study aimed to elucidate the causal interplay between dietary habits, gut microbiota composition, circulating metabolites, serum proteins, laboratory biomarkers and kidney stone formation, employing Mendelian randomisation (MR) to identify potential mediators. A rigorous two-sample MR framework was employed to assess the causal associations between kidney stones and a spectrum of predisposing factors. This encompassed dietary patterns, gut microbiota profiles, circulating metabolic intermediates, serum proteins and laboratory test indicators. Significant associations were further analysed using mediation analysis to uncover indirect pathways. Initial significance was determined at p < 0.05, followed by the implementation of False Discovery Rate correction (FDR p < 0.05) to reduce the likelihood of false positives due to multiple comparisons. Direct causal relationships were established between kidney stones and 9 dietary factors (including fruit, alcohol, coffee intake), 11 gut microbiota types, 8 metabolites, 12 plasma proteins and 8 laboratory indicators (CRE, EGFR, CA, UAHDL, APOA, CYS and URNA). Notably, nine mediation pathways were discovered. These pathways reveal the indirect effects of dietary habits on kidney stone formation mediated through laboratory biomarkers. Specifically, five dietary habits-alcohol, coffee, fruit, champagne/white wine and dried fruit consumption-were shown to mediate through seven key factors: APOA, CA, CYS, EGFR, HDL, UA and URNA. Six of these mediations were positive, indicating facilitatory roles, while three exhibited negative mediation, suggestive of competitive inhibition in the diet-kidney stone causal pathway. This MR study underscored the causal links between dietary habits, gut microbiota composition, circulating metabolites, serum proteins, laboratory biomarkers and kidney stone development, shedding light on potential mediators including seven laboratory biomarkers.

SOX6
Also flagged:Aldehyde Oxidase 1chronic diseasessarcopeniaAOX1molybdenum flavin enzymemetabolism
Journal Article 2025-07-01 ✓ 1 Snippet Liu Y, Wang QQ, Huang TE, Yao M, Wang BH, Huang CP, Wang S, Lu YF, Lan XQ, Tian XL, Xiang Y.
In-Text Gene Mentions

…as PGC‐1α andSox6, have been identified…

Show Full Abstract

Aerobic exercise has significant health benefits, including preventing chronic diseases like sarcopenia. It strongly depends on muscle fiber types, with higher oxidative fiber ratios enhancing endurance. However, the molecular mechanisms underlying aerobic exercise capacity remain incompletely understood. In this study, we identified 395 genes associated with muscle fiber types, among which 39 were linked to metabolic pathways. Notably, we focused on aldehyde oxidase 1 (AOX1), a molybdenum flavin enzyme, due to its unique non-mitochondrial localization, suggesting a potential causal role in regulating muscle metabolism. We further revealed a significant downregulation of Aox1 mRNA expression in the skeletal muscle of mice after two weeks of exercise training, indicating its involvement in exercise adaptation. To further explore this link, we generated Aox1 knockout (KO) mice and subjected them to endurance capacity tests. Aox1 KO mice exhibited significantly enhanced exercise endurance compared to wild-type (WT) controls, accompanied by a shift toward a more oxidative muscle phenotype, as indicated by an increased proportion of oxidative fibers. Mechanistically, Aox1 KO mice exhibit increased expression of PGC-1α, enhanced mitochondrial function, and increased capillary density in skeletal muscle, facilitating improved oxygen delivery and utilization during exercise. Additionally, in vitro experiments using C2C12 myotubes revealed that Aox1 knockdown alleviated starvation- and TNF-α-induced muscle atrophy, which partially mimics sarcopenia, highlighting its protective role against aging- and stress-induced muscle damage. These findings identify AOX1 as a negative regulator of aerobic exercise capacity and stress resilience, advancing our understanding of skeletal muscle adaptation and highlighting AOX1 as a potential target for improving exercise performance and mitigating sarcopenia.

PEBP1
Also flagged:programmed cell deathcancercuproptosispyroptosisferroptosistumor
Journal Article 2025-07-01 ✓ 1 Snippet Zhang Z, Wu Y, Liu Y, Zhang J, Zhang Y, Dai Y, Liu C.
In-Text Gene Mentions

…PE-binding protein 1 (PEBP1), P450 oxidoreductase (POR)…

Show Full Abstract

Programmed cell death (PCD) plays a crucial role in preventing cancer initiation and progression. Among the diverse PCD pathways, cuproptosis, pyroptosis, and ferroptosis have garnered attention for their unique mechanisms, which not only directly eliminate tumor cells but also enhance anti-tumor immunity. However, the therapeutic efficacy of PCD inducers is often compromised by rapid compensatory pathways in tumor cells, accelerated drug metabolism, and a lack of specificity, which can result in severe side effects. Engineered nanomedicines offer distinct advantages by leveraging nanoscale physicochemical properties to optimize pharmacokinetics, efficacy, and safety in cancer therapy. These nanomedicines enable precise targeting of tumor cells while enhancing drug stability. Moreover, they can simultaneously activate multiple PCD pathways and integrate with conventional therapies to further amplify anti-tumor effects. This review systematically examines the pathophysiological roles, mechanisms, and therapeutic implications of cuproptosis, pyroptosis, and ferroptosis in cancer treatment, with an emphasis on their modulation by nanomedicines. It also explores the potential interactions among these PCD pathways and highlights recent advancements in nanomedicine-based combination therapies targeting multiple PCD mechanisms. Finally, the challenges, limitations, and prospects for the clinical translation and application of PCD-targeting nanomedicines are discussed.

OLFM4
Also flagged:stem cell proliferationbone morphogenic protein 7antimicrobial peptideRV infectionleucine-rich repeat-containing G protein-coupled receptorgreen fluorescent protein
Journal Article 2025-07-01 ✓ 4 Snippets Bu XY, Tan HY, Wang AM, Wei MT, Pan S, Gao JZ, Li YH, Qian GX, Chen ZH, Ye C, Jia WD.
In-Text Gene Mentions

…olfactomedin 4 (Olfm4), and Lyz1…

…( Lgr5 ,Olfm4, Mki67 )…

…restored Lgr5 ,Olfm4, and Mki67…

…Bmp7 transcript levels remained stable, but Wnt3a partially rescued crypt budding and restoredLgr5 , Olfm4 , and Mki67 expressionin Bmp7-OE organoids, while BMP pathway activity was unaffected ( Supplementary Figure 4C-H ).…

Show Full Abstract

<h4>Background</h4>Rotavirus (RV), a primary cause of diarrhea-related mortality in 2021, has been shown to damage intestinal epithelial cells while upregulating intestinal stem cells (ISCs) activities. ISCs within the crypt niche drive the continuous self-renewal of intestinal epithelium, preserving its barrier functions. Paneth cells secrete antimicrobial peptide and signaling molecules within the intestine crypt, thereby playing a crucial role in intestinal immune defense and providing ISCs functional support. However, the regulatory function of Paneth cells under pathological conditions, such as RV infection, remains unclear.<h4>Aim</h4>To determine the impact of RV infection on Paneth cells and how Paneth cells regulate ISCs during intestinal injury repair.<h4>Methods</h4>We constructed a reference genome for the RV enteric cytopathogenic human orphan virus strain and reanalyzed published single-cell RNA sequencing data to investigate Paneth cell responses to RV-induced intestinal injury. We derived Paneth-ISC communication networks using CellChat, tracked ISC differentiation with pseudotime analysis, and validated our findings in leucine-rich repeat-containing G protein-coupled receptor 5-enhanced green fluorescent protein-internal ribosomal entry site-Cre recombinase estrogen receptor variant 2 mice and organoids <i>via</i> immunofluorescence, flow cytometry, and reverse transcription quantitative polymerase chain reaction.<h4>Results</h4>We found that RV directly infects Paneth cells, leading to a reduction in mature Paneth cells and an increase in kallikrein 1-high immature Paneth cells. Paneth-ISC communication was significantly enhanced. In particular, the bone morphogenic protein 7 (BMP7)-activin A receptor type 2B/BMP receptor type 1A-Smad pathway was upregulated post-infection, suggesting that Paneth cells suppress excessive ISC proliferation. Functional validation confirmed activation of this pathway.<h4>Conclusion</h4>Paneth cells regulate ISC proliferation during RV infection by activating BMP7 signaling, limiting excessive stem cell expansion and preserving crypt homeostasis for effective epithelial repair.

SUDS3
Also flagged:BAHCC1gene expressionHistoneacetylationchromatinSIN3A
Journal Article 2025-07-01 ✓ 2 Snippets Monziani A, Perry RB, Hezroni H, Ulitsky I.
In-Text Gene Mentions

…as SAP130 andSUDS3.…

…FAM60A , andSUDS3Sin3 components led…

Show Full Abstract

Chromatin modifications play a key role in regulating gene expression during development and adult physiology. Histone acetylation, particularly H3K27ac, is associated with increased activity of gene regulatory elements such as enhancers and promoters. However, the regulation of the machinery that writes, reads, and erases this modification remains poorly understood. In particular, the SIN3A-HDAC1 complex possesses histone deacetylase activity, yet it commonly resides at active regulatory regions. Here, we study BAHCC1, a large chromatin-associated protein essential for viability and recently reported to play a largely repressive role. We show that in neuronal lineage cells, BAHCC1 is mainly associated with regulatory elements marked with H3K27ac. BAHCC1 interacts and co-occupies shared genomic regions with the SIN3A scaffold protein, but not with its paralog SIN3B, and its perturbations lead to altered acetylation and expression of proximal genes in a neuronal cell line and primary cortical neurons. The regulated genes are enriched for those functioning in neurogenesis and cell migration, and primary cortical neurons with reduced Bahcc1 expression display impaired neurite outgrowth. We thus propose a model in which BAHCC1 antagonizes SIN3A histone deacetylation and positively regulates the expression of genes that are important for growth and migration-related processes in the neuronal lineage.

H4C8
Also flagged:reverse transcriptionhistonenucleuscytoplasmicpoly (A) polymerasePAP
Journal Article 2025-07-01 ✓ 1 Snippet Dinçaslan FB, Ngang SWY, Tan RZ, Cheow LF.
In-Text Gene Mentions

…, H2AC17 ,H4C8, H2BC18 ,…

Show Full Abstract

Detecting the complete transcriptome, including polyadenylated and nonpolyadenylated RNA, is crucial for understanding cellular roles. However, current efforts to investigate the total cellular transcriptome in single cells are limited by the lack of an automated, high-throughput assay. We developed scComplete-seq, a method that enhances existing droplet-based single-cell mRNA sequencing to provide insights into the nonpolyadenylated transcriptome. This method allows us to detect long and short nonpolyadenylated RNAs at single-cell resolution, including histone RNAs and enhancer RNAs in cancer cells and peripheral blood mononuclear cells (PBMCs). Using scComplete-seq, we identified transcriptomic changes in PBMCs under various stimulations, revealing specific biological processes and associated enhancer activities.

Also flagged:cancerbreast cancertumortumorsmalignant neoplasm of breastcoronavirus
Journal Article 2025-07-01 No Snippets Siegel SD, Zhang Y, Budziszewski R, Bacchus A, Rowland J, Rowland J, Iacocca MV, Hall-Mcbride R, Curriero FC.
Show Full Abstract

<h4>Background</h4>The National Cancer Institute (NCI) requires that NCI-Designated Cancer Centers develop programs to reduce the burden of cancer within their catchment areas, or the geographic area they serve. Extending catchment area approaches to community cancer centers has the potential to meaningfully reduce the burden of cancer nationwide. Building on a prior report that identified 2 advanced breast cancer (BC) hotspots (geographic areas with significantly elevated rates of BC) in a community cancer center catchment area, the objective of this study was to identify screening-related and tumor biology factors that explain the advanced BC hotspots.<h4>Methods</h4>Logistic regressions were used to model the relationship between BC screening interval and odds of advanced BC in a catchment area-based cohort of 3492 breast cancer patients, adjusting for demographic and tumor characteristics. The observed to expected case ratios were used to evaluate how well the regression models explained the hotspots.<h4>Results</h4>In models adjusted for grade, molecular subtype, and histology, patients with inconsistent BC screening had more than twice the odds of advanced breast cancer as patients who screened regularly. The model largely explained one of the hotspots and approximately half of the excess cases observed for the second hotspot.<h4>Conclusions</h4>In a community cancer center catchment area, BC screening and tumor biology were associated with increased odds of advanced BC and helped to explain previously detected hotspots. Specific community outreach and engagement interventions are considered for these hotspots while broader implications for extending catchment area approaches to community cancer centers are discussed.

HFE
Also flagged:Metabolic Diseasesamino acidcatabolismphenylketonuriaPKUorganelle
Journal Article 2025-07-01 ✓ 1 Snippet Saudubray JM, Schiff M.
In-Text Gene Mentions

…in nephrology; orhemochromatosis, Wilson disease, or…

Show Full Abstract

The concept of IMDs has evolved over a century from rare deficits in amino acid catabolism diagnosed by the accumulation of biochemical markers such as phenylketonuria (PKU) to diseases affecting organelle metabolism, synthesis of complex molecules, and cellular trafficking. Small-molecule accumulation disorders form the major group of treatable IMDs. Do not miss these metabolic emergencies! IMDs currently number over 1800 and include all medical specialties. The specificity of true "molecular internists," metabolic specialists, lies in the in-depth knowledge of metabolic pathways and the understanding of the pathophysiology of the deficits underlying the treatments ("precision medicine"). Neurology is massively impacted, but cerebral metabolism remains largely misunderstood. Genetic analyses are becoming increasingly important for diagnosis but must be complemented by biochemical investigations, which sometimes have greater diagnostic specificity and provide functional information at the phenotype level. Biochemical analyses remain essential for monitoring treatment or even for diagnosis. Finally, contrary to early expectations, newborn screening such as that for phenylketonuria, leading to preventive therapy, could be extended to a significant though limited number of IMDs. Currently, there are numerous initiatives that include genetic screening combined with biochemical testing or that extend screening to lysosomal diseases potentially treatable by enzyme or gene therapy.

NEGR1
Also flagged:PeriodontitisPDinflammatory diseaseinflammatory responsegingival recessionchewing
Journal Article 2025-07-01 ✓ 1 Snippet Li J, Chen Y, Wang C, Yu J, Yang Q, Liu Y, Tang C.
In-Text Gene Mentions

…, CD86 andNEGR1showed opposite expression…

Show Full Abstract

Periodontitis (PD) and primary Sjögren's syndrome (pSS) are persistent inflammatory diseases that affect oral health, and numerous studies have uncovered phenotypic and intrinsic correlations between the two. However, a comprehensive and high-resolution analysis at the single-cell level has not been reported comparing the immune cell landscapes in PD and pSS. This study integrated single-cell transcriptome data from peripheral blood mononuclear cells (PBMCs) of healthy controls (HC), PD and pSS patients sourced from the NCBI and NGDC databases. The scRNA datasets were integrated, and cells were clustered using Seurat, with further subdivision of T/NK, myeloid cells and B cell subclusters. Next, NicheNetr was used to analyse the communication between myeloid cells and CD8<sup>+</sup> naive T (Tn) cells. Finally, we identified nine T/NK cell subclusters, seven myeloid cell subclusters and five B cell subclusters. Compared to the HC group, the proportion of CD8<sup>+</sup> Tn cells was significantly downregulated in both PD and pSS. HLA-DRA<sup>+</sup> mono cells showed a significant decrease in PD. Additionally, immature B cells were upregulated in PD but showed an opposite trend in pSS. The intracellular communication analysis between myeloid cells and CD8<sup>+</sup> Tn cells suggested that myeloid cells may promote the exhaustion of CD8<sup>+</sup> Tn cells through the IL-7/TNFSF11-CDKN1A signalling pathways. The BACE2-CDKN1A signalling pathway may also contribute to the depletion of CD8<sup>+</sup> Tn cells in both PD and pSS. Collectively, this study uncovers the single-cell level associations between PD and pSS, providing new insights into the common molecular mechanisms underlying these two diseases.

Also flagged:hydroxylapatiteapatitemineralcalcium hydroxylapatiteAgingdiabetes
Journal Article 2025-07-01 No Snippets Kabakci AG, Tandirovic Gursel A, Aydin B, Eren D, Bozkir MG.
Show Full Abstract

This study aims to investigate the indirect effects of calcium hydroxylapatite (CaHA) injections in the zygomatic and malar regions on the healing of nasolabial folds (NLFs). Given the anatomical complexity and proximity of the nasolabial area, selecting appropriate techniques for CaHA applications is crucial to prevent potential complications. The study is designed to contribute insights into the safety and efficacy of injections, aiming to enhance patient outcomes and minimize risks in aesthetic applications. This retrospective single-center study analyzed the effectiveness of CaHA injections in the zygomatic and malar regions for correcting NLFs in 51 female participants aged between 30 and 55. Images from clinical archives were used, taken before the application and 6 months after the application. The primary outcomes were evaluated using Gabor filter analysis, Global Aesthetic Improvement Scale, and Wrinkle Severity Rating Scale, complemented by morphometric measurements using Image J 1.52a software. Measurements before and 6 months after the application revealed significant improvements in NLF length: from 2.59 ± 0.64 cm to 2.24 ± 0.53 cm on the right side and from 2.76 ± 0.81 cm to 2.59 ± 0.61 cm on the left side. This corresponds to an improvement of 13.51 % and 6.16%, respectively. Evaluations using the Wrinkle Severity Rating Scale, Global Aesthetic Improvement Scale scores, and Gabor filter analysis also demonstrated positive NLF depth post-treatment changes. The results of our study indicate that CaHA injections in the zygomatic and malar regions lead to an indirect improvement in NLFs. Furthermore, our study provides standardized quantitative methods that can be used to assess the effectiveness of treatments in the nasolabial area. These analyses offer reliable tools for evaluating aesthetic procedures and provide valuable contributions to clinical practice.

DCC
Also flagged:cholangiocarcinomaIntrahepatic cholangiocarcinomaperihilar cholangiocarcinomadistal cholangiocarcinomatumorlymph node metastasis
Journal Article 2025-07-01 ✓ 5 Snippets Hussain MM, Wang JM, Zhai AQ, Li FY, Hu HJ.
In-Text Gene Mentions

…IHCC, PHCC, andDCCbased on current…

…6260; PHCC: 6895;DCC: 1329).…

…= 0.88), whileDCCshowed consistent trends…

…RESULTSDCCdemonstrated the most…

…between IHCC andDCC.…

Show Full Abstract

<h4>Background</h4>Cholangiocarcinoma (CCA) comprises heterogeneous malignancies arising at different anatomical locations: Intrahepatic cholangiocarcinoma (IHCC), perihilar cholangiocarcinoma (PHCC), and distal cholangiocarcinoma (DCC). These subtypes exhibit distinct clinical behaviors, treatment approaches, and outcomes. Despite advances in surgical and adjuvant therapies, the prognostic implications of tumor location remain unclear and inconsistently reported. Understanding these variations is essential for personalized management and staging refinement. We hypothesized that the anatomical subtype of CCA significantly influences prognostic outcomes and pathological features.<h4>Aim</h4>To compare prognostic outcomes and clinicopathological characteristics among IHCC, PHCC, and DCC based on current evidence.<h4>Methods</h4>A systematic review and meta-analysis were conducted in accordance with PRISMA guidelines. PubMed, EMBASE, and the Cochrane Library were searched, yielding 11 eligible retrospective comparative studies involving 14484 patients (IHCC: 6260; PHCC: 6895; DCC: 1329). Outcomes assessed included overall survival (OS), lymph node metastasis, neural invasion, and vascular invasion. Statistical analyses were performed using RevMan 5.3 and Stata 13.0.<h4>Results</h4>DCC demonstrated the most favorable prognosis among all subtypes. Despite the highest lymph node metastasis rate (DCC: 56.9%), it was associated with better OS than PHCC and IHCC. Vascular invasion was more prevalent in IHCC (OR = 1.66, 95%CI: 1.22-2.28, <i>P</i> = 0.001). OS comparisons showed no significant difference between PHCC and IHCC (HR = 1.02, <i>P</i> = 0.88), while DCC showed consistent trends toward better survival against both.<h4>Conclusion</h4>Anatomical subtype is a significant prognostic factor in CCA. DCC patients experience superior outcomes despite aggressive lymphatic spread, suggesting better resectability and surgical outcomes. These insights underscore the need for subtype-specific management strategies and future prospective validation.

HFE
Also flagged:Hepatocellular Carcinomaannexin A2cancerpyruvate kinase PKMANXA2Liver tumors
Journal Article 2025-07-01 ✓ 1 Snippet Zorina E, Ronzhina N, Legina O, Klopov N, Zgoda V, Naryzhny S.
In-Text Gene Mentions

…deficiency, tyrosinemia, andhemochromatosis) [ 3 ,…

Show Full Abstract

<h4>Background</h4>Human proteins exist in numerous modifications-proteoforms-which are promising targets for biomarker studies. In this study, we aimed to generate comparative proteomics data, including proteoform patterns, from hepatocellular carcinoma (HCC) and nonmalignant liver tissues.<h4>Methods</h4>To investigate protein profiles and proteoform patterns, we employed a panoramic, integrative top-down proteomics approach: two-dimensional gel electrophoresis (2DE) coupled with liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS).<h4>Results</h4>We visualized over 2500 proteoform patterns per sample type, enabling the identification of distinct protein signatures and common patterns differentiating nonmalignant and malignant liver cells. Among these, 1270 protein patterns were uniformly observed across all samples. Additionally, 38 proteins-including pyruvate kinase PKM (KPYM), annexin A2 (ANXA2), and others-exhibited pronounced differences in proteoform patterns between nonmalignant and malignant tissues.<h4>Conclusions</h4>Most proteoform patterns of the same protein were highly similar, with the dominant peak corresponding to theoretical (unmodified) protein parameters. However, certain proteins displayed altered proteoform patterns and additional proteoforms in cancer compared to controls. These proteins were prioritized for further characterization.

Also flagged:AlbiflorinNeurodegenerative DisordersdepressionAlzheimer's diseaseADmonoamine
Journal Article 2025-07-01 No Snippets Sun S, Hamezah HS, Jin C, Han R, Tong X.
Show Full Abstract

<h4>Aims</h4>Albiflorin, a key compound from Paeonia lactiflora, has shown therapeutic potential in neuropsychiatric and neurodegenerative disorders (NPDs and NDDs), especially depression and Alzheimer's disease (AD). This review aimed to summarize its pharmacological effects, mechanisms, pharmacokinetics, and therapeutic prospects.<h4>Discussion</h4>Albiflorin exhibits multi-target actions, including modulation of monoamine neurotransmitters, inhibition of neuroinflammation, and enhancement of neuroplasticity. In AD, it reduces Aβ accumulation, improves mitochondrial function, and activates MAPK/ERK and Nrf2/HO-1 signaling pathways. In depression, it restores phospholipid and tryptophan metabolism, regulates HPA axis function, and increases BDNF expression. Albiflorin crosses the blood-brain barrier (BBB) and may act indirectly via the gut-brain axis through its metabolite benzoic acid. Though brain concentrations are low, its pharmacological effects remain significant. Albiflorin also shows potential benefits in conditions like cerebral ischemia and hypoxic-ischemic brain injury. Toxicological data indicate low systemic toxicity and good safety margins in vivo and in vitro.<h4>Conclusions</h4>Albiflorin demonstrates promising therapeutic potential for NPDs and NDDs via multi-pathway regulation. However, further studies are needed to optimize brain delivery, understand gut microbiota interactions, and confirm efficacy through clinical trials. The advancement of formulation strategies and pharmacokinetic research will be considered key to achieving clinical translation.

ZNF311
Also flagged:insulininsulin resistanceGlucosetoleranceOR14J1NKAIN2
Journal Article 2025-07-01 ✓ 5 Snippets Gu P, Zheng S, Zhang S, Yuan J, Hong H, Dai J, Zhao J, Xu K, Yang T, Fu Q, Shen S, Dai H.
In-Text Gene Mentions

…= 0.70) andZNF311(PP.H4 = 0.74)…

…decreased expression ofZNF311in thyroid (beta…

…causal variant forZNF311expression in spleen…

…the pancreas andZNF311in the spleen.…

ZNF311and HCG4 have…

Show Full Abstract

<h4>Objective</h4>To identify genetic loci that exhibit potential interactions with smoking status on insulin sensitivity and islet β-cell function within normal glucose tolerance (NGT) populations.<h4>Methods</h4>All participants underwent an OGTT to confirm NGT status, followed by assessments of insulin sensitivity and β-cell function. Analyses were performed in NGT participants from Nanjing (N = 4808) and Jurong (N = 508) for discovery and validation, respectively. Smoking status was categorized into nonsmokers and smokers. After excluding ineligible individuals, a two-stage genome-wide interaction association analysis (GWIS) was conducted in NGT individuals, with the discovery phase (N = 1377) identifying gene-environment interactions and the validation phase (N = 485) confirming significant loci. Subsequent analyses included stratified analysis and expression quantitative trait locus (eQTL) colocalization.<h4>Results</h4>GWIS identified ten SNPs in three loci, including rs4713207 (OR14J1, P<sub>meta</sub> = 3.95 × 10<sup>-8</sup>) for insulin resistance, rs17708475 (NKAIN2, P<sub>meta</sub> = 4.83 × 10<sup>-8</sup>) for insulin sensitivity, and rs201613 (MYH3, P<sub>meta</sub> = 1.05 × 10<sup>-8</sup>) for disposition index. Stratified analyses revealed differential effects of smoking across genotypes at these loci. Specifically, smoking was associated with increased insulin resistance in rs4713207 homozygotes (p = 2.15 × 10<sup>-5</sup>), while an opposite effect was observed in wild-type individuals (p = 0.022). Colocalization analysis indicated that the smoking-related interaction near rs4713207 is driven by a shared causal variant influencing HCG4 (PP.H4 = 0.70) and ZNF311 (PP.H4 = 0.74) expression in the pancreas.<h4>Conclusions</h4>Our findings reveal gene-smoking interactions that affect insulin sensitivity and β-cell function, providing new insights into the heterogeneity of metabolic phenotypes and advancing personalized risk assessment.

HFE
Also flagged:Cirrhosisdecompensated cirrhosisDChepatocellular carcinomaliver diseasealcohol use disorder
Journal Article 2025-07-01 ✓ 1 Snippet Shi Y, Zhang X, Wong T, Yan T, Henry L, Cheung R, Nguyen MH.
In-Text Gene Mentions

…cholangitis, Wilson diseases,hemochromatosis, and α-1 antitrypsin…

Show Full Abstract

<h4>Importance</h4>Patients with cirrhosis are at high risk of developing adverse liver events. However, data on sex differences are limited.<h4>Objective</h4>To compare risk of adverse liver events between male and female patients with cirrhosis.<h4>Design, setting, and participants</h4>This population-based retrospective cohort study included adult patients with cirrhosis who were identified from a US private health insurance claims database (Merative MarketScan Research Databases) from January 1, 2007, to December 31, 2022.<h4>Exposures</h4>Males compared with females.<h4>Main outcomes and measures</h4>The main outcome was the incidence of adverse liver events (decompensated cirrhosis [DC], hepatocellular carcinoma [HCC], and liver transplant [LT]). Propensity score matching on age, liver disease etiologies, geographic region, insurance type, specialty type, alcohol use disorder, obesity, baseline status of decompensation, and Charlson Comorbidity Index score was used to balance baseline characteristics of the male and female groups.<h4>Results</h4>The study included 438 706 patients with cirrhosis (mean [SD] age, 56.8 [15.4] years; 50.8% males), with a higher mean (SD) age in males than in females (57.6 [14.3] vs 55.9 [16.4] years). Propensity score matching yielded 169 711 pairs of female and male patients with similar baseline characteristics for subsequent analyses. Males compared with females had a higher incidence (per 1000 person-years) of DC (65.77 [95% CI, 64.74-66.81] vs 55.35 [95% CI, 54.46-56.25]; P < .001), HCC (6.98 [95% CI, 6.71-7.27] vs 3.35 [95% CI, 3.17-3.54]; P < .001), and LT (10.23 [95% CI, 9.89-10.58] vs 6.27 [95% CI, 6.01-6.52]; P < .001). In the Cox proportional hazards regression model, male sex was associated with 16% higher risk of DC (hazard ratio [HR], 1.16 [95% CI, 1.14-1.19]; P < .001), 63% of LT (HR, 1.63 [95% CI, 1.54-1.71]; P < .001), and 110% of HCC (HR, 2.10 [95% CI, 1.96-2.25]; P < .001). Among the major liver disease etiologies, male sex (compared with female sex) was associated with the highest risk of adverse liver events in patients with alcohol-related liver disease including DC (HR, 1.13 [95% CI, 1.08-1.19]; P < .001), HCC (HR, 2.40 [95% CI, 2.01-2.88]; P < .001), and LT (HR, 1.36 [95% CI, 1.21-1.53]; P < .001), followed by metabolic dysfunction-associated steatotic liver disease and hepatitis C virus (HCV) infection, but not in patients with HBV except for those with HCC (HR, 1.60 [95% CI, 1.08-2.36]; P = .02).<h4>Conclusions and relevance</h4>The findings of this cohort study of adult patients with cirrhosis suggest that significant sex differences in liver complication risk exist, which was more pronounced in nonviral (alcohol-related liver disease and metabolic dysfunction-associated steatotic liver disease) compared with viral (HBV and HCV) cirrhosis. Sex disparities should be taken into consideration in future guidelines and programs for disease monitoring, prevention, and treatment of patients with cirrhosis.

Also flagged:Acute myeloid leukemiaAMLbone marrow failure syndromepediatric leukemiahematological malignancyleukemogenesis
Journal Article 2025-07-01 No Snippets Smith SC, Zhang L.
Show Full Abstract

Acute myeloid leukemia (AML) accounts for only about 15-20% of pediatric leukemia and an overall incidence of 1.4 cases per 200,000 children under the age of 15 years. The majority of pediatric AML occurs de novo, often as the result of somatic first hits in utero. A minority of pediatric AML occurs in response to a predisposition syndrome, such as a bone marrow failure syndrome, or other inherited mutations and copy number changes. While the overall survival of pediatric patients with AML is approximately 70%, survival at the individual level is dependent on the abnormality detected either through cytogenomic analyses or sequencing for mutations in responsible genes. Indeed, de novo infant AML carries a more sobering prognosis than that of pediatric AML. This review describes many of the common genomic abnormalities associated with pediatric AML and characterizes their detection from a laboratory assessment perspective. Pediatric AML is primarily a disease of gene rearrangements rather than of gene mutations, and, as such, clinical cytogenetics takes a primary role.

Also flagged:Transcription factor MohawkinjuriesagingMkxtranscription factorligament diseases
Journal Article 2025-07-01 No Snippets Yang H, Li C, Ding Q, Li TL, Tang W, Sui HJ.
Show Full Abstract

Tendon and ligament injuries due to aging or overload are common clinical injuries of the locomotor system, often resulting in limited motion and pain. These diseases are difficult to partially cure because of their poor regeneration ability. Mohawk (Mkx) is a transcription factor that has been verified as critical to tendon/ligament development. Mkx knockout animals exhibit varying degrees of tendon defects, with multiple genes exhibiting different levels of expression. Mesenchymal stem cells and tendon stem/progenitor cells have been studied under circumstances of Mkx overexpression or deficiency, with or without mechanoforce stimulation. To further investigate the underlying mechanisms of tendon and ligament injury repair and develop therapeutic approaches, it is necessary to dig deeper into the molecular networks regulating tendon/ligament development. The study design is a narrative review. A search of the PubMed database was performed to conduct a comprehensive literature review on Mkx. A total of 119 studies were included. Recent studies have reported the importance of Mkx and its related genes on tendon/ligament developmental processes. In addition, numerous articles have also provided therapeutic aspects to Mkx-related tissue repair after injuries. Mkx plays an important role in tendon/ligament development, as well as the pathological processes. The combination of Mkx, Mkx-related molecular interaction networks with mesenchymal stem cells or tendon stem/progenitor cells, and 3-dimensioned cultural systems may offer a new thought for developing new strategies for acute and chronic tendon/ligament diseases.

DCC
Also flagged:Helicobacter Pylori InfectionColorectal CancerH. pylori infectionHpyloriinfection
Journal Article 2025-07-01 ✓ 1 Snippet Wang S, Liu Y, Shi Y, Liu M.
In-Text Gene Mentions

…variants within theDCC(Deleted in Colorectal…

Show Full Abstract

<h4>Background</h4>Some observational studies have indicated an association between Helicobacter pylori (H. pylori) infection and colorectal cancer (CRC). Nevertheless, the causal relationship between H. pylori infection and CRC remains to be evaluated.<h4>Methods</h4>A two-sample Mendelian randomization (MR) analysis was conducted to investigate whether H. pylori infection is causally associated with CRC in the European population. We chose anti-H. pylori IgG levels as the exposure, CRC as the outcome, and genetic variants strongly linked to anti-H. pylori IgG levels (P < 1×10-5) as the instrumental variables (IVs). Data were obtained from publicly available genetic summary data, specifically the OpenGWAS database. Inverse variance weighted (IVW), weighted median, weighted mode, and MR Egger were used for MR analyses, where IVW analysis was identified as the primary method for our study. MR-Egger regression methods were used to assess horizontal pleiotropy.<h4>Results</h4>No causal association between anti-H. pylori IgG levels and CRC was found in IVW (β, -0.0002; 95% CI, -0.0016 to 0.0012; P = 0.7945), weighted median (β, 0.0006; 95% CI, -0.0010 to 0.0022; P = 0.4456), weighted mode (β, 0.0012; 95% CI, -0.0019 to 0.0043; P = 0.4688), and MR-Egger (β, -0.0025; 95% CI, -0.0052 to 0.0002; P = 0.0886). Sensitivity analyses did not show any evidence of heterogeneity (P = 0.1500) or horizontal pleiotropy (P = 0.0776) among the IVs.<h4>Conclusions</h4>H. pylori infection does not have a significant effect on the risk of CRC in the European population.

Also flagged:canceranti-apoptotic proteinsBcl-xLpathogenesiscancersbinding
Journal Article 2025-07-01 No Snippets Thai QK, Huynh P, Tran TT, Nguyen BH, Nguyen HTT.
Show Full Abstract

<h4>Background</h4>Reactivating the apoptosis pathway in cancer cells represents a crucial therapeutic strategy for cancer treatment, as malignant cells often evade apoptosis to sustain uncontrolled proliferation. Among the anti-apoptotic proteins, Bcl-xL has been implicated in the pathogenesis of various cancers due to its overexpression. Inhibition of this protein has therefore emerged as a key target for several FDA-approved anticancer drugs. In recent decades, research on natural compounds has increasingly shifted toward molecular-level understanding, facilitating the development of potent anticancer agents. One medicinal plant of interest is Andrographis paniculata (Burm.f.) Wall. ex Nees, which has shown a wide range of pharmacological activities, including potential anticancer properties.<h4>Methods</h4>In this study, we curated a set of previously identified natural compounds from A. paniculata in LOTUS database that target Bcl-xL inhibition by in silico methods, included molecular docking and molecular dynamics simulation.<h4>Results</h4>Our findings reveal three compounds exhibiting strong binding affinity toward the Bcl-xL protein. In silico analysis of their anticancer properties suggests that these compounds possess high potential as TP53 enhancers, anticarcinogenic, antineoplastic, apoptosis agonists, antimetastatic, cytostatic, antioxidant agents, and Myc inhibitors. Moreover, all three compounds conform to Lipinski's rule of five and show favorable drug-likeness characteristics. Molecular dynamics simulations over 100 ns, coupled with in-depth principal component analysis and binding free energy calculations, further support the stable and strong interactions of these compounds within the Bcl-xL active site.<h4>Conclusions</h4>Natural compounds from A. paniculata, particularly andrographolide derivatives, exhibit stable and strong interactions with the Bcl-xL protein and possess multiple predicted anticancer activities. These findings support their potential as lead molecules for the development of Bcl-xL-targeted anticancer therapeutics.

Also flagged:gallbladder cancerGall bladder cancercancersbiliary tract cancertumorsgallstone diseases
Journal Article 2025-07-01 No Snippets Sarangi Y, Kumar A.
Show Full Abstract

Gall bladder cancer (GBC) remains a highly aggressive disease, with an overall 5-year dismal survival rate of 15%-20%. Its asymptomatic nature in very early stages and non-specific clinical presentations pose significant challenges to timely detection. Consequently, GBC often presents late, making it one of the most challenging cancers to manage. Surgery offers the best chance for long-term survival; however, only 10% of GBC patients are candidates for upfront resection, with the majority presenting in locally advanced or metastatic stages. Furthermore, GBC is generally resistant to chemotherapy and radiotherapy, limiting the effectiveness of systemic therapy. Therefore, early diagnosis is crucial to offer the best treatment through surgical resection and to improve the outcome. Recent advancements in imaging technologies, biomarker discovery, and molecular diagnostics offer promising avenues for enhancing detection rates. Though non-invasive, most of them lack specificity, and the majority fail as an early diagnostic tool. This review examines the current status of early detection strategies for GBC, addresses the limitations of existing approaches, and explores the newer emerging diagnostic tools and techniques and how they can be exploited in future for its early detection.

HFE
Also flagged:Hemophagocytic Lymphohistiocytosischronic alcohol use disorderpancytopeniaimmune dysregulationhypercytokinemiainfection
Journal Article 2025-07-01 ✓ 5 Snippets Banayan H, Liu J, Haoson D.
In-Text Gene Mentions

…hepatitis, or evenhemochromatosis.…

Hemochromatosis, another plausible diagnosis…

Hemochromatosiscan present with…

…findings supportive ofhemochromatosis, including liver function…

…the diagnosis ofhemochromatosisincludes skin discoloration.…

Show Full Abstract

We present a case of hemophagocytic lymphohistiocytosis (HLH) with a complex presentation that could have been easily mistaken as one of many alternative diagnoses. Our patient, with chronic alcohol use disorder, presented with new-onset liver symptoms and pancytopenia. This case underscores the importance of clinical suspicion and further investigation of a wide differential. The purpose of this case report is to highlight the diagnostic challenges and nuances in patient presentation that can mislead healthcare providers while emphasizing the ambiguity of liver failure symptoms in patients with undiagnosed HLH.

HFE
Also flagged:liver diseaseMetabolic dysfunction-associatedsteatotic liver diseasechronic liver diseaseobesitymetabolic syndrome
Journal Article 2025-07-01 ✓ 1 Snippet Sukocheva O, Ow TW, Harding D, Le Mire M, Tse E.
In-Text Gene Mentions

…5 ], andhemochromatosis[ 6 ] signify…

Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is the most widespread chronic liver disease signified by serious life-threatening conditions. The prevalence of MASLD increases along the growing prevalence in obesity and metabolic syndrome. To minimize costs and complications, non-invasive diagnostic tools, including transient elastography (TE), were introduced for assessment of MASLD. TE measures liver stiffness (LS), a clinical marker for the diagnosis of liver fibrosis and cirrhosis. LS measurements are based on ultrasound wave imaging and quantification. Vibration-controlled TE, including FibroScan<sup>®</sup>, is commonly used TE methods which can accurately identify the degree of liver fibrosis and cirrhosis progression. TE was reported to predict the progression towards hepatocellular carcinoma, portal hypertension, and varices. However, the accuracy of LS diagnostics alone in patients with MASLD remains controversial. TE measurements have several limitations, including inadequate precision due to focal liver lesions, cholestasis, inflammation, and other pathological and anatomical factors which can lead to the stiffness variability. Overestimations of TE readings were reported in obese patients with body mass index (BMI) over 30 kg/m<sup>2</sup>, and older patients with ascites, diabetes, or hypertension. Not all MASLD patients have high BMI. The prevalence of obesity among MASLD patients varies worldwide, indicating the urgent need for comprehensive diagnostic tools. In patients with MASLD, improved diagnostic accuracy has been demonstrated by combining LS measurements with other blood test-based scores and simple clinical parameters (agile scores based on age, sex, platelet count, aminotransferases, and diabetes). This study reviews the limitations of TE-based diagnostics and discusses the combined scoring algorithm. In conclusion, the sequence of LS measurements along assessment of other important clinical markers is an effective, low-cost, reliable tool to identify and monitor fibrosis progression in MASLD.

HFE
Also flagged:epidermal growth factor receptorsEGFRpathogenesisHepatocellular carcinomaliver cancerliver
Journal Article 2025-07-01 ✓ 1 Snippet Al-Awadhi SSA, Patil P, Shetty P, Shetty PK, Shetty RA, Shetty VV.
In-Text Gene Mentions

…disease, NAFLD, andhemochromatosisleads to the…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most prevalent type of primary liver cancer, accounting for roughly 90% of all liver malignancies worldwide, and remains the leading cause of cancer death worldwide. Cirrhosis, viral hepatitis, non-alcoholic fatty liver disease (NAFLD), or liver injuries caused by alcohol are all chronic diseases that have a close association with the pathogenesis of HCC. A key factor in the progression of these diseases to HCC is the activation of the epidermal growth factor receptor (EGFR) signalling pathway. The ErbB family of receptor tyrosine kinases, which includes EGFR, is essential for inflammation, cell division, and liver regeneration. In HCC, EGFR expression and hyperactivation are closely associated with tumor growth, metastasis, and patient prognosis. This review explores the structural and functional aspects of EGFR, its signalling mechanisms in hepatocellular proliferation and apoptosis, its role in liver fibrosis, and the transition from chronic liver injury to advanced HCC. Moreover, crosstalk between EGFR-mediated pathways and other signalling pathways, such as PI3K/AKT/mTOR and MAPK/ERK, contributes to resistance to targeted therapies, suggesting that molecular regulation needs to be improved in strategies targeting EGFR and its downstream pathways.

ARFGEF2
Also flagged:METTL3non-small cell lung cancercancersNSCLCchemokine (C-X-C motif) ligand 3CXCL3
Journal Article 2025-07-01 ✓ 1 Snippet Liu G, Li Z, Tang C.
In-Text Gene Mentions

ARFGEF2

Show Full Abstract

Circular RNA (circRNA) is involved in the occurrence of many cancers. Nonetheless, the mechanism of circ_0003998 in non-small cell lung cancer (NSCLC) needs to be studied in depth. Real-time quantitative PCR (RT-qPCR) was carried out to check the expression of circ_0003998, microRNA-330-5p (miR-330-5p), chemokine (C-X-C motif) ligand 3 (CXCL3) and methyltransferase-3 (METTL3) in NSCLC tissues and cells. CXCL3, Vimentin and E-cadherin protein levels were measured by western blot. The functions of circ_0003998 in NSCLC cell proliferation, apoptosis, angiogenesis, migration and invasion were tested by clone formation assay, flow cytometry, tube formation assay, wound healing assay, and transwell assay in vitro. The dual-luciferase reporter assay was made to verify the relationship between miR-330-5p and circ_0003998 or CXCL3. Finally, animal experiment was made to further research the function of circ_0003998 on tumor formation in vivo. The interaction between circ_0003998 and METTL3 was analyzed by RNA Immunoprecipitation (RIP) assay, methylated RNA Immunoprecipitation (MeRIP) assay and dual-luciferase reporter assay. In NSCLC tissue and cells, circ_0003998 was markedly overexpressed. Circ_0003998 suppression inhibited NSCLC cell growth, angiogenesis, migration and invasion. Circ_0003998 sponged miR-330-5p, and miR-330-5p inhibitor could reverse the suppression effect of circ_0003998 knockdown on NSCLC cell behaviors. CXCL3 was a downstream target gene of miR-330-5p, and CXCL3 overexpression also reversed the suppressive effect of miR-330-5p on NSCLC cell behaviors. Interference of circ_0003998 reduced NSCLC tumorigenesis by regulating miR-330-5p/CXCL3 axis. Also, METTL3 promoted the expression of circ_0003998 by m6A modification. METTL3-modified circ_0003998 promoted NSCLC cell malignancy through miR-330-5p/CXCL3 axis, suggesting that circ_0003998 might be a new treatment strategy for NSCLC.

PRDX6
Also flagged:neuronal infectionsbindingmetabolismorganizationinfectionmelioidosis
Journal Article 2025-07-01 ✓ 4 Snippets Indrawattana N, Santajit S, Seng R, Rungruengkitkun A, Kong-Ngoen T, Tunyong W, Thavorasak T, Reamtong O, Sricharunrat T, Chantratita N, Pumirat P.
In-Text Gene Mentions

…hoGDI1), and peroxiredoxin-6 (Prdx6).…

…29Prdx6is an antioxidant…

Prdx6has both glutathione…

…By neutralizing ROS,Prdx6helps maintain cellular…

Show Full Abstract

ObjectiveThis study aimed to characterize the genetic diversity, structural variation, and functional role of the cycle inhibiting factor (Cif) in <i>Burkholderia pseudomallei</i>, with a particular focus on its involvement in neuronal infections.MethodsWe analyzed the <i>cif</i> gene (<i>bpss1385</i>) from 1294 clinical isolates of <i>B. pseudomallei</i> using phylogenetic analysis and structural modeling to identify Cif variant types. Functional characterization of selected variants was performed using plaque formation assays in SH-SY5Y neuroblastoma cells. Additionally, proteomic profiling was conducted to assess differential host protein expression in SH-SY5Y cells infected with the <i>B. pseudomallei</i> strain K96243 versus a <i>cif</i>-deleted mutant.ResultsThe <i>cif</i> gene was present in 57.7% of clinical isolates, revealing 18 distinct variant types. The wild-type variant (<i>bpss1385</i>) was the most prevalent and shared high sequence and structural similarity with most other variants. However, VT4, VT6, and VT15 displayed notable structural divergence, with VT4 exhibiting the most pronounced alterations, particularly in substrate-binding and catalytic regions. Although VT4 produced a similar number of plaques as the wild type, the plaque size was significantly smaller, suggesting reduced intracellular activity or attenuated virulence. Most other variants retained structural and functional similarity to the wild type. Proteomic analysis identified 52 differentially expressed proteins upon <i>cif</i> deletion, implicating Cif in regulating neuronal cell processes, including mRNA metabolism and cytoskeletal organization.ConclusionOur findings highlight substantial structural variation among <i>B. pseudomallei</i> Cif variants, with VT4 emerging as the most structurally distinct. Despite overall conservation in infection efficiency, VT4's reduced plaque size suggests functional consequences of its structural changes. Along with proteomic evidence of host pathway disruption, these results underscore the role of Cif in modulating host neuronal pathways and support its potential as a therapeutic target in neurological melioidosis.

HTT
Also flagged:strabismusthyroid eye diseasetumorstrokestructural muscle proteinsPLA2R1
Journal Article 2025-07-01 ✓ 1 Snippet Lee KAV, Tesdahl C, Aboobakar IF, Jain A, Martinez Sanchez M, Jin K, Oke I, Whitman MC.
In-Text Gene Mentions

…the involvement ofHTTand MARK2 in…

Show Full Abstract

<h4>Objective</h4>Despite significant evidence of a genetic contribution to strabismus, precise genetic mechanisms have not been identified. There are distinct population differences in the prevalence of strabismus and its subtypes. This study aimed to explore the genetic contributions to strabismus in different ancestral groups.<h4>Design</h4>Case-control.<h4>Participants</h4>The <i>All of Us</i> Research Program includes genotypic and phenotypic data from a diverse population of adults (age ≥18 years at time of enrollment) across the United States. Among participants with whole-genome sequences available, strabismus cases were identified based on diagnosis codes from their electronic health record. Participants with conditions associated with acquired strabismus, such as trauma, thyroid eye disease, tumor, or stroke, were excluded from the case and control cohorts. The final cohort consisted of 1579 cases and 121 490 controls of European (EUR) ancestry, 235 cases and 40 602 controls of Admixed American (AMR) ancestry, and 365 cases and 53 577 controls of African American (AFR) ancestry. Individuals of other ancestral groups were not included due to small numbers of strabismus-affected participants.<h4>Methods</h4>Genome-wide association study of common variants (minor allele frequency >1%) and rare variant association study at the gene level for strabismus.<h4>Main outcome measures</h4>Individual single nucleotide polymorphisms (SNPs) significantly associated with strabismus and genes with significant burden of rare variants in strabismus.<h4>Results</h4>Genome-wide association study identified one locus with 3 significant SNPs (rs2247113, rs2667037, and rs2715926) in intron 1 of <i>PLA2R1</i> in the AFR group, and 2 loci, one in <i>RIMBP2</i> intron (rs184071225) and one intergenic (rs191788703), in the AMR group. Rare variant association study revealed 33 genes with a statistically significant (<i>P</i> value < 5 x 10<sup>-5</sup>) increased burden of variants: 9 in the EUR cohort: <i>ZNF468</i>, <i>CMYA5</i>, <i>NSUN4</i>, <i>TEX45</i>, <i>ICAM3</i>, <i>ADAMTS20</i>, <i>FANCI</i>, <i>HLA-DQB1</i>, and <i>GRIN3B</i>; 14 in the AMR cohort: <i>RIMBP1</i>, <i>UCKL1</i>, <i>EHBP1L1</i>, <i>CLTCL1</i>, <i>HELB</i>, <i>TULP2</i>, <i>APOB</i>, <i>SMPD3</i>, <i>OBSCN</i>, <i>NLRP8</i>, <i>PLOD1</i>, <i>NUP214</i>, <i>OR6J1</i>, and <i>NOP10</i>; and 10 in the AFR cohort: <i>C4orf54</i>, <i>PIGG</i>, <i>OR10D3</i>, <i>MKNK1</i>, <i>KNCN</i>, <i>MS4A14</i>, <i>CSN2</i>, <i>BDKRB1</i>, <i>IL1RL1</i>, and <i>ISM2</i>.<h4>Conclusions</h4>Genetic associations with strabismus differed between ancestry groups, although genes in similar pathways, such as synaptic signaling and structural muscle proteins, were found in multiple groups. This highlights the importance of including diverse populations in studies of genetic associations and suggests that multiple pathways may lead to strabismus in different population groups.<h4>Financial disclosures</h4>Proprietary or commercial disclosure may be found in the Footnotes and Disclosures at the end of this article.

Also flagged:agingisoflavonedaidzeinestrogen receptor betaERβcognitive decline
Journal Article 2025-07-01 No Snippets Sekikawa A, Wharton W, Murray-Krezan C, Wu M, Chang Y, Snitz BE, Coccari M, Yang S, Love ML, Cusick D, Wang R, Li M, Park C, Li J, DeConne TM, Smith C, Verble DD, Lancet MQ, Foroud T, Kim T, Nadkarni NK, Mettenburg JM, Zamora E, Lopez OL, Hughes TM.
Show Full Abstract

<h4>Introduction</h4>Equol, a gut microbiome-derived metabolite of soy isoflavone daidzein, functions as a selective estrogen receptor beta (ERβ) agonist. In preclinical studies, it has demonstrated vascular protective and antioxidant effects, with emerging evidence suggesting potential neuroprotective properties. However, its role in preventing vascular aging and cognitive decline in humans remains unexplored. The Arterial Stiffness, Cognition, and Equol (ACE) trial investigates whether daily equol supplementation can slow the progression of arterial stiffness, brain white matter lesions, and cognitive decline in older adults without dementia.<h4>Methods</h4>ACE is a multicenter, randomized, double-blind, placebo-controlled clinical trial conducted at the University of Pittsburgh, Wake Forest University, and Emory University. Community-dwelling adults aged 65 to 85 years without dementia were enrolled and randomized 1:1 to receive either 10 mg/day of equol or placebo for 24 months. The primary outcome is arterial stiffness assessed by carotid-femoral pulse wave velocity. Secondary outcomes include white matter lesions detected on the brain magnetic resonance imaging and cognitive function as assessed by the Preclinical Alzheimer Cognitive Composite. Power calculations were based on a planned sample size of 400 participants, accounting for an anticipated 20% attrition rate.<h4>Results</h4>A total of 1783 individuals were pre-screened, and 764 underwent in-person eligibility assessment. Of these, 369 participants were randomized into two groups: Arm A (<i>n</i> = 185) and Arm B (<i>n</i> = 184). The randomized sample self-reported as 52% women and 22% Black/African American participants. Baseline demographic and clinical characteristics were well balanced between the two arms, indicating successful randomization.<h4>Discussion</h4>ACE successfully enrolled a racially diverse population of older adults and achieved near-target recruitment. ACE is the first large-scale trial to evaluate whether equol, a selective ERβ agonist, can impact vascular and cognitive aging, paving the way for precision nutrition strategies in dementia prevention.<h4>Highlights</h4>We detail the first randomized controlled trial of equol, an estrogen receptor beta (ERβ) agonist, for vascular and cognitive aging.The study tested equol's effects on arterial stiffness, white matter lesions, and cognition.The multisite trial enrolled 369 self-reported White and Black older adults aged 65 to 85 years.The trial investigated a novel dietary metabolite targeting ERβ pathways.

Also flagged:binding2,3-bisphosphoglycerateoxygenprotein tyrosine phosphatase 1BhydrogenSTING
Journal Article 2025-07-01 No Snippets Omage FB, Salim JA, Mazoni I, Yano IH, Hernández González JE, Giachetto PF, Tasic L, Arni RK, Neshich G.
Show Full Abstract

Allosteric regulation is essential for modulating protein function and represents a promising target for therapeutic intervention, yet the complex dynamics of the protein nanoenvironment hinder the reliable identification of allosteric sites. Traditional pocket-based predictors miss $\sim $18% of experimentally confirmed sites that lie outside surface invaginations. To overcome this limitation, we developed STINGAllo, an interactive web server that introduces a residue-centric machine-learning model. Using 54 optimized internal protein nanoenvironment descriptors, STINGAllo predicts allosteric site-forming residues at single-residue resolution. By integrating hydrophobic interaction networks, local density, graph connectivity, and a unique "sponge effect" metric, STINGAllo detects allosteric sites independently of surface geometry, including concave pockets, flat surfaces, or even cryptic regions. It achieves a success rate of $\sim $78% on benchmark datasets, substantially outperforming existing methods with a 60.2% overall success rate compared with 21.1%-24.2% for contemporary pocket-based predictors. Our analysis further reveals that nearly 52.7% of unique proteins in the Protein Data Bank [(PDB); 119 851 entries, 14 November 2024] contain at least one chain with a predicted allosteric site. STINGAllo accepts protein structures via PDB identifiers or custom uploads, provides interactive 3D visualization of predicted pockets, and supports integration into computational pipelines through a RESTful application programming interface. Overall, STINGAllo bridges advanced computational prediction with user-friendly design, offering a robust tool expected to deepen understanding of protein regulation and accelerate allosteric drug discovery. The server is freely accessible at https://www.stingallo.cbi.cnptia.embrapa.br/.

MLLT10
Also flagged:obesitycancerscolorectal canceresophageal adenocarcinomabreast cancerendometrial cancer
Journal Article 2025-07-01 ✓ 3 Snippets Wang S, Liu H, Yang Y, Wang Q, Zhang C, Zhang S, Gong J, Zhong R.
In-Text Gene Mentions

…rs2183271 (near geneMLLT10) for AFR-BC…

MLLT10( chr10p12.31 )…

…genes, such asMLLT10at chr10p12.31 ,…

Show Full Abstract

Fat distribution patterns are increasingly linked to obesity-related cancers; however, their shared genetic determinants remain unclear. To identify shared genetic architecture between adiposity measures and obesity-related cancers. Utilizing large-scale summary statistics from genome-wide association study, we conducted genome-wide cross trait analyses of nine adiposity measures [body mass index (BMI), waist-to-hip (WTH) ratio, waist-to-hip ratio adjusted for BMI, arm fat ratio, trunk fat ratio, leg fat ratio, abdominal subcutaneous adipose tissue, gluteofemoral adipose tissue, and visceral adipose tissue] in five obesity-related cancers (colorectal cancer, esophageal adenocarcinoma, breast cancer, endometrial cancer, and ovarian cancer) to characterize their shared genetic architecture, biological pathways, and causal relationships. Cross-trait analyses revealed extensive genomic correlations between adiposity measures and obesity-related cancers. Pleiotropic analysis identified 464 pleiotropic loci and 409 unique candidate pleiotropic genes, 128 of which replicated in the transcriptome-wide association studies analysis. Gene-level analysis revealed potential shared biological mechanisms involving the brain-derived neurotrophic factor signaling pathway, WNT/β-catenin signaling, and adipogenesis, whereas TWAS revealed their predominant expression in the digestive, nervous, and adipose tissues. Mendelian randomization analysis showed stronger associations between genetically increased BMI, WTH, and obesity-related cancers than other body fat distributions. Our study demonstrates that pleiotropic genetic determinants between adiposity and obesity-related cancers are widely distributed across the genome, reinforcing the hypothesis that adiposity increases cancer risk and revealing potential molecular pathways that may contribute to both adiposity and cancer development.

DCC
Also flagged:cancervisiontumorsegmentationtumorsGene Expression
Journal Article 2025-07-01 ✓ 1 Snippet Zhang J, Che Y, Liu R, Wang Z, Liu W.
In-Text Gene Mentions

…] also developed Subtype-DCCto identify cancer…

Show Full Abstract

Artificial intelligence (AI) excels at efficiently processing large volumes of data and extracting valuable insights. Deep Learning (DL), a subfield of AI, utilizes multi-layer neural network algorithms to analyze various types of data, mimicking the neural network architecture of the human brain. One of the most prominent features of DL is its end-to-end learning mechanism, which excels at automatic feature extraction and pattern recognition in data. As multi-omics technologies rapidly evolve, the volume of omics data from cancer samples has surged, presenting a significant challenge in managing this vast amount of information. Due to its strong data processing capabilities, DL is increasingly applied across a range of cancer research areas, such as early detection and screening, diagnosis, molecular subtype classification, discovery of biomarkers, and predicting patient prognosis and treatment responses. DL integrates high-dimensional data from fields such as genomics, epigenomics, transcriptomics, proteomics, radiomics, and single-cell omics, enhancing our understanding of cancer development and advancing personalized treatment approaches. This paper reviews various DL models and their roles in analyzing complex data patterns, providing a review of DL applications in cancer multi-omics analysis research and emphasizing its potential in early detection, diagnosis, classification, and prognosis prediction. As DL models are introduced continuously, we expect their application in cancer research to become more extensive, thus propelling the advancement of cancer medicine.

DCC
Also flagged:colon cancerproximal colon cancerdistal colon cancercolorectal cancerperitoneal carcinomatosisKRAS
Journal Article 2025-07-01 ✓ 3 Snippets Muñoz RA, Miranda FJ, Ramírez AA, Regalado D, Ortiz JC, Gallardo G, Pizarro S.
In-Text Gene Mentions

…and those withDCC.<h4>Material and methods</h4>…

…In contrast, theDCCgroup had a…

…staging, compared withDCC.…

Show Full Abstract

<h4>Introduction and aims</h4>There are differences, with genetic and embryologic support, in the clinical behavior of proximal colon cancer (PCC) (right colon: cecum, ascending colon, and transverse colon) and distal colon cancer (DCC) (left colon: descending colon, sigmoid colon, rectum). Our aim was to determine whether there was a divergent pattern in the demographic characteristics, risk factors, TNM stage, and clinical stage at diagnosis between patients with PCC and those with DCC.<h4>Material and methods</h4>A retrospective, analytic, and multicenter study was conducted. Medical records of patients diagnosed with colorectal cancer, confirmed by histopathology and with TNM staging, within the time frame of 2018-2023, were collected from two hospital centers in the city of Chihuahua. They were divided into the PCC and DCC groups, for evaluating the abovementioned characteristics.<h4>Results</h4>From a total of 513 cases, 404 were included in the study. Significant differences were found in the demographic characteristics of female sex and a history of cholecystectomy, both with a greater relative frequency for PCC. Distant metastasis was present in 35.6% of patients, despite their younger age at diagnosis. The rectum was the most commonly affected segment in the DCC group, as was the ascending colon in the PCC group. There was a greater prevalence of peritoneal carcinomatosis in the PCC group. In contrast, the DCC group had a greater prevalence of distant metastasis to other organs, as both individual metastasis (M1a) and multiple site metastasis (M1b). There were no considerable differences in the KRAS, NRAS, or BRAF gene mutations between the two groups.<h4>Conclusions</h4>PCC was associated with a history of cholecystectomy and female sex and had more aggressive TNM staging, compared with DCC.

Also flagged:SOX17pulmonary arterial hypertensionSrytranscription factorembryogenesishaematopoiesis
Journal Article 2025-07-01 No Snippets Lacoste-Palasset T, Aguado B, Grynblat J, Coulet F, Humbert M, Antigny F, Montani D, Ruffenach G.
Show Full Abstract

Pulmonary arterial hypertension (PAH) is a severe disease characterised by progressive remodelling and loss of pulmonary microvessels, driven by endothelial cell dysfunction, smooth muscle cell abnormalities, inflammation and immune system dysregulation. Recent research advancements have uncovered pathogenic rare loss-of-function variants of <i>SOX17</i> (SRY-box transcription factor 17) associated with PAH onset. <i>SOX17</i>, a member of the Sry-related high-mobility group box gene family, encodes a crucial transcription factor in embryogenesis, implicated in the formation and maintenance of endoderm, formation of the heart and vascular tree, and haematopoiesis and stem cell formation, with a strong relationship with hypoxia-inducible factors. Consistent with SOX17's pleiotropic embryogenic role, PAH patients carrying <i>SOX17</i> variants present a particular phenotype associated with congenital heart diseases, younger age, as well as thoracic and extrathoracic vascular anomalies. Genetic and fundamental evidence suggest that SOX17 deficiency is a common occurrence in other forms of PAH. SOX17 deficiency appears to be central in PAH pathophysiology, playing a core role in endothelial dysfunction, intercellular crosstalk and endothelial-to-mesenchymal transition, with differential expression in males and females. Taken together, these data suggest its role as key element of the "multiple hits" theory of PAH, both as a first and second hit and support the notion that therapies aimed at restoring or enhancing its expression may offer promising therapeutic potential for all PAH patients. In this review, we integrate the latest knowledge on SOX17 function in embryogenesis and the PAH pathogenesis to provide an in-depth perspective on SOX17 function in cardiovascular and pulmonary physiology.

HFE
Also flagged:mitochondrialferroptosisliver cirrhosisGene ExpressionMitochondria-relatedferroptosis-related
Journal Article 2025-07-01 ✓ 1 Snippet Deng P, Chaulagain RP, Oluwaseun BD, Gao F, Wang J, Gao R, Jiang X, Li F, Xu L, Xu H, Yao K, Jin S.
In-Text Gene Mentions

…ocardial infarction, ischemia,hemochromatosis, and lymphangioleiomyomatosis…

Show Full Abstract

BackgroundLiver cirrhosis represents a significant challenge to global public health. However, reliable biological markers for diagnosing liver cirrhosis are lacking in clinical practice.MethodsTranscriptome data from liver cirrhosis patients were acquired from the Gene Expression Omnibus database to identify coexpressed differentially expressed genes (DEGs). Mitochondria-related and ferroptosis-related genes were obtained from MitoCarta3.0 and FerrDB V2, respectively. Immune-related module genes were examined through Weighted Gene Co-Expression Network Analysis (WGCNA). By using WGCNA combined with machine learning methods, we identified immune-related biomarkers for liver cirrhosis. The immune cell infiltration was evaluated using CIBERSORTx, with core immune cell types further refined through LASSO regression and random forest. Hub biomarkers were validated using single-cell sequencing, with additional confirmation provided by histological staining and immunohistochemistry (IHC).ResultsThis study identified 2474 DEGs between liver cirrhosis and control groups. Intersection analysis with ferroptosis-related genes and mitochondria-related genes narrowed to 13 hub genes, from which machine learning selected 8 biomarkers. CIBERSORT and Wilcoxon tests revealed notable variations in the 12 immune cell types across the different groups. The WGCNA identified immune-related genes, with four immune-related biomarkers (<i>DHODH</i>, <i>FXN</i>, <i>CS</i>, and <i>ISCU</i>) identified as hub biomarkers. Integrated LASSO regression, random forest, and immune infiltration analyses pinpointed the core cells influencing disease progression. The relationship between the hub biomarkers and immune cells was validated by single-cell data analysis. <i>ISCU</i> expression was verified through IHC, consistent with our bioinformatics findings. Molecular docking identified three small molecules with potential effectiveness.ConclusionOur study identified mitochondrial ferroptosis-related genes (<i>DHODH, FXN, CS,</i> and <i>ISCU</i>) as pivotal biomarkers in liver cirrhosis progression and demonstrated a close connection with the immune microenvironment. These genes may serve as diagnostic indicators and therapeutic targets, thereby providing novel perspectives on the pathogenesis of liver cirrhosis.

DCC
Also flagged:Extracellular VesiclesMetabolismvesiclesextracellularnitrogenmembrane
Journal Article 2025-07-01 ✓ 1 Snippet Mun D, Ryu S, Choi HJ, Kang AN, Lim DH, Oh S, Kim Y.
In-Text Gene Mentions

…milk-derived EVs toC57BL/six micemice for 8…

Show Full Abstract

Extracellular vesicles derived from milk are known to play a significant role in regulating gut microbiota. However, few studies have focused on the effects of these vesicles on specific bacterial species. This study aimed to investigate how bovine colostrum-derived extracellular vesicles (BCEVs) affect the growth and viability of commensal bacteria, specifically <i>Akkermansia muciniphila</i>. BCEVs and <i>A. muciniphila</i> were co-cultured to measure growth rates using spectrophotometry, and cell viability was assessed at the endpoints. Additionally, to determine whether BCEVs enhance the survival of <i>A. muciniphila</i> in the presence of Caco-2 cells, an anaerobic co-culture experiment was conducted to determine the specific interaction between intestinal epithelial cells and gut microbiota using a Transwell system. The results showed that co-culture with BCEVs increased the growth rate and viability of <i>A. muciniphila</i>. Consistent with this, increased viability of <i>A. muciniphila</i> was observed when it was co-cultured with Caco-2 cells. Transcriptomic analysis revealed that BCEVs regulate nitrogen metabolism in <i>A. muciniphila</i>, enhancing the growth rate and viability. Thus, regulating beneficial gut bacteria, such as <i>A. muciniphila</i>, through BCEVs presents a novel biological approach that positively impacts human health.

Also flagged:diabetes mellitusDiabetic neuropathyDNdiabetessensory-motor neuropathyautonomic neuropathy
Journal Article 2025-07-01 No Snippets Mansouri V, Rezaei-Tavirani M, Okhovatian F.
Show Full Abstract

<h4>Introduction</h4>Diabetes mellitus is a chronic disease caused by insulin uptake or deficiency. Side effects of diabetes are numerous, according to the severity of the disease. Diabetes could harm the peripheral nerves, with chronic pain leading to nerve damage known as diabetic neuropathy (DN). Signs and symptoms of DN are sharp pains, numbness, and tingling. Distal symmetric polyneuropathy is the most common nerve injury during DN. Accordingly, this study screens candidate genes related to sural nerve DN (SDN) to find the critical ones.<h4>Methods</h4>Gene expression data from diabetic patients with and without progressive sural nerve neuropathy (GSE24290) were included in the analysis. GEO2R was applied to the first step analysis to find the significantly differentially expressed genes (DEGs). The queried significant DEGs, along with their first 100 neighbors, were included in a network using the Cytoscape software. The network was analyzed using the Cytoscape network analysis application, and the central nodes were identified.<h4>Results</h4>A total of 26 significant DEGs that were extracted from the gene expression profiles, plus 100 first neighbors, were interacted to form the network. <i>INS</i>, <i>ALB</i>, <i>AKT1</i>, <i>APP</i>, <i>SNAP25</i>, <i>NEFL</i>, <i>GFAP</i>, <i>IL6</i>, <i>NEFM</i>, <i>TNF</i>, <i>MAPT</i>, <i>GAP43</i>, and <i>MBP</i> were identified as 13 hubs of the network. <i>NEFL</i> and <i>NEFM</i> were highlighted as the queried hub genes. Insulin, as the top hub node, was determined among all interacted genes (the queried and added genes).<h4>Conclusion</h4><i>INS</i>, <i>NEFL</i>, and <i>NEFM</i> are key genes in DN, which are involved in metabolism regulation and intracellular transportation into axons and dendrites, respectively.

Poster Abstracts

HFE
Also flagged:LDHHburticariaagglutininhemagglutinationantibodies
Journal Article 2025-07-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…treat conditions likehemochromatosis, polycythemia vera, and…

Show Full Abstract

No abstract available.