Gene Literature Dashboard

Viewing May 2026 — 706 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← April 2026 June 2026 →
Also flagged:bindingvesiclestranslationalmucustransductiontumor
Journal Article 2026-05-31 No Snippets Walther T, Dalaka E, Fläschner G, Gómez-González M, Platzman I, Pashapour S, Emmert M, Roca-Cusachs P, Trepat X, Göpfrich K.
Show Full Abstract

Hydrogel microparticles (HMPs) are powerful tools to study and manipulate cellular behavior in 3D cell culture systems and animal models. Here, fully DNA-based HMPs are presented, whose material properties can be precisely tuned by sequence-programmable design of self-assembling DNA nanostructures. These DNA-HMPs offer control over size, stiffness, viscoelasticity and ligand presentation. They are formed by microfluidic encapsulation of two types of orthogonal DNA nanostars and a sequence-complementary DNA linker in water-in-oil droplets. By varying the valency of the DNA nanostar designs, tunable mechanical properties are achieved - spanning three orders of magnitude in Young's modulus from 30Pa$30 \,\mathrm{Pa}$ to 6.5kPa$6.5 \,\mathrm{k}\mathrm{Pa}$ with distinct viscoelastic behavior. Click-chemistry based functionalization with the small fibronectin-derived peptide cyclic-RGD (c[RGD]) enables integration into fibroblast spheroids. DNA-HMPs are stably retained within the spheroids for several days and undergo remodeling, indicating active interactions between the cells and the DNA-HMPs. Combining programmable material properties and inherent biocompatibility of DNA with straightforward functionalization and stimuli-responsiveness, these DNA-HMPs represent a versatile tool to probe and manipulate tissue behaviors in 3D cell cultures.

Also flagged:osteoarthritistransductionextracellularsynthesisdigestionpore
Journal Article 2026-05-31 No Snippets van Mourik M, Spierings J, Koca P, Abinzano F, Addario G, van Donkelaar CC, Ito K, Foolen J.
Show Full Abstract

Providing a functional pericellular matrix (PCM) by fine-tuning the microenvironment of the articular chondrocytes (ACs) can greatly improve the outcomes of articular cartilage tissue engineering. While harvesting ACs with their PCM (chondrons) results in a low cell yield and a heterogeneous mixture of ACs and chondrons, microscale hydrogels could be used for mechanical tuning of the cell microenvironment. This may enable the use of stiffer bulk materials, improving the load-bearing capacity of the construct. This study investigates the effect of microenvironmental stiffness, independent of total construct stiffness, on the regenerative performance of ACs (ECM and PCM synthesis). Additionally, we explored articular cartilage-derived progenitor cells (ACPCs) as a possible alternative to ACs in the presented system. ACs were cultured in a soft or stiff bulk hydrogel (GelMA) or were encapsulated in soft microgels and seeded into the stiff GelMA. Constructs were seeded in an ex vivo porcine chondral defect model and cultured for 28 days with dynamic mechanical stimulation using a compression-sliding bioreactor. PCM and ECM quality were assessed through cell content analysis, immunofluorescent staining, histology, and measurements of GAG and collagen content. Cell encapsulation influenced ECM synthesis and PCM amount and completeness throughout the construct. Although the nonencapsulated groups showed stronger overall alcian blue staining, the encapsulated groups demonstrated more uniform matrix deposition throughout the depth of the tissue. Furthermore, ACPCs performed similarly to ACs. These findings suggest that the approach to differentially tune encapsulating and bulk hydrogel properties holds potential for future articular cartilage tissue engineering, and that ACPCs could be used as an alternative cell source.

SERPINC1
Also flagged:alcohol-associated liver diseasecognitionCognitive impairmentCImild cognitive impairmentdementia
Journal Article 2026-05-31 ✓ 5 Snippets Miarka M, Golenia A, Olejnik P, Grusiecka-Stańczyk M, Małyszko J, Raszeja-Wyszomirska J, Zalewska M.
In-Text Gene Mentions

…AlthoughACE-IIIis not a…

…BecauseACE-IIIperformance is influenced…

ACE-IIIwas selected because…

…MeanACE-IIItotal scores were…

…Using previously appliedACE-IIIthresholds, scores suggestive…

Show Full Abstract

<b>Background</b>: Cognitive impairment is increasingly recognized as a clinically relevant outcome in transplant medicine. We compared multidomain cognitive performance between kidney transplant (KTx) and liver transplant (LTx) recipients and explored etiology-specific differences within the LTx cohort using a standardized cognitive assessment. <b>Methods</b>: This single-center cross-sectional study included 180 adult transplant recipients, 90 KTx and 90 LTx recipients, stratified into alcohol-associated liver disease (ALD; <i>n</i> = 25) and non-ALD etiologies (<i>n</i> = 65). Cognitive performance was assessed using Addenbrooke's Cognitive Examination III (ACE-III). Median time since transplantation was 3.3 months in KTx recipients, 69.2 months in non-ALD LTx recipients, and 17.2 months in ALD LTx recipients. Group differences were analyzed using nonparametric tests with Holm correction, and independent predictors of global cognition were evaluated using multivariable linear regression adjusted for age, education, and time since transplantation. <b>Results</b>: Global cognitive performance differed modestly across groups, with mean ACE-III scores of 90.3 ± 8.7 in KTx, 89.3 ± 6.5 in non-ALD LTx, and 86.9 ± 12.5 in ALD LTx recipients (overall <i>p</i> = 0.047), although no pairwise differences remained significant after Holm correction. However, the relatively small ALD subgroup may have limited statistical power and may have led to underestimation of clinically relevant between-group differences. ACE-III scores ≤ 89 occurred in 30.0%, 47.7%, and 48.0% of participants, respectively, whereas scores < 82 were observed in 13.3%, 12.3%, and 20.0%. Verbal fluency was the lowest-performing domain across groups. Higher education and younger age independently predicted better cognitive performance; time since transplantation was not independently associated with cognitive outcome. <b>Conclusions</b>: Cognitive performance appeared broadly comparable across KTx and LTx recipients, but this finding should be interpreted cautiously given differences in post-transplant follow-up and potential residual confounding. Clinically relevant cognitive vulnerability was common across all groups, supporting structured multidomain assessment and longitudinal studies using harmonized methods.

OLFM4
Also flagged:fermentationdigestionmetabolismHEgene expressionmembrane
Journal Article 2026-05-31 ✓ 1 Snippet Li W, Murphy B, Larsen A.
In-Text Gene Mentions

…, LYSB ,OLFM4, CYTB ,…

Show Full Abstract

Nutritional studies in the cattle typically focus on the rumen and its microbial environment, leaving other parts of the gastrointestinal (GI) tract largely unexplored. Thus, underlying molecular mechanisms and the responses to dietary treatment in the lower gut is poorly understood. In this study, we investigated the caecum transcriptome changes and its associated microbial communities in calves with or without artificially dosed rumen content extracted from an adult cow. Eight calves were included in the study, four received artificially dosed adult rumen content (Treated) and the rest received autoclaved rumen content as a control. We observed significant transcriptome changes in the caecum between treatments, with 1,836 differentially expressed genes (DEGs) identified. A predominant portion of the DEGs were down-regulated in the treated group, which showed significant enrichment for molecular pathways related to immune response, host response to pathogens, and inflammatory responses. For the DEGs correlated with the highest number of microbes, gene ontology analysis indicated an enrichment in pathways associated with inflammation and immune response. By comparing the microbial taxa abundance among different GI tissues collected from the same study, we observed that the same dosing strategy may lead to differential retention of the microbial community in different GI tract locations. Our work indicated that the hind gut showed robust response to artificial dosing and the caecum microbial community may interact extensively with the host to shape the development and maturity of the host immune system in early life. Furthermore, our analysis suggested that tissue-specific analysis is required to fully understand the impact of early dosing on animal performance and physiology.

Also flagged:viremiaacute diseaseAfrican swine feverviral diseasevirionviral
Journal Article 2026-05-31 No Snippets Truong AD, Nguyen HTT, Chu NT, Nguyen LP, Dam KQ, Vo LTH, Nguyen TD, Choi SA, Kim SH, Lee JH, Moon SC, Sur JH, Tran HTT, Dang HV.
Show Full Abstract

Recombinant genotype I-II African swine fever virus (ASFV) strains with high virulence have been increasingly reported in China and Vietnam since 2023, raising significant concerns for disease control. In this study, we characterized the hematological, virological, pathological, and immunological dynamics in ASFV-inoculated pigs, with particular emphasis on temporal changes associated with mortality following the onset of viremia. Specific-pathogen-free pigs were intramuscularly inoculated with 1 × 10<sup>3</sup> or 1 × 10<sup>5</sup> HAD<sub>50</sub>/mL of ASFV LS100 virus strain and developed acute disease characterized by high fever and severe hemorrhagic manifestations. The incubation period ranged from 3 to 5 days, with mortality occurring between 6 and 10 days post-inoculation (dpi). Viral genomic DNA was detected in blood, oral swabs, and rectal swabs as early as 2-4 dpi. Pathological examination revealed prominent necrotic skin lesions and joint swelling. Although hematological parameters and serum biochemical profiles were comparable between high- and low-dose groups, differences in viral load distribution were observed. Notably, cytokine profiling in whole blood revealed a strong and persistent upregulation of pro-inflammatory mediators, including IL-1β, IL-6, IL-12p40, TNF-α, IFN-γ, CCL2, CCL3, CCL14, CXCL9, and CXCL10, which correlated with persistent fever from 2 to 7 dpi. Collectively, these findings confirm that naturally occurring recombinant genotype I-II ASFV strains are highly virulent and capable of inducing severe systemic inflammation. Their continued circulation poses substantial challenges for ASF control and prevention in Vietnam and threatens the global swine industry.

HFE
Also flagged:torsiontesticular tumorsreflextesticularabscesstesticular ischemia
Journal Article 2026-05-31 ✓ 2 Snippets Chen A, Jernigan J, Allamiaghmiouni L, Hazim M.
In-Text Gene Mentions

…2 diabetes mellitus,hemochromatosis, and prior non-Hodgkin…

…non-Hodgkin lymphoma andhemochromatosis, chronic thrombocytopenia can…

Show Full Abstract

Testicular torsion is a urological emergency that requires prompt recognition and intervention. Although it most commonly affects two age groups, including neonates and adolescents, it can occur at any age. Risk factors to consider include anatomic abnormalities, trauma, testicular tumors, and family history. Typical clinical presentation involves an acute onset of severe scrotal pain, a high-riding testicle, and an absent cremasteric reflex. We report an unusual case of a 63-year-old man who presented with a two-week history of progressive scrotal pain and swelling and was found to have concurrent testicular torsion and a large scrotal abscess. This atypical and delayed presentation highlights the diagnostic challenges of testicular torsion in older adults.

ABT1
Also flagged:Diabetic Retinopathychromatinchromosomediabetes mellitusvisionblindness
Journal Article 2026-05-31 ✓ 1 Snippet Luo R, Yu X, Huang C, Tan S, Tseng Y, Feng Y, Li X.
In-Text Gene Mentions

…variant, rs13198716 nearABT1, showed a…

Show Full Abstract

No abstract available.

bioRxiv 2026-05-31 Preprint (No Snippets API) Urquhart K, Alia A, Chen H, Jayathilaka L, Lam C, Janson C, Romanova L.
Show Full Abstract

<h4>ABSTRACT</h4> The leptomeninges (arachnoid and pia) are the inner layers of the meninges that envelope the brain. They define the borders of the subarachnoid space (SAS) where cerebrospinal fluid (CSF) circulates. Leptomeninges act as the barrier tissue and contribute to fluid exchange and immune function of the brain. These processes are identified as key factors in the development of neurodegenerative diseases. The extracellular matrix (ECM) is a critical structural component of leptomeninges. However, it remains insufficiently characterized in health and disease. Here, we performed complete proteomic profiling of ECM proteins (matrisome) of human leptomeninges from individuals with Alzheimer’s disease (AD) and cognitively normal controls (CN) using sequential biochemical fractionation coupled with mass spectrometry. We resolved leptomeningeal matrisome based on the biochemical properties reflected by the protein solubility. This approach identified 211 ECM proteins in human leptomeninges and revealed disease-associated shifts in leptomeningeal solubility consistent with altered matrix organization and signaling. We found that ECM-linked regulators and secreted factors extracellular sulfatase SULF2, antithrombin-III (SERPINC1), secreted frizzled-related protein 3 (sFRP3) and integrin beta-5 (ITGB5), which is a receptor for fibronectin, were differentially expressed in AD leptomeninges based on the disease status. Seven ECM proteins were identified only in AD samples, and two ECM proteins in CN samples. Pathway enrichment implicated TGF-β and Wnt-related signaling and coagulation as critical for leptomeningeal function. Our findings provide the first comprehensive proteomic characterization of the human leptomeningeal matrisome and establish a biochemical framework for investigating how meningeal matrix remodeling contributes to AD.

bioRxiv 2026-05-31 Preprint (No Snippets API) Bombin A, Martin-Jimenez C, Yan S, Saggu S, Liu W, Gonzalez-Giraldo Y, Dew E, Zhou F, Wu H, Du Q, Lee TJ, Sharma A, Zhang W, Shi H, Jiao K, Wang Q.
Show Full Abstract

Chronic stress induces structural and functional changes in the brain, increasing susceptibility to major depressive disorder and other mental illnesses. Myelination deficits are a key pathological feature of stress-related disorders, yet the molecular mechanisms linking chronic stress to oligodendrocyte dysfunction remain poorly understood. Here, we used single-nucleus multiome sequencing to map gene expression and chromatin-accessibility remodeling in the hippocampus of mice exposed to chronic unpredictable mild stress (CUMS), a model that simulates key features of human daily stressors. CUMS induced broad molecular reprogramming across hippocampal cell populations, with stress-responsive gene networks significantly enriched for depression-associated genes. The oligodendrocyte lineage showed heightened vulnerability, with CUMS preferentially disrupting immature OPC/intermediate states and impairing OPC migration, OPC-to-ODC lineage progression, intercellular communication, and myelination. Integrated multiomic analysis identified stage-specific cis-regulatory elements and stress-sensitive gene regulatory networks, converging on SOXD transcription factors, particularly SOX5 and SOX6, as key regulators of OPC dysfunction. SOX6 ChIP-seq confirmed direct SOX6 binding at regulatory elements associated with genes controlling OPC morphogenesis, migration, and glutamatergic signaling. CUMS reduced SOX6 protein levels and SOX6-associated regulatory network activity in OPCs, whereas OPC-specific enhancer-driven restoration of SOX6 rescued stress-induced defects in OPC migration and myelination. Together, these findings define a stress-sensitive SOXD/SOX6 regulatory mechanism linking chronic stress to oligodendrocyte lineage dysfunction and myelination deficits, identifying SOX6 as a functional regulatory node with therapeutic potential for stress-related brain pathology.

Also flagged:chromatinAMLlocalizationcell cyclecanceracute myeloid leukemia
Journal Article 2026-05-30 No Snippets Zeng L, Lei H, Bi J, Run G, Yu B, Ji L.
Show Full Abstract

<h4>Purpose</h4>Acute Myeloid Leukemia (AML) is driven by complex interactions between genetic mutations and epigenetic dysregulation. While alterations in chromatin modifiers are frequent, the precise downstream transcriptional networks they enable and how these networks execute the leukemogenic program remain incompletely defined.<h4>Methods</h4>We employed an integrative bioinformatics strategy. Transcriptomic data from GSE84881 (AML stromal cells) and GSE9476 (AML blasts) identified differentially expressed genes, refined via GeneCards and CellMarker to a 32-gene AML signature. Functional enrichment (GO/KEGG) and protein-protein interaction (PPI) network analyses followed. Core hubs were validated for spatial (single-cell t-SNE) and subtype-specific expression using the Hematologic Malignancy database. Perturbation analysis (GPSAdb2.0 BioTrigger) expanded the network, with pathway enrichment on responsive genes.<h4>Results</h4>The 32-gene signature enriched strongly in hematopoietic differentiation and unexpectedly in cross-lineage developmental pathways (e.g., gland, epithelial development). PPI topology revealed nine hubs: AFF1, TAL1, IKZF1, GATA1, NOTCH1, BCL2, IL1B, IRF4, ZAP70. Single-cell t-SNE showed distinct, non-overlapping localization patterns among AML subpopulations; box plots demonstrated marked expression heterogeneity across 26 molecular subtypes. Perturbation of these hubs generated a 500-gene set whose KEGG enrichment highlighted three interconnected layers: (i) Polycomb repression and ATP-dependent chromatin remodeling (epigenetic gatekeepers), (ii) FoxO signaling, cell cycle, and senescence (core oncogenic pathways), and (iii) broad cancer hallmarks including endocrine resistance and diverse solid tumor pathways.<h4>Conclusion</h4>We propose a hierarchical pathomechanism: synergistic dysfunction in chromatin remodeling and Polycomb-mediated repression establishes a permissive epigenomic landscape, enabling activation of an oncogenic transcriptional network (centered on AFF1, TAL1, IKZF1, GATA1). This network then hijacks TP53/FoxO signaling to drive cell cycle escape, apoptosis resistance, and metabolic adaptation. Our findings unify disparate molecular lesions into a coherent axis and suggest new therapeutic nodes.

Also flagged:Cancermitochondrialtumorbiosynthesisredox homeostasismetabolism
Journal Article 2026-05-30 No Snippets de Souza I, da Silva Teixeira AB, Ferreira Dos Santos A, Friedmann Angeli JP, Ribeiro Reily Rocha C.
Show Full Abstract

The NRF2 pathway has emerged as a central regulator of cellular redox homeostasis, coordinating the expression of a broad array of genes that protect cells from oxidative and electrophilic stress. In the context of cancer, NRF2 has been recognized as a key driver of chemoresistance, as its sustained activation enhances antioxidant defenses, detoxification pathways, and metabolic adaptation, thereby promoting tumor cell survival under therapeutic stress. Beyond its canonical role in redox regulation, NRF2 also orchestrates the expression of multiple genes involved in ferroptosis, a non-apoptotic, iron-dependent form of cell death that has recently gained attention as a promising strategy to overcome drug resistance. Mechanistically, NRF2 modulates ferroptosis through several interconnected pathways, including the regulation of glutathione biosynthesis, lipid metabolism, and iron homeostasis, yet its impact is highly context-dependent and can vary according to cell type and metabolic state. In this review, we provide an overview of the interplay between NRF2 and ferroptosis, tracing the historical development of this network and highlighting the pivotal roles of specific NRF2 targets in controlling ferroptotic susceptibility. Finally, we discuss how targeted modulation of NRF2 may influence ferroptosis, offering a potential avenue for the design of innovative therapies aimed at selectively eradicating resistant tumors.

Also flagged:breast cancergene expressioncancercancersinvasive breast carcinomacell proliferation
Journal Article 2026-05-30 No Snippets Ping J, Jia G, Cai Q, Guo X, Wang J, Tao R, Li B, Bauer JA, Xie Y, Ambs S, Barnard ME, Chen Y, Choi JY, Gao YT, Garcia-Closas M, Gu J, Hu JJ, Iwasaki M, John EM, Kweon SS, Li CI, Matsuda K, Matsuo K, Nathanson KL, Nemesure B, Olopade OI, Pal T, Park SK, Park B, Press MF, Sanderson M, Sandler DP, Yao S, Zheng Y, Ahearn T, Brewster AM, Falusi A, Hennis AJM, Ito H, Kubo M, Lee ES, Makumbi T, Mapoko BSE, Noh DY, O'Brien KM, Ojengbede O, Olshan AF, Park MH, Reid S, Yamaji T, Zirpoli G, Butler EN, Huang M, Low SK, Obafunwa J, Weinberg CR, Zhang H, Zhao H, Ambrosone CB, Cote ML, Huo D, Haiman CA, Kang D, Palmer JR, Troester MA, Shu XO, Long J, Zheng W.
Show Full Abstract

Genome-wide association studies (GWAS) have identified over 200 genetic risk loci for breast cancer, yet their target genes remain largely unknown. We conduct multi-ancestry transcriptome-wide association studies (TWAS) to discover potential breast cancer susceptibility genes. We develop ancestry-specific genetic models to predict levels of gene expression, alternative splicing, and 3' UTR alternative polyadenylation using genomic and transcriptomic data from 652 normal female tissue samples and apply these models to GWAS data of 178,534 cases and 248,300 controls for association analyses. We identify 290 genes associated with breast cancer risk, including 103 previously unreported and 46 not located at known GWAS loci, and 39 genes show distinct associations with breast cancer risk by estrogen-receptor status. Single-cell RNA sequencing and in vitro experiment data provide additional functional evidence for 169 genes. These genes are enriched in pathways implicated in breast carcinogenesis. Our study uncovers insights into breast cancer genetics and biology.

Also flagged:Antimicrobialinfectionspneumoniaurinary tract infectionsmetabolismbloodstream infections
Journal Article 2026-05-30 No Snippets Agnihotri SN, Fatsis-Kavalopoulos N, Vikdahl E, Windhager J, Corbat AA, Andersson DI, Tenje M.
Show Full Abstract

Heteroresistance (HR) is an antibiotic resistance phenotype characterized by the presence of rare resistant subpopulations (frequency ≈ 10<sup>-7</sup> to 10<sup>-4</sup>) within a main susceptible bacterial population. During antibiotic exposure, these subpopulations can be enriched and cause treatment failure. Standard antibiotic susceptibility testing (AST) often fails to detect HR, and the current gold-standard population analysis profile (PAP) test is labor-intensive and time-consuming. We present a digital phenotyping approach combining droplet microfluidics with image texture to detect HR from clinical isolates, including Gram-negative (Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii) and Gram-positive (Staphylococcus aureus) bacteria isolated from bloodstream infections. Our method achieves detection at subpopulation frequencies as low as 10<sup>-6</sup> in 12 to 30 h, depending on bacterial species, which is faster than the PAP test, together with single-cell resolution and high-throughput. This computationally assisted microfluidic platform enables rapid and accurate identification of HR, representing a step toward targeted antibiotic therapy in critical infections.

Also flagged:deficiencysecretionendocytosiscytoskeletonmetabolismcell cycle
Journal Article 2026-05-30 No Snippets Zhou X, Xia J, Chen W, Zou J, Chen J, Zhang X.
Show Full Abstract

<h4>Background</h4>Adaptation is one of the key processes of animal domestication, environmental pressures will leave footprints in the genome. Geese are widely distributed across multiple geographical conditions with distinct adaptations. However, few reports have focused on the environmental adaptability of geese. Moreover, the key environmental drivers that trigger local adaptation and its genetic mechanisms are still unknown. To this end, 35 agro-climatic variables of 257 geese from 14 Chinese breeds were obtained, the key environmental drivers and its genetic mechanism were elucidated by combining the genome data.<h4>Results</h4>Five key environmental drivers, elevation, water scarcity (BIO14), two variables as proxies of food availability (Grass and Landuse), and one variable as proxy of disease resistance (Forest) were identified after dissecting 35 agro-climatic variables by using ecological niche modeling (ENM). Integrating five key environmental drivers with single-nucleotide polymorphism variations, we conduct genome-wide selection signature analyses and genome-environment analysis. This analysis identified 1984 key genes likely integral to the environmental adaptation and mainly enriched in MAPK signaling pathways and metabolic pathways. Allele frequency distribution and selective sweep analysis revealed that some genes play crucial roles in environmental adaptation, including SATB1, NTRK2 and CTIF involved in adapting to the high-altitude hypoxic environments; ARMH3 and BDH2 participated in adapting to water deficiency; COL5L1, ULK4 and PI4KA associated with disease resistance, and other genes involved in metabolic adaptations including IQSEC1, TBC1D14, GRK5, FGGY and LRP1B, etc. Notably, we noticed that feather colour differentiation in geese might be driven by human agricultural practices, with LRP1B involved in this process.<h4>Conclusions</h4>Overall, our study elucidated the five key environmental drivers and their genetic mechanisms. The candidate genes related to environmental adaptability offer new insights into genetic resource development and breeding strategies of Chinese indigenous geese.

ZNF644
Also flagged:gene expressionmaniaanxietysomatizationmembranebipolar disorder
Journal Article 2026-05-30 ✓ 1 Snippet Qiao MX, Wei W, Zhou M, Li ML, Zhang YM, Li XJ, Deng W, Guo WJ, Wang Q, Yu H, Li T.
In-Text Gene Mentions

…T-values, most stronglyZNF644( r =…

Show Full Abstract

<h4>Background</h4>Bipolar disorder (BD) is a highly heritable condition characterized by recurrent shifts between manic and depressive states. Here we investigated the potential involvement of the habenula because it plays a central role in negative affect and behavioral regulation.<h4>Methods</h4>We investigated bilateral habenular volume and seed-based resting-state functional connectivity in a discovery cohort (78 BD, 102 controls) and an independent replication cohort (72 BD, 85 controls). Associations among habenular features, clinical symptoms, and molecular correlates were examined by integrating pathway-specific polygenic risk scores and brain-wide gene expression data from the Allen Human Brain Atlas.<h4>Results</h4>Across both cohorts, BD was associated with reduced bilateral habenular volume and increased rs-FC between the habenula and right precentral gyrus. Habenular volume correlated positively with severity of mania symptoms and negatively with severity of symptoms of anxiety and somatization. Polygenic risk scores linked the altered volume to dopaminergic pathways and altered connectivity to serotonergic pathways, while transcriptomic data linked the altered connectivity to changes in expression of synaptic membrane structures, transporter complexes, and other proteins involved in synaptic transmission.<h4>Conclusions</h4>Structural, functional and transcriptomic data identify the habenula as a critical neural hub in BD and therefore important for understanding pathogenesis and clinical manifestations.<h4>Clinical trial number</h4>Not applicable.

HFE
Also flagged:Aplastic anemiaAAhematological disorderpancytopeniaFanconi anemiahematopoietic malignancies
Journal Article 2026-05-30 ✓ 1 Snippet Itagaki M, Kuwazawa H, Sasaki S, Matsuura M, Tanaka Y, Obara N.
In-Text Gene Mentions

…development, and secondaryhemochromatosisdue to chronic…

Show Full Abstract

This all-case post-marketing surveillance study in Japan evaluated the safety and effectiveness of romiplostim, a thrombopoietin receptor agonist, in patients with aplastic anemia (AA), a rare disease characterized by pancytopenia. All patients with refractory AA who initiated romiplostim from June 2019 to September 2021 were registered. Romiplostim was administered subcutaneously once weekly for 52 weeks. Observation lasted 52 weeks or until 4 weeks after discontinuation. Occurrences of bone marrow fibrosis and hematopoietic tumors were monitored for up to 2 years after romiplostim initiation. Data from 470 patients at 220 institutions were analyzed. The mean age ± standard deviation was 66.27 ± 16.89 years, and 43.40% were male. Romiplostim was discontinued in 219/470 patients (46.60%). Adverse events (AEs) occurred in 57.02% of patients, and adverse drug reactions (ADRs) occurred in 18.09%. AEs of special interest classified as ADRs included thromboembolism (1.49%), hematopoietic tumor (1.28%), and hemorrhage (0.46%). During follow-up, hematopoietic tumors as ADRs were observed in 2/310 patients (0.65%). Hematological response was achieved in 257/327 patients (78.59%) at 27 weeks and 205/244 patients (84.02%) at 52 weeks. Platelet transfusion independence or reduced requirement was achieved in 164/213 patients (77.00%) at 27 weeks and 133/160 patients (83.13%) at 52 weeks, while red blood cell transfusion independence or reduced requirement was achieved in 194/247 patients (78.54%) and 162/186 patients (87.10%), respectively. Long-term romiplostim treatment was safe and effective in patients with refractory AA in a real-world setting. Registration: University Hospital Medical Information Network (UMIN000056465), 16 December, 2024.

SERPINC1
Also flagged:Extracellular vesiclesepsisextracellularvesiclesmembraneinfections
Journal Article 2026-05-30 ✓ 1 Snippet Chiang DM, Pfaffl MW, Schelling G, Meidert AS, Brandes F, Ludwig C, Wudy SI, Kirchner B, Yu MSC, Zenner C, Ulbricht R, Muller L, Reithmair M.
In-Text Gene Mentions

…SERPINA1, IQGAP1, IQGAP2,SERPINC1, C1QC, ORM1, C1QB,…

Show Full Abstract

Sepsis accounts for nearly 20% of global mortality, with antibiotic resistance worsening clinical outcomes. Rapid antibiotic administration and accurate pathogen identification remain crucial. It is well now known that extracellular vesicles (EVs) from human cells and bacterial membrane vesicles (bMVs) play a central role in the interaction between host and pathogen and represent promising biomarkers for early infections. This study investigated how antibiotic exposure alters EV responses in Staphylococcus aureus (SA)spiked blood and compared these findings with EV proteome profiles from bacteremia patients. In an in vitro model, whole blood from healthy donors was spiked with SA at a multiplicity of infection (MOI) of 0.001, treated with clinically relevant concentrations of piperacillin-tazobactam, vancomycin, or moxifloxacin, and plasma was subsequently isolated for EV analysis. EVs were isolated using the Miltenyi Pan EV Kit and analyzed by bead-based flow cytometry and high-resolution LC-MS/MS. In parallel, serum EVs from healthy controls (n = 6) and bacteremia patients (n = 12; 6 blood culture-positive and 6 culture-negative) were analyzed using the same workflow. Flow cytometry revealed increased levels of CMO⁺ CD45⁺ PanEV⁺ SA⁺ vesicles in SA-spiked samples, particularly following low-dose piperacillin-tazobactam and high-dose vancomycin treatment, despite minimal changes in vesicle size and total particle counts. Proteomic analysis of plasma EVs showed significant alterations in protein composition, including increased abundance of the SA-derived ribosomal protein rplU and host defense-associated proteins. Functional enrichment highlighted pathways related to neutrophil degranulation, vesicle-mediated transport, and antibacterial responses. In patient samples, serum EVs were enriched in acute-phase and immune-related proteins, including SERPINA1, SERPINA3, CRP, and SAA2, along with canonical EV markers such as CD81 and syntenin-1, irrespective of blood culture status. Antibiotic exposure and SA infection are associated with measurable changes in the human EV proteome, characterized by enrichment of immune and host defense-related proteins despite stable vesicle numbers. Similar EV-associated protein patterns were observed in both blood culture-positive and -negative patient samples, reflecting shared features of the systemic host response to infection and highlighting the potential of EV profiling to capture infection-associated biological signals.

POU3F2
Also flagged:Cell Killingbindingcell-cell surfaceneurogenesiscell division
Journal Article 2026-05-30 ✓ 1 Snippet Hayashi Y, Matsumoto J, Sumaru K.
In-Text Gene Mentions

…expression of BRN2 (POU3F2) and reelin, which…

Show Full Abstract

<h4>Introduction</h4>Microenvironmental heterogeneity in cultured cells can compromise cell quality, reduce experimental reproducibility, and weaken the confidence of cell therapeutic efficacy. Although micropatterned cell cultures are more homogeneous, conventional micropatterning methods lack flexibility.<h4>Methods</h4>We develop a micropatterning technology by denaturing extracellular matrix (ECM) proteins in specific areas through heat inactivation using a high-speed laser via a light-responsive polymer layer. We have successfully seeded human induced pluripotent stem cells (hiPSCs) in flexible patterns and examine their neural induction in circular geometries of varying diameters.<h4>Results</h4>Size-dependent and cell-autonomous neural structures are formed on this substrate when hiPSCs differentiate into neural lineages in circles of different diameters. This self-organized pattern results from the mitotic orientation and localization of differentiating cells. Furthermore, teratogenic substances can modulate these patterns.<h4>Conclusions</h4>Laser-induced heat inactivation of ECM on culture substrates enables lithography-, hydrogel-, and PDMS-free micropatterning, facilitating on-demand regulation of cell-autonomous tissue formation, the effect of teratogenic substances, and precise tissue engineering in regenerative medicine.

Also flagged:infectionsneurological diseaseencephalitismeningitisacute flaccid paralysispathogenesis
Journal Article 2026-05-29 No Snippets Revel J, Leroy J, Delbecq S, Constant O, Henry Marty F, Naili C, Barthès A, Nagy A, Schmidt-Chanasit J, Cadar D, Abd Rahaman NY, Lajoix AD, Desmetz C, Simonin Y.
Show Full Abstract

West Nile virus (WNV) and Usutu virus (USUV) are neurotropic orthoflaviviruses of the <i>Flaviviridae</i> family, transmitted primarily by <i>Culex</i> mosquitoes and maintained in enzootic cycles involving birds. While WNV is a well-established human pathogen causing hundreds of neuroinvasive cases annually in Europe, USUV has emerged more recently, with fewer documented human infections but increasing evidence of neurovirulence. The viral nonstructural protein 1 (NS1) plays a central role in orthoflavivirus pathogenesis by modulating host immune responses, disrupting endothelial barrier integrity, and facilitating viral dissemination. However, the functional and biochemical properties of NS1 from WNV and USUV remain poorly characterized. We combined <i>in vitro</i>, <i>in vivo</i>, and clinical approaches to compare NS1 secretion, stability, and its impact on blood-brain barrier. Our results show that WNV NS1 is secreted at significantly higher levels, exhibits greater thermal stability, and disrupts brain endothelial barrier integrity <i>in vitro</i>. In contrast, USUV NS1 is secreted less efficiently, is slightly less stable, and does not compromise blood-brain barrier integrity, despite inducing distinct transcriptional responses in brain endothelial cells. In mice, WNV infection led to higher serum NS1 levels and stronger systemic inflammation than USUV. Clinically, WNV NS1 was detected mainly in patients with neurological symptoms, whereas USUV NS1 remained undetectable in all cases. Altogether, these findings reveal differential NS1 properties between these closely related viruses, with key implications for orthoflavivirus diagnosis and neurovirulence mechanisms.

CA10
Also flagged:Enterovirus 71 infectionHand, foot, and mouth diseaseinflammatory responsesviral infectioninfectionbinding
Journal Article 2026-05-29 ✓ 1 Snippet Qi Y, Li W, Peng Q, Shi Y, Tan N, Yang Y, Zhu Y, Hu S, Zhang B, Wan P, Shu X, Liu Y, Liu L, He X, Sun B.
In-Text Gene Mentions

…as CA6 andCA10is increasing; further…

Show Full Abstract

Hand, foot, and mouth disease (HFMD) is primarily caused by Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16), while excessive inflammatory responses induced by viral infection are the main cause of severe conditions. Hence, it is important to develop agents with both antiviral and anti-inflammatory activities for clinical treatment. In this study, we synthesized 20 compounds based on the hybridization of nonsteroidal anti-inflammatory drugs (NSAIDs) and organoselenium and found that YSN-1-167 exhibited significant anti-EV71 function using an EV71-GFP infection system. Mechanistic studies showed that this compound suppressed virus replication but not the binding and entry steps, and further target screening found that YSN-1-167 might suppress 3D polymerase function but not viral 2A and 3C proteases. The conservation of 3D polymerase between EV71 and CA16 prompted us to discover that YSN-1-167 can also significantly inhibit CA16 infection. As expected, this compound can reduce the levels of pro-inflammatory mediators, including IL-1β and COX-2, induced by EV71 infection. Furthermore, YSN-1-167 exhibited favorable safety and effective anti-EV71 and anti-inflammatory properties in neonatal mice. In conclusion, these results suggested that YSN-1-167 can be developed into a potential therapeutic strategy for HFMD induced by EV71 and CA16 via inhibiting virus replication and inflammatory response.

Also flagged:infection
Journal Article 2026-05-29 No Snippets Thai QM, Phung HTT, Ngo ST.
Show Full Abstract

Chikungunya virus (CHIKV) infection remains a significant global health threat with no approved specific antiviral therapy. The nonstructural protein 2 protease (nsP2pro) is essential for viral replication and represents an attractive target for structure-based drug design. In this study, we employed a computational drug repurposing strategy to predict potential nsP2pro inhibitors from FDA-approved compound libraries. We performed molecular docking screens of 1820 unique compounds against the nsP2pro active site. The eight selected top-scoring compounds had docking scores better than that of the reference inhibitor pantinin-1. Subsequent molecular dynamics (MD) simulations revealed that, except for lomitapide, which dissociated from the pocket, the remaining leads formed dynamically stable complexes and modulated the catalytic environment in a chemotype-dependent manner. Small molecules expanded both the Cys478-His548 and Ser482-His548 distances, consistent with dyad perturbation, whereas GnRH-like peptides preserved a more compact geometry in the modeled noncovalent complexes, pointing to possible nonproductive occupation of the active-site region. Free energy perturbation calculations further provided a relative energetic ranking that supported the MD-derived mechanistic trends and placed six compounds ahead of pantinin-1 within the present data set. Among the small-molecule candidates, venetoclax and lapatinib emerge as computationally prioritized candidates for future biochemical and antiviral evaluation. Overall, this study provides mechanistic insight into noncovalent recognition of CHIKV nsP2pro and a framework for future experimental validation.

STAU1
Also flagged:localizationdendritesmicrotubulesNeuronalneurodegenerative disorderslocalizations
Journal Article 2026-05-29 ✓ 5 Snippets Huang S, Chu Y, Zhao R, Li S, Feng Y, Zheng H, Xie Y, Wang T, Wen W.
In-Text Gene Mentions

…two Staufen orthologs,STAU1and STAU2, have…

STAU1is ubiquitously expressed,…

…proteins (e.g., humanSTAU1RBD3, PDB ID:…

…Though bothSTAU1and STAU2 exhibit…

…has demonstrated thatSTAU1condensate recruits MTOR…

Show Full Abstract

The double-stranded RNA-binding protein STAU2 plays an essential role in neural development and synaptic plasticity, assembling target mRNAs into ribonucleoprotein (RNP) granules to control their trafficking, localization, and local translation, though the detailed molecular mechanism remains elusive. Here, we show that STAU2 phase separates to form dynamic condensates in dendrites of hippocampal neurons, recruiting specific mRNAs to assemble mobile RNP granules that are transported distally along microtubules. These RNA-loaded STAU2 condensates undergo a liquid-to-gel transition, which stabilizes the encapsulated transcripts while repressing their translation. During neuron development, disrupting STAU2 condensation impairs RNP formation and compromises anterograde mRNA delivery to distal dendrites. Conversely, STAU2 overexpression promotes excessive coacervation, resulting in oversized RNP granules with reduced mobility, ultimately hindering dendritic elongation and promoting excessive branching. We further demonstrate that synaptic activity bidirectionally remodels STAU2 condensates in parallel with changes in local translation of bound mRNAs. Notably, aberrant STAU2 condensates emerge as a potential pathological feature in aggregation-prone neurodegenerative disorders. Collectively, our findings establish that STAU2 condensate safeguards the development of postmitotic neurons by orchestrating the dendritic transport and activity-dependent translation of its target mRNAs.

Also flagged:Neurological disordersAlzheimer's diseaseADParkinson's diseasePDcerebral ischemia
Journal Article 2026-05-29 No Snippets Xue X, Lai Y, Song S, Wu L, Wang L.
Show Full Abstract

Neurological disorders such as Alzheimer's disease (AD), Parkinson's disease (PD), cerebral ischemia, anxiety and depression pose significant global public health challenges due to their high prevalence and complex pathological mechanisms. Current therapeutic strategies primarily offer symptomatic relief, with limited efficacy in mitigating disease progression. Neuroprotection involves interventions aimed at preserving neuronal structure and function through mechanisms such as reducing oxidative stress, modulating inflammation and inhibiting apoptosis, presenting a promising avenue for treating these conditions. Protocatechuic acid (PCA), a natural phenolic acid compound prevalent in a variety of foods and herbal medicines, has received considerable attention for its notable antioxidant, anti‑inflammatory and neuroprotective properties. The present study systematically reviews the neuroprotective effects and molecular mechanisms of PCA in various neurological disorders (including AD, PD and cerebral ischemia). The present review highlights the multi‑target mechanisms of PCA, which act by mitigating oxidative stress, neuroinflammation, mitochondrial dysfunction and apoptosis, while promoting neuronal regeneration. Furthermore, the present review integrates the body of evidence across neurological contexts to identify conserved protective pathways and discusses the translational potential of PCA, providing a foundation for its clinical application in treating neurological diseases.

HFE
Also flagged:protein-calorie malnutritionmicronutrient deficienciesliver dysfunctionmalnutritionmorbid obesitytype 2 diabetes mellitus
Journal Article 2026-05-29 ✓ 1 Snippet Sakr AA, Almutairi MZ, Hawash AF, Alsahhari AA.
In-Text Gene Mentions

Hemochromatosiswas excluded based…

Show Full Abstract

BACKGROUND One-anastomosis gastric bypass (OAGB) is an effective bariatric surgery; however, there may be serious instances of metabolic and nutritional complications that may require complete reversal. Reversal of complete OAGB to near-normal physiology, especially with a background of sleeve gastrectomy, is extremely rare. This case report discusses the complications associated with reversal of OAGB. CASE REPORT Our patient was a 28-year-old woman who had a history of a sleeve gastrectomy procedure and later underwent a revisional OAGB procedure for poor weight loss/weight regain. She later developed weakness, chronic diarrhea, vomiting, severe protein-calorie malnutrition, refractory micronutrient deficiencies, and severe liver dysfunction with significant hepatocellular damage. She was admitted in unstable medical condition. After multidisciplinary evaluation, the patient underwent a laparoscopic reversal of OAGB to near-normal anatomy. The postoperative course was complicated by septic shock and multi-organ dysfunction requiring critical care interventions. With comprehensive multidisciplinary management, the patient gradually improved. After more than 8 months of follow-up, she demonstrated recovery in nutritional status, liver function, and functional capacity, despite the presence of a reduced gastric reservoir due to prior sleeve gastrectomy. CONCLUSIONS This case confirms that complete reversal of OAGB can be life-saving in selected patients with severe malnutrition and metabolic issues. Early identification of nutritional deficiencies and multidisciplinary care are critical to optimize outcomes in high-risk patients following bariatric surgery.

SERPINC1
Also flagged:liver diseasecirrhosisportal hypertensionmitochondrialtranslationalPorto-sinusoidal vascular disease
Journal Article 2026-05-29 ✓ 5 Snippets Iyer A, Doornbos C, Evelo C, Kutmon M, Ehrhart F.
In-Text Gene Mentions

…Hernández-Gea et al.,SERPINC1was found to…

SERPINC1reflects altered anticoagulant…

…In PSVD,SERPINC1(antithrombin III) has…

…functional overlap withSERPINC1as a liver-derived…

…and multiple serpins (SERPINC1, SERPIND1, SERPINA12) involve…

Show Full Abstract

<h4>Background</h4>Porto-sinusoidal vascular disease (PSVD) is a complex, rare liver disease characterized by the absence of cirrhosis, with or without the presence of portal hypertension or histological lesions. Given the knowledge gaps in the mechanisms involved in this disease with unknown etiology, we used omics-based approaches to further elucidate the pathways affected by PSVD, facilitating improvements in the prognosis, diagnosis, and treatment options for these patients.<h4>Methods</h4>We applied gene set enrichment analysis (GSEA) and weighted gene coexpression network analysis (WGCNA) to identify pathways dysregulated in PSVD. Network construction and visualization were performed in Cytoscape to explore interconnectivity among enriched processes. Within key modules, candidate genes were prioritized by ranking approaches and cross-referenced with findings from previous studies.<h4>Results and conclusion</h4>In this study using both module eigengene correlation network analysis and GSEA, a novel coordinated dysregulation in PSVD was identified characterized by the simultaneous activation of immune and signaling pathways alongside the suppression of metabolic, ribosomal, and mitochondrial programs, highlighting a critical antagonistic interplay between these systems. Alterations in ribosomal proteins, ATP synthase subunits, and serpin family members highlight translational, bioenergetic, and anticoagulant dysfunction as core mechanisms. Together, these findings define PSVD as a disorder of integrated immune, vascular, and metabolic imbalance.

DNAH10
Also flagged:CongenitalHeart Defectscongenital heart defectscongenital diaphragmatic herniapulmonary valve stenosisatrial septal defects
Journal Article 2026-05-29 ✓ 1 Snippet Koga N, Katoh-Fukui Y, Fukui S, Kashimada K, Fukami M.
In-Text Gene Mentions

DNAH10

Show Full Abstract

Monoallelic loss-of-function variants of GATA4 have been implicated in congenital heart defects, 46,XY differences of sex development, and congenital diaphragmatic hernia (CDH). However, there is no report of GATA4-variant positive patients who concomitantly exhibited these three features. Furthermore, the genotype-phenotype correlation of GATA4 abnormality remains unclear. Here, we report a 2-year-old boy who exhibited pulmonary valve stenosis, multiple atrial septal defects, hypospadias, bifid scrotum, bilateral inguinal hernia, and CDH. Endocrine evaluations of the patient were indicative of partial testicular dysgenesis. Exome sequencing identified a de novo 3-bp deletion in GATA4 that has not been reported previously. The variant eliminated one amino acid from the highly conserved five-threonine repeat in the second zinc finger domain (c.829_831del, p.T277del). The variant was assessed as deleterious by in silico analyses and was scored as "likely pathogenic" by the American College of Medical Genetics and Genomics guidelines. Our findings indicate that the five-threonine repeat in the second zinc finger domain contributes to GATA4 function. These results broaden the spectrum of GATA4 pathogenic variants and highlight the phenotypic diversity resulting from GATA4 abnormalities.

Also flagged:agingcognitive impairmentneurodegenerative disorderspost-translational modificationstranslational-related diseases
Journal Article 2026-05-29 No Snippets Chang B, Yang S, Yilixiati A, Zhang F, Sun X, Wang L, Hu B, Zhou Y.
Show Full Abstract

During aging, the progressive decline in neuronal function contributes to cognitive impairment and predisposes individuals to neurodegenerative disorders. This phenomenon has become increasingly prominent in modern society. Recent studies have found that post-translational modifications (PTMs) of proteins play a crucial role in the aging process, influencing the physiological functions and pathological changes in brain cells. This article reviews the variety and complexity of PTMs across brain cell types during aging, analyzes changes in specific modification types and sites, and reveals their impacts on neurophysiological and pathological states. This review also examines the current state of translational research, noting that most of the drugs under investigation lack specificity, and their potential toxic side effects remain undetermined. In light of these concerns, this review proposes therapeutic strategies to guide innovative interventions for aging-related diseases, aiming to facilitate further research and clinical applications in this field.

SOX6
Also flagged:hepatocellular carcinomapathogenesistumorinflammatory responsessecretionimmune responses
Journal Article 2026-05-29 ✓ 5 Snippets Wang Z, Yu H, Yu L, Liu M, Huang X, Wu L, Teng W, Chen S, Fang Z.
In-Text Gene Mentions

…ntech, CAS: 22355-1-AP), anti-Sox6(Santa Cruz Biotechnology,…

…Plasmids HA-Sox6, HA-Myb and GFP-Myb…

…targeting mouse Myb,Sox6and Pax5, and…

…levels of Myb,Sox6and Pax5.…

…proteins (Myb orSox6) were immunoprecipitated usin…

Show Full Abstract

Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide, characterized by complex pathogenesis and immune escape mechanisms. The tumor immune microenvironment plays an increasingly recognized role in tumorigenesis, progression, and treatment. Receptor-interacting serine/threonine-protein kinase 2 (Ripk2) plays a pivotal role in inflammatory responses and immune regulation. This study aimed to investigate the role of Ripk2 in the HCC immune microenvironment, particularly its impact on macrophage function, using a macrophage Ripk2 knockout mouse model (Ripk2<sup>CKO</sup>), single-cell sequencing analysis (scRNA-seq) and flow cytometry (FCM). We found that inhibiting or deleting Ripk2 altered the intratumoral microbiota within macrophages, significantly increasing the abundance of Streptomyces collinus (Sc). This alteration not only prompted a metabolic shift in macrophages but also significantly upregulated the transcription factor Myb expression, promoting Cxcl9 secretion, thereby enhancing CD8<sup>+</sup> T cell infiltration, activity, and proliferation. Furthermore, Ripk2 was found to promote lactate production via the Pax5/Adpgk pathway, leading to CD8<sup>+</sup> T cell dysfunction and forming an immunosuppressive feedback loop in HCC. Combining a Ripk2 inhibitor (GSK583) with a PD-1/PD-L1 inhibitor (BMS202) reduced the hepatotoxicity of BMS202 monotherapy and improved therapeutic efficacy. In conclusion, this study provides new insights into the role of Ripk2 in the HCC immune microenvironment and lays an experimental foundation for the development of Ripk2-targeted immunotherapy strategies.

LRRC7
Also flagged:brain disordersschizophreniaautism spectrum disorderNMDAR encephalitiscognitionbehavioral
Journal Article 2026-05-29 ✓ 1 Snippet Roh JD, Bae M, Oh Y, Yang Y, Lee S, Hwang WC, Yang E, Kim H, Jang H, Choi HW, Kim H, Kim JY, Kim E.
In-Text Gene Mentions
⭐ same-sentence co-mention

…such as Shisa6,Lrrc7/densin-180, Slc32a1/Vgat/Viaa…

Show Full Abstract

Suppressed NMDA receptor (NMDAR) function contributes to multiple brain disorders, including schizophrenia, autism spectrum disorder (ASD), and NMDAR encephalitis. Previous attempts to restore NMDAR activity by increasing ambient glycine, a critical co-agonist, through GlyT1 inhibition have yielded mixed outcomes, partly due to GlyT1's extensive expression in essential brainstem regions. Slc6a20a, a glycine transporter widely expressed in cognition-relevant regions such as the cortex and hippocampus, offers a targeted alternative. Here we show that antisense oligonucleotide (ASO)-mediated Slc6a20a inhibition (Slc6a20a-ASO) normalizes ASD-related phenotypes in male Shank2- and Shank3-mutant mice, with model-dependent rescue profiles. Slc6a20a-ASO rescues NMDAR hypofunction and synaptic phospho-proteomic profiles in the prefrontal cortex. Furthermore, ASO targeting human SLC6A20 rescues suppressed NMDAR function in cortical organoids harboring SHANK2 or SHANK3 mutations. These findings underscore the potential and limitations of Slc6a20a/SLC6A20-ASO for treating disorders characterized by NMDAR hypofunction.

TNFSF4
Also flagged:intrahepatic cholangiocarcinomaliver cancerdamage responselocalizationcell proliferationPrimary
Journal Article 2026-05-29 ✓ 1 Snippet Lu K, Li H, Wu Y, Dong X, Dong D, Fan Y, Li E, Sun L, Shi Y.
In-Text Gene Mentions

…TNFRSF9, TNFRSF4, TNFSF18,TNFSF4, and TNFSF9 were…

Show Full Abstract

<h4>Background</h4>Intrahepatic cholangiocarcinoma (ICC) is a highly aggressive subtype of primary liver cancer with insidious onset, early metastasis, and poor prognosis. DNA damage response (DDR) dysfunction is linked to ICC tumorigenesis, progression, and drug resistance. However, the detailed mechanisms remain underexplored.<h4>Methods</h4>DDR activity was quantified by ssGSEA across 6 independent ICC cohorts. DDR risk model was analyzed using 10 machine learning algorithms to construct 101 combined models, and the optimal Lasso + RSF model was adopted by c-index. The core gene SFN was selected for experimental validation. Single‑cell RNA sequencing and spatial transcriptomics were used to explore cellular localization and tissue distribution of signature genes. In vitro assays were performed in ICC cell lines after SFN knockdown to assess cell proliferation and chemosensitivity.<h4>Results</h4>The DDR risk model showed stable prognostic performance in training and external validation cohorts. High‑risk patients exhibited poor prognosis, immunosuppressive microenvironment and reduced sensitivity to multiple chemotherapeutic agents. SFN was specifically enriched in malignant cells. Knockdown of SFN significantly suppressed cell proliferation and colony formation, enhanced sensitivity to cisplatin and gemcitabine, and increased γ‑H2AX expression indicating elevated DNA double‑strand breaks.<h4>Conclusions</h4>We constructed a robust DDR‑based prognostic model for ICC that enables accurate risk stratification and prediction of therapeutic response. SFN serves as a critical driver of chemoresistance and a potential therapeutic target. These results offer novel biomarkers and mechanistic insights to facilitate precision medicine for ICC patients.

HFE
Also flagged:Marfan SyndromeConnective Tissue DisordersUCTDaortopathiescardiomyopathiesarrhythmias
Journal Article 2026-05-29 ✓ 2 Snippets Soto ME, Vargas-Alarcón G, Huesca-Gómez C, Pérez-Torres I, Arias-Godínez JA, Meza-Toledo SE, Mora-Cervantes R, Rodríguez-Zanella H, Meléndez-Ramírez G, Manzano-Pech L, Fuentevilla-Álvarez G, Gamboa R.
In-Text Gene Mentions

…, COL5A2 ,HFE, SOS1 ,…

…ne patient with TGFBR2+MYBPC3+HFEpresented with pulmonary…

Show Full Abstract

Marfan syndrome (MS), Loeys-Dietz syndrome (LDS), Beals-Hecht syndrome (BHS), Ehlers-Danlos syndrome (EDS), and individuals with undifferentiated connective tissue disease (UCTD) exhibit phenotypic overlap, suggesting a likelihood of genotypic coexistence. Our objective was to evaluate genetic variants (GVs), encoding 174 genes related to aortopathies, cardiomyopathies, arrhythmias, structural heart disease, and hypercholesterolemia, and their relationship to clinical and cardiovascular damage in these syndromes. This was a prospective study in Mexican patients with MS, LDS, EDS, BHS, and UCTD. One hundred and seventy-four genes related to hereditary diseases were studied using next-generation sequencing targeting coding regions. Of the 136 patients, 25 were identified with the recurrent and coexisting GV of <i>MYBPC3</i>. In the MS group, in addition to the presence of GV in <i>FBN1</i>, eight patients had GV in <i>MYBPC3</i>, six in <i>FBN2</i>, and five in <i>COL3A1</i> and <i>COL5A1</i>. In the LDS group, in addition to GV in <i>TGFBR1</i>, <i>TGFBR2</i>, and <i>SMAD3</i>, four patients presented with GV in <i>MYBPC3</i> and two with <i>FBN2</i>. In the BHS group, in addition to <i>FBN2</i>, two patients had GV in MYBPC3 and one with <i>TGFBR2</i>. In the UCTD group, nine patients had GV in <i>MYBPC3</i> and two in <i>COL5A1</i> and <i>COL5A2</i>. All syndromes coexisted with GV in genes related to arrhythmias, sarcomeres, and hypercholesterolemia. In EDS, coexistence with several sarcomere proteins was found.

PRDX6
Also flagged:brain disorderepilepsychronicchronic neurological diseasedevelopmental delaybehavioral
Journal Article 2026-05-29 ✓ 1 Snippet Śliwińska M, Rakuś-Kwiatosz A, Chrościńska-Krawczyk M.
In-Text Gene Mentions

PRDX6was identified to…

Show Full Abstract

<b>Introduction</b>: Epilepsy is a chronic brain disorder causing recurrent seizures as a result of abnormal electrical brain activity. Approximately 70 million people worldwide suffer from it and need antiseizure treatment. The diagnosis and assessment of the effectiveness of the therapy are mainly based on symptoms described by a witness or a patient, which is a method of low reliability. The review aims to evaluate available markers of antiseizure drugs' efficacy, highlighting those that could support the proper course of treatment. <b>Results</b>: Comparing the available studies was very challenging. There were significant differences across the groups enrolled in the studies regarding the type of epilepsy included, the patient inclusion criteria, and the total number of patients. Moreover, most of the trials have been conducted on adults, not on children. <b>Conclusions</b>: Drug selection and their dosage are mainly based on the relationship between patients and their caregivers. Additionally, electroencephalography (EEG) and antiseizure medication (ASM) concentrations are assessed, but according to many studies, none of the applied methods are sufficient for the diagnostic and therapeutic process to be based on.

HFE
Also flagged:metabolic disorderliver diseasesteatosisHepatic steatosisMetabolic dysfunctionsteatotic liver disease
Journal Article 2026-05-29 ✓ 1 Snippet Ma Z, Wang H, Sun X, Zhou S, Sun Y, Wang X, Li T, Yang X, Xu J, Guo W, Wang M, Kow AWC, Zhang H, Zhang L, Sun X.
In-Text Gene Mentions

…acute inflammation, knownhemochromatosis, and recent blood…

Show Full Abstract

<h4>Background</h4>Hepatic steatosis is a common metabolic disorder for which accessible noninvasive assessment remains clinically relevant. This study aimed to evaluate the QCT-referenced performance of ultrasound attenuation (USAT) and an integrated model combining metabolic biomarkers for non-invasive categorization according to hepatic fat fraction in metabolic dysfunction-associated steatotic liver disease (MASLD), using quantitative computed tomography (QCT)-derived hepatic fat fraction categories as pragmatic imaging comparator labels.<h4>Methods</h4>A total of 172 participants were enrolled and categorized into hepatic fat fraction categories by QCT. USAT values, along with serum levels of ALT, AST, and ferritin, were collected. Three models were evaluated: USAT-only, laboratory-only, and an integrated USAT + laboratory model. Model performance was assessed using fold-separated internal validation, including nested five-fold stratified cross-validation with feature selection performed within training folds. Harrell's optimism-corrected bootstrap analysis was also performed as a supplementary internal validation method.<h4>Results</h4>USAT values increased significantly with hepatic fat fraction categories (P<0.001). In fold-separated internal validation, the USAT-only model achieved an AUC of 0.847 (95% CI, 0.780-0.902) for QCT-referenced detection of imaging-defined steatosis, while the laboratory-only model achieved an AUC of 0.753 (95% CI, 0.665-0.829). A fixed integrated model including USAT, ALT, and ferritin achieved an AUC of 0.845 (95% CI, 0.772-0.906), but did not significantly improve AUC compared with USAT alone. Multiclass categorization remained exploratory and limited, particularly for Category 2, which included only 31 participants and showed weak discrimination in the corrected random forest analysis (AUC=0.569 for the USAT + ALT + ferritin model). Subgroup analyses showed higher performance in females, younger participants, and those with higher BMI.<h4>Conclusion</h4>USAT shows promise as a noninvasive adjunct for QCT-referenced detection of imaging-defined hepatic steatosis in a single-center Chinese health-examination cohort, pending external validation. Adding ALT and ferritin may improve sensitivity and calibration, but did not significantly improve AUC over USAT alone. Because discrimination for the intermediate Category 2 group remained weak, the current model should not be considered reliable for full hepatic fat fraction categorization. Further validation in external, multicenter, and more diverse populations is required before any clinical use.

Also flagged:viraltransductiontumorstumorsolid tumorscell differentiation
Journal Article 2026-05-29 No Snippets Wong K, Calnan C, Benson MJ.
Show Full Abstract

Adoptive T cell therapies can deliver curative responses for refractory patients with B cell malignancies, yet clinical activity in solid tumors remains inconsistent. Tumor-intrinsic barriers dominating this inconsistency include the immunosuppressive solid tumor microenvironment (TME) imposing chronic inhibitory cues to T cells and the scarcity of patient-shared and uniformly expressed tumor-restricted antigens for T cells to target. CRISPR-based forward genetics screens enable mapping of the functional genome regulating T cell anti-tumor activity. Here, we review recent insights from pooled CRISPR knockout screens in T cells to define convergent targets and pathways regulating T cell anti-tumor function and align the pharmacology of engineered T cells with sequential barriers they encounter within the TME. We additionally propose a framework for CRISPR screen-enabled target prioritization and present an example of how these principles can be applied to the functional enhancement of T cells through TIL (Tumor Infiltrating Lymphocyte) therapy, which utilizes a patient's personalized immune response against solid tumor antigens.

LRRC7
Also flagged:late blightmicrotubersredox homeostasiscell wallmembranemicrotuberization
Journal Article 2026-05-29 ✓ 1 Snippet Herrera-Isidron L, Careaga-Rojas IA, Uribe-Lopez B, Navarro-Vega AM, Barraza A, Valencia-Lozano E, Cabrera-Ponce JL.
In-Text Gene Mentions

Condensinsubunits, F19K16.15 (M1BD85)…

Show Full Abstract

<h4>Introduction</h4>Multiple-stress is defined as the simultaneous or sequential exposure of plants to multiple abiotic constraints, which triggers regulatory programs that differ fundamentally from single-stress responses. In potato (<i>Solanum tuberosum</i> L.), drought, salinity, heat, and cold severely impair tuber development, yet the molecular architecture underlying resilience to combined stress remains unclear. We hypothesized that multi-stress conditions activate an integrated regulatory network linking tuber induction with stress-responsive metabolic and redox pathways.<h4>Methods</h4>RNA-seq profiling of microtuberization under combined osmotic, salinity, heat, and cold stress was performed. Differential expression analysis identified shared differentially expressed genes (DEGs). A subset of upregulated genes was used for protein-protein interaction (PPI) network construction. Comparative regulatory analyses were performed, and selected genes were validated by qPCR. Statistical analyses were conducted to assess differential expression and network enrichment.<h4>Results</h4>A total of 2,046 shared DEGs were identified, including 1,212 upregulated and 834 downregulated genes. A PPI network constructed from 1,475 unique upregulated genes revealed 317 highly interconnected components. Network analysis identified the StSP6A-FD tuberigen complex as a central regulatory hub integrating developmental signaling with phenylpropanoid metabolism, oxylipin biosynthesis, and redox regulation. Multiple components were associated with hydrogen sulfide (H₂S) signaling, suggesting redox-gasotransmitter integration.<h4>Discussion</h4>Comparative regulatory analysis revealed conservation of the ERF-NAC-MYB-bZIP transcription factor framework, along with expansion of stress-responsive modules. Collectively, these findings establish a mechanistic framework linking tuber induction with adaptive metabolic remodeling under multi-stress conditions.

Also flagged:reverse transcriptionsynthesislung cancerMembranedigestiongene expression
Journal Article 2026-05-29 No Snippets Sun X, Ram O.
Show Full Abstract

This protocol describes sc‑rDSeq, a scalable, droplet‑based method for full‑length, strand‑specific total RNA sequencing at single‑cell resolution. The protocol uses a refined set of 220 ribosomal‑depleted sequences (rDS) primers that selectively exclude ribosomal RNA during initial reverse transcription, enabling capture of both polyadenylated and non‑polyadenylated RNAs such as histone RNAs, noncoding RNAs, and enhancer RNAs, without requiring costly post‑amplification depletion steps. This method is useful for researchers who would like to detect not only gene expression variations, but also alternative splicing events and single nucleotide variations in complex heterogenous cellular systems, providing a more complete view of cellular heterogeneity and regulatory programs that remain invisible to conventional polyadenylated‑only sequencing approaches. Compared with existing full‑length protocols, which are often limited by high reagent costs or reliance on complex multistep microfluidics, sc-rDSeq provides a simpler, single-step microfluidic workflow compatible with standard inDrops platforms, which may reduce experimental complexity and cost relative to existing full-length total-RNA methods. A key improvement is the 10-fold increase in unique molecular identifiers per cell relative to 3' end‑based methods, at a reported reagent cost of approximately $0.08 per cell, making deep total transcriptome analysis more accessible. The protocol includes three major parts: sc‑rDSeq barcode synthesis, single‑cell co‑encapsulation, and library construction.

Also flagged:skin lymphomashematologic neoplasmsskin lymphomalymphomatoid papulosismycosis fungoidesMF
Journal Article 2026-05-29 No Snippets Drabent P, Welfringer A, Gru AA, Molina TJ, Fraitag S.
Show Full Abstract

Cutaneous hematologic neoplasms in children are relatively rare and encompass a wide range of lymphoproliferative and myeloproliferative disorders. This review explores and updates the classification, clinical presentation, diagnostic challenges, histopathology, and management of pediatric lymphomas, lymphoproliferations, and leukemias that may be seen in the skin. The most frequent of them are lymphomatoid papulosis (LyP) and mycosis fungoides (MF), and are discussed first, with a particular focus on differential diagnosis and overlaps with benign lesions-mainly pityriasis lichenoides-which raises questions regarding the delineation of these entities and their potential interconnection. It is important to underline that most cutaneous lymphoproliferations are indolent in children: primary cutaneous CD4+ small/medium T-cell lymphoproliferative disorder, subcutaneous panniculitis-like T-cell lymphoproliferation (non-associated with <i>HAVCR2</i> mutations), primary cutaneous marginal zone lymphoproliferative disorder, and EBV-related lymphoproliferative disorders. However, aggressive hematologic malignancies, although rarer, must not be missed; these are mostly leukemias (but not all forms) and blastic plasmacytoid dendritic cell neoplasm. We emphasize the importance of clinical-pathological correlation, with clonality studies playing a crucial role in some cases. Management strategies are briefly reviewed, ranging from skin-directed therapies like phototherapy and corticosteroids to systemic treatments for more aggressive forms of leukemia cutis and lymphomas.

SERPINC1
Also flagged:Extracellular VesiclepreeclampsiaPEmembranetranslationalExtracellular vesicles
Journal Article 2026-05-29 ✓ 1 Snippet Mahajan V, Kumar A, Jacob J, Costantine MM, Richardson LS, Urrabaz-Garza R, Amabebe E, Tantengco OAG, Kammala AK, Menon R.
In-Text Gene Mentions

…signaling scaffold), COLTA1,SERPINC1, SARS1, RHOA, MMP14…

Show Full Abstract

<b>Background:</b> Low-dose aspirin (LDA) reduces preeclampsia (PE) risk by up to 40%, yet its molecular effects on chorion trophoblast cells (CTCs), a fetal membrane lineage at the feto-maternal interface, remain obscure. CTCs form a structural and immunoregulatory barrier whose dysfunction drives inflammation-associated membrane pathology in PE. Extracellular vesicles (EVs) released by CTCs may encode cellular stress and adaptation states, offering a molecular window into aspirin's timing-dependent effects on PE risk modification. <b>Methods:</b> Human CTCs were challenged with cigarette smoke extract (CSE) to model oxidative stress-driven PE pathology. Two paradigms were tested: (1) prophylactic aspirin (4 and 40 µg/mL) before and/or flanking the CSE, and (2) therapeutic aspirin after the CSE challenge. The EVs were isolated via ultracentrifugation and size-exclusion chromatography, characterized by nanoparticle tracking and immunoblotting, and profiled by quantitative mass spectrometry. A network pathway analysis and machine learning biomarker selection defined the EV-encoded molecular states. <b>Results:</b> The CTC-derived EVs from the CSE-exposed cells carried a PE-like proteomic signature marked by suppressed VEGF/ECM remodeling, activated TNF-p53 apoptotic signaling, and heightened inflammation. Prophylactic low-dose aspirin shifted the EV cargo toward an EV-encoded signature consistent with preserved angiogenic potential (enrichment of VEGFA, COL1A1, and MMP14) and predicted attenuation of apoptotic and NF-κB pathway activity by an Ingenuity Pathway Analysis. High-dose aspirin produced broad transcriptional suppression without an accompanying pro-angiogenic EV signature. Therapeutic (post-injury) aspirin partially attenuated the injury-associated EV cargo but did not restore the angiogenic EV signature. An exploratory machine learning analysis of EV proteomes identified a candidate prophylactic biomarker panel anchored by HSPA8, SERPINF2, COL4A1, and PLOD1, mapped to the predicted angiogenic recovery and redox-balance pathways. These EV cargo readouts represent the predicted molecular states and require functional validation before clinical interpretation. <b>Conclusions:</b> The CTC-derived EV proteomic signatures capture the dose- and timing-dependent aspirin effects in this in vitro CTC model, positioning the chorion as a candidate pharmacological "secondary responder" favoring cellular resilience over classical anti-inflammatory suppression. As an exploratory hypothesis-generating study, EV-based molecular profiling could provide a foundation for future investigations aimed at stratifying aspirin responders from non-responders, although clinical validation in maternal plasma cohorts will be required before any translational application.

bioRxiv 2026-05-29 Preprint (No Snippets API) Ramkhalawan D, Parrales P, Koesterich J, Montoya-Vazquez G, Cuna C, Kreimer A, McQuerry J, Ihnow S, Makki N.
Show Full Abstract

Adolescent idiopathic scoliosis (AIS), the spontaneous development of a lateral spine curvature during puberty, is the most common pediatric spine disorder, affecting ∼3% of children worldwide. As the underlying etiology remains unclear, AIS is treated purely symptomatically, initially by bracing and ultimately by highly invasive, costly surgeries. Genome-wide association studies (GWAS) have identified numerous risk loci in non-coding genomic regions, making it difficult to link them to a biological function. To address this, we performed a multi-tissue investigation to connect genetic risk to tissue-specific molecular pathology. We conducted RNA sequencing on the primary tissues implicated in AIS, paraspinal muscle and spinal cartilage, from patients and unaffected controls. In paraspinal muscle, we identified differentially expressed genes (DEGs) enriched for pathways related to muscle structure, myogenesis, and metabolism. Key upregulated genes include the transcription factor EGR1 and structural components such as MYH1 . In spinal cartilage, we found enrichment of genes related to TGFβ and FoxO signaling, as well as metabolic pathways. Notably, genes crucial for chondrocyte differentiation (e.g. SOX5 and SOX6 ) were significantly downregulated. We then examined genes at known GWAS loci and found that several risk-associated genes were differentially expressed in one or both tissues. To investigate the function of non-coding variants at these loci, we identified and validated several enhancer elements harboring AIS risk SNPs at the BCL2, ADGRG6, BNC2, and FTO loci. We reveal distinct pathological signatures in muscle and cartilage and lay the foundation for connecting non-coding genetic risk to the dysregulation of key developmental and structural pathways.

SOX6
Also flagged:This research aims to assess the pharmacological function of curcumin and explore the potential microRNA (miRNA)-mRNA regulatory mechanism in curcumin-mediated HCC progression.<b><i>Results:</i></b> Curcumin repressed HCC cell proliferation, migration, and invasion.miR-21-5p level was decreased in curcumin-treated cells, and miR-21-5p overexpression reversed curcumin-mediated inhibition of HCC progression.Cell ProliferationHepatocellular Carcinomacancers
Journal Article 2026-05-28 ✓ 5 Snippets Zhou C, Hu C, Wang B, Fan S, Jin W.
In-Text Gene Mentions

Moreover, curcumin exposure increased <i>SOX6</i> expression through regulating miR-21-5p, and knockdown of <i>SOX6</i> overturned curcumin-modulated suppression of HCC progression.

Curcumin Suppresses Cell Proliferation, Migration, and Invasion Through Modulating miR-21-5p/<i>SOX6</i> Axis in Hepatocellular Carcinoma.

<b><i>Conclusions:</i></b> Curcumin repressed proliferation, migration, and invasion of HCC cells by regulating miR-21-5p and <i>SOX6</i>, indicating the promisingly pharmacological effect of curcumin in HCC.

<i>SOX6</i> was targeted through miR-21-5p, and <i>SOX6</i> restoration attenuated miR-21-5p-induced promotion of HCC progression.

…Modulating miR-21-5p/&lt;i&gt;SOX6&lt;/i&gt; Axis in Hepatocellu…

Show Full Abstract

<h4>Background</h4>Curcumin is the major component of turmeric, which has an anticancer property in multiple cancers, including hepatocellular carcinoma (HCC). However, the mechanisms are still largely unclear. This research aims to assess the pharmacological function of curcumin and explore the potential microRNA (miRNA)-mRNA regulatory mechanism in curcumin-mediated HCC progression.<h4>Materials and methods</h4>Hep3B and Huh-7 cells were used for <i>in vitro</i> experiments. Cells were exposed to various doses of curcumin, and transfection was conducted using Lipofectamine 2000. Cell proliferation, migration, and invasion were examined using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide or transwell assay. The abundances of miR-21-5p and sex-determining region Y-related high-mobility group box 6 (<i>SOX6</i>) were examined using quantitative real-time polymerase chain reaction or Western blot. The relationship between miR-21-5p and <i>SOX6</i> was analyzed through luciferase reporter analysis.<h4>Results</h4>Curcumin repressed HCC cell proliferation, migration, and invasion. miR-21-5p level was decreased in curcumin-treated cells, and miR-21-5p overexpression reversed curcumin-mediated inhibition of HCC progression. <i>SOX6</i> was targeted through miR-21-5p, and <i>SOX6</i> restoration attenuated miR-21-5p-induced promotion of HCC progression. Moreover, curcumin exposure increased <i>SOX6</i> expression through regulating miR-21-5p, and knockdown of <i>SOX6</i> overturned curcumin-modulated suppression of HCC progression.<h4>Conclusions</h4>Curcumin repressed proliferation, migration, and invasion of HCC cells by regulating miR-21-5p and <i>SOX6</i>, indicating the promisingly pharmacological effect of curcumin in HCC.

Also flagged:neurodegenerative disordersoptic neuropathiesmitochondrial ataxiasmitochondrialphosphorylationneurodegenerative diseases
Journal Article 2026-05-28 No Snippets Tong Y, He JN, Zhou L, Zhang J, Ho BM, Du L, Yip YWY, Bisnauthsing H, Chan PP, Tham CC, Pang CP, Chu WK.
Show Full Abstract

Mitochondrial dysfunction is a core pathogenic mechanism underlying a broad spectrum of neurodegenerative disorders, from Alzheimer's and Parkinson's diseases to inherited optic neuropathies and mitochondrial ataxias. This review provides a comprehensive analysis of how defects in mitochondrial and nuclear DNA converge to disrupt oxidative phosphorylation, mitochondrial dynamics, calcium homeostasis, and quality control pathways, leading to energy depletion, oxidative stress, and neuronal degeneration across multiple disease contexts. Building on this mechanistic foundation, we examine how these shared pathogenic principles manifest distinctly in major neurodegenerative diseases, while also discussing representative mitochondrial optic neuropathies as tractable disease models that have yielded critical mechanistic and therapeutic insights. We further review recent advances in diagnostic technologies that enhance our ability to detect and stratify mitochondrial pathologies for therapeutic intervention. On the therapeutic front, we provide a comprehensive evaluation of the rapidly evolving landscape, analyzing strategies ranging from metabolic modulators and antioxidants to pioneering gene-targeted therapies, organelle replacement approaches, and emerging epitranscriptomic interventions. Finally, we identify persistent challenges in clinical translation and outline pivotal future directions essential for developing effective, mechanism-informed combination therapies against mitochondrial dysfunction in neurodegeneration.

HTT
Also flagged:membranesmembranesignaling transductioncell proliferationdeathmetabolism
Journal Article 2026-05-28 ✓ 1 Snippet Tu D, Zheng Y, Ding P, Shen M, Tang W, Wei B, Wang H.
In-Text Gene Mentions

…MutantHTT

Show Full Abstract

Cholesterol metabolites are abundant in the central nervous system (CNS) that regulate cell membrane fluidity, signal transduction, and inter- and intracellular vesicular transport, as well as cell proliferation/cell death or migration. Brain cholesterol synthesis and metabolism are tightly coupled to the functional homeostasis of neurons, glial cells or microglia, and dysregulation of these processes has been strongly implicated in neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD). This review provides a comprehensive overview of how cholesterol synthesis, esterification, efflux, uptake, and oxidation affect the CNS function, highlighting the function of key enzymes or metabolites in distinct brain cell types during neurodegeneration. Based on single-cell/nucleus RNA sequencing data from the brains of AD, PD, and HD patients, we summarize cell-type-specific genes in cholesterol metabolism pathways, shedding new light to understand cellular heterogeneity. The role of cholesterol-derived neurosteroids in neurodegenerative diseases is also discussed. Furthermore, how cholesterol metabolites modulate the formation, aggregation, and degradation of amyloid-β (Aβ), α-synuclein and huntingtin, as well as Tau protein phosphorylation are outlined. Finally, future research directions are proposed that aim to understand neurodegenerative diseases with new angle.

LRRC7DCC
Also flagged:translation initiationcancerglioblastomatranslationalcell cyclecell division
Journal Article 2026-05-28 ✓ 3 Snippets Kozuka-Hata H, Hiroki T, Kitamura A, Miyamura N, Akiyama T, Inoue JI, Tsumoto K, Oyama M.
In-Text Gene Mentions

…division regulators (PCNA,Condensincomplex subunits, MCM…

…seven proteins (CAN2,DCC, DYHC1, GNS, HNRH1,…

…AP2M1, CAN2, COPB,DCC, EXOC6, HNRPU, MYH16,…

Show Full Abstract

<h4>Background</h4>It is generally considered that eukaryotic translation initiation prominently occurs from the first AUG codon by ribosomal scanning from the 5-cap end of each mRNA. In order to identify cryptic internal translation initiation sites defined by alternative AUG codons on a proteome-wide scale, we generate a customized amino acid sequence database which contain differential AUG-guided tryptic peptide fragments computationally predicted from well-curated Swiss-Prot human protein reference sequences and applied it for high-resolution mass spectrometry-based proteomic analysis.<h4>Results</h4>The ultra-deep proteomic detection based on the real-time search platform on Orbitrap Eclipse Tribrid mass spectrometry system leads to identification of not only more than 26,000 unique peptides from already annotated human protein coding sequences but also 794 novel peptide fragments defined by alternative downstream translation initiation in human cancer cells. Very notably, Tandem Mass Tag-based multiplex quantitative analysis of patient-derived glioblastoma initiating cells uncovers epidermal growth factor-dependent translational regulation on a wide range of differential AUG-guided non-canonical proteoforms as well as cancer-related transcription factors and cell cycle/cell division regulators in a cell-type specific manner.<h4>Conclusions</h4>Our study provides the first proteome-wide evidence of downstream AUG-guided cryptic translation initiation dynamics in human cancer cells.

SERPINC1
Also flagged:Deficiencyantithrombin deficiencyvenous thrombosishypercoagulationthrombophiliaAT
Journal Article 2026-05-28 ✓ 2 Snippets Tao Y, Lu H, Wu T, Cai Y, Guo J, Corral J, Hu Y, Tang LV.
In-Text Gene Mentions

…Mutations in antithrombin (<i>SERPINC1</i>) lead to the…

…8 (AAV8)-mediated human <i>SERPINC1</i> gene (AAV8-hSERPINC1) in…

Show Full Abstract

<h4>Background</h4>Mutations in antithrombin (<i>SERPINC1</i>) lead to the hereditary antithrombin deficiency. Conventional therapies for hereditary antithrombin deficiency are prophylactic or on-demand oral anticoagulants, which have poor compliance and side effects. This study explored the therapeutic efficacy of adeno-associated virus serotype 8 (AAV8)-mediated human <i>SERPINC1</i> gene (AAV8-hSERPINC1) in AT (antithrombin)-deficiency mice.<h4>Methods</h4>AAV8-hSERPINC1 carrying luciferase was injected into AT<sup>+/-</sup> mice via tail vein injection at low, medium, and high doses. The biodistribution and expression of the carrier were visualized by in vivo bioimaging technology. Plasma AT levels were serially monitored by ELISA, and an inferior vena cava model was established to evaluate thrombotic propensity. Safety was evaluated by monitoring hepatic, renal, and cardiac function parameters and employing flow cytometry.<h4>Results</h4>A dose-dependent increase in AT expression was observed in AT<sup>+/-</sup> mice after AAV8-hSERPINC1 injection. Compared with the untreated mice, medium-dose treatment restored plasma AT activity and antigen in AT<sup>+/-</sup> mice to normal levels by week 8, with maintenance within the normal reference range for 40 weeks. In the venous thrombosis model, the rate of thrombosis in mice treated with medium-dose AAV8-hSERPINC1, rivaroxaban, low-molecular-weight-heparin, and wild-type mice were 60%, 60%, 70% and 60%, respectively. After AAV injection, transient elevations in hepatic transaminases and cytokines were observed in mice during a short-term period.<h4>Conclusions</h4>Our study demonstrates that AAV8-hSERPINC1 gene delivery resulted in durable AT expression, sustained blood hypercoagulation state correction, thereby rescuing thrombophilia in AT-deficient male mice. These data support the long-term efficacy and safety of AAV gene therapy for hereditary antithrombin deficiency.

CCDC92
Also flagged:Bipolar disordermaniadepressionmetabolismschizophreniapsychiatric disorders
Journal Article 2026-05-28 ✓ 1 Snippet Yuan C, Zhang B, Liang Y, Ran J, Hu S, Liu A, Liu Y, Qin F, Jian L, He Y, Han F, Zhang C.
In-Text Gene Mentions

…, LYRM9 ,CCDC92, PDF ,…

Show Full Abstract

<h4>Background</h4>Current bipolar disorder (BD) therapies suffer from limited efficacy and adverse effects, necessitating mechanistically grounded targets.<h4>Methods</h4>We integrated BD genome-wide association study data (158,036 cases; 2,796,499 controls) with brain proteomics (ROSMAP and Banner dorsolateral prefrontal cortex, <i>n</i> = 376 and 152) to perform proteome-wide association studies (PWAS). Bayesian colocalization and summary-data-based Mendelian randomization (SMR) prioritized causal genes. Cell-type-specific transcriptomics validated dysregulation in iPSC-derived neurons, astrocytes, and postmortem hippocampus/prefrontal cortex. Weighted gene co-expression networks (WGCNAs), functional enrichment, and molecular docking assessed functional pathways and druggability.<h4>Results</h4>PWAS identified eight BD-associated genes (false discovery rate < 0.05), with <i>DOC2A</i> emerging as the top candidate. Colocalization (<i>H<sub>4</sub></i> > 0.8) and SMR supported a causal association of <i>DOC2A</i> with BD, with no pleiotropy (heterogeneity in dependent instruments <i>P</i> > 0.01); <i>DOC2A</i> expression decreased in BD across neurons (<i>P</i> = 4.26 × 10<sup>-2</sup>), astrocytes (<i>P</i> = 2.09 × 10<sup>-2</sup>), hippocampus (<i>P</i> = 9.80 × 10<sup>-3</sup>, <i>t</i> = -2.738), and prefrontal cortex (<i>P</i> = 1.44 × 10<sup>-2</sup>, <i>t</i> = -2.580); WGCNA positioned <i>DOC2A</i> as a key regulator (module membership/gene significance <i>P</i> < 0.05) of co-expression networks enriched for BD-associated processes including neurotransmitter secretion and postsynaptic actin cytoskeleton organization (<i>P</i> < 0.05); molecular docking revealed favorable-affinity binding (ΔG < -4 kcal/mol) between DOC2A and BD-related drugs and neuroprotective compounds.<h4>Conclusions</h4>Our convergent multi-omics framework highlights <i>DOC2A</i> dysregulation as a key contributor to synaptic dysfunction in BD and nominates it as a promising therapeutic target. The demonstrated interaction with existing neuroactive compounds provides immediate translational avenues.

CCPG1
Also flagged:agingcancermetabolic diseaseautophagyproteostasisproteasome
Journal Article 2026-05-28 ✓ 1 Snippet Dikic I.
In-Text Gene Mentions

CCPG1, Cell cycle…

Show Full Abstract

Maintaining a functional proteome is essential for cellular health and organismal longevity. Disruption of proteostasis is a hallmark of aging and a central driver of diverse pathologies, including neurodegeneration, cancer, and metabolic disease. The ubiquitin-proteasome system (UPS) and autophagy represent the two principal degradative pathways safeguarding proteome integrity, particularly under conditions of stress. While historically viewed as mechanistically distinct, it is now clear that UPS and autophagy operate as an interconnected and adaptive network. This Perspective discusses three core principles that govern their coordination: (1) a shared molecular language of ubiquitin signals and shuttle proteins that determines cargo routing; (2) spatial compartmentalization through organelle-specific quality control modules and phase-separated degradation hubs; and (3) temporal regulation by stress-responsive signaling pathways that reprogram proteolytic output. Understanding this dynamic partnership not only reveals fundamental organizing principles of cellular homeostasis but also identifies new therapeutic nodes for diseases driven by proteostasis collapse.

BTN2A2
Also flagged:non-small cell lung cancercancerLUADpathogenesistumorscell cycle
Journal Article 2026-05-28 ✓ 2 Snippets Shi Y.
In-Text Gene Mentions

…comparison revealed elevatedBTN2A2, BTNL9, and CD47…

…immune checkpoint molecules (BTN2A2, BTNL9, CD47) in…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD), the predominant histological subtype of non-small cell lung cancer, remains a leading cause of cancer-related mortality worldwide. The RAS signaling pathway plays a critical role in LUAD pathogenesis; however, the heterogeneity of RAS pathway activity and its clinical implications remain poorly understood. This study aimed to characterize RAS pathway activity subtypes and develop a robust prognostic model for LUAD patients.<h4>Methods</h4>Transcriptomic data from 624 LUAD patients (GEO datasets: GSE31210 and GSE72094) were analyzed as the training cohort, with TCGA-LUAD as validation. Consensus clustering stratified patients based on 238 RAS pathway-related genes. Candidate genes were identified through differential expression analysis and WGCNA. Machine learning algorithms (LASSO, Random Forest, SHAP) were applied to construct a prognostic risk model. Comprehensive analyses including GSEA, CIBERSORTx-based immune infiltration, ESTIMATE scoring, and drug sensitivity prediction were performed.<h4>Results</h4>The study identified two distinct RAS pathway activity subtypes among LUAD patients. A three-gene prognostic signature (MAPK10, PLA2G12B, SHC3) was established, with the risk score serving as an independent prognostic indicator. Risk score was an independent prognostic factor. Immune landscape analysis demonstrated that high- and low-risk patients showed different expression levels of immune cells. All signature genes correlated positively with resting mast cells, while MAPK10 and PLA2G12B negatively correlated with activated CD4 + memory T cells. GSEA revealed high-risk tumors enriched in DNA replication, cell cycle, and base excision repair, whereas low-risk tumors favored drug and retinol metabolism pathways. Low-risk patients exhibited lower TIDE and exclusion scores, indicating better immunotherapy response potential. Eight therapeutic compounds (genistein, metformin, quercetin, JNK-9 L) demonstrated favorable binding to signature genes.<h4>Conclusion</h4>This study established a comprehensive landscape of RAS pathway activity subtypes in LUAD, identifying MAPK10, PLA2G12B, and SHC3 as novel prognostic biomarkers with significant associations with immune microenvironment remodeling, providing new insights for personalized treatment strategies and therapeutic target development.

PRDX6
Also flagged:metabolismbone remodelingcell cyclereproductionKashin-Beck diseasesthyroid
Journal Article 2026-05-28 ✓ 3 Snippets Wang Q, Cheng WH.
In-Text Gene Mentions

…enzyme peroxiredoxin 6 (PRDX6) has been shown…

…ThisPRDX6-mediated pathway has attracte…

…discovery of thePRDX6- SEPHS2 interaction suggests…

Show Full Abstract

Selenium (Se) is an essential trace element whose physiological functions in redox regulation, immunity, and metabolism are primarily executed by 25 distinct human selenoproteins. While systemic Se status is maintained through a tightly regulated hepatic distribution hierarchy and receptor-mediated transport to vital organs, recent research has significantly advanced our understanding of the specific roles of individual selenoproteins. This review focuses on the thioredoxin-like family, comprising SELENOT, SELENOV, SELENOW, and SELENOH, which share a conserved Rdx fold but perform diverse, tissue-specific functions. SELENOT has been implicated in the development and function of catecholaminergic circuits and may contribute to the regulation of calcium homeostasis, while SELENOV appears to play a role in modulating energy balance, adiposity, and hepatic responses to stress resistance. Emerging evidence suggests that SELENOW may play roles in muscle maintenance, bone remodeling, and inflammation resolution, with potential involvement in neuroprotection via regulation of tau homeostasis. Finally, the nuclear-localized SELENOH preserves genomic stability and is involved in cell cycle progression. By integrating findings from molecular pathways and physiological data from knockout mouse models, this review highlights the roles of these four proteins in supporting cellular viability and physiological homeostasis under conditions of oxidative and metabolic stress.

Also flagged:Venous Thromboembolismcoagulationintramuscular venous thrombosisdeep vein thrombosisDVTpulmonary embolism
Journal Article 2026-05-28 No Snippets Gou Y, Huang C, Du WJ, Zhang JF, Feng K.
Show Full Abstract

<h4>Background</h4>Venous thromboembolism (VTE) is a major contributor to morbidity and mortality in severe trauma (ST) patients. Platelet count (PLT), fibrinogen level (FIB), and D-dimer level are important coagulation indicators; however, few studies have described their trajectory in ST and assessed predictive value for VTE in clinical and nursing practice.<h4>Objective</h4>To describe the trajectories of PLT, FIB, and D-dimer on days 1, 3, 5, and 7 after ST, and to evaluate their predictive value for post-traumatic VTE.<h4>Methods</h4>Clinical data, including PLT, FIB, and D-dimer, were retrospectively collected from 184 ST patients. Univariate analysis and multivariate logistic regression analysis were used to identify independent risk factors for intramuscular venous thrombosis (IMVT), deep vein thrombosis (DVT), and pulmonary embolism (PE) in ST patients. Receiver operating characteristic (ROC) curve analysis was performed to evaluate the predictive performance of these independent risk factors.<h4>Results</h4>PLT showed a decreasing trend from day 1 to day 3 after trauma, followed by an increasing trend from day 3 to day 7. FIB dropped sharply to the lowest value on day 1 after trauma and then gradually increased. D-dimer surged sharply to the peak on day 1 after trauma, decreased gradually in the first 3 days, and then increased slowly from day 3 to day 7. Multivariate logistic regression analysis identified D-dimer level on day 5 as an independent risk factor for both IMVT (OR=1.133, 95% CI: 1.032-1.243; P=0.009; AUC=0.561) and PE (OR=1.085, 95% CI: 1.016-1.160; P=0.015; AUC=0.721). PLT and FIB were not identified as independent risk factors for IMVT, DVT, or PE.<h4>Conclusions</h4>This study demonstrated that while the dynamic changes in PLT, FIB, and D-dimer can reflect the transition of coagulation status after ST, their value as independent VTE predictive tools is limited. In clinical and nursing practice, it is crucial to determine the timing of coagulation status transition after trauma and explore the optimal timing for pharmacological prophylaxis.

Also flagged:hyperglycemiahypoglycemiasynthesis
Journal Article 2026-05-28 No Snippets Comisso I, Fonda F, Bressan S, Vuerich F, Maserin M, Narduzzi B, Bove T.
Show Full Abstract

<h4>Background</h4>Glycemic control involves methods for measuring, evaluating, and correcting blood glucose levels to maintain glucose homeostasis. It is essential to reduce hyperglycemia-related complications while minimizing the risk of hypoglycemia, and registered nurses (RNs) play a key role in blood glucose monitoring and insulin therapy management in the intensive care unit (ICU).​.<h4>Objectives</h4>To provide a thorough synthesis of nursing perspectives on glycemic control practices for critically ill adult patients admitted to the ICU.<h4>Methods</h4>We conducted a narrative review of the literature using PubMed, Scopus, CINAHL, and Google Scholar, complemented by manual searches of relevant scientific society websites, textbooks, and reference lists.<h4>Results</h4>Available evidence suggests initiating glycemic control for persistent hyperglycemia at ≥180 mg/dL (10 mmol/L) and titrating therapy to an individualized target based on patient evaluation. Arterial blood samples should be prioritized for glucose measurement when available, followed by venous and capillary sampling, individualizing the monitoring frequency. Continuous intravenous insulin infusion is generally recommended, guided by a standardized protocol specifying treatment thresholds, target ranges, insulin infusion adjustments, and monitoring frequency.<h4>Conclusions</h4>This narrative review summarizes nursing perspectives on glycemic control in critically ill adult ICU patients, including glucose measurement, individualized monitoring frequency, and protocol-based intravenous insulin infusion management. Evidence gaps remain regarding the optimal application of these approaches, and nursing research should focus on both patient-centered and organizational outcomes.

SOX6
Also flagged:tokyphoscoliosisScoliosisadolescent idiopathic scoliosispathogenesisDuchenne Muscular Dystrophy
Journal Article 2026-05-28 ✓ 1 Snippet Williams-Ward VC, Wanders K, Hughes SM.
In-Text Gene Mentions

…PAX3 , LBX1,SOX6and GPR126 )…

Show Full Abstract

Scoliosis affects 2-3% of people, often developing during and after adolescence, and currently has a lifetime chance of surgical intervention of ~0.1% in high income countries. Understanding of causal genetic and environmental factors is improving, with mechanical feedback interactions between the neuromuscular and skeletal systems thought to be important. While examining mechanosignalling in the zebrafish musculoskeletal system, we observed transient expression of yap1 mRNA in precursor cells of muscle and notochord and wwtr1 mRNA accumulation in differentiated muscle. Yap1 and Wwtr1/Taz are transcriptional coactivators that mediate Hippo pathway signalling, often in response to mechanosignals. Loss of function mutation of either gene alone transiently altered early larval motility and reduced survival to adulthood, but mutation of yap1 specifically diminished overall growth without an obvious histological muscle defect. Yap1 mutants had a temperature-sensitive phenotype of oedema in cardiac and other tissues, which could be rescued by rearing at low temperature. Rescued yap1 mutants showed focal defects in hypochordal col8a1a mRNA expression at 1-2 days post-fertilisation (dpf), an early motility defect at 5 dpf and subsequently developed a fully penetrant vertebral dysmorphology, reflected by a decrease in posterior vertebral height. Thereafter, frank kyphoscoliosis accompanied by additional vertebral defects developed in around a third of the surviving yap1 mutants and was first detected at 11 dpf. Thus, the mild initial vertebral defect can, in a predisposing genetic or environmental background, gradually develop into full kyphoscoliosis through a positive feedback mechanism, analogous to the Hueter-Volkmann 'Law'. Although the cell type/s of cell autonomous yap1 action remain unclear, we hypothesise that Yap1 mechanosensation mediates feedback between bone, muscle and tendon to restrain vertebral overgrowth and protect against the development of kyphoscoliosis.

Also flagged:Obesitychronic diseasescardiovascular diseasediabetes mellituscancermusculoskeletal disorders
Journal Article 2026-05-28 No Snippets Jiang N, Song Y, Wang Z, Dong Y, Wang Q, Wu H, Gao X, Song Y, Cui Y.
Show Full Abstract

<h4>Objective</h4>Regular exercise reduces the risk of obesity, but the impact of endurance exercise on skeletal muscle metabolic processes remains incompletely understood. This study investigated the effects of endurance exercise on the transcriptome and metabolome of skeletal muscle in obese mice.<h4>Method</h4>Transcriptomic and metabolomic profiling of skeletal muscle samples was performed across experimental groups to identify differentially expressed genes and differential metabolites. Functional enrichment of DEGs and metabolites was analyzed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. Integrated pathway-level analysis was conducted using iPath 3.0.<h4>Results</h4>Integrated transcriptomic and metabolomic analysis indicated that endurance exercise altered lipid metabolism, amino acid metabolism, and nucleotide metabolism pathways in the skeletal muscle of obese mice. Specifically, endurance exercise downregulated the expression of lipid metabolism-related gene Acot2, amino acid metabolism-related gene Nos2, and carbohydrate metabolism-related genes Itpkb and Inpp4b. Furthermore, endurance exercise decreased the levels of palmitic acid, arachidonate, phosphatidylcholine, acetylcholine, hypoxanthine, urea, and acetyl-CoA.<h4>Conclusions</h4>Endurance exercise positively impacts skeletal muscle metabolic health in obese mice through coordinated regulation of multiple metabolic pathways and reduction of specific metabolites.

PLCL1
Also flagged:colorectal cancertumorcancerscancersolid tumorsMismatch
Journal Article 2026-05-28 ✓ 1 Snippet Cheng J, Lu J, Gao Z, Xiao Y, Chen P, Zhou M, Huang D, Zhao Z, Zhang X, Zhao Y, Li M, Gu J.
In-Text Gene Mentions

…activation pathways (PLCL1, 37 RASA3…

Show Full Abstract

<h4>Background</h4>Many patients with cancer benefit little from immune checkpoint blockade (ICB), a major obstacle to immunotherapy for decades. Finding alternative immune checkpoints that control CD8<sup>+</sup> T-cell exhaustion is urgent if we are to improve the efficacy of immunotherapies, particularly in microsatellite stable (MSS) colorectal cancer (CRC) that is resistant to ICB.<h4>Methods</h4>Spatial proximity is essential for suppressive ligand-receptor signaling. Here, we mapped the spatial tumor microenvironment of patients with MSS CRC at single-cell resolution and analyzed the cells interacting with exhausted CD8<sup>+</sup> T cells to identify immune checkpoint ligand-receptor pairs. To investigate the function of this previously unrecognized immune checkpoint, we performed validation studies spanning cellular experiments, mouse models, and clinical patient samples.<h4>Results</h4>We found that a subset of MSS CRC exhibits substantial CD8<sup>+</sup> T-cell infiltration, but their function is suppressed. We identified CLEC2B (ligand)-KLRB1 (receptor) as a novel inhibiting ligand-receptor pair for CD8<sup>+</sup> T cells. KLRB1 acts as an immune checkpoint receptor, increasing CD8<sup>+</sup> T-cell exhaustion and facilitating immune escape in various human cancers. Binding of CLEC2B to KLRB1 initiates immunosuppressive signaling in CD8<sup>+</sup> T cells. Clinically, CLEC2B-KLRB1 expression correlates positively with cancer progression and poor response to ICB, demonstrating that KLRB1<sup>+</sup> CD8<sup>+</sup> T cells are a key marker of the poorly responsive ICB subtype. Furthermore, blocking CLEC2B-KLRB1 signaling with antibodies enhances the antitumor function of CD8<sup>+</sup> T cells, providing a potential immunotherapy target for ICB non-responders.<h4>Conclusions</h4>Our study revealed CLEC2B-KLRB1 as a previously unrecognized immune checkpoint axis that drives T-cell exhaustion specifically in ICB poor responsive MSS CRC. Blockade of KLRB1 with a therapeutic antibody reinvigorated CD8<sup>+</sup> T-cell antitumor immunity, positioning this axis as a promising target for enhancing immunotherapy efficiency in malignancies, including CRC and other ICB-resistant cancers.

PRDX6
Also flagged:chronic pancreatitisCPfibroinflammatory disorderchronic diseasesimmune responsesferroptosis
Journal Article 2026-05-28 ✓ 1 Snippet Tong J, Wu JW, Zou WB, Mao XT, Li YH, Zhu HB, Cao Q, Zhang Z, Zhang Y, Yin H, Zhang JB, Shen FM, Li DJ, Liao Z, Wang P.
In-Text Gene Mentions

…Proteomic profiling identifiedPRDX6as a muscle-derived…

Show Full Abstract

<h4>Background</h4>Chronic pancreatitis (CP) is a progressive fibroinflammatory disorder with persistent immune activation and limited therapeutic options. While physical activity (PA) benefits many chronic diseases, it is often presumed neutral or potentially harmful in CP.<h4>Objective</h4>To assess whether PA protects against CP and defines the underlying mechanisms.<h4>Design</h4>We analysed the association between PA and CP risk in the UK Biobank cohort (>500 000 participants) and validated findings in an independent clinical cohort. In mice, experimental CP was induced and the effects of exercise interventions on pancreatic injury, fibrosis and immune responses were evaluated via histopathology, immunohistochemistry, flow cytometry, bulk and single-cell RNA-sequencing and proteomics.<h4>Results</h4>In the UK Biobank, regular PA was independently associated with a lower risk of CP. This association was consistent across alcohol intake strata and disease subtypes. Consistently, physically active patients with CP exhibited milder clinical manifestations. In mice, exercise interventions, including both preconditioning and postdisease initiation, attenuated pancreatic injury, fibrosis and ferroptosis, with resistance exercise providing greater protection. Mechanistically, skeletal muscle-derived extracellular vesicles (EVs) induced by PA accumulated within inflamed pancreata and dampened mitochondrial DNA-driven innate immune activation while promoting inflammation-resolving states, at least in part through modulation of myeloid stimulator of interferon genes (STING) signalling. Importantly, inhibition of EV release partially attenuates these protective effects. Proteomic profiling identified PRDX6 as a muscle-derived vesicular factor that inhibits ferroptosis and, by binding to the zinc-thumb motif of cyclic GMP-AMP synthase, contributes to suppression of STING activation and inflammatory damage.<h4>Conclusion</h4>PA restrains CP progression by reprogramming pancreatic immune responses and ferroptosis pathways.

DCC
Also flagged:oligodendrocyte differentiationendosomechronic headachefibromyalgiamigraineosteoarthritis
Journal Article 2026-05-28 ✓ 3 Snippets Harlow CE, Uzochukwu E, Fernando HA, Mordaunt CE, Hughey JM, Eicher JD, Robinson L, Bowker N, Howe L, Liu J, Cortes A, Wilson P, Gungabissoon U, Benson VS, Nash A, Young G, Addis L, Xu CF, Webber C, Davitte J, Cader MZ.
In-Text Gene Mentions

…reported (e.g. SLC39A8,DCC, TRPM8) associations.…

…For example,DCC, which encodes…

…(containing genes includingDCC, SEMA3B and…

Show Full Abstract

Pain-related conditions are the leading cause of disability worldwide. Existing GWAS for chronic pain have mainly focused on individual pain-related disorders, which may not optimally capture the phenotype. Here, we define chronic pain based on prescription analgesic use ( ≥ 90 days) in two large biobanks (UK Biobank and FinnGen). GWAS meta-analyses of 11 prescription-based pain phenotypes identify 140 associations with chronic pain, including 78 novel (e.g. ARPP21, CNTNAP2) and 62 previously reported (e.g. SLC39A8, DCC, TRPM8) associations. Integrating these genetic associations with functional data including transcriptome-wide association studies, cell-type and pathway enrichment, and gene enrichment in mouse phenotypes identifies potential mechanisms involved in chronic pain, implicating oligodendrocyte differentiation, neuronal guidance, endolysosomal function and post-synaptic endosome recycling. Our study showcases how the use of prescription data to identify and characterize pain can provide insights into pain genetics and its underlying biology.

Also flagged:-positive breast cancerbreast cancerpositive breast cancerendocrine resistanceagingbrain metastases
Journal Article 2026-05-28 No Snippets Fox MS, Jaramillo-Gómez JA, Marquez-Ortiz RA, Alvarez-Eraso KLF, Contreras-Zárate MJ, Pham TC, Barela EN, Koliavas SN, Kabos P, Serkova NJ, Sartorius CA, Wellberg EA, Cittelly DM.
Show Full Abstract

Estrogen receptor-positive breast cancer represents a significant proportion of breast cancer brain metastasis but remains understudied. Here we show that FGFR1-amplification, a well-established driver of estrogen receptor-positive breast cancer endocrine resistance, promotes estrogen receptor-positive breast cancer brain metastatic colonization in young and aged female mice, through both canonical FGF2/FGFR1 signaling and non-canonical NCAM1/FGFR1 interactions. Astrocytic FGF2-mediated paracrine activation of FGFR1 promotes breast cancer brain metastasis in estrogen-treated young mice, but FGF2 levels and signaling decrease in the brain with aging and estrogen-depletion. Neuronal and astrocytic NCAM1, which remain unchanged in young and aged brains, promote adhesion to neurons, migration, and growth of estrogen receptor-positive cells, suggesting that interactions with astrocytes and neurons facilitate early estrogen receptor-positive breast cancer brain metastasis colonization through FGFR1. Importantly, FDA-approved FGFR inhibitors effectively block early colonization but not late-stage brain metastases, suggesting prevention of FGFR1+ brain metastases as a window of opportunity for FGFR1 inhibitors.

Also flagged:bone formationosteoporosisosteogenesisosteoblast differentiationsenile osteoporosismetabolic bone disorder
Journal Article 2026-05-28 No Snippets Tang CY, Han YX, Wu HX, Jiang HL, Wen Y, He Q, Liu Y, Liu H, Feng G, Luo YF, Wang M, Ma Y, Zhou HD, Liu M.
Show Full Abstract

<h4>Background</h4>Osteoporosis, characterized by reduced bone mass and increased fracture risk, underscores the urgent need for novel anabolic therapies. G protein-coupled receptors (GPCRs) are major drug targets, but the functions of adhesion GPCRs (aGPCRs) in bone remain largely unexplored. G-protein coupled receptor 125 (Gpr125) is an orphan aGPCR, and its role in osteoblast-mediated bone formation is entirely unknown.<h4>Methods</h4>We employed lentiviral-mediated knockdown and overexpression of Gpr125 in primary mouse calvarial osteoblasts and bone marrow stromal cells (BMSCs). Osteogenic and adipogenic differentiation were assessed by staining and marker analysis. Transcriptomic profiling (RNA-seq) and pathway analysis were used to identify downstream mechanisms, validated by rescue experiments with Gper1 overexpression, PI3K/AKT inhibitors (LY294002), and Wnt/β-catenin activation (Wnt3a CM). The osteogenic role of Gpr125 was tested in ovariectomized and aged mouse osteoporosis models via osteoblast-targeted adeno-associated virus (AAV) delivery.<h4>Results</h4>Gpr125 was highly expressed in osteoblasts, peaking during differentiation. Its knockdown severely impaired osteogenesis while promoting adipogenesis in vitro. Conversely, its overexpression enhanced bone formation. RNA-seq identified G protein-coupled estrogen receptor 1 (Gper1) as the key downstream target. We defined a novel signaling axis where Gpr125 upregulates Gper1, which activates PI3K/AKT signaling, leading to β-catenin stabilization and osteogenic transcription. Rescue experiments established a strict hierarchy: Gper1 overexpression fully rescued the osteogenic defect caused by Gpr125 loss, but not Gpr125 expression itself. PI3K inhibition blocked Gpr125-induced β-catenin activation and osteogenesis. β-catenin activation partially rescued osteogenesis but failed to restore upstream signaling. Critically, osteoblast-specific Gpr125 overexpression in vivo effectively ameliorated bone loss and reduced marrow adiposity in both postmenopausal and senile osteoporosis mouse models.<h4>Conclusions</h4>Our study unveils a complete Gpr125-Gper1-PI3K/AKT-β-catenin signaling axis essential for osteoblast differentiation and bone formation. This work identifies the aGPCR Gpr125 as a novel positive regulator of bone anabolism and proposes the Gpr125-Gper1 axis as a promising therapeutic target for developing new treatments against osteoporosis.

Also flagged:NSCLCbrain metastasesantigen presentationnon-small cell lung cancercancerprimary tumors
Journal Article 2026-05-28 No Snippets Vilariño N, de Rodas ML, Villalba-Esparza M, Rajendran BK, Huang B, Hijazo-Pechero S, Costantini A, Ranjan K, Ramos-Paradas J, Lu BY, Nadal E, Goldberg SB, Nguyen DX, Schalper KA.
Show Full Abstract

<h4>Background</h4>Patients with lung cancer brain metastases can benefit from immune checkpoint inhibitors (ICI). However, intracranial responses are often limited and not always concordant with activity seen in extracranial disease. Defects in IFNγ signaling and HLA class-I antigen presentation machinery (APM) on malignant cells can drive immune evasion and ICI resistance, and have traditionally been viewed as interdependent. The possible role of these alterations in non-small cell lung cancer (NSCLC) brain progression remains poorly understood.<h4>Methods</h4>Using multiplex quantitative immunofluorescence, we measured and spatially mapped IFNγ signaling markers (pSTAT1 and IRF1) and multiple HLA class-I APM components (β2M, PSMB8, PSMB9, PSMB10, TAP1, TAP2, Tapasin, Calreticulin, and ERp57) in cancer cells and neighboring non-malignant stromal cells from two patient cohorts, including primary tumors, intra- and extra-cranial NSCLC metastases. We also studied tumor-infiltrating lymphocyte (TILs) subpopulations in the cohorts, performed whole transcriptomic analysis of parental human NSCLC H2030 cells and their brain metastatic counterpart H2030-BrM3, and expanded the results using spatial transcriptomics of human tumors.<h4>Results</h4>We found comparable levels of IFNγ signaling markers in primary and metastatic lesions and marked downregulation of multiple APM components in metastases, some of which were restricted to the brain. Downregulation of HLA class-I APM components was associated with reduced effector TILs and worse survival. Analysis of human parental H2030 and brain metastatic H2030-BrM3 lung adenocarcinoma cells showed comparable signaling responses after IFNγ stimulation and reduced HLA class-I APM markers in metastatic cells. Transcriptomic analysis of primary/metastatic cells and human tumors identified differential expression of multiple genes associated with HLA class-I APM downregulation.<h4>Conclusions</h4>Our results reveal that APM downregulation is a prominent feature of NSCLC brain metastases, is independent from local IFNγ signaling defects and is associated with unfavorable clinical features. We also identified candidate modulators of the APM pathway in brain metastases with potential translational significance.

Also flagged:metabolismnucleusextracellularLOADagingjunctions
Journal Article 2026-05-28 No Snippets Guan Y, Cheng CH, Khanna SD, Fader C, Ohene Y, Wells JA, Koo BB.
Show Full Abstract

<h4>Background</h4>The Apolipoprotein-E ε4 (APOE4) allele is the strongest genetic risk factor for late-onset Alzheimer's disease (LOAD) and may contribute to neurodegeneration through a multi-hit hypothesis, in which vascular dysfunction, glial activation, and impaired lipid metabolism play central roles. Alterations in neurovascular unit (NVU) have emerged as an early APOE4-related phenotype, independent of amyloid and tau pathology. Astrocytes, as the primary source of APOE in the brain and key regulators of NVU homeostasis, may play a central role in these processes. This study investigates APOE4-associated NVU water exchange dynamics and astrocyte-vascular interactions using integrated in vivo MRI, ex vivo histology, and transcriptomic profiling.<h4>Methods</h4>Non-contrast multimodal MRI, including multi-echo time arterial spin labeling (multi-TE ASL), T1-weighted imaging, and diffusion-weighted MRI, were applied in 6-9-month-old APOE3-KI and APOE4-KI mice. Multi-TE ASL was used to estimate regional NVU water exchange dynamics, while diffusion MRI assessed tissue microstructural alterations. Immunohistochemistry evaluated perivascular matrix metalloproteinase-9 (MMP9) activity, vascular-associated markers, astrocytic AQP4 expression, and glial reactivity. Single-nucleus RNA sequencing (snRNAseq) characterized cell-type-specific transcriptional profiles, and inferred cell-cell communication analysis between astrocytes, pericytes, and other NVU components. Integrated analyses compared MRI-derived measures with molecular and cellular findings.<h4>Results</h4>APOE4-KI mice showed regionally specific alterations in NVU water exchange dynamics, particularly in the hippocampus, accompanied by trends toward altered microstructural complexity. Immunohistochemistry demonstrated increased perivascular MMP9 expression and evidence of extracellular matrix remodeling without prominent structural disruption of blood-brain barrier (BBB) markers in APOE4 mice. Astrocytes showed increased AQP4 expression, heightened proinflammatory gene signatures, and morphological reactivity. Molecular findings aligned with MRI, supporting the sensitivity of non-contrast MRI to early NVU alterations. Exploratory snRNAseq suggested an APOE4-enriched astrocyte subpopulation associated with immune activation and matrix-related pathways and suggested potential glial-vascular interactions that require validation in larger samples.<h4>Conclusions</h4>This integrated imaging and molecular analysis suggests that non-contrast multimodal MRI detects early APOE4-related changes in NVU exchange dynamics and glial-vascular interactions. By providing converging multiscale neuroimaging and cellular observations, this work provides a foundation for developing non-invasive biomarkers to monitor neurovascular vulnerability and guide early intervention strategies in individuals at risk for LOAD.

HTT
Also flagged:agingHDgene expressionnucleustranslationalneurodegenerative disorder
Journal Article 2026-05-28 ✓ 5 Snippets Robbins AB, Ranum PT, Huerta-Ocampo I, Kuckyr M, Davidson BL.
In-Text Gene Mentions

…of huntingtin (HTT), producing a…

…Although mutantHTT(mHTT) is expressed…

…the endogenous mouseHttpromoter, recapitulating the…

…with primers humanHTTexon 1 specific…

…Nucleolin, a predictedHTTinteractor encoded by…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) involves progressive corticostriatal dysfunction, yet the temporal dynamics and cell type-specific vulnerability patterns remain incompletely understood. While recent single-cell studies in rapidly progressing models have revealed early developmental and regional changes, temporal profiling distinguishing pathogenic mechanisms from normal aging in full-length HTT models remains lacking. Resolving stage-specific temporal dynamics across interconnected striatal and cortical neuronal populations over protracted time is essential for identifying drivers of cellular dysfunction.<h4>Methods</h4>A temporal single-nucleus transcriptomic atlas was generated from striatum and motor cortex from heterozygous zQ175 knock-in mice at early symptomatic (6 months) and late symptomatic (18 months) stages. This full-length huntingtin model enables staging of progressive circuit dysfunction alongside physiological aging. The high inherited CAG repeat length of the zQ175 model places cells beyond the somatic expansion threshold associated with transcriptional dysregulation and identity erosion in vulnerable human neuronal populations, yet prior to the de-repression crisis and cell loss observed at the most extreme expansions in HD, providing a tractable window into the progressive molecular pathogenic cascade. Genotype-dependent effects were modeled to distinguish cell type-specific signatures of disease mechanisms from age-related and compensatory changes. Integration of weighted gene co-expression and transcription factor regulatory networks with protein-protein interaction databases predicted candidate regulators of stage-specific programs. Findings were validated across human HD datasets and the rapidly progressive R6/2 mouse model.<h4>Results</h4>Temporal gene and network analysis revealed diverging, converging and biphasic patterns of transcriptional changes, distinguishing progressive disease and neuronal identity loss from aging. 21 cell type-specific gene co-expression modules were validated in human HD and R6/2 mice datasets, revealing stage-specific shifts in cellular stress, proteostasis, and synaptic programs. Disease modules enriched for CAG repeat length-dependent genes resolved their temporal progression. Shared vulnerability across cortical and striatal projection neurons implicated epigenetic regulator Zswim6 and splicing factors Rbfox1 and Celf2 in corticostriatal dysfunction. Integrative network analysis identified Foxo1, Neurod2, and Npas2 as stage-specific transcriptional regulators. Cross-species validation established conserved gene regulatory modules in human HD, establishing generalizable cell type-specific gene modules of translational relevance.<h4>Conclusions</h4>This temporally resolved atlas reveals stage-specific transcriptional dynamics of disease-relevant gene expression programs and physiological trajectories in vulnerable neuronal populations. distinguished from aging alone. This work establishes an important framework for understanding the temporal and regional coordination of pathogenic mechanisms, providing molecular insights into stage-specific therapeutic intervention.

NEGR1
Also flagged:agingmegakaryocyte differentiationpathogenesiscarcinogenic disordershematopoiesisosteogenesis
Journal Article 2026-05-28 ✓ 1 Snippet Qin Y, Zhao Z, Chen Y, Zheng Y, Ma K, Lin D, Liu X, Wang Y.
In-Text Gene Mentions

…( Fcrl5 ,Negr1, Cd300e ,…

Show Full Abstract

Marrow senescence contributes to overall organismal aging and involves functional alterations in both the mesenchymal and hematopoietic compartments of bone marrow. Although matrix remodeling-associated 7 (<i>MXRA7</i>) has been demonstrated to modulate mesenchymal function and megakaryocyte differentiation in mice, this study aimed to investigate the potential role of <i>MXRA7</i> in marrow senescence. Single-cell RNA sequencing was performed on bone marrow cells from young and aged wild-type and <i>MXRA7</i>-knockout mice. Comparative analysis of 2-month-old and 2-year-old mice revealed that aging significantly altered the cellular proportions within the bone marrow niche, and <i>MXRA7</i> deficiency markedly increased Macro1 macrophages in aged mice, likely driven by the dysregulation of the <i>Ccl24-Ccr3</i> axis. <i>MXRA7</i> deficiency altered Mid1 expression and the macrophage migration inhibitory factor (<i>Cd74 + Cxcr4</i>), <i>Ccl6 + Ccr2</i>, and Von Willebrand factor signaling pairs (<i>Itga2b + Itgb3</i>), all of which are closely associated with cell status in the bone marrow microenvironment. In summary, these findings underscore <i>MXRA7</i>'s role in cellular profile shifts during bone marrow aging, offering novel insights into how <i>MXRA7</i> coordinates hematopoietic and immune homeostasis in the bone marrow.

Also flagged:extracellularchondrogenesischondrocyte differentiationskeletal diseasesteratocarcinomafibrils
Journal Article 2026-05-28 No Snippets Klawonn A, Tholen S, Skatulla I, Schröder CM, Arnold SJ, Schilling O, Schmidts M.
Show Full Abstract

Cartilage is characterized by a highly specialized extracellular matrix (ECM) secreted by chondrocytes and limited self-regenerative capacity. In vivo investigations of chondrogenesis are limited by difficult and traumatic access, especially in humans. While it is known for decades that disturbances of chondrocyte differentiation and changed cartilage ECM composition cause severe skeletal phenotypes in vertebrates, a detailed molecular understanding of chondrogenesis and cartilage ECM formation is still missing, especially in the context of human genetic skeletal diseases. ATDC5 cells, derived from AT805 mouse teratocarcinoma cells, have been used in the past to model chondrogenic differentiation, however, most studies have investigated few major cellular differentiation markers only so that the composition of the secreted ECM as well as effects on the ATDC5 transcriptome upon differentiation are still unclear. Here, we performed time-resolved transcriptomic and ECM proteomic analyses of differentiating ATDC5 cells. Both datasets confirmed the formation of a cartilage-like matrix with increasing expression of key chondrocyte genes over the course of differentiation. ECM proteomics further revealed a number of ECM components not previously reported in ATDC5 cells or the secreted ECM, encompassing collagens, proteoglycans, glycoproteins and other secreted factors. Overall, our findings provide a more detailed molecular characterization of ATDC5 chondrogenesis and highlight the potential of this model system for ECM-focused studies.

Also flagged:Peripheral nerve injuryaxonalaxongenetic disordersimmune responsesbasal lamina
Journal Article 2026-05-28 No Snippets Zhu S, Cui R, Qiu S, Zhang X, Ma J, Duan W, Li P, Quan D, Yang Z, Zhang S, Rao Z, Bai Y.
Show Full Abstract

Peripheral nerve injury (PNI), especially those with long-distance transected defects, remains a major clinical challenge due to limited regenerative capacity associated with inadequate endogenous Schwann cell (SC) support. Here, we developed a biomimetic nerve graft with a defined spatial gradient of immobilized SCs to facilitate effective transplantation and axonal guidance, thus enhancing peripheral nerve regeneration. SCs were initially encapsulated within decellularized nerve matrix (DNM) microgels using a customized flow-focusing microfluidic device. The DNM microgels supported good viability, facilitated cellular proliferation, and preserved the repair phenotype of the encapsulated SCs, while maintaining their advantageous paracrine activity conducive to axon extension. Furthermore, these microgels were incorporated into the density-gradient pores of a pre-designed scaffold, resulting in a gradient SC-laden scaffold, designated as MGs@G-scaffold. Notably, the spatially graded SCs within the MGs@G-scaffold created a stable environmental gradient of neurotrophic factors, thereby providing sustained biochemical cues to guide axonal elongation. Finally, when transplanted into a 15-mm rat sciatic nerve defect model, the SC-laden scaffolds exhibited significantly improved axonal regeneration, remyelination, and functional recovery compared with the SC-free scaffolds. Additionally, MGs@G-scaffolds outperformed scaffolds with uniform SC distribution (MGs@H-scaffolds), achieving therapeutic outcomes comparable to autografts. Overall, this study demonstrates that transplanting spatially graded SCs embedded in a tissue-engineered bioactive scaffold offers sustained ongoing support for cells, gradient biochemical signals, and a pro-regenerative microenvironment for nerve regeneration and functional recovery, which holds great promise for long-distance PNI repair.

CACNA1E
Also flagged:neurotransmitterneurogenesislong-term potentiationbrain developmentcell-cycle-relatedcell cycle
Journal Article 2026-05-28 ✓ 1 Snippet Al Rayyes I, Louhivuori L, Ellström ID, Smedler E, Uhlén P.
In-Text Gene Mentions

…further enriched forCACNA1Eand CACNA1A .…

Show Full Abstract

Calcium (Ca<sup>2+</sup>) signaling is a key regulator of brain function and development. Here, we comprehensively analyze the Ca<sup>2+</sup> signaling transcriptome in the adult mouse brain and the developing human brain to reveal the basis of signaling specificity. We show that neurons organize into non-stochastic Ca<sup>2+</sup> states that reflect cell-type identity and capture subtle functional differences. These states arise from lineage-specific developmental Ca<sup>2+</sup> programs that are detectable already in progenitor stages, and may precede differentiation into mature neuronal cell types. During neocortical development, many Ca<sup>2+</sup> signaling genes, such as <i>ADGRV1, NCALD,</i> and <i>CREB5</i>, peak at distinct developmental stages, are evolutionarily conserved, and reflect transcriptional heterogeneity within progenitors associated with cell-fate decisions. Together, our findings provide an in-depth understanding of how a tightly regulated Ca<sup>2+</sup> signaling transcriptome encodes cell-state-specific signaling programs and demonstrate that Ca<sup>2+</sup> signaling is precisely tailored to distinct cell states.

Also flagged:uveal melanomabreast cancerhigh-grade serous ovarian carcinomatumortelomerecancer
Journal Article 2026-05-28 No Snippets Almeida I, Lu X, Edwards SL, French JD, Bitar M.
Show Full Abstract

Short-read RNA sequencing (RNAseq) remains a cornerstone for transcriptome profiling, but is limited in reconstructing full-length transcripts and capturing transcript diversity. While long-read RNAseq spans entire transcripts and resolves complex structures, this technology is hindered by its high error rates. In parallel, noncoding RNA transcripts remain underrepresented in current references. Here, we present hybrid <i>de novo</i> RNA assembly (HyDRA), a pipeline that integrates the accuracy of short reads with the structural resolution of long reads to produce more complete <i>de novo</i> transcriptome assemblies. Benchmarking showed HyDRA to outperform existing methods by up to 40%. Using the HyDRA human ovarian metatranscriptome, we identified >50,000 high-confidence long noncoding RNAs, most of which have not been previously detected using traditional methods. Although long-read RNAseq is advancing, the vast availability of short reads ensures HyDRA's ongoing role in capturing high-confidence, cell-type-specific transcripts and advancing our understanding of transcriptomic complexity and the noncoding genome.

Also flagged:deathmood disordersneurotransmissiontranslationalmethylationmetabolic syndrome
Journal Article 2026-05-28 No Snippets Salehi M, Saeidi M, Amanat M, Barias T, Anyeji U, Alzein O, Gunturu S.
Show Full Abstract

<h4>Background</h4>Suicide is the second leading cause of death among children and adolescents, with rates of pediatric suicidal behavior rising substantially over the past two decades. The neurobiology of suicide has been extensively studied in adults, yet pediatric-specific evidence remains limited and the extent to which adult findings can be extrapolated to youth is unclear. This review synthesizes current evidence on the neurobiological correlates of suicidal ideation, suicide attempt, and death by suicide in pediatric and adolescent populations across neurological, genetic, epigenetic, inflammatory, metabolic, and endocrine domains.<h4>Methods</h4>A literature search was conducted in PubMed, Embase, PsycINFO, and Google Scholar for peer-reviewed, English-language human studies. Priority was given to pediatric and adolescent samples, with adult data included where pediatric evidence was lacking. Studies were grouped by biological domain and by suicidal phenotype.<h4>Results</h4>Suicidal ideation, suicide attempt, and death by suicide showed partially distinct biological signatures rather than lying on a single continuum of severity. Different markers, most notably cortisol regulation and stress-related DNA methylation, differed in direction between pediatric and adult cohorts, indicating that adult biomarker data cannot be directly extrapolated to youth. Findings converged on a developmental cascade in which genetic liability and early-life adversity influence the hypothalamic-pituitary-adrenal axis, with downstream effects on epigenetic regulation, neuroinflammation, neurochemistry, and frontolimbic circuitry.<h4>Conclusions</h4>Pediatric suicidal behavior reflects developmentally distinct biological processes that cannot be inferred from adult findings. Advancing the field will require longitudinal, multimodal pediatric studies that disaggregate suicidal phenotypes, span the pubertal transition, and apply age-stratified reference ranges, supporting biologically informed stratification and mechanism-targeted intervention.

TNFSF4
Also flagged:metastatic melanomatumormelanomasquamous non-small-cell lung cancerNSCLCclear-cell renal cell carcinoma
Journal Article 2026-05-28 ✓ 1 Snippet Hu Y, Xie Q.
In-Text Gene Mentions

…CD27, CD70, TNFRSF4,TNFSF4, TNFRSF9, TNFSF9); (iii)…

Show Full Abstract

Adaptive resistance limits durable benefit from immune checkpoint blockade (ICB) in the majority of cancer patients, yet the transcriptomic dynamics of the broader checkpoint landscape during treatment remain poorly characterized across tumor types. Here we present CheckDyn, a multi-cohort computational framework that profiles paired pre- and post-treatment transcriptomes to quantify treatment-induced changes across 38 immune checkpoint and exhaustion-associated genes and to predict adaptive resistance. We integrated publicly available RNA-seq and scRNA-seq data from 64 paired tumor samples spanning melanoma, basal cell carcinoma, and non-small-cell lung cancer (GSE91061, GSE120575, GSE123813, GSE176021), applying pseudo-bulk aggregation, Z-score batch correction, and Stouffer meta-analysis for cross-cohort harmonization. Paired Wilcoxon signed-rank testing and linear mixed-effects meta-analysis identified LAG3 (log<sub>2</sub>FC = 0.596, padj = 0.015), PDCD1 (log<sub>2</sub>FC = 0.810, padj = 0.003), TOX2 (log<sub>2</sub>FC = 0.605, padj = 0.003), CD274 (log<sub>2</sub>FC = 0.402, padj = 0.015), and IDO1 (log<sub>2</sub>FC = 0.381, padj = 0.026) as consistently upregulated post-treatment across cohorts. Co-expression network analysis revealed extensive rewiring, with ENTPD1 (ΔDegree = +0.297) emerging as the largest hub-degree shift, suggesting a shift toward metabolic immune suppression. Temporal trajectory modeling showed that all 38 checkpoint genes followed linear upregulation trajectories, with PDCD1 and LAG3 carrying the steepest slopes. An ensemble classifier combining logistic regression and random forest on pre-to-post expression deltas achieved an area under the receiver operating characteristic curve (AUC) of 0.812 (95% CI: 0.694-0.930; 5-fold cross-validated AUC = 0.806) for adaptive resistance prediction across n = 59 patients with available response annotations. These findings establish a consistent transcriptional signature of compensatory checkpoint upregulation during ICB therapy and provide a data-driven framework for early identification of adaptive resistance that warrants external prospective validation.

bioRxiv 2026-05-28 Preprint (No Snippets API) Iwakoshi-Ukena E, Suzuki M, Furumitsu M, Shimanoe N, Narimatsu Y, Ukena K, Ogino H.
Show Full Abstract

<h4>Background</h4> Ectothermic vertebrates exhibit substantial physiological plasticity in response to environmental temperature fluctuations. Among them, amphibians show particularly pronounced metabolic adjustments under cold conditions; however, the molecular mechanisms by which the liver adapts to low temperatures remain poorly understood. To address this gap, we investigated the hepatic transcriptional response to cold exposure in the African clawed frog ( Xenopus laevis ) using RNA sequencing (RNA-seq) and quantitative PCR. <h4>Results</h4> Exposure to 5°C for five days in X. laevis resulted in pronounced hyperglycemia and extensive transcriptional reprogramming in the liver. RNA-seq analysis indicated that, relative to frogs maintained at 24°C, 2,392 genes were upregulated, whereas 2,031 genes were downregulated. Notably, genes associated with gluconeogenesis, such as foxo1 , g6pc1 , and pck1 , exhibited significant upregulation, whereas genes related to glycolysis and glucose utilization, including gck , pfkm , and ldhb , were downregulated. Concurrently, cold exposure induced the expression of genes involved in fatty acid synthesis, desaturation, and cholesterol biosynthesis, such as srebf1 , acaca , fasn , scd , fads2 , srebf2 , and hmgcr . Conversely, genes related to fatty acid β-oxidation, including ppara , cpt1a , cpt1b , slc25a20 , acadl , hadha , and hadhb , were significantly suppressed. In alignment with this pattern, multiple components of the mitochondrial electron transport chain and ATP synthesis machinery were also downregulated. Additionally, gene groups involved in antioxidant defenses, such as gpx4 , gpx1 , prdx2 , prdx5 , prdx6 , and ferritin-related genes, were upregulated. Representative transcriptomic changes were validated using quantitative PCR analysis. <h4>Conclusions</h4> Exposure to cold temperatures induced coordinated metabolic reprogramming in the liver of X. laevis . This reprogramming was characterized by the activation of gluconeogenesis, suppression of glycolysis, fatty acid β-oxidation, and oxidative phosphorylation, and induction of lipid and cholesterol biosynthetic pathways. These metabolic adjustments suggest that frogs acclimated to cold conditions adopt an energy-conserving metabolic strategy while sustaining glucose production and promoting lipid remodeling to adapt to low-temperature environments. These findings offer novel insights into the molecular mechanisms underlying cold adaptation in ectothermic vertebrates and underscore the pivotal role of the liver in managing transcriptional responses to cold stress.

Also flagged:Cancertumorsacute kidney injurychronic kidney diseaseprogrammed cell deathpyroptosis
Journal Article 2026-05-27 No Snippets Yuan C, Jiang J, Ji J, Ni L.
Show Full Abstract

<h4>Background</h4>Cisplatin is a first-line chemotherapeutic agent widely used in clinical oncology, but its clinical utility is severely limited by cisplatin-induced acute kidney injury (Cis-AKI). Renal tubular epithelial cells (RTECs) are the main target of cisplatin-induced damage, and the pathogenesis involves oxidative stress, inflammatory response, and multiple types of programmed cell death. As a core mitochondrial quality control mechanism, mitophagy is closely related to the above pathological processes, but its overall regulatory network in Cis-AKI remains to be systematically clarified.<h4>Main body</h4>This review systematically summarizes the core pathological mechanisms of cisplatin-induced nephrotoxicity, including mitochondrial dysfunction, oxidative stress, inflammation, apoptosis, pyroptosis, and ferroptosis. It focuses on the molecular pathways of mitophagy (PINK1/PARKIN-dependent and -independent pathways), the bidirectional crosstalk between mitophagy and the aforementioned pathological events, and the dual role of mitophagy in Cis-AKI. In addition, this review collates preclinical progress of mitophagy regulators and their renoprotective effects, and analyzes the current obstacles to clinical translation.<h4>Conclusion</h4>Mitophagy serves as a key regulatory node in Cis-AKI and can simultaneously ameliorate multiple injury pathways by clearing damaged mitochondria and reducing mtROS. Moderate mitophagy plays a renoprotective role, while excessive mitophagy aggravates renal injury. Targeted and precise regulation of mitophagy is expected to become a new strategy for the prevention and treatment of cisplatin-induced nephrotoxicity.

GPR52
Also flagged:SchizophreniaNeuropsychiatric Disorderspsychiatric disordersneurological diseases
Journal Article 2026-05-27 ✓ 5 Snippets Li H, Xia S, Zhang P, Li M, Lv L, Zhang X, Li X, Liu Z, Wang CY, Wang P.
In-Text Gene Mentions

…and Orally EfficaciousGPR52Agonist with Potential…

G protein-coupled receptor 52protein-coupled receptor 52…

…protein-coupled receptor 52 (GPR52) has been identified…

…ubstituted pyrazine derivativeGPR52agonists have been…

…relationship, several potentGPR52agonists (<b>14a</b>, <b>14h</…

Show Full Abstract

G protein-coupled receptor 52 (GPR52) has been identified as a promising therapeutic target for the treatment of schizophrenia, psychiatric disorders, and other human neurological diseases. A series of novel 2,3-disubstituted pyrazine derivative GPR52 agonists have been designed, synthesized, and biologically evaluated. Through the exploration of the structure-activity relationship, several potent GPR52 agonists (<b>14a</b>, <b>14h</b>, <b>14l</b>, <b>20c,</b> and <b>20i</b>) were identified, with EC<sub>50</sub> values in the nanomolar range (26-70 nM). Further studies on <b>14h</b> indicate that it has excellent pharmacokinetic properties in mice and rats, as well as brain permeability (brain/plasma ratio = 1.6 and 3.1, respectively). <i>In vivo</i>, compound <b>14h</b> (<b>R-185</b>) significantly inhibits MK-801-induced hyperlocomotor behaviors in zebrafish larvae and mice. Overall, our research results have identified an effective, orally bioavailable, and brain-permeable GPR52 agonist (<b>14h</b>), which is a promising candidate for the development of antischizophrenia drugs.

HFE
Also flagged:sickle cell anemiametabolismHyperferritinemiainfectionliver diseaseSickle-cell anemia
Journal Article 2026-05-27 ✓ 1 Snippet Al-Shami A, Al-Maktari LAS, Qasem L, Aldhorae K, Al-Khaship S.
In-Text Gene Mentions

…of iron andhemochromatosis[ 13 ,…

Show Full Abstract

<h4>Background</h4>Iron overload remains a critical complication secondary to transfusional therapy and altered iron metabolism in patients with sickle cell anemia (SCA). Hyperferritinemia often serves as a surrogate marker for iron overload; however, as an acute-phase reactant, it may be elevated due to chronic inflammation, infection, or liver disease, potentially overestimating true iron stores. In Yemen, the burden of SCA is high, yet local data on the frequency of hyperferritinemia are scarce. This study aimed to describe the distribution of serum ferritin (SF) levels and the proportion of SCA patients with hyperferritinemia among adolescents and young adults attending the YSTH clinic in Sana'a, and to explore associations with hematological, and sociodemographic parameters.<h4>Methods</h4>A prospective cross-sectional study was conducted between June and December 2024, involving 80 participants (aged ≥ 15 years). The data were analyzed using SPSS version 26. Due to the non-normal distribution and high dispersion of SF, the Median (IQR) and Spearman correlation were utilized. Bivariate analysis calculated crude odds ratio at (95% CI) to identify predictor of elevated SF. Statistical power was limited by the sample size (N = 80) to detect weak associations.<h4>Results</h4>The study enrolled 80 SCA patients with a mean (±SD) age of 18.5 (±3.69) years, of whom 65% were males and 35% were females. The median (IQR) SF level was 1645 ng/mL (414-3525), with values ranging from 77.1 to 4500.0 ng/mL. Approximately 85% of patients exhibited elevated SF level (≥300 ng/mL). While red cell indices did not significantly predict the risk of hyperferritinemia, a significant positive correlation was observed between SF levels and white blood cell count (p = 0.03), suggesting a possible link with the inflammatory state. No significant associations were found between sociodemographic factors and high SF levels.<h4>Conclusion</h4>A high prevalence (85%) of hyperferritinemia (≥ 300 ng/mL) was observed among SCA patients attending the YSTH in Sana'a, Yemen, suggesting probable iron overload. While findings support routine SF screening but highlight the need for future studies incorporating inflammatory markers (e.g., CRP) and systematic transfusion histories to definitively quantify the iron overload burden in this population.

HTT
Also flagged:sarcomassarcomaCancertumor
Journal Article 2026-05-27 ✓ 1 Snippet Kamio S, Ikegami M, Kitada R, Miwa S, Ogura K, Iwata S, Iwata S, Kawai A, Kobayashi E, Suehara Y, Kohsaka S.
In-Text Gene Mentions

…sions, including RBPMS::NTRK2,HTT::NTRK2, and EML4::NTRK3.…

Show Full Abstract

<h4>Background</h4>Accurate identification of gene fusions is critical for precision oncological approaches to sarcomas, where specific fusion genes are actionable targets of tyrosine kinase (TK) inhibitors. This study provides a descriptive overview of the real-world use, under a universal health insurance program, of 3 different comprehensive genomic profiling (CGP) panels within the Japanese national CGP system: GenMineTOP, which integrates DNA and RNA sequencing, and 2 DNA-based panels, FoundationOne CDx and the OncoGuide NCC Oncopanel System.<h4>Methods</h4>We examined 2,633 sarcoma cases from the Center for Cancer Genomics and Advanced Therapeutics (C-CAT) database to identify potentially actionable alterations classified by the Cancer Knowledge Database (CKDB). The mean patient age was 51.1 years, and 45% were female. Detection rates of TK fusions (FGFR1-4, NTRK1-3, ALK, RET, ROS1, and BRAF) were compared descriptively. Additionally, 3 sarcoma cases with an NTRK fusion detected by GenMineTOP were functionally validated.<h4>Results</h4>Potentially actionable alterations (CKDB Levels A, B, and C) were identified in 566 patients (21.5%). Actionable TK fusions were detected in 3.1% (8 of 254) with GenMineTOP, 1.4% (31 of 2,211) with FoundationOne CDx, and 0.6% (1 of 168) with NCC Oncopanel. GenMineTOP identified rare NTRK fusions, including RBPMS::NTRK2, HTT::NTRK2, and EML4::NTRK3. Functional assays suggested their oncogenic potential and demonstrated responsiveness to the TK inhibitors larotrectinib and entrectinib.<h4>Conclusions</h4>In this cohort, the DNA+RNA-based panel showed a higher detection rate for TK fusions, although the panels were applied to different patient groups and the sensitivity and specificity could not be determined. Future studies evaluating different test types on the same tumor specimens are warranted to clarify whether the dual-sequencing approaches can improve the identification of actionable genetic events.<h4>Level of evidence</h4>Diagnostic Level IV. See Instructions for Authors for a complete description of levels of evidence.

DCC
Also flagged:nucleusoligodendrocytetraumatic brain injurybrain injuryinjurydeath
Journal Article 2026-05-27 ✓ 1 Snippet Ji J, Chao H, Chen C, Wang X, Shi W, Liao J, Qian H, Shi H, Hu J, Ye Y, Tu Y, Xu X, Li Z, Yue Z, Yan W, Hong X, Wang H, Chen H, Petretto E, Ji J.
In-Text Gene Mentions

…axon guidance (DCC, FOXP1, CHN1 )…

Show Full Abstract

Severe traumatic brain injury (sTBI) is a leading cause of edema and neurological dysfunction. However, the molecular mechanisms driving injury progression remain poorly understood. Here, we present a single-nucleus transcriptomic atlas of human and male mouse cortex across multiple sTBI stages, providing a systematic landscape of dynamic, cell-type-specific responses to injury and edema. Cross-species analyses reveal both conserved and human-specific programs, including a polarized oligodendrocyte state absent in murine sTBI. This state shows increased ABCA1 and adhesion-related genes and is associated with edema progression. In vitro experiments support an ABCA1-linked role in lipid handling that may support oligodendrocyte-lineage cell function, reflected by the maintenance of myelin-associated marker expression. Analyses combining ligand-receptor interactions, co-expression, and perturbation experiments link microglial CALM2-HMGB1 signaling to oligodendrocyte ABCA1-associated lipid regulation during injury progression. These human-specific programs indicate that rodent models may not fully recapitulate human sTBI mechanisms, underscoring the need for caution when extrapolating cross species findings.

HFE
Also flagged:Cardiac fibrosiscongenital heart diseasecongenital cardiac fibrosisCFextracellularheart failure
Journal Article 2026-05-27 ✓ 1 Snippet Zeigler AC, Touma M.
In-Text Gene Mentions

…iron homeostasis (HFE, TMPRSS6 ),…

Show Full Abstract

Cardiac fibrosis in congenital heart disease (CHD) is associated with poor outcomes, but the genetic risk factors have not been clearly outlined. This review details genes important for regulation of normal cardiac development or fibrosis, particularly cilia-related genes. Specific CHD pathologies have different patterns of fibrosis, likely from interaction between genetic mutations and environmental factors. Future studies are more feasible as tools like single-cell RNAseq and patient-derived organoids have become more affordable and easier to implement. A better understanding of genetic risk factors for fibrosis in CHD could improve diagnosis and treatment for these patients.

HFE
Also flagged:cancerkidneydevelopmental delaysZngenetic disorderoverload
Journal Article 2026-05-27 ✓ 1 Snippet Arunrat N, Sereenonchai S, Sagulkiatpanya T, Oo TK.
In-Text Gene Mentions

…may lead tohemochromatosis, a genetic disorder…

Show Full Abstract

Mining activities are a major source of heavy metal contamination in agricultural systems, posing risks to food safety and human health. This study investigated the soil-rice system in a zinc (Zn) mining-affected area of western Thailand to: (1) quantify heavy metal contamination across soil and rice compartments; (2) evaluate compartment-specific transfer factors (soil-root, root-stem, and stem-grain) to elucidate metal mobility and accumulation pathways; and (3) identify soil properties influencing metal retention and mobility. Soil, root, stem, and grain samples were collected from 20 paddy fields and analyzed for As, Cd, Cr, Cu, Mn, Pb, Zn, Hg, and Fe. The results showed that although bulk soil concentrations were within national standards, the geo-accumulation index (I<sub>geo</sub>) indicated extremely severe Cd and Hg contamination at all sites, with Zn also reaching extremely severe levels at several locations. In addition, consistently elevated pollution load index (PLI) values (> 1) indicated widespread multi-metal pollution across the entire study area. Soil organic matter, cation exchange capacity, and texture were strongly correlated with heavy metal retention and transfer (p < 0.05). Transfer factor analysis revealed high root accumulation of As and Hg, restricted Pb and Cd mobility, and substantial grain translocation of Cu, Zn, and Mn. Despite limited mobility, grain concentrations of As (1.16 mg kg<sup>-1</sup>), Cd (0.98 mg kg<sup>-1</sup>), Pb (4.61 mg kg<sup>-1</sup>), and Hg (0.08 mg kg<sup>-1</sup>) exceeded national food safety standards. Health risk assessment showed that both children and adults faced extremely high non-carcinogenic and carcinogenic risks from rice consumption, with hazard index and cancer risk values exceeding safe thresholds by several orders of magnitude. These findings demonstrate that the legacy of mining activities continues to threaten food safety and public health through rice-based exposure, highlighting the urgent need for targeted remediation, and routine monitoring to mitigate risks and support sustainable agriculture in mining-impacted regions.

ZBTB37
Also flagged:methylationcancerstumorbreast cancerbindingchromosomes
Journal Article 2026-05-27 ✓ 1 Snippet Anwar S, Khan A, Yasmin S, Ulain Q, Ahmad A, Najeeb E, Shahzad MI, Saeed M.
In-Text Gene Mentions

…14 edges, whileZBTB37(transcription factor), NDUFAF…

Show Full Abstract

Dysregulation of IDH1, a key metabolic enzyme, is widely reported across cancers and affects both tumor biology and patient prognosis. However, its regulation and associated epigenetic alterations in breast cancer (BC) remain unclear. This study examined methylation of two CpG islands (I1, I2) within the IDH1 promoter and a putative distal enhancer in clinical BC samples, correlating these patterns with IDH1 expression and clinicopathological features. Expression of PFKP, HIF-1α, and SIX1 was profiled to assess metabolic and developmental pathways. Additionally, genome-wide methylation analysis of IDH1-stratified TCGA-BRCA cohorts was performed to identify topological probe clusters with potential regulatory relevance. Twelve CpGs within I1 (- 109 to - 205 bp) were significantly hypermethylated in BC and showed an association with reduced IDH1 expression and a trend toward improved survival in this cohort, outperforming IDH1 expression in ROC analysis. I1 methylation was markedly higher in postmenopausal, metastatic, and TNBC cases and mapping to key transcription factor binding sites (CTCF, MYC, STAT3), suggesting disruption of regulatory complexes. PFKP, HIF-1α, and SIX1 were upregulated in these cases, indicating metabolic and developmental reprogramming. Genome-wide methylation analysis of IDH1-stratified TCGA cohorts revealed widespread alterations, with 33% of differentially methylated probes mapping to intergenic regions. High-density clusters on chromosomes 13 (85.7/kb) and 6 (32.5/kb), along with hypermethylation of CLDN18 and HRNBP3 promoters, implicated chromatin remodeling and splicing as frequent IDH1-associated events. Network analysis identified 332 hub genes, including HNRNPA1 and CBX5, reinforcing the role of epigenetic deregulation in BC pathogenesis. These findings suggest that IDH1 promoter methylation may hold prognostic relevance and suggest that altered IDH1 regulation contributes to broader epigenetic and chromatin remodeling events in BC.

PLCL1
Also flagged:diabetic cardiomyopathy-nucleusextracellulardemethylationdiabetes mellitus
Journal Article 2026-05-27 ✓ 1 Snippet Xu S, Ju C, Zhu M, Cai Y, Xu F, Liu Y, Liu Y.
In-Text Gene Mentions

…(Pdgfrb, Abcc9, Rgs5,Plcl1, Adgrl3), mesothelial cells…

Show Full Abstract

Despite intensive glycemic control, diabetic cardiomyopathy (DCM) often progresses due to hyperglycemic memory (HGM), yet the specific cardiac cells perpetuating this injury remain unknown. To address this, we performed single-nucleus RNA sequencing (snRNA-seq) on hearts from an HGM rat model. Our analysis of 86,120 nuclei revealed HGM-specific inflammatory and epigenetic reprogramming signatures. Fibroblasts emerged as potential mediators, appearing to drive extracellular matrix remodeling via upregulated LAMININ and COLLAGEN signaling. We uncovered a distinct HGM-specific fibroblast subpopulation characterized by oxidative stress and H3K27 demethylation. Integrative analysis prioritized Fmo2 as a key pathogenic candidate, which was further supported via Mendelian randomization and clinical data as a putative causal gene. This study suggests that a pathogenic Fmo2<sup>+</sup> fibroblast subpopulation may act as a pathological "memory carrier," providing novel mechanistic insights and proposing exploratory therapeutic avenues for HGM-induced cardiac damage beyond glycemic control.

Also flagged:keratopathyaniridiahomeostasiswound-healinginnate immunityaniridia associated keratopathy
Journal Article 2026-05-27 No Snippets Willems M, Vialaret J, Girard M, Feret N, Bremond-Gignac D, Chassaing N, Kindermans J, Fichter L, Hirtz C, Mollevi C, Crowdy H, Pequignot M, Delettre C, Daien V, Michon F.
Show Full Abstract

<h4>Background</h4>Congenital aniridia is a rare disorder presenting as a panocular malformation with variable severity, often complicated by progressive keratopathy. The purpose of this study was to characterise the tear-film proteome in adults with PAX6-related congenital aniridia and to identify dysregulated pathways linked to aniridia associated keratopathy (AAK).<h4>Methods</h4>Tears were obtained with Schirmer strips from four genetically confirmed patients and four age- and sex-matched healthy volunteers. Peptides prepared with the single-pot, solid-phase-enhanced (SP3) protocol were analysed by data-independent nanoLC-MS/MS. Proteins were identified with a false discovery rate (FDR) <1% during DIA data processing. Differential abundance between controls and patients samples was assessed using an adjusted p-value < 0.05. Proteins with |log₂-fold change| ≥1 were considered significantly expressed. Functional enrichment was evaluated with Enrichr (Gene Ontology, Reactome, JensenExp, Orphanet, TissueExp).<h4>Results</h4>A total of 3 162 proteins were detected; 2 633 showed a valid intensity in every sample of at least one group and were retained for statistical testing. Seventy-three (2.8%) were differentially expressed: 33 were over-expressed and 40 under-expressed in aniridia tears. Down-regulated proteins clustered in lipid homeostasis, epithelial junction integrity and wound-healing modules and included lacritin, secretoglobins and cytoskeletal adaptors, indicating a fragile, poorly repaired surface. Up-regulated species were dominated by neutrophil effectors (CD177 ≈ 50-fold) and reflected heightened innate immunity and abnormal epithelial maturation. Anti-angiogenic processes were significantly over-represented in both under and over-expressed protein sets.<h4>Conclusion</h4>Our workflow proved highly sensitive, capturing more than 3 000 tear proteins and thus underscoring the robustness of our proteomic approach. The tear film in aniridia reflects dysregulation of various processes, including immunity, lipid and epithelial homeostasis, and vascular remodelling. Our approach highlights novel biomarkers critical for developing targeted therapeutic strategies.<h4>Trial registration</h4>ClinicalTrials.gov, NCT05562115. Registered on 29 September 2022.

Also flagged:hexagonalboron nitridemineralcalcium silicateboronnitride
Journal Article 2026-05-27 No Snippets Öztekin F, Macit CK, Gürgenç T, Toprak Z, Dündar S, Aksakal B, Özercan İH.
Show Full Abstract

<h4>Background</h4>Mineral trioxide aggregate (MTA) is a calcium silicate-based endodontic biomaterial with well-established sealing ability, biocompatibility, and hard-tissue induction potential; however, the extent to which its biological performance can be modulated by nanostructured reinforcements remains insufficiently defined. Hexagonal boron nitride (hBN) is a layered two-dimensional nanomaterial with high chemical stability, mechanical robustness, and growing relevance in regenerative biomaterials. Because no directly comparable in vivo study had evaluated hBN incorporation into an MTA matrix in a standardized rat tibial defect model, the present work was designed as an exploratory physicochemical and histological study.<h4>Methods</h4>Standardized cylindrical defects (2.5 mm diameter, 4 mm depth) were created in the right tibial metaphysis of 40 systemically healthy rats randomly allocated to four groups (n = 10/group): empty defect control, pure MTA, MTA + 5 wt% hBN, and MTA + 10 wt% hBN. The study was conducted as a single 8-week in vivo experiment following institutional ethics approval. Pure MTA and hBN-modified composites were prepared under standardized mixing conditions and characterized qualitatively by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), and energy-dispersive X-ray spectroscopy (EDX). After 8 weeks, tibiae were harvested, decalcified, paraffin-embedded, stained with hematoxylin-eosin, and scored semi-quantitatively for fibrous tissue, new bone formation, and osteoblastic cell presence. Non-parametric comparisons were performed using Kruskal-Wallis and Dunn-Bonferroni tests (α = 0.05).<h4>Results</h4>XRD and FT-IR analyses showed preservation of the principal calcium silicate phase architecture and hydration-related bonding environment of MTA after hBN incorporation, while SEM-EDX demonstrated a progressively denser and more hBN-rich surface organization in the modified groups, particularly at 10 wt% hBN. Histologically, both hBN-containing groups displayed significantly higher new bone formation and osteoblastic cell presence scores than the empty-defect control. Fibrous tissue scores were also higher in the hBN groups than in the control group, indicating that the tissue response should be interpreted as a modified fibro-osseous reparative profile rather than as simple suppression of fibrosis. Compared with pure MTA, the 10 wt% hBN formulation showed the most favorable overall trend within the tested range, although differences between 5 wt% and 10 wt% hBN were not statistically significant.<h4>Conclusions</h4>Within the boundaries of this exploratory 8-week rat tibial defect study, hBN could be incorporated into MTA without evidence of major physicochemical destabilization and with a more pronounced bone-related healing response than that observed in untreated control defects. The findings do not support an overextended claim of direct osteoblast activation or definitive concentration optimization; rather, they indicate that hBN-reinforced MTA is a promising proof-of-concept composite whose long-term remodeling behavior, mechanical performance, ion release, systemic safety, and true optimum hBN window require further quantitative investigation.

Also flagged:Gallbladder cancertranslationalcancergastrointestinal tumorsgallstonespathogenesis
Journal Article 2026-05-27 No Snippets Jaiswar D, Dixit M.
Show Full Abstract

Gallbladder cancer (GBC) is a highly aggressive malignancy with late presentation, limited therapeutic options, and dismal survival rates. Despite recent advances in molecular profiling, our understanding of GBC remains fragmented, with most studies focusing on isolated genetic or epigenetic events rather than integrating the broader molecular interplay. Frequently altered genes-including TP53, KRAS, ERBB2, and CDKN2A-impact critical signaling cascades such as Ras/MAPK, PI3K/AKT/mTOR, Wnt/β-catenin, and p53, with aberrant ERK pathway activation emerging as a pivotal driver. Epigenetic modifications, dysregulated non-coding RNAs, and immune microenvironmental factors add further layers of complexity but remain underexplored in a unified context. Currently, no comprehensive framework links these alterations into a generalized molecular mechanism that could accelerate biomarker discovery and therapeutic innovation. This review integrates genomic, epigenomic, and immunologic data, complemented by KEGG pathway enrichment analysis, to present a consolidated molecular landscape of GBC. By mapping converging oncogenic hubs and signaling cross-talk, we aim to identify actionable targets-particularly within the ERK axis-that could inform early detection, guide precision therapy, and direct future translational research.

Also flagged:mitochondrialtumorcerebral hemorrhageglioblastomaextracellularvesicles
Journal Article 2026-05-27 No Snippets Deng J, Li D, Li Z, Pan Y, Xiong J.
Show Full Abstract

<h4>Objective</h4>This article provides a systematic review of the biological characteristics, regulatory mechanisms, and roles of MicroRNA-7 (miR-7) in the nervous system, as well as explores its clinical translation potential and challenges.<h4>Methods</h4>A review analysis integrating the progress of basic and clinical research related to miR-7.<h4>Results</h4>Characteristics and Regulation: miR-7 is highly expressed in mammalian brain tissues, with its function finely regulated by ceRNA networks (such as ciRS-7 and lncRNA SNHG1) and epigenetic modifications, forming a multi-layer dynamic regulatory system.<h4>Mechanisms of action</h4>It plays multi-faceted intervention roles in protein aggregation, neuroinflammation, mitochondrial dysfunction, and tumor progression by targeting key factors such as α-synuclein, NLRP3 inflammasome, EGFR/PI3K/AKT/mTOR pathway, and mitochondrial-related proteins (e.g. VDAC1). Role in Disease: It has significant pathophysiological implications in diseases such as Parkinson's disease, Alzheimer's disease, ischemic stroke, cerebral hemorrhage, and glioblastoma. Translational Potential: Changes in miR-7 expression in bodily fluids (blood, cerebrospinal fluid) and extracellular vesicles demonstrate diagnostic and prognostic potential; delivery systems based on nanomedicine (e.g. liposomes, graphene oxide, AAV vectors) and their combination therapy strategies (e.g. in conjunction with chemotherapy and immunotherapy) enhance its brain targeting and therapeutic efficiency.<h4>Conclusion</h4>miR-7 is a key regulatory molecule in brain diseases, with significant value for basic research and clinical translation. Future advancements should leverage cutting-edge technologies such as single-cell sequencing, spatial transcriptomics, and intelligent responsive nanocarriers to deepen the understanding of its regulatory networks and address challenges such as mechanism complexity, delivery system targeting, and the lack of clinical translation standards, to accelerate its transition from basic research to clinical application.

Also flagged:OAbone remodelingknee OAtranslationalbone resorptionacidification
Journal Article 2026-05-27 No Snippets Tang T, Zhang P, Lin Z, Tang ZH, Chen D.
Show Full Abstract

Global disability from osteoarthritis (OA) remains a staggering burden, yet disease-modifying pharmacological therapies remain limited. Current evidence supports OA as a whole-joint disease in which subchondral bone remodeling acts as an early and active driver of structural progression and pain. Osteoclasts are key regulators of this process, but clinical trials targeting osteoclast-dependent remodeling have yielded inconsistent results. This translational gap suggests that the traditional view of osteoclasts as a homogeneous, terminally differentiated resorptive population is no longer sufficient. Latest breakthroughs in single-cell and spatial multi-omics have begun to redefine osteoclast biology by revealing heterogeneity across precursor origin, lineage state, functional output, and niche-specific adaptation. In OA, these studies have clarified the osteoclastogenic microenvironment more clearly than the terminal taxonomy of mature osteoclast subsets, thereby shifting the field toward a state-spectrum framework. In this review, we synthesize recent high-resolution evidence to examine how osteoclast-lineage heterogeneity is organized across disease stages and osteochondral microenvironments, and how distinct osteoclast-lineage programs contribute to subchondral remodeling, angiogenic coupling, interface instability, and pain-related pathology. We further discuss how this framework may inform patient stratification, mechanism-matched intervention, and the development of program-specific therapies in OA.

Also flagged:Epithelial ovarian cancergynaecological cancertumorautophagydegradationorganelles
Journal Article 2026-05-27 No Snippets Webb JD, Borrelli MJ, Valdés YR, Shepherd TG.
Show Full Abstract

<h4>Background/objectives</h4>Epithelial ovarian cancer (EOC) is the deadliest gynaecologic malignancy, largely due to late-stage diagnosis and ineffective therapy. EOC commonly spreads through the peritoneal cavity as multicellular spheroids, which are metastatic structures that enhance survival under detachment stress, promote dissemination, and contribute to therapeutic resistance. We previously showed that ULK1, a serine/threonine kinase classically linked to macroautophagy initiation, supports EOC progression, suggesting non-canonical roles in spheroid biology and pathogenesis.<h4>Methods</h4>CRISPR/Cas9 <i>ULK1</i> knockout (<i>ULK1</i>KO) models were generated in OVCAR8, HEYA8, and ES2 cells. Mitochondrial degradation phenotypes were assessed in spheroids by immunoblotting and fluorescence microscopy. Label-free proteomics with bioinformatic pathway analysis identified ULK1-associated programs in EOC spheroids. Bioenergetic consequences were quantified using Seahorse ATP-Rate assays. Therapeutic interactions were evaluated using multi-dose combination matrices testing the ULK1 inhibitor DCC-3116 with metformin.<h4>Results</h4>ULK1 modulated mitochondrial degradation in a cell-line-specific manner, either promoting or protecting against mitochondrial loss through mechanisms that were uncoupled from canonical autophagy machinery. Proteomic and bioinformatic analyses revealed significant alterations in mitochondria-related processes, aligning with emerging ULK1 functions in mitochondrial homeostasis. <i>ULK1</i> loss broadly reduced OXPHOS complex proteins in EOC spheroids and consistently decreased hexokinase 2 (HK2), indicating coordinated metabolic remodeling. Seahorse profiling mirrored these shifts: OVCAR8 <i>ULK1</i>KO spheroids showed reduced OCR and ATP production, whereas HEYA8 and ES2 <i>ULK1</i>KO spheroids exhibited increased mitochondrial ATP production. Combination matrices showed potential synergy between DCC-3116 and metformin.<h4>Conclusions</h4>These data show that ULK1 differentially regulates mitochondrial degradation across EOC spheroid models through potential mechanisms alternative to canonical autophagy machinery, while reshaping spheroid metabolism and revealing potential therapeutic vulnerabilities in advanced EOC.

PLCL1
Also flagged:Mammary Tumorstumorstumorbreast cancerbreast tumorsbreast cancers
Journal Article 2026-05-27 ✓ 2 Snippets Bulatowicz JJ, Lemenze A, Dogan E, Galifi CA, Maingrette K, Shang Q, Wood TL.
In-Text Gene Mentions

…C-like 1 (Plcl1), and cell…

…adhesion molecule 1PLCL1Phospholipase C-like 1…

Show Full Abstract

<b>Background</b>: The insulin-like growth factor 1 receptor (IGF1R) is a receptor tyrosine kinase whose both overexpression and underexpression have been implicated in the initiation and progression of breast tumorigenesis. The mechanism through which underexpression of the receptor contributes to a more aggressive phenotype is currently less understood. <b>Methods</b>: Through the expression of a dominant-negative IGF1R, we studied the phenotypic effects of receptor inhibition on early MMTV-<i>Wnt1</i> mouse mammary tumors. Utilizing histopathological techniques and single-cell RNA-sequencing, we explored cellular heterogeneity and transcriptional alterations that occur as a result of IGF1R inhibition. <b>Results</b>: Examination of primary tumors failed to reveal obvious differences in tissue architecture or expression of differentiation markers with IGF1R inhibition. Both cohorts of tumors produced metastatic lesions in the lung. Single-cell RNA-sequencing identified previously unknown epithelial subpopulations that were present in both tumor types. In tumors with inhibited IGF1R, a previously undescribed epithelial population marked by expression of both <i>Krt14</i> and <i>Krt6a</i> was identified, transcriptionally distinct from its MMTV-<i>Wnt1</i> counterpart, and present in the smallest lung metastases. In human breast cancer patients, expression levels of <i>KRT14</i> and <i>KRT6A</i> negatively correlated with expression of <i>IGF1R</i>. <b>Conclusions</b>: Inhibition of the IGF1R in a mouse model of basal-like breast cancer produces transcriptionally distinct <i>Krt6a<sup>+</sup></i>/<i>Krt14<sup>+</sup></i> epithelial cells, which are present in the smallest metastatic lesions identified in the lung. Expression of genes associated with this population may potentially be effective biomarkers of metastatic capacity in basal-like breast tumors with low levels of IGF1R expression.

Also flagged:Cancertumormembranesmetabolismgene expressionmembrane
Journal Article 2026-05-27 No Snippets Antal G, Pașcalău NA, Atyim E, Bătrîna O, Șoica C, Mioc M, Tandafirescu C, Mioc A.
Show Full Abstract

Fatty acids (FAs) have drawn attention in the field of oncology due to their multifaceted role, not only as structural components of lipid-based delivery systems but also as functional moieties that can enhance the pharmacokinetic and biological behavior of anticancer drugs and, subsequently, their therapeutic performance. Due to their biocompatibility, structural diversity, high affinity for biological membranes, and albumin-binding capacity, FAs can increase drug lipophilicity, membrane permeability, systemic distribution, tissue distribution, and enable controlled enzymatic release. All these properties endorse the development of nanocarriers containing FAs, such as liposomes, lipid nanoparticles (LNPs), self-nanoemulsifying drug delivery systems (SNEDDS), and self-assembling lipidic prodrugs (LAPs). In addition, several FAs, especially polyunsaturated FAs, seem to have a direct anticancer activity by modulating lipid metabolism, oxidative stress, membrane organization, and regulating cell death pathways. This review summarizes the FA conjugation chemistry, the influence of FA on the pharmacokinetics and tumor-targeting capacity of anticancer agents, and the current developments in FA-based cancer treatment strategies, while also covering the biological functions of FA in cell death pathways and cancer metabolism. By integrating medicinal chemistry, nanocarrier design, pharmacokinetic modulation, and tumor lipid biology, this review positions FA-based strategies as a relevant and evolving platform for improving anticancer drug delivery, tumor selectivity, and therapeutic performance.

TNFSF4
Also flagged:Cutaneous squamous cell carcinomaskin cancermelanomapathogenesisactinic keratosisepithelial-mesenchymal transition
Journal Article 2026-05-27 ✓ 1 Snippet Li W, Xu T, Ding Y, Chen J, Yao G, Wu S, Wu J.
In-Text Gene Mentions

…CD28, CD27, andTNFSF4(P<0.001).…

Show Full Abstract

<h4>Background</h4>Cutaneous squamous cell carcinoma (cSCC) is one of the most common skin malignancies with limited reliable biomarkers for early detection and prognosis. This study integrated bulk and single‑cell transcriptomic data to identify post‑translational modification-related key genes and to characterise cellular and immune alterations in cSCC.<h4>Methods</h4>Publicly available cSCC datasets and post-translational modification-related genes (PTMRGs) were analysed. Single-cell analysis identified key cell populations and differentially expressed genes (DEGs), which were intersected with bulk DEGs, weighted gene co‑expression network modules, and PTMRGs. Candidate genes were prioritised using five feature selection algorithms, validated by quantitative real-time polymerase chain reaction (qRT-PCR) and receiver operating characteristic (ROC) analysis [area under the curve (AUC) >0.7]. Functional exploration included predictive modelling, SHapley Additive Explanations (SHAP) interpretation, immune infiltration analysis, protein interaction mapping, drug prediction with molecular docking, intercellular communication inference, and pseudotime trajectory analysis.<h4>Results</h4>Keratinocytes were identified as the key cell population, yielding 999 single-cell-differentially expressed genes (sc-DEGs). Bulk analysis detected 5,771 DEGs and 17 co‑expression modules; intersection yielded 19 candidate genes. Multi‑method feature selection nominated HIF1A, UBC, and GSTP1; validation retained HIF1A and GSTP1 as final diagnostic markers (upregulated in cSCC; AUCs >0.7). A least absolute shrinkage and selection operator (LASSO) classifier achieved the best performance. SHAP highlighted HIF1A and GSTP1 as dominant contributors. HIF1A was predicted to be nuclear, GSTP1 mitochondrial; both correlated positively with macrophages, natural killer (NK) cells, and neutrophils. Drug prediction and docking identified camptothecin, hydroquinone, and resveratrol with favorable binding (e.g., HIF1A-camptothecin -8.7 kcal/mol; GSTP1-camptothecin -8.6 kcal/mol). Cell-cell signaling was enhanced in cSCC [vascular endothelial growth factor (VEGF), endothelin (EDN) pathways; elevated MIF-(CD74+CXCR4) and MIF-(CD74+CD44)]. Keratinocyte pseudotime revealed progression from normal to metastatic states with concordant keratinocyte‑related gene programs.<h4>Conclusions</h4>HIF1A and GSTP1 are promising diagnostic biomarkers for cSCC, linked to altered immune landscapes, enhanced intercellular signaling, and potential druggable interactions.

TNFSF4
Also flagged:Gene ExpressionTumor-bindingcell proliferationstromal senescence
Journal Article 2026-05-27 ✓ 1 Snippet Lu J, Zhang Z, Yuan W, Zhang Y.
In-Text Gene Mentions

…, CTLA4 ,TNFSF4, TNFSF9 ,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) continues to pose a major health concern for global public health, characterized by pronounced clinical heterogeneity in survival outcomes and therapeutic efficacies. The stromal senescence constitutes a major impediment in constructing robust prognostic models. This study aimed to develop and validate a robust prognostic prediction model to accurately assess the prognostic risk of HCC patients and facilitate personalized precision treatment.<h4>Methods</h4>We obtained data from the Gene Expression Omnibus (GEO), The Cancer Genome Atlas (TCGA), and the Clinical Proteomic Tumor Analysis Consortium (CPTAC) databases. Area Under the Curve Cell (AUCell) was used to quantify senescence in single-cell RNA sequencing (scRNA-seq) of HCC. A stromal-senescence prognostic signature was then built by using Cox and least absolute shrinkage and selection operator (LASSO) analyses. High- and low-risk stratification was interrogated with clusterProfiler, maftools, immune-checkpoint analysis, and oncoPredict. Signature expression was cross-validated in scRNA-seq, bulk RNA sequencing (RNA-seq), proteomic, and spatial transcriptomic datasets. Small-molecule ligands targeting DNASE1L3 were identified by virtual screening, and their binding was verified by molecular docking and dynamics simulations.<h4>Results</h4>It was found that HCC-associated stromal cells exhibited the most pronounced levels of senescence among cell populations. Using machine-learning algorithms, we successfully established <i>DNASE1L3</i>, <i>NDRG2</i>, <i>ADAM15</i>, <i>IGFBP3</i>, <i>MMP14</i>, and <i>ANGPT2</i> as a stromal-senescence prognostic signature in HCC. Subsequent comparisons between patient subgroups based on this signature revealed distinct differences in long-term survival outcomes, mutational landscapes, immune checkpoint expression, and responsiveness to chemotherapeutic agents. Further, the stromal-senescence prognostic signature is significantly associated with metabolic reprogramming, immune inflammation, cell proliferation, and metastasis. Multi-omics data analyses were employed to validate the expression levels of this signature in both tumor and normal tissues. In addition, virtual screening identified three potential <i>DNASE1L3</i> candidates: STL167676, STK598132, and STK119225.<h4>Conclusions</h4>This study developed a robust stromal senescence-associated gene signature that accurately predicts survival outcomes in HCC patients and identified candidate stromal senescence-related molecules for more effective personalized therapy.

MLLT10
Also flagged:Lung cancerNon-Small Cell Lung Cancercancerlung adenocarcinomaNSCLCchromosome
Journal Article 2026-05-27 ✓ 1 Snippet Liu PT, Chen YL, Chen WL, Ho CL, Lee CH.
In-Text Gene Mentions

…LMNA, LRIG3, MAML2,MLLT10, MYH9, NAB2, NACC2,…

Show Full Abstract

Lung cancer is a leading cause of global cancer mortality, with <i>EGFR</i> mutations serving as a primary therapeutic target. Although <i>EGFR</i> tyrosine kinase inhibitors (TKIs) are initially effective, acquired resistance inevitably develops. While <i>ROS1</i> rearrangements are well-known baseline drivers, they are exceptionally rare as acquired resistance mechanisms. We utilized next-generation sequencing (NGS) to identify a rare ROS1 intragenic rearrangement (exons 35-37) in three never-smoking women with <i>EGFR</i>-mutant lung adenocarcinoma following progression on <i>EGFR</i> TKIs. Clinical courses were heterogeneous: one patient achieved a durable partial response using combined osimertinib and crizotinib. A second patient, intolerant to dual TKI therapy due to QTc prolongation and grade 3 edemas, achieved a sustained partial response with platinum-pemetrexed chemotherapy. The third patient exhibited polyclonal resistance, including <i>EGFR</i> C797S and <i>TP53</i> mutations, with fatal central nervous system progression. In this three-patient case series, <i>ROS1</i> exon 35-37 RNA-level intragenic rearrangements were repeatedly detected after <i>EGFR</i>-TKI progression, suggesting a rare transcript-level alteration within heterogeneous resistance evolution. However, its biological significance, driver versus passenger role, and therapeutic relevance remain uncertain. Combined <i>EGFR</i> and <i>ROS1</i> inhibition may be considered in selected cases, but further validation is required.

HFE
Also flagged:Metabolic DysfunctionSteatotic Liver DiseaseType 2 Diabetestype 2 diabetes mellitusnonalcoholic fatty liver diseasechronic liver disease
Journal Article 2026-05-27 ✓ 1 Snippet Dounel J, Díaz LA, Bettencourt R, Tavaglione F, Madamba E, Richards L, Loomba R, Ajmera V.
In-Text Gene Mentions

…lpha-1 antitrypsin deficiency,hemochromatosis, drug-induced liver injury,…

Show Full Abstract

<h4>Background and aims</h4>The American Gastroenterological Association (AGA) Clinical Care Pathway provides a tiered, noninvasive algorithm for fibrosis risk stratification in populations at high risk for metabolic dysfunction-associated steatotic liver disease (MASLD). We assessed the 2-year longitudinal performance of the AGA pathway using magnetic resonance elastography (MRE) as the reference.<h4>Methods</h4>This prospective cohort study enrolled adults aged 50-79 years with type 2 diabetes mellitus from ambulatory care clinics between the dates of February 2016 and February 2025. Participants underwent a standardized clinical research visit with Fibrosis-4 index (FIB-4), vibration-controlled transient elastography (VCTE), and MRE at baseline and at a 2-year interval at the UCSD MASLD Research Center.<h4>Results</h4>Of 626 participants with a baseline assessment, 209 had longitudinal follow-up assessment and were included in the study. The prevalence of MASLD was 69.9%, and 19.0% had significant fibrosis at baseline (MRE ≥3.30 kPa). Applying the AGA pathway of FIB-4 and VCTE, the false negative rate (low risk by pathway with MRE ≥3.30 kPa) at baseline was 7% with 17.6% of participants qualifying for specialty referral. At 2-year follow-up, the false negative rate decreased to 3% and an additional 7%, respectively qualified for specialty referral. Applying a FIB-4 cut point of 1.0 decreased the false negative rate to 0%; however, the number of patients requiring VCTE increased by 54% over 2-years.<h4>Conclusion</h4>Longitudinal reassessment of patients initially classified as low risk by the AGA Clinical Care Pathway substantially reduced misclassification of significant fibrosis, while maintaining a low rate of specialty referral. These findings support serial re-evaluation as a key component of noninvasive fibrosis risk stratification in at-risk populations.

Research Square 2026-05-27 Preprint (No Snippets API) Frampas C, Paudyal B, Guo J, Reeth Kv, Whetton AD, Subbannayya Y, Tchilian E, Pinto SM.
Show Full Abstract

<title>Abstract</title> <p>Respiratory virus infections affect both humans and livestock, causing considerable mortality and morbidity. While respiratory pathogens such as swine influenza A virus (pH1N1) and porcine respiratory coronavirus (PRCV) often present with overlapping clinical symptoms, their pathological trajectories and outcomes differ. Given the propensity for pathogen spillover and the use of pigs as a physiologically relevant large-animal translational model, we aimed to characterise host serum protein signatures that detect and differentiate pH1N1 from PRCV, enabling improved disease monitoring and control. Using high-resolution mass spectrometry-based proteomics, we identified 162 serum proteins that were significantly dysregulated across 3 infection timepoints (1, 5, and 12 days post-infection (DPI)), with signatures correlating with viral shedding and lung pathology as early as 1 DPI. Notably, multiplexed targeted analysis of a subset of proteins in an independent cohort from a different breed and geographic location demonstrated detection, femtomole-level targeted quantitation, and validation of SRGN as a diagnostic marker for pH1N1 and PRCV (AUC = 0.85). Further, SOD1 was validated as an early marker for PRCV, increasing as early as 1 DPI (AUC = 0.9). Finally, a multi-peptide signature composed of SRGN, SOD1, and RAN demonstrated reasonable predictive power for pH1N1 (AUC = 0.75) and PRCV (AUC = 0.65) at 1 DPI. Our data validate the proteomic screening, provide insights into the role of early protein markers in distinguishing respiratory viral infections, and pave the way for the development of point-of-care diagnostics and targeted prevention strategies, enhancing preparedness against emerging zoonotic threats.</p>

medRxiv 2026-05-27 Preprint (No Snippets API) Lee SS, Wang CA, de Vries VA, van Hemert DJ, Schulze A, Brandl C, Aman AM, Alonso-Caneiro D, Choquet H, Gorski M, Hammond CJ, Heid IM, Hunter ML, Hysi P, Jiang C, Jonas J, Klaver CC, Kneepkens SC, Konig S, Lingham G, Luber C, Melton PE, Pennell CE, Ramdas WD, Read SA, Schuster AK, Wang YX, Zimmermann ME, International Glaucoma Genetics Consortium, Khawaja AP, Gharahkhani P, MacGregor S, Guggenheim JA, Mackey DA.
Show Full Abstract

The choroid is critical for maintaining vision and implicated in several ocular diseases, being the sole source of nutrients and waste removal for the outer retina. Genetic discovery can help elucidate the pathways through which choroidal features influence disease risk. Our meta-analysis of genome-wide association studies (n= 78,682 participants) identified 30 genomic regions, including 20 novel loci, associated with choroidal thickness. Findings suggest inflammatory and vascular processes drive choroidal thickness, with overlapping mechanisms shared with refractive error. Genome-wide independently significant SNPs accounted for 18.7% of the genetic variance in choroidal thickness. Mendelian randomisation analyses showed a causal effect of age-related macular degeneration on choroidal thickness, and suggest a bidirectional causal effect between choroidal thickness and primary angle-closure glaucoma. These findings provide insight into the shared genetic architecture and biological pathways linking choroidal thickness and related diseases.

medRxiv 2026-05-27 Preprint (No Snippets API) Delva A, Joza S, Tremblay C, Vo A, Filiatrault M, Carrier M, Taylor J, O’Brien JT, Firbank M, Thomas A, Donaghy PC, Camicioli R, Chertkow H, Dagher A, Postuma RB, Rahayel S.
Show Full Abstract

<h4>BACKGROUND</h4> Dementia with Lewy bodies shares clinical and pathological features with both Parkinson’s disease and Alzheimer’s disease, but the local biological factors that render specific cortical regions vulnerable to atrophy remain poorly defined. In particular, it is unclear whether cortical thinning in dementia with Lewy bodies reflects generic neurodegenerative mechanisms, processes shared with Parkinson’s disease and Alzheimer’s disease, or dementia with Lewy bodies-specific molecular and network susceptibilities. <h4>METHODS</h4> A total of 89 patients with dementia with Lewy bodies and 89 matched controls underwent T1-weighted brain MRI. Scans were processed to generate surface-based cortical thickness maps. Regional cortical thickness estimates, after slice-by-slice manual correction, were mapped to gene expression data from healthy postmortem human brains to identify transcriptomic signatures associated with decreased thickness in dementia with Lewy bodies. We assessed whether genes whose expression was increased with regional thinning converged onto established Parkinson’s disease- and Alzheimer’s disease-related pathways and isolated genes uniquely implicated in dementia with Lewy bodies. Spatial annotation mapping was then used to test whether patterns of cortical thinning overlapped with in vivo neurotransmitter system distributions and whether the observed thickness pattern was constrained by large-scale structural connectivity, consistent with a network-based propagation process. <h4>RESULTS</h4> Cortical thinning predominated in regions that, in the healthy brain, show higher expression of genes involved in mitochondrial function and synaptic transmission. The transcriptomic profile associated with thinning significantly overlapped with genes belonging to Parkinson’s disease and Alzheimer’s disease pathways, supporting shared pathogenic mechanisms across Lewy body and Alzheimer-type neurodegeneration. However, 90 genes associated with cortical thinning did not overlap with Parkinson’s disease or Alzheimer’s disease pathways and were enriched for GABAergic signalling. Spatial mapping analyses showed that regions with greatest thickness reductions colocalized with GABA A , serotoninergic 5-HT 1A , 5-HT 1B , 5-HT4, and dopaminergic D2 receptor distributions, and that the thickness pattern followed structural connectivity. <h4>CONCLUSIONS</h4> MRI-derived cortical thickness changes in dementia with Lewy bodies reflect selective molecular and network vulnerabilities rather than a non-specific degenerative process. Mitochondrial and synaptic genes, together with a distinct GABAergic association and connectivity constraints, delineate mechanisms explaining why some cortical territories are more affected in dementia with Lewy bodies.

BTN3A3
Also flagged:influenza virus infectionmembraneendoplasmic reticulumendocytosisInfectionsinfection
Journal Article 2026-05-26 ✓ 1 Snippet Huang J, Ma K, Ding S, Wang Y, Xiong J, Yi J, Zhang J, He Z, Huang L, Ren X, Zhou J, Chen X, Liu L, Qi W, Wang S, Liao M.
In-Text Gene Mentions

…such as IFITM3,BTN3A3, and MX1 […

Show Full Abstract

Influenza A viruses (IAVs) cause severe outbreaks with high mortality in birds and humans. A deeper understanding of cell-intrinsic defense mechanisms against influenza viruses is therefore crucial for developing novel antiviral strategies. Herein, we perform a genome-wide CRISPR activation screen to systematically elucidate host restriction factors against influenza A (H7N9) virus. Among multiple candidates, cholesterol 25-hydroxylase (CH25H) is shown to be induced by influenza virus infection and inhibit viral membrane fusion. Notably, our previous work demonstrated that CH25H blocks the entry of plasma membrane-fusing viruses such as coronaviruses. This inhibition occurs by relocating accessible cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER). Here, we extend this finding and show that the same mechanism works against endocytosis-dependent viruses such as influenza viruses. The exogenous supplementation of cholesterol can restore depleted accessible cholesterol and reverse the CH25H-mediated restriction. Additionally, we prove that acyl-CoA:cholesterol acyltransferase (ACAT) is required to recruit the accessible cholesterol in this process. However, how hydrophobic accessible cholesterol is transported remains unclear. Here, we demonstrate that GRAMD1/Aster-mediated non-vesicular cholesterol transport is utilized to mobilize accessible cholesterol upon stimulation of CH25H. 25-hydroxycholesterol (25HC), the catalytic product of CH25H, is a natural metabolite that potently inhibits influenza virus infection both <i>in vitro</i> and <i>in vivo</i>. These findings underscore the promising therapeutic potential of 25HC against influenza viruses.

Also flagged:chromatinchromosomemethylationorganizationgene expressionGene Transfer
Journal Article 2026-05-26 No Snippets Macias-Velasco JF, Zhuo X, Tomlinson C, Belter EA, Kremitzki M, Albracht D, Lindsay T, Xing X, Tekkey N, Zhang W, Garza JE, Xu Z, Xin Z, Fu Q, Lawson HA, Stitziel NO, Fulton RS, Li D, Human Pangenome Reference Consortium, Wang T.
Show Full Abstract

The human genome reference established a shared coordinate system for genome function, but it is incomplete and not fully representative of human diversity. Here, we benchmark how genome representation and corresponding analytical frameworks for each representation shape functional genomics using chromatin accessibility sequencing (ATAC-seq), RNA sequencing, whole-genome bisulfite sequencing, and chromosome conformation capture (Hi-C) data from lymphoblastoid cell lines derived from five individuals with fully phased genome assemblies. We compare results across hg38, CHM13, the draft human pangenome, and each individual's maternal and paternal assemblies. Because current pipelines and quality control conventions are tuned to hg38, several of these comparisons reflect genome representation in the context of available methods, rather than sequence alone. Individual identity accounts for 57.52-78.47% of total variance in functional estimates, whereas genome choice contributes 0.002-7.85% and sample-by-genome interactions contribute 0.63-5.43%. About 2% of biological signals are detectable only with personal assemblies. Although these effects are modest overall, some biologically important features remain inaccessible to linear references. Consistent with this, graph-based DNA methylation analysis in the human pangenome reveals a non-reference AluY5a insertion within a putative TNKS enhancer at chromosome 8p23.1 that becomes visible and hypermethylated only in the pangenome.

HTT
Also flagged:methylationneurodegenerative diseasesHDmetabolismcognitive deficitsCerebellar atrophy
Journal Article 2026-05-26 ✓ 3 Snippets Wheildon G, Smith AR, Weymouth L, Harvey J, Kouhsar M, MacBean LF, Troakes C, Pishva E, Smith RG, Lunnon K.
In-Text Gene Mentions

…one of theHTTgene [ 1…

…site in theHTTgene in several…

…increase phosphorylation ofHtt, which rescued energy…

Show Full Abstract

<h4>Background</h4>Huntington's disease is caused by a trinucleotide CAG repeat expansion in the HTT gene. Despite displaying autosomal dominance, phenotypic variation exists amongst mutation carriers, in particular relating to the age that symptoms first occur. This variation is primarily driven by an inverse relationship between CAG expansion size and age of symptom onset. However, the majority of variation in age of onset that is independent of CAG repeat length is thought to be driven by environmental influences. Since DNA methylation can be altered by environmental factors, and as methylomic variation is reported in other neurodegenerative diseases, it may offer a potential mechanism underlying disease manifestation.<h4>Results</h4>We utilized the Illumina EPIC v1 methylation array to profile DNA methylation in 120 samples, including three distinct brain regions (striatum, entorhinal cortex and cerebellum) in 20 Huntington's disease and 22 control donors. We identified seven Bonferroni-significant differentially methylated CpGs within the striatum along with 27 differentially methylated regions, annotated to genes involved in physiological processes known to be disrupted in HD such as the urea cycle and metabolism. Weighted gene correlation network analysis identified modules of co-methylated CpGs that were associated with Huntington's disease, with ontological analyses showing enrichment in disease relevant processes. Furthermore, integration of single-nuclei RNA sequencing data highlighted that genes annotated to these modules are enriched in striatal spiny projection neurons, the primary cell types affected in the disease.<h4>Conclusions</h4>Here, we present the first epigenome-wide association study of Huntington's disease conducted in the striatum, the primary region of neuropathology, along with matched entorhinal cortex and cerebellum on the Illumina EPIC v1 array. Our results suggest that DNA methylation is altered at loci associated with Huntington's disease in disease relevant regions and cell types and strengthens evidence for areas of potential therapeutic intervention.

HTT
Also flagged:nucleusHDHuntington's diseaseneurodegenerative disorderHuntingtons Disease
Journal Article 2026-05-26 ✓ 5 Snippets Kolesnikova A, Sathasivam K, Tusi SK, Landles C, Osborne GF, Kovalenko M, Gillis T, Kamenná E, Sekáč D, Nguyen DT, Valeková I, Juhás Š, Juhásová J, Levinská B, Baxa M, Motlík J, Klíma J, Howland D, Wheeler VC, Bates GP, Ellederova Z.
In-Text Gene Mentions

…polyadenylation site inHTTintron 1, and…

…soluble full-length mutantHTTand HTT1a proteins…

…the huntingtin (HTT) gene (…

…in the huntingtin (HTT) protein.…

…the highly pathogenicHTTexon 1 protein…

Show Full Abstract

Huntington's disease is caused by a CAG expansion in the HTT gene, leading to somatic repeat instability, alternative processing of HTT pre-mRNA, and mutant huntingtin protein production. To model these features, we generated a knock-in minipig (KI-85Q-HD) carrying a (CAG)82CAA(CAG)2 repeat in the endogenous HTT locus. To evaluate this, we quantified somatic expansion in various tissues using small pool- and bulk-PCR; detected HTT1a, an aberrantly spliced HTT transcript, using 3' rapid amplification of cDNA ends and quantitative PCR; and assessed mutant huntingtin protein isoforms using homogeneous time-resolved fluorescence assays. Moderate levels of tissue-specific and age-dependent somatic expansion were observed, highest in the caudate nucleus, kidney and spleen, and detectable in blood cells. We confirmed the presence of HTT1a transcripts terminating at a cryptic polyadenylation site in HTT intron 1, and detected soluble full-length mutant HTT and HTT1a proteins across brain regions and peripheral tissues, while aggregated HTT1a was only detected in the cortex. These results indicate that KI-85Q-HD minipigs exhibit molecular features of Huntington's disease at a pre-symptomatic stage and may serve as a platform for assessing therapeutic distribution and potency.

Journal Article 2026-05-26 No Snippets Simon L.
Show Full Abstract

No abstract available.

MLLT10
Also flagged:Acute myeloid leukemiaAMLLeukemiaICchromosomeminimal residual disease
Journal Article 2026-05-26 ✓ 2 Snippets Pan J, Fu C, Ling Q, Lu Y, Shi Y, Zhang Y, Wang S, Ji C, Qian S, Huang Z, Ge Z, Zhang J, Ouyang G, Jin C, Lu Q, Huang L, Kong H, Zhu Y, Yan Z, Liu D, Jiang H, Chen N, Lin X, Zhou Y, Zhang Y, Li X, Tong H, Jin J, Chen S, Wang H, East China Leukemia Alliance.
In-Text Gene Mentions

…KMT2A::ELL (20%), and KMT2A::MLLT10(12.7%).…

MLLT10

Show Full Abstract

Acute myeloid leukemia (AML) harboring KMT2A rearrangement (KMT2Ar) was generally associated with poor prognosis. We enrolled 490 patients with KMT2Ar from the East China Leukemia Alliance between March 2013 and August 2025. KMT2A::MLLT3 was the most frequent KMT2Ar (31.6%), followed by KMT2A::MLLT4 (25.1%), KMT2A::ELL (20%), and KMT2A::MLLT10 (12.7%). KMT2A::MLLT4 showed an inferior prognosis. The most co-occurring gene mutations were KRAS (20.1%), NRAS (19.0%), TET2 (10.2%), WT1 (8.6%), and PTPN11 (7.4%). Trisomy 8 was more common in patients < 60 years, while FLT3-ITD was only detected in patients < 60 years. With a median follow-up time of 42.6 months, the median overall survival (OS) of all patients was 30.9 months, and the 3-year OS rate was 49.9%. Patients treated with venetoclax plus intensive chemotherapy (Ven+IC) showed the best composite complete remission (CRc) rate and OS compared to intensive chemotherapy, venetoclax plus reduced-intensive chemotherapy, and reduced-intensive chemotherapy (CRc rate: 89.5% vs. 62.4% vs. 57.3% vs. 61.4%; median OS: not reached vs. 39.9 months vs. 34.8 months vs. 12.7 months). Multivariate analysis identified multiparameter flow cytometry minimal residual disease negativity post-induction therapy, allogeneic hematopoietic stem cell transplantation, and Ven+IC as independent favorable prognostic factors for event-free survival (EFS), and KMT2A::MLLT4 fusion, EVI1 overexpression were independent unfavorable prognostic factors for EFS. In summary, our study showed characteristics and prognostic implications in newly diagnosed KMT2Ar AML in China.

Also flagged:metabolismphosphorus fixationbindingmineralizationsecretiondegradation
Journal Article 2026-05-26 No Snippets Hao Y, Yang W, Chai J, Jiang H, Hao S, Luo H, Zhou G, Fu T, Gao Z, Yang Z.
Show Full Abstract

Phosphorus fixation represents a primary constraint limiting the agronomic efficiency of phosphate fertilizers in calcareous soil. Rapeseed roots secrete amounts of organic matter, which can mobilize and decompose insoluble phosphorus in the soil. However, the activation mechanism of sparingly insoluble phosphorus in calcareous soils by rapeseed rhizosphere microorganisms remains unclear. This study aimed to screen and identify phosphate-solubilizing microorganisms from the rapeseed rhizosphere of calcareous soil, and to elucidate their key metabolic pathways for activating insoluble phosphorus. The results demonstrated that (i) fourteen dominant phosphate-solubilizing strains were isolated from rapeseed rhizosphere soil. Among these, <i>Advenella alkanexedens</i> was verified to significantly promote wheat growth and increase soil available phosphorus content. (ii) The culture condition optimization and functional characterization for <i>Advenella alkanexedens</i> revealed that its optimal growth temperature was 30°C, with an initial pH of 7. Its phosphate-solubilizing ability was regulated by Mg<sup>2+</sup>, K<sup>2+</sup>, and Ca<sup>2+</sup> ions, and the strain exhibited considerable salt tolerance and the ability to produce siderophores. (iii) <i>Advenella alkanexedens</i> increased soil available phosphorus content by 11.49%-81.91% and elevated phytase activity by 36.87%-82.49%. Correlation analysis indicated that soil available phosphorus and phytase activity were significantly positively correlated with Ca<sub>2</sub>-P, Ca<sub>8</sub>-P, and Al-P fractions. (iv) Amino acids and organic acids were identified as the key metabolites influencing the phosphate-solubilizing function of <i>Advenella alkanexedens</i>. The KEGG pathway analysis showed these metabolites were primarily enriched in β-alanine metabolism and arginine and proline metabolism pathways. Our findings confirm that <i>Advenella alkanexedens</i> not only promotes crop growth but also significantly increases labile P fractions (Ca<sub>2</sub>-P, Ca<sub>8</sub>-P, Al-P) while reducing more stable forms (Ca<sub>10</sub>-P), thereby enhancing soil phosphorus use efficiency. This study holds important implications for planting rapeseed to activate insoluble phosphorus in soil, to reduce phosphate fertilizer application, and to promote sustainable utilization of soil phosphorus resources. Furthermore, it provides a theoretical foundation for developing agricultural microbial inoculants.IMPORTANCEOur results confirm that <i>Advenella alkanexedens</i> not only benefits crop growth but also converts insoluble phosphates (O-P, Ca10-P) into highly active inorganic phosphorus components, thereby enhancing the utilization efficiency of soil phosphorus. This study was of great significance in activating the insoluble phosphorus in the soil, reducing the input of phosphate fertilizers, achieving the sustainable utilization of phosphorus resources, and protecting the environment. Additionally, it provided a basis for developing agricultural microbial agents.

HFE
Also flagged:Hereditary Hemochromatosis type Iiron deficiencyAnemiaHereditary Hemochromatosis type-Iphosphatetranslational
Journal Article 2026-05-26 ✓ 2 Snippets Colangelo L, Terracina S, Sonato C, De Martino V, Ferrazza G, Panzini E, Diacinti D, Nieddu L, Arienzo F, Occhiuto M, Cipriani C, Trasarti S, Angeloni A, Pepe J, Corsi A, Minisola S.
In-Text Gene Mentions

…variants in theHFEgene [ 19…

…InHfeknockout mice, bone…

Show Full Abstract

<h4>Purpose</h4>Anemia, inflammation and iron deficiency are linked to Fibroblast growth factor 23 (FGF23). Aim of this study was to explore the dynamics of FGF23 in Hereditary Hemochromatosis type-I (HH1).<h4>Methods</h4>Twenty-six consecutive patients with genetically confirmed and uncomplicated HH1 and nineteen healthy age-matched voluntary blood donors (CTR) were enrolled for the study. Intact (iFGF23) and C-terminal (cFGF23) FGF23 and iron status markers were evaluated at baseline (T0) and seven days (T7) after phlebotomy/voluntary blood donation (VBD). Bone mineral density (BMD) and vertebral fracture assessment (VFA) were also evaluated at T0.<h4>Results</h4>Cross-sectional and longitudinal analyses failed to reveal significant differences in iFGF23 in both HH1 (T0: 54.27 ± 14.42 pg/mL; T7: 54.70 ± 15.48 pg/mL) and CTR (T0: 52.77 ± 17.63 pg/mL; T7: 53.27 ± 15.88 pg/mL) groups. Absence of significant difference was also observed for cFGF23 at baseline between the two groups (HH1, T0: 0.98 ± 0.39 pmol/L; CTR, T0: 1.18 ± 0.91 pmol/L) but not at T7 when the values (HH1, T7: 01.20 ± 0.89; CTR, T7: 1.84 ± 1.11 pmol/L) were significantly increased in CTR compared to T0 (p = 0.0003) and to HH1 (p = 0.0240). After phlebotomy/VBD, in both HH1 and CTR groups, serum levels of phosphate were unchanged from baseline while serum iron, ferritin and transferrin saturation and erythrocyte-related parameters (red blood cells, hemoglobin and hematocrit) were significantly reduced (all p  <  0.0001). Serum iron, ferritin, and transferrin saturation were significantly higher in HH1 than in CTR (p = 0.0002 for serum iron and p  <  0.0001 for both ferritin and transferrin saturation) at T7. In the CTR group, these parameters showed a trend toward iron deficiency whereas in HH1 they remained near the upper limit of the normal range, suggesting a persistent mild iron overload. Correlation and regression analyses did not show significant associations between circulating FGF23 (both iFGF23 and cFGF23) and iron status markers. BMD and VFA were not significantly different between HH1 and CTR. Furthermore, BMD and Trabecular Bone Score values were not associated with circulating FGF23 levels.<h4>Conclusion</h4>This pilot study indicates that the serum levels of iFGF23 and cFGF23 and skeletal health evaluated through BMD and VFA do not differ between patients with uncomplicated HH1 and healthy subjects at baseline. The absence of changes in the serum levels of iFGF23 and cFGF23 in HH1 patients with uncomplicated HH1 after phlebotomy may reflect the persistence of iron overload which could counteract the physiological hypoxia-driven stimulation of FGF23 production and cleavage observed in healthy subjects after VBD.

HTT
Also flagged:autism spectrum disorderdevelopmental delayDDneurodevelopmental disordersautismcognition
Journal Article 2026-05-26 ✓ 1 Snippet Santos A, Caramelo F, Barbosa Melo J, Castelo-Branco M.
In-Text Gene Mentions

…as serotonin transporter (5-HTT) and receptor (5-HTR)…

Show Full Abstract

Differentiating autism spectrum disorder (ASD) from developmental delay (DD) is critical for guiding early intervention, but overlapping features and shared biological mechanisms pose challenges. This study investigates whether copy number variations (CNVs) affecting serotonergic genes carry sufficient information to distinguish between these neurodevelopmental disorders (NDDs). Using network mapping and machine learning, we applied gene ontology (GO) terms related to serotonergic systems to filter CNVs and construct networks modeling genetic and biological variation in ASD and DD. We identified hub nodes and subnetworks reflecting distinct patterns in gene and GO term interactions. ASD networks analysis yielded six genetic clusters, five of which remarkably contained genes specifically linked to serotonergic receptor mechanisms. In contrast, DD networks exhibited greater genetic homogeneity, with just two clusters sharing serotonergic mechanisms. Random Forest classifiers using serotonergic gene features achieved an average prediction accuracy of 85.6%, increasing to 88.6% when combined with dopaminergic dosage features, consistent with the two systems capturing partially non-overlapping biological signal. GO-based features yielded comparable accuracy with fewer inputs, emphasizing their efficiency. These findings demonstrate that different genetic alterations may be associated with disruption of shared biological pathways, each leaving a distinct signature tied to clinical diagnoses. Importantly, although genetic heterogeneity is observed in ASD, we found a homogeneity of serotonergic biological terms, suggesting convergence of mechanisms, which was distinct for each condition. Together, these results suggest that serotonergic CNVs carry discriminatory information for ASD vs. DD classification, and that combining serotonergic and dopaminergic features captures partially non-overlapping biological signal.

PEBP1
Also flagged:reverse transcriptionCell cycleconjugationmembranescell differentiationsingle-cell differentiation
Journal Article 2026-05-26 ✓ 5 Snippets Wei N, Zhan H, Deng Y, Liu M, Xiao Y, Gong Y, Wang X, Guan P, Lou X, Xie Y, Wang Y, Li Z, Dai L, Hu H, Zhang H.
In-Text Gene Mentions

Pebp1hi HSCs shared…

…were reduced inPebp1hi HSCs, reflecting…

…Mt2 hi andPebp1hi HSCs were…

…T-lineage potential (Pebp1hi HSCs, fate…

…Mrpl12, Tcf3 andPebp1, increased along…

Show Full Abstract

Haematopoietic stem cells (HSCs) produce all blood and immune cells throughout life, but ageing progressively impairs their function, generating excessive myeloid and megakaryocyte cells at the expense of lymphocytes. This lineage imbalance contributes to immune decline, chronic inflammation and increased disease susceptibility in the elderly, yet the underlying mechanisms remain poorly understood. Here we show that a specific Meg3<sup>+</sup> HSC subset (CD150<sup>hi</sup>Sca1<sup>hi</sup>CD24<sup>hi</sup>CD201<sup>+</sup>CD9<sup>+</sup>CD63<sup>+</sup> long-term HSCs) expands dramatically during ageing and drives this lineage skewing. Using multi-omics profiling, we found that inflammatory signals increase H3K23ac levels in aged Meg3<sup>+</sup> HSCs, enhancing PU.1 activity through recruitment of the reader protein TRIM24. This epigenetic mechanism promotes excessive megakaryocyte and myeloid production. Of note, disrupting H3K23ac-TRIM24 interaction in aged HSCs restored balanced lineage output and reduced inflammatory signals. Our findings reveal a key mechanism linking inflammation to HSC ageing and identify potential therapeutic targets for reversing ageing-related immune decline.

DCC
Also flagged:gene expressionpost-translational modificationsmethylationchromatincell differentiationsynthesis
Journal Article 2026-05-26 ✓ 1 Snippet Ren H, Liu Q, Li B, Yu X, Liang D, Li S, Pan B, Gao Q, Deng W, Yu JM, Wang W.
In-Text Gene Mentions

…, Lrrtm3 ,Dcc, Nrp2 ,…

Show Full Abstract

Histone modifiers are crucial for instructing multiple-stage cellular differentiation, yet the mechanisms underlying their temporal precision remain enigmatic. Here, we demonstrate that the H3K27 demethylase Kdm6b acts as an epigenetic regulator, coordinating stepwise motor neuron (MN) differentiation through sequential partnerships with stage-specific transcription factors (TFs). Genome-wide profiling reveals a progressive gain in Kdm6b occupancy, especially at distal regulatory elements, as differentiation proceeds. Kdm6b dynamically remodels chromatin landscapes by coordinating H3K27me3 removal with H3K27ac and H3K4me1 acquisition, thereby enabling timed gene activation from MN specification to maturation. Stage-specific inhibition of Kdm6b compromises the ordered expression of developmental genes. Mechanistically, Kdm6b interacts with temporal TFs over time to ensure precise transcriptional control and MN differentiation. Our work elucidates how a single epigenetic regulator achieves temporal fidelity of stepwise MN development, providing insight into epigenetic regulation of developmental timing.

Also flagged:bindingViral disordershepatocellular carcinomacirrhosisacquired immunodeficiency syndromeAIDS
Journal Article 2026-05-26 No Snippets Zarei A, Ezati M, Morris MT, Schenk G, Adibi H.
Show Full Abstract

Viral polymerases are key targets for antiviral drug development due to their crucial role in viral replication. This study seeks to discover novel inhibitors using virtual screening of a 200,583-member ZINC-based library, targeting three aspartyl-based viral polymerases: SARS-CoV-2 RdRp, HIV-1 RT, and HCV NS5B. In this line, applying RO5, drug-likeness, and PAINS filters, leading to a pharmacophore model with Ribavirin as the benchmark. Four ligands (Ligands 1-4) with the highest binding affinities were identified via molecular docking and ADME/T studies. These candidates were then subjected to 200 ns molecular dynamics (MD) simulations and binding free-energy calculations to evaluate binding stability. The computational analyses demonstrated that all four ligands stably bound the polymerase active sites and induced some conformational changes. According to MM/PBSA results, Lig-2 and Lig-1 surpass Ribavirin in SARS-CoV-2 RdRp and HIV-1 RT complexes, while Ribavirin showed the strongest binding in HCV NS5B. ADME/T studies supported the pharmacological potential of the ligands, with Lig-2 emerging as a promising lead against all targets, and Lig-1, Lig-3, and Lig-4 showing potential for multi-target antiviral development.

HTT
Also flagged:HDgene expression-nucleuspathogenesismitochondrial
Journal Article 2026-05-26 ✓ 1 Snippet Martín-Climent P, Ortuño-Miquel S, Gallego-Serna JF, Martí-Martínez S, Valor LM.
In-Text Gene Mentions

…the Huntingtin (HTT) gene.…

Show Full Abstract

Transcriptional dysregulation is among the most prominent molecular alterations in Huntington's disease (HD). It is not confined to the brain but also extends to peripheral tissues and cells, enabling minimally invasive screening strategies to identify transcriptional surrogates of the health status in HD mutation carriers. Nonetheless, transcriptomics approaches have failed to identify consistent candidates from peripheral blood, probably due to the low impact of the HD mutation in the transcriptional profiles of circulating cells, which can be masked by the high cellular complexity of this biofluid. In this study, we applied for the first time single-cell RNA-seq to peripheral blood mononuclear cells (PBMCs) to determine which cells accumulate the most prominent gene expression changes, and therefore, represent potential sources of reliable biomarkers. We observed common transcriptional alterations across different blood cell subtypes, which were partially validated in published bulk transcriptomics datasets. To relate these gene expression patterns with disease progression in the absence of a large cohort of patients, we examined selected candidates in a phenotypically characterized cohort of transgenic R6/1 mice. Among the tested genes, only the variations in the interferon related gene Irf7 in blood were mildly correlated with motor coordination performance in mutant mice. Notably, striatal Irf7 expression did not show such phenotypical correlation in the same individuals. Overall, transcriptional-based changes in peripheral blood can be linked to HD but they are mild and not apparently confined to particular cellular subpopulations. In conclusion, dissection of individual blood cells in combination with subsequent validation in mouse models emphasizes the challenges in obtaining clinically relevant biomarkers in HD.

CCPG1
Also flagged:Endoplasmic reticulumautophagymembranesdegradationADbinding
Journal Article 2026-05-26 ✓ 3 Snippets Zhang Y, Sun J, Cai Y, Xu Z, Li X, Wei W, Liu P, Sun Q, Wang ZH, Cui Y.
In-Text Gene Mentions

…al, 2017b ),CCPG1(Smith et al,…

…RTN3, FAM134B, FAM134C,CCPG1, and TEX264, in…

…as shown forCCPG1substrates (Ishii et…

Show Full Abstract

Endoplasmic reticulum autophagy (ER-phagy) is a selective autophagy pathway in which receptor proteins target ER membranes and proteins for degradation, yet its role in Alzheimer's disease (AD) remains unclear. Here, we identify FAM134B/RETREG1 as a specific ER-phagy receptor mediating amyloid precursor protein (APP) degradation. FAM134B directly interacts with ER-localized wild-type and familial mutant APP via their C-terminal domains and recruits LC3 through its LC3-interacting region (LIR) to promote APP delivery to phagophores for lysosomal degradation. In AD, epigenetic silencing at the FAM134B promoter suppresses its transcription by limiting TFEB/TFE3 binding despite their nuclear enrichment. This transcriptional suppression impairs ER-phagy, leading to APP accumulation and exacerbated AD pathology. AAV-mediated hippocampal expression of wild-type, but not LIR-mutant, FAM134B in 5XFAD mice restores ER-phagy, enhances APP clearance, reduces Aβ deposition, preserves synaptic and myelin integrity, and improves cognitive performance. These findings establish FAM134B downregulation as an upstream pathogenic event in AD, suggesting ER-phagy enhancement as a promising strategy to suppress Aβ generation at its source.

Also flagged:cerebrovascular diseaseshypertensionischemic strokefertilizationmetabolismsynthesis
Journal Article 2026-05-26 No Snippets Mi X, Yang X, Li Y, Wang X, Zhao Y, Fu A, Wang Z.
Show Full Abstract

Humic acid (HA) is known to improve phosphorus (P) availability in agricultural soils. Yet, the underlying mechanisms by which it influences the microbial community and subsequent P turnover remain unclear. In this study, a pot experiment was conducted using soil from a three-year Salvia miltiorrhiza (S. miltiorrhiza) cultivation system, in which the soil was amended with three HA concentrations (T1: 100-fold dilution, T2: 200-fold, T3: 400-fold) alongside an untreated control (CK). We determined P uptake by S. miltiorrhiza, soil P fractions, phosphatase activities, along with high-throughput sequencing of the microbial communities to specifically target those associated with P transformation. The results showed that HA application significantly enhanced root P uptake, with increases of 68.59% and 91.05% under T2 and T3, respectively. Consequently, soil Olsen-P content decreased by 19.19% and 15.20%, respectively, consistent with the depletion of available P under enhanced plant uptake. Soil P fractionation further revealed that HA application decreased inorganic P by 20.91% and 32.29%, respectively, under T2 and T3 treatments. Specifically, H<sub>2</sub>O-P decreased by 62.1% and 73.61%, and NaHCO<sub>3</sub>-Pi decreased by 53.21% and 50.48%, respectively, under the T2 and T3 treatments. In parallel, acid phosphatase activity was increased by 68.72% and 66.67% under the T2 and T3 treatments compared to CK. Comparative high-throughput sequencing between T2 and CK revealed that HA application enriched key microbial genera associated with P cycling, including Sphingomonas, Nitrospira, Ferruginibacter, and Hyphomicrobium. Collectively, these findings suggest that HA may promote P mobilization and mineralization through association with microbial communities, thereby potentially enhancing P bioavailability and plant uptake. These findings offer new perspectives on the associations between HA application, microbial community shifts, and P use efficiency, suggesting a potential approach that merits further evaluation for P management in agricultural systems.

SERPINC1
Also flagged:antithrombin deficiencyvenous thromboembolismdeficiency
Journal Article 2026-05-26 ✓ 5 Snippets Remmelzwaal PC, Mulder R, de Boer-Bergsma JJ, Vinke A, Kooistra HAM, Veeger NJGM, Wierenga ATJ, Schuringa JJ, Lukens MV, Meijer K.
In-Text Gene Mentions

…NovelSERPINC1variants in hereditary…

…variants in theSERPINC1gene.…

…covering the fullSERPINC1region.<h4>Methods</h4>In this…

…in which noSERPINC1variant had been…

…classified according toSERPINC1-specific American College of…

Show Full Abstract

<h4>Background</h4>Antithrombin deficiency is a rare hereditary predisposition to venous thromboembolism caused by variants in the SERPINC1 gene. In up to 20% of cases, no explanatory variant is identified.<h4>Objectives</h4>This study uncovered novel variants by covering the full SERPINC1 region.<h4>Methods</h4>In this single-center cohort study, we included antithrombin-deficient families in which no SERPINC1 variant had been previously identified. We used multiple genomic and transcriptomic approaches to identify novel variants and assess their pathogenicity. Variants were classified according to SERPINC1-specific American College of Medical Genetics and Genomics criteria.<h4>Results</h4>We included 10 families with 42 individuals and identified 3 novel SERPINC1 (NM_000488.4) variants: c.42-209T>G, c.1153+429C>T, and c.916T>G. In addition, we identified an exon 6 deletion of uncertain novelty. All variants cosegregated perfectly. Despite being highly suspect, c.42-209T>G was the only variant of uncertain significance according to American College of Medical Genetics and Genomics criteria, which prompted us to perform functional testing. Prediction tools suggested the introduction of an acceptor splice site at c.42-208, resulting in the inclusion of a pseudoexon with premature stopcodon. We confirmed this aberrant splicing prediction by quantitative polymerase chain reaction and Sanger sequencing of cDNA synthesized from RNA isolated from genomic-edited HepG2 cells. c.42-209T>G leads to a reduction of SERPINC1 transcript levels.<h4>Conclusion</h4>We report several novel SERPINC1 variants, one of which is the first pathogenic deep-intronic variant causing antithrombin deficiency through aberrant splicing. This finding improves our understanding of the genetic etiology and clinical practice for antithrombin deficiency. In all tested families registered with our institution, an explanatory SERPINC1 variant has now been identified.

Also flagged:degradationcell wallextracellularbiosynthesissynthesisReverse Transcription
Journal Article 2026-05-26 No Snippets Nam Y, Hue Y, An S, Jeon J, Kim J, Park SY, Kim S, Chi WJ, Kim KT.
Show Full Abstract

<i>Xylaria grammica</i> is an endophytic fungus that produces grammicin, a polyketide reported as a structural isomer of the mycotoxin patulin. However, the environmental regulation of grammicin production remains unclear, and the full biosynthetic pathway has not yet been completely resolved. Genome re-annotation and biosynthetic gene cluster mining revealed high secondary metabolite potential, with 92 predicted clusters spanning major biosynthetic classes. Time-series RNA sequencing under shaking dark, static dark, and continuous light conditions showed strong condition-dependent transcriptome divergence. Light-grown cultures were enriched in functions associated with stress adaptation and detoxification, including oxidoreductase- and monooxygenase-related categories, whereas static dark cultures showed broader activation of secondary metabolism-associated genes at later stages. Among the predicted biosynthetic gene clusters, a patulin-like locus in <i>X. grammica</i> contained homologs corresponding to most genes of the <i>Aspergillus clavatus pat</i> cluster from <i>PatA</i> to <i>PatO</i>, although the gene order differed. Expression profiling revealed coordinated induction of patulin-like genes after 3 days post-inoculation under dark conditions, whereas continuous light strongly repressed their transcription. Quantitative RT-PCR analysis further confirmed this darkness-dependent activation pattern. Together, with previous functional evidence showing that <i>patK</i> and <i>patL</i> are required for grammicin production, these results indicate that darkness acts as a major regulatory switch for secondary metabolism in <i>X. grammica</i> and support the involvement of a patulin-like locus in grammicin biosynthesis. However, the downstream tailoring steps leading to grammicin remain unresolved, and further genetic and metabolomic analyses will be required to complete pathway reconstruction.

DCC
Also flagged:bindingelectron transferdegradation
Journal Article 2026-05-26 ✓ 1 Snippet Li X, Bai Z, Chen Q, Zhang Z.
In-Text Gene Mentions

…TheDCCmolecules show dual…

Show Full Abstract

All-inorganic CsPbBr<sub>3</sub> perovskite solar cells (PSCs) suffer from efficiency losses due to their interfacial energy level mismatch. Herein, we propose a synergistic dual-interface modification strategy to improve the photoelectrical performance of C/CsPbBr<sub>3</sub>/SnO<sub>2</sub>-structure PSCs. At the CsPbBr<sub>3</sub>/carbon interface, <i>N</i>,<i>N</i>'-dicyclohexylcarbodiimide (DCC) could elevate the CsPbBr<sub>3</sub> Fermi level to suppress the interfacial non-radiative recombination to increase the open-circuit voltage (<i>V</i> <sub>OC</sub>). At the SnO<sub>2</sub>/CsPbBr<sub>3</sub> interface, NH<sub>4</sub>F could upshift the SnO<sub>2</sub> Fermi level to enhance the crystallinity of CsPbBr<sub>3</sub> to markedly improve the fill factor (FF). The optimized device could achieve a power conversion efficiency of 9.59% with a <i>V</i> <sub>OC</sub> of 1.53 V and an FF of 82.4%. To elucidate the underlying mechanism, we established a dual-diode series model (DDSM), which revealed that the <i>V</i> <sub>OC</sub> was governed by the CsPbBr<sub>3</sub>/carbon barrier and the FF was controlled by the SnO<sub>2</sub>/CsPbBr<sub>3</sub> barrier. The theoretical predictions were consistent with the experimental results, providing a robust framework for designing high-performance all-inorganic PSCs.

HFE
Also flagged:argyriapigmentationsynthesisParkinsonAlzheimer's diseasespore
Journal Article 2026-05-26 ✓ 1 Snippet Alluhaybi AA, Attia A, Said MA, Alraddadi TS, Sarkar B, Elshaarawy RFM, Shahat A, Shenashen M.
In-Text Gene Mentions

…in addition tohemochromatosis.…

Show Full Abstract

The development of sustainable, economical sensing platforms for rapid monitoring of toxic metals is a critical priority for environmental safety. In this work, a new dual-functional BNP@RHNS nanocomposite sensor was fabricated by immobilizing Br-naphthophen ligand onto agrowaste (rice husk)-derived mesoporous nanosilica. The sensor surface maintains the amorphous nanosilica framework and successfully anchors ligands covalently or non-covalently, according to the physicochemical characterization methods used. The sensor exhibited remarkable spectrophotometric selectivity toward Ag<sup>+</sup> and Fe<sup>3+</sup> ions in aqueous environments with an optimized response time <40 s. The method also showed broad linear dynamic ranges of 0-0.8 ppm and 0-0.85 ppm, and low limits of detection (LOD) of 0.185 ppm and 0.247 ppm for Ag<sup>+</sup> and Fe<sup>3+</sup> ions under the optimized conditions (pH 6.2 & pH 3.6 at 25 °C). The sensing mechanism was meticulously detailed through experimental spectral shifts and corroborated by Density Functional Theory (DFT) calculations. The theoretical work showed that the recognition process is governed by the spontaneous formation of stable coordinate complexes located in the ligand's N<sub>2</sub>O<sub>2</sub> cavity. Moreover, the sensor exhibited high interfering tolerance and was successfully applied to determining metal ions in real water matrices with satisfactory recovery rates (97.37% to 100.73%). Furthermore, this sensor was found to be effective in recovering Ag(i) from leachates of electronic waste, suggesting its broader applicability in urban mining and resource recovery. These findings suggest a promising alternative valorization strategy for rice husk biomass into high-value functional materials for advanced environmental monitoring applications.

CACNA1E
Also flagged:CatatoniaAutism Spectrum Disorderchannelopathyintellectual disabilityepilepsy
Journal Article 2026-05-26 ✓ 1 Snippet Mancine R, Kuang J, Raghunandan C, Palffy A.
In-Text Gene Mentions

…CACNA1C, CACNA1D, orCACNA1Emutations have been…

Show Full Abstract

Autism spectrum disorder (ASD) may be a predisposing factor in the development of catatonia, which has been demonstrated to be effectively treated using electroconvulsive therapy (ECT). CACNA1 channelopathy mutations have been associated with autism spectrum disorder, intellectual disability, and epilepsy. The single published case report of ECT use in CACNA1 subunit mutations demonstrated a negative outcome, and no current case reports on CACNA1B, CACNA1C, CACNA1D, or CACNA1E mutations have been published. We present a case of an adolescent with a known CACNA1D mutation and symptoms of excited catatonia who experienced a reduction in the frequency and severity of self-injurious and violent behavior following treatment with ECT. Our case demonstrates the use of ECT for catatonia in an individual with a CACNA1 mutation without complication and with a positive therapeutic response.

PCDH17
Also flagged:Breast cancerbreast cancerstumorstumormethylationdemethylation
Journal Article 2026-05-26 ✓ 1 Snippet Shafqat A, Arora I, Akbar A, Alfuwais M, Aldubaisi S, Khan MI, Abu-Zaid A, Ahmed F, Yaqinuddin A.
In-Text Gene Mentions

…included RNF213, TRAPPC9,PCDH17, SORBS2, LAMB3, LGR6,…

Show Full Abstract

<h4>Objectives</h4>Breast cancer (BC) subtypes such as HR+, HER2+, and triple-negative (TNBC) show distinct molecular features, treatment responses, and outcomes. DNA methylation is a key, targetable epigenetic regulator in BC. This study examined whether the DNA methyltransferase inhibitor decitabine (DAC) produces subtype-specific epigenomic and transcriptional effects in breast cancer cell lines representing distinct molecular subtypes.<h4>Methods</h4>Gene expression and DNA methylation data from DAC-treated and untreated T-47D (Luminal-A) and JIMT-1 (HER2-amplified, trastuzumab-resistant with a TNBC-like phenotype) breast cancer cell lines were obtained from a published dataset. Differential expressions were assessed using <i>limma</i>, and methylation changes were defined using β-value thresholds. Integrated epigenomic-transcriptional analysis, functional enrichment, Horvath clock CpG evaluation, and survival analysis were performed in the METABRIC and TCGA cohorts.<h4>Results</h4>In JIMT-1, DAC caused hypomethylation at 1195 CpG sites and upregulation of 187 genes, including <i>TFAP2E</i>, an age-associated locus selectively hypomethylated after DAC. In T-47D, DAC induced hypomethylation at 1937 CpGs and upregulated 248 genes. Amongst these, <i>KRT20</i> was upregulated despite promoter hypermethylation, indicating a subtype-specific regulatory architecture. DAC-responsive genes in JIMT-1 were enriched for cytokine signaling and piRNA-mediated epigenetic silencing, whereas T-47D showed enrichment for extracellular matrix organization, collagen dynamics, and piRNA processing pathways. Horvath clock CpG analysis showed selective perturbation of age-associated sites. Survival analysis identified 114 DAC-responsive genes associated with overall survival in ER/PR-positive BC and 8 in the JIMT-1-derived gene set.<h4>Conclusion</h4>DAC induces subtype-dependent epigenomic and transcriptional remodeling, selectively disrupts age-associated regulatory programs, and underscores the need for subtype-stratified evaluation of epigenetic therapies in breast cancer.

PRDX6
Also flagged:membraneextracellularmitochondrial capsuletumorsecretionProtein Degradation
Journal Article 2026-05-26 ✓ 2 Snippets Zeng F, Li F, Guo H, Dong G, Zhou Z, Chen X.
In-Text Gene Mentions

…plasma membrane viaPRDX6chaperoning, while simultaneou…

…or disrupt thePRDX6–GPX4 interaction could select…

Show Full Abstract

As the primary gatekeeper of ferroptosis, glutathione peroxidase 4 (GPX4) represents a compelling therapeutic target. A recent study demonstrates that sustained GPX4 blockade via sophisticated lipidic nanoplatforms simultaneously triggers robust ferroptosis and remodels the tumor immune microenvironment; however, the underlying synergistic mechanisms remain poorly elucidated. By integrating classical GPX4 enzymatic theories with recent breakthroughs regarding its membrane-bound structural functions and its secretion as an immune-disrupting ligand, we propose a framework illustrating how GPX4 serves as a nexus between intracellular survival mechanisms and extracellular immune evasion. More importantly, we delineate a "spatial topological" landscape of GPX4 to fully harness its therapeutic potential in cancer therapy.

Also flagged:neurological disorderscentral nervous systemCNSdisordersautophagymitochondrial
Journal Article 2026-05-26 No Snippets Huang J, Yu M, Zou Y, Wang L, Ma Y, Ma Y, Kong X, Rong F.
Show Full Abstract

Neuroinflammation is a fundamental pathological hallmark driving the initiation and progression of various neurological disorders. Luteolin, a natural flavonoid abundant in medicinal plants, fruits, and vegetables, exerts multifaceted neuroprotective effects across diverse experimental disease models. Its beneficial activities are mediated through complementary mechanisms, including suppression of aberrant microglial activation, modulation of pro-inflammatory signaling pathways, and enhancement of endogenous antioxidant defenses. These integrated actions attenuate inflammatory mediator release, reduce oxidative stress-induced neuronal damage, and inhibit apoptosis, thereby counteracting neuroinflammation-driven pathology. This review synthesizes current knowledge on luteolin's protective roles in central nervous system (CNS) disorders. It elucidates underlying molecular mechanisms, encompassing regulation of key signaling cascades such as NF-κB, MAPK, and Nrf2, as well as its impact on cellular processes including autophagy and mitochondrial function. Critical challenges hindering clinical translation-notably limited oral bioavailability and restricted blood-brain barrier (BBB) permeability-are systematically discussed to guide future research. A comprehensive understanding of luteolin's pleiotropic pharmacological actions will not only enhance knowledge of its therapeutic potential but may also facilitate the development of novel preventive and therapeutic strategies for neuroinflammatory and neurodegenerative diseases.

HTT
Also flagged:Essential TremorETneurological disordersPDmitochondriacytosol
Journal Article 2026-05-26 ✓ 2 Snippets Onat OE, Sonti S, Robakis D, Tekinay AB, Akbostanci C, Durmaz Celik FN, Ozcelik T, Clark LN.
In-Text Gene Mentions

…domain partner ofHTTprotein ( 24…

…between PRPF40B ,HTT, MeCP2, and other…

Show Full Abstract

<h4>Introduction</h4>We leveraged consanguinity and population endogamy in a large four generation Turkish family with ET. Examination of clinical features and genetic analysis identified a homozygous <i>PRPF40B</i> missense variant, in a large region of homozygosity, segregating with ET in the family.<h4>Methods</h4>The ET family is of Turkish origin. The proband and relatives were evaluated at Ankara University Medical School and Bilkent University (Ankara, Turkey). A second evaluation of the clinical and videotape data was performed at Yale University. A total of 6 individuals from the family were clinically assessed. Whole genome sequencing and autozygosity mapping was performed in affected and unaffected family members. Transient transfection of HEK293T cells was performed to assess pathogenicity of the <i>PRPF40B</i> missense variant.<h4>Results</h4>A total of 4 family members were diagnosed with ET; two individuals also had a diagnosis of Parkinson's Disease (PD). We identified a missense variant in <i>PRPF40B</i>, p.Ser166Leu, located within a 7.7 Mb region of homozygosity (ROH) (Chr12: 46595701-54,330,441), which was observed in all analyzed affected family members. Unlike wildtype <i>PRPF40B</i> which localizes to nuclear speckles in the nuclear compartment, when mutant <i>PRPF40B</i> was expressed in HEK293T cells we observed enrichment and localization to the nuclear membrane.<h4>Discussion</h4>The <i>PRPF40B</i> p.Ser166Leu variant is located within a conserved region of the WW protein domain. <i>In Silico</i> pathogenicity and functional studies predict that the missense variant alters the function of <i>PRPF40B</i>. <i>PRPF40B</i> has previously been implicated in the pathogenesis of neurological disorders, including Huntington's disease and Rett syndrome.

Also flagged:ADneurodegenerative disordercognitive declinebrain atrophymitochondrialmetabolism
Journal Article 2026-05-26 No Snippets Wu W, Choi ES, Liu L, Thamilselvan V, Li L, Rippee-Brooks MD, Khatkar K, Li DY, McGrath D, Manning A, Barberan-Soler S, Lee I, Zhao Y, Fang X, Bao X.
Show Full Abstract

<h4>Introduction</h4>Microglia, the resident immune cells of the central nervous system, play a critical role in maintaining neural homeostasis and regulating inflammatory responses in the brain. Increasing evidence suggests that microglial dysfunction contributes to the progression of neurodegenerative diseases, including Alzheimer's disease (AD). However, the molecular mechanisms underlying these alterations remain incompletely understood. This study aimed to characterize disease-associated molecular changes in microglia derived from induced pluripotent stem cells (iPSCs) of sporadic AD patients and healthy donors.<h4>Methods</h4>iPSC-derived microglia from sporadic AD patients and healthy controls were analyzed using integrated multi-omics approaches, including total RNA sequencing, proteomics, and small non-coding RNA (sncRNA) sequencing. Gene Ontology (GO) analysis was performed to identify dysregulated biological pathways from transcriptomic and proteomic datasets. In addition, a modified T4 polynucleotide kinase (T4 PNK)-based sncRNA sequencing method was used to profile disease-associated sncRNAs and identify previously uncharacterized RNA species.<h4>Results</h4>Comparative analyses revealed significant AD-associated alterations in mRNA, protein, and sncRNA expression profiles in iPSC-derived microglia. GO analysis demonstrated dysregulation of pathways related to extracellular communication, intracellular transport, cytoskeletal organization, and protein-protein interactions. Furthermore, the modified T4 PNK-sncRNA sequencing approach identified multiple disease-associated sncRNAs, including several novel and previously uncharacterized RNA species potentially linked to AD pathology.<h4>Discussion</h4>These findings demonstrate that iPSC-derived microglia provide a valuable model for studying molecular mechanisms associated with sporadic AD. The identified transcriptomic, proteomic, and sncRNA alterations highlight key pathways potentially involved in microglial dysfunction and neurodegeneration. In particular, the discovery of novel disease-associated sncRNAs may provide new insights into AD pathogenesis and reveal potential therapeutic targets for future investigation.

SOX6
Also flagged:Fragile X Syndromeintellectual disabilityautismepilepsyhypersensitivityhypermethylation
Journal Article 2026-05-26 ✓ 2 Snippets Sumera A, Crichton A, Kind PC, Sibley C, Booker SA.
In-Text Gene Mentions

…8 strongly expressedSox6, suggesting MGE-derived…

…Cluster 1 wasSox6+ and Adarb2…

Show Full Abstract

<h4>Introduction</h4>GABAergic interneurons (IN) are critical for the precise timing and flow of information in cortical circuits. Loss of GABAergic IN function has been suggested as a potential translationally relevant mechanism of neuropathology in Fragile X Syndrome (FXS). Indeed, in rodent models of FXS, some IN populations may display reduced number, while genes associated with other IN type upregulated. However, it remains unknown how these cell populations, and their cell-type specific gene expression patterns are regulated in early development across other mammalian models of FXS.<h4>Methods</h4>Here we utilise an outbred rat model of FXS, in which we have performed single-nucleus RNA sequencing analysis in neonatal development of the somatosensory cortex. We then use immunohistochemistry to measure the number and distribution of neurochemically identified GABAergic IN subtypes from early development until adolescence in the somatosensory cortex.<h4>Results</h4>We find that GABAergic INs in a rat model of FXS display clear evidence of transcriptomic alteration compared to wild-type littermates in early brain development. These effects are most profound in putative parvalbumin INs, but with modest changes in other cell types. From immunohistochemistry, we find that parvalbumin INs appear largely unaffected in density in distribution, but we observe a large upregulation in the number of somatostatin-expressing INs.<h4>Conclusion</h4>GABAergic INs may display cell-type specific transcriptomic regulation in response to the loss of FMRP. Our data suggests minimal alteration of parvalbumin IN density or distribution, but upregulated somatostatin cell numbers. These data partially agree with previous observations in mouse models of FXS.

Also flagged:extracellularvesiclesdeathinflammatory responsetissue homeostasispathogenesis
Journal Article 2026-05-26 No Snippets Wang Y, Ye Y, Cai D, Xu Y, Cao Y.
Show Full Abstract

Inflammation is an essential host defense mechanism but, when excessive or chronic, can cause severe tissue damage and organ dysfunction. Exosomes, a key subtype of extracellular vesicles, have emerged as critical mediators of intercellular communication by transferring bioactive cargo and modulating inflammatory signaling. This review summarizes the roles of exosomes in inflammation-associated tissue injury, focusing on their regulation of classical inflammatory pathways and programmed cell death. We further discuss the dual functions of exosomes as pathogenic mediators and therapeutic agents, highlighting their diagnostic and therapeutic potential.

Also flagged:head and neck malignanciesmalignant tumorsoral cancermalignant tumorOral squamous cell carcinomaoral cancers
Journal Article 2026-05-26 No Snippets Wang Z, Bian Q, Chu Y, Zhu W, Qin Y, Zheng J.
Show Full Abstract

Oral squamous cell carcinoma, the most prevalent malignancy of the head and neck, presents ongoing challenges regarding its molecular mechanisms and clinical management. Current research largely focuses on isolated signaling pathways or specific immune responses, often overlooking the potential contributing role of the microbiota in tumorigenesis. This review proposes the "microbiome-inflammation-immune axis" as an interpretive working hypothesis to elucidate how dysbiosis and microbial interactions may activate host inflammatory responses, trigger pattern recognition receptors and signaling pathways, and remodel the immune microenvironment, thereby potentially facilitating oral cancer progression. Concurrently, this paper emphasizes clinical translation by critically compiling and evaluating relevant clinical analytical indicators-such as peripheral blood inflammatory markers and salivary microbial markers-from the fields of inflammation and microbiology. This provides multidimensional reference points for future disease diagnosis and treatment.

Also flagged:diabetesend-stage renal diseaseESRDglomerulosclerosisrenal interstitial fibrosisRenal fibrosis
Journal Article 2026-05-26 No Snippets Ran X, Xu Y, Liang R, Duan Y, Jia W, Bian Y, Li C, Zhang M.
Show Full Abstract

Diabetic kidney disease (DKD) is a leading cause of end-stage renal disease, with renal fibrosis as its core pathological hallmark. A central driver of this fibrosis is epithelial-mesenchymal transition (EMT), during which renal tubular epithelial cells transform into matrix-producing myofibroblasts. Endothelial-mesenchymal transition (EndMT) has also emerged as a critical contributor, and together with EMT, accounts for the progressive accumulation of myofibroblasts and extracellular matrix. A major clinical challenge in halting DKD progression is "metabolic memory", a phenomenon whereby renal injury persists and EMT/EndMT remain activated even after glycemic control is achieved. The molecular basis underlying this sustained activation remains incompletely understood. Emerging evidence indicates that metabolic memory is largely mediated by epigenetic mechanisms, including histone modifications, DNA methylation, and non-coding RNA dysregulation. These stable epigenetic imprints maintain the persistent activation of key pro-fibrotic signaling pathways, especially TGF-β, thereby continuously driving EMT, EndMT, and excessive extracellular matrix deposition. Although targeting epigenetic regulators has shown promising anti-fibrotic effects, a systematic review that integrates how metabolic memory orchestrates both EMT and EndMT through a multi-layered epigenetic network remains lacking. This review comprehensively summarizes the epigenetic mechanisms by which metabolic memory sustains EMT and EndMT in DKD, highlights key therapeutic targets, and discusses their translational and clinical implications.

HFE
Also flagged:liver diseasecirrhosiscongestive hepatopathypathogenesiscancerhepatocellular carcinoma
Journal Article 2026-05-26 ✓ 1 Snippet Cai L, Choudhary P, Tanous D, George J.
In-Text Gene Mentions

…including viral hepatitis,hemochromatosisor alcohol related…

Show Full Abstract

The Fontan procedure is a palliative operation for patients with univentricular physiology. Liver complications post-surgery are inevitable and include liver cirrhosis and hepatocellular carcinoma (HCC). Routine surveillance includes transient elastography (TE) and clinical assessment, however longitudinal data on Fontan-associated liver disease (FALD) is scarce. This study aimed to describe the evolution of FALD and assess the correlation between liver stiffness measurement (LSM) and hepatic decompensation. This retrospective case series comprised all adult post-Fontan patients presenting to a tertiary hospital between January 2015 and December 2024. Demographic and clinical information, serum tests, TE and echocardiograms were extracted from medical records. Endpoints assessed were decompensated cirrhosis and findings that warrant HCC multi-disciplinary team review. A derived surrogate outcome, clinically significant portal hypertension (CSPH) was assessed using the Baveno VII criteria. There were a total of 65 patients with 111 Fibroscans™. There was no significant change in LSM by TE when comparing two consecutive decade years post Fontan surgery. On echocardiography, only inferior vena-cava diameter and degree of ventricular function correlated with LSM scores (p = 0.032, p < 0.001). Twelve patients had CSPH, correlating with increased gamma-glutamyltransferase, bilirubin, international normalised ratio and aspartate aminotransferase levels (p = 0.047, 0.034, 0.012, 0.049 respectively). Four patients exhibited features of decompensated cirrhosis, eight warranted multi-disciplinary team discussion however these did not correlate with LSM or steatosis results. LSM and echocardiogram monitoring alone is insufficient for identifying FALD patients at risk of hepatic decompensation. Regular testing and multicenter research is required to develop predictive models that accurately identifies these at-risk patients.

Also flagged:Left Ventricular Hypertrophyhypertensioninfiltrative disorderscardiac amyloidosissarcoidosishypertrophic cardiomyopathy
Journal Article 2026-05-26 No Snippets Banthiya S, Agrawal A, Rai D, Chowdhury M, Pan S, Naidu SS.
Show Full Abstract

Left ventricular hypertrophy (LVH) is a not uncommon finding on cardiac imaging, seen in 10-20% of adults. LVH can represent a response to a physiological load on the heart (either by athletic training, hypertension, or structural heart issues) or it can represent a primary pathology (e.g. infiltrative disorders, including cardiac amyloidosis and sarcoidosis) or familial/genetic conditions (e.g. hypertrophic cardiomyopathy). LVH is an independent risk factor for adverse cardiovascular events, regardless of its etiology. In this review, we survey the etiologies, clinical approach, and use of multimodality imaging in those with LVH.

Also flagged:Diabetes mellituschronic hyperglycemiapathogenesistype 2 diabetesgene expressionextracellular
Journal Article 2026-05-26 No Snippets Deaconu L, Timar RZ, Dragomir C, Seclaman E, Marcu A, Nitusca D.
Show Full Abstract

<i>Background and Objectives</i>: MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and have emerged as potential biomarkers in type 2 diabetes mellitus and its complications. This pilot exploratory study aimed to identify circulating miRNAs with differential expression in plasma from patients with newly diagnosed type 2 diabetes mellitus compared to age- and sex-matched healthy controls. <i>Materials and Methods</i>: Peripheral venous blood samples were collected from diabetic patients (<i>n</i> = 24) and controls (<i>n</i> = 12). Due to the exploratory nature of the study and limited sample material, samples were pooled within each group prior to plasma separation. Total RNA, including miRNAs, was extracted from plasma and analyzed using a high-throughput qPCR panel. Two normalization methods were applied to assess miRNA expression, and overlapping results were used for downstream analysis. Fold regulation was calculated using the 2^(-ΔCt) method. <i>Results</i>: A total of 33 and 42 miRNAs were identified as differentially expressed using the first and second normalization methods, respectively. Fourteen miRNAs were consistently downregulated across both methods. Several of these miRNAs, including hsa-miR-26a-5p, hsa-miR-146a-5p, hsa-miR-186-5p, hsa-miR-19a-3p, and hsa-miR-652-3p, have been previously associated with glucose metabolism, inflammation, and diabetic complications, such as retinopathy, neuropathy, and endothelial dysfunction. The pooling strategy enabled an efficient exploratory assessment of miRNA expression patterns while reducing inter-individual variability. <i>Conclusions</i>: This exploratory pilot study identifies a panel of circulating miRNAs with altered expression in pooled plasma samples from patients with newly diagnosed type 2 diabetes mellitus. These findings provide preliminary insights that warrant further validation in larger, individual-level studies to assess their diagnostic and prognostic potential.

HFE
Also flagged:autosomal dominant polycystic kidney diseaseADPKDkidney disorderadult-onset disorderrenal cystshepatic cysts
Journal Article 2026-05-26 ✓ 4 Snippets Han ST, Rehman AU, Srinivasa ST, Lam A, Ficurilli M, Felice V, Krithivasan P, Phadke S, Abhyankar A, Bergstrom K, Bassetti JA, Jobanputra V.
In-Text Gene Mentions

…was notable forHFE-associated hemochromatosis an…

…for HFE -associatedhemochromatosisand hypertension.…

…pathogenic variant inHFE(HGNC:4886), consistent with…

…known diagnosis ofHFE-related hereditary hemochroma…

Show Full Abstract

<h4>Purpose</h4>Despite improvements in and access to clinical genetic testing, many patients with classic phenotypes remain without a molecular diagnosis. Such cases may reflect variants in noncoding regions or complex alleles made up of disparate sequence variants. In this article, we report a patient with autosomal dominant polycystic kidney disease caused by a deep intronic de novo single-nucleotide substitution forming a dinucleotide variant, with an adjacent common single-nucleotide variant (formerly single-nucleotide polymorphism) inherited from an unaffected parent. Although neither variant alone was predicted to be pathogenic, together as a dinucleotide variant, they created a novel splice donor site that activated a pseudoexon within intron 16 of the <i>PKD1</i> gene.<h4>Methods</h4>Genome sequencing was paired with transcriptome sequencing to evaluate the dinucleotide variant within intron 16 of <i>PKD1</i>.<h4>Results</h4>Evaluation of RNA from patient cells confirmed the inclusion of a 114-bp pseudoexon and an in-frame premature termination codon into the <i>PKD1</i> messenger RNA transcript. This case identified a rare scenario in which the combination of 2 independently predicted benign nucleotide substitutions immediately adjacent to one another generated a pathogenic allele.<h4>Conclusion</h4>This case highlights the diagnostic utility of genome sequencing coupled with RNA sequencing to clarify the effects of a deep intronic variant, confirming a molecular diagnosis for a patient with a clear clinical diagnosis who had undergone years of inconclusive testing. Furthermore, this case cautions that similar events may underlie unsolved cases across other genes and disorders.

Also flagged:Autoimmune Diseasesautoimmune disordersautoimmune diseasebindingrheumatoid arthritisRA
Journal Article 2026-05-26 No Snippets Varras M, Varra F, Varra V, Theodosis-Nobelos P.
Show Full Abstract

No abstract available.

bioRxiv 2026-05-26 Preprint (No Snippets API) Khousakoun D, Souza IA, Ferron L, Gandini MA, Zamponi GW.
Show Full Abstract

Developmental and epileptic encephalopathies (DEEs) are a group of neurological disorders primarily affecting young children and are characterized by severe seizures. DEEs are challenging to manage, with some patients experiencing severe side effects or not responding to frontline therapies. This is partly because of the many underlying mechanisms involved in DEE pathology and the relatively limited mechanism-specific action of current treatments. The CACNA1E gene, which encodes the voltage-gated calcium channel Cav2.3 (R-type), has recently been associated with DEEs. More than fifteen different mutations in CACNA1E have been identified in patients with DEEs; however, the mechanisms by which these mutations affect channel function and, thus, their relationship to DEEs, remain largely unknown. Previous research has begun to characterize the functional effects of R-type channel mutations on channel biophysics, but only a handful of mutations have been studied functionally to date. Here, we transiently expressed Cav2.3 channels and used whole-cell patch-clamp to examine the biophysics of one specific disease-associated R-type channel mutant in which leucine 228 is substituted with a proline (L228P). Compared to wild-type, the L228P mutant did not alter peak current density, inactivation kinetics, or recovery from inactivation, but showed a significant shift towards hyperpolarized voltages in both voltage-dependent activation and steady-state inactivation. This resulted in a broader window current shifted towards more hyperpolarized potentials, which predicts increased channel availability and activity at subthreshold voltages relative to wild-type channels. Our results contribute to the ongoing characterization of R-type mutants, with the long-term goal of informing mechanism-specific therapies for DEEs.

SOX6
Also flagged:extracellularnucleusmethylationlocalizationprimary ciliumnuclear import
Journal Article 2026-05-25 ✓ 1 Snippet Jiang H, Gao Y, Lai B, Wu J, Liao T, Zhang Z, Zhou X, Zhao J, Meng Y, Cai Z, Zhang C, Lai S, Gao R, Wang C, Li J, Yang F, Ding Y, Zhou X.
In-Text Gene Mentions

…factor 6 (SOX6) [ 15…

Show Full Abstract

<h4>Background</h4>Adolescent idiopathic scoliosis (AIS) is a complex spinal deformity with evidence of contributions from multiple genetic factors, but the molecular basis of gene-gene interactions in its development remains unclear. Filamin B (FLNB) and tetratricopeptide repeat domain 26 (TTC26) have both been implicated in the regulation of primary cilia and extracellular matrix homeostasis. However, whether combined variation in these genes contributes to spinal instability has not been established.<h4>Results</h4>We generated mice carrying heterozygous mutations in both Flnb and Ttc26 and find that these double heterozygous mice develop progressive spinal curvature during puberty, whereas single gene mutants show only mild susceptibility. We observed reduced production of collagen type II and aggrecan in the intervertebral disc, accompanied by increased expression of matrix degrading enzymes. Transcriptomic and cellular analyses show that simultaneous loss of Flnb and Ttc26 suppresses Sonic hedgehog (Shh) signaling in the nucleus pulposus, due to impaired methylation and nuclear accumulation of the transcription factor GLI2. We find that TTC26 is required for the localization of protein arginine methyltransferase 7 (PRMT7) to the primary cilium, enabling methylation of GLI2, while FLNB binds methylated GLI2 to promote its nuclear import. Restoring Shh signaling in vivo improves extracellular matrix composition in mutant discs.<h4>Conclusions</h4>These findings show that FLNB and TTC26 act together to regulate Shh-GLI2 signaling and maintain extracellular matrix homeostasis in the intervertebral disc. Their combined disruption compromises spine stability and may contribute to the pathogenesis of adolescent idiopathic scoliosis.

HTT
Also flagged:mood disordermood disordersdepressionbindingmemoryseasonal affective disorder
Journal Article 2026-05-25 ✓ 5 Snippets Dam VH, Johansen A, Gillings N, Svarer C, Miskowiak KW, Knudsen GM, Stenbæk DS, Frokjaer VG.
In-Text Gene Mentions

…and 5-HT transporter (5-HTT) (healthy controls: 137,…

…receptors and the5-HTT.…

…Additionally, for the5-HTTmodel, the serotonin…

…4 R and5-HTT, and so did…

…4 R and5-HTTsystems; future studies…

Show Full Abstract

<h4>Background</h4>Working memory deficits are common in mood disorders and severely affect everyday functioning. Serotonin (5-HT) signalling has been implicated in depression and is also involved in cognitive functioning. However, its relevance for working memory remains largely unexplored.<h4>Aims</h4>Using positron emission tomography (PET) brain imaging, we investigated the link between working memory and multiple 5-HT brain features in both healthy individuals and patients with mood disorders in a cross-sectional analysis of pooled data-sets.<h4>Method</h4>We used multiple linear regression to test the associations between working memory performance and 5-HT 1B receptor (5-HT<sub>1B</sub>R) (healthy controls: 28), 5-HT 2A receptor (5-HT<sub>2A</sub>R) (healthy controls: 116), 5-HT 4 receptor (5-HT<sub>4</sub>R) (healthy controls: 97, patients: 98) and 5-HT transporter (5-HTT) (healthy controls: 137, patients: 12) PET binding in the frontal cortex. The frontal cortex was chosen as region of interest as it is critical for working memory functions.<h4>Results</h4>There was no association between working memory and 5-HT<sub>1B</sub>R (<i>p</i> = 0.14), 5-HT<sub>2A</sub>R (<i>p</i> = 0.99) or 5-HTT (<i>p</i> = 0.80) frontal cortex binding in healthy controls. For the 5-HT<sub>4</sub>R, we observed a significant interaction effect of group status (<i>p</i> = 0.01), with patients showing a positive association (<i>β</i> = 6.51, <i>p</i> = 0.02) and healthy individuals showing no significant association (<i>p</i> = 0.16).<h4>Conclusions</h4>We found no evidence that key 5-HT receptor systems are associated with working memory performance in healthy individuals, but did observe a positive association for 5-HT<sub>4</sub>R in patients with mood disorder. We speculate that although 5-HT neurotransmission markers may map onto working memory performance in the healthy state, pathologically altered 5-HT signalling may contribute to working memory deficits in mood disorders, possibly through downstream signalling and/or interactions with other neurotransmitter systems.

HTTSOX6
Also flagged:neuropsychiatric disordersgene expressionlocomotionhematopoiesisskeletal disordersinnervation
Journal Article 2026-05-25 ✓ 2 Snippets Zhao L, Tang Y, Zhao W, Li S, Chen J, Ge T, Tu Y.
In-Text Gene Mentions

…5-HT2a, 5-HT4, 5-HT6, 5-HTT), dopamine (D1, D2,…

…, RUNX2 ,SOX6, GDF5 ,…

Show Full Abstract

The co-occurrence of skeletal and neuropsychiatric disorders suggests underlying bone-brain associations, yet their characterization remains limited by the anatomical and biological complexity of both systems. Here, we systematically examine these associations across diverse anatomical locations using structural imaging and genetic data from approximately 45,000 UK Biobank participants. We identify widespread structural associations between bone and brain, with 34.9% of examined pairs showing significant relationships. These associations display pronounced regional heterogeneity, with effect size variation aligning with gradients of cortical development and evolutionary expansion, as well as spatial distributions of GABA and 5HT-1b receptors and gene expression profiles of oligodendrocyte precursor cells and astrocytes. Genetic analyses spanning genome-wide, pathway, locus, and single-variant levels further reveal shared genetic architecture between skeletal and brain structures, as well as with multiple neuropsychiatric and neurological traits. Enrichment within the Wnt signaling pathway highlights a potential mechanistic axis underlying bone-brain coupling, while distinct skeletal regions exhibit differential genetic links to specific brain-related health outcomes. Together, these findings demonstrate that bone-brain associations are pervasive yet exhibit substantial anatomical and genetic heterogeneity, providing a systems-level framework for understanding the shared biology of skeletal and brain health.

DCC
Also flagged:nucleusobsessive-compulsive disorderpsychiatric disorderscapsulegene expressiondendrite-
Journal Article 2026-05-25 ✓ 1 Snippet Buyukkahraman G, Caglayan E, Hörpel SG, Zhang Y, van Tussenbroek IA, Orozco CG, Oh E, Hopkins WD, Sherwood CC, Roberts TF, Vernes SC, Konopka G.
In-Text Gene Mentions

…include ELAVL4 ,DCC, and KIF26B…

Show Full Abstract

The dorsal striatum is important for highly specialized functions including movement, learning, and habit formation. However, it is not known if species-specialized behaviors are associated with cellular specializations in the striatum. Here, we compared single-nucleus RNA sequencing (snRNA-seq) data from human, chimpanzee, rhesus macaque, common marmoset, and pale spear-nosed bat caudate (CN) and putamen (Pu) separately as well as mouse caudoputamen (C-Pu), which represents divergence among species spanning approximately 94 million years of evolution. We observed a lower neuron-to-glia ratio in primate striata compared to non-primates, reflecting the allometric scaling of neuron density and relative glia density invariance in larger brains. Among neurons, eccentric spiny projection neurons (eSPNs) - an SPN of unknown function - showed significantly lower proportions in non-primate striata for both CN and Pu. Focusing on the heterogeneity within interneurons, we identified two bat striatal interneuron cell types that are nearly absent in other species: which express LMO3, and co-express FOXP2 and TSHZ2. Other striatal interneurons also exhibited differential abundance between primates and non-primates. In summary, we provide a comprehensive snRNA-seq dataset of dorsal striatum, identify two distinct, previously uncharacterized populations of bat interneurons, and uncover fundamental cellular composition differences between primate and non-primate striata.

DCC
Also flagged:proton transferhydrogenaminosulfonamidealdehydehemiaminal
Journal Article 2026-05-25 ✓ 1 Snippet Zhong F, Ye H, Zou H, Huang J, You L.
In-Text Gene Mentions

DCChas contributed greatly…

Show Full Abstract

Excited-state intramolecular proton transfer (ESIPT) plays a critical role in many chemical processes, and it is essential to develop diverse regulating mechanisms of ESIPT molecules. Herein we report control of ESIPT luminogens with the combination of competing dynamic covalent bonds and non-covalent hydrogen bonds. The incorporation of amino-containing ESIPT fluorophores into 2-formylbenzenesulfonamide offers a versatile platform for dictating reactivity and fluorescence. The competition between intramolecular hydrogen bonding of sulfonamide NH and dynamic ring-fusion of NH with nearby aldehyde site in ring-chain tautomers enables diverse emission of cyclic hemiaminal, ketoimine upon ESIPT, and anionic intramolecular charge transfer (ICT) band in solution. Dynamic covalent reactions with amines give luminogen-dependent ketoimine or ICT emission, with hydrogen bonding from imine nitrogen affecting proton transfer of sulfonamide. In the solid state of one luminogen the engagement of adjacent aldehyde for intramolecular hydrogen bonding affords ICT emission while higher energy excitation induced ketoimine emission. Mechanical grinding and acid fuming treatment allows structural conversion and cyclic hemiaminal/ketoimine emission, further achieving switch of multistate emission colors. Finally, dynamic covalent reactions with amino acids provide a facile way for tuning distinct emission in the solution and solid state. The results should find broad utility in molecular switches, chemical sensing, and intelligent materials.

Also flagged:cancerpancreatic cancerhypercalcemiatumormetastatic pancreatic cancerpancreatic adenocarcinoma
Journal Article 2026-05-25 No Snippets Perez KJ, Dias Costa A, Jordan A, Karasic TB, Elganainy D, Kim S, Yuan C, Gui DY, Tan R, Hong SC, Wang X, Cristea S, Coleman E, Truitt M, Oh TG, Zheng H, Furniss CS, Brais L, Bird A, Remland J, Gocheva V, Thalappillil JS, Anderson M, Cleary JM, Enzinger A, Giannakis M, Ng K, Rubinson DA, Schlechter B, Surana R, Singh H, Abrams T, Teitelbaum U, Izgur N, Allen E, Winter PS, Raghavan S, Yeh JJ, Von Hoff D, Liddle C, Downes M, Evans RM, O'Dwyer P, Aguirre A, Nowak JA, Wolpin BM.
Show Full Abstract

Vitamin D receptor (VDR) agonists promote quiescence of cancer-associated fibroblasts and improve efficacy of chemotherapy in preclinical models of pancreatic cancer. We conducted a run-in phase trial with primary endpoint of safety when the VDR agonist paricalcitol is given with first-line gemcitabine and albumin-bound paclitaxel (GA) in patients with metastatic pancreatic cancer. Secondary endpoints included pharmacodynamic analyses. Thirty-six patients were randomized to GA plus placebo, GA plus intravenous paricalcitol or GA plus oral paricalcitol with pretreatment and on-treatment tumor biopsies. Paricalcitol was safely administered with GA, although five patients (42%) receiving oral paricalcitol had grade 2-4 hypercalcemia and required dose reduction. Nuclear VDR protein expression was heterogeneous across patients, and VDR was expressed in tumor, immune and stromal cells. Compared to pretreatment specimens, on-treatment biopsies had decreased proportion of αSMA<sup>+</sup> fibroblasts, altered fibroblast VDR activation signature and greater density and spatial colocalization of CD8<sup>+</sup> T cells with tumor cells in the GA-plus-paricalcitol arms. VDR expression was predictive of tumor response in the GA-plus-paricalcitol arms. Paricalcitol can be safely administered with chemotherapy to patients with metastatic pancreatic cancer, and on-treatment biopsies indicated favorable modulation of the tumor microenvironment by paricalcitol as predicted by preclinical models. ClinicalTrials.gov identifier: NCT03520790 .

OLFM4
Also flagged:immune responsemetabolismpathogenesisCDinflammatory bowel diseaseobstructions
Journal Article 2026-05-25 ✓ 2 Snippets Kennedy Ng MM, Silverstein S, Nishiyama NC, Beasley C, Lian G, Huan B, Lau G, Weaver D, Awad A, Schaner MR, Sheikh SZ, Furey TS.
In-Text Gene Mentions

…( L1TD1 andOLFM4respectively ) ;…

…viral retrotransposition andOLFM4promotes mucus secretion,…

Show Full Abstract

Crohn's disease (CD) is highly heterogeneous in presentation and progression with no cure. Molecular phenotyping has been used to elucidate cellular and tissue-based alterations to characterize drivers and effects of disease. One currently understudied class of functional molecules is long non-coding RNAs (lncRNAs). Studying the full lncRNA landscape in CD is challenging due in part to an incomplete lncRNA annotation and a lack of their functional characterization in tissues of interest. We used a genome-guided alignment strategy to assemble predicted lncRNA transcripts using short RNA-sequencing data from colon tissue of adult patient samples. When combining our predicted lncRNAs with previous lncRNA annotations, we determined 98 that were differentially expressed, recapitulating many from previous IBD studies while also uncovering new ones. We built gene co-expression networks to cluster lncRNAs with functionally characterized protein-coding genes. Clusters containing differential lncRNAs were correlated to disease status and associated with pathways related to the humoral immune response, metabolism, and tissue regeneration. We uncovered multiple differential lncRNAs whose expression significantly correlated with nearby differential protein-coding genes that have also been differentially expressed in other IBD datasets, such as PITX2. We focused on a predicted lncRNA that is antisense to the PITX2-adjacent lncRNA PANCR, which we called PANCR-AS1, and provide multiple lines of evidence that support PANCR-AS1 functioning as an enhancer of PITX2 expression. Overall, we determined lncRNAs that are potential contributors to CD pathogenesis. We developed a robust pipeline for identifying lncRNAs in diseased and non-diseased tissue that are absent from reference annotations. We also outlined a framework to pinpoint significant disease-associated lncRNAs with potential functional activity related to their nearby protein-coding genes.

Also flagged:flower formationmetabolismcell divisioncell wallpollinationfertilization
Journal Article 2026-05-25 No Snippets Shaban A, Korkar HM, Ahmed I, El-Hamied AGA, Hmmam I.
Show Full Abstract

<h4>Background</h4>Global olive cultivation is often hindered by the physiological phenomenon known as alternate bearing, which results in inconsistent yields from year to year, thereby diminishing economic returns and challenging effective orchard management. While foliar nutrition is acknowledged as a viable approach to boost reproductive performance in olive trees, there is limited research exploring the combined use of NPK and calcium boron nano fertilizers (NPK-NF and CaB-NF) during the 'off-year' season to concurrently enhance flowering, fruit set, oil composition, and reduce the severity of alternate bearing.<h4>Results</h4>Field experiments conducted during the 2023 and 2024 seasons on fifteen-year-old 'Picual' olive trees demonstrated that foliar application of NPK-NF and CaB-NF significantly enhanced reproductive performance and oil quality while reducing alternate bearing severity. Trees receiving NPK-NF (4 mL/L) + CaB-NF (2 mL/L) exhibited maximum flowering parameters, including 9.31 inflorescences per shoot and 68.51% perfect flowers, alongside the highest initial fruit set (37.37%) and final fruit set (26.95%). This treatment produced the greatest 'off-year' yield (0.79 tonnes per acre) while reducing fruit drop to 27.83% compared to 51.77% in controls. Leaf and fruit mineral analysis revealed substantially enhanced nitrogen, phosphorus, potassium, and calcium concentrations in treated trees. Virgin olive oil maintained extra virgin classification with improved oleic acid proportions, reaching 67.85%, and increased pigment concentrations. Notably, the combination of NPK-NF (4 mL/L) + CaB-NF (3 mL/L) reduced alternate bearing severity to 31.06% compared to 88.08% in control trees.<h4>Conclusion</h4>These findings suggest that the deliberate foliar application of NPK-NF and CaB-NF during the 'off-year' season can significantly boost flowering, fruit set, and oil quality, while also alleviating the severity of alternate bearing in 'Picual' olive cultivar. This approach offers a viable nutritional strategy to enhance both yield stability and productivity in commercial olive orchards.

HFE
Also flagged:secondary hyperparathyroidismanemiachronic kidney diseasevascular calcificationrenal osteodystrophyKidney Disease
Journal Article 2026-05-25 ✓ 5 Snippets Wang D, Wang Z, Li J, Gao Z, Zou S.
In-Text Gene Mentions

…into three groups:HFE( n =…

…the US andHFEgroups ( p…

…the study: theHFEgroup ( n…

…compared to theHFEgroup (154.98 ±…

…compared to theHFEgroup (5.30 ±…

Show Full Abstract

<h4>Background</h4>This study aimed to evaluate the surgical outcomes of parathyroidectomy (PTX) for secondary hyperparathyroidism (SHPT) in hemodialysis patients, comparing the use of three operative techniques: high-frequency electrosurgery (HFE), ultrasonic scalpel (US), and bipolar electrocoagulation (BPE).<h4>Methods</h4>The patients were divided into three groups based on the type of surgical instruments used. Outcomes assessed included surgical efficiency, postoperative complications, recurrence rate, hospitalization costs, biochemical and nutritional parameters over 1 year, and overall survival through March 2025.<h4>Results</h4>A total of 171 patients were retrospectively categorized into three groups: HFE (n = 50), US (n = 60), and BPE (n = 61). Compared to group HFE, both the US and BPE groups exhibited significantly shorter durations for drainage tube removal, operative times, and postoperative hospital stays (all p < 0.05). The BPE group also had significantly lower intraoperative blood loss compared to the US and HFE groups (p < 0.05) and incurred the lowest hospitalization costs. The incidence of postoperative complications and recurrence rates did not differ significantly among groups. All groups showed marked reductions in serum calcium, phosphorus, and intact parathyroid hormone levels postoperatively, which stabilized over time with no significant differences between groups. At the 1-year follow-up, patients exhibited significant improvements in anemia-related and nutritional markers compared to baseline. With follow-up extending to March 2025, overall survival did not differ significantly among the three surgical groups (p = 0.987).<h4>Conclusions</h4>PTX effectively corrected SHPT, improved anemia, and enhanced nutritional status in hemodialysis patients. All three surgical techniques, HFE, US, and BPE, were safe and effective, with comparable long-term survival. However, US and BPE offered superior operative efficiency, and BPE represented the most cost-effective option.

Also flagged:gestational diabetes mellitusmemoryDiabetesmetabolic disorderchronic metabolic disordersbisphenols
Journal Article 2026-05-25 No Snippets Liu J, Gao Y, Yi Y, Wang T, Chen Y, Ma J.
Show Full Abstract

Gestational diabetes mellitus (GDM) is one of the most common complications during pregnancy and can severely impair fetal neurodevelopment, leading to abnormalities in emotional, cognitive, and memory functions. However, the precise mechanisms by which GDM affects fetal neural development remain incompletely understood, which is closely associated with the lack of animal models that accurately replicate the key clinical and pathological features of human GDM. Therefore, this review summarizes and evaluates current methodologies for establishing GDM animal models, elucidates the impact of GDM on offspring neurodevelopment and its potential underlying mechanisms, and provides a theoretical foundation for developing and assessing appropriate GDM animal models, clarifying the pathophysiological mechanisms of GDM, and exploring innovative therapeutic strategies.

Also flagged:osteoarthritispathogenesisdegradationmitochondrialautophagyextracellular
Journal Article 2026-05-25 No Snippets Luo J, Li L, Deng Q, Ji Z, Wang C, Dai B.
Show Full Abstract

<h4>Background</h4>Traditionally viewed as a localized "wear-and-tear" pathology, osteoarthritis (OA) is now increasingly recognized as a complex systemic disorder driven by metabolic and inflammatory dysregulation. This review synthesizes emerging evidence to redefine the pathogenesis of OA from a "whole-joint" to a "whole-body" perspective.<h4>Main body</h4>We first examine local degradation mechanisms, identifying synovial macrophage polarization, mitochondrial dysfunction, and autophagy defects as critical drivers of a pro-inflammatory milieu. Furthermore, we elucidate the mechanism of inflammatory "spillover," wherein intra-articular cytokines (e.g. IL-1β, TNF-α) and extracellular vesicles (EVs) enter the circulation, contributing to a state of low-grade systemic inflammation. This systemic inflammatory burden is closely associated with a cascade of comorbidities, including endothelial dysfunction and atherosclerosis potentially mediated by shared mechanisms such as the "bone-vascular axis," sarcopenia through the pain-disuse cycle, and central sensitization coupled with HPA axis dysregulation. Conversely, systemic metabolic disorders, particularly obesity-induced "metaflammation" and insulin resistance, exacerbate joint degeneration through adipokines (e.g. leptin, resistin), forming a vicious bidirectional cycle.<h4>Conclusions</h4>We conclude by discussing how this systemic paradigm necessitates a shift in therapeutic strategies, moving from symptomatic management to holistic interventions. These include targeting metabolic pathways (e.g. metformin), clearing senescent cells (senolytics), and adopting a multidisciplinary precision medicine approach based on inflammatory and metabolic phenotyping.

Also flagged:genes expressionChromatingene expressionmetabolismcell growthreproduction
Journal Article 2026-05-25 No Snippets Zhao A, Qiao J, Kuang R, Chen Z, Tan Y, Zhu M, Zhou G.
Show Full Abstract

<h4>Background</h4>Average daily gain (ADG), age at 115 kg (AGE), backfat thickness (BF), and loin eye area (LEA) are key growth and carcass traits in pigs. However, breed-specific molecular regulatory mechanisms underlying these traits remain largely unknown. Here, we identified multiple candidate genes associated with these 4 traits from Duroc and Yorkshire pigs by three Genome-wide association study(GWAS) methods (MLM, FarmCPU, and BLINK) and differential genes expression analysis, verified them based on RNA sequencing(RNA-seq), Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq), and Chromatin Immunoprecipitation sequencing (ChIP-seq) data from Duroc and Yorkshire pigs, and explored the regulatory mechanisms underlying these traits.<h4>Result</h4>GWAS across Duroc, Landrace, and Yorkshire identified 44 high-confidence SNPs. A total of 24, 13, and 19 candidate genes were identified respectively from Duroc, Landrace, and Yorkshire by GWAS and differential gene expression analysis (in three breeds versus Meishan pigs). The candidate gene ARL8A was found to be highly conserved between Duroc and Yorkshire. GeneMANIA networks of Landrace exhibited tightly connected core modules of candidate genes. Integrated RNA-seq, ATAC-seq, and ChIP-seq analyses of muscle and fat tissue data consistently suggested that ARL8A exhibits relatively high transcriptional activity and chromatin accessibility, supporting its potential role in muscle and fat development.<h4>Conclusions</h4>The integration of three GWAS methods with differential gene expression analysis revealed that core candidate genes involved were mainly involved in regulating fat deposition, energy metabolism, and cell growth in constructed breed-specific regulatory networks. Among these candidate genes, ARL8A was a highly conserved gene modulating growth-related traits (BF and LEA), as evidenced by the multi-omics data. Our findings provide an insight into genetic architecture and regulation mechanisms underlying pig growth and development, offering important resources for porcine molecular breeding and genetic improvement.

PTGIS
Also flagged:Prostate Cancermetabolismprimary tumormetastatic diseasetumorprostate adenocarcinoma
Journal Article 2026-05-25 ✓ 5 Snippets Li R, He H, Sun H, Long Y, Huang N, Zhu Y, Chen H, Jiang G, Chen X.
In-Text Gene Mentions

…the signature, althoughPTGISshowed a more…

…PPP1CB , andPTGISwas established.…

…PLIN3, ALDH3A2, ENO2,PTGIS, and PPP1CB in…

…oteintech, 10149-1-AP, 1:200),PTGIS(Proteintech, 27061-1-AP, 1:20…

…For ALDH3A2, ENO2,PTGIS, and PPP1CB, staining…

Show Full Abstract

<h4>Background</h4>Lipid metabolic reprogramming is increasingly recognized as a critical feature of prostate cancer progression, but the lipid metabolism-related genes that remain continuously dysregulated from normal tissue to primary tumor and metastatic disease have not been systematically characterized, and their biological and prognostic relevance remains incompletely understood.<h4>Objective</h4>To identify lipid metabolism-related genes associated with continuous prostate cancer progression and develop a prognostic signature for survival stratification.<h4>Methods</h4>Clinical prostate cancer specimens and a high-fat diet (HFD)-driven RM-1 tumor model were first used to evaluate lipid metabolic alterations in vivo. GSE6919 transcriptomic data were used to identify genes shared between the Normal-Primary and Primary-Metastatic transitions. These genes were intersected with a curated lipid metabolism-related gene set, followed by GO and KEGG enrichment analyses. TCGA prostate adenocarcinoma expression and clinical data were used for LASSO regression to construct a prognostic model. The four core genes were further evaluated by clinicopathological correlation analysis, protein- and transcript-level validation in clinical tissues and prostate cancer cell lines, and functional assays under oleic acid-induced lipid stress. Immune infiltration analysis, ssGSEA, and nomogram analysis were performed to assess the biological and clinical relevance of the model.<h4>Results</h4>Clinical tissues showed increased PLIN3 expression, and HFD feeding promoted tumor growth and reinforced lipid metabolic alterations in vivo. A total of 44 lipid metabolism-related genes were identified as continuously dysregulated during prostate cancer progression. These genes were mainly enriched in fatty acid metabolism, lipid catabolism, peroxisome, lipid droplet, glycolysis/gluconeogenesis, arachidonic acid metabolism, and PPAR signaling. Eight genes were significantly associated with overall survival in TCGA, and a four-gene signature comprising ALDH3A2, ENO2, PPP1CB, and PTGIS was established. This model effectively stratified patients into high- and low-risk groups with significantly different survival outcomes. The risk score was positively associated with clinical T stage and Gleason score. The four core genes were also associated with lipid metabolic enzymes, immune infiltration patterns, and multiple metabolism-related pathways. Protein- and transcript-level validation in clinical tissues and prostate cancer cell lines supported the biological relevance of the signature, although PTGIS showed a more context-dependent pattern. Functionally, silencing ENO2 reduced oleic acid-induced lipid peroxidation, whereas silencing PPP1CB enhanced it, while ALDH3A2 showed a more context-dependent effect. A nomogram integrating the risk score with clinical variables improved individualized survival prediction.<h4>Conclusion</h4>We identified lipid metabolism-related genes continuously dysregulated during prostate cancer progression and established a four-gene prognostic signature with potential value for survival prediction and risk assessment. These findings highlight lipid metabolic rewiring as an important component of prostate cancer evolution and provide candidate biomarkers for future mechanistic and translational studies.

Also flagged:Neurodegenerative diseasesAlzheimer's diseaseADParkinson's diseasePDHuntington's disease
Journal Article 2026-05-25 No Snippets Salgueiro AM, Ferreira-Marques M, Ribeiro RFN, Lopes SM, Pereira D, Costa DG, Santana MM, de Almeida LP, Cavadas C.
Show Full Abstract

The ketogenic diet (KD) is increasingly recognized as a promising therapeutic strategy for neurodegenerative disorders because of its multifaceted impacts on key pathophysiological mechanisms. This review explores the molecular pathways through which KD may protect against neurodegeneration, including the use of ketone bodies as alternative energy substrates, reduction of oxidative stress and inflammation, modulation of autophagy and protein aggregation, and impact on the gut microbiome. The potential benefits of KD are explored across neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and multiple sclerosis, based on both preclinical and clinical evidence that supports its feasibility. However, challenges in long-term safety, patient adherence, and clinical practicality limit its widespread adoption. This review underscores the potential of KD for treating neurodegeneration on the basis of current scientific evidence while highlighting the need for further research to optimize its application and address existing gaps.

Also flagged:male infertilityazoospermiaInfertilityoligozoospermiaasthenozoospermiasperm
Journal Article 2026-05-25 No Snippets Zahi H, Sfifou F, Slaoui M, Chentoufi L, Abouqal R, Hardizi H.
Show Full Abstract

Male infertility is a complex and heterogeneous disorder. It has a significant genetic component, although some cases remain idiopathic. Next-generation sequencing, particularly whole-exome (WES) and whole-genome sequencing (WGS) has become a powerful tool for uncovering new genetic causes. This systematic review aimed to identify and synthesize genes linked to male infertility reported in WES or WGS studies. The review was registered on PROSPERO (CRD42024597301). A bibliographic search was conducted on PubMed, Scopus, and Web of Science (2014-2024). We included human studies that used WES or WGS to investigate the genetics of male infertility. Two reviewers independently performed screening, data extraction, and risk-of-bias assessment with JBI checklists. Out of 8018 identified records, 23 studies met the inclusion criteria. In total, 169 unique genes were reported; after removing duplicates, 143 genes remained. The most frequently implicated phenotypes were multiple morphological abnormalities of the flagella (MMAF) and non-obstructive azoospermia (NOA). Genes were stratified by recurrence across independent cohorts and by functional validation status. Of the 143 genes, five were replicated with functional validation, 22 demonstrated either replication or functional validation, and 116 were reported in single studies with only in silico support. In studies applying the criteria of American College of Medical Genetics and Genomics (ACMG), the diagnostic yield was 48% for MMAF and 12-23% for NOA, with an average variant-of-uncertain-significance (VUS) burden of 47%. ACMG classification was inconsistently applied across studies. MMAF-associated genes were predominantly autosomal recessive (95%), whereas NOA-associated genes exhibited greater diversity: 60% autosomal recessive, 25% X-linked, and 15% autosomal dominant. Only 34% of genes had undergone functional validation. In summary, among WES and WGS studies of predominantly sporadic cohorts, most identified genes were reported in single studies without functional validation, and standardized variant classification was implemented in only a minority of studies.

Journal Article 2026-05-25 No Snippets Bai Y, Wei P, Wang L, Chi C, Du C, Han Z, Yu J, Wang XQ, Hou S, Xiao Y.
Show Full Abstract

No abstract available.

PTGIS
Also flagged:Colorectal liver metastasiscolorectal cancermetabolismrelatedbiosynthesistumor
Journal Article 2026-05-25 ✓ 1 Snippet Zhang H, Wang K, Guo R, Wu X, Chen Q, He Q, Yang B, Zhuang Y, Yang W, Zhu H.
In-Text Gene Mentions

…genes such asPTGIS[ 26 ],…

Show Full Abstract

Colorectal liver metastasis (CRLM) remains the primary cause of mortality in patients with colorectal cancer (CRC), yet effective predictive tools and reliable biomarkers are still lacking. DeepMetabio-mCRC Screener, an integrated multi-omics framework combining large-scale transcriptomic profiles with serum metabolomics, was developed to address this gap. In a cohort of 1,077 CRC samples, 620 metabolism-related genes were used to train a convolutional neural network, yielding an area under the receiver operating characteristic curve of 0.92 in the validation cohort and 0.97 in the independent testing cohort, outperforming the performance of the 10 established machine learning models. Model-derived transcriptomic risk scores revealed 22 core metabolic features associated with metastatic progression and CRLM occurrence, particularly retinol and tryptophan metabolism. Cross-omics integration revealed aminocarboxymuconate-semialdehyde decarboxylase (ACMSD) as a promising biomarker associated with impaired nicotinamide adenine dinucleotide biosynthesis. Clinical validation in 100 CRC patients confirmed elevated ACMSD levels in patients with CRLM, which correlated with advanced stage, recurrence risk, an immune-inflamed tumor microenvironment, and heightened sensitivity to epidermal growth factor receptor/vascular endothelial growth factor receptor-targeted therapies. In vitro, ACMSD knockdown was associated not only with suppressed CRC cell migration caused by inhibition of the transforming growth factor-β/epithelial-to-mesenchymal transition pathway but also with decreased proinflammatory and immune-responsive pathways and reduced immune cell infiltration. These findings collectively validate the DeepMetabio-mCRC Screener as a substantial early risk prediction tool and underscore ACMSD, identified through this framework, as a multifunctional biomarker for diagnosis, prognosis, molecular characterization, and therapeutic decision-making in patients with CRLM.

Also flagged:Cancertumorovarian cancerscell proliferationsolid tumorrheumatoid arthritis
Journal Article 2026-05-25 No Snippets Li ZX, Zang L, Li YQ, Zhang M, Zhao DM, Han XY, Zhao JF, Ding CH, Liu WS.
Show Full Abstract

Triptolide is a bioactive diterpenoid lactone from traditional Chinese medicine with notable anti-tumor, immunosuppressive, and anti-inflammatory properties. However, its clinical utility is hampered by poor solubility, a narrow therapeutic index, and multi-organ toxicity. In response, extensive efforts have been made to improve its efficacy and safety profile. This review critically examines recent progress in Triptolide research, covering its mechanisms of action, derivative design, drug delivery systems, and cancer-specific applications. It also evaluates its clinical potential against pancreatic, breast, and ovarian cancers, addresses ongoing challenges, and suggests future research paths to accelerate clinical translation. This article presents a narrative review summarizing the research progress on the pharmacological activities, structural modifications, and nanodelivery systems of Triptolide. Literature searches were conducted in PubMed and Web of Science using keywords including "Triptolide", "pharmacological activity", "structural modification", and "nanodelivery", combined with Boolean operators. The search timeframe was from database inception to March 2026. Inclusion criteria were: original research articles related to the pharmacological activities, structural modifications or nanodelivery systems of Triptolide, peer-reviewed journal articles published in English or Chinese. Exclusion criteria were: duplicate publications, conference abstracts, dissertations, and preprints, articles irrelevant to the topic. Study selection was performed independently by two reviewers, with disagreements resolved through discussion or consultation with a third reviewer. A total of 158 articles were included in this review.

Also flagged:lactylationage-related diseasestranslationlocalizationmetabolismaging
Journal Article 2026-05-25 No Snippets Li P, Wu M, Xu L, Ji M, Guan H.
Show Full Abstract

Lactylation (Kla) is a novel post-translation protein modification regulation mechanism realized by the covalent coupling of lactate generated by glycolysis and lysine residues. Lactylation primarily includes histone Kla and non-histone Kla. Kla participates in biological processes in cells by regulating gene transcription and protein expression, as well as subcellular localization. Multiple organs are exposed to lactate metabolism disorder due to aging. Recent studies have demonstrated that Kla mediated by lactate metabolism disorder is involved in the occurrence and development of various age-related diseases. This article summarizes the functions of Kla in age-related diseases and the related mechanisms.

Also flagged:cancerdermatoses
Journal Article 2026-05-25 No Snippets Shrestha R, Tran HTT, Nguyen GH.
Show Full Abstract

<h4>Purpose of review</h4>Modern oncologic therapies, including immune checkpoint inhibitors (ICIs), targeted kinase inhibitors (TKIs), antibody-drug conjugates (ADCs), bispecific antibodies, and adoptive cellular therapies, have transformed cancer care while introducing diverse cutaneous adverse events (cAEs). This review summarizes recent advances in the mechanistic understanding, clinical patterns, and management of dermatologic toxicities associated with contemporary cancer therapeutics.<h4>Recent findings</h4>Emerging evidence indicates that therapy-associated cAEs often reflect distinct biological mechanisms rather than nonspecific drug reactions. These toxicities can be conceptually organized into four major mechanistic paradigms: immune disinhibition, epithelial signaling inhibition, cytotoxic epithelial injury, and cytokine-driven immune activation. While immune checkpoint inhibitors remain the most extensively characterized model, newer therapeutic platforms, including ADCs and immune-engaging cellular therapies, have introduced additional toxicity patterns that are only beginning to be systematically characterized. Recent clinicopathologic studies have clarified cytotoxic epithelial injury patterns associated with ADCs, while early clinical series suggest cytokine-mediated inflammatory eruptions may occur during cellular immunotherapies. At the same time, advances in immunopathologic profiling have supported the development of mechanism-directed management strategies, including targeted cytokine blockade for steroid-refractory immune-mediated dermatoses.<h4>Summary</h4>Cutaneous adverse events associated with modern cancer therapies increasingly represent mechanism-based toxicities linked to therapy-specific biological pathways. Integrating clinical morphology with treatment class and immunologic mechanisms provides a practical framework for diagnosis and management. Mechanism-directed dermatologic care, including early recognition, targeted immunomodulation, and multidisciplinary collaboration, may improve toxicity control while preserving oncologic efficacy.

Tremor pathophysiology.

Also flagged:Tremor syndromesmembranereflexEssential tremorParkinson tremorCortical
Journal Article 2026-05-25 No Snippets Elble RJ.
Show Full Abstract

Tremor syndromes arise from diverse combinations of neuronal oscillation, resonance, and entrainment within interconnected cerebellar, thalamocortical, basal ganglia, and sensorimotor loops. This review synthesizes anatomical, physiological, pathological, clinical, and computational evidence to identify the most likely network mechanisms of common and uncommon tremor syndromes. Mechanical-reflex tremor reflects underdamped musculoskeletal resonance and reflex loop dynamics, whereas central neurogenic tremors arise from intrinsic membrane conductances, electrical coupling, and recurrent inhibitory and excitatory loops that support oscillation, frequency-selective resonance, and entrainment. Acute cerebellar lesions produce intention tremor through impaired dentate-mediated motor planning and interpositus-dependent predictive motor control, causing hypermetria and abnormal transcortical mechanical-reflex oscillation. Delayed tremor after a cerebellothalamic pathway injury reflects maladaptive plasticity, likely within the thalamocortical loop, and similar delayed maladaptive change plus abnormal basal ganglia oscillation produces Holmes tremor. Essential tremor probably originates from oscillatory cerebellar cortical circuits with thalamocortical amplification, shaped by heterogeneous genetic vulnerabilities. Parkinson tremor is produced by increased pallidal and subthalamic oscillation combined with thalamocortical resonance in response to a loss of dopaminergic modulation. Dystonic tremor arises from abnormal oscillation within interacting basal ganglia and cerebellar circuits. Cortical tremor stems from cortical hyperexcitability and reverberation. The properties of orthostatic tremor are most consistent with oscillation originating in the fastigium and associated cerebellar cortex with resonant amplification primarily in the pontobulbar reticular formation and secondarily in the thalamocortical loop. Neuropathic tremors appear to begin as disturbances of physiological mechanical-reflex and central neurogenic pathways but may evolve into disabling oscillation in the cerebellothalamocortical pathway. Tremor in sarcomeric myopathies probably emerges from unexplored central mechanisms of tremorogenesis. Future progress in tremor pathophysiology will require additional animal models and computational network models that can experimentally test proposed oscillatory mechanisms, distinguish causal oscillators from entrained amplifiers, and guide mechanism-based therapies.

OLFM4
Also flagged:mismatch repairLynch SyndromeLScolorectal cancerhereditary nonpolyposis colorectal cancerHNPCC
Journal Article 2026-05-25 ✓ 5 Snippets Xu J, Zhang J, Li Y, Wang Z, Li Q, Liu A, Sheng J, Dong G, Yang L, Cai Z.
In-Text Gene Mentions

…rabbit polyclonal toOLFM4(1:50, ab188822, Abcam)…

…, MT-ATP6 andOLFM4( Figure 4E…

…, GPRC5A andOLFM4and their encoded…

…, GPRC5A andOLFM4(newly identified here),…

…CE2</i>, <i>GPRC5A</i> and <i>OLFM4</i> in the epithelium…

Show Full Abstract

<h4>Background</h4>Lynch Syndrome (LS) is an autosomal dominant disease characterized by germline heterozygous mutations in DNA mismatch repair (MMR) genes. High-risk LS patients may proceed to colorectal cancer (CRC). However, the drivers or biomarkers of LS benign colon tissue approaching malignant CRC are not completely understood. This study aimed to understand the molecular and cellular changes during malignant transition in LS.<h4>Methods</h4>Single-cell RNA sequencing (scRNA-seq) was used to analyze paired fresh biopsy samples from 3 LS patients (carcinoma vs. para-carcinoma, labeled as LS-CA vs. LS-paraCA). Single-nuclear RNA sequencing (snRNA-seq) was used to analyze a frozen biopsy sample of a LS patient. Datasets of Healthy controls and patients diagnosed with sporadic CRC (without LS-related germline or somatic mutations; labeled as nonLS-CRC) were downloaded from the open source. Integrative computational analysis was performed to conclude potential drivers of the malignant transition. Immuno-histo-fluorescence staining (IHF) were also performed for validating the proposed three key markers.<h4>Results</h4>In the single-cell atlas, we observed an increase of primitive cancer stem-cells with high expression of biomarkers <i>CEACAM5, BACE2</i>, <i>GPRC5A</i> and <i>OLFM4</i> in the epithelium of the LS. Both infiltration of immune cells and pathways related to DNA repair biological activity in LS are dramatically increased in carcinoma compared to para-carcinoma. The mutation burden in LS is fundamentally elevated compared to that in healthy controls. Furthermore, T cell and macrophage-related tumor immunity in LS is readily mobilized in carcinomas compared to para-carcinoma.<h4>Conclusions</h4>This study provides single-cell transcriptomic resource using affected tissues from patients with Lynch Syndrome and describes an integrative profile covering the alterations of cancer stem cell markers, mutation burden, and tumor immunity during the malignant transition from latency state to Lynch Syndrome and to colorectal cancer at the single-cell level.

Also flagged:triple-negative breast cancertumormetabolismcancer
Journal Article 2026-05-25 No Snippets He K, Yang S, Zhang K, Yang L, Song F.
Show Full Abstract

Immunotherapy resistance in triple-negative breast cancer (TNBC) remains a critical clinical challenge. This review synthesizes and critically evaluates current evidence on two interconnected mechanisms that have emerged from recent research: the functional plasticity of mast cells (MCs) and metabolic reprogramming. Far from being mere allergic effectors, MCs exhibit high phenotypic diversity, with antigen-presenting MCs (apMCs) representing a unique subset identified in recent studies capable of priming anti-tumor T cell responses. A landmark phase 2 trial has demonstrated that modulation of apMCs can enhance responses to anti-PD-1 therapy in patients with ICI-refractory TNBC. However, within the TNBC TIME, metabolic dysregulation-characterized by glycolytic flux, lactate accumulation, and lipid alterations-skews MCs toward immunosuppressive phenotypes and suppresses apMC function. Published studies have documented that this bidirectional crosstalk forms a vicious cycle that sustains immune evasion and limits the efficacy of immune checkpoint inhibitors. To decipher this complexity, patient-derived organoid (PDO) models co-cultured with autologous immune cells have emerged as a validated platform that preserves tumor heterogeneity and enables real-time dissection of metabolism-immune circuits. This review systematically synthesizes current knowledge on the biological basis of MC plasticity, the metabolite-driven regulation of their function, and the utility of organoid-based systems for mechanistic discovery and drug screening. We critically evaluate emerging multidimensional therapeutic strategies, including pharmacological reprogramming of apMCs, metabolic normalization, and engineered cell therapies, and identify key knowledge gaps that must be addressed to translate these insights into clinical practice. By integrating advances in immuno-oncology, cancer metabolism, and bioengineering, this review provides a framework for translating current insights into clinically actionable strategies to overcome immunotherapy resistance in TNBC.

HFE
Also flagged:Hepatocellular Carcinomacancerinflammatory responsesmitochondrialferroptosisliver cancer
Journal Article 2026-05-25 ✓ 1 Snippet Wang Y, Zhang Y, Ren T, Yuan L, Geng X.
In-Text Gene Mentions

…liver disease (MASLD),hemochromatosis, Wilson’s disease, and…

Show Full Abstract

Aristolochic acid (AA), a naturally occurring compound found in Aristolochia plants, is a well-established nephrotoxin and Group 1 carcinogen. Emerging evidence suggests a potential link between AA exposure and hepatocellular carcinoma (HCC), one of the leading causes of cancer-related mortality worldwide. This review critically evaluates current knowledge on AA's hepatic metabolism, its formation of persistent DNA adducts, and the induction of inflammatory responses in the liver. Based on preclinical and indirect human evidence, we propose a working hypothesis that AA may contribute to hepatocarcinogenesis through a dual mechanism: genotoxic (primarily via H-ras and p53 mutations resulting from AA-DNA adducts) and non-genotoxic (via chronic inflammation involving IL-6, TNF-α, and NF-κB activation, as well as epithelial-mesenchymal transition). We note, however, that these mechanisms remain to be validated in human cohorts and do not yet establish causality. Recent studies have identified novel mechanisms, including PDK4-mediated mitochondrial dysfunction, ferroptosis inhibition via p53 hijacking, and ARID1A deficiency as a susceptibility factor. A recent meta-analysis quantified a significantly increased risk of liver cancer following AA exposure in epidemiological studies. While direct causal evidence in humans remains limited, the high mutational burden observed in AA-exposed liver tissues warrants caution. Nevertheless, the primary public health priority pertains to the prevention of AA exposure. Further epidemiological and mechanistic studies are urgently needed.

Also flagged:wound healingtissuetranslationalcomplexationenvelopescapsules
Journal Article 2026-05-25 No Snippets Tofanica BM, Ungureanu E.
Show Full Abstract

Self-healing materials have attracted increasing attention as a strategy to enhance durability, extend service life, and reduce maintenance in advanced material systems. Among these, cellulose-based self-healing materials represent a sophisticated intersection between sustainable macromolecular chemistry and adaptive materials science. This review provides a synthesis of recent advancements in the field, systematically categorizing materials derived from cellulose raw materials. We evaluate the fundamental chemical strategies employed to achieve autonomous repair, distinguishing between extrinsic mechanisms-utilizing cellulose-based micro/nano-capsules to sequester healing agents-and intrinsic mechanisms governed by dynamic covalent chemistry (Schiff-base, boronic ester, Diels-Alder) and supramolecular interactions (hydrogen bonding, metal-ligand coordination, and host-guest assemblies). The analysis highlights how cellulose's hierarchical structure and abundant surface functionality are leveraged to overcome the traditional trade-off between mechanical toughness and healing efficiency. Particular emphasis is placed on the transition from simple structural hydrogels to sophisticated multifunctional systems. These include ultra-stretchable strain and pressure sensors for e-skin applications, biocompatible and injectable matrices for chronic wound management and stem cell delivery, and advanced anti-freezing eutectogels for performance in extreme environments. Furthermore, we explore the integration of cellulose into traditional sectors, such as self-healing concrete utilizing microbe-induced calcification and smart, eco-friendly coatings for corrosion protection. Finally, we discuss critical challenges, including environmental stability, scalability, and the development of standardized evaluation protocols, providing a roadmap for the next generation of bio-derived, sustainable and intelligent materials.

Also flagged:reproductionhost cellsinfectioncell divisionnitrogen fixationcell proliferation
Journal Article 2026-05-25 No Snippets Zhang Y, Gao Y, Chen C, Zhao A, Wu Y, Shi L, Wei Q, Zhou Z, Yang X, Ming M, Zhang L, Cao F, Fu F.
Show Full Abstract

<i>Hippophae gyantsensis</i> Lian is an important native tree species in the "One River, Two Streams" valley of Tibet, valued for its ecological restoration potential and nutrient-rich fruits. However, this species has several limitations, including a long fruiting cycle (3-5 years to flowering and 10-15 years to reach peak fruit production), small fruit size, and numerous branch thorns. These traits hinder large-scale cultivation and mechanized harvesting, creating an urgent need for improved varieties with larger fruit and higher yield. In this study, we established an efficient <i>Agrobacterium</i>-mediated genetic transformation system for <i>H. gyantsensis</i> using hypocotyls as explants. Under optimized conditions (OD<sub>600</sub> = 0.5, AS = 200 μmol/L, infection time = 15 min), the transformation efficiency reached 36.67% (calculated as the number of PCR-positive plants divided by the total number of explants initially inoculated with <i>Agrobacterium</i>). A rooting rate of 12.5% was achieved using 100 mg/L rooting powder (ABT1) for 40 min, resulting in an overall success rate of approximately 4-5%. Furthermore, we identified and cloned two fruit-size-related genes, <i>Hgfw2.2</i> and <i>Hgfw3.2</i>, from <i>H. gyantsensis</i>. Heterologous expression of <i>Hgfw2.2</i> and <i>Hgfw3.2</i> in tomato decreased and increased fruit size, respectively, consistent with their regulatory roles in fruit development. Given the positive regulatory effect of <i>Hgfw3.2</i>, this gene was further transformed into <i>H. gyantsensis</i>. This study represents the first report of a stable genetic transformation platform for <i>H. gyantsensis</i>, providing a robust technical foundation for future molecular breeding and the development of improved, large-fruited varieties.

Also flagged:Neurological disordersepilepsyinsomniadepressioncord injuryneurotransmitter
Journal Article 2026-05-25 No Snippets Shao J, An Y, Ding R, Wang S, Wang X.
Show Full Abstract

Neurological disorders, including Alzheimer's disease, Parkinson's disease, and stroke, remain major causes of global disability and mortality, with limited neuroprotective therapies available. Traditional Chinese medicine (TCM) offers multi-target therapeutic potential, but its mechanistic complexity requires systematic investigation using appropriate model systems. Zebrafish (<i>Danio rerio</i>) has emerged as a valuable vertebrate platform for TCM neuroprotection research due to its genetic homology with humans, optical transparency, and high-throughput screening compatibility. This review summarizes the application of zebrafish models in studying TCM for Alzheimer's disease, Parkinson's disease, cerebral ischemia, epilepsy, insomnia, depression, and spinal cord injury. Key findings indicate that TCM metabolites exert neuroprotective effects through multiple mechanisms, including anti-oxidative stress, anti-neuroinflammation, anti-apoptosis, neurotransmitter modulation, neurogenesis promotion, and vascular protection. Zebrafish models have proven particularly useful for high-throughput screening of active metabolites, real-time <i>in vivo</i> imaging of neurovascular processes, and rapid safety assessment. However, limitations such as the absence of a layered neocortex, differences in drug metabolism, and the predominantly acute nature of current models must be acknowledged. Addressing these challenges through model standardization, multi-omics integration, and cross-species validation will further enhance the translational relevance of zebrafish-based TCM research. This review provides a practical framework for leveraging zebrafish models to advance the mechanistic understanding and clinical development of neuroprotective TCM therapies.

ARFGEF2
Also flagged:cancergene expressioninduced silencingdeathprostate cancerhepatocellular carcinoma
Journal Article 2026-05-25 ✓ 1 Snippet Murmann AE, Ebadi M, Patel M, Ewe A, Barajas S, Xiao S, Ko MJ, Lee S, Cai W, Paudel B, Sun L, Bartom ET, Kocherginsky M, Liu Y, Kim DH, Aigner A, Peter ME.
In-Text Gene Mentions

…Thermo Fisher Scientific:ARFGEF2(Hs00197455_m1), BIRC5/Survivi…

Show Full Abstract

RNA interference (RNAi) regulates gene expression through small RNAs that act via Argonaute-containing RNA-induced silencing complexes (RISCs). We previously found that short RNAs with G-rich 6mer seeds (e.g., GGGGGC and G5C) can kill cells by targeting C-rich 3' UTR seed matches in essential survival genes (SGs), a mechanism termed death induced by survival gene elimination (DISE). To assess therapeutic potential, we systemically delivered two DISE-inducing sRNAs, sG5C and sCAG (based on CAG trinucleotide repeats), using lipopolyplexes (LPPs) composed of low-molecular-weight polyethyleneimines and lipids. In mouse ovarian and prostate cancer models and a rat hepatocellular carcinoma model, LPP-delivered small RNAs (sRNAs) markedly reduced or eliminated tumors without harming normal tissues. Predicted SG targets were engaged in tumors. Transcriptomic analyses across 10 major human cancers showed that many sG5C-targeted SGs are consistently upregulated in tumors and increase with stage, revealing a therapeutic window. These results support LPP-delivered DISE-inducing sRNAs as a promising pan-cancer therapy.

Also flagged:bindingdegradationtranslationalcell differentiationimmune responsescancer
Journal Article 2026-05-25 No Snippets Lin I, Shirkani P, Garnis C.
Show Full Abstract

MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression post-transcriptionally and play crucial roles in cancer biology and immune function. Among them, miR-150-5p has emerged as a key regulator with complex, context-dependent roles in both tumorigenesis and immune cell differentiation. This review provides a comprehensive synthesis of current knowledge on miR-150-5p, highlighting its dual function as a tumor suppressor or oncogene depending on cancer type and cellular context. We examine its involvement in hematologic malignancies and solid tumors, detailing the molecular mechanisms through which it influences proliferation, apoptosis, and metastasis. Particular emphasis is placed on the role of extracellular vesicle (EV)-associated miR-150-5p as a modulator of the tumor microenvironment (TME), including its impact on angiogenesis, immune evasion, and intercellular communication. We further explore miR-150-5p's regulation of key immune cell subsets-such as macrophages, dendritic cells, T cells, and natural killer cells-and its implications for anti-tumor immunity. Finally, we discuss the therapeutic potential and challenges of targeting miR-150-5p, including delivery barriers, off-target effects, and opportunities for personalized medicine. By integrating recent findings, this review underscores miR-150-5p's value as both a biomarker and a therapeutic target in cancer immunology.

Also flagged:enterovirus infectionreverse-transcriptioninfectionshand, foot, and mouth diseasemouth diseaseHand
Journal Article 2026-05-25 No Snippets Le TV, Tran HLT, Nguyen QH, Nguyen HTT, Tran HTT, Vien CC.
Show Full Abstract

<h4>Objectives</h4>Human enteroviruses (EVs) are associated with a broad spectrum of diseases, including hand, foot, and mouth disease. This study aimed to understand the epidemiology and genotypes/subgenotypes of EVs circulated in Dak Lak, Vietnam between 2022 and 2024.<h4>Methods</h4>Samples were collected from patients admitted to the inpatient and outpatient departments from 2022 to 2024 in Dak Lak of Vietnam. EVs were identified in all samples through real-time reverse-transcription polymerase chain reaction using a commercially available kit.<h4>Results</h4>EVs were detected in 96 samples in the period from 2022-2024 in total of 167 suspected samples; the EV-positive rate was 57.5%. The highest positivity rate for EVs was observed in children aged <5 years, reaching 96.8%, while the rates of EV infections showed no significant differences between genders. The monthly positivity rate for EV infection ranged from 0% to 84.6%, with a peak in September. The most frequently observed EVs were EV A71 (28.1%), Coxsackievirus A6 (28.1%), followed by Coxsackievirus A16 (16.7%) and Coxsackievirus A10 (10.4%), while the proportion of unidentified EV serotypes were 10.4%. The phylogenetic analysis of the VP1 gene of EV A71 strains revealed that two genotypes, B5 (93.7%) and C4 (6.3%), were found and all were closely related to variants causing epidemics of hand, foot, and mouth disease in southern Vietnam that circulated in 2023. Meanwhile, all CVA6, CVA16, and CVA10 strains belonged to D3, B1a, and C3 subgenotypes, respectively.<h4>Conclusion</h4>EV infection is highly prevalent among young children aged <5 years in Dak Lak. Further monitoring through techniques capable of subtyping all EVs is necessary to enhance the observation of these infections and their causes.

Research Square 2026-05-25 Preprint (No Snippets API) Khurram NA, Matyja TM, Varshney N, Alexander M, Barwad A, Sharma CB, Davis K, Celaj S, Furlan A, Oshima K.
Show Full Abstract

<title>Abstract</title> <p> <bold>Purpose</bold> Serum ferritin is an imperfect surrogate of hepatic iron burden, particularly in metabolic and inflammatory liver disease. We evaluated the diagnostic performance of serum ferritin against MRI-derived liver iron concentration (MRI-LIC) and characterized the biological correlates of biochemical–imaging discordance. <bold>Methods</bold> In this single-center retrospective cohort study, 695 adults evaluated for suspected iron overload between 2003 and 2024 underwent serum ferritin, transferrin saturation (TSAT), and HFE genotyping. Biochemical data were available for 664/695 patients, histopathology for 673/695, and paired ferritin–MRI measurements for 77/695. Diagnostic performance of ferritin was assessed by receiver operating characteristic (ROC) analysis and agreement metrics; independent predictors of MRI-defined iron overload (LIC ≥ 2.0 mg/g) were identified using Firth penalized logistic regression. <bold>Results</bold> Among 77 patients with paired data, ferritin showed moderate correlation with MRI-LIC (Spearman ρ = 0.66, p < 0.001) and good discrimination for iron overload (AUC 0.86, 95% CI 0.77–0.95). At 1,000 ng/mL, ferritin showed high specificity (88%) and negative predictive value (90%) but lower sensitivity (54%) and positive predictive value (47%); overall agreement was 82% (κ = 0.39). In multivariable Firth regression, TSAT—but not ferritin—retained association with MRI-defined iron overload. MRI-LIC varied nonlinearly across fibrosis stages, peaking in intermediate fibrosis (F2; Kruskal–Wallis p = 0.006). <bold>Conclusion</bold> Serum ferritin offers high negative predictive value but limited specificity and positive predictive value for hepatic iron overload. MRI-LIC provides direct tissue iron quantification and should be used when biochemical findings are discordant or dysmetabolic hyperferritinemia is suspected. </p>

CACNA1E
Also flagged:PDmethylationgene expressionneurodegenerative disorderADneurological disease
Journal Article 2026-05-24 ✓ 1 Snippet Li G, Ye X, Zhou T, Zhou Z, Min Y, Song H, Liu X.
In-Text Gene Mentions

…genes: AASS, ACMSD,CACNA1E, CSTB, DPAGT1, ENPP2,…

Show Full Abstract

Mounting evidence has associated gut microbial composition and systemic metabolic profiles with Parkinson's disease (PD), yet causal pathways and molecular mechanisms remain unclear. We employed a systematic two-stage analytical framework integrating multiple Mendelian randomization (MR) approaches, transcriptome and epigenome-wide regulatory analyses, and colocalization analysis to genetically dissect the microbiota-host regulatory network implicated in PD susceptibility. Initially, two-sample MR was performed using gut microbiota data from the MiBioGen consortium, followed by an independent replication MR analysis using mbQTL data from the Dutch Microbiome Project (DMP). The two-step MR approach was employed to identify potential mediation of blood metabolites. Summary data-based MR (SMR) methods were also used to pinpoint key blood metabolic genes and regulatory regions associated with PD risk, with the combination of PD GWAS data, blood expression quantitative trait loci (eQTLs), and DNA methylation quantitative trait loci (mQTLs). Colocalization analyses were performed to explore interactions between host metabolic gene expression and the gut microbiota using blood expression quantitative trait loci (eQTLs) and fecal microbial quantitative trait loci (mbQTLs). Our multi-stage analyses identified five microbial taxa with nominal positive associations with Parkinson's disease (PD), including class Clostridia, order Bacillales, and genera Clostridium sensu stricto 1, Dorea, and Lachnospiraceae UCG001. By contrast, three additional microbial genera (Butyricimonas, Defluviitaleaceae UCG011 and Marvinbryantia) exhibited nominal protective correlations with PD. Cross-cohort analyses further indicated a shared correlation pattern along the Clostridia-Clostridiales-Clostridiaceae/Lachnospiraceae taxonomics potentially linking to PD risk across both discovery and validation cohorts. Mediation analyses indicated that betaine may mediate the Lachnospiraceae UCG001-PD associations, while androstenediol monosulfate may serve as a mediator linking Clostridium sensu stricto 1 to PD. SMR analysis highlights genes like SH2B1, JUP, as key host metabolic genes with potential causal relevance to PD, with colocalization indicating genetic overlaps supporting their potential involvement in gene-microbiota interactions. These findings deepen our understanding of gut-brain axis dysregulation in PD and may provide novel insights for future mechanistic validation and targeted preventive or therapeutic investigations.

PEBP1
Also flagged:circadian rhythmdiabetic nephropathyDNmethylationgene expressionsdiabetes
Journal Article 2026-05-24 ✓ 5 Snippets Mao Y, Zhang M, Li X, Zhang Z, Rong W, Zhang X, Feng L, Xu J.
In-Text Gene Mentions

…nobiletin could targetPEBP1, GNAI2, and KIF11,…

…KIF11 but reducedPEBP1.…

…BICC1, ANKIB1, KIF11,PEBP1, and GNAI2…

…proteins, 4 proteins (PEBP1, PTPN9, RBP1, TFPI)…

…The validation ofPEBP1was successfully demonstrated…

Show Full Abstract

This study aims to identify pathogenic genes involved in diabetic nephropathy (DN) through multi-omics analysis of circadian rhythm disruptions to uncover targets for precision medicine. We conducted summary-data-based Mendelian Randomization (SMR) and colocalization analyses using multi-omics quantitative trait loci (QTL) data (methylation quantitative trait loci [mQTL] , expression quantitative trait loci [eQTL], protein quantitative trait loci [pQTL]) to explore genetic associations between circadian rhythm-related genes and DN. Genome-wide association study (GWAS) summary statistics were sourced from major consortia (discovery) and FinnGen (replication). Key gene expressions were validated in GEO (GSE96804). Transcription factors were predicted, and potential drugs (<i>via</i> Enrichr) were assessed through molecular docking. This study identified 395 methylation loci, 29 genes, and 5 proteins linked to disease using blood-derived QTL data. Replication confirmed 62 methylation loci, 5 genes, and 1 protein were associated with DN. Seven methylation loci influenced four DN-related genes (<i>BICC1</i>, <i>ANKIB1</i>, <i>KIF11</i>, <i>GNAI2</i>). Kidney tissues from DN patients showed elevated <i>GNAI2</i> and <i>KIF11</i> but reduced <i>PEBP1</i>. IRF2 was identified as a potential key transcription regulator. Drug predictions suggested calycosin, nitrofural, and nobiletin could target PEBP1, GNAI2, and KIF11, respectively. This SMR study suggested the causal role of circadian rhythm dysfunction in DN. Future research should focus on identifying specific genetic drivers, and exploring therapeutic strategies targeting circadian pathways to mitigate DN progression.

PRDX6
Also flagged:Chronic kidney diseasedeathacute kidneyureteral obstructionrenal fibrosisnuclear transport
Journal Article 2026-05-23 ✓ 1 Snippet Kudo K, Ikeda T, Ikeda K, Maehara N, Hirota A, Yoshikawa Y, Mori H, Takayama M, Yasuda K, Tezuka T, Takagi T, Arai S, Miyazaki T.
In-Text Gene Mentions

…, Prdx1 ,Prdx6, Txnrd1 ,…

Show Full Abstract

Chronic kidney disease (CKD) encompasses multiple pathogenic mechanisms manifested by inflammation, fibrosis, oxidative stress and cell death. We previously showed that circulating protein CD5L (or AIM) ameliorates acute kidney injury, so we explored its effect in a mouse model of unilateral ureteral obstruction (UUO)-induced renal fibrosis. Here, we show a unique kidney-protective pathway mediated by CD5L. CD5L is endocytosed into renal epithelial cells, where it reduces oxidative stress, decreasing cell injury and death. This effect is supported by both a cysteine-dependent direct antioxidant activity of CD5L and enhancement of Nrf2-associated antioxidant responses. In addition, our data suggest that suppression of sphingomyelinase activity and reduction of cellular ceramide may contribute, at least in part, to CD5L-associated augmentation of Nrf2 nuclear transport. These effects depend on the reactive cysteine residue on the CD5L surface. Consistent with these findings, recombinant CD5L treatment in UUO mice reduces sphingomyelinase activity, activates Nrf2, and lowers oxidative stress, alleviating inflammation, fibrosis, and kidney injury. Our findings uncover a novel antioxidant pathway mediated by CD5L with potential implications for CKD-associated fibrotic mechanisms.

Also flagged:Ferroptosisdeathmetabolismtumorinflammatory responsesneurodegenerative diseases
Journal Article 2026-05-23 No Snippets Zhao Y, Fu J, Zhao P, Jiang Y, Wang Y, Zhang Y, Li Z, Zhao Y, Li N, Lang B, Luo Y.
Show Full Abstract

Ferroptosis, a unique form of regulated cell death driven by iron-dependent lipid peroxidation, and macrophage polarization, which reflects the high plasticity of the immune system, represent two prominent frontiers in contemporary life sciences. Emerging evidence suggests a profound bidirectional interplay between these processes, mediated by iron metabolism reprogramming, lipid signaling molecules, and complex molecular axes such as RAGE-STAT3. This review systematically summarizes the biological mechanisms of ferroptosis and macrophage polarization, delving into their interaction within the tumor microenvironment, inflammatory responses, and cardiovascular and neurodegenerative diseases (e.g., Alzheimer's and Parkinson's). We highlight how M1 macrophages induce ferroptosis through pro-inflammatory cytokines and reactive oxygen species, while M2 macrophages inhibit it by modulating iron homeostasis and antioxidant capacity. Finally, we discuss therapeutic strategies targeting the ferroptosis-macrophage polarization axis, providing a theoretical foundation and novel perspectives for developing precise medical interventions.

Also flagged:synthesisAIDSbindingreverse transcriptionhost cellhost cells
Journal Article 2026-05-23 No Snippets Movahednia N, Ramazani A, Fassihi A, Shirvani P, Schols D.
Show Full Abstract

The emergence of resistance against first-generation non-nucleoside reverse transcriptase inhibitors (NNRTIs) necessitates the development of novel scaffolds with improved antiviral efficacy. In this study, a series of pyridinone derivatives were designed and synthesized as potential NNRTIs. The antiviral evaluation against wild-type HIV-1 in MT-4 cells revealed that most of the compounds displayed limited or no activity, often accompanied by cytotoxic effects. However, two derivatives, 4e and 4i, demonstrated remarkable inhibition of HIV-1 replication, with 4i exhibiting low-nanomolar potency against HIV-1 (EC<sub>50</sub> = 5.3 nM), having almost one half of the Rilpivirine activity. Molecular docking confirmed critical hydrogen bonding interactions with Lys103 and π-π stacking with Trp229 and Tyr181, while 300 ns molecular dynamics simulations verified the stability of the compound-enzyme complexes. Collectively, these findings highlight the pyridinone scaffold, particularly compound 4i, as a promising lead for further optimization toward next-generation NNRTIs.

HFE
Also flagged:type 1 retinopathy of prematurity
Journal Article 2026-05-23 ✓ 1 Snippet Shah N, Chandler M, Sauer L, Hartnett ME.
In-Text Gene Mentions

…othelial Growth Factor-TreatedType 1 Retinopathy1 Retinopathy of…

Show Full Abstract

<h4>Purpose</h4>Anti-vascular endothelial growth factor (anti-VEGF) therapy is an important treatment for type 1 retinopathy of prematurity (T1ROP). We previously found that regulation of VEGF signaling increased developmental vascularization into the temporal peripheral retina while reducing intravitreal neovascularization in T1ROP. To address our hypothesis that extension of retinal vascularization by early treatment with anti-VEGF could reduce T1ROP, we determined the effects of anti-VEGF therapy on retinal vascular extension in both retinal hemispheres.<h4>Design</h4>Retrospective, masked, nonrandomized, matched, comparative case series.<h4>Subjects</h4>Over 3 years, 34 of 382 screened infants developed bilateral T1ROP. Consent was obtained from parents of 21 infants for infants receiving bevacizumab 0.25 mg OU. Seven treated eyes (7 infants) had suitable imaging and were included in the treatment group. Seven untreated eyes (7 infants) without T1ROP were randomly selected after matching for birthweight and postmenstrual age from the 382 screened infants and assigned to the control group.<h4>Methods</h4>Infants had gradable 100° field-of-view fundus photographs of both retinal hemispheres at 2 time points: baseline before treatment, if administered, and follow-up, 12 to 35 days later. No eyes with vascularization to the ora at baseline or follow-up were included. Retinal vascular extent was measured in pixels from the optic disc margin to the temporal or nasal vascular borders and divided by the optic disc diameter in pixels to create disc diameter units (DD). Measurements were confirmed by a second masked analyst. The Mann-Whitney U test and Wilcoxon signed-rank test were used for statistical analysis.<h4>Main outcome measures</h4>Temporal and nasal vascular extension in DD.<h4>Results</h4>Relative to control eyes, treated eyes had greater nasal (1.27 ± 0.59 vs 0.55 ± 0.44 DD; P = .038) and temporal (1.69 ± 1.16 vs 0.62 ± 0.49 DD; P = .04) extensions. There was greater disparity in vascular extension between nasal and temporal hemispheres in the treated group than in the control group (0.98 ± 0.64 vs 0.10 ± 0.10 DD; P = .005). Nasal extension was greater than temporal extension in 3 of 7 treated vs 1 of 7 control eyes.<h4>Conclusions</h4>Treated eyes had significantly greater vascular extension in both hemispheres than control eyes, with greater nasal-temporal asymmetry. Although limited by sample size, our findings raise the question of uneven anti-VEGF diffusion in the infant vitreous. Further studies testing injection site, needle length, anti-VEGF agent, and molecular size differences and further follow-up periods are indicated.

POU3F2
Also flagged:Gliomasmalignant tumorsglioblastomaGBMtumorangiogenesis
Journal Article 2026-05-23 ✓ 1 Snippet Chen Z, Zhang Y, Hao L, Feng C, Wang C, Ai T, Hu P, Ji J, Fu S, Chen T, Zhang F, Zhao L, Ke Y.
In-Text Gene Mentions

…TFs such asPOU3F2, SOX2, SALL2, and…

Show Full Abstract

Antiangiogenic therapy remains a challenging issue in the treatment of glioblastoma (GBM). Effective therapies are in urgent need to improve prognosis of GBM patients. The high heterogeneity of GBM is both the cause of its unavoidable therapeutic resistance and the result of extensive genomic dysregulation, of which abnormal transcription factor (TF) networks are recognized to be the culprit. Herein, based on the heterogeneity of GBM, we identified the key TF serum response factor (SRF), which is closely associated with the formation of the GBM vascular microenvironment, from a large-scale dataset. Mechanistically, the 133-240aa region of SRF binds to the transcriptional cofactor P54nrb and undergoes phase separation to form a transcription complex, which upregulates OLFML3 by binding to its enhancer and promoter regions. The secreted extracellular matrix (ECM) glycoprotein OLFML3 activates endothelial cells (ECs) by degrading and remodeling the ECM, releasing proangiogenic factors, promoting intercellular adhesion, and directly acting on ECs to promote angiogenesis. The hyperplasia vasculature, in turn, promotes the infiltration of M2-polarized macrophages, leading to the formation of an immunosuppressive microenvironment. This study comprehensively elucidates the pivotal role of SRF in GBM angiogenesis. Targeting the SRF/P54nrb/OLFML3 axis holds promise for developing novel antiangiogenic strategies to improve GBM treatment outcomes.

Also flagged:Gastric Cancertumorcancertranslationalsynthesispathogenesis
Journal Article 2026-05-23 No Snippets Yu R, Zhang M, Meng Y, Zhu C, Zhang W, Zhang H, Cao Z, Du M, Zhao Z, Bai J, Han Y, Tang Y, Kang W, To KF, Jiao S, An L, Zhou Z.
Show Full Abstract

Gastric cancer (GC) remains a formidable global health challenge, characterized by pronounced molecular heterogeneity, late-stage diagnosis, and limited durable responses to existing therapies. This review synthesizes recent advances in GC research through an integrated, multidisciplinary lens, spanning tumor biology, microenvironmental dynamics, and therapeutic innovation. We first consolidate updated histopathological and molecular classification systems, highlighting oncogenic programs that underpin GC development, including Hippo-YAP signaling and emerging neural-stem cell interactions. We then examine the immunosuppressive tumor microenvironment, emphasizing the dynamic crosstalk among tumor-associated macrophages, regulatory T cells, tertiary lymphoid structures, and cancer-associated fibroblasts that collectively drive metastatic dissemination and therapeutic resistance. Emerging biomarker-guided strategies, including CLDN18.2-targeted therapies, dual immune checkpoint blockade, and engineered cellular therapies, are critically discussed alongside rational combination approaches designed to overcome resistance. Beyond canonical paradigms, we highlight transformative frontiers, such as cancer neuroscience, microbiome-driven immune modulation, and spatially resolved multiomics technologies, that enable high-resolution mapping of cellular interactions. Finally, we critically assess translational barriers, including organ-specific metastatic tropism and resistance evolution, and propose that the convergence of deep molecular profiling, neural-immune modulation, and AI-enabled computational oncology will be central to advancing precision medicine for GC. This integrated framework aims to accelerate the development of mechanism-based combination therapies.

OLFM4
Also flagged:Benign Prostatic HyperplasiaProstate cancertumorPCaprostatecancer
Journal Article 2026-05-23 ✓ 1 Snippet Luo Y, Zhong H, Shang T, Hu B, Yuan D, Jia X, Lin R, Wang Z, Fang Y, Zhu G, Song J, Liu Z, Yan B, Sun F, Jia Z, Yu Y, Mao L, Huang H, Zhu J.
In-Text Gene Mentions

…Results showed thatOLFM4, SCGB3A1, MT1G, MT1M,…

Show Full Abstract

Prostate cancer (PCa) is frequently accompanied by benign prostatic hyperplasia (BPH), highlighting the need to reassess their correlation in tumor risk, malignant progression, and immune status to improve the early diagnosis and treatment of PCa. In this study, single-cell RNA sequencing and spatial transcriptomics were used to analyze the potential association between normal, BPH, and PCa tissues. Our study revealed a continuous transformation map of luminal epithelial cells from hyperplasia to malignancy in BPH and PCa, accompanied by a persistently suppressive immune microenvironment. In the lesion nodules, T cells showed a high degree of infiltration yet showed activation retardation and functional exhaustion. Macrophages were also significantly infiltrated, exhibiting significant M2 polarization characteristics, and inflammatory signaling pathways related to immune escape were activated. Natural killer (NK) cells and B cells were partially activated, yet the low abundance of NK cells and B cells resulted in functional limitations. Our results revealed the dynamic changes of the immune landscape during the occurrence and progression of PCa. Our classification and prognostic models provide a theoretical basis for immunomodulatory and personalized therapies and provide new tools for the early diagnosis and intervention of PCa.

Also flagged:major depressive disorderdepressive episodegeneralized anxiety disorderdepressionAnxiety disordersmental disorders
Journal Article 2026-05-23 No Snippets Kowalczyk M, Aebisher D, Szpara J, Czech S, Kowalczyk E, Majsterek I, Bartusik-Aebisher D, Henrykowska G.
Show Full Abstract

<b>Major</b> depressive disorder (MDD) and anxiety disorders are increasingly understood as conditions involving complex metabolic dysregulation across multiple biological domains. This review aimed to synthesize current clinical and translational evidence on amino acid metabolism, lipid metabolism and short-chain fatty acids (SCFAs) as potential biomarkers, and components of integrative metabolic profiling in these disorders. A structured narrative approach was applied, focusing on studies assessing metabolomic alterations, their clinical correlates and their potential role in patient stratification, and treatment response. The available evidence indicates that amino acid disturbances, particularly within the tryptophan-kynurenine pathway, represent the most consistent and clinically interpretable findings. Lipid-related alterations, especially involving long-chain polyunsaturated fatty acids, provide complementary insights into membrane function, inflammation and neuroplasticity. In contrast, SCFAs appear to function as context-dependent markers rather than robust standalone biomarkers, with their clinical relevance depending on biological matrix, metabolic context and host-microbiota interactions. Importantly, most studies assess individual metabolites rather than integrated metabolic profiles, limiting their interpretability within a metabolomic framework. Overall, current evidence supports a shift toward integrative biomarker models that combine metabolic data with selected molecular and clinical parameters. Future research should focus on standardized, reproducible profiling approaches to enable biologically informed stratification and personalized treatment strategies.

HTT
Also flagged:Bipolar DepressionBipolar disorderdepressionmaniaimpulse control disordersneuroinflammatory disorders
Journal Article 2026-05-23 ✓ 2 Snippets Jucha D, Klimas M, Wiśniewska D, Winiarska M, Szczupak M, Kobak J, Krupa-Nurcek S.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) are particularly important;…

…in this manuscript:5-HTT serotonin transporterserotonin transporter ACC…

Show Full Abstract

No abstract available.

HFE
Also flagged:Hereditary Hemochromatosisironbronze diabetespigmentary cirrhosisHLA class Ichromosome
Journal Article 2026-05-22 ✓ 5 Snippets Sonagra AD, Zubair M.
In-Text Gene Mentions

Hemochromatosis, a disorder caused…

…The termhemochromatosiswas believed to…

…and the presumedhemochromatosisgene on chromosome…

…hereditary Fe [iron] (HFE) gene are present…

…known form ofhemochromatosisthat can be…

Show Full Abstract

Hemochromatosis, a disorder caused by excessive iron absorption, was first described in the mid-1800s as bronze diabetes and pigmentary cirrhosis. The term hemochromatosis was believed to have been coined by von Recklinghausen in 1889. A genetic origin of this metabolic problem was first suggested in the 1930s. In 1977, Simon et al reported the association between an HLA class I–like molecule and the presumed hemochromatosis gene on chromosome 6p, establishing the genetic basis of what is now referred to as hereditary hemochromatosis. Although one of the most common genetic disorders in the United States, affecting over 1 million people, hereditary hemochromatosis is often an incidental finding during routine laboratory iron measurements or the diagnostic workup of other conditions; however, increasing awareness of hereditary hemochromatosis has also contributed to early detection. Early diagnosis allows for intervention before tissue damage occurs due to excessive iron deposition. Iron can deposit in the liver, pancreas, heart, joints, and other endocrine organs if left untreated. Hereditary hemochromatosis is currently classified into 4 major types, encompassing 5 distinct molecular subtypes. These classifications are based on age of onset, underlying genetic mutation, and mode of inheritance. Type I hereditary hemochromatosis is considered the classic form of the disorder, and the onset of symptoms begins in adulthood. Loss-of-function mutations in the hereditary Fe [iron] (HFE) gene are present in approximately 70% of patients diagnosed with hereditary hemochromatosis. This form of hereditary hemochromatosis disproportionately affects males, although females can also be affected. Type 2 hereditary hemochromatosis is frequently called juvenile hemochromatosis, as symptoms begin in childhood, and the disease is typically more clinically severe. Unlike type I hereditary hemochromatosis, this form shows no sex preference. Type 2 hereditary hemochromatosis has 2 subtypes: 2a and 2b. Type 2a hereditary hemochromatosis is caused by mutations in the gene initially known as hemojuvelin (HJV) and is now referred to as HFE2. Type 2b hereditary hemochromatosis is due to hepcidin antimicrobial peptide (HAMP) gene mutations. Type 3 hereditary hemochromatosis typically has an onset at approximately 30 years of age and is caused by mutations in the transferrin receptor 2 (TFR2) gene. Type 4 hereditary hemochromatosis, also known as ferroportin disease, is caused by mutations in the ferroportin/solute carrier family 40 member 1 (SLC40A1) gene. Ferroportin is an iron transmembrane transport protein, and Type 4 hereditary hemochromatosis is the only known form of hemochromatosis that can be inherited in an autosomal dominant fashion. The onset of type 4 hereditary hemochromatosis typically occurs in mid-adulthood.

Also flagged:PDneurodegenerative disorderParkinson DiseaseMovement Disorderatypical parkinsonismparkinsonism
Journal Article 2026-05-22 No Snippets Chu YT, Su YA, Lin CH, Tai CH, Wu YR, Hong CT, Chen YW, Tsai MH, Hardy J, Mok KY, Wu RM, East Asian Parkinson Disease Genomics Consortium, Global Parkinson’s Genetics Program.
Show Full Abstract

Genetic risk factors for Parkinson's disease (PD) remain under-characterized in East Asian populations. We assembled a Taiwanese case-control cohort (2245 PD; 2147 controls), genotyped participants using the Illumina NeuroBooster Array, and imputed 7.6 million variants with the Taiwan Biobank reference panel. Logistic-regression GWAS identified genome-wide significant associations at SNCA and MCCC1, with the lead SNCA signal located in intron 4; conditional and joint analyses suggested an additional 5' SNCA component. We observed suggestive associations at GCH1, PPARGC1A, and GALNT13. Locus-focused haplotype analyses refined the SNCA signal, delineating an East Asian-enriched risk haplotype, and confirmed risk effects of LRRK2 p.G2385R and p.R1628P, including evidence consistent with a gene-dosage effect. A European-derived PRS showed modest discrimination in our cohort (AUC 0.59), while incorporating East Asian and Taiwan-relevant variants improved performance (AUC 0.62). Together, these results define the genetic architecture of PD in Taiwan, highlight shared and population-enriched risk components, and support ancestry-aware PRS construction for improved risk stratification.

SERPINC1
Also flagged:traumatic brain injuryPTSDposttraumatic stress
Journal Article 2026-05-22 ✓ 1 Snippet Vose AK, Bryant VE, Hannan J, Bian J, Dai H, Sorna M, Bautista R, Silliman S.
In-Text Gene Mentions

…(41%, Cohen's d=1.11);ACE-IIIscores improved by…

Show Full Abstract

<h4>Objective</h4>The authors evaluated changes associated with a 3-week interdisciplinary intensive outpatient program that delivers integrated neuropsychiatric rehabilitation for veterans and first responders with persistent postconcussive and co-occurring symptoms after remote traumatic brain injury.<h4>Methods</h4>In this retrospective cohort study, 128 patients completed patient-reported measures, including the Neurobehavioral Symptom Inventory (NSI), PTSD Checklist for DSM-5 (PCL-5), and Life Satisfaction Questionnaire-11 (LiSat-11), and objective assessments, comprising Addenbrooke's Cognitive Examination-III (ACE-III), gait speed, computerized dynamic posturography (for conducting the Sensory Organization Test [SOT]), and Modified Clinical Test of Sensory Interaction in Balance (mCTSIB). Paired t tests were used to compare intake with discharge measures, and a linear mixed-effects model was used to examine NSI scores over time with covariate adjustment.<h4>Results</h4>The NSI total score decreased by 15.6 points (41%, Cohen's d=1.11); ACE-III scores improved by 6.8 points (Cohen's d=1.41); and forward and backward gait speeds, SOT composite scores, and mCTSIB condition 4 scores showed significant improvements (Cohen's d=0.68-0.87). The proportion of patients screening at or above a common PTSD threshold on the PCL-5 declined from 51% at intake to 20% at discharge, and higher baseline PCL-5 scores were associated with higher NSI scores across time points (p<0.001).<h4>Conclusions</h4>These findings are consistent with multidomain benefits of intensive, interdisciplinary neuropsychiatric rehabilitation in this population. These results support the potential of integrated care models to reduce symptom burden and improve cognitive, mobility, vestibular, and life satisfaction outcomes over 3 weeks, while underscoring the close linkage between posttraumatic stress severity and neurobehavioral symptom burden.

Also flagged:pathogenesisskeletal disorderosteoclast proliferationosteoporosisosteoarthritisrheumatoid arthritis
Journal Article 2026-05-22 No Snippets Xie X, Li C, Zheng H, Gan G, Gao X.
Show Full Abstract

N6‑methyladenosine (m<sup>6</sup>A) modifications are key epigenetic regulatory mechanisms in mammals and serve key roles in both normal skeletal development and the pathogenesis of skeletal disorder. The dynamic and reversible regulation of m<sup>6</sup>A relies on three core factors: Methyltransferases (writers), demethylases (erasers) and m<sup>6</sup>A‑binding proteins (readers), which collectively ensure proper physiological functions. Despite this, the functions and regulatory mechanisms of numerous m<sup>6</sup>A‑associated factors in skeletal diseases remain insufficiently understood. m6A modification maintains bone homeostasis during skeletal development primarily by regulating the balance between osteoblasts and osteoclasts. Under pathological conditions, dysregulated m<sup>6</sup>A modification contributes to aberrant osteoclast proliferation and chondrocyte apoptosis, leading to bone loss and cartilage degeneration. These pathological changes are key contributors to common types of skeletal disorder, including osteoporosis, osteoarthritis, rheumatoid arthritis and intervertebral disc degeneration, imposing a burden on human health. Non‑coding RNAs are major targets of m<sup>6</sup>A modification and their interactions exert post‑transcriptional regulation in skeletal biology. The present review summarizes the roles and mechanisms of m<sup>6</sup>A modification in skeletal diseases and highlights its therapeutic potential, offering novel perspectives for disease prevention and treatment.

Also flagged:cancersmetabolismbiosynthesissynthesislysosometumor
Journal Article 2026-05-22 No Snippets Loughran RM, Arora GK, Sun J, Llorente A, Crabtree S, Zhang CY, Ly K, Huynh RL, Cho W, Emerling BM.
Show Full Abstract

In p53-deficient cancers, targeting cholesterol metabolism has emerged as a promising therapeutic approach, given that p53 loss dysregulates sterol regulatory element-binding protein 2 pathways, thereby enhancing cholesterol biosynthesis. While cholesterol synthesis inhibitors such as statins have shown initial success, their efficacy is often compromised by the development of acquired resistance. Consequently, strategies are being explored to disrupt cholesterol homeostasis more comprehensively by inhibiting its synthesis and intracellular transport. In this study, we investigate a previously underexplored function of PI5P4Ks, which catalyzes the conversion of PI(5)P to PI(4,5)P<sub>2</sub> at intracellular membranes. Our findings reveal that PI5P4Ks play a key role in facilitating lysosomal cholesterol transport, regulating lysosome positioning, and sustaining growth signaling via the mechanistic target of rapamycin (mTOR) pathway. While PI5P4Ks have previously been implicated in mTOR signaling and tumor proliferation in p53-deficient contexts, this work elucidates an upstream mechanism that unifies these earlier observations.

CCPG1
Also flagged:Chronic hepatitis Bcirrhosisimmune responseenvelopevirionvirions
Journal Article 2026-05-22 ✓ 1 Snippet Cao H, Krueger E, Chen J, Yang H, Chia JJ, Beran RK, Tam J, Kornyeyev D, Holdorf MM, McNiven MA.
In-Text Gene Mentions

…non-canonical cargo receptorCCPG1; 35 and testis-expressed…

Show Full Abstract

Chronic hepatitis B (CHB), a major global public health burden, is characterized by the presence of high circulating levels of non-infectious subviral particles (SVPs). These SVPs are mainly composed of small hepatitis B surface antigen (SHBs) and are associated with a dysfunctional HBV-specific immune response. Previous studies exploring the cellular mechanisms and molecular pathways by which SVPs are secreted from hepatocytes have utilized either non-hepatic cells or whole-genome HBV-integrated hepatoma cell lines in which SHBs can also be secreted as a component of the virion envelope. In this study, we provide a detailed examination of SHBs trafficking using biochemical approaches coupled with high-resolution confocal microscopy and live-cell imaging via a novel fluorophore-tagged SHBs probe in both HepG2 and primary human hepatocytes stably expressing SHBs. Our results provide evidence that SHBs utilize a modified ER-Golgi secretory pathway with transit from the ER to the multivesicular body and lysosomal/late endosomal compartments. Importantly, we identified the autophagy adapters ATG5 and LC3B, and the ER-phagy protein atlastin 3 (ATL3), central to mediating SHBs secretion. These findings suggest that SHBs is trafficked through a non-canonical path for secretion and provides new potential therapeutic targets for the treatment of CHB.

Also flagged:Parkinson's diseasesynthesisneuroblastomahepatocellular carcinomasquamous cell carcinoma
Journal Article 2026-05-22 No Snippets Machado CS, Moreira J, Silva I, Alfenim AR, de Monte Vidal V, Díaz-Tomé V, Otero Espinar FJ, Pinto M, Fernandes C.
Show Full Abstract

Entacapone is a catechol-O-methyltransferase (COMT) inhibitor, widely used for the symptomatic treatment of Parkinson's disease. However, it presents setbacks associated with a short half-life and a poor blood-brain barrier permeability. In order to surpass these limitations, entacapone was encapsulated in lipid-polymer hybrid nanoparticles (LPHNPs) functionalized with vitamin E (TPGS), using different liquid lipids as olive oil and coconut oil, and the co-surfactant and penetration enhancer Transcutol® HP. Depending on the system chosen, the nanoformulations presented differences in the hydrodynamic sizes (D<sub>DLS</sub>) after synthesis, and an increasing particle size in the following order: Transcutol® HP< olive oil < coconut oil. The nanoformulations presented interaction with mucins and serum proteins, which anticipates a good permeability for oral and intranasal administration. No cytotoxic effects were observed in human neuroblastoma (SH-SY5Y), human hepatocellular carcinoma (HepG2), or squamous cell carcinoma (RPMI 2650) cell lines for concentrations below 10 µM. Furthermore, olive oil and Transcutol® HP nanoformulations maintained the COMT inhibition effect in HepG2 cells and presented antioxidant and iron chelation properties in SH-SY5Y cells. An increase in entacapone permeability was observed for Transcutol® HP nanoformulations using in vitro RPMI cells. In vivo study using Caenorhabditis elegans as a model demonstrated survival percentages > 80% after acute exposure to the nanoformulations in concentrations up to 40 μM in both wild-type (N2) and parkinson's disease model (WLZ3) strain, and antioxidant activity for HTT@Ent (40 μM) formulation in wlz3 strain. Overall, this work shows that the encapsulation of entacapone could be an interesting alternative in solving the drug performance by improving its physicochemical properties and permeability.

Also flagged:AMLmethylationhistonegene expressionDNMT3ATET2
Journal Article 2026-05-22 No Snippets Salah AN, Mansour RM, El-Sayyad GS, Moustafa HAM, Sayed GA, Mohamed HH, Elshami NH, AlFarsi K, Fahim A, Mohammed OA, Rudayni HA, Doghish AS.
Show Full Abstract

Pediatric acute myeloid leukemia (AML) is a heterogeneous hematologic malignancy that accounts for about 15%-20% of childhood leukemias. Despite therapeutic advances, relapses remain common, and survival for high-risk patients is below 60%. Unlike adult AML, pediatric AML displays distinct genetic mutations, including FLT3-ITD, NPM1, KMT2A rearrangements, and core-binding factors (CBF) fusions, as well as extensive epigenetic dysregulation. Aberrant DNA methylation, histone modifications, and altered non-coding RNA expressions disrupt hematopoietic differentiation and activate oncogenic transcriptional networks. Recent advances in silico transcriptomic analysis have transformed the study of pediatric AML by integrating gene expression and epigenetic data to identify molecular drivers and regulatory networks. Computational RNA-seq pipelines and pathway analyses have highlighted key epigenetic regulators, including DNMT3A, TET2, and HDACs, as potential therapeutic targets. Multi-omics approaches combining transcriptomic, methylomic, and chromatin accessibility data are increasingly used to define biomarkers for diagnosis, prognosis, and therapeutic response. This review provides a comprehensive overview of the molecular and epigenetic landscape of pediatric AML, emphasizing the power of in silico transcriptome analysis to uncover disease mechanisms, refine patient stratification, and guide the development of precision-based epigenetic therapies aimed at improving long-term outcomes in children with AML.

BTN2A1
Also flagged:Cancertumorantigen presentationgraft versus host diseaseGvHDsolid cancers
Journal Article 2026-05-22 ✓ 3 Snippets Fisher J, Wu Y, Abate-Daga D, Barisa M, Lamb L.
In-Text Gene Mentions

…mimic the physiologicalBTN2A1–BTN3A1 ligand complex for…

…TCR, a heterodimericBTN2A1/BTN3A1-Fc–CD19 scFv fusion pr…

…ngagement requires coordinatedBTN2A1-BTN3A1 organisation as well…

Show Full Abstract

γδT cells comprise 1-10% of circulating T cells, are further enriched in barrier tissues such as the gut and skin, and also form a critical component of lymphoid stress surveillance. γδ T cells have been gaining prominence as an alternative to αβ T cells for cancer immunotherapy. Such popularity may be attributed to multiple factors including the MHC-independent nature of γδ T activation, which differentiates them from αβ T cells and underlies their lack of alloreactivity. In this Review, we describe efforts to optimize the potential of γδ T cells as a cancer immunotherapeutic. We discuss the impact of disease burden on efficacy and the contexts in which unmodified γδ T cells have succeeded or failed to yield durable responses. Finally, we explore options for enhancing γδ T cell efficacy including combinations with other treatments and engineering strategies to capitalize on their potency.

HTT
Also flagged:PIDdegradation
Journal Article 2026-05-22 ✓ 1 Snippet Fan Y, Ning L, Wu X, Yan Y, Su C, Wang P, Cao Y.
In-Text Gene Mentions

…The role ofHTT

Show Full Abstract

Parafoil systems are increasingly deployed in military and civilian missions that require high-precision trajectory tracking. However, conventional controllers based on linear strategies and limited decision information often fail to cope with task complexity, and existing reinforcement learning studies rarely consider the systematic construction of training task sets, thereby limiting generalization. To address these issues, this paper proposes a Benchmark Task Set Generation (BTSG) algorithm that builds high-quality task sets with diverse and balanced complexity for robust controller training and comprehensive evaluation, formulates the trajectory tracking problem as a Markov decision process with a 46-dimensional observation space and a dense reward structure to enrich decision-support information and improve learning efficiency, and develops a BTSG-SAC framework that integrates BTSG with Soft Actor-Critic (SAC) for controller training. Simulation results show that BTSG-SAC markedly outperforms PID and PPO controllers on the generated benchmark task set, reducing distance deviation by 50.7% and 33.2% under noise-free conditions; under sensor noise, BTSG-SAC attains a 98% success rate, whereas PPO reaches 77% and PID fails to achieve successful tracking. Overall, this paper extends the application of reinforcement learning to parafoil control and offers generalizable methodologies for future autonomous control research.

SERPINC1
Also flagged:liver failurethrombocytopeniahyperbilirubinemialiver tumorsliver cancercoagulation
Journal Article 2026-05-22 ✓ 5 Snippets Jo HS, Yu S, Jeon SM, Choi YJ, Yu YD, Kim DS.
In-Text Gene Mentions

…serum antithrombin III (ATIII) activity, measured preoperat…

ATIIIactivity was evaluated…

…RawATIIIactivity was significantly…

…The POD 3ATIIIdecrease was significantly…

…logistic regression identifiedATIIIchange from baseline…

Show Full Abstract

Post-hepatectomy liver failure (PHLF) remains a serious complication following liver resection, yet early prediction is an unmet clinical need. This prospective study enrolled 151 patients at elevated risk of PHLF (major hepatectomy, thrombocytopenia, or hyperbilirubinemia) and evaluated serum antithrombin III (ATIII) activity, measured preoperatively and on postoperative days (PODs) 1, 2, 3, and 5, as an early predictive marker. PHLF, diagnosed according to the International Study Group of Liver Surgery criteria, occurred in 35 patients (23.2%). ATIII activity was evaluated as raw values and as the percentage change from the preoperative baseline. Raw ATIII activity was significantly lower in the PHLF group at all time points (P < 0.001). The POD 3 ATIII decrease was significantly greater in the PHLF group (36% vs. 29%, P = 0.041). Multivariable logistic regression identified ATIII change from baseline ≥ 30% at POD 3 (odds ratio 3.04, P = 0.021), ALBI grade B (OR 2.77, P = 0.031), and ICG R-15 ≥ 15% (OR 3.50, P = 0.034) as independent risk factors for PHLF. The multivariable model demonstrated acceptable discriminative performance (apparent AUC 0.750; bootstrap-corrected AUC 0.730). These findings suggest that early postoperative decline in ATIII activity could serve as an early biomarker for identifying patients at increased risk of PHLF, potentially enabling timely intervention.

Also flagged:chromatincancerslung adenocarcinomasmall cell carcinoma of the ovarytumorsnucleosome remodeling
Journal Article 2026-05-22 No Snippets Takeuchi M, Okimoto Y, Fukushima M, Hirano H, Ogiwara H.
Show Full Abstract

SWI/SNF-deficient cancers characterized by dual SMARCA4/SMARCA2 loss, including subsets of lung adenocarcinoma and small cell carcinoma of the ovary, hypercalcemic type, represent a major therapeutic challenge. While SMARCA2 paralog-targeting strategies exist for single-subunit loss of SMARCA4, dual SMARCA4/SMARCA2-deficient tumors lack actionable targets. Here, we identify the CHD3/NuRD nucleosome remodeling complex as a critical synthetic lethal vulnerability in these malignancies. Through integrated genomic analyses, we demonstrate that in the absence of SWI/SNF, CHD3 acts as an essential "epigenetic brake" specifically at the enhancer of the cell polarity regulator PARD3B. Loss of CHD3 triggers aberrant chromatin hyper-accessibility and toxic derepression of PARD3B. We further elucidate that PARD3B accumulation is a critical mediator of cell death, which is strongly associated with the attenuation of MYC signaling signatures. This attenuation likely arises from the spatial perturbation of upstream signaling hubs or secondary cellular responses, reducing MYC transcriptional output without degrading the protein itself. Therapeutically, CHD3 depletion led to robust tumor regression in dual SMARCA4/SMARCA2-deficient xenografts, validating the in vivo mechanism of PARD3B upregulation. Collectively, our study defines a novel mode of synthetic lethality driven by "gain-of-toxicity" rather than the loss of survival signals, uncovering a fatal cross-complex dependency. We propose that targeting CHD3 to trigger toxic PARD3B derepression offers a promising therapeutic avenue for treatment-refractory dual SMARCA4/SMARCA2-deficient cancers.

TNFSF4
Also flagged:metabolismtumorclear cell renal cell carcinomagene expressiontumorsccRCC
Journal Article 2026-05-22 ✓ 1 Snippet Fu Y, Liu X, Sun Q, Tang Z, Xu Z, Liu K.
In-Text Gene Mentions

…ENTPD1, TLR4 andTNFSF4were immune stimulating…

Show Full Abstract

<h4>Objectives</h4>To assess the potential role of glutamine metabolism-related genes (GMRGs) in the progression, prognosis, and immune microenvironment of clear cell renal cell carcinoma (ccRCC).<h4>Methods</h4>Publicly available single-cell RNA sequencing dataset was obtained, and differential gene expression analysis across tumors were performed. A cross scale disease driver gene validation chain and spatial transcriptome analysis with glutamine metabolism was further analyzed. 17 gene sets (M10295) correlated with glutamine metabolism were derived. The prognostic model of ccRCC constructed according to the differentially expressed GMRGs (DEGMRGs). GO and KEGG data were applied and the "GSVA" R package was used to analyze the characteristics of immune cells infiltration. In vitro validation study was performed in various RCC cell lines. Two shRNA plasmids were independently transfected into cells and examined by Transwell migration assay, proliferation assays and colony information tests. Glutamine levels and its related metabolism genes were also detected.<h4>Results</h4>ALDH18A1 may serve as a tumor-specific glutamine metabolic marker in epithelial-derived malignancies, and spatial transcriptome analysis reveals enhanced glutamine metabolic activity in the tumor boundary region. The DEGMRGs-based prognostic model tailored for ccRCC delineated a stark contrast in the prognosis of high-risk group and low-risk group. Patients exhibiting high ALDH18A1 TPM demonstrating poorer prognosis compared to those with low levels. The in vitro study validated the high expression of ALDH18A1 in RCC cell lines. ALDH18A1 could significantly inhibit the proliferation and migration of RCC cells, suppress the glutamine metabolism in RCC cells. Additionally, subcutaneous tumor experiments in mice further confirmed the oncogenic-promoting effects of ALDH18A1 on RCC with the crosstalk of M2 macrophages.<h4>Conclusions</h4>ALDH18A1 could serve as a crucial role in precise classification, treatment response, and prognosis of patients with ccRCC by suppressing the proliferation and glutamine metabolisms in tumor cells and constructing tumor microenvironment.

Also flagged:type 2 diabetesgestational diabetes mellitusprimary open angle glaucomainsulin resistancegene expressionatherosclerosis
Journal Article 2026-05-22 No Snippets Zhou S, Ran Z, Li Y, He J, Yuan X, Hu Y, Wang X, Li R, Xu Y, Yan C, Xiong J, Cheng G.
Show Full Abstract

<h4>Background</h4>The etiology of gestational diabetes mellitus (GDM) is constituted by both type 2 diabetes (T2D)-dependent and T2D-independent mechanisms. However, existing studies have evaluated the impact of T2D-dependent loci only for GDM, which limits the power to assess to what extent genetic variants or biological pathways are specific to GDM.<h4>Methods</h4>We subtracted the genetic effects of a genome-wide association study (GWAS) data for T2D from a GWAS data for GDM to reveal loci linked with T2D-independent components of GDM using genomic structural equation model (SEM). In the discovery stage of GWAS-by-subtraction, we used GWAS summary statistics of GDM and T2D from the FinnGen study as input latent variables (16,802 GDM cases and 237,816 controls; 71,728 T2D cases and 369,007 controls). In the replication stage, we adopted the summary statistics from a previously reported GWAS for GDM and T2D as input (21,263 GDM cases and 301,918 controls; 50,409 T2D cases and 523,897 controls). We functionally annotated variants with genome-wide significance, and performed comprehensive analyses including transcriptome-wide and proteome-wide associations, summary-data-based mendelian randomization, linkage disequilibrium score regression, and Mendelian randomization, to explore genetic patterns for T2D-dependent and -independent components of GDM.<h4>Results</h4>We found 69 independent genome-wide significant loci associated with the T2D-independent components of GDM for discovery stage, of which 49 SNPs are not significant in the GWAS for GDM used as input. T2D-independent components of GDM showed only genetic correlation with birth weight dependent on maternal genetic effect (rg = 0.19; P = 0.01), whilst T2D-dependent components of GDM showed genetic correlation with birth weight dependent on fetal genetic effect (rg = -0.22; P = 4.76 × 10<sup>- 7</sup>). Loci of T2D-independent components of GDM effects map to genes related to islets of Langerhans, neural stem cells, blood levels of mannose, abundance of Streptococcus thermophilus and Bacteroides vulgatus, glucose and carbohydrate homeostasis, and the MAPK cascade and adenylate cyclase-activating G protein-coupled receptor signaling pathway.<h4>Conclusions</h4>We identified independent genetic components, loci and genes of GDM that may have been previously masked by T2D, providing more accurate targets for early detection and management of GDM.

OLFM4
Also flagged:Brain-Heart Syndromecardiac insufficiencymyocardial dysfunctioncentral nervous system diseasesstrokedeath
Journal Article 2026-05-22 ✓ 1 Snippet Dong H, Gong X, Zhao Z, Joyama Y, Ji X, Qu P.
In-Text Gene Mentions

…such as BPI,OLFM4, and CD69 (…

Show Full Abstract

<h4>Purpose</h4>A history of coronary heart disease (CHD) increases the risk of Brain-Heart Syndrome (BHS) after acute stroke, partly through heightened inflammatory responses. Evolocumab, a PCSK9 inhibitor, has anti-inflammatory properties, but its transcriptomic effects in BHS patients with CHD remain unclear. This study aims to identify evolocumab-associated transcriptomic changes and inflammation-related biomarkers in this population.<h4>Patients and methods</h4>Blood samples from 24 BHS patients with CHD history (12 receiving rosuvastatin alone, 12 receiving rosuvastatin plus evolocumab) underwent transcriptomic sequencing. Candidate biomarkers were identified via differential expression and machine learning, with functional enrichment and immune infiltration analyses conducted.<h4>Results</h4>Four candidate biomarkers were identified: <i>WHRN (DFNB31)</i>, <i>IL12A</i>, and <i>ASB14</i> were upregulated, while <i>TMED7-TICAM2</i> was downregulated in the evolocumab combination group. These genes were enriched in pathways related to cell metabolism, signal transduction, and immune regulation. Immune infiltration analysis showed modest but detectable changes in B-cell subsets. External validation confirmed differential expression of these candidate biomarkers in CAD patients.<h4>Conclusion</h4>This pilot study provides preliminary insights into the molecular mechanisms of evolocumab in treating Brain-Heart Syndrome with a coronary heart disease history, identifying four inflammation-related biomarkers. These findings suggest potential targets for future investigation; however, given the exploratory nature and small sample size, further experimental and clinical validation is required before any therapeutic application.

BTN3A3
Also flagged:Generalized Pustular Psoriasispsoriasisplaque psoriasisvon Zumbusch psoriasispustuleschronic plaque psoriasis
Journal Article 2026-05-22 ✓ 1 Snippet Deng S, Jiang Y, Li W, Shu Z, Chen T, Liang J, Zhang X.
In-Text Gene Mentions

…AP1S3, MPO, SERPINA3,BTN3A3, and MEFV identified…

Show Full Abstract

Generalized pustular psoriasis (GPP) is a severe and potentially life-threatening form of psoriasis. Although spesolimab, an inhibitor of the interleukin (IL)-36 pathway, has been approved for the treatment of GPP, access to this agent remains limited. Vunakizumab, a humanized IgG1/κ monoclonal antibody that selectively neutralizes interleukin (IL)-17A inhibitors, is not yet approved for GPP. We herein report a 72-year-old male with a 40-year history of plaque psoriasis who developed GPP refractory to methotrexate combined with guselkumab and acitretin (20 mg/day). Following switching to vunakizumab (240 mg intravenously every 2 weeks) in combination with acitretin (40 mg/day), the patient achieved a GPPASI 75 response within 2 weeks and near-complete clearance (GPPASI ≈ 100) by week 12. Six induction doses of vunakizumab were administered, and acitretin was tapered to 20 mg/day for long-term maintenance. Throughout 36 weeks of follow-up, no disease relapse or drug-related adverse events were observed. This case, together with a review of the literature, provides support for IL-17A blockade combined with acitretin as a feasible and fast-acting regimen for refractory GPP in elderly patients.

TNFSF4
Also flagged:cancercancerstranslationalmicrotubulespindlebinding
Journal Article 2026-05-22 ✓ 1 Snippet Liu Y, Liu K, Ding Y, Li X, Shi X, Zhang J, Zhang X, Peng W, Deng J, Chen J.
In-Text Gene Mentions

…TNFSF/TNFRSF family (TNFSF4/18 , TNFRSF4/9/18 )…

Show Full Abstract

<h4>Background</h4>The HAUS family proteins (HAUS1-HAUS8) are essential for mitotic spindle microtubule nucleation. Although HAUS dysregulation has been linked to tumor progression, whether these oncogenic functions are conserved or tissue-specific remains unclear. Therefore, a pan-cancer analysis is needed to identify universal HAUS drivers and context-dependent members for precision oncology.<h4>Methods</h4>We systematically evaluated the expression and prognostic significance of all eight HAUS genes across 33 cancer types using TCGA data. Focusing on liver hepatocellular carcinoma (LIHC), we identified molecular subtypes based on HAUS co-expression patterns and characterized their associations with clinicopathological features, the tumor microenvironment (TME), immune checkpoint expression, and therapeutic response. A HAUS-related prognostic signature was developed using LASSO and Cox regression analyses and validated in independent ICGC cohorts. Regulatory relationships among HAUS members and key signature genes were experimentally validated using immunohistochemistry and Western blotting.<h4>Results</h4>Most HAUS members were overexpressed across multiple cancers and correlated with poor clinical outcomes. In LIHC, two HAUS-based subtypes differed significantly in survival, clinicopathological profiles, immune features, mutational burden, stemness indices, and predicted therapeutic response. A prognostic signature comprising DTYMK and SPP1 effectively stratified LIHC patients into distinct risk groups, with the high-risk group showing significantly worse survival. A nomogram integrating the HAUS-related risk score with clinicopathological variables demonstrated strong predictive performance. Recombinant osteopontin induced HAUS1 and DTYMK expression in LIHC cell lines, supporting a functional SPP1-HAUS1/DTYMK axis.<h4>Conclusion</h4>This study establishes the broad oncogenic relevance of HAUS genes across cancers and demonstrates that a HAUS-based signature enables prognostic stratification in LIHC.

Also flagged:formationdeathdiscsepsispneumoniacell growth
Journal Article 2026-05-22 No Snippets Böke JS, Reuter C, Kielpinski M, Reichert A, Prinz I, Horner D, Prinz A, Bichler F, Aichinger R, Rettenbacher A, Bauer G, Bauer M, Pahlow S, Weber K, Henkel T.
Show Full Abstract

Digital droplet-based bioassays (ddAssays) have been applied in numerous fields, though many existing microfluidic platforms are tailored to specific assay classes and require complex workflows involving multiple processing steps. Here, we present a fully integrated microfluidic platform for generic digital bioassays that combines droplet generation and storage for on-chip incubation and optical readout on a single disposable device. This microfluidic platform enables the parallel execution of test and control experiments, each using more than 200 000 monodisperse droplets of 35 pL. CFD simulations of the step emulsification unit, together with experimental characterization, confirm the predicted device performance. The device is prepared by variothermal compression molding. A dual-layer photoresist strategy was used to create the master for replicating the channel systems with two different channel heights and step transitions between them. The core functionality and the applicability of various optical modalities for image-based readout are demonstrated by exemplary biochemical and microbial growth reporter assays. The platform is compatible with automated image-based analysis for high-throughput digital assay readout.

OLFM4
Also flagged:Gastric cancercancertumorstomach adenocarcinomaSTADregulation
Journal Article 2026-05-22 ✓ 1 Snippet Zhang A, Li Z, Jiang X, Li Y, Zhang M, Ding Y.
In-Text Gene Mentions

…stem cells (OLFM4).…

Show Full Abstract

Transcriptional regulators reflect cellular heterogeneity and are key for prognostic modeling. Given the poor prognosis of stomach adenocarcinoma (STAD), regulator-derived signatures are vital for risk stratification. Using multi-stage scRNA-seq data, we delineated the transcriptional regulatory landscape of STAD and identified <i>Helicobacter pylori</i>-associated epithelial heterogeneity in intestinal metaplasia. We then developed a 23-regulator machine learning-based STAD prognostic signature (SPS) from malignant epithelial cells to predict overall survival (OS). Patients with high-SPS exhibited significantly worse OS than patients with low-SPS (hazard ratio [HR] = 1.50, 95% CI: 1.09-2.09, log rank <i>p</i> = 7.11 × 10<sup>-3</sup>). Notably, SPS outperformed other established STAD prognosis models across various independent datasets and remained an independent prognostic factor after adjusting for clinical and pathologic factors. Moreover, integrating SPS with tumor stage and age showed superior accuracy to stage alone. Collectively, our study establishes a robust regulator-based prognostic signature, holding potential to facilitate precision prognostication in STAD.

ECI2
Also flagged:Atrial fibrillationAFstrokeheart failureanxietyobstructive sleep apnea
Journal Article 2026-05-22 ✓ 1 Snippet Zhang X, Du Y, Shi S, Liu Y, Ye Z, Chai R, Feng M, Li J, Zhang L, Song Q, Du B, Hu Y.
In-Text Gene Mentions

…ARL2BP, BOLA3, CD47,ECI2, FYTTD1, LRR1, RPS3,…

Show Full Abstract

<h4>Introduction</h4>Atrial fibrillation (AF) is the most common and clinically significant arrhythmia requiring treatment. Although an imbalance between the sympathetic and vagal branches of autonomic nervous system (ANS) is known to trigger and sustain AF, the underlying mechanisms remain incompletely understood. Furthermore, there are yet no clinically authorized antiarrhythmic drugs currently targeting the modulation of ANS.<h4>Methods</h4>Targeted LC-MS/MS profiling of plasma 39 neurotransmitters was conducted in a clinical cohort. To identify shared mechanisms, atrial transcriptomes and a sympathetic neuron activation dataset were integrated with DEGs, WGCNA, enrichment, immune infiltration, and machine-learning feature selection, and in silico docking was performed. For <i>in vivo</i> validation, an Ang II-infused mouse model with valsartan intervention was utilized, including transesophageal burst pacing, immunostaining, immunoblotting, and efferocytosis quantification.<h4>Results</h4>Plasma from AF patients exhibited an autonomic-imbalance signature (upregulated monoaminergic and downregulated cholinergic neurotransmitters). Shared ANS-AF bioinformatic analysis highlighted hub genes as CDKN2D, FYTTD1, LRR1, and POPDC3. Immune analyses pinpointed CD47-mediated efferocytosis as a crucial link. <i>In vivo</i>, Ang II induced autonomic remodeling, Ca²⁺-handling suppression, increased apoptosis with CD47/SIRPα upregulation, impaired efferocytosis, and heightened inflammatory signaling; valsartan partially reversed these changes.<h4>Discussion</h4>Multi-omics and <i>in vivo</i> evidence suggests an ANS-immune-atrial remodeling axis in which CD47-SIRPα-dependent efferocytosis blockade is highly associated with atrial inflammation and AF susceptibility, with valsartan acting as a clinically relevant modulator of this pathway.

Also flagged:leukaemiachromosomehaemoglobinopathiesHaematologicalblood cancerhaemolytic anaemias
Journal Article 2026-05-22 No Snippets Blann AD, Dunn RG.
Show Full Abstract

In almost all aspects of biomedical science, molecular pathology has brought unprecedented value in the diagnosis and management of human disease. Numerous commentators cite haematological disease as the leading genetic cause of global mortality and morbidity, and of these, those of the red blood cells are the most frequent. This narrative review, with a historical perspective, will discuss the role of genetics in these conditions, the leading pathology of red blood cells being the haemoglobinopathies, principally sickle cell disease and thalassaemia, with their many variants, and with potential roles for non-coding RNAs. The impact of genetics into conditions of the red cell cytoplasm will consider the enzymopathies, led by glucose-6-phosphate dehydrogenase deficiency, and extend to those of the cell membrane, causing disease such as hereditary elliptocytosis. Mutations in genes coding almost all the coagulation factors, and several platelet abnormalities, are discussed, as are those linked to conditions of iron overload. Previous, current and evolving technologies for diagnostic testing and their link with potential targeted therapeutic options for patient management are considered.

ARFGEF2
Also flagged:Golgivesicleautosomal recessive periventricular nodular heterotopia with microcephalyARPHMWest syndromeperiventricular nodular heterotopia
Journal Article 2026-05-22 ✓ 5 Snippets Liu X, Pang L, Li J, Zhang J, Wu W, Li X, Gong Y, Dou Y, Chen F, Sun S.
In-Text Gene Mentions

…A novel homozygousARFGEF2splice-site variant causing…

…Background TheARFGEF2gene encodes the…

…mutations in theARFGEF2gene are associated…

…variant in theARFGEF2gene.…

…impact of theARFGEF2gene splicing variant.…

Show Full Abstract

<h4>Background</h4>The <i>ARFGEF2</i> gene encodes the brefeldin A (BFA)-inhibited GEF2 protein (BIG2), which is distributed in the trans-Golgi network and plays a crucial role in neuronal proliferation and migration during cortical development through its regulation of vesicle transport. Pathogenic mutations in the <i>ARFGEF2</i> gene are associated with autosomal recessive periventricular nodular heterotopia with microcephaly (ARPHM). To date, only slightly more than 20 cases have been reported worldwide. Herein, we presented a case of a patient with West syndrome who was ultimately diagnosed with ARPHM caused by a homozygous variant in the <i>ARFGEF2</i> gene.<h4>Methods</h4>To identify disease-causing mutations, we performed exome sequencing (ES) of a child with West syndrome, and subsequently employed a minigene splicing assay to evaluate the functional impact of the <i>ARFGEF2</i> gene splicing variant.<h4>Results</h4>The patient's clinical manifestations, examination results, treatment, and follow-up course were comprehensively documented. ES revealed a homozygous NM_006420.3: c.5181+1G>T variant in the <i>ARFGEF2</i> gene. Subsequent functional analysis using a minigene splicing assay confirmed that this variant disrupts normal mRNA splicing, causing complete exon 38 skipping and a 118-bp deletion. The translation of this aberrant transcript is predicted to induce a frameshift, resulting in a truncated protein (p.Val1689SerfsTer20).<h4>Conclusion</h4>A novel pathogenic variant was identified by ES, and a minigene splicing assay established its disruptive impact on <i>ARFGEF2</i> mRNA splicing. This study expands the genetic spectrum of <i>ARFGEF2</i> and provides laboratory evidence for clinical diagnosis.

Also flagged:addictionneuropsychiatric disorderschizophrenianervous system disorderscancerphosphorylation
Journal Article 2026-05-22 No Snippets Hossain WA, Butler MG.
Show Full Abstract

<h4>Background</h4>Addiction is a chronic, relapsing neuropsychiatric disorder despite adverse consequences. Addiction involves neurobiological changes in the reward, motivation, and memory systems, particularly affecting the dopaminergic pathways due to a complex interaction between inherited traits and life experiences.<h4>Methods</h4>To explore the role of genes in addictive behavior, we compiled a list of 332 clinically relevant genes from literature sources and searched GeneAnalytics, STRING web-based programs, and integrated genetic and protein databases for interactions and molecular profiles of genes in tissues and cells, diseases, pathways, biological processes, cellular components, functions, phenotypes, and compounds.<h4>Results</h4>We identified 332 genes associated with addictive behavior and predominantly expressed in the brain associated with schizophrenia, nervous system disorders, and cancer. Nine of the top 10 related pathways showed GPCR protein interaction and signaling involving the <i>CREB1</i>, <i>MAPK1</i>, <i>MAPK3</i>, and <i>AKT1</i> genes. The <i>BDNF</i> gene was recognized in eight of the top 10 high-scoring phenotypes involving the neurotransmitters dopamine and glutamate. We chose to study <i>AKT1</i> as the most identified gene when searching web-based programs and integrated genetic and protein databases. This gene encodes protein kinases that are required for protein phosphorylation, fundamental for most cellular functions, stabilization, regulation of targeted proteins including cell cycle control and signal transduction, neuron formation, and neurological function including the hippocampus. We identified the important PI3/AKT/mTOR signaling pathway that integrates extracellular growth signals, promotes proliferation, and inhibits apoptosis, which is important for brain function. These genes also overlap with other genes associated with ATPase activity, metabolism, and chaperone protein functions that play a role in addiction. In addition, we identified 29 genes that are shared with alcoholism/alcohol use disorder and overlap with interactive molecular functions and processes between alcoholism and addiction.<h4>Conclusion</h4>Our study identified 332 addiction genes from literature sources and used <i>in silico</i> integrated genetic approaches with two searchable web-based programs to provide insights into the complex molecular and genetic architecture of addiction. We identified cell cycle control factors, extracellular growth, signal transduction, and metabolism. The pathways involved selective protein phosphorylation and transduction of proteins as well as neurotrophic factors with mechanisms impacting nervous system development, plasticity and function when disturbed, leading to addictive behavior. Several genes associated with addiction overlapped with those associated with alcohol use disorder.

HFE
Also flagged:Lactic Acidosiscirrhosishyperlactatemiadecompensated cirrhosisEnd‐Stage Liver Diseaseinfection
Journal Article 2026-05-22 ✓ 1 Snippet Ganju N, Nwachukwu CV, Santiago-Gonzalez J, Naeem S, Azinge N, Laiyemo AO.
In-Text Gene Mentions

…liver disease (e.g.,hemochromatosis, alpha‐1 antitrypsin deficien…

Show Full Abstract

Lactic acidosis is a strong predictor of mortality in cirrhosis, reflecting both impaired hepatic clearance and systemic tissue hypoxia. We describe a 38-year-old man with decompensated alcohol-associated cirrhosis who developed severe lactic acidosis despite stable hemodynamics and initially nondiagnostic vascular imaging. Repeat computed tomography demonstrated rectal wall thickening with mesenteric fat stranding, concerning for ischemic injury in the setting of a low-flow state. The patient subsequently experienced pulseless electrical activity arrest and died. This case highlights the prognostic significance of rising lactate in cirrhosis and underscores that severe hyperlactatemia should prompt urgent evaluation for occult hypoperfusion even when early imaging is nondiagnostic.

PRDX6
Also flagged:organellemitochondrialmetabolismmitochondriato cellular stresslocalisation
Journal Article 2026-05-22 ✓ 2 Snippets Li P, Zheng Y, Casas-Martinez JC, Xia Q, Miranda-Vizuete A, Goljanek-Whysall K, McDonagh B.
In-Text Gene Mentions

…conserved mammalian 1-CysPRDX6, has a number…

…Furthermore, loss ofPrdx6in mammalian models…

Show Full Abstract

Fasting induces conserved metabolic and redox adaptations that promote stress resistance and longevity. However, the molecular mechanisms linking transient redox changes and altered metabolism to downstream signalling events remain incompletely understood. Using Caenorhabditis elegans, the roles of peroxiredoxins in coordinating redox-dependent responses to fasting and refeeding were determined. A 4-hr fasting protocol over 5 days extended lifespan, improved late-life physiological activity, reduced age-related lipofuscin and lipid accumulation. The fasting protocol generated a transient increase in mitochondrial ROS, promoted mitochondrial turnover, and attenuated age-related mitochondrial fragmentation. These adaptive responses required the activation and nuclear localisation of the stress-responsive transcription factors DAF-16/FOXO and SKN-1/Nrf2. However, these adaptive responses were abolished in prdx-2 and prdx-6 mutant strains, which exhibited persistent redox imbalance, mitochondrial fragmentation, altered stress resistance, and disrupted DAF-16 and SKN-1 signalling. Mechanistically, loss of 2-Cys PRDX-2 impaired activation of the p38 MAPK PMK-1 pathway, resulting in defective SKN-1 activation. In contrast, loss of 1-Cys PRDX-6 disrupted lipid metabolic signalling, preventing induction of NHR-80 and downstream fatty acid desaturases required for metabolic adaptations. Despite distinct initial signalling pathways, both peroxiredoxins converged on the regulation of DAF-16 and SKN-1. Together, these findings identify PRDX-2 and PRDX-6 as redox sensors that translate a fasting-induced transient ROS signature into mitochondrial and lipid remodelling pathways to promote healthy ageing.

GPR52CCDC92
Also flagged:TumorMultiple Myelomamonoclonal gammopathy of undetermined significanceMGUSsmoldering MMimmunosuppression
Journal Article 2026-05-22 ✓ 2 Snippets Aquilina C, Romano A, Corsale AM, Biondo M, Speciale M, Tofacchi E, Di Simone M, Gigliotta E, Dieli C, Avellone C, Toscano A, Camarda L, Romano A, Cambria D, Giavaresi G, Raimondi L, Neri A, Campana S, Caccamo N, Dieli F, Siragusa S, Meraviglia S, Botta C.
In-Text Gene Mentions

…, GPR6 ,CCDC92, SLC2A4RG ,…

…, TXNRD1 ,GPR52, COX7B ,…

Show Full Abstract

Multiple myeloma (MM) develops through asymptomatic precursor stages characterized by progressive remodeling of the bone marrow (BM) immune microenvironment and disruption of bone homeostasis. To delineate changes in natural killer (NK) cell states during disease evolution, we investigated coordinated immune-tumor remodeling by integrating NK cell functional states with plasma cell-intrinsic susceptibility programs derived from CRISPR-based screens across healthy donors (HD), monoclonal gammopathy of undetermined significance (MGUS), smoldering MM (SMM), and newly diagnosed MM patients. The integration of NK cell state-associated gene signatures with plasma cell transcriptional programs revealed stage-specific co-variation between immune and tumor compartments. Public single-cell RNA sequencing datasets were interrogated to resolve NK cell heterogeneity, identifying cytotoxic CD56<sup>dim</sup> and regulatory CD56<sup>bright</sup> subsets. NK cell dynamics displayed stage-dependent changes, with early expansion followed by the contraction of CD56<sup>dim</sup> cells in BM, whereas CD56<sup>bright</sup> cells showed predominantly compositional remodeling. Within the CD56<sup>bright</sup> subset, transcriptional changes included an increased expression of <i>KLRC1</i> (encoding NKG2A), subsequently validated by multiparametric flow cytometry. In parallel, plasma cell programs associated with NK sensitivity progressively decreased along disease stages, supporting tumor adaptation to immune pressure. The NKG2A ligand HLA-E displayed selective expression within CD16<sup>+</sup> monocytes and followed a distinct variable pattern across disease stages, highlighting a microenvironmental contribution to NK cell regulation. Collectively, these findings indicate a coordinated process of immune-tumor co-evolution, characterized by dynamic remodeling of NK cell states and plasma cell susceptibility, with the NKG2A-HLA-E axis emerging as a central interface during MM progression.

Also flagged:biologyextracellulardegradationtumorcancertissue remodeling
Journal Article 2026-05-22 No Snippets Phan TNL, Truong TT, Vo TH, Pham VH, Nguyen TX, Duong TKN, Doan VHM, Choi J, Misra M, Oh J, Mondal S.
Show Full Abstract

Three-dimensional (3D) bioprinting has rapidly evolved into a controlling platform for the fabrication of patient-specific biomedical implants, with growing importance in advanced drug delivery systems. Beyond structural tissue engineering, bioprinted constructs now function as programmable therapeutic depots capable of localized, sustained, and stimuli-responsive drug release. This review focuses on recent biomaterial design strategies that enable precise control over drug encapsulation, retention, and release kinetics within 3D bioprinted architectures. The physicochemical and mechanical properties of bioinks, including crosslinking density, porosity, degradation behavior, viscoelasticity, and swelling characteristics, directly influence drug loading efficiency and release dynamics under physiological conditions. The rational tuning of these parameters allows the development of constructs that provide spatially controlled and temporally regulated therapeutic delivery. Recent advances in predictive modeling, such as finite element modeling (FEM), data-driven machine learning approaches, and ML, have significantly improved the ability to correlate material composition, printing parameters, and structural geometry with drug diffusion and degradation-mediated release mechanisms. These tools facilitate the optimization of printing variables including extrusion pressure, nozzle diameter, and layer resolution to ensure structural fidelity while maintaining therapeutic functionality. Emerging strategies incorporating multi-material printing, gradient architectures, and stimuli-responsive biomaterials have expanded the potential of 3D bioprinting for combination therapies and personalized medicine. This review discusses key challenges in translating bioprinted drug delivery systems into clinical applications, including the standardization of drug release characterization methods, and long-term stability assessment.

Also flagged:Atrial FibrillationAFheart failurebehavioralion channelcell communication
Journal Article 2026-05-22 No Snippets Wu J, Qin X, Xie S, Zheng L, Yu H, Wang H, Chen Y, Li T, Wu T, Chen D, Hu Y, Wu Y.
Show Full Abstract

<b>Background/Objectives</b>: Atrial fibrillation (AF) is a complex polygenic disorder; its genetic architecture remains challenging to fully elucidate. <b>Methods</b>: In this study, we leveraged the extensive genetic overlap between AF and a spectrum of cardiometabolic and behavioral factors-collectively defined by Life's Essential 8 (LE8)-to advance our understanding of its etiology. <b>Results</b>: We first estimated significant genetic correlations between AF and all LE8 components (r<sub>g</sub>: -0.11 to 0.19) using LD score regression. We then applied conditional false discovery rate analysis and detected 970 pleiotropic loci associated with AF and at least one LE8 trait. Subsequent colocalization analysis identified 179 loci harboring shared causal variants between AF and one or more LE8 components, which were further refined into 137 distinct colocalized regions. Through region-based annotation and functional predictors, we finally prioritized 164 candidate genes from these colocalized loci, including 40 novel genes. These candidate genes were enriched in pathways related to heart development and regulation of cardiac contraction, and were also enriched among molecular targets of otological agents. Among all LE8 components, blood pressure demonstrated the most extensive shared genetic architecture with AF, supported by the strongest genetic correlation, highest pleiotropic enrichment, and the greatest number of colocalized loci with AF. Polygenic risk scores constructed from these colocalized loci demonstrated significant associations not only for AF but also for arrhythmia and heart failure. <b>Conclusions</b>: Our findings establish a genetic pleiotropy-informed framework that enhances the discovery of novel risk loci of AF and advances our understanding of the shared genetic architecture and potential biological mechanisms between AF and LE8 components.

DCC
Also flagged:spinal cord injuryfibersaxonaxonsbehavioralaxonal
Journal Article 2026-05-22 ✓ 5 Snippets Hao X, Ning Y, Dong Y, Rattanasakon P, Yang Y, Liu K, Tian J, Mo Y, Shi S, Li Z.
In-Text Gene Mentions

…in colorectal cancer (DCC), ras-related C3 botulinum…

…levels of netrin-1,DCC, Rac1, and F-actin…

…and its receptorDCC, as well as…

…in colorectal cancer (DCC), and ras-related C3…

…to its receptorDCC, netrin-1 initiates an…

Show Full Abstract

<h4>Background</h4>The rupture and demyelination of nerve fibers after spinal cord injury (SCI) are primary contributors to neurological dysfunction. The axon attraction signal pathway mediated by netrin-1 is crucial for promoting the effective regeneration and repair of nerve axons. Previous studies have proved that electroacupuncture (EA) can improve nerve function and promote nerve repair and regeneration in rats with SCI, yet its underlying mechanism remains to be elucidated. This study aims to evaluate the effects of EA on neural repair and to investigate its regulatory role in the axon guidance signaling pathway, thereby clarifying the mechanisms by which EA promotes nerve repair following SCI.<h4>Methods</h4>Male Sprague Dawley rats were randomly assigned to the Normal group, Sham group, SCI group, and EA group, with each group further divided into subgroups based on intervention duration: 7, 14, and 28 days. Allen's method was employed to establish the SCI model. Dazhui (GV14) and Mingmen (GV4) acupoints were selected for EA intervention. Basso-Beattie-Bresnahan (BBB) score and the inclined plate test were used to evaluate the motor function of rats in each group. Morphological and structural changes in the injured spinal cord were assessed through magnetic resonance imaging (MRI). The fractional anisotropy (FA), radial diffusivity (RD), and mean diffusivity (MD) values in the injured area were measured via diffusion tensor imaging (DTI), and the morphological changes of nerve fiber bundles were analyzed via diffusion tensor tractography (DTT). The expressions of netrin-1, deleted in colorectal cancer (DCC), ras-related C3 botulinum toxin substrate 1 (Rac1) and F-actin were quantified using immunofluorescence (IF) staining, Western blot (WB) and real-time quantitative polymerase chain reaction (RT-PCR).<h4>Results</h4>Compared with the Sham group, the SCI group exhibited significant deficits in motor function (P<0.01), disorganized spinal cord tissue structure, a markedly increased lesion area (P<0.01), impaired integrity of nerve fiber bundles, a significant decrease in FA value (P<0.01), and significantly elevated MD and RD values (P<0.01). Moreover, the expression levels of netrin-1, DCC, Rac1, and F-actin were significantly reduced (P<0.01). EA improved the behavioral performance of rats with SCI (P<0.01). Following EA intervention, the extent of spinal cord structural damage was alleviated, with increased FA values, decreased MD and RD values (P<0.01), alongside evident repair and reconstruction of damaged fiber bundles. Additionally, EA upregulated the expression levels of netrin-1, DCC, Rac1, and F-actin (P<0.01).<h4>Conclusions</h4>EA can significantly improve the motor function of rats with SCI, regulate the nerve guidance factor netrin-1 and its receptor DCC, as well as the molecular switch Rac1, thereby promoting axonal cytoskeletal remodeling and facilitating neural repair. The nerve repair effect of EA may be achieved by regulating the axon attraction signal pathway mediated by netrin-1.

bioRxiv 2026-05-22 Preprint (No Snippets API) Korfmann K, Mathieson S.
Show Full Abstract

Identifying the genetic changes that shaped recent human adaptation depends on our ability to detect selection from genomic data. Summary statistics from haplotype scans have been widely used for that purpose, aggregating genetic signal over windows, though resolution is limited by linkage and their power may diminish as sweeps approach fixation, as in the case of the integrated haplotype score (iHS). Ancient DNA based scans recover signal by analysing time-series trajectories, but the majority of human populations fall outside the geographic range of any existing ancient DNA dataset. Pairwise coalescence times provide a way to complement statistics and can be applied to any modern cohort, yet computing them densely enough at cohort scale poses a computational challenge due to the quadratic growth in the number of haplotype pairs. We introduce gamma_smc_cu , a GPU implementation of the Gamma-SMC algorithm (Schweiger and Durbin, 2023) for pairwise time-to-the-most-recent-common-ancestor (TMRCA) inference. Applied to the 1000 Genomes Project (3,202 phased samples, corresponding to 6,404 haplotypes; 829,638 within-population pairs across 26 populations and five different continental ancestries; ∼10 12 per-site posterior evaluations), it yields a gene-level TMRCA landscape of 17,823 autosomal protein-coding genes after masking for segmental duplications. The scan recovers well-known sweeps ( LCT, SLC24A5, EDAR, FADS1, HERC2, ABCC11 ) and, combined with a depleted-to-enriched variant-class profile, resolves haplotype-block signals down to the gene level. Of seven case studies, two are developed in the main text — GRK2 / ADRBK1 (chr11q13.2; SAS+EUR) and TREML1 / TREM2 (chr6p21.1) — and the remaining five ( IFIH1 chr2q24/IBS, CCDC92 chr12q24/CDX, SLC6A15 chr12q21/CHS, BPIFA2 chr20q11/GIH, CLEC6A chr12p13/CDX) are presented in the Supplementary Information (SI). Notably, TREML1 / TREM2 is a shared out-of-Africa signal — ranked below the within-population 1% tail in 16 of 19 non-African 1000 Genomes panels that PopHumanScan and five landmark haplotype-based scans miss. A previous 10 kb-windowed-mean iHS scan dilutes the cluster of extreme sites packed inside the ∼5 kb gene bodies, while our own gene-level iHS independently recovers the locus in three South Asian panels (BEB, STU, ITU; top 0.4% genome-wide). We cross-validate the seven cases against the 9.7 million per-variant selection posteriors from a recent West-Eurasian ancient DNA scan. BPIFA2 is detected concordantly ( s ≈ 1.8% per generation). GRK2 and CCDC92 reach detection threshold in flanking variants but not within their own gene bodies, while the TREML1 / TREM2 cluster falls below it. To calibrate novelty, we review the candidate landscape against an expanded eight-catalog set spanning curated haplotype scans, the largest current West-Eurasian ancient-DNA leads, and a recent 26-population iHS refinement; the vast majority of our loci overlap at least one prior entry, and only a handful — including TREML1 / TREM2 — remain unflagged. The contributions of this work are gene-level resolution, systematic ancient DNA cross-validation, and a reusable TMRCA landscape that complements aDNA panels.

Also flagged:tumourcancerprotein synthesisribosomenon-small cell lung cancermetabolism
Journal Article 2026-05-21 No Snippets Pardo L, Moore M, Deshmukh R, Powley I, Waldron JA, Kruspig B, McGarry L, Dolma L, Campos AV, Wood C, Leslie H, Hughes M, Jeldes E, Munro J, Mitchell L, Officer-Jones L, Baird R, Coquelet H, Jamieson NB, Sumpton D, Strathdee D, le Quesne J, Bushell M, Murphy DJ, Norman JC.
Show Full Abstract

<h4>Background</h4>Although inhibitors of mRNA translation are being evaluated as anti-cancer agents, the dynamics of protein synthesis throughout tumour progression are still poorly understood. Here we assess how alterations in mRNA translation during early tumorigenesis affect tumour development in KRAS-driven lung adenocarcinoma (LuAd).<h4>Methods</h4>We deployed autochthonous mouse models of LuAd driven by oncogenic KRAS<sup>G12D</sup> combined with moderate overexpression of MYC and simultaneously manipulated mRNA translation by deleting the mRNA helicases eIF4A1 and eIF4A2 or by administering pharmacological inhibitors of protein synthesis, such as rapamycin. This permits synchronous assessment of LuAd initiation and progression in vivo and is amenable to parallel ex vivo culture of tumour-derived cells for detailed analysis of protein synthesis (using ribosome footprinting) and metabolic landscapes. These approaches also allowed us to perform multiplex imaging and spatial transcriptomics to characterise tumour formation in altered mRNA translation conditions and to compare results obtained in mice against the Lattice-A cohort of non-small cell lung cancer (NSCLC) patients.<h4>Results</h4>Deletion of the mRNA-translation repressor, eIF4A2 in KRAS-driven LuAd leads to a dysregulated protein synthesis landscape characterised by a strongly upregulated secretome, enlarged secretory compartments, increased oxidative metabolism and acquisition of senescence-like characteristics. Paradoxically, this overdriven secretory protein synthesis landscape delays tumorigenesis and leads to the appearance of clusters of non-proliferative, p21-positive KRAS<sup>G12D</sup>-expressing cells in the lung. Consistently, reduction of mRNA translation with rapamycin in Eif4a2-deleted tumours suppresses senescence and restores tumorigenesis. Importantly, some Eif4a2 knockout cells overcome senescence to form tumours that exhibit enhanced MAP-kinase signalling and, in contrast to eIF4A2<sup>+/+</sup> lesions, these were eradicated by administration of a MEK inhibitor. Consistently, MAP-kinase signalling was significantly increased in human NSCLC expressing low levels of eIF4A2.<h4>Conclusions</h4>Our study highlights that restraint of mRNA translation by eIF4A2 is critical in the early-stages of KRAS-driven LuAd to allow bypass of oncogene-induced senescence and tumour progression. Importantly, because tumours with dysregulated mRNA translation rely heavily on MAP-kinase signalling they are exquisitely sensitive to MEK inhibition, and this indicates the possibility that low expression of eIF4A2 could be used to identify potential responders to MEK inhibitors in clinical trials.

SERPINC1
Also flagged:mild cognitive impairmentdementiacognitive impairmentmild dementia
Journal Article 2026-05-21 ✓ 2 Snippets Barczak A.
In-Text Gene Mentions

…assessed using WSOP,ACE-III, and MMSE.…

…accuracy comparable toACE-III.…

Show Full Abstract

<h4>Aim of the study</h4>To evaluate the diagnostic accuracy of the Warsaw Cognitive Assessment Scale (Warszawska Skala Oceny Poznawczej, WSOP) for detecting mild cognitive impairment (MCI) and dementia, and to compare its performance with the Addenbrooke's Cognitive Examination III (ACE-III) and the Mini-Mental State Examination (MMSE).<h4>Clinical rationale for the study</h4>Early detection of cognitive impairment remains challenging in clinical practice. Existing screening tools are limited by administration time, sensitivity to early deficits, and reliance on auditory input. The WSOP was developed as a brief, multidomain screening instrument tailored to the Polish population, aiming to balance diagnostic accuracy with clinical efficiency.<h4>Material and methods</h4>A total of 370 participants (111 Controls, 138 with MCI, 121 with mild dementia) were assessed using WSOP, ACE-III, and MMSE. Group differences were analyzed using non-parametric tests, and convergent validity was evaluated with Spearman's correlations. Diagnostic accuracy was assessed using receiver operating characteristic (ROC) analysis, including area under the curve (AUC), sensitivity, specificity, and optimal cut-off values. Additional analyses controlled for age, education, and sex.<h4>Results</h4>WSOP demonstrated high diagnostic accuracy comparable to ACE-III. For distinguishing Controls from MCI, AUC values were 0.945 (WSOP) and 0.951 (ACE-III), both exceeding MMSE (0.80). For MCI versus dementia, AUC values were 0.943 and 0.964, respectively. The optimal WSOP cut-offs were 67.5 for MCI and 53.5 for dementia. Diagnostic performance remained stable after adjusting for demographic variables. WSOP scores showed moderate to strong correlations with ACE-III, providing initial evidence of convergent validity.<h4>Conclusions and clinical implications</h4>WSOP is a brief, reliable multidomain cognitive screening tool with diagnostic accuracy comparable to ACE-III. Its balance of comprehensiveness and efficiency supports its potential use in clinical screening settings, pending further validation in broader populations.

Also flagged:tumorantigen presentationcancersolid tumorsconjugationligand presentation
Journal Article 2026-05-21 No Snippets Dang BT, Pham KY, Le HTT, Nguyen TTK, Vu ATT, Giri A, Shrestha P, Kwon TK, Jeong JH, Yook S.
Show Full Abstract

The immunosuppressive tumor microenvironment, characterized by impaired antigen presentation, "don't eat me" signaling, and T-cell exhaustion, challenges effective cancer immunotherapy. Conventional T-cell-redirecting bispecific engagers (BiTEs) show limited efficacy in solid tumors because of poor T-cell infiltration, rapid clearance, and dose-limiting cytokine release associated with the CD3 agonism. Therefore, we aimed to enhance macrophage-mediated tumor clearance and T-cell priming by developing a bispecific macrophage nanoengager (nanoBIME) that integrates dual immune checkpoint blockade (anti-SIRPα and anti-PD-L1) with STING-agonist delivery (SR717) in a single poly(lactic-<i>co</i>-glycolic acid) nanocarrier (BIS-PLGA-NP@SR717). BIS-PLGA-NP@SR717 exhibited uniform nanoscale features, efficient SR717 encapsulation, and stable dual-antibody conjugation, enabling systemic delivery with sustained intracellular release. Dual-ligand presentation markedly enhanced receptor binding and nanoparticle uptake in macrophages and PD-L1-expressing tumor cells. BIS-PLGA-NP@SR717 synergistically promoted macrophage phagocytosis, repolarized tumor-associated macrophages toward an M1 phenotype, enhanced dendritic cell maturation, and CD8<sup>+</sup> T-cell activation; additionally, it elevated granzyme B, perforin, and IFN-γ production, resulting in robust T-cell-dependent tumor cell killing. In CT26 tumor-bearing mice, BIS-PLGA-NP@SR717 achieved superior tumor accumulation, deep intratumoral penetration, and dose-dependent tumor regression with minimal systemic toxicity. Transcriptomic profiling further revealed the coordinated activation of phagosome-related pathways, antigen presentation, STING/IFN pathways, chemokine signaling, and T-cell receptor engagement. Collectively, BIS-PLGA-NP@SR717 represents an integrated, multiaxis immunotherapeutic nanoplatform that synchronizes innate activation, macrophage remodeling, and T-cell effector functions. Its modular architecture provides a versatile framework for next-generation immunotherapies for solid tumors.

HTT
Also flagged:mitochondrialneurodegenerative diseasesneurodegenerative disorderHDMetabolismextracellular
Journal Article 2026-05-21 ✓ 5 Snippets Oliveira Â, Almeida LM, Oliveira JMA, Pinho BR.
In-Text Gene Mentions

…wild-type- (wt-) or mut-Httwith two MPC…

…Mut-Htt-expressing cells showed decre…

…In wt-Htt-expressing cells, MPC inhibit…

…In mut-Htt-expressing cells, MPC inhibit…

…levels and attenuated mut-Htt-induced eIF2α phosphorylation…

Show Full Abstract

Mitochondrial pyruvate carrier (MPC) inhibition was found protective in models of neurodegenerative diseases, such as Alzheimer's and Parkinson's. However, little is known about MPC as a potential therapeutic target in Huntington's disease (HD), a neurodegenerative disorder with dysregulation of the pro-survival pathway integrated stress response (ISR). Here, we investigate if MPC inhibition modulates the ISR and mitigates mutant huntingtin (mut-Htt) proteotoxicity in a cellular HD model. We treated cells expressing N-terminal fragments of wild-type- (wt-) or mut-Htt with two MPC inhibitors (mitoglitazone and UK5099) or solvent control. Metabolism was assessed analysing resazurin reduction, oxygen consumption, extracellular acidification, and ATP levels. ISR activation and huntingtin proteostasis were assessed using western-blot and filter-trap assays. Mut-Htt-expressing cells showed decreased resazurin reduction and ATP levels, and increased eIF2α phosphorylation, indicating metabolic stress and ISR activation. MPC inhibitors (100 µM) increased resazurin reduction and decreased respiration. The latter was rescued by the membrane-permeant methyl pyruvate, which bypasses MPC inhibition. In wt-Htt-expressing cells, MPC inhibitors increased levels of ATP and ISR markers, suggesting metabolic adaptation and ISR activation. In mut-Htt-expressing cells, MPC inhibitors preserved ATP levels and attenuated mut-Htt-induced eIF2α phosphorylation but without changing soluble or aggregated mut-Htt levels. This work showed that MPC inhibition differentially modulates the ISR: it activates ISR in control cells and attenuates overactive ISR in mut-Htt-expressing cells. However, MPC inhibition did not impact the proteostasis of N-terminal fragment mut-Htt. Further studies are essential to explore MPC inhibition in less severe full-length mut-Htt-expressing models to better understand its therapeutic potential in HD.

HTT
Also flagged:neuropsychiatric disordersAlzheimer's diseaseADParkinson's diseasePDHuntington's disease
Journal Article 2026-05-21 ✓ 1 Snippet Xu X, Ni Z, Wang YB, Fan SS, Du Y, Wang X, Meng XY.
In-Text Gene Mentions

…Hub genesHTTand BDNF were…

Show Full Abstract

<h4>Background</h4>Neurodegenerative and psychiatric disorders, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and schizophrenia (SZ), are characterized by progressive neuronal loss and synaptic dysfunction. Despite their severity, effective disease-modifying treatments remain unavailable, largely due to the elusive nature of their underlying molecular mechanisms.<h4>Methods</h4>To elucidate these mechanisms, we conducted an integrative systems biology analysis incorporating transcriptomic datasets, in silico proteomic networks, and inferred metabolomic profiles. Machine learning (ML) and deep learning (DL) models were employed to identify regulatory networks associated with oxidative stress, immune response, and synaptic signaling. Furthermore, network pharmacology approaches were applied to explore multi-target intervention strategies using bioactive compounds from traditional Chinese medicine (TCM).<h4>Results</h4>Our integrative analysis revealed extensive overlap in dysregulated biological processes across all four disorders, particularly involving oxidative stress and immune activation. We identified TP53, NFE2L2, and PPP3CA as central regulatory hubs driving these pathologies. Notably, computational predictions highlighted that TCM-derived compounds, specifically stigmasterol and dodecanoic acid, exhibit promising multi-target effects for modulating these oxidative and inflammatory responses. Subsequent in vivo experimental validation was performed exclusively to corroborate the disease-associated pathways and core gene dysregulation in an Aβ<sub>42</sub>-induced AD model. These findings demonstrated molecular and behavioral phenotypes consistent with our multi-dimensional computational predictions, establishing a robust mechanistic rationale that merits future in vivo pharmacological validation for the predicted bioactive compounds.<h4>Conclusion</h4>This study highlights the utility of a multi-disease, multi-dimensional framework in uncovering shared pathogenic signatures. By integrating computational analytics with pharmacological modeling and experimental validation, we identified key regulatory genes and natural compounds with therapeutic potential. These findings provide a theoretical foundation for the development of multi-target, personalized treatment strategies against neurodegeneration.

NEGR1
Also flagged:neuroendocrine tumorCancersneuroendocrine tumorstumorchromatincell cycle
Journal Article 2026-05-21 ✓ 4 Snippets Singh PN, Hadj Bachir E, Howe JR, Bellizzi AM, Cejas P, Madha-Krause S, Epstein CB, Chan JA, Bernstein B, Kulke MH, Zhou Q, Shivdasani RA.
In-Text Gene Mentions

…, CLSTN2 ,NEGR1, and SOX5…

…-null cells —NEGR1(Neuronal growth regulator…

…cells — NEGR1 (Neuronal growth regulator 1growth regulator 1),…

…like SOX5 andNEGR1, which are…

Show Full Abstract

Cancers reflect aberrant growth and differentiation of normal cell populations. Biological understanding of small intestine neuroendocrine tumors (SI-NETs) is hampered because their closest normal counterparts, enteroendocrine cells (EECs), constitute tiny fractions of intestinal epithelium. Recent characterization of adult human EEC ontogeny from intestinal stem cells can help overcome that limitation. Transient expression of the transcription factor gene ASCL1 normally ensures proper timing and fidelity of well-differentiated EECs, which express NEUROD1. Here, we report that SI-NETs resembled mature enterochromaffin cells; however, individual tumor cells coexpressed stem/progenitor genes, harboring each differentiation state along the EEC trajectory except ASCL1+ precursors. We found that enhancers normally active, and others inactive, during EEC differentiation underlie aberrant SI-NET gene activity. SI-NETs uniformly expressed NEUROD1 but lacked ASCL1, owing to inaccessible chromatin and repressive H3K27me3 marking at the ASCL1 locus. Multiple cyclin-dependent kinase inhibitor (CDKi) genes were similarly silenced, other than CDKN1B, the only gene recurrently mutated in SI-NETs. Deletion of CDKN1B altered cell cycle kinetics during human EEC differentiation, and deletions of ASCL1 or CDKN1B activated certain genes that are expressed in SI-NETs but not in the normal EEC trajectory. We propose that a limited CDKi repertoire and absence of ASCL1-dependent constraints on EEC maturation together explain unique SI-NET characteristics.

Also flagged:chronic diseasesmetabolismdeathrelated
Journal Article 2026-05-21 No Snippets Rostami MR, Rodriguez-Flores J, Ait Hssain A, Al Shakaki A, Khan H, Vakayil M, Karic E, Elhamid M, Gamal Al Tawil L, Mezey JG, Robay A, Crystal RG.
Show Full Abstract

Intensive care units (ICU) patients are highly vulnerable to inaccurate drug dosing. Pharmacogenomics (PGx) studies the role of inherited genetic variation in drug metabolism and dose efficacy. To assess the prevalence of PGx variants that may influence therapeutic effect in the ICU, we carried out whole genome sequencing (WGS) of 210 Qataris in ICU care at Hamad Medical Corporation (HMC), Doha, Qatar and assessed the WGS for predicted deleterious variants of genes that metabolize 30 drugs commonly prescribed in the ICU. PGx variation was evaluated using two complementary approaches. First, variants with established functional interpretation were assessed using CPIC guidelines and star-allele haplotypes inferred by PharmCAT to estimate the prevalence of alleles associated with abnormal drug metabolism. Second, a broader exploratory analysis examined computationally predicted deleterious single-nucleotide variants in pharmacogenes that currently lack CPIC guidelines or defined star alleles, with these findings interpreted as descriptive of genomic variation rather than clinical metabolizer phenotypes.Of the ICU patients that received the 5 most commonly prescribed drugs (warfarin, phenytoin, midazolam, vancomycin, levetiracetam), 93% had deleterious metabolism-related variants. Ninety-one % of ICU patients carried at least one variant in a gene with known PGx relevance that could potentially impact the metabolism or activity of at least one medication they received. Most patients had ≥14 deleterious variants of genes that affect the metabolism of administered drugs. Comparison of the deleterious variants related to metabolism of ICU drugs with African/African American and European populations revealed significant population specificity in ICU related PGx variants. Together, these data suggest that population specific, PGx based on the individual's genome likely plays a significant role in effective, safe dosing in the ICU setting.

Also flagged:Epilepsydeathsynthesisporebehavioralreflex
Journal Article 2026-05-21 No Snippets Mohsin N, Rasool N, Kanwal A, Saghir KA, Imran I, Siddique F, Nadeem S, Imran M.
Show Full Abstract

This study focused on the synthesis of a novel series of (4-bromothiophen-2-yl)methyl 1-naphthoate derivatives (5a-5h) <i>via</i> the Suzuki-Miyaura cross-coupling with moderate to excellent yields. Acute pentylenetetrazol (PTZ) and 6 Hz psychomotor seizure models were used to investigate <i>in vivo</i> anticonvulsant effects. The 5b, 5d, and 5h showed significant outcomes concerning mortality, protection, and seizure severity. In addition, the goal of the current study was to use a multifaceted strategy that integrates molecular docking (AutoDock Vina), <i>in silico</i> ADMET (SwissADME, Molsoft), and network pharmacology to explore their potential as anti-epileptic drugs against important targets (GABAA receptor (8G5G), SV2A (3O7P, 1PW4)). To find common targets, we built PPI networks and carried out functional enrichment analysis. As compared to standard medications (levetiracetam, diazepam, and PTZ), all compounds (5a-5h) showed greater binding affinities (-7.6 to -9.7 kcal mol<sup>-1</sup>). ADMET profiles revealed drug-like characteristics with good bioavailability scores (0.55), but they also highlighted P-gp substrate liabilities and low solubility as important improvement considerations. Molsoft web server highlighted their good BBB permeation. By focusing on hub genes (SRC, AKT1, MAPK1/3, STAT3, EGFR) implicated in key signaling pathways such as PI3K-Akt, MAPK, JAK-STAT, and GABAergic synapse signaling, network analysis showed that these drugs had 15-25 targets in common with epilepsy.

HFE
Also flagged:Metabolic dysfunction-associated steatohepatitisnon-alcoholic steatohepatitisNASHmetabolic dysfunction-associatedsteatotic liver diseaseinsulin resistance
Journal Article 2026-05-21 ✓ 1 Snippet Lixandru M, Maniu G, Lixandru CI, Grosu F.
In-Text Gene Mentions

…with alcoholic hepatitis,hemochromatosis, Wilson’s disease, severe…

Show Full Abstract

<b>Background/Objectives</b>: Metabolic dysfunction-associated steatohepatitis (MASH) is frequently accompanied by disturbances in coagulation and metabolic homeostasis, partly related to impaired handling of vitamin K-dependent pathways. Although vitamin K is often administered to correct abnormal coagulation tests, its biochemical impact in hospitalized patients with MASH remains insufficiently characterized. This study aimed to evaluate changes in coagulation and metabolic parameters in hospitalized patients with MASH receiving vitamin K supplementation. <b>Methods</b>: We conducted a retrospective study of 84 hospitalized MASH patients who received vitamin K supplementation. Biochemical parameters were recorded at admission and discharge to assess short-term changes during hospitalization. <b>Results</b>: Vitamin K supplementation was associated with modest changes in coagulation parameters, including reductions in PT, INR, and aPTT (e.g., PT decreased from 13.00 s to 11.00 s). Small numerical changes in transaminases, fasting glucose, and total cholesterol were observed during hospitalization, with limited clinical relevance. These patterns were comparable across fibrosis stages, with no significant differences between groups. <b>Discussion</b>: The observed biochemical findings are likely in-hospital factors rather than a direct metabolic effect of vitamin K. <b>Conclusions</b>: Vitamin K supplementation was associated with modest changes in coagulation parameters and small, clinically negligible variations in selected metabolic markers in patients with MASH, irrespective of fibrosis stage. These findings suggest a supportive biochemical effect in selected contexts; further prospective studies are needed to clarify their clinical relevance.

SOX6
Also flagged:Cell Differentiationmultiple myelomasecretionsenescencecell proliferationtranslational
Journal Article 2026-05-21 ✓ 1 Snippet Wang X, Fang C, Li S, Zeng H, Liu J, Duan X, Zhang X, Jiang W, Wang X.
In-Text Gene Mentions

…transcription of theSox6gene [ 34…

Show Full Abstract

Differentiation therapy holds significant potential for the treatment of multiple myeloma (MM). We previously identified that the aminopeptidase N (APN) inhibitor Bestatin promotes MM cell differentiation. Herein, we elucidate the underlying molecular mechanisms of this process. Utilizing MM1.S, U266, and RPMI-8226 cell lines, a combination of CCK-8 assays, flow cytometry, Wright-Giemsa staining, Western blotting, qRT-PCR, ELISA, APN enzymatic activity analysis, SA-β-gal staining, and bioinformatic analyses revealed elevated APN expression across all cell types. Bestatin treatment induced MM cell differentiation in a concentration-dependent manner, which was accompanied by the upregulation of the differentiation marker CD49e, increased immunoglobulin light chain secretion, elevated cellular senescence, and a concomitant suppression of cell proliferation and APN enzymatic activity. Mechanistically, Bestatin exerts its effects by downregulating the CD79B/BTK signaling pathway, thereby activating the downstream transcription factor STAT3. Consistent with this axis, direct inhibition of CD79B/BTK alone was sufficient to induce differentiation, while blockade of STAT3 completely abrogated the differentiation-promoting effect of Bestatin. The APN-neutralizing antibody (WM15) yielded consistent results with Bestatin, further validating this regulatory axis. Furthermore, both the CD79B/BTK inhibitor Ibrutinib and the STAT3 agonist GCDA potentiated the cytotoxicity of the clinical MM drug Ixazomib. Bestatin itself synergized with Ixazomib and enhanced the anti-proliferative effect of IL-6. In summary, our findings establish that the APN inhibitor Bestatin induces MM cell differentiation via the CD79B/BTK-STAT3 signaling axis. Targeting this pathway represents a promising strategy to enhance the efficacy of Ixazomib, providing a compelling rationale for novel combination therapies in MM.

Also flagged:Childhood interstitial lung diseaseschILDpediatricdiffuse parenchymal lung diseaseschronic pulmonary disorderssystemic disease-related disorders
Journal Article 2026-05-21 No Snippets Rapp CK, Griese M, chILD-EU Consortium.
Show Full Abstract

<b>Background/Objectives</b>: Childhood interstitial lung disease (chILD) represents a heterogeneous group of rare pulmonary disorders. Practical diagnostic approaches tested for feasibility and impact in comprehensive cohorts are lacking. We aimed to assess a simple etiologically focused classification approach, clarify the role of genetic testing and quantify the impact of non-pulmonary organ manifestations. <b>Methods</b>: We hypothesized that chILD can be classified in a clinically meaningful and versatile way by answering three questions: Which children have an etiological chILD diagnosis due to (1) identified (exposure-related) cause/lung injury, or (2) systemic disease? (3) In how many children without an etiological diagnosis can a genetic cause be identified? We also calculated the predictive value of non-pulmonary organ involvement for underlying systemic conditions. <b>Results</b>: Among 1693 patients, 24.7% were grouped as ILD related to exposure, 22.7% as ILD with systemic condition, 16.6% as ILD with genetic diagnosis of systemic disease, 10.0% as ILD with genetic diagnosis affecting the lungs only, and 25.8% as ILD without genetic diagnosis. The average genetic diagnostic yield was 50.8%, with higher rates in interstitial pneumonia (61.4%) or pulmonary alveolar proteinosis (87.1%). The presence of ≥two non-pulmonary organ manifestations increased the likelihood of an underlying systemic disease by three to five-fold. <b>Conclusions</b>: An etiological diagnostic strategy effectively classifies chILD and guides genetic testing. Exome or genome sequencing should be considered if ≥two non-pulmonary organs are involved or if the initial diagnosis becomes uncertain due to an unusual disease course or signs of a second underlying condition.

TNFSF4
Also flagged:CancertumorACCAdrenocortical CarcinomaBladder Urothelial CarcinomaBLCA
Journal Article 2026-05-21 ✓ 1 Snippet Yan H, Hu F.
In-Text Gene Mentions

…CD27, CD28, CD40,TNFSF4, and TNFSF14) were…

Show Full Abstract

<h4>Background</h4>The precise identification of cancer subtypes through the integration of multi-omics data has emerged as a key research direction in bioinformatics. Among existing multi-omics integration methods, similarity graph-based clustering algorithms have attracted widespread interest owing to their capacity to effectively characterize the association patterns between samples. However, the majority of existing methods primarily focus on first-order relationships among samples while ignoring the prevalent high-order neighborhood relationships, and fail to fully exploit the complementary information from different omics.<h4>Methods</h4>To address these limitations, we propose an innovative multi-omics integration framework termed MHSGTR, which integrates multi-omics data by combining Motif high-order similarity graphs and tensor regularization to identify cancer subtypes. Specifically, MHSGTR introduces Motif theory to construct a high-order similarity graph and designs a high-order graph learning term to obtain a hybrid similarity that integrates both first-order and high-order information, thereby capturing the latent high-order structural information among samples. For multi-omics data integration, we employ third-order tensor regularization constraints to explore complementary information across multi-omics data, coupled with an attention module to adaptively learn omics-specific weights for constructing a consensus similarity graph. Final clusters are derived via spectral clustering.<h4>Results</h4>Comprehensive experiments on eight TCGA cancer datasets and a case study on adrenocortical carcinoma (ACC) demonstrate that MHSGTR achieves superior clustering performance and identifies cancer subtypes with significant biological differences, showcasing its effectiveness in robust multi-omics integration.

HFE
Also flagged:HomeostasisPathogenesisdiabeteschronic pancreatitisCPautoimmune pancreatitis
Journal Article 2026-05-21 ✓ 2 Snippets Bryliński Ł, Brylińska K, Sado J, Kraśnik K, Smyk M, Komar O, Woliński F, Forma A, Rusek K, Flieger J, Teresiński G, Baj J.
In-Text Gene Mentions

…HbA1c Glycated hemoglobinHFEHemochromatosis gene Hg…

…Glycated hemoglobin HFEHemochromatosisgene Hg Mercury…

Show Full Abstract

The pancreas is an organ with two functions: endocrine and exocrine. The proper functioning of the pancreas depends on many factors. One of these is trace elements-precise control of trace element homeostasis is important for both the endocrine and exocrine parts. This review provides a comprehensive summary of current knowledge regarding the role of trace elements: iron (Fe), copper (Cu), cobalt (Co), iodine (I), manganese (Mn), zinc (Zn), silver (Ag), cadmium (Cd), mercury (Hg), lead (Pb), and selenium (Se) in pancreatic physiology and their influence on the pathogenesis of key diseases of this organ, such as diabetes (DM), acute (AP) and chronic pancreatitis (CP), autoimmune pancreatitis (AIP), and pancreatic cancer (PC). Trace elements, including Fe, Cu, Zn, Se, and Mn, play a fundamental role in maintaining endocrine and exocrine homeostasis, participating in insulin synthesis, stabilizing digestive enzymes, and the functioning of antioxidant systems. It has been demonstrated that disturbances in their concentrations lead to the activation of pathological molecular pathways, including oxidative stress, chronic inflammation, and beta-cell apoptosis. In the context of diabetes, excess Fe promotes ferroptosis, whilst exposure to heavy metals such as Cd, Pb, and Hg induces insulin resistance and pancreatic islet dysfunction. In the course of pancreatitis, elements such as Zn and Se exhibit protective potential by stabilizing tissue barriers, whereas toxic metals impair ion transport, exacerbating fibrotic processes. Furthermore, analysis of available data indicates a significant association between heavy metal accumulation and pancreatic carcinogenesis, driven by DNA damage and oncogene modulation. Understanding pancreatic metallomics opens new prospects for early diagnosis, environmental prevention, and the development of targeted therapeutic strategies that restore the body's micronutrient balance.

Also flagged:Prostate cancerPCacancertumormetastatic castration-resistant prostate cancerconjugation
Journal Article 2026-05-21 No Snippets Zyk NY, Butakova NS, Machulkin AE, Beloglazkina EK.
Show Full Abstract

Prostate-specific membrane antigen (PSMA) ligands are currently one of the popular platforms for creating drugs targeted at prostate cancer tumor cells. In this review, we have collected and systematized current approaches to the synthesis of PSMA ligands based on N-[N-[(<i>S</i>)-1,3-dicarboxypropyl]carbamoyl]-(<i>S</i>)-L-lysine (DCL), the most widely used scaffold in the design of such ligands. The main approaches to each stage of the synthesis of PSMA inhibitors with various structures are considered in detail, and the existing synthetic techniques are compiled and analyzed. We also review examples of using different synthetic pathways for diagnostic and therapeutic drugs based on PSMA ligands. We propose an algorithm for selecting a synthetic route based on the structure of the target ligand.

Also flagged:wound healingextracellulardegradationcell migrationwound repairtissue regeneration
Journal Article 2026-05-21 No Snippets Panainte AD, Peptu CA, Crețeanu A, Bibire N, Nacu I, Vereștiuc L, Popa EG, Păduraru L, Tartau LM, Dănilă R, Bibire T, Yilmaz CN.
Show Full Abstract

Hyaluronic acid (HA) hydrogels have attracted increasing interest for biomedical applications due to their tunable properties and biocompatibility. <b>Methods:</b> In this study, hyaluronic acid HA-based hydrogels were developed using two distinct crosslinking strategies: physical crosslinking through poly(vinyl alcohol) (PVA) incorporation and covalent crosslinking via DCC/NHS-mediated reactions. Piroxicam (Px) was included as a model drug to evaluate the drug delivery potential of the resulting systems. The hydrogels were characterized in terms of morphology, swelling behaviour, adhesion, enzymatic degradation, drug release, and in vitro cytocompatibility. <b>Results:</b> The results indicate that formulation parameters significantly influence the overall performance of the systems. PVA-containing hydrogels exhibited higher swelling capacity and improved adhesive properties, while covalently crosslinked networks showed reduced swelling and enhanced structural stability and resistance to enzymatic degradation. Drug release profiles were dependent on network structure, with more compact systems displaying slower release behaviour. In vitro assays suggested that the developed hydrogels are cytocompatible and that drug incorporation influences both release kinetics and cellular response. However, it should be noted that the biological evaluation was performed under simplified in vitro conditions, which primarily reflect specific aspects such as cell viability and migration. <b>Conclusions</b>: This study provides a comparative analysis of physical and covalent crosslinking strategies within a HA platform and highlights how formulation variables influence key physicochemical and biological properties. These findings contribute to the rational design of HA-based hydrogels, although further studies are required to establish their performance in more complex biological environments.

ARFGEF2
Also flagged:neuronal migrationAutosomal recessive periventricular heterotopiamicrocephalymembraneepilepsymovement disorders
Journal Article 2026-05-21 ✓ 5 Snippets Andreoli L, Caputo D, Doniselli FM, Messina G, Granocchio E, Castellotti B, Freri E.
In-Text Gene Mentions

…pathogenic variants inARFGEF2[ 3 ].…

…clinical picture ofARFGEF2-related PVNH is…

…pathogenic variant inARFGEF2.…

…search term “ARFGEF2” for studies…

…nonsense variant inARFGEF2( NM_006420.2 ):…

Show Full Abstract

Periventricular nodular heterotopia (PVNH) is a genetically heterogeneous malformation of cortical development with variable neurological outcomes. Among recessive forms, <i>ARFGEF2</i>-related disorder is uniquely characterised by the association of diffuse PVNH and progressive microcephaly. We describe a two-year-old boy born to consanguineous parents who presented with severe developmental delay, hypotonia, progressive microcephaly, and infantile-onset epileptic spasms with developmental regression. Brain MRI showed extensive bilateral PVNH associated with callosal hypoplasia and ventriculomegaly. EEG revealed dysmature background activity with multifocal epileptiform discharges and runs of asynchronous fast activity during sleep. Genetic testing identified a novel homozygous nonsense variant in <i>ARFGEF2</i>. The clinical course was characterised by drug-resistant epilepsy and multisystemic involvement, including feeding difficulties and recurrent respiratory infections. To contextualise this case, we performed a comprehensive review of previously reported patients, further delineating the clinical, neuroradiological, and electroclinical spectrum of <i>ARFGEF2</i>-related disorder. This case highlights progressive microcephaly as a key distinguishing feature of <i>ARFGEF2</i>-related PVNH and underscores the importance of early genetic diagnosis to guide targeted surveillance for extra-CNS complications and multidisciplinary care.

Also flagged:neurodegenerative diseasesmitochondrialpost-translational modificationsAlzheimer's diseaseADParkinson's disease
Journal Article 2026-05-21 No Snippets Lv Z, Liu X, Zhou Z, Huang Q, Liu H, Xu Z, Xu P.
Show Full Abstract

Neurodegenerative diseases (NDDs) lack effective disease-modifying therapies. The FOXO transcription factors serve as integrative hubs of cellular stress responses, operating through cell-autonomous homeostasis, intercellular coordination, intracellular quality control, and cell fate decisions four hierarchical tiers. This review systematically examines isoform-specific functions: FOXO1 governs metabolic reprogramming and mitochondrial biogenesis; FOXO3 acts as the principal oxidative stress sensor with context-dependent neuroprotective or pro-apoptotic outputs; FOXO4 regulates cellular senescence; and FOXO6 maintains synaptic metabolic support. These functions vary across cell types and disease stages, with post-translational modifications determining functional transitions. FOXO proteins participate in complex interactions with disease-specific pathological proteins, either promoting clearance and repair or exacerbating neurodegeneration depending on stress intensity and chronicity. Therapeutic strategies targeting FOXO remain in preclinical and early clinical stages. Key challenges include disease stage-dependent dosing, cell-type-specific delivery, blood-brain barrier penetration, and metabolic side effects. Future directions emphasize biomarker-guided patient stratification and precision interventions aligned with the spatiotemporal dynamics of FOXO signaling. Unlike prior reviews focusing on single pathways or diseases, this work integrates isoform-specific, stage-dependent, and cell-type-resolved FOXO functions into a unifying hierarchical framework.

OLFM4
Also flagged:Diabetes mellituschemotaxisdiabetesextracellularefferocytosisangiogenesis
Journal Article 2026-05-21 ✓ 1 Snippet Tan J, Yang D, Qin L, Chen Z, Xu Z, Wei C, Chen J, Huang Y, Yang D, Fang Y, Tang M, Wen H, Yi W, Gao A, Zhang Q, Wang H.
In-Text Gene Mentions

…Pglyrp1, Ltf, Retnlg,Olfm4, Mmp 8, and…

Show Full Abstract

Diabetes mellitus compromises bone regeneration and increases implant failure rates, posing persistent challenges in orthopedic and dental therapies. Although macrophage-centered immunomodulation has been widely investigated, the role of neutrophils, particularly under diabetic conditions, remains insufficiently defined. Here, we identify neutrophil dysfunction, characterized by impaired chemotaxis and elevated oxidative stress, as a critical upstream driver of impaired osseointegration in diabetes. We demonstrate that dietary flavonoid quercetin restores neutrophil redox homoeostasis in association with reactivation of Nrf2/HO-1 signaling, attenuates pathological neutrophil extracellular trap formation, and promotes MerTK-associated efferocytosis by macrophages. Efferocytosis of quercetin-treated neutrophils subsequently reprograms macrophage toward an anti-inflammatory, pro-regenerative M2-like phenotype, therefore establishing a microenvironment favorable for angiogenesis and osteogenesis. Based on these insights, we engineer a biodegradable tri-layered coating on polyetheretherketone (PEEK) implant, comprising an osteoconductive nano-hydroxyapatite base layer, a quercetin-rich antioxidant intermediate layer, and an outermost surface functionalized with the chemotactic peptide formyl-methionyl-leucyl-phenylalanine (fMLP) to actively recruit neutrophils. In a diabetic rat model, this rationally designed interface enables temporal coordination of innate immune responses, leading to substantially improved vascularized bone regeneration and implant osseointegration. These findings highlight neutrophils as key therapeutic targets in diabetic bone repair and propose an immunomodulatory biomaterials strategy that addresses upstream immune dysregulation in compromised metabolic conditions.

Also flagged:proteasomecarboxylcell cyclecell divisionimmune responseantigen presentation
Journal Article 2026-05-21 No Snippets Jang JH, Kim JY, Lee TJ.
Show Full Abstract

Molecular glue degraders (MGDs) are an emerging class of small molecules that promote selective protein degradation by inducing neomorphic interactions between E3 ubiquitin ligases and non-native substrates, referred to as neosubstrates. Clinically validated examples include thalidomide analogs that recruit cereblon (CRBN) to degrade IKAROS family zinc finger 1/3 in multiple myeloma, and arylsulfonamide-based MGDs that promote the degradation of RNA-binding protein 39 in acute myeloid leukemia and solid tumors. These molecules highlight the therapeutic potential of this modality in oncology. These findings underscore the promise of MGDs for eliminating oncogenic proteins previously considered undruggable and overcoming resistance to conventional inhibitors. Despite these successes, the current MGD landscape relies heavily on a limited set of E3 ligases-mainly CRBN which constrains substrate diversity, tissue selectivity, and durability of clinical response. Expanding the therapeutic utility of MGDs requires the systematic identification of novel ligases and their neosubstrates, accompanied by a deeper understanding of the mechanistic basis of ligase-substrate recognition. Recent technological advances, including chemoproteomics, ubiquitin-remnant profiling, degron mapping, clustered regularly interspaced short palindromic repeats-based functional genomics, and artificial intelligence-driven structural modeling, are advancing the discovery of new ligase-substrate pairs and enabling the rational design of degraders. Parallel progress in next-generation CRBN E3 ligase modulators, noncanonical MGDs, and structure-guided engineering further illustrates the expanding therapeutic versatility of this approach. By integrating multidisciplinary discovery strategies with translational oncology, the field is moving toward the development of next-generation MGDs with enhanced specificity, broader substrate scope, and improved resistance profiles. This study aims to elucidate how these innovations expand the degradable proteome and establish MGDs as a cornerstone of precision cancer therapy, thereby redefining the boundaries of drug discovery and providing customizable degraders tailored to diverse cancer contexts.

Also flagged:periodontal diseasetumormembranebone formationangiogenesismembranes
Journal Article 2026-05-21 No Snippets Liu Y, Zhang H, Zhang L, Han J, Yang J.
Show Full Abstract

Despite the placement of millions of dental implants annually, one-quarter to one-half of cases require concurrent guided bone regeneration (GBR), where a recent meta-analysis of 100 studies reported an approximately 26% complication rate that exposes the structural and biological limits of current barrier membranes. Conventional collagen and PTFE-based membranes function predominantly as passive occlusive barriers, lacking the bioactivity, controllable degradation, and immunomodulatory capacity demanded by the dynamic alveolar microenvironment, in which up to 50% of ridge width can be lost within 12 months post-extraction. Addressing this gap requires reframing GBR membranes as programmable interfaces. This review presents a three-lens framework - alveolar-bone-specific osteoimmune biology, metabolically active and stimuli-responsive material platforms, and translational bottlenecks - to systematically chart the field. We synthesize recent advances across four next-generation material families (polymer composites, biodegradable Mg/Zn alloys, MXene-based systems, and citrate-based polymers), four hierarchical structural strategies (bilayer, Janus, gradient, and 4D-printed architectures), and complementary functionalization strategies that include surface chemistry tailoring, bioactive ion release, and stimuli-responsive triggers, explicitly mapping how each modulates mechanical retention, degradation kinetics, antibacterial activity, and macrophage M1-to-M2 polarization. We further evaluate the clinical performance of these material platforms in alveolar ridge augmentation and identify platform-specific post-market follow-up endpoints required for regulatory translation. Finally, we articulate six open mechanistic questions and a near-term agenda integrating artificial intelligence/machine learning-driven design, microfluidic oral-microenvironment models, and standardized large-animal alveolar protocols. This framework repositions GBR membranes toward programmable, osteoimmune-active regenerative platforms, charting an actionable path from bench to clinic.

OLFM4
Also flagged:skin cancermelanomasquamous cell carcinomabasal cell carcinomabindinginflammatory responses
Journal Article 2026-05-21 ✓ 1 Snippet Zhou H, Wang H, Xie K, Ma H, Wu R, Ban D, Wang J, Sun Z, Wei J, Zhou D.
In-Text Gene Mentions

…pivotal node inOLFM4-induced signaling pathways, p…

Show Full Abstract

<h4>Background</h4>Di (2-ethylhexyl) phthalate (DEHP), the most widely used phthalate plasticizer, has been implicated in skin cancer. However, its key targets and multi-pathway mechanisms regulating skin cancer onset and progression remain unclear. Therefore, elucidating DEHP's molecular mechanisms in skin cancer development is crucial for prevention and intervention strategies.<h4>Methods</h4>This study integrates network toxicology, molecular docking, and experimental validation to systematically elucidate the mechanism by which DEHP induces skin cancer. Specifically, we predicted potential DEHP targets and skin cancer-associated targets (melanoma, squamous cell carcinoma, basal cell carcinoma) using multiple databases. Core targets were identified through CytoNCA topological analysis, MCODE module mining, and CytoHubba multi-algorithm integration. Performed GO/KEGG enrichment analysis using the DAVID database; validated the binding potential between DEHP and core targets via molecular docking with AutoDock Vina; and finally verified the abnormal expression profiles of core targets through TCGA/GTEx transcriptomic data, HPA proteomic data, and RT-qPCR experiments in A-375 (human malignant melanoma cells)/Hacat cells.<h4>Results</h4>Initially, this study identified 11 key DEHP-induced skin cancer targets: CTNNB1, ESR1, HIF1A, IL6, MTOR, MYC, STAT3, AKT1, BCL2, CASP3, and CCND1. These targets exhibited specific regulation across different skin cancer subtypes. Subsequently, a four-tier regulatory network linking "DEHP-core targets-pathways-skin cancer" was constructed. Molecular docking confirmed stable binding conformations between DEHP and all 11 key targets, while enrichment analysis revealed their associations with cellular proliferation, apoptosis, inflammatory responses, and core pathways including Jak-STAT and PI3K-Akt/mTOR. Finally, transcriptomic, proteomic, and <i>in vitro</i> cellular experiments validated the significant dysregulation of these targets in skin cancer tissues and tumor cells.<h4>Conclusion</h4>Collectively, this study systematically elucidates the toxicological mechanism by which DEHP promotes skin cancer development through subtype-specific pathways regulated by 11 key targets, clarifying its direct binding patterns with core targets and downstream pathway disruption characteristics. This not only fills a research gap in the molecular mechanisms of DEHP-induced skin carcinogenesis but also provides novel biomarkers for environmental exposure prevention and targeted interventions against skin cancer.

HFE
Also flagged:Primary InfertilityHypogonadotropic HypogonadismPartialEmpty Sella Syndromepituitary hormone deficienciesgonadotropin deficiency
Journal Article 2026-05-21 ✓ 1 Snippet Houjjaj D, Mouhmouh S, Benbella A.
In-Text Gene Mentions

Hemochromatosisand other infiltrative…

Show Full Abstract

Empty sella syndrome (ESS) is a radiological condition characterized by herniation of cerebrospinal fluid into the sella turcica, resulting in compression of the pituitary gland. Although often incidental, ESS may be associated with selective pituitary hormone deficiencies, including gonadotropin deficiency, leading to hypogonadotropic hypogonadism (HH) and infertility. We report the case of a 34-year-old woman with 14 years of primary infertility and a history of primary amenorrhea. Hormonal assessment revealed profound gonadotropin deficiency with a follicle-stimulating hormone (FSH) of 0.39 IU/L, luteinizing hormone (LH) less than 0.10 IU/L, and estradiol below 5 pg/mL, with preserved thyroid and prolactin function. Anti-Müllerian hormone (AMH) level was 0.8 ng/mL. Pituitary magnetic resonance imaging (MRI) demonstrated a partial empty sella without adenoma. Hysterosalpingography and semen analysis were normal. Ovulation induction with human menopausal gonadotropin resulted in pregnancy after one stimulation cycle. Cesarean section was performed at 38+3 weeks of gestation, delivering a healthy male newborn weighing 3180 g with an Apgar score of 10/10. Partial empty sella syndrome may be associated with isolated central hypogonadism leading to infertility, and individualized gonadotropin therapy can restore ovulation and achieve a successful pregnancy outcome.

Research Square 2026-05-21 Preprint (No Snippets API) Yang S, Ju S, Liao Y, Ding S, Guo H, Chen C.
Show Full Abstract

<title>Abstract</title> <p>Purpose Clinically useful glioblastoma (GBM)-specific stemness biomarker programs remain incompletely defined. We aimed to prioritize a GBM-focused stemness program and candidate markers by integrating single-cell, single-nucleus, and bulk transcriptomic data. Methods We integrated scRNA-seq data from 55 GBM samples and snRNA-seq data from 10 GBM samples. Malignant-cell stemness was quantified with CytoTRACE. Stem.Sig was derived from six public GBM single-cell datasets by intersecting genes positively associated with CytoTRACE with genes upregulated in malignant cells. Bulk cohorts were examined for immune associations, tumor-type summary trends with intratumoral heterogeneity (ITH) and tumor mutational burden (TMB), and small-cohort anti-PD-1 outcome modeling. Weighted gene co-expression network analysis (WGCNA) was used to prioritize hub genes, followed by preliminary qPCR and western blot expression support. Results Malignant compartments associated with non-response showed higher CytoTRACE scores than treatment-naive compartments in both cellular and nuclear datasets (both P < 0.001). Stem.Sig was associated with lower immune-related gene expression and lower inferred immune-cell abundance. At the tumor-type summary level, higher median Stem.Sig tended to align with higher ITH and TMB; these comparisons were interpreted descriptively. A Naive Bayes exploratory model showed modest discrimination in pretreatment anti-PD-1 GBM cohorts (validation and test AUCs both 0.65). WGCNA overlap prioritized nine hub genes; SOX6, BCHE, and LINC00511 showed preliminary qPCR support, and SOX6 and BCHE were also supported at the protein level. Conclusion This integrative framework prioritizes a GBM stemness program linked to immune-cold biology, heterogeneity, and adverse outcome, and nominates SOX6, BCHE, and LINC00511 as candidate markers for mechanistic follow-up.</p>

Also flagged:left ventricular dysfunctionventricular fibrillationcardiac arrestCAventricular fibrillation CAdeath
Journal Article 2026-05-20 No Snippets Weihs W, Mueller M, Magnet IAM, Szinovatz AF, Hamza O, Wolner L, Kodajova P, Ullram B, Brock R, Holzer M, Podesser BK, Kiss A, Stommel AM, Högler S.
Show Full Abstract

While the majority of rodent resuscitation studies prioritize neurologic outcomes, research into the long-term effects of global ischemia and reperfusion on cardiac function is scarce, generally limited to morphologic assessments. Extracorporeal cardiopulmonary resuscitation (ECPR) is a promising strategy for highly selected patients with refractory cardiac arrest (CA). We aimed to investigate the impact of ventricular fibrillation CA (VFCA) and subsequent ECPR on cardiac recovery in rats. Adult male Sprague-Dawley rats were subjected to either 6-8 min VFCA, followed by ECPR and compared to sham animals. The primary outcome parameter was cardiac function assessment at 14 days after CA. The hearts of rats surviving for 14 days were isolated and mounted onto an erythrocyte-perfused, isolated working heart (WH) system. Cardiac output (CO), left ventricular systolic pressure (LVSP), and coronary flow were measured. To assess the heart adaptation to hemodynamic stress, the afterload was gradually increased in 10 mmHg increments while CO and LVSP were monitored. Additionally, the hearts from all animals surviving at least 36 h were assessed histologically. Of 15 rats that achieved ROSC after 6 min of CA, 7 could be evaluated in the WH setup 14 days after CA. In the 8 min CA group, 15 animals achieved ROSC, of which 2 were investigated in WH at 14 days after CA. Compared to the hearts of 7 sham animals, no significant differences in cardiac hemodynamics were observed at a set afterload (60 mm Hg; baseline) in the 6 min CA group. However, the two investigated 8 min CA animals exhibited a trend towards reduced CO and LVSP levels. Notably, both CA groups showed impaired hemodynamic performance to hemodynamic stress. Survivors at 14 days consistently showed significant myocardial pathology, with both 6 min and 8 min CA groups exhibiting fibrosis, inflammation, and edema most pronounced in the interventricular septum and right ventricle of the 8 min CA group. Animals that died prematurely displayed time-dependent acute changes, progressing from hypereosinophilic degeneration (36 h survivors) to myocardial necrosis, calcification, and the formation of cell-rich granulation tissue (48-108 h survivors). VFCA led to impaired left ventricular hemodynamic function in 8 min CA rats resuscitated with ECPR at rest and with increasing afterload. The isolated WH system may offer a valuable tool for assessing long-term cardiac function and performance after resuscitation.

Also flagged:mitochondrialDiabetic cardiomyopathymyocardial disorderdiabetes mellituscoronary artery diseasehypertension
Journal Article 2026-05-20 No Snippets Yoon CS, Ko JR, Park N, Park SH, Kim HK, Han J.
Show Full Abstract

Binaphthoquinone (BiNQ), a dimeric compound composed of juglone (5-hydroxy-1,4-naphthoquinone) and naphthazarin (5,8-dihydroxy-1,4-naphthoquinone), was originally isolated from the sea urchin <i>Spatangus purpureus</i> O.F. Müller. In this study, we examined the anti-fibrotic effects of BiNQ in a diabetic context, focusing on its potential to enhance mitochondrial function. Human cardiac fibroblasts (NHCF-V) were cultured under control 5 mM glucose or exposed to 33 mM glucose plus palmitic acid (100 μM). Fibroblast-to-myofibroblast transition was evaluated by measuring the expression level of the myofibroblast marker α-smooth muscle actin (α-SMA), and functional changes were further assessed using a contraction assay. BiNQ was applied at two concentrations (10 nM and 1 μM) and was found to reduce α-SMA expression, indicating inhibition of myofibroblast differentiation. Concurrently, BiNQ enhanced the expression of mitochondrial respiratory chain complexes, resulting in increased ATP production. To elucidate the underlying molecular mechanisms, targeted proteomic analysis was performed using LC-MS/MS, enabling identification and quantification of proteins involved in mitochondrial bioenergetics and fibrotic regulation. Collectively, these findings suggest that BiNQ attenuates fibroblast activation in a diabetic context by improving mitochondrial function and modulating key pro-fibrotic pathways.

Also flagged:synthesisorganization
Journal Article 2026-05-20 No Snippets Nikonovich T, Chatzigiannis CM, Bordier C, Solorzano-Rodriguez R, Baier DM, Ort FF, Aav R, Leyssens T, Blanco-Ania D, Rutjes FPJT, Kananovich D, Colacino E.
Show Full Abstract

Mechanochemical methodologies are reshaping synthetic organic chemistry by enhancing practicality and reducing environmental impact. This review presents a comprehensive account of mechanochemical methods for amide bond formation, arguably the most developed and industrially relevant area within mechanochemical organic synthesis. Covering literature from early contributions to the present (September 2025), the review organization follows key substrate classes and methodological strategies: amide bond formation via coupling of carboxylic acids or their activated derivatives with amines (Section 2), followed by unconventional approaches (Section 3) employing carboxylic acid and amine surrogates, redox chemistry, rearrangements, and transition metal-mediated reactions leading to amide products through alternative bond-forming pathways. Mechanoenzymatic transformations are treated separately (Section 4), with stereochemistry-related issues, such as the preservation of enantiomeric purity, discussed in Section 5. Section 6 highlights the use of amide bond formation as a model system for probing mechanochemical driving forces. Special attention is given to scalability and successful scale-up examples, alignment with green chemistry principles, limitations, unexplored areas, and challenges requiring further development. This review is intended as an accessible and thorough resource for synthetic chemists in both academia and industry, including those newly exploring the field of mechanochemistry, and it provides practical guidance for process optimization and scale-up.

TNFSF4
Also flagged:intestinal disordersreverse transcriptioncoagulationcancercolorectal cancertumor of the intestine
Journal Article 2026-05-20 ✓ 1 Snippet Xiong C, Liao P, Li J.
In-Text Gene Mentions

…TNFSF15 , andTNFSF4) ( p…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC), a lethal tumor of the intestine, has lipotoxicity, which exerts a significant influence on the onset and development of intestinal disorders. This study provides an in-depth evaluation of lipotoxicity-related genes (LRGs) in the CRC treatment setting.<h4>Methods</h4>Differentially expressed genes (DEGs) within The Cancer Genome Atlas-CRC dataset and LRGs were intersected to obtain the LRG-DEGs. Subsequently, univariate Cox regression and a random survival forest model were conducted to select prognostic LRGs and construct a risk model for patients with CRC. Then, prognosis was further investigated via independent prognostic analysis, nomogram construction, enrichment analysis, immune microenvironment analysis, and drug sensitivity testing. Finally, reverse transcription quantitative PCR (RT-qPCR) was used to verify the expression levels of prognostic LRGs.<h4>Results</h4>The constructed risk model with five prognostic LRGs (PPARGC1A, CPT2, CXCL1, FABP4, and OFCC1) showed high prognostic effectiveness. The nomogram subsequently built based on risk score, age, T stage, and M stage showed strong prognostic power. Moreover, the enrichment of diverse pathways was observed across distinct risk groups, exemplified by the PPAR signaling pathway and complement and coagulation cascades. Analysis of the immune microenvironment revealed the strongest positive association between FABP4 and natural killer cells. Drug sensitivity testing identified efficacious drugs for patients with CRC, such as midostaurin and lenalidomide. Notably, RT-qPCR confirmed elevated expression levels for CXCL1 and OFCC1 and reduced levels for FABP4, PPARGC1A, and CPT2 in patients with CRC.<h4>Conclusion</h4>Five prognostic LRGs were determined for CRC, and a new risk model was developed and validated, revealing the critical role of LRGs in CRC and improving our understanding of clinical interventions for this cancer type.

HTT
Also flagged:degradationproteostasisproteasomeADcytoplasmnucleus
Journal Article 2026-05-20 ✓ 1 Snippet Yang Y, Jia L, Xu J, Wu J, Huang H, Yang H, Qi Z, Wang Y, Yu H, Wang S.
In-Text Gene Mentions

…], and Huntington (HTT) protein in Huntington’s…

Show Full Abstract

The dysregulation of proteostasis is a hallmark of Alzheimer's disease (AD), characterized by the accumulation of misfolded and aggregated proteins. Dysfunction of the ubiquitin-proteasome pathway is a major contributing factor to proteostasis imbalance. The E3 ubiquitin ligase, F-box and WD repeat domain-containing 7 (FBXW7), a key hub factor in AD, is significantly downregulated in AD patients. FBXW7 mediates the proteasomal degradation of tau and regulates the development of tau pathology. However, the effect of FBXW7 on β-amyloid pathology and the underlying mechanisms remain unclear. This study demonstrated that FBXW7α, the dominant FBXW7 isoform, was localized in both the cytoplasm and nucleus of neurons. Aging led to a decline in FBXW7α protein levels in the brain tissues of both wild-type and 5×FAD mice. Notably, the level of FBXW7 in the brain tissue of 5×FAD mice is significantly lower than that in wild-type mice after 6 months of age. FBXW7α interacted with BACE1 via the conserved phosphodegron motif and targeted BACE1 for degradation. FBXW7 knockdown diminished the ubiquitination of BACE1, impaired its proteasome-mediated degradation, and increased the accumulation of BACE1 in Golgi fractions. Additionally, restoration of FBXW7α in the hippocampus improved cognitive function and ameliorated amyloid pathology in 5×FAD mice. Our findings suggest that FBXW7α acts as a key regulator of amyloid pathology, and highlight FBXW7α as a promising potential therapeutic target for AD intervention.

Also flagged:neurodegenerative disordercognitive declineADAlzheimersamyloid
Journal Article 2026-05-20 No Snippets Seo H, Terstege DJ, Ren Y, Liu S, Goring KR, Ahn BY, Epp JR.
Show Full Abstract

Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized by cognitive decline and synaptic dysfunction. Among the earliest regions affected is the retrosplenial cortex (RSC), where parvalbumin-expressing (PV + ) interneurons are particularly susceptible to AD-related pathology. To understand the molecular alterations within these vulnerable neurons we employed a dual-platform spatial transcriptomics approach, integrating GeoMx Digital Spatial Profiler (DSP) and Xenium In Situ. We analyzed the transcriptomic profiles of PV+ and NeuN+ neurons in the RSC of female 5xFAD mice. We leveraged the individual strengths of each platform to generate a robust and comprehensive dataset. Using non-negative matrix factorization and k-means clustering, we identified disease-associated metagenes and examined their spatial distribution. Our analysis revealed distinct transcriptional subpopulations within PV+ interneurons, with specific metagenes differentially expressed in RSC. Dner, Gad1, and Pvalb exhibited significant down-regulation in TG mice, suggesting impairments in PV+ interneuron function and GABAergic signalling. Cross-validation between GeoMx DSP and Xenium In Situ as well as RNAscope and immunohistochemistry confirmed the reproducibility and robustness of these findings. This study provides insights into the heterogeneity and molecular vulnerabilities of PV+ interneurons in AD and demonstrates the power of integrating spatial transcriptomic platforms to uncover disease-associated neuronal subtypes and molecular markers.

LRRC7
Also flagged:brain disordersmajor depressive disordergene expressionanxietyconditionsAnhedonia
Journal Article 2026-05-20 ✓ 1 Snippet Gardner-Stephen K, Carvajal-Quisilema RJ, Andrianova L, McGonigal R, Sharma D, Barrie JA, Saathoff M, Cole JJ, Jamieson NB, Craig MT, Cavanagh JT.
In-Text Gene Mentions

…), synapses (Lrrc7; Prkar2b) ;…

Show Full Abstract

Interactions between the brain and immune system play a key role in the aetiology of brain disorders, with inflammation emerging as a potential causal factor in subsets of major depressive disorder, particularly those resistant to treatment. The mechanisms through which immune activation might drive depressive symptoms remain elusive, limiting the ability to develop new targeted therapies. Using a mouse model of neuroinflammation, involving a TLR7/8 agonist, we combined whole-brain and spatial transcriptomics approaches to determine whether TLR7/8-driven neuroinflammation resulted in consistent immune and neurobiological transcriptional changes throughout the brain. We found evidence of strong immune activation throughout the brain,. and this global inflammatory signal led to regionally specific changes in gene expression. In particular, we found reduced expression of genes associated with synaptic function in brain areas underlying mood and anxiety, such as ventral striatum and amygdala.

SOX6
Also flagged:degradationosteoarthritisOApathogenesisbindingchronic inflammatory disorder
Journal Article 2026-05-20 ✓ 1 Snippet Zhang R, Liang Q, Lan T, Li S, Zhang J, Zheng Y.
In-Text Gene Mentions

…transcription factor 6 (SOX6) and SRY-box transcription…

Show Full Abstract

Emerging evidence highlights the critical role of transcription factors (TFs) in diverse diseases, including osteoarthritis (OA). However, the identification of key TFs in OA pathogenesis needs further understanding. BarH-like homeobox 2 (BARX2), significantly downregulated in osteoarthritis (OA) cartilage and IL-1β-stimulated chondrocytes, plays a protective role in OA pathogenesis. Mechanistically, methyltransferase-like 3 (METTL3) / methyltransferase-like 14 (METTL14) complex-mediated N6-methyladenosine (m6A) modification was found to enhance BARX2 mRNA degradation via the YTH N6-methyladenosine RNA binding protein 2 (YTHDF2) - dependent manner, resulting in decreased BARX2 expression in osteoarthritic human chondrocytes. BARX2 was shown to mitigate interleukin-1beta (IL-1β) - induced damage in osteoarthritic human chondrocytes by suppressing Wnt / β-catenin signaling pathway. Conversely, BARX2 knockdown exacerbated this damage. Additionally, we discovered that BARX2 inhibited the activation of Wnt / β-catenin pathway and reduced IL-1β-induced osteoarthritic chondrocyte damage by binding to the topoisomerase II alpha (TOP2A) promoter to suppress TOP2A transcriptional expression. Lastly, our data demonstrated that BARX2 ameliorate OA progression by inhibiting TOP2A-mediated Wnt / β-catenin pathway activation in DMM-induced male OA mice. In conclusion, YTHDF2-mediated decay of m6A-modified BARX2 mRNA by METTL3/14 reduces BARX2 levels, contributing to OA progression via upregulation of TOP2A and consequent activation of the Wnt/β-catenin pathway.

Also flagged:chromatinbrain developmentastrocyteneuropsychiatric diseasecircadian rhythminfection
Journal Article 2026-05-20 No Snippets Gegenhuber B, Sonoda T, Traunmüller L, Davis CP, Koren SA, Griffith EC, Chen C, Greenberg ME.
Show Full Abstract

Sensory experience refines neural circuits during critical periods of postnatal development<sup>1-3</sup>. Although neuronal activity is known to orchestrate the circuit wiring that underlies this process<sup>4,5</sup>, the environmental cues that restrain developmental plasticity as animals mature are less clear. Here we examine the experience-dependent maturation of the mouse primary visual cortex across postnatal development using paired single-cell transcriptomic and chromatin accessibility sequencing. In addition to identifying the activity-dependent gene programs that emerge within each cortical cell type, we find that light exposure drives astrocyte maturation through cell-type-specific recruitment of the glucocorticoid receptor (encoded by Nr3c1) to chromatin. Astrocyte glucocorticoid receptor signalling activates an extensive gene regulatory program that is partially conserved in human brain development and promotes maturation processes that may regulate critical period closure. Collectively, these findings reveal that astrocyte glucocorticoid receptor signalling restricts neuronal plasticity. Glucocorticoid regulation of astrocyte maturation may also contribute to the effects of early-life stress across the brain, and the disruption of this process may increase susceptibility to neuropsychiatric disease.

HFE
Also flagged:liver cancermetastatic liver diseaseliver failuretumorcolorectal liver metastasesliver disease
Journal Article 2026-05-20 ✓ 1 Snippet Ramdhani K, van Rees RCM, Andel D, Roodhart JML, Braat AJAT, Bruijnen RCG, Borel Rinkes IHM, Kranenburg O, Lam MGEH, Smits MLJ, Hagendoorn J.
In-Text Gene Mentions

…underlying liver disease (hemochromatosis).…

Show Full Abstract

<h4>Introduction</h4>Insufficiency of the future liver remnant (FLR) precludes surgery for liver tumors as it is associated with post-hepatectomy liver failure (PHLF). A common strategy to induce pre-operative FLR hypertrophy is portal vein embolization of the tumor bearing liver lobe. More recently, transarterial radio-embolization (radiation lobectomy, RL) has been employed. Direct functional assessment using 99mTc-mebrofenin-hepatobiliary-scintigraphy (HBS) predicts FLR sufficiency more accurately than conventional volume assessment. However, studies describing dynamic functional assessment of the FLR after RL as induction for surgery are currently lacking. This study aims to compare FLR functional changes after PVE and RL.<h4>Methods</h4>This non-interventional retrospective single-center cohort study was performed between 2016 and 2024. Patients with colorectal liver metastases (CRLM) who underwent PVE or RL because of an insufficient FLR (HBS < 2.7%/min/m<sup>2</sup>) were included. Induction of sufficient FLR function was the primary outcome.<h4>Results</h4>Ten PVE- and ten RL-treated patients were included. The median duration to achieve sufficient FLR function was longer for RL- than PVE-treated patients (75 days (64-85) vs 31 days (28-54.5), p = 0.002). RL showed a non-significant higher median functional increase (58.6% vs 51.1%, p = 0.940) and a significantly higher voluminal increase (65.7% vs 36.8%, p = 0.049) compared to PVE. PHLF and resection margins were comparable among groups. There was no 90 day mortality.<h4>Conclusion</h4>RL represents a feasible alternative to PVE with comparable functional outcomes, particularly in patients with lower baseline FLR function or need for simultaneous tumor control. This warrants prospective studies with optimized RL protocols to better define the functional outcomes and clinical applications of RL versus PVE.

Also flagged:cell migrationseminomalocalizationfertilizationtumorgranulosa cell tumor
Journal Article 2026-05-20 No Snippets Jiang Y, Caban KM, Peitzsch M, Herrmann C, Mayr D, Stöckl JB, Fröhlich T, Mayerhofer A, Müller-Taubenberger A, Welter H.
Show Full Abstract

<h4>Background</h4>Filamin A (FLNA) is an actin-binding protein that regulates mechanosensitivity and functions as an intracellular signaling scaffold in various cell types. It has also been implicated in tumor growth. We recently reported FLNA expression in human ovarian granulosa cells and in KGN cells, a granulosa cell tumor (GCT) line.<h4>Results</h4>Immunohistochemistry analysis of 51 GCT samples revealed heterogeneous FLNA expression, with approximately 20% showing weak, 18% strong, and the majority moderate expression. We therefore conducted functional studies in KGN cells using CRISPR/Cas9 gene editing. A proteomic approach revealed marked changes in protein abundance upon FLNA depletion: proteins with increased abundance were predominantly related to adhesion, cytoskeletal organization, regulation of cell shape, and lipid metabolic process, whereas those with decreased abundance were associated with DNA replication, cell division, and cell cycle regulation. FLNA-knockout cells showed enlarged cell sizes, reduced proliferation, and slightly affected steroidogenesis. Disruption of FLNA further reduced migration velocity, altered actin cytoskeletal alignment under flow, and modified expression of genes involved in cytoskeletal architecture, adhesion, and mechanosensing under shear stress.<h4>Conclusions</h4>Our results identify crucial roles of FLNA in shaping the cellular architecture, motility, and proliferation of KGN cells. Consequently, alterations in FLNA expression may influence intracellular signaling, and responsiveness to mechanical cues in both physiological and pathological contexts.

Also flagged:NanomaterialsferroptosisosteoarthritisirondeathOA
Journal Article 2026-05-20 No Snippets Cao S, Lan D, Wei Y, Zeng H, Zhang H.
Show Full Abstract

<h4>Background</h4>Osteoarthritis (OA) lacks effective disease-modifying therapies. Ferroptosis, an iron-dependent form of programmed cell death, has emerged as a novel pathogenic mechanism in OA. Nanomaterials (NMs), with tunable physicochemical properties and targeting capacity, offer promising opportunities for ferroptosis modulation. This systematic review synthesizes preclinical evidence on NM-based strategies in OA.<h4>Methods</h4>This review followed PRISMA 2020 guidelines and was prospectively registered on INPLASY (INPLASY202570110). Comprehensive searches of seven databases (PubMed, Embase, Web of Science, Scopus, ProQuest, Ovid, Cochrane Library) were performed up to July 27, 2025. Eligible studies included in vitro and/or in vivo investigations of NM-based approaches targeting ferroptosis in OA models. Independent screening, data extraction, and risk of bias assessment were conducted. Owing to substantial heterogeneity in nanomaterial platforms, experimental models, and outcome measures, a qualitative evidence synthesis was performed and meta-analysis was not considered appropriate.<h4>Results</h4>Twenty-two eligible studies were identified. Investigated nanoplatforms included polymeric nanoparticles, metal-based carriers, nanozymes, hydrogels, and biomimetic systems. Across in vitro and in vivo models, NMs were reported to modulate ferroptosis through regulation of iron metabolism, scavenging of reactive oxygen species, reinforcement of antioxidant defenses, and modulation of ferroptosis-related signaling. Reported preclinical outcomes included attenuation of lipid peroxidation, preservation of mitochondrial integrity, reduction of chondrocyte death, and improvement in cartilage structure and joint function.<h4>Conclusion</h4>Preclinical evidence supports NM-based ferroptosis modulation as a promising avenue for disease-modifying OA therapy. Translation will require standardized protocols, independent replication across diverse settings, adoption of advanced human-relevant models, and integration with multi-target strategies beyond ferroptosis.

BTN2A2
Also flagged:tumorWilms tumorsolid tumorsTumorspathogenesisgene expression
Journal Article 2026-05-20 ✓ 2 Snippets Gao Z, Lin J, Tang H, Li A, Li R, Xu A, Hu R, Xu S, Zhang M, Yang W, Huang H, Zhang Z, Liu F.
In-Text Gene Mentions

…expressed genes (BTN2A2, HLA-DRB5 ,…

…Conversely,BTN2A2exhibited an inverse…

Show Full Abstract

<h4>Background</h4>Wilms tumor presents a heterogeneous tumor microenvironment. This study aimed to characterize the tumor microenvironment and identify prognostic genes to improve therapeutic strategies.<h4>Methods</h4>We integrated single-cell RNA sequencing and transcriptomic data from paired tumor and normal tissues. Bioinformatics analyses included assessments of cellular heterogeneity, trajectories, and cell-cell communication. Prognostic genes were identified with differential expression, Cox regression, and machine-learning analyses. Furthermore, functional characterization, immune infiltration patterns, and therapeutic targets were systematically investigated. Potential therapeutic compounds were predicted using drug databases and a graph-based deep learning framework to predict compound-protein interactions.<h4>Results</h4>Single-cell RNA sequencing revealed 17 cell clusters, with tumor-specific epithelial cells and renal progenitor cells. Pseudotime trajectory analysis revealed dynamic differentiation, highlighting NRG1/3-ERBB4 signaling. Intersection of the transcriptomic and single-cell data identified 405 key genes. A prognostic model incorporating eight prognostic genes (PRLR, SLC16A7, SGIP1, PPARGC1A, CDHR5, GRB7, FKBP10, and UGT2B7) stratified patients into high- and low-risk groups (p < 0.0001), with area under the curve values > 0.6 for 1-, 2-, and 3-year survival prediction. High-risk patients had elevated regulatory T cell infiltration and immune checkpoint genes (TNFRSF9 and KIR3DL3). Chitosan was identified as a multitarget agent that interacts with the eight prognostic proteins.<h4>Conclusions</h4>This study defined tumor cellular architecture and identified eight prognostic genes with potential clinical value.

Also flagged:mitochondriaproteolysisprotein degradationmitochondrialProtein homeostasisprotein synthesis
Journal Article 2026-05-20 No Snippets Liu L, Yu M, Li X, Xu J, Xie S, Xu S, Yao H.
Show Full Abstract

The caseinolytic protease P (ClpP) is a conserved serine protease that functions with ATPases associated with diverse cellular activities (AAA+) chaperones to ensure protein quality control in organisms ranging from bacteria to human mitochondria. Its tetradecameric structure and adjustable gating support selective substrate recognition, unfolding, and proteolysis, thereby contributing to proteostasis, metabolic balance, stress responses, and bacterial virulence. Growing insights into human ClpP and ClpX complex (hClpXP) have further underscored its relevance to human disease. This review summarizes current knowledge of ClpP architecture and regulatory mechanisms, with emphasis on its roles in cellular homeostasis and pathophysiology. We highlight advances in small-molecule ClpP modulators, including activators, inhibitors, and emerging heterobifunctional degraders such as bacterial proteolysis-targeting chimeras (BacPROTACs) and mitochondrial-targeted PROTACs (MtPTACs), which harness ClpP activity for targeted protein degradation in antibacterial and anticancer applications. Despite notable progress, challenges remain, particularly in achieving selectivity between bacterial and human ClpP (hClpP), minimizing off-target effects, and preventing resistance. Future opportunities include designing reversible covalent inhibitors, developing novel allosteric modulators, and optimizing degrader architectures to expand therapeutic potential. ClpP-directed therapeutic strategies therefore represent a promising avenue for next-generation antibacterial and anticancer drug discovery.

SLC2A14
Also flagged:cellduodenal polypsobesitycentromerestelomereschromosome
Journal Article 2026-05-20 ✓ 1 Snippet Garg P, Jadhav B, Shadrina M, Martin-Trujillo A, Sharp AJ.
In-Text Gene Mentions

SLC2A14

Show Full Abstract

We developed a read-depth-based approach that allows accurate and scalable copy-number genotyping from genome sequencing data, including mosaic, recurrent, and multiallelic copy-number variants (CNVs) that are difficult to genotype using other methods. We genotyped each 5-kb segment throughout the genome in the UK Biobank cohort and performed phenome-wide association studies (PheWASs) using 13,215 traits under three different association models, identifying 501 CNVs associated with 1,537 traits. Of these, almost 75% were not found by comparable single-nucleotide variant (SNV)-based PheWASs. We detected signals with multiallelic CNVs, including a coding repeat within MUC1 (mucin 1, cell-surface associated) associated with stomach/duodenal polyps (p = 7.7 × 10<sup>-24</sup>), copy number of AMY1 (amylase alpha) genes associated with denture use (p = 2.4 × 10<sup>-29</sup>), and a multiallelic coding CNV within NEB, encoding muscle sarcomere protein, associated with muscle mass (p = 9.7 × 10<sup>-24</sup>). We also identified intergenic CNVs with effects on traits known to be regulated by nearby genes. For example, carriers of rare non-coding deletions ∼100 kb upstream of MC4R, coding mutations in which are the most common cause of monogenic obesity, were, on average, ∼14 kg heavier than control subjects. In some cases, non-coding CNVs encompassed regulatory elements of the adjacent candidate gene. Using burden tests, we identified an excess of rare damaging non-coding SNVs within some of these regulatory elements associated with the same traits observed in CNV carriers. Our study provides a detailed map of functional CNVs, including complex loci that are recalcitrant to other methods, providing numerous insights into their effects on human traits.

HFE
Also flagged:gene expressionpolyadenylationmessenger RNAlocalizationdegradationtranslation termination
Journal Article 2026-05-20 ✓ 2 Snippets Vlasenok M, Kuznetsova A, Skvortsov DA, Dontsova OA, Pervouchine DD.
In-Text Gene Mentions

…intron of theHFEgene [ 21…

…validated cases (HFE, CSF3R , and…

Show Full Abstract

The nonsense-mediated messenger RNA decay (NMD) surveillance system detects and selectively eliminates transcripts with premature stop codons. A stop codon is considered premature if it is followed by an exon-exon junction >50 nucleotides downstream. Pruning of the 3'-untranslated region containing such junctions through alternative polyadenylation may provide a mechanism of NMD escape. Here, we systematically examine a subclass of poison exons that carry a premature stop codon for the presence of polyadenylation sites (PAS) in the downstream intron. Using data from the GTEx consortium, we observed that poison exons are more often followed by an active polyadenylation site compared with cassette exons. We also identified tissue-specific switches between NMD-targeted and NMD-escape isoforms in several human genes, including the vaccinia-related kinase <i>VRK3</i>, nuclear transcription factor <i>NFX1</i>, Notch pathway regulator <i>TM2D3</i>, and RNA helicase <i>DDX31</i>. Blocking the cleavage and PAS in these genes using antisense oligonucleotides in human cells led to a switch from NMD-escape to NMD-target isoform, accompanied by a decrease in gene expression levels. This study reveals that NMD escape via alternative polyadenylation is a widespread, yet currently overlooked post-transcriptional mechanism of gene expression regulation.

RC3H1
Also flagged:Tumorbrain tumorscancersglioma-regulation of
Journal Article 2026-05-20 ✓ 1 Snippet Miyara K, Benthami H, Miftah H, Ait Ssi S, Boulhen C, Lakhdar A, Badou A.
In-Text Gene Mentions

…of Regnase-1 andRoquin-1unleashes CAR-T antitumor…

Show Full Abstract

<b>Background/Objectives</b>: Gliomas are among the most aggressive primary brain tumors in adults, characterized by profound molecular heterogeneity and poor response to conventional therapies. Immunotherapy has transformed outcomes in several cancers, yet glioma remains largely refractory, due in part to an immunosuppressive tumor microenvironment. Post-transcriptional regulation of gene expression is increasingly recognized as a key mechanism controlling immune cell function in tumors. Regnase-1, an endoribonuclease regulating the stability of inflammation- and immunity-related mRNAs, is a central modulator of immune responses; however, its role in glioma progression and immune modulation remains poorly understood. This study aimed to evaluate Regnase-1 expression in glioma and investigate its association with tumor grade, prognosis, and immune microenvironment characteristics. <b>Methods</b>: Regnase-1 transcript levels were evaluated by RT-PCR in tumor samples from 40 Moroccan glioma patients and validated using transcriptomic data from The Cancer Genome Atlas (TCGA, <i>n</i> = 672) and the Chinese Glioma Genome Atlas (CGGA, <i>n</i> = 959). Bioinformatic analyses and statistical assessments were performed using established pipelines. <b>Results</b>: Regnase-1 expression was significantly elevated in glioblastoma, IDH-wildtype tumors, and higher tumor grades, correlating with poorer overall survival, and emerging as an independent prognostic factor in the CGGA cohort. High Regnase-1 expression was associated with enrichment of pathways related to angiogenesis, hypoxia, invasion, and immune evasion. Tumors with elevated Regnase-1 showed reduced infiltration of effector immune cells (CD8<sup>+</sup> T cells, Th1 cells) and increased presence of immunosuppressive populations, including regulatory T cells, myeloid-derived suppressor cells, and M2 macrophages. Single-cell analyses further highlighted exhausted CD8<sup>+</sup> T cells and regulatory T cells as major populations linked to Regnase-1 expression. Notably, Regnase-1 expression also exhibited strong positive correlations with multiple inhibitory immune checkpoint pathways. <b>Conclusions</b>: Elevated Regnase-1 expression defines an aggressive, immunosuppressive glioma phenotype and is associated with poor prognosis, supporting its potential as a prognostic biomarker and a target for immunomodulatory strategies.

OLFM4
Also flagged:polycythemia veramyeloproliferative neoplasmerythrocytosisleukocytosisthrombocytosisendothelial dysfunction
Journal Article 2026-05-20 ✓ 2 Snippets Alruwetei AM.
In-Text Gene Mentions

…CAMP , andOLFM4), cytokines, chemokines…

…il-associated effectors (e.g.,OLFM4and MMP9 ),…

Show Full Abstract

Polycythemia vera (PV) is a JAK2V617F-driven myeloproliferative neoplasm characterized by erythroid expansion, increased thrombotic risk, and heterogeneous clinical outcomes. Although prior studies have described key transcriptional abnormalities-including Janus kinase-signal transducer and activator of transcription (JAK-STAT) hyperactivation and chronic myeloinflammation-most have examined single hematopoietic compartments. A multi-compartment approach may reveal conserved and lineage-specific disease-associated transcriptional programs. Here, an integrated, multi-compartment transcriptomic analysis of publicly available microarray datasets was performed, spanning bone marrow (BM) CD34+ progenitors, peripheral blood (PB) CD34+ progenitors, and whole blood from PV patients and healthy controls, with independent validation in neutrophils. Differential gene expression, pathway enrichment, and protein-protein interaction network analyses were used to delineate conserved versus compartment-specific transcriptional programs and to evaluate persistence of progenitor-derived signatures into mature myeloid cells. Across compartments, PV demonstrated consistent enrichment of inflammatory, interferon, and JAK-STAT-associated pathways despite limited overlap at the individual gene level, indicating that core disease processes are maintained through lineage- and differentiation-stage-specific transcriptional reprogramming. Network analysis identified highly connected hub genes, which were used to derive a single-sample gene set enrichment (ssGSEA) signature. This signature showed strong diagnostic performance across cohorts; remained enriched in PV neutrophils; and correlated with platelet count, indolent disease status, and reduced levels in post-splenectomy patients. Together, these findings support a model in which PV is driven by stable, progenitor-derived inflammatory programs that persist across myeloid differentiation while incorporating compartment-specific adaptations, and highlight the value of multi-compartment, network-based approaches for translational biomarker development.

Also flagged:ADdementianeurodegenerative disorderagingpathogenesisneurodegenerative diseases
Journal Article 2026-05-20 No Snippets Song H, Yang M, Wu S, Dai Q, Qin W, Xie W, Chen Y, Jiang X, Zhang X, Deng X, Ouyang C, Zhang Y, Liu X, Zhu Y, Huang G.
Show Full Abstract

Andrographolide (AP), a diterpenoid extracted from <i>Andrographis paniculata</i>, has emerged as a promising treatment for Alzheimer's disease (AD) in preclinical studies, but the underlying mechanisms remain incompletely defined. Here, we demonstrated that AP treatment improved cognition performance and reduced amyloid-β (Aβ) plaque accumulation in 5×FAD transgenic mice of both sexes, by mitigating microglial senescence. Proteomic analysis revealed that AP markedly decreased cholesterol content in the cerebral cortex. Using an <i>in vitro</i> low-density lipoprotein-induced senescence model, we found that AP significantly alleviated senescence in BV2 microglia while enhancing their phagocytic capacity. Mechanistically, AP mitigated microglial senescence by inhibiting STAT3 signaling. Overall, these findings identify a previously unrecognized immunometabolic mechanism for AP in the treatment of AD.

DCC
Also flagged:synapsesMajor depressive disordertranslationalnucleusbehavioralaffective disorders
Journal Article 2026-05-20 ✓ 5 Snippets Mahmud A, Karaman MA.
In-Text Gene Mentions

…cue receptor geneDcc(deleted in colorectal…

…Notably,DCC receptorsreceptors influence stress…

…role of PFCDCC receptorsreceptors following chronic…

…susceptibility, given thatDCCsignaling mediates sex…

…LINC00473 andDCC receptorsreceptors may interact…

Show Full Abstract

Major depressive disorder (MDD) is a multifactorial, circuit-level disorder often triggered by chronic stress, which fundamentally disrupts the neural networks governing reward processing. Central to this pathology is the prefrontal cortex (PFC), an integration hub exerting top-down executive control over subcortical regions. Here, we synthesize translational and preclinical evidence detailing how chronic stress induces structural, functional, and molecular maladaptations within the PFC and its reward-related downstream projections. By dissecting specific neural pathways-including the PFC's connections to the nucleus accumbens (NAc), ventral tegmental area (VTA), ventral hippocampus (vHIPP), and lateral habenula (LHb)- we map how projection-specific dysregulation drives distinct depressive phenotypes. Furthermore, we examine the cellular mechanisms underlying these circuit alterations, emphasizing the roles of disrupted neuromodulation (dopamine, glutamate, and serotonin), impaired synaptic plasticity, and robust neuroinflammatory cascades. We highlight notable sex-dependent findings where relevant, illustrating how specific transcriptomic, morphological, and circuit-level responses can diverge between males and females. Finally, we discuss the necessity of moving beyond simplistic behavioral dichotomies and integrating multimodal neurobiological approaches. Ultimately, delineating these precise, circuit-specific vulnerabilities provides a critical framework for developing targeted therapeutics for stress-induced affective disorders.

Also flagged:bindingorganizationgene expressionIRnucleuscytoplasm
Journal Article 2026-05-20 No Snippets Faretra L, Napolitano F, Pancione M, Cerulo L.
Show Full Abstract

Alternative splicing enables the production of multiple transcripts from a single gene. Among its major forms, intron retention is particularly well characterised in plants, but with ample evidence also in animals. While most introns are constitutively spliced to ensure efficient removal from protein-coding gene transcripts, a subset exhibits an intrinsic sequence-level predisposition to be selectively retained under specific cellular or environmental conditions. However, the synergistic interplay of sequence features that creates this intrinsic predisposition remains only partially understood. Here, we present an exploratory, sequence-centric analysis of intron retention in the human genome. We systematically extract exon-intron-exon units from high-confidence transcript annotations and characterize each event using a broad set of sequence-derived features, including intron and exon architecture, splice site strength, nucleotide composition, transposable element content, and RNA-binding protein (RBP) binding patterns. Using integrative Random Forest and LASSO frameworks, we evaluate both the individual and joint discriminative power of these features. Our results show that intrinsic predisposition to intron retention cannot be explained by any single determinant, but instead emerges from the synergistic interplay of multiple factors. Intron length and GC content represent dominant predictors, while splice site strength, specific transposable element families, and structured RBP binding signatures provide additional explanatory power. Notably, RBP-derived features alone retain substantial predictive capacity, highlighting the importance of regulatory signal organization beyond basic sequence composition. Overall, this study provides a unified view of the sequence-level determinants underlying intron retention in humans and establishes a scalable computational framework for a deeper understanding of post-transcriptional gene regulation and its potential dysregulation.

Also flagged:membranesmembranesignal transductionextracellularlymetabolismlipid droplets
Journal Article 2026-05-20 No Snippets Wang KM, Shang XY, Shi XG.
Show Full Abstract

Lysophosphatidylethanolamine (LysoPE) is a key class of lysophospholipid molecules that play important roles in regulating cell membrane structure, signal transduction, and metabolic regulation. This review consolidates current knowledge on LysoPE's molecular mechanisms, including its biosynthesis, membrane dynamics, and signaling via GPCRs, MAPK, and PI3K/AKT pathways. We critically analyze its context-dependent roles across major disease categories. In metabolic diseases, abnormal LysoPE levels are associated with lipid accumulation and insulin resistance. In the nervous system, LysoPE contributes to neuroinflammation while also exerting neurotrophic and protective effects through MAPK signaling. In tumor progression, LysoPE exhibits tissue-specific pro-migratory or inhibitory effects. LysoPE also shows pathological relevance in cardiovascular diseases, infections, and immune abnormalities. Based on disease-specific expression changes, LysoPE has shown promise as a candidate diagnostic biomarker in preliminary studies, with demonstrated value in treatment efficacy evaluation and prognosis prediction. However, large-scale prospective validation is required before clinical application. Future research should integrate multi-omics technologies and clinical validation to further elucidate its molecular mechanisms and promote its application in precision medicine.

Also flagged:neurological disordersParkinson's diseaseAlzheimer's diseasesdeathAlzheimer's diseaseHuntington's disease
Journal Article 2026-05-20 No Snippets Obafemi BA, Barbosa NV, Aschner M, Adedara IA, Rocha JBT.
Show Full Abstract

Despite currently available drugs for neurological disorders, the incidence of these diseases continues to rise with attendant morbidity, mortality and economic losses. The available treatments oftentimes focus more on either slowing down disease progression or ameliorating symptoms. According to the World Health Organization, some of these disorders, including Parkinson's disease and Alzheimer's diseases are among the leading causes of death globally. Identification of new compounds with neuroprotective properties is a fascinating line of research. Berberine, a plant-derived bioactive compound, of the alkaloid family, has been studied extensively for its neuroprotective properties in a wide range of models of neurological disorders such as Alzheimer's disease, Parkinson's disease, Huntington's disease, autism spectrum disorders, traumatic brain injuries and amyloid lateral sclerosis. Studies have shown that the neuroprotective property of berberine is linked to its ability to modulate several critical biochemical pathways and to regulate the concentrations and activities of important biomarkers that are both diagnostic and therapeutic targets for neurological disorders. This chapter provides insight into the biosynthesis, pharmacokinetics and neuroprotective mechanisms of berberine. Furthermore, ways to improve the utilization of berberine for its neuroprotective potentials such as combining it with other compounds or nanoparticle delivery are highlighted.

Also flagged:neurodegenerative diseasespathogenesismetabolismADPDAmyotrophic Lateral Sclerosis
Journal Article 2026-05-20 No Snippets Wang Z, Li L, Dong Y, Zhang Y.
Show Full Abstract

The pathogenesis of neurodegenerative diseases (NDDs) such as Alzheimer's disease (AD) and Parkinson's disease (PD) is very complex. Recent studies have shown that gut microbiota and their metabolites play a key role in the progression of these diseases. Tryptophan (Trp) is an essential amino acid, which mainly produces a variety of biologically active compounds in the intestine through the metabolism of indole pathway, Kynurenine pathway (KP) and serotonin pathway, including indole derivatives, Kynurenine (KYN) and serotonin (5-HT). These metabolites affect the central nervous system (CNS) through the Microbiota-gut-brain axis (MGBA) and affect CNS in a variety of mechanisms, including immune regulation, neuroprotection and maintenance of intestinal barrier function. They are involved in key pathological processes such as neuroinflammation, oxidative stress and pathological protein aggregation. This paper systematically reviews the mechanism of the role of Trp metabolites derived from gut microbiota in NDDs, and explores their specific roles in AD, PD, Amyotrophic Lateral Sclerosis (ALS) and Huntington's disease (HD), and summarizes the potential therapeutic value of the current pathway strategy. These strategies include nutritional intervention, targeted microbiome therapy [such as probiotic and fecal microbiota transplantation (FMT)], and metabolite-derived drugs. Future research must clarify its dynamic mechanism in the human body, develop relevant biomarkers, and promote personalized prevention and treatment strategies through clinical transformation, so as to provide a new direction for early intervention and treatment of NDDs.

Also flagged:cognitionbehavioralsynthesisanxiety
Journal Article 2026-05-20 No Snippets Dong Y, Lin S, Huang X.
Show Full Abstract

<h4>Background and objective</h4>Guided by career construction theory, this study investigated the association between career exploration and subjective well-being among university students, with a focus on the roles of career adaptability and perceived control.<h4>Methods</h4>A convenience sample of 817 students participated in an online survey, and all constructs were measured using validated instruments, including the Career Exploration Behavior Scale, Career Adapt-Abilities Scale, Happiness Index Scale, and Sense of Control Scale.<h4>Results</h4>Results from structural equation modeling indicated that career exploration was positively associated with subjective well-being, and that career adaptability partially mediated this relationship. In addition, perceived control moderated the association between career exploration and career adaptability, with a stronger link observed among students reporting higher levels of perceived control.<h4>Conclusion</h4>These findings underscore the relevance of promoting career exploration, enhancing career adaptability, and supporting perceived control to foster students' subjective well-being, offering both theoretical reinforcement for career construction theory and practical insights for career development initiatives in higher education.

SOX6
Also flagged:cancerlung cancerliver canceroesophageal cancergene expressioncell proliferation
Journal Article 2026-05-20 ✓ 1 Snippet Zhang M, Ma YR, Chen XY, Sun TS, Wang XY, Wang BB, Wang FH.
In-Text Gene Mentions

…transcription factor 6 (Sox6), thereby providing a…

Show Full Abstract

MicroRNA-17(miR-17) is a prototypical oncogenic miRNA that plays a central driving role in the initiation and progression of various malignant tumours (MT), including lymphoma, lung cancer, colorectal cancer (CRC), and breast cancer (BC). It inhibits the activation of apoptosis pathways and promotes the G1/S phase transition by targeting tumor suppressor genes and cell cycle regulators, thereby driving the unlimited proliferation of tumor cells. Concurrently, it targets molecules associated with epithelial-mesenchymal transition (EMT), activating key signalling pathways, such as Phosphatidylinositol 3-Kinase/Protein Kinase B (PI3K/AKT) and Wnt/Beta-catenin(Wnt/β-catenin) to enhance the invasiveness and migration capabilities of tumour cells. Moreover, miR-17 participates in a cross-regulatory network of non- coding RNAs(ncRNAs), acting both as a molecular sponge to sequester long non-coding RNAs(lncRNAs) and circular RNAs(circRNAs), and as a regulator of the stability or biogenesis of these ncRNAs.This further amplifies oncogenic effects, induces tumor cell resistance to chemotherapy and radiotherapy, and ultimately synergistically promotes tumor angiogenesis, thereby remodeling the tumor microenvironment(TME). In clinical applications, miR-17 holds potential for early cancer diagnosis, particularly serving as a non-invasive biomarker in lung and Gastric cancers (GC). As a therapeutic target, restoring miR-17 expression via targeted interventions enhances. The efficacy of chemotherapy or targeted therapy thereby improves patient prognosis. Despite extensive research in this field, the precise mechanism of action for miR-17 remains incompletely understood. This review summarizes the current state of research concerning the relationship between miR-17 and its target genes in MT, as well as the underlying mechanisms involved.

Also flagged:tumorsynthesisorganellesvesiclesdegradationtumors
Journal Article 2026-05-20 No Snippets Musale S, Jarande S, Nikam A, Pawar R, Kodange NN, Kapare H, Nison M, Pai VR, Aher AA, Datta D, Giram P.
Show Full Abstract

pH-responsive polymers represent a transformative class of smart materials that adapt their physicochemical properties in response to environmental pH changes. This dynamic behavior enables precise control over drug release, tissue interaction, and diagnostic performance, making them highly relevant for advanced healthcare applications. These polymers exploit ionizable functional groups that undergo protonation or deprotonation, triggering conformational changes, solubility shifts, or swelling behavior. Such responsiveness is particularly advantageous in physiological contexts where pH gradients exist, such as the gastrointestinal tract, tumor microenvironments, and intracellular compartments. Recent advances have expanded their utility from simple drug carriers to multifunctional platforms integrating targeting, imaging, and therapeutic functions. Innovations in polymer design, such as block copolymers, hydrogels, and nanostructured assemblies, have improved biocompatibility, tunability, and responsiveness, enabling controlled delivery of small molecules, proteins, and nucleic acids. Furthermore, hybrid systems combining pH-sensitive polymers with inorganic or biological components have opened new avenues for personalized medicine and regenerative therapies. Despite significant progress, challenges remain in achieving predictable <i>in vivo</i> performance, scalable synthesis, and regulatory compliance. This review critically examines the molecular mechanisms, material architectures, and biomedical applications of pH-responsive polymers, highlighting emerging trends and future directions. By bridging chemistry and clinical needs, these adaptive materials are poised to revolutionize therapeutic strategies and diagnostic technologies in modern healthcare.

HFE
Also flagged:Hemolytic SpherocytosisHereditary spherocytosishemolytic anemiasleepanemiaHS type II
Journal Article 2026-05-20 ✓ 4 Snippets Ahn D, Berenberg J.
In-Text Gene Mentions

…from a coexistingHFEvariant under evaluation.…

…from a coexistingHFEvariant.…

…medical genetics forHFEevaluation but was…

…for possible co-inheritedHFEmutations.…

Show Full Abstract

Hereditary spherocytosis (HS) is a common inherited cause of hemolytic anemia and is most often diagnosed in childhood. While the condition does not by itself disqualify affected adults from military service, its autosomal dominant inheritance has important implications for offspring, who may develop more severe disease. We report the case of a 38-year-old active-duty US Army soldier of Saipanese (Chamorro) descent who presented with persistent, unexplained fatigue -- most pronounced during strenuous physical activity -- despite adequate sleep. He had no formal family history of anemia, although one of his three children carries an undiagnosed anemia. Physical examination revealed splenomegaly. Laboratory evaluation demonstrated compensated hemolysis, as evidenced by a low-normal hemoglobin maintained by a reticulocyte response of 9.36%, a normal mean corpuscular volume, an elevated mean corpuscular hemoglobin concentration of 36.7 g/dL -- a characteristic diagnostic feature of HS -- an elevated red cell distribution width, undetectable haptoglobin, and elevated lactate dehydrogenase and indirect bilirubin. The peripheral blood smear was reported by the staff pathologist as a normocytic, normochromic anemia with occasional spherocyte-like forms and mild polychromasia. The patient also demonstrated mild-to-moderate hepatic iron overload despite the absence of transfusions. Genetic testing identified a heterozygous nonsense mutation in the <i>SPTB</i> gene, c.2175G>A (p.Trp725Ter), introducing a premature termination codon within exon 12 and consistent with HS type II. A concurrent pyruvate kinase variant of uncertain significance was also identified. The variant identified in our patient was subsequently deposited in ClinVar by the clinical testing laboratory (Variation ID: 2428713; classified pathogenic) and is absent from gnomAD v4.1.1; to our knowledge, this variant has not previously been described in the published clinical literature. This report provides the clinical and phenotypic characterization of the patient whose testing contributed to that ClinVar submission, and highlights the value of genetic evaluation in adults with unexplained hemolysis, particularly when the offspring is also affected.

HTT
Also flagged:ribosomesendoplasmic reticulummembraneN-glycosylationprotein synthesisbinding
Journal Article 2026-05-20 ✓ 1 Snippet Kennemer B, Balthazor JR.
In-Text Gene Mentions

…silence mutant Huntingtin (HTT) proteins in a…

Show Full Abstract

Three genes found in the Unfolded protein response, Ribophorin 1, Eukaryotic translation initiation factor 2 beta and peptidylprolyl isomerase a are thought to be potential targets for RNA interference (RNAi) in <i>Acyrthosiphon pisum</i>. Ribophorin 1 (RPN1) is a transmembrane glycoprotein that assists in anchoring ribosomes to the rough endoplasmic reticulum membrane. It acts as a substrate specific chaperone. It facilitates N-glycosylation by delivering newly synthesized proteins to the Oligosaccharyl Transferase (OST) complex. Eukaryotic translation Initiation Factor 2 Beta (eIF2B) is a key component of the eIF2 heterotrimer that facilitates protein synthesis initiation by binding GTP and recruiting a specific transfer RNA to the 40S ribosome. The RNA it recruits is tRNAiMet, which delivers the first methionine to the ribosome to start protein synthesis. eIF2B is part of both the Unfolded Protein Response (UPR) and the Integrated Stress Response (ISR). Peptidylprolyl Isomerase A (PPIA) is also known as Cyclophilin A (CypA). CypA is a molecular chaperone that catalyzes the cis-trans isomerization of peptide bonds, which facilitates protein folding and maturation during stressful conditions. Previous studies confirm that RNAi can affect the lifespan and fecundity of pea aphids. The objective of this study was to determine whether the selected genes would also affect the lifespan of pea aphids. Decreasing concentrations of double-stranded Ribo Nucleic Acid (dsRNA) were fed to the aphids to test the effects of each chosen gene. The experiment's objective is to identify the effects of each dsRNA knockdown on the aphids. Higher concentrations had a greater effect on decreasing aphid survival. RPN1 and CypA reduced aphid survival only at the highest concentration tested. eIF2B showed a greater effect on aphid survival at lower concentrations than the other genes tested. It was effective at decreasing survival at a concentration of 100 ng/mL. The result of this study agrees with previous studies that aphid survival can be affected by the introduction of dsRNAs.

bioRxiv 2026-05-20 Preprint (No Snippets API) Bai Y, Xia H, Wu F, Tan X, Wu X.
Show Full Abstract

<h4>Background</h4> The Netrin-1 dependence receptor pathway plays critical roles in neural development, but its expression landscape and prognostic significance in glioblastoma (GBM) remain poorly characterized. <h4>Methods</h4> Single-cell RNA-seq data from 148,019 cells across 34 tumors (Neftel et al., 2019) were analyzed to map Netrin-1 pathway gene expression across GBM cellular states. Differential gene expression and pathway enrichment analyses were performed on NEO1-defined subpopulations. Bulk RNA-seq survival analysis was conducted across three independent GBM cohorts TCGA (n=106), CGGA mRNAseq_325 (n=137), and CGGA mRNAseq_693 (n=237), totaling 480 patients. Primary analysis used continuous Cox regression (per-SD hazard ratios); meta-analysis employed fixed-effects inverse-variance weighting. <h4>Results</h4> In GBM single-cell data, Netrin-1 pathway genes showed state-specific enrichment —NEO1, DCC, NTN1, and RGMB were predominantly expressed in oligodendrocyte-precursor (OPC) and neural-progenitor (NPC) states. Cells positive for NEO1 were enriched for neural differentiation programs (nervous system development, p=9.6×10⁻⁴; Axon Guidance, p=2.8×10⁻⁷), whereas NEO1-negative cells were dominated by ribosomal/translational and immune activation programs. In the 3-cohort survival meta-analysis, NTN1 (Netrin-1 ligand) emerged as the sole gene reaching meta-analytic significance as a risk factor (Meta HR=1.163 per SD, 95% CI 1.056–1.281, p=0.0021, I²=0%, 3/3 cohorts concordant), while DCC and RGMB showed directionally consistent protective trends (DCC: Meta HR=0.938, 95% CI 0.858–1.025, p=0.156; RGMB: Meta HR=0.979, 95% CI 0.881–1.087, p=0.686; both 3/3 cohorts concordant). NEO1 itself did not independently predict survival (Meta HR=1.008, 95% CI 0.885–1.147, p=0.910). After Bonferroni correction for 10 genes tested (threshold p<0.005), only NTN1 met strict significance. In exploratory sex-stratified analysis of a single cohort (CGGA 693, n=237), NEO1 and NTN1 exhibited female-specific risk enhancement (NEO1: HR=1.417, p=0.014; NTN1: HR=1.249, p=0.019), with minimal effects in males. UNC5B showed context-dependent risk in MGMT-unmethylated tumors (HR=1.331, p=0.037). These sex-dimorphic findings require independent validation. <h4>Conclusions</h4> The Netrin-1 pathway exhibits divergent prognostic trends in GBM, with NTN1 as a risk factor and DCC trending toward protection—consistent with the dependence receptor model. These findings, which should be interpreted as hypothesis-generating, nominate NTN1 as a candidate therapeutic target and highlight the potential importance of sex-stratified evaluation in future Netrin-1-directed trials. Independent replication in larger cohorts is warranted.

bioRxiv 2026-05-20 Preprint (No Snippets API) Sathe A, Meka R, Geier B, Long R, Wong C, Wichmann IA, Han S, Shen J, Amieva MR, Ji HP, Huang RJ.
Show Full Abstract

<h4>ABSTRACT</h4> Patients with gastric intestinal metaplasia ( GIM ), a precancerous lesion, are at high risk for progressing to gastric cancer. Identifying these patients is critical to enable gastric cancer interception. Current approaches rely primarily on histologic evaluation of GIM severity and extent, which may be improved by incorporating molecular features that distinguish high-risk lesions. Our prior single-cell and spatial transcriptomics study identified differentially expressed genes associated with the highest-risk category of GIM. They included ANPEP expressed in enterocytes and CPS1 and OLFM4 expressed in intestinal stem-like or progenitor cells. We evaluated the protein expression and localization of these three markers to understand the cellular features associated with GIM risk and their spatial distribution within metaplastic tissues. Using multiplex immunofluorescence, whole slide image analysis and confocal microscopy, we examined protein expression from 100 tissue biopsies annotated for metaplasia severity using the Operative Link on Gastric Intestinal Metaplasia Assessment ( OLGIM ) system. Tissue samples included control gastric tissue, GIM, dysplasia and adenocarcinoma. Quantitative whole slide image analysis demonstrated that CPS1 expression had a modest association with disease severity. Although ANPEP was strongly associated with GIM severity, it was also frequently expressed in stromal regions outside epithelial glands. In contrast, OLFM4 expression was largely restricted to epithelial glands and showed a strong association with increased OLGIM severity. These OLFM4-positive epithelial cells were present in discrete glandular foci that expanded with increasing severity of metaplasia. Within individual metaplastic glands, OLFM4 expression was highest at the gland base with decreased expression toward the gland surface. Overall, these findings identified OLFM4 as a protein marker associated with high-risk GIM. The spatial organization of OLFM4-expressing cells at the base of metaplastic glands and their focal expansion within tissues suggest the presence of a stem cell-like epithelial compartment that may contribute to the progression of GIM towards gastric cancer.

DNAH10
Also flagged:male infertilityinfertilityoligoasthenoteratospermiamitochondrial sheathsflagellumspermiogenesis
Journal Article 2026-05-19 ✓ 1 Snippet Yang F, Meng S, Lu W, Su J, Li G, Ge T, Zhao Y, Whelan EC, Yuan L, Yang Y, Zhang F, Cheng X, Shi A, Zhao Y, Fang X, Niu C, Zheng Y.
In-Text Gene Mentions

…The IDA componentDNAH10was remarkably reduced…

Show Full Abstract

Multiple morphological abnormalities of the sperm flagella (MMAF) is a major cause of male infertility, but identified gene variants can only explain about 60% of clinical cases. Here, dynein axonemal intermediate chain 4 (DNAI4) is identified as an essential regulator of sperm flagellum morphogenesis. RT-PCR and western blot analyses indicate that expression of DNAI4 is enriched in murine testes. Dnai4 deletion in mice causes male-specific infertility due to oligoasthenoteratospermia with MMAF. Electron microscopy analyses revealed that DNAI4 deficiency resulted in an abnormal ultrastructure of sperm flagella, including disorganized mitochondrial sheaths, outer dense fibers and '9+2' axonemes, and missing inner dynein arms (IDA) and outer dynein arms. The IDA component DNAH10 was remarkably reduced in testes and sperm tails of Dnai4 knockout mice. Immunoprecipitation demonstrated an interaction between DNAI4 and the intraflagellar transport protein IFT144 within the testes. Other IFT-A members, including IFT140, IFT122 and IFT121, were downregulated in sperm tails following Dnai4 deletion. Taken together, these findings establish DNAI4 as an essential regulator of sperm flagellum assembly and mammalian spermiogenesis, operating through the regulation of IDA assembly and retrograde intraflagellar transport.

HTT
Also flagged:psychiatric disordersADPDschizophreniadepressionpathogenesis
Journal Article 2026-05-19 ✓ 5 Snippets Luo M, Zhao FK, Wang YM, Bian J, Luo Y.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, which results…

…cellular functions andbrain atrophy HTTatrophy HTT-lowering (ASO/siRN…

…mutation in theHTTgene located on…

…mechanism of acceleratingHttclearance was through…

…transport of ubiquitinatedHttto the proteasome…

Show Full Abstract

Nanomaterials have demonstrated substantial promise in the diagnosis and treatment of neurological and psychiatric disorders, offering novel strategies to overcome the limitations of traditional therapies. This review utilizes bibliometric analysis to evaluate global trends in nanomaterial research for neurological and psychiatric diseases, based on a corpus of 3,987 publications retrieved from the Web of Science Core Collection spanning from 1997 to August 2025. The analysis reveals a consistent upward trajectory in annual publications, reflecting substantial and growing international interest across diverse regions. Following an overview of global research dynamics, this review explores the pathogenesis of neurological and psychiatric disorders, such as Alzheimer's disease, Parkinson's disease, depression, and schizophrenia. The mechanisms underlying these conditions, including neuroinflammation, oxidative stress, protein aggregation, and neurotransmitter imbalances, are systematically discussed. Subsequently, the review focuses on how nanomaterials, including nanoparticles, nanocomposites, and nanocarriers, target these pathogenic mechanisms. The therapeutic applications of nanomaterials are evaluated with respect to their ability to modulate neuroinflammation, reduce oxidative stress, improve drug delivery to the brain, and facilitate the repair of neuronal damage. Despite the promising potential of nanomaterials, several challenges remain, including biocompatibility, targeted delivery, and scalability of treatment options. The review concludes by highlighting future directions for research, emphasizing the need for continued innovation in nanomaterial design and application to address these challenges and advance clinical treatments for neurological and psychiatric disorders.

DCC
Also flagged:epithelial neoplasm of the pancreastumorPanNECPanNETgene expressionpancreatic neuroendocrine neoplasm
Journal Article 2026-05-19 ✓ 1 Snippet Guo S, Shi X, Yin X, Gao S, Li B, Wang H, Li Y, Wang B, Xu X, Zheng K, Song B, Jing W, Song C, Jin G.
In-Text Gene Mentions

…Colorectal Carcinoma (DCC), and DAXX…

Show Full Abstract

<h4>Background</h4>Pancreatic neuroendocrine neoplasm (PanNEN) represents the second most common epithelial neoplasm of the pancreas, characterized by remarkable heterogeneity among its subtypes. This study aimed to comprehensively characterize the molecular landscape of PanNENs and identify key features associated with tumor progression and therapeutic implications.<h4>Results</h4>We performed an integrated molecular analysis of 106 PanNEN samples using whole-genome sequencing, whole-exome sequencing, and transcriptome sequencing. PanNEC demonstrated significantly higher mutation burden compared to PanNET, with recurrent mutations in KRAS and TP53. In metastatic PanNET, structural variation rearrangement signatures (RS) emerged as crucial molecular events affecting tumor-related gene expression. Copy number variation (CNV) analysis revealed four distinct PanNET subgroups: chromosomal-scale loss of heterozygosity (LOH), limited CNV events, whole-genome duplication (WGD), and WGD with chromosomal-scale LOH. We proposed a novel evolutionary model for PanNET based on CNV patterns, validated through transcriptomic analysis and clinical sampling. WGD was identified as a pivotal event in PanNET progression, significantly enhancing tumor aggressiveness. Transcriptomic profiling revealed distinct immune signatures associated with RS subtypes and WGD status, with the RS2 subtype showing a particularly favorable immune profile suggesting potential immunotherapy responsiveness.<h4>Conclusions</h4>In summary, our systematic genomic and transcriptomic analyses revealed distinct biological features among PanNEN subtypes and identified a novel CNV-based evolutionary trajectory in PanNET. We demonstrated that structural variation and whole-genome duplication were critical events driving PanNET progression, providing new insights into PanNET biology with potential clinical implications.

PRDX6
Also flagged:O-GlcNAcylationN-Glycosylation-glycosylationmodificationsdigestionelectron-transfer
Journal Article 2026-05-19 ✓ 4 Snippets Fu L, Yin K, Xu X, Wu R.
In-Text Gene Mentions

PRDX6is a bifunctional…

PRDX6deficiency induces ER…

…and cells lackingPRDX6exhibit heightened sensitivity…

…antioxidant capacity ofPRDX6as part of…

Show Full Abstract

Both protein O-GlcNAcylation and N-glycosylation are extremely important in human cells and regulate many cellular events. While O-GlcNAcylation is known to act as a stress sensor, its changes in human cells with N-glycosylation perturbations remain to be explored. In this study, we comprehensively and site-specifically studied common and cell-type-specific responses of protein O-GlcNAcylation under N-glycosylation inhibition in three types of human cells (HEK293T, HepG2, and Jurkat cells) by integrating metabolic labeling, bio-orthogonal chemistry, and multiplexed proteomics. In total, more than 1000 O-GlcNAcylated proteins were identified and quantified, and the results demonstrate that under the inhibition of protein N-glycosylation, O-GlcNAcylated proteins related to stress response and translation are commonly changed in different types of cells. Furthermore, O-GlcNAcylation changes are cell-type-specific, and O-GlcNAcylated proteins related to leukocyte proliferation and T-cell activation were upregulated in Jurkat cells, while in HEK293T cells, those associated with ribonucleotide metabolism and ribosome biogenesis were upregulated. Site-specific analysis revealed that O-GlcNAcylation sites in structured regions exhibited larger abundance changes compared with those in intrinsically disordered regions. This study provides valuable insights into the regulation of protein O-GlcNAcylation in human cells under N-glycosylation inhibition, advancing our understanding of protein glycosylation.

Also flagged:aginglocalizationdegradationpore
Journal Article 2026-05-19 No Snippets Yang C, Chen Y, Tang C, Lan S, Tan J, Ye H, Chen H, Yao Z, Eckert J, Zhang D, Jiang JZ.
Show Full Abstract

Amorphous alloys are considered promising structural and engineering materials owing to exceptional properties such as high strength/hardness and large elastic limit resulted from disordered atomic structures. However, the intrinsic brittleness and lack of work-hardening severely restrict their widespread application in structural fields. To address these limitations, rejuvenation strategies have recently been proposed and rapidly developed. These approaches can be broadly categorized into mechanical processing, thermal rejuvenation, and alternative techniques. Rejuvenation not only can be applied to a wide range of alloy compositions including martensitic metallic glass, but also retains alloys disordered amorphous structures. Nevertheless, each route still faces unresolved engineering challenges. While enhanced plasticity and strain-hardening have been reported in rejuvenated glassy alloys, issues such as premature mechanical failure and the competition and transition between aging and rejuvenation are frequently observed. The transition from brittle to ductile behavior as well as variations in mechanical performance has been closely linked to microstructural features, particularly atomic clusters. Therefore, a thorough understanding of the relationship among rejuvenation processes, microstructural evolution, and mechanical properties is essential. This work aims to provide a comprehensive and critical review of the current progress in this field.

Also flagged:FerroptosisUlcerative ColitisPathogenesisdeathmetabolismInflammatory bowel disease
Journal Article 2026-05-19 No Snippets Zhao ZQ, Yu ZX, Liu ZQ, Yu T, Fan H.
Show Full Abstract

The ferroptosis of intestinal epithelial cells (IECs), an iron-dependent form of cell death driven by lipid peroxidation, has emerged as a critical pathogenic driver of ulcerative colitis (UC). This review summarizes the core hallmarks of IEC ferroptosis in UC-specifically, lipid peroxidation, iron overload, and antioxidant system dysregulation-and describes key regulatory signaling networks, including the Nrf2/HO-1, SLC7A11/GPX4, and AMPK/mTOR pathways. Furthermore, we systematically evaluated emerging therapeutic strategies targeting these mechanisms, categorized into antioxidant activation, iron and lipid metabolism regulation, immune and microbiota modulation, and multitarget interventions. Elucidating this complex ferroptotic regulatory network provides a vital theoretical foundation for the development of novel disease-stage-specific therapeutic paradigms for UC management.

DCC
Also flagged:lung cancerISGylationcancerUbiquitinationmodificationsignal transduction
Journal Article 2026-05-19 ✓ 2 Snippets Ogunlade BO, Dalby KN, Okpechi SC, Cho EJ, Tyutyunyk-Massey L, Chen Z, Liu X, Ivanic J, Luke B, Desai SD, Alfaro Y, Devkota AK, Sammons RM, Privé GG, Liu X, Dmitrovsky E.
In-Text Gene Mentions

…primer (Hs01117527_g1); humanDCCprimer (Hs00180437_m1); human…

…reduced (NR4A2, ENTPD1,DCC, and USP41) or…

Show Full Abstract

Ubiquitin-Specific Protease 18 (USP18) is a deISGylation enzyme and antineoplastic target. To develop USP18 inhibitors, an enzymatically active human recombinant USP18 protein was engineered suitable for high-throughput screening of ~80,000 chemical compounds. Three of them substantially inhibited USP18 enzymatic activity, with β-lapachone having prominent antineoplastic activity. Independent β-lapachone treatments of murine and human lung cancer cell lines statistically significantly reduced proliferation and increased apoptosis. Gain of USP18 expression antagonized these effects. β-Lapachone treatments statistically significantly repressed lung cancer xenograft growth. β-Lapachone increased reactive oxygen species (ROS), but antineoplastic effects occurred at dosages with negligible ROS production. ROS scavenger treatments did not rescue β-lapachone effects at these concentrations, consistent with an ROS-independent mechanism. IFN-Stimulated Response Element (ISRE) reporter assays following β-lapachone treatment activated this reporter. USP18 cotransfection antagonized this activity. β-Lapachone treatments increased global ISGylation. RNA-seq of lung cancer cells engineered with or without enhanced USP18 expression showed specific pathways affected by β-lapachone treatment. Proteomic analysis of these treated cells revealed known and new ISGylated proteins. In silico modeling identified a unique USP18 pocket where these USP18 inhibitors bind. Engineered mutation of this pocket disrupted β-lapachone activity. Taken together, β-lapachone is an antineoplastic tool compound useful for USP18 inhibitor development.

BTN2A1
Also flagged:childhood-onset hereditary spastic paraplegiadegenerative neurological diseaselocalizationGolgimovement disorderneurological diseases
Journal Article 2026-05-19 ✓ 1 Snippet Ziegler M, Günter C, Alecu JE, Xue X, Kim HM, Saffari A, Davies AK, Sahin M, Ebrahimi-Fakhari D.
In-Text Gene Mentions

…3 genes —BTN2A1, EMILIN1 ,…

Show Full Abstract

Biallelic loss-of-function variants in adaptor protein complex 4 (AP-4) disrupt trafficking of transmembrane proteins at the trans-Golgi network, including autophagy-related protein 9A (ATG9A), leading to childhood-onset hereditary spastic paraplegia (AP-4-HSP). AP-4-HSP is characterized by features of both a neurodevelopmental and a degenerative neurological disease. To investigate the molecular mechanisms underlying AP-4-HSP and identify potential therapeutic targets, we conducted an arrayed CRISPR/Cas9 loss-of-function screen of 8,478 genes, targeting the "druggable genome," in a human neuronal model of AP-4 deficiency. Through this phenotypic screen and subsequent experiments, key modulators of ATG9A trafficking were identified, and complementary pathway analyses provided insights into the regulatory landscape of ATG9A transport. Knockdown of ANPEP and NPM1 enhanced ATG9A availability outside the trans-Golgi network, suggesting that they regulate ATG9A localization. These findings deepen our understanding of ATG9A trafficking in the context of AP-4 deficiency and offer a framework for the development of targeted interventions for AP-4-HSP.

Also flagged:arenearylthioetherpropellanesulfonessulfoximines
Journal Article 2026-05-19 No Snippets Wang KJ, Tang L, He HX, Li Y, Yang F, Xiao Y, Xu WL, Zhang W, Wang G, Feng JJ.
Show Full Abstract

While bicyclo[3.1.1]heptanes (BCHeps) and oxa-/aza-BCHeps have emerged as valuable arene bioisosteres, the corresponding thia-analogs remain underdeveloped. Notably, synthetic efforts to access aryl thioether mimetics have focused predominantly on strain-release thiofunctionalization of [1.1.1]propellane or [3.1.1]propellane to access para- and meta-substituted surrogates, whereas three-dimensional analogs of ortho- and 1,2,4-trisubstituted aryl thioethers remain elusive. Herein, we report a one-pot stepwise protocol featuring anti-thio(seleno)sulfonylation/annulation of bicyclo[1.1.0]butanes (BCBs) to enable scalable access to functionalized 2-thiabicyclo[3.1.1]heptanes (thia-BCHeps) under mild conditions. The synthetic utility is further demonstrated by diverse derivatization of these thia-BCHeps building blocks and facile access to bioisosteres of ortho-, meta-, and 1,2,4-trisubstituted aryl thioether derivatives (e.g., aryl sulfones and aryl sulfoximines). DFT calculations revealed that the reaction proceeded via a polar addition pathway, involving nucleophilic attack of cesium methanesulfinate with BCB. The observed diastereoselectivity originates from the stabilization of the anti-addition transition state by a favorable π-π stacking interaction between two phenyl rings. Crystallographic analysis revealed that these thia-BCHeps display geometric properties almost identical to those of ortho-, meta-, and 1,2,4-trisubstituted aryl thioethers. Physicochemical studies and biological evaluation further validated these thia-BCHeps as a new generation of saturated bioisosteres for aryl thioethers.

OLFM4
Also flagged:Lynch syndromecolorectal cancerLSmismatch repairtumoursporadic cancer
Journal Article 2026-05-19 ✓ 1 Snippet Yang H, Dungan M, Madhu B, Beyries K, Wang X, Kilpatrick R, Chen B, Oh S, Berkowitz M, Smith D, Zhou C, Koralov SB, Axelrad J, Lengner CJ, Belle N, Bewtra M, Katona BW, Cadwell K.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Background</h4>Lynch syndrome (LS) is the most common hereditary cause of colorectal cancer (CRC) and results from pathogenic germline variants affecting mismatch repair. The tissue microenvironment that contributes to this elevated risk of CRC is poorly characterised particularly during the early precancerous stages.<h4>Objective</h4>To define features of the colonic microenvironment that distinguish LS carriers with and without a history of CRC from one another and from the general population.<h4>Design</h4>We applied Expanded Cellular Indexing of Transcriptomes and Epitopes by sequencing, a multimodal single-cell platform, to profile tumour-free colonic cellular composition and transcriptome of LS carriers with and without a history of CRC compared with general population controls. We used flow cytometry, histology and mouse modelling to validate key observations.<h4>Results</h4>We observed widespread remodelling in LS that included striking expansion of epithelial stem and progenitor cells, loss of fibroblast populations and changes in lymphocyte subsets. Although clonally expanded and terminally exhausted CD8 T cells were more prominent in individuals with a history of CRC, LS carriers without CRC displayed enrichment of cytotoxic mucosal-associated invariant T (MAIT) cells associated with <i>CCL20</i> expression in epithelial progenitors, validated by orthogonal techniques including demonstration of a protective function in a murine model of CRC.<h4>Conclusions</h4>These findings define key features of the LS colonic microenvironment and suggest that MAIT cell enrichment contributes to immune surveillance against CRC, offering new insights into disease penetrance, risk stratification and prevention.

TNFSF4
Also flagged:tumorangiogenesismelanomacancerTumorsimmune response
Journal Article 2026-05-19 ✓ 2 Snippets Kim DJ, McGinty M, Anandh S, Riedstra C, Sethi Y, Rutkowski MR, Dudley AC.
In-Text Gene Mentions

…Cd40 , andTnfsf4.…

…as Icosl ,Tnfsf4, and Cd40…

Show Full Abstract

The abnormal tumor vasculature can present a barrier to the infiltration of anti-tumor immune cells, which impairs immune surveillance and response to immunotherapy. Here, we show that genetically deleting the epigenetic factor DNA methyltransferase 1 (Dnmt1) in endothelial cells (ECs) reduces angiogenesis while imparting profound changes to the tumor immune microenvironment (TIME), including increased proportions of CD4<sup>+</sup> memory T cells and NK cells. Depleting CD4<sup>+</sup> T cells, or blocking lymphocyte egress from the lymph nodes, rescues tumor growth in mice with conditional deletion of Dnmt1 in ECs (Dnmt1<sup>iECKO</sup>) and dramatically shortens overall survival, whereas NK cells are dispensable. Tumors implanted in Dnmt1<sup>iECKO</sup> mice show reduced vascular branching, elevated expression of VCAM1, increased vessel-associated T cells, and a shift in vascular specification, including increased proportions of immune-permissive post-capillary venules (PCVs) and interferon-stimulated ECs (IFN-ECs). Deleting Dnmt1 in EC cultures strikingly potentiates responses to combinations of IFNγ and TNFα and, notably, up-regulates important T-cell co-stimulatory molecules for memory CD4<sup>+</sup> T cells, including Icosl, Cd40, and Tnfsf4. Finally, immune checkpoint blockade (ICB) administered to Dnmt1<sup>iECKO</sup> mice with experimental melanoma lung metastasis reduces tumor burden, with some mice showing tumor eradication. Our findings identify endothelial Dnmt1 as a key regulator of vascular-mediated anti-tumor immunity, providing a rationale for integrating epigenetic modulation of the vasculature with cancer immunotherapy regimens.

Also flagged:ofarsenicbisphenol A2-ethylhexylphthalatetetrachlorodibenzo-p-dioxin
Journal Article 2026-05-19 No Snippets Kuntala PK, Miao B, Purushotham D, Zhang B, Li D, Wang T.
Show Full Abstract

The Toxicant Exposures and Responses by Genomic and Epigenomic Regulators of Transcription (TaRGET) program is a multiphase program that aims to understand how environmental factors contribute to disease susceptibility using toxicant-exposed mouse models. Here, we present the TaRGET II Data Portal ( https://data.targetepigenomics.org/ ), a comprehensive repository of multi-omics datasets generated from mice exposed to a range of environmental toxicants, including arsenic (As), lead (Pb), bisphenol A (BPA), tributyltin (TBT), di(2-ethylhexyl) phthalate (DEHP), tetrachlorodibenzo-p-dioxin (TCDD), and ambient air pollution (PM2.5). Epigenomic profiling assays capturing alterations in chromatin accessibility, DNA methylation, gene expression, and histone modifications were produced across multiple research centers, subjected to rigorous quality control, and processed using standardized pipelines. The portal currently hosts 3,612 datasets spanning multiple tissues and genomic assays, collected at four developmental and exposure time points: 3, 5, 20, and 40 weeks. The portal offers an efficient way to browse, search, visualize, and download relevant datasets and associated metadata, serving as a key resource for studying the impact of environmental toxicant exposures on disease susceptibility for the broader scientific community.

VRK2
Also flagged:post-translational modificationscancertumorUbiquitinationphosphorylationcell-penetrating
Journal Article 2026-05-19 ✓ 1 Snippet Li KQ, Ding SQ, Lei Y, Bai X, Liu HZ, Zhao ZM, Dai DQ.
In-Text Gene Mentions

…pathway VRK2/GAPDH/ FBXW10VRK2phosphorylates GAPDH (Ser151),…

Show Full Abstract

The tumor microenvironment is dynamically regulated by complex post-translational modifications (PTMs), which play pivotal roles in cancer immunity. Ubiquitination, along with other PTMs such as phosphorylation, glycosylation, and acetylation, orchestrates immune checkpoint activity and immune cell function, shaping antitumor responses. In this review, we discuss the intricate crosstalk and regulatory mechanisms between ubiquitination and other PTMs in cancer immunity. Studies have revealed that the stability and function of immune checkpoint proteins, such as PD-L1, are dynamically regulated by synergistic or competitive modifications, which directly shape the tumor microenvironment's immunological characteristics. We highlight how PTMs regulate immune cell function (e.g., T cells, NK cells, and macrophages) and key signaling pathways (e.g., STAT, type I IFN, and NF-κB) in the TME. Furthermore, we summarize potential therapeutic strategies targeting these PTMs, including small-molecule inhibitors and novel technologies (e.g., PROTACs and cell-penetrating peptides), which offer insights into overcoming immunotherapy resistance and optimizing combination therapies. Future research should explore non-classical PTMs and leverage multi-omics approaches to refine precision immunotherapy strategies.

POU3F2
Also flagged:neurodevelopmental disordersautism spectrum disordersintellectual disabilityofneurological disordersreticular
Journal Article 2026-05-19 ✓ 5 Snippets Chen SY, Pang HY, Fan PW, Wu GY, Lin WT, Liu FC, Kuo HY.
In-Text Gene Mentions

…ontaining transcription factorPOU3F2(Brn2) is a…

…(RRID: SCR_002990 )Pou3f2- RP_090303_03_E04 –…

…study identified thatPOU3F2may positively regulate…

…sufficient to activatePOU3F2by binding to…

…the promoter ofPOU3F2in GABAergic neurons…

Show Full Abstract

Vocal communication is fundamental for social interaction across species, yet the neural mechanisms that shape vocal circuit development remain poorly understood despite their relevance to neurodevelopmental disorders. Here, we investigate vocal circuit development in mice using isolation-induced ultrasonic vocalizations (USVs) in neonates. An activity-tagging approach identifies the ventromedial prefrontal cortex (vmPFC) as a cortical region strongly activated during USV emission. We find a predictable temporal correlation between vmPFC activity and USV emission using in vivo fiber photometry. Selective activation and inhibition of vmPFC neurons establishes a causal role of vmPFC in vocalization. Interestingly, chronic activation of vmPFC neurons not only increases Foxp2, a gene implicated in childhood speech apraxia, but also Vglut1-labeled synapses in the striatum, suggesting that activity-dependent increases in Foxp2 may promote corticostriatal synaptogenesis. Consistent with this finding, neonatal vmPFC activation partially rescues USV deficits in Foxp2 heterozygous mutant mice. Collectively, our results identify the vmPFC-striatal circuit as a key regulator of neonatal vocalization and suggest that Foxp2 may mediate activity-dependent development of vocal circuits.

Also flagged:perianal diseaseneutrophil activationtissue remodelingCDinflammatory diseaseto
Journal Article 2026-05-19 No Snippets Awad A, Huan B, Shanahan MT, Weaver D, Silverstein S, Lau G, Lian G, Furey B, McMichael BD, Arias A, Keith BP, Shumway AJ, Sethupathy P, Furey TS, Sheikh SZ.
Show Full Abstract

Crohn's disease is biologically heterogeneous, and current clinical classifications poorly predict treatment response or disease progression. The molecular programs that drive clinical outcomes in Crohn's disease remain poorly defined. We generated and analyzed whole-transcriptome RNA-sequencing data from non-inflamed colonic biopsies of 101 well-characterized Crohn's disease patients. We performed weighted gene co-expression network analysis and identified 15 transcriptional programs that stratified Crohn's disease independent of conventional clinical classification. We then tested associations between these programs and clinical outcomes, including primary and secondary treatment failure, surgical burden, and perianal disease. A neutrophil activation program enriched for CD69 expression was strongly associated with both primary and secondary treatment failure, identifying a mucosal immune phenotype of therapeutic resistance. A fibro-proliferative program centered on SERPINE1 expression correlated with higher cumulative surgical burden, implicating tissue remodeling pathways in progressive disease. We also discovered an antimicrobial program, marked by elevated DEFA5 and DEFA6, in colonic mucosa; this signature was enriched in patients with treatment failure and validated by DEFA5 immunofluorescence. A distinct program uniquely associated with perianal disease highlights the molecular features of this severe phenotype that are not captured by standard clinical metrics. In conclusion, colonic transcriptional programs identify biologically meaningful disease states in Crohn's disease that associate with treatment failure, surgical risk, and perianal involvement. These findings provide a molecular basis for prognostic biomarkers and targeted therapeutic stratification in Crohn's disease.

SERPINC1
Also flagged:membranecardiac failureacute myocardial infarctiondeathacute kidney injuryDiffuse intravascular coagulation
Journal Article 2026-05-19 ✓ 1 Snippet Huang JB, Wei Z, Huang Z, Tang XG, Zeng DF, Huang KQ, Li J.
In-Text Gene Mentions

…AcquiredATIIIdeficiency in young…

Show Full Abstract

Extracorporeal membrane oxygenation (ECMO) is a technique increasingly used in the practice of intensive therapy for extracorporeal gas exchange and/or circulatory support in patients with acute respiratory and/or cardiac failure, when conventional treatment modalities are ineffective. We aimed to investigate the association of antithrombin III with clinical outcomes in patients with cardiogenic shock caused by acute myocardial infarction undergoing ECMO. We retrospectively studied patients with acute myocardial infarction complicated by cardiogenic shock undergoing ECMO in four hospitals in China. The in-hospital mortality rate was 47.8% (194/406). The antithrombin III at admission of the in-hospital death group (n = 194) and the survival group (n = 212) were 45.70 ± 21.57 and 50.97 ± 25.37%, respectively. In-hospital mortality and acute kidney injury, and serum creatinine in the antithrombin III at admission < 46% group were significantly higher than that in the antithrombin III at admission ≥ 46% group. By univariate and multivariate analysis, serum albumin < 30 g/L, low AT III at admission, and serum lactate were found to be related to in-hospital mortality. Our investigation demonstrated that low antithrombin III at admission was associated with in-hospital in cardiogenic shock secondary to acute myocardial infarction on ECMO, suggesting that antithrombin III may be an indicator of shock severity.

Also flagged:DengueDENV infectionprimary infectioninfectionDENV-4 infectionsmosquito-borne disease
Journal Article 2026-05-19 No Snippets Nguyen NTT, Takemura T, Ihara M, Yamasato K, Kurashige T, Abe H, Tran HT, Vu H, Pham AHQ, Vu HTB, Nguyen LN, Pham HTT, Pham QD, Le TTH, Nguyen TTT, Hoang PVM, Nguyen HLK, Lam TT, Tran TT, Le LT, Vu KH, Chu TH, Ngwe Tun MM, Morita K, Takamatsu Y, Hasebe F, Le MTQ.
Show Full Abstract

Dengue cases are reported annually in Vung Tau province, southern Vietnam; however, data on viral and host factors associated with disease severity are limited, particularly during epidemics driven by specific serotypes. We investigated the prevalence of dengue virus (DENV), its molecular epidemiology, and clinical-laboratory correlates of severity in patients with suspected dengue at Vung Tau General Hospital between September 2020 and May 2021. Among 1435 suspected cases, 639 (44.5%) were classified as DENV infection-negative, 60 (4.2%) presented with primary infection and 736 (51.3%) with secondary infection. DENV serotyping indicated that DENV-4 was the most prevalent serotype (50 patients, 37.6%), followed by DENV-2 (41, 30.8%), DENV-1 (39, 29.3%), and DENV-3 (3, 2.3%). Phylogenetic analysis revealed DENV-1 genotype I, DENV-2 genotype II (cosmopolitan) and genotype V (Asian I), and DENV-4 genotype I. Notably, DENV-4 exhibited two coexisting clades, suggesting that variations in clade distribution may have contributed to the epidemic. Although parameters commonly associated with dengue severity, such as white blood cell counts, platelet counts, and liver enzyme levels (AST and ALT), were comparable across serotypes, hemoglobin and hematocrit levels were elevated in DENV-4 infections compared with other serotypes. This elevation may indicate a higher risk of plasma leakage, a key feature of severe dengue, underscoring the potential clinical significance of DENV-4 during this epidemic. These findings highlight the epidemiological and clinical importance of DENV-4 and provide evidence for refining dengue control strategies in endemic areas.

Also flagged:gastrointestinal stromal tumorsGISTtumorMitophagymitochondrialdeath
Journal Article 2026-05-19 No Snippets Yin Y, Peng J, Huang Z, Li D, Li X, Hong Z, Lin Y, He Y, Wang J.
Show Full Abstract

<h4>Background</h4>Gastrointestinal stromal tumors (GIST) frequently develop secondary resistance to imatinib, which represents a major obstacle to achieving durable clinical benefit. However, the molecular mechanisms underlying acquired resistance remain poorly understood. Nestin, a cytoskeletal protein, has been implicated in tumor progression and cellular stress responses, but its role in imatinib-resistant GIST has not been fully elucidated.<h4>Methods</h4>Patient tumor specimens, imatinib-resistant GIST cell lines, and xenograft mouse models were analyzed to evaluate Nestin expression. Functional studies were performed using RNA interference-mediated silencing of Nestin. Mitophagy flux assays were conducted to evaluate mitochondrial quality control. The effects of Nestin modulation on PINK1 stability, mitophagy activity, mitochondrial integrity, and imatinib sensitivity were evaluated both in vitro and in vivo. Clinical correlations between Nestin expression, therapeutic response, and prognosis were also analyzed.<h4>Results</h4>Nestin expression was significantly upregulated in imatinib-resistant GIST across patient samples, resistant cell lines, and xenograft models. Mechanistically, Nestin stabilized PINK1, thereby enhancing PINK1-dependent mitophagy and preserving mitochondrial integrity under imatinib-induced stress. RNA interference suppression of Nestin reduced PINK1 accumulation, impaired mitophagy, increased mitochondrial damage, and restored imatinib sensitivity in vitro and in vivo. Clinically, elevated Nestin expression was associated with poor therapeutic response and unfavorable prognosis.<h4>Conclusions</h4>The Nestin-PINK1 axis is a critical driver of imatinib resistance in GIST. Targeting Nestin-mediated mitophagy may represent a promising therapeutic strategy to overcome imatinib resistance and improve clinical outcomes in patients with GIST.

DCC
Also flagged:hyperbilirubinemiapostpartum hemorrhageanemiaintraventricular hemorrhageiron deficiency anemiarespiratory distress syndrome
Journal Article 2026-05-19 ✓ 2 Snippets Yang Y, Zhou J, Zhao L, Wang Y, Wen H.
In-Text Gene Mentions

…clinical evidence concerningDCCin twins.…

…Notably,DCCwas associated with…

Show Full Abstract

<h4>Introduction</h4>Compared with early cord clamping (ECC), delayed cord clamping (DCC) facilitates improved placental transfusion and increases blood volume in singleton pregnancies. However, evidence supporting the use of DCC in twins delivered by cesarean section is limited. The objective of this study was to evaluate the impact of DCC versus ECC on both maternal and neonatal outcomes in twin pregnancies delivered through cesarean section.<h4>Methods</h4>We conducted a retrospective cohort study that included 280 twin pregnancies at ≥28 weeks that were delivered by cesarean section. A comparison of maternal bleeding complications and neonatal hemoglobin and hematocrit levels, hyperbilirubinemia, and neonatal morbidity outcomes was conducted between the DCC and ECC groups.<h4>Results</h4>Among the study cohort, 135 (48.2%) twin pregnancies were in the DCC group, while 145 (51.8%) received ECC. The mean reduction in maternal hemoglobin was significantly greater in the DCC group than in the ECC group (DCC 1.0±1.1 g/l vs. ECC 0.7±1.3 g/l, p=0.042). Despite this, there were no significant differences between the two groups in maternal hemoglobin levels on the first postpartum day or in the incidence of maternal bleeding complications, including postpartum hemorrhage (PPH), blood transfusion, and therapeutic hysterectomy. Notably, the DCC group demonstrated significantly higher levels of neonatal admission hemoglobin, hemoglobin on day 3, and hematocrit on day 3. Furthermore, DCC was associated with a substantial reduction in the risk of neonatal anemia (adjusted OR, 0.244 [95% CI: 0.105-0.566, p<0.001) and intraventricular hemorrhage (aOR, 0.488 [95% CI, 0.157-0.628], p=0.006). The DCC group exhibited a significantly higher incidence of hyperbilirubinemia (aOR, 2.735 [95% CI, 1.735-4.310], p<0.001). However, there was no significant difference in the rate of phototherapy between the DCC and ECC groups (aOR, 0.731 [95% CI, 0.449-1.028], p=0.108).<h4>Conclusion</h4>Compared with ECC, DCC did not result in an increased risk of maternal bleeding complications, neonatal mortality or severe adverse neonatal outcomes in twin pregnancies during cesarean delivery. Although DCC elevated neonatal hemoglobin levels and increased the incidence of hyperbilirubinemia, the rate of phototherapy did not increase. Notably, DCC was linked to a significantly reduced risk of neonatal anemia and intraventricular hemorrhage in cesarean-delivered twins.

Also flagged:Invasive lobular carcinomacancerILCdisseminated tumorinvasive ductal carcinomaCarcinoma Dormancy
Journal Article 2026-05-19 No Snippets Rima XY, Majumder S, Patel DS, Hu C, Li H, Huang X, Nguyen KT, Doon-Ralls J, Nagaraj CK, Hade MD, Magaña SM, Shankar E, Zhang X, Stover DG, Ramaswamy B, Reátegui E.
Show Full Abstract

Invasive lobular carcinoma (ILC) accounts for 10-15% of breast cancers. Despite favorable responses to anti-estrogen therapy, the dissemination of cancer cells and resistance to therapies are significant risks for patients with ILC. Late recurrences are prevalent in ILC, suggesting that disseminated tumor cell (DTC) dormancy may be a mechanism preceding their late overt growth into metastatic lesions. Herein, we investigated the relationship between anti-estrogen resistance and dormancy through multidimensional, micro-compartmentalized in vitro models. The bioengineered platforms recapitulated the morphological characteristics of ILC and highlighted its distinction from invasive ductal carcinoma (IDC). Inducing a reversible dormant phenotype revealed epigenetic changes and enhanced chemical and mechanical sensing of anti-estrogen-resistant ILC cells to the substrate surface, with p27<sup>Kip1</sup> signaling playing a central role. We propose this platform as a high-throughput method for investigating ILC dormancy and its manifestation using a simplified, expedited approach.

SERPINC1
Also flagged:Extracellularmonoclonal gammopathy of undetermined significanceMGUSsmolderingmultiple myelomaplasma cell dyscrasias
Journal Article 2026-05-19 ✓ 1 Snippet Frantzi M, Ahangar M, Vlahou A, Mischak H, Solia I, Theodorakakou F, Liacos CI, Zoidakis J, Terpos E, Dimopoulos MA, Kastritis E.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

Multiple myeloma (MM) evolves from monoclonal gammopathy of undetermined significance (MGUS) and smoldering multiple myeloma (SMM) with annual progression rates of 1% and 10%, respectively. Current risk models don't fully capture the underlying dynamic molecular processes. We hypothesized that urinary peptides reflect disease-specific microenvironmental alterations in plasma cell dyscrasias. To test this hypothesis, capillary electrophoresis coupled to mass spectrometry (CE-MS) was applied to profile the urinary peptidome of 314 individuals, including a discovery group (42 MGUS, 27 SMM, 14 MM), an independent validation group (45 MGUS, 9 SMM, 7 MM, 9 with plasmacytoma), 86 without underlying malignancy, and 75 patients with impaired kidney function. One hundred twenty-one peptides were significantly altered between MM and MGUS and displayed a monotonic abundance trend across the MGUS-SMM-MM continuum. These peptides predominantly derived from collagens, beta-2 microglobulin, alpha-1 antitrypsin, and antithrombin-III. Integration of these 121 peptides into a support vector machine classifier achieved an area under the curve of 0.94 (0.85-0.99; 95% CI) in the independent validation cohort, with 100% sensitivity and 82% specificity for MM detection. The finding that urinary peptides enable non-invasive molecular discrimination of MM from precursor states represents a solid basis for a prospective evaluation in prognosis and detection of progression.

Journal Article 2026-05-19 No Snippets Le YH, Hoang HTT, Khong DT, Nguyen TN, Que TA, Pham DT, Duong QH, Pham HB, Mizuno T, Tanaka K, Yamamoto Y.
Show Full Abstract

<h4>Objectives</h4>Foodborne contamination with pathogenic Escherichia coli poses a significant public health concern, particularly in low- and middle-income countries. This study investigated the prevalence, virulence gene profiles, and antimicrobial resistance (AMR) characteristics of eae-positive E. coli in retail chicken meat from Vietnam, with samples from Japan included for comparative analysis.<h4>Methods</h4>A total of 123 retail chicken meat samples (108 from Vietnam and 15 from Japan) were collected. The presence of pathogenic E. coli was evaluated by quantitative detection of virulence genes using real-time PCR targeting DNA extracted from the samples. Antimicrobial susceptibility of E. coli strains was determined by the broth microdilution method. Virulence and AMR genes were characterized by whole-genome sequencing (WGS) of the strains.<h4>Results</h4>The eae gene-a key virulence determinant of enteropathogenic E. coli (EPEC)-was detected in 73.1% (79/108) of Vietnamese samples and 46.7% (7/15) of Japanese samples. Six eae-positive strains were successfully isolated (five from Vietnam and one from Japan). WGS analysis revealed that all strains possessed genes encoding the locus of enterocyte effacement (LEE) pathogenicity island (LEE1-LEE5) but lacked bfpA, and were therefore classified as atypical EPEC (aEPEC). Antimicrobial susceptibility testing showed that three Vietnamese strains exhibited multidrug resistance, including extended-spectrum β-lactamase production, and three strains harbored quinolone resistance-associated gyrA mutations.<h4>Conclusions</h4>These findings indicate substantial contamination of retail chicken meat in Vietnam with aEPEC strains carrying clinically relevant AMR determinants. Strengthened surveillance and targeted control measures are warranted to reduce the risk of foodborne transmission.

PRDX6
Also flagged:osteosarcomaOStumorbone formationcell proliferationmitochondrial
Journal Article 2026-05-19 ✓ 5 Snippets Yun HM, Lee J, Kim B, Park KR.
In-Text Gene Mentions

…Reynosin targets thePRDX6-AKT-WEE1 axis to suppress…

…the Peroxiredoxin 6 (PRDX6)-mediated oncogenic network.<…

…munohistochemistry to evaluatePRDX6and WEE1 expression…

…stable overexpression ofPRDX6.…

…significant upregulation ofPRDX6and its downstream…

Show Full Abstract

<h4>Background</h4>Osteosarcoma (OS) is a formidable bone malignancy frequently associated with aggressive metastasis and limited therapeutic options. In this study, we investigated the anti-neoplastic potential of reynosin, a bioactive sesquiterpene lactone derived from Aucklandia lappa Decne., focusing on its ability to disrupt the Peroxiredoxin 6 (PRDX6)-mediated oncogenic network.<h4>Methods</h4>Clinical specimen analysis was conducted via immunohistochemistry to evaluate PRDX6 and WEE1 expression in OS patient tissues. In vitro functional assays were performed on MG63 cells to assess proliferation, migration, invasion, and apoptosis. The GeneMANIA algorithm was employed to predict functional protein networks. Mechanistic validation was achieved through gain-of-function experiments utilizing stable overexpression of PRDX6. Furthermore, an ex vivo mouse calvarial bone model was utilized to simulate the tumor-bone microenvironment and evaluate bone formation.<h4>Results</h4>Clinical analysis revealed a significant upregulation of PRDX6 and its downstream effector, WEE1, in OS patient tissues. In vitro assays demonstrated that reynosin treatment significantly hindered MG63 cell proliferation, migration, and invasion by triggering ROS-dependent mitochondrial apoptosis. GeneMANIA predicted a robust functional coupling within the PRDX6-AKT-WEE1 axis. Mechanistic investigations showed that reynosin-induced PRDX6 suppression led to the dephosphorylation of AKT and the subsequent downregulation of WEE1. Crucially, stable overexpression of PRDX6 effectively neutralized the pro-oxidative and anti-proliferative effects of reynosin by restoring p-AKT and WEE1 levels. In the ex vivo model, PRDX6-overexpressing MG63 cells significantly suppressed calvarial bone formation. Notably, reynosin treatment effectively reversed these deleterious effects, restoring bone thickness and collagen matrix integrity.<h4>Conclusion</h4>These findings demonstrate that reynosin exerts its potent anti-osteosarcoma activity by targeting the novel PRDX6-AKT-WEE1 signaling axis, suggesting its potential as a promising lead compound for the treatment of redox-sensitive malignancies.

OLFM4
Also flagged:segmentationbindingGrowthgene expressiondigestionSynthesis
Journal Article 2026-05-19 ✓ 3 Snippets Jeon DG, Han MY, Lee H, Hwang H, Lee JM, Kim ES, Lee GH, Chang Y, Son MY, Park MJ, Nam SW.
In-Text Gene Mentions

…the volcano plot,Olfactomedin-4( Olfm4 ),…

…plot, Olfactomedin-4 (Olfm4), a crypt…

…reduced expression ofOlfm4reflects injury to…

Show Full Abstract

Computational clearing (CC) enhances widefield (WF) fluorescence microscopy by suppressing out-of-focus haze and autofluorescence, yielding semi-confocal quality images suitable for segmentation and image-based phenotyping. Here, we propose an "image tracing" workflow for inflammatory mouse intestinal organoids (mIOs) using paired CC and WF images to generate a differential signal (CC - WF). mIOs were derived from intestinal crypts of Lgr5-EGFP stem cell reporter mice and expanded under epidermal growth factor, Noggin, and R-spondin (ENR) conditions. Inflammation was induced by dextran sulfate sodium (DSS) treatment. CC processing enhanced phalloidin-stained apical F-actin and improved EGFP signals by reducing background noise, enabling robust segmentation and quantitative extraction of image morphometrics including area, circularity, and perimeter. CC-WF vectors derived from three-dimensional area-perimeter-circularity plots sensitively captured DSS-induced epithelial disruption analogous to a leaky-epithelium phenotype. Transcriptomic analysis by RNA-seq of DSS-treated mIOs revealed upregulation of inflammatory pathways including TNF-α signaling via NF-κB and IL-6/JAK/STAT3, aligning with microscopy findings. In a proof-of-concept demonstration using phalloidin-stained fluorescence images, ROC analysis of the CC-WF workflow achieved an AUC = 0.95 with 87.5% sensitivity and 92.9% specificity in distinguishing intact from injured mIOs.

Also flagged:Diabetes mellitushyperglycemiasecretiontype 1 diabetes mellitusT1DMtype 2 diabetes mellitus
Journal Article 2026-05-19 No Snippets Ivanov D, Drobintseva A, Ivanov A, Belova Y, Ditkovskaya L, Maryina O, Kvetnoy I, Nasyrov R, Semenova E.
Show Full Abstract

Diabetes mellitus (DM) is a group of metabolic diseases characterized by chronic hyperglycemia resulting from defects in insulin secretion, insulin action, or both. The most common types-type 1 and type 2 diabetes-have different etiologies and pathophysiological mechanisms. Type 1 diabetes (T1DM) results from autoimmune destruction of the insulin-producing pancreatic β-cells, leading to the development of absolute insulin deficiency, whereas in type 2 diabetes (T2DM), impaired carbohydrate metabolism is primarily caused by insulin resistance and relative insulin deficiency. Current diagnostic criteria do not allow for the detection of the disease at the preclinical stage. MicroRNA (miRNA) influences post-translational regulation of gene expression by inhibiting mRNA translation and also promotes mRNA degradation. The aim of this review is to summarize current evidence on the role of microRNAs in the pathogenesis of T1DM and T2DM and to evaluate their potential as early diagnostic biomarkers and therapeutic targets. It is demonstrated that T1DM and T2DM exhibit altered expression of specific microRNAs involved in β-cell apoptosis, autoimmune inflammation, and insulin signaling. In T1DM, key miRNAs include miR-21, miR-25, miR-146a, and miR-375, which reflect β-cell destruction and the autoimmune process. In T2DM, critical roles are played by miR-9, miR-29, miR-34a, miR-103/107, miR-126, miR-143, and miR-375, which regulate insulin secretion, lipid metabolism, and tissue insulin sensitivity. Particular attention is given to microRNAs whose expression changes several years before clinical disease onset (miR-15a, miR-126, miR-375), offering opportunities for early diagnosis. Data are presented on circulating miRNAs in stable biological fluids (blood, urine). It should be emphasized, however, that the proposed microRNA panel currently represents only a potential diagnostic tool. This panel requires further validation and confirmation by clinicians in large-scale prospective studies and does not yet claim to be ready for routine clinical use. Nevertheless, the development of such a universal microRNA panel, followed by thorough clinical evaluation, has promising biomedical potential, which will not only allow for the diagnosis of diabetes at an early stage but also identify new therapeutic targets for personalized medicine.

Also flagged:degradationbehavioralcognitive deficitsbiosynthesisanxietyatrophy
Journal Article 2026-05-19 No Snippets Sun T, Yang M, Ma Y, Zheng Z, Wan J, Wei J, Pan M, Zhou Y, Yuan X, Li Y, Sun Y.
Show Full Abstract

This study aimed to identify candidate molecular pathways mediating dopaminergic dysfunction induced by PFAS mixture exposure, with a focus on the TM/5-HT signaling axis and calcium-linked lipid metabolites, and to explore potential gut-brain axis involvement. Adult mice were exposed to a PFAS mixture. Behavioral tests assessed spatial memory, spontaneous activity, and motor coordination. Histopathological and ultrastructural analyses examined neuronal atrophy, mitochondrial damage, α-synuclein (α-syn), and tyrosine hydroxylase (TH). Transcriptomics, metabolomics, and gut microbiota profiling (16S rRNA sequencing) were performed, followed by integrated multi-omics and correlation analyses. PFAS exposure was associated with PD-relevant motor and cognitive impairments, including impaired spatial memory, reduced spontaneous activity, and motor coordination deficits. Neuronal atrophy, mitochondrial structural damage, upregulation of α-syn, and downregulation of TH were observed. Transcriptomics identified 315 differentially expressed genes (DEGs) enriched in ciliary movement, neuroactive ligand-receptor interactions, and serotonergic synapses. Metabolomics identified 130 differentially abundant metabolites involved in arachidonic acid metabolism and serotonergic synapses. Integrated analysis highlighted correlative changes in the TM/5-HT signaling pathway. Phosphatidylinositol PI(16:0/20:2(11Z,14Z)) showed a strong positive correlation with <i>Dbh</i> gene expression, suggesting a candidate association between <i>Dbh</i> expression and phosphatidylinositol alterations. Gut microbiota analysis revealed compositional alterations (e.g., <i>Muribaculaceae</i>, <i>Ileibacterium</i>) and predicted functional shifts (e.g., tryptophan metabolism-related modules) were observed; these findings are exploratory. This study identifies multi-omics signatures associated with PFAS mixture-induced dopaminergic dysfunction in mice. The TM/5-HT pathway emerges as a candidate molecular axis requiring further investigation. Gut microbiota alterations suggest a potential peripheral component, but causality and gut-brain axis involvement remain hypothetical and need direct experimental validation.

FBXL4
Also flagged:synthesisorganizationlipogenesischronic liver diseasedysfunction-associated fatty liver diseasesteatosis
Journal Article 2026-05-19 ✓ 1 Snippet Tong S, Chen W, Chen J, Zhu X, Shi A.
In-Text Gene Mentions

…homolog 2 FBXL3F-box and leucine-rich repeat protein 3and leucine-rich repeat…

Show Full Abstract

The liver circadian clock coordinates hepatic lipid metabolism, bile acid synthesis, and glucose homeostasis through interlocking transcription-translation feedback loops. Disruption of this temporal organization is increasingly recognized as a shared pathological feature across the chronic liver disease spectrum. Transcriptomic profiling alone cannot capture the full scope of circadian dysregulation. Approximately half of rhythmically abundant hepatic proteins lack correspondingly rhythmic mRNAs. Roughly 25% of hepatic phosphosites oscillate with a 24-h period. Integrating transcriptomics, proteomics, post-translational modification profiling, metabolomics, and emerging single-cell and spatial approaches is therefore necessary for an accurate account of how circadian programs are remodeled in disease. This narrative review delineates the multi-omics landscape of circadian clock dysregulation across six chronic liver disease categories. These encompass metabolic dysfunction-associated fatty liver disease (MAFLD), alcoholic liver disease (ALD), viral hepatitis, hepatocellular carcinoma (HCC), liver fibrosis, and cholestatic disease. Four molecular features recur across these contexts. BMAL1 functional downregulation, REV-ERBα oscillatory output attenuation, NAD<sup>+</sup> oscillatory amplitude reduction, and gut-liver axis circadian desynchronization together constitute an inferential framework for hepatic circadian failure. These features represent recurring disease-associated motifs rather than an established pan-disease mechanism. The upstream mechanisms and evidence depth differ substantially by disease category. Oncogenic kinase-driven CLOCK post-translational modifications in HCC, phosphoproteomic remodeling in MAFLD, and epigenomic clock disruption persisting after HCV clearance represent findings that transcriptomics alone would not resolve. The near-complete absence of temporally resolved human tissue data remains the principal barrier to translational progress. This evidence gap limits the clinical actionability of current mechanistic findings across all disease categories. Circadian phase inference algorithms and prospective temporally designed cohort studies offer a methodologically grounded path toward clinically actionable circadian hepatology.

SERPINC1
Also flagged:Acute Venous Thromboembolismcoagulationendothelial dysfunctionbindingleukocyte migrationVenous thromboembolism
Journal Article 2026-05-19 ✓ 1 Snippet Onar LC, Guner E, Dalkiran IO, Yilmaz I.
In-Text Gene Mentions

…IL6R, PF4, SELP,SERPINC1, TLR4, TNF, VCAM1,…

Show Full Abstract

<b>Background:</b> Venous thromboembolism (VTE) is a thromboinflammatory disorder involving coordinated activation of coagulation, endothelial dysfunction, and inflammatory signaling. Low-molecular-weight heparins (LMWHs) may exert pharmacological effects beyond anticoagulation. This study compared enoxaparin, bemiparin, and tinzaparin and explored potential multi-target mechanisms using molecular docking, network pharmacology, and enrichment analyses. <b>Methods:</b> In this retrospective cohort study, patients with acute VTE treated with therapeutic-dose LMWHs were analyzed. Stabilized IPTW based on multinomial propensity scores was used to reduce baseline imbalance between treatment groups. Clinical recovery was assessed using the Clinical Severity Score (CSS). Thromboinflammatory biomarkers (MPV, hs-CRP, NLR, fibrinogen) were evaluated during follow-up. Molecular docking, STRING/Cytoscape-based protein-protein interaction, and enrichment analyses were performed. <b>Results:</b> Median time to symptom resolution was 31 days with enoxaparin, 28 days with bemiparin, and 24 days with tinzaparin (log-rank <i>p</i> < 0.001). Recovery was faster with bemiparin (HR 1.28, 95% CI 1.05-1.56) and tinzaparin (HR 1.72, 95% CI 1.41-2.10). Tinzaparin showed greater reductions in hs-CRP, MPV, NLR, and fibrinogen (all <i>p</i> < 0.05) and less analgesic use beyond 10 days (19.7% vs. 27.0% and 33.2%; <i>p</i> < 0.001). Docking analyses identified plausible conformations (root-mean-square deviation, RMSD ≤ 2 Å). Given the structural flexibility and heterogeneous chain length of LMWHs, rigid docking algorithms may not fully capture biologically relevant conformations. Therefore, docking results should be interpreted as qualitative interaction mapping rather than quantitative binding affinity estimation. Network analysis highlighted F3, TNF, IL6, and VWF, while enrichment analyses suggested involvement of cytokine signaling, leukocyte migration, and thromboinflammatory pathways. <b>Conclusions:</b> LMWH therapy was associated with improved thromboinflammatory markers and clinical recovery, with tinzaparin showing comparatively more favorable thromboinflammatory biomarker trajectories and recovery dynamics within the limitations of this observational analysis. Integrated clinical and in silico findings provide hypothesis-generating insights into potential multi-target pharmacological effects beyond anticoagulation; however, these observations should be interpreted cautiously and require experimental validation.

HTT
Also flagged:neurodegenerative diseasebehavioralHDnucleusdeathCMD
Journal Article 2026-05-19 ✓ 4 Snippets Demirtas M, Pustina D, Wood A, Sampaio C, Vohryzek J, Deco G.
In-Text Gene Mentions

…the huntingtin (HTT) gene (…

…TheHTTexpression levels available…

…the huntingtin (HTT) gene expression…

…distribution of theHTTgene transcription.…

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disease with severe motor, cognitive and behavioral symptoms. There is a recent impetus to develop treatments that slow progression before clinical signs emerge. Such early interventions require biomarkers sensitive to the very earliest HD progression. Here we applied cutting-edge fMRI analysis on data collected in the Track-On HD study to evaluate whether functional and effective connectivity obtained from model-free and model-based approaches can produce useful biomarkers of HD progression. We analyzed data from 231 participants with up to three annual visits each and created five groups comprising normative controls and four HD groups according to the Huntington's Disease Integrated Staging System (HD-ISS). We found significant differences between healthy controls and late HD-ISS stages but not in longitudinal change. Specifically, we found attenuated functional and effective connectivity in the caudate nucleus in HD-ISS-2, and this effect extended to other corticostriatal connections in HD-ISS-3. Overall, most of the alterations were only evident in advanced HD stages, and we did not observe widespread alterations in cortical connectivity and graph topography. Although HD-ISS groups did not differ in the amount of in-scanner motion, we did find measures of functional and effective connectivity to be sensitive to motion. We conclude that fMRI can indeed capture attenuation of cortico-striatal functional and effective connectivity across HD progression. This study investigates fMRI alterations across the recently created HD-ISS stages within a novel framework of signal flow across the whole brain.

Also flagged:Parkinson's diseasePDbiosynthesisGene expressionnucleus
Journal Article 2026-05-19 No Snippets Harbert DH.
Show Full Abstract

<h4>Background</h4>Parkinson's disease (PD) involves progressive dopaminergic neuron loss in the substantia nigra (SN). Aldehyde dehydrogenase 1A1 (ALDH1A1), the rate-limiting enzyme in retinoic acid biosynthesis, is enriched in vulnerable dopaminergic neuron subpopulations and is consistently downregulated in PD. However, the relationship between ALDH1A1 expression and broader dopaminergic pathway gene co-expression has not been systematically characterized across multiple independent datasets.<h4>Methods</h4>Gene expression correlations were analyzed across seven independent human SN microarray datasets (<i>n</i> = 156; 70 controls, 86 PD) from the Gene Expression Omnibus. Simple arithmetic means across datasets are reported as the primary summary statistic; random-effects meta-analysis with DerSimonian-Laird estimation was applied to Fisher's z-transformed correlation coefficients to generate pooled estimates with heterogeneity statistics. Marker gene-based enrichment scoring using published cell type markers from single-nucleus RNA-seq profiling of human substantia nigra-with all target genes excluded from signatures-was performed across six analyzable datasets. Selectivity of ALDH1A1 correlation attenuation was assessed using permutation testing (<i>n</i> = 5,000) as the primary statistical test, with parametric tests reported as supplementary.<h4>Results</h4>In controls, ALDH1A1 showed strong co-expression with dopaminergic genes (mean r = 0.92-0.93 for TH, DDC, and SLC18A2). In PD, these correlations were attenuated (mean Δr = -0.336 for ALDH1A1-dopamine pairs). Dopamine-dopamine correlations showed less attenuation (mean Δr = -0.143). Marker gene-based enrichment scoring confirmed significant depletion of ALDH1A1-positive vulnerable dopaminergic neurons in 4 of 6 datasets. After adjusting for estimated cell type enrichment, the selectivity of ALDH1A1 attenuation was preserved (adjusted selectivity: -0.210, increased from raw selectivity of -0.190; raw permutation <i>p</i> = 0.0052).<h4>Conclusion</h4>ALDH1A1 co-expression with dopaminergic pathway genes is attenuated in PD substantia nigra across all seven datasets examined. This attenuation is selective for ALDH1A1-containing pairs, and this selectivity persists after adjusting for cell type enrichment changes. While correlational, these findings are consistent with a role for retinoic acid pathway disruption in PD pathophysiology and warrant mechanistic investigation.

Also flagged:degradationaginglysosomes
Journal Article 2026-05-19 No Snippets Sánchez-Argüello P, Sáez-Salto G, Budai A, Rivier PA, Weldon S, Martín-Esteban A.
Show Full Abstract

Compost application is a widely recommended practice to maintain and improve soil fertility. However, such a practice could be a main entry path for plastic into soil. Accordingly, in the present work, two different compost samples, obtained with and without biochar, were analyzed to investigate how composting can affect the presence of microplastics (MPs). The substrate of both samples (consisting of a mixture of household food waste and animal manure) was also analyzed for comparative purposes. Samples were processed by oxidation, flotation, and filtration. MPs on the filters were observed, counted, and size-calibrated using both a stereomicroscope and an inverted microscope. MPs larger than 1 mm were further characterized by attenuated total reflectance Fourier-transformed infrared spectroscopy (ATR-FTIR). In parallel, mesoplastics (0.5-2 cm) were recovered from substrate and compost and extracted in methanol for testing <i>in vitro</i> cytotoxicity. The estimated concentration of MPs ranged from 820 to 1340 fragments/kg of dry sample, depending upon the sample. Three polymers represented the totality of identified plastic items: polyethylene (PE, including both low and high density), polyethylene terephthalate (PET), and polypropylene (PP) in order of abundance. Nevertheless, cytotoxicity was only observed in mesoplastic extracts from the substrate and could not be attributed to the identified plastic items themselves, suggesting that cytotoxic effects could have been caused by contaminants adsorbed to plastics or by the leaching of plastic additives during the extraction process. In summary, the composting process reduced the cytotoxicity of plastic extracts and the presence of MPs in compost, which could be attributed to the fragmentation of plastics.

HFE
Also flagged:hepatorenal syndromeacute kidney diseaseHRSglomerular filtrationrenal diseaseascites
Journal Article 2026-05-19 ✓ 1 Snippet Park JH, Park HJ, Choi D, Yoon J.
In-Text Gene Mentions

…disorders such ashemochromatosis, can also lead…

Show Full Abstract

<h4>Background</h4>Hepatorenal syndrome-acute kidney disease (HRS-AKD) is associated with poor renal outcomes in cirrhotic patients, yet no established noninvasive imaging marker exists for its early prediction. This study evaluated renal R2* derived from magnetic resonance elastography (MRE) with multi-echo R2* mapping as a noninvasive imaging marker for predicting the development of HRS-AKD in cirrhotic patients with ascites.<h4>Methods</h4>This retrospective observational study analyzed 376 patients who underwent liver MRE with multi-echo R2* mapping between January 2018 and October 2024. Median renal R2* values were quantified from the left kidney using radiomics-based analysis. HRS-AKD was defined as an estimated glomerular filtration rate (eGFR) <60 mL/min/1.73 m<sup>2</sup> or a ≥50% increase in serum creatinine from baseline within 3 months after MRE, without other causes of renal disease. Diagnostic performance of renal R2* was compared with liver stiffness and serum fibrosis markers, including the aspartate aminotransferase-to-alanine aminotransferase ratio (AAR), aspartate aminotransferase-to-platelet ratio index (APRI), and fibrosis-4 (FIB-4) index. Multivariable logistic regression identified independent predictors of HRS-AKD.<h4>Results</h4>Among cirrhotic patients with ascites, 12.9% developed HRS-AKD; 62.5% had a prior episode of HRS-acute kidney injury (AKI). Median renal R2* was higher in patients who developed HRS-AKD (P=0.007), and inversely correlated with eGFR measured at MRE (r=-0.34, P=0.006). Renal R2* did not correlate with serum iron markers or hemoglobin (all P≥0.05). The area under the receiver operating characteristic curve (AUROC) of renal R2* was 74.5 [95% confidence interval (CI): 57.4-91.6] for predicting HRS-AKD, outperforming liver stiffness and serum fibrosis markers. An R2* cut-off of 20.8 s<sup>-1</sup> yielded 75% sensitivity and 74% specificity. R2* ≥20.8 s<sup>-1</sup> was an independent predictor of HRS-AKD [odds ratio (OR) 16.8; P=0.002].<h4>Conclusions</h4>Renal R2* is a promising noninvasive imaging marker candidate for predicting the development of HRS-AKD in cirrhotic patients with ascites.

Also flagged:Triple-Negative Breast CancercancerssynthesisCancercervical carcinomamammary carcinoma
Journal Article 2026-05-19 No Snippets Roy A, Beniwal N, Shome A, Rengan AK, Chinta JP.
Show Full Abstract

Higher intracellular ROS concentration of TNBC cells may serve as a therapeutic target to develop antioxidant-based drugs to treat such cancers. The HCA-conjugated terpyridine-copper analogues are reported for the selective treatment of TNBC, but the investigation on the antiproliferative activities remains to be elucidated. Herein, a set of terpyridine-conjugated HBA and HCA derivatives and their ROS-induced products were isolated and evaluated for their anti-TNBC properties. <i>In vitro</i> studies on 4T1 cell lines revealed that the ROS-oxidized intermediates showed potential therapeutic activity to cause the antiproliferative activity of their parent analogues. Further, the presence of copper was also found to enhance the anticancer activity of these derivatives with high selectivity toward TNBC. Due to the presence of natural antioxidant residues, all these derivatives were found to be biocompatible, as studied over NIH/3T3 cell lines. These results illustrate the involvement of ROS-generated cytotoxic intermediates, responsible for the therapeutic applicability of natural antioxidant-based derivatives toward TNBC.

SERPINC1
Also flagged:coagulation activationcoagulationmembranemembranesacute renal failureacute kidney injury
Journal Article 2026-05-19 ✓ 1 Snippet Xiao Y, Zhang C, Yang T, Huang Y, Wang X, Liu X, Li M, Cui S, Geng G, Li X, Li Q, Chen X.
In-Text Gene Mentions

…CFH, F12, C8G,SERPINC1, C8B, VTN, PROS1,…

Show Full Abstract

<h4>Background</h4>Severe acute kidney injury (AKI) is associated with high mortality. Current blood purification technologies fail to replace the biological functions of renal tubular epithelial cells (RTECs), such as active transport, acid-base homeostasis, and endocrine regulation. The integration of viable RTECs into an extracorporeal circuit to construct a bioartificial kidney represents a potential strategy for renal functional support. However, its translation is constrained by the rapid loss of seed cell phenotypes, immune and coagulation activation triggered by conventional materials, and a lack of <i>in vivo</i> validation in large animal models. However, three key challenges hinder its clinical translation, which this study seeks to address: the rapid loss of seed cell phenotypes, immune and coagulation activation triggered by conventional materials, and a lack of <i>in vivo</i> validation in large animal models.<h4>Methods</h4>We engineered a renal tubule assist device (RAD) that integrates viable cells with a functionalized interface. First, we established an immortalized human proximal tubule cell line [immortalized renal tubular epithelial cell line (iRTEC)] and achieved scalable expansion using a microcarrier system. Second, we fabricated a cell-supporting interface [chlorogenic acid/poly-L-lysine-modified pristine nanofibrous membrane (CA/PLL-PNF)] with antioxidant properties and enhanced hemocompatibility via the layer-by-layer self-assembly of PLL and CA onto polyacrylonitrile nanofibrous membranes. Finally, we assembled these components into a flat-plate bioreactor and evaluated its extracorporeal performance in a Bama miniature pig model after bilateral nephrectomy.<h4>Results</h4>iRTECs were stably expanded on microcarriers while maintaining a proximal tubule phenotype, and these cells outperformed existing cell lines in terms of amino acid hydrolysis and transmembrane transport, acid-base regulation, water transport, and endocrine responsiveness. With respect to the supporting interface, CA/PLL-PNF effectively scavenged diverse free radicals and mitigated cellular oxidative stress. Proteomic analysis confirmed that this modification remodeled the plasma protein corona, which significantly reduced the adsorption of complement and coagulation factors. In the bilaterally nephrectomized pig model, the RAD safely maintained extracorporeal circulation for 4 h-the duration of routine clinical dialysis-and preserved internal homeostasis. The antioxidant interface significantly attenuated circulating lipid peroxidation during treatment. Compared with hemofiltration alone, the RAD significantly enhanced the clearance of middle-molecule toxins (β<sub>2</sub>-microglobulin) and reduced proinflammatory cytokine levels at the outlet, demonstrating its capacity for the active modulation of local inflammation.<h4>Conclusions</h4>This study established a renal support platform that integrates viable cells and functional materials. The device exhibited multidimensional biological efficacy in toxin clearance and internal homeostasis regulation and achieved stable extracorporeal circulation in a preclinical large animal model, which provides experimental evidence for advanced organ support strategies in the setting of severe AKI.

OLFM4
Also flagged:cancertumornon-small cell lung cancerNSCLCTumorsinflammatory response
Journal Article 2026-05-18 ✓ 1 Snippet Kim J, Lee G, Yong SH, Kim EY, Jo Y, Jeong W, Ryu D, Oh CM, Lee SH.
In-Text Gene Mentions

…group, the genesOLFM4, LTF, LBP, SERPINA5…

Show Full Abstract

<h4>Background</h4>Lung cancer remains the leading cause of cancer-related mortality, with poor outcomes driven by late presentation and therapy resistance. While genes encoding secreted proteins may reflect tumor biology and have biomarker potential, systematic multi-cohort studies that identify and validate prognostically relevant secreted protein candidates in non-small cell lung cancer (NSCLC) are limited.<h4>Methods</h4>We conducted a multi-cohort transcriptomic screen of 1,896 genes encoding secreted proteins to nominate prognostic candidates in NSCLC. Candidates were prioritized based on differential expression between tumor and normal tissues and survival associations across public NSCLC cohorts. Serpin family A member 3 (SERPINA3) was selected for further validation in The Cancer Genome Atlas (TCGA) NSCLC dataset. Tumors were stratified by SERPINA3 expression for Kaplan-Meier survival analysis and gene set enrichment analysis (GSEA) using the Hallmark and Kyoto Encyclopedia of Genes and Genomes (KEGG) collections. Translational relevance was assessed in a retrospective bronchoalveolar lavage fluid (BALF) registry using multivariable Cox models.<h4>Results</h4>In the TCGA NSCLC dataset, SERPINA3-high tumors had shorter overall survival (OS; log-rank p=0.016) and progression-free survival (PFS; log-rank p=0.018). GSEA showed enrichment in tumor necrosis factor-α/nuclear factor-κB, inflammatory response, interleukin 6 (IL-6)-Janus kinase (JAK)-signal transducer and activator of transcription 3 (STAT3), and IL-17 signaling pathways. The SERPINA3-high state exhibited a T-cell-infiltrated, checkpoint-high phenotype consistent with T-cell dysfunction, characterized by increased levels of transforming growth factor-β, IL-10, and indoleamine 2,3-dioxygenase (IDO). In the BALF registry, higher BALF-but not plasma-SERPINA3 independently predicted shorter PFS, with a nonsignificant trend toward OS after adjustment.<h4>Conclusion</h4>Across datasets, SERPINA3 indicates an immune-inflammatory tumor state associated with worse survival. BALF-based measurement captured tumor-proximal signals that may be less apparent in plasma, supporting its potential clinical utility for risk stratification and warranting prospective validation.

Also flagged:Kawasaki Diseasecoronary artery aneurysmsvasculitis
Journal Article 2026-05-18 No Snippets Harahsheh AS, Mohsin SM, Tremoulet A, McCrindle BW, Singh S, Webb K, Kobayashi S, Zheleva B, Ulloa-Gutierrez R, Takahashi K, Dahdah N, Council on Lifelong Congenital Heart Disease and Heart Health in the Young; Council on Clinical Cardiology; and the Council on Cardiovascular and Stroke Nursing.
Show Full Abstract

Kawasaki disease (KD) is an acute medium-size vasculitis that affects the coronary arteries. Untreated children can develop coronary artery aneurysms with a prevalence of ≈25%, but prompt treatment with intravenous immunoglobulin (2 g/kg per dose) can reduce the risk to <5%. KD affects children all over the globe with varying incidence and, above all, varying diagnostic accuracy and management accessibility. The recognition of KD remains a burden to overcome in many nations. The success witnessed in the past 50 years of KD research and development among the economically advanced countries has led to effective recognition and management strategies for KD. Hence, local, multicenter, national, and international collaborative efforts, with dynamic exchange between low- and middle-income and countries such as Japan, and Europe and North America, which have developed effective guidelines, are needed to improve recognition and care of patients with KD. In this science advisory, we discuss the status of existing KD collaborative groups, logistics of operating multi-institutional clinical and research collaborations, impact on patient outcome and knowledge sharing, and future directions toward multinational quality improvement for KD collaborations.

Also flagged:Pancreatic cancertumorcancerdigestive disordersextracellularductal adenocarcinoma of the pancreas
Journal Article 2026-05-18 No Snippets Yadav B, Kollur SP, Ali A, Arora P, Gupta A, Saranraj P, Upadhye VJ, Singh P.
Show Full Abstract

Pancreatic cancer remains a formidable global health challenge, ranking as the twelfth most common malignancy yet claiming an outsized toll with dismal 5-year survival rates 13.3%, largely due to late-stage diagnosis and limited therapeutic options. This comprehensive review delves into the transformative potential of peptides as innovative biomarkers and prognostic indicators, addressing the critical gaps in early detection and personalized management of this aggressive disease. Drawing from cutting-edge research in molecular oncology, proteomics, and bioinformatics, this paper highlights key genetic drivers such as KRAS, TP53, CDKN2A, and SMAD4 mutations that fuel Pancreatic cancer progression and stromal desmoplasia. Diverse peptide sources, including tumor-derived neoantigens, stromal remodeling fragments, and immune-modulating signals and their release mechanisms via ectodomain shedding and exosomes, were explored. Emphasizing advanced discovery pipelines, from mass spectrometry-based proteomics to immunoassays and machine learning-driven validation, current work spotlights promising candidates like PF4, PRO-C11-511, and CXCL7, which enhance diagnostic accuracy (AUC up to 0.961) and predict outcomes when integrated with established markers like CA19-9. By overcoming limitations of current biomarkers, such as low specificity and stage-dependency. This review underscores peptides' role in revolutionizing precision oncology, paving the way for non-invasive screening, targeted therapies, and improved survival in pancreatic cancer patients.

DCC
Also flagged:Tumortriple-negative breast cancercancercell cyclebreast cancertumors
Journal Article 2026-05-18 ✓ 3 Snippets Liu W, Song Z.
In-Text Gene Mentions

…and reactivation ofDCCdormancy remain poorly…

…key molecule sustainingDCCdormancy.…

…dormancy by inhibitingDCCreawakening in the…

Show Full Abstract

Metastasis and recurrence of triple-negative breast cancer (TNBC), are mainly attributed to the presence of dormant cancer cells (DCCs), yet the molecular mechanisms governing the maintenance and reactivation of DCC dormancy remain poorly elucidated. This study identified collagen IX alpha 1 chain (Col9a1) as a gene specifically expressed in TNBC dormant cells and confirmed that it is a key molecule sustaining DCC dormancy. Mechanistic studies revealed that COL9A1 sustains TNBC cell dormancy by suppressing the FAK-AKT-p27 signaling axis, thereby inducing G0/G1 cell cycle arrest. Col9a1 knockdown reactivates DCCs, and the reactivated cells recruit natural killer (NK) cells by upregulating retinoic acid early inducible 1γ (RAE-1γ) and secreting proinflammatory cytokines (IL-15/IL-18), thus abrogating the immune evasion capacity of DCCs and enhancing the chemosensitivity of reactivated TNBC cells to docetaxel. This study uncovers a novel mechanism by which COL9A1 regulates TNBC cell dormancy, indicating that COL9A1 can serve as a potential biomarker for assessing the dormant phenotype of TNBC and predicting tumor recurrence, as well as a novel therapeutic target for TNBC. This study also provides preclinical evidence for developing COL9A1-targeted combination therapies for TNBC.

PEBP1
Also flagged:cancerepithelial-mesenchymal transitionembryogenesiscell-to-cell adhesiontumor
Journal Article 2026-05-18 ✓ 3 Snippets Parfenyev SE, Nazarov AN, Daks AA, Fedorova OA, Barlev NA, Shuvalov OY.
In-Text Gene Mentions

…the SNAI2 ,PEBP1, THBD ,…

…, FBP1 ,PEBP1, PTEN ,…

PEBP1/RKIP…

Show Full Abstract

The transcription factor Snail is a central regulatory hub that governs the transition from localized tumorigenesis to invasive, metastatic, therapy-resistant disease. Elucidating the mechanisms of Snail-driven epithelial-mesenchymal transition (EMT) and identifying strategies to target this pathway are critical challenges and promising frontiers for novel oncology therapeutics. In this review, we systematically analyzed the association between Snail expression and patient outcomes across multiple malignancies based on bioinformatics and statistical interrogation of clinical datasets and molecular interaction networks. Our findings indicate that Snail primarily exerts its oncogenic effects by directly activating a network of pro-metastatic and pro-survival oncogenes, rather than by repressing epithelial genes. We further show that the canonical E-box motif (CANNTG) is a poor predictor of Snail targets. Instead, Snail's tumor-promoting activity is largely mediated through its cooperation with EGR1/SP1 transcription factors on non-canonical TCACA promoter elements, which upregulate genes such as ZEB1, MMP9, and LEF1. Based on these conclusions, we propose a refined model for predicting Snail target genes. Finally, given that inhibiting the Snail-EMT axis presents a plausible opportunity to limit cancer progression and improve patient outcomes, we also discuss clinically relevant pharmacological strategies for targeting Snail.

HTT
Also flagged:metabolismpathogenesisneurodegenerative diseasesAlzheimer's diseaseADParkinson's disease
Journal Article 2026-05-18 ✓ 5 Snippets Liu X, Jia L, Wu K, Chen M, Sun J, Yang C, Xu C, Sun J, Wang J, Dai L.
In-Text Gene Mentions

…identified for theHTTprotein.…

HTThas been characterized…

…the expression ofHttexon1‐polyQ. Substitution of…

…exon1‐polyQ. Substitution ofHttMet8 and His82,…

…of copper onHttexon1‐polyQ toxicity.…

Show Full Abstract

Iron (Fe) and copper (Cu) are vital micronutrients that regulate many critical physiological processes in the human body, with their homeostasis in the central nervous system (CNS) being essential for proper neuronal function. Disruptions in their metabolism and regulatory pathways have been associated with the pathogenesis of various forms of neurodegenerative diseases (NDDs) such as Alzheimer's disease (AD) and Parkinson's disease (PD). Despite growing research on metal homeostasis, the intricate molecular mechanisms that link iron and copper metabolism to the initiation and progression of NDDs remain insufficiently elucidated. In this review, we provide a systematic overview of the metabolic processes of iron and copper in the body and CNS, highlighting their interactions with many metal-binding proteins, including transporters, storage proteins, and important intrinsically disordered proteins (e.g., amyloid β-protein, tau, and alpha-synuclein) involved in NDDs. We further dissect the downstream effects of metal ion dyshomeostasis on cellular redox balance, neuroinflammation, autophagy, organelle interaction network, and cell death. Additionally, we discuss current therapeutic strategies aimed at targeting iron and copper dyshomeostasis, as well as the emerging role of artificial intelligence in this field of research. By integrating metal metabolism, metal-protein interactions, the effect of metal dyshomeostasis on downstream biological processes, and potential intervention strategies, this review serves as a comprehensive reference for understanding the pathogenesis of NDDs and offers new perspectives for developing effective therapeutics. Overall, this review underscores the significance of reinstating metal balance for the treatment of neurodegeneration.

PRDX6
Also flagged:Myocardial infarctionMIdeathMitochondriamitochondrialmitophagy
Journal Article 2026-05-18 ✓ 1 Snippet Kadam A, Kashyap S, Samantaray K, Jaiswal N, Goyani S, Kramer PA, Hadi P, Lee J, Furdui CM, Jadiya P, Tomar D.
In-Text Gene Mentions

…NDUFB10, PCK2, APEX1,PRDX6, ALDH2, and SLC25A4…

Show Full Abstract

Metabolic reprogramming is a hallmark of myocardial infarction (MI), in which cardiomyocytes shift from fatty acid oxidation to anaerobic glycolysis, leading to elevated lactate production and mitochondrial dysfunction. Lactylation, a recently discovered lysine post-translational modification, has emerged as a metabolic signaling mechanism; however, its role within mitochondria during MI remains poorly understood. Here, we mapped the mitochondrial lactylome following MI and examine how modulation of lactate transport influences mitochondrial metabolism and redox homeostasis. Using quantitative proteomics, we identify extensive remodeling of mitochondrial protein lactylation after MI, affecting enzymes involved in bioenergetics, redox regulation, and metabolic control. Pharmacological inhibition of monocarboxylate transporter-1 (MCT1) using AZD3965 further reshapes the mitochondrial lactylome, increasing lactylation of specific metabolic and redox-associated proteins without uniformly exacerbating mitochondrial dysfunction. Despite sustained impairment of global cardiac function, MCT1 inhibition attenuates post-MI fibrosis and inflammation and partially restores mitochondrial respiratory capacity. Consistent with in vivo findings, genetic or pharmacological inhibition of MCT1 in hypoxic cardiomyocyte-derived cells reduces mitochondrial reactive oxygen species, decreases inhibitory pyruvate dehydrogenase phosphorylation, and improves mitochondrial bioenergetics. Together, these findings reveal that mitochondrial lactylation is a context-dependent regulator of mitochondrial metabolism and redox balance following MI. Rather than acting solely as a pathological modification, lactylation integrates lactate availability with mitochondrial function to influence inflammatory and fibrotic remodeling, highlighting mitochondrial metabolic plasticity as a potential therapeutic target in ischemic heart disease.

PRDX6
Also flagged:Tumorbenign liver diseaseHepatocellular Carcinomacancerscancerdeath
Journal Article 2026-05-18 ✓ 1 Snippet Roy D, Oppermann E, Vogl TJ, Büdeyri I, Shapiro D, Struecker B, Rolfo CD, Abedin N, Zharov VP, Schnitzbauer A, Pascher A, Bechstein WO, Zimmermann MS, Juratli MA.
In-Text Gene Mentions

…axis 10 andPRDX6expression 11 as…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is associated with high recurrence rates despite curative-intent liver resection. This necessitates improved prognostic tools and novel therapeutic strategies, including immune checkpoint inhibitors (ICIs). Circulating stem cells (CSCs) have emerged as potential prognostic biomarkers.<h4>Aim</h4>To assess the prognostic relevance of CSCs expressing programmed death-ligand 1 (PD-L1+CSCs) in relation to recurrence-free survival (RFS) and overall survival (OS) in patients undergoing surgery for HCC.<h4>Methods</h4>PD-L1+CSCs (CD45-/CD146+/ASGPR+/CD90+/PD-L1+) were analyzed in 27 HCC patients before surgery, immediately after surgery, and at 6 and 12 months after surgery using fluorescence-activated cell sorting and immunofluorescence microscopy. Tumor recurrence was monitored biannually through alpha-fetoprotein (AFP) measurements and imaging (CT/MRI). Control groups included patients with benign liver disease, non-HCC malignancies, and healthy donors.<h4>Results</h4>Before surgery, 29.7% (8/27) of HCC patients had detectable PD-L1+CSCs. Postoperatively, their frequency initially declined to 22.3%, followed by a significant rise to 85% at six months and 88% at twelve months (both p < 0.01). Increasing postoperative PD-L1+CSC levels were associated with tumor recurrence (51.8%). The presence of preoperative PD-L1+CSCs correlated with reduced OS (p = 0.05) and shorter RFS (p = 0.07).<h4>Conclusion</h4>PD-L1+CSCs are associated with poor oncological outcomes and represent promising prognostic and therapeutic targets in HCC.

Also flagged:Homeostasisfollicular dysplasiaferroptosispathogenesismitochondrialestrous cycle
Journal Article 2026-05-18 No Snippets Niu CY, Jiang DM, Wang X, Chen GH, Li S, Guo YN, Ji CW, An XG, Ling WK, Qi YX, Wang XY, Lu L, Wang X, Kang B.
Show Full Abstract

Females with iron overload suffer from follicular dysplasia, and effective therapeutic strategies for preserving fertility remain lacking. As a natural aliphatic polyamine, spermidine exerts antioxidant activity and plays an anti-ferroptosis role in the pathogenesis of various diseases. However, the role and underlying mechanism of spermidine in iron overload-induced ovarian ferroptosis remain largely elusive. This study aimed to investigate the therapeutic potential of spermidine against iron overload-induced ferroptosis in ovarian granulosa cells and elucidate its molecular mechanism. As a result, iron overload models were established in female mice (in vivo, ferrous sulfate) and porcine ovarian granulosa cells (in vitro, ferric ammonium citrate), with spermidine administered at 3 mM (in vivo) or 150 μM (in vitro). Ferritin heavy chain (FHC) and solute carrier family 7 member 11 (SLC7A11) silencing were performed via siRNA transfection, and relevant controls were set. In vivo studies showed that spermidine elevated serum estradiol and progesterone levels, enhanced ovarian catalase (CAT) and superoxide dismutase (SOD) activities, improved granulosa cell mitochondrial morphology, and increased estrous cycle regularity from 35.6% (high-iron group) to 63.1%. In vitro, spermidine improved ferric ammonium citrate (FAC)-impaired cell viability; attenuated reactive oxygen species (ROS) accumulation; upregulated FHC, Nrf2/p-Nrf2/GPX4, SLC7A11 and anti-müllerian hormone (AMH) expression; and inhibited excessive autophagy (decreased LC3BII/I ratio). Mechanistically, spermidine activated AKT-mediated autophagy, modulated iron homeostasis and glutathione (GSH) synthesis via FHC, alleviated ferroptosis-related Nrf2/p-Nrf2/HO-1 pathway overactivation, reduced lipid peroxidation and DNA damage, and restored mitochondrial function. SLC7A11 silencing disrupted glutathione metabolism, induced mitochondrial ROS accumulation, and inhibited autophagy. Proteomic analysis identified microsomal glutathione S-transferase 3 (MGST3) as a potential key downstream target of spermidine in suppressing SLC7A11-mediated ferroptosis. This study reveals a novel therapeutic strategy wherein spermidine protects against ovarian ferroptosis and preserves ovarian function by regulating iron homeostasis through the FHC/SLC7A11 axis.

Also flagged:tumorcancerdeathtumorslocalizationmitochondrial
Journal Article 2026-05-18 No Snippets Jin Y, Zhu J, Yang Y, Li Z, Qin Y.
Show Full Abstract

Gold nanoparticles offer a versatile platform for cancer theranostics because their high atomic number can enhance X-ray energy deposition, their plasmonic properties support photothermal and photoacoustic applications, and their surfaces allow drug loading and molecular targeting. However, therapeutic benefit remains heterogeneous because tumor uptake, intratumoral coverage, and subcellular localization determine whether deposited gold can be converted into biologically effective damage. Redox context further shapes this conversion by determining whether AuNP-triggered physical or catalytic events can overcome local buffering and propagate into durable injury. During radiotherapy, AuNPs increase local secondary electron release and ROS formation, which can intensify DNA damage when GSH-dependent peroxide detoxification, thioredoxin-related buffering, and KEAP1-NRF2-regulated antioxidant responses are insufficient to contain the redox burden. In catalytic systems, Au-containing nanozymes can convert endogenous H<sub>2</sub>O<sub>2</sub> into highly reactive radicals and may simultaneously deplete glutathione, thereby amplifying mitochondrial dysfunction and lipid peroxidation. During photoactivation, plasmonic heating and photosensitizer coupling further reshape ROS generation in a time-dependent and location-dependent manner. On the diagnostic side, CT or spectral CT can quantify tumor gold burden and coverage, whereas ROS-responsive photoacoustic, SERS, or fluorescence probes can report treatment-related oxidants and verify whether redox activation has occurred within the tumor. Clinical translation will therefore depend on quantification-guided dosing, definition of spatial coverage and activation timing, standardized redox-response readouts, and long-term safety evaluation.

Also flagged:transportationmembrane
Journal Article 2026-05-18 No Snippets Chemane IA, Nacamura da Silva GH, Lima MB, Raimundo EK, Vieira RB, Santos LOD, Alba DCC, Neto MG, Silva EPD.
Show Full Abstract

This research evaluated levels of peanut meal inclusion in diets for laying hens. A total of 200 Hisex White hens, 72 weeks of age, were used in a completely randomized design with five treatments and ten replicates of four hens each. Treatments consisted of replacing soybean meal with peanut meal at 0, 25, 50, 75, and 100%. Over a 70-day period, feed intake, egg production, egg weight, egg mass, feed conversion, and internal and external egg quality were evaluated. Economic analyses of diets and estimates of the carbon footprint were also conducted based on life cycle assessment data of the ingredients. Total replacement of soybean meal with peanut meal did not significantly affect productive performance or egg quality (<i>p</i> > 0.05). Increasing levels of peanut meal inclusion linearly reduced feed cost, providing savings of up to US$ 41.81 per ton. In addition, a progressive reduction in the carbon footprint of the diets was observed, reaching a decrease of 26.37% in CO<sub>2</sub> equivalent emissions. Peanut meal can fully replace soybean meal in laying hen diets without compromising productive performance or egg quality while reducing feed costs and environmental impact.

Also flagged:Memory ImpairmentsViral infectionsmembranebindingorganellememory impairment
Journal Article 2026-05-18 No Snippets Farooqui SA, Santerre M, Shcherbik N, Sawaya BE.
Show Full Abstract

Viral infections of the central nervous system produce memory impairment through mechanisms that extend beyond acute neuronal injury. Herpes simplex virus type 1, human immunodeficiency virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, influenza, SARS-CoV-2, West Nile virus, and Zika virus each enter or engage the brain through distinct routes, yet converge on four shared molecular pathways that selectively damage hippocampal circuits: mitochondria-associated membrane (MAM) dysfunction, chronic neuroinflammation, blood-brain barrier (BBB) disruption, and impaired CREB-BDNF signaling. These pathways specifically compromise the dentate gyrus, CA3, and CA1 subfields, producing predictable deficits in pattern separation, associative retrieval, and temporal memory binding. Antiretroviral and antiviral therapies suppress viral replication but fail to reverse organelle-level dysfunction, leaving most hippocampal injury unaddressed. Emerging plasma biomarkers, p-tau217, neurofilament light chain, and GFAP, combined with hippocampal subfield MRI, now enable mechanistic stratification before irreversible circuit loss occurs. This review proposes, as a unifying hypothesis, that virus-associated memory impairment represents a convergent hippocampal syndrome driven by shared downstream pathways, and that combination therapies targeting these pathways simultaneously offer greater therapeutic promise than pathogen-specific approaches alone. The evidentiary basis for this framework varies across pathogens and conditions; direct mechanistic evidence, mechanistic analogy, and preclinical data are distinguished throughout.

Also flagged:cancerneurodegenerative diseaseshost cellhostbindingmembrane
Journal Article 2026-05-18 No Snippets James K, Kovac A, Majerova P.
Show Full Abstract

The pharmaceutical industry has seen significant growth in the development of antibody-based therapeutics, especially monoclonal antibodies (mAbs) and bispecific antibodies (bsAbs), used in the treatment of cancer and neurodegenerative diseases. However, their production and purification remain challenging. It is difficult to achieve both high product yield and the strict purity required for clinical use. Downstream processing is expensive and often involves trade-offs between efficiency and product quality. In addition, current purification methods do not fully remove contaminants, especially host cell proteins, residual DNA, and protein aggregates, affecting the safety and effectiveness of the final product. Recent advances in purification technologies, such as improved chromatography techniques and alternative separation methods, have shown promise in addressing some of these limitations. Process optimization and the integration of continuous manufacturing approaches are being explored to enhance efficiency and scalability. Furthermore, increased regulatory expectations are driving the need for more robust and reproducible purification strategies. As the antibody therapeutics market continues to expand, optimizing manufacturing and purification processes is crucial to achieve cost efficiency and large-scale production. This article discusses the main challenges in antibody production and downstream purification, focusing on monoclonal and bispecific antibodies, and compares current strategies to increase yield, improve purity, and reduce contaminants.

Also flagged:degenerative disc diseasebone formationporecell adhesioninflammatory responsestranslational
Journal Article 2026-05-18 No Snippets Cheng YH, Fu AL, Gaff J, Vadala G, Jain A, Tavakoli J.
Show Full Abstract

Interbody fusion cages are widely used to restore spinal stability, yet conventional designs often exhibit mechanical mismatch and limited biological integration. Functionally graded spinal cages incorporate spatial variations in composition and structure to better align mechanical properties with the surrounding bone environment. Although these designs have been extensively studied from an engineering perspective, their biological implications remain less clearly defined. This review examines how graded material composition, surface characteristics, porosity, and lattice architecture are associated with cellular and molecular responses relevant to bone regeneration. Reported biological responses include protein adsorption, immune modulation, angiogenesis, and osteogenic differentiation. Evidence from orthopaedic implants and tissue engineering systems suggests that such design features may influence mechanobiological pathways; however, direct experimental validation in spinal applications remains limited. Previous reviews primarily focus on material properties or mechanical performance of functionally graded spinal cages. This review presents a structured design-to-biology perspective linking graded implant features with biological responses relevant to spinal fusion. By integrating findings across biomaterials, mechanobiology, and implant design, this review presents a structured design-to-biology perspective and highlights current evidence, translational limitations, and key knowledge gaps in the field. Functionally graded spinal cages represent a promising but still evolving strategy, and further spine-specific mechanobiological and clinical studies are required to establish their impact on fusion outcomes.

Also flagged:gene expressionimmunotoxicity-19metabolic disorderscardiovascular diseasesimmune dysfunction
Journal Article 2026-05-18 No Snippets Hubab M, Siddique A, Sayadi S, Abu-Dieyeh M, Al-Thani R, Soubra L, Al-Ghouti MA.
Show Full Abstract

Dioxins are highly persistent organic pollutants that exist in soil. Their hydrophobic and lipophilic characteristics facilitate long-term stability, posing high risks to the ecosystem and human health. They can be released by different sources, such as the incineration of waste materials, industrial activities, the production of pesticides, and natural or accidental events like forest fires. Dioxins accumulate in food chains and persist in the environment because dioxins are less volatile as well as chemically stable and can strongly bind to organic matter. The accumulation and persistence of dioxins in aquatic and terrestrial systems make them a significant threat to the environment, even at very low concentrations. This review explains the key sources of dioxin-contaminated soil, including industrial emissions and atmospheric deposition, and assesses the associated risks. The transport, places of contamination, and overall status of dioxins are also highlighted in this study. The review also examines the mechanisms of dioxin toxicity, focusing on their interference with hormonal functions and gene expression, as mediated through the aryl hydrocarbon receptor (AhR). This AhR activation leads to gene responses and causes immunotoxicity, endocrine disruption, and oxidative stress. Furthermore, various remediation strategies like biological, physical, and chemical remediation are discussed here as effective approaches for reducing ecological and health risks and promoting soil sustainability.

CCPG1
Also flagged:Bone disordersosteopeniaosteoporosisosteonecrosis of the jawvertebral fractureskeletal disorders
Journal Article 2026-05-18 ✓ 1 Snippet Khaleel S, Al-Qirim T, Alhusban AA, Aburjai T, El Khassawna T.
In-Text Gene Mentions

…stromal cell CCAR1Cell cycle and apoptosis regulator 1cycle and apoptosis…

Show Full Abstract

Plant-derived compounds exhibit well-documented osteogenic and anti-resorptive activities; however, their translation into consistent skeletal benefits remains limited. This review proposes a transformation-state-dependent framework in which the efficacy of plant-based interventions is interpreted through the exposure architectures they generate rather than solely through intrinsic molecular activity. By integrating plant matrix organization, gastrointestinal processing, microbial biotransformation, and formulation-driven pharmacokinetics with the temporal dynamics of bone remodeling, the review addresses a critical gap in the current literature, which largely evaluates phytochemicals independent of their delivery context. Across a continuum ranging from intact plant matrices to isolated compounds and advanced delivery systems, distinct pharmacokinetic regimes emerge, characterized by differences in release kinetics, metabolic transformation, systemic persistence, and target-site exposure. Representative interventions showing promising pharmacokinetic and skeletal findings include curcumin phytosome systems, resveratrol nanoformulations, icariin-loaded delivery platforms, and matrix-associated polyphenol systems capable of promoting sustained or metabolite-mediated exposure. Evidence indicates that sustained, metabolite-mediated exposure profiles are more compatible with the prolonged, cumulative nature of bone remodeling, whereas transient exposure often limits efficacy despite mechanistic activity. Formulation strategies, including phospholipid complexes, bioenhancers, and nano- or vesicle-based systems, can partially overcome these limitations by modulating exposure behavior. By reframing plant-based interventions as dynamic exposure systems, this framework provides a unifying basis for interpreting variability across studies and offers a rational foundation for designing strategies that align pharmacokinetic behavior with skeletal biology, thereby improving translational potential.

HTT
Also flagged:UFMylationautophagydegradationHuntington's diseasetranslationallysosome
Journal Article 2026-05-18 ✓ 3 Snippets Wang X, Lv X, Jiang H, Zhu W, Cao L, Zhou L, Lin F, Deng R, Hu LF, Ma J, Li JB, Xu G.
In-Text Gene Mentions

…in the huntingtin (HTT) gene.…

…with the mouseHttpromoter.…

…of the humanHTTgene with a…

Show Full Abstract

Ubiquitin-fold modifier 1 (UFM1) covalently modifies protein substrates (UFMylation) and alters their biological functions. Genetic screening disclosed that enzymes in the UFMylation system play critical roles in regulating autophagy. However, it is still elusive which protein is UFMylated and how this modification modulates autophagy. Here, our quantitative proteomics and biochemical experiments identify SQSTM1/p62 as a UFMylation substrate and discover its two major UFMylation sites, K420 and K435. Mutating them to Arg (p62<sup>2KR</sup>) completely abolishes the effect of p62 on autophagic activity. Fusion of UFM1<sup>ΔC4</sup> to p62<sup>2KR</sup> (p62<sup>2KR</sup>-UFM1<sup>ΔC4</sup>) restores the p62-mediated pathogenic autophagic degradation in primary cortical neurons and Huntington's disease mouse striatum. Mechanistically, p62 UFMylation enhances its interaction with LC3, augments autophagic flux, and eliminates pathogenic mutant huntingtin. Collectively, this work discovers a new post-translational modification, UFMylation, on p62 and establishes this modification as a key regulator of autophagy that promotes the clearance of mutant huntingtin, offering a potential target for therapeutic intervention.

Also flagged:malignant neoplasmsinfectionsosteomyelitisperiodontitisosteoporosisskeletal disorders
Journal Article 2026-05-18 No Snippets Zhao Y, Cao N, Yang W, Wang Y, Wang W.
Show Full Abstract

E3 ubiquitin ligases are key determinants of substrate specificity within the ubiquitin-proteasome system and have emerged as important regulators of skeletal biology. Although traditionally classified into RING-, HECT-, and RBR-type families based on structural features, their roles in bone homeostasis are more clearly understood when examined in the context of specific skeletal regulatory processes. In this review, we briefly outline major E3 ligase families and the updated human E3 ligase landscape, and then discuss how representative E3 ligases regulate osteoblast differentiation, osteoclast differentiation, cartilage homeostasis, and bone remodeling. A central concept emerging from current evidence is that E3 ligases converge on critical regulatory nodes that govern skeletal cell fate and tissue-level remodeling. In osteogenesis, multiple E3 ligases control RUNX2 stability, transcriptional activity, and associated signaling pathways, including the BMP/SMAD and PI3K/Akt pathways. In osteoclast differentiation, E3 ligases primarily modulate TRAF6-dependent signaling and NF-κB activation, thereby influencing bone resorption. Beyond these lineage-specific roles, E3 ligases also participate in higher-order processes such as osteoblast-osteoclast coupling, osteoimmune regulation, mitochondrial quality control, and cartilage matrix homeostasis, highlighting their roles as process-level regulators of skeletal homeostasis. We further summarize how dysregulation of E3 ligase-mediated pathways contributes to common skeletal disorders, including osteoporosis, inflammatory bone loss, degenerative diseases, and therapy-associated complications. Finally, we discuss emerging pharmacological strategies targeting E3 ligases and E3-dependent pathways, including modulation of ubiquitination signaling and targeted protein degradation. Collectively, this review underscores the central roles of E3 ubiquitin ligases in integrating skeletal regulation and highlights their potential as therapeutic targets in bone-related diseases.

Also flagged:Prostate Cancerneuroendocrineprostate tumorCRPCtumorciliogenesis
Journal Article 2026-05-18 No Snippets Guo Y, Peng S, Jamet T, Firlej V, Irondelle M, Nau C, Girard CA, Asrani K, Lotan TL, Huc R, Soyeux P, Rouleau M, Lacas-Gervais S, Rovini A, Luciano S, Humbert O, Schiappa R, Pujalte-Martin M, Vigneau M, Peraldi P, Bost F, Lazennec G, Vacherot F, Mazure NM.
Show Full Abstract

Primary cilia are increasingly recognized as regulators of cellular signaling and plasticity. Here, we examined their distribution and potential relevance in neuroendocrine (NE) prostate cancer. While typically absent in localized hormone-sensitive prostate tumor cells, we detected primary cilia in neuroendocrine-like cells both <i>in vitro</i> and in castration-resistant prostate cancer (CRPC) samples. <i>In vivo</i>, cilia were consistently observed in CRPC tumor cells exhibiting FDG-PET positivity and NE features, supporting an association between ciliogenesis, metabolic reprogramming, and disease progression. These aggressive tumors also displayed reduced mitochondrial activity, consistent with a shift away from oxidative metabolism. Building on our work in ccRCC, we identified a GLI1⁺/IFT20⁺ or GLI1⁺/IFT80⁺ signature enriched in ciliated, NE-prone subpopulations. <i>In vitro</i>, YAP1 inhibition alone did not induce ciliogenesis, whereas cytoskeletal remodeling with jasplakinolide restored cilium assembly and enabled partial NE transdifferentiation. Single-cell RNA-seq analyses further showed enrichment of ciliogenesis-related genes within NE clusters in CRPC. Together, these observations support a model in which primary cilia are closely associated with NE identity and metabolic adaptation, rather than serving solely as passive markers, and suggest a structural-metabolic axis that may represent a source of biomarkers and therapeutic vulnerabilities.

Also flagged:phosphorescenceconjugationmembranemembranesbiosynthesisbinding
Journal Article 2026-05-18 No Snippets Wu S, Zhou Y, Wu W, Tang Y, Jing M, Zhang J, Zhang H, Zhao Z, Wang J, Maron L, Liu L.
Show Full Abstract

Room temperature phosphorescent (RTP) molecules, owing to their unique afterglow characteristics, can translate microscopic electronic transitions into macroscopic smart responses, and have gradually emerged as a research hotspot in the field of smart molecules. Benefiting from the renewability, biocompatibility, and structural tunability of cellulose, these materials provide an ideal and sustainable platform for constructing RTP systems. Significant progress has been made in this field, leading to the emergence of numerous cellulose-based RTP material systems with novel structures and excellent performance. This review summarizes recent advances in RTP systems cellulose derivatives. First, it elucidates the underlying mechanisms of cluster-triggered emission, followed by a detailed discussion of four key construction strategies: regulation of aggregation structures, reconstruction of clustered emission centers, hydroxyl functionalization, and host-guest doping. In addition, innovative applications in information security and environmental monitoring are highlighted. Finally, current challenges are discussed, and perspectives on the rational design of future biomass-based RTP materials are provided.

HFE
Also flagged:metabolic diseasesliver fibrosisliver diseasedegranulationCx3cl1efferocytosis
Journal Article 2026-05-17 ✓ 1 Snippet Eom JA, Park IG, Hyun JY, Lee NY, Kwon GH, Yoon SJ, Won SM, Ham YL, Lee KJ, Han SH, Yang DH, Kim DJ, Suk KT.
In-Text Gene Mentions

…mmune hepatitis, pancreatitis,hemochromatosis, Wilson’s disease, cancer,…

Show Full Abstract

Phocaeicola dorei has been reported to ameliorate metabolic diseases. Its role in liver fibrosis remains unclear. We evaluated the hepatoprotective effect of P. dorei in liver fibrosis. Fecal samples were collected from healthy controls and patients (n = 285) to assess the clinical relevance of P. dorei. In male mice models (3,5-diethoxycarbonyl-1.4-dihydrocollidine [DDC] diet), P. dorei (10<sup>9</sup> CFU/g twice/week) was orally administered. Primary HSCs, LX-2, THP-1, and HL-60 cell lines were used for mechanical validation. The relative abundance of P. dorei increased with worsing liver disease in human. P. dorei administration significantly reduced neutrophil degranulation and efferocytosis pathways (Ly6g and F4/80). The dysregulated expression of neutrophil-associated chemokines (Cx3cl1 and Cx3cr1) was restored by P. dorei. P. dorei culture supernatant inhibited macrophage-mediated efferocytosis. P. dorei attenuates liver fibrosis by suppressing neutrophil and macrophage infiltration and disrupting efferocytosis. Our results identify P. dorei as a potential microbiome-based therapeutic candidate for cholestatic liver fibrosis.

HTT
Also flagged:Alzheimer's DiseaseADbinding
Journal Article 2026-05-17 ✓ 1 Snippet Jin S, Liu D, Ouyang J.
In-Text Gene Mentions

…CASP3 (Caspase 3),HTT(Huntingtin), TH (Tyrosine…

Show Full Abstract

<h4>Introduction</h4>Benzo[a]pyrene (BaP) exposure is increasingly associated with the progression of Alzheimer's Disease (AD), yet the specific molecular links remain poorly understood. This study utilizes an integrated computational framework, combining network toxicology, machine learning, and molecular dynamics simulations, to identify core biomarkers and elucidate the potential pathological interplay between BaP and AD.<h4>Methods</h4>We began our analysis by identifying the intersection of targets and then created a Protein-Protein Interaction (PPI) Network to identify hub genes. To ensure accuracy, we selected final core molecular targets from the intersection of three distinct types of machine learning algorithms. To validate diagnostic value, immune cell infiltration data analysis was performed using the GSE138260 dataset. Finally, we used molecular docking and 100 ns dynamics to assess how BaP interacts with the core molecular target.<h4>Results</h4>We identified four proteins associated with BaP and AD: CASP3 (Caspase 3), HTT (Huntingtin), TH (Tyrosine Hydroxylase), and PARK7 (DJ-1). These proteins signal neuronal apoptosis and neuro-immune dysregulation due to their involvement in pathways associated with these processes. The Receiver Operating Characteristic (ROC) analysis demonstrated strong diagnostic properties for these targets. Molecular docking data also showed BaP as the main target, with TH binding with a value of -10.02 kcal/mol. The stability of this BaP-TH complex was further confirmed by 100 ns molecular dynamics simulations.<h4>Discussion</h4>The research reveals TH's critical effect on BaP-induced neurotoxicity. We also identify the potential molecular mechanisms contributing to Alzheimer's disease pathology via environmental exposure.<h4>Conclusion</h4>This research identifies several significant molecular interactions between BaP and AD. One major molecular target for BaP interaction with AD is tyrosine hydroxylase (TH). Our findings here create an opportunity for the development of therapeutics for the treatment of AD cases caused by exposure to environmental toxins.

PEBP1
Also flagged:Ferroptosiscancer-induced cardiomyopathydetoxificationcell deathdegradation
Journal Article 2026-05-17 ✓ 2 Snippets Le Y, Zhao Y, Guo J, Luo JZ, Xu J, Yuan A, Wang FX, Wang HS, Lu D, Wang CY.
In-Text Gene Mentions

…levels of the ALOX15-PEBP1complex, and key…

…formation of the ALOX15/PEBP1complex, and in…

Show Full Abstract

<h4>Background</h4>Doxorubicin (DOX) is a cornerstone of current cancer treatment. However, its clinical application is significantly limited by doxorubicin-induced cardiomyopathy (DIC), with ferroptosis of cardiomyocytes being a primary factor in the development of DIC. It is therefore imperative that new strategies targeting ferroptosis are developed with a view to alleviating DIC. Tetrastigma hemsleyanum Diels et Gilg is a plant that has been utilized in traditional Chinese medicine for a variety of purposes, including detoxification, antitumour activity, anti-inflammatory effects, and cardiovascular protection.<h4>Purpose</h4>Thisstudy aims to investigate the effects of β-carboline alkaloids isolated from T. hemsleyanum on ferroptosis in cardiomyocytes, as well as the potential cardioprotective effects of the preferred compound and its role in DIC.<h4>Methods</h4>Four β-carboline alkaloids isolated from T. hemsleyanum were screened for their ability to inhibit ferroptotic cell death in cardiomyocytes. Comprehensive studies have elucidated the role of desbromoarborescidine A (DesA, compound 2) in mitigating doxorubicin-induced cardiac damage and ferroptosis in mouse hearts, as well as its regulatory mechanisms. The cardiac protective effects of DesA on DIC mice were assessed by measuring cardiac function indicators, cardiac tissue damage, inflammation, and fibrosis levels. Subsequent analyses were conducted using Western blotting, immunohistochemistry, immunoprecipitation, and molecular docking in order to detect ALOX15 degradation, the expression levels of the ALOX15-PEBP1 complex, and key indicators associated with ferroptosis.<h4>Results</h4>A novel β-carboline alkaloid desbromoarborescidine E (DesE, compound 1) along with three known tetrahydro-β-carboline alkaloids, all showed the anti-ferroptotic activity, which were isolated from the aerial parts of T. hemsleyanum. It is noteworthy that DesA treatment markedly alleviated doxorubicin-induced cardiac dysfunction, ferroptosis and fibrosis in mice. From a mechanistic perspective, DesA can bind to ALOX15 and promote its ubiquitination and degradation, thereby inhibiting the formation of the ALOX15/PEBP1 complex, and in turn this limits doxorubicin-induced lipid peroxidation and ferroptosis.<h4>Conclusion</h4>These findings demonstrate that DesA protects against DOX-induced cardiomyocyte lipid peroxidation and ferroptosis in cardiac injury by targeting the ALOX15 pathway. Consequently, DesA is a promising lead compound for the development of novel therapeutic agents to treat clinical doxorubicin-induced cardiomyopathy.

HTT
Also flagged:Huntington's DiseaseAnkylosing SpondylitisHDASautosomal-dominant neurodegenerative disordercognitive
Journal Article 2026-05-17 ✓ 1 Snippet Gurskaia R.
In-Text Gene Mentions

…repeat in theHTTgene, resulting in…

Show Full Abstract

Huntington's disease (HD) and ankylosing spondylitis (AS) are genetically and pathophysiologically distinct conditions, and their concurrent management may present a complex clinical challenge. A case is reported of a 35-year-old man with genetically confirmed HD and concurrently diagnosed AS, treated with autologous mesenchymal stem cell (MSC) therapy over three consecutive monthly sessions (50 million MSCs per session, total 150 million administered, intravenous and epidural routes). Validated disease-specific assessments were performed at each visit by the treating neurologist before the cell administration of that day: the Unified Huntington's Disease Rating Scale motor score (UHDRS motor), the Bath Ankylosing Spondylitis Functional Index (BASFI), and the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI). Three serial assessments captured changes from baseline (cumulative dose 0) through cumulative doses of 50 million and 100 million MSCs, after which the third (final) dose was administered without subsequent reassessment. Over the two-month observation period, UHDRS motor score declined from 19 to 2, BASFI from 4.0 to 1.0 (with a transient increase to 8.5 at the second visit), and BASDAI from 2.0 to 1.0. No serious short-term adverse events were observed during the active treatment period. Given the single-patient design, concurrent pharmacotherapy, unblinded assessment, absence of objective biomarkers, and absence of post-third-dose assessment, causal attribution to MSC therapy cannot be established. The observation is presented as hypothesis-generating and warrants further investigation under controlled conditions.

Also flagged:Mucosal melanomacutaneous melanomamelanomamelanomasmetastatic diseasetumor
Journal Article 2026-05-16 No Snippets Mao L, Lai Y, Zheng H, Cui M, Li L, Liu Z, Zhou H, Sun L, Li C, Wei X, Gu J, Bai X, Kong Y, Cui C, Chi Z, Sheng X, Lian B, Li S, Yan X, Tang B, Li J, Zhou L, Wang X, Guo J, Dai J, Si L.
Show Full Abstract

Mucosal melanoma is an aggressive malignancy with limited neoadjuvant options. We conducted a single arm, phase II study of neoadjuvant pembrolizumab plus lenvatinib followed by surgery and adjuvant pembrolizumab in resectable mucosal melanoma (NCT04622566) along with exploratory biomarker analysis. Primary objective was pathological complete response (pCR) rate; secondary endpoints included relapse-free survival (RFS), overall survival (OS), clinical response, surgical outcomes, and safety. Among 21 surgical patients, the pCR rate was 9.5%, major pathologic response (MPR) rate was 19.0%, and the pathologic response rate was 38.1%. Median RFS was 14.8 months (1-year rate: 61.9%); median OS was not reached. No grade 4-5 treatment-related toxicities or additional perioperative complications occcurred. Spatial profiling revealed a more immune-inflamed baseline microenvironment in responders, with activated CD4⁺/CD8⁺ T cell signatures associated with favorable outcomes. Treatment induced vascular normalization and increased T cell infiltration in non-responders, partially narrowing the immune gap. Responders exhibited higher prevalence of persistent TCR clonotypes and tighter spatial proximity between activated CD4⁺ and CD8⁺ T cells. Although the pre-specified primary endpoint was not met, our findings identify activated CD4<sup>+</sup>/CD8<sup>+</sup> T cell states and TCR persistence as key outcome-associated features, supporting immune-informed optimization of peri-operative therapy in mucosal melanoma.

Also flagged:Colorectal cancercancertumorcell surfacemitochondriaperoxisomes
Journal Article 2026-05-16 No Snippets Lee SW, Park SJ, Lee GE, Jung SM, Lee J, Kwon S, Yeom E, Lee DS, Choi EH.
Show Full Abstract

<h4>Background</h4>Cancer stem cells (CSCs) support colorectal cancer progression and therapy resistance, yet the redox regulators that sustain CSC identity are incompletely defined. We investigated the role of peroxiredoxin 5 (PRX5) in CSC formation and tumorigenicity using HCT116 colorectal cancer models.<h4>Methods</h4>CSCs were enriched by serum-free spheroid culture and characterized by qPCR and western blotting for pluripotency and surface markers. PRX5 expression was regulated via siRNA or shRNA gene disruption and overexpression. Intracellular ROS was measured with DCF-DA staining. STAT3 activation was analyzed by <i>p</i>-STAT3 immunoblot. Functional assays included sphere formation, extreme limiting dilution analysis (ELDA), colony formation, and <i>in vivo</i> xenograft tumorigenicity in BALB/c-nu mice.<h4>Results</h4>Spheroid induction selectively upregulated PRX5 among PRX isoforms. Efficient PRX5 knockdown (>95%) reduced OCT4, SOX2, NANOG, and CD133 expression, increased intracellular ROS, lowered <i>p</i>-STAT3 levels, and decreased sphere-forming frequency. Conversely, PRX5 overexpression enhanced pluripotency marker expression and proliferation. <i>In vivo</i>, PRX5-overexpressing xenografts grew faster, achieving a 2.5-fold greater tumor volume by day 19 and a 1.82-fold higher mean tumor weight compared with controls. Tumor tissues showed elevated OCT4, SOX2, NANOG, CD133, and EPCAM.<h4>Conclusion</h4>PRX5 contributes to maintaining a redox environment associated with STAT3 activation and core stemness programs in CRC, promoting CSC phenotypes and tumorigenicity. Targeting PRX5-mediated redox signaling may warrant further investigation as a potential approach to disrupt CSC maintenance and overcome chemoresistance.

CACNA1E
Also flagged:depolarizationsmembranedepolarizationporeresponse topore-forming
Journal Article 2026-05-16 ✓ 1 Snippet Angelini M, McVicar M, Maxfield S, Sokolowski M, Narang S, Scranton K, Yasarbas SS, Savalli N, John SA, Schwingshackl A, Neely A, Pantazis A, Ottolia M, Olcese R.
In-Text Gene Mentions

…CACNA1B : Q00975-1,CACNA1E: Q15878-1, CACNA1G…

Show Full Abstract

Low-voltage-activated (LVA, T-type, or Ca<sub>V</sub>3), calcium-selective channels open in response to modest depolarizations, just above the resting membrane potential, supporting neuronal burst-firing patterns and spontaneous firing in cardiac pacemaker cells. How LVA-channels open at low voltages is unclear: traditional gating-current experiments suggest that LVA-channel voltage-sensing domains (VSDs) paradoxically require stronger depolarization to activate than pore opening. Using voltage-clamp fluorometry, we find that the activation of all four VSDs in human Ca<sub>V</sub>3.1-channels precedes opening in voltage, solving the longstanding conundrum. We also uncover confounding effects of La<sup>3+</sup> (used for gating-current measurements) on VSD function and clarify the role of distinct LVA-channel structure S6<sup>Cyto</sup>. Ca<sub>V</sub>3.1-VSDs operate within a narrow voltage-range, resembling the VSDs of related Na<sub>V</sub>-channels more than those of other Ca<sub>V</sub>-channels. Likely, Na<sub>V</sub>-like VSDs emerge before sodium selectivity.

SOX6
Also flagged:solid tumorNBchromosomecell proliferationtumorchromatin
Journal Article 2026-05-16 ✓ 2 Snippets Zhang X, Yang Y, Zhang M, Fan K, Huang Z, Zhang Y, Kong L, Chen Q, Tan R, Zhang S, Yu D, Xiong X, Wu K.
In-Text Gene Mentions

…UROD1, NB-MKI67, NB-STAT1, NB-SOX6, NB-CSMD1, and NB-HOXC8…

…Point 1 toward NB-SOX6and NB-HOXC8 differentiation…

Show Full Abstract

<h4>Background</h4>Neuroblastoma (NB) is the most common extracranial solid tumor in children and is characterized by marked clinical heterogeneity and poor prognosis. MYCN amplification drives NB tumorigenesis through epigenetic reprogramming and is frequently accompanied by a copy-number gain of the long arm of chromosome 17 (17q). Epigenetic dysregulation of enhancer landscapes-particularly large regulatory elements termed super‑enhancers (SEs), which are enriched for H3K27ac and bound by lineage-specific master transcription factors (TFs)-establishes distinct NB cellular identities and states. These SE domains demarcate oncogenes that function as critical regulators of cell proliferation and apoptosis. Therefore, SE-driven genes represent tumor vulnerabilities, offering selective therapeutic opportunities.<h4>Methods</h4>By integrating ATAC-seq data from 22 NB cell lines, the intratumoral heterogeneity of MYCN-amplified NB was characterized at the level of chromatin accessibility. Subsequently, based on H3K27ac ChIP-seq data from 38 NB cell lines, the ROSE algorithm was employed to identify SE-driven oncogenes. The synergistic mechanism between MYCN amplification and the 17q SE-driven gene MSI2 was investigated through genome‑wide CRISPR/Cas9 loss‑of‑function screens. At single‑cell resolution, we conducted a comprehensive analysis of the characteristics of heterogeneous tumor subpopulations and their immune microenvironment features. This analysis was performed using multiple bioinformatics workflows, including AUCell scoring, SCENIC analysis, copy‑number inference, cell differentiation‑state evaluation, neighborhood abundance tests, and separability tests. Finally, functional validation was performed using NB cell lines (MYCN‑amplified and non‑amplified) to assess gene perturbations.<h4>Results</h4>Pronounced epigenetic heterogeneity was observed within MYCN-amplified NB. MSI2 is an SE‑driven oncogene and is highly expressed in MYCN‑amplified NB. MSI2 and MYCN are co-expressed, may be mutually dependent, and are both correlated with cell cycle-related pathways. At the single-cell level, we identified and redefined an NB-MSI2 + MYCN+ subtype characterized by malignant transcriptional features, an immunosuppressive microenvironment, and poor patient prognosis. Building on this, combined targeting of MSI2 and MYCN markedly reduced proliferation and migration in MYCN‑amplified NB cells.<h4>Conclusions</h4>The NB‑MSI2 + MYCN+ subtype defines a clinically aggressive, therapy‑refractory state characterized by high proliferation, metabolic reprogramming, and immunosuppression. For patients with MYCN-amplified NB, MSI2 is both a prognostic biomarker and a candidate therapeutic target.

Also flagged:hematologic malignanciesdegradationlymphomatumorCancerchronic lymphocytic leukemia
Journal Article 2026-05-16 No Snippets Li Z, Xu S, Jiang X, Yang X, Cui S, Lu Y, Duan X, Zheng J.
Show Full Abstract

<h4>Background</h4>Chlorambucil (<b>CLB</b>) is a clinically effective alkylating agent for hematologic malignancies; however, its therapeutic application is severely hampered by poor aqueous solubility, rapid hydrolytic degradation in physiological fluids, and dose-dependent systemic toxicity. Conventional nanocarriers offer partial solutions but are limited by low drug loading (<10%) and complex fabrication. Prodrug strategy constructed by covalent modification of anticancer drugs can overcome these limitations, enabling improved physicochemical properties and tumor-specific drug release.<h4>Methods</h4>An amphiphilic prodrug (<b>CLB-THAM</b>) was synthesized by conjugating <b>CLB</b> to tromethamine (<b>THAM</b>), a pharmacopeial excipient with GRAS status. The prodrug was formulated into nanomicelles via nanoprecipitation and characterized by DLS and TEM. Hydrolytic stability, in vitro cytotoxicity against A20 lymphoma cells, apoptosis induction, cellular uptake, and in vivo antitumor efficacy in a syngeneic mouse model were systematically evaluated.<h4>Results</h4><b>CLB-THAM</b> spontaneously self-assembled into monodisperse nanomicelles (91.8 nm, PDI 0.103) with an unprecedented drug loading of 70.5%. Using A20 cells as experimental models, the cytotoxic effects of <b>CLB-THAM</b> nanomicelles were investigated at 0-100 μmol/L for 24 h. Notably, the cell viability of <b>CLB-THAM</b> nanomicelles to A20 cells was significantly lower compared with free CLB (45.6% vs. 74.5% at 100 μM), with correspondingly higher apoptosis induction (48.5% vs. 39.0% at 30 μg·mL<sup>-1</sup>). In vivo, the nanoformulation achieved superior tumor suppression in A20 tumor-bearing mice (final tumor volume 421 mm<sup>3</sup> vs. 610 mm<sup>3</sup> for free CLB and 1424 mm<sup>3</sup> for saline), while maintaining excellent hemocompatibility (hemolysis <5%) and minimal systemic toxicity as evidenced by body weight stability and histopathological analysis.<h4>Conclusion</h4>This carrier-minimized prodrug platform concurrently overcomes the solubility, stability, and toxicity bottlenecks of nitrogen mustard chemotherapy, offering a simple and translatable strategy for enhancing the clinical efficacy of chlorambucil.

SOX6
Also flagged:ossificationangiogenesishematopoiesiscell differentiationbone formationinjury
Journal Article 2026-05-16 ✓ 1 Snippet Li YY, Huang S, Hu O, Qin Q, Yan P, Lin P, Wang YB, Jin HJ, Wu J, Wu YT, Luo N, Ma QH, Cai RL, Xie YL, Chen L, Gan YB, Liu P, He J.
In-Text Gene Mentions

…oprogenitor (highly expressingSox6/9 ), Chondrocyte (highly…

Show Full Abstract

<h4>Background</h4>Skeletal stem/progenitor cells (SSPCs) are pivotal orchestrators of embryonic skeletogenesis, underlying chondrogenesis and osteogenesis, however, the molecular determinants governing SSPC functionality remain elusive.<h4>Methods</h4>We performed single-cell RNA sequencing (scRNA-seq) to delineate cellular heterogeneity within the developing limb bud and to identify candidate cellular markers. The spatiotemporal distribution of target cell populations was further examined via immunofluorescence staining. Fluorescence-activated cell sorting (FACS) was used to isolate endothelial cells and SSPCs based on surface markers. Functional properties of these cells were assessed using in vitro assays, and direct co-culture experiments were conducted to evaluate intercellular communication and underlying molecular pathways.<h4>Results</h4>We delineate a CD140a <sup>+</sup> PDPN <sup>+</sup> SSPC population characterized by robust self-renewal and multipotency, peaking in abundance at embryonic day 14.5. Concomitantly, we resolved the heterogeneity within endothelial cell (EC) populations during embryonic angiogenesis, identifying a distinct subpopulation exhibiting high Pecam1 and low Emcn expression (recapitulating type E). Critically, SSPCs manifested enhanced chondrogenic differentiation potential and type II collagen synthesis when co-cultured specifically with type E ECs, highlighting an indispensable role in endochondral ossification during long bone formation. Mechanistic intercellular crosstalk analyses demonstrated that BMP signaling plays an essential role in modulating type E endothelial cell-mediated regulation of SSPC potency through the coordinated actions of transcription factors ID1, MSX2, and SOX9. Notably, pharmacological inhibition of BMP signaling abolished the pro-chondrogenic and pro-osteogenic enhancement conferred by type E ECs upon SSPCs.<h4>Conclusion</h4>These findings uncover a fundamental mechanism of long bone development mediated by CD140a <sup>+</sup> PDPN <sup>+</sup> SSPCs and modulated by type E ECs. This reciprocal, bipotent coupling between skeletogenesis and angiogenesis provides a conceptual framework for understanding skeletal development and homeostasis, proffering novel therapeutic avenues for associated pathologies.<h4>The translational potential of this article</h4>By elucidating the regulatory function of type E endothelial cells in orchestrating chondrogenic priming during embryonic skeletogenesis, this study unveils potential therapeutic strategies for bone regeneration through targeting the vascular network.

Also flagged:Proteostasisdeathneurodegenerative diseaseschronic mental illnessesmethylationneurodegenerative disease
Journal Article 2026-05-16 No Snippets Šmon J, Juković M, Kršanac M, Samardžija B, Videtič Paska A, Žerovnik E, Kouter K, Bradshaw NJ.
Show Full Abstract

Suicide is a major public health concern and cause of death worldwide. While progress has been made in understanding molecular pathways involved in suicide, much more work is needed to identify clinically useful biomarkers of suicidality. Disturbed cellular proteostasis and aggregation of specific misfolded proteins are established pathological factors of neurodegenerative diseases. Increasing evidence also suggests that such aggregates often occur in patients with chronic mental illnesses. Recently, genes related to disturbed proteostasis showed differential methylation in individuals who died by suicide compared to controls. These include five genes encoding proteins that aggregate in neurodegenerative and/or mental illness: <i>CRMP1</i> (also called <i>DPYSL1</i>), <i>DISC1</i>, <i>MAPT</i> (encoding the Tau protein), <i>PRKN</i> (also called <i>PARK2</i>, encoding Parkin), and <i>SOD1</i>. Given the possibility that altered methylation in these genes could affect expression of the proteins they encode, we aimed to review evidence for whether disturbed proteostasis may be a point of overlap between suicidality, neurodegenerative disease, and/or mental illnesses. Epigenetic changes in most of these genes also occur in other neurological disorders. Autophagy, and, to a lesser extent, the ubiquitin-proteasome system, are emerging as potentially impaired in individuals with suicidal tendencies and individuals who died by suicide. Based on this accumulated data, we hypothesise that disturbed proteostasis is likely to be a pathological component of suicidality. It is also plausible that this may lead to the accumulation of aggregated proteins in a similar manner to, and potentially overlapping with, those seen in major mental illnesses. If true, this would have consequences for potential identification of biomarkers for suicidality and should be a priority for future research in the field.

SOX6DCC
Also flagged:Epilepsygene expressionchronic neurological disorderTemporal lobe epilepsyfocal epilepsy-
Journal Article 2026-05-16 ✓ 2 Snippets Chen J, Zhao B, Yang K, Mi W, Huang X, Jiang W, Hu C, Wang Z, Zhang Y, Li X.
In-Text Gene Mentions

…through interaction withDCC receptorsreceptors, implicating it…

…highly expressed PCDH15,SOX6, and BCAS1, were…

Show Full Abstract

Epilepsy is mainly characterized by spontaneous seizures caused by hyperactive neural circuits. To delineate the cell-type-specific mechanisms underlying neuronal hyperexcitability, we resolve the hyperexcitability of excitatory neurons across epileptic human brain trans-foci at single-cell resolution to identify the key drivers and potential diagnostic signatures. We constructed a comprehensive atlas encompassing 240,000 cells derived from the temporal cortex and hippocampus, detecting trans-regional cellular and molecular diversity. We further delineated dynamic trajectories, gene expression patterns, and functional reorganization across cell types. Using the LASSO and random forest algorithms, we prioritized the core genes and developed a logistic regression-based diagnostic model. Despite transregional cellular landscape conservation, major cell types varied in abundance. Detailed analysis delineated various excitatory neuron subtypes' dynamic trajectories, intricate expression, and functional reorganization, with pronounced dysfunction in the posterior hippocampal and temporal cortex networks, indicating hyperactive pro-epileptic effects. Excitatory neurons exhibit an intrinsic ability to autonomously organize themselves into distinct, highly active modules, characterized by a high activation state during epileptogenesis, as illustrated by ten epilepsy-associated functions. Transcription circuits FOSL2/FOS/EGR3/EGR1 promote neuronal hyperexcitability. Integrating epilepsy bulk RNA-seq data, we identified 24 overlapping genes between differential genes and circuit targets. The LASSO and random forest algorithms prioritized three core genes (IL1B, SOCS6, and COL4A1). A logistic regression model based on these three genes showed variable performance, with an apparent AUC of 1.000 in the discovery cohort (GSE256068) and AUCs of 0.974 and 0.722 in and two validation cohorts, indicating the need for further validation. Our study establishes the FOSL2/FOS/EGR3/EGR1 circuit as a master regulator of pathological neuronal hyperactivity across epileptic foci, linking transcriptional activation to network dysfunction. Identifying overactive factors may represent a candidate molecular pathway for future therapeutic exploration against hyperexcitability.

Also flagged:Coronary Artery Stenosiscoronary artery diseasecoronary stenosisStenosischronic coronary syndromeobstructive disease
Journal Article 2026-05-16 No Snippets Nguyen D, Duong SP, Tran TV, Nguyen HTT, Tran TN, Chu VV, Nguyen OKT.
Show Full Abstract

<h4>Background</h4>Coronary computed tomography angiography (CCTA) is an established noninvasive imaging modality for evaluating suspected coronary artery disease (CAD). However, data describing the pattern of coronary stenosis and the extent of significant disease in patients undergoing modern 640-row CCTA remain limited.<h4>Methods</h4>This single-center cross-sectional study included 390 consecutive patients with suspected CAD who underwent 640-row CCTA between May 2021 and May 2022. Stenosis severity was assessed according to the coronary segment and major vessel involvement. Clinically significant stenosis was defined as luminal narrowing of ≥50% in the left main coronary artery (LM) or ≥70% in the left anterior descending, right coronary, or left circumflex arteries. The extent of significant CAD was categorized as single-vessel disease, two-vessel disease, or left main/three-vessel disease.<h4>Results</h4>The mean age of the study population was 58.4±10.4 years, and 209 patients (53.6%) were men. Women were older than men (61.4±10.3 vs. 55.8±10.1 years, p<0.001). Myocardial bridging was identified in 115 patients (29.5%) and was more common in men than in women (73/209 (34.9%) vs. 42/181 (23.2%), p=0.011). Across all coronary segments, most lesions were classified as none-to-moderate stenosis, whereas severe stenosis and total occlusion were less frequent. CCTA-detected significant stenosis was observed in 120 patients (30.8%), while 270 patients (69.2%) had non-significant stenosis. Single-vessel disease, two-vessel disease, and left main or three-vessel disease were present in 46 (11.8%), 41 (10.5%), and 33 patients (8.5%), respectively. Patients older than 60 years had significantly higher proportions of significant stenosis in the left main artery, left anterior descending artery (LAD), right coronary artery (RCA), and left circumflex artery (LCx) (all p<0.001). Among patients with significant CAD, the extent of disease differed by sex in the older age group but not in the younger age group.<h4>Conclusions</h4>In patients undergoing 640-row CCTA for suspected CAD, significant coronary stenosis was common and strongly associated with older age. Older men with significant CAD were more likely to have extensive disease, while myocardial bridging was more frequent and common in men. These findings highlight the clinical value of 640-row CCTA in the detailed characterization of coronary stenosis patterns in routine clinical practice.

SOX6
Also flagged:neuron differentiation-nucleusPDneurogenesisParkinson's disease
Journal Article 2026-05-15 ✓ 5 Snippets Kim TW, Piao J, Bocchi VD, Koo SY, Choi SJ, Chaudhry F, Yang D, Cho HS, Hergenreder E, Ruiz Perera L, Joshi S, Abou Mrad Z, Claros N, Donohue SA, Eun Im Y, Jeong HJ, Frank AK, Walsh RM, Mosharov EV, Betel D, Tabar V, Studer L.
In-Text Gene Mentions

…) within theSOX6+ lineage, marking a…

…identified A9 (SOX6+ ) and…

…expressing ALDH1A1 ,SOX6, and LMO3 ;…

…defined A9 (SOX6positive neurons) and…

…enriched for adultSOX6+ and CALB1+ mDA…

Show Full Abstract

While clinical trials of human pluripotent stem cell-derived midbrain dopamine (mDA) neuron precursor grafts for Parkinson's disease (PD) are ongoing, current protocols remain suboptimal. In particular, the yield of TH+ mDA neurons after in vivo grafting and the expression of certain mDA neuron and subtype-specific markers require improvement. Single-cell transcriptomic analyses of grafts have revealed low proportions of mDA neurons and substantial off-target contamination. Here, we present an optimized mDA neuron differentiation strategy that builds on our clinical-grade ("Boost") protocol by adding FGF18 and IWP2 treatment ("Boost+") at the neurogenesis stage. Boost+ mDA neurons show higher expression of EN1, PITX3, and ALDH1A1. Improvements in mDA neuron yield and transcriptional similarity to primary mDA neurons are observed in vitro and following transplantation. Single-nucleus RNA sequencing demonstrates enrichment of A9 mDA neurons within Boost+ grafts. Functional studies in vitro demonstrate increased dopamine production and release and improved electrophysiological properties. In vivo analyses show higher percentages of TH+ mDA neurons, resulting in efficient rescue of amphetamine-induced rotation behavior in the 6-OHDA rat model and rescue of deficits in some nondrug-induced assays, including the ladder rung assay, which are not improved by Boost mDA neurons. The Boost+ conditions present an optimized differentiation protocol with advantages for disease modeling and mDA neuron grafting paradigms.

CACNA1E
Also flagged:behavioralsubstance use disorderaddictionnucleuswithdrawal anxietyinfection
Journal Article 2026-05-15 ✓ 5 Snippets Bartas K, Derdeyn P, Tian G, Vasquez JJ, Azouz G, Yamamoto CM, Hui M, Beier KT.
In-Text Gene Mentions

…AAGGGTTCATACCTCCGTAA ) forCacna1e.…

…in mice withCacna1edownregulation in NAcLat,…

…CRISPRi knockdown ofCacna1eexpression levels, 10…

…(5 mice forCacna1egRNA and 3…

…for normalization ofCacna1emRNA levels.…

Show Full Abstract

Addictive drugs cause long-lasting changes in connectivity from inputs onto ventral tegmental area dopamine cells (VTA<sup>DA</sup>) that contribute to drug-induced behavioral adaptations. However, it is not known which inputs are altered. Here, we used a rabies virus (RABV)-based mapping strategy to quantify RABV-labeled inputs to VTA cells after a single exposure to one of a variety of misused drugs - cocaine, amphetamine, methamphetamine, morphine, and nicotine - and compared the relative global input labeling across conditions. We observed that all tested addictive drugs elicited similar input changes onto VTA<sup>DA</sup> cells, in particular onto DA cells projecting to the lateral shell of the nucleus accumbens and amygdala. In addition, repeated administration of ketamine/xylazine to induce anesthesia induces a change in inputs to VTA<sup>DA</sup> cells that is similar to but different from those elicited by a single exposure to addictive drugs, suggesting that caution should be taken when using ketamine/xylazine-based anesthesia in rodents when assessing motivated behaviors. Furthermore, comparison of viral tracing data to an atlas of gene expression in the adult mouse brain showed that the basal expression patterns of several gene classes, especially calcium channels, were highly correlated with the extent of both addictive drug- or ketamine/xylazine-induced changes in RABV-labeled inputs to VTA<sup>DA</sup> cells. Reducing expression levels of the voltage-gated calcium channel <i>Cacna1e</i> in cells in the nucleus accumbens lateral shell reduced RABV-mediated input labeling of these cells into VTA<sup>DA</sup> cells. These results directly link genes controlling cellular excitability and the extent of input labeling by RABV.

Also flagged:dental cariesgingivitisperiodontitiscancertissue growthtransportation
Journal Article 2026-05-15 No Snippets Khurshid Z, Cooper PR, Khan AS, Dias G, Mazher J, Moin SF, Ratnayake J.
Show Full Abstract

<h4>Background</h4>Demineralisation of dentin effectively removes the crystalline hydroxyapatite phase while preserving the collagen matrix and associated bioactive proteins. This process results in an osteoinductive scaffold with favourable biological properties, making demineralised dentin a promising naturally derived biomaterial for dentoalveolar bone and orthopaedic bone tissue regeneration.<h4>Objective</h4>This study aimed to evaluate the structural and elemental characteristics of camel dentin matrix after demineralisation using ethylenediaminetetraacetic acid (EDTA) and citric acid (CA) at various concentrations at 24 hours, with the goal of assessing its suitability as a biomaterial for bone grafting.<h4>Methods</h4>Camel dentin granules were extracted after removal of enamel and cementum and treated with EDTA and citric acid for 24 hours. Post-treatment, samples were analysed using scanning electron microscopy to assess morphological changes, energy-dispersive X-ray spectroscopy for elemental composition, Fourier-transform infrared spectroscopy and Raman spectroscopy for molecular characterisation. The degree of demineralisation was compared across groups.<h4>Results</h4>Scanning electron microscopy analysis revealed increased porosity and surface roughness following acid treatment, indicating demineralisation. Energy-dispersive X-ray spectroscopy analysis demonstrated a significant reduction in calcium and phosphorus levels, confirming mineral loss. Fourier-transform infrared spectra confirmed efficient demineralisation, evidenced by reduced phosphate and carbonate bands and enhanced Amide I to III peaks, indicating increased exposure of the collagen framework. Raman spectra showed diminished intensity of phosphate and carbonate peaks in treated samples, further supporting successful demineralisation. EDTA treatment for 24 hours yielded the most pronounced structural and chemical alterations.<h4>Conclusion</h4>Demineralisation of camel dentin using EDTA and citric acid effectively alters its morphology and elemental composition. The optimised demineralisation protocol provides a promising approach for developing future demineralised dentin-derived graft materials from animal sources with potential osteoinductive properties.

PLCL1
Also flagged:kidney cancertumorgene expressionchromatintumorsimmune response
Journal Article 2026-05-15 ✓ 1 Snippet Wang Y, Zhou Z, Liu W, Zhang P, Cheng Y, Su Y, Wang F, Wong KC, Li X.
In-Text Gene Mentions

…2: EX-2 (Plcl1, Il1rapl2 ),…

Show Full Abstract

Single-cell multi-omics technologies profile multiple molecular layers in individual cells, but existing methods often struggle to integrate transcriptomic, proteomic, and epigenomic measurements into an interpretable representation while preserving relationships among cells. Here, we present the single-cell multi-omics adversarial graph convolutional autoencoder (scMAGCA), which constructs cell graphs and uses adversarial alignment to learn interpretable shared embeddings that capture cellular heterogeneity and regulatory complexity. Across diverse datasets, scMAGCA outperforms existing methods in modality alignment, clustering, and batch correction. In Alzheimer's disease, scMAGCA resolves neuronal subtypes and regulatory programs that are missed by single-modality analyses. In kidney cancer, it identifies tumor-specific epithelial and endothelial populations and uncovers biomarkers validated by quantitative polymerase chain reaction. These results support scMAGCA as an interpretable framework for resolving complex cell states in disease.

OLFM4
Also flagged:necrotizing enterocolitisNECferroptosisneonatal diseasessepsisperitonitis
Journal Article 2026-05-15 ✓ 5 Snippets Chen M, Zhao Q, Peng L, Chen Z, Lv S, Zhuang Z, Zheng S, Ye J, He J, Lu Y, Xiao G, Guo Y, He Y.
In-Text Gene Mentions

…and olfactomedin 4 (OLFM4) expression, thereby improvin…

Olfm4deficiency in neutrophils…

…Mechanistically,OLFM4inhibited iPMN-MDSC ferroptosi…

…by restoring theOLFM4-driven anti-ferroptosis axis …

…alterations observed inOlfm4-deficient mice, including…

Show Full Abstract

Circulating polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs) and gut probiotics are crucial for alleviating experimental necrotizing enterocolitis (NEC) in mice, yet the mechanisms linking intestinal PMN-MDSCs (iPMN-MDSCs) to specific microbiota remain unclear. Herein, we identified Lactobacillus (L.) reuteri and L. rhamnosus as two key strains significantly reduced under NEC conditions; their combined supplementation increased iPMN-MDSC abundance and olfactomedin 4 (OLFM4) expression, thereby improving intestinal epithelial cell (IEC) function and attenuating NEC. Olfm4 deficiency in neutrophils exacerbated NEC, disrupted intestinal barrier integrity, and induced microbial dysbiosis. Mechanistically, OLFM4 inhibited iPMN-MDSC ferroptosis by enhancing activating transcription factor 4 (ATF4) activity and upregulating its targets solute carrier family 7a member 11 (Slc7a11) and glutathione peroxidase 4 (Gpx4). Downregulation of Atf4 or Gpx4 recapitulated the phenotypic alterations observed in Olfm4-deficient mice, including aggravated NEC and impaired iPMN-MDSC function. Treatment with indole-3-aldehyde, an effector metabolite of probiotics, alleviated NEC by restoring the OLFM4-driven anti-ferroptosis axis in iPMN-MDSCs. In patients with NEC, reduced intestinal LOX1<sup>+</sup>PMN-MDSCs and a weakened anti-ferroptosis pathway were associated with disease progression. These findings offer a therapeutic strategy for NEC by targeting iPMN-MDSC ferroptosis via probiotic- or metabolite-based interventions.

Also flagged:bindingpsychiatric disordersgene expressionribosomeALSneurogenesis
Journal Article 2026-05-15 No Snippets Wang Y, Zhu H, Hao G, Su Y, Yu Z, Yang Y, Wang F, Chen X, Wong KC, Li X.
Show Full Abstract

RNA-binding proteins (RBPs) often recognize complex RNA secondary structure motifs, and these interactions can vary between cell lines. However, no current computational model can explain the dynamic behavior of RNA sequence-structure motifs across multiple cell lines and link these dynamics to the functional impact of genetic variation. Here we show BRIDGE, an end-to-end unified model that bridges sequence-structure motifs with the functional effects of noncoding genetic variants, thereby enabling genome-wide analysis of dynamic RNA-protein interaction profiles. Our evaluations demonstrate that BRIDGE outperforms existing state-of-the-art methods in static single cell line predictions. Without any retraining, the framework transfers to unseen cellular contexts, thereby revealing a conserved yet adaptable grammar of RNA recognition. Attention-guided interpretation identified 3,571 integrative motifs, including motifs associated with splicing regulation. Moreover, genome-wide in-silico perturbation provides an interpretable view of RBP-binding disruption across variant classes, including splice-region and pathogenic alleles.

RC3H1
Also flagged:protein synthesissynthesismetabolismcytoskeletonPDprotein degradation
Journal Article 2026-05-15 ✓ 2 Snippets Remus A, Palin MF, Lapierre H, van Milgen J, Pomar C.
In-Text Gene Mentions

…GNL3, MALT1, PSMD14,RC3H1, RNF183, SH3RF2, and…

…genes (ASB7, MALT1,RC3H1, RNF183, and SH3RF2)…

Show Full Abstract

Protein synthesis in Low and High protein deposition (PD) gilts, exploring regulatory pathways within the same genetic background and age were studied. Gilts in Low (157 g/d) and High (219 g/d) PD groups underwent jugular vein cannulation to assess insulin, IGF-I and glucose postprandial responses to the same nutrient intake. L[1-<sup>13</sup>C]valine administration enabled measuring protein synthesis rate and efficiency. Results showed 94% greater (P < 0.05) fractional synthesis rates in the longissimus dorsi and tended (P = 0.10) to a greater (11%) absolute synthesis rate in the liver of High PD gilts. High PD gilts tended (P = 0.10) to be more sensitive to insulin. Transcriptomics analyses in muscle identified 67 up-regulated and 102 down-regulated unique genes. Among the up-regulated genes, four olfactory receptors (OR4L1, OR5D13, OR6B2, OR10R2) and one ribosomal protein (RPS15A) present the highest fold-changes in High vs. Low PD gilts. Functional analyses identified six enriched gene ontology terms relate to muscle development, three to protein metabolism and four to signaling pathways. Rap1 signaling and regulation of actin cytoskeleton were over-represented KEGG pathways. High PD gilts exhibit greater protein synthesis and efficiency of protein synthesis, with transcriptomic evidence suggesting changes in the glucose/insulin metabolism and reduced muscle protein degradation.

SERPINC1
Also flagged:genetic disordersrenal tubular dysgenesiscytogenetichyperbilirubinemiahematologic disorderscardiovascular disorders
Journal Article 2026-05-15 ✓ 5 Snippets Cho HW, Kim JM, Park SH, Kim H, Shin DM, Yu HY, Yang M, Ahn SY, Sung SI, Kim BJ, Park MH, Jang MA, Chang YS, Park HY.
In-Text Gene Mentions

…, NSD1 ,SERPINC1, OTC (in…

…, NSD1 ,SERPINC1, OTC ,…

…in AGT ,SERPINC1, PKHD1 ,…

…identified a pathogenicSERPINC1variant associated with…

…Pathogenic variants ofSERPINC1are inherited from…

Show Full Abstract

To establish a rapid whole-genome sequencing (rWGS) workflow applicable to the neonatal intensive care unit (NICU) setting and evaluate its diagnostic utility and clinical feasibility. Twenty critically ill neonates with suspected genetic disorders were included in this study. A workflow for rWGS encompassing neonate enrollment through to the return of genetic diagnosis results was established. A trio-based rWGS data analysis was performed using DRAGEN-GATK-Hail, with results reviewed and reported by a multidisciplinary team. The average turnaround time for the 20 NICU neonates was 5.5 working days. Genetic diagnoses were achieved in ten cases, resulting in a diagnostic yield of 50%, based on the clinical database and variant pathogenicity assessments. The identified diagnostic variants were located across nine genes, including AGT, ANK1, NSD1, SERPINC1, OTC (in two cases), INS, PKHD1, SAMD9, and LZTR1. The clinical implications were confirmed in all ten diagnosed neonates, with 'genetic counseling and recurrence risk management', 'early therapeutic decision-making' and 'enhancement of clinical outcomes and survival rates'. Notably, neonate rWGS-03 demonstrated the highest impact, as rWGS enabled the early identification of renal tubular dysgenesis before symptom onset. This study demonstrates the feasibility of rWGS for critically ill neonates with suspected genetic disorders admitted to the NICU. As the first implementation of neonatologist-driven rWGS in Korea, it highlights the meaningful clinical benefits of timely and accurate diagnosis. Our findings underscore its clinical value and support the integration of rWGS into routine clinical care, as well as the development of future studies within public healthcare systems.

PRDX6PEBP1
Also flagged:cell-cycleADamyloiddementiacognitionAD dementia
Journal Article 2026-05-15 ✓ 2 Snippets Lu L, Pichet Binette A, Hristovska I, Janelidze S, Smets B, Cumplido-Mayoral I, Vasanthakumar A, Milkovich B, Global Neurodegeneration Proteomics Consortium (GNPC), An L, Ossenkoppele R, Krish V, Imam F, Palmqvist S, Vogel JW, Stomrud E, Hansson O, Mattsson-Carlgren N.
In-Text Gene Mentions

…(for example, FMR1,PEBP1, and CLUAP1) showed…

…LRRN1, HES5, andPRDX6, and negative correlations…

Show Full Abstract

The APOE locus is the strongest genetic factor for Alzheimer's disease, with ε4 increasing and ε2 decreasing risk, yet the basis of these opposing effects remains unclear. Here we performed a multicohort proteomic analysis across plasma and cerebrospinal fluid in GNPC, BioFINDER-2, ADNI, UK BioBank, and PPMI. APOE-associated protein alterations are detectable before amyloid pathology and remain stable across age and disease progression. APOE2-associated proteins were enriched in pathways related to cellular maintenance and anti-inflammatory processes. By contrast, APOE4 showed a limited set of upstream mediators linked to cell-cycle and oligodendrocyte precursor cell biology, and a broader group of proteins reflecting vascular, immune, and proteostatic dysfunction shaped by downstream pathology. Comparative analyses highlighted allele-specific mediators and oppositely regulated proteins contributing to differential disease risk. Together, these findings reveal that APOE2 and APOE4 shape Alzheimer's disease risk through distinct molecular architectures and identify candidate biomarkers and targets for allele-specific interventions.

HTT
Also flagged:digestionGlcNAcylationO-GlcNAcylationautophagyproteasome-
Journal Article 2026-05-15 ✓ 2 Snippets Xu N, Wang X, Zhang J, Zhao J, Yan S, Zhou W, Chi W, Li J.
In-Text Gene Mentions

…terminus of Huntington (Htt), which caused its…

Httis a substrate…

Show Full Abstract

O-linked β-N-acetylglucosamine (O-GlcNAc) functions as a nutrition rheostat to mediate cellular signaling pathways. It fluctuates in response to various nutritional factors, for instance, glucose availability. Previous investigations have shown that glucose deprivation upregulates O-GlcNAcylation levels. Meanwhile, starvation also activates autophagy, in particular, chaperone-mediated autophagy (CMA). But it is unknown what signal activates CMA during starvation. In the CMA pathway, heat shock cognate 70 kDa protein (HSC70) recognizes client proteins that bear a KFERQ pentapeptide motif, and delivers them for lysosomal degradation. Herein, we show that glucose depletion increases both the affinity between HSC70 and O-GlcNAc transferase, and HSC70 O-GlcNAcylation levels. We validated that HSC70 is O-GlcNAcylated at T430 according to a previous chemoproteomic screen. We further demonstrate that O-GlcNAcylation attenuates HSC70 stability, but increases its binding with known CMA substrates, such as PKM2. We thus posit that starvation-induced HSC70 O-GlcNAcylation may activate CMA. To test this, we used label-free quantitative mass spectrometry to analyze HSC70-WT and HSC70-T430A interactome, and obtained a proteome-wide potential CMA substrate pool. By studying this dataset, we identified a new CMA substrate, Ataxin-10, a protein involved in a neurologic disorder. We then validated our model by mapping a potential KFERQ motif on Ataxin-10 and showing that HSC70-T430A decreased binding with Ataxin-10. In sum, our work suggests that CMA and O-GlcNAcylation intersect at HSC70, and starvation-induced O-GlcNAcylation of HSC70 is part of the signal that activates CMA during fasting.

Also flagged:Myalgic EncephalomyelitisMEME/CFSsystemic illnessCoronavirus DiseaseCOVID)-19 infection
Journal Article 2026-05-15 No Snippets Frank J, Nesterovitch N, Movva C, Klimas NG, Nathanson L.
Show Full Abstract

Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) is a complex, multi-system disease characterized by a multitude of symptoms across various organ systems. Diagnosis has relied heavily on heterogeneous clinical symptom presentation and evolving case definitions, with treatment focused on addressing presenting symptoms due to the paucity of validated biomarkers. Meanwhile, advances have been made in understanding the underlying pathophysiology through strong epidemiologic, clinical, and basic science studies. This narrative review synthesizes recent advances that are likely to drive a shift in understanding from symptom-based classification toward a molecularly defined understanding of the disease. This shift in understanding will likely provide the foundation for future research efforts focused on targeting diagnosis and treatment more effectively. Specifically, we reference the identification of rare genetic risk variants through the HEAL2 deep learning framework, the large-scale DecodeME genome-wide association study, and dynamic epigenetic markers of disease state. In addition, the findings revealed the downstream consequences of this genetic and epigenetic priming: chronic innate immune activation, CD8+ T cell exhaustion characterized by upregulation of the exhaustion-driving transcription factors Thymocyte Selection-Associated HMG Box (TOX) and Eomesodermin (EOMES), and a cellular energy crisis centered on mitochondrial dysfunction. Furthermore, results of recent studies have revealed sex-specific transcriptomic and proteomic signatures of maladaptive recovery. We also highlight the role of machine learning and artificial intelligence integrations in translating high-dimensional multi-omics data into actionable biological insights, including the identification of monocyte subsets via Positive Unlabeled Learning, circulating cell-free RNA diagnostic signatures, and integrated multi-modal disease models such as BioMapAI. The combination of these findings, which highlight multiple identifiable mechanisms of molecular activity, support the feasibility of molecular subtyping, precision diagnostics, and targeted therapeutic strategies for ME/CFS.

BTN3A3
Also flagged:Psoriasischronic inflammatory skin diseasesplaque psoriasisPustular psoriasisgeneralized pustular psoriasissystemic inflammatory disease
Journal Article 2026-05-15 ✓ 1 Snippet Andrzejczak K, Kucharczyk E, Sternak A, Biliński K, Maj J, Ponikowska M.
In-Text Gene Mentions

…(impairs IL-36 inhibition),BTN3A3(triggers excessive NF-κB…

Show Full Abstract

Generalized pustular psoriasis (GPP) is a rare, severe, and potentially life-threatening inflammatory dermatosis increasingly recognized as a distinct disease entity rather than a variant of plaque psoriasis. Emerging evidence indicates that GPP is primarily driven by dysregulation of the interleukin-36 (IL-36) signaling axis, leading to amplification of proinflammatory cascades in keratinocytes and a predominantly innate, neutrophil-driven immune response. This promotes rapid neutrophil recruitment, sterile pustule formation, and abrupt cutaneous and systemic inflammation. Consistent with this, GPP demonstrates a greater predominance of innate immune and neutrophil-driven inflammation, whereas plaque psoriasis is more strongly associated with IL-23/Th17-mediated adaptive immune responses. Transcriptomic and genetic studies further support this distinction, demonstrating enrichment of IL-36-associated and neutrophil-related signatures, activation of MyD88-dependent pathways, and mutations in genes regulating the IL-36 axis, including <i>IL36RN</i>, <i>AP1S3</i>, and <i>CARD14</i>. Consequently, conventional systemic therapies and biologics targeting TNF-α, IL-17, and IL-23 pathways show variable efficacy and may act more slowly in GPP. In contrast, IL-36 receptor inhibitors represent a more mechanism-aligned approach and have demonstrated rapid and clinically meaningful responses in acute flares. However, important gaps remain, including the lack of validated biomarkers and limited data on long-term treatment outcomes. This review provides an integrated perspective on IL-36-driven inflammation in GPP, including comparison with plaque psoriasis, and outlines its implications for mechanism-based therapeutic approaches.

Also flagged:cancerdeathmetabolic diseasescolon carcinomacolorectal adenocarcinomaglioma
Journal Article 2026-05-15 No Snippets Grymel M, Naprawca P, Dolniak-Budny D, Tomczyk MD, Pielok M, Nowrot B, Skutnik K, Erfurt K, Lalik A.
Show Full Abstract

The multidirectional bioactivity of betulin (BN), its widespread occurrence in plants, relatively low toxicity, and acceptable safety profile make it an attractive scaffold for scientific research and potential therapeutic applications. Due to the presence of reactive functional groups (C-3-OH and C-28-OH), BN is an interesting source of new semisynthetic bioactive compounds obtained via structural modifications of the parent backbone. In our study, we designed new BN-amino acid (BNAA) molecular hybrids, aiming to exploit synergistically the properties of both components. We prepared and evaluated a total of 18 new compounds for antitumor activity against the two human cancer cell lines (HCT 116 and MCF-7) and one non-cancerous cell line (NHDF) using a standard Cell Counting Kit-8 (CCK-8) assay. The potential signaling pathways of the obtained BN derivatives were identified based on the measurement of p21 and Bax mRNA expression levels using the RT-qPCR method. We successfully synthesized a series of new BN hybrids by conjugation of the C-3 and C-28 hydroxyl groups <i>via</i> a succinyl (-CO-CH<sub>2</sub>-CH<sub>2</sub>-CO-, Suc) linker with selected amino acid methyl esters. The structures of all obtained BNAA molecular hybrids were confirmed by spectroscopic analysis (<sup>1</sup>H and <sup>13</sup>C NMR) and high-resolution mass spectrometry (HR-MS). Analysis of the biological activity of the obtained BN derivatives indicated that both the attached amino acids and the substituents at C3 carbon alter BN activity. The obtained BN-amino acid hybrids represent a useful platform for further optimization, especially derivatives (<b>3a</b>, <b>3e</b>, <b>3f</b>, and <b>7d</b>), which showed the most relevant biological profiles in this study.

Also flagged:Steatotic Liver DiseaseMetabolic dysfunction-pathogenesistoinsulin resistancetumor
Journal Article 2026-05-15 No Snippets Kotlyarova A, Kotlyarov S.
Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a widespread condition with a complex pathogenesis. Cell-based models are important tools for studying the mechanisms underlying its development and progression. The aim of this review is to analyze the HepaRG, Huh-7, immortalized human hepatocyte (IHH), and primary human hepatocyte (PHH) cell lines for modeling and studying MASLD. HepaRG represents the most metabolically competent immortalized hepatocyte model with preserved biotransformation activity and a physiological bioenergetic response to lipid loading, making it valuable for pharmacological and toxicological studies. Huh-7 is distinguished by its accessibility and suitability for studying steatosis, lipotoxicity, insulin resistance, and paracrine mechanisms of fibrogenesis; however, its use is limited by its tumor origin, impaired carbohydrate metabolism, and low activity of xenobiotic-metabolizing enzymes. The IHH model occupies an intermediate position because of its non-tumor origin and is of interest for studies of senescence, epigenetic regulation, and signaling pathways involved in steatosis, although interpretation of results requires consideration of immortalization-related effects and specific metabolic limitations. PHH remains the most physiologically relevant platform for MASLD modeling, particularly in three-dimensional (3D) and microphysiological formats; however, its use is limited by high cost, interindividual variability, and the limited duration of the differentiated phenotype. Increasing model complexity-from two-dimensional (2D) monocultures to co-cultures, spheroids, and organ-on-chip systems-enhances physiological relevance and enables reproduction not only of steatosis but also of the inflammatory and fibrogenic components of MASLD progression, yet it reduces reproducibility and complicates standardization. Overall, none of the existing models is universal, and the optimal strategy is to select models according to the specific research question. A key direction for future research is the standardization of steatosis induction protocols and the unification of criteria for evaluating results.

Also flagged:bindingdegradationsynthesisbiocatalysisorganization
Journal Article 2026-05-15 No Snippets López-Rosas CA, Delgado-Alvarado E, Barrera-Méndez F, Bonilla-Landa I, Olivares-Romero JL.
Show Full Abstract

Chirality has emerged as a critical determinant in the design, efficacy, and environmental behavior of modern insecticides. While a significant proportion of agrochemicals are inherently chiral, most are still commercialized as racemic mixtures, despite well-documented differences in biological activity, toxicity, and degradation pathways between enantiomers. In this review, we provide a comprehensive and critical analysis of advances in the stereoselective synthesis and resolution of chiral insecticides, with particular emphasis on neonicotinoids, pyrethroids, and oxadiazines, including indoxacarb. A systematic survey of the literature (1985-2025), including peer-reviewed articles and patents, reveals that multiple strategies have been developed to access enantiomerically enriched compounds, including asymmetric organocatalysis, transition-metal catalysis, chiral-pool approaches, biocatalytic transformations, and chromatographic resolution techniques. Among these, recent developments in photoredox catalysis, recyclable metal complexes, and enzyme-mediated processes have significantly improved enantioselectivity and scalability, bridging the gap between academic methodologies and industrial applications. Despite these advances, challenges remain in achieving cost-effective, sustainable, and universally applicable asymmetric processes. Importantly, the relationship between stereochemistry and biological performance underscores the need for integrating synthetic chemistry with toxicological and environmental studies. Future directions point toward the incorporation of green chemistry principles, continuous-flow processes, and computational tools, including machine learning and molecular modeling, to accelerate the rational design of enantiopure agrochemicals. This review highlights both the progress achieved and the critical gaps that must be addressed to realize the potential of stereoselective insecticide development fully.

Also flagged:canceradaptive immunitytumorgenesolid cancers
Journal Article 2026-05-15 No Snippets Kaur K.
Show Full Abstract

No abstract available.

Also flagged:neurodegenerative diseasesmyelinationaxonalneurodegenerative disordersAlzheimer'sParkinson's
Journal Article 2026-05-15 No Snippets Liu Z, Liu J, Liang J, Meng C, Wang Q, Luo Y, Zhang H.
Show Full Abstract

Oligodendrocyte lineage cells, consisting of mature oligodendrocytes (mOLs) and their progenitors (OPCs), sustain myelination and support axonal metabolic integrity in the mammalian central nervous system. In neurodegenerative disorders, functional deficits spanning impaired mOL homeostasis and dysregulated OPC activation are no longer regarded as passive secondary outcomes of neuronal injury. Instead, emerging clinical and preclinical data demonstrate that oligodendroglial dysfunction actively fuels disease progression. Notably, most human evidence remains correlative, with few definitive proofs that OL pathology initiates neurodegeneration, indicating lineage malfunction predominantly exacerbates, rather than triggers, disease onset across Alzheimer's, Parkinson's, and Huntington's diseases. In this review, we synthesize disease-specific oligodendrocyte pathological signatures and context-dependent cellular responses, focusing on underrecognized OL-intrinsic pathogenic mechanisms: endogenous Aβ production, aberrant protein aggregation, disrupted cholesterol turnover, and excessive neuroinflammatory amplification. We further establish a unified mechanistic model to explain the widespread heterogeneity of white matter pathology across distinct neurodegenerative contexts. We detail four core interconnected pathways whereby defective OL lineage function drives tissue deterioration: myelin loss and progressive axonal degeneration, disrupted neuroimmune homeostasis, cytotoxicity from aggregated pathological proteins, and dysregulated metabolic signaling. To resolve persistent conceptual confusion in the field, we strictly distinguish cell-autonomous primary oligodendroglial lesions, secondary reactive changes following neuronal damage, and non-specific white matter remodeling. We also address critical translational barriers stemming from well-documented phenotypic discrepancies between animal models and human patient brains. Moreover, we consolidate current OL-targeted therapeutic strategies, including myelin restoration, immunomodulatory intervention, metabolic reprogramming, and gene-targeted therapy, highlighting the clinical bottlenecks of single-target regimens and the superior translational prospects of multi-target combinatorial strategies. We conclude by outlining key unresolved challenges and future research avenues, covering OL subtype identification, intercellular signaling crosstalk characterization, humanized model optimization, and precision delivery technique innovation. Collectively, this review refines our understanding of context-dependent oligodendrocyte biofunctions in neurodegeneration, clarifies the origin and consequence of white matter lesions, and offers actionable mechanistic and theoretical support for developing novel glia-based clinical therapies.

SERPINC1
Also flagged:autosomalIntracranial hemorrhagethrombophiliacerebral infarctionsStrokeacute cerebral venous thrombosis
Journal Article 2026-05-15 ✓ 2 Snippets Zhou H, Yin L, Zhang L, Hu L, Zhang W, Ye C, Liu Z.
In-Text Gene Mentions

…4 of theSERPINC1gene, resulting in…

…a pathogenic variant (SERPINC1c.667 T >…

Show Full Abstract

Inherited antithrombin deficiency (IATD) is a rare thrombophilia that predisposes individuals to venous thromboembolism (VTE), though its presentation as spontaneous cerebral venous thrombosis (CVT) is exceedingly uncommon. We report the case of a 27-year-old woman with IATD who developed CVT complicated by bilateral frontal lobe hemorrhage. The initial manifestation of intracranial hemorrhage posed a significant diagnostic and therapeutic dilemma, as it often contraindicates anticoagulation. This case highlights that in the context of CVT, concomitant hemorrhage should not be considered an absolute contraindication to anticoagulant therapy. Our experience underscores the critical importance of a comprehensive diagnostic workup, including thrombophilia screening, in young patients with unprovoked thrombosis at unusual sites. Furthermore, our experience suggests that direct oral anticoagulants (DOACs) could potentially serve as an effective and safe long-term therapeutic option for individuals with IATD, though this hypothesis requires further validation in larger cohorts.

HFE
Also flagged:heart failureacute kidney injuryGU) infectionsGU infectionsdiabeteschronic kidney disease
Journal Article 2026-05-15 ✓ 5 Snippets Zahid S, Ahmad M, Salman F, Zahr F, Golwala H.
In-Text Gene Mentions

…Adverse events,HFE, AKI, and GU…

…Similarly,HFErates were consistently…

…For example,HFEoccurred in 29.4…

…lower rates ofHFEfollowing TAVR.…

…= 0.347), orHFE(45.3 vs. 47.9%;…

Show Full Abstract

<h4>Background</h4>Sodium-glucose cotransporter 2 inhibitors (SGLT2i) have shown cardiovascular and renal benefits across various populations. However, their impact on outcomes after transcatheter aortic valve replacement (TAVR) remains unclear.<h4>Methods</h4>We analyzed 61,763 adults who underwent TAVR between 2013 and 2024 using the TriNetX Research Network. Patients prescribed SGLT2i before or within 1 month of TAVR were compared to nonusers. After 1:1 propensity score matching (n = 3362 per group), outcomes including mortality, hospitalization, heart failure exacerbation, acute kidney injury, genitourinary (GU) infections, renal replacement therapy, and adverse events were evaluated at 6 months, 1 year, and 3 years.<h4>Results</h4>Among 61,763 individuals who underwent TAVR, 3529 (5.7%) received an SGLT2i either before or within 1 month following the procedure. SGLT2i use was associated with significantly lower mortality at all time points (hazard ratio: 0.70; 95% CI: 0.62-0.79; <i>p</i> < 0.001). Hospitalization and heart failure exacerbation were also reduced in the SGLT2i group. No significant differences were observed in rates of acute kidney injury, GU infections, or renal replacement therapy. Subgroup analyses showed consistent benefits among patients with diabetes, chronic kidney disease, and left ventricular ejection fraction <45%.<h4>Conclusions</h4>SGLT2i use around the time of TAVR was linked to improved survival and reduced heart failure-related morbidity, without increased renal or GU complications. These findings support a potential role for SGLT2i as adjunctive therapy in selected TAVR patients.

HFE
Also flagged:parasitic infectionscancersmicrotubulecancercell proliferationandrogen-
Journal Article 2026-05-15 ✓ 1 Snippet Powderly GE, Hassevoort K, Loy M, Balonier J, Sievers C.
In-Text Gene Mentions

…hepatitis, Wilson's disease,hemochromatosis, Budd-Chiari syndrome, biliar…

Show Full Abstract

The self-administration of veterinary-grade anthelmintics, such as fenbendazole and ivermectin, has gained visibility in online communities due to unverified claims regarding potential anticancer effects. Despite these claims, these agents lack human regulatory approval due to unestablished safety profiles. We report a rare case of severe drug-induced liver injury (DILI) in a 65-year-old male with prostate cancer resulting from the concurrent ingestion of veterinary-grade fenbendazole and ivermectin. The patient presented to his primary care provider with a 2-week history of fatigue, jaundice, and abdominal pain following a 3-month regimen of alternating these agents daily at a dosage of "one squirt" (estimated to be 0.18 mg/kg of ivermectin and 0.98 mg/kg of fenbendazole) based on advice from online cancer support groups. Initial laboratory studies revealed profound transaminase elevations, with alanine aminotransferase (ALT) at 1764 U/L, aspartate aminotransferase (AST) at 1132 U/L, and a total bilirubin of 12.9 mg/dL. An R-value of 37.50 confirmed a hepatocellular injury pattern, while an extensive workup ruled out viral, autoimmune, and biliary etiologies. Following the complete cessation of both agents, transaminase levels decreased by 58% within 9 days and normalized within 6 weeks. A Roussel Uclaf Causality Assessment Method (RUCAM) score of 9 indicated a "highly probable" causal relationship between the anthelmintics and the acute liver injury. This case highlights the significant hepatotoxic risks associated with veterinary-grade therapies driven by medical misinformation. Overall, this case emphasizes the need for physicians to maintain a high index of suspicion for alternative therapies in oncology patients.

HFE
Also flagged:Zoonotic infectionsinfectionsaspleniaalcoholismcirrhosisimmunosuppression
Journal Article 2026-05-15 ✓ 1 Snippet Salazar Borbón JD, Xu Carranza D, Alvarez Aguilar PA, Quiros Figueroa L.
In-Text Gene Mentions

…lcohol consumption, cirrhosis,hemochromatosis, or beta-thalassemia major,…

Show Full Abstract

<i>Capnocytophaga canimorsus</i> is a zoonotic Gram-negative bacterium commonly present in the oral flora of dogs and cats. Although human infection is uncommon, it can lead to rapidly progressive and life-threatening disease, particularly in immunocompromised individuals such as those with asplenia. Severe acute respiratory distress syndrome (ARDS) requiring extracorporeal membrane oxygenation (ECMO) has been rarely reported. We describe a 60-year-old woman with hypothyroidism and a remote history of splenectomy who presented with fever, malaise, and gastrointestinal symptoms one week after a dog bite. Blood cultures obtained early during hospitalization grew <i>C. canimorsus</i>. Her clinical course was complicated by rapidly progressive ARDS and multiorgan failure, requiring invasive mechanical ventilation. Despite optimized lung-protective ventilation, neuromuscular blockade, prone positioning, and broad-spectrum antimicrobial therapy, refractory hypoxemia persisted. Veno-venous (VV) ECMO was initiated as rescue therapy, resulting in progressive improvement in gas exchange and pulmonary mechanics. ECMO support was successfully discontinued after 11 days, followed by liberation from mechanical ventilation and full clinical recovery. Severe <i>C. canimorsus</i> infection can result in fulminant ARDS and multiorgan dysfunction. Early recognition and timely escalation to advanced supportive therapies, including VV-ECMO, may be lifesaving in selected patients.

STAU1
Also flagged:ovarian cancerOCgynecologic malignanciespathogenesistumorepithelial cancer
Journal Article 2026-05-15 ✓ 5 Snippets Tong R, Yu X, Xu B, Wu T, Liu M, Shen C, Xu X, Xia F.
In-Text Gene Mentions

…cancer progression throughSTAU1-mediated mRNA decay.…

…binding protein 1 (STAU1).…

…In turn, CDIPTOSP-STAU1interactions were essential…

…evidence of the CDIPTOSP/STAU1/KLF17 axis in the…

STAU1

Show Full Abstract

Ovarian cancer (OC) remains one of the most lethal gynecologic malignancies, largely due to its poorly understood pathogenesis, which limits the development of effective early detection and targeted therapy. This study was designed to explore the potential role of the long non-coding RNA CDIPTOSP in OC progression. We observed high expression of CDIPTOSP in OC tissues and cell lines. Knockdown of CDIPTOSP impeded the proliferation and migration of OC cells. Using the RNA pull-down-Liquid Chromatography-Tandem Mass Spectrometry (LC-MS/MS) approach, we found that CDIPTOSP bound staufen double-stranded RNA binding protein 1 (STAU1). In turn, CDIPTOSP-STAU1 interactions were essential for KLF transcription factor 17 (KLF17) mRNA destabilization. Notably, depletion of KLF17 could rescue the tumor-suppressive effects caused by CDIPTOSP knockdown, whereas overexpression of KLF17 abolished the tumor-promoting effects induced by overexpressing CDIPTOSP. In conclusion, our study provided the first evidence of the CDIPTOSP/STAU1/KLF17 axis in the regulation of OC progression.

bioRxiv 2026-05-15 Preprint (No Snippets API) Hoshina N, Hoshina M, Yamamoto T, Takada M.
Show Full Abstract

<h4>SUMMARY</h4> The basal ganglia (BG) form anatomically and functionally segregated yet integrative parallel circuits, but the molecular mechanisms specifying them remain unclear. We immunohistochemically mapped the expression of three δ2-protocadherin (δ2-PCDH) cell adhesion molecules—PCDH10, PCDH17, and PCDH19—in the BG of macaques. Within the striatum, each PCDH exhibited regional gradients of expression along the rostro–caudal and ventromedial–dorsolateral axes. The three PCDHs showed complementary distributions that continuously delineated molecular boundaries corresponding to functional subdivisions in a graded fashion. Such complementary distributions were also observed in the BG output nuclei. Given that neurons expressing the same δ2-PCDH in distinct BG structures preferentially connect with each other, the three δ2-PCDH expression patterns could define functional territories within parallel BG circuits. Together, the complementary expression of PCDH10, PCDH17, and PCDH19 broadly align with the distinct BG circuits, respectively, suggesting molecular codes underlying the segregated yet integrative parallel organization of the primate BG.

STAU1
Also flagged:autophagydegradationlocalizationALSspinocerebellar ataxia type 2SCA2
Journal Article 2026-05-14 ✓ 5 Snippets Pulst SM, Paul S, Nguyen H, Dansithong W, Figueroa KP, Gandelman M, Bonini NM, Scoles DR.
In-Text Gene Mentions

…Staufen1 (STAU1) is an RBP…

…we showed thatSTAU1is overabundant in…

…flux due toSTAU1-mediated upregulation of mTOR…

STAU1overabundance and impaired…

…age, suggesting thatSTAU1may function as…

Show Full Abstract

RNA-binding proteins (RBPs) play an essential role in development, normal functioning, and human disease. Staufen1 (STAU1) is an RBP that regulates mRNA degradation and subcellular localization, and is part of the ATXN2 protein complex. Previously, we showed that STAU1 is overabundant in patient fibroblasts and in mouse models of Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), and spinocerebellar ataxia type 2 (SCA2), where it is associated with impaired autophagic flux due to STAU1-mediated upregulation of mTOR translation. STAU1 overabundance and impaired autophagy cause accumulation of biomolecular condensates and abnormal unfolded protein response (UPR). We generated a mouse model expressing the entire human STAU1 gene (hSTAU1) in a bacterial artificial chromosome (BAC) construct. hSTAU1 in these mice was expressed in cerebral hemispheres, cerebellum, and spinal cord, as well as cultured cortical neurons and cortical and spinal cord astrocytes, and microglia. Expression of hSTAU1 caused dysregulated gene expression, abnormal autophagy, glial activation, and changes in neuronal marker proteins. All of these were significantly improved by reducing STAU1 abundance by RNAi, but exacerbated in BAC-STAU1 mice crossed with Prp-TDP-43(Q331K) transgenic mice. Similar results were also obtained in eye phenotypes in ALS- and SCA2-relevant fly models upon changing staufen-1 dosage. Despite the molecular changes, we observed no overt behavioral changes in mice up to 55 weeks of age, suggesting that STAU1 may function as an epistatic modifier of neuronal degeneration. The BAC-hSTAU1 mouse will be useful for developing therapies targeting the human STAU1 gene.

DCC
Also flagged:folliculogenesisgene expressioncell cycleooplasmmitochondrialfertilization
Journal Article 2026-05-14 ✓ 2 Snippets Monferini N, Dey P, Donadini L, Zambelli F, Franciosi F, Lodde V, Luciano AM.
In-Text Gene Mentions

…family member 2),DCC(DCC netrin 1…

…member 2), DCC (DCC netrin 1 receptornetrin 1 receptor),…

Show Full Abstract

<h4>Background</h4>The ovarian reserve, primarily composed of primordial (PMF), primary (PF), and secondary follicles (SF), holds great potential for fertility preservation, yet remains inaccessible mainly due to the challenges of replicating early folliculogenesis in vitro. The molecular mechanisms governing the activation and differentiation of oocytes from the dormant PMF pool remain poorly defined. In this study, we used a bovine model to investigate early follicular development.<h4>Results</h4>The transcriptome of isolated PMF, PF, and SF revealed different profiles of the follicles during early folliculogenesis. Differential gene expression analyses between PF versus PMF and SF versus PF revealed 689 and 3,206 significantly regulated genes, respectively (FDR < 0.05), highlighting key pathways including PI3K-Akt, Wnt, mTOR, and ECM-receptor interaction. Between PF versus PMF and SF versus PF, 13 and 69 DEGs were identified as transcription factors, respectively. A Likelihood Ratio Test followed by hierarchical clustering identified four major gene expression clusters across the three stages, showing significant enrichment in processes such as ECM-related functions and cell cycle. Based on the enrichment of the cell cycle pathway, we focused on RAD51, which was highly expressed in preantral follicles. Immunohistochemical analysis further showed that RAD51 protein localized in the ooplasm, along with the mitochondrial marker HSP60.<h4>Conclusion</h4>This is the first study to perform bulk RNA sequencing on isolated preantral follicles (PMF, PF, and SF) in cattle. Our findings provide new insights into the stage-specific mechanisms regulating follicle activation and growth in cattle, laying the groundwork for future in vitro fertility preservation strategies in both clinical and conservation contexts.

Also flagged:Dengue virus infectiondengue virus infectionsinfectioninfectionsviral genomesimmune response
Journal Article 2026-05-14 No Snippets Wu SS, Bjerke JN, Middleton CE, Barbachano-Guerrero A, Dye JR, Worden-Sapper ER, Emerman AB, Endy TP, Thomas SJ, Waickman AT, Larremore DB, Meyerson NR, Sawyer SL.
Show Full Abstract

Dengue viruses are mosquito-borne human pathogens whose global incidence in human infections is rising. Surveillance is hampered by the requirement for blood-based diagnostics. Interestingly, in several prior research studies, dengue virus nucleic acids and proteins could be detected in saliva, making saliva-based diagnostics a plausible alternative. However, the temporal relationships between exposure, viremia, salivary accumulation, and symptom onset remain poorly defined. To address this knowledge gap, nine participants were enrolled in clinical trial NCT04298138 to receive an inoculation with an attenuated dengue virus (DENV-3 strain CH53489). Matched blood and saliva specimens were collected over 10 days. Dengue virus genomes could be detected by RT-qPCR in both blood and saliva before the onset of symptoms in most individuals. The earliest time of detection in blood and saliva was 3.4 and 5.0 days post-infection, respectively. Using this sample set, we also measured host transcriptional responses to dengue infection in both biospecimens. Strikingly, far more human genes showed increased transcript abundance exclusively in saliva (14%) than in PBMCs (5%) or both compartments simultaneously (6%), revealing compartment-specific host responses. For 21 of the human transcripts that increased in response to dengue infection, we quantified their daily abundance across the course of DENV-3 infection in all study participants. Together, these findings demonstrate that sensitive dengue virus detection in saliva should be possible and establish that both blood and saliva capture early host responses to infection.IMPORTANCEDengue virus infections are detected using blood samples, either with nucleic acid amplification tests for the dengue virus genome (in the case of an active infection) or serology-based tests for antibodies recognizing dengue viruses (indicating a prior infection). The requirement for blood draws creates a barrier to dengue virus surveillance. Our data demonstrate that saliva can serve as an alternative biospecimen for detecting dengue virus genomes early in infection, with detection lagging blood by only 1.6 days-a modest and likely acceptable tradeoff given saliva's practical advantages. Unlike blood, saliva is non-invasive, self-collectible, requires no sharps, and is thermostable. We also identified host genes upregulated upon dengue infection, informing on the host response to infection. Our longitudinal study design enabled us to track the kinetics of transcript accumulation both by day post-infection and relative to symptom onset, providing high resolution into the host response to the virus.CLINICAL TRIALSThis study is registered with ClinicalTrials.gov as NCT04298138.

NEGR1
Also flagged:deathspinal cord injuryferroptosisdegradationmembranesMembrane
Journal Article 2026-05-14 ✓ 2 Snippets Yang T, Ye L, Xie P, Song T, Chen J, Zhao H, Liu Z, Chen X, Ding J, Ding X, Shao A, Wu M, Zhao F, Tao S, You T.
In-Text Gene Mentions

…as Gria2 andNegr1, while suppressing inflammato…

…as Gria2 ,Negr1, and Kirrel3…

Show Full Abstract

Ferroptosis is one of the important mechanisms of secondary neuronal death after spinal cord injury (SCI). However, the upstream regulators that could be targeted for therapeutic intervention remain poorly defined. This study identifies gamma-glutamyl transferase 1 (GGT1) as a key driver of ferroptosis, upregulated in neurons post-SCI. Screening a 150-compound natural product library, we discovered Enocyanin (EA), which reduced GGT1 protein levels, protected neurons from hypoxic injury, and exhibited anti-ferroptotic effects. Mechanistically, EA promoted GGT1 degradation through the E3 ligase MGRN1, leading to K48-linked polyubiquitination and proteasomal clearance, halting ferroptosis. To improve EA's stability and delivery, we engineered a biomimetic nanoplatform (NSCm@EA) using neural stem cell membranes, enhancing drug accumulation at the injured spinal cord. At single-cell resolution, NSCm@EA was shown to precisely remodel neuronal subpopulations, selectively expanding γ-motor neurons and upregulating synaptic genes such as Gria2 and Negr1, while suppressing inflammatory and oxidative stress pathways. In summary, this study reveals GGT1's role in ferroptosis, identifies a natural product that induces its ubiquitin-mediated degradation, and presents a targeted biomimetic delivery strategy for precise intervention in spinal cord injury.

Also flagged:extracellular vesiclesProstate cancerPCaextracellularvesiclescancer
Journal Article 2026-05-14 No Snippets Said DS, Abdullah MNH, Nurdin A.
Show Full Abstract

Prostate cancer (PCa) is in the top three most common cancers among the world's male population, and its incidence has been increasing over the years. However, the primary screening and diagnostic tools still rely on serum prostate-specific antigen (PSA) and digital rectal examination (DRE), both of which have been inconclusive. Raised serum PSA and abnormal DRE findings require an invasive prostate biopsy, which has inherent surgical risk. This review aims to provide a comprehensive understanding of the biological production and properties of extracellular vesicles (EVs), which are released by all cell types, including cancer cells, and carry proteins and other biomolecules from their parent cells. EVs are becoming increasingly popular as possible biomarker candidates to improve the accuracy of diagnosing many diseases. Growing data suggest that EVs are crucial for cellular communication and tumour progression via multiple signalling pathways, including epithelial-to-mesenchymal transition (EMT), migration, and invasion, making them suitable for tracking PCa growth and metastasis. Furthermore, choosing the appropriate EV isolation method is essential to ensure accurate diagnosis. More clinically relevant, this review also identifies potential EV protein biomarkers derived from urine, serum, and tissue samples from PCa patients.

Also flagged:synthesisbindingelectron transfer
Journal Article 2026-05-14 No Snippets Schubert TJ, Carpentier A, Li Y, Hubbell KC, Oh J, Zheng SL, Paton RS, Dong Y.
Show Full Abstract

While alkylborane oxidation constitutes one of the most widely utilized strategies to construct C-O bonds, asymmetric versions of this transformation remain elusive. Establishing such an asymmetric approach would unlock a strategically distinct disconnection to oxygen-bearing stereogenic centers, which are ubiquitous across biologically active scaffolds. Herein, we employ a Cu-catalyzed single-electron mechanism to achieve enantioconvergent alkylborane oxidation for the first time. The central challenge─suppressing the unselective carbocation pathway from alkyl radical oxidation by the Cu(II)-carboxylate─is addressed by (1) lowering the reaction temperature to attenuate the undesired radical-polar crossover while (2) leveraging photochemical activation to preserve the single-electron radical functionalization manifold. The reaction exhibits broad functional-group compatibility, engaging benzyl- and allylboronic esters; diverse carboxylic acids, including complex pharmaceutical substructures and heterocycle-containing substrates, are also well tolerated. The reported protocol is scalable to gram quantities and was utilized for the asymmetric synthesis of an immunosuppressant drug candidate. Mechanistic studies, including stoichiometric interrogation of elementary steps, rate law determination, radical trapping experiments, and density functional theory (DFT) computations, indicate that the reaction operates by balancing two light-driven processes: (1) rate-determining N-H bond homolysis followed by N-radical-mediated C-B bond activation and (2) enantioselective Cu-mediated radical functionalization via an inner-sphere pathway. The reactive Cu(II)-carboxylate intermediate was isolated and structurally characterized, permitting direct examination of its spectroscopic features and radical-trapping reactivity. Electron paramagnetic resonance (EPR) studies identified the Cu(II)-carboxylate species as the catalyst resting state, and stoichiometric reaction of the Cu(II)-carboxylate with a persistent trityl radical demonstrated its competency for C-O bond formation. Hammett analysis further revealed that the efficiency of C-O bond formation is governed by the electrophilicity of the Cu(II)-carboxylate intermediate.

PRDX6
Also flagged:nucleusgestationFetal Alcohol Spectrum DisorderFASDalcohol use disorderaddiction
Journal Article 2026-05-14 ✓ 1 Snippet Marquez-Wilkins EM, Youngentob SL, Favero C, Deak T, Gano A.
In-Text Gene Mentions

Prdx6

Show Full Abstract

<h4>Background</h4>Prenatal alcohol exposure through maternal drinking and adolescent alcohol intake are the two most common forms of early alcohol consumption, which may produce synergistic impacts on health. Yet, few preclinical studies have used double-hit models to examine how effects manifest across sex and lifespan.<h4>Methods</h4>In this study, RNA-seq was used to analyze the effects of alcohol on the anterior cingulate cortex (ACC) and nucleus accumbens (NAcc) of adult and adolescent male and female Long-Evans rats (n = 5+ per group, N = 144) that were exposed to ethanol during gestation, adolescence, or both. Prenatally, dams received either ethanol liquid diet (PAE: 2.2% v/v EtOH on gestational day [G]6-8, 4.5% on G9-10, and 6.7% on G11-20) or control diets (PF pair-fed, FCL free-choice liquid diet). In adolescence, offspring were given alcohol (AAE: 11 h of 10% EtOH in tap water, 1 h water, 12 h of water deprivation daily from prenatal [P] day 27-41) or given ad libitum water access (VEH). Brains were collected on P42 (adolescence) and P90 (adulthood). Differentially expressed genes were identified via DESeq2, with the resulting p values adjusted using the Benjamini-Hochberg correction (≤ 0.05).<h4>Results</h4>In the ACC, males showed surprisingly few effects of ethanol, whereas adult females with a double-hit history showed 4 genes downregulated (C3, Syt6, Spetex2l2, and Akap12) and 19 upregulated. These genes did not align to a specific pathway, yet more than one (i.e. C3, Akap12) were associated with immune function (e.g. complement system, glial function). In the NAcc, adolescent females showed the most robust alterations (381 genes up, 419 down) involved in signaling pathways (calcium, oxytocin, cAMP, chemokines, etc.). Both brain regions differed strongly between ages in ethanol-naïve controls. In the ACC, 451 DEGs were identified for males and 95 for females, yet only 36 DEGs overlapped between the sexes, demonstrating that even in the period of late adolescence (P42 onward), males and females were on different trajectories of development (a similar ratio was observed in the NAcc, though there was little overlap between specific genes).<h4>Conclusions</h4>Together, these findings form a foundation for examining sex-specific ACC development and female-specific vulnerability to damage from the double-hit ethanol model. Examining naïve controls is an invaluable control for understanding how ethanol affects the developmental trajectory of neurodevelopmental processes.

Also flagged:cystic fibrosisCFdegradationlung diseaseionmembrane
Journal Article 2026-05-14 No Snippets Fawcett LK, Chew ZA, Schneider-Futschik EK, Allan KM, Patel HR, Jaffe A, Waters S.
Show Full Abstract

<h4>Background</h4>CFTR modulators have transformed cystic fibrosis (CF) treatment, but individual responses vary even among patients with identical <i>CFTR</i> genotypes. This underscores the need for predictive biomarkers to optimise therapeutic selection.<h4>Methods</h4>We evaluated 24 paediatric patients homozygous for F508del-<i>CFTR</i>, assessing lung function (FEV1pp) and sweat chloride (SC) before and after CFTR modulator therapy. Whole-gene sequencing was utilised to identify <i>CFTR</i> and pharmacogene variants. Patient-derived human nasal epithelial cells (HNECs) were expanded and differentiated at the air-liquid interface to assess CFTR function via ion transport (ΔIsc).<h4>Results</h4>Clinical responses varied widely. Twelve participants changed modulators during the study. Sequencing identified 231 additional <i>CFTR</i> variants and pharmacogene polymorphisms, but none correlated with response variability. However, a significant linear relationship emerged between ΔIsc and FEV1pp improvement in patients with baseline FEV1pp<90 (R² = 0.652, p =0.001) and SC reduction (R² = 0.535, p=0.004). Receiver operating characteristic analysis demonstrated high predictive accuracy for SC reduction (area under the curve (AUC)=0.88) and combined FEV1pp/SC response in patients with baseline FEV1pp<90 (AUC=1.00). Exploratory analysis confirmed that ΔIsc predicts FEV1pp changes, modulated by baseline lung function and CFTR modulator type.<h4>Conclusion</h4>Patient-derived differentiated HNEC cultures serve as a robust predictive tool for CFTR modulator response in paediatric CF patients. Their integration into clinical practice can enhance personalised treatment strategies, minimising ineffective therapy use and improving CF patient outcomes with precision medicine.

Also flagged:nitrogenfixationcarbonsulfurwatergrowth
Journal Article 2026-05-14 No Snippets Kawakami J, Gomes MO, Da-Silva PR, Cruz AF.
Show Full Abstract

​Soil microbiota is central to agroecosystem sustainability, influencing fertility, plant health, and resilience. Agricultural practices shape these communities in distinct ways: conventional systems, with intensive chemical inputs, often promote microbial homogeneity, whereas organic systems, with higher organic matter inputs and reduced disturbance, tend to sustain functionally diverse microbiomes. Yet, the extent of these effects remains poorly understood, particularly when taxonomic, functional, and machine-learning-based indicators are evaluated jointly across different cropping systems. To address this gap, we compared the taxonomic and functional diversity of soil microbiota in organic and conventional fields cultivated with common bean (Phaseolus vulgaris) and grapevine (Vitis vinifera) in Brazil. Microbial communities were profiled using 16 S rRNA and ITS sequencing, with analyses spanning diversity metrics, taxonomic composition, functional inference, and machine-learning-based biomarker identification. Bacterial diversity was greater under conventional management, while fungal diversity did not differ between systems. Machine-learning approaches identified Bradyrhizobium and Roseococcus (bacteria) and Lecythophora (fungus) as consistent biomarkers of organic soils. Functional predictions pointed to enhanced nitrogen fixation and carbon cycling in organic fields, whereas sulfur cycling was more prominent in conventional ones. Microbial community structure clearly separated by management and correlated strongly with soil chemistry, and Venn analysis revealed more unique bacterial and fungal operational taxonomic units (OTUs) in organic soils. Together, these results highlight how agricultural management acts as a strong ecological filter of soil microbiota. Conventional farming favored broader bacterial diversity. In contrast, organic systems fostered distinct microbial biomarkers and enhanced functional potential, particularly for nitrogen and carbon pathways.

PRDX6
Also flagged:traumatic brain injurydeathneurotraumasevere traumatic brain injurybrain injurycerebral edema
Journal Article 2026-05-14 ✓ 4 Snippets Cela E, Van Nynatten LR, Tweddell D, Daley M, Morello M, Cepinskas G, Fraser DD.
In-Text Gene Mentions

…(PARK7), and Peroxiredoxin-6 (PRDX6); and the VEGF…

…stress cluster comprisedPRDX6, UCHL1, and PARK7,…

PRDX6, expressed primarily in…

…cerebrospinal fluid (CSF)PRDX6oxidation in TBI…

Show Full Abstract

<h4>Background</h4>Pediatric severe traumatic brain injury (sTBI) remains a leading cause of death and long-term disability, yet its molecular characterization is incomplete. Single-biomarker approaches fail to capture the biological heterogeneity underlying variable clinical outcomes. Comprehensive proteomic profiling across neuropathologic domains to identify clinical endotypes has not been performed in pediatric sTBI. This study addresses this gap using high-throughput plasma neuro-proteomic profiling during the acute injury phase.<h4>Methods</h4>We conducted an exploratory case-control study enrolling 23 pediatric sTBI patients (median age 15 years, 70% male) admitted to a Level 1 Trauma Center and 20 age- and sex-matched healthy controls. Plasma samples were collected on pediatric intensive care unit (PICU) Day 1 and Day 3. Proteomic analysis using the Nucleic Acid-Linked Immuno-Sandwich Assay quantified 120 proteins spanning five neuropathologic domains: neuroinflammation, neurodegeneration, amyloid/tau pathology, synaptic regulation, and vascular/metabolic pathways. Differential expression analysis identified dysregulated proteins in sTBI, facilitating interrogation of protein-protein interaction networks and protein-clinical variable correlations.<h4>Results</h4>Proteomic analysis on PICU Day 1 identified 67 differentially expressed proteins (DEPs): 46 increased and 21 decreased. Inflammatory mediators (n = 31/51) dominated the response, with marked elevations in acute-phase reactants (SAA1, CRP), pro-inflammatory cytokines (IL-6, IL-33), and the anti-inflammatory marker IL-10. Network analysis revealed IL-6 as a central hub linking inflammatory and neurodegenerative pathways. Brain-specific proteins showed distinct temporal patterns: CRH, GFAP, S100B, pTau-231, pTau-181, REST, and TAFA5 displayed biphasic trajectories, whereas NEFH, NEFL, and NGF exhibited sustained increases through PICU Day 3. Enrichment analyses localized DEPs predominantly to inflammatory or neuronal compartments and tissues. Significant correlations emerged between multiple proteins and clinical outcomes.<h4>Conclusions</h4>This exploratory study provides the first comprehensive, multi-domain neuro-proteomic characterization of acute pediatric sTBI, revealing molecular disruptions beyond the scope of traditional single-biomarker approaches. We identified 67 DEPs spanning five neuropathologic domains, with network analysis revealing co-enrichment of inflammatory and neurodegeneration-related programs, consistent with known connectivity patterns. These findings establish a biological foundation for biomarker validation studies and inform precision medicine strategies in pediatric neurotrauma.

Also flagged:neurodegenerative diseasesamyotrophic lateral sclerosisALSfrontotemporal dementialocalizationcytoplasmic
Journal Article 2026-05-14 No Snippets Sinha IR, Atkinson AL, Irwin KE, Ling JP, Wong PC.
Show Full Abstract

TDP-43 is a ubiquitously expressed, primarily nuclear DNA/RNA-binding protein implicated in neurodegenerative diseases including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer's disease (AD). In this review, we examine the structure and regulation of TDP-43, how these features influence its localization and functional activity, and how their disruption may contribute to disease. Among TDP-43's diverse functions, splicing repression of nonconserved RNA sequences termed cryptic exons has emerged as especially central to human disease. TDP-43 nuclear depletion and cytoplasmic aggregation are well-established pathological features in affected neurons and glia of neurodegenerative diseases, and accumulating evidence suggests that loss of TDP-43-mediated splicing repression occurs presymptomatically in disease. Advances in RNA-sequencing have enabled systematic identification of cryptic exon inclusion as a sensitive marker of TDP-43 dysfunction. Here, we synthesize current knowledge of TDP-43 biology and curate datasets from human tissues and experimental models, focusing on cryptic splicing to provide a resource for leveraging cryptic exon biology to better understand, detect, and target TDP-43 dysfunction.

PRDX6CSE1L
Also flagged:cytoplasmicmembranesmembraneNucleuscytoplasmorganelle
Journal Article 2026-05-14 ✓ 2 Snippets Eslami SS, Rai A, Fang H, Thomas A, Cross J, Donner D, Greening DW.
In-Text Gene Mentions

…was enriched forCse1l, Xpo7, Ipo5, Sun2,…

…Hdac6, Nme1/2, andPrdx6) ( 69 ,…

Show Full Abstract

Heart specialization involves nuclear programs; however, chamber-specific regulation of the nuclear proteome landscape remains unknown. In this study, we isolated the nucleus from four major anatomical regions of healthy mouse heart (fresh) and employed quantitative mass spectrometry-based proteomics to construct a comprehensive nuclear proteome landscape of left ventricle (LV, 2403 proteins), right ventricle (RV, 2242 proteins), left atrium (LA, 2368 proteins), and right atrium (RA, 1816 proteins). This led to the discovery of nuclear regional proteome signatures (ventricular signature, 297 proteins; atrial signature, 183 proteins) associated with oxidative metabolism and redox regulation, ferroptosis, extracellular-matrix remodeling, SUMO- and stress-responsive control and transcriptional regulation. Chamber-level analyses further identify distinct nuclear features in LV (120 proteins), LA (188 proteins), and RA (72 proteins). In addition, we defined conserved core nuclear proteome (230 proteins) shared across all anatomical regions, enriched for transcription-regulator complexes, nucleolar/ribosome-associated, RNA-processing, and chromatin-organization components. Within this core network, we report 78 transcription factors/co-factors and select nuclear, chromatin and RNA export-associated proteins, including 29 specific factors (e.g., Alpk3, Rbm14, Arglu1, Hmgb1, Myef2, Sf1) associated with the heart. Regionally, we verified spatial localization in heart of H2ac21 and Sun2 in LA and Ptbp2 in LV by immunofluorescence. This study provides insights into the chamber-resolved view of the nuclear proteome in the heart, establishes a framework for linking nuclear proteomic signatures to atrial and ventricular biology, unique features of the heart nuclear proteome landscape relative to other organs, and a baseline for studying nuclear remodeling in cardiac pathophysiology.

DCC
Also flagged:MethylationMammary Tumorsmammary gland tumorsneoplasmstumorstumor
Journal Article 2026-05-14 ✓ 1 Snippet Jang K, Jeon G, Han J, Cho SB, Kim S, Oh S, Kim HJ.
In-Text Gene Mentions

…1 receptor (DCC) gene has…

Show Full Abstract

Canine mammary gland tumors (cMGTs) are neoplasms arising from mammary epithelial or supporting tissues and account for approximately 50% to 70% of all tumors in intact female dogs. Epigenetic regulation, such as DNA methylation, has been investigated to elucidate the molecular mechanisms of cMGTs. This study explored whether DNA methylation alterations in peripheral blood reflect tumor-related epigenetic patterns. Eighteen client-owned dogs were enrolled, including 10 with cMGTs and 8 healthy controls. Although no individual genes reached statistical significance after multiple testing correction, exploratory gene ontology analysis identified 22 biological processes showing potential enrichment, including 2 hypermethylated and 20 hypomethylated regions. Comparative analysis between canine and human datasets revealed 91 overlapping hypomethylated genes displaying consistent patterns across both species. The top enriched gene ontology terms were morphogenesis of an epithelium and cell growth. These findings provide strictly exploratory and hypothesis-generating evidence that blood-based DNA methylation profiling may capture tumor-associated systemic epigenetic alterations in cMGTs.

Also flagged:behavioralFrontal Lobe SyndromeDementiafrontotemporal lobar degenerationFTLDbehavioral variant frontotemporal dementia
Journal Article 2026-05-14 No Snippets Groeneveld J, de Boer SCM, Krudop W, Ozhegov G, Hulsman M, Dols A, Kerssens CJ, Schouws S, Barkhof F, Holstege H, Pijnenburg YAL, Van Der Lee SJ, Duits FH.
Show Full Abstract

<h4>Background and objectives</h4>The diagnosis of behavioral variant frontotemporal dementia is often difficult because behavioral change has a broad differential diagnosis. Genetic testing may aid in the diagnostic process. We investigated the prevalence of pathogenic genetic variants (PGVs) in individuals referred to our memory clinic with late-onset behavioral change and identified clinical "red flags" for PGV carriership, specifically in diagnostically ambiguous cases.<h4>Methods</h4>Individuals presenting with late-onset behavioral change were included from the Late Onset Frontal Lobe Syndrome study (n = 88), Social Brain Project (n = 265), and Amsterdam Dementia Cohort (n = 349). PGV prevalence was calculated. Among diagnostically ambiguous individuals at baseline, univariate logistic regression models were fitted to identify clinical cues for PGV carriership. Based on these results, we fitted multivariate logistic regression models. We also assessed the association of cortical thickness and subcortical volumes with PGV carriership.<h4>Results</h4>Among 702 individuals, 228 received a diagnosis in the frontotemporal lobar degeneration (FTLD) spectrum at baseline and 474 were diagnostically ambiguous. A total of 106 individuals (15%) carried a PGV (20% in FTLD; 13% in ambiguous cases). The most common PGV in both groups was the <i>C9orf72</i> repeat expansion (56% and 57%), followed by <i>microtubule-associated protein tau</i> (13% and 11%) and <i>GRN</i> (11% and 10%). A <i>Huntingtin</i> repeat expansion was found in 5 ambiguous cases. In multivariate analyses, PGV carriership was associated with a family history of dementia (OR<sub>FH</sub> [95% CI] 3.1 [1.7-5.5], <i>p</i> < 0.001), younger age (OR<sub>age,10yr</sub> [95% CI] 2.0 [1.4-2.9], <i>p</i> < 0.001), female sex (OR<sub>female</sub> [95% CI] 2.0 [1.1-3.6], <i>p</i> = 0.02), a Frontal Assessment Battery score <13 (OR<sub>FAB</sub> [95% CI] 2.1 [1.1-4.1], <i>p</i> < 0.05), and medial temporal and posterior atrophy (OR<sub>MTA</sub> [95% CI] 3.2 [1.0-10], <i>p</i> < 0.05; OR<sub>PCA</sub> [95% CI] 13 [2.0-81], <i>p</i> < 0.01). In additional MRI analyses, atrophy in the thalamus (standardized β ± standard error = -1.26 ± 0.28), putamen (-1.15 ± 0.24), and superior parietal cortex (-1.07 ± 0.22) was most strongly associated with PGV carriership.<h4>Discussion</h4>Genetic testing for dementia-associated genes should be considered in all late-onset behavioral change cases. While we propose several clinical cues as "red flags" for PGV carriership, their absence should not preclude genetic counseling. The higher PGV prevalence among diagnostically ambiguous women suggests that FTLD may be underrecognized in women compared with men.

Also flagged:wound healingcell adhesionangiogenesisosteogenesisinjurydegradation
Journal Article 2026-05-14 No Snippets Shi J, Liang T, Heljak M, Qiu Z, Chen S, Li J, Kazakidi A, Święszkowski W, Li B, Shu W.
Show Full Abstract

Bioactive materials are engineered to actively interact with biological systems and induce favorable cellular and tissue responses. The development of bioactive materials is inherently challenging due to the complexity of the biological processes that they participate in. Traditional high-throughput platforms and computational simulations are often insufficient to address the multidimensional requirements. Artificial intelligence (AI) provides powerful tools to address these challenges. By utilizing data-driven models, AI can reveal non-obvious relationships within experimental datasets, enable prediction of material behaviors, and guide rational design of new materials. In this review, we provide a systematic overview of recent advances in AI for bioactive materials. Firstly, the classification of bioactive materials is summarized, including bioactive metals, bioactive ceramics, bioactive polymers and bioactive composites. Then, current AI tools employed in bioactive materials are presented according to various classification methods. Next, the process-oriented applications of AI in bioactive materials are introduced, such as material design, fabrication optimization, property prediction, in vitro assessments, and in vivo assessments. Finally, the key challenges and future opportunities in this field are discussed comprehensively.

VRK2
Also flagged:epilepsymetabolismGenetic Generalized EpilepsyionGenetic generalized epilepsieschronic neurological disorder
Journal Article 2026-05-14 ✓ 1 Snippet Kidder BL, Xu J, Geng R, Dlugas H, Vavilikolanu A, Chen W, Wasade VS.
In-Text Gene Mentions

…prominently implicating theVRK2/FANCL locus at 2p16.1…

Show Full Abstract

<b>Background/Objectives</b>: Genetic generalized epilepsies (GGE) often remit in childhood, yet a subset of adults remain pharmacoresistant with substantial morbidity. The genetic basis of adult pharmacoresistant GGE is poorly defined. This descriptive study used whole-genome sequencing (WGS) to identify recurrent coding variants and pathways associated with pharmacoresistant adult GGE. <b>Methods</b>: WGS was performed in ten racially diverse adults (mean age 37.2 years; range 20-52) with electroencephalographically confirmed, pharmacoresistant GGE (mean onset 13.7 years). Analysis prioritized variants present in at least 80% of participants and which were either (i) missense variants predicted deleterious with ANNOVAR or (ii) loss-of-function variants predicted high-impact from snpEff. Pathway enrichment and overlap with a commercial clinical epilepsy gene panel were assessed. <b>Results</b>: Filtering identified 133 unique, deleterious coding variants across 69 genes shared by at least eight participants. Four genes (APOL4, KMT2C, SON, VDR) overlapped a clinical epilepsy panel, supporting the capacity of WGS to recover clinically relevant loci. Prioritized loci implicated gastrointestinal and metabolic regulators (e.g., MUC6, PNLIPRP2), chemosensory receptors (OR10D3, OR8U1, TAS2R19), neuroimmune mediators (LILRA2, SIGLEC12, OAS2), and ion transporters (KCNJ12, P2RX5, RHBG), consistent with multifactorial mechanisms of pharmacoresistance. <b>Conclusions</b>: This exploratory WGS study focused exclusively on adults with pharmacoresistant GGE, revealing shared high-impact variants and convergent pathways spanning absorption/metabolism, vitamin D signaling, immunity, and ion transport. Findings broaden the genetic landscape of pharmacoresistant GGE while motivating validation in larger, multiethnic cohorts.

ZNF322
Also flagged:Lung cancercancercancersNon-small-cell lung cancerNSCLClung adenocarcinoma
Journal Article 2026-05-14 ✓ 5 Snippets Sun J, Yang Y, Huang X, Xue D, Li J, Huang Y, Meng Q.
In-Text Gene Mentions

…TRAF2 , andZNF322( Figure 3…

…CASZ1 , andZNF322were highly expressed…

…< 0.001), whileZNF322and CASZ1 were…

…< 0.001), andZNF322( p <…

…GATA4, TRAF2, andZNF322were consistent with…

Show Full Abstract

<b>Background</b>: Lung adenocarcinoma (LUAD) is the most common type of lung cancer and a major cause of cancer death. Zinc finger proteins (ZNFs) have been implicated in LUAD progression, functioning either as oncogenes or tumor suppressors. Therefore, an in-depth investigation of ZNFs may contribute to the development of novel diagnostic and therapeutic strategies for LUAD. <b>Methods</b>: Transcriptomic and clinical data were obtained from the TCGA and GEO databases. Prognosis-related ZNF genes were identified using univariate Cox, LASSO, and multivariate Cox regression analyses. An eight-gene ZNF-based prognostic signature was constructed and validated in two independent external cohorts (GSE50081 and GSE26939). A nomogram integrating independent prognostic factors was developed. Immune infiltration, somatic mutation profiles, and drug sensitivity were systematically analyzed. We further focused on FGD3, a key gene from the signature, examining its expression in LUAD cells and tissues, including lorlatinib-resistant models. <b>Results</b>: The prognostic signature comprising TRIM6, TRIM29, CTCFL, FGD3, GATA4, CASZ1, TRAF2, and ZNF322 effectively stratified patients into distinct risk groups with significantly different overall survival (<i>p</i> < 0.05). The risk score, together with T and N stage, served as independent prognostic predictors (<i>n</i> = 500, <i>p</i> < 0.05). High-risk patients exhibited an immune-desert phenotype, increased tumor mutational burden, and distinct drug sensitivity patterns. Notably, FGD3 expression was downregulated in LUAD tissues (<i>n</i> = 14, <i>p</i> < 0.0001) and lorlatinib-resistant cells, and its restoration suppressed resistant cell proliferation and partially reversed drug resistance. <b>Conclusions</b>: This study establishes a promising ZNF-based prognostic model for LUAD, providing a potential tool for risk stratification and individualized therapeutic decision-making. The identification of FGD3 as a potential mediator of drug resistance highlights its promise as a candidate biomarker and therapeutic target in LUAD.

Also flagged:CancerProstate CancerPCatumortranslationalmatrix
Journal Article 2026-05-14 No Snippets Truong HTT, Kwon WA, Woo HJ, Kim MS, Tran NQ, Joung JY.
Show Full Abstract

Prostate cancer (PCa) progression and treatment resistance are driven by tumor-intrinsic mechanisms and adaptive remodeling of the tumor microenvironment, in which cancer-associated fibroblasts (CAFs) play a crucial role. Although CAF biology is increasingly recognized, a major translational gap remains: CAFs are highly heterogeneous, and comprise distinct functional states with divergent effects on disease progression, immune regulation, and therapeutic resistance. To bridge this gap, we synthesize evidence from single-cell and spatial transcriptomic studies, tissue-based pathology, liquid biopsy assays, and molecular imaging to construct an evidence-tiered, decision-oriented translational framework that connects stromal mechanisms, translational measurement strategies, and therapeutic interventions in PCa. Single-cell and spatial transcriptomic analyses have consistently identified multiple CAF programs, including matrix-remodeling, inflammatory, immunoregulatory, antigen-presenting, and therapy-imprinted states, each with distinct functional outputs and clinical correlates. Tissue-based readouts, including reactive stromal grade (RSG) and fibroblast activation protein (FAP) immunohistochemistry, provide practical proxies for stromal activation and correlate with disease-specific mortality and imaging phenotypes. Circulating CAFs (cCAFs) represent an emerging liquid biopsy modality for longitudinal stromal monitoring, although technical standardization is required before clinical implementation. FAP-targeted PET imaging and emerging dual prostate-specific membrane antigen (PSMA)/FAP-targeted theranostic strategies provide noninvasive tools for patient selection and response assessment, particularly in PSMA-discordant or tracer-heterogeneous disease. Androgen receptor (AR)-targeted therapy can reprogram stromal states toward resistance-promoting circuits, highlighting the dynamic and plastic nature of the CAF compartment. A state-based CAF framework organizes stromal biology into testable translational hypotheses rather than immediate clinical standards. RSG and FAP-based tissue or imaging readouts are practical markers of stromal activation, whereas spatial CAF-immune signatures and cCAF assays remain investigational and require assay harmonization and prospective validation. Future trials should pre-specify stromal biomarkers as enrichment or pharmacodynamic variables when matched to the intervention and should avoid treating CAFs as a uniform therapeutic target.

Also flagged:obesitymetabolic dysfunction-associated steatotic liver diseasenon-alcoholic fatty liver diseaseNAFLDtype 2 diabetescardiovascular disease
Journal Article 2026-05-14 No Snippets Liu Y, Huang T, Dang J, Cai S, Li J, Yang R, Zhang J, Zhu K, Sun Z, Yang Y, Wang Y, Xi B, Song Y.
Show Full Abstract

<b>Background:</b> The prevalence of metabolic dysfunction-associated steatotic liver disease (MASLD) has increased rapidly in pediatric populations. Evidence on the cost-effectiveness of pediatric MASLD screening strategies remains limited. <b>Methods:</b> A decision tree combined with a Markov state-transition model was developed to evaluate the cost-effectiveness of three WHtR-based two-stage screening strategies among children aged 6-14 years in Beijing, China: WHtR combined with ultrasound (S1), WHtR combined with FibroScan<sup>®</sup> (S2), and WHtR combined with magnetic resonance imaging-proton density fat fraction (MRI-PDFF) (S3), compared with no screening (S4). All screening strategies were combined with lifestyle modification programs, including dietary and exercise management. Model inputs were derived from the published literature, national survey data, and expert consensus. Costs and quality-adjusted life years (QALYs) were estimated from a healthcare system perspective over a 10-year time horizon, with a 3% annual discount rate. Incremental cost-utility ratios (ICURs) were calculated, and extensive one-way, two-way, and probabilistic sensitivity analyses were performed. <b>Results:</b> Our model indicated that, at a willingness-to-pay (WTP) threshold of $30,584.0 per QALY, corresponding to three times the gross domestic product (GDP) per capita of China, S2 was identified as the optimal strategy. At a higher WTP threshold of $71,415.5 per QALY, based on the GDP per capita of Beijing, S3 became the most cost-effective option. All three screening strategies were more cost-effective than no screening across both thresholds. Sensitivity analyses demonstrated that utility values for fibrosis stages and the response rate of the lifestyle modification program were the most influential parameters, and probabilistic sensitivity analysis confirmed the robustness of the baseline findings. <b>Conclusions:</b> To the best of our knowledge, this is the first cost-effectiveness analysis for pediatric MASLD in China. Model-based estimates suggest that early screening for MASLD in children using WHtR-based screening strategies is cost-effective, with FibroScan<sup>®</sup> preferred in settings with average economic development and MRI-PDFF preferred in more affluent regions. These findings underscore the importance of context-specific implementation of early MASLD screening strategies in pediatric populations to mitigate long-term disease burden.

OLFM4
Also flagged:cancerhematocheziaintestinal acute radiation syndromeinflammatory responsesphosphorylationautophagy
Journal Article 2026-05-14 ✓ 5 Snippets Ji A, Shen X, Zhao C, Weng Z, Zhang X, Yu KK, Xing S, Yan X, Yu Z.
In-Text Gene Mentions

…an, China, GB12051-100), anti-Olfm4(1:600, Cell Signaling…

Olfm4(Olfactomedin-4) has emerged…

…Olfm4 (Olfactomedin-4) has emerged as…

…dramatic reduction ofOlfm4+ stem cells…

…This depletion ofOlfm4-positive cells likely represe…

Show Full Abstract

<h4>Background</h4>Intestinal acute radiation syndrome (IARS) represents a life-threatening component of acute radiation syndrome with limited effective countermeasures. Understanding molecular determinants governing intestinal epithelial resilience to ionizing radiation is critical for developing radiation toxicity mitigation strategies.<h4>Objectives</h4>This study investigates the role of PIKfyve, a phosphoinositide kinase essential for endolysosomal homeostasis, in modulating radiation-induced intestinal toxicity.<h4>Methods</h4>We utilized an inducible intestinal epithelial-specific PIKfyve-knockout mouse model (PIKfyve cKO) subjected to 10 Gy abdominal irradiation. Intestinal toxicity was assessed through histopathology, barrier permeability (FD4 assay), apoptosis markers, and transcriptomic profiling. Small intestinal organoids were employed for mechanistic validation.<h4>Results</h4>PIKfyve deletion alone did not perturb normal gut architecture but precipitated severe post-irradiation toxicity, including villous atrophy, crypt hypoplasia, and massive crypt-cell apoptosis. Barrier dysfunction was evidenced by elevated serum FD4 and heightened systemic pro-inflammatory cytokines, culminating in markedly increased mortality. Transcriptomic analysis revealed potentiated DNA-damage signaling and amplified inflammatory cascades in PIKfyve-deficient intestines.<h4>Conclusions</h4>These findings identify PIKfyve as a critical guardian of intestinal epithelial integrity against radiation toxicity. Given emerging PIKfyve inhibitors in cancer therapy, our results raise important safety considerations for clinical radiotherapy and position PIKfyve as a potential target for radiation toxicity mitigation.

Also flagged:Gastric cancercancertumorgastric adenocarcinomasegmentationnucleus
Journal Article 2026-05-14 No Snippets Xu X, Fan J, Peng L, Xiang Z, Luo D, Ma C, Huang B, Nie X, Dong X.
Show Full Abstract

<h4>Background</h4>Neoadjuvant immunochemotherapy (nICT) has emerged as a promising strategy for locally advanced gastric cancer (LAGC), yet clinical responses remain heterogeneous and reliable predictive biomarkers are lacking. A comprehensive dissection of the tumor microenvironment (TME) is essential to uncover determinants of therapeutic efficacy and enable precision immunotherapy.<h4>Methods</h4>We performed digital spatial profiling (DSP) using the NanoString GeoMx platform on pretreatment endoscopic biopsies from 19 LAGC patients treated with tislelizumab plus SOX chemotherapy. Multiplex fluorescence staining (PanCK, CD45, CD68) enabled compartment-specific transcriptomic analysis of tumor center regions, immune cell infiltration area, and other stromal regions. Findings were integrated with TCGA-STAD data and validated in an independent cohort (n = 20) by immunohistochemistry (IHC) for NOTUM, SERPINA3, CD8, and FOXP3.<h4>Results</h4>Spatial profiling revealed distinct transcriptional programs across tumor-center regions (TC), immune cell infiltration area (MA), and other stromal regions (OTHER) compartments. High tumor-intrinsic expression of NOTUM, NKD1, and SERPINA3, together with elevated CD8<sup>+</sup> T cell infiltration and a reduced Treg/CD3<sup>+</sup> ratio within the TME, robustly associated with major pathological response (MPR). These spatial biomarkers were orthogonally validated by IHC in an independent cohort. In TCGA-STAD, a six-gene signature (NOTUM, APOA2, SERPINA3, NKD1, GGH, BPIFB1) correlated with prolonged survival and favorable immune infiltration, with conserved immune-modulatory patterns across multiple cancer types.<h4>Conclusions</h4>This study identifies NOTUM, SERPINA3, and CD8<sup>+</sup> T cell density as spatially resolved, clinically actionable predictors of nICT response in LAGC. Our findings underscore the power of spatial TME interrogation to uncover novel biomarkers and guide personalized immunotherapeutic strategies.

Also flagged:TumorTumorssecretionsynthesisautoimmune diseaseslocalization
Journal Article 2026-05-14 No Snippets Tai W, Zheng C.
Show Full Abstract

Tumor antigen-associated autoantibodies (TAAbs) are generated by the immune system in response to tumor-associated antigens (TAAs). The underlying mechanisms of their production remain incompletely understood, yet may encompass factors such as aberrant protein expression, deficiencies in immune tolerance, the tumor inflammatory microenvironment, exosomes, and immunogenic cell death. TAAbs exert a dual effect in tumor initiation and progression, both facilitating and impeding the development of malignant tumors. They represent promising biomarkers for early tumor diagnosis, prognosis assessment, and evaluation of treatment efficacy or outcomes, thereby emerging as a current research focal point. This review initially clarifies the multidimensional mechanisms and dual functions of TAAbs in tumorigenesis and tumor progression, and subsequently explores their application prospects in tumor diagnosis, treatment, and prognosis. Finally, through a summary and analysis of the current research landscape, three crucial and feasible future research directions are put forward. It should be underscored that TAAb detection is a promising adjunctive instrument for tumor diagnosis and treatment; however, it still confronts substantial challenges in clinical application and necessitates further in-depth exploration.

Also flagged:Metabolismtumorphosphorylationsolid tumorscancerlymphoma
Journal Article 2026-05-14 No Snippets McPhedran S, Zhao T, Lum JJ.
Show Full Abstract

T cell-based immunotherapies have transformed cancer treatment, yet their efficacy in solid tumors is constrained by the nutrient-poor and oxidative tumor microenvironment (TME). Accumulating evidence indicates that reactive oxygen species (ROS), methionine metabolism, and the amino acid stress sensor general control nonderepressible 2 (GCN2) are tightly interconnected regulators of T cell activation, differentiation, and effector function. In this review, we detail how these pathways form an integrated redox-metabolic circuit that dynamically tunes T cell responses to environmental stress. Physiological ROS are essential for T cell receptor signaling, glycolytic reprogramming, and cytotoxicity, whereas excessive or prolonged oxidative stress drives exhaustion and apoptosis. GCN2 links amino acid availability, particularly methionine and cysteine, to adaptive transcriptional and metabolic programs that regulate glutathione synthesis and redox homeostasis. We highlight how therapeutic manipulation of methionine availability, GCN2 signaling and ROS produces highly context-dependent outcomes across immune checkpoint blockade and adoptive cell therapy settings in solid tumors. Finally, we discuss emerging strategies to interrogate and modulate this circuit using integrated omics, CRISPR-based screening, and pharmacological approaches, emphasizing the need for context-aware and temporally controlled metabolic interventions to enhance T cell-based immunotherapies in solid tumors.

DCC
Also flagged:psychiatric disordersIBSmajor depressive disorderneuroticismIrritable bowel syndromemitochondrial
Journal Article 2026-05-14 ✓ 1 Snippet Ye W, Ding H, Peng B, Wang X, Cheng Y, Zhang G, Yu H, Ullah K, Chang X, Wang X, Wang Z.
In-Text Gene Mentions

…, SLC4A10 ,DCC, and MRO…

Show Full Abstract

<h4>Introduction</h4>Irritable bowel syndrome (IBS) is a common gut-brain axis disorder characterized by abdominal pain and altered bowel habits, and it shows high comorbidity with psychiatric disorders. However, the shared genetic mechanisms underlying these associations remain incompletely understood.<h4>Methods</h4>We performed a large-scale meta-analysis of IBS in individuals of European ancestry by integrating genome-wide association study (GWAS) summary statistics from the UK Biobank, Bellygenes, and the Million Veteran Program (MVP), thereby increasing statistical power to detect novel IBS loci. We further conducted global genetic correlation analyses with psychiatric traits, followed by multi-trait analysis of GWAS (MTAG) and conditional false discovery rate (condFDR) analyses to identify pleiotropic loci. Transcriptomic, methylomic, and expression quantitative trait locus (eQTL) data were integrated to explore potential regulatory mechanisms.<h4>Results</h4>The meta-analysis identified up to ten previously unreported IBS loci, several of which were supported by colonic and brain eQTL effects. Global genetic correlation analyses confirmed substantial genetic overlap between IBS and psychiatric traits, particularly major depressive disorder and neuroticism. MTAG and condFDR analyses uncovered more than 100 pleiotropic loci, including signals at <i>SORCS1, SLC35D1, COA1</i>, and <i>TLE1</i>. Integrative analyses of transcriptome- and methylome-wide data highlighted regulatory mechanisms spanning colonic, immune, and neuronal tissues, supporting neuro-immune crosstalk and mitochondrial involvement.<h4>Discussion</h4>Our findings provide a comprehensive genetic characterization of IBS, refine its heritable basis, reveal pleiotropic links with psychiatric disorders, and implicate molecular pathways across the gut-brain axis. These results advance mechanistic understanding of IBS and may inform future therapeutic development for IBS and its psychiatric comorbidities.

Also flagged:Inflammatory bowel diseaseulcerative colitispathogenesisMitochondriaphosphorylationmitophagy
Journal Article 2026-05-14 No Snippets Chen S, Guan J, Pang X, Chen X, Li M, Wang H, Mao F.
Show Full Abstract

Inflammatory bowel disease (IBD), encompassing Crohn's disease (CD) and ulcerative colitis (UC), is a chronic inflammatory disorder of the gastrointestinal tract driven by complex interactions among genetic susceptibility, barrier dysfunction, and immune dysregulation. Mitophagy, the selective autophagic clearance of damaged mitochondria, has emerged as a key regulator of intestinal homeostasis and immune balance. Impaired mitophagy compromises epithelial barrier integrity, amplifies inflammatory signaling, and promotes disease progression. This review summarizes the molecular mechanisms of mitophagy, examines its involvement in IBD pathogenesis across intestinal epithelial and immune cell compartments, and highlights mitophagy-modulating compounds that may inform the development of novel therapeutic strategies.

OLFM4
Also flagged:cancerHelicobacter pylori infectiongastrointestinal disorderstumorpathogenesiscell cycle
Journal Article 2026-05-14 ✓ 1 Snippet Wang ZZ, Li YH, Yuan L, Jia SM, Yang P, Liu WJ, Nan Y.
In-Text Gene Mentions

…Notably, HOXC9, KLK8,OLFM4, FNDC1, and LIPF,…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) ranks as the fifth most common malignancy worldwide. Current treatments are limited by side effects and drug resistance, highlighting the need for novel therapies. Traditional Chinese medicine (TCM) pair Coptis-Cinnamon (HL-RG) shows promise against GC, but its mechanism remains unclear.<h4>Methods</h4>Active components and targets of HL-RG were obtained from TCMSP, and GC-related genes from GEO and GeneCards. Intersection targets were analyzed via STRING for PPI network construction. GO and KEGG enrichment analyses were performed using DAVID to identify key pathways and hub genes. Clinical relevance, mutations, immune infiltration, and drug sensitivity were analyzed. Molecular docking validated interactions between core components and hub genes. <i>In vitro</i> experiments (CCK-8, flow cytometry, Transwell, qRT-PCR, Western blot) were conducted in AGS and HGC-27 cells to verify anti-GC effects. To verify the causal relationship, we conducted rescue experiments using the MEK inhibitor U0166 and the MAPK agonist EGF.<h4>Results</h4>Sixteen active components and 499 targets of HL-RG were identified, with 55 common targets screened from 3,194 GC-related DEGs. Enrichment analyses revealed involvement in inflammatory responses and the MAPK pathway, identifying PDGFRB, EGFR, MMP2, MMP9, and KIT as hub genes. Molecular docking showed binding affinities between core components (berberine, berberrubine) and hub genes. <i>In vitro</i> experiments confirmed that HL-RG inhibits GC cell proliferation, induces apoptosis, and suppresses migration and invasion via MAPK pathway regulation. Rescue experiments demonstrated that U0126 phenocopied HL-RG effects, while EGF significantly reversed HL-RG-induced functional changes and p-ERK reduction, confirming that HL-RG acts through the MAPK/ERK pathway.<h4>Conclusions</h4>HL-RG exerts anti-GC effects by targeting the MAPK pathway and its hub genes, providing a scientific basis for its clinical application.

HFE
Also flagged:LeptospirosiszoonosisInfectionhyperbilirubinemiaacute kidney injurymembranes
Journal Article 2026-05-14 ✓ 2 Snippets Drupka M, Pol K, Holubiuk L, Walecik-Kot W.
In-Text Gene Mentions

…high ferritin levels,hemochromatosiswas considered, but…

…typical manifestations ofhemochromatosislike arthralgia, cardiomyopath…

Show Full Abstract

Leptospirosis is a zoonotic disease caused by <i>Leptospira</i> spirochetes. It is widespread worldwide, but remains uncommon in European countries. People who come into contact with water, soil, and animals, especially wild rodents, are at risk of infection. The course of the disease is usually mild, but severe cases presenting with multiorgan dysfunction are potentially fatal. When leptospirosis is suspected, rapid treatment is essential for avoiding life-threatening complications. This report discusses the case of a 51-year-old man who was admitted to the hospital with a history of several days of fever, weakness, vomiting, abdominal pain, and jaundice. His condition quickly deteriorated. Initial test results indicated acute liver and kidney injury and thrombocytopenia. Leptospirosis was considered when, upon further questioning, the patient reported the presence of rats in the kitchen where he worked. Serological tests supported the diagnosis of probable leptospirosis. Empirical treatment with ceftriaxone was effective as the patient's condition improved significantly. This case describes the dynamic course of severe leptospirosis, a disease that is very rare in Poland.

RABGAP1L
Also flagged:AAinflammatory skin diseaseswound healingskin canceratopic dermatitisAD
Journal Article 2026-05-14 ✓ 1 Snippet Trubetskoy D, Grudzien PK, Klopot A, Tsoi LC, Kundu RV, Perez White BE, Budunova I.
In-Text Gene Mentions

RABGAP1L(RAB GTPase Activating…

Show Full Abstract

The increased prevalence of inflammatory skin diseases such as atopic dermatitis, hidradenitis suppurativa, acne, lupus erythematosus in African American (AA) compared to White Non-Hispanic population is well recognized. However, the underlying mechanisms are largely unknown. Here we analyzed proteome in healthy skin biopsies from AA and White Non-Hispanic volunteers using Olink Explore 384 Inflammation biomarker panel. Among proteins with higher expression in AA skin were IRAK1, IL1A, IL4, IL22RA1. It is known that IL1A binding to IL1R1 receptor results in recruitment of signaling adapter MyD88 and IL1R1-associated kinases including IRAK1, a key signal transducer involved in activation of downstream NF-κB and MAPK signaling cascades. We confirmed the increased IRAK1 expression as well as activation of NF-κB and extracellular signal-regulated kinase1/2 signaling in both AA adult and neonatal skin by western blot analysis of relevant proteins (p65/RelA, IKKs, IκBα, extracellular signal-regulated kinase1/2) phosphorylation at specific activating sites. We also confirmed the overexpression of previously reported differentially expressed in AA skin pro-inflammatory genes such as IL1A, TNFα, fold change ER1G in our sets of AA healthy adult and neonatal skin using qRT-PCR. Overall, our study suggests the importance of further analysis of molecular landscape of healthy AA skin to assess how it may contribute to the increased risk of certain inflammatory diseases within the AA population.

PRDX6
Also flagged:mucusextracellularinseminationsecretionsreproductionoestrus
Journal Article 2026-05-14 ✓ 3 Snippets Yusuf M, Toleng AL, Hasrin H, Baharun A, Diansyah AM, Kaiin EM, Masturi M, Sahiruddin S, Jannah M.
In-Text Gene Mentions

…ntin (SPP1), peroxiredoxin-6 (PRDX6), heat-shock proteins B6…

…(ACTA2), SPP1, CRP,PRDX6, SLPI, galectin 3…

…longside antioxidant enzymes (PRDX6, GPX1 and SOD1)…

Show Full Abstract

<h4>Introduction</h4>Reproductive efficiency in swamp buffalo (<i>Bubalus bubalis</i>) remains constrained by the lack of molecular tools to identify fertile females before service. The aim of this study was to discover biologically grounded biomarkers of fertility.<h4>Material and methods</h4>Cervical mucus was profiled using high-resolution proteomic analysis, with quantitative and functional enrichment used to prioritise biologically relevant fertility markers.<h4>Results</h4>The cervical-mucus proteome exhibited a conserved secreted core with marked quantitative shifts that separated favourable-quality from poor-quality mucus. Favourable mucus was characterised by a barrier- and adhesion-associated profile with antimicrobial and antioxidant features, its proteins including integrin/extracellular matrix interactors, redox enzymes, lipocalin 2 (LCN2), secretory leukocyte protease inhibitor (SLPI) and heat-shock protein B6 (HSPB6). Poor mucus showed a neutrophil-acute-phase axis with complement engagement and oxidative chemistry, typified by myeloperoxidase (MPO), pentraxin 3 (PTX3) and C-reactive protein (CRP). Functional enrichment emphasised extracellular and host-defence processes consistent with these opposing mucosal states. These six proteins were consistently the leading discriminants and had coherent biological roles.<h4>Conclusion</h4>Swamp-buffalo cervical mucus is variously in a barrier-competent state and a neutrophil-dominant state. This dichotomy provides a mechanistic explanation for fertility differences at the cervix and yields actionable, secreted protein biomarkers - LCN2/SLPI/HSPB6 in favourable mucus and MPO/PTX3/CRP in poor mucus - for targeted assays and pre-service screening in tropical production systems.

bioRxiv 2026-05-14 Preprint (No Snippets API) Lafage C, Ratié L, Humbert S.
Show Full Abstract

<h4>Background</h4> Huntington disease (HD) is a neurological disorder caused by an aberrant CAG expansion in the HTT gene, producing a mutant protein (mHTT). Although HD is classically characterized by adult-onset cortical and striatal degeneration, accumulating evidence suggests that altered cortical development may also contribute to disease pathogenesis. <h4>Objective</h4> We sought to investigate the impact of mHTT on neocortical patterning, which is a largely unexplored aspect of HD. <h4>Methods</h4> Using the HdhQ140 HD knock-in mouse model, we performed immunofluorescence and in situ hybridization to analyze the patterning of the cortex from embryonic day 10 to postnatal day 7. <h4>Results</h4> During embryogenesis, HTT expression exhibited a high medial-to-low lateral gradient in the neocortex, like that observed for key transcription factors involved in cortical patterning. Notably, HTT expression was absent from the cortical hem, a critical patterning center. In HD, the protein gradient remained unchanged whereas the expression in medial pallium seemed increased. During the early development of the cerebral hemispheres, the expression of morphogens and signaling pathways, including Shh, Fgf8 , and Wnt / BMP genes, were disrupted in organizing centers, leading to altered expression of major neocortical transcription factors. At postnatal stages, the motor and somatosensory cortical areas were misplaced. These developmental alterations were associated with postnatal sensorimotor deficits relevant to HD. <h4>Conclusions</h4> Our findings demonstrate that HD-related neurodevelopmental alterations arise as early as embryonic day 10 in mice. This supports previous work suggesting that defects in brain development contribute to HD pathogenesis prior to clinical onset.

Also flagged:acute myeloid leukemiaAMLtranslationaldegradationpediatric leukemiaAcute Myeloid Leukaemia
Journal Article 2026-05-13 No Snippets Tsakaneli A, Che N, Virely C, McCord B, Gasparoli L, Loe A, Fung K, Ciampa O, Alver NM, Li Q, Bartram J, O'Connor D, Mansour M, Williams O.
Show Full Abstract

Outcomes for pediatric acute myeloid leukemia (AML) have improved significantly in recent years. However, relapsed and refractory disease remains a significant problem. The chemotherapy burden experienced by these patients makes the translational development of non-genotoxic experimental therapies attractive. We previously reported that the anti-helminth drug mebendazole induces degradation of the transcription factor MYB and has potent anti-AML activity. In the present study, we use CRISPR drop-out screening to identify genes encoding the proapoptotic regulators BAK and NOXA as hits conferring resistance to mebendazole activity in AML cells. Conversely, targeting MCL1 with a BH3-mimetic significantly enhanced the anti-AML activity of mebendazole in both AML cell lines in vitro and pediatric patient-derived xenograft (PDX) AML cells ex vivo. Treatment of mice transplanted with THP-1 AML cells or aggressive infant PDX AML cells with this drug combination significantly impaired disease progression in vivo. Our data indicate that mebendazole-induced MYB degradation in combination with MCL1 targeting is a novel non-genotoxic therapeutic strategy for pediatric AML.

HFE
Also flagged:lung cancerscancerdeathsynthesistumorcarcinoma
Journal Article 2026-05-13 ✓ 1 Snippet Lkhoyaali S, Ghizlane C, Batlamous B, Efountame Nkoghe ENC, El Ghissassi I, Mrabti H, Errihani H, Khalis M, Boutayeb S.
In-Text Gene Mentions

…(5%): Polymorphisms inHFE, SERPINA1, NOD1/2, CTNNB1,…

Show Full Abstract

<h4>Purpose</h4>Real-world data (RWD) has become essential to guide oncology practice and policy. However, in Morocco, the extent and quality of available oncology RWD remain unclear. This study aims to address this gap by examining the current status of RWD in oncology in the Moroccan context.<h4>Methods</h4>We systematically identified and synthesized 308 Moroccan cancer studies (1985-2025) drawn from different electronic databases. Eligible studies included those based on population registries, as well as retrospective and prospective clinical cohorts, molecular and genetic studies, and psycho-oncological or health-system analyses. Data were extracted across five domains: (1) epidemiology, (2) molecular biology, (3) treatment outcomes, (4) survivorship and quality of life, and (5) system-level and public health interventions.<h4>Results</h4>Breast (25%), colorectal (12%), and lung cancers (10%) were the most frequently studied. Most RWD outputs originated from Casablanca (34%), followed by Rabat (27%) and Fez (18%). Clinical and epidemiological studies (56%) were the most predominant study types while molecular papers (21%) highlighted actionable biomarkers: EGFR, KRAS, TP53, BRCA1/2, and VEGF.56 CONCLUSION: Morocco has transitioned from case-series oncology research to integrated molecular-epidemiologic RWD networks. Strengthening national data interoperability, biobank integration, and linkage between registries and clinical outcomes is now imperative.

Also flagged:neurodegenerative disorderstranslationalbiosynthesisneurodegenerative diseasesmultiple sclerosissynthesis
Journal Article 2026-05-13 No Snippets Fowler DK, Savage TM, Mackie DI.
Show Full Abstract

Non-psychotropic phytocannabinoids produced by Cannabis sativa, including cannabidiol, cannabigerol, cannabichromene and their varin and acidic analogs, are emerging as promising modulators of neuroinflammation, particularly through actions on microglia, the brain's resident immune cells. These compounds engage numerous receptors, ion channels, and intracellular signaling systems in microglia associated with neuroinflammation, and therefore are promising therapeutic candidates to treat chronic microglial inflammation-mediated neurodegenerative disorders. Despite substantial public and scientific interest, comprehensive evaluation of their mechanistic diversity, disease-relevant potential, and translational gaps across neurodegenerative disorders remains limited. Commonly, gaps also exist between cannabis breeders' and cultivators' knowledge of phytocannabinoid diversity and translational scientists' understanding of therapeutic potential. In this review, we first provide an in-depth overview of the main non-psychotropic phytocannabinoids, their biosynthesis, and the genetics that control their production in cannabis. We then summarize the known mechanisms of action for each cannabinoid in microglial-expressed molecular targets and signaling pathways relevant to neuroinflammation. Lastly, we review the effects of non-psychotropic phytocannabinoids in pre-clinical models and clinical trials of four neuroinflammation-associated neurodegenerative diseases: Alzheimer's disease, Parkinson's disease, multiple sclerosis, and Huntington's disease. Current evidence supports meaningful biological activity and complex cannabinoid-specific polypharmacology, yet substantial gaps persist, especially for cannabinoids other than cannabidiol; addressing these gaps in disease-relevant models will be essential for translating these compounds into future therapeutic strategies. Further, we anticipate the summarized information will foster collaboration between cannabis breeders/cultivators and applications scientists for therapeutic evaluation and development of emerging non-psychotropic phytocannabinoids.

Also flagged:extracellularmembranesecretionmicrobial infectionscell wallsreproduction
Journal Article 2026-05-13 No Snippets Gerrits R, Schumacher J, Gorbushina AA.
Show Full Abstract

Fungal iron acquisition has mostly been studied for pathogens living in competitive environments where securing iron from the host is critical for proliferation. However, how fungi from stress-rich but competition-free material surfaces handle iron uptake is unknown. We studied these processes in rock-inhabiting fungi, known for their constitutive melanin production, extremotolerant lifestyle, and colonization of exposed surfaces such as solar panels and marble monuments, by choosing <i>Knufia petricola</i> to represent this group. The characterization of targeted mutants showed that <i>K. petricola</i> can take up iron via an extracellular-yet undefined-siderophore and a ferroxidase-iron permease complex. By disrupting melanin synthesis, it was demonstrated that this pigment can reduce and adsorb iron, but nevertheless does not contribute significantly to iron acquisition. Moreover, chemotropism toward an iron source was found to be siderophore-dependent. Ferric citrate could not be directly assimilated. Finally, it was found that <i>K. petricola</i> and other rock-inhabiting fungi exhibited high sensitivity to strong iron chelators, such as EDTA. These observations not only offer a potential mitigation strategy for preventing fungal colonization of subaerial materials using iron chelators but also highlight the specialized adaptations of these fungi to low-competition environments.IMPORTANCEThe rock-inhabiting fungus <i>Knufia petricola</i> acquires iron primarily via reductive iron assimilation, independently of the iron-adsorbing and iron-reducing melanin. Its siderophore, although extracellular and allowing chemotropism toward an iron source, cannot obtain iron from strong iron chelators, such as BPS and EDTA. This sensitivity to iron sequestration opens avenues for mitigating the fungal colonization of substrates such as solar panels.

DCC
Also flagged:intraventricular hemorrhagebradycardia
Journal Article 2026-05-13 ✓ 1 Snippet Ahn E, Cypriane J, Ngowi E, Shayo A, Perlman J.
In-Text Gene Mentions

…the impact ofDCCas previous studies…

Show Full Abstract

<h4>Introduction</h4>Studies on neonatal cardiorespiratory transition are important in guiding resuscitation guidelines. The objectives were to determine the immediate transitional changes of heart rate (HR) and saturation values in neonates who received various levels of resuscitation and the level of agreement between NeoBeat and pulse oximetry.<h4>Methods</h4>High-risk deliveries (n = 63) in a low resource setting were observed using pulse oximetry and NeoBeat in three groups: comfortably breathing receiving no resuscitation, labored breathing receiving oxygen only, and apneic receiving bag mask ventilation (BMV) plus oxygen. Data were analyzed by time of birth and compared for levels of agreement.<h4>Results</h4>Comfortably breathing neonates had initial saturation values (86 ± 13%) with relatively high initial HRs (177 ± 19 beats per minute [bpm]). For neonates receiving oxygen only, 43% reached target saturation goals despite an initial HR of 150 ± 21 bpm, while the BMV group had 73% reach target saturation goals with an initial HR of 88 ± 40 bpm. Bland-Altman revealed low bias in all groups and progressively wider lines of agreement as neonates required more resuscitation. In the BMV group, pulse oximetry often displayed a lower HR than NeoBeat at lower mean HR values.<h4>Conclusions</h4>Elevated early saturation values and higher HRs in comfortably breathing neonates may be indicative of a seamless cardiorespiratory adaptation. For neonates requiring resuscitation, oxygen alone without positive end-expiratory pressure may delay respiratory transitioning, as evidenced by low oxygen saturations at 5 min, whereas a higher percentage of neonates receiving BMV with oxygen met target saturation goals.

SERPINC1
Also flagged:respiratory tract infectionsmalariarespiratory infectionsinfectionsupper respiratory tract infectionsrespiratory tract infection
Journal Article 2026-05-13 ✓ 1 Snippet Petersen GL, Edlefsen PT, Li X, Morrison R, Kabyemela E, Nelson JL, Duffy PE, Fried M, Harrington WE.
In-Text Gene Mentions

…four non-HLA loci (ATIII, TG, GSTT1, TNN)…

Show Full Abstract

The presence of maternal cells in the offspring at birth, a phenomenon known as maternal microchimerism, has been previously associated with decreased odds of malaria and respiratory infections in early childhood suggesting a role in immunological responses to infections. Here, we assess the effect of cord blood maternal microchimerism on symptomatic non-malarial infections in Tanzanian children. We conducted a secondary analysis using a nested birth cohort of 52 children from Muheza, Tanzania, with previously measured cord blood maternal microchimerism and longitudinal records on infections in the first four years of life. The associations between maternal microchimerism and symptomatic lower and upper respiratory tract infections, diarrhea, and non-malarial fever were estimated using generalized estimating equation models. In total, 29% of the 52 children in the study screened positive for cord blood maternal microchimerism. Detected versus non-detected maternal microchimerism was associated with 58% lower odds of non-malarial fever (fully adjusted odds ratio (OR): 0.42 [95% CI: 0.18-0.98]) and 28% lower odds of respiratory tract infection (OR: 0.72 [95% CI: 0.53-0.96]). Lower and upper respiratory tract infections contributed equally to the observed association with any symptomatic respiratory tract infections (ORs respectively: 0.81 [95% CI: 0.50-1.31] and 0.71 [95% CI: 0.50-1.01]). We did not find any association between maternal microchimerism and odds of diarrhea (OR: 1.63 [95% CI: 0.85-3.13]). Detectable cord blood maternal microchimerism was associated with lower odds of non-malarial fever and symptomatic respiratory infections in Tanzanian infants. These findings emphasize that MMc may play an underrecognized role in protection from infection during early childhood.

NEGR1
Also flagged:Anti-diseaseautoimmune diseasephosphorylationneurodegenerative diseasesautoimmune encephalitis disorders
Journal Article 2026-05-13 ✓ 1 Snippet Askin B, Kilic C, Cordero Gómez C, Duong SL, Domingues-Baquero A, Goihl A, Nalbach K, Petushi J, Grundschöttel P, Wagner J, Thomas V, Lamberty J, Withers E, Huber H, Huebschmann S, Semenova E, Turko P, Newman AG, Diez L, Beyer M, De Domenico E, Körtvelyessy P, Reinhold D, Schneider A, Neher JJ, Ulas T, Lichtenthaler SF, Rost BR, Schmitz D, Prüss H, Wegmann S.
In-Text Gene Mentions

…(=IgLON2), LSAMP (=IgLON3),NEGR1(=IgLON4), and IgLON5]…

Show Full Abstract

Anti-IgLON5 disease is an autoimmune disease, in which autoantibodies (AABs) against the neuronal cell surface protein IgLON5 lead to profound brain dysfunction and Tau pathology. How α-IgLON5 AABs cause neuronal Tau protein pathology and neurodegeneration remains unclear. We find that patient-derived α-IgLON5 AABs cluster IgLON5 proteins with other cell surface proteins, leading to neuronal hyperactivity that triggers pathological Tau missorting and phosphorylation, typically observed early in Tau-related neurodegenerative diseases. In wild-type mice, α-IgLON5 AABs induce hippocampal Tau phosphorylation and neuroinflammatory responses. Our findings establish a causal link between the α-IgLON5 AABs and Tau pathology in anti-IgLON5 disease patients and highlight the role of neuronal hyperactivity as a disease-overarching driver of Tau pathology and provide a potential target for therapeutic intervention.

HTT
Also flagged:Major depressive disorderorganizationneuropsychiatric disordersAxis I DisordersDepressionsegmentation
Journal Article 2026-05-13 ✓ 2 Snippets Lv Q, Dong D, Fang S, Wang X, Lin P, ZIB Consortium, Feng J, Luo Q, Wang X.
In-Text Gene Mentions

…the serotonin transporter (5-HTT), despite its central…

…5-HT 1A ,5-HTTexpression is more…

Show Full Abstract

Major depressive disorder (MDD) involves multiscale alterations ranging from molecular signaling to large-scale brain network dysfunction. However, how molecular topography constrains system-level connectome reorganization remains inadequately understood, limiting the development of biologically grounded diagnostic markers. We established a biologically grounded framework by integrating molecular organization with systems-level connectome analysis to characterize and classify MDD. Using resting-state functional magnetic resonance imaging data from a discovery cohort of 237 first-episode, medication-naïve MDD patients and 305 healthy controls (HC), as well as an independent multi-site validation cohort comprising 243 MDD patients and 340 HCs, we systematically mapped connectome-wide reconfigurations onto 14 normative neurotransmitter receptor and transporter density distributions. Our findings revealed widespread connectivity alterations (6.38% of edges). These alterations spatially correlated with normative densities of serotonin 1A (5-HT<sub>1A</sub>; ρ = -0.217) and dopaminergic markers, including the dopamine transporter (DAT) and dopamine receptors (D1 and D2; ρ range: -0.204 to -0.227). To translate these mechanistic insights into individual-level predictions, we developed the Neurotransmitter Transporter/Receptor-Annotated Connectome Classification Model (NTR-CCM), which incorporates molecular maps as biological priors to guide feature selection. The NTR-CCM achieved superior diagnostic performance in the discovery cohort (area under the curve [AUC] = 0.83-0.86) and maintained robust generalization in the external validation cohort (AUC = 0.73-0.75). These results indicate that macroscale connectome reorganization in MDD is spatially constrained by the brain's underlying neurochemical architecture. By bridging molecular and systems scales, the NTR-CCM provides a high-performing and mechanistically interpretable framework for precision psychiatry.

SERPINC1
Also flagged:ABLkinasesFGFCRKphosphorylationcorneal opacity
Journal Article 2026-05-13 ✓ 1 Snippet Wu H, Mao Y, Wang Q, Yu H, Bouaziz M, Makrides N, Wang E, Ding Z, Koleske AJ, Radice GL, Hsu J, Zhang X.
In-Text Gene Mentions

…and FOXC1 (Forkhead Box C1Box C1 )…

Show Full Abstract

Peters anomaly is an anterior segment dysgenesis and a leading cause of congenital corneal opacity. Here, we show that loss of ABL kinases restores lens induction in the absence of FGF signaling but induces Peters anomaly type II independently of ERK signaling, a phenotype also observed with elevated FGF-Ras activity. This defect is rescued by allelic deletion of the ABL substrates CRK and CRKL. Contrary to prevailing models, ABL kinases do not act through direct phosphorylation of CRK proteins; instead, they phosphorylate PTPN12, suppressing p130CAS phosphorylation and CRK recruitment required for RHO GTPase activation. ABL kinase deficiency reduces actomyosin contractility in the lens vesicle and genetically interacts with RHOA inhibition, whereas RAC1 inhibition ameliorates disease phenotypes. These findings define an ABL-PTPN12-p130CAS pathway that controls cytoskeletal tension during lens vesicle separation and suggest that modulation of this process may offer a therapeutic approach for Peters anomaly type II.

OLFM4
Also flagged:neuroendocrine neoplasmsNeuroendocrine carcinomaNECneuroendocrine tumorNETpancreatic cancer
Journal Article 2026-05-13 ✓ 1 Snippet Ji Z, Wang X, Ma L, Xin J, Wang Y, Liu S, Liu R.
In-Text Gene Mentions

…to 1.0, whileOLFM4, HABP2, and MUC6…

Show Full Abstract

Neuroendocrine carcinoma (NEC), neuroendocrine tumor grade 3 (NET G3), and pancreatic cancer (PC) are aggressive malignancies with limited effective treatments. This study assessed the efficacy and safety of surufatinib combined with the PD-1 inhibitor sintilimab, with or without chemotherapy. In this phase II trial, 51 patients with advanced NEC (n = 30), NET G3 (n = 12), or PC (n = 9) received surufatinib plus sintilimab; the NEC cohort additionally received chemotherapy. The primary endpoint was progression-free survival (PFS). Secondary endpoints included objective response rate (ORR), disease control rate (DCR), overall survival (OS), and safety. As of August 31, 2025, the median follow-up was 18.6 months. In the NEC cohort, median PFS was 7.3 months, median OS was 13.3 months, and ORR was 53.3%. First-line NEC patients achieved superior outcomes (mPFS 7.6 months; mOS 14.3 months; ORR 65.0%) versus later-line therapy. Median PFS was 6.8 months in the NET G3 cohort and 2.1 months in the PC cohort. Adverse events were manageable; no treatment-related death occurred. Surufatinib plus sintilimab with or without chemotherapy shows encouraging efficacy and acceptable safety in advanced NEC, NET G3, and PC. This clinical trial was registered at ClinicalTrials.gov (NCT05627427) on November 15, 2022.

SERPINC1
Also flagged:digestionphosphorylationpost-translational modifications
Journal Article 2026-05-13 ✓ 1 Snippet Fu Q, Wu Z, Bennett EA, Xing S, Ji Q, Dong Z, Rao H, Gu X, Dang Y, Xing J, Zhou K, Feng X.
In-Text Gene Mentions

…ODAM and TUFT1),SERPINC1was also added…

Show Full Abstract

Homo erectus remains have been found in Africa, Eurasia and Southeast Asia<sup>1-3</sup>, dating back around two million years; however, owing to their age and state of preservation, obtaining informative molecular data from them has proved challenging. Here we successfully extracted and analysed ancient enamel proteins from five male and one female Middle Pleistocene H. erectus specimens from approximately 0.4 million years ago, from the Zhoukoudian, Hexian and Sunjiadong sites. All specimens from all three sites share two amino acid variants. Of these, A253G in AMBN is previously unknown and has not been identified in other human lineages, including H. erectus from Dmanisi (Georgia), Homo antecessor from Atapuerca (Spain), Denisovans, Neanderthals and modern humans. The other variant, AMBN(M273V), has previously been identified in Denisovans, and our evidence now indicates it may have been introduced through populations related to these Middle Pleistocene H. erectus. The regions in the Denisovan genome attributed to super-archaic introgression, some of which later passed to modern humans, are likely to have originated from H. erectus. Late Middle Pleistocene H. erectus may have coexisted with Denisovans in parts of East Asia, where these interactions are presumed to have occurred.

Also flagged:reproductionlactationinfectiongoblet cell differentiationbacterial infectionsallergies
Journal Article 2026-05-13 No Snippets Huang C, Sun A, Reyes J, Ribeiro de Souza J, Cafiero TR, Antunes Fernandes KH, Oliveira FMS, Qiao Y, Gazzinelli-Guimaraes P, Pritykin Y, Lim AI.
Show Full Abstract

Mammalian reproduction requires substantial immune adaptations to safeguard reproductive success and to ultimately shape the evolutionary trajectories of a species. Systemic and placental immunity shift towards tolerance during pregnancy<sup>1,2</sup>; however, how maternal immunity adapts in barrier tissues-which are sites of frequent infection and inflammation-from pregnancy until the postpartum lactation period remains poorly understood. Here we report a previously unrecognized role for eosinophils, a type of granulocyte typically associated with allergies and helminth infections<sup>3,4</sup>, in remodelling the intestinal barrier during reproduction. Beginning in pregnancy and peaking during lactation, eosinophils accumulate in the small intestine in the absence of infection or inflammation. Using genetic and pharmacological perturbations, organoid cultures and single-cell and spatial transcriptomics, we show that eosinophils promote goblet cell differentiation in a stem-cell-intrinsic manner that leads to increased mucus production. This remodelling culminates during lactation and limits pathogen entry and dissemination to confer broad innate protection against enteric bacterial infections. Moreover, in mice, intestinal remodelling and innate defence persist weeks after lactation cessation. Our findings demonstrate that despite a general trend towards systemic immune modulation during reproduction, the maternal intestine undergoes remodelling to strengthen innate defence, a mechanism that may have evolved to protect mothers and offspring in pathogen-rich environments. More broadly, we establish a framework for studying tissue-specific immune adaptation across the reproductive cycle and highlight that tissues can retain changes following physiological reproduction, with lasting implications for host defence and women's health.

SUDS3
Also flagged:lysinehistonecrotonylationchromatinhistonesamino
Journal Article 2026-05-13 ✓ 1 Snippet Dai SK, Ren N, Liu CM, Yang F.
In-Text Gene Mentions

…protein p400 (EP400)histone exchangeexchange and acetyltransferase…

Show Full Abstract

Research on histone lysine crotonylation has evolved from identifying its core regulatory factors and mapping its genome-wide landscape to dissecting its functions in physiological and pathological contexts. Since its discovery nearly 15 years ago, extensive biochemical, structural, and genetic studies have deepened our understanding of how this evolutionarily conserved modification is integrated into intricate epigenetic regulatory networks. In this review, we first summarize mechanistic insights into the molecular basis of transcriptional regulation mediated by histone crotonylation, and discuss competitive crosstalk between this modification and histone acetylation in local chromatin regions. We then present an updated integrative framework to systematically delineate the regulatory roles of histone crotonylation across genes with distinct transcriptional states, as well as its functional implications in health and disease. Finally, we propose a unifying context-dependent model for histone crotonylation-mediated transcriptional regulation, and outline key challenges and future directions in the field.

TNFSF4
Also flagged:tumorbreast cancercancercell proliferationangiogenesisbreast carcinoma
Journal Article 2026-05-13 ✓ 1 Snippet Qiu S, Chen X, Yang J, Sun Y, Liu Y, Wu D, Sun J.
In-Text Gene Mentions

…with CD80 andTNFSF4.…

Show Full Abstract

This study explores the role of adipogenesis-related genes (ARGs) in breast cancer, focusing on CEBPD, a key gene linked to adipogenesis. Using the TCGA-BRCA dataset, differentially expressed ARGs (DARGs) were identified, revealing 26 upregulated and 57 downregulated genes. CEBPD emerged as a central prognostic gene, exhibiting significantly lower expression in tumor tissues, which correlated with poor survival outcomes, making it an independent prognostic indicator. A nomogram integrating CEBPD expression was developed to predict 1-year, 3-year, and 5-year survival with moderate accuracy. Functional validation in vitro confirmed that CEBPD expression was downregulated at mRNA levels in breast cancer. Enforced overexpression of CEBPD significantly suppressed cancer cell proliferation. Gene Set Variation Analysis (GSVA) highlighted significant associations between CEBPD and biological processes such as angiogenesis, apoptosis, hypoxia, and inflammation. Immune microenvironment analysis showed distinct patterns of immune cell infiltration based on CEBPD expression levels. Overall, CEBPD significantly influences breast cancer progression and patient prognosis, suggesting its potential as a biomarker for therapeutic strategies.

Also flagged:Cancertumorcell surfacegene transfersynthesisbreast cancer
Journal Article 2026-05-13 No Snippets Dalela M, Shrivastav TG, Mohanty S, Singh H.
Show Full Abstract

<h4>Background</h4>Paclitaxel (PTX) is a first-line chemotherapeutic agent widely used in the treatment of multiple malignancies; however, its clinical utility is limited by poor aqueous solubility, low bioavailability, lack of tumor specificity, and systemic toxicity. Nanocarrier-based targeted delivery systems offer a promising strategy to overcome these limitations. In this study, we systematically investigated the influence of polymer molecular weight on nanoparticle performance using poly(styrene-alt-maleic anhydride) (PSMA) as a model amphiphilic polymer for breast cancer therapy.<h4>Methods</h4>PSMA polymers with distinct molecular weights were synthesized by modulating initiator concentration, solvent system, and reaction temperature. Folic acid (FA) was covalently conjugated to surface carboxyl groups to enable tumor-targeted delivery. PTX-loaded nanoparticles were formulated from high-molecular-weight (FA-PSMAC<sup>31K</sup>-PTX NPs) and low-molecular-weight (FA-PSMAC<sup>6K</sup>-PTX NPs) polymers and evaluated for physicochemical properties, drug loading efficiency, stability, cellular uptake, cytotoxicity, biodistribution, and antitumor efficacy in vitro and in Ehrlich Ascites Tumor (EAT) tumor-bearing syngeneic BALB/c mice.<h4>Results</h4>High-molecular-weight FA-PSMAC<sup>31K</sup>-PTX nanoparticles demonstrated superior drug encapsulation efficiency and enhanced stability in physiological media compared with FA-PSMAC<sup>6K</sup>-PTX nanoparticles. In vitro studies revealed significantly higher cellular uptake, increased apoptosis induction, and greater cytotoxicity towards high molecular weight nanoparticles (FA-PSMAC<sup>31K</sup>-PTX NPs). In vivo investigations further showed prolonged systemic circulation, enhanced tumor accumulation and penetration, and improved tumor growth inhibition with minimal off-target organ distribution for the high-molecular-weight formulation relative to the low molecular weight polymeric nanoparticles (FA-PSMAC<sup>6K</sup>-PTX NPs) and free PTX.<h4>Conclusions</h4>Polymer molecular weight critically governs nanoparticle stability, biodistribution, and therapeutic efficacy. Folate-targeted high-molecular-weight PSMA nanoparticles significantly enhance PTX delivery and antitumor activity, highlighting molecular weight as a key design parameter in the rational development of targeted nanocarrier systems for breast cancer therapy.

CSE1L
Also flagged:infectionmitochondrialbindingCOVID-19asymptomatic infectionSARS-CoV-2 infection
Journal Article 2026-05-13 ✓ 1 Snippet Batra J, Rutkowska M, Zhou Y, Ye C, Adavikolanu R, Young JM, Anand D, Verma S, Parthasarathy H, Gordon M, Malpotra S, Cupic A, Kehrer T, Dos Santos M, Benjamin R, Moen JM, Winters DM, Caval V, Rojc A, Mena I, Aslam S, Martinez-Romero C, Viñas IC, Khalil Z, Farrugia K, Villalón-Letelier F, Banerjee A, Tussia-Cohen D, Diallo A, Maji S, Muralidharan M, Foussard H, Chen IP, Fuchs R, San Felipe CJ, Zuliani-Alvarez L, Choudhury P, Obernier K, Gracias S, Suryawanshi RK, Bonaventure B, Ibáñez C, Johnson JR, Juste J, Pache L, Stroud RM, Verba KA, Fraser JS, van Bakel H, Taha TY, Ott M, Hagai T, Jouvenet N, Demeret C, Polacco BJ, Swaney DL, Echeverria I, Bouhaddou M, Eckhardt M, Malik HS, Martinez-Sobrido L, Miorin L, García-Sastre A, Krogan NJ.
In-Text Gene Mentions

CSE1L

Show Full Abstract

Coronaviruses, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), can cause severe disease in humans, whereas reservoir hosts such as horseshoe bats remain asymptomatic. To investigate how host-specific protein-protein interactions (PPIs) influence infection, we generated comparative PPI maps for SARS-CoV-2 and its bat progenitor RaTG13, using affinity purification mass spectrometry (AP-MS) in human and greater horseshoe bat cells. We identify both conserved and virus- and host-specific interactions that regulate infection dynamics. Notably, SARS-CoV-2 requires a nonsynonymous mutation in the nucleocapsid to replicate in bat cells expressing human ACE2 and TMPRSS2. Strikingly, a single amino acid difference in Orf9b between viruses acts as a molecular switch that reprograms mitochondrial targeting: in human cells, enhanced translocase of outer mitochondrial membrane 70 (Tom70) binding promotes immune evasion, whereas in bat cells, strengthened interaction with the bat-enriched restriction factor mitochondrial amidoxime reducing component 2 (MTARC2) limits infection. These findings establish a general principle by which minimal sequence variation can reshape virus-host interactions and contribute to immune antagonism, host adaptation, and species barriers.

Also flagged:transportationsynthesisproton-transferactivity
Journal Article 2026-05-13 No Snippets Amenuvor G, Edor JM, Modisha P, Bessarabov D, Makhubela BCE.
Show Full Abstract

The pursuit of hydrogen energy presents a promising path toward meeting growing energy needs sustainably while addressing urgent climate issues. However, developing a hydrogen economy demands significant investments in advanced infrastructure for production, storage, and transportation. The use of critical minerals is essential at nearly every stage of hydrogen technology to ensure efficiency. Consequently, one of the key future challenges will be managing these minerals responsibly to prevent depletion. Phosphorus, for instance, plays a crucial role in research on liquid organic hydrogen storage systems and is becoming increasingly important in catalyst development for water splitting. As research in this field expands rapidly, the demand for phosphorus in hydrogen technology will inevitably rise. This review highlights phosphorus' significance in advancing hydrogen technology, covering its applications in heterogeneous photocatalysis, including black phosphorus, red phosphorus, transition metal phosphides, and emerging high-entropy phosphide materials, as well as phosphorus-doped supports for ammonia borane hydrolysis. In homogeneous catalysis, the review examines the role of phosphorus-based ligands in designing catalysts for liquid organic hydrogen carrier (LOHC) systems, particularly those involving carbon dioxide conversion into formic acid, formate, amides, and methanol. The review also addresses catalyst deactivation mechanisms, theoretical descriptors for rational catalyst design, and sustainable phosphorus management strategies including immobilization, durability, recovery, and efficiency metrics. By emphasizing phosphorus' vital contributions, this article aims to raise awareness of its role in the hydrogen economy, encourage its thoughtful integration into future technologies, and promote sustainable practices in its use.

Also flagged:SynthesisThrombosiscoagulationhemostasisthrombotic disorderschronic kidney disease
Journal Article 2026-05-13 No Snippets Al-Horani RA.
Show Full Abstract

<h4>Introduction</h4>Thrombosis remains a major global health burden, necessitating safer and more effective antithrombotic strategies. Current therapies, including vitamin K antagonists, heparin derivatives, and direct oral anticoagulants, are limited by bleeding risks despite the availability of reversal agents. Factor XIa (FXIa), a serine protease in the intrinsic coagulation pathway, has emerged as a promising target due to its central role in thrombosis while having minimal impact on hemostasis. Previous studies identified Sulfated Pentagalloyl Glucopyranose (SPGG) as a potent, selective, but heterogeneous allosteric inhibitor of FXIa. The study aimed to design and synthesize a chemically homogeneous derivative of SPGG (inhibitor 2) and to evaluate its potency, selectivity, and effect on human plasma coagulation, to identify a potentially safer FXIa-targeted anticoagulant candidate.<h4>Methods</h4>To address the heterogeneity of SPGG, inhibitor 2, a per-sulfated, chemically homogeneous derivative, was designed and synthesized through a three-step synthetic route. The inhibitory activity of inhibitor 2 against FXIa was evaluated, along with its selectivity against thrombin and FXa. Furthermore, its effect on human plasma coagulation was assessed by measuring the Activated Partial Thromboplastin Time (APTT).<h4>Results</h4>Inhibitor 2 demonstrated potent inhibition of FXIa with an IC₂⁽ of 1.42 ± 0.10 μM and showed marked selectivity over thrombin and FXa. Treatment with inhibitor 2 significantly prolonged the APTT of human plasma, indicating effective modulation of the intrinsic coagulation pathway.<h4>Discussion</h4>Inhibitor 2 overcomes the chemical heterogeneity of SPGG while retaining strong selectivity for FXIa over thrombin and FXa. It effectively prolongs APTT with minimal effect on PT, indicating selective targeting of the intrinsic pathway. These results demonstrate that chemical homogeneity can be achieved without compromising functional selectivity.<h4>Conclusion</h4>Inhibitor 2 represents a chemically homogeneous, selective, and potent FXIa inhibitor. These findings support its potential as a lead candidate for the development of FXIatargeted anticoagulants with a potentially reduced bleeding risk.

Also flagged:degradationfermentationbindingbiomineralizationenzyme activitymembrane
Journal Article 2026-05-13 No Snippets Ding P, Liao W, Chen C, Chen X, Wang C, Li X.
Show Full Abstract

Zearalenone (ZEN) is a pervasive mycotoxin contaminating global food and feed. While enzymatic degradation offers a promising, specific, and eco-friendly strategy for mycotoxin mitigation, the biotransformation of ZEN within acidic food matrices remains challenging due to the intrinsically low activity of zearalenone lactonase (ZENG). In this work, we synthesized a ZENG-hydroxyapatite (Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) hybrid nanoflower (CaNF) via biomineralization under alkaline conditions. Compared to free ZENG, the as-prepared biohybrid nanoflower exhibited markedly enhanced acid tolerance and catalytic activity, achieving a 12-fold increase in ZEN degradation efficiency at pH 5.0. Furthermore, the biohybrid nanoflower demonstrated robust performance in various acidic food matrices, including corn juice, wort, beer, and corn steep liquor. This study presents a powerful enzymatic tool for the efficient biotransformation of ZEN in acidic food-related systems.

SERPINC1
Also flagged:Venous thromboembolismdeep vein thrombosisDVTpulmonary embolismPEobesity
Journal Article 2026-05-13 ✓ 1 Snippet Cai T, Ho P, Wang J.
In-Text Gene Mentions

…in coagulation proteins (ATIII, P-selectin, VWF, TFPI,…

Show Full Abstract

<b>Background</b>: Venous thromboembolism (VTE) remains a leading cause of global morbidity and mortality. The pathophysiological mechanisms leading to VTE are still not fully elucidated. Diagnostic biomarkers for VTE lack specificity, and biomarkers to guide the duration of anticoagulation therapy have not yet entered routine clinical practice. Proteomics has emerged as a high-throughput approach for novel biomarker discovery, offering insights into the complex biological processes across the VTE continuum. This review explores current VTE proteomic research and discusses the challenges and gaps hindering clinical translation. <b>Methods</b>: We performed a narrative review based on a search of Scopus and PubMed for original human proteomic studies published between 1995 and July 2025. Results were limited to whole-blood, plasma or serum-based studies. <b>Results</b>: A total of 1190 studies were retrieved, of which 27 studies were included in this review. Studies were mainly plasma-based. Studies compared VTE patients to non-VTE controls, different VTE subtypes, and various provoked VTE cohorts. Broad themes identified proteomic signatures involving dysregulated coagulation, complement activation, inflammation, and platelet activation. <b>Conclusions</b>: Current proteomic evidence supports VTE as a systemic immunothrombotic disorder that shows key differences even years before developing VTE. Proteomic research in VTE holds the promise to identify biomarkers that may aid in the diagnosis and guide management of VTE. However, most proteomic findings remain exploratory to date and methodologies are varied across studies. Future studies should prioritise the workflow standardisation and validate promising biomarker panels in large-scale, prospective, longitudinal cohorts.

Also flagged:Mitochondrial dysfunctionmetabolismneurotransmittersynthesissynapsescognitive impairment
Journal Article 2026-05-13 No Snippets Maciel P, Lamas CB, Araújo AC, Chagas EFB, Guiguer EL, Curi R, Pithon-Curi TC, Almeida MCDS, Sloan KCP, Sloan LA, Souza ALDM, Rubira CJ, Mendes CG, Rocha MG, Valenti VE, Barbalho SM.
Show Full Abstract

Mitochondrial dysfunction is a key contributor to cognitive impairment, directly affecting neuronal viability, synaptic function, and energy metabolism. In the central nervous system, where energy demand is particularly high, disturbances in mitochondrial dynamics, including impaired oxidative phosphorylation (OxPhos), increased reactive oxygen species (ROS) production, and reduced ATP availability, can compromise synaptic transmission and accelerate cognitive decline. These alterations are commonly observed in neurodegenerative diseases such as Alzheimer's (AD) and Parkinson's (PD), in which mitochondrial dysfunction is closely associated with oxidative stress and neuroinflammatory processes. This review aims to investigate the role of mitochondrial dysfunction in cognitive impairment and the effects of physical exercise as a non-pharmacological strategy to mitigate these alterations. Current evidence indicates that exercise promotes mitochondrial biogenesis through activation of the AMPK/PGC-1α pathway, enhances oxidative metabolism, and improves mitochondrial efficiency. Furthermore, exercise reduces oxidative stress and inflammation while stimulating the release of neurotrophic factors, such as brain-derived neurotrophic factor which support neurogenesis, synaptic plasticity, and neuronal survival. Overall, these findings reinforce the importance of mitochondrial integrity in maintaining cognitive function and highlight physical exercise as a promising strategy to counteract mitochondrial dysfunction and delay the progression of neurodegenerative diseases.

HTT
Also flagged:spinocerebellar ataxiaataxiafamilial Parkinsonismamyotrophic lateral sclerosisALSPD
Journal Article 2026-05-13 ✓ 2 Snippets Khojakulov Z, Palvadeau RJ, Kovancılar-Koç M, Atay I, Şahbaz I, Tekgül Ş, Şahin A, Badakal EZD, Gül-Demirkale T, Çiftçi V, Bayraktar E, Tunca C, Smolina N, Akçimen F, Başak AN.
In-Text Gene Mentions

…, DMPK ,HTT, JPH3 ,…

…, CACNA1A ,HTT, PABPN1 ,…

Show Full Abstract

Short tandem repeat (STR) expansions are a major cause of neurodegenerative disorders; however, their genetic and clinical heterogeneity complicates diagnosis. STR detection remains limited in routine short-read next-generation sequencing (NGS) workflows. We evaluated the diagnostic yield and clinical utility of computational STR genotyping in a large Turkish neurodegenerative disease cohort. ExpansionHunter was applied to NGS data from 3150 patients and 146 controls, targeting 15 disease-associated STR loci. To improve genotyping of poorly captured exonic regions in exome data, the default locus coverage threshold was reduced from 10× to 3×. Candidate expansions were visually inspected using REViewer and validated by conventional molecular methods. Computational analysis detected 28 pathogenic and 160 intermediate expansions. Of these, 23 were confirmed as pathogenic, and eight initially classified as intermediate were reclassified as pathogenic after conventional validation, resulting in 31 pathogenic cases across 28 families: <i>HTT</i> (<i>n</i> = 8), <i>ATXN2</i> (<i>n</i> = 5), <i>ATXN1</i> (<i>n</i> = 4), <i>DMPK</i> (<i>n</i> = 3), <i>PABPN1</i> (<i>n</i> = 3), <i>TBP</i> (<i>n</i> = 2), and single cases in <i>AR</i>, <i>ATN1</i>, and <i>CACNA1A</i>. Lowering the coverage threshold markedly increased genotyping rates at low-coverage loci in exome data, particularly in <i>ATXN2</i>. Genetic findings were largely consistent with clinical pre-diagnosis and the additional diagnostic yield was 0.95%. These findings support integrating STR analysis into routine neurogenetic diagnostics.

Also flagged:neuropsychiatric disorderspathogenesissynaptogenesisschizophreniaautism spectrum disorderattention-deficit hyperactivity disorder
Journal Article 2026-05-13 No Snippets Liu J, Zhang Y, Jin R, Zhu Y, Chen J.
Show Full Abstract

Numerous neuropsychiatric disorders frequently exhibit overlapping genetic risk factors, implying the molecular basis for their comorbidity. Nevertheless, the pathogenesis of these disorders remains elusive, particularly regarding how genetic variations impair the physiological function of risk genes and contribute to disease phenotypes. Neurexin 1 protein, encoded by <i>NRXN1</i> gene, belongs to the neurexin family of presynaptic adhesion molecules. And neurexin 1 is involved in synaptogenesis and the maintenance of synaptic action. Genetic variations of <i>NRXN1</i> have been demonstrated to be associated with a spectrum of neuropsychiatric disorders. Herein, this review focuses on the most recent and relevant literature concerning the genetic and molecular mechanisms through which <i>NRXN1</i> variants contribute to the pathogenesis of neuropsychiatric disorders, particularly schizophrenia and autism spectrum disorder. Among them, we propose the isoform-dependent excitation-inhibition imbalance hypothesis of <i>NRXN1</i> in autism spectrum disorder. And this hypothesis may account for both the elevated and decreased excitation-inhibition ratios observed in diverse individuals with autism spectrum disorder. Moreover, both schizophrenia and autism spectrum disorder involve deletions and alternative splicing of <i>NRXN1</i>, offering molecular evidence for their comorbidity. Then, we analyzed and summarized the current research status of <i>NRXN1</i> in other neuropsychiatric disorders, including attention-deficit hyperactivity disorder, insomnia, epilepsy, suicide, and depression. Additionally, available limited researches on <i>NRXN1</i>-targeted therapeutic strategies and associated pharmacological studies are also incorporated. Finally, we discussed existing challenges in <i>NRXN1</i> research within the context of neuropsychiatric disorders and proposed potential avenues to overcome these obstacles.

Also flagged:waterosmoregulationAntidiuretic hormoneAVParginine vasotocinAVT
Journal Article 2026-05-13 No Snippets Lassiter K, Aloui L, Greene ES, Maqaeda M, Schaeffer K, Roach B, Tabler T, Wideman RF, Orlowski S, Dridi S, Bottje WG.
Show Full Abstract

<h4>Background</h4>The major goal of this study was to compare mRNA expression associated with water homeostasis in intestines of high water efficient (HWE) broilers to expression in unselected Modern Random Bred (MRB) broilers under thermoneutral (TN) and heat stress (HS) environments.<h4>Methods</h4>A 2 × 2 factorial study was conducted with two lines (MRB and HWE) and environments (TN and HS). Males were raised in environmental chambers and maintained in TN conditions from 0 to 4 weeks. From 4 to 7 weeks, broilers were maintained under TN conditions (25C) or exposed to cyclic HS conditions (35C, 8 h/d). At 7 weeks, upper and lower duodenum, and cecum samples were obtained. mRNA was determined by RT-PCR for; 1) heat shock proteins (HSP70, HSP90), 2) the arginine vasotocin (AVT), mesotocin (MT) and receptors (VR2, VR1a, VR1b, MTR), 3) the renin angiotensin system (RAS): angiotensinogen (AGT), angiotensin receptors, (AT1, AT2), renin (REN), AGT converting enzyme (ACE), and Na<sup>+</sup>/<sup>+</sup>ATPase (ATP1B1), 4) aquaporins (AQP1-5 and 11), and 5) tight junction proteins occludin (OCLN), and claudins (CLDN2, CLDN15).<h4>Results</h4>A main effect of HS was observed for HSP70 and HSP90 expression in all three intestinal-segments. In lower duodenum, HS-induced upregulation of AVT was accompanied by elevations in VR2, VR1a, VRb, AT1, AQPs (1, 3, 11) OCLN, and CLND2, CLDN15. Main effects of broiler line were observed with HWE exhibiting increased mRNA expression of VR2, VR1a, VR1b, AQP1, AQP3 and AQP5 and CLDN2 in the upper duodenum. There was also higher VR2, MT and AQP5 and lower expression of CLDN15 in the lower duodenum but there were no differences in gene expression between MRB and HWE lines in the cecum. Heat stress upregulated AVT, VR1a, MTR, AVT/MT ratio, AQP1, and AQP3 but downregulated ACE in the upper duodenum. Heat stress also upregulated AVT, VR2, VR1a, VR1b, MTR, AT1, AT2 AQP3, ACP5, OCLN, CLDN2, CLDN15 in the lower duodenum and cecum.<h4>Conclusion</h4>The results provide insight into mechanisms responsible for water efficiency in HWE broilers and provide new information in gene expression in the gastrointestinal tract of broilers exposed to chronic cyclic heat stress conditions.

PEBP1
Also flagged:deathchronic obstructive pulmonary diseaseCOPDpore formationferroptosispathogenesis
Journal Article 2026-05-13 ✓ 1 Snippet Huang A, Liu S, Lan J.
In-Text Gene Mentions

…The 15LOX1-PEBP1complex sustains IL-13/IL-4-me…

Show Full Abstract

Chronic obstructive pulmonary disease (COPD) remains a leading cause of global mortality, yet current therapies principally target bronchodilation and broad anti-inflammatory suppression rather than the regulated cell death programs driving tissue destruction. Pyroptosis, executed through inflammasome-driven gasdermin pore formation, and ferroptosis, mediated by iron-catalyzed lipid peroxidation upon GPX4 failure, have each been implicated in COPD pathogenesis but are conventionally treated as independent processes. This review advances three original contributions. First, we map pyroptotic and ferroptotic associations across COPD inflammatory endotypes, demonstrating preferential non-canonical pyroptotic engagement in T2-low neutrophilic disease and dual death-modality involvement in T2-high eosinophilic disease. Second, we delineate a hierarchical relationship-now supported in COPD-relevant epithelial systems-in which smoke-induced Nrf2 epigenetic silencing drives ferroptotic lipid peroxide accumulation that directly triggers pyroptotic execution through caspase-11 activation, positioning GPX4 as the molecular gatekeeper. Third, we propose an inverted U-shaped model reconciling paradoxical effects of lipid peroxidation on inflammasome regulation, where membrane phospholipid hydroperoxides drive activation while free cytosolic 4-hydroxynonenal mediates suppression through covalent NLRP3 modification. We further integrate extracellular trap biology as a convergent death-associated program sharing execution machinery with pyroptosis and ferroptosis. Building on this framework, we critically appraise emerging therapeutics-including dupilumab, anti-alarmin biologics, NLRP3 inhibitors, and ferroptosis-directed agents-and propose a biomarker-guided precision medicine strategy matching cell death-targeting therapies to individual inflammatory profiles. This framework reframes COPD therapeutic design from single-pathway inhibition toward integrated modulation of interconnected death programs stratified by inflammatory endotype.

SOX6
Also flagged:tumortumorscancertranslationalantigen presentationinnervation
Journal Article 2026-05-13 ✓ 1 Snippet Liu H, Li X, Yu J, Chen T.
In-Text Gene Mentions

…to miR-499-5p andSox6( 267 ).…

Show Full Abstract

As a crucial component of the tumor microenvironment, the nervous system modulates tumor initiation, progression, and metastasis. Conversely, tumors actively hijack and reshape neural structures to activate nerve-dependent developmental and regenerative processes that promote their own growth and survival. Despite extensive progress in tumor-neural crosstalk, the molecular mechanisms underlying neuro-immune coordination in peripheral nerve remodeling remain incompletely understood, and integrated strategies targeting this axis to overcome immunotherapy resistance are still lacking. This review comprehensively examines the phenotypic and functional remodeling of the peripheral nervous system within the tumor microenvironment, with a focus on neuro-immune crosstalk between neural cells, immune cells and cancer cells. We systematically analyze phenotypic remodeling in neurons and glial cells, with particular emphasis on autonomic nerve differentiation, functional reprogramming of the neurotrophin family, and the regulatory roles of immune cells in these processes. Finally, we discuss precision therapeutic strategies including β-adrenergic blockades, neurotrophin signaling inhibition, surgical and pharmacological denervation, and combinatorial regimens with immunotherapy, highlighting their translational potential in cancer treatment. Neuro-immune crosstalk in the tumor microenvironment: schematic of four core interaction nodes: This schematic illustrates the bidirectional interactions between peripheral nerves and immune cells within the tumor microenvironment. Schwann cells engage in antigen presentation and cytokine signaling with tumor-associated macrophages and lymphocytes. Sympathetic-derived norepinephrine drives T cell exhaustion and myeloid-derived suppressor cell expansion, while parasympathetic-derived acetylcholine activates α7 nicotinic acetylcholine receptors on immune cells to suppress NF-κB signaling. Macrophage- and lymphocyte-derived NGF and BDNF establish positive feedforward loops that amplify tumor-neural-immune interactions. Together, these interconnected mechanisms support tumor innervation, progression and immune evasion, positioning the neuro-immune axis as an emerging therapeutic target for cancer treatment.

HTT
Also flagged:Gliomamalignant tumor of the central nervousdepressioncognitiontumoranxiety
Journal Article 2026-05-13 ✓ 5 Snippets Gu H, Wang S, Li M, Guo Y, Li X, Gao Z, Li J, Liu H, Zhou X, Xu Y.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT).…

5-HTT/DAT: functional assays…

…expressing DAT &5-HTT receptorsreceptors (constructed by…

…assical antidepressant targets5-HTTand DAT.…

…activity against both5-HTT(IC 50 =…

Show Full Abstract

Primary gliomas frequently accompany depression, worsening symptoms and prognosis. Current combination therapies show limited efficacy due to poor compliance, overlapping adverse effects, and delayed antidepressant onset. To address this challenge, we aimed to develop a bifunctional agent with both antiglioma and antidepressant properties. Targeting astrocytic Kir4.1 (Kir4.1 potassium channel) in the lateral habenula has been proposed as a potential therapeutic strategy for depression, with the advantage of rapid-onset effects. Through high-throughput screening, Serdemetan (Serd), a broad-spectrum antitumor agent currently in phase I clinical trials with potent antiglioma activity, was found to exhibit moderate Kir4.1 inhibitory activity. Based on this, Serd was selected as the bifunctional lead compound. A series of structural modifications were carried out to enhance its inhibitory activity against Kir4.1 while retaining its antiglioma efficacy, resulting in 21 novel derivatives. Among these, compound <b>19</b> demonstrated improved Kir4.1 inhibition activity while maintaining potent antiglioma activity. In addition, compound <b>19</b> exhibited potential blood-brain barrier permeability. Furthermore, compared with Serd, compound <b>19</b> showed improved inhibitory selectivity for Kir4.1. Finally, the relevant electrophysiological experiments demonstrate that compound <b>19</b> could modulate native Kir4.1 channels in astrocytes. These findings support its further development for bifunctional compound to treat both glioma and depression.

SERPINC1
Also flagged:ADvascular dementiaMDAlzheimerdementiaaging
Journal Article 2026-05-13 ✓ 5 Snippets Barczak A.
In-Text Gene Mentions

…the fact thatACE-IIIis sensitive to…

…utility of theACE-IIIin differen-tiating MD…

…value of theACE-IIIin distinguishing between…

…27 ], withACE-IIIas a routine…

…domain in theACE-IIIincludes both retrograde…

Show Full Abstract

<h4>Purpose</h4>Differentiating between Alzheimer's disease (AD), vascular dementia (VaD), and mixed dementia (MD) remains a major clinical challenge, as overlapping symptoms and comorbid pathologies limit the diagnostic value of screening tools. The Addenbrooke's Cognitive Examination III (ACE-III) offers a multidomain assessment and may support differential diagnosis.<h4>Methods</h4>The study included 138 Polish patients with mild dementia (46 AD, 46 VaD, 46 MD), matched for age, sex, and education, and diagnosed based on current clinical criteria. Group comparisons were conducted using the Kruskal-Wallis test with Dunn- Bonferroni post hoc analyses.<h4>Results</h4>Total ACE-III scores did not differ significantly between the groups. Significant effects were observed only in the <i>Memory</i> domain, where VaD patients scored higher than both AD and MD, who did not differ from each other. Subtest analyses confirmed group differences in episodic memory tasks. Only <i>Serial 7 Subtraction</i> (<i>Attention</i>) and <i>Letter Fluency</i> differentiated between groups, with AD patients outperforming VaD patients. Within the <i>Visuospatial</i> domain, only <i>Dot Counting</i> differentiated between groups (AD > MD > VaD). The <i>Language</i> domain showed no group effects.<h4>Conclusions</h4>While total ACE-III scores have limited diagnostic value, domain- and subtest-level analyses reveal distinct cognitive profiles supporting differential diagnosis. VaD is marked by preserved episodic memory but impaired attention and executive tasks, AD by severe episodic memory deficits, and MD by an AD-like profile with vascular contributions. Domain-focused interpretation of ACE-III may enhance diagnostic accuracy in clinical practice.

TNFSF4
Also flagged:Liver fibrosiswound-healingliver failureextracellularpathogenesisISGylation
Journal Article 2026-05-12 ✓ 1 Snippet Yuan Y, Li J, Rao D, Lu X, Chen M, Chen X, Long X, Zhang B, Liang H, Chen Q, Zhao J.
In-Text Gene Mentions

…proteins such asTNFSF4, IL1B and IL7R…

Show Full Abstract

<h4>Background</h4>Interferon (IFN)-stimulated gene 15 (ISG15) is a downstream molecule of the IFN pathways central to many cellular processes. ISG15 mainly exerts its function through a post-translational modification process known as ISGylation.<h4>Objective</h4>In this study, the role of ISG15 in the activation of hepatic stellate cells (HSCs) and liver fibrosis was examined.<h4>Design</h4>Liver fibrosis was established by carbon tetrachloride (CCl4), bile duct ligation (BDL) surgery and metabolic dysfunction-associated steatohepatitis (MASH) diet between HSC-specific deletion of ISG15 (ISG15cKO) and wild type mice. Using genetic strategies in vitro, the role of ISG15 in HSCs was established. Immunoprecipitation, luciferase reporter assays and chromatin-immunoprecipitation assays (ChIP) in combination with proteomics sequencing in HSCs were used to study the associated downstream mechanisms.<h4>Results</h4>ISG15 was underexpressed in activated HSCs and fibrotic livers, showing an inverse correlation with α-smooth muscle actin in patients with liver fibrosis. ISG15cKO mice developed spontaneous hepatic fibrosis and showed exacerbated CCl4/BDL-induced fibrogenesis. In vitro, ISG15 modulated HSC activation, proliferation and excessive extracellular matrix production. ISG15 deficiency in HSCs promoted transforming growth factorβ2 (TGFβ2) transcription by enhancing phosphorylated cAMP responsive element binding protein 1 (CREB1) activity, thereby inducing CREB1 binding on TGFβ2 promoter regions to activate TGFβ2/SMAD2 signalling. ISGylation directly binds CREB1 on Lys-304 and Lys-305 to inhibit p-CREB1 activity. Overexpression of ISG15 in HSCs or pharmacological inhibition of CREB1 by 666-15 could abolish ISG15 deficiency-induced liver fibrosis in CCl4-treated mice.<h4>Conclusions</h4>ISG15 regulated HSC activation and liver fibrosis in part via the CREB1/TGFβ2/SMAD2 regulatory pathway. Utilisation of ISG15-CREB1 signalling may be a potential therapeutic target for liver fibrosis.

Also flagged:Alzheimer's diseaseADbinding
Journal Article 2026-05-12 No Snippets Gayathri SV, Manjunatha PM, Pai P, Muzzammil Bahawuddeen Khalwathi M, Jana P, Akhila AV, Priya A, Prerna, Satvik, Marwein AS, Nchimbi AH, Atem AEM, Sharma UR, Hari Babu T.
Show Full Abstract

<h4>Background</h4>Curcumin exhibits potent neuroprotective activity but is limited by poor solubility and limited bioavailability. Conjugation with hyaluronic acid (HA), a biocompatible polysaccharide, may improve the stability, therapeutic efficacy and bioavailability of curcumin.<h4>Methods</h4>Network pharmacology, Gene Ontology (GO), and KEGG pathway enrichment analysis revealed curcumin and hyaluronic acid - associated Alzheimer's disease (AD) targets and pathways. Docking and molecular dynamic studies were performed to evaluate protein-ligand interactions. The Hyaluronic acid-curcumin (HA-Cur) conjugate was synthesized through carbodiimide-mediated coupling using DCC and DMAP, purified by dialysis and lyophilized. Characterization was performed using FTIR, UV-visible spectroscopy, solubility, drug release and SEM analyses. In vivo validation used C. elegans CL4176 for Aβ-induced paralysis assay and N2 wild type strain for developmental assay and paraquat induced lifespan assay. Worms were treated with curcumin (1 mg), hyaluronic acid (1 mg), HA-Cur conjugate (0.01, 0.1 and 1 mg/mL), caffeine (Positive standard) and DMSO (Control). Developmental progression from L1 to adulthood was assessed by body length.<h4>Results</h4>Network pharmacological analysis revealed 52 overlapping HA and curcumin associated AD, therapeutic targets, highlighting GSK3B, APP, SERPINE and NFE2L2 as key nodes. Molecular docking demonstrated strong binding affinities of curcumin (GSK3B: -7.7 kcal/mol) and hyaluronic acid (NFE2L2: -7.0 kcal/mol). Molecular dynamics simulation over 100 ns demonstrated stable protein-ligand interactions for both complexes. The conjugate showed enhanced solubility and sustained drug release. HA-Cur (1 mg) notably delayed Aβ-induced paralysis, ∗∗p < 0.01 and ∗∗∗p < 0.001 compared with curcumin and HA respectively. Enhanced survival under paraquat - induced oxidative stress compared to free curcumin and HA and promoted normal developmental progression.<h4>Conclusion</h4>The HA-Cur conjugate exhibited enhanced physicochemical stability and potent neuroprotective and developmental benefits in C. elegans, highlighting its potential as a multifunctional therapeutic agent for AD.

CCPG1
Also flagged:endoplasmic reticulumreticulophagyorganelleGram-negative bacteria infectioninfectionmembrane
Journal Article 2026-05-12 ✓ 1 Snippet Cheng YL, Mello-Vieira J, Covarrubias-Pinto A, Gonzalez A, Kumar Kuncha S, Kew C, Zhang K, Awais Afzal M, Diab N, Borchert S, Hong SY, Huang TC, Chen W, Mato UG, Hornef MW, Hübner CA, Hensel M, Dikic I.
In-Text Gene Mentions

…[ 9 ],CCPG1[ 10 ],…

Show Full Abstract

Selective autophagy of the endoplasmic reticulum (ER), termed ERphagy or reticulophagy, plays a key role in organelle remodeling and cellular homeostasis. However, whether and how ERphagy is regulated during Gram-negative bacteria infection to influence host responses remains unclear. Here, we show that <i>Salmonella enterica</i> serovar Typhimurium releases lipopolysaccharide (LPS) that colocalizes with RETREG1/FAM134B, a reticulon-like ER-resident receptor for ERphagy. Cytosolic delivery of LPS, either during infection or via transfection, markedly increases RETREG1- and LC3B-decorated ER fragments. Mechanistically, affinity-isolation assays demonstrate that LPS directly binds RETREG1 through interactions between lipid A and positively charged residues within its amphipathic helices and C-terminal region. This interaction promotes RETREG1 oligomerization and drives ER membrane fragmentation, a process further amplified by the O-antigen moiety of LPS. The resulting ER fragments accumulate around LC3-positive <i>Salmonella</i>-containing vacuoles, facilitating bacterial clearance. Importantly, both intracellular and extracellular <i>Salmonella</i> exploit outer membrane vesicles (OMVs) to deliver LPS into the host cytosol, triggering RETREG1 activation and ER remodeling. Collectively, our findings reveal a previously unrecognized host response by which LPS of Gram-negative bacteria are sensed by the host ERphagy machinery to promote xenophagy and enhance antibacterial defense.<b>Abbreviations</b>: AH: amphipathic helix; BMDMs: bone-marrow-derived macrophages; Co-IP: co-immunoprecipitation; BafA1: bafilomycin A<sub>1</sub>; Cterm: C-terminal region (Cterm); CFU: colony-forming units; DAPI: 4',6-diamidino-2-phenylindole; ER: endoplasmic reticulum; EPEC: enteropathogenic <i>Escherichia coli</i>; GBP: guanylate binding protein; Gm12250/IRGB10: predicted gene 12250; KDO: keto-3-deoxy-octonate; LPR: lipid-to-protein ratio; LPS: lipopolysaccharide; MAP1LC3B/LC3B: microtubule associated protein 1 light chain 3 beta; mtLIR: LC3B-interacting region mutant; MDP: muramyl dipeptide; OMVs: outer membrane vesicles; O-Ag: O-antigen; OmpA: outer membrane protein A; RHD: reticulum homology domain; R-LPS: rough-LPS; S-LPS: smooth-LPS; SCVs: <i>Salmonella</i>-containing vacuoles; SFB: S-protein-FLAG-streptavidin binding peptide; TM: transmembrane domain; TEM: transmission electron microscopy; WT: wild-type.

HFE
Also flagged:tumormetabolismsynthesisCancerFerroptosisdeath
Journal Article 2026-05-12 ✓ 5 Snippets Sahu AP, Connor JR.
In-Text Gene Mentions

…how diseases likehemochromatosis, which cause systemic…

…hepatocellular carcinoma inhemochromatosispatients, which is…

…(HH) pathogenic variant (HFEp.C282Y) had a…

…tatic iron-regulator protein (HFE) regulates iron uptake…

…has shown thatHFEhas a sexually…

Show Full Abstract

Sex is a critical determining factor in cancer incidence, pathogenesis, and outcome. These effects result from sexual differentiation influencing mechanisms that regulate both normal and cancer biology. Iron biology is sexually dimorphic in nature and plays a key role in tumorigenesis. Therefore, iron metabolism may be a key driver of sex-biased differences in cancer. In this article, we review and synthesize the existing literature examining iron's role in driving sex differences in tumor incidence, progression, response to therapy, and overall survival in different cancer types. We also explore models that could be useful in studying iron metabolism-driven sex differences in tumorigenesis.

Also flagged:obstructive sleep apnealung adenocarcinomaLUADGene Expressionsleep disordersleep
Journal Article 2026-05-12 No Snippets Zhang L, Yang L, Chen G, Yang X, Wang D.
Show Full Abstract

<h4>Background</h4>Obstructive sleep apnea (OSA) affects nearly 1 billion adults worldwide, and it is relatively common in patients with lung adenocarcinoma (LUAD). This study aimed to identify potential shared transcriptomic signatures and explore pathways linking OSA and LUAD.<h4>Methods</h4>Transcriptomic data were obtained from The Cancer Genome Atlas (TCGA) and the Gene Expression Omnibus (GEO). Weighted gene co-expression network analysis (WGCNA) and protein-protein interaction (PPI) network analysis were used to identify hub genes. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed to investigate the functional pathways associated with differentially expressed genes (DEGs). Univariate Cox regression and least absolute shrinkage and selection operator (LASSO)-Cox regression analyses were conducted to identify prognostic genes and construct a prognostic signature for LUAD.<h4>Results</h4>A total of 986 shared DEGs were identified between OSA and LUAD. Among them, 117 hub genes were selected based on the PPI network. A 12-gene signature was constructed and validated in an independent LUAD cohort. The risk score stratified LUAD patients into distinct risk groups and showed associations with estimated immune infiltration patterns. In addition, intermittent hypoxia exposure was associated with expression changes in a subset of signature genes in A549 cells.<h4>Conclusions</h4>This study identified shared transcriptomic features and highlighted immune-related pathways that may represent potential biological associations between OSA and LUAD.

Also flagged:phenolic compoundsmineralsdeathneurodegenerative diseasesneurological diseasesNeurodegeneration
Journal Article 2026-05-12 No Snippets Maiuolo J, Mazza V, Caminiti R, Oppedisano F, Nucera S, Ragusa S, Ilari S, Passacatini LC, Tucci L, Trunfio G, Mollace V, Muscoli C.
Show Full Abstract

Pomegranate is an exceptional fruit that can have several beneficial effects on human health. The peel of pomegranate, a waste product, should be recovered as it still contains valuable constituents, including phenolic compounds, minerals and fibre. The recovery of bioactive compounds occurs through eco-sustainable extraction techniques that reduce costs and promote environmental sustainability and public health. Neurodegeneration is a pathological process causing progressive neuronal damage, potentially leading to cell death. Currently, no drug is known to cure neurodegenerative diseases definitively. A balanced diet rich in fruits and vegetables is associated with a lower risk of certain neurodegenerative conditions. The phytochemicals of plants and their beneficial bioactive compounds demonstrate promising therapeutic potential for human neurological diseases, exhibiting antioxidant and anti-inflammatory properties in the brain. This review aims to highlight the currently existing knowledge on the effects of pomegranate peel against neurodegenerative diseases and their mechanisms of action. The manuscript is intended for those who explore strategies for recovering waste materials and for those who investigate the effects of natural products on neurodegeneration. Prospects could include clinical trials in which pomegranate peel is used in the management of human neurodegenerative diseases.

Also flagged:malignant tumourlactylationtranslationaltumourangiogenesismelanoma
Journal Article 2026-05-12 No Snippets Ruan J, Wang L, Liu F, He Y, Li H, Hong G.
Show Full Abstract

Cutaneous melanoma (CM) is highly invasive with limited prognostic tools, and the prognostic relevance of lactylation, a novel post-translational modification, remains unexplored. We developed a lactylation-related prognostic model using relative methylation orderings from The Cancer Genome Atlas (TCGA) melanoma cohort (<i>n</i> = 458), which was validated in two dependent cohorts (<i>n</i> = 241). Comprehensive analyses of immune infiltration, therapy efficacy, drug sensitivity, and tumour mutation burden were conducted between high- and low-risk groups. Results showed that 284 lactylation-related genes collected classified TCGA melanoma patients into two clusters with significant survival differences (Kaplan-Meier log-rank test, <i>p</i> = 0.046). Between the two clusters, 279 differentially methylated loci were identified (false discovery rate < 0.05 and |Δβ| >0.1). Based on these loci, 1,743 locus pairs were significantly associated with overall survival (Univariate Cox regression, false discovery rate < 0.05). From these significant pairs, the CM 11 locus-pair prognostic model (CM-LP11) consisting of 11 pairs was constructed, which could effectively stratify patients into high- and low-risk groups with significantly different overall survival across all datasets (all <i>p</i> < 0.05, log-rank test). The high-risk group exhibited an immunosuppressive microenvironment with reduced CD8+ T cells and B cells and increased monocytes (<i>p</i> < 0.05, Wilcoxon test). Functional analysis of methylation differences between risk groups showed significant immune response-related pathways such as antigen processing and presentation. The high- and low-risk patients also exhibited distinct sensitivity to cytotoxic chemotherapy, targeted therapy, and immunotherapy, with the low-risk group showing higher immunophenoscore, cytolytic activity, and tumor mutational burden. CM-LP11 represents a robust lactylation-related prognostic biomarker that predictive survival outcomes and therapeutic responses in CM patients, proving insights for personalized treatment strategies.

HTT
Also flagged:obsessive-compulsive disorderorganizationgene expressionmetabolismoxygenneuropsychiatric disorders
Journal Article 2026-05-12 ✓ 1 Snippet Chen K, Liu Y, Xiao Y, Cao F, Zhu S, Pan W, Weng W, Hong Y, Hua Q, Wan K, Ye J, Li Z, Xiang S, Yu F, Wang K, Ji G, Zhu C.
In-Text Gene Mentions

…and serotonin transporter (5-HTT)], the glutamatergic system…

Show Full Abstract

Obsessive-compulsive disorder (OCD) is characterized by disrupted brain network organization, yet the molecular basis underlying this dysconnectivity remains elusive. Here, we applied voxel-wise functional connectivity density (FCD) mapping to characterize brain network alterations across 145 patients with OCD and 168 healthy controls (HCs), while further evaluating its ability to support diagnostic classification and predict treatment response in OCD. Then, we examined the spatial correlations between FCD alterations, neurotransmitter distributions, and gene expression profiles. Relative to HCs, OCD patients showed increased FCD in the visual network and decreased FCD in the limbic and default mode networks. Support vector machine (SVM) and support vector regression (SVR) analyses demonstrated that FCD could efficiently discriminate OCD patients from HCs and predict treatment response. Additionally, the FCD alterations showed significant spatial correlations with four neurotransmitter distributions as well as gene expression patterns enriched in excitatory and inhibitory neurons, synaptic signaling, neuronal function, and cellular metabolism. By integrating neuroimaging, neurotransmitter profiles, and transcriptomics, this study reveals that aberrant FCD in OCD reflects both its clinical relevance and molecular basis, providing insights into the neurobiological mechanisms and potential targets for personalized intervention.

HFE
Also flagged:ErythropoiesismetabolismPolycythemia veramyeloproliferative neoplasmiron deficiencycognitive impairment
Journal Article 2026-05-12 ✓ 3 Snippets Gendrot B, Peyssonnaux C, Plo I, Vaulont S, Fouquet G.
In-Text Gene Mentions

…mutations in theHFEgene , particularly…

HFEencodes a transmembrane…

…The association betweenhemochromatosisand erythrocytosis remains…

Show Full Abstract

Erythropoiesis and iron metabolism are closely interconnected, under both physiological and pathological conditions. Polycythemia vera (PV) is a myeloproliferative neoplasm (MPN) caused by a Janus kinase-2 (JAK2) mutation, resulting in uncontrolled red blood cell production and elevated hemoglobin and hematocrit levels. In PV, iron deficiency is common and may be due to several factors, including chronic gastrointestinal bleeding, chronic inflammation, dysregulated hepcidin signaling, and therapeutic phlebotomy. Many patients exhibit low serum ferritin and low to normal hepcidin levels despite erythroid proliferation, suggesting a maladaptive iron-restricted state. This functional iron deficiency may limit erythropoiesis to some extent, but also contributes to burdensome symptoms such as fatigue, cognitive impairment, and restless leg syndrome. Novel therapeutic approaches, including hepcidin mimetics or ferroportin inhibitors, aim to restore iron homeostasis, improving quality of life and potentially reducing the need for cytoreductive therapy (drugs used to treat MPNs by reducing blood cell production) in low-risk PV patients. In secondary forms of erythrocytosis (both congenital and acquired), iron homeostasis has been less often investigated. However, exploring it may be of great interest since in these affections, iron overload could act as a hidden driver of erythrocytosis by stimulating erythroblast proliferation. Hereditary hemochromatosis (HH) is a well-known cause of iron overload. While its association with erythrocytosis has been a subject of interest, it remains incompletely understood. In this review, we will explore the complex relationship between iron (deficiency or overload, including HH) and erythrocytosis (including PV), discussing underlying mechanisms and potential therapeutic applications.

Also flagged:deathtissue homeostasisorganizationnecroptosisautophagy-dependentpyroptosis
Journal Article 2026-05-12 No Snippets Li B, Lan Z, Cui H, Liu W, Tian Z, Lian J, Zhao Y, Yu G.
Show Full Abstract

Regulated cell death (RCD) is a tightly controlled biological process essential for development, tissue homeostasis, and host defense. Despite extensive investigation, how these signaling pathways are spatially and temporally organized to ensure precise cell death decisions remains incompletely understood. Liquid-liquid phase separation (LLPS), a biophysical mechanism driving the formation of dynamic biomolecular condensates, has emerged as a fundamental principle for cellular organization, signal integration, and stress adaptation. Increasing evidence indicates that LLPS plays a critical role in orchestrating cell fate decisions; however, its involvement in RCD has not yet been systematically defined. In this review, we provide a comprehensive overview of LLPS in the context of RCD. We summarize the physicochemical principles, molecular determinants, and regulatory factors governing LLPS, as well as the functional properties of phase-separated condensates, and then discuss how LLPS modulates key RCD pathways, including apoptosis, necroptosis, autophagy-dependent cell death, pyroptosis, and ferroptosis, highlighting shared and pathway-specific regulatory mechanisms. Furthermore, we examine the pathological consequences of aberrant phase separation-mediated RCD in human diseases and discuss emerging therapeutic strategies aimed at targeting LLPS-driven cell death processes. Finally, we catalog RCD-associated proteins with phase separation potential and outline major conceptual and technical challenges, proposing future directions for this rapidly evolving field.

OLFM4
Also flagged:neoplasmsgastrointestinal syndromedeathcancercell differentiationlipolysis
Journal Article 2026-05-12 ✓ 3 Snippets Liao Z, Huang C, Zhang L, Hu C, Wu Z, Bai Z, Li G, Zhou L, Wang N, Huangfu C, Ni Z, Shen P, Zhou W, Gao Y.
In-Text Gene Mentions

…with antibodies againstOlfm4(1:800, CST, 39141),…

…(1:200, Abcam, ab184601),Olfm4(1:200, CST, 39141),…

…ISCs labeled withOlfm4and proliferative cells…

Show Full Abstract

The development of compounds triggering intestinal stem cells (ISCs) proliferation represents a promising strategy to alleviate irradiation (IR)-induced gastrointestinal syndrome. Here, cannabidiol (CBD)-a nonpsychotomimetic phytocannabinoid derived from the Cannabis sativa plant-was found to dramatically improve body weight loss of mice and stimulate Lgr5<sup>+</sup> ISCs proliferation upon a lethal dose of IR. Using absolute quantitative lipidomics, we found that the dysregulation of fatty acids in crypts induced by IR was rescued by CBD, which was indispensable for ISCs regeneration. Integrative analysis of transcriptome and lipidomics unveiled the critical role of PPARα in regulating fatty acid β-oxidation (FAO) by transcriptionally upregulating Slc27a2 and Acox1. Further experiments showed that CBD could trigger the enrichment of Stat2 on the promoter region of Pparα, ultimately facilitating the FAO program and subsequent ISCs proliferation following IR exposure. In addition,THOC3 was identified as a direct target of CBD, which stabilized the THOC3 protein and substantially alleviated the IR-induced blockade of Stat2 mRNA nuclear export. This study reveals a connection between CBD-driven ISCs proliferation and the FAO program during IR damage, providing a promising avenue for IR-induced gastrointestinal syndrome treatment. The binding of CBD to THOC3 maintains its radiation stability, which then supports the nuclear export of Stat2 mRNA for the subsequent transactivation of Pparα. The upregulation of PPARα will ultimately stimulate the FAO program, thereby facilitating ISCs regeneration during IR exposure.

HTT
Also flagged:Heroin addictionbindingaddictionsubstance use disorderschromatinOpioid use disorder
Journal Article 2026-05-12 ✓ 1 Snippet Chakraborty R, Veerappa A, Guda C.
In-Text Gene Mentions

HTTalso regulates DRD2…

Show Full Abstract

The ongoing opioid crisis underscores the need to elucidate the neurobiology of addiction for improved treatments. Dynamic transcription factor (TF) binding is a key driver of substance use disorders (SUDs), yet its genome-wide patterns in human brain cell types remain poorly defined. We performed a computational re-analysis of publicly available ATAC-seq data (PRJNA561094) from post-mortem putamen samples of heroin users and matched non-users, where we profiled chromatin accessibility analyzing neuronal and glial cells separately. Genome-wide TF binding sites were identified and quantified, followed by footprinting and differential binding analyses. Co-occurrence analysis was applied to identify TF pairings associated with SUD-related genes. Neurons from heroin users exhibited 38 TFs with altered binding and footprinting, while glia showed 11 differentially bound TFs, primarily from the FOS, JUN, and ZNF families. NRF1 and KLF15 were differentially bound in both cell types. These TFs were linked to SUD-associated genes and activation of neuroinflammatory, neurohormonal, and S100 pathway genes. Co-occurrence analysis identified five TF pairs in user neurons and thirteen in non-user glia interacting with SUD-related genes and driving neuroinflammatory signaling. Overall, our findings reveal distinct alterations in TF binding accessibility and co-occurrence networks in heroin users' neurons and glia, implicating transcriptional dysregulation in addiction-related neuroinflammation and neurohormonal activity.

Also flagged:chronic diseasefibril formationbindingdegradation
Journal Article 2026-05-12 No Snippets Brakti I, Lenton S, Polimeni M, Ausserwöger H, Scrutton R, Henriksen A, Lorenzen N, Pedersen MN, Marino JS, Herranz-Trillo F, Terry AE, Knowles TPJ, Groenning M, Foderà V.
Show Full Abstract

At high concentrations, therapeutic monoclonal antibodies (mAbs) often display increased self-association, which may result in liquid-liquid phase separation (LLPS) or high opalescence alone. Due to a suspected link with aggregation, formulation strategies aim at preventing their occurrence. However, the molecular underpinnings of LLPS and opalescence remain unclear, complicating their forecasting at early stages. By combining light and X-ray scattering with microscopy and microfluidics, we report the phase behavior of a model mAb (mAb1). This is characterized by clustering and LLPS in a narrow NaCl range, above which it transitions into an opalescent state devoid of micron-sized assemblies, yet retaining similar self-interaction fingerprints. Using Monte Carlo simulations, we show that the behavior of mAb1 is controlled by a positive patch in its Fab domain, whose degree of charge screening determines solution fate. Finally, we show that LLPS and opalescence are decoupled from stirring-induced aggregation.

DNAH10CCDC92
Also flagged:basal-bodyproteasomeinfertilitymicrotubuleaxonemecentriole
Journal Article 2026-05-12 ✓ 2 Snippets Kossakowski A, Barua D, Muszewska A.
In-Text Gene Mentions

…DNAH8 28 ,DNAH1025 ,DNAH12 29…

…proteins, including TSG10,CCDC92, CEP57, PCM1, MZT2,…

Show Full Abstract

Flagellated fungi are pivotal for understanding the evolution of eukaryotic motility, yet knowledge of their flagellar proteins remains fragmentary. We assembled a cross-phyla atlas by mapping 394 reference flagellar proteins on 184 fungal proteomes. Out of 394 orthogroups, 342 orthogroups have fungal homologs, of which 210 orthogroups are specific to flagellated fungi. From these, we propose a 184-orthogroup minimal flagellum encompassing proteins shared by flagellated fungi. This minimal toolkit retains the axonemal core (tubulins, dynein arms), beat regulators (nexin-dynein regulatory complex, radial spokes), intraflagellar transport (IFT-B, IFT-A, IFT kinesin, dynein), basal-body and trafficking (exocyst/TRAPP). Genes specific to the flagellum preferentially express during flagellated life cycle stages; but conserved flagellar genes show no such expression specificity, regardless of whether the species is flagellated. Fungal lineages differ in the composition of flagellar modules. Neocallimastigomycota stand out as the most diverged among flagellated lineages with the broadest flagellar toolkit, including a complete BBSome, yet reduced centriole-associated modules. We delineate a conserved engine for fungal motility and a modular, lineage-specific set of proteins that broadens regulation and sensory capacity. The conservation of flagellar proteins between fungi and animals opens up possibilities of experimental functional validation in models simpler than animals.

OLFM4
Also flagged:Salmonella infectioninfectioninfectionsdigestionextracellulargene expression
Journal Article 2026-05-12 ✓ 5 Snippets Lebon S, Habshush Menachem A, Davidzohn N, Katz A, Wigoda N, Braun T, Yahalomi D, Rotkopf R, Holiar V, Dadosh T, Levin-Zaidman S, Dezorella N, Goliand I, Kupervaser M, Leebhoff S, Blumberger N, Hoffman D, Grunewald M, Levin Y, Haberman Y, Hofree M, Biton M.
In-Text Gene Mentions

… 5′–GGTCTTGTTCTGCCGACTCT–3′; mOlfm4forward: 5′–CACAGCTCACATCCTTTC…

…′–CACAGCTCACATCCTTTCTCAG–3′; mOlfm4reverse: 5′–ACTCGGACCGTCAGGTTC…

… RRID:AB_397581), rabbit anti-Olfm4(1:200 dilution, Cell…

…the ISC markerOlfm4within the ‘stem…

…stem cell marker,Olfm4IFA (Extended Data…

Show Full Abstract

Intestinal stem cells (ISCs) are essential for sustaining epithelial renewal and barrier integrity, yet their role in orchestrating defense against enteric pathogens remains unclear. Here we identify a stem cell-intrinsic immune mechanism whereby Lgr5<sup>+</sup> ISCs detect intracellular Salmonella enterica and activate an inflammasome-dependent differentiation program. Using fluorescent-labeled S. enterica, single-cell transcriptomics, fate mapping, organoid models, and genetic perturbations, we show that invaded ISCs undergo rapid reprogramming toward antimicrobial peptide-enriched Paneth cells via apoptosis-associated Speck-like protein containing a CARD (ASC, encoded by Pycard)-mediated inflammasome signaling. This fate switch enhances epithelial antimicrobial capacity and restricts pathogen persistence in the crypt. The response is Salmonella-specific and conserved in human intestinal organoids. Moreover, the invasion-associated transcriptional signature is enriched in ISCs from patients with Crohn's disease. Our findings reveal that ISCs act as active sensors of bacterial invasion and initiate epithelial remodeling through inflammasome signaling, highlighting stem cell plasticity as a frontline innate immune strategy.

Also flagged:tumorneurological diseasesbrain tumorsgliomadiffuse-midline-gliomaDiffuse midline glioma
Journal Article 2026-05-12 No Snippets Wei W, Stano M, Kritzer B, Nazarian J, Hierlemann A, Modena MM.
Show Full Abstract

Few therapeutic options for treating neurological diseases are currently available due to the extremely selective nature of the blood-brain barrier (BBB), which strongly limits drug delivery from the systemic circulation into the central nervous system. The lack of effective treatment options is particularly dire for brain tumors, which ultimately result in very low survival rates. To address the challenge of evaluating drug permeation and efficacy within a physiologically relevant context, we developed a perfused, open-microfluidic platform that includes a human BBB model in co-culture with tumor spheroids. The platform was fabricated from inert plastics to enable quantitative small molecule testing, and it featured 32 testing units in a well-plate format. A pump-free, gravity-driven flow scheme was adopted to establish physiological shear-stress conditions and to enable simple parallelization on tilting stages for increased throughput. We tested the efficacy and permeation of four FDA-approved small-molecule chemotherapeutics - cisplatin, doxorubicin, homoharringtonine, and docetaxel on two patient-derived diffuse-midline-glioma models at sub-IC<sub>50</sub> drug concentrations for the BBB. Our results demonstrate that the in vitro BBB significantly limited drug delivery to the tumor, thereby limiting drug efficacy. Furthermore, drug-induced BBB disruption occurred at sub-toxic doses, which led to increased drug permeation to the glioma models. Finally, cell-model-specific responses revealed distinct cytotoxicity behavior, demonstrating the importance of personalized therapy testing. Our scalable BBB-tumor platform provides a physiologically relevant in vitro model system to assess drug permeation, cytotoxicity, and tumor-BBB interactions and offers the potential to advance the discovery of new effective therapeutics against neurological diseases.

OLFM4
Also flagged:diabetic retinopathyvisionproliferative retinopathydiabetic macular oedemaPDRdiabetes
Journal Article 2026-05-12 ✓ 4 Snippets Zhang Y, Li J, Li X, Shao Y.
In-Text Gene Mentions

…e, 5’-CTGCTTCACCACCCCCTGTT 3’;OLFM4forward, 5’ ATGCTCGAAGTGGAGATA…

…olfactory receptor 4 (OLFM4), and lipid-transporting prot…

…expression of CAMP,OLFM4, LCN2 and MMP9…

…TPP1, TPT1, CAMP,OLFM4and TMED10.…

Show Full Abstract

<h4>Background</h4>Diabetic retinopathy (DR), the primary driver of preventable vision impairment in the global working-age demographic, arises from chronic hyperglycaemia and manifests as non-proliferative or proliferative retinopathy with or without diabetic macular oedema. Inflammation and macrophage-derived cytokines drive progression, and proteomics can identify proteins that may be associated with DR. Vitamin C has been implicated in diabetic complications, yet its causal impact on DR remains unclear.<h4>Methods</h4>We performed quantitative proteomics and bioinformatics analyses of peripheral-blood macrophages from patients with proliferative DR (PDR), non-PDR, diabetes without retinopathy and non-diabetic controls. In a series of experiments, we used THP-1 cells exposed to sustained hyperglycemia and retinal lysates from streptozotocin (STZ)-induced mice to quantify TPT1 expression and to investigate its role in modulating autophagy-related mediators and cellular redox homeostasis. Causal inference between circulating vitamin C and DR risk was tested by two-sample Mendelian randomization (MR).<h4>Results</h4>Quantitative profiling revealed 265 proteins whose abundance differed significantly between PDR and controls; 145 were up-regulated and 120 down-regulated, with TPT1 emerging as a central hub within the macrophage interactome. TPT1 expression was markedly reduced under hyperglycemic conditions, which was accompanied by impaired autophagic activity and increased reactive oxygen species production. MR analysis revealed that vitamin C levels were negatively correlated with the risk of DR (OR = 0.09, 95% CI: 0.01-0.57, P = 0.01).<h4>Conclusions</h4>Deficiency of TPT1 links impaired macrophage autophagy to the progression of diabetic retinopathy, while vitamin C, which restores TPT1 expression, represents a promising therapeutic strategy.

PRDX6
Also flagged:metabolismdigestionimmunodeficienciesmetabolic disordersagingfermentation
Journal Article 2026-05-12 ✓ 1 Snippet Zhou Z, Lamanna A, Halder R, Pansart E, Narayanasamy S, Boussoufa B, Kerkour T, Wilmes P, Williams E.
In-Text Gene Mentions

…diet, such asPrdx6[ 20 ],…

Show Full Abstract

<h4>Background</h4>The gut microbiota adapts to and shapes the host's metabolic state through affecting circulating metabolites and consequent gene regulatory networks, resulting in systemic influences in diverse organs via connections such as the gut-liver axis. Numerous variables such as diet, age, and host genetics modulate the composition of the gut microbiome, but their interactions and specific associative and mechanistic links to host molecular phenotypes remain incompletely unannotated. Integrated multi-omics approaches in genetically diverse populations offer an opportunity to dissect these interactions and identify predictive microbial signatures for host phenotypes, such as body weight and molecular associations with gene expression pathways in gut and liver.<h4>Results</h4>We sequenced, aligned, and integrated the cecal metagenome, metatranscriptome, and host transcriptome from 232 mice across 175 distinct cohorts according to a low-fat chow diet (CD) or a high-fat diet (HF), four adult ages (between roughly 180 to 730 days of age), and 43 distinct genotypes (inbred BXD strains). Genetics and diet exerted the strongest influence on microbiota abundance and activity, followed by age. HF feeding significantly reduced diversity across all ages and all genotypes, altering > 300 species. Machine learning models based on microbial profiles reliably predicted body weight within dietary group (AUC = 0.84 for CD, 0.79 for HF) and chronological age (AUC = 0.84), with model performance of age prediction rising to 0.95 when integrating top microbial features with liver proteomics. Network analyses of expression data revealed links between genes, pathways, and specific microbes, including a negative association between cecal Ido1 expression and short-chain fatty acid (SCFA)-producing Lachnospiraceae, suggesting dietary fat may modulate host tryptophan metabolism through microbiota shifts.<h4>Conclusions</h4>Whole metagenome and metatranscriptome sequencing approaches have massively expanded the landscape of microbiome analysis compared to earlier short-read 16S analyses. The resulting datasets quantify hundreds of uniquely identifiable microbes, which can be used to create sets of highly predictive microbial biomarkers for aging and obesity. When trained on controlled mouse populations, these results demonstrate that microbiome profiling can achieve high predictive capacity (AUC = 0.95 with multi-omics integration) for complex readouts such as age and body weight (AUC = 0.84), even considering genetic and dietary variation, establishing a framework for biomarker development. While at present many bacteria are still functionally unannotated at the species level, multi-omics approaches - including gene expression from the host tissues - provide insights into the functional associations of specific taxa in the microbiome. Video Abstract.

Also flagged:remineralizationenamel caries lesionscariesenamel cariesDental cariesoral disease
Journal Article 2026-05-12 No Snippets El-Sharkawy RM, Hanafy RA, Alghonemy WY, Abdelfatah OM, Salem EM.
Show Full Abstract

This study found that combining a biomimetic organic matrix of chitosan (CS) and carboxymethyl cellulose (CMC) with bioinspired fluorapatite nanoparticles (Nano-FA) significantly enhanced the remineralization of early enamel caries lesions. A total of 40 extracted third molars were sectioned into 200 enamel specimens and randomly allocated into five groups: sound enamel (baseline), demineralized enamel, CS-treated, Nano-FA-treated, and CS-Nano-FA-CMC-treated groups. Remineralization efficacy was assessed using Vickers microhardness testing, scanning electron microscopy (SEM), and energy-dispersive X-ray (EDX) analysis. Among all evaluated groups, both Nano-FA and CS-Nano-FA-CMC treatments notably improved enamel microhardness, restoring values close to those of sound enamel. The CS-Nano-FA-CMC group displayed pronounced mineral deposition on the enamel surface and a markedly higher Ca/P ratio (<i>p</i> < 0.001) than other groups. These findings indicate that the CS-Nano-FA-CMC composite is especially effective at promoting remineralization, likely due to synergistic action that results in sustained release of calcium, phosphate, and fluoride ions, and facilitates apatite formation. Within the limitations of this <i>in vitro</i> study, the developed nanocomposite demonstrates strong potential as a future biomimetic agent for managing early enamel caries lesions.

Also flagged:tumorcolorectal cancertumorsimmune responsecolorectal cancersmismatch repair
Journal Article 2026-05-12 No Snippets Li TA, Quigley LT, Chan KF, Williams DS, Mielke LA, Behren A, Da Gama Duarte J.
Show Full Abstract

<h4>Objectives</h4>Gamma-delta (γδ) T cells have been associated with favorable prognoses across several malignancies, underscoring their potential as targets for novel immunotherapies. These unconventional T lymphocytes exhibit an intrinsic tropism for the tumor microenvironment, largely driven by their capacity to recognize stress-induced antigens characteristic of metabolically dysregulated tumors. Unlike the mechanism governing conventional cytotoxic CD8<sup>+</sup> alpha-beta (αβ) T cells, γδ T-cell receptors can engage tumor cell moieties independent of major histocompatibility complex class-I (MHC-I) and human leukocyte class-I molecules. Therefore, γδ T cells may have a pivotal role in the immune response to beta-2 microglobulin-mutated MHC-I negative (MHC-I<sup>-</sup>) colorectal cancers (CRCs) with deficient mismatch repair.<h4>Methods</h4>To determine whether γδ T-cell mobilisation extends to diverse aetiologies of MHC-I loss, we used multispectral immunohistochemistry to stain 150 stage I-IV primary CRC tissues, across eight tissue microarrays.<h4>Results</h4>Our investigation revealed MHC-I loss in ~30% of CRC primary tumors across all disease stages, with a notable increase in stromal γδ T-cell frequency and activation status among stage III cases. Importantly, these findings extend previous observations largely confined to mismatch repair-deficient CRC by demonstrating that stromal γδ T-cell enrichment associated with MHC-I loss also occurs in mismatch repair-proficient tumors, suggesting a broader role for γδ T cells in immune surveillance of MHC-I-deficient CRC.<h4>Conclusion</h4>These data highlight the potential of γδ T cells in counteracting immune evasive MHC-I<sup>-</sup> tumors, thereby offering a robust rationale for their strategic deployment in next-generation immunotherapy regimens.

Also flagged:autophagydegradationpancreatitisdiabetescancerpancreatic disease
Journal Article 2026-05-12 No Snippets Piper M, Kinsey C.
Show Full Abstract

Autophagy is a complex cellular process of cellular degradation that is essential for healthy pancreatic function and, when perturbed, can result in pathological states such as pancreatitis, diabetes, and cancer. Extremes in both activation and inhibition can lead to inflammation, cell damage, and organ dysfunction. Pharmacologic targeting of autophagy to restore homeostasis may provide a therapeutic benefit to various pancreatic pathological processes. In this review, we discuss the current understanding of how autophagy maintains normal pancreatic function and is perturbed in various pancreatic disease states, including opportunities for potential therapeutic intervention.

Also flagged:neurologic disordersHuntington diseasehereditary breast and ovarian cancermitochondrialgenetic disorderhereditary cerebellar ataxia
Journal Article 2026-05-12 No Snippets Narasimhalu K, Raheja A, Cham B, Chen CYT, Kam S, Tan EK.
Show Full Abstract

Genetic testing in neurology is playing an increasingly important role because of advances in sequencing technologies and the availability of targeted therapeutic options. In Singapore, clinical practice guidelines introduced in 2018 required genetic counseling as a part of clinical genetic testing, and a moratorium implemented in 2021 limited the use of genetic results to determine insurability. In response to these developments, we established a neurogenetics clinic staffed jointly by a neurologist and genetic counselor in September 2020. The objective of this study was to describe the patient population, referral patterns, and factors associated with the decision to undergo genetic testing and evaluate downstream management changes. We conducted a retrospective cohort review of adult patients seen at the Singapore General Hospital neurogenetics clinic between September 2020 and December 2023. Demographic, clinical, and referral data were collected, along with details on testing decisions, type of genetic tests performed, and outcomes. Logistic regression was used to explore demographic or referral factors associated with genetic testing uptake. A total of 164 patients were evaluated; 128 (78%) proceeded with genetic testing. Among the 36 who declined, cost was the predominant reason (72%), followed by insurability concerns (11%), perceived lack of clinical utility (8%), and not wishing to know the diagnosis (8%). Logistic regression showed no significant demographic or referral-related predictors of testing uptake. Of those tested, 38% had pathogenic/likely pathogenic results, 11% had variants of uncertain significance, and 51% had negative results. Clinical management was modified in 90% of those with pathogenic/likely pathogenic results and 79% with uncertain variants. Our findings demonstrate a high uptake of genetic testing in an adult neurogenetics clinic. Financial barriers remain the most significant deterrent. Genetic results had a direct impact on clinical care for most diagnosed patients, highlighting substantial clinical utility. Hence, reducing financial barriers will be essential as genetic testing becomes increasingly central to diagnosis, treatment, and management of neurologic disorders.

PEBP1
Also flagged:Asthmachronic inflammatory airway diseaseobesityvisceral obesityimmune cell activationimmune responses
Journal Article 2026-05-12 ✓ 1 Snippet Zhang H, Chen L, Chen H, Zhang K, Chen Z, Chen T.
In-Text Gene Mentions

…hanolamine-binding protein 1 (PEBP1), which activates the…

Show Full Abstract

<h4>Background</h4>Obesity is a significant independent risk factor for asthma severity. However, the underlying molecular mechanisms by which it exacerbates asthma development remain unclear. This study aims to identify and validate key hub genes involved in high-fat diet-induced obesity aggravating asthma.<h4>Methods</h4>Candidate genes associated with asthma, obesity, immunity, and inflammation were identified by integrating GEO databases (GSE76262, GSE41863, and GSE65204) with the GeneCards database. These candidate genes were further screened using three machine learning algorithms (LASSO, Random Forest, and SVM-RFE) followed by SHAP analysis. The expression of the hub gene ALOX15 and its correlation with pulmonary pathological changes were validated in a high-fat diet-induced asthma mouse model using qRT-PCR, Western Blot, and histological staining. Immune cell infiltration and functional pathways were explored using CIBERSORT, GSEA, and GSVA technologies.<h4>Results</h4>Among 233 asthma differentially expressed genes, nine candidate genes associated with obesity, immunity, and inflammation were identified. Machine learning further identified ALOX15, IL1R1, TNFAIP3, and NLRP3 as diagnostic candidate genes, with ALOX15 demonstrating the most robust performance across multiple datasets (AUC > 0.7) and confirmed as the primary predictor via SHAP analysis. Animal experiments confirmed that a high-fat diet significantly exacerbated pulmonary inflammation and airway remodeling. ALOX15 expression in lung tissue was markedly higher in high-fat diet asthma model mice compared to normal diet asthma model mice. Functional analysis revealed a positive correlation between ALOX15 and eosinophil infiltration, with significant enrichment in arachidonic acid metabolism, NF-κB signaling pathways, and lipid metabolism processes.<h4>Conclusion</h4>ALOX15 is a key molecular bridge in the pathogenesis of obesity-exacerbated asthma, linking high-fat diet-induced metabolic dysfunction to pro-inflammatory immune responses in the lungs, and may serve as a potential diagnostic biomarker and therapeutic target for obesity-associated asthma.

HFE
Also flagged:Mucormycosisinvasive fungal infectionimmunosuppressionhaematologicalneutropeniahaemochromatosis
Journal Article 2026-05-12 ✓ 2 Snippets Tan EX, Collis B, Holmes N, Lokan J, Grigg A.
In-Text Gene Mentions

…and C282Y homozygoushemochromatosiswith iron overload…

…of homozygous C282Yhemochromatosisas well as…

Show Full Abstract

Oesophageal mucormycosis is an uncommon life-threatening opportunistic fungal infection usually managed with antifungal therapy and aggressive surgical debridement. We describe a 54-year-old male who developed oesophageal mucormycosis 3 months post-allograft for multiply-relapsed leukaemia. Surgery was not performed due to prohibitive perioperative risk. He received 6 weeks of intravenous Liposomal Amphotericin B followed by long-term isavuconazole. Serial endoscopy and PET/CT imaging demonstrated resolution of infection to 7 months post-transplant where he died from relapsed leukaemia. We demonstrate that antifungal therapy alone may be efficacious where surgery is contraindicated and highlight the utility of PET/CT imaging for staging and monitoring this disease.

Also flagged:remineralizationbiomineralizationdemineralizationorganizationcariesmetabolism
Journal Article 2026-05-12 No Snippets Ilieva R, Avramova I, Petrov O, Rabadjieva D.
Show Full Abstract

Understanding the differences between synthetic and natural hydroxyapatite under conditions that mimic the oral environment, particularly the demineralization and remineralization processes of dental enamel, is essential for assessing their suitability as enamel models in biomineralization studies. The present study aims to systematically compare the structural, chemical, and morphological properties of well-crystallized synthetic carbonated hydroxyapatite (CHA) and natural non-biogenic hydroxyapatite (HA) before and after exposure to solutions with demineralizing and remineralizing activity. Two highly informative surface characterization techniques-X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM)-were employed to examine the resulting surface changes. In addition, powder X-ray diffraction and infrared analyses were used to characterize the initial samples. Demineralization was induced using a lactic acid-based solution, while remineralization was performed through a two-step treatment involving polycarboxybetaine followed by artificial saliva. The results show that natural HA contains an additional fluorapatite phase and a wider range of trace elements (Na, F, Si), leading to a more complex structure. During demineralization, synthetic CHA exhibits more pronounced surface changes and faster dissolution, whereas natural HA demonstrates greater chemical stability. The remineralization process leads to the formation of new surface layers on both materials. Synthetic CHA develops a fine-grained, homogeneous layer enriched in carbonate and hydrated species, while natural HA shows localized crystal growth within structural defects. The results demonstrate that natural HA exhibits greater chemical stability during demineralization and a more enamel-like response during remineralization, whereas synthetic CHA undergoes more pronounced surface restructuring and forms a highly hydrated, carbonate-rich surface layer.

SERPINC1
Also flagged:Neurodegenerative Disordersfrontotemporal dementiamemory impairmentADdelusions ofexecutive dysfunction
Journal Article 2026-05-12 ✓ 5 Snippets Barczak A.
In-Text Gene Mentions

…synthesizes evidence onACE-IIIand M-ACE in…

…acteristic cognitive patterns,ACE-IIImay improve diagnostic…

…clinical utility ofACE-IIIin the differential…

…profiles identified withACE-IIIcan be interpreted…

…of these terms: “ACE-III”, “Addenbrooke’s Cognitive Ex…

Show Full Abstract

Psychotic symptoms, including delusions and hallucinations, frequently complicate the course of Alzheimer's disease (AD), dementia with Lewy bodies (DLB), Parkinson's disease dementia (PDD), and frontotemporal dementia (FTD). Their presence accelerates decline, worsens outcomes, and complicates management. Cognitive screening in such patients is essential yet challenging due to attentional fluctuation, impaired insight, and diagnostic overlap. Addenbrooke's Cognitive Examination III (ACE-III) is a multidomain tool with higher sensitivity than the MMSE. Evidence indicates that ACE-III captures disorder-specific cognitive-psychotic profiles: memory impairment in AD with delusions of theft, visuospatial and attentional deficits in DLB with hallucinations, or executive dysfunction in FTD with paranoid ideation. Mini-ACE (M-ACE), a shorter derivative, is useful in acute psychiatric or advanced dementia settings. This review synthesizes evidence on ACE-III and M-ACE in psychosis-related neurodegeneration, highlights their role in differentiating from primary psychiatric psychoses, and identifies knowledge gaps, particularly in atypical AD variants, mixed dementia, and autosomal dominant AD. ACE-III emerges as a practical and informative tool, but psychosis-specific normative data and longitudinal studies are needed.

DCC
Also flagged:Gliomasprimary tumors of thenervousglioblastomaGBMTumors
Journal Article 2026-05-12 ✓ 1 Snippet Wu X, Liu D, Geng H, Zhang B, Diao H, Zhou Y, Song G, Cheng Y, Liang J.
In-Text Gene Mentions

…/NRXN1, NXPH1/NRXN3, and NTN4/DCC, further supporting a…

Show Full Abstract

Synaptogenesis-related neuron-glioma interactions are increasingly recognized in glioma, yet it remains unclear whether routine H&E morphology can capture these programs and improve prognostic stratification. We integrated H&E whole-slide images, transcriptomes, and clinical data from 434 TCGA gliomas. Deep learning and quantitative pathology yielded an integrated histomorphologic feature set of 2678 features. Synaptogenesis-related activity was quantified using ssGSEA for ninety-eight synaptogenesis-related genes. In the training cohort, Spearman analysis identified 149 correlated histomorphologic features, which were refined to thirty-five by elastic net regularization. Seventeen prognostic candidates were entered into the MIME1 framework, and the most parsimonious model, Enet[0.1], retained fourteen non-zero-coefficient features to define the synaptogenesis-associated histomorphologic signature and construct the pathology-derived risk score (PRS). Multi-omic analyses, Human Protein Atlas validation, and single-nucleus RNA-seq were used to investigate the hub gene and its cellular context. PRS robustly stratified survival in both training and validation cohorts and remained an independent prognostic factor after adjustment for age and 2021 WHO CNS grade. High-risk tumors showed increased stromal and immune scores and enrichment of immune, adhesion, and phagosome-related pathways. <i>EFNB2</i> emerged as the hub gene and was enriched in glioblastoma, and <i>EFNB2</i>-positive malignant cells displayed prominent communication with neurons, including EFNB2-EPHB1 signaling. Exploratory re-analysis of the myeloid compartment further showed that glioblastoma was enriched for suppressive TAM-like states relative to astrocytoma grade 2, supporting a shift toward a more tumor-associated and potentially immunosuppressive microenvironment. Routine H&E histomorphology can capture synaptogenesis-related molecular programs in glioma. The resulting PRS provides clinically relevant prognostic stratification, while <i>EFNB2</i>-positive malignant cells may represent a candidate hub for neuron-tumor communication within a remodeled tumor ecosystem.

Also flagged:coagulopathysepsisfibrinolysiscoagulationclot formationhemostasis
Journal Article 2026-05-12 No Snippets Smudla A, Schöchl H, Calatzis A, Gergely CR, Fazakas J.
Show Full Abstract

Viscoelastic testing (VET) is widely used to guide hemostatic therapy in patients with coagulopathy. One important application is the detection of fibrinolysis, defined as a reduction in clot amplitude after maximum clot firmness (MCF), quantified as maximum lysis (ML). Low ML values have recently been associated with adverse outcomes in trauma and sepsis. However, the biological basis of low ML remains unclear. <b>Objective</b>: To determine whether low ML values reflect reduced plasmin-mediated fibrinolysis in tissue factor (TF) activated viscoelastic assays (EX-assay). <b>Methods</b>: A total of 120 healthy adults (52.5% female; mean age 38.2 ± 14.1 years) were studied. EX-assay without fibrinolysis inhibition were compared with assays containing the antifibrinolytic agent tranexamic acid (AP-assay). VET parameters obtained with and without fibrinolysis inhibition were compared using paired analyses, Pearson correlation, and Bland-Altman methods. <b>Results</b>: Clot firmness at 10 min (CA10) was similar with or without fibrinolysis inhibition; although MCF differed statistically, the difference was clinically negligible. ML ranged from 1% to 13% in both assays, with nearly identical mean values (5.9 ± 2.6% vs. 6.0 ± 2.6%). Correlation analysis demonstrated strong agreement for CA10, MCF, and ML between assays, and Bland-Altman analysis confirmed minimal bias for ML. <b>Conclusions</b>: Low ML values in TF-triggered viscoelastic assays were unaffected by tranexamic acid, suggesting that they are unlikely to reflect plasmin-mediated fibrinolysis. These findings support the contribution of alternative mechanisms, such as platelet-mediated clot retraction.

HFE
Also flagged:diabetesautismintellectual disabilitymaturity-onset diabetes of the young type 5MODY5neuropsychiatric disorders
Journal Article 2026-05-12 ✓ 1 Snippet Dvoryanchikov YV, Khusainova RI, Minniakhmetov IR, Salakhov RR, Smirnov KV, Ibragimova SA, Golodnikov II, Sechko EA, Dobreva EA, Mokrysheva NG.
In-Text Gene Mentions

…septate uterus, andhemochromatosis.…

Show Full Abstract

This article presents the first reported familial case of 17q12 recurrent deletion syndrome in Russia, involving a female patient with diabetes and her daughter diagnosed with atypical autism without intellectual disability. A comprehensive analysis of the molecular genetic features and intrafamilial variability of clinical manifestations was performed. In addition, clinical, laboratory, and instrumental findings were compared with those observed in a classical case of maturity-onset diabetes of the young type 5 (MODY5). Furthermore, the disease course associated with other genetic alterations affecting the 17q12 region, including 17q12 microduplications and various pathogenic variants of the <i>HNF1B</i> gene, was comparatively evaluated. Given the orphan nature of this condition, the present report adds to the limited existing data on the clinical and genetic characteristics of 17q12 recurrent deletion syndrome.

Also flagged:liver fibrosisChronic liver diseasestranslationalinflammatory liver diseasesmitochondrialautophagy
Journal Article 2026-05-12 No Snippets Aquino JB.
Show Full Abstract

Chronic liver diseases represent a major global health burden, with fibrosis as the common pathological outcome of sustained hepatic injury. Once considered irreversible, liver fibrosis is now recognized as a dynamic and potentially reversible process driven by complex cellular and molecular interactions within the hepatic microenvironment. Among these, hepatic macrophages have emerged as central regulators of both fibrogenesis and fibrosis resolution due to their remarkable phenotypic and functional plasticity. This review integrate experimental, translational, and emerging clinical evidence to propose macrophage reprogramming as a unifying therapeutic framework for liver fibrosis. A broad spectrum of intervention strategies -including gene modulation, pharmacological agents, immunometabolic reprogramming, nanotechnology-based delivery systems, and cell-based therapies- converges on promoting restorative macrophage phenotypes across toxic, metabolic, cholestatic, and inflammatory liver diseases. Particular emphasis is placed on key signaling and metabolic circuits -such as NF-κB, STAT1/3/6, PPARα/γ, AMPK, mitochondrial function, and autophagy- that collectively govern macrophage fate and function. The context-dependent nature of macrophage responses is highlighted, underscoring critical differences between toxic injury models (e.g., CCl<sub>4</sub>) and chronic metabolic conditions such as MASH, where macrophage heterogeneity and immunometabolic dysregulation impose additional therapeutic challenges. Emerging clinical data indicate that many antifibrotic strategies -despite distinct primary targets- converge on shared pathways of macrophage modulation, reinforcing their role as integrative hubs linking inflammation, metabolism, and tissue repair. Collectively, current findings indicate that durable fibrosis regression is unlikely to be achieved through single-target interventions. Instead, effective therapeutic strategies will require coordinated, temporally defined modulation of macrophages alongside other hepatic cells populations. Elucidation of the hierarchy and timing of macrophage-driven repair processes will be essential for the rational design of next-generation antifibrotic interventions with improved clinical efficacy.

OLFM4
Also flagged:LeishmaniasisCutaneous leishmaniasisCLulcerative diseasecell activationbraziliensis disease
Journal Article 2026-05-12 ✓ 1 Snippet Lobo-Silva J, Orge C, Neto APDS, Ribeiro BV, Fávaro RD, da Silva JK, Santos SPO, Nunes S, Moitinho-Junior VS, Barral A, Machado NT, Ramos PIP, Khouri R, Farias LP.
In-Text Gene Mentions

…Acod1, Gzma, andOlfm4, were also…

Show Full Abstract

Cutaneous leishmaniasis (CL) caused by <i>Leishmania braziliensis</i> results in chronic skin ulceration and remains challenging to treat. While human transcriptomic studies have identified pathways driving immunopathology, the early events of infection and the molecular transitions from lesion formation to healing are still poorly understood. Here, we performed a longitudinal transcriptomic analysis of skin lesions and draining lymph nodes (dLNs) in the BALB/c ear dermal model infected with <i>L. braziliensis</i>, which recapitulates features of human CL. Using bulk RNA sequencing at 2, 6, and 48 hours and at 14, 35, and 77 days post-infection, we characterized differential gene expression, pathway enrichment, and gene co-expression networks. Ulcerated mouse lesions (Day 35) recapitulated 77% of the inflammatory pathways described in human CL, with many persisting at Day 77 despite "clinical healing". Mice displayed additional upregulation of genes linked to macrophage polarization (<i>Il12a</i>, <i>Il12b</i>, <i>Il4</i>), nitric oxide metabolism (<i>Arg1</i>, <i>Nos2</i>) and epidermal differentiation (e.g., <i>Crnn</i>, <i>Rptn</i>, <i>Tchh</i>, <i>Lce</i> members). Gene co-expression analysis revealed stage-specific gene modules (M) associated with early innate responses (M3), tissue damage (M1), epithelial-mesenchymal transition (M4), and skin barrier remodeling (M6). A long non-coding RNA-enriched module (M2) was selectively downregulated during the ulceration. Cross-species comparison of ulcerated lesions revealed 16 conserved microRNAs and 12 shared epigenetic regulators, including <i>Mir155</i>, <i>Mir142</i>, <i>Sp140</i>, and <i>Kdm6b</i>, with known roles in inflammation and tissue repair, representing promising host-directed therapeutic targets. Together, this study provides a comprehensive temporal framework of host responses to <i>L. braziliensis</i> and identifies actionable non-coding RNAs and epigenetic pathways with translational potential for CL therapy.

Also flagged:Colorectal cancercancertumorcolorectal adenocarcinomaextracellularorganization
Journal Article 2026-05-12 No Snippets Le MK, Liu X, Vaickus L, Yao K, Levy J.
Show Full Abstract

<h4>Background</h4>Characterizing the tumor immune microenvironment (TIME) is essential for understanding anti-tumoral responses in colon cancer. This study introduces TIME Landscaper (TIMEL), a computational framework that uses deep learning to identify tissue structures at the microscopic level and summarizes their distribution across whole-slide images (WSIs) using statistical descriptors reflecting intratumoral heterogeneity for prognostic biomarker discovery.<h4>Methods</h4>The performance of six deep learning image classification models (Inception V3, DenseNet-121, ViT-base, UNI, Prov-GigaPath, and Virchow) was evaluated to segment microarchitectural tumor, stromal, and immune areas using nearly 50,000 mini-patches. The selected model was applied to WSIs from discovery (TCGA-COAD; <i>n</i> = 411) and validation (Dartmouth; <i>n</i> = 108) cohorts, segmenting these components to map their spatial distribution. From these maps, 30 statistical descriptors representing abundance, variation, shape, spatial smoothness, and spatial heterogeneity were calculated as slide-level TIMEL features. Univariate and multivariate regression analyses identified survival-associated and metastasis-related biomarkers from the discovery and validation cohorts, respectively.<h4>Results</h4>Virchow outperformed other models in segmenting tissue compartments (AUCs: 0.99, 0.98, 0.98 for tumor, stromal, immune components). Slide-level stromal and immune variance correlated with pathologist-assessed metrics (<i>R</i> = 0.47 and 0.32, both <i>p</i> < 0.001). Spatial immune clustering predicted poorer survival (HR = 2.73; <i>p</i> < 0.001), whereas tumor clustering was protective (HR = 0.23; <i>p</i> = 0.001). Tumor spatial smoothness was associated with nodal metastasis (OR = 1.65; <i>p</i> = 0.02).<h4>Conclusion</h4>TIMEL integrates deep learning and statistics to capture histological heterogeneity within the TIME, enhancing prognostic assessment and supporting precision oncology from routine histology.

Also flagged:viral infectionvaccinia virus infectioninfectionviral genomegene expressionpoxvirus infection
Journal Article 2026-05-12 No Snippets Jiao P, Ran Y, Liu D, Mei L, Pang G, Liang S, Liu Y, Sun L, Wang Z, Zhang K.
Show Full Abstract

Microribonucleic acids (miRNAs) play diverse roles in numerous biological processes. miRNA-24-3p (miR-24-3p) has been reported to play an important role in viral infection. However, little is known about the involvement of miR-24-3p in persistent vaccinia virus infection. In this study, we discovered that vaccinia virus Western Reserve (VACV-WR) infection suppressed miR-24-3p expression. Delivery of synthetic miR-24-3p mimics into cells reduced viral genome replication, protein levels, and viral titers in VACV-WR-infected cells. Target prediction analysis identified KIF21B as a host target of miR-24-3p, and KIF21B deficiency significantly decreased VACV-WR replication and infection, suggesting that KIF21B is an important host factor facilitating VACV replication. Finally, in a VACV-infected mouse model, miR-24-3p was delivered using lipid nanoparticles (LNP), resulting in attenuated weight loss, higher survival rates, and lower viral loads, confirming that miR-24-3p overexpression significantly restricts VACV replication. In summary, our study demonstrates that miR-24-3p targets the host KIF21B sequence to coordinate suppression of VACV replication, providing a potential therapeutic strategy for VACV treatment.

Also flagged:epigenomegene expressionbindingpairingchromatinmethylation
Journal Article 2026-05-12 No Snippets Ma AJ, Brown BH, Kim S, Hilton IB.
Show Full Abstract

CRISPR/Cas-based epigenome editing technologies hold great promise for identifying novel therapeutic targets, improving gene and cell therapies, and directly addressing the underlying issues in many diseases, all while minimizing risks of genotoxicity often associated with conventional genome editing. Exciting recent advances in CRISPR/Cas-based epigenome editing technologies have drastically enhanced the ability to precisely control the timing, levels, and durations of endogenous gene expression and reprogram epigenetic states in human cells. As a result, epigenome editing is now poised to unlock new biomedical discoveries and treatments for diseases driven by transcriptional and epigenetic dysregulation as well as those stemming from aberrantly repetitive genomic regions or complex genomic arrangements that are difficult to target using conventional genome editing. Additionally, the power of epigenome editors is generating new strategies to control cell fate and function, which has direct and important implications for cell therapies and regenerative medicines. Here, as the first wave of CRISPR/Cas-based epigenome editors move into clinical trials, we cover recent advances as the field looks to address pressing hurdles facing widespread clinical deployment of epigenome editing technologies including delivery, performance, and safety. For instance, the discovery of compact Cas chassis, engineering efforts to reduce effector sizes for efficient delivery, and campaigns to tailor the targeting discrimination of epigenome editors are rapidly progressing, as is research into the development of new effector domains with high specificity, robust performance, and a lack of immunogenicity and cytotoxicity. This exciting progress is quickly moving the community closer to fulfilling the promise of CRISPR/Cas-based epigenome editing as a powerful class of platform technologies for biological discoveries, biotechnological innovations, and medicines.

Research Square 2026-05-12 Preprint (No Snippets API) Bayoglu B, Akdeniz G, Kocabasoglu N, Poyraz CA, Dirican A, Cengiz M.
Show Full Abstract

<title>Abstract</title> <p>Background: Neuronal growth regulator 1 (NEGR1) is a cell adhesion molecule involved in neuronal development and has been identified as a genetic risk locus for major depressive disorder (MDD). However, its functional role and clinical relevance in MDD remain unclear. This study aimed to evaluate circulating NEGR1 levels and their association with depressive symptom severity, and to explore the in vitro effects of fluoxetine on NEGR1 expression. <h4>Methods:</h4> In this case–control study, peripheral blood mononuclear cells (PBMCs) were obtained from 40 drug-naïve patients with MDD and 40 healthy controls. NEGR1 mRNA expression was quantified using quantitative real-time PCR. Circulating NEGR1 protein levels were measured in plasma by ELISA. PBMC cultures were treated with fluoxetine in vitro to assess its effect on NEGR1 expression. Depressive symptom severity was evaluated using the Hamilton Depression Rating Scale and Beck Depression Inventory. <h4>Results:</h4> Circulating NEGR1 protein levels were significantly higher in patients with MDD than in controls (p = 0.01). NEGR1 levels showed a positive correlation with Beck Depression Inventory scores (r = 0.33, p = 0.036). No significant differences were observed in PBMC NEGR1 mRNA expression between groups, and fluoxetine treatment did not significantly affect NEGR1 expression in vitro (p > 0.05). <h4>Conclusion:</h4> Elevated circulating NEGR1 protein levels are associated with MDD and correlate with symptom severity. These findings suggest that NEGR1 may represent a potential peripheral biomarker candidate for MDD, independent of pharmacological treatment effects.</p>

bioRxiv 2026-05-12 Preprint (No Snippets API) Belgrad J, Summers A, Hildebrand S, Sapp E, Luu E, Yamada N, O’Reilly D, Vogt TF, Howland D, Yang XW, DiFiglia M, Aronin N, Khvorova A.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington’s disease (HD) is a neurodegenerative disorder caused by CAG repeat expansion in the huntingtin (HTT) gene, with longer repeats linked to earlier onset. Somatic CAG expansion, particularly in the striatum, contributes to disease progression and is influenced by HTT biology and genetic modifiers. Modulating somatic expansion is emerging as a promising approach to slow or prevent HD, and mouse models have been crucial for preclinical testing of different therapeutic strategies. The BAC-CAG model, developed on the FVB strain, has been used to study somatic expansion of human expanded HTT. However, comparisons with other key HD mouse models have been limited by differences in genetic background, as many other models are on the C57BL/6 strain. The BAC-CAG model has now been developed on a C57BL/6 background. To determine whether the C57BL/6 BAC-CAG model can be used to study and modulate somatic expansion, we compared CAG expansion in mice on C57BL/6 or FVB backgrounds, with and without intraventricular divalent small interfering RNAs (siRNA) targeting HD modifiers MutS homolog 3 (MSH3) and HTT. Both strains exhibited robust, comparable somatic expansion over two months, which was blocked by MSH3-, but not HTT-, targeted siRNA. RNA sequencing identified gene expression differences primarily in pseudogenes, with no differences in endogenous Htt , human HTT , or mismatch repair genes. These results demonstrate that BAC-CAG mice on a C57BL/6 background exhibit somatic CAG expansion comparable to the validated FVB strain, providing a model to study and preclinically test therapies targeting somatic expansion in HD.

medRxiv 2026-05-12 Preprint (No Snippets API) Cullen H, Clarkson C, Nascimento H, Zanovello M, Long J, Caulfield M, Simpson M, Tabrizi SJ, Tucci A.
Show Full Abstract

Huntington’s disease is caused by a CAG repeat expansion in the Huntingtin gene ( HTT ) above a pathogenic threshold; however, the biological consequences of repeat-length variation below this threshold remain poorly understood. Using whole-genome sequencing and linked phenotypic data from UK Biobank participants, we show that repeat-length variation within the normal and intermediate range is associated with measurable differences in brain volume, neuropsychiatric risk, and cognitive processing, and that only one third of pathogenic allele carriers have a recorded clinical diagnosis. Analyses were performed in 474,446 UK Biobank participants, including 30,052 with intermediate repeats (27 – 35), 873 with reduced-penetrance repeats (36 – 39), and 155 with pathogenic repeats (≥40); 48,378 individuals had structural MRI. For quantitative phenotypes (brain volumes and cognition), associations with continuous repeat length were modelled using linear regression within the normal and intermediate range (≤35 repeats); deviation at ≥36 repeats was defined as departure from the extrapolated linear trend. For clinical outcomes (depression, anxiety, dementia, and delirium), repeat length was analysed categorically using Kaplan–Meier and Cox proportional hazards models with age as the timescale. Within the normal and intermediate range, longer HTT CAG repeat length was associated with smaller subcortical and global brain volumes, including the accumbens, putamen, thalamus, hippocampus, and total grey and white matter, with effects amplified in older individuals. Intermediate alleles were associated with an increase in age-dependent depression risk (HR = 1.05, 95% CI 1.02 – 1.10) and longer repeat length within the normal and intermediate range predicted faster reaction time, a pattern that reversed sharply at pathogenic lengths. Among carriers of 40–41 CAG repeats, only 42% (95% CI 19–59%) had received a recorded Huntington’s disease diagnosis by age 84; however, the majority of pathogenic allele carriers who underwent neuroimaging met biomarker criteria for Stage 1 disease, indicating that early neurodegeneration is present in these individuals. This work challenges the current understanding of the HTT CAG repeat length as a purely categorical determinant of monogenic disease and shows that repeat length acts as a quantitative modifier of brain structure and neuropsychiatric vulnerability across the population. These findings have implications for risk prediction, penetrance estimation, and the interpretation of repeat variation in population genomics.

HFE
Also flagged:Ironcongenital anemiaDeferasiroxdeferoxamineanemiascongenital disorder
Journal Article 2026-05-11 ✓ 1 Snippet Torchio F, Lecalvez B, Garelli E, Mallebranche C, Carando A, Castex MP, Garnier N, Zecca M, Aladjidi N, Bertoni E, Sterin A, Licciardello M, Sirvent A, Sau A, Marie I, Bruno B, Da Costa LM, Fagioli F, Quarello P, Leblanc T.
In-Text Gene Mentions

…Over time, secondaryhemochromatosisremains one of…

Show Full Abstract

Diamond-Blackfan Anemia Syndrome (DBAS) is a rare congenital anemia often requiring chronic red blood cell transfusions from infancy. Without appropriate chelation, iron overload develops early and may be severe; however, no data are available on chelation in patients under 3 years of age. To address this, we conducted a retrospective, multicenter study collecting data from the French and Italian DBAS national registries. A total of 167 transfused DBAS patients were screened. Of these, 64 (38%) initiated chelation before the age of three (median: 18 months). Indications for chelation were a serum ferritin ≥ 500 ng/mL (median: 1340 ng/mL) and more than 10 transfusions. Deferasirox was the most frequently used chelator (63%), followed by deferoxamine (35%). Chelation was associated with a significant reduction in serum ferritin levels (-11% per year; p < 0.001). At 5-6 years of age, ferritin level was available for 28 patients: 43% had levels < 500 ng/mL, and none exceeded 2000 ng/mL. Liver iron concentration was assessed in 31/64 patients (48%) at a median age of 3.2 years; 45% showed severe overload at first evaluation. Among 22 patients who underwent cardiac magnetic resonance, no myocardial iron overload was detected. These real-world data support the feasibility, tolerability, and effectiveness of chelation in transfusion-dependent DBAS patients under 3 years, allowing prevention of cardiac iron overload. Although derived from DBAS, these findings may inform the management of iron overload in infants and toddlers with other transfusion-dependent anemias and support development of age-specific chelation strategies.

HTT
Also flagged:Huntington's diseaseautosomal dominant hereditary diseaseHDGene expressionmetabolismautosomal dominant neurodegenerative disorder
Journal Article 2026-05-11 ✓ 5 Snippets Rysankova I, Sekac D, Hansikova H, Kepkova KV, Vodicka P, Vaskovicova M, Altmanova M, Juhas S, Juhasova J, Taborska E, Klempir J, Motlik J, Klima J, Eide L, Ellederova Z.
In-Text Gene Mentions

…encoding the huntingtin (HTT) protein.…

…the huntingtin (HTT) gene on…

…production of mutantHTT(mHTT ) protein…

…fragment of humanHTT(N548), with 124…

…of the humanHTTpromoter and exhibits…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative autosomal dominant hereditary disease caused by a CAG triplet repeat expansion mutation in the gene encoding the huntingtin (HTT) protein. The main feature of HD is the loss of striatal neurons, accompanied by metabolic and transcriptional alterations in both neural and peripheral tissues. Induced pluripotent stem cells (iPSCs) derived from a transgenic HD (TgHD) minipig model expressing a mutant HTT construct were generated to investigate early metabolic, antioxidant and DNA integrity changes associated with HD development. Gene expression analysis showed increased expression of vascular endothelial growth factor (VEGF), pyruvate dehydrogenase kinase 1 (PDK1) and glutamine-oxaloacetic transaminase 1 (GOT1), implying early metabolic alteration in TgHD iPSCs. Moreover, upregulated FANCD2/FANCI-associated nuclease 1 (FAN1) expression indicated genotoxic stress linked to early HD development. These findings suggest metabolic shifts and putative genotoxic events in the pluripotent stem cell state of the TgHD model and point to early effect of the HD mutation. The model may be suitable for evaluating potential cell therapy and in vitro differentiation of iPSCs to neurons and other cells affected in HD.

Also flagged:aseptic meningitisviral meningitismeningitisencephalitisviral infectionscentral
Journal Article 2026-05-11 No Snippets Chabrolles H, Gaume L, Pereira B, Lafolie J, Gueirard P, L'Honneur AS, Adam MN, Nathanson S, Marque-Juillet S, Madhi F, Verdan M, Guitteny MA, Lagathu G, Bailly J-L, Henquell C, Archimbaud C, Blood Enterovirus Diagnosis Infection (BLEDI) Group in the Pediatric Population Study Team.
Show Full Abstract

Enteroviruses (EVs) are the most frequent cause of pediatric aseptic meningitis, and cause neurological complications, such as encephalitis and flaccid paralysis. Our aim was to characterize the age-specific cytokine and chemokine response profiles in the cerebrospinal fluid (CSF) and blood of neonates, infants, and children with enterovirus meningitis. We performed an ancillary study to the French multicenter BLEDI study. We selected 163 patients with confirmed EV or suspected meningitis. Demographic, clinical, and laboratory data were analyzed. Twenty-seven cytokine/chemokines were simultaneously quantified in the CSF and plasma of the patients, using a bio-plex multiplex immunoassay. Cytokine-chemokine expression increased in the CSF with the age of EV patients compared with controls: CSF IP-10, IL-6, and IL-1ra increased 13-, 11-, 5-fold, respectively, in neonates, 41-, 53-, and 20-fold in infants, and 52-, 168-, and 69-fold in children. In plasma, cytokine/chemokines were overexpressed in neonates and downregulated in children, compared with their respective controls: plasma MCP-1, IP-10, and IL-1ra increased 10-fold in neonates, and decreased threefold in children. The expression of cytokine/chemokines varied with CSF pleocytosis but not with EV types and viral load. These findings show that cytokine and chemokine responses during EV meningitis are strongly age-dependent and should be interpreted according to patient age, with neonates, infants, and children being considered separately. Our results also indicate that age stratification is essential in future studies aiming to evaluate cytokines and chemokines as biomarkers of disease severity in EV-associated neurological infections.IMPORTANCEAlthough enteroviruses (EVs) are the main cause of pediatric viral meningitis, the age-specific immune response to infection remains poorly understood. Our work is novel in combining the study of paired biological compartments (cerebrospinal fluid [CSF] and plasma), age stratification, pleocytosis status, viral load, and EV genotype, which allows a comprehensive assessment of how age shapes both local and systemic immune responses during EV meningitis. This study shows that the immunological response to EV meningitis in CSF and plasma evolves with the age of the patients. The expression of cytokines/chemokines varied with CSF pleocytosis but not with EV types and viral load. Our findings highlight that neonatal EV meningitis is associated with distinct immunopathogenic features that reflect age-dependent immune responses. These results indicate that age stratification is essential in future studies aiming to evaluate cytokines and chemokines as biomarkers of disease severity in EV-associated neurological infections.

Also flagged:COVID-19-19deathinfectionzika fevertuberculosis
Journal Article 2026-05-11 No Snippets Freitas EL, Erbisti RS, Grinberg-Weller B, Pinto DCC, Miranda ES.
Show Full Abstract

The COVID-19 pandemic had a significant impact on Brazil, although its effects were not homogeneous across the country. Socioeconomic disparities may influence epidemiological patterns during health emergencies, which impact population mental health. This study aimed to analyze the consumption of psychoactive medicines during the COVID-19 pandemic in Brazil and to characterize its spatiotemporal dynamics, identifying associated social, economic, and demographic factors. We used publicly available retail pharmacies dispensing data from January 2018 to September 2021 across Brazil's municipalities. A statistical model was developed based on indicators of infrastructure, human capital, and labor and income. Generalized additive models were used to characterize the spatiotemporal distribution of drug consumption. In September 2021, average consumption in municipalities reporting COVID-19-related deaths was 22% higher than in municipalities with no reported deaths. Among the most frequently consumed medicines during the study period, second-generation antidepressants were predominant. Life expectancy, employment and education showed positive linear associations with consumption, whereas inadequate water supply and sanitation were inversely associated. Municipality income was positively associated with average consumption of psychoactive medicines, but those with a very high-income development index showed more complex dynamics. Our results suggest that COVID-19 mortality was associated with psychotropic medicines consumption and indicate the need to address socioeconomic vulnerability as a key component of public health emergency response. The COVID-19 pandemic had a significant impact on Brazil, although its effects were not homogeneous across the country. Socioeconomic disparities may influence epidemiological patterns during health emergencies, impacting population mental health. This study aimed to analyze the consumption of psychoactive medicines during the COVID-19 pandemic in Brazil and to characterize its spatiotemporal dynamics, identifying associated social, economic, and demographic factors. We used publicly available data from retail pharmacy dispensing from January 2018 to September 2021 across Brazilian municipalities. A statistical model was developed based on indicators of infrastructure, human capital, labor, and income. Generalized additive models were used to characterize the spatiotemporal distribution of drug consumption. In September 2021, average consumption in municipalities reporting COVID-19-related deaths was 22% higher than in municipalities with no reported deaths. Among the most frequently consumed medicines during the study period, second-generation antidepressants were predominant. Life expectancy, employment, and education showed positive linear associations with consumption, whereas inadequate water supply and sanitation were inversely associated. Municipality income was positively associated with the average consumption of psychoactive medicines, but those with a very high human development index for income showed more complex dynamics. Our results suggest that COVID-19 mortality was associated with psychotropic medicine consumption and indicate the need to address socioeconomic vulnerability as a key component of public health emergency responses.

LRRC7
Also flagged:envelopeenzyme activitieshatchingreproductionchromosomemembrane
Journal Article 2026-05-11 ✓ 1 Snippet Ma C, Sangdehi FM, Kawaguchi M, Sano K, Dannenberg SV, Pettersson ME, Wallberg A, Wort JL, Yan Y, Moshkovskii S, Berg F, Folkvord A, Lenz C, Urlaub H, Kaupp UB, Yasumasu S, Andersson L.
In-Text Gene Mentions

…encoded by theleucin-rich repeat-containing protein 8repeat-containing protein 8…

Show Full Abstract

How species genetically adapt to new environments is a central question in evolutionary biology. Here whole-genome sequencing combined with functional analysis is used to dissect how Atlantic herring, a marine fish, has adapted to the brackish Baltic Sea. Genes involved in reproduction and early development emerge as primary targets of natural selection, with key changes in a sperm-specific anion channel (<i>LRRC8C2</i>), a zona pellucida protein (<i>ZPBA1</i>), a cluster of three genes for fish transglutaminase (<i>FTG1-3</i>), and a copy number expansion of a fish hatching enzyme gene (<i>HE1C</i>). The large diameter of LRRC8C2 homomers facilitates transport of ions and osmolytes, likely preventing swelling of sperm when spawning in low salinity. Altered ZPBA1 sequence together with modified FTG1-3 enzyme activity produces a harder egg envelope that prevents egg swelling in brackish waters, while the enhanced activity of the adapted HE1C enzyme enables larvae to digest this reinforced egg envelope during hatching. Baltic Sea herring populations reproducing in brackish water are fixed or nearly fixed for variant alleles at these four unlinked loci, each carrying multiple amino acid substitutions compared to the alleles prevalent in the Atlantic Ocean populations. The alleles at two of these loci (<i>FTG1-3,</i> and <i>HE1C</i>) have been introgressed from the sister species Pacific herring. These findings reveal concrete molecular mechanisms by which a marine species has adapted to a novel, low-salinity environment.

GPR52ABT1
Also flagged:methylationneuropsychiatric disordersgene expressionmajor depressive disorderhippocampal atrophyneurodegenerative disorders
Journal Article 2026-05-11 ✓ 5 Snippets Liu D, Talevi V, Tavares JF, Wang R, Imtiaz MA, Melas K, Teumer A, Wittfeld K, Hillary RF, Vojinovic D, Beekman M, Armstrong NJ, Estrada S, Völzke H, Bülow R, Royle NA, Wardlaw JM, Wen W, Sachdev PS, Mather KA, Slagboom PE, Cox SR, Grabe HJ, Yang Q, Aziz NA, Breteler MMB.
In-Text Gene Mentions

…expression of theABT1gene was associated…

…reduced expression ofABT1, a gene…

…its target geneGPR52, while methylation…

…the expression ofABT1(activator of basal…

…expression of ABT1 (activator of basal transcription 1of basal transcription…

Show Full Abstract

<h4>Background</h4>Left-right hippocampal volumetric asymmetry and atrophy are implicated in neurodegenerative and neuropsychiatric disorders, yet their molecular basis in healthy adults remains poorly understood.<h4>Methods</h4>We conducted a meta-analysis of epigenome-wide association studies across six population-based cohorts (n = 8156; 53% women; mean age = 60.7 years) to identify DNA methylation signatures associated with left and right hippocampal volumes (LHCV, RHCV) and hippocampal asymmetry (i.e, differences between left and right volumes divided by their sums).<h4>Findings</h4>We identified five CpGs and 262 differentially methylated regions associated with LHCV, nine CpGs and 246 regions with RHCV, one CpG and 16 regions with asymmetry. Cross-omics integration uncovered 15 LHCV-related and 13 RHCV-related methylation-gene expression pairs, with five overlapping genes primarily involved in immune regulation. LHCV-specific genes were involved in cellular signalling, and Mendelian randomisation (MR) analyses supported a potential causal association between brain expression of DIP2C and increased risk of major depressive disorder. RHCV-specific genes were involved in neuronal differentiation pathways, with MR analyses suggesting that brain-tissue expression of BAIAP2, MACF1, SLC16A5, and CORO1B was associated with neuropsychiatric disorders. We also identified sex-specific patterns with hippocampal asymmetry. Notably, baseline methylation at these sites predicted hippocampal atrophy rates, explaining >10% of the variation. Associations with multiple healthy dietary patterns suggest modifiable influences on hippocampal structure.<h4>Interpretation</h4>These findings highlight distinct methylation profiles as potential biomarkers or therapeutic targets for neuropsychiatric and neurodegenerative conditions.<h4>Funding</h4>Institutional funds, Federal Ministry of Education and Research of Germany, Alzheimer's Association.

PTGIS
Also flagged:pulmonary hypertensionPHpulmonary arterial hypertensionpulmonary hypertension associated with pulmonary fibrosisangiogenesisantigen presentation
Journal Article 2026-05-11 ✓ 5 Snippets Lins T, Valzano F, Fließer E, Borek I, Crnkovic S, Morley M, Basil MC, Katzen J, Cantu E, Schupp JC, Kneidinger N, Lindenmann J, Aigner C, Benazzo A, Morrisey EE, Bartkuhn M, Marsh LM, Birnhuber A, Kwapiszewska G.
In-Text Gene Mentions

…GATA6, NPR1, ANXA3,PTGIS, CXCL8 and FOXC1…

…were enriched inPTGIS, PDE3A ,…

…ACKR1 + ,PTGIS+ , and…

…of the ACKR1,PTGISand PRX-positive ECs…

…scular tone modulatory (SULF1/PTGIS), and vascular plasticity…

Show Full Abstract

The physiological state of endothelial cells (ECs) is a central determinant of organ health. Distinct endothelial phenotypes and transcriptional programs are linked to vessel size and anatomical location, but it remains unclear how this intrinsic heterogeneity is organized within a particular niche. We performed compartment-specific single-cell profiling of human pulmonary artery (PA) ECs from healthy donors and from patients with two clinically divergent forms of pulmonary hypertension (PH): pulmonary arterial hypertension (PAH) and pulmonary hypertension associated with pulmonary fibrosis (PH-PF). We identified and localized three major EC subsets in healthy and remodeled PAs termed immuno-, vascular tone- and vascular plasticity modulatory, reflecting their enrichment for distinct biological processes. Expression signatures defining each subset were shared with other arterial beds, including the aorta and coronary arteries, and murine PA. Both PAH and PH-PF altered PAEC subset compositions, with increased immunomodulatory and decreased vascular plasticity modulatory PAECs. PH-PF PAECs were generally defined by dysregulated angiogenesis and antigen presentation, whereas PAH PAECs exhibited lipid metabolic dysfunction and enhanced vasoregulatory signaling. By uncovering endothelial heterogeneity and pathology-specific transcriptional programs in PAs, this study underscores the need of disease-specific therapeutic targeting.

LRRC7
Also flagged:cell divisioninterphasechromatinchromosomesspindlechromosome
Journal Article 2026-05-11 ✓ 5 Snippets Nielsen CF, Witt H, Ridolfi A, Kempers B, Chameau EMJ, van der Smagt S, Sitz J, Barisic M, Peterman EJG, Wuite GJL, Hickson ID.
In-Text Gene Mentions

Condensincomplexes drive many…

…function of bothCondensinsduring mitosis appears…

…chromosomes in mitosis,Condensincomplexes are suggested…

…been proposed thatCondensincomplexes form nested…

…depletion of bothCondensinsfrom human cells…

Show Full Abstract

During mitotic cell division, pliable interphase chromatin is transformed into stiff mitotic chromosomes able to withstand the pushing and pulling forces of the mitotic spindle. How the cell establishes this chromosome stiffness and the cellular consequences if this stiffness is disrupted, is unclear. Condensin complexes drive many of the structural changes in mitotic chromosomes. Here, we combine rapid protein depletion of Condensins I and II with live cell imaging and mechanical characterization of purified mitotic chromosomes to probe their role in mitotic chromosome mechanics. We show that Condensin I, but not Condensin II, is required to establish chromosome stiffness and chromatin elasticity, and yet is not required for maintaining these properties after chromosome formation. Nevertheless, metaphase depletion of Condensin I still leads to severe sister centromere cohesion defects. We propose that the chromatin loop network established by Condensin I is locked in place by an additional 'crosslinking' factor.

HTT
Also flagged:Pneurodegenerative diseasesmembrane-lessorganellesfibrilsP-granules
Journal Article 2026-05-11 ✓ 2 Snippets Weinberg B, Guo Z, Tang R, Ao J, Yin J, Ding G, Blute TA, Savini M, Chiesa G, Wang W, Good M, Wang MC, Cheng JX.
In-Text Gene Mentions

…of condensates andHttaggregation in situ…

…the formation ofHttaggregates within the…

Show Full Abstract

Protein assemblies, including aggregates and condensates, are closely linked to health and diseases. We demonstrate boxcar-enhanced Fluorescence-detected mid-Infrared photothermaL Microscopy (FILM), using two model species, Caenorhabditis elegans and Saccharomyces cerevisiae, to quantitatively resolve these protein states in vivo by imaging β-sheet and α-helix secondary structures and analyzing their ratios. This method directly distinguishes polyglutamine (PolyQ) protein aggregates, α-synuclein protein condensates, and P-granule condensates implicated in neurodegenerative diseases and embryonic development in live organisms. It further enables the unraveling of protein assembly dynamics and their physio-pathological roles, such as age-related progression of PolyQ from condensates to aggregates.

PRDX6
Also flagged:bindingsignal transductioncentrosomeribosomecell cyclepathogenesis
Journal Article 2026-05-11 ✓ 1 Snippet Liao Z, Zhao C, Wang L, Liu W, Teng J, Xie W, Ouyang J, Yao C, Huan Q, Lei X, Fu Y, Zhou B, Jiang X, Ren C.
In-Text Gene Mentions

…promote peroxiredoxin 6 (PRDX6) transcription, thereby promo…

Show Full Abstract

Human pluripotent stem cells (hPSCs) present considerable potential for regenerative medicine; however, the standardization and large-scale production of these cells are hindered by an incomplete understanding of the molecular mechanisms governing self-renewal. The long non-coding RNA ESRG is integral to maintaining hPSC self-renewal, with its depletion leading to reduced levels of nucleophosmin 1 (NPM1) protein, thereby compromising the self-renewal capacity of hPSCs. Mechanistically, ESRG physically interacts with NPM1, and a reduction in ESRG/NPM1 expression results in elevated bone morphogenetic protein 4 (BMP4) levels and decreased polypyrimidine tract-binding protein 1 (PTBP1) levels, which in turn destabilize TGF-β1 mRNA and attenuate TGF-β signaling activity. Notably, treatment with the TGF-β agonist SRI-011381 partially rescues the self-renewal defects caused by ESRG or NPM1 knockdown. Collectively, our findings elucidate that the ESRG-NPM1-BMP4-PTBP1 axis governs hPSC self-renewal by post-transcriptionally regulating TGF-β1 mRNA stability and sustaining TGF-β signaling. This study enhances the understanding of the molecular regulatory network underlying hPSC self-renewal maintenance and validates ESRG as a promising target for improving the in vitro expansion of hPSCs.

HFE
Also flagged:mixed histiocytosisErdheim-Chester diseaseLangerhans cell histiocytosisanemiahistiocytic disordersmyeloid disorder
Journal Article 2026-05-11 ✓ 4 Snippets Buianova AA, Gaydina TA, Reznik EV, Iarovoi MD, Kuznetsova AA, Belova VA, Ignatyuk MA, Shatalov PA, Repinskaia ZA, Shinkarina AP, Volodkin AV, Atiakshin DA, Korostin DO.
In-Text Gene Mentions

…hereditary anemia andhemochromatosis.…

…overload disorder afterHFE-hemochromatosis.…

…overload disorder after HFE-hemochromatosis.…

…similar to classicalhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Mixed histiocytosis (MH), the coexistence of two or more histiocytic disorders in the same patient, is rare and poorly understood. Langerhans cell histiocytosis (LCH) is a clonal myeloid disorder characterized by infiltration of pathological antigen-presenting cells with morphological and phenotypic resemblance to Langerhans cells. Activating mutations of the MAPK/ERK signaling cascade represent the principal driver of LCH pathogenesis and are also central to Erdheim-Chester disease (ECD).<h4>Methods</h4>We present a 34-year-old patient diagnosed with a mixed form of LCH and ECD involving the kidneys, skin, bones, ENT organs, eyes, and central nervous system. The clinical phenotype included diabetes insipidus, chronic otitis externa, and suspected hereditary anemia and hemochromatosis. Tissue samples were examined using histochemical, immunohistochemical, and immunofluorescence methods, along with whole-exome sequencing (WES) of blood and skin. The patient demonstrated a partial clinical and laboratory response to targeted therapy with trametinib and desmopressin.<h4>Results</h4>Comparison of WES data from blood and skin revealed 71,953 shared variants consistent with likely germline origin, 3,081 somatic variants in skin, and 2,633 in blood. A low-level mosaic BRAF V600E mutation (variant allele frequency 1%) was identified in skin, in addition to pathogenic germline variants in STEAP3 (c.523-2 A > T, NM_182915.3) and SLC40A1 (c.332T > A, p.Met111Lys, NM_014585.6). Immunofluorescence of bone marrow trephine biopsy demonstrated heterogeneous cellular populations: sparse tryptase-positive mast cells with minimal intercellular contacts; Vimentin<sup>+</sup>CD11b<sup>-</sup>CD34<sup>+</sup> (0.68%) and Vimentin<sup>+</sup>CD11b<sup>+</sup>CD34<sup>-</sup> (7.78%) stromal subsets; and a predominance of CD68<sup>+</sup> cells (55.61%) over S100<sup>+</sup> cells (43.02%). Double-positive CD68<sup>+</sup>S100<sup>+</sup> cells were infrequent (2.174%), consistent with transitional stages of Langerhans cells toward LCH cells (up to 4.81%). This hybrid microenvironment paralleled the patient's systemic inflammatory activity (elevated acute-phase reactants), multi-organ involvement, and renal interstitial fibrosis/tubular atrophy with impaired kidney function, without serological or histological evidence of vasculitis.<h4>Conclusion</h4>This case illustrates the histological heterogeneity and hybrid nature of MH, where canonical dendritic LCH cells coexist with macrophage-rich ECD-like infiltrate. An integrated approach involving a multidisciplinary clinical team, thorough molecular genetic testing, and the application of targeted therapy is essential for improving prognosis and quality of life in young patients.

HFE
Also flagged:Non-alcoholic fatty liver diseaseNAFLDmetabolic dysfunction-associated fatty liver diseasechronic liver disorderobesityinsulin resistance
Journal Article 2026-05-11 ✓ 1 Snippet El Shebini SM, Youness ER, Ahmed NH, Orban HA, Mohamed RA, Moaty MIA.
In-Text Gene Mentions

…IL-1β, and theHFEgene, have been…

Show Full Abstract

<h4>Background</h4>Metabolic dysfunction-associated fatty liver disease (MAFLD) is closely linked to metabolic abnormalities, including central obesity, dyslipidaemia, hypertension, hyperglycaemia, and impaired liver function. Identifying effective lifestyle interventions and reliable noninvasive biomarkers remains a public health priority.<h4>Objective</h4>This study aimed to evaluate the effect of dietary modification on metabolic and hepatic parameters in women with MAFLD and to assess the potential role of interleukin-18 (IL-18) and alpha-2-macroglobulin (A2M) as noninvasive biomarkers.<h4>Methods</h4>A prospective interventional study was conducted on 54 women with obesity and at least one criterion of metabolic syndrome. Participants were categorized into mild MAFLD, moderate MAFLD, or healthy liver groups based on ultrasonographic findings. All participants followed a calorie-restricted, balanced diet (1000-1200 kcal/day) for eight weeks. Anthropometric measurements, 24-hour dietary recall, and biochemical parameters, including IL-18, A2M, and liver enzymes, were assessed at baseline and post-intervention.<h4>Results</h4>At baseline, women with moderate MAFLD exhibited significantly higher body mass index (BMI), minimal waist circumference (MWC), low-density lipoprotein cholesterol (LDL-C), and LDL/HDL ratio, along with lower high-density lipoprotein cholesterol (HDL-C), reflecting an adverse metabolic profile. They also reported higher macronutrient intake and lower dietary fiber consumption. A strong positive correlation between IL-18 and A2M (p ≤ 0.01) was observed across all groups and was associated with an unfavorable metabolic status. Following the intervention, significant improvements (p ≤ 0.05) were observed in weight, BMI, MWC, LDL-C, and gamma-glutamyl transferase (GGT), along with increased HDL-C levels. A highly significant reduction (p ≤ 0.01) in IL-18 was observed only among participants with MAFLD, while A2M levels decreased significantly (p ≤ 0.05-0.01) across all groups.<h4>Concluions</h4>A calorie-restricted, balanced diet significantly improves metabolic and hepatic parameters in women with MAFLD. These findings highlight the beneficial impact of dietary intervention on liver enzymes and inflammatory markers, particularly GGT, IL-18, and A2M, and support the potential utility of A2M as a noninvasive biomarker and therapeutic target.

DCC
Also flagged:major depressive disorderpathogenesis
Journal Article 2026-05-11 ✓ 1 Snippet Li S, Liu A, Jiang H, Ying Z.
In-Text Gene Mentions

…key genes (e.g.,DCCand TCF4) implicated…

Show Full Abstract

<h4>Background</h4>Multisite chronic pain (MCP) and major depressive disorder (MDD) exhibit significant clinical relevance. However, the central nervous system comorbidity mechanism and the shared genetic risk mechanisms remain poorly elucidated. This study aims to systematically investigate the neurobiological and genetic correlation features between MCP and MDD.<h4>Method</h4>Leveraging a multidimensional genetic framework, we integrated GWAS data for MCP (UK Biobank, UKB), MDD (Psychiatric Genomics Consortium, PGC), and ENIGMA neuroimaging data to investigate their genetic-neurobiological interplay. Initially, genome-wide genetic correlations were evaluated using Linkage Disequilibrium Score Regression (LDSC). Next, the GWAS Pairwise (GWAS-PW) method was employed to identify local genetic association regions, complemented by functional annotation through the FUMA platform. Lastly, Mendelian randomization (MR) mediation models were applied to explore the mediating effects of brain structure.<h4>Result</h4>LDSC analysis revealed a significant genetic correlation between MCP and MDD (rg = 0.53, P = 4.1 ×10<sup>-45</sup>). GWAS-PW method identified 18 genomic regions associated with both MCP and MDD. FUMA functional annotation prioritized seven key genes (e.g., DCC and TCF4) implicated in neurodevelopmental and synaptic regulation pathways. Additionally, mendelian mediation analysis of specific brain regions, such as the isthmus cingulate cortex, play a mediating role in the comorbid pathogenesis of MCP and MDD.<h4>Conclusion</h4>This study revealed that MCP-MDD comorbidity arises from genome-wide shared neurodevelopmental loci, structural abnormalities, and dysregulated coordination among the default mode, central executive, and sensorimotor networks, collectively forming its neurobiological basis.

Also flagged:synthesis
Journal Article 2026-05-11 No Snippets Roy S, Mandal B.
Show Full Abstract

Amide and ester bond formation is crucial in medicinal chemistry and relies heavily on coupling reagents in both academic and industry. We report the development of new cost-effective recyclable benzotriazole-sulfonate coupling reagents in a straightforward, rapid, and easy manner. The reagents efficiently activate carboxylic acids to form amides, esters, thioesters, and peptides, with excellent yields and high chirality retention. The reagent enables drug modifications and transformations, including aldoxime-to-nitrile and carboxylic acid-to-ketone conversions. The use of green solvents effectively minimizes the environmental impact.

TRIM38
Also flagged:COPDChronic Obstructive Lung Diseaseemphysemagene expressionChronic bronchitisairflow
Journal Article 2026-05-11 ✓ 3 Snippets Cáceres A, Agustí A, López-Pleguezuelos C, Franch-Martínez B, Sarrat-González D, Faner R, González JR.
In-Text Gene Mentions

…containing 38 (TRIM38) gene (p=6.6×10…

…Notably,TRIM38, a gene…

…loci such as <i>TRIM38</i> and <i>IFIT3</i>, and…

Show Full Abstract

<h4>Background</h4>COPD is a heterogeneous condition characterised by persistent, poorly reversible airflow obstruction. While some patients experience accelerated decline in forced expiratory volume in 1 s (FEV<sub>1</sub>), others remain stable. We hypothesised that unsupervised analysis of chest computed tomography (CT) scans using machine learning-derived radiomic features may identify endophenotypes associated with distinct clinical and biological characteristics and FEV<sub>1</sub> decline trajectories.<h4>Methods</h4>We analysed 101 radiomic features from 1759 chest CT scans of COPD patients in the ECLIPSE study. Unsupervised consensus clustering identified six mutually exclusive radiomic clusters, and we derived six corresponding average patient score clusters (APSC1-6). Random coefficient models assessed associations between each APSC and baseline clinical characteristics, FEV<sub>1</sub> and its 3-year change, adjusting for relevant covariates. Associations with baseline gene expression in sputum and blood were also evaluated.<h4>Results</h4>Radiomic scores were associated with multiple baseline clinical features. Higher APSC2 (-5.3 mL·year<sup>-1</sup>; 95% CI -9.5- -1.0; p=0.01) and APSC6 (-5.5 mL·year<sup>-1</sup>; 95% CI -9.6- -1.3; p=0.01) predicted greater FEV<sub>1</sub> decline, whereas higher APSC3 was associated with slower decline (+5.2 mL·year<sup>-1</sup>; 95% CI 0.8-9.6; p=0.02). APSC6 was associated with increased sputum expression of genes enriched in respiratory infection pathways, relevant COPD loci such as <i>TRIM38</i> and <i>IFIT3</i>, and higher blood neutrophil counts.<h4>Conclusions</h4>Unsupervised CT radiomic analysis identifies distinct COPD endophenotypes associated with variability in FEV<sub>1</sub> decline and biological markers, supporting potential stratified treatment.

DCC
Also flagged:urogenitalrenal agenesishydropsVermian hypoplasiaDandy Walker malformationcerebral disorders
Journal Article 2026-05-11 ✓ 5 Snippets Chretien M, Osouf J, Abel C, Afenjar A, Attie-Bitach T, Brischoux-Boucher E, Burglen L, Calmels N, Chassaing N, Courtin T, Delanne J, Doco-Fenzy M, Dubourg C, Durand B, Chehadeh SE, Faivre L, Garde A, Ginglinger E, Haushalter V, Haye D, Heide S, Heidet L, Heron D, Jacquin C, Lambert L, Lamouche JB, Laugel V, Bechec AL, Lehalle D, Michel-Calemard L, Ramirez EM, Muller J, Odent S, Patat O, Piard J, Poirsier C, Putoux A, Quelin C, Racine C, Sananes N, Schalk A, Scheidecker S, Thauvin-Robinet C, Valence S, Weingertner AS, Wourms J, Dollfus H, Gerard B, Schluth-Bolard C, Schaefer E.
In-Text Gene Mentions

…, CREBBP ,DCCand CHRNG genes)…

…, THSD1 andDCCgenes) were identified…

…asymptomatic parent (DCC, PKD1 ).…

…the ARID1B andDCCgenes, suggesting a…

…variant in theDCCgene (Mirror movements…

Show Full Abstract

<h4>Objective</h4>This study is an example of the contribution of exome sequencing (ES) in selected prenatal indications, while illustrating the complexity of interpreting prenatal genetic testing. Therefore, one of the aims of this study was to better describe antenatal phenotypes.<h4>Methods</h4>This was a multicenter, comparative, prospective study assessing high-throughput sequencing performance (targeted gene panel <i>versus</i> exome sequencing) in selected prenatal indications.<h4>Results</h4>Trio-ES was performed on 86 fetuses, allowed making a definite etiological diagnosis in 28% of cases (24/86). One-third of diagnoses were obtained only after exome analysis (8/24, 33%). The diagnostic yield varied according to the indication and was the highest for vermian hypoplasia (5/12, 42%) and polymalformative syndromes (30%, 8/27) indications. The variants identified were mainly missense variants in ciliopathy (18%, 6/33) and cytoskeleton (15%, 5/33) genes. Among the etiological diagnoses, one fetus carried a postzygotic mosaic variant in <i>RHOA</i>.<h4>Conclusion</h4>In selected indications, the diagnostic yield of ES was close to 30% and varied according to the indications, showing the importance of clearly define the malformations justifying this approach. An etiological diagnosis was made in 23 families, within a timeframe compatible with pregnancy, thus improving the management of the pregnancy and/or the unborn child.

UNC13C
Also flagged:chromosomessynthesisbiosynthesislocalizationfolliculogenesisovulation
Journal Article 2026-05-11 ✓ 1 Snippet Chen W, Yang F, Chen Y, Liufu S, Wang K, Li Z, Ma H.
In-Text Gene Mentions

…Genes such asUNC13C, WDR72 ,…

Show Full Abstract

To unravel the genetic basis of economically critical reproductive traits in swine, we genotyped 839 sows from three commercial breeds (Duroc, Landrace, Yorkshire) using the Porcine Breeding Chip_plus 50K SNP array, and analyzed three key traits: total number born (TNB), number born alive (NBA), and number of healthy piglets (NHP). We integrated principal component analysis (PCA) for population structure, runs of homozygosity (ROH) detection, genome-wide association studies (GWAS), and GO/KEGG enrichment analysis. Phenotypically, Yorkshire sows exhibited superior and persistent reproductive capacity across parities 1-7 (peak TNB: 14.17 ± 2.82 at parity 4 based on <i>N</i> ≥ 3 data), Duroc sows had limited data with only parity 1 available (TNB: 9.44 ± 2.13), and Landrace sows showed moderate to high performance across parities 1-4 and 7, with peak TNB at parity 4 (17.08 ± 4.61). ROH analysis further revealed that short ROH fragments (1-5 Mb) were the most abundant category across breeds, while the majority of detected ROH were under 10 Mb in length. GWAS identified significant SNPs concentrated on chromosomes 1 and 2, and annotated candidate genes including <i>AMH</i> (ovarian reserve), <i>IZUMO4</i> (embryo implantation), <i>ACSBG2</i> (steroid synthesis), <i>RFX2</i> (follicular maturation), and <i>DOT1L</i> (embryonic development). GO/KEGG enrichment highlighted pathways such as "histone methyltransferase activity" and "fatty acid biosynthesis", which are critical for reproductive processes. This study clarifies breed-specific reproductive patterns and identifies key genetic loci/genes for porcine reproductive traits, providing molecular markers and a theoretical basis for improving swine reproductive performance via molecular breeding.

Also flagged:nanovesiclesvesiclesExtracellular Vesiclesmembraneextracellular spacesecretion
Journal Article 2026-05-11 No Snippets Wang X, Yuan C, Lu R.
Show Full Abstract

Plant-derived nanovesicles (PDNVs) are a class of nanoscale vesicles derived from plant tissues; they are particles with a lipid bilayer and no ability to replicate autonomously. As a type of bioactive natural nanocarrier, they demonstrate immense potential for application in 21st-century nanomedicine, skincare and nutritional health, owing to their excellent biocompatibility, low immunogenicity and targeted delivery capabilities. However, the clinical translation of PDNVs still faces key bottlenecks, including low extraction efficiency, complex purification processes, and immature engineering modification techniques. Compared to the wealth of systematic reviews in the field of Mammalian Extracellular Vesicles (M-EVs), research on PDNVs still lacks a comprehensive exposition of its multifaceted research progress. This review endeavours to comprehensively summarise the shortcomings over the last 60 years regarding PDNV purification processes, research progress, composition and characterisation, engineering modifications, functional mechanisms, clinical translation and market regulation. It discusses the feasibility of innovative approaches such as AI deep learning technologies, interdisciplinary integration and cross-application, and outlines the latest frontiers in PDNV research. It provides comprehensive and reliable reference material for future research and application strategies regarding PDNVs, offering theoretical support and practical guidance to overcome barriers to their industrialisation. This will facilitate the transition from limited laboratory research to clinical application and drive technological innovation in the next generation of naturally derived nanomedicines.

Also flagged:Iron deficiencyIDnutritional deficiencymenstruationchronic inflammatory diseasesgastrointestinal disorders
Journal Article 2026-05-11 No Snippets García-Erce JA, García-López S, Martínez-Francés A.
Show Full Abstract

Iron deficiency (ID) is the most prevalent nutritional disorder worldwide, affecting diverse populations including children, women of reproductive age, older adults and patients with chronic conditions. Oral iron supplementation remains the cornerstone of treatment, together with management of the underlying causes. However, conventional ferrous and ferric salts are often associated with gastrointestinal side effects, poor adherence and limited efficacy, especially in inflammatory settings due to hepcidin-mediated absorption blockade. This review summarizes iron absorption physiology, limitations of traditional oral therapies, and the potential benefits of iron protein succinylate (IPS), a ferric complex bound to succinylated casein. IPS provides pH-dependent release and contains succinic acid, which may enhance absorption while reducing gastrointestinal adverse events. Clinical studies indicate that IPS achieves hematologic outcomes comparable or superior to standard oral salts, fewer gastrointestinal effects and better tolerability. These properties make IPS suitable for patients who do not tolerate or respond adequately to conventional therapy. Special attention is given to chronic inflammation, pregnancy, cancer, or gastrointestinal disorders, where oral iron often fails due to impaired absorption or poorer tolerance. Practical recommendations are included to optimize supplementation through dosing strategies and tailored approaches. Overall, IPS offers an effective, better-tolerated alternative to conventional oral iron therapy.

PLCL1SOX6
Also flagged:Myelinationaxonsmyelinaxonalmembraneneurological disorders
Journal Article 2026-05-11 ✓ 4 Snippets Yun T, Park J, Baek M.
In-Text Gene Mentions

…Sox5 , andSox6were identified as…

…8 ], andPlcl1, a phospholipase…

…Representative genes includedSox6, a TF…

…EGR1, SOX5, andSOX6point to a…

Show Full Abstract

A myelination is essential for neural function in the vertebrate central nervous system, yet the molecular details of how the oligodendrocyte differentiation program has evolved remain poorly understood. Here, we performed a cross-species single-cell transcriptomic analysis of oligodendrocyte lineage cells in the spinal cord of five vertebrate species: fugu, mudskipper, chicken, mouse, and human. Pseudotime trajectory analysis revealed a shared oligodendrocyte progenitor cell (OPC) to committed oligodendrocyte precursor (COP) to myelin-forming oligodendrocyte (MOL) differentiation trajectory across all species, and CAME-based cross-species mapping confirmed the homology of OPC and MOL identities, while COP showed reduced mapping in teleosts compared with amniotes. Among stage-specific DEGs, highly shared genes (≥4 species) were organized into four co-expression modules encompassing cell projection organization, myelination, synapse assembly, and ribonucleoprotein biogenesis, with evolutionary core genes (all 5 species) enriched for oligodendrocyte differentiation and Wnt signaling. Strikingly, amniote-exclusive genes were enriched for synaptic vesicle transport, cell projection organization, predominantly at the OPC stage. This asymmetry indicates that amniotes have expanded the oligodendrocyte differentiation program at the progenitor stage, potentially linked to the myelination demands of terrestrial locomotor circuits. Our findings provide insights into how the oligodendrocyte differentiation program has been shaped by both deep evolutionary conservation and lineage-specific adaptation.

Also flagged:metabolismferroptosisimmune responseshereditary hemochromatosisinflammatory anemianeurodegenerative diseases
Journal Article 2026-05-11 No Snippets Huang L, Pan L, Qin W, Zhao Y, Huang Y, Qin X.
Show Full Abstract

Solute carrier family 40 member 1 (SLC40A1) encodes ferroportin 1 (FPN1), the only known iron efflux transporter in mammalian cells, which is critical for maintaining systemic iron homeostasis and cellular iron balance. SLC40A1 plays a key role in regulating iron homeostasis and is involved in the pathogenesis of inflammatory, fibrotic, neurodegenerative diseases, and cancer, with dysfunction linked to mutations or epigenetic silencing. Its biological functions and regulatory mechanisms are complex and diverse. This article provides an overview of SLC40A1's molecular and biological properties, elucidates its involvement in disease progression, and evaluates its clinical potential. The study seeks to enhance understanding of SLC40A1's mechanisms, laying the groundwork for the development of targeted therapies.

PRDX6
Also flagged:sepsisphosphorylationendoplasmic reticulummitochondrialinfectiondeath
Journal Article 2026-05-11 ✓ 1 Snippet Wang Q, Xue J, Guo L, Hao D, Ito M, Reese R, Huang B, Wu C, Li XA.
In-Text Gene Mentions

…Gpx4, Gpx4-ps2) andPrdx6were also elevated,…

Show Full Abstract

<h4>Background</h4>Sepsis is a life-threatening condition with high mortality and limited therapeutic options. This study investigated the association between plasma cholesterol levels and sepsis survival and explored the mechanisms by which elevated cholesterol confers protection.<h4>Methods</h4>We analyzed 2,787 sepsis patients from the MIMIC-IV database, comparing cholesterol levels between 28-day survivors and non-survivors and assessing mortality risk using multivariable Cox regression. To test causality, C57BL/6J mice were fed either a high-cholesterol diet (HCD) or a regular diet (RD) before cecal ligation and puncture (CLP).<h4>Results</h4>Survivors had significantly higher cholesterol than non-survivors (median 135 vs. 126 mg/dL; p < 0.001). High cholesterol (≥133 mg/dL) was independently associated with reduced 28-day mortality (adjusted HR = 0.80; 95% CI: 0.67-0.95; p = 0.012). In mice, HCD elevated plasma cholesterol and improved survival (52.5% to 90%), through a mechanism that is not primarily explained by broad immune activation. Hepatic transcriptomics revealed metabolic reprogramming, including enhanced oxidative phosphorylation and antioxidant pathways, with suppression of endoplasmic reticulum proteostasis. Inhibition of mitochondrial respiration abolished the survival benefit.<h4>Conclusions</h4>Elevated plasma cholesterol is associated with improved sepsis outcomes, likely through promoting hepatic metabolic reprogramming. Targeting hepatic bioenergetics is a potential therapeutic approach.

Also flagged:behavioralalcohol use disorderpsychiatric conditionsneurological syndromesalcoholdamage
Journal Article 2026-05-11 No Snippets Ferrando R.
Show Full Abstract

Alcohol use and alcohol use disorder (AUD) remain among the leading causes of preventable morbidity and mortality worldwide, yet the mechanisms by which alcohol alters brain structure and function across the lifespan are only partially understood. Over recent decades, multimodal neuroimaging has provided key insights into the acute neurochemical and hemodynamic effects of alcohol, the neuroadaptations associated with sustained exposure, and the circuits that mediate vulnerability, progression, and relapse. In this narrative review, we integrate evidence from structural and diffusion MRI, task-based and resting-state fMRI, magnetic resonance spectroscopy, perfusion and metabolic techniques (arterial spin labeling, perfusion SPECT, FDG PET, and <sup>15</sup>O PET), and molecular PET/SPECT targeting dopaminergic and non-dopaminergic systems. Acute alcohol effects include regionally specific changes in cerebral blood flow and metabolism, perturbations in sensory processing and cognitive control networks, and rapid modulation of dopaminergic, GABAergic, glutamatergic, and opioid signaling, with transient neuroimmune changes. Chronic exposure is associated with macro- and microstructural injury, large-scale network reorganization, and persistent molecular abnormalities in reward, salience, and executive control circuits, with links to craving severity and relapse risk, including heterogeneous neuroimmune findings and reduced synaptic integrity. We also highlight adolescent alcohol use, where exposure during ongoing neurodevelopment is associated with deviations in cortical and white-matter maturation and altered task-related brain responses, with potential lasting effects on connectivity and cognition. Finally, we summarize characteristic imaging patterns of alcohol-related neurological syndromes, highlight sex-related differences, review imaging markers of vulnerability and prognosis (familial risk, genetic variation, and predictors of treatment response), and outline priorities for precision medicine in AUD, emphasizing longitudinal multimodal designs, harmonization, and the development of validated molecular targets and imaging-guided interventions.

HFE
Also flagged:Metabolic Dysfunction-Steatotic Liver Diseasealcohol-related fatty liver diseasemetabolic dysfunction-associated steatotic liver diseasedyslipidemiametabolism
Journal Article 2026-05-11 ✓ 1 Snippet Dhanavade S, Kshirsagar M, Vani A.
In-Text Gene Mentions

…hepatitis, Wilson's disease,hemochromatosis); acute hepatic decompensatio…

Show Full Abstract

<h4>Background</h4> Abnormal lipid metabolism is a hallmark of both alcohol-related fatty liver disease (AFLD) and metabolic dysfunction-associated steatotic liver disease (MASLD), both of which heighten cardiovascular risk. However, comparative data on lipid abnormalities between these two conditions remain sparse, especially among South Asian populations.<h4>Objective</h4> To systematically compare atherogenic lipid profiles between patients with AFLD and MASLD.<h4>Methods</h4> This cross-sectional study enrolled 90 participants, including 30 with AFLD, 30 with MASLD, and 30 healthy controls. Fasting serum samples were assessed for total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglycerides (TG), and non-HDL-C. Additionally, atherogenic indices and lipid ratios were calculated. Group differences were analyzed using ANOVA with post-hoc tests and multivariable regression (α = 0.05).<h4>Results</h4> Both disease groups showed significant dyslipidemia relative to controls (p < 0.001). MASLD patients exhibited the most unfavorable profile (TC = 220 ± 25 mg/dL, LDL-C = 150 ± 20 mg/dL, TG = 200 ± 50 mg/dL) compared to AFLD (TC = 200 ± 30, LDL-C = 130 ± 25, TG = 180 ± 60 mg/dL) and controls (TC = 180 ± 20, LDL-C = 110 ± 15, TG = 120 ± 40 mg/dL). HDL-C was lowest in AFLD (40 ± 10 mg/dL), intermediate in MASLD (45 ± 8 mg/dL), and highest in controls (55 ± 12 mg/dL). The atherogenic index (log[TG/HDL-C]) was significantly higher in MASLD (0.65 ± 0.18) than in AFLD (0.55 ± 0.21) and controls (0.35 ± 0.15; p < 0.001).<h4>Conclusion</h4> MASLD is associated with a more severe atherogenic lipid pattern marked by elevated TC, LDL-C, and TG, whereas AFLD features a more pronounced reduction in HDL-C. These distinct profiles suggest differing cardiovascular risk trajectories and support etiology-specific lipid management approaches.

PRDX6
Also flagged:Redoxmitochondrialendoplasmic reticulumlocalizationNeuriteneurological disorders
Journal Article 2026-05-10 ✓ 4 Snippets Kim G, Lee J, Kwon S, Yeom E, Lee DS.
In-Text Gene Mentions

…six Prdx isoforms, Prdx1–Prdx6, which are commonly…

…2-Cys Prdx, andPrdx6is a 1-Cys…

…In contrast,Prdx6is a 1-Cys…

…particularly important forPrdx6, which is predominantly…

Show Full Abstract

In the nervous system, reactive oxygen species (ROS) serve essential roles in intracellular signaling, but their dysregulation can impair neuronal function and survival. Peroxiredoxins (Prdxs) have classically been regarded as antioxidant enzymes that scavenge peroxides, yet a growing body of evidence indicates that their roles in the brain extend beyond ROS removal. They are increasingly recognized as regulators of redox-dependent processes with isoform-specific roles. In this review, we discuss the functions of Prdxs in the brain from a broad cellular perspective, focusing on their roles in neuronal differentiation, mitochondrial and endoplasmic reticulum (ER) homeostasis, and major neurological disorders including Alzheimer's disease, Parkinson's disease, and ischemic stroke. Prdx isoforms show distinct condition-dependent functions regulated by localization, regulatory state, and cellular environment. Collectively, a broader view of Prdxs as dynamic modulators of neural cell biology may help us understand their coordinated integrate their roles in the coordinated regulation of redox-sensitive cellular processes. Clarifying the isoform-specific and cell-type-specific dependent mechanisms underlying their function will be essential in defining the roles of Prdxs in brain physiology and diseases and to evaluating their therapeutic potential.

TNFSF4
Also flagged:Gallbladder CancerLymph nodeinflammatory responsesGallstoneslymph node metastasismismatch
Journal Article 2026-05-10 ✓ 1 Snippet Li Q, Tang Q, Xue D, Liu H, Tang Z, Zhang D, Chen C, Geng Z.
In-Text Gene Mentions

…checkpoints, TNFSF14 andTNFSF4had the highest…

Show Full Abstract

<b>Background/Objectives</b>: Gallbladder cancer (GBC) is an aggressive biliary tract malignancy with poor prognosis. Lymph node metastasis is a major determinant of adverse outcome in patients with GBC. Gene mutations play an essential role in tumorigenesis; however, it remains uncertain whether genetic mutations play a substantial role in lymph node metastasis in GBC. <b>Methods</b>: In this study, transcriptome and whole-exome sequencing (WES) were used to analyze gene mutations and expression in GBC tissues, focusing on lymph node metastasis. Bioinformatics tools identified differentially expressed genes (DEGs) and significantly mutated genes (SMGs), followed by pathway enrichment and survival analyses. <b>Results</b>: In total, 669 DEGs were identified between metastatic and non-metastatic GBC tissues. Through protein-protein interaction (PPI) network analysis of these DEGs, <i>GPT</i> and <i>NR1I2</i> were identified as candidate genes associated with metabolic reprogramming in lymph node metastasis. Prognostic analysis revealed 22 DEGs associated with patient survival, and significant differences in overall survival, clinicopathological features (e.g., N-stage and positive lymph node count) were observed between cluster 1 and cluster 2. Mutation analysis identified 55 SMGs, primarily related to immune and inflammatory responses. By integrating DEGs and SMGs, <i>PLCL2</i> was identified as a candidate gene potentially associated with both lymph node metastasis and prognosis. GSEA enrichment analysis suggested that <i>PLCL2</i> was potentially linked to immunity, inflammation, and cellular processes, which may imply its possible involvement in GBC metastasis pending experimental validation. <b>Conclusions</b>: Based on integrative transcriptomic and exomic analyses, we identified <i>PLCL2</i> as a candidate gene potentially associated with lymph node metastasis in GBC. These hypothesis-generating findings provide a preliminary basis for future mechanistic validation and biomarker exploration.

Also flagged:Hepatocellular carcinomacancerinfectionalcoholliver diseasenonalcoholic fatty liver disease
Journal Article 2026-05-10 No Snippets Ma S, Li Y, Fei T.
Show Full Abstract

Hepatocellular carcinoma (HCC) is the most common primary liver malignancy and a leading cause of cancer-related mortality worldwide. Despite advances in targeted therapies and immunotherapies, clinical outcomes remain poor owing to profound molecular heterogeneity, intrinsic therapeutic resistance, and complex immune evasion mechanisms. Although genomic profiling has identified recurrent alterations in HCC, large-scale functional validation of candidate drivers and vulnerabilities remains challenging. CRISPR (clustered regularly interspaced short palindromic repeats)-based screening technologies have transformed this landscape by enabling systematic interrogation of gene function in physiologically relevant contexts. In this review, we summarize recent studies that have applied CRISPR screening approaches in HCC research. These efforts have uncovered multilayered dependency programs that govern ferroptosis resistance, metabolic reprogramming, epigenetic regulation, tumor suppressor networks, immune evasion, and resistance to targeted therapies. We also discuss the major limitations of current studies, including model bias, incomplete representation of HCC heterogeneity, and technical constraints intrinsic to pooled screening. Overall, integration of CRISPR screening with patient-derived models, single-cell readouts, and precision editing technologies is expected to accelerate mechanistic discovery and biomarker-guided therapeutic prioritization for HCC.

HFE
Also flagged:anemiabindingiron deficiencymenopauseaginggastrointestinal inflammatory diseases
Journal Article 2026-05-10 ✓ 1 Snippet Zeidan RS, Yang JJ, He R, Cenko E, Mohr AM, Picca A, Anton SD, Cacciatore S.
In-Text Gene Mentions

…or lactation, malignancies,hemochromatosis, or other genetic…

Show Full Abstract

<b>Background/Objectives</b>: Blood iron biomarkers are commonly interpreted using fixed clinical reference intervals, although iron metabolism varies by age, sex, menopausal status, and race. This study aimed to characterize the distribution of iron biomarkers across demographic subgroups and to examine their distribution relative to commonly used reference intervals. <b>Methods</b>: In this cross-sectional study, 7990 adults (≥18 years) from the All of Us Research Program were classified as premenopausal women, postmenopausal women, men < 53 years, or men > 56 years. Serum iron, ferritin, total iron-binding capacity, unsaturated iron-binding capacity, and transferrin saturation (TSAT) were summarized across groups and compared descriptively with commonly used reference intervals. <b>Results</b>: Iron biomarkers varied across demographic groups. Mean serum iron was 82.3 µg/dL overall, with lower levels in premenopausal women (79.5 ± 36.7 µg/dL) and higher levels in men < 53 years (86.8 ± 41.8 µg/dL). Mean TSAT was 25.6% and generally located toward the lower end of commonly used reference ranges. Ferritin showed substantial variability, with higher mean levels in younger men (258.0 ± 581.0 ng/mL) and lower levels in premenopausal women (102.1 ± 224.9 ng/mL). Premenopausal women had higher iron-binding capacity, whereas older men had lower values. Black participants had lower serum iron and TSAT but higher ferritin compared with White participants. A substantial proportion of participants had values outside commonly used reference intervals, particularly for serum iron and TSAT. <b>Conclusions</b>: Iron biomarker distributions differ across demographic subgroups and may not be fully reflected by commonly used reference intervals. These findings highlight the importance of context-specific interpretation and underscore the need for further studies to evaluate the applicability of current reference intervals across diverse populations.

DCC
Also flagged:alanine transaminaseALTliverC-reactive proteinCRPpathogenesis
Journal Article 2026-05-09 ✓ 1 Snippet Chan KH, Clarke J, Kakkoura MG, Iona A, Wang B, Clarke C, Wright N, Yao P, Mazidi M, Im PK, Rahmati M, Kartsonaki C, Morris S, Fry H, Millwood IY, Walters RG, Chen Y, Du H, Yang L, Barnard M, Schmidt DV, Liu Y, Yu C, Sun D, Lv J, Hill M, Li L, Clarke R, Bennett DA, Chen Z, China Kadoorie Biobank Collaborative Group.
In-Text Gene Mentions

Immunoglobulin superfamily, dcc subgroup member 4superfamily, dcc subgroup…

Show Full Abstract

No abstract available.

Also flagged:pancreatic fistulaFistulapancreatitisbenignpostoperative pancreatic fistulasepsis
Journal Article 2026-05-09 No Snippets Farooqui W, Storkholm JH, Krohn PS, Penninga L, Snitkjaer C, Burgdorf SK.
Show Full Abstract

<h4>Introduction</h4>Postoperative pancreatic fistula (POPF) remains a major cause of morbidity after pancreatoduodenectomy (PD), with an incidence of more than 30% in patients with small pancreatic ducts. Evidence supporting preventive measures remains limited. Biodegradable stent placement across the pancreaticojejunostomy (PJ) may reduce the POPF. This study represents the first randomised controlled trial evaluating biodegradable stents in patients with high-risk pancreaticojejunostomies.<h4>Methods</h4>This single centre, patient- and assessor-blinded, randomised clinical trial included patients undergoing PD with a main pancreatic duct < 5 mm. Patients were randomised 1:1 to receive a fast-degrading (12-day) ARCHIMEDES biodegradable stent or no stent. The primary endpoint was Clinically relevant postoperative pancreatic fistula CR-POPF. Secondary outcomes included biliary leakage, major complications (Clavien-Dindo ≥ III), length of stay, readmission, and mortality.<h4>Results</h4>In this interim analysis, 50 patients were randomised (26 received a stent, 24 no-stent). Baseline characteristics including Fistula Risk Score (FRS) were comparable. Patients were mainly operated for malignancies. CR-POPF incidence was lower in stent-group compared to no-stent group. However, this difference was not significant (11,50% vs. 25%, p = 0,20). Biliary leakage and intraoperative blood loss were similar between groups. Two cases of mild, self-limiting postoperative pancreatitis occurred in the stent group. No 30- or 90-day mortality was observed. Median length of stay and readmission rates did not differ significantly.<h4>Conclusion</h4>Interim results from the first blinded, randomised trial with a biodegradable stent, showed no significant reduction in CR-POPF, but a trend towards reducing them. Completing the inclusion and initiating larger multicentre trials are needed to clarify its clinical benefit.

Also flagged:-gene expressionphosphorylationcancertumortranslational
Journal Article 2026-05-09 No Snippets Ma Y, Ma C, Yang A, Chen Y, Gao J, Wang Q, Wei Z, Gao M, Xing X, Liu W.
Show Full Abstract

The CUG-BP and Elav-like (CELF) family of RNA-binding proteins are key regulators of post-transcriptional gene expression, coordinating alternative splicing, mRNA stability, and translation. Although individual members, particularly CELF1 and CELF2, have been extensively characterized, a systematic, paralog-resolved integration of structural determinants, regulatory mechanisms, and disease relevance across all six CELF proteins remains limited. Here, we establish an integrative framework linking conserved RNA recognition motifs and divergent linker domains to context-dependent regulatory outputs, mediated by phosphorylation, nucleocytoplasmic dynamics, and RNA network interactions. We further highlight the neuron-enriched CELF3-CELF6 subfamily, consolidating emerging evidence that extends their roles beyond neural splicing into cancer-associated regulatory programs. Notably, we delineate functional divergence within the family, with CELF1 frequently acting as an oncogenic driver in contrast to the tumor-suppressive role of CELF2, while positioning less-characterized paralogs within this regulatory spectrum. Together, this work defines a unified structure-function-disease axis for CELF proteins and provides a conceptual framework for their prognostic and therapeutic exploitation. However, current CELF-targeted strategies remain largely preclinical and face key translational challenges, including paralog selectivity, off-target effects, and delivery barriers such as limited blood-brain barrier penetration. Accordingly, the most immediate clinical utility of CELF biology is likely to lie in biomarker development and patient stratification, rather than direct therapeutic intervention.

PCDH17
Also flagged:methylationsolid tumorshepatocellular carcinomacancertumorhypomethylation
Journal Article 2026-05-09 ✓ 1 Snippet Zheng J, Cao G, Zhao J, Yu L, Ye X, Chen J, Xie H, Li J, Jia C.
In-Text Gene Mentions

…, PCDHGB2 ,PCDH17, PCDHB16 ,…

Show Full Abstract

<h4>Background</h4>PRAME is a member of the cancer-testis antigen family and exhibits abnormally high expression in various solid tumors. Epigenetic regulation plays a critical role in the development and progression of hepatocellular carcinoma (HCC). Alterations in promoter methylation of specific genes have been widely recognized as valuable biomarkers for predicting cancer risk and assessing prognosis.<h4>Objective</h4>This study systematically investigated the biological function and clinical relevance of PRAME promoter methylation in HCC.<h4>Methods</h4>Using data from The Cancer Genome Atlas (TCGA) cohort, we identified methylation-associated prognostic genes and examined the association between PRAME promoter methylation, its mRNA expression levels, overall survival (OS), and clinicopathologic characteristics. We then validated these findings in an independent HCC cohort from Shulan (Hangzhou) Hospital using MethylTarget multiplex gene methylation detection technology. To investigate the potential role of PRAME in vascular invasion and metastasis, we conducted Gene Ontology (GO) enrichment analysis and Gene Set Enrichment Analysis (GSEA) at both histological and cellular levels.<h4>Results</h4>Analyses across three HCC cohorts consistently showed that the PRAME promoter is generally hypomethylated in tumor tissues, and this hypomethylation was significantly correlated with elevated PRAME mRNA expression. In both the TCGA and Shulan (Hangzhou) Hospital cohorts, PRAME promoter hypomethylation was associated with more advanced clinicopathologic features and shorter OS. Moreover, PRAME promoter methylation status was strongly linked to vascular invasion and distant metastasis in HCC. Further functional analyses revealed significant upregulation of Wnt signaling and cell adhesion-related pathways in tissues with high PRAME expression, a finding corroborated by single-cell RNA sequencing data.<h4>Conclusion</h4>Hypomethylation of the PRAME promoter is closely associated with poor overall survival, adverse clinicopathologic features, vascular invasion, and metastasis in HCC patients. It plays a pivotal role in regulating gene expression and promoting tumor invasiveness. These findings suggest that PRAME promoter methylation may serve as a promising epigenetic biomarker for prognostic evaluation in HCC.

TNFSF4
Also flagged:mucinous adenocarcinomaIMAlung adenocarcinomaLUADinvasive mucinous adenocarcinomatumor
Journal Article 2026-05-09 ✓ 1 Snippet Shi X, Wang Y, Yao N, Xue B, Guo L, Xu L, Zhu C, Qin G, Ying J, Liu Y, Li W.
In-Text Gene Mentions

…, CD83 ,TNFSF4, ICOSLG ,…

Show Full Abstract

Mixed invasive mucinous adenocarcinoma and non-mucinous adenocarcinoma (mixed IMA/NMA) is a rare subtype of lung adenocarcinoma (LUAD) with limited available data. This study aimed to comprehensively analyze the characteristics of this rare entity. A total of 738 surgical cases were enrolled, including 349 pure invasive mucinous adenocarcinoma (IMA), 61 mixed IMA/NMA and 328 pure non-mucinous adenocarcinoma (NMA) cases. Using amplification refractory mutation system, immunohistochemistry, and DNA-/RNA-based next-generation sequencing (DNA and RNA NGS), distinct molecular features were identified in mixed IMA/NMA cases compared with IMA and NMA cases, particularly in EGFR, KRAS, and ALK alterations and PD-L1 expression status. Paired analysis of the IMA and NMA components within mixed IMA/NMA cases using DNA and RNA NGS revealed one to three shared genomic alterations between the two components in the same tumor. However, significant differences were observed in the levels of cancer-associated fibroblasts, protumor cytokines, MHC-II, coactivation molecules, T cells, and effector cells between the components. Similarly, multiplex immunofluorescence assay demonstrated that immune cell infiltration, including CD4<sup>+</sup> and CD8<sup>+</sup> T cells, was significantly higher in the NMA components compared to the IMA components. Postoperative follow-up revealed no significant difference in disease-free survival (DFS) or overall survival (OS) between NMA and mixed IMA/NMA cases; however, both groups showed significantly shorter DFS (P = 0.011) and OS (P = 0.027) compared to IMA cases. Together, this study provides a comprehensive characterization of the molecular profiles, clonal relatedness, tumor heterogeneity, and surgical outcomes of mixed IMA/NMA, which may inform diagnostic and therapeutic strategies for this rare LUAD subtype.

ECI2
Also flagged:cardiovascular diseasemitochondrialcardiovascular diseasespathogenesiscancermyofibrillar myopathy
Journal Article 2026-05-09 ✓ 1 Snippet Terwilliger ZS, Li F, Pentakota A, Zeczycki TN, Green TD, Kolasa M, Edwards NC, Goldman MP, Fisher-Wellman KH, McClung JM.
In-Text Gene Mentions

…some targets (GPD2,ECI2, PCCB, PHB1) in…

Show Full Abstract

<h4>Introduction</h4>Bcl-2 associated athanogene 3 (BAG3) is a multifunctional protein with pleiotropic effects in multiple cell types. Despite our knowledge of its role in cardiovascular disease, its specific role in endothelial cells (ECs) is unknown. The purpose of this study was to identify differences in the EC proteome of multiple tissues before and after cell-specific deletion of Bag3. We hypothesized that BAG3 loss would uniquely alter the baseline proteome landscape of ECs in each tissue.<h4>Methods</h4>Cdh5(PAC)-CreERT2;Bag3f/f mice received tamoxifen (KO; n = 18) or vehicle (WT; n = 18) and tissues (brain, heart, lung, and peripheral skeletal muscle-SkM) were collected for fluorescence-activated cell sorting of ECs from equal numbers of male and female mice at >22 weeks of age, followed by LC-MS/MS label-free proteomics.<h4>Results</h4>Initial comparisons of the WT proteomes between tissues revealed differential abundance of EC proteins (p < 0.05), including 367 brain vs heart; 338 brain vs. lung; 570 brain vs. SkM; 400 heart vs. lung; 104 heart vs. SkM; and 489 lung vs. SkM. Additionally, the EC mitochondrial proteome was unique to each tissue of origin, with significantly (p < 0.05) higher proportions dedicated to complexes I, III, IV, and V, in the heart compared to the other tissues. KO demonstrated the largest effect on SkM ECs, increasing 31 proteins (Mybpc2 Log2FC = 4.81; PFKM Log2FC = 3.02) and decreasing 65 (CDC42 Log2FC = -2.44; Prpf8 Log2FC = -2.24).<h4>Conclusion</h4>Overall, these results demonstrate that the EC proteome of different tissues is unique and that the loss of BAG3 in these cells differentially alters a small proportion of the EC-specific proteome.

HTT
Also flagged:metabolismmale reproductionshort-chain fatty acidsserotoninbile acidsmale infertility
Journal Article 2026-05-09 ✓ 1 Snippet Shi X, Hu Y, Wang C, Hua G, Liu S.
In-Text Gene Mentions

…5-HT 3 ,5-HTT) and TPH enzymatic…

Show Full Abstract

The gut microbiota, as the "second genome" of the human body, plays a central regulatory role in maintaining host physiological homeostasis; conversely, its dysbiosis can impair male reproductive function via the "gut-testis axis", leading to a series of pathological manifestations such as abnormal semen quality, sexual dysfunction, and reproductive organ damage. Gut microbiota exerts multidirectional effects on host metabolism, immunity, endocrinology, and the neural system, collectively forming a complex regulatory network for male reproduction. Among these, microbiota-derived metabolites such as short-chain fatty acids (SCFAs), serotonin (5-HT), and secondary bile acids, function as systemic signaling molecules that exert direct and indirect effects on the testis through blood circulation and modulation of gut barrier integrity, regulation of systemic inflammation, epigenetic reprogramming, respectively. The potential and limitations of microbiota-targeted intervention strategies, including probiotics, prebiotics, synbiotics, traditional natural herbal extracts, and fecal microbiota transplantation (FMT), are also discussed. Finally, we propose that future interventions should be tailored to individual gut microbiota profiles to achieve precise regulation of male reproductive function. This review aims to provide a new systems biology perspective for understanding the complex etiology of male infertility and to lay a theoretical foundation for the development of innovative microbiome-based diagnostic tools and therapeutic strategies.

Also flagged:CHD8autism spectrum disordersneurodevelopmental disorderssynaptic transmissionbehavioralmitochondrial
Journal Article 2026-05-09 No Snippets Kim J, Lee S, Hwang E, Jung H, Lee C, Choi SH, Lee S, Kim S, Moon H, Kim J, Lee G, Kim YG, Shin S, Kang H, Kim SJ, Gee HY, Kim SG, Lee E, Kim E.
Show Full Abstract

CHD8 is a chromatin remodeler implicated in autism spectrum disorders (ASD) and multiple neurodevelopmental disorders, yet heterozygous Chd8-mutant mouse lines often exhibit only mild ASD-related phenotypes, leaving its role unclear. Because a complete knockout of Chd8 causes embryonic lethality, we generated viable homozygous Chd8-mutant mice carrying the human CHD8-Asn2373LysfsX2 mutation using a hybrid (C57BL6/J × 129/Sv) genetic background. Compared to heterozygous Chd8<sup>+/N2373K</sup> mice, the homozygous Chd8<sup>N2373K/N2373K</sup> mice showed more robust phenotypes, including increased ASD-related behaviors and brain volume, decreased cerebral blood volume/flow, brain rhythms, and synaptic transmission, and ASD-related transcriptomic changes. Notably, while Chd8<sup>+/N2373K</sup> mice on a pure background predominantly displayed behavioral deficits in males, the homozygous mutants in the hybrid background exhibited more pronounced female phenotypes, suggesting the interaction of genetic background and mutation strength. A direct comparison of Chd8<sup>+/N2373K</sup> and Chd8<sup>N2373K/N2373K</sup> mice on the same hybrid background across brain volume, cerebral blood flow, neuronal firing, synaptic transmission, and transcriptome revealed a gene dosage-dependent attenuation of sexual dimorphic phenotypes that varied by developmental stage and brain region. Transcriptomic analyses further implicated pathways related to synaptic function, RNA splicing, and mitochondrial activity in mediating differences in male-female protection and susceptibility. Thus, a homozygous Chd8 mutation not only intensifies ASD-related traits but can also diminish typical sex-specific severity patterns, uncovering a novel link between mutation strength and sexual dimorphism in ASD.

Also flagged:infectiongene expressionsepsisimmune response-organ failuredeath
Journal Article 2026-05-09 No Snippets Hwang J, Cha JH, Ahn S, Park JH, Kim S, Jung M, Choi Y, Seok H, Choi WS, Nam MH, Park DW.
Show Full Abstract

<h4>Background</h4>Sepsis is a life-threatening condition caused by a dysregulated host response to infection, with significant biological heterogeneity. Transcriptomic profiling offers insights into immune-related gene expression patterns that may inform patient stratification. This study aimed to identify transcriptomic signatures of sepsis or septic shock.<h4>Method</h4>Eleven adult patients who presented to the emergency department with sepsis or septic shock were enrolled at a tertiary hospital in Korea. Serial whole-blood samples were collected on days 1, 3, and 7. RNA sequencing was performed using Illumina paired-end protocols. Principal component analysis (PCA) was performed on normalized transcriptomic data to derive a gene signature. Enrichment scores were calculated using single-sample gene set enrichment analysis and validated in external bulk and single-cell RNA-seq datasets.<h4>Results</h4>PCA identified first principal component (PC1) as the major axis of variation, separating samples by sepsis severity and timepoint. Clustering of the top 50 PC1 contributing genes identified three transcriptomic subgroups with distinct expression patterns. Enrichment scores for this gene set increased with severity and declined over time. In multiple external sepsis cohorts, enrichment scores showed consistent trends and were significantly associated with 28-day mortality. Functional analysis revealed predominant neutrophil-associated pathways, as further supported by external single-cell RNA-seq validation.<h4>Conclusions</h4>We identified a neutrophil-driven transcriptomic signature associated with sepsis severity and temporal immune dynamics. These findings suggest that longitudinal transcriptomic profiling may provide additional insight into the evolving host immune response during sepsis.

Also flagged:OsteoarthritisOAjoint diseasearticular cartilage degenerationbone remodelingtranslational
Journal Article 2026-05-09 No Snippets Shi Y, Ni Z, Wang F, Li Z, Li S, Li K, Chen X, Xu C, Wang F.
Show Full Abstract

Osteoarthritis (OA) is a complex, multifactorial whole-joint disease characterized by progressive articular cartilage degeneration, synovitis, and subchondral bone remodeling. Current clinical interventions primarily offer symptomatic management but do not halt or reverse disease progression. Recent advancements in regenerative medicine have emphasized mesenchymal stromal cell (MSC) therapy owing to its substantial potential in tissue repair and microenvironmental modulation. This review systematically evaluates the therapeutic efficacy and potential mechanisms of bone marrow-derived MSCs, adipose-derived stromal cells, umbilical cord-derived MSCs, synovium-derived MSCs, embryonic stem cell-derived MSCs and induced pluripotent stem cell-derived MSCs, as well as MSC-derived exosomes, in modulating the joint microenvironment. Furthermore, we discuss recent innovations in nanotechnology-enhanced strategies, designed to improve targeting specificity and therapeutic durability of MSC-based interventions. This review aims to establish a foundational framework and translational roadmap for the development of next-generation disease-modifying therapies for OA.

HFE
Also flagged:Antimicrobialenteric infectionsexcretioniron-deficiency anemiaETEC infectiondetoxification
Journal Article 2026-05-09 ✓ 5 Snippets Navazesh SE, Ter Horst A, Wen W, Liu Y, Kiang D, Li Z, Yu A, Brown CT, Ji P.
In-Text Gene Mentions

…Pigs were stratified by sex and weaning body weight (6.62 ± 1.07 kg) and randomly assigned to one of five dietary treatments ( n = 10/treatment) for 24 d. Experimental diets included: 1) a control diet (Con) containing 25, 139, and 141 mg/kg of Cu, Fe, and Zn, respectively, 2) a low-iron diet (LFe, 19 mg Fe/kg), 3) ahigh-iron diet (HFe, 1,219 mg Fe/kg), 4) a high-copper diet (HCu, 257 mg Cu/kg), and 5) a high-zinc diet (HZn, 2,631 mg Zn/kg, including 2,490 mg Zn/kg from ZnO).…

…Differential abundance analysis revealed no significant changes in AMR genes in pigs fed theHFe orHCu diets, however, cblA-1 , a Bacteroides uniformis specific beta-lactamase, was significantly increased in the LFe and HZn treatment groups relative to the control ( P < 0.05, Table S4).…

…However,HFeshowed more observed features compared to HZn (Fig. 5 A–C).…

…PERMANOVA of Aitchison distances based on gene families relative abundances revealed differences between HZn and all other groups ( P ≤ 0.06), between LFe andHFe( P = 0.06), and between HCu and Con ( P = 0.06) and HFe ( P = 0.06, Fig. S3B).…

…Differential abundance analysis of reads revealed that the LFe andHFetreatment groups did not differ at the pathway level relative to the Con group.…

Show Full Abstract

<h4>Background</h4>High levels of zinc oxide (ZnO) and copper sulfate are widely used as alternative growth promoters in postweaning pig diet. However, excessive exposure to these metals may drive co-selection for heavy metal (HMR) and antibiotic resistance (AMR). Nursery diets also contain abundant iron to offset the low bioavailability of plant-derived iron, yet how dietary iron influence gut dysbiosis and microbial resistance in postweaning pigs remains unclear. This exploratory study examined the effects of dietary iron and metal-based growth promoters on the fecal resistome of postweaning pigs using shotgun metagenomics and whole-genome sequencing (WGS).<h4>Methods</h4>Fifty weanling pigs were stratified and randomly assigned to five dietary treatments for 24 d. Experimental diets included a control diet (Con) containing 25, 139, and 141 mg/kg of Cu, Fe, and Zn, respectively, a low-iron diet (LFe, 19 mg Fe/kg), a high-iron diet (HFe, 1,219 mg Fe/kg), a high-copper diet (HCu, 257 mg Cu/kg), and a high-zinc diet (HZn, 2,631 mg Zn/kg, including 2,490 mg Zn/kg from ZnO). All pigs were orally administered with F18 enterotoxigenic Escherichia coli (ETEC) on d 13-16. Metagenome sequencing were performed on d 24 fecal DNA (n = 24) to identify HMR genes (BacMet Predicted database) and AMR genes (CARD database). Functional annotation was performed using HUMAnN3. Whole genome sequencing (WGS) was conducted on 120 E. coli isolates from fecal cultures on d 1, 12, and 24, and AMR and virulence genes were identified from contig assemblies using ABRicate.<h4>Results</h4>Dietary metal treatments significantly altered β-diversity of HMR genes compared with Con, with HZn differing from both HCu and LFe (P < 0.05). Fecal iron levels correlated with sodB (ρ = 0.64, P = 0.075), an iron-containing superoxide dismutase, while fecal copper levels correlated with pcoC (ρ = 0.66, P = 0.075), a plasmid-mediated copper resistance gene. Across metagenomes, 172 AMR genes were identified, dominated by glycopeptide and tetracycline resistance. While dietary iron had minimal effects on fecal AMR profile, HZn induced the largest shifts in resistome, including increases of ant(9)-la, conferring aminoglycoside resistance on mobile genetic elements, and adeF, encoding a multidrug efflux pump (P < 0.05). Functional profiling revealed enrichment of carbohydrate metabolism pathways in HZn group (P < 0.05). WGS of E. coli isolates showed distinct AMR profiles under HZn on d 24 and distinct virulence profile under LFe on d 12, exhibiting increased prevalence of exotoxin and T3SS genes (P < 0.05).<h4>Conclusion</h4>Dietary iron restriction enhanced E. coli virulence genes, whereas excessive ZnO induced the most pronounced changes in the gut resistome and microbial metabolism, highlighting a risk for AMR co-selection and marked influence on gut microbiota.

HTT
Also flagged:catatoniaHuntington diseaseHDneurodegenerative disordercognitive declineexecutive dysfunction
Journal Article 2026-05-09 ✓ 1 Snippet Miglis G, Kadan J, Noe G, Munjal S.
In-Text Gene Mentions

…expansion in theHTTgene.…

Show Full Abstract

<h4>Introduction</h4>Huntington disease (HD) is a progressive neurodegenerative disorder caused by CAG repeat expansion in the HTT gene. It typically presents with choreiform movements, cognitive decline, and executive dysfunction. Moreover, psychiatric symptoms such as depression, psychosis, and disinhibition are common. Catatonia, a rare and mostly unstudied comorbidity of HD, presents with mutism, rigidity, and agitation. Overlapping psychomotor and behavioral features make the diagnosis of HD with concomitant catatonia challenging. We conducted a scoping review to examine reported cases of catatonia in HD, focusing on diagnostic challenges, treatment approaches, and outcomes.<h4>Methods</h4>A systematic literature search was conducted across PubMed, PubMed Central, Scopus, Embase, Web of Science, and APA PsycInfo using MeSH terms "Huntington Disease" and "Catatonia." We also included additional free text search terms combining "Huntington" and "catatonia OR catatonic OR catalepsy OR mutism OR stupor OR rigidity OR waxy flexibility OR Bush Francis". Peer-reviewed studies reporting confirmed or probable HD with catatonia were included. Three articles describing four unique cases met the inclusion criteria.<h4>Results</h4>Four cases of catatonia in HD were identified (ages 16-62). Presentations ranged from excited to stuporous catatonia, often with psychosis or mood disorders. All received lorazepam with variable responses. Electroconvulsive therapy (ECT) was administered in all four cases, yielding partial or complete relief in most, though one required maintenance ECT and another worsened. Antipsychotics were inconsistently used and sometimes exacerbated symptoms. From the cases reviewed, recurrence was frequently observed with subsequent remission after additional ECT courses.<h4>Discussion</h4>Catatonia in HD is rare and difficult to diagnose due to overlapping motor and behavioral symptoms. Psychosis was present in all reviewed cases, indicating a potential association worthy of future investigation. While lorazepam is typically first-line, ECT showed the most consistent benefit, though relapses were frequent. Moreover, there is evidence to suggest that antipsychotics with strong dopamine antagonism should be used cautiously in this patient population.<h4>Conclusion</h4>This review highlights the rarity and complexity of catatonia in HD and underscores the need for greater clinical awareness. ECT appears effective for many patients, but individualized treatment plans are essential. Further research is needed to clarify diagnostic criteria, underlying mechanisms, and long-term management strategies.

PLCL1
Also flagged:Idiopathic inflammatory myopathiesimmune-mediated disordersdermatomyositispolymyositisPMinclusion body myositis
Journal Article 2026-05-09 ✓ 1 Snippet Dutsch-Wicherek M, Szczęsny P, Wisłowska M.
In-Text Gene Mentions

…and non-HLA allelesPLCL1and BLK […

Show Full Abstract

<b>Background/Objectives:</b> Idiopathic inflammatory myopathies (IIMs) are chronic immune-mediated disorders, causing striated muscle weakness and extramuscular symptoms. Real-world, single-centre data are needed to interpret phenotype patterns and evolving therapies. <b>Methods</b>: A single-centre, retrospective cohort study was conducted at the Rheumatology Clinic of the National Institute of Geriatrics, Rheumatology and Rehabilitation, Warsaw, Poland from 1 January 2022 to 31 December 2025. Data included demographics, IIM subtypes, extramuscular involvement, co-existing Sjögren disease (SD), biopsy results, autoantibodies, and treatment. Due to sample size, descriptive analysis was used. <b>Results</b>: The study included 35 patients (31.4% men). Mean age was 50.7 years; mean body mass index (BMI) was 26.0 kg/m<sup>2</sup>. The cohort consisted of 10 dermatomyositis (DM), one polymyositis (PM), two immune-mediated necrotising myopathy (IMNM), one inclusion body myositis (IBM), 16 anti-synthetase syndrome (ASyS), four juvenile dermatomyositis (JDM), and one clinically amyopathic dermatomyositis (CADM). SD co-occurred in eight cases, including six cases of ASyS. Anti-Jo1 was observed in 13 ASyS cases and one DM. Glucocorticoids (GCSs) were administered in all patients for induction in addition to cyclophosphamide (28.6%), mycophenolate mofetil (MMF) (51.4%), and methotrexate (MTX) (17.1%). Maintenance therapy included MTX (20%), MMF (31.4%), rituximab (34.3%), azathioprine (AZA) (42.9%), and others. Two DM, two JDM, and one ASyS patient received JAK inhibitors, one DM and one JDM anifrolumab, one IBM sirolimus, and four patients with interstitial lung disease (ILD) nintedanib. <b>Conclusions</b>: This Polish single-centre cohort shows effective use of novel therapies for IIM. Sirolimus, JAK inhibitors, and nintedanib were effective. Co-occurrence of SD in ASyS patients requires further research.

Also flagged:AutophagyOvarian Cancercancertumorinflammatory responsesOC
Journal Article 2026-05-09 No Snippets Zoń A, Bednarek IA.
Show Full Abstract

Despite extensive research, the treatment of ovarian cancer remains a significant challenge. One promising strategy involves the regulation of autophagy in cancer cells. However, this process is exceptionally complex and, depending on numerous factors, it can either suppress tumor progression, by maintaining genomic stability and limiting inflammatory responses, or exert a pro-tumor effect, enabling cancer cells to survive in unfavorable environmental conditions. Furthermore, the activation of this pathway can contribute to the development of resistance to drugs used in ovarian cancer therapy, such as cisplatin or paclitaxel. Current therapeutic approaches focus on both the induction and inhibition of autophagy, primarily by targeting the two most important pathways regulating this process: PI3K/Akt/mTOR and AMPK.

FBXL4
Also flagged:Circadian RhythmsAcute Respiratory Distress SyndromeARDScircadian rhythmtranslationalinflammatory responses
Journal Article 2026-05-09 ✓ 1 Snippet Liu BT, Chen Y, Zhu YL, Ren SC, Wang JF.
In-Text Gene Mentions

…protein (β-TrCP) andF-box and leucine-rich repeat protein 3and leucine-rich repeat…

Show Full Abstract

Acute respiratory distress syndrome (ARDS) is a high-mortality condition lacking targeted treatments. Emerging evidence indicates that circadian rhythm disruption is a key factor in the development of ARDS. Core clock proteins control essential processes, including alveolar-capillary barrier function, inflammation, and tissue repair. The intensive care unit (ICU) environment and underlying illness create double hits that impair biological clocks, leading to a cycle of excessive inflammation and organ damage. This review highlights the central role of circadian rhythms in ARDS. Despite strong preclinical evidence, there are still many challenges for clinical application, including a lack of high-quality human studies and uncertainty about the optimal timing of interventions. Incorporating biological rhythm stabilization into multimodal ARDS management is a prerequisite step toward precision medicine. Future research should focus on mechanistic and translational studies to confirm the safety and effectiveness of chronomedicine in improving long-term patient outcomes.

Also flagged:synthesisribosomebacterial infectionsbindinginfectionsbacteremia
Journal Article 2026-05-09 No Snippets Lee IJ, Li Q, Raskar T, Pellegrino J, Ecker AK, Howard SY, Fraser JS, Seiple IB.
Show Full Abstract

Natural products and their derivatives have long served as powerful tools for treating bacterial infections, but the rise of antibiotic resistance threatens their continued effectiveness. Targeted structural modification of existing classes of antibiotics is an effective strategy to overcome resistance and extend clinical utility. The development of group A streptogramins that overcome acetyltransferase resistance, a pervasive resistance mechanism to the class, is an example of successful implementation of this strategy. However, the synthetic chemistry to reach these new analogs was limited in its ability to access modifications at the C4 position on the scaffold, a promising modification site that produced the most potent streptogramin to date. Here, we report the development of a modified route to group A streptogramins that enables access to a broad diversity of functionality at C4. Using cryo-EM data to guide structural modifications, we synthesize several series of C4-modified group A streptogramins with sidechains designed to make binding contacts with the exit tunnel of the ribosome. We identify multiple analogs that are active against multidrug-resistant bacteria, including strains that are resistant to macrolides, β-lactams, vancomycin, and first-generation streptogramins. We structurally characterize the binding of two analogs to the bacterial ribosome, revealing new π-stacking interactions between the C4 sidechain and the non-canonical U1782-U2586 base pair. These findings demonstrate how structure-guided drug design can drive the development of next-generation antibiotics and increase the therapeutic potential of the streptogramin class.

Also flagged:bindingwaterDeltasynthesisbenzeneNSD3
Journal Article 2026-05-08 No Snippets Ansari N, Aviat F, Hénin J, Piquemal JP, Lagardère L.
Show Full Abstract

Relative binding free energy (RBFE) calculations are a cornerstone of rational hit-to-lead and lead optimization in modern drug discovery. However, the high computational cost and limited reliability in tackling large or complex molecular transformations often prevent their routine, high-throughput use. Here we introduce Dual-LAO, a novel, highly efficient method for calculating RBFE. Building on the Lambda-ABF-OPES framework, this method combines a dual-topology setup and suitable restraints to dramatically accelerate free energy convergence. We demonstrate that Dual-LAO, in combination with the AMOEBA polarizable force field, achieves an unprecedented acceleration factor of 15 to 30 times compared to current state-of-the-art methods on standard drug targets. Crucially, the approach maintains high accuracy and successfully tackles previously prohibitive molecular changes, including scaffold-hopping, buried water displacement, charge changes, ring-opening, and binding pose perturbations. This significant leap in efficiency allows for the widespread, routine integration of predictive molecular simulations into the rapid optimization cycles of drug discovery, enabling chemists to confidently model historically challenging systems in timescales compatible with real-world project deadlines.

PRDX6
Also flagged:Hepatocellular carcinomacancerstumorcell differentiationinflammatory responseschronic venous insufficiency
Journal Article 2026-05-08 ✓ 1 Snippet Liu S, Lin Y, Xia H, Li H, Dou Y, Luo J, Yang T, Zeng Q, Guo W, Chen H.
In-Text Gene Mentions

…regulators, such asPRDX6, can drive HCC…

Show Full Abstract

Hepatocellular carcinoma (HCC) remains one of the deadliest malignancies worldwide due to its high rates of recurrence and metastasis. This underscores the urgent need to develop innovative drugs and treatment strategies to improve patient outcomes. This study examined the molecular pathways underlying troxerutin's therapeutic potential in HCC, providing information that could aid in the development of novel therapeutic strategies. Cell proliferation and apoptosis were assessed using CCK-8, EdU assays, and flow cytometry. Protein expression and mRNA alterations were analyzed by Western blotting and PCR, respectively. Cell migration and invasion were evaluated using Transwell assays, while tumor cell stemness was examined through sphere formation assays. Troxerutin's functional role was studied using in vivo models. Proteomic profiling of troxerutin-treated cells was performed using iTRAQ combined with LC-MS/MS to identify differentially expressed proteins (DEPs). Furthermore, luciferase reporter and ChIP assays were conducted to elucidate the underlying regulatory mechanisms. These findings demonstrate that troxerutin markedly inhibits HCC malignancy and stemness in both in vitro and in vivo models. Bioinformatics analysis indicated that the FOXO and SYK signaling pathways were predominantly enriched among the differentially expressed proteins. Mechanistically, we show that Syk dephosphorylation activates FOXO3 and facilitates its translocation into the nucleus. Moreover, we confirm that FOXO3 directly associates with the Syk promoter, thereby initiating its transcription. The present study reveals that troxerutin attenuates HCC progression by targeting the FOXO3/Syk feedback loop, inhibiting the stem-like properties of HCC cells.

OLFM4
Also flagged:gastritisintestinal metaplasiagastric cancercancerintestinal-typediffuse-type gastric cancer
Journal Article 2026-05-08 ✓ 5 Snippets Wen J, Gong Y, Sun L, Lin Z, Xu Q, Jing J, Hu L, Duan H, Yin H, Zhang H, Shen S, Dong N, Li Y, Tu H, Yuan Y.
In-Text Gene Mentions

…progression, that anOLFM4-positive transitional subset…

…We examine theOLFM4-positive IM-crypt compartment…

OLFM4staining was quantified…

…ple-marker panels: KI67/KRT20/OLFM4on CAG-IM; OLFM4/MYB…

…KI67/KRT20/OLFM4 on CAG-IM;OLFM4/MYB and KI67/OLFM4/MUC6 on…

Show Full Abstract

Early gastric carcinogenesis progresses from gastritis through intestinal metaplasia to early gastric cancer, yet the spatial origin of malignant transformation and subtype divergence remains unclear. Here we show, using spatial transcriptomics across human gastric tissues spanning disease progression, that an OLFM4-positive transitional subset emerges at the interface between gastric isthmus/glands and proliferative intestinal metaplasia crypts, consistent with an early step in intestinalization. From these crypts, transcriptional trajectories diverge toward distinct intestinal differentiation programs. Notably, proliferative crypt regions display the closest transcriptional similarity to early gastric cancer and are enriched for proliferation and DNA-repair pathways, supporting their role as a premalignant niche. We further identify increased activity of USF2-associated regulatory networks shared between crypt and cancer regions. Further stratification by Lauren subtype reveals that intestinal-type gastric cancer is characterized by a CDX2-dominated program, whereas diffuse-type gastric cancer exhibits developmental and stemness-related networks with SPP1 and CD44 co-occurring. Together, these findings highlight the intestinal metaplasia crypt as a premalignant niche and provide spatially resolved candidate markers for early detection and mechanistic investigation.

HFE
Also flagged:deathchannelopathiescardiomyopathiesarrhythmogenic cardiomyopathymiscarriagesSudden cardiac
Journal Article 2026-05-08 ✓ 3 Snippets Sabater-Molina M, Nicolas Rocamora E, Munteanu S, Fuentes Bermejo MD, Osuna E, Pérez-Cárceles MD, Pastor Quirante F, Gimeno Blanes JR, Hernández Del Rincón JP.
In-Text Gene Mentions

…GREM2, GUSB, HCN4,HFE, HRAS, IDH2, ILK,…

…GUSB, GYG1, HCN4,HFE, HRAS, IDH2, ILK,…

…HAND1, HAND2, HCN4,HFE, HRAS, IDH2, ILK,…

Show Full Abstract

<h4>Background</h4>Anatomopathological autopsy and postmortem genetic testing play a crucial role in forensic medicine, particularly in elucidating the causes of sudden death (SD) that remain unexplained by conventional methods. This study explores their value in detecting inherited cardiac conditions with medico-legal and preventive implications.<h4>Methods</h4>From a 15-year forensic cohort, 12 cases of sudden unexpected death in which conventional autopsy was inconclusive or where a hereditary cardiac condition was suspected, were analyzed. Each case underwent histology, toxicology, and targeted next-generation sequencing panels covering genes associated with channelopathies and cardiomyopathies. Variants were classified according to ACMG/AMP guidelines, and family studies were performed when feasible.<h4>Results</h4>Integrated pathological and genetic analysis identified pathogenic or likely pathogenic variants in several cases, notably in RYR2 and CALM2 (channelopathies) and FLNC and PPP1R13L (cardiomyopathies). In these cases, genetic findings confirmed the diagnosis, while variants of uncertain significance were detected in others. Postmortem genetic testing proved essential in cases with structurally normal hearts or sub-diagnostic findings, such as concealed arrhythmogenic cardiomyopathy. Familial cascade testing uncovered additional carriers, enabling targeted surveillance and preventive measures.<h4>Conclusion</h4>Combining pathological autopsy and postmortem genetic testing significantly improves the diagnostic yield in unexplained SD, uncovers hidden hereditary cardiac conditions, and provides critical information for risk assessment in relatives. Beyond clinical implications, these findings contribute to accurate forensic determinations and prevention of miscarriages of justice. Integrating genetic studies into forensic protocols should become standard practice to ensure both scientific rigor and legal fairness.<h4>Clinical trial registration</h4>Not applicable.

CACNA1E
Also flagged:developmental epileptic encephalopathyDEEneurodevelopmental disorderdevelopmental delayepilepsyelectrical status epilepticus
Journal Article 2026-05-08 ✓ 1 Snippet Pathiraja H, Wanasinghe A, Hewavitharana H, Abeyratna B, Ratnayake P.
In-Text Gene Mentions

…function of theCACNA1Egene.…

Show Full Abstract

<h4>Background</h4>Developmental epileptic encephalopathy (DEE) is a severe neurodevelopmental disorder characterized by developmental delay, regression, and intractable seizures. Genetic testing plays a crucial role in identifying underlying pathogenic variants, guiding treatment, and improving patient outcomes, particularly in resource-limited settings.<h4>Case presentation</h4>A one-and-a-half-year-old Sri Lankan boy was assessed due to global developmental regression. He exhibited motor delays, with developmental milestones around 9-12 months, including the ability to form a pincer grasp and stand with support. He showed regression in speech and swallowing. By 15 months, he could speak single words, which had reduced to monosyllable babbling by the time of presentation. He was born to healthy, non-consanguineous parents and had a healthy sibling. He had an uncomplicated antenatal and perinatal history and had no history of seizures. His paternal uncle also had developmental delay and epilepsy. He was found to have electrical status epilepticus in sleep (ESES) in the electroencephalogram (EEG) recording, and genetic testing revealed a CACNA<sub>1</sub>E loss-of-function mutation. He had a variable response to antiseizure medications, with a good response to acetazolamide and significant functional deterioration with topiramate. He also responded to treatment for ESES.<h4>Conclusion</h4>Pathogenic variants of CACNA<sub>1</sub>E, particularly those causing either gain-of-function or loss-of-function effects, are linked to severe neurodevelopmental disorders. Clinically, CACNA<sub>1</sub>E mutations often present in early childhood with severe neurodevelopmental impairment, global developmental delay, autistic features, feeding difficulties, and self-injurious behaviors. The molecular mechanisms can explain the deterioration with topiramate and the improvement with acetazolamide, as the mutation causes a loss of function of the CACNA<sub>1</sub>E gene, which is potentially exacerbated by the blocking of the same channel by topiramate and improved by acetazolamide. This case exemplified the use of genetic diagnosis for precision treatment. It highlighted the need to look for modifiable conditions such as epileptic encephalopathy in children with developmental delay and regression, even in the absence of seizures. The CACNA<sub>1</sub>E mutation, EEG finding of ESES, and the responses to targeted treatment add to the literature of this rare disorder.

HTTSOX6
Also flagged:melanocytic neoplasmsSpitz-lineage neoplasmstumorsmelanomasskin tumorsneoplasms
Journal Article 2026-05-08 ✓ 2 Snippets Lenskaya V, Erikson L, Prieto VG, Cho WC.
In-Text Gene Mentions

…, SLC12A7 ,SOX6, TRIM24 ,…

…CD63::PRKCB , andHTT::PKN1 [ 159 ,…

Show Full Abstract

The scope of gene fusions in melanocytic neoplasms is broader than previously recognized, extending well beyond the Spitz-lineage neoplasms where kinase fusions involving ALK, ROS1, NTRK1/2/3, RET, MET, BRAF, and MAP3K8 define biologically and morphologically distinct tumors. Emerging studies demonstrate that a meaningful proportion of conventional non-Spitz lineage melanomas harbor oncogenic fusions. Such fusions may impact clinical behavior, histopathologic presentation and provide opportunities for targeted therapy. The World Health Organization classification of skin tumors, 5th edition, now incorporates fusion status into taxonomy and risk stratification, yet some important questions remain for further investigation: fusion-associated neoplasms can mimic non-melanocytic neoplasm; Spitz-type fusions appear in non-Spitz lesions; and melanocytic differentiation may occur in some other fusion-driven lesions. Broad-panel next-generation sequencing (including RNAseq), together with targeted fluorescence in situ hybridization and immunohistochemistry enhances detection of known and novel fusion partners. Early clinical evidence of TRK, ALK, and ROS1 inhibitor efficacy underscores the translational promise of fusion testing and opens avenues for personalized therapy. This review synthesizes current knowledge on the genomics, histopathology, diagnosis, and therapeutic implications of fusion-driven melanocytic neoplasms, highlighting consensus points and remaining controversies.

HFE
Also flagged:chronic lung diseasesCOPDagingmetabolismchronic diseaseslung disease
Journal Article 2026-05-08 ✓ 2 Snippets Mbaekwe U, Kenny S, Cloonan SM, Kliment CR.
In-Text Gene Mentions

…polymorphisms in theHFEgene, which underlies…

…which underlies hereditaryhemochromatosis, has been observed…

Show Full Abstract

The oxygen-rich milieu of the lungs necessitates precise iron homeostasis and regulation, processes that are fundamental to pulmonary physiology but often receive limited attention. However, in recent years, dysregulation of iron homeostasis has been linked to numerous acute and chronic respiratory diseases. Here, we comprehensively evaluate the mechanisms governing iron homeostasis in the alveolar epithelium of the lung and examine how iron dysregulation contributes to impaired alveolar epithelial repair in respiratory disease. This Review focuses on the effects of iron on alveolar epithelial cell homeostasis and repair and disease pathogenesis. There will be a focus on emerging interventions designed to reestablish iron homeostasis and their potential therapeutic implications related to enhancing lung repair and limiting the progression of lung disease.

Also flagged:pathogenesisHDcell divisionX-linked dystonia parkinsonismDystonia-ParkinsonismHereditary Disease
Journal Article 2026-05-08 No Snippets Jiang A, Correia K, Gillis T, Oliver EL, Jones BP, McAllister B, Mejia Maza A, MacDonald ME, Mouro Pinto R, Wheeler VC, Gusella JF, McLean ZL.
Show Full Abstract

Expanded short tandem DNA repeats are implicated in over 60 human disorders. In many, somatic instability (SI) of the repeat plays a critical role in disease pathogenesis. For example, SI in vulnerable neurons is a key driver of clinical symptoms in Huntington's disease. Quantifying SI has traditionally relied on PCR followed by capillary electrophoresis, with metrics describing the shape of repeat size distributions, such as the expansion index. However, current tools often require costly proprietary software, are time-consuming, and rely on custom pipelines that vary between labs. To address these challenges, we developed Tandem Repeats Analysis by Capillary Electrophoresis (TRACE), an open-source software that processes fragment analysis data end-to-end, from raw files to SI metrics. Additionally, we created an associated web app TRACE-shiny (https://traceshiny.mgh.harvard.edu), for interactive usage. Instability metrics from TRACE benchmarked against published datasets confirm its utility for studying genetic and pharmacological modifiers of SI. TRACE eliminates the need for proprietary software or custom pipelines, making advanced tools for analysis of somatic repeat expansion widely accessible.

PRDX6
Journal Article 2026-05-08 ✓ 1 Snippet Li C, Zhang Y, Ni X, Zhao X, Liang J, Wu G, Quan G.
In-Text Gene Mentions

…proteins like ACAT2,PRDX6, G6PD, HSP90a, HSPA8,…

Show Full Abstract

The present study aimed to investigate the protective effects of astaxanthin (AST) and melatonin (MLT) on ram sperm quality-associated indicators during cryopreservation, and to explore the molecular effects of the two cryoprotectants on the protein profile of cryopreserved sperm. First, ram sperm were diluted with freezing media supplemented with different concentrations of AST and MLT, and then cryopreserved. The effects of different concentrations of AST and MLT were assessed by evaluating the motility and motile parameters, functional and structural indicators, antioxidant capacity, and associated indicators of post-thawed sperm. The concentrations of 50 μM AST (AST group), 0.5 mM MLT (MLT group), and 50 μM AST and 0.5 mM MLT (AST.MLT group) were the most effective, as compared to the control (CON group). Furthermore, alterations in the sperm proteomic profile among the three comparisons (AST vs CON, MLT vs CON, AST.MLT vs CON) were determined using an Orbitrap Astral coupled with a data-independent acquisition (DIA) proteomic approach. After comprehensive bioinformatics analysis, significantly differentially abundant proteins (DAPs) among the three comparisons (32 DAPs in AST vs CON, 34 DAPs in MLT vs CON, 116 DAPs in AST.MLT vs CON) and their enriched molecular pathways were discovered, suggesting that AST and MLT may have synergistic effects on frozen sperm by regulating the abundance changes in proteins. In particular, certain positive proteins like ACAT2, PRDX6, G6PD, HSP90a, HSPA8, HSL, ACTN1, and Ezrin, and negative proteins like Cyt <i>c</i>, CTSF, and AFU, which are tightly associated with the regulation of sperm motility, oxidative stress, and other metabolic processes, may serve as novel potential biomarkers for evaluating sperm quality after freeze-thawing. In conclusion, this study provides valuable insights into the protective effects of AST and MLT on ram semen quality and replenishes information for further clarifying the molecular mechanism based on the modification of the sperm proteome during cryopreservation.

CA10
Also flagged:gene expressiongliomafocal adhesiontumormalignant neoplasms of the central nervousbrain malignancies
Journal Article 2026-05-08 ✓ 1 Snippet Wang Y, Li L, Hu X, Han L, Zhang Y, Zhou Z, Liu W, Yang S.
In-Text Gene Mentions

…as LOXL1, C2CD4A,CA10, EGFR-AS1, CPA4, and…

Show Full Abstract

<h4>Background</h4>Glioma exhibits significant molecular heterogeneity, necessitating improved understanding of molecular subtypes for personalized treatment strategies.<h4>Methods</h4>This study integrated bulk RNA sequencing (GSE35169) to derive transcriptome-defined groups and single-cell RNA sequencing (GSE131928) to characterize cellular heterogeneity and EGFR-associated malignant cell programs. Differential gene expression analysis identified subtype-specific biomarkers. Single-cell analysis included cell-type annotation, pseudotime trajectory, and cell-cell communication inference, with malignant cells stratified by EGFR expression to interrogate EGFR-associated programs. Key findings were validated by qRT-PCR in glioma cell lines (LN229, U251) and normal astrocytes (NHA).<h4>Results</h4>Two transcriptome-defined groups were identified from bulk RNA-seq. In scRNA-seq, the EGFR-high malignant cell state showed enrichment of ECM-related genes (IGFBP2, COL1A1) and enhanced PI3K-AKT, focal adhesion, and angiogenic signaling, with predominant stromal-to-tumor communication (EGF/AREG→EGFR, TGFB1→TGFBR2). The EGFR-low malignant cell state exhibited higher expression of immune-related genes (CXCL10, IL6, STAT1). Functional enrichment analysis based on differentially expressed genes (FDR < 0.05) indicated significant enrichment of interferon signaling and JAK-STAT pathway-related gene sets in the EGFR-low group. Pseudotime analysis revealed gradual transcriptional transitions between proliferation, hypoxia, and immune programs. qRT-PCR validation confirmed elevated EGFR, IGFBP2, and COL1A1 in U251 cells, and higher CXCL10, IL6, and STAT1 in LN229 cells.<h4>Conclusion</h4>This study identifies bulk transcriptome-defined groups and reveals EGFR-associated malignant cell programs linked to distinct microenvironmental interaction patterns. The EGFR-high malignant cell state features proliferative and angiogenic programs, while the EGFR-low malignant cell state shows enhanced immune infiltration. These findings provide molecular evidence for precision classification and subtype-specific therapeutic strategies.

Also flagged:digestionmetabolisminfectioninflammatory responsesenteritisreverse transcription
Journal Article 2026-05-08 No Snippets Wu H, Wang M, Ouyang Q, Zhang X, Liao L, Wang Y, Tang N, Wang Z.
Show Full Abstract

Although Flammulina velutipes residues are increasingly used in fish feeds, their mode of action in the gut is poorly defined. Here, we show that feeding Gymnocypris eckloni diets supplemented with F. velutipes stem-base (FVS) or its polysaccharides (FVP) selectively enhance foregut morphology-increasing both villus height and muscle layer thickness-without affecting mid- or hindgut regions. Transcriptome profiling revealed that 1831 differentially expressed genes (DEGs) were generated by FVS diet in the foregut mainly enriched in the signalling pathways related to DNA replication, fat digestion and absorption and HIF-1 signalling pathway. In addition, the differential genes between the FVP group and the control group were enriched in cell adhesion molecules, MAPK signalling pathway and cytokine-cytokine receptor interaction. Consistent with this, KEGG enrichment highlighted HIF-1α and MAPK as key pathways activated by FVS and FVP, respectively. Importantly, FVP also shifted the gut microbiota composition, boosting Weissella and other putative beneficial bacteria. These findings imply that F. velutipes has the potential to strengthen the intestinal barrier and improve intestinal health, offering valuable insights for the aquaculture of G. eckloni.

SLC9C2
Also flagged:Male infertilitypsychological stressoligoasthenozoospermiametabolismmultisystem disorderinfertility
Journal Article 2026-05-08 ✓ 2 Snippets Zheng JC, Jin ZR, Liu BH, Tian Y, Li JX, Cai J, Jiang H, Xing GG.
In-Text Gene Mentions

SLC9C2, which encodes the…

…physiological role ofSLC9C2(NHE11) has yet…

Show Full Abstract

Male infertility is linked to chronic psychological stress, however, the mechanisms underlying chronic stress-induced oligoasthenozoospermia (OAZS) remain incompletely elucidated. Here, we establish a chronic forced swim stress (CFSS) rat model and identify a gut microbiota-testis/epididymis axis as the mediator. CFSS activates the HPA axis, leading to elevated corticosterone levels. The excessed glucocorticoid compromises gut barrier integrity via glucocorticoid receptor signaling, resulting in depletion of Lactobacillus and disruption of vitamins A/E metabolism. These deficits promote upregulation of Sting1. Concurrently, epididymal transcriptomics analysis reveals downregulation of Slc9c2 as the basis for impaired sperm motility. Notably, restoration of Lactobacillus and dietary supplementation with vitamins A/E ameliorate OAZS phenotypes. Genetic targeting Sting1/Slc9c2 in CFSS model rats treated with vitamins A/E, validating the involvement of vitamin A/E metabolism-Sting1/Slc9c2 axis in mediating CFSS-induced OAZS. These findings redefines OAZS as a multisystem disorder driven by gut microbial-metabolic-testis/epididymis axis dysregulation and proposes microbiota-targeted therapies for chronic stress-induced infertility.

CCDC92
Also flagged:-2 infectionacidificationendosomesdegradationInnate immunityviral infection
Journal Article 2026-05-08 ✓ 1 Snippet Krey K, Risso-Ballester J, Hamad S, Maidl S, Bilekova S, Emslander Q, Verin M, Mundigl S, Cernat A, Piras A, Bergant V, Grass V, Pichlmair A.
In-Text Gene Mentions

…Bunyaviruses 15 ,CCDC92against Ebola virus…

Show Full Abstract

The innate immune system requires the activity of interferon-stimulated genes (ISGs) to mount its protective response against viruses. However, the activity of ISGs against viruses varies widely and is orchestrated by the interplay of hundreds of ISGs. Utilizing a time-resolved, arrayed loss-of-function screen, we systematically investigate 285 ISGs for their virus-modulating activity against eight viruses. The quantitated data from the screen results do not necessarily result in similar quantitative biological effects of gene function but indicates virus specificity of many ISGs and pan-proviral activity of some ISGs, such as RNA 2',3'-cyclic phosphate and 5'-OH ligase (RTCB). Co-depletions of selected candidates identify ISGs with synergistic functions, highlighting particularly strong synergies between ISGs inhibiting entry pathways and ISGs involved in IFN signaling. Among unexplored ISGs, we identify BORCS8, which has a particularly prominent role in modulating SARS-CoV-2 infection. Mechanistically, BORCS8 mediates the acidification of early endosomes during viral entry, a process known to facilitate the degradation of virus particles. Collectively, this extensive resource reveals specificities of ISGs identified in this screening system and suggests potential strategies for antiviral treatment options.

SUDS3
Also flagged:deathgene expressionopioid overdoseopioid addictionoverdoseaddiction
Journal Article 2026-05-08 ✓ 1 Snippet Carter JK, Quach BC, Willis C, Minto MS, Hancock DB, Montalvo-Ortiz J, Corradin O, Logan RW, Walss-Bass C, Maher BS, PGC-SUD Epigenetics Working Group, Johnson EO.
In-Text Gene Mentions

…FLT3LG, RGS4, CENPF,SUDS3, lnc-OXR1, DST, PKD1P3,…

Show Full Abstract

Only recently have human postmortem brain studies of differential gene expression (DGE) associated with opioid overdose death (OOD) been published; sample sizes from these studies have been modest (N = 40-153). To increase statistical power to identify OOD-associated genes, we leveraged human prefrontal cortex RNA-seq data from four independent OOD studies and conducted a transcriptome-wide DGE meta-analysis (N = 272). Using a unified gene expression data processing and analysis framework across studies, we meta-analyzed 20, 098 genes and found 335 significant differentially expressed genes (DEGs) by OOD status (false discovery rate < 0.05). Of these, 66 DEGs were among the list of 303 genes reported as OOD-associated in prior prefrontal cortex molecular studies (e.g., genes/gene families OPRK1, NPAS4, DUSP, EGR). The remaining 269 DEGs were not previously reported (e.g., NR4A2, SYT1, HCRTR2, BDNF). There was little evidence of genetic drivers for the observed differences in gene expression between opioid addiction cases and controls. Enrichment analyses for the DEGs across molecular pathway and biological process databases highlight an interconnected set of genes and pathways linked to orexin and tyrosine kinase receptors through MEK/ERK/MAPK signaling to affect neuronal plasticity.

LRRC7
Also flagged:replication forkschromosomeforksmitosissynthesisreversed forks
Journal Article 2026-05-08 ✓ 5 Snippets Da Mota M, Delamarre A, Barthe A, Jackson J, Bouzalmad N, Torán-Vilarrubias A, Lin YL, Ribeyre C, Vindigni A, Pasero P, Lengronne A.
In-Text Gene Mentions

Condensinand topoisomerases cooperate…

Condensin, a structural maintenance…

Condensinis recruited to…

Condensinbinds multiple genomic…

Condensinpromotes fork restart…

Show Full Abstract

Resolving complex topological structures at replication forks is essential for faithful DNA replication, yet the underlying mechanisms remain poorly understood. Evidence from diverse eukaryotes suggests that condensin - best known for driving chromosome condensation in mitosis - may also operate during S phase to alleviate torsional stress in cooperation with topoisomerases. Here, we show in budding yeast and human cells that condensin binds stressed replication forks, where it cooperates with topoisomerases I and II to promote nascent DNA resection and restart replication. Our data indicate that condensin acts together with topoisomerase I at reversed forks to convert positive supercoils into topological DNA structures that are relaxed by topoisomerase II, enabling fork restart. These findings reveal an evolutionarily conserved role for condensin in resolving topological constraints at arrested forks, reminiscent of its function in chromosome segregation, and suggest that this activity helps prevent the formation of toxic chromosome structures during fork arrest and reversal.

POU3F2
Also flagged:GlioblastomaGBMgliomastumorgene expressionepithelial-to-mesenchymal transition
Journal Article 2026-05-08 ✓ 2 Snippets Rancati S, Campolungo M, Duarte Dalmolin G, Lau P, Furia F, Coppe A, Landuzzi F, Vecchi M, Cavalli A, Gustincich S, Tirelli N.
In-Text Gene Mentions

…stem state reprogramming:POU3F2, SOX2, SALL2, and…

…29 ] -POU3F2, SOX2, SALL2 and…

Show Full Abstract

<h4>Background</h4>We address the therapeutic relevance of glioblastoma (GBM)'s molecular characterization, focusing on whether a proneural-vs-mesenchymal classification may describe GBM heterogeneity, correlate to stemness and CD44 (a marker often, but conflictingly, used in GBM), and have a prognostic value in terms of temozolomide (TMZ) resistance.<h4>Methods</h4>We molecularly profiled 4 patient-derived GBM cells (PD-GBM) and a reference cell line (U87), validating the results in public datasets (PD-GBM, TCGA-GBM), then studying the subtype-specific response to TMZ in vitro, both under normoxia and simulated hypoxia.<h4>Results</h4>Firstly, the proneural subtype transcriptionally and phenotypically correlates with higher stemness. Secondly, CD44 inversely correlates to stemness, acting as a mesenchymal marker both intra-tumorally (FACS-sorted CD44<sup>LOW</sup> cells had higher stemness than CD44<sup>HIGH</sup>) and inter-tumorally (also in larger datasets). Further, mesenchymal PD-GBM cells are also enriched in other hyaluronic acid (HA) surface receptors, proneural in matrix HA receptors. Finally, although TMZ stimulates a general mesenchymal shift in all cells, there are proneural-specific responses: this subtype resists TMZ better under hypoxia (vs. normoxia) in a first treatment, and in a second treatment (vs. single) under normoxia.<h4>Conclusion</h4>PD-GBM show clear proneural/stemness and mesenchymal/CD44 correlations, which may bear prognostic significance, as more proneural/stem GBMs appeared more capable to develop TMZ resistance.

SERPINC1
Also flagged:tumorcanceragingwound healinghepatocellular carcinomacancers
Journal Article 2026-05-08 ✓ 1 Snippet Weng Y, Chen C, Cai Y, Gao F, Situ J, Wu J, Zhang G, Chen X, Jiang D.
In-Text Gene Mentions

…regulated by APOC3,SERPINC1, APOC1, SLC27A5, and…

Show Full Abstract

<h4>Background and aims</h4>Hepatocellular carcinoma (HCC) is a prevalent global cancer. Most patients with HCC are diagnosed at an advanced stage. Therefore, new biomarkers and treatments are urgently needed.<h4>Methods</h4>We employed eQTL and intersected the results with aging-related genes, ultimately identifying ATP13A2 as the target gene for our study. The expression and intercellular communication of ATP13A2 in HCC were analyzed using single-cell RNA sequencing (scRNA-seq) and spatial transcriptomics sequencing (stRNA-seq). Subsequently, we utilized the Deep Learning Survival Neural Network (DeepSurv) model to construct a prognostic model. Additionally, we performed RNA sequencing (RNA-seq) analysis. In vitro, CCK8, cell wound healing, and flow cytometry assays were used to identify the potential functions of ATP13A2 in HCC cells.<h4>Results</h4>ATP13A2 is positively associated with HCC risk. scRNA-seq analysis demonstrated that ATP13A2 + malignant cells exhibited stronger interactions with tumor microenvironment (TME) cells. stRNA-seq analysis revealed that ATP13A2 + malignant cells were significantly spatially correlated with TME cells. The DeepSurv prognostic model indicated that HCC patients with high risk scores had a significantly lower survival rate than those with low risk scores. In vitro, knockdown of ATP13A2 affected the proliferation, apoptosis, and migration of HCC cells.<h4>Conclusion</h4>The ATP13A2 gene is closely related to TME, and its high expression is indicative of poor prognosis. ATP13A2 has the potential to serve as a biomarker for prognosis and efficacy assessment of HCC and may offer a new therapeutic target for its treatment.

Also flagged:bipolar disorderdendritic spinemismatch repairbrain cell communicationimmune responsesynaptic vesicle
Journal Article 2026-05-08 No Snippets Davarinejad O, Moradi MT, Safarzadeh A, Jalalvand M, Kazemisafa F.
Show Full Abstract

<h4>Background</h4>Bipolar disorder (BD) exhibits significant sex differences in its frequency, symptom presentation, and treatment response, suggesting distinct underlying neurobiological mechanisms. However, transcriptomic studies investigating these sex-specific pathways have been fragmented and underpowered.<h4>Method</h4>We conducted the first meta-analysis of post-mortem brain RNA-seq data to delineate sex-related transcriptomic landscapes in BD. We integrated data from four public datasets (GSE80336, GSE80655, GSE202537, GSE42546) from GEO and Array Express, comprising an aggregate of 173 individuals (66 BD cases and 117 controls). After preprocessing and correcting for batch effects, sex-stratified expression analysis was performed using DESeq2. A meta-analysis was conducted with the metafor package to identify differentially expressed genes (DEGs) at an FDR < 0.05. We also performed functional enrichment, protein-protein interaction (PPI) network analysis, hub gene identification, regulatory network reconstruction, and supplementary quantitative analyses of sex-specific interaction effects.<h4>Results</h4>Our results reveal striking differences in transcriptomic signatures between men and women with bipolar disorder, with the most pronounced changes occurring in the brain. A meta-analysis across brain regions identified 34 significantly dysregulated genes. In females, upregulated genes were enriched for hormonal signaling (FSHR pathway, G-protein signaling) and transcriptional/epigenetic regulation (GLIS1, neural plasticity). In males, upregulated genes were involved in synaptic calcium signaling (PDLIM5, dendritic spine regulation) and DNA mismatch repair pathways (PMS1). Analysis of the striatum identified 289 differentially expressed genes. The most significantly upregulated genes in females were implicated in immunity and synaptic plasticity, while the male-specific pattern pointed to alterations in basic cellular functions like structure, internal communication, and genetic regulation. A quantitative interaction analysis revealed a negligible correlation (r = -0.122) between disease effect sizes in females and males and identified one gene with opposing, sex-dependent dysregulation (MEF2C).<h4>Conclusion</h4>This study provides robust evidence that bipolar disorder engages fundamentally distinct molecular pathways in males and females, underscoring the necessity of integrating sex as a biological variable in psychiatric research and advancing toward personalized therapeutic strategies.

PRDX6
Also flagged:Neurodegenerative dementiasADLewy body dementiafrontotemporal dementiadementiadegenerative dementia
Journal Article 2026-05-08 ✓ 4 Snippets Comas-Albertí A, Lladó A, Esteller-Gauxax D, Borrego-Écija S, Falgàs N, Dakterzada F, Pérez-Millan A, Puey R, Collet-Romà T, Guillén N, Massons M, Tort-Merino A, Augé JM, Fernandez-Villullas G, Bosch B, Ruiz-García R, Naranjo L, Balasa M, Piñol-Ripoll G, Antonell A, Sánchez-Valle R.
In-Text Gene Mentions

…6.98 × 10⁻⁵),PRDX6(logFC = 0.575,…

…found upregulation ofPRDX6, FLT1, CX3CL1, and…

PRDX6contributes to antioxidant…

…and higher IL9,PRDX6, and CX3CL1 in…

Show Full Abstract

<h4>Background</h4>Fluid protein studies in cerebrospinal fluid (CSF) and plasma have provided important insights into neurodegenerative dementias; however, there is a limited investigation of sex-related differences and cross-biofluid relationships. In Alzheimer's disease (AD), Lewy body dementia (LBD), and frontotemporal dementia (FTD), large-scale, sex-stratified analyses of paired CSF and plasma samples remain scarce. Using the multiplex and ultrasensitive capabilities of NULISAseq™ technology, this study aims to characterize sex- and disease-specific proteomic alterations associated with Central Nervous System (CNS) pathology to explore underlying mechanisms.<h4>Methods</h4>CSF and plasma samples from 359 individuals with AD, LBD, FTD, and cognitively healthy controls were analyzed using the NULISAseq™ CNS Disease Panel 120. Differential protein expression analyses were conducted across diagnoses and stratified by sex, adjusting for relevant covariates. Spearman's correlation analyses were performed to assess concordance between CSF and plasma protein levels. All statistical analyses were conducted in R v4.4.3.<h4>Results</h4>Differential protein expression analyses across diagnoses revealed two potential transdiagnostic biomarkers: ICAM1 in CSF and ANXA5 in plasma, showing consistent increases across AD, LBD, and FTD. Sex-stratified analyses in CSF showed modest changes, including higher CCL26, ANXA5, and IL10 in females with AD, and higher IL9, PRDX6, and CX3CL1 in males with AD. In LBD, females exhibited upregulation of ACHE, SFRP1, POSTN in both CSF and plasma. NPTX1 was identified as a potential CSF biomarker for FTD, showing downregulation particularly in males. In contrast, analyses stratified by sex in plasma displayed a larger number of proteins across all dementias, with females showing a higher number of upregulated inflammation-related proteins predominantly involved in cytokine signaling. Overall cross-fluid correlations were restricted to a small subset of proteins, indicating compartment-specific regulation.<h4>Conclusions</h4>This study represents a large-scale, sex-stratified proteomic analysis of CSF and plasma across major neurodegenerative dementias using NULISAseq™ technology. The findings highlight sex-dependent biomarker patterns, particularly in plasma, and underscore the importance of incorporating sex as a biological variable in dementia research. Future studies should validate candidate proteins in independent cohorts, investigate their functional and mechanistic roles, and assess their utility for biomarker development and sex-tailored therapeutic strategies.

TNFSF4DNAH10
Also flagged:hepatocellular carcinomaskeletal disorderstumorscancercancerscell proliferation
Journal Article 2026-05-08 ✓ 2 Snippets Wang R, Zhang X, Ren B, Zhou W.
In-Text Gene Mentions

…TNFSF15, TNFSF18, andTNFSF4.…

…in TP53, SASH1,DNAH10, TDRD5, and COL7A1.…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) faces a critical shortage of prognostic biomarkers and therapeutic targets. While solute carrier family 26 member 2 (SLC26A2) is known to be involved in skeletal disorders and even tumors, its specific role in HCC pathogenesis remains undefined.<h4>Methods</h4>We utilized public databases to conduct a comprehensive analysis of SLC26A2 across 33 different cancer types. Additionally, we performed in vitro and in vivo experiments to investigate the functional role of SLC26A2 in the biological behavior of HCC and to explore its mechanistic pathways.<h4>Results</h4>A pan‑cancer analysis revealed significant variability in SLC26A2 mRNA and protein levels, with prognostic implications across cancers. In HCC, SLC26A2 was identified as an independent risk factor for poor overall survival (HR = 1.539, 95% CI 1.084-2.186, p = 0.016) and correlated with higher pathological grade. Functional assays showed that silencing SLC26A2 inhibited HCC cell proliferation, migration, and invasion, while promoting apoptosis; conversely, overexpression led to opposite outcomes. Notably, silencing SLC26A2 significantly increased intracellular ROS, which was linked to subsequent modulation of the JNK/ERK/p38 MAPK signaling pathway-an effect suggested to be reversible by the antioxidant N‑acetylcysteine. In vivo studies demonstrated that silencing SLC26A2 suppressed subcutaneous tumor growth in an HCC xenograft model. Additionally, bioinformatics analysis predicted a competing endogenous RNA regulatory axis comprising the SNHG3/LINC00662-hsa-miR‑122‑5p-SLC26A2.<h4>Conclusion</h4>Our study identifies SLC26A2 as a clinically relevant biomarker and candidate therapeutic target in HCC. Mechanistically, SLC26A2 modulates JNK/ERK/p38 MAPK activity in a manner involving ROS signaling. While its biological roles extend beyond HCC, the clinical implications are most pronounced in this malignancy.

HFE
Also flagged:hormone synthesiscell cycleferroptosisdeath-reperfusioncancers
Journal Article 2026-05-08 ✓ 1 Snippet Maeda A, Nita A, Sashiyama S, Yoshitomo S, Jepkosgei KJ, Xu Y, Arima Y, Nakayama KI, Araki K, Moroishi T.
In-Text Gene Mentions

…hereditary hemochromatosis (Hfe-deficient) mouse models,…

Show Full Abstract

Iron and oxygen are essential for numerous biological processes, yet monitoring their bioactive intracellular dynamics in vivo remains challenging due to the limitations of current detection methods. Here, we introduce the labile iron and oxygen notifier (LiON), a genetically encoded, ratiometric fluorescent reporter enabling single-cell-resolution monitoring of intracellular iron and oxygen levels in vivo. In cultured cells, LiON responds dynamically to physiologically relevant changes in iron and oxygen levels. Using LiON-knockin mice, we revealed heterogeneous distribution of iron and oxygen across tissues, cell types, and even among individual cells of the same type. Thus, LiON offers a platform for studying iron and oxygen metabolism in living organisms, providing insights into the cellular diversity of iron and oxygen utilization and their roles in physiology and disease.

CDK5RAP1
Also flagged:pairingmitochondrialbiosynthesiscytoplasmicnucleuselectron transfer
Journal Article 2026-05-08 ✓ 5 Snippets Maio N, Rouault TA.
In-Text Gene Mentions

…cytosolic tRNAs, whereasCDK5RAP1catalyzes the formation…

…enzymes include CDKAL1,CDK5RAP1, TYW1, and ELP3.…

…CDKAL1 andCDK5RAP1are homologous radical…

…6 A), whereasCDK5RAP1acts primarily on…

…203 ), whereasCDK5RAP1dysfunction has been…

Show Full Abstract

Composed of iron (Fe) and inorganic sulfur (S), iron-sulfur clusters (ISCs) are ancient cofactors present across all domains of life and in some viruses. Over the past 3 decades, cytosolic and nuclear Fe-S proteins have emerged as integral components of DNA replication and repair machineries, telomere maintenance pathways, transcriptional processes, cell cycle regulation, and protein synthesis. More recently, ISCs were identified in viral proteins, including multiple components of the SARS-CoV-2 replication and transcription complex (RTC), which collectively host seven experimentally verified Fe-S cofactors. The coexistence of multiple ISC-dependent enzymes within both cellular and viral replication machineries raises fundamental questions about how these metal cofactors coordinate genome maintenance, replication, and host-virus interactions. Here, we provide an inventory of known mammalian nucleocytoplasmic Fe-S proteins, discuss mechanisms of ISC acquisition, explore the potential roles of ISCs within cellular and viral replication complexes, and highlight critical gaps in our understanding of ISC delivery, coordination, and function among Fe-S proteins in large multi-subunit assemblies.

DARS2
Also flagged:Mitochondrial Diseasemitochondrialmitochondrial diseasescerebral small‐vessel diseasemitochondrial disordersstroke
Journal Article 2026-05-08 ✓ 4 Snippets Mickelsson N, Hirvonen J, Martikainen MH.
In-Text Gene Mentions

…(LBSL) caused byDARS2variants [ 14…

…c.492+2T>C (p.M134_K185del) inDARS2in all three…

…patients carrying pathogenicDARS2variants consistent with…

…such as LBSL (DARS2) and POLG‐related disease.…

Show Full Abstract

Primary mitochondrial diseases frequently affect the central nervous system, yet the extent, distribution and progression of white matter hyperintensities (WMHs) remain insufficiently characterised, particularly in terms of quantitative volumetrics and longitudinal progression. Although WMHs are typically attributed to cerebral small-vessel disease, mitochondrial disorders may cause white matter injury through distinct vascular and metabolic mechanisms. We conducted a retrospective single-centre study at Turku University Hospital including 36 patients with mitochondrial disease, each with at least one brain MRI (73 images). Longitudinal data were available for 15 patients. Three-dimensional T1-weighted and FLAIR images (1.5/3 T) were analysed with the FDA-cleared cNeuro tool to obtain intracranial volume-normalised WMH and lesion volumes and an automated global Fazekas score. At baseline (median age 49 years), WMHs were present in all supratentorial regions. Over time, WMH volumes increased significantly in periventricular, deep and juxtacortical regions, while lesion progression was predominantly periventricular. Fazekas scores remained generally low and stable. In follow-up imaging, women and patients carrying the m.3243A>G variant showed a greater burden of WMHs and lesions, compared with men and those with other mitochondrial diagnoses. WMH load did not differ according to history of stroke-like episodes. Mitochondrial disease is associated with early and progressive WMH accumulation, particularly in individuals with the m.3243A>G variant, and the pattern exceeds what would be expected from conventional vascular risk factors alone. These findings support a disease-specific mechanism of white matter vulnerability and highlight the importance of quantitative MRI for monitoring progression in mitochondrial disease.

HTT
Also flagged:protein synthesismetabolismcircadian rhythmserythropoiesisinfectionsgestation
Journal Article 2026-05-08 ✓ 1 Snippet Gendrot B, Vaillancourt C, Fouquet G.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Tryptophan is an essential amino acid required for protein synthesis and a precursor of key bioactive metabolites produced through the kynurenine, indole and serotonin pathways. Beyond its nutritional role, tryptophan metabolism critically regulates the nervous, immune and endocrine systems, coordinates circadian rhythms via melatonin, and exerts antioxidant effects. These processes are profoundly remodeled during pregnancy. Pregnancy represents a unique physiological state characterized by systemic adaptations, including changes in immunity and erythropoiesis, while the placenta emerges as a central organ coordinating fetal development, maternal-fetal exchanges, immune tolerance, and protection against external infections. Increasing evidence indicates that tryptophan availability and its downstream metabolites play key roles in maintaining maternal-fetal and placental homeostasis. In particular, serotonin, traditionally viewed as a neurotransmitter, has emerged as a locally produced signaling molecule in the placenta, impacting trophoblast development, placental vascularization, and immune modulation. Dysregulation of tryptophan metabolic pathways has been associated with pregnancy complications and adverse developmental outcomes. This review aims to provide an overview of tryptophan metabolism during gestation, with a specific focus on serotonin as a key factor in placental homeostasis. Targeting tryptophan-derived pathways may offer novel opportunities to improve maternal and neonatal health.

HTT
Also flagged:Insomniasleepobstructive sleep apneaneurodegenerative diseasesdementianucleus
Journal Article 2026-05-08 ✓ 1 Snippet Li H, Liang R, Li Z, Cui W, Hu Y, Zuo G, Zhu H, Zhang X.
In-Text Gene Mentions

…Mutation Caused AberrantHttto Anterograde Axonal…

Show Full Abstract

<h4>Background</h4>Chinese herbal medicine has a long history of treating insomnia with excellent curative effects; however, the underlying mechanisms remain unclear. This study discusses the mechanism and curative effects of the main Chinese herbal medicines in the Bushen Anzhi recipe for managing aging-related insomnia (ARI).<h4>Methods</h4>The insomnia dataset GSE98582 was obtained from the Gene Expression Omnibus database and included 342 samples from individuals with insomnia and 213 control samples. In total, 931 neuroinflammatory targets were identified in the GeneCards and molecular signatures (MSigDB) databases. The active components corresponding to <i>Radix Rehmanniae Preparata</i>, <i>Cornus officinalis</i>, <i>Rhizoma dioscoreae</i>, <i>Poria cum Radix Pini</i>, and <i>Polygala tenuifolia</i> were obtained from the Traditional Chinese Medicine Systems Pharmacology and HERB databases. Multi-level interactive network and enrichment analyses of overlapping targets were performed using the STRING, MSigDB, and GeneMANIA websites. Sixty male Sprague Dawley rats were divided into three groups: control (Con, n=20), aging-related insomnia (ARI, n=20), and aging-related insomnia Bushen Anzhi recipe treatment (ARI-BSAZ, n=20). In the ARI group, d-galactose and parachlorophenylalanine were injected intraperitoneally to create an aging-related insomnia rat model. Bushen Anzhi formulation was administered by gavage; Polysomnography, Morris water maze, open-field tests, western blot, and ELISA analyses were performed to assess the effects of this Chinese herbal medicine in managing insomnia.<h4>Results</h4>A total of 25 effective components and 16 neuroinflammation and drug target-related differentially expressed genes were screened. Multi-level network and enrichment analyses showed that Bushen Anzhi mainly regulated cellular biological processes through core target genes such as HIF1A, PTGS2, and GSK3B. Furthermore, compared with the ARI group, the Bushen Anzhi recipe was also found to contribute to increases in total sleep and slow-wave sleep times; significant reductions in escape latency time; increases in fourth quadrant residence time, average movement speed, and amount of wall climbing; reductions in the levels of GSK-3β; and increases in the levels of β-catenin and Wnt3a.<h4>Conclusion</h4>The Bushen Anzhi recipe may alleviate ARI through a complex multi-level interaction network, with findings suggesting a potential association with the regulation of the Wnt signaling pathway, though further experimental validation is warranted.

HFE
Also flagged:age-related macular degenerationvisionneovascular AMDneurodegenerative diseaseblindnessaging
Journal Article 2026-05-08 ✓ 1 Snippet Sannan NS.
In-Text Gene Mentions

…populations: ACE, CCL2,HFE, HIF1A, MYRIP, SKIV2L,…

Show Full Abstract

<h4>Background</h4>Age-related macular degeneration (AMD) is a leading cause of vision loss, with genetic factors playing a key role in disease susceptibility and progression. While extensive genetic research is being conducted, the genetic architecture of AMD in Middle Eastern populations remains understudied. This systematic review summarizes current evidence on genetic variants associated with AMD in Middle Eastern populations.<h4>Methods</h4>A comprehensive literature search was conducted in PubMed, Web of Science Core Collection, and Medline databases. Studies were included if they: (1) examined cohorts from Middle Eastern participants; (2) with clinically diagnosed AMD; (3) explored genetic variants or other genomic markers; (4) no restrictions on year of publication; and (5) were published in English.<h4>Results</h4>The search yielded 449 articles (PubMed: 164, Web of Science: 99, Medline: 186). After removal of 221 duplicates, 228 unique articles were screened. Of these, 28 studies met the inclusion criteria, covering a total of 4,247 AMD cases and 3,447 controls from five countries: Turkey (n = 11), Iran (n = 11), Israel (n = 4), Jordan (n = 1), and Egypt (n = 1). Most analyses were targeted, with 25 studies targeting one to four genetic loci, two studies examining 12 variants, and one genome-wide association study. The most frequently studied genes were CFH, ARMS2, and HTRA1. The CFH Y402H variant (rs1061170) showed overall positive but heterogeneous associations with AMD risk across studied Middle Eastern populations, with reported odds ratios ranging from 0.36 to 17.34 and statistically significant p values ranging from <0.001 to 0.02 (total AMD cases and controls = 2,079). The ARMS2 A69 S variant (rs10490924) and HTRA1 promoter variant (rs11200638) demonstrated strong associations with neovascular AMD.<h4>Conclusion</h4>Few studies have examined genotype-phenotype correlations across this region, and many Middle Eastern countries lack published AMD genetic data. Consequently, the genetic landscape of AMD in the Middle East remains incompletely characterized. Available evidence suggests that variants in CFH, ARMS2, and HTRA1 are important AMD-associated loci in studied Middle Eastern populations, consistent with findings in other population groups.

TNFSF4
Also flagged:pathogenesislocalizationheart failurecardiovascular diseasesinterstitial fibrosisextracellular
Journal Article 2026-05-08 ✓ 1 Snippet Zhao L, Zhou Y, Sun J, Liu S, Liu W, Li A.
In-Text Gene Mentions

…ICOS, NRP1, PDCD1LG2,TNFSF4, TNFSF15, and TNFSF18…

Show Full Abstract

<h4>Background</h4>Heart failure (HF) is a major global public health challenge, and its pathogenesis involves the regulation of a complex immune microenvironment (IME). Cell-in-cell (CIC), as a non-classical form of cell-cell interaction, has been extensively studied in fields like oncology, but its role in HF remains unclear. This study aimed to systematically analyze the expression patterns and functions of CIC-related genes (CRGs) within the HF immune microenvironment.<h4>Methods</h4>Based on transcriptomic data from public databases, CIC-related differentially expressed genes (DEGs) between HF and healthy samples were identified. Three machine learning algorithms-Random Forest, LASSO, and SVM-RFE-were employed to screen diagnostic markers and construct a nomogram model. Consensus clustering analysis was used to stratify HF patients into distinct subtypes based on CRG expression, and their immune infiltration characteristics were compared. Single-cell transcriptomic data were utilized to validate the cellular localization of key genes within the HF microenvironment. Experimental validation of key CRGs was performed using a transverse aortic constriction (TAC)-induced HF rat model.<h4>Results</h4>A total of 21 CIC-related DEGs were identified. A diagnostic model comprising 10 core genes demonstrated high predictive performance in both the training and validation sets. Based on CRG expression, HF patients were classified into two subtypes: Subtype A was enriched with regulatory T cells and M2 macrophages, exhibiting an immunosuppressive and fibrotic phenotype; Subtype B was dominated by cytotoxic T cells and NK cell infiltration, displaying an immune-activated phenotype. Single-cell analysis revealed high expression of CTSK in fibroblasts and enrichment of GZMB in T/NK cells. Animal experiments confirmed the upregulation of LPAR2 and GZMB and the downregulation of IL-10 in the TAC model.<h4>Conclusion</h4>CIC-related genes possess significant diagnostic value in HF and can distinguish HF subtypes with distinct immune microenvironment features. CRGs may participate in HF progression by regulating immune cell infiltration and fibrotic processes, providing a new perspective for understanding HF heterogeneity and developing targeted immunotherapies.

Also flagged:Allergic rhinitis-infectious nasal mucosal diseasenasal congestionsleepasthmapathogenesis
Journal Article 2026-05-08 No Snippets Wang Z, Cai J, Wu J, Zheng H, Shi M, Tong Y, Hou Y, Jia Z, Qi H.
Show Full Abstract

<h4>Background</h4>Allergic rhinitis (AR) is a prevalent chronic inflammatory disorder characterized by persistent inflammation and nasal epithelial barrier disruption. Restoring epithelial integrity and modulating the inflammatory cascade are considered promising therapeutic strategies for AR.<h4>Purpose</h4>This study aims to systematically investigate the therapeutic efficacy of Yuping Tongqiao Tablet (YPTQ), a traditional Chinese medicine formula, in the treatment of AR and to decipher its potential mechanisms and active ingredients focusing on inflammation amelioration and barrier restoration.<h4>Methods</h4>An AR model was established in Sprague-Dawley rats that were sensitized and challenged with OVA. After intervention with different doses of YPTQ, nasal pathological injury and inflammatory cell infiltration were evaluated. <i>In vitro</i>, a human nasal epithelial cell (RPMI-2650) injury model was induced using house dust mites (HDM). Following YPTQ treatment, the expression levels of inflammatory factors and barrier-related proteins were assessed. Furthermore, the potential mechanisms and targets of YPTQ and its active monomers against AR were investigated by integrating network pharmacology analysis and molecular docking with <i>in vitro</i> experiments.<h4>Results</h4>In the OVA-induced AR rat model, YPTQ effectively alleviated nasal symptoms, reduced histopathological damage and inflammatory cell infiltration, and suppressed overall inflammatory levels. In the HDM-induced RPMI-2650 cell injury model, YPTQ significantly inhibited inflammatory cytokines release and upregulated the tight junction protein ZO-1, thereby enhancing epithelial barrier function. Moreover, integrated analysis combining network pharmacology, molecular docking, and both <i>in vitro</i> and <i>in vivo</i> validation confirmed that YPTQ and its active ingredient, kaempferol, exert therapeutic effects through two main pathways. Firstly, they down-regulated the expression of TSLP and inhibited the migration of DCs, which subsequently alleviated nasal inflammation. Secondly, they up-regulated and activated the expression of AhR and the downstream CYP1A1, which in turn promoted the expression of a barrier-associated protein, contributing to the restoration of nasal epithelial barrier integrity.

Also flagged:Cancertumortumorsmetastatic tumorsextracellularorganization
Journal Article 2026-05-08 No Snippets Ramalingam PS, Ilma B, Hussain MS, Jakhmola V, Fatima R, Rana AJ, Agrawal M, Ashique S, Mekala JR, Arumugam S.
Show Full Abstract

The epithelial-mesenchymal transition (EMT) is a central plasticity program in cancer. It enables carcinoma cells to acquire migratory, invasive, immunomodulatory, and therapy-resistant phenotypes. As a result, EMT is a key driver of metastatic progression and poor prognosis. This overview summarizes recent mechanistic innovations across EMT-inducing transcription factors (SNAIL, SLUG, TWIST, ZEB) and their interactions with major signaling cascades, including TGF-β/SMAD, Wnt/β-catenin, Notch, PI3K/AKT/mTOR, and Hippo (YAP/TAZ). Together, these cascades integrate cues from the TME to sustain partial/hybrid EMT states and maintain cancer stemness. We present a review of epigenetic and post-transcriptional regulation of EMT (DNA methylation, histone regulation, and non-coding RNAs) and their role in reversible states transitions and drug tolerance. The translational section highlights advance in biomarker development and limitations of the static, single-timepoint assays in capturing EMT dynamics. We describe the possibilities of longitudinal, multimodal assessment, such as liquid biopsy, spatial profiling, and integrative multi-omics, for real-time monitoring of EMT states. Moreover, we explore the therapeutic opportunities involving epigenetic regulators, RNA-based interventions, EMT-immune crosstalk target, and selected natural products that modulate EMT circuits. Lastly, we propose a precision-oncology model that can consolidate the use of EMT-state stratification (epithelial-predominant, hybrid-mesenchymal, mesenchymal-predominant), adaptive monitoring, and rational combination therapies (with immunotherapy, ferroptosis inducers, and targeted agents) to overcome metastasis and resistance. Taken together, positioning EMT as a continuous, druggable spectrum, over binary switch, allows patient stratification using biomarkers and supports the development of next-generation interventions to reduce the risk of metastasis and enhance long-term clinical outcomes.

Also flagged:synthesisorganizationdegradationbiodegradationwound healingto
Journal Article 2026-05-08 No Snippets Najafloo M, Naji L, Eberl C.
Show Full Abstract

Programmable materials are an emerging class of matter capable of dynamically altering their properties, structure, or function in response to external stimuli. While most research has treated chemical and mechanical responsiveness separately, integrating these domains through mechanochemical design opens new avenues for intelligent, adaptive systems. This review explores how chemical reactivity and molecular interactions can be harnessed alongside mechanical deformation to create materials with controllable behavior across multiple scales. Key topics include force-activated molecular units (mechanophores), stress-guided chemical patterning, and materials whose structure-function relationships evolve under load. We highlight the role of machine intelligence in accelerating the discovery and optimization of programmable metamaterials, emphasizing inverse design, data-driven property prediction, and autonomous adaptation. Applications in soft robotics, shape-memory systems, self-healing materials, and smart coatings are discussed, focusing on chemomechanical feedback loops enhanced by computational tools. Multiscale modeling approaches that integrate chemical kinetics, mechanical stress analysis, and AI-guided generative design are also reviewed. By bridging polymer science, molecular chemistry, mechanical engineering, and artificial intelligence, this framework enables the design of materials that are not only responsive but predictive and self-evolving. Current challenges including scalability, reversibility, and durability are considered, alongside future directions toward biologically inspired, resilient material systems.

HTT
Also flagged:autoimmune diseasesAIDsHDarthropathyAIDHashimoto thyroiditis
Journal Article 2026-05-08 ✓ 5 Snippets Heyd M, Landwehrmeyer GB, Lewerenz J.
In-Text Gene Mentions

…the Huntingtin (HTT) gene.…

…Although the mutantHTTprotein is expressed…

…toxicity of mutantHTTmRNA, toxicity of…

…of the mutantHTTprotein, including its…

…intraneuronal accumulation ofHTTprotein aggregates and…

Show Full Abstract

<h4>Background</h4>In Huntington's disease (HD), signs of inflammatory activation are found in the brain, cerebrospinal fluid, and blood. HD monocytes are reported to be hyperreactive <i>in vitro.</i> Thus, HD mutation might affect the immune system.<h4>Aim</h4>To explore the frequency of autoimmune diseases (AIDs) in HD mutation carriers (people with the HD mutation, PwHD) compared to control participants (CPs) as markers of immune dysfunction related to CAG triplet expansion in the Huntingtin (<i>HTT</i>) gene.<h4>Methods</h4>Analysis of the Enroll-HD periodic dataset #5 (European sites) was conducted. Definite AIDs, coded using the abbreviated ICD-10 in the dataset for comorbidities, were identified. AIDs were grouped by organ specificity into arthropathy-dominant AIDs of musculoskeletal and connective tissues (arthropathic), as well as endocrine, dermatological, and gastrointestinal AIDs.<h4>Results</h4>Although AID frequency was not different in PwHD (709/10,594; 6.7%) compared to CPs (176/2,477; 7.1%, <i>p</i> = 0.451), the AID subgroup distribution differed (<i>p</i> = 0.033) with endocrine AIDs being less frequent in PwHD [odds ratio (OR): 0.80; 95% confidence interval (95% CI) 0.68-0.95], while dermatological AIDs tended to be more common [OR (95% CI): 1.13 (0.94-1.38)]. These observations were explained by a reduced frequency of Hashimoto thyroiditis in PwHD [OR (95% CI): 0.69 (0.56-0.86)], while carriership of the HD mutation was associated with an increased risk of psoriasis [OR (95% CI): 1.27 (1.03-1.60)]. Among PwHD, those with an AID had lower CAG repeats [median (interquartile range): 42 (41-44)] than those without [43 (41-45), <i>p</i> < 0.0001]. When adjusted for sex and age, each extra pathological CAG repeat reduced the AID risk [OR (95% CI): 0.69 (0.61-0.78), <i>p</i> < 0.001]. The CAG dependency of the AID frequency among PwHD was mostly explained by arthropathic AID. In a well-defined early-manifest PwHD core group, each additional CAG repeat reduced the likelihood of an AID<sub>arthro</sub> when adjusted for functional impairment, sex, and age at enrollment with an odds ratio of 0.57 (95% CI: 0.44-0.74, <i>p</i> < 0.0001).<h4>Conclusion</h4>Both the presence and the exact size of the pathological CAG triplet expansion in the <i>HTT</i> gene differentially affect the frequency of certain AIDs. Our results support the idea that HD mutations affect immune function, but in a complex, disease-specific pattern.

ZNFX1
Also flagged:ADMSMDinfectionsmycobacterial infectionpathogenesissynthesis
Journal Article 2026-05-08 ✓ 3 Snippets Qian M, Zhou J, Zhou Q, Zeng Q, Shao L, Zhang W, Ruan Q.
In-Text Gene Mentions

…STAT1, TBX21, IFNG,ZNFX1, CCR2 ) and…

…USP18 , andZNFX1can lead to…

…CCR2, CYBB andZNFX1disrupt IFN-γ-mediated anti-my…

Show Full Abstract

Mendelian susceptibility to mycobacterial disease (MSMD) is a rare inborn error of immunity characterized by heightened susceptibility to low-virulence non-tuberculous mycobacteria. Despite the widespread application of next-generation sequencing, the molecular etiology of approximately 50% of patients remains elusive. To date, 22 genes have been implicated, all converging on the IL-12/23-IFN-γ circuit, underscoring its non-redundant role in controlling intracellular pathogens. Isolated MSMD is characterized by a selective predisposition to one or more mycobacterial and related infections. But syndromic MSMD's clinical phenotypes are highly heterogeneous; apart from mycobacterial infections, patients may suffer from viral, bacterial, or fungal diseases, and can additionally manifest auto-inflammation, malignancy, or cutaneous involvement. Current MSMD management mainly hinges on prolonged antimicrobial therapy or align with recombinant human interferon-γ (rhIFN-γ), although allogeneic hematopoietic stem cell transplantation (HSCT) remains the sole curative yet high-risk option; gene editing is still experimental. Priorities are early high-risk identification, targeted intervention and full-process management.

TNFSF4
Also flagged:innate immunityimmune responseschronic kidney diseasewound healingsepsisimmune depression
Journal Article 2026-05-08 ✓ 1 Snippet Yang P, Fang P, Sun L, Liu L, Fu L, Xi H, Wang X, Bouchareb R, Zhang D, Wu Q, Ji Y, Yang X, Wang H.
In-Text Gene Mentions

…high MC, andTnfsf4and Cxcl10 in…

Show Full Abstract

<h4>Rationale</h4>Inflammatory monocyte (MC) subset polarization is a hallmark of systemic and tissue inflammatory feature in diabetes. The underlying molecular mechanism remains unclear.<h4>Methods and results</h4>Blood pro-inflammatory Ly6C<sup>high</sup> and anti-inflammatory Ly6C<sup>low</sup> MC subsets were isolated from control (C57/BL6), type 1 diabetes mellitus (T1DM), and type 2 diabetes mellitus (T2DM) mice by flow cytometry sorting and subjected to bulk high-throughput RNA-sequencing. Intensive and integrative functional bioinformatic studies were performed by analyzing the transcriptome through seven pairs of comparison between Ly6C<sup>high</sup> and Ly6C<sup>low</sup> MC subsets and between different mouse groups. We examined molecular features of three key immune activation signals in innate and adaptive immune responses, including signal 1 antigen (Ag)-presenting, signal 2 immune checkpoint, and signal 3 cytokine, and their upstream transcription factors (TF). A total of 10 differentially expressed genes (DEG) of MHC-II molecules (signal 1) presented a low expression profile in Ly6C<sup>high</sup> MCs from all mice and mostly further reduced in T2DM Ly6C<sup>high</sup> MC. Ly6C<sup>high</sup> MCs show high intercellular inflammatory propagation based on immune checkpoint/cytokine-ligand expression but low intracellular inflammatory capacity based on immune checkpoint/cytokine-receptor expression, both further enhanced in T1/T2DM. In contrast, Ly6C<sup>low</sup> MCs exhibit low intercellular propagation but high intracellular inflammatory capacity; both also increased in T1/T2DM. Furthermore, 921 upstream DEG transcription factors and 17 transcriptional axes were recognized in diabetic Ly6C<sup>high</sup> MCs by IPA upstream regulator analysis. Finally, three critical transcriptional axes that drove the altered immunological phenotype in Ly6C<sup>high</sup> MCs were recognized: ↓PAX5-↓CIITA-↓Cd74/H2-Eb2 for reduced Ag-presenting power, ↓MYC-↑Sema4a for elevated intercellular inflammatory propagation capacity, and ↑CEBPA/E-↑Csf2ra/3r for enhanced intracellular inflammatory propagation capacity in MC.<h4>Conclusions</h4>We have three major discoveries: 1) Ly6C<sup>high</sup> MCs exhibit lower Ag-presenting power, which was further suppressed in T2DM, mostly via ↓PAX5-↓CIITA-↓CD74 regulation. 2) Ly6C<sup>high</sup> MCs display high intercellular inflammatory propagation but low intracellular inflammatory capacity, both further enhanced in T1/T2DM, mostly via ↓MYC-↑Sema4a and ↑CEBPA/E-↑Csf2ra/3r regulation. 3) Ly6C<sup>low</sup> MCs acquired additional intercellular and intracellular inflammatory capacity in T1/T2DM.

SERPINC1
Also flagged:Fetal Growth Disordersgestational diabetes mellitusintrauterine growth restrictionIUGRplacental insufficiencymacrosomia
Journal Article 2026-05-08 ✓ 4 Snippets Starodubtseva N, Tokareva A, Frankevich N, Kononikhin A, Bugrova A, Indeykina M, Kukaev E, Derenko A, Frankevich V, Nikolaev E, Sukhikh G.
In-Text Gene Mentions

…CP ), andantithrombin-III( SERPINC1 ),…

…and antithrombin-III (SERPINC1), were selected…

…CP , andSERPINC1, were identified.…

…Reduced CP andSERPINC1may indicate depletion…

Show Full Abstract

This prospective study evaluated first-trimester markers in pregnancies with isolated and combined forms of fetal growth disorders and gestational diabetes mellitus (GDM). Among 1869 screened women, the analysis included 83 controls, 55 GDM, 22 isolated intrauterine growth restriction (iIUGR), and 33 isolated large-for-gestational-age (iLGA) cases, with GDM subgroups stratified by fetal growth (GDM with normal fetal weight, GDM + IUGR, and GDM + LGA). First-trimester clinical and routine biochemical parameters were recorded, and serum concentrations of 80 proteins were measured using targeted LC-MRM-MS proteomics. Different trajectories emerged: IUGR phenotypes showed low PAPP-A/PlGF and high TSH (<i>p</i> < 0.01), indicating early placental insufficiency, while macrosomia showed opposite trends. GDM + IUGR represented the most severe "double hit" phenotype (lowest PlGF, earliest delivery), whereas GDM + LGA showed increased umbilical artery resistance despite excessive growth, suggesting endothelial dysfunction. Targeted proteomics revealed characteristic signatures: iIUGR featured low complement (<i>C4A|C4B</i>) and IGF proteins (<i>IGFALS</i>, <i>IGFBP3</i>) versus GDM and iLGA (<i>p</i> < 0.001); GDM + IUGR showed elevated <i>PZP</i> and <i>CD5L</i> versus iIUGR (<i>p</i> < 0.05); GDM + LGA was marked by high <i>C4BPA</i> and low <i>RBP4</i>, <i>SERPINA7</i> versus iLGA (<i>p</i> < 0.05). Complement and IGF pathways were consistently implicated. Machine learning achieved 77% sensitivity for IUGR prediction using clinical parameters and 88% sensitivity for LGA prediction using proteomic data. These findings demonstrate that fetal growth disorders represent pathophysiologically unique entities detectable in the first trimester, enabling early risk stratification and personalized management.

Also flagged:bindingInfluenza infectionhost cellglycosylationinfluenzalentiviral infection
Journal Article 2026-05-08 No Snippets Zhang T, Fang Y, Liu J, Guo A, Yuan B, Zhang Y, Ding L, Ye Q.
Show Full Abstract

The hemagglutinin (HA) of influenza A/H3N2 virus evolves rapidly, with glycosylation driving immune evasion. However, how host microenvironmental cues influence this process remains poorly understood. We identified a novel N-linked glycosylation site at position 110 (N110) in contemporary H3N2 viruses (NSS genotype) that enhances viral fitness by increasing receptor-binding signal, HA cleavage, and replication. Remarkably, hypoxia, which mimics the respiratory tract microenvironment, significantly augments N110 glycosylation. Mechanistically, we identified the B4GAT1-B4GALT1 complex as the key mediator of this modification. Hypoxia upregulates their expression and strengthens their interaction with HA. In ferret models, N110-glycosylated viruses exhibit heightened pathogenicity and evade ancestral antibodies. Furthermore, immunization with N110-containing HA confers broad-spectrum protection, whereas reciprocal immunization is ineffective. Our findings reveal hypoxia-driven glycosylation as a previously unrecognized mechanism of H3N2 adaptation, providing critical insights for vaccine efficacy and highlighting the importance of integrating microenvironmental factors into future antiviral strategies.

SERPINC1
Also flagged:venous thromboembolismAT deficiencythrombophiliaspreeclampsiadeathantithrombin deficiency
Journal Article 2026-05-08 ✓ 2 Snippets Diemer B, Iversen N, Othman L, Hempel EL, Chaireti R, Bremme K.
In-Text Gene Mentions

…analysis of theSERPINC1gene was performed…

…genotype in theSERPINC1gene and AT…

Show Full Abstract

<h4>Background</h4>Hereditary antithrombin (AT) deficiency is a risk factor for venous thromboembolism (VTE) and for obstetric complications and warrants thromboprophylaxis in certain situations. AT deficiency is divided into subtypes with different risk profiles. There is limited knowledge on the specific risks in pregnant women depending on the subtypes.<h4>Objectives</h4>The study aim was to investigate whether genotyping pregnant women with AT deficiency could aid in determining complication risk and subsequently help to individualize antepartum and postpartum treatment.<h4>Methods</h4>This retrospective cohort study included 43 women with AT deficiency with 106 (61 treated, 40 untreated, and 5 unknown) pregnancies between 1990 and 2022 managed at Karolinska University Hospital. Data were gathered on maternal characteristics, heredity and a history of VTE, thrombophilias, treatment during pregnancy, and maternal and neonatal outcome.<h4>Results</h4>Genotyping of AT deficiency was performed, and the women were subsequently divided into low- (<i>n</i> = 26) and high-risk (<i>n</i> = 17) groups. Types I, IIPE, and IIRS were considered high risk, and type IIHBS low risk. In the low-risk group, 6 untreated women (24%) developed preeclampsia, compared with none among the treated (<i>P</i> = .005). Additionally, there were 5 cases (20%) of intrauterine fetal death among the untreated women in the low-risk group, compared with none among the treated women (<i>P</i> = .014). We did not find a statistically significant difference in incidence of VTE or other pregnancy complications between the high-risk and low-risk groups.<h4>Conclusion</h4>Our results suggest that untreated women with type IIHBS have a high risk of pregnancy complications, which might warrant thromboprophylaxis regardless of VTE risk.

GPR52
Also flagged:chemotaxis
Journal Article 2026-05-08 ✓ 1 Snippet Alexander SPH, Bennett KA, Brown AJ, Glass M, Gloriam DE, Hanson J, Insel PA, Kelly E, Langmead CJ, Martemyanov KA, Neubig RR, Offermanns S, Rosenkilde MM, Schulte G, Smith NJ, Wu H, Faccenda E, Harding SD, Davenport AP.
In-Text Gene Mentions

…( GPR21, GPR27,GPR52, GPR85, and GPR88…

Show Full Abstract

In this review, we, on behalf of the Nomenclature and Standards Committee of the International Union of Basic and Clinical Pharmacology, describe criteria for assessing the evidence for pairing receptors with endogenous/physiological ligands for formal receptor deorphanization. This process is illustrated through consideration of the class A G protein-coupled receptors (GPCRs) not yet formally paired with an endogenous/physiological ligand by the Nomenclature and Standards Committee of the International Union of Basic and Clinical Pharmacology. Of the 67 orphan class A GPCRs considered, 25 class A GPCRs have no identified endogenous agonists, although 5 (GPR21, GPR27, GPR52, GPR85, and GPR88) have synthetic ligands that have the potential to be used as tools for uncovering physiological roles and further pharmacological properties of these receptors. Surprisingly, 6 orphan GPCRs (GPR135, GPR152, GPR153, MRGPRF, MRGPRG, and MRGPRX3) have no clear pharmacology or phenotype reported following genetic disruption. Thirty-two orphan GPCRs have been paired with at least 1 endogenous agonist (mainly lipids and their derivatives, peptides, and other metabolites), but further characterization is required from the scientific community to validate these results. We identify 10 orphan class A GPCRs for which there are plausible grounds for considering deorphanization: GPR4 (protons), GPR15 (GPR15L), GPR31 (12S-hydroxyeicosatetraenoic acid), GPR39 (zinc divalent ions, Zn<sup>2+</sup>), GPR65 (protons), GPR68 (protons), GPR132 (9-hydroxyoctadecadienoic acid), GPR183 (7α,25-dihydroxycholesterol), MRGPRD (β-alanine), and MRGPRX1 (bovine adrenal medulla peptide 8-22). The issue of nomenclature for these 10 GPCRs will be considered by further subcommittees of the Nomenclature and Standards Committee of the International Union of Basic and Clinical Pharmacology. We hope this review will prompt further investigations into these members of the currently most widely clinically exploited protein superfamily. SIGNIFICANCE STATEMENT: The use of systematic, rational nomenclature for drug targets provides a framework to ensure consistent identification and rapid recognition. Given that G protein-coupled receptors have fundamental physiological roles and are widespread targets of drugs in current clinical use, we hope the target summary and deorphanization criteria provided here will prompt renewed efforts to investigate these orphan receptors as regulators of physiology and as opportunities for future therapeutic exploitation.

Also flagged:metabolitebiosynthesissynthesisdegradationmetabolismCancer
Journal Article 2026-05-08 No Snippets Cheng Y, Pham HTT, Tu P, Huang L, Cui X.
Show Full Abstract

<h4>Background</h4><i>Panax vietnamensis</i> is a medicinally valuable species whose wild populations are threatened by overexploitation, necessitating the development of sustainable, high-yielding cultivation systems.<h4>Method</h4>A six-year systematic assessment was conducted on three artificial cultivation models: standard field (SF), artificial forest (AF), and wild forest (WF). Growth parameters, biomass production, and saponin content (via HPLC-ELSD) were measured. Furthermore, non-targeted metabolomic analysis (LC-MS/MS) was employed to elucidate the metabolic mechanisms underlying yield and quality in SF-grown plants.<h4>Results</h4>The SF model produced the highest biomass at year five, significantly outperforming the AF and WF systems, while achieving competitive total saponin content.Metabolomic profiling identified the fifth year as a pivotal developmental transition, characterized by the coordinated upregulation of secondary metabolite biosynthesis and stress adaptation pathways, alongside a significant enrichment of the key saponin precursor dimethylallyl diphosphate in taproots. Moreover, a functional division of labor was observed: rhizomes primarily synthesized precursors, whereas taproots functioned as the primary sink for saponin storage, indicating an efficient resource allocation strategy.<h4>Conclusion</h4>This study establishes the five-year SF model as a scientifically grounded and sustainable cultivation protocol for <i>P. vietnamensis</i>. These findings advance our understanding of how cultivation-driven metabolic shifts mediate quality enhancement, providing a framework that integrates agricultural productivity with species conservation.

SLC2A14
Also flagged:metabolismTuberculosisTBinfectionMtb infectionphosphorylation
Journal Article 2026-05-07 ✓ 1 Snippet Brown K, Walsh A, Yennemadi AS, Murphy DM, Connolly SA, Jameson G, O'Sullivan MP, Basdeo SA, O'Leary S, Leisching G, Keane J.
In-Text Gene Mentions

…, SLC2A5 andSLC2A14) compared to…

Show Full Abstract

Tuberculosis (TB)-associated mortality remains disproportionately high among people living with HIV (PLWH), with macrophage dysfunction representing a key mechanism of impaired host defence against Mycobacterium tuberculosis (Mtb) infection. Macrophage metabolic switching has emerged as a paradigm of host success, yet the influence of HIV on this 'Warburg' response in the context of Mtb infection has not been studied. Using the U1 chronically HIV-infected macrophage cell line model coupled with primary human monocyte-derived macrophages (MDMs) exposed to HIV-1 gp120, we systematically characterized transcriptomic and immunometabolic perturbations during Mtb infection. Nanostring RNA analysis revealed that Mtb monoinfection upregulated glycolytic genes while suppressing oxidative phosphorylation (OXPHOS) transcripts, consistent with a Warburg-type metabolic shift. Conversely, HIV infection downregulated glycolytic enzymes and enhanced OXPHOS. Coinfection studies demonstrated HIV-mediated suppression of Mtb-induced glycolytic reprogramming. Extracellular flux analysis demonstrated that gp120 exposure increased basal oxygen consumption rate while impairing spare respiratory capacity in Mtb-infected MDMs, effectively blocking the Warburg metabolic transition. Notably, gp120 attenuated Mtb-induced TNF-α secretion and impaired macrophage control of Mtb growth. This study reveals that HIV gp120 blocks the protective Warburg response to Mtb and highlights the potential of host-directed therapies that boost glycolysis or its downstream effectors (e.g. TNF-α) as adjunctive strategies in TB/HIV co-infection.

Also flagged:mitochondrialtranslationalneurodegenerative diseaseneurodegenerative diseasesamyotrophic lateral sclerosisAD
Journal Article 2026-05-07 No Snippets Liu H, Hu C, Liu H, Gong Z, Jiang S, Xie J, Li Y, Liu C, Wang Y, Zou C, Yang G.
Show Full Abstract

The cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway is a central cytosolic DNA-sensing module that links DNA damage and mitochondrial dysfunction to innate immune activation. Here, we focus on canonical cGAS-STING signaling in the central nervous system (CNS) and discuss non-canonical branches only when directly relevant to neurodegeneration. We summarize structural and activation-termination mechanisms and synthesize cell-type-biased outputs across microglia, astrocytes, neurons, and oligodendroglial lineage cells. We then integrate Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease by mapping shared DNA-stress triggers to multicellular amplification loops and by grading causal evidence from genetic perturbation, pharmacological pathway interference, and correlative human datasets. Finally, we classify inhibitor modalities and emerging enabling technologies while emphasizing translational constraints, including blood-brain barrier (BBB) delivery, long-term safety, human STING-allele diversity, and pharmacodynamic biomarkers. Collectively, we propose an evidence-calibrated framework for judging when cGAS-STING is most plausibly positioned as a causal node, a permissive amplifier, or a secondary correlate in neurodegenerative disease, and where therapeutic translation should proceed cautiously.

Also flagged:membraneextracellularangiogenesistissue homeostasissynthesisdegradation
Journal Article 2026-05-07 No Snippets Burkhard T, Milne E, Qian K, Campagnolo P, Santamaria S.
Show Full Abstract

Pericytes (PCs) are perivascular cells that lie in close association with endothelial cells (ECs), with both cell types embedded within a shared basement membrane (BM), a specialised form of extracellular matrix (ECM). PCs regulate vascular integrity, angiogenesis and capillary blood flow and are capable of differentiating into other cell types including fibroblasts and smooth muscle cells. In recent years, a central role for PCs in regulating the development and maturation of the vasculature, maintaining tissue homeostasis and directing the pleiotropic remodelling of tissues during regeneration has emerged. Here, we review how PCs contribute to the synthesis and remodelling of the ECM in different pathophysiological conditions. Moreover, we provide an atlas of the PC matrisome, the complex of ECM molecules expressed by PCs, based on recent transcriptomics (in particular single-cell RNA sequencing) and proteomics datasets, with the caveat that such an entity does not exist in isolation due to the physical and paracrine interactions between PCs, ECs and other cell types. Understanding the role of PCs in modulating their microenvironment through active synthesis and degradation of specific matrisome components is essential to understand the role these plastic cells play in angiogenesis and in different pathologic conditions, including stroke, Alzheimer's disease and cancer.

LRRC7
Also flagged:response
Journal Article 2026-05-07 ✓ 1 Snippet Bandopadhyay L, Basu D, Sikdar SR.
In-Text Gene Mentions

…esponsive Arabidopsis thalianaLap1homologue (RI01; GenBank…

Show Full Abstract

Leucine aminopeptidases (LAPs) are multifunctional enzymes with roles in both defence and development. In plants, they are reported to be induced by wound-inflicting Lepidopteran insects and regulate wound response pathways leading to an effective defence response. Infestation by Hemipteran mustard aphid, Lipaphis erysimi (L.) Kaltenbach has been reported to induce wound response as well as a wound-responsive Arabidopsis thaliana Lap1 homologue (RI01; GenBank Accession: JK034053) in Rorippa indica (L.) Hiern. This is interesting as Hemipteran insects like aphids are assumed to inflict minimal wounding. In the present study, starting with the RI01 sequence information, we isolated the full length (1566 bp) sequence of a novel R. indica Lap (RiLap) gene, performed in silico analyses and developed transgenic R. indica plants with suppressed RiLAP activity by expressing a 565 bp antisense fragment of RiLap cDNA. We found that the isolated RiLAP is an acidic LAP of M17 family and suppressing it causes a significant increase in aphid herbivory but reduction in total chlorophyll content and possibly photosynthetic capacity in aphid infested transgenic plants of the T1 generation. These findings though preliminary suggest that RiLap could have a role in deterring aphids by acting as a regulatory protein simultaneously balancing defence response and photosynthetic capacity or plant growth. Noting the dearth of research in this area, this pilot study will be useful for designing future in depth analyses in understanding the role of Laps in defence response against Hemipteran insects. The study has implications in the development of sustainable pest management avenues.

TNFSF4
Also flagged:deathmetabolismbreast cancertumorcancerbinding
Journal Article 2026-05-07 ✓ 1 Snippet Yan T, Yu B, Qian F, Fang L, Zhao Y, Ye D.
In-Text Gene Mentions

…immunological checkpoint genesTNFSF4and CD276 in…

Show Full Abstract

<h4>Objective</h4>Disulfidptosis is a recently discovered mechanism of cell death caused by disulfide stress. Arachidonic acid metabolism (AAM) is one of the metabolic mechanisms of polyunsaturated fatty acids. However, few studies have explored the relationship between disulfidptosis and AAM and how together they affect breast cancer prognosis. The aim of this study was to establish a prognostic model of disulfidptosis and arachidonic acid metabolism in breast cancer and to investigate the potential mechanisms of disulfidptosis and arachidonic acid in breast cancer.<h4>Method</h4>A comprehensive approach including single-cell sequencing analysis (scRNA-seq), weighted gene coexpression network analysis (WGNA), and transcriptome differential expression analysis was used to investigate this relationship. Cox regression and Lasso regression analysis were used to screen for arachidonic acid metabolism and disulfidptosis-related genes (AAMDRGs) in breast cancer. This study also comprehensively analyzed the risk score of AAMDRGs, as well as clinical features, tumor microenvironment, somatic mutations, immunotherapy, drug sensitivity, and molecular docking data.<h4>Result</h4>Seven genes associated with disulfidptosis and AAM (ATP5F1B, RPL4, PRDX1, TCP1, CLDN7, GSTK1, PYCARD) were identified in this study. These genes were used to establish a prognostic model related to disulfidptosis and arachidonic acid in breast cancer. The model had excellent performance. Multi-indicator ROC analysis, DAC, and C-index all suggested that the model had high prediction accuracy. This study found that RPL4 is a key candidate gene that can serve as a biomarker for BC, with low expression associated with a poorer prognosis in cancer patients. In addition, this study found that axitinib has a predicted potential pharmacological binding relationship with RPL4 based on molecular docking analysis, which provides a basis for future preclinical and clinical validation studies.<h4>Conclusion</h4>This machine learning-driven disulfidptosis-related and arachidonic acid metabolism-related model provides clinically actionable prognostic stratification, outperforming conventional gene signatures in precision oncology applications. RPL4 is a potential candidate biomarker associated with disulfidptosis and AAM-related pathways in breast cancer, and its potential as a therapeutic target requires further experimental validation.

HTT
Also flagged:spinal and bulbar muscular atrophySBMAnucleusneurodegenerative diseases/polyglutamine (polyQ) disordersage-dependent degenerative diseases
Journal Article 2026-05-07 ✓ 1 Snippet Kuo CJ, Chopp LB, Yu Z, Ni L, Zhao HT, Lim J, Lieberman AP.
In-Text Gene Mentions

…fragment of theHTTgene ( 46…

Show Full Abstract

Skeletal muscle pathology is a critical but poorly understood contributor to neuromuscular degeneration in spinal and bulbar muscular atrophy (SBMA), a CAG/polyglutamine (polyQ) expansion disorder caused by mutation in the androgen receptor (AR). Using a gene-targeted SBMA mouse model, we applied single-nucleus RNA sequencing to identify a disease-specific population of skeletal muscle myonuclei that replaced normal myonuclear subtypes. This transition was associated with dysregulation of the pathway governed by PGC-1α, a central regulator of myofiber specification and metabolic identity. PGC-1α dysfunction in SBMA muscle was age, hormone, and polyQ length dependent and was partially rescued by subcutaneous delivery of AR-targeted antisense oligonucleotides. Integrated ChIP-seq and RNA-seq analyses revealed that aberrant PGC-1α activity promoted the expression of a distinct set of myofiber specification genes while downregulating those that define healthy Type IIb and Type IIx myonuclei. We propose a model in which this dysfunction arose downstream of polyQ-mediated sequestration of PGC-1α cofactors MEF2, CREB, and CBP, leading to transcriptional reprogramming and cellular dysfunction. These findings implicated PGC-1α dysregulation as a key event linking AR polyQ expansion to skeletal muscle degeneration and suggested a shared mechanism for polyQ-mediated muscle pathology across related neurodegenerative diseases.

Also flagged:signal transductionbinding
Journal Article 2026-05-07 No Snippets Dong YJ, Xi K, Zhang YZ, Xue JH, Shen DD, Zang SK, Zhao R, Qi H, Mao C, Wang WW, Zhang Y.
Show Full Abstract

G protein-coupled receptor 174 (GPR174), a key modulator of autoimmune responses, maintains immune homeostasis through distinct G protein signaling pathways, particularly Gs and Gi. Although the structural mechanism of lysophosphatidylserine (LysoPS)-activated GPR174 in the Gs pathway has been characterized, how hydration-mediated interactions influence GPR174 activation and signaling selectivity remains unclear. Here, we determined high-resolution cryo-electron microscopy (cryo-EM) structures of LysoPS-activated human GPR174 bound to Gs (2.0 Å) and Gi (3.4 Å), revealing a continuous hydration-mediated signal transduction network that bridges the sodium-binding pocket, the NPxxY and DRY motifs, and the G protein-binding interface. This network stabilizes the active-state conformation of GPR174 and dynamically reshapes the intracellular cavity, thereby enabling differential engagement of Gs and Gi. Molecular dynamics simulations and functional assays demonstrated that the hydration network is essential for receptor activation and selectively modulates G protein coupling. To evaluate its conservation, we performed sequence alignments and structural analyses across class A GPCRs, defining three hydration cavities: the conserved water cavity (CWC), the junctional water cavity (JWC), and the extended water cavity (EWC), whose hydration is determined by residue properties at position 5.58. Together, our study reveals a hydration-driven molecular mechanism that underlies the activation of GPR174 and its dual G protein selectivity. These findings advance the understanding of hydration-mediated signaling in GPR174 and provide a framework for investigating water-mediated regulation across class A GPCRs.

STAU1
Also flagged:neurodegenerative proteinopathiesamyotrophic lateral sclerosisALScytoplasmicTDP-43 proteinopathiesbehavioral
Journal Article 2026-05-07 ✓ 1 Snippet Copley KE, Mauna JC, Danielson HL, Chen Q, Ozguney B, Ngo M, Xie L, Smirnov A, Davis M, Mayne L, Linsenmeier M, Rubien JD, Bergmann CA, Portz B, Lee BL, Odeh HM, Lai L, Chang YW, Hallegger M, Ule J, Pasinelli P, Poon Y, Mittal J, Fawzi NL, Black BE, Donnelly CJ, Jensen BK, Shorter J.
In-Text Gene Mentions

STAU1

Show Full Abstract

Aberrant aggregation of the prion-like RNA binding protein TDP-43 drives several fatal neurodegenerative proteinopathies, including amyotrophic lateral sclerosis (ALS). In this work, we define how short, specific RNAs solubilize TDP-43. These short RNAs engage and stabilize the TDP-43 RNA recognition motifs, which allosterically destabilizes a conserved helical region in the prion-like domain, thereby promoting aggregation-resistant conformers. Sequence-space mining identified short RNA chaperones with enhanced activity against TDP-43 and disease-linked variants. Enhanced short RNA chaperones mitigated aberrant TDP-43 phenotypes in optogenetic models and in ALS patient-derived and control motor neurons. In mice with cytoplasmic TDP-43 aggregation and motor neuron loss, an enhanced short RNA chaperone reduced pathological aggregation, restored TDP-43 function, and conferred neuroprotection. These results define a mechanistic and therapeutic framework for RNA-based strategies to counter TDP-43 proteinopathies.

TRIM38
Also flagged:liver fibrosisHepatic fibrosischronic liver diseasedegradationfibrosiscirrhosis
Journal Article 2026-05-07 ✓ 5 Snippets Zeng C, Liu J, Jin Z, Zhong S, Wu R, Luo H, Zeng T, Yang Y, Zhou Z.
In-Text Gene Mentions

…or together with His-TRIM38.…

…the E3 ligaseTRIM38mediates UBE2G2-dependent ubiq…

…by UBE2G2 andTRIM38.…

…of UBE2G2 andTRIM38resulted in a…

…either UBE2G2 orTRIM38alone (Fig. S5D…

Show Full Abstract

Hepatic fibrosis is a pivotal stage in which chronic liver disease progresses from reversible injury to decompensation. Liver sinusoidal endothelial cells (LSECs) play a regulatory role in hepatic stellate cells (HSCs) activation through paracrine signaling; therefore, maintaining the physiological phenotype of LSECs is critical for antifibrotic intervention. Spermidine (SPD) has been recognized for its antifibrotic properties; however, its impact on LSECs' function and the underlying mechanism remains largely unknown. In this study, analysis of NHANES data revealed an inverse association between dietary SPD intake and fibrosis risk. Consistently, in vivo and in vitro models demonstrated that SPD significantly ameliorated LSECs dysfunction and attenuated fibrosis progression. Through an integrative analysis incorporating proteomics, public single-cell datasets, and machine-learning prioritization, we identified LSECs-derived biglycan (BGN) as a principal target of SPD; notably, BGN overexpression diminished the capacity of SPD to restore LSECs function and facilitated HSCs activation. Mechanistically, SPD activated NRF2 to increase UBE2G2 expression, thereby enhancing UBE2G2-dependent ubiquitination and degradation of BGN. UBE2G2 knockdown reversed SPD-induced BGN downregulation, subsequently exacerbating LSECs capillarization and enhancing HSCs activation. Furthermore, Bgn overexpression in the CCl<sub>4</sub>-induced mouse model markedly attenuated the ability of SPD to improve LSECs dysfunction and its antifibrotic efficacy. In conclusion, our findings uncover a novel mechanism whereby SPD ameliorates LSECs dysfunction and suppresses fibrosis progression by modulating LSECs-derived BGN, suggesting a new therapeutic strategy for liver fibrosis. Schematic working model of the study. SPD promotes UBE2G2-dependent ubiquitination and proteasomal degradation of BGN, thereby attenuating ERK/p38 phosphorylation, ameliorating LSECs dysfunction, and suppressing HSCs activation.

Also flagged:ferroptosisdeathcancergliomamelanomametabolism
Journal Article 2026-05-07 No Snippets Tabnak P, Ebrahimnezhad M, HajiEsmailPoor Z.
Show Full Abstract

Ferroptosis, an iron-dependent programmed cell death pathway driven by lipid peroxidation, offers a transformative approach to cancer therapy by exploiting unique cellular vulnerabilities. This comprehensive review elucidates the intricate molecular mechanisms of ferroptosis and their modulation by genetic mutations across diverse malignancies, including lung, hematological, liver, colorectal, breast, glioma, renal, pancreatic, thyroid, prostate, cervical, gastric, and melanoma. We delineate the critical functions of ferroptosis regulators, such as GPX4, system Xc⁻, and iron metabolism proteins, in orchestrating the delicate balance between oxidative damage and antioxidant protection. The study further examines how oncogenic mutations in genes like EGFR, KRAS, TP53, KEAP1, and IDH1 reshape ferroptosis susceptibility or resistance through alterations in metabolic pathways, redox homeostasis, and tumor microenvironment interactions. By highlighting mutation-specific sensitivities, this work underscores the potential of ferroptosis-targeted strategies to surmount therapeutic resistance, synergize with conventional treatments like chemotherapy and immunotherapy, and drive precision oncology forward, paving the way for enhanced clinical outcomes across a broad spectrum of cancers.

TNFSF4
Also flagged:gastric cancertumourhaematoxylincancerepidermal growth factor receptorEGFR
Journal Article 2026-05-07 ✓ 3 Snippets Ji J, Zhang X, Hua M, Wang M, Li H, Zheng X, Wang L, Wang H, Song Y, He J, Qin R, Cao Y, Zhang Q, Ge K, Wang Y, Zhang H, Lou S, Han P, Cao L.
In-Text Gene Mentions

…onstrated significantly higherTNFSF4(OX40L) expression in…

…analysis revealed significantTNFSF4overexpression in the…

TNFSF4(OX40L) is known…

Show Full Abstract

Prognostic stratification in gastric cancer (GC) currently relies on the tumour-node-metastasis (TNM) staging system, which incompletely captures tumour heterogeneity. Routine haematoxylin and eosin (H&E)-stained whole-slide images (WSIs) contain additional prognostic information that is not routinely quantified. We developed an interpretable deep learning framework using a weakly supervised Transformer to derive a pathological risk score (TPRS) from WSIs for overall survival (OS) stratification and adjuvant chemotherapy benefit prediction. TPRS was developed on HMU-GC (n = 2876) and validated internally (n = 288) and on TCGA-STAD (n = 355). It achieved a mean 10-fold cross-validation C-index of 0.765 ± 0.003 internally and 0.621 ± 0.005 externally, and was an independent prognostic factor. Stage III patients with high TPRS showed significant survival benefit from adjuvant chemotherapy. Mediation analysis of differentially expressed genes (DEGs) and cellular features in high-attention patches supported a 'Gene → Cellular Features → TPRS' relationship, linking transcriptomics to cellular features and TPRS.

Also flagged:depressionagingAlcoholSleepbehavioralfrailty
Journal Article 2026-05-07 No Snippets Nobre JNP, Soares LA, Teixeira LAC, Prat BV, Nobre JCL, Mourão MFS, Oliveira MCM, Barbosa BR, Silva GKA, Trindade AFV, Amarante LG, Cuellar DC, Thomassini RL, Mendonça VA, Lacerda ACR.
Show Full Abstract

Life habits can influence the aging process. However, there remains a gap in how these factors can associate frailty, independence in activities of daily living, depression and quality of life in older adults. (1) To develop an index to synthesize modifiable lifestyle factors of older adults of middle-income countries; (2) to check the relationship and the association of this index with frailty, independence in daily activities, depression and quality of life. This exploratory, cross-sectional, quantitative study included 192 community-dwelling older adults aged 60 to 96 years (M = 70.66, SD = 7.71), of whom 124 (64.6%) were women. The criteria established for the index, based on the literature, were: (1) smoking, (2) Alcohol consumption, (3) Nutrition, (4) Physical Activity, and (5) Sleep quality. Multi-attribute utility theory was applied to determine the Multicriteria Index (MI) of modifiable lifestyle factors. Pearson's correlation, simple linear regression, and multivariate analyses were conducted to examine the association between the index and clinical outcomes. The index was correlated and associated with frailty, depression, independence in daily activities and quality of life (p < 0.05). The multivariate linear regression analysis demonstrated that modifiable lifestyle factors associated with a healthy lifestyle were linked to 22% of the variation in higher quality-of-life scores and lower depression scores (p < 0.05). Modifiable lifestyle factors for a healthy lifestyle have a positive factor in contributing to overall quality of life in the aging process and healthy lifestyle habits can promote the health of older adults.

DCC
Also flagged:cancerDormant cancercell cycleextracellulartumormetabolism
Journal Article 2026-05-07 ✓ 5 Snippets Qin Y, Zhang J, Xiao Y, Zhang Y, Liu W, Luo X.
In-Text Gene Mentions

…reprogramming across distinctDCCsubtypes, elucidate the…

…bolic reprogramming—leading toDCCdeath through impaired…

…widely across distinctDCCsubtypes, and certain…

…puzzle to identifyDCC-specific metabolic regulatory…

…the field ofDCCmetabolism, breast cancer…

Show Full Abstract

Dormant cancer cells (DCCs) are non-proliferative cancer cells that enter cell cycle arrest in the G0-G1 phase and are recognized as a major cause of therapeutic resistance and cancer recurrence. In response to various intracellular and extracellular signals, DCCs undergo cellular reprogramming that confers drug resistance and enables them to evade immune surveillance. Once reactivated, these cells can resume proliferation, ultimately leading to tumor relapse. Metabolic reprogramming allows DCCs to adapt to the nutrient-deprived tumor microenvironment (TME), reduce energy consumption, and maintain redox homeostasis. Targeting these metabolic vulnerabilities provides promising opportunities to control recurrence and improve therapeutic outcomes. However, the metabolic reprogramming of DCCs is highly heterogeneous, which poses a major challenge for their complete eradication. In this review, we summarize the metabolic features of DCCs, describe the molecular mechanisms underlying metabolic reprogramming across distinct DCC subtypes, elucidate the interactive networks among distinct metabolic pathways, and discuss therapeutic strategies targeting metabolism of DCCs, with the goal of providing new insights into improving treatment efficacy and preventing recurrence.

SUDS3
Also flagged:AMLchromatinorganizationcanceracute myeloid leukemiagene expression
Journal Article 2026-05-07 ✓ 1 Snippet Tellez-Quijorna C, N'Guyen L, Serna-Pujol N, Rodies M, Homs-Aguadé P, Vernerey J, Jordan A, Duprez E.
In-Text Gene Mentions

…and regulatory functions,linker histoneshistones have been…

Show Full Abstract

Linker histone H1 variants play critical, yet distinct, roles in chromatin organization and gene regulation. However, their specificity in cancer cells is not well understood. Our previous studies have shown that acute myeloid leukemia (AML) patients who were H3K27me3HIST1-positive exhibited lower H1.3 expression and a favorable outcome. These results imply that the H1.3 linker histone may play an unknown role in AML progression. In this study, we investigated the function of the H1.3 variant in AML cells. Through chromatin mapping and transcriptomic analyses, we revealed that H1.3 was enriched in regions with a high GC content and colocalized with the repressive mark H3K27me3. This supports its role in chromatin compaction and transcriptional repression. Knockout of H1.3 induced specific changes in gene expression profiles and chromatin dynamics, characterized by a changed in H1.2 localization, which was redistributed from its usual chromatin regions to H1.3 regions. Consequently, we observed chromatin alterations associated with changes in gene programs affecting interferon-related signaling and cell cycle regulation. Overall, our study revealed a mechanistic connection between H1.3 variant imbalance, immune response activation, and cell cycle regulation, with implications for our understanding of epigenetic regulation in AML cells.

DCC
Also flagged:synapsedeath
Journal Article 2026-05-07 ✓ 3 Snippets Zhu Z, Lin W, Xiao L, Qian Z, He T, Wang W, Wang Y, Zhang X, Zhao B, Xie H, Quan X, Zhang Y, Jiang M, Li X, Zhou L, Zhang D, Yu H, Liu Z, Bao L, Jia JM.
In-Text Gene Mentions

…in colorectal cancer (DCC): unliganded DCC triggers…

…cancer (DCC): unligandedDCCtriggers neuronal loss,…

…neuronal loss, whereasDccknockout preserves vulnerable…

Show Full Abstract

Adult neuronal survival underlies lifelong brain function, yet its sustaining mechanisms remain unclear. We identify a neurovascular survival axis at intracranial arteries in mice, where superior cervical ganglion (SCG) sympathetic terminals form synapse-like neurosmooth muscular junctions (NsMJs) with arterial smooth muscle cells (aSMCs) that secrete netrin-4 (Ntn4). Adult aSMC-restricted Ntn4 deletion selectively reduces rostral, intracranial-projecting (cerebrospinal fluid-traced) SCG neurons; the denervation of the intracranial arterial plexus follows soma loss. Local recombinant Ntn4 delivery to the SCG rescues these phenotypes. Ntn4 withdrawal engages a receptor-interacting serine/threonine kinase 1 (RIPK1)/mixed lineage kinase domain-like pseudokinase (MLKL)-linked, caspase-independent, non-inflammatory death program via deleted in colorectal cancer (DCC): unliganded DCC triggers neuronal loss, whereas Dcc knockout preserves vulnerable neurons. Arterial Ntn4 declines from young adulthood and precedes selective neuronal attrition before midlife; aSMC-targeted Ntn4 overexpression prevents this loss. Together, intracranial arteries provide a local, non-cell-autonomous trophic niche that maintains this adult sympathetic subset and becomes compromised as vascular Ntn4 output wanes with age.

Also flagged:mitochondrialPDPhosphorylationmembranemitochondriabinding
Journal Article 2026-05-07 No Snippets Suresh K, Rainville C, Sterner DE, Goldberg MS, Butt TR.
Show Full Abstract

Mitochondria play a major role in cellular health, yet their contribution to chronic diseases has been underestimated. Mitochondria are essential for all tissues and are the major source of ATP in high-energy-demand organs such as brain and heart, which consequently are vulnerable to mitochondrial dysfunction. Failure to repair or remove damaged mitochondria contributes to aging and chronic diseases. Cells have evolved quality control mechanisms, including mitophagy to eliminate damaged mitochondria and mitobiogenesis to replenish them. The ubiquitin-proteasome system (UPS) is responsible for removing misfolded proteins, a process that is highly ATP dependent and therefore reliant on mitochondrial function. In turn, damaged mitochondria are eliminated through coordinated actions of the UPS and lysosomal degradation through mitophagy. Many neurodegenerative diseases are characterized by the presence of disease-specific protein aggregates, such as α-synuclein aggregates in Parkinson's disease and tau neurofibrillary tangles in Alzheimer's disease. These aggregates impair mitochondrial function, while dysfunctional mitochondria generate reactive oxygen species that further exacerbate proteotoxic stress, creating a pathogenic cycle. This highlights the functional interplay between mitochondria and the UPS. Recent studies have uncovered phosphorylation of ubiquitin at serine 65 by the mitochondrial kinase PINK1 as a key signal of mitochondrial dysfunction. Phospho-Ser65-ubiquitin (pUb) has emerged as an indicator of mitochondrial health and a potential biomarker for aging and neurodegenerative disease. However, due largely to a lack of tools, little is known about the role of pUb in cellular physiology. Here, we review the current landscape of pUb biology, the phospho-ubiquitome, and its role as biomarker for mitochondrial health and neurodegeneration.

Also flagged:Bronchopulmonary DysplasiaPulmonary hypertensionretinopathy of prematurityhearinggestationpatent ductus arteriosus
Journal Article 2026-05-07 No Snippets Jackson WM, Foote HP, Stephenson N, Kemp SM, Moore RT, Nitkin CR, Stewart D, Pryhuber GS, Berger JT, Shukla A, England A, Ford SM, Parton LA, Check JF, Hanna MH, Lagoski M, Krishnan R, Leeman KT, Vyas-Read S, Hudak ML, Katheria AC, Pillers DM, Ji J, Banfro F, Nelin LD, McCulloch M, Ahmad K, Laughon MM, Hornik CP, SILDI-SAFE Study Group.
Show Full Abstract

<h4>Objective</h4>To describe the safety of sildenafil based on hypotension in premature infants with bronchopulmonary dysplasia (BPD).<h4>Study design</h4>We conducted a multicenter, randomized, double-blind, placebo-controlled, dose-escalating trial of sildenafil. Infants born < 29 weeks' gestation and at 32-44 weeks postmenstrual age with severe BPD were randomized sequentially into 3 cohorts to receive up to 34 days of intravenous or enteral sildenafil citrate vs placebo (3:1) in a dose-escalating approach. Safety was determined by the incidence of hypotension through 28 days following the last dose of study drug. Pulmonary hypertension by serial echocardiography and daily respiratory severity scores were obtained to assess preliminary efficacy.<h4>Results</h4>A total of 122 infants received sildenafil (N = 92) or placebo (N = 30). The incidence of hypotension did not differ between the sildenafil (1/92) and placebo (0/30) groups. Serious adverse events occurred in 8% of the sildenafil group and 13% of the placebo group; retinopathy of prematurity requiring treatment in 17% and 30%, abnormal hearing results in 8% and 7%, direct hyperbilirubinemia in 4% and 3%, alanine aminotransferase elevation in 3% and 0%, and escalation in respiratory support in 7% and 20%, respectively. There were no differences in daily respiratory severity scores between groups.<h4>Conclusions</h4>Among premature infants with severe BPD, enteral sildenafil citrate did not increase the incidence of hypotension or retinopathy of prematurity. Although we found possible differences between groups in the development of BPD-associated pulmonary hypertension diagnosed by echocardiography in high-risk infants, a larger, randomized controlled trial is needed to assess efficacy.<h4>Clinical trial registration</h4>ClinicalTrials.gov; Identifier: NCT04447989.

HTT
Also flagged:SCA1autosomal dominant neurodegenerative disorderpolyQ diseasesHDspinal and bulbar muscular atrophydentatorubral-pallidoluysian atrophy
Journal Article 2026-05-07 ✓ 5 Snippets Lee C, Grijalva RM, Tejwani L, Bae E, Chase A, Ro H, Kim H, Olmos V, Orengo JP, Lim J.
In-Text Gene Mentions

…(TCF7L2) and huntingtin (HTT), which further suggest…

…TCF7L2 andHTTas potential early…

…highlighted TCF7L2 andHTTas key regulators…

…Similarly,HTT, well known for…

…of TCF7L2 andHTTas potential molecular…

Show Full Abstract

Spinocerebellar ataxia type 1 (SCA1) is a neurodegenerative disease marked by progressive motor deficits and Purkinje cell (PC) degeneration, driven by polyglutamine expansion in ataxin-1. While oligodendroglial dysfunction precedes PC loss, its direct contribution toward SCA1 pathogenesis remains unclear. Here, using an oligodendroglia-specific SCA1 conditional knockin mouse model, we demonstrate that mutant ataxin-1 in oligodendrocytes is sufficient to drive aspects of SCA1-related pathology, including dysregulated myelination, PC axonal shrinkage, and torpedo formation, ultimately impairing motor coordination. Transcriptomic analysis uncovers cerebellar oligodendrocyte subtypes with distinct gene expression signatures and aberrant abundance that contribute to demyelination. This, compounded by a progressive decline in the neuroprotective functions of a cerebellum-specific oligodendrocyte subtype, establishes a critical link between demyelination, axo-myelinic dysfunction, and axonal pathology in SCA1. Upstream transcriptional regulator analysis in oligodendroglia identifies transcription factor 7-like 2 (TCF7L2) and huntingtin (HTT) as key mediators of oligodendroglial dysfunction in SCA1, suggesting shared pathogenic mechanisms with other polyglutamine diseases. Collectively, these findings establish oligodendroglia as key mediators of SCA1 pathogenesis and underscore their critical role in preserving PC axonal integrity.

TNFSF4
Also flagged:immune responsegap junctionleaky gut syndromelumendesmosomesmetabolism
Journal Article 2026-05-07 ✓ 5 Snippets Sokale AO, Aderibigbe AS, Moore D, von Heimendahl E, Stringfellow K, Dridi S.
In-Text Gene Mentions

…IL18, Crp andTnfsf4genes on day…

…IL6, IL8, IL18,Tnfsf4, and Crp…

…IL18, Crp, andTnfsf4on day 21…

…Crp , andTnfsf4on day 21…

…member 4 (Tnfsf4) is a…

Show Full Abstract

In-feed beta-mannanase supplementation has been used for decades to improve gut health and growth performances in poultry, yet its underlying molecular mechanisms are not completely defined. The aim of the present study was to determine the effect and potential mode of action of a new endo-1,4-β-D-mannanase (Natupulse® TS, NPU) on gut integrity and growth performances of turkeys. A total of 640 one-day-old male Hybrid Converter poults were randomly assigned to two dietary treatments without (control, CON) or with Natupulse® TS (NPU, 800 TMU/kg feed) for a 49 day-trial, each treatment having 16 replicate pens of 20 birds each. Body weight (BW), BW gain (BWG), feed intake (FI), and feed conversion ratio (FCR) and intestinal permeability using fluorescein isothiocyanate-dextran (FITC-d) were measured on days 21 and 49. Jejunal samples (16 birds/treatment) were analyzed for markers of stress, inflammation, and gut barrier integrity using real-time quantitative PCR and immunoblot. Dietary NPU supplementation significantly reduced serum FITC-D levels in turkey at day 49 and increased BWG at both day 21 and day 49 compared to the CON group. Molecular analyses showed that dietary NPU supplementation significantly increased jejunal protein levels of HSP60/70/90 on day 21. On day 49, HSP60 remained unchanged, HSP70 was high and HSP90 protein levels were significantly decreased compared to the CON diet. In-feed NPU administration significantly downregulated the jejunal expression of IL8, IL18, Crp and Tnfsf4 genes on day 21, and only IL8 gene on day 49. In addition, NPU supplementation decreased jejunal protein levels of claudins (CLDN1/4/5) on day 21 and CLDN5 on day 49. The expression of genes coding for gap junction proteins was also affected by NPU supplementation, with a significant downregulation of Gja1, Gjb1, Gjc1, and Gjd2 on day 21, and Gjc1 and Gjd2 on day 49. Dietary supplantation of NPU significantly downregulated the jejunal expression of the adherens junction protein afadin (afdn1) gene on day 49 compared to the CON group. In summary, dietary NPU supplementation improved growth performance and jejunal barrier integrity potentially through modulation of the expression of HSPs, pro-inflammatory cytokines, tight junction, gap junction, and adherens junction proteins.

ARFGEF2
Also flagged:Chromosomeneuronal migrationorganizationepilepsyneurodevelopmental delaybehavioral
Journal Article 2026-05-07 ✓ 1 Snippet St Clair Tracy H, Dutton GN, Hall HN, Blaikie A.
In-Text Gene Mentions

…in FLNA andARFGEF2genes ( Cardoso…

Show Full Abstract

Large interstitial deletions spanning chromosome 5q14.3 to q21.1 and encompassing <i>NR2F1</i> are rare. Existing descriptions have largely focused on structural features and presenting manifestations, with fewer reports examining functional neurodevelopmental outcomes over time, particularly in individuals with large interstitial deletions. Here, we present a 16-year longitudinal analysis of an individual with a <i>de novo</i> 13.58 Mb interstitial deletion of 5q14.3 to q21.1 encompassing <i>NR2F1</i> (ClinVar accession SCV007328941), consistent with NR2F1-related neurodevelopmental disorder, historically described under OMIM:615722 (Bosch-Boonstra-Schaaf optic atrophy syndrome). We integrate longitudinal clinical, visual, neurological, and developmental data to examine relationships between optic nerve findings, periventricular heterotopia (PH; OMIM:612881, chromosome 5q14.3 deletion syndrome), cerebral visual impairment (CVI), epilepsy, hypotonia, and long-term functional outcomes. The index case manifested PH and severe CVI from infancy, with profound hypotonia associated oromotor and airway dysfunction. Epilepsy first manifested during adolescence. Longitudinal in-depth analysis suggests that CVI may represent a key mediating factor underlying cognitive, behavioral, and communicative difficulties. Substantial latent cognitive capacity was revealed once visual complexity was reduced and environments appropriately adapted. Analysis of published cases indicates that PH is an uncommon but recurrent feature of <i>NR2F1</i> haploinsufficiency and suggests that optic atrophy can be secondary to cerebral visual pathway dysfunction. This case highlights that longitudinal functional assessment can enhance genotype-phenotype interpretation in rare genomic disorders and provide clinically actionable insights for diagnosis, management, and outcome prediction.

Also flagged:organelleautophagyorganellespexophagyreticulophagyribophagy
Journal Article 2026-05-07 No Snippets Wang C, Liu G, Guo C, Li Q, Wang F, Zhang M.
Show Full Abstract

<h4>Background</h4>As the largest metabolic organ in the human body, skeletal muscle relies on the structural and functional integrity of its organelles for cellular viability and responsiveness. Organelle-specific autophagy, a major subtype of autophagy encompassing mitophagy, pexophagy, reticulophagy (ER-phagy), ribophagy, lysophagy, and nucleophagy, has been reported to exert a protective role in skeletal muscle by selectively eliminating damaged organelles and maintaining cellular homeostasis.<h4>Objective</h4>This scoping review aims to systematically map the current literature on organelle-specific autophagy in skeletal muscle, clarifying the molecular mechanisms, physiological and pathological roles, and research gaps for the six types of organelle-specific autophagy.<h4>Methods</h4>Following the PRISMA-ScR guidelines and the Joanna Briggs Institute framework, we searched PubMed, Embase, Web of Science, and Cochrane Library up to 21 March 2026 using keywords for skeletal muscle combined with mitophagy, pexophagy, ER-phagy, ribophagy, lysophagy, and nucleophagy. Studies involving humans, mice, rats, or skeletal muscle cells were included.<h4>Results</h4>Among 113 included studies, human studies accounted for 15%, animal models 56%, and skeletal muscle cell lines 29%. By autophagy type, mitophagy dominated (87%, 98 studies), reticulophagy and lysophagy each accounted for 4% (five studies each), and lysophagy, pexophagy, ribophagy, and nucleophagy together comprised less than 5%. Regarding evidence level, among 24 human studies, 18 (75%) were cross-sectional observational studies or small case series (level 4), only three were randomized controlled trials (RCTs) (level 2b), and one was an individual RCT (level 1b); the overall evidence was predominantly low-level observational, with a lack of high-quality interventional clinical trials. For autophagic flux methodology, 53% of studies performed dual detection of LC3B and p62, 17% used lysosomal inhibitor blocking experiments, 64% used transmission electron microscopy (TEM) or tandem fluorescent probes, 23% combined bidirectional verification of autophagic function, and 18% examined intervention reversibility. Among 88 animal studies, low risk of bias (RoB) was found in 14 (16%), moderate RoB in 43 (49%), and high RoB in 30 (35%). For 46 cell experiments assessed by five self-established criteria, 83% used TEM to confirm autophagosomes, 28% used lysosomal inhibitors to validate flux, 72% used gene knockout/knockdown to verify mechanisms, 91% used skeletal muscle-derived cell lines, and 41% performed multi-time-point dynamic autophagy detection.<h4>Conclusions</h4>Current research is severely lacking in nonmitophagy mechanisms, standardized dynamic flux assays, and high-quality clinical studies. Furthermore, systematic investigations of sex differences and muscle fiber type specificity are persistently absent, constraining the development of precise intervention strategies. Future efforts should strengthen multiorganelle autophagy network research and clinical translation to provide new targets for preventing and treating skeletal muscle disorders.

Also flagged:supraventricular arrhythmiasshockarrhythmiaseptic shockright ventricular dysfunctionpulmonary hypertension
Journal Article 2026-05-07 No Snippets Balik M, Tencer T, Svobodova E, Otahal M, Jurisinova I, Kaspar V, Krajcova A, Duska F, Waldauf P.
Show Full Abstract

<h4>Introduction</h4>Supraventricular arrhythmias (SVA) are common in mechanically ventilated patients with septic shock and may be aggravated by right ventricular (RV) dysfunction. Optimal rhythm-control strategies in this setting remain uncertain. We explored whether propafenone differs from amiodarone in maintaining sinus rhythm in patients with RV dysfunction.<h4>Methods</h4>This exploratory sub-analysis of the randomized double-blind PRASE trial included patients with septic shock who developed new-onset SVA, had preserved to moderately reduced left ventricular systolic function (ejection fraction >35%), and received continuous norepinephrine at doses <1.0 µg/kg/min. Patients were classified according to the presence or absence of RV dysfunction using comprehensive echocardiographic criteria. Outcomes included cardioversion at 24 h, arrhythmia recurrence, multiple recurrences, and 12-month survival.<h4>Results</h4>Among 162 patients with sufficient echocardiographic data, 73 (45%) met criteria for RV dysfunction. Of these, 42 received propafenone and 31 amiodarone; 89 patients without RV dysfunction served as controls. Cardioversion at 24 h did not differ significantly between propafenone and amiodarone in patients with RV dysfunction (69% vs. 56.7%, <i>p</i> = 0.30). However, arrhythmia recurrence occurred less frequently with propafenone (50%) compared with amiodarone (83.9%; <i>p</i> = 0.003; OR 0.19, 95% CI 0.06-0.56). Multiple (>3) recurrences were also less common with propafenone (<i>p</i> = 0.028; OR 0.24, 95% CI 0.06-0.84). RV dysfunction was not associated with worse 12-month survival compared with controls, and no significant survival difference between antiarrhythmic strategies was observed.<h4>Conclusions</h4>In mechanically ventilated patients with septic shock and RV dysfunction, propafenone was associated with fewer arrhythmia recurrences compared with amiodarone, despite similar short-term cardioversion rates. These findings are hypothesis-generating and suggest that propafenone may represent a promising alternative to amiodarone for rhythm control in critically ill patients with right ventricular dysfunction, warranting further prospective evaluation.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT03029169.

Also flagged:Cancermetabolismmalignant tumorssystemic diseasetumorWilms tumor
Journal Article 2026-05-07 No Snippets Hu M.
Show Full Abstract

No abstract available.

HTT
Also flagged:brain-restricted disorderHDmultisystem diseasetranslationalautosomal dominant neurodegenerative disordermultisystem disorder
Journal Article 2026-05-07 ✓ 2 Snippets Senousy MA, Eid AH, Zaki MB, A Abd-Elmawla M, Ghaiad HR, El-Shiekh RA, Ahmed S, Khalifa HO.
In-Text Gene Mentions

…of the huntingtin (HTT) gene, located at…

…of a mutantHTT(mHTT) protein with…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG repeat expansion in the huntingtin gene, leading to progressive neuronal dysfunction and neurodegeneration. Although classically defined as a brain-restricted disorder marked by striatal and cortical degeneration, increasing evidence suggests HD as a multisystem disease involving both central and peripheral pathological alterations.<h4>Objective</h4>This review aims to provide an integrated overview of neuronal and non-neuronal mechanisms underlying HD, focusing on systemic alterations that influence disease onset, progression, and clinical variability. This review also aims to connect neuropharmacology with pharmaceutical formulation strategies, particularly emphasizing the therapeutic and drug-delivery challenges and nanotechnology-based solutions.<h4>Methods</h4>A structured literature review was conducted using databases including PubMed, EMBASE, and Scopus. Using the appropriate keywords, original articles, clinical studies, systematic reviews, meta-analyses, and high-quality reviews were selected based on their relevance to HD pathophysiology and therapeutic strategies.<h4>Results</h4>HD manifests with motor, cognitive, and psychiatric disturbances; however, this review highlights that peripheral immune activation, gut microbiota dysbiosis, and multiorgan pathology are not merely secondary features but interact with neural circuits, contributing to disease heterogeneity and progression. Current therapeutic approaches are largely symptomatic, achieving minimal effectiveness in disease modification due to challenges such as poor blood-brain barrier penetration, limited target selectivity, and inter-individual variability. New strategies, such as nanotechnology-based drug delivery systems, biologics, and gene editing tools, offer advantages and support a deeper understanding of therapeutic limitations and disease mechanisms, yet their translational applicability remains constrained by limited clinical validation, safety concerns, and scalability problems.<h4>Conclusion</h4>Reconceptualizing HD as a multisystem disorder provides a more comprehensive framework for therapeutic development. Integrating central and peripheral disease mechanisms with advances in targeted drug delivery and patient stratification approaches, such as sex differences, hormonal influences, and environmental factors, is essential for translational progress toward personalized therapeutic approaches. Future research should prioritize interdisciplinary approaches to bridge the gap between mechanistic discoveries and effective disease-modifying interventions.

HTT
Also flagged:lipidbiosynthesisdegradationprotein synthesismetabolismgastrointestinal diseases
Journal Article 2026-05-07 ✓ 1 Snippet Chen X, Xie L, Li B.
In-Text Gene Mentions

…to effectively degradeHtt, thereby treating the…

Show Full Abstract

<h4>Objective</h4>Gut microbiota is closely associated with athletic performance, but differences between sport disciplines have rarely been reported. This study collected gut microbiota samples from athletes across different sport disciplines to further elucidate sport-specific effects on gut microbiota, thereby providing empirical evidence for the "exercise-gut microbiota" relationship within specialized athletic domains.<h4>Methods</h4>Gut microbiota from 27 professional Taekwondo athletes and 11 diving athletes underwent high-throughput sequencing analysis.<h4>Results</h4>(1) No significant difference existed in gut microbiota α-diversity between Taekwondo and diving athletes; (2) No significant differences were observed in gut microbiota structure (β-diversity) between Taekwondo athletes and diving athletes; (3) Intergroup differences existed in the gut microbiota of Taekwondo athletes vs. diving athletes; (4) Regarding KEGG pathways of gut microbiota between Taekwondo and diving athletes, 12 metabolic pathways showed significant differences. Specifically, lipid IVA biosynthesis and Kdo transfer to lipid IVA III pathways were lower in Taekwondo athletes than in diving athletes, whereas pathways including glycine biosynthesis of tetrapyrrole II, and inositol, chiro-inositol, and scyllo-inositol degradation were higher.<h4>Conclusion</h4>Taekwondo athletes and diving athletes exhibit distinct differences in gut microbiota composition and multiple metabolic pathways, but show no significant difference in diversity.

Also flagged:corpus callosum disordersCCneurodevelopmental syndromescallosal disordersaxonsbrain malformations
Journal Article 2026-05-07 No Snippets Ayushma, Srivastava PP, Minocha S.
Show Full Abstract

The Corpus Callosum (CC) is the largest white matter structure in the placental mammalian brain, facilitating critical interhemispheric communication. Anomalies of the CC, ranging from complete agenesis (ACC) to hypoplasia and dysgenesis, are frequent manifestations of complex neurodevelopmental syndromes. While mouse has historically served as the primary model for these disorders due to its conserved mammalian neuroanatomy, zebrafish has emerged as a powerful, albeit non-mammalian, alternative. This review synthesizes data from human, mouse, and zebrafish genetic tables to highlight the anomalies occurring at distinct steps of CC development. We examine how mouse models have been instrumental in mapping the structural failures of commissure formation. Furthermore, we address the utility of zebrafish models demonstrating that they effectively model the underlying cellular mechanisms of these disorders. Through an analysis of convergent phenotypes and divergent phenotypic readouts, we state that zebrafish provide a complementary platform for dissecting the molecular etiology of human callosal disorders.

Also flagged:infectiondegradationsynthesisbindingosteosarcomacell adhesion
Journal Article 2026-05-07 No Snippets Iconaru SL, Ciobanu SC, Bleotu C, Motelica-Heino M, Predoi D.
Show Full Abstract

This study reports on the physico-chemical and in vitro biological characterization of chromium-doped hydroxyapatite (10CrHAp, Cr<sup>3+</sup>, Ca<sub>10-x</sub>Cr<sub>x</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>, x<sub>Cr</sub> = 0.1) and chromium-doped hydroxyapatite in dextran matrix (10CrHAp-Dx) coatings, prepared for the first time via the spin coating technique. X-ray diffraction analysis and Rietveld refinement were used to characterize the materials. Fourier-transform infrared (FTIR) spectroscopy confirmed the presence of functional groups specific to hydroxyapatite. Scanning electron microscopy (SEM) observations revealed the presence of a conglomerate of nanoparticles distributed unevenly across the coatings surface. Atomic force microscopy (AFM) showed that both coatings presented continuous surfaces with uniform morphology. The in vitro biocompatibility of 10CrHAp and 10CrHAp-Dx coatings was evaluated using human osteoblast-like MG63 cell line and MTT assay. SEM and MM visualization assessed the cell adhesion and proliferation and morphological changes in the adhered cells. The antibacterial properties of the 10CrHAp and 10CrHAp-Dx coatings was assessed in vitro against two of the most common bacterial reference strains, <i>Pseudomonas aeruginosa</i> ATCC 27853 and <i>Staphylococcus aureus</i> ATCC 25923. Overall, the coatings achieved log reductions up to ~9.35, corresponding to a bacterial kill rate (for <i>S. aureus</i>) exceeding 99.99%, with 10CrHAp-Dx showing slightly superior performance. Similar behavior (log reductions of ~8.6 and ~8.9, respectively, indicating a sustained antibacterial effect and >99.99% bacterial elimination) was observed and for <i>Pseudomonas aeruginosa</i>. AFM was used to evaluate the bacterial cells interaction with the coating's surfaces. The biological assays demonstrated that both coatings possess notable antibacterial activity, underscoring their potential in biomedical applications, particularly in the design of new antimicrobial devices.

TNFSF4
Also flagged:Colorectal Cancercancertumorgene expressionsynthesisextracellular
Journal Article 2026-05-07 ✓ 2 Snippets Alawad DM, Fertel M, Hicks C.
In-Text Gene Mentions

…, TM1GD1 ,TNFSF4, USP2 and…

…SPATA12 , andTNFSF4.…

Show Full Abstract

<b>Background</b>: Despite remarkable progress in clinical management and screening, colorectal cancer (CRC) remains a major cause of cancer-related deaths worldwide. Sadly, both the number of CRC incidences and the mortality rate are trending upwards, particularly in younger individuals. There is an urgent need for the identification of reliable diagnostic biomarkers and therapeutic targets, and the development of accurate algorithms to guide therapeutic decision-making at the point of care. Here, we leverage multi-model integrative Machine Learning (ML) algorithms using RNA-Seq and somatic mutation data for the classification of tumor-normal samples and the discovery of potential biomarkers and therapeutic targets. <b>Methods</b>: We used RNA sequencing (RNA-Seq) and somatic mutation data from The Cancer Genome Atlas (TCGA) for the development of classification models and the discovery of biomarkers and therapeutic targets. The models were validated using two independent datasets. <b>Results</b>: ML algorithms accurately classified tumor samples and identified a signature for 58 genes, which could serve as potential diagnostic biomarkers. Functional analysis revealed the Wnt and GPCR signaling pathways enriched for somatic mutations. <b>Conclusions</b>: Multi-model integrative ML algorithms integrating gene expression with somatic mutation data represent a powerful approach to the classification of tumor samples and the discovery of biomarkers.

HFE
Also flagged:extracellularwound healingwound infectionangiogenesisdegradationproteasome
Journal Article 2026-05-07 ✓ 1 Snippet Pruzzo V, Bonomi F, Limido E, Weinzierl A, Harder Y, Laschke MW.
In-Text Gene Mentions

…disorders, such ashemochromatosis, thalassemia, and myelodyspla…

Show Full Abstract

Insufficient early vascularization remains a major limitation for the successful integration of implanted dermal substitutes. To overcome this challenge, nanofat has recently been introduced as a promising fat derivative for implant seeding. The present study investigated whether short-term ex vivo pretreatment with the hypoxia-mimetic agent deferoxamine (DFO) can further enhance the in vivo vascularization capacity of nanofat. Nanofat from green fluorescent protein (GFP)<sup>+</sup> donor mice was pretreated for 1 h with DFO (1 mM) or vehicle and subsequently seeded onto collagen-glycosaminoglycan-based dermal substitutes, which were implanted into dorsal skinfold chambers of syngeneic GFP<sup>-</sup> recipient mice. Implant vascularization, microhemodynamics, tissue integration and inflammatory response were assessed over a 14-day period using intravital fluorescence microscopy, histology and immunohistochemistry. Dermal substitutes seeded with DFO-pretreated nanofat exhibited a faster and more extensive vascularization, as evidenced by a significantly higher functional microvessel density in both implant border and center zones when compared to controls. Most blood-perfused microvessels originated from the GFP<sup>+</sup> DFO-pretreated nanofat. The improved vascularization was associated with reduced leukocyte-endothelial cell interactions in peri-implant venules as well as a decreased implant infiltration by macrophages and neutrophils, indicating an attenuation of the early innate inflammatory response. Moreover, DFO pretreatment promoted the tissue integration of the implants and regenerative extracellular matrix remodeling, as evidenced by increased collagen III deposition. These findings demonstrate that short-term ex vivo DFO pretreatment effectively primes nanofat to enhance microvascular network formation and suppress inflammation, resulting in an accelerated and improved engraftment of nanofat-seeded dermal substitutes. See also the graphical abstract(Fig. 1).

NEGR1
Also flagged:autosomeschromosomescell cycleproteolysisendoplasmic reticulumdegradation
Journal Article 2026-05-06 ✓ 2 Snippets Ma J, Liu X, Gao X, Wei D, Zhang Z, Muhammad A, Chen N, Xia X, Ma Y, Wang E, Liu X, Lei C, Jiang Y, Huang Y.
In-Text Gene Mentions

…, NCSTN ,NEGR1, PRTG ,…

…, KDM3B ,NEGR1, etc.),…

Show Full Abstract

<h4>Background</h4>Cattle have undergone complex evolutionary trajectories shaped by domestication, migration, and selection. Although runs of homozygosity (ROH) are a ubiquitous genomic feature, their full potential to decipher the evolutionary history and functional consequences in global cattle populations remains underexplored. We analyzed whole-genome sequences from 102 breeds across 17 geographic regions to conduct a global investigation of ROH landscapes, population structure, genomic inbreeding, and functional variants.<h4>Results</h4>ROH patterns revealed elevated homozygosity burdens in intensively selected European breeds, whereas South Chinese indicine showed a high short ROH burden, suggestive of a unique ancient demography. ROH-based principal component analysis (PCA) and admixture delineated taurine-indicine lineages, region-specific ancestries, inbreeding, and breeding effects. ROH-based inbreeding coefficient (F<sub>ROH</sub>) exhibited greater stability for cross-population inbreeding assessment, showing a high correlation with excess of homozygosity-based inbreeding coefficient (F<sub>HOM</sub>) and a negative association with heterozygosity. Region-specific ROH hotspots, identified via permutation test, reflected a combination of local adaptation and demographic legacies. Trait-focused analyses, cross-validated with multiple selection scans, identified genes underlying growth, milk, and climate adaptation. Notably, we found missense mutations in CHEK2, SPG7, FANCA, and MSRB3, whose frequencies were significantly correlated with temperature and humidity.<h4>Conclusion</h4>This study establishes ROH as a pivotal genomic marker for illuminating the dynamics of domestication, migration, inbreeding, and selection. Our findings offer valuable resources and insights for advancing genetic conservation and precision breeding in cattle under the pressures of climate change.

Also flagged:inflammatory responsesbiosynthesishost cellschronic inflammatory diseasesdigestionmicrobiota
Journal Article 2026-05-06 No Snippets Bao S, Yao C.
Show Full Abstract

The gut microbiota plays a fundamental role in maintaining host health by regulating immune function, epithelial barrier integrity, and metabolic homeostasis. Disruption of microbial community structure (also known as dysbiosis) and altered host-microbiota interactions can shift microbial composition and metabolite production, promote immune dysregulation, and contribute to the initiation and persistence of chronic inflammation. Eicosanoids, a class of signaling lipid mediators derived from arachidonic acid , are essential modulators of acute and chronic inflammatory responses. Emerging evidence highlights a bidirectional interplay between the microbiota and eicosanoid pathways as a hallmark of chronic inflammation. Microbial taxa and their metabolites regulate arachidonic acid availability, eicosanoid biosynthesis, and receptor signaling in host cells. In turn, host-derived eicosanoids shape the gut environment, influencing the gut microbiota and host health state. This self-reinforcing loop drives key features of chronic inflammatory diseases, including a shift toward pro-inflammatory eicosanoid profiles, a relative deficiency of anti-inflammatory or pro-resolving lipid mediators, and microbiota dysbiosis. In this review, we summarize recent advances in the mechanisms underpinning microbiota-eicosanoid crosstalk, outline its contribution to chronic inflammatory diseases, and discuss the therapeutic potential of targeting this bidirectional axis.

Also flagged:Diabetic retinopathytube formationretinopathycell proliferationdiabetesblindness
Journal Article 2026-05-06 No Snippets Liu S, Bao Y, Yilihaer Y, Guo W, Ma C, Xue C, Yang Z, Chen Y, Xie Z.
Show Full Abstract

Diabetic retinopathy (DR) is one of the leading causes of visual impairment and blindness worldwide. Current therapies for DR primarily focus on inhibiting vascular endothelial growth factor A (VEGFA); however, their efficacy remains limited due to drug resistance and the requirement for repeated intravitreal injections. The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome-editing technology enables specific targeting and knockout of the VEGFA gene, offering a novel therapeutic approach for DR. In this study, we synthesized a novel ionizable lipid, M3, and assembled the optimal-performing M3-F4 into lipid nanoparticles (M3-F4 LNP) for codelivery of VEGFA-targeting Cas9 mRNA (mCas9) and single guide RNA (sgRNA). The optimized formulation, composed of M3:cholesterol:DSPC:DMG-PEG at a molar ratio of 45:42.5:10:2.5, exhibited a particle size below 100 nm, a PDI below 0.2, and an encapsulation efficiency above 80%. Sanger sequencing-based indel analysis confirmed VEGFA editing in HRMECs, with sgRNA1 achieving an indel frequency of approximately 28.7%. In high glucose-induced human retinal microvascular endothelial cells (HRMECs), the mCas9/sgVEGFA@M3-F4 LNP reduced cell proliferation, migration, invasion, and tube formation, while restoring endothelial barrier integrity and exerting anti-inflammatory effects. A single intravitreal injection of mCas9/sgVEGFA@M3-F4 LNP effectively inhibited pathological neovascularization and retinal leakage in both oxygen-induced retinopathy mice and streptozotocin-induced diabetic mice <i>in</i> <i>vivo</i>. Furthermore, it markedly attenuated VEGFA-induced inflammation while maintaining excellent biocompatibility. This study demonstrates M3-F4 LNP as a promising method for efficient CRISPR/Cas9 delivery and provides robust support for gene therapy strategies in DR treatment.

Also flagged:ovarian canceruterine fibroidsadenomyosisuterine prolapsemenopausedepression
Journal Article 2026-05-06 No Snippets Yuk JS, Yoon SH.
Show Full Abstract

<h4>Background</h4>Hysterectomy is a common gynecological surgery, but its long-term impact on ovarian cancer risk remains unclear, particularly in Asian populations.<h4>Objective</h4>To evaluate the association between hysterectomy (with or without concomitant adnexal surgery) and the risk of ovarian cancer in South Korean women.<h4>Methods</h4>We conducted a retrospective cohort study using the Korean National Health Insurance Service (NHIS) database (2002-2020). After 1:1 propensity score matching, 13,059 women who underwent hysterectomy for benign indications (aged 40-59) were compared with 13,059 women without hysterectomy. The primary outcome was incident ovarian cancer, defined by three or more medical visits with a C56.xx diagnosis code. Cox proportional hazards models were used to estimate hazard ratios (HRs) for ovarian cancer, adjusting for demographic and clinical confounders.<h4>Results</h4>Over a median follow-up of 11.5 years, ovarian cancer incidence was 18 per 100,000 person-years in the hysterectomy group and 13 per 100,000 person-years in the non-hysterectomy group. Hysterectomy was associated with an imprecise estimate of ovarian cancer risk (HR 1.42, 95% CI 0.79-2.56), compatible with both a clinically meaningful decrease and increase in risk; therefore, the findings are inconclusive. There were no statistically significant differences between the two groups across various decades of life, including females below or above 50 years of age.<h4>Conclusions</h4>This study found no statistically significant association between hysterectomy and ovarian cancer risk, but the wide confidence intervals and limited number of events indicate that the findings remain inconclusive.

POU3F2OLFM4
Also flagged:systemic vasculitispathogenesisextracellularintestinalvasculitisoral ulcers
Journal Article 2026-05-06 ✓ 3 Snippets Lyu C, He K, Li S, Guo Z, Yan X, Tang R, Shi Y, Tuerheng J, Zheng W, Jiang L, Hu Y, Wu D.
In-Text Gene Mentions

…TFs such asPOU3F2, KLF10, and HIF1A,…

…across cohorts, withPOU3F2, VHL, and ZEB2…

…Notably,OLFM4and CD55 were…

Show Full Abstract

Intestinal Behçet's disease is a rare, refractory subtype of systemic vasculitis, characterized by deep ileocecal ulcers and extensive clinical overlap with Crohn's disease, while the cellular and molecular mechanisms underlying its pathogenesis remain poorly characterized. This study aimed to delineate the single-cell transcriptomic landscape of intestinal Behçet's disease, characterize its putative disease-associated transcriptomic signatures, and identify potential candidates for differential diagnosis and targeted treatment. We performed single-cell RNA sequencing on paired inflamed and histologically normal terminal ileum biopsy specimens from 4 patients with active intestinal Behçet's disease, and integrated our dataset with a public single-cell dataset from 12 Crohn's disease patients and 6 healthy controls for systematic bioinformatic analysis. We thereby constructed the first single-cell transcriptomic atlas of human intestinal Behçet's disease, profiling 98,119 high-quality cells to identify 3 major cell lineages, 20 distinct cell populations, and 41 functionally defined cell subtypes. Our analysis indicated that intestinal Behçet's disease may be characterized by robust stromal compartment activation, extracellular matrix remodeling, and potentially distinct epithelial antimicrobial signatures, which showed notable differences from the prominent epithelial barrier dysfunction and interferon-driven immune activation observed in Crohn's disease in this parallel intra-disease comparison framework. We further identified predicted pathogenic crosstalk between endothelial cells and neutrophils, which may be mediated by collagen/laminin-CD44 axes. Our findings thereby characterize the potential pathogenic features of intestinal Behçet's disease, and provide hypothesis-generating clues for the clinical management of this rare disorder.

Also flagged:infectioninnate immunityskininfectionsGene expressionsickness
Journal Article 2026-05-06 No Snippets Alcantara AV, Indong RA, Yoon KH, Kim BS, Hashizume T, Higashibata A, Higashitani A, Szewczyk NJ, Etheridge T, Deane CS, Ellwood RA, Kim HS, Mitchell RJ, Lee JI.
Show Full Abstract

With the recent rise in the numbers and diversity of astronauts and space travelers, health and prevention of illness in space are of primary importance. Changes in immune function among astronauts during spaceflight have been reported, but gaps remain in understanding how this may translate to increases in an in-flight risk of infection. To understand how immunity and infection are affected by microgravity, we used the nematode Caenorhabditis elegans as an animal host-pathogen model. Worms exposed to either space or simulated microgravity for several days exhibited increased Enterobacter gut colonization compared to normal gravity on Earth. Bacterial susceptibility was more severe in immunocompromised mutants of the pmk-1 gene, a conserved p38 MAPK ortholog that regulates innate immunity. RNA sequencing analysis identified several immune effector genes regulated by microgravity through MAPK/PMK-1. Silencing these genes via RNA interference identified specific immune effectors that protect C. elegans against increased Enterobacter gut proliferation, while transgenic expression of one of these effectors prevented increased colonization in immunocompromised C. elegans in microgravity. This study underscores the importance of the conserved MAPK/PMK-1 innate immune pathway in providing protection against possible infection during spaceflight.

Also flagged:deathcopperGHbrain injury
Journal Article 2026-05-06 No Snippets Boys RM, Stewart RO, Lye G, Beausoleil NJ, Stockin KA.
Show Full Abstract

Euthanasia may be necessary for stranded cetaceans to alleviate suffering, achievable through properly applied ballistics causing rapid insensibility and death. Despite widespread use, understanding of appropriate equipment relative to anatomical variation remains limited. We conducted experimental ballistics trials using cetacean cadavers to examine cranial trauma from five projectile types. A .308 calibre rifle with two deforming and three non-deforming projectiles was tested on 30 cadavers across four odontocete species (six per projectile type). Post-mortem computed tomography (PMCT) and dissection evaluated ballistics trauma. PMCT analysis assessed calvarium damage across 8 quadrants, summarized into four sectors. Marked caudoventral (brainstem) fractures were used as a conservative proxy indicator for likely instant insensibility. Generalized linear mixed models evaluated projectile type, brain sector, and species effects on fracture severity and fragmentation. Only 17 (56.7%) cadavers exhibited marked brainstem fractures. Non-deforming full metal jacket and hydrostatic projectiles caused significantly less severe fractures than other projectiles. Deforming and non-deforming monolithic projectiles produced brainstem-disrupting fractures in common, striped, and dusky dolphins. Monolithic projectiles appear more effective for bottlenose dolphins. Preliminary findings indicate deforming or monolithic projectiles were associated with a higher frequency of brainstem-associated osseous fractures in the cadavers studied. However, increased sample sizes with the addition of soft tissue damage quantification, are required to better elucidate species-specific equipment selection.

KLHL20
Also flagged:Protein homeostasismetabolic disorderstumorsneurodegenerative diseasessynthesisribosomes
Journal Article 2026-05-06 ✓ 1 Snippet Cui C, Zhang H, Wang X, Li N, Zhan X.
In-Text Gene Mentions

…ocyclic ligand targeting CUL3^KLHL20, validating it as…

Show Full Abstract

Ubiquitin-proteasome system (UPS)-mediated targeted protein degradation (TPD) is a central mechanism of maintaining protein homeostasis, which is closely associated with multiple diseases. Proteolysis-targeting chimeras (PROTACs) represent a major platform in TPD research and have demonstrated advantages relative to traditional intervention methods, such as small-molecule inhibitors, particularly in expanding the scope of targetable proteins. PROTACs have significant scientific merits in drug discovery and development. Currently, TPD still focuses on the conventional 'protein' level. However, the development of proteoform and proteoformics has enriched the deep understanding of the structural and functional diversities of a conventional protein. Targeted proteoform degradation (TPfD) has been proposed as an approach to more accurately recognize subtle structural and functional alterations within canonical proteins, thereby potentially improving precision drug delivery. Pathology-specific proteoform-based TPfD may facilitate the design of more precisely targetable degradation tools, potentially shifting strategies from general targeting toward more refined clearance. This review discusses the concept, mechanism, and developmental landscape of protein-based TPD and its core tool PROTACs, while systematically elaborating on the limitations of traditional TPD technologies - particularly the challenges associated with distinguishing functionally heterogeneous proteoforms. Thus, this review proposes the innovative concept of proteoform-based TPfD, detailing its technical foundations (rooted in proteoformics), core design methodologies (including ligand optimization, linker system engineering, and E3 ligase selection), and key applications in disease molecular typing, personalized drug development, and dynamic therapeutic regimen optimization. It further explores the potential role of TPfD in advancing precision medicine and discusses how proteoform-oriented strategies may contribute to refining therapeutic approaches for complex diseases.

OLFM4
Also flagged:tumorcolorectal cancertumorscancercolorectal cancerscancers
Journal Article 2026-05-06 ✓ 1 Snippet Chua J, Kaur A, Mitchell F, Korver A, Sakthivel P, Allapitan E, Uddin M, Maqsood A, Chege N, Leon-Coria A, Finney CAM, Bathe OF, Minoo P, Ayyaz A.
In-Text Gene Mentions

…program (LGR5, ASCL2,OLFM4, EPHB2, and AXIN2)…

Show Full Abstract

Immunotherapy remains largely ineffective in colorectal cancer (CRC), particularly in microsatellite stable (MSS) tumors, which represent the majority of cases. However, the complexity of intratumoral heterogeneity has made it difficult to define tumor-intrinsic programs that drive immune resistance. Here, we identify a cancer cell population that emerges predominantly in advanced-stage MSS CRCs. These cells exhibit stem-like features but aberrantly activate a WNT-inhibitory transcriptional program marked by high NOTUM expression. We term these cells WNT/β-catenin inhibitory cancer cells (WICCs). WICCs are enriched in immune-excluded tumors, correlate with reduced CD8<sup>+</sup> T cell infiltration, and are induced in both primary human CRC tumors and patient-derived tumoroids. Selective ablation of WICCs or genetic knockout of NOTUM enhances CD8<sup>+</sup> T-cell-mediated cytotoxicity, uncovering a tumor-intrinsic mechanism of immune evasion and nominating the WICC-NOTUM axis as a selective and tractable therapeutic target to overcome immunotherapy resistance in CRC.

SERPINC1
Also flagged:hemophiliaAT deficiencyliver cirrhosisPost‐transcriptional silencinghemophilia Acoagulation
Journal Article 2026-05-06 ✓ 1 Snippet McCluskey G, Maynadié H, Borgel D, Frenzel L, Harroche A, Bianchini E, Roullet S, Christophe OD, Denis CV, Casari C, Lenting PJ.
In-Text Gene Mentions

…encoded by theSERPINC1gene.…

Show Full Abstract

Antithrombin (AT) circulates as two distinct isoforms, alpha- and beta-AT, which differ in their glycosylation profiles; alpha-AT is fully glycosylated at positions Asn<sup>128</sup>, Asn<sup>167</sup>, Asn<sup>187</sup>, and Asn<sup>224</sup>, whereas beta-AT lacks Asn<sup>167</sup> glycosylation. The ratio of alpha-AT/beta-AT is approximately 9:1 in plasma, with beta-AT being a stronger inhibitor due to its increased affinity for heparin. Post-transcriptional silencing of AT via fitusiran has been shown to efficiently ameliorate the hemostatic balance in hemophilia. In this study, we analyzed if and how fitusiran affected the distribution of alpha-AT and beta-AT. Using different experimental approaches (isoform-specific activity, antigen, and immunoprecipitation assays), we were able to distinguish beta-AT and alpha-AT. Fitusiran treatment reduced the total AT activity to less than 20% of normal in both <i>F8</i> <sup>-/-</sup>-mice and hemophilia A patients. Compared to controls, a 3.8- and 3.3-fold increase in the amount of beta-AT activity relative to residual total AT activity was detected in <i>F8</i> <sup>-/-</sup>-mice and fitusiran-treated patients, respectively (P < 0.0001). Furthermore, the ratio of beta-AT/total AT antigen levels increased 1.8-fold in the human patient samples (from 0.09 ± 0.03 to 0.16 ± 0.01; P = 0.003), which coincided with an increased intensity of the beta-AT band detected in immunoprecipitation assays. It is noteworthy that this increase in the beta-AT/total AT ratio significantly increased its anticoagulant potential. Finally, we measured beta-AT/total AT ratios also in unrelated pathologies: congenital AT deficiency and advanced liver cirrhosis. Both conditions were also associated with an up to twofold higher ratio of beta-AT/total AT. Altogether, our results demonstrate that reduced AT production modulates the ratio between beta-AT and alpha-AT.

TNFSF4
Also flagged:acute kidney injurychronic kidney diseaserenal fibrosisglomerular filtrationinterstitial fibrosis
Journal Article 2026-05-06 ✓ 5 Snippets Yang K, Zhang L, Xiong Z, Lu Y, Zhang S, Liu Y, Zhang L, Cai J, Tang C, Liu Y, Deng T, Sun L, Liu F, Duan S, Xiao L.
In-Text Gene Mentions

…TubularTNFSF4/OX40L promotes fibrotic trans…

…superfamily member 4 (TNFSF4/OX40L) significantly upregula…

…ElevatedTNFSF4levels correlates positively…

…tubule-specific deletion ofTnfsf4markedly ameliorates tubular…

…Furthermore, anti-TNFSF4monoclonal antibody exerts…

Show Full Abstract

Acute kidney injury (AKI) often progresses to chronic kidney disease (CKD) characterized by renal fibrosis, yet the regulatory mechanisms driving this transition remain elusive. Here, it is demonstrated that tumor necrosis factor superfamily member 4 (TNFSF4/OX40L) significantly upregulates in proximal tubular cells (PTCs) from patients with CKD and in murine models of AKI-CKD transition induced by unilateral ischemia-reperfusion injury (uIRI) or repeated low-dose cisplatin. Elevated TNFSF4 levels correlates positively with the severity of tubulointerstitial injury and negatively with estimated glomerular filtration rate. Functionally, proximal tubule-specific deletion of Tnfsf4 markedly ameliorates tubular damage, renal inflammation and interstitial fibrosis in both AKI-CKD models. Furthermore, anti-TNFSF4 monoclonal antibody exerts its therapeutic effects in AKI-CKD mice suffering from uIRI. Conversely, overexpression of TNFSF4 exacerbates pro-fibrotic responses in PTCs under TGF-β1 or chronic hypoxia conditions. Mechanistically, immunoprecipitation-mass spectrometry identifies an interaction between TNFSF4 and glycogen synthase kinase-3α (GSK-3α). TNFSF4 blocks synaptotagmin-like protein 4 (SYTL4)-mediated ubiquitination of GSK-3α, prolongs its half-life, and sustains profibrotic signaling, effects reversed by GSK-3α knockdown. Collectively, these results uncover a previously unrecognized TNFSF4-GSK-3α axis as a key proximal tubule-intrinsic driver of AKI-CKD progression, and propose targeting this pathway as a promising therapeutic strategy to mitigate renal fibrosis and halt AKI-CKD transition.

Also flagged:gestationenvelopedeathCirculationbradycardiaischemia
Journal Article 2026-05-06 No Snippets Zeinali L, Giusto E, Knych H, Lesneski A, Hardie M, Joudi H, Sankaran D, Lakshminrusimha S, Vali P.
Show Full Abstract

<b>Background:</b> Preterm infants with bradycardia at birth often undergo immediate cord clamping (ICC) followed by resuscitation with positive pressure ventilation (PPV), chest compressions (CCs) and umbilical venous catheter (UVC) epinephrine. Resuscitation with an intact cord (PPV during delayed umbilical cord clamping-DCC) stabilizes cardiac output but delays UVC placement. <b>Objective:</b> To evaluate the feasibility of direct epinephrine injection into the umbilical vein during DCC (DCC + direct-epinephrine) compared with ICC and epinephrine administered through a UVC (ICC + cath-epinephrine), and to explore differences in return of spontaneous circulation (ROSC) and need for CCs between these approaches. <b>Methods:</b> Eleven preterm lambs (125-127 d gestation) were asphyxiated by cord compression to decrease heart rate (HR) to <30/min. In the ICC + cath-epinephrine group, the cord was immediately cut, lambs received PPV followed by CCs if HR < 60/min, and epinephrine was administered after UVC placement. In the DCC + direct-epinephrine group, cord compression was released when HR < 30/min and PPV was initiated. If HR remained <60/min, epinephrine was injected into the UV using a 25G needle. If ROSC was achieved, DCC was continued for 2 min. If HR < 100/min, the cord was cut and resuscitation was continued as outlined above. Plasma epinephrine concentrations were analyzed. <b>Results:</b> All lambs required epinephrine. Time to epinephrine was shorter with DCC + direct-epinephrine, 1.0 (0.7, 1.6) vs. 3.7 min (3.2, 5.2). Fewer lambs with DCC + direct-epinephrine needed CC (2/6 vs. 5/5, <i>p</i> = 0.06). ROSC success and plasma epinephrine concentrations were similar. Post-ROSC, heart rates and mean blood pressures tended to be higher in the ICC + cath-epinephrine group. <b>Conclusions:</b> In this perinatal lamb model of asphyxial bradycardia, resuscitation with an intact cord with direct umbilical venous epinephrine injection is feasible. Larger studies are required to determine whether this approach reduces the need for CC or improves clinically meaningful outcomes.

HFE
Also flagged:Hereditary hemochromatosisHHgenetic disordermetabolismcirrhosisdiabetes mellitus
Journal Article 2026-05-06 ✓ 5 Snippets Kablan A, Sezer A, Bakır A, Güneş A, Taşdelen E, Bir F, Erdem H, Saat H, Erdal H, Alay M, Coşkun Y.
In-Text Gene Mentions

…Distribution ofHFEGene Variants in…

…variants in theHFEgene.…

…The distribution ofHFEvariants shows marked…

…distribution of majorHFEvariants in a…

…patients who underwentHFEgene sequencing at…

Show Full Abstract

No abstract available.

bioRxiv 2026-05-06 Preprint (No Snippets API) Nnam CF, Mboya EA, Li Y, Zhang M, Kolling F, Perrard L, Palys TJ, Pflugradt E, Pioli PA, Ernstoff M, Seigne JD, Pettus JR, Ren B, Song L, Christensen BC, Salas LA.
Show Full Abstract

<h4>Background</h4> Retrotransposable elements (RE) comprise approximately 45% of the human genome and are typically repressed by DNA methylation to preserve genomic integrity. In cancer, global DNA hypomethylation can lead to RE derepression, resulting in genomic instability and activation of innate immune pathways through viral mimicry. While individual RE classes have been examined in clear cell renal cell carcinoma (ccRCC), the integrated epigenetic landscape of multiple RE families and their clinical relevance remain incompletely characterized. <h4>Methods</h4> We performed a genome-wide prediction of DNA methylation across three major RE classes (Alu, LINE-1, and LTR elements) using a validated computational framework applied to Illumina methylation array data from two independent ccRCC tumor cohorts. Integrated unsupervised clustering of RE methylation profiles was used to define the epigenetic subtypes. Associations with clinicopathologic variables, tumor immune microenvironment composition (DNA Methylation-derived), hypoxia signaling, innate immune activation, and overall survival were evaluated. Prognostic relevance was assessed using multivariable Cox regression models adjusting for age, sex, AJCC stage or AUA risk group, and immune and angiogenic tumor microenvironment features. Key findings were then externally validated in CPTAC-ccRCC and independently replicated in an institutional Dartmouth Cancer Center (DCC) cohort with matched methylation and RNA-sequencing data. <h4>Results</h4> Integrated clustering identified three reproducible RE methylation subtypes, Repressed, Transient, and Active. In the discovery cohort, the Active subtype showed significantly worse overall survival than the Repressed subtype, with a graded survival pattern across RE methylation states that persisted after multivariable adjustment. RE hypomethylation was associated with reduced EPAS1 (HIF2A) expression, increased immune infiltration, elevated PD-1 expression, and heightened cGAS-STING and interferon signaling, consistent with an immune-inflamed yet immunosuppressed tumor state. In the external CPTAC validation cohort, RE methylation subtypes recapitulated key molecular features and showed supportive survival trends. In the independent DCC replication cohort, an Active RE state was again associated with poorer survival, lower EPAS1 expression, increased PD-1 expression, greater CD8 T-cell and Treg infiltration, and elevated T-cell exhaustion signatures, supporting the reproducibility of the prognostic and immune-exhausted phenotype across cohorts. <h4>Conclusions</h4> We identified RE methylation subtypes with distinct molecular, immunologic, and prognostic features in ccRCC. External validation in CPTAC and independent replication in DCC support the robustness of this RE methylation framework across large-scale and institutional cohorts. These findings highlight the prognostic potential of RE methylation profiles and support their integration into molecular classification strategies to improve risk stratification in ccRCC.

Also flagged:Pancreatic ductal adenocarcinomaPDACtumortumorscancercancers
Journal Article 2026-05-05 No Snippets Nagaraju GP, Nellipudi H, Ganji C, Kuppala V, Ganji SP, Kumari S, Farran B, Srilatha M, Guenter R, El-Rayes BF.
Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal and aggressive tumor types, with a dismal 5-year survival rate of less than 15%. Despite major advances in understanding PDAC biology, therapeutic progress has been limited. Numerous preclinical studies have provided encouraging evidence that immune-based therapies may be effective. However, the clinical translation of immunotherapies for PDAC treatment has proven difficult with a lack of favorable tumor responses outside of a very select group of patients such as patients with MSI high tumors. Immune checkpoint inhibitors, as well as combination strategies with targeted radiotherapy or chemotherapy, have largely failed to demonstrate meaningful survival benefits for the majority of PDAC patients. Increasing evidence indicates that PDAC harbors a uniquely complex and multifaceted immunosuppressive microenvironment, which plays a central role in shielding malignant cells from effective antitumor immunity. Overcoming this barrier requires the development of rational and effective combination regimens that simultaneously target both the tumor and its surrounding immune microenvironment. Novel strategies, including the use of natural killer cell-based therapies, reprogramming of cancer-associated fibroblasts, and integration of predictive or prognostic biomarkers, hold promise for enhancing therapeutic efficacy. This review summarizes recent progress in PDAC immunotherapy, highlights key challenges, and discusses emerging approaches designed to improve patient outcomes.

SUDS3
Also flagged:cancerchromatincell migrationnucleusbreast cancerlocalization
Journal Article 2026-05-05 ✓ 1 Snippet Talajić A, Dominko K, Proust B, Vidaček NŠ, Harcet M, Ćetković H.
In-Text Gene Mentions

…interacting with SDS3 (SUDS3) and ARID4A […

Show Full Abstract

<h4>Background</h4>Early-branching metazoans, such as sponges (Porifera), can provide valuable insight into the emergence of complex gene regulatory systems and cancer-related mechanisms in early metazoan evolution. BRMS1 (breast cancer metastasis suppressor 1) is a component of the Sin3-HDAC complex involved in chromatin remodeling and transcriptional regulation. In humans, BRMS1 inhibits cancer metastasis by modulating signaling pathways that control cell migration, adhesion, and proliferation. Despite its biomedical importance, the evolutionary origin and basic functions of BRMS1 remain largely unexplored.<h4>Results</h4>We identified and characterized a BRMS1 homolog from the cave sponge Eunapius subterraneus and compared it with human BRMS1 and BRMS1-like paralogs. Phylogenetic analyses revealed that BRMS1 and BRMS1-like arose from a duplication of an ancestral BRMS1 gene during early vertebrate evolution. Structural modeling showed that sponge BRMS1 shares high similarity with human BRMS1. Co-immunoprecipitation assays demonstrated that sponge BRMS1 physically associates with human BRMS1 in mammalian cells. In both sponge and human cells, sponge BRMS1 localized predominantly to the nucleus, similar to human BRMS1 and BRMS1-like. Functional assays in human breast cancer cells revealed that sponge BRMS1 suppresses proliferation, colony formation, and migration to a degree comparable to its human homologs.<h4>Conclusions</h4>Our findings demonstrate that the key structural features, subcellular localization, and biological functions of BRMS1 are conserved between sponges and humans. The ability of a sponge BRMS1 homolog to integrate into human protein complexes and suppress cancer cell migration and proliferation suggests that fundamental BRMS1 activities arose early in metazoan evolution, independent of anatomical and functional complexity.

Also flagged:Parkinson's diseasePDneurodegenerative disorderbrain disordergene expressionREM sleep disorder
Journal Article 2026-05-05 No Snippets Hoof V, Schulze-Hentrich J.
Show Full Abstract

Parkinson's disease (PD) is a progressive neurodegenerative disorder characterized by the loss of dopaminergic neurons and the accumulation of misfolded alpha-synuclein. While traditional bulk RNA-sequencing has provided valuable insights into PD pathology, it fails to capture the complex cellular heterogeneity of the human brain. Advances in single-cell transcriptomics have revolutionized our ability to dissect this complexity, enabling the identification of rare, disease-associated cell populations, or the inference of dysregulated intercellular communication networks. In this review, we discuss methodological and analytical frameworks of single-cell RNA-sequencing and summarize key findings from recent studies using single-cell RNA-sequencing that advance our understanding of PD. We highlight how single-cell transcriptomics has refined our understanding of neuronal vulnerability and revealed critical contributions of non-neuronal cells, particularly microglia and oligodendrocytes, to disease pathology in both human postmortem tissue and experimental model systems. Finally, we discuss emerging evidence for sex-specific molecular alterations in PD and emphasize the importance of sex-aware study design and analysis in future single-cell PD research.

HFE
Also flagged:metabolismexcretionbindingmembranemembrane-liketransmembrane
Journal Article 2026-05-05 ✓ 1 Snippet Niu T, He X, Man VH, Wang X, Wang J.
In-Text Gene Mentions

HFEwas always involved…

Show Full Abstract

We reported an expanded Poisson-Boltzmann surface area (PBSA) solvation model for the high-throughput calculation of solvation free energies (SFEs) and partition coefficients (logP) across diverse organic solvents. Furthermore, a predictive model for blood-brain barrier (BBB) permeability (logBB) was developed. Using 1246 experimental SFE measurements from the Minnesota Solvation (MNSol) database, we parametrized the solvent accessible surface area (SASA) nonpolar term for 27 organic solvents, enabling PBSA calculations in a broad set of solvent environments. Across the MNSol data set, PBSA achieves an overall root-mean-square error (RMSE) of 1.10 kcal/mol, compared with 0.98 kcal/mol from quantum mechanical SMD calculations at the B3LYP/6-31G* level. To assess parameter transferability, we computed water-organic solvent logP values for 248 compounds spanning five solvent systems; PBSA yields an overall RMSE of 2.02 log units, slightly higher than the SMD result of 1.5 log units. Finally, we developed a quantitative model for BBB permeability (logBB) using multivariable linear regression based on PBSA-derived hydration free energies and selected organic-solvent SFEs. The model shows stable predictive performance on both the training (<i>N</i> = 865) and test (<i>N</i> = 97) sets, with RMSE ≈ 0.65 log units and MAE ≈ 0.5 log units, and demonstrates improved rank ordering on the test set (Kendall's tau = 0.45). Overall, this work extends PBSA applicability to a wide range of solvents and establishes physically motivated and computationally efficient approaches for predicting some key ADMET descriptors.

Also flagged:osteoarthritisextracellularcartilagedegenerationOApathogenesis
Journal Article 2026-05-05 No Snippets Alba B, Buddiga S, Kaltner H, Toegel S, Schmidt S.
Show Full Abstract

Galectin-3 (Gal-3), a member of the β-galactoside-binding protein family, is critically involved in inflammation, extracellular matrix remodelling, and cartilage degeneration in osteoarthritis (OA). This study aims to elucidate the regulation of the human galectin-3 gene (LGALS3) promoter in SW1353 cells and its control by SOX transcription factors, known to be dysregulated during OA pathogenesis. We sought to identify key sequence elements in the LGALS3 promoter responsible for its transcriptional activity and relevant transcription factors (TFs). Using luciferase reporter assays, we examined deletion variants of the 5' region (-2638 bp to + 52 bp) and assessed their activation potential. We also identified potential transcription factor binding sites (TFBS) through in silico analyses and confirmed SOX9 binding in the - 93/+49 region by chromatin immunoprecipitation using HaloCHIP™. Functional assays revealed that the proximal promoter region (-97 bp to + 52 bp) is critical for reporter gene expression in SW1353 cells. This study demonstrates that the presence of SOX9 leads to a dose-dependent decrease in LGALS3 promoter activity in SW1353 cells. Consistent with this trend, SOX9 overexpression caused a modest reduction in endogenous LGALS3 mRNA levels. Together, these findings highlight the importance of SOX TF interactions in regulating LGALS3 expression and their potential role in chondrocytes.

Also flagged:neurological disordersschizophreniabehavioralautismmild cognitive impairmentcognition
Journal Article 2026-05-05 No Snippets Zhu G, Shao H, Liu H, Zhang P, Duan X, Huang Z, Wang R, Wang Z.
Show Full Abstract

Eye movements are promising biomarkers for psychiatric and neurological disorders, yet conventional recording methods rely on bulky, expensive, and laboratory-bound devices. Deep-learning-based gaze-tracking technology now provides a practical means to capture these biomarkers outside the lab, with consumer-grade smartphones offering a particularly scalable platform. To evaluate the feasibility of this approach for psychiatric assessment, we conducted two complementary studies: a clinical investigation of hospitalized patients with schizophrenia and a normative study of healthy college students. In Study 1, we collected gaze data from individuals with clinically diagnosed schizophrenia (N = 134) and matched healthy controls (N = 130) using both an iPhone and a research-grade EyeLink eye-tracker. In Study 2, we used smartphone gaze-tracking data from a university cohort (N = 631) to classify depressive symptoms. Results demonstrated that smartphone-derived gaze metrics can distinguish psychiatric conditions. For schizophrenia detection, the smartphone model achieved an area under the receiver operating characteristic curve (AUC) of 87.00% and an accuracy of 83.33%, comparable to the EyeLink benchmark (AUC = 87.12%; accuracy = 86.67%). For classifying depressive symptoms, a free-viewing task on Android smartphones yielded an AUC of 75.54% and an accuracy of 75.79%. These findings highlight the potential of smartphone gaze-tracking as an accessible, privacy-preserving tool for real-world psychiatric assessment and treatment monitoring.

SOX6
Also flagged:leukemiamast cell differentiationpathogenesismyeloid leukemiasyndromesbone marrow
Journal Article 2026-05-05 ✓ 1 Snippet Iida K, Nakanishi M, Nakahara J, Asada S, Isobe T, Yabushita T, Fukushima T, Tanaka Y, Ozawa M, Yamada Y, Kitamura T, Yamamoto K, Goyama S.
In-Text Gene Mentions

…ic/erythroid potential (P2rx1,Sox6downregulation) [ 57…

Show Full Abstract

MECOM is a transcription factor critical for the maintenance of hematopoietic stem cells (HSCs) and the pathogenesis of myeloid leukemia. Germline mutations clustered in the C-terminal zinc finger domain (ZFD) of MECOM are known to cause MECOM-associated syndromes, involving bone marrow failure and skeletal anomalies. However, the molecular consequences of these mutations and the precise downstream mechanisms of MECOM remain elusive. Here, we demonstrate that the C-terminal ZFD serves as the dominant DNA-binding module of MECOM, and that disease-associated mutations abrogate its DNA-binding capacity. Mechanistically, we reveal that MECOM functionally antagonizes GATA2 via C-terminal ZFD-mediated DNA binding and recruitment of the corepressor CtBP. This repression promotes myeloid leukemogenesis while suppressing mast cell differentiation. Furthermore, we generated a knockin mouse model harboring a C-terminal ZFD mutation, which successfully recapitulated the clinical phenotypes of MECOM-associated syndromes, including reduction of HSCs and B cells. Collectively, our findings define C-terminal ZFD mutations as loss-of-function mutations with impaired DNA binding, uncover the MECOM-GATA2 axis as a key regulatory pathway, and provide a valuable mouse model for understanding MECOM-associated syndromes.

POU3F2
Also flagged:chromatinbindinglocalizationorganizationneurogenesisgene expression
Journal Article 2026-05-05 ✓ 1 Snippet El Kazwini N, Gao M, Kouadri Boudjelthia I, Cai F, Huang Y, Sanguinetti G.
In-Text Gene Mentions

…most enriched TF,Pou3f2, is a central…

Show Full Abstract

RNA velocity has recently emerged as a key tool in the analysis of single-cell transcriptomic data, yet connecting RNA velocity analyses to underlying regulatory processes has proved challenging. Here, we propose CRAK-Velo, a semi-mechanistic model that integrates chromatin accessibility data in the estimation of RNA velocities. CRAK-Velo provides biologically consistent estimates of developmental flows and enables accurate cell-type deconvolution, while additionally shining light on regulatory processes at the level of interactions between genes and chromatin regions.

SERPINC1
Also flagged:Abdominal aortic thrombosisureterolithiasisarterial thrombosisvenous thromboembolismvascular thromboembolismdiabetes
Journal Article 2026-05-05 ✓ 1 Snippet Almezeiny T.
In-Text Gene Mentions

…Protein S, andantithrombin-III.…

Show Full Abstract

Abdominal aortic thrombosis (AAT) is a rare condition with substantial morbidity and mortality risk if not treated promptly. AAT typically occurs in postoperative patients, particularly those with certain risk factors. Here, we present the case of a urology patient who underwent ureteroscopy and laser lithotripsy for ureterolithiasis. During the postoperative period, the patient was re-admitted with a massive intra-abdominal arterial thrombosis involving the iliac and renal arteries and abdominal aorta. Emergency thrombectomy, angioplasty, and catheter-directed thrombolysis were performed in multiple stages. After a complex postoperative course in the intensive care unit, the patient survived and was discharged in stable condition.

B4GALT5
Also flagged:degradationglycosylation. pyloriinfectiongastric cancerH. pylori infection
Journal Article 2026-05-05 ✓ 5 Snippets Tuo W, Qu Z, Xiang T, Yuan C, Cai Q, Liu G, Wang J, Xiang Y.
In-Text Gene Mentions

…modifying YWHAZ throughB4GALT5-mediated glycosylation during…

Beta-1,4-galactosyltransferase 55 (B4GALT5) was…

…-1,4-galactosyltransferase 5 (B4GALT5) was specifically identified…

…biological functions ofB4GALT5and its regulatory…

…itro and vivo.<h4>Results</h4>B4GALT5expression remarkedly increase…

Show Full Abstract

<h4>Background</h4>Abnormal glycosylation modifications are pivotal in tumorigenesis. However, the mechanism by which Helicobacter pylori (H. pylori) infection affects glycosylation during gastric cancer (GC) progression is not well understood. This study investigated how H. pylori infection-related glycosylation contributes to GC, aiming to uncover new therapeutic targets.<h4>Methods</h4>Differentially expressed glycosyltransferases were identified using lectin microarray analysis following H. pylori infection. Beta-1,4-galactosyltransferase 5 (B4GALT5) was specifically identified in both non- and H. pylori infected AGS cells, and GC tissues. The biological functions of B4GALT5 and its regulatory mechanisms in H. pylori infection-mediated GC progression were investigated in vitro and vivo.<h4>Results</h4>B4GALT5 expression remarkedly increased in GC cells after H. pylori infection and was linked to poor clinical outcomes in patients with GC. Its overexpression reduced cellular apoptosis,and promotedmigration, and invasion, while reducing the effectiveness of chemotherapeutic drugs such as cisplatin and paclitaxel. Mechanistic investigations demonstrated that B4GALT5 directly interacts with YWHAZ, enhancing its glycosylation at the N95 site and thus strengthening its binding to FOXO3a. This subsequently led to FOXO3a degradation, preventing its nuclear translocation. In an in-situ tumor-bearing mouse model, B4GALT5 overexpression accelerated tumor growth, whereas mutating the N95 site of YWHAZ reduced this effect.<h4>Conclusions</h4>Our study reveals that H. pylori contribute to gastric carcinogenesis by activating the B4GALT5/YWHAZ/FOXO3a axis via specific glycosylation, suggesting YWHAZ N95 glycosylation as a potential therapeutic target for GC.

Also flagged:neurodegenerative diseasePDpathogenesisiron deficiencymitochondrialneurodegenerative disorder
Journal Article 2026-05-05 No Snippets Serpa RO, Tufano E, Connor JR.
Show Full Abstract

Parkinson's Disease (PD) is the fastest-growing neurodegenerative disease globally, with prevalence increasing more rapidly than Alzheimer's disease. PD pathogenesis has traditionally been framed around iron accumulation in the substantia nigra (SN), resulting in oxidative injury to vulnerable dopaminergic neurons. However, excess iron alone does not readily explain the temporal emergence of dopaminergic susceptibility across the lifespan. Epidemiological and clinical studies consistently show that iron deficiency often precedes PD diagnosis by more than a decade, suggesting that early iron dysregulation establishes a prodromal metabolic state that destabilizes the nigrostriatal system. Here we propose a dynamic two-phase framework in which iron deficiency establishes a latent vulnerability state characterized by impaired iron-dependent enzymatic activity, diminished ferritin buffering, weakened mitochondrial function, and reduced antioxidant defenses. In this primed context, subsequent increases in dopaminergic flux during L-DOPA therapy may amplify oxidative stress by elevating cytosolic dopamine, perturbing iron handling, and promoting dopamine iron redox chemistry that generates quinones and reactive oxygen species (ROS). Transitions in iron availability including iron supplementation, may further aggravate this process but are not required for its initiation. By reframing PD as a disorder shaped by dynamic changes in iron availability interacting with dopaminergic demand, this review integrates evidence across iron biology, dopaminergic signaling, oxidative stress, and neuroinflammation to propose a mechanistically novel model of PD pathogenesis. This conceptual shift highlights new opportunities for risk stratification, biomarker development, and refinement of dopaminergic therapy within iron dysregulated states.

Also flagged:biosynthesisElongationsynthesiscell cyclegene expressioncell wall
Journal Article 2026-05-05 No Snippets Wu C, Wang FF, Ma FF, Ye LP, Mu SY, Yang YT, Qu XY, Zhang YL, Li SB, Xu SS, Ma XQ, Cao GQ, Lin SZ, Chen Y.
Show Full Abstract

Knot-free timber production in <i>Cunninghamia lanceolata</i> depends critically on internodal characteristics, yet the mechanisms governing internode elongation remain poorly understood, hindering breeding efforts for longer-internode varieties. In this study, we selected two clones with distinct internodal traits (the C1 clone exhibited a 25.03% longer internodal length than the C11 clone) as materials. Enzyme-linked immunosorbent assay (ELISA) and RNA sequencing were used to investigate dynamics in endogenous hormones and transcriptional regulation in internodal growth. Results showed that the difference in indole-3-acetic acid (IAA) rhythms in apical buds is a key factor of C1's longer internodal growth; higher levels of IAA and cytokinins in the apical buds of C1 may support sustained internodal growth; upregulated IAA-related genes in upper phloem (<i>PIN1</i> and <i>SAURs</i>), which are involved in polar transport and signal response, indicates a stronger capacity to establish apical dominance. Hormone transport may be regulated by very long-chain fatty acids (VLCFAs). Consistent with reduced brassinosteroid activity, genes involved in VLCFA biosynthesis and transport were generally lower in C1, implying excessive VLCFA accumulation in C11 may be negative to IAA transporting and internode growth. This study offers a preliminary insight into internodal growth mechanisms influenced by hormone biosynthesis and transport in <i>C. lanceolata</i>., providing a basis for genetic improvement, germplasm selection, and exogenous hormone applications in knot-free timber cultivation.

Also flagged:gene expression
Journal Article 2026-05-05 No Snippets Celiz RH, Guerreiro DD, Brito DCC, Novaes MAS, Ñaupas LVS, Sá NAR, Palomino GJQ, Gomes FDR, Ferreira ACA, Mbemya TG, Fernandes CCL, Rufino LAL, Silva CVO, Silva AR, Neto ACA, Sheheryar S, Sousa FD, Monteiro ACO, Moura AA, Rondina D, Figueiredo JR, Rodrigues APR.
Show Full Abstract

Cryopreservation of testis is an alternative for preserving the reproductive potential of prepubertal animals that do not yet produce spermatozoa or endangered adult animals that die unexpectedly. This study aimed to evaluate slow freezing (SFR) and vitrification (VIT) for testicular tissue cryopreservation in prepubertal and adult Morada Nova rams. Small testicular fragments (3 ×3 ×1 mm) were maintained fresh (CTR) or cryopreserved using Mr. Frosty™ for SFR or the ovarian tissue cryosystem for VIT. Fragments were evaluated for histomorphology, ultrastructure, protein (β-catenin, activated caspase-3), and gene expression (OCT4, β-CATENIN, BAX, BCL2), and proteomic profiles. Morphologically, SFR better preserved seminiferous tubule integrity than VIT, especially in prepubertal animals. Ultrastructural analysis confirmed superior cell preservation with SFR. Immunofluorescence revealed higher β-catenin expression in SFR compared to VIT (p < 0.05), and increased caspase-3 activation post-VIT in adults (p < 0.05). OCT4 gene expression was upregulated after cryopreservation (p < 0.05), suggesting a stress response. Proteomic analysis detected 288 proteins, with distinct expression patterns in prepubertal tissue. PGK2 and EEF1A1 were downregulated, while HNRNPA2B1 was upregulated in cryopreserved groups, especially in VIT, suggesting metabolic suppression and RNA regulation responses. In contrast, adult tissues showed no significant proteomic changes across groups. These results support SFR as the preferable method, particularly for prepubertal testes, due to better structural preservation and more adaptive molecular responses to cryoinjury.

Also flagged:idiopathic pulmonary fibrosisAEinfectiongastroesophageal refluxepithelial cellinflammatory response
Journal Article 2026-05-05 No Snippets Sotiropoulou V, Sampsonas F, Vasarmidi E, Antoniou K, Gogali A, Kostikas K, Drakopanagiotakis F, Steiropoulos P, Margaritopoulos G, Porpodis K, Daniil Z, Tomos I, Papanikolaou I, Tzilas V, Loukides S, Tzouvelekis A.
Show Full Abstract

<h4>Introduction</h4>Despite their profound clinical impact and high mortality, acute exacerbations of idiopathic pulmonary fibrosis (AE-IPF) still lack any effective or standardized treatment strategies. This manuscript describes the rationale and design of a randomized, multicenter, open-label Phase III clinical trial evaluating the efficacy of intravenous immunoglobulin (IVIG) compared with usual care in hospitalized patients with AE-IPF.<h4>Methods</h4>This trial will enroll 196 patients across eight different sites in Greece. Inclusion criteria are designed to identify patients with AE-IPF according to the American Thoracic Society definition, while excluding those with cardiac decompensation or pulmonary embolism. The primary endpoint is a composite of all-cause in-hospital mortality or the need for intubation. Secondary endpoints include all-cause mortality at 30 and 90 days, hospital readmission or a new AE-IPF episode within 90 days, and the change in the PaO<sub>2</sub>/FiO<sub>2</sub> ratio from hospital admission to discharge.<h4>Discussion</h4>Based on the concept that patients with IPF frequently demonstrate impaired cellular and humoral immunity, and inflammation and/or immune dysregulation may contribute to AE-IPF pathogenesis, there is a strong rationale for evaluating the therapeutic usefulness of IVIG in this setting. Retrospective data indicate that IVIG could provide clinical benefit in AE-IPF, potentially through its anti-inflammatory and immunomodulatory effects. In this trial, IVIG will be administered as an adjunct to usual care, which includes pulse corticosteroids, broad-spectrum antibiotics, prophylactic anticoagulation, and oxygen therapy. This intervention has the potential to significantly influence current treatment strategies for AE-IPF.<h4>Clinical trial registration</h4>https://clinicaltrials.gov/, identifier NCT07299695.

POU3F2
Also flagged:Schizophrenianeuropsychiatric disorderpathogenesisimmune disorderneuropsychiatric diseasegene expression
Journal Article 2026-05-05 ✓ 2 Snippets Helaly AMN, Al-Emam A.
In-Text Gene Mentions

…cell TFs (TCF4,POU3F2, NKX2.1, EGR3), (2)…

…cell TFs (TCF4,POU3F2, NKX2.1, EGR3); stem…

Show Full Abstract

Schizophrenia (SCZ) is a severe neuropsychiatric disorder characterized by a progressive clinical course and associated with a wide range of gene transcription signatures. This review examined studies retrieved from PubMed (published between 2005 and 2025) that investigated transcription factors (TFs) correlated with SCZ. Approximately 150 studies aligning with the eligibility criteria were selected. The synthesized evidence identified more than 40 TFs implicated in the pathogenesis and risk of SCZ. Based on functionality, these TFs were categorized into four groups: (1) progenitor cell TFs (TCF4, POU3F2, NKX2.1, EGR3), (2) stem cell TFs (MYC, SOX2, ASCL1, REST, NR2E1), (3) metabolic reprogramming TFs (HIF1, SREBPs, STATs, SOX9, NRF1, NRF2, p53, FOXO, ATF4, NF-κB), and (4) nuclear TFs (AhR, RXR). The discussion shed light on how these TFs in consort with hundreds of potential genes could shape the pathophysiology of SCZ. Indeed, SCZ represents a complex genomic, nuclear, metabolic, and immune disorder characterized by a diseased cellular microenvironment, with hypoxia emerging as a key feature. Although targeting TFs pharmacologically remains challenging, innovative therapeutic strategies-such as antineoplastic and antipsychotic agents that modulate the cellular microenvironment-may offer promising new directions for SCZ treatment.

Also flagged:extracellularvesiclesdegradationmembraneextracellular spacemacrophage polarization
Journal Article 2026-05-05 No Snippets Amarandei AH, Avadanei-Luca S, Bulgaru-Iliescu AI, Moraru DC, Solovastru DFG, Constantinescu MC, Tatar R, Poroch V, Gheuca Solovastru L, Pertea M.
Show Full Abstract

<b>Background/Objectives:</b> Thermal injuries represent a significant global health burden, often complicated by hypertrophic scarring, chronic inflammation, and delayed re-epithelialization. While Mesenchymal Stem Cell (MSC) transplantation has shown promise, its clinical translation is hindered by risks of tumorigenicity and immunological concerns. This study evaluates the efficacy of cell-free Extracellular Vesicle (EV) therapy-derived from both mammalian MSCs and plant sources (PDNVs)-as standardized, off-the-shelf alternatives. This study synthesizes evidence focusing on re-epithelialization velocity, angiogenic activity, and anti-fibrotic outcomes, while assessing the impact of second-generation delivery scaffolds on therapeutic durability. <b>Methods:</b> Conducted in accordance with PRISMA 2020 guidelines and registered in PROSPERO (CRD420261305379), this review interrogated PubMed, Scopus, Embase, and Web of Science for studies published between 2015 and 2026. Eligible studies included in vivo animal models of thermal injury using purified vesicles from mammalian MSC sources or plant-derived nanovesicles compared with placebo, standard care, or untreated controls. Data were synthesized narratively; methodological quality was appraised using the SYRCLE risk of bias tool and compliance with MISEV guidelines. <b>Results:</b> Synthesis of 50 studies revealed that vesicle-based interventions consistently accelerate wound closure and improve histological healing. Mammalian ADSC-derived vesicles demonstrated superior anti-fibrotic effects via the miR-192-5p and miR-125b-5p axes, while hUC-MSC vesicles attenuated systemic inflammatory signaling via miR-181c. Plant-derived nanovesicles (PDNVs) showed potent antioxidant and re-epithelialization effects, with emerging potential as engineered genetic carriers. Crucially, advanced delivery systems, including bioactive hydrogels and microneedle patches, were repeatedly associated with improved local retention and more durable effects than bolus injections. <b>Conclusions:</b> Vesicle-based therapies show consistent pro-healing signals in preclinical models, suggesting source-dependent profiles: MSC-derived vesicles excel in immunomodulation and anti-fibrotic remodeling, while PDNVs provide a scalable, low-immunogenicity platform. As a cell-free strategy, these therapies circumvent the safety risks of live cell transplantation. This review identifies a critical shift toward second-generation delivery scaffolds to overcome the clearance crisis of topical applications, emphasizing the need for harmonized MISEV-aligned characterization in future clinical translation.

SHISA6
Also flagged:myopiarefractive errortype 2 diabetesdiabetic retinopathyendoplasmic reticulumretinal dystrophy
Journal Article 2026-05-05 ✓ 1 Snippet He X, Terry L, Guggenheim JA, UK Biobank Eye and Vision Consortium.
In-Text Gene Mentions

…, NOG ,SHISA6, KCNMA1 ,…

Show Full Abstract

<h4>Purpose</h4>To compare the performance of a novel method for identifying candidate gene-environment interaction loci, Scalable Cauchy Aggregate test using Multiple Phenotypes to test Interactions (SCAMPI) (doi:10.1101/2024.09.10.612314v1), to widely used existing methods, Levene's test and conditional quantile regression (CQR). The 3 methods were evaluated for refractive error, a trait known to exhibit widespread gene-environment interaction effects.<h4>Design</h4>A cohort study; a genome-wide association study to investigate variance heterogeneity of refractive error.<h4>Participants</h4>A discovery sample of 77 880 UK Biobank participants with records of both refractive error and age of onset of spectacle wear (AOSW) and a validation sample of 257 265 UK Biobank participants with known AOSW.<h4>Methods</h4>SCAMPI, Levene's tests, and CQR were applied in the discovery sample. Variance quantitative trait loci (vQTLs) identified using SCAMPI were assessed in the independent validation sample. The SCAMPI vQTLs were further assessed for evidence of genotype-by-education interaction or gene-gene interaction, using linear regression.<h4>Main outcome measures</h4>Genetic variance heterogeneity associated with refractive error (phenotypic variance differences across genotypes).<h4>Results</h4>SCAMPI identified 15 independent vQTLs with <i>P</i> <5.0e-08 while 3 and 11 were found using Levene's test and CQR, respectively. Of the 15 SCAMPI vQTLs, 12 (80%) were supported in the validation data set after accounting for multiple testing. The lead SCAMPI variants included known vQTL associated with refractive error, such as rs12193556 (<i>LAMA2</i>) and rs685352 (<i>GJD2</i>), as well as 3 novel candidate gene-environment interaction loci. Among these novel candidates was rs7077247, an intronic variant in the <i>TCF7L2</i> gene, which was associated with a -0.085 D greater shift toward myopia in participants with a university degree (<i>P</i> = 9.43e-04). This variant is known to be associated with the risk of diabetes and <i>TCF7L2</i> is a component of the Wnt signaling pathway. The SCAMPI vQTLs demonstrated minimal evidence for gene-gene interactions.<h4>Conclusions</h4>The SCAMPI outperformed Levene's test and CQR in identifying candidate gene-environment interaction loci associated with refractive error. Our results suggest that a variant in the <i>TCF7L2</i> gene may confer susceptibility to myopia to a greater extent in those with higher vs. lower educational attainment and suggests a molecular link to Wnt signaling and the risk of myopia associated with intensive education.<h4>Financial disclosures</h4>Proprietary or commercial disclosure may be found in the Footnotes and Disclosures at the end of this article.

SOX6
Also flagged:colorationribosomebindingreproductionmetabolismimmune responses
Journal Article 2026-05-04 ✓ 4 Snippets Deng X, Huang C, Wu Q, Rahayu S, Liu X, Pang L, Hu F, Chen H, Zhu C, Jiang M.
In-Text Gene Mentions

…of novel_circ_000144 issox6.…

…by directly targetingSOX6via the β-catenin/…

…miR-423—x can targetsox6, which is…

…of miR-423—x onsox6, and thus…

Show Full Abstract

<h4>Background</h4>The leopard coral grouper is a valued aquaculture species whose market value is influenced by its body color. Current research on its coloration focuses on adults, leaving early developmental mechanisms unclear. Circular RNAs are important regulators in various processes, including pigmentation. This study aimed to explore the role of circRNAs in early color formation of leopard coral grouper.<h4>Results</h4>Using skin tissues from transparent (26 dph) and newly pigmented red (30 dph) juveniles, we identified 42 differentially expressed circRNAs. Their source genes were enriched in pathways like Hedgehog signaling, cAMP signaling, and carotenoid metabolism. Four key circRNAs were identified, and a circRNA-miRNA network analysis suggested their involvement in melanin synthesis, pigment cell development, and carotenoid metabolism. The qPCR verification results were consistent with the trends in the sequencing results.<h4>Conclusions</h4>This study provides the first circRNA profile during early color transition in leopard coral grouper, revealing a potential post-transcriptional regulatory network. The findings offer new insights into pigmentation mechanisms and provide valuable candidates for molecular-assisted breeding of color traits.

HFE
Also flagged:infectionJUNV infectionarenaviral hemorrhagic feversinfectionshostcell
Journal Article 2026-05-04 ✓ 2 Snippets Wasson SR, Flude BM, Salerno M, Jung KH, Padalino G, Ferla S, Roche-Dugmore DJ, Bott CW, Brancale A, Gowen BB, Bassetto M.
In-Text Gene Mentions

…tary hemochromatosis protein (HFE). ,…

…ligands, Tf, andHFE, as illustrated in…

Show Full Abstract

Pathogenic New World arenaviruses (NWAs), including Junín (JUNV) and Machupo (MACV) viruses, rely on host-virus entry processes that represent attractive points for antiviral intervention. Guided by the known use of human transferrin receptor 1 (hTfR1) by several NWAs for cell entry, we conducted a structure-based virtual screening campaign targeting the MACV GP1-hTfR1 interaction interface to identify small molecules capable of inhibiting early infection. From an <i>in silico</i> screen of commercially available drug-like compounds, 25 candidates were selected and tested in cell-based assays, yielding two chemically distinct scaffolds with low-micromolar activity against JUNV. Hit expansion of the primary chemotype produced 107 new analogues, several of which achieved submicromolar inhibition of JUNV replication. Among them, compound <b>22f</b> demonstrated antiviral activity across multiple arenaviruses, including both hTfR1-tropic NWAs and viruses that use alternative entry pathways, while showing no effect on the unrelated Rift Valley fever virus. In an hTfR1-expressing mouse model of JUNV infection, <b>22f</b> was well tolerated, but did not confer protection. These results provide the foundation for further development and optimization of potent compounds that broadly inhibit infection by the pathogenic NWAs.

ZNFX1
Also flagged:respiratory diseasebindingcell nucleusinfectioninfectionsrubella virus infections
Journal Article 2026-05-04 ✓ 3 Snippets Suomalainen M, Haenseler W, Kolibius J, Plückthun A, Hearing P, Greber UF.
In-Text Gene Mentions

…of the ISGZNFX1was probed by…

…binant rabbit monoclonal anti-ZNFX1(Abcam ab179452, EPR12330…

…IFNα2a-mediated induction ofZNFX1(zinc finger NFX1-type…

Show Full Abstract

Macrophages conduct first-in-line defense against pathogens, including human adenovirus (AdV). AdVs cause respiratory disease, persist in immune cells, and, upon reactivation, are life-threatening to immunocompromised individuals. Here, our single-cell, single-virus experiments showed that AdV-type-C5 entry into human induced-pluripotent stem cell-derived macrophages is attenuated at cell binding and endosomal escape. A significant fraction (~30%) of the double-stranded viral DNA (vDNA) reaches the cell nucleus; however, it failed to efficiently express the immediate-early viral epigenetic regulator E1A. E1A transcription of silenced vDNA was rescued by E1A expression from a heterologous promoter of a superinfecting AdV, and allowed for full viral replication and progeny formation, even days post-infection, indicating long-lived infectivity of dormant vDNA. Bulk RNA-seq analyses showed that attenuated single AdV-C5 infections upregulated signaling, defense, and proinflammatory genes, whereas productive coinfections upregulated DNA replication and signaling pathways. Together, our data demonstrate that macrophages are a Trojan horse for AdV, notably independent of interferon, raising the possibility that macrophages function as a reservoir for AdV <i>in vivo</i> and reactivate dormant virus via epigenetic signals.<h4>Importance</h4>AdV are widespread, cause severe respiratory disease, persist in immune cells, and, upon reactivation, cause life-threatening conditions in immunocompromised individuals. Here, we show that human macrophages are either protected or susceptible to AdV, depending on the cell state, notably in an interferon-independent manner. The decisive cell state switch is the viral immediate-early transcription modulator E1A, which turns a repressive state into a permissive one and allows for the transactivation of dormant AdV-C5 genomes and viral progeny production. The data raise the possibility that macrophages are a hub for AdV persistence and epigenetic reactivation <i>in vivo</i>, in line with the notion that these cells resist immune clearance and serve as reservoirs for HIV, herpesvirus, SARS-CoV-2, or rubella virus infections.

MLLT10
Also flagged:acute myeloid leukemiaAMLmethylationgene expressionCell proliferationphosphorylation
Journal Article 2026-05-04 ✓ 2 Snippets Zuo Y, Geng L, Guo Y, Zhao D, Qi N, Wang Y, Zhang J, Niu Z.
In-Text Gene Mentions

…gene expression (HOXA10,MLLT10), while BCL-2 overexpression…

…downregulated HOXA10 andMLLT10, and blocked PI3K/AKT…

Show Full Abstract

MLL-rearranged acute myeloid leukemia (AML) is a high-risk hematological malignancy driven by aberrant epigenetic regulation. MLL fusion proteins recruit the DOT1L methyltransferase, causing dysregulated histone H3K79 methylation and sustained leukemogenic gene expression (HOXA10, MLLT10), while BCL-2 overexpression contributes to apoptosis resistance. This study evaluated the synergistic efficacy of combining the DOT1L inhibitor EPZ004777 with the BCL-2 inhibitor ABT-737. THP-1 cells were treated with EPZ004777 and ABT-737 alone or in combination. Cell proliferation, apoptosis, H3K79 methylation, target gene expression, and PI3K/AKT signaling were assessed. An in vivo xenograft mouse model (C-NKG mice) validated therapeutic effects. Combined treatment exhibited potent synergistic cytotoxicity. Dual inhibition reduced H3K79 di- and tri-methylation, downregulated HOXA10 and MLLT10, and blocked PI3K/AKT phosphorylation. In vivo, combination therapy prolonged survival, restored bone marrow function, and alleviated organ infiltration. These findings demonstrate that dual targeting of DOT1L and BCL-2 exerts synergistic anti-leukemic activity via PI3K/AKT suppression in MLL-rearranged AML, providing a pharmacological rationale for this innovative combination strategy.

SERPINC1
Also flagged:non-alcoholic fatty liver diseaseNAFLDchronic liver diseaseobesityinsulin resistancehigh blood pressure
Journal Article 2026-05-04 ✓ 2 Snippets Gorlov IP, Gorlova OY, Thrift AP.
In-Text Gene Mentions

…SPECC1L, ATP6V1F, COL5A1,SERPINC1, LGALS3, and COL3A1…

…of them exceptSERPINC1were upregulated in…

Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD), formerly known as non-alcoholic fatty liver disease (NAFLD), exhibits marked racial disparities in incidence, progression, and clinical outcomes. While diet, lifestyle, and socioeconomic factors have been shown to influence these disparities, biological mechanisms underlying racial differences in MASLD risk remain poorly understood. We hypothesized that race-associated variation in hepatic gene expression may contribute to differential susceptibility and progression of MASLD. To test this hypothesis, we analyzed publicly available gene expression data from liver biopsies obtained from over 300 Black and White individuals undergoing bariatric surgery. Gene expression profiles were compared across four histological stages: normal liver, MASLD, metabolic dysfunction-associated steatohepatitis (MASH) without fibrosis, and MASH with fibrosis. We identified more than 200 genes that were significantly differentially expressed between Black and White individuals. Genes associated with MASLD progression were significantly enriched among race-specific genes, supporting the hypothesis that racial differences in hepatic gene expression contribute to disease risk and progression. Using histologically normal liver as a reference, we identified race-specific candidate genes potentially driving MASLD progression. These included UCN3 and PRSS3 in Black individuals, and MMP15, LAMB2, LEPR, ELOVL2, CD48, COL5A2, and ICAM1 in White individuals. Notably, divergence in gene expression profiles between racial groups became more pronounced with advancing disease stages, suggesting that race may play an increasingly important role in later phases of MASLD progression. Our findings indicate that differential modulation of hepatic gene expression represents a potential biological mechanism contributing to racial disparities in MASLD. These results highlight the importance of considering race-specific molecular signatures in understanding MASLD pathogenesis and in developing targeted prevention and therapeutic strategies.

Also flagged:post-translational modificationsporeand epileptic encephalopathiesDEEprotein degradationLynch-syndrome disorder
Journal Article 2026-05-04 No Snippets Moth CW, Sheehan JH, Al Mamun A, Sivley RM, Gulsevin A, Rinker DC, Mchaourab ZF, Undiagnosed Diseases Network, Capra JA, Meiler J.
Show Full Abstract

Effective diagnosis and treatment of rare genetic disorders requires the interpretation of a patient's genetic variants of unknown significance (VUSs). Today, clinical decision-making is primarily guided by gene-phenotype association databases and DNA-based scoring methods. Our web-accessible variant analysis pipeline, VUStruct, supplements these established approaches by deeply analyzing the downstream molecular impact of variation in context of 3D protein structure. VUStruct's growing impact is fueled by the co-proliferation of protein 3D structural models, gene sequencing, compute power, and artificial intelligence. Contextualizing VUSs in protein 3D structural models also illuminates longitudinal genomics studies and biochemical bench research focused on VUS, and we created VUStruct for clinicians and researchers alike. We now introduce VUStruct to the broad scientific community as a mature, web-facing, extensible, High-Performance Computing (HPC) software pipeline. VUStruct maps missense variants onto automatically selected protein structures and launches a broad range of analyses. These include energy-based assessments of protein folding and stability, pathogenicity prediction through spatial clustering analysis, and machine learning (ML) predictors of binding surface disruptions and nearby post-translational modification sites. The pipeline also considers the entire input set of VUS and identifies genes potentially involved in digenic disease. VUStruct's utility in clinical rare disease genome interpretation has been demonstrated through its analysis of over 175 Undiagnosed Disease Network (UDN) Patient cases. VUStruct-leveraged hypotheses have often informed clinicians in their consideration of additional patient testing, and we report here details from two cases where VUStruct was key to their solution. We also note successes with academic research collaborators, for whom VUStruct has informed research directions in both computational genomics and wet lab studies.

Also flagged:gene expressionArboleda-Tham syndromecognitive impairment syndromechromatinbrainmethylation
Journal Article 2026-05-04 No Snippets Voss AK, Eccles S, Wichmann J, Abeysekera W, Bergamasco MI, Garnham AL, Ranathunga N, Yang Y, Bowden R, Smyth GK, Thomas T.
Show Full Abstract

Heterozygous variants in the KAT6A gene encoding the histone lysine acetyltransferase KAT6A (MOZ, MYST3) cause Arboleda-Tham syndrome, a cognitive impairment syndrome. Histone acetylation is generally associated with active gene transcription. Genetic deletion of both alleles of the Kat6a gene in mice causes developmental defects including anterior homeotic transformation, cleft palate, interrupted aortic arch and cardiac septal defects. Loss of KAT6A impairs expression of HOX, DLX and TBX genes, which are essential for body segment identity specification, palate, heart and aortic arch development. However, the effects of loss of KAT6A on chromatin modifications and gene expression in neural cells, which are relevant to normal brain development and function, is still poorly understood. In this study, we used an automated high-throughput chromatin profiling method and RNA sequencing in mouse neural system and progenitor cells to assess the effects of loss of one or two alleles of Kat6a on gene expression, histone acetylation and methylation. We also assessed occupancy by a trithorax group protein and RNA polymerase II. Our data suggests two modes of action for KAT6A: (1) acetylation of histone H3 on lysine 23 at promoters and enhancers and (2) recruitment of the trithorax group protein MLL1 (KMT2A) to promote the expression of developmental genes, including SOX and homeodomain genes. Together, these two functions appear to be required for normal gene expression in neural progenitors and essential for proliferation and neuronal differentiation.

SOX6
Also flagged:cell-cell signallingAutism Spectrum Disordersbasal bodyciliary axonemeJoubert syndromeciliopathy
Journal Article 2026-05-04 ✓ 2 Snippets Hasenpusch-Theil K, Lesayova A, Kozić Z, Beltran M, Wilson G, Henderson NC, Dando O, Theil T.
In-Text Gene Mentions

…the MGE (SOX6, LHX6 )…

…, LHX6 andSOX6, were altered.…

Show Full Abstract

Primary cilia control cell-cell signalling and their dysfunction has been implicated in Autism Spectrum Disorders (ASD) but their roles in the ASD aetiology remain largely unexplored. Here, we analysed the impact of ASD mutations in CEP41 using human cortical organoids. CEP41 encodes a centrosomal protein located at the basal body and the ciliary axoneme and is mutated in ASD individuals and in Joubert syndrome, a ciliopathy with high incidence of ASD. To gain insights into CEP41's role in ASD aetiology, we characterised human cortical organoids carrying the CEP41 R242H point mutations found in ASD individuals. This mutation did not interfere with CEP41's ciliary localisation but cilia were shorter and had lower levels of tubulin polyglutamylation, which is indicative of altered cilia stability and signalling. Moreover, scRNAseq analyses revealed that the expression of several transcription factors with critical roles in interneuron development was altered in mutant interneurons and their progenitors. The CEP41 mutation also caused an augmented formation of upper layer cortical neurons. Taken together, these findings indicate that CEP41 controls excitatory and inhibitory neuron differentiation, alterations in which might lead to an excitation/inhibition imbalance that is widely recognized as a convergent mechanism underlying neurodevelopmental disorders.

SERPINC1
Also flagged:lupusliver diseasethrombocytopeniafactor deficienciesImmune Thrombocytopenia andThrombosis
Journal Article 2026-05-04 ✓ 1 Snippet Guy S, Hickey K, Maclean R.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

The direct thrombin inhibitor argatroban is licensed for use in Heparin-induced thrombocytopenia. Original trial data gave the recommendation of monitoring argatroban by Activated Partial Thromboplastin Time (APTT) stating a therapeutic target range of 1.5-3.0 times baseline APTT and not exceeding 100 s. APTT has limitations due to prolongation arising in factor deficiencies, lupus anticoagulants, liver disease, and high FVIII levels leading to potential overestimation of argatroban. Argatroban has demonstrated a plateau effect on APTT at higher concentrations; additionally, APTT reagents have different sensitivity to argatroban, potentially underestimating or overestimating the argatroban. Anti-IIa methods have been recommended as a suitable alternative to accurately quantify argatroban levels. However, there is a lack of consensus on what the target therapeutic range should be. This review will demonstrate how argatroban monitoring by APTT may not be the most suitable method to successfully dose argatroban based on the current state of knowledge and recent published guidelines and highlight the benefits of the anti-IIa methods.

BTN2A1
Also flagged:degenerative neurological disorderADneurodegenerative disorderbehavioralMetabolismpathogenesis
Journal Article 2026-05-04 ✓ 5 Snippets Liu S, Zhu J, Zhong H, Zhou D, Long Q, Zhang Z, Yang X, Wu Q, Cheng C, Wu J, Luu HN, Wang J, Zhao B, Wu C, Deng Y, Wu L.
In-Text Gene Mentions

…one inflammatory protein (BTN2A1) exhibited a positive…

…inverse association ofBTN2A1with AD risk.…

…them, five (i.e.,BTN2A1, BTN3A2, LILRB4, CD22,…

BTN2A1[ 61 ],…

…, 70 ],BTN2A1[ 71 ],…

Show Full Abstract

Alzheimer's disease (AD) is a prevalent degenerative neurological disorder with limited treatment options. Prior studies reported specific metabolites and inflammatory proteins to be related to AD risk. However, the intricate relationship between inflammatory proteins, blood metabolites, and AD risk in European population remains unclear. Genetic instruments for 1,091 metabolites and 736 inflammatory proteins were derived from two recent comprehensive genome-wide association studies. Univariable Mendelian Randomization was employed to assess potential causal effects of metabolites on AD risk, potential effects of inflammatory proteins on metabolites, and effects of inflammatory proteins on AD risk. Multivariable MR (MVMR) was further applied to disentangle direct effects of proteins and metabolites on AD. Twelve metabolites were identified to be associated with AD risk, and 226 inflammatory proteins demonstrated likely to be causal effects on these 12 metabolites. Further examining the associations between such inflammatory proteins and AD risk revealed 22 associations for which the effect directions from inflammatory proteins to metabolites, from metabolites to AD risk, and from inflammatory proteins to AD risk were aligned, suggesting inflammatory protein - metabolite - AD risk pathway. MVMR further highlighted four trios in which the effect directions were consistent with the UVMR results, supporting a metabolite‑mediated pattern. This large‑scale genetic analysis highlights specific metabolites as direct contributors to AD risk and suggests that certain inflammatory proteins may influence AD primarily through downstream metabolic pathways. Our findings offer potential novel therapeutic targets for AD intervention.

Also flagged:extracellularmembranecytoskeletonsynthesispost-traumatic osteoarthritisjoint disorder
Journal Article 2026-05-04 No Snippets Cordeiro MC, Barbero A, Martin I, Stoddart MJ.
Show Full Abstract

Articular cartilage, as a mechanosensitive tissue, supports and distributes various mechanical forces-including compression, shear, hydrostatic pressure, and tensile strain-during joint loading and motion. These external forces deform not only the chondrocytes but also their pericellular matrix and the surrounding extracellular matrix (ECM). Those mechanical cues are detected by mechanosensors on the plasma membrane (e.g., integrins) and transmitted through the cytoskeleton, ultimately being converted into biochemical signals. These signals activate key mechanoresponsive intracellular pathways-including TGF-β-induced SMAD, Rho-GTPase, MAPKs (ERK, JNK, p38), PI3K/AKT/mTOR, MRTF-SRF, and YAP/TAZ-that regulate chondrogenic differentiation and cartilage-specific matrix synthesis. This field of study is known as mechanobiology. Over the past decades, it has gained increasing recognition, particularly with the emergence of tissue-engineering constructs as a novel strategy for cartilage repair. However, progress in chondrogenic mechanobiology has primarily centred on intrinsic substrate- or matrix-derived cues, while overlooking the role of extrinsic mechanical forces. This review therefore provides an updated perspective on chondrogenic mechanobiology, with a particular focus on the cellular responses to external mechanical stimuli. It also emphasizes the therapeutic potential of incorporating mechanical stimulation into tissue-engineering strategies for cartilage repair, an emerging filed referred to as Regenerative Rehabilitation (RR). Since this concept has so far been investigated mainly in vitro, we highlight only those studies and refer to it as In vitro Regenerative Rehabilitation. Moreover, this review also addresses post-traumatic osteoarthritis (PTOA), a common joint disorder that frequently results from traumatic cartilage damage. It explores the mechanobiological mechanisms underlying OA and discusses in vitro regenerative rehabilitation studies, highlighting how external forces could serve as an alternative to conventional biochemical treatments for preventing OA progression.

Also flagged:tumorcancerepithelial-mesenchymal transitionextracellularcancersmethylation
Journal Article 2026-05-04 No Snippets Sharma P, Thuy NP, Ansari IH, Tripathi RM, Kala M, Elberry MH, Sharma N, Lee SJ.
Show Full Abstract

Chemoresistance remains the primary cause of cancer treatment failure, yet current understanding remains fragmented across isolated mechanistic studies. This review provides a unified framework linking tumor microenvironment (TME) signaling, epigenetic reprogramming, and nanotherapeutic intervention as an integrated axis driving and potentially reversing chemoresistance. We systematically examine how TME components: hypoxia (HIF-1α pathway), acidosis, cancer-associated fibroblasts (TGF-β/PDGF signaling), and immune cells (NF-κB-mediated immunosuppression) activate signaling cascades that directly interface with epigenetic machinery. These TME-activated pathways recruit DNA methyltransferases, histone-modifying enzymes, and regulate microRNA (miRNA) networks, establishing stable resistant phenotypes including epithelial-mesenchymal transition, cancer stem cells, and metabolic adaptation. Critically, miRNA dysregulation serves as a central integrator, creating bidirectional crosstalk between signaling pathways and epigenetic modifications through self-reinforcing circuits. Unlike previous reviews focusing on isolated resistance mechanisms, we demonstrate how this integrated TME-epigenetic axis creates specific therapeutic vulnerabilities exploitable through rationally designed nanotechnology platforms delivering epigenetic modulators (DNMT inhibitors, HDAC inhibitors, EZH2 inhibitors) and gene therapy tools (CRISPR-Cas9 epigenetic editors, miRNA mimics/antagomirs). We critically evaluate clinical translation challenges, including EPR effect heterogeneity, delivery barriers, and biomarker gaps, providing a balanced perspective on both potential and obstacles. This mechanistic framework guides the development of next-generation combination therapies targeting multiple nodes within the TME-epigenetic-nanotherapy axis.

HTT
Also flagged:mitochondrialhereditary cancerneurologic disordersneuromuscular disordersneurocutaneous disordersinborn errors of metabolism
Journal Article 2026-05-04 ✓ 2 Snippets Brazilian Rare Genomes Project Consortium. Electronic address: antonio.campos@einstein.br, Brazilian Rare Genomes Project Consortium.
In-Text Gene Mentions

…, HOXD13 ,HTT, JPH3 ,…

…DMPK , andHTT, three cases…

Show Full Abstract

Genome sequencing (GS) has emerged as a transformative tool in the diagnosis of rare diseases with complex phenotypes. This technology uncovers structural, intronic, non-coding, and mitochondrial variants that traditional methods might miss, thereby facilitating the understanding of the underlying genomic basis of human disorders. We enrolled 10,305 patients with suspected rare diseases or hereditary cancer risk syndromes from 21 centers throughout Brazil. Their genomes were sequenced with short, paired-end reads, and diagnostic reports were provided for 9,448 of these patients. The overall diagnostic yield was 35.6%, and 4.6% of all positive reports had GS-exclusive findings (e.g., short copy-number variants overlapping fewer than three exons, deep intronic variants, short tandem repeat expansions, and mitochondrial structural variants-usually not detected by other diagnostic tests such as exome sequencing). Preliminary analysis of transcriptome sequencing (TS) or long-read GS combined with GS interpretation provided a small but welcome improvement in diagnostic yield (0.1% and 1.0% of positive reports, respectively). Almost 3,200 variant/phenotype interpretations were submitted to ClinVar. GS is proving to be an invaluable resource for shortening the diagnostic odyssey of patients with rare diseases, providing crucial genomic diagnostics, and enriching genetic databases with variant interpretations from underrepresented populations. Therefore, GS has the potential to significantly enhance the precision of healthcare in genetically diverse populations.

HFE
Also flagged:Irongenetic disordershereditary hemochromatosiserythropoiesisthalassemiasickle cell disease
Journal Article 2026-05-04 ✓ 5 Snippets Chatzikalil E, Delaporta P, Bistas K, Kattamis A.
In-Text Gene Mentions

Hemochromatosis, the main cause…

…alteration in theHFEgene [ 7…

…In rare cases,hemochromatosisis caused by…

…with [ferritin], [TSAT], [hemochromatosis], and [thalassemia], limiting…

…iron levels (HFE, HJV ,…

Show Full Abstract

Iron overload is associated with significant health risks, underscoring the importance of understanding its pathophysiology as well as establishing accurate diagnostic and monitoring methods. Chronic iron overload is associated with either genetic disorders characterized by excessive iron accumulation (hereditary hemochromatosis), or is secondary to diseases of ineffective erythropoiesis and/or requiring regular blood transfusions (like thalassemia, sickle cell disease, myelodysplastic syndromes). Diagnosis is based on clinical suspicion, corroborated by laboratory findings such as elevated serum ferritin and transferrin saturation, along with imaging techniques (magnetic resonance imaging) which facilitate non-invasive assessment of iron levels in parenchymal organs. Elevated ferritin and transferrin saturation and exclusion of secondary causes should prompt genetic evaluation for hereditary disorders predisposing iron overload. Chronic systemic iron overload causes progressive tissue iron accumulation, leading to severe clinical implications, including myocardial dysfunction, liver cirrhosis, and increased risk of hepatocellular carcinoma. Monitoring includes evaluating iron overload indices (serum ferritin, transferrin saturation, liver and heart iron concentration) along with serum and urine indices of parenchymal organ damage at different timepoints regarding the type of disease, patient's age, severity and response to treatment, and aims in improving disease progression and preventing complications. This article provides a comprehensive overview of the pathophysiologic mechanisms and the diagnostic and monitoring techniques of iron overload, in order to revise current knowledge and to raise clinical awareness for effective management.

ARFGEF2
Also flagged:cancerColorectal Cancertumortumorsimmune responsesbinding
Journal Article 2026-05-04 ✓ 1 Snippet Li D, Shen W, Yang S, Liu H, Tan X, He X, Hao J, Yin X.
In-Text Gene Mentions

…DGRG7‐K663E, FBXO41‐R577Q, andARFGEF2‐W1135R from P2; ASTN1‐L297V,…

Show Full Abstract

To develop a personalized neoantigen therapy strategy for microsatellite stability (MSS)-advanced colorectal cancer (CRC), neoantigens from collected human CRC samples were screened, and the feasibility and effectiveness of these neoantigens in treating CRC were explored. Whole-exome sequencing and transcriptome sequencing were performed to identify somatic mutations, RNA expression, and human leukocyte antigen alleles. Based on these data, neoantigen candidates were predicted, and their immunogenicity was evaluated. Selected neoantigens from patients elicited enhanced T-cell responses in CRC peripheral blood lymphocytes. Mutated peptides SOX9-V144M, ZNF169-A275S, CDH4-V456M, NIM1K-T66M, and MAP3K9-R1008Q were more effective than nonmutated ones in Patient 1. Vaccination with mutant peptides ZNF169-A275S and CDH4-V456M inhibited tumor growth in an autologous humanized CRC mouse model. Highly immunogenic neoantigens are strong candidates for personalized cancer therapy, showing promise for translating into effective treatments for CRC patients with advanced disease.

PCDH17
Also flagged:Colorectal adenomacolorectal carcinomacancercell cyclehyperplastic polypssporadic colorectal cancer
Journal Article 2026-05-04 ✓ 1 Snippet Valickova A, Urbanova M, Horak J, Jungwirth J, Kral J, Hucl T, Makajevova V, Summerova S, Kohout P, Matej R, Vodicka P, Vymetalkova V.
In-Text Gene Mentions

PCDH17

Show Full Abstract

Colorectal adenoma (CRA) is a precancerous lesion that can progress to colorectal carcinoma (CRC); however, its malignant potential varies considerably. The present study aimed to characterize the putatively pathogenic variants (PPVs) of CRA and to assess their potential clinical relevance in identifying lesions with an increased risk of progression at precancerous stages. PPVs in a panel of 176 cancer-associated genes were analyzed in 67 CRA samples and matched adjacent normal mucosa using next-generation sequencing. The panel included genes involved in DNA repair pathways, cell cycle regulation and the genes directly associated with CRC development. PPVs in CRA tissue were identified in 44 patients. The most frequently mutated genes were found to be <i>APC, KRAS, FBXW7, BRAF</i> and <i>MAP2K4</i>, with <i>APC</i> mutations being the most prevalent. A higher frequency of PPVs was observed in CRA with high-grade dysplasia and tubulo-villous features. Notably, among the entire sample set, there were 10 hyperplastic polyps, which are generally considered low risk; however, three carried PPVs, specifically one polyp carried <i>APC, MAP2K4</i> and <i>FEN1</i> mutations, another polyp carried <i>BRAF</i> and <i>POLQ</i> mutation, and a third carried a <i>MAP2K4</i> mutation. These findings suggested that mutational profiling may provide additional molecular information beyond histopathological assessment and could support improved risk stratification of colorectal lesions in early, precancerous stages. Such molecular characterization may be of value for identifying subsets of patients who could benefit from closer clinical surveillance.

HFE
Also flagged:Tic disordersvocal ticstictic disordervocal tic disorderTourette syndrome
Journal Article 2026-05-04 ✓ 5 Snippets Jia R, Zhu T, Tian X, Wang S, Zhang S, Fan F, Wang Y, Chai Y, Chen Z, Hu Y, Li W, Han F.
In-Text Gene Mentions

…several genes (BMPR1B,HFE, HJV, TFR2, and…

HFE, TFRC, HJV, and…

HFE(hemochromatosis gene) forms…

…HFE (hemochromatosisgene) forms a…

…was proposed, thatHFE, TFRC, HJV, and…

Show Full Abstract

<h4>Introduction</h4>Tic disorders (TDs) are common neurodevelopmental conditions with unclear pathogenesis and a lack of objective biomarkers. This study aimed to explore the associations among circulating microRNAs (miRNAs), erythroid phenotypes, iron homeostasis, and pediatric TD.<h4>Methods</h4>A total of 30 TD children and 10 healthy controls were enrolled. Serum levels of five candidate miRNAs, erythroid parameters, and iron metabolism indicators were detected. In this study, serum levels of five candidate miRNAs were quantified in children with tic disorders and age- and sex-matched normal controls using RT-qPCR. Erythroid phenotypes and serum iron-metabolism indicators were assessed in parallel. Differential expression analyses, multivariate modeling, and network-based target and functional enrichment analyses were performed to explore integrated molecular signatures.<h4>Results</h4>Results showed that hsa-miR-125b-5p and hsa-miR-23a-3p were significantly upregulated in the TD group. TD children exhibited lower hemoglobin, mean corpuscular volume (MCV), serum ferritin, transferrin (TrF), total ironbinding capacity, and soluble transferrin receptor, along with higher mean corpuscular hemoglobin concentration, while hemoglobin fractions remained unchanged. The integrated model combining hsa-miR-125b-5p, MCV, and TrF showed excellent diagnostic performance (AUC=0.977). Network and enrichment analyses revealed convergent biological pathways involving cellular and multicellular homeostasis, metal ion regulation, and TGF-β/BMP-associated signaling, linking miRNA-associated regulatory networks to erythroid and ironrelated processes.<h4>Discussion</h4>In conclusion, children with TD may exhibit homeostatic dysregulation of circulating miRNAs, erythroid profiles, and iron metabolism. This integrative molecular framework may provide insight into peripheral regulatory mechanisms relevant to neurodevelopmental pathology.

MRPL39
Also flagged:epithelialEpsteinvirusEBV) infectionlocalized diseasemetastatic disease
Journal Article 2026-05-04 ✓ 2 Snippets Chen H, Wu Y, Zhang K, Chen Z, Xu H, Xie C, Lin C, Pan X.
In-Text Gene Mentions

…( 124 ), lnc-MRPL39-2, CircWHSC1, HOXA-AS2, and…

…Long Non-Coding RNAMRPL39-2, 1…

Show Full Abstract

Nasopharyngeal carcinoma (NPC) is a metastasis-prone malignancy that is highly prevalent in endemic regions. Epigenetic dysregulation, including aberrant DNA/RNA/protein methylation, histone modifications, and non-coding RNA networks, contributes to NPC invasion and metastasis by reshaping epithelial-mesenchymal transition, tumor microenvironment interactions, immune evasion, and therapy adaptation. This review provides a structured overview of the core mechanisms of epigenetic regulation in NPC, highlighting aberrant methylation (DNA, RNA, protein), histone post-translational modifications (acetylation, phosphorylation, ubiquitination, palmitoylation), and the dysregulation of non-coding RNAs. We also summarize current translational progress, including biomarker development and early NPC-specific epigenetic trials, while highlighting the major barriers to clinical implementation, such as tumor heterogeneity, off-target effects, and insufficient validation. Overall, this review integrates mechanistic and translational evidence to clarify how epigenetic insights may support biomarker-guided and precision-oriented management of NPC.

SERPINC1
Also flagged:septic cardiomyopathysepsisreverse transcriptiondegradationbindinginfection
Journal Article 2026-05-04 ✓ 1 Snippet Tao Y, Li L, Wang J, Du W, Ye S, Lu J.
In-Text Gene Mentions

…factors such asForkhead Box C1Box C1 (FOXC1),…

Show Full Abstract

<h4>Background</h4>Septic cardiomyopathy (SCM) is one of the most common and serious complications of sepsis. Earlier research has identified reciprocal regulation between SCM and gut microbiota (GM), but the mechanistic basis of GM in SCM development remains obscure. This study aimed to explore the value of targets of GM in SCM.<h4>Methods</h4>The genome-wide association study (GWAS) data of sepsis and GM were downloaded from public databases. The causal association between GM and sepsis was evaluated via Mendelian randomization (MR) analysis to identify key microbiota potentially involved in septic complications. The metabolites and targets corresponding to the GM were acquired from the public databases. The differentially expressed genes (DEGs) between SCM and control were obtained by differential expression analysis. Subsequently, biomarkers were identified by the intersection of DEGs and targets of GM, and machine learning algorithm. Gene set enrichment analysis (GSEA), and immune analysis were adopted. Then, the upstream factors and metabolites linked to biomarkers were obtained. Finally, molecular docking and molecular dynamics (MD) simulation analysis was conducted. Additionally, the concentrations of the inflammatory cytokine IL-6 and the myocardial injury marker cTnI in clinical samples were detected using enzyme-linked immunosorbent assay (ELISA). The concentration of the key metabolite propylene glycol was measured via gas chromatography-mass spectrometry (GC-MS). The expression levels of biomarker genes were validated through reverse transcription quantitative polymerase chain reaction (RT-qPCR).<h4>Results</h4>A total of 5 GM, such as genus.Bifidobacterium.id.436.scatter were obtained based on MR analysis, and 22 metabolites, such as folic acid, and 461 targets, such as CA12 were obtained. Then, a total of 166 DEGs were determined, a total of 11 candidate genes were obtained through the intersection of the targets of GM and SCM. Finally, STAT3 and SLC5A1 were identified as biomarkers, and these 2 genes were both enriched in the pathways such as valine leucine and isoleucine degradation. Moreover, immune cells such as MDSCs and activated dendritic cells might have a notable impact on SCM with biomarkers. Transcription factors (TFs) such as FOXC1 and microRNAs (miRNAs) such as miR-3120-3p have been found to have regulatory relationships with biomarkers, and propylene glycol had good binding activity with biomarkers. Finally, clinical sample validation results demonstrated that serum IL-6 and cTnI concentrations were significantly elevated in SCM patients, while propylene glycol levels were markedly decreased. Concurrently, STAT3 mRNA expression was significantly upregulated, whereas SLC5A1 expression was significantly downregulated.<h4>Conclusion</h4>This study identified STAT3 and SLC5A1 as candidate biomarkers associated with gut microbiota in SCM, providing a foundation for future investigation into their mechanistic roles.

FBXL4
Also flagged:Circadianintervertebral disc degenerationCircadian rhythmsmetabolismautophagyextracellular
Journal Article 2026-05-04 ✓ 1 Snippet Zhao J, Wang S.
In-Text Gene Mentions

F-box and leucine-rich repeat protein 3and leucine-rich repeat…

Show Full Abstract

Circadian rhythms are essential for maintaining intervertebral disc (IDD) homeostasis and regulate cellular metabolism, mechanical responses, and therapeutic efficacy. Core clock genes, especially CLOCK and BMAL1, have central roles in controlling energy metabolism, autophagy, and extracellular matrix production in disc cells. When circadian rhythms are disturbed, the progression of intervertebral disc degeneration (IDD) can be accelerated through increased inflammatory activity and impaired nutrient supply, which is particularly harmful in the avascular environment of the disc. Circadian regulation also influences how disc cells adapt to mechanical stress, thereby helping maintain disc structure and function under both normal and pathological loading conditions. As a result, people who are chronically affected by circadian disruption, such as shift workers or individuals with long-term sleep loss, may have a higher risk of developing IDD. From a therapeutic perspective, strategies based on circadian regulation, including light therapy, time-restricted feeding, and chronotherapy, have shown potential to slow or even reverse degenerative changes by re-establishing synchrony with endogenous biological rhythms. This review summarizes the role of circadian rhythms in IDD homeostasis and IDD progression, and further discusses the clinical significance of circadian-targeted approaches for the prevention and treatment of spinal disorders.

Also flagged:lung cancermitochondrialcancerLung tumorsTumormembrane
Journal Article 2026-05-04 No Snippets Catalán M, Vidal D, Molina-Berríos A, Carrasco-Rojas J, López-Muñoz R, Vásquez G, Olmedo I, Jara JA.
Show Full Abstract

<h4>Introduction</h4>Lung cancer remains the leading cause of cancer-related mortality worldwide. Drug resistance is a major limitation of current therapies, prompting the search for new treatment strategies. Lung tumors frequently develop a hypoxic microenvironment associated with aggressive behavior and unfavorable clinical outcomes. Tumor-initiating cells (TICs), also known as cancer stem cells, and hypoxia-driven metabolic adaptations contribute significantly to therapy resistance. Mitochondrial destabilization has emerged as a promising invariant target in TICs. Triphenylphosphonium (TPP<sup>+</sup>)-conjugated hydroxybenzoates selectively accumulate in the mitochondrial matrix, driven by membrane potential, disrupting organelle function. Additionally, doxycycline inhibits mitochondrial biogenesis and reduces mitochondrial mass. Here, we evaluate a therapeutic strategy combining TPP<sup>+</sup>-conjugated lipophilic cations with doxycycline to target mitochondrial vulnerability in non-small cell lung cancer.<h4>Methods</h4>TPP<sup>+</sup> lipophilic cations conjugated to benzoate derivatives, alone or combined with doxycycline, were evaluated for their ability to disrupt mitochondrial function, reduce cell viability, and induce apoptosis in two lung cancer cell lines under normoxic and hypoxic conditions.<h4>Results</h4>Our results demonstrate that these compounds exhibit cytotoxicity in lung cancer cells, particularly under hypoxic conditions, consistent with mitochondrial functional impairment. Combinations of TPP<sup>+</sup>C<sub>10</sub>/doxycycline and GA-TPP<sup>+</sup>C<sub>10</sub>/doxycycline exhibited synergistic cytotoxicity in both normoxia and hypoxia, and increased apoptotic cell death compared to monotherapies.<h4>Conclusion</h4>Targeting mitochondrial functions using mitochondria-directed compounds, particularly in combination with doxycycline, represents a promising therapeutic approach for lung cancer. This strategy may be especially effective in hypoxic microenvironments, where conventional therapies often fail. Further <i>in vivo</i> validation is warranted to support the translational potential of this approach.

TNFSF4
Also flagged:22q11.2 deletion syndromeendocrine dysregulationcongenital athymiacombined immune deficiencySCIDT lymphopenia
Journal Article 2026-05-04 ✓ 1 Snippet Hennings V, Lingman Framme J, Thörn K, Lundqvist C, Lemarquis A, Oskarsdottir S, Telemo E, Björklund Å, Ekwall O.
In-Text Gene Mentions

…signaling such asTNFSF4and SERPINB9 (…

Show Full Abstract

22q11.2 deletion syndrome (22q11DS) is associated with congenital anomalies and variable thymic hypoplasia with T cell lymphopenia and immune dysregulation. However, the spatial organization of human thymic lymphopoiesis and stromal mechanisms contributing to thymic dysfunction in 22q11DS remain incompletely defined. We applied spatial transcriptomic and spatial proteomic analyses on thymic samples from two 22q11DS patients and compared them with healthy controls. Across 22q11DS samples, we observed alterations in the corticomedullary organization and in the frequencies of fibroblasts, B cells, regulatory T cells, and mTEC subsets. These features coincided with a prominent remodeling of the mesenchymal compartment, including increased expression of extracellular matrix programs and collagens, and predicted disruption in mesenchymal-epithelial cell crosstalk. In the medulla, we observed alterations in interferon-associated gene programs within a colocalized niche comprising B cells, antigen-presenting cells, and mTEC subsets. Together, this provides an integrated spatial map of the 22q11DS thymus and nominates stromal remodeling as a candidate driver of impaired central tolerance induction in 22q11DS.

Also flagged:Microtubulescell divisionorganellesbindingmicrotubulespindle
Journal Article 2026-05-04 No Snippets Garg J, Lopes Ribeiro J, Wallin S, Alisaraie L.
Show Full Abstract

The intracellular transport system is pivotal for cellular function and integrity, facilitated by cytoskeletal motor proteins such as dynein, which traverse along microtubules (MTs). The heterogeneity of the tubulin isotypes composing MTs introduces functional diversity, potentially affecting cytoskeletal motor proteins' interactions with the MT. This <i>in silico</i> study investigated the influence of amino acid sequence variations in the C-terminal tails (CTTs) of six different <i>Homo sapiens</i> tubulin isotypes, TUBB2A, TUBB2B, TUBB2C, TUBB3, TUBB4A, and TUBB5, highly expressed in human brain tumors, and assessed the isotypes' effect on the binding of motor protein dynein to MT. Among these isotypes, TUBB2A, TUBB2B, and TUBB2C were found to affect conformational motions of the dynein's microtubule-binding domain (MTBD) and stalk domain. The investigation highlighted the novel role of isotype-specific variations in lateral interactions between tubulin protofilaments (PFs) in determining the proximity of the β-CTT of the adjacent PF to the MTBD, potentially affecting dynein's motility and suggesting how changes in isotype expression directly influence dynein's velocity and processivity and contribute to transport defects associated with neurological disorders and cancers. Isolating specific tubulin isotypes experimentally is challenging due to their high sequence similarity and complex interactions with other microtubule-associated proteins. This makes it challenging to distinguish between different tubulin isotypes and their effects, particularly in tissues where multiple isotypes are coexpressed. Additionally, these isotypes are heavily modified <i>in vivo</i> by post-translational modifications, which further complicate the isolation of a single, unmodified tubulin isotype. As a result, computational approaches have been necessary in this study for exploring these effects in a controlled, isotype-specific manner.

Research Square 2026-05-04 Preprint (No Snippets API) Alexander MW, Wood B, Oh H, Bot V, Borger J, Galbiati F, Walker K, Resnick S, Ochs-Balcom H, Wyss-Coray T, Kooperberg C, Reiner A, Jacobs E, Rabin J, Casaletto K, Saloner R.
Show Full Abstract

<title>Abstract</title> <p>Earlier menopause is a risk factor for several age-related diseases, including dementia. The biological pathways linking menopause timing to later-life brain aging are not understood. Leveraging large-scale plasma proteomics in postmenopausal women from the UK Biobank (N=15,012), earlier menopause was associated with upregulation of pro-inflammatory and extracellular matrix degradation pathways, plus accelerated aging across proteomic clocks of organ and cellular aging, including brain and oligodendrocyte aging. Elevated GDF15, a canonical aging marker, was the top protein correlate of earlier menopause. We observed robust replication of menopause timing proteomic shifts in the Women’s Health Initiative Long Life Study (N=1,210). In UKB, proteins associated with earlier menopause, including GDF15, exhibited concordant associations with incident dementia risk and brain atrophy, cerebral small vessel disease burden, and white matter microstructural integrity. Collectively, our findings identify proteomic signatures linking ovarian aging to brain aging, providing a framework to inform interventions to reduce dementia risk.</p>

bioRxiv 2026-05-04 Preprint (No Snippets API) Li G, Frydman GH, Li H.
Show Full Abstract

The interplay between inflammation and coagulation is a central driver of thrombotic risk across various diseases. While mathematical models of blood coagulation are well established, there remains a critical gap in quantitative frameworks that capture inflammation-induced hypercoagulability. In this study, we develop a mathematical model that explicitly simulates the interaction between pro-inflammatory cytokines and the coagulation cascade. The model incorporates key mechanisms, including: (i) upregulation of tissue factor (TF) by IL-1 β , IL-6, and TNF- α ; (ii) suppression of natural anticoagulants, namely antithrombin III (ATIII) and tissue factor pathway inhibitor (TFPI), by IL-6 and TNF- α ; and (iii) feedback amplification of proinflammatory cytokines by thrombin. By encoding the bidirectional feedback between inflammatory and coagulation pathways, the model captures essential features of inflammation-driven hypercoagulability and enables systematic quantification of how variability in inflammatory extent and duration results in heterogeneous thrombin generation (TG) dynamics. To evaluate its effectiveness, we integrate the model with TG assays and apply it to virtual patient cohorts representing four clinically distinct conditions: COVID-19, sickle cell disease (SCD), type 2 diabetes mellitus (T2DM) and Hemophilia A. Model simulations predict that disease-specific inflammatory environments induce distinct shifts in TG dynamics. In COVID-19 and T2DM, elevated cytokine levels lead to shortened lag times and increased thrombin peak, whereas in SCD, shortened lag times are accompanied by a reduced thrombin peak. These effects are strongly modulated by both cytokine concentration and duration of exposure. These results demonstrate that the proposed computational model augments conventional TG assays by mechanistically linking inflammatory signaling to disease-specific coagulation responses. Collectively, the proposed computational framework extends conventional TG assays by considering the interplay between inflammation and coagulation, thereby providing a potential tool for predicting disease progression and identifying disease-specific therapeutic targets to advance personalized management strategies in thrombo-inflammatory disorders.

Journal Article 2026-05-03 No Snippets Malec J, Rusen K, Golding GB, Ilie L.
Show Full Abstract

Protein sequence alignment is one of the most fundamental procedures in bioinformatics. Due to its many downstream applications, improvements to this procedure are of great importance. We consider two revolutionary concepts that emerged recently as candidates for improving the state-of-the-art alignment methods: AlphaFold and protein language models such as Ankh, ProtT5, or ESM-C. Alignment improvements can come from the structural alignment of AlphaFold-predicted structures or the scoring based on the similarity of protein embeddings produced by the protein language models. Thorough comparison on many domains from BAliBASE and CDD demonstrates that the Ankh-score method produces much better sequence alignments than the structural alignments using US-align of AlphaFold3-predicted structures. Both are better than the traditional method using BLOSUM matrices. This suggests that Ankh embeddings may possess certain information that is not available in the AlphaFold3-predicted structures. The alignment software is freely available as a web server at e-score.csd.uwo.ca and as source code at github.com/lucian-ilie/E-score.

DCC
Also flagged:breast cancercancerscancerlymphatic disorderscaveolaeendocytosis
Journal Article 2026-05-03 ✓ 4 Snippets Zheng B, He C, Zhao F, Li R, Zhang Z, Chen X, Shi M, He B, Wang R, Ren G, Zhang S, Yang S.
In-Text Gene Mentions

…, DHA, DHA-SME,DCC, DCC-SME, DSC, and…

…the treatment ofDCC-SME or DSC-SME.…

…TheDCC-SME or DSC-SME treatment…

…Moreover,DCC-SME or DSC-SME treatment…

Show Full Abstract

The eradication of cancers within the lymphatic system is a key treatment goal for cancer metastasis and an important determinant of patient prognosis. Therefore, efficient delivery of chemotherapy drugs to the lymphatic system with minimal side effects holds potential for improved treatment options in aggressive breast cancer. In contrast to the invasive administration routes, oral nanocarriers, particularly self-microemulsifying drug delivery system (SME) has attracted increasing attention to treating lymphatic disorders by exploiting intestinal lymphatic transport. In this study, an optimized SME formulation loaded with a reduction-sensitive lipophilic dihydroartemisinin (DHA) prodrug (DSC) was developed for oral delivery and the treatment of breast cancer metastasis by harnessing intestinal lymphatic transport. Compared with parent DHA, DSC exhibited higher affinity with the oil phase of SME, improving the molar drug loading (1.83-fold) and sustained-release behavior of the SME formulation. DSC also exhibited reduction-triggered release of DHA under high reducing condition, which may reduce unnecessary systemic exposure while improving antitumor efficacy. In vitro cell studies revealed that DSC-SME was internalized into intestinal epithelial cells primarily via caveolae/lipid raft- and clathrin-mediated endocytosis, rather than macropinocytosis. Following internalization, it was subsequently trafficked across cells via the chylomicron pathway. After oral administration, DSC-SME enhanced intestinal retention and promoted drug accumulation in mesenteric lymph nodes. Its oral bioavailability was 8.91- and 2.14-fold higher than that of free DHA and DHA-SME, respectively. Both in vitro and in vivo studies indicated that DSC-SME exhibited favorable antitumor efficacy against murine orthotopic 4 T1 breast tumors and lung metastases, with no significant gastrointestinal or systemic toxicity observed under the current experimental conditions. The proposed mechanism of action involved glutathione depletion, apoptosis induction, proliferation inhibition, and amelioration of the immunosuppressive tumor microenvironment. Collectively, these findings suggest that integrating a reduction-responsive lipophilic prodrug with a convenient SME formulation may offer a promising oral platform for inhibiting cancer metastasis, warranting further preclinical evaluation.

Also flagged:Neurodegenerative Diseasesdegradationmitochondrialphosphorylationmetabolismmyelin
Journal Article 2026-05-03 No Snippets Ailioaie C, Ailioaie LM, Stan CI, Sava A, Chiran DA.
Show Full Abstract

Neurodegenerative diseases (NDDs) in children represent a heterogeneous group of rare but collectively significant disorders characterized by progressive neurological decline, developmental regression, and substantial morbidity and mortality. Unlike adult-onset neurodegeneration, pediatric conditions are predominantly genetic and frequently arise from defects in fundamental cellular pathways, including lysosomal degradation, mitochondrial oxidative phosphorylation, peroxisomal lipid metabolism, and myelin maintenance. This comprehensive review synthesizes current knowledge regarding the epidemiology, molecular classification, pathophysiology, and emerging therapeutic strategies of major pediatric neurodegenerative disorders. Epidemiological data indicate a "rare-but-many" landscape, where individually uncommon diseases collectively impose a measurable population burden. Mechanistically, disease progression reflects converging processes such as toxic substrate accumulation, impaired autophagy-lysosome flux, mitochondrial bioenergetic failure, oxidative stress, neuroinflammation, and glial dysfunction. Representative groups discussed include lysosomal storage disorders, leukodystrophies, mitochondrial encephalopathies, peroxisomal disorders, and other monogenic neurodegenerative syndromes. Advances in next-generation sequencing, metabolic profiling, and neuroimaging have substantially improved diagnostic accuracy and enabled earlier detection, including through newborn screening programs. Therapeutic paradigms are shifting from primarily supportive care toward mechanism-based interventions, including enzyme replacement therapy, hematopoietic stem cell transplantation, substrate reduction strategies, and gene therapy approaches. Early molecular diagnosis is increasingly recognized as critical for optimizing outcomes, particularly in disorders amenable to presymptomatic intervention. Continued integration of genomic medicine, standardized epidemiologic surveillance, and translational research will be essential to refine disease classification, improve prognostication, and expand access to targeted therapies. Collectively, pediatric neurodegenerative diseases exemplify the intersection of developmental neurobiology and inherited metabolic dysfunction, underscoring the need for multidisciplinary, precision-based clinical strategies.

CACNA1E
Also flagged:neurodevelopmental disordersepileptic encephalopathychannelopathies
Journal Article 2026-05-03 ✓ 2 Snippets Souza IA, Gambeta E, Benkirane M, Zamponi GW, Gandini MA.
In-Text Gene Mentions

…novo variants in <i>CACNA1E</i>, the gene encoding…

…racterize three pathogenic <i>CACNA1E</i> variants: H151L, M163T,…

Show Full Abstract

De novo variants in <i>CACNA1E</i>, the gene encoding the Cav2.3 voltage-gated calcium channel, are often associated with severe neurodevelopmental disorders, including developmental and epileptic encephalopathy. All reported variants up to date have exhibited gain-of-function effects on their biophysical properties. Here, we functionally characterize three pathogenic <i>CACNA1E</i> variants: H151L, M163T, and R1182C, using electrophysiology and structural modeling. M163T and R1182C exhibit depolarizing shifts in the voltage-dependence of activation, whereas R1182C also shows a reduced peak current density. H151L selectively slows recovery from inactivation. Our findings provide the first mechanistic evidence linking loss-of-function Cav2.3 pathogenic variants to variable neurological phenotypes, expanding the clinical spectrum of <i>CACNA1E</i> channelopathies.

Also flagged:periventricular nodular heterotopiaMCDneuronal migrationgenetic epilepsySeizuresgeneralized tonic-clonic seizures
Journal Article 2026-05-02 No Snippets Song J, Sun X, Zhang C.
Show Full Abstract

Periventricular nodular heterotopia (PVNH) is a malformation of cortical development (MCD) mainly caused by aberrant neuronal migration, and a group of diseases sharing similar pathological manifestations, including the presence of nodular clusters of abnormal neurons in the subependymal region. PVNH is one of major causes that result in genetic epilepsy. Seizures can strike as early as a few days after birth but are more common at 10-20 years old, and among them, generalized tonic-clonic seizures are commonly observed. PVNH is a highly genetically heterogeneous disease associated with various rare single gene variants. However, despite the fact that the FLNA gene is identified to be closely correlated with the presence of PVNH, mutations in other genes were understudied and have not attracted as much attention due to the relatively low morbidity of PVNH. In consequence, an updated spectrum of PVNH-associated risk genes with potentially pathogenic changes that lead to PVNH in human patients is urgently needed. The risk genes that have already been clinically reported for PVNH are summarized here chronologically according to when the first patient was reported, and clinical manifestations of patients with each of these genes are described. Human cerebral organoids as well as animal models are subsequently discussed in this review to reveal alterations in risk gene products and the pathogenesis of PVNH.

OLFM4
Also flagged:Bipolar Disorder
Journal Article 2026-05-02 ✓ 4 Snippets Örüm MH, Yılmaz S, Öner P.
In-Text Gene Mentions

…LRFN5 andOLFM4in Acute Manic…

…(LRFN5) and olfactomedin-4 (OLFM4) levels and aggregate…

…LRFN5 andOLFM4levels were measured…

…circulating LRFN5 andOLFM4levels alongside an…

Show Full Abstract

ObjectivesThis study aimed to compare serum leucine-rich repeat and fibronectin type III domain-containing protein-5 (LRFN5) and olfactomedin-4 (OLFM4) levels and aggregate index of systemic inflammation (AISI) values between hospitalized subjects with bipolar disorder (BD) experiencing acute manic episodes with psychotic features and healthy controls (HCs), and to examine their associations with clinical features and symptom severity.MethodsIn this cross-sectional study, participant characteristics and clinical features were assessed by structured clinical interviews. LRFN5 and OLFM4 levels were measured in the BD (n = 37) and HC (n = 35) groups using Enzyme-Linked ImmunoSorbent Assay kit.ResultsSerum LRFN5 (adjusted <i>P</i> = 0.0117) and OLFM4 (adjusted <i>P</i> = 0.0117) levels were significantly lower, whereas AISI (adjusted <i>P</i> = 0.0005) levels were significantly higher in the BD group compared with HCs, after adjusting for age, gender, body mass index, and smoking status. Within the BD group, a strong positive correlation was observed between LRFN5 and OLFM4 levels (r = 0.702, adjusted <i>P</i> = 0.006) and AISI showed a significant positive correlation with manic symptom severity score after controlling for age, gender, body mass index, and smoking status (r = 0.472, adjusted <i>P</i> = 0.030). In binary logistic regression analysis adjusted for age, gender, body mass index, and smoking status, lower OLFM4 levels (odds ratio (OR) = 0.970, <i>P</i> = 0.020, adjusted <i>P</i> = 0.003) and higher AISI values (OR = 1.008, <i>P</i> = 0.002, adjusted <i>P</i> = 0.001) were independently associated with BD status, alongside smoking status (OR = 19.213, <i>P</i> = 0.005, adjusted <i>P</i> = 0.001) (apparent area under the curve (AUC) = 0.914, optimism-corrected AUC = 0.884). After repeated stratified holdout validation, the mean and median test AUCs were 0.868 and 0.876, respectively.ConclusionsSubjects with BD experiencing acute manic episodes with psychotic features exhibited decreased circulating LRFN5 and OLFM4 levels alongside an increased systemic inflammatory burden, as reflected by AISI. AISI showed the strongest association with BD status and symptom severity and OLFM4 remained significant in adjusted analyses. Rather than indicating definitive diagnostic utility, the observed alterations may instead reflect underlying biological processes related to BD.

Also flagged:Chromosomeorganizationorgan developmentchromosomescell divisionchromatin
Journal Article 2026-05-02 No Snippets Reimonn T, Yilmaz VO, Tran H, Ng G, Liu D, Abdennur N.
Show Full Abstract

Chromosome conformation capture methods, such as Hi-C, have been used to profile chromosome organization from a wide variety of biosamples and conditions; however, existing methods for analyzing such datasets have disadvantages for large-scale integrative studies of long-range interactions. To address this shortcoming, we introduce an analytical framework, jointly-hic, that computes harmonized projections across arbitrarily many contact frequency matrices, suitable for integrative studies of compartmentalization and long-range interactions. Our approach produces robust and directly comparable first and higher-order principal component scores that collectively capture biologically meaningful information beyond traditional A/B compartment scores.

DCC
Also flagged:axon guidanceneurodevelopmental disordersaxon-guidancechronic diseaserestrictionchronic non-communicable diseases
Journal Article 2026-05-02 ✓ 5 Snippets Read JF, Stern DA, Carr TF, Spangenberg AL, Yang M, Luna-Ramirez RI, Guerra S, Morgan WJ, Binder AT, VanWormer JJ, Seroogy CM, Miller RL, Zoratti EM, Ober C, Jackson DJ, Limesand SW, Gold DR, Gern JE, CADRE consortium, Bosco A, Martinez FD.
In-Text Gene Mentions

….g., Ephrin-A3, Semaphorin-6A,DCC) and growth factor…

…(e.g., SPON2, CHL1,DCC) (Supplementary Fig. 11B,…

…the netrin receptorDCC, the semaphorin receptor…

…our candidate genes/proteins (DCC netrin 1 receptornetrin 1 receptor,…

…Netrin receptors (DCC, UNC5B ),…

Show Full Abstract

Children born small for gestational age (SGA) face elevated risks of metabolic, cardiovascular, respiratory, and neurodevelopmental disorders, as well as premature mortality, yet the underlying mechanisms remain only partly understood. We analyze blood proteomic data from multiple birth cohorts to identify molecular pathways linked to SGA and to later-life lung function. We find that approximately one-third of SGA children exhibit a distinct molecular endotype marked by dysregulation of axon-guidance proteins in cord blood. In peripheral blood collected later in life, these proteins are inversely associated with contemporaneous spirometric restriction. Using GWAS data and an experimental sheep model, we obtain convergent evidence that axon-guidance genes are associated with spirometric indices (FEV<sub>1</sub>/FVC) at genome-wide significance and are broadly expressed during fetal development across multiple organs. These findings offer new insight into the developmental origins of chronic disease and highlight axon-guidance pathways as promising targets for investigating multiorgan morbidity.

BTN3A3BTN2A1
Also flagged:neurodegenerative disordershistone modificationsCognitionfrontal lobeagingdementia
Journal Article 2026-05-02 ✓ 2 Snippets Rahman MS, Frkatović-Hodžić A, van den Ameele J, Hill SM, Kingston N, Bradley JR, Tom BDM, Chinnery PF.
In-Text Gene Mentions
⭐ same-sentence co-mention

…genes- BTN3A2 ,BTN3A3and BTN2A1 -belongs…

⭐ same-sentence co-mention

…, BTN3A3 andBTN2A1-belongs to ‘…

Show Full Abstract

Executive function is an essential cognitive domain for typical human behavior which is disrupted in neurodevelopmental and neurodegenerative disorders, but little is known about its underlying molecular basis. To address this, we perform genome-wide association studies (GWAS) using three different measures of executive function in UK Biobank (N = 84,238) and NIHR BioResource's Genes and Cognition (N = 9932) study participants, followed by a meta-analysis. The trail-making alphanumeric (TMA) measure is the most heritable phenotype (h²=7-26%), associated with 18 independent loci that exhibit a similar direction of effect in both cohorts. Across these loci, in-silico follow-up implicates 178 genes, of which NT5DC2 and RP11-579E24.2 are independently replicated prior to meta-analysis. TMA is linked to pan-cerebral differences in brain structure, with brain-enriched genes showing a biphasic expression profile from early development through to later life. Our data implicate specific cell types, histone modifications and butyrophilin immunoglobulin family proteins as potential targets for promoting cognitive resilience.

PTGIS
Also flagged:synthesisangiogenesissteroidogenesiscell proliferationcell adhesiongene expression
Journal Article 2026-05-02 ✓ 5 Snippets Blitek A, Szymanska M.
In-Text Gene Mentions

…PPARD, PPARG, PTGES,PTGIS, PTGS2, SLC27A1, SLC27A2,…

…ANGPT2, CD36, PPARG,PTGIS, PTGS2, SCL27A1, SLC27A4,…

…ANGPT2, PPARG, PTGES,PTGIS, PTGS2, SLC27A1, SLC27A4,…

…the medium inhibitedPTGISmRNA expression in…

PTGISprotein abundance decreased…

Show Full Abstract

This study aimed to determine whether fatty acids (FAs) may affect the function of the early porcine placenta. First, the expression of FA transporters (CD36, SLC27A) in conceptuses and placentae of days 10-11, 12-13, 15-16, 18-20, 25, and 30 pregnant gilts (n = 5-8 per group) was examined using Real-time PCR, Western blot, and immunohistochemistry. Then, primary trophoblast (pTr) cells from days 15-16 conceptuses were exposed to n-6 and n-3 polyunsaturated FAs (PUFAs) to study prostaglandin (PG) synthesis and the expression of genes related to FA action, angiogenesis, steroidogenesis, and lipid transport. Furthermore, pTr cell proliferation and adhesion in response to PUFAs were determined colorimetrically. Increased mRNA expression of CD36, SLC27A1, and SLC27A2 was detected in days 18-25 placentae compared with days 10-13 conceptuses. SLC27A4 and SLC27A6 expression was greater in days 10-11 spherical than in days 15-16 elongated conceptuses. SLC27A1, SLC27A4, and SLC27A6 were localized at the placenta-endometrium interface. PUFAs of n-6 series elevated PGE2 and PGI2 synthesis, whereas n-3 PUFAs stimulated PGE2 but inhibited PGI2 output. All PUFAs up-regulated the mRNA expression of CPT1A, a rate-limiting enzyme of FA β-oxidation. Moreover, docosahexaenoic acid (DHA) increased FABP5, SLC27A4, LDLR (lipoprotein receptor), and proangiogenic ANGPT1 and ANGPTL4 mRNA expression. DHA and arachidonic acid stimulated pTr cell proliferation, while linoleic and eicosapentaenoic acids increased cell adhesion. These results are the first demonstrating dynamic changes of FA transporter expression in peri-implantation conceptuses and developing placentae of the pig and indicate FA uptake by the early placenta. Furthermore, PUFAs may support placenta development by modulating gene expression, increasing PGE2 level, and promoting trophoblast cell viability and adhesion.

Also flagged:extracellularstem cell differentiationcell migrationtissue morphogenesiscell proliferationmechanotransduction
Journal Article 2026-05-02 No Snippets Zhang W, Zhang D, Niu H, Zhang J, Li Y.
Show Full Abstract

Hydrogels, particularly those based on polymer networks, exhibit complex mechanical behaviors arising from the interplay between network architecture, molecular interactions, and external stimuli. In particular, their viscoelasticity, energy dissipation, and nonlinear mechanical responses arise from the dynamic nature of crosslinking and multiscale relaxation processes. This review provides a comprehensive overview of hydrogel mechanics from a multiscale perspective, covering viscoelastic behavior, relaxation dynamics, energy dissipation mechanisms, nonlinear deformation, and fracture properties. We summarize recent advances in experimental characterization, including bulk rheology and single-molecule force spectroscopy, and discuss how molecular-level interactions, bond kinetics and mechanochemical processes contribute to macroscopic mechanical performance. In addition, theoretical models and constitutive frameworks describing transient and dynamic polymer networks are critically evaluated to bridge microscopic dynamics with bulk responses. Emerging strategies that integrate dynamic bonding and force-responsive elements are also discussed in the context of tailoring mechanical adaptability and functionality. Finally, we outline current challenges and future directions toward the rational design of hydrogels with tunable viscoelasticity, enhanced mechanical robustness, and programmable mechanical functions.

Also flagged:Thrombocytopeniahematologic diseaseschronic thrombocytopeniagray platelet syndromeHereditary thrombocytopeniasimmunodeficiency
Journal Article 2026-05-02 No Snippets Györke E, Benyó G, Árvai KB, Bödör C, Kereskai L, Ábrahám H, Réger B, Egyed B, Ottóffy G.
Show Full Abstract

<h4>Background</h4>The etiological diagnosis of chronic thrombocytopenia in children remains challenging and is often established by exclusion. In this article, we present the case of a patient in whom we used whole-exome sequencing (WES) to help identify the underlying cause and determine the appropriate treatment.<h4>Methods</h4>Whole-exome sequencing was performed to clarify the genetic background of the disease. Based on the results, transmission electron microscopy (TEM) was also carried out to confirm or exclude the pathogenic role of the identified <i>NBEAL2</i> gene variant and to assess the presence of gray platelet syndrome.<h4>Results</h4>In this patient, despite the presence of the <i>NBEAL2</i> gene variant, neither gray platelet syndrome nor a pathogenic role of the variant could be confirmed. However, the genetic findings identified by WES led to numerous additional investigations, causing a considerable burden on both the patient and the family.<h4>Conclusions</h4>Our case highlights that WES testing, which is emerging in pediatric hematology practice, offers not only diagnostic advantages but also pitfalls. Whole-exome sequencing has recently emerged as a new diagnostic tool and has been available nationwide in pediatric hematology-oncology care in Hungary for just over two years. While personalized treatment strategies for benign hematologic diseases increasingly rely on high-throughput genetic testing, the clinical application of WES requires a cautious, critical evaluation of results. Despite the method's promise, the heterogeneity of the findings underscores the need to interpret WES results carefully and to place them in a clinical context in every case.

Also flagged:agingdegenerative musculoskeletal diseasesbiofilm formationinfectionshost cellextracellular
Journal Article 2026-05-02 No Snippets Martín-Santana Y, González-Carranza Y, Díaz-Tato L, Juárez-Hernández A, García-Sánchez EO, De La Garza-Ramos MA, Rodríguez-Castellanos EA, Hernández-Rodríguez MAL.
Show Full Abstract

The design of implant surfaces that support bone integration while limiting bacterial colonization remains a central challenge in biomaterials science and engineering. In this work, zinc-doped biomimetic calcium phosphate (CaP-Zn) coatings were fabricated on Ti6Al4V through surface activation followed by deposition in supersaturated simulated body fluid (SBF). Acid and alkali-calcium treatments produced a porous, calcium-rich interface that enabled the uniform formation of apatite-like CaP layers. Zinc incorporation was achieved without suppressing the formation of CaP phases and led to systematic changes in coating microstructure and surface chemistry. Spectroscopic and structural analyses indicated Zn incorporation within the CaP matrix, consistent with partial Ca<sup>2+</sup> substitution and its association with poorly crystalline domains. These features promoted controlled ionic release and localized dissolution-reprecipitation behavior. Antibacterial testing against <i>Streptococcus mutans</i> revealed a clear Zn-dependent reduction in bacterial viability, while cytocompatibility remained within acceptable limits at moderate Zn levels. Finally, the coatings combine intrinsic bioactivity with ion-mediated antibacterial functionality, offering a multifunctional surface strategy for advanced titanium-based implants.

Also flagged:tuberculosisTBpulmonary diseasechromatinmetabolisminfections
Journal Article 2026-05-02 No Snippets Druszczynska M, Sadowska B, Kulesza J, Kulesza E, Fol M.
Show Full Abstract

The Bacillus Calmette-Guérin (BCG) vaccine, originally developed for tuberculosis (TB) prevention, has recently attracted attention due to its broader immunomodulatory properties. In addition to its role in TB control, BCG induces trained immunity, a process involving epigenetic and metabolic reprogramming of innate immune cells that leads to altered systemic inflammatory responses. Increasing evidence suggests that these long-term immune adaptations may influence the central nervous system by modulating microglial activation and neuroinflammatory pathways implicated in neurodegenerative diseases. In parallel, chronic infections such as TB are associated with persistent systemic inflammation and immune dysregulation, which may contribute to microglial priming and increased vulnerability to neurodegeneration. This narrative review, based on a targeted literature search of PubMed, Scopus, Web of Science, Embase, and relevant preprint servers, synthesizes current evidence on the relationships between BCG vaccination, trained immunity, and neuroimmune interactions. We focus on studies addressing systemic immune reprogramming, microglial responses, and neuroinflammatory mechanisms relevant to neurodegenerative disorders. The available data suggest that BCG-induced immune modulation may exert context-dependent effects on the brain, with potential neuroprotective implications under certain conditions. However, the evidence remains heterogeneous and largely observational, and causality cannot yet be established. Further mechanistic and prospective studies are required to clarify whether BCG-induced trained immunity can modify the risk or progression of age-related neurodegenerative diseases.

Also flagged:Cardiovascular diseasessignal transductionhypertensionatherosclerosiscardiovascular diseasecardiac hypertrophy
Journal Article 2026-05-02 No Snippets Cui Y, Wen Y, Wang X, Xu Y, Jiang M.
Show Full Abstract

Cardiovascular diseases have high mortality rates and present a high burden on society and the global healthcare system. A large quantity of drugs have been developed, such as aspirin, ACE inhibitors, beta-blockers, and statins. Although these traditional drugs have decreased the morbidity and mortality of cardiovascular diseases, they still have multiple limitations. Due to their shortcomings, researchers have continued to search for novel targets for drug treatment. The tripartite motif (TRIM) protein family is a superfamily with E3 ubiquitin ligase activity and involves diversified processes including proliferation, development, signal transduction, and immune regulation. The latest research has shown that TRIM proteins participate in the progression of cardiovascular diseases, such as cardiac hypertrophy, cardiac ischemia-reperfusion injury, heart failure, hypertension, atherosclerosis, and so on. In this review, we summarize the structure and function of TRIM proteins, as well as the mechanisms of their involvement in various cardiovascular diseases, aiming to raise awareness of the importance of TRIM proteins in cardiovascular disease research and treatment. Advancing our understanding of mechanisms mediated by TRIM proteins may emphasize their contributions to cardiovascular diseases and provide the opportunity to develop novel and targeted therapeutic strategies to combat cardiovascular diseases.

Also flagged:pulmonary TBTBTB infectionDiabetes mellitusinfectionsinfluenza
Journal Article 2026-05-01 No Snippets Nguyen HT, Vo LNQ, Codlin AJ, Forse R, Wingfield T, Annerstedt KS, MacLean EL, Creswell J, Kirubi B, Nguyen HB, Van Dinh L, Doan HT, Forsman LD, TBI Testing Team.
Show Full Abstract

<h4>Background</h4>Tuberculosis (TB) infection is a driver of the global TB epidemic. Accurate, affordable, and simpler diagnostics are crucial for identifying people for preventive therapy. We evaluated the diagnostic performance of the STANDARD F TB-Feron FIA (TB-Feron), a near-point-of-care (POC) assay for detecting TB infection.<h4>Methods</h4>From June to December 2024, we conducted a cross-sectional study at the Vietnam National Lung Hospital, enrolling 352 participants, including 345 eligible participants: 95 with microbiologically confirmed pulmonary TB (Group 1), 200 household contacts of people with pulmonary TB (Group 2), and 50 with a recent history of a negative QFT-Plus result and no known TB exposure (Group 3). Participants were tested with TB-Feron and the reference standard, QuantiFERON TB Gold Plus (QFT-Plus). Results were compared for sensitivity and specificity (primary endpoints), with inter-test agreement (Cohen's κ) and reproducibility (Bland-Altman analysis) as secondary outcomes.<h4>Results</h4>Among 345 eligible participants, TB-Feron sensitivity was 88.4% (95% confidence interval [CI] 80.2-94.1) in Group 1, and specificity was 70.0% (55.4-82.1) in Group 3. In Group 2, positive and negative agreements with QFT-Plus were 89.2% (79.8-95.2%) and 75.4% (66.9-82.6), respectively, with inter-test agreement of 80.5% (Cohen's κ=0.6069, P < .0001). Intra-test reproducibility showed no significant differences in IFN-γ levels (mean difference = 2.08 IU/mL, 95% CI -1.28 to 5.44, P = .206).<h4>Conclusions</h4>With high sensitivity, the TB-Feron assay is a potential near-POC alternative to the QFT-Plus assay for diagnosing TB infection, but requires consideration of its suboptimal specificity.

ABT1HFE
Also flagged:pulmonary hypertensionhemoglobinopathypulmonary vascular diseaseright ventricularvaso-occlusive crisismetabolism
Journal Article 2026-05-01 ✓ 2 Snippets Lucero MJ, Setua S, Thangaraju K, Khan A, Lamb DR, Lisk C, Swindle D, Cendali FI, Dzieciatkowska M, Stephenson D, Pak DI, Tolson R, Zaeske S, Rana NK, Khan S, Westover N, Davizon-Castillo P, George G, Hassell K, Nuss R, D'Alessandro A, Manolova V, Irwin DC, Buehler PW.
In-Text Gene Mentions

…iron overabsorption orhemochromatosisper se, 8…

…53 Theactivator of transcription 1of transcription 1…

Show Full Abstract

<h4>Abstract</h4>Sickle cell disease (SCD) is a genetically inherited hemoglobinopathy arising from homozygosity or compound heterozygosity for a single base pair mutation in hemoglobin β-globin gene (HBB), and the severity is affected by allelic combinations, haplotypes, and gene products. Numerous SCD mouse models exist to study mechanism and therapeutic intervention, and each display some phenotypic features of human disease. Berkeley SCD mice demonstrate clinically relevant pulmonary hypertension (mean pulmonary artery pressure, 25-35 mm Hg) when housed under subchronic (3-month) exposure to a moderately decreased oxygen level, ∼15%. This model accelerates red blood cell (RBC) sickling and hemolysis, which perpetuates precapillary pulmonary vascular disease and right ventricular dysfunction. Iron restriction in SCD is reported to attenuate the frequency and severity of vaso-occlusive crisis through reducing sickle hemoglobin in RBCs. Vamifeport is an oral clinical stage ferroportin inhibitor shown to improve microcirculatory blood flow in Townes-SS mice. We hypothesized that vamifeport treatment may attenuate right ventricular dysfunction and pulmonary vascular remodeling in Berkeley SCD mice that express a pulmonary hypertension phenotype. Further, we hypothesized that lung and right ventricle metabolism and protein expressions would show an antioxidant and iron-regulatory response that favors the attenuation of cardiopulmonary dysfunction. Indeed, attenuation of red cell sickling, reduced extravascular and intravascular hemolysis, and normalization of cardiopulmonary dysfunction was observed after vamifeport treatment. We suggest that induction of mild iron-deficiency anemia may attenuate deadly sequelae of SCD, including cardiopulmonary dysfunction.

Also flagged:plastidmitochondrialorganelleendophytismcarbon fixationphotosynthesis
Journal Article 2026-05-01 No Snippets Kim W, Jost M, Nickrent D, Zhou R, Acar P, Langschied F, Ebersberger I, Wicke S, Wanke S.
Show Full Abstract

Parasitic plants have evolved independently at least a dozen times across angiosperms, yielding some of the most extreme examples of genomic reconfiguration in plants. Comparative analyses of plastid, mitochondrial, and nuclear genomes reveal striking convergence across lineages such as progressive plastid genome reduction with retention of a minimal core gene set, alongside lineage-specific divergences, including unusual mitochondrial genome architectures, rampant horizontal gene transfer, and repeated loss of nuclear gene families. Expanded sampling largely confirms stepwise plastid genome condensation but also uncovers rare losses of presumed essential genes, novel tRNA retention patterns, and extremes in genome size and base composition. Mitochondrial genome sizes largely vary (<60 kb to ~4 Mb), shaped by repeat proliferation, recombination, and massive acquisition of foreign DNA. Nuclear genomes integrate these organellar changes with structural and regulatory innovations via e.g. polyploidy and repeat-driven evolution, as well as large-scale gene losses. These insights are increasingly translatable to agriculture through predictive weed management and resistance breeding pipelines that combine preattachment control, postattachment defense, and molecular surveillance to slow virulence evolution. The same genomic toolkits, including high-quality assemblies, organelle haplotyping, and quantitative diagnostics, can support the conservation of nonweedy parasites by refining species boundaries, identifying evolutionarily significant units, and informing International Union for Conservation of Nature (IUCN) Red List assessments and recovery plans. By bridging fundamental and applied research, parasitic plant genomics is poised to move beyond descriptive cataloguing toward design-based strategies that safeguard crop production while conserving some of the most specialized and ecologically vulnerable plants on earth.

OLFM4
Also flagged:membraneextracellularlocalizationEndosomeslysosomesorganelles
Journal Article 2026-05-01 ✓ 1 Snippet Yue Z, Dai W, Cao Z, Hu B, Wang Z, Ma X, Qin D, Zhang T, Sang Q, Mei J, Yu T, Zhou Y, Luo Z, Xu J, Yuan Z, Li YY, Zhang J, Huang C, Yang Z.
In-Text Gene Mentions

…( LGR5 ,OLFM4, and ASCL2…

Show Full Abstract

G protein-coupled receptors (GPCR) are increasingly recognized for their organelle-specific functions in cancer. A better understanding of the mechanisms governing their dynamic subcellular distribution and functional coordination is essential for developing spatially targeted therapies that exploit the subcellular signaling networks of GPCRs. In this study, we found that Golgi-localized GPR15 underwent spatiotemporal trafficking to enhance 5-fluorouracil (5-FU) chemosensitivity in colorectal cancer. Dependent on Gαq, GPR15 associated with and restrained PARP4 enzymatic activity in the Golgi apparatus to drive cytosolic NAD+ accumulation. MGST1 interacted with and navigated GPR15 redistribution to mitochondria to increase mitochondrial NAD+ abundance, which fueled central carbon metabolism and activated downstream metabolic networks to prime tumors for 5-FU cytotoxicity. Treatment with the PARP inhibitor rucaparib showed potent synergy with 5-FU and demonstrated robust tumor suppression in patient-derived organoids and xenograft models through NAD+-mediated metabolic perturbation. This work establishes spatially encoded GPCR signaling as a druggable axis to potentiate chemotherapy efficacy, redefining intracellular receptor trafficking as an important regulator of metabolic plasticity in cancer therapy.<h4>Significance</h4>GPCR redistribution spatially regulates NAD+ metabolism and can be harnessed with clinically available PARP inhibitors to enhance chemosensitivity, offering a strategy to target nongenetic adaptive mechanisms for treating colorectal cancer.

HFE
Also flagged:phosphorylation
Journal Article 2026-05-01 ✓ 5 Snippets Liu S, Tsyplenkova S, Charlebois E, Wallace DF, Subramaniam VN, Fillebeen C, Pantopoulos K.
In-Text Gene Mentions

…the hemochromatosis proteinHfe.…

…driven by liberatedHfe.…

…which likely sequestersHfe.…

…indicating that "liberated"Hferequires Tfr2 to…

…and Tfr2 andHfeexhibit nonredundant functions…

Show Full Abstract

<h4>Abstract</h4>In hepatocytes, transferrin receptor 1 (Tfr1) plays a limited role in iron acquisition but negatively regulates signaling to the iron hormone hepcidin (Hamp) through its interaction with the hemochromatosis protein Hfe. Its homolog, transferrin receptor 2 (Tfr2), operates as an iron sensor and direct positive regulator of hepcidin expression. We generated TfrcAlb-Cre;Tfr2Alb-Cre mice with hepatocyte-specific ablation of both Tfr1 and Tfr2 to study their effects on iron homeostasis. These animals are viable and develop systemic iron overload, recapitulating a key feature of Tfr2Alb-Cre mice, albeit with milder hepatic iron accumulation and relatively higher residual hepcidin expression, presumably driven by liberated Hfe. Only Tfr1-expressing primary hepatocytes from Tfrcfl/fl;Tfr2fl/fl and Tfr2Alb-Cre mice internalized fluorescent holo-transferrin (AF647-Tf), arguing against a significant contribution of Tfr2 or other receptors in transferrin-bound iron uptake. Under dietary iron restriction, Hamp mRNA suppression and hepatic iron depletion were comparable in Tfr2-deficient livers from TfrcAlb-Cre;Tfr2Alb-Cre and Tfr2Alb-Cre mice despite compensatory Tfr1 upregulation in the latter, which likely sequesters Hfe. Conversely, Tfr1-deficient but Tfr2-expressing livers from TfrcAlb-Cre mice displayed relatively elevated Hamp mRNA, as expected. Following an acute dietary iron challenge, Hamp mRNA induction and Smad1,5,9 phosphorylation occurred only in the liver of Tfr2-expressing TfrcAlb-Cre but not in TfrcAlb-Cre;Tfr2Alb-Cre mice, indicating that "liberated" Hfe requires Tfr2 to become functionally active. Collectively, these findings demonstrate that transferrin receptors are dispensable for hepatocellular iron supply, and Tfr2 and Hfe exhibit nonredundant functions under chronic iron loading but act cooperatively to induce hepcidin in response to an acute iron challenge.

HFE
Also flagged:erythropoiesismetabolismanemiairon-overload disordersbindingtransporter
Journal Article 2026-05-01 ✓ 2 Snippets Leal S, Denardo A, Van Echten A, Jungnickel H, Nelson CB, Sandoval D, Salvador JA, Shin J, Chung A, Brush MN, Bennett CP, Piermatteo A, Secrest PD, Jung CL, Ganz T, Poli M, Gordts PLSM.
In-Text Gene Mentions

…also displace thehemochromatosisprotein (HFE) from…

…the hemochromatosis protein (HFE) from interacting with…

Show Full Abstract

<h4>Abstract</h4>Hepcidin, a liver-derived hormone, is the central regulator of systemic iron homeostasis. Elevated hepcidin levels contribute to iron-refractory iron-deficiency anemia and anemia of inflammation, both characterized by restricted iron availability. Current treatments, such as parenteral iron infusions, are often ineffective and pose risks of adverse reactions, underscoring the need for alternative therapeutic strategies targeting hepcidin. We previously identified a novel hepcidin regulatory pathway involving liver heparan sulfate (HS) proteoglycans (HSPGs), which modulate receptor-ligand interactions through their sulfated HS chains. Recently, we found that halofuginone (HF) impairs HS biosynthesis and considered whether it could be used as a hepcidin modulator. Here, we demonstrate that in human hepatoma (Hep3B) cells, HF inhibits both basal and bone morphogenetic protein 6-induced hepcidin expression and SMAD1 phosphorylation signaling in a dose- and time-dependent manner. Consistently, Hep3B cells lacking HS (EXT1-/-) show no hepcidin suppression in response to HF. In vivo administration of HF reduces hepcidin expression in an iron-overload mouse model (8.3 g/kg carbonyl iron). This effect was absent in mice with impaired liver HS sulfation (Ndst1f/fAlbCre+), confirming that HF suppresses hepcidin via HSPG-mediated mechanisms. Additionally, HF decreased hepcidin expression in mice subjected to acute inflammation. These findings establish HF as a potential therapeutic for mitigating hepcidin-driven iron restriction in anemic disorders.

Also flagged:intracranial hemorrhageplatelet aggregationformationpathogenesisneonatalalloimmune thrombocytopenia
Journal Article 2026-05-01 No Snippets Zhang H, Paddock C, Oosterhoff JJ, Nguyen HTT, Zhi H, Wang Z, Sheridan D, Stuge TB, Ghevaert C, Newman DK, Vidarsson G, Newman PJ, Zhu J.
Show Full Abstract

<h4>Abstract</h4>Fetal and neonatal alloimmune thrombocytopenia (FNAIT) can be caused by maternal immunoglobulin G alloantibodies against the human platelet antigen 1a (HPA-1a), a Leu33Pro polymorphism at the plexin-semaphorin-integrin (PSI) domain of the β3 subunit shared by integrins αIIbβ3 and αVβ3. Although serologic detection of anti-HPA-1a alloantibodies has long aided FNAIT diagnosis, the disease remains a major clinical challenge due to unpredictable severe outcomes, particularly intracranial hemorrhage and fetal loss. To define the molecular basis of HPA-1a immunogenicity and antibody pathogenicity, we determined crystal structures of the HPA-1a antigen bound to Fabs from 4 anti-HPA-1a monoclonal antibodies, including 3 clinically relevant maternal alloantibodies (26.4, D-204, and M-204) and 1 murine antibody (SZ21). The structures reveal that all antibodies recognize an HPA-1a epitope centered on Leu33, spanning both PSI and integrin-epidermal growth factor (I-EGF) 1 domains of β3 integrin. Variations in antibody-binding interfaces account for differential affinities to both αIIbβ3 and αVβ3, whereas distinct binding orientations determine whether antibody engagement stabilizes the bent inactive β3 conformation. Functional assays demonstrated antibody-dependent inhibition of αIIbβ3-mediated platelet aggregation, thrombus formation, and clot retraction, as well as αVβ3-mediated endothelial adhesion and spreading. These results establish the structural framework of HPA-1a alloantigenicity, explain the conformational selectivity of anti-HPA-1a antibodies, and elucidate how they block integrin activation. The findings provide mechanistic insight into FNAIT pathogenesis and suggest that antibody heterogeneity in affinity and function may contribute to clinical variability. Furthermore, these findings demonstrate antibody-mediated stabilization of the PSI/I-EGF1 domain as a potential strategy for allosteric modulation of integrin structure and function.

HTT
Also flagged:ADHDorganizationemotional dysregulationattention-deficit/hyperactivity disorderneurodevelopmental disorderbehavioral
Journal Article 2026-05-01 ✓ 1 Snippet Pan N, Long Y, Qin K, Pope IZ, Chen Q, Zhu Z, Cao Y, Li L, Singh MK, McNamara RK, DelBello MP, Chen Y, Fornito A, Gong Q.
In-Text Gene Mentions

…ydroxytryptamine transporter [5-HTT], Pearson r =…

Show Full Abstract

<h4>Importance</h4>Attention-deficit/hyperactivity disorder (ADHD) is characterized by considerable clinical heterogeneity, and existing classification frameworks constrain the development of neurobiologically informed subtyping approaches.<h4>Objective</h4>To investigate whether normative modeling of topological properties derived from brain morphometry similarity networks can provide robust stratification markers for children with ADHD.<h4>Design, settings, and participants</h4>This case-control study leveraged multisite cross-sectional neurodevelopmental datasets with a longitudinal follow-up cognitive assessment for a subset. Morphometric similarity networks were constructed and normative models were developed for 3 topological metrics: degree centrality, nodal efficiency, and participation coefficient. Through semisupervised clustering, putative biotypes were delineated and their clinical profiles were examined. Brain profiles of these biotypes were further contextualized in terms of their neurochemical and functional correlates using large-scale databases, and model generalizability was assessed with external validation performed in an independent transdiagnostic cohort. Study data were analyzed from November 2023 to January 2025.<h4>Exposures</h4>Normative modeling of topological properties derived from brain morphometry.<h4>Main outcomes and measures</h4>Topological deviations in morphometric similarity networks derived from brain structural image.<h4>Results</h4>The discovery cohort comprised 446 children with ADHD (mean [SD] age, 11.5 [2.6] years; 339 male [76.0%]) and 708 controls (mean [SD] age, 11.0 [2.3] years; 429 male [60.6%]), whereas the validation cohort included 554 children with ADHD (mean [SD] age, 10.1 [2.8]; 372 male [67.1%]) and 123 controls (mean [SD] age, 10.1 [3.0]; 70 male [56.9%]). ADHD exhibited atypical hub organization across all 3 topological metrics, with significant case-control differences primarily localized to a covarying multimetric component in the orbitofrontal cortex. Three biotypes emerged: severe-combined with emotional dysregulation (widespread medial prefrontal cortex-pallidum alterations, n = 142), predominantly hyperactive/impulsive (anterior cingulate cortex-pallidum circuit alterations, n = 177), and predominantly inattentive (superior frontal gyrus alterations, n = 127), each characterized by distinct clinical profiles and longitudinal trajectories. These neural profiles of each biotype showed distinct neurochemical and functional correlates. Critically, the core findings were replicated in the validation cohort, demonstrating robust generalizability.<h4>Conclusions and relevance</h4>Results of this case-control study reveal that the integration of normative modeling with semisupervised clustering provided both dimensional and categorical insights into ADHD heterogeneity, identifying 3 distinct ADHD biotypes with unique clinical-neural profiles that advance the understanding of ADHD's neurobiological complexity and lay the groundwork for personalized management.

CCPG1
Also flagged:mantle cell lymphomagene expressiontumorstumormetabolismcell cycle
Journal Article 2026-05-01 ✓ 1 Snippet Yan Y, Chen W, Ge X, Sun J, Yu L, Garcia-Mansfield K, Zhang X, Yu Y, Xiong W, Zou D, An G, Jia Z, Pirrotte P, Li JJ, Yu Z, Hao M, Qiu L, Qi J, Wang L, Yi S.
In-Text Gene Mentions

…them, APC2 andCCPG1, which are related…

Show Full Abstract

<h4>Abstract</h4>Mantle cell lymphoma (MCL) is a biologically heterogeneous B-cell malignancy. Although genomics and transcriptomics have delineated parts of the MCL disease spectrum, proteomics remains largely unexplored. Here, we conducted a comprehensive proteogenomic analysis integrating genomics, transcriptomics, and proteomics on peripheral blood samples from 27 patients with MCL and 4 healthy donors to investigate the translational and posttranslational dimensions of MCL. Our study identified 1296 downregulated and 468 upregulated proteins in MCL cells. The splicing pathways were significantly upregulated at both the mRNA and protein levels, suggesting a critical role for aberrant RNA splicing in MCL pathogenesis. Integration of proteomic data with genetic aberrations revealed immunoglobulin heavy chain variable mutational status and CCND1 mutation are associated with distinctive transcriptomic and proteomic profiles, which correspond to significant differences in clinical outcomes. A multiomics molecular stratification model incorporating proteomic data showed superior predictive power for patient survival compared with single-omics models (concordance index, 0.83 vs 0.74). This study provides, to our knowledge, the first comprehensive proteogenomic profile of MCL, offering novel insights into its molecular mechanisms and clinical behavior. The identification of molecular subtypes and prognostic protein signatures underscores the potential of proteomics to guide precision medicine strategies for MCL.

SOX6
Also flagged:Peripheral nerve injuriesaxonalsecretioninflammatory responsesDigestioninfection
Journal Article 2026-05-01 ✓ 1 Snippet Yang Z, Qu G, Wang X, Wang L, Chen L, Fu G, Chen W, Yang Z, Li W, Zhou Y, Jin J, Zhou L, Zou D.
In-Text Gene Mentions

…, NRXN1 ,SOX6, EPHA7 ,…

Show Full Abstract

<h4>Background</h4>Peripheral nerve injuries (PNIs) present a persistent clinical challenge due to the intrinsically limited regenerative capacity of peripheral nerves. While dental pulp stem cells (DPSCs) exhibit significant neuroregenerative potential, their therapeutic efficacy is constrained by hostile microenvironments and inherent functional heterogeneity. Genetic modification may offer a promising strategy to enhance their therapeutic capabilities.<h4>Methods</h4>DPSCs were induced toward neural lineage differentiation, and key gene candidates were identified through qRT-PCR. Lentiviral-mediated gene interference was performed to modulate target gene expression, followed by comprehensive analysis of differentiation outcomes using qRT-PCR, Western blotting, and immunofluorescence assays. RNA sequencing was employed to uncover associated signaling pathways, which were subsequently validated through pharmacological inhibition with specific inhibitors. The therapeutic efficacy of genetically engineered DPSCs was evaluated in a rat model of sciatic nerve crush injury, with neural regeneration quantitatively assessed via neuroelectrophysiological measurements and histological analyses.<h4>Results</h4>LARP7 positively regulated the Schwann cell-like differentiation of DPSCs, as well as their trophic and anti-inflammatory effects, thus enhancing its therapeutic effects on nerve repair and promoting functional recovery. Mechanistically, we found that LARP7 remodeled cytokine-cytokine receptor interactions, enhancing trophic support while attenuating proinflammatory responses, and activated the PI3K-Akt-mTOR signaling pathway, with ERBB4 serving as a critical downstream effector, promoting DPSCs differentiation into Schwann cell-like phenotypes.<h4>Conclusions</h4>Collectively, LARP7-mediated changes in DPSCs establish a new therapeutic paradigm that addresses the limitations of current stem cell-based interventions and enables the development of standardized biotherapeutics for peripheral nerve repair.

LRRC7
Also flagged:SingleNucleussingle-nucleuscell-cell communication
Journal Article 2026-05-01 ✓ 1 Snippet Zhao Z, Duan X, Huang H, Zhang Y, Wang M, Qin J, Lin S, Chen H.
In-Text Gene Mentions

…by Mctp1 andLrrc7) that progressively dominate…

Show Full Abstract

The foreign body response to intracortical electrodes, characterized by chronic neuroinflammation and glial scar formation, remains a primary cause of long-term functional failure. However, neurons and glial cells' heterogeneity and intercellular signaling mechanisms following electrode implantation remain poorly resolved, which is responsible for direct dysfunction. Here, we applied single-nucleus RNA sequencing (snRNA-seq) to profile the peri-implant microenvironment in rat motor cortex tissue at 3, 25, and 50 days post-electrode implantation. Integrated bioinformatic analyses, including clustering, pseudotemporal trajectory reconstruction, and cell-cell communication inference, revealed a coordinated cellular response. We identified a pathologic microglial subpopulation (marked by Gpnmb, SPP1, and CD63) and a scar-associated astrocytic subtype (characterized by Mctp1 and Lrrc7) that progressively dominate the peri-implant niche. Crucially, we reveal that neurons orchestrate these processes via CX3CL1-CX3CR1 signaling, modulating microglial polarization and PTN-ALK/Ptpprz1 interaction, promoting astrogliosis and scar formation. These findings define the dynamic neuron-glia signaling landscape surrounding chronically implanted electrodes and provide mechanistic insight into how modulating cell-cell communication may improve the long-term biocompatibility of neural interfaces.

LRRC7DCC
Also flagged:X-Chromosomedosage compensationchromosomesX-chromosomesgene expressionchromatin
Journal Article 2026-05-01 ✓ 5 Snippets Chawla B, Jatia S, Sloan D, Eduful J, Mendoza H, McClear CA, Tran J, Csankovszki G.
In-Text Gene Mentions

Condensinsare 5-subunit protein…

Condensinhas the heterodimeric…

…The DC complex (DCC) is a 10-subunit…

…2014 ), theDCCreduces the gene…

…dependent on theDCC( Crane et…

Show Full Abstract

Dosage compensation (DC) in Caenorhabditis elegans utilizes a condensin complex that resembles mitotic condensins but differs by 1 subunit, DPY-27. DPY-27 replaces SMC-4, one of the structural maintenance of chromosome (SMC) proteins that is responsible for hydrolyzing ATP, required for the condensation of DNA and other mitotic condensin functions. To understand whether the ATPase function is required in DC, we first demonstrated that DPY-27 is capable of hydrolyzing ATP in vitro. Then, we used CRISPR/Cas9-mediated genome editing to generate an ATPase mutation in dpy-27. Although the mutant protein is expressed and is incorporated into the condensin IDC complex, this mutation results in a loss of DC. Specifically, we found that without ATPase function, DPY-27-containing condensin IDC has reduced capacity to bind DNA, condense the X chromosomes, and facilitate H4K20me1 enrichment on the X-chromosomes. Our results suggest that condensin IDC, like mitotic condensins, uses ATP hydrolysis to perform its functions, making C. elegans DC a model for how activities attributed to mitotic condensins can be used to regulate gene expression.

HTT
Also flagged:bindingHuntington's Diseaseneurodegenerative disorderreplication forkcell divisionHD
Journal Article 2026-05-01 ✓ 1 Snippet Goldberg ME, Dashnow H, Harris K, Quinlan AR.
In-Text Gene Mentions

…stretch in theHTTgene ( Wright…

Show Full Abstract

Short tandem repeats (STRs) are hotspots of genomic instability that mutate at rates orders of magnitude greater than nonrepetitive loci due to frequent replication slippage. Expansions at some STR loci cause Mendelian diseases, while variation at other noncoding loci may affect complex traits, possibly by altering transcription factor occupancy of nearby binding sites. Accordingly, some STRs are inferred to be under purifying selection, regardless of their instability. One or more "interruptions", or bases that disrupt the locus's canonical repeat, significantly decrease an STR's mutability. For example, the onset of Huntington's Disease, a neurodegenerative disorder associated with somatic expansions of a trinucleotide coding STR, is delayed in individuals whose inherited alleles contain interruptions. Thus, interruptions that decrease mutation rate at some coding loci may broadly protect against deleterious phenotypes associated with locus instability. However, interruptions may themselves be deleterious at constrained loci, particularly at noncoding loci in gene regulatory elements, possibly disrupting the formation of secondary structures key to their function. We therefore hypothesized that the frequency of interruptions could depend on a locus's functional importance-at constrained loci, the fitness effects of expansions but also interruptions could be more deleterious than at neutral loci. To test this hypothesis, we examined the distribution of interruptions at ∼650,000 autosomal STRs. In the ∼2,500 3- or 6bp-motif coding STRs, we find that synonymous interruption density increases with purifying selection on the gene, while the opposite is true for missense-causing interruptions. In contrast, noncoding STRs in gene regulatory elements harbor fewer interruptions than elements that are unassociated with gene regulation and thus more likely to be evolving neutrally. Our findings indicate that the abundance of interruptions may be partially explained at coding STRs by the benefit of lower instability, whereas maintaining a core stretch of uninterrupted repeat may be key to the function of regulatory noncoding STRs, outweighing the benefits of stability.

OLFM4
Also flagged:endometriosisendometriomasdeepsecretionsdigestioncycle
Journal Article 2026-05-01 ✓ 5 Snippets Paterson ESJ, Scheck S, Kleffmann T, Gill R, Bedford N, McDowell S, Girling JE, Henry CE.
In-Text Gene Mentions

…sfatin (Invitrogen, #EH482RB),OLFM4(Abcam, #ab267805) and…

…SPARCL1, NAMPT, andOLFM4were chosen based…

OLFM4and SPARCL1 were…

OLFM4standards ranged from…

…of LGMN, NAMPT,OLFM4, and SPARCL1 per…

Show Full Abstract

<h4>Purpose</h4>Endometriosis is a prevalent inflammatory condition characterised by the presence of endometrial-like tissue outside the uterus and is associated with significant challenges, including diagnostic delays and continued reliance on laparoscopy. Although extensive research has investigated potential biomarkers in various biofluids, none have been validated for clinical use.<h4>Experimental design</h4>This pilot study explored the proteome of cervicovaginal fluid to identify biomarkers of endometriosis. SWATH-MS was performed over two experiments on cervicovaginal fluid sampled via a low vaginal swab, from people with (n = 20) and without (n = 19) surgically confirmed endometriosis. STRING, OPLS-DA modelling and ingenuity pathway analysis were used to interrogate the data. ELISA was performed validate SWATH-MS findings.<h4>Results</h4>There were 29 proteins in experiment one and 47 proteins in experiment two identified as differentially abundant between cases and controls. No proteins were identified as differentially abundant in both experiments. Legumain (LGMN) measured via ELISA was significantly increased in the cervicovaginal fluid of people with endometriosis.<h4>Conclusions and clinical relevance</h4>Cervicovaginal fluid proteins sampled via vaginal swab may have limited biomarker potential for endometriosis. A larger and more diverse cohort would be required to confirm the promise of cervicovaginal fluid LGMN as a candidate biomarker of endometriosis.

Also flagged:metabolismlipolysisthermoregulationlipogenesisresponses to heatextracellular
Journal Article 2026-05-01 No Snippets Morrissey-Basler MC, Szymanski MR, Filep EM, Langan SP, Ormsbee MJ, Lee EC, Casa DJ.
Show Full Abstract

This study aimed to determine whether fat metabolism differs between males and females when exposed to extreme exercise-heat stress. Physically active males (n = 11, 23 ± 4 years, 81.7 ± 11.8 kg, body fat 16.4 ± 6.6%) and females (n = 13, 25 ± 4 years, 60.4 ± 7.1 kg, 24.4 ± 6.7%) completed a 2-h exercise-heat tolerance test (40 °$\boldsymbol{{}^{\circ}}$ C, 40% relative humidity). Differences (pre-, post-, change, and mean difference (MD)) within and between groups were analyzed. The subcutaneous abdominal adipose tissue (SCAAT) interstitial glycerol concentration and adipose tissue blood flow (ethanol Output:Input (O:I)) pre-exercise, every 30 min (min) of exercise, and during recovery was measured with microdialysis. Non-esterified fatty acids, insulin, insulin-like growth factor, epinephrine and norepinephrine, and cortisol were measured in blood. Resting energy expenditure (REE) was measured pre- and post-exercise and exercising metabolic heat production (MHP) was collected during 30 and 90 min of the HTT. Despite no sex differences in systemic blood biomarkers, fat oxidation (g × min<sup>-1</sup>) was higher in males (M) (vs. Females (F)) at 30 min of HTT (3.92 ± 0.25 (M), 3.58 ± 0.38 (F), p = 0.021). SCAAT interstitial glycerol was similar across all time points between sexes (baseline glycerol ranges (mmol × L<sup>-1</sup>): 104.6-1260.0 (F), 165.0-775.6 (M)); however, females had a greater O:I ratio at 90 min of exercise (vs. M) (0.69 ± 0.33 (F); 0.44 ± 0.20 (M); p = 0.033). Pre- and post-exercise REE were 23% (MD: 447.5 kcal × day<sup>-1</sup>, p < 0.001) and 25% (MD: 485 kcal × day<sup>-1</sup>, p < 0.001) lower in females compared to males. Post-exercise RER (0.67 ± 0.06 (F); 0.72 ± 0.08 (M); p = 0.045) and mean MHP was higher in males (MD: 94W). Fat oxidation was higher in males compared to females at 30 min with no changes in SCAAT lipolysis or blood biomarkers before or after an acute bout of exercise-heat stress.

Also flagged:Hepatocellular CarcinomaNAFLDmetabolismnon‐alcoholic fatty liver diseasehepatic steatosisliver cancer
Journal Article 2026-05-01 No Snippets Jeon EH, Bae AN, Lee H, Park KU, Shin HM, Park JH, Kim KS, Park IC, Lee YH.
Show Full Abstract

We have previously defined the constitutive photomorphogenic protein 1 (COP1) gene as a therapeutic target in hepatocellular carcinoma (HCC). A recent study demonstrated that COP1 induces non-alcoholic fatty liver disease (NAFLD), a precursor to HCC, in normal hepatocytes and that reducing COP1 expression significantly improves high-fat diet-induced hepatic steatosis. Thus, in this study, we investigated if the function of COP1 was associated with HCC metabolism and evolution. Silencing of COP1 expression by a target siRNA significantly suppressed long-term colony formation in Huh7, HepG2, Huh1, and PLC/PRF/5 HCC cell lines. RNA sequencing of COP1-silenced Huh7 and HepG2 cells revealed the same directional regulation of 24 (14 up- and 10 down-regulated) genes. Notable molecular alterations were upregulation of AKR1D1 and downregulation of TMEM65, which involves negative regulation of lipid metabolism and promotion of metastasis, respectively. Correlation analysis using GEPIA2 supported inverse relationship between COP1 and AKR1D1 expression and positive relationship between COP1 and TMEM65 expression in HCC clinical samples. Targeting of COP1 reduced fat accumulation and metastatic potential in both HCC parental cells and CD133<sup>+</sup> liver cancer stem cells. Overexpression of COP1 reversed the phenotypic changes. Collectively, our findings indicate that the COP1 is functionally correlated with HCC lipid metabolism and stemness.

HTT
Also flagged:mitochondrialHuntington's diseaseHDneurodegenerative disordermitochondria
Journal Article 2026-05-01 ✓ 1 Snippet D'Egidio F, Putthanbut N, Starahs M, Lee JY, Borlongan CV.
In-Text Gene Mentions

…expansion in theHTTgene, producing a…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by cytosine-adenine-guanine (CAG) triplet expansion in the HTT gene, producing a mutant Huntingtin protein that impairs mitochondrial dynamics by reducing fusion and increasing fission. Mesenchymal stem cells (MSCs) have shown potential therapeutic effects by sharing functional mitochondria and other secretomes. In this study, quinolinic acid-lesioned neuro-2a (QA-N2a) cells and glutamatergic neurons with 50 CAG repeats (HD neurons) were co-cultured with human umbilical cord-derived MSCs for 5 hours. For QA-N2a cells, immunocytochemistry (ICC) was performed to demonstrate the change in GABA and Substance P before and after co-culture. For HD neurons, ICC was conducted to identify mitochondrial proteins, while Western blot was employed to evaluate proteins related to inflammation and mitochondrial function. As a result, co-culture with MSC significantly restored the expression of GABA and Substance P, which diminished after QA exposure. In HD neurons co-cultured with MSCs, an increase in mitochondrial abundance was observed, with significantly higher intensity and dendritic distribution of mitochondria compared to control cells. Western blot analysis confirmed this increase and showed a rising trend in ATP5a levels. MSCs also promoted mitochondrial fusion, indicated by higher levels of Mitofusin 2 (MFN2) and Mitochondrial Dynamin Like GTPase (OPA1), and a trend of reduction in the fission marker Dynamin-Related Protein (DRP1). Additionally, the co-culture led to a decreased trend in neuroinflammation markers IL-6, TNF-α, MMP9, and p-NFkB. Collectively, this study demonstrates that MSCs alleviate HD pathology by restoring the mitochondria activity and potentially suppressing inflammation in two different HD in vitro models.

HFE
Also flagged:Hyperferritinemiametabolismliver diseaseserythropoiesisCPhereditary hemochromatosis
Journal Article 2026-05-01 ✓ 5 Snippets Morel P, Silva Rodriguez M, Benmouffek C, Goksen B, Chéry C, Haghnejad V, Bensenane M, Feillet F, Guéant JL, Namour F, Bronowicki JP, Oussalah A.
In-Text Gene Mentions

…testing for rarehemochromatosisgenes, yet no…

…Patients with knownHFEp.Cys282Tyr homozygosity were…

HFEwas the most…

…after exclusion ofHFEp.Cys282Tyr homozygosity.…

…genetic etiologies beyondHFE‐related hemochromatosis.…

Show Full Abstract

<h4>Background and aims</h4>Hyperferritinemia encompasses heterogeneous genetic etiologies beyond HFE-related hemochromatosis. Current guidelines recommend testing for rare hemochromatosis genes, yet no consensus exists on comprehensive genomic approaches. We aimed to characterise the genetic landscape of unexplained hyperferritinemia using clinical exome sequencing (CES) and evaluate genotype-phenotype correlations across functional pathways.<h4>Methods</h4>In this retrospective study (2019-2024), consecutive patients with unexplained hyperferritinemia after exclusion of secondary causes underwent CES. Patients with known HFE p.Cys282Tyr homozygosity were not referred for CES. Variant filtering was performed using the Genomics England panel for iron metabolism and the French network for rare liver diseases panel, combined with phenotype-driven analysis based on Human Phenotype Ontology annotations for iron-related phenotypes. Genes were categorised into four pathways: systemic iron sensing, iron transport and storage, hepatic metabolism and erythropoiesis.<h4>Results</h4>Among 108 patients, CES identified at least one variant in 72 (66.7%), including 44 (40.7%) with likely pathogenic or pathogenic (LP/P) variants. HFE was the most frequently affected gene, followed by SERPINA1, ATP7B, and CP. Among patients without monogenic HFE alterations (n = 57), 21 (36.8%) carried variants, mainly affecting CP, ATP7B, SERPINA1 or GBA. Digenic or oligogenic inheritance was observed in 30.6% (22/72) of patients overall and in 20.5% (9/44) of those carrying LP/P variants, most frequently involving HFE-SERPINA1 and HFE-ATP7B combinations. Cross-pathway combinations occurred in 17 of 22 digenic patients (77.3%). The systemic iron sensing group exhibited significantly higher serum iron (p = 0.009) and transferrin saturation (p = 0.008).<h4>Conclusions</h4>CES reveals genetic heterogeneity beyond the traditional Mendelian framework, with frequent non-HFE gene involvement and digenic inheritance and should be considered after exclusion of HFE p.Cys282Tyr homozygosity.

UNC13C
Also flagged:mitochondrialphosphorylationsecretiontype 2 diabetescell proliferationendoplasmic reticulum
Journal Article 2026-05-01 ✓ 1 Snippet Perez KC, Alexander J, Rahman MM, Alsharif H, Liu Y, Kim JA, Hunter CS, Nguyen T, Bhatnagar S.
In-Text Gene Mentions

…, Stxbp5 ,Unc13c, and Rims2…

Show Full Abstract

The transition from a proliferative to a functionally mature state is a critical phase in postnatal pancreatic β-cell development, yet the molecular mechanisms coordinating this shift remain poorly understood. Here, we identify tomosyn-2 as a key regulator that restrains β-cell maturation and insulin secretory capacity. Tomosyn-2 expression progressively declines in mouse islets with age, coinciding with enhanced biphasic glucose-stimulated insulin secretion and reduced β-cell proliferation. Mice lacking tomosyn-2 exhibit improved glucose clearance, elevated plasma insulin levels, and enhanced insulin secretion from isolated islets without changes in insulin action. Mechanistically, tomosyn-2 interacts with syntaxin-1A to inhibit insulin granule exocytosis by limiting SNARE complex assembly. Transcriptomic and network analyses reveal that loss of tomosyn-2 is associated with coordinated changes in insulin secretion and cell-cycle regulation, reducing β-cell proliferation and mass expansion by downregulating Akt1 signaling and cell-cycle mediators, while promoting β-cell identity and functional maturation accompanied by altered islet cytoarchitecture. These findings identify tomosyn-2 as a molecular brake that balances proliferation and insulin secretion to achieve a threshold of functionally mature β-cell mass during postnatal development. Targeting tomosyn-2 or its downstream pathways may enhance β-cell functional competence and offer new strategies to restore insulin secretion in diabetes.<h4>Article highlights</h4>The mechanisms governing the postnatal transition of pancreatic β-cells from a proliferative, immature state to a functionally mature, glucose-responsive state remain poorly understood. We investigate the role of tomosyn-2 in modulating β-cell proliferation and insulin secretion during postnatal maturation. Tomosyn-2 inhibits SNARE complex formation and insulin secretion, and its loss is associated with enhanced β-cell maturation, increased biphasic insulin secretion, reduced β-cell proliferation, and suppressed Akt1-cyclinD1 signaling. Tomosyn-2 functions as a physiological brake on insulin secretion, coordinating the balance between β-cell maturation and proliferation, with implications for diabetes pathogenesis and β-cell regenerative strategies.

Also flagged:AtherosclerosisASCVDagingantigen presentationAtherosclerotic cardiovascular diseasesecretion
Journal Article 2026-05-01 No Snippets Lems S, Mazzei MG, Foks AC, McNamara CA.
Show Full Abstract

Atherosclerotic cardiovascular disease (ASCVD) is increasingly recognized not just as a lipid-driven disease, but as a complex interplay between vascular cells and the immune system. Accumulating evidence highlights a central, yet heterogeneous role for B cells in atherogenesis, with distinct subsets displaying opposing roles. In this review, we provide an in-depth overview of the contributions of B cell subsets to ASCVD, including emerging insights into the roles and pathways of atheroprotective innate B cells producing IgM against oxidation-specific epitopes (IgM<sup>OSE</sup>) and newly appreciated age-associated B cells (ABCs), a distinct subset that accumulates with aging and potentially exacerbates atherosclerosis. By integrating insights from preclinical models and human studies, we describe the mechanisms through which B cell subsets influence ASCVD, including antigen presentation and immune checkpoint-mediated communication, secretion of cytokines and chemokines, and we highlight that humoral immunity in atherosclerosis reflects a context-dependent interplay between antibody effector properties and antigenic targets rather than antibody class alone. Finally, we explore how the advances in our understanding of B cells may guide the development of more targeted immunomodulatory therapies that enhance atheroprotective B cell functions while limiting atherogenic responses.

SOX6
Also flagged:Colorectal Cancercancerprimary tumortumorcolon cancerRCC
Journal Article 2026-05-01 ✓ 5 Snippets Taniguchi A, Kagawa S, Nogi S, Yagi T, Kanaya N, Kuroda S, Kikuchi S, Kakiuchi Y, Tazawa H, Fujiwara T.
In-Text Gene Mentions

…as well asSOX6+Fib and ADAMDEC1+Fib (Figure…

…results showed thatSOX6+ Fibs were enriched…

…detected primarily inSOX6+ Fibs and iCAFs…

SOX6+ Fibs and iCAFs…

…y EGFR‐expressing non‐myCAFs (SOX6+ Fibs and iCAFs).…

Show Full Abstract

Sidedness influences colorectal cancer (CRC) prognosis and treatment response, yet the mechanism dictating differential EGFR inhibitor (EGFRI) sensitivity is unclear. This study investigated the tumor microenvironment (TME) in relation to EGFRI eligibility-clinically defined by factors such as tumor sidedness (e.g., left-sided), RAS/BRAF wild-type status, and microsatellite stability (MSS)-using integrated single-cell RNA sequencing (scRNA-seq), with bulk RNA-seq and spatial transcriptomics validation. We found cancer cell features reflected EGFRI eligibility more strongly than sidedness. EGFRI eligible tumors exhibited high Epiregulin (EREG) expression by cancer cells. Cell interaction analysis revealed a specific "EREG/EGFR/CSF axis" in EGFRI eligible CRC: EREG derived from cancer cell stimulates EGFR-expressing non-myCAF subtypes of cancer-associated fibroblasts (CAFs), which signal via CSF to M1/M2-like Tumor-Associated Macrophages/Monocytes (TAM/TAMo), potentially promoting M2 polarization. Spatial analysis confirmed the proximity of these interacting cell populations and localized EGFR pathway activation near cancer cells specifically in eligible tumors. This study provides a TME-centric view of EGFRI eligibility, identifying a key intercellular communication network driving differential responses. These findings suggest TME features could offer more precise patient stratification than sidedness alone, potentially improving CRC therapeutic strategies.

LRRC7SUDS3
Also flagged:Chromatidnucleosomechromosomeschromatinorganizationchromatosome
Journal Article 2026-05-01 ✓ 2 Snippets Shintomi K, Ohsumi K, Iwabuchi M, Hirano T.
In-Text Gene Mentions

Condensinsplay central roles…

…we focused onlinker histoneshistones as an…

Show Full Abstract

Mitotic chromosomes, consisting of a pair of rod-shaped chromatids, emerge from a dramatic reorganization of nucleosome fibers. However, the mechanisms by which local chromatin organization influences large-scale mitotic chromatid architecture remain poorly understood. Here, we report a modified cell-free assay in which erythrocyte nuclei, instead of conventionally used sperm nuclei, are incubated in Xenopus mitotic egg extracts. This modification enables mitotic chromatids to assemble from substrates containing regularly spaced, dense nucleosome arrays, allowing chromatid formation to be experimentally separated from nucleosome assembly. In this system, depletion of the linker histone H1.8 results in thinner chromatids with enhanced individualization, whereas excess H1.8 loading promotes chromatid clustering through its C-terminal tail. Chromatid clustering is also observed upon depletion of the histone chaperone Nap1 or the chromatin remodeler ISWI, whose roles have been underappreciated in conventional assays. Together, our findings demonstrate that histone density and dynamics cooperate with condensins and topoisomerase IIα to shape mitotic chromatid architecture.

PLCL1
Also flagged:organizationmitochondrialDravet Syndromedevelopmental epileptic encephalopathymyoclonic epilepsyinfancy
Journal Article 2026-05-01 ✓ 1 Snippet Martins M, Nugue G, Aguiar A, Souza LRQ, Abrantes PV, Trajano JR, Stelling M, Junqueira M, Rehen S, Guimarães MZP.
In-Text Gene Mentions

…the GABAergic synapse,PLCL1showed higher relative…

Show Full Abstract

Dravet syndrome (DS) is a rare and severe childhood-onset developmental epileptic encephalopathy caused primarily by mutations in the sodium channel gene SCN1A. Animal models have undeniably advanced our understanding of DS, but they still do not fully capture its clinical heterogeneity, highlighting the need for complementary human in vitro systems. Here, we generated induced pluripotent stem cells (iPSCs) from urine epithelial cells of three DS patients carrying distinct SCN1A variants and differentiated them into neural stem cells (NSCs) and early-stage neurospheres. Clinical severity was assessed using the DANCE checklist, and molecular phenotypes were characterized through isobaric quantitative proteomics. Comparative analyses identified differences in protein abundance across patient-derived lines, with distinct molecular patterns associated with clinical severity measures. The patient-derived lines exhibited variability in protein groups related to synaptic organization, mitochondrial processes, and RNA processing, reflecting interindividual molecular differences within the cohort. These findings establish patient-derived neurospheres as a scalable human model for investigating molecular variability in DS. This approach provides a framework to explore disease heterogeneity and provides a foundation for future studies linking molecular profiles to clinical variability in DS.

BTN2A1
Also flagged:Prostate cancerPCacancerdeathprostatic intraepithelial neoplasialactylation
Journal Article 2026-05-01 ✓ 1 Snippet Takashima Y, Tanaka M, Yoshii K, Yagi T, Miyagawa-Hayashino A, Tashiro K.
In-Text Gene Mentions

…while TCAL1, LTBP3,BTN2A1, AMOTL2, and ADA…

Show Full Abstract

<h4>Background/aim</h4>Prostate cancer (PCa) is a leading malignancy in men, and understanding its molecular mechanisms is crucial for advancing therapeutic strategies. Ubiquitination, a key post-translational modification, regulates protein degradation and signaling, playing a vital role in cancer progression. This study focuses on HECTD4, a HECT-type E3 ubiquitin ligase, to identify its ubiquitination targets and understand its role in PCa.<h4>Materials and methods</h4>HECTD4 knockdown was performed in LNCaP, PC-3, and DU145 PCa cell lines. A combination of semi-quantitative PCR and liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to identify proteins with altered expression and ubiquitination profiles. Gene ontology analysis, pathway analysis, and a proliferation assay were conducted to explore the biological significance of HECTD4.<h4>Results</h4>We identified 1,605 downregulated and 1,736 upregulated proteins upon HECTD4 knockdown. Key proteins involved in tumor suppression and cell cycle regulation, such as NUSAP1, CDK6, and MED13L, were ubiquitinated by HECTD4. Functional annotations revealed that these targets are associated with critical pathways, including phosphoinositide 3-kinase (PI3K)-AKT, Ras-mitogen-activated protein kinase (MAPK), and mammalian target of rapamycin (mTOR), as well as immune infiltration, drug response, and survival analysis.<h4>Conclusion</h4>HECTD4 regulates protein stability and activation through ubiquitination, impacting cell cycle progression, tumor suppression, and immune response in PCa. These findings suggest that HECTD4 is a promising therapeutic target, with potential applications in drug development aimed at disrupting oncogenic signaling and enhancing treatment efficacy.

HTT
Also flagged:Huntington's disease
Journal Article 2026-05-01 ✓ 1 Snippet Lee L, Richards AL, Anand P, Beers B, Golden L, Kong R.
In-Text Gene Mentions

…bioavailable, small moleculeHTTgene splicing modifier…

Show Full Abstract

Votoplam is a novel, orally bioavailable, small molecule HTT gene splicing modifier that is being developed for the treatment of Huntington's disease. A single-dose, open-label, three-dose level (5, 10, 20 mg), parallel group ethnicity study was conducted to evaluate the pharmacokinetics and safety of votoplam in healthy Caucasian versus Japanese participants. Six participants per ethnic group were enrolled at each dose (12 participants per dose level overall). Thirty-five participants (N = 18 Japanese; N = 17 Caucasian) completed the study. Study results showed slightly higher exposure for Japanese participants at all dose levels. AUC<sub>0-last</sub> increased by 1.27-, 1.17-, and 1.29-fold, and C<sub>max</sub> increased by 1.58-, 1.19-, and 1.61-fold for 5, 10, and 20 mg, respectively, for Japanese compared with Caucasian participants. Doses proportionality was observed for both ethnicities. Few mild and moderate TEAEs were reported and were comparable between Japanese and Caucasian participants. In summary, votoplam pharmacokinetics and safety profiles are similar between healthy Japanese and Caucasian participants when administered in the single dose range of 5, 10, and 20 mg. Therefore, it is expected that dose adjustments should not be necessary in future clinical studies enrolling Japanese participants.

Also flagged:aldehydeflavonoidavicularinquercetinmineralwax
Journal Article 2026-05-01 No Snippets Martínez-Flores S, Martínez-Villarreal MG, Domínguez-Martínez F, Lozano-González M, Rivero-Cruz I, Flores-Bocanegra L, Del Valle-Pérez P, Macías-Rubalcava M, Bye R, Linares E, Aparicio-Trejo OE, Mata R.
Show Full Abstract

An integrative phytochemical investigation of Porophyllum linaria was conducted in comparison with Porophyllum macrocephalum, combining structural elucidation, volatilome profiling, analytical method development, bioactivity, and nutritional assessment. Chromatographic fractionation of a MeOH-CH<sub>2</sub>Cl<sub>2</sub> (1:1) extract of P. linaria afforded two undescribed long-chain cyclopropyl alcohol waxes, identified as cis-8,9-methylenuntriacontan-5-ol and cis-7,8-methylenuntriacontan-5-ol, whose structures were established by extensive spectroscopic analysis (1D and 2D NMR, HRESIMS) and chemical derivatization. Volatile constituents of both species were characterized, revealing interspecific differences. P. linaria essential oil was dominated by β-myrcene, d-limonene, nonanal, decanal, and (E)-2-dodecenal, whereas P. macrocephalum showed a limonene-rich profile with lower aldehyde content. LC-ESI-MS analysis of infusion extracts demonstrated distinct flavonoid patterns, with avicularin as the major marker of P. linaria and quercetin derivatives predominant in P. macrocephalum. Two validated UHPLC-MS methods were developed for the quantification of avicularin and quercetin in the respective species. Aqueous extracts exhibited antihyperglycemic and radical-scavenging activities. Nutrient analysis revealed their high fiber and mineral content. This study expands the chemical diversity of the genus Porophyllum, reports new cyclopropane-derived wax constituents, and provides analytical markers to support species differentiation and quality control. Chemical diversity of plant wax constituents contributes novel structural motifs to the genus Porophyllum.

SERPINC1
Also flagged:coagulationplatelet aggregationcardiopulmonary disordersmyocardial infarctionMIpulmonary embolism
Journal Article 2026-05-01 ✓ 1 Snippet Khalid W, Khan AU.
In-Text Gene Mentions

…piroxicam with (a)antithrombin-III(AT-III) receptor, (b)…

Show Full Abstract

<h4>Background</h4>Recent research indicates that non-steroidal anti-inflammatory drugs may interfere in coagulation process and platelet aggregation. However, the potential of piroxicam in thrombotic and cardiopulmonary disorders remained unexplored.<h4>Objectives</h4>To bridge this knowledge gap, the current study was conducted to assess the potential of piroxicam as antithrombotic and cardiopulmonary protective agent using multi-level approaches.<h4>Materials and methods</h4>Piroxicam was docked against 16 key proteins involved in thrombotic and cardiopulmonary conditions. Its antiplatelet effect was evaluated by arachidonic acid (AA) and adenosine diphosphate (ADP)-induced aggregation while its effect on coagulation parameters were also evaluated. Cardiopulmonary protective effect in rats was investigated through isoproterenol induced myocardial infarction (MI) and self-embolus induced pulmonary embolism (PE).<h4>Results</h4>Strong binding interactions were identified, with docking energies of ≥-9.0 kcal/mol noted for cyclooxygenase (COX) 1, glycopotein-IIb/IIIa, antithrombin-III, COX-2, and nuclear factor Kappa-B (NFkB). Piroxicam significantly inhibited AA and ADP-induced platelet aggregation (IC50: 0.68 and 24.9 μM) and also prolonged the prothrombin, activated partial thromboplastin, thrombin, and clot lysis time. Piroxicam markedly and in a dose-related manner lowered MI and PE associated serum markers in experimental rats. Piroxicam further safeguarded cardiac and pulmonary tissues from infarction and histopathological injury through the suppression of oxidative imbalance and inflammatory activity. This protective outcome was also due to reduced expression of tissue necrosis factor-α, NFkB, COX-2, NLRP3, and platelet-derived growth factor-β, verified using immunohistochemistry, enzyme-linked immunosorbent assay, and real-time polymerase chain reaction RT-PCR techniques.<h4>Conclusions</h4>These results indicate the prophylactic potential of piroxicam in cardiopulmonary thrombotic disorders.

SOX6
Also flagged:neurodevelopmental disorderschromatincell proliferationintellectual disabilitydevelopmental delayautism
Journal Article 2026-05-01 ✓ 1 Snippet Sun J, Noss S, Smolen C, Bhavana VH, Banerjee D, Das M, Giardine B, Prabhu A, Amor DJ, Pope K, Lockhart PJ, Girirajan S.
In-Text Gene Mentions

…as NRXN3 ,SOX6, and DPP10…

Show Full Abstract

Disease-associated variants can lead to variable phenotypic outcomes in neurodevelopmental disorders, but the biological mechanisms underlying this variability remain poorly understood. Here, we develop a framework to investigate this phenomenon using the 16p12.1 deletion as a paradigm of variable expressivity. Using induced pluripotent stem cell models from affected families and CRISPR-edited lines with the 16p12.1 deletion, we find that the deletion and rare variants in the genetic background jointly influence chromatin accessibility and expression of neurodevelopmental genes. Cellular analyses identify family-specific phenotypes, including altered inhibitory neuron production and neural progenitor cell proliferation, which correlate with head-size variation. CRISPR activation of individual 16p12.1 genes variably rescue these defects by modulating key developmental signaling pathways. Integrative analyses further identify regulatory hubs, including transcription factors FOXG1 and JUN, as mediators of these effects. Our study provides a functional framework for investigating how individual genetic architectures contribute to phenotypic variability in neurodevelopmental disorders.

OLFM4
Also flagged:Inflammatory bowel diseaseintestinal infectiondifferentiationcolitisbindingphosphorylation
Journal Article 2026-05-01 ✓ 5 Snippets Li H, Ding X, Fabec S, Bakheet A, Gao W, Song M, Liu R, Han X.
In-Text Gene Mentions

…, Ascl ,Olfm4and Lyz1 )…

…Atoh1, Lyz1 andOlfm4expression as well…

…Lgr5 + orOlfm4+ ISCs differently…

…of Lgr5 intoOlfm4ISCs that can…

…Lgr5 while increasingOlfm4expression in enteroids.…

Show Full Abstract

How intestinal stem cells (ISCs) are regulated during inflammation remains largely unexplored, leading to a lack of effective treatments for inflammatory bowel diseases (IBD). ISC-mediated intestinal epithelial regenerative repair can be regulated by intra-epithelial T lymphocytes, whose maturation is controlled by STAT5 dimeric or tetrameric activation. However, the mechanisms by which the T lymphocytes can protect ISCs are unclear. Here we hypothesize that tetrameric STAT5 regulates intra-crypt T cells to act as niche cells for ISC regeneration. Using IBD biospecimens, STAT5-hyperactive, tetramer-deficient mice and organoids, we found IBD-ulcerative colitis exhibited more crypt TCRγδ<sup>+</sup>STAT5<sup>+</sup> T cells and less ISC pluripotency than healthy patients. Compared with wild-type mice, depleting tetrameric STAT5 in mice significantly increased ISC-mediated intestinal epithelial hyperplasia, TCR gene signatures, crypt TCRγδ<sup>+</sup> T cells with elevated STAT5 tyrosine phosphorylation (pYSTAT5) and IL-17A levels, amplified both Lgr5<sup>hi</sup> and Lgr5<sup>low</sup> ISC proliferation and promoted de novo crypt regeneration with increased TCRγδ<sup>+</sup> cell influx post irradiation or colitis. By contrast, depleting tetrameric STAT5 in organoids reduced ISC pluripotency and organoid growth post irradiation. Mechanistically, chromatin immunoprecipitation and single-cell RNA sequencing analyses with crypt cells revealed that depleting STAT5 tetramers decreased STAT5-binding on the Metallothionein 1 (Mt1) locus in crypt T cells and increased Mt1 expression, which leads to T cell migration into crypts and enhanced ISC regeneration. Together, the tetrameric STAT5 suppresses the formation of the crypt T cell niche. Interrupting STAT5 tetramers promotes the expansion of crypt TCRγδ cells, providing a target for promoting ISC regenerative repair during IBD-ulcerative colitis.

PRDX6
Also flagged:degradationautotoxicityseed germinationrootmetabolismgene expression
Journal Article 2026-05-01 ✓ 1 Snippet Zhou T, Wang G, Li X, Chen C, Huang X.
In-Text Gene Mentions

…, K22395 ,PRDX6, UGT72E ,…

Show Full Abstract

<h4>Background</h4>Panax ginseng faces continuous cropping obstacles due to autotoxicity from protopanaxadiol-type ginsenosides. Despite studies on individual ginsenosides being reported, the integrated impact of these compounds across different growth stages requires further investigation.<h4>Methods</h4>We employed multi-omics approaches to elucidate stage-specific molecular mechanisms in ginseng under protopanaxadiol-type ginsenosides stress. Plants were treated with varying concentrations (10-150 mg/L) of protopanaxadiol-type ginsenosides across four growth stages, followed by integrated transcriptomics, extensively targeted metabolomics, and phytohormone-targeted metabolomics analyses with morphological and physiological assessments.<h4>Results</h4>Ginseng plants treated with 100 mg/L protopanaxadiol-type ginsenosides showed stage-specific stress responses. Transcriptomics analysis revealed over 20,000 differentially expressed genes across developmental stages (P < 0.05). Significant alterations were observed in pathways related to flavonoids biosynthesis, leading to the identification of 31 key differentially abundant metabolites and 22 critical enzyme genes. Furthermore, 47 differentially expressed genes involved in zeatin biosynthesis and phytohormone signal transduction pathways were identified, potentially regulating the differential accumulation of 8 phytohormones (abscisic acid, jasmonic acid, jasmonoyl-L-isoleucine, salicylic acid, and cytokinins). These molecular responses were putatively associated with enhanced resistance and adaptation to protopanaxadiol-type ginsenosides component stress in ginseng plants. WGCNA identified co-expression modules associated with flavonoid metabolites and phytohormones, providing network-level support for the coordinated regulation between these pathways. Strong correlations were observed between differentially expressed genes and differentially abundant metabolites, suggesting stage-dependent coordinated regulatory networks.<h4>Conclusion</h4>Protopanaxadiol-type ginsenosides triggered stage-specific regulatory networks in ginseng, especially during the flowering period stage. Parallel activation of flavonoid biosynthesis and phytohormone signaling pathways contributed to the adaptive response to autotoxicity. These findings provided preliminary insights for solving continuous cropping obstacle of ginseng and provided a research strategy for investigating stress response mechanisms of plants.

SUDS3
Also flagged:chronic inflammatory airway disorderallergic asthmaAAAsthmachronic inflammatory diseasegene expression
Journal Article 2026-05-01 ✓ 1 Snippet Liu W, Xu S, He Q.
In-Text Gene Mentions

…(LRIG1), LOC401357, andG protein regulated inducer of neurite outgrowth 3protein regulated inducer…

Show Full Abstract

<h4>Background</h4>Allergic asthma (AA) is a heterogeneous chronic inflammatory airway disorder. In this study, we performed a retrospective bioinformatics analysis based on public transcriptome datasets to identify critical genes associated with immune cell infiltration in AA and to establish a novel predictive model.<h4>Methods</h4>Two transcriptome datasets (GSE73482 and GSE40889) were analyzed to explore key genes implicated in AA. Functional enrichment analyses, including Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses, were performed using Metascape. Least absolute shrinkage and selection operator regression was applied to screen feature genes and construct a diagnostic prediction model. Weighted gene co-expression network analysis (WGCNA) was conducted to identify AA-related gene modules. The fractions of infiltrating immune cells were estimated using single-sample gene set enrichment analysis (ssGSEA). Gene set variation analysis and gene set enrichment analysis (GSEA) were performed to explore the biological functions and related signaling pathways of the key genes. The Cistrome Data Browser database was used to predict transcription factors that potentially regulate these key genes.<h4>Results</h4>We identified 4 highly significant genes in the brown module: membrane associated O acetyltransferase 1 (MBOAT1), leucine rich repeats and immunoglobulin-like domains 1 (LRIG1), LOC401357, and G protein regulated inducer of neurite outgrowth 3 (GPRIN3). GSEA results revealed that these key genes were significantly enriched in multiple immune-related signaling pathways. To further explore the regulatory network of these genes, transcription factors were predicted using the Cistrome Data Browser database, and the regulatory network was visualized using Cytoscape software.<h4>Conclusion</h4>MBOAT1, LRIG1, LOC401357, and GPRIN3 are candidate AA-associated genes identified through retrospective modeling. The identification of these genes offers potential opportunities to utilize them as biomarkers and targets for immunotherapy in AA.

Also flagged:nuclear specklesphosphorylationdegradationproteasomeautophagosomebinding
Journal Article 2026-05-01 No Snippets Crotti S, Secco V, Morini M, Carra S.
Show Full Abstract

Proteins comprise well-ordered structural domains and intrinsically disordered regions that explore broad conformational ensembles, a pervasive feature of the human proteome that underlies key aspects of cellular physiology. In the crowded intracellular environment, stress can shift protein conformational equilibria toward aggregation-prone states, exposing hydrophobic regions that can drive aberrant protein-protein interactions, promoting aggregation. To maintain proteome integrity, cells depend on an integrated protein‑quality‑control network in which molecular chaperones, their co‑factors and dedicated degradation systems act in concert. Within this network, small heat shock proteins serve as an ATP-independent first line of defense that stabilizes non-native proteins and limits irreversible aggregation. Recent work shows that small heat shock proteins can also safeguard the liquid‑like dynamics of biomolecular condensates formed by liquid-liquid phase separation. These membraneless compartments organize cellular biochemistry but are susceptible to stress- and disease-induced arrest or aggregation. Rather than undergoing phase separation autonomously, small heat shock proteins can be recruited into pre-existing condensates such as stress granules, nuclear speckles, p62 bodies, and condensates formed by disease-associated proteins, where they help preserve condensate fluidity. Together, these findings position small heat shock proteins as modulators of condensate dynamics that link protein quality control to mesoscale cellular organization, with important implications for cell biology, aging, and human disease.

Also flagged:genetic diseasesgenetic disordersneurofibromatosis (type 1spinal muscular atrophyphenylketonuriaepisodic kinesigenic dyskinesia type 1
Journal Article 2026-05-01 No Snippets Koyutourk B, Ergoren MC.
Show Full Abstract

Minor or genetically isolated populations like Turkish-Cypriots (TC) are usually challenging to diagnose and treat for uncommon genetic diseases. TC may exhibit several patterns of unusual genetic disorders based on their unique historical and demographic conditions. The objective of the current study is to identify and investigate the rarest genetic disorders in TC patients. Therefore, between 2019 and 2025, clinical and genetic data, which were confirmed by gene panels and exome sequencing, from 150 TC patients were retrospectively analysed in our clinic. Also, inheritance models and variant types were classified and contrasted. Out of 150 patients, 123 different rare diseases were discovered. Observed in 10 cases (6.7%), neurofibromatosis (type 1) was the most common of these, trailed by spinal muscular atrophy in 6 cases (4%), phenylketonuria in 6 cases (4%), and episodic kinesigenic dyskinesia type 1 in 4 cases (2.7%). Importantly, 114 of the discovered diseases (76%) were observed in only one patient, indicating a vast spectrum of ultrarare or single-case conditions within the group. Autosomal dominant was the most prevalent mode of inheritance; other types also present were autosomal recessive and mitochondrial inheritance. The recurrence of particular gene pathogenic variants in a group of patients may suggest a potential founder effect; however, further population-based haplotype studies are required to confirm this hypothesis within the TC population. The results demonstrate an overrepresentation of particular neurogenetic syndromes and underline the necessity of targeted screening procedures and population-dependent databases to maximise diagnostic yield and genetic counselling in this poorly characterised population.

HFE
Also flagged:Adrenal InsufficiencyCOVID-19Acute Kidney Injurydisease 2019hyperkalemiachronic kidney disease
Journal Article 2026-05-01 ✓ 1 Snippet Yglesias Dimadi II, Hussain A, Joseph Raja BB.
In-Text Gene Mentions

…eg, hypophysitis, sarcoidosis,hemochromatosis), surgery, radiation therapy,…

Show Full Abstract

BACKGROUND The coronavirus disease 2019 (COVID-19) pandemic has elucidated various extrapulmonary manifestations of severe acute respiratory syndrome coronavirus 2, including endocrine complications that affect the hypothalamic-pituitary-adrenal axis. Efforts to diagnose adrenal insufficiency in critically ill patients are challenging due to overlapping symptoms such as hypotension and fatigue. This challenge is amplified in patients with renal comorbidities, among whom classic electrolyte derangements of adrenal insufficiency (eg, hyperkalemia) may be masked by acute kidney injury (AKI) and renal replacement therapy. CASE REPORT A 46-year-old man with chronic kidney disease and an ileostomy presented with fatigue, abdominal pain, high ileostomy output, and hypotension. Evaluation revealed COVID-19 with concomitant AKI, metabolic acidosis, and hyperkalemia. Initial management via hemodialysis and remdesivir corrected the acidosis and electrolyte abnormalities. However, after renal recovery and discontinuation of dialysis, the patient developed recurrent, refractory hypotension, hyperkalemia, and hypoglycemia, prompting assessment for adrenal dysfunction. Morning cortisol levels were critically low. A subsequent cosyntropin stimulation test showed a blunted cortisol response, confirming adrenal insufficiency. Hydrocortisone and fludrocortisone treatments resulted in hemodynamic stabilization and resolution of the electrolyte abnormalities. CONCLUSIONS This case highlights the "masking" effect of dialysis on the clinical presentation of adrenal insufficiency. Clinicians must maintain a high index of suspicion for adrenal insufficiency in patients with COVID-19 who display recurrent hypotension or hyperkalemia despite renal recovery. Furthermore, the presence of hyperkalemia in a patient with high ileostomy output is paradoxical and should prompt immediate evaluation for mineralocorticoid deficiency.

Also flagged:respiratory infectionscytoplasmicorganelleshost cellsimmune responsebronchiolitis
Journal Article 2026-05-01 No Snippets Basse V, Agarwal T, Sneideris T, Richard CA, Troussier J, Vasseur JJ, Debart F, Eléouët JF, de Csillery E, Knowles T, Galloux M.
Show Full Abstract

Respiratory syncytial virus (RSV) causes severe respiratory infections, with viral replication occurring in cytoplasmic membraneless viral factories formed by liquid-liquid phase separation (LLPS). The interactions among the RSV nucleoprotein N, phosphoprotein P, transcription factor M2-1, and RNA drive these condensates. Here, we used a microfluidic PhaseScan platform, together with biochemical and cellular assays, to systematically characterize LLPS involving RSV proteins and RNA. We identified optimal concentrations of oligomeric N and P tetramers for condensate formation in vitro without crowding agents, demonstrated that monomeric N inhibits LLPS and revealed that M2-1 enhances condensate formation by increasing multivalency. Notably, we found that M2-1 preferentially binds 5' capped RNA, distinguishing it from N, which binds uncapped RNA. These findings elucidate molecular determinants of RSV viral factory assembly and subcompartmentalization, providing insights into viral replication mechanisms and informing potential antiviral strategies targeting LLPS processes.

Also flagged:membraneboundmembranesorganellesextracellulartumor
Journal Article 2026-05-01 No Snippets Bi C, Schwermer F, Schäkel L, Mirza S, Baburi H, Riziki P, Schmies CC, Winzer R, Idris R, Rolshoven G, Schilling J, Luckenbach L, Pelletier J, Brusoni LS, Al Hroub H, Al Hamwi G, Lopez V, Ahmadsay A, Raulien L, Sylvester K, Sévigny J, Tolosa E, Guse AH, Müller CE.
Show Full Abstract

Ectonucleotidases catalyze the hydrolysis of extracellular nucleotides, maintaining the balance between proinflammatory ATP and immunosuppressive adenosine. In the present study, we developed potent competitive inhibitors of the main ATP-hydrolyzing ectoenzyme nucleoside triphosphate diphosphohydrolase-1 (NTPDase1, CD39) based on 8-butylthio-AMP as a lead structure. Altogether, 88 purine nucleotides and analogs with broad structural modifications were synthesized, 78 of which are new compounds. 8-Substitution of the purine scaffold with bulky residues is essential for high potency and confers metabolic stability. 8-(1-Naphthylthio)-<i>N</i><sup>6</sup>-(4-phenylbutyl)-AMP (<b>42b</b>, PSB-24379) is the most potent CD39 inhibitor of the series (<i>K</i><sub>i</sub> 77.4 nM), showing ancillary CD73 inhibition (<i>K</i><sub>i</sub> 240 nM). Docking into a human CD39 homology model rationalized key interactions. PSB-24379 reduced ATP hydrolysis in melanoma and breast cancer cell membranes and partially reverted ATP-mediated effects on T cell activation and proliferation in an ATP-rich environment. These CD39 inhibitors represent high-quality tool compounds with potential as drugs for immunotherapy of cancer.

DNAJC1
Also flagged:Fibrosarcomacancerdegradationdeathmitochondrialcell proliferation
Journal Article 2026-05-01 ✓ 1 Snippet Petrenko V, Vrublevskaya V, Skarga Y, Zhmurina M, Morenkov O.
In-Text Gene Mentions

DNAJC1

Show Full Abstract

<h4>Background</h4>Two isoforms of the 90-kDa heat shock protein (Hsp90), stress-inducible Hsp90α and constitutively expressed Hsp90β, function in mammalian cells as molecular chaperones that promote the folding of specific client proteins involved in essential cellular processes and regulatory pathways. A number of Hsp90 client proteins take part in cancer progression, and the inhibition of Hsp90 induces the degradation of oncogenic client proteins and cancer cell death. Hsp90 inhibitors specific for individual Hsp90 isoforms have a significant potential for the development of anticancer therapeutics due to reduced toxicity. Cells with knocked-out genes encoding Hsp90 isoforms represent excellent cellular models to investigate the rearrangement of the cell chaperone machinery in response to the suppression/loss of the Hsp90 isoforms.<h4>Results</h4>Recently, we have shown that the knockout of the HSP90AA1 gene encoding Hsp90α in human fibrosarcoma HT1080 cells does not affect basic cellular processes in normal and stressful conditions, which suggests an adaptation of the cell chaperone machinery to the loss of Hsp90α. Here, we demonstrated that the lack of Hsp90α in HT1080 cells leads to an up-regulation of the constitutively expressed Hsp90β and several important Hsp90 co-chaperones (Aha1, Hop, and others). The expression of the major chaperones of the Hsp70 machinery (Hsp70-1, Hsp70-2, Hsc70) was also significantly induced. The components of the prefoldin-chaperonin folding arm and PFDL, R2TP, and R2SP complexes, as well as the major mitochondrial chaperones, were also largely up-regulated in Hsp90α-KO cells, while the expression of ER-resident chaperones/co-chaperones was either repressed or did not change.<h4>Conclusions and significance</h4>We demonstrated here for the first time an adaptation of the cell chaperone machinery to the loss of the Hsp90α chaperone, which may be important for understanding the molecular mechanisms of action of Hsp90α-specific inhibitors and elaborating new therapy strategies in combating cancer, including the combination of Hsp90α-targeted therapy.

Also flagged:Movement Disordersparoxysmal dyskinesiaEDSdystoniaparoxysmal dyskinesiasand Epileptic Encephalopathies
Journal Article 2026-05-01 No Snippets Mohammad S, Ebrahimi-Fakhari D, Morales-Briceno H.
Show Full Abstract

<h4>Background</h4>Monogenic developmental and epileptic encephalopathies (DEE) frequently feature co-occurring movement disorders. Gene discovery has expanded epilepsy-dyskinesia syndromes (EDS) from classic associations such as stereotypies in Rett syndrome to PRRT2-related infantile seizures with paroxysmal dyskinesia and crouched gait in SCN1A-associated Dravet syndrome.<h4>Objectives</h4>To outline the movement disorders spectrum in EDS, propose a pragmatic syndrome-based clinical framework, group implicated genes into mechanistic categories, highlight selected genotype-phenotype correlations, and summarize symptomatic and precision therapeutic options.<h4>Methods</h4>A non-systematic, structured literature review identified monogenic disorders reported with EDS, grouping publications into four tiers: multi-etiology cohorts; small series and narrative/systematic reviews; single-gene or pathway-focused reports; and mechanistic/therapeutic studies.<h4>Results</h4>Eight cohort studies and multiple tier 2-3 series and reviews yielded 245 single-gene associations, most mapping to ion channel and synaptic signaling pathways. Across DEE cohorts, movement disorders occurred in roughly one-quarter to over one-half of patients, were often hyperkinetic (notably dystonia and stereotypies), and frequently combined multiple phenomenologies. We grouped clinical presentations into early and late infantile-onset EDS, Rett and Rett-like syndromes, paroxysmal/episodic and relapsing-remitting disorders, disorders with severe acute motor exacerbations, and hypokinetic/progressive phenotypes. Treatments are guided by gene- and mechanism-informed strategies including sodium-channel blockers, glutamatergic modulators, ketogenic diet, agents for paroxysmal dyskinesias, and deep brain stimulation in life-threatening crises.<h4>Conclusions</h4>Movement disorders are common, often severe, and genetically heterogeneous across EDS. A syndrome-based approach integrating clinical features, neuroimaging, and broad genetic testing (including copy number variants and repeat expansions) can guide symptomatic management and emerging precision therapies.

Also flagged:Cell Deathinterstitial lung diseasedeathfibroblasttissue remodelingautophagy
Journal Article 2026-05-01 No Snippets Pan X, Yang L, Zhao M, Zhou Y, Xia C, Liu H, Wang Y, Lian H, Li B, Wang L, Yu G.
Show Full Abstract

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive interstitial lung disease characterized by deregulated cell death programs that drive epithelial injury, fibroblast activation, and irreversible tissue remodeling. Multiple regulated cell death (RCD) modalities, including apoptosis, autophagy, necrosis, ferroptosis, pyroptosis, and cuproptosis, are implicated in IPF pathogenesis across epithelial cells, fibroblasts, macrophages, and endothelial cells. Apoptosis leads to alveolar epithelial cell loss and fibrosis initiation, whereas autophagy modulates fibroblast proliferation and extracellular matrix turnover. Necrosis amplifies inflammation; ferroptosis promotes epithelial dysfunction through lipid peroxidation; and pyroptosis activates the inflammasome pathway. Emerging evidence links cuproptosis, a copper-dependent death mode, to fibrotic remodeling. These pathways are interconnected: apoptosis and autophagy can shift within the same cell, and epithelial apoptosis may induce macrophage pyroptosis, amplifying the profibrotic cascade. Emerging evidence indicates that these RCD modalities are coordinated through shared stress signals and regulatory nodes. Therapeutically, targeting RCD offers promising opportunities, with Bcl-2 inhibitors for apoptosis, mTOR inhibitors for autophagy, iron chelators for ferroptosis, and early interventions for pyroptosis and cuproptosis. Targeting shared regulatory mechanisms or combining pathway-directed strategies may further enhance efficacy. By balancing cell death and survival, these strategies could attenuate inflammation, restrict fibroblast-driven scarring, and restore repair capacity. This review underscores the complexity and crosstalk of RCD in IPF, and proposes a conceptual framework for their coordinated regulation, highlighting its potential for therapeutic innovation.

DCC
Also flagged:multiple myelomamonoclonal gammopathy of undetermined significancetumorhematological malignancieschainsmyeloma
Journal Article 2026-05-01 ✓ 5 Snippets Garrido D, Ledesma M, Stella F, Galvano C, Lopresti S, Riva E, Fundia A, Slavutsky I.
In-Text Gene Mentions

…PTPRD, NOTCH4, SH3RF3,DCC, and CSMD1…

…( SH3RF3 rs76256617),DCC Netrin 1 ReceptorNetrin 1 Receptor…

…1 Receptor (DCCrs72920200), and CUB…

…PTPRD, NOTCH4, SH3RF3,DCC, and CSMD…

…TheDCCgene (18q21), encoding…

Show Full Abstract

<h4>Introduction</h4>Microarrays enable high-throughput detection of single-nucleotide variants, making them valuable tools in genetic research. The use of this technology in multiple myeloma, a genetically complex malignancy with highly variable outcomes, may facilitate the identification of novel prognostic biomarkers.<h4>Objective</h4>To identify single-nucleotide variants with prognostic value in newly diagnosed multiple myeloma and to evaluate the ability of microarray technology to distinguish multiple myeloma from monoclonal gammopathy of undetermined significance.<h4>Methods</h4>A total of 56 newly diagnosed multiple myeloma and 14 monoclonal gammopathy of undetermined significance patients were retrospectively analyzed using the Infinium Global Screening Array-24 v3.0. Binary discriminant and principal component analyses were employed to identify single-nucleotide variants associated with post-induction response. Kaplan-Meier curves and log-rank tests were used to evaluate overall survival and progression-free survival.<h4>Results</h4>A total of 692 single-nucleotide variants were associated with post-induction response, of which 42 (t-score >4) were the most discriminant. Variants in the PTPRD, NOTCH4, SH3RF3, DCC, and CSMD1 genes were linked to poorer treatment responses: carriers of alternative alleles showed higher partial remission rates (p-value = 0.005) and early relapse (p-value = 0.021). These patients also showed a reduced 5-year overall survival (p-value = 0.008) and shorter progression-free survival (p-value = 0.017). The current cohort exhibited higher minor allele frequencies for SH3RF3, PTPRD, and CSMD1 relative to broader Latin American datasets. Additionally, 13 single-nucleotide variants were multiple myeloma-specific and eight were specific for monoclonal gammopathy of undetermined significance.<h4>Conclusion</h4>Single-nucleotide variants of the PTPRD, NOTCH4, SH3RF3, DCC, and CSMD1 genes emerge as promising prognostic biomarkers in newly diagnosed multiple myeloma. Microarray-based single-nucleotide variants profiling shows potential for personalized risk stratification, warranting further validation and functional characterization.

OLFM4
Also flagged:aginggene expressionsecretionantigen presentationTcell activation
Journal Article 2026-05-01 ✓ 1 Snippet Wu F, Zhang M, Wu J, Wang Z, Ma Y, Dong L, Cheng L, Ji T, Zheng C, Ren F, Fang B.
In-Text Gene Mentions

…DEGs such asOlfm4, Ccr2 ,…

Show Full Abstract

Aging is associated with systemic immune remodeling and disease susceptibility, but its impact on intestinal mucosal immunity, particularly changes in M cells, remains largely unknown. This study aimed to investigate how aging alters intestinal mucosal immune phenotypes, specifically follicle-associated epithelial cells (FAE) and the gut microbiota, and to identify interconnected pathways that may be exploited to maintain intestinal immune function in the elderly. Using intestinal tissue from young and aged mice, this study assessed manifestations of intestinal epithelial aging, changes in immune cells in the lamina propria, and microbial composition. Aging was associated with increased expression of senescence-associated secretory phenotype (SASP) markers (IL-1β, TNF-α, p16) and decreased levels of tight junction proteins (Occludin, Tricellulin), suggesting epithelial barrier dysfunction. Aged mice exhibited decreased Naïve Th cells, increased Effector Th and Th17 subsets, and decreased fecal IgA. Microbiome analysis revealed enrichment of inflammatory bacteria, such as Desulfovibrio and Candidatus_Saccharimonas, and elevated dysbiosis indices. RNA sequencing of FAEs revealed 578 differentially expressed genes, including downregulation of Gp2 and Ccl28, indicating impaired M cell function. Association analysis between microbiome changes and mucosal immune aging revealed that enrichment of key inflammatory bacteria may contribute to impaired M cell function and dysregulated intestinal mucosal immunity. These findings reveal a multi-layered disruption of intestinal homeostasis during aging-comprising barrier function, immune imbalance, FAEs dysfunction, and shifts in specific microbial taxa -leading to increased susceptibility to pathogens. Targeting these age-related pathways may provide strategies for maintaining intestinal immunity in the elderly.

Also flagged:agingage‐related diseasesLate‐onset hypogonadismsexual dysfunctionbiosynthesisspermatogenesis
Journal Article 2026-05-01 No Snippets Wu H, Ning G, Jian M, Peng A, Wang H, Li B, Zhou X.
Show Full Abstract

In the context of global population aging, public health challenges due to aging are garnering significant attention. Late-onset hypogonadism (LOH) is a common age-related condition in men characterized by progressively decreasing serum testosterone levels with age, manifesting as sexual dysfunction, reduced physical vigor, and psychological or neurological abnormalities. Testosterone is synthesized primarily in testicular Leydig cells (LCs), and LC senescence during aging is key for suppressing testosterone production. This review systematically synthesizes the multidimensional molecular mechanisms underlying LC senescence. This process is driven primarily by oxidative stress (OS) and mitochondrial dysfunction and encompasses multiple interrelated layers, including epigenetic remodeling, the senescence-associated secretory phenotype (SASP), stem Leydig cell (SLC) niche degradation, and disruption of intrinsic circadian rhythms. Exogenous testosterone supplementation therapy (TST) remains the mainstay of the clinical management of LOH; however, its long-term use increasingly poses safety risks and is inherently limited to treating symptoms. Melatonin, a molecule with pleiotropic antiaging properties, including potent antioxidant effects and the ability to improve mitochondrial function, has the potential to synergistically antagonize the aforementioned multiple LC senescence pathways. By effectively mitigating LC aging and promoting endogenous testosterone synthesis, the use of melatonin could shift the treatment paradigm for LOH from "passive hormone supplementation" to "active cellular function repair". This article recapitulates preclinical and preliminary clinical evidence on the efficacy of melatonin in treating testicular or LC dysfunction, validating its therapeutic promise, and proactively identifies critical directions for future translational research, providing valuable insights for the development of novel, etiology-oriented therapeutic strategies for LOH.

PRDX6
Also flagged:Aortic aneurysmdissectioncognitive impairmentAlzheimer's diseasebehavioralGene Expression
Journal Article 2026-05-01 ✓ 5 Snippets Xie R, Lin X, Chen S, Li J, Zhou J, Xu K, Zheng Y, Huang W, Zhang L.
In-Text Gene Mentions

…pivotal role ofPRDX6in pathophysiological mechanis…

…Expression levels ofPRDX6were examined in…

…Correlative analyses betweenPRDX6and pro-inflammatory cytokines…

…functional role ofPRDX6in modulating synaptic…

…lian randomization prioritizedPRDX6was prioritized as…

Show Full Abstract

<h4>Aims</h4>This study aims to explore the relationship between aortic aneurysm and dissection (AAD) and cognitive impairment, with an emphasis on uncovering the potential biological mechanisms.<h4>Methods</h4>Utilizing the UK Biobank database, a matched cohort study was performed to assess the association between AAD and the risk of Alzheimer's disease. Cognitive function was evaluated in a β-aminopropionitrile (BAPN)-induced AAD mouse model through a series of behavioral assays. Drug-target Mendelian randomization analysis was conducted to identify candidate genes implicated in this association. Expression levels of PRDX6 were examined in brain tissues from Alzheimer's disease patients using datasets from the Gene Expression Omnibus (GEO), as well as in aortic tissues and blood samples obtained from both AAD patients and AAD model mice. Correlative analyses between PRDX6 and pro-inflammatory cytokines (IL-1β and TNF-α) were performed in mouse hippocampal tissues of the mouse model. Additionally, in vitro experiments employing SH-SY5Y cells were carried out to investigate the functional role of PRDX6 in modulating synaptic protein expression and inflammatory responses.<h4>Results</h4>Competing risk regression analysis indicated that AAD is significantly associated with an increased incidence of cognitive impairment. Behavioral testing revealed that AAD model mice exhibited deficits in cognitive performance. Mendelian randomization prioritized PRDX6 was prioritized as a candidate gene of interest. Elevated PRDX6 expression was observed in brain tissues from Alzheimer's disease patients. Both AAD patients and AAD model mice demonstrated markedly increased PRDX6 levels in aortic tissues and circulating blood; notably, PRDX6 expression was also upregulated in the hippocampus of AAD mice. In the hippocampus, PRDX6 expression positively correlated with levels of IL-1β and TNF-α expression in AAD mice. In SH-SY5Y cells, silencing of PRDX6 resulted in increased expression of synaptic proteins, reduced pro-inflammatory cytokine production, and decreased apoptosis, whereas overexpression of PRDX6 elicited inverse effects.<h4>Conclusions</h4>The present findings establish a significant association between AAD and heightened risk of cognitive impairment. PRDX6 has been identified as a potential mediator in this relationship, and PRDX6-related neuroinflammation is proposed as a plausible mechanistic pathway linking AAD to cognitive dysfunction.

Also flagged:cancerstumorcancertranslationalmethylationBreast invasive carcinoma
Journal Article 2026-05-01 No Snippets Li AZ, Du Y, Liu Y, Chen L, Liu R.
Show Full Abstract

Multi-omics profiling characterizes cancer biology and supports biomarker discovery for prognosis and therapy selection. Although numerous computational multi-omics biomarker identification methods have been proposed, their ability to identify clinically relevant biomarkers has not been systematically evaluated, leaving it unclear whether the resulting biomarker nominations are reliable for downstream validation. Here, we systematically benchmark 20 representative statistical, machine learning and deep learning methods using curated gold-standard prognostic and therapeutic biomarkers across five real-world datasets. We evaluate performance in terms of both biomarker identification accuracy and stability. Overall, DeePathNet and DeepKEGG achieve the best performance. Across methods, effective biomarker recovery is associated with the integration of biological knowledge, global feature interactions, multivariate feature attribution, and effective regularization. Analysis of omics type contributions reveals method- and modality-specific biases, highlighting the importance of broader omics integration. We further evaluate methods on simulated datasets to probe sensitivity with controlled signal and noise. By aggregating results from top-performing methods, we construct consensus biomarker panels that nominate candidates for potential investigations. Finally, we provide user-friendly interfaces to allow researchers to benchmark new methods against the 20 baselines or apply selected methods for biomarker identification on custom multi-omics datasets. Our benchmark is publicly available at https://github.com/athanzli/CancerMOBI-Bench.

TNFSF4
Also flagged:behavioralmetabolismporemembranesexcretionresponse to saltwater
Journal Article 2026-05-01 ✓ 1 Snippet Ramos E, Hilgers L, Carrasco-Valenzuela T, De Panis D, Picorelli A, Sullivan J, Uliano-Silva M, Bentley BP, Scott PA, Hiller M, Nery MF, Shaffer HB, Komoroske L, Mazzoni CJ.
In-Text Gene Mentions

…member 4 (TNFSF4), and crystallin…

Show Full Abstract

The transition from terrestrial to marine environments represents one of the most fundamental evolutionary shifts in vertebrate history, requiring radical physiological and genomic remodeling. We investigated the genomic signatures of saltwater adaptation in the green sea turtle (Chelonia mydas), the leatherback turtle (Dermochelys coriacea), and the independently evolved estuarine diamondback terrapin (Malaclemys terrapin). Our analyses reveal that the marine transition is characterized by rapid evolution and expansion in gene families linked to iron metabolism, organ morphogenesis, and sensory perception-patterns that mirror those seen in other secondarily marine tetrapods. Notably, while we identified shared targets of positive selection across these independent lineages, we found no evidence of repeated evolution at the nucleotide level, reinforcing that functional convergence often arises through distinct molecular trajectories. Furthermore, demographic reconstructions reveal that saltwater-adapted turtles share a history of deep-time population declines; however, the delayed recovery of M. terrapin underscores the specific susceptibility of estuarine specialists to Pleistocene sea-level volatility. By bridging comparative genomics and historical demography, this study provides new insights into the genomic basis of marine adaptations in turtles and a comprehensive framework for understanding the molecular and ecological mechanisms that facilitate major vertebrate transitions into the marine realm.

Also flagged:intracerebral hemorrhagestrokescerebral infarctionsubarachnoid hemorrhagehematomaStroke
Journal Article 2026-05-01 No Snippets Lu T, Zheng B, Wang D, Liao W, Su C, Wu X, Zhong X, Chen X, Ying G, Cai Y, Du Q, Dong X.
Show Full Abstract

<h4>Background</h4>Intracerebral hemorrhage (ICH) is commonly encountered in elderly patients. Peroxiredoxin 6 (Prx6) is involved in oxidative stress and inflammatory responses. Here, serum Prx6 levels were measured to explore their prognostic value in ICH.<h4>Methods</h4>In this multicenter observational analytical study of 306 elderly patients with ICH and 100 elderly controls, serum Prx6 levels were quantified at admission of all patients, at serial time points of 103 patients and at study entry of controls. Outcome variables included early neurological deterioration (END) and poor neurological status mirrored by six-month modified Rankin Scale (mRS).<h4>Results</h4>Serum Prx6 levels were significantly elevated upon admission of patients, gradually increased on day 1, peaked on day 3, decreased from day 5 until day 14 after ICH, and were markedly higher during 14 days than those of controls. Serum Prx6 levels, in independent correlation with National Institutes of Health Stroke Scale scores, hematoma sizes and mRS scores, were linearly related to risks of END and poor prognosis, and independently predicted their occurrences. The independent associations were robust in sensitivity analysis. The association between serum Prx6 levels and poor prognosis was partially mediated by END. Serum Prx6 levels showed an effective predictive ability for poor prognosis and END. Other parameters, such as age, gender, and hypertension, negligibly affected the relevance of Prx6 levels in poor prognosis and END. The combined models encompassing independent predictors were visualized via the nomograms and had acceptable goodness of fit and clinical benefit via various statistical tools.<h4>Conclusion</h4>Elevated serum Prx6 levels post-ICH in the elderly are intimately related to bleeding severity and clinical outcomes; and END partially interprets the association of serum Prx6 with poor prognosis, therefore suggesting that serum Prx6 may be a prognostic biomarker of ICH in the elderly.

Also flagged:steatohepatitisdiabetesobesityliver diseasechronic diseasescardiovascular disease
Journal Article 2026-05-01 No Snippets Torre E, Di Matteo S, Martinotti C, Bruno GM, Cabrino A, Fogliati EL, Giusti A, Barbieri M, Bottaro LC, Colombo GL.
Show Full Abstract

<h4>Background and objectives</h4>Metabolic dysfunction-associated liver disease (MASLD) and its progression to steatohepatitis (MASH) are highly prevalent among obese patients, contributing substantially to healthcare costs. Semaglutide, a GLP-1 receptor agonist, has shown metabolic and hepatic benefits in this population. This study assessed the cost-effectiveness of Wegovy<sup>®</sup> (semaglutide 2.4 mg) versus no pharmacological treatment in obese patients with MASH ≤F3 without diabetes, from the perspective of the Italian National Health Service (NHS).<h4>Materials and methods</h4>A cost-effectiveness analysis (CEA) was conducted using a Markov model developed in Microsoft Excel<sup>®</sup>, adopting the Italian NHS perspective over a 10-year horizon. In line with study perspective, the model included healthcare resource use and direct costs associated with the management of obesity with MASH (≤F3) and related complications (major obesity related complications and liver disease evolution). Since semaglutide 2.4 mg is not yet reimbursed in Italy, cost assumptions were applied. The target population was estimated from epidemiological data, and utility values were derived from international literature, reflecting the relationship between weight loss and improved quality of life. Costs and outcomes were discounted at 3% annually. Model robustness was tested through one-way deterministic sensitivity analyses (OWSAs).<h4>Results</h4>The base case estimated 782,920 obese adults in Italy with MASH ≤F3 without diabetes. The analysis yielded an incremental cost-effectiveness ratio (ICER) of €22,691 per QALY gained over 10 years, below the accepted Italian willingness-to-pay thresholds. OWSAs confirmed the robustness of results.<h4>Conclusion</h4>Semaglutide 2.4 mg is a cost-effective and sustainable option for treating obese patients with MASH ≤F3 in Italy, a subgroup at high risk of progressing to advanced liver disease. By improving both fibrosis and body weight, semaglutide may play a key role in reducing the long-term clinical and economic burden of MASLD.

SOX6
Also flagged:nucleosomechromatinnucleosomesbindingcell senescencecancer
Journal Article 2026-05-01 ✓ 1 Snippet Liu J, Song X, Zhou L, Zhao Y, Kim J, Li J, Dean A, Guo X.
In-Text Gene Mentions

…Hba-a, Id2, Gata2,Sox6, and Slc4a1…

Show Full Abstract

Histone chaperone ASF1B is largely known to be functionally correlated with cell proliferation and cell cycle. We found that the expression of ASF1B was abundant together with histone variant H3.3 during in mouse fetal liver cells. However, the mechanism underlying this coordination is still unclear. HIRA, a H3.3 specific chaperone, was dispensable in fetal hematopoiesis. In contrast, we found that ASF1B predominantly regulated H3.3 encoding genes and erythroid genes, whereas ASF1A served a compensatory function. Notably, ASF1B occupied >70% of H3.3 nucleosomes and determined H3.3 enrichment at erythroid gene promoters and enhancers. However, loss of ASF1B de-repressed the expression of embryonic/fetal globin genes by altering enrichment of H3.3 and erythroid transcription factors as well as chromatin accessibility. The regulatory pathway of ASF1B in H3.3 enrichment involved the recruitment of chromatin remodeler BRG1 and accumulation of H3K27ac in active chromatin. In summary, ASF1B plays a crucial role in enrichment of H3.3 nucleosomes and establishment of the chromatin environment to affect erythroid gene expression, highlighting the therapeutic potential of ASF1B in targeting erythrocyte disorders, such as β-globin hemoglobinopathies.

Also flagged:gene transferreproductionenvelopehost genomesposttranscriptionalheterochromatin
Journal Article 2026-05-01 No Snippets Brann T, Souza de Oliveira F, Iriarte A, Protasio AV.
Show Full Abstract

In eukaryotes, horizontal gene transfer (HGT) often involves transposable elements (TEs), host-parasite relationships, aquatic environments, or any of them combined. Horizontal transfer of transposable elements is both impactful, owing to the subsequent transposition burst, and insightful, providing information on organisms' evolutionary history. The flatworm Schistosoma mansoni is a human parasite with two free-living aquatic stages (intercalated between a definitive human host and intermediate snail host) and has a sizable TE content. We aimed to identify and characterize potential instances of HGT leveraging new genomic resources available. Using the latest chromosome-scale genome assembly and available TE sequences for the S. mansoni genome, we identify that two TEs, named Perere-3 and Sr3, are putatively horizontally transferred. We demonstrate the presence of these TEs in the genomes of Schistosoma spp. intermediate hosts, most likely explained by HGT. Perere-3/Sr3 were also found across a wide range of additional organisms not susceptible to schistosome infection, including turtles, fish, and other mollusks. We propose that the patchy distribution of Perere-3/Sr3 across the phylogenetic tree is best explained by HGT. Our synonymous substitution calculations further support HGT, as divergence between schistosome and snail TE sequences is markedly lower than that observed for conserved orthologous genes. We propose that HGT is likely linked to schistosomes' parasitic nature as several snail species sharing the elements are susceptible to infection. However, the rationale for the presence of Perere-3/Sr3 in species beyond this relationship is unknown.

Also flagged:CancerTumorextracellularbinding
Journal Article 2026-05-01 No Snippets Sevgi M, Işık Y, Karaca C, Çağlar E, Abdioğlu HB, Zendel F, Başbınar Y, Üvet H.
Show Full Abstract

Single-cell mechanical properties such as stiffness, elasticity, and viscosity, are crucial in governing biological processes like migration, proliferation, and differentiation. In cancer, the mechanical properties of cells undergo significant alterations, which contribute to tumor growth, metastasis, and resistance to therapy. This review focuses on cancer cell stiffness and explores how its regulation is disrupted by the complex interplay among cytoskeletal remodeling, nuclear mechanics, and extracellular matrix (ECM) interactions. Cancer-associated fibroblasts (CAFs) and ECM composition within the tumor microenvironment (TME) modulate cellular mechanics via mechanotransduction pathways involving Yes-associated protein/transcriptional coactivator with PDZ-binding motif (YAP/TAZ) and integrin-focal adhesion kinase (FAK) signaling. Increasing evidence supports cell stiffness as a promising diagnostic and prognostic biomarker, as well as a predictor of treatment response. Therefore, advanced techniques for measuring cell stiffness such as atomic force microscopy (AFM), Brillouin microscopy, and acousto-holography are evaluated with a focus on their potential clinical applicability. However, translation into routine oncology practice remains limited by technical variability, lack of standardized protocols, and the need for large-scale clinical validation. This review highlights the potential of integrating biomechanical markers into clinical workflows as a means to advance cancer diagnostics and enable more personalized therapeutic strategies.

Also flagged:phosphorylationtumorcell proliferationcancermetabolismpancreatic cancer
Journal Article 2026-05-01 No Snippets Dang F, Dai S, Zhao T, Zhang R, Chen L, Zhao Y.
Show Full Abstract

The Hippo, as a central pathway regulating cell proliferation, apoptosis, stem cell homeostasis and organ development, is closely associated with the onset and progression of tumors, metabolic reprogramming, drug resistance and immune evasion when it is abnormally inactivated. The Hippo not only directly promotes tumor cell proliferation, maintains cancer stem cell properties, and mediates metabolic reprogramming and treatment resistance, but also reshapes the tumor microenvironment (TME) by regulating the formation, heterogeneity and function of cancer-associated fibroblasts (CAFs). Furthermore, it mediates tumor immunosuppression and immune evasion by modulating programmed death-ligand 1 (PD-L1) expression, T-cell function, macrophage polarization and cytokine secretion. At the same time, inflammatory cytokines, growth factors, metabolites and physical signals within the TME can negatively regulate the activity of the Hippo, creating a pro-tumor positive feedback loop. This article provides a systematic review of the composition and regulation of the Hippo, its mechanisms of action in the biological behavior of tumor cells and interactions within the tumor microenvironment, as well as progress in the development of drugs targeting this pathway. It offers a theoretical basis for a deeper understanding of the role of the Hippo in tumors and for the development of novel anti-tumor therapeutic strategies.

Also flagged:agingdegradation-transferconjugationCarboxylationelectron transfer
Journal Article 2026-05-01 No Snippets Carrascal-Hernández DC, Ramos-Hernández A, Galán-Freyle NJ, Insuasty D, Méndez-López M.
Show Full Abstract

Environmental pollution constitutes an increasingly complex global challenge, largely driven by industrial expansion and the consequent release of toxic species such as Cd<sup>2+</sup>, Pb<sup>2+</sup>, Cu<sup>2+</sup>, Hg<sup>2+</sup>, Fe<sup>3+</sup>, As<sup>3+</sup>, and Rh<sup>3+</sup> into natural ecosystems. These contaminants pose significant risks to environmental integrity and public health, motivating the development of analytical technologies capable of sensitive, selective, and reliable detection. In this context, graphene-based electrochemical sensors have emerged as versatile platforms for monitoring a broad range of analytes, particularly in environmental applications involving heavy-metal detection. The intrinsic physicochemical properties of graphene derivatives have enabled low detection limits, rapid response times, and tunable selectivity. Despite analytical advances, critical challenges persist regarding operational stability in complex matrices, inter-batch reproducibility, and robustness to interfering species, which continue to hinder large-scale deployment and real-world applicability. However, challenges remain regarding stability and performance in complex arrays, reproducibility, and resistance to interference, necessitating innovative strategies for functionalization and molecular recognition. This review article establishes a comparative framework based on functionalization strategies (covalent, non-covalent, and hybrid), the chemical nature of graphene (GO, rGO, and doping), and various types of polymers (conductors and insulators), using statistical metrics such as the limit of detection (LOD), linear range, working potential, stability, and interferences, employing a bibliometric analysis using the PRISMA 2020 methodology. This comparative framework enables analysis and explanation of performance trends, and the generation of design and functionalization recommendations for versatile applications, including criteria for reproducibility and sustainability.

Also flagged:Congenital heart diseaseinfectioncell homeostasisactivationgene expressionorganization
Journal Article 2026-05-01 No Snippets Abu YE, Kammeyer C, Yang T, Jauregui RG, Cramer A, Junge C, Kleiner S, Janssen A, Jirmo AC, Horke A, Förster R, Beerbaum P, Boehne M, Ravens S.
Show Full Abstract

Congenital heart disease (CHD) is a major global health problem. Although treatment and survival have impressively improved, many patients face comorbidities such as increased susceptibility to infection that may shorten their lives. As many children undergo cardiac surgery with concomitant thymectomy early in life, most studies of the immune system in patients with CHD have focused on the quantitative analysis of lymphocyte subpopulations, maturation, and T cell receptor repertoires, whereas knowledge of effector functions remains limited. We analysed αβ T cell phenotypes, transcriptomes, and functions in children with CHD who underwent cardiac surgery within a year of birth and were followed up to five to ten years after thymectomy, in comparison to age-matched healthy controls. Children with CHD showed reduced T cell populations, a reduction of recent thymic emigrants (RTEs) and naive T cells, regulatory T cells with a higher suppressive phenotype, and, most importantly, high activation states of T cells, further reflected in higher granzyme and cytokine production. This reveals persistent alterations in T cell immunity years after early-life thymectomy in children with CHD, highlighting the need for long-term immune monitoring and providing a basis for understanding immune-related comorbidities in this patient population.

Also flagged:Cell surfacesextracellularaxon guidance
Journal Article 2026-05-01 No Snippets Gailey CD, Miller DM.
Show Full Abstract

Cell surfaces display dense arrays of extracellular proteins that interact with each other and with secreted cues. Nawrocka et al. deployed a biochemical screen to catalog these interactions at genome scale for the model organism C. elegans and identified new effectors of axon guidance, insulin signaling, growth factor biology, and neuronal connectivity.

HFE
Also flagged:Cardiomyopathiesinflammatory cardiomyopathiesmyocardial diseasescardiac dysfunctionheart failuremyocarditis
Journal Article 2026-05-01 ✓ 1 Snippet Rojulpote C, Givertz MM, Mitchell RN, Padera RF, Kwong RY, Divakaran S, Dorbala S.
In-Text Gene Mentions

Hemochromatosis

Show Full Abstract

Infiltrative and inflammatory cardiomyopathies comprise a spectrum of myocardial diseases defined by the accumulation of abnormal substances or inflammation within the myocardium. Although their etiologies differ, they share common mechanisms of cardiac dysfunction, such as microvascular dysfunction, denervation, impaired energetics, apoptosis, inflammation, and myocardial infiltration. While conventional cardiovascular imaging techniques assess structural and functional changes, they do not usually yield insight into underlying mechanistic processes. This review highlights the role of advanced cardiovascular imaging in identifying pathophysiologic mechanisms to improve our understanding of these disease processes in order to improve the care of patients.

Also flagged:agingneuropsychiatric disordersCNS diseasesCNS Disordersneurotransmitternucleus
Journal Article 2026-05-01 No Snippets Niu RZ, Zhang MY, Li YP, Zhou XQ, Liu XL, Wu J, Wu J, Wang WW, Wang YJ, Ruan Y, Ding Y, Zeng XF, Bao TH.
Show Full Abstract

The neurotransmitter system (NTS) composed of neurotransmitter receptors and transporters is associated with a variety of diseases and disorders. The identification of disease-associated NTS features is important for understanding disease mechanisms and for prioritizing potential therapeutic targets. The differences in the composition of NTS in aging and different diseases are not well understood. Here, we show how to integrate multi-omics data at scale, including single-cell and spatial transcriptomic, to identify disease-associated NTS. By integrating, annotating, and analyzing 368 publicly available single-nucleus RNA sequencing (snRNA-seq) datasets from 17 cohort studies, we created a snRNA-seq dataset for the prefrontal cortex (PFC) of the human brain. The resulting dataset included > 1 million cells covering healthy individuals throughout the life course after birth and eight common neuropsychiatric disorders. We comprehensively describe the cellular heterogeneity of NTS in aging and disease, and resolve the relationship between age or sex and disease-associated NTS. A module composed of NTS and their regulatory genes was constructed and showed disease-associated discriminatory signal, with supportive validation from protein-level and external datasets. In order to screen NTS networks that can simulate disease brain tissue, we conducted a comparative analysis of five disease-related cerebral organoids and found partial similarity between patient-derived organoids and parental brain tissues. Our work provides a multi-disease cell atlas based on large-scale snRNA-seq data and analyses the disease and sex heterogeneity of NTS, which provides new insights into the mechanisms of multiple CNS diseases and sheds light on disease precision therapy against NTS.

TNFSF4
Also flagged:methylationgene expressioncancertumorcancersposttranslational modification
Journal Article 2026-05-01 ✓ 1 Snippet A UD, Shukla PK.
In-Text Gene Mentions

…TNFRSF13C, TNFSF13B, andTNFSF4(Figure 7d ).…

Show Full Abstract

<h4>Background</h4>Ubiquitin-specific protease 22, an important catalytic component of the human SAGA (Spt-Ada-GcN5 Acetyltransferase) complex, regulates the deubiquitination and methylation of histones, which in turn influences gene expression. Its overexpression alters gene regulation, transcription, cancer progression, and therapy resistance. Its role is increasingly being noticed in cancers.<h4>Aims</h4>To conducted a pan-cancer analysis across multiple malignancies, as it allows for a comprehensive assessment of USP22 expression, regulation, and clinical impact.<h4>Methods</h4>The Human Protein Atlas, UALCAN, and Timer 2.0 were used to examine USP22 expression at the gene and protein levels in 33 TCGA cancer types. Furthermore, various tools have been employed to study genetic changes, overall survival (OS), disease-free survival (DFS), DNA methylation profiles, and immune associations. Gene correlation and protein-protein interaction were examined.<h4>Results</h4>USP22 expression level was observed to be significantly higher in 13 distinct cancer types among the 33 TCGA cancer types. Along with the pathological stages of the TCGA sample, it showed overexpression in the histological subtypes, TP53 mutant stages, and tumor grade in numerous cancers compared to the control. According to the study, elevated USP22 expression was linked to a worse chance of survival and a lower OS rate in several types of cancer. High expression of USP22 is linked to a poor immunosuppressive microenvironment, and the CpG-aggregated methylation analysis shows that the gene is significantly hypomethylated in tumor samples, which is highly associated with its known upregulation in cancer.<h4>Conclusion</h4>USP22 may have potential relevance in cancer, and the pathways associated with it could offer possible targets for therapeutic intervention.

Also flagged:bindingprotein synthesiscatalytic activitymembranemembranesenzyme activity
Journal Article 2026-05-01 No Snippets Sikkema AP, Klemm BP, Perera L, Hall TMT.
Show Full Abstract

Transfer RNAs (tRNAs) are transcribed and then processed through a series of post-transcriptional steps to produce mature forms that are charged with amino acids for translation. A CCA sequence is added at their 3' ends as the site of aminoacylation. Although a single enzyme typically adds the CCA tail without a nucleic acid template, Schizosaccharomyces pombe encodes two enzymes: CCA1 that adds the two cytosines and CCA2 that adds the adenosine. Here we explore how these two S. pombe enzymes evolved specificity to generate the 3' CCA tails. Enzymology (activity and kinetic assays) indicates distinct nucleotide addition specificity. CCA1 adds the sequential cytosines with a slower first addition followed by a quicker second addition. CCA2 then rapidly adds the terminal adenosine. Moreover, structural biology (crystal structures and molecular dynamics simulations) explains how the active site configuration and distances between active site and tRNA elbow binding residues of CCA1 and CCA2 restrict their tRNA substrate specificity. Together the data presented here describe how S. pombe CCA1 and CCA2 interrogate complete reaction complexes of tRNA and nucleotide substrates that arrange the particular components for active site catalysis and therefore specificity.

Also flagged:β-thalassemiasickle cell anemiaHPFHmyelodysplastic syndromeschromosomeβ-hemoglobinopathies
Journal Article 2026-05-01 No Snippets Abu Za'ror YSM, Suleiman JB, Delmani FA, Alhmoud JF, Ayasreh AM, Al-Wendawi SI, AlRamadneh TN, Azlan M.
Show Full Abstract

Reactivating fetal hemoglobin (HbF) has become a key therapeutic strategy for β-hemoglobinopathies. However, the regulatory networks controlling HbF are complex and have only recently been uncovered. This review integrates current knowledge of the genetic and epigenetic factors that influence HbF expression, including BCL11A, HBS1L-MYB, KLF1, and variants associated with HPFH, and shows how these pathways work together to regulate γ-globin levels. It also highlights recent advances in HbF-targeted treatments, including gene-editing technologies such as CRISPR-Cas9-based BCL11A enhancer disruption, promoter editing to mimic hereditary persistence of fetal hemoglobin (HPFH), and advanced tools like base and prime editing. By combining mechanistic understanding with therapeutic development, this review highlights how improvements in HbF regulation have transformed efforts to find cures for sickle cell disease and β-thalassemia, while also revealing new opportunities for targeted HbF induction across different patient groups.

Also flagged:anxietydepressiondiabetesCFCystic FibrosisAnxiety Disorder
Journal Article 2026-05-01 No Snippets Vitale RJ, Ford C, Filigno SS, Sweeney L, Snell C, Putman MS, Rai S, Riekert KA.
Show Full Abstract

<h4>Background</h4>Cystic fibrosis (CF) is a complex disease requiring adherence to an intensive medical regimen to maintain health. For those who develop CF-related diabetes (CFRD, 20% adolescents, 30%-50% adults), daily self-management is additionally complex and burdensome. This study aimed to examine how managing CFRD influences self-efficacy, adherence, mental health, and executive functioning for people with CF.<h4>Methods</h4>Using data collected in a cross-sectional study addressing barriers to daily care, we examined relationships between self-efficacy (CF-Medication Beliefs Questionnaire), adherence measures (composite medication possession ratio), barriers to daily care (Daily Care Check-in), psychological outcomes (Patient Health Questionnaire-8 and General Anxiety Disorder Scale-7), and executive function (Behavior Rating Inventory of Executive Function), comparing those with and without CFRD.<h4>Results</h4>Of 405 participants enrolled, 131 (33%) had CFRD. Treatment complexity was higher for those with CFRD (p < 0.001), but adherence, barriers to daily care, anxiety, depression, and executive function did not differ by CFRD status (p > 0.05 for all). People with CFRD had higher self-efficacy (p = 0.030) and lower concerns about privacy (p = 0.015) than those without CFRD.<h4>Conclusions</h4>Despite higher treatment complexity, people with CFRD had similar adherence and higher self-efficacy than those without CFRD, suggesting that, in our sample, managing CFRD may uniquely impact self-efficacy, supporting adherence by way of adaptive coping. No differences were seen in mental health or executive function variables. Future research is needed to further explore relationships between executive function, glycemic outcomes, and diabetes management in samples representative of the population with CF and CFRD.

PCDH17
Also flagged:acute pancreatitisinflammatory diseasepathogenesissecretioninflammatory responsemulti-organ dysfunction syndrome
Journal Article 2026-05-01 ✓ 1 Snippet Jia X, Cui B, Liu X.
In-Text Gene Mentions

…endothelial cells (PECAM1,PCDH17, VWF), fibroblasts (DCN,…

Show Full Abstract

<h4>Introduction</h4>Acute pancreatitis (AP) is a severe inflammatory disease where epithelial injury and dysregulated repair are central to pathogenesis, yet the underlying transcriptional mechanisms remain poorly understood.<h4>Methods</h4>This study employed an integrated approach to identify and characterize the transcription factor MXD3 as a master regulator of AP progression. Using single-cell RNA sequencing in a ceruleininduced rat AP model, we delineated a pathogenic epithelial trajectory from ciliated through non-ciliated to a proliferative state, with MXD3 emerging as the most significantly upregulated transcription factor in the proliferative cluster. Subsequent validation in pancreatic ductal epithelial-specific MXD3 knockout rats revealed profound protection against AP, manifesting as reduced histological damage, diminished fibrosis, attenuated neutrophil infiltration (MPO+ cells), and decreased expression of pro-inflammatory cytokines (IL-6, TNF-α, IL-1β).<h4>Results</h4>Mechanistically, we demonstrated that MXD3 directly activates the Wnt/β-catenin pathway, as evidenced by increased non-phospho β-catenin, its nuclear accumulation, and transcriptional upregulation of canonical targets (cMyc, Cyclin D1, Axin2). Furthermore, functional rescue experiments confirmed the pathway's necessity, wherein the β-catenin inhibitor ICG-001 substantially reversed MXD3-driven apoptosis, necrosis, and pro-inflammatory cytokine secretion (IL-1β, IL-6, MCP-1) <i>in vitro</i>.<h4>Conclusions</h4>Our findings establish a novel MXD3- Wnt/β-catenin axis as a crucial mechanism governing epithelial pathology in AP, revealing MXD3 as a promising therapeutic target for this debilitating condition.

POU3F2
Also flagged:agingorganizationaxonsynapserelatedactivity
Journal Article 2026-05-01 ✓ 1 Snippet Kulatunga DCM, Kim MK.
In-Text Gene Mentions

…as ASCL1, BRN2 (POU3F2, POU class 3…

Show Full Abstract

Marker selection precision in neuronal studies is critical for reliable neuron identification. However, it largely depends on the experimental context. Variations in neuronal marker specificity across experimental models, neuronal maturation stages, and neurotransmitter phenotypes have highlighted the vitality of implementing "context-tuned" strategies in marker selection. Neuronal markers arise from canonical protein-coding genes, non-coding RNAs (ncRNAs), including microRNAs (miRNAs), isoform-specific variants, neurotransmitters, and numerous metabolic signatures. Here, we emphasize protein-coding genes as markers because of their wide availability, ease of interpretation, and compatibility with standard detection methods like qPCR, <i>in situ</i> hybridization, immunocytochemistry, and Western blotting. They are also directly linked to cellular structures, signaling pathways, functional importance, and are adaptable across different platforms. We aim to guide the strategic selection and application of neuronal markers to maximize accuracy and interpretive confidence across diverse experimental systems. The review addresses the molecular origin and nature of neuronal markers, their specific applications, including distinguishing neuronal from non-neuronal cells in tissue or histological preparations, identifying neurotransmitter phenotypes in neuronal cultures and tissues, evaluating neuronal maturity in progenitor-derived systems, discriminating between immature and fully differentiated neurons <i>in vitro</i>, and detecting neurons alongside other neuronal or non-neuronal subtypes in mixed populations. Furthermore, it emphasizes positive and negative marker strategies, accounting for developmental timing, cellular specificity, model system differences, and rigorous exclusion of unintended cell types. Through this comprehensive review, we deliver a simplified reference for neuroscientists seeking to enhance the accuracy, specificity, and reproducibility of their neurobiological studies.

Also flagged:CancerFerroptosisdeathmetabolismautophagyimmune response
Journal Article 2026-05-01 No Snippets Li Y, Zhou C, Wang Z, Ni W, Xu H, Xing Y, Huang L.
Show Full Abstract

Cancer is a global health public issue with an increasing morbidity and mortality. Ferroptosis is a form of regulated cell death characterized by iron accumulation and lipid peroxidation, providing a novel and promising strategy for cancer treatment. Plant polysaccharides possess low toxicity, minimal side effects, and significant therapeutic potential, particularly in antioxidation, immune regulation, and cancer suppression. However, it is unknown that whether and how ferroptosis is involved in the anticancer effects of plant polysaccharides. Occurrence of ferroptosis in cancer cells involves with several cell events including disturbed iron metabolism, overwhelmed lipid metabolism, and disordered antioxidant defense, which is fatal to cancer cells. Recent studies have showed that plant polysaccharides play significant roles in cancer treatment with activities in ferroptosis regulation through inhibiting cancer growth, enhancing treatment sensitivity, reducing drug resistance, strengthening immune function. This review presents the current understanding of polysaccharides regulation in cancer treatment targeting ferroptosis, and also address the limitation and future direction of polysaccharide application regarding cancer treatment via ferroptosis. These findings would contribute to advancing cancer therapy.

OLFM4
Also flagged:gene expressioncell adhesionperistalsisMechanotransductionsynthesisfocal adhesion
Journal Article 2026-05-01 ✓ 2 Snippets Alzain N, Almalla A, Sandu K, Gerbeth L, Ziegler JF, Gutwein C, Weidner P, Glauben R, Weinhart M, Siegmund B.
In-Text Gene Mentions

OLFM4expression showed modest…

…MKI67 , andOLFM4was observed under…

Show Full Abstract

Primary human intestinal epithelial cells (IECs) require microenvironments that reproduce various <i>in vivo</i> cues to maintain survival, differentiation, and function <i>in vitro</i>. In this study, we investigated how intestinal stem cell (ISC)-derived monolayers respond to biomimetic substrates and shear stress using 3D-printed hydrogels based on bioactive decellularized and methacrylated small intestinal submucosa (dSIS-MA) integrated into a custom millifluidic system. Extensive bulk RNA sequencing experiments revealed that, compared with Matrigel-coated tissue culture plastic, dSIS-MA hydrogels supported survival- and differentiation-related signaling, stabilized gene expression over time, and promoted absorptive lineage maturation while reducing crypt-associated signatures. By applying dynamic culture conditions to the hydrogel system, IECs underwent transcriptional remodeling, characterized by activation of metabolic and immune pathways. Longitudinal analysis further indicated that shear stress enhanced metabolic pathway-associated gene expression and promoted differentiation toward absorptive lineages. These findings establish dSIS-MA hydrogels with controlled fluid flow as a biomimetic <i>in vitro</i> model that supports survival, maturation of human IECs and enables transcriptional adaptation to defined biochemical and mechanical cues, supporting future applications in disease modelling, drug testing, and regenerative medicine.

Also flagged:GBMGliomascancer ofintracranial tumorstumorsdiffuse astrocytoma band oligodendrogliomas
Journal Article 2026-05-01 No Snippets Chen Y, Liu H, Yuan P, Li Y, Xu C, Li R, Chen J, Wu F.
Show Full Abstract

Glioblastoma (GBM) is the most common and aggressive type of central nervous system cancer, characterized by high rates of recurrence and mortality. As the highest-grade glioma, patient prognosis remains poor despite multimodal interventions including surgery, chemotherapy, and postoperative radiotherapy. Therefore, developing novel therapeutic strategies and precise diagnostic tools has become an urgent need in oncology research. In recent years, exosomes have emerged as important candidates for targeted tumor therapy due to their natural, endogenous nanocarrier properties, such as low immunogenicity, good biocompatibility, and the ability to cross biological barriers. In particular, exosome-based delivery systems loading functional microRNAs (miRNAs) offer a promising new strategy for intervening in malignant tumor progression. Studies have shown that exosome-delivered tumor-suppressive miRNAs can effectively inhibit tumor cell proliferation, promote apoptosis, impede migration and invasion, and reverse chemoresistance. These functions have been validated through <i>in vitro</i> cellular models and <i>in vivo</i> animal experiments across various tumors, confirming the efficacy of engineered exosome-miRNA delivery systems in suppressing tumor growth, delaying metastasis, and sensitizing tumors to treatment. Furthermore, in the field of biomarkers, aberrant expression of various miRNAs is closely associated with GBM proliferation, invasion, metastasis, and therapy resistance. Specifically, downregulated tumor-suppressive miRNAs and upregulated oncogenic miRNAs may serve as potential biomarkers for monitoring disease progression, assessing prognosis, and predicting therapeutic response. In summary, the miRNA system offers dual potential as both a targeted therapeutic approach and a precise biomarker, providing new directions for the diagnosis and treatment of GBM. However, challenges such as optimizing delivery efficiency and enhancing targeting specificity remain. Moving forward, interdisciplinary efforts will be essential to overcome these technical barriers and advance its translation from basic research to clinical application.

Also flagged:agingneurodegenerative diseasesage-related diseasesneurodegenerative disordersmitochondrialcognitive decline
Journal Article 2026-05-01 No Snippets Kaya Y, Kırboğa KK.
Show Full Abstract

Aging is a complex biological process characterized by progressive functional decline and increased vulnerability to age-related diseases, particularly neurodegenerative disorders. At the biological level, aging is characterized by a range of molecular and cellular mechanisms, including genomic instability, telomere attrition, loss of proteostasis, mitochondrial dysfunction, and chronic inflammation, which collectively contribute to cognitive decline and neuronal dysfunction over time. These hallmarks do not function independently but instead interact with one another during aging and neurodegeneration. Consequently, brain aging and neurodegenerative diseases are recognized as closely interconnected processes. To better understand this relationship, it is essential to examine the shared molecular and cellular mechanisms that link brain aging to neurodegeneration. In this review, we summarize the principal mechanisms underlying aging and neurodegenerative diseases, examine their roles in these processes, and highlight how their interactions shape both aging and neurodegeneration. We also discuss potential therapeutic strategies targeting key mechanisms involved in aging and neurodegeneration.

PRDX6
Also flagged:deathbacteremialeukemialymphomacapsulebinding
Journal Article 2026-05-01 ✓ 1 Snippet Maddala R, Lankford LK, Skiba NP, Rao PV.
In-Text Gene Mentions

…(GPX4), peroxiredoxin 6 (PRDX6), aldo-keto reductase family…

Show Full Abstract

<h4>Purpose</h4>Morphogenesis, growth, shape, mechanics, and transparency of the ocular lens critically depend on cytoskeletal networks and cell adhesive interactions. However, the molecular composition of these cellular components of lens fibers remains to be defined in depth. This study is aimed at providing an unbiased and comprehensive characterization of cytoskeletal and cytoskeleton-associated proteins in human lens fibers.<h4>Methods</h4>Transparent lenses from young adult human donors (ages 21 and 31), with capsules removed, were processed to enrich the cytoskeletome fraction, which was then trypsin-digested and subjected to proteomics analysis using a Q Exactive HF Orbitrap LC-MS/MS spectrometer. Selected proteins were validated by immunoblotting and immunofluorescence. Gene Ontology enrichment analysis was performed to classify the identified proteins.<h4>Results</h4>Proteomic analysis identified 530 proteins in the human lens fiber cytoskeletome, including known and lesser-known cytoskeletal, membrane-associated, adhesive, scaffolding, signaling, and metabolic proteins. Notably, several neuron preferred proteins, chaperonins, and proteasome, signaling, and redox regulators were enriched in the cytoskeletal interactome. Many of the neuron preferred proteins were localized to the cortical lens fiber cells. In addition, certain cytoskeletal protein profiles differed between human and mouse lenses.<h4>Conclusions</h4>This study provides the first comprehensive profile of the human lens fiber cytoskeletome. It highlights the presence of neuron-enriched cytoskeletal, adhesive, and scaffolding proteins; cytoskeletal chaperonins; proteasome, signaling, and redox regulators; and both canonical and lesser-known cytoskeletal proteins. These findings suggest that a diverse, complex, and dynamically regulated cytoskeletal network contributes to lens fiber cell architecture, adhesion, trafficking, mechanics, and clarity.

PRDX6
Also flagged:reflexDigestionmicrophthalmiacorneal opacityiris hypoplasiaaniridia
Journal Article 2026-05-01 ✓ 1 Snippet Willems M, Girard M, Feret N, Touchet D, Vialaret J, Kindermans J, Fichter L, Hirtz C, Bremond-Gignac D, Daien V, Delettre C, Pequignot M, Michon F.
In-Text Gene Mentions

…tress-response pathways (e.g.,PRDX6and TXNDC17), more…

Show Full Abstract

<h4>Purpose</h4>The purpose of this study was to determine how Pax6 haploinsufficiency alters epithelial maturation, immune balance, sensory innervation, and lacrimal function across the ocular surface, and how these defects affect corneal repair.<h4>Methods</h4>Pax6tm1Ued mice crossed with CMV-Cre were used to generate Pax6+/- animals. Ocular-surface maturation, epithelial organization, immune infiltration, and sensory innervation were assessed by whole-cornea immunostaining. Standardized corneal abrasion was used to evaluate epithelial and neural repair. Corneal RNA sequencing and tear-film proteomics were performed in both sexes to define genotype- and sex-dependent molecular programs.<h4>Results</h4>Pax6+/- mice showed heterogeneous ocular phenotypes, delayed eyelid opening, reduced KRT12, persistent central KRT14 expansion, and a sustained deficit in central proliferation. Immune infiltration was elevated from eyelid opening onward. Corneal nerves were markedly reduced and disorganized, with decreased sensitivity despite minimal trigeminal transcriptional changes. Transcriptomics revealed sex-specific gene-expression patterns converging on inflammation and extracellular-matrix remodeling. After abrasion, closure rates were preserved, but Pax6+/- corneas failed to fully restore normal epithelial identity, territorial patterning, or nerve density. Tear secretion was impaired in a sex-dependent manner, and proteomics showed depletion of structural and antioxidant proteins with exaggerated inflammatory and keratinization responses after injury.<h4>Conclusions</h4>Our model showed that Pax6 haploinsufficiency is associated with epithelial dysmaturation, chronic inflammation, denervation, defective repair, and sex-modulated lacrimal dysfunction. These integrated abnormalities mirror key features of AAK and underline inflammation, neurotrophic support, and tear-film quality as therapeutic targets.

SERPINC1
Also flagged:Venous thromboembolismdeep vein thrombosisDVTpulmonary embolismPEblood clotting
Journal Article 2026-05-01 ✓ 2 Snippets Jiang Q, Huang Y, Zhu T, Mao C, Li C, Wang F, Li J, Wang Y, Gao R, Liu X, Zhang Y, Li L, Li Y.
In-Text Gene Mentions

…(AST), antithrombin III (ATIII), international normalized ra…

…AST aspartate transaminaseATIIIantithrombin III AUC…

Show Full Abstract

Venous thromboembolism (VTE) is a growing public health threat whose prevalence imposes a significant burden on patients and the economy. It mostly affects the lower limbs and is more prevalent in patients who have fractures or who are bedridden for long periods of time. Deep vein thrombosis (DVT) is more common and advances more quickly in cases of traumatizing lower extremity fractures. This study aims to develop a nomogram to predict the risk of deep vein thrombosis (DVT) progression following lower limb fracture surgery, providing a theoretical foundation for preoperative prevention. This retrospective study analyzed 500 patients who underwent lower limb fracture surgery at the Third Hospital of Hebei Medical University. The mean age was 54 years, and 65.8% were male. Thrombotic progression occurred in 30.2% of patients. Data collected included demographics, comorbidities, surgical details, and laboratory parameters. Independent risk factors for postoperative DVT progression were identified using logistic regression. A nomogram prediction model was developed and evaluated using the area under the ROC curve (AUC), calibration curves, and decision curve analysis (DCA). Results showed 5 significant (P < .05) independent risk factors for thrombosis progression: age (45-59 years), blood transfusion, short time from fracture to surgery, elevated d-dimer levels, and preoperative thrombosis location (intermuscular vein thrombosis). Using these 5 independent criteria, a risk prediction model for DVT progression in patients following lower extremity fracture surgery exhibited good performance with an AUC value of 0.691 (95% CI: 0.642-0.740). Internal validation of the model revealed that the calibration curves were near the ideal curves. The developed and validated prediction model demonstrated good accuracy in identifying high-risk patients and provided key insights into DVT pathogenesis. This reliable tool informs clinical strategies for targeted interventions, ultimately improving patient outcomes.

Also flagged:mental health disordersdepressionschizophreniaanxietyautism spectrum disordersubstance use disorders
Journal Article 2026-05-01 No Snippets Bengoetxea de Tena I, Sallie FN, Rodriguez Abiero A, Rizzi B, Champarini LG, Corti E, Masella G, Dunn AL, Binder LB, Wenzel TJ, Robles AI, Anversa RG, Tremblay C, Fokoua AR, de Lima RMS, D'Ávila M, Truong TTT, Pierce JC, Rodrigues RS, Dinamarca-Villarroel L, Almeida FB, Piironen AK, Aguiar AFL, Jaramillo AM, Santos L, de Lange A, Nutt DJ, Lawrence AJ.
Show Full Abstract

Neuropsychiatric disorders represent a significant global health burden. Despite decades of research, current treatments typically provide only symptomatic relief, rather than addressing the underlying mechanisms of these conditions. Historically, research focused on the dopaminergic and serotonergic systems, which are deeply involved in the pathophysiology of many mental health disorders, including depression, schizophrenia, anxiety, autism spectrum disorder (ASD), and different substance use disorders, including alcohol use disorder (AUD). However, therapies targeting these systems have limitations, often only producing partial symptom relief plus compliance-limiting side effects. This highlights the need for improved treatments that may emerge from a broader understanding of the neurobiological bases of these conditions, especially neurochemical systems beyond dopamine and serotonin. Additional monoamines (e.g., histamine, acetylcholine, norepinephrine), neurolipid systems (e.g., endocannabinoids), and diverse signaling molecules such as neuropeptides, trace amines, and cytokines are increasingly recognized as key players in the dysfunction of neural circuits. In this review, which originated from the International Society for Neurochemistry (ISN)/Journal of Neurochemistry 5th Flagship School in October 2024 held in Naxos, Greece, we describe the importance of these neuromodulatory systems in the pathophysiology of select neuropsychiatric disorders, discuss their potential as targets for therapeutic intervention, exploring how they may offer more effective, mechanism-based treatments. We also highlight recent clinical trials, underscoring the progress in advancing towards clinical application, as well as sex-specific neurobiological differences, a historically overlooked, yet fundamental determinant of the pathophysiology of neuropsychiatric disorders. We propose that expanding our focus beyond traditional monoamines offers a promising avenue for the development of new, disease-modifying treatments that can more effectively address the underlying causes of neuropsychiatric disorders. By targeting these pathways, we believe it may be possible to develop therapies that restore balance to dysregulated brain circuits and improve long-term outcomes for patients.

SUDS3
Also flagged:chromatingene expressiongene bodiestranscriptional silencingnucleosomenucleosomes
Journal Article 2026-05-01 ✓ 1 Snippet Zhao H, Li H, Wang C, Yang X, Zou B, Dong S, Zhang N, Zhou Y, Yi L, Zhang Y, Xie Y, Qin D, Chao WCH, Pei D, He J.
In-Text Gene Mentions

…is a Sin3histone deacetylase complexdeacetylase complex (HDAC)…

Show Full Abstract

The regulation of gene expression requires precise control of chromatin-associated complexes that respond to diverse structural and epigenetic cues. The Rpd3 Large (Rpd3L) complex is a Sin3 histone deacetylase complex (HDAC) that dynamically adapt to chromatin states to reinforce transcriptional silencing, yet the mechanisms governing the catalytic activation in chromatin context-dependent manner remain unclear. Here we present the cryo-electron microscopy structure of Rpd3L bound to both mono- and di-nucleosome substrate at near-atomic resolution, uncovering a substrate-guided allosteric activation mechanism. Rpd3L adopts an asymmetric architecture, in which the proximal catalytic module anchors the first nucleosome, while the Sin3 PAH domains engage linker DNA to reposition a second nucleosome. This spatial configuration brings the distal catalytic module into proximity with chromatin and unlocks its latent deacetylase activity. Biochemical and mass spectrometry analyses confirm that dual nucleosome engagement selectively enhances Rpd3L activity and broadens substrate specificity. Together, these findings establish a hierarchical mechanism by which Rpd3L interprets histone modifications and nucleosome organization to modulate its enzymatic output at promoter regions. Our study provides a framework for understanding higher-order chromatin repression mechanisms by chromatin-regulation complexes and co-repressors.

Also flagged:restless leg syndromeschizophreniabindinggene expressionautosomesX-chromosome
Journal Article 2026-05-01 No Snippets Li RY, Su C, Qin ZS.
Show Full Abstract

Expression quantitative trait loci (eQTLs) are regulatory variants that affect the expression level of their target genes and have significant impact on disease biology. However, eQTL mapping has been done mostly in one tissue at a time, despite the known prevalence of correlations among tissues. Multivariate analyses incorporating multiple phenotypes are available, but they emphasize linear combinations of phenotypes. We present MTClass, a machine learning framework that attempts to classify an individual's genotype based on a vector of multiphenotype expression levels of a given gene. We conduct simulation studies and multiple case studies using real and imputed data, and we demonstrate that MTClass detects more functionally relevant variants and genes compared to existing single-tissue approaches as well as multi-phenotype association tests. Our results suggest that the importance of expression regulation at the MHC region may have been underestimated, and they provide fresh biological insights into genetic variants that have pleiotropic effects, influencing gene expression in a complex manner.

Also flagged:metabolismresponse tobiosynthesisrootcell differentiationgene expression
Journal Article 2026-05-01 No Snippets Zhang T, Peng JT, Chu J, Luo S, Lee J, Sánchez Rodríguez DB, Gundran K, Xia X, Garay-Arroyo A, Richardson JA, Dickinson AJ.
Show Full Abstract

Citric acid is an integral component of primary metabolism and cellular energetics and plays extensive roles in other cellular processes, such as signaling, chelating, and exudation. Here, we characterized the unique effects that citric acid has on Arabidopsis (Arabidopsis thaliana) root structure and development. In particular, we investigated how citric acid modifies 2 root types in opposing ways: by inhibiting primary root growth while promoting anchor root growth. To understand the mechanisms driving these different growth patterns within the same organism, we analyzed nutrient and transcriptomic responses to citric acid treatment in anchor roots and primary roots. High-spatial resolution elemental analysis revealed that root meristems and the root-hypocotyl junction are regions of strong nutrient enrichment, but that citric acid treatment has little effect on nutrient levels in these regions. Transcriptional analysis revealed major differences between primary roots and anchor roots in response to citric acid. In particular, citric acid acted as a reactive oxygen species (ROS) scavenger through increased Class III peroxidase transcription, effectively reducing H2O2 levels both in vitro and in vivo. Altering the ROS balance at the root-hypocotyl junction was sufficient to induce anchor root formation. Citric acid treatment also differentially upregulated lignin biosynthesis, lignin assembly, and ETHYLENE RESPONSE FACTOR 115 expression in primary roots and anchor roots. ETHYLENE RESPONSE FACTOR 115 regulates the quiescent center and root columella, and we found that citric acid treatment induces developmental defects in this tissue. Overall, this study reveals that a vital organic acid produced and secreted at relatively high concentrations has both widespread and specific effects on plant development and root architecture.

Also flagged:chromatinnucleosomesorganizationhistonebindingnucleosome
Journal Article 2026-05-01 No Snippets Kwon SY, Jang B, Grisan V, Liang Y, Reed MAC, Jung H, Lee YE, Halston R, Chan KH, Bottegoni G, Gunther UL, Wu C, Badenhorst P.
Show Full Abstract

The nucleosome remodeling factor (NURF) is a conserved imitation switch-containing ATP-dependent chromatin remodeling complex that slides nucleosomes to control transcription and genome organization. Recognition of histone modifications (HPTMs) by reader domains has been proposed to focus remodeler action at discrete genome targets, either by controlling recruitment or through local allosteric regulation of core enzymatic activities. To distinguish mechanisms by which HPTMs influence NURF, we defined the HPTM-binding specificity of NURF by screening novel combinations of histone-reader interactions. We observe the NURF-selective subunit (BPTF/NURF301) recognizes multiple H3 and H4 tail modifications via C-terminal PHD2 and bromodomains. Modified H3 recognition requires a new binding-pocket on PHD2 for H3K9AcS10p that cooperates with the known H3K4me3-binding hydrophobic cage to enable high-affinity binding to triply modified H3K4me3K9AcS10p. This combinatorial HPTM recognition discriminates and stabilizes NURF recruitment to +1 nucleosomes of active genes, maintaining nucleosome position to control transcription. Our data establish direct, causal links between HPTM recognition, remodeler recruitment, and consequent activity.

Also flagged:bindingchronic lymphocytic leukaemiaviral genomecoronavirus infectionsEnzyme ActivitySynthesis
Journal Article 2026-05-01 No Snippets Kollár L, Mihalovits LM, Bajusz D, Knez D, Simon J, Balcomb BH, Fearon D, Gobec S, Keserű GM.
Show Full Abstract

Linking of fragments in neighboring binding sites is one of the optimization strategies in fragment-based drug discovery, where additive or even more substantial bioactivity improvements can be realized. However, such efforts present a considerable challenge when one fragment binds covalently to the target protein, as small modifications can influence the correct positioning of the covalent warhead toward the targeted nucleophilic residue. Here, we present a case study of fragment linking that yielded single-digit micromolar, covalent inhibitors of the SARS-CoV-2 main protease, starting from fragments that were inactive in the biochemical assay. Using structural information from a recent, high-throughput crystallographic fragment screen, we show that the success of fragment linking in the design of targeted covalent inhibitors is heavily impacted by several factors, including the warhead type, the labeling chemistry, and even subtle changes in the designed linker. Notably, we observe that induced fit effects might override the original fragment orientations in the linked molecule, highlighting the need for reliable structure verification, especially in consecutive rounds of fragment elaboration.

BTN2A1
Also flagged:Lung cancercancerlung adenocarcinomaLUADlung squamous cell carcinomaLUSC
Journal Article 2026-05-01 ✓ 5 Snippets Geng X, Xue J, Liu K, Song Z, Wang Y, Cao X, Li Z, Chen L.
In-Text Gene Mentions

…Ig-like lectin 1 (BTN2A1/SIGLEC1; OR 0.850, 95%…

…FinnGen and theBTN2A1–LUSC association in TRICL-ILC…

…indicate that bothBTN2A1/SIGLEC1 and LAYN/ULBP2 are…

…Vγ9Vδ2 T cells,BTN2A1has been reported…

…body mass indexBTN2A1butyrophilin subfamily 2…

Show Full Abstract

Lung cancer remains the leading cause of cancer-related mortality worldwide, with major subtypes including lung adenocarcinoma, lung squamous cell carcinoma (LUSC), and small cell lung cancer, yet the causal role of plasma protein-protein ratios in subtype-specific development remains poorly understood. We performed a bidirectional, two-sample Mendelian randomization (MR) analysis to assess the causal effects of plasma protein-protein ratios on lung cancer. Genetic instruments for protein-protein ratios were derived from a large-scale proteomic genome-wide association study, and lung cancer summary statistics were obtained from the FinnGen and Transdisciplinary Research in Cancer of the Lung and International Lung Cancer Consortium databases. Our study identified 17 plasma protein-protein ratios associated with lung cancer across both databases, including 5 for overall lung cancer (LC), 4 for lung adenocarcinoma, 5 for LUSC, and 4 for small cell lung cancer. Notably, a higher melanoma inhibitory activity (MIA)/DAN family BMP antagonist ratio was associated with increased risk for both LC and LUSC. When analyzing the constituent proteins of these ratios individually, only the causal association between MIA and LC remained significant. Subsequent 2-step MR analysis revealed that the MIA/DAN family BMP antagonist ratio mediated the effect of body mass index on LUSC development, with consistent mediation proportions across both databases (13.46%, 95% confidence interval: 3.14%-23.77% in FinnGen; 9.26%, 95% confidence interval: 0.05%-18.47% in Transdisciplinary Research in Cancer of the Lung and International Lung Cancer Consortium). Additional exploratory mediation pathways were identified for smoking initiation and body mass index; however, these findings should be interpreted with caution, given the assumptions underlying 2-step MR and the exploratory nature of the analysis. Multiple sensitivity analyses confirmed the robustness of these findings. This MR study offers novel proteomic insights into lung cancer pathogenesis and identifies candidate protein-protein ratios that warrant further functional investigation to assess their therapeutic potential.

TNFSF4
Also flagged:colorectal cancertumorimmune responsesautoimmune diseasestumorsGene Expression
Journal Article 2026-05-01 ✓ 2 Snippets Liu B, Li H, Hao M, Liu X, Yuan D, Huang W, Li W, Zeng J, Zhu Y, Ding L.
In-Text Gene Mentions

…TNFRSF25 , andTNFSF4compared to the…

…TNFRSF25 , andTNFSF4.…

Show Full Abstract

Colorectal cancer (CRC) is characterized by high incidence and mortality rates. Early identification of high-risk CRC patients and timely intervention are crucial for reducing mortality rates. This study aims to develop a prognostic model incorporating immune-related genes using 101 machine learning algorithms. We utilized data from 630 CRC patients in The Cancer Genome Atlas Program database and the Gene Expression Omnibus database as a validation set. We identified immune-related genes from the ImmPort repository and conducted differential gene expression analysis. We developed 101 machine learning models, including random survival forest, elastic net, LASSO, Ridge regression, stepwise Cox, Coxboost, partial least squares regression for Cox, supervised principal component analysis, generalized boosted modeling, and survival support vector machines. The model with the highest mean concordance index was selected as the optimal prognostic model. The Ridge regression model demonstrated the most robust performance with a mean concordance index of 0.67. Patients with higher immune-related gene risk score (IRGRS) had significantly lower survival rates (log-rank test, P < .001). Univariate and multivariate Cox regression analyses confirmed IRGRS as an independent prognostic factor. Nomograms successfully predicted overall survival at 1, 2, and 3 years. IRGRS correlated with immune cell infiltration levels and stromal activity in the tumor microenvironment. High IRGRS scores were associated with higher tumor immune dysfunction and exclusion scores, suggesting potential differences in response to immune checkpoint inhibitors. In addition, high IRGRS patients exhibited greater sensitivity to certain chemotherapy drugs. The IRGRS score is a potent predictor of survival in CRC patients. This study offers a new perspective for CRC prognosis and supports the development of personalized treatment strategies.

ZBTB37CACNA1E
Also flagged:Gene expressionchromatinpsychiatric disordersMajor Depressive DisorderSchizophreniatranslational
Journal Article 2026-05-01 ✓ 2 Snippets Liu S, Zhao X, Wei Z, Carr DF, Moraros J.
In-Text Gene Mentions

…seven candidate genes:Cacna1e, Map1a, Gnas, Arc,…

…Specifically, ADARB1 andZBTB37were identified among…

Show Full Abstract

N  6-methyladenosine (m6A), the most prevalent internal RNA modification, is an emerging key regulator of gene expression in the central nervous system, and its dysregulation is connected to psychiatric disorders. However, disentangling the causal links between specific m6A sites and diseases phenotypes remain challenging. This review presents a comprehensive survey of practical bioinformatics strategies to address it. Our review outlines four analytical themes: (i) the reliable calibration of false-positive signals, (ii) causal inference via statistical genetics, (iii) the acquisition of cell-type-specific functional insights, and (iv) the application of machine learning to predict clinical biomarkers. We validate these analytical strategies through a case study in major depressive disorder, specifically by intersecting m6A effects with psychiatric genetic risk. By streamlining these workflows, we provide a roadmap for formulating testable hypotheses regarding epitranscriptome-targeted therapeutic interventions in psychiatric disorders.

SERPINC1
Also flagged:Extracellular vesiclesneurodegenerative diseasesbehavioralcognitive impairmentpathogenesisextracellular
Journal Article 2026-05-01 ✓ 5 Snippets Hutson HK, Qin G, Cai C, Nestorova GG.
In-Text Gene Mentions

…APOB, APOE, C7,SERPINC1, and THBS1), reflecting…

…of protease inhibitors (SERPINC1, SERPINE1, SERPINB3, SERPINF2…

…family members (SERPINA7,SERPINC1, SERPINF1) and coagulation…

…hibitors (ITIH2/3/4, SERPINF2,SERPINC1), reflecting active metabolic…

…eptidase inhibitors (SERPINA7,SERPINC1, SERPINF1), coagulation facto…

Show Full Abstract

<b>Background:</b> Extracellular vesicles (EVs) mediate intercellular communication in the central nervous system and are a major source of biomarkers. This study characterizes the EV-derived proteome secreted by human endothelial brain cells (HEBCs), astrocytes, and neurons to identify cell-specific roles in intercellular communication in the brain. <b>Methods:</b> Mass spectrometry analyses of EVs and corresponding parent cells were performed to identify differentially enriched proteins. Gene Ontology (GO) analysis of statistically significant, abundantly expressed proteins between EVs and parent cells (log<sub>2</sub> fold-change ≥ 2.0, <i>p</i> < 0.05) was performed to assess cell-specific functions. <b>Results:</b> Proteome analysis identified on average 932 proteins in astrocyte EVs (versus 1725 in parent cells), 1040 in HEBC EVs (versus 5451 in parent cells), and 470 in neuronal EVs (versus 578 in parent cells). The analysis indicated that astrocytes had the highest number of significantly abundant proteins (118), followed by HEBCs (24) and neurons (25). Astrocyte EVs were enriched in lipoproteins, complement factors, and protease inhibitors; HEBCs EVs in tight junction proteins, adhesion molecules, and protease regulators; and neuronal EVs in chromatin-associated histones, tubulin isoforms, and RNA-binding proteins. <b>Conclusions:</b> The proteomic signatures of EVs from different neurovascular unit cells suggest specialized roles in blood-brain barrier homeostasis, immune regulation, and synaptic and epigenetic signaling under healthy conditions. These baseline signatures provide a framework for future studies to investigate how brain cell-derived EVs may contribute to neurodegenerative disorders.

POU3F2
Also flagged:gene expressionchromatinhistone modificationsbindingchronic myelogenous leukemialiver cancer
Journal Article 2026-05-01 ✓ 1 Snippet DeGroat W, Kreimer A.
In-Text Gene Mentions

…10 −182 ),POU3F2(FDR = 7.21…

Show Full Abstract

Enhancers are cis-regulatory elements that drive context-specific gene expression, yet their target genes and modes of action remain largely unresolved. Because most disease-associated variants lie in non-coding regulatory DNA, accurate, cell type-specific enhancer-gene (E-G) mapping is essential for understanding genetic risk. However, current E-G prediction frameworks lack the resolution to capture such context-specific interactions. Massively parallel reporter assays (MPRAs) provide measurements of cis-regulatory activity, but their integration into genome-scale E-G models has been limited. Here, we introduce MPRabc, an MPRA-informed model that improves E-G interaction prediction. MPRabc integrates predicted MPRA activity, sequence-derived regulatory features, epigenomic signals, and three-dimensional chromatin contact maps with clustered regularly interspaced short palindromic repeats-based perturbation training data. Benchmarking against validated regulatory interactions shows that MPRabc outperforms state-of-the-art models. We generated high-resolution E-G networks for K562, HepG2, and human induced pluripotent stem cell (hiPSC) cell lines and applied a graph-based framework to identify regulatory architecture, map trait-associated variants and expression quantitative trait loci, and resolve transcription factor drivers of enhancer activity. Across contexts, we accurately recovered lineage-defining regulatory programs, including GATA1::TAL1 in K562, HNF1A/B in HepG2, and POU factor circuits in hiPSCs. Together, these results establish MPRA-informed modeling as a scalable strategy for decoding enhancer function and linking non-coding variants to gene regulatory mechanisms across cellular contexts.

PRDX6
Also flagged:metabolismhead and neck squamous cell carcinomacancerHNSCCgene expressionphosphate
Journal Article 2026-05-01 ✓ 3 Snippets Lu D, Liang Y, Mo T, Arikin A.
In-Text Gene Mentions

…C tissues.<h4>Results</h4>SMS,PRDX6, GSTO1, and ADA…

…tumor group, whereasPRDX6showed no significant…

…bolism-related signature (SMS,PRDX6, GSTO1, ADA) was…

Show Full Abstract

<h4>Background</h4>Impaired metabolism of branched-chain amino acids (BCAAs) has been linked to cancer progression; however, the specific mechanisms underlying BCAA metabolism in head and neck squamous cell carcinoma (HNSCC) remain unclear. This study aimed to identify prognostic genes associated with BCAA metabolism in HNSCC and elucidate their functional roles.<h4>Methods</h4>HNSCC-related datasets (TCGA-HNSCC, GSE65858, GSE41613, GSE103322, and GSE140042) were analyzed, and candidate genes were identified by intersecting differentially expressed genes from differential expression analysis with key module genes associated with BCAA metabolism-related gene (BCAA-MRG) scores from weighted gene coexpression network analysis. Prognostic genes were subsequently selected to construct a risk model using univariate Cox regression analysis, proportional hazards testing, and least absolute shrinkage and selection operator regression. Independent prognostic analysis, enrichment analysis, and immune microenvironment assessment were subsequently performed. Moreover, single-cell RNA sequencing (scRNA-seq) and pseudotime analysis were used to evaluate prognostic gene expression at the cellular level. RT-qPCR was used to validate gene expression levels in HNSCC tissues.<h4>Results</h4>SMS, PRDX6, GSTO1, and ADA were identified as prognostic genes for the risk model. The HNSCC samples were stratified into a high-risk group (HRG) and a low-risk group (LRG), with LRG showing notably better survival outcomes. A nomogram model based on risk score and age demonstrated excellent predictive performance for patients with HNSCC. Furthermore, enrichment analysis revealed that the pentose phosphate pathway and fructose and mannose metabolism were substantially associated with HNSCC progression. Differences in the infiltration levels of 20 immune cell types (including plasmacytoid dendritic cells, mast cells, and T follicle helper cells) and the expression of 10 immune checkpoints (such as CD276, CD27, and CD40) were observed between HRG and LRG. Epithelial cells, which exhibited higher expression of prognostic genes, were highlighted as key cells. Notably, the expression trends of these genes varied across different cell differentiation stages. RT-qPCR validation revealed that SMS, GSTO1, and ADA were highly expressed in the tumor group, whereas PRDX6 showed no significant difference between the tumor and normal tissues.<h4>Conclusion</h4>A four-gene BCAA metabolism-related signature (SMS, PRDX6, GSTO1, ADA) was identified that stratifies patients with HNSCC into distinct risk groups with different survival and immune microenvironments. The model suggests BCAA-immune interactions, specifically in epithelial cells, provide preliminary insights for prognosis and therapy. Nevertheless, these conclusions are mainly based on computational predictions, and the small RT-qPCR cohort limits experimental validation strength; thus, further studies are needed to confirm these findings.

HTT
Also flagged:dystoniaChildhood-onset dystonianeurotransmissiongene expression
Journal Article 2026-05-01 ✓ 1 Snippet Yilmaz S, Serdaroglu E, Simsek E, Kara B, Turkdogan D, Yis U, Erol I, Yuksel D, Kanmaz S, Eroglu A, Canpolat M, Komur M, Cıtak Kurt N, Sakarya Gunes A, Soydemir D, Besen S, Bektas O, Kirik S, Atalay Celik H, Ardicli D, Aksoy A, Yarar C, Cerci Kubur C, Olgac Dundar N, Gungor O, Kamasak T, Olculu CB, Gumus H, Yildirim M, Isik E, Atik T, Cogulu O, Basak AN, Sunnetci Akkoyunlu D, Özbakır DH, Kayhan G, Gerik Çelebi HB, Karaer K, Dundar M, Kaiyrzhanov R, Ceylaner S, Per H, Hiz AS, Cansu A, Okuyaz C, Anlar B, Tekgul H.
In-Text Gene Mentions

…COL6A3, DNM1L, GNB1,HTT, PRKRA, PRRT2, RHOBTB2,…

Show Full Abstract

<h4>Background</h4>Childhood-onset dystonia (COD) encompasses a clinically and etiologically heterogeneous group of disorders, often with overlapping features. Genetic testing plays a pivotal role in uncovering underlying causes, identifying treatable subtypes, and informing individualized management strategies.<h4>Objective</h4>To delineate the molecular genetic etiology, phenotypic characteristics, and treatment strategies in a multicenter cohort with gene-related CODs.<h4>Methods</h4>The study cohort comprised 81 patients with gene-related COD from 19 tertiary pediatric neurology centers in Turkiye. Clinical phenomenology, biochemical, electrophysiological, neuroimaging findings, diagnostic genetic tests, causative genes and variants, inheritance patterns, gene-related phenotypes, treatment modalities, and their efficacy were gathered.<h4>Results</h4>A diverse genetic landscape was identified in the cohort of 81 patients, revealing 62 distinct (pathogenic/likely pathogenic) variants across 26 genes. The genetic diagnoses were established through whole-exome sequencing (49.4%), single-gene testing (25.9%), and targeted gene panels (23.5%). Of the 81 patients, 59 had single-nucleotide variants (SNVs), 21 had deletions or duplications, and one patient carried a pathogenic trinucleotide repeat expansion. The common etiologies of gene-related COD were KMT2B (16%), GCH1 (11.1%), SLC2A1 (11.1%), GNAO1 (8.6%), TOR1A (8.6%), GNAL (6.2%). Rare etiologies were SLC18A2 and TH (each 4.9%), ATP1A3, NKX2-1, PRKN, SCN4A, THAP1 (each 2.5%), and ultra-rare etiologies (single patients) were: ACY5, ADPRS, ANO3, COL6A3, DNM1L, GNB1, HTT, PRKRA, PRRT2, RHOBTB2, SETX, SLC6A3, TUBB4A (1.2%). Based on Gene Ontology classification, the most represented functional categories were neurotransmission (n = 18, 22.2%), gene expression (n = 17, 20.9%), and signaling (n = 14, 17.3%). Genetic diagnosis influenced treatment modalities with pharmacotherapy modification or implementation of deep brain stimulation in 60.5% of the cohort, with targeted therapies being more effective than symptomatic treatments (p = 0.0118).<h4>Conclusion</h4>This nationwide study highlights the phenotypic and genetic diversity of gene-related COD with certain therapeutic implications based on the molecular etiology-specific diagnosis.

Also flagged:origins of replicationforkscell cyclereplisomechromosomeschromosome
Journal Article 2026-05-01 No Snippets Jomaa H, Assaf R.
Show Full Abstract

Origins of DNA replication (Ori) are genomic loci where DNA synthesis begins, essential for bacterial viability, eukaryotic development, and genome integrity. While early computational methods relied on compositional skews and motif heuristics, recent years have seen a shift toward artificial intelligence approaches. This review systematically surveys Ori prediction methods published through August 2025, integrating biological background with curated datasets, benchmarks, and a classification of computational strategies from rule-based models to deep learning. We summarize performance across organisms, cell types, and platforms, and highlight key trends, challenges, and opportunities in benchmarking, interpretability, and cross-species generalization-providing both an accessible entry point for practitioners and a roadmap for future methodological development.

DARS2
Also flagged:leukodystrophiesmyelinmetachromatic leukodystrophyMLDKrabbe's diseaseN-acetylaspartate
Journal Article 2026-05-01 ✓ 3 Snippets Ruffini ML, Pereira DA, Helmer RS, Souza AM, Lima BS, Baccarin G, Yamada GK, Borella LFM, Turci RD, Duarte JÁ, Reis F.
In-Text Gene Mentions

…caused by biallelicDARS2mutations that disable…

…on detecting pathogenicDARS2variants, supplemented by…

…mitochondrial machinery (DARS2, L2HGDH )…

Show Full Abstract

<h4>Background</h4>Leukodystrophies are inherited disorders that primarily affect the central nervous system white matter and often present with nonspecific symptoms, making early diagnosis difficult. Magnetic resonance imaging (MRI) is the key initial imaging test because it reveals characteristic myelin patterns that can guide biochemical and genetic workups.<h4>Objective</h4>To review clinically useful MRI and MR spectroscopy (MRS) patterns in major leukodystrophies and emphasize their diagnostic relevance using a practical, pattern-recognition approach.<h4>Methods</h4>Narrative review of the literature integrating conventional MRI, including T1/T2 fluid-attenuated inversion recovery (FLAIR), and diffusion-weighted imaging (DWI), as well as advanced techniques (MRS), with a pictorial, case-based approach.<h4>Results</h4>The pivotal imaging distinction is between hypomyelination-diffuse, persistent T2/FLAIR hyperintensity with relative temporal stability and absent enhancement-and demyelination, characterized by confluent, progressive lesions with disorder-specific topographic predilection. Recognizable signatures include U-fiber sparing and a tigroid pattern in metachromatic leukodystrophy (MLD); parieto-occipital predominance with trizonal enhancement and restricted diffusion in X-linked adrenoleukodystrophy (X-ALD); frontal predominance and the "tadpole sign" in Alexander's disease; optic pathway and thalamic involvement in Krabbe's disease; markedly elevated N-acetylaspartate (NAA) on MRS in Canavan's disease; and tract-selective leukoencephalopathy brainstem/spinal cord involvement with a lactate peak (LBSL). These imaging clues refine differential diagnosis, guide targeted genetic testing, and support longitudinal monitoring.<h4>Conclusion</h4>The use of MRI-especially when complemented by DWI and MRS-remains central for early recognition and classification of leukodystrophies. A structured, pattern-based approach integrating clinical context with imaging topography can reduce diagnostic delay and support timely management.

Also flagged:NAFLDpathogenesisnon-alcoholic fatty liver disease
Journal Article 2026-05-01 No Snippets Wei C, Pan X, Liu Y, Huang Z, Wei J, Luo J, Luo M.
Show Full Abstract

<h4>Objectives</h4>The prevalence of non-alcoholic fatty liver disease (NAFLD) in obese children has been increasing year by year. Its pathogenesis involves the joint effects of genes and gut microbiota, but their interaction effects remain unclear. This study aims to investigate the associations of gene polymorphisms, gut microbiota, and their interactions with NAFLD in obese children, thereby providing new clues for research on the pathogenesis of NAFLD in this population.<h4>Methods</h4>A case-control study was conducted. A total of 87 obese children with NAFLD who visited Hunan Children's Hospital from January 2020 to September 2021 were selected as a case group, and 50 obese children without NAFLD who visited the hospital during the same period were selected as a control group. Polymorphisms in 52 candidate genes were detected using multiplex polymerase chain reaction and high-throughput sequencing, and the composition of the gut microbiota was analyzed using 16S ribosomal DNA (16S rDNA) sequencing. Logistic regression was used to analyze the associations between candidate gene polymorphisms and NAFLD in obese children, and the Benjamini-Hochberg method was applied for false discovery rate (FDR) correction in multiple comparisons, with an expected FDR of 0.05. Linear discriminant analysis effect size (LEfSe) analysis was used to compare the relative abundance of gut microbiota at the genus level. Logistic regression models, crossover analysis, and generalized multifactor dimensionality reduction (GMDR) were used to explore two-factor gene-microbiota interactions and the associations of higher-order multifactor interactions with the risk of NAFLD in obese children.<h4>Results</h4>After adjustment for sex, age, and body mass index, <i>PRKAB1</i> rs6490265 and <i>IL32</i> rs28372698 were both significantly associated with NAFLD in obese children (both <i>P</i><0.05). <i>IL32</i> rs28372698 remained statistically significant after FDR correction, under both the dominant and additive models (<i>P</i><sub>adj</sub>=0.035), whereas PRKAB1 rs6490265 showed no significant differences in any model after FDR correction. Compared with the control group, <i>Escherichia-Shigella</i>, <i>Enterobacter</i>, <i>Bacteroides</i>, <i>Klebsiella</i>, <i>Dialister</i>, and <i>Erysipelotrichaceae_UCG_003</i> were significantly enriched in the NAFLD group (all <i>P</i><0.05). Compared with the NAFLD group, <i>Intestinibacter</i>, <i>Coprococcus</i>, <i>Ralstonia</i>, <i>Ligilactobacillus</i>, <i>Fusicatenibacter</i>, <i>Sarcina</i>, <i>Eubacterium_eligens_</i>group, and <i>Pseudomonas</i> were significantly enriched in the control group (all <i>P</i><0.05). Multiplicative interaction analysis showed that the interaction terms between <i>PRKAB1</i> rs6490265 and <i>Bacteroides</i>, between <i>PRKAB1</i> rs6490265 and <i>Intestinibacter</i>, and between <i>IL32</i> rs28372698 and <i>Ligilactobacillus</i> were statistically significant (all <i>P</i><0.05). GMDR higher-order interaction analysis showed that the interaction among <i>IL32</i> rs28372698, <i>Ligilactobacillus</i>, and <i>Intestinibacter</i> was the best model.<h4>Conclusions</h4>Polymorphisms in <i>PRKAB1</i> and <i>IL32</i> may be potentially associated with the risk of NAFLD in obese children. The antagonistic interaction effects between <i>PRKAB1</i> rs6490265 and the abundance of <i>Bacteroides</i> and <i>Enterobacter</i>, as well as the synergistic interaction effect between <i>IL32</i> rs28372698 and the abundance of <i>Ligilactobacillus</i>, may jointly influence the risk of NAFLD in obese children.

bioRxiv 2026-05-01 Preprint (No Snippets API) Madhukaran S, Fomina Y, Balagannavar G, Payne E, Wilson J, Wang L, Hon G, Florian Rodriguez M, Mahendroo M.
Show Full Abstract

<h4>SUMMARY</h4> Development of the female reproductive tract in mice occurs in early postnatal life. The current model identifies Trp63 as the master regulator that initiates differentiation of simple columnar Keratin 8+ epithelium in the cervix and vagina into a stratified squamous epithelium. Thereafter Trp63+ basal progenitors maintain cervicovaginal epithelial cell homeostasis and in the adult serve as the progenitor for hormone-regulated shifts in stratified squamous and secretory luminal cells. This model differs from the human in which two progenitors, one columnar and the other basal gives rise to secretory cells in the endocervix and stratified squamous epithelia in the ectocervix and vagina respectively. In the current study, we identify a population of Krt8+, Tp63- epithelial cells that are retained in the cervicovaginal epithelium during the postnatal developmental period and into adulthood. Single cell datasets from the cervices of adult mice, identify Olfactomedin 4 (Olfm4), as a unique marker of the Krt8+Trp63- population. Adult lineage tracing and reassessment of gene markers during postnatal development support a revised model in which two progenitors are delineated in the mouse cervix and vagina by PND15. Olfactomedin 4+ progenitors give rise to specialized secretory goblet cells, while Trp63+ basal progenitors give rise to stratified squamous luminal cells in the cervix and vagina of nonpregnant and pregnant mice. Consistent with the expansion of goblet cells in pregnancy, the Olfm4+ progenitor is highly proliferative in early pregnancy and progesterone regulates increased goblet cell differentiation. These findings reveal a previously unrecognized species similarity between mice and humans in which goblet cell and squamous keratinized cell subtypes are derived from two progenitor populations respectively. <h4>HIGHLIGHTS</h4> Two epithelial progenitors (Trp63 and Olfm4) populations are delineated in the cervix and vagina within the first two weeks of postnatal life. The Trp63+ progenitor gives rise to keratinized epithelial cells, whereas the Olfm4+ progenitor cells give rise to secretory goblet cells. lfm4 is not required for maintenance of the luminal progenitor or differentiation of goblet cells in the cervix and vagina during adulthood and pregnancy. In adults, progesterone promotes differentiation of Olfm4+ progenitors into goblet cells.