Gene Literature Dashboard

Viewing July 2026 — 575 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← June 2026 August 2026 →
Also flagged:chromosomeorganizationheterochromatinsatellitomeschromosomeskinetochore
Journal Article 2026-07-31 No Snippets Calegari LM, Milani D, Bardella VB, Hickmann F, Cabral-de-Mello DC.
Show Full Abstract

Satellite DNAs (satDNAs) are a major component of eukaryotic genomes, playing key roles in chromosome organization, heterochromatin formation, and genome evolution. Although satellitomes have been increasingly characterized in insects, most studies focus on monocentric species, leaving holocentric systems comparatively understudied. Here, we investigate the satellitomes of two pentatomid bugs, Edessa meditabunda and Edessa loxdalii, which exhibit unusually large heterochromatin blocks for holocentric chromosomes. Using an integrative approach combining genome analysis and molecular cytogenetics, we identified 31 satDNA families shared between species. E. loxdalii shows higher satDNA abundance and lower sequence divergence, consistent with recent amplification and homogenization, whereas E. meditabunda exhibits lower abundance and higher divergence, suggesting more advanced sequence degeneration. SatDNA landscape analyses indicate distinct evolutionary trajectories, with evidence of multiple amplification waves and differential repeat turnover. Despite these differences, both species share a conserved set of satDNAs, including highly abundant families that dominate their satellitomes, supporting the library hypothesis. Compared to other Pentatomidae species with low heterochromatin content, there is no overall increase in satDNA abundance in Edessa, but rather amplification of specific families. Chromosomal mapping revealed that these amplified satDNAs are major components of terminal heterochromatin blocks, while less abundant families show chromosome-specific distributions, including accumulation on the Y chromosome, with signs of evolutionary differentiation between species. Overall, this study provides new insights into satellitome organization and evolution in Pentatomidae, highlighting the role of satDNAs in shaping chromosome architecture in holocentric systems.

DDX27
Also flagged:gastric cancercancerchronic gastritisImmune responseH. pylori infectionphosphorylation
Journal Article 2026-07-31 ✓ 5 Snippets Huang X, Ma J, Xiao Y, Pan J, Xu Q, Cao X, Liu Y, Yi X, Tian F.
In-Text Gene Mentions

…unique peptides, includingDDX27(17), EBNA1 BP2…

…algorithm were NIP7,DDX27, EBNA1 BP2, WDR3,…

…4 hub genes--DDX27, EBNA1 BP2, MAK16,…

…4 hub proteins--NIP7,DDX27, EBNA1 BP2, WDR3,…

DDX27is a DEAD-box…

Show Full Abstract

<h4>Background</h4>Helicobacter pylori (H. pylori) infection is the principal etiological factor for gastric cancer (GC), which ranks as the fourth leading cause of cancer-related mortality globally. Although the Correa cascade describes the stepwise progression from chronic gastritis to intestinal-type GC, the molecular events underlying this "inflammation-to-cancer" transition remain incompletely characterized.<h4>Objective</h4>This study aimed to delineate stage-specific proteomic alterations across H. pylori-associated gastric mucosal lesions and to identify candidate progression-associated biomarkers in GC.<h4>Methods</h4>Label-free quantitative proteomic analysis (LC-MS/MS) was performed on gastric tissue specimens from 22 patients stratified into four histopathological stages: H. pylori-negative chronic non-atrophic gastritis (HpN-CG), H. pylori-positive chronic non-atrophic gastritis (HpC-CG), H. pylori-positive chronic atrophic gastritis (HpC-CAG), and intestinal-type GC. Functional enrichment (GO, KEGG), temporal clustering (Mfuzz), and protein-protein interaction (PPI) network analyses were conducted. Key hub genes were externally assessed using GEPIA RNA-seq data from TCGA and GTEx.<h4>Results</h4>A total of 6,019 proteins were quantified. Differential expression analysis identified 771 DEPs between HpC-CG and HpN-CG, 101 DEPs between HpC-CAG and HpC-CG, and 535 DEPs between GC and HpC-CAG. Immune response pathways were up-regulated upon H. pylori infection, whereas oxidative phosphorylation was progressively suppressed throughout disease progression. Mfuzz clustering revealed that Cluster 4 ribosome-biogenesis proteins, including NIP7 and PDCD11 identified in the proteomic/PPI analysis, exhibited continuous up-regulation from precancerous stages to GC. External RNA-expression validation supported significant up-regulation of seven Cluster 4 hub genes, whereas Cluster 6 proteins did not show concordant transcript-level down-regulation.<h4>Conclusion</h4>This study provides a comprehensive proteomic landscape of H. pylori-driven gastric carcinogenesis. Cluster 4 ribosome-biogenesis proteins represent candidate progression-associated protein markers requiring further protein-level validation, while the progressive decline in oxidative phosphorylation underscores mitochondrial dysfunction as a hallmark of disease progression.

SOX6
Also flagged:obesitygene expressionhypomethylationmitochondrialmetabolismDiabetes
Journal Article 2026-07-31 ✓ 3 Snippets Pileggi CA, Mohottalage D, Kennedy LS, Nikpay M, Hamilton LMK, Roffe M, Kanaan MN, Jarrar A, Kolozsvari N, Wang D, Cuperlovic-Culf M, Alain T, Steinberg GR, McPherson R, Dent R, Harper ME.
In-Text Gene Mentions

…cell differentiation factor,SOX6, and the…

…with MMP2 ,SOX6, JAK2 ,…

…, MMP2 ,SOX6, JAK2 ,…

Show Full Abstract

<h4>Background</h4>Understanding how skeletal muscle responds to weight loss is crucial for developing targeted strategies to manage obesity and promote sustained improvement in metabolic health. Here, we investigated the molecular mechanisms underlying skeletal muscle reprogramming of gene expression and metabolic activity following Roux-en-Y gastric bypass (RYGB).<h4>Methods</h4>Forty-one women were studied before and one year after RYGB surgery. We leveraged multi-omics (DNA methylomics and transcriptomics) and machine learning approaches to complement muscle metabolic analyses and clinical data to identify mechanisms underlying RYGB-induced muscle metabolic reprogramming.<h4>Findings</h4>RYGB markedly decreased body weight and fat mass and improved metabolic health. Integrative analysis of vastus lateralis muscle identified 8233 genes with differentially methylated regions and 2173 differentially expressed genes post-RYGB surgery, of which 1197 genes were both differentially methylated and differentially expressed. Promoter hypomethylation was associated with the enhanced expression of transcription factors involved in skeletal muscle development and ribosomal subunits. In contrast, expression of genes encoding mitochondrial proteins decreased despite increases in mitochondrial content and enhanced mitochondrial function in skeletal muscle post-RYGB. Pre-operative muscle OXPHOS capacity, and expression of skeletal muscle hypertrophy and differentiation genes MYOC and EHMT2 were associated with weight loss success.<h4>Interpretation</h4>RYGB improves systemic metabolic health and induces sustained skeletal muscle bioenergetic reprogramming characterised by enhanced expression of genes involved in myogenesis and protein translation, but decreased expression of genes involved in mitochondrial metabolism, which may reflect improved mitochondrial quality and function. These findings advance our understanding of skeletal muscle metabolic responses to weight loss and of individual variability in metabolic phenotypes.<h4>Funding</h4>Canadian Institutes of Health Research (CIHR PJT183651-M-EH, 201709FDN-CEBA-116200-GRS), Diabetes Canada Investigator Award grant OG-3-22-5645-GS (GRS), J. Bruce Duncan Endowed Chair in Metabolic Diseases (GRS), Tier 1 Canada Research Chair in Mitochondrial Bioenergetics and Metabolic Health (M-EH), Tier 1 Canada Research Chair in Metabolic Diseases (GRS).

Also flagged:Ovarian cancertumorinflammatory responsescell proliferationangiogenesisepithelial-to-mesenchymal transition
Journal Article 2026-07-31 No Snippets Lee J, Yeo SG, Kim HO, Lee JM, Singh MK, Kim SS, Oh TI, Park DC.
Show Full Abstract

Ovarian cancer is often diagnosed at an advanced stage because its early symptoms are nonspecific, and the prognosis remains poor due to frequent recurrence and the development of drug resistance even after standard treatment. This review includes 19 <i>in vitro</i> studies and seeks to mechanistically summarize how reactive oxygen species (ROS) reinforce the tumorigenic program from the early stages of ovarian carcinogenesis to tumor progression, metastasis, and treatment resistance. Collectively, the selected studies suggest that exposure to environmental toxicants can increase ROS levels in ovarian epithelial cells, accompanied by inflammatory responses and elevated DNA damage markers, thereby creating a carcinogenesis-priming environment. During the progression stage, hypoxia, hormones, growth factors, and lipid signaling repeatedly activate survival and growth pathways, such as those involving HIF-1α/VEGF, JAK/STAT3, and AKT/mTOR, through ROS-mediated mechanisms to promote tumor cell proliferation, anti-apoptotic activity, and angiogenesis. In addition, ROS are associated with alterations in epithelial-to-mesenchymal transition-related markers, remodeling of the extracellular matrix, and regulation of matrix metalloproteinases, which enhance the metastatic and invasive potential of tumor cells. In the therapeutic context, ROS have been suggested to contribute to platinum-based chemotherapy resistance through mechanisms including changes in mitochondrial dynamics, activation of the DNA damage response, and reprogramming of ROS-dependent phosphorylation networks. Understanding the diverse molecular mechanisms and clinical manifestations associated with ROS expression in high-grade serous ovarian cancer (HGSOC) will contribute to a more precise understanding of its pathophysiology. Furthermore, studies on redox-targeted therapeutic strategies, particularly the application of mitochondria-targeted antioxidants, may provide valuable translational insights for the treatment of ovarian cancer and other ROS-related diseases.

HTT
Also flagged:bindingHDpathogenesisaxonalnucleofectionSynthesis
Journal Article 2026-07-31 ✓ 5 Snippets Maffezzini C, Iennaco R, Scolz A, Maestri S, Landles C, Osborne GF, Bronzini MM, Trovesi C, Carzaniga T, Casiraghi L, Ramirez JQ, Vogt TF, Felsenfeld DP, Bellini T, Zuccato C, Bates GP, Cattaneo E.
In-Text Gene Mentions

…Alternative processing ofHTTpre-mRNA generates the…

…huntingtin gene (HTT), which comprises…

…reduction in full-lengthHTTtranscripts, shifting expressi…

…the PRD inHTTaggregation 7 ,…

HTTexon 1 constructs…

Show Full Abstract

Expansion of CAG repeats in HTT exon 1 is the acknowledged driver of Huntington's disease. Alternative processing of HTT pre-mRNA generates the truncated HTT1a transcript, translated into a toxic peptide. While its dependence on CAG length is well documented, the role of adjacent sequences - particularly the Proline-Rich Domain (PRD) - remains unexplored. Using our HuntEx1-engineered mouse embryonic stem cell platform, we show that human PRD promotes HTT1a production, whereas its replacement with mouse PRD in an otherwise human exon 1 markedly reduces HTT1a levels. Mechanistically, we find that the PRD shapes mRNA structure, and motif analysis identifies Serine-Arginine Splicing Factor 7 (SRSF7) binding sites in mouse but not in human PRD. Their targeted mutation confirms SRSF7's regulatory role in suppressing HTT1a production. Our findings establish the PRD as a key cis-regulator of HTT1a biogenesis, demonstrating that HTT toxicity also depends on sequence context, and highlighting splicing-based, PRD-focused therapeutic avenues.

Research Square 2026-07-31 Preprint (No Snippets API) Das A, Ramesh V, Grover VK, Karamballi R, Majumdar P.
Show Full Abstract

<title>Abstract</title> <p> <bold>Background</bold> Genetic studies are conducted in athletic populations to understand the influence of genotype on phenotype, with the prospects of identifying talent, designing individualized training programmes, and predicting injuries in sports. Despite extensive research on improving water sports performance, the effects of various genetic polymorphisms on competitive performance remain unclear. <bold>Objective</bold> This systematic review aims to identify key gene variants associated with on-water sports and assess their influence on performance. <bold>Methods</bold> To fulfill this aim, a systematic search was conducted in Web of Science, Scopus, and PubMed until 6th October 2024, along with a secondary search of the included full-text articles. Studies examining the associations between genetic variants and on-water sports performance (rowing, canoeing, kayaking, sailing, surfing, and rafting) and meeting the Hardy‒Weinberg equilibrium criteria were included, and the risk of bias was determined. <bold>Results</bold> A total of 28 articles (6 high risk-of-bias) were included and reviewed (22 rowing, 4 kayaking, 5 canoeing, 1 each on surfing and rafting and none on sailing) that examined 17 different variants (ACE, ACTN3, AMPD1, CKMM, GABPB1, GDF8, HFE, HIF1A, MCT1, NOS3, PPARA, PPARGC1A, TFAM, UCP2, UCP3, VEGFR, and VEGFR2) from 8 different populations (Russians, Polish, Spanish, Brazilians, Hungarian, Australian, Turkish, and Chinese) associated with performance. The available evidence was inadequate for performing a meta-analysis and determining whether any of the genetic variants identified in this review were associated with sports performance. <bold>Conclusion</bold> Although several structural and functional genes and their polymorphisms have been identified that are associated with on-water sports performance, further collaborative genome-wide association studies and gene expression and gene‒gene interaction studies are needed in larger populations of different ethnicities to investigate additional possible genetic variants and the role of these gene polymorphisms in enabling success in sports. </p>

Research Square 2026-07-31 Preprint (No Snippets API) Vasudevan S, Prakash B, Shah I, Vendrell I, Fischer R, Foster R, Jagannath A.
Show Full Abstract

<title>Abstract</title> <p>Lithium is the gold standard mood stabiliser used to treat cycling mania and depression in bipolar disorder. Despite seven decades of clinical use, the mechanisms of its mood stabilisation are incompletely understood, fundamentally limiting development of improved alternatives. Two established lithium targets, glycogen synthase kinase 3β (GSK3β) and inositol monophosphatase, both modulate phosphorylation, suggesting lithium may exert broad effects on neuronal phosphorylation networks. We performed a discovery-phase in vitro screen of 140 kinases at 10mM LiCl and demonstrated that lithium inhibits 17 kinases beyond GSK3β. We therefore used untargeted quantitative phosphoproteomics to create a comprehensive map of lithium's phosphorylation signature in mouse synaptoneurosomes collected at dawn and dusk, matching peaks in phosphorylation driven by the sleep/wake cycle. Genes encoding lithium-sensitive phosphoproteins were significantly enriched in bipolar disorder genome-wide association studies, providing independent genomic evidence that these phosphorylation networks are relevant to bipolar pathophysiology. We further refined existing models of lithium’s action by showing that GSK3β inhibition is temporally restricted to dawn, indicating cross talk with sleep/wake cycles of phosphorylation. Overall, our data demonstrate that lithium’s pleiotropic effects may result from coordinated multi-kinase network reorganisation rather than single-target inhibition — a principle with direct implications for rational polypharmacology in mood stabiliser development.</p>

Also flagged:nucleusImportin 7IPO7nuclear transport receptorβ-karyopherinimport receptor
Journal Article 2026-07-30 No Snippets Palchevska O, Ko YH, Cingolani G.
Show Full Abstract

Importin 7 (IPO7) is a nuclear transport receptor of the β-karyopherin family that mediates the translocation of a broad spectrum of macromolecules, commonly referred to as cargoes. Discovered nearly three decades ago, IPO7 was initially identified as an import receptor for constitutive cellular cargoes, including histone H1 and ribosomal proteins, and was shown to function synergistically and partially redundantly with canonical receptors such as importin β1 and karyopherin β2. Over the past 15 years, however, accumulating evidence has established IPO7 as an important mediator of signal-dependent nuclear trafficking in response to extracellular stimuli, including cytokines, growth factors, and cellular stress. Thus, IPO7 has emerged as a versatile nuclear transport receptor that couples extracellular signaling to dynamic changes in nuclear composition and gene expression. Mechanistically, many IPO7 cargoes lack classical nuclear localization signals and instead contain noncanonical targeting motifs that directly engage IPO7. In several cases, phosphorylation-dependent conformational changes expose these motifs, promoting IPO7 binding and translocation through the nuclear pore complex. The expanding repertoire of IPO7 cargoes, including ERK, SMAD3, EGR1, GLI1, the glucocorticoid receptor, HIF-1α, YAP1, and RUNX2, highlights its prominent role at the interface of signaling and transcriptional control. Consistent with these functions, dysregulation of IPO7-mediated transport has been implicated in cancer, hypoxia, and other pathological states. Beyond cellular signaling, IPO7 also contributes to the nuclear trafficking of viral genomes and proteins. Here, we review the molecular mechanisms of IPO7-dependent nuclear import, emerging principles of cargo recognition, and pathways that regulate IPO7 activity during cellular signaling.

HFE
Also flagged:Telomereidiopathic pulmonary fibrosisinterstitial lung diseaseciliumpathogenesisextracellular
Journal Article 2026-07-30 ✓ 1 Snippet Mocci S, Littera R, Deidda S, Cannas F, Cocco C, Lorrai M, Mereu C, Murgia M, Nutile G, Lai F, Sanna C, Serventi L, Tosone G, Zedda E, Giuressi E, Lai S, Perra A, Floris M, Giglio S.
In-Text Gene Mentions

…haemochromatosis type 1 (HFE-related haemochromatosishaemochromatosis) disorders, a…

Show Full Abstract

<h4>Background</h4>Idiopathic pulmonary fibrosis (IPF) is a progressive interstitial lung disease in which both environmental exposures and genetic predisposition contribute to disease susceptibility. Studying the burden of rare variants in a genetically homogeneous founder population may help identify disease-associated alleles that are difficult to detect in more heterogeneous populations.<h4>Methods</h4>Whole exome sequencing was performed on 123 patients with IPF and 1110 unrelated controls from Sardinia (Italy). Variant prioritisations were conducted according to the American College of Medical Genetics (ACMG) guidelines. In parallel, gene burden of rare predicted loss-of-function variants was assessed using the Cohort Allelic Sums Test (CAST) algorithm to identify genes significantly enriched in IPF cases compared with controls.<h4>Results</h4>Pathogenic or likely pathogenic variants in known telomere-related genes were identified in 11.4% of patients. These variants were associated with younger age at diagnosis and a higher prevalence among never-smokers. CAST analysis identified a significant enrichment of loss-of-function variants in 82 genes, including <i>MUC5B</i> (OR=443.1, false discovery rate=3.7E-05), functionally related to cilium organisation and motility, with a significant overrepresentation of dynein-related genes.<h4>Conclusions</h4>This study supports the contribution of telomere-related variants to IPF susceptibility and suggests a possible role for rare variants affecting mucociliary pathways. Together, these findings broaden the current understanding of IPF biology in this cohort. The distinctive genetic background of the Sardinian population may have facilitated the identification of rare or population-specific variants, underscoring the potential value of founder populations in complex disease genetics.

Also flagged:Pancreatic ductal adenocarcinomaPDACcancersepithelial-mesenchymal transitionpancreatic cancercancer
Journal Article 2026-07-30 No Snippets Varadharaj V, Leon F, Krishna Kumar N, Nallasamy P, Raut P, Kaur AB, Arikath K, Petersen W, Rauth S, Gayen N, Alsafwani ZW, Mathivanan P, Marimuthu S, Mallya K, Bommideni M, Cox JL, Talmon GA, Grandgenett PM, Hollingsworth MA, DiMaio DJ, Grem JL, Batra SK, Ponnusamy MP.
Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is among the most lethal cancers, with over 83% of patients presenting metastases to vital organs such as the liver, lungs, and peritoneum. Although glycosylation has been established as a critical factor in PDAC development, little is known about the molecular underpinnings of organ-specific metastasis. In this study, we investigated the role of glycosyltransferases (GTs) in mediating PDAC metastatic organotropism. Through an unbiased transcriptomic screen, we identified distinct GT expression patterns in liver- and lung-tropic PDAC cells. Notably, GCNT3 and B3GNT3 were selectively upregulated in liver and lung-tropic cells, respectively. These mutually exclusive expression patterns were validated in human metastatic PDAC specimens, where GCNT3 was enriched in liver metastatic lesions and B3GNT3 in lung metastases. Proteomic profiling revealed that differential expression of these GTs is associated with epithelial-mesenchymal transition and glycoproteome remodeling in metastatic cells. Functional studies using in vitro assays, ex vivo organotypic cultures, and in vivo metastasis models demonstrated that loss of GCNT3 or B3GNT3 impairs the proliferation and survival of PDAC cells in their respective metastatic organ environments. Together, these findings uncover a glycosylation-based mechanism that facilitates organ-specific survival of metastatic PDAC cells and highlight glycosyltransferases as potential therapeutic targets for disrupting metastatic adaptation.

HTT
Also flagged:Huntington's DiseaseHDautosomal dominant neurodegenerative disordertranslationalgene-silencingautophagy
Journal Article 2026-07-30 ✓ 1 Snippet Semwal BC, Singh K, Sharma R, Sharma D, Sharma A, Jain D, Sharma MC.
In-Text Gene Mentions

…expansion in theHTTgene, resulting in…

Show Full Abstract

Huntington's disease [HD] is a progressive, autosomal dominant neurodegenerative disorder caused by a pathogenic CAG repeat expansion in the HTT gene, resulting in mutant huntingtin [mHTT] protein accumulation, neuronal dysfunction, and selective neurodegeneration. Current pharmacological management remains largely symptomatic, with no approved therapies capable of modifying disease progression. In recent years, however, significant advances in molecular neuroscience and translational medicine have accelerated the development of disease-modifying strategies targeting the underlying pathogenic mechanisms of HD. This review synthesizes emerging pharmacological therapies with a particular focus on insights derived from recent and ongoing clinical trials. Key therapeutic approaches discussed include gene-silencing technologies such as antisense oligonucleotides, RNA interference, and CRISPRCas9- based strategies, as well as small-molecule modulators targeting mutant huntingtin aggregation, proteostasis, autophagy, mitochondrial dysfunction, and neuroinflammation. In addition, advances in symptomatic treatments addressing motor, cognitive, and psychiatric manifestations are reviewed. The article critically examines translational challenges encountered in clinical development, including blood-brain barrier penetration, allele selectivity, dosing paradigms, patient heterogeneity, biomarker integration, and ethical considerations associated with irreversible genetic interventions. Lessons learned from both successful and failed trials highlight the importance of precision medicine approaches, biomarker-guided trial designs, and combination therapies targeting multiple pathogenic pathways. Collectively, this review provides an updated and clinically relevant overview of the evolving HD therapeutic landscape and outlines key considerations for translating molecular advances into effective and safe pharmacological interventions.

Also flagged:tumorendocytosispentose phosphatemetabolismtumorssarcomas
Journal Article 2026-07-30 No Snippets Liao K, Xu F, Gao Y, Jiang X, Lin Y, Chen J.
Show Full Abstract

Proton therapy spares normal tissues better than photon therapy, potentially reducing toxicity while maintaining tumor control. However, challenges remain due to variations in proton dose distribution, particularly at the distal edge of the spread-out Bragg peak (SOBP); for organs at risk, such variation is crucial. We evaluated the biological effects by comparing two positions of the proton profile, the entrance plateau (EP) and SOBP, in a murine model and investigated distinct metabolomic and proteomic signatures. Mice exposed to the EP beam segment (LET<sub>d</sub> = 0.8 keV/µm) exhibited less weight reduction than their SOBP-irradiated counterparts (LET<sub>d</sub> = 2.6 keV/µm). Two hours post-irradiation, the SOBP caused more severe DNA damage in the hippocampus and thalamus. Hematoxylin and eosin staining revealed eosinophil aggregation in both groups, with more surviving neurons in the EP group. Metabolomic profiles differed more between the EP and SOBP groups at 2 h than at 3 days post-irradiation. Relative to EP, SOBP irradiation at 2 h increased fructose-1,6-bisphosphate (FBP), dihydroxyacetone phosphate (DHAP), and inosine but decreased prostaglandin F2α; subsequently, proteomic analysis at day 3 showed that calcium signaling, NF-κB, and endocytosis pathways were enriched in the SOBP group. Combined multi-omics analysis further demonstrated that SOBP irradiation significantly activated the pentose phosphate pathway, purine metabolism, and phospholipase D signaling, while concurrently suppressing arachidonic acid metabolism. Our findings underscore the need for early detection of proton-induced brain toxicity and demonstrate that the higher-LET SOBP segment causes more severe damage than the EP. Targeting these dysregulated multi-omics pathways may offer a promising strategy for mitigating radiation-induced brain injury during proton therapy.

Also flagged:HypercalcemiaMultiple Myelomabone remodelingCOVID-19plasma cell myelomahyperphosphatemia
Journal Article 2026-07-30 No Snippets Finch-Cruz CN, Fazal SI, Fuentes Morales V.
Show Full Abstract

We report the first documented case of extreme, intact parathyroid hormone (PTH)-independent hypercalcemia mediated by a rare non-osteoclastic bone remodeling mechanism in a 65-year-old Puerto Rican woman, detected within 24 h of the second dose of the Moderna mRNA-1273 COVID-19 vaccine and leading to the diagnosis of high-risk biclonal IgA plasma cell myeloma (R-ISS Stage III). Peak serum calcium reached 17.4 mg/dL with concurrent hyperphosphatemia, normal lactate dehydrogenase (LDH), and without marrow osteoclasts or osteolytic lesions, findings inconsistent with classical cancer-associated hypercalcemia. Hypercalcemia resolved within eight days with supportive treatment alone, remaining durably normal nine months later. The temporal proximity to vaccination, together with the biochemical-histopathological profile, generates the hypothesis, without implying causation, that a vaccine-induced innate immune response triggered a rare inflammatory osteocytic perilacunar/canalicular remodeling. The biclonal gammopathy, Clone-1 (normal karyotype, CD33<sup>+</sup>, OCT-2<sup>+</sup>, MYC<sup>-</sup>, CD19<sup>+</sup>, PAX5<sup>-</sup>) and Clone-2 (complex high-risk karyotype, OCT-2<sup>-</sup>, MYC<sup>+</sup>low, CD19<sup>-</sup>), suggests epigenetic rather than genomic drivers in the predominant clone. This case proposes a novel mechanistic hypothesis for vaccine-associated hypercalcemia and generates testable questions that warrant prospective investigation.

Also flagged:organellesorganizationbindingchromatingene expressionbase excision repair
Journal Article 2026-07-30 No Snippets Glinsky GV.
Show Full Abstract

Mechanisms governing initiation steps of the assembly of endogenous multi-protein complexes (EMC) remain incompletely understood. Here, multiple lines of observations are reported describing the function-aligned initiation sequence of hybrid assembly pathways (HAP) of EMC. The first step of HAP-guided chain reactions of protein-protein interactions (PPI) of EMC assemblies constitutes the creation of cell type-specific pools of hetero and homo dimers. The molecular anatomy of HAP was elucidated by defining qualitative and quantitative characteristics of protein binding to a compendium of 200,393 distinct genomic regulatory elements (GRE), including 49,667 sequences representing control sets of genomic loci as well as 150,726 GRE of different evolutionary origins. The consensus sequence of HAP actions consists of: a) Initiation on genomic DNA of the formation of metastable hetero- and homodimers of EMCs' protein constituents; b) Release of dimers from DNA templates for delivery to the EMC assembly compartments; c) Assembly of defined EMC by sequential on demand addition of proteins to preformed dimers serving as attractors of EMC-specific ensembles of monomers. Chromosome-naïve DNA scaffolds facilitating creation of intracellular dimer pools engage networks of ~700 transcription factors (TFs), 534 of which manifest region-specific patterns of significantly enriched expression in 1358 brain regions. HAP initiators appear to operate within nucleosome-depleted islands of transposable elements (TE) - derived sequences within heterochromatin. PPI assembly lines of EMCs operate in 2 concurrent modes: TF-TF PPI cascade and PPI HUB protein cascade. Regardless of the number of DNA-bound initiator TFs (ranging from one to 716 TFs), both modes of operations reached the equilibrium at the PPI constituents saturation levels of ~245 proteins for TF-TF PPI modes and of ~351 proteins for PPI HUB protein modes. Distinct panels of DNA-bound initiator TFs and proteins of PPI cascade ensembles are enriched in either defined sets of neuroanatomical structures (TF-TF mode) or among structural-functional constituents of synapses (HUB proteins mode). Thus, these bifurcated cascades appear biologically congruent: TF-TF constituents map to transcriptional signatures of hundreds of brain regions, whereas HUB constituents map to synaptogenesis and synaptic structures, suggesting the unified logic of genomic functions coordinating region identity and connectivity. Evidence-supported examples of default operations of PPI-guided assemblies of hetero- and homodimers of Yamanaka factors, neurogenesis constituents, and protein components of postsynaptic density of excitatory and inhibitory synaptogenesis are reported with detailed analytical focus on human Claustrum. The foundational set of observations reported in this contribution should facilitate experimental and theoretical explorations of TE-seeded genomic codes for initiators of PPI chain reactions of protein dimerization creating pools of attractors to guide and accelerate the EMC assemblies.

SUDS3
Also flagged:scoliosisepilepsycell differentiationcleidocranial dysplasiamicrocephalyhormone secretion
Journal Article 2026-07-30 ✓ 1 Snippet Cao GH, Liu L, Liu Z, Zhu L, Ta N, Liu YH, Zhang AQ, Fan LL.
In-Text Gene Mentions

…T cell: CNOT6L (chromatin modifiermodifier), JUND (AP-1…

Show Full Abstract

Members of the immunoglobulin superfamily (IgSF) are cell-surface proteins essential for a wide range of biological processes, including molecular transport, morphoregulation, and cell differentiation. IGSF10, a member of this family, has been identified as a disease-associated gene in delayed puberty and cleidocranial dysplasia. In this study, a Chinese patient with delayed puberty, microcephaly, scoliosis, and epilepsy was investigated. The genetic defect and immune alterations were assessed using whole-exome sequencing, Sanger sequencing, and single-cell RNA sequencing. After variant filtering, a novel IGSF10 variant, NM_178,822.5:c.4518del (p.His1506Gln fs Ter13), was identified in the proband. Sanger sequencing indicated that this variant was <i>de novo</i>, as it was present only in the proband and absent from her parents. Quantitative real-time PCR showed that the newly identified variant was associated with reduced IGSF10 mRNA abundance, consistent with nonsense-mediated decay. Single-cell RNA sequencing of peripheral blood mononuclear cells revealed that this variant was associated with marked alterations in effector T-cell and monocyte populations. Further analysis suggested altered differentiation patterns of T cells and monocytes, supporting the hypothesis that immune perturbations may contribute to the patient's reproductive, neurological, and skeletal phenotypes, although this possibility requires functional validation. A novel IGSF10 variant was identified in a Chinese patient with delayed puberty, microcephaly, scoliosis, and epilepsy. This case expands the mutational spectrum of IGSF10 deficiency and suggests that its phenotypic spectrum may include scoliosis and epilepsy, pending further confirmation. These findings also provide preliminary insight into the potential interplay among IGSF10, immune function, hormone secretion, and brain and skeletal development.

Also flagged:ferroptosisneurodegenerative disordercognitive impairmentpathogenesismitochondrialmetabolism
Journal Article 2026-07-30 No Snippets Ding S, Guo Z, Ji H, He J.
Show Full Abstract

Alzheimer's disease (AD) is a neurodegenerative disorder characterized primarily by progressive cognitive impairment, whose pathogenesis involves multiple pathological processes including protein deposition, metal homeostasis dysregulation, oxidative stress, mitochondrial dysfunction, and neuroinflammation. In recent years, metabolism-related cell death modalities such as ferroptosis, cuproptosis, and disulfidptosis have gradually been recognized as potentially involved in neuronal damage in Alzheimer's disease. This review summarizes the fundamental mechanisms of ferroptosis, cuproptosis, and disulfidptosis, along with their research evidence in AD. Ferroptosis is primarily driven by iron imbalance, lipid peroxidation buildup, and impaired GPX4 defense. This process exhibits a bidirectional amplification loop with Aβ and tau pathologies. Cuproptosis contributes to neuronal damage through abnormal copper accumulation, FDX1-related mitochondrial protein lipoylation dysfunction, loss of iron-sulfur cluster proteins, and proteotoxic stress. Disulfidptosis links glucose metabolism disorders, insufficient reducing power, and actin cytoskeleton vulnerability, providing novel insights into metabolic stress and structural damage in AD. Furthermore, the three modes of cell death can undergo cross-regulation through the SLC7A11-NADPH-GSH/GPX4 axis, the FDX1-DLAT/DLST-iron-sulfur cluster axis, as well as upstream factors such as p53, NRF2, and AMPK. Metabolic cell death may constitute a critical pathological network in AD. Targeting these death pathways and their shared hubs is expected to provide new directions for disease stratification, biomarker development, and disease-modifying therapies.

PRDX6
Also flagged:extracellularimmune responseallograft valve dysfunctiondegradationvalve stenosisGoldenhar's syndrome
Journal Article 2026-07-30 ✓ 1 Snippet Seidel AD, Rückoldt J, Werlein C, Knoll M, Petzold C, Engelhardt R, Riehle C, Horke A, Bobylev D, Avsar M, Sarikouch S, Neubert L, Kamp JC.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6) ( 28 )…

Show Full Abstract

<h4>Objective</h4>The objective of this study was to gain insight into the molecular mechanisms leading to early degeneration of decellularized homografts.<h4>Methods</h4>Formalin-fixed and paraffin-embedded tissues from fresh explanted decellularized aortic (<i>n</i> = 7) and pulmonary (<i>n</i> = 8) valves were used. RNA was isolated and analyzed using panel-based transcriptomics, focusing on fibrosis- and inflammation-related genes. Differentially expressed genes were used as input parameters for biological pathway analysis using the Gene Ontology Biological Process and Hallmark databanks. Formalin-fixed and paraffin-embedded tissues from freshly explanted healthy donor aortic (<i>n</i> = 7) and pulmonary valves (<i>n</i> = 8) were used as controls.<h4>Results</h4>Our analysis revealed 56 differentially expressed genes in decellularized aortic valves compared to donor aortic valves, of which 21 and 35 were up- and downregulated, respectively. Decellularized pulmonary valves showed 115 differentially expressed genes compared to donor pulmonary valves, 66 of which were up- and 49 downregulated. In both decellularized aortic and pulmonary valve explants, we found increased expression of fibrosis-, inflammation-, and endothelium-related genes and a decreased expression of genes encoding for complement factors in line with the observed biological pathway activity patterns.<h4>Conclusion</h4>We present a comprehensive transcriptome analysis of explanted decellularized heart valve homografts providing insights into the biological processes leading to continued degeneration and ultimately loss of function. The degeneration of decellularized homografts is driven by inflammation, fibrosis, and extracellular matrix (ECM) remodelling, reinforced by ongoing oxidative stress rather than by a mainly complement-driven humoral immune response.

OLFM4PTGIS
Also flagged:Extracellular Vesiclestumorvesiclemembranepancreatic diseasespancreatic ductal adenocarcinoma
Journal Article 2026-07-30 ✓ 2 Snippets Peng J, Liu L, Ge X, Han Y, Tian W, Chen Y, Zhao Y, Han X.
In-Text Gene Mentions

…tumor-derived EVs, includingOLFM4[ 23 ,…

…25 ], JCHAIN,PTGIS, and HLA-DQB1, exhibited…

Show Full Abstract

Extracellular Vesicles (EVs) have been increasingly recognized as mediators of intercellular communication in pancreatic tissues, carrying molecular cargo reflective of their cellular origin; however, their direct isolation from solid tissue remains technically challenging due to the high enzymatic activity, lipid content, and structural fragility of the pancreas. Here, we establish a pancreas-adapted and reproducible workflow for the isolation of EVs directly from human and mouse pancreatic tissues across tumor and non-tumorous contexts. This approach integrates controlled tissue processing, gentle enzymatic-mechanical dissociation, and sequential centrifugation to enable efficient vesicle recovery while preserving structural integrity and minimizing contamination. The isolated EVs exhibited characteristic size distributions, intact morphology, and enrichment of canonical EV markers, accompanied by depletion of intracellular components. Quantitative analyses demonstrated high reproducibility across independent isolations, with a coefficient of variation of less than 6%. Proteomic profiling revealed selective enrichment of vesicle-associated proteins and preservation of molecular differences between tumor and normal pancreatic tissues, indicating that tissue-derived EVs retain disease-associated protein signatures. Together, these results establish a standardized framework for pancreas-derived EV isolation that supports reproducible downstream analyses and facilitates molecular characterization of pancreatic tissues.

SERPINC1
Also flagged:PreeclampsiaPEcomplement activationdegranulationgestationdiabetes mellitus
Journal Article 2026-07-30 ✓ 5 Snippets Starodubtseva N, Poluektova A, Tokareva A, Kononikhin A, Brzhozovskiy A, Bugrova A, Kukaev E, Khodzhaeva Z, Nikolaev E, Sukhikh G.
In-Text Gene Mentions

…PRSS1, IGHV1-4, andSERPINC1showed a strong…

…SAA4, ORM2, FBLN1,SERPINC1, SERPINA7, C1S, C9,…

…PRSS1, AHSG, CFHR4,SERPINC1, APOA1, ORM2, and…

…= 0.63) andSERPINC1(r = 0.54).…

…t-trimester antithrombin III (SERPINC1) levels in 853…

Show Full Abstract

First-trimester prediction of preeclampsia (PE) remains a major clinical challenge, particularly outside specialized fetal medicine centers. This study aimed to identify and validate serum protein biomarkers for early PE prediction using an integrated proteomic approach. A prospective cohort of 64 first-trimester singleton pregnancies (32 future PE cases, 32 matched controls) was analyzed. Untargeted proteomics was performed using DIA-PASEF-MS, followed by targeted cross-platform verification with MRM-MS. Machine learning classifiers (support vector machines, SVM, and random forest) were trained on differentially abundant proteins (FDR < 0.01, VIP > 1.5). DIA-MS identified 33 protein markers associated with complement activation, IGF transport regulation, and platelet degranulation. An SVM model with a linear kernel achieved 95% accuracy (AUC = 0.95, sensitivity = 95%, specificity = 97%). Four markers (AFM, AHSG, C8A, IGHG1) were confirmed across platforms, confirming the discovery findings. Cross-platform correlation was high: 71% of overlapping proteins showed r > 0.5 (<i>p</i> < 0.001), with the highest concordance observed for potential PE marker AHSG (r = 0.8, <i>p</i> < 0.001). PRSS1, IGHV1-4, and SERPINC1 showed a strong correlation with proteinuria (|r| > 0.5, <i>p</i> < 0.05), linking the proteomic signature to clinical severity. Integrated DIA-MS and MRM-MS proteomics yields a reproducible, high-performance serum signature for first-trimester PE prediction. The identified markers reflect core pathophysiological pathways and offer potential to augment current FMF-based screening algorithms.

HFE
Also flagged:End-stage kidney diseasekidney failurechronic kidney diseasesheart failureDiabetes mellitustype 2 diabetes
Journal Article 2026-07-30 ✓ 1 Snippet Liu PY, Shih CK, Hsieh MH, Lin CC, Liu CY, Lai EC, Li CY, Yu CH, Sung JM.
In-Text Gene Mentions

…heart failure exacerbation (HFE).…

Show Full Abstract

Patients with end-stage kidney disease (ESKD) receiving maintenance dialysis have a high burden of heart failure (HF), with cardiovascular disease the leading cause of death, yet are largely excluded from randomized trials. Using the TriNetX federated electronic health record network, we emulate a target trial comparing initiation of glucagon-like peptide-1 receptor agonists (GLP-1RAs) versus dipeptidyl peptidase-4 inhibitors (DPP-4is) in diabetic ESKD patients with HF, undergoing maintenance dialysis. We identify a primary ESKD-HF population and a confirmatory dialysis-dependence-coded HF subset, and apply a new-user, active-comparator design and use propensity score matching to balance baseline characteristics. In the primary ESKD-HF population, GLP-1RAs use is associated with a lower risk of the primary composite ischemic cardiovascular events plus HF exacerbations, than DPP-4i initiation (31.7% vs. 41.4%; HR 0.72[0.64-0.82], P < 0.0001), with concordance reductions in ischemic events (HR 0.74), HF exacerbations (HR 0.76), all-cause mortality (HR 0.68), and a death-inclusive composite (HR 0.72). Results are consistent in multivariable models, across prespecified subgroups, and in extensive sensitivity analyses, and are corroborated in the confirmatory dialysis-dependence-coded HF subset HR (0.71[0.60-0.85]). These findings provide real-world evidence suggesting GLP-1RAs may improve cardiovascular outcomes in dialysis-dependent diabetic ESKD with HF and support prospective randomized evaluation.

BTN2A1
Also flagged:Solid tumorscancerstumortumorshematologic malignanciessolid tumor
Journal Article 2026-07-30 ✓ 1 Snippet Ramírez-Fernández Á, Bear AS, Kamali E, Bartoszek R, Ho M, Chen GM, Dersh D, Córdoba-Espejo L, Liu J, Deng M, Velasco-Sidro M, Jain A, Noll JH, Hopkins CR, Koucky O, Minehart J, Dimitri AJ, Williams E, Lavorando M, Segura-Tudela A, Scholler J, Barber-Rotenberg J, Jadlowsky JK, Powell DJ, Chew A, Gonzalez VE, Siegel DL, Levine BL, Lotze MT, June CH, Riley JL, Vonderheide RH, Herbst F, Fraietta JA.
In-Text Gene Mentions

…pathways mediated byBTN2A1and BTN3A1 butyrophilins…

Show Full Abstract

Solid tumors often evade TCR-engineered αβ T cells when antigen expression varies or when the restricting Human Leukocyte Antigen (HLA) allele is lost. γδ T cells, in contrast, detect cellular dysregulation through non-peptide/Major Histocompatibility Complex (MHC) cues, including phosphoantigens and stress ligands, and can be developed as allogeneic therapies. Although intratumoral γδ T cell signatures are associated with improved outcome across cancers, γδ recognition itself is broad and still selected within the thymus just as αβ T cell receptors (TCRs) are. It does not, however, anchor specificity to a defined driver-mutation pMHC epitope. We therefore asked whether a high-affinity, co-receptor-independent αβ TCR could graft oncogenic-driver specificity onto γδ T cells while leaving the endogenous γδ TCR intact. We knocked the KRASG12V/HLA-A*11:01 TCR A11v into primary human γδ T cells. Engineered cells co-expressed the transgenic αβ TCR and the endogenous γδ TCR and lysed KRASG12V/HLA-A*11:01<sup>+</sup> tumor cells in vitro and in vivo. To cover potential resistance through loss of HLA-A*11:01, we delivered an mRNA lipid nanoparticle (LNP) encoding a secreted mesothelin×CD3 (M5) bispecific T cell engager (TCE). LNP-M5 produced circulating TCE that redirected γδ A11v T cells and polyclonal bystander T cells to kill mesothelin<sup>+</sup> targets, accompanied by development of higher γδ A11v T cell counts in vivo. In humanized mice bearing mixed HLA-A*11:01<sup>+</sup> and HLA-A*11:01 - KRASG12V tumors, γδ A11v T cells produced transient control, whereas adding LNP-M5 yielded complete responses and prolonged survival. Thus, this two-part therapy couples invariant driver targeting to tunable redirection and addresses loss of the restricting HLA allele, a central escape route for TCR-based therapy. It provides an off-the-shelf reagent to enable KRAS-anchored treatment with the ability to redeliver the reagent.

Also flagged:axonsdendritesaxonalsecretionsynapsesaxon terminals
Journal Article 2026-07-29 No Snippets Lebowitz JJ, Banerjee A, Handy G, Williams JT, Kaeser PS.
Show Full Abstract

Midbrain dopamine neurons release dopamine not only from their axons but also from their somata and dendrites. Shared and distinct properties have been proposed for somatodendritic and axonal release, but the mechanisms of somatodendritic release remain unclear. We here used gene knock-out, electrophysiology, and imaging to define roles of the synaptic vesicle priming protein Munc13 in somatodendritic dopamine release in comparison with axonal secretion. We characterized mice of either sex and found that Munc13 ablation decreased evoked but not spontaneous somatodendritic dopamine transmission measured as D2 receptor-mediated currents. Imaging with a fluorescent sensor confirmed the importance of Munc13 in evoked somatodendritic and axonal dopamine secretion. Pharmacological experiments revealed a modest contribution of release from norepinephrine axons to D2 receptor-mediated currents, and the relative contribution was enhanced after Munc13 knock-out. Altogether, these data establish important roles of Munc13 in evoked somatodendritic release. These roles are similar to Munc13 functions in axonal dopamine release and at fast synapses. Spontaneous midbrain dopamine release was not impaired by Munc13 ablation from dopamine neurons and may rely on a release pathway that is independent of the prototypical release machinery employed at synapses.

SERPINC1
Also flagged:HeparinpolysaccharideglycosaminoglycansthrombinProtaminesulfate
Journal Article 2026-07-29 ✓ 1 Snippet Osei FB, Mariasoosai C, Christodolu Z, Caringi C, Heidari S, Twum K, Nanjappa S, Trivedi E, Washington AV, Torabifard H, Beyeh NK.
In-Text Gene Mentions

…through activation ofantithrombin-III, which in turn,…

Show Full Abstract

Heparin, a polyanionic anticoagulant, is widely used clinically but requires neutralization to restore normal blood coagulation. Protamine sulfate (PS) is the standard antidote, yet limitations exist. Herein, a polycationic, cavity-containing pillar[6]arene macrocycle (P12+) demonstrates superior heparin neutralization in physiological media compared to its lower-valency analog P10+, and performance comparable to PS. MTT assays reveal low toxicity of the P12+, suggesting feasibility for in vivo use. Dynamic light scattering reveals that P12+ forms nanoscale complexes below 400 nm, smaller than PS-heparin aggregates. Remarkably, P12+ exhibits enhanced neutralization of low-molecular-weight heparin, a known limitation of PS. Additionally, heparin detection is achieved via a host-guest indicator displacement assay (IDA) using methyl orange (MO). UV-vis studies show ∼80% MO release with P12+, compared to ∼40% with P10+ in the presence of heparin. This response is detectable in undiluted human plasma for P12+, whereas P10+ shows a suitable response in 5% diluted plasma. A fluorescence-based IDA enables sensitive detection down to 0.11 U/mL, below the therapeutic range (0.80-2.00 U/mL). Molecular dynamics simulations support these findings, revealing that weaker host-guest interactions and favorable electrostatics in P12+ facilitate efficient MO release.

SERPINC1
Also flagged:secretionliver diseasemetabolismfocal adhesionprotein synthesisdetoxification
Journal Article 2026-07-29 ✓ 1 Snippet Ghanem SS, Al-Barazenji T, Badi R, Abdelalim EM.
In-Text Gene Mentions

…F12 , andSERPINC1) (Fig. 6…

Show Full Abstract

<h4>Background</h4>Human pluripotent stem cells (hPSCs) offer a promising source of hepatocytes for disease modeling and drug screening. However, hepatocytes derived in conventional two-dimensional (2D) cultures often exhibit incomplete maturation, limiting their physiological relevance. The molecular mechanisms underlying the improved differentiation observed in three-dimensional (3D) culture systems remain poorly understood.<h4>Results</h4>Induced PSCs (iPSCs) were differentiated into hepatic progenitors under 2D monolayer culture. At the hepatic progenitor stage, cells were either continued in 2D or re-aggregated into 3D organoids for hepatocyte maturation. Both conditions were cultured under identical experimental conditions throughout terminal differentiation for controlled comparison. At the end of differentiation, cultures were evaluated by immunostaining, gene and protein expression, functional assays, and RNA sequencing. Compared with 2D cultures, 3D hepatic organoids showed higher expression of mature hepatocyte markers (ALB, CPS1, AAT, and CYP3A4) and improved function, including increased albumin secretion, glycogen storage, and urea production. RNA sequencing identified 1,266 differentially expressed genes with upregulated genes enriched in hepatic metabolic pathways and downregulated genes associated with focal adhesion and extracellular (ECM)-receptor interaction.<h4>Conclusions</h4>These findings demonstrate that 3D organoid culture enhances iPSC-derived hepatocyte maturation by activating liver-specific transcriptional programs, while suppressing progenitor-associated gene signatures, supporting its use for liver disease modelling and drug metabolism studies.

Also flagged:viremiainfectionprovirusesastrocyteneurocognitive disorderspathogenesis
Journal Article 2026-07-29 No Snippets Dave RS, Oludipe AA, Pasipanodya EC, Sherman S, Wilson SH, Gabuzda DH, Churchill MJ, Angelovich TA, Gorelick RJ, Gianella S, Chaillon A, Fields JA, Morgello S, Gelman BB, Moore DJ, Singer EJ, Ances BM, Fox HS.
Show Full Abstract

HIV persistence within anatomical reservoirs remains the primary barrier to achieving an HIV cure. While antiretroviral therapy effectively suppresses plasma viremia, it does not eliminate integrated proviral genomes that persist in long-lived cellular compartments. The central nervous system (CNS) is a clinically important HIV reservoir, characterized by immune privilege and the persistence of tissue-resident infection despite effective antiretroviral therapy (ART). Evidence from postmortem studies reveals that HIV DNA, RNA, and even intact replication-competent proviruses remain detectable in brain tissue from virally suppressed people with HIV. Evidence derived primarily from in situ approaches and viable-cell studies supports myeloid-lineage reservoirs, particularly microglia and CNS-associated macrophages, as key cellular sources of persistence, while the extent and biological relevance of astrocyte infection remains debated. These reservoirs exhibit transcriptional activity and are associated with chronic neuroinflammation, which may contribute to HIV-associated neurocognitive disorders, despite systemic viral suppression. Here, we synthesize recent findings from autopsy brain studies, including work enabled by major biorepositories, such as the National NeuroHIV Tissue Consortium and rapid-autopsy programs, including the Last Gift, both of which are essential for studying HIV reservoirs in the CNS. We summarize methodologies for detecting and characterizing HIV in brain tissue, highlight heterogeneous patterns of regional distribution and compartmentalization, and review emerging links between CNS persistence and neuroinflammation. We conclude with priorities for harmonized tissue processing, multi-modal single-cell and spatial profiling, and coordinated cross-cohort analyses to clarify the contribution of CNS reservoirs to neuroHIV pathogenesis and systemic rebound.

MMS22L
Also flagged:SPONASTRIME dysplasiareplication forksskeletal disorderpathogenesisreplication forkhypersensitivity
Journal Article 2026-07-29 ✓ 5 Snippets Karmakar A, Roy S.
In-Text Gene Mentions

…pathways, with the TONSL-MMS22Lcomplex working as…

…of TONSL orMMS22Lcauses hypersensitivity to…

…TONSL-MMS22Lcomplex associates with…

…TONSL-MMS22Lcomplex also interacts…

MMS22Lalso undergoes phosphorylation…

Show Full Abstract

TONSL safeguards genome stability by facilitating replication-dependent DNA damage repair and protecting stalled replication forks through homologous recombination. Mutations in TONSL cause SPONASTRIME dysplasia, a rare skeletal disorder. We reveal that TONSL homo-dimerizes via its ubiquitin-like domain (UBL), and two recurrent SPONASTRIME dysplasia causative variants (R934W and G973R) abolish this dimerization. Crystal structures at 1.9 Å resolution show UBL<sup>WT</sup> forms domain-swapped dimers that assemble into ring-like octamers. The R934W variant eliminates critical hydrogen bonds and introduces steric clashes, forcing monomeric conformation. G973R destabilizes an evolutionarily conserved residue within a conformationally restricted β-turn. Biochemically, UBL<sup>WT</sup> exists as dimers while UBL<sup>R934W</sup> remains monomeric. Functionally, dimerization-deficient variants fail to suppress replication stress-induced DNA damage, show impaired RAD51 foci formation, and exhibit severely compromised survival following genotoxic stress. These findings establish TONSL dimerization as essential for genome maintenance and provide structural and mechanistic insights into SPONASTRIME dysplasia pathogenesis.

ZNF644SOX6
Also flagged:brain disorderscell-surfacephagocytosisantigen-presentationmethylationaging
Journal Article 2026-07-29 ✓ 2 Snippets McQuade A, Mishra R, Hagan V, Liang W, Colias PJ, Castillo VC, Gonzalez B, Lubin JP, Haage V, Marshe V, Fujita M, Ta T, Gomes L, Teter O, Han X, Robichaud N, Chasins SE, Rexach JE, De Jager PL, Nuñez JK, Kampmann M.
In-Text Gene Mentions

SOX6

ZNF644

Show Full Abstract

Microglia, the brain's innate immune cells, can adopt a wide variety of activation states relevant to health and disease. Dysregulation of microglial activation occurs in numerous brain disorders, and driving or inhibiting specific states could be therapeutic. To discover regulators of microglial activation states, we conducted CRISPR interference screens in induced pluripotent stem cell (iPSC)-derived microglia for inhibitors and activators of six microglial states. We characterized 31 regulators at the single-cell transcriptomic and cell-surface proteome level in two distinct iPSC-derived microglia models, uncovering protein markers of relevant states. We functionally characterized several multi-state regulators. ZNF532 and PRDM1 knockdown drive disease-associated, lipid-rich signatures and enhance phagocytosis while showing opposing effects on antigen-presentation signatures. DNMT1 knockdown results in widespread loss of DNA methylation, activating negative regulators of interferon signaling. These findings provide a framework to direct microglial activation to selectively enrich microglial activation states, define their functional outputs, and inform future therapies.

POU3F2
Also flagged:autism spectrum disorderproteasomeorganizationgene expressionneurodevelopmental disorderchromatin
Journal Article 2026-07-29 ✓ 1 Snippet Park TH, Koh IG, Sung S, Park H, Kim J, Lee S, Lee YJ, Ko H, Han JH, Bong G, Yoo HJ, Kim J, An JY, Lee JY.
In-Text Gene Mentions

…(BCL11B) and BRN2 (POU3F2) as deep- and…

Show Full Abstract

De novo variants in the ubiquitin-proteasome pathway are linked to autism spectrum disorder (ASD), yet their functional impact on neurodevelopment remains poorly understood. We investigated USP15, a deubiquitinating enzyme with rare damaging variants identified in individuals with ASD, using isogenic human iPSC-derived brain organoids and single-cell transcriptomics. USP15 mutant organoids showed genotype-dependent, progenitor-centered alterations during corticogenesis. Heterozygous organoids modeling haploinsufficiency displayed a shift toward later pseudotime states together with altered maturation and synaptic organization of deep-layer neurons. In contrast, homozygous organoids showed broader phenotypes, including mitotic suppression, aberrant HOX gene expression, and stress-response activation. Regulon analysis showed reduced activity of progenitor-associated regulons, including SOX2, NR2F1, and NR2F2, in heterozygous organoids, whereas homozygous organoids exhibited broader changes in transcriptional regulatory networks. Furthermore, USP15 mutant-associated gene expression patterns were significantly enriched for established ASD risk genes. Comparison with the mouse brain perturbation atlas showed that the transcriptional signature of the USP15 mutant showed notable overlap with those of Fezf2 and Foxp1 mutants, key regulators of deep-layer projection neuron identity. These findings characterize genotype-dependent neurodevelopmental phenotypes associated with reduced USP15 dosage and provide a human neural framework for investigating ASD-relevant developmental mechanisms in the context of a rare ubiquitin-pathway variant.

UNC13C
Also flagged:Epilepsyneurological diseasedrug-refractory epilepsyDravet syndromeinflammatory responsesdeath
Journal Article 2026-07-29 ✓ 1 Snippet Huang Y, Fan L, Wong MY, Lei Z, Krishnamachary B, Zhu D, Cadiz MP, Nagiri RK, Ye P, Norman K, Bhagwat M, Lee YJ, Li H, Zhu J, Amin S, Lauderdale K, Chen H, Luo W, Gong S, Liechty BL, Palop JJ, Sinha SC, Wu J, Zhao M, Gan L.
In-Text Gene Mentions

…synaptic transmission (Unc13cand Robo2 )…

Show Full Abstract

Epilepsy is a prevalent neurological disease, with one-third of individuals becoming nonresponsive to antiepileptic drugs and developing drug-refractory epilepsy (DRE). Here we identify activation of cyclic GMP-AMP synthase (cGAS), a double-stranded DNA sensor that induces type I interferon (IFN) signaling, in human DRE brain tissue. Microglia from individuals with DRE exhibit a robust type I IFN signature and the activation of upstream cGAS-STING signaling. Further, in mouse models of Dravet syndrome, a genetic form of DRE, we similarly detect activation of the cGAS pathway. We show that microglial cGAS can be activated by DNA released from hyperexcitable neurons. Genetic reduction and pharmacological inhibition of cGAS attenuates seizure phenotypes, reduces glial inflammatory signatures and normalizes neuronal transcriptomic changes in mice with Dravet syndrome. Together, these findings identify cGAS-mediated neuroimmune signaling as a contributor to seizure pathology in Dravet syndrome and highlight this pathway as a potential therapeutic target.

HTT
Also flagged:Huntington's diseaseHDneurodegenerative disorderpathogenesisproteolysisbrain atrophy
Journal Article 2026-07-29 ✓ 1 Snippet Shirguppe S, Gapinske M, Swami D, Shenouda K, Miskalis A, Gosstola N, Del Bosque Siller D, Guerra I, Acharya P, Joulani D, Szkwarek MG, Nambiar A, Bhattacharjee A, Dangi AS, Odle N, Nathan GE, Elias G, Stilger M, Winter J, Woods WS, Anand D, Lim CKW, Maslov S, Gaj T, Perez-Pinera P.
In-Text Gene Mentions

…of the huntingtin (HTT) gene, resulting in…

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disorder caused by an expanded CAG repeat within exon 1 of the huntingtin (HTT) gene, resulting in a mutant protein that drives neuronal dysfunction and loss. A key event in the pathogenesis of HD is proteolytic cleavage of mutant HTT, which generates aggregation-prone N-terminal fragments that contribute to toxicity. Strategies that prevent this process thus hold therapeutic potential. Here we develop CRISPR base editors that generate proteolysis-resistant HTT isoforms by disrupting the splice acceptor of HTT exon 13, an exon that encodes critical proteolytic cleavage sites implicated in N-terminal fragment production. When delivered to the striatum of an HD rodent model, these editors reduced HTT fragment formation, decreased aggregation, improved functional deficits and attenuated brain atrophy. Collectively, these results demonstrate the potential of base editing and splice-site modulation to mitigate mutant HTT toxicity in HD.

POU3F2
Also flagged:Prostate Cancertumorstumorneuroendocrineneuroendocrine tumoradenocarcinoma
Journal Article 2026-07-29 ✓ 1 Snippet Pecoraro G, De Giorgi A, Montelatici G, Salfi G, Lin HM, Turco F, Taha T, Beltran H, de Bono J, Aggarwal RR, von Amsberg G, Joerger M, Imbimbo M, Colombo I, Gillessen S, Pedrani M.
In-Text Gene Mentions

…protein 2 (BRN2 [POU3F2]) and SOX2, additional…

Show Full Abstract

Inhibition of androgen receptor (AR) signaling remains the cornerstone of systemic therapy for advanced prostate cancer (PC). However, a subset of aggressive tumors either arises de novo with neuroendocrine features or emerges under treatment pressure through lineage plasticity and AR independence. These lethal states are encompassed within the spectrum of aggressive-variant prostate cancer (AVPC), an umbrella term that includes both histologically confirmed neuroendocrine prostate cancer (NEPC)-comprising de novo NEPC and treatment-emergent NEPC (t-NEPC)-and clinically or molecularly defined AVPC lacking histologic confirmation but sharing neuroendocrine-like, AR-indifferent, or small-cell features. These phenotypes are characterized by rapid progression, visceral dissemination, low or discordant prostate-specific antigen (PSA) levels relative to tumor burden, and poor prognosis. Treatment options for NEPC/AVPC remain limited and largely rely on platinum-based chemotherapy, which usually provides only modest and transient benefit. This unmet need has intensified interest in lineage-associated vulnerabilities. Delta-like ligand 3 (DLL3), an inhibitory Notch ligand with restricted expression in normal adult tissues, is aberrantly upregulated in several neuroendocrine malignancies and has emerged as a clinically actionable target. In prostate cancer, DLL3 expression is enriched in neuroendocrine tumor cells, being detected in approximately 76.6% of castration-resistant NEPC compared with only 12.5% of castration-resistant adenocarcinoma, supporting its development as both a biomarker and therapeutic vulnerability. Clinical success of DLL3-targeted therapies in small-cell lung cancer further supports evaluation of DLL3-directed strategies in NEPC and related AVPC states. This review summarizes the biological rationale, translational evidence, and emerging clinical data supporting DLL3-targeted therapies in prostate cancer. Investigational platforms include antibody-drug conjugates, bispecific and trispecific T-cell engagers, and DLL3-directed radiopharmaceuticals. Early clinical studies suggest that activity is largely confined to DLL3-expressing neuroendocrine tumors, highlighting the importance of biomarker-guided patient selection. Delta-like ligand 3-directed therapies may reshape the management of DLL3-expressing prostate cancer if ongoing efforts to refine biomarkers improve patient enrichment and optimize trial design are successfully translated into clinical practice.

Also flagged:Synthesisextracellularosteogenesisbone resorptionbacterial infectionscell proliferation
Journal Article 2026-07-29 No Snippets Agourrame H, Amor F, Ait-Ouakrim E, Dahhou M, Khachani N, Zarrouk A.
Show Full Abstract

Herein, divalent cations such as Ca<sup>2+</sup>, Sr<sup>2+</sup>, and Mg<sup>2+</sup> are widely studied for their contribution to the bioactivity and performance enhancement of biomaterials intended for bone applications. The incorporation of functional ions into these bioceramics thus represents a promising and economically viable approach. In contrast, Fe, Al, and B cations, although recognized for their influence on structure, chemical stability, and certain physicochemical properties, remain relatively unexplored in relation to the bioactivity of bone-related biomaterials. The present study focuses on the development of three bioactive bioceramics, successfully synthesized by the conventional solid-state reaction method, followed by heat treatments between 100 °C and 1000 °C. These bioceramics are based on the dicalcium silicate phase (Ca<sub>2</sub>SiO<sub>4</sub>), into which bioactive trivalent cations, such as Boron oxide (B<sub>2</sub>O<sub>3</sub>), Alumina (Al<sub>2</sub>O<sub>3</sub>) and Hematite (Fe<sub>2</sub>O<sub>3</sub>) have been incorporated, named CSF, CSA, CSB respectively. Furthermore, the bioactivity of these bioceramics were evaluated by immersing them in simulated body fluid (SBF) and artificial saliva (AS) for 24 hours at 37 °C. The samples were then characterized by powder X-ray diffraction (XRD), scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), Fourier transform infrared spectroscopy (FT-IR), and UV spectroscopy. These analyses were complemented by using transmission electron microscopy (TEM). X-ray diffraction (XRD) results confirmed that the Dicalcium silicate (Ca<sub>2</sub>SiO<sub>4</sub>) phase is predominant in the three bioceramics, with secondary bioactive phases such as Grossite (CaAl<sub>4</sub>O<sub>7</sub>), Tricalcium borate (Ca<sub>3</sub>B<sub>2</sub>O<sub>6</sub>) and Brownmillerite (Ca<sub>2</sub>Fe<sub>2</sub>O<sub>5</sub>), specific to each incorporated oxide. The optical band gap of the samples, determined by UV-visible spectrophotometry, ranged from 3.60, 3.21 and 2.99 eV for CSF, CSB, CSA respectively. Antibacterial activity, evaluated against Gram-negative (<i>Pseudomonas aeruginosa</i>) and Gram-positive (<i>Staphylococcus aureus</i> and <i>Enterococcus faecalis</i>) bacteria, revealed significant inhibition of <i>Staphylococcus aureus</i>. XRD analyses after only 24 hours immersion in simulated media, complemented by scanning electron microscopy (SEM) observations, showed that these bioceramics rapidly promote the formation of a bone-like hydroxyapatite (Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) layer, demonstrating their potential as biomaterials for bone regeneration. The results obtained indicate that the incorporation of bioactive oxides into dicalcium silicate may significantly improve its properties, thus enhancing its potential for tissue regeneration applications.

OLFM4
Also flagged:GolgiorganizationGolgi apparatusagingmembraneendoplasmic reticulum
Journal Article 2026-07-29 ✓ 2 Snippets Belevich I, Porcile L, Sola-Carvajal A, Grommisch D, Annusvar K, Heinz P, Das S, Webb AT, Andersson S, Pentinmikko N, Villablanca EJ, Goldenring JR, Kasper M, Jokitalo E, Coffey RJ, Katajisto P, Scharaw S.
In-Text Gene Mentions

…Egfr enrichment inOlfm4+ ISCs ensured that…

…used: monoclonal rabbitOlfm4(Cell Signaling, D6Y5A,…

Show Full Abstract

Cell-to-cell signaling between niche and stem cells regulates tissue renewal. While the identity of many mediating factors is known, it is largely unknown whether stem cells optimize their receptiveness to niche signals according to the niche organization. Here, we show that Lgr5+ small intestinal stem cells (ISCs) regulate the morphology and orientation of their secretory apparatus to match the niche architecture, and to increase transport efficiency of niche signal receptors. ISCs orient their Golgi apparatus laterally towards Paneth cells of the epithelial niche, and divide Golgi into multiple stacks. Stem cells with multiple lateral Golgi transport stem cell receptors with a higher efficiency than cells with one single Golgi. The lateral Golgi orientation and enhanced receptor transport requires A-kinase anchor protein 9 (Akap9), and is necessary for normal renewal capacity. Moreover, reduced Akap9 in aged ISCs renders ISCs insensitive to niche-dependent modulation of Golgi stack number and transport efficiency. Our results reveal a stem cell-specific Golgi complex configuration that facilitates efficient niche signal reception and tissue renewal, which is compromised in the aged epithelium.

BTN2A2BTN2A1
Also flagged:Hepatocellular Carcinomapost-translational modificationstumorhepatocyte differentiationtranslational modificationcancer
Journal Article 2026-07-29 ✓ 5 Snippets Ai Z, Liang Y, Cai Y, Gao J, Ren L, Wang Q, Chen Y, Huang Y, Xiang Z.
In-Text Gene Mentions

…positively correlated withBTN2A1(cor = 0.33,…

…< 0.05) andBTN2A2(cor = 0.34,…

…ICPs, such asBTN2A1(cor = 0.48,…

…p < 0.05),BTN2A2(cor = 0.46,…

…genes via aBTN2A1/2 subcluster, which further…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) has a poor prognosis with lymph node metastasis (LNM), severely impacting survival. Protein post-translational modifications (PTMs) regulate tumor microenvironment (TME) dynamics, but their role in HCC LNM is unknown.<h4>Methods</h4>This study systematically analyzed single-cell RNA sequencing (scRNA-seq) and bulk transcriptomic data from TCGA-LIHC and validation cohorts. Key cellular subpopulations and differentially expressed genes (DEGs) were identified. PTM-related candidate genes were identified through intersection analysis. Prognostic genes were determined via Cox regression and integrated into a random survival forest (RSF) model. Patients were stratified to assess associations with TME remodeling, genomic alterations, immune checkpoints, and drug sensitivity. Pseudotime trajectory and transcription factor activity analyses elucidated molecular dynamics.<h4>Results</h4>Hepatocyte populations were significantly expanded in both LNM and non-LNM HCC groups. The intersection of scRNA-seq DEGs, bulk DEGs, and PTM-related genes identified five candidate genes, among which PJA1 and RFPL4B identified as potential prognostic risk factors and were incorporated into a robust RSF model. High-risk patients exhibited poor survival outcomes, increased tumor mutational burden, and pronounced tumor microenvironment alterations. PJA1 expression was negatively correlated with hepatocyte infiltration. Pseudotime analysis revealed that LNM-associated hepatocytes were arrested in early differentiation states, coinciding with dysregulated transcription factor activity.<h4>Conclusion</h4>This study computationally identified PJA1 and RFPL4B as post-translational modification-related candidate prognostic genes potentially associated with HCC LNM. The proposed risk model stratified patients into subgroups characterized by distinct tumor microenvironment features and genomic instability. Computational analysis suggested that arrest of hepatocyte differentiation and dysregulation of transcription factor networks may be implicated in metastatic progression, thereby offering novel therapeutic insights.

Also flagged:Cardiovascular diseasescoronary artery diseasechronic heart failureCHFpulmonary hypertensionischemic cardiomyopathy
Journal Article 2026-07-29 No Snippets Jiang Y, Zhang J, Zeng L, Li Y, Wang D, Li Y, Sun L, Fan F.
Show Full Abstract

Accumulating evidence highlights the pivotal role of ferroptosis in diverse cardiovascular diseases (CVDs) such as atherosclerosis, aortic aneurysm, aortic dissection, vascular aging, calcific aortic valve disease, myocardial ischemia reperfusion injury, cardiomyopathy, and heart failure. Studies on the molecular mechanism of ferroptosis have revealed potential targets for the treatment of CVDs, and a large number of studies have reported evidence of drug-mediated ferroptosis and iron metabolism mechanisms intervening in CVDs. This review delves into the latest molecular characteristics of ferroptosis, associated biological processes, and regulatory pathways. Notably, various compounds like iron chelators (e.g., deferoxamine, deferiprone), chloroiodohydroxyquin and its derivatives, antioxidants (e.g., vitamin E, lipoic acid, selenium), Ferrostatin-1 (Fer-1), etc., have demonstrated efficacy in animal studies against CVDs, offering cardiovascular protection. In summary, this review outlines the role of ferroptosis in CVDs, the regulatory effects of relevant drugs (including natural products) on ferroptosis within cardiovascular contexts, aiming to provide valuable insights for CVDs management and the development of novel therapeutics.

Also flagged:AutophagyPathogenesisMitochondrial Diseasesmitochondrialdegradationmacroautophagy
Journal Article 2026-07-29 No Snippets Avdonina ED, Kutsev SI, Shestopalov AV.
Show Full Abstract

Mitochondrial diseases are a heterogeneous group of inherited disorders caused by defects in the mitochondrial genome or nuclear genes encoding proteins essential for mitochondrial function. These conditions are characterised by progressive dysfunction of tissues with high energy demands, particularly the nervous and muscular systems. In recent years, increasing consideration has been paid to the role of autophagy-the cellular mechanism for the degradation and recycling of intracellular components in the pathogenesis of mitochondrial diseases. This review synthesizes current knowledge on molecular mechanisms of macroautophagy and selective forms of au-tophagy targeting specific organelles and structures: mitophagy, pexophagy, ribophagy, ER-phagy, aggrephagy, lipophagy, lisophagy, and nucleophagy. Using classic mitochondrial syndromes-Kearns-Sayre syndrome (KSS), MERRF, and MELAS, as well as various mitochondrial myopathies-as examples, we discuss experimental evidence indicating both compensatory activation of autophagy and its insufficiency or blockade at different stages. Furthermore, we examine the link between deficiencies of key fatty acid β-oxidation enzymes (VLCAD, MCAD, CPT2) and impaired autophagic flux, including secondary defects of mitophagy mediated by energy deficiency. The review systematises current understanding of how dysregulation of selective autophagy promotes the accumulation of damaged mitochondria, oxidative stress, inflammation, and cell death in mitochondrial diseases. Prospects for therapeutic modulation of autophagy as a potential approach to treating these disorders are discussed.

PRDX6
Also flagged:cell cyclephytohormonebiosynthesiscell divisionmetabolismaging
Journal Article 2026-07-29 ✓ 2 Snippets Gao X, He X, Wu H, Li S, Yin S, Xue Z, Liang Y, Cao H, Wang R, Zhang B, Hao J, Gao R.
In-Text Gene Mentions

…, CYP84A ,PRDX6, and UGT72E…

…CSE , andPRDX6, were significantly…

Show Full Abstract

Understanding whether long-term vascular cambium vitality in ancient trees reflects progressive decline or adaptive reprogramming is central to grasping woody plant longevity. We performed an integrative analysis of functional traits, transcriptome profiles, and metabolomic landscapes of cambial zone enriched from 80-, 500-, and 1000-year-old <i>Styphnolobium japonicum</i> trees. With increasing tree age, the vascular cambium showed fewer cell layers, reduced thickness, and lower auxin, gibberellin, and IAA/ABA ratios, whereas bark thickness, malondialdehyde, abscisic acid, jasmonic acid, and salicylic acid contents increased. Transcriptomic and metabolomic analyses revealed that differentially expressed genes and metabolites were primarily enriched in the cell cycle, phytohormone signaling, and phenylpropanoid biosynthesis pathways. Specifically, genes associated with cell division were down-regulated in millennial trees, whereas phenolic acids, flavonoids, and lignin-related metabolites significantly accumulated. Piecewise structural equation modeling suggested associations among tree age, transcription factors, structural genes, metabolites, and cambial functional traits. These results indicate that cambial senescence is not a simple linear decay but a highly coordinated remodeling process, providing crucial evidence for delayed senescence in long-lived woody species.

PTGIS
Also flagged:ageingLysosomevacuolemacroautophagyproteasomeAutophagy
Journal Article 2026-07-29 ✓ 1 Snippet Cai M, Xu M.
In-Text Gene Mentions

…Prostacyclin synthase (PTGIS; CES = 0.441)…

Show Full Abstract

Autophagy-lysosome dysfunction accompanies dermal fibroblast ageing, yet whether remodelling is transcriptional or post-transcriptional in primary human cells remains unresolved. We reanalysed the Genetic and Epigenetic Signatures of Translational Ageing Laboratory Testing(GESTALT) paired RNA sequencing (RNA-seq) and tandem mass tag (TMT) proteome from 82 donors (aged 22-89) using Data Integration Analysis for Biomarker discovery using Latent cOmponents (DIABLO) for supervised multi-omics integration, weighted gene co-expression network analysis (WGCNA), external Genotype-Tissue Expression(GTEx) transcriptomic comparison, network medicine proximity mapping and CDOCKER molecular docking. Three analyses converged on the autophagy-lysosome axis: Kyoto Encyclopaedia of Genes and Genomes (KEGG) Lysosome ranked first in discordant-quadrant analysis; gene set enrichment analysis (GSEA) identified vacuole organisation and macroautophagy as the top age-upregulated Gene Ontology (GO) terms; and WGCNA recovered KEGG Lysosome in the brown module. Module regression localised most proteomic age signals to the lysosomal degradative-capacity module, whereas the proteasome was unaffected. McNemar testing and GTEx comparison supported a protein-side, post-transcriptional origin. TCIRG1, CTSA and ATP6V0D1 were recurrent hubs. Network proximity computationally prioritised hydroxytyrosol as a lysosomal-degradative-capacity-preferential candidate, and CDOCKER on cathepsin A linked its advantage over tyrosol to an ortho-hydroxyl group forming additional hydrogen bonds. These results support protein-layer-dominant autophagy-lysosome remodelling as a feature of dermal fibroblast ageing and suggest a cell-type-resolved computational route from ageing proteomics to testable dietary candidates.

Also flagged:acute myeloid leukemiaAMLrefractoryDown syndromechronic GVHDdeath
Journal Article 2026-07-29 No Snippets Ackerman A, Ebens CL, Lund TC, MacMillan ML, Williams R, Chandrasekaran AJ, Shanley R, Krieger E, Hoover A.
Show Full Abstract

<h4>Background/aims</h4>Optimal pre-transplant chemotherapy exposure for pediatric patients with high-risk acute myeloid leukemia (AML) in first complete remission (CR1) remains undefined. Many patients achieve measurable residual disease (MRD)-negative remission early, raising the question of whether additional chemotherapy prior to allogeneic hematopoietic cell transplantation (HCT) improves outcomes. We evaluated the impact of pre-HCT chemotherapy cycles on post-transplant outcomes.<h4>Methods</h4>We conducted a retrospective single-center cohort study of pediatric patients (age 0-18 years) with high-risk AML undergoing first myeloablative allogeneic HCT in MRD-negative CR1 between 2011 and 2023. Patients were stratified by receipt of 1-2 versus 3-4 pre-HCT chemotherapy cycles. Patients in the 3-4 cycle cohort who had achieved MRD-negative remission by the end of cycle 2 were assessed and compared to the 1-2 cycle cohort for rates of two-year relapse-free survival (RFS) and cumulative incidence of relapse. All patients in both cohorts were assessed for rates of two-year overall survival (OS) and one-year non-relapse mortality (NRM).<h4>Results</h4>Forty patients met inclusion criteria; 22 (55%) received 1-2 cycles and 18 (45%) received 3-4 cycles. Excluding patients who were not MRD-negative after 2 cycles, two-year RFS was 66% (95% CI 32-86) for 3-4 cycles vs 68% (45-83) for 1-2 cycles (Hazard Ratio [HR] 0.88 [95% CI 0.26-3.01], p=0.84). The cumulative incidence of relapse at two years was 34% (9-62) in the 3-4 cycle cohort and 14% (3-31) in the 1-2 cycle cohort (HR 2.39 [0.57-10.1], p=0.23). Two-year OS was 77% (49-91) for 3-4 cycles vs 67% (46-84) in the 1-2 cycle cohort (HR 0.63 [0.18-2.14], p=0.46). One-year NRM was 0% in the 3-4 cycle group and 18% (5-37) in the 1-2 cohort (HR NE, p=0.06).<h4>Conclusions</h4>Among pediatric patients with high-risk AML undergoing allogeneic HCT in MRD-negative CR1 at a single center, 3-4 pre-transplant chemotherapy cycles were not associated with statistically significant differences in overall or relapse-free survival compared to 1-2 cycles, although the study was underpowered to exclude clinically meaningful differences. Consolidation with HCT after 1-2 cycles of chemotherapy, once MRD-negative remission is achieved, warrants prospective exploration of risk- and remission-guided treatment strategies.

Also flagged:metabolismhistone modificationsorganelleAcute Myocardial InfarctionCardiovascular diseasesepigenetic
Journal Article 2026-07-29 No Snippets Yu X, Cui C, He J, Guan X, Zhang Z.
Show Full Abstract

<h4>Background</h4>Cardiovascular diseases (CVDs) remain the leading cause of mortality worldwide, with inflammation central to disease progression. Emerging evidence reveals intricate crosstalk between metabolic reprogramming and epigenetic modifications in cardiovascular inflammatory injury, offering novel therapeutic strategies.<h4>Objective</h4>This review elucidates the regulatory mechanisms underlying the metabolic-epigenetic axis in cardiovascular inflammation and explores both conventional and traditional Chinese medicine (TCM)-based intervention strategies.<h4>Results</h4>Three findings are highlighted: (i) the succinate-hypoxia-inducible factor 1α (HIF-1α)-interleukin-1β (IL-1β) and itaconate-nuclear factor erythroid 2-related factor 2 (Nrf2) axes form an opposing pair defining macrophage polarization; (ii) acetyl-CoA, α-ketoglutarate (α-KG), lactate, and β-hydroxybutyrate (β-OHB) couple metabolism to histone modifications (H3K27ac, H3K27me3, H3K18la, H3K9ac) and DNA 5-hydroxymethylcytosine (5hmC), establishing trained immunity; (iii) mitochondrial dysfunction (mtDNA-cGAS-STING; mitochondrial ROS-NLRP3 inflammasome) and ferroptosis (GPX4/ACSL4) integrate these signals at the organelle level. TCM compounds (berberine, Shengmai Injection, tanshinone IIA, ginsenosides) modulate this axis at multiple nodes, with clinical support from the Phase III China Tongxinluo Study in Acute Myocardial Infarction (CTS-AMI) trial.<h4>Conclusions</h4>The metabolic-epigenetic axis offers a tractable framework for precision anti-inflammatory cardiovascular therapy. Mechanistic studies and biomarker-guided trials are required to validate combined TCM-based interventions.

Also flagged:solid tumorsTumorstumor-cell immunitylocalizationimmune responses
Journal Article 2026-07-29 No Snippets Pastorino C, Falco M, Giordano C, Zarefeizabadi N, Rutigliani M, Carbone A, Clavarezza M, Ortolani F, Nanni L, Della Chiesa M, Sivori S, Carlomagno S.
Show Full Abstract

Natural killer (NK) cells are uniquely equipped to eliminate transformed cells without prior antigen sensitization, yet their therapeutic potential in solid tumors remains only partially realized. At the center of this paradox lies a complex network of inhibitory pathways, dominated by killer cell immunoglobulin-like receptors (KIRs) and the CD94/NKG2A axis, which continuously calibrate NK-cell self-tolerance and effector competence. Tumors exploit these regulatory circuits through dynamic remodeling of HLA-I expression: while loss of classical HLA-I impairs CD8<sup>+</sup> T-cell recognition, preservation or upregulation of non-classical HLA, particularly HLA-E, sustains inhibitory signaling and promotes immune escape. These mechanisms are further amplified by the tumor microenvironment (TME), where stromal barriers, hypoxia, metabolic stress, and immunosuppressive networks collectively restrict NK-cell infiltration, persistence, and cytotoxicity. Such multilayered suppression helps explain why therapeutic blockade of KIR or NKG2A alone has yielded only modest clinical benefit in most solid tumors, despite compelling biological rationale. Emerging evidence suggests that the KIR- and CD94/NKG2-centered network should be viewed not only as a therapeutic target but also as a framework for the next-generation of NK-cell-based immunotherapies. Future strategies will likely combine checkpoint modulation with donor- and patient-tailored NK-cell selection, engineered NK-cell products with enhanced metabolic resilience and reduced checkpoint sensitivity, and interventions aimed at remodeling the tumor niche to restore trafficking, persistence, and functional fitness. In this mini-review, we discuss how KIR- and CD94/NKG2-mediated signaling is shaped by the TME and examine emerging combinatorial and personalized approaches designed to unlock the full therapeutic potential of NK cells in solid tumors.

Also flagged:Amyotrophic lateral sclerosisALSneurodegenerative disorderneuronproteinopathysporadic ALS
Journal Article 2026-07-29 No Snippets Gomes-Duarte A, Wong JK, Moro A, Pasteuning-Vuhman S, Pos W, Haselberg R, Sogorb-González M, Pascoal S, Borst L, Chatterjee M, Giera M, Tsimikas S, Sadiq SA, van Deventer S.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder defined by progressive motor neuron loss and TDP-43 proteinopathy, yet the upstream drivers of this pathology remain unclear. Oxidized phosphatidylcholines (PC-OxPL) have emerged as potent inducers of proteinopathy in the central nervous system (CNS), but their role in ALS has not been systematically explored. We identify a distinct PC-OxPL signature in the cerebrospinal fluid (CSF) of patients with sporadic ALS (sALS) and show that apolipoprotein E (apoE)-containing particles are the primary PC-OxPL carriers in this compartment. In human iPSC-derived motor neurons, PC-OxPL exposure triggered disease-relevant transcriptional alterations and TDP-43 pathology, establishing PC-OxPL as a mediator of ALS-like neurodegeneration <i>in vitro</i>. To counteract this toxicity, we engineered an Adeno-Associated Virus (AAV)-delivered single-chain antibody fragment (scFv), PC-OxPL-VecTab, targeting PC-OxPL neoepitopes. PC-OxPL-VecTab neutralized PC-OxPL-induced neurotoxicity, reduced TDP-43 aggregation, and prevented motor neuron death and behavioral deficits in a sALS CSF transfer mouse model. Intrathecal delivery of PC-OxPL-VecTab in minipigs achieved broad CNS biodistribution and transgene expression, supporting the feasibility of CNS delivery. These findings position PC-OxPL as a mechanistic contributor to ALS pathogenesis and establish PC-OxPL-VecTab as a therapeutic strategy for ALS with potential broader applicability to disorders associated with PC-OxPL accumulation.

Also flagged:Neurodegenerative diseasescognitive diseasesendoplasmic reticulum-mitochondria-associatedmitochondrialAmyotrophic lateral sclerosis
Journal Article 2026-07-29 No Snippets Anwar AI, Hegazi AA, Bhuchakra HP, Nelson JR, Birdsong TL, Fontenot CJ, Zeibo M, Fazal-Ur-Rehman MM, Bieber HP, Spring CJ, Smith JL, Hachem IA, Singh T, Sawaya MF, Murnane KS, Kaye AD.
Show Full Abstract

Neurodegenerative diseases are targets for pridopidine therapy, which aims to improve quality of life through neuroprotective mechanisms that involve sigma-1 receptor (S1R) activation. Neurodegenerative motor and cognitive diseases are influenced by dopamine imbalance, where disruptions in pathways contribute to states that are hyperkinetic or hypokinetic, while current dopaminergic treatments are symptomatic rather than disease-modifying, especially for Huntington's disease and Amyotrophic lateral sclerosis. This review summarizes the mechanisms underlying pridopidine-mediated neuroprotection and examines the current evidence supporting its therapeutic potential. The S1R is an endoplasmic reticulum-mitochondria-associated chaperone involved in homeostasis of calcium, stress regulation, and mitochondrial function. Pridopidine is a small lipophilic molecule that crosses the blood-brain barrier and acts as an S1R agonist, with minimal dopamine D2 receptor occupancy. Activation of S1R by pridopidine modulates calcium signaling and enhances anti-apoptotic activity. Collectively, available evidence suggests that pridopidine may improve motor outcomes and slow disease progression in Huntington's disease and amyotrophic lateral sclerosis, supporting its promise as a disease-modifying therapeutic strategy.

Also flagged:Autism Spectrum Disorderbehavioraltranslationalsensoryintellectual disabilityattention deficit/hyperactivity disorder
Journal Article 2026-07-29 No Snippets Valappil AK, Kim SN.
Show Full Abstract

Autism spectrum disorder (ASD) is a heterogeneous neurodevelopmental condition characterized by impairments in social communication, restricted and repetitive behaviors, sensory dysregulation, and frequent psychiatric comorbidities. Increasing attention has been directed toward acupuncture as a complementary neuro-modulatory intervention; however, its underlying molecular mechanisms remain incompletely understood. This review synthesizes evidence from preclinical, clinical, and molecular studies published between 2015 and 2025 to examine how acupuncture influences neurobiological pathways relevant to ASD. Current evidence indicates that acupuncture modulates multiple neurotransmitter systems, including glutamatergic, GABAergic, dopaminergic, serotonergic, and noradrenergic signaling, while also influencing neurotrophin-mediated plasticity, neuroinflammatory responses, and synaptic function. Studies conducted directly in ASD models demonstrate regulation of excitatory/inhibitory balance, monoaminergic signaling, neurotrophin pathways, and ASD-associated behavioral outcomes, whereas evidence from related neuropsychiatric conditions provides complementary mechanistic support for these pathways. Collectively, the findings suggest that acupuncture may act through coordinated modulation of interconnected neurotransmitter and neuroplasticity networks rather than a single molecular target. However, direct mechanistic evidence in ASD-specific models and clinical populations remains limited, and considerable heterogeneity exists among acupuncture protocols and outcome measures. Future studies integrating standardized stimulation paradigms with molecular, electrophysiological, neuroimaging, and behavioral assessments will be essential to validate the proposed mechanisms and clarify the translational potential of acupuncture in ASD.

Also flagged:Brucellosiszoonosestype IV secretionbiosynthesisinfectiondeath
Journal Article 2026-07-29 No Snippets Qadeer A, Tharwat M, Halawani IF, Alzahrani FM, Alzahrani KJ, Alshanbari FA, Khan MZ.
Show Full Abstract

Brucellosis remains among the most widespread global zoonoses, yet its genetic architecture-spanning host susceptibility and pathogen virulence-is increasingly being investigated. Advances in whole-genome sequencing, transposon mutagenesis, CRISPR screening, and machine learning-driven transcriptomics have accelerated marker discovery on both sides of the host-pathogen interface, although most signatures remain at discovery or early-validation stages. In hosts, polymorphisms in innate immune receptors (<i>TLR2</i>, <i>TLR5</i>, <i>VDR</i>), cytokine regulators (<i>TNF</i>, <i>CTLA4</i>), and novel candidates such as <i>ASAP1</i> are linked to differential susceptibility in humans and livestock. In <i>Brucella</i>, functional genomics shows that virulence relies on interconnected regulatory circuits that control the type IV secretion system, lipopolysaccharide biosynthesis, and stress responses, with gene essentiality shifting according to the host immune context. Antimicrobial resistance may involve unconventional mechanisms, including metabolic and regulatory adaptation, that are not fully explained by classical resistance-gene paradigms and may implicate metabolic reprogramming and ribosomal modulation. This review synthesizes these converging lines of evidence, highlights key gaps-chiefly the scarcity of functional validation for host associations and limited multi-omics integration-and proposes a roadmap for translating genetic markers toward future diagnostic refinement and therapeutic target discovery, urging a shift from descriptive cataloging toward mechanistic and clinical validation.

bioRxiv 2026-07-29 Preprint (No Snippets API) Greco TM, Hutton JE, Justice JL, Reed TJ, Vogt TF, Prasad BC, Cristea IM.
Show Full Abstract

Huntington’s disease (HD) is a life-altering genetic neurodegenerative disorder, with cognitive, motor, and psycho-social effects that have consequential impacts on the individuals and their families. While current treatments improve disease symptoms, there are no FDA-approved therapies that prevent disease progression. Converging lines of evidence from human GWAS and mouse models point to DNA repair and handling (R/H) proteins as promising therapeutic targets due to their ability to modulate somatic expansion of the CAG repeat of HTT. The roles of DNA R/H HD modulator proteins are incompletely understood, in part, due to their relatively low cellular abundance and technical challenges in quantification. Here, we developed and validated targeted mass spectrometry assays quantifying DNA R/H proteins, spanning functions in mismatch repair, Fanconi anemia, and transcriptional regulation, using complementary workflows for timsTOF and Orbitrap platforms. We built species-specific experiment spectral libraries that outperformed in silico libraries for target detection. Applying this pipeline to an HTT-Q140 knock-in mouse HD model, we observed that DNA R/H protein abundances were largely unchanged in HD mice, while HTT and HAP40 showed increased nuclear association with disease progression. To facilitate translational research applications, we further developed a stable isotope dilution assay for absolute quantification of 11 human mismatch repair-associated proteins and generated an HTT knock-out human neuroblastoma cell line. Additionally, we used thermal proximity coaggregation profiling to characterize the endogenous interactomes of MMR proteins. We observed that HTT KO caused proteome down-regulation in selected DNA R/H proteins and reshaped the MMR protein interactome, with the most pronounced changes observed for MLH1 and PMS1 interactions. Overall, we established a validated, transferable assay for quantifying DNA R/H proteins in perturbation studies using human and mouse HD model systems and provide evidence that HTT influences the abundance and interaction landscape of proteins central to CAG repeat instability.

bioRxiv 2026-07-29 Preprint (No Snippets API) Fernandez JP, Gärtner A, Perez-Perez J, Cumming SA, Feng J, van Belois K, He K, Yang D, Castells-Esteve C, Bergé-Gardeñes M, Bergander AL, Lubieniecki KP, Miclăuș M, Fissolo N, Comabella M, Vogt A, Gebauer L, Cavaleri F, Voelkner C, Illarionova A, Limbani H, Marke G, Chen RZ, Prasad BC, Vogt TF, Reid DA, Pinto RM, Podlesniy P, Kulisevsky J, Balmus G, Nguyen HP, Pouladi MA, Monckton DG, Brito V, Beuzer P.
Show Full Abstract

<h4>ABSTRACT</h4> Somatic instability (SI) of expanded DNA repeats is a hallmark of repeat expansion disorder (REDs) and drives onset and progression in Huntington’s disease (HD) yet the absence of target engagement (TE) biomarkers for SI-modulating therapies represents a critical gap to clinical development. Here, we describe the development of the unscheduled repair synthesis assay (URSA)—combining 5-ethynyl-2’-deoxyuridine (EdU) pulse-labeling with digital PCR or sequencing—and show that the CAG-expanded huntingtin ( HTT ) exon 1 allele is a highly active DNA repair hotspot in cells from people with HD (PwHD). Repair activity increases with repeat length, is allele-specific, and depends strongly on MSH3, a central driver of somatic expansion. URSA robustly quantifies MSH3 modulation in preclinical models within days compared to weeks or months required by conventional repeat-length measurements. Critically, substantial repair activity is detectable in peripheral blood mononuclear cells (PBMCs) from PwHD, where signal correlates with CAG length and improves predictive models of somatic expansion (SE) beyond age and CAG length alone. Unlike repeat-length changes, which require years to accumulate in blood, URSA signal is measurable within days. These findings establish DNA repair activity at the mutant HTT locus as a mechanistically grounded pharmacodynamic biomarker, enabling TE monitoring on a clinically actionable timescale, and with broad applicability to REDs and other diseases where modulation of the DNA damage response is therapeutically targeted.

bioRxiv 2026-07-29 Preprint (No Snippets API) Samstag CL, Bragg RM, Neumann K, Mathews E, Lam K, Wu CC, Marchionini DM, MacCoss MJ, Raftery D, Carroll JB.
Show Full Abstract

Multiple therapeutic strategies are being developed to slow Huntington’s disease (HD) progression through targeted reduction of huntingtin (HTT) protein or mRNA. Despite HTT’s discovery over 30 years ago, its cellular functions remain incompletely understood, and the long-term consequences of HTT-lowering therapies remain unclear. We previously demonstrated that hepatic HTT loss in mice disrupts hepatocyte zonation and metabolism. Here, we investigate the physiological consequences of hepatic Htt loss. Across multiple models of Htt loss—including ubiquitous and hepatocyte-specific genetic knockouts and a therapeutically relevant Htt -targeting siRNA—there was elevated expression of IL-6/STAT3-driven acute phase response genes. Single-nucleus RNA sequencing reveals a zonal pattern of hepatocyte stress, most highly upregulated in pericentral hepatocytes, and identifies a distinct pericentral cluster of stressed hepatocytes that was enriched ∼9.6-fold following Htt knockout. Histological examination reveals that Htt loss results in increased hepatic pathology, including hepatic intranuclear inclusions, apoptosis, and necrosis, as well as prevalence of granulomas. Transcriptomic analysis reveals significant upregulation of metallothionein genes following Htt loss, as confirmed by elevated plasma metallothionein-1 (MT1) levels in knockout mice. These findings underscore important safety considerations for HTT-lowering therapies and suggest candidate biomarkers for monitoring hepatic off-target effects in clinical trials.

medRxiv 2026-07-29 Preprint (No Snippets API) Zeng W, Kohleick L, Beuchel C, Zoodsma M, Koprulu M, Zanini JC, Wild B, Langenberg C, Pietzner M.
Show Full Abstract

<h4>ABSTRACT</h4> Foundation models trained on electronic healthcare records (EHRs) have gained traction with the aim to transform personalised medicine. However, their interpretability is bound to redescribing the records the models were trained on, missing implicitly learned concepts and biases. Here, we show that human genetics provides an orthogonal layer to surface implicitly learned biological concepts and otherwise hidden risk factors. Re-implementing the generative transformer Delphi-2M in >500,000 UK Biobank participants, we performed genome-wide association testing on its 120 learned embeddings and identified 434 genome-wide-significant signals across 151 independent loci and 98 embeddings, revealing a heritable structure that feature-attribution methods cannot recover. Effector-gene mapping implicated cholesterol metabolism and an IL-1-family epithelial-alarmin pathway, supported by strong (>50-fold) enrichment for variants previously associated with blood lipids, body-mass index, and asthma. Loci recovered the targets of essentially all approved lipid-lowering and severe-asthma therapies, and another twelve drugs not obvious from genetic results based on single ICD-10 GWAS. Yet, embeddings poorly explained variation in pleiotropic risk factors, while still retaining most of their predictive value. Substantial improvements in predictive performance were hence confined to a minority of common diseases by adding specific diagnostic or organ-derived markers. Our findings suggest that human genetics might be most powerful as an orthogonal explanatory or regularising layer to train the next generation of EHR-based foundation models that likely benefit most from the addition of targeted biomarkers to advance personalised medicine.

SOX6
Also flagged:Tissuegene expressionchromosome-nucleuscell
Journal Article 2026-07-28 ✓ 5 Snippets Zhang B, Qiu S, Du Z, Xiao H, Su Y, Tang A, Bao B, Zhu B, Chen Y, Gao X, Xu L, Wang Z, Zhang L, Gao H, Li J, Zheng C.
In-Text Gene Mentions

…pe-specific regulators: TBX15,SOX6, and TCF12 in…

…we identified TBX15,SOX6and TCF12 as…

…TFs, whereas TBX15,SOX6and RORA were…

…Notably, TBX15 andSOX6exhibited high activity…

…implicated TBX15 andSOX6in muscle fiber-type…

Show Full Abstract

<h4>Background</h4>The genetic dissection of complex traits in livestock continues to pose a significant challenge in the field of animal genetics and breeding. Although traditional genome-wide association studies (GWAS) are capable of localizing genetic variants associated with specific traits, they are insufficient to elucidate the underlying physiological mechanisms. An integrated analysis of multi-trait GWAS and multi-transcriptomic data systematically identifies key tissues and cell types influencing complex traits in beef cattle and elucidates their genetic regulatory basis.<h4>Results</h4>We systematically mapped tissue- and cell-type-specific regulatory architectures underlying 20 economically important traits in beef cattle. Tissue-level analyses revealed distinct trait-tissue associations: fatty acid traits, including C16:0 and C20:4, were enriched in liver; carcass traits, including marbling score and carcass weight, in renal cortex/medulla and longissimus dorsi muscle; meat-quality traits such as pH in cartilaginous tissues; and total fat content in bone marrow. At cellular resolution, analysis of eight trait-associated tissues identified 38 discrete cell types. Myofibers were significantly associated with most carcass traits, including rib-eye area and backfat thickness, whereas hepatocytes emerged as key regulators of fatty acid and meat-quality traits, such as C16:0 and crude protein content. Transcription factor analysis identified cell-type-specific regulators: TBX15, SOX6, and TCF12 in myofibers; FOXA2 and NR1H4 in hepatocytes; and IRF8 and IKZF1 in microglia. Notably, hepatocytes and microglia showed complementary, trait-specific association patterns: hepatocytes were enriched for C16:0 associated saturated fatty-acid metabolic pathways, while microglia were enriched for C16:1 and unsaturated fatty-acid-related pathways, suggesting potential cross-tissue coordination in lipid regulation.<h4>Conclusions</h4>Our study links specific tissues and cell types to phenotypic variation in beef cattle and identifies core transcriptional regulators and pathways driving trait variation. These cell-resolved maps provide mechanistic insight into how genetic variation shapes economically important traits, offering a valuable resource for functional studies, cell-informed precision breeding strategies, and the design of large-scale molecular phenotyping.

Also flagged:microspherescollagentissue remodelingtranslationalmetabolic disordersaging
Journal Article 2026-07-28 No Snippets Lang Z, Shi Y, Guo X, Long X, Zhu S, Chen T, Li C, Zhao L, Si T, Zhu Z.
Show Full Abstract

With the progressive shift of minimally invasive aesthetic medicine toward regeneration-oriented therapeutic paradigms, injectable materials have evolved from providing simple volumetric augmentation to enabling tissue remodeling and long-term structural improvement. Regenerative functional microspheres, as representative biostimulatory injectable materials have demonstrated expanding clinical value in facial rejuvenation, skin texture enhancement, and scar repair. However, studies on different material systems remain fragmented with respect to their mechanisms of action, manufacturing strategies, and clinical outcomes, and the lack of systematic integration and cross-comparison has hindered manufacturing standardization and standardized clinical application. Focusing on aesthetic medical applications, this review systematically summarizes the regenerative mechanisms, major material systems, fabrication strategies, and clinical evidence of regenerative functional microspheres. Centered on the critical clinical effects of biostimulation and collagen remodeling, this review highlights recent advances in regenerative mechanisms and material design, outlines the influence of key fabrication technologies on product uniformity and safety, and systematically analyzes major clinical indications and therapeutic characteristics, while also discussing key challenges and future development trends in this field. This review aims to provide a structured overview to guide material design, process optimization, and clinical translation of regenerative microspheres, offering a reference framework for innovation and application of regenerative aesthetic materials.

Also flagged:neurogenesisgene expressiontumorCOVID-19gestationcell division
Journal Article 2026-07-28 No Snippets Ji L, Wang A, Sonthalia S, Seo S, Naiman DQ, Younes L, Colantuoni C, Geman D.
Show Full Abstract

Defining cell classes is central to the analysis of growing single-cell RNA sequencing (scRNA-seq) atlases. Marker genes are most often identified by differential expression (DE) methods that assess genes one at a time, ignoring the redundancy and complementarity revealed when genes are considered jointly. Working with binarized expression data, we instead seek discriminating <i>panels</i> of genes that together are specific to a cell type, framing marker-panel selection as a variant of the minimal set-covering problem in combinatorial optimization. This formulation efficiently searches the vast space of candidate panels, exploits the large cell numbers typical of scRNA-seq, and is robust to zero-inflation. Using blood and brain data, we show that our method, CellCover, reduces gene redundancy and captures cell-class-specific signals distinct from those found by DE. Transfer-learning experiments across mouse, primate, and human data demonstrate that CellCover identifies conserved cell classes in neocortical neurogenesis and tracks developmental progression in progenitors and neurons. Examining outer radial glia markers across mammals, we find that transcriptomic elements of this key cell type likely arose in rodent gliogenic precursors before the full program emerged in the primate lineage.

Also flagged:ethylene glycolallyl sulfideazidealkyneyes-associated protein 1localization
Journal Article 2026-07-28 No Snippets Friend NE, Petrich NR, Shockley KE, Manning AN, Jaeschke MW, Saeb D, Young MW, Anseth KS.
Show Full Abstract

Granular hydrogels offer a powerful platform for engineering porous, cell-instructive scaffolds with tunable mechanical, structural, and biochemical properties, yet introducing spatial and functional heterogeneity typically requires multiple microgel populations or complex fabrication strategies. Here, we present a programmable, photoresponsive granular hydrogel platform that enables post-assembly spatiotemporal control of scaffold mechanics and cell microenvironments from a single microgel formulation. Poly(ethylene glycol) microgels containing photolabile allyl sulfide moieties were synthesized via strain-promoted azide-alkyne cycloaddition and assembled into granular scaffolds capable of light-mediated remodeling through radical addition-fragmentation chain transfer. This chemistry afforded dynamic, on-demand, and spatially defined tuning of mechanical properties (G' = 0.7-3.7 kPa) while maintaining scaffold porosity (∼20%). High-resolution photopatterning across multiple length (6 µm-1 mm) and timescales enabled precise modulation of local microenvironments. Human mesenchymal stem/stromal cells embedded in these scaffolds responded to spatiotemporal modulation of matrix mechanics as observed by changes in morphology, yes-associated protein 1 (YAP) nuclear localization, and secretory profiles. Together, these results establish a versatile and broadly applicable strategy for programming mechanical heterogeneity and regulating cell behavior in granular hydrogels through photolabile moieties.

Also flagged:Golginucleuslocalizationtocytoplasmicnuclear import
Journal Article 2026-07-28 No Snippets Galea G, Kuodyte K, Khan MM, Thul PJ, Neumann B, Lundberg E, Pepperkok R.
Show Full Abstract

The Golgi complex serves as a critical hub for cellular homeostasis, yet its communication with the nucleus remains largely unexplored. By analyzing and siRNA-validating localization data from the Human Protein Atlas, we uncovered substantial proteome interconnectivity between the Golgi and nucleus, including an unexpected enrichment for DNA repair factors. We identify a cluster of DNA damage response (DDR) proteins occupying distinct sub-Golgi compartments that redistribute dynamically between the Golgi and nucleus in response to genotoxic stress, with the type of DNA lesion shaping the direction of redistribution. Focusing on the homologous recombination (HR) regulator RAD51C, we show that DNA damage triggers ataxia telangiectasia mutated (ATM)-dependent release of a giantin-tethered Golgi RAD51C pool, with subsequent importin-β-dependent nuclear import, where repair-associated foci form. Giantin depletion prematurely releases RAD51C, producing aberrant nuclear foci lacking key DDR markers, reducing ATM activation and HR efficiency, elevating genome instability, and accelerating proliferation. The Golgi thus acts as a spatiotemporal coordination node for DDR factors safeguarding genomic stability.

SERPINC1
Also flagged:Alzheimer's Disease DementiadementiaAlzheimer's diseaseAD
Journal Article 2026-07-28 ✓ 2 Snippets Barczak A.
In-Text Gene Mentions

…the usefulness ofACE-IIIfor functionally anchored…

…D subtypes.<h4>Conclusion</h4>ACE-IIIprovides clinically meaningful…

Show Full Abstract

<h4>Introduction</h4>Translating cognitive test results into clinically meaningful measures of dementia severity remains challenging in real-world settings, where biomarkers are limited and functional assessment may occasionally be confounded by noncognitive factors. Although the Addenbrooke's Cognitive Examination-III (ACE-III) is widely used for detecting Alzheimer's disease (AD), its role in severity staging is less established. This study evaluated the usefulness of ACE-III for functionally anchored staging and compared it with the Mini-Mental State Examination (MMSE).<h4>Methods</h4>In a retrospective real-world cohort of 1,170 patients with AD dementia (late-onset, early onset, and mixed), severity was classified using the Functional Assessment Staging Tool (FAST). Receiver operating characteristic analyses were used to derive cut-offs for differentiating adjacent stages (FAST 4 vs. 5; FAST 5 vs. 6). Domain-level and subtype-specific analyses were conducted.<h4>Results</h4>ACE-III showed excellent discrimination between FAST 4 and 5 (area under the ROC curve [AUC] = 0.92; cut-off ≤56) and moderate discrimination between FAST 5 and 6 (AUC = 0.77; cut-off ≤42), outperforming MMSE in later stages (AUC = 0.63). Attention contributed most to earlier transitions, whereas later stages showed broader domain involvement. Cut-offs varied across AD subtypes.<h4>Conclusion</h4>ACE-III provides clinically meaningful estimates of dementia severity and may help overcome limitations of functional assessment in real-world settings, supporting its use for staging and monitoring in routine clinical practice.

PRDX6
Also flagged:SUMOylationwound healingtumorhepatocellular carcinomacell proliferationliver cancer
Journal Article 2026-07-28 ✓ 1 Snippet Li S, Wang J, Wang L, Bian T, Qian S, Zhu X, Zhou X, Wang Z, Chen L.
In-Text Gene Mentions

…genes, such asPRDX6, has been found…

Show Full Abstract

<h4>Introduction</h4>Hepatocellular carcinoma (HCC) is a highly aggressive malignancy characterized by limited therapeutic options and significant cellular heterogeneity. This study aims to delineate the SUMOylation-mediated transcriptomic landscape and develop a robust prognostic signature to predict survival and immunotherapy response in HCC patients.<h4>Methods</h4>Malignant epithelial cells were classified into SUMOylation-related subtypes using nonnegative matrix factorization. A prognostic signature (SUMOylation.Sig) was constructed via machine learning and validated across multiple cohorts. Immune infiltration, immunotherapy response, and drug sensitivity were evaluated. Furthermore, we performed functional validation of a core signature gene, VPS72, through siRNA-mediated knockdown, colony formation and wound healing assays in HCC cells.<h4>Results</h4>We identified 10 prognostic SUMOylation-related genes (SRGs) and stratified malignant epithelial cells into five SUMOylation subtypes. The SUMOylation-C4 subtype was associated with favorable outcomes and enhanced immune infiltration. A 13-gene prognostic SUMOylation.Sig was developed and validated, effectively stratifying patients into low- and high-risk categories with distinct survival and responsiveness to immunotherapy. Low-risk patients exhibited increased immune cell infiltration and superior responses to immune checkpoint inhibitors. Experimental validation confirmed differential expression of signature genes in HCC cell lines. Notably, in vitro experiments demonstrated that VPS72 knockdown significantly suppressed the proliferation and migration of HepG2 and LM3 cells, confirming its oncogenic potential.<h4>Conclusions</h4>Our study establishes a SUMOylation-based cellular taxonomy and a robust 13-gene prognostic tool for HCC. The experimental validation of VPS72 underscores the functional importance of the signature, suggesting its potential involvement in tumor progression and highlighting potential therapeutic targets for personalized clinical management.

Also flagged:Chromatinagingreplicative senescencecell cycleoftumor
Journal Article 2026-07-28 No Snippets Torlai Triglia E, Miller TE, Durand NC, Kim KL, Casaní-Galdón S, D'Antonio J, Javed N, Paz Hernandez A, Raman A, Cruz AJ, Issner R, Choudhary A, Aguet F, Verga J, Chan M, Ramanathan V, Li CM, Hecht V, Hansen AS, Aryee MJ, Epstein CB, Kelley DR, Najm FJ, Shoresh N, Ardlie K, Hendrickson DG, Ruby JG, Bernstein BE, Gaskell E.
Show Full Abstract

The 9p21 locus encodes critical cell cycle regulators p16<sup>INK4A</sup>, p14<sup>ARF</sup>, and p15<sup>INK4B</sup> and contains a high density of SNPs associated with aging-related diseases. Progress toward understanding 9p21 regulatory mechanisms has been constrained by complex transcript structures and a shortage of cell models that retain physiologic locus control. We innovated tools to deconvolve the expression and regulation of 9p21 transcripts in single cells. We find that 9p21 transcripts exhibit highly divergent expression across tissues and cell types, with p15<sup>INK4B</sup> predominating. Despite being frequently conflated under the term CDKN2A, p14<sup>ARF</sup> and p16<sup>INK4A</sup> are independently expressed across tissues, cell types, aging, and in a fibroblast model of replicative senescence. We annotate a network of cis-regulatory elements (CREs), whose activities and interactions underpin these complex regulatory dynamics. Our systematic characterization of 9p21 transcripts and CREs provides mechanistic insights and the tools for future studies of this vital locus.

GPR52HTTDCC
Also flagged:fibromyalgiachronic pain syndromesomatic disorderspost-traumatic stress disorderirritable bowel syndromecentral nervous system disorder
Journal Article 2026-07-28 ✓ 5 Snippets Kerrebijn I, Bjornsdottir G, Arbabi K, Urpa L, Haapaniemi H, Thorleifsson G, Stefansdottir L, Frangakis S, Valliere J, Kunorozva L, Abner E, Ji C, Kangur M, Aagaard B, Bliddal H, Brunak S, Bruun MT, Didriksen M, Erikstrup C, Finer S, Geirsson AJ, Gudbjartsson DF, Hansen TF, van Heel D, Jonsdottir I, Knight S, Knowlton KU, Mikkelsen C, Nadauld LD, Olafsdottir TA, Ostrowski SR, Pedersen OBV, Saevarsdottir S, Skuladottir AT, Sørensen E, Stefansson H, Sulem P, Sveinsson OA, Thorlacius GE, Thorsteinsdottir U, Ullum H, Vikingsson A, Werge TM, Chronic Pain Genomics Consortium, FinnGen, DBDS Genomic Consortium, Estonian Biobank Research Team, Genes & Health Research Team, Saxena R, Stefansson K, Brummett CM, Glintborg B, Clauw DJ, Thorgeirsson TE, Williams FMK, Sinnott-Armstrong N, Ollila HM, Wainberg M.
In-Text Gene Mentions

…coding variant inHTT, the causal…

⭐ same-sentence co-mention

…the HTT regulatorGPR52, as well…

…neural roles, includingDCC, DRD2 /…

…the Huntingtin (HTT) gene.…

HTT, the causal…

Show Full Abstract

Fibromyalgia is a common and debilitating chronic pain syndrome of poorly understood etiology. Here we conduct a multi-ancestry genome-wide association study meta-analysis across 2,563,755 individuals (54,629 cases and 2,509,126 controls) from 11 cohorts, identifying 26 risk loci for fibromyalgia. The strongest association was with a coding variant in HTT, the causal gene for Huntington's disease. Gene prioritization implicated the HTT regulator GPR52, as well as diverse genes with neural roles, including DCC, DRD2/NCAM1, MDGA2 and CELF4. Fibromyalgia heritability was exclusively enriched within brain tissues and neural cell types. Fibromyalgia showed strong, positive genetic correlation with a wide range of chronic pain, psychiatric and somatic disorders, including genetic correlations above 0.7 with low back pain, post-traumatic stress disorder and irritable bowel syndrome. Despite large sex differences in fibromyalgia prevalence, the genetic architecture of fibromyalgia was nearly identical between males and females. This study provides robust genetic evidence defining fibromyalgia as a central nervous system disorder, thereby establishing a biological framework for its complex pathophysiology and extensive clinical comorbidities.

DNAH10
Also flagged:fertilizationlocalization
Journal Article 2026-07-28 ✓ 4 Snippets Gan KE, Zhong HL, Li Y, Liu WY, Ou SB, Liang ZK, Li J, Zhou L, Yalikun T, Li T, Chen H, Wang WJ, He ZY, Yuan P.
In-Text Gene Mentions

…case-series evidence fromDNAH10, DNAH12, CFAP47 ,…

…chain 10 (DNAH10) and dynein…

DNAH10/DNAH12 variants segregated wi…

…restored fertilization inDNAH10/DNAH12 deficiency, whereas IC…

Show Full Abstract

Fertilization and early-cleavage failure are the major causes of assisted reproductive technology failure, but genotype-guided care is underused. We conducted whole-exome sequencing with Sanger confirmation in 20 men from couples with unexplained fertilization and cleavage failure after in vitro fertilization or intracytoplasmic sperm injection (ICSI). Then, further sperm transmission electron microscopy, immunofluorescence, and, where appropriate, embryo quantitative parental contamination test (qPCT) and kinship analysis were integrated in selected cases. Six novel variants were found in four families: two each in dynein axonemal heavy chain 10 ( DNAH10 ) and dynein axonemal heavy chain 12 ( DNAH12 ) and one in cilia and flagella associated protein 47 ( CFAP47 ) and phospholipase C zeta 1 ( PLCZ1 ), respectively. DNAH10/DNAH12 variants segregated with multiple morphological abnormalities of the sperm flagella and showed "9+2" axonemal disruption and reduced dynein signals. Hemizygous CFAP47 c.8006C>T is associated with cleavage failure and altered PLCZ1 localization. Homozygous PLCZ1 c.589C>T in a consanguineous pedigree coincided with multinuclear (≥3 pronuclei) zygotes, and qPCT/kinship indicated excess paternal contribution, consistent with suspected polyspermy in multinuclear zygotes. Management-matched genotype: ICSI restored fertilization in DNAH10/DNAH12 deficiency, whereas ICSI plus assisted oocyte activation (AOA) improved cleavage and yielded ongoing pregnancies in CFAP47/PLCZ1 deficiency. These findings outline potentially actionable clinical strategies-ICSI for axonemal dynein defects and ICSI plus AOA for activation pathway defects-and support targeted genetic testing plus embryo qPCT/kinship in selected cases.

ECI2ARFGEF2
Also flagged:Major Depressive DisorderAmyotrophic Lateral SclerosisALSsleepautophagysynaptic vesicle
Journal Article 2026-07-28 ✓ 2 Snippets Cheung N.
In-Text Gene Mentions

…(Z = 6.41),ARFGEF2(Z = −5.87),…

…ACSL6, HADHB, HADH,ECI2, ACAT2, CPT2, CPT1A,…

Show Full Abstract

<h4>Background</h4>Major depressive disorder (MDD) and amyotrophic lateral sclerosis (ALS) are usually treated as unrelated, yet depressive symptoms occur in a substantial minority of people with ALS and may appear early. These symptoms are heterogeneous and may reflect syndromal MDD, psychological and functional burden, fatigue, apathy, pseudobulbar affect, frontotemporal involvement, sleep or respiratory disturbance, medication effects, or shared affective vulnerability. A proposed pruning-continuum model suggests both disorders may share vulnerability in microglia-mediated synaptic pruning, with ALS amplified by autophagy and protein-quality-control failure and MDD by RNA-processing, stress, and immune dysregulation. We performed an exploratory secondary transcriptome-wide association study (TWAS)/pathway-integration analysis to test whether predefined nicotinamide mononucleotide (NMN)-nominated pathways map onto this vulnerability.<h4>Methods</h4>We integrated precomputed S-PrediXcan outputs for MDD and ALS across available brain-relevant tissues. Ten Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were predefined from a prior re-analysis of NMN-associated transcriptional programs in aged mouse metabolic tissues. Mouse-derived candidates were represented by human ortholog symbols before the human TWAS screen. The analysis tested nominated pathways rather than the 35-gene NMN-robust list as a standalone set. Cross-tissue screening used Stouffer Z aggregation, tissue-level Wilcoxon testing, competitive permutation testing, percentile bootstrap intervals, pairwise disease statistics, Levene variance tests, concordance measures, and leave-one-out sensitivity analysis. No analysis was treated as confirmatory or evidence of causal mediation.<h4>Results</h4>MDD showed the strongest Stouffer-based exploratory signal in the synaptic vesicle cycle pathway, with a meta-across-tissue Stouffer Z of 3.41 and a wide bootstrap 95% confidence interval of -0.46 to 7.40. This signal did not survive competitive permutation testing (p = 0.1222) or Wilcoxon testing (p = 0.1926). The strongest tissue-level result occurred in the amygdala (Z = 4.057; nominal Wilcoxon p = 0.0093), although tissue-level permutation testing was not performed in the multi-gene-set run. ALS showed no significant meta-across-tissue enrichment among the 10 nominated pathways but displayed candidate gene-level signals in autophagy, endosomal, and vesicle-related genes, including TBK1 and C9orf72. Exploratory Levene tests indicated variance heterogeneity in the regulation of the actin cytoskeleton, endocytosis, and neuroactive ligand-receptor interaction; the actin cytoskeleton and endocytosis remained significant in pooled global false discovery rate (FDR) analysis. Fourteen genes were influential in at least two focus pathways, including EGF, KNG1, FGF8, RAC1, PAK1, PAK2, RAF1, MAPK1, and FGFR1.<h4>Conclusions</h4>These findings are hypothesis-generating. MDD and ALS may stress overlapping cellular logistics processes while engaging largely different genes. MDD showed the strongest exploratory pathway-level signal in synaptic vesicle biology, whereas ALS showed candidate gene-level coherence in autophagy and endosomal processes without significant meta-pathway enrichment. NMN/NAD+ repletion is not established as a treatment for MDD, ALS, or their comorbidity. These findings generate hypotheses about NAD+-linked cellular stress pathways for future preclinical and clinical studies.

DCC
Also flagged:MiNEN of the urinary bladderlarge cell neuroendocrine carcinomaenteric-type adenocarcinomaLCNECneuroendocrine carcinomaNEC
Journal Article 2026-07-28 ✓ 1 Snippet Xiu X, Li J, Duan L, Wang X, Guo Z, Xiao X, Han Q, Gao F.
In-Text Gene Mentions

…sequence involving TP53,DCC, and APC.…

Show Full Abstract

Large cell neuroendocrine carcinoma (LCNEC) is the rarest high-grade neuroendocrine carcinoma (NEC) of the urinary bladder. It can be observed in mixed neuroendocrine/non-neuroendocrine neoplasm (MiNEN), which is predominantly associated with urothelial carcinoma (UC) and less frequently with adenocarcinoma. Here, we report a primary MiNEN of the urinary bladder, composed of LCNEC and enteric-type adenocarcinoma. The patient was a 58-year-old male who initially presented with painless hematuria and dysuria. Transabdominal ultrasonography demonstrated a 4.8 × 2.4 cm hypoechoic lesion arising from the posterior bladder wall. Histologically, the tumor showed distinct yet closely apposed components of LCNEC and enteric-type adenocarcinoma. Immunohistochemically, the LCNEC component was positive for neuroendocrine markers, including CD56, chromogranin, synaptophysin, and INSM1, while the adenocarcinoma component was positive for CK20 and CDX2. Notably, both components showed aberrant P53 expression (P53-null pattern), supporting a shared clonal origin with divergent differentiation. After progression following initial platinum-based chemotherapy, the patient achieved a radiographic partial response (PR) of pulmonary metastases after treatment with enfortumab vedotin plus pembrolizumab administered with radiotherapy. Our case highlights the diagnostic importance of recognizing a high-grade neuroendocrine component in bladder tumors. Furthermore, antibody-drug conjugates and immune checkpoint inhibitors may merit further study in this rare entity.

Also flagged:hematological malignanciessolid tumorstumorsolid tumorextracellularbinding
Journal Article 2026-07-28 No Snippets Liu W, Gu J, Xie C, Du B, Liu M, Zhang J.
Show Full Abstract

Although chimeric antigen receptor T (CAR-T) cell therapy has achieved remarkable success in hematological malignancies, its therapeutic efficacy in solid tumors remains limited by several challenges, including insufficient tumor infiltration, T cell exhaustion and the immunosuppressive tumor microenvironment (TME). CRISPR/Cas, a third-generation gene editing technology developed in recent years, is characterized by its simplicity and high efficiency. This technology has demonstrated broad application potential across multiple fields and has emerged as a powerful tool for improving CAR-T cell therapy. In this review, we summarize recent advances in the application of CRISPR/Cas gene editing technology to enhance the antitumor activity of CAR-T cells against solid tumors. We also discuss the key challenges currently faced and systematically propose potential strategies for overcoming the limitations.

Also flagged:spinal muscular atrophyautosomalneuromuscular disorderchildhood disorderchromosomesynthesis
Journal Article 2026-07-28 No Snippets Liu J, Liu Y, Yuan A, Ning K.
Show Full Abstract

Spinal muscular atrophy (SMA) is a devastating autosomal recessive neuromuscular disorder characterized by progressive degeneration of lower motor neurons, leading to muscle weakness and atrophy predominantly manifesting in childhood. The disease is caused by homozygous deletion or loss-of-function mutations in the survival motor neuron 1 (SMN1) gene, with the nearly identical SMN2 gene acting as a critical modifier of disease severity. Since the initial clinical descriptions in 1891 and the identification of the causative gene in 1995, the field has witnessed transformative therapeutic progress. The FDA approval of nusinersen, an antisense oligonucleotide targeting SMN2 splicing, in 2016 marked the first disease-modifying therapy, followed by the gene replacement therapy onasemnogene abeparvovec in 2019 and the orally administered small-molecule splicing modifier risdiplam in 2020. These SMN-targeted therapies have substantially improved survival and motor outcomes, particularly when administered presymptomatically as enabled by increasingly widespread newborn screening programs. However, a significant proportion of patients, especially those with later-onset disease and adults, show limited responses, and existing therapies cannot reverse established neurodegeneration or muscle pathology. In this review, we trace the history of SMA research and therapy development, critically compare the three approved treatments, and discuss key unresolved challenges including treatment-switching criteria, management of late-diagnosed patients, and the emerging role of biomarkers such as neurofilament light chain and compound muscle action potential. We further explore non-SMN therapeutic strategies targeting PTEN, plastin 3, neurocalcin delta, myostatin, and neuroinflammation, and examine the rationale for combination approaches that integrate SMN restoration with muscle- and neuro-protective agents. Finally, we address future directions encompassing precision medicine, next-generation gene editing, and biomarker-driven trial design. While SMA has been transformed from a fatal childhood disorder to a treatable condition, a definitive cure for all patients remains the goal of ongoing and future research.

HFE
Also flagged:cirrhosisliver diseasedecompensated cirrhosisthrombocytopeniahypoalbuminemiahyponatremia
Journal Article 2026-07-28 ✓ 2 Snippets Wang L, Ye X, Luo W, Zhang W, Qian L, Huang J.
In-Text Gene Mentions

Hemochromatosis, Wilson disease, alpha-1…

…( 15 ),HFEtesting, MRI iron…

Show Full Abstract

<h4>Background</h4>Hypopituitarism is associated with adverse body composition and steatotic liver disease, particularly when the growth hormone/insulin-like growth factor-1 (GH/IGF-1) axis is disturbed. Progression to decompensated cirrhosis is uncommon, and published reports do not establish a direct causal relationship.<h4>Case presentation</h4>A 37-year-old woman presented with jaundice, massive ascites, splenomegaly, thrombocytopenia, hypoalbuminemia, coagulopathy, and hyponatremia. She had undergone pituitary adenoma surgery at approximately 12 years of age, followed by amenorrhea and more than two decades without regular endocrine follow-up or hormone replacement. The clinical and biochemical profile supported long-standing panhypopituitarism. Possible central HPA-axis dysfunction was present; secondary adrenal insufficiency was clinically probable but not dynamically confirmed. Other features included central hypothyroidism, hypogonadotropic hypogonadism, low prolactin, central diabetes insipidus, and severe GH/IGF-1 axis disturbance. GH stimulation testing was not performed, and interpretation of the GH/IGF-1 axis was confounded by advanced liver disease. Common viral, autoimmune, alcohol-related, drug-related, and overt cardiac causes were not supported. However, transferrin saturation was 94.6%, and iron overload, Wilson disease, alpha-1 antitrypsin deficiency, and histological metabolic steatohepatitis were not fully excluded. Liver biopsy supported advanced fibrosis/cirrhosis, and explant pathology showed micronodular cirrhosis with hepatocellular cholestasis. She underwent liver transplantation in May 2026. Aminotransferase levels subsequently declined, but persistent thrombocytopenia, pulmonary infection, and acute kidney injury requiring hemodialysis developed. She progressed to septic shock and died more than 20 days after transplantation.<h4>Conclusion</h4>Long-standing untreated panhypopituitarism may have contributed to metabolic and fibrogenic risk in this patient, but incomplete etiological evaluation precluded a definitive causal link. Lifelong endocrine follow-up and attention to liver health are warranted after pituitary surgery.

POU3F2
Also flagged:brain tumorgliomagliomascell proliferationwound healingbinding
Journal Article 2026-07-28 ✓ 1 Snippet Wang D, Yu W, Wang R, Liu N.
In-Text Gene Mentions

…factors, such asPOU3F2/BRN-2 and OCT4 are…

Show Full Abstract

<h4>Background</h4>Glioma is a highly aggressive brain tumor with poor prognosis, necessitating new biomarkers and therapeutic targets. This study aimed to explore the role of Pit-Oct-Unc class 3 homeobox 4 (POU3F4) in glioma using bioinformatics analysis and experimental verification.<h4>Methods</h4>Bioinformatics analysis was performed using the public databases The Cancer Genome Atlas (TCGA) and Human Protein Atlas database to explore POU3F4 expression and prognosis in gliomas. Samples were collected from clinical glioma tissues, paracancerous tissues, and plasma of patients and healthy candidates. POU3F4 expression was examined using molecular biological methods, and its potential diagnostic value was assessed. <i>In vitro</i>, normal human astrocytes (NHAs) and various glioma cells (U87MG, U251MG, T98G, A172, and LN229) were used to assess POU3F4 expression using quantitative polymerase chain reaction (qPCR) and western blotting (WB). U87MG and U251MG cells were transfected with specific small interfering RNAs (siRNAs) of POU3F4. The effects of POU3F4 siRNA on cell proliferation, apoptosis, and migration were assessed using the Cell Counting Kit-8 (CCK-8), clone formation, 5-ethynyl-2'-deoxyuridine (EdU), terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), wound healing, and Transwell assays. The binding of KLF15 to the promoter region of POU3F4 was validated using chromatin immunoprecipitation (ChIP) assay. Finally, the molecular mechanism of KLF15-POU3F4 axis in regulating the PI3K/AKT signaling pathway was preliminarily explored by measuring the phosphorylation levels of phosphatidylinositol 3-kinase (PI3K) and protein kinase B (AKT).<h4>Results</h4>Bioinformatics analysis revealed that POU3F4 levels were increased in gliomas, and upregulated POU3F4 may be associated with poor prognosis. Additionally, clinical sample analysis confirmed that POU3F4 was overexpressed in glioma tissues and plasma samples, and its levels in glioma tissues were positively associated with those in the plasma. The receiver operating characteristic (ROC) curve demonstrated that POU3F4 levels in both tissue and plasma exhibited good diagnostic value for glioma. <i>In vitro</i> experiments demonstrated that POU3F4 was overexpressed in different gliomas. POU3F4 knockdown reduced the growth and metastasis of glioma cells and increased apoptosis. Mechanistic studies demonstrated that POU3F4 knockdown did not affect the messenger ribonucleic acid (mRNA) or protein expression of PI3K or AKT but significantly reduced their phosphorylation. In addition, JASPAR database prediction and ChIP experiments confirmed that KLF15 is an upstream transcription factor of POU3F4, which can directly bind to the POU3F4 promoter region and positively regulate its expression. Functional recovery experiments have shown that the KLF15-POU3F4 axis promotes the proliferation, migration, and invasion of glioma cells by activating the PI3K/AKT signaling pathway.<h4>Conclusions</h4>POU3F4 was upregulated in glioma and facilitated glioma cell growth and metastasis while suppressing apoptosis. KLF15 is its upstream transcription factor that positively regulates the expression of POU3F4. The KLF15-POU3F4 axis promotes glioma progression by activating the PI3K/AKT signaling pathway.

SOX6
Also flagged:PDorganizationaxonsphosphorylationsynapsescell
Journal Article 2026-07-28 ✓ 4 Snippets Chen C, He Q, Tombesi G, Napier E, Jaconelli M, Moreno-Ramos OA, Serio H, Naaldijk Y, Promes V, Schneeweis A, Quinn K, Nasios C, Greggio E, Kozorovitskiy Y, Arango D, Khan AR, Alessi DR, Dombeck DA, Hilfiker S, Awatramani R, Parisiadou L.
In-Text Gene Mentions

…a ventrally biasedSox6+ /Aldehyde Dehydrogenase…

…models demonstrated thatSox6/Aldh1a1 markers molecularly d…

…subtypes marked bySOX6(Fig. 1E ).…

…These particularSOX6+ populations, including the…

Show Full Abstract

Parkinson's disease (PD) is defined pathologically by loss of dopamine-producing neurons in the substantia nigra pars compacta (SNc). Yet synaptic dysfunction emerges much earlier, making it essential to define the mechanisms that drive early nigrostriatal deregulation. In the SNc, molecularly distinct dopamine neuron subtypes show differential susceptibility to PD. Here, we used intersectional genetic mouse models to determine how the PD-linked kinase LRRK2 affects vulnerable dopamine subtypes. Immunofluorescence and proximity-labeling proteomics revealed enriched LRRK2 expression in vulnerable dopamine neuron subclusters. High-resolution imaging showed that pathogenic LRRK2 disrupts presynaptic release-site organization in vulnerable dopamine axons, leading to reduced spontaneous and evoked striatal dopamine release in vivo. Proteomic analyses further showed that mutant LRRK2 increases phosphorylation of RAB3 proteins, impairing their interaction with the active-zone effectors RIM1 and RIM2. Together, these findings highlight a subtype-specific, cell-autonomous mechanism by which pathogenic LRRK2 impairs PD-vulnerable nigrostriatal synapses and provide a framework for therapeutic strategies targeting early synaptic deficits in PD.

Also flagged:coronary artery diseasedeathhemostasisHLA-CCDKN2ACDKN2B
Journal Article 2026-07-28 No Snippets Mancini I, Pagliari MT, Sadeghian S, Abbasi SH, Poorhosseini H, Boroumand MA, Lotfi-Tokaldany M, Pappalardo E, Agosti P, Rosendaal FR, Peyvandi F.
Show Full Abstract

<h4>Background</h4>Coronary artery disease (CAD) is a leading cause of death worldwide. Evidence of genetic predisposition is derived mostly from studies of Europeans and East Asians.<h4>Objectives</h4>To test selected variants for association with early-onset CAD.<h4>Methods</h4>We performed a case-control study of 697 young angiography-defined CAD cases (women aged <55 years, men <45) and 911 age- and sex-matched controls in Iran. We tested 24 variants (12 established CAD loci, 12 candidates in hemostasis genes) using age- and sex-adjusted logistic regression, stratified by ethnicity. A 6-variant unweighted genetic risk score (GRS) was built from the top loci. Additive interaction with cardiovascular risk factors was assessed by relative excess risk due to interaction.<h4>Results</h4>Of 12 established loci, <i>HCG27</i>-<i>HLA-C</i>, <i>CDKN2A</i>/<i>CDKN2B</i>, and <i>SORT1</i> showed nominal or near-nominal replication and 4 were directionally aligned with prior literature, whereas 5 showed no association. Among hemostasis candidates, <i>F5</i> rs4524 was nominally associated with increased risk, and <i>TSPAN15</i> rs78707713 and <i>F11</i> rs2289252 suggested reduced risk. Ethnicity-stratified analyses indicated nominal or suggestive ancestry-specific effects at <i>SORT1</i>, <i>HCG27</i>-<i>HLA-C</i>, <i>CDKN2A</i>/<i>CDKN2B</i>, <i>LPA</i>, <i>VWF</i>, <i>MIA3</i>, and <i>CXCL12</i>. The GRS (range, 2-11 alleles/person) yielded a per-allele odds ratio of 1.20 (95% CI, 1.12-1.29), ie, a 5.2-fold higher risk across the observed range. Combining GRS with metabolic comorbidities showed super-additive effects (relative excess risk due to interaction, 6.66; 95% CI, 2.04-11.28).<h4>Conclusion</h4>Ten variants, including 3 previously linked to venous thrombosis, showed nominal or suggestive association with early-onset CAD in Iranians or specific ethnic groups. Genetic burden substantially amplified risk in the presence of metabolic comorbidities. Our findings underscore the need for ancestry-aware studies in multiethnic populations.

bioRxiv 2026-07-28 Preprint (No Snippets API) Tripathi K, Stojanovic L, Gohari Z, Abdelrheem M, Santos G, Tyler A, Cooper B, Lapidus RG, Perkins D, Heredia A, Nephew KP, Baylin SB, Topper MJ, Baer MR, Rassool FV.
Show Full Abstract

TP53 -mutated acute myeloid leukemia (AML) has dismal outcomes with current treatments and represents a critical unmet need. TP53 -mutated AML is proposed to be susceptible to immunotherapeutic approaches but, to date, there is no established immunotherapy for this sub-group. Expression of stimulator of interferon genes (STING), a key innate immune driver that activates interferon (IFN) signaling, is decreased by epigenetic silencing or mutation in many cancers, including those with TP53 mutations. Here, we report that response to the next-generation synthetic STING agonist C92 is potentiated in AML cell lines and primary cells with TP53- mutated versus wild-type (WT) cells, representing a previously undescribed vulnerability of these leukemia cells to STING small molecule therapies. Moreover, combining treatment with the DNA methyltransferase inhibitor (DNMTi) decitabine (DAC), significantly increases STING activation, with marked transcriptome-wide increase in repetitive elements (REs) and upregulation of a critical set of interferon-related genes. Cell death in TP53 KO versus WT AML is specifically dependent on innate immune zinc finger NFX1-type containing 1 (ZNFX1) and Z-DNA-binding protein 1 (ZBP1) driving increased cleavage and activation of Receptor-Interacting-Serine/Threonine-Protein Kinase 3 (RIPK3) and mixed lineage kinase domain-like protein (MLKL), suggesting mechanisms of necroptosis. Finally, C92 and DAC combination significantly reduces leukemia burden in humanized AML mouse models, accompanied by increased immune responses, including cytokines and cytotoxic T lymphocytes in the leukemia microenvironment. These results support development of clinical trial strategies combining STING agonists with DNMTis for patients with TP53 -mutated AML. <h4>Summary</h4> TP53-mutated AML potentiates effects of novel next-generation STING agonist C92, with unique allosteric and non-cyclic dinucleotide (non-CD) mechanism of action, inducing increased STING activation and cytokine release STING agonists and DNMTis, synergistically increase STING activation with marked transcriptome-wide increase in repetitive elements (REs) and upregulation of a critical set of interferon-related genes in TP53 -mutated AML STING agonists induce necroptosis via a STING-ZNFX1-ZBP1-necroptosis axis in TP53 -mutated AML. This drug combination reduces leukemia burden, activates immune responses in AML models and supports translation for high-risk AML patients. <h4>Statement of Translational Relevance</h4> This pre-clinical study identifies a novel therapeutic vulnerability in ( TP53 )-mutated acute myeloid leukemia (AML), a poor prognosis subtype with a critical unmet need. Novel next-generation STING agonist C92, with unique allosteric and non-cyclic dinucleotide (non-CD) mechanism of action, induces increased STING activation and cytokine release, compared with WT TP53 in AML cell lines and primary cells, and has superior STING activity with respect to several STING agonists currently in clinical studies. Combining C92 treatment with the DNA methyltransferase inhibitor (DNMTi) decitabine (DAC) synergistically increases STING activation, with marked transcriptome-wide increase in repetitive elements (REs) and upregulation of a critical set of interferon-related genes, driving ZNFX1-driven inflammatory necroptotic cell death. Utilizing humanized mouse models, C92 in combination with DAC significantly reduces leukemia burden and enhances cytotoxic T-cell responses in the tumor microenvironment, supporting clinical translation for high-risk AML patients.

PEBP1
Also flagged:Traumatic brain injuryanxietyneuropsychiatric disordersposttraumatic anxietybrain injury
Journal Article 2026-07-27 ✓ 2 Snippets Li MG, Qian XB, Zhang HL, Li D, Ji L, Xu XC, Ding JS, Yin LJ, Zhang L, Xu GY, Gao R.
In-Text Gene Mentions

… Calr‐R CGATATTCTGCTCATGCTTCACPebp1‐F TGGTCAACATGAAGGGTAATGA Pebp…

…Pebp1‐F TGGTCAACATGAAGGGTAATGAPebp1‐R CCAGGTTATACTTCTTGCGGAA Clcn…

Show Full Abstract

Traumatic brain injury (TBI) is a prevalent cause of secondary neuropsychiatric disorders, with post-traumatic anxiety significantly worsening long-term outcomes. However, the key neural circuits and molecular mechanisms underlying post-TBI anxiety remain poorly understood. Here, we show that TBI patients with frontal lobe injuries and anxiety exhibited increased activity and enhanced functional connectivity in the anterior insular cortex (aIC) and lateral orbitofrontal cortex (lOFC). Mechanistically, we established a mouse model of moderate frontal lobe TBI, categorizing animals into anxious and non-anxious TBI groups. BOLD-fMRI and c-Fos expression analyses revealed that mice with post-traumatic anxiety also exhibited increased activity in the aIC and lOFC, as well as heightened activity in the aIC-lOFC glutamatergic circuit. Optogenetic and chemogenetic modulation of this circuit bidirectionally regulated post-traumatic anxiety. Single-cell RNA sequencing of aIC glutamatergic neurons identified a specific downregulation of KCNC3 in anxious TBI mice. Functional validation confirmed that KCNC3 downregulation mediates hyperactivity in the aIC-lOFC glutamatergic circuit and induces post-traumatic anxiety. Together, these findings unveil a critical role of TBI‑induced KCNC3 downregulation in aIC glutamatergic neurons in driving hyperactivity of the aIC-lOFC glutamatergic circuit and resulting post‑traumatic anxiety, and they suggest KCNC3 and the aIC-lOFC circuit as promising therapeutic targets for post‑TBI anxiety.

SOX6
Also flagged:axonalmyelinmultiple sclerosisdemyelinating disorders-nucleus
Journal Article 2026-07-27 ✓ 3 Snippets De Herdt D, Lefevere E, Brouwers V, Hartvig L, Geeraerts E, Hsiao CC, Chen JQA, Pinto R, Duvey G, Burbidge S, Harmeier A, Knuesel I.
In-Text Gene Mentions

…of stage-specific markers (SOX6, BMP4, TNS3, TCF7L2,…

…COP-associated markers (e.g.,SOX6, TNS3, FYN) showed…

…CLDN5, Claudin 5;SOX6, SRY-Box transcription factor…

Show Full Abstract

Myelination, driven by differentiation of oligodendrocyte precursor cells, is critical for metabolic and structural support and efficient axonal signal transmission in neurons. Loss of myelin is a hallmark of multiple sclerosis and other devastating demyelinating disorders. As demyelination persists, neurons become increasingly vulnerable, leading to neurodegeneration and chronic disability. Restoring myelin through endogenous repair mechanisms offers a promising therapeutic approach to mitigate progressive neuronal loss. One key regulator of myelination is the G protein-coupled receptor 17, GPR17, whose chronic upregulation in oligodendrocyte precursor cells is commonly seen with myelin injury. In line with single-nucleus transcriptomic data showing predominant expression of GPR17 in committed oligodendrocyte precursor cells, our postmortem immunohistochemical analyses of MS patient tissue revealed a significant upregulation of GPR17+/BCAS1+ oligodendrocyte precursor cells adjacent to and in demyelinated lesions. Importantly, remyelinated lesions lacked GPR17 immunoreactivity, consistent with a model in which sustained GPR17 expression is associated with demyelination and impaired oligodendrocyte precursor cell differentiation. To test the impact of pharmacological GPR17 inhibition on remyelination, we evaluated the effects of a novel, selective GPR17 antagonist in cuprizone-induced murine demyelination models. This toxin-induced approach has been widely used to study mechanisms of de- and remyelination, in the absence of the full inflammatory complexity of demyelinating diseases such as multiple sclerosis. We show that oral treatment results in robust functional recovery consistent with remyelination, as evidenced by improved spatial memory and recovery of visual evoked potential latency delays. GPR17 antagonism also accelerated structural remyelination in the corpus callosum and optic nerve. Together, these findings support a role for pharmacological GPR17 antagonism in promoting remyelination and highlight this G protein-coupled receptor as a promising therapeutic target for demyelinating disorders.

VRK2
Also flagged:KSHV infectionprimary infectioninnate immunityviral infectionspersistent infectionenvelope
Journal Article 2026-07-27 ✓ 5 Snippets Yu CJ, Damania B.
In-Text Gene Mentions

…erine/threonine kinases, VRK1,VRK2and VRK3, named…

…three members: VRK1,VRK2, and VRK3.…

…that VRK1 andVRK2are more closely…

…major isoform ofVRK2associates with the…

…Notably,VRK2has been shown…

Show Full Abstract

Kaposi sarcoma-associated herpesvirus (KSHV) is an oncogenic gammaherpesvirus that is associated with several human malignancies, and primary infection by KSHV can activate both DNA and RNA sensing pathways. Host innate immunity is a rapid, first-line defense against foreign pathogens, where pattern recognition receptors detect virus-associated antigens and activate the type I interferon response to prime the cell to an antiviral state to limit viral infections. However, viruses such as gammaherpesviruses, have evolved mechanisms to co-opt host factors to antagonize these pathways to promote persistent infection. The cellular vaccinia-related kinase (VRK) family is a trio of serine/threonine kinases, VRK1, VRK2 and VRK3, named for their homology to the vaccinia virus B1 kinase. The VRKs are involved in many cellular processes, including nuclear envelope assembly during mitosis and the DNA damage response. However, the role of the VRKs in KSHV infection and innate immunity has not previously been explored. We found that VRK3 is upregulated in response to KSHV primary infection of endothelial cells. VRK3 is also upregulated during KSHV reactivation from latency. Knockdown of VRK3 limited KSHV primary infection and lytic reactivation and resulted in increased activation of TBK1 and IRF3 and subsequent upregulation of interferon stimulated genes. Overexpression of VRK3 reversed this phenotype. Furthermore, we are also the first to demonstrate that VRK3 is a negative regulator of the interferon response even in the absence of viral infection. Collectively, our data highlight the importance of the host factor, VRK3, as a novel suppressor of the type I interferon response during the KSHV viral lifecycle.

PRDX6
Also flagged:bronchopulmonary dysplasialung diseasecell-cycle
Journal Article 2026-07-27 ✓ 1 Snippet Chang HP, Cantu A, Cantu Gutierrez ME, Lingappan K.
In-Text Gene Mentions

…induction of <i>Hmox1</i>, <i>Prdx6</i>, and <i>Anxa1</i>. <i>Hif…

Show Full Abstract

Bronchopulmonary dysplasia (BPD), a lung disease associated with preterm birth, is characterized by arrested alveolarization and impaired pulmonary vascular growth. Exposure to early life hyperoxia is a disease-contributing factor, and endothelial determinants of injury versus repair remain incompletely defined. We hypothesized that endothelial-specific loss of <i>Hif-1α</i> during the saccular stage of development would adversely impact lung development and augment injury after hyperoxia exposure. Tamoxifen-inducible endothelial-specific <i>Hif-1α</i> knockout and <i>Hif-1α</i><sup>fl/fl</sup> littermates were exposed to room air or 95% O<sub>2</sub> from <i>postnatal day</i> (PND) <i>1</i>-<i>5</i>, and lungs were analyzed at PND7 and PND21 for morphometry, vascular density, and lung endothelial transcriptomic response. Endothelial <i>Hif-1α</i> deletion had no impact on baseline alveolarization but reduced vascular density under normoxia and significantly worsened hyperoxia-induced alveolar simplification, septal thickening, and vascular rarefaction. Hyperoxia increased endothelial proliferation in both genotypes after 48 h of recovery in normoxia. Bulk RNA sequencing of the lung endothelial cells revealed a shared hyperoxia injury program (e.g., <i>Inhba</i>, <i>Serpine1</i> induction; <i>Esm1</i>, <i>Gpihbp1</i>, <i>Car2</i> suppression). The transcriptomic response in <i>HIF1α</i><sup>ECKO</sup> endothelial cells was significantly muted compared with wild-type endothelial cells, lacking induction of <i>Hmox1</i>, <i>Prdx6</i>, and <i>Anxa1</i>. <i>Hif-1α</i>-deficient endothelial cells upregulated <i>Col18a1</i> and <i>Ackr3</i> and showed enrichment of TNF-NF-κB, TGF-β, and cell-cycle checkpoint pathways, consistent with maladaptive remodeling. Cross-referencing with human single-cell BPD data demonstrated that genes identified in the murine hyperoxia model exhibit conserved but heterogeneous endothelial expression patterns across BPD disease states. These findings identify endothelial <i>Hif-1α</i> as a central determinant of recovery after neonatal hyperoxia exposure.<b>NEW & NOTEWORTHY</b> This study identifies endothelial hypoxia-inducible factor-1α (HIF-1α) as a critical determinant of neonatal lung response to hyperoxia. Using an inducible endothelial-specific <i>Hif-1α</i> knockout model, we demonstrate that loss of endothelial <i>Hif-1α</i> exacerbates hyperoxia-induced impairments in pulmonary vascular development and alveolarization, key pathological features of bronchopulmonary dysplasia.

OLFM4
Also flagged:ageingPaneth cell differentiation
Journal Article 2026-07-27 ✓ 2 Snippets Wei B, Wang D, Sun H, Ren P, Wang Y, Chang Y, Wang Y, Tang Q.
In-Text Gene Mentions

…Lgr5, Ascl2 andOlfm4, elevated numbers of…

…elevated numbers ofOlfm4-positive and Ki67-positive ce…

Show Full Abstract

<h4>Background</h4>Intestinal ageing is characterized by progressive epithelial deterioration, barrier dysfunction and impaired regenerative capacity, which together contribute to age-related intestinal decline. Sulfated fucans derived from Saccharina japonica (SJ-FUC) are marine polysaccharides with potential bioactivities, although their role in intestinal ageing remains unclear. This study investigated the protective effects of SJ-FUC in a D-galactose-induced ageing mouse model.<h4>Results</h4>Administration of SJ-FUC significantly alleviated intestinal ageing-associated phenotypes by reducing oxidative stress, suppressing senescence-associated secretory phenotype-related inflammatory cytokines, and downregulating the senescence markers P53, P16 and P21. Histological analysis showed marked improvement in ileal architecture and epithelial barrier integrity. SJ-FUC also mitigated ageing-associated regenerative decline, as indicated by increased expression of intestinal stem cell-related markers Lgr5, Ascl2 and Olfm4, elevated numbers of Olfm4-positive and Ki67-positive cells in ileal crypts, and restoration of Wnt/β-catenin signalling. In addition, SJ-FUC promoted goblet and Paneth cell differentiation. 16S rRNA sequencing further showed that SJ-FUC remodelled gut microbial composition, characterized by enrichment of beneficial taxa such as Lactobacillus and reduction of potentially detrimental bacteria including Bacteroides.<h4>Conclusion</h4>Sulfated fucans from Saccharina japonica alleviate intestinal ageing by preserving epithelial integrity and restoring regenerative capacity, supporting their potential as functional marine polysaccharides for improving age-related intestinal dysfunction. © 2026 Society of Chemical Industry.

Also flagged:Epilepsy-Dyskinesia Syndromesneurogenetic disordersepilepsymovement disordersEDSMD
Journal Article 2026-07-27 No Snippets Widdess-Walsh P.
Show Full Abstract

No abstract available.

HTT
Also flagged:obstructive sleep apnea
Journal Article 2026-07-27 ✓ 2 Snippets Liu J, Wu W, Sun X, Cai Y, Chen J, Cao D.
In-Text Gene Mentions

…= 0.040), and5-HTT(mean Rho =…

…receptors, DAT, and5-HTTwas significantly associated…

Show Full Abstract

<h4>Objectives</h4>To evaluate whether the spatial pattern of obstructive sleep apnea (OSA)-related regional magnetic susceptibility alterations colocalizes with the normative distribution of neurotransmitter receptors and transporters.<h4>Methods</h4>Regional magnetic susceptibility was assessed in 36 OSA patients and 30 screen-negative controls (SNC) using quantitative susceptibility mapping (QSM). The spatial colocalization between OSA-related QSM alterations and the normative distribution of receptors/transporters was examined using PET-derived neurotransmitter maps included in NiSpace. Clinical correlates of colocalization strength were also explored.<h4>Results</h4>Compared with SNC, patients with OSA showed increased magnetic susceptibility in the left insula, left middle temporal gyrus, and left inferior temporal gyrus (all P<sub>FDR</sub> = 0.047), with similar trends in the right putamen and right transverse temporal gyrus that did not survive correction. These QSM alterations colocalized with the normative distribution of NMDA receptor (mean Rho = 0.177, P<sub>Meff</sub> = 0.001), Dopamine transporter (DAT) (mean Rho = 0.149, P<sub>Meff</sub> = 0.040), and 5-HTT (mean Rho = 0.153, P<sub>Meff</sub> = 0.040). The strength of colocalization with NMDA receptors, DAT, and 5-HTT was significantly associated with disease severity.<h4>Conclusion</h4>This study provides convergent evidence linking OSA-related magnetic susceptibility alterations, consistent with iron-related changes, to the normative distribution of glutamatergic, serotonergic, and dopaminergic neurotransmitter systems. These spatial associations correlated with disease severity, highlighting the potential of spatial colocalization approaches for understanding neurochemical vulnerability in OSA.

SOX6
Also flagged:ossificationmineralizationcancergene expressioncell divisionmetabolism
Journal Article 2026-07-27 ✓ 2 Snippets Bi X, Liu B, Li B, Zhao M, Tian H, Chen J.
In-Text Gene Mentions

…, PTCH1 ,SOX6, YWHAZ ,…

…BMP4, PTCH1 ,SOX6, YWHAZ ,…

Show Full Abstract

<h4>Background</h4>Deer antler is the only mammalian organ capable of periodic complete regeneration. Its astonishing growth rate-reaching several centimeters per day-provides a unique model for research in tissue regeneration and developmental biology. This rapid growth relies on the protective and signaling functions of the skin, as well as the vigorous proliferation and differentiation capacity of mesenchymal cells. Although previous studies have identified some key factors involved in antler growth, systematically comparing the transcriptomic profiles of these two core tissues (skin and mesenchyme) to identify candidate genes regulating their synergistic growth is crucial for deciphering the molecular mechanisms underlying this "ultra-fast" growth.<h4>Methods</h4>The Illumina NovaSeq 6000 sequencing platform was used to perform transcriptome sequencing on the antler tissues of the <i>Cervus elaphus xanthopygus</i> (Dongbei red deer) with a growth period of approximately 60 days. Bioinformatics methods were used to identify the transcriptional expression of genes in the antler tissues, and the expression levels of some genes were tested by fluorescence quantitative PCR.<h4>Results</h4>A total of 109.82 Gb of transcriptome data was generated from the skin and mesenchymal tissues of antlers, and 40,023 transcripts were obtained. There were 3,530 genes with differential expression between the skin and the mesenchymal tissues of antlers. Genes with upregulated expression levels in the mesenchymal layer were enriched in phosphate-containing compound metabolic processes and multiple biological processes related to bone development such as skeletal system development, cartilage development, regulation of ossification, and enamel mineralization. Among the genes enriched in the cancer pathway and the PI3K-Akt signaling pathway, those that may play an important role in the rapid growth process of deer antlers were screened, including <i>MDM2</i>, <i>RPS6KB1</i>, <i>CASP3</i>, <i>BMP4</i>, <i>PTCH1</i>, <i>SOX-6</i>, <i>YWHAZ</i>, and <i>HSP90B1</i>.<h4>Conclusions</h4>The discovery of these genes provides a reference for a further in-depth understanding of the mechanism of the rapid growth of antlers.

SOX6
Also flagged:ossificationtissue morphogenesismineralizationchondrogenesisextracellularorganization
Journal Article 2026-07-27 ✓ 4 Snippets Xi X, Cao X, Zhou Y, Tian Z, Hou N, Li Z, Zhou Z, Li X, Su H.
In-Text Gene Mentions

…transcription factors SOX9,SOX6, and RUNX3, whose…

…elevated expression ofSOX6and the cartilage…

…studies, which reportedSOX6to be predominantly…

…transcription factors SOX9,SOX6, RUNX3, and ZNF281…

Show Full Abstract

<h4>Background</h4>The antler primary growth center, located at the distal tip of the growing antler, comprises five consecutive tissue zones beneath the velvet skin. Because the outermost reserve mesenchyme contains blastema progenitor cells with multipotent differentiation capacity, antler regeneration recapitulates embryonic skeletal development through endochondral ossification (ECO). The molecular mechanisms governing cell fate decisions and tissue morphogenesis across these zones remain poorly understood.<h4>Methods</h4>We profiled the proteome of the sika deer (<i>Cervus nippon</i>) antler growth center across all five tissue zones using the Orbitrap Astral platform in data-independent acquisition (DIA) mode. Protein identification and quantification were performed with DIA-NN. Proteome dynamics were analyzed by integrating three complementary clustering approaches including weighted gene co-expression network analysis (WGCNA), Fuzzy C-means clustering, and monotonic feature selection. Differentially expressed proteins were annotated by gene ontology (GO) enrichment analysis. Transcriptomic data from the same tissue zones were reanalyzed to assess mRNA-protein concordance.<h4>Results</h4>A total of 8,173 proteins were identified across the five tissue zones, representing the most comprehensive proteomic coverage of the antler growth center. Clustering analyses resolved distinct protein expression modules corresponding to sequential ECO stages from mesenchymal proliferation in the reserve mesenchyme to cartilage mineralization in the innermost zone. Deep proteome coverage enabled detection of low-abundance chondrogenic transcription factors SOX9, SOX6, and RUNX3, whose spatial expression matched their known roles in chondrogenesis. At the protein level, the reserve mesenchyme co-expressed 11 embryonic and 23 mesenchymal stem cell markers, indicating that antler stem cells represented a unique mesenchymal stem cell (MSC) population possessing partial embryonic stem cell (ESC)-like features.<h4>Conclusions</h4>This study provides a spatially resolved proteomic atlas of the complete antler growth center and identifies key regulatory proteins at each stage of endochondral ossification. The findings offer new insights into progenitor cell characteristics, transcription factor activity, and protein dynamics during bone development, with potential relevance to bone repair and regenerative medicine.

Also flagged:bindingSynthesis
Journal Article 2026-07-27 No Snippets Bryant RT, Handford RC, Handunneththige S, Teat SJ, Hall MB, Tilley TD.
Show Full Abstract

Fe(0) dinitrogen complexes [SiP<sub>3</sub> <sup>R</sup>]Fe-N[triple bond, length as m-dash]N-Fe[SiP<sub>3</sub> <sup>R</sup>] (1-R; [SiP<sub>3</sub> <sup>R</sup>] = PhSi(CH<sub>2</sub>PR<sub>2</sub>)<sub>3</sub>; R = <sup><i>i</i></sup> Pr, Ph) are accessed by one- or two-electron reduction of Fe(i) and Fe(ii) chloride complexes [SiP<sub>3</sub> <sup><sup><i>i</i></sup> Pr</sup>]FeCl or κ<sup>2</sup>-[SiP<sub>3</sub> <sup>R</sup>]FeCl<sub>2</sub> (R = <sup><i>i</i></sup> Pr, Ph), respectively, and fully characterized by means of multinuclear NMR spectroscopy, single-crystal X-ray diffraction (SC-XRD), and Mössbauer spectroscopy. Complexes 1-R represent rare examples of bimetallic Fe(0) compounds with dinitrogen as a bridging ligand and have an overall spin of <i>S</i> = 0. Heating 1-R in the presence of SiH<sub>4</sub> gas resulted in four-fold Si-H activation to furnish diiron complexes [SiP<sub>3</sub> <sup>R</sup>](H)<sub>2</sub>Fe[double bond, length as m-dash]Si[double bond, length as m-dash]Fe(H)<sub>2</sub>[SiP<sub>3</sub> <sup>R</sup>] (2-R; R = <sup><i>i</i></sup> Pr, Ph), which were characterized by multinuclear NMR spectroscopy, SC-XRD, Mössbauer spectroscopy, and density functional theory calculations. Complexes 2-R exhibit the shortest iron-silicon bonds to date and nearly linear Fe[double bond, length as m-dash]Si[double bond, length as m-dash]Fe cores. This work extends a previously developed strategy for SiH<sub>4</sub> activation from cobalt to iron, while offering insight into the silicon-atom extrusion from SiH<sub>4</sub> in molecular systems.

TNFSF4
Also flagged:co-infectionlatent tuberculosisTBHIV infectionimmune responseslatent TB
Journal Article 2026-07-27 ✓ 1 Snippet Sharan R, Zou Y, Lai Z, Weldon K, Bradley T, Luo X, Wu H, Khader SA, Kaushal D.
In-Text Gene Mentions

…HSP90B1-TLR7 , andTNFSF4-TNFRSF4 remained enriched, wh…

Show Full Abstract

Using single-cell transcriptomics of bronchoalveolar lavage cells from <i>Mtb</i>/SIV co-infected rhesus macaques on cART, we reveal profound immune dysregulation during early SIV co-infection of latent tuberculosis. SIV induces a sharp decline in CD4<sup>+</sup> T cells, NK, and NKT cells, with incomplete recovery of <i>Mtb</i>-specific T<sub>H1</sub> effector responses despite viral suppression. Instead, a persistent T<sub>H17</sub>-skewed environment emerges, alongside sustained myeloid inflammation driven by Type I interferon signaling and pro-inflammatory regulators such as <i>KLF6</i> and <i>NFKB1</i>. Ligand-receptor network analyses demonstrate expanded CD4<sup>+</sup> T cell-macrophage crosstalk and loss of immune homeostasis that cART fails to fully restore. These findings expose how SIV remodels the pulmonary immune landscape to impair protective immunity against <i>Mtb</i>, providing a transcriptomic framework to explain TB reactivation in HIV infection. Our work highlights the urgent need for adjunctive immunotherapies to complement cART, aiming to rebalance immune responses and improve TB control in co-infected individuals.

CACNA1E
Also flagged:autism spectrum disorderautismsecretionaction potentialssynaptic transmissionsynapses
Journal Article 2026-07-27 ✓ 2 Snippets Ma K, Webb M, Newton SS, Lee FS, Qin L.
In-Text Gene Mentions

…Cav 1.3), andCacna1e(encoding Cav 2.3)…

…p = 0.68;Cacna1e: male BDNF…

Show Full Abstract

Males are more commonly diagnosed with autism spectrum disorder (ASD) than females with a ratio of about 4-1. However, the neural mechanisms underlying the sex differences in ASD are unknown. Social deficits are the core symptoms of patients with ASD. Previous studies showed that diminished activity-dependent brain-derived neurotrophic factor (BDNF) signaling induced differential severity of autism-like social preference deficits in male and female mice by using a mouse model with genetic knock-in of human BDNF methionine (Met) allele, which significantly decreased activity-dependent BDNF release without affecting basal BDNF secretion. Here, we investigated the synaptic mechanisms for diminished activity-dependent BDNF-induced differential severity of social preference deficits in males and females. The prefrontal cortex (PFC) is a critical brain region for social behaviors. Whole-cell patch-clamp brain slice recordings showed that diminished activity-dependent BDNF signaling differentially increased the frequency of spontaneous action potentials (sAPs) of pyramidal neurons in the PFC of male and female BDNF<sup>+/Met</sup> mice. The frequency of sAPs in male BDNF<sup>+/Met</sup> mice was higher than in female BDNF<sup>+/Met</sup> mice. Diminished activity-dependent BDNF signaling differentially enhanced excitatory synaptic transmission and dampened inhibitory synaptic transmission of pyramidal neurons at pre- and post- synapses in males and females, which were mediated by dysregulated transcriptional levels of key synaptic genes. Chemogenetic inhibition of pyramidal neurons in the PFC of BDNF<sup>+/Met</sup> mice was sufficient to ameliorate autism-like social preference deficits in males and females. This study reveals synaptic mechanisms underlying the differential severity of social preference deficit in male and female BDNF<sup>+/Met</sup> mice, which provides a potential neural basis for sex differences in male and female ASD patients with and without the BDNF Val66Met SNP.

Also flagged:immune responsessecretiondetoxificationantiviral responsescell cyclegene expression
Journal Article 2026-07-27 No Snippets Li S, Stachon T, Fries FN, Seitz B, Ludwig N, Szentmáry N.
Show Full Abstract

<b>Purpose:</b> To characterize the messenger RNA (mRNA) and microRNA (miRNA) expression profiles of the normal human cornea and conjunctiva using impression cytology (IC) samples and to investigate their molecular characteristics and regulatory networks. <b>Methods:</b> Corneal and conjunctival IC samples were collected from healthy subjects. Whole-transcriptome and miRNA sequencing were performed, followed by differential expression and bioinformatics analyses. Regulatory networks, protein interaction networks, and functional enrichment analyses were constructed. Selected genes and miRNAs were validated by RT-qPCR. <b>Results:</b> A total of 1676 differentially expressed genes and 175 differentially expressed miRNAs were identified between the cornea and conjunctiva. Functional analyses revealed that genes showing higher expression in the cornea were mainly associated with epithelial structure, barrier function, and antiviral immune responses. In contrast, genes showing higher expression in the conjunctiva were primarily involved in immune regulation, secretion, metabolic detoxification, and tissue remodeling. PPI network analysis showed that hub genes in the cornea were predominantly interferon-stimulated genes related to antiviral responses, while those in the conjunctiva were mainly involved in cell cycle regulation and metabolic detoxification. GO and KEGG analyses further supported these functional distinctions. RT-qPCR validation generally supported the expression patterns identified by RNA sequencing. <b>Conclusions:</b> Our findings reveal that the cornea is characterized by gene expression programs supporting epithelial homeostasis, barrier function, and antiviral immunity, whereas the conjunctiva exhibits transcriptional signatures related to immune surveillance, secretion, metabolic processing, and tissue remodeling. The miRNA-mRNA regulatory networks constructed in this study provide new insights into the molecular regulatory mechanisms of the ocular surface and offer a theoretical basis for future research into disease mechanisms and targeted therapeutic strategies.

BTN2A2BTN2A1
Also flagged:malignant tumorreverse transcriptionnasopharyngeal carcinomapathogenesisvirusEBV) infection
Journal Article 2026-07-27 ✓ 3 Snippets Liang Q, Cao C, Zou Z, Peng Y, Feng C.
In-Text Gene Mentions

BTN2A1, CD274, CD276, CD47,…

…seven genes (e.g.,BTN2A1, CD276, LGALS9) were…

…checkpoint genes (includingBTN2A2, CD160, TNFRSF14), while…

Show Full Abstract

<h4>Background</h4>Nasopharyngeal carcinoma (NPC) is a malignant tumor of the nasopharyngeal mucosal epithelium. The aryl hydrocarbon receptor (AhR)-a widely distributed nuclear receptor regulating adaptive adverse responses-is confirmed carcinogenic upon activation. Thus, this study aims to identify novel biomarkers for NPC treatment.<h4>Methods</h4>Relevant data were obtained from public databases. Biomarkers were developed through the application of differential expression analysis, univariate Cox regression, and machine learning algorithms. Molecular mechanisms were then explored through immune infiltration and molecular regulatory networks. Additionally, the drug sensitivity analysis revealed potential differences in sensitivity to chemotherapy drugs. The experimental verification was conducted using reverse transcription quantitative polymerase chain reaction (RT-qPCR).<h4>Results</h4>Cholinergic receptor nicotinic beta 2 subunit (CHRNB2), adenylate cyclase 4 (ADCY4), and cell division cycle 6 (CDC6) were identified as biomarkers. CHRNB2 and CDC6 were highly expressed, while ADCY4 was lowly expressed in NPC. ADCY4 showed a significant positive correlation with plasmacytoid dendritic cells [correlation coefficient (cor) =0.48, P<0.001]. In contrast, CDC6 exhibited a strong negative correlation with central memory CD4 T cells (cor =-0.75, P<0.001), while CHRNB2 was significantly negatively correlated with activated B cells (cor =-0.50, P<0.001). A total of 9 microRNAs (hsa-miR-26a-5p) and 31 long non-coding RNAs (lncRNAs) (GAS5) associated with biomarkers were predicted. Patients with high ADCY4 expression demonstrated a higher half-maximal inhibitory concentration (IC<sub>50</sub>) value for gemcitabine compared to those with low expression. However, the opposite trend was observed for CDC6 and CHRNB2.<h4>Conclusions</h4>This study identified CHRNB2, ADCY4, and CDC6 as candidate biomarkers and provided preliminary clues for further exploration of potential therapeutic strategies for NPC.

Also flagged:SynthesisH. pylori infectionduodenal ulcersmucosa-associated lymphoid tissue (MALT) lymphomagastric cancerpenicillin allergy
Journal Article 2026-07-27 No Snippets D'Agostino I, Kovačević S, Shaldam MA, Ammazzalorso A, Campestre C, Guglielmi P, Coluccia M, Gilardoni A, Aykaç O, Bozbey Merde İ, Sisto F, Carradori S.
Show Full Abstract

<b>Background:</b> Among natural products, vanillin (<b>Van</b>), a major component of <i>Vanilla planifolia</i>, exhibits multiple bioactivities, including antimicrobial effects. <b>Methods:</b> In this study, <b>Van</b>, its analogues <i>o</i>-vanillin (<b>oVan</b>), <i>iso</i>-vanillin (<b>iVan</b>), ethylvanillin (<b>eVan</b>), and a library of newly synthesized derivatives were evaluated against <i>Helicobacter pylori</i> strains with distinct antibiotic susceptibilities. Time-kill kinetics, antibacterial spectrum, and viability in a normal gastric cell line GES-1, were also assessed. <b>Results: Van</b> showed minimal or no activity (MIC and MBC > 128 µg/mL), whereas structural modifications markedly improved anti-<i>H. pylori</i> activity, with MIC values as low as 4 µg/mL. Compounds <b>16V</b>, <b>20oV,</b> and <b>29eV</b> were among the most potent (MIC<sub>90</sub> = 4-16 µg/mL). Activity depended on both the vanilloid core and substituent type. The compounds were inactive against representative Gram-negative and Gram-positive bacteria (MIC > 128 µg/mL). Selected compounds preserved viability in GES-1 cells. Hierarchical clustering, artificial neural clustering, and principal component analysis identified potency-related architectural motifs and strain-specific activity. Docking against <i>H. pylori</i> urease suggested that several compounds, particularly <b>16V</b>, may interact with the enzyme, providing preliminary support for a possible involvement of this target. <b>Conclusions:</b> Systematic modification of the vanilloid scaffold generated selective and relatively non-cytotoxic anti-<i>H. pylori</i> hit compounds and confirmed the value of natural metabolites in antibacterial drug discovery.

bioRxiv 2026-07-27 Preprint (No Snippets API) Iennaco R, Maffezzini C, Maestri S, Scolz A, Cattaneo A, Murgia A, Trovesi C, Cammarota E, Vezzoli E, Falqui A, Felsenfeld DP, Vogt TF, Bachi A, Zuccato C, Cattaneo E.
Show Full Abstract

The Huntingtin gene ( HTT ) contains a conserved, yet expandable CAG repeat within exon 1. While the pathogenic expansion in Huntington’s Disease (HD) is well studied, the role of surrounding domains remains unclear. Using genome-edited mini-organoids and neurons, we dissected HTT exon 1 and found species-specific toxicity: the human variant caused more severe deficits than the mouse. Swapping the proline-rich domain (PRD) - the most divergent region - revealed its key role: the mouse PRD mitigated, while the human PRD worsened neuronal phenotypes. Omics profiling showed that pathogenic human exon 1 induced broad protein dysregulation, largely reversed by mouse PRD replacement. Bioinformatics implicated the actin cytoskeleton and transcriptional coactivator MKL2/MRTFB. We validated MKL2/MRTFB dysregulation in HD models and showed that restoring its expression rescued neuronal abnormalities. These findings highlight the PRD’s contribution to HD toxicity and point to MKL2/MRTFB and the cytoskeleton as candidate mediators.

PRDX6
Also flagged:pathogenesiskidney diseasesmitochondrialpost-translational modificationsextracellularacute kidney injury
Journal Article 2026-07-26 ✓ 1 Snippet Jia LH, Song YX, Bai QX, Li YR, Jia J, Tan RZ, Wang L.
In-Text Gene Mentions

…(PRDX5), and 1-Cys (PRDX6) members, serves as…

Show Full Abstract

Oxidative stress is a well-established driver in the pathogenesis and progression of various kidney diseases. The peroxiredoxin (PRDXs) family, comprising typical 2-Cys, atypical 2-Cys, and 1-Cys members, serves as essential thiol-dependent peroxidases that maintain cellular redox balance. Unlike classical antioxidant enzymes that solely scavenge reactive oxygen species, PRDXs are unique in their ability to undergo redox-sensitive structural transitions, functioning as molecular chaperones and intracellular signaling hubs. In the kidney, PRDXs exert multifaceted protective roles by preserving mitochondrial integrity and attenuating inflammatory and fibrotic signaling. Interestingly, beyond these canonical functions, several PRDX members exhibit context-dependent detrimental effects that paradoxically aggravate renal injury. Such dual functionality is regulated through sophisticated mechanisms, including specific post-translational modifications, molecular chaperone switching, and extracellular release as damage-associated molecular patterns. Although PRDXs represent promising therapeutic targets and biomarkers, their functional duality poses considerable challenges for drug development. Future efforts must focus on spatiotemporally precise regulation to selectively augment PRDXs-mediated defense while mitigating their injury-promoting effects.

DARS2
Also flagged:Leukodystrophiesgenetic disordersaxonsmitochondrialdisordershereditary diseases
Journal Article 2026-07-26 ✓ 2 Snippets Yang Z, Zhang W, Yu F, Duan X, Zhou M, Tang B.
In-Text Gene Mentions

…ial aspartyl-tRNA synthetase (DARS2) -related leukodystrophies, s…

…CT Computed tomographyDARS2Aspartyl-tRNA synthetase 2…

Show Full Abstract

Leukodystrophies (LDs), a group of heterogeneous genetic disorders, are characterized by selective involvement of cerebral white matter, including abnormal white matter development and/or progressive degeneration. Oligodendrocytes, astrocytes, microglia, axons, and the neurovascular unit collectively contribute to white matter homeostasis and disease progression. Recently, genomic sequencing has identified pathogenic variants in the alanyl-tRNA synthetase 1 (<i>AARS1</i>) and alanyl-tRNA synthetase 2, mitochondrial (<i>AARS2</i>) genes in LD-related phenotypes. Dysfunction of AARS1 and AARS2 proteins may impair cytosolic or mitochondrial tRNA aminoacylation, compromise editing fidelity, and disrupt mitochondrial homeostasis, which may lead to disruption of protein homeostasis, cellular stress responses, and energy failure. Alanyl-tRNA synthetase (AlaRS) impairments play an important role in the pathological processes of cytosolic and mitochondrial alanyl-tRNA synthetase-related disorders. These molecular defects are associated with characteristic neuroimaging patterns and diverse clinical manifestations observed in <i>AARS1</i>/<i>AARS2</i>-related disorders. This review summarizes current knowledge on the genetic basis, clinicopathological features, and molecular mechanisms of <i>AARS1</i>- and <i>AARS2</i>-related leukodystrophies, and discusses emerging therapeutic perspectives, with the aim of facilitating precision diagnosis and future targeted interventions.

Also flagged:ADAgingtranscription factorspathogenesisendoplasmic reticulumcircadian rhythm
Journal Article 2026-07-26 No Snippets Trivedi MR, Shah J, Su Y, Reiman EM, Wu T, Wang Q.
Show Full Abstract

Artificial Intelligence (AI) has been increasingly applied to investigate genetic irregularities associated with Alzheimer's Disease (AD). However, its potential to uncover deeper, more detailed molecular and cellular mechanisms remains underexplored, primarily due to limitations in integrating large-scale data and capturing the complex, cell-type-specific dynamics involved in AD pathology. Single-cell RNA sequencing (scRNA-seq) has emerged as a powerful tool in transcriptomics, offering high-resolution, cell-specific insights into complex biological systems. Despite this advancement, a significant gap remains in identifying both common and cell-type-specific transcriptomic signatures that define AD-related cellular and molecular processes. To address this, we propose a deep learning framework leveraging a Multi-Layer Perceptron (MLP) to classify AD versus control nuclei using scRNA-seq data from the Religious Orders Study/Memory and Aging Project (ROSMAP). We focus on microglial subclusters, particularly those representing homeostatic and activated states, to train the MLP model for optimal classification performance. We utilize the predicted embeddings from the MLP to model a disease progression trajectory for each of the datasets. Our model demonstrates strong performance in both classification and disease trajectory inference. To enhance interpretability, SHapley Additive exPlanations (SHAP) are applied to identify key AD-associated genes. Based on the most salient genes implicated in AD, we built transcription gene regulatory networks, revealing novel transcription factors and regulons for AD pathogenesis. These regulons highlight profound impacts of dysregulations of proteostasis, endoplasmic reticulum (ER) stress responses, and circadian rhythm on synaptic plasticity and neuronal survival in AD, offering a more holistic approach to drug target discovery compared to conventional single-target strategies, potentially leading to greater efficacy in slowing or reversing disease progression. This work demonstrates the transformative potential of AI in elucidating the molecular mechanisms of AD, offering improvements over traditional methods and uncovering novel insights into disease pathogenesis and potential therapeutic targets.

bioRxiv 2026-07-26 Preprint (No Snippets API) Bruno-Vignolo A, Arnaiz C, Fernandez-Chiappe F, Ricciuti A, Duarte LA, Ducrey I, Linenberg IM, Pollak CN, Ballestero PL, Propato-Lots M, Falzone CS, Beckwith EJ, Falzone TL, Muraro NI.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington’s disease is a severe neurodegenerative condition arising from an abnormal CAG repeat expansion in the HTT gene, which leads to the production of a mutant Huntingtin protein carrying an extended polyglutamine stretch. Although the field has largely centred on the toxic effects gained by this mutant protein, growing evidence points to the loss of normal wild-type Huntingtin function as an additional contributor to disease progression. Despite this, the cell-intrinsic roles of wild-type Huntingtin in neuronal biology remain poorly defined, in part because disentangling its specific contributions from broader network-level effects has proven technically challenging. To address this knowledge gap, we took advantage of the Drosophila huntingtin homolog ( htt ) and selectively manipulated its expression in the small lateral ventral neurons (sLNvs), a discrete cluster of just eight circadian pacemaker neurons that govern behavioral rhythmicity and sleep. Through targeted genetic knock-down, we show that reducing htt levels in sLNvs weakens the robustness of free-running circadian rhythms and substantially increases sleep in female flies. These behavioral changes are not rooted in developmental abnormalities, as restricting htt knock-down to adult flies reproduces the sleep phenotype across both beam-crossing and video-based locomotion assays. At the cellular level, htt loss disrupts dense core vesicle trafficking along sLNv axons, altering the fraction of motile vesicles and their velocity, and abolishing the time-of-day-dependent fluctuations in vesicle dynamics observed in these neurons. Complementary electrophysiological recordings using whole-cell patch-clamp further reveal that htt knock-down lowers action potential firing rates without perturbing resting membrane potential. Together, these results identify huntingtin as a cell-autonomous regulator of neuropeptide trafficking, neuronal excitability and circadian output. Beyond advancing our understanding of wild-type huntingtin physiology, this work carries direct relevance for HD therapeutic strategies, particularly those involving huntingtin-lowering approaches, by highlighting functions that may be unintentionally compromised.

OLFM4
Also flagged:stem cell proliferationchromatincell proliferationmethylationorganizationmembranes
Journal Article 2026-07-25 ✓ 5 Snippets Nagarajan P, Martin CJ, Keller AR, Akkaya-Colak KB, Festing MH, Mihaylova MM, Parthun MR.
In-Text Gene Mentions

…Primary antibodies includedOLFM4(CST-39141) and Cleaved…

…the ISC markerOLFM4to test whether…

…the number ofOLFM4positive cells following…

…in Ki67 andOLFM4staining in crypts.…

…an increase inOLFM4staining, and decreases…

Show Full Abstract

Stem cells are critical for the development and maintenance of tissue integrity. An important example is intestinal stem cells (ISCs) that generate all epithelial cell types necessary for formation of the intestinal lining. HAT1 is a histone acetyltransferase that acetylates newly synthesized histone H4 molecules on lysine residues 5 and 12 during replication-coupled chromatin assembly. Within the intestine, HAT1 is specifically expressed in intestinal stem and progenitor cells. We generated an inducible deletion of the Hat1 gene in intestinal epithelial cells. Following loss of Hat1, intestinal crypts became elongated, with an increase in stem and progenitor cell proliferation and an increase in the population of OLFM+ cells. Loss of Hat1 also resulted in alterations in ISC differentiation, including an increase in the number of Goblet cells and the mislocalization of Paneth cells into villi. HAT1 is specifically responsible for the acetylation of histone H4 lysine 5 (H4K5ac) in ISCs. Genome-wide characterization of HAT1-dependent H4K5ac in intestinal crypt cells indicates that the most significant loss of H4K5ac occurs regions of the genome that correspond to in lamina-associated domains, as defined in mouse embryonic fibroblasts. Loss of H4K5ac is accompanied by an increase in histone H3 K9 tri-methylation, indicating that HAT1 regulates genome-wide histone modification patterns in intestinal crypt cells. A direct role for HAT1 in ISC function was demonstrated using organoids in culture. HAT1 is required for differentiation in organoids and for the maintenance of Lgr5+ stem cells. These results indicate that HAT1 is required for the proper regulation of ISC renewal and differentiation.

Also flagged:metabolismlipolysislipogenesisobesityageingto
Journal Article 2026-07-25 No Snippets Mitrovic M, Horakova O, Riecan M, Kleinova V, Cajka T, Rossmeislova L, Kuda O, Rossmeisl M.
Show Full Abstract

Improving adipose tissue (AT) metabolism through exercise might increase production of lipokines from the fatty acid esters of hydroxy fatty acids (FAHFA) family. Although exercise training can increase insulin sensitivity and levels of specific FAHFA in AT and the circulation in humans, the effects of acute exercise on FAHFA levels remain unclear. Previously untrained lean, obese and aged male C57BL/6J mice were subjected to acute treadmill exercise. AT lipolysis, metabolomic profile and FAHFA levels were analysed at baseline and 0 and 3 h postexercise. Baseline AT levels of FAHFA, particularly those containing mono- and polyunsaturated fatty acids, were lower in obese and aged mice compared with lean mice. AT-specific expression of genes related to de novo lipogenesis and lipolysis was reduced, particularly in obese mice, whereas expression of FAHFA hydrolysis-related genes was higher in aged mice. In lean mice, acute exercise increased plasma non-esterified fatty acids and their release from AT explants, which was suppressed in obese and aged counterparts. Only in lean animals, acute exercise led to a time-dependent increase in total FAHFA levels in AT, with the most pronounced increase observed in 13/12-regioisomers from different FAHFA subfamilies. The effect of acute exercise on AT FAHFA levels was stronger than that of fasting alone, revealing palmitoleic acid-containing FAHFA as the most differentiating regioisomers. In contrast, plasma FAHFA levels were minimally affected in all groups. In conclusion, acute exercise increases FAHFA levels in AT but not in plasma, and this effect appears to be negatively affected by obesity and ageing.

Also flagged:mitochondrialHHacute mountain sicknesscerebral oedemapulmonary oedemachronic health disease
Journal Article 2026-07-25 No Snippets Santocildes G, Lorenzo K, Magalhães J, Amézqueta S, Pagès T, Torres JL, Viscor G, Ramos-Romero S, Torrella JR.
Show Full Abstract

Acute exposure to high-altitude hypobaric hypoxia (HH) disrupts physiological homeostasis. While gastrointestinal and neurological disturbances are its main manifestations, muscle function is also affected. However, its short-term effects on the gut-muscle axis remain poorly understood. The present study investigated the impact of a 4-hour exposure to simulated altitude (5,000 m) on intestinal morphology, gut microbiota composition, short-chain fatty acid (SCFA) levels, and skeletal muscle mitochondrial function in male Sprague-Dawley rats. Despite the severity of the hypoxic stimulus, biometric and hematological parameters remained largely unchanged, suggesting preserved systemic stability. Histological analysis revealed a significant reduction in intestinal crypt depth, indicating early structural alterations, while villus morphology and goblet cell counts remained unchanged. Microbiota profiling showed a decrease in Enterobacteriales abundance, while other bacterial groups and SCFA concentrations remained stable, pointing to limited microbial shifts under acute conditions. In skeletal muscle, reactive oxygen species (ROS) production increased under complex I-supported respiration while mitochondrial respiration was maintained across all respiratory states. This suggests a qualitative shift in redox balance. Collectively, these findings indicate that acute HH triggers early localized responses in intestinal and muscular tissues without inducing widespread systemic disruption, highlighting the resilience of the gut-muscle axis to short-term hypoxic stress. Longer or repeated exposures may be required to elicit broader physiological adaptations. This study contributes to understanding the early effects of altitude-related hypoxia and underscore the importance of exposure duration in shaping host responses.

Also flagged:capsulesrespiratory infectionsAntimicrobialinvasive pneumococcal diseasespneumoniameningitis
Journal Article 2026-07-25 No Snippets Reeks RK, Ntim OK, Donkor ES.
Show Full Abstract

<h4>Background</h4>Non-typeable <i>Streptococcus pneumoniae</i> (NT-Sp) strains lack detectable capsules and are often missed by traditional serotyping. While associated primarily with asymptomatic carriage, NT-Sp has emerged as a key player in antimicrobial resistance (AMR) gene dissemination and serotype replacement in the post-vaccine era. This systematic review and meta-analysis synthesize global evidence on NT-Sp carriage, its prevalence, antimicrobial resistance patterns, and genetic diversity.<h4>Methods</h4>A systematic search of PubMed, Scopus, Web of Science, Google Scholar, and ScienceDirect was conducted up to May 2025. Eligible studies reporting NT-Sp carriage, molecular typing, or AMR profiles were included. Data extraction and quality assessment followed PRISMA guidelines. A meta-analysis was performed to estimate pooled prevalence of NT-Sp carriage and resistance, with subgroup and meta-regression analyses exploring heterogeneity. Methodological quality was assessed using the Newcastle-Ottawa Scale adapted for cross-sectional studies. Only open-access and free full-text articles were included, which may have introduced selection bias.<h4>Results</h4>Forty studies from 23 countries were included. The pooled NT-Sp carriage prevalence was 4.64% (95% CI: 2.78%-6.92%), with substantial heterogeneity (<i>I</i> <sup>2</sup> = 97.1%, 95% CI: 96.6%-97.5%). Subgroup analyses revealed geographic variation, with Oceania showing the highest prevalence (7.24%, 95% CI: 1.39%-17.04%) and North America the lowest (0.44%, 95% CI: 0.05%-1.11%). Age-stratified analysis showed that studies, including all ages had the highest estimate (29.88%, 95% CI: 0.00%-100.00%), while children had a pooled prevalence of 4.05% (95% CI: 0.00%-15.80%). Vaccination era did not significantly influence NT-Sp carriage (<i>p</i> = 0.312). Resistance was highest for co-trimoxazole (67.21%, 95% CI: 49.92%-82.73%), penicillin (44.57%, 95% CI: 24.45%-65.50%), and erythromycin (39.85%, 95% CI: 19.58%-61.77%). Meta-regression identified the "all ages" participant category as a significant predictor of lower NT-Sp prevalence (<i>p</i> = 0.034). Molecular tools revealed substantial genomic diversity, with dominant clonal complexes varying by region.<h4>Conclusion</h4>NT-Sp is a globally distributed and genetically diverse pneumococcal subset with considerable AMR potential. Its persistence post-PCV introduction and resistance gene carriage highlights the need for improved detection, molecular surveillance, and consideration in next-generation vaccine development. Specifically, clinical laboratories in high-prevalence settings should adopt molecular methods (e.g., PCR or WGS) to detect NT-Sp in carriage surveillance; empirical antibiotic guidelines for pediatric respiratory infections should consider NT-Sp resistance patterns, particularly the high prevalence of co-trimoxazole resistance (67%) and next-generation PCV trials should include NT-Sp carriage as an exploratory endpoint. Integrating NT-Sp into global pneumococcal control strategies is essential.

Also flagged:Intrahepatic CholestasisFamilial Intrahepatic Cholestasisliver disordercholestatic liver diseasecholestasisciliopathy
Journal Article 2026-07-25 No Snippets Conti A, Gabrielli F, Ferrari S, Vaisfeld A, De Masi C, Azzaroli F, Piscaglia F, Vitale G.
Show Full Abstract

Progressive Familial Intrahepatic Cholestasis (PFIC) is a rare liver disorder that, although typically present in childhood, can also occur in adulthood. Early diagnosis is crucial for appropriate clinical management, prognostic assessment, and therapeutic decision-making; however, it remains challenging due to phenotypic variability and the frequent identification of genetic variants of uncertain significance (VUS). Advances in next-generation sequencing (NGS) and whole-exome sequencing (WES) have improved the detection of disease-associated variants, revealing that the same genetic variants-often in a heterozygous state-may lead to adult-onset cholestatic disease, with milder or atypical presentations, while still conferring a significant risk of progressive liver injury and related complications. To assess the diagnostic yield and clinical utility of NGS panels and WES in adults with suspected PFIC or unexplained cholestatic liver disease, focusing on variant interpretation, emerging disease-associated genes, and clinical significance of VUS. A literature review was conducted to assess molecular diagnostics in adult cryptogenic cholestasis, with a focus on studies employing targeted NGS panels and WES. Selected studies were examined for diagnostic yield, variant classification, interpretive challenges, including VUS, and integration with clinical data. Data on patient demographics, sequencing techniques, and variant interpretation strategies were extracted to evaluate the current capabilities and limitations of genomic testing. From an initial search of 211 publications, 15 studies met the inclusion criteria, comprising five large adult cohorts and ten single-patient or trio-based reports. Across 72 patients, sequencing technologies identified 75 pathogenic or likely pathogenic variants, predominantly missense mutations, demonstrating high genetic heterogeneity. The most implicated genes included <i>ABCB4</i>, <i>ABCB11</i>, <i>ATP8B1</i>, <i>TJP2</i>, and <i>USP53</i>, with diagnostic yields ranging from 13.2% in large heterogeneous cohorts to substantially higher rates in carefully selected individual cases. VUS were identified in up to 67% of cases, highlighting the need for multidisciplinary interpretation integrating clinical, biochemical, and genetic data. Emerging evidence also implicated ciliopathy-associated genes such as <i>DCDC2</i>, <i>NPHP3</i>, <i>PKHD1</i>, <i>TULP3</i>, and <i>TTC21B</i>, expanding the genetic spectrum of adult cholestasis. Clinically, presentations ranged from mild biochemical abnormalities to progressive cholestasis, with pruritus being a common feature across studies. Comprehensive genetic testing significantly enhances diagnostic accuracy, informs prognosis, and guides individualized management in adults with cryptogenic cholestasis. Emerging evidence suggests that ciliopathy-associated genes may contribute to the genetic architecture of adult cholestatic disorders, further expanding the spectrum of disease-associated genes. However, the high prevalence of VUS remains a major challenge, highlighting the need for functional studies, longitudinal follow-up, and improved variant interpretation frameworks. As genomic technologies and analytical approaches continue to evolve, genetic testing is expected to play an increasingly central role in precision hepatology.

Also flagged:FerroptosisNeurodegenerative Diseasesdeathhematopoiesisneurogenesiscognition
Journal Article 2026-07-25 No Snippets Han M, Huang H, Yuan X, Fan P, Li M.
Show Full Abstract

Ferroptosis is an iron-dependent form of regulated cell death characterized by iron dyshomeostasis, glutathione depletion, glutathione peroxidase 4 dysfunction, and excessive lipid peroxidation. Exercise is a safe and accessible non-pharmacological intervention with broad neuroprotective potential, but the evidentiary basis linking exercise specifically to ferroptosis is uneven. Only a limited subset of studies directly combines an exercise intervention with ferroptosis-related outcomes in neurodegenerative models; much of the proposed pathway architecture is inferred from pharmacological, cellular, observational, or acute neurological injury studies. This review therefore separates direct exercise evidence from exercise-related supporting evidence and non-exercise mechanistic evidence. The most directly relevant findings, concentrated largely in aerobic exercise models, show exercise-associated changes in brain iron handling, the cystine/glutamate antiporter-glutathione peroxidase 4 antioxidant system, and lipoxygenase-dependent lipid peroxidation. Supporting studies suggest additional peripheral-to-central mechanisms involving muscle-derived exosomes, exercise-associated changes in systemic and cerebral iron handling, and inflammatory regulation. Bone marrow hematopoiesis, adult neurogenesis, synaptic plasticity, and astrocyte-controlled iron traffic are incorporated as biologically plausible but incompletely tested links. Evidence for resistance training, high-intensity interval training, mind-body exercise, and human disease remains insufficient. The central limitation is therefore not pathway plausibility but the scarcity of exercise-specific causal experiments demonstrating that ferroptosis suppression is required for neuroprotection.

CCDC92
Also flagged:lung adenocarcinomaLUADprimary tumorgene expressiontumorsdeath
Journal Article 2026-07-24 ✓ 1 Snippet Xie T, Wu L, Li Y, You M, Wang Z, Gao R, Hao X, Ying J, Li J, Xing P.
In-Text Gene Mentions

…PRRG4, MS4A15 ,CCDC92, and CDCA8…

Show Full Abstract

Distant metastasis, characterized by organotropism, is a major cause of mortality in lung adenocarcinoma (LUAD). In this study, digital spatial profiling (DSP), multiplex immunofluorescence (mIF), and clinical data from 52 LUAD patients were integrated to develop organ-specific metastasis risk models, and the molecular mechanisms underlying metastatic organotropism were investigated. Random forest models based on primary tumor spatial transcriptomics accurately predicted metastasis to the brain (AUC = 0.974), liver (AUC = 0.975), adrenal gland (AUC = 0.929), and bone (AUC = 0.907). Key compartment-specific gene expression signatures associated with organotropic metastasis were identified, including those expressed in tumors (e.g., FKBP1A for the brain and MOCOS for the liver), immune cells (e.g., ADAMTSL2 for the liver), and stromal cells (e.g., CKAP2 for the brain). Pathway analyses revealed distinct biological processes associated with organotropism, such as enriched cell death pathways in brain metastasis and extracellular matrix (ECM) remodeling in liver metastasis. Postmetastasis survival models highlight stromal gene expression (e.g., PKM for OS and VCAM1 for PFS) and immunosuppressive microenvironments (e.g., M2 macrophage infiltration) as critical prognostic factors. The high-precision prediction models and key molecular signatures identified in this study enhance our understanding of "seed-soil" interaction dynamics and offer promising biomarkers and therapeutic targets for future clinical use.

SOX6
Also flagged:heart diseaseembryogenesisepithelial-mesenchymal transitionembryoid bodySynthesisgene expression
Journal Article 2026-07-24 ✓ 1 Snippet Zhou M, Li C, Kong R, Wang X, Yin Y, Wang D, Ai Z, Niu B, Liu Z, Li T.
In-Text Gene Mentions

…, ESRRG ,SOX6, and MEF2C…

Show Full Abstract

The signaling mechanisms and developmental dynamics that govern the divergence of myocardial and epicardial lineages during human heart development remain poorly understood. Here, we developed a human pluripotent stem cell-based cardiac development model and employed time-course single-cell RNA sequencing to delineate cardiac lineage specification trajectories. We identified retinoic acid (RA) as a critical fate switch at the cardiac mesoderm stage. RA instructs epicardial lineage commitment of cardiac mesoderm through a primed-epicardium to proepicardium-like population and finally to epicardium, a process requiring precise BMP modulation. Conversely, RA absence directs cardiac mesoderm along a default myocardial pathway, yielding developing and mature cardiomyocytes. Both trajectories are governed by the hierarchical activation of key transcription factors. Our study integrates signaling and dynamics to elucidate the temporal regulatory network of the RA-BMP axis in human cardiac fate determination. These findings provide fundamental insights into human cardiogenesis and a crucial roadmap for modeling heart disease and advancing regenerative strategies.

CACNA1EPTGIS
Also flagged:signal-transductionsynthesistransductiongene expressionPDsignal transduction
Journal Article 2026-07-24 ✓ 2 Snippets Haynes JM.
In-Text Gene Mentions

…2 synthase (PTGIS, S2 Table…

…Ca v 2.3,CACNA1E) and T-type…

Show Full Abstract

Microarray and Next Generation Sequencing studies offer insight into gene regulation in Parkinson's disease (PD). However, analysing vast numbers of genes can make the interpretation of data difficult when considering the platforms and techniques used across different studies. In this study, transcript expression, restricted to genes related to G-protein coupled receptors, activating agonists, agonist precursors, synthesis enzymes and transduction processes, as well as stress-related chaperones and solute carriers, was assessed across nine microarray platforms and two RNAseq studies of the substantia nigra (nigral volume). Changes in gene expression associated with PD were assessed by differential expression analysis while RNAseq studies were also used to calculate transcript per million values for each of the genes within the nigral volume. This analysis showed extensive changes in nigral volume signalling for several robustly expressed signal-related transcripts including tyrosine hydroxylase (TH), WNT signalling components (SFRP1, RSPO2 and DKK3), Kallikrein Related Peptidase 6 (KLK6), neurexins (NRXN1, NRXN3), prostaglandin synthases (PTGES2, PTGES3) and fractalkine (CX3CL1). The nigral volume signalling ligand data was then cross-referenced to the most abundant G-protein coupled receptor and signal transduction transcripts in the pigmented neurons using two RNAseq and two microarray studies. There were 32 significant changes in G-protein coupled receptor and associated signalling genes in pigmented neurons from PD tissue. Of these, 30 genes were upregulated. Analysis of the transcription factors likely regulating the 30 upregulated genes indicates a stimulation of cell stress pathways, particularly the JNK-MAP kinase pathway. Following this pathway back to changes in nigral signalling transcripts indicates that deficits in at least two autocrine/paracrine signalling systems; dopamine, via Gαo-coupled dopamine D2 receptors and Dickkopf-3 (DKK3) appear likely to contribute to pigmented neuron stress in PD.

TNFSF4
Also flagged:type 2 inflammationimmune responsesairway inflammatory diseasestranslationalchronicatopic dermatitis
Journal Article 2026-07-24 ✓ 3 Snippets Navarro-Triviño FJ, Torres T, Ruiz-Villaverde R, Moreno-Amador JL, Mendes-Bastos P.
In-Text Gene Mentions

…Its ligand, OX40L (CD252/TNFSF4), is mainly expressed…

…“OX40”, “OX40L”, “TNFRSF4”, “TNFSF4”, “co-stimulation”, “type 2…

…its ligand OX40L (TNFSF4) belongs to the…

Show Full Abstract

The OX40-OX40L co-stimulatory pathway has emerged as an important regulator of T-cell persistence and immune memory. While traditionally associated with type 2 inflammation, its role extends across multiple barrier tissues, including the skin and respiratory mucosa, where it integrates epithelial signals with adaptive immune responses. To provide a comprehensive and integrative overview of the OX40-OX40L axis as a shared driver of immune persistence across skin and airway inflammatory diseases and to discuss its therapeutic implications. A narrative review was conducted based on a focused literature search of PubMed, Scopus, and Web of Science up to February 2026. Experimental, translational, and clinical studies addressing OX40-OX40L biology and therapeutic targeting were included. OX40 signaling acts as a late co-stimulatory pathway that sustains effector T-cell survival, promotes tissue-resident memory T-cell formation, and modulates regulatory T-cell function. In barrier tissues, epithelial-derived alarmins such as TSLP and IL-33 induce OX40L expression on antigen-presenting cells, reinforcing type 2-polarized immune responses. This axis contributes to chronic inflammation in atopic dermatitis, asthma, allergic rhinitis, and nasal polyposis, supporting the concept of shared mechanisms of immune persistence across type 2 inflammatory diseases. Beyond type 2 immunity, OX40-OX40L signaling also participates in Th1-, Th17-, and Th22-mediated responses, as well as in autoimmune, fibrosing, and lymphoproliferative disorders. Therapeutic targeting of this pathway, particularly with monoclonal antibodies such as amlitelimab, has demonstrated clinically meaningful efficacy and suggests potential for durable disease modification. The OX40-OX40L axis represents an important immunological pathway linking epithelial activation to adaptive immune memory across barrier tissues. Its role in sustaining immune persistence provides a conceptual framework for understanding chronic inflammatory diseases and supports continued investigation of therapies targeting upstream co-stimulatory pathways.

Also flagged:AutophagyObsessive-Compulsive Disorderagingmitochondrialchronic psychiatric illnessbehavioral
Journal Article 2026-07-24 No Snippets Cheung N.
Show Full Abstract

Obsessive-compulsive disorder (OCD) remains difficult to treat in a substantial minority of patients, despite the established first-line use of exposure and response prevention, selective serotonin reuptake inhibitors, and pharmacological augmentation. This treatment gap has encouraged renewed interest in biological axes that sit outside a narrow monoamine-centered model. In this study, we asked whether transcriptional genetic signals for OCD show enrichment in cellular maintenance pathways motivated by nicotinamide mononucleotide (NMN)-associated aging biology and whether any such pathways outperform a curated antidepressant-related gene comparator. Using OCD transcriptome-wide association study (TWAS)-derived gene-level Z statistics and an absolute Z-score ranking framework, ten NMN-motivated Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway expansions were compared against AntiDep_Genes. The strongest and most defensible finding in the OCD analysis was selective enrichment of KEGG_AUTOPHAGY_ANIMAL. Autophagy nominally outperformed the antidepressant comparator in the primary head-to-head test, with normalized enrichment score (NES) = 1.166, p = 0.041979, and difference in normalized enrichment score (dNES) = +0.2097. The signal persisted after removal of overlapping antidepressant-related genes, with cleaned NES = 1.1784 and p = 0.042479, and the autophagy set also showed a higher absolute Z-score distribution than AntiDep_Genes by Mann-Whitney U testing, p = 0.04717. Leading-edge overlap with the antidepressant comparator was minimal, limited to mechanistic target of rapamycin (MTOR). The OCD autophagy signal was driven by a mixture of core autophagy machinery and upstream signaling genes, including MAPK3, MAP1LC3A, PPP2CB, MAP2K1, GORASP2, BAD, ATG2A, ATG10, MAPK8, and CALCOCO2. This pattern suggests a signaling-execution module rather than a simple enrichment of canonical ATG genes alone. The result is biologically consistent with recent OCD genetic findings implicating cortical and hippocampal excitatory neurons and D1/D2 striatal medium spiny neurons, which are cell types with high synaptic and metabolic demands. These findings are best viewed as hypothesis-generating. They do not support NMN, nicotinamide adenine dinucleotide (NAD+) precursors, or autophagy modulators as OCD treatments, but they do identify autophagy and mitochondrial quality-control biology as plausible targets for future functional and stratification studies. The autophagy enrichment was nominally significant in the primary analysis but did not survive Benjamini-Hochberg false-discovery rate correction across the ten tested pathways (false discovery rate (FDR)-adjusted p = 0.41979); the findings should therefore be considered hypothesis-generating.

CDK5RAP1
Also flagged:Esophageal CancerCuproptosistotumorpathogenesis
Journal Article 2026-07-24 ✓ 1 Snippet Fan W, Huang C, Wang Z, Sun S, Li K, Liu X, Wang Z, Zhao T, Zhang G, Pan X.
In-Text Gene Mentions

…the cuproptosis-related geneCDK5RAP1were closely correlated.…

Show Full Abstract

<h4>Introduction</h4>The present study analyzed the specific function of MARVEL domaincontaining protein 3 (MARVELD3) in esophageal cancer (EC).<h4>Methods</h4>MARVELD3 expression and its association with clinicopathological features in EC samples were analyzed using data from the TCGA and GEO databases. Enrichment analysis was performed on differentially expressed genes (DEGs) in samples with high and low MARVELD3 expression. Furthermore, the relationships of MARVELD3 with immune infiltration, response to immune therapy, N6-methyladenosine (m6A) modification, cuproptosis, and ceRNA regulatory network were explored.<h4>Results</h4>In EC, MARVELD3 exhibited high expression, which was significantly correlated with the T-stage and histological type. ROC curve analysis demonstrated a high prediction accuracy of MARVELD3 for tumor prognosis. Moreover, immune infiltration analysis showed a close relationship between MARVELD3 and the immune microenvironment and immune cells in EC. Additionally, MARVELD3, the m6A modification-related gene YTHDF1, and the cuproptosis-related gene CDK5RAP1 were closely correlated. Furthermore, the predicted ceRNA regulatory network THRBIT1/ hsa-miR-23a-3p/MARVELD3 and LINC00261/hsa-miR-23a-3p/MARVELD3 axes may be involved in the pathogenesis of EC and its progression.<h4>Discussion</h4>This study analyzed the involvement of MARVELD3 in EC and revealed its relationship with m6A modification and cuproptosis and its relevant ceRNA regulatory network.<h4>Conclusion</h4>MARVELD3 may be a potential biomarker for EC and was closely linked to immune infiltration, response to immune therapy, m6A modification, cuproptosis, and ceRNA regulatory networks in EC.

Also flagged:immune responsesorganizationantigen presentationcell activationlymphocyte activationlocalization
Journal Article 2026-07-24 No Snippets Jackson L, Williams SM, Sinclair J, Kume A, Bahadoran A, Langohr IM, Danz H, Lu B, Bangari DS, Cox AJ, Macia L, Chivukula S, West NP.
Show Full Abstract

Vaccination relies on innate and adaptive responses initiated at the injection site followed by activation in draining lymph nodes. However, high-plex, spatially resolved maps that couple injection site signals with transcriptomic programs in draining lymph nodes over time are still lacking. Here, we used spatial transcriptomics to map early responses to an adjuvanted recombinant haemagglutinin (rHA) protein vaccine formulated with Sanofi's proprietary oil-in-water adjuvant AF03. Mice received intramuscular rHA-protein or PBS. Injection site muscle and draining lymph nodes were collected at Days 1 and 7 post-prime for GeoMx™ Digital Spatial Profiling (DSP) and CosMx™ Spatial Molecular Imaging (SMI) single-cell imaging. In lymph nodes, rHA-protein vaccination induced early innate pathway activation in non-follicular regions at Day 1. By Day 7, adaptive pathways were enriched within follicles, with differentially expressed genes (DEGs) linked to germinal center (GC) formation, transcriptional regulation and signaling. These changes coincided with expansion of a proliferative GC-like B-cell cluster within the follicular area. At the injection site, 20x20 µM spatial grids were used rather than segmented cells. Clusters, enriched for fibroblast and muscle cells showed Day 1 induction of chemokines and interferon stimulated genes, concentrated in fibroblast rich stromal layers. These spatially organized tissue programs were accompanied by transient systemic cytokine elevations and increased antigen-specific IgG titers. Together, these data provide a previously unresolved view of what, when and where local inflammation and lymph node organization are spatially and temporally associated during early responses following vaccination with an adjuvanted rHA-protein vaccine.

PRDX6
Also flagged:mitochondrialAge-related macular degenerationblindnessagingchoroidal neovascularizationmetabolism
Journal Article 2026-07-24 ✓ 1 Snippet Zhan B, Xia R, Tao L.
In-Text Gene Mentions

…Furthermore, peroxiredoxin 6 (PRDX6) overexpression significantly…

Show Full Abstract

<h4>Objective</h4>To investigate whether Ginkgolide B (GB) protects retinal pigment epithelial cells (RPEs) from hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>)-induced oxidative stress and apoptosis, and to explore the potential involvement of the adenosine monophosphate-activated protein kinase <i>α</i> (AMPKα)/nuclear factor erythroid 2-related factor 2 (Nrf2) pathway.<h4>Methods</h4>Human RPEs were divided into the following groups: control, model (200 μmol/L H₂O₂ for 24 h), GB + H₂O₂, GB + H₂O₂ + Compound C (an AMPK inhibitor), H₂O₂ + Compound C, and GB alone. Cell viability, apoptosis, antioxidant parameters, and AMPKα/Nrf2 expression were assessed using the Cell Counting Kit-8 (CCK-8) assay, flow cytometry, colorimetric biochemical assays, transmission electron microscopy (TEM), quantitative polymerase chain reaction (PCR), and Western blot.<h4>Results</h4>TEM showed that GB attenuated H₂O₂-induced mitochondrial swelling and cristae disruption, which were reversed by Compound C. Compared with the model group, the GB + H₂O₂ group exhibited increased cell viability, decreased apoptosis, elevated activities of catalase (CAT), glutathione peroxidase (GPx), and superoxide dismutase (SOD), as well as increased glutathione (GSH) content, and reduced malondialdehyde (MDA) (all <i>p</i> < 0.05), though protein carbonyl (PC) levels showed no significant amelioration. All protective effects were attenuated by Compound C. In the GB-alone group, the percentage of apoptotic cells, Nrf2 mRNA expression, and all other parameters did not differ significantly from those in the control group.<h4>Conclusion</h4>GB was associated with protection of RPEs against H₂O₂-induced oxidative stress and apoptosis. Because these protective effects were attenuated by pharmacological inhibition of AMPK, the findings suggest that AMPK/Nrf2 signaling may contribute to the cytoprotective actions of GB. However, additional mechanistic studies are required to confirm the involvement of this pathway.

HFE
Also flagged:Liver Tumordeathhepatomaliver tumorscell proliferationtumor
Journal Article 2026-07-24 ✓ 2 Snippets Cornejo Müller A, Liehr T, Balakrishnan P, Kankel S, Buhl EM, Keller DT, Hardt KS, Schröder-Lange SK, Liedtke C, Weiskirchen R.
In-Text Gene Mentions

…Stard5 , andHfewere also expressed,…

…Ppard , andHfeis consistent with…

Show Full Abstract

Caspase-8 and the NF-κB essential modulator (NEMO, also referred to as IKKγ) play critical roles in controlling TNF-α-induced cell death and survival in hepatocytes. The aim of this study was to generate a hepatocyte-derived cell line in which the <i>Casp8</i> and <i>Nemo</i> genes can be conditionally inactivated simultaneously to investigate the significance of the corresponding signaling pathways. To this end, we induced hepatocellular carcinoma in <i>Casp8</i><sup>f/f</sup><i>Nemo</i><sup>f/f</sup> mice using diethylnitrosamine and established an immortalized hepatoma cell line from explanted liver tumors, which is subsequently referred to as ΔCN60. ΔCN60 cells still retain floxed <i>Casp8</i> and <i>Nemo</i> alleles, allowing for efficient Cre-mediated deletion to generate <i>Casp8</i><sup>Δ</sup><i>Nemo</i><sup>Δ</sup> derivatives. Loss of both Caspase-8 and NEMO inhibits cell proliferation, increases the expression of tumor and progenitor markers (AFP, CD133), reduces albumin expression, and blocks TNF-α-induced NF-κB p65 nuclear translocation. ΔCN60 <i>Casp8<sup>Δ</sup>Nemo<sup>Δ</sup></i> cells display altered sensitivity to prolonged TNF-α exposure, suggesting a potential shift in necroptosis-associated signaling pathways, although necroptotic cell death was not directly demonstrated. ΔCN60 serves as a versatile hepatoma model for investigating Caspase-8/NEMO-dependent TNF-α signaling and hepatocyte plasticity and may help prioritize future in vivo experiments by enabling selected mechanistic questions to be addressed first in vitro.

Also flagged:Synthesiscyclizationnucleuscancercytoskeletonmetabolism
Journal Article 2026-07-24 No Snippets Nosova EV, Lipunova GN, Charushin VN.
Show Full Abstract

This review covers published data (mostly from 2019 to 2025) on the synthesis and biological activity of azolo[<i>a</i>]quinoxalines, including pyrazolo-, imidazo- and triazolo-annelated systems. We highlight that most research efforts are directed toward the design of anticancer agents, with additional applications as Toll-like receptor antagonists, monoamine oxidase inhibitors, opioid receptor modulators, PI3Kα inhibitors, tubulin polymerization inhibitors, GABAᴀ receptor modulators, VEGFR-2 kinase inhibitors, BRD9 binders, and anti-inflammatory, antimicrobial, and antifungal agents. Recent synthetic strategies include Cu-catalyzed oxidative annulations, I<sub>2</sub>-mediated C-H functionalization, metal-free cascade cyclization, and multicomponent reactions, often employing eco-friendly catalysts and reductants. A growing number of studies integrate virtual screening, molecular docking, and pharmacophore-based in silico approaches to guide lead discovery and optimization. Innovative drug delivery systems, such as nanogels and hybrid molecules combining azoloquinoxalines with pharmacophores like thalidomide, have also been explored. This review emphasizes both the medicinal chemistry aspects of azolo[<i>a</i>]quinoxalines and the synthetic methodologies for their preparation from the perspective of drug development and discovery.

Also flagged:Agingmodificationschromatinmethylationmitochondrialgene expression
Journal Article 2026-07-24 No Snippets Guo Y, Yan Y, Zhao L, Mao S.
Show Full Abstract

Aging is driven by progressive epigenetic alterations-DNA methylation drift, aberrant histone modifications, chromatin remodeling, and non-coding RNA dysregulation. Vitamin D, acting through its nuclear receptor vitamin D receptor (VDR), modulates the epigenetic landscape to potentially counteract these age-related changes. This review first describes age-related epigenetic alterations, then outlines vitamin D signaling and its interface with the epigenetic machinery. Next, tissue-specific epigenetic actions of vitamin D in the immune, musculoskeletal, and nervous systems are discussed. Finally, clinical trial evidence is examined, interindividual variability is highlighted, and future research directions are proposed. However, large randomized controlled trials (RCTs) consistently show limited benefits of vitamin D monotherapy, with measurable anti-aging effects observed when combined with exercise and nutritional interventions. Its efficacy is constrained by interindividual variability, J-shaped dose-response, and tissue-specific barriers. For deficient individuals (serum 25-hydroxyvitamin D (25(OH)D) < 50 nmol/L), guided supplementation-typically 800-2000 international units (IU)/day-is warranted to achieve tentative target serum concentrations of 75-125 nmol/L, the range linked to favorable epigenetic and immune effects. For those already sufficient (e.g., serum 25(OH)D ≥ 50 nmol/L), indiscriminate supplementation without biochemical indication is not supported. Therefore, promoting healthy aging through vitamin D requires serum-monitored, individually titrated, and multimodal regimens, with supplementation reserved primarily for documented deficiency and integrated with lifestyle interventions.

MLLT10
Also flagged:post-translational modificationsorganizationheterochromatinchromatincancergene expression
Journal Article 2026-07-24 ✓ 1 Snippet Sattarifard H, Oyeyode M, Prajapati D, Duaqui A, Kaur G, Muker I, Luo W, Lakowski TM, Davie JR.
In-Text Gene Mentions

…limited to AFF1/AF4,MLLT10/AF10, MLLT3/AF9, and MLLT1/EN…

Show Full Abstract

Histone-modifying enzymes and histone post-translational modifications (PTMs) play key roles in the organization (euchromatin versus heterochromatin) and function (active versus silenced genes) of chromatin. The abundance and activity of these enzymes, along with their associated histone PTMs, are often altered in cancer cells, leading to deregulated gene expression. The expression of the KMT2A-MLLT3 protein, resulting from a chromosomal translocation in mixed-lineage leukemia (MLL), a subtype of acute myeloid leukemia, augments transcription elongation, promoting the expression of <i>HOXA9</i> and <i>MEIS1</i>, genes that play critical roles in MLL development. Bortezomib, a proteasome inhibitor, has been effective at treating various cancers. In this study, we compared the impact of bortezomib on histone PTMs in the MLL cell line MOLM-13 and the chronic myeloid leukemic (CML) cell line K562. We report that MOLM-13 had a greater level of histone H2B monoubiquitinated at lysine 120 (H2BK120ub) and histone H3 dimethylated at lysine 79 (H3K79me2) (modifications involved in elongation) and similar levels of histone H2A monoubiquitinated at lysine 119 (H2AK119ub). Bortezomib treatment resulted in significant reductions in H2BK120ub and H2AK119ub levels, as well as in transcript levels of genes involved in MLL development.

Also flagged:Autoimmune Diseasesdeathmyocardial infarctionMIstrokeheart failure
Journal Article 2026-07-24 No Snippets Huang J, Liu C, Sperling LS, Quyyumi AA, Sun YV.
Show Full Abstract

<h4>Background</h4>Autoimmune diseases (AIDs) are associated with increased cardiovascular risk. However, specific protein mediators linking AIDs to major adverse cardiovascular events (MACE) and cardiovascular death (CV death) remain unexplored. This study identifies proteomic mediators linking AIDs to MACE via high-dimensional mediation analysis in the UK Biobank.<h4>Methods</h4>We used UK Biobank data with proteomic profiling by Olink platform. Participants with prevalent myocardial infarction (MI), stroke, and heart failure at baseline were excluded. AIDs were categorized into musculoskeletal (MSK), vasculitis, gastrointestinal (GI), neurologic, and rheumatic fever subsets. Fine-Gray models assessed associations between AIDs and MACE and CV death. Proteome-wide association studies identified proteins associated with both AIDs and cardiovascular outcomes. High-dimensional mediation analysis (HIMA) explored protein-mediated pathways. All models adjusted for age, sex, lipids, BMI, smoking, hypertension, diabetes, chronic kidney disease, atrial fibrillation, and coronary artery disease.<h4>Results</h4>Among 400,633 participants (median follow-up 14.5 years, 44.8% male), AIDs were present in 28,754 (7.2%). All AID categories were associated with increased MACE (sHR: MSK 1.34, vasculitis 1.67, GI 1.20, neurologic 1.33, rheumatic fever 1.38; all <i>p</i> < 0.001). For CV death, MSK, vasculitis, and rheumatic fever showed increased risk (sHR 1.34, 1.78, 1.51; all <i>p</i> ≤ 0.004), but not GI or neurologic AIDs. In 43,599 participants with proteomic data, HIMA identified 66 and 32 unique potential mediators linking AIDs to MACE and CV death, respectively. Four proteins (Growth Differentiation Factor 15, Interleukin-15, urokinase plasminogen activator receptor, and Tenascin C) mediated the AID-MACE relationship across multiple AID categories. Growth Differentiation Factor 15 and Interleukin-15 were shared mediators for CV death.<h4>Conclusions</h4>This proteomic analysis identifies specific proteins that may mediate the association between AIDs and adverse cardiovascular outcomes, offering mechanistic insights into immune-related cardiovascular risk. These findings are hypothesis-generating and require replication and validation before the identified proteins can be considered causal mediators or adopted for clinical risk stratification.

Also flagged:Hypertensionageingmenopausecellular senescenceHypertensive disorders of pregnancycardiovascular disease
Journal Article 2026-07-24 No Snippets Hooshmandi S, Freestone NS, Arrigoni FIF.
Show Full Abstract

<b>Purpose:</b> Hypertension in women is a dynamic, hormone sensitive condition shaped by cumulative physiological changes across the life course. This review summarises current evidence relating vascular ageing, hormonal regulation, metabolic dysfunction, and reproductive history to blood pressure regulation in women. <b>Materials and Methods:</b> A narrative review of the literature was conducted using PubMed, Scopus and Google Scholar. Clinical, epidemiological, and mechanistic studies were synthesised to evaluate factors influencing hypertension in women. Reports in which menopausal status was not defined, or previous reproductive milestones were not documented, were excluded or interpreted with caution. <b>Results:</b> Evidence suggests that menopause, vascular ageing, metabolic dysfunction, androgen to oestrogen balance, and reproductive history interact to influence endothelial function, neurohormonal regulation, renal sodium handling, and vascular resistance. Ageing-related mechanisms, including cellular senescence, chronic low-grade inflammation, and genetic susceptibility, may contribute to increased cardiovascular risk. Hypertensive disorders of pregnancy identify women who are at higher risk of developing cardiovascular disease later in life and provide an opportunity for earlier risk assessment and prevention. Emerging therapies, including GLP-1 receptor agonists and SGLT2 inhibitors, may offer additional options for improving cardiovascular risk management, although their role in sex-specific prevention remains an evolving area of research. <b>Conclusions:</b> Hypertension in women is best understood within a life-course framework. Incorporating reproductive history, menopausal status, metabolic health, and emerging risk markers may improve cardiovascular risk assessment and support earlier intervention.

bioRxiv 2026-07-24 Preprint (No Snippets API) Li P, Zheng Y, Tang J, Xia Q, Casas-Martinez JC, Ortiz-Alcántara Á, Requejo-Aguilar R, Padilla CA, Quinlan LR, Vizuete AM, Goljanek-Whysall K, McDonagh B.
Show Full Abstract

Peroxiredoxin 6 (PRDX6) is a multifunctional enzyme with peroxidase, calcium independent phospholipase A 2 (aiPLA₂) and lysophospatidylcholine acyltransterase (LPCAT) activities. Although PRDX6 can repair peroxidised phospholipids and help prevent ferroptosis, its role in the adaptive response to physiological oxidative stress remains unclear. In this study PRDX6 function was investigated using myoblasts exposed to an acute low concentration of H 2 O 2 and Caenorhabditis elegans subjected to a swimming intervention. Mild oxidative stress promoted myogenesis and mitochondrial turnover in myoblasts, while exercise enhanced activity and longevity in C. elegans . The adaptive responses were associated with increased mitochondrial localisation of PRDX6. In contrast, loss of PRDX6 under mild stress conditions resulted in increased mitochondrial lipid peroxidation, enhanced mitochondrial ER contact sites (MERCS), mitochondrial calcium accumulation, release of mitochondrial DNA and activation of innate immune signalling pathways. Similar phenotypes were induced by the ferroptosis activator erastin and rescued by the lipid peroxyl scavenger Ferrostatin-1, indicating lipid peroxidation was the key triggering event. Furthermore, inhibition of mitochondrial calcium uptake in C. elegans prevented calcium overload and attenuated inflammatory signalling. Together, the results identify PRDX6 as a conserved regulator of mitochondrial adaptation to physiological oxidative stress, functioning to limit mitochondrial lipid peroxidation and prevent excessive MERCS assembly, mitochondrial calcium dysregulation and inflammatory activation.

DNAH10
Also flagged:ciliopathiesossificationosteoblast differentiationchondrocyte maturation
Journal Article 2026-07-23 ✓ 5 Snippets Zheng R, Du X, Yan J, Huang G, Guo Z, Li W, Que H, Wen Y, Yan F, Chen D, Dai L, Shi Y, Chen W, Xu W.
In-Text Gene Mentions

…iallelic variants in &lt;i&gt;DNAH10&lt;/i&gt; are associated with…

…AlthoughDNAH10is well characterised…

…and identified biallelic <i>DNAH10</i> variants.…

…these variants onDNAH10protein abundance.…

….<h4>Results</h4>Biallelic <i>DNAH10</i> variants were identified…

Show Full Abstract

<h4>Background</h4>Primary cilia are essential for skeletal development by coordinating key signalling pathways in osteoblasts and chondrocytes. While pathogenic variants in approximately 40 genes have been linked to skeletal ciliopathies, additional causative genes remain to be identified. Although DNAH10 is well characterised in motile cilia, its role in primary cilia remains unclear.<h4>Methods</h4>Whole-exome sequencing was performed in two individuals with skeletal developmental abnormalities and identified biallelic <i>DNAH10</i> variants. In vitro assays were used to assess the effects of these variants on DNAH10 protein abundance. <i>Dnah10</i> knockout mice were generated to investigate the associated skeletal phenotypes and underlying mechanisms.<h4>Results</h4>Biallelic <i>DNAH10</i> variants were identified in two individuals with skeletal developmental abnormalities. In vitro, these missense variants were associated with reduced DNAH10 protein abundance. <i>Dnah10</i>-deficient mice recapitulated key skeletal features, including polydactyly, impaired cartilage development and abnormal ossification. Mechanistically, <i>Dnah10</i> loss was associated with abnormal primary cilia morphology, attenuated Hedgehog signalling, impaired osteoblast differentiation and defective chondrocyte maturation.<h4>Conclusion</h4>Our findings support <i>DNAH10</i> as a candidate gene associated with skeletal developmental abnormalities and ciliary dysfunction and suggest a previously underappreciated role for DNAH10 in primary cilia-related skeletal development beyond its established role in motile cilia.

Also flagged:chromatinhistone modificationscancerprostate cancergene expressiontumor
Journal Article 2026-07-23 No Snippets Cao H, Wu Z, Ji B, Yang S, Gonzalez-Smith L, Vu A, Rhie SK.
Show Full Abstract

<h4>Background</h4>The transcription process is controlled by non-coding regulatory elements, more than 70% of which are putative enhancers. These enhancers comprise over 600,000 regions and are marked by histone modifications. However, the mechanisms by which altered enhancers in cancer cooperate within the three-dimensional chromatin architecture to drive oncogenic programs remain poorly understood.<h4>Results</h4>By integrating 201 H3K27ac ChIP-seq datasets from prostate, we identify 3,216 high-confidence prostate cancer-specific putative enhancers. Ultra-high-resolution chromatin interaction profiling by Region Capture Micro-C at a representative chr6q24.1 locus reveals that these enhancers form cancer-specific, highly nested interactions with promoters that coalesce into a multi-connected hub absent in normal prostate cells. CRISPR/Cas9 perturbations of these enhancers, examined one by one, distinguish enhancer classes within the hub. Deletion of a central enhancer collapses hub-wide enhancer activities and architecture, leading to the downregulation of target genes, impaired proliferation, and reduced clonogenic growth. In contrast, deletion of a redundant enhancer results in minimal transcriptional changes, as neighboring enhancers rescue cancer signaling through compensatory architectural rewiring that strengthens alternative enhancer-promoter interactions. We also observe that FOXA1, a pioneer transcription factor activated in prostate cancer, directly binds to these enhancers and regulates distinct enhancer classes, leading to varying degrees of chromatin accessibility and gene expression changes.<h4>Conclusions</h4>These findings suggest that enhancers function in a coordinated manner, forming multi-connected cancer-specific chromatin interaction hubs, with distinct enhancer classes contributing differently to gene regulation. This study advances our ability to modulate gene expression in a cell type-specific manner, opening new avenues for precision therapies.

PRDX6
Also flagged:deathorganizationphosphorylationinflammatory responsesIschemic Strokestroke
Journal Article 2026-07-23 ✓ 2 Snippets Seong KJ, Park S, Bae SW, Kim D, Lee JH, Choi WS, Park ZY, Jung JY, Kim WJ.
In-Text Gene Mentions

…network included SOD2,PRDX6, and glutathione‐associated e…

…enzymes, including SOD2,PRDX6, GSR, and GSTP1,…

Show Full Abstract

Ischemic stroke induces oxidative stress, neuroinflammation, neuronal death, and synaptic dysfunction, leading to persistent motor and cognitive deficits. The human dental pulp stem cell (hDPSC) secretome is a promising cell-free therapeutic candidate containing neurotrophic, antioxidant, and immunomodulatory factors. Here, we investigated its therapeutic effects in a photothrombotic mouse model of ischemic stroke and CoCl<sub>2</sub>-induced hypoxic BV2 microglial cells. Proteomic profiling identified antioxidant-associated proteins, including SOD2, GSR, and GSTP1, and microglial phenotype-related candidates, including GRN, CSF1, and LRP1. hDPSC secretome treatment reduced stroke-induced infarct volume and attenuated stroke-increased neuronal apoptosis, neuronal ROS accumulation, and NF-κB-associated inflammatory signaling in the cortex and hippocampus. It also shifted microglial marker expression toward an M2-associated profile and improved stroke-impaired hippocampal neurogenesis, vascular remodeling, and synaptic organization. Proteomic analyses further identified coordinated changes in pathways related to oxidative phosphorylation, inflammatory responses, calcium signaling, SNARE-associated vesicular transport, and ROBO-Rho-associated cytoskeletal remodeling. These molecular and cellular changes were associated with improved motor coordination, spatial learning and memory, contextual memory, and anxiety-like behavior. These findings support the hDPSC secretome as a cell-free therapeutic candidate for post-stroke functional recovery linked to redox, inflammatory, neurovascular, and synaptic remodeling.

SUDS3
Also flagged:nucleusbindinglocalizationgene expressionpost‐translational modificationsorganization
Journal Article 2026-07-23 ✓ 1 Snippet Quail T, Wittmann S.
In-Text Gene Mentions

…droplets composed oflinker histoneshistones [ 67…

Show Full Abstract

Transcription is spatially organized in the nucleus, concentrating transcription factors, coactivators, and RNA polymerase II into dynamic, membraneless compartments. Such assemblies have been described in many ways, from small complexes of defined stoichiometry to membraneless biomolecular condensates. We argue that these are not competing descriptions but positions along a single continuum, and propose "transcriptional compartment" as an umbrella term for it. We then turn to the functional literature and ask what these compartments have been shown to do, and what they have not. The clearest evidence for a functional role of condensation may emerge in contexts where transcription must generate switch-like responses, such as cell-fate decisions, stress responses, environmental sensing, and disease. Much of the remaining biology, however, sits in the small, transient assemblies between the two extremes. These are the hardest to study, in part because they fall below the diffraction limit of light microscopy and because the interactions that drive their formation usually also carry out their function, so the two cannot be perturbed independently. We survey the experimental and computational toolkit available for this problem and outline the open methodological challenges that remain.

HTT
Also flagged:bone remodelingosteoclastogenesismetabolismAutophagyosteoclast differentiationinflammatory bone disease
Journal Article 2026-07-23 ✓ 2 Snippets Yang P, Zhu B, He Y, Tian Y, Kang H, Hu S, Wang P, Xu Y, Lei Z, Qi P, Yang H, Lin Y, Dong Y, Li F, Guan H.
In-Text Gene Mentions

…roxytryptamine transporter (5‐HTT), which mediates serotonin/5‐…

…the 5‐HT transporter (5‐HTT), which is primarily…

Show Full Abstract

Inflammatory osteolysis arises from pro-inflammatory cytokine-driven osteoclast activation and disrupted bone remodeling equilibrium. The IRE1-XBP1s axis, a major unfolded protein response pathway, regulates cellular homeostasis, but its role in inflammatory osteoclastogenesis remained unexplored. Single-cell RNA-seq showed increased osteoclast precursor cells and activated IRE1-XBP1s in LPS-induced osteolysis. Inhibition of this axis reduced osteoclastogenesis and bone loss in vitro and in vivo. RNA-seq indicated that blocking IRE1-XBP1s suppressed Slc6a4 transcription, with gene set enrichment analysis confirming its role in 5-HT transport. Dual-luciferase assays and ChIP-PCR demonstrated XBP1s' direct transcriptional regulation targeting the Slc6a4 promoter. The 5-HT transporter inhibitor escitalopram also inhibited osteoclastogenesis, highlighting the IRE1-XBP1s-Slc6a4 axis's importance. Notably, untargeted metabolomics suggested 5-HT inhibited intracellular 3-methyladenine (3MA) metabolism, a compound previously considered unnatural. HPLC-MS confirmed the presence of 3MA metabolism in inflammatory osteoclasts, and 3MA supplementation attenuated 5-HT-induced autophagy and osteoclast differentiation. Blocking the IRE1-XBP1s-Slc6a4 axis reduced pro-osteoclastogenic effects in inflammatory bone disease patient-derived PBMCs. This study demonstrates that IRE1-XBP1s inhibition alleviates inflammatory osteoclastogenesis and osteolysis via a 5-HT-dependent anti-autophagy mechanism, proposing this pathway as a therapeutic target for inflammatory bone loss.

DDX27
Also flagged:inflammatory responseschromatinposttranslational modificationsphosphorylationbindingcancer
Journal Article 2026-07-23 ✓ 1 Snippet Wu SY, Chiang CM.
In-Text Gene Mentions

DDX27

Show Full Abstract

Bromodomain-containing protein 4 (BRD4) is an important therapeutic target for anticancer, antiviral, and anti-inflammatory responses. Although its role in transcription, chromatin dynamics, and epigenetic programs is well recognized, recent studies have expanded the functions of BRD4 and its related bromodomain and extra-terminal (BET) family members (BRD2, BRD3, and BRDT) to other molecular and biological processes. How a universal epigenetic regulator is tailored for context-specific gene/pathway regulation is mechanistically intriguing. In this review, we highlight the importance of protein isoforms and posttranslational modifications, particularly phosphorylation, in generating the protein diversity necessary for selective factor recruitment and context-dependent regulation. Three BRD4 protein isoforms have been identified, including the universally expressed BRD4-L and BRD4-S(a) (simplified as BRD4-S), representing the long and short isoform a, and cell-/stress-specific short isoform b, BRD4-S(b). A phospho-switch mechanism controlling the open/closed state of the bromodomain and BRD4 interaction with partner proteins will also be discussed. Mechanistic understanding of BET protein action has led not only to the development of diverse bromodomain-binding compounds currently used in clinical trials but also to the discovery of a new class of small-molecule inhibitors targeting an intrinsically disordered region (IDR) of phospho-BRD4 to alter specific protein-protein interaction (PPI) networks without globally perturbing transcription programs and chromatin landscapes, thus significantly reducing off-target effects and providing new directions for therapeutic drug development.

B4GALT5
Also flagged:cancerchromatincutaneous melanomaacral melanomatumorgene expression
Journal Article 2026-07-23 ✓ 1 Snippet Xu Z, Ugurbil A, Kwan J, Schaefer C, Abdulraouf A, Lu Z, Tang E, Zhou W, Cao J.
In-Text Gene Mentions

…20 (e.g., CEBPB,B4GALT5, UBE2V1), where amplification…

Show Full Abstract

Cancer arises from genetic and epigenetic alterations that reshape chromatin, transcriptional regulation, and malignant cell states. To chart cancer-intrinsic regulatory programs, we build a pan-cancer single-cell atlas of 60 cancer cell lines spanning 16 tissue origins and 20 cancer types, comprising 240,957 snRNA-seq and 223,347 snATAC-seq profiles. Integrative analyses reveal cell-state heterogeneity, core gene-regulatory networks, and a conserved EMT axis transcending tissue of origin; copy-number analysis identifies transcription factor amplification and hyperactivation as drivers of state reprogramming. Comparing cutaneous melanoma with acral melanoma, a rare subtype underrepresented in previous studies, uncovers a universal inflammation-suppressive program in acral and an inflamed landscape in cutaneous melanoma, with JAK-STAT activity as the central discriminator. Integrating data across models and patient cohorts links tumor-intrinsic regulation to microenvironmental composition and therapeutic response. By profiling rare alongside common subtypes, this atlas offers a resource for mapping pan-cancer and subtype-specific regulatory programs shaping cell-state plasticity.

Also flagged:E3 ubiquitin ligasesmacroautophagyubiquitinproteasomeorganellesmitophagy
Journal Article 2026-07-23 No Snippets Müller M, Winklhofer KF, Reggiori F.
Show Full Abstract

In contrast to the ubiquitin (Ub)-proteasome-system, which only degrades individual proteins, macroautophagy can eliminate protein complexes or aggregates, organelles and even pathogens. Terms such as mitophagy, aggrephagy, lysophagy and xenophagy have been coined based on the targeted substrate. In Ub-dependent selective macroautophagy, cargo selectivity is specified by E3 Ub ligases that append Ub chains that in turn are recognized by selective autophagy receptors (SARs), driving sequestration into autophagosomes. While several Ub-dependent SARs have been identified and characterized, the E3 Ub ligases that ultimately decide target fate remain poorly studied. In this review, we summarize what is known about the E3 Ub ligases involved in selective macroautophagy, with a particular emphasis on the degradation of mitochondria, protein aggregates, lysosomes and pathogens. A better characterization of these enzymes could improve therapeutic strategies for targeted degradation in acute and chronic diseases.

Also flagged:age-related neurodegenerative disordersADPDmetabolismneurodegenerative diseasesgene expression
Journal Article 2026-07-23 No Snippets Xiao Y, Wang S, Hou Y, Shang H.
Show Full Abstract

Alzheimer's disease (AD) and Parkinson's disease (PD) are the two most common age-related neurodegenerative disorders. Allen Human Brain Atlas (AHBA) provides high-resolution transcriptomic data across 102 brain regions with multi-site sampling from healthy controls, promoting the use of brain-wide transcriptomic data for imaging transcriptomics and cross-modal model construction. Increasingly, researchers are utilizing brain-wide transcriptomic datasets to investigate the transcriptome correlates of the neuroimage phenotypes in AD and PD. Leveraging the AHBA, researchers have analyzed the transcriptomic correlations of regional susceptibility to Aβ deposition, tau deposition, α-synuclein propagation, and disease-related multiple-dominal neuroimage phenotypes. These studies revealed that transcriptomic pathways related to metabolism, immunity, neurotransmission, and synaptic function play critical roles in the neuroimage phenotype of AD and PD. By incorporating transcriptomic data modeling, subsequent analyses further confirmed that transcriptomic differences provide the molecular basis for the varying susceptibility observed across brain regions. The analytical approaches of imaging transcriptomics, multimodal data integration strategies, and model construction methods used in AD and PD provide a novel perspective for exploration and can be extended to other neurodegenerative diseases. Future research is expected to utilize brain-wide transcriptomic data to uncover the gene expression mechanisms driving neurodegenerative disease phenotypes.

Also flagged:glioblastomalung cancertumourbreast cancerhepatocellular carcinomaAlzheimer disease
Journal Article 2026-07-23 No Snippets Liu Y, Yi M, Tang C, Wang T, Li X.
Show Full Abstract

The mesenchymal homeobox transcription factor MEOX2 is recognized for its roles in development and homeostasis, but the full landscape of its complex and often contradictory functions in human diseases, along with its potential unifying regulatory logic, remains to be systematically elucidated. This Review synthesizes current evidence to provide a comprehensive overview of MEOX2's widespread roles in both neoplastic and non-neoplastic diseases. MEOX2 is remarkably context-dependent: it acts as an oncogene in glioblastoma and lung cancer, but as a tumour suppressor in breast cancer, hepatocellular carcinoma and other tumour types. Its dysregulation is also linked to neurovascular deficits in Alzheimer disease (AD), cardiovascular disorders, metabolic fibrosis and developmental malformations. This functional versatility stems from MEOX2's role as a key signalling integrator, subject to fine-tuned regulation by epigenetic mechanisms, non-coding RNA networks and core pathways including PI3K/AKT, ERK and Hedgehog (Hh). Given the strong association between MEOX2 expression and clinical outcomes, it has emerged as a potential diagnostic and prognostic biomarker for several diseases. Intervention strategies targeting MEOX2 and its regulatory networks show translational promise. This Review proposes a conceptual framework placing MEOX2 as a 'cross-disease core regulatory node', systematically delineates its complex disease associations and molecular mechanisms, and charts a course for the future development of precision medicine strategies targeting MEOX2.

SOX6
Also flagged:cell cyclecell proliferationGNcell divisionneurogenesisdeath
Journal Article 2026-07-23 ✓ 5 Snippets Tirado-Melendro P, Li L, Medina-Menéndez C, Jurado-Angulo P, Rodríguez-Martín P, García-Redondo L, Bilińska K, Morales AV.
In-Text Gene Mentions

…loss of oneSox6copy, a closely…

…in combination withSox6in IPC cell…

…the related proteinSox6are expressed in…

…members Sox5 andSox6could be involved…

…that Sox5 andSox6display an overlapping…

Show Full Abstract

The development of the dentate gyrus (DG) of the hippocampus is protracted over time in comparison with other brain regions such as hippocampal cornus ammoni or neocortex, extending over the first postnatal weeks. During DG postnatal development, neural stem cells (NSCs) will remain to generate the adult neurogenic niche that will sustain granule neuron (GN) production throughout life. NSCs in the DG divide to generate intermediate progenitor cells (IPCs), whose highly regulated dynamics of self-renewal or cell cycle exit decisions still remain poorly understood. Sox5 is a transcription factor (TF) essential for the establishment of adult NSCs, however, its potential role in Sox5 expressing IPCs during DG development remains unexplored. In this study, we demonstrate that conditional loss of Sox5 during embryonic development leads to critical alterations in cell proliferation and survival in IPCs. Specifically, following Sox5 loss, IPCs exhibit a shortening of S-phase duration in late postnatal and juvenile adult stages. Furthermore, these alterations in IPC cell cycle dynamics could be behind the defects in GN differentiation observed in Sox5-defective mice that ultimately leads to subtle morphological changes in DG architecture. Finally, we demonstrate that the additional loss of one Sox6 copy, a closely related TF to Sox5, lead to more profound disruptions in DG morphology than the one observed upon Sox5 loss. Overall, these findings point to a prominent role for Sox5 in combination with Sox6 in IPC cell cycle progression and GN maturation during postnatal DG development.

Also flagged:ferroptosiscancerdeathmembranesmembraneTumor
Journal Article 2026-07-23 No Snippets Di Dio A, Smaldone G, Napolitano V, Bertamino A, Gomez-Monterrey IM.
Show Full Abstract

Ferroptosis is an iron-dependent form of regulated cell death driven by the accumulation of peroxidized phospholipids in cellular membranes. In cancer, susceptibility to ferroptosis is not fixed but instead reflects a dynamic metabolic state shaped by lipid remodeling programs that determine membrane composition, oxidative liability, and the capacity to detoxify lipid peroxides. Tumor cells rewire fatty acid synthesis, desaturation, esterification, storage, sterol metabolism, and ether phospholipid remodeling to alter the abundance and distribution of oxidizable phospholipids and thereby shift their ferroptotic threshold. Polyunsaturated fatty acid-rich membrane phospholipids and di-polyunsaturated phospholipids promote lipid peroxidation and ferroptosis sensitivity, whereas monounsaturated fatty acids, lipid-droplet sequestration, 7-dehydrocholesterol, membrane-bound O-acyltransferase domain-containing 1 and 2, and antioxidant defense systems including glutathione peroxidase 4, ferroptosis suppressor protein 1, and the GTP cyclohydrolase 1-tetrahydrobiopterin pathway suppress ferroptotic death. Therapy-resistant, mesenchymal-like, and drug-tolerant persister states often display elevated oxidative stress together with increased dependence on lipid peroxide detoxification, whereas cancer stem cell-like states can remain either buffered or vulnerable depending on context. Here, we synthesize how lipid-state remodeling, tumor genotype, cell-state plasticity, and microenvironmental cues position tumors along a functional ferroptotic threshold, and we discuss how integrated lipidomic, transcriptional, and state-associated biomarkers may support biomarker-guided ferroptosis-based strategies in precision oncology.

VRK2
Also flagged:envelopechromosomecell cyclechromatinorganizationgene expression
Journal Article 2026-07-23 ✓ 1 Snippet Shi P, Wang S, Zang Z, Wang D, Yang C, Tao J, Liu J, Sun J, Shen W, Wang R, Sun M.
In-Text Gene Mentions

…glioblastoma (GBM) harboringVRK2promoter methylation, VRK1…

Show Full Abstract

Barrier-to-Autointegration Factor 1 (BANF1) is a self-associating protein encoded within the q13.1 locus of chromosome 11. It is integral to multiple cellular processes, including cell cycle regulation, chromatin organization, gene expression modulation, nuclear envelope (NE) repair, DNA damage repair (DDR), innate immune function, and viral infection control. While prior investigations have provided preliminary phenotypic and bioinformatic characterizations of BANF1 across various disease states, comprehensive analyses detailing its functional roles and mechanistic underpinnings in diverse pathological contexts remain scarce. In cancer, BANF1 is frequently upregulated, with cancer cells leveraging its functions to preserve NE integrity, inhibit activation of the cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) immune pathway, and facilitate epithelial-mesenchymal transition (EMT). These activities contribute to enhanced genomic stability and promote tumor cell proliferation and migration, thereby conferring oncogenic properties. In neurodegenerative diseases, BANF1 is implicated in disease pathogenesis, exemplified by its mediation of glutamate-induced oxidative stress and apoptosis in neuronal cells, as observed in Alzheimer's disease (AD). Additionally, rare mutations in BANF1 are associated with hereditary conditions: the recessive Ala12Thr (A12T) variant causes Néstor-Guillermo progeria syndrome (NGPS), whereas the dominant Gly16Arg (G16R) mutation results in dominant motor neuronopathy. This review further synthesizes recent progress in exploring BANF1 as a therapeutic target, encompassing the development of small-molecule inhibitors, immunomodulatory approaches, and its potential applications in cancer treatment. Overall, this article provides a comprehensive overview of BANF1's structural features, cellular functions, and involvement in disease initiation and progression, with particular emphasis on its expression profiles in malignancies and the therapeutic promise of BANF1-directed interventions.

Also flagged:cerebrovascular disorderstranslationalsynthesiscerebrovascular diseasepathogenesiscerebrovascular diseases
Journal Article 2026-07-23 No Snippets Shao Y, Jiang S, Zhai L, Sun F.
Show Full Abstract

Ubiquitin-specific protease 25 (USP25), a pivotal deubiquitinating enzyme, has attracted increasing attention in cardiovascular and cerebrovascular research due to its regulatory function in maintaining ubiquitination homeostasis. Considerable advances have been achieved in elucidating the molecular mechanisms through which USP25 participates in the pathological progression of diverse cardiovascular and cerebrovascular disorders. From the perspective of translational medicine, notable progress has also been observed in the development of USP25-targeted therapeutics, with several inhibitors having advanced to preclinical and early-phase clinical trials, thereby offering promising targets for precision treatment. Nevertheless, a systematic synthesis of fundamental biological properties, the trajectory of research development, and the intricate upstream-downstream regulatory networks of USP25, together with its mechanistic roles and therapeutic potential in these diseases, remains absent. In response, this review provides an in-depth summary of the essential biological features of USP25, elucidates the interplay between its upstream regulators and downstream substrates, and highlights its specific molecular mechanisms in cardiovascular and cerebrovascular disease pathogenesis. Additionally, the feasibility and strategic approaches of targeting USP25 for therapeutic purposes are analyzed, while the limitations and potential breakthroughs in the development of USP25 inhibitors are discussed. Finally, priority research directions are proposed to guide future exploration, with the ultimate aim of contributing theoretical foundations and novel perspectives for clinical management of cardiovascular and cerebrovascular diseases.

ZNFX1
Also flagged:Signalosomeinflammatory responsesautoimmune diseasepost-translational modificationsdegradationHomeostasis
Journal Article 2026-07-23 ✓ 1 Snippet Shu QP, Li SZ.
In-Text Gene Mentions

…signaling adaptor ZDHHCZinc finger DHHC-type palmitoyltransferase ZNFX1finger DHHC-type palmitoyltran…

Show Full Abstract

VISA/MAVS is a central signaling hub that links viral RNA sensing to type I interferon production and inflammatory responses. Because of its potent signal-amplifying capacity, VISA activity must be precisely controlled: insufficient activation compromises antiviral defense, whereas excessive or spontaneous activation can drive chronic inflammation and autoimmune disease. Recent studies have revealed a complex regulatory network governing VISA signaling, involving post-translational modifications, dynamic protein interactions, selective degradation pathways, metabolic cues, and intrinsic inhibitory mechanisms that collectively determine its activation threshold, signaling duration, and downstream output. In this review, we discuss the molecular mechanisms that regulate VISA activation, signal propagation, signal termination, and quiescence maintenance under resting conditions. We propose that immune homeostasis is achieved not through a simple on-off switch, but through continuous regulation of the VISA signalosome life cycle. This framework provides an integrated view of VISA and offers new insights into the molecular mechanisms underlying immune homeostasis.

Also flagged:Mitochondrial DiseasesPrimary mitochondrial diseasesPMDsgenetic disordersmitochondrialmitochondrial encephalomyopathy
Journal Article 2026-07-23 No Snippets Lim AZ, Moe AM, Stefanetti RJ, Ng YS.
Show Full Abstract

Primary mitochondrial diseases (PMDs) are one of the most common genetic disorders with an estimated prevalence of 1 in 4300. This review article summarises the latest updates in the field of mitochondrial medicine over the last decade. The availability of exome and genome sequencing in clinical practice has empowered clinicians to unravel the phenotypic heterogeneity of PMD and to end the diagnostic odyssey experienced by many patients and families. In unresolved cases, the detection of variant(s) of unknown significance by next-generation sequencing creates diagnostic and clinical uncertainties, and integrating a multi-omics approach can improve diagnostic yield. Alongside breakthroughs in genomic technologies, there is growing interest in using fluid biomarkers to guide diagnosis, monitor disease progression, and potentially serve as clinical trial endpoints. However, the clinical application of these fluid biomarkers in unselected patient cohorts with different disease onset and phenotypes would require more robust evidence. Natural history studies derived from national and international collaborations have provided insights into genotype-phenotype relationships and prognostic factors across several genotypes, including m.3243A>G, <i>MT-ATP6</i>, <i>POLG</i>, and <i>TK2</i>. Advances in therapeutic discoveries and clinical trials are challenging the obsolete dogma that PMDs are untreatable and bringing hope to patients; four compounds have been licensed, and many trials are in progress. Many barriers and challenges to translating laboratory discoveries into clinical therapy in PMD remain, including preclinical models for efficacy and safety testing, sample size, trial design, and the selection of outcome measures and trial endpoints.

HFE
Also flagged:FabryPompelysosomal storage diseasesamino acid disordersfatty acid oxidation disordersorganic acid disorders
Journal Article 2026-07-23 ✓ 1 Snippet Lee CY, Niu DM, Yang CF, Chen YJ.
In-Text Gene Mentions

…P/LP variants inHFEwere identified in…

Show Full Abstract

<b>Background/Objectives:</b> Whole exome sequencing (WES) has emerged as a clinically valuable second-tier test following abnormal biochemical newborn screening (NBS). However, population-specific data on diagnostic yield, secondary findings (SFs), and exome-wide carrier burden remain scarce in East Asian neonates, particularly since the release of the ACMG SF v3.3 gene list. We aimed to characterize these metrics in a Taiwanese neonatal cohort. <b>Methods:</b> We retrospectively analyzed 118 consecutive neonates referred to Taipei Veterans General Hospital between August 2021 and August 2022 following abnormal biochemical NBS. WES was performed on the Illumina NovaSeq 6000 platform; variants were classified per the 2015 ACMG/AMP framework and re-evaluated under ACMG SF v3.3. Referral categories comprised lysosomal storage diseases (<i>n</i> = 61), amino acid disorders (<i>n</i> = 38), fatty acid oxidation disorders (<i>n</i> = 13), and organic acid disorders (<i>n</i> = 6). <b>Results:</b> Fifty neonates (42.4%) received confirmed molecular diagnoses and 45 (38.1%) were carriers (combined molecular resolution 80.5%). Five participants (4.2%) harbored pathogenic/likely pathogenic variants in ACMG SF v3.3 genes (<i>TTN</i>, <i>LDLR</i>, <i>PTEN</i>, <i>RYR1</i>, <i>TP53</i>). Incidental findings occurred in 51.7%, and at least one recessive-carrier variant was detected in 99.2% (mean 4.15 per individual; median 4). The Taiwanese-specific c.639+919G>A cardiac Fabry variant accounted for 24/25 confirmed male Fabry cases, and the p.Gly576Ser pseudodeficiency allele confounded all suspected Pompe cases. <b>Conclusions:</b> Second-tier WES substantially improves diagnostic precision, discriminating confirmed diagnoses from carrier, pseudodeficiency, and biochemical false-positive states. The high carrier burden and incidental-finding rate underscore the importance of comprehensive pre- and post-test genetic counseling in East Asian neonatal genomic programs.

Also flagged:Endometriosispathogenesisnerveinflammatory responsesallergiesbenign disease
Journal Article 2026-07-23 No Snippets Yan Y, Lan X, Mai H, Tan H, Liang Y.
Show Full Abstract

The most common symptom of endometriosis is pain. The pathogenesis of endometriosis-associated pain remains unclear. In this review, we illustrate the pathogenesis of endometriosis-associated pain and the mechanisms of dienogest acts on endometriosis-associated pain, as well as therapeutic applications targeting these processes, by searching the literature in PubMed and Web of Science until May 2026. Abnormal distribution of nerve fibers, central sensitization, imbalance of inflammatory and immune environment, and hypoxic stress contribute to the generation of endometriosis-associated pain. Dienogest, as a fourth-generation selective progesterone receptor agonist, plays a key role in the treatment of endometriosis-associated pain by reducing serum estrogen levels, alleviating inflammatory responses, regulating nerve growth factor, modulating control central nervous system allergies, and influencing the biological processes of endometriotic stromal cells. Moreover, its long-term safety and tolerability are relatively satisfactory according to clinical studies, making it an effective therapeutic agent for endometriosis.

SHISA6
Also flagged:Gene Expressiongliomatumorsorganizationsynapselower-grade glioma
Journal Article 2026-07-23 ✓ 1 Snippet Rodrigues B, Dalmolin M, Dal-Pizzol HR, Malafaia O, Fernandes MAC, Coelho KMPA, Roesler R, Isolan GR.
In-Text Gene Mentions

…, GSG1L ,SHISA6, SHISA7 ,…

Show Full Abstract

<b>Background:</b> Glutamatergic neuron-to-glioma signaling mediated by α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) has emerged as an important mechanism in glioma progression. <b>Objectives/Methods:</b> We analyzed the expression of the AMPAR subunit genes <i>GRIA1</i>, <i>GRIA2</i>, <i>GRIA3</i>, and <i>GRIA4</i> in lower-grade glioma (LGG). <b>Results:</b> Expression of <i>GRIA1</i>-<i>GRIA4</i> was highest in IDH-mutant/1p19q-codeleted tumors and lowest in IDH-wildtype tumors across both The Cancer Genome Atlas (TCGA) and the Chinese Glioma Genome Atlas (CGGA) cohorts. High expression of each <i>GRIA</i> gene was associated with longer overall survival (OS). Transcriptome-wide analyses identified positive correlations between an AMPAR score and genes involved in synaptic organization, neuronal connectivity, and neurotransmission. Co-expression analyses demonstrated coordinated expression between <i>GRIA1</i>-<i>GRIA4</i> and genes encoding AMPAR auxiliary proteins. Gene Ontology (GO) enrichment revealed overrepresentation of synaptic signaling, trans-synaptic communication, and synapse organization. Although the AMPAR score was associated with favorable survival in univariate analyses, it did not retain independent prognostic significance after adjustment for key clinicomolecular variables. Elevated expression of AMPAR subunit genes in LGG was associated with favorable molecular subtypes and a synaptic transcriptional program. <b>Conclusions:</b> These findings suggest that <i>GRIA1</i>-<i>GRIA4</i> expression is associated with a synaptically enriched transcriptional program in LGG, although its cellular origin remains uncertain.

Research Square 2026-07-23 Preprint (No Snippets API) Toniolo S, Zhao S, Broulidakis M, Fower A, Gendarini C, Scholcz A, Griffiths T, Zetterberg H, Thompson S, Manohar S, Husain M.
Show Full Abstract

<title>Abstract</title> <p>Background Digital cognitive testing and plasma biomarkers have emerged as key players for population screening and measuring drug efficacy in clinical trials for Alzheimer’s Disease (AD). Understanding test-retest reliability of these tools is essential to estimate meaningful effects of an intervention over time. Whilst some data exist on variability of plasma and digital biomarkers at very short time frames or annually, studies conducted at intermediate time scales are lacking. Data on impact on this variability on clinical decision-making are also rare. Methods Paired testing of plasma biomarkers and digital cognition was performed at 0, 3 and 6 months in a cohort of 92 individuals (55 cognitively unimpaired healthy controls (HC) and 37 patients with early AD dementia (AD)). Plasma biomarkers examined included pTau217, pTau181, NfL, GFAP and the Aβ42/40 ratio. OCTAL (Oxford Cognitive Testing Portal) digital cognitive testing platform was used to measure cognition. Results pTau181 emerged as the plasma biomarker with worst test-retest reliability and was the only measure where repeating the sample improved accuracy in group discrimination. None of the digital measures showed further improvement in diagnostic accuracy if repeated over time, reflecting high reliability. Individual metrics showed different reliability profiles based on the index used to measure variability (Coefficient of variation or Intraclass Correlation Coefficient) and varied within groups (HC and AD). Conclusion Test-retest reliability measures are essential for interpretation of meaningful effects over time for plasma and digital outcomes.</p>

DCC
Also flagged:steatohepatitismetabolic dysfunctionsteatoticliver diseasestage liver diseasecompensated cirrhosis
Journal Article 2026-07-22 ✓ 2 Snippets Tacke F, Kim Y, Haas JS, Daumont MJ, Maas C, O'Donnell J, Schattenberg JM.
In-Text Gene Mentions

…€3884–11,538), €7224 forDCC(€5839–8938) and €12,948…

…stages such asDCCand HCC.…

Show Full Abstract

<b>Aim:</b> Metabolic dysfunction-associated steatohepatitis (MASH) is a progressive form of metabolic dysfunction-associated steatotic liver disease, linked to hepatic and extra-hepatic complications and substantial healthcare costs. Despite its clinical and economic impact, real-world evidence on disease progression and costs in Germany is limited. <b>Materials & methods:</b> We conducted a retrospective cohort study using statutory health insurance claims from the InGef database (2016-2023), covering 4.7% of the German population. Patients with MASH were identified using ICD-10-GM code K75.8, in absence of the more specific code in the German coding system. Baseline characteristics and comorbidities were assessed over 2 years prior to index diagnosis. Progression was defined by transitions through end-stage liver disease (ESLD) stages: compensated cirrhosis, decompensated cirrhosis, hepatocellular carcinoma and liver transplantation. Healthcare costs were analyzed descriptively and via regression models. <b>Results:</b> Among 4710 patients with MASH (prevalence: 0.15%), 39.4% had documented ESLD during follow-up (mean follow-up in days 1530). Disease progression to ESLD occurred in 26.0% of patients without baseline ESLD (n = 922/3490), whereas 4.0% of patients with baseline ESLD (n = 48/1188) progressed to a more severe ESLD stage during follow-up, with a mean time to first progression of approximately 25.3 months. Patients with ESLD incurred annual costs of €12,737 versus €4928 for those without ESLD. Progression to hepatocellular carcinoma and liver transplantation resulted in predicted costs of €12,948 and €75,719 per patient-year, respectively. Mortality was significantly higher among patients with ESLD (incidence rate ratio: 4.65; 95% CI: 3.76-5.79). <b>Discussion:</b> Over a quarter of identified patients with MASH already had advanced liver disease at baseline, suggesting potential underdiagnosis or late recognition in routine clinical practice. Early detection, proactive management and targeted therapies are essential to reduce progression and economic burden.

PRDX6
Also flagged:Tumorphosphorylationlocalizationhead and neck cancersautophagycancer
Journal Article 2026-07-22 ✓ 1 Snippet Pai A, Dcunha L, Gopalakrishnan AP, Ummar S, Rajeev AC, Raju R.
In-Text Gene Mentions

…as CCNL2, CDK11B,PRDX6, YTHDC1, RBM15, SRRM1,…

Show Full Abstract

Dual-specificity protein kinase CLK4 plays a pivotal role in regulating alternative mRNA splicing, DNA repair, and various cellular processes through precise phosphorylation. In this study, we analyzed 3825 global human cellular phosphoproteome studies, identifying 430 qualitative profiles and 55 quantitative differential datasets featuring high-confidence Class-1 phosphosites (localization probability ≥ 75%; A-score ≥ 13). Notably, S136 and S138 emerged as predominant phosphorylation sites outside the kinase domain. These sites showed frequent detection and differential expression in liver, lung, and head and neck cancers, as documented in PhosphositePlus. We identified a high-confidence set of co-regulated phosphoproteins, including SQSTM1, SRRT, RPS6, TP53BP1, TNKS1BP1, THUMPD1, OTUD4, and TCEA1. These proteins link CLK4 to critical pathways, including RNA splicing, autophagy, DNA damage response, and cancer progression. Binary interactors, including SRRM2, Interacts with SPT6 1 (IWS1), RBBP6, ZC3H18, BUD13, and DYRK1A, further connect CLK4 to RNA processing and splicing. Predicted downstream substrates, such as CCNL2, CDK11B, PRDX6, YTHDC1, RBM15, SRRM1, SFSWAP, HNRNPU, and DOCK7, highlight CLK4's broad regulatory scope. Upstream kinases were also predicted for S136 and S138. Site-resolved analyses revealed tumor-specific dysregulation of CLK4 phosphorylation at key residues. Co-occurring phosphosite alterations and nearby somatic mutations suggest disrupted CLK4 regulation in cancer. Overall, this study provides a comprehensive phosphoproteomic resource that maps CLK4's co-regulatory networks, paving the way for mechanistic investigations and targeted cancer therapies.

FBXL4
Also flagged:Mitochondriametabolismphosphorylationmitochondrialmetabolic diseaseaging
Journal Article 2026-07-22 ✓ 1 Snippet Alsina D, Rubalcava-Gracia D, Bubb K, Garcia-Villegas R, Vegvari A, Filograna R, Rosenberger FA, Koolmeister C, Larsson NG.
In-Text Gene Mentions

…mtDNA mutator orFbxl4-knockout mice (…

Show Full Abstract

Mitochondrial gene expression is essential for oxidative phosphorylation that generates the bulk of the cellular ATP, and mitochondrial dysfunction is a common cause of human metabolic diseases. Recently, the first pathogenic variants in the only known mitochondrial RNA polymerase (POLRMT) were described in patients presenting with a wide variety of clinical manifestations, including hypotonia, short stature, and developmental delay. Here, we modeled two human pathogenic POLRMT variants by creating the corresponding substitutions in mice: the dominant S582F and the recessive R984C variant. Mice homozygous for the R984C variant showed perinatal lethality without apparent embryonic developmental defects, a finding consistent with a failure to adapt to the metabolic transition to oxidative metabolism at birth. Mice carrying the S582F variant were viable and exhibited decreased mitochondrial transcript levels due to impaired de novo transcription. However, mtDNA levels and in organello mtDNA replication remained normal, which recapitulates the molecular phenotypes observed in patients. Altogether, our findings indicate that the conserved arginine near the active site is essential for POLRMT function, while the serine in the intercalating hairpin of the N-terminal domain is required for near-genome length transcription but not primase activity. This study highlights genotype-phenotype differences and provides new insights into POLRMT function.

TNFSF4
Also flagged:bladder cancercell divisiontumorBLCAcentrosomewound-healing
Journal Article 2026-07-22 ✓ 1 Snippet Dong C, Fang Z, Han Y, Yin Y, Cao Y, Lu Q.
In-Text Gene Mentions

…correlations with IL6,TNFSF4, and ENTPD1, but…

Show Full Abstract

<h4>Background</h4>Centrosome-related genes (CRGs) regulate cell division and genomic stability and may influence tumor progression, but their prognostic and functional roles in bladder cancer (BLCA) are not fully defined.<h4>Methods</h4>We curated 698 CRGs and identified 12 prognostic genes to construct a centrosome-related signature score (CRSS). The prognostic value of CRSS was evaluated in TCGA and GSE13507 cohorts. Functional enrichment, immune landscape, and drug sensitivity were analyzed through pathway analysis, ESTIMATE, and IC50 prediction. Machine learning and Mendelian randomization were used to identify the most promising CRGs. Furthermore, we performed single-cell RNA sequencing analysis to uncover the expression patterns of candidate CRGs. Expression and functional validation were performed using RT-qPCR, CCK-8, wound-healing assays, and immunohistochemistry.<h4>Results</h4>CRSS stratified patients into high- and low-risk groups with significant differences in overall survival. High-risk patients exhibited upregulated Aerobic glycolysis (AC), oxidative phosphorylation (OxPhos) and partial epithelial-mesenchymal transition (pEMT) pathways, higher immune/stromal scores, and distinct immune infiltration, including increased M0/M2 macrophages and decreased CD8⁺ T and follicular helper T cells. High-risk tumors showed altered sensitivity to multiple drugs, including AZD8186 and Staurosporine. Integrative analyses identified SPHK1 as a key candidate CRG. SPHK1 expression was associated with tumor grade, stage, poor survival, and the wound-healing molecular subtype. Functional assays showed that SPHK1 knockdown inhibited bladder cancer cell proliferation and migration. Immunohistochemistry further confirmed higher SPHK1 expression in tumors with more aggressive clinicopathological features.<h4>Conclusions</h4>We established a CRG-based model for BLCA and identified SPHK1 as a key gene associated with tumor progression and clinical outcomes.

HFE
Also flagged:methylationgenetic disordersimmune diseaseshepatitis B virus infectionchromosomeschromosome
Journal Article 2026-07-22 ✓ 1 Snippet Tran TTH, Hoang TH, Tran MH, Pham TM, Nguyen NN, Vu GM, Duong VC, Vu QT, Nguyen NT, Vu HQ, Nguyen TM, Nguyen TK, Nguyen SV, Dang T, Nguyen H, Do T, Le C, Nguyen DT, Nguyen HTT, Le NQ, Nguyen QH, Le LT, Pham T, Vu DM, Le HTT, Ngo TD, Nguyen LT, Hoang Y, Dao DX, Phan GH, Tran T, Tran Q, Ha CT, Nguyen L, Luu HN, Dao M, Le L, Le VS, Thuy Duong N, Nguyen Q, Le DH, Vu V, Vo NS.
In-Text Gene Mentions

…SRD5A2 , andHFE, which were…

Show Full Abstract

The population of Vietnam remains underrepresented in global genomic databases. Here, we present VN1K, a resource of multi-omics and phenotypic information for 1011 unrelated Vietnamese individuals. We present high-depth short-read whole-genome sequencing data for all samples along with various -omics datasets. Using a high-sensitivity variant detection pipeline, which includes a pangenome graph reference and a deep-learning framework, we identify approximately 42 million variants with 7 million short insertions/deletions and 90 thousand structural variants. VN1K also features a whole-genome methylation profile based on long read sequencing. We create a genotype imputation panel with high accuracy on the Vietnamese population, allowing us to identify variants with significantly different allele frequencies in the Vietnamese population compared to other populations. We establish the functional relevance of some of these variants, particularly those in genes associated with genetic disorders, immune diseases, and drug responses, by integrating the allele frequency differences with known genotype-phenotype associations and clinical annotations. Further, we map various loci related to hepatitis B virus infection, triglyceride levels, LDL-C levels, serum glucose levels, HbA1c levels, and levels of two liver enzymes (ALT and AST). The VN1K dataset is accessible via genome.vinbigdata.org, an integrated platform with both linear and graph-based genome browsers.

Also flagged:chromatinnuclear laminanuclear specklesnucleoplasmlaminaneurogenesis
Journal Article 2026-07-22 No Snippets Ahanger SH, Semenza ER, Zhang C, Gil E, Cole MA, Lu SH, Wang L, Kriegstein AR, Lim DA.
Show Full Abstract

The nuclear genome is spatially organized into a three-dimensional architecture by physical association of large chromosomal domains with subnuclear compartments including the nuclear lamina at the radial periphery and nuclear speckles within the nucleoplasm<sup>1-5</sup>. However, how higher-order spatial genome architecture regulates human development has been overlooked, and the interplay between chromatin state and subnuclear genome compartmentalization is poorly understood. Here we generate high-resolution maps of genomic interactions with the lamina and speckles in cells of the neurogenic lineage isolated from mid-gestational human cortex, identifying an intimate association between subnuclear genome compartmentalization, chromatin state and transcription. During cortical neurogenesis, subnuclear genome compartmentalization is extensively remodelled, relocating hundreds of neuronal genes from the lamina to speckles, including key neurodevelopmental genes bivalent for trimethylation of histone H3 at Lys27 (H3K27me3) and Lys4 (H3K4me3). At the lamina, bivalent genes have exceptionally low expression, and relocation to speckles enhances resolution of bivalent chromatin to H3K4me3 monovalency and increases transcription more than eightfold. We further demonstrate that proximity to the nuclear periphery-not the presence of H3K27me3-maintains the lowly expressed, poised state of bivalent genes embedded in the lamina. We find that the repressive environment of the lamina is associated with spatial segregation of the transcriptional elongation machinery from the nuclear periphery. Our results establish a paradigm in which knowing the spatial location of a gene is necessary for understanding its epigenomic regulation.

Also flagged:bindinglocalizationmetaphasechromosomeSynthesisconjugation
Journal Article 2026-07-22 No Snippets Bae J, Kim Y, Choe J, Hong J, Lee B, Hashiya K, Bando T, Sugiyama H, Lee S, Lee JH, Jo K.
Show Full Abstract

Accurate single-molecule optical genome mapping remains challenging due to the limited information content of barcode-only or profile-only strategies. Here, we present Dual Optical Mapping (DOM), which integrates sequence-specific barcode markers with AT frequency-dependent intensity profiles on the same DNA molecules to enhance mapping accuracy. Conventional optical mapping approaches rely either on sequence-specific barcodes generated by restriction endonucleases, nicking enzymes, or methyltransferases, or on dense profile mapping using DNA-binding molecules. By combining these complementary sources of information within a unified dual-channel framework, DOM increases positional specificity and alignment confidence. As a model system, we applied DOM to the E. coli genome (4.6 Mbp), where the combined dual-channel scoring metric (cc_rg2) ranked 172 of 182 molecules (95%) at the correct genomic locus as the top match, while 179 of 182 molecules (98%) could be validated after quality-control review. We further extended DOM to the human genome through genome-wide cross-correlation scanning coupled with placement score ranking. This quantitative framework enables objective evaluation of alignment distinctiveness across the entire genome, demonstrating scalability to large and complex genomic contexts. These results establish DOM as a scalable dual-channel framework for high-accuracy single-molecule genome mapping across both bacterial and human genomes.

Also flagged:cell activationcell-surfaceendoplasmic reticulumGolgi apparatusbindingproteasome
Journal Article 2026-07-22 No Snippets Arosa FA, Cardoso EM.
Show Full Abstract

Classical Major Histocompatibility Complex Class I (MHC-I) molecules are traditionally viewed as stable peptide-presenting structures expressed on the surface of all nucleated cells. Their expression by professional antigen-presenting dendritic cells (DCs) enables CD8+ T-cell activation, differentiation, and immune surveillance. However, accumulating evidence indicates that cell-surface MHC-I molecules exist in three major conformational states: (1) β2m-associated, peptide-loaded conformers that originate in the endoplasmic reticulum and pass through the Golgi apparatus after binding proteasome-generated cytosolic peptides (hereafter referred to as closed conformers); (2) β2m-free, peptide-empty conformers that arise following β2m dissociation from closed conformers either at the plasma membrane or after internalization and recycling (hereafter referred to as open conformers); and (3) β2m-associated, peptide-empty conformers that represent an intermediate state between closed and open conformers. Here, we propose a conceptual framework, supported by computational predictors of intrinsically disordered regions, in which transitions between closed and open MHC-I conformers are coupled to intracellular regulatory processes, including post-translational modifications of conserved motifs, intracellular trafficking, and signaling. Although direct experimental evidence linking these processes remains limited, we integrate independent observations into a working model that may guide future investigations into MHC-I-mediated cell-cell communication in both immune and non-immune contexts, in health and disease. For clarity, in this article we define "open conformers" as structurally competent, β2m-free, and peptide-deficient MHC-I molecules.

SOX6
Also flagged:Salivary adenoid cystic carcinomatumorsmyelopoiesisgene expressiontumorcell-cycle-
Journal Article 2026-07-22 ✓ 1 Snippet Yang G, Wang X, Ye T, Ma T, Chen Y, Nan F, Kong L, Chen X.
In-Text Gene Mentions

…upregulated expression ofSOX6(erythroid-restricted) and NR4…

Show Full Abstract

Salivary adenoid cystic carcinoma (SACC) is an immunologically cold malignancy with limited response to current immunotherapies. Integrated transcriptomic profiling of peripheral blood, primary tumors, lung metastases, and a two-donor single-cell dataset revealed compartment-specific expression signatures and, through computational inference, systemic immune dysregulation marked by hematopoietic suppression, T-cell exhaustion, compensatory myelopoiesis, and an immature B-cell expansion. To explore the transcriptional basis of this peripheral immune aberration, blood-derived RNA-seq was interrogated, identifying only 32 unique genes meeting |log2FC| > 1 and <i>q</i> < 0.05 among 34,999 transcripts; qPCR confirmed concordant upregulation of <i>IL33</i> and <i>CCL14</i>, providing directional rather than confirmatory support, suggesting peripheral immune molecular aberrations that still require validation through broader differential gene expression validation. Complementing this transcriptomic signature, detection of <i>MYB-NFIB</i> fusion transcripts matching tumor tissue in one patient's blood suggested that tumor-derived signals may access the circulation, although cohort validation remains necessary. Extending these peripheral observations to tissue compartments, we applied expression stratification, correlation networks, ligand-receptor mapping, and a virtual gain-loss model to computationally predict regulatory associations involving <i>IL17RB/OLIG1/NOTCH1</i> in primary tumors and a <i>CD24/IL17RB/MYB/MYBL2/CXCL13/CXCR5</i> module in lung metastases. At the single-cell level, cluster 10 emerged as a cell-cycle-high tumor population with transcriptional overlap with proliferating immune progenitors, providing a potential cellular basis for tumor cell entry into the circulation. Collectively, these computational inferences generate testable hypotheses for multicompartment immune dysregulation in SACC, positioning <i>IL17RB</i> as a candidate molecule that warrants prospective validation in SACC-specific preclinical models.

Also flagged:clinical malariasickle cell diseaseblood disordermalariaanaemiadeath
Journal Article 2026-07-22 No Snippets Mutagonda RF, Sarro YDS, Ruhl AP, Mmbando B, Nembaware V, Kengne A, Kuona P, Ackerman H, Guindo A.
Show Full Abstract

<h4>Introduction</h4>Sickle cell disease is a monogenic blood disorder prevalent in Africa, where malaria poses a health risk for affected individuals. Individuals with sickle cell disease are susceptible to malaria, which can be complicated by vaso-occlusive episodes, severe anaemia and death. Understanding the intersection of malaria and sickle cell disease in African countries with high co-prevalence is essential for developing effective management and prevention strategies, including clinical guidelines on the use of malaria chemoprophylaxis in this population. This study will determine the monthly incidence of malaria in children living with sickle cell disease in each of two clusters of African countries.<h4>Methods and analysis</h4>This 1-year observational study will enrol 2808 children with sickle cell disease, aged 6 months to 17 years, at Sickle Pan-African Research Consortium clinical sites in Ghana, Mali, Nigeria (West), Tanzania, Uganda, Zimbabwe and Zambia (East-South). Malaria infection will be assessed at monthly visits and unscheduled sick visits over 12 months. Data collected will include socio-demographic characteristics, beta-globin genotype, medical history, clinical symptoms and malaria blood smear or rapid diagnostic test results. The primary outcome is monthly incidence of clinical malaria; a secondary outcome is incidence of asymptomatic malaria.<h4>Ethics and dissemination</h4>This study was developed with input from patients with sickle cell disease and their caregivers. The study will be conducted according to the principles of the Declaration of Helsinki. Written informed consent from guardians and assent from child participants age 7 or above will be provided before enrolling in the study. This protocol has been reviewed and approved by local and national ethics committees at each study site. The findings of this study will be provided to participants and the general public through presentations at the annual Sickle Cell Day community events at each study site, local media and open access publication in peer-reviewed journals.The full names of the ethics committees are as follows. Ghana: Komfo Anokye Teaching Hospital Institutional Review Board; Mali: Ethics Committee of the University of Sciences, Techniques and Technologies of Bamako; Nigeria: National Health Research Ethics Committee of Nigeria; Tanzania: Muhimbili University of Health and Allied Sciences Research Ethics Committee and National Health Research Ethics Committee; Uganda: Makerere School of Medicine Research and Ethic Committee; Zambia: National Health Research Authority and Excellence in Research Ethics and Science Converge Institutional Review Board; and Zimbabwe: Joint Research Ethics Committee and the Medical Research Council of Zimbabwe.

Also flagged:mesomelicLanger mesomelic dysplasiaskeletal dysplasiasex chromosomeschondrocyte proliferationorganization
Journal Article 2026-07-22 No Snippets Piwar H, Pawlasek J, Sielaff P, Sztachelska M, Ordak M.
Show Full Abstract

Langer mesomelic dysplasia is an exceptionally rare skeletal dysplasia caused by complete or functionally complete deficiency of the <i>SHOX</i> (short stature homeobox) gene located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Clinically, the disorder is characterized by severe disproportionate short stature and marked mesomelic shortening of the limbs, particularly involving hypoplasia or aplasia of the ulna and fibula, while cognitive development and life expectancy are generally preserved. This narrative review summarizes current knowledge regarding the molecular genetics, developmental biology, clinical manifestations, radiographic findings, prenatal diagnosis, and differential diagnosis of Langer mesomelic dysplasia. The SHOX protein functions as a homeodomain-containing transcription factor essential for chondrocyte proliferation, differentiation, and growth plate organization. Pathogenic mechanisms include biallelic <i>SHOX</i> deletions, enhancer-region defects, missense variants affecting the homeodomain and nuclear localization signal, as well as splice-site variants leading to severe reduction of functional protein dosage. The article also discusses the broad phenotypic spectrum of <i>SHOX</i> deficiency, genotype-phenotype variability, and the relationship between Langer mesomelic dysplasia and related disorders such as Léri-Weill dyschondrosteosis and Turner syndrome. Understanding the molecular basis of this condition is essential for accurate diagnosis, genetic counseling, and prenatal assessment in affected families.

OLFM4
Also flagged:sepsisacute kidney injurygene expressionlocalizationCell-cell communication
Journal Article 2026-07-22 ✓ 1 Snippet Huang Y, Fei S, Huang M, Huang X, Lu F.
In-Text Gene Mentions

…CEACAM8 , andOLFM4, were prominently…

Show Full Abstract

<h4>Background</h4>Sepsis and acute kidney injury (AKI) are life-threatening conditions often coexisting as sepsis-associated AKI (S-AKI). However, their shared molecular mechanisms and immune heterogeneity remain unclear. This study aims to identify robust diagnostic biomarkers applicable to both conditions and to elucidate their diverse immune microenvironments using integrated transcriptomic approaches.<h4>Methods</h4>Transcriptomic datasets for sepsis and AKI were analyzed, with multiple cohorts used for training and external validation. Differential gene expression and WGCNA identified key modules, while LASSO and Random Forest algorithms screened shared hub genes. A diagnostic nomogram was constructed and evaluated using ROC and decision curve analyses. Single-cell RNA sequencing data were further analyzed to determine cellular localization, functional pathways, and intercellular communication.<h4>Results</h4>Four hub genes (<i>FBXO21</i>, <i>FLOT1</i>, <i>TMC6</i>, and <i>KLRB1</i>) were identified as robust diagnostic biomarkers for both sepsis and AKI, demonstrating strong predictive performance across validation cohorts. Single-cell analysis revealed that these genes were enriched in specific immune cell populations and injured renal cells, and were closely associated with T-cell activation and immune signaling pathways. Cell-cell communication analysis further inferred distinct ligand-receptor interactions that may underlie immune crosstalk in both conditions.<h4>Conclusion</h4>We identified a reliable four-gene diagnostic signature shared by sepsis and AKI and characterized their shared immune heterogeneity and inferred intercellular communication networks. These findings provide potential targets for early diagnosis and therapeutic intervention in sepsis-associated renal injury.

CA10
Also flagged:Tissue Expressiongene expressionmetabolismproliferationbiosynthesisbone remodeling
Journal Article 2026-07-22 ✓ 5 Snippets Wang K, Niu Z, Tang S, Han B, Xu J, Ma Y, Ding X, Shi H.
In-Text Gene Mentions

…candidate genes, includingCA10, WDR45B ,…

…seven genes (CA10, ADRB2 ,…

…these genes (CA10, ADRB2 ,…

…candidate genes includingCA10, ADRB2 ,…

…Concurrently,CA10(Carbonic Anhydrase X)…

Show Full Abstract

<h4>Introduction</h4>Duolang sheep is a meat-fat dual-purpose breed originating from Xinjiang, China, and the genetic basis of body size variation in this breed remains unclear.<h4>Methods</h4>Whole-genome resequencing was performed on 224 Duolang sheep with complete records for six body size traits. After variant calling, imputation, and quality control, 19.65 million high-quality SNPs were retained. After linkage disequilibrium pruning, 2.1 million relatively independent SNPs were used for a mixed linear model GWAS in GEMMA. Tajima's D and integrated haplotype score analyses were performed in a kinship-filtered subset of 60 animals, and SheepGTEx data were used to characterize tissue expression patterns.<h4>Results</h4>The GWAS identified 24 significant SNPs for height, body length, chest girth, shoulder width, and hip width. Integration of GWAS intervals with selection-signal regions prioritized 31 candidate genes, including <i>CA10</i>, <i>WDR45B</i>, <i>FADS2</i>, <i>LGALS12</i>, and <i>CTNNA2</i>. Multi-tissue expression profiles provided functional context for the prioritized genes.<h4>Discussion</h4>These findings provide insight into the genetic architecture of body size traits in Duolang sheep and identify candidate loci for future validation and genetic improvement studies.

Also flagged:Cancermalignant tumorsbindingepithelial-mesenchymal transitiontumortumors
Journal Article 2026-07-22 No Snippets Shi Q, Lou N, Xing H, Fu L.
Show Full Abstract

Cancer remains a major global health burden, with its incidence and mortality rates persistently high despite advances in treatment. Despite therapeutic innovations, malignant tumors continue to pose a formidable challenge to global health. Against this backdrop, the crosstalk between long non-coding RNAs (lncRNAs) and the Notch signaling pathway has emerged as a pivotal driver of tumorigenesis and progression. However, the complex regulatory network and a comprehensive mechanistic framework of this axis await systematic elucidation. This review systematically consolidates recent advances in understanding how lncRNAs precisely modulate Notch pathway activity through diverse mechanisms, including acting as competing endogenous RNAs, direct protein binding, epigenetic regulation, and exosome-mediated intercellular communication. The discussion encompasses various malignancies, spanning the digestive, respiratory, urogenital, nervous, and hematologic systems. The lncRNA-Notch regulatory axis is identified as a ubiquitous and functionally central oncogenic network. It orchestrates critical malignant phenotypes-such as such as stemness maintenance, epithelial-mesenchymal transition, metabolic shifts, drug resistance, and immune evasion-through intricate bidirectional crosstalk. Functional studies confirm that targeting key nodes of this axis can effectively reverse drug resistance and suppress tumor growth. Although challenges remain in its clinical translation, future research integrating single-cell multi-omics, nanotechnology, and other innovative strategies will undoubtedly open new avenues for precision diagnosis and cancer therapy.

Also flagged:tumormetabolismgene expressioncervical squamous cell carcinomalactylationcervical cancer
Journal Article 2026-07-22 No Snippets Zheng Y, Li Y, Zhang S, Lv Q, Zhang J, Zhang B, Li Y.
Show Full Abstract

<h4>Introduction</h4>Lactylation, an emerging post-translational modification, modulates tumor metabolism and gene expression, thereby influencing the initiation and progression of cervical squamous cell carcinoma (CESC). This study aims to identify lactylation-associated prognostic features in CESC through the integration of transcriptomic data and single-cell RNA sequencing (scRNA-seq).<h4>Methods</h4>Publicly available datasets were utilized for this study. Lactylation-related genes (LRGs) linked to CESC prognosis were found through analysis. Key prognostic genes include PGK1, PFKP, DDX39A, RFC4, WAS, and PFKM, with PFKP identified as a risk factor.<h4>Results</h4>The risk model demonstrated strong predictive performance, and immune infiltration analysis revealed elevated levels of immune cells, with CD8<sup>+</sup> T cells negatively correlating with risk. ScRNA-seq analysis identified three distinct cell types, with CD8<sup>+</sup> T cells showing a distinct developmental trajectory, marked by a reduction in early-stage cells and an accumulation of late-stage cells within the CESC microenvironment. Moreover, the expression of prognostic genes was elevated during the later stages of CD8<sup>+</sup> T cell differentiation.<h4>Conclusion</h4>LRGs demonstrated significant prognostic value in CESC and accurately predicted patient outcomes. Furthermore, the study underscored the pivotal role of CD8<sup>+</sup> T cells in the progression of CESC.

Research Square 2026-07-22 Preprint (No Snippets API) Fu J, Chen J, Liu C, Ren W, Wu C.
Show Full Abstract

<title>Abstract</title> <p>Exosomes play critical roles in prostate cancer (PRAD) progression. This study aimed to identify and validate exosome-related diagnostic biomarkers for PRAD using integrated bioinformatics and machine learning approaches. Transcriptomic data from TCGA-PRAD and three GEO cohorts were intersected with curated exosome-related gene sets to obtain exosome-related DEGs (Exo-DEGs). Core diagnostic genes were selected through a consensus strategy integrating LASSO, SVM-RFE, and random forest. Diagnostic performance was assessed using ROC analysis, nomogram, and decision curve analysis, while model interpretability was examined using SHAP. Immune infiltration was estimated by ssGSEA. Drug prediction used DSigDB enrichment and molecular docking to AKR1B1. Twelve Exo-DEGs were identified, yielding an eight-gene exosome-related diagnostic signature (CAV1, CLU, FGFR2, APOE, AKR1B1, OLFM4, ALB, and GATA4). The signature demonstrated excellent diagnostic accuracy (AUC = 0.966), outperforming single-gene classifiers. Among ten machine-learning classifiers, random forest achieved the best test-set performance (AUC = 0.953), with SHAP highlighting FGFR2, APOE, CAV1, and CLU as top contributors. Core genes were positively associated with multiple immune cell signatures. Molecular docking suggested stable AKR1B1 binding with cholesterol (Vina score − 8.2 kcal/mol) and warfarin (− 8.0 kcal/mol). Bulk analyses showed decreased AKR1B1 expression in tumors, while single-cell analyses revealed prominent expression in myeloid populations, particularly macrophages, linked to inflammasome signaling, EMT, and immune responses. AKR1B1 represents a promising diagnostic biomarker with functional relevance to tumor immunity and metabolism, offering potential for targeted drug development.</p>

medRxiv 2026-07-22 Preprint (No Snippets API) Fiorini MR, Dilliott AA, Alsabagh S, Wredenhagen N, Farhan SM.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease characterized by the selective degeneration of motor neurons with a substantial genetic contribution to disease risk. Distinct genetic etiologies converge on key pathogenic processes in ALS, including aberrant RNA metabolism, proteostatic stress, dysregulated vesicular transport, and mitochondrial dysfunction. Here, we investigate whether perturbed transcriptional programs associated with definitive ALS genes harbor elusive genetic contributors to disease. We analyzed RNA sequencing data profiling induced pluripotent stem cell-derived motor neurons from individuals with ALS ( N = 438) and controls ( N = 187). Leveraging an integrative analytical framework, we identified transcriptional pathways linking variants in definitive ALS genes to widespread coordinated co-expression activity driven by gene-specific transcriptional programs. We subsequently subjected all genes comprising significant pathways to genetic analyses to uncover novel targets and characterized these genes using single-nuclei transcriptomics of the motor and prefrontal cortices of individuals with ALS and controls. The identified transcriptional programs associated with definitive ALS genes showed strong concordance to established biology, including dysregulated proteostasis and mitochondrial stress in SOD1 ALS, protein aggregation and degradation pathways in FUS ALS, and altered vesicle dynamics, synaptic transmission, autophagy, and trafficking programs in GRN ALS. These pathways encompassed both well-established ALS genes, as well as six target genes— PTPRN2 , UNC13C , TTC3 , USP10 , PSMD4 , and RUFY3 —of which USP10 , PSMD4, and RUFY3 have not yet been described in the context of ALS genetic association studies. Single-nuclei analyses demonstrated that target gene expression was enriched in the baseline architecture of neuronal populations, supporting neuron-intrinsic mechanisms of vulnerability. PSMD4 showed region-specific dysregulation in selectively vulnerable Layer 5 motor neurons of individuals with ALS, implicating regionally divergent proteasome activation as a neuron-intrinsic feature of ALS vulnerability. Collectively, this work advances the molecular understanding of distinct genetic ALS etiologies, provides mechanistic insight into emerging ALS target genes, and establishes a generalizable framework that is readily applicable across heritable diseases for the identification of disease-relevant molecular pathways and target genes.

Preprints.org 2026-07-22 Preprint (No Snippets API) V.O P, D.G Z, A.V K, D.S K, E.S V.
Show Full Abstract

Induced pluripotent stem cells (iPSCs) are prone to genomic instability during prolonged culture, with recurrent chromosomal aberrations conferring selective advantages. Replication stress is a major driver of this instability, yet the repertoire of replication stress‑sensitive loci in iPSCs remains largely unexplored. Here, we mapped aphidico-lin‑sensitive fragile sites (asFS) in three independent iPSC lines using classical cytogenetic break analysis combined with Monte Carlo simulation and MiDAS mapping directly on banded metaphase chromosomes. We identified 28 asFS, which segregated into a highly active Major cluster (8 sites, accounting for 59% of breaks among asFS) and a less active Minor cluster (20 sites). Five universal asFS (9p21, 6q25-26, 20p11-12, 10q22, Xq25) were present in all three lines, representing a tissue‑specific fragility signature of pluripotent stem cells, with Xq25 shifting into the Major cluster after correction for X chromosome dosage. Minor asFS showed preferential co‑localization with physical breakpoints or minimal overlapping regions of recurrent culture‑acquired aberrations, including 20q11.21 (BCL2L1), 1q32 (MDM4), 8q24 (MYC), 17q21 (WNT3‐WNT9B), and 18q21 (DCC/FRA18B). MiDAS mapping validated most asFS and revealed additional replication stress‑sensitive loci in pericentromeric and subtelomeric regions that are difficult to score by conventional G‑banding. Comparison with fragile site maps from other cell types con-firmed tissue specificity, showing that the iPSC asFS repertoire is distinct in rank order and relative activity. Collectively, our findings indicate that the asFS repertoire in iPSCs is hierarchically organized into a stable universal core and a variable peripheral component, and suggest that Minor asFS may serve as initial substrates for adaptive culture‑acquired rearrangements. This work provides a framework for understanding how replication stress and clonal selection shape the mutational landscape of pluripotent stem cells

bioRxiv 2026-07-22 Preprint (No Snippets API) Jung O, Hoffmeister-Ullerich S, Omriouate A, Plumhoff J, Kreutz MR, Grochowska KM, Morellini F.
Show Full Abstract

Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin ( HTT ) gene. The disease is characterized by movement disorders, and it also presents with personality changes, including apathy and aggression, along with cognitive decline. While most animal models for HD have been validated for motor deficits, less is known about alterations in other behavioral functions. Here, we performed a longitudinal study to analyze the behavior of a knock-in mouse model of HD with a chimeric mouse/human exon 1 containing 140 CAG repeats inserted in the murine huntingtin gene. We specifically inquired about the onset of cognitive impairments in knock-in mice and whether changes in various behavioral functions such as locomotion, anxiety, and cognition correlate at the individual level. Our data indicate that female and male knock-in mice exhibit reductions in body weight, novelty-induced locomotion, and remote spatial memory retrieval. However, social behavior, working, and short-term memory remain unaffected. Within knock-in mice, lower open-field activity correlated with poorer remote memory performance. Moreover, CAG repeat length negatively correlated with locomotor activity and spatial memory, indicating that greater repeat expansion predicts more severe behavioral impairment. These findings identify early affective changes, followed by selective long-term memory and locomotor deficits, in knock-in mice, supporting this model as a useful platform for studying prodromal HD and repeat-length-dependent disease variability. <h4>Highlights</h4> CAG140 knock-in mice show early anxiety, later reduced locomotion and memory deficits Long-term and remote memory are impaired while short-term and working memory are spared Lower locomotion at the age of 8 months correlates with poorer memory at 14 months of age in individual CAG140 knock-in mice Greater CAG repeat length predicts worse locomotion and memory

Also flagged:female infertilitysecretionangiogenesisinfertilityinfectionschronic endometritis
Journal Article 2026-07-21 No Snippets Lin S, Shi H, Huang X, Chen X, Chen L, Zhan Q, Bai S, Shi X, Yang J, Chen W.
Show Full Abstract

Endometrial injury remains a leading cause of female infertility, yet current clinical interventions exhibit limited regenerative efficacy. In this study, we developed a micro-nano composite system (G-H/ADSC@PDA/PFD) combining adipose-derived mesenchymal stem cell (ADSC)-laden double-network hydrogel (G-H/ADSC) microspheres with pirfenidone (PFD)-loaded polydopamine (PDA/PFD) nanoparticles to achieve synergistic stem cell and drug delivery. The microspheres were fabricated from gelatin methacryloyl (GelMA) and hyaluronic acid methacryloyl (HAMA) via droplet microfluidic technology, exhibiting favorable mechanical strength and cytocompatibility. They provide a 3D microenvironment that supports ADSC growth, proliferation, and paracrine secretion, thereby enhancing angiogenesis and modulating the inflammatory milieu. Moreover, the incorporated PDA/PFD nanoparticles enhance the adhesion of the composite system to the injured endometrial site, while efficiently scavenging reactive oxygen species. The sustained release of PFD downregulates TGF-β expression, inhibits collagen deposition and fibrotic progression, and further optimizes the regenerative niche for ADSCs. In a rat model of endometrial injury, the G-H/ADSC@PDA/PFD system significantly promoted endometrial regeneration, reduced fibrosis, restored the local microenvironment, and successfully restored fertility. This study introduces a promising combinatorial strategy for the treatment of endometrial injury and infertility.

HFE
Also flagged:Alzheimer's diseaseneurodegenerative disorderdetoxificationureaketonemetabolism
Journal Article 2026-07-21 ✓ 1 Snippet Zhang N, Chen W, Wang M.
In-Text Gene Mentions

…liver diseases likehemochromatosis, increased iron deposition…

Show Full Abstract

Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized by amyloid-β (Aβ) deposition. The liver-brain axis underscores the central role of the liver in modulating cognitive function through multidimensional regulatory mechanisms. As a core metabolic and detoxification organ, the liver also helps maintain cerebral homeostasis via pathways including the urea cycle, antioxidant systems, ketone body metabolism, and bile acid regulation. Dysfunction of these processes may lead to ammonia accumulation, exacerbated oxidative stress, and Aβ clearance, thereby accelerating the pathological progression of AD. Liver-derived factors such as apolipoprotein E (APOE), C-reactive protein (CRP), fibroblast growth factor 21 (FGF21), and insulin-like growth factor 1 (IGF-1) significantly increase the risk of AD through dual mechanisms-inhibiting Aβ clearance and activating neuroinflammation, thereby directly affecting cognitive function via modulation of inflammation, metabolism, and blood-brain barrier (BBB) integrity. Neural interfaces formed by the hypothalamic-pituitary-target gland axis and the vagus nerve enable communication from the liver to the brain, with emerging evidence also supporting a reverse influence from the brain to the liver. Emerging technologies such as molecular tracing and nanocarriers provide new tools for deciphering dynamic interactions within the liver-brain axis. Liver-targeted metabolic interventions show potential for reversing cognitive impairment. Unlike previous reviews that mainly focused on single pathways, this review conceptualizes the liver-brain axis as a multidimensional regulatory network in AD. By clearly linking network nodes to potential therapeutic interventions, it provides us with a novel framework that not only describes the various mechanisms but also focuses on identifying actionable targets for disease prevention and treatment.

Also flagged:leukemiasleukemiaacute leukemialocalizationcytoplasmnuclear export
Journal Article 2026-07-21 No Snippets Yamada A, Nagasawa S, Nakagawa M, Kamimura S, Inoue N, Watanabe H, Takagi M, Koga Y, Keino D, Nakayama H, Yoshimura J, Doi K, Mitsui J, Tsuji S, Moritake H.
Show Full Abstract

Germline variants in leukemia predisposition genes are increasingly detected in pediatric patients. Nevertheless, the rare variants identified in diagnostic samples may be misinterpreted without variant-level functional evaluation and cautious clinical interpretation. Whole-exome sequencing was performed on 28 individuals from five kindreds in which at least two children developed acute leukemia. Results identified a rare ETV6 variant, c.604C > G (p.Arg202Gly), in monozygotic twins with ETV6::RUNX1-positive B-cell precursor acute lymphoblastic leukemia. To support variant interpretation, HeLa-cell populations stably expressing FLAG-tagged wild-type ETV6 and p.Arg202Gly and the known loss-of-function control p.Pro214Leu were established. Subcellular localization was assessed via immunofluorescence microscopy with quantitative scoring. Transcriptional repression was evaluated using luciferase reporter assays driven by ETV6 target promoters (MMP3 and PF4). p.Arg202Gly predominantly showed nuclear localization comparable to WT, whereas p.Pro214Leu was enriched in the cytoplasm. In the reporter assays, similar to WT, p.Arg202Gly retained repression activity. Meanwhile, p.Pro214Leu failed to repress both reporters. The in-silico prediction of nuclear export sequences suggested an additional export signal in p.Pro214Leu, but not in p.Arg202Gly. Collectively, these findings indicate that p.Arg202Gly behaves as WT-like in the assays performed and do not support a loss-of-function effect. Our study emphasizes the importance of variant-level functional assessment for rare ETV6 variants to inform clinical interpretation and avoid overestimation of pathogenicity.

Also flagged:airway hyperresponsivenesshyperresponsivenessasthmapulmonary diseaseAHRvitamin A
Journal Article 2026-07-21 No Snippets Otoshi T, Kotton BD, Kameshwar AK, Seki Y, Cardell Z, Ke X, Matsuno Y, Rajaram P, Kim YK, Sharpton SM, Quadro L, Cardoso WV, Suzuki M.
Show Full Abstract

Airway structural remodeling and hyperresponsiveness (AHR), hallmarks of asthma, are influenced by genetic variations and adverse exposures. While intrauterine perturbations in lung development have been linked to adult pulmonary disease, the developmental origins of these abnormalities remain poorly understood. Here, we provide evidence of genetic background playing a key role in this process. Using A/J and C57BL/6J mice known for their distinct susceptibility to AHR, we show that A/J embryos selectively develop an aberrant airway smooth muscle (SM) program and AHR in adulthood when exposed transiently to a vitamin A/retinoic acid (RA)-disrupted intrauterine environment in vivo by maternal BMS493 administration. Single-nucleus multiomics identified a mesenchymal cell population overactivating TGF-β targets in response to BMS493 selectively in A/J lungs. These cells, localized to sites of airway SM initiation and p-SMAD2- and -3, exhibited robust BMS493-mediated upregulation of SMAD2/3 targets, including regulators of SM program Pdgfra and Tnc. Functional analyses in vivo and cultured lungs showed aberrant SM formation in areas of overactive TGF-β of BMS493-exposed lungs. These abnormalities were prevented by inhibiting TGF-β signaling in utero in RA-deficient embryos. These findings underscore how distinct genetic backgrounds respond to intrauterine perturbations that program airway structure and function, with potential lasting consequences in postnatal pulmonary function.

Also flagged:degradationendoplasmic reticulumxenophagyinfectionsinfectionreticulophagy
Journal Article 2026-07-21 No Snippets Gatica D, Klionsky DJ.
Show Full Abstract

In recent years ERphagy, the selective autophagic degradation of the endoplasmic reticulum (ER), has emerged as a key selective autophagic pathway involved not only in the recycling of the ER, but also in preventing the replication of viruses and bacteria. The mechanisms by which ERphagy achieves this do not seem immediately related to canonical xenophagy pathways and could provide a new avenue for therapeutic targets to combat pathogenic infections. In this editor's corner we briefly summarize the ways ERphagy is involved in pathogen infection, highlighting the potential ERphagy has as an understudied innate immune response pathway.<b>Abbreviation</b>: IFN-I: type I interferon; LPS: lipopolysaccharide; STING1: stimulator of interferon response cGAMP interactor 1.

ANKRD45
Also flagged:tumorhepatocellular carcinomaliver cancertransmembranecancertumors
Journal Article 2026-07-21 ✓ 1 Snippet Lin P, Wen Y, Zhao J, Zhang F, Su Y, He H, Yu H, Li Q, Liu C, Hu Z, Li Y, Fang Z, Liang L, Huang S.
In-Text Gene Mentions

…including LDHB, GJA10,ANKRD45, SDSL, ZPLD1, FILIP1…

Show Full Abstract

<h4>Background</h4>Primary liver cancer, predominantly hepatocellular carcinoma (HCC), has limited therapeutic options. While mutation-derived neoantigen vaccine holds promise, its success is hindered by low antigen availability. This study explores transcriptome-derived neoantigens (neoantigen-encoding tumor-specific transcripts, neoTSTs) in HCC, characterizing their features, generation mechanisms, and therapeutic potential.<h4>Methods</h4>We developed a computational pipeline integrating STAR/StringTie-based transcript assembly with multiexon/single-exon reference datasets (23,972 human control samples) for tumor-specific transcripts (TSTs) identification. A custom sliding-window algorithm compared TST-encoded peptides against UniProt, with neoTSTs predicted using netMHCPan. This framework was applied to 1,013 patients with liver cancer. NeoTSTs were validated through proteomics, immunopeptidomics, and HLA-transgenic models. Multiomics analyses characterized splicing patterns, transposable elements, and transcription factor regulation. Single-cell RNA-seq and Hep53.4 murine models assessed tumor coverage and immunotherapeutic efficacy.<h4>Results</h4>We analyzed RNA-seq data from 1,013 patients with liver cancer and constructed a multilayered reference dataset. Using a customized pipeline, we identified an average of 60 neoTSTs per patient, significantly surpassing mutation-derived neoantigens (neoMuts). NeoTSTs exhibited higher population frequencies, with 73.1% providing multiple epitopes, and were validated through mass spectrometry and HLA transgenic mouse models. Mechanistically, neoTSTs were generated via retained introns, transposable element activation, HNF4A-regulated alternative promoters, and de novo transmembrane domain generation. Single-cell analysis revealed neoTSTs cover >75% of tumor cells and identified antigen-presenting cancer-associated fibroblasts that enriched in immunotherapy responders and amplified CD4<sup>+</sup> T-cell responses. In murine HCC models, neoTST vaccination outperformed neoMuts, inducing dual major histocompatibility complex-I/II activation and significant tumor growth inhibition.<h4>Conclusions</h4>NeoTSTs represent a superior neoantigen source in HCC, compensating for the limitations of mutation-derived targets. The remarkable abundance and patient-to-patient sharedness of neoTSTs underscore their dual potential: (1) as personalized immunotherapeutic targets, and (2) as broadly applicable antigens for low-TMB tumors. These findings provide a transformative framework for expanding treatment options in HCC immunotherapy.

HTT
Also flagged:centrosomeciliumNeurodegenerative diseaseshereditary ataxiasmetabolismcentrosomes
Journal Article 2026-07-21 ✓ 5 Snippets Sahin U, Firat-Karalar EN.
In-Text Gene Mentions

…expansion in theHTTgene, producing an…

…tract in Huntingtin (HTT) protein (Tabrizi et…

HTTis expressed ubiquitously,…

…defects in diverseHTTfunctions (Jiang et…

…Wild-typeHTTlocalizes to the…

Show Full Abstract

Neurodegenerative diseases (NDDs), including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and hereditary ataxias, remain major global health challenges with limited therapeutic options. Although clinically and genetically diverse, these diseases share extensively studied cellular and molecular hallmarks, including protein aggregation, impaired proteostasis, cytoskeletal abnormalities, altered energy metabolism, nucleic acid damage, and chronic inflammation. Emerging evidence indicates that dysfunction of the centrosome-cilium-satellite axis intersects with these established pathways in disease- and cell type-specific contexts. This axis, composed of centrosomes, primary cilia, and centriolar satellites, coordinates cytoskeletal organization, ciliary signaling, trafficking, proteostasis, and stress responses and acquires specialized functions in neurons that support polarity, connectivity, and long-term maintenance. In this review, we outline the structure, function, and neuronal specializations of the centrosome-cilium-satellite axis, then examine how its dysfunction has been reported in neurodegenerative disease models. We also discuss centriolar satellites as regulators of centrosome and cilium biology whose disease-specific roles in classical NDDs remain comparatively underexplored, with insights from Huntington's disease and schizophrenia. Finally, we discuss therapeutic strategies aimed at restoring axis structure and dynamics, modulating ciliary signaling, and correcting disease-linked genetic or transcript-level defects, emphasizing mechanism-based approaches that require validation in disease-relevant models. Together, the centrosome-cilium-satellite axis provides an emerging framework for understanding context-dependent organelle dysfunction in neuronal vulnerability and neurodegeneration.

PRDX6
Also flagged:PDACextracellularmetabolismcoagulationsecretionPancreatic Ductal Adenocarcinoma
Journal Article 2026-07-21 ✓ 5 Snippets Xiang L, Jin Y, Hu R, He Y, Zhang Y, Li A.
In-Text Gene Mentions

…CTRB2, MARCO, PIGR,PRDX6, REG1A, Trypsin‐2, and…

…patients, whereas PEP‐FAP,PRDX6, CTRB2, REG1A, Trypsin‐2,…

…body/tail tumors, whilePRDX6, MARCO, and Trypsin‐2…

…ptor (PIGR), peroxiredoxin‐6 (PRDX6), lithostathine‐1‐alpha (REG1…

…29 ], whereasPRDX6may represent oxidative…

Show Full Abstract

<h4>Background</h4>Pancreatic ductal adenocarcinoma (PDAC) is a highly lethal malignancy that is often diagnosed after curative treatment is no longer feasible. Existing biomarkers, particularly CA19-9, have limited sensitivity and specificity. Plasma proteins that capture tumor-associated biological alterations may therefore provide useful signals for earlier detection.<h4>Methods</h4>Plasma samples from 99 patients with PDAC and 30 healthy controls were analyzed using data-independent acquisition (DIA) proteomics. Differentially expressed proteins were identified using predefined statistical thresholds and further examined by functional enrichment analysis. Selected candidate biomarkers were validated by ELISA in an independent subset.<h4>Results</h4>Among 565 quantified plasma proteins, 52 were differentially expressed between PDAC and controls. These proteins were enriched in extracellular processes, cholesterol metabolism, complement and coagulation cascades, and pancreatic secretion pathways. ELISA validation confirmed higher plasma levels of Cathepsin S, CTRB2, MARCO, PIGR, PRDX6, REG1A, Trypsin-2, and PEP-FAP in patients with PDAC compared with healthy controls. ROC analyses showed moderate-to-good discriminatory performance for several candidates, and the MARCO + PEP-FAP model improved classification compared with either marker alone.<h4>Conclusion</h4>These findings reveal circulating proteins linked to key PDAC-related biological processes and identify eight candidates for further evaluation in multi-protein diagnostic panels. Larger validation studies incorporating clinically relevant disease control groups are warranted to determine their diagnostic specificity and clinical utility.

Also flagged:genetic diseasesgenetic diseasecytoplasmmitochondriacytoplasmicchromosome
Journal Article 2026-07-21 No Snippets Antonellis A, Barrientos M, Bensasson E, DeClercq T, Garrigós P, Heilmann R, Horvath R, Magee D, Moresco A, Rowland A, Vallee I, Alexander R, Cui H, Gruić-Sovulj I, Hendrickson TL, Kim S, Ling J, Martinis SA, Musier-Forsyth K, Yang XL, Heinemann IU, Ribas de Pouplana L.
Show Full Abstract

Aminoacyl-tRNA synthetases (ARSs) are a family of enzymes that attach amino acids to tRNAs. To date, all 37 human ARS genes have been implicated in genetic diseases, affecting over a thousand patients worldwide. At the 2025 Federation of European Biochemical Societies (FEBS) Special Meeting 'Expanding Frontiers in Aminoacyl-tRNA Synthetase Research', patients, families, and advocacy groups communicated the need for a unified approach for reporting on ARS gene names and associated conditions in the scientific literature. This request stemmed from the current use of multiple nomenclature systems and the desire of these individuals to rapidly identify published data on specific ARS genes. Here, we summarize ARS gene nomenclature and request that the scientific community adhere to a single nomenclature system.

HFE
Also flagged:Chronic pancreatitistype 3c diabetestype 3c diabetes mellitusCP-onset diabetesinsulin
Journal Article 2026-07-21 ✓ 1 Snippet Makashova M, Tamadon A, Bazargaliyev Y, Kudabayeva K, Kosmuratova R, Mussin NM, Safarzoda Sharoffidin R.
In-Text Gene Mentions

…carcinoma, cystic fibrosis,hemochromatosis, and previous pancreatic…

Show Full Abstract

<h4>Background</h4>Chronic pancreatitis (CP) progressively destroys pancreatic parenchyma and predisposes patients to pancreatogenic type 3c diabetes mellitus (T3cDM).<h4>Objectives</h4>We conducted a systematic review and meta-analysis of cohort studies enrolling adults with clinically and/or instrumentally confirmed CP and no pre-existing diabetes at baseline.<h4>Design</h4>Systematic review and meta-analysis of cohort studies.<h4>Data sources and methods</h4>Scopus, Web of Science Core Collection, and PubMed were searched from inception to August 2025. Random-effects models estimated pooled incidence of new-onset diabetes and the proportion requiring insulin. Prespecified subgroup analyses were stratified by follow-up duration (<60 months, 60-120 months, >120 months). Meta-regression explored demographic, behavioral, and clinical moderators.<h4>Results</h4>Nineteen studies met the inclusion criteria and contributed to the primary meta-analysis of incident diabetes after CP. The pooled incidence of diabetes was 30% (95% CI: 27-34; <i>I</i>² = 94.8%), with a prediction interval of 15%-49%. Exploratory follow-up-stratified analysis suggested a time-dependent increase: 18% (95% CI: 14-22) at <60 months, 25% (95% CI: 15-35) at 60-120 months, and 44% (95% CI: 24-66) at >120 months (<i>p</i> for subgroup differences = 0.0184). Among patients who developed diabetes, 59% (95% CI: 46-71; 7 studies; <i>I</i>² = 91.7%) required insulin therapy. Meta-regression did not identify statistically significant study-level moderators, although pancreatic calcification showed a non-significant positive trend.<h4>Conclusion</h4>CP is associated with a substantial and time-dependent incidence of diabetes; however, the pooled estimates should be interpreted cautiously because the included studies were observational and highly heterogeneous. These findings support long-term glycemic monitoring and careful classification of pancreatogenic diabetes in patients with CP, while optimal screening intervals and treatment timing require further prospective evidence.<h4>Trial registration</h4>PROSPERO CRD420251136931.

Also flagged:Neurodegenerative Diseasesmitochondrialmultiple system atrophyamyotrophic lateral sclerosisspinocerebellar ataxiasspinal muscular atrophy
Journal Article 2026-07-21 No Snippets Zeng CW.
Show Full Abstract

Neurodegenerative diseases represent a major and growing global health burden. Although these disorders are often clinically defined by symptoms and affected brain regions, many are mechanistically linked to abnormal protein accumulation, misfolding, impaired proteostasis, RNA dysregulation, mitochondrial dysfunction, and neuroinflammation. In this Perspective article, I discuss major neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, prion diseases, spinocerebellar ataxias, and spinal muscular atrophy, through the lens of disease-associated proteins and experimental modeling. I argue that a protein-centered framework provides a useful approach for understanding disease mechanisms and selecting transgenic mouse models, while recognizing that aging, cellular context, neuroinflammation, mitochondrial dysfunction, vascular dysfunction, and other disease modifiers also shape neurodegeneration. Transgenic and genetically engineered mouse models have been essential for dissecting the pathogenic roles of amyloid-β, tau, α-synuclein, TDP-43, SOD1, FUS, <i>C9ORF72</i>-associated dipeptide repeat proteins, mutant huntingtin, prion protein, ataxins, and SMN deficiency. However, these models have important limitations, including artificial overexpression, familial mutation bias, species differences, and incomplete representation of aging-related sporadic diseases. Rather than seeking a single "best" model, a more productive strategy is to adopt model portfolios tailored to specific biological questions and to integrate mouse studies with human cellular models, postmortem tissue, omics approaches, and biomarker-based validation. Such an approach may improve mechanistic insight, strengthen translational relevance, and enhance the predictive value of preclinical neurodegenerative disease research.

Also flagged:osteoarthritisOAchronic joint diseaseinfectionsarthritisSynthesis
Journal Article 2026-07-21 No Snippets Deng Y, Arash S, Rong J, Althobaiti SA, Liu S, Ransdell-Green E, Fehringer EV, Wang D.
Show Full Abstract

Thermoresponsive polymeric prodrugs represent a promising strategy for localized and sustained in vivo drug delivery. In this work, two polyethylene glycol (PEG)-based dexamethasone (Dex) prodrugs with different Dex contents were synthesized using a four-arm PEG scaffold. Prodrug <b>1</b>, containing four Dex molecules, showed high aqueous solubility but no thermoresponsive gelation behavior. In contrast, eight-Dex Prodrug <b>2</b> exhibited temperature-dependent aggregation and formed hydrogels in aqueous media. The viscosity of the Prodrug <b>2</b> hydrogel was reduced by introducing 10% ethanol as a cosolvent, enabling an injectable formulation that rapidly forms a hydrogel depot upon contact with aqueous media. The hydrogel provides gradual Dex release via the cleavage of the acid-labile hydrazone bond linking Dex to the PEG. In a monosodium iodoacetate (MIA)-induced osteoarthritis (OA) pain model, intra-articular (IA) injection of Prodrug <b>2</b> produced rapid and sustained pain relief for up to 28 days. These findings indicate that the hydrogel-forming four-arm PEG-based Dex prodrug offers a potentially effective approach for prolonged local corticosteroid (CS) delivery, applicable to the treatment of many local pathologies, including OA and OA pain.

Also flagged:Autoimmune Myocarditisinflammatory disease of the myocardiumMyocarditisinflammatory diseaseviral infectionsinflammatory cardiomyopathy
Journal Article 2026-07-21 No Snippets Pirzadah H, Ibrahim Z, Pirzadah Y, Yusuf N.
Show Full Abstract

Autoimmune myocarditis is an inflammatory disease of the myocardium driven by immune dysregulation and genetic predisposition. Recent advances in genomics, including genome-wide association studies (GWAS), have revealed key loci and pathways involved in disease susceptibility. This review synthesizes current knowledge on genetic determinants, from classical candidate genes to emerging GWAS findings, and explores their clinical implications for risk stratification and precision medicine.

Also flagged:liver diseaseshereditary liver diseasesmetabolismsynthesisexcretioninherited
Journal Article 2026-07-21 No Snippets Liu R, Cong S, Gao Y, Xu J, Shi X.
Show Full Abstract

Inherited liver diseases are predominantly caused by monogenic mutations, and the vast majority of these conditions currently lack curative treatment options. Although liver transplantation may be used for patients with end-stage disease, it faces numerous challenges, including donor organ shortage, immune rejection, and the need for lifelong immunosuppression. In recent years, CRISPR-Cas9-based gene editing technology has advanced rapidly, offering transformative hope for the treatment of these diseases. This review systematically elucidates the working principles and technical advantages of the CRISPR-Cas9 system and its derived tools (base editing and prime editing), summarizes recent applications of these technologies in the treatment of hereditary liver diseases, and discusses the prospects and challenges of their clinical translation, aiming to provide a theoretical reference for future research in this field.

POU3F2
Also flagged:Oral Squamous Cell CarcinomaOSCChead-and-neck cancerstumourhead-and-neck canceroral cancers
Journal Article 2026-07-21 ✓ 2 Snippets Alqarni A, Hosmani J, Alqahtani AMA, Assiri HA, Meer RM, Patil S.
In-Text Gene Mentions

…, TCF12 ,POU3F2, SOX4 ,…

…, TCF12 ,POU3F2) in the…

Show Full Abstract

Oral squamous cell carcinoma (OSCC) accounts for most head-and-neck cancers, and effective biological adjuvants remain limited. Gingival mesenchymal stem cells (GMSCs) exhibit anti-tumour paracrine activity, but the underlying molecular mechanisms and their relevance in patient cohorts remain incompletely understood. Consensus apoptosis-reactive oxygen species (ROS) effectors were identified through integrated transcriptomic analyses of TCGA-HNSC and three GEO cohorts. Candidate genes were evaluated in primary OSCC cells exposed to GMSC-conditioned medium or indirect Transwell co-culture. Findings were further examined using patient-cohort validation, single-cell ligand-receptor analysis, pathway and transcription-factor activity inference, and drug-repurposing approaches. Computational analyses identified an apoptosis-ROS network centred on <i>BAX</i>, <i>BCL2</i>, <i>CASP3</i>, <i>CASP9</i>, <i>NOX1</i>, and <i>GPX1</i>. Indirect GMSC co-culture reduced intracellular ROS, increased early apoptosis, and induced G2/M accumulation, whereas conditioned medium produced inconsistent effects, suggesting a requirement for live bidirectional paracrine signalling. <i>BAX</i> was the only consistently up-regulated effector. The axis demonstrated concordant differential expression across independent HPV-negative OSCC cohorts but was not independently prognostic under leakage-free cross-validation or external validation. Pathway analyses supported ROS suppression, apoptosis activation, and altered stromal-tumour communication. Drug-repurposing analyses identified HSP90 inhibitors and the FDA-approved TOP2 inhibitor mitoxantrone as candidate therapeutic agents. GMSC paracrine activity targets a biologically interpretable apoptosis-ROS axis in OSCC that is reproducibly expressed across patient cohorts but does not constitute an independent prognostic biomarker. The identified therapeutic candidates warrant further experimental investigation.

Also flagged:Respiratory Diseasesasthmachronic obstructive pulmonary diseaseCOPDidiopathic pulmonary fibrosislung cancer
Journal Article 2026-07-21 No Snippets Gurajala S, Al Humoud SY, Al Yousif GF, Alameri RA, Pandurangam G, Fayyomi AKA, Abed S, Sardidi NS, Alrayes MM, Alsabhan TA, Alajmi SH, Alfaraj A, Al Ghannam N.
Show Full Abstract

Respiratory medicine is transitioning from symptom-driven, standardized care to a more precise, patient-specific approach guided by molecular profiling. This evolution is being enabled by advances in liquid biopsy, multiomics, and artificial intelligence (AI) analytics. Fractional exhaled nitric oxide (FeNO) and blood eosinophils, the two commonly used markers in asthma, are now being joined by more precise airway markers such as galectin-10, which could aid clinicians in making more informed decisions for biological treatments. In chronic obstructive pulmonary disease (COPD) similar progress is underway, with treatment now emphasizing inflammation endotypes, especially eosinophilic patterns, to direct therapeutic choices. Alongside these developments, routine blood-based ratios (e.g., platelet-to-lymphocyte and neutrophil-to-lymphocyte) are being explored as predictors of exacerbation risk, and forced oscillation testing (FOT) is proving useful for picking up early disease shifts. In more severe conditions, biomarkers are linked to an early and better prognosis, enabling timely intervention. Markers like Matrix metalloproteinase-7 (MMP-7) and CC chemokine ligand 18 (CCL18) have proven to be reliable indicators of mortality and disease progression in idiopathic pulmonary fibrosis. Meanwhile, in lung cancer, liquid biopsies, especially those measuring circulating tumor DNA and micro-RNA (miRNA) panels, are enhancing screening accuracy while helping to cut down on the high false-positive rates seen with low-dose computerised tomography (CT). Other respiratory conditions such as bronchiectasis, pulmonary embolism, pneumonia, and acute respiratory distress syndrome (ARDS) are also benefiting from biomarker advances. At the same time there is a growing push to standardize how these biomarkers are measured. AI-based clinical decision support systems are also playing an increasingly important role in the translation of all these complicated data into actionable clinical insights. Together these developments pave the way for improved respiratory care that is precise and responsive to individual patient needs.

BTN2A2
Also flagged:gene expressioncancertumorlung adenocarcinomaLUADtumors
Journal Article 2026-07-21 ✓ 1 Snippet Chen A, Gao T, Liu F, Zhao M, Bai R, Liu Q.
In-Text Gene Mentions

…BTLA, BTNL9, CTLA4,BTN2A2and BTNL3) alongside…

Show Full Abstract

Keratins (KRTs) are intermediate filament proteins expressed in epithelial cells and serve as diagnostic cancer biomarkers. They serve pivotal roles in tumor progression and metastasis, but their prognostic value in lung adenocarcinoma (LUAD) and relationship with the tumor immune microenvironment remain unclear. Gene expression of KRTs in The Cancer Genome Atlas (TCGA)-LUAD was analyzed; candidate genes were selected using LASSO and random forest. An XGBoost classifier with SHAP interpretation distinguished tumor from normal tissues. Prognostic models were developed using 101 algorithms with 10-fold cross-validation and validated in two independent GEO cohorts. Immune cell composition and pathway activity were assessed by CIBERSORT, MCP-counter, ssGSEA and GSEA; the TIDE score estimated potential immunotherapy response. Functional validation of KRT81 was performed via shRNA knockdown in LUAD cell lines, followed by proliferation, apoptosis and migration assays. A KRT-based diagnostic and prognostic signature was established. The XGBoost model achieved high accuracy (TCGA AUC=0.996; GSE31210 AUC=0.860); SHAP identified KRT81 as a key contributor. A four-gene prognostic model (KRT27, KRT80, KRT16, KRT81) stratified patients into high- and low-risk groups. The risk score was associated with advanced tumor stage and independently predicted overall survival (multivariate HR=2.16, 95% CI 1.43-3.28, P=2.0×10-4). High-risk tumors enriched proliferation/stroma pathways (cell cycle, DNA repair, ECM-receptor interaction, focal adhesion, p53 signaling); low-risk tumors enriched immune pathways. Immune profiling revealed reduced T/B cell infiltration, increased endothelial cells and higher T-cell exclusion scores in high-risk patients, indicating an immunosuppressive microenvironment. Higher risk scores also associated with chemotherapy resistance. Functional validation confirmed that shRNA-mediated KRT81 knockdown reduced LUAD cell proliferation, migration and invasion, while promoting apoptosis. These findings link KRT expression to clinical outcomes, the tumor microenvironment and therapeutic response in LUAD, suggesting roles for KRTs in cancer progression, chemotherapy resistance and predictive potential for immunotherapy response. This study provides new insights for prognostic evaluation and therapeutic decision-making in LUAD.

Also flagged:mitochondriametabolismmitochondrialphosphorylationmitophagyorganelle
Journal Article 2026-07-21 No Snippets Li Q, You M.
Show Full Abstract

Mitochondria are central regulators of cellular metabolism, redox balance, calcium signaling, and cell survival, making them essential for neuronal function. Because neurons rely heavily on mitochondrial oxidative phosphorylation to meet their high energetic demands, mitochondrial dysfunction has emerged as a key pathogenic driver in major neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. Defects in mitochondrial bioenergetics, excessive reactive oxygen species production, impaired mitochondrial dynamics, disrupted mitophagy, and dysregulated calcium handling collectively contribute to neuronal damage, synaptic dysfunction, and neuroinflammation. These insights have prompted growing interest in therapeutic strategies that directly target mitochondria to restore organelle homeostasis. Recent advances in chemical biology and nanomedicine have enabled the development of mitochondria-targeted ligands, peptide-based targeting systems, and carrier or nanotechnology-enabled delivery platforms designed to overcome biological barriers and selectively deliver therapeutic cargos to mitochondria within the central nervous system. In this Review, we summarize mitochondrial pathological mechanisms in neurodegenerative diseases and discuss emerging mitochondria-targeted therapeutic strategies, highlighting delivery technologies, therapeutic modalities, and translational challenges. Although most strategies remain at the preclinical or proof-of-principle stage, these advances are beginning to shape a conceptual framework for precision mitochondrial medicine, with the longer-term goal of developing disease-modifying interventions for neurodegenerative disorders.

CACNA1E
Also flagged:epilepsyepileptic encephalopathycongenital heart diseasespasmschronicbrain disorder
Journal Article 2026-07-21 ✓ 5 Snippets Pan J, Zhao MF, Liu ZC, Li RB, Jin JY, Tang CB, Cheng ZB.
In-Text Gene Mentions

…mutational spectrum ofCACNA1Eand provides a…

…A novelCACNA1Emutation (c.1256G >…

…BackgroundCACNA1Emutations cause developmental…

…carries a novelCACNA1Evariant.…

…), while theCACNA1Egene, encoding the…

Show Full Abstract

<h4>Background</h4><i>CACNA1E</i> mutations cause developmental and epileptic encephalopathy. We report a Chinese pediatric patient with epilepsy and congenital heart disease who carries a novel CACNA1E variant.<h4>Methods</h4>Whole-exome sequencing (WES) was performed on the proband and his unaffected parents. The variant was validated by Sanger sequencing and screened in 200 healthy controls. Bioinformatic tools and ACMG criteria were used for pathogenicity assessment.<h4>Results</h4>A <i>de novo</i> heterozygous missense variant, NM_000721.4: c.1256G > A (p.R419Q), was identified. It was absent in both parents and in 200 controls. The variant lies in a highly conserved and intolerant region. ACMG classification: likely pathogenic (PS2 + PM2 + PP3). The patient showed marked short-term response to adrenocorticotropic hormone (ACTH).<h4>Conclusion</h4>This novel variant expands the mutational spectrum of CACNA1E and provides a potential treatment clue for ACTH responsiveness in CACNA1E-related spasms.

Research Square 2026-07-21 Preprint (No Snippets API) Nguyen D, Truong TTT, Panizzutti B, Ellis M, Spolding B, CourtneySwinton, Bortolasci CC, Bryce J, Smith J, Field C, Liu ZS, Kim JH, Berk M, Walder K.
Show Full Abstract

<title>Abstract</title> <p> <bold>Background</bold> Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a debilitating multisystem disorder characterised by profound fatigue, post-exertional malaise, muscle pain and weakness. Although skeletal muscle abnormalities and mitochondrial alterations have been reported in people with ME/CFS, the underlying biological processes remain poorly understood, and no validated disease models, biomarkers or effective treatments are currently available. This study used patient-derived induced pluripotent stem cell (iPSC) myogenic progenitor (MP) cells to investigate intrinsic transcriptomic abnormalities in ME/CFS and identify potential drug repurposing candidates. <bold>Methods</bold> MP cells were generated from iPSCs derived from people with ME/CFS and healthy controls, and successfully characterised. Global mRNA sequencing was performed to compare transcriptomic profiles between ME/CFS and control MP cells (n = 6 ME/CFS; n = 7 controls). Differentially expressed genes and pathways were identified, followed by drug repurposing analysis using the Library of Integrated Network-based Cellular Signatures drug database (LINCS2) and supporting literature review. <bold>Results</bold> RNA sequencing identified seven differentially expressed genes at adjusted p < 0.05, including <italic>MIR205HG</italic> , <italic>FEZF1</italic> , <italic>HLA-DMB</italic> , <italic>SLC1A2</italic> , <italic>SYT13</italic> , <italic>GALNT4</italic> , and <italic>SLC2A14</italic> . Pathway analysis identified 73 differentially expressed pathways, of which 96% were downregulated in ME/CFS MP cells. Downregulated pathways included those involved in cell cycle regulation, DNA replication, mismatch repair, immune response and muscle cytoskeleton regulation-related pathways. In contrast, upregulated pathways were associated with metabolic reprogramming, including increased reliance on branched-chain amino acids for energy production. These findings suggest intrinsic abnormalities in ME/CFS-derived MP cells, particularly involving metabolic regulation, mitochondrial function and muscle-related cellular processes. Based on the differentially expressed genes, LINCS2-based drug repurposing analysis and literature review identified 22 candidate drugs with potential relevance to ME/CFS. These included safe and widely available agents such as leflunomide, melatonin and midodrine, which target pathways related to antiviral defence, immunomodulation, neurotransmitter modulation, autonomic regulation and vascular function. <bold>Conclusions</bold> Patient-derived iPSC-MP cells provide a useful model for investigating intrinsic skeletal muscle-related abnormalities in ME/CFS. Transcriptomic profiling revealed altered pathways related to cell cycle regulation, immune function, cytoskeletal organisation and energy metabolism, supporting the involvement of mitochondrial and metabolic dysfunction in ME/CFS pathobiology. Drug repurposing analysis identified several clinically relevant candidates that may warrant further functional validation as potential therapeutic options for ME/CFS. </p>

PRDX6
Also flagged:parasitic diseaseextraintestinal abscessesferroptosishost cellsamoebiasismetabolism
Journal Article 2026-07-20 ✓ 1 Snippet Zhou R, Li W, Zhou Q, Zhao Y, Li X, Zhang H, Dong D, Jing W, Tachibana H, Feng M, Fu G, Cheng X.
In-Text Gene Mentions

…distress syndrome, elevatedPRDX6exacerbated lung injury…

Show Full Abstract

Amoebiasis is a critical global parasitic disease caused by <i>Entamoeba histolytica</i>. It includes amoebic colitis and extraintestinal abscesses. <i>E. histolytica</i> peroxiredoxin (<i>Eh</i>Prx) is a crucial antioxidant enzyme that maintains redox homeostasis and participates in counteracting oxidative stress, supporting trophozoite survival and pathogenicity in the host. We observed the <i>Eh</i>Prx structure to be a decameric ring formed through the polymerization of five dimers. <i>Eh</i>Prx had a unique α-helical structure at its N-terminus. Protein-protein docking and surface plasmon resonance (SPR) assay results suggest that <i>Eh</i>Prx may bind to myeloid differentiation factor 2 (MD2), the ligand protein of toll-like receptor 4 (TLR4), rather than directly to TLR4. Furthermore, <i>Eh</i>Prx was crucial in the induction of cellular ferroptosis by <i>E. histolytica</i> trophozoites and regulated ferroptosis in host cells through the TLR4/MD2 pathway. These findings may hold a solid structural basis and promising concepts for investigating the pathogenic mechanisms and drug targets of <i>E. histolytica</i>.<h4>Importance</h4><i>Entamoeba histolytica</i> is the causative agent of amoebiasis, a significant global health concern. Within this parasite, <i>E. histolytica</i> peroxiredoxin (<i>Eh</i>Prx) plays a pivotal role in mitigating oxidative stress, a critical survival mechanism in the hostile environment of the human host. <i>Eh</i>Prx belongs to a family of antioxidant enzymes responsible for detoxifying peroxides, which are deleterious byproducts of cellular metabolism and host-derived immune responses. By neutralizing reactive oxygen species (ROS), EhPrx safeguards the parasite's cellular integrity, ensuring its survival, proliferation, and pathogenicity. Despite its functional importance, the precise structural details of <i>Eh</i>Prx remain elusive, hindering a comprehensive understanding of its molecular mechanisms. Cryo-electron microscopy (cryo-EM) offers a promising avenue for elucidating the high-resolution structure of <i>Eh</i>Prx, which could reveal critical insights into its biological functions and inter- or intramolecular interactions. Such structural characterization may be indispensable for advancing our knowledge of <i>E. histolytica</i> biology and identifying novel diagnostic markers to combat amoebiasis effectively.

Also flagged:inflammatory bowel diseasepsychiatric disordersanxietydepressionapremilastpathogenesis
Journal Article 2026-07-20 No Snippets Jori C, Shaney Rehman A, Lamba T, Ahmad A, Kumar J, Ali A, Joshi A, Ali A, Parvez S, Agrewala JN, Khan R.
Show Full Abstract

Oral nanomedicines that modulate gut microbiota and gut-brain interactions are crucial for effectively treating inflammatory bowel disease (IBD) and associated psychiatric disorders, such as anxiety and depression. However, the underlying causes of psychiatric disorders in patients with IBD remain unclear, and effective treatment strategies have yet to be established. Herein, we developed oral gastroprotective βG@Apr-WPG NMs (β-glucan armored apremilast encapsulating tryptophan-poly(lactic-co-glycolic acid)-glutathione nanomicelles). This system effectively treats IBD and associated anxiety/depression by modulating the microbiota-gut-brain axis. βG@Apr-WPG NMs demonstrated gastroprotection enhances retention, and enables sustained release within the inflamed colon, enhances drug solubility, and inflammation-responsive apremilast release significantly improving oral therapeutic efficacy. Oral βG@Apr-WPG NMs administration outperformed free apremilast by restoring gut barrier integrity, reducing histopathological damage, and modulating microbial dysbiosis. Systemic inflammation and neuroinflammation were markedly suppressed. Notably, the βG@Apr-WPG NMs ameliorated anxiety- and depression-like symptoms, as well as cognitive deficits in colitis-induced mice, highlighting its therapeutic impact beyond the gut. Addressing reduced efficacy of conventional therapies, this multifunctional βG@Apr-WPG NMs platform offers safe, simple, and highly efficient therapeutic strategy integrating targets intestinal inflammation, microbiota-gut-brain axis modulation, in the pathogenesis of IBD with comorbid neuropsychiatric disorders with confirmed safety.

SERPINC1
Also flagged:acute kidney injuryarcuate venous thrombosisRenal arcuate vein thrombosisupper respiratory tract infectionthrombosisrenal vascular disorder
Journal Article 2026-07-20 ✓ 1 Snippet Junqiong P, Shaojun L, Lifang Z, Chunqing L, Yafen Y.
In-Text Gene Mentions

ATIII

Show Full Abstract

Renal arcuate vein thrombosis (RAVT) is a rare and often underrecognized cause of acute kidney injury (AKI) that typically requires renal biopsy for diagnosis. We report a 29-year-old man who developed AKI following heavy alcohol intake, an upper respiratory tract infection, and exposure to multiple medications including repeated nonsteroidal anti-inflammatory drugs and traditional Chinese patent medicines. Laboratory tests showed mild proteinuria without hematuria and negative autoimmune serology, with normal renal imaging. Renal biopsy revealed acute tubular injury and thrombus-like material within arcuate veins, accompanied by mild medullary hemorrhage and focal vascular necrosis, findings suggestive of arcuate venous thrombosis. Renal function recovered completely after supportive therapy within eight days.This case highlights that an arcuate venous lesion suggestive of thrombosis may be an underrecognized finding in patients with multifactorial, biopsy-proven AKI, even when the clinical presentation and imaging findings are nonspecific. Awareness of this possibility may broaden the differential diagnosis in selected patients with unexplained or disproportionate AKI and multiple renal risk factors, and kidney biopsy may help identify otherwise unrecognized vascular involvement.

DNAJC1
Also flagged:lactationmatingsynthesis
Journal Article 2026-07-20 ✓ 1 Snippet Kumar I, Vyas J, Khan A, Ramola G, Ilayaraja I, Muansangi L, Chitra A, Pal P, Singh RK, Kamboj ML, Raja TV, Mukherjee A, Mukherjee S.
In-Text Gene Mentions

…stress resilience (DNAJB5,DNAJC1), and immunological defence…

Show Full Abstract

The Karan Fries (KF), a newly developed dairy cattle (Holstein Friesian × Tharparkar), after nine generations of inter se mating (mating among crossbreds) by maintaining a stable, composite breed structure, is expected to preserve some heterosis or hybrid vigour through the retention of heterozygosity and selective pressure for performance traits. Although a decline in productivity is generally seen from F1 to later inter se generations, the rate of loss of heterosis slows down, allowing the population to reach a new equilibrium. This seems to be an interesting proposition. Therefore, to assess the retained heterosis and to evaluate the current status of the KF population, the present study was conducted, which included a sizeable phenotyped and genotyped animals (n = 355). The analysis identified a stabilized genomic architecture with a mean exotic inheritance of 64.34 ± 0.74% (predominantly Holstein Friesian) and an indigenous contribution of 35.66 ± 0.95% (primarily Tharparkar). Genomic indicators of heterosis revealed a mean Genomic Retained Heterosis (RH<sub>g</sub>) of 59% which accounts for 15.82% of the total observed KF average yield (4153.14 ± 167.32 kg). Genomic Retained Heterozygosity (RHET<sub>g</sub>) of 0.44%. Notably, a near-perfect correlation (r = 0.98) was observed between these two metrics, indicating that RHET<sub>g</sub> can be used interchangeably with RH<sub>g</sub> to assess heterosis and its effects in instances where parental genotypic records were absent. Linear regression analysis demonstrated that RH<sub>g</sub> was a primary driver of productivity, with Total Milk Yield (TMY) increasing by 1113.81 ± 301.91 kg per unit increase in RH<sub>g</sub> (p < 0.001). The impact on TMY was significantly larger than on 305-day milk yield (339.08 ± 282.92 kg), suggesting that genomic heterosis specifically enhances lactation persistence and environmental robustness. A joint-model GWAS identified 182 SNPs with significant additive effects and 117 SNPs with significant dominance effects for TMY. Functional annotation revels candidate genes for milk synthesis (SLC25A1, PIP4K2A, LATS2), heat stress resilience (DNAJB5, DNAJC1), and immunological defence (ARHGAP15, LPAR3). Protein network analysis identified the Mitochondrial Ribosomal Protein (MRP) family, specifically hub gene MRPL22, as the central driving gene for both additive and dominance components. These findings confirm that KF cattle effectively leverage retained heterosis to integrate high production potential with robust tropical climatic adaptability.

PRDX6
Also flagged:central nervous system disorderbehavioralvesiclesADgene expressionpathogenesis
Journal Article 2026-07-20 ✓ 2 Snippets Ma L, Wang D, Li Z, Ye G, Chen M.
In-Text Gene Mentions

…NME1, TGFBR3, TNFRSF1A,PRDX6, CD44, PLD3, CXCR4,…

…LDHA, CLIC1, TNFRSF1A,PRDX6, PLD3, RHOBTB3, WDR46,…

Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is a degenerative central nervous system disorder characterized by progressive cognitive and behavioral impairment. As nanoscale intercellular communication vesicles that carry AD-related pathological molecules, exosomes are promising biomarkers and therapeutic carriers for AD. In this study, we downloaded AD-related gene expression profiles and clinical data from the Gene Expression Omnibus (GEO) database (datasets GSE138260, GSE29378, GSE36980, and GSE5281). Through a series of bioinformatics analyses, clinical predictive model construction, pharmacological network analysis, and molecular docking simulations, we developed an exosomal gene-based predictive model for AD pathogenesis and identified potential pharmacological networks and molecular docking targets for AD treatment.<h4>Materials and methods</h4>AD-related gene expression and clinical data were retrieved from the GEO database. Bioinformatics analyses, clinical model construction, drug-gene network analysis, and molecular docking were subsequently performed to explore exosomal gene models for predicting AD pathogenesis, as well as potential pharmacological networks and molecular docking targets for AD therapy.<h4>Results</h4>A five-exosomal-gene predictive model was established, comprising CD44, CXCR4, TUBB, PSMA5, and PSMB3. Pharmacological network analysis of these five genes revealed their significant associations with chelidonine, 2-chloro-1,4-dinitrobenzene, oxazolone, phencyclidine, thioridazine, and etodolac. Further molecular docking simulations identified key binding targets, including R41, Y42, R78, Y79, C77, I88, C97, A98, I96, I72, L70, E67, G103, I91, and T102.<h4>Conclusions</h4>Our comprehensive analyses successfully established a reliable exosomal gene-based model for predicting AD pathogenesis, and identified relevant pharmacological networks and core molecular docking targets, providing novel insights for AD diagnosis and targeted therapy.

HTT
Also flagged:neurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseAmyotrophic lateral sclerosisHuntington's diseaseFrontotemporal dementia
Journal Article 2026-07-20 ✓ 1 Snippet Pattnaik PP, Prusty SK, Pati S, Jew KA, Bora AK, Sahoo J, Sahu PK.
In-Text Gene Mentions

…TARDBP, LRRK2 andHTT.…

Show Full Abstract

Neurodegenerative diseases are progressive disorders that involve the loss and dysfunction of neurons. Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Huntington's disease, Frontotemporal dementia are examples of diseases. While different clinically, these disorders have a common genetic, molecular and cellular basis. This review examines the common genetic pathways, along with the interactions between genes of major neurodegenerative diseases, with a focus on the key genes, such as APOE, SNCA, MAPT, TARDBP, LRRK2 and HTT. The common pathogenic mechanisms considered to play a major role in disease progression include protein misfolding and aggregation, mitochondrial dysfunction, oxidative stress, neuroinflammation, diminished autophagy, and impaired lysosomal function, as well as synaptic degeneration. The review also emphasizes the role of systems biology strategies, such as genome-wide association studies, transcriptomics, proteomics, metabolomics, interactome analysis, and multi-omics integration, to unveiling complex molecular networks in neurodegeneration. Furthermore, the emerging biomarker strategies and therapeutic strategies targeting convergence signaling pathways including NF-κB, PI3K-Akt-mTOR, MAPK and Wnt/β-catenin are summarized. The common genetic basis and the cross-connecting molecular mechanisms of the various neurodegenerative diseases could help in the discovery of new biomarkers and pan-therapeutic targets. Further advances in molecular genetics, computational biology and precision medicine are needed to enhance early detection and the creation of effective disease-modifying treatments.

DCC
Journal Article 2026-07-20 ✓ 1 Snippet Yasar E, Dogru S, Eroglu E, Yaras N.
In-Text Gene Mentions

…PIF, E/DRY, NPxxY),DCCmaps, CP, DRIN…

Show Full Abstract

The Angiotensin II type-2 receptor (AGTR2) is a G protein-coupled receptor (GPCR) that mediates vasodilatory, anti-proliferative, and cardioprotective responses as part of the renin-angiotensin system (RAS). However, the precise structural dynamics underlying its ligand-specific activation remain incompletely understood. In this study, we performed long-timescale molecular dynamics (MD) simulations to investigate how Angiotensin peptides differentially modulate the structural dynamics of AGTR2 in both inactive- and active-like conformations and to elucidate ligand-specific modulation of AGTR2 in the RAS protective arm. Ang II stabilized a 'Locked Active State' through compact TM3-TM6 distances, persistent hydrogen bonding (PHE8-LYS215<sup>5.42</sup>), salt bridges (ARG2-ASP279<sup>6.58</sup>, ARG2-ASP297<sup>7.32</sup>), hydrophobic contacts (TRP100<sup>2.60</sup>, MET128<sup>3.36</sup>), and rotameric locking of micro-switches. These interactions stabilized Helix 8, enhancing dynamic network connectivity and supporting ligand-dependent activation-related conformational tendencies rather than a full canonical GPCR activation transition. Conversely, Ang1-7 induced a 'Flexible Intermediate State' characterized by weaker interactions (PRO7-THR125<sup>3.33</sup>), dynamic instability at the Helix 8 interface, and increased conformational sampling. Activation motif analyses (CWxP, PIF, E/DRY, NPxxY), DCC maps, CP, DRIN metrics, and PCA confirmed distinct signaling features for each ligand. This study provides a dual functional profile for AGTR2, where Ang II acts as a strong conformational stabilizer promoting activation-related dynamic features, while Ang 1-7 serves as a dynamic modulator. These findings contribute to a structural and dynamic framework for understanding AGTR2 signaling and supporting its therapeutic potential in fine-tuning cardiovascular responses within the RAS.

Also flagged:epithelial ovarian cancertumorsmembranetumor
Journal Article 2026-07-20 No Snippets Ngo LH, Nguyen QTT, Vo HTT, Kim MK, Lee SK, McClelland M, Lee EJ.
Show Full Abstract

Patient-derived organoids (PDOs) can recapitulate selected features of original tumors and provide a useful system for studying epithelial ovarian cancer (EOC) in three-dimensional culture. Nonetheless, the protocol to generate EOC-PDOs has not yet been standardized. We therefore empirically refined the culture conditions and medium composition, considering the protocol effective when EOC PDOs were successfully established in five consecutive attempts. Tissue and ascites samples (from 29 and 8 patients, respectively) were used and the Syringe-extruded Organoid Basement membrane extract Assembly (SOBA) fragment culture method applied. Selected similarities in cell morphology, marker expression, and detectable alterations between organoids and patient-matched tumor tissue were assessed using pairwise comparisons. The refined workflow used a culture medium containing recombinant human R-Spondin 1 protein (250 ng/mL), Noggin, and NRG1, factors implicated in organoid maintenance and expansion. Ultimately, 31 EOC organoid lines successfully generated from 82.8% (24/29) of tissue and 87.5% (7/8) of ascites samples. The SOBA technique increased the 10 day PDO yield by 2.75-fold relative to the surface-attached dome method (p < 0.0001). This empirically refined workflow can be adjusted for specific experimental applications; however, further validation across larger and clinically diverse EOC cohorts is required.

OLFM4
Also flagged:gallbladder cancertumordegradationcancercell activationbiliary tract cancer
Journal Article 2026-07-20 ✓ 1 Snippet Cheng Z, Jiang L, Wang MY, Tang QY, Zhao JW, Yang ZY, Gu J, Song XL, Dong P, Pan LJ, Shu YJ, Wei G.
In-Text Gene Mentions

…circFOXP1-miR-4477a axis andOLFM4-mediated MAPK-AP1 signaling, …

Show Full Abstract

Gallbladder cancer (GBC), a lethal malignancy of the biliary tract, is associated with a poor clinical prognosis. Although chemo-immunotherapy combinations demonstrate preliminary efficacy, the molecular determinants of treatment response remain elusive. Emerging evidence implicates aberrant alternative splicing in modulating tumor immunity. Through an in vitro CRISPR/Cas9 screen, we identified SRSF2 as a key RNA-binding protein regulating PD-L1 expression. Intriguingly, SRSF2 does not directly bind PD-L1 mRNA. Multi-omics analyses (mRNA-seq, RIP-seq, and proteomics) revealed that SRSF2 induces exon skipping in hnRNPD, shifting isoform expression from full-length P45 to truncated P40. Functional studies established that P45-but not P40-binds to AU-rich elements in the PD-L1 3'-UTR to promote mRNA degradation. Leveraging this mechanism, we designed splice-switching antisense oligonucleotides (ASOs) that block SRSF2-mediated exon skipping, restoring P45 expression. This intervention effectively reduced PD-L1 levels and potentiated T-cell-mediated cytotoxicity in vitro and in vivo. These findings elucidate a splicing-centric mechanism of immune evasion and highlight the therapeutic potential of splicing modulation in cancer immunotherapy. Proposed model of the SRSF2-hnRNPD-PD-L1 axis in gallbladder cancer (GBC) immune evasion and its therapeutic targeting. Overexpression of SRSF2 drives hnRNPD exon skipping, shifting the isoform balance from the PD-L1-degrading P45 to the truncated P40. This transition stabilizes PD-L1 mRNA and facilitates tumor immune evasion. Conversely, therapeutic intervention with splice-switching ASOs blocks SRSF2-mediated alternative splicing, restores P45 expression, and effectively reactivates T-cell-mediated cytotoxicity against GBC cells.

Also flagged:deathmembraneChagas diseaseCDhost cellinfection
Journal Article 2026-07-20 No Snippets Rocha YM, Ribeiro LR, de Moura GA, Chaves MM, Rodrigues JPV, Magalhães EP, Barbosa SICG, Frota LS, de Morais SM, da Silva WMB, de Oliveira VNEM, de Oliveira RN, Martins AMC, Nicolete R.
Show Full Abstract

<h4>Background</h4>Chagas disease (CD) is caused by Trypanosoma cruzi. Treatment is based on benznidazole (Bz), although it has significant limitations, such as low efficacy in the chronic phase. Therefore, the search for new therapies with greater selectivity and antiparasitic activity is necessary. In this context, 1,2,4-oxadiazole stands out for its biological properties, including antiparasitic activities.<h4>Objective</h4>To evaluate the in vitro activity of N-cyclohexyl 3-(3-methylphenyl)-1,2,4-oxadiazol-5-amine derivatives against the Y strain of T. cruzi and an in vivo toxicity study.<h4>Methods</h4>Cytotoxicity was evaluated in LLC-MK2 cells by the MTT assay, while the antiparasitic effect on the three T. cruzi life forms was determined by counting. Flow cytometry analyses were then conducted to investigate possible death pathway mechanisms and antioxidant and antiacetylcholinesterase activities. Scanning electron microscopy (SEM) was also performed to observe morphological changes caused by the compounds. Finally, in vivo acute toxicity tests were performed on ZebraFish embryos.<h4>Results</h4>The results presented show distinct cellular toxicity profiles in LLC-MK2 cells, in addition to demonstrating antiparasitic activity at different concentrations. In amastigotes, cytotoxic effects were stimulated. The molecules also induced an increase in reactive oxygen species and membrane damage, in addition to loss of integrity and morphological changes. The antioxidant activity revealed a high capacity for scavenging free radicals, suggesting an alteration of the redox balance of the parasite, in addition to showing inhibition of acetylcholinesterase, an important enzyme present in the formation of parasites, which choline is a constituent. In the ZebraFish model, molecule 2a showed dose-dependent embryonic toxicity, with an LC50 of 14-15 µM.<h4>Main conclusions</h4>The calculated conclusions appear to indicate an antiparasitic effect associated with cell death mechanisms. However, further studies are needed to reduce toxicity in the animal model and increase delivery to the site of action.

HTT
Also flagged:neurodegenerative disordermismatch repairpathogenesisautosomal dominant neurodegenerative disordercognitive declinedeath
Journal Article 2026-07-20 ✓ 5 Snippets Osborne GF, Smith EJ, Sathasivam K, Kang Z, Nita IM, Cañibano-Pico M, Phillips J, Bates GP, Landles C.
In-Text Gene Mentions

…in the huntingtin (HTT) protein.…

…the huntingtin (HTT) gene, encoding…

…alternative processing ofHTTpre-mRNA increasingly favours…

…the huntingtin (HTT) gene, which…

…alternative processing ofHTTpre-mRNA to generate…

Show Full Abstract

Huntington's disease is an inherited neurodegenerative disorder caused by a CAG repeat expansion in exon 1 of the huntingtin (<i>HTT</i>) gene, encoding an expanded polyglutamine tract in the huntingtin (HTT) protein. The pathogenic CAG repeat of <i>HTT</i> is unstable and undergoes progressive somatic expansion in specific brain cells and peripheral tissues throughout life. Genes involved in DNA mismatch repair pathways, which promote repeat expansion, have been identified as genetic modifiers of the disease. Consequently, the rate of CAG repeat expansion is a key determinant driving the age of onset and disease progression. As the CAG repeat expands, alternative processing of <i>HTT</i> pre-mRNA increasingly favours production of the <i>HTT1a</i> transcript, which encodes the highly pathogenic and aggregation-prone HTT1a protein. This process provides a mechanistic link between CAG repeat expansion and disease pathogenesis, as increased HTT1a production accelerates HTT aggregation and neuronal dysfunction. HTT1a has previously been detected in Huntington's disease mouse models by using immunoprecipitation coupled with western blotting, homogeneous time-resolved fluorescence (HTRF) and Meso Scale Discovery (MSD) bioassays and immunohistochemistry. These approaches were developed using MW8, a neoepitope antibody that specifically recognizes the C-terminus of HTT1a. MW8 is a relatively weak antibody with limited detection sensitivity. To generate more robust HTT1a-specific reagents, two novel recombinant antibodies, 1B12 and 11G2, have been developed for evaluation. Using an allelic series of knock-in (<i>Hdh</i>Q20, <i>Hdh</i>Q50, <i>Hdh</i>Q80, <i>Hdh</i>Q111, CAG140 and zQ175) mice, alongside transgenic YAC128 and N171-82Q models, we extensively evaluated and compared the performance of MW8, 1B12 and 11G2. We demonstrate that 1B12 and 11G2 function as HTT1a-specific neoepitope antibodies by immunoprecipitation with western blotting and by immunohistochemistry. To enhance HTT1a detection using HTRF and MSD technology platforms, we further evaluated the performance of 1B12 and 11G2 in HTT bioassays using cortical lysates from zQ175 and YAC128 mice. In zQ175 mice, enhanced detection of aggregated HTT1a by HTRF and MSD revealed that HTT fragments longer than HTT1a can be incorporated into HTT1a-containing aggregates. The most sensitive assays were subsequently applied across the allelic series of knock-in mice to assess the effect of polyglutamine length on bioassay performance. For optimal sensitivity, we recommend the preferential use of 1B12 for HTRF assays and 11G2 for MSD assays. Collectively, these findings establish 1B12 and 11G2 as robust antibodies to reliably detect and track HTT1a pathology <i>in vivo</i> and promote the replacement of previously used MW8-based experimental approaches.

OLFM4
Also flagged:gastric cancerchronic atrophic gastritisintestinal metaplasiaadvancedstomach adenocarcinomatumor
Journal Article 2026-07-20 ✓ 4 Snippets Han X, Chen Q, Huang X, Hao Z, Han Y, Xu Y, Chen J, Qi J, Chen J.
In-Text Gene Mentions

…es (Epi_ANPEP, Epi_LLGL2, Epi_OLFM4, Epi_SLC16A3, Epi_SPINK4) (…

…static states (Epi_ANPEP, Epi_OLFM4, Epi_SPINK4) contracted (…

…tes—Epi_ANPEP, Epi_LLGL2, Epi_OLFM4, Epi_SLC16A3, and Epi_SPINK4—…

…rdering places Epi_ANPEP/LLG2/OLFM4at early to…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) progression entails profound epithelial-stromal remodeling, yet how epithelial metabolic programs are linked to myeloid-dominated immune exclusion and prognostic risk remains unclear. This study aimed to integrate single-cell RNA sequencing (scRNA-seq) and bulk transcriptomic analyses to characterize a lactate-myeloid-related risk axis in GC.<h4>Methods</h4>We integrated six scRNA-seq datasets comprising 116 samples and 355,091 cells spanning paratumor (PT), chronic atrophic gastritis (CAG), moderate intestinal metaplasia (MIM), severe intestinal metaplasia (SIM), early gastric cancer (EGC), and advanced gastric cancer (AGC), and coupled them to bulk cohorts. Epithelial and myeloid states, pseudotime trajectories, ligand-receptor programs, and pathway activities were analyzed. A 19-gene prognostic model anchored on SLC16A3/MCT4 co-expression and macrophage immunoregulatory modules was developed in The Cancer Genome Atlas stomach adenocarcinoma (TCGA-STAD) cohort and externally validated in GSE84437. Mutation burden, tumor immune dysfunction and exclusion (TIDE), and expression-based drug-response predictions were further evaluated. SLC16A3 expression was validated by immunohistochemistry (IHC) in an independent clinical cohort.<h4>Results</h4>The integrated atlas showed immune contraction with epithelial expansion in premalignant lesions, followed by enrichment of aberrant epithelium and myeloid lineages in EGC/AGC. Within epithelium, a late-pseudotime SLC16A3+ lactate-export program increased with progression and was associated with extracellular matrix (ECM) remodeling, pro-angiogenic signaling, and myeloid-recruiting chemokines. IHC confirmed marked SLC16A3 enrichment within dense, cohesive neoplastic nests of Lauren intestinal and mixed subtypes. Myeloid decomposition revealed macrophage-centric expansion dominated by SPP1+ and APOE+ tumor-associated macrophage (TAM) states. The model-derived risk score stratified overall survival independently of clinical covariates. Low-risk tumors exhibited higher mutation counts and tumor mutational burden (TMB), whereas high-risk tumors were genomically quieter but TIDE-high. Expression-based analyses nominated differential drug-response patterns across risk groups, which require further validation.<h4>Conclusions</h4>This study identifies an epithelial SLC16A3-associated lactate-myeloid transcriptional program linked to macrophage-rich immune exclusion and poor prognosis in GC. The 19-gene model provides a biologically interpretable framework for risk stratification, while the immune-evasion and drug-response findings should be considered hypothesis-generating and require prospective and functional validation.

SERPINC1
Also flagged:Cognitive Impairmentmild cognitive impairmentearly dementiacoronary artery diseasesubstance usethyroid dysfunction
Journal Article 2026-07-20 ✓ 1 Snippet Teotia S, Rana AK, Gupta V.
In-Text Gene Mentions

…group achieved normalACE-IIIscores (>82) compared…

Show Full Abstract

Background Cognitive impairment (mild cognitive impairment and early dementia) is a growing concern with limited therapeutic options. L-arginine, a semi-essential amino acid and precursor of nitric oxide, has shown neuroprotective effects in animal studies, but human trials, particularly in India, are lacking. This pilot study aimed to assess the safety and efficacy of oral L-arginine in elderly patients with cognitive impairment. Methodology This was a prospective, double-blind, randomized, placebo-controlled pilot study conducted at a tertiary care hospital in North India. Sixty-six subjects aged ≥60 years with subjective cognitive complaints were screened using the Hindi version of Addenbrooke's Cognitive Examination III (ACE-III); those scoring ≤82 were included after excluding reversible causes, including low vitamin B12 levels and abnormal thyroid-stimulating hormone (TSH) levels, coronary artery disease (CAD), and substance use. Thirty-eight participants were randomized to receive either oral L-arginine 6.4 g/day or a matching placebo for 30 days. Cognitive function was reassessed post-intervention using ACE-III. Adverse effects and tolerability were recorded. Results Thirty-five subjects completed the study (16 L-arginine and 19 placebo). Baseline characteristics were comparable between groups. After 30 days, the L-arginine group showed statistically significant within-group improvements in attention (p=0.018), memory (p<0.001), and language (p=0.017) domains, while the placebo group improved only in memory (p=0.003). Between-group comparison showed that significantly more patients in the L-arginine group achieved normal ACE-III scores (>82) compared to placebo (37.5% vs. 5.3%, p=0.032). Adverse effects leading to withdrawal in the L-arginine group included thyroid dysfunction (one participant), nausea/diarrhea (one participant), and bitter taste (one participant); no withdrawals occurred in the placebo group (p=0.353). Conclusions Oral L-arginine (6.4 g/day for 30 days) appears safe and improves attention, memory, and language domains in elderly patients with cognitive impairment. Larger, longer-term trials are warranted to confirm these findings and assess progression to dementia.

Also flagged:Synthesispulmonary arterial hypertensiontransferbindingextracellularplatelet aggregation
Journal Article 2026-07-20 No Snippets Cai X, Dai M, Wang Y, Liu G, An X, Li X, Huang Y, Mu Z, Fu Q, Wang Y.
Show Full Abstract

To address the pharmacokinetic limitations and moderate potency of current prostanoid IP receptor agonists for treating pulmonary arterial hypertension, we developed a series of conformationally constrained diphenylpyrazinyl amino cycloalkoxy acetic acids. By replacing the flexible side chain of MRE-269 with a rigid cyclic framework, we locked the bioactive conformation, identifying <b>7a-5</b> and its deuterated analog <b>7a-19</b>. Compound <b>7a-19</b> exhibited potent antiaggregatory activity (IC<sub>50</sub> = 0.97 μM), a 7-fold enhancement over MRE-269 (IC<sub>50</sub> = 7.4 μM). Crucially, leveraging the deuterium kinetic isotope effect in rats, <b>7a-19</b> demonstrated an 11-fold increase in systemic exposure (AUC <sub><i>o‑t</i></sub> = 26.7 h μg/mL), a prolonged half-life (<i>t</i> <sub>1/2</sub> = 12.0 h), and excellent oral bioavailability (<i>F</i> = 47.3%). Combined with a clean safety profile in the Mini-Ames assay and a lack of hERG inhibition (IC<sub>50</sub> = 143.1 μM), <b>7a-19</b> stands out as a robust, long-acting lead candidate for PAH therapy.

Research Square 2026-07-20 Preprint (No Snippets API) Larue L, RAYMOND J, COZ ML, AKTARY Z, POUTEAUX M, HAMM M, FAVAUDON V, Petit V, Bellacosa A, Goding C, Sage E.
Show Full Abstract

<title>Abstract</title> <p> Adult stem cells maintain tissue homeostasis and regenerative capacity throughout life, but the mechanisms that preserve their integrity during aging and stress remain incompletely understood. Hair follicle pigmentation provides a tractable model to study stem cell maintenance as it relies on melanocyte stem cells (McSCs) whose depletion leads to age-related hair greying. Here, we identify the transcription factor BRN2 ( <italic>POU3F2</italic> ) as a key regulator of McSC homeostasis. We show that BRN2 activity is enriched in McSCs and declines with age in both mouse and human hair follicles. Using a melanocyte-specific conditional knockout mouse model, we reveal that loss of Brn2 promotes melanocyte differentiation and accumulation in the hair follicle bulb, accompanied by increased expression of melanocytic genes and a marked downregulation of DNA repair pathways, particularly those involved in nucleotide excision repair and chromosome maintenance. Brn2-deficient cells displayed impaired activation of the DNA damage response following ionizing radiation and entered a p53–p21–associated senescence-like differentiation state rather than undergoing apoptosis. In vivo, Brn2-deficient mice exposed to irradiation-induced stress developed rapid and permanent hair depigmentation associated with depletion of melanocyte lineage cells. Together, these findings identify BRN2 as a suppresor of stress-induced hair greying that links genome maintenance to melanocyte stem cell fate. </p>

Also flagged:lung adenocarcinomaLUADcell cycleLung cancercancersmall-cell lung cancer
Journal Article 2026-07-19 No Snippets Tokunaga T, Tomioka Y, Takeda AH, Ishihara Y, Nagata A, Kato M, Suetsugu T, Mizuno K, Aoki M, Ueda K, Seki N.
Show Full Abstract

Approximately half of Japanese patients with lung adenocarcinoma (LUAD) have epi-dermal growth factor receptor (<i>EGFR</i>) gene mutations. Therefore, <i>EGFR</i> is the most critical therapeutic target in treating LUAD. This study's purpose is to explore novel therapeutic targets for LUAD and further improve EGFR inhibitor combination therapy. We created microRNA (miRNA) expression signatures from clinical specimens of LUAD patients harboring <i>EGFR</i> gene mutations using RNA sequencing. Based on the miRNA signature, we focused on <i>miR-206</i>, which had the most downregulated expression. We searched for its target gene in LUAD cells by facilitating transfection of <i>miR-206</i> into the <i>EGFR</i> mutant cell line PC9 and searching for genes with suppressed expression. A total of 821 genes were downregulated in PC9 cells. Through molecular classification of these genes, we revealed that 18 genes were closely related to the cell cycle. Among these genes, we focused on cyclin-dependent kinase 4 (<i>CDK4</i>) and investigated the synergistic effects of a CDK4/6 inhibitor (abemaciclib or palbociclib) and osimertinib, an EGFR inhibitor in LUAD cells. In vitro and three-dimensional culture analyses showed that combination therapy with a CDK4/6 inhibitor and an EGFR inhibitor synergistically suppressed proliferation of LUAD cells with <i>EGFR</i> mutations. Our miRNA-based analysis is an excellent strategy for identifying therapeutic targets for LUAD. Continued analysis will reveal target molecules that enhance the therapeutic effects of EGFR inhibitors.

Also flagged:mitochondrialinnermembranephosphorylationmetabolismobesity
Journal Article 2026-07-19 No Snippets Yan M, Wang H, Sha W, Fu Y.
Show Full Abstract

Uncoupling protein 1 (UCP1) is a mitochondrial inner-membrane carrier classically recognized as the molecular effector of non-shivering thermogenesis in brown adipose tissue. By dissipating the proton-motive force generated by oxidative phosphorylation, UCP1 converts stored chemical energy into heat and enables adaptive thermogenesis during cold exposure. The rediscovery of metabolically active brown adipose tissue (BAT) and inducible beige adipocytes in adult humans has renewed interest in UCP1-positive thermogenic adipose tissue as a regulator of systemic metabolism and a potential target for therapeutic modulation in obesity and cardiometabolic disease. Beyond thermogenesis, accumulating evidence indicates that UCP1-positive brown/beige adipocytes and thermogenic adipose tissue are involved in lipid and glucose metabolism, mitochondrial redox homeostasis, inflammatory remodeling, organ protection, and tumor-associated metabolic adaptation, mainly through adipocyte-autonomous mechanisms and adipose-organ communication. However, UCP1 biology is complex: BAT activity measured by imaging does not directly quantify UCP1 proton conductance, non-adipose UCP1 expression is often low and technically challenging to validate, local cell-autonomous UCP1 function in non-adipose tissues remains controversial, and UCP1-independent thermogenic pathways may compensate in selected contexts. In this review, we summarize the molecular and structural basis of UCP1 function, its regulation at transcriptional and post-transcriptional levels, and its biological roles in cellular and systemic homeostasis, with explicit distinction between direct adipocyte-autonomous UCP1 functions, indirect systemic effects mediated by thermogenic adipose tissue, and preliminary or incompletely validated evidence of local UCP1 activity in non-adipose cells. We further discuss the association of UCP1-positive thermogenic adipose tissue with obesity, type 2 diabetes mellitus (T2DM), cardiovascular disease, kidney injury, liver disease, neurological disorders, and cancer. Finally, we evaluate UCP1-related thermogenic adipose tissue activity as a biomarker and therapeutic target, highlighting current limitations, safety concerns, and future directions for precision metabolic medicine.

bioRxiv 2026-07-19 Preprint (No Snippets API) Boulos MA, Afghan AM, Rudkouskaya A, Fidaleo AM, Sidhu HS, Khan MT, Mongin AA.
Show Full Abstract

<h4>ABSTRACT</h4> Volume-regulated anion channels (VRACs), formed by leucine-rich repeat-containing 8 (LRRC8) proteins, are ubiquitously expressed chloride channels essential for cell volume regulation and implicated in diverse physiological and pathological processes. Small-molecule VRAC inhibitors have been reported to modulate paracrine signaling, proliferation, differentiation, migration, and apoptosis, and have been patented for potential therapeutic applications in stroke, cardiovascular and metabolic diseases, and cancer. However, growing evidence indicates that many commonly used VRAC blockers exert substantial off-target effects and frequently fail to reproduce phenotypes observed after deletion of the essential VRAC subunit LRRC8A. Here, we systematically compared effects of several widely used pharmacological VRAC inhibitors with outcomes of molecular downregulation of LRRC8A in limiting proliferation of malignant glioblastoma cells derived from surgical specimens. NIH/3T3 fibroblasts served as a non-malignant control. In serum-containing media, structurally diverse VRAC blockers (DCPIB, DIDS, carbenoxolone, phloretin, and bromadiolone) reduced proliferation in a non-uniform manner, with potencies that did not correlate with reported VRAC affinities and varied markedly among cell lines. Radiotracer-based measurements of VRAC activity indicated that these discrepancies were largely attributable to binding of inhibitors to serum albumin. When experiments were repeated under serum-free conditions, all inhibitors except DIDS and phloretin induced extensive death of both malignant and non-malignant cells, confirmed by microscopy and LDH release assays. This cytotoxicity was accompanied by a marked reduction in intracellular ATP levels, consistent with previously reported mitochondrial uncoupling effects. In contrast, LRRC8A knockdown reduced proliferation without substantial cell death. Together, these findings demonstrate that most commercially available VRAC blockers limit proliferation and viability predominantly through VRAC-independent mechanisms. Under standard culture conditions, serum albumin masks much of their intrinsic cytotoxicity. These results underscore the need for rigorous molecular controls in pharmacological studies and provide basis for developing more selective and less toxic VRAC-targeting agents.

Also flagged:systemic lupus erythematosusSLEautoimmune diseasepathogenesislocalizationlupus nephritis
Journal Article 2026-07-18 No Snippets Ushijima TS, Okamura T, Fujio K.
Show Full Abstract

Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the emergence of autoantibodies and deposition of immune complexes. SLE presents with heterogeneous multi-organ involvement that varies among patients and its mechanisms have been investigated to facilitate appropriate stratification and treatment selection. Bulk RNA-seq and bulk ATAC-seq have provided important insights into the pathogenesis of SLE; however, these approaches are inherently limited by their reliance on predefined cell subsets and known markers, which can introduce bias and restrict their ability to fully resolve cellular heterogeneity. Recent advances in multi-omics analyses have enabled the investigation of multi-layered information beyond single-cell RNA sequencing (scRNA-seq) alone and have contributed substantially to elucidating the pathogenesis of SLE. Although the emergence of autoreactive B cells and the production of autoantibodies in SLE are well established, the mechanisms of evasion from negative selection remain unclear. Multi-omics analyses have revealed key aspects of SLE pathogenesis, particularly the expansion of atypical B cells (ABCs), an autoreactive population driven by extrafollicular pathways. Furthermore, beyond transcriptional profiling, multi-omics analysis has emerged as an additional investigative method, which combines scRNA-seq with other modalities. Spatial analyses, for instance, have provided critical insights into the tissue localization and persistence of autoreactive B cells within inflammatory niches in lupus nephritis, suggesting that local microenvironments contribute to treatment resistance. Additionally, B cell receptor (BCR) sequencing has revealed distinctive BCR features in SLE, such as reduced somatic hypermutation, increased repertoire naiveness, and increased immunoglobulin variable region heavy chain gene (IGHV4-34) usage in B cells in bone marrow and affected organs (not only in peripheral blood). Furthermore, emerging multimodal approaches integrating spatial, transcriptomic, and epigenomic information further highlight pathogenic cell-cell interactions and inflammatory circuits that cannot be captured by scRNA-seq alone. In this review, we summarize recent multi-omics studies that elucidate the origin, differentiation, and tissue localization of pathogenic B cells in SLE. We provide an overview of the multi-omics analyses focusing on B cells so far, especially at single-cell resolution, and discuss their possible applications in precision medicine.

SOX6
Also flagged:CraniosynostosisCScraniofacial disordersscaphocephalysagittal synostosistrigonocephaly
Journal Article 2026-07-18 ✓ 1 Snippet De Gregorio V, Tosi DD, Vita A, Salvati M, Massimi L, Tamburrini G, Tiberio F, Lattanzi W.
In-Text Gene Mentions

…EXTL3 , andSOX6have often been…

Show Full Abstract

<h4>Purpose</h4>This systematic review aims to provide an updated overview of the relative contribution of germline genetic and environmental factors to the pathophysiology of sagittal craniosynostosis (sCS).<h4>Methods</h4>Using the PubMed database in accordance with Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines, relevant studies addressing genetic and/or environmental determinants of sCS in paediatric patients were systematically reviewed.<h4>Results</h4>A total of 1238 records were identified, of which 97 studies met inclusion criteria after full-text review. Overall, 25,877 patients were included, with 11,086 diagnosed with sCS (42.8%). Germline genetic variants potentially associated with craniosynostosis were reported in 251 patients, accounting for 12.6% of genetically tested individuals with sCS. Identified variants were distributed across 125 genes, with recurrent findings in 25 genes. Environmental and perinatal factors were more consistently reported across large population-based and case-control studies. Frequently associated factors included male sex, advanced maternal age, maternal smoking, thyroid dysfunction, fertility treatments, foetal constraint, prematurity, and abnormal birth weight, although effect sizes varied across studies.<h4>Conclusion</h4>Identifiable germline genetic causes appear to account for only a minority of sCS cases, whereas epidemiological evidence suggests that environmental and perinatal influences may also contribute to disease pathogenesis. Nevertheless, most cases lack identifiable germline mutations in key signalling pathways, and the available evidence does not support either genetic or environmental factors as individually deterministic drivers of disease development. Overall, the evidence synthesized in this review supports a multifactorial model for sCS, in which rare genetic susceptibility and non-genetic influences likely interact in the etiopathogenesis of the condition rather than reflecting a single dominant aetiology. However, heterogeneity across studies, differences in genetic testing methodologies, potential bias in exposure assessment, and the limited availability of integrative analyses restrict definitive conclusions regarding the relative contribution of these factors.

SUDS3
Also flagged:replication forkchromatincancers
Journal Article 2026-07-18 ✓ 5 Snippets Zhou Z, Huang K, Li R, Chen Y, Lin S, Deng S, He Z, Chen J, Lu J, Liu Y, Ma W, Wu S, Liu F, Songyang Z.
In-Text Gene Mentions

SUDS3nuclear condensates decelerate…

…We identifySUDS3as a condensate-associated…

SUDS3forms dynamic nuclear…

…Loss ofSUDS3disrupts this spatial…

…fork acceleration inSUDS3-deficient cells results in…

Show Full Abstract

Faithful DNA replication requires precise control of replication fork progression to maintain genome integrity; yet, the mechanisms that restrain excessive fork acceleration remain unclear. We identify SUDS3 as a condensate-associated regulator of replication speed. SUDS3 forms dynamic nuclear condensates during S phase and under replication stress. These condensates spatially partition replication-associated factors, particularly MCM10, thereby limiting their accessibility to replication-associated chromatin. Loss of SUDS3 disrupts this spatial regulation and leads to aberrantly accelerated fork progression. Under replication stress, unchecked fork acceleration in SUDS3-deficient cells results in defective fork protection, excessive single-stranded DNA accumulation, ATR-CHK1 hyperactivation, and increased genome instability. Consequently, SUDS3 deficiency sensitizes cells to replication-targeting chemotherapeutic agents, a phenotype rescued by wild-type SUDS3 but not by condensate-defective mutant. Together, our findings reveal a condensate-based mechanism that constrains replication dynamics and establish SUDS3 condensates as critical safeguards of genome stability and potential vulnerabilities in replication-stressed cancers.

UNC13C
Also flagged:esophageal carcinomatumortumorsphosphorylationgene expressiontranslational
Journal Article 2026-07-18 ✓ 1 Snippet Gu Y, Ying T, Tao K, Yang Q, Zeng J.
In-Text Gene Mentions

…7 prognostic genes (UNC13C, MAP7D2, SCARA5 downregulated…

Show Full Abstract

Histone deacetylases (HDACs) correlate closely with tumor prognosis and serve as therapeutic targets for malignancies. This study aimed to explore esophageal carcinoma (ESCA) therapeutic strategies via identifying histone deacetylation-related prognostic genes. We analyzed The Cancer Genome Atlas (TCGA)-ESCA and GSE53622 datasets, along with 17 histone deacetylation-related genes (HDRGs). Differentially expressed genes (DEGs1) between tumor and normal TCGA-ESCA samples were identified; DEGs2 linked to HDRGs were screened via unsupervised clustering of TCGA-ESCA tumors. Candidate genes were defined as the intersection of DEGs1 and DEGs2, followed by functional enrichment analysis and regression analyses. TCGA-ESCA samples were stratified into high-/low-risk groups, with model validation. Independent prognostic analysis, gene set enrichment analysis (GSEA), immune/gene mutation/drug sensitivity analyses, regulatory network construction, and RT-qPCR validation were performed. The intersection of 3556 DEGs1 and 1622 DEGs2 generated 694 candidates, yielding 7 prognostic genes (UNC13C, MAP7D2, SCARA5 downregulated; SLC35D3, HSPA6, IL31RA, CXCL8 upregulated in tumors). Risk score and pathologic M were independent prognostic factors for nomogram construction, with favorable predictive value. GSEA showed enrichment in pathways like ECM receptor interaction and oxidative phosphorylation; immune correlation, drug sensitivity (e.g., WH.4.023), and RT-qPCR validation of gene expression were confirmed. This study established and verified a novel HDRG-related ESCA prognostic model. The model may serve as a potential tool for risk stratification in ESCA patients and offer new perspectives for exploring the role of histone deacetylation modifications in ESCA progression. However, its clinical translational value, including guiding immunotherapy or targeted drug selection, requires further validation in large-scale prospective studies.

PCDH17
Also flagged:oral squamous cell carcinomaOSCCmalignant tumorGene Expressionwound healingcell cycle
Journal Article 2026-07-18 ✓ 1 Snippet Shen C, Hou R, Zhang J, Zhang Q, Li M, Wang J, Guan J.
In-Text Gene Mentions

…, BSPRY ,PCDH17, C1orf116 ,…

Show Full Abstract

Oral squamous cell carcinoma (OSCC) is a common malignant tumor in the oral and maxillofacial region with a poor prognosis, and its pathophysiology has not been fully elucidated. Although FKBP10 is overexpressed in multiple malignancies, its function and regulatory mechanism in OSCC remain largely unknown. Methods: OSCC and paired adjacent normal tissue samples were collected, and public datasets including The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) were integrated. Bioinformatics approaches including Weighted Gene Co-Expression Network Analysis (WGCNA), limma differential expression analysis and machine learning were applied to screen candidate target genes. Single-cell and spatial transcriptome analyses were performed to delineate the main expression domain of FKBP10 and its distribution in macrophages. Cell Counting Kit-8 (CCK-8), colony formation, Transwell, wound healing and flow cytometry assays were conducted to examine the effects of FKBP10 knockdown on the biological behaviors of SCC-9 cells. Western blot and Gene Set Enrichment Analysis (GSEA) were adopted to explore the potential molecular mechanism. Result: Bioinformatics research identified FKBP10 as a significant target gene for OSCC. FKBP10 is predominantly enriched in fibroblasts and significantly upregulated in OSCC tissues. It has a strong positive correlation with M2-type macrophage infiltration and is linked to a negative outcome for patients. FKBP10 knockdown can cause cell apoptosis, stop the cell cycle at the G0/G1 phase, and prevent SCC-9 cells from proliferating, migrating, and invading. Meanwhile, knockdown of FKBP10 downregulated the protein levels of Periostin (POSTN), Integrin Subunit Beta 5 (ITGB5) and key WNT signaling molecules. Conclusion༚FKBP10 may influence the recruitment of M2-type macrophages by regulating the ECM/integrin adhesion signal and the WNT pathway, thereby changing the tumor immune milieu and encouraging the occurrence and progression of OSCC. It is projected to become a promising biomarker and target for prognostic evaluation and targeted therapy of OSCC.

Also flagged:homeostasiscuproptosistumorcancerextracellularmitochondrial
Journal Article 2026-07-18 No Snippets Li G, Wang W.
Show Full Abstract

Copper, an essential trace element with dual functions in cancer progression, drives tumor growth via oncogenic signaling, metabolic plasticity, and extracellular matrix remodeling. By contrast, copper overload triggers cuproptosis, a form of mitochondrial proteotoxic cell death mediated by the FDX1/LIPT1/DLAT/Fe-S regulatory axis. To date, a unified theoretical framework integrating copper metabolism, tumor microenvironment (TME) remodeling, and antitumor immunity remains lacking. In this review, we reframe the TME as a structured copper ecosystem in which both cellular components and the extracellular matrix are modulated by copper, and propose a contextual copper signaling network, in which copper-mediated tumor cell fate is determined by the labile copper pool, the metabolic state, and tumor cellular heterogeneity. We further delineate a unified causal chain linking cuproptosis-driven immunogenicity and cGAS-STING activation to immune cell activation and PD-L1 modulation. Therapeutically, copper chelation and cuproptosis induction strategies have demonstrated promising efficacy, and combining cuproptosis induction with existing antitumor therapies may reverse therapeutic resistance and enhance treatment efficacy. Future studies need to validate cuproptosis-related signatures as predictive biomarkers for precision oncology and refine copper-targeted therapies to minimize systemic toxicities.

Also flagged:cartilage degenerationchondrocyte differentiationosteoarthritisOAagingtumors
Journal Article 2026-07-18 No Snippets Bravo-Baranda L, Milián L, Sancho-Tello M, Llop-Miguel M, Monleón-Guinot I, Martínez-Ramos C, Morales-Tatay JM, Mínguez-Rey MF, Mata M.
Show Full Abstract

<h4>Introduction</h4>Articular cartilage degeneration can lead to a progressive loss of joint function and, eventually, total joint failure. The use of mesenchymal stem cells (MSCs) for cartilage regeneration has proven effective; however, the difficulty of their clinical application has prompted research into other strategies, such as using MSC secretome instead of cells themselves. Our aim was to generate a culture system to obtain large amounts of MSC secretome with a controlled and known composition and the potential to induce articular cartilage regeneration.<h4>Methods</h4>Human dental pulp stem cells (hDPSCs) embedded in alginate/agarose beads were cultured in a bioreactor with constant agitation and periodic culture medium exchange. The secretome was collected and characterized according to known chondral markers (TGF-β1, SERPINE1, miR-140, miR-675, miR-23a, miR-204, miR-211, and miR-337-5p). Metabolomic and proteomic analyses were carried out for detailed characterization of the collected secretome. The chondrogenic potential of the collected secretome was tested in an in vitro model developed using human primary chondrocytes cultured in 3D on alginate-agarose scaffolds.<h4>Results</h4>Our system allowed us to obtain 1200 mL of secretome from intensive cultures of hDPSCs. The cells cultured on the platform remained viable and in an active anabolic state, secreting large amounts of prochondrogenic mediators. Variability between batches of secretome was low, and the collected secretome induced primary chondrocyte differentiation in vitro.<h4>Conclusions</h4>Genomic, metabolomic, and proteomic data indicate that hDPSCs on the platform proliferate and acquire a chondrocyte-like phenotype. These cells secrete mediators that define a microenvironment favorable for chondral regeneration. This is further supported by evidence found in the in vitro differentiation model. Our platform allows the production of large volumes of secretome with controlled composition and chondrogenic induction potential. This is a necessary preclinical study for the subsequent analysis of the secretome obtained using in vivo experimental models.

DCC
Also flagged:ADHDAttention‐deficit/hyperactivity disorderneurodevelopmental disordersbehavioralreading disabilityRD
Journal Article 2026-07-18 ✓ 5 Snippets Zhao J, Huang S, Liu W, Wang F, Qian H, Hu X.
In-Text Gene Mentions

…odevelopmental genes includingDCC, MEF2C, and ST3GAL3.…

…developmental genes, includingDCC, MEF2C, and ST3GAL3.…

…genes such asDCC, and activity‐dependent regul…

…include signals near PTPRF/DCC(word reading), MEF2C…

…eurodevelopmental genes (e.g.,DCC, MEF2C, ST3GAL3) implicated…

Show Full Abstract

<h4>Background</h4>Attention-deficit/hyperactivity disorder (ADHD) and language/reading difficulties frequently co-occur. The extent of shared genetic architecture remains incompletely defined. We investigated genome-wide overlap between ADHD and four core skills: word reading, nonword reading, spelling, and phoneme awareness.<h4>Methods</h4>We integrated genome-wide association study (GWAS) summary statistics from the Psychiatric Genomics Consortium for ADHD (38,691 cases; 186,843 controls) and from the GenLang Consortium for language-related traits (<i>n</i> = 13,633-33,959). We performed linkage disequilibrium score regression (LDSC) to estimate genetic correlations and stratified LDSC to identify enriched genomic annotations. Cross-trait meta-analyses were conducted using MTAG and CPASSOC to identify cross-trait association signals. Mendelian randomization (MR) was applied to assess potential directional relationships.<h4>Results</h4>Genome-wide genetic correlations were negative and significant between ADHD and each reading- and language-related trait (word reading rg = -0.35, <i>p</i> = 1.35 × 10<sup>-16</sup>; nonword reading rg = -0.28, <i>p</i> = 2.15 × 10<sup>-9</sup>; spelling rg = -0.38, <i>p</i> = 1.03 × 10<sup>-15</sup>; phoneme awareness rg = -0.28, <i>p</i> = 2.64 × 10<sup>-6</sup>). Partitioned heritability analysis using S-LDSC showed significant enrichment after Benjamini-Hochberg false discovery rate correction (BH-FDR), concentrated in conserved or constrained annotations such as Genomic Evolutionary Rate Profiling and phastCons. Cross-trait analyses (MTAG and CPASSOC) identified loci associated with ADHD and each skill, 6 for word reading, 7 for spelling, 7 for phoneme awareness, and 4 suggestive loci for nonword reading (dual-method <i>p</i> < 5 × 10<sup>-6</sup>); several map near neurodevelopmental genes including DCC, MEF2C, and ST3GAL3. Bidirectional MR findings were consistent with a potential directional contribution of ADHD genetic liability to poorer reading/language performance, with no clear evidence supporting the reverse direction under standard MR assumptions.<h4>Conclusion</h4>ADHD and language/reading abilities share a substantial polygenic overlap with convergent signals in neuronal regulatory annotations. These genome-wide findings support a transdiagnostic framework linking attention and literacy-related skills, while indicating that causal and clinical interpretations should remain cautious given the modest effect sizes and limited variance captured by current GWAS resources.

PRDX6
Also flagged:desuccinylationsuccinylationpost-translational modificationinflammatory diseasesFerroptosispathogenesis
Journal Article 2026-07-18 ✓ 1 Snippet Shen K, Wei Y, Xu H, Ke Z, Zhang H, Zhou X, Chen P, Zhan P, Zhang F, Zhu S, Jin J, Lv T, Song Y.
In-Text Gene Mentions

…T5-mediated desuccinylation ofPRDX6at K209 mitigates…

Show Full Abstract

Protein succinylation, an emerging post-translational modification (PTM), assumes a crucial role in the initiation and advancement of inflammatory diseases. Ferroptosis, propelled by lethal lipid peroxidation, is intricately associated with the pathogenesis of inflammation. Targeting ferroptosis has recently emerged as a promising therapeutic approach for acute lung injury (ALI). Nevertheless, the crosstalk between protein succinylation and ferroptosis in the regulation of ALI remains ambiguous. FOXO4, a key regulator of oxidative stress responses, is dynamically regulated by various PTMs. We identify SIRT7 as the desuccinylase essential for FOXO4 activation and nuclear localization. Mechanistically, SIRT7 desuccinylates FOXO4 at lysine 139 (K139), thereby inhibiting MDM2-mediated K48-linked polyubiquitination, which stabilizes FOXO4 and maintains FOXO4 nuclear retention. This consequently upregulates glutathione peroxidase 4 (GPX4) and suppresses lipopolysaccharide (LPS)-induced ferroptosis in alveolar epithelial cells (AECs). In vivo experiments demonstrated that SIRT7-knockout (SIRT7-KO) exacerbates LPS-induced ALI. Furthermore, the delivery of a FOXO4-K139R (mimicking desuccinylation) via adeno-associated virus 6 (AAV6) significantly alleviated pulmonary ferroptosis and histopathological damage in SIRT7-KO mice. Notably, pharmacological activation of SIRT7 with trilobatin (TLB) significantly attenuates ALI in LPS-challenged mice, establishing a potential therapeutic pathway for this pathology. Collectively, these findings delineate a previously unrecognized mechanism through which SIRT7 governs the nuclear retention and activation of FOXO4 via desuccinylation, establishing the SIRT7-FOXO4 axis as a potential therapeutic target and theoretical basis for ALI intervention.

PEBP1
Also flagged:Asthmachronic airway diseasepathogenesistranslationalinflammatory responselung diseases
Journal Article 2026-07-18 ✓ 1 Snippet Chen Y, Huang H, Chen Z, Hu M, Zhang J, Yu Q, Liu D, Yang H, Du Y, Li Y, Liang S, Li W, Huang W, Liao H, Wu J, Dong H.
In-Text Gene Mentions

…[ 41 ],PEBP1-mediated lipid peroxidation […

Show Full Abstract

Asthma exhibits pronounced circadian variation, yet the molecular mechanisms linking clock disruption to airway epithelial injury remain unclear. In this study, we identify the core clock component BMAL1 as a critical epithelial regulator that restrains ferroptosis-associated injury during allergic airway inflammation. Using a house dust mite (HDM)-induced murine asthma model and HDM-stimulated human bronchial epithelial cells, we found that BMAL1 expression was significantly reduced, whereas BMAL1 deficiency markedly aggravated airway inflammation, mucus metaplasia, and remodeling. Integrated transcriptomic and metabolomic analyses revealed a signature of inflammatory activation and metabolic reprogramming linked to ferroptosis. Consistently, BMAL1 deficiency increased lipid peroxidation and reactive oxygen species levels, downregulated GPX4 and xCT (SLC7A11), and upregulated COX2 expression in the airway epithelium both in vivo and in vitro. Treatment with Ferrostatin-1 attenuated these alterations and partially rescued the aggravated asthmatic phenotype in Bmal1-deficient mice. Notably, constitutive overexpression of BMAL1 also worsened HDM-induced airway pathology, suggesting that disruption of BMAL1 rhythmic oscillation contributes to disease progression. Mechanistically, BMAL1 deficiency activated the AP-1 pathway, induced COX2 expression, and promoted ferroptosis-associated epithelial injury, whereas inhibition of JUN alleviated this phenotype. Furthermore, melatonin also mitigated the aggravated airway pathology and ferroptosis-related changes associated with BMAL1 deficiency. Collectively, these findings identify BMAL1 as a key regulator of airway epithelial ferroptosis and highlight JUN signaling, together with COX2-associated prostaglandin responses, as downstream components of asthma exacerbations driven by circadian dysregulation.

Also flagged:osteoporosisbone diseasesynthesisosteoblast differentiationhomeostasisbone remodeling
Journal Article 2026-07-18 No Snippets Roy M, Dutta G, Das A, Singha Roy S, Debnath B, Jana M, Sugumaran A.
Show Full Abstract

Osteoporosis is a chronic metabolic bone disease that leads to decreased mineral density and causes damage to bone microarchitecture. Elderly persons are more susceptible to bone fractures and have reduced bone strength due to osteoporosis. Conventional pharmacological treatments are the key therapies, but increasing evidence highlights the potential of nutritional interventions to support bone health. Macronutrients, especially proteins from soy, legumes, nuts, seeds, and whole grains, supply essential amino acids vital for type I collagen synthesis, osteoblast differentiation, and bone-forming signalling pathways, promoting bone regeneration and structural integrity. Micronutrients from green leafy vegetables, including magnesium, potassium, vitamin K, vitamin C, zinc, and boron, contribute to mineral homeostasis, enhance calcium absorption, manage oxidative stress, and impact key pathways in bone remodeling, such as RANKL/OPG, Wnt/β-catenin, estrogen modulation, and antioxidant mechanisms. This review examines the current research on the usefulness of macronutrients and micronutrients from numerous plant sources in promoting bone tissue regeneration and reducing dependence on synthetic anti-osteoporotic treatment. It highlights their roles as sustainable, low-risk supplements to traditional osteoporosis treatments by integrating molecular insights with dietary knowledge.

Also flagged:Extracellular VesicleDiabetic kidney diseasetype 2 diabetes mellituschronic kidney diseaseglomerular filtrationhyperglycemia
Journal Article 2026-07-18 No Snippets Ablaikhanova N, Yessenbekova A, Duisenbek A, Okhas I, Ussipbek B, Assan G, Yessenova M, Abaildayev A, Safiollayeva A, Syraiyl S, Satken K, Rusanova I, Mukhitdin B.
Show Full Abstract

Diabetic kidney disease (DKD) remains one of the most severe microvascular complications of type 2 diabetes mellitus (T2DM) and a leading cause of chronic kidney disease (CKD) worldwide. Nevertheless, despite considerable progress in elucidating its molecular background, early diagnosis and accurate stratification of disease progression remain challenging when relying on conventional clinical biomarkers such as albuminuria and estimated glomerular filtration rate (eGFR). Growing evidence indicates that DKD is driven by interconnected pathogenic mechanisms, including chronic hyperglycemia, activation of the protein kinase C (PKC) signaling pathway, renin-angiotensin-aldosterone system (RAAS) dysregulation, oxidative stress, inflammatory cascades, and immune system activation involving Toll-like receptors (TLR) and the NLRP3 inflammasome. These processes collectively contribute to endothelial dysfunction, podocyte injury, extracellular matrix accumulation, and progressive renal fibrosis. Exosomes and their molecular cargo, particularly miRNAs, have emerged as promising regulators and non-invasive biomarkers reflecting ongoing renal injury. Urinary exosomal microRNAs (uEV-miRNAs) are of interest due to their stability in biological fluids and their direct origin from nephron segments, enabling real-time reflection of renal pathophysiology. Accumulating studies suggest that differentially expressed microRNAs (miRNAs), including miR-21-5p, miR-30a-5p, miR-192-5p, and miR-142-3p, are closely associated with key pathways in DN. However, their clinical translation remains limited by methodological heterogeneity, the lack of standardized isolation protocols, and insufficient validation in large longitudinal cohorts. This review navigates the current landscape of knowledge on the molecular mechanisms underlying DKD and examines the emerging role of uEV-miRNAs as diagnostic biomarkers. Altogether, uEV-miRNAs offer a promising avenue for improving early detection, risk stratification, and disease monitoring in DKD.

Also flagged:chromatincell cyclebindingcell growthtumorbreast cancer
Journal Article 2026-07-17 No Snippets Johnson Thomas AL, Karakyriakou B, Muskus PC, Roberts AM, Rendleman J, Warren A, Lu H, Birmingham KA, Friedman MK, Goen AE, Yang H, Wilkins OM, Kolling FW, Demidenko E, Jorns JM, Christensen BC, Miller TW.
Show Full Abstract

Estrogen therapy elicits clinical benefit in ~ 30% of patients with endocrine-resistant estrogen receptor (ER)-positive breast cancer, but its mechanism of action and strategies to increase efficacy remain unclear. Estrogen therapy can induce ER transcriptional hyperactivation and DNA damage; we postulated that such damage could be exacerbated by epigenetic dysregulation via inhibition of histone deacetylases (HDACi). We evaluated the effects of 17b-estradiol and HDACi in three types of ER<sup>+</sup> breast cancer models: Cells adapted to growth following long-term estrogen deprivation; cells engineered to overexpress exogenous ER that confers endocrine resistance; mice bearing endocrine-resistant patient-derived xenografts. Assay endpoints included apoptosis, growth, DNA damage, histone post-translational modification, levels of ER-regulated transcripts and encoded proteins, cell cycle and replication status, and genome-wide chromatin accessibility, ER binding, and transcriptional profiles. Entinostat treatment increased histone acetylation and chromatin accessibility. Combination treatment with E2 and entinostat inhibited cell growth and induced apoptosis in ER-overexpressing models. E2 and entinostat induced DNA damage as single agents and in combination. These agents synergized against tumor models, offering HDACi as a strategy to enhance efficacy of estrogen therapy.

Also flagged:Agingcell proliferationmitochondrialage-related diseasesresponse toage-related disorders
Journal Article 2026-07-17 No Snippets Wang X, Deng W, Tu S, Tang H, Yin K, Zhu X.
Show Full Abstract

Aging is accompanied by a gradual loss of cellular function and systemic weakening of the homeostasis of multiple tissues, leading to a variety of age‑related diseases and eventual mortality. Super‑enhancers are a distinct class of cis‑regulatory elements with strong transcriptional activation properties; they are bound by a large number of key transcription factors and cofactors, and possess distinct characteristic modification marks of enhancers. The past decade has seen an exponential growth in the field of super‑enhancer research, partly because of the strong transcriptional activity of super‑enhancers. Super‑enhancers are notably activated in response to aging or aging‑related factors, and serve a pivotal role in aging and aging‑related diseases by modulating key biological processes, including cell proliferation, differentiation and senescence. In the present review, the changes in super‑enhancers under aging‑related stimuli are initially discussed. The mechanistic contributions of super‑enhancers to cellular senescence from the perspective of DNA damage and mitochondrial dysfunction, two hallmarks of aging, are then systematically summarized. Furthermore, the pathogenic involvement of super‑enhancer dysregulation in specific age‑related disorders, including atherosclerosis and type Ⅱ diabetes, is explored, highlighting the potential of super‑enhancers as therapeutic targets. Finally, the current challenges and prospects of super‑enhancers within the context of aging biology are discussed, aiming to provide novel theoretical guidance for the treatment of age‑associated diseases.

HFE
Also flagged:Type 2 Diabetesatherosclerotic cardiovascular diseaseASCVDcardiovascular diseaseacute myocardial infarctionischemic heart diseases
Journal Article 2026-07-17 ✓ 2 Snippets Wu JY, Lee KW, Kao CL, Hung KC, Yu T, Lin YM.
In-Text Gene Mentions

…from outpatient care,HFEevents identified through…

…the definition ofHFEmay be nonspecific…

Show Full Abstract

<h4>Background</h4>To evaluate the association between tirzepatide use and 1-year risk of major adverse cardiovascular events in patients with type 2 diabetes and atherosclerotic cardiovascular disease, compared with GLP-1 (glucagon-like peptide-1) receptor agonists.<h4>Methods</h4>We conducted a retrospective, propensity score-matched cohort study using the TriNetX network. A total of 16 402 patients with type 2 diabetes and atherosclerotic cardiovascular disease initiating tirzepatide or GLP-1 receptor agonists between January 1, 2022, and March 31, 2025 were matched 1:1. The primary outcome was 1-year major adverse cardiovascular events; secondary outcomes included all-cause mortality, acute myocardial infarction, major adverse limb events, and tissue plasminogen activator use.<h4>Results</h4>Tirzepatide was associated with a lower risk of major adverse cardiovascular events (hazard ratio [HR], 0.75 [95% CI, 0.63-0.91]) and reduced risks of all-cause mortality (HR, 0.69 [95% CI, 0.53-0.90]), major adverse limb events (HR, 0.59 [95% CI, 0.39-0.88]), and acute myocardial infarction (HR, 0.70 [95% CI, 0.53-0.93]), compared with GLP-1 receptor agonists. Results were robust across subgroups and sensitivity analyses.<h4>Conclusions</h4>Among patients with type 2 diabetes and atherosclerotic cardiovascular disease, tirzepatide was associated with a significantly reduced 1-year risk of major adverse cardiovascular events and other cardiovascular outcomes compared with GLP-1 receptor agonists. These findings support the cardiometabolic potential of tirzepatide, warranting further prospective validation.

Also flagged:metastatic breast cancertumorbreast cancerphosphorylationmetastatic diseasetumors
Journal Article 2026-07-17 No Snippets Dong W, Wang S, Chan B, Vasquez M, Cui JZM, Sampson J, Sannes C, Yang W, Puri A, Chang J, Zhao H, Li X, Wong STC.
Show Full Abstract

<h4>Purpose</h4>Trastuzumab deruxtecan (T-DXd) has improved outcomes in metastatic breast cancer; however, a substantial subset of patients experience early lack of clinical benefit that is not reliably predicted by routine clinicopathologic variables. In an institutional cohort of 109 T-DXd-treated metastatic lesions, HER2 expression level, ER/PR status, Ki-67 index, and metastatic site were not significantly associated with response, highlighting the need to define mechanistic determinants of intrinsic resistance.<h4>Experimental design</h4>We performed spatial transcriptomic and proteomic profiling using NanoString GeoMx Digital Spatial Profiling on pretreatment bone, brain, and soft-tissue metastases from patients with clinical benefit (response) versus early progression (resistance) on T-DXd. Tumor (PanCK⁺) and immune (CD45⁺) compartments were analyzed to link tumor architecture and region-resolved signaling states with therapeutic response. Candidate resistance pathways were functionally evaluated in HER2-positive breast cancer cell lines and in vivo metastasis models treated with T-DXd alone or combined with the RAGE inhibitor TTP488.<h4>Results</h4>Spatial proteogenomics revealed recurrent upregulation of S100 family alarmins in resistant tumor regions, associated with activation of a RAGE-centered pro-survival signaling program characterized by ERK, AKT, and STAT3 phosphorylation. Pharmacologic RAGE inhibition enhanced T-DXd-induced apoptosis, restored drug sensitivity in vitro, and significantly reduced metastatic burden in lung and brain metastasis models.<h4>Conclusions</h4>Spatial proteogenomics identifies a conserved S100-RAGE-driven survival state coupled to immune-excluded tumor architecture as a mechanism of intrinsic T-DXd resistance across metastatic niches. Targeting this pathway with an orally available RAGE antagonist restores T-DXd responsiveness and offers an immediately translatable strategy to overcome resistance in metastatic breast cancer.

Also flagged:synthesischromatinbindingaginggene expressionmetabolism
Journal Article 2026-07-17 No Snippets Storer F, McClure CD, Gomez AE, Minkley LJ, Wong TL, Markevych N, Southall TD.
Show Full Abstract

The RNA-binding protein Sex-lethal (Sxl) is classically known as a master regulator of sex determination and mRNA splicing in Drosophila melanogaster. However, this role is not conserved across species, and functions beyond the canonical pathway remain poorly understood. In this study, we uncover a splicing-independent role for Sxl at the chromatin level in the Drosophila brain. Using Targeted DamID (TaDa) profiling in neurons, we identify widespread binding of Sxl to promoter regions, independent of sex or RNA binding activity. Notably, Sxl chromatin occupancy exhibits near-complete overlap with Polr3E (RPC37), an RNA Polymerase III subunit, with Sxl binding abolished upon Polr3E knockdown. Depletion of Sxl in mature male neurons induces widespread transcriptional changes, particularly in metabolic genes, and improves negative geotaxis during aging, phenotypes that closely mirror Polr3E knockdown. Conversely, overexpression of the brain-specific SxlRAC transcript leads to severe climbing deficits and upregulated gene expression associated with metabolism and translation. Manipulating Sxl levels in the brain significantly impacts select tRNA production and global protein synthesis rates. Together, these findings reveal a previously unrecognized role for Sxl in regulating Pol III activity via Polr3E, modulating tRNA synthesis and supporting neuronal metabolism. Given the emerging tie between Pol III regulation and neuronal aging, our study highlights Sxl as a novel factor in neuronal homeostasis.

SOX6DCC
Also flagged:Neuroblastomapediatric cancerneuroblastomasmesenchymal transitionadrenal tumorsmetastatic neuroblastomas
Journal Article 2026-07-17 ✓ 2 Snippets Wu LMN, Oblinger JL, Xin D, Rao R, Zhang F, Adam M, Lopez-Nunez O, Szabo S, von Allmen D, Chang LS, Weiss BD, Lu QR.
In-Text Gene Mentions

…, FUT9 ,DCC, and DKK2…

…neuroblasts and theSOX6regulon in early…

Show Full Abstract

Neuroblastoma, a pediatric cancer derived from sympathetic ganglia of the peripheral nervous system, frequently metastasizes, driving poor outcomes. Primary neuroblastomas are well-characterized, but the mechanisms underlying metastasis remain poorly understood. Here, by using single-cell and spatial multiomics, we identified that lymph node metastases in high-risk neuroblastomas display distinctive cellular heterogeneity and plasticity, marked by mesenchymal-like and stem-like states and heightened epithelial-to-mesenchymal transition activity compared to primary adrenal tumors. In addition, compared to primary adrenal masses, the metastatic niche display increased immunosuppressive myeloid programs, heightened immune checkpoint signaling, and lymphocyte exhaustion, which are indicative of immune evasion and dysfunction. Notably, metastatic neuroblastomas show elevated eIF4F translation machinery and XPO1 levels. Dual inhibition of eIF4A and XPO1 synergistically halted tumor growth and prolonged survival in xenograft models. Together, our multiomics studies reveal the molecular and cellular plasticity that contributes to therapy resistance and highlight exploitable therapeutic vulnerabilities in high-risk metastatic neuroblastomas.

OLFM4
Also flagged:pneumoniainflammatory lung diseasesinfectious diseasesgene expressionpathogenesismembrane
Journal Article 2026-07-17 ✓ 1 Snippet Li Z, Li T, Li K, Zheng M, Chen L, Sun J, Li Y, He S, Tian H.
In-Text Gene Mentions

…hub genes includingOLFM4, RETN, LTF, CEACAM6,…

Show Full Abstract

Accurate and early detection of pneumonia is crucial for effective treatment; however, current diagnostic methods often lack the necessary specificity and sensitivity. Herein, we begin with a comprehensive bioinformatics analysis, identifying neutrophil elastase (NE) as a critical biomarker associated with pneumonia progression. We subsequently develop an NE-responsive probe (NERP), composed of a hemicyanine fluorophore linked to an NE-sensitive peptide, specifically designed for activation in inflamed tissues. To facilitate urinalysis, NERP is further refined into a hydrophilic active targeting responsive probe (ATRP<sub>H</sub>). ATRP<sub>H</sub> demonstrates exceptional sensitivity in both in vivo imaging and urine-based detection, with urine analysis offering a noninvasive, early-stage diagnostic option that overcomes the limitations of tissue penetration and low accuracy. In addition, ATRP<sub>H</sub> is highly effective in drug screening, dosage optimization, and exploring mechanisms of NE production. This biomarker screening and design strategy not only enhances pneumonia diagnosis and treatment via different routes of administration but also has broader potential for other inflammatory lung diseases.

Also flagged:chromatinbindinghistone modificationsnucleosomeorganizationgene expression
Journal Article 2026-07-17 No Snippets Zhou Z, Cheng Y, Lieberth J, Zhang J, Jin Y, Li A, Yu H, Ozer A, Lis JT.
Show Full Abstract

Enhancers are abundant and critical gene-distal cis-regulatory elements with distinct architectural features; however, a mechanistic understanding of their interactions within endogenous chromatin contexts remains challenging. Here, we developed a recombinase-mediated genome-rewriting platform to explore how a long-range human enhancer, eNMU, confers a remarkable 10,000-fold activation of its target gene, Neuromedin U (NMU), at its native locus. Our systematic dissection reveals two functionally distinct sub-elements of eNMU: the canonical autonomous enhancer e1 and the intrinsically inactive facilitator e2, which dramatically augments e1's activity. The autonomous enhancer e1 is functionally hierarchical to e2, additional facilitators, and the NMU promoter across the ∼100-kb NMU-eNMU region, and it orchestrates the formation of a 3D regulatory hub. e1 also harbors a bipartite structure: a divergently transcribed retroviral long terminal repeat (LTR) enhancer and an adjacent LTR promoter that dampens NMU expression. We explore and discuss the broader implications of our focused study for understanding enhancer regulatory mechanisms genome-wide.

LRRC7
Also flagged:Purinepyrimidinecyclic dinucleotidesphagosomepattern recognition receptorsbacterial infection
Journal Article 2026-07-17 ✓ 1 Snippet Ragland SA, Lindblad KE, Li Y, Choi JH, Okin D, Mao JQ, Richmond-Buccola D, Coronado DR, Brown MR, Snapper SB, Kranzusch PJ, Kagan JC.
In-Text Gene Mentions

leucine-rich repeat-containing protein 8

Show Full Abstract

Toll-like receptors (TLRs) are considered general sensors of bacterial encounters. Here, we examined whether other pattern recognition receptors are commonly activated during bacterial infection. TLR-independent interferon (IFN) responses were induced in macrophages in response to diverse bacterial encounters. Of the cytoplasmic receptor families examined, the cyclic dinucleotide (CDN) sensor STING was required for IFN responses to evolutionarily diverse bacteria. Various bacterial CDNs were present in murine tissues; these activated stimulator of interferon genes (STING) after bacteriolysis in phagolysosomes in a manner requiring two CDN transporters. Importantly, bacterial CDNs were increased in colonic biopsies from patients with inflammatory bowel disease. Systemic delivery of dead, CDN-laden bacteria promoted anti-tumor immunity in mice. Detection of diverse CDNs, including pyrimidine-based CDNs, was an evolutionarily conserved feature of STING, with distinct binding modes for purine- and pyrimidine-based CDNs. Thus, a phagocytosis-CDN-STING connection places cytoplasmic sensing as a common outcome of host-bacteria interactions that set the immune tone of a tissue, with implications for host defense.

Also flagged:endoplasmic reticulumsynthesisprotein synthesissecretiondeathmetabolic disorders
Journal Article 2026-07-17 No Snippets Raja Mathanki N, Isaac Newton ON, Bera AK.
Show Full Abstract

The endoplasmic reticulum (ER), a major calcium ion (Ca<sup>2+</sup>) reservoir, plays a pivotal role in lipid synthesis, protein synthesis, and secretion. Disruption of ER function leads to the accumulation of misfolded proteins, resulting in ER stress. To restore cellular homeostasis, the unfolded protein response (UPR) is activated. However, prolonged or irreversible ER stress can trigger apoptosis and cell death. Cellular dysfunction and apoptosis arising from disrupted ER Ca<sup>2+</sup> homeostasis are often implicated in neurodegenerative and metabolic disorders. We investigated the role of LRRC8B, an ER-resident protein previously linked to ER Ca<sup>2+</sup> homeostasis, in the ER stress response. LRRC8B expression was upregulated in response to chemically induced ER stress. Overexpression of LRRC8B enhanced the viability of HEK293T cells exposed to the ER stressor tunicamycin, whereas LRRC8B knockdown increased their susceptibility to apoptosis. Furthermore, LRRC8B overexpression reduced protein aggregation during ER stress by upregulating cytoprotective genes associated with the adaptive UPR, including BiP, calnexin, and PDI. Conversely, LRRC8B knockdown decreased BiP expression and elevated the levels of ER stress-induced apoptotic proteins such as CHOP, Bax, and cleaved caspase-3. Co-treatment with the chemical chaperone, 4-PBA, partially rescued the LRRC8B knockdown cells undergoing apoptosis. In Neuro 2a (N2a) cells, LRRC8B overexpression diminished the aggregation of mutant huntingtin protein (HTT-83Q), associated with Huntington's disease, whereas its knockdown exacerbated HTT-83Q aggregation. Taken together, these findings suggest that LRRC8B is a key modulator of the ER stress response and plays a cytoprotective role.

PRDX6
Also flagged:mitochondrialorganizationinsulin resistanceglucose intolerancemetabolic liver diseasepathogenesis
Journal Article 2026-07-17 ✓ 1 Snippet Kim S, Kim YJ, Kim N, Kim U, Park YS, Yun JH, Heo J, Lee H, Choi J, Park S, Jeong I, Kim BJ, Shin HY.
In-Text Gene Mentions

…, Prdx1 ,Prdx6, and Gpx1…

Show Full Abstract

<h4>Objectives</h4>SAMM50 rs3761472 is associated with metabolic dysfunction-associated steatotic liver disease (MASLD), but its functional consequences in vivo remain unclear. We investigated whether this variant disrupts mitochondrial function and promotes MASLD progression.<h4>Methods</h4>Associations of rs3761472 with MASLD and liver-related traits were evaluated using Korea Biobank Array data. We generated Samm50 knock-in (KI) mice carrying the D110G substitution corresponding to human rs3761472 using CRISPR/Cas9 and assessed hepatic mitochondrial homeostasis and MASLD-related phenotypes in mice fed a normal diet or a high-fat diet.<h4>Results</h4>In human genetic analyses, rs3761472 was significantly associated with MASLD and higher serum levels of liver injury markers. Samm50-KI mice showed reduced hepatic SAMM50 expression, disrupted mitochondrial organization, impaired mitochondrial respiration and ATP production, increased mitochondrial oxidative stress, inflammatory activation, apoptosis, and liver injury. Following high-fat diet feeding, Samm50-KI mice exhibited greater hepatic lipid accumulation and liver injury, together with more pronounced insulin resistance and glucose intolerance, than wild-type mice.<h4>Conclusions</h4>Our findings establish rs3761472 as a functional genetic variant linking mitochondrial architecture to metabolic liver disease pathogenesis, with potential relevance as a genetic biomarker for MASLD susceptibility.

PRDX6
Also flagged:Hepatocellular CarcinomatumorType 2 DiabetesPrimary liver cancercancerliver cancers
Journal Article 2026-07-17 ✓ 1 Snippet Sun Z, Wang N, Wu X, Wang T, Liu D, Zou Y, He R, Jia N.
In-Text Gene Mentions

…oxidative stress regulatorPRDX6has been verified…

Show Full Abstract

<h4>Objective</h4>To develop and validate a non-invasive model for predicting early recurrence (ER) after microwave ablation (MWA) in patients with hepatocellular carcinoma (HCC) and comorbid type 2 diabetes (T2D).<h4>Methods</h4>This retrospective study enrolled 186 HCC patients with T2D who underwent MWA and were divided into training (n=149) and validation (n=37) cohorts. Preoperative clinical parameters and portal-venous phase MRI radiomic features were extracted. A radiomics score (RAD -score) was constructed using the K-nearest neighbors (KNN) algorithm after feature selection. A clinical model was built using logistic regression, and a nomogram integrating clinical factors and the RAD -score was established. Model performance was evaluated using ROC curves, calibration curves, and decision curve analysis (DCA). Kaplan--Meier curves, pathological analysis, and immunohistochemistry validated prognostic stratification.<h4>Results</h4>Four core radiomic features were identified. The combined nomogram achieved AUCs of 0.877 (training) and 0.846 (validation), outperforming the clinical (AUC 0.718) and radiomics (AUC 0.774) models alone. In the validation cohort, the sensitivity, specificity, and negative predictive value were 80.0%, 83.8%, and 90.1%, respectively. DCA showed a significant net benefit across threshold probabilities of 0.1-0.9. High-risk patients had a 5.8-fold (training) and 2.51-fold (validation) higher recurrence risk with significantly shorter progression-free survival. Pathological and immunohistochemical analyses confirmed more aggressive tumor features (higher rates of microvascular invasion, poor differentiation, thick-trabecular type, CD34 expression, and glypican-3 expression) in the high-risk group.<h4>Conclusion</h4>The nomogram provides a satisfactory prediction of early recurrence within two years after MWA in HCC patients with T2D, enabling individualized postoperative surveillance and intervention.

OLFM4
Also flagged:Colorectal Cancertumorlocalizationcytoplasmiccancerregulation of
Journal Article 2026-07-17 ✓ 1 Snippet Đokić N, Bubanja A, Karanović J, Despotović J.
In-Text Gene Mentions

…AXIN2, RNF43, LGR5,OLFM4, and SLC12A2 […

Show Full Abstract

<b>Background/Objectives</b>: Long non-coding RNAs (lncRNAs) are important regulators of tumor biology through their interactions with DNA, proteins, and non-coding RNAs. Although ENST00000615487.1 (also known as CTD-2396E7.11/AC010503.4) has been associated with multiple malignancies, its biological role in colorectal cancer (CRC) remains poorly characterized. This study aimed to investigate the expression pattern, cellular and subcellular localization, and potential functional role of ENST00000615487.1 in CRC using integrated in vitro and in silico approaches. <b>Methods</b>: Molecular characteristics of the transcript were obtained with the CPC2 and RNA Analyzer 3 tools. Differential expression of ENST00000615487.1 across 10 tumor types was analyzed using the UCSC Xena Browser. Transcript expression was experimentally evaluated in normal, tumor, and fibroblastic colon cell lines by PCR, while subcellular localization was assessed through the lncATLAS, lncLocator, and iLoc-LncRNA tools, and experimentally confirmed by qRT-PCR. Single-cell RNA sequencing data from the GSE161277 dataset were analyzed to determine cell type-specific expression patterns. Potential interactions with DNA, miRNAs, and proteins were investigated using Fasim-LongTarget, miRDB, and AnnoLnc2, followed by functional enrichment analyses using STRING and Enrichr. <b>Results</b>: ENST00000615487.1 was identified as a structurally stable non-coding transcript with a highly organized secondary structure. Differential expression analysis demonstrated significant downregulation in CRC compared with that in normal colon tissue. Single-cell transcriptomic analysis revealed predominantly epithelial-specific expression. In silico and experimental analyses demonstrated predominant nuclear localization in normal colon cells, whereas cytoplasmic enrichment was observed in CRC cells. Functional analyses identified potential interactions with <i>HIP1R</i>, <i>RPH3AL</i>, specific miRNAs, and proteins involved in transcriptional regulation and RNA processing pathways, as well as functional connections with proteins involved in vesicular transport. <b>Conclusions</b>: ENST00000615487.1 is a structurally stable lncRNA exhibiting context-dependent expression and localization patterns in CRC, suggesting a potential shift from nuclear transcriptional regulation toward cytoplasmic post-transcriptional functions during colorectal carcinogenesis.

Also flagged:gene expressionpathogenesiscancerneurodegenerative diseasesbindingdegradation
Journal Article 2026-07-17 No Snippets Wen Y, Peng L, Wang J.
Show Full Abstract

The ZFP36 family proteins (TTP, ZFP36L1, and ZFP36L2) are RNA-binding proteins that function as key post-transcriptional regulators of gene expression. They bind AU-rich elements (AREs) in target mRNA 3'UTRs, recruit the CCR4-NOT deadenylation complex to trigger mRNA decay, and maintain homeostasis in immunity, barrier function, and stem cell fate. Rather than acting on single targets, all family members share a conserved mRNA destabilization mechanism, with outcomes determined by member-specific expression, kinase-mediated regulation, and cell-type-dependent target availability. Dysregulation of this network stabilizes mRNAs encoding pro-inflammatory cytokines, immune checkpoints, and oncogenes, driving pathogenesis of inflammation, autoimmunity, cancer, cardiovascular and neurodegenerative diseases. Individual family members exert context-dependent and sometimes opposing effects, so their net function depends on the specific cellular and disease context. Therapeutic strategies targeting ZFP36 activity, including phosphatase agonism and epigenetic modulation, have shown promising preclinical results, but clinical translation remains early. This review summarizes the molecular regulatory networks of the ZFP36 family and their physiological and pathological roles, emphasizing the mechanistic principles that unify family-member function and the contextual factors that diversify it, to provide a foundation for future therapeutic development.

DCC
Also flagged:Pancreatic Acinar Cell Carcinomapancreatic ductal adenocarcinomaPDACpancreatic cancercancerpancreatic neoplasms
Journal Article 2026-07-17 ✓ 1 Snippet Farhoud N, Al-Rajabi RMT, Baranda JC, Li H, Zhang W, Paluri RK, Manne A, Dandawate P, Sun W, Kasi A.
In-Text Gene Mentions

…in colorectal carcinoma (DCC) protein and may…

Show Full Abstract

Pancreatic acinar cell carcinoma (PACC) is a rare exocrine pancreatic malignancy accounting for approximately 1-2% of adult pancreatic neoplasms. Although historically grouped with pancreatic ductal adenocarcinoma (PDAC), accumulating evidence demonstrates that PACC represents a biologically distinct entity with unique clinical, pathologic, and molecular characteristics. Compared with PDAC, PACC more commonly presents as a large pancreatic mass, is less frequently associated with obstructive jaundice, and exhibits lower rates of <i>KRAS</i> mutations. Recent genomic studies have identified recurrent alterations involving DNA damage repair pathways, WNT/β-catenin signaling, and actionable kinase fusions, including <i>BRAF</i> and <i>RAF1</i> rearrangements. In advanced disease, fluoropyrimidine- and platinum-based regimens appear to demonstrate greater activity than traditional gemcitabine-based approaches, although prospective comparative data are lacking. This review summarizes the current understanding of the epidemiology, clinical presentation, pathology, molecular landscape, treatment approaches, and prognostic factors associated with PACC. We highlight emerging opportunities for precision oncology and discuss ongoing challenges in the management of this uncommon pancreatic malignancy.

Also flagged:Asthmachronic inflammatory disease of the airwayspathogenesischronic respiratory diseasesimmune responsesmucus
Journal Article 2026-07-17 No Snippets Xi T, Zu T, Pang X, Wu F.
Show Full Abstract

Asthma is a highly heterogeneous chronic inflammatory disease of the airways, among which Th2-high asthma represents the most prevalent endotype. The pathogenesis of Type 2 (T2) asthma (driven by type 2 inflammation) involves a complex immune network orchestrated by the coordinated actions of multiple effector cell populations, including Th2 cells, group 2 innate lymphoid cells (ILC2s), and type 2 cytotoxic T (Tc2) cells. Epithelial-derived alarmins, particularly interleukin-33 (IL-33) and thymic stromal lymphopoietin (TSLP), function as key upstream initiators that bridge innate and adaptive immunity. In addition, multilayered regulatory mechanisms-including genetic susceptibility, metabolic reprogramming, and ubiquitination-collectively govern the initiation and progression of Th2-driven inflammation. With the deepening understanding of these mechanisms, therapeutic strategies have progressively shifted from targeting downstream effector molecules to upstream alarmins, thereby providing new directions for precision medicine. This review systematically summarizes recent advances in the immunopathogenesis and targeted therapies of T2 asthma, offering a conceptual framework for precision-based clinical interventions.

TNFSF4
Also flagged:cancertumorsmelanomatumorchronic infectionorganization
Journal Article 2026-07-17 ✓ 1 Snippet Barnes R, Cummings K, Perusina Lanfranca M, Rodriguez AB, Stasiak K, Ludewig B, Dolatshahi S, Engelhard VH.
In-Text Gene Mentions

…( Cd80, Cd86,Tnfsf4(Ox40L), Tnfsf5 (Cd40L),…

Show Full Abstract

<h4>Introduction</h4>In recent years, the clinical relevance of tertiary lymphoid structures (TLS) in cancer has become increasingly clear. However, the mechanisms that promote TLS development have remained obscure, largely because of a lack of animal models in which cause and effect studies can be performed. In this study, we used a mouse model in which TLS develop spontaneously in intraperitoneal tumors to address this issue.<h4>Methods</h4>Cxcl13-cre-tdTomato mice were implanted with B16-OVA melanoma tumors in either intraperitoneal or subcutaneous locations to establish which cells expressed CXCL13. Single cell suspensions from tumors were analyzed by flow cytometry. To address the impact of CXCL13<sup>+</sup> CAF on TLS formation, we bred Cxcl13-cre tdTomato mice to R26R-iDTR<sup>flox</sup> mice, which express the diphtheria toxin receptor under the control of a floxed stop codon. The resulting Cxcl13-cre/iDTR mice were treated with diphtheria toxin beginning on day 7 after IP tumor implantation. Single cell suspensions from tumors were analyzed by flow cytometry. To characterize their functional properties, CAF in IP melanoma tumors from Cxcl13-cre/eGFP mice were collected by cell sorting, analyzed for transcript expression using scRNA-seq, clustered into groups using the Seurat package, and profiled using pathway analysis and differential gene analysis.<h4>Results</h4>Extending earlier studies in which we showed that CXCR5-expressing B cells are essential for TLS development, we found that CXCL13, the ligand for CXCR5, were expressed exclusively by a population of cancer-associated fibroblasts (CAF), and that these CAF were essential to promote B cell accumulation in these tumors. In keeping with earlier work showing that the presence of TLS was associated with smaller tumor size, we also found that the lack of B cell accumulation was associated with larger tumor size. Using scRNA-seq, we identified 7 groups of CAF in TLS containing tumors. One of these CAF groups was substantially enriched for CXCL13-expressing cells. This population was also enriched for additional genes that could promote B cell recruitment and enable regulation by a variety of cytokines. However, other genes that we have shown or hypothesize to be important in TLS development were enriched for expression in other CAF groups.<h4>Conclusions</h4>This work indicates that TLS development in this model depends on multiple CAF populations operating at distinct points in the developmental process. Some of these populations appear similar to, but distinct from, those defined in other human and murine tumor models. However, we also discriminated new immunologically relevant populations of CAF, particularly one expressing CXCL13, which we propose acts as a central organizer of tumor-associated TLS.

ZNFX1
Also flagged:SCLCtumorautophagycell-cyclesmall cell lung cancerproteostasis
Journal Article 2026-07-17 ✓ 1 Snippet Han J, Xu S, Jiang Y.
In-Text Gene Mentions

…between SYTL3 andZNFX1, whereas correlations among…

Show Full Abstract

<h4>Background</h4>Small cell lung cancer (SCLC) is a highly aggressive malignancy characterized by rapid progression, early metastasis, frequent relapse, and treatment resistance. Although chemoimmunotherapy has improved outcomes in a subset of patients, reliable molecular stratification tools reflecting tumor heterogeneity and survival risk remain limited. Chaperone-mediated autophagy (CMA) is involved in proteostasis, metabolic adaptation, and stress responses, but its cellular heterogeneity and prognostic relevance in SCLC remain unclear.<h4>Methods</h4>This study integrated single-cell RNA sequencing data, bulk transcriptomic cohorts, and clinical information to characterize CMA-related heterogeneity in SCLC. At the single-cell level, SCLC subtypes were annotated, CMA scores were calculated, and differences among baseline, sensitive, and resistant states were evaluated. At the bulk level, tumor versus normal differential expression analysis and weighted gene co-expression network analysis were performed to identify CMA-related candidate genes. A CMA-related Risk Score was constructed through comprehensive machine learning comparison and evaluated using survival analysis, time-dependent receiver operating characteristic curves, Cox regression, nomogram analysis, functional enrichment, immune microenvironment analysis, and drug sensitivity prediction. ARRDC3 was further validated by <i>in vitro</i> experiments.<h4>Results</h4>Single-cell analysis revealed marked SCLC subtype heterogeneity and nonuniform CMA activity across cellular subtypes. Significant CMA score differences between sensitive and resistant cells were observed in the SCLC-A_NR0B1/MYCL+ and SCLC_Hypoxia_glycolytic subtypes. Integration of CMA-related co-expression modules with tumor-associated differentially expressed genes identified 53 candidate genes. The machine learning-derived Risk Score effectively stratified patients into high-risk and low-risk groups across the combined cohort, GSE60052 cohort, and cBioPortal cohort, with high-risk patients showing significantly poorer overall survival. The Risk Score remained an independent prognostic factor and was associated with proliferative, cell-cycle, metabolic, immune, and drug sensitivity-related features. <i>In vitro</i> experiments showed that ARRDC3 overexpression suppressed proliferation, colony formation, migration, and invasion in H446 cells.<h4>Conclusion</h4>This study revealed CMA-related cellular heterogeneity in SCLC and established a robust prognostic Risk Score associated with survival, biological pathway activity, immune microenvironment features, and potential therapeutic responses. Functional validation of ARRDC3 further supports the biological relevance of this model, providing new insights into SCLC molecular risk stratification and CMA-associated resistance states.

SOX6PEBP1
Also flagged:multiple myelomagene expressionExtracellular VesiclesMyelomaExtracellularvesicles
Journal Article 2026-07-16 ✓ 3 Snippets Platonova N, Aiello G, Ronchetti D, Citro V, Asselta R, Casati L, Giannandrea D, Taiana E, Neri A, Sini G, Calzavara E, Turrini M, D'Amato A, Chiaramonte R.
In-Text Gene Mentions

…networks (AR, TWIST1/2,SOX6, SP1, KLF8 and…

…ENO1, EZR, FN1,PEBP1, PKM and STMN1;…

…[ 39 ],SOX6[ 40 ],…

Show Full Abstract

Despite therapeutic advances, multiple myeloma (MM) remains characterized by progression and relapse, underscoring the need for reliable biomarkers for early detection and monitoring. Extracellular vesicles (EV) are cell-derived, lipid bilayer-enclosed particles that mediate intercellular communication and circulate in body fluids, making them promising biomarkers. This study compares the proteome of MM-derived EV with parental cells and evaluates whether EV represent a superior source of MM-specific biomarkers. We used high-resolution mass spectrometry to analyze MM cell lines and their EV. Cell line-derived EV offer a cleaner, tumor-specific protein profile, minimizing background from nonmalignant cells and improving biomarker accuracy. MS datasets were subjected to bioinformatic analysis, followed by functional enrichment using gene set libraries such as Gene Ontology, Jensen Compartments, TRRUST and DisGeNET, to extend interpretation beyond limited protein databases. Compared to cellular proteins, the EV proteome was enriched in functions related to oncogenic signaling, transcriptional regulation and MM pathophysiology, strengthening its potential as a cancer-related biomarker source. DisGeNET identified cancer-related proteins that were further evaluated to identify MM-specific candidates analyzing MM patients' gene expression databases containing clinical data. This led to the identification of macrophage migration inhibitory factor (MIF) and prohibitin. ELISA on plasma from MM patients detected significantly increased MIF levels in smoldering and active MM compared with healthy donors. Approximately half of circulating MIF was EV-associated in MM patients, indicating that MIF is distributed between vesicular and soluble plasma fractions and underscoring its potential as a noninvasive biomarker for MM early detection and patient monitoring.

Also flagged:Rheumatic heart diseaseRHDvalvular heart diseasevalvular diseaserheumatic valve diseaseMechanotransduction
Journal Article 2026-07-16 No Snippets Mai TA, Marchandot B, Hmadeh S, Nguyen HTT, Pham HM, Nguyen QN, Schini-Kerth V, Pibarot P, Morel O.
Show Full Abstract

Rheumatic heart disease (RHD) remains the leading cause of acquired valvular heart disease in low- and middle-income countries, affecting an estimated 40 million individuals and disproportionately affecting children and young adults in endemic regions. No pharmacological intervention has been shown to modify valvular disease progression in established RHD. Sodium-glucose cotransporter-2 (SGLT2) inhibitors have demonstrated cardioprotective effects across multiple cardiovascular conditions, prompting interest in their potential applicability to RHD. This hypothesis-generating review synthesizes current evidence on the molecular and cellular pathology of RHD and evaluates the mechanistic plausibility of SGLT2 inhibitor effects in this context. Evidence derived largely from non-rheumatic valve disease and experimental models suggests that SGLT2 inhibitors may attenuate oxidative stress, inflammatory cytokine signaling, transforming growth factor-β-driven fibrosis, and mitochondrial dysfunction; processes implicated in valvular remodeling. Mechanotransduction cascades and osteogenic calcification pathways, characterized primarily in calcific aortic valve disease, are biologically plausible but remain uncharacterized in RHD tissue. Whether these mechanisms are operative within the postinflammatory, immune-mediated rheumatic valve environment remains uncertain and represents an important avenue for future research. Validation of SGLT2 expression in rheumatic valve tissue, mechanistic testing in etiologically relevant models, and early-phase clinical trials tailored to endemic health system realities are essential prerequisites before any therapeutic claims can be advanced. This review outlines the translational pathway needed to determine whether this hypothesis warrants clinical development.

Also flagged:hemoglobinopathiesSickle cell diseasecancerhemoglobinopathygene expressionβ‐hemoglobinopathies
Journal Article 2026-07-16 No Snippets Yu M, Das P, Zhang X, Cheng X.
Show Full Abstract

Sickle cell disease and cancer represent fundamentally distinct classes of human disease-one is driven by a defined mutation in β-globin, whereas the other arises through complex genetic and epigenetic alterations that reshape cellular identity and behavior. Despite these differences, both contexts illustrate how transcription factors, chromatin regulators, and cis-regulatory elements can impose disease-relevant gene expression states. In β-hemoglobinopathies, therapeutic reactivation of fetal hemoglobin through modulation of γ-globin (HBG1/2) regulatory pathways, most notably disruption of the erythroid-specific BCL11A enhancer, has emerged as a clinically validated strategy. These advances have been facilitated in part by the HUDEP-2 erythroid progenitor cell line, which provides a tractable adult erythroid model for identifying fetal hemoglobin regulators, validating their function, and evaluating relevant gene editing and gene-regulatory therapies. Many of the regulators implicated in γ-globin silencing, including BCL11A, ZBTB7A, NuRD-associated proteins, DNMT1, KDM1A/LSD1, MYB, and ATF4, also function in cancer-associated transcriptional or epigenetic networks. In cancer, these factors can support oncogenic transcription, tumor suppressor repression, impaired differentiation, stress adaptation, invasion, or therapy resistance. This review summarizes discoveries enabled by HUDEP-2 cells in fetal hemoglobin regulation and hemoglobinopathy therapeutic development, then discusses how these mechanisms provide conceptual parallels for understanding and targeting regulatory dependencies in cancer.

Also flagged:pathogenesisthymic stromal lymphopoietinbaicaleinB lymphocyte kinaseB cell linkerproliferating cell nuclear antigen
Journal Article 2026-07-16 No Snippets He S, Zheng Z, Meng L, Lin L, Wang Z, Zhou J, Lin J, Yang R, Lin Y, Huang Y, Huang Z, Huang Y, Chen Y, Li L, Chen F, Dong R.
Show Full Abstract

<h4>Background & aims</h4>Hirschsprung-associated enterocolitis, a lethal complication of Hirschsprung's disease-a prevalent congenital disorder with high morbidity-has a poorly understood pathogenesis. We investigated how aberrant immune-stromal crosstalk drives mucosal injury in Hirschsprung's disease.<h4>Methods</h4>Integrated single-cell RNA sequencing, spatial transcriptomics, bulk RNA sequencing, and proteomics were performed using human Hirschsprung's disease tissues. Validation was conducted using murine Hirschsprung-associated enterocolitis (Ednrb<sup>-/-</sup>) models, flow cytometry, multiplex immunohistochemistry, in vitro B-cell stimulation, epithelial coculture, rescue experiments with the thymic stromal lymphopoietin inhibitor baicalein, and ex vivo intestinal organoid assays.<h4>Results</h4>We identified significant expansion and hyperactivation of B cells that colocalized with epithelial barrier defects in Hirschsprung's disease segments. Multiomics analysis revealed an activated phenotype in these naive and memory B cells, characterized by the upregulation of B lymphocyte kinase, B cell linker, and proliferating cell nuclear antigen, which may contribute to impaired epithelial homeostasis. Crucially, we identified profibrotic thymic stromal lymphopoietin+ fibroblasts enriched in Hirschsprung's disease. Spatial mapping and in vitro assays demonstrated that thymic stromal lymphopoietin potently activated B cells, synergizing with classical stimuli to enhance proliferation. Activated B cells, in turn, secreted proinflammatory factors, such as, ICAM1 and CCL5, which induced epithelial apoptosis, suppressed proliferation, and disrupted tight junctions-effects that were amplified by thymic stromal lymphopoietin costimulation. Activated B cells and epithelial dysfunction were conserved in Hirschsprung-associated enterocolitis (Ednrb<sup>-/-</sup>) mouse models. Coculture and ex vivo organoid experiments confirmed that thymic stromal lymphopoietin-activated B cells directly destabilized epithelial homeostasis; crucially, baicalein treatment rescued epithelial proliferation, attenuated apoptosis, and reduced inflammation-associated gene expression.<h4>Conclusions</h4>Our study reveals a novel pathogenic mechanism whereby thymic stromal lymphopoietin instigates pathogenic B-cell hyperactivation, thereby disrupting epithelial integrity and increasing susceptibility to Hirschsprung-associated enterocolitis. Inhibition of thymic stromal lymphopoietin signaling with baicalein ameliorates epithelial injury, highlighting this axis as a promising therapeutic target for Hirschsprung-associated enterocolitis prevention in patients with Hirschsprung's disease.

HTT
Also flagged:bindinggene expressionspliceosomepairinggenetic diseasesSpinal Muscular Atrophy
Journal Article 2026-07-16 ✓ 2 Snippets Kuang Z, Kosmyna B, Li X, Tang Z, Shi S, Lambert K, Zhang W, Giovinazzo J, Effenberger KA, Sierra J, Ying L, Barraza SJ, Li W, Wang J, Trotta CR, Zhao R.
In-Text Gene Mentions

…the SMN2 andHTT5′ ss suggests…

…in SMN2 orHTT, which can…

Show Full Abstract

Risdiplam and branaplam represent two classes of small-molecule splicing modulators that promote U1 snRNP recognition of weak non-canonical GA/GU-containing 5' splice sites (ss). We demonstrate that branaplam enhances recognition of these 5' ss by reconstituted U1 snRNP in vitro, and that this effect depends on the ZnF domain of U1C and Helix H of U1 snRNA, but not U1A or U1-70K. We also demonstrate that branaplam enhances the weak 5' ss recognition through a dual act of strengthening the U1 snRNP-5' ss interaction and U1 snRNP-U1C interaction. In cells, depletion of U1C reduces or abolishes compound-induced exon inclusion for most cassette exons. Interestingly, a subset of cassette exons become responsive to compound only upon U1C knockdown, supporting a model in which U1C stabilizes specific conformations at the 5' ss-U1 snRNA interface in a context-dependent manner that can either facilitate or hinder compound binding. Surprisingly, risdiplam shows no effect on weak 5' ss recognition in vitro, suggesting additional cellular factors are required for its activity.

Also flagged:nucleusresponses to heat-gene expressionproteostasiscell
Journal Article 2026-07-16 No Snippets Yu X, Shambhvi, Ceballos DA, Ferreira MM, Zapata A, Seneviratne N, Pokharel S, Fang Y, Li G, Leal Yepes FA, McFadden JW, Duan JE.
Show Full Abstract

<h4>Background</h4>Heat stress (HS) poses a major challenge to the dairy industry by reducing milk production, yet its cell type-specific effects in the bovine mammary gland remain incompletely defined. In this study, we recorded production traits and collected mammary biopsies from cows under thermoneutral (TN), HS, and pair-fed (PF) conditions.<h4>Results</h4>Clinical measurements confirmed HS-induced physiological alterations. Compared with TN cows, HS cows exhibited reduced dry matter intake (DMI), milk yield, and yields of fat, protein, and lactose, along with increased water intake and milk urea nitrogen. The use of PF controls indicated that decreased DMI accounted for 45% of the milk-yield reduction, whereas direct HS effects accounted for the remaining reduction. We applied single-nucleus RNA-seq (snRNA-seq) on mammary biopsies to generate cell-resolved HS responses. We identified 14 distinct cell clusters, including epithelial, immune, and stromal populations. Under the TN condition, casein genes (e.g., CSN1S1, CSN2) were broadly expressed across luminal cells but were attenuated under HS, whereas luminal alveolar cells showed relative upregulation. Heat shock protein genes were strongly induced by HS, primarily in epithelial clusters. Gene-set enrichment analyses revealed increased ribosomal activities across HS-responsive clusters and enrichment of protein folding and metabolic pathways in luminal alveolar cells, suggesting elevated proteostasis demands under stress. Pseudotime analysis positioned luminal cells along a progenitor-to-secretory trajectory under TN, accompanied by increased casein gene expression, whereas under HS, mature luminal cells shifted toward a homeostasis regulatory state. Cell-cell communication analysis demonstrated HS-induced remodeling of interepithelial signaling, including altered ERBB4-mediated signaling from luminal hormone-sensing to alveolar lineages. Finally, transcription factor activity profiling highlighted cell type-specific HS-activated regulators and their downstream target genes.<h4>Conclusions</h4>Together, this cell type-resolved atlas delineates how HS alters bovine mammary epithelial function, developmental state, and intercellular crosstalk. These findings point to proteostasis pressure, disrupted signaling pathways, and rewired regulatory networks as mechanistic contributors to reduced lactational performance under HS, offering insights for improving heat resilience in dairy cattle.

DCC
Also flagged:gene expressionnucleusneuronal migrationdeathaxonsinnervation
Journal Article 2026-07-16 ✓ 1 Snippet Achiwa H, Hara Y, Kawaji H, Oshima M, Kaneko N, Morioka A, Hoerder-Suabedissen A, Molnár Z, Ohtaka-Maruyama C.
In-Text Gene Mentions

…list, including Ptpn1,Dcc, Igf1r , and…

Show Full Abstract

Subplate neurons (SpNs) are among the earliest-born and maturing neurons in the developing cerebral cortex. They arise from multiple origins and can be classified into several subgroups based on morphology, connectivity, and gene expression. These neurons play essential roles in cortical circuit formation, yet their cellular diversity and transcriptional dynamics remain incompletely understood. Here, we characterized transcriptomic profiles of SpN subpopulations in embryonic mouse cortex using Lpar1-EGFP and NeuroD1/Cre-ERT2 (D1B) reporter lines. We applied complementary approaches of gene expression profiling, including bulk microarray analysis, single-cell RNA sequencing (scRNA-seq), and Visium spatial transcriptomics. At embryonic day 17 (E17), scRNA-seq identified 10 distinct Lpar1-EGFP-positive SpN clusters, which spatial transcriptomics mapped to specific cortical regions. While many markers showed enrichment within the subplate region, others extended into the hippocampus and ventral pallium (including the amygdala, claustrum, and endopiriform nucleus). Integrated analysis of Lpar1-EGFP and D1B lines revealed both overlapping and unique gene expression signatures, highlighting dynamic markers of subplate identity. Comparisons between E15 and E17 datasets showed substantial transcriptional shifts, suggesting rapid developmental changes in SpN subgroups. Validation with in situ hybridization and RNAscope confirmed the selectivity of key markers, including Cryab, Cdh13, Nr4a2, and Lmo3. Together, these findings provide a molecular framework for further classifying SpN subtypes and identifying candidate markers for transient versus persistent populations, thereby advancing our understanding of early cortical development.

Also flagged:psychosisdyslipidemiainsulin resistancetype 2 diabetestranslationalschizophrenia spectrum disorders
Journal Article 2026-07-16 No Snippets Cheung N.
Show Full Abstract

Antipsychotic-associated metabolic toxicity remains one of the most persistent clinical problems in psychopharmacology. Clozapine and olanzapine are especially effective for psychosis but carry high liability for weight gain, dyslipidemia, insulin resistance, and type 2 diabetes. Current monitoring recommendations recognize this risk, yet they remain largely uniform across patients and do not incorporate ancestry-specific genetic risk or mechanistic drug-gene information. We performed a transcriptome-wide association study-informed drug-gene prioritization analysis to examine whether approved antipsychotic target genes overlap with genes whose genetically predicted expression is associated with type 2 diabetes. The analysis used ancestry-specific type 2 diabetes transcriptome-wide association study (TWAS) results derived from a multi-ancestry genome-wide association study (GWAS) and approved antipsychotic drug-gene interactions from the Drug-Gene Interaction Database (DGIdb). For each drug, target genes were matched to TWAS genes across six metabolic tissues, and a weighted risk score was calculated as the sum of the absolute TWAS z-score multiplied by the drug-gene interaction score for significant targets. Follow-up analyses decomposed signals into targets with positive and negative TWAS directions, operationally interpreted as aggravating and compensatory, while also examining curated metabolic axis genes including GLP1R, GIPR, PPARG, and SLC2A4. The analysis identified recurrent exploratory target-overlap signals for clozapine and olanzapine. Clozapine showed the most consistent cross-ancestry aggravating profile, with recurrent target overlap involving GLP1R and immune-related genes. Olanzapine showed strong mechanistic-axis overlap involving GLP1R, GIPR, and PPARG, although its simple TWAS directionality was often classified as compensatory. Trifluoperazine emerged as a notable candidate, with significant target enrichment in the European ancestry analysis and top ranking in the Hispanic analysis. Fluspirilene also met the combined enrichment false discovery rate threshold in the European ancestry analysis, although its clinical metabolic interpretation was less direct. Haloperidol decanoate showed a high burden driven partly by SLC2A4, but its directionality was frequently mixed or compensatory. These findings nominate the incretin axis as a plausible translational bridge between antipsychotic metabolic liability and existing interventions such as GLP-1 receptor agonists. They also identify a key methodological gap. Future models must incorporate the pharmacologic mode of action to distinguish receptor blockade from activation. Except for the enrichment-positive European ancestry findings for trifluoperazine and fluspirilene, the results are exploratory prioritization signals and do not establish drug-specific metabolic effects, causal mechanisms, or ancestry-specific treatment effects. Overall, this TWAS-informed analysis provides a hypothesis-generating framework for ancestry-aware metabolic monitoring and targeted validation studies.

Also flagged:AMLacute myeloid leukemiadegradationbindingpathogenesisadult leukemia
Journal Article 2026-07-16 No Snippets Elmenier FM, Dokla EME, Samir N, Lasheen DS, Abouzid KAM, Abou El Ella DA.
Show Full Abstract

FMS-like tyrosine kinase 3 (FLT3) is a key driver of acute myeloid leukemia (AML); mutations within FLT3, specifically ITD lesions and TKD point mutations, promote proliferation and are associated with poor prognosis. Although FLT3 inhibition is central to AML therapy, resistance, particularly <i>via</i> D835 activation-loop variants and the F691L gatekeeper substitution, limits durability. Among the major therapeutic classes, type I inhibitors bind the active (DFG-in) conformation, whereas type II inhibitors stabilize the inactive (DFG-out) state. In contrast, irreversible covalent inhibitors target reactive cysteine residues within the kinase domain. Collectively, these approaches represent complementary therapeutic strategies with distinct resistance liabilities and structural design considerations. This review integrates structural biology with medicinal-chemistry evidence across type I, type II, irreversible, and dual-modality FLT3 inhibitors, analyzing how hinge contacts, back-pocket occupancy, and warhead placement govern activity across wild-type and mutant FLT3. We map resistance-defining residues (<i>e.g.</i> F691, D835, N676, N701) and design tactics to preserve potency against resistant variants. We also summarize combination therapy that augments selective FLT3 blockade and outline PROTAC approaches that induce FLT3 degradation, positioning these modalities as alternatives when single-molecule polypharmacology is constrained. Finally, we catalogue dual-target FLT3 chemotypes, highlighting examples that retain activity against F691L and D835 in cellular systems and xenografts. Overall, this review provides a section-by-section guide covering FLT3 structure and mutation hotspots, analyses of type I, type II, and irreversible inhibitors, dual-modality designs, combinations, PROTACs, and future perspectives. It links binding mode, covalent engagement, and second-target selection to recurrent resistance biology to guide more resilient FLT3-targeted therapies for high-risk AML.

Also flagged:ferroptosisPancreatic cancertumordeathdoxorubicinoxygen
Journal Article 2026-07-16 No Snippets Yang P, He S, Xu M, Sun Y, Gao J, Chen J, Niu T, Hao L.
Show Full Abstract

Pancreatic cancer responds poorly to conventional chemotherapy, largely because of the pronounced resistance of tumor cells to chemotherapy-induced apoptosis. Ferroptosis, a non-apoptotic form of programmed cell death, has emerged as a promising strategy to overcome this resistance. However, its therapeutic efficacy is often limited by insufficient hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) and excessive glutathione (GSH) in the tumor microenvironment (TME). Herein, we developed a nanoplatform, HM-MnO<sub>2</sub>@DOX/CaO<sub>2</sub>@PDA/HA (HMDCPH), using hollow mesoporous manganese dioxide (HM-MnO<sub>2</sub>) as a carrier to co-deliver doxorubicin (DOX) and calcium peroxide (CaO<sub>2</sub>). The crosslinked PDA/HA shell enhanced both the tumor-targeting capability and biocompatibility of the nanoplatform. In the TME, HM-MnO<sub>2</sub> depleted GSH and promoted reactive oxygen species (ROS) generation, whereas CaO<sub>2</sub> decomposition generated H<sub>2</sub>O<sub>2</sub> and released Ca<sup>2+</sup>, inducing mitochondrial calcium overload and further aggravating oxidative stress. These synergistic effects enhanced lipid peroxidation (LPO) and exacerbated ferroptosis-related oxidative damage. Moreover, the near-infrared (NIR)-triggered photothermal effect further strengthened the antitumor efficacy of HMDCPH. In addition, nanoplatform degradation released Mn<sup>2+</sup>, enabling T<sub>1</sub>-weighted magnetic resonance imaging (MRI). Collectively, this study presents a synergistic nanotherapeutic strategy that integrates chemotherapy, photothermal therapy, and ferroptosis-related mechanisms to overcome chemoresistance in pancreatic cancer.

DCC
Also flagged:Diffuse Large B-Cell LymphomaHIV InfectionDLBCLtumorsgene expressiontumor
Journal Article 2026-07-16 ✓ 1 Snippet Labiad Y, Baier C, Genin M, Besson C, Prevot S, Lepidi H, Costello R.
In-Text Gene Mentions

…(FRA3B), WWOX (FRA16D),DCC(FRA18B) and PARK2…

Show Full Abstract

<b>Objectives:</b> Transcriptomic profiling has enabled the classification of Diffuse Large B-Cell Lymphoma (DLBCL) into distinct subtypes, such as Germinal Center B-cell-like (GCB) and Activated B-cell-like (ABC), primarily in HIV-negative patients. However, HIV-associated DLBCL may follow different molecular mechanisms due to immune dysregulation. This study aimed to characterize the transcriptomic landscape of HIV-related DLBCL to identify distinct subtypes and deregulated pathways with potential theranostic implications. <b>Methods:</b> Twelve formalin-fixed, paraffin-embedded DLBCL samples from HIV-positive patients were analyzed using Agilent's microarray. Quantile normalization and unsupervised hierarchical clustering were performed to classify tumors based on gene expression profiles. <b>Results:</b> Two distinct transcriptomic subgroups were identified. <i>TP53</i> and <i>BCL7A</i> were overexpressed in cluster I, while <i>BCL2</i> was overexpressed in cluster II. Notably, the "immune system development" pathway was under expressed in cluster I compared to cluster II. <b>Conclusions:</b> Our findings reveal two molecularly distinct subtypes of HIV-associated DLBCL, likely driven by differences in tumor microenvironment and immune status. These transcriptomic profiles may guide future targeted therapies. Further validation in larger cohorts and integration with proteomic and clinical data are warranted to develop a comprehensive theranostic framework.

DCC
Also flagged:Depressionspinesynapseorganizationchromatinsleep
Journal Article 2026-07-16 ✓ 1 Snippet Zeng W, Yang X, Xu Y.
In-Text Gene Mentions

…CENPW, TCF4, andDCC.…

Show Full Abstract

<b>Background:</b> Depression-related liability is frequently accompanied by reduced physical function, yet the shared genetic architecture linking mood-related traits and physical-function decline remains incompletely characterized. <b>Methods:</b> We applied genomic structural equation modeling to European-ancestry GWAS summary statistics for five constituent phenotypes: depressive symptoms, depression diagnosis, grip strength, appendicular lean mass, and walking pace. A Depression-Physical Function shared genetic factor was constructed as a cross-trait genetic covariance dimension and evaluated using LDSC-based validation and leave-one-trait-out sensitivity analyses. We then performed factor GWAS, FUMA locus annotation, Bayesian fine-mapping, MAGMA gene-based analysis, transcriptome-wide association analysis, pathway enrichment, CELLECT/MAGMA cell-type specificity analysis, partitioned heritability analysis, and gsMap spatial transcriptomic mapping. <b>Results:</b> The shared factor showed good model fit and retained 755,397 quality-controlled variants for downstream analysis. The factor was positively genetically correlated with depression-related traits and negatively correlated with physical-function-related traits. FUMA identified 245 genome-wide significant SNPs, 44 lead SNPs, and 38 genomic risk loci, with 127 positional mapped genes. Fine-mapping prioritized one high-confidence locus. MAGMA identified 19 Bonferroni-significant genes and 326 FDR-significant genes, while TWAS identified 322 FDR-significant expression-associated genes. Integrating FUMA positional mapping, MAGMA gene-level association and TWAS expression-level association prioritized eight convergent genes: TMEM106B, CENPW, DRD2, LRFN5, NCAPG, DCAF16, SGIP1, and FAM120A. Functional enrichment highlighted postsynaptic structure, neuron spine, synaptic plasticity, and synapse organization. CELLECT/MAGMA prioritized brain non-myeloid neurons and glial populations, with additional endocrine-metabolic and immune-hematopoietic signals. Spatial transcriptomic mapping localized top signals to brain and spinal cord regions in the embryonic neuro-muscle reference. Partitioned heritability analysis showed enrichment in conserved, intronic, promoter, and chromatin-related genomic annotations. <b>Conclusions:</b> These findings support a shared polygenic covariance dimension linking depression-related liability with reduced physical-function-related genetic propensity. Downstream analyses prioritized candidate loci, genes, and biological contexts, with enrichment patterns consistent with neuronal, synaptic, and regulatory genomic processes.

HTT
Also flagged:Autismautism spectrum disordersynaptic transmissionbindingneurodevelopmental disordergene expression
Journal Article 2026-07-16 ✓ 5 Snippets Zheng G, Wang L, Wang G, Zhang Y, Han X, Qiu G, Sun Y, Pei L, Wu S, Li H.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT) ( Figure 9…

…the interactions with5-HTT, APP, PTGS2 and…

…region of the 5-HTTgene, such as…

…levels, thereby inhibiting5-HTTexpression [ 43…

…binding to the5-HTTprotein or changing…

Show Full Abstract

Early childhood exposure to bisphenol A (BPA) is closely associated with autism spectrum disorder (ASD), though the precise molecular mechanisms remain unclear. To investigate this, we employed an integrated computational approach combining network toxicology, molecular docking, and molecular dynamics simulation. Potential targets of BPA and ASD-related genes were collected from multiple databases, identifying 57 overlapping targets. Protein-protein interaction network analysis highlighted 16 core targets among them. Gene Ontology and KEGG pathway enrichment analyses indicated these targets are primarily involved in synaptic transmission, GABAergic signaling, and neuroactive ligand-receptor interactions. Molecular docking demonstrated potential binding between BPA and several core targets, including estrogen receptor 1 (ESR1), gamma-aminobutyric acid type A receptor subunit beta-2 (GABRB2), and amyloid precursor protein (APP), with binding energies below -5 kcal/mol. The stability of the BPA-ESR1 complex was further supported through 100 ns molecular dynamics simulation. These results suggest that BPA may contribute to ASD by disrupting neuroendocrine pathways and synaptic function via interactions with key targets such as ESR1.

SERPINC1
Also flagged:Cervical NeoplasiaInvasive Cancercervical lesionscervical diseaseinvasive squamous cell carcinomacoagulation
Journal Article 2026-07-16 ✓ 3 Snippets Yurin AM, Starodubtseva NL, Bugrova AE, Kononikhin AS, Silachev DN, Frankevich VE, Tokareva AO, Indeykina MI, Evtushenko EA, Yakovlev AA, Mezhevitinova EA, Nikolaev EN, Nazarova NM, Prilepskaya VN, Chernyshev VS, Sukhikh GT.
In-Text Gene Mentions

…in HSIL samples:Antithrombin-III(SERPINC1), an inhibitor…

…IL samples: Antithrombin-III (SERPINC1), an inhibitor of…

…two enriched proteins (SERPINC1, TTR) and five…

Show Full Abstract

Human papillomavirus (HPV)-associated cervical lesions remain a significant disease burden and minimally invasive blood-based biomarkers could complement cytology and HPV testing. This study aimed to characterize the proteomic composition of plasma-derived CD9<sup>+</sup> small extracellular vesicles (sEVs) across the morphological spectrum of HPV-associated cervical disease, from histologically normal (NILM) through low-grade (LSIL) and high-grade (HSIL) lesions to invasive squamous cell carcinoma (SCC). Plasma samples from 34 women (NILM, LSIL, HSIL, SCC) were pooled per group, and CD9<sup>+</sup> sEVs were isolated using an electrochemically controlled immunoaffinity capture method, followed by nanoparticle tracking analysis, transmission electron microscopy, Western blotting, and label-free LC-MS/MS proteomic profiling. The core sEV proteome comprised 258 shared proteins. LSIL showed the most pronounced changes with broad enrichment of complement and coagulation components and acute-phase reactants alongside depletion of immunoglobulin chains and complement C1r-like protein (C1RL). HSIL exhibited few differential proteins, dominated by neutrophil degranulation and retinoid metabolism pathways. SCC demonstrated extensive cargo depletion (22 downregulated proteins) and a nearly sevenfold upregulation of C1RL. Five proteins (including immunoglobulin chains and GPLD1) correlated positively with lesion severity. Pathway analysis consistently implicated platelet activation, lipoprotein remodeling, and insulin-like growth factor signaling. We conclude that plasma CD9<sup>+</sup> sEVs carry stage-specific proteomic signatures distinguishing HPV-associated cervical lesions, with C1RL emerging as a candidate biphasic marker warranting further validation.

MMS22L
Also flagged:Lactation-ribosomecell cyclephosphorylationReverse transcription
Journal Article 2026-07-16 ✓ 4 Snippets Mu T, Qiao Z, Hu H, Ma Y, Jiang Z, Huang Y, Sun Z.
In-Text Gene Mentions

…and previous reports,MMS22Land NCAPG were…

…phenotypes showed thatMMS22L, CCNE 2,…

MMS22Lwas significantly enriched…

…FPP, PIGO, CCNE2,MMS22L, and SLC25A25 were…

Show Full Abstract

Lactation traits are important indicators for evaluating the production performance of dairy cows and the economic efficiency of dairy production. Identifying potential regulatory genes is essential for elucidating the molecular mechanisms underlying lactation and facilitating molecular breeding. This study aimed to identify candidate genes and regulatory pathways potentially associated with lactation traits in dairy cows by integrating transcriptome expression profiles of primary bovine mammary epithelial cells (BMECs) from eight Holstein cows with lactation phenotypic data. A gene co-expression network was constructed using weighted gene co-expression network analysis (WGCNA). Co-expression modules associated with lactation traits were identified, and candidate genes were further screened by integrating gene significance, module membership, functional enrichment analysis, random forest analysis, gene-phenotype association analysis, single-gene gene set enrichment analysis (GSEA), ROC curve analysis, and tissue expression profiling. Four co-expression modules, namely MEdarkturquoise, MEsteelblue, MEbrown, and MEskyblue3, were significantly associated with lactation traits (<i>p</i> < 0.05). Genes in these modules were mainly enriched in biological processes and pathways related to ribosome biogenesis, protein translation, the cell cycle, oxidative phosphorylation, and the PI3K-Akt signaling pathway, which may be involved in lactation regulation. Through multi-strategy cross-screening, four candidate genes were ultimately identified. <i>MDM</i>2 was associated with daily milk yield (DYM), <i>RPL37</i>A with total milk solids (TMS), and <i>SLC25A</i>25 and <i>CCNE</i>2 with milk fat percentage (MFP) and fat-to-protein percentage ratio (FPP). Reverse transcription quantitative real-time PCR (RT-qPCR) validation showed that <i>MDM</i>2 and <i>RPL37A</i> were relatively highly expressed in mammary tissue, suggesting that they may be involved in lactation-related biological processes in dairy cows. These findings provide potential candidate regulators and theoretical support for further studies on the molecular mechanisms of lactation traits; however, their functional roles require further validation through in vitro and in vivo experiments.

Also flagged:Amino acidinfectionsmembranesextracellularquaternary ammoniumsynthesis
Journal Article 2026-07-16 No Snippets Bezerra RG, Pérez L, de Sousa FFO.
Show Full Abstract

Antimicrobial therapy is becoming increasingly ineffective over infections due to the gradual microbial resistance to conventional treatments. This aspect highlights the urgent need for the development of new antimicrobial agents. In this context, the amino acid-derived surfactants have proven to be a promising alternative to eradicate numerous microorganisms and their biofilms. The antimicrobial action of these agents can be explained by their amphiphilic structure, a configuration that allows interactions with structural components, such as the microorganism membranes and extracellular matrices of biofilms, promoting destructive effects on the cellular integrity and microbial vital processes. In addition, these surfactants can be easily synthesized using green chemistry principles, are biodegradable and more biocompatible than commercial quaternary ammonium surfactants. This paper aimed to elucidate the relevance of amino acid-derived surfactants with antimicrobial properties, presenting their structural compositions and connecting to the novel evidences on their mechanism of action. An integrative review was conducted, drawing upon findings from scientific articles published in the last 20 years (between 2005 and 2025), exclusively in English, retrieved from the PubMed database. This research employs a qualitative approach, adopting a basic research design with descriptive objectives, using a bibliographic method to explore the topic. The results indicate that the search for new amino acid-derived surfactants with antimicrobial activity has gradually grown over the last years. These molecules have shown promising characteristics, singular structures leading to innovative mechanisms of action, capable of overcoming the defenses of resistant microorganisms. In conclusion, the ability of these compounds to inhibit the growth of bacteria, yeasts, and fungi has been demonstrated, offering an effective approach to prevent and combat the spread of infections, especially in the context of microbial resistance.

HTT
Also flagged:transcytosisphosphorylationneurodegenerative diseasesNeurodegenerative DiseaseParkinson DiseaseAmyotrophic Lateral Sclerosis
Journal Article 2026-07-16 ✓ 2 Snippets Zhao X, Sun L, Zhang X, Qi X, Wu G, Wu G.
In-Text Gene Mentions

…expansion in theHTTgene, leading to…

…repeats in theHTTprotein and resulting…

Show Full Abstract

The blood-brain barrier (BBB) blocks most drugs from entering the brain. Over 98% of small-molecule drugs and nearly all biologics fail to cross this barrier. Nanoparticles (NPs) provide multiple ways to bypass the BBB. These include receptor-mediated transcytosis, adsorptive-mediated transport, and intranasal delivery. NPs can also modify disease-related pathways. For example, they promote amyloid-β clearance, reduce tau phosphorylation, and reprogram neuroimmune responses. Many preclinical studies have shown promising results in Alzheimer's, Parkinson's, and Huntington's diseases. However, no NP-based therapy has moved beyond early-stage clinical trials. Several issues remain unresolved. Direct comparisons between different NP platforms are lacking. The long-term toxicity of NPs in the brain is not well understood. Animal models also do not accurately reflect human disease. We suggest that future work should focus on standardized characterization, better predictive models, and clinical trial designs that address NP diversity. Researchers should also compare NP therapies with existing treatments in a rigorous manner.

OLFM4
Also flagged:sepsistranslationalacute lung injurymodificationsmethylationhistone modifications
Journal Article 2026-07-16 ✓ 1 Snippet Wei J, Xiong R, Zhang T, Liang F, Chen J, Zhao Y, Huang Y, Huang Z, Peng C.
In-Text Gene Mentions

…(DEGs) including BPI,OLFM4, LCN2, CD24, MMP8,…

Show Full Abstract

Sepsis-induced acute lung injury (SI-ALI) remains a leading cause of mortality in critical care, characterized by complex pathophysiology and substantial patient heterogeneity that challenge conventional diagnostic and therapeutic approaches. Precision medicine, which tailors prevention, diagnosis, and treatment strategies to individual patient characteristics, offers a promising avenue to improve outcomes in this condition. This review focuses on the pivotal role of epigenetic modifications-including DNA methylation, histone modifications, and non-coding RNAs-in the pathogenesis and progression of SI-ALI. We comprehensively summarize recent advances in understanding how these epigenetic mechanisms contribute to disease heterogeneity and influence clinical trajectories. Furthermore, we highlight the emerging potential of epigenetic biomarkers as tools for risk stratification, prognostic evaluation, and guidance of targeted therapeutic interventions in SI-ALI. By integrating current research findings, this article aims to establish a novel theoretical framework and translational direction for the precision management of SI-ALI, ultimately facilitating the development of personalized treatment strategies to address the unmet clinical needs in this critical condition.

HTT
Also flagged:behavioralneurodegenerative movement disorderHDautosomal-dominant neurodegenerative disordercognitive declinecognition
Journal Article 2026-07-16 ✓ 1 Snippet Delussi M, Ladisa E, Ammendola E, Paparella G, Abbatantuono C, Tancredi G, Paparella G, Brattico E, de Tommaso M.
In-Text Gene Mentions

…expansion in theHTTgene, leading to…

Show Full Abstract

<h4>Background</h4>Huntington's disease is a rare neurodegenerative movement disorder characterized by early disruption of frontostriatal systems, affecting motor, cognitive, and affective domains. Non-invasive brain stimulation targeting prefrontal networks may offer a means to modulate these distributed systems, although controlled evidence in Huntington's disease remains limited, particularly for accelerated stimulation protocols.<h4>Objective</h4>To investigate whether accelerated intermittent theta-burst stimulation (iTBS) applied to the dorsolateral prefrontal cortex is associated with behavioral, motor and electrophysiological changes reflecting modulation of prefrontal network function in early-stage Huntington's disease.<h4>Methods</h4>Ten patients with genetically confirmed Huntington's disease participated in a within-subject, fixed-order longitudinal study, which included a sham exposure phase followed by active stimulation. Assessments were conducted at baseline (T0), after sham stimulation (T1), after active accelerated iTBS (T2), and at 60-day follow-up (T3). Clinical scales for motor impairment, behavioral measures targeting executive, affective, and social-cognitive domains were combined with event-related potentials (ERPs) recorded during cognitive and emotional Stroop tasks. The fixed-order design was chosen to minimize potential carry-over effects associated with accelerated stimulation protocols.<h4>Results</h4>No significant behavioral or electrophysiological changes were observed during the sham exposure phase. In contrast, active iTBS was associated with domain-specific behavioral changes, particularly in affective, executive, and social-cognitive domains, accompanied by changes in event-related potential activity, particularly within delayed N200-related responses during emotional interference. Effects were domain-specific and were not associated with normalization of electrophysiological latency profiles. Motor scales were not modified by either sham or real stimulation.<h4>Conclusion</h4>Accelerated prefrontal iTBS was associated with behavioral and electrophysiological changes following active stimulation of prefrontal network in Huntington's disease. These findings support the feasibility of targeting distributed non-motor circuits in HD and designs accounting for cumulative and time-dependent effects of stimulation in early-phase neuromodulation studies.

medRxiv 2026-07-16 Preprint (No Snippets API) Li L, Tang Z, Zhong Z, Geng T, Guo Y, Liao Y, Demirkan A, Bowden J, Bragg F, Pan A, Sun X, Liu J, Liu G, Liu J.
Show Full Abstract

Multimorbidity is highly prevalent in ageing populations, yet its shared molecular basis remains poorly defined, limiting the development of therapies that target multiple conditions. We systematically integrated measurements of 1,954 circulating proteins from 54,219 individuals in discovery and 35,559 in replication, focusing on ten common age-related diseases: coronary artery disease, chronic kidney disease, chronic obstructive pulmonary disease, dementia, heart failure, major depressive disorder, osteoarthritis, Parkinson’s disease, stroke, and type 2 diabetes. Coronary artery disease emerged as a central condition in the multimorbidity network, sharing circulating protein signatures with seven other diseases. Through genetic causal-inference analyses, we identified 40 circulating proteins with cross-disease relevance, of which four were further supported by colocalization of genetic variant associations. Among these, complement C1r, encoded by C1R, emerged as a key link between coronary artery disease and dementia, supported by independent colocalization evidence (PP.H4 = 0.86). Phenome-wide association analyses of C1R variants suggested that this signal was not driven by widespread unrelated genetic effects, but instead may reflect a more specific contribution to coronary artery disease–dementia pathogenesis. In vitro experiments further suggested that fibroblast-derived C1R promotes endothelial inflammation and neuronal apoptosis, providing mechanistic plausibility. Together, these findings position C1R as a biologically plausible and therapeutically relevant molecular link between coronary artery disease and dementia.

CACNA1E
Also flagged:behavioralribosometranslationalsynaptic transmissionmetabolismphosphorylation
Journal Article 2026-07-15 ✓ 1 Snippet Jeong M, Jang JH, Oh SJ, Choi JW, Oh YS.
In-Text Gene Mentions

…, Cacna1d ,Cacna1e, Cacna2d2 ,…

Show Full Abstract

Hilar mossy cells (MCs) are crucial for integrating and propagating signals across the hippocampal dorsoventral axis, mediating cognitive and affective processing. While MCs exhibit profound dorsoventral differences in their projections, physiology, and behavioral roles, the molecular basis underlying this functional specialization remains largely unexplored. To address this gap, we used translating ribosome affinity purification (TRAP) in male mice to systematically compare the translatome of <i>Drd2</i>-expressing, MC-enriched populations along the dorsoventral axis. This analysis revealed distinct translational signatures with 1,442 genes enriched in dorsal and 1,337 genes in ventral <i>Drd2</i>-expressing, MC-enriched populations. Pathway analysis demonstrated significant functional segregation along the dorsoventral axis. The dorsal population is notably enriched for genes linked to neuronal connectivity and synaptic transmission, whereas the ventral counterpart shows enrichment in genes associated with energy metabolism and cellular maintenance. Specifically, we identified a subset of dorsal enriched genes, including neurotransmitter receptors, ion channels, and axon guidance regulators, contrasting with ventral enriched genes highly related to glucose/fatty acid metabolism, oxidative phosphorylation, and exocytosis. We further predicted distinct sets of upstream transcriptional regulators activated in each subpopulation, providing insights into the regulatory networks that may drive molecular divergence. Our findings provide a translatomic basis for the dorsoventral heterogeneity of Drd2-expressing neurons that include MCs, offering molecular signatures associated with their differential contributions to hippocampal function.

Also flagged:follicular thyroid neoplasmtrabecular tumorNIFTPthyroid noduletumorsneoplasms
Journal Article 2026-07-15 No Snippets Kanematsu R, Hirokawa M, Suzuki A, Higuchi M, Usuki S, Kamma H, Akamizu T.
Show Full Abstract

<h4>Background</h4>The coexistence of hyalinizing trabecular tumor (HTT) and areas with a morphology of noninvasive follicular thyroid neoplasm with papillary-like nuclear features (NIFTP) within a single thyroid nodule has not been previously reported. We aimed to determine whether such tumors represent two independent neoplasms or a single tumor exhibiting divergent morphology.<h4>Methods</h4>Ten tumors containing both HTT and NIFTP-like areas were examined. The term "NIFTP-like" was used strictly as a descriptive morphological designation for areas that fulfill the histologic criteria of NIFTP. Immunohistochemical analyses of Ki-67 (MIB-1) and type IV collagen and targeted molecular testing were performed. Ten NIFTPs, 10 follicular adenomas, and three HTTs were used as controls.<h4>Results</h4>HTT components consistently showed characteristic membranous Ki-67 staining and intra-trabecular type IV collagen deposition, whereas NIFTP-like areas lacked these features, except for focal apical Ki-67 staining. Intranuclear cytoplasmic inclusions in HTT were positive for type IV collagen. NIFTPs showed neither membranous Ki-67 nor intra-trabecular type IV collagen. Molecular analysis demonstrated identical profiles between HTT components and NIFTP-like areas: three tumors harbored PAX8::GLIS3 fusions, and none showed RAS mutations. Pure HTT controls exhibited the same pattern.<h4>Conclusions</h4>Our findings indicate that these follicular-patterned areas represent a morphological variant within the spectrum of HTT rather than a true NIFTP-related component or two separate neoplasms. These findings expand the recognized histologic diversity of HTT and highlight a potential diagnostic pitfall in follicular-patterned thyroid tumors. Focal apical Ki-67 staining may serve as a useful clue for distinguishing HTT from NIFTP.

HFE
Also flagged:nucleotideamino acidPVS1PS1PS2PS3
Journal Article 2026-07-15 ✓ 1 Snippet Arda İnan R, Kayaalp B, Safieh F, Ece Kars M, Stein D, Cooper DN, Stenson PD, Konu Ö, Casanova JL, Itan Y, Nazlı Başak A, Özçelik T.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Purpose</h4>Classification of DNA sequence data requires the implementation of the American College of Medical Genetics and Genomics (ACMG) standards and guidelines. Therefore, automated tools have been developed. However, these tools often lack robust and up-to-date methodologies. This study reports on the development of a new tool and examines its performance for diagnostic and research purposes.<h4>Methods</h4>The automated ACMG-based variant classifier (AAVC) presented here computationally analyzes sequence variants following the ACMG guidelines, the Clinical Genome Resource specifications and a novel framework by leveraging large public databases and in silico prediction tools.<h4>Results</h4>AAVC demonstrated high concordance (94.39%) with the Food and Drug Administration recognized variant classifications, outperforming currently available tools. It classified 55% of the variants of uncertain significance in clinical variation into clinically significant categories. We identified, in the Turkish Variome, 215 novel pathogenic, likely pathogenic, or variants of uncertain significance high variants in the secondary finding genes and revealed that 1 in 10 individuals carried an actionable genotype.<h4>Conclusion</h4>AAVC constitutes a robust framework for the accurate classification of human germline sequence diversity is available at https://aavc.bilkent.edu.tr/, offering a highly accurate, rapid, and up-to-date platform for clinical laboratories and research groups to automatically interpret sequence variants.

DCC
Journal Article 2026-07-15 ✓ 1 Snippet Dockerill M, Payne RJ, Winssinger N.
In-Text Gene Mentions

…Thrombin Inhibitor UsingDCC.…

Show Full Abstract

Dynamic combinatorial chemistry (DCC) offers a powerful yet underutilized strategy for ligand discovery, largely limited by heterogeneous kinetic constraints in exchange reactions and analytical challenges. Here we report a peptide nucleic acid (PNA)-templated trivalent DCC platform that enables rapid, target-guided exploration of 125 000 assemblies to identify ultrahigh-affinity and reversible thrombin inhibitors. Short hybridization handles allow unbiased equilibration of a three-fragment library, and size-exclusion filtration combined with matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) provides a complete selection-readout cycle in under 1 h. From this library, thrombin amplifies synergistic fragment combinations engaging the active site and both exosites, yielding a trivalent inhibitor with apparent sub-picomolar affinity (K<sub>D</sub> ≈ 84 fM) and near-stoichiometric inhibition. Despite its extreme potency, inhibition remains fully reversible: addition of a single-stranded toehold antidote rapidly disassembles the complex and restores activity in buffer and in plasma. These results establish hybridization-guided DCC as a fast, scalable route to programmable multivalent therapeutics with on-demand reversibility.

Also flagged:degenerative disordersstrokebindingpsychiatric disordersgene expressionnucleus
Journal Article 2026-07-15 No Snippets Georges K, Krogsbaek M, Jensen SN, Als TD, Thorsen K, Busch JR, Banner J, Nyengaard JR.
Show Full Abstract

Human brain bank material offers a great potential for studying a wide range of diseases from psychiatric to degenerative disorders, stroke, and pain. Historically, the primary limitation has been the technical usability of long-term formalin fixed and stored tissue samples with inadequate RNA quality. However, new and emerging, highly sensitive techniques now enable the study of the human transcriptome in autopsied brain material. This study aimed to develop a protocol for analysing RNA expression in two distinct cell populations within a spatial context from long-term formalin fixed human hypothalamus samples from the Danish SURVIVE study, using the GeoMx Digital Spatial Profiler from NanoString. RNAscope assays were used to optimize target retrieval, followed by evaluation with QuPath quantification to determine optimal RNA binding conditions. Optimal RNA availability was achieved with baking the slides at 60 °C for 1 h, followed by 30 min of 99 °C heat-induced target retrieval while maintaining tissue integrity. Subsequently, tissue was stained for either microglia or neurons with Iba1 and CRH specific antibodies and analysed in the GeoMx Digital Spatial Profiler. Whole transcriptome probes within the Iba1 and CRH segments were sequenced on the Illumina NovaSeq platform. The novel bioinformatic tool StandR was used for quality control and data analysis. The two cellular segments were compared, and we found 932 differentially expressed genes: 317 upregulated in the CRH segment, and 615 upregulated in the Iba1 segment. This paper presents a detailed workflow and highlights the ability to obtain relevant transcriptomic information from long-term fixed human brain tissue.

BTN2A1
Also flagged:oral squamous cell carcinomaOSCCtumorferroptosisextracellularhead and neck squamous cell carcinoma
Journal Article 2026-07-15 ✓ 2 Snippets Tang W, Hu S, Wu J.
In-Text Gene Mentions

BTN2A1and CD276 were…

…positive correlations ofBTN2A1and CD276 with…

Show Full Abstract

Radiotherapy resistance remains a major obstacle in the treatment of oral squamous cell carcinoma (OSCC). This study aimed to identify radiotherapy-associated prognostic biomarkers and explore their functional relevance in OSCC. Integrated single-cell RNA-seq analysis, TCGA-based bulk transcriptomic analysis, Scissor analysis, hdWGCNA, and random survival forest modeling identified a four-gene risk signature comprising KPNA2, P4HA1, ARL6IP1, and TUBA1B. The model effectively stratified patients into high- and low-risk groups and showed prognostic value in both the TCGA-OSCC training cohort and the GSE41613 validation cohort. Immune infiltration, immune checkpoint, malignant subclustering, pseudotime, CellChat, and virtual knockout analyses further suggested that these genes were associated with tumor immune remodeling, malignant cell heterogeneity, oxidative stress, ferroptosis, and extracellular matrix-related pathways. Immunohistochemical validation showed that KPNA2, P4HA1, ARL6IP1, and TUBA1B were upregulated in OSCC tissues, particularly in radioresistant OSCC tissues. In vitro, HSC-3 and SCC9 cells exhibited relatively stronger radioresistance, and siRNA-mediated knockdown of these genes in SCC9 cells enhanced irradiation-induced suppression of metabolic activity, colony formation, and invasion. Collectively, these findings suggest that KPNA2, P4HA1, ARL6IP1, and TUBA1B may serve as prognostic biomarkers and potential therapeutic targets for overcoming OSCC radioresistance.

Also flagged:autoimmune diseasesrheumatoid arthritisconjugationbinding
Journal Article 2026-07-15 No Snippets Lin L, Mitchell TR, Sanches K, Abdallah M, Ren Y, Farooq MA, Song H, Qu J, Chen Z, De Nardo W, McCague R, Naseem MU, Panyi G, Babu Reddiar S, Wai DCC, Norton RS, Trevaskis NL.
Show Full Abstract

Upregulation of the voltage-gated potassium channel K<sub>V</sub>1.3 in effector memory T cells has been implicated in several autoimmune diseases, making selective K<sub>V</sub>1.3 blockade an attractive therapeutic strategy. HsTX1[R14A], a 34-residue peptide with picomolar potency and high selectivity for K<sub>V</sub>1.3, is effective in a rodent model of rheumatoid arthritis. However, the in vivo half-life of HsTX1[R14A] can be improved to enhance its potential as a therapeutic candidate. Here we explore how conjugation to C14, C16 or C18 acyl chains affects HsTX1[R14A] binding to serum albumin and lipoproteins, potency at K<sub>V</sub>1.3, pharmacokinetics (PK), and biodistribution to key organs, tissues, and lymph nodes. The fluorophore Cy5 was conjugated to the HsTX1[R14A] analogs for biodistribution studies. LC-MS/MS assays were developed to quantify the lipidated peptides in mouse plasma. Conjugation of palmitic and stearic acids to HsTX1[R14A] caused over 20-fold loss in potency but significantly enhanced its binding to albumin, while showing minimal association with plasma lipoproteins. This modification extended the plasma exposure by 9-fold and prolonged the elimination half-life by 2-fold after subcutaneous (SC) injection to mice. Biodistribution studies demonstrated that Cy5-labelled lipidated analogs enhanced accumulation at the dosing site and draining lymph nodes at 4 and 12 h after SC injection compared to Cy5-HsTX1[R14A]. Cy5-labelled lipidated analogs of HsTX1[R14A] also accumulated in the gastrointestinal tract more than HsTX1[R14A], while having significantly less exposure in the kidneys at 4 and 12 h after SC administration. Thus, lipidation is a promising approach to optimize the PK, biodistribution and therapeutic potential of HsTX1[R14A].

HFE
Also flagged:mitochondrialMendelian disordersinherited diseasesdeathCOVID-19hereditary disorders
Journal Article 2026-07-15 ✓ 1 Snippet Shanmugam A, Fletcher BS, Pala M, Klaric L, Kerr SM, Donaldson SW, Tzoneva G, Shuldiner AR, Richards MB, McLaughlin RL, Cavalleri GL, Byrne RP, Gilbert EH, Wilson JF.
In-Text Gene Mentions

…the BTD andHFEgenes were identified,…

Show Full Abstract

The Scottish Travellers are a traditionally nomadic community in Scotland that has historically been marginalised, and remained socially isolated from the settled Scottish population until recently. Little, however, is known about their genetic origins, population structure and risks of Mendelian disease. After an approach from the community to address this gap and increase representation, we analyzed array genotypes and whole-exome sequencing data from up to 125 Gypsy/Traveller individuals, alongside settled British and Irish references. We demonstrate that Scottish Travellers are genetically distinct from Irish Travellers, English Gypsies and European Roma, as well as the settled British and Irish populations. However, they do share autosomal and mitochondrial genetic ancestry with settled Scots. Two genetic subgroups are detectable: one which is more drifted and one more admixed. High levels of autozygosity are apparent, consistent with consanguinity. We detect signals of bottlenecks in autosomal and mitochondrial data. Importantly, we identified an enrichment of rare, pathogenic variants, including at least five putative founder variants associated with recessive Mendelian disorders. These findings provide insights into the genetic history of the Scottish Traveller population and highlight the opportunity and need for community-driven clinical genetics screening initiatives to decrease the scope for further health disparities.

OLFM4
Also flagged:metabolismimmune responsesinflammatory bowel diseasescolitisimmune responseinflammatory disease
Journal Article 2026-07-15 ✓ 2 Snippets Yu T, Yang W, Bilotta AJ, Yao S, Lee JH, Zhao Q, Zhou J, Ordog T, Dulai PS, Cong Y.
In-Text Gene Mentions

…( Lgr5 andOlfm4, Supplementary Fig.…

…markers Lgr5 andOlfm4(Supplementary Fig. 8F…

Show Full Abstract

Intestinal epithelial cells (IEC) are the primary cell type in direct contact with stimuli from the luminal microbiota, playing a critical role in host-microbe interactions. However, how IECs communicate with underlying immune cells to maintain homeostasis remains poorly understood. In addition, the mechanisms by which IECs sense microbiota-derived stimuli to initiate this crosstalk are not yet fully understood. Here, we demonstrate that oral administration of the gut microbiota metabolite butyrate induces sustained IL-10 production in CD4⁺ T cells, conferring long-lasting protection against intestinal inflammation even after treatment withdrawal. This persistent immunoregulatory effect is also observed in germ-free mice, indicating the establishment of a butyrate-conditioned intestinal environment. By metabolomic profiling, we identify N1-acetylspermidine as a metabolite contributing to the IL-10-inducing activity of butyrate-treated IEC-conditioned medium. Mechanistically, butyrate induces sustained transcriptional and epigenetic activation of the acetylpolyamine biosynthetic enzyme Sat1 in IECs, which catalyzes the acetylation of spermidine to generate N1-acetylspermidine, and this activation persists after butyrate withdrawal. Together, our findings reveal a mechanism by which butyrate sensing establishes persistent crosstalk between IECs and T cells, thereby maintaining intestinal immune tolerance through epigenetic regulation and reprogramming of epithelial metabolism.

Also flagged:calcium phosphatehydroxyapatitecell adhesioncollagenalginatecellulose
Journal Article 2026-07-15 No Snippets Barakat A, Ehagali GAM, El-Moslamy SH, Abusaif MS, Owda ME, Ammar YA, Ghazy MB.
Show Full Abstract

Implant-associated infections remain a major challenge in bone regeneration, often compromising the long-term success of hydroxyapatite-based biomaterials. A new sulfonated quinoxaline aldehyde, 2-ethoxy-4-formylphenyl 2,3-dioxo-1,2,3,4-tetrahydroquinoxaline-6-sulfonate (B6), was synthesized and covalently grafted onto chitosan via Schiff base condensation to yield derivatives with controlled degrees of substitution (d1-d4). Which were subsequently incorporated into hydroxyapatite to form composite systems (dH0-dH4). Structural characterization using Fourier-transform infrared spectroscopy (FTIR), nuclear magnetic resonance (NMR), X-ray diffraction (XRD), and X-ray photoelectron spectroscopy (XPS) confirmed successful Schiff base formation, while thermogravimetric analysis (TGA) indicated enhanced thermal stability. Scanning electron microscopy with energy-dispersive X-ray analysis (SEM-EDX) and Brunauer-Emmett-Teller (BET) analyses revealed homogeneous hydroxyapatite dispersion and a mesoporous architecture (44.8 m<sup>2</sup> g<sup>- 1</sup>, ~ 20 nm pores) for the optimized composite. Among the investigated formulations, dH2 exhibited the most balanced physicochemical and biological performance. The dH2 composite exhibited pronounced antimicrobial activity, achieving biofilm inhibition of 89.65% against Bacillus cereus and 86.65% against Staphylococcus aureus, with MIC values lower than those of reference antibiotics under the tested conditions. Cytotoxicity assessment using Vero and MG-63 cells demonstrated excellent biocompatibility, with > 99% cell viability at ≤ 125 µg/mL and IC<sub>50</sub> values of 344.99 and 156.62 µg/mL, respectively. These findings indicate that the developed chitosan-quinoxaline Schiff base hydroxyapatite composite represents a multifunctional, infection-resistant platform suitable for bone regeneration applications.

Also flagged:pore-formingextracellularbindingSynaptic transmissionsynaptic clefttransmitter
Journal Article 2026-07-15 No Snippets Hohaus N, Reissner C, Missler M.
Show Full Abstract

Rapid release of neurotransmitters from presynaptic boutons is essential for brain function and is triggered by Ca<sup>2+</sup> influx through voltage-gated calcium channels (VGCCs), which consist of an α1 pore-forming subunit, intracellular β subunits, and mostly extracellular α2δ auxiliary subunits. Neurexins (Nrxn) regulate neurotransmission and presynaptic Ca<sup>2+</sup> influx, but the physical interactions with VGCC subunits remain unknown. Here, we examined these interactions in recombinant VGCC-Nrxn complexes using a nanobody-based co-precipitation system. We found that the α2δ-1 and α2δ-3 variants bind to the α1 pore-forming subunits of Ca<sub>V</sub>2.1- and Ca<sub>V</sub>2.2-type VGCCs with distinct preferences, whereas Nrxn1α and Nrxn1β do not directly interact with α1. Since Nrxn1α binds both α2δ variants but Nrxn1α/α2δ complexes do not include α1, mobile α2δ subunits may dynamically toggle between Nrxn1α and the Ca<sub>V</sub> core. Additionally, Nrxn1α associates with α1 subunits independently of α2δ through the intracellular scaffold protein Mint2, which enhances Nrxn1α/α2δ complex formation by inhibiting full glycosylation of α2δ. Extracellularly shorter Nrxn1β cannot bind α2δ but can indirectly associate with Ca<sub>V</sub>2 α1 pore-forming subunits via either Mint2 or CASK proteins. Therefore, our findings reveal distinct molecular complexes through which αNrxn and βNrxn variants interact with VGCC subunits to regulate presynaptic Ca<sup>2+</sup> influx. (196 words).

Also flagged:Extracellularvesiclesamyotrophic lateral sclerosisALSneurodegenerative syndromecytoplasmic
Journal Article 2026-07-15 No Snippets Bolsinger MM, Vivek N, Singh J, Challa A, Zhu A, Rothell T, Wang S, Zhang T, Zhu S, Robbins N, Fenwick L, Ruttenberg G, Bogoniewski A, Taha HB.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative syndrome diagnosed clinically using standardized criteria, with neuropathological confirmation of motor neuron loss and TDP-43 aggregates in postmortem brain tissue. Extracellular vesicles (EVs) have emerged as potential minimally invasive biomarkers for ALS, but studies vary widely in methodology and reproducibility. We conducted a systematic review and meta-analysis to evaluate the diagnostic potential of EV-associated proteins and RNAs in ALS. Following PRISMA guidelines, we searched PubMed and EMBASE from inception to May 21st, 2026. Forty-one studies met inclusion criteria. Where published summary statistics were available, these were used directly; where they were not, data were reconstructed from figures or obtained from authors and re-analyzed to derive standardized effect sizes and exploratory diagnostic accuracy estimates. Random-effects models were used for continuous outcomes, and diagnostic accuracy was assessed using hierarchical summary ROC and bivariate random-effects models. Publication bias was evaluated using Begg, Egger, and funnel plots. EV-associated TDP-43 was the most frequently studied protein. Meta-analysis of five studies showed a moderate but non-significant increase in EVs from ALS vs. controls (SMD = 1.30) with high heterogeneity (I = 97.8%). Sixteen studies assessing EV-RNA biomarkers showed minimal overlap and limited independent replication. Diagnostic accuracy meta-analysis across 11 studies yielded moderate performance (AUC = 0.839). No publication bias was found across both meta-analyses. EV biomarkers for ALS show biological promise but are limited by methodological variability and insufficient replication. This work highlights the need for standardized protocols, transparent data sharing, and independent validation.

POU3F2
Also flagged:organizationgene expressionbindingchromatin
Journal Article 2026-07-15 ✓ 1 Snippet Térmeg A, Storozhuk V, Kliesmete Z, Edenhofer FC, Geuder J, Dietl T, Vieth B, Janssen P, Richter D, Bonev B, Hellmann I.
In-Text Gene Mentions

…( NR2F1 andPOU3F2), and could…

Show Full Abstract

To understand phenotypic evolution, it is essential to investigate the underlying gene regulatory networks (GRNs). However, most comparative GRN analyzes remain descriptive due to the low signal-to-noise ratio inherent in single-cell transcriptomics data. To address this, we introduce CroCoNet (Cross-species Comparison of Networks), an R-package for quantitative GRN comparison across species. CroCoNet builds comparable network modules centered on putative regulators and compares module topologies within and between species, distinguishing true evolutionary divergence from technical and biological confounders. We demonstrate its utility by comparing early neural differentiation across primates and validating results with a CRISPRi analysis of the diverged POU5F1 module.

OLFM4
Also flagged:Membranemembranesstem cellextracellularcell differentiationmucus
Journal Article 2026-07-15 ✓ 1 Snippet Youn J, Kim H, Than N, Kim J, Yoon J, Kim D, Kim HJ, Kim DS.
In-Text Gene Mentions

…such as LGR5,OLFM4, RGMB, SMOC2, and…

Show Full Abstract

Reconstructing intestinal organoid-derived epithelium on porous membranes is a promising strategy for building in vitro intestine models that combine biological complexity with experimental accessibility. A central challenge is designing membranes that reproduce the biochemical and biophysical cues of the native intestinal microenvironment. Here, we report a nanofiber-supported decellularized extracellular matrix (NaDE) membrane engineered to emulate these key features. Specifically, a colon-specific NaDE (C-NaDE) membrane is fabricated by integrating porcine colon-derived decellularized extracellular matrix (CdECM) hydrogel with an ultra-thin nanofiber scaffold. The resulting membrane preserves a collagen-rich extracellular matrix (ECM) composition and exhibits basement membrane-level stiffness (∼230 kPa), thereby providing a supportive niche for intestinal epithelial reconstruction. Colon organoid-derived epithelium cultured on the C-NaDE membrane shows enhanced expression of genes associated with stem cell maintenance and epithelial proliferation. Notably, the C-NaDE membrane also increases markers related to secretory epithelial lineages that are typically underrepresented in conventional synthetic stiff membrane systems, including enteroendocrine, tuft, and Paneth cell populations. These findings demonstrate that integrating organ-specific matrix composition with tissue-relevant mechanics can improve membrane-based intestinal epithelial models. The C-NaDE membrane, therefore, provides a physiologically enhanced platform for studying intestinal biology, disease mechanisms, barrier function, and drug responses.

NEGR1
Also flagged:Posttraumatic Stress DisorderPTSDAgingcognitionmembranetranslational
Journal Article 2026-07-15 ✓ 1 Snippet Cheung N.
In-Text Gene Mentions

…EP300, ATP6V1D, ABLIM3,NEGR1, SSH2, and GRIA1.…

Show Full Abstract

Background Posttraumatic stress disorder (PTSD) is a trauma- and stressor-related disorder characterized by persistent intrusion symptoms, avoidance, negative alterations in cognition and mood, and alterations in arousal and reactivity after exposure to a qualifying traumatic event. Symptoms must persist for more than one month and cause clinically significant distress or functional impairment under the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition, Text Revision (DSM-5-TR) criteria. Reported PTSD prevalence in older adults varies according to diagnostic criteria and sampling frame; nationally representative studies have reported lifetime prevalence estimates of approximately 4.5% under the DSM-IV criteria and higher probable DSM-5 estimates when functional impairment was not included. Aging-related gene-set annotations may therefore provide one way to investigate biological vulnerability without directly measuring aging phenotypes. This secondary gene-set analysis tested whether supplied Polycomb-derived aging modules were competitively enriched in PTSD transcriptome-wide association study (TWAS) signals and whether their strongest gene-level signals were distinct from the curated GenAge human aging comparator. The post-hoc analyses were exploratory and hypothesis-generating. Methods PTSD S-PrediXcan/TWAS summary files were analyzed using absolute meta-Z-score ranking. Competitive gene set enrichment analysis (GSEA) used 2,000 gene-label permutations, and over-representation analysis (ORA) examined genes with absolute Z-scores greater than 3. Leading-edge overlap, signed directionality, top-gene comparisons, manual functional categorization, and sensitivity analyses after removing GenAge-overlapping genes were performed as secondary analyses. Results At the set level, GenAge showed the highest normalized enrichment score (NES = 1.0971; permutation p = 0.124938), while Module B was the strongest Polycomb-derived module but did not exceed GenAge (NES = 1.0474; p = 0.206397; false discovery rate (FDR) = 0.825588). None of the Polycomb-derived modules reached significance after FDR correction, and their ORA results were non-significant. Exploratory analysis of Module B showed larger top-tail absolute TWAS Z-scores than GenAge among the available top-50 output (median |Z|, 4.7845 versus 3.8822; nominal Mann-Whitney U p = 0.000474). Immune/major histocompatibility complex (MHC)/co-stimulation genes had the most negative descriptive mean Z-score, but no leading-edge or top-gene sign test showed statistically significant directional skew. Module B shared little leading-edge or top-gene overlap with GenAge. Conclusions Primary analyses did not demonstrate robust competitive enrichment of Polycomb-derived aging modules in PTSD TWAS. The Module B findings are secondary and exploratory. They generate a testable hypothesis that selected immune/MHC, adhesion, and membrane-signaling genes may contribute to PTSD vulnerability through a focal neuroimmune-adhesion interface that is partly separable from broad cellular aging programs. This possibility requires independent replication, formal pathway testing, and functional validation before mechanistic or translational conclusions can be drawn.

SOX6
Also flagged:proteolysiscell cyclecell differentiationchromatincancerneurodevelopmental disorders
Journal Article 2026-07-15 ✓ 3 Snippets Roibás-Santos M, Suárez-Bregua P, Rotllant J, Carracedo Á, Allegue C, Sánchez L, Blanco-Hortas A, Pensado-López A.
In-Text Gene Mentions

…to act onSOX6, which is crucial…

…cells, 36 andSOX6has been found…

…and proteolysis ofSOX6, a process deemed…

Show Full Abstract

Thyroid Hormone Receptor Interactor 12 (TRIP12) is an E3 ubiquitin ligase capable of mediating ubiquitin-dependent proteolysis of specific protein substrates. This function regulates key biological processes, including cell cycle progression, cell differentiation, chromatin remodelling and DNA damage repair. Consequently, loss-of-function mutations in <i>TRIP12</i> have been associated with a broad spectrum of human diseases, including cancer and neurological and neurodevelopmental disorders. Previous studies have demonstrated that pathological variants of <i>TRIP12</i> cause Clark-Baraitser syndrome, characterized by craniofacial dysmorphism, motor delay and intellectual disability, with or without autism spectrum disorder. Despite the well-characterized clinical manifestations, the underlying molecular pathways affected by <i>TRIP12</i> disruption and their implication in the pathophysiology of autism spectrum disorder and intellectual disability remain unclear. Using a knock-out zebrafish model, we have elucidated the essential role of <i>trip12</i> in diverse metabolic and biological pathways, particularly those related to neural and neurodevelopmental processes, shedding light on potential mechanisms underlying the pathogenesis. Heterozygous and recessive homozygous zebrafish mutants exhibit clinical features analogous to those observed in human patients, including craniofacial anomalies and decreased locomotor activity. Furthermore, this study provides substantial evidence for the vital role of <i>trip12</i> in the early stages of development, as homozygous individuals exhibited early mortality by Day 23 post-fertilization, while a substantial mortality rate of 90% was observed by Day 35 in 'heterozygous' mutants. The present study demonstrates the profound impact that <i>trip12</i> mutations have on embryogenesis, and transcriptomic analysis offers an in-depth knowledge of the molecular basis of the disease. These findings offer valuable insights into potential therapeutic targets for improving outcomes in individuals with <i>TRIP12</i>-associated disorders.

Also flagged:Pathogenesisgene expressioncardiovascular diseasescoronary heart diseasemyocardial ischaemiamitochondrial
Journal Article 2026-07-15 No Snippets Plewa P, Kulpa J, Szulc J, Szczepanik M, Domańska M, Pawlik A.
Show Full Abstract

Long non-coding RNAs (lncRNAs) constitute an important group of regulatory RNA molecules involved in the control of gene expression at the epigenetic, transcriptional, and post-transcriptional levels. In recent years, their crucial role in the pathophysiology of cardiovascular diseases, particularly coronary heart disease, has become increasingly evident. The aim of this review is to present current knowledge regarding the mechanisms of lncRNA action in the cardiovascular system, their involvement in the molecular processes associated with myocardial ischaemia, and their potential diagnostic and therapeutic applications. We discuss the molecular mechanisms responsible for the regulation of cardiomyocyte apoptosis, oxidative stress, mitochondrial dysfunction, angiogenesis, coronary vessel remodelling, and cardiac fibrosis. Particular attention is paid to selected lncRNAs involved in coronary heart disease, including MIAT, MALAT1, ANRIL, and H19, which influence inflammatory processes, vascular smooth muscle cell proliferation, responses to hypoxia, and cardiac fibrosis. The potential of lncRNAs as diagnostic and prognostic biomarkers in coronary artery disease is also discussed. Current evidence suggests that molecules such as MALAT1, MIAT, LIPCAR, and HCG11 may have considerable diagnostic and prognostic value, including for predicting major adverse cardiovascular events and the no-reflow phenomenon following percutaneous coronary intervention. Furthermore, contemporary therapeutic strategies targeting lncRNAs are presented, including antisense oligonucleotides, siRNAs, and CRISPR/Cas9 genome-editing technologies. Despite promising preclinical findings, the clinical application of lncRNA-based therapies remains limited by challenges related to safety, delivery of therapeutic molecules, and translation of experimental findings into clinical practice. Nevertheless, lncRNAs represent a promising avenue for the development of precision medicine and may play an important role in the future diagnosis and treatment of cardiovascular diseases.

Also flagged:translationalmetabolismprotein synthesisribosomeenergy homeostasissynthesis
Journal Article 2026-07-15 No Snippets Zhu T, Chen H, Zheng Z, Guo H, Liu B, Zhu K, Zhang N, Xian L, Yu Y, Liu Y, Chen S, Zhang D.
Show Full Abstract

Grass carp (<i>Ctenopharyngodon idella</i>) is an important freshwater aquaculture species in China. However, high-density farming often leads to significant growth differentiation among individuals, seriously affecting yield and product quality. Here, we conducted an integrated transcriptomic and data-independent acquisition (DIA) proteomic analysis across the brain, liver, and muscle tissues of fast-growing (FG) and slow-growing (SG) grass carp after 9 months of high-density culture. Our analysis revealed that the core mechanism driving growth differentiation is a deep decoupling of transcription and translation, where enhanced muscle translational efficiency dictates the fast-growth phenotype, while slow growth is constrained by central stress and hepatic energy depletion. In the slow growth group, the brain exhibited translational arrest and neuroinflammation, and the liver entered a state of hypermetabolism mediated by AMPK, evidenced by the post-transcriptional up-regulation of key sensors such as CAB39 (PRM ratio = 1.634) and CAMKK2 (PRM ratio = 1.295). Conversely, in the fast-growing group, the mTOR-ribosome signaling axis was strongly activated at the post-transcriptional level in the muscle (GSEA NES = -1.852), triggering myofibrillar protein deposition despite transcriptional silence in classical growth pathways. These findings elucidate the systemic molecular mechanisms of growth divergence and provide high-confidence molecular targets for developing fast-growing, stress-resilient grass carp strains for precision aquaculture breeding.

TAOK3
Also flagged:Pancreatic Ductal Adenocarcinomasolid tumorstumorcancerdegradationpancreatic cancer
Journal Article 2026-07-15 ✓ 5 Snippets Tai J, He H, Perini MV, Nikfarjam M.
In-Text Gene Mentions

…acid kinase 3 (TAOK3) as a central…

…the STE20 family,TAOK3coordinates diverse cellular…

…the PDA parenchyma,TAOK3maintains the cancer…

…Within the TME,TAOK3facilitates local invasion…

…Furthermore,TAOK3exerts immunomodulatory effect…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDA) remains one of the most recalcitrant solid tumors, characterized by a fibrotic and immunosuppressive tumor microenvironment (TME), inherent chemoresistance and systemic cachexia. Recent pan-cancer proteomic and transcriptome analyses have identified Thousand-and-one amino acid kinase 3 (TAOK3) as a central signaling node governing these lethal hallmarks. Operating as a MAP kinase kinase kinase (MAP3K) within the STE20 family, TAOK3 coordinates diverse cellular processes. In the PDA parenchyma, TAOK3 maintains the cancer stem cell (CSC) phenotype by enforcing a strict DNA damage response checkpoint. Within the TME, TAOK3 facilitates local invasion by regulating endosomal trafficking for invadopodia assembly. Furthermore, TAOK3 exerts immunomodulatory effects, dictating macrophage polarization and preserving canonical T-cell receptor (TCR) signaling by inducing the degradation of the SHP-1 phosphatase. Systemically, tumor-derived signals establish a pathogenic feedforward loop with skeletal muscle whereby TAOK1 activity is upregulated in peripheral skeletal muscle to drive muscle atrophy secondary to TAOK3 expression in the primary tumor. The recent development of specific structural inhibitors with dual-acting natural bioactivities, provides a compelling preclinical foundation to transition TAOK3 from prognostic biomarker to premier therapeutic target in pancreatic oncology.

Also flagged:MitochondrialGastric Cancermitochondriaorganellesmetabolismcancer
Journal Article 2026-07-15 No Snippets Liu H, Zhang Y, Wang J, Qiao M, Guo Q.
Show Full Abstract

Through multifaceted reprogramming, mitochondria, the fundamental organelles of eukaryotic cells, can drive the malignant growth of malignancies. They also control energy metabolism, redox balance, and cell fate determination. Due to its high heterogeneity and primary/acquired drug resistance, gastric cancer (GC), a highly deadly and common cancer worldwide, continues to present significant clinical treatment challenges. Current targeted and immunotherapy strategies have been unable to significantly improve long-term patient survival. Thus, the pathological roles and molecular mechanisms of mitochondrial dysfunction (including mutations in mitochondrial DNA, imbalances in mitochondrial dynamics, aberrant mitophagy, abnormalities in mitochondrial permeability transition pores, and metabolic disorders) in the development of GC are systematically reviewed in this article. The specific mitochondrial phenotypic remodeling of various molecular subtypes of GC, abnormalities in membrane contact interactions between mitochondria and other organelles, the regulatory roles of mitochondrial dysfunction in tumor microenvironment (TME) immune evasion, maintenance of tumor stemness, and ferroptosis, as well as their major effects on the malignant progression and treatment resistance of GC, are all thoroughly examined. In order to provide important theoretical references and novel research perspectives for identifying therapeutic targets with greater precision, clarifying resistance mechanisms, and developing novel combination strategies in GC, this article summarizes the current research status and translational potential of anti-GC therapeutic strategies targeting mitochondria. It also explores the translational challenges currently faced in this field and the core future research directions.

PLCL1
Also flagged:DLBCLDiffuse large B-cell lymphomatumorgene expression
Journal Article 2026-07-15 ✓ 1 Snippet Zhang H, Hong C, Gao X, Shi Y, He C, Li Q, Hu R, Zhang X, Lang X, Zhuang W, Li B.
In-Text Gene Mentions

…expression-based model (MYC,PLCL1, IRF8, LNPEP) stratified…

Show Full Abstract

<h4>Purpose</h4>Diffuse large B-cell lymphoma (DLBCL) is genetically heterogeneous. We aimed to define a compartment-aware driver mutation landscape of DLBCL by integrating tumor tissue and circulating cell-free DNA (cfDNA) sequencing, and to assess its biological and prognostic relevance.<h4>Materials and methods</h4>Somatic mutations were analyzed from targeted sequencing of tumor tissue or bone marrow and cfDNA from peripheral blood or cerebrospinal fluid, including paired tissue-liquid samples, together with whole-genome sequencing data from TCGA. Driver genes were identified using four complementary algorithms. Functional enrichment and protein-protein interaction analyses were performed. Prognostic relevance was evaluated using multigene expression-based modeling with Cox and LASSO regression in independent cohorts.<h4>Results</h4>Recurrent driver alterations converged on core pathogenic pathways, including B-cell receptor signaling, NF-κB activation, epigenetic regulation, and immune escape. Twenty-two high-confidence driver genes, including PIM1, KMT2D, CD79B, B2M, TP53, MYC, and EZH2, were consistently identified across clinical cohorts and supported by TCGA data. cfDNA profiling showed substantial concordance with tissue-derived drivers while revealing gene-specific differences in mutation burden and co-mutation patterns, indicating complementary capture of clinically relevant heterogeneity. Network analysis highlighted TP53, MYC, EP300, and CREBBP as central hubs. A four-gene expression-based model (MYC, PLCL1, IRF8, LNPEP) stratified patients by overall survival and modestly improved prognostic discrimination beyond the International Prognostic Index.<h4>Conclusion</h4>Integrated analysis of tumor tissue and cfDNA sequencing defines a clinically relevant driver framework for DLBCL. cfDNA preserves core oncogenic signals while complementing tissue profiling, supporting refined genomic risk stratification.

CACNA1E
Also flagged:Diabetic retinopathyvisionretinopathyinflammatory responsesdiabetesblindness
Journal Article 2026-07-15 ✓ 1 Snippet Liu X, Zhang N, Wu S, Zhang M, Sun B, Chen L.
In-Text Gene Mentions

…LAMP3, PPP2R5D, CHIT1,CACNA1E, CACNA2D3, TGM1, ACTBP8,…

Show Full Abstract

Diabetic retinopathy remains a major cause of vision loss, and therapeutic strategies beyond anti-vascular endothelial growth factor treatment are still needed. This study aimed to identify genetically supported druggable targets for diabetic retinopathy and to evaluate finerenone as a candidate therapeutic intervention in experimental retinopathy. We performed druggable Mendelian randomization by integrating druggable-gene resources, blood cis-expression quantitative trait locus data, and a large genome-wide association dataset for diabetic retinopathy. Significant genes were further evaluated using colocalization analysis, functional enrichment, protein-protein interaction network analysis, drug prediction, and molecular docking. Finerenone was subsequently assessed in db/db mice and in the oxygen-induced retinopathy model. Thirty candidate druggable genes were associated with diabetic retinopathy after false discovery rate correction. Among them, CDH2 was the only candidate showing significant colocalization with diabetic retinopathy risk, with a posterior probability for a shared causal variant of 0.85. Protein-protein interaction analysis showed relatively high connectivity of CDH2 within the candidate network, and molecular docking suggested a favorable predicted interaction between finerenone and N-cadherin. <i>In vivo</i>, finerenone reduced avascular and neovascular areas in oxygen-induced retinopathy retinas and decreased retinal expression of TNF-α, IL-1β, and N-cadherin in db/db mice. These findings prioritize CDH2/N-cadherin as a genetically supported candidate target in diabetic retinopathy and support finerenone as a potential therapeutic candidate. The retinal protective effects of finerenone may be associated with suppression of inflammatory responses and downregulation of N-cadherin, although the direct mechanistic link requires further validation.

HFE
Also flagged:type 1 diabetesdiabetic ketoacidosistype 1 DKAglycogenic hepatopathyMauriac syndromelactic acidosis
Journal Article 2026-07-15 ✓ 5 Snippets Fu R, Yang M, Guo Y, Huang Y, Li X, Zhang M.
In-Text Gene Mentions

…identified a homozygousHFEmutation, suggesting hereditar…

…mutation in theHFEgene (refer to…

…mutation in theHFEgene, this finding…

…HomozygousHFEgene mutation…

…with a homozygousHFEgene mutation has…

Show Full Abstract

<h4>Medical history summary</h4>A 14-year-old female with type 1 diabetes for over six years presented with abdominal pain for two days and vomiting for three hours. Her regimen includes NovoRapid before meals and glargine at bedtime, but she has irregular meal patterns, inconsistent blood glucose monitoring, and poor insulin adherence. She has a history of recurrent diabetic ketoacidosis (DKA) and related hospitalizations.<h4>Clinical presentation</h4>The patient is alert but mildly weak, with adequate responsiveness. Breathing is slightly increased, deep, and regular. Extremities are cool. Radial pulses are strong, but dorsalis pedis pulses are diminished bilaterally. There is scattered right abdominal tenderness. The liver is palpable 5 cm below the costal margin, with medium texture and blunt borders, and percussion tenderness is positive.<h4>Diagnostic methods</h4>Venous blood glucose was 21.86 mmol/L, and HbA1c was 10%. Arterial blood gas showed pH 6.933, pCO2 31.4 mmHg, and BEb -25.3 mmol/L. Insulin was below 1.39 pmol/L, and C-peptide below 0.003 pmol/L. Urinalysis revealed glucose 4+ and ketones 1+, leading to a diagnosis of type 1 DKA. Liver function was abnormal, with hepatomegaly and blood lactate at 9.85 mmol/L. Metabolic, infectious, and immune causes were excluded. Liver biopsy confirmed glycogenic hepatopathy, establishing a diagnosis of Mauriac syndrome with lactic acidosis. Serum uric acid ranged from 434 to 545 mmol/L, indicating hyperuricemia. Whole-exome sequencing identified a homozygous HFE mutation, suggesting hereditary hemochromatosis, though ferritin was normal and no iron deposition was seen on pathology.<h4>Treatment</h4>Continuous intravenous insulin therapy was initiated, along with diabetes education, dietary guidance, exercise, glucose monitoring, and symptomatic care. An insulin pump was subsequently used for continuous subcutaneous insulin infusion (with Gansulin R before meals). Later, the pump was discontinued and switched to a four-injection subcutaneous regimen, consisting of NovoRapid before meals and insulin glargine at bedtime. Bicyclol Tablets was given for hepatoprotection.<h4>Clinical outcome</h4>The patient was hospitalized for 13 days, remained afebrile, and reported no discomfort. Blood glucose ranged from 3.1 to 15.2 mmol/L. Liver size slightly decreased, but tenderness persisted. Liver function and lipids were mostly normal at discharge. Two months later, she was readmitted for DKA; liver function was normal, but hepatomegaly with tenderness persisted.

PRDX6SERPINC1
Also flagged:refractive errormyopiacorneal astigmatismastigmatismwound healingblood coagulation
Journal Article 2026-07-15 ✓ 4 Snippets Wei X, Li W, Zhang W.
In-Text Gene Mentions

…(SOD1) and peroxiredoxin-6 (PRDX6) have been associated…

…( P01042 ),SERPINC1( P01008 ),…

…such as KNG1,SERPINC1, PLG, FGA, and…

…her candidates—including KNG1,SERPINC1, PLG, FGA, FGB,…

Show Full Abstract

<h4>Introduction</h4>Astigmatism is a common refractive error associated with myopia, yet its molecular mechanisms remain poorly understood. This study aimed to identify and validate differentially expressed proteins (DEPs) in corneal astigmatism through a label-free quantitative proteomic approach, followed by biomarker validation using parallel reaction monitoring (PRM).<h4>Methods</h4>This two-phase, retrospective case-control study aimed to identify and verify differentially expressed proteins (DEPs) associated with corneal astigmatism. Phase I (discovery) employed label-free quantitative (LFQ) proteomics to compare stromal samples from 9 patients (10 eyes) with compound myopic astigmatism (Group A) and 8 patients (10 eyes) with simple myopia (Group B). Phase II (verification) involved targeted parallel reaction monitoring (PRM) in an independent cohort comprising 13 patients (15 eyes) in Group A and 14 patients (15 eyes) in Group B, quantifying discovery-prioritized proteins. Bioinformatic analyses including COG, GO, KEGG, and protein-protein interaction mapping were performed to characterize enriched pathways and guide PRM target selection.<h4>Results</h4>A total of 127 DEPs were identified, with 31 upregulated and 96 downregulated in Group A. Bioinformatic analysis of the discovery dataset showed enrichment of proteins associated with wound healing, blood coagulation, and lipid metabolism; these enrichments were exploratory and were used only to prioritize candidates for targeted verification. Targeted PRM verified a significant reduction in APOA4 in astigmatism; other candidates showed concordant trends without statistical significance.<h4>Conclusion</h4>After targeted verification, APOA4 was the only protein that remained significantly reduced in corneal astigmatism, supporting reduced APOA4 as a candidate biomarker that warrants further study. The discovery-phase associations with coagulation, lipid metabolism, and wound-healing pathways were not confirmed at the protein level and should be regarded as hypothesis-generating, requiring confirmation in larger, adequately powered cohorts.

CA10
Also flagged:dementiacognitive declinemild cognitive impairmentextracellularsynaptic transmissionAD
Journal Article 2026-07-15 ✓ 1 Snippet Lin Y, Cheng L, Zhang Z, Cui L, Li W, Guo Q, Miao Y.
In-Text Gene Mentions

…UGT3A1 , andCA10, and were…

Show Full Abstract

<h4>Introduction</h4>Brain β-amyloid (Aβ) accumulation is a hallmark of Alzheimer's disease, but noninvasive detection remains challenging. Blood transcriptomics may provide accessible biomarkers associated with Aβ pathology.<h4>Methods</h4>We integrated peripheral blood transcriptomic profiling and MRI-derived structural metrics from 48 individuals across the cognitive continuum, including subjective cognitive decline (SCD), mild cognitive impairment (MCI), and dementia, stratified by Aβ-PET status. Predictive models were constructed using leave-one-out cross-validation (LOOCV), and selected genes were validated by qRT-PCR.<h4>Results</h4>Cross-stage analysis identified <i>RUNX1T1</i> and <i>COL14A1</i> as consistently downregulated in Aβ-positive individuals regardless of clinical stage. A predictive model incorporating these two genes demonstrated moderate discrimination of Aβ-PET status in internal leave-one-out cross-validation (LOOCV) evaluation (AUC = 0.81). In addition, <i>COL14A1</i> expression was associated with cortical thickness and hippocampal volume, whereas <i>RUNX1T1</i> was primarily associated with hippocampal structure. Among individuals with MCI or dementia, <i>HCN1</i> and <i>NRG3</i> were upregulated, whereas <i>KCNMB2</i> was downregulated in Aβ-positive subjects. A three-gene model based on these markers achieved an LOOCV AUC of 0.79.<h4>Discussion</h4>These findings indicate that peripheral blood transcriptomic alterations are associated with Aβ pathology across clinical groups. <i>RUNX1T1</i> and <i>COL14A1</i> represent candidate peripheral biomarkers associated with Aβ pathology, while the observed molecular signatures and their associations with brain structural measures provide a basis for further validation in larger, longitudinal cohorts and mechanistic studies.

Also flagged:ferroptosisdeathhepatocellular carcinomacancermalignant tumorapoptotic cell
Journal Article 2026-07-15 No Snippets Yang F, Li Z, Zheng B.
Show Full Abstract

Ferroptosis is an iron-dependent form of programmed cell death driven by lipid peroxidation, distinct from apoptosis and necrosis. It has been confirmed as a key regulator in hepatocellular carcinoma (HCC). This study systematically elucidates three interconnected regulatory networks of ferroptosis-metabolic, epigenetic, and microenvironmental-and proposes a closed-loop regulatory model integrating these dimensions. By integrating metabolic biomarkers, epigenetic indicators, and microenvironmental features, we also summarize emerging strategies to enhance ferroptosis sensitivity. By summarizing the regulatory nodes as well as clinical translation progress, this work provides a comprehensive roadmap for overcoming therapeutic bottlenecks in HCC and realizing ferroptosis-based precision medicine.

bioRxiv 2026-07-15 Preprint (No Snippets API) Hooper KM, Clark SG, Lundquist EA.
Show Full Abstract

UNC-6/Netrin is a conserved regulator of dorsal-ventral axon and cell migrations. UNC-6 is composed of a Laminin N-terminal domain (LN), three epidermal growth factor repeats (EGF), and a Netrin C terminal domain (NC). Here, we identified missense mutations in distinct UNC-6 domains and assessed their roles in dorsal VD/DD motor axon guidance and ventral AVM axon guidance. A missense mutation in a conserved residue of the LN domain (G289D) resulted in dorsal and ventral axon guidance defects similar to unc-6 null. A distinct missense mutation in the LN domain (S120F) was hypomorphic and strongly perturbed ventral AVM axon guidance with minimal effects on dorsal VD/DD axon guidance, showing that S120F is predominantly required for ventral guidance. Missense mutations altering conserved cysteine residues involved in di-sulfide bonding in the EGF domains were analyzed. EGF1(C321G) caused both ventral and dorsal axon guidance defects albeit weaker than unc-6 null, indicating that EGF1 is required for both. EGF2(C347Y) strongly affected dorsal VD/DD axon guidance similar to unc-6 null, with weaker perturbation of ventral AVM axon guidance. Previous results revealed that EGF3(C410Y) specifically disrupted dorsal axon guidance, a result that we confirmed. Our studies using missense mutations in the endogenous unc-6 locus complement previous structure-function studies using transgenic expression, and identify domains specifically required for ventral AVM guidance (S120Y in the LN domain) and dorsal VD/DD axon guidance (C410Y in EGF3). The crystal structure of UNC-6 indicates conserved N-linked glycosylation at N114 and N128. Mutation of these sites in UNC-6 had no effect on dorsal ventral axon guidance, showing that they do not play a major role. However, the N114 and N128 mutations interacted genetically with unc-40 and unc-5 mutations, indicating that these glycosylation sites indeed have a role in UNC-6 signaling. Our results will inform studies on how these distinct UNC-6 domains interact with guidance receptors ( e.g. UNC-40/DCC and UNC-5) and other extracellular molecules to mediate dorsal-ventral axon guidance.

medRxiv 2026-07-15 Preprint (No Snippets API) Ayubcha C, Dennis E, Bhattacharyya U, John J, Lam M, Lencz T, Ge T, Chen C.
Show Full Abstract

With recent advances in high-throughput proteomic technologies, population-scale plasma proteomics datasets, often linked to extensive genetic and phenotypic information, have become increasingly accessible. Yet the relationships between circulating protein levels, brain imaging phenotypes, and risk for neurological and psychiatric disorders remain largely unexplored. Proteome-wide association studies offer a promising approach for elucidating biological mechanisms that connect genetic variation to complex brain-related traits and diseases. In this study, we integrated protein quantitative trait loci (pQTLs) from the two largest plasma proteomic resources (the UK Biobank Pharma Proteomics Project [UKB-PPP] and Ferkingstad et al. [deCODE]) with genome-wide association studies of brain imaging-derived phenotypes in UK Biobank using Mendelian randomization and colocalization analyses. We identified 120 cis and 20 trans associations between plasma proteins and imaging phenotypes and validated these findings using brain tissue-derived proteomic and transcriptomic datasets. Multivariable Mendelian randomization revealed eleven plasma proteins (coding genes APOE, ARL3, MICB, NSF, RHOC, RSPO3, ENPP2, BTN2A1, EIF2AK3, MRVI1, and OPLAH ) with significant direct effects on the risk of Alzheimer’s disease, Parkinson’s disease, multiple sclerosis, bipolar disorder, and schizophrenia. Single-cell expression and pathway enrichment analyses further revealed cell-type-specific effects and distinct biological processes underlying these protein- disease associations. Together, these findings demonstrate robust links between plasma protein variation and brain structure, delineate protein-disease pathways, and highlight the cellular and molecular mechanisms that contribute to neurobiological diversity and pathology.

Also flagged:extracellularbindingSynthesiscell-cell adhesiondegradation
Journal Article 2026-07-14 No Snippets Cheng K, Lim E, Stern B, Zoldan J, Peppas N.
Show Full Abstract

The bone marrow extracellular matrix (BM-ECM) has distinct mechanical and biochemical subniches, in which hematopoietic stem cells (HSCs) reside, self-renew, and differentiate into immune cells. Stiffness and diffusivity are key mechano-regulators of HSC fate. To control these key microenvironment parameters, we prepared a poly(ethylene-glycol) norbornene (PEGNB)-modified hydrogel platform with tunable stiffness and solute diffusivity by varying the polymer volume fraction, the number of macromolecular arms, their arm length, and their crosslinker type. The latter was identified as either nondegradable dithiothreitol (DTT) or matrix metalloproteinase (MMP)-degradable peptides. We characterized 24 PEGNB hydrogels for stiffness, swelling, and solute diffusion. Hydrogel swelling ratios ranged from 0.89 to 2.48 for DTT-crosslinked networks and 1.49 to 4.86 for peptide-crosslinked networks, supporting solvent retention for cell culture. Storage moduli ranged from 6.4 to 44.8 kPa (DTT-crosslinked networks) and 3.6 to 32.7 kPa (peptide-crosslinked networks), within the physiological range of the BM-ECM. Solute diffusivity values were also evaluated for all hydrogel formulations. Introduction of an MMP-sensitive crosslinker maintained the same relationship among hydrogel stiffness, swelling and solute diffusion while allowing for cell-mediated remodeling and high cell viability. Unlike prior predictive models, our study accounts for structural complexity to better match <i>in vivo</i> conditions. Therefore, we present a modular framework for engineering PEGNB hydrogels with independently tunable mechanical and transport properties, providing a robust, physiologically relevant platform to investigate stem cell-matrix interactions and advance stem cell-based tissue engineering.

PRDX6
Also flagged:neurodegenerative disordermitochondrial respiratory chainPDParkinson's diseaseprotein degradationmitochondrial
Journal Article 2026-07-14 ✓ 1 Snippet Qin B, Fu Z, Zou X, Chai S, Weng J, Wang P, Sun X, Sang M.
In-Text Gene Mentions

…( Scn7a ,Prdx6) (Figure 1A,B…

Show Full Abstract

<h4>Background</h4>Parkinson's disease (PD) is a neurodegenerative disorder characterized by progressive degeneration of midbrain substantia nigra dopaminergic neurons, resulting in striatal dopamine depletion and motor dysfunction. While this pathological cascade is well-established, its underlying mechanisms remain elusive.<h4>Methods</h4>To further investigate the pathological mechanisms of PD, we performed single-cell RNA sequencing of the midbrain and striatum from Hua-Syn (SNCA*A53T) transgenic (A53T) mice as a PD model.<h4>Results</h4>Analysis of 22 865 midbrain and 32 117 striatal cells revealed cell-type-specific risk association. Glial populations (astrocytes, microglia, oligodendrocytes) showed significant enrichment for PD-risk genes. Variance-based clustering identified PD-enriched subclusters exhibiting upregulated inflammatory pathways, apoptotic pathways, proteostasis disruption, glutamatergic signaling dysregulation, and mitochondrial respiratory chain defects. Transcriptional regulation analysis identified genes associated with PD specific activity, including Rorb and Foxc1 in the midbrain and Dbx2 and Klf13 in the striatum. Cell-cell interactions showed that cell-to-cell signaling was enhanced, and the SEMA and CCL neuroinflammatory axes were specifically activated in the PD group.<h4>Conclusions</h4>Our integrative analysis delineates the cellular and molecular architecture of the pathological process triggered by the expression of A53T mutant α-synuclein, and provides a framework for targeted therapeutic development.

Also flagged:degradationtumormelanomatumorsskin cancerscolorectal cancer
Journal Article 2026-07-14 No Snippets Olea XD, Beede K, Pereira G, Scott D, Petucci C, Martens E, Rodionov D, Shah A, Martinez MP, Kim H, Sharma AK, Martin A, Zhang T, Faries MB, Hamid O, Devkota S, Osterman A, Knott S, Voest EE, Ajami NJ, Wargo J, Ramer-Tait AE, Ronai ZA.
Show Full Abstract

Study of gut microbiota control of anti-tumor immunity (ATI) identifies Bacteroides rodentium and the human-related Bacteroides uniformis species to be capable of inducing ATI and limiting melanoma development in germ-free (GF), complex microbiome, or wild-type (WT) mice. Enhanced CD8<sup>+</sup> T cell infiltration within tumors of mice harboring B. rodentium coincides with increased expression of immune-stimulating pathways. Metabolomic analyses identify lower tryptophan levels in the cecal samples of GF mice harboring B. rodentium. In silico genomic reconstruction reveals that B. rodentium and B. uniformis harbor tryptophanase A (TnaA) and aromatic aminotransferase genes, which degrade tryptophan to indoles. Administration of B. uniformis harboring TnaA mutant fails to inhibit melanoma growth. Notably, administration of indoles effectively induces ATI and inhibits melanoma development. Correspondingly, the levels of bacterially encoded tryptophan-degrading enzymes are higher in cohorts of patients with melanoma responding to immunotherapy. These findings identify indoles as tryptophan breakdown products capable of inducing ATI resulting in melanoma inhibition.

HMGN4
Also flagged:Nucleinucleus-chromatinmethylationcell cycle-coupled
Journal Article 2026-07-14 ✓ 1 Snippet Kanchustambham VL, Pla I, Xu T, Su P, Fisher NP, Hollas MAR, Markiv P, Agarwal U, Lysakowska M, Kafader JO, Bao X, Kelleher NL.
In-Text Gene Mentions

…HMGN1, HMGN2, HMGN3,HMGN4, and HMGA1 detected…

Show Full Abstract

Advances in single-nucleus RNA sequencing have demonstrated advantages over single-cell transcriptomics by enabling capture of dynamic cellular states and transcriptional activity in rare or difficult-to-isolate cell types. To achieve analogous enhancements in intact protein profiling, we applied single-cell proteoform imaging mass spectrometry (scPiMS) to nuclei for label-free, proteoform-resolved analysis of >10<sup>4</sup> human skin cells. Using scPiMS, we surveyed ∼400 proteoforms across over 17,000 single nuclei isolated from human epidermal keratinocytes spanning undifferentiated (UD) proliferative to differentiated (DF) states, generating single-nucleus proteoform maps of epidermal differentiation. Proteoforms were assigned using intact mass tag matching to a reference proteoform library generated from bulk top-down LC-MS/MS analyses of UD and DF nuclei and subsequently applied to single-nucleus proteoform assignment scores. Unsupervised clustering of single-nucleus proteoform imaging mass spectrometry (snPiMS) data resolved 12 distinct proteoform-defined clusters spanning a continuum from UD proliferative states to terminal differentiation. A progenitor-enriched cluster (cluster 4) exhibited elevated high-mobility group-17, acetylated H2A/H2B variants, and H2A.Z, consistent with open and developmentally poised chromatin. An early differentiating population (cluster 3) was marked by histone H3 bearing H3K4 acetylation together with H3K9 monomethylation, indicative of transcriptional activation. Progressive histone H4 methylation (H4K20me1, H4K20me2, and H4K20me3) reflected cell cycle-coupled modification of newly synthesized H4 in progenitor-like nuclei prior to differentiation, corresponding to clusters 5, 2, and 8, respectively. Cluster 1 was enriched in H3 proteoforms bearing H3K4me3 together with H3K9me1, consistent with an active yet transcriptionally poised chromatin state. Differentiation-committed states (cluster 0) exhibited H3 proteoforms containing H3K4 and H3K9 acetylation together with H3K36me2 reflecting transcriptionally active chromatin. Bulk histone post-translational modification profiling corroborated these trends, with UD nuclei enriched in H3K9me2 and H4K20me1 and DF nuclei enriched in H4K20me2, H3K79me2, H3K27me2/3, and H3K36me3. Together, snPiMS uniquely resolves combinatorial histone proteoforms within individual nuclei, revealing a continuous chromatin trajectory across epidermal differentiation.

Also flagged:acute kidney injurytranslationalcancermembraneanginaKidney Disease
Journal Article 2026-07-14 No Snippets Backston K, Buehrer B, Ezgü D, Sivaram P, Tanna S, Koka R, Sethi SK, Moritz M, Raina R.
Show Full Abstract

Acute Kidney Injury (AKI) is currently diagnosed in pediatric patients by measuring rises in serum creatinine. The objective of this systematic review is to determine the diagnostic accuracy of novel biomarkers for early detection or prediction of pediatric AKI across a variety of high-risk pediatric populations. Relevant studies were searched in PubMed, Cochrane Library, and Web of Science databases. Observational studies and randomized trials assessing diagnostic biomarkers for AKI in high-risk pediatric populations were included, while studies limited to traditional biomarkers, adult populations, or non-original research were excluded. Risk of bias was assessed using the QUADAS-2 tool. The review was prospectively registered in PROSPERO (CRD420261293432). Diagnostic accuracy outcomes included AUC, sensitivity, specificity, and other performance measures. 53 total studies were included and grouped into 1 of 5 categories based on the specific population of pediatric patients studied and the general etiology of their AKI. Of note, neutrophil gelatinase-associated lipocalin, kidney injury molecule-1, and cystatin-C were among the most studied biomarkers and showed significant promise as reliable indicators of kidney injury. The product of tissue inhibitor of metalloproteinase-2 and insulin-like growth factor binding protein-7, interleukin-18, and others showed some evidence of being predictive, early markers of AKI and warrant additional investigation. The review further discusses the integration of novel biomarkers within existing clinical detection frameworks, including validated risk stratification tools and emerging FDA-approved biomarker assays, to contextualize their translational potential in high-risk pediatric populations. Future advances in precision medicine may lead to earlier diagnosis and better prognosis for pediatric patients suffering from AKI.

DCC
Also flagged:secretionhypersensitivityphosphorylationnucleussynapsesChronic low back
Journal Article 2026-07-14 ✓ 5 Snippets Pan D, Shen M, Abatan E, Zheng J, Nasser P, M Laudier D, Kong C, Yan L, Qiu Z, C Iatridis J, Wan M, Zheng J, K Taylor B, Cao X.
In-Text Gene Mentions

…Dorsal hornDCCamplification loop induced…

…endplates to activateDCCsignaling in dorsal…

…Importantly,DCCactivation induces Src…

…both netrin-1 andDCCin DH neurons…

…Moreover, netrin-1/DCCexpression is also…

Show Full Abstract

Spine degeneration is associated with low back pain (LBP), a major cause of disability and functional decline. However, effective therapies for non-specific LBP remain limited because its underlying mechanisms are poorly understood. Here, we show that spine degeneration induces netrin-1 secretion in porous endplates to activate DCC signaling in dorsal root ganglion (DRG) neurons in both LBP and naturally aged male mice. Conditional loss of netrin-1 in Trap<sup>+</sup> osteoclasts, or Dcc in Avil<sup>+</sup> DRG neurons reduced spinal hypersensitivity. Importantly, DCC activation induces Src phosphorylation and SNARE complex docking, leading to presynaptic glutamate release in the dorsal horn (DH). Consequently, presynaptic glutamate release induces expression of both netrin-1 and DCC in DH neurons as a form of postsynaptic plasticity that initiates a positive feedback loop to amplify spinal hypersensitivity. Moreover, netrin-1/DCC expression is also amplified in the parabrachial nucleus (PBN) in the brain in both LBP and aged male mice. Thus, osteoclast-derived netrin-1 in porous endplates activates DCC-mediated hypersensitivity in DRG neurons to be further amplified in the DH neurons. These results promote the concept of non-specific LBP as a form of nociplastic pain.

DCC
Also flagged:autoimmune polyglandular syndrome type 1APS-1autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophyAPECEDdegradationgene expression
Journal Article 2026-07-14 ✓ 1 Snippet Tirado-Herranz A, Pastor-Moreno A, Area-Navarro M, Noboa-Velástegui J, Conchillo O, Palacio JR, Daura X, Alvarez I.
In-Text Gene Mentions

…[ 40 ],DCC[ 41 ]…

Show Full Abstract

The autoimmune regulator (AIRE) is expressed in medullary thymic epithelial cells (mTECs) and is crucial for generating an immunocompetent T cell repertoire during central tolerance. Loss of AIRE function causes autoimmune polyglandular syndrome type 1 (APS-1), also known as autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). Intracellular proteins are regulated by ubiquitination pathways. E3 ubiquitin ligases are specific proteins that confer selectivity to polyubiquitination, tagging proteins for proteasomal degradation while also performing other functions. In mTECs, peptides generated via the class I antigen-processing pathway are presented by HLA-I molecules to CD8 thymocytes to eliminate self-reactive T-cell precursors. AIRE induces promiscuous gene expression in mTECs, but little is known about the regulatory mechanisms of AIRE. Previously, we and others demonstrated that AIRE is an apoptosis inductor. Here, we demonstrate that AIRE increases the intracellular levels of SIAH-interacting protein (SIP), an adaptor protein of the SIAH E3 ubiquitin ligase family. We also show that AIRE interacts with SIAH1 in the human thymus. While AIRE contains two putative SIAH-interacting motifs, it interacts with SIAH proteins only through the sequence spanning residues 119-125. AlphaFold modeling indicated that the interaction between AIRE and SIAH1 is highly analogous to that observed between SIP and SIAH1, suggesting that both proteins compete for SIAH1 binding. The CARD domain and the SIAH-interacting motif is required to AIRE-mediated apoptosis. AIRE co-localized with SIAH proteins in the cytoplasm of HEK-293 cells. Finally, SIAH1 ubiquitinated AIRE, targeting it for proteasomal degradation. Collectively, these findings reveal a novel pathway for the degradation and regulation of AIRE.

HFE
Also flagged:Hereditary Hyperferritinemia Cataract SyndromeHHCShyperferritinemiacataractssynthesishereditary hemochromatosis
Journal Article 2026-07-14 ✓ 5 Snippets Yiğit Y, Çelebi HBG.
In-Text Gene Mentions

…FTL mutation andHFEH63D homozygosity appears…

…Patient With CoexistingHFEH63D Homozygosity…

…addition, a homozygousHFEc.187C > G…

…Mutations in theHFEgene, particularly the…

…FTL mutations andHFEvariants has rarely…

Show Full Abstract

<h4>Background</h4>Hereditary hyperferritinemia cataract syndrome (HHCS) is a rare autosomal dominant disorder caused by mutations in the FTL gene, characterized by elevated serum ferritin levels without systemic iron overload and early-onset cataract. Misinterpretation of hyperferritinemia may lead to unnecessary investigations and treatment.<h4>Case</h4>We report a pediatric case with familial involvement in which hyperferritinemia was incidentally detected in a 9-year-old boy. Laboratory evaluation revealed markedly elevated serum ferritin levels with normal transferrin saturation and no evidence of systemic iron overload. Genetic analysis identified a heterozygous c.-161C > <i>T</i> mutation in the FTL gene. In addition, a homozygous HFE c.187C > <i>G</i> (p.His63Asp) variant was detected. Family screening revealed similar biochemical and genetic findings in multiple relatives, several of whom had bilateral cataracts.<h4>Conclusion</h4>This case underscores the importance of considering HHCS in pediatric patients presenting with hyperferritinemia and normal transferrin saturation. The coexistence of FTL mutation and HFE H63D homozygosity appears to be incidental and should be interpreted cautiously. Recognition of this condition is essential to prevent unnecessary investigations and inappropriate treatment.

VRK2
Also flagged:Constriction Injuryhypersensitivitychronic constriction injurysynapsebindingNeuropathic Pain
Journal Article 2026-07-14 ✓ 5 Snippets Chen P, Wu J, Tang S, Gong Q, Wang C, Wang W, Wu Y, Tang T, Luo R, Wu Z, Qin Z, Wang L.
In-Text Gene Mentions

…vaccinia-related kinase 2 (VRK2) as the top…

…Nono, indicating thatVRK2might act as…

VRK2was identified through…

…should determine whetherVRK2directly regulates Nono…

…whether manipulation ofVRK2affects Kcnq2 expression,…

Show Full Abstract

Neuropathic pain, resulting from somatosensory nervous system damage or disease, is a debilitating condition marked by spontaneous pain, hypersensitivity, and sensory abnormalities. Neuropathic pain involves spinal neuronal hyperexcitability, yet its molecular basis remains poorly defined. We utilized a comprehensive multi-omics approach, incorporating proteomics, phosphoproteomics, concatenated tandem array of consensus transcription response elements, and both single-cell and spatial transcriptomics, to chart time-resolved adaptations in the L4 to L6 spinal cord of a chronic constriction injury rat model. Multi-omics revealed remodeling of glutamatergic synapse pathways and identified non-POU (Pit-Oct-Unc) domain-containing octamer binding (Nono) as a down-regulated transcription factor associated with reduced potassium voltage-gated channel subfamily Q member 2 (Kcnq2) expression. Nono and Kcnq2 were co-enriched in neurexin 3-positive and peripherin-positive spinal neurons. Restoring Nono expression up-regulated Kcnq2, enhanced K<sup>+</sup> outward currents (an effect largely abolished by the Kcnq2/3 blocker XE991), and alleviated pain hypersensitivity. Mechanistically, Nono was enriched at a conserved Kcnq2 promoter region in vivo and enhanced Kcnq2 promoter activity in reporter assays. Together, these findings established a Nono-Kcnq2 transcriptional axis that constrained spinal excitability and suggested a therapeutic entry point for neuropathic pain.

Also flagged:Ovarian Cancertumorepithelial ovarian cancerbindinggynecologic malignanciescancer
Journal Article 2026-07-14 No Snippets Ma Y, Chen Z, Shen X, Ding F, Liu N, Yu S, Xu JK, Li H, Lu A, Zhang H, Zhong C, Zhang Y, Li F, Yang DH, Tang T, Zhang BT, Zhang G.
Show Full Abstract

Paclitaxel resistance and poor tumor selectivity remain significant challenges in epithelial ovarian cancer therapy. To overcome these challenges, we engineered PSaA360, a structurally constrained aptamer-drug conjugate with a dual-functional molecular lock that simultaneously rigidifies the AS1411 aptamer and delivers potent telomerase inhibition. Unlike the conformational flexibility of conventional aptamer-drug conjugates, PSaA360 employs the G-quadruplex stabilizer 360A to simultaneously rigidify the AS1411 aptamer into a high-affinity conformation and deliver potent telomerase inhibition. This structure-constrained and therapy-integrated strategy improved nucleolin binding, enhanced cellular internalization, and counteracted paclitaxel chemoresistance. In vivo, PSaA360 exhibited marked tumor inhibition with minimal systemic toxicity. By transforming a therapeutic agent into a structural stabilizer, PSaA360 establishes a new paradigm for mechanism-guided aptamer engineering in chemotherapy-resistant malignancies.

PRDX6
Also flagged:amyotrophic lateral sclerosisALSsporadic ALSneurodegenerative diseasepathogenesisaxonal
Journal Article 2026-07-14 ✓ 3 Snippets Baskar K, Steffke C, Bernsen S, Elmas Z, Hesebeck-Brinckmann J, Schuster J, Meyer T, Weydt P, Weishaupt J, Brenner D, Catanese A.
In-Text Gene Mentions

…idative stress-related markersPRDX6and ENO2, compared…

…HBA1, ENO2, andPRDX6in C9orf72-ALS samples,…

…in ENO2 andPRDX6, markers linked to…

Show Full Abstract

<h4>Background and objectives</h4>CSF proteomics has emerged as a valuable strategy for identifying diagnostic and prognostic biomarkers in amyotrophic lateral sclerosis (ALS). However, the limited availability and volumes of CSF samples restrict the broader clinical application of CSF-based biomarker panels. To address this challenge, we investigated whether the novel nucleic acid-linked immuno-sandwich assay (NULISA) multiplex platform-capable of quantifying multiple neural, glial, and inflammatory markers from minimal biofluid volumes-could validate previously proposed biomarkers and identify additional candidates relevant to ALS.<h4>Methods</h4>Using this platform, we measured a targeted panel of 131 biomarkers in cohorts of patients with C9orf72-associated ALS, sporadic ALS (sALS), and matched healthy controls.<h4>Results</h4>The 6 markers neurofilament heavy chain (NEFH) and neurofilament light chain (NEFL), chitinases-particularly chitotriosidase-1 (CHIT1) and chitinase-3-like protein-1 (CHI3L1), and chemokines CCL2 and CCL3 were significantly elevated in both ALS groups compared with controls. These biomarkers correlated with disease progression and demonstrated strong diagnostic performance when combined into aggregate scores, as reflected by a high area under the receiver operating characteristic curve for ALS. Notably, C9orf72-ALS patients exhibited higher levels of the oxidative stress-related markers PRDX6 and ENO2, compared with sALS patients, suggesting a genotype-specific molecular signature.<h4>Discussion</h4>Overall, our findings support the use of a multiplexed panel of diverse, inflammatory, glial, and neurodegeneration-associated biomarkers as a complementary diagnostic and prognostic tool alongside established measurements of neurofilaments. This approach may enhance biomarker robustness while minimizing CSF volume requirements, thereby improving clinical feasibility in ALS research and care.

CSE1L
Also flagged:rapid eye movement sleep behavior disorderextracellularvesiclesPDextracellular matrixmetabolism
Journal Article 2026-07-14 ✓ 3 Snippets Zhou Y, Zhang W, Lu Y, Zhou Y, Xu X, Chen Z, Li H, Jiang C, Zhao Z.
In-Text Gene Mentions

…as COL3A1+NRGN andCSE1L) that provide high…

…MMP7, ENSA, POLR3E,CSE1L, ACTA2 and negatively…

…negatively associated withCSE1Land LTF, pointing…

Show Full Abstract

<h4>Background</h4>Parkinson's disease (PD) is clinically heterogeneous, and the presence of rapid eye movement sleep behavior disorder (RBD) defines a distinct and aggressive subtype. There is an urgent need for molecular biomarkers to understand and identify these subtypes. Neuron-derived extracellular vesicles (nEVs) provide a window into brain pathology.<h4>Methods</h4>In this pilot study, we isolated plasma nEVs via L1CAM immunocapture from 28 subjects (PD-RBD, PD-noRBD, and controls). Proteomic analysis was performed using data-independent acquisition mass spectrometry (DIA-MS).<h4>Results</h4>We quantified 1354 proteins. Comparative analysis revealed 239 differentially expressed proteins (DEPs) between PD-RBD and PD-noRBD. PD-RBD patients exhibited significantly higher levels of α-synuclein (SNCA) and showed pronounced enrichment in extracellular matrix remodeling (eg, NRGN, ELAV3) pathways. In contrast, PD-noRBD was characterized by dysregulated lipid metabolism (eg, APOE, CETP) and systemic inflammation. Specific DEPs correlated with motor severity, autonomic dysfunction, and brain iron deposition.<h4>Conclusion</h4>This pilot study reveals distinct proteomic profiles between the plasma nEVs of PD-RBD and PD-noRBD, suggesting divergent pathophysiological processes involving structural/extracellular matrix remodeling versus systemic metabolic-inflammatory pathways. These findings provide a prioritized panel of candidate nEV biomarkers for subtype-specific stratification in PD, which warrant further large-scale clinical and functional validation.

PRDX6
Also flagged:Ferroptosisdeathcervical cancermitochondrialgynecological malignanciescancer
Journal Article 2026-07-14 ✓ 2 Snippets Sun Q, Wang D, Zhao Q, Cui Y, Zhang Y, Pi Y, Liu H, Wang Z.
In-Text Gene Mentions

…enzyme peroxiredoxin 6 (PRDX6) and peroxide-responsive prot…

…altered TXN2 andPRDX6expression.…

Show Full Abstract

Ferroptosis, an iron-dependent form of regulated cell death driven by lipid peroxidation, has emerged as a promising therapeutic strategy for cervical cancer. However, the mitochondrial factors governing ferroptosis sensitivity in this malignancy remain incompletely understood. PET117, a conserved mitochondrial protein, has been implicated in mitochondrial homeostasis, yet its role in ferroptosis regulation and cervical cancer pathophysiology is unknown. Here, we report a novel role of PET117 in regulating ferroptosis. PET117 expression was significantly elevated in cervical cancer tissues and loss of <i>PET117</i> in HeLa cells markedly suppressed erastin- and RSL3-induced ferroptosis. Mechanistically, <i>PET117</i> deficiency attenuated intracellular reactive oxygen species (ROS) accumulation, lipid peroxidation, and iron overload. Mitochondrial proteomics and RNA-seq revealed extensive remodeling of the mitochondrial proteome and ferroptosis-related transcriptional networks upon PET117 depletion. Notably, integrative analysis of mitochondrial and nascent proteomes identified acyl-CoA synthetase family member 2 (ACSF2) as a downstream target of PET117. These findings establish PET117 as a novel regulator of ferroptosis in cervical cancer, thereby linking mitochondrial function to ferroptosis regulation.

BTN3A3
Also flagged:SarcomasGene Expressionmethylationsarcoma-mediatedcell adhesion
Journal Article 2026-07-14 ✓ 5 Snippets Liu F, Zhao S.
In-Text Gene Mentions

…High Expression ofBTN3A3Acts as an…

…3 member A3 (BTN3A3) may be used…

…(GEO), we detectedBTN3A3in normal and…

…results showed thatBTN3A3expression was higher…

…The expression ofBTN3A3was regulated by…

Show Full Abstract

<h4>Background</h4>Butyrophilin subfamily 3 member A3 (BTN3A3) may be used as a prognostic biomarker for various malignancies. However, there is little evidence on the role of BTN3A3 in sarcomas.<h4>Methods</h4>Using data from the Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO), we detected BTN3A3 in normal and sarcomas tissues. Then we further evaluated clinical relevance, prognostic significance, genetic alternations, DNA methylation, co-expression gene and correlations with immune infiltration of BTN3A3.<h4>Results</h4>The results showed that BTN3A3 expression was higher in sarcoma tissues than in normal tissues. The expression of BTN3A3 was regulated by methylation and miRNA. Higher BTN3A3 expression was associated with a better prognosis of sarcomas than lower BTN3A3 expression. GSEA revealed that the JAK-STAT signaling pathway, cytokine-cytokine receptor interaction, NK cell-mediated cytotoxicity, T cell receptor signaling pathway, cell adhesion, and Toll-like receptor signaling were differentially enriched in patients with elevated BTN3A3 expression. The BTN3A3 expression were found to be positively correlated with immune infiltration, immune checkpoints. In the multivariate analysis, high BTN3A3 expression was found to be an independent risk factor for overall survival.<h4>Conclusion</h4>In conclusion, increased BTN3A3 expression is a significant predictor of better prognosis in patients with sarcomas.

OLFM4
Also flagged:Extracellularvesiclescancervesiclesmall intestinal neuroendocrine neoplasmssynapse
Journal Article 2026-07-14 ✓ 2 Snippets Burman J, Fan C, El Husseiny M, Riestra PV, Sandberg A, Zambirinis CP, Kotán R, Amorim L, Gimm O, Bojmar L.
In-Text Gene Mentions

…including olfactomedin 4 (OLFM4), previously linked to…

OLFM4, uniquely detected in…

Show Full Abstract

Despite widespread storage of frozen whole blood (FWB) in biobanks worldwide, its suitability for extracellular vesicle (EV) research remains largely unassessed. Here, we developed a robust and practical workflow for EV-based cancer biomarker analysis from FWB by comparing differential ultracentrifugation (dUC), size-exclusion chromatography, and their combination. All methods successfully recovered vesicles within the expected 50-150 nm range, enriched for canonical EV markers, while reducing blood-derived EV contaminants, and displayed vesicle-like morphology. Among tested methods, dUC emerged as the most cost-effective and labor-efficient approach. Applying this pipeline to biobanked FWB samples from patients with small intestinal neuroendocrine neoplasms yielded an average of ∼1,000 proteins detected per sample using mass spectrometry-based proteomics, including known neuroendocrine markers and enrichment in synapse organization signaling pathways. These findings demonstrate the feasibility of EV isolation from FWB and biomarker-relevant downstream analysis, highlighting the untapped potential of EV-based biomarker discovery across diseases from existing biobanks.

Also flagged:endometriosisadaptive immunitymethylationhistone modificationschromatingene expression
Journal Article 2026-07-14 No Snippets Xu W, Du J.
Show Full Abstract

The survival of ectopic endometrial lesions in endometriosis critically depends on their ability to evade immune recognition and clearance by the host, a process known as immune evasion. Recent studies suggest that this process is not driven by a single factor but rather results from a multidimensional, interactive regulatory network involving immune dysregulation, epigenetic remodeling, and metabolic reprogramming. The pathophysiology of endometriosis is characterized by reduced cytotoxic activity and functional exhaustion of effector immune cells, along with excessive activation and expansion of immunosuppressive cells, affecting both innate and adaptive immunity. The overexpression of immune checkpoint molecules further impairs immunological clearance. DNA methylation, histone modifications, and non-coding RNAs contribute to immune cell tolerance by stabilizing repressive transcription programs and silencing pro-inflammatory genes. These epigenetic mechanisms maintain a sustained immunosuppressive state through direct regulation of immune-related genes and hormone-metabolizing enzymes. Additionally, the hypoxic environment of ectopic lesions stimulates glycolysis, leading to the accumulation of metabolites such as lactate. Beyond directly impairing immune cell function, these metabolites act as signaling molecules or cofactors for epigenetic enzymes, thereby influencing chromatin states and gene expression, thus mechanistically and functionally linking metabolism to epigenetics. This review aims to systematically unravel this multidimensional mechanism, elucidate its synergistic role in disease progression, and potentially pave the way for future combined therapeutic strategies targeting this complex pathway. Such approaches offer a novel and promising means to overcome immune evasion and clinical resistance in endometriosis.

SUDS3
Also flagged:chromatincell cycleextracellularcell-cyclenon-small cell lung cancergene expression
Journal Article 2026-07-14 ✓ 1 Snippet Nisar H, Serçin Ö, Hellweg CE.
In-Text Gene Mentions

…multiple families —linker histoneshistones (H1-3, H1-4,…

Show Full Abstract

<h4>Introduction</h4>High-linear energy transfer (LET) radiation such as carbon ions exhibits greater biological effectiveness than conventional low-LET X-rays, but the transcriptional mechanisms underlying this advantage remain incompletely understood. We hypothesized that high-LET radiation induces a qualitatively different transcriptional response rather than simply amplifying low-LET signaling.<h4>Methods</h4>A549 non-small cell lung cancer cells were exposed to equal physical doses (8 Gy) of X-rays or carbon ions (LET 73 keV/µm), and transcriptomic profiling was performed 4 h post-irradiation. Differential expression analysis was integrated with Hallmark pathway enrichment using gene set enrichment analysis (GSEA), over-representation analysis (ORA), and leading-edge gene interrogation to identify shared and LET-dependent gene expression regulation.<h4>Results</h4>Both radiation modalities activated a conserved DNA damage response characterized by p53 signaling and apoptosis-related genes. In contrast, carbon ions selectively suppressed mitotic regulators including CENPE, KIF2C, PLK1, and BUB1, consistent with transcriptional disruption of the replication-segregation machinery. High-LET irradiation additionally enriched inflammatory and stress-associated pathways, including tumor necrosis factor (TNF), Nuclear Factor κB (NF-κB) and extracellular matrix and adhesion-related signatures annotated within the Hallmark epithelial-mesenchymal transition (EMT) gene set. Carbon ions also downregulated multiple core and linker histone genes, revealing a chromatin regulatory reprogramming signature although this may reflect modulation of mRNA stability linked to replication stress and cell-cycle progression. KRAS-associated gene networks were enriched under high-LET conditions, reflecting convergence of stress-responsive signaling.<h4>Discussion</h4>At equal physical doses, high-LET carbon ion irradiation is associated with a transcriptional program distinct from that of low-LET X-rays, characterized by downregulation of mitotic and chromatin regulatory programs and selective engagement of stress-associated signaling networks. These findings provide mechanistic insight into LET-dependent radiobiology and suggest transcriptional pathway remodeling may contribute to the enhanced biological effectiveness of carbon ions.

SERPINC1
Also flagged:venous thromboembolismextracellular matrixglycocalyxNSnephrotic syndromeorganization
Journal Article 2026-07-14 ✓ 5 Snippets Liu X, Ma J, Lyu Y, Zhang X, Song W, Yang P, Zhai Z, Fan G, Wang D.
In-Text Gene Mentions

…POSTN, SDC1, MMP2,SERPINC1, APOA1, PCSK9, and…

… (matrix metalloproteinase-2),SERPINC1(also known as…

…as antithrombin III [ATIII]), APOA1 (apolipoprotein A1),…

SERPINC1(ATIII) was significantly…

…SERPINC1 (ATIII) was significantly higher…

Show Full Abstract

<h4>Background</h4>Nephrotic syndrome (NS) carries a high and heterogeneous risk of venous thromboembolism (VTE). Hypercoagulability has been considered as key factors, but in-depth molecular mechanisms remain unrevealed.<h4>Objectives</h4>We aimed to identify patients with NS who are under higher risk for VTE and explore key pathways and molecules using proteomic profiling.<h4>Methods</h4>Serum proteomic data from 49 patients with NS were analyzed via unsupervised consensus clustering (top 1000 variable proteins, <i>K</i> = 2) and gene set variation analysis. Differentially expressed proteins were identified, and a protein-protein interaction network was constructed to pinpoint hub proteins. The levels of hub proteins were compared between the clusters, and their correlation with clinical biomarkers of renal function were analyzed. The cumulative incidence of VTE over 2 years was the primary end point. Trajectory analysis was performed to reveal the dynamic changes of renal function of each cluster.<h4>Results</h4>Unsupervised clustering stratified 2 clusters. Cluster 2 had numerically higher prevalence of both baseline and cumulative VTE than in cluster 1 (43% vs 11%; <i>P</i> = 0.13 for baseline VTE; and 58% vs 22%; <i>P</i> = .074 for cumulative VTE) and had enriched activity in extracellular matrix organization and cell-cell interaction pathways. Differentially expressed protein analysis found 145 upregulated proteins in cluster 2, and protein-protein interaction network analysis identified 9 candidate hub proteins (CTNNB1, VCAN, POSTN, SDC1, MMP2, SERPINC1, APOA1, PCSK9, and LIPC), all significantly elevated in cluster 2, and MMP2 and POSTN were associated with markers of tubular injury.<h4>Conclusion</h4>Serum proteomics analysis identified a group of patients with NS who were potentially at higher risk of developing VTE. Extracellular matrix and endothelial glycocalyx damage might play an important role in VTE development among patients with NS.

medRxiv 2026-07-14 Preprint (No Snippets API) Hu S, Zhu P, Wu S, Gao S, Wang R, Liu F, He Y, Han Z, Wang T, Wang M, Ren C, Ji X, Zhao W, Li S, Liu G.
Show Full Abstract

Transient ischemic attack (TIA) is a critical harbinger of subsequent stroke, and most genetic risk remains uncharacterized. Here we firstly performed the largest TIA genome-wide association study (GWAS) meta analysis in 1,332,453 European individuals (58,976 cases and 1,273,477 controls), followed by an independent replication in 610,409 non-European individuals (23,557 TIA and 586,852 controls), a multi-ancestry GWAS meta analysis in 1,942,862 individuals (82,533 cases and 1,860,329 controls), and a cross-trait GWAS meta-analysis of TIA with stroke and its subtypes. We identified 44 loci including 25 known stroke loci and 19 TIA specific loci ( CELSR2 , SLC4A7 , CASC15 , SRRM3 , SLC44A1 , LOC107984361 , GSE1 , LOC105372530 , HCG20 , OXR1 , SLC4A1 , RBBP8 , TUSC3 , DCC , PALMD , ZNF475 , CTAGE1 , FUT2 and MRPS6 ). Post-GWAS pinpointed 51 high confidence genes (24 are potential therapeutic targets) and 13 statistically significant pathways including protein-lipid complex, neurofibrillary tangle, high-density lipoprotein particle. These findings provide critical insights into the genetic basis of TIA.

medRxiv 2026-07-14 Preprint (No Snippets API) Margelyte R, Dardani C, Hanson AL, Shen X, Havdahl A, Rai D, McIntosh AM, Wray NR, Davey Smith G, Hemani G, Bullmore ET, Gaunt TR, Khandaker GM.
Show Full Abstract

Distinguishing causal biology from confounding or downstream consequences of psychiatric disorders remains a key barrier for drug development in psychiatry. We performed a large-scale proteogenomic investigation using a sequential triangulation framework integrating plasma proteomics, Mendelian randomisation, genetic colocalisation, transcriptomics, rare-variant analyses, and clinical phenotyping to identify causal proteins and prioritise therapeutic targets for depression, anxiety, bipolar disorder, and psychotic disorders. Using 2,920 plasma proteins measured in 52,615 UK Biobank participants, we identified 830 protein-disorder associations involving 574 proteins. Mendelian randomisation and colocalisation prioritised 26 proteins with putative causal effects, of which 17 are potentially druggable. Integrating multi-omic and phenotypic evidence ultimately resulted in five high-confidence causal candidates: DDR1 and LTB for depression, DDR1 for anxiety, DSG3 and PBXIP1 for bipolar disorder, and PDIA3 for psychosis. These findings provide convergent evidence implicating neuroimmune and neurodevelopmental pathways in psychiatric disorder biology, while also identifying potentially tractable targets for therapeutic development.

ARFGEF2
Also flagged:axonslocalizationmembraneaxonalaxoncytoskeleton
Journal Article 2026-07-13 ✓ 3 Snippets Bonacossa-Pereira I, Le D, Coakley S, Hilliard MA.
In-Text Gene Mentions

…(also known asARFGEF2), which is capable…

ARFGEF2is the human…

…(also known asARFGEF2), is associated with…

Show Full Abstract

Neurites of sensory neurons innervate the skin and are embedded within it. These delicate structures are chronically exposed to mechanical strain and yet their integrity is maintained throughout life. In C. elegans, UNC-70 (a β-spectrin protein) functions in synergy with the small GTPase RAB-35 within the skin to stabilize neuron-epidermal attachment against mechanical strain and prevent movement-induced damage to mechanosensitive axons. However, the molecular pathway regulating these specialized attachments remains elusive. Here, through an unbiased genetic screen, we have identified a guanine nucleotide exchange factor (GEF), AGEF-1, that impacts axonal maintenance. This molecule is known to function in endocytic recycling and its human ortholog, BIG2 (also known as ARFGEF2), is associated with the development of the periventricular nodular heterotopia. We show that AGEF-1 functions selectively within the skin to regulate axonal integrity of mechanosensitive neurons. Mechanistically, we reveal that AGEF-1 binds to epidermal RAB-35 and regulates its activity, modulating neuron-epidermal attachment stability. Finally, we demonstrate that this GEF is highly conserved, with its human ortholog BIG2 being capable of replacing AGEF-1. Together, we reveal the molecular machinery responsible for fine-tuning neuron-epidermal attachments and maintaining axonal integrity during life.

Also flagged:Huntington's diseaseFriedreich's ataxiaHDFRDAneurodegenerative disorderstranslational
Journal Article 2026-07-13 No Snippets Mundada AR, Badikol AR, Mangu K.
Show Full Abstract

Huntington's disease (HD) and Friedreich's ataxia (FRDA) are progressive inherited neurodegenerative disorders caused by trinucleotide repeat expansions but characterized by distinct pathogenic mechanisms. HD arises from a coding-region CAG expansion in the HTT gene that produces toxic gain-of-function effects of mutant huntingtin (mHTT), whereas FRDA results primarily from intronic GAA repeat expansion in FXN, leading to epigenetic repression and frataxin deficiency. The emergence of CRISPR-based genome engineering has created new opportunities to address these diseases at their genetic origin. This review examines current CRISPR therapeutic strategies for HD and FRDA, including allele-specific editing, transcriptional suppression, repeat excision, epigenetic reactivation, and emerging precision editing approaches such as base editing and prime editing. We compare the molecular rationale, preclinical outcomes, and translational limitations associated with each approach while highlighting how disease architecture influences therapeutic design. Although preclinical studies demonstrate promising restoration of cellular phenotypes and functional improvement, significant barriers remain. Efficient delivery to the central nervous system and cardiac tissue, control of editing duration, immune responses, off-target activity, and emerging concerns regarding on-target genomic instability continue to limit clinical translation. Recent advances in delivery engineering, non-viral systems, and programmable editing platforms suggest that future therapeutic success will depend on integrating disease-specific biology with increasingly precise and controllable genome engineering technologies. Ethical and regulatory concerns remain substantial, particularly regarding informed consent in the context of cognitive decline and the irreversibility of genomic modification.

Also flagged:Obesitytype 2 diabetescardiovascular diseasecancersbehavioralSyndromic obesity
Journal Article 2026-07-13 No Snippets Serbis A, Kantza E, Garoufou M, Christou M, Siomou E, Tigas S.
Show Full Abstract

<h4>Purpose</h4>Obesity is a major global health crisis with rising prevalence in both pediatric and adult populations, leading to an increased risk of cardiovascular, metabolic, and other chronic complications affecting all organ systems. A clear understanding of the genetic contributors to polygenic, syndromic, and monogenic obesity is essential for early diagnosis and targeted management.<h4>Methods</h4>Advances in genome-wide association studies (GWAS) and sequencing technologies have greatly expanded our understanding of the genetic alterations underlying this multifaceted disease and have helped in delivering personalized treatment.<h4>Results</h4>The pathogenesis of common, polygenic obesity is related to a complex interplay between genetic susceptibility and environmental factors. Syndromic obesity, a less common form, is characterized by early-onset accompanied by additional features such as developmental delay, dysmorphic traits, and various organ system involvement. The rarest form, monogenic obesity, is characterized by severe early-onset non-syndromic obesity caused by mutations in single genes regulating appetite within the hypothalamus. These monogenic obesity cases, though infrequent, have been instrumental in elucidating key pathways involved in hunger and satiety.<h4>Conclusion</h4>This review provides a comprehensive summary of the most recent findings on the genetic basis of obesity across all age groups, highlighting clinical implications and emerging therapeutic opportunities.

SERPINC1
Also flagged:immune thrombocytopeniapolycystic kidney diseasecyst infectionrenal cyst infectionhematomarenal cyst
Journal Article 2026-07-13 ✓ 1 Snippet Iwamura N, Matsukuma Y, Iwamura K, Zhang Y, Yamada S, Nakamura K, Sakoda T, Kanaji S, Nakano T, Ago T.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

A 65-year-old man with polycystic kidney disease who had undergone living-donor kidney transplantation presented with fever and left flank pain and was diagnosed with renal cyst infection. Combination antimicrobial therapy with levofloxacin, clindamycin, meropenem, and teicoplanin was initiated. His platelet count was 257,000/µL on day 5; however, it abruptly declined overnight to below the lower limit of detection (< 2,000/µL). He subsequently developed a massive retroperitoneal hematoma, presumably due to hemorrhage from the infected renal cyst, and required emergency selective arterial embolization. Drug-induced immune thrombocytopenia was strongly suspected, and all recently initiated medications were discontinued. He was treated with high-dose intravenous dexamethasone and intravenous immunoglobulin, leading to a transient recovery of the platelet count. However, thrombocytopenia recurred during prednisolone tapering. Although drug-dependent platelet-reactive antibodies were not detected in the patient's serum, teicoplanin was considered a plausible causative agent based on pharmacokinetic considerations and previous reports; however, the causative drug could not be definitively identified. This case illustrates fulminant thrombocytopenia highly suggestive of drug-induced immune thrombocytopenia in which the platelet count fell to an undetectable level overnight. In patients receiving multiple drugs, clinicians should remain vigilant for drug-induced immune thrombocytopenia and should closely monitor platelet counts during treatment.

Also flagged:Stress granulescytoplasmicresponse to environmentalStress granule formationinfectionsorganelles
Journal Article 2026-07-13 No Snippets Demeshkina NA, Ferré-D'Amaré AR.
Show Full Abstract

Stress granules are large cytoplasmic bodies formed in response to environmental insults by eukaryotic cells. Stress granule formation is key for post-stress recovery, and many diseases and infections are characterized by dysregulation of these membraneless organelles. How specific and non-specific macromolecular interactions drive the formation of stress granules and other large assemblies is an area of active research. Stress granules are comprised of dense, ~200 nm cores, and these are known to contain numerous RNAs and proteins. Now, we have discovered that more than half of the nucleic acid content of stress granule cores is circular, double-stranded DNA. We demonstrate cytologically that these extrachromosomal circular DNAs (eccDNAs) colocalize cytoplasmically with canonical stress granule marker proteins in HEK293T cells, and through CRISPR targeting in budding yeast, that they are required for stress granule formation upon stress. This discovery thus reveals a key function for eccDNA in the eukaryotic stress response.

HFE
Also flagged:Pancreatic Ductal AdenocarcinomaPDACcell-cycletumorstumorG1-phase
Journal Article 2026-07-13 ✓ 1 Snippet Rubbino F, Greco L, Scagliotti A, Di Cristofaro A, de Murtas V, De Simone G, Forciniti S, Grizzi F, Bianchi P, Basso G, Lambroia L, Kunderfranco P, Cappello P, Novelli F, Doglioni C, Colombo P, Mazzone M, Falconi M, Zerbi A, Malesci A, Laghi L.
In-Text Gene Mentions

…the association betweenHFEH63D polymorphism and…

Show Full Abstract

<h4>Purpose</h4>Controversy exists regarding the association between HFE H63D polymorphism and pancreatic ductal adenocarcinoma (PDAC). This study initially assessed the frequency of H63D in PDAC patients and subsequently investigated correlations between genotype and disease phenotype.<h4>Experimental design</h4>H63D prevalence was determined by genotyping 795 PDAC patients from two retrospective cohorts of unselected (n = 389) or surgically resected (n = 171) individuals, and one prospective cohort of resectable cases (n = 235). Associations between H63D status and clinicopathological variables were retrospectively evaluated in unselected patients and prospectively validated in surgical candidates. The phenotypic impact of H63D carriage was also investigated using a genetically engineered KCH67D murine model and PDAC cell lines. Spatial transcriptomics was applied to human PDAC samples to define genotype-associated microenvironmental and cell-cycle alterations.<h4>Results</h4>H63D prevalence was higher in patients with resectable PDAC (37.7%, 37.4%, and 34% across cohorts) than in those with unresectable disease (22.4%) or the general population (24.1%). Despite this, resected H63D carriers had significantly worse outcomes, with the variant emerging as an independent predictor of shorter disease-free survival (p = 0.002). Consequently, KCh67d mice developed earlier, larger tumors with increased metastatic spread. H63D PDAC cells and tumor spatial transcriptomic showed enhanced invasiveness, G1-phase accumulation, and TGFβ-independent EMT activation.<h4>Conclusions</h4>The H63D variant is strongly associated with PDAC resectability and, paradoxically, with a poorer post-surgical outcome. Activation of a TWIST1-dependent EMT program within a G1-enriched cellular context underlies the more aggressive phenotype of H63D PDAC, possibly accounting for the clinical conundrum.

Also flagged:colorectal neoplasiaadenomacolorectal canceralcoholcancerfunctional
Journal Article 2026-07-13 No Snippets To HTT, Vu NTH, Tong HND, Nguyen DTA, Phan TDA, Ngo DQ, Hiyama T, Quach DT.
Show Full Abstract

<h4>Objective</h4>Several studies have investigated colorectal neoplasia (CRN) in Vietnamese patients who present with lower gastrointestinal symptoms. However, data on subjects without symptoms is limited. This study aimed to determine the prevalence and risk factors for CRN in asymptomatic Vietnamese adults.<h4>Methods</h4>This was a prospective, cross-sectional, single-center study. Participants were consecutively recruited from asymptomatic individuals who were self-selected to undergo self-funded screening colonoscopy. CRN was defined as the presence of adenoma, sessile serrated lesions, or colorectal cancer. Advanced CRN included adenoma ≥ 1 cm, with villous features or high-grade dysplasia; sessile serrated lesion ≥ 1 cm or with dysplasia; traditional serrated adenoma; or colorectal cancer. Multivariable logistic regression was performed to identify independent risk factors for CRN, adjusting for age, sex, BMI, family history of colorectal cancer, smoking status, and alcohol consumption.<h4>Results</h4>There were 714 patients, with a median age of 51 (18-79 years) and a female-to-male ratio of 1:1.46. In this screening-attending cohort, the prevalence of overall CRN and advanced CRN were 26.2% and 9.0%, respectively. In the multivariate analysis, factors significantly associated with CRN included increasing age per 10-year increment (odds ratio [OR]: 1.76; 95% confidence interval [CI]: 1.47-2.11; p < 0.001), body mass index ≥ 23 kg/m2 (OR: 1.70; 95% CI: 1.16-2.50; p = 0.006), alcohol consumption (OR: 1.83, 95% CI: 1.10-3.04, p = 0.020), and family history of colorectal cancer (OR: 2.43; 95% CI: 1.36-4.37; p = 0.003).<h4>Conclusions</h4>CRN was prevalent in this self-selected screening-attending cohort in a private clinical setting. Increasing age, overweight, and family history of colorectal cancer were independent factors associated with CRN.

Also flagged:hepatocellular carcinomachromosomebindingcell adhesionangiogenesisacute myeloid leukemia
Journal Article 2026-07-13 No Snippets Liang XJ, Albertini C, Kronenberger T, Shevchenko E, Rasch A, Berger BT, Schwalm M, Berger LM, Krämer A, Serafim RAM, Forster M, Chaikuad A, Bolognesi ML, Müller S, Poso A, Laufer S, Knapp S, Gehringer M.
Show Full Abstract

The tyrosine kinase expressed in hepatocellular carcinoma (TEC) family comprises five nonreceptor tyrosine kinases─BTK, ITK, BMX, TXK, and TEC─with key roles in immune signaling. Although BTK and ITK have been extensively studied, selective inhibitors for TEC, TXK, and BMX remain scarce. Recently, we identified 7-azaindole-based covalent BMX inhibitors with potent inhibitory activity and robust cellular target engagement but limited selectivity across TEC family members, especially BTK. Here, we describe a new generation of BMX inhibitors designed to exploit subtle structural differences between BMX and BTK by incorporating diverse <i>N</i>-acylamino substituents at the azaindole 5-position or variations at the linker and warhead. Our compounds display subnanomolar BMX potency and improved selectivity over BTK and other TEC kinases. Key compound <b>11i</b> showed strong cellular target engagement, good <i>in vitro</i> metabolic stability, a favorable kinome profile, and rapid covalent inactivation kinetics, positioning it among the best BMX chemical probes currently available.

PRDX6
Also flagged:mitochondrialphosphorylationextracellularmitochondriaacidificationlocomotion
Journal Article 2026-07-13 ✓ 1 Snippet Tsukahara R, Kitajima Y, Ichihashi Y, Iwase H, Ohki S, Sotomaru Y, Kurosaki T, Kawano Y, Yasuda T.
In-Text Gene Mentions

…, Gclm ,Prdx6, and Gsta3…

Show Full Abstract

<h4>Background</h4>Calcium/calmodulin-dependent protein kinase II (CaMKII) is activated in skeletal muscle with exercise, yet its physiological role in endurance training adaptation remains unclear. This study determined whether endogenous CaMKIIγ/δ in skeletal muscle is required for endurance training-induced metabolic remodeling and exercise adaptation.<h4>Methods</h4>We generated male skeletal muscle-specific CaMKIIγ/δ knockout (CaMKII mKO) mice and assessed muscle phenotype, exercise capacity, and training adaptation. Acute exercise-induced CaMKII activation was evaluated by phosphorylation status. Transcriptomic changes were analyzed by RNA sequencing before and after 4 weeks of treadmill endurance training. Mitochondrial protein abundance, ultrastructure, and bioenergetics were examined by immunoblotting, transmission electron microscopy, and Seahorse extracellular flux analysis in myotubes with acute CaMKIIγ/δ deletion.<h4>Results</h4>Acute treadmill exercise induced CaMKII phosphorylation in muscle without altering total CaMKII abundance. CaMKII mKO mice showed normal muscle mass, grip strength, and baseline performance. However, endurance training-induced improvement in running capacity was significantly blunted. Transcriptomic analyses revealed downregulation of oxidative phosphorylation and glycolytic gene programs in CaMKII-deficient muscle at baseline and after training. OXPHOS complex protein abundance was partially reduced at baseline and markedly reduced across complexes I-V after training. CaMKII deficiency increased ultrastructurally abnormal mitochondria without reducing mitochondrial number. Consistently, CaMKII-deficient myotubes showed lower absolute per-well oxygen consumption and extracellular acidification rate.<h4>Conclusions</h4>In male mice, endogenous CaMKIIγ/δ in muscle is dispensable for baseline locomotor performance but essential for endurance training-induced metabolic remodeling and mitochondrial integrity. These findings support a role for CaMKII in linking contraction-induced calcium signaling to metabolic adaptation in muscle.

Also flagged:cognitive declinegene expressionorganizationAgingsynthesisreverse transcription
Journal Article 2026-07-13 No Snippets Carver CM, Gomez PT, Rodriguez SL, Redden JT, Latham AS, Ha Y, Kachergus JM, Liu Y, Shi J, Tran T, Wang L, Melov S, Thompson EA, Schafer MJ.
Show Full Abstract

Brain white matter undergoes structural and functional alterations linked to late-life cognitive decline, but the cellular and molecular basis of its selective vulnerability remains incompletely defined. Here, in naturally aged mice, we demonstrate that senescent and disease-associated microglia (DAM) phenotypes converge in hippocampal-adjacent white matter, particularly in the fimbria. Using regional gene expression profiling, immunolabeling, GeoMx digital spatial profiling and CosMx spatial molecular imaging, we identify an aged brain-exclusive microglial population concentrated in white matter that expresses DAM genes together with a 'SenBrain' senescence gene signature, including galectin-3 (GAL3/Lgals3). Single-cell spatial trajectory analyses suggest that multiple cell fate transitions may give rise to this aged, proinflammatory, senescent- and DAM-linked state. Pharmacogenetic or pharmacological senotherapeutic interventions reduced white matter GAL3<sup>+</sup> DAM abundance and restored a more youthful microglial organization in aged fimbria. These findings identify a senescence- and DAM-enriched microglial state as a prominent and partially reversible feature of aged brain white matter.

HTT
Also flagged:Major depressive disorderimmuneneurotransmissionInflammatory depressionanhedoniaIL-6
Journal Article 2026-07-13 ✓ 1 Snippet Juárez-Paredes FC, Juárez-Ugalde J.
In-Text Gene Mentions

…ortadores de serotonina (SERT/5-HTT), lo que podría…

Show Full Abstract

Major depressive disorder (MDD) is a highly prevalent and disabling condition, and although conventional treatments focused on monoaminergic neurotransmission have been helpful for many individuals, a substantial proportion of patients fail to achieve adequate symptom remission. Over the past decade, accumulating evidence has highlighted systemic inflammation as a central component in the pathophysiology of MDD, suggesting that immune dysregulation may characterize a distinct subgroup of patients. Activation of the immune system can adversely influence neurotransmission, impair neuroplasticity, disrupt the hypothalamic-pituitary-adrenal (HPA) axis, and promote glial cell activation, all of which can contribute to chronicity and resistance to standard therapies. This understanding has led to the proposal of "inflammatory depression" as a specific endotype within the broader depressive spectrum. Recognizing this profile is essential for advancing precision medicine and improving clinical decision-making. It is increasingly postulated that these patients may benefit from targeted anti-inflammatory strategies, including pharmacologic agents, nutraceuticals, structured physical exercise, and dietary interventions with immunomodulatory effects. Despite these promising avenues, more rigorous clinical trials are needed to establish standardized protocols and refine patient selection based on inflammatory biomarkers, ensuring more effective and personalized treatment approaches.

DCC
Also flagged:carcinoma in situcholangiocarcinomadistal cholangiocarcinomainvasive carcinomaPD
Journal Article 2026-07-13 ✓ 1 Snippet Shibata Y, Ono Y, Kiritani S, Kobayashi K, Oba A, Ito H, Inoue Y, Takahashi Y.
In-Text Gene Mentions

…poor survival inDCCafter PD, highlighting…

Show Full Abstract

<h4>Background</h4>The biological heterogeneity and oncological impact of R1 carcinoma in situ (R1cis) lesions in distal cholangiocarcinoma (DCC) remain unclear. This retrospective study evaluated the clinical significance of R1cis in patients with DCC undergoing pancreaticoduodenectomy (PD).<h4>Methods</h4>We retrospectively analyzed 151 patients who underwent PD for DCC between 2005 and 2023, excluding those with in-hospital mortality or distant metastasis. Based on the final pathological diagnosis, patients were classified into three groups: final R0, final R1cis, and final R1inv (invasive carcinoma).<h4>Results</h4>Fourteen patients (9%) had final R1cis and seven (5%) had final R1inv. The final R1cis group showed significantly worse overall survival (OS) than the final R0 group (median survival time: 34.3 vs. 114.7 months, p = 0.002). Preoperative and intraoperative analysis identified elevated preoperative CA19-9 (p < 0.001), preoperative modified Glasgow Prognostic Score (p = 0.038), and initial R1inv (p < 0.001) as independent predictors of poor OS. Postoperative analysis demonstrated that pancreatic invasion (p = 0.037), pT3/T4 (p = 0.023), final R1cis (p = 0.007), and final R1inv (p = 0.001) were independent prognostic factors. Recurrence occurred more frequently in the R1cis/R1inv group, with increased rates of both local and distant recurrence.<h4>Conclusion</h4>Final R1cis is an independent prognostic factor for poor survival in DCC after PD, highlighting the importance of achieving final R0 resection.

SHISA6
Also flagged:metabolismangiogenesischromosometransposonschromosomesautosomes
Journal Article 2026-07-13 ✓ 1 Snippet Li W, Su Y, Liu C, Lin X, Xue S, Badaoui B, Yan X, Lv Q, Su R.
In-Text Gene Mentions

…, MDGA1 ,SHISA6), cell cycle…

Show Full Abstract

High-altitude environments, characterized by hypoxia, intense ultraviolet radiation, and low temperatures, pose major challenges to livestock survival. In recent years, researchers have gradually uncovered adaptive mechanisms in livestock across different altitudes using whole-genome resequencing. Previous studies of goat altitude adaptation have been limited by small breed numbers and low sequencing depth, hindering comprehensive exploration of adaptive mechanisms across different altitudes. This study analyzed whole-genome resequencing data from 151 individuals across 17 goat breeds representing three distinct altitude gradients (high, middle, and low). Using both SNPs and structural variations (SVs), we characterized population relationships, gene flow, and the SV landscape, including QTL-SV associations and transposable element interactions. Selective sweep analyses using F<sub>ST</sub>, θπ ratio, XP-CLR, XP-EHH, and LFMM identified several candidate genes associated with altitude adaptation, including <i>ABCC4</i>, <i>RPS6</i>, <i>DSG4</i>, and <i>LY9</i>, which were significantly enriched in pathways related to hypoxia response, oxidative stress, energy metabolism, angiogenesis, and nervous system regulation. Notably, <i>ABCC4</i> showed ABCC4 showed recurrent candidate selection signals in both SNP and SV analyses, suggesting its potential involvement in altitude adaptation. These findings provide multi-level genomic evidence for goat adaptation to high-altitude stress and provide important insights into the adaptive evolution of goats.

Also flagged:dementiafirst spinocerebellar ataxia type 17SCA17primary dementia syndromecognitionHuntington disease
Journal Article 2026-07-13 No Snippets Zhang S, Zhang X, Li L, Zhou B, Shao W.
Show Full Abstract

<h4>Background</h4>Spinocerebellar ataxia type 17 (SCA17) is an autosomal dominant repeat-expansion disorder with marked phenotypic heterogeneity. Cognitive and neuropsychiatric symptoms may dominate early recognition and initially suggest a primary dementia syndrome. We aimed to illustrate diagnostic redirection in dementia-first SCA17 through integrated clinical, imaging, familial, and molecular assessment.<h4>Case presentation</h4>We describe the clinical course, neurological findings, cognitive and functional assessments, ancillary investigations, neuroimaging, pedigree information, and molecular genetic findings of a proband with SCA17 and one tested at-risk adult relative. To contextualize the family, we conducted a focused literature review of genetically confirmed SCA17 case and family reports identified through PubMed, Web of Science, Embase, China National Knowledge Infrastructure (CNKI), and Wanfang up to April 16, 2026.<h4>Findings</h4>Repeat-expansion testing established SCA17 in a proband who had initially presented through a dementia-first clinical pathway, with TATA-box binding protein (TBP) alleles of 37/51 repeats. Targeted presymptomatic cascade testing identified the same expanded 51-repeat allele in her asymptomatic adult daughter. Review of 25 published studies showed broad variation in age at onset, TBP repeat size, family context, presenting syndrome, and cumulative phenotype, including cognition-dominant, behavior-dominant, Huntington disease-like, parkinsonian, dystonic, choreic, seizure-associated, and atypical neuroimaging presentations.<h4>Conclusion</h4>The present family illustrates a dementia-first route to SCA17 recognition, in which the initial syndrome-based dementia interpretation remained etiologically provisional as cerebellar signs, cerebellar-predominant atrophy, autosomal-dominant family context, and TBP expansion were integrated. This case-based perspective is intended to support etiological reconsideration in selected dementia-first presentations, rather than to serve as validated clinical criteria.

TRIM38
Also flagged:cancerhepatocellular carcinomadeathdepolarizationmitochondrialmembrane
Journal Article 2026-07-13 ✓ 1 Snippet Hung MC, Chiou HL, Hsieh YH, Chen PN, Yu YL, Lee HL.
In-Text Gene Mentions

…ahydromagnolol (THM) targetingTRIM38-dependent PANoptosis and exhi…

Show Full Abstract

Licoricidin (LCD), a natural isoflavonoid compound extracted from Glycyrrhiza species, has been extensively demonstrated to possess diverse biological activities, including anti-inflammatory and potent anti-cancer effects. However, the precise mechanism underlying LCD action against hepatocellular carcinoma (HCC) remains unclear, particularly regarding its regulation of cell death. In this study, we comprehensively explored the effects of LCD on HCC cells <i>in vitro</i> and investigated its role and mechanism of action in the induction of PANoptosis. Our results reveal that LCD exhibited potent anti-HCC activities by decreasing cell viability and significantly inhibiting clonogenic survival in HCC cell lines. Our results demonstrate that LCD triggered a substantial accumulation of reactive oxygen species and induced depolarization of the mitochondrial membrane, leading to profound mitochondrial dysfunction. We further confirmed that LCD activated a comprehensive PANoptosis program by synchronously upregulating the expression of apoptotic proteins (Bax, c-CASP3, and c-PARP1), pyroptotic proteins (c-CASP 1 and c-GSDMD), and the phosphorylation of necroptotic executioners (p-MLKL and p-RIPK1). Treatment with the ROS inhibitor (NAC), apoptosis inhibitor (ZVAD), or necroptosis inhibitor (Nec-1) significantly reduced the expression of PANoptosis-related proteins in LCD-treated cells. Furthermore, molecular docking simulations and cellular thermal shift assay (CETSA) assay confirmed the direct and stable binding of LCD to PANoptosis-related proteins. In summary, we show for the first time that LCD exerts favorable anti-HCC activities via the induction of PANoptosis through a ROS-dependent mechanism and potntial direct modulation of core executive proteins. This multi-target action suggests that LCD could be a novel candidate for the management of hepatocellular carcinoma.

Also flagged:cell-divisiontumorgastric carcinomaSolid Tumorssolid tumormicrotubule
Journal Article 2026-07-13 No Snippets Ruedas P, Gruss H, Hempelmann A, Vranic M, Neuberth SJ, Petrich V, Gross D, Pálfi A, Pahl AM, Hechler T.
Show Full Abstract

Antibody drug conjugates (ADCs) enable selective delivery of highly potent small molecules, yet most clinically validated payloads target solely cell-division pathways with several drawbacks such as high off-target toxicity and a lack of efficacy on nondividing tumor cells (e.g., tumor stem cells). Metabolic targets such as nicotinamide phosphoribosyltransferase (NAMPT) offer a complementary mode of action and are predestined as ADC payloads since systemic toxicities have prevented clinical use of NAMPT inhibitors (NAMPTi) as free drugs. Here we show that highly hydrophobic NAMPTi, especially cyanoguanidine-containing inhibitors, are chemically and metabolically suboptimal for ADC deployment due to limited efficacy likely due to lysosomal conversion to inactive guanylureas. Guided by structure-based design, and molecular dynamics simulations, we developed two next-generation NAMPT inhibitors featuring (i) a tertiary alcohol to balance hydrophilicity and (ii) an isoindoline-urea group to improve lysosomal stability in comparison to the cyanoguanidine. The optimized inhibitors retained high affinity to the NAMPT enzyme and showed strong cellular activity upon targeted delivery through ADCs. When conjugated to anti-CD30, anti-HER2, or anti-TROP2 antibodies, the resulting ADCs showed durable responses in hematologic and solid tumor models, including complete regressions in the metabolically stringent NCI-N87 gastric carcinoma xenograft after a single 2 mg/kg dose. These findings highlight physicochemical tuning and lysosomal stability as key design principles for NAMPT-based payloads and support NAMPT inhibition as a very promising mode of action (MoA) for next-generation ADC therapeutics.

bioRxiv 2026-07-13 Preprint (No Snippets API) Al-Kurdi B, Hernandez JA, Lewis AH, Snyder LM, Markus SM, Swygert SG.
Show Full Abstract

<h4>SUMMARY</h4> SMC complexes influence virtually all DNA-dependent processes by organizing the genome via the process of loop extrusion. Although transcription has been implicated in regulating SMC complex function, the underlying mechanisms remain unclear. Further, the directionality of loop extrusion observed in biochemical experiments has been difficult to reconcile with the chromatin condensation observed in cells. Here, we use a quiescent yeast model to uncover the relationship between condensin loop extrusion and transcription. Condensin gradually relocates to transcribed gene promoters during quiescence entry, allowing us to dissect condensin targeting mechanisms temporally. Through targeted degradation experiments, we discover that topological stress generated by transcription leads to single-stranded DNA accumulation at promoters, and that these RPA-bound regions are loading sites and extrusion barriers for condensin. We further use a condensin mutant to determine that condensin extrudes loops asymmetrically in cells. We propose that antagonism by RPA universally regulates SMC complex function.

Also flagged:extracellularvesiclesgenetic diseasesgene expressionamyloidosisimmune response
Journal Article 2026-07-12 No Snippets Yang M, Song Y, Wang Z, Chao K, Li L, Zhang X, Duan X, Yu C, Xue R, Zhao J.
Show Full Abstract

Therapeutic genome editing has advanced rapidly with the development of diverse programmable nucleases, from zinc-finger nucleases and transcription activator-like effector nucleases to clustered regularly interspaced short palindromic repeats (CRISPR)-based systems such as base and prime editors. Despite these breakthroughs, clinical translation remains constrained by the challenge of achieving safe, efficient, and tissue-specific delivery. Viral vectors, particularly adeno-associated viruses, have enabled durable editing in selected organs but are limited by their restricted cargo capacity, immunogenicity, and complex manufacturing. Nonviral platforms, most notably ionizable lipid nanoparticles, have demonstrated remarkable efficacy for hepatic targets, with clinical trials reporting up to 93% protein knockdown after a single dose. An expanding set of emerging modalities, including virus-mimicking nanosystems, cell-derived extracellular vesicles, cell-penetrating peptides, and intelligent-responsive multifunctional scaffolds, further enriches the delivery toolbox by supporting transient expression and programmable targeting across diverse editors and tissues. Parallel advances in high-throughput barcoded screening and machine learning are accelerating vector optimization, while rational chemical modification of payloads improves in vivo stability and specificity. This review provides a comprehensive overview of current and emerging delivery systems for genome editing, highlighting key innovations, unresolved challenges, and interdisciplinary strategies poised to unlock broader therapeutic potential.

TNFSF4
Also flagged:cancertumorslung cancerstumormetastatic cancersinfections
Journal Article 2026-07-12 ✓ 1 Snippet Thapa B, Nishizaki D, Miyashita H, Lee S, Nesline MK, Previs RA, Conroy JM, Jensen TJ, DePietro P, Pabla S, Kato S, Kurzrock R.
In-Text Gene Mentions

…as TNFRSF4 andTNFSF4, respectively.…

Show Full Abstract

<h4>Background</h4>Preclinical data suggests a potential role for OX40 agonists in cancer treatment, though clinical trials have yielded modest results.<h4>Objectives</h4>We assessed OX40 and other immune checkpoint RNA expression in advanced solid malignancies and their clinical outcomes.<h4>Design</h4>We conducted a retrospective cohort study analyzing tissue samples from 514 cancer patients.<h4>Methods</h4>Immune marker transcripts were evaluated using a clinical-grade laboratory test. OX40 expression was normalized, and percentiles ranked as "moderate/low" (0-74) or "high" (75-100).<h4>Results</h4>High OX40 expression was found in 24% of tumors, primarily in esophageal, liver/bile duct, stomach, small intestine, and lung cancers. High OX40 was associated with increased expression of programmed death-1, cytotoxic T-lymphocyte-associated antigen-4, and forkhead box P3 but did not predict overall survival in immunotherapy-naïve patients or outcomes post-immunotherapy.<h4>Conclusion</h4>OX40 expression is heterogeneous and strongly associated with immunosuppressive checkpoints, potentially suggesting that effective use of OX40 agonists may depend on patient selection based on tumor immunomics.

Also flagged:Renal Cell CarcinomaRCCmelanomacell proliferationtumorkidney cancer
Journal Article 2026-07-12 No Snippets Yoshino H, Fukuda I, Enokida H, Seki N, Goto Y.
Show Full Abstract

<b>Background/Objectives</b>: Cabozantinib is a tyrosine kinase inhibitor that primarily targets MET. It has become an important drug in the treatment of renal cell carcinoma (RCC); however, many patients do not respond to cabozantinib treatment and there is no effective next-line therapy. In this study, we identified molecular-targeted drugs that exhibit synergistic effects with cabozantinib using CRISPR/Cas9 screening. <b>Methods</b>: A kinome-wide synthetic lethal CRISPR/Cas9 screen was used to identify target molecules using 786-o RCC cells. A library was generated, and treatment with vehicle or cabozantinib was carried out, followed by next-generation sequencing to identify candidate genes. A combination index based on the Chou-Talalay method was used to evaluate the synergistic effect of cabozantinib through cell viability assays. Xenograft assays were conducted to determine the effect in vivo. <b>Results</b>: CRISPR/Cas9-based screening revealed four genes (<i>MEK1</i>, <i>DCLK1</i>, <i>DYRK3</i>, and <i>FGFR1</i>) that were candidates for synthetic lethality by cabozantinib in RCC cells. We focused on MEK1 because the MEK1 inhibitor cobimetinib has been approved for melanoma treatment. In a cell proliferation assay using 786-o and A498 RCC cells, the combination of cobimetinib and cabozantinib exhibited a synergistic effect. A xenograft assay also revealed a significant synergistic effect of cobimetinib and cabozantinib. <b>Conclusions</b>: CRISPR/Cas9 screening identified MEK1 as a candidate for a synthetic lethal target with cabozantinib in RCC. The combined inhibition of MET/VEGFR and MEK1 suppressed compensatory MAPK reactivation and downregulated the PI3K-Akt pathway, including the survival-associated genes PPP2R3B and ATF6B, and produced significant tumor growth suppression in vivo. These findings highlight the potential of cabozantinib plus cobimetinib, an already-FDA-approved MEK inhibitor, as a readily translatable combination strategy to overcome cabozantinib resistance in RCC.

HFE
Also flagged:Celiac Diseasethyroid dysfunctionhypothyroidismglaucomaanemiahyperferritinemia
Journal Article 2026-07-12 ✓ 2 Snippets Karczewski T, Karczewski D.
In-Text Gene Mentions

…unexplained hyperferritinemia,HFEtesting and hepatology…

…T, gamma-glutamyl transferase;HFE, homeostatic iron regulator…

Show Full Abstract

<b>Background/Objectives:</b> Celiac disease (CD) is an immune-mediated enteropathy with gastrointestinal and extraintestinal manifestations. In primary care, recognition can be delayed when psychiatric symptoms, arthralgia, thyroid dysfunction, alcohol exposure, and liver-test abnormalities coexist. This case report describes a confounder-aware diagnostic approach to histologically confirmed CD in a patient with a multifactorial primary-care presentation. <b>Methods:</b> We report a single-patient, de-identified reflective case from routine family medicine practice, organized according to CARE case-report principles. <b>Results:</b> A woman in her early sixties with hypothyroidism and glaucoma presented with new low mood, anhedonia, somnolence, generalized anxiety, increased alcohol intake, poor appetite, weight loss, abdominal bloating, diarrhea, flatulence, and polyarthralgia. Initial investigations, including celiac serology obtained before gluten-free diet advice, showed mild anemia, marked hyperferritinemia, severe cholestatic and hepatocellular liver-test abnormalities, uncontrolled hypothyroidism, and strongly positive tissue transglutaminase IgA (>250 kIU/L; reference 0.0-14.9). Radiographs showed mild osteoarthritis and osteopenia without erosive arthropathy. Computed tomography excluded malignancy but showed severe diffuse hepatic steatosis and mild pancreatic atrophy. Mirtazapine was started at the index visit; after the initial laboratory results, gluten-free diet advice, alcohol-reduction counseling, and levothyroxine adjustment were undertaken. During the diagnostic episode, small-bowel biopsy demonstrated moderate-to-severe crypt hyperplastic villous atrophy with increased intraepithelial lymphocytes, and gastric biopsies showed no significant pathology; the histology was consistent with CD. Symptoms improved substantially. Longer-term objective follow-up showed persistent but improved celiac serology (tTG-IgA 49.4 kIU/L), normalization of thyroid-stimulating hormone, partial improvement in gamma-glutamyl transferase, which remained elevated, and a later iron-deficiency pattern with persistent anemia. <b>Conclusions:</b> This case supports targeted CD testing when anxiety or depressive symptoms occur alongside gastrointestinal symptoms, weight loss, arthralgia, hypothyroidism or documented thyroid autoimmunity, anemia, osteopenia, or liver-test abnormalities. Histology and repeat serology confirmed the diagnosis, but the psychiatric and hepatic manifestations still require cautious interpretation because hypothyroidism, alcohol exposure, steatotic liver disease, and simultaneous treatments also shaped the clinical course.

Also flagged:ADidiopathic normal pressure hydrocephalustraumatic brain injurycognitioncognitive impairmentAlzheimer's disease
Journal Article 2026-07-11 No Snippets Del Giovane M, Giunchiglia V, David MCB, Kolanko MA, Trender WR, Hellyer PJ, Kaur H, Sharp DJ, Carswell C, Malhotra PA, Hampshire A.
Show Full Abstract

<h4>Objective</h4>To assess the utility, accessibility, and equivalence to supervised scales of online cognitive assessment in older individuals with cognitive impairment.<h4>Methods</h4>Patients with Alzheimer's disease (AD, n = 31), idiopathic normal pressure hydrocephalus (iNPH, n = 26), and traumatic brain injury (TBI, n = 23) completed online cognitive tasks (Cognitron). We evaluated cognition relative to a large normative dataset (N ≈ 400,000), adjusting for device and demographics which can affect performance. Principal Component Analysis (PCA) was used to derive domain-specific and total composite scores. We compared clinical groups and correlated performance with standard assessments.<h4>Results</h4>Uptake was ~70%. PCA identified components across memory, processing speed, language, and executive functions. AD showed memory and language impairments compared with the norms and other groups. iNPH had greater executive and processing speed deficits, consistent with a subcortical impairment profile. TBI showed milder deficits in memory, working memory, and language. Cognitron total composite was associated with standard supervised tests (ADAS-Cog: β = -0.76, p < 0.001 and ACE-III: β = 0.69, p < 0.001). In iNPH, Cognitron composite predicted walking speed (estimate = 1.10, p < 0.001), a core clinical feature of the disease which is difficult to evaluate remotely. We selected five tasks with high completion rates, discriminability between conditions, and broad cognitive coverage. The derived short composite showed very high accuracy in separating AD (AUC = 0.94) and iNPH (AUC = 0.90) from age-matched norms; performance was weaker for TBI (AUC = 0.66).<h4>Interpretation</h4>Online assessment in older clinical populations is feasible and sensitive to subtle disease-specific cognitive deficits. A demographically adjusted, 15-min battery offers a scalable adjunct to standard testing, with potential to reduce burden on patients and healthcare systems.

Also flagged:mismatch repairHuntington's diseaseHDpathogenesisMismatch
Journal Article 2026-07-11 No Snippets Bunting EL, Panhale A, McColgan P, Koi M, Brundin P, Carethers JM.
Show Full Abstract

Somatic expansion of the HTT CAG repeat is a key feature of Huntington's disease (HD) pathogenesis. Mismatch repair (MMR) enzymes drive this process through erroneous DNA repair, with variants in MMR genes modifying the onset and progression of disease features. Cell-type-specific CAG repeat sizing recently confirmed that elevated somatic expansion underlies the selective vulnerability of HD medium spiny neurons, with expansion beyond certain CAG thresholds associated with distinct stages of cellular pathogenesis. In this review, we synthesise insights from post-mortem brain tissue, cell systems, and mouse models, detailing key CAG repeat-length-dependent changes. In addition, we critically evaluate the MMR proteins MSH3, MLH3, and PMS1 as therapeutic targets for slowing somatic expansion and outline key safety considerations for emerging MMR-modulating approaches.

OLFM4
Also flagged:Colorectal cancerwound healingdeathtumorwound-healingcancer
Journal Article 2026-07-11 ✓ 5 Snippets Sakahara M, Okamoto T, Kumegawa K, Natsume Y, Kusama D, Yamanaka H, Komatsuzaki R, Yaginuma K, Srivastava U, Takahashi-Kanemitsu A, Susaki EA, Obama K, Nagayama S, Maruyama R, Yao R.
In-Text Gene Mentions

…probes were used: Hs-OLFM4(#311041-C1), Hs-ASCL2-C2 (#31…

…that olfactomedin 4 (OLFM4) and leucine-rich repeat-cont…

…Expression levels ofOLFM4and LGR5 in…

…Low levels ofOLFM4and LGR5 were…

…do not containOLFM4+ or LGR5…

Show Full Abstract

Metastasis is the principal cause of death from colorectal cancer (CRC), yet the cellular states that enable tumor dissemination remain poorly defined. Disseminated tumor cells (DTCs) are rare, transient, and clinically inaccessible, limiting mechanistic insight into their biology. Here we show that CRC cells transiently adopt a wound-healing program normally used by epidermal keratinocytes during tissue repair to enable metastatic dissemination. Using serial orthotopic transplantation of patient-derived organoids to model metastasis, we find that DTCs lose cancer stem cell features and instead express wound-inducible keratins, including KRT17, before metastatic outgrowth. This state is reversible, as cells reacquire primary tumor-like characteristics upon colonization of distant organs. Mechanistically, this transition is associated with reduced EZH2 activity and activation of YAP signaling. Clinically, KRT17⁺ cells localize to the invasive front of primary CRCs and are absent from adjacent normal tissue. These findings uncover unexpected lineage plasticity across distinct developmental origins and identify a transient, targetable state critical for metastatic progression.

OLFM4
Also flagged:colitisinflammatory bowel diseasemetabolismdegradationulcerative colitisCD
Journal Article 2026-07-11 ✓ 3 Snippets Shang S, Liu J, Dai SY, Lv XX, Liu YX, Lu R, Wei YX, Xie RK, Shi QY, Shen CJ, Hua F.
In-Text Gene Mentions

… CTCTCCAGCATTCGTCAGTCCA; mouseOlfm4primers, Forward: AAAGTGACCTTG…

…by Lgr5 andOlfm4) and reserve stem…

…of Lgr5 andOlfm4(markers for CBCs),…

Show Full Abstract

Intestinal stem cell number or their regeneration ability is crucial for attaining mucosal healing. Deciphering the molecular mechanisms responsible for the impairment of intestinal stem cells in inflammatory bowel disease could yield innovative therapeutic insights. Altered bile acid metabolism is a hallmark feature of inflammatory bowel disease, typically characterized by elevated fecal levels of primary bile acids, such as glycocholic acid. However, the relationship between glycocholic acid and inflammatory bowel disease remains unclear. Here, we report that glycocholic acid accelerates inflammatory bowel disease progression through downregulating TRIB3 expression to disrupt intestinal stem cells self-renewal. TRIB3 is highly expressed in crypt cells and sustains intestinal epithelial stemness by preventing ID1 palmitoylation and AP3D1-mediated lysosomal degradation. Glycocholic acid is found to suppress TRIB3-ID1 axis, thereby compromising intestinal epithelium integrity. Notably, we identify Bergenin, a natural compound, as a potential therapeutic agent against inflammatory bowel disease via upregulating TRIB3. These findings highlight the TRIB3-ID1 axis as a promising therapeutic target for inflammatory bowel disease therapy.

Also flagged:synthesisCatalystmetalstransition metalsunsaturatedfuran
Journal Article 2026-07-11 No Snippets Athar R, Ahmad S, Khan SG, Zahoor AF, Hussain SM, Munawar S, Mushtaq A, Ahmad R, Said MA.
Show Full Abstract

Gold catalysis has played a pivotal role in modern synthetic chemistry, facilitating the construction of complex core structures in synthetic molecules as well as in natural products. Over time, gold catalysis has become well known for its functional group tolerance, mild conditions and environmentally benign attributes. This review summarizes key developments of gold catalyzed reactions for the synthesis of biologically active natural products reported since 2021, emphasizing the strategic role of gold catalysis in addressing key synthetic challenges and highlighting its growing importance as a powerful methodology in modern natural product synthesis and the synthesis of their analogues.

Also flagged:GlioblastomaGBMbrain tumorpathogenesisangiogenesisglioma
Journal Article 2026-07-11 No Snippets van de Langerijt KA, Kibria MG, Villa GR, Mineo M.
Show Full Abstract

Glioblastoma (GBM) is the most aggressive primary brain tumor, characterized by rapid progression, therapeutic resistance, and poor patient prognosis. Emerging evidence highlights the critical role of long non-coding RNAs (lncRNAs) in GBM pathogenesis, particularly through their interactions with RNA-binding proteins (RBPs). These interactions form complex regulatory networks that influence multiple GBM hallmarks, such as sustained proliferation, induction of angiogenesis, and immune evasion. Additionally, these interactions play a pivotal role in maintaining glioma stem-like cells, a subpopulation responsible for tumor recurrence and resistance to conventional therapies. Understanding the mechanistic basis of lncRNA-RBP interactions offers promising opportunities for therapeutic intervention. Targeting these networks could enable the development of novel and more effective treatment strategies. This review provides an in-depth analysis of the molecular mechanisms by which lncRNA-RBP complexes promote GBM development.

TNFSF4
Also flagged:LupusPathogenesisSystemic AutoimmunitySystemic lupus erythematosusSLEchronic autoimmune disorder
Journal Article 2026-07-11 ✓ 1 Snippet Netti GS, Troise D, Infante B, Rossini M, Camporeale V, De Luca F, Leccese G, Galloso F, Cuttano R, Sanguedolce F, Gesualdo L, Stallone G, Ranieri E.
In-Text Gene Mentions

…BANK1, TNFAIP3, andTNFSF4, modulates antigen presentati…

Show Full Abstract

Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder characterized by the loss of self-tolerance to nuclear and cytoplasmic antigens, triggering immune activation and tissue inflammation. Lupus nephritis (LN) is a major determinant of disease-related morbidity, disability, chronic kidney disease progression, kidney failure, and mortality in SLE, affecting approximately 30% of patients at diagnosis and up to 50-60% within the first decade. This review examines the disease's pathogenic mechanisms, emphasizing the innate immune system's role in the loss of self-tolerance and subsequent activation of the adaptive immune response. Mechanisms include dysregulated cell death pathways, impaired clearance of nucleic acid-containing debris and immune complexes, and involvement of antigen-presenting cells and other innate immune cells. These processes lead to the clonal expansion of autoreactive lymphocytes, generating effector T cells, memory B cells, and plasma cells that produce autoantibodies, resulting in renal injury. The review further explores the immunological processes driving kidney damage, beginning with autoantibody binding and immune complex deposition, followed by complement-mediated microvascular injury, kidney stromal cell activation, and leukocyte recruitment. Lastly, it discusses LN treatment strategies, from traditional to novel targeted therapies, with a focus on their systemic immunologic impacts and the protection of podocytes.

PRDX6
Also flagged:Chronic Rhinosinusitisinflammatory diseasepathogenesismucus secretionimmune responsesnasal polyps
Journal Article 2026-07-11 ✓ 1 Snippet Lee J, Jung SY, Kim HO, Lee JM, Singh MK, Kim SS, Oh TI, Park DC, Yeo SG.
In-Text Gene Mentions

…(OXR1), peroxiredoxin 6 (PRDX6), neutrophil cytosolic factor…

Show Full Abstract

Chronic rhinosinusitis (CRS) is an inflammatory disease of the sinonasal mucosa whose pathogenesis is characterized by complex interactions of immunological and environmental factors. The maintenance of normal sinonasal function requires a balance of sinus ostial patency, mucociliary clearance, and mucus secretion, and disruption of this balance can lead to CRS. Although many studies have examined the pathophysiology of CRS, the role of reactive oxygen species (ROS) remains incompletely understood. In this review, we analyzed 22 studies of CRS that examined the effects of ROS on epithelial barrier function, local immune responses, and tissue remodeling. The results from in vitro studies, animal models, and human tissue analyses suggest that ROS are not merely by-products of inflammation, but appear to function as key mediators in the pathophysiology of CRS, particularly in the formation and persistence of the CRS phenotype with nasal polyps (CRSwNP). In particular, CRSwNP is characterized by increased activity of enzymes in the dual oxidase (DUOX) and NADPH oxidase (NOX) families, mitochondrial dysfunction, and decreased activity of superoxide dismutase (SOD) and peroxiredoxin 2 (PRDX2). At the molecular level, these alterations increase the generation of ROS and impair antioxidant defense. At the cellular level, these alterations disrupt the epithelial barrier, activate inflammasomes, increase pyroptosis, and induce the formation of neutrophilic and eosinophilic extracellular traps. These changes culminate in the epithelial-mesenchymal transition (EMT), with the formation of nasal polyps and tissue remodeling. Increased oxidative stress can also occur in CRS without nasal polyps (CRSsNP), but this phenotype appears to have relatively preserved antioxidant defense systems, which may partly explain the more limited structural remodeling. External stimuli, such as fungal proteases, bacterial toxins, and certain antibiotics, can also increase the production of ROS and may contribute to disease chronicity. Taken together, the level and pathophysiological roles of ROS differ in the two primary phenotypes of CRS. Further mechanistic studies are needed to clarify the specific alterations of redox pathways in these two phenotypes and to develop novel therapeutic strategies that target ROS.

DCC
Also flagged:Obstructive Sleep Apneato hypoxiasleephypertensioncoronary artery diseasestroke
Journal Article 2026-07-11 ✓ 1 Snippet Erdem M, Kıran TR, Kırıcı Berber N, Şahin Gür L, Erdem Ş.
In-Text Gene Mentions

…in Colorectal Cancer (DCC) receptor, its homolog…

Show Full Abstract

<b><i>Background and Objectives</i>:</b> Obstructive sleep apnea (OSA) is characterized by recurrent upper airway collapse, leading to intermittent hypoxia, oxidative stress, and systemic inflammation. Hypoxia-inducible factor-1α (HIF-1α) plays a central role in cellular adaptation to hypoxia, whereas Netrin family members have emerged as regulators of inflammatory and endothelial responses. However, the roles of Netrin-1 and Netrin-4 in OSA-related intermittent hypoxia remain unclear. This study aimed to investigate circulating HIF-1α, Netrin-1, and Netrin-4 levels in patients with OSA and to evaluate their associations with disease severity and hypoxic burden. <b><i>Materials and Methods</i>:</b> This study included 52 patients with newly diagnosed OSA and 26 healthy controls. Participants were classified as severe OSA, mild-moderate OSA, or control according to apnea-hypopnea index (AHI) values. All participants underwent overnight polysomnography. Serum HIF-1α, Netrin-1, and Netrin-4 levels were measured using ELISA. ROC curve analyses were performed to assess the ability of the investigated biomarkers to distinguish patients with OSA from controls. Correlation analyses evaluated associations between biomarkers and polysomnographic parameters, while multiple linear regression analyses adjusted for BMI, age, gender, CRP, and LDL levels were used to identify independent associations. <b><i>Results</i>:</b> Serum HIF-1α, Netrin-1, and Netrin-4 levels differed significantly among the groups (<i>p</i> < 0.0001) and progressively increased from controls to mild-moderate and severe OSA groups. ROC curve analyses demonstrated excellent discriminative performance for HIF-1α (AUC = 0.9072) and Netrin-1 (AUC = 0.8928), while Netrin-4 also showed good discriminative ability (AUC = 0.8284). HIF-1α levels were positively correlated with both AHI, reflecting disease severity, and T90, reflecting nocturnal hypoxic burden (<i>p</i> < 0.0001). Similar positive correlations were observed between Netrin-1, Netrin-4, and both AHI and T90 (<i>p</i> < 0.0001). In multiple linear regression analyses, AHI remained independently associated with HIF-1α, Netrin-1, and Netrin-4 after adjustment for BMI, age, gender, CRP, and LDL levels (<i>p</i> < 0.0001). In contrast, BMI, age, gender, CRP, and LDL were not significantly associated with any of these biomarker levels in the adjusted models. <b><i>Conclusions</i>:</b> Circulating HIF-1α, Netrin-1, and Netrin-4 levels are significantly elevated in patients with OSA and are positively associated with disease severity and hypoxic burden. The independent relationship between AHI and these biomarkers suggests that intermittent hypoxia may contribute to activation of HIF-1α-related and Netrin-associated pathways in OSA. These findings indicate that Netrin family members may have potential relevance as biomarkers of hypoxia-associated inflammatory and endothelial alterations in OSA.

Also flagged:Hyalinizing trabecular tumorsthyroidbenign neoplasmspapillary thyroid carcinomaPTCmedullary thyroid carcinoma
Journal Article 2026-07-11 No Snippets Boutzios G, Tsourouflis G, Gakiopoulou C, Destouni M, Karaviti E, Paschou S, Giovannopoulos I.
Show Full Abstract

Hyalinizing trabecular tumors (HTTs) of the thyroid are rare benign neoplasms that often mimic papillary thyroid carcinoma (PTC) and medullary thyroid carcinoma (MTC) on cytology, creating significant diagnostic challenges. We present a case of a 38-year-old female with a 4.2 cm right thyroid nodule. Fine-needle aspiration biopsy revealed overlapping nuclei, grooves, pseudoinclusions, and stromal hyaline material, which are suspicious features of malignancy (Bethesda category V). The patient underwent total thyroidectomy. Histology showed a well-encapsulated trabecular neoplasm with extensive stromal hyalinization. Immunohistochemistry was thyroglobulin and thyroid transcription factor-1 positive, and calcitonin, chromogranin A, and carcinoembryonic antigen negative, confirming HTT. Despite these tumors being, for the most part, benign, their cytological overlap with PTC and MTC usually results in misdiagnosis and overtreatment, including unnecessary total thyroidectomy. The lack of uniform cytological or molecular markers also renders preoperative diagnosis more challenging. The current case outlines the diagnostic dilemma of HTTs and the need for improved diagnostic tools to guide appropriate management and prevent overtreatment of this otherwise benign tumor.

Also flagged:neurodegenerative diseasesbrainagingneurodegenerative diseaseviral infectionviral infections
Journal Article 2026-07-10 No Snippets Medina F, Bellizzi A.
Show Full Abstract

Circular RNAs (circRNAs) represent a class of highly stable, covalently closed RNA molecules increasingly recognized as important regulators of brain aging and neurodegenerative disease. Growing evidence also implies circRNAs in viral infection, suggesting a potential intersection between viral neuropathogenesis and neurodegeneration. However, no studies have yet directly integrated circRNAs, neurotropic viral infections, and neurodegenerative disorders within a single mechanistic framework. To date, specific circRNAs have been linked to the progression of Alzheimer's disease and Parkinson's disease, where they regulate central pathological processes including amyloid-β clearance, neuroinflammation, synaptic plasticity, neuronal apoptosis, and oxidative stress. Moreover, it has been established that both host cells and viruses produce circRNAs during infection. Virus-derived circRNAs can enhance viral replication, promote immune evasion, and support latency. In contrast, host circRNAs contribute to antiviral defense by acting as microRNA sponges, interacting with viral proteins, or encoding peptides with antiviral activity, mechanisms particularly explored in viral oncogenesis. In this review, we will evaluate the most updated research evidence on the role of circRNAs in major neurodegenerative diseases and neurotropic viral infections. Considering the growing concern regarding the long-term neurological consequences of viral infections, including chronic neuroinflammation, viral reactivation, and post-viral syndromes, dysregulated circRNAs may represent a mechanistic link between viral infection and associated neurodegenerative processes. Finally, we will discuss future directions for identifying circRNAs-based biomarkers and developing circRNAs-targeted therapeutic strategies for age-related and virus-associated neurological disorders.

ECI2
Also flagged:metabolismbile acidssteroidsObesityinborn errors ofcarbohydrate
Journal Article 2026-07-10 ✓ 2 Snippets Faquih TO, Imtiaz MA, Talevi V, Landstra EN, van Hylckama Vlieg A, Li-Gao R, Rosendaal FR, Noordam R, van Heemst D, Mook-Kanamori DO, Breteler MMB, Aziz NA, van Dijk KW.
In-Text Gene Mentions

…of ACADM andECI2, in addition to…

…that ACADM andECI2expression were associated…

Show Full Abstract

<h4>Background</h4>Metabolomic analyses are increasingly applied in both etiological and predictive research, but frequently report missing values, which are then either imputed or removed from the analyses, and not examined as true missingness due to altered metabolism. We hypothesized that interindividual genetic variation may account for part of this missingness.<h4>Results</h4>We perform a logistic GWAS of metabolite missingness from an untargeted mass spectrometry-based platform in the Netherlands Epidemiology of Obesity Study (N = 594) and the Rhineland Study (N = 4,165). We consider metabolites missing in 10%-90% of individuals in both cohorts (N = 224). GWAS meta-analyses of these metabolites' probability of missingness revealed 55 metabolome-wide significant associations, including 42 novel ones (p < 1.58 × 10<sup>-10</sup>), involving 28 metabolites and 41 lead SNPs.<h4>Conclusions</h4>Despite considerable pleiotropy, the majority of identified SNP- 'missing metabolite' associations are biologically plausible, relating to beta-oxidation, bile acids, steroids, and xenobiotics metabolism. These findings suggest that missing values in metabolomics are partially non-random and reflect potential genetic variation.

Also flagged:ornithineNrf2nutrient transporters
Journal Article 2026-07-10 No Snippets Deng ZC, Huang YX, Cao KX, Peng Z, Refaie A, Khalil MM, Zhao L, Guan LL, Sun LH.
Show Full Abstract

<h4>Background</h4>The small intestinal microbiota directly influences host intestinal digestive and absorptive responses to dietary nutrients and plays a crucial role in optimizing feed efficiency in food-producing animals. However, the microbial functions of small intestine in regulating feed efficiency in broiler chickens remain to be elucidated.<h4>Methods</h4>A total of 150 healthy broilers were individually housed under identical feeding conditions to accurately calculate their feed efficiency. The gut microbiota in different intestinal segments of high and low feed efficiency chickens were compared using 16S rRNA sequencing. Gut bacterial candidates associated with feed efficiency were identified through a two-part model, LEfSe, and the Wilcoxon rank-sum test. Another 1725 1-day-old male broiler chicks were fed either a basal diet (BD) or BD supplemented with four different bacterial candidates isolated from the chicken gut to investigate their roles in regulating gut microbiota and nutrient absorption. The underlying molecular mechanisms by which key Limosilactobacillus strains and their metabolite ornithine improve intestinal health were also examined using an intestinal epithelial cell line.<h4>Results</h4>This study found that chickens with high feed efficiency exhibited greater microbial community stability and stronger cooperative interactions compared to low feed efficiency chickens, particularly within the duodenal microbiota. Meanwhile, duodenal resident Limosilactobacillus were significantly positively correlated with feed efficiency. Further validation trials revealed that specific Limosilactobacillus strains (L. vaginalis LD11 and L. ingluviei CC32) significantly improved feed efficiency, concurrently enhancing antioxidant capacity, barrier function, nutrient absorption, as well as increasing Limosilactobacillus abundance in the duodenum. These two bacterial strains could produce high concentrations of ornithine in the duodenum, which effectively alleviated LPS-induced intestinal cell damage by enhancing antioxidant capacity and upregulating the protein expression of nutrient transporters. Mechanistically, both bacterial strains and ornithine enhanced antioxidant capacity and nutrient uptake by activating Nrf2 signaling.<h4>Conclusions</h4>Dietary intervention using L. vaginalis LD11 and L. ingluviei CC32 contributes to high feed efficiency by producing ornithine, which modulates the duodenal microbiota and enhances the intestinal physiological functions for nutrient absorption Video Abstract.

Also flagged:embryogenesisofgene expressionfertilizationmethylationdegradation
Journal Article 2026-07-10 No Snippets Zhou C, Wang M, Chen Z, Zhang Y.
Show Full Abstract

Early embryogenesis is accompanied by dynamic epigenetic modifications. Although such dynamics are important in cell intrinsic regulation of gene expression, their extrinsic roles in mediating intercellular communication during early embryogenesis are less understood. Here, using the dTAG system, we reveal previously underappreciated stage-specific functions of PRC2 in regulating preimplantation and primordial germ cell (PGC) development. We demonstrate that PRC2 plays important roles in regulating maternal-to-zygotic transition and epiblast formation. By systematically analysing H3K27me3 and H3K4me3 dynamics, we redefine the timing of bivalency establishment and uncover a stepwise mechanism governing bivalency acquisition in early embryogenesis. Moreover, PRC2 regulates proper PGC numbers in the epiblast by controlling Esrrb expression in the extraembryonic ectoderm. Thus, our study uncovers a previously unknown cell-autonomous function of PRC2 in preimplantation development and its non-cell-autonomous impact in PGC number regulation, both through interplays between epigenetic-epigenetic and epigenetic-transcription factors networks.

DCC
Also flagged:hypertensionceliac diseaselumbar radiculopathychronic diseasescardiovascular diseaseaddiction
Journal Article 2026-07-10 ✓ 3 Snippets Xie XY, Lin JW, Li PC, Fang JY, Chen ZC, Huang XY, Cao MH, Lin LL, Guo MY.
In-Text Gene Mentions

…> 0.05): CHST3,DCC, UHRF1BP1, SNRPC .…

…6.87×10 −9 ),DCC(OR (95% CI)…

…blood; CHST3 ,DCCin brain) passed…

Show Full Abstract

<h4>Purpose</h4>Low back pain (LBP) is a leading cause of disability worldwide with limited effective pharmacotherapies. We aimed to identify novel therapeutic candidate targets for LBP through integrative genomics.<h4>Methods</h4>We employed summary-data-based Mendelian randomization (SMR) with GWAS data from FinnGen (13,178 cases/164,682 controls) and tissue-specific expression quantitative trait loci (eQTLs) from peripheral blood (Westra cohort: n = 5,311; 15,636 genes) and brain tissue (UKBEC: n = 134; 16,309 genes). Heterogeneity in dependent instruments (HEIDI) analysis validated causal associations. Candidate targets were further assessed by pathway enrichment, drug prediction, and phenome-wide association studies (PheWAS).<h4>Results</h4>Peripheral blood eQTLs identified four genes associated with LBP (<i>P<sub>SMR</sub> <</i> 3.2×10<sup>-</sup>, HEIDI <i>P ></i> 0.05): <i>BTN2A3P, GFPT1, UHRF1BP1, SNRPC</i>; brain eQTLs identified four genes associated with LBP (<i>P<sub>SMR</sub> <</i> 3.07×10<sup>-</sup>, HEIDI <i>P ></i> 0.05): <i>CHST3, DCC, UHRF1BP1, SNRPC</i>. Cross-tissue integration prioritized <i>UHRF1BP1</i> and <i>SNRPC</i> as consensus candidates. Drug prediction suggested levamisole and taxifolin as potential <i>UHRF1BP1</i>-modulating compounds. PheWAS indicated low pleiotropic risk, with associations mainly with hypertension and celiac disease.<h4>Conclusion</h4>This multi-omics framework prioritizes <i>UHRF1BP1</i> (involved in epigenetic regulation) and <i>SNRPC</i> (RNA splicing modulator) as mechanistically novel, genetically supported candidate targets for LBP, providing a foundation for future experimental validation and therapeutic development.

PEBP1
Also flagged:FerroptosisMitochondriaIschemic Strokedeathmitochondrialmetabolism
Journal Article 2026-07-10 ✓ 2 Snippets Ma K, Jiang Y, Yang Y, Rao T, Zhan Y, Yin Z, Dan Y, Xu S, Yang S.
In-Text Gene Mentions

…PRDX1, IDH1, SLC7A11,PEBP1, and NCOA3 were…

…IDH1, SLC7A11, andPEBP1were screened and…

Show Full Abstract

<h4>Background</h4>Ischemic stroke (IS) is a major cause of death and long-term disability worldwide. Multiple complex biological processes contribute to IS-related neuronal death, among which oxidative stress plays a central role in disease progression. Increasing evidence suggests that oxidative stress-induced neuronal injury is closely associated with ferroptosis and mitochondrial dysfunction, both of which contribute to excessive reactive oxygen species accumulation, lipid peroxidation, and impaired cellular energy metabolism during cerebral ischemia. However, their relative contributions and associated molecular signatures in IS have not been systematically compared. Therefore, this study aimed to identify ferroptosis- and mitochondria-associated genes involved in oxidative stress and neuronal injury in IS and to explore their potential as therapeutic targets for ischemic brain injury.<h4>Methods</h4>Two public microarray datasets (GSE22255 and GSE58294) were integrated and analyzed using weighted gene co-expression network analysis (WGCNA) to identify IS-associated gene modules. Ferroptosis-related genes from FerrDb and mitochondria-associated genes from MitoCarta3.0 were intersected with key modules to screen candidate genes. Protein-protein interaction analysis and CytoHubba were applied to identify hub genes. Logistic regression models were constructed to compare the diagnostic performance of ferroptosis- and mitochondria-related gene signatures. Functional enrichment analyses were conducted using Gene Ontology and KEGG. Key genes were further validated in a rat middle cerebral artery occlusion/reperfusion (MCAO/R) model treated with the ferroptosis inhibitor Ferrostatin-1 (Fer-1).<h4>Results</h4>Nine ferroptosis-related hub genes and nine mitochondria-related hub genes were identified. The ferroptosis-based diagnostic model showed significantly higher discriminatory power than the mitochondrial model (AUC = 0.949 vs. 0.829). Among these genes, GSK3B, IDH1, and PRDX1 exhibited the most prominent differential expression and were selected as core genes. In vivo experiments demonstrated that Fer-1 markedly reduced infarct volume, improved neurological function, attenuated oxidative stress, and restored the ACSL4/GPX4/TFR1 signaling axis. Fer-1 also reversed MCAO-induced dysregulation of GSK3B phosphorylation, IDH1, and PRDX1 expression, indicating effective suppression of ferroptosis.<h4>Conclusion</h4>Ferroptosis-related gene signatures outperform mitochondria-associated genes in the diagnosis of ischemic stroke. GSK3B, IDH1, and PRDX1 represent key molecular regulators linking oxidative stress to ferroptotic neuronal injury and may serve as promising biomarkers and therapeutic targets for ischemic stroke.

Also flagged:ferroptosisOsteoarthritisOAjoint disorderextracellulardeath
Journal Article 2026-07-10 No Snippets Kulyar MF, Pachaleva J, Brazaite S, Akhtar M, Hasan MM, Kaboli S, Lebedis I, Bernotiene E.
Show Full Abstract

Osteoarthritis (OA) is progressively documented as a whole-joint disorder in which oxidative stress, iron dysregulation and intercellular communication together drive progressive tissue degeneration. Among the chief oxidative mechanisms, lipid peroxidation has arisen as a critical contributor to cartilage destruction and inflammatory signalling cascade. Reactive aldehydes produced during lipid peroxidation, mainly malondialdehyde (MDA) and 4-hydroxy-2-nonenal (4-HNE), function as electrophilic mediators that change signalling pathways, extracellular matrix components and proteins, including NF-κB and MAPK. Persistent oxidative stress converges on ferroptosis, an iron-dependent form of regulated cell death characterized by impaired GPX4 activity, lipid peroxide accumulation and glutathione depletion. Ferroptotic chondrocytes also amplify osteoarthritic progression by releasing matrix-degrading enzymes and inflammatory cytokines that impact neighbouring osteoclasts, osteoblasts and synoviocytes. Additionally, mechanical stress contributes to this pathological network through Piezo1/TRPV4-mediated mechanotransduction, connecting aberrant biomechanical loading to intracellular calcium imbalance, ferroptosis activation and iron accumulation. Accumulative evidence specifies that dysregulated iron homeostasis plays a dual role in OA pathogenesis, as iron overload promotes reactive oxygen species generation through Fenton chemistry, whereas iron deficiency impairs antioxidant defence and osteogenesis mechanisms. Therapeutically, biomaterial-based nano-delivery systems, antioxidant compounds, iron chelators, and ferroptosis-targeted interventions have confirmed potential in restoring redox balance and suppress OA-associated inflammation. Cerium oxide, selenium, and MnO2 nanozymes, together with smart intra-articular delivery platforms, provide targeted reactive oxygen species scavenging and improve therapeutic localization within inflamed joints. By integrating mechanotransduction, iron metabolism, ferroptosis and lipid peroxidation, inter-tissue communication into a unified mechanistic framework, this review highlights emerging diagnostic biomarkers and translational strategies for the development of disease-modifying therapies in osteoarthritis.<h4>The translational potential of this article</h4>This review proposes an effective cascade mechanism wherein mechanical and inflammatory stimulation results in iron deregulation, lipid peroxidation, ferroptosis, and finally the development of osteoarthritis. The assessment of biomarkers related to ferroptosis such as MDA, 4 HNE adducts, labile iron, and GPX4 enzymatic activities can be useful for stratifying early-stage osteoarthritis and monitoring the disease. Meanwhile, antioxidant molecules, iron chelating compounds, and nanotechnology-based intraarticular drug delivery systems represent promising strategies for the prevention of osteoarthritis development.

TNFSF4
Also flagged:tumorbreast cancercancerfocal adhesionAStumors
Journal Article 2026-07-10 ✓ 2 Snippets Liu Y, Wang P, Yuan B, Zhou P, Sun Q.
In-Text Gene Mentions

…molecules, such asTNFSF4, CD28 ,…

…immune-stimulatory molecules (TNFSF4, CD28 ,…

Show Full Abstract

Alternative splicing (AS) shapes tumor biology by generating mRNA isoforms that regulate oncogenic signaling, immune modulation, and therapeutic response. However, its immune-related role in breast cancer (BRCA) remains insufficiently defined. Using TCGA-BRCA RNA-seq and clinical data, we quantified percent-spliced-in values with SpliceSeq and identified 1,063 differentially expressed AS events across 861 genes. These genes were enriched in cancer- and immune-related pathways, including focal adhesion, VEGF signaling, and cytokine-receptor interactions. Prognostic analyses revealed immune-associated AS events linked to overall survival and progression-free interval. Consensus clustering defined three AS-based subtypes with distinct immune landscapes and outcomes. C3 showed high immune infiltration, immune-activating molecule expression, and favorable prognosis, consistent with an immune-hot phenotype, whereas C1 displayed immunosuppressive features. Genomic alterations in splicing factors were associated with elevated tumor mutation burden, suggesting genomic instability may contribute to immune-related splicing dysregulation in BRCA.

Also flagged:obesitymetabolismHypertensioninsulin resistancetype 2 diabetescoronary heart disease
Journal Article 2026-07-10 No Snippets Wang R, Chen Z, Wang Y, Zhang Y, Song A.
Show Full Abstract

Obesity stands as a formidable 21st-century public health crisis, with its capacity to aggravate depressive symptoms gaining increasing clinical attention. Traditional treatment models often treat these two conditions separately. However, recent research evidence suggests a complex network linking obesity and depressive symptoms across metabolism, behavior, and mental health, with dietary patterns proposed as a key upstream modulator of both metabolic and psychological pathways. The specific mechanisms by which diet influences obesity and depressive symptoms remain unclear. Therefore, this narrative review focuses on analyzing molecular connections between diet, obesity, and depressive symptoms, including adipose tissue inflammation, the gut-brain axis, the hypothalamus-pituitary-adrenal axis, insulin and brain-derived neurotrophic factor levels, and neuroplasticity. We discuss the possible pathways and effects of different diet therapies in regulating metabolism and simultaneously impacting mental health, including calorie restriction diet, intermittent fasting, ketogenic diet, low glycemic index diet, plant-based diet, Mediterranean diet, Dietary Approaches to Stop Hypertension, among others. This review aims to provide a scientific basis for precision nutrition and personalized, sustainable diet therapies in clinical practice, promoting awareness and improving treatment strategies for depressive symptoms in obese patients.

Also flagged:synthesismembranebacterial infectionsmembranespore formationcell division
Journal Article 2026-07-10 No Snippets Pei J, Xiong L, Ge Q, Wu X, Chu M, Bao P, Guo X.
Show Full Abstract

<h4>Background</h4>The rapid emergence of multidrug-resistant bacterial pathogens has created an urgent demand for alternative antimicrobial agents. Bovine lactoferricin (Lfcin B), a cationic antimicrobial peptide derived from bovine lactoferrin, exhibits potent broad-spectrum antibacterial activity. Although truncated derivatives of Lfcin B retain partial antimicrobial effects, their efficacy relative to full-length Lfcin B and the structural mechanisms governing their function remain poorly understood.<h4>Methods</h4>Full-length Lfcin B and three truncated variants (Lfcin B15, Lfcin B9, and Lfcin B6) were synthesized using solid-phase peptide synthesis and characterized by RP-HPLC and MALDI-TOF-MS. Circular dichroism spectroscopy was employed to evaluate secondary structural changes under different ionic and hydrophobic environments. Tertiary structures were predicted using AlphaFold3. Antibacterial activities were assessed against multidrug-resistant Gram-negative and Gram-positive pathogens, including <i>Escherichia coli</i>, <i>Klebsiella pneumoniae</i>, <i>Pseudomonas aeruginosa</i>, <i>Salmonella typhimurium</i>, <i>Salmonella gallinarum</i>, <i>Shigella flexneri</i>, <i>Staphylococcus aureus</i>, and <i>Trueperella pyogenes</i>, using MIC, MBC, and agar diffusion assays.<h4>Results</h4>Circular dichroism spectroscopy revealed that ionic strength and hydrophobic environments modulate the secondary structures of the peptides, with increased ionic strength consistently reducing random coil ratios across all variants. Structural stability progressively diminished with peptide truncation, as shorter variants exhibited less conformational complexity. AlphaFold3-predicted tertiary structures identified two distinct conformations for full-length Lfcin B, an α-helix-rich state and a β-sheet-dominant topology, whereas truncated variants adopted simpler structural ensembles, primarily α-helical or random coil conformations. Antibacterial activity decreased markedly with peptide truncation. Lfcin B demonstrated the strongest and broadest-spectrum antibacterial activity, showing substantially lower MIC and MBC values and larger inhibition zones than truncated peptides. In contrast, Lfcin B6 exhibited only limited activity against <i>T. pyogenes</i>. Structural analyses indicated that the intact sequence and intramolecular disulfide bond of Lfcin B are essential for maintaining conformational stability, membrane interaction capacity, and antibacterial potency.<h4>Conclusions</h4>The antibacterial efficacy of bovine Lfcin B is strongly associated with its full-length sequence, conformational adaptability, and disulfide bond-mediated structural stability. Progressive truncation compromises structural plasticity and significantly attenuates antimicrobial activity. These findings support Lfcin B as a promising structural scaffold for the development of next-generation therapeutics against antibiotic-resistant bacterial infections.

Also flagged:cancergastric cancermetabolismmalignant tumorscancersstomach cancer
Journal Article 2026-07-10 No Snippets Li R, Li G, Chen S, Lv X, Wang D, Xiang J, Jiang Y, Tan D, Wu C.
Show Full Abstract

<b>Background:</b> Gastric cancer remains a leading cause of cancer-related deaths worldwide. Although significant progress has been made in clinical diagnosis and treatment, the molecular mechanisms underlying gastric cancer have not yet been fully elucidated. To address this, this study employs a multi-omics approach to systematically analyze the molecular characteristics of gastric cancer. <b>Methods:</b> This case-control study enrolled 218 GC patients and 218 healthy controls, and adopted a multi-omics strategy combining inductively coupled plasma mass spectrometry (ICP-MS), element-related genome-wide association study (eGWAS), and untargeted metabolomics to explore the element-gene-metabolite regulatory axis in GC. <b>Results:</b> A total of nine plasma differential elements associated with gastric cancer were identified, with a combined diagnostic accuracy of 0.918. Specifically, elements such as Fe, Co, and Li showed significant correlations with 63 genes involved in key signaling pathways, including MAPK, SMAD, and Wnt. Genome-wide association studies (GWAS) revealed that gastric cancer-related genes were significantly enriched in cancer-associated pathways and signaling cascades such as Rap1. Metabolomic analysis further demonstrated that 20 elements in the gastric cancer cohort correlated with 94 metabolites, predominantly enriched in pyrimidine and glutathione metabolism pathways. <b>Conclusions:</b> These nine plasma differential elements showed high combined diagnostic efficacy and were associated with genes and metabolites enriched in cancer-related signaling, metabolic reprogramming, and DNA damage response pathways. Together, these findings suggest potential multi-level associations among plasma elemental alterations, genetic variation, and metabolic dysregulation in GC, providing candidate circulating biomarkers and mechanistic clues for future investigation.

Also flagged:Liver Fibrosiswound-healingextracellularmethylationchronic liver diseasespathogenesis
Journal Article 2026-07-10 No Snippets Wu H, Gao L, Zhao X, Li X, Lin Y, Chen L, Li L, Shen L, Bao W, Zhu J, Huai C, Chen Z, Zhuang Y, Qin S.
Show Full Abstract

<b>Background/Objectives:</b> Liver fibrosis, a wound-healing response to chronic liver injury characterized by excessive extracellular matrix (ECM) accumulation, represents a major global health burden with no approved anti-fibrotic therapies. Pien Tze Huang (PZH), an officially approved traditional Chinese medicine (NMPA Drug Approval No. Z35020243), has demonstrated hepatoprotective effects, yet its epigenetic mechanisms in fibrosis treatment remain unexplored. <b>Methods</b>: We performed the first integrated methylome-transcriptome-proteome analysis to investigate PZH's anti-fibrotic mechanisms in a CCl<sub>4</sub>-induced mouse model using reduced representation bisulfite sequencing (RRBS), RNA-seq, and TMT-labeled LC-MS/MS. <b>Results</b>: We identified 10,974 differentially methylated loci (DMLs) and 773 differentially expressed genes (DEGs) modulated by PZH treatment. Integration analysis revealed ANXA3 and CORO1A as candidate therapeutic targets exhibiting significant inverse methylation-expression correlations validated at both transcriptomic and proteomic levels. Notably, PZH treatment modulated the CRLF-CLCF1 cytokine complex and the EGR-3 transcription factor network (42/44 genes enriched), suggesting broad transcriptional reprogramming in fibrotic liver. Protein-protein interaction (PPI) analysis highlighted key gene pairs such as <i>Dnmt1-Uhrf1</i>, <i>Cbfb-Runx1</i>, and <i>Col4a1-Col4a2</i>, implicating PZH in epigenetic maintenance, transcription factor regulation, and ECM remodeling. <b>Conclusions:</b> These findings suggest mechanistic insights into PZH's multi-target anti-fibrotic effects and offer a rationale for developing potential therapeutic targets for liver fibrosis.

Also flagged:type 1 diabetes mellitusdiabetesT1DMautoimmune diseasemetabolismanxiety
Journal Article 2026-07-10 No Snippets Swaminath M, Griggs SA, Lukasik J, Spanakis EK, Kinney RL, Ash GI.
Show Full Abstract

<h4>Purpose of study</h4>The purpose of this study was to understand the experiences and challenges with diabetes management and physical activity faced by adults with Type 1 Diabetes Mellitus (T1DM), as well as gather feedback on proposed features for a digital health tool, to inform the development of T1DM-tailored interventions.<h4>Methods</h4>US-based participants who had T1DM for at least 6 months were recruited online through social media and healthcare platforms. Data were collected through two semi-structured interviews focused on aim (1) understanding lived experiences with managing T1DM during physical exercise and the role of digital tools in exercise routines and aim (2) participant preferences on proposed digital tool features.<h4>Results</h4>Thematic data analysis revealed four major themes for aim 1: (1) lifestyle patterns, (2) motivations and barriers to exercise, (3) confidence with technology, and (4) T1DM-specific application with networking and accountability features. For aim 2, four themes were identified: (1) data interface, (2) tailored coaching and diverse representation, (3) T1DM-specific stigma, and (4) prior experience and current diabetes self-management goals.<h4>Conclusion</h4>It is essential that a digital health tool for people with T1DM offers personalized exercise support that adapts to real-time glucose measurements. The tool should provide educational content, facilitate peer interaction, and integrate with continuous glucose monitors and insulin pump technologies. By incorporating features specifically designed for the T1DM community, a digital health solution can improve diabetes management and promote an active lifestyle.

TNFSF4
Also flagged:infectionimmune responsesantigen presentationinfluenza infectionimmunityRespiratory
Journal Article 2026-07-10 ✓ 2 Snippets Ong W, Hopkins RA, Yang E, Novita, Talib N, Au B, Connolly JE.
In-Text Gene Mentions

…37 , 38TNFSF439 , 40…

…genes (VEGFA, DUSP4,TNFSF4, and IL7R).…

Show Full Abstract

Respiratory syncytial virus (RSV) infection often elicits ineffective long-term immune responses due to inefficient immune priming, complicating disease management and vaccine development. Dendritic cells (DCs) are central regulators of antiviral immunity and antigen presentation; yet, the direct impact of RSV on these pathways remains poorly understood. In this study, we identify sustained HLA-DM expression as a unique hallmark of RSV infected CD1c<sup>+</sup> DCs, a phenotype not observed following influenza infection or poly(I:C) stimulation. Using single cell RNA sequencing, pharmacological inhibition, and complementary controls, we demonstrate that TBK1 dependent Type I Interferon signaling is a key regulator of HLA-DM expression during DC maturation. Co-culture experiments further suggest that HLA-DM-high DCs influence CD4<sup>+</sup> T cell differentiation, supporting a model in which sustained HLA-DM expression reshapes antigen presentation and downstream adaptive immunity. Together, these findings uncover a previously unknown link between innate antiviral signaling and antigen presentation machinery in human DCs.

HFE
Also flagged:Ferroptosispathogenesisdeathmitochondrioncancertranslational
Journal Article 2026-07-10 ✓ 1 Snippet Kumar V, Arulsamy S, Khan WA, Sharma S, Arora P, Kumar S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Chemotherapy-induced hepatorenal toxicity is one of the most predominant dose-limiting obstacles in oncological pharmacotherapy, and the molecular mechanisms surrounding its pathogenesis are still poorly defined. Lipid peroxide toxicity-induced, iron-dependent, nonapoptotic types of regulated cell death called ferroptosis have emerged as a mechanically important process in the organ injury caused by chemotherapy. In this Keynote Review, we will summarize recent evidence showing the implication of ferroptosis in liver and kidney toxicity of platinum-based drugs, anthracycline drugs, tyrosine kinase inhibitors, and some targeted drugs. We identify key mechanisms underlying ferroptosis, including abnormalities of the axis of system Xc<sup>-</sup>/glutathione peroxidase4 (GPX4) axis, changes in iron homeostasis, and activation of ferritinophagy and the maladaptive effects of polyunsaturated fatty acid oxidation. The role of the hepatorenal microenvironment is discussed in detail, with a particular focus on mitochondrion-related abnormalities, interaction between endocrine and immune cells, and mitochondrion-endoplasmic reticulum-stress coupling, as well as interactions with ferroptosis suppressor protein 1 (FSP1)/CoQ10 and dihydroorotate dehydrogenase (DHODH) pathways. Data from the preclinical models are combined with new treatment data to develop a linear toxicological story. The utility of the use of biomarker strategies such as plasma malondialdehyde, 4-hydroxynonenal adducts, circulating GPX4, and urinary prostaglandin-like isoprostanes in diagnosis and monitoring is examined. The role of therapeutic interventions such as Nrf2 activators, liproxstatin1, ferrostatin1, and iron chelators for reducing organ-specific ferroptotic injury without reducing effectiveness as antineoplastic is briefly explored. This Review highlights ferroptosis as a therapeutic target that is amenable to therapy and suggests a systematic approach for its integration into toxicological risk classifications during drug development for cancer treatment.

bioRxiv 2026-07-10 Preprint (No Snippets API) Otani Y, Srinivasan V, Töller JS, Kallem T, Ball N, Barsukov I, Saarikangas J, Kreienkamp H, Goult BT.
Show Full Abstract

SHANK proteins form core postsynaptic density (PSD) scaffolds that organise synaptic signalling complexes through multiple protein-protein interaction domains, including PDZ domains that typically recognise C-terminal peptide motifs. Here, we identify an internal PDZ recognition mechanism that links the synaptic protein Densin-180 to SHANK and promotes SHANK scaffold assembly. We map SHANK binding to an internal PDZ-binding motif in Densin-180 (residues 843-863) and show by NMR spectroscopy and fluorescence polarisation that this motif binds SHANK1-3 PDZ domains with high affinity and specificity, competing with canonical C-terminal ligands. The crystal structure of the Densin-180-SHANK complex reveals that Phe858 inserts into the hydrophobic pocket of the PDZ domain despite the absence of a terminal carboxylate. In neurons, this interaction mediates Densin-180 recruitment to dendritic spines and drives activity-dependent reorganisation of postsynaptic SHANK3 assemblies, whereas mutation of Phe858 disrupts both processes. Disrupting the Densin-180-SHANK interaction using a Densin-180-derived peptide impairs activity-dependent structural plasticity of spines, accompanied by defects in PSD organisation and actin cytoskeleton remodelling. These findings define an internal mode of PDZ recognition and reveal how Densin-180 couples neuronal activity to the remodelling of postsynaptic SHANK scaffolds.

medRxiv 2026-07-10 Preprint (No Snippets API) Real R, Ravazio R, Nodehi A, Ben-Shlomo Y, Williams N, Barros RC, Grosset D, Hu M, Winchester L, Morris HR.
Show Full Abstract

<h4>INTRODUCTION</h4> Parkinson’s disease (PD) presents with motor and non-motor symptoms, including dementia, but the severity and rate of cognitive decline are heterogeneous and difficult to predict clinically. <h4>METHODS</h4> We quantified baseline serum proteins with the high-throughput SomaScan ® assay in 834 PD individuals and performed Cox regression to identify proteins associated with subsequent development of dementia. Candidate biomarker proteins were replicated in 371 individuals from an independent cohort and meta-analysed. <h4>RESULTS</h4> Protein targets significantly associated with progression to dementia were predominantly involved in synaptic plasticity, protein degradation/lysosomal function and extracellular matrix organisation. Mendelian Randomisation further revealed that changes in the Nogo receptor RTN4R may be causally associated with the development of Lewy body dementia. <h4>DISCUSSION</h4> We identified several proteins predicting progression to dementia in PD, indicating changes in blood proteome that precede the development of clinical symptoms by several years, providing a window of opportunity to identify at-risk individuals early on.

bioRxiv 2026-07-10 Preprint (No Snippets API) Amos SM, Chen C, Xiang Y, Motoyama K, González-Robles TJ, Narendra V, Johnson G, Lee HT, Ho Y, Celikoyar I, Ye Z, Guo S, Glickman C, O’Hearn N, Sarkar O, Arroyo-Ortega A, Devine T, Pagano M, Ruggles KV, Sánchez-Rivera FJ, Koehler AN, Lowe SW, Soto-Feliciano YM.
Show Full Abstract

Chromatin regulation critically influences gene expression and cancer progression, yet the functions of chromatin adaptors remain incompletely defined. Using focused CRISPR screening, we identified TRIM28, a multi-domain chromatin adaptor, as a dependency in acute leukemia, where its depletion impaired leukemia cell proliferation in vitro and in vivo , while activating neutrophil differentiation programs. Integrative transcriptomic and chromatin profiling revealed that TRIM28 acts as a co-repressor of neutrophil-associated loci independently of H3K9 methylation, and that TRIM28 loss drives terminal differentiation of leukemia cells into functionally mature neutrophil-like cells with reduced leukemic potential. We developed a selective small-molecule TRIM28 inhibitor that binds the TRIM28 PHD-bromodomain, phenocopies TRIM28 loss across biochemical and cellular assays, exhibits low micromolar anti-leukemia activity, induces neutrophil differentiation, and synergizes with Menin inhibition. Together, these findings, spanning target discovery, mechanism of action, and chemical probe development, establish TRIM28 as a regulator of myeloid cell fate and a promising pro-differentiation therapeutic target in acute leukemia.

Also flagged:Blood MalignanciesHematologic Conditionsimmune responsesmetabolismhematopoiesishematological diseases
Journal Article 2026-07-09 No Snippets Molajafari A, Ebrahim-Saraie HS, Moghadam MT, Hasannejad-Bibalan M.
Show Full Abstract

<h4>Background</h4>The human microbiota plays a key role in maintaining host homeostasis by regulating immune responses, metabolism, and hematopoiesis. Microbial dysbiosis has been increasingly associated with immune dysfunction, inflammation, and bone marrow abnormalities that may contribute to hematological diseases. This review summarizes current evidence on the role of the microbiota in normal hematopoiesis and its potential involvement in benign and malignant hematological disorders.<h4>Methods</h4>A narrative literature review was conducted through comprehensive searches of major scientific databases without time restrictions using the keywords Microbiome, Dysbiosis, Hematopoiesis, Anemia, Immune Thrombocytopenia, Congenital Neutropenia, Thrombosis, Lymphoma, Leukemia, and Multiple Myeloma. Relevant experimental, clinical, and review articles were screened and synthesized.<h4>Results</h4>Available evidence suggests that the microbiota may influence hematopoietic stem cell function, immune cell development, and hematopoietic homeostasis. Microbial dysbiosis has been proposed to be associated with benign hematological disorders, including anemia, immune thrombocytopenia, congenital neutropenia, and thrombosis, as well as hematological malignancies such as leukemia, lymphoma, and multiple myeloma. Certain bacterial and viral infections may also influence disease progression and therapeutic responses. Microbiota-targeted interventions, including probiotics, prebiotics, dietary interventions, fecal microbiota transplantation, and other microbiome-based therapies, have shown potential as adjunctive therapeutic strategies.<h4>Conclusions</h4>Current evidence suggests that microbiota dysbiosis may contribute to the pathogenesis of various hematological disorders. A better understanding of host-microbiota interactions may support the development of novel biomarkers and microbiota-based therapeutic approaches, although further clinical studies are required to confirm their efficacy and safety.

SERPINC1
Also flagged:metabolic disordersintellectual disabilitiesdeathphenylketonuriaPKUcongenital hypothyroidism
Journal Article 2026-07-09 ✓ 1 Snippet Mu J, Sun M, Li Y, Li P, Zou H.
In-Text Gene Mentions

…, PROC ,SERPINC1, EPB41 ,…

Show Full Abstract

<b>Objective:</b> To evaluate real-world implementation of newborn genetic screening (NBGS) in terms of positivity rate, carrier frequency, and diagnostic accuracy for inherited metabolic disorders (IMDs), and to explore feasibility and challenges in regional clinical application.<b>Methods:</b> This study enrolled 1590 newborns (August 2023-November 2024) whose parents opted for NBGS. A targeted sequencing panel covering 465 genes for 596 diseases alongside traditional biochemical screening for 46 disorders were performed. Variants were classified per ACMG guidelines. Positive cases were recalled for confirmatory Sanger sequencing and auxiliary biochemical tests. We calculated uptake, carrier frequency, identified hotspot variants, and compared allele frequencies with gnomAD_EAS. Diagnostic performance was compared with biochemical screening.<b>Results:</b> Uptake was 10.41% (1590/15,272). Overall positivity was 7.74% (123/1590). Among these, 10 were positive for IMDs‑related genes, with 8 confirmed, giving a positive predictive value (PPV) of 80.00% for IMDs - significantly higher than biochemical screening's 5.71%. We detected 2,354 variants, with carrier frequency 70.94%. Hotspot IMDs variants included <i>MMACHC</i> c.609G>A, c.658_660del, and <i>MUT</i> c.1286A>G, whose minor allele frequencies differed from gnomAD, indicating regional specificity. High carrier rates were also seen for lysosomal storage genes (<i>GALC</i> c.1901T>C, 53.57%; c.2041G>A, 32.14%).<b>Conclusion:</b> NBGS offers high PPV and specificity, reducing false positives and providing early molecular evidence for IMDs. Regional hotspot and MAF differences underscore the need for a local genetic database. Although the acceptance of NBGS is increasing, factors such as cost and varying levels of awareness among healthcare providers remain barriers to its broader implementation. This study provides preliminary data supporting the implementation of regional newborn genetic screening programs and informs secondary and tertiary prevention strategies.

SOX6
Also flagged:septal
Journal Article 2026-07-09 ✓ 5 Snippets Tarolli HG, Harvey AB, Devji I, Deepe RN, Drummond JR, Wolters RA, Wessels A.
In-Text Gene Mentions

SOX6is expressed in…

…including SOX5 andSOX6to cooperatively regulate…

…AlthoughSOX6has documented roles…

…the importance ofSOX6in valvuloseptal morphogenesis…

…studies revealed thatSOX6is expressed in…

Show Full Abstract

Cells derived from the endocardium, epicardium, cardiac neural crest, and second heart field play a critical role in the formation of the valvuloseptal structures of the heart. Previous studies have shown that the expression of the transcription factor SOX9 in these cell populations is essential in the regulation of this process. SOX9 interacts with other SOX family members including SOX5 and SOX6 to cooperatively regulate other developmental events. Although SOX6 has documented roles in the postnatal heart, its role in cardiac development has not yet been examined. For the current study we decided to investigate the importance of SOX6 in valvuloseptal morphogenesis. Expression studies revealed that SOX6 is expressed in many of the cell lineages that contribute to the formation of the heart. Given the pattern of SOX6 expression in the endocardium and endocardial-derived cells as well as in the coronary endothelium, we focused on the role of SOX6 in these cell populations by generating endothelial/endocardial-specific Sox6 knockout mice. These conditional knockout mice presented with ventricular septal defects, enlarged atrioventricular valves, and coronary abnormalities. Cardiovascular defects observed in the endothelial/endocardial-specific Sox6 knockout mouse demonstrate that SOX6 plays an important role in valvuloseptal development.

DCC
Also flagged:Morphogenesissteroidogenesiscycleinfertilityendometrial pathologiesextracellular
Journal Article 2026-07-09 ✓ 4 Snippets Sousa MJ, Vriendt S, Liu L, Ruiz TFR, Vankelecom H, Amorim CA.
In-Text Gene Mentions

…consistent with establishedDCCefficiency and was…

… hormone add‐back (SPHEGaT‐CM_DCC+E2+P4) resulted in significan…

…untreated SPHEGaT‐CM, whereasDCCtreatment alone did…

…than in bothDCC‐treated groups.…

Show Full Abstract

The human ovarian-endometrial axis operates through coordinated, dynamic endocrine signaling that cannot be faithfully reproduced by static hormone supplementation. While endometrial organoids (EMOs) respond to exogenous estradiol and progesterone, whether a spatially organized human ovarian endocrine unit can instruct epithelial morphogenesis through physiologically integrated signaling remains unknown. Here, we engineered a multilayered human follicle-like spheroid composed of primary granulosa cells and stromal-derived theca-like cells (SPHEGaT), recreating architectural and steroidogenic features of the ovarian follicle. These constructs generated sustained biologically active concentrations of estradiol and progesterone while maintaining high viability and low hypoxic burden. When co-cultured with EMOs, SPHEGaTs induced progressive epithelial remodeling characterized by folding morphogenesis, increased progesterone receptor expression, and upregulation of secretory/progesterone-responsive genes including PAEP, SPP1 and HSD17B2. Strikingly, partial steroid depletion did not abolish organoid folding, whereas static supplementation with exogenous estradiol and progesterone failed to restore the differentiation phenotype. These findings suggest that endometrial remodeling is influenced not merely by hormone concentration, but also by additional signaling cues present within the SPHEGaT-derived microenvironment. Together, this work establishes a human 3D platform in which integrated ovarian-derived signaling supports epithelial morphogenesis, providing new framework for studying ovarian-endometrial communication and highlighting the limitations of hormone-only models in reproductive bioengineering.

ZNFX1
Also flagged:tuberculosiscell surfacephosphorylationmycobacterial diseasesMSMDgenetic disorders
Journal Article 2026-07-09 ✓ 1 Snippet Olguín Calderón D, Kilpatrick LE, Conil C, Philippot Q, Ogishi M, Vellutini J, Han JE, Keating N, Li H, Rao G, Bohlen J, Lay CS, Platt S, Kerner G, Feredj E, Peel JN, Momenilandi M, Seeleuthner Y, Lainé C, Soudée C, Leloup C, Debuisson C, Lanternier F, Bitoun S, Pavy S, Mariette X, Rafik A, Skhoun H, El Ouazzani H, Abderahmani-Ghorfi I, El-Baghdadi J, Baena A, Tejada-Giraldo M, Barrera LF, Arias AA, Fabio G, Carrabba M, Emiroglu M, Bezrodnik L, El Zein L, Hammoud H, Gregersen PK, Terrier B, Leon Lopez R, Touzet M, Pestre V, Pasquet M, Rogge L, Fayon M, Galode F, Jeziorski E, Duffy D, Quintana-Murci L, Patin E, Cunningham-Rundles C, Meyts I, Zhang SY, Zhang Q, Jouanguy E, Boisson B, Rosain J, Béziat V, Shahrooei M, Mahdaviani SA, Rezaei N, Parvaneh N, Chavoshzadeh Z, Yazdanpanah N, Aladjidi N, Noguera-Julian A, Esteve-Solé A, Alsina L, Mansouri D, Keles S, Ortakoylu MG, Aygun D, Yucel E, Kiykim A, Camcioglu Y, Ma CS, Tangye SG, Zhang P, Abel L, Craggs PD, Casanova JL, Cobat A, Puel A, Bustamante J, Hill SJ, Boisson-Dupuis S.
In-Text Gene Mentions

…by which inheritedZNFX1deficiency causes MSMD…

Show Full Abstract

Homozygosity for rare loss-of-function IL23R variants abolishes IL-23-dependent IFN-γ production by lymphocytes, including NK and innate-like T cells, thereby underlying clinical disease due to weakly virulent mycobacterial species. We report selective enrichment in homozygosity for four hypomorphic IL23R variants in our cohort of patients with tuberculosis. Three of these IL23R alleles are rare (G300V, G149R, and L372F), with a minor allele frequency (MAF) under 1%, but the fourth (R381Q) is surprisingly common, with an MAF as high as 10.2% in certain populations. The other 15 missense alleles found in the homozygous state in public databases are isomorphic. The four hypomorphic IL-23R variants identified dimerize with IL-12Rβ1 and bind IL-23. However, their function is impaired by low levels of cell surface expression (R381Q, G300V) and/or as a consequence of conformational changes altering agonist efficacy. IFN-γ production in response to IL-23 is impaired in innate-like T cells and NK cells. These data suggest that recessive partial IL-23R deficiency, whether due to rare or common variants, confers a predisposition to tuberculosis while preserving immunity to less virulent mycobacteria.

HFESUDS3
Also flagged:brain tumorsneurogenesiscell cyclebrain cancersglioblastomachromatid
Journal Article 2026-07-09 ✓ 2 Snippets Ulmke PA, Ivanov MN, Nguyen HD, Pham L, Muchamedin A, Alzu'bi A, Veleva LV, Kachovski T, Mao X, Lubieniecki KP, Kovachev E, Clowry GJ, Tonchev AB, Nguyen HP, Tuoc T.
In-Text Gene Mentions

…Thesechromatin modifiersmodifiers belong to…

…Egr1, Msx2, Tmprss6,Hfe, Gdf5, Vsir, Tmem119,…

Show Full Abstract

The evolutionary expansion of the human neocortex relies on species-specific features of intermediate progenitor cells (IPCs), including enhanced proliferation and neuronal production. The transcriptomic differences in IPCs underlying their differential capacity across species remain elusive. To identify the transcriptional signature of human IPCs (hIPCs), we isolated TBR2-positive IPCs from developing human neocortex. A comparative genome-wide expression analysis of IPC transcriptional profiles from human and mouse outlined genes preferentially expressed in hIPCs encoding key factors of cell signaling, transcriptional regulation, and proliferation. Mutations in several hIPC-specific genes were linked to cortical malformations and brain tumors. Functional experiments involving hIPC-specific overexpression of CDKN3 in developing mouse cortex validated the pivotal role of CDKN3 in IPC proliferation and neurogenesis, and supported its identification as a key determinant of hIPC biogenesis. Our findings offer new insights into the molecular features of hIPCs underlying their capacity to mediate the evolutionary expansion of the human neocortex.

B4GALT5
Also flagged:biosynthesismicrocephalycognitive impairmentcataractsbindingcatalytic activity
Journal Article 2026-07-09 ✓ 5 Snippets Montavoci L, Dei Cas M, Caretti A, Ben Mariem O, Eberini I, Giaquinto L, De Falco A, Antonietta de Matteis M, Brunetti-Pierri N, Trinchera M.
In-Text Gene Mentions

B4GALT5deficiency impairs glycosphing…

…icated galactosyltransferases,B4GALT5and B4GALT6.…

…specific roles ofB4GALT5and B4GALT6 in…

…loss-of-function variants inB4GALT5, suggesting that intact…

…suggesting that intactB4GALT5activity is indispensable…

Show Full Abstract

Lactosylceramide is a glycosphingolipid precursor synthesized by two dedicated galactosyltransferases, B4GALT5 and B4GALT6. The specific roles of B4GALT5 and B4GALT6 in humans have not yet been clearly defined. Here, we report the first human case with bi-allelic loss-of-function variants in B4GALT5, suggesting that intact B4GALT5 activity is indispensable for normal glycosphingolipid biosynthesis and human development. We identified bi-allelic variants in the B4GALT5 gene in a child presenting with microcephaly, mild cognitive impairment, and bilateral cataracts. B4GALT5/6 double KO cells transfected with B4GALT5 carrying either of the variants identified in the patient lacked lactosylceramide synthase activity and failed to produce glycosphingolipids. In silico analyses predicted decreased protein stability and impaired UDP-Gal binding for both B4GALT5 variants. Together, these findings indicate that both variants result in deficient B4GALT5 activity, leaving B4GALT6 as the sole source of lactosylceramide synthase activity. Consistent with this, patient plasma and fibroblasts exhibited an approximately 80% reduction in glycosphingolipid levels compared with healthy controls. Unexpectedly, when expressed in model cells human B4GALT6 displayed lower expression and lower catalytic activity, than human B4GALT5, raising questions about its capacity to compensate for B4GALT5 deficiency. In conclusion, we identified a potential new congenital disorder of glycosylation caused by deficient lactosylceramide synthase activity that may be insufficient to support glycosphingolipids synthesis at levels required for normal brain function.

Also flagged:lumenestrous cycleestrusgene expressionmetabolismbiosynthesis
Journal Article 2026-07-09 No Snippets Waheed A, Rocha CC, Bastien AB, Maldonado MBC, Ashrafi N, Mimi RA, Graham SF, Peñagaricano F, Binelli M.
Show Full Abstract

<h4>Background</h4>In cattle, the second week after estrus encompasses critical changes in uterine function. The endometrium will either prepare for the release of luteolytic pulses of prostaglandin-F2 alpha or for the support of an eventual pregnancy. We hypothesized that concentrations of amino acids and lipids in the uterine luminal fluid (ULF), and the gene expression in luminal epithelial cells (LE), change across the second week of the estrous cycle. The objective was to compare amino acid and lipid concentrations in ULF and target gene expression in LE 7 (D7), 10 and 14 d after estrus. The ULF and LE samples were collected from the uterine body of five primiparous, non-lactating, cyclic Bos indicus-influenced crossbred cows using a cytological brush on each day after synchronized estrus. Targeted metabolomics of ULF was performed using mass spectrometry, and gene expression in LE was assessed using RNA sequencing. Data were analyzed by uni- and multivariate statistics.<h4>Results</h4>Multivariate analyses separated D7, D10, and D14, with amino acid metabolism and lipid biosynthesis as enriched pathways. Luminal concentrations of amino acids (e.g., arginine, histidine) and lipids (e.g., CE(17:1), PC aa C34:1) increased from D7 to D10, but from D10 to D14 concentrations of amino acids (e.g., glutamine, glutamic acid) decreased while that of lipids (e.g., CE(18:2), SM C16:0) continued to increase. Transcriptomic profiling revealed temporal regulation of 186 amino acid-related and 133 lipid-related genes. Between D7 and D10, there was increased expression of genes for oxidative phosphorylation and extracellular secretion pathways supporting secretory capacity, while decreased expression of genes in arginine-proline metabolism and solute carrier-mediated transport pathways promoted luminal metabolite accumulation. From D10 to D14, there was increased expression of genes in fatty acid elongation and sphingolipid metabolism pathways likely driving lipid synthesis and amino acid catabolism, while decreased expression of genes in protein digestion/absorption and PI3K/AKT signaling pathways reduced nutrient export to the lumen.<h4>Conclusions</h4>ULF composition and LE gene expression changed markedly during the second week of the estrous cycle. It is plausible that the dynamic shifts in amino acid and lipid metabolites in the uterine lumen reflect changing responses to sex steroids. The influence of such changes on embryo development and pregnancy success in cattle warrants investigation.

OLFM4
Also flagged:adenomaintestinal adenomasmall intestinal tumorscell proliferationtumorsmismatch repair
Journal Article 2026-07-09 ✓ 1 Snippet Sui Y, Hoshi N, Okamoto N, Ku Y, Ooi M, Watanabe D, Miyazaki H, Agawa M, Nakamura H, Inoue J, Yang H, Kodama Y.
In-Text Gene Mentions

…munohistochemical staining forOlfm4(van der Flier…

Show Full Abstract

Red and processed meats have been implicated in intestinal tumorigenesis; however, the roles of their main nutritional components, amino acids, in the modulation of adenoma development remain unclear. This study aimed to investigate the roles of various amino acids in intestinal tumorigenesis. Apc<sup>Min/+</sup> mice, as a model of spontaneous intestinal adenoma, were fed diets restricted to essential amino acids (leucine, lysine, valine), or the non-essential amino acid arginine to observe the modulation of tumorigenesis. The mice were fed diets with a reduction in each amino acid starting at 5 weeks of age and analyzed at 15 weeks of age. Among the diets tested, only the 90% leucine-restricted (Leu-R) diet dramatically reduced the size and number of small intestinal tumors. Mechanistically, both cell proliferation and mTORC1 pathway activation were reduced in tumors from the 90% Leu-R group. Further, Gene Set Enrichment Analysis (GSEA) showed that the 90% Leu-R diet affected pathways related to DNA repair and genome stability in small intestinal tumors. Notably, mismatch repair (MMR) genes, <i>Mlh1</i>, <i>Msh2</i>, and <i>Pms2</i>, were upregulated in small intestinal tumors from the 90% Leu-R group. Organoids derived from small intestinal tumors from the 90% Leu-R group exhibited fewer and smaller spherical structures. Leucine plays a key role in small intestinal tumorigenesis in Apc<sup>Min/+</sup> mice. The 90% Leu-R diet suppressed activation of the mTORC1 pathway and maintained genomic stability presumably via the MMR system. These findings suggest the potential for tumor prevention strategies targeting specific essential amino acids.

CACNA1E
Also flagged:vesicleshypersensitivityimmune responsesChromatinextracellularExtracellular Vesicles
Journal Article 2026-07-09 ✓ 1 Snippet Luo X, Wickman JR, DaCunza JT, Tian Y, Sacan A, Ajit SK.
In-Text Gene Mentions

…such as Gata2,Cacna1e, Doc2b, Pde10a, and…

Show Full Abstract

<h4>Introduction</h4>Small extracellular vesicles (sEVs) are cell-released lipid vesicles that facilitate intercellular communication by transferring bioactive cargo to recipient cells. We previously showed that a single intrathecal administration of RAW 264.7 macrophage-derived sEVs, given two weeks prior to complete Freund's adjuvant (CFA)-induced inflammation, resulted in earlier recovery from mechanical and thermal hypersensitivity. How this long-term memory develops, and how sEVs regulate immune responses, are unknown. Recent studies have shown that priming microglia with inflammatory stimuli can enhance or suppress responses to a delayed secondary insult via epigenetic modifications. We hypothesized that prophylactic intrathecal administration of macrophage-derived sEVs confers accelerated resolution of inflammatory pain by reprogramming epigenetic memory in spinal microglia.<h4>Methods</h4>Microglia were ablated using the colony-stimulating factor 1 receptor (CSF1R) inhibitor PLX5622 prior to sEV administration. Pain behaviors were assessed following CFA-induced inflammation. Chromatin immunoprecipitation sequencing (ChIP-seq) was performed on spinal microglia isolated 14 days after sEV administration. The role of epigenetic modification was evaluated by pharmacological inhibition of the H3K4 mono-methyltransferase SETD7.<h4>Results</h4>Prophylactic sEV administration accelerated the resolution of inflammatory pain hypersensitivity. This effect was abolished in mice treated with PLX5622, indicating that microglia are required during sEV exposure. ChIP-seq analysis revealed enrichment of H3K4me1-marked loci in spinal microglia 14 days after sEV administration, consistent with induction of innate immune memory. Inhibition of SETD7 eliminated the protective effect of sEVs, demonstrating a requirement for H3K4 mono-methylation.<h4>Discussion</h4>Macrophage-derived sEVs induce a microglia-dependent, epigenetically mediated form of pain prophylaxis. These findings support a model in which sEVs establish a primed, memory-like state in spinal microglia, characterized by enhancer-associated chromatin changes that confer latent regulatory potential and enhance resolution of subsequent inflammatory pain. This work links extracellular vesicles to microglial epigenetic remodeling and suggests a potential strategy for non-addictive, preventive pain therapeutics.

Also flagged:Skin DiseasesMajor Depressive DisorderADurticariachronic inflammatory skin diseasespsychiatric disorders
Journal Article 2026-07-09 No Snippets Deng C, Ding Y, Li X, Qiu G, Li Z, Song Y.
Show Full Abstract

<h4>Background</h4>Psoriasis (PSO), atopic dermatitis (AD), and urticaria (URT) are chronic inflammatory skin diseases marked by severe pruritus. These conditions are frequently comorbid with psychiatric disorders, especially major depressive disorder (MDD). Despite this clinical overlap, the underlying shared genetic mechanisms driving these comorbidities remain largely unclear.<h4>Methods</h4>We integrated large-scale European-ancestry genome-wide association study (GWAS) summary statistics for PSO, AD, URT, and MDD. Genetic overlap was assessed using linkage disequilibrium score regression (LDSC), high-definition likelihood (HDL), MAGMA-based gene and pathway analyses, PLACO cross-trait pleiotropy analysis, Bayesian colocalization, and summary-data-based Mendelian randomization (SMR). Tissue-specific enrichment and gene expression analyses were performed using GTEx transcriptomic resources.<h4>Results</h4>All three skin diseases showed significant positive genetic correlations with MDD. We identified 70 genome-wide significant pleiotropic SNPs and 13 shared genomic risk loci across the pairwise IAD-MDD analyses, with 11q13.1 and 11q12.2 prominent in AD-MDD. Prioritized genes, including FADS1, SLC22A4, SLC22A5, and FOXP3, showed enrichment in immune-related tissues and brain regions. Functional analyses implicated transcriptional regulation, synaptic signaling, and IgE isotype switching, supporting shared immunological and neurobiological pathways.<h4>Conclusion</h4>This study provides genetic evidence consistent with shared susceptibility between pruritic inflammatory skin diseases and MDD. The findings generate hypotheses about immune-neural pathways underlying skin-psychiatric comorbidity, but they should be interpreted in light of key limitations, including European-only summary statistics, summary-level inference, possible sample overlap, and the absence of an independent replication cohort.

CCPG1
Also flagged:PDchronic hepatitis Bmetabolismneurodegenerative diseaseLewy bodiespersistent infection
Journal Article 2026-07-09 ✓ 1 Snippet Ge Y, Cai H, Li Y, Li Y, Liu H, Zeng G, Yang K, Luo Y.
In-Text Gene Mentions

…complexes (with TEX264,CCPG1, SEC62 , etc.)…

Show Full Abstract

<h4>Background</h4>Epidemiological studies on the association between chronic hepatitis B (CHB) and Parkinson's disease (PD) have yielded inconsistent findings, with causality obscured by confounding and limited mechanistic evidence.<h4>Methods</h4>The study employed an integrated approach encompassing two-sample Mendelian randomization(MR), multi-omics analysis, machine learning-driven gene screening, immune infiltration profiling, and multicenter retrospective clinical validation, with retrospective clinical validation conducted in two independent cohorts.<h4>Results</h4>MR provided evidence suggesting a genetically predicted inverse association between susceptibility to CHB and the risk of PD (OR = 0.82-0.94, <i>p</i> < 0.05). Through the integration of machine learning and multi-omics data, <i>RTN3</i> and <i>MAP4K3</i> were recognized as priority cross-disease genes linking these two conditions. Phenylalanine metabolism emerged as an amino acid pathway showing consistent dysregulated patterns between the two diseases, with peripheral phenylalanine levels exhibiting a divergent trend: elevated in CHB while relatively lower in PD. Immune infiltration analysis and clinical hematological data suggested that eosinophil levels tended to decline in CHB but rise in PD, and such divergent expression patterns may be linked to the observed inverse correlation between CHB and PD susceptibility. (OR = 8.99, <i>p</i> < 0.001).<h4>Conclusion</h4>Genetic susceptibility to chronic hepatitis B is inversely associated with Parkinson's disease risk. The shared pathophysiological landscape potentially involves <i>MAP4K3, RTN3</i>, phenylalanine metabolism, and eosinophil. These factors represent candidate therapeutic targets and peripheral biomarkers for PD risk reduction.

DCC
Also flagged:peripheral neuropathyCIPNcancerneuropathyChemotherapy-induced peripheral neuropathysensory neuropathy
Journal Article 2026-07-09 ✓ 2 Snippets Maganti A, Rankothge I, Sakadales H, Kok E, Britton J, Rao N, Shatunova S, Shimell K, Zambrano PMR, Park SB, Schweitzer D, Laakso EL, Yengo L, Vetter I, Starobova H.
In-Text Gene Mentions

…M3-AS1/LINC02500 rs6552496 andDCCrs17748074, both linked…

…(e.g., PKNOX1, PRDM6,DCC), none has…

Show Full Abstract

Chemotherapy-induced peripheral neuropathy (CIPN) is a common, dose-limiting toxicity of cancer treatment, yet reliable biomarkers to predict individual susceptibility remain lacking. Germline genetic variation has been widely investigated as a potential contributor to CIPN risk; however, the consistency and clinical utility of these associations remain unclear. We performed a systematic review of genetic association studies evaluating CIPN across neurotoxic chemotherapies. PubMed, Embase, Web of Science, and the Cochrane Library were searched (April 2025) for human studies assessing germline variants in relation to clinician- or patient-reported CIPN. Eligible studies were identified in four major drug classes: vincristine, taxanes, platinum agents, and bortezomib. Study characteristics, phenotyping approaches, ancestry, and variant-level data were extracted, and study quality was assessed using Q-Genie. Meta-analysis was not performed due to substantial heterogeneity in study design and outcome measures. 72 studies were included, predominantly involving cohorts of European ancestry. The most consistently replicated loci were CEP72 and ETAA1 for vincristine-induced neuropathy; EPHA5, FGD4, and FZD3 for taxane-induced neuropathy; and ABC transporter genes and GSTP1 for platinum-induced neuropathy. For bortezomib, associations involving TRPV1, DNA repair pathways, and inflammatory signalling showed emerging but largely non-replicated evidence. Across studies, marked heterogeneity in CIPN definitions, phenotyping instruments, statistical approaches, and effect allele reporting limited comparability and reproducibility. Collectively, these findings indicate that current pharmacogenomic approaches to CIPN are constrained by poor replication, population bias, and inconsistent methodology, which hinder translation into clinically actionable biomarkers. Future progress will require harmonised phenotyping, multi-ancestry genome-wide studies, and integration of functional validation to enable robust risk stratification and precision oncology approaches to CIPN.<h4>Systematic review registration</h4>Identifier PROSPERO [CRD42025635757].

TRIM38
Also flagged:autophagyhost proteininfectionsneurological disorderspolyproteinsynthesis
Journal Article 2026-07-09 ✓ 1 Snippet Saidu U, Patrick B, Su WC.
In-Text Gene Mentions

…proteins 22 (TRIM22),TRIM38, and C19orf66, inhibit…

Show Full Abstract

Dengue virus (DENV) and Zika virus (ZIKV) are medically important orthoflaviviruses that utilize the multifunctional NS3 protease, in complex with its cofactor NS2B, for viral replication and host modulation. Here, we summarize current knowledge of host proteins targeted by NS3 proteases and discuss recent advances in proteomic and computational approaches for identifying these substrates. We further discuss evidence showing that NS2B3-mediated cleavage alters innate immune signaling, autophagy, protein translation, and cytoskeletal dynamics. In addition, we compare the host substrate specificities of DENV and ZIKV proteases, emphasizing both shared mechanisms and virus-specific differences that may contribute to their distinct disease manifestations. A deeper understanding of NS3-mediated host protein cleavage will provide critical insights into orthoflavivirus biology and further establish NS3 as a promising target for antiviral intervention.

PRDX6
Also flagged:lungphagocytosissecretionmultiple sclerosisneurodegenerative diseaseNeurodegenerative diseases
Journal Article 2026-07-09 ✓ 1 Snippet Shen K, Guo K, Leong SH, Lim R, Chew WL, Lee CQE, Ho L.
In-Text Gene Mentions

…is marked byPrdx6, which mediates…

Show Full Abstract

Metabolic regulation and its underlying mechanisms play a critical role in controlling and resolving inflammation in the brain, directly shaping glial cell activation and the central nervous system's response to injury and disease. In our screen for microproteins that modify inflammatory outcomes, we discovered MOCCI (protein product of C15orf48/AA467197) as a significant regulator of gut and lung inflammation. However, its involvement in neuroinflammation is unknown. Here, we show that MOCCI is upregulated in microglia and astrocytes in both the mouse and human brain upon inflammation, and is required for orchestrating proper, complete, and beneficial activation of microglia and astrocytes. Induction of MOCCI triggers the transition of glia into a neuroprotective state and promotes the resolution of inflammation. <i>In vitro</i>, MOCCI deficiency leads to reduced migration, phagocytosis and cytokine secretion in microglia and astrocytes. In the cuprizone mouse model of multiple sclerosis, MOCCI plays a role in both demyelination and remyelination. These results position MOCCI as a molecular brake on neuroinflammation, highlighting its therapeutic potential for targeting glial metabolic health and resolving chronic CNS inflammation in neurodegenerative disease.

Also flagged:synthesisprotein catabolismsleepdegradationmembranetissue remodeling
Journal Article 2026-07-09 No Snippets Muñoz-López M, Quesada-Fernández G, Sancho-Haro ES, Ramírez de la Piscina-Viúdez X, Baz-Valle E, López-Gil JF, Tornero-Aguilera JF.
Show Full Abstract

<b>Background:</b> Biomarkers are increasingly used in sport science and sports medicine to monitor training load, recovery, metabolic stress, nutritional status, and potential clinical risk in athletes. However, their interpretation is often limited by overreliance on isolated values, population reference ranges, and simplified thresholds. This narrative review aims to provide a contextual and metabolically informed framework for interpreting routine and emerging biomarkers in athletes. <b>Methods:</b> A critical narrative synthesis was conducted across key physiological domains relevant to athlete monitoring, including exercise intensity, metabolic flexibility, muscle damage, protein catabolism, hydration, hematological and iron status, micronutrient and bone-muscle health, inflammation, endocrine stress, sport-specific interpretation, and emerging metabolomics. The review integrated routine laboratory markers with pathway-level metabolomic interpretation and practical decision-making principles. <b>Results:</b> Routine markers such as lactate, creatine kinase, urea/blood urea nitrogen (BUN), creatinine, electrolytes, ferritin, C-reactive protein, cortisol, testosterone, and vitamin D are useful only when interpreted in relation to individual baseline, sampling conditions, recent workload, nutrition, hydration, sleep, illness, sex-specific physiology, and performance. Metabolomics expands interpretation by identifying pathway-level signatures involving glycolysis, β-oxidation, amino acid turnover, purine degradation, ketone bodies, acylcarnitines, bile acids, oxylipins, kynurenine metabolites, and exercise-induced signaling molecules such as lactate, β-aminoisobutyric acid (BAIBA), and N-lactoyl-phenylalanine (Lac-Phe). However, omics-derived markers require careful standardization and validation before routine applied use. <b>Conclusions:</b> Biomarkers should refine, not replace, clinical reasoning and athlete monitoring. A BASE framework (Baseline, Analytical standardization, Sport-specific context, and Evidence of functional change) may support more precise and proportionate interpretation of both routine blood tests and emerging metabolomic tools in athletes.

Also flagged:tissue homeostasiscancerneurodegenerative diseasesimmune responsestumorextracellular
Journal Article 2026-07-09 No Snippets Do E, Puro D, Hansda S.
Show Full Abstract

Inflammation is a critical protective response that maintains tissue homeostasis. However, persistent or dysregulated inflammation contributes significantly to the progression of cancer and neurodegenerative diseases. Recent advances in RNA biology have identified non-coding RNAs (ncRNAs), including microRNAs, long non-coding RNAs, and circular RNAs, as key modulators of inflammatory signaling networks. These RNA molecules regulate key pathways such as NF-κB, STAT3, MAPK, and PI3K/AKT, thereby influencing immune responses, tumor progression, neuronal survival, and cellular stress adaptation. In parallel, RNA-sensing receptors, including Toll-like receptors and RIG-I-like receptors, connect innate immune activation with chronic inflammatory pathology. Emerging evidence further demonstrates that inflammatory RNAs participate in epigenetic regulation, intercellular communication, and inter-organ crosstalk through extracellular vesicles and exosomes. In cancer, RNA-mediated feedback loops sustain tumor-promoting inflammation, metastasis, and immune evasion, whereas in neurodegenerative disorders, they contribute to glial activation, neuronal dysfunction, and progressive neuroinflammation. This review examines the mechanistic relationship between RNA dysregulation and inflammation across cancer and neurodegeneration, with particular emphasis on RNA signaling networks, exosomal communication, and targeted RNA-based therapeutics. Collectively, advances in understanding the RNA-inflammation axis may reveal new opportunities for precision diagnostics and next generation therapeutic interventions.

HFE
Also flagged:Ischemic Hepatopathysystemic hypotensioncardiac failurecholestasisacute pancreatitisdisseminated intravascular coagulation
Journal Article 2026-07-09 ✓ 1 Snippet Palmer OD, Kodjoe EN, Rezek M, Abib O, Agyeman W.
In-Text Gene Mentions

…exceeding 45%; however,HFEgene testing was…

Show Full Abstract

While ischemic hepatopathy is most commonly associated with systemic hypotension or cardiac failure, it may also occur in the setting of microvascular compromise secondary to severe systemic inflammation. Ischemic hepatopathy is characterized by acute, marked elevations in aminotransferase levels with minimal cholestasis and rapid biochemical recovery. Although acute pancreatitis is a recognized trigger of disseminated intravascular coagulation (DIC), hepatic ischemia resulting from this complication is rarely reported. We present the case of a 49-year-old man with acute-on-chronic pancreatitis who developed extreme transaminase elevation (aspartate aminotransferase (AST) > 10,000 IU/L), severe thrombocytopenia, and coagulopathy in the absence of hypotension or hepatic encephalopathy. An extensive evaluation excluded viral, autoimmune, toxic, metabolic, and obstructive etiologies, as well as hemophagocytic lymphohistiocytosis (HLH). Liver enzyme levels improved rapidly with supportive care and N-acetylcysteine therapy. This case highlights pancreatitis-associated ischemic hepatopathy as an important diagnostic consideration in patients presenting with marked aminotransferase elevation.

bioRxiv 2026-07-09 Preprint (No Snippets API) Seefelder M.
Show Full Abstract

Transcriptional dysregulation and proteostatic collapse are cardinal yet mechanistically separate features of Huntington disease (HD), and how the polyglutamine (polyQ) expansion in huntingtin (HTT) rewires its interactome to produce both remains unresolved. We integrated four published HTT affinity-proteomics datasets and contrasted wild-type and polyQ-expanded HTT within one Bayesian model (B ayes I nteractomics ). Of 4,338 proteins, 275 were condition-dependent: the expansion strips HTT of the transcription-activation machinery (Mediator, the ASCOM H3K4-methyltransferase, CREBBP, CDK9) while gaining contacts with the 26S proteasome, HSP70 chaperones and a synaptic and actin-cytoskeletal network, around an intact chaperonin–HAP40 core. This picture emerges only from integration: the datasets overlap so little that a “reproducible in ≥ 2 studies” consensus would recover just ∼ 21% of the high-confidence interactors. By reconciling HD’s transcriptional and proteotoxic arms within one quantitative interactome, this loss-plus-gain model recasts two historically separate disease mechanisms as complementary and nominates prioritised interfaces (HTT–Mediator/ASCOM, HTT–proteasome) for validation and therapeutic targeting.

bioRxiv 2026-07-09 Preprint (No Snippets API) Zhang W, Pan Y, Xie X, Du J, Zhang H, Ye Z, Yan X, Huang J, Jing H, Zhang S, Liu X, Chen D, Liu Y, Yu X, Bai X.
Show Full Abstract

The vertebrate water-to-land transition was accompanied by a six-fold increase in gravitational force, followed by the migration of hematopoietic stem cells (HSCs) from kidney or liver to the bone marrow, and the acquisition of enhanced immune functions to cope with novel environmental pressures. Bone senses mechanical loading and provides a microenvironment for HSC development, yet whether bone mechanosensation affects immune cell development and immune homeostasis remains unclear. Here, we unveil bone as a mechanosensory organ that translates mechanical force into hematopoietic instructions. Mechanical loading of bone directs HSCs toward lymphoid lineages in mice and non-human primates, whereas unloading favors myeloid commitment. This process requires osteocyte mechanosensor Piezo1, which induces loading-responsive bone-derived factors such as IL1R2, SERPINC1 and INMT, thereby restraining inflammatory signaling and guiding HSC differentiation. Osteocyte Piezo1 deficiency recapitulates the hematopoietic and immune alterations observed during unloading. Functionally, this pathway enhances acute infection resistance and suppresses immunosenescence in mice and in aged long-tailed macaques. Notably, skeletal mechanoregulation of immune homeostasis is conserved across vertebrate species. Our research defines the mechano-bone-immune axis (mechano-osteoimmunology), offering a novel evolutionary perspective on the interconnected development of the skeletal and immune systems and presenting a promising non-pharmacological target to address immune dysfunction.

PTGIS
Also flagged:gene expressionatherosclerosisASpathogenesismetabolismimmunosuppression
Journal Article 2026-07-08 ✓ 1 Snippet Gao Z, Huang H, Li Y, Liu L, Yu F, Nie Y.
In-Text Gene Mentions

…genes HMOX1 andPTGISwere identified; HMOX1…

Show Full Abstract

<h4>Background</h4>Endothelial cells (ECs) are central to vascular homeostasis, and their dysfunction is a key driver of atherosclerosis (AS). Hemodynamic forces, particularly laminar and disturbed flow (LF, laminar flow; DF, disturbed flow) patterns, differentially regulate ECs phenotypes via mechanosensing and epigenetic mechanisms. However, prior studies, largely reliant on single time-point analysis at isolated time points, fail to capture the dynamic gene expression responses of ECs to shear stress (SS). To address this, our study employs a time-series approach to dynamically delineate how distinct flow patterns shape ECs transcriptomes over time, aiming to identify pivotal regulatory genes and provide novel insights into AS pathogenesis.<h4>Methods</h4>In this study, samples were collected at multiple time points (0, 0.5, 2, 4, 6, 12, and 24 h) under LF or DF stimulation and subjected to RNA-seq. Time-series analysis was then performed to correlate data across these time points, thereby dynamically reflecting the effects of SS induced by different blood flow patterns on gene expression in endothelial cells. We identified two specific modules through weighted gene co-expression network analysis (WGCNA) to elucidate the effects of different blood flow patterns on ECs. Subsequently, a multi-database integration analysis was performed to screen for candidate genes.<h4>Results</h4>RNA-seq analysis of the multi-time-point transcriptomes of endothelial cells under different blood flow patterns revealed, through time-series analysis, that LF exerts a protective effect on homeostasis, whereas DF drives energy metabolism dysregulation, protein damage, and immunosuppression. WGCNA further identified that DF-specific modules were enriched in the endoplasmic reticulum stress pathway, while LF-specific modules were enriched in the oxidative phosphorylation pathway. Based on a multi-dataset cross-screening, the core genes HMOX1 and PTGIS were identified; HMOX1 was upregulated upon LF stimulation but downregulated in inflammatory and plaque tissues.<h4>Conclusion</h4>Through transcriptomic sequencing and RT-qPCR validation, this study's further analysis of the HMOX1 gene reinforces the role of blood flow patterns in the progression of atherosclerosis and provides a basis for exploring hemodynamic-related diagnostic markers and therapeutic strategies. Further research on mechanosensitive genes and their signaling pathways may offer insights into the prevention and treatment of cardiovascular diseases.

SERPINC1
Also flagged:coagulationicteruslipemiathromboplastin
Journal Article 2026-07-08 ✓ 1 Snippet Zhai Q, Chen S, Xiao H, Weng D, Zhou T, Wang F.
In-Text Gene Mentions

…and antithrombin III (ATIII).…

Show Full Abstract

<h4>Background</h4>Frequent phlebotomy for laboratory testing is a major cause of iatrogenic blood loss, particularly in critical care settings. Conventional large-volume blood collection tubes often collect blood far in excess of analyzer requirements. This study evaluated the analytical performance of novel 1 mL vacuum blood collection tubes compared to conventional 3 mL tubes for coagulation testing, assessing their potential to reduce diagnostic blood loss without compromising test quality.<h4>Methods</h4>Following the established guidelines (CLSI EP07 and WST 224-2018), the performance of 1 mL microsample tubes was systematically compared with conventional 3 mL tubes. The evaluation indicators covered aspiration volume accuracy, result comparability of six coagulation parameters, and anti-interference capability against hemolysis, icterus, and lipemia (HIL). The six detected coagulation parameters included activated partial thromboplastin time (APTT), prothrombin time (PT), thrombin time (TT), fibrinogen (FIB), D-dimer, and antithrombin III (ATIII). Passing-Bablok regression analysis and Bland-Altman analysis were performed to assess the consistency and bias of detection results. All tests were implemented on a CX9000 automated coagulation analyzer.<h4>Results</h4>The aspiration volume deviation (Rb) for the microsample tube (4.0%) was comparable to the conventional tube (4.9%), both within the acceptable ± 10% tolerance. Passing-Bablok regression demonstrated high concordance between 1 mL microtubes and conventional tubes across all six coagulation parameters (n = 46-71), with slopes ranging from 0.931 to 1.051 and intercepts from - 0.018 to 2.555; all P-values for deviation from linearity were non-significant. Bland-Altman analysis confirmed that all evaluated coagulation parameters met the predefined clinical consistency criteria.<h4>Conclusion</h4>The 1 mL vacuum coagulation tube demonstrated equivalent analytical performance to conventional 3 mL tubes across 6 routine coagulation parameters, including aspiration accuracy, result comparability, and interference resistance. Its implementation can significantly reduce blood draw volumes by over 50%, offering a reliable and blood-conserving solution for coagulation testing, especially beneficial for critical care, pediatric, and other vulnerable patients.

Also flagged:chromatinorgan developmentphotosynthesisgene expressiondevelopmentcell differentiation
Journal Article 2026-07-08 No Snippets Guo H, Li F, Zhang L, Zhang Y, Cai X, Chen H, Zheng X, Wu J, Wang X, Liang J.
Show Full Abstract

Chinese cabbage forms a leafy head as its main edible organ, a process involving extensive morphological and transcriptional changes. Here, we employed ATAC-seq to profile a time-series chromatin accessibility landscape across key developmental stages of leaf heading. This analysis revealed highly dynamic, stage-specific chromatin accessible regions accompanied by distinct transcription factors activities. Genes associated with adaxial-abaxial polarity and hormone signaling displayed dynamic accessibility patterns, suggesting their critical roles in head formation. BrKAN2 emerged as a key candidate regulator. Mutant analysis in Chinese cabbage and overexpression in Arabidopsis significantly altered leaf morphology and dorsoventral polarity. Population genetic analysis further indicated strong selection on BrKAN2 in heading Brassica rapa. Integration of DAP-seq and ATAC-seq identified BrKAN2.1 target genes enriched in organ development and hormone-related pathways, which were validated by VIGS and EMSA. Auxin responsiveness assays underscored the importance of auxin signaling in heading. Collectively, these findings uncover a dynamic chromatin landscape underlying leaf heading and establish BrKAN2 as a central regulatory factor, offering new insights for genetic improvement of Chinese cabbage.

HFE
Also flagged:hereditary tumour syndromesLynch syndromeepilepsyepilepsiesdevelopmental disorders22q11.2 deletion syndrome
Journal Article 2026-07-08 ✓ 2 Snippets Heyne HO, Ludwig KU, Schmidt A, Schmidt A.
In-Text Gene Mentions

…– for example,HFE- hemochromatosis [1] ;…

…for example, HFE-hemochromatosis[1] ; hereditary…

Show Full Abstract

Mendelian diseases are caused by rare pathogenic variants with large effects. However, phenotypes are often different between individuals carrying the same variant ("variable expressivity"), or even absent in some carriers ("incomplete penetrance"), suggesting that the genetic architecture of Mendelian diseases is more complex than previously thought. Common genetic variants are a potential modifier of observed phenotypes. Individual common variants usually have small effects, but in aggregate their effects can be substantial and be quantified as a polygenic score (PGS). The present review summarises available data on how PGS modify phenotypes in Mendelian diseases. We show that modifying effects of PGS on penetrance and expressivity have been observed in carriers of rare pathogenic variants across a broad range of conditions. This suggests that in Mendelian diseases, a modifying effect of the common variant background on penetrance and expressivity might be the rule rather than the exception. We anticipate that increasing data availability and methodological advances will improve our understanding of the genetic architecture of Mendelian diseases, including the joint consideration of both common and rare variants.

Also flagged:diseasestissuefibrotic diseaseshypertensioncoronary artery diseaseesophageal varices
Journal Article 2026-07-08 No Snippets Lebeaupin C, Donahue KL, Dower K, Wynn TA, Hart KM, Fabre T.
Show Full Abstract

Fibrosis is a major cause of mortality and morbidity worldwide with limited therapeutic options. Our understanding of fibrosis has significantly improved and led to the identification of "core" fibrogenic mechanisms that fuel a self-sustaining vicious cycle following the initial insult. The fibrotic niche is the result of complex cellular and molecular interactions that need to be disrupted to achieve transformational therapies. In this Review, we describe the current understanding of fibrogenic mechanisms, the progress and limitations of omics approaches in the identification of novel fibrotic pathways, and advances in therapeutic modalities that all together have the potential to unleash innovative cross-organ antifibrotic therapies.

Also flagged:colon cancertumorcolorectal cancerColorectal cancercancerdeath
Journal Article 2026-07-08 No Snippets Dias Costa A, Kim S, Hong SC, Yuan C, Qi X, Zhang J, Bleday R, Goldberg J, Irani J, Melnitchouk N, Sicinska ET, Lowder KE, Thalappillil JS, Takashima Y, Väyrynen SA, Payne EM, Meyerhardt JA, Yurgelun MB, Abrams TA, Coleman EC, Fitzpatrick B, Ganser C, Metayer KA, Brais LK, Shivdasani RA, Wolpin BM, Hollis BW, Nowak JA, Ng K.
Show Full Abstract

Although vitamin D (VitD) exhibits anti-tumor activity in colorectal cancer (CRC) preclinically, its effects in the human tumor microenvironment (TME) remain unclear. We conducted a randomized, placebo-controlled trial of preoperative high-dose VitD supplementation in stage I-III colon cancer patients to assess its impact on the TME. Forty-two patients received either VitD3 (50,000 IU/day for 7 days, then 10,000 IU/day) or placebo before surgery. Spatial immune-profiling and assessment of VitD receptor (VDR) and CYP27B1 expression were performed on paired tumor samples from 24 patients. VitD significantly increased plasma 25-hydroxyvitamin D levels (P<0.001), increased CD3+CD8+ memory T cells (P=0.03), reduced CD3+CD4+FoxP3+ regulatory T cells (P=0.02) and spatially re-organized the TME, leading to greater T cell and tumor cell proximity. Post-treatment VDR expression was heterogeneous and decreased overall (P=0.02). Spatial transcriptomic profiling of post-treatment resections reflected predominantly repressive VDR activity. These findings support an immunomodulatory role for VitD, warranting further mechanistic investigation.

Also flagged:hydroxypyridinone5-aminolevulinic acidirontumourdeathphototoxicity
Journal Article 2026-07-08 No Snippets Jiang X, Feng M, Niu X, Wang S, Sun Y, Chen W, Bai R.
Show Full Abstract

Superficial tumours can be effectively treated with photodynamic therapy (PDT), which is characterised by its targeted approach and enhanced safety profile. 5-aminolevulinic acid (ALA), a precursor to the endogenous photosensitiser PpIX, has been widely utilised in PDT. However, its high hydrophilicity, poor permeability and stability, necessitates structural modifications to improve its drug-like properties and increase the PpIX yield. Hydroxypyridinone (HPO) iron chelators can synergistically enhance PpIX production when administered in conjunction with ALA, as well as inducing tumour cell death through iron chelation. Consequently, this study designed a series of novel ALA-HPO derivatives, functioning as dual prodrugs to elevate intracellular PpIX levels and enhance photodynamic anti-tumour effects. The optimised compound <b>AP-8</b> displayed the highest phototoxicity and greatest PpIX yield, demonstrating superior photodynamic anti-tumour efficacy compared to ALA in a mouse melanoma model, with a TGI of 84.74%. These findings underscore the potent application potential of ALA-HPO derivatives in PDT.

DCC
Also flagged:Autismcell cycleanxietymetabolismcell proliferationbrain development
Journal Article 2026-07-08 ✓ 1 Snippet Lin X, Wu J, Ying Y, Yan B, Wang J, Zou J, Jiang K.
In-Text Gene Mentions

DCC

Show Full Abstract

Fyn-related kinase (FRK), which belongs to the Src family of non-receptor protein tyrosine kinases, functions during the cell cycle. Here, we report an autistic patient with an intragenic mutation of FRK and two other autism-related genes. Circumventing the barrier of murine model studies, we generated the CRISPR/Cas9-engineered frk <sup>-/-</sup> zebrafish. We found that frk-knockout led to early developmental abnormalities. Frk <sup>-/-</sup> fish exhibited autism-like behavior, including impaired social communication, repetitive stereotypic behavior, altered anxiety level, and cognitive dysfunction in both larvae and adults, which could be rescued by the transgenic neuron-specific re-expression of frk. GO and KEGG analysis of RNA-sequencing data found that the frk-knockout-induced DEGs were mainly concentrated in processes and functions related to cell metabolism. PPI network analysis of the detected DEGs suggested that the cyp24a1/tp53 pathway may play a key role in frk-knockout-induced autism. Furthermore, we found that the numbers of BrdU<sup>+</sup> cells were significantly increased in the frk <sup>-/-</sup> larval brains. Inhibition of Cyp24a1 or activation of tp53 reduced cell proliferation and partially ameliorated social impairments in frk <sup>-/-</sup> zebrafish. Overall, our work established an autism model of frk-knockout with an assessable behavior phenotype in zebrafish and provided key insights into cell proliferation and the influence of the cyp24a1/tp53 pathway-regulated cell proliferation on frk-knockout-induced autism-like behaviors.

SOX6
Also flagged:erectile dysfunctiontranslationalEDerectionpathogenesisinfection
Journal Article 2026-07-08 ✓ 1 Snippet Ye T, Zhong X, Wang S, Zhong W, Chi A, Chai M, Shi P, Shi X.
In-Text Gene Mentions

…, Nrtn andSox6), and the…

Show Full Abstract

Erectile dysfunction compromises men's quality of life and fertility. Mesenchymal stromal cell injection therapy holds clinical promise, yet its efficacy is limited by poor cell retention and survival in the corpus cavernosum due to rapid blood flow, elevated reactive oxygen species and inflammation. Here, we show that mesenchymal stromal cells surface-engineered with polydopamine nanoparticles conjugated to antibodies against vascular cell adhesion molecule 1 exhibit enhanced retention, survival, and therapeutic efficacy in erectile dysfunction. We demonstrate that the multivalent antibodies guide the cells to inflamed cavernosal endothelium, while polydopamine mitigates reactive oxygen species‑induced damage and improves the inflammatory microenvironment. We show that the underlying engineering process is rapidly achievable under mild conditions, minimizing the impact on cell viability. We find that surface-engineered mesenchymal stromal cells display improved survival under high reactive oxygen species stress and enhanced targeting capabilities in vitro. In rat models of erectile dysfunction, we demonstrate that the engineered cells achieve robust cavernosal retention, reduce local reactive oxygen species and inflammation, reverse tissue pathology, and restore erectile function. We further validate their efficacy in beagle models, confirming cross-species translational potential. Thus, this study provides a facile and translatable surface engineering strategy to overcome key bottlenecks in mesenchymal stromal cell-based erectile dysfunction therapy.

Also flagged:lysineshistone H3Histonepost-translational modificationslysinearginine
Journal Article 2026-07-08 No Snippets Price D, Zemlyanskiy G, Trakarnphornsombat W, Forne I, Volkova N, Dubusse L, Cooper AJ, Imhof A, Radzisheuskaya A.
Show Full Abstract

Histone post-translational modifications are fundamental to genome regulation, yet dissecting the functions of individual histone marks in mammals remains challenging due to the presence of multiple histone gene copies. Here we develop a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) prime editing platform enabling precise, reversible and combinatorial mutagenesis of canonical and noncanonical histone H3 genes within their native genomic context. Using systematic lysine-to-arginine substitutions benchmarked against synonymous controls, we identify key residues, including H3K4, H3K9, H3K14, H3K18 and H3K79, whose mutation compromises fitness in mouse embryonic stem cells. We further show that H3K56, linked to genome stability in yeast and Drosophila, has a conserved role in mammalian cells. Through analysis of selected double mutants, we uncover functional crosstalk across residues, with combinations such as H3K27R + H3K36R impairing stem cell self-renewal and altering transcription. Altogether, this study establishes a functional map of histone H3 lysines in mammals and provides a broadly applicable platform for systematic dissection of chromatin regulation.

DCC
Also flagged:extracellular matrixneocollagenesissynthesisDeathcytoplasmcoagulation
Journal Article 2026-07-08 ✓ 1 Snippet Goo H, Kim C, Hong N, Lee YJ, Kim EY, Choi SH, Park JO, Baek MH, Hwang SJ, Lee JW, Lee W, Kim R, Lee Y, Ahn JC.
In-Text Gene Mentions

…findings suggest thatDCC-Based monopolar RF treatment…

Show Full Abstract

<h4>Purpose</h4>To investigate the thermal effects, dermal remodeling, and safety of a novel direct contact cooling (DCC) based monopolar radiofrequency (RF) system using a minipig model.<h4>Methods</h4>Monopolar RF was applied at three levels. Temperature changes, visual skin assessment, hematological analysis, and histological and histochemical evaluations were performed at baseline and up to 30 day post-treatment.<h4>Results</h4>DCC-based monopolar RF achieved effective dermal heating without excessive epidermal temperature elevation. No adverse visual, systemic, or histological reactions were observed. Collagen density and elastic fiber remodeling were significantly enhanced at 30 days.<h4>Conclusion</h4>DCC-based monopolar RF safely induces controlled dermal thermal stimulation and promotes extracellular matrix remodeling, supporting its potential as an effective non-invasive skin rejuvenation modality.

Also flagged:carboncell wallextracellularbiomineralizationcarbon fixationphotosynthesis
Journal Article 2026-07-08 No Snippets Ramasinghe LP, Regunton AK, Held MA, Cimatu KLA.
Show Full Abstract

Biomimetic polymers have emerged as a powerful class of materials that are capable of replicating biological processes, functions, properties, or structures found in natural systems. While extensive reviews are available due to the significant progress in synthetic biomimetic materials, this review focuses exclusively on sustainable, naturally derived biomimetic polymers, as the global focus has shifted towards low-carbon footprint remedies. Biomimicry can only be reliably evaluated using appropriate characterization techniques, and selecting the ideal technique depends on several factors: the specific biomimetic feature of interest, the relevant length scale, the condition of the sample, and whether qualitative or quantitative assessment is required. Hence, we critically survey how complementary chemical, mechanical, structural, and morphological methods are able to span different length scales. We highlight both established and emerging characterization techniques which belong to four broad categories: spectroscopy, microscopy, diffraction/scattering, and thermo-mechanical analysis. Ultimately, this review guides the rational design for next-generation biomimetic materials, bridging the gap between biomimicry, material characterization, and sustainable materials.

HFE
Also flagged:cancerHBCcholangiocarcinomatumorPD-1PD-L1
Journal Article 2026-07-08 ✓ 2 Snippets Abdelrahim M, Esmail A, Connor AA, Kodali S, Saharia A, Victor DW, Simon CJ, Cheah YL, Lee SS, Javle M, Kaseb AO, Ghobrial RM.
In-Text Gene Mentions

…lpha-1 antitrypsin deficiency,hemochromatosis, and Wilson’s disease…

…medical history ofhemochromatosis, cirrhosis, non-alcoholic ste…

Show Full Abstract

<h4>Background</h4>Hepatobiliary carcinoma (HBC) ranks as the sixth most prevalent cancer worldwide. Orthotopic liver transplantation (OLT) has emerged as a highly effective treatment option for early-stage HBC. Immunotherapies as neoadjuvant options are now being actively investigated in the transplant oncology era. This study reports our institutional experience in patients with HBC who had received immune checkpoint inhibitors (ICPI) prior to curative OLT.<h4>Methods</h4>This retrospective cohort included 25 patients with HBC [17 with HCC and eight with cholangiocarcinoma (CCA)], who received ICPI prior to OLT at a single institution from January 2019 to December 2025. Graft rejection was assessed and reported along with the type of ICPI, tumor features, locoregional therapies (LRTs), and the timing of ICPI in association with OLT.<h4>Results</h4>All 25 patients with HBC underwent OLT after neoadjuvant ICPI. A total of 19 patients were men, and six were women with a median age of 55 (interquartile range: 36-74) years at OLT. All patients received ICPI, including combinations of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors. Liver-directed/locoregional therapies were utilized in most cases, including transarterial chemoembolization (TACE), yttrium-90 (Y90), stereotactic body radiotherapy (SBRT), and radiofrequency ablation (RFA). The median washout period was 4.5 months. All patients responded to ICPI and achieved a safe and successful OLT. Most patients received tacrolimus plus mycophenolate as immunosuppressant (IS) therapy post-OLT, with 17 patients requiring additional IS, including prednisone or everolimus. One patient experienced immediate graft failure on the day of transplant, was made anhepatic, and was successfully retransplanted on the following day. Three patients experienced acute rejection during the first year post-transplant (two with liver rejection and one with kidney rejection following a deceased donor kidney transplant that was performed in conjunction with OLT).<h4>Conclusions</h4>Our study highlights the potential of ICPI to achieve tumor downstaging prior to OLT in patients with HBC when given as a neoadjuvant therapy. In addition, this study illustrated the importance of timing for the administration of ICPI before OLT. Given the lack of conclusive evidence in this therapeutic area, these findings lay the groundwork for prospective trials to further examine the impact of ICPI in the pre-transplant setting.

Also flagged:clear cell renal cell carcinomaccRCCpathogenesisreverse transcriptionbindingtumor
Journal Article 2026-07-08 No Snippets Chang P, Qin Z, Liu R, Wang B, Lu H, Jing S, Guo C, Li W.
Show Full Abstract

<h4>Background</h4>Clear cell renal cell carcinoma (ccRCC) is a prevalent malignancy, representing 80-90% of kidney cancer cases. This study aimed to identify potential prognostic genes to improve patient survival prediction and provide new insights into the pathogenesis and treatment of ccRCC through comprehensive whole transcriptome sequencing analysis.<h4>Methods</h4>The analysis utilized whole transcriptomic data from publicly available datasets, including TCGA-KIRC and GSE96574. Methods involved identifying differentially expressed mRNAs and long non-coding RNAs, prognostic gene screening via MCODE plugin and risk model construction, followed by functional enrichment, molecular network construction, drug prediction, and molecular docking. The expression levels of key genes were subsequently validated using reverse transcription quantitative PCR (RT-qPCR) on clinical samples.<h4>Results</h4>Eight prognostic genes (IFNG, CXCL13, KLRK1, LAG3, ITGAX, TNFRSF9, CD2, CD8B) were identified and formed a risk stratification model. These genes were primarily enriched in immune-related pathways such as antigen processing and presentation. A regulatory network involving transcription factors, miRNAs, lncRNA PVT1, and circRNAs was constructed. Drug prediction and molecular docking suggested potential targeted drugs, including amitriptyline hydrochloride for CD8B and IFNG, and rituximab for CXCL13 and IFNG, with strong binding affinities noted for ITGAX and KLRK1. RT-qPCR validation confirmed significantly elevated expression of IFNG, LAG3, TNFRSF9, and CD8B in ccRCC patients compared to controls (p < 0.05).<h4>Conclusions</h4>This study identifies an eight-gene signature as a promising prognostic biomarker for ccRCC, deeply involved in the tumor immune microenvironment. The findings offer novel insights into ccRCC pathogenesis and highlight potential therapeutic targets and agents, paving the way for improved prognostic strategies and immunotherapeutic approaches.

Also flagged:ferroptosisosteoarthritistranslationalOAdegenerative diseaseiron
Journal Article 2026-07-08 No Snippets Li J, Yang F, Deng X, Zhang L, Huang X, Yu Y, Xiong H.
Show Full Abstract

Osteoarthritis (OA) has traditionally been regarded as a degenerative disease primarily characterized by cartilage wear and tear. However, accumulating evidence suggests that it is fundamentally a whole-joint disorder involving the coordinated participation of cartilage, synovium, subchondral bone, and immune components. In recent years, ferroptosis and immunosenescence have each been recognized as contributors to OA initiation and progression, yet their potential interplay within the osteoimmune microenvironment remains insufficiently integrated. This review summarizes how iron homeostasis imbalance, lipid peroxidation, and impaired antioxidant defense promote ferroptosis in joint-resident cells, and how immunosenescence influences joint homeostasis through chronic low-grade inflammation and functional remodeling. It further analyzes the possible crosstalk between these two processes in cartilage, synovium, subchondral bone, and related immune cells. In addition, this review outlines current advances in therapeutic strategies, including anti-ferroptotic interventions, anti-senescence modulation, and optimization of local delivery approaches. At present, direct evidence supporting a stable causal loop between ferroptosis and immunosenescence in OA remains limited, and many of the proposed mechanisms are still largely derived from <i>in vitro</i> studies, animal models, and extrapolation from other disease contexts. Therefore, this review aims to provide a testable working framework for understanding the link between ferroptosis and immunosenescence in OA from the perspective of the osteoimmune microenvironment and evidence stratification, and to offer reference for the development of future mechanism-oriented therapeutic strategies.

STAU1
Also flagged:neurodegenerative disordermitochondrialPDgene expressionvesicle-traffickingautophagy
Journal Article 2026-07-08 ✓ 3 Snippets Koks S, Muldmaa M, Price J, Whiley L, Jakobson M, Singleton L, Howting D, Pfaff AL, Chopra A, Watson M, Sikk K, Taba P.
In-Text Gene Mentions

…VPS13C, LRRK2, GRN,STAU1, NPTN, PARK7).…

…expressed genes areSTAU1, AAK1, GRN and…

STAU1and NPTN were…

Show Full Abstract

Parkinson's disease (PD) is a complex neurodegenerative disorder with diverse molecular signatures that extend beyond the central nervous system. Peripheral blood serves as a minimally invasive source of transcriptomic biomarkers reflecting systemic inflammation, mitochondrial dysfunction, lysosomal impairment, and disrupted RNA processing-key pathways involved in PD. Long-read RNA sequencing with Oxford Nanopore Technologies (ONT) offers unprecedented detail of full-length transcripts, alternative isoforms, and RNA modifications, enabling more accurate detection of disease-related transcriptional changes. We conducted high-throughput ONT long-read RNA sequencing on blood samples from 145 individuals, including PD patients and age-matched healthy controls. RNA libraries were prepared using a cDNA-based protocol optimised for high-accuracy PromethION sequencing. Transcriptomes were quantified with ONT-specific pipelines, and analyses of differential gene expression (DGE), differential transcript expression (DEX), differential transcript usage (DTU), and alternative splicing were performed using ONT-aware tools such as DRIMSeq, DEXSeq, and stageR. Pathway enrichment linked disease-related changes to mitochondrial, lysosomal, and vesicle-trafficking pathways. Our analysis identified highly significant PD-associated transcriptional signatures in peripheral blood (SNCA, VPS13C, LRRK2, GRN, STAU1, NPTN, PARK7). Long-read sequencing uncovered extensive isoform-level dysregulation, including novel transcript variants (e.g., BCL2L2-PABPN1, SQSTM1) in pathways relevant to PD, such as autophagy and endolysosomal trafficking. DTU analyses revealed shifts in isoforms of LRRK2 and GBA1, indicating widespread disturbances in RNA processing. Enrichment analysis showed activation of molecular pathways linked to neurodegeneration. This study provides the largest long-read blood transcriptomic dataset in PD to date, demonstrating that ONT sequencing can resolve isoform-level changes and reveal systemic molecular signatures of PD. Our findings support the development of blood-based RNA biomarkers and the establishment of long-read transcriptomics as a transformative approach for genomic pathology in PD.

POU3F2
Also flagged:autismobesitychromatincell cycle-relatedgene expressionchromosome
Journal Article 2026-07-08 ✓ 3 Snippets Yang Y, Quintana Urzainqui I, Pratt T.
In-Text Gene Mentions

…, RFX4(+) ,POU3F2(+) , PAX6(+) ,…

…promoters and regulatesPOU3F2and NEUROD2 proneural…

…Notably,POU3F2loss-of-function alleles assoc…

Show Full Abstract

The 574-kilobase pair <i>16p11.2</i> microdeletion raises a person's odds for neurodevelopmental and energy balance conditions, particularly autism and obesity, with considerable clinical heterogeneity, and how much this reflects genetic versus environmental or stochastic factors is unclear. GABAergic forebrain interneurons originate from progenitors residing in the ventricular zones of the fetal ventral telencephalon, and their perturbation is implicated in <i>16p11.2</i> phenotypes, prompting investigation of how the <i>16p11.2</i> microdeletion impacts their development. Here we studied human-induced pluripotent stem cell (IPSC) derived ventral telencephalic interneuron progenitors in two-dimensional culture, comparing IPSCs isogenic except for a heterozygous <i>16p11.2</i> microdeletion to minimize confounding effects of genetic background. Single-cell RNA sequencing generated single-cell transcriptome populations for comparative bioinformatics, revealing hundreds of differentially expressed transcripts, many associated with cell signaling, chromatin biology, and neurodevelopmental conditions. Pertinently, we find that transcript level variation is significantly greater between <i>16p11.2</i> heterozygous progenitors than their isogenic wild type counterparts both for sets of genes comprising regulons, gene-sets functionally connected by transcription factor regulation, and for randomly selected gene sets. This indicates that the <i>16p11.2</i> locus itself has a genome-wide property in stabilizing transcription between cells. Regulons with the greatest increased variability in <i>16p11.2</i> heterozygous progenitors exhibit strong enrichment for cell cycle-related genes, and many are regulated by transcription factors themselves associated with autism and/or obesity, suggesting the hypothesis that enhanced transcriptional variation contributes to <i>16p11.2</i> microdeletion phenotypes.

Also flagged:neurologic diseasemeningitismeningoencephalitisnecrotizing encephalitiscystsToxoplasmosis
Journal Article 2026-07-08 No Snippets Esposito E, Testori C, Mattioda V, Iaccarino D, Oliviero M, Paduano G, Auriemma C, Gallo A, Lucibelli MG, Riccardi MG, Borriello G, Galiero G, Paciello O, Giorda F, Lucifora G, Di Nocera F.
Show Full Abstract

<i>Toxoplasma gondii</i> is an emerging cause of neurologic disease in cetaceans. In the present study, we combined molecular detection, microsatellite genotyping, and neuropathology in stranded striped dolphins along the coasts of Campania and Calabria (Southern Italy). During the years 2018-2023, 93 cetaceans were necropsied. Brain tissues were screened for <i>T. gondii</i> DNA by Real-Time PCR targeting the 529-bp repeat element; positive samples (Ct range 21-30) were genotyped using eight microsatellite markers (TUB2, W35, TgM-A, B18, B17, M33, IV.1 and XI.1) and compared with reference strains by hierarchical clustering. Histology and immunohistochemistry (IHC) for <i>T. gondii</i> were performed on available brains. <i>T. gondii</i> DNA in the brain was detected in 12/93 cetaceans; all positive cases were striped dolphins (<i>Stenella coeruleoalba</i>). Genotyping revealed two genotypes, with GII in 10/12 dolphins and GIII in 2/12. In 10 evaluable cases, lesions ranged from mild non-suppurative meningitis/meningoencephalitis to severe necrotizing encephalitis. IHC was positive in 7/10 positive cases; tissue cysts were observed in proximity to lesions in the more severely affected brains. These findings document the circulation of multiple <i>T. gondii</i> genotypes in pelagic dolphins from Southern Italy, supporting the land-to-sea transmission hypothesis and confirming the value of striped dolphins as sentinels of terrestrial pathogens from a One Health perspective.

Also flagged:tumormelanomainnate immunitycell proliferationExtracellular Vesiclescancer
Journal Article 2026-07-08 No Snippets Nakano M, Tamura A, Yorikawa S, Matsuki N, Ito R, Matsuoka H, Saito M.
Show Full Abstract

<h4>Background/objectives</h4>Extracellular vesicles (EVs) participate in tumor progression and immune regulation through the transfer of bioactive molecules. Although tumor-derived EVs are generally considered to promote metastasis, accumulating evidence suggests that their functions vary according to the biological characteristics of their cells of origin. This study investigated the mechanisms underlying the anti-metastatic effects of EVs derived from <i>Nanog</i>-overexpressing melanoma cells (<i>Nanog</i><sup>+</sup>F10-EVs).<h4>Methods</h4><i>Nanog</i><sup>+</sup>F10-EVs were isolated and characterized by EV marker expression. Their anti-metastatic activity was evaluated using melanoma liver metastasis models in Rag2-deficient and macrophage-depleted mice. Differential miRNA expression analysis was performed to identify candidate functional mediators. Functional studies were conducted using <i>miR-19a-3p</i>-overexpressing cells and EVs.<h4>Results</h4><i>Nanog</i><sup>+</sup>F10-EVs significantly suppressed melanoma metastasis. Rag2 deficiency only modestly affected this activity, whereas macrophage depletion abolished the anti-metastatic effect, suggesting a predominant role of innate immunity. miRNA profiling identified <i>miR-19a-3p</i> as a candidate mediator enriched in <i>Nanog</i><sup>+</sup>F10-EVs. Despite promoting tumor cell proliferation and migration, <i>miR-19a-3p</i>-enriched EVs partially reproduced anti-metastatic activity. Macrophage marker analysis suggested that these effects were not fully explained by classical M1/M2 polarization.<h4>Conclusions</h4><i>Nanog</i><sup>+</sup>F10-EVs may suppress metastasis through macrophage-dependent innate immune regulation potentially mediated by <i>miR-19a-3p</i> and are consistent with a model of preemptive immune education.

Also flagged:Acute Myeloid LeukemiaAMLhematologic malignancymethylationpost-translational modificationschromatin
Journal Article 2026-07-08 No Snippets Xu J, Lacaud G.
Show Full Abstract

Acute myeloid leukemia (AML) is a heterogeneous hematologic malignancy characterized by a block of differentiation and uncontrolled expansion of myeloid progenitor cells. Standard treatment includes intensive induction chemotherapy, typically with cytarabine and anthracycline, followed by consolidation chemotherapy or allogeneic hematopoietic stem cell transplantation. However, these approaches are often associated with relapse and treatment-related toxicity. Accumulating evidence highlights a critical role for epigenetic dysregulation in driving disease initiation, progression, and therapeutic resistance. In this review, we examine an integrated framework of epigenetic regulation in AML, encompassing DNA methylation, histone post-translational modifications, chromatin remodeling, and RNA-mediated epigenetics. We discuss how alterations in key epigenetic regulators, such as DNMT3A, TET2, IDH1/2, EZH2, and histone-modifying enzymes, reshape the transcriptional and epigenetic landscape of leukemic cells. Particular emphasis is placed on epigenetically defined AML subtypes, including <i>NPM1</i>-mutated, <i>DNMT3A</i>-mutated, and <i>KMT2A</i>-rearranged AML, which illustrate distinct mechanisms of transcriptional and epigenetic dysregulation and confer unique therapeutic vulnerabilities. We further summarize current and emerging therapeutic strategies, ranging from conventional chemotherapy to molecularly targeted agents, epigenetic drugs, and immunotherapeutic approaches. Despite these advances, durable responses remain limited, highlighting the need to better understand epigenetic mechanisms to overcome resistance and improve patient outcomes.

Research Square 2026-07-08 Preprint (No Snippets API) Jauhari A, Clise C, Amygdalos O, Wang X, Singh T, Michealraj K, Agnihotri S, Carlisle D, Friedlander R.
Show Full Abstract

<title>Abstract</title> <p> Huntington’s disease (HD) is an inherited neurodegenerative disorder caused by CAG repeat expansion in the <italic>HTT</italic> gene, yet the molecular mechanisms linking mutant huntingtin (mHTT) to selective neuronal vulnerability remain incompletely understood. Emerging evidence suggests that post-transcriptional RNA regulation plays a role in HD pathogenesis; however, the contribution of epitranscriptomic modifications remains to be fully defined. Here, we identify N⁶-methyladenosine (m⁶A) RNA methylation as a conserved and modifiable regulator of HD-associated neurodegeneration. Using complementary HD mouse models (R6/2 and zQ175), human postmortem striatum, and mHTT-expressing striatal cells, we demonstrate dysregulation of the m⁶A machinery, including upregulation of the writers METTL3/METTL14 and the reader IGF2BP3, accompanied by elevated global m⁶A levels in the cortex and striatum. Pharmacological inhibition or siRNA-mediated knockdown of METTL3 reduced global m⁶A, improved cell viability, suppressed caspase-3/9 activation, and attenuated inflammatory cytokine production in HD cells. Mechanistically, knockdown of either METTL3 or IGF2BP3 significantly reduced mHTT protein levels in sdhQ <sup>111/111</sup> striatal cells, identifying an m⁶A-IGF2BP3 axis that promotes mHTT accumulation and toxicity. Notably, these interventions had minimal effects in wild-type cells, indicating the selective vulnerability of mHTT-expressing cells. Together, these findings establish aberrant m⁶A RNA methylation as a driver of mHTT accumulation, neuronal apoptosis, and inflammation in HD, and highlight the METTL3-IGF2BP3 pathway as a promising epitranscriptomic therapeutic target. </p>

PLCL1
Also flagged:metabolismdiabetesIronautosomeschromosomeautosome
Journal Article 2026-07-07 ✓ 1 Snippet Wang M, Duan S, Sun Q, Tang R, Luo L, Zhong J, Sabitov Z, CAGDP Consortium†, Wei LH, Liu C, Zhabagin M, He G.
In-Text Gene Mentions

…pain, in CAAH‐Mixed;PLCL1and DPP10 ,…

Show Full Abstract

Central Asians are underrepresented in genomic research, limiting insights into their genetic history and disease risk. We established the Central Asian Genomic Diversity Project and sequenced whole genomes from 166 individuals across 20 Central Asian and Afghan Hazara groups. We identify marked differentiation driven by varying West/East Eurasian ancestry; Tajiks align with West Eurasians, Dungans with East Asians, and we report four geographically structured Turkic-related clusters, two Indo-European clines, and long-range migration events, including Siberian links in Hazaras and Sino-Tibetan ties in Dungans. Admixture dates cluster ∼650-1000 years ago, coinciding with the Song-Yuan era and Mongol expansion. We characterize distinct distributions of medically relevant variants and population-specific adaptation signatures across metabolic, immune, and neurological pathways, and illuminate shifts in subsistence practices correlated with trait-associated variation. We also detect Neanderthal-like and Denisovan-like segments that show group-specific associations with immunity, psychiatric risk, drug metabolism, and diabetes, underscoring the scientific imperative for a broader characterization of Central Asian evolutionary history and informing precision medicine.

CACNA1E
Also flagged:nerve injurymitochondrialmembranemetabolismconstriction injurycytoplasmic
Journal Article 2026-07-07 ✓ 1 Snippet Sun F, Yu N, Yu L, Tian X, Ma Y, Xie Y, Wang T, Ma C.
In-Text Gene Mentions

…( Ntrk1, Nefh,Cacna1e), injury‐associated NP…

Show Full Abstract

Neuropathic pain results from aberrant sensory processing following nerve injury. Voltage-dependent anion channels (VDACs), a family of ATP gatekeepers in the outer mitochondrial membrane, are central to cellular metabolism and action potential generation, yet their roles in peripheral neuropathic pain remain poorly defined. Here, we demonstrate that among the VDAC isoforms, VDAC1 is predominantly expressed in dorsal root ganglion (DRG) nociceptive neurons and is markedly upregulated in a mouse model of chronic constriction injury (CCI). Functionally, VDAC1 promotes neuropathic pain by increasing mitochondrial ATP permeability, thereby elevating cytoplasmic ATP levels and enhancing neuronal excitability. Genetic or pharmacological inhibition of VDAC1 reduced cytoplasmic ATP, suppresses neuronal hyperexcitability, and alleviates pain behaviors. Collectively, these findings indicate the role of VDAC1 in ATP dynamics and neuronal excitability, highlighting it as a potential therapeutic target for neuropathic pain.

Also flagged:spermatogenesisamino acidinfertilemale infertilitymatingcourtship
Journal Article 2026-07-07 No Snippets Bowman JD, Silva N, Schüftan E, Almeida JM, Brattig-Correia R, Oliveira RA, Tüttelmann F, Enard D, Navarro-Costa P, Lynch VJ.
Show Full Abstract

Gorillas have a polygynous social system in which the highest-ranking male has almost exclusive access to females and sires most of the offspring in the troop. Such behavior results in a dramatic reduction of sperm competition, which is ultimately associated with numerous traits that cause low efficacy of gorilla spermatogenesis. However, the molecular basis behind the remarkable erosion of the gorilla male reproductive system remains unknown. Here, we explored the genetic implications of the polygynous social system in gorillas by testing for altered selection intensity across 13,310 orthologous protein-coding genes from 261 Eutherian mammals. We identified 578 genes with relaxed purifying selection in the gorilla lineage, compared with only 96 that were positively selected. Genes under relaxed purifying selection in gorillas have accumulated numerous deleterious amino acid substitutions; their expression is biased towards male germ cells, and they are enriched in functions related to meiosis and sperm biology. We tested the role of gorilla relaxed genes previously not implicated in male reproductive function using the <i>Drosophila</i> model system and identified 41 novel spermatogenesis genes required for normal fertility. Furthermore, by exploring exome/genome sequencing data of infertile men with severe spermatogenic impairment, we found that the human orthologs of the gorilla relaxed genes are enriched for loss-of-function variants in infertile men. These data provide compelling evidence that reduced sperm competition in gorillas is associated with relaxed purifying selection on genes related to male reproductive function. The accumulation of deleterious mutations in these genes likely provides the mechanistic basis behind the low efficacy of gorilla spermatogenesis and uncovers new candidate genes for human male infertility.

NEGR1POU3F2
Also flagged:morphogenesisneuraldevelopmental disorderstissue morphogenesisembryogenesisorganogenesis
Journal Article 2026-07-07 ✓ 3 Snippets Huang RE, Anand GM, Megale HC, Chen J, Abraham-Igwe C, Ramanathan S.
In-Text Gene Mentions

…, SP5 ,POU3F2, SSRP1 ,…

…PAX8 , andNEGR1(from bottom left…

…PAX8 , andNEGR1( Figure 5D…

Show Full Abstract

Genetic studies of human embryonic morphogenesis are constrained by ethical and practical challenges, restricting insights into developmental mechanisms and disorders. Human pluripotent stem cell (hPSC)-derived organoids provide a powerful alternative for the study of embryonic morphogenesis. However, screening for genetic drivers of morphogenesis in vitro has been infeasible due to organoid variability and the high costs of performing scaled tissue-wide single-gene perturbations. By overcoming both these limitations, we developed a platform that integrates reproducible organoid morphogenesis with uniform single-gene perturbations, enabling high-throughput arrayed CRISPR interference screening in hPSC-derived organoids. To demonstrate the power of this platform, we screened 77 transcription factors in an organoid model of anterior neurulation to identify <i>ZIC2</i>, <i>SOX11</i>, and <i>ZNF521</i> as essential regulators of neural tube closure. We discovered that <i>ZIC2</i> and <i>SOX11</i> are required for closure, while <i>ZNF521</i> prevents ectopic closure points. Single-cell transcriptomic analysis of perturbed organoids revealed co-regulated gene targets of <i>ZIC2</i> and <i>SOX11</i> and an opposing role for <i>ZNF521</i>, suggesting that these transcription factors jointly govern a gene regulatory program driving neural tube closure in the anterior forebrain region. Our single-gene perturbation platform enables high-throughput genetic screening of in vitro models of human embryonic morphogenesis.

Also flagged:Breast Cancertumortumorsphosphorylationglycolysismetabolism
Journal Article 2026-07-07 No Snippets Meng S, Wei X, Wang Z, Chen S, Chen K, Cheng J, Chen Z, Liang J, Dai L.
Show Full Abstract

Reversing the immunosuppressive tumor microenvironment by targeting metabolic competition between tumors and immune effector cells could induce tumor starvation and enhance the activity of immune cells, representing a potential approach to boost tumor immunotherapy. However, its actual efficacy is limited by compensatory oxidative phosphorylation (OXPHOS) energy replenishment and low delivery efficiency. Herein, we report a hydrogen sulfide (H<sub>2</sub>S)-self-supplying nanoplatform that orchestrates a dual blockade of glycolysis and OXPHOS for improved triple-negative breast cancer (TNBC) immunotherapy. The micellar system, HA-ADT@W, achieves tumor-targeted delivery of a glycolysis inhibitor (WZB117) and H<sub>2</sub>S continually released in GSH-overexpressed tumor cells. This strategy concurrently suppresses glucose uptake in tumor cells by reversing the acidic tumor microenvironment (TME) and disrupts compensatory OXPHOS via H<sub>2</sub>S-mediated inhibition of cytochrome c oxidase. Consequently, we demonstrate a significant rewiring of tumor energy metabolism that not only induces immunogenic cell death with remodeling of the immunosuppressive TME but also alleviates nutrient constraints of immune effector cells, leading to enhanced infiltration and function of cytotoxic immune cells. This work exhibits a smart nanoplatform-based H<sub>2</sub>S self-supplied micelle for reinforced TNBC immunotherapy via regulated metabolic competition between tumors and immune effector cells with TME normalization.

Also flagged:sweat gland carcinomasweat gland carcinomastumorsextramammary Paget's carcinomabreast cancerplatinum
Journal Article 2026-07-07 No Snippets Ziemer M, Erdmann M, Agaimy A, Becker JC, Böer-Auer A, Helbig D, Erfurt-Berge C, Frisman A, Hempel C, Leiter U, Meier F, Mentzel T, Racz L, Redler S, Schliep S, Seidel C, Tasdogan A, Utikal J, Weishaupt C, Ugurel S.
Show Full Abstract

The current classification of sweat gland carcinomas is based on histomorphological characteristics and distinguishes between more than 20 entities. Most patients are older, but some subtypes also affect middle-aged and younger patients. The majority of tumors arise de novo. Sweat gland carcinomas have nonspecific clinical features. The tumors are usually located in the head and neck area and on extremities, with the exception of extramammary Paget's carcinoma, which has an anogenital predilection. Sweat gland carcinomas occurring in the armpit may pose a histomorphological challenge in distinguishing them from metastatic or primary breast cancer. The diagnosis is made histopathologically via excisional biopsy. Histopathological subdifferentiation is essential for an accurate diagnosis. Metastasis initially occurs locally (per continuitatem), later to regional lymph nodes and distant organs. The treatment of choice is complete surgical excision with entire histopathological margin control (microscopically controlled surgery) or alternatively with wide local excision with a safety margin. Postoperative adjuvant radiotherapy is recommended for high-risk tumors. The data available for drug therapy of advanced tumors is generally weak, with the best results seen for chemotherapy using platinum derivatives. Furthermore, targeted therapies are possible, e.g., with HER2/neu or EGFR inhibitors, possibly in combination with chemotherapy. A risk-adapted regimen is recommended for the follow-up care.

HTT
Also flagged:Huntington's diseaseHDautosomal dominant neurodegenerative disordermitochondrialbehavioral
Journal Article 2026-07-07 ✓ 1 Snippet Cervantes-Arriaga A, Beltrán-Torres AX, Romero-García D, Rodríguez-Violante M.
In-Text Gene Mentions

…the huntingtin gene (HTT), resulting in mutant…

Show Full Abstract

Huntington's disease (HD) is a progressive, autosomal dominant neurodegenerative disorder caused by cytosine-adenine-guanine (CAG) trinucleotide repeat expansion in the huntingtin gene (HTT), resulting in mutant huntingtin (mHTT) with toxic gain-of-function and partial loss of normal huntingtin function. This narrative review summarizes recent advances in genetics, pathophysiology, clinical features, diagnostic assessment, biomarkers, and therapeutic development. Genetic testing demonstrating an expanded HTT CAG repeat is the definitive diagnostic test and should be interpreted with genetic counseling and attention to allele categories. Pathophysiologically, HD involves CAG instability, age-dependent somatic expansion in vulnerable neurons, transcriptional dysregulation, proteostasis failure, mitochondrial dysfunction, excitotoxicity, and neuroinflammation, leading primarily to degeneration of striatal medium spiny neurons and later cortical involvement. Clinically, HD can begin from juvenile to late-adult life and manifests with motor, cognitive, psychiatric, and behavioral symptoms that evolve from premanifest biological change to functional decline. Current clinical care relies on symptom-directed treatment, whereas quantitative neuroimaging, cerebrospinal fluid biomarkers are mainly used for research and trial enrichment. Symptomatic management includes vesicular monoamine transporter type 2 inhibitors, antipsychotics, rehabilitation, nutritional support, and multidisciplinary care. Emerging disease-modifying approaches include HTT-lowering, somatic expansion inhibition, and gene-based therapies, but efficacy depends on target selectivity, timing, delivery route, dose, and patient selection.

HFE
Also flagged:type 1 diabetesautoimmune diseasesecretiongene expressionchronic autoimmune diseasesretinopathy
Journal Article 2026-07-07 ✓ 4 Snippets Suomi T, Starskaia I, Rasool O, Kalim UU, Bruggraber S, Marcovecchio ML, Hendricks E, Overbergh L, Peakman M, Tree T, Brunak S, Schulte AM, Mathieu C, Knip M, Lahesmaa R, Elo LL, INNODIA Consortium.
In-Text Gene Mentions

…TNF , TNFRSF8,HFE, and STAM…

HFEencodes a protein…

…51 Additionally,HFEvariants have been…

…52 and maternalHFEgenotypes have been…

Show Full Abstract

<h4>Background</h4>Type 1 diabetes is an autoimmune disease with significant long-term complications. Variability in the decline of insulin secretion after diagnosis complicates both the development of treatments and disease management. We previously reported that gene expression changes within the first year post-diagnosis were associated with C-peptide decline at two years in the first INNODIA cohort of patients with newly diagnosed type 1 diabetes. Here, we aimed to validate these findings in an independent follow-up cohort and to increase statistical power by combining the data from both cohorts.<h4>Methods</h4>We analysed transcriptomic data from a follow-up INNODIA cohort of 168 individuals with newly diagnosed type 1 diabetes to assess whether previously identified associations with disease progression could be replicated. We then combined data from the original and follow-up cohorts for integrated analysis. Longitudinal gene expression changes during the first year after diagnosis were examined in relation to disease progression, alongside age and estimated immune cell abundances.<h4>Findings</h4>Analysis of the follow-up cohort validated the previously observed longitudinal changes in gene expression during the first year after diagnosis. In the combined dataset, transcriptomic analysis identified a large number of genes that were differentially expressed during the first year after disease onset. More rapid disease progression was associated with younger age and a relative decrease in neutrophil abundance. In addition, changes in the expression of several genes were associated with the rate of disease progression.<h4>Interpretation</h4>These findings support the existence of biological heterogeneity in disease progression after diagnosis of type 1 diabetes and contribute to an improved understanding of the molecular dynamics associated with disease progression. These findings may help future studies aiming to enable patient stratification and design of more targeted and personalised therapeutic approaches in type 1 diabetes.<h4>Funding</h4>This project has received funding from the Innovative Medicines Initiative 2 Joint Undertaking under grant agreement No 115797 (INNODIA) and No 945268 (INNODIA HARVEST).

TNFSF4
Also flagged:chromatininfectionhomeostasischronic inflammatory diseaseinflammatory diseasesrheumatoid arthritis
Journal Article 2026-07-07 ✓ 1 Snippet Yang W, Pires S, Cardakli E, Nagayama M, Scott C, Tran N, Oguntunmibi S, Bradstreet TR, Webber AM, Astorkia M, Betel D, Diehl G, Edelson BT, Longman RS.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

A key feature of the intestinal immune system is balancing pathogen defense with antigen-specific tolerance to commensal bacteria. Here, using conditional deletion models, we identified the transcription factor BHLHE40 as a central regulator of group 3 innate lymphoid cell (ILC3)- and RORγt⁺ antigen-presenting cell (APC)-dependent mucosal immunity. In ILC3s, BHLHE40 drove transcription of cytokine effector programs and maintenance of mucosal immunity. Cytokine TL1A stimulation and inflammation induced Bhlhe40 expression, amplifying these programs through epigenetic modulation of chromatin accessibility at effector loci. Bhlhe40 was also highly expressed in RORγt⁺ APCs, where it was required for the generation of antigen-specific Tregs. In parallel, BHLHE40 integrated microbial cues to promote expression of the co-stimulatory molecule OX40L by ILC3s, further promoting antigen-specific Treg induction. Together, these findings define Bhlhe40 as a coordinated regulator of barrier immunity and support a model in which ILC3s and RORγt⁺ APCs act in concert to shape antigen-specific intestinal immunity.

HTT
Also flagged:neurodegenerative disorderinclusion bodiesautosomal dominant neurodegenerative disorderneurodegenerative disorderspolyglutamine disorderspolyQ disorders
Journal Article 2026-07-07 ✓ 5 Snippets Thomas MG, Levy SA, Jenkins MH, Lambert M, Frost B.
In-Text Gene Mentions

…the protein huntingtin (HTT).…

…we have developedHTTLUM , a…

…iferase-based detector of HTT-HTTinteraction in adult…

…of the huntingtin (HTT) gene.…

…1HTTis a large…

Show Full Abstract

Huntington's disease is a neurodegenerative disorder caused by a polyglutamine (polyQ) expansion in exon one of the gene that encodes for the protein huntingtin (HTT). PolyQ expansion drives HTT aggregation into multimeric species that range from soluble oligomers to fibrillar, insoluble inclusion bodies. Cellular mechanisms facilitating HTT aggregation are incompletely understood, hindering efforts to develop strategies that prevent inclusion body formation or promote clearance of misfolded protein. To enable future unbiased <i>in vivo</i> screening approaches to identify genetic modifiers and pharmacological strategies to suppress HTT aggregation, we have developed HTT<sup>LUM</sup>, a split-luciferase-based detector of HTT-HTT interaction in adult <i>Drosophila melanogaster</i> neurons. This system permits real-time monitoring of HTT multimerization in living, active flies. The non-lethal nature of the HTT<sup>LUM</sup> system enables subsequent analysis of HTT aggregation, neurotoxicity, and other phenotypes in the same flies, thus serving as a platform for medium-throughput screening followed by mechanistic validation of potential modifier candidates.

Also flagged:adherens junctionsmembranesecretiondiabetes mellitusfibrotic diseasessalivary gland tumors
Journal Article 2026-07-07 No Snippets Min SN, Wu LL, Yu GY, Cong X.
Show Full Abstract

Although salivary glands are highly vascularized, the microvascular endothelial barrier has only recently emerged as a pivotal determinant of glandular homeostasis and disease. This review synthesizes current understanding of the salivary gland endothelial barrier, with particular emphasis on the regulation of tight junctions (TJs). Structurally, the barrier comprises endothelial cells interconnected by TJs and adherens junctions, supported by a basement membrane and pericytes. Among TJ components, claudin-5 serves as a key endothelial-specific regulator of paracellular permeability, and is dynamically modulated by biochemical and mechanical stimuli during saliva secretion. Cholinergic, adrenergic, and neuropeptide signaling pathways coordinate to fine-tune endothelial permeability to meet the fluctuating secretory demands. Conversely, under pathological conditions, such as Sjögren's syndrome, radiation-induced injury, diabetes mellitus, fibrotic diseases, and salivary gland tumors, the integrity of the endothelial TJ complex is impaired. These pathologies are characterized by aberrant TJ expression, mislocalization, and signaling-mediated junctional disassembly, which trigger vascular leakage and immune cell infiltration-two key processes that act as primary drivers of glandular dysfunction. Collectively, these findings enrich our understanding of the microvascular mechanisms that link endothelial barrier function to salivation, and highlight that the restoration of junctional integrity is a promising therapeutic strategy for salivary gland diseases.

OLFM4
Also flagged:aniridiaCAaniridia-associated keratopathycell adhesionextracellularimmune responses
Journal Article 2026-07-07 ✓ 2 Snippets Li S, Stachon T, Fries FN, Csidey M, Náray A, Csorba A, Élő Á, Seitz B, Nagy ZZ, Maka E, Corton M, Jávorszky E, Tory K, Ludwig N, Szentmáry N.
In-Text Gene Mentions

…Among them,OLFM4, S100A7 ,…

…including FAT3 ,OLFM4, LRRTM3 ,…

Show Full Abstract

This study aimed to measure mRNA and miRNA expression profile in corneal impression cytology (IC) samples from patients with congenital aniridia (CA) and healthy controls, and to elucidate the key genes and signaling pathways involved in aniridia-associated keratopathy (AAK). Corneal IC samples were collected from 14 patients with CA and 14 healthy controls. RNA sequencing was performed to identify differentially expressed genes (DEGs) and miRNAs. Correlations with age and AAK grade were analyzed, selected miRNAs were validated by RT-qPCR, and Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were conducted to characterize biological functions and pathways. A total of 695 DEGs and 19 differentially expressed miRNAs were identified. <i>KRT24</i> expression was negatively associated with age, whereas <i>LY6D</i> expression positively correlated with AAK grade. Several miRNAs were linked to disease severity, including positive correlations for miR-224-5p, miR-224-3p, and miR-452-5p, and negative correlations for miR-204-3p, miR-181b-5p, and miR-181a-5p. RT-qPCR confirmed significant downregulation of miR-204-5p and miR-138-5p in aniridia samples. Functional enrichment analyses showed that DEGs were mainly involved in cell adhesion, extracellular matrix remodeling, inflammatory and immune responses, and neural-related processes. Target genes of dysregulated miRNAs were enriched in transcriptional regulation, cell proliferation, apoptosis, and migration, with significant involvement of PI3K-Akt, AGE-RAGE, and EGFR signaling pathways. Corneal epithelial cells from patients with CA exhibit coordinated mRNA and miRNA dysregulation associated with extracellular matrix disruption, inflammation, and altered signaling pathways. These findings improve understanding of AAK pathogenesis and identify potential biomarkers and therapeutic targets.

Also flagged:canceroligonucleotidesacute coronary syndromegene expressionCas9Coronary artery disease
Journal Article 2026-07-07 No Snippets Nappi F.
Show Full Abstract

The identification of microRNAs (miRNAs) has resulted in significant advancements in research, particularly regarding their utilization as diagnostic and therapeutic targets. This has generated enthusiasm for exploring the potential of non-coding RNAs (ncRNAs) in treating cancer and other diseases, with miRNAs and long non-coding RNAs (lncRNAs) showing particular promise. Over the past twelve years, there has been significant research into RNA-based treatments. Antisense oligonucleotides and small interfering RNAs are the most commonly used. Certain products have received Federal and Drug Administration approval. Notably, the findings from clinical trials have been inconsistent, with certain investigations indicating notable effectiveness and others reporting only minimal efficacy or safety concerns. Consequently, clinical trials are currently underway to evaluate the efficacy of novel treatment options, including antimiRNAs, in addressing these challenges. There is an increasing interest in the use of long non-coding RNA (lncRNA)-based therapies. The potential for drugs developed using this technology is significant. Significant advancements in preclinical and clinical trials have emerged, indicating promising potential for future developments. MiRNAs are playing an increasingly important role in the diagnosis and prediction of acute coronary syndrome manifestations. Its utilization, whether as a comprehensive approach or in conjunction with existing biomarkers, may be implemented in the foreseeable future, especially in instances of uncertainty regarding diagnosis. The primary objective of this review is to deliver a thorough and detailed assessment of recent progress in the field of microRNA detection and characterization. A key focus of this assessment will be on their clinical translation. Secondly, an exploration of the prevailing knowledge in the field of RNA therapies as potential targets for diagnosis and treatment in the cardiovascular system will be conducted. The most recent challenges and perspectives on the road to clinical application are presented herein. The aim of the present seminar is to furnish a thorough report on the recent advancements in the detection and characterization of miRNAs and lncRNAs, with specific emphasis on their clinical translation. In summary, the paper herein presents an exploration of the most recent challenges and perspectives on the road to clinical application.

Also flagged:amino acidhemagglutination inhibitionglycoproteinshemagglutininHAneuraminidase
Journal Article 2026-07-07 No Snippets Su X, Cai K, Zong Y, Guo Y, Yin Y, Zheng X, Miao X, Yang H, Qin T, Peng D, Chen S.
Show Full Abstract

The highly pathogenic H5 subtype avian influenza viruses (AIVs) pose persistent threats to the poultry industry and public health owing to their high lethality and pandemic potential. Migratory wild birds play a pivotal role in the global dissemination and genetic reassortment of the virus, serving as both natural reservoirs and long-distance vectors that drive its spatiotemporal spread. However, the extent and evolutionary drivers of antigenic divergence among H5 AIVs circulating in wild birds in East China remain poorly understood. Here, we aim to characterize the evolutionary dynamics and antigenic divergence of H5 AIVs isolated from wild birds in East China between 2013 and 2022. Whole-genome sequencing and phylogenetic analysis revealed that the isolates belonged to multiple clades, including 2.3.2.1 and 2.3.4.4, and encompassed the H5N1, H5N6, and H5N8 subtypes. Key amino acid site analysis showed that the glycosylation site patterns in the HA and NA proteins varied among clades, with some strains exhibiting gains or losses of glycosylation sites, while certain strains had acquired mutations associated with mammalian adaptation. Cross-hemagglutination inhibition (HI) assays combined with antigenic cartography demonstrated that the majority of the isolates were antigenically well-matched with the contemporaneous vaccine strains used in China, indicating that these vaccines effectively covered the predominant circulating antigenic variants at the time. Nevertheless, potential antigenic mismatches were still observed between some circulating strains and these vaccine strains. These findings suggest that wild birds in East China may contribute to the regional movement and diversification of H5 AIVs, highlighting the value of sustained surveillance for early warning and vaccine strain evaluation.

Also flagged:lactationstressgestationsynthesissecretionparturition
Journal Article 2026-07-07 No Snippets Mól N, Zasada M, Suski M, Zasada W, Kwinta P.
Show Full Abstract

<h4>Objectives</h4>Human milk composition changes across lactation, but paired within-subject proteomic analyses comparing longitudinal trajectories in term and preterm milk remain limited. We aimed to characterize stage-associated proteomic changes within each cohort and determine whether longitudinal remodeling is shared or divergent between term and preterm lactation.<h4>Methods</h4>In this single-center prospective study conducted at the Neonatal Intensive Care Unit, Jagiellonian University Medical College, Kraków, Poland (October 2020-November 2021), 40 lactating mothers (20 preterm, <32 weeks' gestation, mean age 29.4 ± 6.1 years; 20 term, 37-42 weeks, mean age 30.2 ± 5.5 years) provided paired milk samples at ≤10 days postpartum and week 5. Milk serum proteomes were analyzed by quantitative data-independent acquisition mass spectrometry; differential abundance was assessed using two-sample <i>t</i>-tests with Storey false discovery rate correction (q < 0.05) and fold-change >1.5, followed by ClueGO pathway enrichment.<h4>Results</h4>Stage-associated differential abundance was identified for 108 proteins in term milk (58 increased, 50 decreased) and 103 in preterm milk (64 increased, 39 decreased). Of these, 87 were shared between cohorts (80.6% of term, 84.5% of preterm set) with concordant directionality. Shared upregulated pathways included oxidative stress response and glycolysis (e.g., PRDX5, fold change 2.49, q = 0.044); shared downregulated pathways related to mucosal immunity (e.g., tenascin, fold change 9.61-11.41, q < 0.0001). Cohort-specific pathway signals were limited relative to shared remodeling.<h4>Conclusions</h4>The human milk serum proteome undergoes substantial longitudinal remodeling in both term and preterm lactation, with most changes following a common temporal pattern; prematurity-related differences appear selective rather than global. These findings support lactation stage as a key determinant of milk proteomic composition and underscore the value of longitudinal, stage-aware study designs, although formal time-by-group interaction testing was not performed.

Also flagged:bindinginfectious diseasesimmune responseanxietyhigh blood pressurehypertension
Journal Article 2026-07-07 No Snippets Benedetto Tiz D.
Show Full Abstract

The amide functional group remains a cornerstone of medicinal chemistry, serving as an indispensable scaffold in the design of modern therapeutics. This review presents an analysis of FDA-approved drugs (small molecules and peptides with MW < 1300 Da) containing amide functionality between 2021 and 2025, highlighting its continued and evolving role in addressing contemporary medical challenges. An analysis of these novel therapeutics reveals the remarkable functional versatility of the amide bond. In antiviral agents like nirmatrelvir (Paxlovid<sup>®</sup>), amides form the structural backbone of peptidomimetics, enabling high-affinity binding to a viral protease. In precision oncology, as seen with adagrasib (Krazati<sup>®</sup>), the amide acts as a critical, metabolically stable linker that positions a covalent warhead for selective inhibition of a mutant kinase. This analysis underscores that amide's unique combination of planarity, resonance stabilization, and capacity for robust hydrogen bonding continues to make it an essential element in the medicinal chemist's toolkit, underpinning the development of next-generation therapeutics across oncology, infectious diseases, and neurology. To provide a practical framework for drug discovery, the synthetic routes for each drug are detailed, with particular emphasis placed on the key amide-forming strategies employed.

Also flagged:cancerbindingovarian cancermitochondrialredox homeostasismembrane
Journal Article 2026-07-07 No Snippets Bednarczyk-Cwynar B, Ruszkowski P, Kulawik M, Sip S, Zalewski P, Wiśniewska D, Günther A.
Show Full Abstract

<b>Background/Objectives:</b> This study aimed to improve the biological profile of oleanolic acid (OA) through structural modification at the C-17 carboxyl group and the C-3 hydroxyl group, with a focus on the design of short-chain alkyl esters and 3-O-furoyl hybrids. <b>Methods</b>: Two series of OA derivatives were synthesized and characterized using spectroscopic methods, including <sup>1</sup>H NMR, <sup>13</sup>C NMR and MS. In silico structure-activity relationship (SAR) analysis, ADMETox profiling, and molecular docking to the epidermal growth factor receptor (EGFR) tyrosine kinase domain were performed as predictive and hypothesis-generating tools. Anticancer activity was evaluated in vitro using the MTT assay against human cancer cell lines, including HeLa, MCF-7, A-549, SKBR-3, PC-3 and SKOV-3, as well as non-malignant human dermal fibroblasts (HDFs). Antioxidant properties were assessed using cell-free CUPRAC and DPPH assays. <b>Results</b>: The C-17 esterification markedly enhanced cytotoxic potency compared to the parent OA, while the introduction of the 3-O-furoyl moiety further improved antiproliferative activity in several derivatives. Selected compounds showed low-micromolar IC<sub>50</sub> values and moderate selectivity toward cancer cells. Molecular docking suggested favorable accommodation of selected derivatives within the EGFR ATP-binding pocket, mainly through hydrophobic and π-related interactions; however, these results do not confirm direct EGFR binding and require experimental validation. The CUPRAC and DPPH assays provided preliminary insight into chemical redox behavior but should not be directly extrapolated to intracellular antioxidant or pro-oxidant activity. Predicted ADMETox profiles indicated moderate permeability and relatively low predicted risk for selected toxicity endpoints, while also highlighting high lipophilicity, poor aqueous solubility and potential metabolic liabilities. <b>Conclusions</b>: Overall, the results identify several OA derivatives as promising anticancer lead compounds for further optimization and mechanistic investigation.

ZNF644
Also flagged:reproductiontranslationaldesmosomesmetabolismcytoplasmnucleus
Journal Article 2026-07-07 ✓ 1 Snippet Anas M, Zhao B, Yu H, Dahlen CR, Swanson KC, Ringwall KA, Hulsman Hanna LL.
In-Text Gene Mentions

…BARHL2 , andZNF644were found associated…

Show Full Abstract

Latent variables derived through factor analysis reveal the underlying biological traits (UBT) in organisms. However, research on UBT development and genomic applications in beef cattle is limited. This study aimed to model previously identified economically important UBT in genome-wide association studies (GWAS) using univariate and multivariate approaches. Data on 35 traits related to the body size, reproduction, and carcass characteristics from 297 admixed beef heifers were analyzed using two models. Due to the sample-size constraints, the two models utilized were: 1) all traits included (n = 161) and 2) optimized record numbers by segregating the reproductive and body size traits (n = 297) from carcass traits (n = 161). The UBT identified from a prior study included body size (BS) and body composition (BC) in model 1 and BS, ovary size (OS), and yield grade (YG) in model 2, along with non-contributing but economically relevant traits such as body density (DENS) and intra-muscular fat (IMF). Genotypically adjusted causal networks showed that BS influenced BC (model 1) and OS (model 2). Multi-trait and structural equation modeling (SEM) GWAS approaches were used to integrate BS with BC and OS, while univariate modeling was used for unrelated UBT and direct traits, such as YG, IMF, and DENS. Across all the approaches, 1,911 SNP from nine different regions were identified and mapped to 98 features, including genes, pseudogenes, and multiple non-coding and translational RNA. Enrichment analysis highlighted extracellular matrix-receptors, <i>HERC</i> family genes in cellular growth, desmosomes in morphogenesis, and energy metabolism related to <i>PIGY</i> genes. Genes linked to muscle and carcass traits, including <i>FAM184B, NCAPG</i>, and <i>LCORL</i>, were also identified. The heritability of UBT (0.46-0.84) was higher than that of individual traits, particularly for reproductive and carcass-related traits. This study provides insights into the relationships of body and carcass-oriented traits in admixed beef heifers that are directly relevant to phenotyping and genetic evaluations being conducted in the beef industry.

Also flagged:immune responsecancerneurodegenerative diseasemelanomacancersdegradation
Journal Article 2026-07-07 No Snippets Kazmierski WM, Miriyala N, De la Rosa M, Miller J, Gentry ZO, Samano V, Catalano J, Chong PY, Wang F, Price DJ, Basilla J, Mebrahtu M, Wang L, Shewchuk L, Matico R, Dunham R.
Show Full Abstract

The indoleamine 2,3-dioxygenase 1 (IDO1) enzyme promotes an immunosuppressive microenvironment and disrupts natural antitumor immune response in cancer cells. IDO1 inhibition has been a target of multiple cancer immunotherapy efforts and is of interest to autoimmune and neurodegenerative disease therapeutic areas. While the first-generation holo-IDO1 inhibitor, epacadostat, did not demonstrate sufficient response in the phase III ECHO-301 trial, multiple next-generation inhibitors and combination therapy clinical trials are ongoing. Herein, we describe our IDO1 inhibitor discovery and optimization effort, in which the lipophilic ligand efficiency index was used to track and guide drug-likeness, minimize entropic penalty, and deliver novel, potent, selective, and orally bioavailable apo-IDO1 inhibitors. Compounds in this class have the potential for an improved pharmacodynamic response and thus are potentially attractive clinical candidates. Our lead molecules are achiral and can be easily synthesized on a large scale in several synthetic steps.

PRDX6
Also flagged:atrial fibrillationventricular arrhythmiasmetabolic diseasespathogenesiscatecholaminergic polymorphic ventricular tachycardiaCa 2+
Journal Article 2026-07-06 ✓ 1 Snippet Li B, Dong Y, Chen Y, Liu C, Li Y.
In-Text Gene Mentions

…(PLA2) activity ofPrdx6is crucial for…

Show Full Abstract

Oxidative stress mediated by NADPH oxidase 2 (NOX2), a major source of reactive oxygen species in the myocardium, is an important mechanism that underlies cardiac arrhythmias. NOX2 is activated by the precise assembly of multiple protein subunits. It plays a critical role in initiating and sustaining atrial fibrillation and ventricular arrhythmias by disrupting calcium homeostasis, differentially regulating ion channel function, and inducing structural remodeling. Notably, a close association between NOX2 and arrhythmias is well-established, and interventions targeting NOX2 have demonstrated therapeutic potential. However, the signaling pathways through which NOX2 modulates myocardial electrophysiology under different pathological states remain unclear. Moreover, the dynamic coupling of NOX2 with upstream risk factors, such as abnormal cardiac load and metabolic diseases, remains poorly characterized. In this review, we summarize the structure, activation mechanisms, arrhythmogenic mechanisms, and targeted strategies of NOX2, providing a comprehensive reference for understanding its role in cardiac electrical remodeling and developing antiarrhythmic therapies.

HFE
Also flagged:autoinflammatory diseasesAIDsimmune-mediated disordersimmune responsesautoinflammatory disease
Journal Article 2026-07-06 ✓ 1 Snippet Geniş EÇ, Çam FS.
In-Text Gene Mentions

…in MEFV (38.2%),HFE(29.1%), and SLC29A3…

Show Full Abstract

ObjectiveAutoimmune and autoinflammatory diseases (AIDs) represent a heterogeneous group of immune-mediated disorders characterized by dysregulated innate and adaptive immune responses. This study aimed to investigate the immunogenetic background of AIDS by assessing the distribution of genetic variants identified by a targeted next-generation sequencing (NGS) panel and elucidating genotype-phenotype correlations in the context of systemic immune dysregulation.Materials and methodsA targeted NGS panel encompassing 19 genes involved in immune regulation, inflammatory signaling pathways, and immune tolerance was utilized to evaluate a cohort of 110 patients presenting with clinical manifestations suggestive of autoinflammatory disease. Clinical severity was quantitatively assessed using longitudinal serum C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) measurements across acute and baseline periods. Detected variants were classified according to the American College of Medical Genetics and Genomics (ACMG) guidelines and correlated with patient clinical phenotypes and established immunogenetic literature.ResultsA total of 55 genetic variants were identified across 41 patients. Alterations predominantly clustered in MEFV (38.2%), HFE (29.1%), and SLC29A3 (21.8%), followed by NOD2, MVK, CARD14, IL10RB, and PLCG2 (1.8% each). According to ACMG criteria, 61.8% of the variants were pathogenic, 25.5% were likely pathogenic, and 12.7% were VUS. Genotype-phenotype correlation analyses successfully linked rare variants (including PLCG2, IL10RB, and CARD14) and oligogenic combinations to specific laboratory profiles. These findings revealed unexpected penetrance, variable expressivity, and distinct biomarker disassociations, most notably highlighted by isolated ESR elevations reaching 91 mm/h.ConclusionOur findings underscore the immunogenetic heterogeneity of autoinflammatory diseases and substantiate the diagnostic value of NGS-based profiling in deciphering complex genotype-phenotype associations. The integration of specific quantitative biomarkers and downstream mechanisms highlights how non-HLA regulatory variants reshape the chronic inflammatory immune microenvironment, lowering the threshold for inflammasome activation and systemic autoimmunity.

SERPINC1
Also flagged:polysaccharidesα-glucansarabinogalactanshomogalacturonansrhamnogalacturonansmannose
Journal Article 2026-07-06 ✓ 1 Snippet Zhao XF, Wu ZW, Liu XQ, Qiu MH.
In-Text Gene Mentions

…10 kDa), andAPS-III(~ 300 Da)…

Show Full Abstract

Maca (Lepidium meyenii Walp.) is a high-altitude cruciferous crop native to the Peruvian Andes. Its edible hypocotyl accumulates structurally diverse polysaccharides that exhibit a broad spectrum of bioactivities, including immunomodulatory, antioxidant, anti-fatigue, and hepatoprotective effects. This review systematically summarizes recent advances in the extraction, purification, and structural characterization of maca polysaccharides. Five major structural types have been identified: α-glucans, arabinogalactans (types I and II), homogalacturonans, rhamnogalacturonans, and mannose-containing heteropolysaccharides, with molecular weights spanning three orders of magnitude (3.0-1951.0 kDa). We critically analyze structure-activity relationships, demonstrating that biological functions are governed by the interplay of molecular weight, monosaccharide composition, glycosidic linkage patterns, and spatial conformation. Key findings reveal that medium-molecular-weight fractions (200.0-400.0 kDa) exhibit optimal immunomodulatory activity, specific monosaccharide motifs confer receptor selectivity, and triple-helix conformations enhance immune recognition. Current limitations-including structural heterogeneity, incomplete mechanistic understanding, and lack of clinical validation-are discussed, alongside future research priorities. This work provides a comprehensive framework for understanding maca polysaccharide structure-function relationships and guiding their future development as functional food ingredients.

Also flagged:Alzheimer's diseasebinding
Journal Article 2026-07-06 No Snippets Nguyen TH, Nguyen HNT, Pham MQ, Phung HTT.
Show Full Abstract

Alzheimer's disease remains a major global health challenge, and β-site amyloid precursor protein cleaving enzyme 1 (BACE-1) represents a critical therapeutic target as it catalyzes the rate-limiting step in amyloid-β production. While computational studies have extensively explored small-molecule BACE-1 inhibitors, large-scale screening combined with physics-based refinement has rarely been applied to peptide scaffolds. Here, we report an integrated machine learning (ML)-to- free energy perturbation (FEP) pipeline, combining XGBoost-based screening, molecular docking, replicate explicit-solvent molecular dynamics (MD), and absolute FEP calculations, as a multi-stage alternative to single-scoring approaches for tetrapeptide lead discovery against BACE-1. Screening a library of 16,000 tetrapeptides with an XGBoost model prioritized four candidates (HWRE, HWER, WHRR, and HWRQ) for structure-based evaluation. Molecular docking confirmed favorable positioning within the catalytic cleft, while replicate MD simulations revealed multivalent binding through hydrogen bonds, salt bridges to the catalytic dyad (Asp32/Asp228), and hydrophobic contacts with conserved pocket residues; interaction-fingerprint and hotspot analyses provided residue-level guidance for optimization. FEP calculations delivered quantitative thermodynamic ranking, separating three strong predicted binders (HWRE, WHRR, HWRQ; ΔG<sub>FEP</sub> = - 29.45 to - 32.00 kcal mol<sup>-1</sup>) from the weaker candidate HWER (ΔG<sub>FEP</sub> = - 14.78 kcal mol<sup>-1</sup>). The three high-affinity peptides share a conserved H/W/R motif with persistent dyad anchoring and dense hydrogen-bond networks, a compact scaffold amenable to peptidomimetic optimization, with HWRE as the top lead across all computational stages. This study delivers experimentally testable tetrapeptide candidate inhibitors and establishes a scalable framework for peptide-based ligand discovery against BACE-1 and related aspartyl proteases.

Also flagged:Diabetic retinopathyretinal vascular diseasesdiabetesvisionagingAge-related macular degeneration
Journal Article 2026-07-06 No Snippets Kuo BI, Wang TA, Chu TC, Chan DC, Cheng SY, Tsai CT, Tsai CL, Lee YC, Chen CJ, Chen WL, Lee JT, Tsai CY, Liu PY, Chang CY, Chao CT, Kao JH, Hsieh YT, Collaborators of AI Ophthalmology Research Group.
Show Full Abstract

<h4>Background</h4>Diabetic retinopathy (DR) and age-related macular degeneration (AMD) are 2 of the leading causes of vision loss worldwide. As population aging and diabetes prevalence increase, timely detection of these conditions has become essential. However, limited professionalism and insufficient training in ophthalmic screening among general medicine physicians may lead to delayed diagnosis and treatment. Artificial intelligence (AI)-assisted diagnostic tools may help to improve the screening of DR and AMD in routine clinical practice.<h4>Objective</h4>This study aims to evaluate the clinical effectiveness and cost-effectiveness of AI-assisted fundus imaging for DR and AMD screening in adults with diabetes and older adults at risk of macular degeneration.<h4>Methods</h4>This multicenter, 2-arm, parallel-group, open-label, individual-level randomized controlled trial and patient recruitment are performed at the settings of Family Medicine and Geriatric and Gerontology Care over 4 medical centers in Taiwan. Eligibility includes (1) diabetic individuals aged ≥20 years for DR screening, and (2) individuals aged ≥50 years for AMD screening. The study protocol has been approved by the ethics committees of all participating hospitals, and all participants will provide written informed consent.<h4>Results</h4>The study was funded in September 2024, began on October 2, 2025, and is expected to be completed in December 2027. After the pilot implementation phase without randomization, participants will be randomized 1:1 into two groups: (1) AI-assisted screening, and (2) usual physician-only screening. The primary outcomes will include the detection rates (defined as participants with confirmed DR or AMD among all screened participants) and the positive predictive values (defined as participants with confirmed DR or AMD among those who tested positive). Cost-effectiveness analyses will be performed using data derived from the trial results.<h4>Conclusions</h4>This study will provide robust evidence on the effectiveness of AI-assisted ophthalmic screening in improving patient eye health outcomes through timely screening and accurate early detection. This strategy may be cost-effective.

HTT
Also flagged:Huntington's diseaseHDagingautophagy
Journal Article 2026-07-06 ✓ 1 Snippet Lee SW, Upshaw TJ, Bailey DJ, Lee SA, Kim J, Joshi P, Smith GE, Swinford S, Oh YM.
In-Text Gene Mentions

…repeats within theHTTgene, leading to…

Show Full Abstract

Huntington's disease (HD) arises from abnormal expansion of CAG trinucleotide repeats within the HTT gene, leading to mutant huntingtin (mHTT) aggregation, progressive loss of striatal medium spiny neurons (MSNs), and progressive neurodegeneration. While the genetic cause is established, the mechanisms that confer selective MSN vulnerability, particularly those linked to aging, remain unclear. We employed a combination of miR-9/9*-124-driven reprogramming and MSN-specific transcription factors to generate patient-derived MSNs from fibroblasts of symptomatic HD patients (HD-MSNs), pre-symptomatic mutation carriers (pre-HD-MSNs), and healthy controls, preserving donor age signatures. Multi-omics analysis integrating RNA-seq and ATAC-seq revealed reduced CDKN1A expression and promoter accessibility in HD-MSNs compared with pre-HD-MSNs. Overexpression of CDKN1A in HD-MSNs alleviated HD pathologies, including DNA double-strand breaks, oxidative DNA damage, and mHTT aggregates, while improving neuronal survival and autophagy-associated activity. Conversely, knockdown of CDKN1A in pre-HD-MSNs elicited opposite effects, revealing a CDKN1A-dependent survival mechanism in HD. Together, these findings suggest that reduced CDKN1A expression may contribute to HD-associated MSN vulnerability and is associated with altered DNA damage responses and autophagy-related processes in HD-MSNs. Our study identifies CDKN1A as a potential modulator of neuronal resilience in HD.

TRIM38
Also flagged:acute myocardial infarctionmitochondrialcardiovascular diseasescoronary artery diseasemembraneautophagy
Journal Article 2026-07-06 ✓ 1 Snippet Ren M, He S, Duan M, Chi B, Chen Z, Zhao Z, Ciren Z, Qiangba Y, Fu Y, Wang G, Yuan L, An F, Jia E.
In-Text Gene Mentions

…the E3 ligaseTRIM38, leading to annexin…

Show Full Abstract

Circular RNAs (circRNAs) have been implicated in various cardiovascular diseases and hold promise as diagnostic biomarkers and therapeutic targets. However, the roles and mechanisms of circRNAs in coronary artery disease (CAD) and its severe complication, acute myocardial infarction (AMI), remain unclear. CircRNA sequencing, fluorescence in situ hybridization, and quantitative PCR were used to assess circTMCC1 expression in human coronary artery segments, peripheral blood mononuclear cells (PBMCs) from CAD patients, M1 macrophages, and an AMI mouse model. Multiple analytical methods were employed to investigate the predictive value of circTMCC1 for quantitative flow ratio (QFR) measurements. In vitro, we employed plasmid overexpression, small interfering RNA transfection, flow cytometry, immunofluorescence, reactive oxygen species (ROS), and mitochondrial membrane potential assays. In vivo, Masson's trichrome, hematoxylin and eosin staining, and immunohistochemistry were performed. Mechanistic investigations included bioinformatics, RNA pull-down, RNA immunoprecipitation, co-immunoprecipitation, western blotting, and immunofluorescence. CircTMCC1 was significantly upregulated in CAD patients (p < 0.001) and associated with poor prognosis in AMI mouse models. CircTMCC1 was highly expressed in M1 macrophages (p < 0.001), and silencing its expression reduced M1 polarization, improved cardiac function after infarction, and regulated mitochondrial autophagy. Mechanistically, circTMCC1 facilitates the interaction between annexin A1 and the E3 ligase TRIM38, leading to annexin A1 degradation. Additionally, the AMPK/mTOR signaling pathway was identified as a downstream target of circTMCC1. These findings suggest that circTMCC1 may serve as a promising diagnostic biomarker and therapeutic target for CAD and AMI, potentially improving prognosis.

HTT
Also flagged:bindinghereditary non-polyposis colon cancerHNPCCLynch syndromemismatch repairreplication forks
Journal Article 2026-07-06 ✓ 1 Snippet Chen Y, Hu H, Shang X, Fishwick KM, Greco G, Xiao Q, Zhou Y, Huang Q, Jiang T, Huang X, Wang G, Zhen X, Xu G, Qin S, Sartori AA, Liu Y.
In-Text Gene Mentions

…In theHttQ111 knock-in mouse…

Show Full Abstract

Huntington's disease is driven by CAG repeat expansion in the mutant huntingtin gene. Nuclease FAN1 and mismatch repair protein MLH1 regulate repeat expansion through direct interaction, but the underlying structural basis remains unclear. Here, we show that the MLH1 C-terminal domain binds to FAN1-derived peptides containing either the MIP or MIM motif with comparable affinities. Crystal structures of this domain bound to each motif provide structural insights into human MLH1-FAN1 interaction, revealing a conserved mechanism for FAN1-MIP recognition and a previously unrecognized binding site on MLH1, termed the S3 site, for FAN1-MIM engagement. Co-immunoprecipitation assays confirmed that mutation of key MLH1 residues disrupts FAN1 binding in cells. These findings establish the molecular basis of MLH1-FAN1 recognition and provide a structural framework for understanding the regulation of CAG repeat expansion in Huntington's disease.

PRDX6
Also flagged:ferroptosisdeathpathogenesisR
Journal Article 2026-07-06 ✓ 5 Snippets Liu J, Zou H, Huang M, Zhuang C, Hu Y, Wang Z, Wang L, Yao J, Zhang F.
In-Text Gene Mentions

…MiR-381-3p targets the CREB1/PRDX6axis to regulate…

…of peroxiredoxin 6 (PRDX6) to facilitate its…

…upregulation of the CREB1/PRDX6axis significantly suppressed…

…inhibition of the CREB1/PRDX6axis exacerbated ferroptosis,…

…clusion, the miR-381-3p/CREB1/PRDX6signaling axis protects…

Show Full Abstract

Ferroptosis, an iron-dependent type of cell death, has attracted significant attention in recent years. Accumulating evidence demonstrates that ferroptosis critically contributes to the pathogenesis of intestinal ischemia/reperfusion (I/R) primarily through triggering excessive lipid peroxidation, disrupting iron homeostasis, and disabling endogenous antioxidant system. Therefore, targeted inhibition of ferroptosis represents a promising therapeutic strategy to alleviate intestinal I/R damage. However, the upstream molecular regulatory networks governing ferroptosis in intestinal I/R, especially miRNA-mediated post-transcriptional regulatory mechanisms, are not fully understood. MiRNA microarray analysis revealed that the expression of miR-381-3p is upregulated following intestinal I/R insult. Bioinformatic prediction combined with dual-luciferase reporter assays confirmed that miR-381-3p directly targets and negatively regulates cAMP response element-binding protein 1 (CREB1), a key transcription factor closely implicated in ferroptosis modulation. Subsequent experiments confirmed that CREB1 specifically binds to the promoter region of peroxiredoxin 6 (PRDX6) to facilitate its transcriptional activation, as quantified by quantitative real-time PCR. Both in vivo intestinal I/R injury mouse models and an in vitro Caco-2 cell hypoxia/reoxygenation (H/R) model were utilized for functional verification. The results revealed that upregulation of the CREB1/PRDX6 axis significantly suppressed the expression of acyl-CoA synthetase long-chain family member 4 (ACSL4), which is a key marker of ferroptosis. Meanwhile, enhanced GPX4 activity and elevated intracellular glutathione (GSH) content were observed, accompanied by reduced intracellular iron overload and alleviated histological and cellular morphological damage. Conversely, inhibition of the CREB1/PRDX6 axis exacerbated ferroptosis, with corresponding adverse changes in these ferroptosis-related indicators. In conclusion, the miR-381-3p/CREB1/PRDX6 signaling axis protects against intestinal I/R by suppressing ferroptosis, providing novel molecular targets and a theoretical basis for the prevention of intestinal I/R injury.

HTT
Also flagged:brain disordersage-related brain diseasesagingcognitioncognitive declinedepression
Journal Article 2026-07-06 ✓ 3 Snippets Mantey R, Hu J, Touhidinia M, Butt T, Sidky AM, Sobhani R, Estrada S, Haendler K, De Domenico E, Beyer MD, Breteler MMB, Aziz NA.
In-Text Gene Mentions

…carriers in theHTTgene exhibited significantly…

…expansions in theHTTgene [ 13…

…expansions in theHTTgene may confer…

Show Full Abstract

<h4>Background</h4>Although genome-wide association studies (GWAS) have uncovered many genetic variants linked to brain structure, much of its heritability still remains unexplained. Short tandem repeats (STRs) are rarely considered in GWAS but may account for part of this "missing heritability". While the causal association of large pathogenic repeat expansions with a range of brain disorders is well established, the role of non-pathogenic STR variations in the general population is largely unknown. In this study, we systematically assessed the relationship between STR variations and brain imaging-derived phenotypes across the adult lifespan in the general population.<h4>Methods</h4>We used targeted deep sequencing to genotype approximately 3,000 polymorphic STRs across 2,958 individuals (mean age: 54.1 years, range: 30-90 years, 57.1% women) from the population-based Rhineland Study in Bonn, Germany. STR sizes at 2940 loci were estimated using ExpansionHunter v5, while 45 brain imaging-derived phenotypes were obtained from 3T T1-weighted MRI scans using the FreeSurfer processing pipeline. Associations between STR lengths and neuroimaging phenotypes were assessed using multiple linear regression models, adjusting for age, sex, population stratification, and other relevant covariates. Significant findings were independently assessed for directional consistency in the UK Biobank Imaging Substudy (N = 38,879), leveraging available whole-genome sequencing data.<h4>Results</h4>The expansion of an intronic AC repeat in PRR14L was associated with larger thalamic volume (standardized β [95% CI] = 0.15 [0.06-0.24]), while AATG repeat polymorphisms in NADK were associated with reduced subcortical gray matter volume (-0.05 [-0.08 to - 0.01]) and thalamic volume (-0.06 [-0.08 to - 0.04]). These associations were directionally consistent in the UK Biobank cohort. Beyond single loci, higher polygenic burden of moderate STR expansions was associated with increased total brain, gray matter, supratentorial, and thalamic volumes (all multiple-testing-corrected p < 0.05).<h4>Conclusions</h4>Our findings indicate that moderate STR expansions are region-specific determinants of brain morphology and suggest that STR variability may have evolved to enhance neuroanatomical plasticity and cognitive function. By leveraging large population-based cohorts, our study extends current understanding of how repetitive genomic elements contribute to inter-individual variation in brain structure beyond the effects of single-nucleotide variation.

Also flagged:innate immunitycanceradaptive immunityimmune responsestumorviral infection
Journal Article 2026-07-06 No Snippets Chen B, Tao X, Wang Y.
Show Full Abstract

The cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway is a central regulator of innate immunity and plays a critical role in inducing pro-inflammatory cytokines and type I interferons (IFN-I). This pathway has emerged as a promising target for cancer immunotherapy and antiviral treatments. Despite its promise, the clinical translation of STING agonists is hindered by several challenges, including structural instability, high production costs, and inefficient delivery systems. These barriers underscore the urgent need for further research and innovation to optimize STING-based therapies. This review provides a comprehensive overview of the cGAS-STING pathway, focusing on its activation mechanisms and recent advances aimed at enhancing its therapeutic efficacy. Alternative activators of STING, including metal ions, exogenous DNA, and endogenous DNA, are discussed for their potential to stimulate this pathway. Furthermore, synergistic therapeutic strategies combining cGAS-STING activation with reactive oxygen species (ROS)-based treatments, such as photodynamic therapy, radiotherapy, sonodynamic therapy, and chemodynamic therapy, are highlighted. Finally, recent progress in harnessing STING activation for antiviral defense against emerging pathogens, such as SARS-CoV-2 and influenza viruses, is summarized to provide insights into the future development of cGAS-STING-targeted immunotherapies.

Also flagged:hydroxyapatitesynthesisWatermetalszinccopper
Journal Article 2026-07-06 No Snippets Bekele EA, Korsa HA, Desalegn YM, Adem AA.
Show Full Abstract

Lead (Pb(ii)) exposure poses significant health risks to various organ systems, including the hematological, renal, neurological, and cardiovascular systems. In this study, nano-hydroxyapatite (nano-HAp) was prepared <i>via</i> an ultrasonication-assisted hydrothermal method to remove Pb(ii) from an aqueous solution. The nano-HAp adsorbent was characterized using X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), Brunauer-Emmett-Teller (BET) surface area, and point of zero charge (pH<sub>pzc</sub>) analyses. The effects of various factors, including pH (2-8), initial Pb(ii) concentration (40-200 mg L<sup>-1</sup>), adsorbent dose (0.01-0.07 g L<sup>-1</sup>), and contact time (30-130 min), were investigated, with the residual Pb(ii) concentrations measured <i>via</i> atomic absorption spectroscopy (AAS). The highest removal efficiency of 99.84% was achieved at an optimum pH of 5, an initial Pb(ii) concentration of 40 mg L<sup>-1</sup>, an adsorbent dose of 0.03 g L<sup>-1</sup>, and a contact time of 110 min. Based on the coefficients of determination (<i>R</i> <sup>2</sup>), the pseudo-second-order kinetic (<i>R</i> <sup>2</sup> = 0.9912) and Langmuir isotherm (<i>R</i> <sup>2</sup> = 0.9993) models best described the adsorption process. The maximum monolayer adsorption capacity was determined to be 133.33 mg g<sup>-1</sup>. Thermodynamic analysis confirmed that the process was spontaneous and endothermic, as indicated by positive Δ<i>H</i> and negative Δ<i>G</i> values. Furthermore, reusability studies demonestrated that the nano-HAp adsorbent maintained a removal efficiency above 86% after five successive cycles. Therefore, the prepared nano-HAp adsorbent represents a promising, eco-friendly adsorbent for Pb(ii) removal.

Also flagged:synthesisacridine1,10-phenanthrolinebindingguaninehydrogen
Journal Article 2026-07-06 No Snippets Sárik JR, Szatmári I, Lőrinczi B.
Show Full Abstract

In the past 30 years acridine and 1,10-phenanthroline ring systems have become more widespread in the investigation of novel G-quadruplex binding compounds. Starting from the well-known BRACO19 and PhenDC3 these biologically active scaffolds have undergone several major structural changes to improve the affinity and selectivity of these noncanonical DNA and RNA structures. The library of these molecules is dominated by symmetrical derivatives, however recently asymmetrical analogues have also found their way to be the focus of several research groups. Furthermore, the modification of the 1,10-phenanthroline ring system has also been investigated and has led to derivatives with competent G-quadruplex binding capabilities. The aim of this review is to provide a comprehensive look into the chemistry behind these molecules and to investigate the most widely used methods to achieve these compounds.

Also flagged:synthesisinfectious diseasesmetabolismmineralizationcell adhesionosteoblast activity
Journal Article 2026-07-06 No Snippets Sultana N, Akash MH, Mrittika BM, Das H, Fatema K, Maisha MN, Abedin Muntasir MJ, Alamgir M.
Show Full Abstract

Hydroxyapatite (HAp), a calcium phosphate material that closely resembles the mineral phase of natural bone, is widely studied due to its biocompatibility, bioactivity, and osteoconductivity, making it an important biomaterial in biomedical applications. With increasing demand for HAp-based materials, considerable research has focused on developing synthesis methods to tailor its structural and functional properties. Variations in synthesis strategies can significantly influence crystallinity, particle size, porosity, and surface characteristics of HAp, which in turn affect biological performance. Among biogenic sources, bovine-derived HAp has received attention due to its compositional similarity to natural bone mineral. Several studies report that, depending on extraction and processing conditions, bovine HAp can exhibit favorable crystallinity, mechanical stability, and porous architecture; however, these properties remain highly dependent on preparation parameters and require careful control. This review summarizes the synthesis of bovine HAp using conventional methods (thermal decomposition and hydrothermal techniques), hybrid approaches (calcination combined with vibro-milling and alkaline heat treatment, as well as ultrasonic-assisted spray drying), and emerging techniques such as subcritical water processing, transferred arc plasma, and annealing, each offering varying degrees of control over physicochemical properties. Characterization techniques, including X-ray diffraction (XRD), scanning and transmission electron microscopy (SEM, TEM), and energy-dispersive X-ray spectroscopy (EDX), are discussed for evaluating crystallinity, morphology, and elemental composition respectively. Furthermore, the biomedical applications of bovine-derived HAp are reviewed, including bone tissue engineering, bone grafting, dental repair, drug delivery, bioactive coatings, and antibacterial activity. While bovine-derived HAp shows promise as a sustainable and multifunctional biomaterial, further studies are required to address challenges related to processing consistency, long-term performance, and clinical translation.

Also flagged:synthesisBeta-tricalcium phosphatedegradationmetalscalcium phosphatetricalcium phosphate
Journal Article 2026-07-06 No Snippets Akter T, Habibur Rahman M, Shadat Hossain M, Maruf MMS, Alam MK, Sahadat Hossain M.
Show Full Abstract

Beta-tricalcium phosphate (β-TCP) is widely utilized in biomedical applications due to its outstanding biocompatibility and strong osteoconductive properties. Its high bioresorbability in the physiological environment allows the implanted material to undergo slow, controlled degradation over time, facilitating a gradual replacement with the body's native tissue, making it particularly suitable for bone reconstruction. A large number of studies have investigated the synthesis of β-TCP using a variety of chemical approaches, including both dry and wet approaches. Each method has distinct advantages and limitations, and these significantly influence crystallite size, crystallinity, densification behavior, shrinkage, morphology, and the overall properties of the final product. For surgical implants that require high mechanical strength, achieving high ceramic density is essential. The use of nano-sized β-TCP powders as starting materials has proven effective in producing dense ceramics. Furthermore, to preserve the resorbability of β-TCP, it is critical to obtain a pure phase. For these reasons, investigations into β-TCP synthesis have steadily increased, with a particular focus on tailoring its crystallographic properties. This review focuses on six methods for synthesizing β-TCP for bone grafting materials, dental implant applications, and bone tissue engineering. Traditional β-TCP synthesis is often criticized for generating large, non-uniform particles and secondary phases at high temperatures. In contrast, methods such as sol-gel, hydrothermal, solution combustion, and chemical precipitation are preferred for their superior control over the final product properties. We summarize the available information on each synthesis process, including benefits and drawbacks.

HFE
Also flagged:LipidMetabolic dysfunction-associated fatty liver diseasehepatocellular carcinomacirrhosisdiglyceridesphingomyelin
Journal Article 2026-07-06 ✓ 1 Snippet Safri F, Pickford R, Xu Y, Yang W, Nguyen R, Yuen L, Lam V, Nahm C, Pang T, George J, Qiao L.
In-Text Gene Mentions

…alcohol-related liver disease,hemochromatosis, or other causes…

Show Full Abstract

Metabolic dysfunction-associated fatty liver disease (MAFLD) is now the leading cause of hepatocellular carcinoma (HCC) globally. HCC surveillance is currently restricted to patients with cirrhosis, leaving those without cirrhosis, who present with more advanced disease and poorer outcomes without adequate risk stratification tools. This study compared lipid profiles across MAFLD and MAFLD-related HCC (MAFLD-HCC) patients, with and without cirrhosis, to characterise metabolic dysregulation underlying non-cirrhotic MAFLD-HCC (<i>nc</i>MAFLD-HCC). Plasma and liver lipidomic profiles were obtained from 221 patients (140 MAFLD, 66 cirrhotic MAFLD-HCC (<i>c</i>MAFLD-HCC), and 15 <i>nc</i>MAFLD-HCC) using untargeted liquid chromatography mass spectrometry. Univariate, multivariable and enrichment analyses were performed for statistically determining the lipid profile difference between the groups. Seventy percent of lipid classes were more abundant in MAFLD than in ncMAFLD-HCC and cMAFLD-HCC. Multivariate analysis revealed distinct lipid profiles across the three groups in both plasma and liver. Over 100 lipid species including diglyceride (DAG), sphingomyelin (SM), triglyceride (TG), dihydroceramide (DHCer), and linoleic acid derivatives were differentially expressed in ncMAFLD-HCC versus MAFLD, with enrichment in pathways such as glycerolipid metabolism, G-protein signalling, MAPK signalling, EGFR-TKI resistance pathway, implicated in HCC development. <i>nc</i>MAFLD-HCC exhibits a distinct lipid signature, offering preliminary mechanistic insight and a foundation for non-invasive biomarker development.

POU3F2
Also flagged:deathnerve injurygene expressionperipheral nerve injuryaxonalautophagy
Journal Article 2026-07-06 ✓ 1 Snippet Zhou Z, Xiong R, Fu S, Su Y, Ao Q, Chen YC, Ao P.
In-Text Gene Mentions

…3 homeobox 2 (Brn2/POU3F2), and early growth…

Show Full Abstract

Schwann cells, the principal glial cells of the peripheral nervous system, play a central role in nerve repair following injury. Upon injury, mature Schwann cells dedifferentiate into repair Schwann cells. These processes are governed by complex gene regulatory networks, yet the quantitative dynamics of these processes remain unclear. Here, using a bottom-up systems biology approach, we constructed an endogenous regulatory network model based on experimentally validated interactions, without relying on high-throughput data as input. The model captures Schwann cell dedifferentiation dynamics and reveals a potential landscape composed of stable states and intermediate transition states. Simulations recapitulate post-injury trajectories and confirm the role of c-Jun upregulation in maintaining repair capacity. Furthermore, the model predicts multiple potential therapeutic targets, including tumor protein p53 (P53), c-Jun N-terminal kinase (JNK), and phosphatase and tensin homolog (PTEN), for sustaining repair competence. We also identify intrinsic heterogeneity within repair Schwann cells. Furthermore, we uncover key transition states that simultaneously connect repair-competent cells to both repair-deficient and apoptotic phenotypes. These intermediate states may represent critical regulatory bottlenecks and serve as key cellular targets for improving peripheral nerve regeneration. Overall, this work provides new insights into the precise regulation of Schwann cell fate and establishes a theoretical framework for regenerative medicine and clinical strategies in peripheral nerve repair.

Also flagged:metabolismresponse toendoplasmic reticulumresponse to stresscell-cyclegene expression
Journal Article 2026-07-06 No Snippets Pannala VR, Hari A, Auerbach SS, Wallqvist A.
Show Full Abstract

The liver and kidneys are the primary organs that clear chemicals from the body, yet they often exhibit different pathological responses to the same systemic exposure. While high-throughput transcriptomics (HTT) can map broad molecular perturbations, identifying the differential mechanisms that govern organ-specific injury remains a challenge. To address this knowledge gap, we investigated the dose-dependent effects of three peroxisome proliferator-activated receptor alpha agonists-coumarin, fenofibrate, and perfluorooctanoic acid (PFOA)-on liver and kidney metabolism to understand the organ-specific mechanisms of toxicity. We used HTT data from 5-day <i>in vivo</i> rat exposure studies and performed a comparative analysis on the paired liver and kidney data, using gene co-expression and pathway enrichment analyses together with genome-scale models, to investigate their differential sensitivity to chemical exposure. Our results revealed that all three chemicals caused larger gene perturbations in the liver compared to the kidney, in agreement with their well-known hepatotoxicity. Fenofibrate and PFOA triggered a profound upregulation in pathways related to fatty acid metabolism but suppressed several pathways related to amino acid metabolism in both organs. All three chemicals showed a strong upregulated antioxidant response in the liver, indicating an adaptive response to chemical stress, with fenofibrate and PFOA entering uncontrolled endoplasmic reticulum stress, which was also observed for PFOA in the kidney. Our comparative analysis revealed a striking divergence in cellular repair mechanisms in response to stress across both tissues: while the liver strongly upregulated apoptotic and cell-cycle repair pathways, signaling active hepatotoxicity, the kidney consistently downregulated these same vital processes in response to all three chemicals, indicating differential mechanisms that may lead to organ toxicity.

Also flagged:transportationgene expressionmetabolismgestationexcretionpsychological stress
Journal Article 2026-07-06 No Snippets Sebesta SR, Baker EC, Cilkiz KZ, Cardoso RC, Hairgrove TB, Long CR, Randel RD, Welsh TH, Riley DG.
Show Full Abstract

The liver is a central regulator of metabolic and endocrine functions that support fetal growth and postnatal development. Prenatal stress can reprogram hepatic development in the offspring, potentially causing long-term changes in metabolism and production efficiency. However, the influence of prenatal stress on hepatic molecular function and resulting phenotypes in beef cattle remains poorly understood. Therefore, the objectives of this study were to evaluate phenotypic traits and liver tissue gene expression in Brahman heifer and bull calves from prenatal transportation stress (PNS) and control (Control) treatment groups. One group of pregnant Brahman cows were transported for a 2-h period every 20 (±5) d from 60 to 140 days of gestation. Another group of pregnant Brahman cows served as Control. Thirty-two calves, eight heifer and eight bull calves from the PNS and Control groups, respectively, were utilized. Calves were weighed at approximately 25 (±2) d of age. The following day, calves were euthanized, and liver tissues were harvested. Phenotypic traits evaluated include birth weight, harvest weight, liver weight, pen score, and liver weight:harvest weight. Interaction of sex and treatment did not explain substantial variation for any trait (<i>P</i> > 0.28). Sex influenced birth weight, harvest weight, liver weight (<i>P</i> < 0.05), and treatment influenced liver weight:harvest weight (<i>P</i> < 0.10). Linear regression coefficients of traits on calf age as a linear covariate were not different from 0 (<i>P</i> > 0.41). Controlling false discovery rate at 0.10, there were no differentially expressed genes for PNS relative to Control and 13 differentially expressed genes for male relative to female comparisons. No genes were found to be differentially expressed across all comparisons. It is possible that the few differences between sexes and treatments may be due to relatively small sample sizes or to an unknown adaptation mechanism to the stress prenatally induced by this young age. Heightening the severity of prenatal transportation stress through increased duration or frequency of transportation may result in more differentially expressed genes.

CCPG1
Also flagged:Endoplasmic reticulumsynthesisinflammatory responsesinfectionssepsisdigestive system diseases
Journal Article 2026-07-06 ✓ 2 Snippets Wang C, Gao J, Guo C, Li Q, Wang F, Zhang M.
In-Text Gene Mentions

…receptors, such asCCPG1, SEC62, and TEX264…

…substrate selectivity level,CCPG1specifically recognizes differ…

Show Full Abstract

The endoplasmic reticulum (ER) is responsible for the synthesis, modification, and folding of various intracellular proteins. Under strong external stimuli, the ER often undergoes significant structural disorganization and functional abnormalities, a process that generally accelerates the onset and progression of inflammatory responses and related diseases, such as infections and sepsis, digestive system diseases, cancer, neurological disorders, circulatory diseases, and musculoskeletal diseases. Therefore, maintaining ER homeostasis is crucial for delaying the inflammatory process. As an important type of selective autophagy, ER-phagy has transcended merely "waste removal" to become a key cellular hub integrating immune and stress signals. It not only effectively curbs the excessive activation of the NF-κB pathway and the NLRP3 inflammasome by timely clearing inflammatory pathogens and ER fragments damaged by calcium store abnormalities and oxidation but also maintains immune cell homeostasis, thereby inhibiting the initiation and spread of excessive inflammatory responses. This review summarizes the key receptors, regulatory mechanisms, and the latest research on ER-phagy in various inflammation-related diseases, aiming to draw academic attention to the important value of ER-phagy in inflammatory diseases.

SERPINC1
Also flagged:tumourmitochondrialdigestive tract tumourscancerpathogenesismitochondria-associated
Journal Article 2026-07-06 ✓ 1 Snippet Zhang W, Tang YL, Chen YY, Shang Y, Mo HB, Huang J, Li YF, Liu ZH, Tan GL, Ning YK, Chen GQ, Ling JW, Wang L, Jiang JS, Luo JY, Chen G.
In-Text Gene Mentions

…NT5E, RHOBTB3, SEMA6A,SERPINC1, UPP1).…

Show Full Abstract

<h4>Background</h4>Mitochondria-related genes play a crucial role in driving tumour cell progression, but little is known about their molecular mechanisms and biological pathways. This study conducted a comprehensive analysis of the mitochondrial key gene LACTB2 in digestive tract tumours and explored a novel early blood-based diagnostic model for gastric cancer (GC).<h4>Methods</h4>This study analyzed LACTB2 expression, biological pathways, and immune regulation in a large cohort of 10,581 samples. IHC staining was performed using 236 internal GC samples. Multi-omics data were integrated for comprehensive analysis of LACTB2 in GC. A combination of extensive clinical samples and multiple machine learning models enabled the construction of prognostic and blood-based diagnostic models (n = 14,219).<h4>Results</h4>LACTB2 overexpression is associated with clinical metastasis and the activation of pro-cancer pathways, and LACTB2 may mediate immune suppression and immune evasion through various methods. There is a significant transcriptional regulatory network upstream of LACTB2. LACTB2 overexpression may drive malignant transformation of GC epithelial cells through pro-cancer metabolic signalling networks, and the related mechanisms were spatially validated. Dysregulated expression of LACTB2 can affect the prognosis of GC patients, and Afatinib and Ulixertinib may play a significant role in targeting LACTB2 in the treatment of GC patients. An excellent early blood diagnostic model for GC was constructed based on the upstream miRNA of LACTB2.<h4>Conclusion</h4>Our study provides new insights into the differential expression and pathogenesis of LACTB2 in digestive tract tumours, particularly its prognostic and diagnostic value in GC.

CCDC92
Also flagged:metabolismDiabetic kidney diseaseend-stage renal diseaseESRDglomerular filtrationmembrane
Journal Article 2026-07-06 ✓ 2 Snippets Shang J, Zeng Z, Chai S, Lv X, Han X, Ma B, Xu Y, Wang R, Lv Z.
In-Text Gene Mentions

…axis and theCCDC92/ABCA1 pathway, further elucid…

…of JAML orCCDC92in podocytes markedly…

Show Full Abstract

Diabetic kidney disease (DKD) is the main cause of end-stage renal disease (ESRD) worldwide. Podocytes are important components of the glomerular filtration barrier, which is located between glomerular capillary endothelial cells and the basement membrane, and is essential for maintaining normal renal function. Its injury is a key factor in the progression of DKD. Lipid homeostasis plays an important role in maintaining the normal physiological function of cells. In recent years, many studies have revealed that lipid metabolism disorders play a core role in driving podocyte injury, but its specific mechanism network has not been systematically characterized. This article systematically reviews the latest evidence from recent years, indicating that lipid metabolism disorders mainly lead to podocyte structure and dysfunction, apoptosis and extracellular matrix deposition through key pathways such as lipid peroxidation, abnormal sphingolipid metabolism and abnormal cholesterol accumulation. In addition, the review summarizes the core regulatory roles of related signaling pathways such as Sterol Regulatory Element-Binding Protein 1 (SREBP1), Peroxisome Proliferator-Activated Receptor α (PPARα) and NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome in this process. This review emphasizes that lipid metabolism disorder is a key driver of podocyte injury in DKD. This provides a theoretical basis for a new therapy for DKD that focuses on lipid metabolism as the core strategy. Future research should focus on elucidating the interaction network between these pathways and promoting the clinical transformation of related intervention strategies to delay disease progression.

Also flagged:Cell cyclecolitisinflammatory bowel diseasecolorectal cancerG1 phasetumor
Journal Article 2026-07-06 No Snippets Fu Y, Wang Y, Wu S, Ying Y, Li J, Ou Y, Wang Y, Li L, Wu Y, Yan J, Yang Z.
Show Full Abstract

The process of developing from inflammatory bowel disease (IBD) to colorectal cancer (CRC) depends on the dysregulation of the core cell cycle network. Single-cell omics studies have revealed a significant difference: malignant colorectal cancer cells are mainly in the G2/M phase, while epithelial cells in inflammatory bowel disease (IBD) exhibit G1 phase arrest or excessive proliferation - this indicates that during chronic inflammation, the original cell cycle of precancerous cells has already become dysregulated. Among the key signaling pathways, such as Rb-E2F, NF-κB, JAK-STAT and Hippo-YAP, jointly regulate the cell cycle system. Including cyclins D1, A2 and B1 and their cyclin-dependent kinases (CDKs), as well as cyclin-dependent kinase inhibitors (such as p21, p27, p57), jointly regulate intestinal tumor cells and tumor immune escape. Therefore, this review elaborates on the key interactions between ROS and the cell cycle/cyclin/CDK axis, and explains in detail how oxidative stress and DNA damage disrupt cell cycle checkpoints, thereby driving the growth, invasion, metastasis and immune escape of intestinal tumors. In conclusion, for the regulation of the cell cycle during the "inflammation-cancer" transformation process in colorectal cancer, new targets and reasonable combination strategies have been proposed.

bioRxiv 2026-07-06 Preprint (No Snippets API) Iden M, Schmidt R, Mohammed RDAS, Dlugi TA, Kumar R, Tsaih S, Nosirov B, Kadamberi IP, Mittal S, Narayan SL, Bradley WH, Erickson B, Czaja RC, Felix JC, Jin V, Ojesina AI, Pradeep S, Smith BC, Rader JS.
Show Full Abstract

TAOK3 is a lesser-studied MAPK family serine/threonine kinase our group has shown to be targeted by HPV integration, suggesting a potential role in driving invasive cervical cancer (ICC). Here, we profiled TAOK3 expression in patient tumors, metastases, and cervical cancer models and localized TAOK3 within a tumor epithelial subpopulation by integrating two single-cell RNA-seq datasets. Functional consequences of TAOK3 loss were assessed with siRNA and CRISPRi in cell lines and 3D spheroids. In vivo effects were evaluated in intracervical xenografts with species-specific RNA-seq to resolve tumor versus microenvironmental responses. TAOK3 mRNA/protein were elevated in primary and metastatic ICC and primarily localized to a keratin-positive epithelial subset (T3epi) enriched for cadherin/S100 binding, vesicle/endocytic pathways, and leading-edge programs. TAOK3 silencing reprogrammed transcriptomes and proteomes toward reduced WNT/cell-cycle and motility signaling, altered endocytosis and cytoskeleton organization, and reshaped phospho-networks linked to chromatin remodeling and ERBB2–ERBB3/cytoskeletal kinase activity. Functionally, TAOK3 inhibition prolonged G2/M, suppressed invasion, and enhanced sensitivity to low dose paclitaxel. Prolonged inactivation induced methuosis-like cell death with extracellular ATP release. In xenografts, TAOK3 knockdown reduced tumor burden, downregulated KRT14 —a leader cell marker—within the human tumor compartment, and enriched microenvironmental pathways for immune activation, with a specific decrease in CD206+ M2 macrophages. TAOK3 delineates an invasion-competent epithelial state in ICC and coordinates cell-cycle control, cytoskeleton–membrane dynamics, and tumor–immune crosstalk. Genetic or pharmacologic TAOK3 inhibition constrains tumor growth, potentiates paclitaxel, and remodels the microenvironment toward anti-tumor immunity, supporting TAOK3 as a potential therapeutic target and biomarker in ICC. <h4>Statement of Significance</h4> TAOK3 marks an invasion-competent epithelial subpopulation in cervical cancer. TAOK3 inhibition slows tumor growth, enhances chemoresponse, and reduces M2 macrophages, revealing TAOK3 as a potential therapeutic target and biomarker for patient stratification.

Also flagged:limb developmentchromatinmethylationhistone modificationsorganizationformation
Journal Article 2026-07-05 No Snippets Vallejo-De Lira CM, Galván-Hernández CI, Chimal-Monroy J, Marin-Llera JC.
Show Full Abstract

Vertebrate limb development provides an excellent model for understanding how epigenetic mechanisms coordinate the integration of positional information and temporal signals to generate complex three-dimensional structures. An increasing body of evidence shows that chromatin-based mechanisms, including DNA methylation, histone modifications, and higher-order chromatin organization, define the competence of progenitor cells to respond to morphogenetic signals with spatial and temporal precision during limb development. This review explores how epigenetic mechanisms orchestrate and regulate the major phases of limb formation: from field specification and bud induction to morphogenesis, lineage differentiation, and programmed cell death. Here, we examine how chromatin remodeling, histone and DNA modifications, and enhancer - promoter interactions functionally converge with developmental signaling pathways to control gene expression programs that govern timing, positional identity, and cell fate decisions. Furthermore, this review highlights recent advances that link epigenetic landscapes with morphogenetic outcomes and discusses how comparative epigenomic approaches are reshaping our understanding of evolutionary diversification in limb morphology.

DCC
Also flagged:extracellularcolorectal cancertumorepithelial-to-mesenchymal transitionangiogenesistumors
Journal Article 2026-07-05 ✓ 1 Snippet Limanówka P, Kot A, Wagner W, Ochman B, Mielcarska S, Kula A, Dawidowicz M, Hudy D, Szrot M, Piecuch J, Czuba Z, Świętochowska E, Gisterek-Grocholska I, Waniczek D.
In-Text Gene Mentions

…the β-catenin/APC, EGFR/Ras,DCC/SMAD4, and p53, alongside…

Show Full Abstract

Cartilage oligomeric matrix protein (COMP) influences extracellular matrix remodeling. We investigated its clinical, prognostic, and immunomodulatory significance in colorectal cancer (CRC). COMP was quantified via ELISA in 107 paired CRC and normal tissues. Expression was correlated with clinicopathological features, mutational profiles, microsatellite instability (MSI), tumor-infiltrating lymphocytes (TILs), immune checkpoints, and multiplex cytokine networks. For transcriptomic validation, the FieldEffectCrc dataset was used for Gene Set Enrichment Analysis (GSEA), and The Cancer Genome Atlas (TCGA) CRC cohort for survival analysis. COMP was significantly upregulated in CRC tissues (<i>p</i> < 0.001) and correlated with advanced T, N, and overall pathological stages (all <i>p</i> < 0.05, tau = 0.18, 0.21, and 0.23, respectively). High COMP expression was linked to restricted immune infiltration (reduced stromal TILs, <i>p</i> < 0.05, tau = -0.23), elevated levels in microsatellite stable (MSS) compared to MSI tumors (<i>p</i> < 0.01), and correlated positively with immune exhaustion markers (T-cell immunoglobulin and mucin-domain containing-3 (TIM-3), galectin-9 (GAL9), sialic acid-binding Ig-like lectin 9 (SIGLEC9)). Transcriptomic data linked high COMP to worse disease-specific and progression-free survival, and enrichment in pro-tumorigenic pathways (epithelial-to-mesenchymal transition, angiogenesis, IL-6 signaling). COMP upregulation defines an immunosuppressive microenvironment in CRC, particularly in MSS tumors. It represents an important prognostic biomarker and potential therapeutic target for overcoming immunotherapy resistance.

SUDS3
Also flagged:methylationimmune responsemetabolismdetoxificationautophagyactivity
Journal Article 2026-07-05 ✓ 1 Snippet Li Y, Xu W, Wen X, Wu A, Zhang H, Zhang H, Li W, Chen S.
In-Text Gene Mentions

…regulators (H2AZ2, NSD3,SUDS3), and genes involved…

Show Full Abstract

Chronic heat stress poses a major challenge to marine aquaculture, yet its sex-associated molecular basis remains poorly understood in Chinese tongue sole (<i>Cynoglossus semilaevis</i>). Juveniles were exposed to a control temperature (24 °C) or elevated temperature (30 °C) for two months, and liver samples from low-temperature females (LF), high-temperature females (HF), low-temperature males (LM), and high-temperature males (HM) were analyzed by RNA sequencing (RNA-seq) and whole-genome bisulfite sequencing (WGBS). Principal component analysis indicated a strong temperature-associated separation, while sex-related separation under heat stress was smaller and was mainly observed along the second principal component. In high-temperature relative to low-temperature comparisons, females showed a broader set of differentially expressed genes (DEGs; LF vs. HF, 1968) than males (LM vs. HM, 506). Differential methylation analyses indicated that cytosine-guanine (CG) methylation was the predominant heat-associated epigenetic signal. Integrative analysis identified 624 overlapping genes between DEGs and CG-associated differentially methylated genes (CG-DMGs) in females and 177 in males, suggesting broader methylation-associated transcriptional remodeling in females. Functional enrichment associated the female overlap genes with immune response, inflammatory signaling, lipid metabolism, and detoxification, whereas male overlap genes were more closely associated with proteostasis, autophagy, and DNA replication/repair. Correlation analyses suggested modest methylation-expression coupling and highlighted candidate W-linked genes, including H2AZ2 and ANKRD13A. Overall, these results should be regarded as a preliminary baseline for understanding sex-associated molecular responses to chronic heat stress in tongue sole and as a source of candidate genes and pathways for future validation and heat-resilience breeding.

DCC
Also flagged:gestationsgestationintraventricular hemorrhagesynthesisbradycardiasarcoplasmic reticulum
Journal Article 2026-07-05 ✓ 3 Snippets Surak A, Polglase G, Schmölzer GM.
In-Text Gene Mentions

…authors reported thatDCCwas associated with…

…potential risks forDCCin monochorionic twins.…

…of literature regardingDCCin twins.…

Show Full Abstract

Deferred umbilical cord clamping enhances placental transfusion and is associated with improved outcomes in preterm infants. Following lung aeration and prior to umbilical cord clamping, the increase in pulmonary blood flow contributes to establishing blood volume within the pulmonary vascular bed, which constitutes the mechanism of physiology-based cord clamping. While the benefits of deferred cord clamping have been well described in singleton deliveries, evidence in twin pregnancies remains limited. This is particularly relevant for monochorionic twins, who share a placental circulation and may be at risk of inter-twin transfusion. This narrative review summarizes and critically appraises the available literature on deferred cord clamping in twin pregnancies, with particular emphasis on monochorionic twins. We highlight potential benefits, risks, and current knowledge gaps. Individual Participant Data meta-analyses and adequately powered studies are needed to better evaluate outcomes in multiple gestations, including long-term neurodevelopment.

PRDX6
Also flagged:mitochondrialmitochondria-associatedmetabolismphosphorylationcell divisioncell cycle
Journal Article 2026-07-04 ✓ 3 Snippets Khongkla E, Kwanthongdee J, Chetsawang B.
In-Text Gene Mentions

…( O08709 ,PRDX6) belongs to an…

…Elevated levels ofPRDX6contribute to the…

…the upregulation ofPRDX6was observed in…

Show Full Abstract

ObjectiveAs an in vitro model of catecholaminergic neurons, Cath.a Differentiated cells or CAD cells have been selected because of their direct origin in the mouse CNS and their ability to undergo inducible differentiation. Dexamethasone (DEX), a glucocorticoid receptor agonist, generates postmitotic and neurite-bearing CAD cells. Although the morphological differentiation of CAD cells induced by DEX has been well characterized, a comprehensive understanding of its proteomic profile and underlying pathways remains limited. Neuronal differentiation involves substantial remodeling of mitochondrial metabolic programs. However, the relationship between DEX-induced neuronal differentiation in CAD cells and mitochondrial metabolic state remains incompletely understood.MethodsIn this study, we applied a label-free quantitative SWATH-MS proteomic approach to investigate the protein expression in CAD cells upon differentiation.ResultsThe results of the proteomic analysis of 1,114 proteins associated with various GO terms, including neuronal differentiation and characteristics of brain-derived CAD cells, are shown. The data revealed the upregulation of proteins involved in mitochondria-associated metabolism and oxidative phosphorylation in DEX-differentiated cells compared with those in dividing cells, highlighting the role of mitochondrial metabolic changes during the neuronal differentiation of CAD cells. In addition, we identified proteins that were commonly expressed between the two neuronal differentiating protocols. A shared set of proteins involves electron transport, metabolic pathways, and DNA repair.ConclusionsThis study first highlights the proteomic signature and elucidates the key altered molecular pathways underlying DEX-induced neuronal differentiation in CAD cells.

DCC
Also flagged:intervertebral disc degenerationinnervationnerveaxon
Journal Article 2026-07-04 ✓ 2 Snippets Wang M, Gao F, Xu Z, Xue K, Yu Y, Wang F, Zou J, Huang G.
In-Text Gene Mentions

…nistically, EA promoted UNC5B-DCCcomplex formation, reduced…

… subsequently modulates UNC5B/DCCdownstream cAMP-cGMP-calcium p…

Show Full Abstract

<h4>Purpose</h4>Lumbar intervertebral disc degeneration (IVDD) is characterized by abnormal innervation and neurogenic inflammation, contributing to chronic discogenic pain. Electroacupuncture (EA) alleviates IVDD-related pain, yet its underlying mechanisms remain incompletely understood. This study aimed to investigate the role of the axonal guidance factor Netrin-1 in EA-mediated inhibition of myelinated nerve fiber ingrowth into degenerative intervertebral discs and to elucidate the downstream signaling pathways involved.<h4>Methods</h4>A rabbit axial compression IVDD model was established. Animals were divided into sham, model, EA, model+OV-Netrin-1, EA+sh-Netrin-1, EA+μ-opioid antagonist (β-FNA), and EA+δ-opioid antagonist (NTI) groups. Tarlov scoring, MRI, HE, AB-PAS, immunohistochemistry, TEM, Western blot, RT-qPCR, Co-IP, ELISA and flow cytometry were used to evaluate disc histology, nerve ingrowth, Netrin-1 expression in annulus fibrosus (AF) and dorsal root ganglion (DRG), endogenous opioid peptides, receptor interactions, cAMP/cGMP levels and intracellular calcium concentration.<h4>Results</h4>EA improved Tarlov scores, restored disc structure and reduced pathological nerve ingrowth in degenerative discs. EA downregulated Netrin-1 in AF but upregulated Netrin-1 in L2 DRG. DRG Netrin-1 overexpression mimicked EA's anti-neoinnervation effect, whereas Netrin-1 knockdown abolished EA efficacy. EA elevated spinal POMC/M-ENK; blocking μ/δ opioid receptors reversed EA-mediated Netrin-1 upregulation in DRG. Mechanistically, EA promoted UNC5B-DCC complex formation, reduced cAMP, increased cGMP and lowered intracellular Ca<sup>2+</sup> via Netrin-1 receptors to inhibit myelinated axon sprouting.<h4>Conclusion</h4>EA upregulates DRG Netrin-1 by activating endogenous opioid peptide signaling. Netrin-1 subsequently modulates UNC5B/DCC downstream cAMP-cGMP-calcium pathways to suppress abnormal myelinated nerve fiber ingrowth, thereby alleviating discogenic pain and delaying IVDD progression.

DCC
Also flagged:telomerechromosomemitosischromosomesdevelopmental diseaseMRXSL syndrome
Journal Article 2026-07-04 ✓ 1 Snippet Redaelli S, Tritto V, Mangano E, Bordoni R, Sala E, Villa N, Crosti F, Dalprà L, Spaccini L, Sirtori A, Cazzaniga G, Conconi D, Bentivegna A, Riva P.
In-Text Gene Mentions

…2 of theDCCgene.…

Show Full Abstract

Chromosomal triplications are rare structural variations often associated with complex phenotypes. We report the molecular characterization of a novel intrachromosomal triplication at 18q12.1q21.2 identified in a fetus with ultrasound abnormalities. Conventional karyotyping and array-CGH revealed a partial tetrasomy and a 26 Mb region of loss of homozygosity (LOH), extending from the triplication to the telomere. Long-read sequencing (LRS) identified breakpoint junctions revealing a direct-inverted-direct triplication structure. Breakpoint analysis suggested that this rearrangement arose through a U-type exchange between sister chromatids, likely mediated by microhomology-based mechanisms. This process likely generated a transient dicentric chromosome that subsequently broke during mitosis. The resulting duplicated chromosome may have been stabilized by telomere capture, consistent with the triplicated 18q12.1q21.2 region followed by the 18q21.2q23 LOH. Nine genes within the triplicated region, including SMAD2 and SMAD4, showed high predicted sensitivity to increased dosage, possibly contributing to the clinical phenotype. This study highlights the utility of LRS in defining complex chromosomal rearrangements and emphasizes the importance of molecular breakpoint analysis for understanding pathogenic mechanisms and improving genetic prenatal diagnosis.

Update on Genetic Chorea.

HTT
Also flagged:chorea disorderschoreaAdult-onset Neurodegeneration in Nucleotide Excision Repair DisorderHDdeathhyperkinetic movement disorder
Journal Article 2026-07-04 ✓ 1 Snippet Ostrozovicova M, Skorvanek M.
In-Text Gene Mentions

…of the huntingtin (HTT) gene [ 4…

Show Full Abstract

<h4>Purpose of review</h4>Chorea is a symptom of numerous pathophysiologically and clinically heterogeneous genetic conditions. A number of developments have been made in this field over the last years linked to improved genomic testing, large cohort collaborations and improved understanding of the molecular mechanisms. This review aims to provide an update on the new genetic conditions and phenotypes linked to chorea disorders, their modification factors and pathophysiological background.<h4>Recent findings</h4>Several novel genetic conditions have been linked to chorea over the last 3 years, including mutations in FTH1, NAA60, ACBD6 or TOR1AIP2. Also, novel phenotypes have been established and linked to chorea, such as Adult-onset Neurodegeneration in Nucleotide Excision Repair Disorder (NERD-ND). Major advances have been made in understanding of the pathophysiological role of somatic instability in HD. Striatal pallidal neurons (SPNs) with 150-500 + CAG repeats seem to lose positive and then negative features of neuronal identity, de-repress senescence/apoptosis genes, ultimately leading to cell death. Improved recognition of the genetic background of chorea leads to more effective diagnostic processes, better prognostication and improved personalized treatment. The findings on somatic instability in HD suggest that neurodegeneration in HD is an asynchronous DNA process for >95% of a neuron's life, with majority of neurons in all disease stages having a HTT gene which is not biologically harmful. This has potential major therapeutic implications not only in HD but also in other neurological repeat expansion disorders.

ABT1
Also flagged:thermomorphogenesishypersensitivitytranspirationcytoplasmicdegradationphosphorylation
Journal Article 2026-07-04 ✓ 1 Snippet Qin W, Yin Q, Wang N, Pan Y, Meng S, Qin G.
In-Text Gene Mentions

…NORMAL THERMOMORPHOGENESIS 1 (ABT1) as an interactor…

Show Full Abstract

Global increases in the intensity and frequency of elevated temperatures is threatening ecosystem stability and crop yield. Understanding plant thermomorphogenesis is critical for developing climate-resilient crops, yet the underlying mechanisms remain to be clarified. Here, we identify the BEL1-LIKE HOMEODOMAIN transcription factor BLH1 as a critical negative regulator of thermomorphogenesis that modulates the key BRASSINAZOLE-RESISTANT 1 (BZR1)-PHYTOCHROME INTERACTING FACTOR 4 (PIF4) thermomorphogenic regulatory module. Overexpression of BLH1 or its homologs confers high-temperature (HT) insensitivity, whereas blh higher-order mutants exhibit HT hypersensitivity. BLH1 expression is directly repressed by BZR1 and is down-regulated by HT. We further demonstrate that BLH1 directly binds to the PIF4 promoter to repress its transcription and concurrently interacts with the PIF4 protein to inhibit its activity. Overexpression of BLH1 rescues the elongated hypocotyl phenotype in bzr1-1D or PIF4 overexpression plants. Our findings define a BZR1-BLH1-PIF4 regulatory axis that modulates the BZR1-PIF4-auxin-BR-BZR1 positive feedback loop, ensuring a balanced thermomorphogenic response to HT.

Also flagged:cancerbindingmembraneconjugationdegradationtumor
Journal Article 2026-07-04 No Snippets Majed M, Galala AA, Othman DIA, Amer MM, Abouzeid S.
Show Full Abstract

Moringa oleifera pericarp, an underutilized agro-waste, was investigated as a potential source of anticancer agents. In this study, bioassay-guided fractionation of the pericarp extract led to the identification of the ethyl acetate fraction as the most active fraction, showing notable antioxidant, antimicrobial, and cytotoxic activities. Subsequent purification afforded three compounds: 4-(α-L-rhamnopyranosyloxy)-benzaldehyde (M<sub>1</sub>), 4-(α-L-rhamnopyranosyl) benzyl alcohol (M<sub>2</sub>), and 4-(hydroxymethyl) phenol-1-O-β-D-glucopyranosyl-(1''→3')-O-α-L-rhamnopyranoside (M<sub>3</sub>). The major constituent, M<sub>2</sub>, was semi-synthetically modified by Steglich esterification with cinnamic acid and crotonic acid to yield two sugar-based enone derivatives, S1<sub>M2</sub> and S2<sub>M2</sub>. Structural elucidation was performed using IR, MS, and NMR spectroscopy. The cytotoxic activity of the isolated and semi-synthesized compounds was evaluated against HepG2 and HCT116 cancer cell lines, and selectivity was assessed using normal WI-38 fibroblasts. Among the tested compounds, S2<sub>M2</sub> exhibited the most potent cytotoxicity, with IC<sub>50</sub> values of 5.97 ± 0.19 µM and 11.52 ± 0.37 µM against HepG2 and HCT116 cells, respectively, together with favorable selectivity. In addition, S2<sub>M2</sub> showed strong inhibitory activity against epidermal growth factor receptor tyrosine kinase (EGFR-TK) and carbonic anhydrase IX (CAIX), with IC<sub>50</sub>values of 0.40 ± 0.008 µM and 0.27 ± 0.01 µM, respectively. Molecular docking and 100-ns molecular dynamics simulations supported the stable binding of S2<sub>M2</sub> within the active sites of EGFR-TK and CAIX, and MM-GBSA calculations confirmed its favorable binding free energy. Structure-activity relationship analysis suggested that the α,β-unsaturated carbonyl moiety significantly contributed to the observed anticancer activity. These findings highlight M. oleifera pericarp as a promising source of bioactive glycosylated phenolic scaffolds and identify S2<sub>M2</sub> as a potential dual-target anticancer lead for further development.

PTGIS
Also flagged:endoplasmic reticulummineralizationosteogenesisphosphorylationdisorders
Journal Article 2026-07-04 ✓ 5 Snippets Bao H, Wang J, Yang H, Liu H, Han X, Fan Z.
In-Text Gene Mentions

…While prostacyclin synthase (PTGIS) is critical for…

…lear.<h4>Methods</h4>FollowingPTGISmodulation in bone…

…n.<h4>Results</h4>Knockdown ofPTGISenhanced ALP activity,…

…Conversely,PTGISknockdown reduced tubule…

…the overexpression ofPTGISpromoted Ca²⁺ efflux,…

Show Full Abstract

<h4>Background</h4>Mesenchymal stem cells (MSCs) play a key role in ectopic mineralization. Effective treatment requires both inhibiting pathological calcification and promoting vessel growth. While prostacyclin synthase (PTGIS) is critical for vascular health, its role in regulating osteogenic and angiogenic differentiation in MSCs remains unclear.<h4>Methods</h4>Following PTGIS modulation in bone marrow mesenchymal stem cells (BMSCs), osteogenesis was assessed by alkaline phosphatase (ALP) activity, Alizarin Red staining (ARS), and hydroxyapatite/tricalcium phosphate (HA/TCP) particles implantation. Angiogenesis was evaluated via a co-culture system of BMSCs and human umbilical vein endothelial cells (HUVECs). Mechanistic studies involved Ca²⁺ dynamics, western blotting, and pharmacological inhibition.<h4>Results</h4>Knockdown of PTGIS enhanced ALP activity, mineralization, the expression of the osteogenic marker DMP1/BSP, and bone-like tissue formation both in vitro and in vivo. Conversely, PTGIS knockdown reduced tubule formation in vitro and impaired blood vessel formation, and the expression of the angiogenic marker CD31 in vivo. Mechanistically, the overexpression of PTGIS promoted Ca²⁺ efflux, endoplasmic reticulum (ER) dilation and vacuolization, increased the levels of the ER stress markers BIP/GRP75, and elevated PI3K/AKT phosphorylation. The inhibition of either ER stress or AKT activity restored osteogenic capacity by enhancing ALP activity and mineralization, and suppressed angiogenic capacity by inhibiting tubule formation in BMSCs.<h4>Conclusion</h4>PTGIS inhibited osteogenic and promoted angiogenic differentiation of BMSCs through ER stress mediated PI3K/AKT signaling pathway. This PTGIS-dependent regulatory pathway offers new insight into MSC fate determination and represents a potential therapeutic strategy for treating ectopic mineralization disorders.

PRDX6
Also flagged:ferroptosisbiosynthesisgene expressiontumormetabolismsynthesis
Journal Article 2026-07-04 ✓ 2 Snippets Zhang X.
In-Text Gene Mentions

…genetic deletion ofPRDX6exacerbating ferroptosis, and…

…Genetic deletion ofPRDX6—a regulator of cellular…

Show Full Abstract

Chronic arsenic exposure threatens over 200 million people worldwide and induces multi-organ injury, yet the panoramic molecular reprogramming across organs remains incompletely understood, and traditional single-omics approaches fail to capture cross-level and cross-organ regulatory associations. This review systematically integrates evidence from global epidemiology to single-cell spatial omics, tracing the evolution of multi-omics technologies-from single-platform profiling to data fusion strategies such as coupled matrix factorization (CMF) and the DIABLO framework, two complementary multi-omics integration approaches-and to cutting-edge spatial transcriptomics. We highlight ferroptosis as a common mechanism in arsenic-induced multi-organ injury. At the molecular level, we propose a mechanistic model wherein arsenic (AsIII) disrupts selenium metabolism by inhibiting Sec-tRNA<sup>Sec</sup> synthesis, thereby impairing selenoprotein (especially GPX4) biosynthesis, a paradigm distinct from the traditional "ROS burst → lipid peroxidation" theory. Supporting evidence includes reduced <sup>75</sup>Se incorporation into cellular RNA, genetic deletion of PRDX6 exacerbating ferroptosis, and rescue by selenium supplementation via Nrf2 activation. At the organ level, we compare toxicity features and propose that tissue-intrinsic ferroptosis thresholds-determined by iron content, PUFA-phospholipid composition, GSH reserves, GPX4 redundancy, and selenium availability-govern differential organ susceptibility; the brain shows extreme vulnerability, whereas the liver exhibits relative resistance. Emerging spatial omics further reveals elevated arsenic-responsive gene expression in tumor-adjacent regions. This systems toxicology paradigm offers mechanistic grounding for combinatorial biomarker panels and genotype-guided precision selenium supplementation, although definitive causal validation through tissue-specific Gpx4 knockout or Sec-tRNA<sup>Sec</sup> rescue experiments remains a critical next step. We also discuss prospects for AI-driven toxicity prediction models.

PCDH17
Also flagged:organizationcognitionnucleuspsychiatric disordersautism spectrum disorderobsessive-compulsive disorder
Journal Article 2026-07-04 ✓ 5 Snippets Hoshina N, Hoshina M, Yamamoto T, Takada M.
In-Text Gene Mentions

…expression of PCDH10,PCDH17, and PCDH19 broadly…

…ell adhesion molecules—PCDH10,PCDH17, and PCDH19—in the…

…• PCDH10,PCDH17, and PCDH19 show…

…members PCDH10 andPCDH17as key molecules,…

…three δ2-PCDH proteins—PCDH10,PCDH17, and PCDH19—in the…

Show Full Abstract

The basal ganglia (BG) form anatomically and functionally segregated yet integrative parallel circuits, but the molecular mechanisms specifying them remain unclear. We immunohistochemically mapped the expression of three δ2-protocadherin (δ2-PCDH) cell adhesion molecules-PCDH10, PCDH17, and PCDH19-in the BG of macaques. Within the striatum, each PCDH exhibited regional gradients of expression along the rostro-caudal and ventromedial-dorsolateral axes. The three PCDHs showed complementary distributions that continuously delineated molecular boundaries corresponding to functional subdivisions in a graded fashion. Such complementary distributions were also observed in the BG output nuclei. Given that neurons expressing the same δ2-PCDH in distinct BG structures preferentially connect with each other, the three δ2-PCDH expression patterns could define functional territories within parallel BG circuits. Together, the complementary expression of PCDH10, PCDH17, and PCDH19 broadly aligns with the distinct BG circuits, respectively, suggesting molecular codes underlying the segregated yet integrative parallel organization of the primate BG.

bioRxiv 2026-07-04 Preprint (No Snippets API) Salazar L, Burns MS, Stocksdale JT, Wang KQ, Cao G, Miramontes R, McClure NR, Ho L, Keith AR, Sutherland M, Cookson MR, Ward M, Skarnes WC, Thompson LM.
Show Full Abstract

<h4>STRUCTURED ABSTRACT</h4> <h4>Purpose of Research</h4> The generation of iPSC lines expressing 21, 56 and 79 glutamine repeats within the HTT protein and homozygous KO of HTT in the KOLF2.1J background as an additional disease series within the iPSC Neurodegenerative Disease Initiative (iNDI) collection. <h4>Major Findings</h4> All iPSCs, even those expressing long repeats of 79Q or HTT KO, were capable of differentiating to striatal and cortical neurons, astrocytes and microglia using established protocols. General quality control stains and morphological analyses are described for each differentiation. A selected set of assays were carried out on differentiated cells; expanded repeat expressing astrocytes showed altered expression of astrocyte protein markers and morphological characteristics, and striatal neurons showed altered DARPP-32/CTIP2 colocalization. mRNAseq carried out for striatal neurons showed high similarities in gene expression changes between 79Q and KO lines compared to the unexpanded repeat. <h4>Conclusions</h4> The KOLF2.1J isogenic CAG repeat series serves as a community resource to study HD mechanisms with the potential for direct comparison across other neurodegenerative diseases through the iNDI collection.

medRxiv 2026-07-04 Preprint (No Snippets API) Harder A, Wang R, Bergstedt J, Huider F, Kurvits S, Thorp J, Gong T, Assary E, Thijssen AB, Merola GP, Goula AA, Bentwood S, Karlsson R, Pasman JA, Fabbri C, Hickie IB, Peyrot WJ, Levinson DF, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Potash JB, Shi J, Medland SE, Mitchell BL, Kwong AS, Eley TC, Lewis CM, Hamilton SP, Martin NG, Boomsma DI, Lehto K, Wray NR, Breen G, Penninx BW, Milaneschi Y, Marshall S, Thomson PA, Lu Y.
Show Full Abstract

<h4>ABSTRACT</h4> Major depressive disorder (MDD) is a complex psychiatric disorder, characterized by a range of mood, cognitive, and neurovegetative symptoms. Current diagnostic criteria treat opposite symptom directions as equivalent; weight gain or loss, and increased or decreased sleep, each count toward a single diagnosis. We defined three subgroups of individuals meeting criteria for MDD: AERS+ (hypersomnia with increased appetite/weight gain), AERS− (insomnia with appetite/weight loss), and an Uncategorized group, and conducted genome-wide association meta-analyses for each ( N eff = 47,858, 156,624, and 215,828, respectively). We identified 27 genome-wide significant loci across subtypes, 4 for AERS+ , 10 for AERS− and 13 for Uncategorized. AERS+ showed higher SNP-based heritability (10.9%) and lower polygenicity (1.7% of SNPs) than AERS− (7.9%; 2.9%) or Uncategorized (8.6%; 5.3%), with larger effect sizes at its associated loci. The AERS+ and AERS− subtypes were moderately genetically correlated ( r g = 0.64, se = 0.04). Metabolic traits emerged as a primary differentiator: AERS+ correlated positively with BMI, metabolic syndrome, and related traits, whereas AERS− correlated weakly in the opposite direction. These findings show that the directionality of neurovegetative symptoms indexes genetic heterogeneity within MDD, with metabolic biology as a central axis of differentiation.

OLFM4
Also flagged:Gastric cancersynthesissolid tumorswound healingcell proliferationhomologous recombination
Journal Article 2026-07-03 ✓ 1 Snippet Cai X, He Y, Kang L, Zhou D, Wang M, Ma T.
In-Text Gene Mentions

…ALDH1A1, FAM3B, CXCL17,OLFM4, MT1M, REG1A, TCEAL9,…

Show Full Abstract

Gastric cancer (GC) is one of the most prevalent and life‑threatening malignancies of the digestive tract worldwide. Ribonucleotide reductase regulatory subunit M2 (RRM2), a rate‑limiting subunit in deoxyribonucleotide synthesis, is overexpressed and is associated with a poor prognosis in various solid tumors. However, its functional role and mechanisms in GC‑specific malignant epithelial cell populations remain unclear. Single‑cell transcriptomic data from GC and adjacent normal tissues were analyzed. Key malignant epithelial cell populations were identified using inferCNV, pseudotime trajectory analysis, and weighted gene co‑expression network analysis. RRM2 was identified as a core gene by integrating data from TCGA‑STAD, GSE66229, and GSE84433 datasets and analyzing its clinical relevance. To evaluate the biological effects of RRM2, functional assays, including colony formation, apoptosis, Transwell migration, and wound healing assays, were performed using AGS and HGC‑27 GC cells with RRM2 knockdown. DNA damage was assessed using the alkaline comet assay and phosphorylated histone H2AX (γH2AX) immunofluorescence, and the expression of DNA damage repair‑related proteins [including γH2AX, phosphorylated tumor protein p53 (p‑p53), RAD51 recombinase (RAD51), poly(ADP‑ribose) polymerase 1 (PARP‑1), and X‑ray repair cross‑complementing protein 1 (XRCC1)] was examined using western blotting. Through analysis of gastric epithelial cell populations, a major malignant epithelial effector population in GC was identified, enriched in cells with active DNA replication and repair. Differentially expressed genes specific to this population were intersected with prognostic genes from GEO GC datasets, resulting in the identification of RRM2 as a key effector gene. Transcriptomic analysis revealed that high RRM2 expression was associated with an active immune microenvironment. Functional assays showed that RRM2 knockdown significantly inhibited GC cell proliferation and migration while promoting apoptosis. In addition, RRM2 knockdown exacerbated DNA damage, upregulated p‑p53, and downregulated RAD51, with no significant effects on PARP‑1 or XRCC1 expression. Collectively, RRM2 was shown to be a crucial regulator of the malignant phenotype of gastric epithelial cells. It promoted GC cell proliferation, invasion, and migration and modulated DNA damage and homologous recombination repair. In addition, RRM2 influenced the tumor immune microenvironment, highlighting its potential as a driver of malignant progression and a promising target for immunotherapy in GC.

CCPG1
Also flagged:endoplasmic reticulumchromatinER ‐phagyERbindingmyofibrils
Journal Article 2026-07-03 ✓ 1 Snippet Wang X, Zhan G, Li J, Yang X, Wen Y, Tang Y, Zhang P, Xia Y, Yang X.
In-Text Gene Mentions

…stress (e.g., viaCCPG1at 24 hours),…

Show Full Abstract

<h4>Background</h4>The clinical utility of doxorubicin, a potent chemotherapeutic agent, is severely limited by its dose-dependent cardiotoxicity. Hypoxia-inducible factor 1α (HIF1α) is a key regulator of cardiovascular adaptation, but its role and mechanism in doxorubicin-induced cardiotoxicity (DIC) remain unclear.<h4>Methods</h4>Using in vitro (AC16 cells) and in vivo (mouse) models of DIC, we used genetic (knockout, knockdown) and pharmacological (FG4592) approaches to modulate HIF1α. Cardiac function, apoptosis, endoplasmic reticulum (ER) morphology, and ER-phagy flux were assessed. Molecular mechanisms were investigated using chromatin immunoprecipitation and promoter activity assays.<h4>Results</h4>HIF1α exhibited a dynamic, biphasic expression pattern during DIC progression. Stabilization of HIF1α by FG4592 alleviated doxorubicin-induced cardiac dysfunction, atrophy, fibrosis, and apoptosis, whereas HIF1α knockout exacerbated these injuries. The protective effects of FG4592 were strictly dependent on HIF1α. Mechanistically, HIF1α transcriptionally activated the ER-phagy receptor gene testis-expressed protein 264 (<i>TEX264</i>) by directly binding to its promoter. This activation enhanced ER-phagy, and suppressed ER stress-mediated apoptosis. Crucially, ablation of <i>TEX264</i> abolished the cardioprotective effects of both HIF1α and FG4592.<h4>Conclusions</h4>This study identifies a novel HIF1α/TEX264/ER-phagy axis that is suppressed in DIC and is central to cardiomyocyte survival. Targeting this pathway, particularly with the clinically available HIF1α stabilizer FG4592, represents a promising therapeutic strategy against DIC.

Also flagged:Circulardegradationcancerneurodegenerative disorderscardiovascular diseaseribosome
Journal Article 2026-07-03 No Snippets Lindner G, Xu SM, Santucci K, Gao Y, Janitz M.
Show Full Abstract

Circular RNAs (circRNAs) were first identified approximately 50 years ago in pathogenic viroids as single-stranded, covalently closed RNA molecules. Initially considered by-products of splicing, circRNAs are now recognised as an important class of regulatory RNAs involved in microRNA sponging, RNA-protein interactions, and cellular pathways. Their closed-loop structure, generated through backsplicing, confers resistance to exonucleolytic degradation and contributes to their stability. Owing to their tissue- and disease-specific expression, circRNAs have emerged as promising biomarkers for cancer, neurodegenerative disorders, and cardiovascular disease. Over the past decade, numerous bioinformatics tools utilising RNA-sequencing (RNA-seq) data have been developed for circRNA detection and analysis. Detection methods have evolved from manual split-read inspection to automated identification of the back spliced junction, while annotation pipelines now resolve the genomic origins and structural characteristics of circRNAs. Because individual circRNA callers vary considerably in sensitivity and specificity, a combined usage of tools in circRNA detection has become the preferred strategy for generating high-confidence datasets. Beyond their non-coding functions, increasing evidence suggests that some circRNAs possess protein-coding potential through open reading frames, cap-independent translation mechanisms, internal ribosome entry sites (IRESs), and N6-methyladenosine modifications. A new generation of bioinformatic tools can now assess the protein-coding potential of circRNAs, integrating the above features, as well as machine learning and deep learning approaches refining these predictions. This review summarises recently developed short-read RNA-seq bioinformatics tools for circRNA detection, consensus calling, annotation, and protein-coding potential prediction, with a particular focus on advances from the past five years that facilitate the identification of translatable circRNAs.

Also flagged:sleepemotional stressbehavioraltype 2 diabetesmetabolismanemia
Journal Article 2026-07-03 No Snippets Krarup KB, Krarup HB, Pedersen IS, Mørk M, Kristensen SR, Handberg A, Wimmer R, Nguyen HTT.
Show Full Abstract

<h4>Introduction</h4>Extended computer gaming is characterized by prolonged sedentary activity, disrupted sleep, emotional stress, and unrestricted intake of energy-dense foods and beverages.<h4>Objectives</h4>This study explored short-term metabolic responses and recovery following prolonged gaming in healthy young men.<h4>Methods</h4>Nine healthy male participants (mean age 25.8 ± 2.6 years) took part in a controlled local area network (LAN) gaming event consisting of two 18-hour gaming sessions separated by a 6-hour sleep period. Serum samples were collected at multiple time points during the intervention and at a 5-day follow-up. Metabolomic profiling was performed using proton nuclear magnetic resonance (<sup>1</sup>H-NMR)-based metabolomics.<h4>Results</h4>Temporal variation in serum metabolomic profiles was observed during prolonged gaming, particularly in lipid-related measures, including very low-density lipoprotein (VLDL) subclasses. Exploratory multivariate analyses showed separation between early and later time points during the intervention. At five days following the gaming sessions, metabolomic profiles showed substantial overlap with baseline. Metabolites that varied during the gaming period generally returned toward baseline concentrations, although inter-individual variability was observed.<h4>Conclusions</h4>Prolonged computer gaming was associated with transient alterations in serum metabolomic profiles in healthy young men, most notably in lipid-related measures. Metabolomic profiles at five days showed convergence toward baseline following a single gaming episode. These findings provide time-resolved insight into metabolomic variation under a real-world behavioral exposure. Further studies are required to determine whether repeated exposure to similar conditions is associated with cumulative metabolic changes over time.

Also flagged:phosphorylationinsulin resistancemetabolismdiabetesmitochondrialmitochondrion
Journal Article 2026-07-03 No Snippets Nielsen SR, Nguyen HTT, Stoico MP, Brock C, Højlund K, Pedersen IS, Frederiksen AL.
Show Full Abstract

<h4>Introduction</h4>The pathogenic mitochondrial gene variant m.3243A>G disrupts oxidative phosphorylation and is associated with insulin resistance, both of which may be linked to unfavorable lipid metabolism. However, the metabolic alterations in m.3243A>G carriers, including what differentiates those with and without diabetes, remain incompletely understood.<h4>Objectives</h4>To investigate metabolomic profiles in fasting serum and urine samples from m.3243A>G carriers compared to healthy controls.<h4>Methods</h4>Metabolomic profiling of serum and urine samples using nuclear magnetic resonance-based metabolomics in m.3243A>G carriers (n = 28) was compared to healthy controls matched for age and sex. Additionally, profiles from m.3243A>G carriers with diabetes (n = 16) were compared with carriers without diabetes (n = 12) to identify potential metabolites associated with the presence of diabetes.<h4>Results</h4>Twenty-five metabolites in serum and 16 in urine were identified as metabolites separating m.3243A>G carriers from healthy controls. The m.3243A>G carriers presented with increased triglycerides across lipoprotein particles and altered very-low-density lipoprotein concentrations and composition. In addition, there were alterations in metabolites from a number of metabolic pathways, including glycolysis, the tricarboxylic acid cycle, glutathione, one-carbon, and nucleotide metabolism. A three metabolite-urine signature (uracil, hypoxanthine, and 1-methylnicotinamide) demonstrated discriminating potential between m.3243A>G carriers and controls in exploratory machine learning analyses (area under the curve values 0.94-0.99 and cross-validation prediction of 0.81-0.93). Among m.3243A>G carriers, branched-chain amino acids were higher in individuals with diabetes compared with carriers without diabetes.<h4>Conclusion</h4>Dysregulated lipoprotein metabolism represents a significant metabolic fingerprint of m.3243A>G carriers. Furthermore, higher levels of branched-chain amino acids may be associated with the presence of diabetes.

ECI2
Also flagged:metabolismobesitymitochondriallipid dropletsbeta-oxidationMetabolic diseases
Journal Article 2026-07-03 ✓ 1 Snippet Pitkänen S, Hakomäki H, Kärkkäinen O, Lehtonen M, Das S, Rysä J, Küblbeck J, Levonen AL.
In-Text Gene Mentions

…delta isomerase 2 (Eci2), long-chain acyl-CoA synthet…

Show Full Abstract

<h4>Introduction</h4>Phthalates are widely used as plasticizers in consumer products and are suspected to be metabolism-disrupting chemicals. Di-isononyl phthalate (DINP) is commonly recognized as less hazardous substitute for more studied di(2-ethylhexyl) phthalate (DEHP).<h4>Materials and methods</h4>The effects of DINP on hepatic lipid metabolism were studied using C57BL/6J mice with diet-induced obesity, and human HepaRG and C3A cell lines. The mice were orally exposed to 0, 1.5, 15 or 150 mg/kg bw/d DINP for 20 weeks, followed by assessment of glucose and insulin tolerance, hepatic histology, transcriptome and metabolome. The cells were exposed to DINP and its metabolites, followed by measurement of mitochondrial function and nuclear receptor activation.<h4>Results</h4>The highest dose of DINP decreased hepatic lipid droplets and slightly attenuated weight gain and glucose tolerance of the mice. DINP exposure elevated acylcarnitine levels, indicating altered fatty acid beta-oxidation, which was accompanied by enrichment in mitochondrial and peroxisomal lipid metabolism pathways at transcriptomics level. In vitro, monoisononyl phthalate (MINP), the primary metabolite of DINP, increased mitochondrial respiration and beta-oxidation in presence of long-chain fatty acids. DINP metabolites activated peroxisome proliferator-activated receptors (PPARs) of both mouse and human, with an activation profile partially distinct from DEHP.<h4>Conclusions</h4>Our findings indicate that DINP remodels hepatic lipid metabolism through its active metabolites via PPARs at high doses, with additional modes of action at lower exposure levels. Due to species-specific differences in nuclear receptor activation potencies, the adverse or potentially beneficial nature of these effects in humans remains ambiguous.

PTGIS
Also flagged:colorectal cancermethylationtumormalignant tumorscancerprogrammed cell death
Journal Article 2026-07-03 ✓ 1 Snippet Sun Y, Peng K, Li Y, Zheng D, Liu L, Yin J, Yu K, Xu C, Conde J, Li Z, Yin C, Wang W, Xiao W.
In-Text Gene Mentions

…showed that SFRP2,PTGIS, DAPK1, CRYAB, SRPX,…

Show Full Abstract

Chemoresistance to 5-fluorouracil (5-FU) remains a critical barrier in colorectal cancer (CRC) management. This study integrates multi-omics data from 26,192 human samples to elucidate the RNA methylation-mediated crosstalk between tumor-associated macrophages (TAMs) and tumor cells. Machine learning models were able to effectively stratify patients by risk and identified a core signature of six genes (including SCG2), whose expression patterns were associated with poor prognosis and chemotherapy resistance-related phenotypes. Mechanistically, 5-FU elevates m6A modification in TAMs, polarizing them toward the M2 phenotype. SCG2 mRNA methylation promotes TNF-α ubiquitination, reducing its levels and thereby sustaining NF-κB activation in tumor cells to drive PCD resistance. The core candidate genes (CCGs) model effectively predicts survival outcomes. Targeting SCG2 represents a novel strategy to reverse chemoresistance by disrupting TAMs-tumor crosstalk, offering actionable targets for personalized therapy optimization.

HFE
Also flagged:Non-alcoholic fatty liver diseaseNAFLDviral infectionsimple steatosisnon-alcoholic steatohepatitisNASH
Journal Article 2026-07-03 ✓ 1 Snippet Mostafaei R, Nachvak SM, Saber A, Mahaki B, Jalilian N, Behbood L, Salehi MG, Heidarpour B, Hassankiadeh RF.
In-Text Gene Mentions

…virus, autoimmune hepatitis,hemochromatosis, celiac disease, pituitary…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD), also termed metabolic dysfunction‑associated fatty liver disease is a problem across the world. The most important factor of the increase in NAFLD prevalence is the insulin resistance. This study is the first clinical trial with the aim of determining the effect of Pistacia atlantica Sub. Kurdica gum on glycemic indices especially insulin resistance in patients with nonalcoholic fatty liver disease.<h4>Methods</h4>In this double-blind randomized clinical trial 50 patients with nonalcoholic fatty liver disease were randomized into two groups: those given syrup containing Pistacia atlantica sub. Kurdica gum (Group A), those on placebo (Group B). Over a two-month period, Group A given syrup containing 500 mg of P. atlantica sub. Kurdica gum per each tablespoon and Group B given syrup without P. atlantica sub. Kurdica gum. Anthropometric measures, biochemical indices and physical activity were evaluated at the beginning and end of the intervention.<h4>Results</h4>We observed a significant decrease in fatty liver grade in group A (P = 0.03). The mean of fasting serum insulin and the insulin-resistance index (HOMA-IR) decreased significantly (P = 0.002, P < 0.001) and quantitative insulin sensitivity check index (QUICKI) increased from baseline in group A (P = 0.001). Fasting blood sugar (FBS) decreased significantly from baseline in group A (P = 0.019), but the mean changes between group not significant (P = 0.061). Weight had significant decrease in group A (P < 0.001).<h4>Conclusions</h4>Pistacia atlantica sub. Kurdica gum can decrease insulin resistance, increase insulin sensitivity and subsequently improvement NAFLD in patient with nonalcoholic fatty liver disease. It is suggested that clinical trials be conducted in the long duration of the intervention, as well as a larger sample size.<h4>Trial registration</h4>Registration number of Clinical trial: IRCT20231219060466N1 ( https://irct.behdasht.gov.ir/ ).

ARFGEF2
Also flagged:Glaucomaprimary angle-closure glaucomagene expressionblindnessagingnormal-tension glaucoma
Journal Article 2026-07-03 ✓ 2 Snippets Hu D, Hu RY, Zhang YY, Cheng YY, Yu FL, Huang X.
In-Text Gene Mentions

…weighted genes includedARFGEF2, CDK14, and LOC643406,…

…weighted genes, includingARFGEF2, CDK14, and LOC643406…

Show Full Abstract

<h4>Purpose</h4>To investigate large-scale structural brain network reorganization in primary angle-closure glaucoma (PACG) using regional radiomics similarity networks (R2SNs) and to characterize their associated molecular and neurobiological substrates.<h4>Design</h4>Case-control study.<h4>Methods</h4>Structural magnetic resonance imaging data were acquired from 44 patients with PACG and 44 age- and sex-matched healthy controls. Individualized R2SNs were constructed to identify PACG-related structural network alterations. Partial least squares regression was used to link R2SN alterations with brain-wide transcriptomic profiles, followed by enrichment, cell-type, neurochemical, and epicenter analyses. Supervised machine learning was used to evaluate the discriminative value of R2SN-derived features.<h4>Results</h4>Compared with controls, patients with PACG demonstrated widespread R2SN alterations extending beyond the visual pathway, involving frontal, temporal, limbic, and subcortical regions. Network-level analyses revealed disrupted structural covariance across intrinsic functional systems, particularly within limbic, default mode, attentional, and frontoparietal control networks. Imaging-transcriptomic analyses showed spatial coupling between PACG-related network alterations and gene expression profiles enriched in synaptic, cytoskeletal, and immune-related processes. Epicenter analysis identified highly connected hub regions within default mode and attentional systems. Machine learning classifiers based on R2SN features achieved robust discrimination between groups.<h4>Conclusion</h4>PACG is associated with widespread structural brain network reorganization beyond the visual system.R2SN-derived network features may provide sensitive imaging markers of central structural reorganization and offer a multiscale framework for understanding the neural mechanisms of PACG.

BTN2A2BTN2A1
Also flagged:CancerBiliary tract cancertumorGene ExpressionT-cell activation
Journal Article 2026-07-03 ✓ 2 Snippets Mandal S, Astbury S, Grove JI, Ramage JM, Jackson AM, Aithal GP.
In-Text Gene Mentions
⭐ same-sentence co-mention

…Expression ofBTN2A1, BTN2A2, BTN3A1, BTN3A2,…

⭐ same-sentence co-mention

…Expression of BTN2A1,BTN2A2, BTN3A1, BTN3A2, and…

Show Full Abstract

<h4>Objectives</h4>Biliary tract cancer (BTC) remains therapeutically challenging with poor survival outcomes; systemic therapies achieving complete responses in only 2% to 5% of patients. γδ T-cell-based adoptive cell therapy represents a promising strategy due to MHC-independent activation. γδ T cells are activated through direct engagement of butyrophilin (BTN) family molecules; conversely, nonclassical HLA class-I molecules, particularly HLA-E, function as inhibitory ligands for NKG2A expressed on γδ T cells, suppressing anti-tumor immunity. Characteristics of tumor-infiltrating γδ T cells, their activity, and inhibitory interactions in BTC remain unexplored.<h4>Methods</h4>Single-cell RNA-sequencing data from 19 BTC tumor samples in the Gene Expression Omnibus (GEO) were analyzed to characterize γδ T-cell infiltration and the expression of regulatory molecules. MHC-I molecules, butyrophilin (BTN) molecules, intercellular adhesion molecules (ICAM), and NKG2A checkpoint receptors were quantified.<h4>Results</h4>γδ T cells comprised 0% to 4.9% of all cells present in the BTC tumor samples. Expression of BTN2A1, BTN2A2, BTN3A1, BTN3A2, and ICAM1 was noted in all the tissue samples, supporting Vγ9Vδ2 T-cell activation potential. Classic HLA class-I expression was preserved (70% to 90% of cells). HLA-E was overexpressed (60% to 95.7% of cells expressing HLA-E). Around 30% of NK cells and γδ T cells exhibited NKG2A positivity (log2 expression >2).<h4>Conclusions</h4>Given the presence of regulatory molecules such as BTN and ICAM, Vγ9Vδ2 T-cell-based adoptive cell therapy appears promising. A combination of elevated HLA-E expression with high γδ T-cell NKG2A positivity establishes a potent inhibitory checkpoint axis in BTC. These findings support the rationale of investigating anti-NKG2A blockade combined with γδ T-cell-based adoptive therapy as a novel therapeutic strategy.

HFE
Also flagged:polycythemiabindingerythrocytosispolycythemia verasynthesiserythropoiesis
Journal Article 2026-07-03 ✓ 5 Snippets Cinli TA, Alavanda C.
In-Text Gene Mentions

…Synergistic Contribution ofHFEH63D Mutation to…

…study examined whetherHFEH63D carriers living…

…59 patients withHFEgene mutation (heterozygous…

…assessed in theHFEmutation group to…

…higher in theHFEmutation group.…

Show Full Abstract

<b>Objective:</b> This study examined whether HFE H63D carriers living at moderate-to-high altitude have a stronger secondary polycythemia phenotype than non-carriers from the same region. <b>Methods:</b> This retrospective cohort study included 59 patients with HFE gene mutation (heterozygous <i>n</i> = 49, homozygous <i>n</i> = 10) and 51 controls without HFE mutation (total <i>N</i> = 110). JAK2 V617F negativity was confirmed in all participants. Serum erythropoietin (EPO) levels were assessed in the HFE mutation group to support secondary, non-clonal erythrocytosis. <b>Results:</b> Hemoglobin (17.32 ± 1.29 vs. 15.11 ± 0.95 g/dL (<i>p</i> < 0.001), hematocrit (median 51.50 vs. 45.20; <i>p</i> < 0.001), and erythrocyte count (<i>p</i> < 0.001) were significantly higher in the HFE mutation group. Transferrin saturation was higher in the HFE mutation group than in controls (64.56 ± 2.03% vs. 36.30 ± 1.58%; <i>p</i> < 0.001; Cohen's d = 0.95). Serum iron was higher and total iron-binding capacity was lower in the HFE mutation group, respectively (127.58 ± 44.10 vs. 93.62 ± 29.55 µg/dL and 194.32 ± 72.41 vs. 243.36 ± 40.82 µg/dL; both <i>p</i> < 0.001). CRP levels were also significantly elevated (<i>p</i> < 0.001). No significant differences were observed between the heterozygous and homozygous HFE mutation subgroup. <b>Conclusions:</b> HFE H63D carriers had higher erythrocytosis-related parameters and transferrin saturation than controls. These findings suggest that HFE-related changes in iron handling may strengthen the erythrocytosis phenotype at moderate-to-high altitude. Larger prospective studies should test this association.

DCC
Also flagged:Extracellular VesiclesTriple negative breast cancerbreast cancerdeathExtracellularvesicles
Journal Article 2026-07-03 ✓ 1 Snippet El Rayes S, Ababneh E, Nannuri V, Vaidya M, Sugaya K, Zhao J.
In-Text Gene Mentions

DCC-derived EVs…

Show Full Abstract

Triple negative breast cancer (TNBC) is an aggressive and heterogeneous subtype of breast cancer characterized by the absence of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2), resulting in limited options for targeted therapy and high rates of metastasis, recurrence and death. Extracellular vesicles (EVs) have emerged as central mediators of TNBC pathophysiology, functioning as key intercellular communication vehicles transporting oncogenic proteins, nucleic acids, lipids, and metabolites. These EV-mediated interactions promote tumor microenvironment (TME) remodeling, immune evasion, metastatic niche formation, and therapeutic resistance. Given their stability, accessibility, and molecular complexity, EVs also represent promising diagnostic and prognostic biomarkers for TNBC. Advances in isolation and molecular profiling technologies have enabled the identification of EV-associated signatures that predict therapeutic response and stratify patient risk. Beyond their utility as biomarkers, EVs are rapidly emerging as therapeutic targets and delivery platforms, demonstrating efficacy in transporting chemotherapeutics, RNA-based therapeutics, immune modulators, and photosensitizers with enhanced targeting specificity and therapeutic efficiency. Collectively, EVs play a multifaceted role in TNBC biology, serving simultaneously as drivers of disease progression, minimally invasive biomarkers, and versatile therapeutic vehicles. The integration of EV-centered diagnostics, multi-omic profiling, and engineered therapeutics holds significant potential to transform TNBC management and advance precision oncology for this challenging breast cancer subtype.

Also flagged:acute promyelocytic leukemianeuroblastomaNBcancerleukemiabreast cancer
Journal Article 2026-07-03 No Snippets Moroz P, Muciek K, Świtalska M, Wietrzyk J, Lazar Z, Gliszczyńska A.
Show Full Abstract

Tretinoin (all-<i>trans</i>-retinoic acid, ATRA) is an established therapy for acute promyelocytic leukemia (APL) and neuroblastoma (NB); however, its broader oncological application is limited by poor bioavailability and rapid resistance development. In this study, we developed lipidic ester derivatives of ATRA as a potential prodrug approach aimed at modulating its physicochemical and biological properties. Three ATRA derivatives were evaluated in vitro in six human cancer cell lines: leukemia (MV4-11), gastric (AGS), colon (HT-29), lung (A549), and breast cancer cells (MCF-7, MDA-MB-468). Cytotoxicity toward normal human breast epithelial cells (MCF-10A) was also assessed. Among the synthesized derivatives, cetyl all-<i>trans</i>-retinoate (ATRA-CA) exhibited the strongest anticancer activity, showing up to threefold greater potency than ATRA, with inhibitory concentrations ranging from 1.34 to 23.1 µM and minimal toxicity toward normal cells. Moreover, ATRA-CA enhanced the efficacy of conventional chemotherapeutics. In A549 cells, treatment with 5 and 10 µM ATRA-CA reduced the cisplatin IC<sub>50</sub> from 25.7 ± 3.2 µM to 9.1 ± 3.0 and 5.9 ± 1.5 µM, corresponding to synergistic (CI = 0.63) and additive (CI = 0.88) effects, respectively. Similar effects were observed in MCF-7 cells and in combination with doxorubicin and paclitaxel.

Also flagged:cancerprotein synthesistumorcancersribosomesgene expression
Journal Article 2026-07-03 No Snippets Luo M, Liu J, Su Y, Fu R, Huang X, Wang Q, Li J, Li Z, Liu L.
Show Full Abstract

Transfer RNA (tRNA) is essential for protein synthesis and undergoes diverse chemical modifications that regulate its stability and function. Dysregulation of tRNA expression and modifications, along with the activity of tRNA-derived small RNAs (tsRNAs) and aminoacyl-tRNA synthetases, has been increasingly linked to cancer development, influencing tumor proliferation, metastasis, stress responses, and therapy resistance. Here we systematically review the biological features of tRNA and its modifications, elucidate their mechanistic roles in various cancers, and explore the emerging functions of tsRNAs and tRNA-modifying enzymes. We also assess the diagnostic and therapeutic potential of targeting tRNA pathways in oncology. These insights provide a foundation for advancing precision medicine approaches by exploiting tRNA-related mechanisms to improve cancer diagnosis and treatment outcomes.

Also flagged:tacrolimusacute kidney injuryanemiacreatinine-mediatedchronic kidney disease
Journal Article 2026-07-03 No Snippets Hussaini T, Chahal D, Marquez V, Wen T, Dahiya M, Yoshida EM, Law MR.
Show Full Abstract

<h4>Introduction</h4>Tacrolimus (Tac) is highly bound to erythrocytes, with less than 1% present in the pharmacologically active unbound fraction. In anemia, whole-blood trough concentrations may underestimate effective exposure. Hematocrit (Hct) adjustment has been proposed but clinical outcome data are limited.<h4>Methods</h4>We conducted a single-center retrospective cohort study of adult liver transplant recipients (2018 to 2022) to examine the relationship between Hct-adjusted Tac and early clinical outcomes. Tac troughs, Hct, and serum creatinine were collected for 90 days. Hct-adjusted Tac was calculated as (0.45 ÷ Hct) × total Tac. The difference between adjusted and measured Tac (delta Tac) was used to represent anemia-related underestimation and modeled as a time-varying covariate in Cox regression for acute kidney injury (AKI) and biopsy-proven T cell-mediated rejection (TCMR), adjusting for established risk factors.<h4>Results</h4>Among 344 recipients (median age 59 years; 62% male), TCMR occurred in 15.7% and AKI in 69.8%. Delta Tac was not associated with TCMR (HR 0.93, 95% CI 0.77 to 1.14) but was associated with higher AKI hazard (HR 1.15 per ng/mL, 95% CI 1.08 to 1.24).<h4>Discussion</h4>These findings suggest that divergence between Hct-adjusted and measured Tac is associated with increased AKI risk without a corresponding signal for rejection.

Also flagged:mitochondrialorganizationribosomeprotein synthesisneurodegenerative disorderscytoplasm
Journal Article 2026-07-03 No Snippets Shahzaib M, Aprile D, Laporta G, Galderisi U, Colonna G.
Show Full Abstract

This study presents an in-depth analysis of an interactome comprising approximately 1033 nodes, focusing on its topology, reliability, and functional implications, with particular attention to the small mitochondrial proteins of the Humanin family and their nuclear-encoded MTRNR2Lx paralogs. The analysis, conducted through stringent high-reliability filters and experimentally supported interaction data, produced a curated network model in which approximately 70% of the retained interactions were supported by experimental evidence, providing a solid basis for network-based functional interpretation. The topology of the interactome showed scale-free and modular network characteristics, with hub and bottleneck nodes defining highly connected stress-response and regulatory modules. Humanin-related proteins, positioned at the periphery of the interactome, emerged as candidate modulatory nodes linking peripheral signaling interfaces to broader functional modules. Mitochondrial Humanin may contribute to early cytoprotective responses, including pathways associated with BAX-dependent apoptosis regulation, whereas nuclear MTRNR2Lx proteins appear to be connected to more sustained regulatory networks involving neuroprotection- and apoptosis-associated modules under chronic stress conditions. In particular, the MTRNR2Lx-FPR2/G-protein module, including GNB1, emerged as a candidate signaling interface that may contribute to the downstream organization of Humanin-related responses. This network-based distinction supports the view that Humanin-family peptides may operate as modulators of stress-response networks rather than as isolated effectors of intrinsic mitochondrial functions. Overall, the methodological approach, results, and proposed model provide new insights into the systems-level organization of Humanin biology and identify prioritized molecular candidates for future in vitro and in vivo validation in the context of neurodegeneration, apoptosis, and cellular stress.

B4GALT5
Also flagged:Congenital Disorders ofGlycosphingolipid Biosynthesisbiosynthesisneurological syndromesintellectual disabilityenzyme activity
Journal Article 2026-07-03 ✓ 2 Snippets Montavoci L, Dei Cas M, Penati S, Trinchera M.
In-Text Gene Mentions

…and the galactosyltransferaseB4GALT5have been reported…

…The putativeB4GALT5-associated disease is relativ…

Show Full Abstract

Glycosphingolipids (GSLs) are glycoconjugates in which a short and heterogeneous saccharide chain is attached to a lipid moiety called ceramide. Based on their sugar backbone, mammalian GSLs are primarily grouped into the ganglio-, lacto-/neolacto-, and globo-series. Sialic acid-containing GSLs are known as gangliosides. Complex ganglio-series gangliosides are particularly abundant in the brain, whereas simple ganglio-series gangliosides, as well as those belonging to other series or neutral GSLs, are less abundant and typical of non-neural tissues. Congenital disorders in the biosynthesis of the lipid moiety of sphingolipids (SLs) result from defects in enzymes and proteins involved in ceramide biosynthesis and transport. Congenital disorders in the biosynthesis of the sugar chain of GSLs specifically affect ganglio-series ganglioside biosynthesis and are caused by pathogenic variants in GM3 synthase (ST3GAL5) or GM2/GD2/asialo-GM2 synthase (B4GALNT1). Defective variants of the sialyltransferase ST3GAL3 and the galactosyltransferase B4GALT5 have been reported and proposed to impair GSL biosynthesis. The occurrence of these syndromes has provided new insights into the physiological and pathological roles of GSLs. Most of these disorders are associated with completely inactive enzyme variants, leading to severe neurological syndromes. Only a few cases highlighted variants that retained partial activity, resulting in milder phenotypes, which included non-syndromic intellectual disability. It is therefore conceivable that many undiagnosed patients, with mild neurological symptoms, may carry variants retaining residual enzyme activity, insufficient to ensure normal levels of brain GSLs. The purpose of this article is to encourage clinicians to look for additional GLS hereditary disorders associated with a milder phenotype. We also hope to boost future investigations by highlighting the most critical issues emerging from recent literature on SL and GSL biosynthesis and their related defects.

Also flagged:Asthmachronic airway diseasemucuschronic inflammatory diseasesmitochondrialenzyme activity
Journal Article 2026-07-03 No Snippets Smail SW, Salih RH, Ismail BA, Maghdid IS, Yashooa RK, Rasheed TK, Hamadamin SH, Janson C.
Show Full Abstract

Asthma is a heterogeneous chronic airway disease in which oxidative stress (OS) plays a central mechanistic role beyond classical immune-mediated inflammation. Reactive oxygen and nitrogen species (ROS/RNS), generated by recruited inflammatory cells and activated airway structural cells, drive epithelial injury, mucus hypersecretion, airway remodeling, and modulate key transcription factors including nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) pathways. This review synthesizes current evidence on the multilevel redox-based determinants of asthma severity, spanning from genetic polymorphisms to circulating biomarkers. We examine serum antioxidant enzymes, superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), peroxiredoxins (PRDXs), and the thioredoxin (Trx) system as dynamic indicators of systemic redox status and disease severity, alongside oxidative enzymes including NADPH oxidases and dual oxidases (NOX/DUOX), xanthine oxidase (XO), and myeloperoxidase (MPO) that serve as upstream sources of airway oxidant burden. Functional genetic polymorphisms in antioxidant genes <i>(SOD2, CAT, glutathione S-transferase mu 1/glutathione S-transferase theta 1 (GSTM1/GSTT1), heme oxygenase-1 (HO-1), NAD(P)H quinone dehydrogenase 1 (NQO1), nuclear factor erythroid 2-related factor 2/Kelch-like ECH-associated protein 1 (Nrf2/KEAP1))</i> and oxidative enzyme genes including <i>nitric oxide synthase 1/2/3 (NOS1/2/3), MPO, cytochrome b-245 alpha chain (CYBA)</i>, and <i>xanthine dehydrogenase (XDH)</i> are reviewed as modulators of individual redox capacity and asthma susceptibility, with particular attention to gene-environment interactions. We further discuss oxidative damage biomarkers, including malondialdehyde (MDA), 8-isoprostanes, 4-hydroxynonenal, 8-oxo-7, 8-dihydro-2'-deoxyguanosine, protein carbonyls, 3-nitrotyrosine, and advanced oxidation protein products as indicators of lipid, DNA, and protein oxidation that correlate with disease activity and control. The roles of micronutrient cofactors in modulating antioxidant enzyme function and their potential as contextual biomarkers are also addressed. Additionally, emerging evidence on microRNAs (miRNAs) linked to OS biology in asthma is presented. Finally, we critically evaluate the challenges limiting clinical translation, including biomarker non-specificity, analytical variability, gene-environment complexity, and the absence of standardized reference ranges. This integrated framework supports the development of multilevel redox prognostic panels combining genetic, enzymatic, and oxidative damage readouts for improved asthma phenotyping, severity stratification, and personalized therapeutic approaches.

bioRxiv 2026-07-03 Preprint (No Snippets API) Padukka Vidanalage AA, Gagalova KK, Furuki E, Kamphuis F, Rybak K, Periyannan S, Gibberd M, Phan HTT.
Show Full Abstract

<h4>ABSTRACT</h4> Parastagonospora nodorum (Berk.) Quaedvlieg, Verkley & Crousis, a necrotrophic fungal pathogen, is the causal agent for septoria nodorum blotch, a major constraint on global wheat production. Pathogen-produced necrotrophic effectors (NEs) that interact with host-sensitivity genes in an inverse gene-for-gene manner, collectively leading to effector-triggered susceptibility (ETS). Here, we investigated the transcriptional responses of two Triticum aestivum L. genotypes, Mace and Lancer, following infiltration with a novel NE, SnTox8. A total of 12,679 unique differentially expressed genes in Mace and 149 in Lancer were detected from transcriptomic analysis. In the SnTox8-sensitive cultivar, Mace, numerous defence-related genes were induced, including protein phosphorylation cascades, reactive oxygen species bursts, calcium signalling, phytohormone modulation, and suppression of photosynthesis, consistent with findings from other ETS models, in which necrotrophic fungal pathogens hijack host defence systems to proliferate. The interaction also activated genes involved in signal transduction, metabolism, membrane modification, and molecular transport, reflecting a coordinated host reprogramming that promotes cellular dysfunction and cell death, thereby facilitating necrotrophic pathogenesis. In contrast, Lancer, an SnTox8-insensitive cultivar, exhibited minimal transcriptional changes with no evidence of effector recognition or downstream defence-related activities. Overall, this study exhibited that SnTox8 manipulates kinase-mediated immune signalling and metabolic reprogramming to convert defence activation into host cell death, revealing a mechanistic basis for ETS in wheat. The identified SnTox8- Snn8 -triggered processes were confirmed through additional transcriptome analysis of Mace mutants. Outcomes from this study establish a foundation for identifying, functionally characterising and validating the corresponding host susceptibility gene Snn8 .

bioRxiv 2026-07-03 Preprint (No Snippets API) Nasu M, Esumi S, Wakayama T, Shimamura K.
Show Full Abstract

The piriform cortex, the largest paleocortical domain and a central olfactory cortex, is classically described as a three-layered structure, with layer II subdivided into semilunar and superficial pyramidal neurons. However, its cellular composition, developmental logic, and evolutionary relationship with the six-layered neocortex remain incompletely defined. Here, we aimed to resolve piriform cortical cell types and laminar organization and compare their molecular programs across mammalian cortical regions and the reptilian cortex. We performed single-nucleus RNA sequencing of the microdissected piriform cortex and integrated neuronal lineage data with published datasets, with spatial validation via the Allen Mouse Brain Atlas. Interspecies analyses identified piriform-dominant glutamatergic populations marked by Unc13c/Lmo3/Rora and an Rorb/Reln/Ntng1-enriched sensory-recipient subtype localized to the superficial layer IIa, consistent with semilunar neurons. Spatial transcriptomic mapping revealed that piriform layer IIb contains neocortical upper-layer-like corticocortical neurons, while piriform layer III segregates into layer V–like (IIIa), layer VI–like (IIIb), and VIb/VII (subplate)-equivalent populations, indicating a neocortex-like laminar framework with an inverted positioning of sensory recipients and corticocortical compartments relative to the neocortex. GABAergic neurons largely conformed to canonical MGE- and CGE-derived lineages but included a piriform-specific Rgs9+Pde7b+ subtype consistent with an LGE-related origin, suggesting region-specific diversification of GABAergic neurons. Disease ontology enrichment linked hippocampus-dominant glutamatergic programs to Alzheimer’s-related genes and piriform-dominant (and pan-cortical) excitatory and inhibitory programs to autism spectrum disorder and intellectual disability, implicating coordinated E/I circuit specializations in area-selective vulnerability. These findings support a revised view of the paleocortex as a divergent specialization of a conserved, multilayered cortical program and provide molecular markers and a comparative framework for studying cortical evolution and region-specific disease susceptibility.

Also flagged:cardiovascular diseasesatherosclerosisdeathdiabetic retinopathychronic kidney microvascular injurysystem disorders
Journal Article 2026-07-02 No Snippets Gholizadeh H, Benam KH.
Show Full Abstract

Vascular and cardiovascular diseases are leading causes of mortality globally. Despite significant progress in elucidating the molecular and cellular mechanisms involved in these conditions, some critical aspects, including complex intercellular interactions and therapeutic efficacy, require further investigation to be fully understood and predicted. This lack of knowledge motivates the development of advanced research methodologies, where bioengineering has contributed significantly. Technological advances in bioengineering have evolved into powerful tools that replicate the molecular and cellular microenvironment of human vascular and cardiac tissues with unprecedented fidelity in vitro and ex vivo. The evolution of conventional 2-dimensional, monocultured cell models into 3-dimensional and mechanically dynamic models that also possess tissue-level cellular and molecular sophistications enables studying vascular pathologies and therapies with promising predictability. Various techniques, such as microphysiological systems, organoids, and bioprinting, are increasingly used and further improved through numerous studies to reconstruct human vascular microenvironment and the associated diseases such as atherosclerosis and thrombosis in vitro. Despite these advancements, there are still challenges with each of these methods in addition to the knowledge gaps left for future research. This review takes a critical approach to comprehensively review existing reports and the most recent progress in the application of cutting-edge in vitro and ex vivo technologies for vascular biology and pathology. More importantly, it highlights the challenges and research gaps that will require future research to be addressed.

Also flagged:organizationCAP1CAP2lung diseaseembryoFerritin
Journal Article 2026-07-02 No Snippets Ceas A, Jimenez A, Liu Y, De Niz M, Vila Ellis L.
Show Full Abstract

Pulmonary vascular development requires coordinated growth, remodeling, and specialization of the endothelial network to support airway branching and alveolar formation. Recent advances in single-cell and spatial transcriptomics have revealed that endothelial cells are organized along a transcriptional arteriovenous spectrum while simultaneously adopting region-specific identities within the capillary bed. In particular, the emergence of distinct alveolar capillary populations, including capillary endothelial cell type 1 and capillary endothelial cell type 2 cells, highlights previously unappreciated heterogeneity. Parallel studies further demonstrate that macrovascular and microvascular identities are influenced by positional context, vessel caliber, and flow-associated transcriptional programs. Together, these insights redefine how endothelial specialization is established during lung development. Here, we review current understanding of pulmonary vascular morphogenesis, endothelial fate specification, and capillary diversification and discuss how emerging imaging platforms may help connect molecular identity with spatial organization and dynamic cellular behavior.

Also flagged:schizophreniagene expressiondendritic spinehallucinationsdelusionscognitive deficits
Journal Article 2026-07-02 No Snippets Morris BJ.
Show Full Abstract

Altered glutamatergic and dopaminergic transmission in regions including cortex and hippocampus is thought to contribute to schizophrenia symptoms. The prominent role of glutamate (particularly via NMDA receptors) and dopamine (particularly via D2 receptors) in synaptic plasticity, and the impairment of plasticity-associated cognitive function in the condition, has suggested that schizophrenia may be viewed as a disorder of synaptic plasticity. This is encouraging, as regards developing improved treatments, as plasticity by its nature is dynamic and malleable. However, there are many distinguishable forms of synaptic plasticity, and it is not immediately obvious whether all forms are affected, and throughout the brain, or whether specific forms of plasticity are compromised, and only in certain brain regions. Here, I describe the molecules mediating various forms of plasticity, and collate the electrophysiological, imaging, pathological, genetic and biochemical evidence to address their possible dysfunction in schizophrenia. The overall picture is consistent with suboptimal function of all forms of plasticity, in circuitry centred on prefrontal cortex and thalamus. Many of the neurobiological changes characteristic of schizophrenia (reduced metabolic activity, GABAergic interneuron gene expression and dendritic spine density, in circuitry centred on prefrontal cortex) can be viewed as consequences of compromised plasticity rather than fundamental aetiological factors. Of hundreds of genes potentially contributing to genetic risk, more than 60 are directly implicated in plasticity processes, comprising receptors, voltage-sensitive Ca<sup>2+</sup> channels, scaffold proteins, GTPases and kinase cascades. The conclusion is that multitudinous mechanisms of plasticity are all likely to be implicated in schizophrenia aetiology, but only in discrete neural circuits.

SERPINC1
Also flagged:extracellularvesiclesvesicleallograftExtracellular vesicleheart failure
Journal Article 2026-07-02 ✓ 5 Snippets Dai S, Zhou W, Chen F, Zhang H, Ji Z, Zong X, Zhang W, Hu J, Jiang S, Wang F, Shen Z.
In-Text Gene Mentions

…with antithrombin III (ATIII) emerging as a…

…silencing of hepaticATIIIdirectly accelerated allograft…

…Mechanistically,ATIIIoverexpression was associated…

…implicate the proteinATIIIas a contributor…

…hereby enhancing liver-derivedATIIIor its downstream…

Show Full Abstract

Extracellular vesicle-mediated interorgan communication represents a promising frontier in transplant immunology; however, its role in cardiac allograft rejection remains poorly characterized. We performed proteomic profiling of plasma-derived extracellular vesicles in a rat heterotopic heart transplantation model and identified a distinct liver-predominant protein signature during acute rejection, with antithrombin III (ATIII) emerging as a top candidate. Functional validation revealed that pharmacological extracellular vesicle inhibition intensified systemic and intragraft inflammation, whereas adeno-associated virus-mediated silencing of hepatic ATIII directly accelerated allograft rejection. Conversely, adeno-associated virus-mediated hepatocyte-specific ATIII overexpression attenuated rejection pathology, reduced immune cell recruitment, and markedly prolonged median graft survival. This protective effect was achieved without evidence of coagulopathic complications, indicating an immunomodulatory mechanism beyond ATIII's canonical anticoagulant function. Mechanistically, ATIII overexpression was associated with upregulation of heme oxygenase-1 (HO-1) in the liver and suppression of proinflammatory cytokine expression in the graft. These findings highlight hepatocyte-derived extracellular vesicles as important mediators of a liver-heart signaling axis in transplant rejection and further implicate the protein ATIII as a contributor to this axis. Our study reveals a therapeutically targetable liver-heart signaling axis in transplant rejection, whereby enhancing liver-derived ATIII or its downstream pathways (such as HO-1) could attenuate acute cardiac allograft rejection.

SOX6
Also flagged:organ homeostasisfibrotic diseasestissue homeostasisfibroblast activationcancerpancreatic ductal adenocarcinoma
Journal Article 2026-07-02 ✓ 3 Snippets Yip T, Stockis J, Simpson C, McCartney EE, Raghunathan S, Rangel-Sosa MM, Hummel SN, Moreno-Vicente J, Raddi G, Garcia C, Linkute R, Pinaud S, Cheng MF, Hill LA, Underhill TM, Rodewald HR, Schneider C, Jørgensen C, McKenzie ANJ, Acton SE, Seale P, Clatworthy MR, Buechler MB, Halim TYF.
In-Text Gene Mentions

…the transcription factorSox6, amongst other…

…Moreover,Sox6CAFs derived selectively…

…iCAF, myCAF andSox6+ CAFs (…

Show Full Abstract

Local fibroblast development and densities influence organ health and disease, although it remains unclear how tissue fibroblast topography is controlled in situ. Here, we defined Group 2 innate lymphoid cells (ILC2s) as key regulators of fibroblast homeostasis in the pancreas. ILC2s colocalized with fibroblasts expressing the genes <i>Pi16<sup>+</sup>Dpp4<sup>+</sup>Ly6c<sup>+</sup></i> in an interstitial niche of the exocrine pancreas, which encapsulates the organ parenchyma. ILC2s specifically regulated the expansion of <i>Pi16<sup>+</sup>Dpp4<sup>+</sup>Ly6c<sup>+</sup></i> fibroblasts, which have progenitor capacity, while restraining differentiated intraparenchymal <i>Col15a1<sup>+</sup></i> fibroblasts during inflammation. These circuits reinforced fibroblast numbers after injury and set an inflammatory threshold. The ILC2 and <i>Pi16<sup>+</sup>Dpp4<sup>+</sup>Ly6c<sup>+</sup></i> fibroblast progenitor niche expanded around tumors and controlled cancer-associated fibroblast ontogeny and density. Hence, ILC2-fibroblast dialogue represents a regulatory node that locally orchestrates tissue homeostasis and pathology.

Also flagged:translationalnucleosomesbindingnucleosomesubnucleosomechromatin
Journal Article 2026-07-02 No Snippets Chen H, Krebs JE, Lang OW, Hu J, Mellini DC, Hyle J, Li C, Lai WKM, Pugh BF.
Show Full Abstract

How transcription factors (TFs) and their binding sites organize and engage nucleosomes at natural genomic locations remains poorly understood. Here, we develop Benzonase-seq to measure the rotational phasing of nucleosomes in human cells and enhance chromatin immunoprecipitation (ChIP)-exo (v6) to measure rotational phasing on the same DNA molecule bound by a TF. Unbound CTCF sites were found to be rotationally accessible on nucleosomes, and this rotational accessibility is encoded by classical dinucleotide periodicities. CTCF binding results in nucleosome displacement to adjacent DNA phasing sequences. Upon examining 40 TF classes, unbound sites were found to be phased either inward or outward or to lack phasing. In all examined cases, TF binding (e.g., NFIA and FoxA) results in adjacent rotational and translational phasing, which is not dinucleotide encoded. Benzonase-seq also more robustly maps nucleosome and subnucleosome positions in hard-to-map CpG islands. These findings provide a clearer view of how TFs engage and position nucleosomes to shape the natural chromatin landscape.

PTGIS
Also flagged:lung fibrosismyofibroblast differentiationidiopathic pulmonary fibrosiscellular senescenceextracellularsecretion
Journal Article 2026-07-02 ✓ 1 Snippet Li X, Xu G, Wang Q, Ma Q, Liu X, Li H, Wang S, Liu Y, Jin Y, Miao X, He Z, Dong J, Li K, Wang J, Li Y, Zhang Q, Jiang D, Wu J, Ning W, Chen H.
In-Text Gene Mentions

…tosis-associated transcripts (Ptgis, Ano6 ,…

Show Full Abstract

Lung fibrosis progression is marked by impaired alveolar epithelial regeneration and uncontrolled myofibroblast differentiation, though the underlying mechanisms remain poorly understood. In this study, we discovered that Atg5 was upregulated in the mesenchymal cells of lungs from both patients with idiopathic pulmonary fibrosis (IPF) and mice with bleomycin (BLM)-induced fibrosis. Selective deletion of Atg5 in lung mesenchymal cells increased the susceptibility of mice to BLM-induced lung fibrosis. Mechanistically, the loss of Atg5 promoted transforming growth factor β 1 (TGF-β1)-induced oxidative stress and cellular senescence in fibroblasts, myofibroblast differentiation, and extracellular matrix deposition. Intriguingly, loss of Atg5 impaired the secretion of tissue repair-favoring factors in fibroblasts, causing defects in the proliferation and differentiation of alveolar type 2 cells. This study showed that Atg5 is essential for alveolar epithelial repair and myofibroblast control in lung fibrosis.

CACNA1E
Also flagged:epileptic encephalopathyepileptic encephalopathiesneurological disorders
Journal Article 2026-07-02 ✓ 2 Snippets Khousakoun D, Souza IA, Ferron L, Gandini MA, Zamponi GW.
In-Text Gene Mentions

…TheCACNA1Egene, which encodes…

…different variants inCACNA1Ehave been identified…

Show Full Abstract

Developmental and epileptic encephalopathies (DEEs) are a group of neurological disorders that primarily affect young children and are characterized by severe seizures. DEEs are challenging to manage, with some patients experiencing severe side effects or not responding to frontline therapies. The CACNA1E gene, which encodes the voltage-gated calcium channel Cav2.3 (R-type), has recently been associated with DEEs. More than fifteen different variants in CACNA1E have been identified in patients with DEEs; however, the mechanisms by which these variants affect channel function and, thus, their relationship to DEEs, remain largely unknown. Previous research has begun to characterize the functional effects of R-type channel variants on channel biophysics, but only a handful of them have been studied functionally to date. Here, we transiently expressed Cav2.3 channels in a tsA-201 cell expression system and used whole-cell patch-clamp to examine the biophysics of one specific disease-associated R-type channel variant in which leucine 228 is substituted with a proline (L228P). Compared to wild-type, the L228P mutant did not present altered peak current density, inactivation kinetics, or recovery from inactivation, but showed a significant shift towards hyperpolarized voltages in both voltage-dependent activation and steady-state inactivation. This resulted in a broader window current shifted towards more hyperpolarized potentials, which predicts increased channel availability and activity at subthreshold voltages relative to wild-type channels. Our results contribute to the ongoing characterization of R-type variants, with the long-term goal of informing mechanism-specific therapies for DEEs.

HTT
Also flagged:Huntington's DiseaseHDneurodegenerative disorder-nucleus
Journal Article 2026-07-02 ✓ 1 Snippet Li J, Zhou Q, Shi C, Lin Y, Han B, Gao J, Li J, Li C, Chen Y, Huang C, Wu J, Wang W, Song J, Zhang Y, He Q, Wang W, Tu Z, Li S, Li XJ, Ning B, Yan S.
In-Text Gene Mentions

…sequence in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by an abnormal expansion of the CAG trinucleotide repeat sequence in the HTT gene. Research on HD, a rare condition, relies heavily on donations of post-mortem brain tissue, which are extremely valuable yet difficult to obtain. While numerous studies have published single-nucleus RNA sequencing (snRNA-seq) data from the brain tissues of HD patients, such datasets remain scattered across various public repositories. A lack of standardized metadata and analytical workflows has hindered the integration and reutilization of these resources. To address this challenge, we constructed a curated, multi-brain-region, single-nucleus atlas of controls/HD patients by integrating 104 tissue samples from 39 HD patients and 34 controls, spanning six brain regions: the striatum (caudate and putamen), frontal cortex, cingulate cortex, nucleus accumbens, hippocampus, and cerebellum. This atlas comprises 330,892 cells that have been subjected to standardized quality control, batch effect correction and cell type annotation. Here, we present the first large-scale, multi-region single-nucleus reference atlas for HD, providing a comprehensive resource for the research community. It will serve as a critical data foundation for deepening the investigation of cell-type-specific molecular mechanisms underlying HD, facilitating cross-brain-region experimental validation, and enable the identification of novel therapeutic targets.

TRIM38
Also flagged:pathogenesisdiseases of thedegradationexperimental autoimmune encephalomyelitisischemic strokeneuroinflammatory diseases
Journal Article 2026-07-02 ✓ 1 Snippet Cao Z, Zhu Z, Zeng P, Mei F, Wang D, Xu J, Xu Y, Chen K, Wei C, Shen J, Jin K, Chen J, Li Z, Liu B, Schlüter D, Huang J, Wang X.
In-Text Gene Mentions

…contrary, TRIM30α andTRIM38induce the lysosome-dependent…

Show Full Abstract

Microglia contribute to detrimental neuroinflammation under pathological conditions and thereby drive the pathogenesis and development of various diseases of the central nervous system (CNS). Here, the deubiquitinating enzyme OTUB1 is identified as a regulator of microglial activation and CNS inflammation. In mice, microglia-specific OTUB1 deletion significantly ameliorates ischemic brain injury by reducing the pro-inflammatory activation of microglia. OTUB1 enhances Toll-like receptor (TLR) signaling through stabilizing UBC13 and TAB2, leading to the increased induction of cytokines. Notably, OTUB1 reduces the proteasomal degradation of TAB2 by reducing its K48 ubiquitination in a catalytic activity-independent manner. Moreover, microglia-confined OTUB1 deficiency also alleviates lipopolysaccharide-induced sickness behavior and experimental autoimmune encephalomyelitis in mice due to decreased neuroinflammation. Pharmacological inhibition of OTUB1 significantly mitigated ischemic stroke injury in mice. These findings reveal an important role of OTUB1 in potentiating microglial activation and neuroinflammation, providing a proof-of-principle observation for targeting OTUB1 in the treatment of TLR-associated neuroinflammatory diseases.

Also flagged:chronic disorderscancerneurological diseasescardiovascular disordersarthritisbinding
Journal Article 2026-07-02 No Snippets Dawood DH, Al-Hussain SA, Farghaly TA, Alsaedi AMR, Zaki MEA.
Show Full Abstract

Various acute and chronic disorders, such as cancer, neurological diseases, cardiovascular disorders, and arthritis, are linked to inflammation. However, the long-term utilization of the available anti-inflammatory medications is frequently restricted by side effects and inadequate selectivity, emphasizing the need for safer and more effective therapeutic agents. A thiazole scaffold emerged as a unique framework in medicinal chemistry owing to its prominent biological effectiveness and favorable pharmacokinetic characteristics. Recently, substantial interest has been gained by various thiazole-based derivatives as potential anti-inflammatory drugs. The thiazole-containing derivatives have exerted prominent anti-inflammatory effects <i>via</i> a variety of mechanisms, such as suppression of COX and LOX enzymes, inhibition of pro-inflammatory cytokines such as TNF-α and IL-6, as well as the impediment of the significant inflammatory signaling pathways. It has been demonstrated that the substitution patterns and hybridization of the thiazole scaffold with other bioactive pharmacophores led to the improvement of the anti-inflammatory effectiveness and selectivity. The current review highlights the thiazole-based anti-inflammatory derivatives as promising candidates, encompassing publications from 2020 to 2025 for the discovery of innovative anti-inflammatory therapies by focusing on varied synthetic routes, structure-activity relationships, and mechanistic insights, besides their binding modes within the active site of the target enzymes and cytokines.

Also flagged:bindingsynthesisdiabetes mellitusmetabolic syndromeabdominal obesityhypertension
Journal Article 2026-07-02 No Snippets Aziz H.
Show Full Abstract

Thiazole heterocycles, characterized by their unique combination of sulfur and nitrogen atoms, have emerged as versatile scaffolds in medicinal chemistry. The presence of heteroatoms provide multiple binding sites, enabling rapid investigation of structure activity relationships (SARs), aiding the development of potent, and targeted inhibitors. Thiazoles exhibit remarkable tolerance to diverse functionalities, and can be readily modified to fine-tune lipophilicity, polarity, and metabolic stability, making thiazoles as valuable frameworks for hit-to-lead optimization, and drug development with favorable pharmacokinetic profiles. In this context, the current review (2020-2025) highlights: biologically inspired thiazoles, and approved drugs, synthetic approaches like condensation, multicomponent reactions, microwave-assisted synthesis, and cycloaddition strategies, recent advances in anti-oxidant, and antidiabetic thiazole analogues, analysis of SARs, and molecular docking insights into protein-ligand interactions. Thus, biological screenings reveal thiazole hybrids often outperform simple thiazoles, with several analogues demonstrating superior anti-oxidant and antidiabetic potential to drugs in free radical scavenging and enzymes inhibition assays. SARs analysis confirm electron-donating and electron-withdrawing groups around thiazole ring significantly influence inhibitory potential of the screened analogues. Molecular docking further supports these findings, showing strong intermolecular interactions that underpin enhanced bioactivity. To conclude, thiazole scaffolds represent a promising frontier in rational drug design, and discovery. Thus, the present review article emphasizes continued exploration through optimized synthetic methodologies, hybrid development, and comprehensive biological evaluation to unlock their full therapeutic potential.

Also flagged:angiogenesiscancertumoursynthesiscell growthnucleus
Journal Article 2026-07-02 No Snippets Govindarajan M, Maji L, Mannathan S, Kumaradoss KM, Chowdhury A, Jois SD, Baskar B.
Show Full Abstract

Imidazoles, indoles, and pyrimidines are promising heterocyclic scaffolds for anticancer drug discovery. Based on the literature from 2020 to 2025, this review summarises that structurally diverse imidazoles, particularly ether-linked and long-chain variants, exhibit robust anticancer activity through multi-target protein inhibition and minimal off-target effects. Indoles trigger apoptosis and inhibit angiogenesis, while pyrimidines and their hybrids exhibit nanomolar potency and often outperform conventional chemotherapy. These scaffolds collectively modulate important pathways in cancer and exhibit enhanced selectivity toward tumour cells; however, clinical translation is challenging mainly due to incomplete mechanism of action and pharmacokinetics. Further rational optimisation and green synthesis methods may accelerate the development of these heterocycles into next-generation anticancer agents.

Also flagged:synthesisenzyme activitycell wallbinding
Journal Article 2026-07-02 No Snippets Jin P, Tu H, Wang N, Li F, Wei X, Chen Z.
Show Full Abstract

Immobilized penicillin G acylase (PGA) is a critical industrial biocatalyst for converting penicillin G into 6-aminopenicillanic acid (6-APA), a key intermediate in the synthesis of β-lactam antibiotics. Although various microorganisms can produce penicillin acylases, free PGA is highly susceptible to structural instability and environmental factors such as temperature and pH fluctuations, leading to a significant activity loss. Furthermore, the separation of free enzymes from reaction systems remains technically challenging, increasing operational complexity and cost. To overcome these limitations, immobilization strategies have been extensively explored. Immobilized PGA exhibits superior stability, reusability, and operational robustness, which are highly desirable for industrial applications. These advantages also lead to improved product purity, reduced contamination risks, and economic benefits. However, immobilization does not necessarily improve intrinsic catalytic efficiency, instead, it often involves a trade-off between catalytic activity and stability due to conformational constraints and mass transfer limitations. Although improved catalytic performance is sometimes reported, such enhancement generally reflects apparent activity rather than intrinsic catalytic efficiency. This review systematically summarizes the origins, classification, structure, and catalytic mechanisms of PGA. It also critically evaluates recent progress in immobilization methods, carrier materials, reaction media, enzyme activity regeneration, and reactor design, providing insights into future challenges and opportunities in this field.

Also flagged:chewingcariesmineralization
Journal Article 2026-07-02 No Snippets Reyes-Gasga J, Moreno-Rios M, Rodríguez-Gómez A, Bres E.
Show Full Abstract

We examine the image contrasts presented at micrometric and nanometric scales of the scanning electron microscope (SEM), transmission electron microscope (TEM), scanning transmission electron microscope (STEM), and atomic force microscope (AFM) in the tapping mode, looking for the observation of the central feature known as "the central dark line" (CDL) in the structure of human tooth enamel crystals. Since our interest is in inorganic material, mainly at the nanometric scale, the enamel samples for SEM and AFM were polished following a metallographic procedure, using progressively finer silicon carbide papers and etching with orthophosphoric acid. For TEM and STEM, the samples were produced by the focused ion beam (FIB) technique. The CDL images were well recorded using TEM and STEM, but not in SEM and AFM images. SEM images revealed the size and morphology of the enamel crystals, while AFM images revealed spherical and band-like structures. The observation of the CDL using TEM and STEM suggests that it may represent a potential chemical compositional site.

ECI2
Also flagged:metabolismautophagymitophagydetoxificationbile secretionenergy homeostasis
Journal Article 2026-07-02 ✓ 2 Snippets Xu B, Wang H, Shu X, Liu L, Wang Y, Li Y, Niu Z, Chen Z, Zheng X, Chen J.
In-Text Gene Mentions

…CREB3L3, RBM3, EEF1D,ECI2and PCK2 .…

…LDHB, CPT1A, HADHB,ECI2, MSMO1 ), xenobiotic…

Show Full Abstract

Feeding governs energy acquisition and drives state-specific hepatic metabolism. As the central metabolic and homeostatic organ in poultry, hepatic molecular mechanisms driving metabolic shifts pre- and post-feeding remain uncharacterized. We performed Oxford Nanopore full-length transcriptome sequencing on liver tissue from 6-week-old broilers under three energy states: ad libitum feeding (AL), fasting (F), and refeeding after fasting (RF). A total of 34,271 genes, 79,282 transcripts (including 6,605 annotated novel transcripts), 287 fusion transcripts, 74,892 simple sequence repeats, and 2,327 long non-coding RNAs (lncRNAs) were identified. Alternative polyadenylation (APA) analysis showed that AL and RF groups preferentially used proximal APA sites relative to the F group. Functional enrichment highlighted lipid and carbohydrate metabolism, autophagy, and mitophagy pathways. Differentially expressed transcripts (DETs) showed more differential events than differentially expressed genes (DEGs), and functional enrichment of DEGs, DETs, and differentially expressed lncRNAs in F vs AL and F vs RF comparisons mainly highlighted lipid, protein, carbohydrate, and xenobiotic metabolism pathways. Notably, enrichment analysis of APA, DEGs, and DETs between AL and RF identified the NOD-like receptor signaling pathway, a core innate immune signaling cascade, as one of the top altered pathways. Consistently, both F and RF groups displayed reduced expression of antimicrobial peptide genes (AvBD1, AvBD6, AvBD7, CATH2, CATH3) relative to the AL group, implying that short-term fasting may transiently suppress hepatic immune defense capacity. This study identifies numerous novel hepatic transcripts and demonstrates that, under distinct energy states, the liver maintains energy homeostasis via transcript-level expression shifts and APA site selection. These findings provide molecular insights into the metabolic responses and hepatic immune to fasting stress, laying a foundation for optimizing feeding regimens and improving liver health in broiler production.

CSE1L
Also flagged:autism spectrum disorderneurodevelopmental disordercircadian rhythmgene expressionCircadian rhythmsnucleus
Journal Article 2026-07-02 ✓ 1 Snippet Ziaei A, Shirvani-Farsani Z, Ghafouri-Fard S.
In-Text Gene Mentions

… nucleocytoplasmic transport (CSE1L, KPNB1 and TNPO1)…

Show Full Abstract

Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder. It is marked by difficulties in social communication and the presence of repetitive behaviors. Research has found that disruptions in the body's circadian rhythm and dopamine signaling pathways can contribute to the development of this disorder. Long non-coding RNAs (lncRNAs) are important for regulating gene expression. They have been identified as potential risk genes and diagnostic markers for ASD. This observational (case-control) study aimed to investigate and compare the expression levels of three lncRNAs related to circadian rhythm, <i>NRON</i>, <i>HULC</i>, and LINC01138, and two lncRNAs linked to dopamine signaling, <i>MIAT</i> and <i>TRAF3IP2-AS1</i>, in the peripheral blood of 30 patients with ASD and 41 healthy controls using Real-time PCR. The results showed a significant increase in <i>NRON</i> lncRNA expression in patients with ASD compared to healthy controls (P = 0.0048**). However, the expression level of <i>HULC</i>, LINC01138, <i>MIAT</i>, and <i>TRAF3IP2-AS1</i> did not show any significant difference between these two groups (P > 0.05). Additionally, when analyzing by sex, affected males had significantly higher <i>NRON</i> expression than control males (P = 0.002**). There was also a significant correlation between the expression of <i>MIAT</i> and <i>TRAF3IP2-AS1</i> and the age of ASD patients. Moreover, ROC curve analysis suggested that <i>NRON</i> could serve as a diagnostic marker for ASD (AUC = 0.70 and P = 0.004). Overall, these findings indicate that dysregulation of <i>NRON</i> in peripheral blood is associated with ASD. While the functional relevance of this peripheral signature to CNS pathophysiology remains to be established, <i>NRON</i> may serve as a candidate for future peripheral biomarker discovery attempts.

HFE
Also flagged:Liver FibrosisAutoimmune Hepatitiscirrhosisliver diseaseliver failureinflammatory liver disease
Journal Article 2026-07-02 ✓ 1 Snippet Ashimova N, Raissova A, Yenin E, Khozhamkul R, Zholdybay Z, Shamshidinova M, Usenova T, Teufel A, Mustapayeva A, Nersesov A.
In-Text Gene Mentions

…injury, Wilson’s disease,hemochromatosis, or hepatocellular carcinoma,…

Show Full Abstract

<b>Background/Objectives</b>: Autoimmune hepatitis (AIH) is a chronic immune-mediated liver disease that may progress to cirrhosis and liver failure if not diagnosed early. Although liver biopsy remains the reference standard for fibrosis assessment, its invasive nature limits routine use. This study aimed to compare the diagnostic performance of ultrasound-based microvascular imaging (MVI), transient elastography (TE), and serum fibrosis indices (APRI and FIB-4) in patients with biopsy-confirmed AIH. <b>Methods:</b> Fifty-five patients with probable or definite AIH according to IAIHG criteria were included in the study. All patients underwent liver biopsy, and fibrosis stage was assessed using the METAVIR system. TE and MVI examinations were performed, and APRI and FIB-4 scores were calculated. Diagnostic performance was evaluated using AUROC, sensitivity, and specificity. Spearman correlation and logistic regression analyses were additionally performed. <b>Results</b>: The mean age of the patients was 49.2 years, and most patients were women. Cirrhosis was present in 58.2% of the cohort. TE demonstrated high diagnostic accuracy, whereas FIB-4 showed moderate performance and APRI demonstrated limited utility. MVI achieved the highest diagnostic performance, with AUROC values of 0.99 for significant fibrosis and 0.97 for cirrhosis. MVI showed the strongest correlation with histological fibrosis stage (r = 0.916, <i>p</i> < 0.001), followed by TE (r = 0.907, <i>p</i> < 0.001). MVI was strongly associated with histologically confirmed cirrhosis (OR 16.7, 95% CI 2.36-118.2, <i>p</i> = 0.004). <b>Conclusions</b>: MVI demonstrates diagnostic performance comparable to TE and may represent a promising adjunctive non-invasive imaging biomarker for fibrosis assessment in AIH. Larger multicenter studies are required for external validation before routine clinical implementation.

Also flagged:Synthesiscancercytoskeletonsmetabolismbreast cancerdeath
Journal Article 2026-07-02 No Snippets Prodea A, Mioc M, Munteanu A, Mioc A, Paşcalău NA, Mara BI, Atyim E, Balan-Porcarasu M, Racoviceanu R, Șoica C.
Show Full Abstract

The current study describes the synthesis and preliminary anticancer assessment of a novel series of C3/C28-bis-1,2,4-triazolyl-sulfanylacetate-betulin (AP1-5) derivatives to identify potent agents for clinical development. The cytotoxicity of AP1-5 was evaluated using the Alamar blue assay against MCF-7, A375, PANC-1 (cancer cells) and HaCat (human keratinocytes) cells. Moreover, the molecular mechanisms responsible for cytotoxicity were investigated through in vitro (DCFDA/H<sub>2</sub>DCDFA assay, caspase-3/7 assay, and morphological analysis) and in silico assays (network pharmacology, molecular docking, molecular dynamics simulation, and ADMET predictions). The result highlighted AP5, containing unsubstituted 1,2,4-triazoles, as the lead derivative of the series with increased potency against MCF-7, with an IC<sub>50</sub> value of 7.41 μM compared to its phenyl-substituted analogs (AP1-4). The derivatives induced apoptosis, marked by fragmented nuclei, round cells, disorganized cytoskeletons, and activation of caspases-3/-7 through a ROS-decreasing mechanism. The network pharmacology assessment predicted AP5 may interact with key proteins in the PI3K/Akt pathway, such as MAP2K1, MDM2, IGF1, JAK2, IL2 and FGFR1, as well as ESR1, PGR and MMP2. Molecular docking suggested MMP-2 is the most favorable target for AP5 among the validated proteins, while molecular dynamics simulations supported the predicted AP5-MMP-2 interaction. Moreover, the ADMET profiling of AP5 showed acceptable intestinal absorption, non-glycoprotein-P substrate status, and reduced hepatic metabolism compared to betulin. However, the ADMET analysis also highlighted some potential toxicity risks such as DILI, genotoxicity, carcinogenicity and skin sensitization that need to be further investigated. Altogether, these promising findings support the further exploration of AP5 as a promising drug candidate for breast cancer in vivo to assess its potency and toxicity.

OLFM4
Also flagged:cell cyclecancerinfectious diseasesinfectionscell growthimmune responses
Journal Article 2026-07-02 ✓ 2 Snippets Molinari A, Moccia V, Babbucci M, Peruzza L, Negrisolo E, Centelleghe C, Mazzariol S, Zappulli VEG.
In-Text Gene Mentions

…, CNTNAP2 ,OLFM4, THBS4 ,…

…, FRMPD4 ,OLFM4, SEMA6A ,…

Show Full Abstract

Bats are important reservoirs of zoonotic pathogens and valuable models for studying antiviral tolerance and neuroinflammation within a <i>One Health</i> framework. However, chiropteran neural 2D-<i>in vitro</i> models remain limited. Here, we established and characterized the first chiropteran primary (CpBCs) and immortalized (CiBCs) cell lines from <i>Hypsugo savii</i> species. To overcome the limited lifespan of CpBCs, immortalization strategies based on human telomerase reverse transcriptase (hTERT) and Simian virus 40 large T antigen (SV40) were evaluated. Electroporation-mediated transfection with SV40 successfully generated CiBCs, whereas liposome-mediated and hTERT-based approaches were unsuccessful. RNA sequencing revealed marked transcriptional changes comparing CiBCs with CpCBs, such as the upregulation of pathways related to cell cycle progression, DNA replication, and proliferation in CiBCs, together with the downregulation of apoptosis, inflammatory signaling, and immune-related pathways. Immortalized cells also exhibited enrichment of neural stem cell-like and cancer-associated signatures, suggesting partial dedifferentiation induced by SV40-mediated immortalization. Overall, this study provides a novel chiropteran brain-derived 2D-<i>in vitro</i> platform for investigating bat neurobiology, host-pathogen interactions, viral tolerance, and neurotropic infectious diseases relevant to emerging zoonoses.

PCDH17
Also flagged:Idiopathic Normal Pressure Hydrocephalusneurological disordercognitive impairmenturinary incontinenceneurodegenerative diseasesaxonal
Journal Article 2026-07-02 ✓ 1 Snippet Kwiecień A, Dudzic M, Lemański A, Kalka JM, Drużdż A, Hojan K, Palandri G, Sokół B.
In-Text Gene Mentions

…CELSR2, PCDH7, PCDH9,PCDH17, CDH2, CDH6, and…

Show Full Abstract

Idiopathic normal pressure hydrocephalus (iNPH) is a potentially reversible neurological disorder characterized by gait disturbance, cognitive impairment, and urinary incontinence; however, its diagnosis and prediction of shunt responsiveness remain challenging. This systematic review aimed to synthesize current evidence on cerebrospinal fluid (CSF) proteomic biomarkers in iNPH and to identify molecular patterns with diagnostic and prognostic relevance. A PRISMA-guided search of PubMed, Web of Science, and Google Scholar identified 14 eligible studies comprising 1171 iNPH patients. Proteomic analyses revealed substantial heterogeneity in study design and detected proteins; however, consistent patterns emerged. iNPH is associated with upregulation of inflammatory and extracellular matrix-related proteins and relative downregulation of synaptic and neuronal markers. Neurodegenerative proteins, including amyloid-β, tau, and neurofilament light chain, demonstrated value in differentiating iNPH from comorbid neurodegenerative diseases and in predicting response to ventriculoperitoneal shunting (VPS). These findings support a multifactorial model of iNPH involving impaired glymphatic clearance, neuroinflammation, blood-brain barrier dysfunction, and mechanical axonal stress. Multidimensional biomarker profiles, rather than single proteins, appear to provide the greatest clinical utility, highlighting the need for standardized proteomic panels and integrative predictive models. However, given the substantial heterogeneity of the included studies and the predominantly exploratory nature of current proteomic evidence, the identified proteins should be interpreted as candidate biomarkers rather than clinically validated diagnostic or prognostic tools. Multidimensional biomarker profiles appear biologically plausible and may offer greater explanatory value than single proteins, but their clinical utility requires validation in standardized prospective cohorts. The authors therefore propose a conceptual iNPH proteomic "Vulnerability Model" integrating CSF biomarkers to reflect the balance between reversible and irreversible pathology; this is currently a hypothetical model that requires rigorous statistical and clinical validation through large-scale prospective cohort studies before it can fulfill its potential for improving patient stratification and prediction of postoperative outcomes.

Also flagged:tumorCervical cancercancerosteoporosisbone injuryreflex
Journal Article 2026-07-02 No Snippets Liu H, Cheng C, Zhang J, Wu M, Hu Y, He L, Li Z, Wang J.
Show Full Abstract

<h4>Purpose</h4>Dual-energy computed tomography (DECT) has been applied to tumor radiotherapy planning but has rarely been used in post-treatment toxicity assessment. This study assesses the feasibility of using DECT to detect early pelvic radiation-induced bone injury (pRIBI).<h4>Methods</h4>Thirty mature female New Zealand White rabbits were allocated at random into five distinct cohorts: one non-irradiated control group and four experimental groups subjected to a single 30-Gy radiation exposure, with euthanasia performed at 1, 2, 3, or 4 weeks following irradiation. All rabbits underwent DECT before and after radiotherapy and contents of calcium (Ca), hydroxyapatite (HAP) and fat at the seventh lumbar vertebra (L7) and femoral neck (FN) were measured. Postmortem quantitative analysis utilized hematoxylin and eosin (HE)-stained with adipocyte-area-ratio (%) to measure fat content, while Ca content was measured via muffle furnace. Statistical evaluation was conducted via one-way analysis of variance (ANOVA) accompanied by <i>post-hoc</i> comparisons, alongside Pearson correlation assessments. The DECT-derived Ca concentration was validated using a phantom study.<h4>Results</h4>Phantom validation confirmed high DECT Ca quantification accuracy (<i>R</i> <sup>2</sup> = 0.995). DECT revealed progressive demineralization at L7 and FN, with significant reductions in Ca and HAP (<i>P</i> < 0.05) following a triphasic trajectory: initial slow decline (weeks 0-1), accelerated loss (weeks 1-3), and late attenuation (weeks 3-4). Muffle furnace Ca measurements strongly correlated with DECT values (<i>r</i> <sup>2</sup> = 0.949, <i>P</i> < 0.05). Fat peaked at week 1 (<i>P</i> < 0.05) and progressively declined thereafter, aligning with histopathology.<h4>Conclusion</h4>DECT enables non-invasive detection of early pRIBI, characterized by Ca and HAP loss, and dynamic fat remodeling. These findings underscore its potential for unveiling early pRIBI.

Also flagged:methylationallergic asthmacell adhesionneuronal growthinflammatory responsesairway allergy
Journal Article 2026-07-02 No Snippets Llinás-Caballero K, Acevedo N, Merid SK, Donado K, Espinoza H, Mondol E, Reina R, Regino R, Benedetti I, Zakzuk J, Puerta L, Melén E, Caraballo L.
Show Full Abstract

<h4>Background</h4>House dust mite (HDM) <i>Blomia tropicalis</i> is a major global inducer of allergic asthma, yet its epigenetic impact on airway tissues remains poorly understood. The aim of this study was to perform an exploratory, hypothesis-generating screening of the DNA methylation changes that occur in lung tissue of mice with robust allergic inflammation compared to saline-exposed controls.<h4>Methods</h4>We sensitized and challenged BALB/c mice with <i>B. tropicalis</i> extract or purified allergens Blo t 2 and Blo t 13 or saline solution in a model of acute allergic airway inflammation, then assessed lung DNA methylation across over 285.000 CpG sites using the Infinium Mouse Methylation BeadChip (Illumina) (n = 6 mice per group, 24 lung samples).<h4>Results</h4>Allergen-exposed mice exhibit distinct lung DNA methylation profiles compared to controls following exposure to Blo t 2, Blo t 13, or <i>B. tropicalis</i> extract. Analysis of differentially methylated regions (DMRs) revealed 137, 179 and 313 DMRs in mice exposed to Blo t 2, Blo t 13, or <i>B. tropicalis</i> extract, respectively. Genes in key differentially methylated regions included protocadherin alpha genes (<i>Pcdha1 to Pcdha6</i>), cadherin 8 (<i>Cdh8</i>) and interleukin 11 receptor alpha (<i>Il11ra</i>). Genes in DMRs were enriched in several biological processes including homophilic cell adhesion via plasma membrane adhesion molecules and nervous system development. Notably, there was also found significant differences in mRNA levels of neuronal growth genes such as (<i>Gdf7</i>), N-acetylated alpha-linked acidic dipeptidase 2 (<i>Naalad2</i>), prune homolog 2 with BCH domain (<i>Prune2</i>), cerebellin 1 precursor (<i>Cbln1</i>) and, in the proapoptotic gene <i>Bcl2l11.</i><h4>Conclusion</h4>Exposure to <i>B. tropicalis</i> allergens is associated with lung DNA methylation changes in genes implicated in allergic asthma and inflammatory responses, offering novel epigenetic insights and key targets of house dust mite-induced airway allergy. This exposure may involve a joint neuro-immune epigenetic reprogramming in the lung, altering the methylation of cell-adhesion and local neural signaling genes, alongside key lipid inflammatory drivers. Our results support the hypothesis that <i>Blomia tropicalis</i> exposure disrupts the airway epithelial barrier and sensitizes the local pulmonary neuroendocrine network, strongly predisposing the tissue to hyperreactivity and allergic inflammation.

PTGIS
Also flagged:secretionimmune responsesdegenerative diseasescell differentiationmineralizationacute monocytic leukemia
Journal Article 2026-07-02 ✓ 1 Snippet da Costa VR, Souza OF, Ramires Teixeira M, Alievi AL, de Oliveira MM, Orikaza CM, Popi AF, Kerkis I, Araldi RP.
In-Text Gene Mentions

…( CACNB2 andPTGIS) were exclusively…

Show Full Abstract

<h4>Background</h4>Human dental pulp stem cells (hDPSCs) are a mesenchymal stromal cell (MSC)-like population with emerging therapeutic relevance, yet their immunomodulatory behavior remains incompletely defined.<h4>Methods</h4>Here we examine how hDPSCs from three independent human donors modulate macrophages differentiated from the THP-1 and U-937 monocytic cell lines. Using co-culture systems, we assess cytokine secretion profiles and macrophage surface marker expression by multiplex immunoassays and flow cytometry.<h4>Results</h4>Co-culture revealed donor- and lineage-specific modulation of key cytokines, including TNF-α, IL-10, IL-6, IL-1β, CXCL10, and IL-1RA, while surface marker analysis indicated minimal macrophage polarization. Notably, hDPSCs exhibited transcriptional changes in inflammation-related genes upon interaction with macrophages.<h4>Conclusions</h4>Together, these findings reveal that hDPSC immunomodulatory activity is highly context-dependent and donor-specific, highlighting the importance of donor-aware functional assays for potency assessment and standardization of human cell-based therapies.

HFE
Also flagged:endocrinopathiesβ-thalassemiaanemiasanemiaIronhypothyroidism
Journal Article 2026-07-02 ✓ 1 Snippet Almahmoud R, Hussein A, Al Khaja F, Soliman AF, Dewedar H, Mathai S.
In-Text Gene Mentions

…severe anemia andhemochromatosisfrom frequent blood…

Show Full Abstract

<h4>Introduction</h4>β-thalassemia major (BTM) is made up of group of quantitative anemias characterized by severe anemia and hemochromatosis from frequent blood transfusion. Iron overload in the endocrine system (pituitary gland, thyroid and parathyroid glands, pancreas, and gonads) resulting in different endocrinopathies is a major challenge among BTM patients especially among adults. This study aims at describing different endocrinopathies; namely short stature, hypothyroidism and diabetes mellitus among adults treated at Dubai Thalassemia Center in United Arab Emirates.<h4>Materials and methods</h4>This study is observational retrospective cohort in nature, of all adult patients with BTM aged above 18 years who attended the Dubai Thalassemia Centre during the period of November 2019 and May 2021, were extracted from patients' electronic medical records.<h4>Results</h4>A total of 200 adults with BTM above 18 years of age were enrolled in this study. Females constituted 54.5% (n=109) of the sample while 45.5% (n=91) were males. The annual average pre-transfusion hemoglobin level was 9 gm/dL in 81.5%, n=163, while it was low (<9 gm/dL) in 18.0% (n=36) patients. The mean height of all male patients was 165.4 cm (SD = 6.05) and for females it was 154.11 cm (SD = 5.67), while the mean weights of all male and female patients were 60.4 kg (SD + 12.74) and 55.8 kg (SD = 14.60), respectively. Of all female patients, the mean age of menarche was 15 years. The prevalence of Hypogonadism is 23%, Diabetes Mellitus 15%, Hypothyroidism 11%, Hypoparathyroidism 9% and Short Stature 1.5%.<h4>Conclusion</h4>Despite the improved care and introduction of oral chelators, the prevalence of endocrinopathies namely hypogonadism, short stature, hypothyroidism, hypoparathyroidism and diabetes mellitus still pose a major concern for patients with BTM. More emphasis needs to be placed on improving compliance with chelation, and further studies are required to investigate new therapies options to reduce these complications.

Also flagged:Skeletal muscle dysfunctionchronic obstructive pulmonary diseaseCOPDmyopathymitochondrialproteasome
Journal Article 2026-07-02 No Snippets Gao Q, Mao Y, Xie S, Wang W, Xia J, Wu W.
Show Full Abstract

Skeletal muscle dysfunction (SMD) is a critical extrapulmonary comorbidity in chronic obstructive pulmonary disease (COPD), contributing to exercise intolerance, poor quality of life, and increased mortality. Building upon and extending the disuse model, this review synthesizes evidence establishing COPD-induced SMD as a distinct myopathy with intrinsic disease drivers. Its pathophysiology is driven by a self-reinforcing network: mitochondrial energetic crisis featuring bioenergetic failure and dysregulated dynamics, chronic oxidative stress and inflammation fueling catabolic drive via ubiquitin-proteasome system activation, and epigenetic dysregulation through alterations in key histone deacetylases (HDACs) and microRNA expression, which collectively orchestrate a pro-atrophic phenotype. We further explore how these molecular insights are translating into novel diagnostic tools, including circulating biomarkers like myomiRs and C-terminal agrin fragment, and imaging techniques such as shear wave elastography. Although exercise training remains the cornerstone of management, its limited efficacy underscores the need for adjunctive and targeted therapies. We discuss promising strategies from pharmacological and nutritional support to emerging agents targeting specific pathways, including the IL-36 receptor, lipoprotein-associated phospholipase A2, aryl hydrocarbon receptor, and mitsugumin 53. Effective management of COPD-related SMD will hinge on a precision medicine framework, leveraging biomarker-guided stratification to deploy personalized combinatorial interventions aimed at preserving muscle mass and function.

Also flagged:membranemembrane-bindingconjugationAcutepneumonia
Journal Article 2026-07-02 No Snippets Jin Y, Qu L, Gao X, Qi X, Zhao D, Ga L, Zhao Y, Liang G, Xiao Y, Ma Y.
Show Full Abstract

<b>Objectives:</b> The ongoing evolution of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and the current treatment limitations-particularly the emergence of drug resistance and the reduced efficacy of some existing drugs against new variants-highlight the need for novel antiviral strategies with novel action mechanisms. Fusion inhibitors that disrupt six-helix bundle (6-HB) formation during viral entry represent a promising approach. Posaconazole, an antifungal agent, has been identified as a weak fusion inhibitor, but suffers from poor membrane permeability and modest activity. This study aimed to enhance its antiviral potency by conjugating it with cell-penetrating polyarginine peptides and to investigate the mechanism of action. <b>Methods:</b> A series of posaconazole-polyarginine conjugates were synthesized via click chemistry. Antiviral activity was evaluated using pseudotyped SARS-CoV-2 Omicron XDV in HEK293T cells. Mechanisms were investigated by circular dichroism, native PAGE, size-exclusion HPLC, molecular docking, and isothermal titration calorimetry. Metabolic stability was assessed using hepatic microsomes. <b>Results:</b> Posa-R8 exhibited potent antiviral activity comparable to the clinical candidate EK1, with minimal cytotoxicity. Mechanistic studies confirmed that Posa-R8 binds the HR2 region of the spike protein, disrupts 6-HB formation, and inhibits membrane fusion. It also showed strong lipid bilayer affinity and improved phase I metabolic stability over EK1. <b>Conclusions:</b> Polyarginine conjugation enhances the membrane-binding affinity and antiviral efficacy of posaconazole. Posa-R8 represents a promising lead for developing next-generation SARS-CoV-2 fusion inhibitors.

Also flagged:cognitioncortical atrophybrain atrophyPDgene expressionatrophy
Journal Article 2026-07-01 No Snippets Vo A, Tremblay C, Rahayel S, Al-Bachari S, Berendse HW, Bright JK, Cendes F, d'Angremont E, Dalrymple-Alford JC, Debove I, Dirkx MF, Druzgal J, Garraux G, Helmich RC, Hu MT, Jahanshad N, Johansson ME, Klein JC, Laansma MA, McMillan CT, Melzer TR, Misic B, Mosley P, Owens-Walton C, Parkes LM, Pellicano C, Piras F, Poston KL, Rango M, Rummel C, Schwingenschuh P, Suette M, Thompson PM, Tosun D, Tsai CC, van Balkom TD, van den Heuvel OA, van der Werf YD, van Heese EM, Vriend C, Wang JJ, Wiest R, Yasuda CL, Dagher A.
Show Full Abstract

Parkinson's disease is associated with extensive structural brain changes. Recent work has proposed that the spatial pattern of disease pathology is shaped by both network spread and local vulnerability. However, few studies have assessed these biological frameworks in large patient samples across disease stages. Analysing the largest imaging cohort in Parkinson's disease to date (n = 3096 patients), we investigated the roles of network architecture and local brain features by relating regional abnormality maps to normative profiles of connectivity, intrinsic networks, cytoarchitectonics, neurotransmitter receptor densities and gene expression. We found widespread cortical and subcortical atrophy in Parkinson's disease to be associated with advancing disease stage, longer time since diagnosis and poorer global cognition. Structural brain connectivity best explained cortical atrophy patterns in Parkinson's disease and across disease stages. These patterns were robust among individual patients. The precuneus, lateral temporal cortex and amygdala were identified as likely network-based epicentres, with high convergence across disease stages. Individual epicentres varied significantly among patients, yet they consistently localized to the default mode and limbic networks. Furthermore, we showed that regional overexpression of genes implicated in synaptic structure and signalling conferred increased susceptibility to brain atrophy in Parkinson's disease. In summary, this study demonstrates in a well-powered sample that structural brain abnormalities in Parkinson's disease across disease stages and within individual patients are influenced by both network spread and local vulnerability.

HFE
Also flagged:osteogenesis imperfectaType III OI
Journal Article 2026-07-01 ✓ 1 Snippet Mulcrone JE, Seide K, Chacko J, Carter EM, Pleshko N, Derocher CE, Raggio CL.
In-Text Gene Mentions

…is a heterogeneoustype 1 collagenopathy1 collagenopathy characterized…

Show Full Abstract

Osteogenesis imperfecta (OI) is a heterogeneous type 1 collagenopathy characterized by recurrent fractures, decreased bone mass, and short stature. Bisphosphonates reduce fracture incidence in children with OI, but do not improve growth velocity. C-type natriuretic peptide (CNP) is produced in the growth plate (also in the brain and heart), and it positively regulates linear bone growth; people with OI have been shown to have reduced serum levels of CNP. This pilot study evaluated whether a CNP analog combined with alendronate (ALN) improves growth and BMD in oim/oim (OIM) mice, a model of moderate-to-severe Type III OI. Two-wk-old OIM and WT mice received weekly ALN and 1 of 3 CNP regimens: 10 μg/kg 3 d/wk (low), 20 μg/kg 3 d/wk (medium), or 20 μg/kg 5 d/wk (high). Controls received saline. Faxitron images were taken at 2, 8, and 14 wk (sacrifice) to assess fracture incidence and measure femoral length and vertebral height. MicroCT was used to assess bone microstructural parameters of the femur ex vivo. The high-dose group had no fractures post-sacrifice, while 1 fracture each was observed in the low and medium dose groups. Femoral length increased in all treated groups, with the high dose-group showing the greatest increase (8.2% and significant) in OIM mice. Vertebral height increased in all treated groups; low and high dose groups had greater and comparable increases than the medium group in OIM mice. All treated groups showed increased trabecular BMD. Cortical tissue mineral density, BMD, and thickness were also elevated in all treated groups compared to the controls. In conclusion, CNP analog adjuvant treatment enhanced linear growth and bone quality without compromising fracture reduction, providing benefits not seen with bisphosphonates alone. These results will inform optimal dosing for future studies. A full murine study is planned to further evaluate the therapeutic potential for translation to humans.

Also flagged:rpoBDCC1waterpulmonary diseasebronchiectasisinfection
Journal Article 2026-07-01 No Snippets Honda JR, Wilsey RN, Raulerson CK, Ding LH, Castaneda CL, Joyner JL.
Show Full Abstract

It's difficult to prove exactly when and how people with bronchiectasis acquire nontuberculous mycobacteria (NTM) from the environment. We present data showing long-term household exposures of a homeowner and development of NTM pulmonary disease following the onset of bronchiectasis and correlating disease onset with longitudinal environmental sampling in an NTM geographic hotspot.

Also flagged:Gliomasdehydrogenase deficiencyhypermethylationhydratase deficiency syndromephosphorylationfamilial tumor syndromes
Journal Article 2026-07-01 No Snippets Gray MT, Cayrol R, May A, Skaugen JM, Hayek F, Lapointe S, Hawkins CE, Pearce TM, Pratt D, Wiredja D, Toland A, Marker DF.
Show Full Abstract

Oncometabolite production plays a key role in the development and progression of isocitrate dehydrogenase-mutant gliomas. The aberrant gain-of-function activity of the mutant isocitrate dehydrogenase protein results in the production of the oncometabolite D-2-hydroxyglutarate, which in turn promotes DNA hypermethylation and gliomagenesis through several mechanisms. Rare gliomas in patients with fumarate hydratase deficiency syndrome share many morphologic and molecular features with isocitrate dehydrogenase-mutant gliomas, with the oncometabolites succinate and 2-succinocysteine similarly thought to promote global DNA hypermethylation. Like isocitrate dehydrogenase and fumarate hydratase, succinate dehydrogenase is also a member of the citric acid cycle that additionally participates in oxidative phosphorylation. While succinate dehydrogenase deficiency has been implicated in familial tumor syndromes, it has not yet been associated with glial neoplasms. Here we report 3 cases of diffuse glioma with succinate dehydrogenase deficiency that show many similarities with isocitrate dehydrogenase-mutant gliomas. We propose that succinate dehydrogenase deficiency with accumulation of the oncometabolite succinate can promote gliomagenesis in a similar manner as seen in isocitrate dehydrogenase-mutant and fumarate hydratase-deficient gliomas, and we discuss the proposed mechanisms that may lead to tumor formation.

Also flagged:central nervous system disordersCNS diseasesHuntington's diseaseAlzheimer's disease
Journal Article 2026-07-01 No Snippets Hupalo D, McCauley JL, Gomez L, Griswold AJ, Hoher G, Konidari I, Lorenzo J, Parker GS, Pascual J, Sandford AR, Whitehead PL, Davis DA, Garamszegi S, Gultekin SH, Sun X, Vontell RT, Chatigny M, Chernicky D, Constant MM, Darling IG, Ennulat DJ, Esposito JM, Morris K, Lawton ES, Morakabati NR, Oduor P, Rodgers AP, Sang LA, Sullivan KM, Tabit CJ, Turpin T, Zeabi A, Zheng T, Berretta S, Klengel T, Ruzicka WB, Oakley DH, Blanchard T, Ho E, Johnson R, LeFevre A, Bustamante M, Haroutunian V, Marino C, Purohit DP, Wysocki M, Glausier JR, Lewis DA, Nagra RM, Alba C, Martin J, Rice E, Rosenberger J, Smith G, Sukumar G, Tompkins M, Wilkerson MD, Dalgard CL, Scott WK.
Show Full Abstract

CNS diseases are a prevailing cause of morbidity and mortality worldwide, and are influenced by environmental and biological factors, including genetic risk. Here, we generated genome-wide genetic data on a large cohort of brain tissue donors with in-depth clinical and neuropathological phenotyping, allowing for broad investigations into the risk and mechanisms of these neurological, neurodevelopmental and psychiatric conditions. This resource consists of 9663 donors with array-based genotyping and 9543 donors with whole-genome sequencing completed. The clinical diagnoses of these donors include 148 CNS diseases clustered into 15 broad categories by International Classification of Diseases-10 (ICD-10) coding. These donors were collected by six repositories comprising the National Institutes of Health NeuroBioBank, with an average participant age of 60 years. While primarily older individuals of European descent, the cohort also contains younger donors and individuals from non-European backgrounds. Variants were detected in whole-genome sequencing, normalized and annotated to describe their functional impact, resulting in 171 121 209 unique variants and 1 078 774 non-silent variants. These raw and normalized data have been made available as a neurogenomics resource in the National Institute of Mental Health Data Archive (nda.nih.gov), combined with donor-matched deep demographic and phenotypic data from the NeuroBioBank Portal (neurobiobank.nih.gov). To illustrate applications, we replicated the strong association observed in previous studies between pathogenic CAG nucleotide repeat expansions in the HTT gene with the clinical diagnosis of Huntington's disease, as well as associations of the APOE gene with Alzheimer's disease, and examined the association of polygenic risk scores with the three most common disease diagnoses in the cohort.

OLFM4
Also flagged:sepsisGene expressiondegranulationdeathinfectionimmune response
Journal Article 2026-07-01 ✓ 1 Snippet Giannini HM, Kan M, Cosgriff CV, Morley MP, Miano TA, Narayanan N, Ittner CAG, Turner AP, Esperanza MP, Erlich MC, Oniyide O, Anderson BJ, Jones TK, Feng R, Reilly JP, Himes BE, Shashaty MGS, Meyer NJ.
In-Text Gene Mentions

…( LCN2 ,OLFM4, RETN ,…

Show Full Abstract

Transcriptomic analysis of blood cells can reveal key elements of the dysregulated host response in sepsis and spur biomarker and mechanism identification. We hypothesized that sepsis nonsurvivors exhibit a distinct transcriptional signature in whole blood that reflects insights into sepsis mortality. We conducted a prospective observational cohort study of 161 critically ill sepsis patients. Whole blood RNA was collected within 24 hours of intensive care unit admission. Gene expression levels were measured using microarrays, and changes in gene levels were compared between 30-day nonsurvivors and survivors, adjusting for age, sex, and neutrophil count. Pathway overrepresentation analysis and weighted gene co-expression analysis were performed to identify biological pathways and gene co-expression groups, respectively, associated with sepsis mortality. Gene- and pathway-based results were compared to findings in an independent cohort of 479 sepsis patients with 28-day mortality data. Thirty-day mortality in the enrolled sepsis cohort was 37% (60 of 161 patients). We identified 1106 differentially expressed genes in nonsurvivors (Benjamini-Hochberg-adjusted P-value <.05), including several neutrophil-related genes (CEACAM8, ELANE, PRTN3, MPO, CEACAM6, DEFA4, MS4A3) with expression levels over 1.8 times higher in nonsurvivors despite adjusting for neutrophil counts. The neutrophil degranulation pathway was prominent based on its overrepresentation in (1) differentially expressed genes in both cohorts, (2) overrepresentation by gene set enrichment analysis, and (3) 4 of the 6 gene co-expression groups correlated with sepsis mortality. Our findings highlight the involvement of neutrophil degranulation genes in sepsis mortality, prompting further study to better understand whether they constitute a modifiable target.

Also flagged:ChromatinBreast Cancernucleusactivationbreast cancerstumors
Journal Article 2026-07-01 No Snippets Gao A, Khatri PH, Ma G, Liu P, Fernandez-Martinez A, Donahue K, Wang Y, Kim EJ, Hu M, Liu F, Zhou J, Chan NT, Yang X, Welch Schwartz R, Ong IM, Burkard ME, Wisinski KB, Perou CM, Dinh HQ, Xu W.
Show Full Abstract

Patients with hormone receptor-positive/HER2-positive (HR+/HER2+) breast cancer represent a historically underrecognized subgroup demonstrating poor response to combined endocrine and HER2-targeted therapies. In this study, using single-cell transcriptomic and epigenomic sequencing of estrogen receptor-positive (ER+)/HER2+ models, we identified BRD8, an acetyl-lysine reader in the EP400 histone acetyltransferase complex, as a critical mediator of ER/HER2 signaling cross-talk. BRD8 expression rapidly increased following anti-HER2 treatment, whereas its depletion disrupted ER-HER2 interaction and enhanced drug sensitivity. Single-nucleus assay for transposase-accessible chromatin using sequencing revealed that chromatin regions opening after anti-HER2 treatment were enriched for ER, FOX, and ETS transcription factor motifs, coinciding with BRD8-dependent gene activation through EP400-mediated acetylated H2AZ deposition. BRD8 regulated ER-dependent and ER-independent growth pathways, and depletion of BRD8 abolished neratinib-induced ER activation and restored drug sensitivity in resistant cells. A three-gene BRD8 signature successfully predicted anti-HER2 therapy response in two human clinical trials. Together, these findings establish BRD8 as both a predictive biomarker for anti-HER2 response and a therapeutic target to overcome resistance in HR+/HER2+ breast cancer.<h4>Significance</h4>Multiomic single-cell profiling of breast cancer identified BRD8 as a critical mediator of resistance to HER2-targeted therapies that enables ER-HER2 cross-talk and serves as a predictive biomarker for treatment response.

HFE
Also flagged:hereditary hemochromatosisHHdegradationiron-overload disorders
Journal Article 2026-07-01 ✓ 2 Snippets Yu Y, Jiang L, Lin Z, Liu Y, Liang W, Su Y, Wu Q, Min J, Wang F.
In-Text Gene Mentions

…loading in murinehemochromatosis.…

…model for studyinghemochromatosis.…

Show Full Abstract

<h4>Abstract</h4>Excess iron induces tissue toxicity in various conditions, including hereditary hemochromatosis (HH). Hepcidin, a liver-derived hormone encoded by the HAMP gene, plays a pivotal role in regulating systemic iron by mediating the degradation of ferroportin (FPN), the sole cellular iron exporter. Previous research found that the E3 ubiquitin ligase RNF217 is a key regulator of iron homeostasis by directly affecting FPN degradation; however, the role of RNF217 overexpression in iron-overload disorders such as HH is poorly understood. To address this question, we generated both global and intestine-specific Rnf217-overexpressing mice and then crossed these mice with hemojuvelin knockout (Hjv-/-) mice, a model for studying hemochromatosis. We found that both global and intestine-specific Rnf217 overexpression caused an identical rescue of the HH phenotype, implicating duodenal enterocytes as the main site where RNF217 overexpression exerts its beneficial effects. Moreover, we found that intestinal Rnf217 overexpression significantly reduced iron accumulation in the serum and in vital organs; importantly, these effects were not correlated with hepcidin levels. In summary, our findings demonstrate that intestinal RNF217 overexpression can directly suppress iron absorption by modulating FPN protein levels, bypassing hepcidin. This suggests a possible therapeutic strategy for iron-overload disorders, warranting further study to establish its clinical potential.

B4GALT5
Also flagged:Pancreatic ductal adenocarcinomaPDACpancreatic intraepithelial neoplasiaPanINinvasive carcinomacancer
Journal Article 2026-07-01 ✓ 1 Snippet Min J, Schweizer L, Zonderland G, Selvanesan BC, Thomsen JH, Oldenburg L, Bae SW, Kim B, Hernández SD, Jez G, Bernard V, Swanson BJ, Klute KA, Wang H, Caffrey TC, Grandgenett PM, Hollingsworth MA, Ummat I, Strauss MT, Mund A, Maitra A.
In-Text Gene Mentions

…and the glycosyltransferaseB4GALT5, were also consistently…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) evolves through precursors, yet the protein programs governing early progression remain poorly defined. We applied Deep Visual Proteomics (DVP)-integrating computational pathology, laser microdissection, and mass spectrometry (MS)-to profile normal ducts, acinar-to-ductal metaplasia (ADM), low-grade (LG) and high-grade (HG) pancreatic intraepithelial neoplasia (PanIN), and invasive carcinoma from organ donors and patients with PDAC. Quantifying 9,181 proteins from ∼100 cells per region, we uncovered a molecular field effect in histologically normal ducts and proteomic divergence of LG-PanINs by cancer context. We identified four stage-associated molecular programs. Stress adaptation and immune engagement emerged early in cancer-associated normal ducts. Metabolic reprogramming initiated in normal ducts and intensified across PanIN progression. Mitochondrial remodeling became prominent in HG-PanINs before invasion. MS detected KRAS hotspot mutant peptides within incidental precursor lesions from cancer-free individuals. These findings demonstrate that molecular reprogramming precedes histologic transformation, creating opportunities for earlier detection of lethal cancer.<h4>Significance</h4>Artificial intelligence (AI)-guided DVP represents the first in-depth assessment of the proteomic landscapes observed during the multistep progression of pancreatic adenocarcinoma, including histologically normal ducts, ADM, and LG- and HG-PanIN lesions. These data represent a unique resource of candidate biomarkers and interception targets against this lethal disease. See related commentary by Yang and Fan, p. 1255.

HFE
Also flagged:membranevesiclecellcongenital hemolytic anemiadisordersmacrocytosis
Journal Article 2026-07-01 ✓ 1 Snippet D'Onofrio V, Esposito FM, Marra R, Rosato BE, Nostroso A, Perrotta A, Matsell E, Manno M, Iscaro A, Dionisi M, Martone S, Arcioni F, Barbato A, Chiariotti L, Della Monica R, van Oirschot-Hermans BA, van Wijk R, Molday RS, Iolascon A, Russo R, Andolfo I.
In-Text Gene Mentions

…or duplications inHFE, TFR2 ,…

Show Full Abstract

<h4>Abstract</h4>The ATP11C gene, localized on the X chromosome, encodes the major phosphatidylserine flippase in human red blood cells (RBCs). Flippases actively transport phospholipids from the outer to the inner leaflet of the lipid bilayer, establishing and maintaining phospholipid asymmetry crucial for cell survival. Variants in ATP11C have been recently associated with a novel form of X-linked congenital hemolytic anemia. In this study, we identified 10 individuals from 7 unrelated families harboring 6 rare, novel variants in the ATP11C gene. Three of the variants were further characterized and functionally validated. Of note, the first variant, p.R467C, was identified in a male neonate presenting with mild hemolytic anemia. The second variant, c.2226-1G>C, was found in a male aged 53 years who was originally suspected of hereditary hemochromatosis. The third variant, p.D609V, was detected in a female aged 68 years with mild anemia. Functional studies revealed reduced ATP11C protein expression, as well as decreased flippase activity both in vitro and in ex vivo RBCs supporting a loss-of-function mechanism. Additionally, in the female patient, we identified skewed X-chromosome inactivation, because of which the pathogenic effect of the heterozygous ATP11C variant became clinically evident. Our study expands the clinical spectrum of ATP11C-related hemolytic anemia, highlighting its association with adult-onset disease and hepatic iron overload. We emphasize the importance of including ATP11C in genetic testing for the diagnosis of hereditary hemolytic anemia and iron metabolism alterations. These findings enhance our understanding of RBCs membrane homeostasis and elucidate the critical role of ATP11C in erythropoiesis and systemic iron regulation.

DCC
Also flagged:dosage compensationembryogenesisbindingchromosomesautosomeschromosome
Journal Article 2026-07-01 ✓ 5 Snippets Jash E, Tan ZM, Rakozy AI, Azhar AA, Mendoza H, D'Arca J, Csankovszki G.
In-Text Gene Mentions

…dosage compensation complex (DCC) in C. elegans…

…TheDCCis a 10-subunit…

…TheDCCis recruited to…

…TheDCCcompacts the X…

…H4K20me1 by theDCCsubunit DPY-21 (…

Show Full Abstract

The Caenorhabditis elegans nuclear hormone receptor sex-1 is an embryonic X-signal element that represses xol-1, the sex-switch gene that is the master regulator of sex determination and dosage compensation. Several prior studies on sex-1 function have suggested that sex-1 may have additional downstream roles beyond the regulation of xol-1 expression. In this study, we characterize some of these additional roles of sex-1 in regulating the dual processes of sex determination and dosage compensation during embryogenesis. Our study reveals that sex-1 acts on many of the downstream targets of xol-1 in a xol-1-independent manner. Further analysis of these shared but independently regulated downstream targets uncovered that sex-1 mediates the expression of hermaphrodite- and male-biased genes during embryogenesis. We validated sex-1 binding on one of these downstream targets, the male developmental gene her-1. Our data suggests a model where sex-1 exhibits multilevel direct transcriptional regulation on several targets, including xol-1 and genes downstream of xol-1, to reinforce the appropriate expression of sex-biased transcripts in XX embryos. Furthermore, we found that xol-1  sex-1 double mutants show defects in dosage compensation. Our study provides evidence that misregulation of dpy-21, one of the components of the dosage compensation complex, and the subsequent misregulation of H4K20me1 enrichment on the X chromosomes, may contribute to this defect.

HTT
Also flagged:neurodegenerative diseasesADphosphorylationsynaptogenesisneurogenesisPD
Journal Article 2026-07-01 ✓ 1 Snippet Sopko Z, Pačesová A, Železná B, Maletínská L.
In-Text Gene Mentions

…in the huntingtinHTTgene, involving an…

Show Full Abstract

The neuroprotective properties of several anorexigenic peptides, including leptin and glucagon-like peptide-1, are well established across models of neurodegenerative diseases. However, less is known about the role of orexigenic neuropeptides-including neuropeptide Y, agouti-related peptide, melanin-concentrating hormone, orexins, galanin, and peripherally released hormone ghrelin-that are best known for their role in energy balance and stimulation of food intake. Growing evidence highlights their broader neuroprotective properties across preclinical models of Alzheimer's disease (AD) and Parkinson's disease (PD). In AD, these peptides reduce hallmark pathologies such as amyloid burden, tau phosphorylation, oxidative stress, and neuroinflammation, while enhancing synaptogenesis, neurogenesis, and cognitive function. In PD models, ghrelin protects nigrostriatal dopaminergic neurons by restoring autophagic flux, suppressing endoplasmic reticulum stress-mediated apoptosis, and reducing microglial activation, whereas orexin A and B preserve tyrosine hydroxylase expression, promote neuronal excitability, and improve motor and cognitive outcomes. Taken together, these findings position orexigenic peptides as promising modulators of neurodegeneration and highlight their potential as therapeutic targets in AD and PD.

POU3F2
Also flagged:BrainNeuropsychiatric DisordersAlzheimer's diseaseParkinson's diseaseHuntington's diseasebipolar disorder
Journal Article 2026-07-01 ✓ 5 Snippets Liu X, Xu H, Zhao Y, Yang J, Zhang L, Wang Z, Lim K, Zhang C, Lu L.
In-Text Gene Mentions

…Roles ofPOU3F2in Brain Development…

POU3F2, a member of…

POU3F2deletion results in…

…have demonstrated thatPOU3F2is involved in…

…Besides,POU3F2also plays a…

Show Full Abstract

POU3F2, a member of the Pit-Oct-Unc (POU) domain transcription factor family, is widely expressed in the central nervous system and essential for the development and maturation of brain. POU3F2 deletion results in impaired hypothalamus and neocortex development, and most mice die between postnatal days 0 and 10. Recently, emerging evidences have demonstrated that POU3F2 is involved in neuropsychiatric disorders, including Alzheimer's disease, Parkinson's disease, Huntington's disease, bipolar disorder, schizophrenia, and autism spectrum disorder, albeit still with some limitations in current studies. Besides, POU3F2 also plays a vital role in the reprogramming of somatic cells into neuronal lineages, which provides new ideas and directions for the treatment of neuropsychiatric disorders. This review aims to systematically summarize and analyze the diverse roles of POU3F2 in brain development, neuropsychiatric disorders, and neuronal reprogramming. Furthermore, the potential of POU3F2-targeted therapies for neuropsychiatric disorders and proposed key questions for future research are also emphasized. POU3F2 plays a pivotal role in brain development, the pathogenesis of neurological and psychiatric disorders, and the reprogramming of neural cells. A more comprehensive and systematic understanding of its molecular mechanism might provide novel therapeutic approaches for neuropsychiatric disorders.

HTT
Also flagged:autosomal dominant neurodegenerative diseaseHDagingsynapsesautosomalneurodegenerative disease
Journal Article 2026-07-01 ✓ 5 Snippets McCaughey-Chapman A, Connor B.
In-Text Gene Mentions

…the Huntingtin (HTT) gene which…

…N-terminus on theHTTprotein.…

…identification of theHttgene in 1993,…

…64 Indeed,HTTis a master…

…65 Similarly,HTTis a positive…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease characterized by the loss of GABAergic medium spiny neurons (MSNs). Cellular models of HD are mainly derived from human embryonic stem cells or induced pluripotent stem cells. These models are limited by their DNA embryonic age, low neuronal yields, and limited disease pathology. We propose direct reprogramming, which maintains the aging signature of the cells, to human induced lateral ganglionic eminence precursors (hiLGEP) results in the generation of high yields of functionally mature MSNs exhibiting pathological hallmarks of HD. hiLGEPs were derived from normal and HD fibroblasts by direct reprogramming and differentiated to MSNs. hiLGEP and MSN fate acquisition was compared between normal and HD through gene and protein expression. Known pathological hallmarks of HD were investigated within the hiLGEP-derived MSNs. The formation of functional synapses was investigated using live cell calcium imaging. We demonstrate that HD fibroblasts can be reprogrammed to hiLGEPs expressing key linage markers and displaying disease-related changes in expression of FOXP1 and FOXP2. HD hiLGEPs can be differentiated to high yields of MSNs co-expressing DARPP32, GABA, or GAD65/67, and SYN1 and PSD-95. HD MSNs show a reduced expression of BDNF, HAP1, TRKB, Rhes and PGC1α, exhibit MW8+ mHTT aggregates and display smaller cell somas, reduced total neurite length and reduced branched neurites when compared to normal MSNs. An administration of 100 µM dopamine was necessary to generate a calcium response in HD MSNs. This study establishes a directly reprogrammed hiLGEP-derived MSN model of HD which recapitulates pathological signatures.

PTGIS
Also flagged:tumorpancreatic ductal adenocarcinomaPDACpathogenesiscancernucleus
Journal Article 2026-07-01 ✓ 1 Snippet Roger E, Mummey HM, Zimmer E, Srinivasan D, Härle A, Moubri L, Michels AK, Singh R, Ekizce M, Melzer MK, Lee Y, Silva A, Härle L, Engleitner T, Arnold F, Morawe M, Naggay BK, Schneider J, Gilberg L, Mosler JP, Ludwig C, Meng C, Hirschenberger M, Hunszinger V, Kluck K, Kirchner M, Volckmar AL, Wirth M, Alhamdani MSS, Hoheisel JD, Löhr JM, Seufferlein T, Abaei A, Kemkemer R, Rad R, Budczies J, Mulaw MA, Hermann PC, Haenle MM, Sparrer KMJ, Halbrook CJ, Gaulton KJ, Steinestel K, Stenzinger A, Dusetti N, Perkhofer L, Gout J, Kleger A.
In-Text Gene Mentions

…and apCAFs (Ptgis, Fth1 ,…

Show Full Abstract

The tumor microenvironment (TME) actively contributes to pancreatic ductal adenocarcinoma (PDAC) pathogenesis through dynamic bidirectional tumor-stroma interactions. In this study, we demonstrated that ATM-deficient tumor epithelium reprograms the TME in a genotype-specific manner to enhance cancer aggressiveness. In genetically engineered mouse models, pancreatic stellate cell and cancer-associated fibroblast (CAF) coculture systems, single-nucleus multiomics, and human PDAC models, tumoral loss of ATM serine/threonine kinase drove CAFs toward αSMA+ myofibroblastic (myCAF) differentiation, independently of p53 status. The myCAFs, in turn, promoted cancer aggressiveness and chemoresistance. Mechanistically, ATM deficiency increased reactive oxygen species and contractility signaling, enhancing TGFβ1 secretion. Pharmacologic TGFβ inhibition reversed myCAF differentiation, sensitized tumors to chemotherapy, and impaired tumor progression in both murine and human ATM-null models. These findings reveal that ATM-deficient tumors shape a cancer-promoting niche via TGFβ signaling and identify dual targeting of intrinsic and extrinsic vulnerabilities as a promising precision oncology strategy.<h4>Significance</h4>TGF-β-driven myofibroblastic stromal differentiation in ATM-deficient pancreatic cancer generates a genotype-specific tumor microenvironment, providing a targetable axis and highlighting the need to integrate epithelial genotype and stromal context in pancreatic cancer therapy.

MLLT10
Also flagged:AMLAcute myeloid leukemiaCancerdeathgene expressionchromosome
Journal Article 2026-07-01 ✓ 2 Snippets Colgan JN, Peplinski JH, Wang YC, Kirkey DC, Wallace LK, Feng Y, Fan L, Connerty P, Ries RE, Lamble A, Huang BJ, Alonzo TA, Ma X, Tarlock K, Meshinchi S.
In-Text Gene Mentions

…to have co-occurringMLLT10rearrangements and less…

…, KMT2A ::MLLT10, and KMT2A…

Show Full Abstract

<h4>Abstract</h4>Acute myeloid leukemia (AML) is a heterogeneous disease with complex mutational profiles that lead to variable clinical outcomes. NRAS and KRAS are among the most frequently mutated genes in AML, but their clinical impact has not been well characterized. In this cohort of >2000 children and young adults with AML, we evaluated the role of mutations in RAS genes and mutation complexity in outcome determination. Given enrichment in KMT2A-rearranged (KMT2A-r) AML, we specifically studied the significance of RAS mutations in KMT2A-r AML. Using variant calls from next-generation sequencing platforms, we identified RAS mutations in 35.1% (N = 669; NRAS, n = 518; KRAS, n = 216). We demonstrated that NRAS mutations were not associated with outcome in AML or in KMT2A-r AML. In contrast, KRAS mutations demonstrated inferior outcomes in AML, with enrichment of prevalence and enhancement of prognostic implications in KMT2A-r AML, including non-high-risk KMT2A fusions. Additionally, we describe a complex RAS (Comp-RAS) mutation cohort characterized by 2 distinct RAS mutations or high variant allele frequency RAS mutations that collectively account for 13.5% (n = 90) of the patients with RAS mutations. Patients with complex KRAS mutations and those with Comp-RAS mutations in the KMT2A-r cohort had a distinctly adverse outcome, and data demonstrate that Comp-RAS status drives adverse outcomes for those with KRAS mutations in the whole AML cohort.

Also flagged:chromatintranslationalembryogenesisstem cell differentiationcell differentiationstem cell
Journal Article 2026-07-01 No Snippets Park EJ, Levin-Ferreyra F, Di Stefano B.
Show Full Abstract

Differentiation requires coordinated exit from the stem cell state, during which gene regulatory networks sustaining self-renewal are dismantled, while lineage-specific programs are activated. This transition is governed by chromatin modifications, transcriptional networks, RNA processing, translational control, and metabolic rewiring that must operate with temporal precision. Despite significant progress in identifying individual regulatory components, understanding how these layers integrate to orchestrate irreversible cell fate commitment remains a fundamental challenge. This review examines common and unique regulatory principles governing stem cell exit, from totipotency during early embryogenesis to tissue-specific stem cell differentiation in adults. We synthesize recent findings on regulatory mechanisms across mammalian species, highlight species-specific adaptations, and explore the concept of reversibility in differentiation. Elucidating these principles has broad implications for regenerative medicine, cellular reprogramming, and diseases in which differentiation programs are corrupted.

Also flagged:immune responsescancer
Journal Article 2026-07-01 No Snippets Karbalaeimahdi M, Marcelina DCC, Stan RC.
Show Full Abstract

Programmed Cell Death-1 receptors on the surface of monocytes and T and B cells modulate various immune responses and are key immunotherapy targets. Immunotherapeutic monoclonal antibodies, including Nivolumab, block the activity of this receptor and are a mainstay of cancer therapy. Use of these drugs has been associated with side effects, including local inflammation and systemic fever in some cancer patients. To understand the role of physiologic (37°C), pathophysiologic (39°C) and standard (25°C) temperatures on the formation of the immune complexes between PD-1 and Nivolumab, we used Surface Plasmon Resonance and Molecular Dynamics simulations, at appropriate temperatures. The mean lives obtained from the dissociation curves of Nivolumab:PD-1 complexes at 37°C or 25°C are ~16 times and ~125 times longer, respectively, than those at 39°C (~7 s). These discrepancies are due to N-terminal loop from PD-1 moving away from Nivolumab only at the higher temperatures, as well as due to changes in the epitope:paratope interface.

PTGIS
Also flagged:hypertensioninflammatory responsespathologiescardiovascular diseaseallergyasthma
Journal Article 2026-07-01 ✓ 1 Snippet AlMotairy R, Ullah MM, Blessinger S, Lunel AM, Fehrenbach DJ, Zhang J, Szarkowicz C, Ceneviva ZJ, Wang J, Madhur MS, Shuey MM, Bastarache L, Peebles RS, Norlander AE.
In-Text Gene Mentions

PTGIS

Show Full Abstract

Prostaglandin I2 (PGI2) signaling is vasoprotective. Further, PGI2 signaling exhibits immunomodulatory properties that largely promote an anti-inflammatory state. Inflammation and immune activity are associated with the development of hypertension. However, it remains unknown whether exogeneous PGI2 can restrain the immune and inflammatory responses in the context of hypertension. A phenome-wide association study evaluated single-nucleotide polymorphisms (SNPs) in the receptor for PGI2, IP (gene name PTGIR), and the associated odds of developing cardiovascular pathologies. C57Bl/6J mice underwent one of two models to evaluate the effect of an exogenous PGI2 analog on aortic inflammation and hypertension. Mice were either administered the PGI2 analog, treprostinil (TPL), at the initiation of angiotensin II (Ang II) infusion to determine the effect of TPL on the development of inflammation and hypertension, or mice were administered TPL after 2 weeks of Ang II to determine the ability of TPL to reduce blood pressure and inflammation in established hypertension. Humans who were heterozygous for an SNP in IP had a significantly greater odds ratio for several vascular pathologies compared to controls. Mice that received TPL at the onset of Ang II infusion were protected from developing hypertension and exhibited reduced aortic inflammation. Mice that received TPL two weeks after initiation of Ang II infusion exhibited a significant reduction in their blood pressure, decreased aortic inflammation, diminished aortic fibrosis, and fewer splenic Th1 cells compared to vehicle treatment. Exogeneous PGI2 signaling protects against the development and/or maintenance of Ang II-induced hypertension, possibly through inhibition of Th1 cell function.

Also flagged:Reproductiongenetic diseasesmonogenicCOVID-19hCGinfertility
Journal Article 2026-07-01 No Snippets Spinella F, Christopikou D, De Rycke M, Florensa M, Heijligers M, Toft CLF, Constantinou E, Viville S, Goossens V, Dimitriadou E.
Show Full Abstract

<h4>Study question</h4>What are the trends and developments in preimplantation genetic testing (PGT) in 2019-2021 as compared to previous years?<h4>Summary answer</h4>The main trend observed in the 22nd to 24th datasets on PGT is that the implementation of trophectoderm biopsy with comprehensive whole-genome testing is most often applied for PGT for aneuploidies (PGT-A) and concurrent PGT-M/SR/A, while for PGT for monogenic disorders (PGT-M) and PGT for chromosomal structural rearrangements (PGT-SR), single-cell targeted testing with PCR and FISH still prevails.<h4>What is known already</h4>Since it was established in 1997, the PGT Consortium within the European Society for Human Reproduction (ESHRE) has been collecting and analysing data from mainly European PGT centres. To date, 21 datasets and an overview of the first 10 years of data collections have been published.<h4>Study design, size, duration</h4>The data for PGT analyses performed between 1 January 2019 and 31 December 2021 with a 2-year follow-up, after analysis were provided by participating centres on a voluntary basis. Data were collected using an online platform; the data reported on a per genetic analysis basis as opposed to the former cycle-based database.<h4>Participants/materials, setting, methods</h4>Data on biopsy methods, diagnostic technologies, genetic diseases, and clinical outcomes were submitted by 45 centres. Records with multiple PGT-M and/or PGT-SR analyses or inconsistent PGT data were excluded. Embryo transfers performed within 2 years of analysis were included to calculate clinical outcomes, including stratification by biopsy day and cumulative pregnancy rates. Data analysis, calculations, and preparation of figures and tables were carried out by expert co-authors.<h4>Main results and the role of chance</h4>A total of 14 731 PGT analyses were reported: 3782 for PGT-M, 874 for PGT-SR, 8492 for PGT-A, and 1583 for combined PGT-M/SR with PGT-A, henceforth referred to as combined testing. The use of trophectoderm biopsy increased for PGT-M (33% in 2018 to 49% in 2019-2021), remained stable for PGT-SR (33-36%), and was consistently high for PGT-A (98%) and combined cases (96%). The adoption of genome-wide or targeted technologies following whole-genome amplification (WGA) remained relatively stable for PGT-M (12-14%) and PGT-SR (44-45%), while genome-wide analysis performed on whole-genome-amplified DNA became the standard for PGT-A (99%). The combination of PGT-M/SR with PGT-A was performed either by applying a technology following WGA (74%) or by targeted methods (PCR or FISH, 24%). Diagnostic efficiency was 87% for PGT-M, 92% for PGT-SR, 98% for PGT-A, and 90% for combined testing. Pregnancy rates per embryo transfer were 26% for PGT-M, 26% for PGT-SR, 35% for PGT-A, and 36% for combined testing. Across all groups, Day 5 biopsies yielded better outcomes than Day 3 or Day 6 biopsies.<h4>Limitations, reasons for caution</h4>The findings refer to data submitted by 45 participating centres and do not reflect global trends in PGT. Information on the health of babies born following PGT was not included in this manuscript. It should also be noted that final outcomes may be influenced by the number and type of centres submitting data in different years.<h4>Wider implications of the findings</h4>The Consortium datasets provide a valuable resource for monitoring trends in PGT practice, both from a technological perspective and in terms of clinical outcomes.<h4>Study funding/competing interest(s)</h4>The study has no external funding, and all costs are covered by ESHRE. There are no competing interests declared.<h4>Trial registration number</h4>NA.

Also flagged:infectionpathogenesisWNV infectionviral infectionsadaptiveviral encephalitis
Journal Article 2026-07-01 No Snippets Cimini E, Tartaglia E, Cristofanelli F, Gili S, Maggi F.
Show Full Abstract

Between mosquitoes and birds, West Nile virus (WNV) is a neurotropic flavivirus, an arthropod-borne pathogen involved in an enzootic cycle. Additionally, it can infect both people and horses, leading to severe illness. Since 1999, WNV has spread across North and South America, including Mexico and the Caribbean. It is endemic in several regions of Europe, Africa, the Middle East, and Asia. WNV affects the central nervous system (CNS), causing severe disease in a small percentage of infected individuals, especially in immunocompromised or elderly hosts. This re-emerging pathogen was identified during an outbreak in July 2025 in the Lazio region of Italy, rekindling interest in an area where the virus had not circulated for some time and raising several questions about the WNV vector and its spread. Gammadelta T (γδ T) lymphocytes are innate cells that can respond rapidly and non-specifically to viral infections and other pathogens, thereby linking innate and adaptive immunity. Several studies in mice and humans suggest they play distinct roles in controlling WNV infection by communicating with other immune cells, underscoring their antiviral role, which is essential for containing viral dissemination in the host. This review will discuss recent studies on the role of γδ T cells in viral pathogenesis and in protective immunity during WNV infection.

HFE
Also flagged:cirrhosisasciteshepatic encephalopathyliver failureacute kidney injuryheart failure
Journal Article 2026-07-01 ✓ 1 Snippet Bedoya JU, Wagner M, Malézieux E, Primard P, Larrue H, Mouri S, Bouzbib C, Soler M, Bureau C, Molinari N, Guiu B, Aboudrar M, Mbenda C, Roux C, Pageaux GP, Thabut D, Rudler M.
In-Text Gene Mentions

…holangitis), Wilson's disease,hemochromatosisand alpha‐1‐anti‐trypsin defic…

Show Full Abstract

<h4>Background & aims</h4>Transjugular intrahepatic portosystemic shunt (TIPS) improves survival in refractory ascites. A careful patient's selection is mandatory as TIPS can lead to complications. Liver volumetry is predictive of outcomes before hepatic surgery, but data on its role before TIPS placement are scarce. We aimed to evaluate whether liver and spleen volume measurements are associated with prognosis after TIPS placement in patients with ascites.<h4>Methods</h4>We analysed data from three French centers, treated with TIPS between 2017 and February 2022. Inclusion criteria encompassed a TIPS placement for refractory or recurrent ascites and availability of cross-sectional imaging. Exclusion criteria included non-cirrhotic portal hypertension, other indications for TIPS, hepatocellular carcinoma beyond Milan criteria, and extrahepatic malignancy. Liver and spleen volumes were measured using pre-TIPS CT or MRI scans. The primary endpoint was 1-year transplant-free survival (TFS). Secondary endpoints were overt hepatic encephalopathy (HE), recurrence of ascites, acute variceal bleeding, and jaundice.<h4>Results</h4>The 160 patients were included (median age 60 years, male gender 83.8%, alcohol-related cirrhosis 58.8%, with active alcohol consumption in 25.6%, Child-Pugh B cirrhosis in 81.2%, median MELD score was 12). The 1-year TFS was 60.1%. Multivariate analysis identified serum creatinine (HR = 1.01 95% CI [1.00-1.01], p = 0.04), total bilirubin (HR = 1.02 95% CI [1.02-1.04], p = 0.004), and portal pressure gradient (HR = 1.09 95% CI [1.01-1.18], p = 0.03) as independent factors associated with TFS. Neither liver-to-spleen volume ratios (LSVR) (p = 0.36) nor liver volume index (p = 0.92) were significantly associated with death or LT. Overall, 38.1% of patients developed overt HE after TIPS, with lower platelet count (HR = 1.01 95% CI [1.00-1.01], p = 0.04) emerging as an independent predictor. No radiological characteristics were associated with the recurrence of ascites.<h4>Conclusions</h4>In this multicenter study, liver and spleen volumes were not associated with transplant-free survival or liver-related outcomes in patients undergoing TIPS for ascites. These findings suggest that liver volumetry should not be a determining factor in patient selection for TIPS placement.

Also flagged:Membraneorganizationbindingporesynthesisenzyme activity
Journal Article 2026-07-01 No Snippets Maleki MF, Jakobsen JB, Schuiten ED, Wagner T, Neves ALA, Bunch L.
Show Full Abstract

Hydrogenotrophic methanogens are anaerobic archaea that convert carbon dioxide and hydrogen into methane. Central to this process is the heterodisulfide reductase (Hdr), which catalyzes the reduction of the heterodisulfide made of coenzyme M and coenzyme B. In vivo, Hdr functions in association with electron-donating modules such as the [NiFe]-hydrogenase (HdrMvh), which supplies reducing equivalents derived from hydrogen oxidation. Here, we isolate the catalytic properties of Hdr by evaluating substrate turnover independently of its native electron-donating modules using an artificial electron donor system. The molecular features governing substrate recognition and turnover by Hdr were investigated through the design and synthesis of 18 non-endogenous analogs of the native heterodisulfide substrate (compounds 2a-r). We show that several non-endogenous disulfides can serve as alternative substrates for Hdr, including analogs with variation in the coenzyme B-derived amino acid moiety (O-phosphono-Ser, L-Asp, L-Glu, and 2-aminoadipic acid), and that the coenzyme M sulfonate can be replaced by a carboxylate group. In contrast, modifications that disrupt charge balance, chain length, or stereochemical compatibility result in loss of substrate activity and, in some cases, lead to inhibitory behavior, underscoring the narrow constraints required for productive catalysis.

Also flagged:immune responseschromosomechromosomescolorationfertilizationtelomeres
Journal Article 2026-07-01 No Snippets Ali A, Waldbieser GC, Youngblood RC, Wheeler PA, Scheffler BE, Willis S, Narum SR, Thorgaard GH, Salem M, Palti Y.
Show Full Abstract

Rainbow trout (Oncorhynchus mykiss) exhibit extensive genomic diversity shaped by domestication, life history and geographic origin. To advance the development of a comprehensive pangenome reference, we present new de novo genome assemblies of two genetically and ecologically distinct lines: Whale Rock (WR; wild, landlocked, Central California) and Keithley Creek (KC; wild, resident, interior Columbia Basin), along with the previously published assemblies of the Arlee (domesticated, Northern California) and Swanson (semi-domesticated, resident, Alaska) lines. All assemblies provide nearly complete coverage of known genes (BUSCO 95.8%-99.7%) and are similar in genome size (~2.3 Gb), with scaffold N50 values between 3.4 Mb (KC) and 52.4 Mb (Swanson). Comparative whole-genome alignments revealed high sequence conservation (97%-98% identity) among assemblies, but also evidence of extensive structural variation of at least 50 bp in length. Structural variant (SV) profiling identified tens of thousands of deletions, insertions and complex rearrangements largely in noncoding sequences. In an initial assessment of the utility of having multiple de novo genome assemblies for rainbow trout, we found that two strains (Arlee and Swanson; domesticated) share SVs enriched in genes linked with growth, reproduction and adaptation to domestication, such as GTP binding and ECM-receptor interaction. In comparison, the other two strains (WR and KC; wild origin) share SVs associated with reproductive timing, such as the GnRH signalling pathway. Both Arlee and WR also have unique SVs potentially related to their geographic origin and unique life history. Additionally, we identified SVs in key regions, such as a QTL for fillet yield on Omy17 and the maturation-associated six6/erβ-gphb5 locus on Omy25q, suggesting the importance of considering SVs when investigating the genomics of complex traits. Together, these assemblies and comparative analyses establish a foundation for a rainbow trout pangenome reference, illuminating how they can be utilized to reveal the structural genomic basis of domestication, adaptation, and other complex traits in O. mykiss.

TRIM38
Also flagged:inflammatory responsesantiviral responseimmune responseviral infectioninfectionantiviral immunity
Journal Article 2026-07-01 ✓ 1 Snippet Camp CR, Baskaran J, Brown M, Parker C, Drotos P, West RC.
In-Text Gene Mentions

…TRIM14, TRIM22, TRIM25,TRIM38, and TRIM69) and…

Show Full Abstract

<h4>Abstract</h4>Early pregnancy requires a tightly regulated pro-inflammatory environment shared between the primitive placenta and decidua. While immune balance supports successful implantation and placental invasion, disruptions in immune signaling during this period can impair implantation and lead to embryo loss. In this study, we investigated the molecular mechanisms underlying immune imbalance during implantation using a trophoblast stem cell (TSC) model. TSCs were cultured in either stem cell or syncytiotrophoblast (STB) differentiation medium and treated with either lipopolysaccharides (LPSs) or interferon beta (IFNB). RT-qPCR and western blotting revealed that LPS failed to induce a pro-inflammatory cytokine response in TSCs or STBs. In contrast, IFNB triggered a strong antiviral response in both TSCs and STBs. RNA sequencing of IFNB-treated TSC and STB 3D spheroids revealed subtle differences between the TSC and STB responses to interferons. Both TSC and STB IFNB-treated spheroids mount an interferon-mediated antiviral response; however, STB spheroid genes associated with the type I interferon response, viral RNA/DNA sensing, and antigen processing were upregulated. We also compared the interferon response between the CT27 (female) and CT29 (male) TSCs and STBs. While STBs showed minimal differences, the CT29 TSCs exhibited a markedly stronger interferon response than the CT27 TSCs. Collectively, these findings suggest that the primitive placenta is selectively responsive to interferon signaling rather than direct pathogen-associated stimuli. This implies that maternal immune activation, rather than microbial invasion, likely drives that placental immune response and embryo success at this stage. Understanding these dynamics underscores the importance of the maternal immune balance in early pregnancy success.<h4>Lay summary</h4>The maternal immune system has a direct influence on the success of embryo implantation. If that balance is disturbed, the placenta can fail to invade into the uterus and implantation can fail, leading to embryo mortality and pregnancy loss. In our study, we used stem cells from the placenta to explore how they respond to different kinds of immune signals (i.e. signals from bacteria versus signals from the mother's immune response). We found that placental stem cells do not respond to signals from bacteria. However, they do react strongly to signals that resemble a viral infection in the mother. These data suggest that the early placenta is more sensitive to the mother's immune signals than to direct infection, which highlights the critical role of maternal immune health in early pregnancy.

Also flagged:Retrotransposonsreverse transcriptionmembranelocalizationchromosomeorganization
Journal Article 2026-07-01 No Snippets Stuart AJ, Du Z, Hassan NT, Adelson DL.
Show Full Abstract

Retrotransposons are mobile, repetitive DNA sequences that are ubiquitous across eukaryotes and widely recognized as key drivers of both gene and genome evolution. The CR1 group of retrotransposons is thought to have been present in the most recent common ancestor of vertebrates ∼560 Ma and is the dominant retrotransposon in the majority of vertebrate species. The advent of long-read sequencing technologies has enabled the assembly of high-quality genomes from representatives of almost all major vertebrate orders, enabling comparative analysis with deeply divergent species. To better understand the composition of CR1-group elements (CGEs) in vertebrates, we systematically characterized transposable elements across representative species from every available extant order of vertebrates. Our analysis uncovered previously unknown phylogenetic relationships of CGEs within and between species and has pushed back the origin of certain CR1-group subclades by tens of millions of years. Additionally, entirely novel elements with no close relatives in existing databases were uncovered within several of the species analyzed. We also detected numerous putative horizontal transfer events, many of which had not been previously documented. Overall, this investigation has provided the first vertebrate-wide analysis of an element that is historically understudied yet plays a pivotal role in genome biology and evolution.

Also flagged:synthesisprotein synthesisbiosynthesisinfection
Journal Article 2026-07-01 No Snippets Husain SM, Wang L, Han LC, Bowen JI, Song Z, de Courcy-Ireland F, Winter AJ, Simpson TJ, Race PR, Spencer J, Crump MP, Willis CL.
Show Full Abstract

With growing understanding of complex biosynthetic pathways to natural products, mutasynthesis, which combines metabolic engineering with chemical synthesis, is becoming an increasingly important tool to produce novel compounds. Mupirocin, isolated from Pseudomonas fluorescens, is a mixture of pseudomonic acids (PAs) that exhibit antibiotic activity against Gram-positive bacteria including methicillin-resistant Staphylococcus aureus. We have developed a flexible approach, based on mutasynthesis, for the preparation of a library of novel PA analogues. The antimicrobial activities of the natural products and synthetic analogues were evaluated against Bacillus subtilis and four Staphylococcus aureus strains. Interestingly, one of the analogues retained antimicrobial activity in all the assays but lacked structural features that render PA-A unstable, that is, the 10,11-epoxide (replaced by an alkene) and ester linkage (replaced by a ketone). In addition, mutasynthesis allowed the preparation of an analogue of a key biosynthetic intermediate (desepoxy-PA-B) in which the C<sub>9</sub> hydroxy fatty acid is replaced by a C<sub>7</sub> analogue. Feeding studies with mutant strains of Pseudomonas fluorescens revealed that C<sub>7</sub>-desepoxy-PA-B was converted to the novel metabolite C<sub>7</sub>-PA-C with loss of the 8-hydroxyl group but with no extension to the C<sub>9</sub> side chain.

Also flagged:bindingcardiovascular diseasesneurological disordersmetabolic diseasescancerstranslational
Journal Article 2026-07-01 No Snippets Jahan I, Serrano Matos YA, Jayaraman A, Joshi AD.
Show Full Abstract

Aryl hydrocarbon receptor nuclear translocator 2 is a member of the basic helix-loop-helix/Per-ARNT-Sim family of transcription factors involved in responding to various environmental, metabolic, and chemical signals. Initially known for its involvement in neurodevelopment, ARNT2 is now recognized as an essential binding partner for other transcription factors, including single-minded homologs 1 and 2, neuronal PAS domain protein 4, hypoxia-inducible factor 1, and plausibly Aryl hydrocarbon receptor to regulate stress adaptation, synaptic plasticity, immune signaling, and energy balance pathways. The role of ARNT2 has also been implicated in a plethora of pathologies, including inflammation, cardiovascular diseases, neurological disorders, metabolic diseases, and cancers. This review summarizes the current knowledge of ARNT2's structure, regulation, interacting partners, and its toxicopathological significance. A better understanding of ARNT2 biology may open new avenues for its characterization as a molecular target and designing novel therapeutic strategies across multiple diseases.

PCDH17
Also flagged:Olfactory dysfunctionbehavioralneuronal differentiationananosmiaof
Journal Article 2026-07-01 ✓ 5 Snippets Yoo SH, Jang JY, Bae JS, Ventura R, Kim EH, Kim AY, Mo JH, Park J, Kang K, Yun Y, Lee JH, Kim YJ, Lee DJ, Kim JH.
In-Text Gene Mentions

…of DLGAP2 andPCDH17was higher in…

…KCNMA1 , andPCDH17— upregulated by…

…no. NBP2-82086), and anti-PCDH17(1:50, Novus Biologicals,…

…DLGAP2, FOXO3, HIPK2,PCDH17, SOX2, NESTIN, NEUROG1,…

…KCNMA1 , andPCDH17— were found…

Show Full Abstract

Olfactory dysfunction is a debilitating condition with no established treatment. This study evaluated the efficacy of intranasal (i.n.) NAD administration in restoring olfactory function. Cultured human olfactory stem cells (hOSCs) were treated with NAD and assessed by immunofluorescence staining, PCR, and western blot analyses. In vivo, mice with ZnSO<sub>4</sub>-induced anosmia were treated with i.n. NAD, intraperitoneal dexamethasone, or PBS and evaluated by histological analysis, behavioral tests, bulk RNA-sequencing (RNA-seq), and in situ hybridization. NAD promoted hOSC differentiation into olfactory sensory neurons (OSNs), evidenced by increased stem cell (SOX2 and nestin) and OSN markers (Tuj1 and OMP) expression, and upregulated neuronal differentiation-related genes (SOX2, NESTIN, NEUROD1, NEUROG1, and OMP). In vivo, the NAD group showed significant olfactory function improvement and marked olfactory epithelium repair. Bulk RNA-seq of the olfactory turbinate tissue identified 113 differentially expressed genes (cluster T1) upregulated in control and NAD groups. The Gene Ontology (GO) term "modulation of chemical synaptic transmission" was associated with cluster T1, and 25 genes implicated in this GO were upregulated in the NAD group. Integration with publicly available single-cell RNA-seq data identified six neuronal marker genes - ABHD2, DLGAP2, FOXO3, HIPK2, KCNMA1, and PCDH17 - upregulated by NAD. Protein expression of DLGAP2 and PCDH17 was higher in differentiated hOSCs treated with NAD. In situ hybridization confirmed that Dlgap2, Foxo3, and Pcdh17 expression was restored in anosmic mice treated with i.n. NAD. The potential therapeutic efficacy of i.n. NAD administration was demonstrated by showing regeneration of OSNs in hOSCs and restoring olfactory function in an anosmia mouse model.

PRDX6
Also flagged:Kashin-Beck diseaseosteoarthropathydeathextracellulardegradationmitochondrial
Journal Article 2026-07-01 ✓ 1 Snippet Liu Y, Li J, Zhang M, Zhang Y, Wang M, Wang R, Zhao X, Yang P, Chen J, Sun J.
In-Text Gene Mentions

…(GSR), peroxiredoxins 6 (PRDX6), peroxisome proliferator-act…

Show Full Abstract

Kashin-Beck disease (KBD) is an endemic osteoarthropathy characterized by chondrocyte death and extracellular matrix (ECM) degradation; however, the underlying molecular mechanisms remain poorly understood. This study aimed to explore whether glutathione peroxidase 6 (GPx6) is involved in regulating ferroptosis and matrix degradation in KBD cartilage injury. In articular cartilage from children with KBD, GPx6 expression was markedly reduced, particularly in the deep zone where chondrocyte death and matrix loss were most severe. Similarly, downregulation of GPx6 was observed in a T-2 toxin‑induced rat model and in C28/I2 chondrocytes, accompanied by decreased COL2A1 and ACAN levels and increased expression of MMP13 and ADAMTS4. Molecular docking indicates a potential interaction between T-2 toxin and GPx6. Gpx6 knockout mice exhibited signs of ECM degradation in articular cartilage, along with an enhanced susceptibility to T-2 toxin exposure. Mechanistically, Gpx6 deficiency led to elevated MDA levels, reduced SOD activity and GSH/GSSG ratio, as well as mitochondrial shrinkage, cristae loss, and lipid peroxidation. Knockdown of GPX6 suppressed the expression of SLC7A11, SLC3A2, and GPx4, while Ferrostatin‑1 partially reversed these ferroptosis‑related alterations but failed to restore GPx6 expression. Conversely, overexpression of GPX6 partially restored the function of the SLC7A11/GPx4 axis, improved redox balance, attenuated mitochondrial lipid peroxidation, and mitigated matrix degradation. Collectively, these findings suggest that downregulation of GPx6 may be closely associated with ferroptosis in KBD chondrocytes, and that GPx6 may serve as a potential upstream regulator of this process. Furthermore, dysregulation of the GPx6‑SLC7A11/GPx4 pathway may also be involved in the pathological process of cartilage injury in KBD.

HTT
Also flagged:HDdepressionautosomal dominant neurodegenerative disorderchromosomeanxietypsychiatric disorders
Journal Article 2026-07-01 ✓ 4 Snippets Nguyen QTR, Titeux H, Riad R, Massart R, Morgado G, Youssov K, Dupoux E, Bachoud-Lévi AC.
In-Text Gene Mentions

…of the Huntingtin (HTT) gene on chromosome…

…carriers of theHTTgene were included…

…in 89 FrenchHTTgene carriers from…

…of the mutantHTTgene using speech-based…

Show Full Abstract

Huntington's disease (HD) causes progressive disability through motor, psychiatric, and cognitive symptoms. Machine learning speech analysis can detect motor and cognitive symptoms of HD, but not yet psychiatric symptoms. This study investigated whether speech analyses can detect the presence of psychiatric symptoms in HD. Audio recordings of six narrative tasks (cookie-theft picture description, red-riding hood storytelling, most recent 24 hours recalling, happy, sad, or angry storytelling) were prospectively collected from subsequent genetically confirmed HD participants from the BIOHD and REPAIR CAPIT-HD-Beta cohorts at the Hospital Henri-Mondor, Créteil. Speech therapists blindly annotated speech samples to allow extraction of three types of features: linguistic, LASER, and acoustic features. Psychiatric symptoms in participants were detected using the Problem Behaviors Assessment Short version (PBA-s). Machine learning classifier models were trained on 80% of the 89 participants before being tested on the remaining 20% of individuals. F1-scores were calculated and compared to chance. Linguistic features detected obsessive/compulsive behavior (OCB) with all but joy task, and best with the cookie task (F1-score: 0.67, confidence interval [0.47-0.86] (p ≦ 0.001)). They also best detected depression with the red-riding hood (F1 score 0.66, [0.45-0.87], p ≦ 0.001), apathy with the joy task (0.60, [0.39-0.81], p ≦ 0.001), but not irritability. LASER features best detected OCB (0.65, [0.45-0.84], p ≦ 0.001), depression (0.60, [0.40, 0.80], p ≦ 0.01) and apathy (0.61, [0.37, 0.86], p ≦ 0.001) from the red-riding hood task, but not irritability. Acoustic features best detected depression (0.63, [0.46, 0.80], p ≦ 0.001) and OCB (0.60, [0.43, 0.77], p ≦ 0.001) but not apathy nor irritability. This study showed that speech analyses can detect obsessive/compulsive behaviors, depression, and apathy in HD participants but not irritability. Linguistic and LASER features provided the most consistent detections, but acoustic features also detected depression and OCB, highlighting their complementary role for psychiatric characterization in HD.

Also flagged:localizationcapsidsynthesisdegradationBiodegradationcatalytic activity
Journal Article 2026-07-01 No Snippets Thürlemann M, Pultar F, Gordiy I, Ruijsenaars E, Riniker S.
Show Full Abstract

We present the next generation of AMP, a neural network potential (NNP) with anisotropic message passing designed to study large biomolecular systems at DFT accuracy in the condensed phase using a multiscale approach similar to quantum-mechanics/molecular-mechanics (QM/MM) with electrostatic embedding. We trained AMPv3 on our recently published biomolecular multiscale simulation (BMS25) data set and demonstrated the model's high efficiency, which enabled us to simulate proteins involving thousands of atoms at DFT accuracy in addition to explicit MM solvent for up to 100 ns, which presents a major leap for contemporary NNPs. We observe excellent scaling to large systems on a single GPU. AMPv3-BMS25 (or AMP-BMS for short) shows promising performance on benchmarks, and we demonstrate that the model can be used to accurately estimate experimental properties, including solvation free energies of small molecules and structural features of proteins. Finally, AMP-BMS/MM was employed to predict the free-energy profiles of reactions catalyzed by the enzymes chorismate mutase and fluoroacetate dehalogenase. In total, AMP-BMS/MM was used to simulate proteins in the condensed phase for a cumulative 23 μs simulation time or 48 billion integration steps. This work establishes AMP-BMS as a highly efficient and accurate model for multiscale simulations of biomolecules.

HFE
Also flagged:atrial fibrillationBayés' syndromeFabry diseasecardiac conduction diseasesupraventricular arrhythmiaconduction
Journal Article 2026-07-01 ✓ 2 Snippets Kunce NE, Silva A, Haigney M, Kisling A.
In-Text Gene Mentions

…as cardiac sarcoidosis,hemochromatosis, Pompe disease, or…

…diac amyloidosis, sarcoidosis,hemochromatosis, Pompe disease, and…

Show Full Abstract

We present the case of a 72-year-old female with Fabry disease who developed an advanced interatrial conduction block and atrial fibrillation, a condition known as Bayés' syndrome. Fabry disease is an X-linked inherited lysosomal storage disorder that results in the accumulation of globotriaosylceramide in various organs, including the heart. While this condition has been shown to cause cardiac conduction disease, Bayés' syndrome as a result of Fabry disease has not been reported in the literature. This case report suggests that Fabry disease may precipitate atrial cardiomyocyte damage at Bachmann's bundle leading to interatrial block and supraventricular arrhythmia.

PCDH17
Also flagged:organizationnucleusneuropsychiatric disordersgene expressionaddictionneuropsychiatric disease
Journal Article 2026-07-01 ✓ 1 Snippet Ravichandran P, Bach SV, Phillips RA, Valentine MR, Eagles NJ, Du Y, Del Rosario I, AlGrain HA, Maguire SE, Miller RA, Divecha HR, Tippani M, Montgomery KD, Kleinman JE, Han S, Page SC, Hyde TM, Collado-Torres L, Battle A, Martinowich K, Hicks SC, Maynard KR.
In-Text Gene Mentions

PCDH17

Show Full Abstract

The nucleus accumbens (NAc) is a key component of the mesolimbic dopamine system that is implicated in several neuropsychiatric disorders. The NAc contains transcriptomically distinct medium spiny neuron (MSN) subtypes, but their spatial organization remains unclear. We generated a spatiomolecular atlas of the human NAc by integrating paired single-cell and spatial transcriptomics of postmortem NAc tissue. We identified transcriptionally unique cell populations and spatial domains (SpDs), including D1 islands composed of discrete MSN subtypes enriched for dopamine receptor D1 (DRD1) and OPRM1. We demonstrated continuous spatial gene expression gradients across the NAc and evolutionary conservation of spatial features. We also identified SpDs associated with risk for psychiatric and addiction-related traits and spatially mapped risk-associated ligand-receptor interactions. Finally, we predicted enrichment of drug-responsive transcriptional programs in both SpDs and cell types. Collectively, we provide a spatiomolecular framework for understanding the relevance of the human NAc in neuropsychiatric diseases.

SUDS3
Also flagged:colitisinflammatory bowel diseaseulcerative colitisCDinflammatory responsesimmune cell activation
Journal Article 2026-07-01 ✓ 1 Snippet Meng F, Zhang T, Meng X, Zhao W, Jin G, Zhao Y, Sun Z, Dai X, Chu F, Xiong J, Chen Q, Zhong W, Liu X, Wang B, Wu X, Cao H.
In-Text Gene Mentions

…Whilepolycomb repressiverepressive complexes are…

Show Full Abstract

Monocyte-macrophage transition is dysregulated in inflammatory bowel disease. While polycomb repressive complexes are crucial for maintaining cellular identity, their specific roles in colitis are poorly defined. Here, we show that Ring finger protein 2, a core catalytic subunit of polycomb repressive complex 1, regulates the monocyte-macrophage transition during colitis. It is highly expressed in the immature colon and circulating monocytes during ulcerative colitis. And mice with myeloid-specific deficiency exhibited attenuated experimental colitis, restored monocyte/macrophage balance, and improved anti-tumor necrosis factor alpha efficacy. Mechanistically, Ring finger protein 2 represses Runt-related transcription factor 3 expression via histone H2A lysine 119 monoubiquitination. This disrupts the inhibition of the recombination signal-binding protein for the immunoglobulin kappa J region, the central activator of the Notch pathway, thereby exacerbating inflammation. Silencing of the axis markedly inhibited proinflammatory responses, regulating monocyte-macrophage transition. These findings reveal that Ring finger protein 2 disrupts the monocyte-macrophage transition during colitis, offering insights into colitis treatments.

PTGIS
Also flagged:Short Rib Thoracic Dystrophychondrodysplasiascytoskeletonvesiclesorganellesmicrotubules
Journal Article 2026-07-01 ✓ 1 Snippet Antony D, Güleç EY, Klawonn A, Bakey Z, Schüle I, Kim GJ, Cathomen T, Skatulla I, Brunner HG, Arnold SJ, Schmidts M.
In-Text Gene Mentions

…Enpp2, Hgf, Cd36,Ptgis, Bmper, Cxcr4, Igf2,…

Show Full Abstract

Cytoplasmic Dynein-2 / IFT-dynein is the only known retrograde motor for intraflagellar transport. Dysfunction of the two intermediate dynein chains WDR34 and WDR60 causes Short Rib Thoracic Dystrophy (SRTD), a human skeletal chondrodysplasias with high lethality. However, individual protein functions are incompletely understood as complete loss of function of WDR34 or WDR60 is lethal in vertebrates and individuals with SRTD carry at least one putative hypomorphic missense allele. Gene knockout is therefore not suitable to study the effect of these human missense disease alleles. Therefore, using CRISPR single base editors, we recreate three different human disease missense alleles, including a novel WDR60 variant, p.Ala968Val identified in this study. Consistent with previous findings in the dynein-2 full loss of function models and patient fibroblasts, mutant cell lines show hedgehog signaling defects as well as disturbed retrograde IFT. Transcriptome analyses reveal differentially regulated expression of genes associated with various biological processes, including regulation of the actin cytoskeleton. Further, we observe differential regulation of genes associated with Golgi intracellular transport. In addition to providing cellular model systems enabling investigations of the effect of human SRTD disease alleles, our findings indicate non-ciliary functions for WDR34 and WDR60 in addition to the established roles as components of the retrograde IFT motor complex in cilia.

SOX6
Also flagged:Glioblastomabrain tumourtumourgliomasolid cancersimmunosuppression
Journal Article 2026-07-01 ✓ 1 Snippet Savage N, Grewal S, Shaikh MV, Zemp FJ, Mckenna D, Mikolajewicz N, Najem H, Pyczek J, Wei J, Taleb MAB, Asselstine LC, Anand A, Chafe SC, Zhai K, Maich WT, Chokshi CR, Patel H, Korman TE, Subapanditha M, Tabunshchyk Z, Tatari N, Miletic P, Chen D, Pacheco S, Omar AT, Wang B, Han H, Chan JA, Brown KR, Venugopal C, Kislinger T, Heimberger AB, Moffat J, Mahoney DJ, Singh SK.
In-Text Gene Mentions

…markers such asSox6and Hmga2 .…

Show Full Abstract

Glioblastoma is a lethal brain tumour for which current multimodal treatment rarely prevents recurrence<sup>1</sup>. Therapeutic failure is driven by extensive intratumoural cellular heterogeneity<sup>2</sup> with a microenvironment dominated by tumour-associated macrophages that sustain tumour growth and immunosuppression<sup>3</sup>. Although chimeric antigen receptor (CAR)-T cell therapies are being developed for glioblastoma, sustained response has been undermined by non-uniform antigen expression, antigen loss and microenvironmental barriers that are not directly engaged by tumour-targeting designs<sup>4</sup>. These limitations motivate new strategies that address the disease as a coupled tumour-immune system rather than a single malignant compartment. Here we use a multi-omic target discovery platform to identify GPNMB as a dual-compartment antigen in glioblastoma. Anti-GPNMB CAR-T cells showed potent anti-tumour activity, with long-term disease control in orthotopic patient-derived xenografts and syngeneic glioma models through concomitant depletion of GPNMB<sup>+</sup> tumour and immunosuppressive myeloid populations. By collapsing tumour control and microenvironmental reprogramming, these findings provide a new strategy for antigen selection and targeting in heterogenous, myeloid-rich solid cancers.

Also flagged:movement disorderbehaviouralHDinfectionlocomotionneurological disorders
Journal Article 2026-07-01 No Snippets Blumenstock S, Arakelyan D, Del Grosso N, Schneider S, Shao Y, Gjoni E, Klein R, Dudanova I, Komiyama T.
Show Full Abstract

Huntington's disease (HD) is a devastating movement disorder without a cure at present<sup>1</sup>. Although the monogenic basis of HD is well defined<sup>2</sup>, the complex downstream effects that underlie behavioural symptoms are poorly understood. These effects include cortical dysfunction<sup>3,4</sup>, yet the roles of specific cortical neuronal subtypes in HD symptoms remain largely unexplored. Here we used longitudinal in vivo two-photon calcium imaging to examine the activity of three cortical inhibitory neuron (IN) subtypes and excitatory corticostriatal (CStr) projection neurons in the motor cortex of the transgenic R6/2 HD mouse model throughout disease progression. We found that motor deficits in R6/2 mice were accompanied by neuron subtype-specific abnormalities in movement-related activity. This included marked hypoactivity of vasoactive intestinal peptide (VIP)-INs and CStr neurons, which was also observed in the knock-in zQ175DN HD mouse model. Optogenetic activation of VIP-INs in R6/2 mice restored healthy levels of activity in VIP-INs and their downstream CStr neurons and ameliorated motor deficits in R6/2 mice; behavioural improvements persisted for days after stimulation. Our findings highlight cortical INs as a potential therapeutic target for HD.

Also flagged:autismaxonscognitionaxon guidancecell–cell adhesionsynaptogenesis
Journal Article 2026-07-01 No Snippets Tsyporin J, Zhang M, Qi C, Segal A, Li X, Kim H, Choi SH, Pavlovic I, Bandiera S, Finn T, Kim SK, Shibata A, Nakamura T, Onishi K, Zhang Z, Hammarlund E, Su G, Salla N, Kachko J, Hawley C, Li S, Doyle DZ, Peng X, Nottoli T, Ruiz-Reig N, Tissir F, Nakagawa Y, Herzog E, Ma S, Gobeske K, Pattabiraman K, Shimogori T, Duque A, Fornito A, Huang H, Shibata M, Chen B, Sestan N.
Show Full Abstract

The cerebral cortex is organized along a dominant sensorimotor-to-association (S-A) axis, anchored by modality-specific primary sensorimotor areas at one end and transmodal association areas forming distributed networks that support abstract cognition at the other<sup>1-11</sup>. The developmental mechanisms shaping this axis remain unclear<sup>9-24</sup>. Here we present converging multispecies evidence supporting the multinodal induction-exclusion in network development (MIND) model, in which S-A patterning is governed by competing processes of induction and exclusion driven by two opposing transcriptomically defined programs. 'Pericentral' programs are induced around the frontotemporal poles, progress inwards toward the central regions of the undifferentiated neocortex and define higher-order association features. 'Central' programs are induced centrally through first-order sensorimotor thalamocortical inputs, establish primary areas and exclude pericentral programs. These conserved programs compete for space, resulting in compartmentalized expression of axon guidance, cell-cell adhesion, retinoic acid signalling, synaptogenesis, WNT signalling and autism-risk-associated genes. Notably, PLXNC1 and SEMA7A, a receptor-ligand pair representing pericentral and central programs, respectively, exhibit repulsive interactions between primary and higher-order association corticocortical axons. Induction and exclusion together establish an S-A organization in which primary areas emerge as focal islands within a broader ocean of distributed association networks. The MIND model provides a unifying framework for experimental, evolutionary and clinical phenomena, revealing induction and exclusion as antagonistic yet complementary principles shaping the S-A axis and processing hierarchies.

DCC
Also flagged:ADAlzheimer Diseaseneurodegenerative diseasesfrontotemporal dementiaParkinson diseasePD
Journal Article 2026-07-01 ✓ 2 Snippets Phillips B, Sanford J, Janve VA, Liu M, Johnson M, Gong K, Bergmann K, Lowery J, Flynn A, Brock W, Montejo BS, Sykora N, Budde J, Mellios N, Papageorgiou G, Sperling RA, Buckley RF, Seto M, Morris JC, Perlmutter JS, Kotzbauer PT, Perrin RJ, Hohman TJ, Ibanez L, Cruchaga C.
In-Text Gene Mentions

…quantify circular RNAs:DCC16 and CIRI2…

…found when usingDCC, CIRI2 or CIRI3…

Show Full Abstract

Detection of Alzheimer's disease (AD) before the development of clinical symptoms is critical for enabling the use of new treatments. Circular RNAs (circRNAs) are highly stable non-coding RNAs enriched in the brain that can cross the blood-brain barrier. Here, analyzing blood data from 1,221 individuals with AD and healthy individuals, we identified 34 circRNAs associated with AD status. A predictive model including these 34 circRNAs was comparable to plasma phosphorylated Tau-217 (pTau217) in classifying AD based on biomarker-confirmed (amyloid-β and Tau) status and replicated in independent samples from the Knight-Alzheimer Disease Research Center (n = 551: 76 AD, 475 cognitively unimpaired) and preclinical A4 (n = 1,767) cohorts. Classification of biomarker-confirmed status by blood circRNAs (area under the curve (AUC) = 0.945) had a higher predictive ability than plasma pTau217 (AUC = 0.877) and was further improved in the integrated model (circRNA+pTau217 AUC = 0.977). This model showed high AD specificity with low predictive power for Parkinson's disease, frontotemporal dementia, and other neurodegenerative diseases. In the Knight-Alzheimer Disease Research Center discovery cohort, these circRNAs (hazard ratio = 2.92) outperformed pTau217 (hazard ratio = 1.81) and amyloid-positron emission tomography when predicting progression to symptomatic AD. Although prospective validation in larger cohorts is needed, these results propose blood circRNAs as potential biomarkers for AD diagnosis and disease progression.

UNC13C
Also flagged:medulloblastomagene expressiontumorstumor
Journal Article 2026-07-01 ✓ 1 Snippet Amona EB, Sumy MSA, Jones T, Wang S, Mistry AM, Raj A, Donninger H, Yaddanapudi K, Kong M.
In-Text Gene Mentions

…COX10, FBLIM1, andUNC13C, reflecting roles in…

Show Full Abstract

Genetic, epigenetic, and transcriptomic analyses have stratified medulloblastoma (MB) into four canonical subgroups of Wingless Type (WNT), Sonic Hedgehog (SHH), and Group 3 and Group 4, with distinct patient profiles and prognoses. Recent classification strategies have also considered combining Group 3 and Group 4 tumors into a Non-WNT/Non-SHH subgroup to account for biological overlap and heterogeneity. Using high-dimensional gene expression data from 487 pediatric and young adult patients and over twenty-one thousand transcripts, this study explores which genes can improve prognostic accuracy for survival while accounting for molecular stratification, histological subtype, key oncogenic drivers (MYC and MYCN amplification), and established clinical covariates, including age group (< 3 vs. 3-21 years) and metastatic status. We then develop a multi-stage framework for identifying prognostic genes and evaluating modern survival modeling strategies. In the first stage, gene screening was performed using Benjamini-Hochberg adjusted Cox regression across false discovery rate (FDR) thresholds from 1% to 6%, with the number of retained genes increasing from 15 at 1% to 146 at 6% FDR. In the second stage, multiple survival models were evaluated, including LASSO, Elastic Net, Ridge regression, SCAD, MCP, PCA-Cox, and Random Survival Forests, using ten-fold cross-validation with the Integrated Brier Score as the primary calibration metric and the concordance index as a secondary discrimination measure. Although Ridge regression achieved the lowest prediction error at higher FDR thresholds, it did not perform variable selection and retained large gene sets, limiting interpretability. In contrast, the 6% FDR Elastic Net model provided an optimal balance between predictive accuracy and model sparsity while reducing the gene set from 146 to 49 genes, yielding an interpretable final multivariable model. Gene-level effects from the final Elastic Net-penalized Cox model revealed a clear prognostic gradient. Genes associated with poorer survival included FKBP4, CSNK2A2, GPC4, GATA3, NPY, LYPD1, CLCA4, and BNC2, which have been implicated in tumor progression, signaling pathways, and immune-related processes, whereas genes associated with improved survival included ZNF774, COX10, FBLIM1, and UNC13C, reflecting roles in cellular regulation and protective biological processes. These findings demonstrate that combining FDR-based screening with Elastic Net-penalized Cox modeling yields a robust, parsimonious, and biologically meaningful prognostic framework for medulloblastoma, achieving strong predictive performance while maintaining interpretability in high-dimensional genomic settings.

HFE
Also flagged:Insulin ResistanceIRfatty liver diseaseacanthosis nigricanshyperglycemiametabolic syndrome
Journal Article 2026-07-01 ✓ 1 Snippet Rozaik MM, Uddin MK, Mahmood SA, Sukonna SI, Nafian T, Aftab KA, Murshed KM, Azad MAK.
In-Text Gene Mentions

…Cholestatic liver disease,Hemochromatosis, portal HTN) were…

Show Full Abstract

<h4>Background</h4>In Bangladesh, the prevalence of MAFLD patients is about 33.86%. Most of the patients with MAFLD are also strongly associated with hepatic and adipose tissue insulin resistance (IR). Homeostasis model assessment of insulin resistance (HOMA-IR) is a simple and useful method for evaluating insulin resistance and β cell function.<h4>Methods</h4>This observational cross-sectional study was carried out in the outpatient department of Hepatology, Bangladesh Medical University. The subjects were non-alcoholic overweight patients with sonographic evidence of fatty liver disease aged 18 years or above. Participants were subjected to a pre-designed questionnaire including personal data. Assessment of medical history, physical examinations and investigations to measure IR were performed. Statistical analyses were carried out by using the SPSS version PC 26.0.<h4>Results</h4>The Majority of the participants, precisely 60% (95% confidence interval [CI]: 45.2, 73.6) had insulin resistance (IR) and median HOMA-IR index was 2.85. Patients with acanthosis nigricans had significantly higher IR biochemically (Mean HOMA-IR index; 5.79 vs. 2.89), which was significant statistically. No significant correlation was observed between HOMA-IR and alternative metabolic markers, including METS-IR, TG/HDL-c ratio and BMI.<h4>Conclusion</h4>A high frequency (60%) of insulin resistance was found among overweight, non-diabetic patients with MAFLD. This finding underscores the immense value of regular screening for hyperglycemia in this population. With the increasing burden of metabolic syndrome, early identification of IR would enable timely preventive interventions-potentially slowing the progression to type 2 diabetes and consequently reducing subsequent risk of developing diabetes-related complications.

Also flagged:Biliary Tract Cancergastrointestinal cancerinvasive adenocarcinomahepatobiliary cancertumorstumor
Journal Article 2026-07-01 No Snippets Takahashi T, Yanagimoto H, Akita M, Tsugawa D, Yoshida M, Ueda Y, Okazaki T, Ueno K, Miyazaki H, Otsubo I, Komatsu S, Fukumoto T.
Show Full Abstract

<h4>Background/aim</h4>Currently, the modified albumin-bilirubin (mALBI) grade, a novel liver function assessment, is used as a prognostic factor in many areas of gastrointestinal cancer. We evaluated whether mALBI grade predicted survival in a large multicenter cohort of patients who underwent curative-intent resection for biliary tract cancer (BTC).<h4>Patients and methods</h4>We retrospectively analyzed data for 634 patients who underwent curative resection for BTC at four centers during 2001-2023. The mALBI grade was calculated from preoperative albumin and total bilirubin levels. Cox proportional hazards regression was used to assess the association of mALBI grade with overall survival (OS) and recurrence-free survival (RFS) in a propensity score-matched cohort. The mALBI grade was defined by subdividing ALBI grade 2 at a cutoff of -2.27; patients with mALBI grades 1-2a were classified as the low mALBI group, and those with grades 2b-3 as the high mALBI group.<h4>Results</h4>After propensity score-matching, the high mALBI group remained associated with poorer OS (44 <i>vs</i>. 70 months; <i>p</i>=0.015) than the low mALBI group. Multivariate analysis revealed that high mALBI grade was independently associated with poor OS (hazard ratio=1.584, 95% confidence interval=1.077-2.331; <i>p</i>=0.020) and RFS (hazard ratio =1.447, 95% confidence interval=1.023-2.046, <i>p</i>=0.037).<h4>Conclusion</h4>A high mALBI grade was associated with shorter OS and RFS in patients with resected BTC. Preoperative mALBI grade is an important prognostic indicator for risk stratification and prognostic evaluation.

Also flagged:Chromatinbindingcorneal ulcer lesionscorneal ulcerdigestionEpithelial
Journal Article 2026-07-01 No Snippets Zhu L, Chen C, Lin Z, Liu J, Guo H, Tan J, Huang Y, Ou Z, Hu H, Liang J, Chen R, Ji J, Ouyang H, Wang L.
Show Full Abstract

<h4>Purpose</h4>To define the role and mechanisms of the epigenetic regulator CXXC1 in corneal epithelial cells (CECs) differentiation.<h4>Methods</h4>Chromatin remodeling-related gene ontology (GO) modules were integrated with RNA sequencing (RNA-seq) to identify CXXC finger protein 1 (CXXC1) as a candidate epigenetic regulator of CECs differentiation. Loss-of-function studies were performed in limbal stem/progenitor cells (LSCs), followed by air-liquid interface-induced differentiation into CECs. Effects of CXXC1 depletion were assessed by RNA-seq, quantitative real-time PCR, and immunofluorescence. Chromatin immunoprecipitation sequencing (ChIP-seq) for CXXC1 and H3K4me3 was combined with transcriptomics to identify insulin-like growth factor binding protein 6 (IGFBP6) as a direct target. The role and pathological relevance of the CXXC1-IGFBP6 axis were evaluated by IGFBP6 knockdown and in human corneal ulcer tissues.<h4>Results</h4>CXXC1 was expressed throughout the corneal epithelium and was markedly upregulated during LSC-to-CEC differentiation. CXXC1 depletion impaired differentiation and reduced expression of CECs markers and key corneal epithelial regulators. ChIP-seq revealed CXXC1 binding at the IGFBP6 locus, coinciding with H3K4me3 enrichment, whereas CXXC1 knockdown reduced both H3K4me3 enrichment and IGFBP6 expression. IGFBP6 knockdown phenocopied CXXC1 loss. Depletion of either gene activated inflammatory, angiogenic, and hypoxia-related gene programs, suggesting abnormal corneal epithelial differentiation and pathological changes. Both proteins were markedly reduced in human corneal ulcer lesions.<h4>Conclusions</h4>CXXC1 maintains CECs differentiation through H3K4me3-dependent activation of IGFBP6 and other epithelial regulators. The CXXC1-IGFBP6 axis is associated with pathological changes in corneal ulcer lesions.

UNC13C
Also flagged:gene expressionDepressionnucleusMajor Depressive Disorderneurogenesishippocampal atrophy
Journal Article 2026-07-01 ✓ 1 Snippet Geoghegan EM, Hagenauer MH, Hernandez E, Espinoza S, Flandreau EI, Nguyen PT, Santiago AN, Bhuiyan MR, Mensch S, Watson SJ, Akil H, Hen R.
In-Text Gene Mentions

…homolog C (Unc13c) was down‐regulated…

Show Full Abstract

Depression can be treated with traditional pharmaceuticals targeting monoaminergic function, nontraditional drug classes and neuromodulatory interventions. To identify mechanisms of action shared across clinically-effective antidepressant treatment categories, we performed two systematic meta-analyses of public transcriptional profiling data from adult laboratory rodents (rats, mice). The outcome variable was gene expression, measured by microarray or RNA-Seq from bulk-dissected tissue from two depression-related brain regions (hippocampus, cortex). Relevant datasets were identified in the Gemma database of curated, reprocessed transcriptional profiling data using predefined search terms and inclusion/exclusion criteria (hippocampus: June 24, 2024, cortex: July 10, 2024). Differential expression results were extracted for all genes, minimizing bias. For each gene, a random effects meta-analysis model was fit to antidepressant vs. control effect sizes (Log2 Fold Changes) from each study for each brain region, with follow-up analyses exploring sources of effect heterogeneity. For the hippocampus, 15 relevant studies were identified, containing 22 antidepressant vs. control group comparisons (collective n = 313 samples), with approximately half representing traditional versus nontraditional antidepressants. Of 16 439 analyzed genes, 58 were consistently differentially expressed (False Discovery Rate (FDR) < 0.05) following treatment. Antidepressant effects were enriched in the dentate gyrus and in gene sets related to stress regulation, brain growth and plasticity, vasculature and glia, and immune function. Comparisons with single nucleus RNA-Seq confirmed effects on specific hippocampal cell types, including potential rejuvenation of dentate granule neurons. For the cortex, 13 studies were identified, containing 16 antidepressant vs. control group comparisons (collective n = 233 samples). Of 15 583 analyzed genes, only one was consistently differentially expressed (FDR < 0.05: Atp6v1b2), but overall expression patterns moderately resembled the hippocampus. These genes and pathways showing consistent differential expression across treatment categories may be promising targets for novel therapies. Future work should explore relevance to human clinical populations and potential heterogeneity introduced by sex and subregion.

Also flagged:deathtight junctionsmembraneendothelial dysfunctionextracellularstroke
Journal Article 2026-07-01 No Snippets Nzobokela J, Muchaili L, Mangimela JK, Kirabo A, Masenga SK.
Show Full Abstract

Ischemic stroke remains a leading cause of death and disability worldwide, with blood-brain barrier (BBB) disruption playing a central role in vasogenic edema, neuroinflammation, hemorrhagic transformation, and secondary neuronal injury. The BBB is a specialized neurovascular unit composed of endothelial tight junctions, pericytes, astrocytes, and basement membrane structures that undergo coordinated molecular and cellular changes during ischemia-reperfusion injury, generating diverse biomarker signatures including endothelial dysfunction, oxidative stress, inflammatory mediators, and extracellular matrix remodeling. However, conventional biomarkers and imaging approaches fail to fully capture the dynamic and heterogeneous nature of BBB injury. Meaningful interpretation of BBB-derived biomarkers requires mechanistic understanding of their molecular and cellular origins, making the integration of BBB pathophysiology with computational modeling essential for clinically relevant translation. Recent advances in machine learning (ML) and deep learning (DL) enable integration of neuroimaging, molecular, clinical, and multi-omics data to characterize BBB dysfunction and improve prediction of stroke outcomes. ML-based models have demonstrated value in identifying BBB-related signatures associated with infarct progression, hemorrhagic transformation, and functional recovery, while deep neural networks enhance lesion segmentation and prognostic modeling. Despite this progress, challenges including data heterogeneity, limited longitudinal datasets, and model interpretability remain barriers to clinical translation. This review integrates the molecular and cellular mechanisms of BBB disruption with machine learning approaches for BBB biomarker profiling, highlighting a pathway toward biologically informed, personalized ischemic stroke management.

Also flagged:malignant peripheral nerve sheath tumorMPNSTtumorslocalized diseaseNF1pathogenesis
Journal Article 2026-07-01 No Snippets Aggerholm-Pedersen N, Handrup MM, Thomassen SB, Engelmann B, Kongstad KM, Jakobsen MV, Baad-Hansen T, Farholt S, Thomas D, Ejerskov C.
Show Full Abstract

<h4>Purpose</h4>While neurofibromatosis type 1 (NF1)-associated malignant peripheral nerve sheath tumor (nfMPNST) is often considered to have a particularly poor prognosis compared to sporadic malignant peripheral nerve sheath tumor (sMPNST), this assumption remains insufficiently substantiated. This study aimed to compare clinical characteristics, treatment outcome, and survival between nfMPNST and sMPNST in a nationwide Danish cohort.<h4>Patient and method</h4>We conducted a retrospective cohort study of patients with malignant peripheral nerve sheath tumor (MPNST) in Denmark from 2000 to 2020. NF1-associated cases were identified through a national NF1 registry, while sporadic cases of MPNST were extracted from the Danish Sarcoma Database. Clinical, pathological, and treatment data were supplemented by chart review and national pathology records. Survival outcomes were analyzed using Kaplan-Meier estimates and Cox proportional hazards models.<h4>Results</h4>A total of 146 patients were included, of which 42 had nfMPNST and 104 sMPNST. Patients with nfMPNST were significantly younger at diagnosis (median 37 [min-max: 12-73] vs 58 [min-max: 5-93] years, P < .001) and had larger tumors (>5 cm in 88% vs 50%, P < .001). Wide margin resection was achieved less often in nfMPNST (35% vs 66%, P = .003), and adjuvant radiotherapy was more commonly administered (61% vs 36%). Five-year overall survival for localized disease was significantly lower in nfMPNST (44% vs 63%, P = .03), with higher recurrence rates (69% vs 49%, P = .049) and shorter time to recurrence (median 2.2 vs 3.4 years). Among 27 sMPNST tumors analyzed by next-generation sequencing, 5 (19%) harbored pathogenic NF1 variants.<h4>Conclusion</h4>nfMPNST presents at a younger age with more aggressive features and worse outcomes compared to sporadic cases. These findings support the need for tailored surveillance and treatment strategies in NF1 patients and highlight the potential role of NF1 alterations in sMPNST pathogenesis.

Also flagged:autoimmune diseasesrheumatoid arthritisextracellularpsoriasismultiple sclerosisbinding
Journal Article 2026-07-01 No Snippets Chédotal H, Povlsen K, Narayanan D, Gotfredsen CH, Gajhede M, Bach A, Clausen MH.
Show Full Abstract

Tumor necrosis factor receptor 1 (TNFR1) plays a major role in immunoregulation. It is involved in inflammatory and autoimmune diseases like rheumatoid arthritis, psoriasis, Alzheimer's disease, and multiple sclerosis. However, few small-molecule inhibitors of TNFR1 have been reported, even though they constitute a good alternative to already existing antibody therapies targeting the TNF pathway. Here, we report the discovery of a new class of molecules for the extracellular domain of TNFR1 using a fragment-based approach through primary screening by NMR spectroscopy, followed by orthogonal validation by surface plasmon resonance (SPR) and X-ray crystallography. Guided by these results, we have synthesized 46 analogs with micromolar potency showing up to ∼10-fold improved affinity toward TNFR1 compared to the fragment hits. These results can provide a structural basis for the discovery of novel TNFR1 inhibitors in the future.

SERPINC1
Also flagged:ExtracellularVesiclevesiclesfertilizationendocytosiscoagulation
Journal Article 2026-07-01 ✓ 2 Snippets Furlan AO, Bridi A, Drum JN, Sousa LMMC, Almeida MC, Felix JS, Zutin LA, Santos IAD, de Athayde FRF, Scaramele NF, de Souza CA, Keohane PCP, Silveira JCD, Filho RS, Campos DB, Lopes FL.
In-Text Gene Mentions

…of SERPIND1 ,SERPINC1, and SERPINF2…

…expression of theSERPINC1and decreased expression…

Show Full Abstract

Establishing a successful pregnancy relies on effective communication between the mother and fetus. Small extracellular vesicles (sEVs) are pivotal in facilitating intercellular communication, transferring messenger RNA (mRNA), noncoding RNA (ncRNA), and proteins. Considering the prevalence of in vitro fertilization (IVF) in bovine production, despite its lower birth rate, we aimed to evaluate whether there are differences in transcript content in sEVs between pregnancies from artificial insemination fixed-time (FTAI) and in vitro fertilization-embryo transfer (IVF-ET). Uterine fluid was collected on Days 18 and 32 from AI- and IVF-derived pregnancies in beef cattle. sEVs were isolated, and total RNA was extracted for transcriptome and microtranscriptome analysis. Differences in transcript abundance were greatest when comparing Days 18 and 32 within the IVF-ET, suggesting that temporal changes in transcripts are highly influenced by reproductive technique. Gene set enrichment analysis showed 22 gene sets in IVF-ET18 x FTAI18, with mRNAs involved in embryonic pre-adhesion that may impair embryo fixation. In IVF-ET32 x IVF-ET18, target genes of differentially expressed (DE) microRNAs (miRNAs) were enriched in endocytosis pathway, while target genes of DE lncRNAs were enriched in complement and coagulation cascades pathway. In summary, sEVs derived from FTAI and IVF-ET pregnancies have different coding and noncoding transcript content, suggesting failures in maternal-fetal communication post-IVF.

PRDX6
Also flagged:Agingblindnessmitochondrialglaucomahyperglycemiadiabetic retinopathy
Journal Article 2026-07-01 ✓ 1 Snippet Zong Y, Fan Q, Qiu S, Zhang H, Cen Z.
In-Text Gene Mentions

…antioxidant defenses, notablyPrdx6, which precipitates ROS…

Show Full Abstract

Age-related eye diseases (AREDs)-including age-related macular degeneration (AMD), glaucoma, and diabetic retinopathy-are leading causes of permanent blindness. Current treatments manage clinical manifestations but do not halt the molecular processes that drive disease progression. This limitation has shifted attention toward "geroscience," a strategy that targets the fundamental biology of aging rather than treating each disease in isolation. Four key hallmarks of aging-mitochondrial dysfunction, loss of proteostasis, cellular senescence, and epigenetic drift-are widely implicated in AREDs. We review evidence that these hallmarks do not act independently; instead, they form an interactive, self-reinforcing network. The way this network engages differs from tissue to tissue. In the high-energy environment of the retinal pigment epithelium, mitochondrial dysfunction dominates and drives AMD. In the mechanically stressed trabecular meshwork (TM), senescence and epigenetic drift take precedence, leading to glaucoma. In the neurovascular unit, chronic hyperglycemia routes the same network into a metabolic-epigenetic amplification loop that sustains diabetic retinopathy. The same aging mechanisms, routed through distinct tissue contexts, thus produce divergent clinical phenotypes. We also evaluate emerging therapies, including senolytics, mitochondria-targeted agents, and partial epigenetic reprogramming, and identify key intervention nodes such as NLRP3, p62, and NAD⁺ metabolism. Dismantling these pathological feedback loops offers a path beyond symptom management toward combination strategies that restore tissue resilience.

Also flagged:acute respiratory distress syndromeARDSsepsisGene expressionhomeostasisinfection
Journal Article 2026-07-01 No Snippets Zhang R, Fu Y, Long F, Cheng Q.
Show Full Abstract

We hypothesized that acute respiratory distress syndrome (ARDS) and sepsis share hypoxia-related transcriptional signatures that reflect overlapping immunopathogenic mechanisms. This study aimed to identify shared hypoxia-related genes and associated regulatory features using bioinformatic analyses. Gene expression datasets GSE28750 and GSE76293 were analyzed separately after within-dataset normalization. Differentially expressed genes (DEGs) were defined using |logFC| > 1 and adjusted P < .05. Hypoxia-related genes were compiled from GeneCards, PubMed-curated studies, and molecular signatures database, harmonized by official gene symbols, and intersected with common DEGs from both datasets to identify hypoxia-related DEGs (HRDEGs). Gene ontology enrichment, gene set enrichment analysis, interaction network analysis, immune infiltration analysis, and protein-protein interaction analysis using STRING with a minimum interaction score of 0.400 were subsequently performed. Eleven HRDEGs were identified: capping actin protein, gelsolin-like, CKS2, CLU, FLVCR1, FUNDC1, HPSE, LCN2, MAPK14, PFKFB3, PLAC8, and TDRD9. Gene ontology enrichment suggested involvement in cellular iron ion homeostasis- and iron ion transport-related processes. Gene set enrichment analysisindicated enrichment of hypoxia- and inflammation-related pathways. Under the stricter STRING threshold (score ≥ 0.400), the protein-protein interaction network showed a limited but biologically plausible interaction pattern among the HRDEGs. Predicted miRNA, ribonucleic acid-binding protein, transcription factor, drug, and immune infiltration analyses further suggested that these genes may participate in inflammatory and immune regulatory processes relevant to ARDS and sepsis. This bioinformatic study identified shared hypoxia-associated genes in ARDS and sepsis and generated testable hypotheses regarding their possible regulatory and immunologic relevance. These findings should be interpreted as exploratory and warrant experimental validation in future studies.

HTT
Also flagged:ulcerative colitisinflammatory bowel diseaseautoimmune diseaseimmune responsescolorectal cancermembranes
Journal Article 2026-07-01 ✓ 1 Snippet Chen Y, Luo M, Li K.
In-Text Gene Mentions

…family that mediatesHTTpalmitoylation. […

Show Full Abstract

This study explores the potential mechanisms between palmitoylation and ulcerative colitis (UC) through Mendelian randomization, bioinformatics analysis combined with eQTL and protein quantitative trait loci. This study selected a dataset of 5034 UC patients from the Finnish database and conducted Mendelian randomization analysis with palmitoylation target genes to explore the causal relationships between the two. Sensitivity and pleiotropy tests were performed alongside bioinformatics analysis to screen for the best target genes, ensuring the robustness of the results. Finally, immune cells were included for mediation analysis between palmitoylation and UC to explore potential mechanisms. Through Mendelian randomization analysis combined with sensitivity and pleiotropy tests, 5 target genes related to palmitoylation were identified to have a significant causal relationship with UC. Subsequent bioinformatics analysis confirmed ZDHHC13 and PPT1 as potential gene targets. By including immune cells in the mediation analysis, it was ultimately found that there is a potential mechanism involving ZDHHC13, CD62L- monocyte AC, and UC. There is a significant causal relationship between palmitoylation and UC. Furthermore, the palmitoylation gene ZDHHC13 can regulate CD62L- monocyte AC immune cells, inhibiting the occurrence of UC.

OLFM4
Also flagged:SepsisSeptic Shockimmune responseinfectiongene expression
Journal Article 2026-07-01 ✓ 1 Snippet Yu F, Lou S, Wei W, He H.
In-Text Gene Mentions

…articipating biomarkers ELANE,OLFM4, and MMP8) and…

Show Full Abstract

<h4>Background</h4>Sepsis is a serious condition resulting from an uncontrolled immune response to infection, often leading to organ dysfunction and septic shock. Current biomarkers have limitations in reflecting disease severity. Recent advances in gene expression analysis suggest that identifying novel biomarkers could improve early diagnosis and intervention, potentially enhancing patient outcomes in sepsis and septic shock.<h4>Methods</h4>A whole blood RNA-Seq dataset was obtained from the public database, consisting of samples from sepsis, septic shock, and healthy control groups. Hub genes were identified using differential expression analysis and weighted gene co-expression network analysis. Functional analysis was performed using Gene Ontology and Gene Set Enrichment Analysis. Expression levels of each hub gene across different groups were compared. Biomarkers were identified and predictive models for sepsis and septic shock were constructed using stepwise regression and logistic regression. The models were validated using external datasets.<h4>Results</h4>Nine hub genes were identified, with expression levels showing an upward trend in sepsis and septic shock samples. These hub genes were enriched in pathways related to the innate immune system and neutrophils. Predictive models for sepsis (with participating biomarkers ELANE, OLFM4, and MMP8) and septic shock (with participating biomarker COL17A1) demonstrated good diagnostic efficacy during validation.<h4>Conclusions</h4>This study identified biomarkers and developed predictive models for early identification of sepsis and septic shock, which could improve patient prognosis. Further investigations are needed to understand the underlying mechanisms of these biomarkers in sepsis.

Also flagged:Synapsesneurodevelopmental disorderscognitive disorderscognitionbindingpsychiatric disorders
Journal Article 2026-07-01 No Snippets Volk LJ.
Show Full Abstract

KIBRA (WWC1) has been a subject of scientific interest and investigation for almost two decades following its initial association with nonpathological variation in human memory performance. Work in a variety of animal models confirms that KIBRA supports memory function and demonstrates that regulation of AMPA-type glutamate receptors is a key mechanism by which KIBRA modulates neuronal function. KIBRA is a scaffolding protein at excitatory synapses, and its interactome is enriched for proteins that regulate AMPA receptor (AMPAR) trafficking and synaptic plasticity as well as neurodevelopmental disorders. Here, I provide a comprehensive discussion of known and potential mechanisms by which KIBRA and its interactome regulate adaptive brain function, encompassing AMPAR trafficking, synaptic plasticity, and experience-induced modification of circuit dynamics. Disrupted KIBRA function is implicated in a variety of cognitive disorders, and I review mechanisms by which KIBRA may contribute to neuropathology as well as recent work suggesting that KIBRA manipulation may be a target for cognitive enhancement. I expand the discussion to include recent data identifying the KIBRA homolog WWC2 as a regulator of GABA<sub>A</sub> receptor expression at inhibitory synapses. In contrast to their distinct roles at excitatory and inhibitory synapses, KIBRA and WWC2 promote dendritic arborization in a non-redundant manner, and I discuss potential shared mechanisms by which WWC proteins regulate neuronal morphology as well as evidence that this function of WWC proteins may be disrupted in neurodevelopmental pathology.

Also flagged:synthesisvesiclesmembraneconjugationCell proliferationAcylation
Journal Article 2026-07-01 No Snippets Dei L, Cadeddu S, Taillefumier C, Migone C, Fabiano A, Piras AM, Santangelo MC, Di Pietro S, Di Bussolo V, Angelici G.
Show Full Abstract

A convergent synthetic approach has been developed to access a potentially wide library of amphiphilic glycopeptoids. The intrinsic modularity of apolar peptoid units, coupled with the ability to conjugate various two-headed monosaccharide units, enables the exploration of a vast chemical space for the precise regulation of amphiphilic properties and the formation of diverse nanomaterials through self-assembly. A full characterization of the physical and chemical properties of the self-assembled materials obtained has been conducted on some representative molecular structures designed for the formation of aggregates. The comprehension of the relation between the molecular structure of this family of amphiphilic compounds and their self-assembly could lead to the "on demand synthesis" of functional excipient for drug delivery or compounds for the stabilization and crystallization of membrane proteins.

Also flagged:sensinglocalisationcytoplasmicexosomeAlzheimer'sALS
Journal Article 2026-07-01 No Snippets Tani H.
Show Full Abstract

Engineering RNA stability has become a cornerstone of modern therapeutics, almost entirely in one direction: mRNA vaccines established stabilisation of exogenous transcripts as a powerful design axis. The symmetric operation-exploitation of instability in endogenous targets-has been comparatively underexplored. We argue that target RNA half-life is an underused but quantitatively consequential design parameter for antisense oligonucleotide (ASO) therapeutics, and that short-lived long noncoding RNAs (lncRNAs) are a particularly attractive target class. Under sustained ASO dosing, the time to a new steady state is set by the sum of the target's own decay rate and the ASO-induced decay rate, so-for a given depth of knockdown-endogenous half-life becomes a major determinant of pharmacodynamic onset alongside ASO potency and delivery, most directly for RNase H-dependent gapmers; we treat the resulting first-order relationships as a qualitative design heuristic rather than a quantitative pharmacokinetic/pharmacodynamic model. Two back-to-back 2012 surveys-BRIC-seq in human HeLa and actinomycin-D microarray in mouse Neuro-2a-yielded similar median lncRNA half-lives of 3.4 and 3.5 h, with a short-lived fraction we term short-lived noncoding transcripts (SLiTs; t<sub>1/2</sub> < 4 h). SLiTs include several disease-relevant regulators (GAS5, NEAT1, CDKN2B-AS1/ANRIL, HOTAIR, TUG1); their rapid turnover supports fast onset, reversibility and tight titratability. We (i) develop a kinetic framework for how target half-life shapes ASO pharmacodynamic onset, (ii) survey the cross-species half-life landscape, (iii) propose a decay-pathway-aware ASO design framework aligning modality choice with endogenous decay machinery, (iv) re-read representative clinical ASO cases (nusinersen, tofersen, tominersen, MALAT1 ASOs) through the half-life lens, and (v) outline a half-life-aware preclinical roadmap. Treating half-life symmetrically-engineered up in vaccine RNAs, exploited downward in endogenous targets-highlights a largely unoccupied design space for next-generation oligonucleotide therapeutics.

DARS2
Also flagged:Lipogenesisaginglipid dropletsynthesisatrophyadipocyte differentiation
Journal Article 2026-07-01 ✓ 1 Snippet Huang T, Huang Y, Zhou Y, Lu X, Yang L, Yu J, Sheng Y, Xia F, Ding G, Lv Y, Lv S.
In-Text Gene Mentions

…intestine‐specific knockout ofDARS2(encoding aspartyl‐tRNA synthe…

Show Full Abstract

Age-related subcutaneous adipose tissue (SAT) atrophy is a hallmark of aging, contributing to metabolic dysfunction and systemic aging. The mechanisms underlying SAT atrophy and potential therapeutic strategies remain poorly understood. Here, we report that small intestinal epithelium-derived exosomes (SI-Exos) mediate gut-adipose communication and play a pivotal role in age-related SAT remodeling. We found that the miRNA cargo of SI-Exos undergoes significant age-related changes. Administration of young SI-Exos to aged mice enhanced lipid droplet formation, reversed SAT atrophy, and reduced inflammation in visceral adipose tissue (VAT). These beneficial effects were mediated by young SI-Exos targeting PDGFRα<sup>+</sup> progenitor cells, the major adipocyte precursors in SAT. Mechanistically, young SI-Exos were enriched with miR-379-5p, which targeted Usp34, a negative regulator of lipogenesis. Inhibition of Usp34 downregulated the Wnt/β-catenin pathway, promoting lipid droplet formation and differentiation of PDGFRα<sup>+</sup> progenitor cells. Single-cell RNA sequencing analysis further confirmed that young SI-Exos enhanced lipid transport and synthesis in SAT cell populations. Additionally, NK cells were increased. Our findings reveal a previously unrecognized role of SI-Exos in regulating SAT progenitor cell dynamics through the miR-379-5p/Usp34/Wnt/β-catenin axis, offering a potential therapeutic strategy for combating age-associated SAT atrophy and promoting healthy aging.

Also flagged:tumorcatalytic activitycancerdephosphorylationphosphorylationmembrane
Journal Article 2026-07-01 No Snippets Leonard TA.
Show Full Abstract

PH domain leucine-rich repeat protein phosphatases 1 and 2 (PHLPP1/PHLPP2) have, for more than 20 years, been described as Akt phosphatases and tumor suppressor genes. Approximately 200 PubMed-indexed articles have been published on the topic, including efforts to pharmacologically inhibit PHLPP in disease settings. A recent study, however, presents evidence that PHLPP is actually a pseudophosphatase with no catalytic activity. These observations question its reported role in cancer. The designation of PHLPP1 and PHLPP2 as pseudophosphatases necessitates both a critical examination of the literature and new hypotheses for the biological function of these ancient proteins. Here, we review the emergence of PHLPP1 and PHLPP2 as cellular signal transducers, critically examine the evidence for their reported phosphatase activity and tumor suppressor functions, and propose steps to elucidate their biological functions.

Also flagged:synthesismetabolismmembraneAlzheimer's diseaseParkinson's syndromecancer
Journal Article 2026-07-01 No Snippets Zhang Z, Jin L, Wei Y, Ding G.
Show Full Abstract

A new cholic acid-salicylaldehyde conjugate, probe CASA, was facilely constructed through one-step esterification. The probe sensitively and selectively detected both N<sub>2</sub>H<sub>4</sub> and pH, with the salicylaldehyde group as the sensing site. Based on the combined AIE/ESIPT mechanism, the probe exhibited a yellow-green turn-on fluorescent response to N<sub>2</sub>H<sub>4</sub> with a low detection limit of 26 nM and a rapid detection time of 10 min. Through the ICT process, the probe displayed a light blue turn-on fluorescence signal for neutral pH variations in a linear range of 5.0-7.8 with a pK<sub>a</sub> value of 6.26. The microstructural attributes of the probe during assembly could elucidate the recognition processes. Probe CASA enabled quantitative analysis of N<sub>2</sub>H<sub>4</sub> and pH in real environmental samples. A smartphone-assisted sensing system and probe-coated portable test strips were developed to facilitate convenient and on-site testing. Additionally, the probe possessed excellent biocompatibility and low cytotoxicity, making it possible to monitor the changes of N<sub>2</sub>H<sub>4</sub> and pH within living cells. This dual-channel N<sub>2</sub>H<sub>4</sub>-pH independent detection can prevent spectral crosstalk, facilitate instrument simplification, and provide a more intelligent and reliable analytical toolkit for complex systems. The findings are anticipated to provide more innovative strategies of highly efficient fluorescent probes for multi-analyte detection.

DCC
Also flagged:neuron migrationextracellularneurogenesisaxonsaxonneuron development
Journal Article 2026-07-01 ✓ 4 Snippets Madhusudan S, Eskici N, Gomez-Sanchez C, Pulli K, Vaaralahti K, Yellapragada V, Conway JRW, Wang Y, Raivio T.
In-Text Gene Mentions

…( 33 ),DCC( 34 ),…

…migration, such asDCC( 36 ,…

…SEMA3E, PLXNA4, UNC5C,DCC, and DSCAM (…

…( 53 ),DCC( 34 ,…

Show Full Abstract

Gonadotropin-releasing hormone (GnRH) neurons regulate the hypothalamic-pituitary-gonadal (HPG) axis and are required for puberty onset and reproductive competence. However, the transcriptional regulators governing GnRH neuron specification and migration remain poorly defined. The homeodomain transcription factor DLX5 is expressed in fetal human GnRH neurons, its expression precedes that of GNRH1 in human pluripotent stem cell (hPSC)-derived GnRH neurons, and in mice, it serves as a guidance cue for GnRH neuron migration. We hypothesized that DLX5 may act as an upstream regulator of human GnRH neuron fate specification and migratory capacity. Using CRISPR activation, we upregulated DLX5 during FGF8b-directed differentiation of hPSCs to GnRH neurons via dual SMAD inhibition and Notch inhibition, as previously described. DLX5 activation increased neural progenitor motility (P < 0.001), upregulated FGF8 (P < 0.05), and induced GABAergic markers, including GAD1 and GAD2. Notably, DLX5 activation induced GNRH1 in the absence of exogenous FGF8b (P < 0.05), suggesting that in GnRH neurons, DLX5 regulates FGF8. When combined with exogenous FGF8b, DLX5 activation produced distinct neuronal patterning accompanied by upregulation of extracellular matrix genes, such as SPARC, which has been implicated in neurite outgrowth. Collectively, these data indicate that activation of DLX5 promotes GnRH neurogenesis from hPSCs, by driving GABAergic fate, inducing FGF8, and remodeling the extracellular matrix.

OLFM4
Also flagged:pathogenesisgastric cancerGastric Intestinal Metaplasianeoplasmcancerchronic active gastritis
Journal Article 2026-07-01 ✓ 1 Snippet Li F, Wen H, Ren F, Zheng P, Liu S.
In-Text Gene Mentions

…( LGR5 ,OLFM4, ASCL2 ,…

Show Full Abstract

Gastric intestinal metaplasia (GIM) is a crucial precancerous lesion with ill-defined drivers, and identifying regulators of its early proliferation and reprogramming is key to interception. We integrated epigenomic-transcriptomic analysis of human GIM and normal tissues, validated targets via dual-luciferase assay, and mapped cellular heterogeneity by single-cell RNA sequencing of patient-derived gastric organoids. Functional validation using organoids included STAT3 knockdown assessed by qRT-PCR and immunofluorescence. STAT3 was identified as a top regulator of hypomethylated, upregulated genes in GIM and directly transactivated CCND2. Single-cell analysis revealed a dominant proliferative "Cycling GIM-precursor" population co-expressing STAT3/CCND2. STAT3 knockdown reduced CCND2 and intestinal markers (CDX2, MUC2) in GIM organoids. The STAT3-CCND2 axis is central to early GIM pathogenesis, offering targets for early detection and chemoprevention of gastric cancer.

SERPINC1
Also flagged:coagulationcomplement activationglucosemetabolismbile acidAging
Journal Article 2026-07-01 ✓ 2 Snippets Huang YL, Lee WJ, Lee PL, Peng LN, Hsiao FY, Chen LK.
In-Text Gene Mentions

…IGFALS, SAA1, APOC4,SERPINC1, HABP2, and INHBC.…

…FETUB, KLKB1, andSERPINC1have also been…

Show Full Abstract

Quantifying biological aging requires biomarkers that capture multisystem physiological decline beyond chronological age. We aimed to compare the prognostic performance of plasma proteomics, metabolomics, and conventional clinical risk factors for all-cause mortality, and to characterize molecular pathways associated with mortality risk and age-related physiological decline. Untargeted plasma proteomics and metabolomics were profiled in 848 community-dwelling adults from the I-Lan Longitudinal Aging Study (ILAS), followed for a mean of 8.5 years, during which 92 deaths occurred. Cox proportional hazards models were applied to identify mortality-associated molecular features and their enriched biological pathways. We identified 79 proteins associated with all-cause mortality (FDR < 0.1), predominantly liver-derived and immune-related. Pathway analysis revealed coordinated dysregulation across coagulation cascades, complement activation, oxidative stress responses, glucose metabolism, and bile acid metabolism. Elastic net regression was subsequently used to construct omics-based mortality risk scores, which were further evaluated in an independent validation cohort from the Longitudinal Aging Study of Taipei (LAST). A 20-protein mortality score achieved strong discrimination (C-index 0.81), outperforming metabolite-based models (C-index 0.77) and clinical risk factors (C-index 0.73) in the discovery cohort. In the external validation cohort, both proteomic- and metabolomic-derived scores showed directionally consistent associations with mortality risk. Together, these findings identify liver- and immune-enriched molecular signatures associated with mortality risk in older adults and support the utility of plasma multi-omics profiling as a scalable precision tool for biological age assessment. The identified proteomic and metabolomic pathways may help inform future interventions targeting systemic aging and age-related functional decline.

Also flagged:ADSynthesisfibrilscognitionAmyloidAlzheimer
Journal Article 2026-07-01 No Snippets Acosta-Guzmán P, Bedoya-Malagón D, Mercado-Coy L, Morantes SJ, Guevara-Pulido J.
Show Full Abstract

Nonsteroidal anti-inflammatory drugs (NSAIDs), such as ibuprofen, naproxen, and indomethacin, have reduced amyloid beta (Aβ) levels and improved cognitive function in mouse models of Alzheimer's disease (AD). The objective of the current research is to evaluate different NSAIDs using computer-aided drug design (CADD) to explore their potential as new treatments for AD. CADD is an advanced technique for designing biologically active molecules and involves two primary approaches: structure-based virtual screening and ligand-based virtual screening. After identifying the NSAID with the highest affinity for amyloid Aβ1-42 fibrils (PDB 2BEG), we designed analogs through bioisosteric modifications. Twenty derivatives were created, and two carprofen analogs with the most promising properties were synthesized, yielding 75% success with compound A-1 and 70% with compound A-2. These analogs exhibited lower predicted IC<sub>50</sub> values (1.57 μM) and more negative interaction energies (-6.43 and -6.67 kcal/mol for A-1 and A-2, respectively) compared to carprofen. Safety evaluations in L929 cells indicated that these compounds were safe at concentrations of 40 µM. In conclusion, two carprofen analogs were successfully designed and synthesized, demonstrating higher affinity for the amyloid Aβ1-42 fibrils, better-predicted IC<sub>50</sub> values than carprofen, and safety in the L929 in vitro assay.

Also flagged:gene expressionpolymerasepost‐translational modificationshydroxylcytoplasmicribonucleic acid
Journal Article 2026-07-01 No Snippets Desind SZ, Bell SK, Lutz CS.
Show Full Abstract

Noncoding RNAs (ncRNAs) are a diverse and abundant class of molecules that play essential roles in gene regulation across eukaryotic organisms, including roles in human homeostasis and disease. Historically regarded as transcriptional artifacts or byproducts, ncRNAs are now recognized as essential regulators of transcriptional and post-transcriptional processes that shape cellular homeostasis and disease phenotypes. We outline the historical discovery, classification, and functional diversification of many classes of ncRNAs, with a focus on long noncoding RNAs (lncRNAs) and microRNAs (miRNAs). We summarize the current understanding of miRNA and lncRNA biogenesis, processing, and key mechanisms of action, including miRNA-lncRNA interactions and structure-dependent regulatory functions of lncRNAs. Emphasis is placed on the dynamic interplay between lncRNAs and miRNAs, their roles in fine-tuning gene expression networks, and how advances in transcriptomics, chemical probing, and structural biology have transformed our understanding of ncRNA regulatory complexity. Finally, we summarize the current landscape of RNA therapeutics. This analysis maps the historical evolution of ncRNA biology, the establishment of ncRNAs as integral regulators of gene expression and disease phenotype, and the emerging prevalence of RNA-based therapeutic strategies.

SUDS3
Also flagged:Lactylationmacrophage activationgene-expressionpathogenesislactatemetabolism
Journal Article 2026-07-01 ✓ 1 Snippet Ma C, Han J, Tian Y.
In-Text Gene Mentions

…generally classified intolinker histoneshistones (H1) and…

Show Full Abstract

As an emerging epigenetic modification, lactylation has attracted increasing attention in studies of macrophage activation in recent years. Accumulating evidence indicates that lactylation not only regulates macrophage gene-expression programs and polarization trajectories, but also contributes to the pathogenesis and prognosis of a wide range of diseases. In this review, we summarize fundamental concepts related to lactate metabolism and protein lactylation, and we discuss how lactylation shapes macrophage function and plasticity, with particular emphasis on its mechanistic roles under distinct pathophysiological conditions. In addition, we examine the regulatory networks through which lactylation modulates macrophage polarization and highlight its potential translational applications in clinical intervention. Collectively, this review aims to provide updated insights and therapeutic perspectives to support disease prevention, delay progression, and improve patient outcomes. We also emphasize the limitations of causal inference in current studies, contextualize the classical M1/M2 nomenclature, and synthesize how lactate flux, microenvironmental cues, thresholds of lactylation, and writer/eraser/reader balance may determine divergent disease outcomes.

Also flagged:immune responsesgastric cancerlocalizationphosphorylationtumortranslational modifications
Journal Article 2026-07-01 No Snippets Li Q, Peng Y, Liu D, Ma X, Wu Y.
Show Full Abstract

The cGAS-STING pathway represents a crucial component of innate immune responses and has been increasingly recognized as a pivotal regulatory mechanism governing gastric cancer progression and therapeutic resistance. This comprehensive review synthesizes current knowledge regarding the mechanisms through which Post-Translational Modifications (PTMs) modulate the activity, stability, and subcellular localization of cGAS and STING proteins, encompassing phosphorylation, ubiquitination, acetylation, SUMOylation, and palmitoylation. These PTMs function as pivotal regulators that maintain the delicate balance between immune activation and suppression within the tumor microenvironment, directly influencing tumor immune evasion, proliferation, and metastatic potential. Furthermore, we critically examine the dual role of the cGAS-STING pathway in gastric cancer, highlighting its context-dependent anti-tumor and pro-tumor effects. We also investigate potential therapeutic strategies targeting post-translational modifications to restore or potentiate cGAS-STING signaling, which could substantially enhance the efficacy of chemotherapy, radiotherapy, targeted therapy, and immunotherapy. Our comprehensive analysis underscores the substantial prognostic and therapeutic promise of PTM-directed interventions for gastric cancer management, providing a valuable foundation for future mechanistic research and clinical translation.

Also flagged:AtherosclerosisASchronic inflammatory diseasechromatininflammatory responsesmembrane
Journal Article 2026-07-01 No Snippets Wei Y, Zhang F, Liao Y, Zhao Y, Guo J.
Show Full Abstract

Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid metabolic dysregulation and vascular cell phenotypic switching. Its progression is governed by intricate interactions between immune and vascular cells within multi-layered molecular networks. This review synthesizes recent evidence on the specific roles of key regulatory proteins in atherogenesis. We first examine how epigenetic modifiers, notably histone deacetylases, Sirtuins, EZH2, and TET2, remodel chromatin to activate pro-inflammatory gene programs. Subsequently, we delineate how critical transcription factors, such as KLFs, PPARs, Nrf2, and BACH1, couple metabolic homeostasis with anti-inflammatory responses. Furthermore, we detail how specific membrane signaling axes, including Eph receptors, Notch, and the SIRPα-CD47 checkpoint, alongside RIPK-mediated cell death pathways, govern endothelial dysfunction, macrophage polarization, and efferocytosis. We also discuss the contributions of UCP and ANGPTL proteins to cellular metabolism and inflammasome regulation. Notably, we propose an integrative perspective on cross-tier signaling crosstalk, highlighting complex feedback loops among histone deacetylases, KLFs, and Eph receptors that amplify vascular inflammation. Ultimately, comprehensively elucidating these immuno-vascular networks will pave the way for next-generation, precision-targeted therapies to mitigate the global burden of cardiovascular disease.

HFE
Also flagged:IronThalassemiaHyperferritinemiaβ-thalassemia traitliver diseaseLiver cirrhosis
Journal Article 2026-07-01 ✓ 5 Snippets Risca G, Mariani R, Botti M, Pelucchi S, Galimberti S, Piperno A.
In-Text Gene Mentions

…higher frequency ofHFEand non-HFE iron-related…

…of HFE and non-HFEiron-related genotypes (risk…

…of Metabolic Alterations,HFEGenotypes, and Cirrhosis…

…the role ofHFEvariants (p.C282Y and…

…in patients withHFE-hemochromatosis homozygous fo…

Show Full Abstract

<h4>Background</h4>An increased serum ferritin is a frequent finding in adults with β-thalassemia trait (BTT). However, whether such an increase is associated with a proportional increase in iron stores is unclear.<h4>Objectives</h4>We aimed to evaluate liver iron stores in a consecutive cohort of BTT with hyperferritinemia who underwent magnetic resonance imaging (LIC<sup>MRI</sup>) for clinical purposes.<h4>Methods</h4>Sixty-six BTT subjects with hyperferritinemia were studied. Clinical, biochemical, and genetic evaluations were done to assess the cause of hyperferritinemia. LICMRI was classified as: grade-1= ≤3 mg/g (normal/mild); grade-2= >3≤7 mg/g (moderate); grade-3= >7 (severe).<h4>Results</h4>80.3% showed normal/mild (n=29, 43.9%) or moderate LIC<sup>MRI</sup> (n=24, 36.4%), while 19.7% (n=13) showed values >7 mg/g. The latter had lower haemoglobin concentration (p=0.004) and higher transferrin saturation and ferritin compared to subjects with lower LIC<sup>MRI</sup> (p<0.001), while steatotic liver disease was more frequent in subjects with lower LIC<sup>MRI</sup> grades (p=0.012). Liver cirrhosis was significantly more frequent in subjects with moderate/severe than in those with lower LIC<sup>MRI</sup> grades (p=0.001 and p=0.025, respectively). We found a higher frequency of HFE and non-HFE iron-related genotypes (risk genotypes) in LIC<sup>MRI</sup> grades 2-3 compared to none in LIC<sup>MRI</sup> grade 1 (p=0.003 and p<0.0001, respectively). A regression analysis identified risk genotypes, liver cirrhosis, and BMI as significantly associated with LIC<sup>MRI</sup>.<h4>Conclusions</h4>Hyperferritinemia is common in BTT subjects, but major iron overload is limited to a minority of cases. They present associated genetic and acquired causes of iron accumulation and increased risk of liver damage.

POU3F2
Also flagged:metabolismalcohol dependencealcohol use disorderanxietybehavioraldepression
Journal Article 2026-07-01 ✓ 1 Snippet Ge Y, Yuan Y, Li M, Huang Z, Zhang C, Yu C, Xu J, Zhang S, Guo H, Zhang X, Fu R, Ren Z.
In-Text Gene Mentions

…Slc38a1 , andPou3f2, suggesting potential…

Show Full Abstract

<h4>Background</h4>The central amygdala (CeA) is closely associated with the development of alcohol dependence by mediating negative affective and stress responses during alcohol withdrawal. Chronic alcohol disrupts CeA neuroimmune balance and lipid metabolism, accelerating alcohol use disorder (AUD), but the regulatory mechanisms remain unclear. This exploratory study aimed to identify CeA key genes associated with AUD and investigate their potential involvement in mediating these dysregulations.<h4>Methods</h4>Based on the GSE31708 dataset, differential gene analysis, protein-protein interaction (PPI) network, random forest, and LASSO regression were used to screen hub genes. Adult male Long-Evans rats were trained to consume alcohol over 8 weeks; open field test (OFT) and elevated plus maze (EPM) assessed withdrawal-induced anxiety, and RT-qPCR validated candidate genes. CIBERSORT analyzed immune cell composition, co-expression networks delineated molecular interactions, and Mendelian randomization (MR) explored potential genetic associations.<h4>Results</h4>Hub gene <i>Cbr4</i> was found to be significantly upregulated in the CeA of AUD subjects. Preliminary <i>in vivo</i> validation revealed increased <i>Cbr4</i> expression in alcohol-withdrawn rats, and a negative correlation was observed between <i>Cbr4</i> expression and anxiety-like behavioral parameters. Mendelian randomization analyses suggest that <i>Ephx2</i> -a pivotal molecule in the co-expression network-has a genetic association with <i>Cbr4</i> (OR = 1.32, 95% CI = 1.15-1.51, <i>p</i> = 0.031). Immune infiltration analysis indicated reduced regulatory T cell (Treg) levels in AUD subjects, with <i>Cbr4</i> expression showing a negative correlation with Treg abundance. Multiple Treg subtypes appeared to be associated with a protective effect against AUD (OR = 0.9744-0.9797, <i>p</i> = 0.036-0.043).<h4>Conclusion</h4>Our findings suggest that <i>Cbr4</i> in the CeA may play a role in the pathological processes of AUD. It may contribute to AUD development through two potential mechanisms: a possible genetic interaction with <i>Ephx2</i>, and a negative association with Treg abundance, which may be associated with dysregulation of CeA neuroimmune homeostasis. These preliminary observations provide a basis for further investigation into <i>Cbr4</i> as an exploratory molecular indicator for AUD.

CACNA1E
Also flagged:maturity onset diabetesMODYtype 2 diabetes mellitussynaptic vesicleDiabetes of the YoungMaturity-onset diabetes of the young
Journal Article 2026-07-01 ✓ 1 Snippet Moscona-Nissan A, Marrero-Rodríguez D, Andonegui-Elguera S, Luna-Ávila ES, Martínez-Mendoza F, Vela-Patiño S, Ramírez-Ramos I, Hinojosa-Alvarez S, Hernandez-Perez J, Chavez-Santoscoy RA, Mercado-Medrez S, León-Wu KS, De Miguel-Ibáñez R, Mercado M, Taniguchi-Ponciano K, Ferreira-Hermosillo A.
In-Text Gene Mentions

…, TBC1D4 ,CACNA1E, and MNX1…

Show Full Abstract

<h4>Introduction</h4>Maturity Onset Diabetes of the Young (MODY) remains an underdiagnosed condition with remarkable genetic variability across populations. While diagnostic tools are based on Caucasian cohorts, Whole Exome Sequencing (WES) studies are needed to identify new genes in non-Caucasians, as up to 77% of patients do not harbor variants of significance in MODY-known genes. No WES studies have addressed the genomic landscape of MODY beyond its canonical genes in Latino populations. We aimed to characterize the genomic landscape of MODY through WES in a Mexican cohort, comparing cases with type 2 diabetes mellitus (T2DM) patients and healthy controls (HC).<h4>Methods</h4>WES was performed in 17 patients with MODY, 17 with T2DM and 17 HC. We compared the single nucleotide variant landscape across groups in MODY-known genes and searched for genetic variants with differential enrichment across groups.<h4>Results</h4>MODY genes used for routine diagnosis showed low discrimination utility, as patients with MODY, T2DM and HC harbored genetic variants in MODY-known genes at similar frequencies in most cases. We found 14 genes with variants capable of distinguishing MODY from T2DM and HC. Variants in genes such as <i>MAP2K3</i>, <i>SYT15</i>, <i>KCNJ12</i>, <i>PEX5</i>, and <i>TPTE</i> were found in 75-100% of MODY cases while absent in T2DM and HC. Enrichment analysis revealed involvement in synaptic vesicle trafficking, insulin/IGF pathway-mitogen activated protein kinase kinase/MAPK, and insulin/IGF pathway-protein kinase B/AKT signaling.<h4>Discussion</h4>MODY presents a complex genetic architecture in the Mexican population. Besides improving our understanding of glycemic regulation pathways, identified genes may serve as diagnostic biomarkers.

PEBP1
Also flagged:embryogenesismetabolismextracellularvesiclesembryo developmentExtracellular vesicles
Journal Article 2026-07-01 ✓ 2 Snippets Li Y, Xiong W, Gao L, Lv M, Li F, Long R, Liu C, Wei J, Wang M, Zhang C, Yu Q, Guo N, Jin L, Sui C.
In-Text Gene Mentions

…with five proteins‐YWHAZ,PEBP1, PKM, CKB and…

…including YWHAZ, PKM,PEBP1, CKB and ARHGDIA.…

Show Full Abstract

Extracellular vesicles (EVs) in the mammalian oviduct constitute a key maternal regulatory system that maintains redox balance during early embryogenesis, yet their molecular cargo and functional relevance in human embryos remain poorly defined. Here, we show that human Fallopian tube-derived EVs (oEVs) are rapidly internalized by human preimplantation embryos and improve developmental quality in vitro, increasing high-quality Day 3 embryo formation and blastocyst development. Label-free proteomics identified 6505 oEV proteins, with metabolic, antioxidant and stress-response pathways strongly enriched. Cross-reference with four independent datasets revealed a conserved protein subset shared across secretory-phase oviduct fluid, pluripotent stem cell-derived EVs and in-vivo-developed embryos; among these, YWHAZ was prioritized for functional validation because of its abundance in oEVs, its presence across embryo-related datasets, and its known involvement in stress-response pathways. We found that Ywhaz-deficient mouse embryos exhibit elevated oxidative and apoptotic stress, transcriptional signatures of impaired glutathione metabolism, and failure to survive to birth despite normal blastocyst morphology. Recombinant YWHAZ protein alone failed to enter intact embryos, whereas engineered YWHAZ-loaded EVs were efficiently internalized and significantly reduced intracellular ROS and apoptosis, restoring redox status towards in vivo levels without compromising implantation or foetal growth. Taken together, these findings identify YWHAZ protein as a conserved vesicle-delivered regulator of redox homeostasis and demonstrate that EV-mediated molecular delivery can partially rescue the oxidative stress burden characteristic of in vitro embryo culture. This work provides mechanistic insight into the maternal redox support system of the oviduct and establishes a foundation for EV-based engineering of next-generation embryo culture strategies. Fallopian tube extracellular vesicles enhance human IVF embryo development by delivering functional proteins such as YWHAZ to regulate oxidative stress and blastocyst formation. Large Scale Data Proteomic data are available in the PRIDE database under accession number PXD054946 (https://www.ebi.ac.uk/pride/). Ywhaz-KO embryo RNA-sequencing data are available in the GEO database under accession number GSE294735 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE294735.

SUDS3
Also flagged:ATPaseRNA polymerase IIPol IItranscription factorsovarian clear cell carcinomaSWI/SNF
Journal Article 2026-07-01 ✓ 1 Snippet Kimura A, Nakabayashi J, Ohara O, Kimura Y.
In-Text Gene Mentions

chromatin modifiers

Show Full Abstract

Brg1 is a core ATPase subunit of the SWItch/Sucrose Non-Fermentable (SWI/SNF) chromatin-remodeling complex that regulates DNA accessibility for RNA polymerase II (Pol II), transcription factors, and DNA repair enzymes. Phosphoproteomic profiling of highly malignant ovarian clear cell carcinoma (OCCC) cell lines revealed reduced levels of several SWI/SNF components and decreased Brg1 phosphorylation within its histone-binding region. Prior work showed that phosphorylation-mimic and phosphorylation-deficient mutants alter chromatin-silencing factors, producing chromatin condensation and decondensation, respectively. Here, we performed RNA-seq in Brg1-deficient JHOC-5 cells and in isogenic cells expressing Brg1-WT, phosphorylation-mimic brg1-S<sup>1452</sup>D, or phosphorylation-deficient brg1-S<sup>1452</sup>A. PCA and hierarchical clustering separated brg1-S<sup>1452</sup>A from the other lines, indicating a strong transcriptional impact of Ser<sup>1452</sup> dephosphorylation. JHOC-5 and brg1-S<sup>1452</sup>A shared altered expression of Pol II-promoter-regulated genes. Apoptosis genes (BCL2, FGFR2, ZC3H12A, and NFKBIA) showed reciprocal expression between brg1-S<sup>1452</sup>D and brg1-S<sup>1452</sup>A, consistent with increased and decreased apoptosis, respectively. Genes linked to cell adhesion/migration and neuronal development also differed, accompanied by reduced cell circularity in brg1-S<sup>1452</sup>A. Overall, Brg1 phosphorylation at Ser<sup>1452</sup> shapes SWI/SNF-mediated chromatin remodeling to regulate transcriptional programs controlling apoptosis and cell morphology.

Also flagged:cognitive impairmentorganizationhyperthyroidismHTHyperthyroidendocrine dysfunction
Journal Article 2026-07-01 No Snippets Chakraborty P, Upadhyay N, Kumar P, Rana P, Saha S, D'souza M, Sekhri T, Khushu S, Kumar M.
Show Full Abstract

Hyperthyroidism is associated with cognitive impairment and neuropsychiatric symptoms, yet its effects on white matter architecture and neuromolecular organization remain poorly understood. We examined how hyperthyroidism alters white matter wiring architecture and the neuromodulatory systems underlying these disturbances. Diffusion MRI-derived structural connectomes were analyzed in 30 patients with hyperthyroidism (HT) and 28 matched healthy controls (HC). Structural connections were classified into short-, medium-, and long-range pathways, and global and nodal network topology was quantified using graph theoretical analysis. Molecular associations were examined using nine PET-derived neurotransmitter receptor density maps through spatial correlation, multiple regression, and dominance analysis. Associations with thyroid hormone levels, clinical measures, and cognitive scores were evaluated using permutation-based statistical testing. Neurotransmitter-weighted network measures were computed by linking normative neurotransmitter density with graph theoretical metrics. Spatial autocorrelation was controlled using spin permutation testing, with results additionally corrected for multiple comparisons using false discovery rate (FDR) correction. Hyperthyroid patients exhibited significantly increased medium-range (p = .002) and long-range connectivity (p = .02), reduced modularity (p = .009), and increased characteristic path length (p = .032) as compared to controls, indicating disrupted segregation and efficiency. Nodal alterations were predominantly right-lateralized, involving cortical, subcortical, and cerebellar regions. Clinically, BMI predicted modularity (p = .01), while free thyroxine levels predicted characteristic path length (p = .04) and long-range connectivity strength (p = .03). The Nahor-Benson score was associated with increased medium-range connectivity (p = .02) and nodal degree (p = .03) in right cerebellar lobule IV-V. Neurotransmitter receptor distributions explained substantial variance in network topology (adjusted R<sup>2</sup> = 0.45 in controls; 0.38 in hyperthyroidism), with dominant contributions from 5-HT<sub>1A</sub> (33%) and dopamine transporter (17%). Furthermore, 5-HTT-weighted within module degree z-score predicted thyroid-stimulating hormone (TSH) levels in hyperthyroidism (p = .03), linking hormonal dysregulation to molecular connectomic reorganization. Our findings suggest that excess thyroid hormone drives right-lateralized connectomic reorganization and increased metabolic demand, mediated by serotonergic and dopaminergic receptor architecture, linking endocrine dysfunction to large-scale brain network vulnerability. These insights inform mechanistic models and biomarkers for clinical translation.

Also flagged:bindingbiodegradationkidneyAdsorptionsynthesismethylation
Journal Article 2026-07-01 No Snippets Sha B, Soodan A, Lompe KM, Barin G, Vlugt TJH, Peristeras LD, Moultos OA.
Show Full Abstract

β-Cyclodextrin (β-CD)-based polymers have shown high adsorption capacities for removing per- and polyfluoroalkyl substances (PFAS) from drinking water. PFAS capture by these materials involves many physical and chemical processes, such as adsorption and inclusion complexation. Quantifying the underlying host-guest binding between CDs and PFAS nevertheless remains essential because it governs the primary inclusion step. Here, we investigated native and linker-modified CD-PFAS inclusion complexes in aqueous solution using isothermal titration calorimetry (ITC) and molecular dynamics (MD) simulations with the attach-pull-release (APR) method. We computed the Gibbs free energies of binding for α-, β-, and γ-CDs with seven linear PFAS, including perfluorocarboxylic acids and perfluorosulfonic acids, and found reasonable agreement with our experimental measurements and previously reported data. Comparison between implicit and explicit solvent calculations suggests that the apparently better agreement of the implicit solvent model for some native monomer complexes is likely due to error cancellation rather than a more transferable physical description, whereas explicit solvent is required to capture solvent-related salt and linker effects. Overall, β-CD exhibited the strongest binding affinities, whereas α-CD showed negligible affinities and γ-CD bound PFAS more weakly than β-CD. Hydrogen bonding, interaction-energy decomposition, and solvent-accessible surface area showed that host-guest hydrogen bonding cannot uniquely predict affinities, and that hydrophobic dehydration plays a dominant role in binding. We further examined how background ion concentration affects β-CD-PFAS binding and found that explicit solvent simulations capture a clear salt dependence, with Li/Merz ion parameters describing the high-salinity trend more reasonably than the Joung-Cheatham model. To mimic the local microenvironment surrounding CD units in polymers, we also examined three linker-modified β-CD models containing phenyl groups. Bind3P water correctly reproduced the experimentally reported enhancement of PFAS adsorption with increasing linker number, and energy decomposition showed that linker groups strengthen PFAS binding by enhancing local hydrophobic confinement and specific linker-guest interactions. Overall, this combined experimental and computational study provides molecular-level insight into the building blocks of cyclodextrin polymers and lays the groundwork for future in silico construction of CD polymer models for PFAS adsorption under diverse water-matrix conditions.

Also flagged:Neurological Disordersneurological diseasesPNSnervous system diseasesAlzheimer's diseaseParkinson's disease
Journal Article 2026-07-01 No Snippets Farrokhi MR, Hosseini K.
Show Full Abstract

One of the most efficient and promising viral vectors for the treatment of central nervous system (CNS) and peripheral nervous system (PNS)-related diseases is adeno-associated virals (AAVs), which in recent years, researchers have succeeded in substantially managing and mitigating these disorders by leveraging innovative therapeutic mechanisms at the cellular and molecular levels, which are widely utilized due to their favorable characteristics, including a robust safety profile, the ability to cross the blood-brain barrier, and differential tropisms for distinct types of neuronal cells. Clinically, AAVs have high specificity and have therefore become a dynamic and useful tool for the gene therapy of a variety of neurological diseases. Many researchers around the world have been able to study a variety of neurological diseases in vitro cellular models, in vivo animal models, and human clinical studies using these vectors. Given these characteristics, the overall aim of the present review is to investigate the role of AAV vectors carrying coding and non-coding RNAs in the treatment of a variety of neurological disorders, to study the relationship between these vectors and cellular signaling pathways, and to examine its clinical applications in various neurological diseases.

HFE
Also flagged:iron deficiencyanaemiainfectionend stage kidney diseaseheart failureresponse to
Journal Article 2026-07-01 ✓ 1 Snippet Suttaluang C, Phannajit J, Siribamrungwong M, Chongthanakorn K, Lewsuwan S, Katavetin P, Avihingsanon Y, Praditpornsilpa K, Eiam-Ong S, Takkavatakarn K, Susantitaphong P.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Iron deficiency is common in patients receiving haemodialysis and contributes to adverse outcomes. Conventional iron biomarkers, including ferritin and transferrin saturation (TSAT), have limitations and may be less accessible in some settings. Reticulocyte haemoglobin equivalent (RET-He) is a lower-cost, potentially more accessible marker for detection of iron deficiency. This study evaluated whether RET-He-guided intravenous iron supplementation is non-inferior to TSAT-guided supplementation in haemodialysis patients.<h4>Methods</h4>In this randomized non-inferiority trial, 160 haemodialysis patients were randomized to a TSAT-guided group (n = 79) or RET-He-guided group (n = 81). Intravenous iron was administered in both groups according to prespecified protocols. The primary outcome was the erythropoietin resistance index (ERI) at 3 and 6 months. RET-He guidance was considered non-inferior if the upper bound of the 95% confidence interval (CI) for the between-group mean difference was ≤ 160 units/week/g/dL. Secondary outcomes included all-cause mortality, hospitalization, cardiovascular events, blood transfusion, and infection.<h4>Results</h4>Baseline characteristics were comparable between groups. RET-He-guided supplementation was non-inferior to TSAT-guided supplementation for ERI at 3 months (mean difference, -35.92; 95% CI, -155.60 to 90.29; p = 0.001 for non-inferiority) and 6 months (mean difference, -39.68; 95% CI, -187.01 to 107.64; p = 0.004 for non-inferiority). The RET-He group received significantly lower cumulative intravenous iron doses. Secondary outcomes did not differ significantly, although the trial was not powered for these clinical outcomes.<h4>Conclusion</h4>RET-He-guided intravenous iron supplementation was non-inferior to TSAT-guided supplementation for reducing ERI over 6 months. Use of RET-He may offer a lower-cost and more accessible strategy for anaemia management in haemodialysis patients, particularly in resource-limited settings.

Also flagged:hatchingwatermineralsamino acidsembryogenesisamino acid
Journal Article 2026-07-01 No Snippets Kursun K, Abdallah N, Baylan M.
Show Full Abstract

<h4>Background</h4>Restricting nutrients in eggs may hinder the growth of commercial chickens, which could result in higher embryonic mortality and poor growth performance, indicating the significance of in ovo injection of dietary nutrients to support embryonic and post-hatch growth in poultry.<h4>Objective</h4>This study investigated the in ovo supplementation of a dietary supplement on egg weight, embryonic development, hatching, and chick quality traits of broiler chickens.<h4>Method</h4>A total of 300 hatching eggs were randomly pre-assigned to a specific in ovo injection protocol (T-1, T-2, T3, and T-4) and incubated under standard conditions. At embryonic day (ED) 12, the eggs were either injected with distilled water or a dietary supplement (containing a mixture of vitamins, trace minerals, and amino acids). The injection treatment consisted of T-1 (non-injected eggs), T-2 (eggs injected with 5 mL of distilled water), T-3 (eggs injected with 5 mL of a solution containing 0.04% of the dietary supplement), and T-4 (eggs injected with 5 mL of a solution containing 0.08% of the dietary supplement).<h4>Results</h4>The results revealed that the experimental treatment had no effect on egg weight or egg weight loss during embryogenesis (p > 0.05). The lowest weight of yolk-free body mass (YFBM-w), yield of yolk-free body mass (YFBM-Y), embryo length (Em-L), embryo width (Em-W), tibia length (TL), and wing length (WL) at ED 16 were identified in T-4 (p < 0.05). At ED 19, the highest Em-L and eye width (Ey-w) were identified in T-3 (p < 0.05). The highest chick weight at hatch (CWAH) and chick yield (CY) were identified in T-4 (p < 0.05). While the chick length and appearance score were lowest in T-4, the chick eye score was lowest in T-2 (p < 0.05). The embryonic mortality, hatchability, navel, and leg scores of chicks were similar among the treatments (p > 0.05).<h4>Conclusion</h4>It was concluded that the in ovo injection of a mixture of dietary nutrients could improve embryonic traits during the latter part of embryogenesis, chick weight, and chick yield at hatch; however, it may possess a strong negative effect on hatchability, embryonic mortality, and chick quality traits.

Also flagged:endoplasmic reticulophagyendoplasmic reticulummitochondrialautophagydeathautophagosomes
Journal Article 2026-07-01 No Snippets Guo X, Wu J, Han B, Yang T, Yin H, Xiong J, Xie R.
Show Full Abstract

<h4>Objectives</h4>To investigate the role of C/EBP homologous protein (CHOP) in dithiothreitol (DTT)‑induced endoplasmic reticulophagy in murine hepatocytes cells and its mechanism for regulating hepatocytes pyroptosis through endoplasmic reticulum (ER)‑mitochondria interactions.<h4>Methods</h4>The changes in CHOP, endoplasmic reticulophagy, mitochondrial-ER contact sites (MERCs)-associated protein, and pyroptosis-associated proteins in DTT-treated BRL-3A cells were examined using Western blotting, and CHOP enrichment in the promoter regions of ATG5, ATG12 and LC3 genes was detected using ChIP assay. The effect of bafilomycin A1 (an autophagy inhibitor) pretreatment on DTT-induced BRL-3A cell death was assessed using Hoechst 33342 and propidium iodide staining. The effects of lentivirus-mediated CHOP overexpression in the hepatocytes on ER-phagy, MERCs-associated proteins, pyroptosis-associated proteins, and colocalizations of ER with the autophagosomes, lysosomes and mitochondria were examined using Western blotting and immunofluorescence double staining; the changes in intramitochondrial Ca<sup>2+</sup>, mitochondrial membrane potential and intramitochondrial GSDMD-N levels were also analyzed.<h4>Results</h4>DTT treatment for 12 h did not significantly affect CHOP protein expression but significantly upregulated ER-phagy, MERCs-associated proteins, and pyroptosis-associated proteins in BRL-3A cells. DTT treatment for 36 h markedly increased CHOP protein expression and further increased MERCs-associated proteins and pyroptosis-associated protein levels, but moderately decreased ER-phagy levels. DDT treatment significantly downregulated CHOP enrichment in the promoter regions of ATG5, ATG12 and LC3 genes in BRL-3A cells. Pretreatment with bafilomycin A1 significantly increased DTT-induced BRL-3A cell death. CHOP overexpression in BRL-3A cells downregulated the levels of endoplasmic reticulophagy-related proteins, upregulated MERCs- and pyroptosis-related proteins, and reduced the colocalization of ER with autophagosomes and lysosomes, and increased its colocalization with the mitochondria, resulting in also elevated intramitochondrial Ca²⁺ levels and GSDMD-N protein and decreased mitochondrial transmembrane potential.<h4>Conclusions</h4>CHOP promotes hepatocytes pyroptosis by suppressing ER-phagy and enhancing ER-mitochondrial interactions, which leads to increased Ca²⁺ shuttling from the ER to the mitochondria.

PRDX6
Also flagged:Osteoporosisskeletal disorderOPcell proliferationosteogenesisgene silencing
Journal Article 2026-07-01 ✓ 1 Snippet Liu J, Chen K, Wen J, Zeng Q, Cheng L, Ge Q, Chen J, Yuan W, Wang P, Xiao L, Jin H, Wu Y.
In-Text Gene Mentions

…genes (including PRDX1,PRDX6, NQO1) were downregulated…

Show Full Abstract

Osteoporosis (OP) is a prevalent skeletal disorder characterized by progressive bone mass loss and deteriorated microarchitecture, in which oxidative stress-induced mesenchymal stem cell (MSC) dysfunction serves as a core pathogenic mechanism. Yougui Pills (YGPs), a classical traditional Chinese medicine formula, are widely applied in clinical OP management, yet the cellular and molecular mechanisms underlying their anti-osteoporotic effects remain incompletely defined. This study aimed to elucidate the bone-protective role of YGPs in OP and explore the underlying mechanism, focusing on oxidative stress modulation in MSCs and the Nrf2/HO-1 signalling pathway. The bioactive components of YGPs and YGP-containing serum were characterized via UPLC. In vivo, an ovariectomy (OVX) mouse model was established to evaluate YGPs' effects on bone mass, trabecular microstructure and osteogenesis using micro-CT, histological and immunohistochemical assays; public GEO datasets were re-analysed to profile transcriptomic alterations and oxidative stress signatures in OP-derived MSCs. In vitro, H<sub>2</sub>O<sub>2</sub> was used to induce ROS accumulation and oxidative injury in MSCs, with assessments of cell proliferation, apoptosis, ROS levels, migration and osteogenic differentiation. Network pharmacology and siRNA-mediated gene silencing were conducted for target prediction and mechanistic validation. In vivo results showed that YGP treatment significantly ameliorated OVX-induced osteopenia, increased bone mineral density, improved trabecular microstructure, and upregulated osteogenic markers (ALP, OCN, Runx2, COL1A1). Transcriptomic re-analysis revealed upregulated oxidative stress markers in OP MSCs, consistent with In vitro findings that YGPs attenuated H<sub>2</sub>O<sub>2</sub>-triggered ROS overproduction, suppressed apoptosis and ectopic lipid deposition, and enhanced MSC proliferation, migration and osteogenic differentiation. Mechanistically, YGPs activated the Nrf2/HO-1 signalling axis, while Nrf2 knockdown abrogated YGPs' cytoprotective and pro-osteogenic effects. In conclusion, YGPs mitigate oxidative stress-induced MSC dysfunction and promote osteogenesis via the Nrf2/HO-1 pathway, supporting YGPs as a promising therapeutic candidate for OP.

SERPINC1
Also flagged:coagulationanemiaplacenta previaplacental abruptionplacenta accretaPostpartum hemorrhage
Journal Article 2026-07-01 ✓ 1 Snippet Zhang Y, Zhu Y, Wang H, Wang M, Guo Y.
In-Text Gene Mentions

…D-dimer (D-D), andantithrombin-III(AT-III]) of the…

Show Full Abstract

<h4>Objectives</h4>To construct a quantitative nomogram for predicting the risk of PPH in parturients by integrating thromboelastography(TEG) with conventional coagulation parameters [prothrombin time (PT), activated partial thromboplastin time(APTT), and fibrinogen(FIB)] to provide a clinical tool for early intervention.<h4>Methodology</h4>A retrospective analysis was conducted on the clinical data of 500 parturients who delivered at Affiliated Hospital of Chengde Medical College between January 2021 and September 2025. Participants were divided into a PPH group (<i>n =</i> 85) and a non-PPH group (<i>n =</i> 415) based on whether PPH occurred. Collected the clinical characteristics, TEG parameters, and conventional coagulation parameters [thrombin time (TT), APTT, PT, FIB, D-dimer (D-D), and antithrombin-III (AT-III]) of the enrolled participants.<h4>Results</h4>There were statistically significant differences in the comparison of the number of previous abortions, history of preterm birth, previous cesarean section,prior PPH, anemia, prolonged labor, placenta previa, placental abruption, placenta accreta, coagulation index (CI), FIB, D-D, and AT-III between the non-PPH group and the PPH group (all <i>P <</i> 0.05). Logistic regression identified previous cesarean section,previous PPH, anemia,coagulation index (CI), D-D and AT-III as independent risk factors for PPH (all <i>P <</i> 0.05), whereas FIB were protective factors (all <i>P <</i> 0.05). The bootstrap-based internal validation (1,000 resamplings) with an optimism-corrected bias of 0.007.<h4>Conclusion</h4>The nomogram integrating TEG parameters with conventional coagulation parameters demonstrates excellent discrimination, calibration, and predictive accuracy for assessing PPH risk in parturients.

HTT
Also flagged:Down syndromeAlzheimer's diseaseADParkinson's diseasedevelopmental disordersPD
Journal Article 2026-07-01 ✓ 1 Snippet Paul S, Dubey S, Tiwari P.
In-Text Gene Mentions

…of mutant Huntingtin (HTT) protein, potentially mitigat…

Show Full Abstract

Dual-specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), located within the Down syndrome critical region and implicated in Alzheimer's disease (AD), Parkinson's disease (PD), and context-dependent cancer biology, represents a high-value yet challenging therapeutic target. This review compiles comprehensive structure-activity relationship (SAR) insights essential for medicinal chemists designing selective DYRK1A inhibitors. We detail the molecular architecture of the ATP-binding pocket of DYRK1A, key regulatory residues (Lys188, Phe238, Glu239, Leu241), and structure-function relationships governing inhibitor classes: ATP-competitive agents, ATP-non-competitive inhibitors, and Proteolysis-Targeting Chimeras (PROTAC) degraders with emphasis on functional group modifications and scaffold optimization strategies. Readers will gain actionable insights on binding mode predictions, potency-selectivity trade-offs, and prioritization of lead compounds for preclinical validation. The framework addresses pharmacokinetic property optimization and selectivity profiling across kinase families, enabling researchers to accelerate rational inhibitor design and facilitate translation of DYRK1A therapeutics into clinical trials for neurodegenerative and developmental disorders.

PLCL1
Also flagged:agingphosphorylationextracellularmitochondrialsoft tissue sarcomabehavioral
Journal Article 2026-07-01 ✓ 1 Snippet Habing KM, Sagendorf TJ, Alcazar-Daleo CA, Sanford JA, Leach D, Vanderpool JC, Hutchinson-Bunch CM, Gritsenko M, Many GM, Nakayama KH.
In-Text Gene Mentions

…a‐associated features includedPlcl1S96, a phosphosite…

Show Full Abstract

Severe muscle trauma disrupts endogenous repair mechanisms and produces chronic functional deficits that are poorly defined in aging. We investigated inflammatory, molecular, and physiological responses to volumetric muscle loss in young adult and aged female mice. Cytokine profiling revealed elevated baseline inflammation in aged mice and a blunted early injury response; for example, IL-6 increased 4.4-fold in young versus 1.8-fold in aged mice at day 3 post-injury. By day 28, histological analyses revealed comparable reductions in muscle size and increased fibrosis across ages. Despite similar structural pathology, age-dependent differences emerged in functional and molecular adaptations. Both groups exhibited persistent force deficits; however, aged muscles showed significantly altered relaxation kinetics (p < 0.001), suggesting dysregulated excitation-contraction coupling. Aged mice also demonstrated altered post-injury limb loading patterns. Global proteomics identified age-associated enrichment of complement and antigen-processing pathways and signatures of metabolic dysfunction (p < 0.05). Phosphoproteomic analysis revealed reduced basal kinase activity in aged muscle but exaggerated injury-induced phosphorylation of Mapk1-associated sites indicating a dysregulated stress response. Together, these findings indicate that aging muscles operate within a heightened inflammatory and perturbed kinase-signaling environment that may impair coordinated regeneration and functional recovery following traumatic injury.

Also flagged:bone tumortumorproliferationangiogenesissarcomatranslational
Journal Article 2026-07-01 No Snippets Solernó LM, Llavona C, Saud ZY, Onassis MC, Gottardo MF, Ledesma MM, Alonso DF, Garona J.
Show Full Abstract

<h4>Background</h4>Osteosarcoma (OSA) is the most common primary malignant bone tumor and is characterized by high mortality, early metastatic dissemination, and extensive vascularization. Although overexpression of Vascular Endothelial Growth Factor A (VEGF-A) is associated with poor prognosis, clinical responses to the anti-VEGF-A monoclonal antibody Bevacizumab (BEVA) have been limited. Desmopressin (dDAVP), a hemostatic agent that acts as a selective arginine vasopressin receptor 2 (AVPR2) agonist, has demonstrated antitumor and angiostatic properties in other malignancies, however, its role in OSA remains incompletely characterized. This study evaluated the therapeutic potential of dDAVP as a coadjuvant strategy to enhance BEVA efficacy in OSA.<h4>Methods</h4>Bioinformatic analyses of AVPR2 expression and its associations with tumor aggressiveness, immune and stromal infiltration markers, and clinical outcomes were performed using TCGA-SARC and TARGET-OS datasets. Endothelial proliferation, migration, and morphogenesis were assessed in HmVEC-L and HMEC-1 microvascular cells. Antitumor activity was evaluated in human (MG-63) and murine (K7M3) OSA models. <i>In vivo</i> activity was assessed using xenogeneic and syngeneic models of tumor growth, metastasis, and tumor-associated angiogenesis. Combined dDAVP + BEVA therapy was evaluated <i>in vitro</i> and <i>in vivo</i>. Histopathological endpoints included mitotic index, desmoplasia, vimentin expression, and tumor necrosis.<h4>Results</h4>Exploratory transcriptomic analyses revealed that AVPR2 expression was inversely associated with proangiogenic, prosurvival, and prometastatic gene signatures, while positively correlating with immune and stromal infiltration markers. Elevated AVPR2 expression was also associated with improved survival in both the pan-sarcoma cohort and a pediatric OSA subset. dDAVP significantly reduced pulmonary metastasis and OSA-driven vascularization <i>in vivo</i> and inhibited endothelial proliferation, migration, and morphogenesis <i>in vitro</i>. Under tumor-conditioned conditions, dDAVP enhanced the antivascular activity of BEVA. Combined treatment with clinically relevant doses of dDAVP and BEVA significantly inhibited OSA xenograft progression without overt toxicity and favorably modulated histopathological markers of tumor aggressiveness.<h4>Conclusion</h4>These findings support further translational evaluation of dDAVP as a potential adjuvant therapy in OSA, particularly in combination with BEVA. By targeting complementary angiogenesis-related mechanisms, this dual antiangiogenic strategy may improve therapeutic efficacy in OSA.

TNFSF4
Also flagged:programmed cell deathbreast cancertumorgene expressionfemale cancerdeath
Journal Article 2026-07-01 ✓ 1 Snippet Zhang Z, Yang X, Tang J, Cai L, Feng J.
In-Text Gene Mentions

…for TNFSF15, CD276,TNFSF4, and ICOSLG, the…

Show Full Abstract

This study aims to identify programmed cell death (PCD)-associated genes linked to breast cancer prognosis for the construction of a prognostic model. Transcriptomic and clinical information was imported from the The Cancer Genome Atlas (TCGA) and GEO databases. Modulatory genes related to 18 types of PCD were evaluated. Furthermore, the TCGA and GEO datasets were employed as the training and validation datasets, respectively. A risk score prognostic model based on PCD-related genes was generated via univariate, LASSO, and multivariate Cox regression analyses. Further, differences in drug sensitivity, tumor mutation burden (TMB), immune-related pathways and cell infiltration, and immune checkpoints were compared between high-risk and low-risk cohorts to elucidate the clinical applicability of the model. Lastly, the model gene's expression was verified by RT-PCR. The data revealed 1480 PCD-related genes from the TCGA breast cancer gene expression matrix. Differential expression analysis identified 186 differentially expressed PCD genes. Furthermore, a prognostic model was generated according to the risk scores using multivariate Cox regression. The model comprised 8 PCD-related genes (BRSK2, CD24, IFNG, LAMB3, PDX1, PMAIP1, SLC7A11, and TRIML2). Moreover, breast cancer cases were divided into high-risk and low-risk cohorts per the median risk score. The results indicated that low-risk patients had better prognoses, and the model showed good predictive performance in the GEO validation cohort. The area under the curve values were 0.819, 0.731, and 0.674 for the nomogram's 3, 5, and 8 years overall survival, respectively. Functional enrichment analysis revealed that the prognostic model was markedly linked with the modulation of the immune microenvironment and tumor progression in breast cancer. Immune infiltration assessment revealed that low-risk patients had increased activity in immune-related pathways and infiltration of immune cells. In addition, the low-risk cohort had lower TMB and elevated immune checkpoint-related levels. Correlation analysis between immune checkpoints and risk scores indicated that low-risk patients were more responsive to immunotherapy. Drug sensitivity analysis showed variations in the IC50 values between the risk cohorts, suggesting potential variations in drug efficacy across different risk cohorts. Gene expression was verified by RT-PCR.A prognostic risk model for breast cancer based on 8 PCD-related genes was constructed and its predictive value was validated. The established model may provide novel biomarkers and effective therapeutic targets for breast cancer diagnosis and treatment.

Also flagged:Parkinson's diseasePDsynthesisneurodegenerative disordermitochondrialmetabolism
Journal Article 2026-07-01 No Snippets Pernicone AO, Budeguer Isa V, Guayán ML, Teran MDM, Stagnetto A, Mercado AL, Ploper D, Manzano VE, Chehín R, Varela O.
Show Full Abstract

Parkinson's disease (PD) is driven by a combination of dopaminergic neuron loss, α-synuclein (α-Syn) aggregation, and oxidative stress, underscoring the need for multi-target therapies. We previously developed Pegasus (DAD9), a dopamine-doxycycline conjugate designed to couple dopaminergic activity with the neuroprotective properties of tetracyclines while limiting dopamine's oxidative reactivity. In this study, we explore a critical but less-examined element of this scaffold: the linker. By incorporating a sulfur atom and progressively extending the tether, we introduced subtle modifications to modulate molecular flexibility, electronic properties, and physicochemical parameters without disrupting the main pharmacophoric domains. The synthesis of these highly functionalized hybrids required a tailored strategy, highlighting the inherent challenges of working with such complex conjugates. Across the series, all compounds retained their ability to interfere with α-Syn aggregation, showed no effect on cell viability, and lacked antibacterial activity. While modest variations in physicochemical properties were observed, anti-aggregative potency remained comparable across the linker-modified series. Together, these results indicate that the scaffold tolerates linker modification within the explored chemical space, supporting a role for the linker as a modulatory element rather than a primary driver of the main α-Syn-related functional activity.

Also flagged:Oral squamous-cell carcinomaOSCCOral Squamous Cell CarcinomaOral canceroral potentially malignant disordersOPMDs
Journal Article 2026-07-01 No Snippets Li Y, Liu Y, Cong Y, Liu J, Pan W, Guan X, Wang J.
Show Full Abstract

Oral squamous-cell carcinoma (OSCC) is a prevalent malignancy of the head and neck region. A delay in the diagnosis of OSCC often results in a high metastatic tendency, which is the main reason for the high patient mortality. Dynamic monitoring and management of the onset and progression of OSCC are critical for improving patient survival rates. Liquid biopsy technology-characterized by its non-invasive nature, procedural convenience, and capacity for longitudinal monitoring-is a promising adjunct to histopathological examination for the early diagnosis of OSCC. Epigenetic alterations, characterized by reversibility and long-term stability in physiological fluids, are critical enablers of liquid biopsy and its clinical utility. Advances in detection technologies, including quantitative polymerase chain reaction (qPCR), digital droplet PCR (ddPCR), next-generation sequencing (NGS), and electrochemical biosensors, have significantly facilitated the research and clinical translation of epigenetic biomarkers in oral liquid biopsies. However, translating epigenetic biomarkers from research discovery to clinical practice for OSCC remains hindered by several critical challenges: the scarcity of large-scale, rigorously designed cohort studies, limited multicenter validation, inconsistent preprocessing protocols, and a lack of harmonized analytical platforms. Finally, we propose a conceptual framework to outline potential clinical application models for these biomarkers.

SERPINC1
Also flagged:gene expressionwound healingcell migration
Journal Article 2026-07-01 ✓ 5 Snippets Pan SM, Xu B, Qian QQ, Li XD, Chen JF, Lou JL, Feng LF.
In-Text Gene Mentions

…of MYNN andSERPINC1genes].…

…genes MYNN andSERPINC1in BEAS-2B cells,…

…TERC, MYNN andSERPINC1were detected by…

…of MYNN andSERPINC1increased with the…

…TERC significantly decreasedSERPINC1expression (<i>P</i><0.05), wh…

Show Full Abstract

<b>Objective:</b> To investigate the effects of hexavalent chromium exposure on lncRNA TERC and its target genes MYNN and SERPINC1 in BEAS-2B cells, and their roles in hexavalent chromium-induced malignant transformation. <b>Methods:</b> In September 2022, BEAS-2B cells were treated with different concentrations of hexavalent chromium, and the mRNA expression levels of lncRNA TERC, MYNN and SERPINC1 were detected by qPCR. After knockdown or overexpression of lncRNA TERC via transfection, the cells were exposed to hexavalent chromium and the gene expression changes were measured. Long-term continuous exposure to 0.5 μmol/L hexavalent chromium was performed, and malignant phenotypes were assessed by morphological observation, wound healing assay, plate colony formation assay and soft agar colony formation assay. In malignantly transformed cells, the effects of lncRNA TERC knockdown or overexpression on target gene expression and cell migration were evaluated. For inter-group data comparisons, if the data follow a normal distribution with homogeneous variances, one-way ANOVA is employed, followed by pairwise comparisons using the SNK test. <b>Results:</b> After 24 h exposure to 0.75 and 1 μmol/L hexavalent chromium, the mRNA expression levels of MYNN and SERPINC1 increased with the elevation of concentration (<i>P</i><0.05). After exposure to 0.5 μmol/L hexavalent chromium for 1-7 d, the expression levels of both genes showed an overall upward trend with prolonged duration. Knockdown of lncRNA TERC significantly decreased SERPINC1 expression (<i>P</i><0.05), while overexpression of lncRNA TERC elevated the expression of both MYNN and SERPINC1 (<i>P</i><0.05). After long-term exposure to 0.5 μmol/L hexavalent chromium for 60 passages, the cells exhibited malignant phenotypic changes, with increased 48 h migration rate (<i>P</i><0.05) and higher soft agar colony formation rate than the control group [ (0.20±0.04) vs (0.09±0.03), <i>P</i><0.05]. The expression of TERC remained higher than that of the control group throughout the exposure (<i>P</i><0.05). In malignantly transformed cells, the expression levels of MYNN and SERPINC1 were elevated (<i>P</i><0.05). Knockdown of TERC decreased the expression of both genes and reduced cell migration (<i>P</i><0.05), whereas overexpression of TERC markedly increased the expression of both genes (<i>P</i><0.05) . <b>Conclusion:</b> Hexavalent chromium exposure induces alterations in MYNN and SERPINC1 expression in BEAS-2B cells, demonstrating concentration-and time-dependent effects. lncRNA TERC may promote cell migration by regulating the expression of MYNN and SERPINC1, playing a role in hexavalent chromium-induced malignant transformation.

Also flagged:charge transferinflammatory responsesmineralizationextracellularosteoblast proliferationinfections
Journal Article 2026-07-01 No Snippets Jalalvand L, Souri A, Shanaghi A, Naseri M.
Show Full Abstract

In this study, the corrosion behavior of hydroxyapatite (HA), hydroxyapatite-copper (HA-Cu), and hydroxyapatite-copper-collagen (HA-Cu-Col) nanocoatings electrochemically deposited on Ti-6Al-4V alloy was systematically investigated. For the hybrid coatings, collagen was incorporated via an immersion process followed by heat treatment at 80°C for 1 hour. Grazing incidence X-ray diffraction (GIXRD) confirmed the retention of the HA phase across all coatings, with Cu addition leading to co-precipitation of metallic Cu phases, evidenced by distinct peaks at 2θ angles of 34.3°, 42°, and 50.4°. Collagen integration, without forming new phases, resulted in a uniform organic-inorganic matrix and enhanced nanoscale porosity. Field-emission scanning electron microscopy (FE-SEM) revealed that the HA coating exhibited a dense needle-like morphology with lengths of 1-5 μm and rod diameters of 200-500 nm, whereas HA-Cu displayed a granular-floret structure interspersed with 20-50 nm copper nanoparticles. The hybrid HA-Cu-Col coating formed a compact fibrous-floret network with nanoscale uniformity. Tafel polarization tests indicated the highest corrosion potential (E<sub>corr</sub>) for HA-Cu-Col at +0.54 V vs. Ag/AgCl reference electrode, while the lowest corrosion current density (I<sub>corr</sub>) was achieved with HA at 0.027 µA/cm<sup>2</sup>, followed by HA-Cu-Col at 0.040 µA/cm<sup>2</sup>, confirming that the hybrid system maintains low corrosion kinetics while introducing stable passivation behavior. Electrochemical impedance spectroscopy data after 48 hours of immersion showed coating resistances (R<sub>coat</sub>) of 2885, 13268, and 12851 Ω.cm<sup>2</sup> for HA, HA-Cu, and HA-Cu-Col, respectively, whereas the highest charge transfer resistance (R<sub>ct</sub>) of 1078 kΩ.cm<sup>2</sup> was observed for HA-Cu-Col, indicating superior suppression of interfacial electrochemical reactions despite the moderate R<sub>coat</sub> value at extended immersion. Overall, the hybrid HA-Cu-Col nanocoating exhibited enhanced impedance behavior, suggesting improved barrier properties through higher charge transfer resistance, stable passive region formation (0.64-1.58 V), controlled ionic diffusion, and bio-inspired networking. Although initial open-circuit potential (OCP) fluctuations point to interfacial dynamics that warrant further long-term investigation, the coating remains a promising candidate for Ti implant applications in physiological environments.

Also flagged:airsaculitiskeratoconjunctivitisviral diseasesinfectionavian influenzaacidification
Journal Article 2026-07-01 No Snippets Moore PA.
Show Full Abstract

Treating poultry litter with alum is a best management practice (BMP) used to reduce ammonia (NH<sub>3</sub>) volatilization and phosphorus (P) runoff and leaching. However, recently we have observed that alum additions to litter have not always reduced soluble reactive phosphorus (SRP). The objectives of this research were (1) to determine why alum additions to litter occasionally fail to reduce SRP and (2) to determine if aluminum (Al), calcium (Ca), and/or iron (Fe) nanoparticles applied alone or in combination with dry acids used for NH<sub>3</sub> control (alum or sodium bisulfate) would reduce SRP in litter. Five lab studies were conducted. Results showed when litter had previously been treated with sodium bisulfate was treated with alum, it increased SRP, possibly due to the formation of sodium alunite. Applications of sodium bisulfate alone to poultry litter also increased SRP. While the addition of Al and Fe nanoparticles to litter had relatively little effect on SRP when applied alone or in combination with alum or sodium bisulfate, the addition of a calcium silicate based nanoparticle had a synergistic effect on reducing SRP when applied with alum or sodium bisulfate. When TPX was applied with sodium bisulfate at rates of 1.25%, 2.5%, and 5%, the SRP decreased from 3410 mg P kg<sup>-1</sup> to 1220, 541, and 233 mg P kg<sup>-1</sup> litter, respectively. However, TPX increased litter pH, which may negatively affect the efficacy of alum and poultry litter treatment on reducing NH<sub>3</sub> emissions, indicating more research is needed on this practice to determine if it is a cost-effective BMP for reducing P runoff.

MRPL39
Also flagged:cell cyclechromosomecell-cycleGene Expressionorganizationdosage compensation
Journal Article 2026-07-01 ✓ 1 Snippet Morikawa Y, Bromley A, Steimle JD, Martin JF.
In-Text Gene Mentions

…mb downstream ofMrpl39and 1.9 mb…

Show Full Abstract

The Fucci mouse lines are valuable tools for tracing cell cycle stages during development and in postnatal tissues; however, the insertion loci for the transgenes remain unidentified. Here, we report the genomic insertion sites of both the Fucci-G1 and -S/G2/M transgenes, identified through whole-genome sequencing. Interestingly, the Fucci-G1 transgene is located proximal to the Shh lung gut enhancer (SLGE) on chromosome 5. Homozygous Fucci-G1 embryos are perinatal lethal but survive until embryonic day (E)18.5, exhibiting craniofacial and foregut-related defects. Expression of Shh and canonical targets are downregulated in the pharyngeal arches of E11.5 homozygous Fucci-G1 embryos. Furthermore, in situ hybridization analysis showed diminished Shh expression in the pharyngeal and foregut endoderm, consistent with disruptions to SLGE activity. Our results indicate that heterozygous Fucci-G1 mice are suitable for cell cycle studies; however, we caution potential genetic interference when investigating SHH-related pathways.

Also flagged:infectious diseaseCOVID-19syphilis-19translational
Journal Article 2026-07-01 No Snippets Shin S, Kim NH, Lee HR, Yoon JH, Kim BJ, Park HW, Roh EY.
Show Full Abstract

Public cord blood (CB) banks face declining inventories worldwide, but the relative contributions of regulatory changes, declining birth rates, and infectious disease outbreaks remain unclear. We performed a retrospective analysis of 73 925 CB units submitted to a Korean public cord blood bank from 2006 to 2025, encompassing two regulatory transitions in total nucleated cell (TNC) criteria and three major outbreaks (H1N1, MERS, and COVID-19), using interrupted time series, correlation, and multivariable analyses. Of 73 925 submissions, 27 684 (37.4%) were banked. The 2011 TNC ≥ 8 × 108 criterion produced a moderate reduction in banking rate from 37.7% to 33.6%, while the 2021 TNC ≥ 11 × 108 revision caused an abrupt decline from 52.6% to 24.4%. H1N1 and MERS had minimal effects, whereas the COVID-19 period showed a sustained decline coinciding with the 2021 TNC revision. Birth decline correlated strongly with submissions (R2 = 0.94). Regulatory criteria changes were the primary driver of banking rate fluctuations, while declining births affected submission volume. Among three outbreaks, only the COVID-19 period overlapped with a sustained decline, likely reflecting concurrent regulatory change rather than the pandemic itself. CB quality and safety were maintained throughout all disruptions. These findings have direct translational implications for sustaining the global CB inventory as a critical source of hematopoietic stem cells for transplantation.

Also flagged:gene expressionmethylationlocalizationspliceosometranslationalpairing
Journal Article 2026-07-01 No Snippets Wu S, Schneggenburger K, Yu MC.
Show Full Abstract

Accurate removal of intervening intronic sequences from pre-mRNA is required for proper eukaryotic gene expression. This process, termed pre-mRNA splicing, is carried out by a spliceosome, a dynamic RNA-protein macromolecular machinery. Proteomic studies have shown that many spliceosomal components and associated factors harbor protein arginine methylation, a type of post-translational modification. These findings raise the question of how arginine methylation influences the process or outcome of pre-mRNA splicing. Although targeted studies have provided important molecular insights into how this modification regulates splicing protein subcellular localization, abundance, RNA/protein interactions, and snRNP biogenesis, much remains unknown, especially given the large number of methylated proteins identified that have known roles in regulating pre-mRNA splicing. In this review, we summarize current knowledge of how protein arginine methylation contributes to pre-mRNA splicing and discuss how this modification may help tune the structural and functional plasticity of the spliceosome.

HFE
Also flagged:Hepatitisautoimmune hepatitisWilson diseasehereditary hemochromatosisimmune-mediated liver diseaselymphoplasmacytic hepatitis
Journal Article 2026-07-01 ✓ 3 Snippets Darling JM.
In-Text Gene Mentions

…variant in theHFEgene with variable…

…Untreatedhemochromatosisleads to cirrhosis…

…Wilson disease orhemochromatosis.…

Show Full Abstract

Although metabolic, viral, and drug- and alcohol-related etiologies are a familiar part of the evaluation of elevated liver enzymes, less common causes include autoimmune hepatitis, Wilson disease, and hereditary hemochromatosis. Each has a progressive course to end-organ damage underscoring the importance of early recognition, as effective therapies are available. Autoimmune hepatitis is an immune-mediated liver disease, with a female predominance and autoantibodies present in about 80% of cases. It can progress rapidly without treatment. Liver biopsy featuring lymphoplasmacytic hepatitis is needed for diagnosis and to determine the intensity of immunosuppression. Wilson disease is caused by biallelic variants in the ATP7B gene resulting in copper accumulation in the liver, brain, kidneys, and corneas. Diagnosis relies on clinical findings, laboratory data, and genetic testing results. Lifelong chelation therapy is required. Hereditary hemochromatosis is characterized by iron overload, usually due to a common variant in the HFE gene with variable disease penetrance; it is prevalent in people of Northern European ancestry. Untreated hemochromatosis leads to cirrhosis and hepatocellular carcinoma. Early diagnosis and initiation of phlebotomy can result in normal life expectancy. To facilitate early diagnosis, genetic testing of first-degree relatives is recommended for those with Wilson disease or hemochromatosis.

PRDX6
Also flagged:angiogenesistranslationalBreast CancerTumorExtracellular Vesiclesextracellular
Journal Article 2026-07-01 ✓ 1 Snippet Alkaabi A, Nasrallah D, Giordo R, Nasrallah GK, Zayed H, Pintus G.
In-Text Gene Mentions

…MYL6, GSTP1, TTYH3,PRDX6, MUC1, MYH14, and…

Show Full Abstract

Tumor-derived extracellular vesicles (EVs) are major mediators of oncogenic intercellular communication. However, many studies using conditioned media (CM) recover operationally defined EV- or small EV-enriched fractions rather than biogenesis-proven exosomes. This review synthesizes evidence from CM-derived tumor EV studies and aligns their biological interpretation with current EV nomenclature, characterization, and reporting principles. We first discuss exosome biogenesis as a defined endosomal pathway and then examine how CM collection, serum handling, culture format, oxygen tension, conditioning interval, isolation strategy, storage, and co-isolated material shape EV yield, cargo composition, and apparent biological activity. Mechanistically, CM-based studies have clarified how tumor-derived EV-enriched preparations can support pre-metastatic niche formation, immune evasion through PD-L1 and regulatory RNA cargo, stromal and endothelial remodeling, angiogenesis, and therapy resistance. We also evaluate EV-associated miRNA and protein biomarkers as candidate liquid-biopsy analytes, emphasizing that their diagnostic value remains assay-, cohort-, and workflow-dependent. Therapeutically, the review distinguishes mechanisms inferred from CM-derived tumor EV studies from engineered EV platforms for drug, RNA, cytokine, vaccine, or immune-agonist delivery. Across these areas, we emphasize that robust EV-specific biological interpretations require complementary and methodologically independent characterization, purity and co-isolate assessment, EV-depleted CM, add-back or rescue designs, cargo perturbation, enzymatic controls where appropriate, and dose-normalized functional assays. Advances in microfluidics, immunoaffinity capture, single-vesicle analysis, and multi-omics profiling are improving resolution, but translation will depend on standardized workflows, product- or biomarker-specific validation, scalability, potency metrics, safety, regulatory-grade quality control, and more explicit integration with in vivo and clinically annotated datasets. This article is categorized under: Nanotechnology Approaches to Biology > Nanoscale Systems in Biology Diagnostic Tools > Diagnostic Nanodevices Therapeutic Approaches and Drug Discovery > Nanomedicine for Oncologic Disease.

Research Square 2026-07-01 Preprint (No Snippets API) Lu Z, Ozyurt R, Bildik G, Mao W, Yang H, Bast R.
Show Full Abstract

<title>Abstract</title> <p>Cancer cells depend on protein quality control pathways to survive intrinsic and microenvironmental stress. Endoplasmic reticulum (ER)-selective autophagy (ER-phagy) maintains ER homeostasis by eliminating damaged ER and misfolded protein aggregates during ER stress. How ER stress-induced ER-phagy is regulated in cancer remains poorly understood. Salt-inducible kinases SIK2 and SIK3 (SIK2/3) are serine/threonine kinases implicated in metabolic regulation and cancer cell survival, but their roles in ER stress signaling and ER-phagy have not previously been studied. Here, we show that genetic or pharmacologic inhibition of SIK2/3 induces proteotoxic stress and activates the unfolded protein response through the PERK and IRE1 pathways, with predominant engagement of PERK and its downstream effector ATF4. SIK2/3 inhibition promotes ER-phagy by upregulating the ER-phagy receptor CCPG1 in an ATF4-dependent manner and increasing autophagic flux, thereby enabling cancer cell survival under stress. Disruption of this adaptive response results in the accumulation of polyubiquitinated protein aggregates, induction of CHOP, and apoptotic cell death in ovarian cancer cells. Importantly, combined treatment with the dual SIK2/3 inhibitor GRN-300 and the autophagy inhibitor chloroquine synergistically enhanced proteotoxic stress, reduced cell viability (combination index < 0.9), and triggered CHOP-dependent apoptosis. In ovarian cancer xenograft models, GRN-300 plus chloroquine markedly suppressed tumor growth and significantly prolonged survival compared with either monotherapy. Together, these findings identify SIK2/3 as key regulators of ER stress-induced ER-phagy and reveal a targetable stress-adaptation pathway that can be exploited therapeutically in ovarian cancer.</p>

bioRxiv 2026-07-01 Preprint (No Snippets API) Ichikawa Y.
Show Full Abstract

Linkage disequilibrium between two biallelic loci is usually summarized by scalar association measures such as r 2 and D ′ . These measures quantify how visible an allelic association is to a symmetric LD scan, but they do not directly represent the topology of carrier sets: whether the carriers of one variant are contained within, partially overlap with, or are disjoint from the carriers of the other. This distinction is structural. On the haplotype-frequency simplex, carrier-set inclusion corresponds to a boundary face where one haplotype class is absent. In the rare–common regime, a nested rare variant is further constrained by the ceiling r 2 ≤ p A / p B , so that complete carrier-set inclusion can remain nearly invisible to r 2 . Here, as a companion to the Fisher-geometry preprint 1 , we examine the empirical and dynamic behavior of this carrier-set topology. In 1000 Genomes Phase 3, across 156,604,320 SNP pairs from the MHC and NEGR1 regions, pairs on the ∣ D ′ ∣= 1 boundary span a wide range of r 2 and ∣ C ∣. Within fixed r 2 strata, r 2 poorly distinguishes nested from non-nested carrier-set configurations, with AUROC values of approximately 0.54–0.62, whereas the boundary-sensitive normalization ∣ D ′ ∣ separates them much more effectively, with AUROC values of approximately 0.90–0.92. The empirical data also obey the predicted r 2 ≤ p A / p B ceiling. We then introduce a temporal axis using a two-locus Wright–Fisher model on the same simplex. Carrier-set topology evolves through three motions relative to the ∣ D ′ ∣= 1 boundary: formation or persistence, in which recombination suppression establishes and maintains inclusion without requiring selection; visibility change, in which selection or drift moves r 2 along the boundary while preserving the inclusion relation; and breaking, in which a recombination pulse introduces the previously absent haplotype and dissolves inclusion. A fourth mode, specificity erosion, expands the partner carrier set while preserving inclusion, thereby lowering P ( A ∣ B ) while keeping P ( B ∣ A ) and ∣ D ′ ∣ equal to one. This mode shows that asymmetric conditional probabilities are best understood as diagnostic coordinates for carrier-set topology, not as the primary object itself. Together, these results show that topology and visibility are separable axes of LD structure. Conventional r 2 -based scans and carrier-set topology scans therefore answer complementary, not interchangeable, questions.